[med-svn] [andi] 01/02: Imported Upstream version 0.9.4
Fabian Klötzl
kloetzl-guest at moszumanska.debian.org
Mon Oct 5 12:52:46 UTC 2015
This is an automated email from the git hooks/post-receive script.
kloetzl-guest pushed a commit to branch master
in repository andi.
commit 85bea24c7e9a47b5bdec6f53e87b1db2e35c3fae
Author: Fabian Klötzl <fabian at kloetzl.info>
Date: Mon Oct 5 10:23:44 2015 +0200
Imported Upstream version 0.9.4
---
COPYING | 674 ++++
ChangeLog | 3583 ++++++++++++++++++
INSTALL | 370 ++
Makefile.am | 43 +
Makefile.in | 1208 ++++++
README | 66 +
README.md | 66 +
aclocal.m4 | 1370 +++++++
andi-manual.pdf | Bin 0 -> 420249 bytes
ar-lib | 270 ++
compile | 347 ++
configure | 7968 ++++++++++++++++++++++++++++++++++++++++
configure.ac | 110 +
depcomp | 791 ++++
docs/Doxyfile | 1781 +++++++++
docs/Makefile.am | 22 +
docs/Makefile.in | 505 +++
docs/andi.1 | 56 +
docs/andi.1.in | 56 +
install-sh | 527 +++
libs/Makefile.am | 5 +
libs/Makefile.in | 549 +++
libs/pfasta.c | 439 +++
libs/pfasta.h | 39 +
m4/ax_cxx_compile_stdcxx_11.m4 | 162 +
missing | 215 ++
opt/Makefile.am | 10 +
opt/Makefile.in | 536 +++
opt/compat-stdlib.h | 3 +
opt/compat-string.h | 3 +
opt/psufsort/Makefile.am | 4 +
opt/psufsort/Makefile.in | 577 +++
opt/psufsort/c_interface.cxx | 15 +
opt/psufsort/interface.h | 17 +
opt/psufsort/psufsort.cxx | 336 ++
opt/reallocarray.c | 34 +
opt/strchrnul.c | 8 +
src/Makefile.am | 23 +
src/Makefile.in | 724 ++++
src/andi.c | 271 ++
src/config.hin | 146 +
src/dist_hack.h | 75 +
src/esa.c | 668 ++++
src/esa.h | 81 +
src/global.h | 48 +
src/io.c | 184 +
src/io.h | 36 +
src/process.c | 366 ++
src/process.h | 15 +
src/sequence.c | 313 ++
src/sequence.h | 60 +
test-driver | 139 +
test/Makefile.am | 25 +
test/Makefile.in | 686 ++++
test/test_esa.c | 200 +
test/test_extra.sh | 16 +
test/test_fasta.cxx | 106 +
test/test_join.sh | 75 +
test/test_random.sh | 25 +
test/test_seq.c | 79 +
60 files changed, 27126 insertions(+)
diff --git a/COPYING b/COPYING
new file mode 100644
index 0000000..94a9ed0
--- /dev/null
+++ b/COPYING
@@ -0,0 +1,674 @@
+ GNU GENERAL PUBLIC LICENSE
+ Version 3, 29 June 2007
+
+ Copyright (C) 2007 Free Software Foundation, Inc. <http://fsf.org/>
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+ Preamble
+
+ The GNU General Public License is a free, copyleft license for
+software and other kinds of works.
+
+ The licenses for most software and other practical works are designed
+to take away your freedom to share and change the works. By contrast,
+the GNU General Public License is intended to guarantee your freedom to
+share and change all versions of a program--to make sure it remains free
+software for all its users. We, the Free Software Foundation, use the
+GNU General Public License for most of our software; it applies also to
+any other work released this way by its authors. You can apply it to
+your programs, too.
+
+ When we speak of free software, we are referring to freedom, not
+price. Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+them if you wish), that you receive source code or can get it if you
+want it, that you can change the software or use pieces of it in new
+free programs, and that you know you can do these things.
+
+ To protect your rights, we need to prevent others from denying you
+these rights or asking you to surrender the rights. Therefore, you have
+certain responsibilities if you distribute copies of the software, or if
+you modify it: responsibilities to respect the freedom of others.
+
+ For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must pass on to the recipients the same
+freedoms that you received. You must make sure that they, too, receive
+or can get the source code. And you must show them these terms so they
+know their rights.
+
+ Developers that use the GNU GPL protect your rights with two steps:
+(1) assert copyright on the software, and (2) offer you this License
+giving you legal permission to copy, distribute and/or modify it.
+
+ For the developers' and authors' protection, the GPL clearly explains
+that there is no warranty for this free software. For both users' and
+authors' sake, the GPL requires that modified versions be marked as
+changed, so that their problems will not be attributed erroneously to
+authors of previous versions.
+
+ Some devices are designed to deny users access to install or run
+modified versions of the software inside them, although the manufacturer
+can do so. This is fundamentally incompatible with the aim of
+protecting users' freedom to change the software. The systematic
+pattern of such abuse occurs in the area of products for individuals to
+use, which is precisely where it is most unacceptable. Therefore, we
+have designed this version of the GPL to prohibit the practice for those
+products. If such problems arise substantially in other domains, we
+stand ready to extend this provision to those domains in future versions
+of the GPL, as needed to protect the freedom of users.
+
+ Finally, every program is threatened constantly by software patents.
+States should not allow patents to restrict development and use of
+software on general-purpose computers, but in those that do, we wish to
+avoid the special danger that patents applied to a free program could
+make it effectively proprietary. To prevent this, the GPL assures that
+patents cannot be used to render the program non-free.
+
+ The precise terms and conditions for copying, distribution and
+modification follow.
+
+ TERMS AND CONDITIONS
+
+ 0. Definitions.
+
+ "This License" refers to version 3 of the GNU General Public License.
+
+ "Copyright" also means copyright-like laws that apply to other kinds of
+works, such as semiconductor masks.
+
+ "The Program" refers to any copyrightable work licensed under this
+License. Each licensee is addressed as "you". "Licensees" and
+"recipients" may be individuals or organizations.
+
+ To "modify" a work means to copy from or adapt all or part of the work
+in a fashion requiring copyright permission, other than the making of an
+exact copy. The resulting work is called a "modified version" of the
+earlier work or a work "based on" the earlier work.
+
+ A "covered work" means either the unmodified Program or a work based
+on the Program.
+
+ To "propagate" a work means to do anything with it that, without
+permission, would make you directly or secondarily liable for
+infringement under applicable copyright law, except executing it on a
+computer or modifying a private copy. Propagation includes copying,
+distribution (with or without modification), making available to the
+public, and in some countries other activities as well.
+
+ To "convey" a work means any kind of propagation that enables other
+parties to make or receive copies. Mere interaction with a user through
+a computer network, with no transfer of a copy, is not conveying.
+
+ An interactive user interface displays "Appropriate Legal Notices"
+to the extent that it includes a convenient and prominently visible
+feature that (1) displays an appropriate copyright notice, and (2)
+tells the user that there is no warranty for the work (except to the
+extent that warranties are provided), that licensees may convey the
+work under this License, and how to view a copy of this License. If
+the interface presents a list of user commands or options, such as a
+menu, a prominent item in the list meets this criterion.
+
+ 1. Source Code.
+
+ The "source code" for a work means the preferred form of the work
+for making modifications to it. "Object code" means any non-source
+form of a work.
+
+ A "Standard Interface" means an interface that either is an official
+standard defined by a recognized standards body, or, in the case of
+interfaces specified for a particular programming language, one that
+is widely used among developers working in that language.
+
+ The "System Libraries" of an executable work include anything, other
+than the work as a whole, that (a) is included in the normal form of
+packaging a Major Component, but which is not part of that Major
+Component, and (b) serves only to enable use of the work with that
+Major Component, or to implement a Standard Interface for which an
+implementation is available to the public in source code form. A
+"Major Component", in this context, means a major essential component
+(kernel, window system, and so on) of the specific operating system
+(if any) on which the executable work runs, or a compiler used to
+produce the work, or an object code interpreter used to run it.
+
+ The "Corresponding Source" for a work in object code form means all
+the source code needed to generate, install, and (for an executable
+work) run the object code and to modify the work, including scripts to
+control those activities. However, it does not include the work's
+System Libraries, or general-purpose tools or generally available free
+programs which are used unmodified in performing those activities but
+which are not part of the work. For example, Corresponding Source
+includes interface definition files associated with source files for
+the work, and the source code for shared libraries and dynamically
+linked subprograms that the work is specifically designed to require,
+such as by intimate data communication or control flow between those
+subprograms and other parts of the work.
+
+ The Corresponding Source need not include anything that users
+can regenerate automatically from other parts of the Corresponding
+Source.
+
+ The Corresponding Source for a work in source code form is that
+same work.
+
+ 2. Basic Permissions.
+
+ All rights granted under this License are granted for the term of
+copyright on the Program, and are irrevocable provided the stated
+conditions are met. This License explicitly affirms your unlimited
+permission to run the unmodified Program. The output from running a
+covered work is covered by this License only if the output, given its
+content, constitutes a covered work. This License acknowledges your
+rights of fair use or other equivalent, as provided by copyright law.
+
+ You may make, run and propagate covered works that you do not
+convey, without conditions so long as your license otherwise remains
+in force. You may convey covered works to others for the sole purpose
+of having them make modifications exclusively for you, or provide you
+with facilities for running those works, provided that you comply with
+the terms of this License in conveying all material for which you do
+not control copyright. Those thus making or running the covered works
+for you must do so exclusively on your behalf, under your direction
+and control, on terms that prohibit them from making any copies of
+your copyrighted material outside their relationship with you.
+
+ Conveying under any other circumstances is permitted solely under
+the conditions stated below. Sublicensing is not allowed; section 10
+makes it unnecessary.
+
+ 3. Protecting Users' Legal Rights From Anti-Circumvention Law.
+
+ No covered work shall be deemed part of an effective technological
+measure under any applicable law fulfilling obligations under article
+11 of the WIPO copyright treaty adopted on 20 December 1996, or
+similar laws prohibiting or restricting circumvention of such
+measures.
+
+ When you convey a covered work, you waive any legal power to forbid
+circumvention of technological measures to the extent such circumvention
+is effected by exercising rights under this License with respect to
+the covered work, and you disclaim any intention to limit operation or
+modification of the work as a means of enforcing, against the work's
+users, your or third parties' legal rights to forbid circumvention of
+technological measures.
+
+ 4. Conveying Verbatim Copies.
+
+ You may convey verbatim copies of the Program's source code as you
+receive it, in any medium, provided that you conspicuously and
+appropriately publish on each copy an appropriate copyright notice;
+keep intact all notices stating that this License and any
+non-permissive terms added in accord with section 7 apply to the code;
+keep intact all notices of the absence of any warranty; and give all
+recipients a copy of this License along with the Program.
+
+ You may charge any price or no price for each copy that you convey,
+and you may offer support or warranty protection for a fee.
+
+ 5. Conveying Modified Source Versions.
+
+ You may convey a work based on the Program, or the modifications to
+produce it from the Program, in the form of source code under the
+terms of section 4, provided that you also meet all of these conditions:
+
+ a) The work must carry prominent notices stating that you modified
+ it, and giving a relevant date.
+
+ b) The work must carry prominent notices stating that it is
+ released under this License and any conditions added under section
+ 7. This requirement modifies the requirement in section 4 to
+ "keep intact all notices".
+
+ c) You must license the entire work, as a whole, under this
+ License to anyone who comes into possession of a copy. This
+ License will therefore apply, along with any applicable section 7
+ additional terms, to the whole of the work, and all its parts,
+ regardless of how they are packaged. This License gives no
+ permission to license the work in any other way, but it does not
+ invalidate such permission if you have separately received it.
+
+ d) If the work has interactive user interfaces, each must display
+ Appropriate Legal Notices; however, if the Program has interactive
+ interfaces that do not display Appropriate Legal Notices, your
+ work need not make them do so.
+
+ A compilation of a covered work with other separate and independent
+works, which are not by their nature extensions of the covered work,
+and which are not combined with it such as to form a larger program,
+in or on a volume of a storage or distribution medium, is called an
+"aggregate" if the compilation and its resulting copyright are not
+used to limit the access or legal rights of the compilation's users
+beyond what the individual works permit. Inclusion of a covered work
+in an aggregate does not cause this License to apply to the other
+parts of the aggregate.
+
+ 6. Conveying Non-Source Forms.
+
+ You may convey a covered work in object code form under the terms
+of sections 4 and 5, provided that you also convey the
+machine-readable Corresponding Source under the terms of this License,
+in one of these ways:
+
+ a) Convey the object code in, or embodied in, a physical product
+ (including a physical distribution medium), accompanied by the
+ Corresponding Source fixed on a durable physical medium
+ customarily used for software interchange.
+
+ b) Convey the object code in, or embodied in, a physical product
+ (including a physical distribution medium), accompanied by a
+ written offer, valid for at least three years and valid for as
+ long as you offer spare parts or customer support for that product
+ model, to give anyone who possesses the object code either (1) a
+ copy of the Corresponding Source for all the software in the
+ product that is covered by this License, on a durable physical
+ medium customarily used for software interchange, for a price no
+ more than your reasonable cost of physically performing this
+ conveying of source, or (2) access to copy the
+ Corresponding Source from a network server at no charge.
+
+ c) Convey individual copies of the object code with a copy of the
+ written offer to provide the Corresponding Source. This
+ alternative is allowed only occasionally and noncommercially, and
+ only if you received the object code with such an offer, in accord
+ with subsection 6b.
+
+ d) Convey the object code by offering access from a designated
+ place (gratis or for a charge), and offer equivalent access to the
+ Corresponding Source in the same way through the same place at no
+ further charge. You need not require recipients to copy the
+ Corresponding Source along with the object code. If the place to
+ copy the object code is a network server, the Corresponding Source
+ may be on a different server (operated by you or a third party)
+ that supports equivalent copying facilities, provided you maintain
+ clear directions next to the object code saying where to find the
+ Corresponding Source. Regardless of what server hosts the
+ Corresponding Source, you remain obligated to ensure that it is
+ available for as long as needed to satisfy these requirements.
+
+ e) Convey the object code using peer-to-peer transmission, provided
+ you inform other peers where the object code and Corresponding
+ Source of the work are being offered to the general public at no
+ charge under subsection 6d.
+
+ A separable portion of the object code, whose source code is excluded
+from the Corresponding Source as a System Library, need not be
+included in conveying the object code work.
+
+ A "User Product" is either (1) a "consumer product", which means any
+tangible personal property which is normally used for personal, family,
+or household purposes, or (2) anything designed or sold for incorporation
+into a dwelling. In determining whether a product is a consumer product,
+doubtful cases shall be resolved in favor of coverage. For a particular
+product received by a particular user, "normally used" refers to a
+typical or common use of that class of product, regardless of the status
+of the particular user or of the way in which the particular user
+actually uses, or expects or is expected to use, the product. A product
+is a consumer product regardless of whether the product has substantial
+commercial, industrial or non-consumer uses, unless such uses represent
+the only significant mode of use of the product.
+
+ "Installation Information" for a User Product means any methods,
+procedures, authorization keys, or other information required to install
+and execute modified versions of a covered work in that User Product from
+a modified version of its Corresponding Source. The information must
+suffice to ensure that the continued functioning of the modified object
+code is in no case prevented or interfered with solely because
+modification has been made.
+
+ If you convey an object code work under this section in, or with, or
+specifically for use in, a User Product, and the conveying occurs as
+part of a transaction in which the right of possession and use of the
+User Product is transferred to the recipient in perpetuity or for a
+fixed term (regardless of how the transaction is characterized), the
+Corresponding Source conveyed under this section must be accompanied
+by the Installation Information. But this requirement does not apply
+if neither you nor any third party retains the ability to install
+modified object code on the User Product (for example, the work has
+been installed in ROM).
+
+ The requirement to provide Installation Information does not include a
+requirement to continue to provide support service, warranty, or updates
+for a work that has been modified or installed by the recipient, or for
+the User Product in which it has been modified or installed. Access to a
+network may be denied when the modification itself materially and
+adversely affects the operation of the network or violates the rules and
+protocols for communication across the network.
+
+ Corresponding Source conveyed, and Installation Information provided,
+in accord with this section must be in a format that is publicly
+documented (and with an implementation available to the public in
+source code form), and must require no special password or key for
+unpacking, reading or copying.
+
+ 7. Additional Terms.
+
+ "Additional permissions" are terms that supplement the terms of this
+License by making exceptions from one or more of its conditions.
+Additional permissions that are applicable to the entire Program shall
+be treated as though they were included in this License, to the extent
+that they are valid under applicable law. If additional permissions
+apply only to part of the Program, that part may be used separately
+under those permissions, but the entire Program remains governed by
+this License without regard to the additional permissions.
+
+ When you convey a copy of a covered work, you may at your option
+remove any additional permissions from that copy, or from any part of
+it. (Additional permissions may be written to require their own
+removal in certain cases when you modify the work.) You may place
+additional permissions on material, added by you to a covered work,
+for which you have or can give appropriate copyright permission.
+
+ Notwithstanding any other provision of this License, for material you
+add to a covered work, you may (if authorized by the copyright holders of
+that material) supplement the terms of this License with terms:
+
+ a) Disclaiming warranty or limiting liability differently from the
+ terms of sections 15 and 16 of this License; or
+
+ b) Requiring preservation of specified reasonable legal notices or
+ author attributions in that material or in the Appropriate Legal
+ Notices displayed by works containing it; or
+
+ c) Prohibiting misrepresentation of the origin of that material, or
+ requiring that modified versions of such material be marked in
+ reasonable ways as different from the original version; or
+
+ d) Limiting the use for publicity purposes of names of licensors or
+ authors of the material; or
+
+ e) Declining to grant rights under trademark law for use of some
+ trade names, trademarks, or service marks; or
+
+ f) Requiring indemnification of licensors and authors of that
+ material by anyone who conveys the material (or modified versions of
+ it) with contractual assumptions of liability to the recipient, for
+ any liability that these contractual assumptions directly impose on
+ those licensors and authors.
+
+ All other non-permissive additional terms are considered "further
+restrictions" within the meaning of section 10. If the Program as you
+received it, or any part of it, contains a notice stating that it is
+governed by this License along with a term that is a further
+restriction, you may remove that term. If a license document contains
+a further restriction but permits relicensing or conveying under this
+License, you may add to a covered work material governed by the terms
+of that license document, provided that the further restriction does
+not survive such relicensing or conveying.
+
+ If you add terms to a covered work in accord with this section, you
+must place, in the relevant source files, a statement of the
+additional terms that apply to those files, or a notice indicating
+where to find the applicable terms.
+
+ Additional terms, permissive or non-permissive, may be stated in the
+form of a separately written license, or stated as exceptions;
+the above requirements apply either way.
+
+ 8. Termination.
+
+ You may not propagate or modify a covered work except as expressly
+provided under this License. Any attempt otherwise to propagate or
+modify it is void, and will automatically terminate your rights under
+this License (including any patent licenses granted under the third
+paragraph of section 11).
+
+ However, if you cease all violation of this License, then your
+license from a particular copyright holder is reinstated (a)
+provisionally, unless and until the copyright holder explicitly and
+finally terminates your license, and (b) permanently, if the copyright
+holder fails to notify you of the violation by some reasonable means
+prior to 60 days after the cessation.
+
+ Moreover, your license from a particular copyright holder is
+reinstated permanently if the copyright holder notifies you of the
+violation by some reasonable means, this is the first time you have
+received notice of violation of this License (for any work) from that
+copyright holder, and you cure the violation prior to 30 days after
+your receipt of the notice.
+
+ Termination of your rights under this section does not terminate the
+licenses of parties who have received copies or rights from you under
+this License. If your rights have been terminated and not permanently
+reinstated, you do not qualify to receive new licenses for the same
+material under section 10.
+
+ 9. Acceptance Not Required for Having Copies.
+
+ You are not required to accept this License in order to receive or
+run a copy of the Program. Ancillary propagation of a covered work
+occurring solely as a consequence of using peer-to-peer transmission
+to receive a copy likewise does not require acceptance. However,
+nothing other than this License grants you permission to propagate or
+modify any covered work. These actions infringe copyright if you do
+not accept this License. Therefore, by modifying or propagating a
+covered work, you indicate your acceptance of this License to do so.
+
+ 10. Automatic Licensing of Downstream Recipients.
+
+ Each time you convey a covered work, the recipient automatically
+receives a license from the original licensors, to run, modify and
+propagate that work, subject to this License. You are not responsible
+for enforcing compliance by third parties with this License.
+
+ An "entity transaction" is a transaction transferring control of an
+organization, or substantially all assets of one, or subdividing an
+organization, or merging organizations. If propagation of a covered
+work results from an entity transaction, each party to that
+transaction who receives a copy of the work also receives whatever
+licenses to the work the party's predecessor in interest had or could
+give under the previous paragraph, plus a right to possession of the
+Corresponding Source of the work from the predecessor in interest, if
+the predecessor has it or can get it with reasonable efforts.
+
+ You may not impose any further restrictions on the exercise of the
+rights granted or affirmed under this License. For example, you may
+not impose a license fee, royalty, or other charge for exercise of
+rights granted under this License, and you may not initiate litigation
+(including a cross-claim or counterclaim in a lawsuit) alleging that
+any patent claim is infringed by making, using, selling, offering for
+sale, or importing the Program or any portion of it.
+
+ 11. Patents.
+
+ A "contributor" is a copyright holder who authorizes use under this
+License of the Program or a work on which the Program is based. The
+work thus licensed is called the contributor's "contributor version".
+
+ A contributor's "essential patent claims" are all patent claims
+owned or controlled by the contributor, whether already acquired or
+hereafter acquired, that would be infringed by some manner, permitted
+by this License, of making, using, or selling its contributor version,
+but do not include claims that would be infringed only as a
+consequence of further modification of the contributor version. For
+purposes of this definition, "control" includes the right to grant
+patent sublicenses in a manner consistent with the requirements of
+this License.
+
+ Each contributor grants you a non-exclusive, worldwide, royalty-free
+patent license under the contributor's essential patent claims, to
+make, use, sell, offer for sale, import and otherwise run, modify and
+propagate the contents of its contributor version.
+
+ In the following three paragraphs, a "patent license" is any express
+agreement or commitment, however denominated, not to enforce a patent
+(such as an express permission to practice a patent or covenant not to
+sue for patent infringement). To "grant" such a patent license to a
+party means to make such an agreement or commitment not to enforce a
+patent against the party.
+
+ If you convey a covered work, knowingly relying on a patent license,
+and the Corresponding Source of the work is not available for anyone
+to copy, free of charge and under the terms of this License, through a
+publicly available network server or other readily accessible means,
+then you must either (1) cause the Corresponding Source to be so
+available, or (2) arrange to deprive yourself of the benefit of the
+patent license for this particular work, or (3) arrange, in a manner
+consistent with the requirements of this License, to extend the patent
+license to downstream recipients. "Knowingly relying" means you have
+actual knowledge that, but for the patent license, your conveying the
+covered work in a country, or your recipient's use of the covered work
+in a country, would infringe one or more identifiable patents in that
+country that you have reason to believe are valid.
+
+ If, pursuant to or in connection with a single transaction or
+arrangement, you convey, or propagate by procuring conveyance of, a
+covered work, and grant a patent license to some of the parties
+receiving the covered work authorizing them to use, propagate, modify
+or convey a specific copy of the covered work, then the patent license
+you grant is automatically extended to all recipients of the covered
+work and works based on it.
+
+ A patent license is "discriminatory" if it does not include within
+the scope of its coverage, prohibits the exercise of, or is
+conditioned on the non-exercise of one or more of the rights that are
+specifically granted under this License. You may not convey a covered
+work if you are a party to an arrangement with a third party that is
+in the business of distributing software, under which you make payment
+to the third party based on the extent of your activity of conveying
+the work, and under which the third party grants, to any of the
+parties who would receive the covered work from you, a discriminatory
+patent license (a) in connection with copies of the covered work
+conveyed by you (or copies made from those copies), or (b) primarily
+for and in connection with specific products or compilations that
+contain the covered work, unless you entered into that arrangement,
+or that patent license was granted, prior to 28 March 2007.
+
+ Nothing in this License shall be construed as excluding or limiting
+any implied license or other defenses to infringement that may
+otherwise be available to you under applicable patent law.
+
+ 12. No Surrender of Others' Freedom.
+
+ If conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License. If you cannot convey a
+covered work so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you may
+not convey it at all. For example, if you agree to terms that obligate you
+to collect a royalty for further conveying from those to whom you convey
+the Program, the only way you could satisfy both those terms and this
+License would be to refrain entirely from conveying the Program.
+
+ 13. Use with the GNU Affero General Public License.
+
+ Notwithstanding any other provision of this License, you have
+permission to link or combine any covered work with a work licensed
+under version 3 of the GNU Affero General Public License into a single
+combined work, and to convey the resulting work. The terms of this
+License will continue to apply to the part which is the covered work,
+but the special requirements of the GNU Affero General Public License,
+section 13, concerning interaction through a network will apply to the
+combination as such.
+
+ 14. Revised Versions of this License.
+
+ The Free Software Foundation may publish revised and/or new versions of
+the GNU General Public License from time to time. Such new versions will
+be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+ Each version is given a distinguishing version number. If the
+Program specifies that a certain numbered version of the GNU General
+Public License "or any later version" applies to it, you have the
+option of following the terms and conditions either of that numbered
+version or of any later version published by the Free Software
+Foundation. If the Program does not specify a version number of the
+GNU General Public License, you may choose any version ever published
+by the Free Software Foundation.
+
+ If the Program specifies that a proxy can decide which future
+versions of the GNU General Public License can be used, that proxy's
+public statement of acceptance of a version permanently authorizes you
+to choose that version for the Program.
+
+ Later license versions may give you additional or different
+permissions. However, no additional obligations are imposed on any
+author or copyright holder as a result of your choosing to follow a
+later version.
+
+ 15. Disclaimer of Warranty.
+
+ THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
+APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
+HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY
+OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,
+THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM
+IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF
+ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
+
+ 16. Limitation of Liability.
+
+ IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS
+THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY
+GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE
+USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF
+DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
+PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),
+EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGES.
+
+ 17. Interpretation of Sections 15 and 16.
+
+ If the disclaimer of warranty and limitation of liability provided
+above cannot be given local legal effect according to their terms,
+reviewing courts shall apply local law that most closely approximates
+an absolute waiver of all civil liability in connection with the
+Program, unless a warranty or assumption of liability accompanies a
+copy of the Program in return for a fee.
+
+ END OF TERMS AND CONDITIONS
+
+ How to Apply These Terms to Your New Programs
+
+ If you develop a new program, and you want it to be of the greatest
+possible use to the public, the best way to achieve this is to make it
+free software which everyone can redistribute and change under these terms.
+
+ To do so, attach the following notices to the program. It is safest
+to attach them to the start of each source file to most effectively
+state the exclusion of warranty; and each file should have at least
+the "copyright" line and a pointer to where the full notice is found.
+
+ <one line to give the program's name and a brief idea of what it does.>
+ Copyright (C) <year> <name of author>
+
+ This program is free software: you can redistribute it and/or modify
+ it under the terms of the GNU General Public License as published by
+ the Free Software Foundation, either version 3 of the License, or
+ (at your option) any later version.
+
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU General Public License for more details.
+
+ You should have received a copy of the GNU General Public License
+ along with this program. If not, see <http://www.gnu.org/licenses/>.
+
+Also add information on how to contact you by electronic and paper mail.
+
+ If the program does terminal interaction, make it output a short
+notice like this when it starts in an interactive mode:
+
+ <program> Copyright (C) <year> <name of author>
+ This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
+ This is free software, and you are welcome to redistribute it
+ under certain conditions; type `show c' for details.
+
+The hypothetical commands `show w' and `show c' should show the appropriate
+parts of the General Public License. Of course, your program's commands
+might be different; for a GUI interface, you would use an "about box".
+
+ You should also get your employer (if you work as a programmer) or school,
+if any, to sign a "copyright disclaimer" for the program, if necessary.
+For more information on this, and how to apply and follow the GNU GPL, see
+<http://www.gnu.org/licenses/>.
+
+ The GNU General Public License does not permit incorporating your program
+into proprietary programs. If your program is a subroutine library, you
+may consider it more useful to permit linking proprietary applications with
+the library. If this is what you want to do, use the GNU Lesser General
+Public License instead of this License. But first, please read
+<http://www.gnu.org/philosophy/why-not-lgpl.html>.
diff --git a/ChangeLog b/ChangeLog
new file mode 100644
index 0000000..fc37a5c
--- /dev/null
+++ b/ChangeLog
@@ -0,0 +1,3583 @@
+commit 357a1f1
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-25
+
+ release v0.9.4
+
+commit 44d8361
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-19
+
+ delete temporary files
+
+commit eab44f8
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-19
+
+ test low-memory mode
+
+commit bb44d77
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-19
+
+ silence tests
+
+commit f0066b7
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-19
+
+ adds extra tests
+
+commit f621895
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-19
+
+ checks if andi can be executed
+
+commit a2e4bfc
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-19
+
+ fixes issue with more than three sequences
+
+commit 3136215
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-19
+
+ ignore weird config header
+
+commit f7fa17a
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-19
+
+ removes AC_FUNC_{M,RE}ALLOC checks
+
+commit 5db1332
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-19
+
+ adds manual to top directory
+
+commit 8b41ccd
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-19
+
+ changes manual paths
+
+commit a6a5a31
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-19
+
+ improves manual building
+
+commit 7b02992
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ Doxyfile is not a pdf
+
+commit 563683e
+Merge: 3c22106 0eaead6
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ Merge branch 'master' into manual
+
+ Conflicts:
+ Makefile.am
+ docs/manual/andi-manual.pdf
+
+commit 0eaead6
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ updates known issues
+
+commit cec0f13
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ uses reallocarray for arrays
+
+commit d9353a3
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ mention other licenses
+
+commit 60a3f4d
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ fix coverage
+
+commit dfc24d6
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ test dist and psufsort via travis CI
+
+commit 76708ef
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ list subdirs explicitly to avoid dist errors
+
+commit 3665e3b
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ adds interface.h to source files
+
+commit d236756
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ improves makefiles
+
+commit cb1281e
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ improves build system
+
+commit 7f8f3fa
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ the tests require a working andi
+
+commit c77aa39
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ fixes andi build
+
+commit 6a1eaef
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ adds files for compat lib
+
+commit 37fbf22
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ removes config.hin from version control
+
+commit 8f59a90
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-18
+
+ adds compatibility library
+
+commit f3f51a9
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-17
+
+ adds configure checks
+
+commit 9bd8c3f
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-09-17
+
+ replaces kseq with pfasta
+
+ Switched to pfasta, the pedantic FASTA parsing library. See
+ https://github.com/kloetzl/pfasta for details.
+
+commit 3c22106
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-07-31
+
+ fix versioning in manual
+
+commit 47c3c95
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-07-31
+
+ fixes typo
+
+commit a7f3dd3
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-07-31
+
+ adds version number into manual
+
+commit 354defb
+Merge: 4adb3df 79d8155
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-07-31
+
+ Merge branch 'master' into manual
+
+commit 79d8155
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-07-31
+
+ bumps version number
+
+commit c43d478
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-07-31
+
+ release v0.9.3
+
+commit c8b3c7f
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-07-03
+
+ improves asymmetric distance handling
+
+ The anchor distance is not symmetric. i.e. d(i,j) != d(j,i). Thus
+ we computed both distances and average the result. Now, when computing
+ the average, the individual distances are weighted by the coverage.
+
+commit 4c60dfd
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-07-03
+
+ improves distance matrix handling
+
+commit 1df25aa
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-06-26
+
+ improves man page
+
+commit f4f44dd
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-06-26
+
+ improve synopsis
+
+commit 4adb3df
+Merge: 0b0a06b 80516e8
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-06-26
+
+ Merge branch 'master' into manual
+
+commit 80516e8
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-06-26
+
+ test for relative error
+
+commit 686376d
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-06-26
+
+ count long anchors as homologous
+
+ Sometimes a single long anchor spans a whole contig. Then no second anchors,
+ neither left nor right, can be found. In this case, count the long anchor
+ as homologous if its length is double the threshold.
+
+commit 2d7df3c
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-06-25
+
+ use proper NAN
+
+commit 0b0a06b
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-06-16
+
+ adds comments
+
+commit 005b7bf
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-06-16
+
+ copy manual to the top dir
+
+commit b144e6e
+Merge: 14b4cf0 0b90106
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-09
+
+ Merge branch 'esa_opt'
+
+commit 14b4cf0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-09
+
+ bumps version number
+
+commit efe4a9d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-09
+
+ release v0.9.2
+
+commit 0b90106
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-04
+
+ Revert "merges FVC and LCP"
+
+ This reverts commit 632b069da544f9f54f96985ba03b627e20c0c2c2, because that
+ commit imposes a maximum LCP limit at 2^24. This could be problematic for
+ big mammalian genomes. Also the runtime improvement of this feature was
+ smaller than expected.
+
+ Conflicts:
+ src/esa.c
+
+commit 18156ac
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-04
+
+ adds constness
+
+commit 6667295
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-04
+
+ adds fallback for strchrnul
+
+ Apparently, `strchrnul(3)` is a GNU specific function and unavailable on
+ BSD and Darwin (OS X). Thus we have to check for its existance and
+ provide a fallback function. Thanks to Marc Garcia-Garcera for pointing
+ this out.
+
+commit 0ee3413
+Merge: a66c812 707fd3f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-02
+
+ Merge branch 'master' into esa_opt
+
+ Conflicts:
+ src/esa.c
+
+commit 707fd3f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-02
+
+ bumps version number
+
+commit ce94f7b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-02
+
+ release v0.9.1
+
+commit db86b56
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-02
+
+ Adds reference to blog post by @katholt to manual
+
+commit 9b5308d
+Merge: 26fe4a9 a72c573
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-02
+
+ Merge branch 'master' of github.com:EvolBioInf/andi
+
+commit 26fe4a9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-06-02
+
+ solves issue where the manual would be overwritten
+
+commit a72c573
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-06-01
+
+ display proper error during configuration when libdivsufsort is missing.
+
+ fixes issue #3.
+
+commit 65b175d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-05-13
+
+ ignore failing build with missing pdflatex
+
+commit 1857a7b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-05-13
+
+ adds coverage badge
+
+commit 01906aa
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-05-08
+
+ improves code-docs
+
+commit a66c812
+Merge: ced0c8d 74b5be9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-05-08
+
+ Merge branch 'master' into esa_opt
+
+commit 74b5be9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-05-08
+
+ improves readme
+
+ - minor changes
+ - adds dependency section as suggested by crashfrog in issue #2
+
+commit b803e4e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-05-08
+
+ only build the manual when pdflatex is present
+
+commit 360451e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-05-08
+
+ improves readme
+
+commit 2ce6e0d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-30
+
+ adds long form --threads argument
+
+commit e077cfb
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-30
+
+ improves andi version string
+
+commit 3fde435
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-30
+
+ improves readme
+
+commit 41fe18a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-30
+
+ fixes andi reference
+
+commit 7178096
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-30
+
+ ignores more files
+
+commit b1189e2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-30
+
+ adds bibliography
+
+commit 8c84d23
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-30
+
+ simplifies manual
+
+ Delete the chapter copied from my thesis. If anyone is really interested in that, they should simply read the thesis.
+
+commit f8fb5a4
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-28
+
+ ingore tex build files
+
+commit ea0fe1b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-28
+
+ Adds Manual
+
+ This commit adds the user manual for andi. It is written in LaTeX
+ and thus compiles to PDF. Some images, which are not generated via
+ LaTeX them selves, are given as .pdf. Further more .tex and .data
+ files are given for advanced plots.
+
+ Even though, one should not include generated files into source
+ control, I include andi-manual.pdf. This way, I can link to it online.
+ Also, a the user might not have LaTeX or the neccessary packages, to
+ build the manual. Thus, the final result, but not intermediate steps,
+ are committed.
+
+commit ced0c8d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-16
+
+ check for too long input sequences
+
+commit ff99ceb
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-15
+
+ more pass by value
+
+commit 14a500f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-15
+
+ pass intervals by value
+
+commit 3bb40ba
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-15
+
+ Revert "ensure matches are increasing"
+
+ Sorry, for being stupid.
+
+ This reverts commit 596771cb77ec197e04e9c91fc90f530f9c976ad3.
+
+commit 596771c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-15
+
+ ensure matches are increasing
+
+commit d0e6d93
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-15
+
+ adds address sanitizer make target
+
+commit fdd3b4e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-15
+
+ improves esa unit tests
+
+commit 67615be
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-15
+
+ removes legacy typedef
+
+commit 3d9b402
+Merge: 420bf0a 8940c9d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-14
+
+ Merge branch 'master' into esa_opt
+
+commit 8940c9d
+Merge: 7980acf ddd3996
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-14
+
+ Merge branch 'master' of github.com:EvolBioInf/andi
+
+commit ddd3996
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-14
+
+ adds contact details to readme
+
+commit 7980acf
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-14
+
+ improves unit tests
+
+commit c9c7b6b
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-12
+
+ improves readme
+
+commit 420bf0a
+Merge: 5403ae9 c0df08d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-10
+
+ Merge branch 'master' into esa_opt
+
+commit c0df08d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-10
+
+ use a single thread for the unit tests
+
+commit 1279915
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-10
+
+ warn about -t in single threaded builds
+
+commit 5403ae9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-10
+
+ improves locality
+
+commit b69b074
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-10
+
+ avoids needless recomparison
+
+commit d6fcbcc
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-10
+
+ improves constness
+
+commit 089bfdb
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-10
+
+ null freed pointers
+
+commit 422b66c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-10
+
+ check for LCP overflow
+
+commit 632b069
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-09
+
+ merges FVC and LCP
+
+commit 4c225da
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-09
+
+ reduces memory usage
+
+commit d1b0438
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-09
+
+ renames esa_t to esa_s
+
+commit 4a91d27
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-09
+
+ updates help
+
+commit 8a140e0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-09
+
+ fixes bug introduced in 72b59da6
+
+commit d5b8dc7
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-09
+
+ limits number of threads for travis builds
+
+commit 72b59da
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-09
+
+ simplifies code
+
+commit 526b891
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-09
+
+ just testing
+
+commit 7801887
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-09
+
+ changes C standard to C99
+
+commit 4a842e0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-07
+
+ bumps version number
+
+commit 542b490
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-07
+
+ release v0.9
+
+ This is version 0.9 of the `andi` tool for efficient estimation of evolutionary distances. It is faster and uses less memory than the last version. It also features a new suffix array construction algorithm: psufsort. That one can be activated via:
+
+ ./configure --without-libdivsufsort
+
+ Also, a lot of the code has been refactored to plain C. This reduces the dependencies and makes the code easier to maintain.
+
+commit 61d1379
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-07
+
+ fixes distribution issues
+
+commit 3c5fc09
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-07
+
+ fixes false flag
+
+commit 18580fb
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-07
+
+ improves man page
+
+commit a7abb0f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-07
+
+ fixes readme
+
+commit 7aef3f6
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-04-07
+
+ use all processors by default
+
+commit e18b71a
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-04
+
+ adds newline
+
+commit edea232
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-04
+
+ fixes printf formatting for size_t
+
+commit b20d875
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-04
+
+ more simplifications
+
+commit 0fdb6d9
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-04
+
+ simplifies some code
+
+commit e924757
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-04
+
+ removes debug information
+
+commit 4b7a139
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-04
+
+ fixes use after free
+
+commit 90b17a0
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-04
+
+ further improves join test case
+
+commit 0ec5de9
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-03
+
+ improves join test case
+
+commit 82a4e5b
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-03
+
+ streamline more code
+
+commit 569924e
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-03
+
+ adds static scoping
+
+commit 8d4e8dd
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-03
+
+ improves code
+
+commit e6922b8
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-03
+
+ more simplifications
+
+commit 67df1fc
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-03
+
+ Simplifies code
+
+commit c117cf6
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ Revert "fixes tests"
+
+ This reverts commit f9bb1730fc27670210a4c2fc4febc2ab07d64186.
+ Removes now useless tests.
+
+commit 398a2b4
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ renames various functions
+
+commit f4cd87c
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ renames get_interval_FVC to get_interval
+
+commit 02890ca
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ simplifies code
+
+commit df0e446
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ goto considered useful
+
+commit c2e53c3
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ Revert "fixes travis language"
+
+ This reverts commit ef9a9b084964d0eca2d87362054dd9184782c9bb.
+
+commit 30e2046
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ moves function definitions
+
+commit ef9a9b0
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ fixes travis language
+
+commit 1cdcb61
+Merge: cbd5013 95ddbbf
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ Merge branch 'master' into travis
+
+ Conflicts:
+ .travis.yml
+ configure.ac
+
+commit cbd5013
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ I dont know what I am doing wrong here
+
+commit 95ddbbf
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ fixes broken travis build, hopefully
+
+commit 11eac26
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ fixes feature test macro
+
+commit 4832109
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ fixes broken build
+
+commit bf5245e
+Merge: e91faab 5cb414e
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ Merge branch 'master' into travis
+
+ Conflicts:
+ .travis.yml
+
+commit 5cb414e
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ fixes broken coverage
+
+commit 04b0894
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-04-02
+
+ removes old merge conflict
+
+commit 441f837
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-03-30
+
+ fixes dejavu bug
+
+commit ca9c572
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-03-28
+
+ removes useless instruction
+
+commit 687b35c
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-03-28
+
+ fixes C++ build weirdness
+
+commit a6a46fd
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-03-28
+
+ ignores stamp files
+
+commit 8bc60b4
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-03-28
+
+ fixes c++ definition macro
+
+commit 993a668
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-03-28
+
+ fixes compiler warnings
+
+commit 22fa316
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-03-28
+
+ removes last traces of C++ in andi
+
+commit 305e7bc
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-03-27
+
+ follow up fix
+
+commit 653e6f7
+Merge: 26f6556 2034a8c
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-03-27
+
+ Merge branch 'master' of https://github.com/kloetzl/andi
+
+ Conflicts:
+ src/Makefile.am
+
+commit 26f6556
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-03-26
+
+ refactors all the code to plain C
+
+ As the RMQs were the only dependency using C++, and we got rid of those,
+ I refactored the code to plain C11. Thus we no longer need a C++ compiler,
+ except for the unit tests, or psufsort. This might make andi easier to port
+ to old machines without decent C++ compilers. Additionally, this now allows
+ us to use the cool C features, missing in C++.
+
+commit 2034a8c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-03-25
+
+ fixes perf make target
+
+commit 8148f7f
+Merge: 3505106 0c98b73
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-03-23
+
+ Merge branch 'psufsort'
+
+ Conflicts:
+ Makefile.am
+ src/esa.h
+ test/Makefile.am
+
+commit 3505106
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-03-23
+
+ bumps version number to 0.9-beta
+
+commit 336216a
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-22
+
+ fixes everything
+
+commit f9bb173
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-22
+
+ fixes tests
+
+commit dcab084
+Merge: bd7de82 cec5fd2
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-22
+
+ Merge branch 'master' into no-rmq
+
+ Conflicts:
+ Makefile.am
+ src/Makefile.am
+ src/andi.cpp
+ src/esa.cpp
+ src/esa.h
+ src/process.cpp
+ test/Makefile.am
+
+commit cec5fd2
+Merge: 249fae4 b70f1d6
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-02-19
+
+ Merge branch 'master' of github.com:EvolBioInf/andi
+
+commit b70f1d6
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-18
+
+ if extra verbose, print asymmetric distances
+
+commit 249fae4
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-02-16
+
+ adds flags for old versions of automake
+
+commit 0c98b73
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-11
+
+ enables concurrency in psufsort
+
+commit 0cbd62f
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-11
+
+ updates config.h template
+
+commit cdc676f
+Merge: a9c581c ed853dc
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-09
+
+ Merge branch 'master' into psufsort
+
+commit ed853dc
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ fixes travis build
+
+commit e91faab
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ even more fixing
+
+commit 6f6fb76
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ may be
+
+commit 3d41793
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ further tests
+
+commit 6a23b73
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ adds some flags
+
+commit 90910fb
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ testing
+
+commit 747e78a
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ adds two more autoconf func checks
+
+commit a9c581c
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ use autoconf C++11 macro
+
+commit 97b396d
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ follow up
+
+commit 5256361
+Merge: 80b83b0 a7df689
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ Merge branch 'master' into psufsort
+
+commit a7df689
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ improves readme
+
+commit 9363851
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ adds m4 macro for C++11 support
+
+commit e605395
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ removes unnecessary compile flags
+
+commit 780e5f4
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-08
+
+ adds missing include
+
+commit 01212e9
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-07
+
+ fixes invalid memory access in unit test
+
+commit 4ba4fb0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-02-05
+
+ fixes maf2phy output format
+
+commit 80b83b0
+Merge: 5d1cdf5 73d16c1
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-04
+
+ Merge branch 'master' into psufsort
+
+ Conflicts:
+ Makefile.am
+
+commit 73d16c1
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-04
+
+ bumps version
+
+commit 7f7aca2
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-04
+
+ release v0.8.1
+
+commit 735d4ee
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-04
+
+ also distribute test scripts
+
+commit a2a1ee6
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-04
+
+ build a distribution with enabled unit tests
+
+commit 5d1cdf5
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-04
+
+ adds psufsort
+
+ Instead of libdivsufsort the suffix array can now be built with psufsort.
+ The switch is made at configuration time.
+
+commit 858d871
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-03
+
+ warn about too short sequences
+
+commit 56ea554
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-03
+
+ improves warning for broken sequences
+
+commit 008efb6
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-01
+
+ removes gmon from make target
+
+commit d38c242
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-02-01
+
+ improves docs
+
+ - adds documentation for dist_hack
+ - ignores doxygen sqlite file
+
+commit d0a5b4f
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-01-25
+
+ fixes join test, again
+
+commit 0c3afc6
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-01-25
+
+ fixes join test
+
+commit 6473063
+Merge: 39adc6c c3874bd
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-01-25
+
+ Merge branch 'master' into coverage
+
+commit c3874bd
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-01-25
+
+ adds test for join mode
+
+commit 39adc6c
+Merge: 8a22def bb8580b
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-01-25
+
+ Merge branch 'master' into coverage
+
+commit bb8580b
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-01-25
+
+ adds docs
+
+commit 4fe6be2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-01-09
+
+ adds 'off' diagnostic
+
+commit 8f31a57
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-01-09
+
+ improves diagnotics
+
+commit c6e8b6d
+Merge: 4b334be aa7296a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2015-01-08
+
+ Merge branch 'master' of github.com:EvolBioInf/andi
+
+commit aa7296a
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2015-01-02
+
+ bumps version number
+
+commit 69b2cef
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-25
+
+ updates readme
+
+commit 4b334be
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-19
+
+ bumps version number
+
+commit 4482df1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-19
+
+ release v0.8
+
+commit 8a22def
+Merge: f21aa12 2dde04d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-19
+
+ Merge branch 'master' into coverage
+
+commit 2dde04d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-19
+
+ updates man page
+
+commit f21aa12
+Merge: 547d442 3c19a89
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-19
+
+ Merge branch 'master' into coverage
+
+commit 3c19a89
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-19
+
+ more micro optimizations
+
+commit 8cac12b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-18
+
+ updates kseq.h
+
+commit 93fa5b7
+Merge: b90d408 e1d955d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-18
+
+ Merge branch 'microopt'
+
+commit e1d955d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-18
+
+ Revert "more use of FVC"
+
+ This reverts commit 71218a5da1b1540165ac7081edc130d9201ceaf2.
+
+commit b90d408
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-18
+
+ minor cleanup
+
+commit c7451af
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-18
+
+ updates citation
+
+commit 547d442
+Merge: 13757e3 955eba9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-18
+
+ Merge branch 'master' into coverage
+
+commit 955eba9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-15
+
+ stop failing on very similar sequences
+
+commit 5e470a1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-12
+
+ reduces memory usage
+
+ The reverse-complement+forward string is only needed for the subjects in a comparison. Thus it can be computed on demand and freed afterwards. This reduces the memory from 3 byte per input nucleotide to 1+e where e depends on the number of threads.
+
+commit f713a0e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-12
+
+ adds link to paper
+
+commit 396203e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-12-08
+
+ removes further needless checks
+
+commit cf88d33
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-12-07
+
+ further simplifications
+
+commit 71218a5
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-12-07
+
+ more use of FVC
+
+commit 24d9e3e
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-12-07
+
+ simplifies condition
+
+commit 174c76d
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-12-07
+
+ removes some redundant checks
+
+commit efb8e9c
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-12-07
+
+ simplify variables
+
+commit 72a6584
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-12-07
+
+ fixes wrong lookup on singleton intervals
+
+commit 18d5e8b
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-12-07
+
+ fixes serious typo
+
+commit 9df4a68
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-11-23
+
+ first take at another optimization
+
+commit d7a0a28
+Merge: 44d82bd f9ce417
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-11-23
+
+ Merge branch 'master' of https://github.com/kloetzl/andi
+
+commit 44d82bd
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-11-15
+
+ replaces auto with proper types to support older compilers
+
+commit 13757e3
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-20
+
+ excludes libdivsufsort
+
+commit 62a4da6
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-20
+
+ fixes excludes for coveralls
+
+commit a7fe5d9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-17
+
+ explicitly sets gcov path
+
+commit 366d145
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-11-17
+
+ adds gcov build flags
+
+commit 622fa5c
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-11-17
+
+ adds coveralls.io
+
+commit f9ce417
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-17
+
+ Revert "adds libdivsufsort dir to includes for the unit tests"
+
+ This reverts commit 3f7a6cf64c8565e5f5c4e21448e739b021babb22.
+
+commit 59568f8
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-11-15
+
+ replaces auto with proper types to support older browsers
+
+commit ceca24b
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-11-15
+
+ adds errno.h dependency
+
+commit c5d0af3
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-11-15
+
+ bumps version number
+
+commit 8ea49c1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-14
+
+ release v0.7.3
+
+commit 9618eae
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ adds travis build status to readme
+
+commit 75f99d9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ more travis trial and error
+
+commit 266bf8b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ fixes travis library path
+
+commit d17cc3e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ use betters compilers
+
+commit ee93575
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ fixes travis paths
+
+commit d12a1fa
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ fixes travis scripts missing sudo
+
+commit 3ef0750
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ fixes download link in travis build script
+
+commit 5ae938c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ fixes travis syntax
+
+commit a8920ec
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ adds travis file
+
+commit 3f7a6cf
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ adds libdivsufsort dir to includes for the unit tests
+
+commit c6fc52e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ fixes memory leak and other issues with test_fasta
+
+commit 26c1ba5
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ fixes manpage
+
+commit 6f5133d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ fixes link for kseq.h
+
+commit 27301dd
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ adds random unit tests
+
+commit 5dad58d
+Merge: 215d026 cb6b828
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-13
+
+ Merge branch 'master' of github.com:EvolBioInf/andi
+
+commit cb6b828
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-11-11
+
+ simplifies argument parsing
+
+commit 11328ae
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-11-11
+
+ updates kseq.h
+
+ This fixes not only compiler warnings but also an issue when reading from pipes. See https://github.com/lh3/seqtk/pull/43 for details.
+
+commit 215d026
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-10
+
+ follow up commit
+
+commit 264bdf6
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-10
+
+ uses err.h instead of custom error messages
+
+commit f7055a1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-06
+
+ adds another warning
+
+commit 9138257
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-06
+
+ fixes warning being printed in any case
+
+commit 51211bf
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-06
+
+ adds the vmatch script
+
+ The vmatch script can be used to compare the performance of andi with vmatch. The latter can compute indexes and matches which then can be used to compute the anchor distance. Since vmatch is much slower then andi this last step is skipped.
+
+commit 9afc2c9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-06
+
+ warns on failed estimations
+
+commit 60a7ffc
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-03
+
+ fixes the changelog build
+
+commit 0f2125f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-03
+
+ fixes ChangeLog reaction
+
+commit a3ccffd
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-11-03
+
+ release v0.7.2
+
+ This is an insignificant testing release.
+
+commit 954a4a2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-30
+
+ adds avg. anchor length to diagnostics
+
+commit 29b8851
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-27
+
+ skips nucleotides known to be equal
+
+commit 8cb6b5b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-27
+
+ fixes rare issue
+
+ Let Q,S be sequences. If Q contains a nucleotide which S doesn't, before this commit the comparision would break at that point (or atleast in some cases). No it'll be treated as regular mismatch.
+
+commit beece1e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-27
+
+ fixes race condition
+
+commit 02383fc
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-10-26
+
+ removes useless initialization
+
+commit 10f8af4
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-10-26
+
+ adds more input validation
+
+commit 8174d3d
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-10-26
+
+ adds diagnostics
+
+commit 98414e5
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-10-26
+
+ fixes function names to be more clear
+
+commit 3ca5764
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-10-26
+
+ fixes ordering of members in lcp-intervals
+
+commit d52830d
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-10-25
+
+ removes old code
+
+commit eadd193
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-10-24
+
+ fixes more typos
+
+commit b27a7bf
+Author: Fabian Klötzl <fabian at kloetzl.info>
+Date: 2014-10-24
+
+ fixes typos
+
+commit 0fe80ae
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-24
+
+ bumps version number to v0.8-beta (again)
+
+commit 7295f5a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-24
+
+ release v0.7.1
+
+commit e57593d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-24
+
+ adds instructions for unit tests to readme
+
+commit ba4be59
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-24
+
+ fixes dependency for GLIB2
+
+ Previously GLIB2 was required for the unit tests. This commit make compilation of unit tests optional via a parameter for ./configure. By default its disabled.
+
+commit b8b5404
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-16
+
+ bumps version to v0.8-beta
+
+commit efc51ee
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-16
+
+ release v0.7
+
+commit ea1941c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-16
+
+ updates man page
+
+commit d3d3cc0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-16
+
+ fixes `make distcheck`
+
+ The `make distcheck` command now completes successfully. To achieve that,
+ the option subdir-objects hat to be disabled because of a bug in automake.
+ See http://lists.gnu.org/archive/html/automake/2014-04/msg00003.html
+ Hopefully that will not cause further issues in distributions of andi.
+
+commit 32536ce
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-16
+
+ adds checks for stdint.h inttypes.h headers
+
+commit 1bde82b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-16
+
+ fixes issue with AM_PROG_AR and old versions of autoconf
+
+commit 6d8685d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-14
+
+ fixes some dist issues
+
+commit e9896c1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-14
+
+ set default cache depth to 10
+
+commit bd7de82
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-14
+
+ fixes caching
+
+commit 785e154
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-14
+
+ optimizes no-rmqs
+
+commit a623882
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-09
+
+ DRY
+
+commit 4c1fdd4
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-09
+
+ reduces memory needs for fast mode
+
+commit 2987bf7
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-09
+
+ removes RMQ reference from help string
+
+commit 4718cd4
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-09
+
+ adds docs
+
+commit cca056f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-07
+
+ annotates esa_init_CLD
+
+commit 8783b47
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-07
+
+ adds docs
+
+commit 6125618
+Merge: 821529a 31de193
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-07
+
+ Merge branch 'master' into no-rmq
+
+commit 821529a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-07
+
+ adds docs
+
+commit a474db7
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-07
+
+ renames get*Interval functions
+
+commit 36eea19
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-07
+
+ removes ISA from ESA struct
+
+commit fd90671
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-07
+
+ removes RMQ from ESA struct
+
+commit 486e327
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-07
+
+ removes RMQ dependency
+
+commit 54215a0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-07
+
+ removes various RMQ related code
+
+commit 31de193
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-06
+
+ fixes rare issue related to lcp-intervals with non-acgt suffixes
+
+commit 55fae2c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-06
+
+ fixes datatype
+
+commit 370f0a3
+Merge: f836305 39287a6
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-06
+
+ Merge branch 'master' into no-rmq
+
+commit f836305
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-06
+
+ check result of esa_init_CLD
+
+commit 53af15b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-06
+
+ adds various tests
+
+commit c6e4522
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-06
+
+ fixes incorrect assertion
+
+commit 39287a6
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-06
+
+ catch error from malloc in cache initialization
+
+commit 21efc1c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-02
+
+ fixes tests
+
+commit 848d7a3
+Merge: 6ac4f41 5047798
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-02
+
+ Merge branch 'master' into no-rmq
+
+ Conflicts:
+ src/process.cpp
+
+commit 5047798
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-02
+
+ fixes buffer underflow due to signedness error
+
+commit 6ac4f41
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-02
+
+ uses the cached normq version
+
+commit 33301eb
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-02
+
+ adds LCP-interval finding strategy without RMQs
+
+commit cf03cfc
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-01
+
+ adds guards for omp functions
+
+commit a9b0855
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-01
+
+ updates help strings
+
+commit f7c212f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-01
+
+ creates new io.cpp file
+
+ * moves io functions into io.cpp
+ * creates unified interface (FAIL,WARN) for errors
+
+commit 99bc3dd
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-10-01
+
+ adds --low-memory argument
+
+commit 53581d7
+Merge: 2810afb ef682bd
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-29
+
+ Merge branch 'master' into spacetime
+
+commit ef682bd
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-29
+
+ adds perf make target for Linux buildin perf tool
+
+commit 2810afb
+Merge: 16bad97 31baab2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-29
+
+ Merge branch 'master' into spacetime
+
+ Conflicts:
+ src/process.cpp
+
+commit 31baab2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-29
+
+ fixes some confusing API
+
+commit 2d28ef1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-25
+
+ prints nicer error message
+
+commit 824d57b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-25
+
+ speeds up hashing
+
+commit 8acea76
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-25
+
+ fixes CACHE_LENGTH type
+
+commit 36dd292
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-24
+
+ ignores more test files
+
+commit 3f0150b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-24
+
+ adds unit tests for sequence manipulation
+
+commit 3f5d7fe
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-24
+
+ fixes wrong datatypes leading to memory corruption
+
+commit bc2bf3e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-24
+
+ fixes race condition
+
+commit b9cb1d3
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-24
+
+ simplifies makefile
+
+commit 8c14ea3
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-24
+
+ uses autoconf for glib flags
+
+commit f1104af
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-24
+
+ fixes make issues
+
+commit ba5871a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-24
+
+ fixes some make issues
+
+commit af2f8b2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-24
+
+ ignore coverage files
+
+commit 9b3dd8f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-22
+
+ adds unit tests for the cache
+
+commit 1396f46
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-22
+
+ caches even more
+
+commit 1f75c78
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-22
+
+ fixes caching
+
+ These changes reenable caching. Now andi should be as fast as in version v0.6 and as accurate as in v0.5. (hopefully ;)
+
+commit 3af6e8a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-19
+
+ correctly handle lcp > 1
+
+commit ff4bc33
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-19
+
+ reenables caching which was effectively disabled in the last commit
+
+commit c29e2fe
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-19
+
+ fixes inaccurate results
+
+ On filling the cache, beware of intervals whose LCP is longer than the current position. Previous to this commit incorrect paths in the suffix tree were followed and hence an incorrect cache was created. Now, for such cases, the code falls back to a non-cached search. The performance impact of this needs to be evaluated and might be due to changes in the future.
+
+commit 5ba4688
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-19
+
+ bumps version to 0.7-beta
+
+commit a363372
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-19
+
+ release v0.6
+
+commit fae1ac0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-19
+
+ fixes invalid read
+
+ Valgrind reported an invalid read at this point. Googling suggests
+ this might be a valgrind error. Still, casting solves the issue.
+
+commit d60ef86
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-19
+
+ fixes various invalid read errors
+
+commit d2f9f53
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-18
+
+ adds safety checks
+
+commit 611e3bf
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-18
+
+ fixes use after free
+
+commit 16bad97
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-17
+
+ changes parallelization
+
+ Instead of computing all rows of the distance matrix simultaneously, we now fill a single row in parallel. At the moment this is slower, but uses less memory than the old method. In the future the user can pick either method via a (compile time) switch.
+
+commit 496eba0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-17
+
+ adds profiling make target
+
+commit 0aa12d5
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-17
+
+ fixes falsy coverage
+
+commit 8fe50e6
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-17
+
+ print additional coverage informatin on -v
+
+commit d2c900b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-17
+
+ fixes unsafe comparison
+
+commit 36a037d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-15
+
+ inverts -p argument
+
+commit 7609f64
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-15
+
+ skip broken sequences
+
+commit 65a4f5f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-15
+
+ fixes further memory leak and nullptr deref.
+
+commit 622d2ec
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-15
+
+ fixes a memory leak
+
+commit 6177a9e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-15
+
+ renames *_seq -> seq_*
+
+commit 01b6fcc
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-15
+
+ adds docs
+
+commit 569d266
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-15
+
+ removes duplicate code
+
+commit 7803c6e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-15
+
+ removes deprecated functions
+
+commit 2454b97
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-15
+
+ clean up
+
+commit 373b2ae
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-15
+
+ ignore additional andi versions
+
+commit 602ab52
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-15
+
+ adds build instructions for plain git repo.
+
+commit cabba9f
+Merge: decfc60 b85e8f9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-04
+
+ Merge branch 'cache'
+
+commit b85e8f9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-04
+
+ adds check in cache DFS
+
+commit 716958a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-04
+
+ fills the cache using a DFS
+
+commit b02964c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-04
+
+ quick exit on singleton intervals
+
+commit decfc60
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-04
+
+ fixes two possible memory leaks
+
+commit c60b4f6
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-04
+
+ adds docs
+
+commit 9c92e8a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-04
+
+ fixes code so it can be build on thymine
+
+commit 7ba1d36
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-01
+
+ implements RMQ caching
+
+commit 0b8a614
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-01
+
+ refactor ESA creation
+
+commit d0d431f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-01
+
+ renames dsa_init -> dsa_new
+
+commit d99262b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-01
+
+ canonicalize dsa_* function names
+
+commit 1ac0768
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-01
+
+ removes incorrect check
+
+commit 959fcfb
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-01
+
+ updates RMQ library
+
+ * update RMQ_succint to RMQ_improved. This results in faster programs
+ at slightly more memory consumption.
+ * fixes the memory leak by making the destructor of RMQ virtual.
+ * updates Makefile, configure.ac and Readme
+ * updates configure.ac and gitignore for non-posix archiver
+
+commit b4d6b15
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-01
+
+ bump version to v0.6-beta
+
+commit 149f8d2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-01
+
+ release v0.5
+
+commit 808fba6
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-01
+
+ ignores compile file
+
+commit 2ee20d9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-09-01
+
+ ignore sublime files
+
+commit b5d2115
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-08-08
+
+ moves functions to allow inlining
+
+commit 2d8a089
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ simplifies code
+
+ printf does not need the `l` in `%lf`. The type is double anyways.
+
+commit cf174a2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ forces execution of Changelog make rule
+
+commit 7996535
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ fixes typo
+
+commit 51fb88d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ enhances various docs
+
+commit 0a4f8a1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ improves docs in esa.h
+
+commit 9710462
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ improves docs for printDistMatrix
+
+commit 79ed6ce
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ adds test to gitignore
+
+commit 37d4096
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ adds docs for minAnchorLength
+
+commit 77a2463
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ improves docs slightly
+
+commit b963e25
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ fixes undefined behaviour
+
+commit 226c6a3
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ removes obsolete -s commandline argument
+
+commit 3fe143e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ fixes instructions for building the code docs
+
+commit 646875b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ fixes code docs not building
+
+commit 8bbdd3f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ return nan also in --raw mode
+
+commit 613df03
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ improves readme
+
+commit a43bf35
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ removes some TODOs
+
+commit e2836dc
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-30
+
+ adds changelog
+
+ * The changelog is automatically generated from git
+
+commit bdc26c0
+Author: kloetzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-26
+
+ adds data sets to readme
+
+commit 06a06a3
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-25
+
+ changes to our own binomial coeff. implementation
+
+ * Removes dependecy for GSL
+ * Use our own implementation for computing the
+ binomial coefficient.
+
+commit e34763f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-25
+
+ fixes configure script not adding -ldivsufsort
+
+ * closes issue #1
+
+commit 0c4603a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-25
+
+ improves autoconf check for libdivsufsort
+
+ * We now also check for the existence of the header file.
+ * If the lib if not properly installed we now abort compilation
+ with an error.
+
+commit 997faf6
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-23
+
+ updates readme
+
+ * adds simK tool
+ * improves licensing paragraph
+
+commit 92ac7cd
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-23
+
+ adds maf2phy.awk script
+
+ This script can convert the *mutation annotation format* to
+ PHYLIP format, as stated in the accompanying paper.
+
+commit 907dfdc
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-23
+
+ improves readme
+
+ The readme is optimized to provide a nice project overview when
+ seen via GitHub.
+
+commit 1686f39
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-23
+
+ auto generate make file
+
+commit 612ea9d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-23
+
+ bumps version number
+
+commit 1fd6351
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-23
+
+ release v0.4
+
+commit a6b6a17
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-23
+
+ changing anchor length calculation
+
+ replacing the formula for the minimum anchor length with formula (4)
+ from Haubold et al. (2009)
+
+commit 851e94a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-19
+
+ improves man page
+
+commit 32db374
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-19
+
+ updates documentation to better explain -p
+
+commit a3c46ac
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-19
+
+ changes default -p value to 0.95
+
+ For real this time.
+
+commit d140650
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-19
+
+ Revert "changes default -p value to 0.95"
+
+ This reverts commit e02845f9e0bb93f25d56d16d07c19b6c863f86cd.
+
+commit e02845f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-19
+
+ changes default -p value to 0.95
+
+commit 8e39cc7
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ improves readme
+
+commit 612984a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ adds configure to gitignore
+
+commit 2796fe8
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ improves autoconf files
+
+commit 196c907
+Merge: 76910b1 f6a7569
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ Merge branch 'master' into autoconf
+
+commit f6a7569
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ correct the authors name
+
+commit 76910b1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ improves man page
+
+commit 74c01b7
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ changes version number
+
+commit 06b0821
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ removes automatically generated file
+
+commit e6b23b0
+Merge: f25d3c3 f1ab00c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ Merge branch 'master' into autoconf
+
+commit f1ab00c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ pretty print filenames in join mode
+
+commit f25d3c3
+Merge: 59acc79 efc335f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ Merge branch 'master' into autoconf
+
+ Conflicts:
+ src/Makefile
+
+commit efc335f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ catches another rare error
+
+commit cff7fea
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ validate input
+
+commit 5458c2e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-18
+
+ fixes join mode
+
+ This is a rewrite of the join mode. The changes include:
+
+ * Rather than iteratively using `asprintf` to create the new long sequence
+ we now call `malloc` once.
+ * Ditch the crude handwritten implementation of a dynamically growing
+ array. Instead a C wrapper for `std::vector<seq_t>` is used.
+ * The name of a joined sequence is now the filename.
+ * Of a sequence name only the first nine characters get printed.
+ * Adds and fixes documentation all over the place.
+ * Renames `sequence.c` to `sequence.cpp` to reflect the fact that its
+ code is actually C++.
+
+commit 59acc79
+Merge: 83e0891 28da4c0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-16
+
+ Merge branch 'master' into autoconf
+
+commit 28da4c0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-16
+
+ adds docs
+
+commit 11656a8
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-12
+
+ changes default -p value to 0.6
+
+commit 03ff31c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-12
+
+ removes needless define and removes warning
+
+commit aa6e559
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-12
+
+ adds join mode
+
+ The join mode treats every sequences from a file as part of one genome. It does
+ so by appending the sequences to each other with a separator character in between.
+ This is useful if contigs of one organism are kept in one file and need to be
+ compared to another organism.
+
+ The join mode is activated via --join or -j and expects at least one filename
+ to be passed via command line arguments.
+
+commit 83e0891
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-11
+
+ adds missing to gitignore
+
+commit 42b818d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-11
+
+ improves readme
+
+commit 541e982
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-11
+
+ removes missing file
+
+commit bb86846
+Merge: d0a877d d18f5f1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-11
+
+ Merge branch 'master' into autoconf
+
+commit d18f5f1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-11
+
+ fixes low precision of printed results
+
+ If the distance matrix contains values smaller than 0.001
+ we now use scientific notation for the output to increase the
+ presicion.
+
+commit 6160450
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-11
+
+ fixes NaN result for nearly identical sequences
+
+commit e3eb46c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-11
+
+ fixes acknowledgements
+
+commit ed959c3
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-11
+
+ adds acknowledgements
+
+commit f02a2a1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-11
+
+ improves output
+
+ Now the default values for all parameters are printed on --help.
+
+commit 25b0838
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-05
+
+ fixes result for identical sequences
+
+commit 50e94f1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-05
+
+ changes names to be printed left adjusted
+
+commit d0a877d
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-05
+
+ changes version number to conform to debian standards
+
+commit ed67160
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-05
+
+ makes stripping mandatory and ignores case
+
+ The stripping introduced in the last commit is now done automatically. Hence
+ the option --strip is removed. Still, a warning is issued if characters other
+ than [acgtACGT] were contained in the input. Also the case of the input is now
+ being ignored.
+
+commit 8966fb2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-05
+
+ adds various files to build process
+
+commit 3beb749
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-05
+
+ adds strip option
+
+commit 64a2a77
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ adds rough man page
+
+commit f204d7e
+Merge: 0a78ab2 61b04d5
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ Merge branch 'master' into autoconf
+
+commit 0a78ab2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ prepares for better documentation
+
+commit a1a87f8
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ cleans up makefiles
+
+commit 3f73bb8
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ adds missing file
+
+commit 9acb51e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ fixes readme to reflect autoconf changes
+
+commit 4cabef5
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ generate a README from README.md to satisfy autoconf
+
+commit 61b04d5
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ improves help string
+
+commit da3af7b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ removes the option to use different strategies
+
+commit d5c8452
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ removes option for single stranded comparision
+
+commit 0b55dee
+Merge: 7d6a0eb ae812b9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ Merge branch 'master' into autoconf
+
+ Conflicts:
+ src/Makefile
+
+commit 7d6a0eb
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ improves .gitignore to ignore various autoconf files
+
+commit 82586e0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ adds configure.ac script
+
+commit 3bc6895
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ adds configure script
+
+commit e24a215
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ adds GNU style files
+
+commit 9d326f9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ switches from manual make files to automake
+
+commit ae812b9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ removes resolved TODOs
+
+commit 0e7a48a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ adds gc-content calculation
+
+commit ff9166a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-04
+
+ removes libdivsufsort64 dependency
+
+commit bae0912
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-02
+
+ renames files for autoconf
+
+ With autoconf, we can no longer compile .c files using CXX. They
+ have to have the ending .cpp or an error will be thrown. Also the
+ Makefile is now generated by automake.
+
+commit e800c53
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-02
+
+ removing test file
+
+commit 175f2d9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-02
+
+ renames np to andi
+
+commit 6e6f855
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-02
+
+ increases the max number of sequences
+
+commit f3d67dd
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-06-02
+
+ fixes help string
+
+commit 0862a0a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ bumps version number
+
+commit 9a74c1b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ v0.3
+
+commit 457f7f0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ fixes typo in docs
+
+commit d52f433
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ further cleanup
+
+commit 6b315f7
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ removes code rendered unneccessary by the previous commit
+
+commit d8218bd
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ removes simple strategy
+
+commit b4f2498
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ merged optimization
+
+commit 6f247a8
+Merge: b1a7657 687fe1b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ Merge branch 'optimization'
+
+commit b1a7657
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ fixes random anchor propability
+
+ The -p switch now resembles the certainty that a pair of anchors
+ is not random. This takes into account that both anchors of a pair
+ may be independently found by chance alone. p=0.95 is the new
+ default value.
+
+commit 687fe1b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ saving yet another RMQ
+
+commit b71b3e4
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ corrects the threshhold computation
+
+commit 4c9e492
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ adds anchor length calculation
+
+commit cdcc38b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-28
+
+ changes default strategy to anchor
+
+commit cbc990c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-26
+
+ improves code and docs
+
+commit 8abb51b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-26
+
+ improves docs
+
+commit 1bcefe3
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-26
+
+ improves code and docs
+
+commit 633c56c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-26
+
+ improves readme
+
+commit d62338b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-26
+
+ removes sophisticated strategy
+
+commit b512a40
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-26
+
+ adds readme
+
+commit 688302f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-26
+
+ adds more docs
+
+commit 533ef97
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-26
+
+ changes -c to -t and CORES to THREADS
+
+commit 1e7bc51
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-22
+
+ adds docs
+
+commit 3dbdd74
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-22
+
+ removes check for NULL.
+
+ free(3) can totaly work with NULL values. Stop checking for that.
+
+commit 66efa76
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-22
+
+ removes inc, check and window strategy
+
+commit 03020f2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-21
+
+ create symmetric distance matrix and print N
+
+commit e78d80c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-21
+
+ adds anchor strategy
+
+commit de01ee2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-21
+
+ adds docs and debug information
+
+commit 156bc46
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-19
+
+ adds docs make target
+
+commit 111b306
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-15
+
+ enhances documentation
+
+commit 473ddbf
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-15
+
+ adds documentation via doxygen
+
+commit 447d85e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-15
+
+ nicer help string
+
+commit 41c53f0
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-15
+
+ removes abundant variable
+
+commit 8822d26
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-15
+
+ adds strategies to help string
+
+commit b5fda92
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-15
+
+ uses better api methods
+
+commit 26a9a56
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-15
+
+ fixes function declaration
+
+commit 3cff29c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-15
+
+ enhances program arguments
+
+commit b9a0320
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-14
+
+ fixes wrong lookahead
+
+commit eae68b5
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-14
+
+ fixes comparisions and adds variable number of mismatches
+
+commit 09d8271
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-14
+
+ break after a snp
+
+commit d18b14f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-14
+
+ enhances sophisticated strategy
+
+commit 1ff08a7
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-14
+
+ adds 'sophisticated' distance method
+
+commit 4e0bf24
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-14
+
+ adds dist_check method
+
+commit d8528f3
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-14
+
+ moves catcomp() and revcomp()
+
+commit 784c4d2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ bumps version number
+
+commit 0c6e8f3
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ version 0.2
+
+commit e480717
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ fixes incompatible compile flags
+
+commit 3aa3e69
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ fixes help string
+
+commit 3747d87
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ makes double stranded comparision the default
+
+ Instead of using -d to activate double stranded comparision, -D can
+ be used to disable it. Single stranded comparison is faster but
+ less accurate.
+
+commit 1c06e42
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ adds rough neighbouhood strategy
+
+commit 9b0c763
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ prefer const pointers
+
+commit b1163eb
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ fixes wrong types and debug information in dist_inc()
+
+commit 07667de
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ removes old headers
+
+commit 9049b81
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ removes unused variable
+
+commit 4f6a4b6
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ adds another file to the clean command
+
+commit 50e8c2e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ updates gitignore
+
+commit e28a0af
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-12
+
+ removes testRMQ binary file
+
+commit 94fcd06
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-08
+
+ use a search window of 10 for the inc strategy
+
+commit b3a768a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-08
+
+ removes uninteresting test files
+
+commit 5e7ad4a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-08
+
+ removes yet another useless file
+
+commit 019d0e9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-08
+
+ removes and untracks old files
+
+commit fed5793
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-08
+
+ bumps version number
+
+commit 51de1d1
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-08
+
+ simplifies code
+
+commit f189a0c
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-08
+
+ removes extra semicolon
+
+commit ddbf36a
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-08
+
+ adds version
+
+commit f60397f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-08
+
+ simplifies inc strategy
+
+commit 4688690
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-07
+
+ fixes wrong types
+
+commit 59c06a3
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-07
+
+ fixes wrong corection
+
+commit 95f8a69
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-07
+
+ adds more docs
+
+commit 1fe82e9
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-07
+
+ adds docs
+
+commit cf71d8f
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-07
+
+ adds documentation and fixes types
+
+commit 283acfd
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-07
+
+ removes even more lines of unused code
+
+commit e160808
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-07
+
+ uses correct types
+
+commit 9105ce4
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-07
+
+ removes legacy code
+
+commit e8427e3
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-07
+
+ removes old code
+
+commit 9bef601
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-07
+
+ adds comments
+
+commit 700200e
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-05
+
+ removes unneccessary code
+
+commit bb97a07
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-05
+
+ optimize for speed
+
+commit 0685e12
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-05
+
+ removes .o files
+
+commit aa3ff1b
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-05
+
+ adds .gitignore
+
+commit 0262461
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-05
+
+ removed profiling files
+
+commit f79e294
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-05
+
+ only use 32 bit and other optimizations
+
+commit bdc5db2
+Author: Fabian Klötzl <kloetzl at evolbio.mpg.de>
+Date: 2014-05-05
+
+ adds files
diff --git a/INSTALL b/INSTALL
new file mode 100644
index 0000000..a1e89e1
--- /dev/null
+++ b/INSTALL
@@ -0,0 +1,370 @@
+Installation Instructions
+*************************
+
+Copyright (C) 1994-1996, 1999-2002, 2004-2011 Free Software Foundation,
+Inc.
+
+ Copying and distribution of this file, with or without modification,
+are permitted in any medium without royalty provided the copyright
+notice and this notice are preserved. This file is offered as-is,
+without warranty of any kind.
+
+Basic Installation
+==================
+
+ Briefly, the shell commands `./configure; make; make install' should
+configure, build, and install this package. The following
+more-detailed instructions are generic; see the `README' file for
+instructions specific to this package. Some packages provide this
+`INSTALL' file but do not implement all of the features documented
+below. The lack of an optional feature in a given package is not
+necessarily a bug. More recommendations for GNU packages can be found
+in *note Makefile Conventions: (standards)Makefile Conventions.
+
+ The `configure' shell script attempts to guess correct values for
+various system-dependent variables used during compilation. It uses
+those values to create a `Makefile' in each directory of the package.
+It may also create one or more `.h' files containing system-dependent
+definitions. Finally, it creates a shell script `config.status' that
+you can run in the future to recreate the current configuration, and a
+file `config.log' containing compiler output (useful mainly for
+debugging `configure').
+
+ It can also use an optional file (typically called `config.cache'
+and enabled with `--cache-file=config.cache' or simply `-C') that saves
+the results of its tests to speed up reconfiguring. Caching is
+disabled by default to prevent problems with accidental use of stale
+cache files.
+
+ If you need to do unusual things to compile the package, please try
+to figure out how `configure' could check whether to do them, and mail
+diffs or instructions to the address given in the `README' so they can
+be considered for the next release. If you are using the cache, and at
+some point `config.cache' contains results you don't want to keep, you
+may remove or edit it.
+
+ The file `configure.ac' (or `configure.in') is used to create
+`configure' by a program called `autoconf'. You need `configure.ac' if
+you want to change it or regenerate `configure' using a newer version
+of `autoconf'.
+
+ The simplest way to compile this package is:
+
+ 1. `cd' to the directory containing the package's source code and type
+ `./configure' to configure the package for your system.
+
+ Running `configure' might take a while. While running, it prints
+ some messages telling which features it is checking for.
+
+ 2. Type `make' to compile the package.
+
+ 3. Optionally, type `make check' to run any self-tests that come with
+ the package, generally using the just-built uninstalled binaries.
+
+ 4. Type `make install' to install the programs and any data files and
+ documentation. When installing into a prefix owned by root, it is
+ recommended that the package be configured and built as a regular
+ user, and only the `make install' phase executed with root
+ privileges.
+
+ 5. Optionally, type `make installcheck' to repeat any self-tests, but
+ this time using the binaries in their final installed location.
+ This target does not install anything. Running this target as a
+ regular user, particularly if the prior `make install' required
+ root privileges, verifies that the installation completed
+ correctly.
+
+ 6. You can remove the program binaries and object files from the
+ source code directory by typing `make clean'. To also remove the
+ files that `configure' created (so you can compile the package for
+ a different kind of computer), type `make distclean'. There is
+ also a `make maintainer-clean' target, but that is intended mainly
+ for the package's developers. If you use it, you may have to get
+ all sorts of other programs in order to regenerate files that came
+ with the distribution.
+
+ 7. Often, you can also type `make uninstall' to remove the installed
+ files again. In practice, not all packages have tested that
+ uninstallation works correctly, even though it is required by the
+ GNU Coding Standards.
+
+ 8. Some packages, particularly those that use Automake, provide `make
+ distcheck', which can by used by developers to test that all other
+ targets like `make install' and `make uninstall' work correctly.
+ This target is generally not run by end users.
+
+Compilers and Options
+=====================
+
+ Some systems require unusual options for compilation or linking that
+the `configure' script does not know about. Run `./configure --help'
+for details on some of the pertinent environment variables.
+
+ You can give `configure' initial values for configuration parameters
+by setting variables in the command line or in the environment. Here
+is an example:
+
+ ./configure CC=c99 CFLAGS=-g LIBS=-lposix
+
+ *Note Defining Variables::, for more details.
+
+Compiling For Multiple Architectures
+====================================
+
+ You can compile the package for more than one kind of computer at the
+same time, by placing the object files for each architecture in their
+own directory. To do this, you can use GNU `make'. `cd' to the
+directory where you want the object files and executables to go and run
+the `configure' script. `configure' automatically checks for the
+source code in the directory that `configure' is in and in `..'. This
+is known as a "VPATH" build.
+
+ With a non-GNU `make', it is safer to compile the package for one
+architecture at a time in the source code directory. After you have
+installed the package for one architecture, use `make distclean' before
+reconfiguring for another architecture.
+
+ On MacOS X 10.5 and later systems, you can create libraries and
+executables that work on multiple system types--known as "fat" or
+"universal" binaries--by specifying multiple `-arch' options to the
+compiler but only a single `-arch' option to the preprocessor. Like
+this:
+
+ ./configure CC="gcc -arch i386 -arch x86_64 -arch ppc -arch ppc64" \
+ CXX="g++ -arch i386 -arch x86_64 -arch ppc -arch ppc64" \
+ CPP="gcc -E" CXXCPP="g++ -E"
+
+ This is not guaranteed to produce working output in all cases, you
+may have to build one architecture at a time and combine the results
+using the `lipo' tool if you have problems.
+
+Installation Names
+==================
+
+ By default, `make install' installs the package's commands under
+`/usr/local/bin', include files under `/usr/local/include', etc. You
+can specify an installation prefix other than `/usr/local' by giving
+`configure' the option `--prefix=PREFIX', where PREFIX must be an
+absolute file name.
+
+ You can specify separate installation prefixes for
+architecture-specific files and architecture-independent files. If you
+pass the option `--exec-prefix=PREFIX' to `configure', the package uses
+PREFIX as the prefix for installing programs and libraries.
+Documentation and other data files still use the regular prefix.
+
+ In addition, if you use an unusual directory layout you can give
+options like `--bindir=DIR' to specify different values for particular
+kinds of files. Run `configure --help' for a list of the directories
+you can set and what kinds of files go in them. In general, the
+default for these options is expressed in terms of `${prefix}', so that
+specifying just `--prefix' will affect all of the other directory
+specifications that were not explicitly provided.
+
+ The most portable way to affect installation locations is to pass the
+correct locations to `configure'; however, many packages provide one or
+both of the following shortcuts of passing variable assignments to the
+`make install' command line to change installation locations without
+having to reconfigure or recompile.
+
+ The first method involves providing an override variable for each
+affected directory. For example, `make install
+prefix=/alternate/directory' will choose an alternate location for all
+directory configuration variables that were expressed in terms of
+`${prefix}'. Any directories that were specified during `configure',
+but not in terms of `${prefix}', must each be overridden at install
+time for the entire installation to be relocated. The approach of
+makefile variable overrides for each directory variable is required by
+the GNU Coding Standards, and ideally causes no recompilation.
+However, some platforms have known limitations with the semantics of
+shared libraries that end up requiring recompilation when using this
+method, particularly noticeable in packages that use GNU Libtool.
+
+ The second method involves providing the `DESTDIR' variable. For
+example, `make install DESTDIR=/alternate/directory' will prepend
+`/alternate/directory' before all installation names. The approach of
+`DESTDIR' overrides is not required by the GNU Coding Standards, and
+does not work on platforms that have drive letters. On the other hand,
+it does better at avoiding recompilation issues, and works well even
+when some directory options were not specified in terms of `${prefix}'
+at `configure' time.
+
+Optional Features
+=================
+
+ If the package supports it, you can cause programs to be installed
+with an extra prefix or suffix on their names by giving `configure' the
+option `--program-prefix=PREFIX' or `--program-suffix=SUFFIX'.
+
+ Some packages pay attention to `--enable-FEATURE' options to
+`configure', where FEATURE indicates an optional part of the package.
+They may also pay attention to `--with-PACKAGE' options, where PACKAGE
+is something like `gnu-as' or `x' (for the X Window System). The
+`README' should mention any `--enable-' and `--with-' options that the
+package recognizes.
+
+ For packages that use the X Window System, `configure' can usually
+find the X include and library files automatically, but if it doesn't,
+you can use the `configure' options `--x-includes=DIR' and
+`--x-libraries=DIR' to specify their locations.
+
+ Some packages offer the ability to configure how verbose the
+execution of `make' will be. For these packages, running `./configure
+--enable-silent-rules' sets the default to minimal output, which can be
+overridden with `make V=1'; while running `./configure
+--disable-silent-rules' sets the default to verbose, which can be
+overridden with `make V=0'.
+
+Particular systems
+==================
+
+ On HP-UX, the default C compiler is not ANSI C compatible. If GNU
+CC is not installed, it is recommended to use the following options in
+order to use an ANSI C compiler:
+
+ ./configure CC="cc -Ae -D_XOPEN_SOURCE=500"
+
+and if that doesn't work, install pre-built binaries of GCC for HP-UX.
+
+ HP-UX `make' updates targets which have the same time stamps as
+their prerequisites, which makes it generally unusable when shipped
+generated files such as `configure' are involved. Use GNU `make'
+instead.
+
+ On OSF/1 a.k.a. Tru64, some versions of the default C compiler cannot
+parse its `<wchar.h>' header file. The option `-nodtk' can be used as
+a workaround. If GNU CC is not installed, it is therefore recommended
+to try
+
+ ./configure CC="cc"
+
+and if that doesn't work, try
+
+ ./configure CC="cc -nodtk"
+
+ On Solaris, don't put `/usr/ucb' early in your `PATH'. This
+directory contains several dysfunctional programs; working variants of
+these programs are available in `/usr/bin'. So, if you need `/usr/ucb'
+in your `PATH', put it _after_ `/usr/bin'.
+
+ On Haiku, software installed for all users goes in `/boot/common',
+not `/usr/local'. It is recommended to use the following options:
+
+ ./configure --prefix=/boot/common
+
+Specifying the System Type
+==========================
+
+ There may be some features `configure' cannot figure out
+automatically, but needs to determine by the type of machine the package
+will run on. Usually, assuming the package is built to be run on the
+_same_ architectures, `configure' can figure that out, but if it prints
+a message saying it cannot guess the machine type, give it the
+`--build=TYPE' option. TYPE can either be a short name for the system
+type, such as `sun4', or a canonical name which has the form:
+
+ CPU-COMPANY-SYSTEM
+
+where SYSTEM can have one of these forms:
+
+ OS
+ KERNEL-OS
+
+ See the file `config.sub' for the possible values of each field. If
+`config.sub' isn't included in this package, then this package doesn't
+need to know the machine type.
+
+ If you are _building_ compiler tools for cross-compiling, you should
+use the option `--target=TYPE' to select the type of system they will
+produce code for.
+
+ If you want to _use_ a cross compiler, that generates code for a
+platform different from the build platform, you should specify the
+"host" platform (i.e., that on which the generated programs will
+eventually be run) with `--host=TYPE'.
+
+Sharing Defaults
+================
+
+ If you want to set default values for `configure' scripts to share,
+you can create a site shell script called `config.site' that gives
+default values for variables like `CC', `cache_file', and `prefix'.
+`configure' looks for `PREFIX/share/config.site' if it exists, then
+`PREFIX/etc/config.site' if it exists. Or, you can set the
+`CONFIG_SITE' environment variable to the location of the site script.
+A warning: not all `configure' scripts look for a site script.
+
+Defining Variables
+==================
+
+ Variables not defined in a site shell script can be set in the
+environment passed to `configure'. However, some packages may run
+configure again during the build, and the customized values of these
+variables may be lost. In order to avoid this problem, you should set
+them in the `configure' command line, using `VAR=value'. For example:
+
+ ./configure CC=/usr/local2/bin/gcc
+
+causes the specified `gcc' to be used as the C compiler (unless it is
+overridden in the site shell script).
+
+Unfortunately, this technique does not work for `CONFIG_SHELL' due to
+an Autoconf bug. Until the bug is fixed you can use this workaround:
+
+ CONFIG_SHELL=/bin/bash /bin/bash ./configure CONFIG_SHELL=/bin/bash
+
+`configure' Invocation
+======================
+
+ `configure' recognizes the following options to control how it
+operates.
+
+`--help'
+`-h'
+ Print a summary of all of the options to `configure', and exit.
+
+`--help=short'
+`--help=recursive'
+ Print a summary of the options unique to this package's
+ `configure', and exit. The `short' variant lists options used
+ only in the top level, while the `recursive' variant lists options
+ also present in any nested packages.
+
+`--version'
+`-V'
+ Print the version of Autoconf used to generate the `configure'
+ script, and exit.
+
+`--cache-file=FILE'
+ Enable the cache: use and save the results of the tests in FILE,
+ traditionally `config.cache'. FILE defaults to `/dev/null' to
+ disable caching.
+
+`--config-cache'
+`-C'
+ Alias for `--cache-file=config.cache'.
+
+`--quiet'
+`--silent'
+`-q'
+ Do not print messages saying which checks are being made. To
+ suppress all normal output, redirect it to `/dev/null' (any error
+ messages will still be shown).
+
+`--srcdir=DIR'
+ Look for the package's source code in directory DIR. Usually
+ `configure' can determine that directory automatically.
+
+`--prefix=DIR'
+ Use DIR as the installation prefix. *note Installation Names::
+ for more details, including other options available for fine-tuning
+ the installation locations.
+
+`--no-create'
+`-n'
+ Run the configure checks, but stop before creating any output
+ files.
+
+`configure' also accepts some other, not widely useful, options. Run
+`configure --help' for more details.
+
diff --git a/Makefile.am b/Makefile.am
new file mode 100644
index 0000000..7975954
--- /dev/null
+++ b/Makefile.am
@@ -0,0 +1,43 @@
+ACLOCAL_AMFLAGS = ${ACLOCAL_FLAGS} -I m4
+AM_DISTCHECK_CONFIGURE_FLAGS="--enable-unit-tests"
+
+.PHONY: all
+
+if !BUILD_WITH_LIBDIVSUFSORT
+OPT_PSUFSORT = opt/psufsort
+endif
+
+SUBDIRS = . $(OPT_PSUFSORT) libs opt src docs
+DIST_SUBDIRS = . libs opt src docs test opt/psufsort
+
+# Conditionaly build the tests
+if BUILD_TESTS
+
+SUBDIRS+= test
+
+TESTS = test/test_esa test/test_seq test/test_extra.sh test/test_random.sh test/test_join.sh
+
+$(TESTS): src/andi
+# $(MAKE) -C test
+
+endif # BUILD_TESTS
+
+
+dist_noinst_DATA = README ChangeLog README.md
+dist_pdf_DATA = andi-manual.pdf
+
+# This is a small hack to satisfy both GitHub and the GNU coding style.
+README: README.md
+ cp README.md README
+
+
+# Recreate the changelog, when the version string changes.
+ChangeLog: configure.ac
+ echo "Missing Git" > ChangeLog;
+ if test -d $(srcdir)/.git; then \
+ which git && git log --stat --date=short --abbrev-commit | grep --invert-match '^ [[:alnum:].]' | git stripspace > ChangeLog; \
+ fi
+
+.PHONY: code-docs
+code-docs:
+ cd docs && $(MAKE) code-docs;
diff --git a/Makefile.in b/Makefile.in
new file mode 100644
index 0000000..d82aca3
--- /dev/null
+++ b/Makefile.in
@@ -0,0 +1,1208 @@
+# Makefile.in generated by automake 1.14.1 from Makefile.am.
+# @configure_input@
+
+# Copyright (C) 1994-2013 Free Software Foundation, Inc.
+
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+ at SET_MAKE@
+
+VPATH = @srcdir@
+am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
+am__make_running_with_option = \
+ case $${target_option-} in \
+ ?) ;; \
+ *) echo "am__make_running_with_option: internal error: invalid" \
+ "target option '$${target_option-}' specified" >&2; \
+ exit 1;; \
+ esac; \
+ has_opt=no; \
+ sane_makeflags=$$MAKEFLAGS; \
+ if $(am__is_gnu_make); then \
+ sane_makeflags=$$MFLAGS; \
+ else \
+ case $$MAKEFLAGS in \
+ *\\[\ \ ]*) \
+ bs=\\; \
+ sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
+ | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
+ esac; \
+ fi; \
+ skip_next=no; \
+ strip_trailopt () \
+ { \
+ flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
+ }; \
+ for flg in $$sane_makeflags; do \
+ test $$skip_next = yes && { skip_next=no; continue; }; \
+ case $$flg in \
+ *=*|--*) continue;; \
+ -*I) strip_trailopt 'I'; skip_next=yes;; \
+ -*I?*) strip_trailopt 'I';; \
+ -*O) strip_trailopt 'O'; skip_next=yes;; \
+ -*O?*) strip_trailopt 'O';; \
+ -*l) strip_trailopt 'l'; skip_next=yes;; \
+ -*l?*) strip_trailopt 'l';; \
+ -[dEDm]) skip_next=yes;; \
+ -[JT]) skip_next=yes;; \
+ esac; \
+ case $$flg in \
+ *$$target_option*) has_opt=yes; break;; \
+ esac; \
+ done; \
+ test $$has_opt = yes
+am__make_dryrun = (target_option=n; $(am__make_running_with_option))
+am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
+pkgdatadir = $(datadir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkglibexecdir = $(libexecdir)/@PACKAGE@
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+
+# Conditionaly build the tests
+ at BUILD_TESTS_TRUE@am__append_1 = test
+subdir = .
+DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
+ $(top_srcdir)/configure $(am__configure_deps) \
+ $(dist_noinst_DATA) $(dist_pdf_DATA) test-driver COPYING \
+ ChangeLog INSTALL README ar-lib compile depcomp install-sh \
+ missing
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+am__aclocal_m4_deps = $(top_srcdir)/m4/ax_cxx_compile_stdcxx_11.m4 \
+ $(top_srcdir)/configure.ac
+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
+ $(ACLOCAL_M4)
+am__CONFIG_DISTCLEAN_FILES = config.status config.cache config.log \
+ configure.lineno config.status.lineno
+mkinstalldirs = $(install_sh) -d
+CONFIG_HEADER = $(top_builddir)/src/config.h
+CONFIG_CLEAN_FILES =
+CONFIG_CLEAN_VPATH_FILES =
+AM_V_P = $(am__v_P_ at AM_V@)
+am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
+am__v_P_0 = false
+am__v_P_1 = :
+AM_V_GEN = $(am__v_GEN_ at AM_V@)
+am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
+am__v_GEN_0 = @echo " GEN " $@;
+am__v_GEN_1 =
+AM_V_at = $(am__v_at_ at AM_V@)
+am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
+am__v_at_0 = @
+am__v_at_1 =
+SOURCES =
+DIST_SOURCES =
+RECURSIVE_TARGETS = all-recursive check-recursive cscopelist-recursive \
+ ctags-recursive dvi-recursive html-recursive info-recursive \
+ install-data-recursive install-dvi-recursive \
+ install-exec-recursive install-html-recursive \
+ install-info-recursive install-pdf-recursive \
+ install-ps-recursive install-recursive installcheck-recursive \
+ installdirs-recursive pdf-recursive ps-recursive \
+ tags-recursive uninstall-recursive
+am__can_run_installinfo = \
+ case $$AM_UPDATE_INFO_DIR in \
+ n|no|NO) false;; \
+ *) (install-info --version) >/dev/null 2>&1;; \
+ esac
+am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`;
+am__vpath_adj = case $$p in \
+ $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \
+ *) f=$$p;; \
+ esac;
+am__strip_dir = f=`echo $$p | sed -e 's|^.*/||'`;
+am__install_max = 40
+am__nobase_strip_setup = \
+ srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*|]/\\\\&/g'`
+am__nobase_strip = \
+ for p in $$list; do echo "$$p"; done | sed -e "s|$$srcdirstrip/||"
+am__nobase_list = $(am__nobase_strip_setup); \
+ for p in $$list; do echo "$$p $$p"; done | \
+ sed "s| $$srcdirstrip/| |;"' / .*\//!s/ .*/ ./; s,\( .*\)/[^/]*$$,\1,' | \
+ $(AWK) 'BEGIN { files["."] = "" } { files[$$2] = files[$$2] " " $$1; \
+ if (++n[$$2] == $(am__install_max)) \
+ { print $$2, files[$$2]; n[$$2] = 0; files[$$2] = "" } } \
+ END { for (dir in files) print dir, files[dir] }'
+am__base_list = \
+ sed '$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;s/\n/ /g' | \
+ sed '$$!N;$$!N;$$!N;$$!N;s/\n/ /g'
+am__uninstall_files_from_dir = { \
+ test -z "$$files" \
+ || { test ! -d "$$dir" && test ! -f "$$dir" && test ! -r "$$dir"; } \
+ || { echo " ( cd '$$dir' && rm -f" $$files ")"; \
+ $(am__cd) "$$dir" && rm -f $$files; }; \
+ }
+am__installdirs = "$(DESTDIR)$(pdfdir)"
+DATA = $(dist_noinst_DATA) $(dist_pdf_DATA)
+RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive \
+ distclean-recursive maintainer-clean-recursive
+am__recursive_targets = \
+ $(RECURSIVE_TARGETS) \
+ $(RECURSIVE_CLEAN_TARGETS) \
+ $(am__extra_recursive_targets)
+AM_RECURSIVE_TARGETS = $(am__recursive_targets:-recursive=) TAGS CTAGS \
+ cscope check recheck distdir dist dist-all distcheck
+am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
+# Read a list of newline-separated strings from the standard input,
+# and print each of them once, without duplicates. Input order is
+# *not* preserved.
+am__uniquify_input = $(AWK) '\
+ BEGIN { nonempty = 0; } \
+ { items[$$0] = 1; nonempty = 1; } \
+ END { if (nonempty) { for (i in items) print i; }; } \
+'
+# Make sure the list of sources is unique. This is necessary because,
+# e.g., the same source file might be shared among _SOURCES variables
+# for different programs/libraries.
+am__define_uniq_tagged_files = \
+ list='$(am__tagged_files)'; \
+ unique=`for i in $$list; do \
+ if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+ done | $(am__uniquify_input)`
+ETAGS = etags
+CTAGS = ctags
+CSCOPE = cscope
+am__tty_colors_dummy = \
+ mgn= red= grn= lgn= blu= brg= std=; \
+ am__color_tests=no
+am__tty_colors = { \
+ $(am__tty_colors_dummy); \
+ if test "X$(AM_COLOR_TESTS)" = Xno; then \
+ am__color_tests=no; \
+ elif test "X$(AM_COLOR_TESTS)" = Xalways; then \
+ am__color_tests=yes; \
+ elif test "X$$TERM" != Xdumb && { test -t 1; } 2>/dev/null; then \
+ am__color_tests=yes; \
+ fi; \
+ if test $$am__color_tests = yes; then \
+ red='[0;31m'; \
+ grn='[0;32m'; \
+ lgn='[1;32m'; \
+ blu='[1;34m'; \
+ mgn='[0;35m'; \
+ brg='[1m'; \
+ std='[m'; \
+ fi; \
+}
+am__recheck_rx = ^[ ]*:recheck:[ ]*
+am__global_test_result_rx = ^[ ]*:global-test-result:[ ]*
+am__copy_in_global_log_rx = ^[ ]*:copy-in-global-log:[ ]*
+# A command that, given a newline-separated list of test names on the
+# standard input, print the name of the tests that are to be re-run
+# upon "make recheck".
+am__list_recheck_tests = $(AWK) '{ \
+ recheck = 1; \
+ while ((rc = (getline line < ($$0 ".trs"))) != 0) \
+ { \
+ if (rc < 0) \
+ { \
+ if ((getline line2 < ($$0 ".log")) < 0) \
+ recheck = 0; \
+ break; \
+ } \
+ else if (line ~ /$(am__recheck_rx)[nN][Oo]/) \
+ { \
+ recheck = 0; \
+ break; \
+ } \
+ else if (line ~ /$(am__recheck_rx)[yY][eE][sS]/) \
+ { \
+ break; \
+ } \
+ }; \
+ if (recheck) \
+ print $$0; \
+ close ($$0 ".trs"); \
+ close ($$0 ".log"); \
+}'
+# A command that, given a newline-separated list of test names on the
+# standard input, create the global log from their .trs and .log files.
+am__create_global_log = $(AWK) ' \
+function fatal(msg) \
+{ \
+ print "fatal: making $@: " msg | "cat >&2"; \
+ exit 1; \
+} \
+function rst_section(header) \
+{ \
+ print header; \
+ len = length(header); \
+ for (i = 1; i <= len; i = i + 1) \
+ printf "="; \
+ printf "\n\n"; \
+} \
+{ \
+ copy_in_global_log = 1; \
+ global_test_result = "RUN"; \
+ while ((rc = (getline line < ($$0 ".trs"))) != 0) \
+ { \
+ if (rc < 0) \
+ fatal("failed to read from " $$0 ".trs"); \
+ if (line ~ /$(am__global_test_result_rx)/) \
+ { \
+ sub("$(am__global_test_result_rx)", "", line); \
+ sub("[ ]*$$", "", line); \
+ global_test_result = line; \
+ } \
+ else if (line ~ /$(am__copy_in_global_log_rx)[nN][oO]/) \
+ copy_in_global_log = 0; \
+ }; \
+ if (copy_in_global_log) \
+ { \
+ rst_section(global_test_result ": " $$0); \
+ while ((rc = (getline line < ($$0 ".log"))) != 0) \
+ { \
+ if (rc < 0) \
+ fatal("failed to read from " $$0 ".log"); \
+ print line; \
+ }; \
+ printf "\n"; \
+ }; \
+ close ($$0 ".trs"); \
+ close ($$0 ".log"); \
+}'
+# Restructured Text title.
+am__rst_title = { sed 's/.*/ & /;h;s/./=/g;p;x;s/ *$$//;p;g' && echo; }
+# Solaris 10 'make', and several other traditional 'make' implementations,
+# pass "-e" to $(SHELL), and POSIX 2008 even requires this. Work around it
+# by disabling -e (using the XSI extension "set +e") if it's set.
+am__sh_e_setup = case $$- in *e*) set +e;; esac
+# Default flags passed to test drivers.
+am__common_driver_flags = \
+ --color-tests "$$am__color_tests" \
+ --enable-hard-errors "$$am__enable_hard_errors" \
+ --expect-failure "$$am__expect_failure"
+# To be inserted before the command running the test. Creates the
+# directory for the log if needed. Stores in $dir the directory
+# containing $f, in $tst the test, in $log the log. Executes the
+# developer- defined test setup AM_TESTS_ENVIRONMENT (if any), and
+# passes TESTS_ENVIRONMENT. Set up options for the wrapper that
+# will run the test scripts (or their associated LOG_COMPILER, if
+# thy have one).
+am__check_pre = \
+$(am__sh_e_setup); \
+$(am__vpath_adj_setup) $(am__vpath_adj) \
+$(am__tty_colors); \
+srcdir=$(srcdir); export srcdir; \
+case "$@" in \
+ */*) am__odir=`echo "./$@" | sed 's|/[^/]*$$||'`;; \
+ *) am__odir=.;; \
+esac; \
+test "x$$am__odir" = x"." || test -d "$$am__odir" \
+ || $(MKDIR_P) "$$am__odir" || exit $$?; \
+if test -f "./$$f"; then dir=./; \
+elif test -f "$$f"; then dir=; \
+else dir="$(srcdir)/"; fi; \
+tst=$$dir$$f; log='$@'; \
+if test -n '$(DISABLE_HARD_ERRORS)'; then \
+ am__enable_hard_errors=no; \
+else \
+ am__enable_hard_errors=yes; \
+fi; \
+case " $(XFAIL_TESTS) " in \
+ *[\ \ ]$$f[\ \ ]* | *[\ \ ]$$dir$$f[\ \ ]*) \
+ am__expect_failure=yes;; \
+ *) \
+ am__expect_failure=no;; \
+esac; \
+$(AM_TESTS_ENVIRONMENT) $(TESTS_ENVIRONMENT)
+# A shell command to get the names of the tests scripts with any registered
+# extension removed (i.e., equivalently, the names of the test logs, with
+# the '.log' extension removed). The result is saved in the shell variable
+# '$bases'. This honors runtime overriding of TESTS and TEST_LOGS. Sadly,
+# we cannot use something simpler, involving e.g., "$(TEST_LOGS:.log=)",
+# since that might cause problem with VPATH rewrites for suffix-less tests.
+# See also 'test-harness-vpath-rewrite.sh' and 'test-trs-basic.sh'.
+am__set_TESTS_bases = \
+ bases='$(TEST_LOGS)'; \
+ bases=`for i in $$bases; do echo $$i; done | sed 's/\.log$$//'`; \
+ bases=`echo $$bases`
+RECHECK_LOGS = $(TEST_LOGS)
+TEST_SUITE_LOG = test-suite.log
+TEST_EXTENSIONS = @EXEEXT@ .test
+LOG_DRIVER = $(SHELL) $(top_srcdir)/test-driver
+LOG_COMPILE = $(LOG_COMPILER) $(AM_LOG_FLAGS) $(LOG_FLAGS)
+am__set_b = \
+ case '$@' in \
+ */*) \
+ case '$*' in \
+ */*) b='$*';; \
+ *) b=`echo '$@' | sed 's/\.log$$//'`; \
+ esac;; \
+ *) \
+ b='$*';; \
+ esac
+am__test_logs1 = $(TESTS:=.log)
+am__test_logs2 = $(am__test_logs1:@EXEEXT at .log=.log)
+TEST_LOGS = $(am__test_logs2:.test.log=.log)
+TEST_LOG_DRIVER = $(SHELL) $(top_srcdir)/test-driver
+TEST_LOG_COMPILE = $(TEST_LOG_COMPILER) $(AM_TEST_LOG_FLAGS) \
+ $(TEST_LOG_FLAGS)
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+distdir = $(PACKAGE)-$(VERSION)
+top_distdir = $(distdir)
+am__remove_distdir = \
+ if test -d "$(distdir)"; then \
+ find "$(distdir)" -type d ! -perm -200 -exec chmod u+w {} ';' \
+ && rm -rf "$(distdir)" \
+ || { sleep 5 && rm -rf "$(distdir)"; }; \
+ else :; fi
+am__post_remove_distdir = $(am__remove_distdir)
+am__relativize = \
+ dir0=`pwd`; \
+ sed_first='s,^\([^/]*\)/.*$$,\1,'; \
+ sed_rest='s,^[^/]*/*,,'; \
+ sed_last='s,^.*/\([^/]*\)$$,\1,'; \
+ sed_butlast='s,/*[^/]*$$,,'; \
+ while test -n "$$dir1"; do \
+ first=`echo "$$dir1" | sed -e "$$sed_first"`; \
+ if test "$$first" != "."; then \
+ if test "$$first" = ".."; then \
+ dir2=`echo "$$dir0" | sed -e "$$sed_last"`/"$$dir2"; \
+ dir0=`echo "$$dir0" | sed -e "$$sed_butlast"`; \
+ else \
+ first2=`echo "$$dir2" | sed -e "$$sed_first"`; \
+ if test "$$first2" = "$$first"; then \
+ dir2=`echo "$$dir2" | sed -e "$$sed_rest"`; \
+ else \
+ dir2="../$$dir2"; \
+ fi; \
+ dir0="$$dir0"/"$$first"; \
+ fi; \
+ fi; \
+ dir1=`echo "$$dir1" | sed -e "$$sed_rest"`; \
+ done; \
+ reldir="$$dir2"
+DIST_ARCHIVES = $(distdir).tar.gz
+GZIP_ENV = --best
+DIST_TARGETS = dist-gzip
+distuninstallcheck_listfiles = find . -type f -print
+am__distuninstallcheck_listfiles = $(distuninstallcheck_listfiles) \
+ | sed 's|^\./|$(prefix)/|' | grep -v '$(infodir)/dir$$'
+distcleancheck_listfiles = find . -type f -print
+ACLOCAL = @ACLOCAL@
+AMTAR = @AMTAR@
+AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
+AR = @AR@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CXX = @CXX@
+CXXDEPMODE = @CXXDEPMODE@
+CXXFLAGS = @CXXFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+EXEEXT = @EXEEXT@
+GLIB_CFLAGS = @GLIB_CFLAGS@
+GLIB_LIBS = @GLIB_LIBS@
+GREP = @GREP@
+HAVE_CXX11 = @HAVE_CXX11@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+MKDIR_P = @MKDIR_P@
+OBJEXT = @OBJEXT@
+OPENMP_CFLAGS = @OPENMP_CFLAGS@
+OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+PKG_CONFIG = @PKG_CONFIG@
+PKG_CONFIG_LIBDIR = @PKG_CONFIG_LIBDIR@
+PKG_CONFIG_PATH = @PKG_CONFIG_PATH@
+RANLIB = @RANLIB@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
+ac_ct_AR = @ac_ct_AR@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_CXX = @ac_ct_CXX@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+am__tar = @am__tar@
+am__untar = @am__untar@
+bindir = @bindir@
+build_alias = @build_alias@
+builddir = @builddir@
+datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
+exec_prefix = @exec_prefix@
+host_alias = @host_alias@
+htmldir = @htmldir@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localedir = @localedir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+mkdir_p = @mkdir_p@
+oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+psdir = @psdir@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+top_build_prefix = @top_build_prefix@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
+ACLOCAL_AMFLAGS = ${ACLOCAL_FLAGS} -I m4
+AM_DISTCHECK_CONFIGURE_FLAGS = "--enable-unit-tests"
+ at BUILD_WITH_LIBDIVSUFSORT_FALSE@OPT_PSUFSORT = opt/psufsort
+SUBDIRS = . $(OPT_PSUFSORT) libs opt src docs $(am__append_1)
+DIST_SUBDIRS = . libs opt src docs test opt/psufsort
+ at BUILD_TESTS_TRUE@TESTS = test/test_esa test/test_seq test/test_extra.sh test/test_random.sh test/test_join.sh
+# $(MAKE) -C test
+dist_noinst_DATA = README ChangeLog README.md
+dist_pdf_DATA = andi-manual.pdf
+all: all-recursive
+
+.SUFFIXES:
+.SUFFIXES: .log .test .test$(EXEEXT) .trs
+am--refresh: Makefile
+ @:
+$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
+ @for dep in $?; do \
+ case '$(am__configure_deps)' in \
+ *$$dep*) \
+ echo ' cd $(srcdir) && $(AUTOMAKE) --foreign'; \
+ $(am__cd) $(srcdir) && $(AUTOMAKE) --foreign \
+ && exit 0; \
+ exit 1;; \
+ esac; \
+ done; \
+ echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Makefile'; \
+ $(am__cd) $(top_srcdir) && \
+ $(AUTOMAKE) --foreign Makefile
+.PRECIOUS: Makefile
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+ @case '$?' in \
+ *config.status*) \
+ echo ' $(SHELL) ./config.status'; \
+ $(SHELL) ./config.status;; \
+ *) \
+ echo ' cd $(top_builddir) && $(SHELL) ./config.status $@ $(am__depfiles_maybe)'; \
+ cd $(top_builddir) && $(SHELL) ./config.status $@ $(am__depfiles_maybe);; \
+ esac;
+
+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+ $(SHELL) ./config.status --recheck
+
+$(top_srcdir)/configure: $(am__configure_deps)
+ $(am__cd) $(srcdir) && $(AUTOCONF)
+$(ACLOCAL_M4): $(am__aclocal_m4_deps)
+ $(am__cd) $(srcdir) && $(ACLOCAL) $(ACLOCAL_AMFLAGS)
+$(am__aclocal_m4_deps):
+install-dist_pdfDATA: $(dist_pdf_DATA)
+ @$(NORMAL_INSTALL)
+ @list='$(dist_pdf_DATA)'; test -n "$(pdfdir)" || list=; \
+ if test -n "$$list"; then \
+ echo " $(MKDIR_P) '$(DESTDIR)$(pdfdir)'"; \
+ $(MKDIR_P) "$(DESTDIR)$(pdfdir)" || exit 1; \
+ fi; \
+ for p in $$list; do \
+ if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
+ echo "$$d$$p"; \
+ done | $(am__base_list) | \
+ while read files; do \
+ echo " $(INSTALL_DATA) $$files '$(DESTDIR)$(pdfdir)'"; \
+ $(INSTALL_DATA) $$files "$(DESTDIR)$(pdfdir)" || exit $$?; \
+ done
+
+uninstall-dist_pdfDATA:
+ @$(NORMAL_UNINSTALL)
+ @list='$(dist_pdf_DATA)'; test -n "$(pdfdir)" || list=; \
+ files=`for p in $$list; do echo $$p; done | sed -e 's|^.*/||'`; \
+ dir='$(DESTDIR)$(pdfdir)'; $(am__uninstall_files_from_dir)
+
+# This directory's subdirectories are mostly independent; you can cd
+# into them and run 'make' without going through this Makefile.
+# To change the values of 'make' variables: instead of editing Makefiles,
+# (1) if the variable is set in 'config.status', edit 'config.status'
+# (which will cause the Makefiles to be regenerated when you run 'make');
+# (2) otherwise, pass the desired values on the 'make' command line.
+$(am__recursive_targets):
+ @fail=; \
+ if $(am__make_keepgoing); then \
+ failcom='fail=yes'; \
+ else \
+ failcom='exit 1'; \
+ fi; \
+ dot_seen=no; \
+ target=`echo $@ | sed s/-recursive//`; \
+ case "$@" in \
+ distclean-* | maintainer-clean-*) list='$(DIST_SUBDIRS)' ;; \
+ *) list='$(SUBDIRS)' ;; \
+ esac; \
+ for subdir in $$list; do \
+ echo "Making $$target in $$subdir"; \
+ if test "$$subdir" = "."; then \
+ dot_seen=yes; \
+ local_target="$$target-am"; \
+ else \
+ local_target="$$target"; \
+ fi; \
+ ($(am__cd) $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \
+ || eval $$failcom; \
+ done; \
+ if test "$$dot_seen" = "no"; then \
+ $(MAKE) $(AM_MAKEFLAGS) "$$target-am" || exit 1; \
+ fi; test -z "$$fail"
+
+ID: $(am__tagged_files)
+ $(am__define_uniq_tagged_files); mkid -fID $$unique
+tags: tags-recursive
+TAGS: tags
+
+tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ set x; \
+ here=`pwd`; \
+ if ($(ETAGS) --etags-include --version) >/dev/null 2>&1; then \
+ include_option=--etags-include; \
+ empty_fix=.; \
+ else \
+ include_option=--include; \
+ empty_fix=; \
+ fi; \
+ list='$(SUBDIRS)'; for subdir in $$list; do \
+ if test "$$subdir" = .; then :; else \
+ test ! -f $$subdir/TAGS || \
+ set "$$@" "$$include_option=$$here/$$subdir/TAGS"; \
+ fi; \
+ done; \
+ $(am__define_uniq_tagged_files); \
+ shift; \
+ if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
+ test -n "$$unique" || unique=$$empty_fix; \
+ if test $$# -gt 0; then \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ "$$@" $$unique; \
+ else \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ $$unique; \
+ fi; \
+ fi
+ctags: ctags-recursive
+
+CTAGS: ctags
+ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ $(am__define_uniq_tagged_files); \
+ test -z "$(CTAGS_ARGS)$$unique" \
+ || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
+ $$unique
+
+GTAGS:
+ here=`$(am__cd) $(top_builddir) && pwd` \
+ && $(am__cd) $(top_srcdir) \
+ && gtags -i $(GTAGS_ARGS) "$$here"
+cscope: cscope.files
+ test ! -s cscope.files \
+ || $(CSCOPE) -b -q $(AM_CSCOPEFLAGS) $(CSCOPEFLAGS) -i cscope.files $(CSCOPE_ARGS)
+clean-cscope:
+ -rm -f cscope.files
+cscope.files: clean-cscope cscopelist
+cscopelist: cscopelist-recursive
+
+cscopelist-am: $(am__tagged_files)
+ list='$(am__tagged_files)'; \
+ case "$(srcdir)" in \
+ [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
+ *) sdir=$(subdir)/$(srcdir) ;; \
+ esac; \
+ for i in $$list; do \
+ if test -f "$$i"; then \
+ echo "$(subdir)/$$i"; \
+ else \
+ echo "$$sdir/$$i"; \
+ fi; \
+ done >> $(top_builddir)/cscope.files
+
+distclean-tags:
+ -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
+ -rm -f cscope.out cscope.in.out cscope.po.out cscope.files
+
+# Recover from deleted '.trs' file; this should ensure that
+# "rm -f foo.log; make foo.trs" re-run 'foo.test', and re-create
+# both 'foo.log' and 'foo.trs'. Break the recipe in two subshells
+# to avoid problems with "make -n".
+.log.trs:
+ rm -f $< $@
+ $(MAKE) $(AM_MAKEFLAGS) $<
+
+# Leading 'am--fnord' is there to ensure the list of targets does not
+# expand to empty, as could happen e.g. with make check TESTS=''.
+am--fnord $(TEST_LOGS) $(TEST_LOGS:.log=.trs): $(am__force_recheck)
+am--force-recheck:
+ @:
+
+$(TEST_SUITE_LOG): $(TEST_LOGS)
+ @$(am__set_TESTS_bases); \
+ am__f_ok () { test -f "$$1" && test -r "$$1"; }; \
+ redo_bases=`for i in $$bases; do \
+ am__f_ok $$i.trs && am__f_ok $$i.log || echo $$i; \
+ done`; \
+ if test -n "$$redo_bases"; then \
+ redo_logs=`for i in $$redo_bases; do echo $$i.log; done`; \
+ redo_results=`for i in $$redo_bases; do echo $$i.trs; done`; \
+ if $(am__make_dryrun); then :; else \
+ rm -f $$redo_logs && rm -f $$redo_results || exit 1; \
+ fi; \
+ fi; \
+ if test -n "$$am__remaking_logs"; then \
+ echo "fatal: making $(TEST_SUITE_LOG): possible infinite" \
+ "recursion detected" >&2; \
+ else \
+ am__remaking_logs=yes $(MAKE) $(AM_MAKEFLAGS) $$redo_logs; \
+ fi; \
+ if $(am__make_dryrun); then :; else \
+ st=0; \
+ errmsg="fatal: making $(TEST_SUITE_LOG): failed to create"; \
+ for i in $$redo_bases; do \
+ test -f $$i.trs && test -r $$i.trs \
+ || { echo "$$errmsg $$i.trs" >&2; st=1; }; \
+ test -f $$i.log && test -r $$i.log \
+ || { echo "$$errmsg $$i.log" >&2; st=1; }; \
+ done; \
+ test $$st -eq 0 || exit 1; \
+ fi
+ @$(am__sh_e_setup); $(am__tty_colors); $(am__set_TESTS_bases); \
+ ws='[ ]'; \
+ results=`for b in $$bases; do echo $$b.trs; done`; \
+ test -n "$$results" || results=/dev/null; \
+ all=` grep "^$$ws*:test-result:" $$results | wc -l`; \
+ pass=` grep "^$$ws*:test-result:$$ws*PASS" $$results | wc -l`; \
+ fail=` grep "^$$ws*:test-result:$$ws*FAIL" $$results | wc -l`; \
+ skip=` grep "^$$ws*:test-result:$$ws*SKIP" $$results | wc -l`; \
+ xfail=`grep "^$$ws*:test-result:$$ws*XFAIL" $$results | wc -l`; \
+ xpass=`grep "^$$ws*:test-result:$$ws*XPASS" $$results | wc -l`; \
+ error=`grep "^$$ws*:test-result:$$ws*ERROR" $$results | wc -l`; \
+ if test `expr $$fail + $$xpass + $$error` -eq 0; then \
+ success=true; \
+ else \
+ success=false; \
+ fi; \
+ br='==================='; br=$$br$$br$$br$$br; \
+ result_count () \
+ { \
+ if test x"$$1" = x"--maybe-color"; then \
+ maybe_colorize=yes; \
+ elif test x"$$1" = x"--no-color"; then \
+ maybe_colorize=no; \
+ else \
+ echo "$@: invalid 'result_count' usage" >&2; exit 4; \
+ fi; \
+ shift; \
+ desc=$$1 count=$$2; \
+ if test $$maybe_colorize = yes && test $$count -gt 0; then \
+ color_start=$$3 color_end=$$std; \
+ else \
+ color_start= color_end=; \
+ fi; \
+ echo "$${color_start}# $$desc $$count$${color_end}"; \
+ }; \
+ create_testsuite_report () \
+ { \
+ result_count $$1 "TOTAL:" $$all "$$brg"; \
+ result_count $$1 "PASS: " $$pass "$$grn"; \
+ result_count $$1 "SKIP: " $$skip "$$blu"; \
+ result_count $$1 "XFAIL:" $$xfail "$$lgn"; \
+ result_count $$1 "FAIL: " $$fail "$$red"; \
+ result_count $$1 "XPASS:" $$xpass "$$red"; \
+ result_count $$1 "ERROR:" $$error "$$mgn"; \
+ }; \
+ { \
+ echo "$(PACKAGE_STRING): $(subdir)/$(TEST_SUITE_LOG)" | \
+ $(am__rst_title); \
+ create_testsuite_report --no-color; \
+ echo; \
+ echo ".. contents:: :depth: 2"; \
+ echo; \
+ for b in $$bases; do echo $$b; done \
+ | $(am__create_global_log); \
+ } >$(TEST_SUITE_LOG).tmp || exit 1; \
+ mv $(TEST_SUITE_LOG).tmp $(TEST_SUITE_LOG); \
+ if $$success; then \
+ col="$$grn"; \
+ else \
+ col="$$red"; \
+ test x"$$VERBOSE" = x || cat $(TEST_SUITE_LOG); \
+ fi; \
+ echo "$${col}$$br$${std}"; \
+ echo "$${col}Testsuite summary for $(PACKAGE_STRING)$${std}"; \
+ echo "$${col}$$br$${std}"; \
+ create_testsuite_report --maybe-color; \
+ echo "$$col$$br$$std"; \
+ if $$success; then :; else \
+ echo "$${col}See $(subdir)/$(TEST_SUITE_LOG)$${std}"; \
+ if test -n "$(PACKAGE_BUGREPORT)"; then \
+ echo "$${col}Please report to $(PACKAGE_BUGREPORT)$${std}"; \
+ fi; \
+ echo "$$col$$br$$std"; \
+ fi; \
+ $$success || exit 1
+
+check-TESTS:
+ @list='$(RECHECK_LOGS)'; test -z "$$list" || rm -f $$list
+ @list='$(RECHECK_LOGS:.log=.trs)'; test -z "$$list" || rm -f $$list
+ @test -z "$(TEST_SUITE_LOG)" || rm -f $(TEST_SUITE_LOG)
+ @set +e; $(am__set_TESTS_bases); \
+ log_list=`for i in $$bases; do echo $$i.log; done`; \
+ trs_list=`for i in $$bases; do echo $$i.trs; done`; \
+ log_list=`echo $$log_list`; trs_list=`echo $$trs_list`; \
+ $(MAKE) $(AM_MAKEFLAGS) $(TEST_SUITE_LOG) TEST_LOGS="$$log_list"; \
+ exit $$?;
+recheck: all
+ @test -z "$(TEST_SUITE_LOG)" || rm -f $(TEST_SUITE_LOG)
+ @set +e; $(am__set_TESTS_bases); \
+ bases=`for i in $$bases; do echo $$i; done \
+ | $(am__list_recheck_tests)` || exit 1; \
+ log_list=`for i in $$bases; do echo $$i.log; done`; \
+ log_list=`echo $$log_list`; \
+ $(MAKE) $(AM_MAKEFLAGS) $(TEST_SUITE_LOG) \
+ am__force_recheck=am--force-recheck \
+ TEST_LOGS="$$log_list"; \
+ exit $$?
+test/test_esa.log: test/test_esa
+ @p='test/test_esa'; \
+ b='test/test_esa'; \
+ $(am__check_pre) $(LOG_DRIVER) --test-name "$$f" \
+ --log-file $$b.log --trs-file $$b.trs \
+ $(am__common_driver_flags) $(AM_LOG_DRIVER_FLAGS) $(LOG_DRIVER_FLAGS) -- $(LOG_COMPILE) \
+ "$$tst" $(AM_TESTS_FD_REDIRECT)
+test/test_seq.log: test/test_seq
+ @p='test/test_seq'; \
+ b='test/test_seq'; \
+ $(am__check_pre) $(LOG_DRIVER) --test-name "$$f" \
+ --log-file $$b.log --trs-file $$b.trs \
+ $(am__common_driver_flags) $(AM_LOG_DRIVER_FLAGS) $(LOG_DRIVER_FLAGS) -- $(LOG_COMPILE) \
+ "$$tst" $(AM_TESTS_FD_REDIRECT)
+test/test_extra.sh.log: test/test_extra.sh
+ @p='test/test_extra.sh'; \
+ b='test/test_extra.sh'; \
+ $(am__check_pre) $(LOG_DRIVER) --test-name "$$f" \
+ --log-file $$b.log --trs-file $$b.trs \
+ $(am__common_driver_flags) $(AM_LOG_DRIVER_FLAGS) $(LOG_DRIVER_FLAGS) -- $(LOG_COMPILE) \
+ "$$tst" $(AM_TESTS_FD_REDIRECT)
+test/test_random.sh.log: test/test_random.sh
+ @p='test/test_random.sh'; \
+ b='test/test_random.sh'; \
+ $(am__check_pre) $(LOG_DRIVER) --test-name "$$f" \
+ --log-file $$b.log --trs-file $$b.trs \
+ $(am__common_driver_flags) $(AM_LOG_DRIVER_FLAGS) $(LOG_DRIVER_FLAGS) -- $(LOG_COMPILE) \
+ "$$tst" $(AM_TESTS_FD_REDIRECT)
+test/test_join.sh.log: test/test_join.sh
+ @p='test/test_join.sh'; \
+ b='test/test_join.sh'; \
+ $(am__check_pre) $(LOG_DRIVER) --test-name "$$f" \
+ --log-file $$b.log --trs-file $$b.trs \
+ $(am__common_driver_flags) $(AM_LOG_DRIVER_FLAGS) $(LOG_DRIVER_FLAGS) -- $(LOG_COMPILE) \
+ "$$tst" $(AM_TESTS_FD_REDIRECT)
+.test.log:
+ @p='$<'; \
+ $(am__set_b); \
+ $(am__check_pre) $(TEST_LOG_DRIVER) --test-name "$$f" \
+ --log-file $$b.log --trs-file $$b.trs \
+ $(am__common_driver_flags) $(AM_TEST_LOG_DRIVER_FLAGS) $(TEST_LOG_DRIVER_FLAGS) -- $(TEST_LOG_COMPILE) \
+ "$$tst" $(AM_TESTS_FD_REDIRECT)
+ at am__EXEEXT_TRUE@.test$(EXEEXT).log:
+ at am__EXEEXT_TRUE@ @p='$<'; \
+ at am__EXEEXT_TRUE@ $(am__set_b); \
+ at am__EXEEXT_TRUE@ $(am__check_pre) $(TEST_LOG_DRIVER) --test-name "$$f" \
+ at am__EXEEXT_TRUE@ --log-file $$b.log --trs-file $$b.trs \
+ at am__EXEEXT_TRUE@ $(am__common_driver_flags) $(AM_TEST_LOG_DRIVER_FLAGS) $(TEST_LOG_DRIVER_FLAGS) -- $(TEST_LOG_COMPILE) \
+ at am__EXEEXT_TRUE@ "$$tst" $(AM_TESTS_FD_REDIRECT)
+
+distdir: $(DISTFILES)
+ $(am__remove_distdir)
+ test -d "$(distdir)" || mkdir "$(distdir)"
+ @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ list='$(DISTFILES)'; \
+ dist_files=`for file in $$list; do echo $$file; done | \
+ sed -e "s|^$$srcdirstrip/||;t" \
+ -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+ case $$dist_files in \
+ */*) $(MKDIR_P) `echo "$$dist_files" | \
+ sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+ sort -u` ;; \
+ esac; \
+ for file in $$dist_files; do \
+ if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+ if test -d $$d/$$file; then \
+ dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
+ if test -d "$(distdir)/$$file"; then \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+ cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
+ else \
+ test -f "$(distdir)/$$file" \
+ || cp -p $$d/$$file "$(distdir)/$$file" \
+ || exit 1; \
+ fi; \
+ done
+ @list='$(DIST_SUBDIRS)'; for subdir in $$list; do \
+ if test "$$subdir" = .; then :; else \
+ $(am__make_dryrun) \
+ || test -d "$(distdir)/$$subdir" \
+ || $(MKDIR_P) "$(distdir)/$$subdir" \
+ || exit 1; \
+ dir1=$$subdir; dir2="$(distdir)/$$subdir"; \
+ $(am__relativize); \
+ new_distdir=$$reldir; \
+ dir1=$$subdir; dir2="$(top_distdir)"; \
+ $(am__relativize); \
+ new_top_distdir=$$reldir; \
+ echo " (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) top_distdir="$$new_top_distdir" distdir="$$new_distdir" \\"; \
+ echo " am__remove_distdir=: am__skip_length_check=: am__skip_mode_fix=: distdir)"; \
+ ($(am__cd) $$subdir && \
+ $(MAKE) $(AM_MAKEFLAGS) \
+ top_distdir="$$new_top_distdir" \
+ distdir="$$new_distdir" \
+ am__remove_distdir=: \
+ am__skip_length_check=: \
+ am__skip_mode_fix=: \
+ distdir) \
+ || exit 1; \
+ fi; \
+ done
+ -test -n "$(am__skip_mode_fix)" \
+ || find "$(distdir)" -type d ! -perm -755 \
+ -exec chmod u+rwx,go+rx {} \; -o \
+ ! -type d ! -perm -444 -links 1 -exec chmod a+r {} \; -o \
+ ! -type d ! -perm -400 -exec chmod a+r {} \; -o \
+ ! -type d ! -perm -444 -exec $(install_sh) -c -m a+r {} {} \; \
+ || chmod -R a+r "$(distdir)"
+dist-gzip: distdir
+ tardir=$(distdir) && $(am__tar) | GZIP=$(GZIP_ENV) gzip -c >$(distdir).tar.gz
+ $(am__post_remove_distdir)
+
+dist-bzip2: distdir
+ tardir=$(distdir) && $(am__tar) | BZIP2=$${BZIP2--9} bzip2 -c >$(distdir).tar.bz2
+ $(am__post_remove_distdir)
+
+dist-lzip: distdir
+ tardir=$(distdir) && $(am__tar) | lzip -c $${LZIP_OPT--9} >$(distdir).tar.lz
+ $(am__post_remove_distdir)
+
+dist-xz: distdir
+ tardir=$(distdir) && $(am__tar) | XZ_OPT=$${XZ_OPT--e} xz -c >$(distdir).tar.xz
+ $(am__post_remove_distdir)
+
+dist-tarZ: distdir
+ @echo WARNING: "Support for shar distribution archives is" \
+ "deprecated." >&2
+ @echo WARNING: "It will be removed altogether in Automake 2.0" >&2
+ tardir=$(distdir) && $(am__tar) | compress -c >$(distdir).tar.Z
+ $(am__post_remove_distdir)
+
+dist-shar: distdir
+ @echo WARNING: "Support for distribution archives compressed with" \
+ "legacy program 'compress' is deprecated." >&2
+ @echo WARNING: "It will be removed altogether in Automake 2.0" >&2
+ shar $(distdir) | GZIP=$(GZIP_ENV) gzip -c >$(distdir).shar.gz
+ $(am__post_remove_distdir)
+
+dist-zip: distdir
+ -rm -f $(distdir).zip
+ zip -rq $(distdir).zip $(distdir)
+ $(am__post_remove_distdir)
+
+dist dist-all:
+ $(MAKE) $(AM_MAKEFLAGS) $(DIST_TARGETS) am__post_remove_distdir='@:'
+ $(am__post_remove_distdir)
+
+# This target untars the dist file and tries a VPATH configuration. Then
+# it guarantees that the distribution is self-contained by making another
+# tarfile.
+distcheck: dist
+ case '$(DIST_ARCHIVES)' in \
+ *.tar.gz*) \
+ GZIP=$(GZIP_ENV) gzip -dc $(distdir).tar.gz | $(am__untar) ;;\
+ *.tar.bz2*) \
+ bzip2 -dc $(distdir).tar.bz2 | $(am__untar) ;;\
+ *.tar.lz*) \
+ lzip -dc $(distdir).tar.lz | $(am__untar) ;;\
+ *.tar.xz*) \
+ xz -dc $(distdir).tar.xz | $(am__untar) ;;\
+ *.tar.Z*) \
+ uncompress -c $(distdir).tar.Z | $(am__untar) ;;\
+ *.shar.gz*) \
+ GZIP=$(GZIP_ENV) gzip -dc $(distdir).shar.gz | unshar ;;\
+ *.zip*) \
+ unzip $(distdir).zip ;;\
+ esac
+ chmod -R a-w $(distdir)
+ chmod u+w $(distdir)
+ mkdir $(distdir)/_build $(distdir)/_inst
+ chmod a-w $(distdir)
+ test -d $(distdir)/_build || exit 0; \
+ dc_install_base=`$(am__cd) $(distdir)/_inst && pwd | sed -e 's,^[^:\\/]:[\\/],/,'` \
+ && dc_destdir="$${TMPDIR-/tmp}/am-dc-$$$$/" \
+ && am__cwd=`pwd` \
+ && $(am__cd) $(distdir)/_build \
+ && ../configure \
+ $(AM_DISTCHECK_CONFIGURE_FLAGS) \
+ $(DISTCHECK_CONFIGURE_FLAGS) \
+ --srcdir=.. --prefix="$$dc_install_base" \
+ && $(MAKE) $(AM_MAKEFLAGS) \
+ && $(MAKE) $(AM_MAKEFLAGS) dvi \
+ && $(MAKE) $(AM_MAKEFLAGS) check \
+ && $(MAKE) $(AM_MAKEFLAGS) install \
+ && $(MAKE) $(AM_MAKEFLAGS) installcheck \
+ && $(MAKE) $(AM_MAKEFLAGS) uninstall \
+ && $(MAKE) $(AM_MAKEFLAGS) distuninstallcheck_dir="$$dc_install_base" \
+ distuninstallcheck \
+ && chmod -R a-w "$$dc_install_base" \
+ && ({ \
+ (cd ../.. && umask 077 && mkdir "$$dc_destdir") \
+ && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" install \
+ && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" uninstall \
+ && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" \
+ distuninstallcheck_dir="$$dc_destdir" distuninstallcheck; \
+ } || { rm -rf "$$dc_destdir"; exit 1; }) \
+ && rm -rf "$$dc_destdir" \
+ && $(MAKE) $(AM_MAKEFLAGS) dist \
+ && rm -rf $(DIST_ARCHIVES) \
+ && $(MAKE) $(AM_MAKEFLAGS) distcleancheck \
+ && cd "$$am__cwd" \
+ || exit 1
+ $(am__post_remove_distdir)
+ @(echo "$(distdir) archives ready for distribution: "; \
+ list='$(DIST_ARCHIVES)'; for i in $$list; do echo $$i; done) | \
+ sed -e 1h -e 1s/./=/g -e 1p -e 1x -e '$$p' -e '$$x'
+distuninstallcheck:
+ @test -n '$(distuninstallcheck_dir)' || { \
+ echo 'ERROR: trying to run $@ with an empty' \
+ '$$(distuninstallcheck_dir)' >&2; \
+ exit 1; \
+ }; \
+ $(am__cd) '$(distuninstallcheck_dir)' || { \
+ echo 'ERROR: cannot chdir into $(distuninstallcheck_dir)' >&2; \
+ exit 1; \
+ }; \
+ test `$(am__distuninstallcheck_listfiles) | wc -l` -eq 0 \
+ || { echo "ERROR: files left after uninstall:" ; \
+ if test -n "$(DESTDIR)"; then \
+ echo " (check DESTDIR support)"; \
+ fi ; \
+ $(distuninstallcheck_listfiles) ; \
+ exit 1; } >&2
+distcleancheck: distclean
+ @if test '$(srcdir)' = . ; then \
+ echo "ERROR: distcleancheck can only run from a VPATH build" ; \
+ exit 1 ; \
+ fi
+ @test `$(distcleancheck_listfiles) | wc -l` -eq 0 \
+ || { echo "ERROR: files left in build directory after distclean:" ; \
+ $(distcleancheck_listfiles) ; \
+ exit 1; } >&2
+check-am: all-am
+ $(MAKE) $(AM_MAKEFLAGS) check-TESTS
+check: check-recursive
+all-am: Makefile $(DATA)
+installdirs: installdirs-recursive
+installdirs-am:
+ for dir in "$(DESTDIR)$(pdfdir)"; do \
+ test -z "$$dir" || $(MKDIR_P) "$$dir"; \
+ done
+install: install-recursive
+install-exec: install-exec-recursive
+install-data: install-data-recursive
+uninstall: uninstall-recursive
+
+install-am: all-am
+ @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-recursive
+install-strip:
+ if test -z '$(STRIP)'; then \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ install; \
+ else \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+ fi
+mostlyclean-generic:
+ -test -z "$(TEST_LOGS)" || rm -f $(TEST_LOGS)
+ -test -z "$(TEST_LOGS:.log=.trs)" || rm -f $(TEST_LOGS:.log=.trs)
+ -test -z "$(TEST_SUITE_LOG)" || rm -f $(TEST_SUITE_LOG)
+
+clean-generic:
+
+distclean-generic:
+ -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
+ -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
+
+maintainer-clean-generic:
+ @echo "This command is intended for maintainers to use"
+ @echo "it deletes files that may require special tools to rebuild."
+clean: clean-recursive
+
+clean-am: clean-generic mostlyclean-am
+
+distclean: distclean-recursive
+ -rm -f $(am__CONFIG_DISTCLEAN_FILES)
+ -rm -f Makefile
+distclean-am: clean-am distclean-generic distclean-tags
+
+dvi: dvi-recursive
+
+dvi-am:
+
+html: html-recursive
+
+html-am:
+
+info: info-recursive
+
+info-am:
+
+install-data-am: install-dist_pdfDATA
+
+install-dvi: install-dvi-recursive
+
+install-dvi-am:
+
+install-exec-am:
+
+install-html: install-html-recursive
+
+install-html-am:
+
+install-info: install-info-recursive
+
+install-info-am:
+
+install-man:
+
+install-pdf: install-pdf-recursive
+
+install-pdf-am:
+
+install-ps: install-ps-recursive
+
+install-ps-am:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-recursive
+ -rm -f $(am__CONFIG_DISTCLEAN_FILES)
+ -rm -rf $(top_srcdir)/autom4te.cache
+ -rm -f Makefile
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-recursive
+
+mostlyclean-am: mostlyclean-generic
+
+pdf: pdf-recursive
+
+pdf-am:
+
+ps: ps-recursive
+
+ps-am:
+
+uninstall-am: uninstall-dist_pdfDATA
+
+.MAKE: $(am__recursive_targets) check-am install-am install-strip
+
+.PHONY: $(am__recursive_targets) CTAGS GTAGS TAGS all all-am \
+ am--refresh check check-TESTS check-am clean clean-cscope \
+ clean-generic cscope cscopelist-am ctags ctags-am dist \
+ dist-all dist-bzip2 dist-gzip dist-lzip dist-shar dist-tarZ \
+ dist-xz dist-zip distcheck distclean distclean-generic \
+ distclean-tags distcleancheck distdir distuninstallcheck dvi \
+ dvi-am html html-am info info-am install install-am \
+ install-data install-data-am install-dist_pdfDATA install-dvi \
+ install-dvi-am install-exec install-exec-am install-html \
+ install-html-am install-info install-info-am install-man \
+ install-pdf install-pdf-am install-ps install-ps-am \
+ install-strip installcheck installcheck-am installdirs \
+ installdirs-am maintainer-clean maintainer-clean-generic \
+ mostlyclean mostlyclean-generic pdf pdf-am ps ps-am recheck \
+ tags tags-am uninstall uninstall-am uninstall-dist_pdfDATA
+
+
+.PHONY: all
+
+ at BUILD_TESTS_TRUE@$(TESTS): src/andi
+
+# This is a small hack to satisfy both GitHub and the GNU coding style.
+README: README.md
+ cp README.md README
+
+# Recreate the changelog, when the version string changes.
+ChangeLog: configure.ac
+ echo "Missing Git" > ChangeLog;
+ if test -d $(srcdir)/.git; then \
+ which git && git log --stat --date=short --abbrev-commit | grep --invert-match '^ [[:alnum:].]' | git stripspace > ChangeLog; \
+ fi
+
+.PHONY: code-docs
+code-docs:
+ cd docs && $(MAKE) code-docs;
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
diff --git a/README b/README
new file mode 100644
index 0000000..9be208b
--- /dev/null
+++ b/README
@@ -0,0 +1,66 @@
+[](https://travis-ci.org/EvolBioInf/andi) [](https://coveralls.io/r/EvolBioInf/andi?branch=master)
+
+# About
+
+This is the `andi` program for estimating the evolutionary distance between closely related genomes. These distances can be used to rapidly infer phylogenies for big sets of genomes. Because `andi` does not compute full alignments, it is so efficient that it scales even up to thousands of bacterial genomes.
+
+This readme covers all necessary instructions for the impatient to get `andi` up and running. For extensive instructions please consult the [manual](andi-manual.pdf).
+
+
+# Build Instructions
+
+For the latest [stable release](https://github.com/EvolBioInf/andi/releases) of `andi` download the tar ball. If you'd like to contribute to this software, feel free to create a fork of our [git repository](https://github.com/EvolBioInf/andi) and send pull requests.
+
+
+## Prerequisites
+
+This program has the following external dependency: [libdivsufsort](https://code.google.com/p/libdivsufsort/). Please make sure you installed `libdivsufsort` before attempting a build. If you did get the source, not as a tarball, but straight from the git repository, you will also need the autotools. Run `autoreconf -i` to generate the configure script and continue with the next step.
+
+
+## Compiling
+
+Assuming you have installed all prerequisites, building is as easy as follows.
+
+ $ ./configure
+ $ make
+ $ make install
+
+Excessive build instructions are located in `INSTALL`. If the build was successful you can get the usage instructions via `--help` or the man page.
+
+ $ andi --help
+ $ man andi
+
+You can use simply `andi` with your genomes in `FASTA` format.
+
+ $ andi S1.fasta S2.fasta
+ 2
+ S1 0.0 0.1
+ s2 0.1 0.0
+
+From this distance matrix the phylogeny can be inferred via neighbor-joining. Check the [manual](andi-manual.pdf). for a more thorough description.
+
+
+# Links and Additional Resources
+
+The release of this software is accompanied by a paper from [Haubold et al.](http://bioinformatics.oxfordjournals.org/content/31/8/1169). It explains the used *anchor distance* strategy in great detail. The `maf2phy.awk` script used in the validation process is located under `scripts`. Simulations were done using our own [simK](http://guanine.evolbio.mpg.de/bioBox/) tool.
+
+## Data Sets
+
+1. 29. E. coli strains: [data](http://guanine.evolbio.mpg.de/andi/eco29.fasta.gz)
+2. 109 E. coli ST131 strains ([paper](http://www.pnas.org/content/early/2014/03/28/1322678111.abstract)):
+ * [99 newly sequenced strains](https://github.com/BeatsonLab-MicrobialGenomics/ST131_99)
+ * [10 previously published strains](http://guanine.evolbio.mpg.de/andi/st131_extra.tgz)
+3. 3085 Streptococcus pneumoniae strains ([paper](http://www.nature.com/ng/journal/v46/n3/full/ng.2895.html)): ftp://ftp.sanger.ac.uk/pub/pathogens/Streptococcus/pneumoniae/Maela_assemblies.tgz
+
+## License
+
+Copyright © 2014, 2015 Fabian Klötzl
+License GPLv3+: GNU GPL version 3 or later.
+
+This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. The full license text is available at <http://gnu.org/licenses/gpl.html>.
+
+Some files may be licensed differently.
+
+## Contact
+
+In case of bugs or unexpected errors don't hesitate to send me a mail: kloetzl at evolbio.mpg.de
diff --git a/README.md b/README.md
new file mode 100644
index 0000000..9be208b
--- /dev/null
+++ b/README.md
@@ -0,0 +1,66 @@
+[](https://travis-ci.org/EvolBioInf/andi) [](https://coveralls.io/r/EvolBioInf/andi?branch=master)
+
+# About
+
+This is the `andi` program for estimating the evolutionary distance between closely related genomes. These distances can be used to rapidly infer phylogenies for big sets of genomes. Because `andi` does not compute full alignments, it is so efficient that it scales even up to thousands of bacterial genomes.
+
+This readme covers all necessary instructions for the impatient to get `andi` up and running. For extensive instructions please consult the [manual](andi-manual.pdf).
+
+
+# Build Instructions
+
+For the latest [stable release](https://github.com/EvolBioInf/andi/releases) of `andi` download the tar ball. If you'd like to contribute to this software, feel free to create a fork of our [git repository](https://github.com/EvolBioInf/andi) and send pull requests.
+
+
+## Prerequisites
+
+This program has the following external dependency: [libdivsufsort](https://code.google.com/p/libdivsufsort/). Please make sure you installed `libdivsufsort` before attempting a build. If you did get the source, not as a tarball, but straight from the git repository, you will also need the autotools. Run `autoreconf -i` to generate the configure script and continue with the next step.
+
+
+## Compiling
+
+Assuming you have installed all prerequisites, building is as easy as follows.
+
+ $ ./configure
+ $ make
+ $ make install
+
+Excessive build instructions are located in `INSTALL`. If the build was successful you can get the usage instructions via `--help` or the man page.
+
+ $ andi --help
+ $ man andi
+
+You can use simply `andi` with your genomes in `FASTA` format.
+
+ $ andi S1.fasta S2.fasta
+ 2
+ S1 0.0 0.1
+ s2 0.1 0.0
+
+From this distance matrix the phylogeny can be inferred via neighbor-joining. Check the [manual](andi-manual.pdf). for a more thorough description.
+
+
+# Links and Additional Resources
+
+The release of this software is accompanied by a paper from [Haubold et al.](http://bioinformatics.oxfordjournals.org/content/31/8/1169). It explains the used *anchor distance* strategy in great detail. The `maf2phy.awk` script used in the validation process is located under `scripts`. Simulations were done using our own [simK](http://guanine.evolbio.mpg.de/bioBox/) tool.
+
+## Data Sets
+
+1. 29. E. coli strains: [data](http://guanine.evolbio.mpg.de/andi/eco29.fasta.gz)
+2. 109 E. coli ST131 strains ([paper](http://www.pnas.org/content/early/2014/03/28/1322678111.abstract)):
+ * [99 newly sequenced strains](https://github.com/BeatsonLab-MicrobialGenomics/ST131_99)
+ * [10 previously published strains](http://guanine.evolbio.mpg.de/andi/st131_extra.tgz)
+3. 3085 Streptococcus pneumoniae strains ([paper](http://www.nature.com/ng/journal/v46/n3/full/ng.2895.html)): ftp://ftp.sanger.ac.uk/pub/pathogens/Streptococcus/pneumoniae/Maela_assemblies.tgz
+
+## License
+
+Copyright © 2014, 2015 Fabian Klötzl
+License GPLv3+: GNU GPL version 3 or later.
+
+This is free software: you are free to change and redistribute it. There is NO WARRANTY, to the extent permitted by law. The full license text is available at <http://gnu.org/licenses/gpl.html>.
+
+Some files may be licensed differently.
+
+## Contact
+
+In case of bugs or unexpected errors don't hesitate to send me a mail: kloetzl at evolbio.mpg.de
diff --git a/aclocal.m4 b/aclocal.m4
new file mode 100644
index 0000000..ec10480
--- /dev/null
+++ b/aclocal.m4
@@ -0,0 +1,1370 @@
+# generated automatically by aclocal 1.14.1 -*- Autoconf -*-
+
+# Copyright (C) 1996-2013 Free Software Foundation, Inc.
+
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+m4_ifndef([AC_CONFIG_MACRO_DIRS], [m4_defun([_AM_CONFIG_MACRO_DIRS], [])m4_defun([AC_CONFIG_MACRO_DIRS], [_AM_CONFIG_MACRO_DIRS($@)])])
+m4_ifndef([AC_AUTOCONF_VERSION],
+ [m4_copy([m4_PACKAGE_VERSION], [AC_AUTOCONF_VERSION])])dnl
+m4_if(m4_defn([AC_AUTOCONF_VERSION]), [2.69],,
+[m4_warning([this file was generated for autoconf 2.69.
+You have another version of autoconf. It may work, but is not guaranteed to.
+If you have problems, you may need to regenerate the build system entirely.
+To do so, use the procedure documented by the package, typically 'autoreconf'.])])
+
+# pkg.m4 - Macros to locate and utilise pkg-config. -*- Autoconf -*-
+# serial 1 (pkg-config-0.24)
+#
+# Copyright © 2004 Scott James Remnant <scott at netsplit.com>.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+#
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+# PKG_PROG_PKG_CONFIG([MIN-VERSION])
+# ----------------------------------
+AC_DEFUN([PKG_PROG_PKG_CONFIG],
+[m4_pattern_forbid([^_?PKG_[A-Z_]+$])
+m4_pattern_allow([^PKG_CONFIG(_(PATH|LIBDIR|SYSROOT_DIR|ALLOW_SYSTEM_(CFLAGS|LIBS)))?$])
+m4_pattern_allow([^PKG_CONFIG_(DISABLE_UNINSTALLED|TOP_BUILD_DIR|DEBUG_SPEW)$])
+AC_ARG_VAR([PKG_CONFIG], [path to pkg-config utility])
+AC_ARG_VAR([PKG_CONFIG_PATH], [directories to add to pkg-config's search path])
+AC_ARG_VAR([PKG_CONFIG_LIBDIR], [path overriding pkg-config's built-in search path])
+
+if test "x$ac_cv_env_PKG_CONFIG_set" != "xset"; then
+ AC_PATH_TOOL([PKG_CONFIG], [pkg-config])
+fi
+if test -n "$PKG_CONFIG"; then
+ _pkg_min_version=m4_default([$1], [0.9.0])
+ AC_MSG_CHECKING([pkg-config is at least version $_pkg_min_version])
+ if $PKG_CONFIG --atleast-pkgconfig-version $_pkg_min_version; then
+ AC_MSG_RESULT([yes])
+ else
+ AC_MSG_RESULT([no])
+ PKG_CONFIG=""
+ fi
+fi[]dnl
+])# PKG_PROG_PKG_CONFIG
+
+# PKG_CHECK_EXISTS(MODULES, [ACTION-IF-FOUND], [ACTION-IF-NOT-FOUND])
+#
+# Check to see whether a particular set of modules exists. Similar
+# to PKG_CHECK_MODULES(), but does not set variables or print errors.
+#
+# Please remember that m4 expands AC_REQUIRE([PKG_PROG_PKG_CONFIG])
+# only at the first occurence in configure.ac, so if the first place
+# it's called might be skipped (such as if it is within an "if", you
+# have to call PKG_CHECK_EXISTS manually
+# --------------------------------------------------------------
+AC_DEFUN([PKG_CHECK_EXISTS],
+[AC_REQUIRE([PKG_PROG_PKG_CONFIG])dnl
+if test -n "$PKG_CONFIG" && \
+ AC_RUN_LOG([$PKG_CONFIG --exists --print-errors "$1"]); then
+ m4_default([$2], [:])
+m4_ifvaln([$3], [else
+ $3])dnl
+fi])
+
+# _PKG_CONFIG([VARIABLE], [COMMAND], [MODULES])
+# ---------------------------------------------
+m4_define([_PKG_CONFIG],
+[if test -n "$$1"; then
+ pkg_cv_[]$1="$$1"
+ elif test -n "$PKG_CONFIG"; then
+ PKG_CHECK_EXISTS([$3],
+ [pkg_cv_[]$1=`$PKG_CONFIG --[]$2 "$3" 2>/dev/null`
+ test "x$?" != "x0" && pkg_failed=yes ],
+ [pkg_failed=yes])
+ else
+ pkg_failed=untried
+fi[]dnl
+])# _PKG_CONFIG
+
+# _PKG_SHORT_ERRORS_SUPPORTED
+# -----------------------------
+AC_DEFUN([_PKG_SHORT_ERRORS_SUPPORTED],
+[AC_REQUIRE([PKG_PROG_PKG_CONFIG])
+if $PKG_CONFIG --atleast-pkgconfig-version 0.20; then
+ _pkg_short_errors_supported=yes
+else
+ _pkg_short_errors_supported=no
+fi[]dnl
+])# _PKG_SHORT_ERRORS_SUPPORTED
+
+
+# PKG_CHECK_MODULES(VARIABLE-PREFIX, MODULES, [ACTION-IF-FOUND],
+# [ACTION-IF-NOT-FOUND])
+#
+#
+# Note that if there is a possibility the first call to
+# PKG_CHECK_MODULES might not happen, you should be sure to include an
+# explicit call to PKG_PROG_PKG_CONFIG in your configure.ac
+#
+#
+# --------------------------------------------------------------
+AC_DEFUN([PKG_CHECK_MODULES],
+[AC_REQUIRE([PKG_PROG_PKG_CONFIG])dnl
+AC_ARG_VAR([$1][_CFLAGS], [C compiler flags for $1, overriding pkg-config])dnl
+AC_ARG_VAR([$1][_LIBS], [linker flags for $1, overriding pkg-config])dnl
+
+pkg_failed=no
+AC_MSG_CHECKING([for $1])
+
+_PKG_CONFIG([$1][_CFLAGS], [cflags], [$2])
+_PKG_CONFIG([$1][_LIBS], [libs], [$2])
+
+m4_define([_PKG_TEXT], [Alternatively, you may set the environment variables $1[]_CFLAGS
+and $1[]_LIBS to avoid the need to call pkg-config.
+See the pkg-config man page for more details.])
+
+if test $pkg_failed = yes; then
+ AC_MSG_RESULT([no])
+ _PKG_SHORT_ERRORS_SUPPORTED
+ if test $_pkg_short_errors_supported = yes; then
+ $1[]_PKG_ERRORS=`$PKG_CONFIG --short-errors --print-errors --cflags --libs "$2" 2>&1`
+ else
+ $1[]_PKG_ERRORS=`$PKG_CONFIG --print-errors --cflags --libs "$2" 2>&1`
+ fi
+ # Put the nasty error message in config.log where it belongs
+ echo "$$1[]_PKG_ERRORS" >&AS_MESSAGE_LOG_FD
+
+ m4_default([$4], [AC_MSG_ERROR(
+[Package requirements ($2) were not met:
+
+$$1_PKG_ERRORS
+
+Consider adjusting the PKG_CONFIG_PATH environment variable if you
+installed software in a non-standard prefix.
+
+_PKG_TEXT])[]dnl
+ ])
+elif test $pkg_failed = untried; then
+ AC_MSG_RESULT([no])
+ m4_default([$4], [AC_MSG_FAILURE(
+[The pkg-config script could not be found or is too old. Make sure it
+is in your PATH or set the PKG_CONFIG environment variable to the full
+path to pkg-config.
+
+_PKG_TEXT
+
+To get pkg-config, see <http://pkg-config.freedesktop.org/>.])[]dnl
+ ])
+else
+ $1[]_CFLAGS=$pkg_cv_[]$1[]_CFLAGS
+ $1[]_LIBS=$pkg_cv_[]$1[]_LIBS
+ AC_MSG_RESULT([yes])
+ $3
+fi[]dnl
+])# PKG_CHECK_MODULES
+
+# Copyright (C) 2002-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_AUTOMAKE_VERSION(VERSION)
+# ----------------------------
+# Automake X.Y traces this macro to ensure aclocal.m4 has been
+# generated from the m4 files accompanying Automake X.Y.
+# (This private macro should not be called outside this file.)
+AC_DEFUN([AM_AUTOMAKE_VERSION],
+[am__api_version='1.14'
+dnl Some users find AM_AUTOMAKE_VERSION and mistake it for a way to
+dnl require some minimum version. Point them to the right macro.
+m4_if([$1], [1.14.1], [],
+ [AC_FATAL([Do not call $0, use AM_INIT_AUTOMAKE([$1]).])])dnl
+])
+
+# _AM_AUTOCONF_VERSION(VERSION)
+# -----------------------------
+# aclocal traces this macro to find the Autoconf version.
+# This is a private macro too. Using m4_define simplifies
+# the logic in aclocal, which can simply ignore this definition.
+m4_define([_AM_AUTOCONF_VERSION], [])
+
+# AM_SET_CURRENT_AUTOMAKE_VERSION
+# -------------------------------
+# Call AM_AUTOMAKE_VERSION and AM_AUTOMAKE_VERSION so they can be traced.
+# This function is AC_REQUIREd by AM_INIT_AUTOMAKE.
+AC_DEFUN([AM_SET_CURRENT_AUTOMAKE_VERSION],
+[AM_AUTOMAKE_VERSION([1.14.1])dnl
+m4_ifndef([AC_AUTOCONF_VERSION],
+ [m4_copy([m4_PACKAGE_VERSION], [AC_AUTOCONF_VERSION])])dnl
+_AM_AUTOCONF_VERSION(m4_defn([AC_AUTOCONF_VERSION]))])
+
+# Copyright (C) 2011-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_PROG_AR([ACT-IF-FAIL])
+# -------------------------
+# Try to determine the archiver interface, and trigger the ar-lib wrapper
+# if it is needed. If the detection of archiver interface fails, run
+# ACT-IF-FAIL (default is to abort configure with a proper error message).
+AC_DEFUN([AM_PROG_AR],
+[AC_BEFORE([$0], [LT_INIT])dnl
+AC_BEFORE([$0], [AC_PROG_LIBTOOL])dnl
+AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
+AC_REQUIRE_AUX_FILE([ar-lib])dnl
+AC_CHECK_TOOLS([AR], [ar lib "link -lib"], [false])
+: ${AR=ar}
+
+AC_CACHE_CHECK([the archiver ($AR) interface], [am_cv_ar_interface],
+ [AC_LANG_PUSH([C])
+ am_cv_ar_interface=ar
+ AC_COMPILE_IFELSE([AC_LANG_SOURCE([[int some_variable = 0;]])],
+ [am_ar_try='$AR cru libconftest.a conftest.$ac_objext >&AS_MESSAGE_LOG_FD'
+ AC_TRY_EVAL([am_ar_try])
+ if test "$ac_status" -eq 0; then
+ am_cv_ar_interface=ar
+ else
+ am_ar_try='$AR -NOLOGO -OUT:conftest.lib conftest.$ac_objext >&AS_MESSAGE_LOG_FD'
+ AC_TRY_EVAL([am_ar_try])
+ if test "$ac_status" -eq 0; then
+ am_cv_ar_interface=lib
+ else
+ am_cv_ar_interface=unknown
+ fi
+ fi
+ rm -f conftest.lib libconftest.a
+ ])
+ AC_LANG_POP([C])])
+
+case $am_cv_ar_interface in
+ar)
+ ;;
+lib)
+ # Microsoft lib, so override with the ar-lib wrapper script.
+ # FIXME: It is wrong to rewrite AR.
+ # But if we don't then we get into trouble of one sort or another.
+ # A longer-term fix would be to have automake use am__AR in this case,
+ # and then we could set am__AR="$am_aux_dir/ar-lib \$(AR)" or something
+ # similar.
+ AR="$am_aux_dir/ar-lib $AR"
+ ;;
+unknown)
+ m4_default([$1],
+ [AC_MSG_ERROR([could not determine $AR interface])])
+ ;;
+esac
+AC_SUBST([AR])dnl
+])
+
+# AM_AUX_DIR_EXPAND -*- Autoconf -*-
+
+# Copyright (C) 2001-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# For projects using AC_CONFIG_AUX_DIR([foo]), Autoconf sets
+# $ac_aux_dir to '$srcdir/foo'. In other projects, it is set to
+# '$srcdir', '$srcdir/..', or '$srcdir/../..'.
+#
+# Of course, Automake must honor this variable whenever it calls a
+# tool from the auxiliary directory. The problem is that $srcdir (and
+# therefore $ac_aux_dir as well) can be either absolute or relative,
+# depending on how configure is run. This is pretty annoying, since
+# it makes $ac_aux_dir quite unusable in subdirectories: in the top
+# source directory, any form will work fine, but in subdirectories a
+# relative path needs to be adjusted first.
+#
+# $ac_aux_dir/missing
+# fails when called from a subdirectory if $ac_aux_dir is relative
+# $top_srcdir/$ac_aux_dir/missing
+# fails if $ac_aux_dir is absolute,
+# fails when called from a subdirectory in a VPATH build with
+# a relative $ac_aux_dir
+#
+# The reason of the latter failure is that $top_srcdir and $ac_aux_dir
+# are both prefixed by $srcdir. In an in-source build this is usually
+# harmless because $srcdir is '.', but things will broke when you
+# start a VPATH build or use an absolute $srcdir.
+#
+# So we could use something similar to $top_srcdir/$ac_aux_dir/missing,
+# iff we strip the leading $srcdir from $ac_aux_dir. That would be:
+# am_aux_dir='\$(top_srcdir)/'`expr "$ac_aux_dir" : "$srcdir//*\(.*\)"`
+# and then we would define $MISSING as
+# MISSING="\${SHELL} $am_aux_dir/missing"
+# This will work as long as MISSING is not called from configure, because
+# unfortunately $(top_srcdir) has no meaning in configure.
+# However there are other variables, like CC, which are often used in
+# configure, and could therefore not use this "fixed" $ac_aux_dir.
+#
+# Another solution, used here, is to always expand $ac_aux_dir to an
+# absolute PATH. The drawback is that using absolute paths prevent a
+# configured tree to be moved without reconfiguration.
+
+AC_DEFUN([AM_AUX_DIR_EXPAND],
+[dnl Rely on autoconf to set up CDPATH properly.
+AC_PREREQ([2.50])dnl
+# expand $ac_aux_dir to an absolute path
+am_aux_dir=`cd $ac_aux_dir && pwd`
+])
+
+# AM_CONDITIONAL -*- Autoconf -*-
+
+# Copyright (C) 1997-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_CONDITIONAL(NAME, SHELL-CONDITION)
+# -------------------------------------
+# Define a conditional.
+AC_DEFUN([AM_CONDITIONAL],
+[AC_PREREQ([2.52])dnl
+ m4_if([$1], [TRUE], [AC_FATAL([$0: invalid condition: $1])],
+ [$1], [FALSE], [AC_FATAL([$0: invalid condition: $1])])dnl
+AC_SUBST([$1_TRUE])dnl
+AC_SUBST([$1_FALSE])dnl
+_AM_SUBST_NOTMAKE([$1_TRUE])dnl
+_AM_SUBST_NOTMAKE([$1_FALSE])dnl
+m4_define([_AM_COND_VALUE_$1], [$2])dnl
+if $2; then
+ $1_TRUE=
+ $1_FALSE='#'
+else
+ $1_TRUE='#'
+ $1_FALSE=
+fi
+AC_CONFIG_COMMANDS_PRE(
+[if test -z "${$1_TRUE}" && test -z "${$1_FALSE}"; then
+ AC_MSG_ERROR([[conditional "$1" was never defined.
+Usually this means the macro was only invoked conditionally.]])
+fi])])
+
+# Copyright (C) 1999-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+
+# There are a few dirty hacks below to avoid letting 'AC_PROG_CC' be
+# written in clear, in which case automake, when reading aclocal.m4,
+# will think it sees a *use*, and therefore will trigger all it's
+# C support machinery. Also note that it means that autoscan, seeing
+# CC etc. in the Makefile, will ask for an AC_PROG_CC use...
+
+
+# _AM_DEPENDENCIES(NAME)
+# ----------------------
+# See how the compiler implements dependency checking.
+# NAME is "CC", "CXX", "OBJC", "OBJCXX", "UPC", or "GJC".
+# We try a few techniques and use that to set a single cache variable.
+#
+# We don't AC_REQUIRE the corresponding AC_PROG_CC since the latter was
+# modified to invoke _AM_DEPENDENCIES(CC); we would have a circular
+# dependency, and given that the user is not expected to run this macro,
+# just rely on AC_PROG_CC.
+AC_DEFUN([_AM_DEPENDENCIES],
+[AC_REQUIRE([AM_SET_DEPDIR])dnl
+AC_REQUIRE([AM_OUTPUT_DEPENDENCY_COMMANDS])dnl
+AC_REQUIRE([AM_MAKE_INCLUDE])dnl
+AC_REQUIRE([AM_DEP_TRACK])dnl
+
+m4_if([$1], [CC], [depcc="$CC" am_compiler_list=],
+ [$1], [CXX], [depcc="$CXX" am_compiler_list=],
+ [$1], [OBJC], [depcc="$OBJC" am_compiler_list='gcc3 gcc'],
+ [$1], [OBJCXX], [depcc="$OBJCXX" am_compiler_list='gcc3 gcc'],
+ [$1], [UPC], [depcc="$UPC" am_compiler_list=],
+ [$1], [GCJ], [depcc="$GCJ" am_compiler_list='gcc3 gcc'],
+ [depcc="$$1" am_compiler_list=])
+
+AC_CACHE_CHECK([dependency style of $depcc],
+ [am_cv_$1_dependencies_compiler_type],
+[if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
+ # We make a subdir and do the tests there. Otherwise we can end up
+ # making bogus files that we don't know about and never remove. For
+ # instance it was reported that on HP-UX the gcc test will end up
+ # making a dummy file named 'D' -- because '-MD' means "put the output
+ # in D".
+ rm -rf conftest.dir
+ mkdir conftest.dir
+ # Copy depcomp to subdir because otherwise we won't find it if we're
+ # using a relative directory.
+ cp "$am_depcomp" conftest.dir
+ cd conftest.dir
+ # We will build objects and dependencies in a subdirectory because
+ # it helps to detect inapplicable dependency modes. For instance
+ # both Tru64's cc and ICC support -MD to output dependencies as a
+ # side effect of compilation, but ICC will put the dependencies in
+ # the current directory while Tru64 will put them in the object
+ # directory.
+ mkdir sub
+
+ am_cv_$1_dependencies_compiler_type=none
+ if test "$am_compiler_list" = ""; then
+ am_compiler_list=`sed -n ['s/^#*\([a-zA-Z0-9]*\))$/\1/p'] < ./depcomp`
+ fi
+ am__universal=false
+ m4_case([$1], [CC],
+ [case " $depcc " in #(
+ *\ -arch\ *\ -arch\ *) am__universal=true ;;
+ esac],
+ [CXX],
+ [case " $depcc " in #(
+ *\ -arch\ *\ -arch\ *) am__universal=true ;;
+ esac])
+
+ for depmode in $am_compiler_list; do
+ # Setup a source with many dependencies, because some compilers
+ # like to wrap large dependency lists on column 80 (with \), and
+ # we should not choose a depcomp mode which is confused by this.
+ #
+ # We need to recreate these files for each test, as the compiler may
+ # overwrite some of them when testing with obscure command lines.
+ # This happens at least with the AIX C compiler.
+ : > sub/conftest.c
+ for i in 1 2 3 4 5 6; do
+ echo '#include "conftst'$i'.h"' >> sub/conftest.c
+ # Using ": > sub/conftst$i.h" creates only sub/conftst1.h with
+ # Solaris 10 /bin/sh.
+ echo '/* dummy */' > sub/conftst$i.h
+ done
+ echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
+
+ # We check with '-c' and '-o' for the sake of the "dashmstdout"
+ # mode. It turns out that the SunPro C++ compiler does not properly
+ # handle '-M -o', and we need to detect this. Also, some Intel
+ # versions had trouble with output in subdirs.
+ am__obj=sub/conftest.${OBJEXT-o}
+ am__minus_obj="-o $am__obj"
+ case $depmode in
+ gcc)
+ # This depmode causes a compiler race in universal mode.
+ test "$am__universal" = false || continue
+ ;;
+ nosideeffect)
+ # After this tag, mechanisms are not by side-effect, so they'll
+ # only be used when explicitly requested.
+ if test "x$enable_dependency_tracking" = xyes; then
+ continue
+ else
+ break
+ fi
+ ;;
+ msvc7 | msvc7msys | msvisualcpp | msvcmsys)
+ # This compiler won't grok '-c -o', but also, the minuso test has
+ # not run yet. These depmodes are late enough in the game, and
+ # so weak that their functioning should not be impacted.
+ am__obj=conftest.${OBJEXT-o}
+ am__minus_obj=
+ ;;
+ none) break ;;
+ esac
+ if depmode=$depmode \
+ source=sub/conftest.c object=$am__obj \
+ depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
+ $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
+ >/dev/null 2>conftest.err &&
+ grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
+ grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
+ grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
+ ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
+ # icc doesn't choke on unknown options, it will just issue warnings
+ # or remarks (even with -Werror). So we grep stderr for any message
+ # that says an option was ignored or not supported.
+ # When given -MP, icc 7.0 and 7.1 complain thusly:
+ # icc: Command line warning: ignoring option '-M'; no argument required
+ # The diagnosis changed in icc 8.0:
+ # icc: Command line remark: option '-MP' not supported
+ if (grep 'ignoring option' conftest.err ||
+ grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
+ am_cv_$1_dependencies_compiler_type=$depmode
+ break
+ fi
+ fi
+ done
+
+ cd ..
+ rm -rf conftest.dir
+else
+ am_cv_$1_dependencies_compiler_type=none
+fi
+])
+AC_SUBST([$1DEPMODE], [depmode=$am_cv_$1_dependencies_compiler_type])
+AM_CONDITIONAL([am__fastdep$1], [
+ test "x$enable_dependency_tracking" != xno \
+ && test "$am_cv_$1_dependencies_compiler_type" = gcc3])
+])
+
+
+# AM_SET_DEPDIR
+# -------------
+# Choose a directory name for dependency files.
+# This macro is AC_REQUIREd in _AM_DEPENDENCIES.
+AC_DEFUN([AM_SET_DEPDIR],
+[AC_REQUIRE([AM_SET_LEADING_DOT])dnl
+AC_SUBST([DEPDIR], ["${am__leading_dot}deps"])dnl
+])
+
+
+# AM_DEP_TRACK
+# ------------
+AC_DEFUN([AM_DEP_TRACK],
+[AC_ARG_ENABLE([dependency-tracking], [dnl
+AS_HELP_STRING(
+ [--enable-dependency-tracking],
+ [do not reject slow dependency extractors])
+AS_HELP_STRING(
+ [--disable-dependency-tracking],
+ [speeds up one-time build])])
+if test "x$enable_dependency_tracking" != xno; then
+ am_depcomp="$ac_aux_dir/depcomp"
+ AMDEPBACKSLASH='\'
+ am__nodep='_no'
+fi
+AM_CONDITIONAL([AMDEP], [test "x$enable_dependency_tracking" != xno])
+AC_SUBST([AMDEPBACKSLASH])dnl
+_AM_SUBST_NOTMAKE([AMDEPBACKSLASH])dnl
+AC_SUBST([am__nodep])dnl
+_AM_SUBST_NOTMAKE([am__nodep])dnl
+])
+
+# Generate code to set up dependency tracking. -*- Autoconf -*-
+
+# Copyright (C) 1999-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+
+# _AM_OUTPUT_DEPENDENCY_COMMANDS
+# ------------------------------
+AC_DEFUN([_AM_OUTPUT_DEPENDENCY_COMMANDS],
+[{
+ # Older Autoconf quotes --file arguments for eval, but not when files
+ # are listed without --file. Let's play safe and only enable the eval
+ # if we detect the quoting.
+ case $CONFIG_FILES in
+ *\'*) eval set x "$CONFIG_FILES" ;;
+ *) set x $CONFIG_FILES ;;
+ esac
+ shift
+ for mf
+ do
+ # Strip MF so we end up with the name of the file.
+ mf=`echo "$mf" | sed -e 's/:.*$//'`
+ # Check whether this is an Automake generated Makefile or not.
+ # We used to match only the files named 'Makefile.in', but
+ # some people rename them; so instead we look at the file content.
+ # Grep'ing the first line is not enough: some people post-process
+ # each Makefile.in and add a new line on top of each file to say so.
+ # Grep'ing the whole file is not good either: AIX grep has a line
+ # limit of 2048, but all sed's we know have understand at least 4000.
+ if sed -n 's,^#.*generated by automake.*,X,p' "$mf" | grep X >/dev/null 2>&1; then
+ dirpart=`AS_DIRNAME("$mf")`
+ else
+ continue
+ fi
+ # Extract the definition of DEPDIR, am__include, and am__quote
+ # from the Makefile without running 'make'.
+ DEPDIR=`sed -n 's/^DEPDIR = //p' < "$mf"`
+ test -z "$DEPDIR" && continue
+ am__include=`sed -n 's/^am__include = //p' < "$mf"`
+ test -z "$am__include" && continue
+ am__quote=`sed -n 's/^am__quote = //p' < "$mf"`
+ # Find all dependency output files, they are included files with
+ # $(DEPDIR) in their names. We invoke sed twice because it is the
+ # simplest approach to changing $(DEPDIR) to its actual value in the
+ # expansion.
+ for file in `sed -n "
+ s/^$am__include $am__quote\(.*(DEPDIR).*\)$am__quote"'$/\1/p' <"$mf" | \
+ sed -e 's/\$(DEPDIR)/'"$DEPDIR"'/g'`; do
+ # Make sure the directory exists.
+ test -f "$dirpart/$file" && continue
+ fdir=`AS_DIRNAME(["$file"])`
+ AS_MKDIR_P([$dirpart/$fdir])
+ # echo "creating $dirpart/$file"
+ echo '# dummy' > "$dirpart/$file"
+ done
+ done
+}
+])# _AM_OUTPUT_DEPENDENCY_COMMANDS
+
+
+# AM_OUTPUT_DEPENDENCY_COMMANDS
+# -----------------------------
+# This macro should only be invoked once -- use via AC_REQUIRE.
+#
+# This code is only required when automatic dependency tracking
+# is enabled. FIXME. This creates each '.P' file that we will
+# need in order to bootstrap the dependency handling code.
+AC_DEFUN([AM_OUTPUT_DEPENDENCY_COMMANDS],
+[AC_CONFIG_COMMANDS([depfiles],
+ [test x"$AMDEP_TRUE" != x"" || _AM_OUTPUT_DEPENDENCY_COMMANDS],
+ [AMDEP_TRUE="$AMDEP_TRUE" ac_aux_dir="$ac_aux_dir"])
+])
+
+# Do all the work for Automake. -*- Autoconf -*-
+
+# Copyright (C) 1996-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This macro actually does too much. Some checks are only needed if
+# your package does certain things. But this isn't really a big deal.
+
+dnl Redefine AC_PROG_CC to automatically invoke _AM_PROG_CC_C_O.
+m4_define([AC_PROG_CC],
+m4_defn([AC_PROG_CC])
+[_AM_PROG_CC_C_O
+])
+
+# AM_INIT_AUTOMAKE(PACKAGE, VERSION, [NO-DEFINE])
+# AM_INIT_AUTOMAKE([OPTIONS])
+# -----------------------------------------------
+# The call with PACKAGE and VERSION arguments is the old style
+# call (pre autoconf-2.50), which is being phased out. PACKAGE
+# and VERSION should now be passed to AC_INIT and removed from
+# the call to AM_INIT_AUTOMAKE.
+# We support both call styles for the transition. After
+# the next Automake release, Autoconf can make the AC_INIT
+# arguments mandatory, and then we can depend on a new Autoconf
+# release and drop the old call support.
+AC_DEFUN([AM_INIT_AUTOMAKE],
+[AC_PREREQ([2.65])dnl
+dnl Autoconf wants to disallow AM_ names. We explicitly allow
+dnl the ones we care about.
+m4_pattern_allow([^AM_[A-Z]+FLAGS$])dnl
+AC_REQUIRE([AM_SET_CURRENT_AUTOMAKE_VERSION])dnl
+AC_REQUIRE([AC_PROG_INSTALL])dnl
+if test "`cd $srcdir && pwd`" != "`pwd`"; then
+ # Use -I$(srcdir) only when $(srcdir) != ., so that make's output
+ # is not polluted with repeated "-I."
+ AC_SUBST([am__isrc], [' -I$(srcdir)'])_AM_SUBST_NOTMAKE([am__isrc])dnl
+ # test to see if srcdir already configured
+ if test -f $srcdir/config.status; then
+ AC_MSG_ERROR([source directory already configured; run "make distclean" there first])
+ fi
+fi
+
+# test whether we have cygpath
+if test -z "$CYGPATH_W"; then
+ if (cygpath --version) >/dev/null 2>/dev/null; then
+ CYGPATH_W='cygpath -w'
+ else
+ CYGPATH_W=echo
+ fi
+fi
+AC_SUBST([CYGPATH_W])
+
+# Define the identity of the package.
+dnl Distinguish between old-style and new-style calls.
+m4_ifval([$2],
+[AC_DIAGNOSE([obsolete],
+ [$0: two- and three-arguments forms are deprecated.])
+m4_ifval([$3], [_AM_SET_OPTION([no-define])])dnl
+ AC_SUBST([PACKAGE], [$1])dnl
+ AC_SUBST([VERSION], [$2])],
+[_AM_SET_OPTIONS([$1])dnl
+dnl Diagnose old-style AC_INIT with new-style AM_AUTOMAKE_INIT.
+m4_if(
+ m4_ifdef([AC_PACKAGE_NAME], [ok]):m4_ifdef([AC_PACKAGE_VERSION], [ok]),
+ [ok:ok],,
+ [m4_fatal([AC_INIT should be called with package and version arguments])])dnl
+ AC_SUBST([PACKAGE], ['AC_PACKAGE_TARNAME'])dnl
+ AC_SUBST([VERSION], ['AC_PACKAGE_VERSION'])])dnl
+
+_AM_IF_OPTION([no-define],,
+[AC_DEFINE_UNQUOTED([PACKAGE], ["$PACKAGE"], [Name of package])
+ AC_DEFINE_UNQUOTED([VERSION], ["$VERSION"], [Version number of package])])dnl
+
+# Some tools Automake needs.
+AC_REQUIRE([AM_SANITY_CHECK])dnl
+AC_REQUIRE([AC_ARG_PROGRAM])dnl
+AM_MISSING_PROG([ACLOCAL], [aclocal-${am__api_version}])
+AM_MISSING_PROG([AUTOCONF], [autoconf])
+AM_MISSING_PROG([AUTOMAKE], [automake-${am__api_version}])
+AM_MISSING_PROG([AUTOHEADER], [autoheader])
+AM_MISSING_PROG([MAKEINFO], [makeinfo])
+AC_REQUIRE([AM_PROG_INSTALL_SH])dnl
+AC_REQUIRE([AM_PROG_INSTALL_STRIP])dnl
+AC_REQUIRE([AC_PROG_MKDIR_P])dnl
+# For better backward compatibility. To be removed once Automake 1.9.x
+# dies out for good. For more background, see:
+# <http://lists.gnu.org/archive/html/automake/2012-07/msg00001.html>
+# <http://lists.gnu.org/archive/html/automake/2012-07/msg00014.html>
+AC_SUBST([mkdir_p], ['$(MKDIR_P)'])
+# We need awk for the "check" target. The system "awk" is bad on
+# some platforms.
+AC_REQUIRE([AC_PROG_AWK])dnl
+AC_REQUIRE([AC_PROG_MAKE_SET])dnl
+AC_REQUIRE([AM_SET_LEADING_DOT])dnl
+_AM_IF_OPTION([tar-ustar], [_AM_PROG_TAR([ustar])],
+ [_AM_IF_OPTION([tar-pax], [_AM_PROG_TAR([pax])],
+ [_AM_PROG_TAR([v7])])])
+_AM_IF_OPTION([no-dependencies],,
+[AC_PROVIDE_IFELSE([AC_PROG_CC],
+ [_AM_DEPENDENCIES([CC])],
+ [m4_define([AC_PROG_CC],
+ m4_defn([AC_PROG_CC])[_AM_DEPENDENCIES([CC])])])dnl
+AC_PROVIDE_IFELSE([AC_PROG_CXX],
+ [_AM_DEPENDENCIES([CXX])],
+ [m4_define([AC_PROG_CXX],
+ m4_defn([AC_PROG_CXX])[_AM_DEPENDENCIES([CXX])])])dnl
+AC_PROVIDE_IFELSE([AC_PROG_OBJC],
+ [_AM_DEPENDENCIES([OBJC])],
+ [m4_define([AC_PROG_OBJC],
+ m4_defn([AC_PROG_OBJC])[_AM_DEPENDENCIES([OBJC])])])dnl
+AC_PROVIDE_IFELSE([AC_PROG_OBJCXX],
+ [_AM_DEPENDENCIES([OBJCXX])],
+ [m4_define([AC_PROG_OBJCXX],
+ m4_defn([AC_PROG_OBJCXX])[_AM_DEPENDENCIES([OBJCXX])])])dnl
+])
+AC_REQUIRE([AM_SILENT_RULES])dnl
+dnl The testsuite driver may need to know about EXEEXT, so add the
+dnl 'am__EXEEXT' conditional if _AM_COMPILER_EXEEXT was seen. This
+dnl macro is hooked onto _AC_COMPILER_EXEEXT early, see below.
+AC_CONFIG_COMMANDS_PRE(dnl
+[m4_provide_if([_AM_COMPILER_EXEEXT],
+ [AM_CONDITIONAL([am__EXEEXT], [test -n "$EXEEXT"])])])dnl
+
+# POSIX will say in a future version that running "rm -f" with no argument
+# is OK; and we want to be able to make that assumption in our Makefile
+# recipes. So use an aggressive probe to check that the usage we want is
+# actually supported "in the wild" to an acceptable degree.
+# See automake bug#10828.
+# To make any issue more visible, cause the running configure to be aborted
+# by default if the 'rm' program in use doesn't match our expectations; the
+# user can still override this though.
+if rm -f && rm -fr && rm -rf; then : OK; else
+ cat >&2 <<'END'
+Oops!
+
+Your 'rm' program seems unable to run without file operands specified
+on the command line, even when the '-f' option is present. This is contrary
+to the behaviour of most rm programs out there, and not conforming with
+the upcoming POSIX standard: <http://austingroupbugs.net/view.php?id=542>
+
+Please tell bug-automake at gnu.org about your system, including the value
+of your $PATH and any error possibly output before this message. This
+can help us improve future automake versions.
+
+END
+ if test x"$ACCEPT_INFERIOR_RM_PROGRAM" = x"yes"; then
+ echo 'Configuration will proceed anyway, since you have set the' >&2
+ echo 'ACCEPT_INFERIOR_RM_PROGRAM variable to "yes"' >&2
+ echo >&2
+ else
+ cat >&2 <<'END'
+Aborting the configuration process, to ensure you take notice of the issue.
+
+You can download and install GNU coreutils to get an 'rm' implementation
+that behaves properly: <http://www.gnu.org/software/coreutils/>.
+
+If you want to complete the configuration process using your problematic
+'rm' anyway, export the environment variable ACCEPT_INFERIOR_RM_PROGRAM
+to "yes", and re-run configure.
+
+END
+ AC_MSG_ERROR([Your 'rm' program is bad, sorry.])
+ fi
+fi])
+
+dnl Hook into '_AC_COMPILER_EXEEXT' early to learn its expansion. Do not
+dnl add the conditional right here, as _AC_COMPILER_EXEEXT may be further
+dnl mangled by Autoconf and run in a shell conditional statement.
+m4_define([_AC_COMPILER_EXEEXT],
+m4_defn([_AC_COMPILER_EXEEXT])[m4_provide([_AM_COMPILER_EXEEXT])])
+
+# When config.status generates a header, we must update the stamp-h file.
+# This file resides in the same directory as the config header
+# that is generated. The stamp files are numbered to have different names.
+
+# Autoconf calls _AC_AM_CONFIG_HEADER_HOOK (when defined) in the
+# loop where config.status creates the headers, so we can generate
+# our stamp files there.
+AC_DEFUN([_AC_AM_CONFIG_HEADER_HOOK],
+[# Compute $1's index in $config_headers.
+_am_arg=$1
+_am_stamp_count=1
+for _am_header in $config_headers :; do
+ case $_am_header in
+ $_am_arg | $_am_arg:* )
+ break ;;
+ * )
+ _am_stamp_count=`expr $_am_stamp_count + 1` ;;
+ esac
+done
+echo "timestamp for $_am_arg" >`AS_DIRNAME(["$_am_arg"])`/stamp-h[]$_am_stamp_count])
+
+# Copyright (C) 2001-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_PROG_INSTALL_SH
+# ------------------
+# Define $install_sh.
+AC_DEFUN([AM_PROG_INSTALL_SH],
+[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
+if test x"${install_sh}" != xset; then
+ case $am_aux_dir in
+ *\ * | *\ *)
+ install_sh="\${SHELL} '$am_aux_dir/install-sh'" ;;
+ *)
+ install_sh="\${SHELL} $am_aux_dir/install-sh"
+ esac
+fi
+AC_SUBST([install_sh])])
+
+# Copyright (C) 2003-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# Check whether the underlying file-system supports filenames
+# with a leading dot. For instance MS-DOS doesn't.
+AC_DEFUN([AM_SET_LEADING_DOT],
+[rm -rf .tst 2>/dev/null
+mkdir .tst 2>/dev/null
+if test -d .tst; then
+ am__leading_dot=.
+else
+ am__leading_dot=_
+fi
+rmdir .tst 2>/dev/null
+AC_SUBST([am__leading_dot])])
+
+# Check to see how 'make' treats includes. -*- Autoconf -*-
+
+# Copyright (C) 2001-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_MAKE_INCLUDE()
+# -----------------
+# Check to see how make treats includes.
+AC_DEFUN([AM_MAKE_INCLUDE],
+[am_make=${MAKE-make}
+cat > confinc << 'END'
+am__doit:
+ @echo this is the am__doit target
+.PHONY: am__doit
+END
+# If we don't find an include directive, just comment out the code.
+AC_MSG_CHECKING([for style of include used by $am_make])
+am__include="#"
+am__quote=
+_am_result=none
+# First try GNU make style include.
+echo "include confinc" > confmf
+# Ignore all kinds of additional output from 'make'.
+case `$am_make -s -f confmf 2> /dev/null` in #(
+*the\ am__doit\ target*)
+ am__include=include
+ am__quote=
+ _am_result=GNU
+ ;;
+esac
+# Now try BSD make style include.
+if test "$am__include" = "#"; then
+ echo '.include "confinc"' > confmf
+ case `$am_make -s -f confmf 2> /dev/null` in #(
+ *the\ am__doit\ target*)
+ am__include=.include
+ am__quote="\""
+ _am_result=BSD
+ ;;
+ esac
+fi
+AC_SUBST([am__include])
+AC_SUBST([am__quote])
+AC_MSG_RESULT([$_am_result])
+rm -f confinc confmf
+])
+
+# Fake the existence of programs that GNU maintainers use. -*- Autoconf -*-
+
+# Copyright (C) 1997-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_MISSING_PROG(NAME, PROGRAM)
+# ------------------------------
+AC_DEFUN([AM_MISSING_PROG],
+[AC_REQUIRE([AM_MISSING_HAS_RUN])
+$1=${$1-"${am_missing_run}$2"}
+AC_SUBST($1)])
+
+# AM_MISSING_HAS_RUN
+# ------------------
+# Define MISSING if not defined so far and test if it is modern enough.
+# If it is, set am_missing_run to use it, otherwise, to nothing.
+AC_DEFUN([AM_MISSING_HAS_RUN],
+[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
+AC_REQUIRE_AUX_FILE([missing])dnl
+if test x"${MISSING+set}" != xset; then
+ case $am_aux_dir in
+ *\ * | *\ *)
+ MISSING="\${SHELL} \"$am_aux_dir/missing\"" ;;
+ *)
+ MISSING="\${SHELL} $am_aux_dir/missing" ;;
+ esac
+fi
+# Use eval to expand $SHELL
+if eval "$MISSING --is-lightweight"; then
+ am_missing_run="$MISSING "
+else
+ am_missing_run=
+ AC_MSG_WARN(['missing' script is too old or missing])
+fi
+])
+
+# Helper functions for option handling. -*- Autoconf -*-
+
+# Copyright (C) 2001-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# _AM_MANGLE_OPTION(NAME)
+# -----------------------
+AC_DEFUN([_AM_MANGLE_OPTION],
+[[_AM_OPTION_]m4_bpatsubst($1, [[^a-zA-Z0-9_]], [_])])
+
+# _AM_SET_OPTION(NAME)
+# --------------------
+# Set option NAME. Presently that only means defining a flag for this option.
+AC_DEFUN([_AM_SET_OPTION],
+[m4_define(_AM_MANGLE_OPTION([$1]), [1])])
+
+# _AM_SET_OPTIONS(OPTIONS)
+# ------------------------
+# OPTIONS is a space-separated list of Automake options.
+AC_DEFUN([_AM_SET_OPTIONS],
+[m4_foreach_w([_AM_Option], [$1], [_AM_SET_OPTION(_AM_Option)])])
+
+# _AM_IF_OPTION(OPTION, IF-SET, [IF-NOT-SET])
+# -------------------------------------------
+# Execute IF-SET if OPTION is set, IF-NOT-SET otherwise.
+AC_DEFUN([_AM_IF_OPTION],
+[m4_ifset(_AM_MANGLE_OPTION([$1]), [$2], [$3])])
+
+# Copyright (C) 1999-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# _AM_PROG_CC_C_O
+# ---------------
+# Like AC_PROG_CC_C_O, but changed for automake. We rewrite AC_PROG_CC
+# to automatically call this.
+AC_DEFUN([_AM_PROG_CC_C_O],
+[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
+AC_REQUIRE_AUX_FILE([compile])dnl
+AC_LANG_PUSH([C])dnl
+AC_CACHE_CHECK(
+ [whether $CC understands -c and -o together],
+ [am_cv_prog_cc_c_o],
+ [AC_LANG_CONFTEST([AC_LANG_PROGRAM([])])
+ # Make sure it works both with $CC and with simple cc.
+ # Following AC_PROG_CC_C_O, we do the test twice because some
+ # compilers refuse to overwrite an existing .o file with -o,
+ # though they will create one.
+ am_cv_prog_cc_c_o=yes
+ for am_i in 1 2; do
+ if AM_RUN_LOG([$CC -c conftest.$ac_ext -o conftest2.$ac_objext]) \
+ && test -f conftest2.$ac_objext; then
+ : OK
+ else
+ am_cv_prog_cc_c_o=no
+ break
+ fi
+ done
+ rm -f core conftest*
+ unset am_i])
+if test "$am_cv_prog_cc_c_o" != yes; then
+ # Losing compiler, so override with the script.
+ # FIXME: It is wrong to rewrite CC.
+ # But if we don't then we get into trouble of one sort or another.
+ # A longer-term fix would be to have automake use am__CC in this case,
+ # and then we could set am__CC="\$(top_srcdir)/compile \$(CC)"
+ CC="$am_aux_dir/compile $CC"
+fi
+AC_LANG_POP([C])])
+
+# For backward compatibility.
+AC_DEFUN_ONCE([AM_PROG_CC_C_O], [AC_REQUIRE([AC_PROG_CC])])
+
+# Copyright (C) 2001-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_RUN_LOG(COMMAND)
+# -------------------
+# Run COMMAND, save the exit status in ac_status, and log it.
+# (This has been adapted from Autoconf's _AC_RUN_LOG macro.)
+AC_DEFUN([AM_RUN_LOG],
+[{ echo "$as_me:$LINENO: $1" >&AS_MESSAGE_LOG_FD
+ ($1) >&AS_MESSAGE_LOG_FD 2>&AS_MESSAGE_LOG_FD
+ ac_status=$?
+ echo "$as_me:$LINENO: \$? = $ac_status" >&AS_MESSAGE_LOG_FD
+ (exit $ac_status); }])
+
+# Check to make sure that the build environment is sane. -*- Autoconf -*-
+
+# Copyright (C) 1996-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_SANITY_CHECK
+# ---------------
+AC_DEFUN([AM_SANITY_CHECK],
+[AC_MSG_CHECKING([whether build environment is sane])
+# Reject unsafe characters in $srcdir or the absolute working directory
+# name. Accept space and tab only in the latter.
+am_lf='
+'
+case `pwd` in
+ *[[\\\"\#\$\&\'\`$am_lf]]*)
+ AC_MSG_ERROR([unsafe absolute working directory name]);;
+esac
+case $srcdir in
+ *[[\\\"\#\$\&\'\`$am_lf\ \ ]]*)
+ AC_MSG_ERROR([unsafe srcdir value: '$srcdir']);;
+esac
+
+# Do 'set' in a subshell so we don't clobber the current shell's
+# arguments. Must try -L first in case configure is actually a
+# symlink; some systems play weird games with the mod time of symlinks
+# (eg FreeBSD returns the mod time of the symlink's containing
+# directory).
+if (
+ am_has_slept=no
+ for am_try in 1 2; do
+ echo "timestamp, slept: $am_has_slept" > conftest.file
+ set X `ls -Lt "$srcdir/configure" conftest.file 2> /dev/null`
+ if test "$[*]" = "X"; then
+ # -L didn't work.
+ set X `ls -t "$srcdir/configure" conftest.file`
+ fi
+ if test "$[*]" != "X $srcdir/configure conftest.file" \
+ && test "$[*]" != "X conftest.file $srcdir/configure"; then
+
+ # If neither matched, then we have a broken ls. This can happen
+ # if, for instance, CONFIG_SHELL is bash and it inherits a
+ # broken ls alias from the environment. This has actually
+ # happened. Such a system could not be considered "sane".
+ AC_MSG_ERROR([ls -t appears to fail. Make sure there is not a broken
+ alias in your environment])
+ fi
+ if test "$[2]" = conftest.file || test $am_try -eq 2; then
+ break
+ fi
+ # Just in case.
+ sleep 1
+ am_has_slept=yes
+ done
+ test "$[2]" = conftest.file
+ )
+then
+ # Ok.
+ :
+else
+ AC_MSG_ERROR([newly created file is older than distributed files!
+Check your system clock])
+fi
+AC_MSG_RESULT([yes])
+# If we didn't sleep, we still need to ensure time stamps of config.status and
+# generated files are strictly newer.
+am_sleep_pid=
+if grep 'slept: no' conftest.file >/dev/null 2>&1; then
+ ( sleep 1 ) &
+ am_sleep_pid=$!
+fi
+AC_CONFIG_COMMANDS_PRE(
+ [AC_MSG_CHECKING([that generated files are newer than configure])
+ if test -n "$am_sleep_pid"; then
+ # Hide warnings about reused PIDs.
+ wait $am_sleep_pid 2>/dev/null
+ fi
+ AC_MSG_RESULT([done])])
+rm -f conftest.file
+])
+
+# Copyright (C) 2009-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_SILENT_RULES([DEFAULT])
+# --------------------------
+# Enable less verbose build rules; with the default set to DEFAULT
+# ("yes" being less verbose, "no" or empty being verbose).
+AC_DEFUN([AM_SILENT_RULES],
+[AC_ARG_ENABLE([silent-rules], [dnl
+AS_HELP_STRING(
+ [--enable-silent-rules],
+ [less verbose build output (undo: "make V=1")])
+AS_HELP_STRING(
+ [--disable-silent-rules],
+ [verbose build output (undo: "make V=0")])dnl
+])
+case $enable_silent_rules in @%:@ (((
+ yes) AM_DEFAULT_VERBOSITY=0;;
+ no) AM_DEFAULT_VERBOSITY=1;;
+ *) AM_DEFAULT_VERBOSITY=m4_if([$1], [yes], [0], [1]);;
+esac
+dnl
+dnl A few 'make' implementations (e.g., NonStop OS and NextStep)
+dnl do not support nested variable expansions.
+dnl See automake bug#9928 and bug#10237.
+am_make=${MAKE-make}
+AC_CACHE_CHECK([whether $am_make supports nested variables],
+ [am_cv_make_support_nested_variables],
+ [if AS_ECHO([['TRUE=$(BAR$(V))
+BAR0=false
+BAR1=true
+V=1
+am__doit:
+ @$(TRUE)
+.PHONY: am__doit']]) | $am_make -f - >/dev/null 2>&1; then
+ am_cv_make_support_nested_variables=yes
+else
+ am_cv_make_support_nested_variables=no
+fi])
+if test $am_cv_make_support_nested_variables = yes; then
+ dnl Using '$V' instead of '$(V)' breaks IRIX make.
+ AM_V='$(V)'
+ AM_DEFAULT_V='$(AM_DEFAULT_VERBOSITY)'
+else
+ AM_V=$AM_DEFAULT_VERBOSITY
+ AM_DEFAULT_V=$AM_DEFAULT_VERBOSITY
+fi
+AC_SUBST([AM_V])dnl
+AM_SUBST_NOTMAKE([AM_V])dnl
+AC_SUBST([AM_DEFAULT_V])dnl
+AM_SUBST_NOTMAKE([AM_DEFAULT_V])dnl
+AC_SUBST([AM_DEFAULT_VERBOSITY])dnl
+AM_BACKSLASH='\'
+AC_SUBST([AM_BACKSLASH])dnl
+_AM_SUBST_NOTMAKE([AM_BACKSLASH])dnl
+])
+
+# Copyright (C) 2001-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# AM_PROG_INSTALL_STRIP
+# ---------------------
+# One issue with vendor 'install' (even GNU) is that you can't
+# specify the program used to strip binaries. This is especially
+# annoying in cross-compiling environments, where the build's strip
+# is unlikely to handle the host's binaries.
+# Fortunately install-sh will honor a STRIPPROG variable, so we
+# always use install-sh in "make install-strip", and initialize
+# STRIPPROG with the value of the STRIP variable (set by the user).
+AC_DEFUN([AM_PROG_INSTALL_STRIP],
+[AC_REQUIRE([AM_PROG_INSTALL_SH])dnl
+# Installed binaries are usually stripped using 'strip' when the user
+# run "make install-strip". However 'strip' might not be the right
+# tool to use in cross-compilation environments, therefore Automake
+# will honor the 'STRIP' environment variable to overrule this program.
+dnl Don't test for $cross_compiling = yes, because it might be 'maybe'.
+if test "$cross_compiling" != no; then
+ AC_CHECK_TOOL([STRIP], [strip], :)
+fi
+INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s"
+AC_SUBST([INSTALL_STRIP_PROGRAM])])
+
+# Copyright (C) 2006-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# _AM_SUBST_NOTMAKE(VARIABLE)
+# ---------------------------
+# Prevent Automake from outputting VARIABLE = @VARIABLE@ in Makefile.in.
+# This macro is traced by Automake.
+AC_DEFUN([_AM_SUBST_NOTMAKE])
+
+# AM_SUBST_NOTMAKE(VARIABLE)
+# --------------------------
+# Public sister of _AM_SUBST_NOTMAKE.
+AC_DEFUN([AM_SUBST_NOTMAKE], [_AM_SUBST_NOTMAKE($@)])
+
+# Check how to create a tarball. -*- Autoconf -*-
+
+# Copyright (C) 2004-2013 Free Software Foundation, Inc.
+#
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# _AM_PROG_TAR(FORMAT)
+# --------------------
+# Check how to create a tarball in format FORMAT.
+# FORMAT should be one of 'v7', 'ustar', or 'pax'.
+#
+# Substitute a variable $(am__tar) that is a command
+# writing to stdout a FORMAT-tarball containing the directory
+# $tardir.
+# tardir=directory && $(am__tar) > result.tar
+#
+# Substitute a variable $(am__untar) that extract such
+# a tarball read from stdin.
+# $(am__untar) < result.tar
+#
+AC_DEFUN([_AM_PROG_TAR],
+[# Always define AMTAR for backward compatibility. Yes, it's still used
+# in the wild :-( We should find a proper way to deprecate it ...
+AC_SUBST([AMTAR], ['$${TAR-tar}'])
+
+# We'll loop over all known methods to create a tar archive until one works.
+_am_tools='gnutar m4_if([$1], [ustar], [plaintar]) pax cpio none'
+
+m4_if([$1], [v7],
+ [am__tar='$${TAR-tar} chof - "$$tardir"' am__untar='$${TAR-tar} xf -'],
+
+ [m4_case([$1],
+ [ustar],
+ [# The POSIX 1988 'ustar' format is defined with fixed-size fields.
+ # There is notably a 21 bits limit for the UID and the GID. In fact,
+ # the 'pax' utility can hang on bigger UID/GID (see automake bug#8343
+ # and bug#13588).
+ am_max_uid=2097151 # 2^21 - 1
+ am_max_gid=$am_max_uid
+ # The $UID and $GID variables are not portable, so we need to resort
+ # to the POSIX-mandated id(1) utility. Errors in the 'id' calls
+ # below are definitely unexpected, so allow the users to see them
+ # (that is, avoid stderr redirection).
+ am_uid=`id -u || echo unknown`
+ am_gid=`id -g || echo unknown`
+ AC_MSG_CHECKING([whether UID '$am_uid' is supported by ustar format])
+ if test $am_uid -le $am_max_uid; then
+ AC_MSG_RESULT([yes])
+ else
+ AC_MSG_RESULT([no])
+ _am_tools=none
+ fi
+ AC_MSG_CHECKING([whether GID '$am_gid' is supported by ustar format])
+ if test $am_gid -le $am_max_gid; then
+ AC_MSG_RESULT([yes])
+ else
+ AC_MSG_RESULT([no])
+ _am_tools=none
+ fi],
+
+ [pax],
+ [],
+
+ [m4_fatal([Unknown tar format])])
+
+ AC_MSG_CHECKING([how to create a $1 tar archive])
+
+ # Go ahead even if we have the value already cached. We do so because we
+ # need to set the values for the 'am__tar' and 'am__untar' variables.
+ _am_tools=${am_cv_prog_tar_$1-$_am_tools}
+
+ for _am_tool in $_am_tools; do
+ case $_am_tool in
+ gnutar)
+ for _am_tar in tar gnutar gtar; do
+ AM_RUN_LOG([$_am_tar --version]) && break
+ done
+ am__tar="$_am_tar --format=m4_if([$1], [pax], [posix], [$1]) -chf - "'"$$tardir"'
+ am__tar_="$_am_tar --format=m4_if([$1], [pax], [posix], [$1]) -chf - "'"$tardir"'
+ am__untar="$_am_tar -xf -"
+ ;;
+ plaintar)
+ # Must skip GNU tar: if it does not support --format= it doesn't create
+ # ustar tarball either.
+ (tar --version) >/dev/null 2>&1 && continue
+ am__tar='tar chf - "$$tardir"'
+ am__tar_='tar chf - "$tardir"'
+ am__untar='tar xf -'
+ ;;
+ pax)
+ am__tar='pax -L -x $1 -w "$$tardir"'
+ am__tar_='pax -L -x $1 -w "$tardir"'
+ am__untar='pax -r'
+ ;;
+ cpio)
+ am__tar='find "$$tardir" -print | cpio -o -H $1 -L'
+ am__tar_='find "$tardir" -print | cpio -o -H $1 -L'
+ am__untar='cpio -i -H $1 -d'
+ ;;
+ none)
+ am__tar=false
+ am__tar_=false
+ am__untar=false
+ ;;
+ esac
+
+ # If the value was cached, stop now. We just wanted to have am__tar
+ # and am__untar set.
+ test -n "${am_cv_prog_tar_$1}" && break
+
+ # tar/untar a dummy directory, and stop if the command works.
+ rm -rf conftest.dir
+ mkdir conftest.dir
+ echo GrepMe > conftest.dir/file
+ AM_RUN_LOG([tardir=conftest.dir && eval $am__tar_ >conftest.tar])
+ rm -rf conftest.dir
+ if test -s conftest.tar; then
+ AM_RUN_LOG([$am__untar <conftest.tar])
+ AM_RUN_LOG([cat conftest.dir/file])
+ grep GrepMe conftest.dir/file >/dev/null 2>&1 && break
+ fi
+ done
+ rm -rf conftest.dir
+
+ AC_CACHE_VAL([am_cv_prog_tar_$1], [am_cv_prog_tar_$1=$_am_tool])
+ AC_MSG_RESULT([$am_cv_prog_tar_$1])])
+
+AC_SUBST([am__tar])
+AC_SUBST([am__untar])
+]) # _AM_PROG_TAR
+
+m4_include([m4/ax_cxx_compile_stdcxx_11.m4])
diff --git a/andi-manual.pdf b/andi-manual.pdf
new file mode 100644
index 0000000..0f731f6
Binary files /dev/null and b/andi-manual.pdf differ
diff --git a/ar-lib b/ar-lib
new file mode 100755
index 0000000..fe2301e
--- /dev/null
+++ b/ar-lib
@@ -0,0 +1,270 @@
+#! /bin/sh
+# Wrapper for Microsoft lib.exe
+
+me=ar-lib
+scriptversion=2012-03-01.08; # UTC
+
+# Copyright (C) 2010-2013 Free Software Foundation, Inc.
+# Written by Peter Rosin <peda at lysator.liu.se>.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+#
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program. If not, see <http://www.gnu.org/licenses/>.
+
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+# This file is maintained in Automake, please report
+# bugs to <bug-automake at gnu.org> or send patches to
+# <automake-patches at gnu.org>.
+
+
+# func_error message
+func_error ()
+{
+ echo "$me: $1" 1>&2
+ exit 1
+}
+
+file_conv=
+
+# func_file_conv build_file
+# Convert a $build file to $host form and store it in $file
+# Currently only supports Windows hosts.
+func_file_conv ()
+{
+ file=$1
+ case $file in
+ / | /[!/]*) # absolute file, and not a UNC file
+ if test -z "$file_conv"; then
+ # lazily determine how to convert abs files
+ case `uname -s` in
+ MINGW*)
+ file_conv=mingw
+ ;;
+ CYGWIN*)
+ file_conv=cygwin
+ ;;
+ *)
+ file_conv=wine
+ ;;
+ esac
+ fi
+ case $file_conv in
+ mingw)
+ file=`cmd //C echo "$file " | sed -e 's/"\(.*\) " *$/\1/'`
+ ;;
+ cygwin)
+ file=`cygpath -m "$file" || echo "$file"`
+ ;;
+ wine)
+ file=`winepath -w "$file" || echo "$file"`
+ ;;
+ esac
+ ;;
+ esac
+}
+
+# func_at_file at_file operation archive
+# Iterate over all members in AT_FILE performing OPERATION on ARCHIVE
+# for each of them.
+# When interpreting the content of the @FILE, do NOT use func_file_conv,
+# since the user would need to supply preconverted file names to
+# binutils ar, at least for MinGW.
+func_at_file ()
+{
+ operation=$2
+ archive=$3
+ at_file_contents=`cat "$1"`
+ eval set x "$at_file_contents"
+ shift
+
+ for member
+ do
+ $AR -NOLOGO $operation:"$member" "$archive" || exit $?
+ done
+}
+
+case $1 in
+ '')
+ func_error "no command. Try '$0 --help' for more information."
+ ;;
+ -h | --h*)
+ cat <<EOF
+Usage: $me [--help] [--version] PROGRAM ACTION ARCHIVE [MEMBER...]
+
+Members may be specified in a file named with @FILE.
+EOF
+ exit $?
+ ;;
+ -v | --v*)
+ echo "$me, version $scriptversion"
+ exit $?
+ ;;
+esac
+
+if test $# -lt 3; then
+ func_error "you must specify a program, an action and an archive"
+fi
+
+AR=$1
+shift
+while :
+do
+ if test $# -lt 2; then
+ func_error "you must specify a program, an action and an archive"
+ fi
+ case $1 in
+ -lib | -LIB \
+ | -ltcg | -LTCG \
+ | -machine* | -MACHINE* \
+ | -subsystem* | -SUBSYSTEM* \
+ | -verbose | -VERBOSE \
+ | -wx* | -WX* )
+ AR="$AR $1"
+ shift
+ ;;
+ *)
+ action=$1
+ shift
+ break
+ ;;
+ esac
+done
+orig_archive=$1
+shift
+func_file_conv "$orig_archive"
+archive=$file
+
+# strip leading dash in $action
+action=${action#-}
+
+delete=
+extract=
+list=
+quick=
+replace=
+index=
+create=
+
+while test -n "$action"
+do
+ case $action in
+ d*) delete=yes ;;
+ x*) extract=yes ;;
+ t*) list=yes ;;
+ q*) quick=yes ;;
+ r*) replace=yes ;;
+ s*) index=yes ;;
+ S*) ;; # the index is always updated implicitly
+ c*) create=yes ;;
+ u*) ;; # TODO: don't ignore the update modifier
+ v*) ;; # TODO: don't ignore the verbose modifier
+ *)
+ func_error "unknown action specified"
+ ;;
+ esac
+ action=${action#?}
+done
+
+case $delete$extract$list$quick$replace,$index in
+ yes,* | ,yes)
+ ;;
+ yesyes*)
+ func_error "more than one action specified"
+ ;;
+ *)
+ func_error "no action specified"
+ ;;
+esac
+
+if test -n "$delete"; then
+ if test ! -f "$orig_archive"; then
+ func_error "archive not found"
+ fi
+ for member
+ do
+ case $1 in
+ @*)
+ func_at_file "${1#@}" -REMOVE "$archive"
+ ;;
+ *)
+ func_file_conv "$1"
+ $AR -NOLOGO -REMOVE:"$file" "$archive" || exit $?
+ ;;
+ esac
+ done
+
+elif test -n "$extract"; then
+ if test ! -f "$orig_archive"; then
+ func_error "archive not found"
+ fi
+ if test $# -gt 0; then
+ for member
+ do
+ case $1 in
+ @*)
+ func_at_file "${1#@}" -EXTRACT "$archive"
+ ;;
+ *)
+ func_file_conv "$1"
+ $AR -NOLOGO -EXTRACT:"$file" "$archive" || exit $?
+ ;;
+ esac
+ done
+ else
+ $AR -NOLOGO -LIST "$archive" | sed -e 's/\\/\\\\/g' | while read member
+ do
+ $AR -NOLOGO -EXTRACT:"$member" "$archive" || exit $?
+ done
+ fi
+
+elif test -n "$quick$replace"; then
+ if test ! -f "$orig_archive"; then
+ if test -z "$create"; then
+ echo "$me: creating $orig_archive"
+ fi
+ orig_archive=
+ else
+ orig_archive=$archive
+ fi
+
+ for member
+ do
+ case $1 in
+ @*)
+ func_file_conv "${1#@}"
+ set x "$@" "@$file"
+ ;;
+ *)
+ func_file_conv "$1"
+ set x "$@" "$file"
+ ;;
+ esac
+ shift
+ shift
+ done
+
+ if test -n "$orig_archive"; then
+ $AR -NOLOGO -OUT:"$archive" "$orig_archive" "$@" || exit $?
+ else
+ $AR -NOLOGO -OUT:"$archive" "$@" || exit $?
+ fi
+
+elif test -n "$list"; then
+ if test ! -f "$orig_archive"; then
+ func_error "archive not found"
+ fi
+ $AR -NOLOGO -LIST "$archive" || exit $?
+fi
diff --git a/compile b/compile
new file mode 100755
index 0000000..531136b
--- /dev/null
+++ b/compile
@@ -0,0 +1,347 @@
+#! /bin/sh
+# Wrapper for compilers which do not understand '-c -o'.
+
+scriptversion=2012-10-14.11; # UTC
+
+# Copyright (C) 1999-2013 Free Software Foundation, Inc.
+# Written by Tom Tromey <tromey at cygnus.com>.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+#
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program. If not, see <http://www.gnu.org/licenses/>.
+
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+# This file is maintained in Automake, please report
+# bugs to <bug-automake at gnu.org> or send patches to
+# <automake-patches at gnu.org>.
+
+nl='
+'
+
+# We need space, tab and new line, in precisely that order. Quoting is
+# there to prevent tools from complaining about whitespace usage.
+IFS=" "" $nl"
+
+file_conv=
+
+# func_file_conv build_file lazy
+# Convert a $build file to $host form and store it in $file
+# Currently only supports Windows hosts. If the determined conversion
+# type is listed in (the comma separated) LAZY, no conversion will
+# take place.
+func_file_conv ()
+{
+ file=$1
+ case $file in
+ / | /[!/]*) # absolute file, and not a UNC file
+ if test -z "$file_conv"; then
+ # lazily determine how to convert abs files
+ case `uname -s` in
+ MINGW*)
+ file_conv=mingw
+ ;;
+ CYGWIN*)
+ file_conv=cygwin
+ ;;
+ *)
+ file_conv=wine
+ ;;
+ esac
+ fi
+ case $file_conv/,$2, in
+ *,$file_conv,*)
+ ;;
+ mingw/*)
+ file=`cmd //C echo "$file " | sed -e 's/"\(.*\) " *$/\1/'`
+ ;;
+ cygwin/*)
+ file=`cygpath -m "$file" || echo "$file"`
+ ;;
+ wine/*)
+ file=`winepath -w "$file" || echo "$file"`
+ ;;
+ esac
+ ;;
+ esac
+}
+
+# func_cl_dashL linkdir
+# Make cl look for libraries in LINKDIR
+func_cl_dashL ()
+{
+ func_file_conv "$1"
+ if test -z "$lib_path"; then
+ lib_path=$file
+ else
+ lib_path="$lib_path;$file"
+ fi
+ linker_opts="$linker_opts -LIBPATH:$file"
+}
+
+# func_cl_dashl library
+# Do a library search-path lookup for cl
+func_cl_dashl ()
+{
+ lib=$1
+ found=no
+ save_IFS=$IFS
+ IFS=';'
+ for dir in $lib_path $LIB
+ do
+ IFS=$save_IFS
+ if $shared && test -f "$dir/$lib.dll.lib"; then
+ found=yes
+ lib=$dir/$lib.dll.lib
+ break
+ fi
+ if test -f "$dir/$lib.lib"; then
+ found=yes
+ lib=$dir/$lib.lib
+ break
+ fi
+ if test -f "$dir/lib$lib.a"; then
+ found=yes
+ lib=$dir/lib$lib.a
+ break
+ fi
+ done
+ IFS=$save_IFS
+
+ if test "$found" != yes; then
+ lib=$lib.lib
+ fi
+}
+
+# func_cl_wrapper cl arg...
+# Adjust compile command to suit cl
+func_cl_wrapper ()
+{
+ # Assume a capable shell
+ lib_path=
+ shared=:
+ linker_opts=
+ for arg
+ do
+ if test -n "$eat"; then
+ eat=
+ else
+ case $1 in
+ -o)
+ # configure might choose to run compile as 'compile cc -o foo foo.c'.
+ eat=1
+ case $2 in
+ *.o | *.[oO][bB][jJ])
+ func_file_conv "$2"
+ set x "$@" -Fo"$file"
+ shift
+ ;;
+ *)
+ func_file_conv "$2"
+ set x "$@" -Fe"$file"
+ shift
+ ;;
+ esac
+ ;;
+ -I)
+ eat=1
+ func_file_conv "$2" mingw
+ set x "$@" -I"$file"
+ shift
+ ;;
+ -I*)
+ func_file_conv "${1#-I}" mingw
+ set x "$@" -I"$file"
+ shift
+ ;;
+ -l)
+ eat=1
+ func_cl_dashl "$2"
+ set x "$@" "$lib"
+ shift
+ ;;
+ -l*)
+ func_cl_dashl "${1#-l}"
+ set x "$@" "$lib"
+ shift
+ ;;
+ -L)
+ eat=1
+ func_cl_dashL "$2"
+ ;;
+ -L*)
+ func_cl_dashL "${1#-L}"
+ ;;
+ -static)
+ shared=false
+ ;;
+ -Wl,*)
+ arg=${1#-Wl,}
+ save_ifs="$IFS"; IFS=','
+ for flag in $arg; do
+ IFS="$save_ifs"
+ linker_opts="$linker_opts $flag"
+ done
+ IFS="$save_ifs"
+ ;;
+ -Xlinker)
+ eat=1
+ linker_opts="$linker_opts $2"
+ ;;
+ -*)
+ set x "$@" "$1"
+ shift
+ ;;
+ *.cc | *.CC | *.cxx | *.CXX | *.[cC]++)
+ func_file_conv "$1"
+ set x "$@" -Tp"$file"
+ shift
+ ;;
+ *.c | *.cpp | *.CPP | *.lib | *.LIB | *.Lib | *.OBJ | *.obj | *.[oO])
+ func_file_conv "$1" mingw
+ set x "$@" "$file"
+ shift
+ ;;
+ *)
+ set x "$@" "$1"
+ shift
+ ;;
+ esac
+ fi
+ shift
+ done
+ if test -n "$linker_opts"; then
+ linker_opts="-link$linker_opts"
+ fi
+ exec "$@" $linker_opts
+ exit 1
+}
+
+eat=
+
+case $1 in
+ '')
+ echo "$0: No command. Try '$0 --help' for more information." 1>&2
+ exit 1;
+ ;;
+ -h | --h*)
+ cat <<\EOF
+Usage: compile [--help] [--version] PROGRAM [ARGS]
+
+Wrapper for compilers which do not understand '-c -o'.
+Remove '-o dest.o' from ARGS, run PROGRAM with the remaining
+arguments, and rename the output as expected.
+
+If you are trying to build a whole package this is not the
+right script to run: please start by reading the file 'INSTALL'.
+
+Report bugs to <bug-automake at gnu.org>.
+EOF
+ exit $?
+ ;;
+ -v | --v*)
+ echo "compile $scriptversion"
+ exit $?
+ ;;
+ cl | *[/\\]cl | cl.exe | *[/\\]cl.exe )
+ func_cl_wrapper "$@" # Doesn't return...
+ ;;
+esac
+
+ofile=
+cfile=
+
+for arg
+do
+ if test -n "$eat"; then
+ eat=
+ else
+ case $1 in
+ -o)
+ # configure might choose to run compile as 'compile cc -o foo foo.c'.
+ # So we strip '-o arg' only if arg is an object.
+ eat=1
+ case $2 in
+ *.o | *.obj)
+ ofile=$2
+ ;;
+ *)
+ set x "$@" -o "$2"
+ shift
+ ;;
+ esac
+ ;;
+ *.c)
+ cfile=$1
+ set x "$@" "$1"
+ shift
+ ;;
+ *)
+ set x "$@" "$1"
+ shift
+ ;;
+ esac
+ fi
+ shift
+done
+
+if test -z "$ofile" || test -z "$cfile"; then
+ # If no '-o' option was seen then we might have been invoked from a
+ # pattern rule where we don't need one. That is ok -- this is a
+ # normal compilation that the losing compiler can handle. If no
+ # '.c' file was seen then we are probably linking. That is also
+ # ok.
+ exec "$@"
+fi
+
+# Name of file we expect compiler to create.
+cofile=`echo "$cfile" | sed 's|^.*[\\/]||; s|^[a-zA-Z]:||; s/\.c$/.o/'`
+
+# Create the lock directory.
+# Note: use '[/\\:.-]' here to ensure that we don't use the same name
+# that we are using for the .o file. Also, base the name on the expected
+# object file name, since that is what matters with a parallel build.
+lockdir=`echo "$cofile" | sed -e 's|[/\\:.-]|_|g'`.d
+while true; do
+ if mkdir "$lockdir" >/dev/null 2>&1; then
+ break
+ fi
+ sleep 1
+done
+# FIXME: race condition here if user kills between mkdir and trap.
+trap "rmdir '$lockdir'; exit 1" 1 2 15
+
+# Run the compile.
+"$@"
+ret=$?
+
+if test -f "$cofile"; then
+ test "$cofile" = "$ofile" || mv "$cofile" "$ofile"
+elif test -f "${cofile}bj"; then
+ test "${cofile}bj" = "$ofile" || mv "${cofile}bj" "$ofile"
+fi
+
+rmdir "$lockdir"
+exit $ret
+
+# Local Variables:
+# mode: shell-script
+# sh-indentation: 2
+# eval: (add-hook 'write-file-hooks 'time-stamp)
+# time-stamp-start: "scriptversion="
+# time-stamp-format: "%:y-%02m-%02d.%02H"
+# time-stamp-time-zone: "UTC"
+# time-stamp-end: "; # UTC"
+# End:
diff --git a/configure b/configure
new file mode 100755
index 0000000..4c02a85
--- /dev/null
+++ b/configure
@@ -0,0 +1,7968 @@
+#! /bin/sh
+# Guess values for system-dependent variables and create Makefiles.
+# Generated by GNU Autoconf 2.69 for andi 0.9.4.
+#
+#
+# Copyright (C) 1992-1996, 1998-2012 Free Software Foundation, Inc.
+#
+#
+# This configure script is free software; the Free Software Foundation
+# gives unlimited permission to copy, distribute and modify it.
+## -------------------- ##
+## M4sh Initialization. ##
+## -------------------- ##
+
+# Be more Bourne compatible
+DUALCASE=1; export DUALCASE # for MKS sh
+if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then :
+ emulate sh
+ NULLCMD=:
+ # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
+ # is contrary to our usage. Disable this feature.
+ alias -g '${1+"$@"}'='"$@"'
+ setopt NO_GLOB_SUBST
+else
+ case `(set -o) 2>/dev/null` in #(
+ *posix*) :
+ set -o posix ;; #(
+ *) :
+ ;;
+esac
+fi
+
+
+as_nl='
+'
+export as_nl
+# Printing a long string crashes Solaris 7 /usr/bin/printf.
+as_echo='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
+as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo
+as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo$as_echo
+# Prefer a ksh shell builtin over an external printf program on Solaris,
+# but without wasting forks for bash or zsh.
+if test -z "$BASH_VERSION$ZSH_VERSION" \
+ && (test "X`print -r -- $as_echo`" = "X$as_echo") 2>/dev/null; then
+ as_echo='print -r --'
+ as_echo_n='print -rn --'
+elif (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then
+ as_echo='printf %s\n'
+ as_echo_n='printf %s'
+else
+ if test "X`(/usr/ucb/echo -n -n $as_echo) 2>/dev/null`" = "X-n $as_echo"; then
+ as_echo_body='eval /usr/ucb/echo -n "$1$as_nl"'
+ as_echo_n='/usr/ucb/echo -n'
+ else
+ as_echo_body='eval expr "X$1" : "X\\(.*\\)"'
+ as_echo_n_body='eval
+ arg=$1;
+ case $arg in #(
+ *"$as_nl"*)
+ expr "X$arg" : "X\\(.*\\)$as_nl";
+ arg=`expr "X$arg" : ".*$as_nl\\(.*\\)"`;;
+ esac;
+ expr "X$arg" : "X\\(.*\\)" | tr -d "$as_nl"
+ '
+ export as_echo_n_body
+ as_echo_n='sh -c $as_echo_n_body as_echo'
+ fi
+ export as_echo_body
+ as_echo='sh -c $as_echo_body as_echo'
+fi
+
+# The user is always right.
+if test "${PATH_SEPARATOR+set}" != set; then
+ PATH_SEPARATOR=:
+ (PATH='/bin;/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 && {
+ (PATH='/bin:/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 ||
+ PATH_SEPARATOR=';'
+ }
+fi
+
+
+# IFS
+# We need space, tab and new line, in precisely that order. Quoting is
+# there to prevent editors from complaining about space-tab.
+# (If _AS_PATH_WALK were called with IFS unset, it would disable word
+# splitting by setting IFS to empty value.)
+IFS=" "" $as_nl"
+
+# Find who we are. Look in the path if we contain no directory separator.
+as_myself=
+case $0 in #((
+ *[\\/]* ) as_myself=$0 ;;
+ *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
+ done
+IFS=$as_save_IFS
+
+ ;;
+esac
+# We did not find ourselves, most probably we were run as `sh COMMAND'
+# in which case we are not to be found in the path.
+if test "x$as_myself" = x; then
+ as_myself=$0
+fi
+if test ! -f "$as_myself"; then
+ $as_echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2
+ exit 1
+fi
+
+# Unset variables that we do not need and which cause bugs (e.g. in
+# pre-3.0 UWIN ksh). But do not cause bugs in bash 2.01; the "|| exit 1"
+# suppresses any "Segmentation fault" message there. '((' could
+# trigger a bug in pdksh 5.2.14.
+for as_var in BASH_ENV ENV MAIL MAILPATH
+do eval test x\${$as_var+set} = xset \
+ && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || :
+done
+PS1='$ '
+PS2='> '
+PS4='+ '
+
+# NLS nuisances.
+LC_ALL=C
+export LC_ALL
+LANGUAGE=C
+export LANGUAGE
+
+# CDPATH.
+(unset CDPATH) >/dev/null 2>&1 && unset CDPATH
+
+# Use a proper internal environment variable to ensure we don't fall
+ # into an infinite loop, continuously re-executing ourselves.
+ if test x"${_as_can_reexec}" != xno && test "x$CONFIG_SHELL" != x; then
+ _as_can_reexec=no; export _as_can_reexec;
+ # We cannot yet assume a decent shell, so we have to provide a
+# neutralization value for shells without unset; and this also
+# works around shells that cannot unset nonexistent variables.
+# Preserve -v and -x to the replacement shell.
+BASH_ENV=/dev/null
+ENV=/dev/null
+(unset BASH_ENV) >/dev/null 2>&1 && unset BASH_ENV ENV
+case $- in # ((((
+ *v*x* | *x*v* ) as_opts=-vx ;;
+ *v* ) as_opts=-v ;;
+ *x* ) as_opts=-x ;;
+ * ) as_opts= ;;
+esac
+exec $CONFIG_SHELL $as_opts "$as_myself" ${1+"$@"}
+# Admittedly, this is quite paranoid, since all the known shells bail
+# out after a failed `exec'.
+$as_echo "$0: could not re-execute with $CONFIG_SHELL" >&2
+as_fn_exit 255
+ fi
+ # We don't want this to propagate to other subprocesses.
+ { _as_can_reexec=; unset _as_can_reexec;}
+if test "x$CONFIG_SHELL" = x; then
+ as_bourne_compatible="if test -n \"\${ZSH_VERSION+set}\" && (emulate sh) >/dev/null 2>&1; then :
+ emulate sh
+ NULLCMD=:
+ # Pre-4.2 versions of Zsh do word splitting on \${1+\"\$@\"}, which
+ # is contrary to our usage. Disable this feature.
+ alias -g '\${1+\"\$@\"}'='\"\$@\"'
+ setopt NO_GLOB_SUBST
+else
+ case \`(set -o) 2>/dev/null\` in #(
+ *posix*) :
+ set -o posix ;; #(
+ *) :
+ ;;
+esac
+fi
+"
+ as_required="as_fn_return () { (exit \$1); }
+as_fn_success () { as_fn_return 0; }
+as_fn_failure () { as_fn_return 1; }
+as_fn_ret_success () { return 0; }
+as_fn_ret_failure () { return 1; }
+
+exitcode=0
+as_fn_success || { exitcode=1; echo as_fn_success failed.; }
+as_fn_failure && { exitcode=1; echo as_fn_failure succeeded.; }
+as_fn_ret_success || { exitcode=1; echo as_fn_ret_success failed.; }
+as_fn_ret_failure && { exitcode=1; echo as_fn_ret_failure succeeded.; }
+if ( set x; as_fn_ret_success y && test x = \"\$1\" ); then :
+
+else
+ exitcode=1; echo positional parameters were not saved.
+fi
+test x\$exitcode = x0 || exit 1
+test -x / || exit 1"
+ as_suggested=" as_lineno_1=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_1a=\$LINENO
+ as_lineno_2=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_2a=\$LINENO
+ eval 'test \"x\$as_lineno_1'\$as_run'\" != \"x\$as_lineno_2'\$as_run'\" &&
+ test \"x\`expr \$as_lineno_1'\$as_run' + 1\`\" = \"x\$as_lineno_2'\$as_run'\"' || exit 1
+test \$(( 1 + 1 )) = 2 || exit 1"
+ if (eval "$as_required") 2>/dev/null; then :
+ as_have_required=yes
+else
+ as_have_required=no
+fi
+ if test x$as_have_required = xyes && (eval "$as_suggested") 2>/dev/null; then :
+
+else
+ as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+as_found=false
+for as_dir in /bin$PATH_SEPARATOR/usr/bin$PATH_SEPARATOR$PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ as_found=:
+ case $as_dir in #(
+ /*)
+ for as_base in sh bash ksh sh5; do
+ # Try only shells that exist, to save several forks.
+ as_shell=$as_dir/$as_base
+ if { test -f "$as_shell" || test -f "$as_shell.exe"; } &&
+ { $as_echo "$as_bourne_compatible""$as_required" | as_run=a "$as_shell"; } 2>/dev/null; then :
+ CONFIG_SHELL=$as_shell as_have_required=yes
+ if { $as_echo "$as_bourne_compatible""$as_suggested" | as_run=a "$as_shell"; } 2>/dev/null; then :
+ break 2
+fi
+fi
+ done;;
+ esac
+ as_found=false
+done
+$as_found || { if { test -f "$SHELL" || test -f "$SHELL.exe"; } &&
+ { $as_echo "$as_bourne_compatible""$as_required" | as_run=a "$SHELL"; } 2>/dev/null; then :
+ CONFIG_SHELL=$SHELL as_have_required=yes
+fi; }
+IFS=$as_save_IFS
+
+
+ if test "x$CONFIG_SHELL" != x; then :
+ export CONFIG_SHELL
+ # We cannot yet assume a decent shell, so we have to provide a
+# neutralization value for shells without unset; and this also
+# works around shells that cannot unset nonexistent variables.
+# Preserve -v and -x to the replacement shell.
+BASH_ENV=/dev/null
+ENV=/dev/null
+(unset BASH_ENV) >/dev/null 2>&1 && unset BASH_ENV ENV
+case $- in # ((((
+ *v*x* | *x*v* ) as_opts=-vx ;;
+ *v* ) as_opts=-v ;;
+ *x* ) as_opts=-x ;;
+ * ) as_opts= ;;
+esac
+exec $CONFIG_SHELL $as_opts "$as_myself" ${1+"$@"}
+# Admittedly, this is quite paranoid, since all the known shells bail
+# out after a failed `exec'.
+$as_echo "$0: could not re-execute with $CONFIG_SHELL" >&2
+exit 255
+fi
+
+ if test x$as_have_required = xno; then :
+ $as_echo "$0: This script requires a shell more modern than all"
+ $as_echo "$0: the shells that I found on your system."
+ if test x${ZSH_VERSION+set} = xset ; then
+ $as_echo "$0: In particular, zsh $ZSH_VERSION has bugs and should"
+ $as_echo "$0: be upgraded to zsh 4.3.4 or later."
+ else
+ $as_echo "$0: Please tell bug-autoconf at gnu.org about your system,
+$0: including any error possibly output before this
+$0: message. Then install a modern shell, or manually run
+$0: the script under such a shell if you do have one."
+ fi
+ exit 1
+fi
+fi
+fi
+SHELL=${CONFIG_SHELL-/bin/sh}
+export SHELL
+# Unset more variables known to interfere with behavior of common tools.
+CLICOLOR_FORCE= GREP_OPTIONS=
+unset CLICOLOR_FORCE GREP_OPTIONS
+
+## --------------------- ##
+## M4sh Shell Functions. ##
+## --------------------- ##
+# as_fn_unset VAR
+# ---------------
+# Portably unset VAR.
+as_fn_unset ()
+{
+ { eval $1=; unset $1;}
+}
+as_unset=as_fn_unset
+
+# as_fn_set_status STATUS
+# -----------------------
+# Set $? to STATUS, without forking.
+as_fn_set_status ()
+{
+ return $1
+} # as_fn_set_status
+
+# as_fn_exit STATUS
+# -----------------
+# Exit the shell with STATUS, even in a "trap 0" or "set -e" context.
+as_fn_exit ()
+{
+ set +e
+ as_fn_set_status $1
+ exit $1
+} # as_fn_exit
+
+# as_fn_mkdir_p
+# -------------
+# Create "$as_dir" as a directory, including parents if necessary.
+as_fn_mkdir_p ()
+{
+
+ case $as_dir in #(
+ -*) as_dir=./$as_dir;;
+ esac
+ test -d "$as_dir" || eval $as_mkdir_p || {
+ as_dirs=
+ while :; do
+ case $as_dir in #(
+ *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
+ *) as_qdir=$as_dir;;
+ esac
+ as_dirs="'$as_qdir' $as_dirs"
+ as_dir=`$as_dirname -- "$as_dir" ||
+$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+ X"$as_dir" : 'X\(//\)[^/]' \| \
+ X"$as_dir" : 'X\(//\)$' \| \
+ X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X"$as_dir" |
+ sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)[^/].*/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\).*/{
+ s//\1/
+ q
+ }
+ s/.*/./; q'`
+ test -d "$as_dir" && break
+ done
+ test -z "$as_dirs" || eval "mkdir $as_dirs"
+ } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir"
+
+
+} # as_fn_mkdir_p
+
+# as_fn_executable_p FILE
+# -----------------------
+# Test if FILE is an executable regular file.
+as_fn_executable_p ()
+{
+ test -f "$1" && test -x "$1"
+} # as_fn_executable_p
+# as_fn_append VAR VALUE
+# ----------------------
+# Append the text in VALUE to the end of the definition contained in VAR. Take
+# advantage of any shell optimizations that allow amortized linear growth over
+# repeated appends, instead of the typical quadratic growth present in naive
+# implementations.
+if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null; then :
+ eval 'as_fn_append ()
+ {
+ eval $1+=\$2
+ }'
+else
+ as_fn_append ()
+ {
+ eval $1=\$$1\$2
+ }
+fi # as_fn_append
+
+# as_fn_arith ARG...
+# ------------------
+# Perform arithmetic evaluation on the ARGs, and store the result in the
+# global $as_val. Take advantage of shells that can avoid forks. The arguments
+# must be portable across $(()) and expr.
+if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null; then :
+ eval 'as_fn_arith ()
+ {
+ as_val=$(( $* ))
+ }'
+else
+ as_fn_arith ()
+ {
+ as_val=`expr "$@" || test $? -eq 1`
+ }
+fi # as_fn_arith
+
+
+# as_fn_error STATUS ERROR [LINENO LOG_FD]
+# ----------------------------------------
+# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are
+# provided, also output the error to LOG_FD, referencing LINENO. Then exit the
+# script with STATUS, using 1 if that was 0.
+as_fn_error ()
+{
+ as_status=$1; test $as_status -eq 0 && as_status=1
+ if test "$4"; then
+ as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ $as_echo "$as_me:${as_lineno-$LINENO}: error: $2" >&$4
+ fi
+ $as_echo "$as_me: error: $2" >&2
+ as_fn_exit $as_status
+} # as_fn_error
+
+if expr a : '\(a\)' >/dev/null 2>&1 &&
+ test "X`expr 00001 : '.*\(...\)'`" = X001; then
+ as_expr=expr
+else
+ as_expr=false
+fi
+
+if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then
+ as_basename=basename
+else
+ as_basename=false
+fi
+
+if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
+ as_dirname=dirname
+else
+ as_dirname=false
+fi
+
+as_me=`$as_basename -- "$0" ||
+$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
+ X"$0" : 'X\(//\)$' \| \
+ X"$0" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X/"$0" |
+ sed '/^.*\/\([^/][^/]*\)\/*$/{
+ s//\1/
+ q
+ }
+ /^X\/\(\/\/\)$/{
+ s//\1/
+ q
+ }
+ /^X\/\(\/\).*/{
+ s//\1/
+ q
+ }
+ s/.*/./; q'`
+
+# Avoid depending upon Character Ranges.
+as_cr_letters='abcdefghijklmnopqrstuvwxyz'
+as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
+as_cr_Letters=$as_cr_letters$as_cr_LETTERS
+as_cr_digits='0123456789'
+as_cr_alnum=$as_cr_Letters$as_cr_digits
+
+
+ as_lineno_1=$LINENO as_lineno_1a=$LINENO
+ as_lineno_2=$LINENO as_lineno_2a=$LINENO
+ eval 'test "x$as_lineno_1'$as_run'" != "x$as_lineno_2'$as_run'" &&
+ test "x`expr $as_lineno_1'$as_run' + 1`" = "x$as_lineno_2'$as_run'"' || {
+ # Blame Lee E. McMahon (1931-1989) for sed's syntax. :-)
+ sed -n '
+ p
+ /[$]LINENO/=
+ ' <$as_myself |
+ sed '
+ s/[$]LINENO.*/&-/
+ t lineno
+ b
+ :lineno
+ N
+ :loop
+ s/[$]LINENO\([^'$as_cr_alnum'_].*\n\)\(.*\)/\2\1\2/
+ t loop
+ s/-\n.*//
+ ' >$as_me.lineno &&
+ chmod +x "$as_me.lineno" ||
+ { $as_echo "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2; as_fn_exit 1; }
+
+ # If we had to re-execute with $CONFIG_SHELL, we're ensured to have
+ # already done that, so ensure we don't try to do so again and fall
+ # in an infinite loop. This has already happened in practice.
+ _as_can_reexec=no; export _as_can_reexec
+ # Don't try to exec as it changes $[0], causing all sort of problems
+ # (the dirname of $[0] is not the place where we might find the
+ # original and so on. Autoconf is especially sensitive to this).
+ . "./$as_me.lineno"
+ # Exit status is that of the last command.
+ exit
+}
+
+ECHO_C= ECHO_N= ECHO_T=
+case `echo -n x` in #(((((
+-n*)
+ case `echo 'xy\c'` in
+ *c*) ECHO_T=' ';; # ECHO_T is single tab character.
+ xy) ECHO_C='\c';;
+ *) echo `echo ksh88 bug on AIX 6.1` > /dev/null
+ ECHO_T=' ';;
+ esac;;
+*)
+ ECHO_N='-n';;
+esac
+
+rm -f conf$$ conf$$.exe conf$$.file
+if test -d conf$$.dir; then
+ rm -f conf$$.dir/conf$$.file
+else
+ rm -f conf$$.dir
+ mkdir conf$$.dir 2>/dev/null
+fi
+if (echo >conf$$.file) 2>/dev/null; then
+ if ln -s conf$$.file conf$$ 2>/dev/null; then
+ as_ln_s='ln -s'
+ # ... but there are two gotchas:
+ # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail.
+ # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable.
+ # In both cases, we have to default to `cp -pR'.
+ ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe ||
+ as_ln_s='cp -pR'
+ elif ln conf$$.file conf$$ 2>/dev/null; then
+ as_ln_s=ln
+ else
+ as_ln_s='cp -pR'
+ fi
+else
+ as_ln_s='cp -pR'
+fi
+rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file
+rmdir conf$$.dir 2>/dev/null
+
+if mkdir -p . 2>/dev/null; then
+ as_mkdir_p='mkdir -p "$as_dir"'
+else
+ test -d ./-p && rmdir ./-p
+ as_mkdir_p=false
+fi
+
+as_test_x='test -x'
+as_executable_p=as_fn_executable_p
+
+# Sed expression to map a string onto a valid CPP name.
+as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'"
+
+# Sed expression to map a string onto a valid variable name.
+as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'"
+
+
+test -n "$DJDIR" || exec 7<&0 </dev/null
+exec 6>&1
+
+# Name of the host.
+# hostname on some systems (SVR3.2, old GNU/Linux) returns a bogus exit status,
+# so uname gets run too.
+ac_hostname=`(hostname || uname -n) 2>/dev/null | sed 1q`
+
+#
+# Initializations.
+#
+ac_default_prefix=/usr/local
+ac_clean_files=
+ac_config_libobj_dir=.
+LIBOBJS=
+cross_compiling=no
+subdirs=
+MFLAGS=
+MAKEFLAGS=
+
+# Identity of this package.
+PACKAGE_NAME='andi'
+PACKAGE_TARNAME='andi'
+PACKAGE_VERSION='0.9.4'
+PACKAGE_STRING='andi 0.9.4'
+PACKAGE_BUGREPORT=''
+PACKAGE_URL=''
+
+# Factoring default headers for most tests.
+ac_includes_default="\
+#include <stdio.h>
+#ifdef HAVE_SYS_TYPES_H
+# include <sys/types.h>
+#endif
+#ifdef HAVE_SYS_STAT_H
+# include <sys/stat.h>
+#endif
+#ifdef STDC_HEADERS
+# include <stdlib.h>
+# include <stddef.h>
+#else
+# ifdef HAVE_STDLIB_H
+# include <stdlib.h>
+# endif
+#endif
+#ifdef HAVE_STRING_H
+# if !defined STDC_HEADERS && defined HAVE_MEMORY_H
+# include <memory.h>
+# endif
+# include <string.h>
+#endif
+#ifdef HAVE_STRINGS_H
+# include <strings.h>
+#endif
+#ifdef HAVE_INTTYPES_H
+# include <inttypes.h>
+#endif
+#ifdef HAVE_STDINT_H
+# include <stdint.h>
+#endif
+#ifdef HAVE_UNISTD_H
+# include <unistd.h>
+#endif"
+
+ac_subst_vars='am__EXEEXT_FALSE
+am__EXEEXT_TRUE
+LTLIBOBJS
+LIBOBJS
+HAVE_STRCHRNUL_FALSE
+HAVE_STRCHRNUL_TRUE
+HAVE_REALLOCARRAY_FALSE
+HAVE_REALLOCARRAY_TRUE
+GLIB_LIBS
+GLIB_CFLAGS
+PKG_CONFIG_LIBDIR
+PKG_CONFIG_PATH
+PKG_CONFIG
+BUILD_TESTS_FALSE
+BUILD_TESTS_TRUE
+BUILD_WITH_LIBDIVSUFSORT_FALSE
+BUILD_WITH_LIBDIVSUFSORT_TRUE
+HAVE_CXX11
+EGREP
+GREP
+OPENMP_CFLAGS
+OPENMP_CXXFLAGS
+ac_ct_AR
+AR
+RANLIB
+CPP
+am__fastdepCXX_FALSE
+am__fastdepCXX_TRUE
+CXXDEPMODE
+ac_ct_CXX
+CXXFLAGS
+CXX
+am__fastdepCC_FALSE
+am__fastdepCC_TRUE
+CCDEPMODE
+am__nodep
+AMDEPBACKSLASH
+AMDEP_FALSE
+AMDEP_TRUE
+am__quote
+am__include
+DEPDIR
+OBJEXT
+EXEEXT
+ac_ct_CC
+CPPFLAGS
+LDFLAGS
+CFLAGS
+CC
+AM_BACKSLASH
+AM_DEFAULT_VERBOSITY
+AM_DEFAULT_V
+AM_V
+am__untar
+am__tar
+AMTAR
+am__leading_dot
+SET_MAKE
+AWK
+mkdir_p
+MKDIR_P
+INSTALL_STRIP_PROGRAM
+STRIP
+install_sh
+MAKEINFO
+AUTOHEADER
+AUTOMAKE
+AUTOCONF
+ACLOCAL
+VERSION
+PACKAGE
+CYGPATH_W
+am__isrc
+INSTALL_DATA
+INSTALL_SCRIPT
+INSTALL_PROGRAM
+target_alias
+host_alias
+build_alias
+LIBS
+ECHO_T
+ECHO_N
+ECHO_C
+DEFS
+mandir
+localedir
+libdir
+psdir
+pdfdir
+dvidir
+htmldir
+infodir
+docdir
+oldincludedir
+includedir
+localstatedir
+sharedstatedir
+sysconfdir
+datadir
+datarootdir
+libexecdir
+sbindir
+bindir
+program_transform_name
+prefix
+exec_prefix
+PACKAGE_URL
+PACKAGE_BUGREPORT
+PACKAGE_STRING
+PACKAGE_VERSION
+PACKAGE_TARNAME
+PACKAGE_NAME
+PATH_SEPARATOR
+SHELL'
+ac_subst_files=''
+ac_user_opts='
+enable_option_checking
+enable_silent_rules
+enable_dependency_tracking
+enable_openmp
+with_libdivsufsort
+enable_unit_tests
+'
+ ac_precious_vars='build_alias
+host_alias
+target_alias
+CC
+CFLAGS
+LDFLAGS
+LIBS
+CPPFLAGS
+CXX
+CXXFLAGS
+CCC
+CPP
+PKG_CONFIG
+PKG_CONFIG_PATH
+PKG_CONFIG_LIBDIR
+GLIB_CFLAGS
+GLIB_LIBS'
+
+
+# Initialize some variables set by options.
+ac_init_help=
+ac_init_version=false
+ac_unrecognized_opts=
+ac_unrecognized_sep=
+# The variables have the same names as the options, with
+# dashes changed to underlines.
+cache_file=/dev/null
+exec_prefix=NONE
+no_create=
+no_recursion=
+prefix=NONE
+program_prefix=NONE
+program_suffix=NONE
+program_transform_name=s,x,x,
+silent=
+site=
+srcdir=
+verbose=
+x_includes=NONE
+x_libraries=NONE
+
+# Installation directory options.
+# These are left unexpanded so users can "make install exec_prefix=/foo"
+# and all the variables that are supposed to be based on exec_prefix
+# by default will actually change.
+# Use braces instead of parens because sh, perl, etc. also accept them.
+# (The list follows the same order as the GNU Coding Standards.)
+bindir='${exec_prefix}/bin'
+sbindir='${exec_prefix}/sbin'
+libexecdir='${exec_prefix}/libexec'
+datarootdir='${prefix}/share'
+datadir='${datarootdir}'
+sysconfdir='${prefix}/etc'
+sharedstatedir='${prefix}/com'
+localstatedir='${prefix}/var'
+includedir='${prefix}/include'
+oldincludedir='/usr/include'
+docdir='${datarootdir}/doc/${PACKAGE_TARNAME}'
+infodir='${datarootdir}/info'
+htmldir='${docdir}'
+dvidir='${docdir}'
+pdfdir='${docdir}'
+psdir='${docdir}'
+libdir='${exec_prefix}/lib'
+localedir='${datarootdir}/locale'
+mandir='${datarootdir}/man'
+
+ac_prev=
+ac_dashdash=
+for ac_option
+do
+ # If the previous option needs an argument, assign it.
+ if test -n "$ac_prev"; then
+ eval $ac_prev=\$ac_option
+ ac_prev=
+ continue
+ fi
+
+ case $ac_option in
+ *=?*) ac_optarg=`expr "X$ac_option" : '[^=]*=\(.*\)'` ;;
+ *=) ac_optarg= ;;
+ *) ac_optarg=yes ;;
+ esac
+
+ # Accept the important Cygnus configure options, so we can diagnose typos.
+
+ case $ac_dashdash$ac_option in
+ --)
+ ac_dashdash=yes ;;
+
+ -bindir | --bindir | --bindi | --bind | --bin | --bi)
+ ac_prev=bindir ;;
+ -bindir=* | --bindir=* | --bindi=* | --bind=* | --bin=* | --bi=*)
+ bindir=$ac_optarg ;;
+
+ -build | --build | --buil | --bui | --bu)
+ ac_prev=build_alias ;;
+ -build=* | --build=* | --buil=* | --bui=* | --bu=*)
+ build_alias=$ac_optarg ;;
+
+ -cache-file | --cache-file | --cache-fil | --cache-fi \
+ | --cache-f | --cache- | --cache | --cach | --cac | --ca | --c)
+ ac_prev=cache_file ;;
+ -cache-file=* | --cache-file=* | --cache-fil=* | --cache-fi=* \
+ | --cache-f=* | --cache-=* | --cache=* | --cach=* | --cac=* | --ca=* | --c=*)
+ cache_file=$ac_optarg ;;
+
+ --config-cache | -C)
+ cache_file=config.cache ;;
+
+ -datadir | --datadir | --datadi | --datad)
+ ac_prev=datadir ;;
+ -datadir=* | --datadir=* | --datadi=* | --datad=*)
+ datadir=$ac_optarg ;;
+
+ -datarootdir | --datarootdir | --datarootdi | --datarootd | --dataroot \
+ | --dataroo | --dataro | --datar)
+ ac_prev=datarootdir ;;
+ -datarootdir=* | --datarootdir=* | --datarootdi=* | --datarootd=* \
+ | --dataroot=* | --dataroo=* | --dataro=* | --datar=*)
+ datarootdir=$ac_optarg ;;
+
+ -disable-* | --disable-*)
+ ac_useropt=`expr "x$ac_option" : 'x-*disable-\(.*\)'`
+ # Reject names that are not valid shell variable names.
+ expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+ as_fn_error $? "invalid feature name: $ac_useropt"
+ ac_useropt_orig=$ac_useropt
+ ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
+ case $ac_user_opts in
+ *"
+"enable_$ac_useropt"
+"*) ;;
+ *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--disable-$ac_useropt_orig"
+ ac_unrecognized_sep=', ';;
+ esac
+ eval enable_$ac_useropt=no ;;
+
+ -docdir | --docdir | --docdi | --doc | --do)
+ ac_prev=docdir ;;
+ -docdir=* | --docdir=* | --docdi=* | --doc=* | --do=*)
+ docdir=$ac_optarg ;;
+
+ -dvidir | --dvidir | --dvidi | --dvid | --dvi | --dv)
+ ac_prev=dvidir ;;
+ -dvidir=* | --dvidir=* | --dvidi=* | --dvid=* | --dvi=* | --dv=*)
+ dvidir=$ac_optarg ;;
+
+ -enable-* | --enable-*)
+ ac_useropt=`expr "x$ac_option" : 'x-*enable-\([^=]*\)'`
+ # Reject names that are not valid shell variable names.
+ expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+ as_fn_error $? "invalid feature name: $ac_useropt"
+ ac_useropt_orig=$ac_useropt
+ ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
+ case $ac_user_opts in
+ *"
+"enable_$ac_useropt"
+"*) ;;
+ *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--enable-$ac_useropt_orig"
+ ac_unrecognized_sep=', ';;
+ esac
+ eval enable_$ac_useropt=\$ac_optarg ;;
+
+ -exec-prefix | --exec_prefix | --exec-prefix | --exec-prefi \
+ | --exec-pref | --exec-pre | --exec-pr | --exec-p | --exec- \
+ | --exec | --exe | --ex)
+ ac_prev=exec_prefix ;;
+ -exec-prefix=* | --exec_prefix=* | --exec-prefix=* | --exec-prefi=* \
+ | --exec-pref=* | --exec-pre=* | --exec-pr=* | --exec-p=* | --exec-=* \
+ | --exec=* | --exe=* | --ex=*)
+ exec_prefix=$ac_optarg ;;
+
+ -gas | --gas | --ga | --g)
+ # Obsolete; use --with-gas.
+ with_gas=yes ;;
+
+ -help | --help | --hel | --he | -h)
+ ac_init_help=long ;;
+ -help=r* | --help=r* | --hel=r* | --he=r* | -hr*)
+ ac_init_help=recursive ;;
+ -help=s* | --help=s* | --hel=s* | --he=s* | -hs*)
+ ac_init_help=short ;;
+
+ -host | --host | --hos | --ho)
+ ac_prev=host_alias ;;
+ -host=* | --host=* | --hos=* | --ho=*)
+ host_alias=$ac_optarg ;;
+
+ -htmldir | --htmldir | --htmldi | --htmld | --html | --htm | --ht)
+ ac_prev=htmldir ;;
+ -htmldir=* | --htmldir=* | --htmldi=* | --htmld=* | --html=* | --htm=* \
+ | --ht=*)
+ htmldir=$ac_optarg ;;
+
+ -includedir | --includedir | --includedi | --included | --include \
+ | --includ | --inclu | --incl | --inc)
+ ac_prev=includedir ;;
+ -includedir=* | --includedir=* | --includedi=* | --included=* | --include=* \
+ | --includ=* | --inclu=* | --incl=* | --inc=*)
+ includedir=$ac_optarg ;;
+
+ -infodir | --infodir | --infodi | --infod | --info | --inf)
+ ac_prev=infodir ;;
+ -infodir=* | --infodir=* | --infodi=* | --infod=* | --info=* | --inf=*)
+ infodir=$ac_optarg ;;
+
+ -libdir | --libdir | --libdi | --libd)
+ ac_prev=libdir ;;
+ -libdir=* | --libdir=* | --libdi=* | --libd=*)
+ libdir=$ac_optarg ;;
+
+ -libexecdir | --libexecdir | --libexecdi | --libexecd | --libexec \
+ | --libexe | --libex | --libe)
+ ac_prev=libexecdir ;;
+ -libexecdir=* | --libexecdir=* | --libexecdi=* | --libexecd=* | --libexec=* \
+ | --libexe=* | --libex=* | --libe=*)
+ libexecdir=$ac_optarg ;;
+
+ -localedir | --localedir | --localedi | --localed | --locale)
+ ac_prev=localedir ;;
+ -localedir=* | --localedir=* | --localedi=* | --localed=* | --locale=*)
+ localedir=$ac_optarg ;;
+
+ -localstatedir | --localstatedir | --localstatedi | --localstated \
+ | --localstate | --localstat | --localsta | --localst | --locals)
+ ac_prev=localstatedir ;;
+ -localstatedir=* | --localstatedir=* | --localstatedi=* | --localstated=* \
+ | --localstate=* | --localstat=* | --localsta=* | --localst=* | --locals=*)
+ localstatedir=$ac_optarg ;;
+
+ -mandir | --mandir | --mandi | --mand | --man | --ma | --m)
+ ac_prev=mandir ;;
+ -mandir=* | --mandir=* | --mandi=* | --mand=* | --man=* | --ma=* | --m=*)
+ mandir=$ac_optarg ;;
+
+ -nfp | --nfp | --nf)
+ # Obsolete; use --without-fp.
+ with_fp=no ;;
+
+ -no-create | --no-create | --no-creat | --no-crea | --no-cre \
+ | --no-cr | --no-c | -n)
+ no_create=yes ;;
+
+ -no-recursion | --no-recursion | --no-recursio | --no-recursi \
+ | --no-recurs | --no-recur | --no-recu | --no-rec | --no-re | --no-r)
+ no_recursion=yes ;;
+
+ -oldincludedir | --oldincludedir | --oldincludedi | --oldincluded \
+ | --oldinclude | --oldinclud | --oldinclu | --oldincl | --oldinc \
+ | --oldin | --oldi | --old | --ol | --o)
+ ac_prev=oldincludedir ;;
+ -oldincludedir=* | --oldincludedir=* | --oldincludedi=* | --oldincluded=* \
+ | --oldinclude=* | --oldinclud=* | --oldinclu=* | --oldincl=* | --oldinc=* \
+ | --oldin=* | --oldi=* | --old=* | --ol=* | --o=*)
+ oldincludedir=$ac_optarg ;;
+
+ -prefix | --prefix | --prefi | --pref | --pre | --pr | --p)
+ ac_prev=prefix ;;
+ -prefix=* | --prefix=* | --prefi=* | --pref=* | --pre=* | --pr=* | --p=*)
+ prefix=$ac_optarg ;;
+
+ -program-prefix | --program-prefix | --program-prefi | --program-pref \
+ | --program-pre | --program-pr | --program-p)
+ ac_prev=program_prefix ;;
+ -program-prefix=* | --program-prefix=* | --program-prefi=* \
+ | --program-pref=* | --program-pre=* | --program-pr=* | --program-p=*)
+ program_prefix=$ac_optarg ;;
+
+ -program-suffix | --program-suffix | --program-suffi | --program-suff \
+ | --program-suf | --program-su | --program-s)
+ ac_prev=program_suffix ;;
+ -program-suffix=* | --program-suffix=* | --program-suffi=* \
+ | --program-suff=* | --program-suf=* | --program-su=* | --program-s=*)
+ program_suffix=$ac_optarg ;;
+
+ -program-transform-name | --program-transform-name \
+ | --program-transform-nam | --program-transform-na \
+ | --program-transform-n | --program-transform- \
+ | --program-transform | --program-transfor \
+ | --program-transfo | --program-transf \
+ | --program-trans | --program-tran \
+ | --progr-tra | --program-tr | --program-t)
+ ac_prev=program_transform_name ;;
+ -program-transform-name=* | --program-transform-name=* \
+ | --program-transform-nam=* | --program-transform-na=* \
+ | --program-transform-n=* | --program-transform-=* \
+ | --program-transform=* | --program-transfor=* \
+ | --program-transfo=* | --program-transf=* \
+ | --program-trans=* | --program-tran=* \
+ | --progr-tra=* | --program-tr=* | --program-t=*)
+ program_transform_name=$ac_optarg ;;
+
+ -pdfdir | --pdfdir | --pdfdi | --pdfd | --pdf | --pd)
+ ac_prev=pdfdir ;;
+ -pdfdir=* | --pdfdir=* | --pdfdi=* | --pdfd=* | --pdf=* | --pd=*)
+ pdfdir=$ac_optarg ;;
+
+ -psdir | --psdir | --psdi | --psd | --ps)
+ ac_prev=psdir ;;
+ -psdir=* | --psdir=* | --psdi=* | --psd=* | --ps=*)
+ psdir=$ac_optarg ;;
+
+ -q | -quiet | --quiet | --quie | --qui | --qu | --q \
+ | -silent | --silent | --silen | --sile | --sil)
+ silent=yes ;;
+
+ -sbindir | --sbindir | --sbindi | --sbind | --sbin | --sbi | --sb)
+ ac_prev=sbindir ;;
+ -sbindir=* | --sbindir=* | --sbindi=* | --sbind=* | --sbin=* \
+ | --sbi=* | --sb=*)
+ sbindir=$ac_optarg ;;
+
+ -sharedstatedir | --sharedstatedir | --sharedstatedi \
+ | --sharedstated | --sharedstate | --sharedstat | --sharedsta \
+ | --sharedst | --shareds | --shared | --share | --shar \
+ | --sha | --sh)
+ ac_prev=sharedstatedir ;;
+ -sharedstatedir=* | --sharedstatedir=* | --sharedstatedi=* \
+ | --sharedstated=* | --sharedstate=* | --sharedstat=* | --sharedsta=* \
+ | --sharedst=* | --shareds=* | --shared=* | --share=* | --shar=* \
+ | --sha=* | --sh=*)
+ sharedstatedir=$ac_optarg ;;
+
+ -site | --site | --sit)
+ ac_prev=site ;;
+ -site=* | --site=* | --sit=*)
+ site=$ac_optarg ;;
+
+ -srcdir | --srcdir | --srcdi | --srcd | --src | --sr)
+ ac_prev=srcdir ;;
+ -srcdir=* | --srcdir=* | --srcdi=* | --srcd=* | --src=* | --sr=*)
+ srcdir=$ac_optarg ;;
+
+ -sysconfdir | --sysconfdir | --sysconfdi | --sysconfd | --sysconf \
+ | --syscon | --sysco | --sysc | --sys | --sy)
+ ac_prev=sysconfdir ;;
+ -sysconfdir=* | --sysconfdir=* | --sysconfdi=* | --sysconfd=* | --sysconf=* \
+ | --syscon=* | --sysco=* | --sysc=* | --sys=* | --sy=*)
+ sysconfdir=$ac_optarg ;;
+
+ -target | --target | --targe | --targ | --tar | --ta | --t)
+ ac_prev=target_alias ;;
+ -target=* | --target=* | --targe=* | --targ=* | --tar=* | --ta=* | --t=*)
+ target_alias=$ac_optarg ;;
+
+ -v | -verbose | --verbose | --verbos | --verbo | --verb)
+ verbose=yes ;;
+
+ -version | --version | --versio | --versi | --vers | -V)
+ ac_init_version=: ;;
+
+ -with-* | --with-*)
+ ac_useropt=`expr "x$ac_option" : 'x-*with-\([^=]*\)'`
+ # Reject names that are not valid shell variable names.
+ expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+ as_fn_error $? "invalid package name: $ac_useropt"
+ ac_useropt_orig=$ac_useropt
+ ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
+ case $ac_user_opts in
+ *"
+"with_$ac_useropt"
+"*) ;;
+ *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--with-$ac_useropt_orig"
+ ac_unrecognized_sep=', ';;
+ esac
+ eval with_$ac_useropt=\$ac_optarg ;;
+
+ -without-* | --without-*)
+ ac_useropt=`expr "x$ac_option" : 'x-*without-\(.*\)'`
+ # Reject names that are not valid shell variable names.
+ expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
+ as_fn_error $? "invalid package name: $ac_useropt"
+ ac_useropt_orig=$ac_useropt
+ ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
+ case $ac_user_opts in
+ *"
+"with_$ac_useropt"
+"*) ;;
+ *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--without-$ac_useropt_orig"
+ ac_unrecognized_sep=', ';;
+ esac
+ eval with_$ac_useropt=no ;;
+
+ --x)
+ # Obsolete; use --with-x.
+ with_x=yes ;;
+
+ -x-includes | --x-includes | --x-include | --x-includ | --x-inclu \
+ | --x-incl | --x-inc | --x-in | --x-i)
+ ac_prev=x_includes ;;
+ -x-includes=* | --x-includes=* | --x-include=* | --x-includ=* | --x-inclu=* \
+ | --x-incl=* | --x-inc=* | --x-in=* | --x-i=*)
+ x_includes=$ac_optarg ;;
+
+ -x-libraries | --x-libraries | --x-librarie | --x-librari \
+ | --x-librar | --x-libra | --x-libr | --x-lib | --x-li | --x-l)
+ ac_prev=x_libraries ;;
+ -x-libraries=* | --x-libraries=* | --x-librarie=* | --x-librari=* \
+ | --x-librar=* | --x-libra=* | --x-libr=* | --x-lib=* | --x-li=* | --x-l=*)
+ x_libraries=$ac_optarg ;;
+
+ -*) as_fn_error $? "unrecognized option: \`$ac_option'
+Try \`$0 --help' for more information"
+ ;;
+
+ *=*)
+ ac_envvar=`expr "x$ac_option" : 'x\([^=]*\)='`
+ # Reject names that are not valid shell variable names.
+ case $ac_envvar in #(
+ '' | [0-9]* | *[!_$as_cr_alnum]* )
+ as_fn_error $? "invalid variable name: \`$ac_envvar'" ;;
+ esac
+ eval $ac_envvar=\$ac_optarg
+ export $ac_envvar ;;
+
+ *)
+ # FIXME: should be removed in autoconf 3.0.
+ $as_echo "$as_me: WARNING: you should use --build, --host, --target" >&2
+ expr "x$ac_option" : ".*[^-._$as_cr_alnum]" >/dev/null &&
+ $as_echo "$as_me: WARNING: invalid host type: $ac_option" >&2
+ : "${build_alias=$ac_option} ${host_alias=$ac_option} ${target_alias=$ac_option}"
+ ;;
+
+ esac
+done
+
+if test -n "$ac_prev"; then
+ ac_option=--`echo $ac_prev | sed 's/_/-/g'`
+ as_fn_error $? "missing argument to $ac_option"
+fi
+
+if test -n "$ac_unrecognized_opts"; then
+ case $enable_option_checking in
+ no) ;;
+ fatal) as_fn_error $? "unrecognized options: $ac_unrecognized_opts" ;;
+ *) $as_echo "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2 ;;
+ esac
+fi
+
+# Check all directory arguments for consistency.
+for ac_var in exec_prefix prefix bindir sbindir libexecdir datarootdir \
+ datadir sysconfdir sharedstatedir localstatedir includedir \
+ oldincludedir docdir infodir htmldir dvidir pdfdir psdir \
+ libdir localedir mandir
+do
+ eval ac_val=\$$ac_var
+ # Remove trailing slashes.
+ case $ac_val in
+ */ )
+ ac_val=`expr "X$ac_val" : 'X\(.*[^/]\)' \| "X$ac_val" : 'X\(.*\)'`
+ eval $ac_var=\$ac_val;;
+ esac
+ # Be sure to have absolute directory names.
+ case $ac_val in
+ [\\/$]* | ?:[\\/]* ) continue;;
+ NONE | '' ) case $ac_var in *prefix ) continue;; esac;;
+ esac
+ as_fn_error $? "expected an absolute directory name for --$ac_var: $ac_val"
+done
+
+# There might be people who depend on the old broken behavior: `$host'
+# used to hold the argument of --host etc.
+# FIXME: To remove some day.
+build=$build_alias
+host=$host_alias
+target=$target_alias
+
+# FIXME: To remove some day.
+if test "x$host_alias" != x; then
+ if test "x$build_alias" = x; then
+ cross_compiling=maybe
+ elif test "x$build_alias" != "x$host_alias"; then
+ cross_compiling=yes
+ fi
+fi
+
+ac_tool_prefix=
+test -n "$host_alias" && ac_tool_prefix=$host_alias-
+
+test "$silent" = yes && exec 6>/dev/null
+
+
+ac_pwd=`pwd` && test -n "$ac_pwd" &&
+ac_ls_di=`ls -di .` &&
+ac_pwd_ls_di=`cd "$ac_pwd" && ls -di .` ||
+ as_fn_error $? "working directory cannot be determined"
+test "X$ac_ls_di" = "X$ac_pwd_ls_di" ||
+ as_fn_error $? "pwd does not report name of working directory"
+
+
+# Find the source files, if location was not specified.
+if test -z "$srcdir"; then
+ ac_srcdir_defaulted=yes
+ # Try the directory containing this script, then the parent directory.
+ ac_confdir=`$as_dirname -- "$as_myself" ||
+$as_expr X"$as_myself" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+ X"$as_myself" : 'X\(//\)[^/]' \| \
+ X"$as_myself" : 'X\(//\)$' \| \
+ X"$as_myself" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X"$as_myself" |
+ sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)[^/].*/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\).*/{
+ s//\1/
+ q
+ }
+ s/.*/./; q'`
+ srcdir=$ac_confdir
+ if test ! -r "$srcdir/$ac_unique_file"; then
+ srcdir=..
+ fi
+else
+ ac_srcdir_defaulted=no
+fi
+if test ! -r "$srcdir/$ac_unique_file"; then
+ test "$ac_srcdir_defaulted" = yes && srcdir="$ac_confdir or .."
+ as_fn_error $? "cannot find sources ($ac_unique_file) in $srcdir"
+fi
+ac_msg="sources are in $srcdir, but \`cd $srcdir' does not work"
+ac_abs_confdir=`(
+ cd "$srcdir" && test -r "./$ac_unique_file" || as_fn_error $? "$ac_msg"
+ pwd)`
+# When building in place, set srcdir=.
+if test "$ac_abs_confdir" = "$ac_pwd"; then
+ srcdir=.
+fi
+# Remove unnecessary trailing slashes from srcdir.
+# Double slashes in file names in object file debugging info
+# mess up M-x gdb in Emacs.
+case $srcdir in
+*/) srcdir=`expr "X$srcdir" : 'X\(.*[^/]\)' \| "X$srcdir" : 'X\(.*\)'`;;
+esac
+for ac_var in $ac_precious_vars; do
+ eval ac_env_${ac_var}_set=\${${ac_var}+set}
+ eval ac_env_${ac_var}_value=\$${ac_var}
+ eval ac_cv_env_${ac_var}_set=\${${ac_var}+set}
+ eval ac_cv_env_${ac_var}_value=\$${ac_var}
+done
+
+#
+# Report the --help message.
+#
+if test "$ac_init_help" = "long"; then
+ # Omit some internal or obsolete options to make the list less imposing.
+ # This message is too long to be a string in the A/UX 3.1 sh.
+ cat <<_ACEOF
+\`configure' configures andi 0.9.4 to adapt to many kinds of systems.
+
+Usage: $0 [OPTION]... [VAR=VALUE]...
+
+To assign environment variables (e.g., CC, CFLAGS...), specify them as
+VAR=VALUE. See below for descriptions of some of the useful variables.
+
+Defaults for the options are specified in brackets.
+
+Configuration:
+ -h, --help display this help and exit
+ --help=short display options specific to this package
+ --help=recursive display the short help of all the included packages
+ -V, --version display version information and exit
+ -q, --quiet, --silent do not print \`checking ...' messages
+ --cache-file=FILE cache test results in FILE [disabled]
+ -C, --config-cache alias for \`--cache-file=config.cache'
+ -n, --no-create do not create output files
+ --srcdir=DIR find the sources in DIR [configure dir or \`..']
+
+Installation directories:
+ --prefix=PREFIX install architecture-independent files in PREFIX
+ [$ac_default_prefix]
+ --exec-prefix=EPREFIX install architecture-dependent files in EPREFIX
+ [PREFIX]
+
+By default, \`make install' will install all the files in
+\`$ac_default_prefix/bin', \`$ac_default_prefix/lib' etc. You can specify
+an installation prefix other than \`$ac_default_prefix' using \`--prefix',
+for instance \`--prefix=\$HOME'.
+
+For better control, use the options below.
+
+Fine tuning of the installation directories:
+ --bindir=DIR user executables [EPREFIX/bin]
+ --sbindir=DIR system admin executables [EPREFIX/sbin]
+ --libexecdir=DIR program executables [EPREFIX/libexec]
+ --sysconfdir=DIR read-only single-machine data [PREFIX/etc]
+ --sharedstatedir=DIR modifiable architecture-independent data [PREFIX/com]
+ --localstatedir=DIR modifiable single-machine data [PREFIX/var]
+ --libdir=DIR object code libraries [EPREFIX/lib]
+ --includedir=DIR C header files [PREFIX/include]
+ --oldincludedir=DIR C header files for non-gcc [/usr/include]
+ --datarootdir=DIR read-only arch.-independent data root [PREFIX/share]
+ --datadir=DIR read-only architecture-independent data [DATAROOTDIR]
+ --infodir=DIR info documentation [DATAROOTDIR/info]
+ --localedir=DIR locale-dependent data [DATAROOTDIR/locale]
+ --mandir=DIR man documentation [DATAROOTDIR/man]
+ --docdir=DIR documentation root [DATAROOTDIR/doc/andi]
+ --htmldir=DIR html documentation [DOCDIR]
+ --dvidir=DIR dvi documentation [DOCDIR]
+ --pdfdir=DIR pdf documentation [DOCDIR]
+ --psdir=DIR ps documentation [DOCDIR]
+_ACEOF
+
+ cat <<\_ACEOF
+
+Program names:
+ --program-prefix=PREFIX prepend PREFIX to installed program names
+ --program-suffix=SUFFIX append SUFFIX to installed program names
+ --program-transform-name=PROGRAM run sed PROGRAM on installed program names
+_ACEOF
+fi
+
+if test -n "$ac_init_help"; then
+ case $ac_init_help in
+ short | recursive ) echo "Configuration of andi 0.9.4:";;
+ esac
+ cat <<\_ACEOF
+
+Optional Features:
+ --disable-option-checking ignore unrecognized --enable/--with options
+ --disable-FEATURE do not include FEATURE (same as --enable-FEATURE=no)
+ --enable-FEATURE[=ARG] include FEATURE [ARG=yes]
+ --enable-silent-rules less verbose build output (undo: "make V=1")
+ --disable-silent-rules verbose build output (undo: "make V=0")
+ --enable-dependency-tracking
+ do not reject slow dependency extractors
+ --disable-dependency-tracking
+ speeds up one-time build
+ --disable-openmp do not use OpenMP
+ --enable-unit-tests build unit tests [default: no]
+
+Optional Packages:
+ --with-PACKAGE[=ARG] use PACKAGE [ARG=yes]
+ --without-PACKAGE do not use PACKAGE (same as --with-PACKAGE=no)
+ --without-libdivsufsort Build without libdivsufsort and use psufsort
+ instead.
+
+Some influential environment variables:
+ CC C compiler command
+ CFLAGS C compiler flags
+ LDFLAGS linker flags, e.g. -L<lib dir> if you have libraries in a
+ nonstandard directory <lib dir>
+ LIBS libraries to pass to the linker, e.g. -l<library>
+ CPPFLAGS (Objective) C/C++ preprocessor flags, e.g. -I<include dir> if
+ you have headers in a nonstandard directory <include dir>
+ CXX C++ compiler command
+ CXXFLAGS C++ compiler flags
+ CPP C preprocessor
+ PKG_CONFIG path to pkg-config utility
+ PKG_CONFIG_PATH
+ directories to add to pkg-config's search path
+ PKG_CONFIG_LIBDIR
+ path overriding pkg-config's built-in search path
+ GLIB_CFLAGS C compiler flags for GLIB, overriding pkg-config
+ GLIB_LIBS linker flags for GLIB, overriding pkg-config
+
+Use these variables to override the choices made by `configure' or to help
+it to find libraries and programs with nonstandard names/locations.
+
+Report bugs to the package provider.
+_ACEOF
+ac_status=$?
+fi
+
+if test "$ac_init_help" = "recursive"; then
+ # If there are subdirs, report their specific --help.
+ for ac_dir in : $ac_subdirs_all; do test "x$ac_dir" = x: && continue
+ test -d "$ac_dir" ||
+ { cd "$srcdir" && ac_pwd=`pwd` && srcdir=. && test -d "$ac_dir"; } ||
+ continue
+ ac_builddir=.
+
+case "$ac_dir" in
+.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;;
+*)
+ ac_dir_suffix=/`$as_echo "$ac_dir" | sed 's|^\.[\\/]||'`
+ # A ".." for each directory in $ac_dir_suffix.
+ ac_top_builddir_sub=`$as_echo "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'`
+ case $ac_top_builddir_sub in
+ "") ac_top_builddir_sub=. ac_top_build_prefix= ;;
+ *) ac_top_build_prefix=$ac_top_builddir_sub/ ;;
+ esac ;;
+esac
+ac_abs_top_builddir=$ac_pwd
+ac_abs_builddir=$ac_pwd$ac_dir_suffix
+# for backward compatibility:
+ac_top_builddir=$ac_top_build_prefix
+
+case $srcdir in
+ .) # We are building in place.
+ ac_srcdir=.
+ ac_top_srcdir=$ac_top_builddir_sub
+ ac_abs_top_srcdir=$ac_pwd ;;
+ [\\/]* | ?:[\\/]* ) # Absolute name.
+ ac_srcdir=$srcdir$ac_dir_suffix;
+ ac_top_srcdir=$srcdir
+ ac_abs_top_srcdir=$srcdir ;;
+ *) # Relative name.
+ ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix
+ ac_top_srcdir=$ac_top_build_prefix$srcdir
+ ac_abs_top_srcdir=$ac_pwd/$srcdir ;;
+esac
+ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix
+
+ cd "$ac_dir" || { ac_status=$?; continue; }
+ # Check for guested configure.
+ if test -f "$ac_srcdir/configure.gnu"; then
+ echo &&
+ $SHELL "$ac_srcdir/configure.gnu" --help=recursive
+ elif test -f "$ac_srcdir/configure"; then
+ echo &&
+ $SHELL "$ac_srcdir/configure" --help=recursive
+ else
+ $as_echo "$as_me: WARNING: no configuration information is in $ac_dir" >&2
+ fi || ac_status=$?
+ cd "$ac_pwd" || { ac_status=$?; break; }
+ done
+fi
+
+test -n "$ac_init_help" && exit $ac_status
+if $ac_init_version; then
+ cat <<\_ACEOF
+andi configure 0.9.4
+generated by GNU Autoconf 2.69
+
+Copyright (C) 2012 Free Software Foundation, Inc.
+This configure script is free software; the Free Software Foundation
+gives unlimited permission to copy, distribute and modify it.
+_ACEOF
+ exit
+fi
+
+## ------------------------ ##
+## Autoconf initialization. ##
+## ------------------------ ##
+
+# ac_fn_c_try_compile LINENO
+# --------------------------
+# Try to compile conftest.$ac_ext, and return whether this succeeded.
+ac_fn_c_try_compile ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ rm -f conftest.$ac_objext
+ if { { ac_try="$ac_compile"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_compile") 2>conftest.err
+ ac_status=$?
+ if test -s conftest.err; then
+ grep -v '^ *+' conftest.err >conftest.er1
+ cat conftest.er1 >&5
+ mv -f conftest.er1 conftest.err
+ fi
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; } && {
+ test -z "$ac_c_werror_flag" ||
+ test ! -s conftest.err
+ } && test -s conftest.$ac_objext; then :
+ ac_retval=0
+else
+ $as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ ac_retval=1
+fi
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+ as_fn_set_status $ac_retval
+
+} # ac_fn_c_try_compile
+
+# ac_fn_cxx_try_compile LINENO
+# ----------------------------
+# Try to compile conftest.$ac_ext, and return whether this succeeded.
+ac_fn_cxx_try_compile ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ rm -f conftest.$ac_objext
+ if { { ac_try="$ac_compile"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_compile") 2>conftest.err
+ ac_status=$?
+ if test -s conftest.err; then
+ grep -v '^ *+' conftest.err >conftest.er1
+ cat conftest.er1 >&5
+ mv -f conftest.er1 conftest.err
+ fi
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; } && {
+ test -z "$ac_cxx_werror_flag" ||
+ test ! -s conftest.err
+ } && test -s conftest.$ac_objext; then :
+ ac_retval=0
+else
+ $as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ ac_retval=1
+fi
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+ as_fn_set_status $ac_retval
+
+} # ac_fn_cxx_try_compile
+
+# ac_fn_c_try_cpp LINENO
+# ----------------------
+# Try to preprocess conftest.$ac_ext, and return whether this succeeded.
+ac_fn_c_try_cpp ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ if { { ac_try="$ac_cpp conftest.$ac_ext"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_cpp conftest.$ac_ext") 2>conftest.err
+ ac_status=$?
+ if test -s conftest.err; then
+ grep -v '^ *+' conftest.err >conftest.er1
+ cat conftest.er1 >&5
+ mv -f conftest.er1 conftest.err
+ fi
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; } > conftest.i && {
+ test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" ||
+ test ! -s conftest.err
+ }; then :
+ ac_retval=0
+else
+ $as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ ac_retval=1
+fi
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+ as_fn_set_status $ac_retval
+
+} # ac_fn_c_try_cpp
+
+# ac_fn_cxx_try_link LINENO
+# -------------------------
+# Try to link conftest.$ac_ext, and return whether this succeeded.
+ac_fn_cxx_try_link ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ rm -f conftest.$ac_objext conftest$ac_exeext
+ if { { ac_try="$ac_link"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_link") 2>conftest.err
+ ac_status=$?
+ if test -s conftest.err; then
+ grep -v '^ *+' conftest.err >conftest.er1
+ cat conftest.er1 >&5
+ mv -f conftest.er1 conftest.err
+ fi
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; } && {
+ test -z "$ac_cxx_werror_flag" ||
+ test ! -s conftest.err
+ } && test -s conftest$ac_exeext && {
+ test "$cross_compiling" = yes ||
+ test -x conftest$ac_exeext
+ }; then :
+ ac_retval=0
+else
+ $as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ ac_retval=1
+fi
+ # Delete the IPA/IPO (Inter Procedural Analysis/Optimization) information
+ # created by the PGI compiler (conftest_ipa8_conftest.oo), as it would
+ # interfere with the next link command; also delete a directory that is
+ # left behind by Apple's compiler. We do this before executing the actions.
+ rm -rf conftest.dSYM conftest_ipa8_conftest.oo
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+ as_fn_set_status $ac_retval
+
+} # ac_fn_cxx_try_link
+
+# ac_fn_c_try_link LINENO
+# -----------------------
+# Try to link conftest.$ac_ext, and return whether this succeeded.
+ac_fn_c_try_link ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ rm -f conftest.$ac_objext conftest$ac_exeext
+ if { { ac_try="$ac_link"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_link") 2>conftest.err
+ ac_status=$?
+ if test -s conftest.err; then
+ grep -v '^ *+' conftest.err >conftest.er1
+ cat conftest.er1 >&5
+ mv -f conftest.er1 conftest.err
+ fi
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; } && {
+ test -z "$ac_c_werror_flag" ||
+ test ! -s conftest.err
+ } && test -s conftest$ac_exeext && {
+ test "$cross_compiling" = yes ||
+ test -x conftest$ac_exeext
+ }; then :
+ ac_retval=0
+else
+ $as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ ac_retval=1
+fi
+ # Delete the IPA/IPO (Inter Procedural Analysis/Optimization) information
+ # created by the PGI compiler (conftest_ipa8_conftest.oo), as it would
+ # interfere with the next link command; also delete a directory that is
+ # left behind by Apple's compiler. We do this before executing the actions.
+ rm -rf conftest.dSYM conftest_ipa8_conftest.oo
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+ as_fn_set_status $ac_retval
+
+} # ac_fn_c_try_link
+
+# ac_fn_c_check_header_mongrel LINENO HEADER VAR INCLUDES
+# -------------------------------------------------------
+# Tests whether HEADER exists, giving a warning if it cannot be compiled using
+# the include files in INCLUDES and setting the cache variable VAR
+# accordingly.
+ac_fn_c_check_header_mongrel ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ if eval \${$3+:} false; then :
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+$as_echo_n "checking for $2... " >&6; }
+if eval \${$3+:} false; then :
+ $as_echo_n "(cached) " >&6
+fi
+eval ac_res=\$$3
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+else
+ # Is the header compilable?
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking $2 usability" >&5
+$as_echo_n "checking $2 usability... " >&6; }
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+$4
+#include <$2>
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ ac_header_compiler=yes
+else
+ ac_header_compiler=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_header_compiler" >&5
+$as_echo "$ac_header_compiler" >&6; }
+
+# Is the header present?
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking $2 presence" >&5
+$as_echo_n "checking $2 presence... " >&6; }
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#include <$2>
+_ACEOF
+if ac_fn_c_try_cpp "$LINENO"; then :
+ ac_header_preproc=yes
+else
+ ac_header_preproc=no
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_header_preproc" >&5
+$as_echo "$ac_header_preproc" >&6; }
+
+# So? What about this header?
+case $ac_header_compiler:$ac_header_preproc:$ac_c_preproc_warn_flag in #((
+ yes:no: )
+ { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: accepted by the compiler, rejected by the preprocessor!" >&5
+$as_echo "$as_me: WARNING: $2: accepted by the compiler, rejected by the preprocessor!" >&2;}
+ { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: proceeding with the compiler's result" >&5
+$as_echo "$as_me: WARNING: $2: proceeding with the compiler's result" >&2;}
+ ;;
+ no:yes:* )
+ { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: present but cannot be compiled" >&5
+$as_echo "$as_me: WARNING: $2: present but cannot be compiled" >&2;}
+ { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: check for missing prerequisite headers?" >&5
+$as_echo "$as_me: WARNING: $2: check for missing prerequisite headers?" >&2;}
+ { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: see the Autoconf documentation" >&5
+$as_echo "$as_me: WARNING: $2: see the Autoconf documentation" >&2;}
+ { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: section \"Present But Cannot Be Compiled\"" >&5
+$as_echo "$as_me: WARNING: $2: section \"Present But Cannot Be Compiled\"" >&2;}
+ { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: proceeding with the compiler's result" >&5
+$as_echo "$as_me: WARNING: $2: proceeding with the compiler's result" >&2;}
+ ;;
+esac
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+$as_echo_n "checking for $2... " >&6; }
+if eval \${$3+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ eval "$3=\$ac_header_compiler"
+fi
+eval ac_res=\$$3
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+fi
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_check_header_mongrel
+
+# ac_fn_c_try_run LINENO
+# ----------------------
+# Try to link conftest.$ac_ext, and return whether this succeeded. Assumes
+# that executables *can* be run.
+ac_fn_c_try_run ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ if { { ac_try="$ac_link"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_link") 2>&5
+ ac_status=$?
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; } && { ac_try='./conftest$ac_exeext'
+ { { case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_try") 2>&5
+ ac_status=$?
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }; }; then :
+ ac_retval=0
+else
+ $as_echo "$as_me: program exited with status $ac_status" >&5
+ $as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ ac_retval=$ac_status
+fi
+ rm -rf conftest.dSYM conftest_ipa8_conftest.oo
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+ as_fn_set_status $ac_retval
+
+} # ac_fn_c_try_run
+
+# ac_fn_c_check_header_compile LINENO HEADER VAR INCLUDES
+# -------------------------------------------------------
+# Tests whether HEADER exists and can be compiled using the include files in
+# INCLUDES, setting the cache variable VAR accordingly.
+ac_fn_c_check_header_compile ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+$as_echo_n "checking for $2... " >&6; }
+if eval \${$3+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+$4
+#include <$2>
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ eval "$3=yes"
+else
+ eval "$3=no"
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+eval ac_res=\$$3
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_check_header_compile
+
+# ac_fn_c_check_type LINENO TYPE VAR INCLUDES
+# -------------------------------------------
+# Tests whether TYPE exists after having included INCLUDES, setting cache
+# variable VAR accordingly.
+ac_fn_c_check_type ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+$as_echo_n "checking for $2... " >&6; }
+if eval \${$3+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ eval "$3=no"
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+$4
+int
+main ()
+{
+if (sizeof ($2))
+ return 0;
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+$4
+int
+main ()
+{
+if (sizeof (($2)))
+ return 0;
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+
+else
+ eval "$3=yes"
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+eval ac_res=\$$3
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_check_type
+
+# ac_fn_c_find_intX_t LINENO BITS VAR
+# -----------------------------------
+# Finds a signed integer type with width BITS, setting cache variable VAR
+# accordingly.
+ac_fn_c_find_intX_t ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking for int$2_t" >&5
+$as_echo_n "checking for int$2_t... " >&6; }
+if eval \${$3+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ eval "$3=no"
+ # Order is important - never check a type that is potentially smaller
+ # than half of the expected target width.
+ for ac_type in int$2_t 'int' 'long int' \
+ 'long long int' 'short int' 'signed char'; do
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+$ac_includes_default
+ enum { N = $2 / 2 - 1 };
+int
+main ()
+{
+static int test_array [1 - 2 * !(0 < ($ac_type) ((((($ac_type) 1 << N) << N) - 1) * 2 + 1))];
+test_array [0] = 0;
+return test_array [0];
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+$ac_includes_default
+ enum { N = $2 / 2 - 1 };
+int
+main ()
+{
+static int test_array [1 - 2 * !(($ac_type) ((((($ac_type) 1 << N) << N) - 1) * 2 + 1)
+ < ($ac_type) ((((($ac_type) 1 << N) << N) - 1) * 2 + 2))];
+test_array [0] = 0;
+return test_array [0];
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+
+else
+ case $ac_type in #(
+ int$2_t) :
+ eval "$3=yes" ;; #(
+ *) :
+ eval "$3=\$ac_type" ;;
+esac
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ if eval test \"x\$"$3"\" = x"no"; then :
+
+else
+ break
+fi
+ done
+fi
+eval ac_res=\$$3
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_find_intX_t
+
+# ac_fn_c_find_uintX_t LINENO BITS VAR
+# ------------------------------------
+# Finds an unsigned integer type with width BITS, setting cache variable VAR
+# accordingly.
+ac_fn_c_find_uintX_t ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking for uint$2_t" >&5
+$as_echo_n "checking for uint$2_t... " >&6; }
+if eval \${$3+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ eval "$3=no"
+ # Order is important - never check a type that is potentially smaller
+ # than half of the expected target width.
+ for ac_type in uint$2_t 'unsigned int' 'unsigned long int' \
+ 'unsigned long long int' 'unsigned short int' 'unsigned char'; do
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+$ac_includes_default
+int
+main ()
+{
+static int test_array [1 - 2 * !((($ac_type) -1 >> ($2 / 2 - 1)) >> ($2 / 2 - 1) == 3)];
+test_array [0] = 0;
+return test_array [0];
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ case $ac_type in #(
+ uint$2_t) :
+ eval "$3=yes" ;; #(
+ *) :
+ eval "$3=\$ac_type" ;;
+esac
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ if eval test \"x\$"$3"\" = x"no"; then :
+
+else
+ break
+fi
+ done
+fi
+eval ac_res=\$$3
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_find_uintX_t
+
+# ac_fn_c_check_func LINENO FUNC VAR
+# ----------------------------------
+# Tests whether FUNC exists, setting the cache variable VAR accordingly
+ac_fn_c_check_func ()
+{
+ as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
+$as_echo_n "checking for $2... " >&6; }
+if eval \${$3+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+/* Define $2 to an innocuous variant, in case <limits.h> declares $2.
+ For example, HP-UX 11i <limits.h> declares gettimeofday. */
+#define $2 innocuous_$2
+
+/* System header to define __stub macros and hopefully few prototypes,
+ which can conflict with char $2 (); below.
+ Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
+ <limits.h> exists even on freestanding compilers. */
+
+#ifdef __STDC__
+# include <limits.h>
+#else
+# include <assert.h>
+#endif
+
+#undef $2
+
+/* Override any GCC internal prototype to avoid an error.
+ Use char because int might match the return type of a GCC
+ builtin and then its argument prototype would still apply. */
+#ifdef __cplusplus
+extern "C"
+#endif
+char $2 ();
+/* The GNU C library defines this for functions which it implements
+ to always fail with ENOSYS. Some functions are actually named
+ something starting with __ and the normal name is an alias. */
+#if defined __stub_$2 || defined __stub___$2
+choke me
+#endif
+
+int
+main ()
+{
+return $2 ();
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_link "$LINENO"; then :
+ eval "$3=yes"
+else
+ eval "$3=no"
+fi
+rm -f core conftest.err conftest.$ac_objext \
+ conftest$ac_exeext conftest.$ac_ext
+fi
+eval ac_res=\$$3
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+ eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
+
+} # ac_fn_c_check_func
+cat >config.log <<_ACEOF
+This file contains any messages produced by compilers while
+running configure, to aid debugging if configure makes a mistake.
+
+It was created by andi $as_me 0.9.4, which was
+generated by GNU Autoconf 2.69. Invocation command line was
+
+ $ $0 $@
+
+_ACEOF
+exec 5>>config.log
+{
+cat <<_ASUNAME
+## --------- ##
+## Platform. ##
+## --------- ##
+
+hostname = `(hostname || uname -n) 2>/dev/null | sed 1q`
+uname -m = `(uname -m) 2>/dev/null || echo unknown`
+uname -r = `(uname -r) 2>/dev/null || echo unknown`
+uname -s = `(uname -s) 2>/dev/null || echo unknown`
+uname -v = `(uname -v) 2>/dev/null || echo unknown`
+
+/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null || echo unknown`
+/bin/uname -X = `(/bin/uname -X) 2>/dev/null || echo unknown`
+
+/bin/arch = `(/bin/arch) 2>/dev/null || echo unknown`
+/usr/bin/arch -k = `(/usr/bin/arch -k) 2>/dev/null || echo unknown`
+/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null || echo unknown`
+/usr/bin/hostinfo = `(/usr/bin/hostinfo) 2>/dev/null || echo unknown`
+/bin/machine = `(/bin/machine) 2>/dev/null || echo unknown`
+/usr/bin/oslevel = `(/usr/bin/oslevel) 2>/dev/null || echo unknown`
+/bin/universe = `(/bin/universe) 2>/dev/null || echo unknown`
+
+_ASUNAME
+
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ $as_echo "PATH: $as_dir"
+ done
+IFS=$as_save_IFS
+
+} >&5
+
+cat >&5 <<_ACEOF
+
+
+## ----------- ##
+## Core tests. ##
+## ----------- ##
+
+_ACEOF
+
+
+# Keep a trace of the command line.
+# Strip out --no-create and --no-recursion so they do not pile up.
+# Strip out --silent because we don't want to record it for future runs.
+# Also quote any args containing shell meta-characters.
+# Make two passes to allow for proper duplicate-argument suppression.
+ac_configure_args=
+ac_configure_args0=
+ac_configure_args1=
+ac_must_keep_next=false
+for ac_pass in 1 2
+do
+ for ac_arg
+ do
+ case $ac_arg in
+ -no-create | --no-c* | -n | -no-recursion | --no-r*) continue ;;
+ -q | -quiet | --quiet | --quie | --qui | --qu | --q \
+ | -silent | --silent | --silen | --sile | --sil)
+ continue ;;
+ *\'*)
+ ac_arg=`$as_echo "$ac_arg" | sed "s/'/'\\\\\\\\''/g"` ;;
+ esac
+ case $ac_pass in
+ 1) as_fn_append ac_configure_args0 " '$ac_arg'" ;;
+ 2)
+ as_fn_append ac_configure_args1 " '$ac_arg'"
+ if test $ac_must_keep_next = true; then
+ ac_must_keep_next=false # Got value, back to normal.
+ else
+ case $ac_arg in
+ *=* | --config-cache | -C | -disable-* | --disable-* \
+ | -enable-* | --enable-* | -gas | --g* | -nfp | --nf* \
+ | -q | -quiet | --q* | -silent | --sil* | -v | -verb* \
+ | -with-* | --with-* | -without-* | --without-* | --x)
+ case "$ac_configure_args0 " in
+ "$ac_configure_args1"*" '$ac_arg' "* ) continue ;;
+ esac
+ ;;
+ -* ) ac_must_keep_next=true ;;
+ esac
+ fi
+ as_fn_append ac_configure_args " '$ac_arg'"
+ ;;
+ esac
+ done
+done
+{ ac_configure_args0=; unset ac_configure_args0;}
+{ ac_configure_args1=; unset ac_configure_args1;}
+
+# When interrupted or exit'd, cleanup temporary files, and complete
+# config.log. We remove comments because anyway the quotes in there
+# would cause problems or look ugly.
+# WARNING: Use '\'' to represent an apostrophe within the trap.
+# WARNING: Do not start the trap code with a newline, due to a FreeBSD 4.0 bug.
+trap 'exit_status=$?
+ # Save into config.log some information that might help in debugging.
+ {
+ echo
+
+ $as_echo "## ---------------- ##
+## Cache variables. ##
+## ---------------- ##"
+ echo
+ # The following way of writing the cache mishandles newlines in values,
+(
+ for ac_var in `(set) 2>&1 | sed -n '\''s/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'\''`; do
+ eval ac_val=\$$ac_var
+ case $ac_val in #(
+ *${as_nl}*)
+ case $ac_var in #(
+ *_cv_*) { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5
+$as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
+ esac
+ case $ac_var in #(
+ _ | IFS | as_nl) ;; #(
+ BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #(
+ *) { eval $ac_var=; unset $ac_var;} ;;
+ esac ;;
+ esac
+ done
+ (set) 2>&1 |
+ case $as_nl`(ac_space='\'' '\''; set) 2>&1` in #(
+ *${as_nl}ac_space=\ *)
+ sed -n \
+ "s/'\''/'\''\\\\'\'''\''/g;
+ s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\''\\2'\''/p"
+ ;; #(
+ *)
+ sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p"
+ ;;
+ esac |
+ sort
+)
+ echo
+
+ $as_echo "## ----------------- ##
+## Output variables. ##
+## ----------------- ##"
+ echo
+ for ac_var in $ac_subst_vars
+ do
+ eval ac_val=\$$ac_var
+ case $ac_val in
+ *\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
+ esac
+ $as_echo "$ac_var='\''$ac_val'\''"
+ done | sort
+ echo
+
+ if test -n "$ac_subst_files"; then
+ $as_echo "## ------------------- ##
+## File substitutions. ##
+## ------------------- ##"
+ echo
+ for ac_var in $ac_subst_files
+ do
+ eval ac_val=\$$ac_var
+ case $ac_val in
+ *\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
+ esac
+ $as_echo "$ac_var='\''$ac_val'\''"
+ done | sort
+ echo
+ fi
+
+ if test -s confdefs.h; then
+ $as_echo "## ----------- ##
+## confdefs.h. ##
+## ----------- ##"
+ echo
+ cat confdefs.h
+ echo
+ fi
+ test "$ac_signal" != 0 &&
+ $as_echo "$as_me: caught signal $ac_signal"
+ $as_echo "$as_me: exit $exit_status"
+ } >&5
+ rm -f core *.core core.conftest.* &&
+ rm -f -r conftest* confdefs* conf$$* $ac_clean_files &&
+ exit $exit_status
+' 0
+for ac_signal in 1 2 13 15; do
+ trap 'ac_signal='$ac_signal'; as_fn_exit 1' $ac_signal
+done
+ac_signal=0
+
+# confdefs.h avoids OS command line length limits that DEFS can exceed.
+rm -f -r conftest* confdefs.h
+
+$as_echo "/* confdefs.h */" > confdefs.h
+
+# Predefined preprocessor variables.
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_NAME "$PACKAGE_NAME"
+_ACEOF
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_TARNAME "$PACKAGE_TARNAME"
+_ACEOF
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_VERSION "$PACKAGE_VERSION"
+_ACEOF
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_STRING "$PACKAGE_STRING"
+_ACEOF
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_BUGREPORT "$PACKAGE_BUGREPORT"
+_ACEOF
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_URL "$PACKAGE_URL"
+_ACEOF
+
+
+# Let the site file select an alternate cache file if it wants to.
+# Prefer an explicitly selected file to automatically selected ones.
+ac_site_file1=NONE
+ac_site_file2=NONE
+if test -n "$CONFIG_SITE"; then
+ # We do not want a PATH search for config.site.
+ case $CONFIG_SITE in #((
+ -*) ac_site_file1=./$CONFIG_SITE;;
+ */*) ac_site_file1=$CONFIG_SITE;;
+ *) ac_site_file1=./$CONFIG_SITE;;
+ esac
+elif test "x$prefix" != xNONE; then
+ ac_site_file1=$prefix/share/config.site
+ ac_site_file2=$prefix/etc/config.site
+else
+ ac_site_file1=$ac_default_prefix/share/config.site
+ ac_site_file2=$ac_default_prefix/etc/config.site
+fi
+for ac_site_file in "$ac_site_file1" "$ac_site_file2"
+do
+ test "x$ac_site_file" = xNONE && continue
+ if test /dev/null != "$ac_site_file" && test -r "$ac_site_file"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: loading site script $ac_site_file" >&5
+$as_echo "$as_me: loading site script $ac_site_file" >&6;}
+ sed 's/^/| /' "$ac_site_file" >&5
+ . "$ac_site_file" \
+ || { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "failed to load site script $ac_site_file
+See \`config.log' for more details" "$LINENO" 5; }
+ fi
+done
+
+if test -r "$cache_file"; then
+ # Some versions of bash will fail to source /dev/null (special files
+ # actually), so we avoid doing that. DJGPP emulates it as a regular file.
+ if test /dev/null != "$cache_file" && test -f "$cache_file"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: loading cache $cache_file" >&5
+$as_echo "$as_me: loading cache $cache_file" >&6;}
+ case $cache_file in
+ [\\/]* | ?:[\\/]* ) . "$cache_file";;
+ *) . "./$cache_file";;
+ esac
+ fi
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: creating cache $cache_file" >&5
+$as_echo "$as_me: creating cache $cache_file" >&6;}
+ >$cache_file
+fi
+
+# Check that the precious variables saved in the cache have kept the same
+# value.
+ac_cache_corrupted=false
+for ac_var in $ac_precious_vars; do
+ eval ac_old_set=\$ac_cv_env_${ac_var}_set
+ eval ac_new_set=\$ac_env_${ac_var}_set
+ eval ac_old_val=\$ac_cv_env_${ac_var}_value
+ eval ac_new_val=\$ac_env_${ac_var}_value
+ case $ac_old_set,$ac_new_set in
+ set,)
+ { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&5
+$as_echo "$as_me: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&2;}
+ ac_cache_corrupted=: ;;
+ ,set)
+ { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was not set in the previous run" >&5
+$as_echo "$as_me: error: \`$ac_var' was not set in the previous run" >&2;}
+ ac_cache_corrupted=: ;;
+ ,);;
+ *)
+ if test "x$ac_old_val" != "x$ac_new_val"; then
+ # differences in whitespace do not lead to failure.
+ ac_old_val_w=`echo x $ac_old_val`
+ ac_new_val_w=`echo x $ac_new_val`
+ if test "$ac_old_val_w" != "$ac_new_val_w"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' has changed since the previous run:" >&5
+$as_echo "$as_me: error: \`$ac_var' has changed since the previous run:" >&2;}
+ ac_cache_corrupted=:
+ else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&5
+$as_echo "$as_me: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&2;}
+ eval $ac_var=\$ac_old_val
+ fi
+ { $as_echo "$as_me:${as_lineno-$LINENO}: former value: \`$ac_old_val'" >&5
+$as_echo "$as_me: former value: \`$ac_old_val'" >&2;}
+ { $as_echo "$as_me:${as_lineno-$LINENO}: current value: \`$ac_new_val'" >&5
+$as_echo "$as_me: current value: \`$ac_new_val'" >&2;}
+ fi;;
+ esac
+ # Pass precious variables to config.status.
+ if test "$ac_new_set" = set; then
+ case $ac_new_val in
+ *\'*) ac_arg=$ac_var=`$as_echo "$ac_new_val" | sed "s/'/'\\\\\\\\''/g"` ;;
+ *) ac_arg=$ac_var=$ac_new_val ;;
+ esac
+ case " $ac_configure_args " in
+ *" '$ac_arg' "*) ;; # Avoid dups. Use of quotes ensures accuracy.
+ *) as_fn_append ac_configure_args " '$ac_arg'" ;;
+ esac
+ fi
+done
+if $ac_cache_corrupted; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+ { $as_echo "$as_me:${as_lineno-$LINENO}: error: changes in the environment can compromise the build" >&5
+$as_echo "$as_me: error: changes in the environment can compromise the build" >&2;}
+ as_fn_error $? "run \`make distclean' and/or \`rm $cache_file' and start over" "$LINENO" 5
+fi
+## -------------------- ##
+## Main body of script. ##
+## -------------------- ##
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+
+am__api_version='1.14'
+
+ac_aux_dir=
+for ac_dir in "$srcdir" "$srcdir/.." "$srcdir/../.."; do
+ if test -f "$ac_dir/install-sh"; then
+ ac_aux_dir=$ac_dir
+ ac_install_sh="$ac_aux_dir/install-sh -c"
+ break
+ elif test -f "$ac_dir/install.sh"; then
+ ac_aux_dir=$ac_dir
+ ac_install_sh="$ac_aux_dir/install.sh -c"
+ break
+ elif test -f "$ac_dir/shtool"; then
+ ac_aux_dir=$ac_dir
+ ac_install_sh="$ac_aux_dir/shtool install -c"
+ break
+ fi
+done
+if test -z "$ac_aux_dir"; then
+ as_fn_error $? "cannot find install-sh, install.sh, or shtool in \"$srcdir\" \"$srcdir/..\" \"$srcdir/../..\"" "$LINENO" 5
+fi
+
+# These three variables are undocumented and unsupported,
+# and are intended to be withdrawn in a future Autoconf release.
+# They can cause serious problems if a builder's source tree is in a directory
+# whose full name contains unusual characters.
+ac_config_guess="$SHELL $ac_aux_dir/config.guess" # Please don't use this var.
+ac_config_sub="$SHELL $ac_aux_dir/config.sub" # Please don't use this var.
+ac_configure="$SHELL $ac_aux_dir/configure" # Please don't use this var.
+
+
+# Find a good install program. We prefer a C program (faster),
+# so one script is as good as another. But avoid the broken or
+# incompatible versions:
+# SysV /etc/install, /usr/sbin/install
+# SunOS /usr/etc/install
+# IRIX /sbin/install
+# AIX /bin/install
+# AmigaOS /C/install, which installs bootblocks on floppy discs
+# AIX 4 /usr/bin/installbsd, which doesn't work without a -g flag
+# AFS /usr/afsws/bin/install, which mishandles nonexistent args
+# SVR4 /usr/ucb/install, which tries to use the nonexistent group "staff"
+# OS/2's system install, which has a completely different semantic
+# ./install, which can be erroneously created by make from ./install.sh.
+# Reject install programs that cannot install multiple files.
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for a BSD-compatible install" >&5
+$as_echo_n "checking for a BSD-compatible install... " >&6; }
+if test -z "$INSTALL"; then
+if ${ac_cv_path_install+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ # Account for people who put trailing slashes in PATH elements.
+case $as_dir/ in #((
+ ./ | .// | /[cC]/* | \
+ /etc/* | /usr/sbin/* | /usr/etc/* | /sbin/* | /usr/afsws/bin/* | \
+ ?:[\\/]os2[\\/]install[\\/]* | ?:[\\/]OS2[\\/]INSTALL[\\/]* | \
+ /usr/ucb/* ) ;;
+ *)
+ # OSF1 and SCO ODT 3.0 have their own names for install.
+ # Don't use installbsd from OSF since it installs stuff as root
+ # by default.
+ for ac_prog in ginstall scoinst install; do
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_prog$ac_exec_ext"; then
+ if test $ac_prog = install &&
+ grep dspmsg "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
+ # AIX install. It has an incompatible calling convention.
+ :
+ elif test $ac_prog = install &&
+ grep pwplus "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
+ # program-specific install script used by HP pwplus--don't use.
+ :
+ else
+ rm -rf conftest.one conftest.two conftest.dir
+ echo one > conftest.one
+ echo two > conftest.two
+ mkdir conftest.dir
+ if "$as_dir/$ac_prog$ac_exec_ext" -c conftest.one conftest.two "`pwd`/conftest.dir" &&
+ test -s conftest.one && test -s conftest.two &&
+ test -s conftest.dir/conftest.one &&
+ test -s conftest.dir/conftest.two
+ then
+ ac_cv_path_install="$as_dir/$ac_prog$ac_exec_ext -c"
+ break 3
+ fi
+ fi
+ fi
+ done
+ done
+ ;;
+esac
+
+ done
+IFS=$as_save_IFS
+
+rm -rf conftest.one conftest.two conftest.dir
+
+fi
+ if test "${ac_cv_path_install+set}" = set; then
+ INSTALL=$ac_cv_path_install
+ else
+ # As a last resort, use the slow shell script. Don't cache a
+ # value for INSTALL within a source directory, because that will
+ # break other packages using the cache if that directory is
+ # removed, or if the value is a relative name.
+ INSTALL=$ac_install_sh
+ fi
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $INSTALL" >&5
+$as_echo "$INSTALL" >&6; }
+
+# Use test -z because SunOS4 sh mishandles braces in ${var-val}.
+# It thinks the first close brace ends the variable substitution.
+test -z "$INSTALL_PROGRAM" && INSTALL_PROGRAM='${INSTALL}'
+
+test -z "$INSTALL_SCRIPT" && INSTALL_SCRIPT='${INSTALL}'
+
+test -z "$INSTALL_DATA" && INSTALL_DATA='${INSTALL} -m 644'
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether build environment is sane" >&5
+$as_echo_n "checking whether build environment is sane... " >&6; }
+# Reject unsafe characters in $srcdir or the absolute working directory
+# name. Accept space and tab only in the latter.
+am_lf='
+'
+case `pwd` in
+ *[\\\"\#\$\&\'\`$am_lf]*)
+ as_fn_error $? "unsafe absolute working directory name" "$LINENO" 5;;
+esac
+case $srcdir in
+ *[\\\"\#\$\&\'\`$am_lf\ \ ]*)
+ as_fn_error $? "unsafe srcdir value: '$srcdir'" "$LINENO" 5;;
+esac
+
+# Do 'set' in a subshell so we don't clobber the current shell's
+# arguments. Must try -L first in case configure is actually a
+# symlink; some systems play weird games with the mod time of symlinks
+# (eg FreeBSD returns the mod time of the symlink's containing
+# directory).
+if (
+ am_has_slept=no
+ for am_try in 1 2; do
+ echo "timestamp, slept: $am_has_slept" > conftest.file
+ set X `ls -Lt "$srcdir/configure" conftest.file 2> /dev/null`
+ if test "$*" = "X"; then
+ # -L didn't work.
+ set X `ls -t "$srcdir/configure" conftest.file`
+ fi
+ if test "$*" != "X $srcdir/configure conftest.file" \
+ && test "$*" != "X conftest.file $srcdir/configure"; then
+
+ # If neither matched, then we have a broken ls. This can happen
+ # if, for instance, CONFIG_SHELL is bash and it inherits a
+ # broken ls alias from the environment. This has actually
+ # happened. Such a system could not be considered "sane".
+ as_fn_error $? "ls -t appears to fail. Make sure there is not a broken
+ alias in your environment" "$LINENO" 5
+ fi
+ if test "$2" = conftest.file || test $am_try -eq 2; then
+ break
+ fi
+ # Just in case.
+ sleep 1
+ am_has_slept=yes
+ done
+ test "$2" = conftest.file
+ )
+then
+ # Ok.
+ :
+else
+ as_fn_error $? "newly created file is older than distributed files!
+Check your system clock" "$LINENO" 5
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+$as_echo "yes" >&6; }
+# If we didn't sleep, we still need to ensure time stamps of config.status and
+# generated files are strictly newer.
+am_sleep_pid=
+if grep 'slept: no' conftest.file >/dev/null 2>&1; then
+ ( sleep 1 ) &
+ am_sleep_pid=$!
+fi
+
+rm -f conftest.file
+
+test "$program_prefix" != NONE &&
+ program_transform_name="s&^&$program_prefix&;$program_transform_name"
+# Use a double $ so make ignores it.
+test "$program_suffix" != NONE &&
+ program_transform_name="s&\$&$program_suffix&;$program_transform_name"
+# Double any \ or $.
+# By default was `s,x,x', remove it if useless.
+ac_script='s/[\\$]/&&/g;s/;s,x,x,$//'
+program_transform_name=`$as_echo "$program_transform_name" | sed "$ac_script"`
+
+# expand $ac_aux_dir to an absolute path
+am_aux_dir=`cd $ac_aux_dir && pwd`
+
+if test x"${MISSING+set}" != xset; then
+ case $am_aux_dir in
+ *\ * | *\ *)
+ MISSING="\${SHELL} \"$am_aux_dir/missing\"" ;;
+ *)
+ MISSING="\${SHELL} $am_aux_dir/missing" ;;
+ esac
+fi
+# Use eval to expand $SHELL
+if eval "$MISSING --is-lightweight"; then
+ am_missing_run="$MISSING "
+else
+ am_missing_run=
+ { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: 'missing' script is too old or missing" >&5
+$as_echo "$as_me: WARNING: 'missing' script is too old or missing" >&2;}
+fi
+
+if test x"${install_sh}" != xset; then
+ case $am_aux_dir in
+ *\ * | *\ *)
+ install_sh="\${SHELL} '$am_aux_dir/install-sh'" ;;
+ *)
+ install_sh="\${SHELL} $am_aux_dir/install-sh"
+ esac
+fi
+
+# Installed binaries are usually stripped using 'strip' when the user
+# run "make install-strip". However 'strip' might not be the right
+# tool to use in cross-compilation environments, therefore Automake
+# will honor the 'STRIP' environment variable to overrule this program.
+if test "$cross_compiling" != no; then
+ if test -n "$ac_tool_prefix"; then
+ # Extract the first word of "${ac_tool_prefix}strip", so it can be a program name with args.
+set dummy ${ac_tool_prefix}strip; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_STRIP+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$STRIP"; then
+ ac_cv_prog_STRIP="$STRIP" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_STRIP="${ac_tool_prefix}strip"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+STRIP=$ac_cv_prog_STRIP
+if test -n "$STRIP"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $STRIP" >&5
+$as_echo "$STRIP" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+fi
+if test -z "$ac_cv_prog_STRIP"; then
+ ac_ct_STRIP=$STRIP
+ # Extract the first word of "strip", so it can be a program name with args.
+set dummy strip; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_STRIP+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$ac_ct_STRIP"; then
+ ac_cv_prog_ac_ct_STRIP="$ac_ct_STRIP" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_ac_ct_STRIP="strip"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_STRIP=$ac_cv_prog_ac_ct_STRIP
+if test -n "$ac_ct_STRIP"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_STRIP" >&5
+$as_echo "$ac_ct_STRIP" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+ if test "x$ac_ct_STRIP" = x; then
+ STRIP=":"
+ else
+ case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+ STRIP=$ac_ct_STRIP
+ fi
+else
+ STRIP="$ac_cv_prog_STRIP"
+fi
+
+fi
+INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s"
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for a thread-safe mkdir -p" >&5
+$as_echo_n "checking for a thread-safe mkdir -p... " >&6; }
+if test -z "$MKDIR_P"; then
+ if ${ac_cv_path_mkdir+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH$PATH_SEPARATOR/opt/sfw/bin
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_prog in mkdir gmkdir; do
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ as_fn_executable_p "$as_dir/$ac_prog$ac_exec_ext" || continue
+ case `"$as_dir/$ac_prog$ac_exec_ext" --version 2>&1` in #(
+ 'mkdir (GNU coreutils) '* | \
+ 'mkdir (coreutils) '* | \
+ 'mkdir (fileutils) '4.1*)
+ ac_cv_path_mkdir=$as_dir/$ac_prog$ac_exec_ext
+ break 3;;
+ esac
+ done
+ done
+ done
+IFS=$as_save_IFS
+
+fi
+
+ test -d ./--version && rmdir ./--version
+ if test "${ac_cv_path_mkdir+set}" = set; then
+ MKDIR_P="$ac_cv_path_mkdir -p"
+ else
+ # As a last resort, use the slow shell script. Don't cache a
+ # value for MKDIR_P within a source directory, because that will
+ # break other packages using the cache if that directory is
+ # removed, or if the value is a relative name.
+ MKDIR_P="$ac_install_sh -d"
+ fi
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $MKDIR_P" >&5
+$as_echo "$MKDIR_P" >&6; }
+
+for ac_prog in gawk mawk nawk awk
+do
+ # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_AWK+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$AWK"; then
+ ac_cv_prog_AWK="$AWK" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_AWK="$ac_prog"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+AWK=$ac_cv_prog_AWK
+if test -n "$AWK"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $AWK" >&5
+$as_echo "$AWK" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+ test -n "$AWK" && break
+done
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether ${MAKE-make} sets \$(MAKE)" >&5
+$as_echo_n "checking whether ${MAKE-make} sets \$(MAKE)... " >&6; }
+set x ${MAKE-make}
+ac_make=`$as_echo "$2" | sed 's/+/p/g; s/[^a-zA-Z0-9_]/_/g'`
+if eval \${ac_cv_prog_make_${ac_make}_set+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat >conftest.make <<\_ACEOF
+SHELL = /bin/sh
+all:
+ @echo '@@@%%%=$(MAKE)=@@@%%%'
+_ACEOF
+# GNU make sometimes prints "make[1]: Entering ...", which would confuse us.
+case `${MAKE-make} -f conftest.make 2>/dev/null` in
+ *@@@%%%=?*=@@@%%%*)
+ eval ac_cv_prog_make_${ac_make}_set=yes;;
+ *)
+ eval ac_cv_prog_make_${ac_make}_set=no;;
+esac
+rm -f conftest.make
+fi
+if eval test \$ac_cv_prog_make_${ac_make}_set = yes; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+$as_echo "yes" >&6; }
+ SET_MAKE=
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+ SET_MAKE="MAKE=${MAKE-make}"
+fi
+
+rm -rf .tst 2>/dev/null
+mkdir .tst 2>/dev/null
+if test -d .tst; then
+ am__leading_dot=.
+else
+ am__leading_dot=_
+fi
+rmdir .tst 2>/dev/null
+
+# Check whether --enable-silent-rules was given.
+if test "${enable_silent_rules+set}" = set; then :
+ enableval=$enable_silent_rules;
+fi
+
+case $enable_silent_rules in # (((
+ yes) AM_DEFAULT_VERBOSITY=0;;
+ no) AM_DEFAULT_VERBOSITY=1;;
+ *) AM_DEFAULT_VERBOSITY=1;;
+esac
+am_make=${MAKE-make}
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $am_make supports nested variables" >&5
+$as_echo_n "checking whether $am_make supports nested variables... " >&6; }
+if ${am_cv_make_support_nested_variables+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if $as_echo 'TRUE=$(BAR$(V))
+BAR0=false
+BAR1=true
+V=1
+am__doit:
+ @$(TRUE)
+.PHONY: am__doit' | $am_make -f - >/dev/null 2>&1; then
+ am_cv_make_support_nested_variables=yes
+else
+ am_cv_make_support_nested_variables=no
+fi
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_make_support_nested_variables" >&5
+$as_echo "$am_cv_make_support_nested_variables" >&6; }
+if test $am_cv_make_support_nested_variables = yes; then
+ AM_V='$(V)'
+ AM_DEFAULT_V='$(AM_DEFAULT_VERBOSITY)'
+else
+ AM_V=$AM_DEFAULT_VERBOSITY
+ AM_DEFAULT_V=$AM_DEFAULT_VERBOSITY
+fi
+AM_BACKSLASH='\'
+
+if test "`cd $srcdir && pwd`" != "`pwd`"; then
+ # Use -I$(srcdir) only when $(srcdir) != ., so that make's output
+ # is not polluted with repeated "-I."
+ am__isrc=' -I$(srcdir)'
+ # test to see if srcdir already configured
+ if test -f $srcdir/config.status; then
+ as_fn_error $? "source directory already configured; run \"make distclean\" there first" "$LINENO" 5
+ fi
+fi
+
+# test whether we have cygpath
+if test -z "$CYGPATH_W"; then
+ if (cygpath --version) >/dev/null 2>/dev/null; then
+ CYGPATH_W='cygpath -w'
+ else
+ CYGPATH_W=echo
+ fi
+fi
+
+
+# Define the identity of the package.
+ PACKAGE='andi'
+ VERSION='0.9.4'
+
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE "$PACKAGE"
+_ACEOF
+
+
+cat >>confdefs.h <<_ACEOF
+#define VERSION "$VERSION"
+_ACEOF
+
+# Some tools Automake needs.
+
+ACLOCAL=${ACLOCAL-"${am_missing_run}aclocal-${am__api_version}"}
+
+
+AUTOCONF=${AUTOCONF-"${am_missing_run}autoconf"}
+
+
+AUTOMAKE=${AUTOMAKE-"${am_missing_run}automake-${am__api_version}"}
+
+
+AUTOHEADER=${AUTOHEADER-"${am_missing_run}autoheader"}
+
+
+MAKEINFO=${MAKEINFO-"${am_missing_run}makeinfo"}
+
+# For better backward compatibility. To be removed once Automake 1.9.x
+# dies out for good. For more background, see:
+# <http://lists.gnu.org/archive/html/automake/2012-07/msg00001.html>
+# <http://lists.gnu.org/archive/html/automake/2012-07/msg00014.html>
+mkdir_p='$(MKDIR_P)'
+
+# We need awk for the "check" target. The system "awk" is bad on
+# some platforms.
+# Always define AMTAR for backward compatibility. Yes, it's still used
+# in the wild :-( We should find a proper way to deprecate it ...
+AMTAR='$${TAR-tar}'
+
+
+# We'll loop over all known methods to create a tar archive until one works.
+_am_tools='gnutar pax cpio none'
+
+am__tar='$${TAR-tar} chof - "$$tardir"' am__untar='$${TAR-tar} xf -'
+
+
+
+
+
+
+# POSIX will say in a future version that running "rm -f" with no argument
+# is OK; and we want to be able to make that assumption in our Makefile
+# recipes. So use an aggressive probe to check that the usage we want is
+# actually supported "in the wild" to an acceptable degree.
+# See automake bug#10828.
+# To make any issue more visible, cause the running configure to be aborted
+# by default if the 'rm' program in use doesn't match our expectations; the
+# user can still override this though.
+if rm -f && rm -fr && rm -rf; then : OK; else
+ cat >&2 <<'END'
+Oops!
+
+Your 'rm' program seems unable to run without file operands specified
+on the command line, even when the '-f' option is present. This is contrary
+to the behaviour of most rm programs out there, and not conforming with
+the upcoming POSIX standard: <http://austingroupbugs.net/view.php?id=542>
+
+Please tell bug-automake at gnu.org about your system, including the value
+of your $PATH and any error possibly output before this message. This
+can help us improve future automake versions.
+
+END
+ if test x"$ACCEPT_INFERIOR_RM_PROGRAM" = x"yes"; then
+ echo 'Configuration will proceed anyway, since you have set the' >&2
+ echo 'ACCEPT_INFERIOR_RM_PROGRAM variable to "yes"' >&2
+ echo >&2
+ else
+ cat >&2 <<'END'
+Aborting the configuration process, to ensure you take notice of the issue.
+
+You can download and install GNU coreutils to get an 'rm' implementation
+that behaves properly: <http://www.gnu.org/software/coreutils/>.
+
+If you want to complete the configuration process using your problematic
+'rm' anyway, export the environment variable ACCEPT_INFERIOR_RM_PROGRAM
+to "yes", and re-run configure.
+
+END
+ as_fn_error $? "Your 'rm' program is bad, sorry." "$LINENO" 5
+ fi
+fi
+
+
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+if test -n "$ac_tool_prefix"; then
+ # Extract the first word of "${ac_tool_prefix}gcc", so it can be a program name with args.
+set dummy ${ac_tool_prefix}gcc; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_CC+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$CC"; then
+ ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_CC="${ac_tool_prefix}gcc"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+$as_echo "$CC" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+fi
+if test -z "$ac_cv_prog_CC"; then
+ ac_ct_CC=$CC
+ # Extract the first word of "gcc", so it can be a program name with args.
+set dummy gcc; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_CC+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$ac_ct_CC"; then
+ ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_ac_ct_CC="gcc"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_CC=$ac_cv_prog_ac_ct_CC
+if test -n "$ac_ct_CC"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CC" >&5
+$as_echo "$ac_ct_CC" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+ if test "x$ac_ct_CC" = x; then
+ CC=""
+ else
+ case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+ CC=$ac_ct_CC
+ fi
+else
+ CC="$ac_cv_prog_CC"
+fi
+
+if test -z "$CC"; then
+ if test -n "$ac_tool_prefix"; then
+ # Extract the first word of "${ac_tool_prefix}cc", so it can be a program name with args.
+set dummy ${ac_tool_prefix}cc; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_CC+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$CC"; then
+ ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_CC="${ac_tool_prefix}cc"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+$as_echo "$CC" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+ fi
+fi
+if test -z "$CC"; then
+ # Extract the first word of "cc", so it can be a program name with args.
+set dummy cc; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_CC+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$CC"; then
+ ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+ ac_prog_rejected=no
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ if test "$as_dir/$ac_word$ac_exec_ext" = "/usr/ucb/cc"; then
+ ac_prog_rejected=yes
+ continue
+ fi
+ ac_cv_prog_CC="cc"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+if test $ac_prog_rejected = yes; then
+ # We found a bogon in the path, so make sure we never use it.
+ set dummy $ac_cv_prog_CC
+ shift
+ if test $# != 0; then
+ # We chose a different compiler from the bogus one.
+ # However, it has the same basename, so the bogon will be chosen
+ # first if we set CC to just the basename; use the full file name.
+ shift
+ ac_cv_prog_CC="$as_dir/$ac_word${1+' '}$@"
+ fi
+fi
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+$as_echo "$CC" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+fi
+if test -z "$CC"; then
+ if test -n "$ac_tool_prefix"; then
+ for ac_prog in cl.exe
+ do
+ # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
+set dummy $ac_tool_prefix$ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_CC+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$CC"; then
+ ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_CC="$ac_tool_prefix$ac_prog"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
+$as_echo "$CC" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+ test -n "$CC" && break
+ done
+fi
+if test -z "$CC"; then
+ ac_ct_CC=$CC
+ for ac_prog in cl.exe
+do
+ # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_CC+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$ac_ct_CC"; then
+ ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_ac_ct_CC="$ac_prog"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_CC=$ac_cv_prog_ac_ct_CC
+if test -n "$ac_ct_CC"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CC" >&5
+$as_echo "$ac_ct_CC" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+ test -n "$ac_ct_CC" && break
+done
+
+ if test "x$ac_ct_CC" = x; then
+ CC=""
+ else
+ case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+ CC=$ac_ct_CC
+ fi
+fi
+
+fi
+
+
+test -z "$CC" && { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "no acceptable C compiler found in \$PATH
+See \`config.log' for more details" "$LINENO" 5; }
+
+# Provide some information about the compiler.
+$as_echo "$as_me:${as_lineno-$LINENO}: checking for C compiler version" >&5
+set X $ac_compile
+ac_compiler=$2
+for ac_option in --version -v -V -qversion; do
+ { { ac_try="$ac_compiler $ac_option >&5"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_compiler $ac_option >&5") 2>conftest.err
+ ac_status=$?
+ if test -s conftest.err; then
+ sed '10a\
+... rest of stderr output deleted ...
+ 10q' conftest.err >conftest.er1
+ cat conftest.er1 >&5
+ fi
+ rm -f conftest.er1 conftest.err
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }
+done
+
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+int
+main ()
+{
+
+ ;
+ return 0;
+}
+_ACEOF
+ac_clean_files_save=$ac_clean_files
+ac_clean_files="$ac_clean_files a.out a.out.dSYM a.exe b.out"
+# Try to create an executable without -o first, disregard a.out.
+# It will help us diagnose broken compilers, and finding out an intuition
+# of exeext.
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the C compiler works" >&5
+$as_echo_n "checking whether the C compiler works... " >&6; }
+ac_link_default=`$as_echo "$ac_link" | sed 's/ -o *conftest[^ ]*//'`
+
+# The possible output files:
+ac_files="a.out conftest.exe conftest a.exe a_out.exe b.out conftest.*"
+
+ac_rmfiles=
+for ac_file in $ac_files
+do
+ case $ac_file in
+ *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
+ * ) ac_rmfiles="$ac_rmfiles $ac_file";;
+ esac
+done
+rm -f $ac_rmfiles
+
+if { { ac_try="$ac_link_default"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_link_default") 2>&5
+ ac_status=$?
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }; then :
+ # Autoconf-2.13 could set the ac_cv_exeext variable to `no'.
+# So ignore a value of `no', otherwise this would lead to `EXEEXT = no'
+# in a Makefile. We should not override ac_cv_exeext if it was cached,
+# so that the user can short-circuit this test for compilers unknown to
+# Autoconf.
+for ac_file in $ac_files ''
+do
+ test -f "$ac_file" || continue
+ case $ac_file in
+ *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj )
+ ;;
+ [ab].out )
+ # We found the default executable, but exeext='' is most
+ # certainly right.
+ break;;
+ *.* )
+ if test "${ac_cv_exeext+set}" = set && test "$ac_cv_exeext" != no;
+ then :; else
+ ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
+ fi
+ # We set ac_cv_exeext here because the later test for it is not
+ # safe: cross compilers may not add the suffix if given an `-o'
+ # argument, so we may need to know it at that point already.
+ # Even if this section looks crufty: it has the advantage of
+ # actually working.
+ break;;
+ * )
+ break;;
+ esac
+done
+test "$ac_cv_exeext" = no && ac_cv_exeext=
+
+else
+ ac_file=''
+fi
+if test -z "$ac_file"; then :
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+$as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error 77 "C compiler cannot create executables
+See \`config.log' for more details" "$LINENO" 5; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+$as_echo "yes" >&6; }
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for C compiler default output file name" >&5
+$as_echo_n "checking for C compiler default output file name... " >&6; }
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_file" >&5
+$as_echo "$ac_file" >&6; }
+ac_exeext=$ac_cv_exeext
+
+rm -f -r a.out a.out.dSYM a.exe conftest$ac_cv_exeext b.out
+ac_clean_files=$ac_clean_files_save
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for suffix of executables" >&5
+$as_echo_n "checking for suffix of executables... " >&6; }
+if { { ac_try="$ac_link"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_link") 2>&5
+ ac_status=$?
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }; then :
+ # If both `conftest.exe' and `conftest' are `present' (well, observable)
+# catch `conftest.exe'. For instance with Cygwin, `ls conftest' will
+# work properly (i.e., refer to `conftest.exe'), while it won't with
+# `rm'.
+for ac_file in conftest.exe conftest conftest.*; do
+ test -f "$ac_file" || continue
+ case $ac_file in
+ *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
+ *.* ) ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
+ break;;
+ * ) break;;
+ esac
+done
+else
+ { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "cannot compute suffix of executables: cannot compile and link
+See \`config.log' for more details" "$LINENO" 5; }
+fi
+rm -f conftest conftest$ac_cv_exeext
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_exeext" >&5
+$as_echo "$ac_cv_exeext" >&6; }
+
+rm -f conftest.$ac_ext
+EXEEXT=$ac_cv_exeext
+ac_exeext=$EXEEXT
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#include <stdio.h>
+int
+main ()
+{
+FILE *f = fopen ("conftest.out", "w");
+ return ferror (f) || fclose (f) != 0;
+
+ ;
+ return 0;
+}
+_ACEOF
+ac_clean_files="$ac_clean_files conftest.out"
+# Check that the compiler produces executables we can run. If not, either
+# the compiler is broken, or we cross compile.
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are cross compiling" >&5
+$as_echo_n "checking whether we are cross compiling... " >&6; }
+if test "$cross_compiling" != yes; then
+ { { ac_try="$ac_link"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_link") 2>&5
+ ac_status=$?
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }
+ if { ac_try='./conftest$ac_cv_exeext'
+ { { case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_try") 2>&5
+ ac_status=$?
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }; }; then
+ cross_compiling=no
+ else
+ if test "$cross_compiling" = maybe; then
+ cross_compiling=yes
+ else
+ { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "cannot run C compiled programs.
+If you meant to cross compile, use \`--host'.
+See \`config.log' for more details" "$LINENO" 5; }
+ fi
+ fi
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $cross_compiling" >&5
+$as_echo "$cross_compiling" >&6; }
+
+rm -f conftest.$ac_ext conftest$ac_cv_exeext conftest.out
+ac_clean_files=$ac_clean_files_save
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for suffix of object files" >&5
+$as_echo_n "checking for suffix of object files... " >&6; }
+if ${ac_cv_objext+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+int
+main ()
+{
+
+ ;
+ return 0;
+}
+_ACEOF
+rm -f conftest.o conftest.obj
+if { { ac_try="$ac_compile"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_compile") 2>&5
+ ac_status=$?
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }; then :
+ for ac_file in conftest.o conftest.obj conftest.*; do
+ test -f "$ac_file" || continue;
+ case $ac_file in
+ *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM ) ;;
+ *) ac_cv_objext=`expr "$ac_file" : '.*\.\(.*\)'`
+ break;;
+ esac
+done
+else
+ $as_echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "cannot compute suffix of object files: cannot compile
+See \`config.log' for more details" "$LINENO" 5; }
+fi
+rm -f conftest.$ac_cv_objext conftest.$ac_ext
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_objext" >&5
+$as_echo "$ac_cv_objext" >&6; }
+OBJEXT=$ac_cv_objext
+ac_objext=$OBJEXT
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are using the GNU C compiler" >&5
+$as_echo_n "checking whether we are using the GNU C compiler... " >&6; }
+if ${ac_cv_c_compiler_gnu+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+int
+main ()
+{
+#ifndef __GNUC__
+ choke me
+#endif
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ ac_compiler_gnu=yes
+else
+ ac_compiler_gnu=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ac_cv_c_compiler_gnu=$ac_compiler_gnu
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_c_compiler_gnu" >&5
+$as_echo "$ac_cv_c_compiler_gnu" >&6; }
+if test $ac_compiler_gnu = yes; then
+ GCC=yes
+else
+ GCC=
+fi
+ac_test_CFLAGS=${CFLAGS+set}
+ac_save_CFLAGS=$CFLAGS
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CC accepts -g" >&5
+$as_echo_n "checking whether $CC accepts -g... " >&6; }
+if ${ac_cv_prog_cc_g+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ ac_save_c_werror_flag=$ac_c_werror_flag
+ ac_c_werror_flag=yes
+ ac_cv_prog_cc_g=no
+ CFLAGS="-g"
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+int
+main ()
+{
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ ac_cv_prog_cc_g=yes
+else
+ CFLAGS=""
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+int
+main ()
+{
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+
+else
+ ac_c_werror_flag=$ac_save_c_werror_flag
+ CFLAGS="-g"
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+int
+main ()
+{
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ ac_cv_prog_cc_g=yes
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ ac_c_werror_flag=$ac_save_c_werror_flag
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cc_g" >&5
+$as_echo "$ac_cv_prog_cc_g" >&6; }
+if test "$ac_test_CFLAGS" = set; then
+ CFLAGS=$ac_save_CFLAGS
+elif test $ac_cv_prog_cc_g = yes; then
+ if test "$GCC" = yes; then
+ CFLAGS="-g -O2"
+ else
+ CFLAGS="-g"
+ fi
+else
+ if test "$GCC" = yes; then
+ CFLAGS="-O2"
+ else
+ CFLAGS=
+ fi
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $CC option to accept ISO C89" >&5
+$as_echo_n "checking for $CC option to accept ISO C89... " >&6; }
+if ${ac_cv_prog_cc_c89+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ ac_cv_prog_cc_c89=no
+ac_save_CC=$CC
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#include <stdarg.h>
+#include <stdio.h>
+struct stat;
+/* Most of the following tests are stolen from RCS 5.7's src/conf.sh. */
+struct buf { int x; };
+FILE * (*rcsopen) (struct buf *, struct stat *, int);
+static char *e (p, i)
+ char **p;
+ int i;
+{
+ return p[i];
+}
+static char *f (char * (*g) (char **, int), char **p, ...)
+{
+ char *s;
+ va_list v;
+ va_start (v,p);
+ s = g (p, va_arg (v,int));
+ va_end (v);
+ return s;
+}
+
+/* OSF 4.0 Compaq cc is some sort of almost-ANSI by default. It has
+ function prototypes and stuff, but not '\xHH' hex character constants.
+ These don't provoke an error unfortunately, instead are silently treated
+ as 'x'. The following induces an error, until -std is added to get
+ proper ANSI mode. Curiously '\x00'!='x' always comes out true, for an
+ array size at least. It's necessary to write '\x00'==0 to get something
+ that's true only with -std. */
+int osf4_cc_array ['\x00' == 0 ? 1 : -1];
+
+/* IBM C 6 for AIX is almost-ANSI by default, but it replaces macro parameters
+ inside strings and character constants. */
+#define FOO(x) 'x'
+int xlc6_cc_array[FOO(a) == 'x' ? 1 : -1];
+
+int test (int i, double x);
+struct s1 {int (*f) (int a);};
+struct s2 {int (*f) (double a);};
+int pairnames (int, char **, FILE *(*)(struct buf *, struct stat *, int), int, int);
+int argc;
+char **argv;
+int
+main ()
+{
+return f (e, argv, 0) != argv[0] || f (e, argv, 1) != argv[1];
+ ;
+ return 0;
+}
+_ACEOF
+for ac_arg in '' -qlanglvl=extc89 -qlanglvl=ansi -std \
+ -Ae "-Aa -D_HPUX_SOURCE" "-Xc -D__EXTENSIONS__"
+do
+ CC="$ac_save_CC $ac_arg"
+ if ac_fn_c_try_compile "$LINENO"; then :
+ ac_cv_prog_cc_c89=$ac_arg
+fi
+rm -f core conftest.err conftest.$ac_objext
+ test "x$ac_cv_prog_cc_c89" != "xno" && break
+done
+rm -f conftest.$ac_ext
+CC=$ac_save_CC
+
+fi
+# AC_CACHE_VAL
+case "x$ac_cv_prog_cc_c89" in
+ x)
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: none needed" >&5
+$as_echo "none needed" >&6; } ;;
+ xno)
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: unsupported" >&5
+$as_echo "unsupported" >&6; } ;;
+ *)
+ CC="$CC $ac_cv_prog_cc_c89"
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cc_c89" >&5
+$as_echo "$ac_cv_prog_cc_c89" >&6; } ;;
+esac
+if test "x$ac_cv_prog_cc_c89" != xno; then :
+
+fi
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CC understands -c and -o together" >&5
+$as_echo_n "checking whether $CC understands -c and -o together... " >&6; }
+if ${am_cv_prog_cc_c_o+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+int
+main ()
+{
+
+ ;
+ return 0;
+}
+_ACEOF
+ # Make sure it works both with $CC and with simple cc.
+ # Following AC_PROG_CC_C_O, we do the test twice because some
+ # compilers refuse to overwrite an existing .o file with -o,
+ # though they will create one.
+ am_cv_prog_cc_c_o=yes
+ for am_i in 1 2; do
+ if { echo "$as_me:$LINENO: $CC -c conftest.$ac_ext -o conftest2.$ac_objext" >&5
+ ($CC -c conftest.$ac_ext -o conftest2.$ac_objext) >&5 2>&5
+ ac_status=$?
+ echo "$as_me:$LINENO: \$? = $ac_status" >&5
+ (exit $ac_status); } \
+ && test -f conftest2.$ac_objext; then
+ : OK
+ else
+ am_cv_prog_cc_c_o=no
+ break
+ fi
+ done
+ rm -f core conftest*
+ unset am_i
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_prog_cc_c_o" >&5
+$as_echo "$am_cv_prog_cc_c_o" >&6; }
+if test "$am_cv_prog_cc_c_o" != yes; then
+ # Losing compiler, so override with the script.
+ # FIXME: It is wrong to rewrite CC.
+ # But if we don't then we get into trouble of one sort or another.
+ # A longer-term fix would be to have automake use am__CC in this case,
+ # and then we could set am__CC="\$(top_srcdir)/compile \$(CC)"
+ CC="$am_aux_dir/compile $CC"
+fi
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+DEPDIR="${am__leading_dot}deps"
+
+ac_config_commands="$ac_config_commands depfiles"
+
+
+am_make=${MAKE-make}
+cat > confinc << 'END'
+am__doit:
+ @echo this is the am__doit target
+.PHONY: am__doit
+END
+# If we don't find an include directive, just comment out the code.
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for style of include used by $am_make" >&5
+$as_echo_n "checking for style of include used by $am_make... " >&6; }
+am__include="#"
+am__quote=
+_am_result=none
+# First try GNU make style include.
+echo "include confinc" > confmf
+# Ignore all kinds of additional output from 'make'.
+case `$am_make -s -f confmf 2> /dev/null` in #(
+*the\ am__doit\ target*)
+ am__include=include
+ am__quote=
+ _am_result=GNU
+ ;;
+esac
+# Now try BSD make style include.
+if test "$am__include" = "#"; then
+ echo '.include "confinc"' > confmf
+ case `$am_make -s -f confmf 2> /dev/null` in #(
+ *the\ am__doit\ target*)
+ am__include=.include
+ am__quote="\""
+ _am_result=BSD
+ ;;
+ esac
+fi
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $_am_result" >&5
+$as_echo "$_am_result" >&6; }
+rm -f confinc confmf
+
+# Check whether --enable-dependency-tracking was given.
+if test "${enable_dependency_tracking+set}" = set; then :
+ enableval=$enable_dependency_tracking;
+fi
+
+if test "x$enable_dependency_tracking" != xno; then
+ am_depcomp="$ac_aux_dir/depcomp"
+ AMDEPBACKSLASH='\'
+ am__nodep='_no'
+fi
+ if test "x$enable_dependency_tracking" != xno; then
+ AMDEP_TRUE=
+ AMDEP_FALSE='#'
+else
+ AMDEP_TRUE='#'
+ AMDEP_FALSE=
+fi
+
+
+
+depcc="$CC" am_compiler_list=
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking dependency style of $depcc" >&5
+$as_echo_n "checking dependency style of $depcc... " >&6; }
+if ${am_cv_CC_dependencies_compiler_type+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
+ # We make a subdir and do the tests there. Otherwise we can end up
+ # making bogus files that we don't know about and never remove. For
+ # instance it was reported that on HP-UX the gcc test will end up
+ # making a dummy file named 'D' -- because '-MD' means "put the output
+ # in D".
+ rm -rf conftest.dir
+ mkdir conftest.dir
+ # Copy depcomp to subdir because otherwise we won't find it if we're
+ # using a relative directory.
+ cp "$am_depcomp" conftest.dir
+ cd conftest.dir
+ # We will build objects and dependencies in a subdirectory because
+ # it helps to detect inapplicable dependency modes. For instance
+ # both Tru64's cc and ICC support -MD to output dependencies as a
+ # side effect of compilation, but ICC will put the dependencies in
+ # the current directory while Tru64 will put them in the object
+ # directory.
+ mkdir sub
+
+ am_cv_CC_dependencies_compiler_type=none
+ if test "$am_compiler_list" = ""; then
+ am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
+ fi
+ am__universal=false
+ case " $depcc " in #(
+ *\ -arch\ *\ -arch\ *) am__universal=true ;;
+ esac
+
+ for depmode in $am_compiler_list; do
+ # Setup a source with many dependencies, because some compilers
+ # like to wrap large dependency lists on column 80 (with \), and
+ # we should not choose a depcomp mode which is confused by this.
+ #
+ # We need to recreate these files for each test, as the compiler may
+ # overwrite some of them when testing with obscure command lines.
+ # This happens at least with the AIX C compiler.
+ : > sub/conftest.c
+ for i in 1 2 3 4 5 6; do
+ echo '#include "conftst'$i'.h"' >> sub/conftest.c
+ # Using ": > sub/conftst$i.h" creates only sub/conftst1.h with
+ # Solaris 10 /bin/sh.
+ echo '/* dummy */' > sub/conftst$i.h
+ done
+ echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
+
+ # We check with '-c' and '-o' for the sake of the "dashmstdout"
+ # mode. It turns out that the SunPro C++ compiler does not properly
+ # handle '-M -o', and we need to detect this. Also, some Intel
+ # versions had trouble with output in subdirs.
+ am__obj=sub/conftest.${OBJEXT-o}
+ am__minus_obj="-o $am__obj"
+ case $depmode in
+ gcc)
+ # This depmode causes a compiler race in universal mode.
+ test "$am__universal" = false || continue
+ ;;
+ nosideeffect)
+ # After this tag, mechanisms are not by side-effect, so they'll
+ # only be used when explicitly requested.
+ if test "x$enable_dependency_tracking" = xyes; then
+ continue
+ else
+ break
+ fi
+ ;;
+ msvc7 | msvc7msys | msvisualcpp | msvcmsys)
+ # This compiler won't grok '-c -o', but also, the minuso test has
+ # not run yet. These depmodes are late enough in the game, and
+ # so weak that their functioning should not be impacted.
+ am__obj=conftest.${OBJEXT-o}
+ am__minus_obj=
+ ;;
+ none) break ;;
+ esac
+ if depmode=$depmode \
+ source=sub/conftest.c object=$am__obj \
+ depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
+ $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
+ >/dev/null 2>conftest.err &&
+ grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
+ grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
+ grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
+ ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
+ # icc doesn't choke on unknown options, it will just issue warnings
+ # or remarks (even with -Werror). So we grep stderr for any message
+ # that says an option was ignored or not supported.
+ # When given -MP, icc 7.0 and 7.1 complain thusly:
+ # icc: Command line warning: ignoring option '-M'; no argument required
+ # The diagnosis changed in icc 8.0:
+ # icc: Command line remark: option '-MP' not supported
+ if (grep 'ignoring option' conftest.err ||
+ grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
+ am_cv_CC_dependencies_compiler_type=$depmode
+ break
+ fi
+ fi
+ done
+
+ cd ..
+ rm -rf conftest.dir
+else
+ am_cv_CC_dependencies_compiler_type=none
+fi
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_CC_dependencies_compiler_type" >&5
+$as_echo "$am_cv_CC_dependencies_compiler_type" >&6; }
+CCDEPMODE=depmode=$am_cv_CC_dependencies_compiler_type
+
+ if
+ test "x$enable_dependency_tracking" != xno \
+ && test "$am_cv_CC_dependencies_compiler_type" = gcc3; then
+ am__fastdepCC_TRUE=
+ am__fastdepCC_FALSE='#'
+else
+ am__fastdepCC_TRUE='#'
+ am__fastdepCC_FALSE=
+fi
+
+
+ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
+if test -z "$CXX"; then
+ if test -n "$CCC"; then
+ CXX=$CCC
+ else
+ if test -n "$ac_tool_prefix"; then
+ for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
+ do
+ # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
+set dummy $ac_tool_prefix$ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_CXX+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$CXX"; then
+ ac_cv_prog_CXX="$CXX" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_CXX="$ac_tool_prefix$ac_prog"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+CXX=$ac_cv_prog_CXX
+if test -n "$CXX"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CXX" >&5
+$as_echo "$CXX" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+ test -n "$CXX" && break
+ done
+fi
+if test -z "$CXX"; then
+ ac_ct_CXX=$CXX
+ for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
+do
+ # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_CXX+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$ac_ct_CXX"; then
+ ac_cv_prog_ac_ct_CXX="$ac_ct_CXX" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_ac_ct_CXX="$ac_prog"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_CXX=$ac_cv_prog_ac_ct_CXX
+if test -n "$ac_ct_CXX"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CXX" >&5
+$as_echo "$ac_ct_CXX" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+ test -n "$ac_ct_CXX" && break
+done
+
+ if test "x$ac_ct_CXX" = x; then
+ CXX="g++"
+ else
+ case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+ CXX=$ac_ct_CXX
+ fi
+fi
+
+ fi
+fi
+# Provide some information about the compiler.
+$as_echo "$as_me:${as_lineno-$LINENO}: checking for C++ compiler version" >&5
+set X $ac_compile
+ac_compiler=$2
+for ac_option in --version -v -V -qversion; do
+ { { ac_try="$ac_compiler $ac_option >&5"
+case "(($ac_try" in
+ *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
+ *) ac_try_echo=$ac_try;;
+esac
+eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
+$as_echo "$ac_try_echo"; } >&5
+ (eval "$ac_compiler $ac_option >&5") 2>conftest.err
+ ac_status=$?
+ if test -s conftest.err; then
+ sed '10a\
+... rest of stderr output deleted ...
+ 10q' conftest.err >conftest.er1
+ cat conftest.er1 >&5
+ fi
+ rm -f conftest.er1 conftest.err
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }
+done
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are using the GNU C++ compiler" >&5
+$as_echo_n "checking whether we are using the GNU C++ compiler... " >&6; }
+if ${ac_cv_cxx_compiler_gnu+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+int
+main ()
+{
+#ifndef __GNUC__
+ choke me
+#endif
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+ ac_compiler_gnu=yes
+else
+ ac_compiler_gnu=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ac_cv_cxx_compiler_gnu=$ac_compiler_gnu
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_cxx_compiler_gnu" >&5
+$as_echo "$ac_cv_cxx_compiler_gnu" >&6; }
+if test $ac_compiler_gnu = yes; then
+ GXX=yes
+else
+ GXX=
+fi
+ac_test_CXXFLAGS=${CXXFLAGS+set}
+ac_save_CXXFLAGS=$CXXFLAGS
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CXX accepts -g" >&5
+$as_echo_n "checking whether $CXX accepts -g... " >&6; }
+if ${ac_cv_prog_cxx_g+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ ac_save_cxx_werror_flag=$ac_cxx_werror_flag
+ ac_cxx_werror_flag=yes
+ ac_cv_prog_cxx_g=no
+ CXXFLAGS="-g"
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+int
+main ()
+{
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+ ac_cv_prog_cxx_g=yes
+else
+ CXXFLAGS=""
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+int
+main ()
+{
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+
+else
+ ac_cxx_werror_flag=$ac_save_cxx_werror_flag
+ CXXFLAGS="-g"
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+int
+main ()
+{
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+ ac_cv_prog_cxx_g=yes
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ ac_cxx_werror_flag=$ac_save_cxx_werror_flag
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cxx_g" >&5
+$as_echo "$ac_cv_prog_cxx_g" >&6; }
+if test "$ac_test_CXXFLAGS" = set; then
+ CXXFLAGS=$ac_save_CXXFLAGS
+elif test $ac_cv_prog_cxx_g = yes; then
+ if test "$GXX" = yes; then
+ CXXFLAGS="-g -O2"
+ else
+ CXXFLAGS="-g"
+ fi
+else
+ if test "$GXX" = yes; then
+ CXXFLAGS="-O2"
+ else
+ CXXFLAGS=
+ fi
+fi
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+depcc="$CXX" am_compiler_list=
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking dependency style of $depcc" >&5
+$as_echo_n "checking dependency style of $depcc... " >&6; }
+if ${am_cv_CXX_dependencies_compiler_type+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
+ # We make a subdir and do the tests there. Otherwise we can end up
+ # making bogus files that we don't know about and never remove. For
+ # instance it was reported that on HP-UX the gcc test will end up
+ # making a dummy file named 'D' -- because '-MD' means "put the output
+ # in D".
+ rm -rf conftest.dir
+ mkdir conftest.dir
+ # Copy depcomp to subdir because otherwise we won't find it if we're
+ # using a relative directory.
+ cp "$am_depcomp" conftest.dir
+ cd conftest.dir
+ # We will build objects and dependencies in a subdirectory because
+ # it helps to detect inapplicable dependency modes. For instance
+ # both Tru64's cc and ICC support -MD to output dependencies as a
+ # side effect of compilation, but ICC will put the dependencies in
+ # the current directory while Tru64 will put them in the object
+ # directory.
+ mkdir sub
+
+ am_cv_CXX_dependencies_compiler_type=none
+ if test "$am_compiler_list" = ""; then
+ am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
+ fi
+ am__universal=false
+ case " $depcc " in #(
+ *\ -arch\ *\ -arch\ *) am__universal=true ;;
+ esac
+
+ for depmode in $am_compiler_list; do
+ # Setup a source with many dependencies, because some compilers
+ # like to wrap large dependency lists on column 80 (with \), and
+ # we should not choose a depcomp mode which is confused by this.
+ #
+ # We need to recreate these files for each test, as the compiler may
+ # overwrite some of them when testing with obscure command lines.
+ # This happens at least with the AIX C compiler.
+ : > sub/conftest.c
+ for i in 1 2 3 4 5 6; do
+ echo '#include "conftst'$i'.h"' >> sub/conftest.c
+ # Using ": > sub/conftst$i.h" creates only sub/conftst1.h with
+ # Solaris 10 /bin/sh.
+ echo '/* dummy */' > sub/conftst$i.h
+ done
+ echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
+
+ # We check with '-c' and '-o' for the sake of the "dashmstdout"
+ # mode. It turns out that the SunPro C++ compiler does not properly
+ # handle '-M -o', and we need to detect this. Also, some Intel
+ # versions had trouble with output in subdirs.
+ am__obj=sub/conftest.${OBJEXT-o}
+ am__minus_obj="-o $am__obj"
+ case $depmode in
+ gcc)
+ # This depmode causes a compiler race in universal mode.
+ test "$am__universal" = false || continue
+ ;;
+ nosideeffect)
+ # After this tag, mechanisms are not by side-effect, so they'll
+ # only be used when explicitly requested.
+ if test "x$enable_dependency_tracking" = xyes; then
+ continue
+ else
+ break
+ fi
+ ;;
+ msvc7 | msvc7msys | msvisualcpp | msvcmsys)
+ # This compiler won't grok '-c -o', but also, the minuso test has
+ # not run yet. These depmodes are late enough in the game, and
+ # so weak that their functioning should not be impacted.
+ am__obj=conftest.${OBJEXT-o}
+ am__minus_obj=
+ ;;
+ none) break ;;
+ esac
+ if depmode=$depmode \
+ source=sub/conftest.c object=$am__obj \
+ depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
+ $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
+ >/dev/null 2>conftest.err &&
+ grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
+ grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
+ grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
+ ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
+ # icc doesn't choke on unknown options, it will just issue warnings
+ # or remarks (even with -Werror). So we grep stderr for any message
+ # that says an option was ignored or not supported.
+ # When given -MP, icc 7.0 and 7.1 complain thusly:
+ # icc: Command line warning: ignoring option '-M'; no argument required
+ # The diagnosis changed in icc 8.0:
+ # icc: Command line remark: option '-MP' not supported
+ if (grep 'ignoring option' conftest.err ||
+ grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
+ am_cv_CXX_dependencies_compiler_type=$depmode
+ break
+ fi
+ fi
+ done
+
+ cd ..
+ rm -rf conftest.dir
+else
+ am_cv_CXX_dependencies_compiler_type=none
+fi
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_CXX_dependencies_compiler_type" >&5
+$as_echo "$am_cv_CXX_dependencies_compiler_type" >&6; }
+CXXDEPMODE=depmode=$am_cv_CXX_dependencies_compiler_type
+
+ if
+ test "x$enable_dependency_tracking" != xno \
+ && test "$am_cv_CXX_dependencies_compiler_type" = gcc3; then
+ am__fastdepCXX_TRUE=
+ am__fastdepCXX_FALSE='#'
+else
+ am__fastdepCXX_TRUE='#'
+ am__fastdepCXX_FALSE=
+fi
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether ${MAKE-make} sets \$(MAKE)" >&5
+$as_echo_n "checking whether ${MAKE-make} sets \$(MAKE)... " >&6; }
+set x ${MAKE-make}
+ac_make=`$as_echo "$2" | sed 's/+/p/g; s/[^a-zA-Z0-9_]/_/g'`
+if eval \${ac_cv_prog_make_${ac_make}_set+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat >conftest.make <<\_ACEOF
+SHELL = /bin/sh
+all:
+ @echo '@@@%%%=$(MAKE)=@@@%%%'
+_ACEOF
+# GNU make sometimes prints "make[1]: Entering ...", which would confuse us.
+case `${MAKE-make} -f conftest.make 2>/dev/null` in
+ *@@@%%%=?*=@@@%%%*)
+ eval ac_cv_prog_make_${ac_make}_set=yes;;
+ *)
+ eval ac_cv_prog_make_${ac_make}_set=no;;
+esac
+rm -f conftest.make
+fi
+if eval test \$ac_cv_prog_make_${ac_make}_set = yes; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+$as_echo "yes" >&6; }
+ SET_MAKE=
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+ SET_MAKE="MAKE=${MAKE-make}"
+fi
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking how to run the C preprocessor" >&5
+$as_echo_n "checking how to run the C preprocessor... " >&6; }
+# On Suns, sometimes $CPP names a directory.
+if test -n "$CPP" && test -d "$CPP"; then
+ CPP=
+fi
+if test -z "$CPP"; then
+ if ${ac_cv_prog_CPP+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ # Double quotes because CPP needs to be expanded
+ for CPP in "$CC -E" "$CC -E -traditional-cpp" "/lib/cpp"
+ do
+ ac_preproc_ok=false
+for ac_c_preproc_warn_flag in '' yes
+do
+ # Use a header file that comes with gcc, so configuring glibc
+ # with a fresh cross-compiler works.
+ # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
+ # <limits.h> exists even on freestanding compilers.
+ # On the NeXT, cc -E runs the code through the compiler's parser,
+ # not just through cpp. "Syntax error" is here to catch this case.
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#ifdef __STDC__
+# include <limits.h>
+#else
+# include <assert.h>
+#endif
+ Syntax error
+_ACEOF
+if ac_fn_c_try_cpp "$LINENO"; then :
+
+else
+ # Broken: fails on valid input.
+continue
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
+
+ # OK, works on sane cases. Now check whether nonexistent headers
+ # can be detected and how.
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#include <ac_nonexistent.h>
+_ACEOF
+if ac_fn_c_try_cpp "$LINENO"; then :
+ # Broken: success on invalid input.
+continue
+else
+ # Passes both tests.
+ac_preproc_ok=:
+break
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
+
+done
+# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
+rm -f conftest.i conftest.err conftest.$ac_ext
+if $ac_preproc_ok; then :
+ break
+fi
+
+ done
+ ac_cv_prog_CPP=$CPP
+
+fi
+ CPP=$ac_cv_prog_CPP
+else
+ ac_cv_prog_CPP=$CPP
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $CPP" >&5
+$as_echo "$CPP" >&6; }
+ac_preproc_ok=false
+for ac_c_preproc_warn_flag in '' yes
+do
+ # Use a header file that comes with gcc, so configuring glibc
+ # with a fresh cross-compiler works.
+ # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
+ # <limits.h> exists even on freestanding compilers.
+ # On the NeXT, cc -E runs the code through the compiler's parser,
+ # not just through cpp. "Syntax error" is here to catch this case.
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#ifdef __STDC__
+# include <limits.h>
+#else
+# include <assert.h>
+#endif
+ Syntax error
+_ACEOF
+if ac_fn_c_try_cpp "$LINENO"; then :
+
+else
+ # Broken: fails on valid input.
+continue
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
+
+ # OK, works on sane cases. Now check whether nonexistent headers
+ # can be detected and how.
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#include <ac_nonexistent.h>
+_ACEOF
+if ac_fn_c_try_cpp "$LINENO"; then :
+ # Broken: success on invalid input.
+continue
+else
+ # Passes both tests.
+ac_preproc_ok=:
+break
+fi
+rm -f conftest.err conftest.i conftest.$ac_ext
+
+done
+# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
+rm -f conftest.i conftest.err conftest.$ac_ext
+if $ac_preproc_ok; then :
+
+else
+ { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
+$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
+as_fn_error $? "C preprocessor \"$CPP\" fails sanity check
+See \`config.log' for more details" "$LINENO" 5; }
+fi
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+if test -n "$ac_tool_prefix"; then
+ # Extract the first word of "${ac_tool_prefix}ranlib", so it can be a program name with args.
+set dummy ${ac_tool_prefix}ranlib; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_RANLIB+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$RANLIB"; then
+ ac_cv_prog_RANLIB="$RANLIB" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_RANLIB="${ac_tool_prefix}ranlib"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+RANLIB=$ac_cv_prog_RANLIB
+if test -n "$RANLIB"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $RANLIB" >&5
+$as_echo "$RANLIB" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+fi
+if test -z "$ac_cv_prog_RANLIB"; then
+ ac_ct_RANLIB=$RANLIB
+ # Extract the first word of "ranlib", so it can be a program name with args.
+set dummy ranlib; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_RANLIB+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$ac_ct_RANLIB"; then
+ ac_cv_prog_ac_ct_RANLIB="$ac_ct_RANLIB" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_ac_ct_RANLIB="ranlib"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_RANLIB=$ac_cv_prog_ac_ct_RANLIB
+if test -n "$ac_ct_RANLIB"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_RANLIB" >&5
+$as_echo "$ac_ct_RANLIB" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+ if test "x$ac_ct_RANLIB" = x; then
+ RANLIB=":"
+ else
+ case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+ RANLIB=$ac_ct_RANLIB
+ fi
+else
+ RANLIB="$ac_cv_prog_RANLIB"
+fi
+
+
+if test -n "$ac_tool_prefix"; then
+ for ac_prog in ar lib "link -lib"
+ do
+ # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
+set dummy $ac_tool_prefix$ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_AR+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$AR"; then
+ ac_cv_prog_AR="$AR" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_AR="$ac_tool_prefix$ac_prog"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+AR=$ac_cv_prog_AR
+if test -n "$AR"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $AR" >&5
+$as_echo "$AR" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+ test -n "$AR" && break
+ done
+fi
+if test -z "$AR"; then
+ ac_ct_AR=$AR
+ for ac_prog in ar lib "link -lib"
+do
+ # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_prog_ac_ct_AR+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -n "$ac_ct_AR"; then
+ ac_cv_prog_ac_ct_AR="$ac_ct_AR" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_prog_ac_ct_AR="$ac_prog"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+fi
+fi
+ac_ct_AR=$ac_cv_prog_ac_ct_AR
+if test -n "$ac_ct_AR"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_AR" >&5
+$as_echo "$ac_ct_AR" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+ test -n "$ac_ct_AR" && break
+done
+
+ if test "x$ac_ct_AR" = x; then
+ AR="false"
+ else
+ case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+ AR=$ac_ct_AR
+ fi
+fi
+
+: ${AR=ar}
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking the archiver ($AR) interface" >&5
+$as_echo_n "checking the archiver ($AR) interface... " >&6; }
+if ${am_cv_ar_interface+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+ am_cv_ar_interface=ar
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+int some_variable = 0;
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ am_ar_try='$AR cru libconftest.a conftest.$ac_objext >&5'
+ { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$am_ar_try\""; } >&5
+ (eval $am_ar_try) 2>&5
+ ac_status=$?
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }
+ if test "$ac_status" -eq 0; then
+ am_cv_ar_interface=ar
+ else
+ am_ar_try='$AR -NOLOGO -OUT:conftest.lib conftest.$ac_objext >&5'
+ { { eval echo "\"\$as_me\":${as_lineno-$LINENO}: \"$am_ar_try\""; } >&5
+ (eval $am_ar_try) 2>&5
+ ac_status=$?
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }
+ if test "$ac_status" -eq 0; then
+ am_cv_ar_interface=lib
+ else
+ am_cv_ar_interface=unknown
+ fi
+ fi
+ rm -f conftest.lib libconftest.a
+
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_ar_interface" >&5
+$as_echo "$am_cv_ar_interface" >&6; }
+
+case $am_cv_ar_interface in
+ar)
+ ;;
+lib)
+ # Microsoft lib, so override with the ar-lib wrapper script.
+ # FIXME: It is wrong to rewrite AR.
+ # But if we don't then we get into trouble of one sort or another.
+ # A longer-term fix would be to have automake use am__AR in this case,
+ # and then we could set am__AR="$am_aux_dir/ar-lib \$(AR)" or something
+ # similar.
+ AR="$am_aux_dir/ar-lib $AR"
+ ;;
+unknown)
+ as_fn_error $? "could not determine $AR interface" "$LINENO" 5
+ ;;
+esac
+
+
+# Make sure, also the C++ programs are compiled with OpenMP
+ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
+
+
+
+ OPENMP_CXXFLAGS=
+ # Check whether --enable-openmp was given.
+if test "${enable_openmp+set}" = set; then :
+ enableval=$enable_openmp;
+fi
+
+ if test "$enable_openmp" != no; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $CXX option to support OpenMP" >&5
+$as_echo_n "checking for $CXX option to support OpenMP... " >&6; }
+if ${ac_cv_prog_cxx_openmp+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+#ifndef _OPENMP
+ choke me
+#endif
+#include <omp.h>
+int main () { return omp_get_num_threads (); }
+
+_ACEOF
+if ac_fn_cxx_try_link "$LINENO"; then :
+ ac_cv_prog_cxx_openmp='none needed'
+else
+ ac_cv_prog_cxx_openmp='unsupported'
+ for ac_option in -fopenmp -xopenmp -openmp -mp -omp -qsmp=omp -homp \
+ -Popenmp --openmp; do
+ ac_save_CXXFLAGS=$CXXFLAGS
+ CXXFLAGS="$CXXFLAGS $ac_option"
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+#ifndef _OPENMP
+ choke me
+#endif
+#include <omp.h>
+int main () { return omp_get_num_threads (); }
+
+_ACEOF
+if ac_fn_cxx_try_link "$LINENO"; then :
+ ac_cv_prog_cxx_openmp=$ac_option
+fi
+rm -f core conftest.err conftest.$ac_objext \
+ conftest$ac_exeext conftest.$ac_ext
+ CXXFLAGS=$ac_save_CXXFLAGS
+ if test "$ac_cv_prog_cxx_openmp" != unsupported; then
+ break
+ fi
+ done
+fi
+rm -f core conftest.err conftest.$ac_objext \
+ conftest$ac_exeext conftest.$ac_ext
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cxx_openmp" >&5
+$as_echo "$ac_cv_prog_cxx_openmp" >&6; }
+ case $ac_cv_prog_cxx_openmp in #(
+ "none needed" | unsupported)
+ ;; #(
+ *)
+ OPENMP_CXXFLAGS=$ac_cv_prog_cxx_openmp ;;
+ esac
+ fi
+
+
+
+# Execute all tests using C
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for cos in -lm" >&5
+$as_echo_n "checking for cos in -lm... " >&6; }
+if ${ac_cv_lib_m_cos+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ ac_check_lib_save_LIBS=$LIBS
+LIBS="-lm $LIBS"
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+/* Override any GCC internal prototype to avoid an error.
+ Use char because int might match the return type of a GCC
+ builtin and then its argument prototype would still apply. */
+#ifdef __cplusplus
+extern "C"
+#endif
+char cos ();
+int
+main ()
+{
+return cos ();
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_link "$LINENO"; then :
+ ac_cv_lib_m_cos=yes
+else
+ ac_cv_lib_m_cos=no
+fi
+rm -f core conftest.err conftest.$ac_objext \
+ conftest$ac_exeext conftest.$ac_ext
+LIBS=$ac_check_lib_save_LIBS
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_m_cos" >&5
+$as_echo "$ac_cv_lib_m_cos" >&6; }
+if test "x$ac_cv_lib_m_cos" = xyes; then :
+ cat >>confdefs.h <<_ACEOF
+#define HAVE_LIBM 1
+_ACEOF
+
+ LIBS="-lm $LIBS"
+
+fi
+
+
+ OPENMP_CFLAGS=
+ # Check whether --enable-openmp was given.
+if test "${enable_openmp+set}" = set; then :
+ enableval=$enable_openmp;
+fi
+
+ if test "$enable_openmp" != no; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $CC option to support OpenMP" >&5
+$as_echo_n "checking for $CC option to support OpenMP... " >&6; }
+if ${ac_cv_prog_c_openmp+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+#ifndef _OPENMP
+ choke me
+#endif
+#include <omp.h>
+int main () { return omp_get_num_threads (); }
+
+_ACEOF
+if ac_fn_c_try_link "$LINENO"; then :
+ ac_cv_prog_c_openmp='none needed'
+else
+ ac_cv_prog_c_openmp='unsupported'
+ for ac_option in -fopenmp -xopenmp -openmp -mp -omp -qsmp=omp -homp \
+ -Popenmp --openmp; do
+ ac_save_CFLAGS=$CFLAGS
+ CFLAGS="$CFLAGS $ac_option"
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+#ifndef _OPENMP
+ choke me
+#endif
+#include <omp.h>
+int main () { return omp_get_num_threads (); }
+
+_ACEOF
+if ac_fn_c_try_link "$LINENO"; then :
+ ac_cv_prog_c_openmp=$ac_option
+fi
+rm -f core conftest.err conftest.$ac_objext \
+ conftest$ac_exeext conftest.$ac_ext
+ CFLAGS=$ac_save_CFLAGS
+ if test "$ac_cv_prog_c_openmp" != unsupported; then
+ break
+ fi
+ done
+fi
+rm -f core conftest.err conftest.$ac_objext \
+ conftest$ac_exeext conftest.$ac_ext
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_c_openmp" >&5
+$as_echo "$ac_cv_prog_c_openmp" >&6; }
+ case $ac_cv_prog_c_openmp in #(
+ "none needed" | unsupported)
+ ;; #(
+ *)
+ OPENMP_CFLAGS=$ac_cv_prog_c_openmp ;;
+ esac
+ fi
+
+
+
+# By default try to build with libdivsufsort.
+
+# Check whether --with-libdivsufsort was given.
+if test "${with_libdivsufsort+set}" = set; then :
+ withval=$with_libdivsufsort;
+fi
+
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for grep that handles long lines and -e" >&5
+$as_echo_n "checking for grep that handles long lines and -e... " >&6; }
+if ${ac_cv_path_GREP+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if test -z "$GREP"; then
+ ac_path_GREP_found=false
+ # Loop through the user's path and test for each of PROGNAME-LIST
+ as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_prog in grep ggrep; do
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ ac_path_GREP="$as_dir/$ac_prog$ac_exec_ext"
+ as_fn_executable_p "$ac_path_GREP" || continue
+# Check for GNU ac_path_GREP and select it if it is found.
+ # Check for GNU $ac_path_GREP
+case `"$ac_path_GREP" --version 2>&1` in
+*GNU*)
+ ac_cv_path_GREP="$ac_path_GREP" ac_path_GREP_found=:;;
+*)
+ ac_count=0
+ $as_echo_n 0123456789 >"conftest.in"
+ while :
+ do
+ cat "conftest.in" "conftest.in" >"conftest.tmp"
+ mv "conftest.tmp" "conftest.in"
+ cp "conftest.in" "conftest.nl"
+ $as_echo 'GREP' >> "conftest.nl"
+ "$ac_path_GREP" -e 'GREP$' -e '-(cannot match)-' < "conftest.nl" >"conftest.out" 2>/dev/null || break
+ diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
+ as_fn_arith $ac_count + 1 && ac_count=$as_val
+ if test $ac_count -gt ${ac_path_GREP_max-0}; then
+ # Best one so far, save it but keep looking for a better one
+ ac_cv_path_GREP="$ac_path_GREP"
+ ac_path_GREP_max=$ac_count
+ fi
+ # 10*(2^10) chars as input seems more than enough
+ test $ac_count -gt 10 && break
+ done
+ rm -f conftest.in conftest.tmp conftest.nl conftest.out;;
+esac
+
+ $ac_path_GREP_found && break 3
+ done
+ done
+ done
+IFS=$as_save_IFS
+ if test -z "$ac_cv_path_GREP"; then
+ as_fn_error $? "no acceptable grep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" "$LINENO" 5
+ fi
+else
+ ac_cv_path_GREP=$GREP
+fi
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_path_GREP" >&5
+$as_echo "$ac_cv_path_GREP" >&6; }
+ GREP="$ac_cv_path_GREP"
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for egrep" >&5
+$as_echo_n "checking for egrep... " >&6; }
+if ${ac_cv_path_EGREP+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ if echo a | $GREP -E '(a|b)' >/dev/null 2>&1
+ then ac_cv_path_EGREP="$GREP -E"
+ else
+ if test -z "$EGREP"; then
+ ac_path_EGREP_found=false
+ # Loop through the user's path and test for each of PROGNAME-LIST
+ as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_prog in egrep; do
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ ac_path_EGREP="$as_dir/$ac_prog$ac_exec_ext"
+ as_fn_executable_p "$ac_path_EGREP" || continue
+# Check for GNU ac_path_EGREP and select it if it is found.
+ # Check for GNU $ac_path_EGREP
+case `"$ac_path_EGREP" --version 2>&1` in
+*GNU*)
+ ac_cv_path_EGREP="$ac_path_EGREP" ac_path_EGREP_found=:;;
+*)
+ ac_count=0
+ $as_echo_n 0123456789 >"conftest.in"
+ while :
+ do
+ cat "conftest.in" "conftest.in" >"conftest.tmp"
+ mv "conftest.tmp" "conftest.in"
+ cp "conftest.in" "conftest.nl"
+ $as_echo 'EGREP' >> "conftest.nl"
+ "$ac_path_EGREP" 'EGREP$' < "conftest.nl" >"conftest.out" 2>/dev/null || break
+ diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
+ as_fn_arith $ac_count + 1 && ac_count=$as_val
+ if test $ac_count -gt ${ac_path_EGREP_max-0}; then
+ # Best one so far, save it but keep looking for a better one
+ ac_cv_path_EGREP="$ac_path_EGREP"
+ ac_path_EGREP_max=$ac_count
+ fi
+ # 10*(2^10) chars as input seems more than enough
+ test $ac_count -gt 10 && break
+ done
+ rm -f conftest.in conftest.tmp conftest.nl conftest.out;;
+esac
+
+ $ac_path_EGREP_found && break 3
+ done
+ done
+ done
+IFS=$as_save_IFS
+ if test -z "$ac_cv_path_EGREP"; then
+ as_fn_error $? "no acceptable egrep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" "$LINENO" 5
+ fi
+else
+ ac_cv_path_EGREP=$EGREP
+fi
+
+ fi
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_path_EGREP" >&5
+$as_echo "$ac_cv_path_EGREP" >&6; }
+ EGREP="$ac_cv_path_EGREP"
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for ANSI C header files" >&5
+$as_echo_n "checking for ANSI C header files... " >&6; }
+if ${ac_cv_header_stdc+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#include <stdlib.h>
+#include <stdarg.h>
+#include <string.h>
+#include <float.h>
+
+int
+main ()
+{
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ ac_cv_header_stdc=yes
+else
+ ac_cv_header_stdc=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+
+if test $ac_cv_header_stdc = yes; then
+ # SunOS 4.x string.h does not declare mem*, contrary to ANSI.
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#include <string.h>
+
+_ACEOF
+if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
+ $EGREP "memchr" >/dev/null 2>&1; then :
+
+else
+ ac_cv_header_stdc=no
+fi
+rm -f conftest*
+
+fi
+
+if test $ac_cv_header_stdc = yes; then
+ # ISC 2.0.2 stdlib.h does not declare free, contrary to ANSI.
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#include <stdlib.h>
+
+_ACEOF
+if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
+ $EGREP "free" >/dev/null 2>&1; then :
+
+else
+ ac_cv_header_stdc=no
+fi
+rm -f conftest*
+
+fi
+
+if test $ac_cv_header_stdc = yes; then
+ # /bin/cc in Irix-4.0.5 gets non-ANSI ctype macros unless using -ansi.
+ if test "$cross_compiling" = yes; then :
+ :
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#include <ctype.h>
+#include <stdlib.h>
+#if ((' ' & 0x0FF) == 0x020)
+# define ISLOWER(c) ('a' <= (c) && (c) <= 'z')
+# define TOUPPER(c) (ISLOWER(c) ? 'A' + ((c) - 'a') : (c))
+#else
+# define ISLOWER(c) \
+ (('a' <= (c) && (c) <= 'i') \
+ || ('j' <= (c) && (c) <= 'r') \
+ || ('s' <= (c) && (c) <= 'z'))
+# define TOUPPER(c) (ISLOWER(c) ? ((c) | 0x40) : (c))
+#endif
+
+#define XOR(e, f) (((e) && !(f)) || (!(e) && (f)))
+int
+main ()
+{
+ int i;
+ for (i = 0; i < 256; i++)
+ if (XOR (islower (i), ISLOWER (i))
+ || toupper (i) != TOUPPER (i))
+ return 2;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_run "$LINENO"; then :
+
+else
+ ac_cv_header_stdc=no
+fi
+rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
+ conftest.$ac_objext conftest.beam conftest.$ac_ext
+fi
+
+fi
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_header_stdc" >&5
+$as_echo "$ac_cv_header_stdc" >&6; }
+if test $ac_cv_header_stdc = yes; then
+
+$as_echo "#define STDC_HEADERS 1" >>confdefs.h
+
+fi
+
+# On IRIX 5.3, sys/types and inttypes.h are conflicting.
+for ac_header in sys/types.h sys/stat.h stdlib.h string.h memory.h strings.h \
+ inttypes.h stdint.h unistd.h
+do :
+ as_ac_Header=`$as_echo "ac_cv_header_$ac_header" | $as_tr_sh`
+ac_fn_c_check_header_compile "$LINENO" "$ac_header" "$as_ac_Header" "$ac_includes_default
+"
+if eval test \"x\$"$as_ac_Header"\" = x"yes"; then :
+ cat >>confdefs.h <<_ACEOF
+#define `$as_echo "HAVE_$ac_header" | $as_tr_cpp` 1
+_ACEOF
+
+fi
+
+done
+
+
+if test "x$with_libdivsufsort" != "xno"; then :
+
+ for ac_header in divsufsort.h
+do :
+ ac_fn_c_check_header_mongrel "$LINENO" "divsufsort.h" "ac_cv_header_divsufsort_h" "$ac_includes_default"
+if test "x$ac_cv_header_divsufsort_h" = xyes; then :
+ cat >>confdefs.h <<_ACEOF
+#define HAVE_DIVSUFSORT_H 1
+_ACEOF
+ have_libdivsufsort=yes
+else
+ have_libdivsufsort=no
+fi
+
+done
+
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking for divsufsort in -ldivsufsort" >&5
+$as_echo_n "checking for divsufsort in -ldivsufsort... " >&6; }
+if ${ac_cv_lib_divsufsort_divsufsort+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ ac_check_lib_save_LIBS=$LIBS
+LIBS="-ldivsufsort $LIBS"
+cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+/* Override any GCC internal prototype to avoid an error.
+ Use char because int might match the return type of a GCC
+ builtin and then its argument prototype would still apply. */
+#ifdef __cplusplus
+extern "C"
+#endif
+char divsufsort ();
+int
+main ()
+{
+return divsufsort ();
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_link "$LINENO"; then :
+ ac_cv_lib_divsufsort_divsufsort=yes
+else
+ ac_cv_lib_divsufsort_divsufsort=no
+fi
+rm -f core conftest.err conftest.$ac_objext \
+ conftest$ac_exeext conftest.$ac_ext
+LIBS=$ac_check_lib_save_LIBS
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_divsufsort_divsufsort" >&5
+$as_echo "$ac_cv_lib_divsufsort_divsufsort" >&6; }
+if test "x$ac_cv_lib_divsufsort_divsufsort" = xyes; then :
+ cat >>confdefs.h <<_ACEOF
+#define HAVE_LIBDIVSUFSORT 1
+_ACEOF
+
+ LIBS="-ldivsufsort $LIBS"
+
+else
+ have_libdivsufsort=no
+fi
+
+
+else
+
+ have_libdivsufsort=no
+ # psufsort needs C++11
+ ax_cxx_compile_cxx11_required=true
+ ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
+ ac_success=no
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CXX supports C++11 features by default" >&5
+$as_echo_n "checking whether $CXX supports C++11 features by default... " >&6; }
+if ${ax_cv_cxx_compile_cxx11+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+ template <typename T>
+ struct check
+ {
+ static_assert(sizeof(int) <= sizeof(T), "not big enough");
+ };
+
+ struct Base {
+ virtual void f() {}
+ };
+ struct Child : public Base {
+ virtual void f() override {}
+ };
+
+ typedef check<check<bool>> right_angle_brackets;
+
+ int a;
+ decltype(a) b;
+
+ typedef check<int> check_type;
+ check_type c;
+ check_type&& cr = static_cast<check_type&&>(c);
+
+ auto d = a;
+ auto l = [](){};
+
+ // http://stackoverflow.com/questions/13728184/template-aliases-and-sfinae
+ // Clang 3.1 fails with headers of libstd++ 4.8.3 when using std::function because of this
+ namespace test_template_alias_sfinae {
+ struct foo {};
+
+ template<typename T>
+ using member = typename T::member_type;
+
+ template<typename T>
+ void func(...) {}
+
+ template<typename T>
+ void func(member<T>*) {}
+
+ void test() {
+ func<foo>(0);
+ }
+ }
+
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+ ax_cv_cxx_compile_cxx11=yes
+else
+ ax_cv_cxx_compile_cxx11=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ax_cv_cxx_compile_cxx11" >&5
+$as_echo "$ax_cv_cxx_compile_cxx11" >&6; }
+ if test x$ax_cv_cxx_compile_cxx11 = xyes; then
+ ac_success=yes
+ fi
+
+ if test x$ac_success = xno; then
+ for switch in -std=gnu++11 -std=gnu++0x; do
+ cachevar=`$as_echo "ax_cv_cxx_compile_cxx11_$switch" | $as_tr_sh`
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CXX supports C++11 features with $switch" >&5
+$as_echo_n "checking whether $CXX supports C++11 features with $switch... " >&6; }
+if eval \${$cachevar+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ ac_save_CXXFLAGS="$CXXFLAGS"
+ CXXFLAGS="$CXXFLAGS $switch"
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+ template <typename T>
+ struct check
+ {
+ static_assert(sizeof(int) <= sizeof(T), "not big enough");
+ };
+
+ struct Base {
+ virtual void f() {}
+ };
+ struct Child : public Base {
+ virtual void f() override {}
+ };
+
+ typedef check<check<bool>> right_angle_brackets;
+
+ int a;
+ decltype(a) b;
+
+ typedef check<int> check_type;
+ check_type c;
+ check_type&& cr = static_cast<check_type&&>(c);
+
+ auto d = a;
+ auto l = [](){};
+
+ // http://stackoverflow.com/questions/13728184/template-aliases-and-sfinae
+ // Clang 3.1 fails with headers of libstd++ 4.8.3 when using std::function because of this
+ namespace test_template_alias_sfinae {
+ struct foo {};
+
+ template<typename T>
+ using member = typename T::member_type;
+
+ template<typename T>
+ void func(...) {}
+
+ template<typename T>
+ void func(member<T>*) {}
+
+ void test() {
+ func<foo>(0);
+ }
+ }
+
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+ eval $cachevar=yes
+else
+ eval $cachevar=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ CXXFLAGS="$ac_save_CXXFLAGS"
+fi
+eval ac_res=\$$cachevar
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+ if eval test x\$$cachevar = xyes; then
+ CXXFLAGS="$CXXFLAGS $switch"
+ ac_success=yes
+ break
+ fi
+ done
+ fi
+
+ if test x$ac_success = xno; then
+ for switch in -std=c++11 -std=c++0x; do
+ cachevar=`$as_echo "ax_cv_cxx_compile_cxx11_$switch" | $as_tr_sh`
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CXX supports C++11 features with $switch" >&5
+$as_echo_n "checking whether $CXX supports C++11 features with $switch... " >&6; }
+if eval \${$cachevar+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ ac_save_CXXFLAGS="$CXXFLAGS"
+ CXXFLAGS="$CXXFLAGS $switch"
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+ template <typename T>
+ struct check
+ {
+ static_assert(sizeof(int) <= sizeof(T), "not big enough");
+ };
+
+ struct Base {
+ virtual void f() {}
+ };
+ struct Child : public Base {
+ virtual void f() override {}
+ };
+
+ typedef check<check<bool>> right_angle_brackets;
+
+ int a;
+ decltype(a) b;
+
+ typedef check<int> check_type;
+ check_type c;
+ check_type&& cr = static_cast<check_type&&>(c);
+
+ auto d = a;
+ auto l = [](){};
+
+ // http://stackoverflow.com/questions/13728184/template-aliases-and-sfinae
+ // Clang 3.1 fails with headers of libstd++ 4.8.3 when using std::function because of this
+ namespace test_template_alias_sfinae {
+ struct foo {};
+
+ template<typename T>
+ using member = typename T::member_type;
+
+ template<typename T>
+ void func(...) {}
+
+ template<typename T>
+ void func(member<T>*) {}
+
+ void test() {
+ func<foo>(0);
+ }
+ }
+
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+ eval $cachevar=yes
+else
+ eval $cachevar=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ CXXFLAGS="$ac_save_CXXFLAGS"
+fi
+eval ac_res=\$$cachevar
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+ if eval test x\$$cachevar = xyes; then
+ CXXFLAGS="$CXXFLAGS $switch"
+ ac_success=yes
+ break
+ fi
+ done
+ fi
+ ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+ if test x$ax_cxx_compile_cxx11_required = xtrue; then
+ if test x$ac_success = xno; then
+ as_fn_error $? "*** A compiler with support for C++11 language features is required." "$LINENO" 5
+ fi
+ else
+ if test x$ac_success = xno; then
+ HAVE_CXX11=0
+ { $as_echo "$as_me:${as_lineno-$LINENO}: No compiler with C++11 support was found" >&5
+$as_echo "$as_me: No compiler with C++11 support was found" >&6;}
+ else
+ HAVE_CXX11=1
+
+$as_echo "#define HAVE_CXX11 1" >>confdefs.h
+
+ fi
+
+
+ fi
+
+
+
+fi
+
+if test "x$have_libdivsufsort" = "xno"; then :
+ if test "x$with_libdivsufsort" != "xno"; then :
+ as_fn_error $? "Configuration for libdivsufsort failed. Either install libdivsufsort, or use our replacement, psufsort, instead.
+ ./configure --without-libdivsufsort
+The latter may result in longer runtimes." "$LINENO" 5
+
+fi
+
+fi
+
+ if test "x${with_libdivsufsort}" != "xno"; then
+ BUILD_WITH_LIBDIVSUFSORT_TRUE=
+ BUILD_WITH_LIBDIVSUFSORT_FALSE='#'
+else
+ BUILD_WITH_LIBDIVSUFSORT_TRUE='#'
+ BUILD_WITH_LIBDIVSUFSORT_FALSE=
+fi
+
+
+# The unit tests require GLIB2. So by default do not build the test.
+# If enabled, check for glib.
+
+# Check whether --enable-unit-tests was given.
+if test "${enable_unit_tests+set}" = set; then :
+ enableval=$enable_unit_tests; try_unit_tests=${enableval}
+else
+ try_unit_tests=no
+
+fi
+
+
+ if test "x${try_unit_tests}" = xyes; then
+ BUILD_TESTS_TRUE=
+ BUILD_TESTS_FALSE='#'
+else
+ BUILD_TESTS_TRUE='#'
+ BUILD_TESTS_FALSE=
+fi
+
+
+if test "x${try_unit_tests}" = xyes; then
+
+ have_glib=yes
+
+
+
+
+
+
+
+if test "x$ac_cv_env_PKG_CONFIG_set" != "xset"; then
+ if test -n "$ac_tool_prefix"; then
+ # Extract the first word of "${ac_tool_prefix}pkg-config", so it can be a program name with args.
+set dummy ${ac_tool_prefix}pkg-config; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_path_PKG_CONFIG+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ case $PKG_CONFIG in
+ [\\/]* | ?:[\\/]*)
+ ac_cv_path_PKG_CONFIG="$PKG_CONFIG" # Let the user override the test with a path.
+ ;;
+ *)
+ as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_path_PKG_CONFIG="$as_dir/$ac_word$ac_exec_ext"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+ ;;
+esac
+fi
+PKG_CONFIG=$ac_cv_path_PKG_CONFIG
+if test -n "$PKG_CONFIG"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $PKG_CONFIG" >&5
+$as_echo "$PKG_CONFIG" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+
+fi
+if test -z "$ac_cv_path_PKG_CONFIG"; then
+ ac_pt_PKG_CONFIG=$PKG_CONFIG
+ # Extract the first word of "pkg-config", so it can be a program name with args.
+set dummy pkg-config; ac_word=$2
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
+$as_echo_n "checking for $ac_word... " >&6; }
+if ${ac_cv_path_ac_pt_PKG_CONFIG+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ case $ac_pt_PKG_CONFIG in
+ [\\/]* | ?:[\\/]*)
+ ac_cv_path_ac_pt_PKG_CONFIG="$ac_pt_PKG_CONFIG" # Let the user override the test with a path.
+ ;;
+ *)
+ as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ for ac_exec_ext in '' $ac_executable_extensions; do
+ if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+ ac_cv_path_ac_pt_PKG_CONFIG="$as_dir/$ac_word$ac_exec_ext"
+ $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
+ break 2
+ fi
+done
+ done
+IFS=$as_save_IFS
+
+ ;;
+esac
+fi
+ac_pt_PKG_CONFIG=$ac_cv_path_ac_pt_PKG_CONFIG
+if test -n "$ac_pt_PKG_CONFIG"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_pt_PKG_CONFIG" >&5
+$as_echo "$ac_pt_PKG_CONFIG" >&6; }
+else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+fi
+
+ if test "x$ac_pt_PKG_CONFIG" = x; then
+ PKG_CONFIG=""
+ else
+ case $cross_compiling:$ac_tool_warned in
+yes:)
+{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
+$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
+ac_tool_warned=yes ;;
+esac
+ PKG_CONFIG=$ac_pt_PKG_CONFIG
+ fi
+else
+ PKG_CONFIG="$ac_cv_path_PKG_CONFIG"
+fi
+
+fi
+if test -n "$PKG_CONFIG"; then
+ _pkg_min_version=0.9.0
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking pkg-config is at least version $_pkg_min_version" >&5
+$as_echo_n "checking pkg-config is at least version $_pkg_min_version... " >&6; }
+ if $PKG_CONFIG --atleast-pkgconfig-version $_pkg_min_version; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+$as_echo "yes" >&6; }
+ else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+ PKG_CONFIG=""
+ fi
+fi
+
+pkg_failed=no
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for GLIB" >&5
+$as_echo_n "checking for GLIB... " >&6; }
+
+if test -n "$GLIB_CFLAGS"; then
+ pkg_cv_GLIB_CFLAGS="$GLIB_CFLAGS"
+ elif test -n "$PKG_CONFIG"; then
+ if test -n "$PKG_CONFIG" && \
+ { { $as_echo "$as_me:${as_lineno-$LINENO}: \$PKG_CONFIG --exists --print-errors \"glib-2.0\""; } >&5
+ ($PKG_CONFIG --exists --print-errors "glib-2.0") 2>&5
+ ac_status=$?
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }; then
+ pkg_cv_GLIB_CFLAGS=`$PKG_CONFIG --cflags "glib-2.0" 2>/dev/null`
+ test "x$?" != "x0" && pkg_failed=yes
+else
+ pkg_failed=yes
+fi
+ else
+ pkg_failed=untried
+fi
+if test -n "$GLIB_LIBS"; then
+ pkg_cv_GLIB_LIBS="$GLIB_LIBS"
+ elif test -n "$PKG_CONFIG"; then
+ if test -n "$PKG_CONFIG" && \
+ { { $as_echo "$as_me:${as_lineno-$LINENO}: \$PKG_CONFIG --exists --print-errors \"glib-2.0\""; } >&5
+ ($PKG_CONFIG --exists --print-errors "glib-2.0") 2>&5
+ ac_status=$?
+ $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
+ test $ac_status = 0; }; then
+ pkg_cv_GLIB_LIBS=`$PKG_CONFIG --libs "glib-2.0" 2>/dev/null`
+ test "x$?" != "x0" && pkg_failed=yes
+else
+ pkg_failed=yes
+fi
+ else
+ pkg_failed=untried
+fi
+
+
+
+if test $pkg_failed = yes; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+
+if $PKG_CONFIG --atleast-pkgconfig-version 0.20; then
+ _pkg_short_errors_supported=yes
+else
+ _pkg_short_errors_supported=no
+fi
+ if test $_pkg_short_errors_supported = yes; then
+ GLIB_PKG_ERRORS=`$PKG_CONFIG --short-errors --print-errors --cflags --libs "glib-2.0" 2>&1`
+ else
+ GLIB_PKG_ERRORS=`$PKG_CONFIG --print-errors --cflags --libs "glib-2.0" 2>&1`
+ fi
+ # Put the nasty error message in config.log where it belongs
+ echo "$GLIB_PKG_ERRORS" >&5
+
+ have_glib=no
+elif test $pkg_failed = untried; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
+$as_echo "no" >&6; }
+ have_glib=no
+else
+ GLIB_CFLAGS=$pkg_cv_GLIB_CFLAGS
+ GLIB_LIBS=$pkg_cv_GLIB_LIBS
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
+$as_echo "yes" >&6; }
+
+fi
+
+ if test "x${have_glib}" = xno; then
+ as_fn_error $? "Missing Glib 2. Either install it or build without unit tests." "$LINENO" 5
+ fi
+
+ ax_cxx_compile_cxx11_required=true
+ ac_ext=cpp
+ac_cpp='$CXXCPP $CPPFLAGS'
+ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
+ ac_success=no
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CXX supports C++11 features by default" >&5
+$as_echo_n "checking whether $CXX supports C++11 features by default... " >&6; }
+if ${ax_cv_cxx_compile_cxx11+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+ template <typename T>
+ struct check
+ {
+ static_assert(sizeof(int) <= sizeof(T), "not big enough");
+ };
+
+ struct Base {
+ virtual void f() {}
+ };
+ struct Child : public Base {
+ virtual void f() override {}
+ };
+
+ typedef check<check<bool>> right_angle_brackets;
+
+ int a;
+ decltype(a) b;
+
+ typedef check<int> check_type;
+ check_type c;
+ check_type&& cr = static_cast<check_type&&>(c);
+
+ auto d = a;
+ auto l = [](){};
+
+ // http://stackoverflow.com/questions/13728184/template-aliases-and-sfinae
+ // Clang 3.1 fails with headers of libstd++ 4.8.3 when using std::function because of this
+ namespace test_template_alias_sfinae {
+ struct foo {};
+
+ template<typename T>
+ using member = typename T::member_type;
+
+ template<typename T>
+ void func(...) {}
+
+ template<typename T>
+ void func(member<T>*) {}
+
+ void test() {
+ func<foo>(0);
+ }
+ }
+
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+ ax_cv_cxx_compile_cxx11=yes
+else
+ ax_cv_cxx_compile_cxx11=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ax_cv_cxx_compile_cxx11" >&5
+$as_echo "$ax_cv_cxx_compile_cxx11" >&6; }
+ if test x$ax_cv_cxx_compile_cxx11 = xyes; then
+ ac_success=yes
+ fi
+
+ if test x$ac_success = xno; then
+ for switch in -std=gnu++11 -std=gnu++0x; do
+ cachevar=`$as_echo "ax_cv_cxx_compile_cxx11_$switch" | $as_tr_sh`
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CXX supports C++11 features with $switch" >&5
+$as_echo_n "checking whether $CXX supports C++11 features with $switch... " >&6; }
+if eval \${$cachevar+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ ac_save_CXXFLAGS="$CXXFLAGS"
+ CXXFLAGS="$CXXFLAGS $switch"
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+ template <typename T>
+ struct check
+ {
+ static_assert(sizeof(int) <= sizeof(T), "not big enough");
+ };
+
+ struct Base {
+ virtual void f() {}
+ };
+ struct Child : public Base {
+ virtual void f() override {}
+ };
+
+ typedef check<check<bool>> right_angle_brackets;
+
+ int a;
+ decltype(a) b;
+
+ typedef check<int> check_type;
+ check_type c;
+ check_type&& cr = static_cast<check_type&&>(c);
+
+ auto d = a;
+ auto l = [](){};
+
+ // http://stackoverflow.com/questions/13728184/template-aliases-and-sfinae
+ // Clang 3.1 fails with headers of libstd++ 4.8.3 when using std::function because of this
+ namespace test_template_alias_sfinae {
+ struct foo {};
+
+ template<typename T>
+ using member = typename T::member_type;
+
+ template<typename T>
+ void func(...) {}
+
+ template<typename T>
+ void func(member<T>*) {}
+
+ void test() {
+ func<foo>(0);
+ }
+ }
+
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+ eval $cachevar=yes
+else
+ eval $cachevar=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ CXXFLAGS="$ac_save_CXXFLAGS"
+fi
+eval ac_res=\$$cachevar
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+ if eval test x\$$cachevar = xyes; then
+ CXXFLAGS="$CXXFLAGS $switch"
+ ac_success=yes
+ break
+ fi
+ done
+ fi
+
+ if test x$ac_success = xno; then
+ for switch in -std=c++11 -std=c++0x; do
+ cachevar=`$as_echo "ax_cv_cxx_compile_cxx11_$switch" | $as_tr_sh`
+ { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CXX supports C++11 features with $switch" >&5
+$as_echo_n "checking whether $CXX supports C++11 features with $switch... " >&6; }
+if eval \${$cachevar+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ ac_save_CXXFLAGS="$CXXFLAGS"
+ CXXFLAGS="$CXXFLAGS $switch"
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+ template <typename T>
+ struct check
+ {
+ static_assert(sizeof(int) <= sizeof(T), "not big enough");
+ };
+
+ struct Base {
+ virtual void f() {}
+ };
+ struct Child : public Base {
+ virtual void f() override {}
+ };
+
+ typedef check<check<bool>> right_angle_brackets;
+
+ int a;
+ decltype(a) b;
+
+ typedef check<int> check_type;
+ check_type c;
+ check_type&& cr = static_cast<check_type&&>(c);
+
+ auto d = a;
+ auto l = [](){};
+
+ // http://stackoverflow.com/questions/13728184/template-aliases-and-sfinae
+ // Clang 3.1 fails with headers of libstd++ 4.8.3 when using std::function because of this
+ namespace test_template_alias_sfinae {
+ struct foo {};
+
+ template<typename T>
+ using member = typename T::member_type;
+
+ template<typename T>
+ void func(...) {}
+
+ template<typename T>
+ void func(member<T>*) {}
+
+ void test() {
+ func<foo>(0);
+ }
+ }
+
+_ACEOF
+if ac_fn_cxx_try_compile "$LINENO"; then :
+ eval $cachevar=yes
+else
+ eval $cachevar=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ CXXFLAGS="$ac_save_CXXFLAGS"
+fi
+eval ac_res=\$$cachevar
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
+$as_echo "$ac_res" >&6; }
+ if eval test x\$$cachevar = xyes; then
+ CXXFLAGS="$CXXFLAGS $switch"
+ ac_success=yes
+ break
+ fi
+ done
+ fi
+ ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+ if test x$ax_cxx_compile_cxx11_required = xtrue; then
+ if test x$ac_success = xno; then
+ as_fn_error $? "*** A compiler with support for C++11 language features is required." "$LINENO" 5
+ fi
+ else
+ if test x$ac_success = xno; then
+ HAVE_CXX11=0
+ { $as_echo "$as_me:${as_lineno-$LINENO}: No compiler with C++11 support was found" >&5
+$as_echo "$as_me: No compiler with C++11 support was found" >&6;}
+ else
+ HAVE_CXX11=1
+
+$as_echo "#define HAVE_CXX11 1" >>confdefs.h
+
+ fi
+
+
+ fi
+
+fi
+
+# Check for various headers including those used by libdivsufsort.
+for ac_header in limits.h stdlib.h string.h unistd.h stdint.h inttypes.h err.h errno.h fcntl.h
+do :
+ as_ac_Header=`$as_echo "ac_cv_header_$ac_header" | $as_tr_sh`
+ac_fn_c_check_header_mongrel "$LINENO" "$ac_header" "$as_ac_Header" "$ac_includes_default"
+if eval test \"x\$"$as_ac_Header"\" = x"yes"; then :
+ cat >>confdefs.h <<_ACEOF
+#define `$as_echo "HAVE_$ac_header" | $as_tr_cpp` 1
+_ACEOF
+
+fi
+
+done
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for inline" >&5
+$as_echo_n "checking for inline... " >&6; }
+if ${ac_cv_c_inline+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ ac_cv_c_inline=no
+for ac_kw in inline __inline__ __inline; do
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+#ifndef __cplusplus
+typedef int foo_t;
+static $ac_kw foo_t static_foo () {return 0; }
+$ac_kw foo_t foo () {return 0; }
+#endif
+
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ ac_cv_c_inline=$ac_kw
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+ test "$ac_cv_c_inline" != no && break
+done
+
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_c_inline" >&5
+$as_echo "$ac_cv_c_inline" >&6; }
+
+case $ac_cv_c_inline in
+ inline | yes) ;;
+ *)
+ case $ac_cv_c_inline in
+ no) ac_val=;;
+ *) ac_val=$ac_cv_c_inline;;
+ esac
+ cat >>confdefs.h <<_ACEOF
+#ifndef __cplusplus
+#define inline $ac_val
+#endif
+_ACEOF
+ ;;
+esac
+
+ac_fn_c_check_type "$LINENO" "size_t" "ac_cv_type_size_t" "$ac_includes_default"
+if test "x$ac_cv_type_size_t" = xyes; then :
+
+else
+
+cat >>confdefs.h <<_ACEOF
+#define size_t unsigned int
+_ACEOF
+
+fi
+
+ac_fn_c_check_type "$LINENO" "ssize_t" "ac_cv_type_ssize_t" "$ac_includes_default"
+if test "x$ac_cv_type_ssize_t" = xyes; then :
+
+else
+
+cat >>confdefs.h <<_ACEOF
+#define ssize_t int
+_ACEOF
+
+fi
+
+ac_fn_c_find_intX_t "$LINENO" "32" "ac_cv_c_int32_t"
+case $ac_cv_c_int32_t in #(
+ no|yes) ;; #(
+ *)
+
+cat >>confdefs.h <<_ACEOF
+#define int32_t $ac_cv_c_int32_t
+_ACEOF
+;;
+esac
+
+ac_fn_c_find_uintX_t "$LINENO" "8" "ac_cv_c_uint8_t"
+case $ac_cv_c_uint8_t in #(
+ no|yes) ;; #(
+ *)
+
+$as_echo "#define _UINT8_T 1" >>confdefs.h
+
+
+cat >>confdefs.h <<_ACEOF
+#define uint8_t $ac_cv_c_uint8_t
+_ACEOF
+;;
+ esac
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for stdbool.h that conforms to C99" >&5
+$as_echo_n "checking for stdbool.h that conforms to C99... " >&6; }
+if ${ac_cv_header_stdbool_h+:} false; then :
+ $as_echo_n "(cached) " >&6
+else
+ cat confdefs.h - <<_ACEOF >conftest.$ac_ext
+/* end confdefs.h. */
+
+ #include <stdbool.h>
+ #ifndef bool
+ "error: bool is not defined"
+ #endif
+ #ifndef false
+ "error: false is not defined"
+ #endif
+ #if false
+ "error: false is not 0"
+ #endif
+ #ifndef true
+ "error: true is not defined"
+ #endif
+ #if true != 1
+ "error: true is not 1"
+ #endif
+ #ifndef __bool_true_false_are_defined
+ "error: __bool_true_false_are_defined is not defined"
+ #endif
+
+ struct s { _Bool s: 1; _Bool t; } s;
+
+ char a[true == 1 ? 1 : -1];
+ char b[false == 0 ? 1 : -1];
+ char c[__bool_true_false_are_defined == 1 ? 1 : -1];
+ char d[(bool) 0.5 == true ? 1 : -1];
+ /* See body of main program for 'e'. */
+ char f[(_Bool) 0.0 == false ? 1 : -1];
+ char g[true];
+ char h[sizeof (_Bool)];
+ char i[sizeof s.t];
+ enum { j = false, k = true, l = false * true, m = true * 256 };
+ /* The following fails for
+ HP aC++/ANSI C B3910B A.05.55 [Dec 04 2003]. */
+ _Bool n[m];
+ char o[sizeof n == m * sizeof n[0] ? 1 : -1];
+ char p[-1 - (_Bool) 0 < 0 && -1 - (bool) 0 < 0 ? 1 : -1];
+ /* Catch a bug in an HP-UX C compiler. See
+ http://gcc.gnu.org/ml/gcc-patches/2003-12/msg02303.html
+ http://lists.gnu.org/archive/html/bug-coreutils/2005-11/msg00161.html
+ */
+ _Bool q = true;
+ _Bool *pq = &q;
+
+int
+main ()
+{
+
+ bool e = &s;
+ *pq |= q;
+ *pq |= ! q;
+ /* Refer to every declared value, to avoid compiler optimizations. */
+ return (!a + !b + !c + !d + !e + !f + !g + !h + !i + !!j + !k + !!l
+ + !m + !n + !o + !p + !q + !pq);
+
+ ;
+ return 0;
+}
+_ACEOF
+if ac_fn_c_try_compile "$LINENO"; then :
+ ac_cv_header_stdbool_h=yes
+else
+ ac_cv_header_stdbool_h=no
+fi
+rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
+fi
+{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_header_stdbool_h" >&5
+$as_echo "$ac_cv_header_stdbool_h" >&6; }
+ ac_fn_c_check_type "$LINENO" "_Bool" "ac_cv_type__Bool" "$ac_includes_default"
+if test "x$ac_cv_type__Bool" = xyes; then :
+
+cat >>confdefs.h <<_ACEOF
+#define HAVE__BOOL 1
+_ACEOF
+
+
+fi
+
+
+if test $ac_cv_header_stdbool_h = yes; then
+
+$as_echo "#define HAVE_STDBOOL_H 1" >>confdefs.h
+
+fi
+
+
+# Until someone convinces me otherwise, I will deactivate the macros
+# AC_FUNC_MALLOC and AC_FUNC_REALLOC. They only check if `malloc(0)` retuns a
+# non-null pointer. This breaks the build on systems using uClibc, including
+# my laptop.
+# As requesting zero bytes is not useful, and implementation-defined behaviour,
+# I should be avoided in the first place. Thus I really don't need these checks.
+
+for ac_func in floor pow sqrt strdup strerror
+do :
+ as_ac_var=`$as_echo "ac_cv_func_$ac_func" | $as_tr_sh`
+ac_fn_c_check_func "$LINENO" "$ac_func" "$as_ac_var"
+if eval test \"x\$"$as_ac_var"\" = x"yes"; then :
+ cat >>confdefs.h <<_ACEOF
+#define `$as_echo "HAVE_$ac_func" | $as_tr_cpp` 1
+_ACEOF
+
+fi
+done
+
+for ac_func in strndup
+do :
+ ac_fn_c_check_func "$LINENO" "strndup" "ac_cv_func_strndup"
+if test "x$ac_cv_func_strndup" = xyes; then :
+ cat >>confdefs.h <<_ACEOF
+#define HAVE_STRNDUP 1
+_ACEOF
+
+fi
+done
+
+for ac_func in strchr strrchr strchrnul
+do :
+ as_ac_var=`$as_echo "ac_cv_func_$ac_func" | $as_tr_sh`
+ac_fn_c_check_func "$LINENO" "$ac_func" "$as_ac_var"
+if eval test \"x\$"$as_ac_var"\" = x"yes"; then :
+ cat >>confdefs.h <<_ACEOF
+#define `$as_echo "HAVE_$ac_func" | $as_tr_cpp` 1
+_ACEOF
+
+fi
+done
+
+for ac_func in strtoul strtod
+do :
+ as_ac_var=`$as_echo "ac_cv_func_$ac_func" | $as_tr_sh`
+ac_fn_c_check_func "$LINENO" "$ac_func" "$as_ac_var"
+if eval test \"x\$"$as_ac_var"\" = x"yes"; then :
+ cat >>confdefs.h <<_ACEOF
+#define `$as_echo "HAVE_$ac_func" | $as_tr_cpp` 1
+_ACEOF
+
+fi
+done
+
+for ac_func in reallocarray
+do :
+ ac_fn_c_check_func "$LINENO" "reallocarray" "ac_cv_func_reallocarray"
+if test "x$ac_cv_func_reallocarray" = xyes; then :
+ cat >>confdefs.h <<_ACEOF
+#define HAVE_REALLOCARRAY 1
+_ACEOF
+
+fi
+done
+
+
+ if test "x$ac_cv_func_reallocarray" = xyes; then
+ HAVE_REALLOCARRAY_TRUE=
+ HAVE_REALLOCARRAY_FALSE='#'
+else
+ HAVE_REALLOCARRAY_TRUE='#'
+ HAVE_REALLOCARRAY_FALSE=
+fi
+
+ if test "x$ac_cv_func_strchrnul" = xyes; then
+ HAVE_STRCHRNUL_TRUE=
+ HAVE_STRCHRNUL_FALSE='#'
+else
+ HAVE_STRCHRNUL_TRUE='#'
+ HAVE_STRCHRNUL_FALSE=
+fi
+
+
+ac_config_headers="$ac_config_headers src/config.h:src/config.hin"
+
+
+ac_config_files="$ac_config_files Makefile docs/andi.1 docs/Makefile libs/Makefile opt/Makefile opt/psufsort/Makefile src/Makefile test/Makefile"
+
+cat >confcache <<\_ACEOF
+# This file is a shell script that caches the results of configure
+# tests run on this system so they can be shared between configure
+# scripts and configure runs, see configure's option --config-cache.
+# It is not useful on other systems. If it contains results you don't
+# want to keep, you may remove or edit it.
+#
+# config.status only pays attention to the cache file if you give it
+# the --recheck option to rerun configure.
+#
+# `ac_cv_env_foo' variables (set or unset) will be overridden when
+# loading this file, other *unset* `ac_cv_foo' will be assigned the
+# following values.
+
+_ACEOF
+
+# The following way of writing the cache mishandles newlines in values,
+# but we know of no workaround that is simple, portable, and efficient.
+# So, we kill variables containing newlines.
+# Ultrix sh set writes to stderr and can't be redirected directly,
+# and sets the high bit in the cache file unless we assign to the vars.
+(
+ for ac_var in `(set) 2>&1 | sed -n 's/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'`; do
+ eval ac_val=\$$ac_var
+ case $ac_val in #(
+ *${as_nl}*)
+ case $ac_var in #(
+ *_cv_*) { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5
+$as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
+ esac
+ case $ac_var in #(
+ _ | IFS | as_nl) ;; #(
+ BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #(
+ *) { eval $ac_var=; unset $ac_var;} ;;
+ esac ;;
+ esac
+ done
+
+ (set) 2>&1 |
+ case $as_nl`(ac_space=' '; set) 2>&1` in #(
+ *${as_nl}ac_space=\ *)
+ # `set' does not quote correctly, so add quotes: double-quote
+ # substitution turns \\\\ into \\, and sed turns \\ into \.
+ sed -n \
+ "s/'/'\\\\''/g;
+ s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\\2'/p"
+ ;; #(
+ *)
+ # `set' quotes correctly as required by POSIX, so do not add quotes.
+ sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p"
+ ;;
+ esac |
+ sort
+) |
+ sed '
+ /^ac_cv_env_/b end
+ t clear
+ :clear
+ s/^\([^=]*\)=\(.*[{}].*\)$/test "${\1+set}" = set || &/
+ t end
+ s/^\([^=]*\)=\(.*\)$/\1=${\1=\2}/
+ :end' >>confcache
+if diff "$cache_file" confcache >/dev/null 2>&1; then :; else
+ if test -w "$cache_file"; then
+ if test "x$cache_file" != "x/dev/null"; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: updating cache $cache_file" >&5
+$as_echo "$as_me: updating cache $cache_file" >&6;}
+ if test ! -f "$cache_file" || test -h "$cache_file"; then
+ cat confcache >"$cache_file"
+ else
+ case $cache_file in #(
+ */* | ?:*)
+ mv -f confcache "$cache_file"$$ &&
+ mv -f "$cache_file"$$ "$cache_file" ;; #(
+ *)
+ mv -f confcache "$cache_file" ;;
+ esac
+ fi
+ fi
+ else
+ { $as_echo "$as_me:${as_lineno-$LINENO}: not updating unwritable cache $cache_file" >&5
+$as_echo "$as_me: not updating unwritable cache $cache_file" >&6;}
+ fi
+fi
+rm -f confcache
+
+test "x$prefix" = xNONE && prefix=$ac_default_prefix
+# Let make expand exec_prefix.
+test "x$exec_prefix" = xNONE && exec_prefix='${prefix}'
+
+DEFS=-DHAVE_CONFIG_H
+
+ac_libobjs=
+ac_ltlibobjs=
+U=
+for ac_i in : $LIBOBJS; do test "x$ac_i" = x: && continue
+ # 1. Remove the extension, and $U if already installed.
+ ac_script='s/\$U\././;s/\.o$//;s/\.obj$//'
+ ac_i=`$as_echo "$ac_i" | sed "$ac_script"`
+ # 2. Prepend LIBOBJDIR. When used with automake>=1.10 LIBOBJDIR
+ # will be set to the directory where LIBOBJS objects are built.
+ as_fn_append ac_libobjs " \${LIBOBJDIR}$ac_i\$U.$ac_objext"
+ as_fn_append ac_ltlibobjs " \${LIBOBJDIR}$ac_i"'$U.lo'
+done
+LIBOBJS=$ac_libobjs
+
+LTLIBOBJS=$ac_ltlibobjs
+
+
+{ $as_echo "$as_me:${as_lineno-$LINENO}: checking that generated files are newer than configure" >&5
+$as_echo_n "checking that generated files are newer than configure... " >&6; }
+ if test -n "$am_sleep_pid"; then
+ # Hide warnings about reused PIDs.
+ wait $am_sleep_pid 2>/dev/null
+ fi
+ { $as_echo "$as_me:${as_lineno-$LINENO}: result: done" >&5
+$as_echo "done" >&6; }
+ if test -n "$EXEEXT"; then
+ am__EXEEXT_TRUE=
+ am__EXEEXT_FALSE='#'
+else
+ am__EXEEXT_TRUE='#'
+ am__EXEEXT_FALSE=
+fi
+
+if test -z "${AMDEP_TRUE}" && test -z "${AMDEP_FALSE}"; then
+ as_fn_error $? "conditional \"AMDEP\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
+fi
+if test -z "${am__fastdepCC_TRUE}" && test -z "${am__fastdepCC_FALSE}"; then
+ as_fn_error $? "conditional \"am__fastdepCC\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
+fi
+if test -z "${am__fastdepCXX_TRUE}" && test -z "${am__fastdepCXX_FALSE}"; then
+ as_fn_error $? "conditional \"am__fastdepCXX\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
+fi
+if test -z "${BUILD_WITH_LIBDIVSUFSORT_TRUE}" && test -z "${BUILD_WITH_LIBDIVSUFSORT_FALSE}"; then
+ as_fn_error $? "conditional \"BUILD_WITH_LIBDIVSUFSORT\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
+fi
+if test -z "${BUILD_TESTS_TRUE}" && test -z "${BUILD_TESTS_FALSE}"; then
+ as_fn_error $? "conditional \"BUILD_TESTS\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
+fi
+if test -z "${HAVE_REALLOCARRAY_TRUE}" && test -z "${HAVE_REALLOCARRAY_FALSE}"; then
+ as_fn_error $? "conditional \"HAVE_REALLOCARRAY\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
+fi
+if test -z "${HAVE_STRCHRNUL_TRUE}" && test -z "${HAVE_STRCHRNUL_FALSE}"; then
+ as_fn_error $? "conditional \"HAVE_STRCHRNUL\" was never defined.
+Usually this means the macro was only invoked conditionally." "$LINENO" 5
+fi
+
+: "${CONFIG_STATUS=./config.status}"
+ac_write_fail=0
+ac_clean_files_save=$ac_clean_files
+ac_clean_files="$ac_clean_files $CONFIG_STATUS"
+{ $as_echo "$as_me:${as_lineno-$LINENO}: creating $CONFIG_STATUS" >&5
+$as_echo "$as_me: creating $CONFIG_STATUS" >&6;}
+as_write_fail=0
+cat >$CONFIG_STATUS <<_ASEOF || as_write_fail=1
+#! $SHELL
+# Generated by $as_me.
+# Run this file to recreate the current configuration.
+# Compiler output produced by configure, useful for debugging
+# configure, is in config.log if it exists.
+
+debug=false
+ac_cs_recheck=false
+ac_cs_silent=false
+
+SHELL=\${CONFIG_SHELL-$SHELL}
+export SHELL
+_ASEOF
+cat >>$CONFIG_STATUS <<\_ASEOF || as_write_fail=1
+## -------------------- ##
+## M4sh Initialization. ##
+## -------------------- ##
+
+# Be more Bourne compatible
+DUALCASE=1; export DUALCASE # for MKS sh
+if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then :
+ emulate sh
+ NULLCMD=:
+ # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
+ # is contrary to our usage. Disable this feature.
+ alias -g '${1+"$@"}'='"$@"'
+ setopt NO_GLOB_SUBST
+else
+ case `(set -o) 2>/dev/null` in #(
+ *posix*) :
+ set -o posix ;; #(
+ *) :
+ ;;
+esac
+fi
+
+
+as_nl='
+'
+export as_nl
+# Printing a long string crashes Solaris 7 /usr/bin/printf.
+as_echo='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
+as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo
+as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo$as_echo
+# Prefer a ksh shell builtin over an external printf program on Solaris,
+# but without wasting forks for bash or zsh.
+if test -z "$BASH_VERSION$ZSH_VERSION" \
+ && (test "X`print -r -- $as_echo`" = "X$as_echo") 2>/dev/null; then
+ as_echo='print -r --'
+ as_echo_n='print -rn --'
+elif (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then
+ as_echo='printf %s\n'
+ as_echo_n='printf %s'
+else
+ if test "X`(/usr/ucb/echo -n -n $as_echo) 2>/dev/null`" = "X-n $as_echo"; then
+ as_echo_body='eval /usr/ucb/echo -n "$1$as_nl"'
+ as_echo_n='/usr/ucb/echo -n'
+ else
+ as_echo_body='eval expr "X$1" : "X\\(.*\\)"'
+ as_echo_n_body='eval
+ arg=$1;
+ case $arg in #(
+ *"$as_nl"*)
+ expr "X$arg" : "X\\(.*\\)$as_nl";
+ arg=`expr "X$arg" : ".*$as_nl\\(.*\\)"`;;
+ esac;
+ expr "X$arg" : "X\\(.*\\)" | tr -d "$as_nl"
+ '
+ export as_echo_n_body
+ as_echo_n='sh -c $as_echo_n_body as_echo'
+ fi
+ export as_echo_body
+ as_echo='sh -c $as_echo_body as_echo'
+fi
+
+# The user is always right.
+if test "${PATH_SEPARATOR+set}" != set; then
+ PATH_SEPARATOR=:
+ (PATH='/bin;/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 && {
+ (PATH='/bin:/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 ||
+ PATH_SEPARATOR=';'
+ }
+fi
+
+
+# IFS
+# We need space, tab and new line, in precisely that order. Quoting is
+# there to prevent editors from complaining about space-tab.
+# (If _AS_PATH_WALK were called with IFS unset, it would disable word
+# splitting by setting IFS to empty value.)
+IFS=" "" $as_nl"
+
+# Find who we are. Look in the path if we contain no directory separator.
+as_myself=
+case $0 in #((
+ *[\\/]* ) as_myself=$0 ;;
+ *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+ IFS=$as_save_IFS
+ test -z "$as_dir" && as_dir=.
+ test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
+ done
+IFS=$as_save_IFS
+
+ ;;
+esac
+# We did not find ourselves, most probably we were run as `sh COMMAND'
+# in which case we are not to be found in the path.
+if test "x$as_myself" = x; then
+ as_myself=$0
+fi
+if test ! -f "$as_myself"; then
+ $as_echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2
+ exit 1
+fi
+
+# Unset variables that we do not need and which cause bugs (e.g. in
+# pre-3.0 UWIN ksh). But do not cause bugs in bash 2.01; the "|| exit 1"
+# suppresses any "Segmentation fault" message there. '((' could
+# trigger a bug in pdksh 5.2.14.
+for as_var in BASH_ENV ENV MAIL MAILPATH
+do eval test x\${$as_var+set} = xset \
+ && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || :
+done
+PS1='$ '
+PS2='> '
+PS4='+ '
+
+# NLS nuisances.
+LC_ALL=C
+export LC_ALL
+LANGUAGE=C
+export LANGUAGE
+
+# CDPATH.
+(unset CDPATH) >/dev/null 2>&1 && unset CDPATH
+
+
+# as_fn_error STATUS ERROR [LINENO LOG_FD]
+# ----------------------------------------
+# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are
+# provided, also output the error to LOG_FD, referencing LINENO. Then exit the
+# script with STATUS, using 1 if that was 0.
+as_fn_error ()
+{
+ as_status=$1; test $as_status -eq 0 && as_status=1
+ if test "$4"; then
+ as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
+ $as_echo "$as_me:${as_lineno-$LINENO}: error: $2" >&$4
+ fi
+ $as_echo "$as_me: error: $2" >&2
+ as_fn_exit $as_status
+} # as_fn_error
+
+
+# as_fn_set_status STATUS
+# -----------------------
+# Set $? to STATUS, without forking.
+as_fn_set_status ()
+{
+ return $1
+} # as_fn_set_status
+
+# as_fn_exit STATUS
+# -----------------
+# Exit the shell with STATUS, even in a "trap 0" or "set -e" context.
+as_fn_exit ()
+{
+ set +e
+ as_fn_set_status $1
+ exit $1
+} # as_fn_exit
+
+# as_fn_unset VAR
+# ---------------
+# Portably unset VAR.
+as_fn_unset ()
+{
+ { eval $1=; unset $1;}
+}
+as_unset=as_fn_unset
+# as_fn_append VAR VALUE
+# ----------------------
+# Append the text in VALUE to the end of the definition contained in VAR. Take
+# advantage of any shell optimizations that allow amortized linear growth over
+# repeated appends, instead of the typical quadratic growth present in naive
+# implementations.
+if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null; then :
+ eval 'as_fn_append ()
+ {
+ eval $1+=\$2
+ }'
+else
+ as_fn_append ()
+ {
+ eval $1=\$$1\$2
+ }
+fi # as_fn_append
+
+# as_fn_arith ARG...
+# ------------------
+# Perform arithmetic evaluation on the ARGs, and store the result in the
+# global $as_val. Take advantage of shells that can avoid forks. The arguments
+# must be portable across $(()) and expr.
+if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null; then :
+ eval 'as_fn_arith ()
+ {
+ as_val=$(( $* ))
+ }'
+else
+ as_fn_arith ()
+ {
+ as_val=`expr "$@" || test $? -eq 1`
+ }
+fi # as_fn_arith
+
+
+if expr a : '\(a\)' >/dev/null 2>&1 &&
+ test "X`expr 00001 : '.*\(...\)'`" = X001; then
+ as_expr=expr
+else
+ as_expr=false
+fi
+
+if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then
+ as_basename=basename
+else
+ as_basename=false
+fi
+
+if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
+ as_dirname=dirname
+else
+ as_dirname=false
+fi
+
+as_me=`$as_basename -- "$0" ||
+$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
+ X"$0" : 'X\(//\)$' \| \
+ X"$0" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X/"$0" |
+ sed '/^.*\/\([^/][^/]*\)\/*$/{
+ s//\1/
+ q
+ }
+ /^X\/\(\/\/\)$/{
+ s//\1/
+ q
+ }
+ /^X\/\(\/\).*/{
+ s//\1/
+ q
+ }
+ s/.*/./; q'`
+
+# Avoid depending upon Character Ranges.
+as_cr_letters='abcdefghijklmnopqrstuvwxyz'
+as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
+as_cr_Letters=$as_cr_letters$as_cr_LETTERS
+as_cr_digits='0123456789'
+as_cr_alnum=$as_cr_Letters$as_cr_digits
+
+ECHO_C= ECHO_N= ECHO_T=
+case `echo -n x` in #(((((
+-n*)
+ case `echo 'xy\c'` in
+ *c*) ECHO_T=' ';; # ECHO_T is single tab character.
+ xy) ECHO_C='\c';;
+ *) echo `echo ksh88 bug on AIX 6.1` > /dev/null
+ ECHO_T=' ';;
+ esac;;
+*)
+ ECHO_N='-n';;
+esac
+
+rm -f conf$$ conf$$.exe conf$$.file
+if test -d conf$$.dir; then
+ rm -f conf$$.dir/conf$$.file
+else
+ rm -f conf$$.dir
+ mkdir conf$$.dir 2>/dev/null
+fi
+if (echo >conf$$.file) 2>/dev/null; then
+ if ln -s conf$$.file conf$$ 2>/dev/null; then
+ as_ln_s='ln -s'
+ # ... but there are two gotchas:
+ # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail.
+ # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable.
+ # In both cases, we have to default to `cp -pR'.
+ ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe ||
+ as_ln_s='cp -pR'
+ elif ln conf$$.file conf$$ 2>/dev/null; then
+ as_ln_s=ln
+ else
+ as_ln_s='cp -pR'
+ fi
+else
+ as_ln_s='cp -pR'
+fi
+rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file
+rmdir conf$$.dir 2>/dev/null
+
+
+# as_fn_mkdir_p
+# -------------
+# Create "$as_dir" as a directory, including parents if necessary.
+as_fn_mkdir_p ()
+{
+
+ case $as_dir in #(
+ -*) as_dir=./$as_dir;;
+ esac
+ test -d "$as_dir" || eval $as_mkdir_p || {
+ as_dirs=
+ while :; do
+ case $as_dir in #(
+ *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
+ *) as_qdir=$as_dir;;
+ esac
+ as_dirs="'$as_qdir' $as_dirs"
+ as_dir=`$as_dirname -- "$as_dir" ||
+$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+ X"$as_dir" : 'X\(//\)[^/]' \| \
+ X"$as_dir" : 'X\(//\)$' \| \
+ X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X"$as_dir" |
+ sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)[^/].*/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\).*/{
+ s//\1/
+ q
+ }
+ s/.*/./; q'`
+ test -d "$as_dir" && break
+ done
+ test -z "$as_dirs" || eval "mkdir $as_dirs"
+ } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir"
+
+
+} # as_fn_mkdir_p
+if mkdir -p . 2>/dev/null; then
+ as_mkdir_p='mkdir -p "$as_dir"'
+else
+ test -d ./-p && rmdir ./-p
+ as_mkdir_p=false
+fi
+
+
+# as_fn_executable_p FILE
+# -----------------------
+# Test if FILE is an executable regular file.
+as_fn_executable_p ()
+{
+ test -f "$1" && test -x "$1"
+} # as_fn_executable_p
+as_test_x='test -x'
+as_executable_p=as_fn_executable_p
+
+# Sed expression to map a string onto a valid CPP name.
+as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'"
+
+# Sed expression to map a string onto a valid variable name.
+as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'"
+
+
+exec 6>&1
+## ----------------------------------- ##
+## Main body of $CONFIG_STATUS script. ##
+## ----------------------------------- ##
+_ASEOF
+test $as_write_fail = 0 && chmod +x $CONFIG_STATUS || ac_write_fail=1
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+# Save the log message, to keep $0 and so on meaningful, and to
+# report actual input values of CONFIG_FILES etc. instead of their
+# values after options handling.
+ac_log="
+This file was extended by andi $as_me 0.9.4, which was
+generated by GNU Autoconf 2.69. Invocation command line was
+
+ CONFIG_FILES = $CONFIG_FILES
+ CONFIG_HEADERS = $CONFIG_HEADERS
+ CONFIG_LINKS = $CONFIG_LINKS
+ CONFIG_COMMANDS = $CONFIG_COMMANDS
+ $ $0 $@
+
+on `(hostname || uname -n) 2>/dev/null | sed 1q`
+"
+
+_ACEOF
+
+case $ac_config_files in *"
+"*) set x $ac_config_files; shift; ac_config_files=$*;;
+esac
+
+case $ac_config_headers in *"
+"*) set x $ac_config_headers; shift; ac_config_headers=$*;;
+esac
+
+
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+# Files that config.status was made for.
+config_files="$ac_config_files"
+config_headers="$ac_config_headers"
+config_commands="$ac_config_commands"
+
+_ACEOF
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+ac_cs_usage="\
+\`$as_me' instantiates files and other configuration actions
+from templates according to the current configuration. Unless the files
+and actions are specified as TAGs, all are instantiated by default.
+
+Usage: $0 [OPTION]... [TAG]...
+
+ -h, --help print this help, then exit
+ -V, --version print version number and configuration settings, then exit
+ --config print configuration, then exit
+ -q, --quiet, --silent
+ do not print progress messages
+ -d, --debug don't remove temporary files
+ --recheck update $as_me by reconfiguring in the same conditions
+ --file=FILE[:TEMPLATE]
+ instantiate the configuration file FILE
+ --header=FILE[:TEMPLATE]
+ instantiate the configuration header FILE
+
+Configuration files:
+$config_files
+
+Configuration headers:
+$config_headers
+
+Configuration commands:
+$config_commands
+
+Report bugs to the package provider."
+
+_ACEOF
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+ac_cs_config="`$as_echo "$ac_configure_args" | sed 's/^ //; s/[\\""\`\$]/\\\\&/g'`"
+ac_cs_version="\\
+andi config.status 0.9.4
+configured by $0, generated by GNU Autoconf 2.69,
+ with options \\"\$ac_cs_config\\"
+
+Copyright (C) 2012 Free Software Foundation, Inc.
+This config.status script is free software; the Free Software Foundation
+gives unlimited permission to copy, distribute and modify it."
+
+ac_pwd='$ac_pwd'
+srcdir='$srcdir'
+INSTALL='$INSTALL'
+MKDIR_P='$MKDIR_P'
+AWK='$AWK'
+test -n "\$AWK" || AWK=awk
+_ACEOF
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+# The default lists apply if the user does not specify any file.
+ac_need_defaults=:
+while test $# != 0
+do
+ case $1 in
+ --*=?*)
+ ac_option=`expr "X$1" : 'X\([^=]*\)='`
+ ac_optarg=`expr "X$1" : 'X[^=]*=\(.*\)'`
+ ac_shift=:
+ ;;
+ --*=)
+ ac_option=`expr "X$1" : 'X\([^=]*\)='`
+ ac_optarg=
+ ac_shift=:
+ ;;
+ *)
+ ac_option=$1
+ ac_optarg=$2
+ ac_shift=shift
+ ;;
+ esac
+
+ case $ac_option in
+ # Handling of the options.
+ -recheck | --recheck | --rechec | --reche | --rech | --rec | --re | --r)
+ ac_cs_recheck=: ;;
+ --version | --versio | --versi | --vers | --ver | --ve | --v | -V )
+ $as_echo "$ac_cs_version"; exit ;;
+ --config | --confi | --conf | --con | --co | --c )
+ $as_echo "$ac_cs_config"; exit ;;
+ --debug | --debu | --deb | --de | --d | -d )
+ debug=: ;;
+ --file | --fil | --fi | --f )
+ $ac_shift
+ case $ac_optarg in
+ *\'*) ac_optarg=`$as_echo "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"` ;;
+ '') as_fn_error $? "missing file argument" ;;
+ esac
+ as_fn_append CONFIG_FILES " '$ac_optarg'"
+ ac_need_defaults=false;;
+ --header | --heade | --head | --hea )
+ $ac_shift
+ case $ac_optarg in
+ *\'*) ac_optarg=`$as_echo "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"` ;;
+ esac
+ as_fn_append CONFIG_HEADERS " '$ac_optarg'"
+ ac_need_defaults=false;;
+ --he | --h)
+ # Conflict between --help and --header
+ as_fn_error $? "ambiguous option: \`$1'
+Try \`$0 --help' for more information.";;
+ --help | --hel | -h )
+ $as_echo "$ac_cs_usage"; exit ;;
+ -q | -quiet | --quiet | --quie | --qui | --qu | --q \
+ | -silent | --silent | --silen | --sile | --sil | --si | --s)
+ ac_cs_silent=: ;;
+
+ # This is an error.
+ -*) as_fn_error $? "unrecognized option: \`$1'
+Try \`$0 --help' for more information." ;;
+
+ *) as_fn_append ac_config_targets " $1"
+ ac_need_defaults=false ;;
+
+ esac
+ shift
+done
+
+ac_configure_extra_args=
+
+if $ac_cs_silent; then
+ exec 6>/dev/null
+ ac_configure_extra_args="$ac_configure_extra_args --silent"
+fi
+
+_ACEOF
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+if \$ac_cs_recheck; then
+ set X $SHELL '$0' $ac_configure_args \$ac_configure_extra_args --no-create --no-recursion
+ shift
+ \$as_echo "running CONFIG_SHELL=$SHELL \$*" >&6
+ CONFIG_SHELL='$SHELL'
+ export CONFIG_SHELL
+ exec "\$@"
+fi
+
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+exec 5>>config.log
+{
+ echo
+ sed 'h;s/./-/g;s/^.../## /;s/...$/ ##/;p;x;p;x' <<_ASBOX
+## Running $as_me. ##
+_ASBOX
+ $as_echo "$ac_log"
+} >&5
+
+_ACEOF
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+#
+# INIT-COMMANDS
+#
+AMDEP_TRUE="$AMDEP_TRUE" ac_aux_dir="$ac_aux_dir"
+
+_ACEOF
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+
+# Handling of arguments.
+for ac_config_target in $ac_config_targets
+do
+ case $ac_config_target in
+ "depfiles") CONFIG_COMMANDS="$CONFIG_COMMANDS depfiles" ;;
+ "src/config.h") CONFIG_HEADERS="$CONFIG_HEADERS src/config.h:src/config.hin" ;;
+ "Makefile") CONFIG_FILES="$CONFIG_FILES Makefile" ;;
+ "docs/andi.1") CONFIG_FILES="$CONFIG_FILES docs/andi.1" ;;
+ "docs/Makefile") CONFIG_FILES="$CONFIG_FILES docs/Makefile" ;;
+ "libs/Makefile") CONFIG_FILES="$CONFIG_FILES libs/Makefile" ;;
+ "opt/Makefile") CONFIG_FILES="$CONFIG_FILES opt/Makefile" ;;
+ "opt/psufsort/Makefile") CONFIG_FILES="$CONFIG_FILES opt/psufsort/Makefile" ;;
+ "src/Makefile") CONFIG_FILES="$CONFIG_FILES src/Makefile" ;;
+ "test/Makefile") CONFIG_FILES="$CONFIG_FILES test/Makefile" ;;
+
+ *) as_fn_error $? "invalid argument: \`$ac_config_target'" "$LINENO" 5;;
+ esac
+done
+
+
+# If the user did not use the arguments to specify the items to instantiate,
+# then the envvar interface is used. Set only those that are not.
+# We use the long form for the default assignment because of an extremely
+# bizarre bug on SunOS 4.1.3.
+if $ac_need_defaults; then
+ test "${CONFIG_FILES+set}" = set || CONFIG_FILES=$config_files
+ test "${CONFIG_HEADERS+set}" = set || CONFIG_HEADERS=$config_headers
+ test "${CONFIG_COMMANDS+set}" = set || CONFIG_COMMANDS=$config_commands
+fi
+
+# Have a temporary directory for convenience. Make it in the build tree
+# simply because there is no reason against having it here, and in addition,
+# creating and moving files from /tmp can sometimes cause problems.
+# Hook for its removal unless debugging.
+# Note that there is a small window in which the directory will not be cleaned:
+# after its creation but before its name has been assigned to `$tmp'.
+$debug ||
+{
+ tmp= ac_tmp=
+ trap 'exit_status=$?
+ : "${ac_tmp:=$tmp}"
+ { test ! -d "$ac_tmp" || rm -fr "$ac_tmp"; } && exit $exit_status
+' 0
+ trap 'as_fn_exit 1' 1 2 13 15
+}
+# Create a (secure) tmp directory for tmp files.
+
+{
+ tmp=`(umask 077 && mktemp -d "./confXXXXXX") 2>/dev/null` &&
+ test -d "$tmp"
+} ||
+{
+ tmp=./conf$$-$RANDOM
+ (umask 077 && mkdir "$tmp")
+} || as_fn_error $? "cannot create a temporary directory in ." "$LINENO" 5
+ac_tmp=$tmp
+
+# Set up the scripts for CONFIG_FILES section.
+# No need to generate them if there are no CONFIG_FILES.
+# This happens for instance with `./config.status config.h'.
+if test -n "$CONFIG_FILES"; then
+
+
+ac_cr=`echo X | tr X '\015'`
+# On cygwin, bash can eat \r inside `` if the user requested igncr.
+# But we know of no other shell where ac_cr would be empty at this
+# point, so we can use a bashism as a fallback.
+if test "x$ac_cr" = x; then
+ eval ac_cr=\$\'\\r\'
+fi
+ac_cs_awk_cr=`$AWK 'BEGIN { print "a\rb" }' </dev/null 2>/dev/null`
+if test "$ac_cs_awk_cr" = "a${ac_cr}b"; then
+ ac_cs_awk_cr='\\r'
+else
+ ac_cs_awk_cr=$ac_cr
+fi
+
+echo 'BEGIN {' >"$ac_tmp/subs1.awk" &&
+_ACEOF
+
+
+{
+ echo "cat >conf$$subs.awk <<_ACEOF" &&
+ echo "$ac_subst_vars" | sed 's/.*/&!$&$ac_delim/' &&
+ echo "_ACEOF"
+} >conf$$subs.sh ||
+ as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
+ac_delim_num=`echo "$ac_subst_vars" | grep -c '^'`
+ac_delim='%!_!# '
+for ac_last_try in false false false false false :; do
+ . ./conf$$subs.sh ||
+ as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
+
+ ac_delim_n=`sed -n "s/.*$ac_delim\$/X/p" conf$$subs.awk | grep -c X`
+ if test $ac_delim_n = $ac_delim_num; then
+ break
+ elif $ac_last_try; then
+ as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
+ else
+ ac_delim="$ac_delim!$ac_delim _$ac_delim!! "
+ fi
+done
+rm -f conf$$subs.sh
+
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+cat >>"\$ac_tmp/subs1.awk" <<\\_ACAWK &&
+_ACEOF
+sed -n '
+h
+s/^/S["/; s/!.*/"]=/
+p
+g
+s/^[^!]*!//
+:repl
+t repl
+s/'"$ac_delim"'$//
+t delim
+:nl
+h
+s/\(.\{148\}\)..*/\1/
+t more1
+s/["\\]/\\&/g; s/^/"/; s/$/\\n"\\/
+p
+n
+b repl
+:more1
+s/["\\]/\\&/g; s/^/"/; s/$/"\\/
+p
+g
+s/.\{148\}//
+t nl
+:delim
+h
+s/\(.\{148\}\)..*/\1/
+t more2
+s/["\\]/\\&/g; s/^/"/; s/$/"/
+p
+b
+:more2
+s/["\\]/\\&/g; s/^/"/; s/$/"\\/
+p
+g
+s/.\{148\}//
+t delim
+' <conf$$subs.awk | sed '
+/^[^""]/{
+ N
+ s/\n//
+}
+' >>$CONFIG_STATUS || ac_write_fail=1
+rm -f conf$$subs.awk
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+_ACAWK
+cat >>"\$ac_tmp/subs1.awk" <<_ACAWK &&
+ for (key in S) S_is_set[key] = 1
+ FS = ""
+
+}
+{
+ line = $ 0
+ nfields = split(line, field, "@")
+ substed = 0
+ len = length(field[1])
+ for (i = 2; i < nfields; i++) {
+ key = field[i]
+ keylen = length(key)
+ if (S_is_set[key]) {
+ value = S[key]
+ line = substr(line, 1, len) "" value "" substr(line, len + keylen + 3)
+ len += length(value) + length(field[++i])
+ substed = 1
+ } else
+ len += 1 + keylen
+ }
+
+ print line
+}
+
+_ACAWK
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+if sed "s/$ac_cr//" < /dev/null > /dev/null 2>&1; then
+ sed "s/$ac_cr\$//; s/$ac_cr/$ac_cs_awk_cr/g"
+else
+ cat
+fi < "$ac_tmp/subs1.awk" > "$ac_tmp/subs.awk" \
+ || as_fn_error $? "could not setup config files machinery" "$LINENO" 5
+_ACEOF
+
+# VPATH may cause trouble with some makes, so we remove sole $(srcdir),
+# ${srcdir} and @srcdir@ entries from VPATH if srcdir is ".", strip leading and
+# trailing colons and then remove the whole line if VPATH becomes empty
+# (actually we leave an empty line to preserve line numbers).
+if test "x$srcdir" = x.; then
+ ac_vpsub='/^[ ]*VPATH[ ]*=[ ]*/{
+h
+s///
+s/^/:/
+s/[ ]*$/:/
+s/:\$(srcdir):/:/g
+s/:\${srcdir}:/:/g
+s/:@srcdir@:/:/g
+s/^:*//
+s/:*$//
+x
+s/\(=[ ]*\).*/\1/
+G
+s/\n//
+s/^[^=]*=[ ]*$//
+}'
+fi
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+fi # test -n "$CONFIG_FILES"
+
+# Set up the scripts for CONFIG_HEADERS section.
+# No need to generate them if there are no CONFIG_HEADERS.
+# This happens for instance with `./config.status Makefile'.
+if test -n "$CONFIG_HEADERS"; then
+cat >"$ac_tmp/defines.awk" <<\_ACAWK ||
+BEGIN {
+_ACEOF
+
+# Transform confdefs.h into an awk script `defines.awk', embedded as
+# here-document in config.status, that substitutes the proper values into
+# config.h.in to produce config.h.
+
+# Create a delimiter string that does not exist in confdefs.h, to ease
+# handling of long lines.
+ac_delim='%!_!# '
+for ac_last_try in false false :; do
+ ac_tt=`sed -n "/$ac_delim/p" confdefs.h`
+ if test -z "$ac_tt"; then
+ break
+ elif $ac_last_try; then
+ as_fn_error $? "could not make $CONFIG_HEADERS" "$LINENO" 5
+ else
+ ac_delim="$ac_delim!$ac_delim _$ac_delim!! "
+ fi
+done
+
+# For the awk script, D is an array of macro values keyed by name,
+# likewise P contains macro parameters if any. Preserve backslash
+# newline sequences.
+
+ac_word_re=[_$as_cr_Letters][_$as_cr_alnum]*
+sed -n '
+s/.\{148\}/&'"$ac_delim"'/g
+t rset
+:rset
+s/^[ ]*#[ ]*define[ ][ ]*/ /
+t def
+d
+:def
+s/\\$//
+t bsnl
+s/["\\]/\\&/g
+s/^ \('"$ac_word_re"'\)\(([^()]*)\)[ ]*\(.*\)/P["\1"]="\2"\
+D["\1"]=" \3"/p
+s/^ \('"$ac_word_re"'\)[ ]*\(.*\)/D["\1"]=" \2"/p
+d
+:bsnl
+s/["\\]/\\&/g
+s/^ \('"$ac_word_re"'\)\(([^()]*)\)[ ]*\(.*\)/P["\1"]="\2"\
+D["\1"]=" \3\\\\\\n"\\/p
+t cont
+s/^ \('"$ac_word_re"'\)[ ]*\(.*\)/D["\1"]=" \2\\\\\\n"\\/p
+t cont
+d
+:cont
+n
+s/.\{148\}/&'"$ac_delim"'/g
+t clear
+:clear
+s/\\$//
+t bsnlc
+s/["\\]/\\&/g; s/^/"/; s/$/"/p
+d
+:bsnlc
+s/["\\]/\\&/g; s/^/"/; s/$/\\\\\\n"\\/p
+b cont
+' <confdefs.h | sed '
+s/'"$ac_delim"'/"\\\
+"/g' >>$CONFIG_STATUS || ac_write_fail=1
+
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+ for (key in D) D_is_set[key] = 1
+ FS = ""
+}
+/^[\t ]*#[\t ]*(define|undef)[\t ]+$ac_word_re([\t (]|\$)/ {
+ line = \$ 0
+ split(line, arg, " ")
+ if (arg[1] == "#") {
+ defundef = arg[2]
+ mac1 = arg[3]
+ } else {
+ defundef = substr(arg[1], 2)
+ mac1 = arg[2]
+ }
+ split(mac1, mac2, "(") #)
+ macro = mac2[1]
+ prefix = substr(line, 1, index(line, defundef) - 1)
+ if (D_is_set[macro]) {
+ # Preserve the white space surrounding the "#".
+ print prefix "define", macro P[macro] D[macro]
+ next
+ } else {
+ # Replace #undef with comments. This is necessary, for example,
+ # in the case of _POSIX_SOURCE, which is predefined and required
+ # on some systems where configure will not decide to define it.
+ if (defundef == "undef") {
+ print "/*", prefix defundef, macro, "*/"
+ next
+ }
+ }
+}
+{ print }
+_ACAWK
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+ as_fn_error $? "could not setup config headers machinery" "$LINENO" 5
+fi # test -n "$CONFIG_HEADERS"
+
+
+eval set X " :F $CONFIG_FILES :H $CONFIG_HEADERS :C $CONFIG_COMMANDS"
+shift
+for ac_tag
+do
+ case $ac_tag in
+ :[FHLC]) ac_mode=$ac_tag; continue;;
+ esac
+ case $ac_mode$ac_tag in
+ :[FHL]*:*);;
+ :L* | :C*:*) as_fn_error $? "invalid tag \`$ac_tag'" "$LINENO" 5;;
+ :[FH]-) ac_tag=-:-;;
+ :[FH]*) ac_tag=$ac_tag:$ac_tag.in;;
+ esac
+ ac_save_IFS=$IFS
+ IFS=:
+ set x $ac_tag
+ IFS=$ac_save_IFS
+ shift
+ ac_file=$1
+ shift
+
+ case $ac_mode in
+ :L) ac_source=$1;;
+ :[FH])
+ ac_file_inputs=
+ for ac_f
+ do
+ case $ac_f in
+ -) ac_f="$ac_tmp/stdin";;
+ *) # Look for the file first in the build tree, then in the source tree
+ # (if the path is not absolute). The absolute path cannot be DOS-style,
+ # because $ac_f cannot contain `:'.
+ test -f "$ac_f" ||
+ case $ac_f in
+ [\\/$]*) false;;
+ *) test -f "$srcdir/$ac_f" && ac_f="$srcdir/$ac_f";;
+ esac ||
+ as_fn_error 1 "cannot find input file: \`$ac_f'" "$LINENO" 5;;
+ esac
+ case $ac_f in *\'*) ac_f=`$as_echo "$ac_f" | sed "s/'/'\\\\\\\\''/g"`;; esac
+ as_fn_append ac_file_inputs " '$ac_f'"
+ done
+
+ # Let's still pretend it is `configure' which instantiates (i.e., don't
+ # use $as_me), people would be surprised to read:
+ # /* config.h. Generated by config.status. */
+ configure_input='Generated from '`
+ $as_echo "$*" | sed 's|^[^:]*/||;s|:[^:]*/|, |g'
+ `' by configure.'
+ if test x"$ac_file" != x-; then
+ configure_input="$ac_file. $configure_input"
+ { $as_echo "$as_me:${as_lineno-$LINENO}: creating $ac_file" >&5
+$as_echo "$as_me: creating $ac_file" >&6;}
+ fi
+ # Neutralize special characters interpreted by sed in replacement strings.
+ case $configure_input in #(
+ *\&* | *\|* | *\\* )
+ ac_sed_conf_input=`$as_echo "$configure_input" |
+ sed 's/[\\\\&|]/\\\\&/g'`;; #(
+ *) ac_sed_conf_input=$configure_input;;
+ esac
+
+ case $ac_tag in
+ *:-:* | *:-) cat >"$ac_tmp/stdin" \
+ || as_fn_error $? "could not create $ac_file" "$LINENO" 5 ;;
+ esac
+ ;;
+ esac
+
+ ac_dir=`$as_dirname -- "$ac_file" ||
+$as_expr X"$ac_file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+ X"$ac_file" : 'X\(//\)[^/]' \| \
+ X"$ac_file" : 'X\(//\)$' \| \
+ X"$ac_file" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X"$ac_file" |
+ sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)[^/].*/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\).*/{
+ s//\1/
+ q
+ }
+ s/.*/./; q'`
+ as_dir="$ac_dir"; as_fn_mkdir_p
+ ac_builddir=.
+
+case "$ac_dir" in
+.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;;
+*)
+ ac_dir_suffix=/`$as_echo "$ac_dir" | sed 's|^\.[\\/]||'`
+ # A ".." for each directory in $ac_dir_suffix.
+ ac_top_builddir_sub=`$as_echo "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'`
+ case $ac_top_builddir_sub in
+ "") ac_top_builddir_sub=. ac_top_build_prefix= ;;
+ *) ac_top_build_prefix=$ac_top_builddir_sub/ ;;
+ esac ;;
+esac
+ac_abs_top_builddir=$ac_pwd
+ac_abs_builddir=$ac_pwd$ac_dir_suffix
+# for backward compatibility:
+ac_top_builddir=$ac_top_build_prefix
+
+case $srcdir in
+ .) # We are building in place.
+ ac_srcdir=.
+ ac_top_srcdir=$ac_top_builddir_sub
+ ac_abs_top_srcdir=$ac_pwd ;;
+ [\\/]* | ?:[\\/]* ) # Absolute name.
+ ac_srcdir=$srcdir$ac_dir_suffix;
+ ac_top_srcdir=$srcdir
+ ac_abs_top_srcdir=$srcdir ;;
+ *) # Relative name.
+ ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix
+ ac_top_srcdir=$ac_top_build_prefix$srcdir
+ ac_abs_top_srcdir=$ac_pwd/$srcdir ;;
+esac
+ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix
+
+
+ case $ac_mode in
+ :F)
+ #
+ # CONFIG_FILE
+ #
+
+ case $INSTALL in
+ [\\/$]* | ?:[\\/]* ) ac_INSTALL=$INSTALL ;;
+ *) ac_INSTALL=$ac_top_build_prefix$INSTALL ;;
+ esac
+ ac_MKDIR_P=$MKDIR_P
+ case $MKDIR_P in
+ [\\/$]* | ?:[\\/]* ) ;;
+ */*) ac_MKDIR_P=$ac_top_build_prefix$MKDIR_P ;;
+ esac
+_ACEOF
+
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+# If the template does not know about datarootdir, expand it.
+# FIXME: This hack should be removed a few years after 2.60.
+ac_datarootdir_hack=; ac_datarootdir_seen=
+ac_sed_dataroot='
+/datarootdir/ {
+ p
+ q
+}
+/@datadir@/p
+/@docdir@/p
+/@infodir@/p
+/@localedir@/p
+/@mandir@/p'
+case `eval "sed -n \"\$ac_sed_dataroot\" $ac_file_inputs"` in
+*datarootdir*) ac_datarootdir_seen=yes;;
+*@datadir@*|*@docdir@*|*@infodir@*|*@localedir@*|*@mandir@*)
+ { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&5
+$as_echo "$as_me: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&2;}
+_ACEOF
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+ ac_datarootdir_hack='
+ s&@datadir@&$datadir&g
+ s&@docdir@&$docdir&g
+ s&@infodir@&$infodir&g
+ s&@localedir@&$localedir&g
+ s&@mandir@&$mandir&g
+ s&\\\${datarootdir}&$datarootdir&g' ;;
+esac
+_ACEOF
+
+# Neutralize VPATH when `$srcdir' = `.'.
+# Shell code in configure.ac might set extrasub.
+# FIXME: do we really want to maintain this feature?
+cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
+ac_sed_extra="$ac_vpsub
+$extrasub
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
+:t
+/@[a-zA-Z_][a-zA-Z_0-9]*@/!b
+s|@configure_input@|$ac_sed_conf_input|;t t
+s&@top_builddir@&$ac_top_builddir_sub&;t t
+s&@top_build_prefix@&$ac_top_build_prefix&;t t
+s&@srcdir@&$ac_srcdir&;t t
+s&@abs_srcdir@&$ac_abs_srcdir&;t t
+s&@top_srcdir@&$ac_top_srcdir&;t t
+s&@abs_top_srcdir@&$ac_abs_top_srcdir&;t t
+s&@builddir@&$ac_builddir&;t t
+s&@abs_builddir@&$ac_abs_builddir&;t t
+s&@abs_top_builddir@&$ac_abs_top_builddir&;t t
+s&@INSTALL@&$ac_INSTALL&;t t
+s&@MKDIR_P@&$ac_MKDIR_P&;t t
+$ac_datarootdir_hack
+"
+eval sed \"\$ac_sed_extra\" "$ac_file_inputs" | $AWK -f "$ac_tmp/subs.awk" \
+ >$ac_tmp/out || as_fn_error $? "could not create $ac_file" "$LINENO" 5
+
+test -z "$ac_datarootdir_hack$ac_datarootdir_seen" &&
+ { ac_out=`sed -n '/\${datarootdir}/p' "$ac_tmp/out"`; test -n "$ac_out"; } &&
+ { ac_out=`sed -n '/^[ ]*datarootdir[ ]*:*=/p' \
+ "$ac_tmp/out"`; test -z "$ac_out"; } &&
+ { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file contains a reference to the variable \`datarootdir'
+which seems to be undefined. Please make sure it is defined" >&5
+$as_echo "$as_me: WARNING: $ac_file contains a reference to the variable \`datarootdir'
+which seems to be undefined. Please make sure it is defined" >&2;}
+
+ rm -f "$ac_tmp/stdin"
+ case $ac_file in
+ -) cat "$ac_tmp/out" && rm -f "$ac_tmp/out";;
+ *) rm -f "$ac_file" && mv "$ac_tmp/out" "$ac_file";;
+ esac \
+ || as_fn_error $? "could not create $ac_file" "$LINENO" 5
+ ;;
+ :H)
+ #
+ # CONFIG_HEADER
+ #
+ if test x"$ac_file" != x-; then
+ {
+ $as_echo "/* $configure_input */" \
+ && eval '$AWK -f "$ac_tmp/defines.awk"' "$ac_file_inputs"
+ } >"$ac_tmp/config.h" \
+ || as_fn_error $? "could not create $ac_file" "$LINENO" 5
+ if diff "$ac_file" "$ac_tmp/config.h" >/dev/null 2>&1; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: $ac_file is unchanged" >&5
+$as_echo "$as_me: $ac_file is unchanged" >&6;}
+ else
+ rm -f "$ac_file"
+ mv "$ac_tmp/config.h" "$ac_file" \
+ || as_fn_error $? "could not create $ac_file" "$LINENO" 5
+ fi
+ else
+ $as_echo "/* $configure_input */" \
+ && eval '$AWK -f "$ac_tmp/defines.awk"' "$ac_file_inputs" \
+ || as_fn_error $? "could not create -" "$LINENO" 5
+ fi
+# Compute "$ac_file"'s index in $config_headers.
+_am_arg="$ac_file"
+_am_stamp_count=1
+for _am_header in $config_headers :; do
+ case $_am_header in
+ $_am_arg | $_am_arg:* )
+ break ;;
+ * )
+ _am_stamp_count=`expr $_am_stamp_count + 1` ;;
+ esac
+done
+echo "timestamp for $_am_arg" >`$as_dirname -- "$_am_arg" ||
+$as_expr X"$_am_arg" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+ X"$_am_arg" : 'X\(//\)[^/]' \| \
+ X"$_am_arg" : 'X\(//\)$' \| \
+ X"$_am_arg" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X"$_am_arg" |
+ sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)[^/].*/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\).*/{
+ s//\1/
+ q
+ }
+ s/.*/./; q'`/stamp-h$_am_stamp_count
+ ;;
+
+ :C) { $as_echo "$as_me:${as_lineno-$LINENO}: executing $ac_file commands" >&5
+$as_echo "$as_me: executing $ac_file commands" >&6;}
+ ;;
+ esac
+
+
+ case $ac_file$ac_mode in
+ "depfiles":C) test x"$AMDEP_TRUE" != x"" || {
+ # Older Autoconf quotes --file arguments for eval, but not when files
+ # are listed without --file. Let's play safe and only enable the eval
+ # if we detect the quoting.
+ case $CONFIG_FILES in
+ *\'*) eval set x "$CONFIG_FILES" ;;
+ *) set x $CONFIG_FILES ;;
+ esac
+ shift
+ for mf
+ do
+ # Strip MF so we end up with the name of the file.
+ mf=`echo "$mf" | sed -e 's/:.*$//'`
+ # Check whether this is an Automake generated Makefile or not.
+ # We used to match only the files named 'Makefile.in', but
+ # some people rename them; so instead we look at the file content.
+ # Grep'ing the first line is not enough: some people post-process
+ # each Makefile.in and add a new line on top of each file to say so.
+ # Grep'ing the whole file is not good either: AIX grep has a line
+ # limit of 2048, but all sed's we know have understand at least 4000.
+ if sed -n 's,^#.*generated by automake.*,X,p' "$mf" | grep X >/dev/null 2>&1; then
+ dirpart=`$as_dirname -- "$mf" ||
+$as_expr X"$mf" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+ X"$mf" : 'X\(//\)[^/]' \| \
+ X"$mf" : 'X\(//\)$' \| \
+ X"$mf" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X"$mf" |
+ sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)[^/].*/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\).*/{
+ s//\1/
+ q
+ }
+ s/.*/./; q'`
+ else
+ continue
+ fi
+ # Extract the definition of DEPDIR, am__include, and am__quote
+ # from the Makefile without running 'make'.
+ DEPDIR=`sed -n 's/^DEPDIR = //p' < "$mf"`
+ test -z "$DEPDIR" && continue
+ am__include=`sed -n 's/^am__include = //p' < "$mf"`
+ test -z "$am__include" && continue
+ am__quote=`sed -n 's/^am__quote = //p' < "$mf"`
+ # Find all dependency output files, they are included files with
+ # $(DEPDIR) in their names. We invoke sed twice because it is the
+ # simplest approach to changing $(DEPDIR) to its actual value in the
+ # expansion.
+ for file in `sed -n "
+ s/^$am__include $am__quote\(.*(DEPDIR).*\)$am__quote"'$/\1/p' <"$mf" | \
+ sed -e 's/\$(DEPDIR)/'"$DEPDIR"'/g'`; do
+ # Make sure the directory exists.
+ test -f "$dirpart/$file" && continue
+ fdir=`$as_dirname -- "$file" ||
+$as_expr X"$file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+ X"$file" : 'X\(//\)[^/]' \| \
+ X"$file" : 'X\(//\)$' \| \
+ X"$file" : 'X\(/\)' \| . 2>/dev/null ||
+$as_echo X"$file" |
+ sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)[^/].*/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\).*/{
+ s//\1/
+ q
+ }
+ s/.*/./; q'`
+ as_dir=$dirpart/$fdir; as_fn_mkdir_p
+ # echo "creating $dirpart/$file"
+ echo '# dummy' > "$dirpart/$file"
+ done
+ done
+}
+ ;;
+
+ esac
+done # for ac_tag
+
+
+as_fn_exit 0
+_ACEOF
+ac_clean_files=$ac_clean_files_save
+
+test $ac_write_fail = 0 ||
+ as_fn_error $? "write failure creating $CONFIG_STATUS" "$LINENO" 5
+
+
+# configure is writing to config.log, and then calls config.status.
+# config.status does its own redirection, appending to config.log.
+# Unfortunately, on DOS this fails, as config.log is still kept open
+# by configure, so config.status won't be able to write to it; its
+# output is simply discarded. So we exec the FD to /dev/null,
+# effectively closing config.log, so it can be properly (re)opened and
+# appended to by config.status. When coming back to configure, we
+# need to make the FD available again.
+if test "$no_create" != yes; then
+ ac_cs_success=:
+ ac_config_status_args=
+ test "$silent" = yes &&
+ ac_config_status_args="$ac_config_status_args --quiet"
+ exec 5>/dev/null
+ $SHELL $CONFIG_STATUS $ac_config_status_args || ac_cs_success=false
+ exec 5>>config.log
+ # Use ||, not &&, to avoid exiting from the if with $? = 1, which
+ # would make configure fail if this is the last instruction.
+ $ac_cs_success || as_fn_exit 1
+fi
+if test -n "$ac_unrecognized_opts" && test "$enable_option_checking" != no; then
+ { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: unrecognized options: $ac_unrecognized_opts" >&5
+$as_echo "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2;}
+fi
+
+
diff --git a/configure.ac b/configure.ac
new file mode 100644
index 0000000..c69acfd
--- /dev/null
+++ b/configure.ac
@@ -0,0 +1,110 @@
+AC_INIT([andi], [0.9.4])
+AM_INIT_AUTOMAKE([-Wall foreign ])
+
+AC_CONFIG_MACRO_DIR([m4])
+
+AC_PROG_CC
+AC_PROG_CXX
+AC_PROG_MAKE_SET
+AC_PROG_CPP
+AC_PROG_RANLIB
+m4_ifdef([AM_PROG_AR], [AM_PROG_AR])
+
+# Make sure, also the C++ programs are compiled with OpenMP
+AC_LANG(C++)
+AC_OPENMP
+
+# Execute all tests using C
+AC_LANG(C)
+
+AC_CHECK_LIB(m, cos)
+AC_OPENMP
+
+# By default try to build with libdivsufsort.
+AC_ARG_WITH([libdivsufsort],
+ AS_HELP_STRING([--without-libdivsufsort], [Build without libdivsufsort and use psufsort instead.]))
+
+AS_IF([test "x$with_libdivsufsort" != "xno"],
+ [
+ AC_CHECK_HEADERS([divsufsort.h],[have_libdivsufsort=yes],[have_libdivsufsort=no])
+ AC_CHECK_LIB(divsufsort, divsufsort, [], [have_libdivsufsort=no])
+ ],
+ [
+ have_libdivsufsort=no
+ # psufsort needs C++11
+ AX_CXX_COMPILE_STDCXX_11([],[mandatory])
+ ]
+)
+
+AS_IF([test "x$have_libdivsufsort" = "xno"],
+ [AS_IF([test "x$with_libdivsufsort" != "xno"],
+ [AC_MSG_ERROR([Configuration for libdivsufsort failed. Either install libdivsufsort, or use our replacement, psufsort, instead.
+ ./configure --without-libdivsufsort
+The latter may result in longer runtimes.])
+ ])
+])
+
+AM_CONDITIONAL([BUILD_WITH_LIBDIVSUFSORT],[test "x${with_libdivsufsort}" != "xno"])
+
+# The unit tests require GLIB2. So by default do not build the test.
+# If enabled, check for glib.
+
+AC_ARG_ENABLE([unit-tests],
+ [AS_HELP_STRING([--enable-unit-tests],[build unit tests @<:@default: no@:>@])],
+ [try_unit_tests=${enableval}],[try_unit_tests=no]
+ )
+
+AM_CONDITIONAL([BUILD_TESTS],[test "x${try_unit_tests}" = xyes])
+
+if test "x${try_unit_tests}" = xyes; then
+
+ have_glib=yes
+ PKG_CHECK_MODULES([GLIB], [glib-2.0], [], [have_glib=no])
+
+ if test "x${have_glib}" = xno; then
+ AC_MSG_ERROR([Missing Glib 2. Either install it or build without unit tests.])
+ fi
+
+ AX_CXX_COMPILE_STDCXX_11([],[mandatory])
+fi
+
+# Check for various headers including those used by libdivsufsort.
+AC_CHECK_HEADERS([limits.h stdlib.h string.h unistd.h stdint.h inttypes.h err.h errno.h fcntl.h])
+
+AC_C_INLINE
+AC_TYPE_SIZE_T
+AC_TYPE_SSIZE_T
+AC_TYPE_INT32_T
+AC_TYPE_UINT8_T
+AC_HEADER_STDBOOL
+
+# Until someone convinces me otherwise, I will deactivate the macros
+# AC_FUNC_MALLOC and AC_FUNC_REALLOC. They only check if `malloc(0)` retuns a
+# non-null pointer. This breaks the build on systems using uClibc, including
+# my laptop.
+# As requesting zero bytes is not useful, and implementation-defined behaviour,
+# I should be avoided in the first place. Thus I really don't need these checks.
+
+AC_CHECK_FUNCS([floor pow sqrt strdup strerror])
+AC_CHECK_FUNCS([strndup])
+AC_CHECK_FUNCS([strchr strrchr strchrnul])
+AC_CHECK_FUNCS([strtoul strtod])
+AC_CHECK_FUNCS([reallocarray])
+
+AM_CONDITIONAL([HAVE_REALLOCARRAY], [test "x$ac_cv_func_reallocarray" = xyes])
+AM_CONDITIONAL([HAVE_STRCHRNUL], [test "x$ac_cv_func_strchrnul" = xyes])
+
+AC_CONFIG_HEADERS([src/config.h:src/config.hin])
+
+AC_CONFIG_FILES([
+ Makefile
+ docs/andi.1
+ docs/Makefile
+ libs/Makefile
+ opt/Makefile
+ opt/psufsort/Makefile
+ src/Makefile
+ test/Makefile
+])
+AC_OUTPUT
+
diff --git a/depcomp b/depcomp
new file mode 100755
index 0000000..4ebd5b3
--- /dev/null
+++ b/depcomp
@@ -0,0 +1,791 @@
+#! /bin/sh
+# depcomp - compile a program generating dependencies as side-effects
+
+scriptversion=2013-05-30.07; # UTC
+
+# Copyright (C) 1999-2013 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program. If not, see <http://www.gnu.org/licenses/>.
+
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+# Originally written by Alexandre Oliva <oliva at dcc.unicamp.br>.
+
+case $1 in
+ '')
+ echo "$0: No command. Try '$0 --help' for more information." 1>&2
+ exit 1;
+ ;;
+ -h | --h*)
+ cat <<\EOF
+Usage: depcomp [--help] [--version] PROGRAM [ARGS]
+
+Run PROGRAMS ARGS to compile a file, generating dependencies
+as side-effects.
+
+Environment variables:
+ depmode Dependency tracking mode.
+ source Source file read by 'PROGRAMS ARGS'.
+ object Object file output by 'PROGRAMS ARGS'.
+ DEPDIR directory where to store dependencies.
+ depfile Dependency file to output.
+ tmpdepfile Temporary file to use when outputting dependencies.
+ libtool Whether libtool is used (yes/no).
+
+Report bugs to <bug-automake at gnu.org>.
+EOF
+ exit $?
+ ;;
+ -v | --v*)
+ echo "depcomp $scriptversion"
+ exit $?
+ ;;
+esac
+
+# Get the directory component of the given path, and save it in the
+# global variables '$dir'. Note that this directory component will
+# be either empty or ending with a '/' character. This is deliberate.
+set_dir_from ()
+{
+ case $1 in
+ */*) dir=`echo "$1" | sed -e 's|/[^/]*$|/|'`;;
+ *) dir=;;
+ esac
+}
+
+# Get the suffix-stripped basename of the given path, and save it the
+# global variable '$base'.
+set_base_from ()
+{
+ base=`echo "$1" | sed -e 's|^.*/||' -e 's/\.[^.]*$//'`
+}
+
+# If no dependency file was actually created by the compiler invocation,
+# we still have to create a dummy depfile, to avoid errors with the
+# Makefile "include basename.Plo" scheme.
+make_dummy_depfile ()
+{
+ echo "#dummy" > "$depfile"
+}
+
+# Factor out some common post-processing of the generated depfile.
+# Requires the auxiliary global variable '$tmpdepfile' to be set.
+aix_post_process_depfile ()
+{
+ # If the compiler actually managed to produce a dependency file,
+ # post-process it.
+ if test -f "$tmpdepfile"; then
+ # Each line is of the form 'foo.o: dependency.h'.
+ # Do two passes, one to just change these to
+ # $object: dependency.h
+ # and one to simply output
+ # dependency.h:
+ # which is needed to avoid the deleted-header problem.
+ { sed -e "s,^.*\.[$lower]*:,$object:," < "$tmpdepfile"
+ sed -e "s,^.*\.[$lower]*:[$tab ]*,," -e 's,$,:,' < "$tmpdepfile"
+ } > "$depfile"
+ rm -f "$tmpdepfile"
+ else
+ make_dummy_depfile
+ fi
+}
+
+# A tabulation character.
+tab=' '
+# A newline character.
+nl='
+'
+# Character ranges might be problematic outside the C locale.
+# These definitions help.
+upper=ABCDEFGHIJKLMNOPQRSTUVWXYZ
+lower=abcdefghijklmnopqrstuvwxyz
+digits=0123456789
+alpha=${upper}${lower}
+
+if test -z "$depmode" || test -z "$source" || test -z "$object"; then
+ echo "depcomp: Variables source, object and depmode must be set" 1>&2
+ exit 1
+fi
+
+# Dependencies for sub/bar.o or sub/bar.obj go into sub/.deps/bar.Po.
+depfile=${depfile-`echo "$object" |
+ sed 's|[^\\/]*$|'${DEPDIR-.deps}'/&|;s|\.\([^.]*\)$|.P\1|;s|Pobj$|Po|'`}
+tmpdepfile=${tmpdepfile-`echo "$depfile" | sed 's/\.\([^.]*\)$/.T\1/'`}
+
+rm -f "$tmpdepfile"
+
+# Avoid interferences from the environment.
+gccflag= dashmflag=
+
+# Some modes work just like other modes, but use different flags. We
+# parameterize here, but still list the modes in the big case below,
+# to make depend.m4 easier to write. Note that we *cannot* use a case
+# here, because this file can only contain one case statement.
+if test "$depmode" = hp; then
+ # HP compiler uses -M and no extra arg.
+ gccflag=-M
+ depmode=gcc
+fi
+
+if test "$depmode" = dashXmstdout; then
+ # This is just like dashmstdout with a different argument.
+ dashmflag=-xM
+ depmode=dashmstdout
+fi
+
+cygpath_u="cygpath -u -f -"
+if test "$depmode" = msvcmsys; then
+ # This is just like msvisualcpp but w/o cygpath translation.
+ # Just convert the backslash-escaped backslashes to single forward
+ # slashes to satisfy depend.m4
+ cygpath_u='sed s,\\\\,/,g'
+ depmode=msvisualcpp
+fi
+
+if test "$depmode" = msvc7msys; then
+ # This is just like msvc7 but w/o cygpath translation.
+ # Just convert the backslash-escaped backslashes to single forward
+ # slashes to satisfy depend.m4
+ cygpath_u='sed s,\\\\,/,g'
+ depmode=msvc7
+fi
+
+if test "$depmode" = xlc; then
+ # IBM C/C++ Compilers xlc/xlC can output gcc-like dependency information.
+ gccflag=-qmakedep=gcc,-MF
+ depmode=gcc
+fi
+
+case "$depmode" in
+gcc3)
+## gcc 3 implements dependency tracking that does exactly what
+## we want. Yay! Note: for some reason libtool 1.4 doesn't like
+## it if -MD -MP comes after the -MF stuff. Hmm.
+## Unfortunately, FreeBSD c89 acceptance of flags depends upon
+## the command line argument order; so add the flags where they
+## appear in depend2.am. Note that the slowdown incurred here
+## affects only configure: in makefiles, %FASTDEP% shortcuts this.
+ for arg
+ do
+ case $arg in
+ -c) set fnord "$@" -MT "$object" -MD -MP -MF "$tmpdepfile" "$arg" ;;
+ *) set fnord "$@" "$arg" ;;
+ esac
+ shift # fnord
+ shift # $arg
+ done
+ "$@"
+ stat=$?
+ if test $stat -ne 0; then
+ rm -f "$tmpdepfile"
+ exit $stat
+ fi
+ mv "$tmpdepfile" "$depfile"
+ ;;
+
+gcc)
+## Note that this doesn't just cater to obsosete pre-3.x GCC compilers.
+## but also to in-use compilers like IMB xlc/xlC and the HP C compiler.
+## (see the conditional assignment to $gccflag above).
+## There are various ways to get dependency output from gcc. Here's
+## why we pick this rather obscure method:
+## - Don't want to use -MD because we'd like the dependencies to end
+## up in a subdir. Having to rename by hand is ugly.
+## (We might end up doing this anyway to support other compilers.)
+## - The DEPENDENCIES_OUTPUT environment variable makes gcc act like
+## -MM, not -M (despite what the docs say). Also, it might not be
+## supported by the other compilers which use the 'gcc' depmode.
+## - Using -M directly means running the compiler twice (even worse
+## than renaming).
+ if test -z "$gccflag"; then
+ gccflag=-MD,
+ fi
+ "$@" -Wp,"$gccflag$tmpdepfile"
+ stat=$?
+ if test $stat -ne 0; then
+ rm -f "$tmpdepfile"
+ exit $stat
+ fi
+ rm -f "$depfile"
+ echo "$object : \\" > "$depfile"
+ # The second -e expression handles DOS-style file names with drive
+ # letters.
+ sed -e 's/^[^:]*: / /' \
+ -e 's/^['$alpha']:\/[^:]*: / /' < "$tmpdepfile" >> "$depfile"
+## This next piece of magic avoids the "deleted header file" problem.
+## The problem is that when a header file which appears in a .P file
+## is deleted, the dependency causes make to die (because there is
+## typically no way to rebuild the header). We avoid this by adding
+## dummy dependencies for each header file. Too bad gcc doesn't do
+## this for us directly.
+## Some versions of gcc put a space before the ':'. On the theory
+## that the space means something, we add a space to the output as
+## well. hp depmode also adds that space, but also prefixes the VPATH
+## to the object. Take care to not repeat it in the output.
+## Some versions of the HPUX 10.20 sed can't process this invocation
+## correctly. Breaking it into two sed invocations is a workaround.
+ tr ' ' "$nl" < "$tmpdepfile" \
+ | sed -e 's/^\\$//' -e '/^$/d' -e "s|.*$object$||" -e '/:$/d' \
+ | sed -e 's/$/ :/' >> "$depfile"
+ rm -f "$tmpdepfile"
+ ;;
+
+hp)
+ # This case exists only to let depend.m4 do its work. It works by
+ # looking at the text of this script. This case will never be run,
+ # since it is checked for above.
+ exit 1
+ ;;
+
+sgi)
+ if test "$libtool" = yes; then
+ "$@" "-Wp,-MDupdate,$tmpdepfile"
+ else
+ "$@" -MDupdate "$tmpdepfile"
+ fi
+ stat=$?
+ if test $stat -ne 0; then
+ rm -f "$tmpdepfile"
+ exit $stat
+ fi
+ rm -f "$depfile"
+
+ if test -f "$tmpdepfile"; then # yes, the sourcefile depend on other files
+ echo "$object : \\" > "$depfile"
+ # Clip off the initial element (the dependent). Don't try to be
+ # clever and replace this with sed code, as IRIX sed won't handle
+ # lines with more than a fixed number of characters (4096 in
+ # IRIX 6.2 sed, 8192 in IRIX 6.5). We also remove comment lines;
+ # the IRIX cc adds comments like '#:fec' to the end of the
+ # dependency line.
+ tr ' ' "$nl" < "$tmpdepfile" \
+ | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' \
+ | tr "$nl" ' ' >> "$depfile"
+ echo >> "$depfile"
+ # The second pass generates a dummy entry for each header file.
+ tr ' ' "$nl" < "$tmpdepfile" \
+ | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' -e 's/$/:/' \
+ >> "$depfile"
+ else
+ make_dummy_depfile
+ fi
+ rm -f "$tmpdepfile"
+ ;;
+
+xlc)
+ # This case exists only to let depend.m4 do its work. It works by
+ # looking at the text of this script. This case will never be run,
+ # since it is checked for above.
+ exit 1
+ ;;
+
+aix)
+ # The C for AIX Compiler uses -M and outputs the dependencies
+ # in a .u file. In older versions, this file always lives in the
+ # current directory. Also, the AIX compiler puts '$object:' at the
+ # start of each line; $object doesn't have directory information.
+ # Version 6 uses the directory in both cases.
+ set_dir_from "$object"
+ set_base_from "$object"
+ if test "$libtool" = yes; then
+ tmpdepfile1=$dir$base.u
+ tmpdepfile2=$base.u
+ tmpdepfile3=$dir.libs/$base.u
+ "$@" -Wc,-M
+ else
+ tmpdepfile1=$dir$base.u
+ tmpdepfile2=$dir$base.u
+ tmpdepfile3=$dir$base.u
+ "$@" -M
+ fi
+ stat=$?
+ if test $stat -ne 0; then
+ rm -f "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
+ exit $stat
+ fi
+
+ for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
+ do
+ test -f "$tmpdepfile" && break
+ done
+ aix_post_process_depfile
+ ;;
+
+tcc)
+ # tcc (Tiny C Compiler) understand '-MD -MF file' since version 0.9.26
+ # FIXME: That version still under development at the moment of writing.
+ # Make that this statement remains true also for stable, released
+ # versions.
+ # It will wrap lines (doesn't matter whether long or short) with a
+ # trailing '\', as in:
+ #
+ # foo.o : \
+ # foo.c \
+ # foo.h \
+ #
+ # It will put a trailing '\' even on the last line, and will use leading
+ # spaces rather than leading tabs (at least since its commit 0394caf7
+ # "Emit spaces for -MD").
+ "$@" -MD -MF "$tmpdepfile"
+ stat=$?
+ if test $stat -ne 0; then
+ rm -f "$tmpdepfile"
+ exit $stat
+ fi
+ rm -f "$depfile"
+ # Each non-empty line is of the form 'foo.o : \' or ' dep.h \'.
+ # We have to change lines of the first kind to '$object: \'.
+ sed -e "s|.*:|$object :|" < "$tmpdepfile" > "$depfile"
+ # And for each line of the second kind, we have to emit a 'dep.h:'
+ # dummy dependency, to avoid the deleted-header problem.
+ sed -n -e 's|^ *\(.*\) *\\$|\1:|p' < "$tmpdepfile" >> "$depfile"
+ rm -f "$tmpdepfile"
+ ;;
+
+## The order of this option in the case statement is important, since the
+## shell code in configure will try each of these formats in the order
+## listed in this file. A plain '-MD' option would be understood by many
+## compilers, so we must ensure this comes after the gcc and icc options.
+pgcc)
+ # Portland's C compiler understands '-MD'.
+ # Will always output deps to 'file.d' where file is the root name of the
+ # source file under compilation, even if file resides in a subdirectory.
+ # The object file name does not affect the name of the '.d' file.
+ # pgcc 10.2 will output
+ # foo.o: sub/foo.c sub/foo.h
+ # and will wrap long lines using '\' :
+ # foo.o: sub/foo.c ... \
+ # sub/foo.h ... \
+ # ...
+ set_dir_from "$object"
+ # Use the source, not the object, to determine the base name, since
+ # that's sadly what pgcc will do too.
+ set_base_from "$source"
+ tmpdepfile=$base.d
+
+ # For projects that build the same source file twice into different object
+ # files, the pgcc approach of using the *source* file root name can cause
+ # problems in parallel builds. Use a locking strategy to avoid stomping on
+ # the same $tmpdepfile.
+ lockdir=$base.d-lock
+ trap "
+ echo '$0: caught signal, cleaning up...' >&2
+ rmdir '$lockdir'
+ exit 1
+ " 1 2 13 15
+ numtries=100
+ i=$numtries
+ while test $i -gt 0; do
+ # mkdir is a portable test-and-set.
+ if mkdir "$lockdir" 2>/dev/null; then
+ # This process acquired the lock.
+ "$@" -MD
+ stat=$?
+ # Release the lock.
+ rmdir "$lockdir"
+ break
+ else
+ # If the lock is being held by a different process, wait
+ # until the winning process is done or we timeout.
+ while test -d "$lockdir" && test $i -gt 0; do
+ sleep 1
+ i=`expr $i - 1`
+ done
+ fi
+ i=`expr $i - 1`
+ done
+ trap - 1 2 13 15
+ if test $i -le 0; then
+ echo "$0: failed to acquire lock after $numtries attempts" >&2
+ echo "$0: check lockdir '$lockdir'" >&2
+ exit 1
+ fi
+
+ if test $stat -ne 0; then
+ rm -f "$tmpdepfile"
+ exit $stat
+ fi
+ rm -f "$depfile"
+ # Each line is of the form `foo.o: dependent.h',
+ # or `foo.o: dep1.h dep2.h \', or ` dep3.h dep4.h \'.
+ # Do two passes, one to just change these to
+ # `$object: dependent.h' and one to simply `dependent.h:'.
+ sed "s,^[^:]*:,$object :," < "$tmpdepfile" > "$depfile"
+ # Some versions of the HPUX 10.20 sed can't process this invocation
+ # correctly. Breaking it into two sed invocations is a workaround.
+ sed 's,^[^:]*: \(.*\)$,\1,;s/^\\$//;/^$/d;/:$/d' < "$tmpdepfile" \
+ | sed -e 's/$/ :/' >> "$depfile"
+ rm -f "$tmpdepfile"
+ ;;
+
+hp2)
+ # The "hp" stanza above does not work with aCC (C++) and HP's ia64
+ # compilers, which have integrated preprocessors. The correct option
+ # to use with these is +Maked; it writes dependencies to a file named
+ # 'foo.d', which lands next to the object file, wherever that
+ # happens to be.
+ # Much of this is similar to the tru64 case; see comments there.
+ set_dir_from "$object"
+ set_base_from "$object"
+ if test "$libtool" = yes; then
+ tmpdepfile1=$dir$base.d
+ tmpdepfile2=$dir.libs/$base.d
+ "$@" -Wc,+Maked
+ else
+ tmpdepfile1=$dir$base.d
+ tmpdepfile2=$dir$base.d
+ "$@" +Maked
+ fi
+ stat=$?
+ if test $stat -ne 0; then
+ rm -f "$tmpdepfile1" "$tmpdepfile2"
+ exit $stat
+ fi
+
+ for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2"
+ do
+ test -f "$tmpdepfile" && break
+ done
+ if test -f "$tmpdepfile"; then
+ sed -e "s,^.*\.[$lower]*:,$object:," "$tmpdepfile" > "$depfile"
+ # Add 'dependent.h:' lines.
+ sed -ne '2,${
+ s/^ *//
+ s/ \\*$//
+ s/$/:/
+ p
+ }' "$tmpdepfile" >> "$depfile"
+ else
+ make_dummy_depfile
+ fi
+ rm -f "$tmpdepfile" "$tmpdepfile2"
+ ;;
+
+tru64)
+ # The Tru64 compiler uses -MD to generate dependencies as a side
+ # effect. 'cc -MD -o foo.o ...' puts the dependencies into 'foo.o.d'.
+ # At least on Alpha/Redhat 6.1, Compaq CCC V6.2-504 seems to put
+ # dependencies in 'foo.d' instead, so we check for that too.
+ # Subdirectories are respected.
+ set_dir_from "$object"
+ set_base_from "$object"
+
+ if test "$libtool" = yes; then
+ # Libtool generates 2 separate objects for the 2 libraries. These
+ # two compilations output dependencies in $dir.libs/$base.o.d and
+ # in $dir$base.o.d. We have to check for both files, because
+ # one of the two compilations can be disabled. We should prefer
+ # $dir$base.o.d over $dir.libs/$base.o.d because the latter is
+ # automatically cleaned when .libs/ is deleted, while ignoring
+ # the former would cause a distcleancheck panic.
+ tmpdepfile1=$dir$base.o.d # libtool 1.5
+ tmpdepfile2=$dir.libs/$base.o.d # Likewise.
+ tmpdepfile3=$dir.libs/$base.d # Compaq CCC V6.2-504
+ "$@" -Wc,-MD
+ else
+ tmpdepfile1=$dir$base.d
+ tmpdepfile2=$dir$base.d
+ tmpdepfile3=$dir$base.d
+ "$@" -MD
+ fi
+
+ stat=$?
+ if test $stat -ne 0; then
+ rm -f "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
+ exit $stat
+ fi
+
+ for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
+ do
+ test -f "$tmpdepfile" && break
+ done
+ # Same post-processing that is required for AIX mode.
+ aix_post_process_depfile
+ ;;
+
+msvc7)
+ if test "$libtool" = yes; then
+ showIncludes=-Wc,-showIncludes
+ else
+ showIncludes=-showIncludes
+ fi
+ "$@" $showIncludes > "$tmpdepfile"
+ stat=$?
+ grep -v '^Note: including file: ' "$tmpdepfile"
+ if test $stat -ne 0; then
+ rm -f "$tmpdepfile"
+ exit $stat
+ fi
+ rm -f "$depfile"
+ echo "$object : \\" > "$depfile"
+ # The first sed program below extracts the file names and escapes
+ # backslashes for cygpath. The second sed program outputs the file
+ # name when reading, but also accumulates all include files in the
+ # hold buffer in order to output them again at the end. This only
+ # works with sed implementations that can handle large buffers.
+ sed < "$tmpdepfile" -n '
+/^Note: including file: *\(.*\)/ {
+ s//\1/
+ s/\\/\\\\/g
+ p
+}' | $cygpath_u | sort -u | sed -n '
+s/ /\\ /g
+s/\(.*\)/'"$tab"'\1 \\/p
+s/.\(.*\) \\/\1:/
+H
+$ {
+ s/.*/'"$tab"'/
+ G
+ p
+}' >> "$depfile"
+ echo >> "$depfile" # make sure the fragment doesn't end with a backslash
+ rm -f "$tmpdepfile"
+ ;;
+
+msvc7msys)
+ # This case exists only to let depend.m4 do its work. It works by
+ # looking at the text of this script. This case will never be run,
+ # since it is checked for above.
+ exit 1
+ ;;
+
+#nosideeffect)
+ # This comment above is used by automake to tell side-effect
+ # dependency tracking mechanisms from slower ones.
+
+dashmstdout)
+ # Important note: in order to support this mode, a compiler *must*
+ # always write the preprocessed file to stdout, regardless of -o.
+ "$@" || exit $?
+
+ # Remove the call to Libtool.
+ if test "$libtool" = yes; then
+ while test "X$1" != 'X--mode=compile'; do
+ shift
+ done
+ shift
+ fi
+
+ # Remove '-o $object'.
+ IFS=" "
+ for arg
+ do
+ case $arg in
+ -o)
+ shift
+ ;;
+ $object)
+ shift
+ ;;
+ *)
+ set fnord "$@" "$arg"
+ shift # fnord
+ shift # $arg
+ ;;
+ esac
+ done
+
+ test -z "$dashmflag" && dashmflag=-M
+ # Require at least two characters before searching for ':'
+ # in the target name. This is to cope with DOS-style filenames:
+ # a dependency such as 'c:/foo/bar' could be seen as target 'c' otherwise.
+ "$@" $dashmflag |
+ sed "s|^[$tab ]*[^:$tab ][^:][^:]*:[$tab ]*|$object: |" > "$tmpdepfile"
+ rm -f "$depfile"
+ cat < "$tmpdepfile" > "$depfile"
+ # Some versions of the HPUX 10.20 sed can't process this sed invocation
+ # correctly. Breaking it into two sed invocations is a workaround.
+ tr ' ' "$nl" < "$tmpdepfile" \
+ | sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' \
+ | sed -e 's/$/ :/' >> "$depfile"
+ rm -f "$tmpdepfile"
+ ;;
+
+dashXmstdout)
+ # This case only exists to satisfy depend.m4. It is never actually
+ # run, as this mode is specially recognized in the preamble.
+ exit 1
+ ;;
+
+makedepend)
+ "$@" || exit $?
+ # Remove any Libtool call
+ if test "$libtool" = yes; then
+ while test "X$1" != 'X--mode=compile'; do
+ shift
+ done
+ shift
+ fi
+ # X makedepend
+ shift
+ cleared=no eat=no
+ for arg
+ do
+ case $cleared in
+ no)
+ set ""; shift
+ cleared=yes ;;
+ esac
+ if test $eat = yes; then
+ eat=no
+ continue
+ fi
+ case "$arg" in
+ -D*|-I*)
+ set fnord "$@" "$arg"; shift ;;
+ # Strip any option that makedepend may not understand. Remove
+ # the object too, otherwise makedepend will parse it as a source file.
+ -arch)
+ eat=yes ;;
+ -*|$object)
+ ;;
+ *)
+ set fnord "$@" "$arg"; shift ;;
+ esac
+ done
+ obj_suffix=`echo "$object" | sed 's/^.*\././'`
+ touch "$tmpdepfile"
+ ${MAKEDEPEND-makedepend} -o"$obj_suffix" -f"$tmpdepfile" "$@"
+ rm -f "$depfile"
+ # makedepend may prepend the VPATH from the source file name to the object.
+ # No need to regex-escape $object, excess matching of '.' is harmless.
+ sed "s|^.*\($object *:\)|\1|" "$tmpdepfile" > "$depfile"
+ # Some versions of the HPUX 10.20 sed can't process the last invocation
+ # correctly. Breaking it into two sed invocations is a workaround.
+ sed '1,2d' "$tmpdepfile" \
+ | tr ' ' "$nl" \
+ | sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' \
+ | sed -e 's/$/ :/' >> "$depfile"
+ rm -f "$tmpdepfile" "$tmpdepfile".bak
+ ;;
+
+cpp)
+ # Important note: in order to support this mode, a compiler *must*
+ # always write the preprocessed file to stdout.
+ "$@" || exit $?
+
+ # Remove the call to Libtool.
+ if test "$libtool" = yes; then
+ while test "X$1" != 'X--mode=compile'; do
+ shift
+ done
+ shift
+ fi
+
+ # Remove '-o $object'.
+ IFS=" "
+ for arg
+ do
+ case $arg in
+ -o)
+ shift
+ ;;
+ $object)
+ shift
+ ;;
+ *)
+ set fnord "$@" "$arg"
+ shift # fnord
+ shift # $arg
+ ;;
+ esac
+ done
+
+ "$@" -E \
+ | sed -n -e '/^# [0-9][0-9]* "\([^"]*\)".*/ s:: \1 \\:p' \
+ -e '/^#line [0-9][0-9]* "\([^"]*\)".*/ s:: \1 \\:p' \
+ | sed '$ s: \\$::' > "$tmpdepfile"
+ rm -f "$depfile"
+ echo "$object : \\" > "$depfile"
+ cat < "$tmpdepfile" >> "$depfile"
+ sed < "$tmpdepfile" '/^$/d;s/^ //;s/ \\$//;s/$/ :/' >> "$depfile"
+ rm -f "$tmpdepfile"
+ ;;
+
+msvisualcpp)
+ # Important note: in order to support this mode, a compiler *must*
+ # always write the preprocessed file to stdout.
+ "$@" || exit $?
+
+ # Remove the call to Libtool.
+ if test "$libtool" = yes; then
+ while test "X$1" != 'X--mode=compile'; do
+ shift
+ done
+ shift
+ fi
+
+ IFS=" "
+ for arg
+ do
+ case "$arg" in
+ -o)
+ shift
+ ;;
+ $object)
+ shift
+ ;;
+ "-Gm"|"/Gm"|"-Gi"|"/Gi"|"-ZI"|"/ZI")
+ set fnord "$@"
+ shift
+ shift
+ ;;
+ *)
+ set fnord "$@" "$arg"
+ shift
+ shift
+ ;;
+ esac
+ done
+ "$@" -E 2>/dev/null |
+ sed -n '/^#line [0-9][0-9]* "\([^"]*\)"/ s::\1:p' | $cygpath_u | sort -u > "$tmpdepfile"
+ rm -f "$depfile"
+ echo "$object : \\" > "$depfile"
+ sed < "$tmpdepfile" -n -e 's% %\\ %g' -e '/^\(.*\)$/ s::'"$tab"'\1 \\:p' >> "$depfile"
+ echo "$tab" >> "$depfile"
+ sed < "$tmpdepfile" -n -e 's% %\\ %g' -e '/^\(.*\)$/ s::\1\::p' >> "$depfile"
+ rm -f "$tmpdepfile"
+ ;;
+
+msvcmsys)
+ # This case exists only to let depend.m4 do its work. It works by
+ # looking at the text of this script. This case will never be run,
+ # since it is checked for above.
+ exit 1
+ ;;
+
+none)
+ exec "$@"
+ ;;
+
+*)
+ echo "Unknown depmode $depmode" 1>&2
+ exit 1
+ ;;
+esac
+
+exit 0
+
+# Local Variables:
+# mode: shell-script
+# sh-indentation: 2
+# eval: (add-hook 'write-file-hooks 'time-stamp)
+# time-stamp-start: "scriptversion="
+# time-stamp-format: "%:y-%02m-%02d.%02H"
+# time-stamp-time-zone: "UTC"
+# time-stamp-end: "; # UTC"
+# End:
diff --git a/docs/Doxyfile b/docs/Doxyfile
new file mode 100644
index 0000000..0020c5a
--- /dev/null
+++ b/docs/Doxyfile
@@ -0,0 +1,1781 @@
+# Doxyfile 1.7.6.1
+
+# This file describes the settings to be used by the documentation system
+# doxygen (www.doxygen.org) for a project.
+#
+# All text after a hash (#) is considered a comment and will be ignored.
+# The format is:
+# TAG = value [value, ...]
+# For lists items can also be appended using:
+# TAG += value [value, ...]
+# Values that contain spaces should be placed between quotes (" ").
+
+#---------------------------------------------------------------------------
+# Project related configuration options
+#---------------------------------------------------------------------------
+
+# This tag specifies the encoding used for all characters in the config file
+# that follow. The default is UTF-8 which is also the encoding used for all
+# text before the first occurrence of this tag. Doxygen uses libiconv (or the
+# iconv built into libc) for the transcoding. See
+# http://www.gnu.org/software/libiconv for the list of possible encodings.
+
+DOXYFILE_ENCODING = UTF-8
+
+# The PROJECT_NAME tag is a single word (or sequence of words) that should
+# identify the project. Note that if you do not use Doxywizard you need
+# to put quotes around the project name if it contains spaces.
+
+PROJECT_NAME = "andi"
+
+# The PROJECT_NUMBER tag can be used to enter a project or revision number.
+# This could be handy for archiving the generated documentation or
+# if some version control system is used.
+
+PROJECT_NUMBER =
+
+# Using the PROJECT_BRIEF tag one can provide an optional one line description
+# for a project that appears at the top of each page and should give viewer
+# a quick idea about the purpose of the project. Keep the description short.
+
+PROJECT_BRIEF =
+
+# With the PROJECT_LOGO tag one can specify an logo or icon that is
+# included in the documentation. The maximum height of the logo should not
+# exceed 55 pixels and the maximum width should not exceed 200 pixels.
+# Doxygen will copy the logo to the output directory.
+
+PROJECT_LOGO =
+
+# The OUTPUT_DIRECTORY tag is used to specify the (relative or absolute)
+# base path where the generated documentation will be put.
+# If a relative path is entered, it will be relative to the location
+# where doxygen was started. If left blank the current directory will be used.
+
+OUTPUT_DIRECTORY = .
+
+# If the CREATE_SUBDIRS tag is set to YES, then doxygen will create
+# 4096 sub-directories (in 2 levels) under the output directory of each output
+# format and will distribute the generated files over these directories.
+# Enabling this option can be useful when feeding doxygen a huge amount of
+# source files, where putting all generated files in the same directory would
+# otherwise cause performance problems for the file system.
+
+CREATE_SUBDIRS = NO
+
+# The OUTPUT_LANGUAGE tag is used to specify the language in which all
+# documentation generated by doxygen is written. Doxygen will use this
+# information to generate all constant output in the proper language.
+# The default language is English, other supported languages are:
+# Afrikaans, Arabic, Brazilian, Catalan, Chinese, Chinese-Traditional,
+# Croatian, Czech, Danish, Dutch, Esperanto, Farsi, Finnish, French, German,
+# Greek, Hungarian, Italian, Japanese, Japanese-en (Japanese with English
+# messages), Korean, Korean-en, Lithuanian, Norwegian, Macedonian, Persian,
+# Polish, Portuguese, Romanian, Russian, Serbian, Serbian-Cyrillic, Slovak,
+# Slovene, Spanish, Swedish, Ukrainian, and Vietnamese.
+
+OUTPUT_LANGUAGE = English
+
+# If the BRIEF_MEMBER_DESC tag is set to YES (the default) Doxygen will
+# include brief member descriptions after the members that are listed in
+# the file and class documentation (similar to JavaDoc).
+# Set to NO to disable this.
+
+BRIEF_MEMBER_DESC = YES
+
+# If the REPEAT_BRIEF tag is set to YES (the default) Doxygen will prepend
+# the brief description of a member or function before the detailed description.
+# Note: if both HIDE_UNDOC_MEMBERS and BRIEF_MEMBER_DESC are set to NO, the
+# brief descriptions will be completely suppressed.
+
+REPEAT_BRIEF = YES
+
+# This tag implements a quasi-intelligent brief description abbreviator
+# that is used to form the text in various listings. Each string
+# in this list, if found as the leading text of the brief description, will be
+# stripped from the text and the result after processing the whole list, is
+# used as the annotated text. Otherwise, the brief description is used as-is.
+# If left blank, the following values are used ("$name" is automatically
+# replaced with the name of the entity): "The $name class" "The $name widget"
+# "The $name file" "is" "provides" "specifies" "contains"
+# "represents" "a" "an" "the"
+
+ABBREVIATE_BRIEF =
+
+# If the ALWAYS_DETAILED_SEC and REPEAT_BRIEF tags are both set to YES then
+# Doxygen will generate a detailed section even if there is only a brief
+# description.
+
+ALWAYS_DETAILED_SEC = NO
+
+# If the INLINE_INHERITED_MEMB tag is set to YES, doxygen will show all
+# inherited members of a class in the documentation of that class as if those
+# members were ordinary class members. Constructors, destructors and assignment
+# operators of the base classes will not be shown.
+
+INLINE_INHERITED_MEMB = NO
+
+# If the FULL_PATH_NAMES tag is set to YES then Doxygen will prepend the full
+# path before files name in the file list and in the header files. If set
+# to NO the shortest path that makes the file name unique will be used.
+
+FULL_PATH_NAMES = YES
+
+# If the FULL_PATH_NAMES tag is set to YES then the STRIP_FROM_PATH tag
+# can be used to strip a user-defined part of the path. Stripping is
+# only done if one of the specified strings matches the left-hand part of
+# the path. The tag can be used to show relative paths in the file list.
+# If left blank the directory from which doxygen is run is used as the
+# path to strip.
+
+STRIP_FROM_PATH =
+
+# The STRIP_FROM_INC_PATH tag can be used to strip a user-defined part of
+# the path mentioned in the documentation of a class, which tells
+# the reader which header file to include in order to use a class.
+# If left blank only the name of the header file containing the class
+# definition is used. Otherwise one should specify the include paths that
+# are normally passed to the compiler using the -I flag.
+
+STRIP_FROM_INC_PATH =
+
+# If the SHORT_NAMES tag is set to YES, doxygen will generate much shorter
+# (but less readable) file names. This can be useful if your file system
+# doesn't support long names like on DOS, Mac, or CD-ROM.
+
+SHORT_NAMES = NO
+
+# If the JAVADOC_AUTOBRIEF tag is set to YES then Doxygen
+# will interpret the first line (until the first dot) of a JavaDoc-style
+# comment as the brief description. If set to NO, the JavaDoc
+# comments will behave just like regular Qt-style comments
+# (thus requiring an explicit @brief command for a brief description.)
+
+JAVADOC_AUTOBRIEF = NO
+
+# If the QT_AUTOBRIEF tag is set to YES then Doxygen will
+# interpret the first line (until the first dot) of a Qt-style
+# comment as the brief description. If set to NO, the comments
+# will behave just like regular Qt-style comments (thus requiring
+# an explicit \brief command for a brief description.)
+
+QT_AUTOBRIEF = NO
+
+# The MULTILINE_CPP_IS_BRIEF tag can be set to YES to make Doxygen
+# treat a multi-line C++ special comment block (i.e. a block of //! or ///
+# comments) as a brief description. This used to be the default behaviour.
+# The new default is to treat a multi-line C++ comment block as a detailed
+# description. Set this tag to YES if you prefer the old behaviour instead.
+
+MULTILINE_CPP_IS_BRIEF = NO
+
+# If the INHERIT_DOCS tag is set to YES (the default) then an undocumented
+# member inherits the documentation from any documented member that it
+# re-implements.
+
+INHERIT_DOCS = YES
+
+# If the SEPARATE_MEMBER_PAGES tag is set to YES, then doxygen will produce
+# a new page for each member. If set to NO, the documentation of a member will
+# be part of the file/class/namespace that contains it.
+
+SEPARATE_MEMBER_PAGES = NO
+
+# The TAB_SIZE tag can be used to set the number of spaces in a tab.
+# Doxygen uses this value to replace tabs by spaces in code fragments.
+
+TAB_SIZE = 8
+
+# This tag can be used to specify a number of aliases that acts
+# as commands in the documentation. An alias has the form "name=value".
+# For example adding "sideeffect=\par Side Effects:\n" will allow you to
+# put the command \sideeffect (or @sideeffect) in the documentation, which
+# will result in a user-defined paragraph with heading "Side Effects:".
+# You can put \n's in the value part of an alias to insert newlines.
+
+ALIASES =
+
+# This tag can be used to specify a number of word-keyword mappings (TCL only).
+# A mapping has the form "name=value". For example adding
+# "class=itcl::class" will allow you to use the command class in the
+# itcl::class meaning.
+
+TCL_SUBST =
+
+# Set the OPTIMIZE_OUTPUT_FOR_C tag to YES if your project consists of C
+# sources only. Doxygen will then generate output that is more tailored for C.
+# For instance, some of the names that are used will be different. The list
+# of all members will be omitted, etc.
+
+OPTIMIZE_OUTPUT_FOR_C = YES
+
+# Set the OPTIMIZE_OUTPUT_JAVA tag to YES if your project consists of Java
+# sources only. Doxygen will then generate output that is more tailored for
+# Java. For instance, namespaces will be presented as packages, qualified
+# scopes will look different, etc.
+
+OPTIMIZE_OUTPUT_JAVA = NO
+
+# Set the OPTIMIZE_FOR_FORTRAN tag to YES if your project consists of Fortran
+# sources only. Doxygen will then generate output that is more tailored for
+# Fortran.
+
+OPTIMIZE_FOR_FORTRAN = NO
+
+# Set the OPTIMIZE_OUTPUT_VHDL tag to YES if your project consists of VHDL
+# sources. Doxygen will then generate output that is tailored for
+# VHDL.
+
+OPTIMIZE_OUTPUT_VHDL = NO
+
+# Doxygen selects the parser to use depending on the extension of the files it
+# parses. With this tag you can assign which parser to use for a given extension.
+# Doxygen has a built-in mapping, but you can override or extend it using this
+# tag. The format is ext=language, where ext is a file extension, and language
+# is one of the parsers supported by doxygen: IDL, Java, Javascript, CSharp, C,
+# C++, D, PHP, Objective-C, Python, Fortran, VHDL, C, C++. For instance to make
+# doxygen treat .inc files as Fortran files (default is PHP), and .f files as C
+# (default is Fortran), use: inc=Fortran f=C. Note that for custom extensions
+# you also need to set FILE_PATTERNS otherwise the files are not read by doxygen.
+
+EXTENSION_MAPPING =
+
+# If you use STL classes (i.e. std::string, std::vector, etc.) but do not want
+# to include (a tag file for) the STL sources as input, then you should
+# set this tag to YES in order to let doxygen match functions declarations and
+# definitions whose arguments contain STL classes (e.g. func(std::string); v.s.
+# func(std::string) {}). This also makes the inheritance and collaboration
+# diagrams that involve STL classes more complete and accurate.
+
+BUILTIN_STL_SUPPORT = NO
+
+# If you use Microsoft's C++/CLI language, you should set this option to YES to
+# enable parsing support.
+
+CPP_CLI_SUPPORT = NO
+
+# Set the SIP_SUPPORT tag to YES if your project consists of sip sources only.
+# Doxygen will parse them like normal C++ but will assume all classes use public
+# instead of private inheritance when no explicit protection keyword is present.
+
+SIP_SUPPORT = NO
+
+# For Microsoft's IDL there are propget and propput attributes to indicate getter
+# and setter methods for a property. Setting this option to YES (the default)
+# will make doxygen replace the get and set methods by a property in the
+# documentation. This will only work if the methods are indeed getting or
+# setting a simple type. If this is not the case, or you want to show the
+# methods anyway, you should set this option to NO.
+
+IDL_PROPERTY_SUPPORT = YES
+
+# If member grouping is used in the documentation and the DISTRIBUTE_GROUP_DOC
+# tag is set to YES, then doxygen will reuse the documentation of the first
+# member in the group (if any) for the other members of the group. By default
+# all members of a group must be documented explicitly.
+
+DISTRIBUTE_GROUP_DOC = NO
+
+# Set the SUBGROUPING tag to YES (the default) to allow class member groups of
+# the same type (for instance a group of public functions) to be put as a
+# subgroup of that type (e.g. under the Public Functions section). Set it to
+# NO to prevent subgrouping. Alternatively, this can be done per class using
+# the \nosubgrouping command.
+
+SUBGROUPING = YES
+
+# When the INLINE_GROUPED_CLASSES tag is set to YES, classes, structs and
+# unions are shown inside the group in which they are included (e.g. using
+# @ingroup) instead of on a separate page (for HTML and Man pages) or
+# section (for LaTeX and RTF).
+
+INLINE_GROUPED_CLASSES = NO
+
+# When the INLINE_SIMPLE_STRUCTS tag is set to YES, structs, classes, and
+# unions with only public data fields will be shown inline in the documentation
+# of the scope in which they are defined (i.e. file, namespace, or group
+# documentation), provided this scope is documented. If set to NO (the default),
+# structs, classes, and unions are shown on a separate page (for HTML and Man
+# pages) or section (for LaTeX and RTF).
+
+INLINE_SIMPLE_STRUCTS = NO
+
+# When TYPEDEF_HIDES_STRUCT is enabled, a typedef of a struct, union, or enum
+# is documented as struct, union, or enum with the name of the typedef. So
+# typedef struct TypeS {} TypeT, will appear in the documentation as a struct
+# with name TypeT. When disabled the typedef will appear as a member of a file,
+# namespace, or class. And the struct will be named TypeS. This can typically
+# be useful for C code in case the coding convention dictates that all compound
+# types are typedef'ed and only the typedef is referenced, never the tag name.
+
+TYPEDEF_HIDES_STRUCT = NO
+
+# The SYMBOL_CACHE_SIZE determines the size of the internal cache use to
+# determine which symbols to keep in memory and which to flush to disk.
+# When the cache is full, less often used symbols will be written to disk.
+# For small to medium size projects (<1000 input files) the default value is
+# probably good enough. For larger projects a too small cache size can cause
+# doxygen to be busy swapping symbols to and from disk most of the time
+# causing a significant performance penalty.
+# If the system has enough physical memory increasing the cache will improve the
+# performance by keeping more symbols in memory. Note that the value works on
+# a logarithmic scale so increasing the size by one will roughly double the
+# memory usage. The cache size is given by this formula:
+# 2^(16+SYMBOL_CACHE_SIZE). The valid range is 0..9, the default is 0,
+# corresponding to a cache size of 2^16 = 65536 symbols.
+
+SYMBOL_CACHE_SIZE = 0
+
+# Similar to the SYMBOL_CACHE_SIZE the size of the symbol lookup cache can be
+# set using LOOKUP_CACHE_SIZE. This cache is used to resolve symbols given
+# their name and scope. Since this can be an expensive process and often the
+# same symbol appear multiple times in the code, doxygen keeps a cache of
+# pre-resolved symbols. If the cache is too small doxygen will become slower.
+# If the cache is too large, memory is wasted. The cache size is given by this
+# formula: 2^(16+LOOKUP_CACHE_SIZE). The valid range is 0..9, the default is 0,
+# corresponding to a cache size of 2^16 = 65536 symbols.
+
+LOOKUP_CACHE_SIZE = 0
+
+#---------------------------------------------------------------------------
+# Build related configuration options
+#---------------------------------------------------------------------------
+
+# If the EXTRACT_ALL tag is set to YES doxygen will assume all entities in
+# documentation are documented, even if no documentation was available.
+# Private class members and static file members will be hidden unless
+# the EXTRACT_PRIVATE and EXTRACT_STATIC tags are set to YES
+
+EXTRACT_ALL = YES
+
+# If the EXTRACT_PRIVATE tag is set to YES all private members of a class
+# will be included in the documentation.
+
+EXTRACT_PRIVATE = NO
+
+# If the EXTRACT_STATIC tag is set to YES all static members of a file
+# will be included in the documentation.
+
+EXTRACT_STATIC = NO
+
+# If the EXTRACT_LOCAL_CLASSES tag is set to YES classes (and structs)
+# defined locally in source files will be included in the documentation.
+# If set to NO only classes defined in header files are included.
+
+EXTRACT_LOCAL_CLASSES = YES
+
+# This flag is only useful for Objective-C code. When set to YES local
+# methods, which are defined in the implementation section but not in
+# the interface are included in the documentation.
+# If set to NO (the default) only methods in the interface are included.
+
+EXTRACT_LOCAL_METHODS = NO
+
+# If this flag is set to YES, the members of anonymous namespaces will be
+# extracted and appear in the documentation as a namespace called
+# 'anonymous_namespace{file}', where file will be replaced with the base
+# name of the file that contains the anonymous namespace. By default
+# anonymous namespaces are hidden.
+
+EXTRACT_ANON_NSPACES = NO
+
+# If the HIDE_UNDOC_MEMBERS tag is set to YES, Doxygen will hide all
+# undocumented members of documented classes, files or namespaces.
+# If set to NO (the default) these members will be included in the
+# various overviews, but no documentation section is generated.
+# This option has no effect if EXTRACT_ALL is enabled.
+
+HIDE_UNDOC_MEMBERS = NO
+
+# If the HIDE_UNDOC_CLASSES tag is set to YES, Doxygen will hide all
+# undocumented classes that are normally visible in the class hierarchy.
+# If set to NO (the default) these classes will be included in the various
+# overviews. This option has no effect if EXTRACT_ALL is enabled.
+
+HIDE_UNDOC_CLASSES = NO
+
+# If the HIDE_FRIEND_COMPOUNDS tag is set to YES, Doxygen will hide all
+# friend (class|struct|union) declarations.
+# If set to NO (the default) these declarations will be included in the
+# documentation.
+
+HIDE_FRIEND_COMPOUNDS = NO
+
+# If the HIDE_IN_BODY_DOCS tag is set to YES, Doxygen will hide any
+# documentation blocks found inside the body of a function.
+# If set to NO (the default) these blocks will be appended to the
+# function's detailed documentation block.
+
+HIDE_IN_BODY_DOCS = NO
+
+# The INTERNAL_DOCS tag determines if documentation
+# that is typed after a \internal command is included. If the tag is set
+# to NO (the default) then the documentation will be excluded.
+# Set it to YES to include the internal documentation.
+
+INTERNAL_DOCS = NO
+
+# If the CASE_SENSE_NAMES tag is set to NO then Doxygen will only generate
+# file names in lower-case letters. If set to YES upper-case letters are also
+# allowed. This is useful if you have classes or files whose names only differ
+# in case and if your file system supports case sensitive file names. Windows
+# and Mac users are advised to set this option to NO.
+
+CASE_SENSE_NAMES = YES
+
+# If the HIDE_SCOPE_NAMES tag is set to NO (the default) then Doxygen
+# will show members with their full class and namespace scopes in the
+# documentation. If set to YES the scope will be hidden.
+
+HIDE_SCOPE_NAMES = NO
+
+# If the SHOW_INCLUDE_FILES tag is set to YES (the default) then Doxygen
+# will put a list of the files that are included by a file in the documentation
+# of that file.
+
+SHOW_INCLUDE_FILES = YES
+
+# If the FORCE_LOCAL_INCLUDES tag is set to YES then Doxygen
+# will list include files with double quotes in the documentation
+# rather than with sharp brackets.
+
+FORCE_LOCAL_INCLUDES = NO
+
+# If the INLINE_INFO tag is set to YES (the default) then a tag [inline]
+# is inserted in the documentation for inline members.
+
+INLINE_INFO = YES
+
+# If the SORT_MEMBER_DOCS tag is set to YES (the default) then doxygen
+# will sort the (detailed) documentation of file and class members
+# alphabetically by member name. If set to NO the members will appear in
+# declaration order.
+
+SORT_MEMBER_DOCS = YES
+
+# If the SORT_BRIEF_DOCS tag is set to YES then doxygen will sort the
+# brief documentation of file, namespace and class members alphabetically
+# by member name. If set to NO (the default) the members will appear in
+# declaration order.
+
+SORT_BRIEF_DOCS = NO
+
+# If the SORT_MEMBERS_CTORS_1ST tag is set to YES then doxygen
+# will sort the (brief and detailed) documentation of class members so that
+# constructors and destructors are listed first. If set to NO (the default)
+# the constructors will appear in the respective orders defined by
+# SORT_MEMBER_DOCS and SORT_BRIEF_DOCS.
+# This tag will be ignored for brief docs if SORT_BRIEF_DOCS is set to NO
+# and ignored for detailed docs if SORT_MEMBER_DOCS is set to NO.
+
+SORT_MEMBERS_CTORS_1ST = NO
+
+# If the SORT_GROUP_NAMES tag is set to YES then doxygen will sort the
+# hierarchy of group names into alphabetical order. If set to NO (the default)
+# the group names will appear in their defined order.
+
+SORT_GROUP_NAMES = NO
+
+# If the SORT_BY_SCOPE_NAME tag is set to YES, the class list will be
+# sorted by fully-qualified names, including namespaces. If set to
+# NO (the default), the class list will be sorted only by class name,
+# not including the namespace part.
+# Note: This option is not very useful if HIDE_SCOPE_NAMES is set to YES.
+# Note: This option applies only to the class list, not to the
+# alphabetical list.
+
+SORT_BY_SCOPE_NAME = NO
+
+# If the STRICT_PROTO_MATCHING option is enabled and doxygen fails to
+# do proper type resolution of all parameters of a function it will reject a
+# match between the prototype and the implementation of a member function even
+# if there is only one candidate or it is obvious which candidate to choose
+# by doing a simple string match. By disabling STRICT_PROTO_MATCHING doxygen
+# will still accept a match between prototype and implementation in such cases.
+
+STRICT_PROTO_MATCHING = NO
+
+# The GENERATE_TODOLIST tag can be used to enable (YES) or
+# disable (NO) the todo list. This list is created by putting \todo
+# commands in the documentation.
+
+GENERATE_TODOLIST = YES
+
+# The GENERATE_TESTLIST tag can be used to enable (YES) or
+# disable (NO) the test list. This list is created by putting \test
+# commands in the documentation.
+
+GENERATE_TESTLIST = YES
+
+# The GENERATE_BUGLIST tag can be used to enable (YES) or
+# disable (NO) the bug list. This list is created by putting \bug
+# commands in the documentation.
+
+GENERATE_BUGLIST = YES
+
+# The GENERATE_DEPRECATEDLIST tag can be used to enable (YES) or
+# disable (NO) the deprecated list. This list is created by putting
+# \deprecated commands in the documentation.
+
+GENERATE_DEPRECATEDLIST= YES
+
+# The ENABLED_SECTIONS tag can be used to enable conditional
+# documentation sections, marked by \if sectionname ... \endif.
+
+ENABLED_SECTIONS =
+
+# The MAX_INITIALIZER_LINES tag determines the maximum number of lines
+# the initial value of a variable or macro consists of for it to appear in
+# the documentation. If the initializer consists of more lines than specified
+# here it will be hidden. Use a value of 0 to hide initializers completely.
+# The appearance of the initializer of individual variables and macros in the
+# documentation can be controlled using \showinitializer or \hideinitializer
+# command in the documentation regardless of this setting.
+
+MAX_INITIALIZER_LINES = 30
+
+# Set the SHOW_USED_FILES tag to NO to disable the list of files generated
+# at the bottom of the documentation of classes and structs. If set to YES the
+# list will mention the files that were used to generate the documentation.
+
+SHOW_USED_FILES = YES
+
+# If the sources in your project are distributed over multiple directories
+# then setting the SHOW_DIRECTORIES tag to YES will show the directory hierarchy
+# in the documentation. The default is NO.
+
+SHOW_DIRECTORIES = NO
+
+# Set the SHOW_FILES tag to NO to disable the generation of the Files page.
+# This will remove the Files entry from the Quick Index and from the
+# Folder Tree View (if specified). The default is YES.
+
+SHOW_FILES = YES
+
+# Set the SHOW_NAMESPACES tag to NO to disable the generation of the
+# Namespaces page.
+# This will remove the Namespaces entry from the Quick Index
+# and from the Folder Tree View (if specified). The default is YES.
+
+SHOW_NAMESPACES = YES
+
+# The FILE_VERSION_FILTER tag can be used to specify a program or script that
+# doxygen should invoke to get the current version for each file (typically from
+# the version control system). Doxygen will invoke the program by executing (via
+# popen()) the command <command> <input-file>, where <command> is the value of
+# the FILE_VERSION_FILTER tag, and <input-file> is the name of an input file
+# provided by doxygen. Whatever the program writes to standard output
+# is used as the file version. See the manual for examples.
+
+FILE_VERSION_FILTER =
+
+# The LAYOUT_FILE tag can be used to specify a layout file which will be parsed
+# by doxygen. The layout file controls the global structure of the generated
+# output files in an output format independent way. The create the layout file
+# that represents doxygen's defaults, run doxygen with the -l option.
+# You can optionally specify a file name after the option, if omitted
+# DoxygenLayout.xml will be used as the name of the layout file.
+
+LAYOUT_FILE =
+
+# The CITE_BIB_FILES tag can be used to specify one or more bib files
+# containing the references data. This must be a list of .bib files. The
+# .bib extension is automatically appended if omitted. Using this command
+# requires the bibtex tool to be installed. See also
+# http://en.wikipedia.org/wiki/BibTeX for more info. For LaTeX the style
+# of the bibliography can be controlled using LATEX_BIB_STYLE. To use this
+# feature you need bibtex and perl available in the search path.
+
+CITE_BIB_FILES =
+
+#---------------------------------------------------------------------------
+# configuration options related to warning and progress messages
+#---------------------------------------------------------------------------
+
+# The QUIET tag can be used to turn on/off the messages that are generated
+# by doxygen. Possible values are YES and NO. If left blank NO is used.
+
+QUIET = NO
+
+# The WARNINGS tag can be used to turn on/off the warning messages that are
+# generated by doxygen. Possible values are YES and NO. If left blank
+# NO is used.
+
+WARNINGS = YES
+
+# If WARN_IF_UNDOCUMENTED is set to YES, then doxygen will generate warnings
+# for undocumented members. If EXTRACT_ALL is set to YES then this flag will
+# automatically be disabled.
+
+WARN_IF_UNDOCUMENTED = YES
+
+# If WARN_IF_DOC_ERROR is set to YES, doxygen will generate warnings for
+# potential errors in the documentation, such as not documenting some
+# parameters in a documented function, or documenting parameters that
+# don't exist or using markup commands wrongly.
+
+WARN_IF_DOC_ERROR = YES
+
+# The WARN_NO_PARAMDOC option can be enabled to get warnings for
+# functions that are documented, but have no documentation for their parameters
+# or return value. If set to NO (the default) doxygen will only warn about
+# wrong or incomplete parameter documentation, but not about the absence of
+# documentation.
+
+WARN_NO_PARAMDOC = NO
+
+# The WARN_FORMAT tag determines the format of the warning messages that
+# doxygen can produce. The string should contain the $file, $line, and $text
+# tags, which will be replaced by the file and line number from which the
+# warning originated and the warning text. Optionally the format may contain
+# $version, which will be replaced by the version of the file (if it could
+# be obtained via FILE_VERSION_FILTER)
+
+WARN_FORMAT = "$file:$line: $text"
+
+# The WARN_LOGFILE tag can be used to specify a file to which warning
+# and error messages should be written. If left blank the output is written
+# to stderr.
+
+WARN_LOGFILE =
+
+#---------------------------------------------------------------------------
+# configuration options related to the input files
+#---------------------------------------------------------------------------
+
+# The INPUT tag can be used to specify the files and/or directories that contain
+# documented source files. You may enter file names like "myfile.cpp" or
+# directories like "/usr/src/myproject". Separate the files or directories
+# with spaces.
+
+INPUT = ../src
+
+# This tag can be used to specify the character encoding of the source files
+# that doxygen parses. Internally doxygen uses the UTF-8 encoding, which is
+# also the default input encoding. Doxygen uses libiconv (or the iconv built
+# into libc) for the transcoding. See http://www.gnu.org/software/libiconv for
+# the list of possible encodings.
+
+INPUT_ENCODING = UTF-8
+
+# If the value of the INPUT tag contains directories, you can use the
+# FILE_PATTERNS tag to specify one or more wildcard pattern (like *.cpp
+# and *.h) to filter out the source-files in the directories. If left
+# blank the following patterns are tested:
+# *.c *.cc *.cxx *.cpp *.c++ *.d *.java *.ii *.ixx *.ipp *.i++ *.inl *.h *.hh
+# *.hxx *.hpp *.h++ *.idl *.odl *.cs *.php *.php3 *.inc *.m *.mm *.dox *.py
+# *.f90 *.f *.for *.vhd *.vhdl
+
+FILE_PATTERNS =
+
+# The RECURSIVE tag can be used to turn specify whether or not subdirectories
+# should be searched for input files as well. Possible values are YES and NO.
+# If left blank NO is used.
+
+RECURSIVE = NO
+
+# The EXCLUDE tag can be used to specify files and/or directories that should be
+# excluded from the INPUT source files. This way you can easily exclude a
+# subdirectory from a directory tree whose root is specified with the INPUT tag.
+# Note that relative paths are relative to the directory from which doxygen is
+# run.
+
+EXCLUDE =
+
+# The EXCLUDE_SYMLINKS tag can be used to select whether or not files or
+# directories that are symbolic links (a Unix file system feature) are excluded
+# from the input.
+
+EXCLUDE_SYMLINKS = NO
+
+# If the value of the INPUT tag contains directories, you can use the
+# EXCLUDE_PATTERNS tag to specify one or more wildcard patterns to exclude
+# certain files from those directories. Note that the wildcards are matched
+# against the file with absolute path, so to exclude all test directories
+# for example use the pattern */test/*
+
+EXCLUDE_PATTERNS =
+
+# The EXCLUDE_SYMBOLS tag can be used to specify one or more symbol names
+# (namespaces, classes, functions, etc.) that should be excluded from the
+# output. The symbol name can be a fully qualified name, a word, or if the
+# wildcard * is used, a substring. Examples: ANamespace, AClass,
+# AClass::ANamespace, ANamespace::*Test
+
+EXCLUDE_SYMBOLS =
+
+# The EXAMPLE_PATH tag can be used to specify one or more files or
+# directories that contain example code fragments that are included (see
+# the \include command).
+
+EXAMPLE_PATH =
+
+# If the value of the EXAMPLE_PATH tag contains directories, you can use the
+# EXAMPLE_PATTERNS tag to specify one or more wildcard pattern (like *.cpp
+# and *.h) to filter out the source-files in the directories. If left
+# blank all files are included.
+
+EXAMPLE_PATTERNS =
+
+# If the EXAMPLE_RECURSIVE tag is set to YES then subdirectories will be
+# searched for input files to be used with the \include or \dontinclude
+# commands irrespective of the value of the RECURSIVE tag.
+# Possible values are YES and NO. If left blank NO is used.
+
+EXAMPLE_RECURSIVE = NO
+
+# The IMAGE_PATH tag can be used to specify one or more files or
+# directories that contain image that are included in the documentation (see
+# the \image command).
+
+IMAGE_PATH =
+
+# The INPUT_FILTER tag can be used to specify a program that doxygen should
+# invoke to filter for each input file. Doxygen will invoke the filter program
+# by executing (via popen()) the command <filter> <input-file>, where <filter>
+# is the value of the INPUT_FILTER tag, and <input-file> is the name of an
+# input file. Doxygen will then use the output that the filter program writes
+# to standard output.
+# If FILTER_PATTERNS is specified, this tag will be
+# ignored.
+
+INPUT_FILTER =
+
+# The FILTER_PATTERNS tag can be used to specify filters on a per file pattern
+# basis.
+# Doxygen will compare the file name with each pattern and apply the
+# filter if there is a match.
+# The filters are a list of the form:
+# pattern=filter (like *.cpp=my_cpp_filter). See INPUT_FILTER for further
+# info on how filters are used. If FILTER_PATTERNS is empty or if
+# non of the patterns match the file name, INPUT_FILTER is applied.
+
+FILTER_PATTERNS =
+
+# If the FILTER_SOURCE_FILES tag is set to YES, the input filter (if set using
+# INPUT_FILTER) will be used to filter the input files when producing source
+# files to browse (i.e. when SOURCE_BROWSER is set to YES).
+
+FILTER_SOURCE_FILES = NO
+
+# The FILTER_SOURCE_PATTERNS tag can be used to specify source filters per file
+# pattern. A pattern will override the setting for FILTER_PATTERN (if any)
+# and it is also possible to disable source filtering for a specific pattern
+# using *.ext= (so without naming a filter). This option only has effect when
+# FILTER_SOURCE_FILES is enabled.
+
+FILTER_SOURCE_PATTERNS =
+
+#---------------------------------------------------------------------------
+# configuration options related to source browsing
+#---------------------------------------------------------------------------
+
+# If the SOURCE_BROWSER tag is set to YES then a list of source files will
+# be generated. Documented entities will be cross-referenced with these sources.
+# Note: To get rid of all source code in the generated output, make sure also
+# VERBATIM_HEADERS is set to NO.
+
+SOURCE_BROWSER = NO
+
+# Setting the INLINE_SOURCES tag to YES will include the body
+# of functions and classes directly in the documentation.
+
+INLINE_SOURCES = NO
+
+# Setting the STRIP_CODE_COMMENTS tag to YES (the default) will instruct
+# doxygen to hide any special comment blocks from generated source code
+# fragments. Normal C and C++ comments will always remain visible.
+
+STRIP_CODE_COMMENTS = YES
+
+# If the REFERENCED_BY_RELATION tag is set to YES
+# then for each documented function all documented
+# functions referencing it will be listed.
+
+REFERENCED_BY_RELATION = NO
+
+# If the REFERENCES_RELATION tag is set to YES
+# then for each documented function all documented entities
+# called/used by that function will be listed.
+
+REFERENCES_RELATION = NO
+
+# If the REFERENCES_LINK_SOURCE tag is set to YES (the default)
+# and SOURCE_BROWSER tag is set to YES, then the hyperlinks from
+# functions in REFERENCES_RELATION and REFERENCED_BY_RELATION lists will
+# link to the source code.
+# Otherwise they will link to the documentation.
+
+REFERENCES_LINK_SOURCE = YES
+
+# If the USE_HTAGS tag is set to YES then the references to source code
+# will point to the HTML generated by the htags(1) tool instead of doxygen
+# built-in source browser. The htags tool is part of GNU's global source
+# tagging system (see http://www.gnu.org/software/global/global.html). You
+# will need version 4.8.6 or higher.
+
+USE_HTAGS = NO
+
+# If the VERBATIM_HEADERS tag is set to YES (the default) then Doxygen
+# will generate a verbatim copy of the header file for each class for
+# which an include is specified. Set to NO to disable this.
+
+VERBATIM_HEADERS = YES
+
+#---------------------------------------------------------------------------
+# configuration options related to the alphabetical class index
+#---------------------------------------------------------------------------
+
+# If the ALPHABETICAL_INDEX tag is set to YES, an alphabetical index
+# of all compounds will be generated. Enable this if the project
+# contains a lot of classes, structs, unions or interfaces.
+
+ALPHABETICAL_INDEX = YES
+
+# If the alphabetical index is enabled (see ALPHABETICAL_INDEX) then
+# the COLS_IN_ALPHA_INDEX tag can be used to specify the number of columns
+# in which this list will be split (can be a number in the range [1..20])
+
+COLS_IN_ALPHA_INDEX = 5
+
+# In case all classes in a project start with a common prefix, all
+# classes will be put under the same header in the alphabetical index.
+# The IGNORE_PREFIX tag can be used to specify one or more prefixes that
+# should be ignored while generating the index headers.
+
+IGNORE_PREFIX =
+
+#---------------------------------------------------------------------------
+# configuration options related to the HTML output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_HTML tag is set to YES (the default) Doxygen will
+# generate HTML output.
+
+GENERATE_HTML = YES
+
+# The HTML_OUTPUT tag is used to specify where the HTML docs will be put.
+# If a relative path is entered the value of OUTPUT_DIRECTORY will be
+# put in front of it. If left blank `html' will be used as the default path.
+
+HTML_OUTPUT = html
+
+# The HTML_FILE_EXTENSION tag can be used to specify the file extension for
+# each generated HTML page (for example: .htm,.php,.asp). If it is left blank
+# doxygen will generate files with .html extension.
+
+HTML_FILE_EXTENSION = .html
+
+# The HTML_HEADER tag can be used to specify a personal HTML header for
+# each generated HTML page. If it is left blank doxygen will generate a
+# standard header. Note that when using a custom header you are responsible
+# for the proper inclusion of any scripts and style sheets that doxygen
+# needs, which is dependent on the configuration options used.
+# It is advised to generate a default header using "doxygen -w html
+# header.html footer.html stylesheet.css YourConfigFile" and then modify
+# that header. Note that the header is subject to change so you typically
+# have to redo this when upgrading to a newer version of doxygen or when
+# changing the value of configuration settings such as GENERATE_TREEVIEW!
+
+HTML_HEADER =
+
+# The HTML_FOOTER tag can be used to specify a personal HTML footer for
+# each generated HTML page. If it is left blank doxygen will generate a
+# standard footer.
+
+HTML_FOOTER =
+
+# The HTML_STYLESHEET tag can be used to specify a user-defined cascading
+# style sheet that is used by each HTML page. It can be used to
+# fine-tune the look of the HTML output. If the tag is left blank doxygen
+# will generate a default style sheet. Note that doxygen will try to copy
+# the style sheet file to the HTML output directory, so don't put your own
+# style sheet in the HTML output directory as well, or it will be erased!
+
+HTML_STYLESHEET =
+
+# The HTML_EXTRA_FILES tag can be used to specify one or more extra images or
+# other source files which should be copied to the HTML output directory. Note
+# that these files will be copied to the base HTML output directory. Use the
+# $relpath$ marker in the HTML_HEADER and/or HTML_FOOTER files to load these
+# files. In the HTML_STYLESHEET file, use the file name only. Also note that
+# the files will be copied as-is; there are no commands or markers available.
+
+HTML_EXTRA_FILES =
+
+# The HTML_COLORSTYLE_HUE tag controls the color of the HTML output.
+# Doxygen will adjust the colors in the style sheet and background images
+# according to this color. Hue is specified as an angle on a colorwheel,
+# see http://en.wikipedia.org/wiki/Hue for more information.
+# For instance the value 0 represents red, 60 is yellow, 120 is green,
+# 180 is cyan, 240 is blue, 300 purple, and 360 is red again.
+# The allowed range is 0 to 359.
+
+HTML_COLORSTYLE_HUE = 220
+
+# The HTML_COLORSTYLE_SAT tag controls the purity (or saturation) of
+# the colors in the HTML output. For a value of 0 the output will use
+# grayscales only. A value of 255 will produce the most vivid colors.
+
+HTML_COLORSTYLE_SAT = 100
+
+# The HTML_COLORSTYLE_GAMMA tag controls the gamma correction applied to
+# the luminance component of the colors in the HTML output. Values below
+# 100 gradually make the output lighter, whereas values above 100 make
+# the output darker. The value divided by 100 is the actual gamma applied,
+# so 80 represents a gamma of 0.8, The value 220 represents a gamma of 2.2,
+# and 100 does not change the gamma.
+
+HTML_COLORSTYLE_GAMMA = 80
+
+# If the HTML_TIMESTAMP tag is set to YES then the footer of each generated HTML
+# page will contain the date and time when the page was generated. Setting
+# this to NO can help when comparing the output of multiple runs.
+
+HTML_TIMESTAMP = YES
+
+# If the HTML_ALIGN_MEMBERS tag is set to YES, the members of classes,
+# files or namespaces will be aligned in HTML using tables. If set to
+# NO a bullet list will be used.
+
+HTML_ALIGN_MEMBERS = YES
+
+# If the HTML_DYNAMIC_SECTIONS tag is set to YES then the generated HTML
+# documentation will contain sections that can be hidden and shown after the
+# page has loaded. For this to work a browser that supports
+# JavaScript and DHTML is required (for instance Mozilla 1.0+, Firefox
+# Netscape 6.0+, Internet explorer 5.0+, Konqueror, or Safari).
+
+HTML_DYNAMIC_SECTIONS = NO
+
+# If the GENERATE_DOCSET tag is set to YES, additional index files
+# will be generated that can be used as input for Apple's Xcode 3
+# integrated development environment, introduced with OSX 10.5 (Leopard).
+# To create a documentation set, doxygen will generate a Makefile in the
+# HTML output directory. Running make will produce the docset in that
+# directory and running "make install" will install the docset in
+# ~/Library/Developer/Shared/Documentation/DocSets so that Xcode will find
+# it at startup.
+# See http://developer.apple.com/tools/creatingdocsetswithdoxygen.html
+# for more information.
+
+GENERATE_DOCSET = NO
+
+# When GENERATE_DOCSET tag is set to YES, this tag determines the name of the
+# feed. A documentation feed provides an umbrella under which multiple
+# documentation sets from a single provider (such as a company or product suite)
+# can be grouped.
+
+DOCSET_FEEDNAME = "Doxygen generated docs"
+
+# When GENERATE_DOCSET tag is set to YES, this tag specifies a string that
+# should uniquely identify the documentation set bundle. This should be a
+# reverse domain-name style string, e.g. com.mycompany.MyDocSet. Doxygen
+# will append .docset to the name.
+
+DOCSET_BUNDLE_ID = org.doxygen.Project
+
+# When GENERATE_PUBLISHER_ID tag specifies a string that should uniquely identify
+# the documentation publisher. This should be a reverse domain-name style
+# string, e.g. com.mycompany.MyDocSet.documentation.
+
+DOCSET_PUBLISHER_ID = org.doxygen.Publisher
+
+# The GENERATE_PUBLISHER_NAME tag identifies the documentation publisher.
+
+DOCSET_PUBLISHER_NAME = Publisher
+
+# If the GENERATE_HTMLHELP tag is set to YES, additional index files
+# will be generated that can be used as input for tools like the
+# Microsoft HTML help workshop to generate a compiled HTML help file (.chm)
+# of the generated HTML documentation.
+
+GENERATE_HTMLHELP = NO
+
+# If the GENERATE_HTMLHELP tag is set to YES, the CHM_FILE tag can
+# be used to specify the file name of the resulting .chm file. You
+# can add a path in front of the file if the result should not be
+# written to the html output directory.
+
+CHM_FILE =
+
+# If the GENERATE_HTMLHELP tag is set to YES, the HHC_LOCATION tag can
+# be used to specify the location (absolute path including file name) of
+# the HTML help compiler (hhc.exe). If non-empty doxygen will try to run
+# the HTML help compiler on the generated index.hhp.
+
+HHC_LOCATION =
+
+# If the GENERATE_HTMLHELP tag is set to YES, the GENERATE_CHI flag
+# controls if a separate .chi index file is generated (YES) or that
+# it should be included in the master .chm file (NO).
+
+GENERATE_CHI = NO
+
+# If the GENERATE_HTMLHELP tag is set to YES, the CHM_INDEX_ENCODING
+# is used to encode HtmlHelp index (hhk), content (hhc) and project file
+# content.
+
+CHM_INDEX_ENCODING =
+
+# If the GENERATE_HTMLHELP tag is set to YES, the BINARY_TOC flag
+# controls whether a binary table of contents is generated (YES) or a
+# normal table of contents (NO) in the .chm file.
+
+BINARY_TOC = NO
+
+# The TOC_EXPAND flag can be set to YES to add extra items for group members
+# to the contents of the HTML help documentation and to the tree view.
+
+TOC_EXPAND = NO
+
+# If the GENERATE_QHP tag is set to YES and both QHP_NAMESPACE and
+# QHP_VIRTUAL_FOLDER are set, an additional index file will be generated
+# that can be used as input for Qt's qhelpgenerator to generate a
+# Qt Compressed Help (.qch) of the generated HTML documentation.
+
+GENERATE_QHP = NO
+
+# If the QHG_LOCATION tag is specified, the QCH_FILE tag can
+# be used to specify the file name of the resulting .qch file.
+# The path specified is relative to the HTML output folder.
+
+QCH_FILE =
+
+# The QHP_NAMESPACE tag specifies the namespace to use when generating
+# Qt Help Project output. For more information please see
+# http://doc.trolltech.com/qthelpproject.html#namespace
+
+QHP_NAMESPACE = org.doxygen.Project
+
+# The QHP_VIRTUAL_FOLDER tag specifies the namespace to use when generating
+# Qt Help Project output. For more information please see
+# http://doc.trolltech.com/qthelpproject.html#virtual-folders
+
+QHP_VIRTUAL_FOLDER = doc
+
+# If QHP_CUST_FILTER_NAME is set, it specifies the name of a custom filter to
+# add. For more information please see
+# http://doc.trolltech.com/qthelpproject.html#custom-filters
+
+QHP_CUST_FILTER_NAME =
+
+# The QHP_CUST_FILT_ATTRS tag specifies the list of the attributes of the
+# custom filter to add. For more information please see
+# <a href="http://doc.trolltech.com/qthelpproject.html#custom-filters">
+# Qt Help Project / Custom Filters</a>.
+
+QHP_CUST_FILTER_ATTRS =
+
+# The QHP_SECT_FILTER_ATTRS tag specifies the list of the attributes this
+# project's
+# filter section matches.
+# <a href="http://doc.trolltech.com/qthelpproject.html#filter-attributes">
+# Qt Help Project / Filter Attributes</a>.
+
+QHP_SECT_FILTER_ATTRS =
+
+# If the GENERATE_QHP tag is set to YES, the QHG_LOCATION tag can
+# be used to specify the location of Qt's qhelpgenerator.
+# If non-empty doxygen will try to run qhelpgenerator on the generated
+# .qhp file.
+
+QHG_LOCATION =
+
+# If the GENERATE_ECLIPSEHELP tag is set to YES, additional index files
+# will be generated, which together with the HTML files, form an Eclipse help
+# plugin. To install this plugin and make it available under the help contents
+# menu in Eclipse, the contents of the directory containing the HTML and XML
+# files needs to be copied into the plugins directory of eclipse. The name of
+# the directory within the plugins directory should be the same as
+# the ECLIPSE_DOC_ID value. After copying Eclipse needs to be restarted before
+# the help appears.
+
+GENERATE_ECLIPSEHELP = NO
+
+# A unique identifier for the eclipse help plugin. When installing the plugin
+# the directory name containing the HTML and XML files should also have
+# this name.
+
+ECLIPSE_DOC_ID = org.doxygen.Project
+
+# The DISABLE_INDEX tag can be used to turn on/off the condensed index (tabs)
+# at top of each HTML page. The value NO (the default) enables the index and
+# the value YES disables it. Since the tabs have the same information as the
+# navigation tree you can set this option to NO if you already set
+# GENERATE_TREEVIEW to YES.
+
+DISABLE_INDEX = NO
+
+# The GENERATE_TREEVIEW tag is used to specify whether a tree-like index
+# structure should be generated to display hierarchical information.
+# If the tag value is set to YES, a side panel will be generated
+# containing a tree-like index structure (just like the one that
+# is generated for HTML Help). For this to work a browser that supports
+# JavaScript, DHTML, CSS and frames is required (i.e. any modern browser).
+# Windows users are probably better off using the HTML help feature.
+# Since the tree basically has the same information as the tab index you
+# could consider to set DISABLE_INDEX to NO when enabling this option.
+
+GENERATE_TREEVIEW = NO
+
+# The ENUM_VALUES_PER_LINE tag can be used to set the number of enum values
+# (range [0,1..20]) that doxygen will group on one line in the generated HTML
+# documentation. Note that a value of 0 will completely suppress the enum
+# values from appearing in the overview section.
+
+ENUM_VALUES_PER_LINE = 4
+
+# By enabling USE_INLINE_TREES, doxygen will generate the Groups, Directories,
+# and Class Hierarchy pages using a tree view instead of an ordered list.
+
+USE_INLINE_TREES = NO
+
+# If the treeview is enabled (see GENERATE_TREEVIEW) then this tag can be
+# used to set the initial width (in pixels) of the frame in which the tree
+# is shown.
+
+TREEVIEW_WIDTH = 250
+
+# When the EXT_LINKS_IN_WINDOW option is set to YES doxygen will open
+# links to external symbols imported via tag files in a separate window.
+
+EXT_LINKS_IN_WINDOW = NO
+
+# Use this tag to change the font size of Latex formulas included
+# as images in the HTML documentation. The default is 10. Note that
+# when you change the font size after a successful doxygen run you need
+# to manually remove any form_*.png images from the HTML output directory
+# to force them to be regenerated.
+
+FORMULA_FONTSIZE = 10
+
+# Use the FORMULA_TRANPARENT tag to determine whether or not the images
+# generated for formulas are transparent PNGs. Transparent PNGs are
+# not supported properly for IE 6.0, but are supported on all modern browsers.
+# Note that when changing this option you need to delete any form_*.png files
+# in the HTML output before the changes have effect.
+
+FORMULA_TRANSPARENT = YES
+
+# Enable the USE_MATHJAX option to render LaTeX formulas using MathJax
+# (see http://www.mathjax.org) which uses client side Javascript for the
+# rendering instead of using prerendered bitmaps. Use this if you do not
+# have LaTeX installed or if you want to formulas look prettier in the HTML
+# output. When enabled you also need to install MathJax separately and
+# configure the path to it using the MATHJAX_RELPATH option.
+
+USE_MATHJAX = NO
+
+# When MathJax is enabled you need to specify the location relative to the
+# HTML output directory using the MATHJAX_RELPATH option. The destination
+# directory should contain the MathJax.js script. For instance, if the mathjax
+# directory is located at the same level as the HTML output directory, then
+# MATHJAX_RELPATH should be ../mathjax. The default value points to the
+# mathjax.org site, so you can quickly see the result without installing
+# MathJax, but it is strongly recommended to install a local copy of MathJax
+# before deployment.
+
+MATHJAX_RELPATH = http://www.mathjax.org/mathjax
+
+# The MATHJAX_EXTENSIONS tag can be used to specify one or MathJax extension
+# names that should be enabled during MathJax rendering.
+
+MATHJAX_EXTENSIONS =
+
+# When the SEARCHENGINE tag is enabled doxygen will generate a search box
+# for the HTML output. The underlying search engine uses javascript
+# and DHTML and should work on any modern browser. Note that when using
+# HTML help (GENERATE_HTMLHELP), Qt help (GENERATE_QHP), or docsets
+# (GENERATE_DOCSET) there is already a search function so this one should
+# typically be disabled. For large projects the javascript based search engine
+# can be slow, then enabling SERVER_BASED_SEARCH may provide a better solution.
+
+SEARCHENGINE = YES
+
+# When the SERVER_BASED_SEARCH tag is enabled the search engine will be
+# implemented using a PHP enabled web server instead of at the web client
+# using Javascript. Doxygen will generate the search PHP script and index
+# file to put on the web server. The advantage of the server
+# based approach is that it scales better to large projects and allows
+# full text search. The disadvantages are that it is more difficult to setup
+# and does not have live searching capabilities.
+
+SERVER_BASED_SEARCH = NO
+
+#---------------------------------------------------------------------------
+# configuration options related to the LaTeX output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_LATEX tag is set to YES (the default) Doxygen will
+# generate Latex output.
+
+GENERATE_LATEX = YES
+
+# The LATEX_OUTPUT tag is used to specify where the LaTeX docs will be put.
+# If a relative path is entered the value of OUTPUT_DIRECTORY will be
+# put in front of it. If left blank `latex' will be used as the default path.
+
+LATEX_OUTPUT = latex
+
+# The LATEX_CMD_NAME tag can be used to specify the LaTeX command name to be
+# invoked. If left blank `latex' will be used as the default command name.
+# Note that when enabling USE_PDFLATEX this option is only used for
+# generating bitmaps for formulas in the HTML output, but not in the
+# Makefile that is written to the output directory.
+
+LATEX_CMD_NAME = latex
+
+# The MAKEINDEX_CMD_NAME tag can be used to specify the command name to
+# generate index for LaTeX. If left blank `makeindex' will be used as the
+# default command name.
+
+MAKEINDEX_CMD_NAME = makeindex
+
+# If the COMPACT_LATEX tag is set to YES Doxygen generates more compact
+# LaTeX documents. This may be useful for small projects and may help to
+# save some trees in general.
+
+COMPACT_LATEX = NO
+
+# The PAPER_TYPE tag can be used to set the paper type that is used
+# by the printer. Possible values are: a4, letter, legal and
+# executive. If left blank a4wide will be used.
+
+PAPER_TYPE = a4
+
+# The EXTRA_PACKAGES tag can be to specify one or more names of LaTeX
+# packages that should be included in the LaTeX output.
+
+EXTRA_PACKAGES =
+
+# The LATEX_HEADER tag can be used to specify a personal LaTeX header for
+# the generated latex document. The header should contain everything until
+# the first chapter. If it is left blank doxygen will generate a
+# standard header. Notice: only use this tag if you know what you are doing!
+
+LATEX_HEADER =
+
+# The LATEX_FOOTER tag can be used to specify a personal LaTeX footer for
+# the generated latex document. The footer should contain everything after
+# the last chapter. If it is left blank doxygen will generate a
+# standard footer. Notice: only use this tag if you know what you are doing!
+
+LATEX_FOOTER =
+
+# If the PDF_HYPERLINKS tag is set to YES, the LaTeX that is generated
+# is prepared for conversion to pdf (using ps2pdf). The pdf file will
+# contain links (just like the HTML output) instead of page references
+# This makes the output suitable for online browsing using a pdf viewer.
+
+PDF_HYPERLINKS = YES
+
+# If the USE_PDFLATEX tag is set to YES, pdflatex will be used instead of
+# plain latex in the generated Makefile. Set this option to YES to get a
+# higher quality PDF documentation.
+
+USE_PDFLATEX = YES
+
+# If the LATEX_BATCHMODE tag is set to YES, doxygen will add the \\batchmode.
+# command to the generated LaTeX files. This will instruct LaTeX to keep
+# running if errors occur, instead of asking the user for help.
+# This option is also used when generating formulas in HTML.
+
+LATEX_BATCHMODE = NO
+
+# If LATEX_HIDE_INDICES is set to YES then doxygen will not
+# include the index chapters (such as File Index, Compound Index, etc.)
+# in the output.
+
+LATEX_HIDE_INDICES = NO
+
+# If LATEX_SOURCE_CODE is set to YES then doxygen will include
+# source code with syntax highlighting in the LaTeX output.
+# Note that which sources are shown also depends on other settings
+# such as SOURCE_BROWSER.
+
+LATEX_SOURCE_CODE = NO
+
+# The LATEX_BIB_STYLE tag can be used to specify the style to use for the
+# bibliography, e.g. plainnat, or ieeetr. The default style is "plain". See
+# http://en.wikipedia.org/wiki/BibTeX for more info.
+
+LATEX_BIB_STYLE = plain
+
+#---------------------------------------------------------------------------
+# configuration options related to the RTF output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_RTF tag is set to YES Doxygen will generate RTF output
+# The RTF output is optimized for Word 97 and may not look very pretty with
+# other RTF readers or editors.
+
+GENERATE_RTF = NO
+
+# The RTF_OUTPUT tag is used to specify where the RTF docs will be put.
+# If a relative path is entered the value of OUTPUT_DIRECTORY will be
+# put in front of it. If left blank `rtf' will be used as the default path.
+
+RTF_OUTPUT = rtf
+
+# If the COMPACT_RTF tag is set to YES Doxygen generates more compact
+# RTF documents. This may be useful for small projects and may help to
+# save some trees in general.
+
+COMPACT_RTF = NO
+
+# If the RTF_HYPERLINKS tag is set to YES, the RTF that is generated
+# will contain hyperlink fields. The RTF file will
+# contain links (just like the HTML output) instead of page references.
+# This makes the output suitable for online browsing using WORD or other
+# programs which support those fields.
+# Note: wordpad (write) and others do not support links.
+
+RTF_HYPERLINKS = NO
+
+# Load style sheet definitions from file. Syntax is similar to doxygen's
+# config file, i.e. a series of assignments. You only have to provide
+# replacements, missing definitions are set to their default value.
+
+RTF_STYLESHEET_FILE =
+
+# Set optional variables used in the generation of an rtf document.
+# Syntax is similar to doxygen's config file.
+
+RTF_EXTENSIONS_FILE =
+
+#---------------------------------------------------------------------------
+# configuration options related to the man page output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_MAN tag is set to YES (the default) Doxygen will
+# generate man pages
+
+GENERATE_MAN = NO
+
+# The MAN_OUTPUT tag is used to specify where the man pages will be put.
+# If a relative path is entered the value of OUTPUT_DIRECTORY will be
+# put in front of it. If left blank `man' will be used as the default path.
+
+MAN_OUTPUT = man
+
+# The MAN_EXTENSION tag determines the extension that is added to
+# the generated man pages (default is the subroutine's section .3)
+
+MAN_EXTENSION = .3
+
+# If the MAN_LINKS tag is set to YES and Doxygen generates man output,
+# then it will generate one additional man file for each entity
+# documented in the real man page(s). These additional files
+# only source the real man page, but without them the man command
+# would be unable to find the correct page. The default is NO.
+
+MAN_LINKS = NO
+
+#---------------------------------------------------------------------------
+# configuration options related to the XML output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_XML tag is set to YES Doxygen will
+# generate an XML file that captures the structure of
+# the code including all documentation.
+
+GENERATE_XML = NO
+
+# The XML_OUTPUT tag is used to specify where the XML pages will be put.
+# If a relative path is entered the value of OUTPUT_DIRECTORY will be
+# put in front of it. If left blank `xml' will be used as the default path.
+
+XML_OUTPUT = xml
+
+# The XML_SCHEMA tag can be used to specify an XML schema,
+# which can be used by a validating XML parser to check the
+# syntax of the XML files.
+
+XML_SCHEMA =
+
+# The XML_DTD tag can be used to specify an XML DTD,
+# which can be used by a validating XML parser to check the
+# syntax of the XML files.
+
+XML_DTD =
+
+# If the XML_PROGRAMLISTING tag is set to YES Doxygen will
+# dump the program listings (including syntax highlighting
+# and cross-referencing information) to the XML output. Note that
+# enabling this will significantly increase the size of the XML output.
+
+XML_PROGRAMLISTING = YES
+
+#---------------------------------------------------------------------------
+# configuration options for the AutoGen Definitions output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_AUTOGEN_DEF tag is set to YES Doxygen will
+# generate an AutoGen Definitions (see autogen.sf.net) file
+# that captures the structure of the code including all
+# documentation. Note that this feature is still experimental
+# and incomplete at the moment.
+
+GENERATE_AUTOGEN_DEF = NO
+
+#---------------------------------------------------------------------------
+# configuration options related to the Perl module output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_PERLMOD tag is set to YES Doxygen will
+# generate a Perl module file that captures the structure of
+# the code including all documentation. Note that this
+# feature is still experimental and incomplete at the
+# moment.
+
+GENERATE_PERLMOD = NO
+
+# If the PERLMOD_LATEX tag is set to YES Doxygen will generate
+# the necessary Makefile rules, Perl scripts and LaTeX code to be able
+# to generate PDF and DVI output from the Perl module output.
+
+PERLMOD_LATEX = NO
+
+# If the PERLMOD_PRETTY tag is set to YES the Perl module output will be
+# nicely formatted so it can be parsed by a human reader.
+# This is useful
+# if you want to understand what is going on.
+# On the other hand, if this
+# tag is set to NO the size of the Perl module output will be much smaller
+# and Perl will parse it just the same.
+
+PERLMOD_PRETTY = YES
+
+# The names of the make variables in the generated doxyrules.make file
+# are prefixed with the string contained in PERLMOD_MAKEVAR_PREFIX.
+# This is useful so different doxyrules.make files included by the same
+# Makefile don't overwrite each other's variables.
+
+PERLMOD_MAKEVAR_PREFIX =
+
+#---------------------------------------------------------------------------
+# Configuration options related to the preprocessor
+#---------------------------------------------------------------------------
+
+# If the ENABLE_PREPROCESSING tag is set to YES (the default) Doxygen will
+# evaluate all C-preprocessor directives found in the sources and include
+# files.
+
+ENABLE_PREPROCESSING = YES
+
+# If the MACRO_EXPANSION tag is set to YES Doxygen will expand all macro
+# names in the source code. If set to NO (the default) only conditional
+# compilation will be performed. Macro expansion can be done in a controlled
+# way by setting EXPAND_ONLY_PREDEF to YES.
+
+MACRO_EXPANSION = NO
+
+# If the EXPAND_ONLY_PREDEF and MACRO_EXPANSION tags are both set to YES
+# then the macro expansion is limited to the macros specified with the
+# PREDEFINED and EXPAND_AS_DEFINED tags.
+
+EXPAND_ONLY_PREDEF = NO
+
+# If the SEARCH_INCLUDES tag is set to YES (the default) the includes files
+# pointed to by INCLUDE_PATH will be searched when a #include is found.
+
+SEARCH_INCLUDES = YES
+
+# The INCLUDE_PATH tag can be used to specify one or more directories that
+# contain include files that are not input files but should be processed by
+# the preprocessor.
+
+INCLUDE_PATH =
+
+# You can use the INCLUDE_FILE_PATTERNS tag to specify one or more wildcard
+# patterns (like *.h and *.hpp) to filter out the header-files in the
+# directories. If left blank, the patterns specified with FILE_PATTERNS will
+# be used.
+
+INCLUDE_FILE_PATTERNS =
+
+# The PREDEFINED tag can be used to specify one or more macro names that
+# are defined before the preprocessor is started (similar to the -D option of
+# gcc). The argument of the tag is a list of macros of the form: name
+# or name=definition (no spaces). If the definition and the = are
+# omitted =1 is assumed. To prevent a macro definition from being
+# undefined via #undef or recursively expanded use the := operator
+# instead of the = operator.
+
+PREDEFINED =
+
+# If the MACRO_EXPANSION and EXPAND_ONLY_PREDEF tags are set to YES then
+# this tag can be used to specify a list of macro names that should be expanded.
+# The macro definition that is found in the sources will be used.
+# Use the PREDEFINED tag if you want to use a different macro definition that
+# overrules the definition found in the source code.
+
+EXPAND_AS_DEFINED =
+
+# If the SKIP_FUNCTION_MACROS tag is set to YES (the default) then
+# doxygen's preprocessor will remove all references to function-like macros
+# that are alone on a line, have an all uppercase name, and do not end with a
+# semicolon, because these will confuse the parser if not removed.
+
+SKIP_FUNCTION_MACROS = YES
+
+#---------------------------------------------------------------------------
+# Configuration::additions related to external references
+#---------------------------------------------------------------------------
+
+# The TAGFILES option can be used to specify one or more tagfiles.
+# Optionally an initial location of the external documentation
+# can be added for each tagfile. The format of a tag file without
+# this location is as follows:
+#
+# TAGFILES = file1 file2 ...
+# Adding location for the tag files is done as follows:
+#
+# TAGFILES = file1=loc1 "file2 = loc2" ...
+# where "loc1" and "loc2" can be relative or absolute paths or
+# URLs. If a location is present for each tag, the installdox tool
+# does not have to be run to correct the links.
+# Note that each tag file must have a unique name
+# (where the name does NOT include the path)
+# If a tag file is not located in the directory in which doxygen
+# is run, you must also specify the path to the tagfile here.
+
+TAGFILES =
+
+# When a file name is specified after GENERATE_TAGFILE, doxygen will create
+# a tag file that is based on the input files it reads.
+
+GENERATE_TAGFILE =
+
+# If the ALLEXTERNALS tag is set to YES all external classes will be listed
+# in the class index. If set to NO only the inherited external classes
+# will be listed.
+
+ALLEXTERNALS = NO
+
+# If the EXTERNAL_GROUPS tag is set to YES all external groups will be listed
+# in the modules index. If set to NO, only the current project's groups will
+# be listed.
+
+EXTERNAL_GROUPS = YES
+
+# The PERL_PATH should be the absolute path and name of the perl script
+# interpreter (i.e. the result of `which perl').
+
+PERL_PATH = /usr/bin/perl
+
+#---------------------------------------------------------------------------
+# Configuration options related to the dot tool
+#---------------------------------------------------------------------------
+
+# If the CLASS_DIAGRAMS tag is set to YES (the default) Doxygen will
+# generate a inheritance diagram (in HTML, RTF and LaTeX) for classes with base
+# or super classes. Setting the tag to NO turns the diagrams off. Note that
+# this option also works with HAVE_DOT disabled, but it is recommended to
+# install and use dot, since it yields more powerful graphs.
+
+CLASS_DIAGRAMS = YES
+
+# You can define message sequence charts within doxygen comments using the \msc
+# command. Doxygen will then run the mscgen tool (see
+# http://www.mcternan.me.uk/mscgen/) to produce the chart and insert it in the
+# documentation. The MSCGEN_PATH tag allows you to specify the directory where
+# the mscgen tool resides. If left empty the tool is assumed to be found in the
+# default search path.
+
+MSCGEN_PATH =
+
+# If set to YES, the inheritance and collaboration graphs will hide
+# inheritance and usage relations if the target is undocumented
+# or is not a class.
+
+HIDE_UNDOC_RELATIONS = YES
+
+# If you set the HAVE_DOT tag to YES then doxygen will assume the dot tool is
+# available from the path. This tool is part of Graphviz, a graph visualization
+# toolkit from AT&T and Lucent Bell Labs. The other options in this section
+# have no effect if this option is set to NO (the default)
+
+HAVE_DOT = NO
+
+# The DOT_NUM_THREADS specifies the number of dot invocations doxygen is
+# allowed to run in parallel. When set to 0 (the default) doxygen will
+# base this on the number of processors available in the system. You can set it
+# explicitly to a value larger than 0 to get control over the balance
+# between CPU load and processing speed.
+
+DOT_NUM_THREADS = 0
+
+# By default doxygen will use the Helvetica font for all dot files that
+# doxygen generates. When you want a differently looking font you can specify
+# the font name using DOT_FONTNAME. You need to make sure dot is able to find
+# the font, which can be done by putting it in a standard location or by setting
+# the DOTFONTPATH environment variable or by setting DOT_FONTPATH to the
+# directory containing the font.
+
+DOT_FONTNAME = Helvetica
+
+# The DOT_FONTSIZE tag can be used to set the size of the font of dot graphs.
+# The default size is 10pt.
+
+DOT_FONTSIZE = 10
+
+# By default doxygen will tell dot to use the Helvetica font.
+# If you specify a different font using DOT_FONTNAME you can use DOT_FONTPATH to
+# set the path where dot can find it.
+
+DOT_FONTPATH =
+
+# If the CLASS_GRAPH and HAVE_DOT tags are set to YES then doxygen
+# will generate a graph for each documented class showing the direct and
+# indirect inheritance relations. Setting this tag to YES will force the
+# CLASS_DIAGRAMS tag to NO.
+
+CLASS_GRAPH = YES
+
+# If the COLLABORATION_GRAPH and HAVE_DOT tags are set to YES then doxygen
+# will generate a graph for each documented class showing the direct and
+# indirect implementation dependencies (inheritance, containment, and
+# class references variables) of the class with other documented classes.
+
+COLLABORATION_GRAPH = YES
+
+# If the GROUP_GRAPHS and HAVE_DOT tags are set to YES then doxygen
+# will generate a graph for groups, showing the direct groups dependencies
+
+GROUP_GRAPHS = YES
+
+# If the UML_LOOK tag is set to YES doxygen will generate inheritance and
+# collaboration diagrams in a style similar to the OMG's Unified Modeling
+# Language.
+
+UML_LOOK = NO
+
+# If set to YES, the inheritance and collaboration graphs will show the
+# relations between templates and their instances.
+
+TEMPLATE_RELATIONS = NO
+
+# If the ENABLE_PREPROCESSING, SEARCH_INCLUDES, INCLUDE_GRAPH, and HAVE_DOT
+# tags are set to YES then doxygen will generate a graph for each documented
+# file showing the direct and indirect include dependencies of the file with
+# other documented files.
+
+INCLUDE_GRAPH = YES
+
+# If the ENABLE_PREPROCESSING, SEARCH_INCLUDES, INCLUDED_BY_GRAPH, and
+# HAVE_DOT tags are set to YES then doxygen will generate a graph for each
+# documented header file showing the documented files that directly or
+# indirectly include this file.
+
+INCLUDED_BY_GRAPH = YES
+
+# If the CALL_GRAPH and HAVE_DOT options are set to YES then
+# doxygen will generate a call dependency graph for every global function
+# or class method. Note that enabling this option will significantly increase
+# the time of a run. So in most cases it will be better to enable call graphs
+# for selected functions only using the \callgraph command.
+
+CALL_GRAPH = NO
+
+# If the CALLER_GRAPH and HAVE_DOT tags are set to YES then
+# doxygen will generate a caller dependency graph for every global function
+# or class method. Note that enabling this option will significantly increase
+# the time of a run. So in most cases it will be better to enable caller
+# graphs for selected functions only using the \callergraph command.
+
+CALLER_GRAPH = NO
+
+# If the GRAPHICAL_HIERARCHY and HAVE_DOT tags are set to YES then doxygen
+# will generate a graphical hierarchy of all classes instead of a textual one.
+
+GRAPHICAL_HIERARCHY = YES
+
+# If the DIRECTORY_GRAPH, SHOW_DIRECTORIES and HAVE_DOT tags are set to YES
+# then doxygen will show the dependencies a directory has on other directories
+# in a graphical way. The dependency relations are determined by the #include
+# relations between the files in the directories.
+
+DIRECTORY_GRAPH = YES
+
+# The DOT_IMAGE_FORMAT tag can be used to set the image format of the images
+# generated by dot. Possible values are svg, png, jpg, or gif.
+# If left blank png will be used. If you choose svg you need to set
+# HTML_FILE_EXTENSION to xhtml in order to make the SVG files
+# visible in IE 9+ (other browsers do not have this requirement).
+
+DOT_IMAGE_FORMAT = png
+
+# If DOT_IMAGE_FORMAT is set to svg, then this option can be set to YES to
+# enable generation of interactive SVG images that allow zooming and panning.
+# Note that this requires a modern browser other than Internet Explorer.
+# Tested and working are Firefox, Chrome, Safari, and Opera. For IE 9+ you
+# need to set HTML_FILE_EXTENSION to xhtml in order to make the SVG files
+# visible. Older versions of IE do not have SVG support.
+
+INTERACTIVE_SVG = NO
+
+# The tag DOT_PATH can be used to specify the path where the dot tool can be
+# found. If left blank, it is assumed the dot tool can be found in the path.
+
+DOT_PATH =
+
+# The DOTFILE_DIRS tag can be used to specify one or more directories that
+# contain dot files that are included in the documentation (see the
+# \dotfile command).
+
+DOTFILE_DIRS =
+
+# The MSCFILE_DIRS tag can be used to specify one or more directories that
+# contain msc files that are included in the documentation (see the
+# \mscfile command).
+
+MSCFILE_DIRS =
+
+# The DOT_GRAPH_MAX_NODES tag can be used to set the maximum number of
+# nodes that will be shown in the graph. If the number of nodes in a graph
+# becomes larger than this value, doxygen will truncate the graph, which is
+# visualized by representing a node as a red box. Note that doxygen if the
+# number of direct children of the root node in a graph is already larger than
+# DOT_GRAPH_MAX_NODES then the graph will not be shown at all. Also note
+# that the size of a graph can be further restricted by MAX_DOT_GRAPH_DEPTH.
+
+DOT_GRAPH_MAX_NODES = 50
+
+# The MAX_DOT_GRAPH_DEPTH tag can be used to set the maximum depth of the
+# graphs generated by dot. A depth value of 3 means that only nodes reachable
+# from the root by following a path via at most 3 edges will be shown. Nodes
+# that lay further from the root node will be omitted. Note that setting this
+# option to 1 or 2 may greatly reduce the computation time needed for large
+# code bases. Also note that the size of a graph can be further restricted by
+# DOT_GRAPH_MAX_NODES. Using a depth of 0 means no depth restriction.
+
+MAX_DOT_GRAPH_DEPTH = 0
+
+# Set the DOT_TRANSPARENT tag to YES to generate images with a transparent
+# background. This is disabled by default, because dot on Windows does not
+# seem to support this out of the box. Warning: Depending on the platform used,
+# enabling this option may lead to badly anti-aliased labels on the edges of
+# a graph (i.e. they become hard to read).
+
+DOT_TRANSPARENT = NO
+
+# Set the DOT_MULTI_TARGETS tag to YES allow dot to generate multiple output
+# files in one run (i.e. multiple -o and -T options on the command line). This
+# makes dot run faster, but since only newer versions of dot (>1.8.10)
+# support this, this feature is disabled by default.
+
+DOT_MULTI_TARGETS = YES
+
+# If the GENERATE_LEGEND tag is set to YES (the default) Doxygen will
+# generate a legend page explaining the meaning of the various boxes and
+# arrows in the dot generated graphs.
+
+GENERATE_LEGEND = YES
+
+# If the DOT_CLEANUP tag is set to YES (the default) Doxygen will
+# remove the intermediate dot files that are used to generate
+# the various graphs.
+
+DOT_CLEANUP = YES
diff --git a/docs/Makefile.am b/docs/Makefile.am
new file mode 100644
index 0000000..2fadecf
--- /dev/null
+++ b/docs/Makefile.am
@@ -0,0 +1,22 @@
+dist_man_MANS = andi.1
+dist_noinst_DATA = Doxyfile
+
+# I intentionally do not list any of the manual files here. I neither want them
+# distributed nor installed. The reason is that building the manual requires
+# LaTeX with a whole bunch of packages installed. Plus, so many things can go
+# wrong, when building, so it's better to inspect the result. Thus, the manual
+# has to be build by hand and copied to the right place for distribution.
+
+.PHONY: code-docs
+code-docs:
+ doxygen
+
+manual/version.tex: manual/version.tex.in $(top_srcdir)/configure.ac
+ sed "s/VERSION/$(VERSION)/" manual/version.tex.in > manual/version.tex
+
+manual/andi-manual.pdf: manual/andi-manual.tex manual/version.tex
+ @echo "error: manual rebuild of the manual required (no pun intended)."
+ @exit 1
+
+# maintainer-clean-local:
+# rm -f manual/*{aux,log,out,toc} manual/andi-manual.pdf
diff --git a/docs/Makefile.in b/docs/Makefile.in
new file mode 100644
index 0000000..f6fad5d
--- /dev/null
+++ b/docs/Makefile.in
@@ -0,0 +1,505 @@
+# Makefile.in generated by automake 1.14.1 from Makefile.am.
+# @configure_input@
+
+# Copyright (C) 1994-2013 Free Software Foundation, Inc.
+
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+ at SET_MAKE@
+
+VPATH = @srcdir@
+am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
+am__make_running_with_option = \
+ case $${target_option-} in \
+ ?) ;; \
+ *) echo "am__make_running_with_option: internal error: invalid" \
+ "target option '$${target_option-}' specified" >&2; \
+ exit 1;; \
+ esac; \
+ has_opt=no; \
+ sane_makeflags=$$MAKEFLAGS; \
+ if $(am__is_gnu_make); then \
+ sane_makeflags=$$MFLAGS; \
+ else \
+ case $$MAKEFLAGS in \
+ *\\[\ \ ]*) \
+ bs=\\; \
+ sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
+ | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
+ esac; \
+ fi; \
+ skip_next=no; \
+ strip_trailopt () \
+ { \
+ flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
+ }; \
+ for flg in $$sane_makeflags; do \
+ test $$skip_next = yes && { skip_next=no; continue; }; \
+ case $$flg in \
+ *=*|--*) continue;; \
+ -*I) strip_trailopt 'I'; skip_next=yes;; \
+ -*I?*) strip_trailopt 'I';; \
+ -*O) strip_trailopt 'O'; skip_next=yes;; \
+ -*O?*) strip_trailopt 'O';; \
+ -*l) strip_trailopt 'l'; skip_next=yes;; \
+ -*l?*) strip_trailopt 'l';; \
+ -[dEDm]) skip_next=yes;; \
+ -[JT]) skip_next=yes;; \
+ esac; \
+ case $$flg in \
+ *$$target_option*) has_opt=yes; break;; \
+ esac; \
+ done; \
+ test $$has_opt = yes
+am__make_dryrun = (target_option=n; $(am__make_running_with_option))
+am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
+pkgdatadir = $(datadir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkglibexecdir = $(libexecdir)/@PACKAGE@
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+subdir = docs
+DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
+ $(srcdir)/andi.1.in $(dist_man_MANS) $(dist_noinst_DATA)
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+am__aclocal_m4_deps = $(top_srcdir)/m4/ax_cxx_compile_stdcxx_11.m4 \
+ $(top_srcdir)/configure.ac
+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
+ $(ACLOCAL_M4)
+mkinstalldirs = $(install_sh) -d
+CONFIG_HEADER = $(top_builddir)/src/config.h
+CONFIG_CLEAN_FILES = andi.1
+CONFIG_CLEAN_VPATH_FILES =
+AM_V_P = $(am__v_P_ at AM_V@)
+am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
+am__v_P_0 = false
+am__v_P_1 = :
+AM_V_GEN = $(am__v_GEN_ at AM_V@)
+am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
+am__v_GEN_0 = @echo " GEN " $@;
+am__v_GEN_1 =
+AM_V_at = $(am__v_at_ at AM_V@)
+am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
+am__v_at_0 = @
+am__v_at_1 =
+SOURCES =
+DIST_SOURCES =
+am__can_run_installinfo = \
+ case $$AM_UPDATE_INFO_DIR in \
+ n|no|NO) false;; \
+ *) (install-info --version) >/dev/null 2>&1;; \
+ esac
+am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`;
+am__vpath_adj = case $$p in \
+ $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \
+ *) f=$$p;; \
+ esac;
+am__strip_dir = f=`echo $$p | sed -e 's|^.*/||'`;
+am__install_max = 40
+am__nobase_strip_setup = \
+ srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*|]/\\\\&/g'`
+am__nobase_strip = \
+ for p in $$list; do echo "$$p"; done | sed -e "s|$$srcdirstrip/||"
+am__nobase_list = $(am__nobase_strip_setup); \
+ for p in $$list; do echo "$$p $$p"; done | \
+ sed "s| $$srcdirstrip/| |;"' / .*\//!s/ .*/ ./; s,\( .*\)/[^/]*$$,\1,' | \
+ $(AWK) 'BEGIN { files["."] = "" } { files[$$2] = files[$$2] " " $$1; \
+ if (++n[$$2] == $(am__install_max)) \
+ { print $$2, files[$$2]; n[$$2] = 0; files[$$2] = "" } } \
+ END { for (dir in files) print dir, files[dir] }'
+am__base_list = \
+ sed '$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;s/\n/ /g' | \
+ sed '$$!N;$$!N;$$!N;$$!N;s/\n/ /g'
+am__uninstall_files_from_dir = { \
+ test -z "$$files" \
+ || { test ! -d "$$dir" && test ! -f "$$dir" && test ! -r "$$dir"; } \
+ || { echo " ( cd '$$dir' && rm -f" $$files ")"; \
+ $(am__cd) "$$dir" && rm -f $$files; }; \
+ }
+man1dir = $(mandir)/man1
+am__installdirs = "$(DESTDIR)$(man1dir)"
+NROFF = nroff
+MANS = $(dist_man_MANS)
+DATA = $(dist_noinst_DATA)
+am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+ACLOCAL = @ACLOCAL@
+AMTAR = @AMTAR@
+AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
+AR = @AR@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CXX = @CXX@
+CXXDEPMODE = @CXXDEPMODE@
+CXXFLAGS = @CXXFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+EXEEXT = @EXEEXT@
+GLIB_CFLAGS = @GLIB_CFLAGS@
+GLIB_LIBS = @GLIB_LIBS@
+GREP = @GREP@
+HAVE_CXX11 = @HAVE_CXX11@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+MKDIR_P = @MKDIR_P@
+OBJEXT = @OBJEXT@
+OPENMP_CFLAGS = @OPENMP_CFLAGS@
+OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+PKG_CONFIG = @PKG_CONFIG@
+PKG_CONFIG_LIBDIR = @PKG_CONFIG_LIBDIR@
+PKG_CONFIG_PATH = @PKG_CONFIG_PATH@
+RANLIB = @RANLIB@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
+ac_ct_AR = @ac_ct_AR@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_CXX = @ac_ct_CXX@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+am__tar = @am__tar@
+am__untar = @am__untar@
+bindir = @bindir@
+build_alias = @build_alias@
+builddir = @builddir@
+datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
+exec_prefix = @exec_prefix@
+host_alias = @host_alias@
+htmldir = @htmldir@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localedir = @localedir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+mkdir_p = @mkdir_p@
+oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+psdir = @psdir@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+top_build_prefix = @top_build_prefix@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
+dist_man_MANS = andi.1
+dist_noinst_DATA = Doxyfile
+all: all-am
+
+.SUFFIXES:
+$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
+ @for dep in $?; do \
+ case '$(am__configure_deps)' in \
+ *$$dep*) \
+ ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
+ && { if test -f $@; then exit 0; else break; fi; }; \
+ exit 1;; \
+ esac; \
+ done; \
+ echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign docs/Makefile'; \
+ $(am__cd) $(top_srcdir) && \
+ $(AUTOMAKE) --foreign docs/Makefile
+.PRECIOUS: Makefile
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+ @case '$?' in \
+ *config.status*) \
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
+ *) \
+ echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
+ cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
+ esac;
+
+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+
+$(top_srcdir)/configure: $(am__configure_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(ACLOCAL_M4): $(am__aclocal_m4_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(am__aclocal_m4_deps):
+andi.1: $(top_builddir)/config.status $(srcdir)/andi.1.in
+ cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@
+install-man1: $(dist_man_MANS)
+ @$(NORMAL_INSTALL)
+ @list1=''; \
+ list2='$(dist_man_MANS)'; \
+ test -n "$(man1dir)" \
+ && test -n "`echo $$list1$$list2`" \
+ || exit 0; \
+ echo " $(MKDIR_P) '$(DESTDIR)$(man1dir)'"; \
+ $(MKDIR_P) "$(DESTDIR)$(man1dir)" || exit 1; \
+ { for i in $$list1; do echo "$$i"; done; \
+ if test -n "$$list2"; then \
+ for i in $$list2; do echo "$$i"; done \
+ | sed -n '/\.1[a-z]*$$/p'; \
+ fi; \
+ } | while read p; do \
+ if test -f $$p; then d=; else d="$(srcdir)/"; fi; \
+ echo "$$d$$p"; echo "$$p"; \
+ done | \
+ sed -e 'n;s,.*/,,;p;h;s,.*\.,,;s,^[^1][0-9a-z]*$$,1,;x' \
+ -e 's,\.[0-9a-z]*$$,,;$(transform);G;s,\n,.,' | \
+ sed 'N;N;s,\n, ,g' | { \
+ list=; while read file base inst; do \
+ if test "$$base" = "$$inst"; then list="$$list $$file"; else \
+ echo " $(INSTALL_DATA) '$$file' '$(DESTDIR)$(man1dir)/$$inst'"; \
+ $(INSTALL_DATA) "$$file" "$(DESTDIR)$(man1dir)/$$inst" || exit $$?; \
+ fi; \
+ done; \
+ for i in $$list; do echo "$$i"; done | $(am__base_list) | \
+ while read files; do \
+ test -z "$$files" || { \
+ echo " $(INSTALL_DATA) $$files '$(DESTDIR)$(man1dir)'"; \
+ $(INSTALL_DATA) $$files "$(DESTDIR)$(man1dir)" || exit $$?; }; \
+ done; }
+
+uninstall-man1:
+ @$(NORMAL_UNINSTALL)
+ @list=''; test -n "$(man1dir)" || exit 0; \
+ files=`{ for i in $$list; do echo "$$i"; done; \
+ l2='$(dist_man_MANS)'; for i in $$l2; do echo "$$i"; done | \
+ sed -n '/\.1[a-z]*$$/p'; \
+ } | sed -e 's,.*/,,;h;s,.*\.,,;s,^[^1][0-9a-z]*$$,1,;x' \
+ -e 's,\.[0-9a-z]*$$,,;$(transform);G;s,\n,.,'`; \
+ dir='$(DESTDIR)$(man1dir)'; $(am__uninstall_files_from_dir)
+tags TAGS:
+
+ctags CTAGS:
+
+cscope cscopelist:
+
+
+distdir: $(DISTFILES)
+ @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ list='$(DISTFILES)'; \
+ dist_files=`for file in $$list; do echo $$file; done | \
+ sed -e "s|^$$srcdirstrip/||;t" \
+ -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+ case $$dist_files in \
+ */*) $(MKDIR_P) `echo "$$dist_files" | \
+ sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+ sort -u` ;; \
+ esac; \
+ for file in $$dist_files; do \
+ if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+ if test -d $$d/$$file; then \
+ dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
+ if test -d "$(distdir)/$$file"; then \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+ cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
+ else \
+ test -f "$(distdir)/$$file" \
+ || cp -p $$d/$$file "$(distdir)/$$file" \
+ || exit 1; \
+ fi; \
+ done
+check-am: all-am
+check: check-am
+all-am: Makefile $(MANS) $(DATA)
+installdirs:
+ for dir in "$(DESTDIR)$(man1dir)"; do \
+ test -z "$$dir" || $(MKDIR_P) "$$dir"; \
+ done
+install: install-am
+install-exec: install-exec-am
+install-data: install-data-am
+uninstall: uninstall-am
+
+install-am: all-am
+ @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-am
+install-strip:
+ if test -z '$(STRIP)'; then \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ install; \
+ else \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+ fi
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+ -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
+ -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
+
+maintainer-clean-generic:
+ @echo "This command is intended for maintainers to use"
+ @echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
+clean-am: clean-generic mostlyclean-am
+
+distclean: distclean-am
+ -rm -f Makefile
+distclean-am: clean-am distclean-generic
+
+dvi: dvi-am
+
+dvi-am:
+
+html: html-am
+
+html-am:
+
+info: info-am
+
+info-am:
+
+install-data-am: install-man
+
+install-dvi: install-dvi-am
+
+install-dvi-am:
+
+install-exec-am:
+
+install-html: install-html-am
+
+install-html-am:
+
+install-info: install-info-am
+
+install-info-am:
+
+install-man: install-man1
+
+install-pdf: install-pdf-am
+
+install-pdf-am:
+
+install-ps: install-ps-am
+
+install-ps-am:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-am
+ -rm -f Makefile
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-am
+
+mostlyclean-am: mostlyclean-generic
+
+pdf: pdf-am
+
+pdf-am:
+
+ps: ps-am
+
+ps-am:
+
+uninstall-am: uninstall-man
+
+uninstall-man: uninstall-man1
+
+.MAKE: install-am install-strip
+
+.PHONY: all all-am check check-am clean clean-generic cscopelist-am \
+ ctags-am distclean distclean-generic distdir dvi dvi-am html \
+ html-am info info-am install install-am install-data \
+ install-data-am install-dvi install-dvi-am install-exec \
+ install-exec-am install-html install-html-am install-info \
+ install-info-am install-man install-man1 install-pdf \
+ install-pdf-am install-ps install-ps-am install-strip \
+ installcheck installcheck-am installdirs maintainer-clean \
+ maintainer-clean-generic mostlyclean mostlyclean-generic pdf \
+ pdf-am ps ps-am tags-am uninstall uninstall-am uninstall-man \
+ uninstall-man1
+
+
+# I intentionally do not list any of the manual files here. I neither want them
+# distributed nor installed. The reason is that building the manual requires
+# LaTeX with a whole bunch of packages installed. Plus, so many things can go
+# wrong, when building, so it's better to inspect the result. Thus, the manual
+# has to be build by hand and copied to the right place for distribution.
+
+.PHONY: code-docs
+code-docs:
+ doxygen
+
+manual/version.tex: manual/version.tex.in $(top_srcdir)/configure.ac
+ sed "s/VERSION/$(VERSION)/" manual/version.tex.in > manual/version.tex
+
+manual/andi-manual.pdf: manual/andi-manual.tex manual/version.tex
+ @echo "error: manual rebuild of the manual required (no pun intended)."
+ @exit 1
+
+# maintainer-clean-local:
+# rm -f manual/*{aux,log,out,toc} manual/andi-manual.pdf
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
diff --git a/docs/andi.1 b/docs/andi.1
new file mode 100644
index 0000000..4b4facc
--- /dev/null
+++ b/docs/andi.1
@@ -0,0 +1,56 @@
+.TH ANDI "1" "June 2015" "0.9.4" ""
+.SH NAME
+andi \- estimates evolutionary distance
+.SH SYNOPSIS
+.B andi
+[\fI-jrv\fR] [\fI-p FLOAT\fR] [\fI-t INT\fR] \fIFILES\fR...
+.SH DESCRIPTION
+.TP
+\fBandi\fR estimates the evolutionary distance between closely related genomes. For this \fBandi\fR reads the input sequences from \fIFASTA\fR files and computes the pairwise anchor distance. The idea behind this is explained in a paper by Haubold et al. (see below).
+.SH OUTPUT
+The output is a symmetrical distance matrix in \fIPHYLIP\fR format, with each entry representing divergence with a positive real number. A distance of zero means that two sequences are identical, whereas other values are estimates for the nucleotide substitution rate (Jukes-Cantor corrected). For technical reasons the comparison might fail and no estimate can be computed. In such cases \fInan\fR is printed. This either means that the input sequences were too short (<200bp) or too diverse [...]
+.SH OPTIONS
+.TP
+\fB\-j\fR, \fB\-\-join\fR
+Use this mode if each of your \fIFASTA\fR files represents one assembly with numerous contigs. \fBandi\fR will then treat all of the contained sequences per file as a single genome. In this mode at least one file name must be provided via command line arguments. For the output the filename is used to identify each sequence.
+.TP
+\fB\-m\fR, \fB\-\-low-memory\fR
+In multithreaded mode, \fBandi\fR requires memory linear to the amount of threads. The low memory mode changes this to a constant demand independent from the used number of threads. Unfortunately, this comes at a significant runtime cost.
+.TP
+\fB\-p\fR <FLOAT>
+Significance of an anchor pair; default: 0.05.
+.TP
+\fB\-r\fR, \fB\-\-raw\fR
+Calculates raw distances; default: Jukes\-Cantor corrected.
+.TP
+\fB\-t\fR <INT>
+The number of threads to be used; by default, all available processors are used.
+.br
+Multithreading is only available if \fBandi\fR was compiled with OpenMP support.
+.TP
+\fB\-v\fR, \fB\-\-verbose\fR
+Prints additional information. Apply multiple times for extra verboseness.
+.TP
+\fB\-h\fR, \fB\-\-help\fR
+Prints the synopsis and an explanation of available options.
+.TP
+\fB\-\-version\fR
+Outputs version information and acknowledgments.
+.SH COPYRIGHT
+Copyright \(co 2014, 2015 Fabian Klötzl
+License GPLv3+: GNU GPL version 3 or later.
+.br
+This is free software: you are free to change and redistribute it.
+There is NO WARRANTY, to the extent permitted by law.
+The full license text is available at <http://gnu.org/licenses/gpl.html>.
+.PP
+.SH ACKNOWLEDGMENTS
+1) andi: Haubold, B. Klötzl, F. and Pfaffelhuber, P. (2015). andi: Fast and accurate estimation of evolutionary distances between closely related genomes
+.br
+2) Algorithms: Ohlebusch, E. (2013). Bioinformatics Algorithms. Sequence Analysis, Genome Rearrangements, and Phylogenetic Reconstruction. pp 118f.
+.br
+3) SA construction: Mori, Y. (2005). Short description of improved two\-stage suffix sorting algorithm. http://homepage3.nifty.com/wpage/software/itssort.txt
+.SH BUGS
+.SS Reporting Bugs
+Please report bugs to <kloetzl at evolbio.mpg.de> or at <https://github.com/EvolBioInf/andi>.
+.SS
diff --git a/docs/andi.1.in b/docs/andi.1.in
new file mode 100644
index 0000000..3f46b6e
--- /dev/null
+++ b/docs/andi.1.in
@@ -0,0 +1,56 @@
+.TH ANDI "1" "June 2015" "@VERSION@" ""
+.SH NAME
+andi \- estimates evolutionary distance
+.SH SYNOPSIS
+.B andi
+[\fI-jrv\fR] [\fI-p FLOAT\fR] [\fI-t INT\fR] \fIFILES\fR...
+.SH DESCRIPTION
+.TP
+\fBandi\fR estimates the evolutionary distance between closely related genomes. For this \fBandi\fR reads the input sequences from \fIFASTA\fR files and computes the pairwise anchor distance. The idea behind this is explained in a paper by Haubold et al. (see below).
+.SH OUTPUT
+The output is a symmetrical distance matrix in \fIPHYLIP\fR format, with each entry representing divergence with a positive real number. A distance of zero means that two sequences are identical, whereas other values are estimates for the nucleotide substitution rate (Jukes-Cantor corrected). For technical reasons the comparison might fail and no estimate can be computed. In such cases \fInan\fR is printed. This either means that the input sequences were too short (<200bp) or too diverse [...]
+.SH OPTIONS
+.TP
+\fB\-j\fR, \fB\-\-join\fR
+Use this mode if each of your \fIFASTA\fR files represents one assembly with numerous contigs. \fBandi\fR will then treat all of the contained sequences per file as a single genome. In this mode at least one file name must be provided via command line arguments. For the output the filename is used to identify each sequence.
+.TP
+\fB\-m\fR, \fB\-\-low-memory\fR
+In multithreaded mode, \fBandi\fR requires memory linear to the amount of threads. The low memory mode changes this to a constant demand independent from the used number of threads. Unfortunately, this comes at a significant runtime cost.
+.TP
+\fB\-p\fR <FLOAT>
+Significance of an anchor pair; default: 0.05.
+.TP
+\fB\-r\fR, \fB\-\-raw\fR
+Calculates raw distances; default: Jukes\-Cantor corrected.
+.TP
+\fB\-t\fR <INT>
+The number of threads to be used; by default, all available processors are used.
+.br
+Multithreading is only available if \fBandi\fR was compiled with OpenMP support.
+.TP
+\fB\-v\fR, \fB\-\-verbose\fR
+Prints additional information. Apply multiple times for extra verboseness.
+.TP
+\fB\-h\fR, \fB\-\-help\fR
+Prints the synopsis and an explanation of available options.
+.TP
+\fB\-\-version\fR
+Outputs version information and acknowledgments.
+.SH COPYRIGHT
+Copyright \(co 2014, 2015 Fabian Klötzl
+License GPLv3+: GNU GPL version 3 or later.
+.br
+This is free software: you are free to change and redistribute it.
+There is NO WARRANTY, to the extent permitted by law.
+The full license text is available at <http://gnu.org/licenses/gpl.html>.
+.PP
+.SH ACKNOWLEDGMENTS
+1) andi: Haubold, B. Klötzl, F. and Pfaffelhuber, P. (2015). andi: Fast and accurate estimation of evolutionary distances between closely related genomes
+.br
+2) Algorithms: Ohlebusch, E. (2013). Bioinformatics Algorithms. Sequence Analysis, Genome Rearrangements, and Phylogenetic Reconstruction. pp 118f.
+.br
+3) SA construction: Mori, Y. (2005). Short description of improved two\-stage suffix sorting algorithm. http://homepage3.nifty.com/wpage/software/itssort.txt
+.SH BUGS
+.SS Reporting Bugs
+Please report bugs to <kloetzl at evolbio.mpg.de> or at <https://github.com/EvolBioInf/andi>.
+.SS
diff --git a/install-sh b/install-sh
new file mode 100755
index 0000000..377bb86
--- /dev/null
+++ b/install-sh
@@ -0,0 +1,527 @@
+#!/bin/sh
+# install - install a program, script, or datafile
+
+scriptversion=2011-11-20.07; # UTC
+
+# This originates from X11R5 (mit/util/scripts/install.sh), which was
+# later released in X11R6 (xc/config/util/install.sh) with the
+# following copyright and license.
+#
+# Copyright (C) 1994 X Consortium
+#
+# Permission is hereby granted, free of charge, to any person obtaining a copy
+# of this software and associated documentation files (the "Software"), to
+# deal in the Software without restriction, including without limitation the
+# rights to use, copy, modify, merge, publish, distribute, sublicense, and/or
+# sell copies of the Software, and to permit persons to whom the Software is
+# furnished to do so, subject to the following conditions:
+#
+# The above copyright notice and this permission notice shall be included in
+# all copies or substantial portions of the Software.
+#
+# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+# X CONSORTIUM BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN
+# AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNEC-
+# TION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+#
+# Except as contained in this notice, the name of the X Consortium shall not
+# be used in advertising or otherwise to promote the sale, use or other deal-
+# ings in this Software without prior written authorization from the X Consor-
+# tium.
+#
+#
+# FSF changes to this file are in the public domain.
+#
+# Calling this script install-sh is preferred over install.sh, to prevent
+# 'make' implicit rules from creating a file called install from it
+# when there is no Makefile.
+#
+# This script is compatible with the BSD install script, but was written
+# from scratch.
+
+nl='
+'
+IFS=" "" $nl"
+
+# set DOITPROG to echo to test this script
+
+# Don't use :- since 4.3BSD and earlier shells don't like it.
+doit=${DOITPROG-}
+if test -z "$doit"; then
+ doit_exec=exec
+else
+ doit_exec=$doit
+fi
+
+# Put in absolute file names if you don't have them in your path;
+# or use environment vars.
+
+chgrpprog=${CHGRPPROG-chgrp}
+chmodprog=${CHMODPROG-chmod}
+chownprog=${CHOWNPROG-chown}
+cmpprog=${CMPPROG-cmp}
+cpprog=${CPPROG-cp}
+mkdirprog=${MKDIRPROG-mkdir}
+mvprog=${MVPROG-mv}
+rmprog=${RMPROG-rm}
+stripprog=${STRIPPROG-strip}
+
+posix_glob='?'
+initialize_posix_glob='
+ test "$posix_glob" != "?" || {
+ if (set -f) 2>/dev/null; then
+ posix_glob=
+ else
+ posix_glob=:
+ fi
+ }
+'
+
+posix_mkdir=
+
+# Desired mode of installed file.
+mode=0755
+
+chgrpcmd=
+chmodcmd=$chmodprog
+chowncmd=
+mvcmd=$mvprog
+rmcmd="$rmprog -f"
+stripcmd=
+
+src=
+dst=
+dir_arg=
+dst_arg=
+
+copy_on_change=false
+no_target_directory=
+
+usage="\
+Usage: $0 [OPTION]... [-T] SRCFILE DSTFILE
+ or: $0 [OPTION]... SRCFILES... DIRECTORY
+ or: $0 [OPTION]... -t DIRECTORY SRCFILES...
+ or: $0 [OPTION]... -d DIRECTORIES...
+
+In the 1st form, copy SRCFILE to DSTFILE.
+In the 2nd and 3rd, copy all SRCFILES to DIRECTORY.
+In the 4th, create DIRECTORIES.
+
+Options:
+ --help display this help and exit.
+ --version display version info and exit.
+
+ -c (ignored)
+ -C install only if different (preserve the last data modification time)
+ -d create directories instead of installing files.
+ -g GROUP $chgrpprog installed files to GROUP.
+ -m MODE $chmodprog installed files to MODE.
+ -o USER $chownprog installed files to USER.
+ -s $stripprog installed files.
+ -t DIRECTORY install into DIRECTORY.
+ -T report an error if DSTFILE is a directory.
+
+Environment variables override the default commands:
+ CHGRPPROG CHMODPROG CHOWNPROG CMPPROG CPPROG MKDIRPROG MVPROG
+ RMPROG STRIPPROG
+"
+
+while test $# -ne 0; do
+ case $1 in
+ -c) ;;
+
+ -C) copy_on_change=true;;
+
+ -d) dir_arg=true;;
+
+ -g) chgrpcmd="$chgrpprog $2"
+ shift;;
+
+ --help) echo "$usage"; exit $?;;
+
+ -m) mode=$2
+ case $mode in
+ *' '* | *' '* | *'
+'* | *'*'* | *'?'* | *'['*)
+ echo "$0: invalid mode: $mode" >&2
+ exit 1;;
+ esac
+ shift;;
+
+ -o) chowncmd="$chownprog $2"
+ shift;;
+
+ -s) stripcmd=$stripprog;;
+
+ -t) dst_arg=$2
+ # Protect names problematic for 'test' and other utilities.
+ case $dst_arg in
+ -* | [=\(\)!]) dst_arg=./$dst_arg;;
+ esac
+ shift;;
+
+ -T) no_target_directory=true;;
+
+ --version) echo "$0 $scriptversion"; exit $?;;
+
+ --) shift
+ break;;
+
+ -*) echo "$0: invalid option: $1" >&2
+ exit 1;;
+
+ *) break;;
+ esac
+ shift
+done
+
+if test $# -ne 0 && test -z "$dir_arg$dst_arg"; then
+ # When -d is used, all remaining arguments are directories to create.
+ # When -t is used, the destination is already specified.
+ # Otherwise, the last argument is the destination. Remove it from $@.
+ for arg
+ do
+ if test -n "$dst_arg"; then
+ # $@ is not empty: it contains at least $arg.
+ set fnord "$@" "$dst_arg"
+ shift # fnord
+ fi
+ shift # arg
+ dst_arg=$arg
+ # Protect names problematic for 'test' and other utilities.
+ case $dst_arg in
+ -* | [=\(\)!]) dst_arg=./$dst_arg;;
+ esac
+ done
+fi
+
+if test $# -eq 0; then
+ if test -z "$dir_arg"; then
+ echo "$0: no input file specified." >&2
+ exit 1
+ fi
+ # It's OK to call 'install-sh -d' without argument.
+ # This can happen when creating conditional directories.
+ exit 0
+fi
+
+if test -z "$dir_arg"; then
+ do_exit='(exit $ret); exit $ret'
+ trap "ret=129; $do_exit" 1
+ trap "ret=130; $do_exit" 2
+ trap "ret=141; $do_exit" 13
+ trap "ret=143; $do_exit" 15
+
+ # Set umask so as not to create temps with too-generous modes.
+ # However, 'strip' requires both read and write access to temps.
+ case $mode in
+ # Optimize common cases.
+ *644) cp_umask=133;;
+ *755) cp_umask=22;;
+
+ *[0-7])
+ if test -z "$stripcmd"; then
+ u_plus_rw=
+ else
+ u_plus_rw='% 200'
+ fi
+ cp_umask=`expr '(' 777 - $mode % 1000 ')' $u_plus_rw`;;
+ *)
+ if test -z "$stripcmd"; then
+ u_plus_rw=
+ else
+ u_plus_rw=,u+rw
+ fi
+ cp_umask=$mode$u_plus_rw;;
+ esac
+fi
+
+for src
+do
+ # Protect names problematic for 'test' and other utilities.
+ case $src in
+ -* | [=\(\)!]) src=./$src;;
+ esac
+
+ if test -n "$dir_arg"; then
+ dst=$src
+ dstdir=$dst
+ test -d "$dstdir"
+ dstdir_status=$?
+ else
+
+ # Waiting for this to be detected by the "$cpprog $src $dsttmp" command
+ # might cause directories to be created, which would be especially bad
+ # if $src (and thus $dsttmp) contains '*'.
+ if test ! -f "$src" && test ! -d "$src"; then
+ echo "$0: $src does not exist." >&2
+ exit 1
+ fi
+
+ if test -z "$dst_arg"; then
+ echo "$0: no destination specified." >&2
+ exit 1
+ fi
+ dst=$dst_arg
+
+ # If destination is a directory, append the input filename; won't work
+ # if double slashes aren't ignored.
+ if test -d "$dst"; then
+ if test -n "$no_target_directory"; then
+ echo "$0: $dst_arg: Is a directory" >&2
+ exit 1
+ fi
+ dstdir=$dst
+ dst=$dstdir/`basename "$src"`
+ dstdir_status=0
+ else
+ # Prefer dirname, but fall back on a substitute if dirname fails.
+ dstdir=`
+ (dirname "$dst") 2>/dev/null ||
+ expr X"$dst" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+ X"$dst" : 'X\(//\)[^/]' \| \
+ X"$dst" : 'X\(//\)$' \| \
+ X"$dst" : 'X\(/\)' \| . 2>/dev/null ||
+ echo X"$dst" |
+ sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)[^/].*/{
+ s//\1/
+ q
+ }
+ /^X\(\/\/\)$/{
+ s//\1/
+ q
+ }
+ /^X\(\/\).*/{
+ s//\1/
+ q
+ }
+ s/.*/./; q'
+ `
+
+ test -d "$dstdir"
+ dstdir_status=$?
+ fi
+ fi
+
+ obsolete_mkdir_used=false
+
+ if test $dstdir_status != 0; then
+ case $posix_mkdir in
+ '')
+ # Create intermediate dirs using mode 755 as modified by the umask.
+ # This is like FreeBSD 'install' as of 1997-10-28.
+ umask=`umask`
+ case $stripcmd.$umask in
+ # Optimize common cases.
+ *[2367][2367]) mkdir_umask=$umask;;
+ .*0[02][02] | .[02][02] | .[02]) mkdir_umask=22;;
+
+ *[0-7])
+ mkdir_umask=`expr $umask + 22 \
+ - $umask % 100 % 40 + $umask % 20 \
+ - $umask % 10 % 4 + $umask % 2
+ `;;
+ *) mkdir_umask=$umask,go-w;;
+ esac
+
+ # With -d, create the new directory with the user-specified mode.
+ # Otherwise, rely on $mkdir_umask.
+ if test -n "$dir_arg"; then
+ mkdir_mode=-m$mode
+ else
+ mkdir_mode=
+ fi
+
+ posix_mkdir=false
+ case $umask in
+ *[123567][0-7][0-7])
+ # POSIX mkdir -p sets u+wx bits regardless of umask, which
+ # is incompatible with FreeBSD 'install' when (umask & 300) != 0.
+ ;;
+ *)
+ tmpdir=${TMPDIR-/tmp}/ins$RANDOM-$$
+ trap 'ret=$?; rmdir "$tmpdir/d" "$tmpdir" 2>/dev/null; exit $ret' 0
+
+ if (umask $mkdir_umask &&
+ exec $mkdirprog $mkdir_mode -p -- "$tmpdir/d") >/dev/null 2>&1
+ then
+ if test -z "$dir_arg" || {
+ # Check for POSIX incompatibilities with -m.
+ # HP-UX 11.23 and IRIX 6.5 mkdir -m -p sets group- or
+ # other-writable bit of parent directory when it shouldn't.
+ # FreeBSD 6.1 mkdir -m -p sets mode of existing directory.
+ ls_ld_tmpdir=`ls -ld "$tmpdir"`
+ case $ls_ld_tmpdir in
+ d????-?r-*) different_mode=700;;
+ d????-?--*) different_mode=755;;
+ *) false;;
+ esac &&
+ $mkdirprog -m$different_mode -p -- "$tmpdir" && {
+ ls_ld_tmpdir_1=`ls -ld "$tmpdir"`
+ test "$ls_ld_tmpdir" = "$ls_ld_tmpdir_1"
+ }
+ }
+ then posix_mkdir=:
+ fi
+ rmdir "$tmpdir/d" "$tmpdir"
+ else
+ # Remove any dirs left behind by ancient mkdir implementations.
+ rmdir ./$mkdir_mode ./-p ./-- 2>/dev/null
+ fi
+ trap '' 0;;
+ esac;;
+ esac
+
+ if
+ $posix_mkdir && (
+ umask $mkdir_umask &&
+ $doit_exec $mkdirprog $mkdir_mode -p -- "$dstdir"
+ )
+ then :
+ else
+
+ # The umask is ridiculous, or mkdir does not conform to POSIX,
+ # or it failed possibly due to a race condition. Create the
+ # directory the slow way, step by step, checking for races as we go.
+
+ case $dstdir in
+ /*) prefix='/';;
+ [-=\(\)!]*) prefix='./';;
+ *) prefix='';;
+ esac
+
+ eval "$initialize_posix_glob"
+
+ oIFS=$IFS
+ IFS=/
+ $posix_glob set -f
+ set fnord $dstdir
+ shift
+ $posix_glob set +f
+ IFS=$oIFS
+
+ prefixes=
+
+ for d
+ do
+ test X"$d" = X && continue
+
+ prefix=$prefix$d
+ if test -d "$prefix"; then
+ prefixes=
+ else
+ if $posix_mkdir; then
+ (umask=$mkdir_umask &&
+ $doit_exec $mkdirprog $mkdir_mode -p -- "$dstdir") && break
+ # Don't fail if two instances are running concurrently.
+ test -d "$prefix" || exit 1
+ else
+ case $prefix in
+ *\'*) qprefix=`echo "$prefix" | sed "s/'/'\\\\\\\\''/g"`;;
+ *) qprefix=$prefix;;
+ esac
+ prefixes="$prefixes '$qprefix'"
+ fi
+ fi
+ prefix=$prefix/
+ done
+
+ if test -n "$prefixes"; then
+ # Don't fail if two instances are running concurrently.
+ (umask $mkdir_umask &&
+ eval "\$doit_exec \$mkdirprog $prefixes") ||
+ test -d "$dstdir" || exit 1
+ obsolete_mkdir_used=true
+ fi
+ fi
+ fi
+
+ if test -n "$dir_arg"; then
+ { test -z "$chowncmd" || $doit $chowncmd "$dst"; } &&
+ { test -z "$chgrpcmd" || $doit $chgrpcmd "$dst"; } &&
+ { test "$obsolete_mkdir_used$chowncmd$chgrpcmd" = false ||
+ test -z "$chmodcmd" || $doit $chmodcmd $mode "$dst"; } || exit 1
+ else
+
+ # Make a couple of temp file names in the proper directory.
+ dsttmp=$dstdir/_inst.$$_
+ rmtmp=$dstdir/_rm.$$_
+
+ # Trap to clean up those temp files at exit.
+ trap 'ret=$?; rm -f "$dsttmp" "$rmtmp" && exit $ret' 0
+
+ # Copy the file name to the temp name.
+ (umask $cp_umask && $doit_exec $cpprog "$src" "$dsttmp") &&
+
+ # and set any options; do chmod last to preserve setuid bits.
+ #
+ # If any of these fail, we abort the whole thing. If we want to
+ # ignore errors from any of these, just make sure not to ignore
+ # errors from the above "$doit $cpprog $src $dsttmp" command.
+ #
+ { test -z "$chowncmd" || $doit $chowncmd "$dsttmp"; } &&
+ { test -z "$chgrpcmd" || $doit $chgrpcmd "$dsttmp"; } &&
+ { test -z "$stripcmd" || $doit $stripcmd "$dsttmp"; } &&
+ { test -z "$chmodcmd" || $doit $chmodcmd $mode "$dsttmp"; } &&
+
+ # If -C, don't bother to copy if it wouldn't change the file.
+ if $copy_on_change &&
+ old=`LC_ALL=C ls -dlL "$dst" 2>/dev/null` &&
+ new=`LC_ALL=C ls -dlL "$dsttmp" 2>/dev/null` &&
+
+ eval "$initialize_posix_glob" &&
+ $posix_glob set -f &&
+ set X $old && old=:$2:$4:$5:$6 &&
+ set X $new && new=:$2:$4:$5:$6 &&
+ $posix_glob set +f &&
+
+ test "$old" = "$new" &&
+ $cmpprog "$dst" "$dsttmp" >/dev/null 2>&1
+ then
+ rm -f "$dsttmp"
+ else
+ # Rename the file to the real destination.
+ $doit $mvcmd -f "$dsttmp" "$dst" 2>/dev/null ||
+
+ # The rename failed, perhaps because mv can't rename something else
+ # to itself, or perhaps because mv is so ancient that it does not
+ # support -f.
+ {
+ # Now remove or move aside any old file at destination location.
+ # We try this two ways since rm can't unlink itself on some
+ # systems and the destination file might be busy for other
+ # reasons. In this case, the final cleanup might fail but the new
+ # file should still install successfully.
+ {
+ test ! -f "$dst" ||
+ $doit $rmcmd -f "$dst" 2>/dev/null ||
+ { $doit $mvcmd -f "$dst" "$rmtmp" 2>/dev/null &&
+ { $doit $rmcmd -f "$rmtmp" 2>/dev/null; :; }
+ } ||
+ { echo "$0: cannot unlink or rename $dst" >&2
+ (exit 1); exit 1
+ }
+ } &&
+
+ # Now rename the file to the real destination.
+ $doit $mvcmd "$dsttmp" "$dst"
+ }
+ fi || exit 1
+
+ trap '' 0
+ fi
+done
+
+# Local variables:
+# eval: (add-hook 'write-file-hooks 'time-stamp)
+# time-stamp-start: "scriptversion="
+# time-stamp-format: "%:y-%02m-%02d.%02H"
+# time-stamp-time-zone: "UTC"
+# time-stamp-end: "; # UTC"
+# End:
diff --git a/libs/Makefile.am b/libs/Makefile.am
new file mode 100644
index 0000000..8f39c5c
--- /dev/null
+++ b/libs/Makefile.am
@@ -0,0 +1,5 @@
+# (C) 2015, Fabian Klötzl <fabian at kloetzl.info> ISC License
+
+noinst_LIBRARIES= libpfasta.a
+libpfasta_a_SOURCES= pfasta.c pfasta.h
+libpfasta_a_CPPFLAGS= -I$(top_srcdir)/opt
diff --git a/libs/Makefile.in b/libs/Makefile.in
new file mode 100644
index 0000000..a5cda35
--- /dev/null
+++ b/libs/Makefile.in
@@ -0,0 +1,549 @@
+# Makefile.in generated by automake 1.14.1 from Makefile.am.
+# @configure_input@
+
+# Copyright (C) 1994-2013 Free Software Foundation, Inc.
+
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+ at SET_MAKE@
+
+# (C) 2015, Fabian Klötzl <fabian at kloetzl.info> ISC License
+
+VPATH = @srcdir@
+am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
+am__make_running_with_option = \
+ case $${target_option-} in \
+ ?) ;; \
+ *) echo "am__make_running_with_option: internal error: invalid" \
+ "target option '$${target_option-}' specified" >&2; \
+ exit 1;; \
+ esac; \
+ has_opt=no; \
+ sane_makeflags=$$MAKEFLAGS; \
+ if $(am__is_gnu_make); then \
+ sane_makeflags=$$MFLAGS; \
+ else \
+ case $$MAKEFLAGS in \
+ *\\[\ \ ]*) \
+ bs=\\; \
+ sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
+ | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
+ esac; \
+ fi; \
+ skip_next=no; \
+ strip_trailopt () \
+ { \
+ flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
+ }; \
+ for flg in $$sane_makeflags; do \
+ test $$skip_next = yes && { skip_next=no; continue; }; \
+ case $$flg in \
+ *=*|--*) continue;; \
+ -*I) strip_trailopt 'I'; skip_next=yes;; \
+ -*I?*) strip_trailopt 'I';; \
+ -*O) strip_trailopt 'O'; skip_next=yes;; \
+ -*O?*) strip_trailopt 'O';; \
+ -*l) strip_trailopt 'l'; skip_next=yes;; \
+ -*l?*) strip_trailopt 'l';; \
+ -[dEDm]) skip_next=yes;; \
+ -[JT]) skip_next=yes;; \
+ esac; \
+ case $$flg in \
+ *$$target_option*) has_opt=yes; break;; \
+ esac; \
+ done; \
+ test $$has_opt = yes
+am__make_dryrun = (target_option=n; $(am__make_running_with_option))
+am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
+pkgdatadir = $(datadir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkglibexecdir = $(libexecdir)/@PACKAGE@
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+subdir = libs
+DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
+ $(top_srcdir)/depcomp
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+am__aclocal_m4_deps = $(top_srcdir)/m4/ax_cxx_compile_stdcxx_11.m4 \
+ $(top_srcdir)/configure.ac
+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
+ $(ACLOCAL_M4)
+mkinstalldirs = $(install_sh) -d
+CONFIG_HEADER = $(top_builddir)/src/config.h
+CONFIG_CLEAN_FILES =
+CONFIG_CLEAN_VPATH_FILES =
+LIBRARIES = $(noinst_LIBRARIES)
+ARFLAGS = cru
+AM_V_AR = $(am__v_AR_ at AM_V@)
+am__v_AR_ = $(am__v_AR_ at AM_DEFAULT_V@)
+am__v_AR_0 = @echo " AR " $@;
+am__v_AR_1 =
+libpfasta_a_AR = $(AR) $(ARFLAGS)
+libpfasta_a_LIBADD =
+am_libpfasta_a_OBJECTS = libpfasta_a-pfasta.$(OBJEXT)
+libpfasta_a_OBJECTS = $(am_libpfasta_a_OBJECTS)
+AM_V_P = $(am__v_P_ at AM_V@)
+am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
+am__v_P_0 = false
+am__v_P_1 = :
+AM_V_GEN = $(am__v_GEN_ at AM_V@)
+am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
+am__v_GEN_0 = @echo " GEN " $@;
+am__v_GEN_1 =
+AM_V_at = $(am__v_at_ at AM_V@)
+am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
+am__v_at_0 = @
+am__v_at_1 =
+DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)/src
+depcomp = $(SHELL) $(top_srcdir)/depcomp
+am__depfiles_maybe = depfiles
+am__mv = mv -f
+AM_V_lt = $(am__v_lt_ at AM_V@)
+am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
+am__v_lt_0 = --silent
+am__v_lt_1 =
+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
+ $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
+AM_V_CC = $(am__v_CC_ at AM_V@)
+am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
+am__v_CC_0 = @echo " CC " $@;
+am__v_CC_1 =
+CCLD = $(CC)
+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
+AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
+am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
+am__v_CCLD_0 = @echo " CCLD " $@;
+am__v_CCLD_1 =
+SOURCES = $(libpfasta_a_SOURCES)
+DIST_SOURCES = $(libpfasta_a_SOURCES)
+am__can_run_installinfo = \
+ case $$AM_UPDATE_INFO_DIR in \
+ n|no|NO) false;; \
+ *) (install-info --version) >/dev/null 2>&1;; \
+ esac
+am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
+# Read a list of newline-separated strings from the standard input,
+# and print each of them once, without duplicates. Input order is
+# *not* preserved.
+am__uniquify_input = $(AWK) '\
+ BEGIN { nonempty = 0; } \
+ { items[$$0] = 1; nonempty = 1; } \
+ END { if (nonempty) { for (i in items) print i; }; } \
+'
+# Make sure the list of sources is unique. This is necessary because,
+# e.g., the same source file might be shared among _SOURCES variables
+# for different programs/libraries.
+am__define_uniq_tagged_files = \
+ list='$(am__tagged_files)'; \
+ unique=`for i in $$list; do \
+ if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+ done | $(am__uniquify_input)`
+ETAGS = etags
+CTAGS = ctags
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+ACLOCAL = @ACLOCAL@
+AMTAR = @AMTAR@
+AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
+AR = @AR@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CXX = @CXX@
+CXXDEPMODE = @CXXDEPMODE@
+CXXFLAGS = @CXXFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+EXEEXT = @EXEEXT@
+GLIB_CFLAGS = @GLIB_CFLAGS@
+GLIB_LIBS = @GLIB_LIBS@
+GREP = @GREP@
+HAVE_CXX11 = @HAVE_CXX11@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+MKDIR_P = @MKDIR_P@
+OBJEXT = @OBJEXT@
+OPENMP_CFLAGS = @OPENMP_CFLAGS@
+OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+PKG_CONFIG = @PKG_CONFIG@
+PKG_CONFIG_LIBDIR = @PKG_CONFIG_LIBDIR@
+PKG_CONFIG_PATH = @PKG_CONFIG_PATH@
+RANLIB = @RANLIB@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
+ac_ct_AR = @ac_ct_AR@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_CXX = @ac_ct_CXX@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+am__tar = @am__tar@
+am__untar = @am__untar@
+bindir = @bindir@
+build_alias = @build_alias@
+builddir = @builddir@
+datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
+exec_prefix = @exec_prefix@
+host_alias = @host_alias@
+htmldir = @htmldir@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localedir = @localedir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+mkdir_p = @mkdir_p@
+oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+psdir = @psdir@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+top_build_prefix = @top_build_prefix@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
+noinst_LIBRARIES = libpfasta.a
+libpfasta_a_SOURCES = pfasta.c pfasta.h
+libpfasta_a_CPPFLAGS = -I$(top_srcdir)/opt
+all: all-am
+
+.SUFFIXES:
+.SUFFIXES: .c .o .obj
+$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
+ @for dep in $?; do \
+ case '$(am__configure_deps)' in \
+ *$$dep*) \
+ ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
+ && { if test -f $@; then exit 0; else break; fi; }; \
+ exit 1;; \
+ esac; \
+ done; \
+ echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign libs/Makefile'; \
+ $(am__cd) $(top_srcdir) && \
+ $(AUTOMAKE) --foreign libs/Makefile
+.PRECIOUS: Makefile
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+ @case '$?' in \
+ *config.status*) \
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
+ *) \
+ echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
+ cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
+ esac;
+
+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+
+$(top_srcdir)/configure: $(am__configure_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(ACLOCAL_M4): $(am__aclocal_m4_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(am__aclocal_m4_deps):
+
+clean-noinstLIBRARIES:
+ -test -z "$(noinst_LIBRARIES)" || rm -f $(noinst_LIBRARIES)
+
+libpfasta.a: $(libpfasta_a_OBJECTS) $(libpfasta_a_DEPENDENCIES) $(EXTRA_libpfasta_a_DEPENDENCIES)
+ $(AM_V_at)-rm -f libpfasta.a
+ $(AM_V_AR)$(libpfasta_a_AR) libpfasta.a $(libpfasta_a_OBJECTS) $(libpfasta_a_LIBADD)
+ $(AM_V_at)$(RANLIB) libpfasta.a
+
+mostlyclean-compile:
+ -rm -f *.$(OBJEXT)
+
+distclean-compile:
+ -rm -f *.tab.c
+
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libpfasta_a-pfasta.Po at am__quote@
+
+.c.o:
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(COMPILE) -c -o $@ $<
+
+.c.obj:
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(COMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+
+libpfasta_a-pfasta.o: pfasta.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpfasta_a_CPPFLAGS) $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) -MT libpfasta_a-pfasta.o -MD -MP -MF $(DEPDIR)/libpfasta_a-pfasta.Tpo -c -o libpfasta_a-pfasta.o `test -f 'pfasta.c' || echo '$(srcdir)/'`pfasta.c
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libpfasta_a-pfasta.Tpo $(DEPDIR)/libpfasta_a-pfasta.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='pfasta.c' object='libpfasta_a-pfasta.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpfasta_a_CPPFLAGS) $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) -c -o libpfasta_a-pfasta.o `test -f 'pfasta.c' || echo '$(srcdir)/'`pfasta.c
+
+libpfasta_a-pfasta.obj: pfasta.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpfasta_a_CPPFLAGS) $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) -MT libpfasta_a-pfasta.obj -MD -MP -MF $(DEPDIR)/libpfasta_a-pfasta.Tpo -c -o libpfasta_a-pfasta.obj `if test -f 'pfasta.c'; then $(CYGPATH_W) 'pfasta.c'; else $(CYGPATH_W) '$(srcdir)/pfasta.c'; fi`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libpfasta_a-pfasta.Tpo $(DEPDIR)/libpfasta_a-pfasta.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='pfasta.c' object='libpfasta_a-pfasta.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpfasta_a_CPPFLAGS) $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS) -c -o libpfasta_a-pfasta.obj `if test -f 'pfasta.c'; then $(CYGPATH_W) 'pfasta.c'; else $(CYGPATH_W) '$(srcdir)/pfasta.c'; fi`
+
+ID: $(am__tagged_files)
+ $(am__define_uniq_tagged_files); mkid -fID $$unique
+tags: tags-am
+TAGS: tags
+
+tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ set x; \
+ here=`pwd`; \
+ $(am__define_uniq_tagged_files); \
+ shift; \
+ if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
+ test -n "$$unique" || unique=$$empty_fix; \
+ if test $$# -gt 0; then \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ "$$@" $$unique; \
+ else \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ $$unique; \
+ fi; \
+ fi
+ctags: ctags-am
+
+CTAGS: ctags
+ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ $(am__define_uniq_tagged_files); \
+ test -z "$(CTAGS_ARGS)$$unique" \
+ || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
+ $$unique
+
+GTAGS:
+ here=`$(am__cd) $(top_builddir) && pwd` \
+ && $(am__cd) $(top_srcdir) \
+ && gtags -i $(GTAGS_ARGS) "$$here"
+cscopelist: cscopelist-am
+
+cscopelist-am: $(am__tagged_files)
+ list='$(am__tagged_files)'; \
+ case "$(srcdir)" in \
+ [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
+ *) sdir=$(subdir)/$(srcdir) ;; \
+ esac; \
+ for i in $$list; do \
+ if test -f "$$i"; then \
+ echo "$(subdir)/$$i"; \
+ else \
+ echo "$$sdir/$$i"; \
+ fi; \
+ done >> $(top_builddir)/cscope.files
+
+distclean-tags:
+ -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
+
+distdir: $(DISTFILES)
+ @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ list='$(DISTFILES)'; \
+ dist_files=`for file in $$list; do echo $$file; done | \
+ sed -e "s|^$$srcdirstrip/||;t" \
+ -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+ case $$dist_files in \
+ */*) $(MKDIR_P) `echo "$$dist_files" | \
+ sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+ sort -u` ;; \
+ esac; \
+ for file in $$dist_files; do \
+ if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+ if test -d $$d/$$file; then \
+ dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
+ if test -d "$(distdir)/$$file"; then \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+ cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
+ else \
+ test -f "$(distdir)/$$file" \
+ || cp -p $$d/$$file "$(distdir)/$$file" \
+ || exit 1; \
+ fi; \
+ done
+check-am: all-am
+check: check-am
+all-am: Makefile $(LIBRARIES)
+installdirs:
+install: install-am
+install-exec: install-exec-am
+install-data: install-data-am
+uninstall: uninstall-am
+
+install-am: all-am
+ @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-am
+install-strip:
+ if test -z '$(STRIP)'; then \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ install; \
+ else \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+ fi
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+ -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
+ -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
+
+maintainer-clean-generic:
+ @echo "This command is intended for maintainers to use"
+ @echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
+clean-am: clean-generic clean-noinstLIBRARIES mostlyclean-am
+
+distclean: distclean-am
+ -rm -rf ./$(DEPDIR)
+ -rm -f Makefile
+distclean-am: clean-am distclean-compile distclean-generic \
+ distclean-tags
+
+dvi: dvi-am
+
+dvi-am:
+
+html: html-am
+
+html-am:
+
+info: info-am
+
+info-am:
+
+install-data-am:
+
+install-dvi: install-dvi-am
+
+install-dvi-am:
+
+install-exec-am:
+
+install-html: install-html-am
+
+install-html-am:
+
+install-info: install-info-am
+
+install-info-am:
+
+install-man:
+
+install-pdf: install-pdf-am
+
+install-pdf-am:
+
+install-ps: install-ps-am
+
+install-ps-am:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-am
+ -rm -rf ./$(DEPDIR)
+ -rm -f Makefile
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-am
+
+mostlyclean-am: mostlyclean-compile mostlyclean-generic
+
+pdf: pdf-am
+
+pdf-am:
+
+ps: ps-am
+
+ps-am:
+
+uninstall-am:
+
+.MAKE: install-am install-strip
+
+.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean clean-generic \
+ clean-noinstLIBRARIES cscopelist-am ctags ctags-am distclean \
+ distclean-compile distclean-generic distclean-tags distdir dvi \
+ dvi-am html html-am info info-am install install-am \
+ install-data install-data-am install-dvi install-dvi-am \
+ install-exec install-exec-am install-html install-html-am \
+ install-info install-info-am install-man install-pdf \
+ install-pdf-am install-ps install-ps-am install-strip \
+ installcheck installcheck-am installdirs maintainer-clean \
+ maintainer-clean-generic mostlyclean mostlyclean-compile \
+ mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
+ uninstall-am
+
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
diff --git a/libs/pfasta.c b/libs/pfasta.c
new file mode 100644
index 0000000..c54cea7
--- /dev/null
+++ b/libs/pfasta.c
@@ -0,0 +1,439 @@
+/*
+ * Copyright (c) 2015, Fabian Klötzl <fabian-pfasta at kloetzl.info>
+ *
+ * Permission to use, copy, modify, and/or distribute this software for any
+ * purpose with or without fee is hereby granted, provided that the above
+ * copyright notice and this permission notice appear in all copies.
+ *
+ * THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
+ * WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
+ * MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
+ * ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
+ * WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
+ * ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
+ * OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
+ *
+ */
+
+#include <assert.h>
+#include <ctype.h>
+#include <errno.h>
+#include <stdint.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
+#include <sys/types.h>
+#include <unistd.h>
+
+#include <compat-stdlib.h>
+#include "pfasta.h"
+
+#define BUFFERSIZE 4096
+
+/** @file
+ *
+ * Welcome to the code of `pfasta`, the pedantic FASTA parser. For future
+ * reference I here explain some general, noteworthy things about the code.
+ *
+ * - Most functions returning an `int` follow the zero-errors convention. On
+ * success a `0` is returned. A negative number indicates an error. Positive
+ * numbers can be used to signal a different exceptional state (i.e. EOF).
+ * - All functions use pointers to objects for their parameters.
+ * - The low-level Unix `read(2)` function is used to grab bytes from a file
+ * descriptor. These are stored in a buffer. The contents of this buffer is
+ * checked one char at a time and then appended to string buffer. Finally,
+ * the resulting strings are returned.
+ * - To work around the fact that C has no exceptions, I declare some nifty
+ * macros below.
+ * - As the length of the sequences are not known in advance I implemented a
+ * simple structure for growable strings called `dynstr`. One character at
+ * a time can be appended using `dynstr_put`. Internally an array is
+ * realloced with growth factor 1.5.
+ * - The functions which do the actual parsing are prefixed `pfasta_read_*`.
+ */
+
+#define PF_EXIT_ERRNO() \
+ do { \
+ pf->errno__ = errno; \
+ pf->errstr = NULL; \
+ return errno; \
+ } while (0)
+
+#define PF_EXIT_FORWARD() return -1
+
+#define PF_FAIL_FORWARD() \
+ do { \
+ return_code = -1; \
+ goto cleanup; \
+ } while (0)
+
+#define PF_FAIL_ERRNO() \
+ do { \
+ pf->errno__ = errno; \
+ pf->errstr = NULL; \
+ return_code = errno; \
+ goto cleanup; \
+ } while (0)
+
+#define PF_FAIL_STR(str) \
+ do { \
+ pf->errno__ = 0; \
+ pf->errstr = str; \
+ return_code = -1; \
+ goto cleanup; \
+ } while (0)
+
+static int buffer_init(pfasta_file *pf);
+static inline int buffer_peek(const pfasta_file *pf);
+static inline int buffer_adv(pfasta_file *pf);
+static int buffer_read(pfasta_file *pf);
+
+typedef struct dynstr {
+ char *str;
+ size_t capacity, count;
+} dynstr;
+
+static inline int dynstr_init(dynstr *ds);
+static inline int dynstr_put(dynstr *ds, char c);
+static inline void dynstr_free(dynstr *ds);
+static inline char *dynstr_move(dynstr *ds);
+static inline size_t dynstr_len(const dynstr *ds);
+
+int pfasta_read_name(pfasta_file *pf, pfasta_seq *ps);
+int pfasta_read_comment(pfasta_file *pf, pfasta_seq *ps);
+int pfasta_read_seq(pfasta_file *pf, pfasta_seq *ps);
+
+/*
+ * When reading from a buffer, basically three things can happen.
+ *
+ * 1. Bytes are read (success)
+ * 2. Low-level error (fail)
+ * 3. No more bytes (EOF)
+ *
+ * A low-level error is indicated by `buffer_adv` returning non-zero. As
+ * end-of-file is technically a successful read, EOF is instead signalled by
+ * `buffer_peek`.
+ */
+
+/** @brief Initialises the read buffer. First, memory is allocated and then
+ * filled. Both operations may fail. But this ensure we detect problems with
+ * an unreadable file at the the initialisation of the parser!
+ *
+ * @param pf - The parser we want to initialise.
+ * @returns 0 iff successful.
+ */
+static int buffer_init(pfasta_file *pf) {
+ char *buffer = malloc(BUFFERSIZE);
+ if (!buffer) PF_EXIT_ERRNO();
+
+ pf->buffer = pf->readptr = pf->fillptr = buffer;
+ if (buffer_read(pf) < 0) PF_EXIT_FORWARD();
+ return 0;
+}
+
+/** @brief Returns the current character or EOF.
+ *
+ * @param pf - The parser to read from.
+ * @returns The current character or EOF.
+ */
+static inline int buffer_peek(const pfasta_file *pf) {
+ if (pf->readptr < pf->fillptr) {
+ return (int)*(pf->readptr);
+ }
+ return EOF;
+}
+
+/** @brief Advances the read pointer in the buffer to the next character. If
+ * needed, the buffer is filled with fresh bytes. A non-zero value is returned
+ * if reading fails.
+ *
+ * @param pf - The parser which should be advanced.
+ * @returns 0 iff successful.
+ */
+static inline int buffer_adv(pfasta_file *pf) {
+ if (pf->readptr < pf->fillptr - 1) {
+ pf->readptr++;
+ return 0;
+ }
+
+ if (buffer_read(pf) < 0) PF_EXIT_FORWARD();
+
+ return 0;
+}
+
+/** @brief Fills the buffer with new data.
+ *
+ * @param pf - The parser which should be updated.
+ * @returns 0 iff successful.
+ */
+static int buffer_read(pfasta_file *pf) {
+ ssize_t count = read(pf->fd, pf->buffer, BUFFERSIZE);
+ if (count < 0) PF_EXIT_ERRNO();
+ if (count == 0) { // EOF
+ pf->fillptr = pf->buffer;
+ pf->readptr = pf->buffer + 1;
+ return 1;
+ }
+
+ pf->readptr = pf->buffer;
+ pf->fillptr = pf->buffer + count;
+
+ return 0;
+}
+
+/** @brief Frees all data associated with a parser. Also nulls pointers to avoid
+ * a potential double-free.
+ *
+ * @param pf - The parser that shall be freed.
+ */
+void pfasta_free(pfasta_file *pf) {
+ if (!pf) return;
+ free(pf->buffer);
+ pf->buffer = pf->readptr = pf->fillptr = pf->errstr = NULL;
+ pf->errno__ = 0;
+ pf->fd = -1;
+}
+
+/** @brief Creates a new parser for the given file. This includes allocating the
+ * buffer and reading the first few bytes. These are then used to break on empty
+ * or non-FASTA files.
+ *
+ * @param pf - A pointer to the parser structure we intend to initialise. No
+ * assumption is made about the referenced memory except its existence.
+ * @returns 0 iff successful.
+ */
+int pfasta_parse(pfasta_file *pf, int file_descriptor) {
+ assert(pf && file_descriptor >= 0);
+ int return_code = 0;
+
+ pf->errno__ = 0;
+ pf->buffer = pf->readptr = pf->fillptr = pf->errstr = NULL;
+ pf->fd = file_descriptor;
+
+ if (buffer_init(pf) != 0) PF_FAIL_FORWARD();
+
+ int c = buffer_peek(pf);
+ if (c == EOF) PF_FAIL_STR("Empty file");
+ if (c != '>') PF_FAIL_STR("File does not start with '>'");
+
+cleanup:
+ return return_code;
+}
+
+/** @brief Frees the memory of a FASTA sequence. **/
+void pfasta_seq_free(pfasta_seq *ps) {
+ if (!ps) return;
+ free(ps->name);
+ free(ps->comment);
+ free(ps->seq);
+ ps->name = ps->comment = ps->seq = NULL;
+}
+
+/** @brief Reads the next sequence from the parser into the memory pointed to by
+ * the parameter `ps`. This may fail for various reasons. No matter, what
+ * happens, always free `ps` after usage!
+ *
+ * @param pf - The parser to read from.
+ * @param ps - A reference to memory for the sequence data.
+ *
+ * @returns 0 if successful, 1 if the end of the file was reached and a negative
+ * number on error.
+ */
+int pfasta_read(pfasta_file *pf, pfasta_seq *ps) {
+ assert(pf && ps && pf->buffer);
+ *ps = (pfasta_seq){NULL, NULL, NULL};
+ int return_code = 0;
+
+ if (buffer_peek(pf) == EOF) return 1;
+ if (buffer_peek(pf) != '>') PF_FAIL_STR("Expected '>'");
+
+ if (pfasta_read_name(pf, ps) < 0) PF_FAIL_FORWARD();
+ if (isblank(buffer_peek(pf))) {
+ if (pfasta_read_comment(pf, ps) < 0) PF_FAIL_FORWARD();
+ }
+ if (pfasta_read_seq(pf, ps) < 0) PF_FAIL_FORWARD();
+
+ // Skip blank lines
+ while (buffer_peek(pf) == '\n') {
+ if (buffer_adv(pf) != 0) PF_FAIL_FORWARD();
+ }
+
+cleanup:
+ return return_code;
+}
+
+/** @brief Reads the sequence name and saves it into the structure.
+ *
+ * @param pf - The parser used for reading.
+ * @param ps - The structure used to hold the name, later.
+ *
+ * @returns 0 iff successful
+ */
+int pfasta_read_name(pfasta_file *pf, pfasta_seq *ps) {
+ int return_code = 0;
+ dynstr name;
+ if (dynstr_init(&name) != 0) PF_FAIL_ERRNO();
+
+ while (1) {
+ if (buffer_adv(pf) != 0) PF_FAIL_FORWARD();
+
+ int c = buffer_peek(pf);
+ if (c == EOF) PF_FAIL_STR("Unexpected EOF in sequence name");
+ if (!isgraph(c)) break;
+
+ if (dynstr_put(&name, c) != 0) PF_FAIL_ERRNO();
+ }
+
+ if (dynstr_len(&name) == 0) PF_FAIL_STR("Empty name");
+
+ ps->name = dynstr_move(&name);
+
+cleanup:
+ dynstr_free(&name);
+ return return_code;
+}
+
+/** @brief Reads the sequence comment and saves it into the structure.
+ *
+ * @param pf - The parser used for reading.
+ * @param ps - The structure used to hold the comment, later.
+ *
+ * @returns 0 iff successful
+ */
+int pfasta_read_comment(pfasta_file *pf, pfasta_seq *ps) {
+ int return_code = 0;
+ dynstr comment;
+ if (dynstr_init(&comment) != 0) PF_FAIL_ERRNO();
+
+ while (1) {
+ if (buffer_adv(pf) != 0) PF_FAIL_FORWARD();
+
+ int c = buffer_peek(pf);
+ if (c == EOF) PF_FAIL_STR("Unexpected EOF in sequence comment");
+ if (c == '\n') break;
+
+ if (dynstr_put(&comment, c) != 0) PF_FAIL_ERRNO();
+ }
+
+ ps->comment = dynstr_move(&comment);
+
+cleanup:
+ dynstr_free(&comment);
+ return return_code;
+}
+
+/** @brief Reads the sequence data and saves it into the structure.
+ *
+ * @param pf - The parser used for reading.
+ * @param ps - The structure used to hold the data, later.
+ *
+ * @returns 0 iff successful
+ */
+int pfasta_read_seq(pfasta_file *pf, pfasta_seq *ps) {
+ int return_code = 0;
+ dynstr seq;
+ if (dynstr_init(&seq) != 0) PF_FAIL_ERRNO();
+
+ while (1) {
+ assert(buffer_peek(pf) == '\n');
+
+ // deal with the first character explicitly
+ if (buffer_adv(pf) != 0) PF_FAIL_FORWARD();
+
+ int c = buffer_peek(pf);
+ if (c == EOF || c == '>' || c == '\n') break;
+
+ goto regular;
+
+ // read line
+ while (1) {
+ if (buffer_adv(pf) != 0) PF_FAIL_FORWARD();
+
+ c = buffer_peek(pf);
+ if (c == '\n') break;
+
+ regular:
+ if (!isgraph(c)) PF_FAIL_STR("Unexpected character in sequence");
+ if (dynstr_put(&seq, c) != 0) PF_FAIL_ERRNO();
+ }
+ }
+
+ if (dynstr_len(&seq) == 0) PF_FAIL_STR("Empty sequence");
+ ps->seq = dynstr_move(&seq);
+
+cleanup:
+ dynstr_free(&seq);
+ return return_code;
+}
+
+/** @brief Returns an explanatory string for encountered errors. */
+const char *pfasta_strerror(const pfasta_file *pf) {
+ if (!pf) return NULL;
+ if (pf->errno__ == 0) {
+ return pf->errstr;
+ } else {
+ return strerror(pf->errno__);
+ }
+}
+
+/** @brief Creates a new string that can grow dynamically.
+ *
+ * @param ds - A reference to the dynstr container.
+ *
+ * @returns 0 iff successful.
+ */
+static inline int dynstr_init(dynstr *ds) {
+ *ds = (dynstr){NULL, 0, 0};
+ ds->str = malloc(61);
+ if (!ds->str) return -1;
+ ds->str[0] = '\0';
+ ds->capacity = 61;
+ return 0;
+}
+
+/** @brief A append a character to a string.
+ *
+ * @param ds - A reference to the dynstr container.
+ * @param c - The new character.
+ *
+ * @returns 0 iff successful.
+ */
+static inline int dynstr_put(dynstr *ds, char c) {
+ if (ds->count >= ds->capacity - 1) {
+ char *neu = reallocarray(ds->str, ds->capacity / 2, 3);
+ if (!neu) {
+ dynstr_free(ds);
+ return -1;
+ }
+ ds->str = neu;
+ ds->capacity = (ds->capacity / 2) * 3;
+ }
+
+ ds->str[ds->count++] = c;
+ return 0;
+}
+
+/** @brief Frees a dynamic string. */
+static inline void dynstr_free(dynstr *ds) {
+ if (!ds) return;
+ free(ds->str);
+ *ds = (dynstr){NULL, 0, 0};
+}
+
+/** @brief Returns the string as a standard `char*`. The internal reference is
+ * then deleted. Hence the name *move* as in *move semantics*.
+ *
+ * @param ds - The dynamic string to move from.
+ *
+ * @returns a `char*` to a standard null-terminated string.
+ */
+
+static inline char *dynstr_move(dynstr *ds) {
+ char *out = ds->str;
+ out[ds->count] = '\0';
+ *ds = (dynstr){NULL, 0, 0};
+ return out;
+}
+
+/** @brief Returns the current length of the dynamic string. */
+static inline size_t dynstr_len(const dynstr *ds) { return ds->count; }
diff --git a/libs/pfasta.h b/libs/pfasta.h
new file mode 100644
index 0000000..603cff1
--- /dev/null
+++ b/libs/pfasta.h
@@ -0,0 +1,39 @@
+/*
+ * Copyright (c) 2015, Fabian Klötzl <fabian-pfasta at kloetzl.info>
+ *
+ * Permission to use, copy, modify, and/or distribute this software for any
+ * purpose with or without fee is hereby granted, provided that the above
+ * copyright notice and this permission notice appear in all copies.
+ *
+ * THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
+ * WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
+ * MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
+ * ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
+ * WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
+ * ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
+ * OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
+ *
+ */
+
+#ifndef PFASTA_H
+#define PFASTA_H
+
+typedef struct pfasta_file {
+ char *buffer, *readptr, *fillptr;
+ char *errstr;
+ int errno__;
+ int fd;
+} pfasta_file;
+
+typedef struct pfasta_seq {
+ char *name, *comment, *seq;
+} pfasta_seq;
+
+int pfasta_parse(pfasta_file *, int file_descriptor);
+void pfasta_free(pfasta_file *);
+void pfasta_seq_free(pfasta_seq *);
+int pfasta_read(pfasta_file *, pfasta_seq *);
+
+const char *pfasta_strerror(const pfasta_file *);
+
+#endif /* PFASTA_H */
diff --git a/m4/ax_cxx_compile_stdcxx_11.m4 b/m4/ax_cxx_compile_stdcxx_11.m4
new file mode 100644
index 0000000..f3779d6
--- /dev/null
+++ b/m4/ax_cxx_compile_stdcxx_11.m4
@@ -0,0 +1,162 @@
+# ============================================================================
+# http://www.gnu.org/software/autoconf-archive/ax_cxx_compile_stdcxx_11.html
+# ============================================================================
+#
+# SYNOPSIS
+#
+# AX_CXX_COMPILE_STDCXX_11([ext|noext],[mandatory|optional])
+#
+# DESCRIPTION
+#
+# Check for baseline language coverage in the compiler for the C++11
+# standard; if necessary, add switches to CXXFLAGS to enable support.
+#
+# The first argument, if specified, indicates whether you insist on an
+# extended mode (e.g. -std=gnu++11) or a strict conformance mode (e.g.
+# -std=c++11). If neither is specified, you get whatever works, with
+# preference for an extended mode.
+#
+# The second argument, if specified 'mandatory' or if left unspecified,
+# indicates that baseline C++11 support is required and that the macro
+# should error out if no mode with that support is found. If specified
+# 'optional', then configuration proceeds regardless, after defining
+# HAVE_CXX11 if and only if a supporting mode is found.
+#
+# LICENSE
+#
+# Copyright (c) 2008 Benjamin Kosnik <bkoz at redhat.com>
+# Copyright (c) 2012 Zack Weinberg <zackw at panix.com>
+# Copyright (c) 2013 Roy Stogner <roystgnr at ices.utexas.edu>
+# Copyright (c) 2014 Alexey Sokolov <sokolov at google.com>
+# Copyright (c) 2014, 2015 Google Inc.
+#
+# Copying and distribution of this file, with or without modification, are
+# permitted in any medium without royalty provided the copyright notice
+# and this notice are preserved. This file is offered as-is, without any
+# warranty.
+
+#serial 7
+
+m4_define([_AX_CXX_COMPILE_STDCXX_11_testbody], [[
+ template <typename T>
+ struct check
+ {
+ static_assert(sizeof(int) <= sizeof(T), "not big enough");
+ };
+
+ struct Base {
+ virtual void f() {}
+ };
+ struct Child : public Base {
+ virtual void f() override {}
+ };
+
+ typedef check<check<bool>> right_angle_brackets;
+
+ int a;
+ decltype(a) b;
+
+ typedef check<int> check_type;
+ check_type c;
+ check_type&& cr = static_cast<check_type&&>(c);
+
+ auto d = a;
+ auto l = [](){};
+
+ // http://stackoverflow.com/questions/13728184/template-aliases-and-sfinae
+ // Clang 3.1 fails with headers of libstd++ 4.8.3 when using std::function because of this
+ namespace test_template_alias_sfinae {
+ struct foo {};
+
+ template<typename T>
+ using member = typename T::member_type;
+
+ template<typename T>
+ void func(...) {}
+
+ template<typename T>
+ void func(member<T>*) {}
+
+ void test() {
+ func<foo>(0);
+ }
+ }
+]])
+
+AC_DEFUN([AX_CXX_COMPILE_STDCXX_11], [dnl
+ m4_if([$1], [], [],
+ [$1], [ext], [],
+ [$1], [noext], [],
+ [m4_fatal([invalid argument `$1' to AX_CXX_COMPILE_STDCXX_11])])dnl
+ m4_if([$2], [], [ax_cxx_compile_cxx11_required=true],
+ [$2], [mandatory], [ax_cxx_compile_cxx11_required=true],
+ [$2], [optional], [ax_cxx_compile_cxx11_required=false],
+ [m4_fatal([invalid second argument `$2' to AX_CXX_COMPILE_STDCXX_11])])
+ AC_LANG_PUSH([C++])dnl
+ ac_success=no
+ AC_CACHE_CHECK(whether $CXX supports C++11 features by default,
+ ax_cv_cxx_compile_cxx11,
+ [AC_COMPILE_IFELSE([AC_LANG_SOURCE([_AX_CXX_COMPILE_STDCXX_11_testbody])],
+ [ax_cv_cxx_compile_cxx11=yes],
+ [ax_cv_cxx_compile_cxx11=no])])
+ if test x$ax_cv_cxx_compile_cxx11 = xyes; then
+ ac_success=yes
+ fi
+
+ m4_if([$1], [noext], [], [dnl
+ if test x$ac_success = xno; then
+ for switch in -std=gnu++11 -std=gnu++0x; do
+ cachevar=AS_TR_SH([ax_cv_cxx_compile_cxx11_$switch])
+ AC_CACHE_CHECK(whether $CXX supports C++11 features with $switch,
+ $cachevar,
+ [ac_save_CXXFLAGS="$CXXFLAGS"
+ CXXFLAGS="$CXXFLAGS $switch"
+ AC_COMPILE_IFELSE([AC_LANG_SOURCE([_AX_CXX_COMPILE_STDCXX_11_testbody])],
+ [eval $cachevar=yes],
+ [eval $cachevar=no])
+ CXXFLAGS="$ac_save_CXXFLAGS"])
+ if eval test x\$$cachevar = xyes; then
+ CXXFLAGS="$CXXFLAGS $switch"
+ ac_success=yes
+ break
+ fi
+ done
+ fi])
+
+ m4_if([$1], [ext], [], [dnl
+ if test x$ac_success = xno; then
+ for switch in -std=c++11 -std=c++0x; do
+ cachevar=AS_TR_SH([ax_cv_cxx_compile_cxx11_$switch])
+ AC_CACHE_CHECK(whether $CXX supports C++11 features with $switch,
+ $cachevar,
+ [ac_save_CXXFLAGS="$CXXFLAGS"
+ CXXFLAGS="$CXXFLAGS $switch"
+ AC_COMPILE_IFELSE([AC_LANG_SOURCE([_AX_CXX_COMPILE_STDCXX_11_testbody])],
+ [eval $cachevar=yes],
+ [eval $cachevar=no])
+ CXXFLAGS="$ac_save_CXXFLAGS"])
+ if eval test x\$$cachevar = xyes; then
+ CXXFLAGS="$CXXFLAGS $switch"
+ ac_success=yes
+ break
+ fi
+ done
+ fi])
+ AC_LANG_POP([C++])
+ if test x$ax_cxx_compile_cxx11_required = xtrue; then
+ if test x$ac_success = xno; then
+ AC_MSG_ERROR([*** A compiler with support for C++11 language features is required.])
+ fi
+ else
+ if test x$ac_success = xno; then
+ HAVE_CXX11=0
+ AC_MSG_NOTICE([No compiler with C++11 support was found])
+ else
+ HAVE_CXX11=1
+ AC_DEFINE(HAVE_CXX11,1,
+ [define if the compiler supports basic C++11 syntax])
+ fi
+
+ AC_SUBST(HAVE_CXX11)
+ fi
+])
diff --git a/missing b/missing
new file mode 100755
index 0000000..db98974
--- /dev/null
+++ b/missing
@@ -0,0 +1,215 @@
+#! /bin/sh
+# Common wrapper for a few potentially missing GNU programs.
+
+scriptversion=2013-10-28.13; # UTC
+
+# Copyright (C) 1996-2013 Free Software Foundation, Inc.
+# Originally written by Fran,cois Pinard <pinard at iro.umontreal.ca>, 1996.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program. If not, see <http://www.gnu.org/licenses/>.
+
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+if test $# -eq 0; then
+ echo 1>&2 "Try '$0 --help' for more information"
+ exit 1
+fi
+
+case $1 in
+
+ --is-lightweight)
+ # Used by our autoconf macros to check whether the available missing
+ # script is modern enough.
+ exit 0
+ ;;
+
+ --run)
+ # Back-compat with the calling convention used by older automake.
+ shift
+ ;;
+
+ -h|--h|--he|--hel|--help)
+ echo "\
+$0 [OPTION]... PROGRAM [ARGUMENT]...
+
+Run 'PROGRAM [ARGUMENT]...', returning a proper advice when this fails due
+to PROGRAM being missing or too old.
+
+Options:
+ -h, --help display this help and exit
+ -v, --version output version information and exit
+
+Supported PROGRAM values:
+ aclocal autoconf autoheader autom4te automake makeinfo
+ bison yacc flex lex help2man
+
+Version suffixes to PROGRAM as well as the prefixes 'gnu-', 'gnu', and
+'g' are ignored when checking the name.
+
+Send bug reports to <bug-automake at gnu.org>."
+ exit $?
+ ;;
+
+ -v|--v|--ve|--ver|--vers|--versi|--versio|--version)
+ echo "missing $scriptversion (GNU Automake)"
+ exit $?
+ ;;
+
+ -*)
+ echo 1>&2 "$0: unknown '$1' option"
+ echo 1>&2 "Try '$0 --help' for more information"
+ exit 1
+ ;;
+
+esac
+
+# Run the given program, remember its exit status.
+"$@"; st=$?
+
+# If it succeeded, we are done.
+test $st -eq 0 && exit 0
+
+# Also exit now if we it failed (or wasn't found), and '--version' was
+# passed; such an option is passed most likely to detect whether the
+# program is present and works.
+case $2 in --version|--help) exit $st;; esac
+
+# Exit code 63 means version mismatch. This often happens when the user
+# tries to use an ancient version of a tool on a file that requires a
+# minimum version.
+if test $st -eq 63; then
+ msg="probably too old"
+elif test $st -eq 127; then
+ # Program was missing.
+ msg="missing on your system"
+else
+ # Program was found and executed, but failed. Give up.
+ exit $st
+fi
+
+perl_URL=http://www.perl.org/
+flex_URL=http://flex.sourceforge.net/
+gnu_software_URL=http://www.gnu.org/software
+
+program_details ()
+{
+ case $1 in
+ aclocal|automake)
+ echo "The '$1' program is part of the GNU Automake package:"
+ echo "<$gnu_software_URL/automake>"
+ echo "It also requires GNU Autoconf, GNU m4 and Perl in order to run:"
+ echo "<$gnu_software_URL/autoconf>"
+ echo "<$gnu_software_URL/m4/>"
+ echo "<$perl_URL>"
+ ;;
+ autoconf|autom4te|autoheader)
+ echo "The '$1' program is part of the GNU Autoconf package:"
+ echo "<$gnu_software_URL/autoconf/>"
+ echo "It also requires GNU m4 and Perl in order to run:"
+ echo "<$gnu_software_URL/m4/>"
+ echo "<$perl_URL>"
+ ;;
+ esac
+}
+
+give_advice ()
+{
+ # Normalize program name to check for.
+ normalized_program=`echo "$1" | sed '
+ s/^gnu-//; t
+ s/^gnu//; t
+ s/^g//; t'`
+
+ printf '%s\n' "'$1' is $msg."
+
+ configure_deps="'configure.ac' or m4 files included by 'configure.ac'"
+ case $normalized_program in
+ autoconf*)
+ echo "You should only need it if you modified 'configure.ac',"
+ echo "or m4 files included by it."
+ program_details 'autoconf'
+ ;;
+ autoheader*)
+ echo "You should only need it if you modified 'acconfig.h' or"
+ echo "$configure_deps."
+ program_details 'autoheader'
+ ;;
+ automake*)
+ echo "You should only need it if you modified 'Makefile.am' or"
+ echo "$configure_deps."
+ program_details 'automake'
+ ;;
+ aclocal*)
+ echo "You should only need it if you modified 'acinclude.m4' or"
+ echo "$configure_deps."
+ program_details 'aclocal'
+ ;;
+ autom4te*)
+ echo "You might have modified some maintainer files that require"
+ echo "the 'autom4te' program to be rebuilt."
+ program_details 'autom4te'
+ ;;
+ bison*|yacc*)
+ echo "You should only need it if you modified a '.y' file."
+ echo "You may want to install the GNU Bison package:"
+ echo "<$gnu_software_URL/bison/>"
+ ;;
+ lex*|flex*)
+ echo "You should only need it if you modified a '.l' file."
+ echo "You may want to install the Fast Lexical Analyzer package:"
+ echo "<$flex_URL>"
+ ;;
+ help2man*)
+ echo "You should only need it if you modified a dependency" \
+ "of a man page."
+ echo "You may want to install the GNU Help2man package:"
+ echo "<$gnu_software_URL/help2man/>"
+ ;;
+ makeinfo*)
+ echo "You should only need it if you modified a '.texi' file, or"
+ echo "any other file indirectly affecting the aspect of the manual."
+ echo "You might want to install the Texinfo package:"
+ echo "<$gnu_software_URL/texinfo/>"
+ echo "The spurious makeinfo call might also be the consequence of"
+ echo "using a buggy 'make' (AIX, DU, IRIX), in which case you might"
+ echo "want to install GNU make:"
+ echo "<$gnu_software_URL/make/>"
+ ;;
+ *)
+ echo "You might have modified some files without having the proper"
+ echo "tools for further handling them. Check the 'README' file, it"
+ echo "often tells you about the needed prerequisites for installing"
+ echo "this package. You may also peek at any GNU archive site, in"
+ echo "case some other package contains this missing '$1' program."
+ ;;
+ esac
+}
+
+give_advice "$1" | sed -e '1s/^/WARNING: /' \
+ -e '2,$s/^/ /' >&2
+
+# Propagate the correct exit status (expected to be 127 for a program
+# not found, 63 for a program that failed due to version mismatch).
+exit $st
+
+# Local variables:
+# eval: (add-hook 'write-file-hooks 'time-stamp)
+# time-stamp-start: "scriptversion="
+# time-stamp-format: "%:y-%02m-%02d.%02H"
+# time-stamp-time-zone: "UTC"
+# time-stamp-end: "; # UTC"
+# End:
diff --git a/opt/Makefile.am b/opt/Makefile.am
new file mode 100644
index 0000000..4a10fa8
--- /dev/null
+++ b/opt/Makefile.am
@@ -0,0 +1,10 @@
+noinst_LIBRARIES= libcompat.a
+libcompat_a_SOURCES= compat-string.h compat-stdlib.h
+
+if !HAVE_STRCHRNUL
+libcompat_a_SOURCES+= strchrnul.c
+endif
+
+if !HAVE_REALLOCARRAY
+libcompat_a_SOURCES+= reallocarray.c
+endif
diff --git a/opt/Makefile.in b/opt/Makefile.in
new file mode 100644
index 0000000..7bc339a
--- /dev/null
+++ b/opt/Makefile.in
@@ -0,0 +1,536 @@
+# Makefile.in generated by automake 1.14.1 from Makefile.am.
+# @configure_input@
+
+# Copyright (C) 1994-2013 Free Software Foundation, Inc.
+
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+ at SET_MAKE@
+
+VPATH = @srcdir@
+am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
+am__make_running_with_option = \
+ case $${target_option-} in \
+ ?) ;; \
+ *) echo "am__make_running_with_option: internal error: invalid" \
+ "target option '$${target_option-}' specified" >&2; \
+ exit 1;; \
+ esac; \
+ has_opt=no; \
+ sane_makeflags=$$MAKEFLAGS; \
+ if $(am__is_gnu_make); then \
+ sane_makeflags=$$MFLAGS; \
+ else \
+ case $$MAKEFLAGS in \
+ *\\[\ \ ]*) \
+ bs=\\; \
+ sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
+ | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
+ esac; \
+ fi; \
+ skip_next=no; \
+ strip_trailopt () \
+ { \
+ flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
+ }; \
+ for flg in $$sane_makeflags; do \
+ test $$skip_next = yes && { skip_next=no; continue; }; \
+ case $$flg in \
+ *=*|--*) continue;; \
+ -*I) strip_trailopt 'I'; skip_next=yes;; \
+ -*I?*) strip_trailopt 'I';; \
+ -*O) strip_trailopt 'O'; skip_next=yes;; \
+ -*O?*) strip_trailopt 'O';; \
+ -*l) strip_trailopt 'l'; skip_next=yes;; \
+ -*l?*) strip_trailopt 'l';; \
+ -[dEDm]) skip_next=yes;; \
+ -[JT]) skip_next=yes;; \
+ esac; \
+ case $$flg in \
+ *$$target_option*) has_opt=yes; break;; \
+ esac; \
+ done; \
+ test $$has_opt = yes
+am__make_dryrun = (target_option=n; $(am__make_running_with_option))
+am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
+pkgdatadir = $(datadir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkglibexecdir = $(libexecdir)/@PACKAGE@
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+ at HAVE_STRCHRNUL_FALSE@am__append_1 = strchrnul.c
+ at HAVE_REALLOCARRAY_FALSE@am__append_2 = reallocarray.c
+subdir = opt
+DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
+ $(top_srcdir)/depcomp
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+am__aclocal_m4_deps = $(top_srcdir)/m4/ax_cxx_compile_stdcxx_11.m4 \
+ $(top_srcdir)/configure.ac
+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
+ $(ACLOCAL_M4)
+mkinstalldirs = $(install_sh) -d
+CONFIG_HEADER = $(top_builddir)/src/config.h
+CONFIG_CLEAN_FILES =
+CONFIG_CLEAN_VPATH_FILES =
+LIBRARIES = $(noinst_LIBRARIES)
+ARFLAGS = cru
+AM_V_AR = $(am__v_AR_ at AM_V@)
+am__v_AR_ = $(am__v_AR_ at AM_DEFAULT_V@)
+am__v_AR_0 = @echo " AR " $@;
+am__v_AR_1 =
+libcompat_a_AR = $(AR) $(ARFLAGS)
+libcompat_a_LIBADD =
+am__libcompat_a_SOURCES_DIST = compat-string.h compat-stdlib.h \
+ strchrnul.c reallocarray.c
+ at HAVE_STRCHRNUL_FALSE@am__objects_1 = strchrnul.$(OBJEXT)
+ at HAVE_REALLOCARRAY_FALSE@am__objects_2 = reallocarray.$(OBJEXT)
+am_libcompat_a_OBJECTS = $(am__objects_1) $(am__objects_2)
+libcompat_a_OBJECTS = $(am_libcompat_a_OBJECTS)
+AM_V_P = $(am__v_P_ at AM_V@)
+am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
+am__v_P_0 = false
+am__v_P_1 = :
+AM_V_GEN = $(am__v_GEN_ at AM_V@)
+am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
+am__v_GEN_0 = @echo " GEN " $@;
+am__v_GEN_1 =
+AM_V_at = $(am__v_at_ at AM_V@)
+am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
+am__v_at_0 = @
+am__v_at_1 =
+DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)/src
+depcomp = $(SHELL) $(top_srcdir)/depcomp
+am__depfiles_maybe = depfiles
+am__mv = mv -f
+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
+ $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
+AM_V_CC = $(am__v_CC_ at AM_V@)
+am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
+am__v_CC_0 = @echo " CC " $@;
+am__v_CC_1 =
+CCLD = $(CC)
+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
+AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
+am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
+am__v_CCLD_0 = @echo " CCLD " $@;
+am__v_CCLD_1 =
+SOURCES = $(libcompat_a_SOURCES)
+DIST_SOURCES = $(am__libcompat_a_SOURCES_DIST)
+am__can_run_installinfo = \
+ case $$AM_UPDATE_INFO_DIR in \
+ n|no|NO) false;; \
+ *) (install-info --version) >/dev/null 2>&1;; \
+ esac
+am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
+# Read a list of newline-separated strings from the standard input,
+# and print each of them once, without duplicates. Input order is
+# *not* preserved.
+am__uniquify_input = $(AWK) '\
+ BEGIN { nonempty = 0; } \
+ { items[$$0] = 1; nonempty = 1; } \
+ END { if (nonempty) { for (i in items) print i; }; } \
+'
+# Make sure the list of sources is unique. This is necessary because,
+# e.g., the same source file might be shared among _SOURCES variables
+# for different programs/libraries.
+am__define_uniq_tagged_files = \
+ list='$(am__tagged_files)'; \
+ unique=`for i in $$list; do \
+ if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+ done | $(am__uniquify_input)`
+ETAGS = etags
+CTAGS = ctags
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+ACLOCAL = @ACLOCAL@
+AMTAR = @AMTAR@
+AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
+AR = @AR@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CXX = @CXX@
+CXXDEPMODE = @CXXDEPMODE@
+CXXFLAGS = @CXXFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+EXEEXT = @EXEEXT@
+GLIB_CFLAGS = @GLIB_CFLAGS@
+GLIB_LIBS = @GLIB_LIBS@
+GREP = @GREP@
+HAVE_CXX11 = @HAVE_CXX11@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+MKDIR_P = @MKDIR_P@
+OBJEXT = @OBJEXT@
+OPENMP_CFLAGS = @OPENMP_CFLAGS@
+OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+PKG_CONFIG = @PKG_CONFIG@
+PKG_CONFIG_LIBDIR = @PKG_CONFIG_LIBDIR@
+PKG_CONFIG_PATH = @PKG_CONFIG_PATH@
+RANLIB = @RANLIB@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
+ac_ct_AR = @ac_ct_AR@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_CXX = @ac_ct_CXX@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+am__tar = @am__tar@
+am__untar = @am__untar@
+bindir = @bindir@
+build_alias = @build_alias@
+builddir = @builddir@
+datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
+exec_prefix = @exec_prefix@
+host_alias = @host_alias@
+htmldir = @htmldir@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localedir = @localedir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+mkdir_p = @mkdir_p@
+oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+psdir = @psdir@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+top_build_prefix = @top_build_prefix@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
+noinst_LIBRARIES = libcompat.a
+libcompat_a_SOURCES = compat-string.h compat-stdlib.h $(am__append_1) \
+ $(am__append_2)
+all: all-am
+
+.SUFFIXES:
+.SUFFIXES: .c .o .obj
+$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
+ @for dep in $?; do \
+ case '$(am__configure_deps)' in \
+ *$$dep*) \
+ ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
+ && { if test -f $@; then exit 0; else break; fi; }; \
+ exit 1;; \
+ esac; \
+ done; \
+ echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign opt/Makefile'; \
+ $(am__cd) $(top_srcdir) && \
+ $(AUTOMAKE) --foreign opt/Makefile
+.PRECIOUS: Makefile
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+ @case '$?' in \
+ *config.status*) \
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
+ *) \
+ echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
+ cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
+ esac;
+
+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+
+$(top_srcdir)/configure: $(am__configure_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(ACLOCAL_M4): $(am__aclocal_m4_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(am__aclocal_m4_deps):
+
+clean-noinstLIBRARIES:
+ -test -z "$(noinst_LIBRARIES)" || rm -f $(noinst_LIBRARIES)
+
+libcompat.a: $(libcompat_a_OBJECTS) $(libcompat_a_DEPENDENCIES) $(EXTRA_libcompat_a_DEPENDENCIES)
+ $(AM_V_at)-rm -f libcompat.a
+ $(AM_V_AR)$(libcompat_a_AR) libcompat.a $(libcompat_a_OBJECTS) $(libcompat_a_LIBADD)
+ $(AM_V_at)$(RANLIB) libcompat.a
+
+mostlyclean-compile:
+ -rm -f *.$(OBJEXT)
+
+distclean-compile:
+ -rm -f *.tab.c
+
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/reallocarray.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/strchrnul.Po at am__quote@
+
+.c.o:
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(COMPILE) -c -o $@ $<
+
+.c.obj:
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(COMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+
+ID: $(am__tagged_files)
+ $(am__define_uniq_tagged_files); mkid -fID $$unique
+tags: tags-am
+TAGS: tags
+
+tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ set x; \
+ here=`pwd`; \
+ $(am__define_uniq_tagged_files); \
+ shift; \
+ if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
+ test -n "$$unique" || unique=$$empty_fix; \
+ if test $$# -gt 0; then \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ "$$@" $$unique; \
+ else \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ $$unique; \
+ fi; \
+ fi
+ctags: ctags-am
+
+CTAGS: ctags
+ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ $(am__define_uniq_tagged_files); \
+ test -z "$(CTAGS_ARGS)$$unique" \
+ || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
+ $$unique
+
+GTAGS:
+ here=`$(am__cd) $(top_builddir) && pwd` \
+ && $(am__cd) $(top_srcdir) \
+ && gtags -i $(GTAGS_ARGS) "$$here"
+cscopelist: cscopelist-am
+
+cscopelist-am: $(am__tagged_files)
+ list='$(am__tagged_files)'; \
+ case "$(srcdir)" in \
+ [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
+ *) sdir=$(subdir)/$(srcdir) ;; \
+ esac; \
+ for i in $$list; do \
+ if test -f "$$i"; then \
+ echo "$(subdir)/$$i"; \
+ else \
+ echo "$$sdir/$$i"; \
+ fi; \
+ done >> $(top_builddir)/cscope.files
+
+distclean-tags:
+ -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
+
+distdir: $(DISTFILES)
+ @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ list='$(DISTFILES)'; \
+ dist_files=`for file in $$list; do echo $$file; done | \
+ sed -e "s|^$$srcdirstrip/||;t" \
+ -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+ case $$dist_files in \
+ */*) $(MKDIR_P) `echo "$$dist_files" | \
+ sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+ sort -u` ;; \
+ esac; \
+ for file in $$dist_files; do \
+ if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+ if test -d $$d/$$file; then \
+ dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
+ if test -d "$(distdir)/$$file"; then \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+ cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
+ else \
+ test -f "$(distdir)/$$file" \
+ || cp -p $$d/$$file "$(distdir)/$$file" \
+ || exit 1; \
+ fi; \
+ done
+check-am: all-am
+check: check-am
+all-am: Makefile $(LIBRARIES)
+installdirs:
+install: install-am
+install-exec: install-exec-am
+install-data: install-data-am
+uninstall: uninstall-am
+
+install-am: all-am
+ @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-am
+install-strip:
+ if test -z '$(STRIP)'; then \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ install; \
+ else \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+ fi
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+ -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
+ -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
+
+maintainer-clean-generic:
+ @echo "This command is intended for maintainers to use"
+ @echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
+clean-am: clean-generic clean-noinstLIBRARIES mostlyclean-am
+
+distclean: distclean-am
+ -rm -rf ./$(DEPDIR)
+ -rm -f Makefile
+distclean-am: clean-am distclean-compile distclean-generic \
+ distclean-tags
+
+dvi: dvi-am
+
+dvi-am:
+
+html: html-am
+
+html-am:
+
+info: info-am
+
+info-am:
+
+install-data-am:
+
+install-dvi: install-dvi-am
+
+install-dvi-am:
+
+install-exec-am:
+
+install-html: install-html-am
+
+install-html-am:
+
+install-info: install-info-am
+
+install-info-am:
+
+install-man:
+
+install-pdf: install-pdf-am
+
+install-pdf-am:
+
+install-ps: install-ps-am
+
+install-ps-am:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-am
+ -rm -rf ./$(DEPDIR)
+ -rm -f Makefile
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-am
+
+mostlyclean-am: mostlyclean-compile mostlyclean-generic
+
+pdf: pdf-am
+
+pdf-am:
+
+ps: ps-am
+
+ps-am:
+
+uninstall-am:
+
+.MAKE: install-am install-strip
+
+.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean clean-generic \
+ clean-noinstLIBRARIES cscopelist-am ctags ctags-am distclean \
+ distclean-compile distclean-generic distclean-tags distdir dvi \
+ dvi-am html html-am info info-am install install-am \
+ install-data install-data-am install-dvi install-dvi-am \
+ install-exec install-exec-am install-html install-html-am \
+ install-info install-info-am install-man install-pdf \
+ install-pdf-am install-ps install-ps-am install-strip \
+ installcheck installcheck-am installdirs maintainer-clean \
+ maintainer-clean-generic mostlyclean mostlyclean-compile \
+ mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
+ uninstall-am
+
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
diff --git a/opt/compat-stdlib.h b/opt/compat-stdlib.h
new file mode 100644
index 0000000..d7f02d5
--- /dev/null
+++ b/opt/compat-stdlib.h
@@ -0,0 +1,3 @@
+#include <stdlib.h>
+
+void *reallocarray(void *optr, size_t nmemb, size_t size);
diff --git a/opt/compat-string.h b/opt/compat-string.h
new file mode 100644
index 0000000..7f11975
--- /dev/null
+++ b/opt/compat-string.h
@@ -0,0 +1,3 @@
+#ifndef HAVE_STRCHRNUL
+char *strchrnul(const char *s, int c);
+#endif
diff --git a/opt/psufsort/Makefile.am b/opt/psufsort/Makefile.am
new file mode 100644
index 0000000..2682dc4
--- /dev/null
+++ b/opt/psufsort/Makefile.am
@@ -0,0 +1,4 @@
+noinst_LIBRARIES = libpsufsort.a
+libpsufsort_a_SOURCES = psufsort.cxx c_interface.cxx interface.h $(top_srcdir)/src/global.h
+libpsufsort_a_CXXFLAGS = $(OPENMP_CXXFLAGS) -W -Wall
+libpsufsort_a_CPPFLAGS = $(OPENMP_CXXFLAGS) -I$(top_srcdir)/src
diff --git a/opt/psufsort/Makefile.in b/opt/psufsort/Makefile.in
new file mode 100644
index 0000000..f98d7e1
--- /dev/null
+++ b/opt/psufsort/Makefile.in
@@ -0,0 +1,577 @@
+# Makefile.in generated by automake 1.14.1 from Makefile.am.
+# @configure_input@
+
+# Copyright (C) 1994-2013 Free Software Foundation, Inc.
+
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+ at SET_MAKE@
+
+VPATH = @srcdir@
+am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
+am__make_running_with_option = \
+ case $${target_option-} in \
+ ?) ;; \
+ *) echo "am__make_running_with_option: internal error: invalid" \
+ "target option '$${target_option-}' specified" >&2; \
+ exit 1;; \
+ esac; \
+ has_opt=no; \
+ sane_makeflags=$$MAKEFLAGS; \
+ if $(am__is_gnu_make); then \
+ sane_makeflags=$$MFLAGS; \
+ else \
+ case $$MAKEFLAGS in \
+ *\\[\ \ ]*) \
+ bs=\\; \
+ sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
+ | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
+ esac; \
+ fi; \
+ skip_next=no; \
+ strip_trailopt () \
+ { \
+ flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
+ }; \
+ for flg in $$sane_makeflags; do \
+ test $$skip_next = yes && { skip_next=no; continue; }; \
+ case $$flg in \
+ *=*|--*) continue;; \
+ -*I) strip_trailopt 'I'; skip_next=yes;; \
+ -*I?*) strip_trailopt 'I';; \
+ -*O) strip_trailopt 'O'; skip_next=yes;; \
+ -*O?*) strip_trailopt 'O';; \
+ -*l) strip_trailopt 'l'; skip_next=yes;; \
+ -*l?*) strip_trailopt 'l';; \
+ -[dEDm]) skip_next=yes;; \
+ -[JT]) skip_next=yes;; \
+ esac; \
+ case $$flg in \
+ *$$target_option*) has_opt=yes; break;; \
+ esac; \
+ done; \
+ test $$has_opt = yes
+am__make_dryrun = (target_option=n; $(am__make_running_with_option))
+am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
+pkgdatadir = $(datadir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkglibexecdir = $(libexecdir)/@PACKAGE@
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+subdir = opt/psufsort
+DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
+ $(top_srcdir)/depcomp
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+am__aclocal_m4_deps = $(top_srcdir)/m4/ax_cxx_compile_stdcxx_11.m4 \
+ $(top_srcdir)/configure.ac
+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
+ $(ACLOCAL_M4)
+mkinstalldirs = $(install_sh) -d
+CONFIG_HEADER = $(top_builddir)/src/config.h
+CONFIG_CLEAN_FILES =
+CONFIG_CLEAN_VPATH_FILES =
+LIBRARIES = $(noinst_LIBRARIES)
+ARFLAGS = cru
+AM_V_AR = $(am__v_AR_ at AM_V@)
+am__v_AR_ = $(am__v_AR_ at AM_DEFAULT_V@)
+am__v_AR_0 = @echo " AR " $@;
+am__v_AR_1 =
+libpsufsort_a_AR = $(AR) $(ARFLAGS)
+libpsufsort_a_LIBADD =
+am_libpsufsort_a_OBJECTS = libpsufsort_a-psufsort.$(OBJEXT) \
+ libpsufsort_a-c_interface.$(OBJEXT)
+libpsufsort_a_OBJECTS = $(am_libpsufsort_a_OBJECTS)
+AM_V_P = $(am__v_P_ at AM_V@)
+am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
+am__v_P_0 = false
+am__v_P_1 = :
+AM_V_GEN = $(am__v_GEN_ at AM_V@)
+am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
+am__v_GEN_0 = @echo " GEN " $@;
+am__v_GEN_1 =
+AM_V_at = $(am__v_at_ at AM_V@)
+am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
+am__v_at_0 = @
+am__v_at_1 =
+DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)/src
+depcomp = $(SHELL) $(top_srcdir)/depcomp
+am__depfiles_maybe = depfiles
+am__mv = mv -f
+AM_V_lt = $(am__v_lt_ at AM_V@)
+am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
+am__v_lt_0 = --silent
+am__v_lt_1 =
+CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
+ $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
+AM_V_CXX = $(am__v_CXX_ at AM_V@)
+am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
+am__v_CXX_0 = @echo " CXX " $@;
+am__v_CXX_1 =
+CXXLD = $(CXX)
+CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
+ -o $@
+AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
+am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
+am__v_CXXLD_0 = @echo " CXXLD " $@;
+am__v_CXXLD_1 =
+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
+ $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
+AM_V_CC = $(am__v_CC_ at AM_V@)
+am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
+am__v_CC_0 = @echo " CC " $@;
+am__v_CC_1 =
+CCLD = $(CC)
+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
+AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
+am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
+am__v_CCLD_0 = @echo " CCLD " $@;
+am__v_CCLD_1 =
+SOURCES = $(libpsufsort_a_SOURCES)
+DIST_SOURCES = $(libpsufsort_a_SOURCES)
+am__can_run_installinfo = \
+ case $$AM_UPDATE_INFO_DIR in \
+ n|no|NO) false;; \
+ *) (install-info --version) >/dev/null 2>&1;; \
+ esac
+am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
+# Read a list of newline-separated strings from the standard input,
+# and print each of them once, without duplicates. Input order is
+# *not* preserved.
+am__uniquify_input = $(AWK) '\
+ BEGIN { nonempty = 0; } \
+ { items[$$0] = 1; nonempty = 1; } \
+ END { if (nonempty) { for (i in items) print i; }; } \
+'
+# Make sure the list of sources is unique. This is necessary because,
+# e.g., the same source file might be shared among _SOURCES variables
+# for different programs/libraries.
+am__define_uniq_tagged_files = \
+ list='$(am__tagged_files)'; \
+ unique=`for i in $$list; do \
+ if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+ done | $(am__uniquify_input)`
+ETAGS = etags
+CTAGS = ctags
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+ACLOCAL = @ACLOCAL@
+AMTAR = @AMTAR@
+AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
+AR = @AR@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CXX = @CXX@
+CXXDEPMODE = @CXXDEPMODE@
+CXXFLAGS = @CXXFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+EXEEXT = @EXEEXT@
+GLIB_CFLAGS = @GLIB_CFLAGS@
+GLIB_LIBS = @GLIB_LIBS@
+GREP = @GREP@
+HAVE_CXX11 = @HAVE_CXX11@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+MKDIR_P = @MKDIR_P@
+OBJEXT = @OBJEXT@
+OPENMP_CFLAGS = @OPENMP_CFLAGS@
+OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+PKG_CONFIG = @PKG_CONFIG@
+PKG_CONFIG_LIBDIR = @PKG_CONFIG_LIBDIR@
+PKG_CONFIG_PATH = @PKG_CONFIG_PATH@
+RANLIB = @RANLIB@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
+ac_ct_AR = @ac_ct_AR@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_CXX = @ac_ct_CXX@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+am__tar = @am__tar@
+am__untar = @am__untar@
+bindir = @bindir@
+build_alias = @build_alias@
+builddir = @builddir@
+datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
+exec_prefix = @exec_prefix@
+host_alias = @host_alias@
+htmldir = @htmldir@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localedir = @localedir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+mkdir_p = @mkdir_p@
+oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+psdir = @psdir@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+top_build_prefix = @top_build_prefix@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
+noinst_LIBRARIES = libpsufsort.a
+libpsufsort_a_SOURCES = psufsort.cxx c_interface.cxx interface.h $(top_srcdir)/src/global.h
+libpsufsort_a_CXXFLAGS = $(OPENMP_CXXFLAGS) -W -Wall
+libpsufsort_a_CPPFLAGS = $(OPENMP_CXXFLAGS) -I$(top_srcdir)/src
+all: all-am
+
+.SUFFIXES:
+.SUFFIXES: .cxx .o .obj
+$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
+ @for dep in $?; do \
+ case '$(am__configure_deps)' in \
+ *$$dep*) \
+ ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
+ && { if test -f $@; then exit 0; else break; fi; }; \
+ exit 1;; \
+ esac; \
+ done; \
+ echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign opt/psufsort/Makefile'; \
+ $(am__cd) $(top_srcdir) && \
+ $(AUTOMAKE) --foreign opt/psufsort/Makefile
+.PRECIOUS: Makefile
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+ @case '$?' in \
+ *config.status*) \
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
+ *) \
+ echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
+ cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
+ esac;
+
+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+
+$(top_srcdir)/configure: $(am__configure_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(ACLOCAL_M4): $(am__aclocal_m4_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(am__aclocal_m4_deps):
+
+clean-noinstLIBRARIES:
+ -test -z "$(noinst_LIBRARIES)" || rm -f $(noinst_LIBRARIES)
+
+libpsufsort.a: $(libpsufsort_a_OBJECTS) $(libpsufsort_a_DEPENDENCIES) $(EXTRA_libpsufsort_a_DEPENDENCIES)
+ $(AM_V_at)-rm -f libpsufsort.a
+ $(AM_V_AR)$(libpsufsort_a_AR) libpsufsort.a $(libpsufsort_a_OBJECTS) $(libpsufsort_a_LIBADD)
+ $(AM_V_at)$(RANLIB) libpsufsort.a
+
+mostlyclean-compile:
+ -rm -f *.$(OBJEXT)
+
+distclean-compile:
+ -rm -f *.tab.c
+
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libpsufsort_a-c_interface.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libpsufsort_a-psufsort.Po at am__quote@
+
+.cxx.o:
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
+
+.cxx.obj:
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+
+libpsufsort_a-psufsort.o: psufsort.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpsufsort_a_CPPFLAGS) $(CPPFLAGS) $(libpsufsort_a_CXXFLAGS) $(CXXFLAGS) -MT libpsufsort_a-psufsort.o -MD -MP -MF $(DEPDIR)/libpsufsort_a-psufsort.Tpo -c -o libpsufsort_a-psufsort.o `test -f 'psufsort.cxx' || echo '$(srcdir)/'`psufsort.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libpsufsort_a-psufsort.Tpo $(DEPDIR)/libpsufsort_a-psufsort.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='psufsort.cxx' object='libpsufsort_a-psufsort.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpsufsort_a_CPPFLAGS) $(CPPFLAGS) $(libpsufsort_a_CXXFLAGS) $(CXXFLAGS) -c -o libpsufsort_a-psufsort.o `test -f 'psufsort.cxx' || echo '$(srcdir)/'`psufsort.cxx
+
+libpsufsort_a-psufsort.obj: psufsort.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpsufsort_a_CPPFLAGS) $(CPPFLAGS) $(libpsufsort_a_CXXFLAGS) $(CXXFLAGS) -MT libpsufsort_a-psufsort.obj -MD -MP -MF $(DEPDIR)/libpsufsort_a-psufsort.Tpo -c -o libpsufsort_a-psufsort.obj `if test -f 'psufsort.cxx'; then $(CYGPATH_W) 'psufsort.cxx'; else $(CYGPATH_W) '$(srcdir)/psufsort.cxx'; fi`
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libpsufsort_a-psufsort.Tpo $(DEPDIR)/libpsufsort_a-psufsort.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='psufsort.cxx' object='libpsufsort_a-psufsort.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpsufsort_a_CPPFLAGS) $(CPPFLAGS) $(libpsufsort_a_CXXFLAGS) $(CXXFLAGS) -c -o libpsufsort_a-psufsort.obj `if test -f 'psufsort.cxx'; then $(CYGPATH_W) 'psufsort.cxx'; else $(CYGPATH_W) '$(srcdir)/psufsort.cxx'; fi`
+
+libpsufsort_a-c_interface.o: c_interface.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpsufsort_a_CPPFLAGS) $(CPPFLAGS) $(libpsufsort_a_CXXFLAGS) $(CXXFLAGS) -MT libpsufsort_a-c_interface.o -MD -MP -MF $(DEPDIR)/libpsufsort_a-c_interface.Tpo -c -o libpsufsort_a-c_interface.o `test -f 'c_interface.cxx' || echo '$(srcdir)/'`c_interface.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libpsufsort_a-c_interface.Tpo $(DEPDIR)/libpsufsort_a-c_interface.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='c_interface.cxx' object='libpsufsort_a-c_interface.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpsufsort_a_CPPFLAGS) $(CPPFLAGS) $(libpsufsort_a_CXXFLAGS) $(CXXFLAGS) -c -o libpsufsort_a-c_interface.o `test -f 'c_interface.cxx' || echo '$(srcdir)/'`c_interface.cxx
+
+libpsufsort_a-c_interface.obj: c_interface.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpsufsort_a_CPPFLAGS) $(CPPFLAGS) $(libpsufsort_a_CXXFLAGS) $(CXXFLAGS) -MT libpsufsort_a-c_interface.obj -MD -MP -MF $(DEPDIR)/libpsufsort_a-c_interface.Tpo -c -o libpsufsort_a-c_interface.obj `if test -f 'c_interface.cxx'; then $(CYGPATH_W) 'c_interface.cxx'; else $(CYGPATH_W) '$(srcdir)/c_interface.cxx'; fi`
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libpsufsort_a-c_interface.Tpo $(DEPDIR)/libpsufsort_a-c_interface.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='c_interface.cxx' object='libpsufsort_a-c_interface.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libpsufsort_a_CPPFLAGS) $(CPPFLAGS) $(libpsufsort_a_CXXFLAGS) $(CXXFLAGS) -c -o libpsufsort_a-c_interface.obj `if test -f 'c_interface.cxx'; then $(CYGPATH_W) 'c_interface.cxx'; else $(CYGPATH_W) '$(srcdir)/c_interface.cxx'; fi`
+
+ID: $(am__tagged_files)
+ $(am__define_uniq_tagged_files); mkid -fID $$unique
+tags: tags-am
+TAGS: tags
+
+tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ set x; \
+ here=`pwd`; \
+ $(am__define_uniq_tagged_files); \
+ shift; \
+ if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
+ test -n "$$unique" || unique=$$empty_fix; \
+ if test $$# -gt 0; then \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ "$$@" $$unique; \
+ else \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ $$unique; \
+ fi; \
+ fi
+ctags: ctags-am
+
+CTAGS: ctags
+ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ $(am__define_uniq_tagged_files); \
+ test -z "$(CTAGS_ARGS)$$unique" \
+ || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
+ $$unique
+
+GTAGS:
+ here=`$(am__cd) $(top_builddir) && pwd` \
+ && $(am__cd) $(top_srcdir) \
+ && gtags -i $(GTAGS_ARGS) "$$here"
+cscopelist: cscopelist-am
+
+cscopelist-am: $(am__tagged_files)
+ list='$(am__tagged_files)'; \
+ case "$(srcdir)" in \
+ [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
+ *) sdir=$(subdir)/$(srcdir) ;; \
+ esac; \
+ for i in $$list; do \
+ if test -f "$$i"; then \
+ echo "$(subdir)/$$i"; \
+ else \
+ echo "$$sdir/$$i"; \
+ fi; \
+ done >> $(top_builddir)/cscope.files
+
+distclean-tags:
+ -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
+
+distdir: $(DISTFILES)
+ @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ list='$(DISTFILES)'; \
+ dist_files=`for file in $$list; do echo $$file; done | \
+ sed -e "s|^$$srcdirstrip/||;t" \
+ -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+ case $$dist_files in \
+ */*) $(MKDIR_P) `echo "$$dist_files" | \
+ sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+ sort -u` ;; \
+ esac; \
+ for file in $$dist_files; do \
+ if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+ if test -d $$d/$$file; then \
+ dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
+ if test -d "$(distdir)/$$file"; then \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+ cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
+ else \
+ test -f "$(distdir)/$$file" \
+ || cp -p $$d/$$file "$(distdir)/$$file" \
+ || exit 1; \
+ fi; \
+ done
+check-am: all-am
+check: check-am
+all-am: Makefile $(LIBRARIES)
+installdirs:
+install: install-am
+install-exec: install-exec-am
+install-data: install-data-am
+uninstall: uninstall-am
+
+install-am: all-am
+ @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-am
+install-strip:
+ if test -z '$(STRIP)'; then \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ install; \
+ else \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+ fi
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+ -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
+ -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
+
+maintainer-clean-generic:
+ @echo "This command is intended for maintainers to use"
+ @echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
+clean-am: clean-generic clean-noinstLIBRARIES mostlyclean-am
+
+distclean: distclean-am
+ -rm -rf ./$(DEPDIR)
+ -rm -f Makefile
+distclean-am: clean-am distclean-compile distclean-generic \
+ distclean-tags
+
+dvi: dvi-am
+
+dvi-am:
+
+html: html-am
+
+html-am:
+
+info: info-am
+
+info-am:
+
+install-data-am:
+
+install-dvi: install-dvi-am
+
+install-dvi-am:
+
+install-exec-am:
+
+install-html: install-html-am
+
+install-html-am:
+
+install-info: install-info-am
+
+install-info-am:
+
+install-man:
+
+install-pdf: install-pdf-am
+
+install-pdf-am:
+
+install-ps: install-ps-am
+
+install-ps-am:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-am
+ -rm -rf ./$(DEPDIR)
+ -rm -f Makefile
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-am
+
+mostlyclean-am: mostlyclean-compile mostlyclean-generic
+
+pdf: pdf-am
+
+pdf-am:
+
+ps: ps-am
+
+ps-am:
+
+uninstall-am:
+
+.MAKE: install-am install-strip
+
+.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean clean-generic \
+ clean-noinstLIBRARIES cscopelist-am ctags ctags-am distclean \
+ distclean-compile distclean-generic distclean-tags distdir dvi \
+ dvi-am html html-am info info-am install install-am \
+ install-data install-data-am install-dvi install-dvi-am \
+ install-exec install-exec-am install-html install-html-am \
+ install-info install-info-am install-man install-pdf \
+ install-pdf-am install-ps install-ps-am install-strip \
+ installcheck installcheck-am installdirs maintainer-clean \
+ maintainer-clean-generic mostlyclean mostlyclean-compile \
+ mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
+ uninstall-am
+
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
diff --git a/opt/psufsort/c_interface.cxx b/opt/psufsort/c_interface.cxx
new file mode 100644
index 0000000..7191986
--- /dev/null
+++ b/opt/psufsort/c_interface.cxx
@@ -0,0 +1,15 @@
+#include <string>
+#include <vector>
+#include <cstring>
+
+std::vector<int> psufsort(const std::string& T);
+
+extern "C" int c_psufsort(const char *str, int* SA){
+ if( !str || !SA){
+ return 1;
+ }
+ auto T = std::string(str);
+ auto temp = psufsort(T);
+ memcpy(SA, temp.data()+1, T.size() * sizeof(int));
+ return 0;
+}
diff --git a/opt/psufsort/interface.h b/opt/psufsort/interface.h
new file mode 100644
index 0000000..9e22601
--- /dev/null
+++ b/opt/psufsort/interface.h
@@ -0,0 +1,17 @@
+#ifdef __cplusplus
+
+std::vector<int> psufsort(const std::string& T);
+
+#else
+
+#ifdef __cplusplus
+extern "C" {
+#endif
+
+int c_psufsort(const char *str, int* SA);
+
+#ifdef __cplusplus
+}
+#endif
+
+#endif
diff --git a/opt/psufsort/psufsort.cxx b/opt/psufsort/psufsort.cxx
new file mode 100644
index 0000000..54ec0e1
--- /dev/null
+++ b/opt/psufsort/psufsort.cxx
@@ -0,0 +1,336 @@
+#include <string>
+#include <vector>
+#include <utility>
+#include <cstring>
+#include <algorithm>
+#include <iostream>
+#include <cassert>
+#include <cmath>
+#include <global.h>
+
+void mk_sort (std::vector<int>& SA, const std::string& T, size_t l, size_t r, size_t depth);
+void insertion_sort (std::vector<int>& SA, const std::string& T, size_t l, size_t r, size_t depth);
+void TSQS (std::vector<int>& SA, const std::string& T, size_t l, size_t r, size_t depth);
+void mk_buildin (std::vector<int>& SA, const std::string& T, size_t l, size_t r, size_t depth);
+
+std::vector<int> psufsort(const std::string& T);
+
+class Bucket {
+
+public:
+ size_t start, size;
+ constexpr Bucket() noexcept : start(0), size(0) {};
+};
+
+class PSufSort
+{
+ const std::string& T;
+ std::vector<int>& SA;
+ size_t threshold;
+public:
+ PSufSort(const std::string& _T, std::vector<int>& _SA, size_t size) : T(_T), SA(_SA) {
+ threshold = std::log(size);
+ }
+ ~PSufSort() {};
+
+ // All intervals are semi-open: [l,r)
+ void sort(size_t l, size_t r, size_t depth, size_t calls);
+ void sort_tsqs(size_t l, size_t r, size_t depth, size_t calls);
+ void sort_insert(size_t l, size_t r, size_t depth, size_t calls);
+ void sort_heap(size_t l, size_t r, size_t depth, size_t calls);
+
+ void build_heap( int* rSA, size_t n, size_t depth);
+ void heapify( int* rSA, size_t heap_size, size_t i, size_t depth);
+
+ char median3(size_t a, size_t b, size_t c, size_t depth);
+
+ void swap_range(size_t a, size_t b, size_t n);
+ inline char char_at( size_t sai, size_t depth);
+ inline const char *str_from( size_t sai, size_t depth);
+};
+
+std::vector<int> psufsort(const std::string& T){
+ auto n = T.size();
+ auto SA = std::vector<int>(n+1);
+
+ auto L = std::vector<Bucket>(256);
+ auto bucket_SM = std::vector<Bucket>(256*256); // S-
+ auto bucket_SS = std::vector<Bucket>(256*256); // S*
+
+ auto SM = [&](size_t X, size_t Y) -> Bucket& {
+ return bucket_SM[(X<<8) + Y];
+ };
+ auto SS = [&](size_t X, size_t Y) -> Bucket& {
+ return bucket_SS[(X<<8) + Y];
+ };
+
+ // classify suffixes and compute the bucket sizes
+ ssize_t i = n -1;
+ while( i >= 0){
+ if( T[i] >= T[i+1]){
+ L[T[i]].size++;
+ i--;
+ continue;
+ }
+
+ SS(T[i], T[i+1]).size++;
+ i--;
+
+ while( i >= 0 && T[i] <= T[i+1]){
+ SM(T[i], T[i+1]).size++;
+ i--;
+ }
+ }
+
+ // Deal with the null byte
+ SS(0,0).size = 1;
+ SA[0] = n;
+
+ // compute bucket starting points
+ int j = 0;
+ for(i=0; i<256; i++){
+ L[i].start = j;
+ j += L[i].size;
+ for(auto k =i; k< 256; k++){
+ SS(i, k).start = j;
+ j += SS(i, k).size;
+ SM(i, k).start = j;
+ j += SM(i, k).size;
+ }
+ }
+
+ // fill in S* buckets
+ i = n -1;
+ while( i >= 0){
+ auto c = T[i];
+
+ if( c >= T[i+1]){ // skip L
+ i--;
+ continue;
+ }
+
+ SA[SS(c,T[i+1]).start] = i;
+ SS(c,T[i+1]).start++;
+ i--;
+
+ while( i >= 0 && T[i] <= T[i+1]){ // skip S-
+ i--;
+ }
+ }
+
+ // correct the `++` from the previous loop.
+ for(i=0; i<256*256; i++){
+ bucket_SS[i].start -= bucket_SS[i].size;
+ }
+
+ // sort all S* suffixes
+ #pragma omp parallel for shared(SA,T) schedule(dynamic, 1) num_threads( (FLAGS & F_LOW_MEMORY) ? THREADS : 1)
+ for(i=0; i<256*256; i++){
+ const auto buc = bucket_SS[i];
+ if( buc.size > 1){
+ int b = buc.start;
+ int e = b + buc.size;
+ auto sorter = PSufSort( T, SA, buc.size);
+
+ // sort
+ sorter.sort( b, e, 2, 0);
+ }
+ }
+
+ // induced insert all S-
+ for(i=n; i >= 0;i--){
+ int j = SA[i];
+ if( j == 0) continue;
+
+ auto a = T[j-1];
+ auto b = T[j];
+ if( a <= b){
+ SA[SM(a, b).start + SM(a, b).size - 1] = j-1;
+ SM(a, b).size--;
+ }
+ }
+
+ // induced insert all Ls
+ for(i=0; i<n+1; i++){
+ int j = SA[i];
+ if( j == 0) continue;
+
+ auto a = T[j-1];
+ if( SA[L[a].start] != 0) continue;
+ if( a >= T[j]){
+ SA[L[a].start] = j -1;
+ L[a].start++;
+ }
+ }
+
+ return SA; // move doesnt move
+}
+
+inline char PSufSort::char_at( size_t sai, size_t depth){
+ return T[sai + depth];
+}
+
+inline const char *PSufSort::str_from( size_t sai, size_t depth){
+ return &T[sai + depth];
+}
+
+void PSufSort::swap_range(size_t a, size_t b, size_t n){
+ auto& SA = this->SA;
+
+ for(auto i=0; i< n; i++){
+ std::swap(SA[a++], SA[b++]);
+ }
+}
+
+void PSufSort::sort (size_t l, size_t r, size_t depth, size_t calls) {
+ if(l >= r){
+ return;
+ }
+
+ auto m = r - l;
+ if( m < 2 ){
+ return;
+ }
+
+ if (m <= 16){
+ sort_insert(l, r, depth, calls);
+ return;
+ }
+
+ if( calls < threshold){
+ sort_tsqs(l, r, depth, calls);
+ } else {
+ sort_heap(l, r, depth, calls);
+ }
+}
+
+
+void PSufSort::sort_insert (size_t l, size_t r, size_t depth, size_t unused){
+ auto cmp_from = [&]( size_t a, size_t b){
+ auto ta = T.data()+ a +depth;
+ auto tb = T.data()+ b +depth;
+
+ return strcmp(ta,tb);
+ };
+
+ for(auto j = l+1; j < r; j++){
+ auto X = SA[j];
+
+ auto i = j;
+ for(; i > l && cmp_from( SA[i-1], X) > 0 ; i--){
+ SA[i] = SA[i-1];
+ }
+
+ SA[i] = X;
+ }
+}
+
+char PSufSort::median3(size_t b, size_t a, size_t c, size_t depth){
+ auto key = [&](size_t i){
+ return char_at(SA[i], depth);
+ };
+
+ if( key(a) > key(b) ){ std::swap(SA[a], SA[b]); }
+ if( key(b) > key(c) ){ std::swap(SA[b], SA[c]); }
+ if( key(a) > key(b) ){ std::swap(SA[a], SA[b]); }
+
+ return key(b);
+}
+
+void PSufSort::sort_tsqs (size_t l, size_t r, size_t depth, size_t calls){
+ auto K = median3(l, (r-l)/2 + l, r-1, depth); // pick K
+
+ auto a = l;
+ auto b = l;
+ auto c = r-1;
+ auto d = r-1;
+
+ while(true) {
+ for(; b <= c && char_at(SA[b], depth) <= K; b++){
+ if( char_at(SA[b], depth) == K){
+ std::swap(SA[a], SA[b]);
+ a++;
+ }
+ }
+
+ for(; b <= c && char_at(SA[c], depth) >= K; c--){
+ if( char_at(SA[c], depth) == K){
+ std::swap(SA[c],SA[d]);
+ d--;
+ }
+ }
+
+ if( b > c) break;
+
+ std::swap(SA[b],SA[c]);
+ b++, c--;
+ }
+
+ auto m = std::min(a-l, b-a);
+ swap_range(l, b-m, m);
+
+ m = std::min(d-c, r-d-1);
+ swap_range(b, r-m, m);
+
+ auto i = l + b - a;
+ auto j = r - d + c;
+
+ this->sort(l, i, depth, calls + 1);
+ this->sort(i, j, depth+1, calls + 1);
+ this->sort(j, r, depth, calls + 1);
+}
+
+constexpr inline size_t LEFT(size_t i) noexcept {
+ return (i << 1) + 1;
+}
+
+constexpr inline size_t RIGHT(size_t i) noexcept {
+ return (i << 1) + 2;
+}
+
+constexpr inline size_t PARENT( size_t i) noexcept {
+ return (i-1) >> 1;
+}
+
+void PSufSort::build_heap( int* rSA, size_t n, size_t depth){
+ auto heap_size = n;
+ for( ssize_t i= PARENT(n-1); i>=0 ; i--){
+ heapify(rSA, heap_size, i, depth);
+ }
+}
+
+void PSufSort::heapify( int* rSA, size_t heap_size, size_t i, size_t depth){ // aka. siftDown
+ auto key = [&](size_t j){
+ return T.data() + j + depth;
+ };
+
+ auto l = LEFT(i);
+ auto r = RIGHT(i);
+ auto largest = i;
+
+ if( l < heap_size && strcmp( key(rSA[l]) , key(rSA[i])) > 0 ){
+ largest = l;
+ }
+ if( r < heap_size && strcmp( key(rSA[r]) , key(rSA[largest])) > 0){
+ largest = r;
+ }
+ if( largest != i){
+ std::swap(rSA[i], rSA[largest]);
+ heapify(rSA, heap_size, largest, depth);
+ }
+}
+
+void PSufSort::sort_heap(size_t left, size_t right, size_t depth, size_t calls){
+ auto rSA = SA.data() + left;
+ auto n = right - left;
+ auto heap_size = n;
+
+ build_heap(rSA, n, depth);
+
+ for( auto i = n-1; i ; i--){
+ std::swap(rSA[0],rSA[i]);
+ heap_size--;
+ heapify(rSA, heap_size, 0, depth);
+ }
+}
+
diff --git a/opt/reallocarray.c b/opt/reallocarray.c
new file mode 100644
index 0000000..e8c09db
--- /dev/null
+++ b/opt/reallocarray.c
@@ -0,0 +1,34 @@
+#include <errno.h>
+#include <stdint.h>
+#include "compat-stdlib.h"
+
+/*
+ * Copyright (c) 2008 Otto Moerbeek <otto at drijf.net>
+ *
+ * Permission to use, copy, modify, and distribute this software for any
+ * purpose with or without fee is hereby granted, provided that the above
+ * copyright notice and this permission notice appear in all copies.
+ *
+ * THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES
+ * WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF
+ * MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR
+ * ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES
+ * WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN
+ * ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF
+ * OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE.
+ */
+
+/*
+ * This is sqrt(SIZE_MAX+1), as s1*s2 <= SIZE_MAX
+ * if both s1 < MUL_NO_OVERFLOW and s2 < MUL_NO_OVERFLOW
+ */
+#define MUL_NO_OVERFLOW ((size_t)1 << (sizeof(size_t) * 4))
+
+void *reallocarray(void *optr, size_t nmemb, size_t size) {
+ if ((nmemb >= MUL_NO_OVERFLOW || size >= MUL_NO_OVERFLOW) && nmemb > 0 &&
+ SIZE_MAX / nmemb < size) {
+ errno = ENOMEM;
+ return NULL;
+ }
+ return realloc(optr, size * nmemb);
+}
diff --git a/opt/strchrnul.c b/opt/strchrnul.c
new file mode 100644
index 0000000..a36fe5c
--- /dev/null
+++ b/opt/strchrnul.c
@@ -0,0 +1,8 @@
+/* @brief Here follows a simple implementation of the GNU function `strchrnul`.
+ * Please check the gnulib manual for details.
+ */
+char *strchrnul(const char *s, int c){
+ char *p = strchr(s,c);
+
+ return p != NULL ? p : strchr(s, '\0');
+}
diff --git a/src/Makefile.am b/src/Makefile.am
new file mode 100644
index 0000000..8eebbe6
--- /dev/null
+++ b/src/Makefile.am
@@ -0,0 +1,23 @@
+bin_PROGRAMS = andi
+
+if !BUILD_WITH_LIBDIVSUFSORT
+PSUFSORT=$(top_builddir)/opt/psufsort/libpsufsort.a
+# This is a hack to make sure, andi is created with a C++ compiler
+DUMMY=dummy.cxx
+endif
+
+andi_SOURCES = andi.c esa.c process.c sequence.c io.c global.h esa.h process.h sequence.h io.h dist_hack.h
+andi_CPPFLAGS = $(OPENMP_CFLAGS) -I$(top_srcdir)/libs -I$(top_srcdir)/opt -std=gnu99
+andi_CFLAGS = $(OPENMP_CFLAGS) -W -Wall -Wno-missing-field-initializers
+andi_CXXFLAGS = $(OPENMP_CXXFLAGS) -W -Wall
+andi_LDADD = $(PSUFSORT) $(top_builddir)/libs/libpfasta.a $(top_builddir)/opt/libcompat.a
+nodist_EXTRA_andi_SOURCES = $(DUMMY)
+
+.PHONY: perf
+perf: CFLAGS+= -g -O3 -ggdb
+perf: andi
+
+.PHONY: asan
+asan: CFLAGS+= -fsanitize=address -fno-omit-frame-pointer -g -O1
+asan: CXXFLAGS+= -fsanitize=address -fno-omit-frame-pointer -g -O1
+asan: andi
diff --git a/src/Makefile.in b/src/Makefile.in
new file mode 100644
index 0000000..616bda1
--- /dev/null
+++ b/src/Makefile.in
@@ -0,0 +1,724 @@
+# Makefile.in generated by automake 1.14.1 from Makefile.am.
+# @configure_input@
+
+# Copyright (C) 1994-2013 Free Software Foundation, Inc.
+
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+ at SET_MAKE@
+
+VPATH = @srcdir@
+am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
+am__make_running_with_option = \
+ case $${target_option-} in \
+ ?) ;; \
+ *) echo "am__make_running_with_option: internal error: invalid" \
+ "target option '$${target_option-}' specified" >&2; \
+ exit 1;; \
+ esac; \
+ has_opt=no; \
+ sane_makeflags=$$MAKEFLAGS; \
+ if $(am__is_gnu_make); then \
+ sane_makeflags=$$MFLAGS; \
+ else \
+ case $$MAKEFLAGS in \
+ *\\[\ \ ]*) \
+ bs=\\; \
+ sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
+ | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
+ esac; \
+ fi; \
+ skip_next=no; \
+ strip_trailopt () \
+ { \
+ flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
+ }; \
+ for flg in $$sane_makeflags; do \
+ test $$skip_next = yes && { skip_next=no; continue; }; \
+ case $$flg in \
+ *=*|--*) continue;; \
+ -*I) strip_trailopt 'I'; skip_next=yes;; \
+ -*I?*) strip_trailopt 'I';; \
+ -*O) strip_trailopt 'O'; skip_next=yes;; \
+ -*O?*) strip_trailopt 'O';; \
+ -*l) strip_trailopt 'l'; skip_next=yes;; \
+ -*l?*) strip_trailopt 'l';; \
+ -[dEDm]) skip_next=yes;; \
+ -[JT]) skip_next=yes;; \
+ esac; \
+ case $$flg in \
+ *$$target_option*) has_opt=yes; break;; \
+ esac; \
+ done; \
+ test $$has_opt = yes
+am__make_dryrun = (target_option=n; $(am__make_running_with_option))
+am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
+pkgdatadir = $(datadir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkglibexecdir = $(libexecdir)/@PACKAGE@
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+bin_PROGRAMS = andi$(EXEEXT)
+subdir = src
+DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
+ $(srcdir)/config.hin $(top_srcdir)/depcomp
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+am__aclocal_m4_deps = $(top_srcdir)/m4/ax_cxx_compile_stdcxx_11.m4 \
+ $(top_srcdir)/configure.ac
+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
+ $(ACLOCAL_M4)
+mkinstalldirs = $(install_sh) -d
+CONFIG_HEADER = config.h
+CONFIG_CLEAN_FILES =
+CONFIG_CLEAN_VPATH_FILES =
+am__installdirs = "$(DESTDIR)$(bindir)"
+PROGRAMS = $(bin_PROGRAMS)
+am_andi_OBJECTS = andi-andi.$(OBJEXT) andi-esa.$(OBJEXT) \
+ andi-process.$(OBJEXT) andi-sequence.$(OBJEXT) \
+ andi-io.$(OBJEXT)
+andi_OBJECTS = $(am_andi_OBJECTS)
+andi_DEPENDENCIES = $(PSUFSORT) $(top_builddir)/libs/libpfasta.a \
+ $(top_builddir)/opt/libcompat.a
+andi_LINK = $(CXXLD) $(andi_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) \
+ $(LDFLAGS) -o $@
+AM_V_P = $(am__v_P_ at AM_V@)
+am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
+am__v_P_0 = false
+am__v_P_1 = :
+AM_V_GEN = $(am__v_GEN_ at AM_V@)
+am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
+am__v_GEN_0 = @echo " GEN " $@;
+am__v_GEN_1 =
+AM_V_at = $(am__v_at_ at AM_V@)
+am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
+am__v_at_0 = @
+am__v_at_1 =
+DEFAULT_INCLUDES = -I. at am__isrc@
+depcomp = $(SHELL) $(top_srcdir)/depcomp
+am__depfiles_maybe = depfiles
+am__mv = mv -f
+AM_V_lt = $(am__v_lt_ at AM_V@)
+am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
+am__v_lt_0 = --silent
+am__v_lt_1 =
+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
+ $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
+AM_V_CC = $(am__v_CC_ at AM_V@)
+am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
+am__v_CC_0 = @echo " CC " $@;
+am__v_CC_1 =
+CCLD = $(CC)
+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
+AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
+am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
+am__v_CCLD_0 = @echo " CCLD " $@;
+am__v_CCLD_1 =
+CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
+ $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
+AM_V_CXX = $(am__v_CXX_ at AM_V@)
+am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
+am__v_CXX_0 = @echo " CXX " $@;
+am__v_CXX_1 =
+CXXLD = $(CXX)
+CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
+ -o $@
+AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
+am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
+am__v_CXXLD_0 = @echo " CXXLD " $@;
+am__v_CXXLD_1 =
+SOURCES = $(andi_SOURCES) $(nodist_EXTRA_andi_SOURCES)
+DIST_SOURCES = $(andi_SOURCES)
+am__can_run_installinfo = \
+ case $$AM_UPDATE_INFO_DIR in \
+ n|no|NO) false;; \
+ *) (install-info --version) >/dev/null 2>&1;; \
+ esac
+am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) \
+ $(LISP)config.hin
+# Read a list of newline-separated strings from the standard input,
+# and print each of them once, without duplicates. Input order is
+# *not* preserved.
+am__uniquify_input = $(AWK) '\
+ BEGIN { nonempty = 0; } \
+ { items[$$0] = 1; nonempty = 1; } \
+ END { if (nonempty) { for (i in items) print i; }; } \
+'
+# Make sure the list of sources is unique. This is necessary because,
+# e.g., the same source file might be shared among _SOURCES variables
+# for different programs/libraries.
+am__define_uniq_tagged_files = \
+ list='$(am__tagged_files)'; \
+ unique=`for i in $$list; do \
+ if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+ done | $(am__uniquify_input)`
+ETAGS = etags
+CTAGS = ctags
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+ACLOCAL = @ACLOCAL@
+AMTAR = @AMTAR@
+AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
+AR = @AR@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CXX = @CXX@
+CXXDEPMODE = @CXXDEPMODE@
+CXXFLAGS = @CXXFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+EXEEXT = @EXEEXT@
+GLIB_CFLAGS = @GLIB_CFLAGS@
+GLIB_LIBS = @GLIB_LIBS@
+GREP = @GREP@
+HAVE_CXX11 = @HAVE_CXX11@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+MKDIR_P = @MKDIR_P@
+OBJEXT = @OBJEXT@
+OPENMP_CFLAGS = @OPENMP_CFLAGS@
+OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+PKG_CONFIG = @PKG_CONFIG@
+PKG_CONFIG_LIBDIR = @PKG_CONFIG_LIBDIR@
+PKG_CONFIG_PATH = @PKG_CONFIG_PATH@
+RANLIB = @RANLIB@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
+ac_ct_AR = @ac_ct_AR@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_CXX = @ac_ct_CXX@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+am__tar = @am__tar@
+am__untar = @am__untar@
+bindir = @bindir@
+build_alias = @build_alias@
+builddir = @builddir@
+datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
+exec_prefix = @exec_prefix@
+host_alias = @host_alias@
+htmldir = @htmldir@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localedir = @localedir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+mkdir_p = @mkdir_p@
+oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+psdir = @psdir@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+top_build_prefix = @top_build_prefix@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
+ at BUILD_WITH_LIBDIVSUFSORT_FALSE@PSUFSORT = $(top_builddir)/opt/psufsort/libpsufsort.a
+# This is a hack to make sure, andi is created with a C++ compiler
+ at BUILD_WITH_LIBDIVSUFSORT_FALSE@DUMMY = dummy.cxx
+andi_SOURCES = andi.c esa.c process.c sequence.c io.c global.h esa.h process.h sequence.h io.h dist_hack.h
+andi_CPPFLAGS = $(OPENMP_CFLAGS) -I$(top_srcdir)/libs -I$(top_srcdir)/opt -std=gnu99
+andi_CFLAGS = $(OPENMP_CFLAGS) -W -Wall -Wno-missing-field-initializers
+andi_CXXFLAGS = $(OPENMP_CXXFLAGS) -W -Wall
+andi_LDADD = $(PSUFSORT) $(top_builddir)/libs/libpfasta.a $(top_builddir)/opt/libcompat.a
+nodist_EXTRA_andi_SOURCES = $(DUMMY)
+all: config.h
+ $(MAKE) $(AM_MAKEFLAGS) all-am
+
+.SUFFIXES:
+.SUFFIXES: .c .cxx .o .obj
+$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
+ @for dep in $?; do \
+ case '$(am__configure_deps)' in \
+ *$$dep*) \
+ ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
+ && { if test -f $@; then exit 0; else break; fi; }; \
+ exit 1;; \
+ esac; \
+ done; \
+ echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign src/Makefile'; \
+ $(am__cd) $(top_srcdir) && \
+ $(AUTOMAKE) --foreign src/Makefile
+.PRECIOUS: Makefile
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+ @case '$?' in \
+ *config.status*) \
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
+ *) \
+ echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
+ cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
+ esac;
+
+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+
+$(top_srcdir)/configure: $(am__configure_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(ACLOCAL_M4): $(am__aclocal_m4_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(am__aclocal_m4_deps):
+
+config.h: stamp-h1
+ @test -f $@ || rm -f stamp-h1
+ @test -f $@ || $(MAKE) $(AM_MAKEFLAGS) stamp-h1
+
+stamp-h1: $(srcdir)/config.hin $(top_builddir)/config.status
+ @rm -f stamp-h1
+ cd $(top_builddir) && $(SHELL) ./config.status src/config.h
+$(srcdir)/config.hin: $(am__configure_deps)
+ ($(am__cd) $(top_srcdir) && $(AUTOHEADER))
+ rm -f stamp-h1
+ touch $@
+
+distclean-hdr:
+ -rm -f config.h stamp-h1
+install-binPROGRAMS: $(bin_PROGRAMS)
+ @$(NORMAL_INSTALL)
+ @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
+ if test -n "$$list"; then \
+ echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
+ $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
+ fi; \
+ for p in $$list; do echo "$$p $$p"; done | \
+ sed 's/$(EXEEXT)$$//' | \
+ while read p p1; do if test -f $$p \
+ ; then echo "$$p"; echo "$$p"; else :; fi; \
+ done | \
+ sed -e 'p;s,.*/,,;n;h' \
+ -e 's|.*|.|' \
+ -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
+ sed 'N;N;N;s,\n, ,g' | \
+ $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
+ { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
+ if ($$2 == $$4) files[d] = files[d] " " $$1; \
+ else { print "f", $$3 "/" $$4, $$1; } } \
+ END { for (d in files) print "f", d, files[d] }' | \
+ while read type dir files; do \
+ if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
+ test -z "$$files" || { \
+ echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
+ $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
+ } \
+ ; done
+
+uninstall-binPROGRAMS:
+ @$(NORMAL_UNINSTALL)
+ @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
+ files=`for p in $$list; do echo "$$p"; done | \
+ sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
+ -e 's/$$/$(EXEEXT)/' \
+ `; \
+ test -n "$$list" || exit 0; \
+ echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
+ cd "$(DESTDIR)$(bindir)" && rm -f $$files
+
+clean-binPROGRAMS:
+ -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
+
+andi$(EXEEXT): $(andi_OBJECTS) $(andi_DEPENDENCIES) $(EXTRA_andi_DEPENDENCIES)
+ @rm -f andi$(EXEEXT)
+ $(AM_V_CXXLD)$(andi_LINK) $(andi_OBJECTS) $(andi_LDADD) $(LIBS)
+
+mostlyclean-compile:
+ -rm -f *.$(OBJEXT)
+
+distclean-compile:
+ -rm -f *.tab.c
+
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/andi-andi.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/andi-dummy.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/andi-esa.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/andi-io.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/andi-process.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/andi-sequence.Po at am__quote@
+
+.c.o:
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(COMPILE) -c -o $@ $<
+
+.c.obj:
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(COMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+
+andi-andi.o: andi.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -MT andi-andi.o -MD -MP -MF $(DEPDIR)/andi-andi.Tpo -c -o andi-andi.o `test -f 'andi.c' || echo '$(srcdir)/'`andi.c
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-andi.Tpo $(DEPDIR)/andi-andi.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='andi.c' object='andi-andi.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -c -o andi-andi.o `test -f 'andi.c' || echo '$(srcdir)/'`andi.c
+
+andi-andi.obj: andi.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -MT andi-andi.obj -MD -MP -MF $(DEPDIR)/andi-andi.Tpo -c -o andi-andi.obj `if test -f 'andi.c'; then $(CYGPATH_W) 'andi.c'; else $(CYGPATH_W) '$(srcdir)/andi.c'; fi`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-andi.Tpo $(DEPDIR)/andi-andi.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='andi.c' object='andi-andi.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -c -o andi-andi.obj `if test -f 'andi.c'; then $(CYGPATH_W) 'andi.c'; else $(CYGPATH_W) '$(srcdir)/andi.c'; fi`
+
+andi-esa.o: esa.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -MT andi-esa.o -MD -MP -MF $(DEPDIR)/andi-esa.Tpo -c -o andi-esa.o `test -f 'esa.c' || echo '$(srcdir)/'`esa.c
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-esa.Tpo $(DEPDIR)/andi-esa.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='esa.c' object='andi-esa.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -c -o andi-esa.o `test -f 'esa.c' || echo '$(srcdir)/'`esa.c
+
+andi-esa.obj: esa.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -MT andi-esa.obj -MD -MP -MF $(DEPDIR)/andi-esa.Tpo -c -o andi-esa.obj `if test -f 'esa.c'; then $(CYGPATH_W) 'esa.c'; else $(CYGPATH_W) '$(srcdir)/esa.c'; fi`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-esa.Tpo $(DEPDIR)/andi-esa.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='esa.c' object='andi-esa.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -c -o andi-esa.obj `if test -f 'esa.c'; then $(CYGPATH_W) 'esa.c'; else $(CYGPATH_W) '$(srcdir)/esa.c'; fi`
+
+andi-process.o: process.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -MT andi-process.o -MD -MP -MF $(DEPDIR)/andi-process.Tpo -c -o andi-process.o `test -f 'process.c' || echo '$(srcdir)/'`process.c
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-process.Tpo $(DEPDIR)/andi-process.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='process.c' object='andi-process.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -c -o andi-process.o `test -f 'process.c' || echo '$(srcdir)/'`process.c
+
+andi-process.obj: process.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -MT andi-process.obj -MD -MP -MF $(DEPDIR)/andi-process.Tpo -c -o andi-process.obj `if test -f 'process.c'; then $(CYGPATH_W) 'process.c'; else $(CYGPATH_W) '$(srcdir)/process.c'; fi`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-process.Tpo $(DEPDIR)/andi-process.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='process.c' object='andi-process.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -c -o andi-process.obj `if test -f 'process.c'; then $(CYGPATH_W) 'process.c'; else $(CYGPATH_W) '$(srcdir)/process.c'; fi`
+
+andi-sequence.o: sequence.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -MT andi-sequence.o -MD -MP -MF $(DEPDIR)/andi-sequence.Tpo -c -o andi-sequence.o `test -f 'sequence.c' || echo '$(srcdir)/'`sequence.c
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-sequence.Tpo $(DEPDIR)/andi-sequence.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='sequence.c' object='andi-sequence.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -c -o andi-sequence.o `test -f 'sequence.c' || echo '$(srcdir)/'`sequence.c
+
+andi-sequence.obj: sequence.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -MT andi-sequence.obj -MD -MP -MF $(DEPDIR)/andi-sequence.Tpo -c -o andi-sequence.obj `if test -f 'sequence.c'; then $(CYGPATH_W) 'sequence.c'; else $(CYGPATH_W) '$(srcdir)/sequence.c'; fi`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-sequence.Tpo $(DEPDIR)/andi-sequence.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='sequence.c' object='andi-sequence.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -c -o andi-sequence.obj `if test -f 'sequence.c'; then $(CYGPATH_W) 'sequence.c'; else $(CYGPATH_W) '$(srcdir)/sequence.c'; fi`
+
+andi-io.o: io.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -MT andi-io.o -MD -MP -MF $(DEPDIR)/andi-io.Tpo -c -o andi-io.o `test -f 'io.c' || echo '$(srcdir)/'`io.c
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-io.Tpo $(DEPDIR)/andi-io.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='io.c' object='andi-io.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -c -o andi-io.o `test -f 'io.c' || echo '$(srcdir)/'`io.c
+
+andi-io.obj: io.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -MT andi-io.obj -MD -MP -MF $(DEPDIR)/andi-io.Tpo -c -o andi-io.obj `if test -f 'io.c'; then $(CYGPATH_W) 'io.c'; else $(CYGPATH_W) '$(srcdir)/io.c'; fi`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-io.Tpo $(DEPDIR)/andi-io.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='io.c' object='andi-io.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CFLAGS) $(CFLAGS) -c -o andi-io.obj `if test -f 'io.c'; then $(CYGPATH_W) 'io.c'; else $(CYGPATH_W) '$(srcdir)/io.c'; fi`
+
+.cxx.o:
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
+
+.cxx.obj:
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+
+andi-dummy.o: dummy.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CXXFLAGS) $(CXXFLAGS) -MT andi-dummy.o -MD -MP -MF $(DEPDIR)/andi-dummy.Tpo -c -o andi-dummy.o `test -f 'dummy.cxx' || echo '$(srcdir)/'`dummy.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-dummy.Tpo $(DEPDIR)/andi-dummy.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='dummy.cxx' object='andi-dummy.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CXXFLAGS) $(CXXFLAGS) -c -o andi-dummy.o `test -f 'dummy.cxx' || echo '$(srcdir)/'`dummy.cxx
+
+andi-dummy.obj: dummy.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CXXFLAGS) $(CXXFLAGS) -MT andi-dummy.obj -MD -MP -MF $(DEPDIR)/andi-dummy.Tpo -c -o andi-dummy.obj `if test -f 'dummy.cxx'; then $(CYGPATH_W) 'dummy.cxx'; else $(CYGPATH_W) '$(srcdir)/dummy.cxx'; fi`
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/andi-dummy.Tpo $(DEPDIR)/andi-dummy.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='dummy.cxx' object='andi-dummy.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(andi_CPPFLAGS) $(CPPFLAGS) $(andi_CXXFLAGS) $(CXXFLAGS) -c -o andi-dummy.obj `if test -f 'dummy.cxx'; then $(CYGPATH_W) 'dummy.cxx'; else $(CYGPATH_W) '$(srcdir)/dummy.cxx'; fi`
+
+ID: $(am__tagged_files)
+ $(am__define_uniq_tagged_files); mkid -fID $$unique
+tags: tags-am
+TAGS: tags
+
+tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ set x; \
+ here=`pwd`; \
+ $(am__define_uniq_tagged_files); \
+ shift; \
+ if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
+ test -n "$$unique" || unique=$$empty_fix; \
+ if test $$# -gt 0; then \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ "$$@" $$unique; \
+ else \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ $$unique; \
+ fi; \
+ fi
+ctags: ctags-am
+
+CTAGS: ctags
+ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ $(am__define_uniq_tagged_files); \
+ test -z "$(CTAGS_ARGS)$$unique" \
+ || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
+ $$unique
+
+GTAGS:
+ here=`$(am__cd) $(top_builddir) && pwd` \
+ && $(am__cd) $(top_srcdir) \
+ && gtags -i $(GTAGS_ARGS) "$$here"
+cscopelist: cscopelist-am
+
+cscopelist-am: $(am__tagged_files)
+ list='$(am__tagged_files)'; \
+ case "$(srcdir)" in \
+ [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
+ *) sdir=$(subdir)/$(srcdir) ;; \
+ esac; \
+ for i in $$list; do \
+ if test -f "$$i"; then \
+ echo "$(subdir)/$$i"; \
+ else \
+ echo "$$sdir/$$i"; \
+ fi; \
+ done >> $(top_builddir)/cscope.files
+
+distclean-tags:
+ -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
+
+distdir: $(DISTFILES)
+ @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ list='$(DISTFILES)'; \
+ dist_files=`for file in $$list; do echo $$file; done | \
+ sed -e "s|^$$srcdirstrip/||;t" \
+ -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+ case $$dist_files in \
+ */*) $(MKDIR_P) `echo "$$dist_files" | \
+ sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+ sort -u` ;; \
+ esac; \
+ for file in $$dist_files; do \
+ if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+ if test -d $$d/$$file; then \
+ dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
+ if test -d "$(distdir)/$$file"; then \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+ cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
+ else \
+ test -f "$(distdir)/$$file" \
+ || cp -p $$d/$$file "$(distdir)/$$file" \
+ || exit 1; \
+ fi; \
+ done
+check-am: all-am
+check: check-am
+all-am: Makefile $(PROGRAMS) config.h
+installdirs:
+ for dir in "$(DESTDIR)$(bindir)"; do \
+ test -z "$$dir" || $(MKDIR_P) "$$dir"; \
+ done
+install: install-am
+install-exec: install-exec-am
+install-data: install-data-am
+uninstall: uninstall-am
+
+install-am: all-am
+ @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-am
+install-strip:
+ if test -z '$(STRIP)'; then \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ install; \
+ else \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+ fi
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+ -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
+ -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
+
+maintainer-clean-generic:
+ @echo "This command is intended for maintainers to use"
+ @echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
+
+distclean: distclean-am
+ -rm -rf ./$(DEPDIR)
+ -rm -f Makefile
+distclean-am: clean-am distclean-compile distclean-generic \
+ distclean-hdr distclean-tags
+
+dvi: dvi-am
+
+dvi-am:
+
+html: html-am
+
+html-am:
+
+info: info-am
+
+info-am:
+
+install-data-am:
+
+install-dvi: install-dvi-am
+
+install-dvi-am:
+
+install-exec-am: install-binPROGRAMS
+
+install-html: install-html-am
+
+install-html-am:
+
+install-info: install-info-am
+
+install-info-am:
+
+install-man:
+
+install-pdf: install-pdf-am
+
+install-pdf-am:
+
+install-ps: install-ps-am
+
+install-ps-am:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-am
+ -rm -rf ./$(DEPDIR)
+ -rm -f Makefile
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-am
+
+mostlyclean-am: mostlyclean-compile mostlyclean-generic
+
+pdf: pdf-am
+
+pdf-am:
+
+ps: ps-am
+
+ps-am:
+
+uninstall-am: uninstall-binPROGRAMS
+
+.MAKE: all install-am install-strip
+
+.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
+ clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
+ distclean distclean-compile distclean-generic distclean-hdr \
+ distclean-tags distdir dvi dvi-am html html-am info info-am \
+ install install-am install-binPROGRAMS install-data \
+ install-data-am install-dvi install-dvi-am install-exec \
+ install-exec-am install-html install-html-am install-info \
+ install-info-am install-man install-pdf install-pdf-am \
+ install-ps install-ps-am install-strip installcheck \
+ installcheck-am installdirs maintainer-clean \
+ maintainer-clean-generic mostlyclean mostlyclean-compile \
+ mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
+ uninstall-am uninstall-binPROGRAMS
+
+
+.PHONY: perf
+perf: CFLAGS+= -g -O3 -ggdb
+perf: andi
+
+.PHONY: asan
+asan: CFLAGS+= -fsanitize=address -fno-omit-frame-pointer -g -O1
+asan: CXXFLAGS+= -fsanitize=address -fno-omit-frame-pointer -g -O1
+asan: andi
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
diff --git a/src/andi.c b/src/andi.c
new file mode 100644
index 0000000..b1ba8d8
--- /dev/null
+++ b/src/andi.c
@@ -0,0 +1,271 @@
+/**
+ * @file
+ *
+ * This is the main file. It contains functions to parse the commandline arguments,
+ * read files etc.
+ *
+ * @brief The main file
+ * @author Fabian Klötzl
+
+ * @section License
+
+ * This program is free software; you can redistribute it and/or
+ * modify it under the terms of the GNU General Public License as
+ * published by the Free Software Foundation; either version 3 of
+ * the License, or (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful, but
+ * WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
+ * General Public License for more details at
+ * http://www.gnu.org/copyleft/gpl.html
+ *
+ */
+
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
+#include <assert.h>
+#include <getopt.h>
+#include <errno.h>
+#include "global.h"
+#include "process.h"
+#include "io.h"
+#include "sequence.h"
+
+#ifdef _OPENMP
+#include <omp.h>
+#endif
+
+/* Global variables */
+int FLAGS = 0;
+int THREADS = 1;
+double RANDOM_ANCHOR_PROP = 0.05;
+
+void usage(void);
+void version(void);
+
+/**
+ * @brief The main function.
+ *
+ * The main function reads and parses the commandline arguments. Depending on
+ * the set flags it reads the input files and forwards the contained sequences
+ * to processing.
+ */
+int main( int argc, char *argv[]){
+ int c;
+ int version_flag = 0;
+
+ struct option long_options[] = {
+ {"version", no_argument, &version_flag, 1},
+ {"help", no_argument, NULL, 'h'},
+ {"raw", no_argument, NULL, 'r'},
+ {"verbose", no_argument, NULL, 'v'},
+ {"join", no_argument, NULL, 'j'},
+ {"low-memory", no_argument, NULL, 'm'},
+ {"threads", required_argument, NULL, 't'},
+ {0,0,0,0}
+ };
+
+#ifdef _OPENMP
+ // Use all available processors by default.
+ THREADS = omp_get_num_procs();
+#endif
+
+ // parse arguments
+ while( 1 ){
+
+ int option_index = 0;
+
+ c = getopt_long( argc, argv, "jvhrt:p:m", long_options, &option_index);
+
+ if( c == -1){
+ break;
+ }
+
+ switch (c){
+ case 0:
+ break;
+ case 'h':
+ usage();
+ break;
+ case 'r':
+ FLAGS |= F_RAW;
+ break;
+ case 'v':
+ FLAGS |= FLAGS & F_VERBOSE ? F_EXTRA_VERBOSE : F_VERBOSE;
+ break;
+ case 'p':
+ {
+ errno = 0;
+ char *end;
+ double prop = strtod( optarg, &end);
+
+ if( errno || end == optarg || *end != '\0'){
+ warnx(
+ "Expected a floating point number for -p argument, but '%s' was given. "
+ "Skipping argument.", optarg
+ );
+ break;
+ }
+
+ if( prop < 0.0 || prop > 1.0 ){
+ warnx(
+ "A probability should be a value between 0 and 1; "
+ "Ignoring -p %f argument.", prop
+ );
+ break;
+ }
+
+ RANDOM_ANCHOR_PROP = prop;
+ }
+ break;
+ case 'm':
+ FLAGS |= F_LOW_MEMORY;
+ break;
+ case 'j':
+ FLAGS |= F_JOIN;
+ break;
+ case 't':
+ {
+#ifdef _OPENMP
+ errno = 0;
+ char *end;
+ long unsigned int threads = strtoul( optarg, &end, 10);
+
+ if( errno || end == optarg || *end != '\0'){
+ warnx(
+ "Expected a number for -t argument, but '%s' was given. "
+ "Ignoring -t argument.", optarg
+ );
+ break;
+ }
+
+ if( threads > (long unsigned int) omp_get_num_procs() ){
+ warnx(
+ "The number of threads to be used, is greater then the number of available processors; "
+ "Ignoring -t %lu argument.", threads
+ );
+ break;
+ }
+
+ THREADS = threads;
+#else
+ warnx("This version of andi was built without OpenMP and thus "
+ "does not support multi threading. Ignoring -t argument.");
+#endif
+ }
+ break;
+ case '?': /* intentional fall-through */
+ default:
+ usage();
+ break;
+ }
+ }
+
+ if( version_flag ){
+ version();
+ }
+
+ argc -= optind;
+ argv += optind;
+
+ // at least one file name must be given
+ if( FLAGS & F_JOIN && argc == 0 ){
+ errx(1, "In join mode at least one filename needs to be supplied.");
+ }
+
+ dsa_t dsa;
+ if(dsa_init(&dsa)){
+ errx(errno,"Out of memory.");
+ }
+
+ const char *file_name;
+
+ // parse all files
+ int minfiles = FLAGS & F_JOIN ? 2 : 1;
+ for( ; ; minfiles-- ){
+ if( !*argv){
+ if( minfiles <= 0) break;
+
+ // if no files are supplied, read from stdin
+ file_name = "-";
+ } else {
+ file_name = *argv++;
+ }
+
+ if( FLAGS & F_JOIN){
+ read_fasta_join( file_name, &dsa);
+ } else {
+ read_fasta( file_name, &dsa);
+ }
+ }
+
+
+ size_t n = dsa_size( &dsa);
+
+ if( FLAGS & F_VERBOSE){
+ fprintf( stderr, "Comparing %zu sequences\n", n);
+ fflush( stderr);
+ }
+
+ seq_t *sequences = dsa_data( &dsa);
+ // compute distance matrix
+ if( n >= 2){
+ calculate_distances(sequences, n);
+ } else {
+ warnx("I am truly sorry, but with less than two sequences (%zu given) there is nothing to compare.", n);
+ }
+
+ dsa_free( &dsa);
+ return 0;
+}
+
+/**
+ * Prints the usage to stdout and then exits successfully.
+ */
+void usage(void){
+ const char str[]= {
+ "Usage: andi [-jrv] [-p FLOAT] [-t INT] FILES...\n"
+ "\tFILES... can be any sequence of FASTA files. If no files are supplied, stdin is used instead.\n"
+ "Options:\n"
+ " -j, --join Treat all sequences from one file as a single genome\n"
+ " -m, --low-memory Use less memory at the cost of speed\n"
+ " -p <FLOAT> Significance of an anchor pair; default: 0.05\n"
+ " -r, --raw Calculates raw distances; default: Jukes-Cantor corrected\n"
+ " -v, --verbose Prints additional information\n"
+#ifdef _OPENMP
+ " -t <INT> The number of threads to be used; by default, all available processors are used\n"
+#endif
+ " -h, --help Display this help and exit\n"
+ " --version Output version information and acknowledgments\n"
+ };
+
+ printf("%s", str);
+ exit(EXIT_SUCCESS);
+}
+
+/**
+ * This function just prints the version string and then aborts
+ * the program. It conforms to the [GNU Coding Standard](http://www.gnu.org/prep/standards/html_node/_002d_002dversion.html#g_t_002d_002dversion).
+ */
+void version(void){
+ const char str[]= {
+ "andi " VERSION "\n"
+ "Copyright (C) 2014, 2015 Fabian Klötzl\n"
+ "License GPLv3+: GNU GPL version 3 or later <http://gnu.org/licenses/gpl.html>\n"
+ "This is free software: you are free to change and redistribute it.\n"
+ "There is NO WARRANTY, to the extent permitted by law.\n\n"
+ "Acknowledgments:\n"
+ "1) Andi: Haubold, B. Klötzl, F. and Pfaffelhuber, P. (2015). "
+ "Fast and accurate estimation of evolutionary distances between closely related genomes\n"
+ "2) Algorithms: Ohlebusch, E. (2013). Bioinformatics Algorithms. Sequence Analysis, "
+ "Genome Rearrangements, and Phylogenetic Reconstruction. pp 118f.\n"
+ "3) SA construction: Mori, Y. (2005). Short description of improved two-stage suffix "
+ "sorting alorithm. http://homepage3.nifty.com/wpage/software/itssort.txt\n"
+ };
+ printf("%s", str);
+ exit(EXIT_SUCCESS);
+}
+
+
diff --git a/src/config.hin b/src/config.hin
new file mode 100644
index 0000000..a356f15
--- /dev/null
+++ b/src/config.hin
@@ -0,0 +1,146 @@
+/* src/config.hin. Generated from configure.ac by autoheader. */
+
+/* define if the compiler supports basic C++11 syntax */
+#undef HAVE_CXX11
+
+/* Define to 1 if you have the <divsufsort.h> header file. */
+#undef HAVE_DIVSUFSORT_H
+
+/* Define to 1 if you have the <errno.h> header file. */
+#undef HAVE_ERRNO_H
+
+/* Define to 1 if you have the <err.h> header file. */
+#undef HAVE_ERR_H
+
+/* Define to 1 if you have the <fcntl.h> header file. */
+#undef HAVE_FCNTL_H
+
+/* Define to 1 if you have the `floor' function. */
+#undef HAVE_FLOOR
+
+/* Define to 1 if you have the <inttypes.h> header file. */
+#undef HAVE_INTTYPES_H
+
+/* Define to 1 if you have the `divsufsort' library (-ldivsufsort). */
+#undef HAVE_LIBDIVSUFSORT
+
+/* Define to 1 if you have the `m' library (-lm). */
+#undef HAVE_LIBM
+
+/* Define to 1 if you have the <limits.h> header file. */
+#undef HAVE_LIMITS_H
+
+/* Define to 1 if you have the <memory.h> header file. */
+#undef HAVE_MEMORY_H
+
+/* Define to 1 if you have the `pow' function. */
+#undef HAVE_POW
+
+/* Define to 1 if you have the `reallocarray' function. */
+#undef HAVE_REALLOCARRAY
+
+/* Define to 1 if you have the `sqrt' function. */
+#undef HAVE_SQRT
+
+/* Define to 1 if stdbool.h conforms to C99. */
+#undef HAVE_STDBOOL_H
+
+/* Define to 1 if you have the <stdint.h> header file. */
+#undef HAVE_STDINT_H
+
+/* Define to 1 if you have the <stdlib.h> header file. */
+#undef HAVE_STDLIB_H
+
+/* Define to 1 if you have the `strchr' function. */
+#undef HAVE_STRCHR
+
+/* Define to 1 if you have the `strchrnul' function. */
+#undef HAVE_STRCHRNUL
+
+/* Define to 1 if you have the `strdup' function. */
+#undef HAVE_STRDUP
+
+/* Define to 1 if you have the `strerror' function. */
+#undef HAVE_STRERROR
+
+/* Define to 1 if you have the <strings.h> header file. */
+#undef HAVE_STRINGS_H
+
+/* Define to 1 if you have the <string.h> header file. */
+#undef HAVE_STRING_H
+
+/* Define to 1 if you have the `strndup' function. */
+#undef HAVE_STRNDUP
+
+/* Define to 1 if you have the `strrchr' function. */
+#undef HAVE_STRRCHR
+
+/* Define to 1 if you have the `strtod' function. */
+#undef HAVE_STRTOD
+
+/* Define to 1 if you have the `strtoul' function. */
+#undef HAVE_STRTOUL
+
+/* Define to 1 if you have the <sys/stat.h> header file. */
+#undef HAVE_SYS_STAT_H
+
+/* Define to 1 if you have the <sys/types.h> header file. */
+#undef HAVE_SYS_TYPES_H
+
+/* Define to 1 if you have the <unistd.h> header file. */
+#undef HAVE_UNISTD_H
+
+/* Define to 1 if the system has the type `_Bool'. */
+#undef HAVE__BOOL
+
+/* Name of package */
+#undef PACKAGE
+
+/* Define to the address where bug reports for this package should be sent. */
+#undef PACKAGE_BUGREPORT
+
+/* Define to the full name of this package. */
+#undef PACKAGE_NAME
+
+/* Define to the full name and version of this package. */
+#undef PACKAGE_STRING
+
+/* Define to the one symbol short name of this package. */
+#undef PACKAGE_TARNAME
+
+/* Define to the home page for this package. */
+#undef PACKAGE_URL
+
+/* Define to the version of this package. */
+#undef PACKAGE_VERSION
+
+/* Define to 1 if you have the ANSI C header files. */
+#undef STDC_HEADERS
+
+/* Version number of package */
+#undef VERSION
+
+/* Define for Solaris 2.5.1 so the uint8_t typedef from <sys/synch.h>,
+ <pthread.h>, or <semaphore.h> is not used. If the typedef were allowed, the
+ #define below would cause a syntax error. */
+#undef _UINT8_T
+
+/* Define to `__inline__' or `__inline' if that's what the C compiler
+ calls it, or to nothing if 'inline' is not supported under any name. */
+#ifndef __cplusplus
+#undef inline
+#endif
+
+/* Define to the type of a signed integer type of width exactly 32 bits if
+ such a type exists and the standard includes do not define it. */
+#undef int32_t
+
+/* Define to `unsigned int' if <sys/types.h> does not define. */
+#undef size_t
+
+/* Define to `int' if <sys/types.h> does not define. */
+#undef ssize_t
+
+/* Define to the type of an unsigned integer type of width exactly 8 bits if
+ such a type exists and the standard includes do not define it. */
+#undef uint8_t
diff --git a/src/dist_hack.h b/src/dist_hack.h
new file mode 100644
index 0000000..53f4c87
--- /dev/null
+++ b/src/dist_hack.h
@@ -0,0 +1,75 @@
+/** @file
+ * @brief This file is a preprocessor hack for the two functions `distMatrix` and `distMatrixLM`.
+ */
+#ifdef FAST
+#define NAME distMatrix
+#define P_OUTER _Pragma("omp parallel for num_threads( THREADS)")
+#define P_INNER
+#else
+#undef NAME
+#undef P_OUTER
+#undef P_INNER
+#define NAME distMatrixLM
+#define P_OUTER
+#define P_INNER _Pragma("omp parallel for num_threads( THREADS)")
+#endif
+
+/** @brief This function calls dist_andi for pairs of subjects and queries, and thereby fills the distance matrix.
+ *
+ * This function is actually two functions. It is one template that gets compiled into two functions via
+ * preprocessor hacks. The reason is DRY (Do not Repeat Yourselves).
+ * The two functions only differ by their name and pragmas; i.e. They run in different parallel modes.
+ * `distMatrix` is faster than `distMatrixLM` but needs more memory.
+ *
+ * @param sequences - The sequences to compare
+ * @param n - The number of sequences
+ * @param M - A matrix for additional output data
+ */
+void NAME( data_t *M, seq_t* sequences, size_t n){
+ size_t i;
+
+ //#pragma
+ P_OUTER
+ for(i=0;i<n;i++){
+ seq_t *subject = &sequences[i];
+ esa_s E;
+
+ seq_subject_init( subject);
+ if( esa_init( &E, subject)){
+ warnx("Failed to create index for %s.", subject->name);
+
+ for( size_t j=0; j< n; j++){
+ M(i,j).distance = (i==j) ? 0.0 : NAN;
+ M(i,j).coverage = 0.0;
+ }
+
+ continue;
+ }
+
+ // now compare every other sequence to i
+ size_t j;
+
+ P_INNER
+ for(j=0; j<n; j++){
+ if( j == i) {
+ M(i,j) = (data_t){0.0,0.0};
+ continue;
+ }
+
+ // TODO: Provide a nicer progress indicator.
+ if( FLAGS & F_EXTRA_VERBOSE ){
+ #pragma omp critical
+ {
+ fprintf( stderr, "comparing %zu and %zu\n", i, j);
+ }
+ }
+
+ size_t ql = sequences[j].len;
+
+ M(i,j) = dist_anchor( &E, sequences[j].S, ql, subject->gc);
+ }
+
+ esa_free(&E);
+ seq_subject_free(subject);
+ }
+}
diff --git a/src/esa.c b/src/esa.c
new file mode 100644
index 0000000..992878f
--- /dev/null
+++ b/src/esa.c
@@ -0,0 +1,668 @@
+/**
+ * @file
+ * @brief ESA functions
+ *
+ * This file contains various functions that operate on an enhanced suffix
+ * array. The basic algorithms originate from the book of Ohlebusch
+ * "Bioinformatics Algorithms" (2013). Most of these were heavily modified
+ * for improved performance. One example is the lcp-cache.
+ *
+ * The ESA structure defined in esa.h contains a `cache` field. This cache is
+ * used to quickly look up lcp-intervals. Consider the queries "AAGT" and
+ * "AACG". In both cases the interval for "AA" has to be looked up in the
+ * ESA. If we simply store the interval for "AA" in the cache, once and use it
+ * for each query we are significantly faster (up to 7 times).
+ */
+#include <stdlib.h>
+#include <string.h>
+#include <assert.h>
+#include "esa.h"
+
+static void esa_init_cache_dfs( esa_s *, char *str, size_t pos, lcp_inter_t in);
+static void esa_init_cache_fill( esa_s *, char *str, size_t pos, lcp_inter_t in);
+
+static lcp_inter_t get_interval( const esa_s *, lcp_inter_t ij, char a);
+lcp_inter_t get_match( const esa_s *, const char *query, size_t qlen);
+static lcp_inter_t get_match_from( const esa_s *, const char *query, size_t qlen, saidx_t k, lcp_inter_t ij);
+
+static int esa_init_SA( esa_s *);
+static int esa_init_LCP( esa_s *);
+static int esa_init_CLD( esa_s *);
+
+/** @brief The prefix length up to which LCP-intervals are cached. */
+const size_t CACHE_LENGTH = 10;
+
+/** @brief Map a code to the character. */
+char code2char( ssize_t code){
+ switch( code & 0x3){
+ case 0: return 'A';
+ case 1: return 'C';
+ case 2: return 'G';
+ case 3: return 'T';
+ }
+ return '\0';
+}
+
+/** @brief Map a character to a two bit code. */
+ssize_t char2code( const char c){
+ ssize_t result = -1;
+ switch( c){
+ case 'A' : result = 0; break;
+ case 'C' : result = 1; break;
+ case 'G' : result = 2; break;
+ case 'T' : result = 3; break;
+ }
+ return result;
+}
+
+#define R(CLD, i) ((CLD)[(i)])
+#define L(CLD, i) ((CLD)[(i)-1])
+
+
+
+/** @brief Fills the LCP-Interval cache.
+ *
+ * Traversing the virtual suffix tree, created by SA, LCP and CLD is rather slow.
+ * Hence we create a cache, holding the LCP-interval for a prefix of a certain
+ * length ::CACHE_LENGTH. This function it the entry point for the cache filling
+ * routine.
+ *
+ * @param self - The ESA.
+ * @returns 0 iff successful
+ */
+int esa_init_cache( esa_s *self){
+ lcp_inter_t* cache = malloc((1 << (2*CACHE_LENGTH)) * sizeof(lcp_inter_t) );
+
+ if( !cache){
+ return 1;
+ }
+
+ self->cache = cache;
+
+ char str[CACHE_LENGTH+1];
+ str[CACHE_LENGTH] = '\0';
+
+ saidx_t m = L(self->CLD, self->len);
+ lcp_inter_t ij = {
+ .i = 0,
+ .j = self->len - 1,
+ .m = m,
+ .l = self->LCP[m]
+ };
+
+ esa_init_cache_dfs( self, str, 0, ij);
+
+ return 0;
+}
+
+/** @brief Fills the cache — one char at a time.
+ *
+ * This function is a depth first search on the virtual suffix tree and fills
+ * the cache. Or rather it calls it self until some value to cache is calculated.
+ * This function is a recursive version of get_inteval but with more edge cases.
+ *
+ * @param C - The ESA.
+ * @param str - The current prefix.
+ * @param pos - The length of the prefix.
+ * @param in - The LCP-interval of prefix[0..pos-1].
+ */
+void esa_init_cache_dfs( esa_s *C, char *str, size_t pos, const lcp_inter_t in){
+ // we are not yet done, but the current strings do not exist in the subject.
+ if( pos < CACHE_LENGTH && in.i == -1 && in.j == -1){
+ esa_init_cache_fill(C,str,pos,in);
+ return;
+ }
+
+ // we are past the caching length
+ if( pos >= CACHE_LENGTH){
+ esa_init_cache_fill(C,str,pos,in);
+ return;
+ }
+
+ lcp_inter_t ij;
+
+ // iterate over all nucleotides
+ for( int code = 0; code < 4; ++code){
+ str[pos] = code2char(code);
+ ij = get_interval(C, in, str[pos]);
+
+ // fail early
+ if( ij.i == -1 && ij.j == -1){
+ esa_init_cache_fill(C, str, pos + 1, ij);
+ continue;
+ }
+
+ // The LCP-interval is deeper than expected
+ if ( ij.l > (ssize_t)(pos + 1)){
+
+ // Check if it still fits into the cache
+ if( (size_t)ij.l < CACHE_LENGTH){
+
+ // fill with dummy value
+ esa_init_cache_fill(C, str, pos+1, in);
+
+ char non_acgt = 0;
+
+ // fast forward
+ size_t k = pos + 1;
+ for(;k < (size_t)ij.l; k++){
+ // In some very edgy edge cases the lcp-interval `ij` contains
+ // a `;` or another non-acgt character. Since we cannot cache
+ // those, break.
+ char c = C->S[C->SA[ij.i]+k];
+ if( char2code(c) < 0){
+ non_acgt = 1;
+ break;
+ }
+
+ str[k] = c;
+ }
+
+ if( non_acgt) {
+ esa_init_cache_fill(C, str, k, ij);
+ } else {
+ esa_init_cache_dfs(C, str, k, ij);
+ }
+
+ continue;
+ }
+
+ // If the lcp-interval exceeds the cache depth, stop here and fill
+ esa_init_cache_fill(C, str, pos+1, in);
+ continue;
+ }
+
+ // Continue one level deeper
+ esa_init_cache_dfs(C,str,pos+1, ij);
+ }
+}
+
+/** @brief Fills the cache with a given value.
+ *
+ * Given a prefix and a value this function fills the cache beyond this point
+ * the value.
+ *
+ * @param C - The ESA.
+ * @param str - The current prefix.
+ * @param pos - The length of the prefix.
+ * @param in - The LCP-interval of prefix[0..pos-1].
+ */
+void esa_init_cache_fill( esa_s *C, char *str, size_t pos, lcp_inter_t in){
+ if( pos < CACHE_LENGTH){
+ for( int code = 0; code < 4; ++code){
+ str[pos] = code2char(code);
+ esa_init_cache_fill( C, str, pos + 1, in);
+ }
+ } else {
+ ssize_t code = 0;
+ for( size_t i = 0; i < CACHE_LENGTH; ++i ){
+ code <<= 2;
+ code |= char2code(str[i]);
+ }
+
+ C->cache[code] = in;
+ }
+}
+
+/**
+ * @brief Initializes the FVC (first variant character) array.
+ *
+ * The FVC is of my own invention and simply defined as
+ * `FVC[i] = S[SA[i]+LCP[i]]`. This expression is constantly used in
+ * get_interval. By precomputing the result, we have less memory
+ * accesses, less cache misses, and thus improved runtimes of up to 15%
+ * faster matching. This comes at a negligible cost of increased memory.
+ *
+ * @param self - The ESA
+ * @returns 0 iff successful
+ */
+int esa_init_FVC(esa_s *self){
+ size_t len = self->len;
+
+ char *FVC = self->FVC = malloc(len);
+ if(!FVC){
+ return 1;
+ }
+
+ const char *S = self->S;
+ const int *SA = self->SA;
+ const int *LCP= self->LCP;
+
+ FVC[0] = '\0';
+ for(size_t i=len; i--; FVC++, SA++, LCP++){
+ *FVC = S[*SA + *LCP];
+ }
+
+ return 0;
+}
+
+/** @brief Initializes an ESA.
+ *
+ * This function initializes an ESA with respect to the provided sequence.
+ * @param C - The ESA to initialize.
+ * @param S - The sequence
+ * @returns 0 iff successful
+ */
+int esa_init( esa_s *C, const seq_t *S){
+ if( !C || !S || !S->S) return 1;
+
+ *C = (esa_s){
+ .S = S->RS,
+ .len = S->RSlen
+ };
+
+ int result;
+
+ result = esa_init_SA(C);
+ if(result) return result;
+
+ result = esa_init_LCP(C);
+ if(result) return result;
+
+ result = esa_init_CLD(C);
+ if(result) return result;
+
+ result = esa_init_FVC(C);
+ if( result) return result;
+
+ result = esa_init_cache(C);
+ if(result) return result;
+
+ return 0;
+}
+
+/** @brief Free the private data of an ESA. */
+void esa_free( esa_s *self){
+ free( self->SA);
+ free( self->LCP);
+ free( self->CLD);
+ free( self->cache);
+ free( self->FVC);
+ *self = (esa_s){};
+}
+
+/**
+ * Computes the SA given a string S. To do so it uses libdivsufsort.
+ * @param C The enhanced suffix array to use. Reads C->S, fills C->SA.
+ * @returns 0 iff successful
+ */
+int esa_init_SA(esa_s *C){
+ // assert c.S
+ if( !C || !C->S ){
+ return 1;
+ }
+
+ C->SA = malloc(C->len * sizeof(saidx_t));
+ if( !C->SA ){
+ return 2;
+ }
+
+ saidx_t result = 1;
+
+ #ifdef HAVE_LIBDIVSUFSORT
+ result = divsufsort((const unsigned char*)C->S, C->SA, C->len);
+ #else
+ result = c_psufsort(C->S, C->SA);
+ #endif
+
+ return result;
+}
+
+/** @brief Initializes the CLD (child) array.
+ *
+ * See Ohlebusch.
+ *
+ * @param C - The ESA
+ */
+int esa_init_CLD( esa_s *C){
+ if( !C || !C->LCP){
+ return 1;
+ }
+ saidx_t* CLD = C->CLD = malloc((C->len+1) * sizeof(saidx_t));
+ if( !C->CLD) {
+ return 2;
+ }
+
+ saidx_t *LCP = C->LCP;
+
+ typedef struct pair_s {
+ saidx_t idx, lcp;
+ } pair_t;
+
+ pair_t *stack = malloc((C->len+1) * sizeof(pair_t));
+ pair_t *top = stack; // points at the topmost filled element
+ pair_t last;
+
+ R(CLD,0) = C->len + 1;
+
+ top->idx = 0;
+ top->lcp = -1;
+
+ // iterate over all elements
+ for( size_t k = 1; k < (size_t)(C->len + 1); k++){
+ while( LCP[k] < top->lcp){
+ // top->lcp is a leaf
+ last = *top--;
+
+ // link all elements of same lcp value in a chain
+ while( top->lcp == last.lcp){
+ R(CLD,top->idx) = last.idx;
+ last = *top--;
+ }
+
+ // store the l-index of last
+ if( LCP[k] < top->lcp){
+ R(CLD, top->idx) = last.idx;
+ } else {
+ L(CLD, k) = last.idx;
+ }
+ }
+
+ // continue one level deeper
+ top++;
+ top->idx = k;
+ top->lcp = LCP[k];
+ }
+
+ free( stack);
+ return 0;
+}
+
+/**
+ * This function computed the LCP array, given the suffix array. Thereto it uses
+ * a special `phi` array, which makes it slightly faster than the original
+ * linear-time algorithm by Kasai et al.
+ *
+ * @param C The enhanced suffix array to compute the LCP from.
+ * @returns 0 iff successful
+ */
+int esa_init_LCP( esa_s *C){
+ const char *S = C->S;
+ saidx_t *SA = C->SA;
+ saidx_t len = C->len;
+
+ // Trivial safety checks
+ if( !C || !S || !SA || len == 0){
+ return 1;
+ }
+
+ // Allocate new memory
+ // The LCP array is one element longer than S.
+ saidx_t *LCP = C->LCP = malloc((len+1)*sizeof(saidx_t));
+ if( !LCP ){
+ return 3;
+ }
+
+ LCP[0] = -1;
+ LCP[len] = -1;
+
+ // Allocate temporary arrays
+ saidx_t *PHI = malloc( len * sizeof(saidx_t));
+ saidx_t *PLCP = PHI;
+ if( !PHI ){
+ free(PHI);
+ return 2;
+ }
+
+ PHI[SA[0]] = -1;
+ saidx_t k;
+ ssize_t i;
+
+
+ for( i=1; i< len; i++){
+ PHI[SA[i]] = SA[ i-1];
+ }
+
+ ssize_t l = 0;
+ for( i = 0; i< len ; i++){
+ k = PHI[i];
+ if( k != -1 ){
+ while( S[k+l] == S[i+l]){
+ l++;
+ }
+ PLCP[i] = l;
+ l--;
+ if( l < 0) l = 0;
+ } else {
+ PLCP[i] = -1;
+ }
+ }
+
+ // unpermutate the LCP array
+ for( i=1; i< len; i++){
+ LCP[i] = PLCP[SA[i]];
+ }
+
+ free(PHI);
+ return 0;
+}
+
+/** @brief For the lcp-interval of string `w` compute the interval for `wa`
+ *
+ * Say, we already know the LCP-interval ij for a string `w`. Now we want to
+ * check if `wa` may also be found in the ESA and thus in the subject. So we
+ * look for the sub interval of `ij` in which all strings feature an `a` as
+ * the next character. If such a sub interval is found, its boundaries are
+ * returned.
+ *
+ * @param self - The ESA.
+ * @param ij - The lcp-interval for `w`.
+ * @param a - The next character.
+ * @returns The lcp-interval one level deeper.
+ */
+static lcp_inter_t get_interval( const esa_s *self, lcp_inter_t ij, char a){
+ saidx_t i = ij.i;
+ saidx_t j = ij.j;
+
+ const saidx_t *SA = self->SA;
+ const saidx_t *LCP = self->LCP;
+ const char *S = self->S;
+ const saidx_t *CLD = self->CLD;
+ const char *FVC= self->FVC;
+ // check for singleton or empty interval
+ if( i == j ){
+ if( S[SA[i] + ij.l] != a){
+ ij.i = ij.j = -1;
+ }
+ return ij;
+ }
+
+ int m = ij.m;
+ int l = ij.l;
+
+ char c = S[SA[i] + l];
+ goto SoSueMe;
+
+ do {
+ c = FVC[i];
+
+ SoSueMe:
+ if( c == a){
+ /* found ! */
+ saidx_t n = L(CLD, m);
+
+ ij = (lcp_inter_t){
+ .i = i,
+ .j = m-1,
+ .m = n,
+ .l = LCP[n]
+ };
+
+ return ij;
+ }
+
+ if( c > a){
+ break;
+ }
+
+ i = m;
+
+ if( i == j ){
+ break; // singleton interval, or `a` not found
+ }
+
+ m = R(CLD,m);
+ } while ( /*m != "bottom" && */ LCP[m] == l);
+
+ // final sanity check
+ if( i != ij.i ? FVC[i] == a : S[SA[i] + l] == a){
+ ij.i = i;
+ ij.j = j;
+ /* Also return the length of the LCP interval including `a` and
+ * possibly even more characters. Note: l + 1 <= LCP[m] */
+ ij.l = LCP[m];
+ ij.m = m;
+ } else {
+ ij.i = ij.j = -1;
+ }
+
+ return ij;
+}
+
+/** @brief Compute the longest match of a query with the subject.
+ *
+ * The *longest match* is the core concept of `andi`. Its simply defined as the
+ * longest prefix of a query Q appearing anywhere in the subject S. Talking about
+ * genetic sequences, a match is a homologous region, likely followed by a SNP.
+ *
+ * This function returns the interval for where the longest match of the query
+ * can be found in the ESA. Thereto it expects a starting interval for the search.
+ *
+ * @param C - The enhanced suffix array for the subject.
+ * @param query - The query sequence.
+ * @param qlen - The length of the query. Should correspond to `strlen(query)`.
+ * @param k - The starting index into the query.
+ * @param ij - The LCP interval for the string `query[0..k]`.
+ * @returns The LCP interval for the longest prefix.
+ */
+lcp_inter_t get_match_from( const esa_s *C, const char *query, size_t qlen, saidx_t k, lcp_inter_t ij){
+
+ if( ij.i == -1 && ij.j == -1){
+ return ij;
+ }
+
+ // fail early on singleton intervals.
+ if( ij.i == ij.j){
+
+ // try to extend the match. See line 513 below.
+ saidx_t p = C->SA[ij.i];
+ size_t k = ij.l;
+ const char *S = (const char *)C->S;
+
+ for( ; k< qlen && S[p+k]; k++ ){
+ if( S[p+k] != query[k]){
+ ij.l = k;
+ return ij;
+ }
+ }
+
+ ij.l = k;
+ return ij;
+ }
+
+ saidx_t l, i, j;
+
+ lcp_inter_t res = ij;
+
+ const saidx_t *SA = C->SA;
+ const char *S = C->S;
+
+ // Loop over the query until a mismatch is found
+ do {
+ // Get the subinterval for the next character.
+ ij = get_interval( C, ij, query[k]);
+ i = ij.i;
+ j = ij.j;
+
+ // If our match cannot be extended further, return.
+ if( i == -1 && j == -1 ){
+ res.l = k;
+ return res;
+ }
+
+ res.i = ij.i;
+ res.j = ij.j;
+
+ l = qlen;
+ if( i < j && ij.l < l){
+ /* Instead of making another look up we can use the LCP interval calculated
+ * in get_interval */
+ l = ij.l;
+ }
+
+ // By definition, the kth letter of the query was matched.
+ k++;
+
+ // Extend the match
+ for( int p = SA[i]; k < l; k++){
+ if( S[p+k] != query[k] ){
+ res.l = k;
+ return res;
+ }
+ }
+ } while ( k < (ssize_t)qlen);
+
+ res.l = qlen;
+ return res;
+}
+
+/** @brief Get a match.
+ *
+ * Given an ESA and a string Q find the longest prefix of Q that matches somewhere
+ * in C. This search is done entirely via jumping around in the ESA, and thus is
+ * slow.
+ *
+ * @param C - The ESA.
+ * @param query - The query string — duh.
+ * @param qlen - The length of the query.
+ * @returns the lcp interval of the match.
+ */
+lcp_inter_t get_match( const esa_s *C, const char *query, size_t qlen){
+ // sanity checks
+ if( !C || !query || !C->len || !C->SA || !C->LCP || !C->S || !C->CLD ){
+ return (lcp_inter_t){-1,-1,-1,-1};
+ }
+
+ saidx_t m = L(C->CLD, C->len);
+ lcp_inter_t ij = {
+ .i = 0,
+ .j = C->len - 1,
+ .m = m,
+ .l = C->LCP[m]
+ };
+
+ return get_match_from(C, query, qlen, 0, ij);
+}
+
+/** @brief Compute the LCP interval of a query. For a certain prefix length of the
+ * query its LCP interval is retrieved from a cache. Hence this is faster than the
+ * naive `get_match`. If the cache fails to provide a proper value, we fall back
+ * to the standard search.
+ *
+ * @param C - The enhanced suffix array for the subject.
+ * @param query - The query sequence.
+ * @param qlen - The length of the query. Should correspond to `strlen(query)`.
+ * @returns The LCP interval for the longest prefix.
+ */
+lcp_inter_t get_match_cached( const esa_s *C, const char *query, size_t qlen){
+ if( qlen <= CACHE_LENGTH) return get_match( C, query, qlen);
+
+ ssize_t offset = 0;
+ for( size_t i = 0; i< CACHE_LENGTH; i++){
+ offset <<= 2;
+ offset |= char2code(query[i]);
+ }
+
+ if( offset < 0){
+ return get_match( C, query, qlen);
+ }
+
+ lcp_inter_t ij = C->cache[offset];
+
+ if( ij.i == -1 && ij.j == -1){
+ return get_match( C, query, qlen);
+ }
+
+ return get_match_from(C, query, qlen, ij.l, ij);
+}
+
diff --git a/src/esa.h b/src/esa.h
new file mode 100644
index 0000000..6580a2d
--- /dev/null
+++ b/src/esa.h
@@ -0,0 +1,81 @@
+/**
+ * @file
+ * @brief This header contains the declarations for functions in esa.c.
+ *
+ */
+#ifndef _ESA_H_
+#define _ESA_H_
+
+#include "sequence.h"
+#include "config.h"
+
+#ifdef HAVE_LIBDIVSUFSORT
+# include <divsufsort.h>
+#else
+
+#include "../opt/psufsort/interface.h"
+
+typedef int saidx_t;
+
+#endif
+
+/**
+ * @brief Represents LCP-Intervals.
+ *
+ * This struct is used to represent LCP-intervals. The member `i` should
+ * coincide with the lower bound whereas `j` is the upper bound. Both bounds
+ * are inclusive. So if `i == j` the interval contains exactly one element,
+ * namely `i`. To represent an empty interval please use `i == j == -1`.
+ * Other variants, such as `i == j == -2` can be used to indicate an error.
+ * The common prefix length is denoted by l and should always be non-negative.
+ * Variables of this type are often called `ij`.
+ */
+typedef struct {
+ /** @brief The common prefix length */
+ saidx_t l;
+ /** @brief lower bound */
+ saidx_t i;
+ /** @brief upper bound */
+ saidx_t j;
+ /** The new middle. */
+ saidx_t m;
+} lcp_inter_t;
+
+/**
+ * @brief The ESA type.
+ *
+ * This structure holds arrays and objects associated with an enhanced
+ * suffix array (ESA).
+ */
+typedef struct esa_s {
+ /** The base string from which the ESA was generated. */
+ const char *S;
+ /** The actual suffix array with indexes into S. */
+ saidx_t *SA;
+ /** The LCP holds the number of letters up to which a suffix `S[SA[i]]`
+ equals `S[SA[i-1]]`. Hence the name longest common prefix. For `i = 0`
+ and `i = len` the LCP value is -1. */
+ saidx_t *LCP;
+ /** The length of the string S. */
+ saidx_t len;
+ /** A cache for lcp-intervals */
+ lcp_inter_t *cache;
+ /** The FVC array holds the character after the LCP. */
+ char *FVC;
+ /** This is the child array. */
+ saidx_t *CLD;
+} esa_s;
+
+lcp_inter_t get_match_cached( const esa_s *, const char *query, size_t qlen);
+lcp_inter_t get_match( const esa_s *, const char *query, size_t qlen);
+int esa_init( esa_s *, const seq_t *S);
+void esa_free( esa_s *);
+
+#ifdef DEBUG
+
+char code2char( ssize_t code);
+
+#endif //DEBUG
+
+#endif
+
diff --git a/src/global.h b/src/global.h
new file mode 100644
index 0000000..4f6f1d3
--- /dev/null
+++ b/src/global.h
@@ -0,0 +1,48 @@
+/**
+ * @file
+ * @brief Global Definitions
+ *
+ * This file contains the declaration of global variables and
+ * their related values. The actual definition is located in andi.c
+ */
+#ifndef _GLOBAL_H_
+#define _GLOBAL_H_
+#include "config.h"
+
+/**
+ * The *global* variable ::FLAGS is used to set different options
+ * for the execution of the program. Use `FLAGS & F_NAME` to check
+ * if `F_NAME` was set.
+ */
+extern int FLAGS;
+
+/**
+ * The *global* variable ::THREADS contains the number of threads the program
+ * should use.
+ */
+extern int THREADS;
+
+/**
+ * The ::RANDOM_ANCHOR_PROP represents the probability with which a found
+ * anchor is a random match and not homologous. Its value can be set using
+ * the `-p` switch.
+ */
+extern double RANDOM_ANCHOR_PROP;
+
+/**
+ * This enum contains the available flags. Please note that all
+ * available options are a power of 2.
+ */
+enum {
+ F_NONE = 0,
+ F_RAW = 1,
+ F_VERBOSE = 2,
+ F_EXTRA_VERBOSE = 4,
+ F_NON_ACGT = 8,
+ F_JOIN = 16,
+ F_LOW_MEMORY = 32,
+ F_SHORT = 64
+};
+
+#endif
+
diff --git a/src/io.c b/src/io.c
new file mode 100644
index 0000000..ad638ec
--- /dev/null
+++ b/src/io.c
@@ -0,0 +1,184 @@
+/**
+ * @file
+ * @brief This file contains the definitions for various io methods.
+ */
+#define _GNU_SOURCE
+#include <fcntl.h>
+#include <math.h>
+#include <stdio.h>
+#include <string.h>
+#include <unistd.h>
+
+#include <pfasta.h>
+#include <compat-string.h>
+
+#include "global.h"
+#include "io.h"
+
+/**
+ * @brief Joins all sequences from a file into a single long sequence.
+ *
+ * Apart from reading all sequences from a file, this function also
+ * merges them into one long sequence.
+ *
+ * "I didn't learn joined up handwriting for nothing, you know."
+ * ~ Gilderoy Lockhart
+ *
+ * @param in - The file pointer to read from.
+ * @param dsa - An array that holds found sequences.
+ * @param name - The name of the file to be used for the name of the sequence.
+ */
+void read_fasta_join( const char* file_name, dsa_t *dsa){
+ if( !file_name || !dsa ) return;
+
+ dsa_t single;
+ dsa_init(&single);
+ read_fasta( file_name, &single);
+
+ if( dsa_size( &single) == 0 ){
+ return;
+ }
+
+ seq_t joined = dsa_join( &single);
+
+ /* In join mode we try to be clever about the sequence name. Given the file
+ * path we extract just the file name. ie. path/file.ext -> file
+ * This obviously fails on Windows.
+ */
+
+ const char *left = strrchr( file_name, '/'); // find the last path separator
+ left = (left == NULL) ? file_name : left + 1; // left is the position one of to the right of the path separator
+
+ const char *dot = strchrnul( left, '.'); // find the extension
+
+ joined.name = strndup( left, dot-left ); // copy only the file name, not its path or extension
+ dsa_push( dsa, joined);
+ dsa_free( &single);
+}
+
+
+/**
+ * @brief This function reads sequences from a file.
+ * @param in - The file pointer to read from.
+ * @param dsa - An array that holds found sequences.
+ */
+void read_fasta( const char* file_name, dsa_t *dsa){
+ if( !file_name || !dsa) return;
+
+ int file_descriptor = strcmp(file_name, "-") ? open(file_name, O_RDONLY) : STDIN_FILENO;
+ if (file_descriptor < 0) warn("%s", file_name);
+
+ int l;
+ int check;
+
+ seq_t top = {};
+ pfasta_file pf;
+
+ if ((l = pfasta_parse(&pf, file_descriptor)) != 0) {
+ warnx("%s: Parser initialization failed: %s", file_name, pfasta_strerror(&pf));
+ goto fail;
+ }
+
+ pfasta_seq ps;
+ while ((l = pfasta_read(&pf, &ps)) == 0) {
+ check = seq_init( &top, ps.seq, ps.name);
+
+ // skip broken sequences
+ if( check != 0) continue;
+
+ dsa_push( dsa, top);
+ pfasta_seq_free(&ps);
+ }
+
+ if (l < 0) {
+ warnx("%s: Input parsing failed: %s", file_name, pfasta_strerror(&pf));
+ pfasta_seq_free(&ps);
+ }
+
+fail:
+ pfasta_free(&pf);
+ close(file_descriptor);
+}
+
+
+/**
+ * @brief Prints the distance matrix.
+ *
+ * This function pretty prints the distance matrix. For small distances
+ * scientific notation is used.
+ * @param D - The distance matrix
+ * @param sequences - An array of pointers to the sequences.
+ * @param n - The number of sequences.
+ */
+void print_distances( const data_t *D, const seq_t *sequences, size_t n){
+
+ int use_scientific = 0;
+ int failed = 0;
+ size_t i,j;
+
+ for( i=0; i<n && (!use_scientific || !failed); i++){
+ for( j=0; j<n; j++){
+ if( D(i,j).distance > 0 && D(i,j).distance < 0.001 ){
+ use_scientific = 1;
+ }
+ if( isnan(D(i,j).distance)){
+ failed = 1;
+ }
+ }
+ }
+
+ if( failed){
+ warnx("Some distance computations failed and are reported as nan. "
+ "Please refer to the documentation for further details.");
+ }
+
+ printf("%zu\n", n);
+ for( i=0;i<n;i++){
+ // Print exactly nine characters of the name. Pad with spaces if necessary.
+ printf("%-9.9s", sequences[i].name);
+
+ for( j=0;j<n;j++){
+ // print average, weighted by covered nucleotides
+ double val = 0;
+ if( i != j){
+ double ijnucl = D(i,j).coverage * (double)sequences[j].len;
+ double jinucl = D(j,i).coverage * (double)sequences[i].len;
+ val = (D(i,j).distance * ijnucl + D(j,i).distance * jinucl)
+ / (ijnucl + jinucl);
+ }
+
+ if( FLAGS & F_EXTRA_VERBOSE ){
+ val = D(i,j).distance;
+ }
+
+ if( !(FLAGS & F_RAW)){
+ val = -0.75 * log(1.0- (4.0 / 3.0) * val ); // jukes cantor
+ }
+ // fix negative zero
+ if( val <= 0.0 ){
+ val = 0.0;
+ }
+
+ // use scientific notation for small numbers
+ printf(use_scientific ? " %1.4e" : " %1.4f", val);
+ }
+ printf("\n");
+ }
+}
+
+/**
+ * @brief Prints the coverage matrix.
+ * @param D - The distance matrix
+ * @param n - The number of sequences.
+ */
+void print_coverages( const data_t *D, size_t n){
+ size_t i,j;
+ printf("\nCoverage:\n");
+ for(i=0; i<n; i++){
+ for(j=0; j<n; j++){
+ printf("%1.4e ", D(i,j).coverage);
+ }
+ printf("\n");
+ }
+}
+
diff --git a/src/io.h b/src/io.h
new file mode 100644
index 0000000..38e6856
--- /dev/null
+++ b/src/io.h
@@ -0,0 +1,36 @@
+/**
+ * @file
+ * @brief This header contains function declarations for io procedures.
+ */
+#ifndef _IO_H_
+#define _IO_H_
+
+#include <err.h>
+#include <errno.h>
+#include <stdio.h>
+#include "sequence.h"
+
+/** @brief The data structure can be used to store output data resulting
+ * from the computation of distance.
+ */
+typedef struct data_s {
+ /** The distance */
+ double distance;
+ /** The coverage */
+ double coverage;
+} data_t;
+
+
+/**
+ * This is a neat hack for dealing with matrices.
+ */
+#define D( X, Y) (D[ (X)*n + (Y) ])
+#define M( X, Y) (M[ (X)*n + (Y) ])
+
+void read_fasta( const char *, dsa_t *dsa);
+void read_fasta_join( const char *, dsa_t *dsa);
+
+void print_distances( const data_t *D, const seq_t *sequences, size_t n);
+void print_coverages( const data_t *D, size_t n);
+
+#endif // _IO_H_
diff --git a/src/process.c b/src/process.c
new file mode 100644
index 0000000..4b7a8a9
--- /dev/null
+++ b/src/process.c
@@ -0,0 +1,366 @@
+
+
+/**
+ * @file
+ * @brief This file contains various distance methods.
+ */
+#include <stdlib.h>
+#include <string.h>
+#include <assert.h>
+#include <math.h>
+#include <stdio.h>
+#include "esa.h"
+#include "global.h"
+#include "process.h"
+#include "sequence.h"
+#include "io.h"
+
+#ifdef _OPENMP
+#include <omp.h>
+#endif
+
+double shuprop( size_t x, double g, size_t l);
+
+/**
+ * @brief Calculates the minimum anchor length.
+ *
+ * Given some parameters calculate the minimum length for anchors according
+ * to the distribution from Haubold et al. (2009).
+ *
+ * @param p - The probability with which an anchor is allowed to be random.
+ * @param g - The the relative amount of GC in the subject.
+ * @param l - The length of the subject.
+ * @returns The minimum length of an anchor.
+ */
+size_t minAnchorLength( double p, double g, size_t l){
+ size_t x = 1;
+
+ double prop = 0.0;
+ while( prop < 1 - p){
+ prop = shuprop( x, g/2, l);
+ x++;
+ }
+
+ return x;
+}
+
+/**
+ * @brief Calculates the binomial coefficient of n and k.
+ *
+ * We used to use gsl_sf_lnchoose(xx,kk) for this functionality.
+ * After all, why implement something that has already been done?
+ * Well, the reason is simplicity: GSL is used for only this one
+ * function and the input (n<=20) is not even considered big.
+ * Hence its much easier to have our own implementation and ditch
+ * the GSL dependency even if that means our code is a tiny bit
+ * less optimized and slower.
+ *
+ * @param n - The n part of the binomial coefficient.
+ * @param k - analog.
+ * @returns (n choose k)
+ */
+size_t binomial_coefficient( size_t n, size_t k){
+ if( n <= 0 || k > n){
+ return 0;
+ }
+
+ if( k == 0 || k == n ){
+ return 1;
+ }
+
+ if( k > n-k ){
+ k = n-k;
+ }
+
+ size_t res = 1;
+
+ for( size_t i= 1; i <= k; i++){
+ res *= n - k + i;
+ res /= i;
+ }
+
+ return res;
+}
+
+/**
+ * @brief Given `x` this function calculates the probability of a shustring
+ * with a length less than `x`.
+ *
+ * Let X be the longest shortest unique substring (shustring) at any position. Then
+ * this function computes P{X <= x} with respect to the given parameter set. See
+ * Haubold et al. (2009).
+ *
+ * @param x - The maximum length of a shustring.
+ * @param g - The the half of the relative amount of GC in the DNA.
+ * @param l - The length of the subject.
+ * @returns The probability of a certain shustring length.
+ */
+double shuprop( size_t x, double p, size_t l){
+ double xx = (double)x;
+ double ll = (double)l;
+ size_t k;
+
+ double s = 0.0;
+
+ for(k=0; k<= x; k++){
+ double kk = (double)k;
+ double t = pow(p,kk) * pow(0.5 - p, xx - kk);
+
+ s += pow(2,xx) * (t * pow(1-t,ll)) * (double)binomial_coefficient(x,k);
+ if( s >= 1.0){
+ s = 1.0;
+ break;
+ }
+ }
+
+ return s;
+}
+
+/**
+ * @brief Divergence estimation using the anchor technique.
+ *
+ * The dist_anchor() function estimates the divergence between two
+ * DNA sequences. The subject is given as an ESA, whereas the query
+ * is a simple string. This function then looks for *anchors* -- long
+ * substrings that exist in both sequences. Then it manually checks for
+ * mutations between those anchors.
+ *
+ * @return An estimate for the number of mutations within homologous regions.
+ * @param C - The enhanced suffix array of the subject.
+ * @param query - The actual query string.
+ * @param query_length - The length of the query string. Needed for speed reasons.
+ */
+data_t dist_anchor( const esa_s *C, const char *query, size_t query_length, double gc){
+ size_t snps = 0; // Total number of found SNPs
+ size_t homo = 0; // Total number of homologous nucleotides.
+
+ lcp_inter_t inter;
+
+ size_t last_pos_Q = 0;
+ size_t last_pos_S = 0;
+ size_t last_length = 0;
+ // This variable indicates that the last anchor was the right anchor of a pair.
+ size_t last_was_right_anchor = 0;
+
+ size_t this_pos_Q = 0;
+ size_t this_pos_S;
+ size_t this_length;
+
+ size_t num_right_anchors = 0;
+
+#ifdef DEBUG
+ size_t num_matches = 0;
+ size_t num_anchors = 0;
+ size_t num_anchors_in_rc = 0;
+ size_t num_right_anchors_in_rc = 0;
+ size_t length_anchors = 0;
+ double off_num = 0.0;
+ double off_dem = 0.0;
+#endif
+
+ size_t threshold = minAnchorLength( 1-sqrt(1-RANDOM_ANCHOR_PROP), gc, C->len);
+
+ data_t retval = {0.0,0.0};
+
+ // Iterate over the complete query.
+ while( this_pos_Q < query_length){
+ inter = get_match_cached( C, query + this_pos_Q, query_length - this_pos_Q);
+
+#ifdef DEBUG
+ num_matches++;
+#endif
+
+ this_length = inter.l <= 0 ? 0 : inter.l;
+
+ if( inter.i == inter.j && this_length >= threshold)
+ {
+ // We have reached a new anchor.
+ this_pos_S = C->SA[ inter.i];
+
+#ifdef DEBUG
+ num_anchors++;
+ length_anchors += this_length;
+ if( this_pos_S < (size_t)(C->len / 2)){
+ num_anchors_in_rc++;
+ }
+#endif
+
+ // Check if this can be a right anchor to the last one.
+ if( this_pos_Q - last_pos_Q == this_pos_S - last_pos_S ){
+ num_right_anchors++;
+#ifdef DEBUG
+ if( this_pos_S < (size_t)(C->len / 2)){
+ num_right_anchors_in_rc++;
+ }
+#endif
+
+ // Count the SNPs in between.
+ size_t i;
+ for( i= last_length; i< this_pos_Q - last_pos_Q; i++){
+ if( C->S[ last_pos_S + i] != query[ last_pos_Q + i] ){
+ snps++;
+ }
+ }
+ homo += this_pos_Q - last_pos_Q;
+ last_was_right_anchor = 1;
+ } else {
+#ifdef DEBUG
+ double off = fabs((double)(this_pos_Q - last_pos_Q)- (double)(this_pos_S - last_pos_S));
+ if( off < 100 ){
+ off_num += off;
+ off_dem++;
+ }
+#endif
+ if( last_was_right_anchor){
+ // If the last was a right anchor, but with the current one, we
+ // cannot extend, then add its length.
+ homo += last_length;
+ } else if( (last_length / 2) >= threshold){
+ // The last anchor wasn't neither a left or right anchor. But,
+ // it was as long as an anchor pair. So still count it.
+ homo += last_length;
+ }
+
+ last_was_right_anchor = 0;
+ }
+
+ // Cache values for later
+ last_pos_Q = this_pos_Q;
+ last_pos_S = this_pos_S;
+ last_length= this_length;
+ }
+
+ // Advance
+ this_pos_Q += this_length + 1;
+ }
+
+#ifdef DEBUG
+ if( FLAGS & F_EXTRA_VERBOSE ){
+ const char str[] = {
+ "- threshold: %ld\n"
+ "- matches: %lu\n"
+ "- anchors: %lu (rc: %lu)\n"
+ "- right anchors: %lu (rc: %lu)\n"
+ "- avg length: %lf\n"
+ "- off: %f (skipped: %.0f)\n"
+ "\n"
+ };
+
+ #pragma omp critical
+ {
+ fprintf(stderr, str, threshold, num_matches, num_anchors, num_anchors_in_rc, num_right_anchors, num_right_anchors_in_rc, (double)length_anchors/ num_anchors, off_num/off_dem, off_dem );
+ }
+ }
+#endif
+
+ // Very special case: The sequences are identical
+ if( last_length >= query_length ){
+ retval.coverage = 1.0;
+ return retval;
+ }
+
+ // We might miss a few nucleotides if the last anchor was also a right anchor.
+ if( last_was_right_anchor ){
+ homo += last_length;
+ }
+
+ // Nearly identical sequences
+ if( homo == query_length){
+ retval.distance = (double)snps/(double)homo;
+ retval.coverage = 1.0;
+ return retval;
+ }
+
+ // Insignificant results. All abort the fail train.
+ if ( homo <= 3){
+ retval.distance = NAN;
+ return retval;
+ }
+
+ // Abort if we have more homologous nucleotides than just nucleotides. This might
+ // happen with sequences of different lengths.
+ if( homo >= (size_t) C->len ){
+ retval.distance = NAN;
+ retval.coverage = 1.0;
+ return retval;
+ }
+
+ retval.distance = (double)snps/(double)homo;
+ retval.coverage = (double)homo/(double)query_length;
+ return retval;
+}
+
+/**
+ * @brief Computes the distance matrix.
+ *
+ * The distMatrix() populates the D matrix with computed distances. It allocates D and
+ * @param sequences An array of pointers to the sequences.
+ * @param n The number of sequences.
+ */
+#define FAST
+#include "dist_hack.h"
+
+/**
+ * @brief Computes the distance matrix.
+ *
+ * The distMatrixLM() populates the D matrix with computed distances. It allocates D and
+ * @param sequences An array of pointers to the sequences.
+ * @param n The number of sequences.
+ */
+#undef FAST
+#include "dist_hack.h"
+
+/**
+ * @brief Calculates and prints the distance matrix
+ * @param sequences - An array of pointers to the sequences.
+ * @param n - The number of sequences.
+ */
+void calculate_distances( seq_t* sequences, int n){
+ int i;
+
+ // check the sequences
+ for( i=0;i<n;i++){
+ if( sequences[i].S == NULL || sequences[i].len == 0){
+ errx(1, "Missing sequence: %s", sequences[i].name);
+ }
+
+ if( sequences[i].len < 1000){
+ FLAGS |= F_SHORT;
+ }
+ }
+
+ if( FLAGS & F_SHORT ){
+ warnx("One of the given input sequences is shorter than a thousand nucleotides. "
+ "This may result in inaccurate distances. Try an alignment instead.");
+ }
+
+ // Warn about non ACGT residues.
+ if( FLAGS & F_NON_ACGT ){
+ warnx("The input sequences contained characters other than acgtACGT. "
+ "These were automatically stripped to ensure correct results.");
+ }
+
+ data_t *M = malloc(n*n*sizeof(data_t));
+ if( !M){
+ err( errno, "Could not allocate enough memory for the comparison matrix. Try using --join or --low-memory.");
+ }
+
+ // compute the distances
+ if( FLAGS & F_LOW_MEMORY){
+ distMatrixLM( M, sequences, n);
+ } else {
+ distMatrix( M, sequences, n);
+ }
+
+ // print the results
+ print_distances( M, sequences, n);
+
+ // print additional information.
+ if( FLAGS & F_VERBOSE){
+ print_coverages( M, n);
+ }
+
+ free(M);
+}
+
+
diff --git a/src/process.h b/src/process.h
new file mode 100644
index 0000000..262db4a
--- /dev/null
+++ b/src/process.h
@@ -0,0 +1,15 @@
+/**
+ * @file
+ * @brief This file contains the declarations of functions in process.c
+ *
+ */
+#ifndef _PROCESS_H_
+#define _PROCESS_H_
+
+#include "sequence.h"
+
+void calculate_distances( seq_t* sequences, int n);
+
+#endif
+
+
diff --git a/src/sequence.c b/src/sequence.c
new file mode 100644
index 0000000..973699d
--- /dev/null
+++ b/src/sequence.c
@@ -0,0 +1,313 @@
+/**
+ * @file
+ * @brief Sequence utilities
+ *
+ * This file contains utility functions for working with DNA sequences.
+ */
+#include <ctype.h>
+#include <limits.h>
+#include <stdlib.h>
+#include <string.h>
+
+#include <compat-stdlib.h>
+#include "sequence.h"
+#include "global.h"
+
+void normalize( seq_t *S);
+
+/** Create a new dynamic array for sequences. */
+int dsa_init(dsa_t *A){
+ // allocate at least 4 slots so the growth by 1.5 below doesn't get stuck
+ // at 3 slots.
+ A->data = malloc(sizeof(seq_t) * 4);
+ if(!A->data){
+ return 1;
+ }
+
+ A->capacity = 4;
+ A->size = 0;
+ return 0;
+}
+
+/** Add a sequence to an array. */
+void dsa_push( dsa_t *A, seq_t S){
+ if( A->size < A->capacity){
+ A->data[A->size++] = S;
+ } else {
+ // use the near-optimal growth factor of 1.5
+ seq_t* ptr = reallocarray(A->data, A->capacity / 2, sizeof(seq_t) * 3);
+ if(ptr == NULL){
+ err(errno, "out of memory?");
+ }
+
+ A->capacity = (A->capacity / 2) * 3;
+ A->data = ptr;
+ A->data[A->size++] = S;
+ }
+}
+
+/** Frees the array and all sequences stored within. */
+void dsa_free( dsa_t *A){
+ size_t i;
+ for( i=0; i< A->size; i++){
+ seq_free(&A->data[i]);
+ }
+
+ free(A->data);
+ *A = (dsa_t){};
+}
+
+/** Returns the number of sequences stored within an array. */
+size_t dsa_size( dsa_t *A){
+ return A->size;
+}
+
+/** Get the raw C array. */
+seq_t* dsa_data( dsa_t *A){
+ return A->data;
+}
+
+/**
+ * @brief Convert an array of multiple sequences into a single sequence.
+ *
+ * This function joins all sequences contained in an array into one
+ * long sequence. The sequences are separated by a `!` character. The
+ * caller has to free the initial array.
+ *
+ * @returns A new sequence representation the union of the array.
+ */
+seq_t dsa_join( dsa_t *A){
+ seq_t joined = {};
+
+ if( A->size == 0){
+ return joined;
+ }
+
+ if(A->size == 1){
+ /* If we are to join just one sequence, _move_ its contents. */
+ joined = A->data[0];
+ A->data[0] = (seq_t){};
+ return joined;
+ }
+
+ seq_t *data = A->data;
+ seq_t *it = data;
+
+ // Compute the total length
+ size_t total = 0, i;
+ for( i=0; i< A->size; i++, it++ ){
+ total += it->len + 1;
+ }
+
+ // A single malloc for the whole new sequence
+ char *ptr = malloc( total);
+ if( ptr == NULL ){
+ return joined;
+ }
+ char *next = ptr;
+
+ // Copy all old sequences and add a `!` in between
+
+ it = data;
+ memcpy( next, it->S, it->len);
+ next += it->len;
+
+ for( i=1, it++; i < A->size; i++, it++){
+ *next++ = '!';
+ memcpy( next, it->S, it->len);
+ next += it->len;
+ }
+
+ // Don't forget the null byte.
+ *next = '\0';
+
+ joined.S = ptr;
+ joined.len = total -1; // subtract the null byte
+
+ return joined;
+}
+
+/**
+ * @brief Frees the memory of a given sequence.
+ * @param S - The sequence to free.
+ */
+void seq_free( seq_t *S){
+ free( S->S);
+ free( S->RS);
+ free( S->name);
+ *S = (seq_t){};
+}
+
+/**
+ * @brief Compute the reverse complement.
+ * @param str The master string.
+ * @param len The length of the master string
+ * @return The reverse complement. The caller has to free it!
+ */
+char *revcomp( const char *str, size_t len){
+ char *rev = malloc( len + 1);
+ if( !str || !rev) return NULL;
+
+ char *r = rev;
+ const char *s = str + len-1;
+
+ rev[len] = '\0';
+
+ char c, d;
+ char local_non_acgt = 0;
+
+ while( len --> 0 ){
+ c = *s--;
+
+ switch( c){
+ case 'A': d = 'T'; break;
+ case 'T': d = 'A'; break;
+ case 'G': d = 'C'; break;
+ case 'C': d = 'G'; break;
+ case '!': d = ';'; break; // rosebud
+ default:
+ local_non_acgt = 1;
+ continue;
+ }
+
+ *r++ = d;
+ }
+
+ if( local_non_acgt ){
+ #pragma omp atomic
+ FLAGS |= F_NON_ACGT;
+ }
+
+ return rev;
+}
+
+/**
+ * @brief This function concatenates the reverse complement to a given master string. A
+ * `#` sign is used as a separator.
+ * @param s The master string.
+ * @param len Its length.
+ * @return The newly concatenated string.
+ */
+char *catcomp( char *s , size_t len){
+ if( !s) return NULL;
+
+ char *rev = revcomp( s, len);
+
+ char *temp = (char*) realloc( rev, 2 * len + 2);
+ if( !temp){
+ free(rev);
+ return NULL;
+ }
+
+ rev = temp;
+ rev[len] = '#';
+
+ memcpy( rev+len+1, s, len+1);
+
+ return rev;
+}
+
+/**
+ * @brief Calculates the GC content of a sequence.
+ *
+ * This function computes the relative amount of G and C in the total sequence.
+ */
+double calc_gc( seq_t *S){
+ size_t GC = 0;
+ char *p = S->S;
+
+ for(; *p; p++){
+ if( *p == 'G' || *p == 'C'){
+ GC++;
+ }
+ }
+
+ return S->gc = (double)GC/S->len;
+}
+
+/** @brief Prepares a sequences to be used as the subject in a comparison. */
+void seq_subject_init( seq_t *S){
+ calc_gc(S);
+
+ S->RS = catcomp(S->S, S->len);
+ S->RSlen = 2 * S->len + 1;
+}
+
+/** @brief Frees some memory unused for when a sequence is only used as query. */
+void seq_subject_free( seq_t *S){
+ free(S->RS);
+ S->RS = NULL;
+ S->RSlen = 0;
+ S->gc = 0.0;
+}
+
+/** @brief Initializes a sequences
+ *
+ * @returns 0 iff successful.
+ */
+int seq_init( seq_t *S, const char *seq, const char *name){
+ if( !S || !seq || !name) {
+ return 1;
+ }
+
+ *S = (seq_t){
+ .S = strdup(seq),
+ .name=strdup(name)
+ };
+
+ if( !S->S || !S->name){
+ seq_free(S);
+ return 2;
+ }
+
+ normalize( S);
+
+ // recalculate the length because `normalize` might have stripped some characters.
+ S->len = strlen(S->S);
+
+ const size_t LENGTH_LIMIT = (INT_MAX - 1) /2;
+ if(S->len > LENGTH_LIMIT){
+ warnx("The input sequence %s is too long. The technical limit is %zu.", S->name, LENGTH_LIMIT);
+ return 3;
+ }
+
+ return 0;
+}
+
+/**
+ * @brief Restricts a sequence characters set to ACGT.
+ *
+ * This function strips a sequence of non ACGT characters and converts acgt to
+ * the upper case equivalent. A flag is set if a non-canonical character was encountered.
+ */
+void normalize( seq_t *S){
+ char *p, *q;
+ char local_non_acgt = 0;
+ for( p= q= S->S; *p; p++){
+ switch( *p){
+ case 'A':
+ case 'C':
+ case 'G':
+ case 'T':
+ case '!':
+ *q++ = *p;
+ break;
+ case 'a':
+ case 'c':
+ case 'g':
+ case 't':
+ *q++ = toupper( (unsigned char)*p);
+ break;
+ default:
+ local_non_acgt = 1;
+ break;
+
+ }
+ }
+ *q = '\0';
+ if ( local_non_acgt ){
+ #pragma omp atomic
+ FLAGS |= F_NON_ACGT;
+ }
+}
+
diff --git a/src/sequence.h b/src/sequence.h
new file mode 100644
index 0000000..b28a513
--- /dev/null
+++ b/src/sequence.h
@@ -0,0 +1,60 @@
+/**
+ * @file
+ * @brief Functions and structures for DNA sequences
+ *
+ */
+#ifndef _SEQUENCE_H_
+#define _SEQUENCE_H_
+
+#include <err.h>
+#include <errno.h>
+#include <stdlib.h>
+
+/**
+ * @brief A structure for sequences.
+ *
+ * This structure is used to represent a DNA sequence of some kind.
+ */
+typedef struct seq_s {
+ /** This is the DNAs forward strand as a string. */
+ char *S;
+ /** This member contains first the reverse strand and then the
+ forward strand. */
+ char *RS;
+ /** The length of the forward strand. */
+ size_t len;
+ /** Corresponds to strlen(RS) */
+ size_t RSlen;
+ /** A name for this sequence */
+ char *name;
+ /**
+ * @brief GC-Content
+ *
+ * The relative amount of G or C in the DNA.
+ */
+ double gc;
+} seq_t;
+
+void seq_free( seq_t *S);
+void seq_subject_init( seq_t *S);
+void seq_subject_free( seq_t *S);
+int seq_init( seq_t *S, const char *seq, const char *name);
+
+/**
+ * A dynamically growing structure for sequences.
+ */
+
+typedef struct dsa_s {
+ seq_t* data;
+ size_t capacity, size;
+} dsa_t;
+
+int dsa_init(dsa_t *A);
+void dsa_push( dsa_t *A, seq_t S);
+void dsa_free( dsa_t *A);
+size_t dsa_size( dsa_t *A);
+seq_t* dsa_data( dsa_t *A);
+
+seq_t dsa_join( dsa_t *dsa);
+
+#endif
diff --git a/test-driver b/test-driver
new file mode 100755
index 0000000..d306056
--- /dev/null
+++ b/test-driver
@@ -0,0 +1,139 @@
+#! /bin/sh
+# test-driver - basic testsuite driver script.
+
+scriptversion=2013-07-13.22; # UTC
+
+# Copyright (C) 2011-2013 Free Software Foundation, Inc.
+#
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+#
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program. If not, see <http://www.gnu.org/licenses/>.
+
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+# This file is maintained in Automake, please report
+# bugs to <bug-automake at gnu.org> or send patches to
+# <automake-patches at gnu.org>.
+
+# Make unconditional expansion of undefined variables an error. This
+# helps a lot in preventing typo-related bugs.
+set -u
+
+usage_error ()
+{
+ echo "$0: $*" >&2
+ print_usage >&2
+ exit 2
+}
+
+print_usage ()
+{
+ cat <<END
+Usage:
+ test-driver --test-name=NAME --log-file=PATH --trs-file=PATH
+ [--expect-failure={yes|no}] [--color-tests={yes|no}]
+ [--enable-hard-errors={yes|no}] [--]
+ TEST-SCRIPT [TEST-SCRIPT-ARGUMENTS]
+The '--test-name', '--log-file' and '--trs-file' options are mandatory.
+END
+}
+
+test_name= # Used for reporting.
+log_file= # Where to save the output of the test script.
+trs_file= # Where to save the metadata of the test run.
+expect_failure=no
+color_tests=no
+enable_hard_errors=yes
+while test $# -gt 0; do
+ case $1 in
+ --help) print_usage; exit $?;;
+ --version) echo "test-driver $scriptversion"; exit $?;;
+ --test-name) test_name=$2; shift;;
+ --log-file) log_file=$2; shift;;
+ --trs-file) trs_file=$2; shift;;
+ --color-tests) color_tests=$2; shift;;
+ --expect-failure) expect_failure=$2; shift;;
+ --enable-hard-errors) enable_hard_errors=$2; shift;;
+ --) shift; break;;
+ -*) usage_error "invalid option: '$1'";;
+ *) break;;
+ esac
+ shift
+done
+
+missing_opts=
+test x"$test_name" = x && missing_opts="$missing_opts --test-name"
+test x"$log_file" = x && missing_opts="$missing_opts --log-file"
+test x"$trs_file" = x && missing_opts="$missing_opts --trs-file"
+if test x"$missing_opts" != x; then
+ usage_error "the following mandatory options are missing:$missing_opts"
+fi
+
+if test $# -eq 0; then
+ usage_error "missing argument"
+fi
+
+if test $color_tests = yes; then
+ # Keep this in sync with 'lib/am/check.am:$(am__tty_colors)'.
+ red='[0;31m' # Red.
+ grn='[0;32m' # Green.
+ lgn='[1;32m' # Light green.
+ blu='[1;34m' # Blue.
+ mgn='[0;35m' # Magenta.
+ std='[m' # No color.
+else
+ red= grn= lgn= blu= mgn= std=
+fi
+
+do_exit='rm -f $log_file $trs_file; (exit $st); exit $st'
+trap "st=129; $do_exit" 1
+trap "st=130; $do_exit" 2
+trap "st=141; $do_exit" 13
+trap "st=143; $do_exit" 15
+
+# Test script is run here.
+"$@" >$log_file 2>&1
+estatus=$?
+if test $enable_hard_errors = no && test $estatus -eq 99; then
+ estatus=1
+fi
+
+case $estatus:$expect_failure in
+ 0:yes) col=$red res=XPASS recheck=yes gcopy=yes;;
+ 0:*) col=$grn res=PASS recheck=no gcopy=no;;
+ 77:*) col=$blu res=SKIP recheck=no gcopy=yes;;
+ 99:*) col=$mgn res=ERROR recheck=yes gcopy=yes;;
+ *:yes) col=$lgn res=XFAIL recheck=no gcopy=yes;;
+ *:*) col=$red res=FAIL recheck=yes gcopy=yes;;
+esac
+
+# Report outcome to console.
+echo "${col}${res}${std}: $test_name"
+
+# Register the test result, and other relevant metadata.
+echo ":test-result: $res" > $trs_file
+echo ":global-test-result: $res" >> $trs_file
+echo ":recheck: $recheck" >> $trs_file
+echo ":copy-in-global-log: $gcopy" >> $trs_file
+
+# Local Variables:
+# mode: shell-script
+# sh-indentation: 2
+# eval: (add-hook 'write-file-hooks 'time-stamp)
+# time-stamp-start: "scriptversion="
+# time-stamp-format: "%:y-%02m-%02d.%02H"
+# time-stamp-time-zone: "UTC"
+# time-stamp-end: "; # UTC"
+# End:
diff --git a/test/Makefile.am b/test/Makefile.am
new file mode 100644
index 0000000..8476cd0
--- /dev/null
+++ b/test/Makefile.am
@@ -0,0 +1,25 @@
+check_PROGRAMS = test_esa test_seq test_fasta
+dist_noinst_DATA = test_extra.sh test_random.sh test_join.sh
+
+if !BUILD_WITH_LIBDIVSUFSORT
+PSUFSORT=$(top_builddir)/opt/psufsort/libpsufsort.a
+# This is a hack to make sure, the test_esa executable is created with a C++ compiler
+DUMMY=dummy.cxx
+endif
+
+test_seq_SOURCES = test_seq.c ../src/sequence.c
+test_seq_CPPFLAGS = -I$(top_srcdir)/src -I$(top_srcdir)/opt -DDEBUG -std=gnu99
+test_seq_CFLAGS = -W -Wall $(GLIB_CFLAGS) -Wno-missing-field-initializers
+test_seq_LDADD = $(GLIB_LIBS) $(top_builddir)/opt/libcompat.a
+
+test_esa_SOURCES = test_esa.c ../src/esa.c ../src/sequence.c $(top_srcdir)/src/esa.h
+test_esa_CPPFLAGS = $(OPENMP_CFLAGS) -I$(top_srcdir)/libs -I$(top_srcdir)/opt -I$(top_srcdir)/src -DDEBUG -std=gnu99
+test_esa_CFLAGS = $(OPENMP_CFLAGS) -W -Wall $(GLIB_CFLAGS) -Wno-missing-field-initializers
+test_esa_LDADD = $(GLIB_LIBS) $(PSUFSORT) $(top_builddir)/opt/libcompat.a
+test_esa_CXXFLAGS = $(OPENMP_CXXFLAGS) -W -Wall
+nodist_EXTRA_test_esa_SOURCES = $(DUMMY)
+
+test_fasta_SOURCES = test_fasta.cxx
+
+.PHONY: all
+all: $(check_PROGRAMS)
diff --git a/test/Makefile.in b/test/Makefile.in
new file mode 100644
index 0000000..24ee43b
--- /dev/null
+++ b/test/Makefile.in
@@ -0,0 +1,686 @@
+# Makefile.in generated by automake 1.14.1 from Makefile.am.
+# @configure_input@
+
+# Copyright (C) 1994-2013 Free Software Foundation, Inc.
+
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+ at SET_MAKE@
+
+VPATH = @srcdir@
+am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
+am__make_running_with_option = \
+ case $${target_option-} in \
+ ?) ;; \
+ *) echo "am__make_running_with_option: internal error: invalid" \
+ "target option '$${target_option-}' specified" >&2; \
+ exit 1;; \
+ esac; \
+ has_opt=no; \
+ sane_makeflags=$$MAKEFLAGS; \
+ if $(am__is_gnu_make); then \
+ sane_makeflags=$$MFLAGS; \
+ else \
+ case $$MAKEFLAGS in \
+ *\\[\ \ ]*) \
+ bs=\\; \
+ sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
+ | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
+ esac; \
+ fi; \
+ skip_next=no; \
+ strip_trailopt () \
+ { \
+ flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
+ }; \
+ for flg in $$sane_makeflags; do \
+ test $$skip_next = yes && { skip_next=no; continue; }; \
+ case $$flg in \
+ *=*|--*) continue;; \
+ -*I) strip_trailopt 'I'; skip_next=yes;; \
+ -*I?*) strip_trailopt 'I';; \
+ -*O) strip_trailopt 'O'; skip_next=yes;; \
+ -*O?*) strip_trailopt 'O';; \
+ -*l) strip_trailopt 'l'; skip_next=yes;; \
+ -*l?*) strip_trailopt 'l';; \
+ -[dEDm]) skip_next=yes;; \
+ -[JT]) skip_next=yes;; \
+ esac; \
+ case $$flg in \
+ *$$target_option*) has_opt=yes; break;; \
+ esac; \
+ done; \
+ test $$has_opt = yes
+am__make_dryrun = (target_option=n; $(am__make_running_with_option))
+am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
+pkgdatadir = $(datadir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkglibexecdir = $(libexecdir)/@PACKAGE@
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+check_PROGRAMS = test_esa$(EXEEXT) test_seq$(EXEEXT) \
+ test_fasta$(EXEEXT)
+subdir = test
+DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
+ $(top_srcdir)/depcomp $(dist_noinst_DATA)
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+am__aclocal_m4_deps = $(top_srcdir)/m4/ax_cxx_compile_stdcxx_11.m4 \
+ $(top_srcdir)/configure.ac
+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
+ $(ACLOCAL_M4)
+mkinstalldirs = $(install_sh) -d
+CONFIG_HEADER = $(top_builddir)/src/config.h
+CONFIG_CLEAN_FILES =
+CONFIG_CLEAN_VPATH_FILES =
+am_test_esa_OBJECTS = test_esa-test_esa.$(OBJEXT) \
+ test_esa-esa.$(OBJEXT) test_esa-sequence.$(OBJEXT)
+test_esa_OBJECTS = $(am_test_esa_OBJECTS)
+am__DEPENDENCIES_1 =
+test_esa_DEPENDENCIES = $(am__DEPENDENCIES_1) $(PSUFSORT) \
+ $(top_builddir)/opt/libcompat.a
+test_esa_LINK = $(CXXLD) $(test_esa_CXXFLAGS) $(CXXFLAGS) \
+ $(AM_LDFLAGS) $(LDFLAGS) -o $@
+am_test_fasta_OBJECTS = test_fasta.$(OBJEXT)
+test_fasta_OBJECTS = $(am_test_fasta_OBJECTS)
+test_fasta_LDADD = $(LDADD)
+am_test_seq_OBJECTS = test_seq-test_seq.$(OBJEXT) \
+ test_seq-sequence.$(OBJEXT)
+test_seq_OBJECTS = $(am_test_seq_OBJECTS)
+test_seq_DEPENDENCIES = $(am__DEPENDENCIES_1) \
+ $(top_builddir)/opt/libcompat.a
+test_seq_LINK = $(CCLD) $(test_seq_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) \
+ $(LDFLAGS) -o $@
+AM_V_P = $(am__v_P_ at AM_V@)
+am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
+am__v_P_0 = false
+am__v_P_1 = :
+AM_V_GEN = $(am__v_GEN_ at AM_V@)
+am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
+am__v_GEN_0 = @echo " GEN " $@;
+am__v_GEN_1 =
+AM_V_at = $(am__v_at_ at AM_V@)
+am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
+am__v_at_0 = @
+am__v_at_1 =
+DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)/src
+depcomp = $(SHELL) $(top_srcdir)/depcomp
+am__depfiles_maybe = depfiles
+am__mv = mv -f
+AM_V_lt = $(am__v_lt_ at AM_V@)
+am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
+am__v_lt_0 = --silent
+am__v_lt_1 =
+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
+ $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
+AM_V_CC = $(am__v_CC_ at AM_V@)
+am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
+am__v_CC_0 = @echo " CC " $@;
+am__v_CC_1 =
+CCLD = $(CC)
+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
+AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
+am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
+am__v_CCLD_0 = @echo " CCLD " $@;
+am__v_CCLD_1 =
+CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
+ $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
+AM_V_CXX = $(am__v_CXX_ at AM_V@)
+am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
+am__v_CXX_0 = @echo " CXX " $@;
+am__v_CXX_1 =
+CXXLD = $(CXX)
+CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
+ -o $@
+AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
+am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
+am__v_CXXLD_0 = @echo " CXXLD " $@;
+am__v_CXXLD_1 =
+SOURCES = $(test_esa_SOURCES) $(nodist_EXTRA_test_esa_SOURCES) \
+ $(test_fasta_SOURCES) $(test_seq_SOURCES)
+DIST_SOURCES = $(test_esa_SOURCES) $(test_fasta_SOURCES) \
+ $(test_seq_SOURCES)
+am__can_run_installinfo = \
+ case $$AM_UPDATE_INFO_DIR in \
+ n|no|NO) false;; \
+ *) (install-info --version) >/dev/null 2>&1;; \
+ esac
+DATA = $(dist_noinst_DATA)
+am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
+# Read a list of newline-separated strings from the standard input,
+# and print each of them once, without duplicates. Input order is
+# *not* preserved.
+am__uniquify_input = $(AWK) '\
+ BEGIN { nonempty = 0; } \
+ { items[$$0] = 1; nonempty = 1; } \
+ END { if (nonempty) { for (i in items) print i; }; } \
+'
+# Make sure the list of sources is unique. This is necessary because,
+# e.g., the same source file might be shared among _SOURCES variables
+# for different programs/libraries.
+am__define_uniq_tagged_files = \
+ list='$(am__tagged_files)'; \
+ unique=`for i in $$list; do \
+ if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+ done | $(am__uniquify_input)`
+ETAGS = etags
+CTAGS = ctags
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+ACLOCAL = @ACLOCAL@
+AMTAR = @AMTAR@
+AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
+AR = @AR@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CXX = @CXX@
+CXXDEPMODE = @CXXDEPMODE@
+CXXFLAGS = @CXXFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+EXEEXT = @EXEEXT@
+GLIB_CFLAGS = @GLIB_CFLAGS@
+GLIB_LIBS = @GLIB_LIBS@
+GREP = @GREP@
+HAVE_CXX11 = @HAVE_CXX11@
+INSTALL = @INSTALL@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+MKDIR_P = @MKDIR_P@
+OBJEXT = @OBJEXT@
+OPENMP_CFLAGS = @OPENMP_CFLAGS@
+OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_URL = @PACKAGE_URL@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+PKG_CONFIG = @PKG_CONFIG@
+PKG_CONFIG_LIBDIR = @PKG_CONFIG_LIBDIR@
+PKG_CONFIG_PATH = @PKG_CONFIG_PATH@
+RANLIB = @RANLIB@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+abs_builddir = @abs_builddir@
+abs_srcdir = @abs_srcdir@
+abs_top_builddir = @abs_top_builddir@
+abs_top_srcdir = @abs_top_srcdir@
+ac_ct_AR = @ac_ct_AR@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_CXX = @ac_ct_CXX@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+am__tar = @am__tar@
+am__untar = @am__untar@
+bindir = @bindir@
+build_alias = @build_alias@
+builddir = @builddir@
+datadir = @datadir@
+datarootdir = @datarootdir@
+docdir = @docdir@
+dvidir = @dvidir@
+exec_prefix = @exec_prefix@
+host_alias = @host_alias@
+htmldir = @htmldir@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localedir = @localedir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+mkdir_p = @mkdir_p@
+oldincludedir = @oldincludedir@
+pdfdir = @pdfdir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+psdir = @psdir@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+srcdir = @srcdir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+top_build_prefix = @top_build_prefix@
+top_builddir = @top_builddir@
+top_srcdir = @top_srcdir@
+dist_noinst_DATA = test_extra.sh test_random.sh test_join.sh
+ at BUILD_WITH_LIBDIVSUFSORT_FALSE@PSUFSORT = $(top_builddir)/opt/psufsort/libpsufsort.a
+# This is a hack to make sure, the test_esa executable is created with a C++ compiler
+ at BUILD_WITH_LIBDIVSUFSORT_FALSE@DUMMY = dummy.cxx
+test_seq_SOURCES = test_seq.c ../src/sequence.c
+test_seq_CPPFLAGS = -I$(top_srcdir)/src -I$(top_srcdir)/opt -DDEBUG -std=gnu99
+test_seq_CFLAGS = -W -Wall $(GLIB_CFLAGS) -Wno-missing-field-initializers
+test_seq_LDADD = $(GLIB_LIBS) $(top_builddir)/opt/libcompat.a
+test_esa_SOURCES = test_esa.c ../src/esa.c ../src/sequence.c $(top_srcdir)/src/esa.h
+test_esa_CPPFLAGS = $(OPENMP_CFLAGS) -I$(top_srcdir)/libs -I$(top_srcdir)/opt -I$(top_srcdir)/src -DDEBUG -std=gnu99
+test_esa_CFLAGS = $(OPENMP_CFLAGS) -W -Wall $(GLIB_CFLAGS) -Wno-missing-field-initializers
+test_esa_LDADD = $(GLIB_LIBS) $(PSUFSORT) $(top_builddir)/opt/libcompat.a
+test_esa_CXXFLAGS = $(OPENMP_CXXFLAGS) -W -Wall
+nodist_EXTRA_test_esa_SOURCES = $(DUMMY)
+test_fasta_SOURCES = test_fasta.cxx
+all: all-am
+
+.SUFFIXES:
+.SUFFIXES: .c .cxx .o .obj
+$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
+ @for dep in $?; do \
+ case '$(am__configure_deps)' in \
+ *$$dep*) \
+ ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
+ && { if test -f $@; then exit 0; else break; fi; }; \
+ exit 1;; \
+ esac; \
+ done; \
+ echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign test/Makefile'; \
+ $(am__cd) $(top_srcdir) && \
+ $(AUTOMAKE) --foreign test/Makefile
+.PRECIOUS: Makefile
+Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
+ @case '$?' in \
+ *config.status*) \
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
+ *) \
+ echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
+ cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
+ esac;
+
+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+
+$(top_srcdir)/configure: $(am__configure_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(ACLOCAL_M4): $(am__aclocal_m4_deps)
+ cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
+$(am__aclocal_m4_deps):
+
+clean-checkPROGRAMS:
+ -test -z "$(check_PROGRAMS)" || rm -f $(check_PROGRAMS)
+
+test_esa$(EXEEXT): $(test_esa_OBJECTS) $(test_esa_DEPENDENCIES) $(EXTRA_test_esa_DEPENDENCIES)
+ @rm -f test_esa$(EXEEXT)
+ $(AM_V_CXXLD)$(test_esa_LINK) $(test_esa_OBJECTS) $(test_esa_LDADD) $(LIBS)
+
+test_fasta$(EXEEXT): $(test_fasta_OBJECTS) $(test_fasta_DEPENDENCIES) $(EXTRA_test_fasta_DEPENDENCIES)
+ @rm -f test_fasta$(EXEEXT)
+ $(AM_V_CXXLD)$(CXXLINK) $(test_fasta_OBJECTS) $(test_fasta_LDADD) $(LIBS)
+
+test_seq$(EXEEXT): $(test_seq_OBJECTS) $(test_seq_DEPENDENCIES) $(EXTRA_test_seq_DEPENDENCIES)
+ @rm -f test_seq$(EXEEXT)
+ $(AM_V_CCLD)$(test_seq_LINK) $(test_seq_OBJECTS) $(test_seq_LDADD) $(LIBS)
+
+mostlyclean-compile:
+ -rm -f *.$(OBJEXT)
+
+distclean-compile:
+ -rm -f *.tab.c
+
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/test_esa-dummy.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/test_esa-esa.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/test_esa-sequence.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/test_esa-test_esa.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/test_fasta.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/test_seq-sequence.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/test_seq-test_seq.Po at am__quote@
+
+.c.o:
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(COMPILE) -c -o $@ $<
+
+.c.obj:
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(COMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+
+test_esa-test_esa.o: test_esa.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -MT test_esa-test_esa.o -MD -MP -MF $(DEPDIR)/test_esa-test_esa.Tpo -c -o test_esa-test_esa.o `test -f 'test_esa.c' || echo '$(srcdir)/'`test_esa.c
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_esa-test_esa.Tpo $(DEPDIR)/test_esa-test_esa.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='test_esa.c' object='test_esa-test_esa.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -c -o test_esa-test_esa.o `test -f 'test_esa.c' || echo '$(srcdir)/'`test_esa.c
+
+test_esa-test_esa.obj: test_esa.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -MT test_esa-test_esa.obj -MD -MP -MF $(DEPDIR)/test_esa-test_esa.Tpo -c -o test_esa-test_esa.obj `if test -f 'test_esa.c'; then $(CYGPATH_W) 'test_esa.c'; else $(CYGPATH_W) '$(srcdir)/test_esa.c'; fi`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_esa-test_esa.Tpo $(DEPDIR)/test_esa-test_esa.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='test_esa.c' object='test_esa-test_esa.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -c -o test_esa-test_esa.obj `if test -f 'test_esa.c'; then $(CYGPATH_W) 'test_esa.c'; else $(CYGPATH_W) '$(srcdir)/test_esa.c'; fi`
+
+test_esa-esa.o: ../src/esa.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -MT test_esa-esa.o -MD -MP -MF $(DEPDIR)/test_esa-esa.Tpo -c -o test_esa-esa.o `test -f '../src/esa.c' || echo '$(srcdir)/'`../src/esa.c
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_esa-esa.Tpo $(DEPDIR)/test_esa-esa.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='../src/esa.c' object='test_esa-esa.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -c -o test_esa-esa.o `test -f '../src/esa.c' || echo '$(srcdir)/'`../src/esa.c
+
+test_esa-esa.obj: ../src/esa.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -MT test_esa-esa.obj -MD -MP -MF $(DEPDIR)/test_esa-esa.Tpo -c -o test_esa-esa.obj `if test -f '../src/esa.c'; then $(CYGPATH_W) '../src/esa.c'; else $(CYGPATH_W) '$(srcdir)/../src/esa.c'; fi`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_esa-esa.Tpo $(DEPDIR)/test_esa-esa.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='../src/esa.c' object='test_esa-esa.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -c -o test_esa-esa.obj `if test -f '../src/esa.c'; then $(CYGPATH_W) '../src/esa.c'; else $(CYGPATH_W) '$(srcdir)/../src/esa.c'; fi`
+
+test_esa-sequence.o: ../src/sequence.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -MT test_esa-sequence.o -MD -MP -MF $(DEPDIR)/test_esa-sequence.Tpo -c -o test_esa-sequence.o `test -f '../src/sequence.c' || echo '$(srcdir)/'`../src/sequence.c
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_esa-sequence.Tpo $(DEPDIR)/test_esa-sequence.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='../src/sequence.c' object='test_esa-sequence.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -c -o test_esa-sequence.o `test -f '../src/sequence.c' || echo '$(srcdir)/'`../src/sequence.c
+
+test_esa-sequence.obj: ../src/sequence.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -MT test_esa-sequence.obj -MD -MP -MF $(DEPDIR)/test_esa-sequence.Tpo -c -o test_esa-sequence.obj `if test -f '../src/sequence.c'; then $(CYGPATH_W) '../src/sequence.c'; else $(CYGPATH_W) '$(srcdir)/../src/sequence.c'; fi`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_esa-sequence.Tpo $(DEPDIR)/test_esa-sequence.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='../src/sequence.c' object='test_esa-sequence.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CFLAGS) $(CFLAGS) -c -o test_esa-sequence.obj `if test -f '../src/sequence.c'; then $(CYGPATH_W) '../src/sequence.c'; else $(CYGPATH_W) '$(srcdir)/../src/sequence.c'; fi`
+
+test_seq-test_seq.o: test_seq.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_seq_CPPFLAGS) $(CPPFLAGS) $(test_seq_CFLAGS) $(CFLAGS) -MT test_seq-test_seq.o -MD -MP -MF $(DEPDIR)/test_seq-test_seq.Tpo -c -o test_seq-test_seq.o `test -f 'test_seq.c' || echo '$(srcdir)/'`test_seq.c
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_seq-test_seq.Tpo $(DEPDIR)/test_seq-test_seq.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='test_seq.c' object='test_seq-test_seq.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_seq_CPPFLAGS) $(CPPFLAGS) $(test_seq_CFLAGS) $(CFLAGS) -c -o test_seq-test_seq.o `test -f 'test_seq.c' || echo '$(srcdir)/'`test_seq.c
+
+test_seq-test_seq.obj: test_seq.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_seq_CPPFLAGS) $(CPPFLAGS) $(test_seq_CFLAGS) $(CFLAGS) -MT test_seq-test_seq.obj -MD -MP -MF $(DEPDIR)/test_seq-test_seq.Tpo -c -o test_seq-test_seq.obj `if test -f 'test_seq.c'; then $(CYGPATH_W) 'test_seq.c'; else $(CYGPATH_W) '$(srcdir)/test_seq.c'; fi`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_seq-test_seq.Tpo $(DEPDIR)/test_seq-test_seq.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='test_seq.c' object='test_seq-test_seq.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_seq_CPPFLAGS) $(CPPFLAGS) $(test_seq_CFLAGS) $(CFLAGS) -c -o test_seq-test_seq.obj `if test -f 'test_seq.c'; then $(CYGPATH_W) 'test_seq.c'; else $(CYGPATH_W) '$(srcdir)/test_seq.c'; fi`
+
+test_seq-sequence.o: ../src/sequence.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_seq_CPPFLAGS) $(CPPFLAGS) $(test_seq_CFLAGS) $(CFLAGS) -MT test_seq-sequence.o -MD -MP -MF $(DEPDIR)/test_seq-sequence.Tpo -c -o test_seq-sequence.o `test -f '../src/sequence.c' || echo '$(srcdir)/'`../src/sequence.c
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_seq-sequence.Tpo $(DEPDIR)/test_seq-sequence.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='../src/sequence.c' object='test_seq-sequence.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_seq_CPPFLAGS) $(CPPFLAGS) $(test_seq_CFLAGS) $(CFLAGS) -c -o test_seq-sequence.o `test -f '../src/sequence.c' || echo '$(srcdir)/'`../src/sequence.c
+
+test_seq-sequence.obj: ../src/sequence.c
+ at am__fastdepCC_TRUE@ $(AM_V_CC)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_seq_CPPFLAGS) $(CPPFLAGS) $(test_seq_CFLAGS) $(CFLAGS) -MT test_seq-sequence.obj -MD -MP -MF $(DEPDIR)/test_seq-sequence.Tpo -c -o test_seq-sequence.obj `if test -f '../src/sequence.c'; then $(CYGPATH_W) '../src/sequence.c'; else $(CYGPATH_W) '$(srcdir)/../src/sequence.c'; fi`
+ at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_seq-sequence.Tpo $(DEPDIR)/test_seq-sequence.Po
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='../src/sequence.c' object='test_seq-sequence.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_seq_CPPFLAGS) $(CPPFLAGS) $(test_seq_CFLAGS) $(CFLAGS) -c -o test_seq-sequence.obj `if test -f '../src/sequence.c'; then $(CYGPATH_W) '../src/sequence.c'; else $(CYGPATH_W) '$(srcdir)/../src/sequence.c'; fi`
+
+.cxx.o:
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
+
+.cxx.obj:
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
+
+test_esa-dummy.o: dummy.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CXXFLAGS) $(CXXFLAGS) -MT test_esa-dummy.o -MD -MP -MF $(DEPDIR)/test_esa-dummy.Tpo -c -o test_esa-dummy.o `test -f 'dummy.cxx' || echo '$(srcdir)/'`dummy.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_esa-dummy.Tpo $(DEPDIR)/test_esa-dummy.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='dummy.cxx' object='test_esa-dummy.o' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CXXFLAGS) $(CXXFLAGS) -c -o test_esa-dummy.o `test -f 'dummy.cxx' || echo '$(srcdir)/'`dummy.cxx
+
+test_esa-dummy.obj: dummy.cxx
+ at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CXXFLAGS) $(CXXFLAGS) -MT test_esa-dummy.obj -MD -MP -MF $(DEPDIR)/test_esa-dummy.Tpo -c -o test_esa-dummy.obj `if test -f 'dummy.cxx'; then $(CYGPATH_W) 'dummy.cxx'; else $(CYGPATH_W) '$(srcdir)/dummy.cxx'; fi`
+ at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/test_esa-dummy.Tpo $(DEPDIR)/test_esa-dummy.Po
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='dummy.cxx' object='test_esa-dummy.obj' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(test_esa_CPPFLAGS) $(CPPFLAGS) $(test_esa_CXXFLAGS) $(CXXFLAGS) -c -o test_esa-dummy.obj `if test -f 'dummy.cxx'; then $(CYGPATH_W) 'dummy.cxx'; else $(CYGPATH_W) '$(srcdir)/dummy.cxx'; fi`
+
+ID: $(am__tagged_files)
+ $(am__define_uniq_tagged_files); mkid -fID $$unique
+tags: tags-am
+TAGS: tags
+
+tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ set x; \
+ here=`pwd`; \
+ $(am__define_uniq_tagged_files); \
+ shift; \
+ if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
+ test -n "$$unique" || unique=$$empty_fix; \
+ if test $$# -gt 0; then \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ "$$@" $$unique; \
+ else \
+ $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+ $$unique; \
+ fi; \
+ fi
+ctags: ctags-am
+
+CTAGS: ctags
+ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
+ $(am__define_uniq_tagged_files); \
+ test -z "$(CTAGS_ARGS)$$unique" \
+ || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
+ $$unique
+
+GTAGS:
+ here=`$(am__cd) $(top_builddir) && pwd` \
+ && $(am__cd) $(top_srcdir) \
+ && gtags -i $(GTAGS_ARGS) "$$here"
+cscopelist: cscopelist-am
+
+cscopelist-am: $(am__tagged_files)
+ list='$(am__tagged_files)'; \
+ case "$(srcdir)" in \
+ [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
+ *) sdir=$(subdir)/$(srcdir) ;; \
+ esac; \
+ for i in $$list; do \
+ if test -f "$$i"; then \
+ echo "$(subdir)/$$i"; \
+ else \
+ echo "$$sdir/$$i"; \
+ fi; \
+ done >> $(top_builddir)/cscope.files
+
+distclean-tags:
+ -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
+
+distdir: $(DISTFILES)
+ @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
+ list='$(DISTFILES)'; \
+ dist_files=`for file in $$list; do echo $$file; done | \
+ sed -e "s|^$$srcdirstrip/||;t" \
+ -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
+ case $$dist_files in \
+ */*) $(MKDIR_P) `echo "$$dist_files" | \
+ sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
+ sort -u` ;; \
+ esac; \
+ for file in $$dist_files; do \
+ if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+ if test -d $$d/$$file; then \
+ dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
+ if test -d "$(distdir)/$$file"; then \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+ cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
+ find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
+ fi; \
+ cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
+ else \
+ test -f "$(distdir)/$$file" \
+ || cp -p $$d/$$file "$(distdir)/$$file" \
+ || exit 1; \
+ fi; \
+ done
+check-am: all-am
+ $(MAKE) $(AM_MAKEFLAGS) $(check_PROGRAMS)
+check: check-am
+all-am: Makefile $(DATA)
+installdirs:
+install: install-am
+install-exec: install-exec-am
+install-data: install-data-am
+uninstall: uninstall-am
+
+install-am: all-am
+ @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-am
+install-strip:
+ if test -z '$(STRIP)'; then \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ install; \
+ else \
+ $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+ install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
+ "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
+ fi
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+ -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
+ -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
+
+maintainer-clean-generic:
+ @echo "This command is intended for maintainers to use"
+ @echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
+clean-am: clean-checkPROGRAMS clean-generic mostlyclean-am
+
+distclean: distclean-am
+ -rm -rf ./$(DEPDIR)
+ -rm -f Makefile
+distclean-am: clean-am distclean-compile distclean-generic \
+ distclean-tags
+
+dvi: dvi-am
+
+dvi-am:
+
+html: html-am
+
+html-am:
+
+info: info-am
+
+info-am:
+
+install-data-am:
+
+install-dvi: install-dvi-am
+
+install-dvi-am:
+
+install-exec-am:
+
+install-html: install-html-am
+
+install-html-am:
+
+install-info: install-info-am
+
+install-info-am:
+
+install-man:
+
+install-pdf: install-pdf-am
+
+install-pdf-am:
+
+install-ps: install-ps-am
+
+install-ps-am:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-am
+ -rm -rf ./$(DEPDIR)
+ -rm -f Makefile
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-am
+
+mostlyclean-am: mostlyclean-compile mostlyclean-generic
+
+pdf: pdf-am
+
+pdf-am:
+
+ps: ps-am
+
+ps-am:
+
+uninstall-am:
+
+.MAKE: check-am install-am install-strip
+
+.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
+ clean-checkPROGRAMS clean-generic cscopelist-am ctags ctags-am \
+ distclean distclean-compile distclean-generic distclean-tags \
+ distdir dvi dvi-am html html-am info info-am install \
+ install-am install-data install-data-am install-dvi \
+ install-dvi-am install-exec install-exec-am install-html \
+ install-html-am install-info install-info-am install-man \
+ install-pdf install-pdf-am install-ps install-ps-am \
+ install-strip installcheck installcheck-am installdirs \
+ maintainer-clean maintainer-clean-generic mostlyclean \
+ mostlyclean-compile mostlyclean-generic pdf pdf-am ps ps-am \
+ tags tags-am uninstall uninstall-am
+
+
+.PHONY: all
+all: $(check_PROGRAMS)
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
diff --git a/test/test_esa.c b/test/test_esa.c
new file mode 100644
index 0000000..299872a
--- /dev/null
+++ b/test/test_esa.c
@@ -0,0 +1,200 @@
+#include "esa.h"
+#include <glib.h>
+#include "global.h"
+#include <stdio.h>
+#include <string.h>
+
+int FLAGS = F_NONE;
+int THREADS = 1;
+
+extern const int CACHE_LENGTH;
+
+char code3char( ssize_t code){
+ switch( code & 0x7){
+ case 0: return 'A';
+ case 1: return 'C';
+ case 2: return 'G';
+ case 3: return 'T';
+ case 4: return '!';
+ case 5: return ';';
+ case 6: return '#';
+ }
+ return '\0';
+}
+
+typedef struct {
+ esa_s *C;
+ seq_t *S;
+} esa_fixture;
+
+void assert_equal_lcp( const lcp_inter_t *a, const lcp_inter_t *b){
+ g_assert_cmpint( a->i, ==, b->i);
+ g_assert_cmpint( a->j, ==, b->j);
+ g_assert_cmpint( a->l, ==, b->l);
+}
+
+void assert_equal_cache_nocache( const esa_s *C, const char *str, size_t qlen){
+ lcp_inter_t a = get_match_cached(C, str, qlen);
+ lcp_inter_t b = get_match(C, str, qlen);
+ assert_equal_lcp( &a, &b);
+ g_assert(strncmp(str, C->S + C->SA[a.i], a.l) == 0);
+ g_assert( str[a.l] != C->S[ a.l + C->SA[a.i]] || str[a.l] == '\0');
+}
+
+void setup( esa_fixture *ef, gconstpointer test_data){
+ ef->C = malloc( sizeof(esa_s));
+ ef->S = malloc( sizeof(seq_t));
+
+ g_assert( ef->C != NULL);
+ g_assert( ef->S != NULL);
+
+ const char *seq = {
+ "TACGAGCACTGGTGGAATTGATGTC"
+ "CAGTCTTATATGGCGCACCAGGCTG"
+ "ATAGTAGTAGCAGTTTGCTTATCTC"
+ "ATCGCGTGTTTCCGGATGACAGAGA"
+ "TACGTGCACTGGTGGGATTGATGTC"
+ "TAGTATTATATGGCGCACCAGGATG"
+ "ATAGTAGTAGCAGTTTGCTTATCCC"
+ "ATCGCGTGTTTGCGGATGACCGAGA"
+ };
+
+ g_assert( seq_init( ef->S, seq, "S0" ) == 0);
+ seq_subject_init( ef->S);
+ g_assert( ef->S->RS != NULL);
+ int check = esa_init( ef->C, ef->S);
+ g_assert( check == 0);
+}
+
+void setup2( esa_fixture *ef, gconstpointer test_data){
+ ef->C = malloc( sizeof(esa_s));
+ ef->S = malloc( sizeof(seq_t));
+
+ g_assert( ef->C != NULL);
+ g_assert( ef->S != NULL);
+
+ const char *seq = {
+ "TACGAGCACTGGTGGAATTGATGTC"
+ "CAGTCTTATATGGCGCACCAGGCTG"
+ "ATAGTAGTAGCAGTTTGCTTATCTC"
+ "ATCGCGTGTTTCCGGATGACAGAGA"
+ "!"
+ "TACGTGCACTGGTGGGATTGATGTC"
+ "TAGTATTATATGGCGCACCAGGATG"
+ "ATAGTAGTAGCAGTTTGCTTATCCC"
+ "ATCGCGTGTTTGCGGATGACCGAGA"
+ };
+
+ g_assert( seq_init( ef->S, seq, "S0" ) == 0);
+ seq_subject_init( ef->S);
+ g_assert( ef->S->RS != NULL);
+ int check = esa_init( ef->C, ef->S);
+ g_assert( check == 0);
+}
+
+void teardown( esa_fixture *ef, gconstpointer test_data){
+ esa_free(ef->C);
+ free(ef->C);
+ seq_free(ef->S);
+ free(ef->S);
+}
+
+extern int count;
+
+void basic( esa_fixture *ef, gconstpointer test_data){
+ esa_s *C = ef->C;
+ g_assert( C->SA);
+
+ lcp_inter_t a = get_match_cached(C, "AAGACTGG", 8);
+ lcp_inter_t b = get_match(C, "AAGACTGG", 8);
+ assert_equal_lcp( &a, &b);
+ g_assert(strncmp("AAGACTGG",C->S + C->SA[a.i], 8) == 0);
+
+ a = get_match_cached(C, "AATTAAAA", 8);
+ b = get_match(C, "AATTAAAA", 8);
+ assert_equal_lcp( &a, &b);
+ g_assert(strncmp("AATTAAAA",C->S + C->SA[a.i], a.l) == 0);
+
+ a = get_match_cached(C, "ACCGAGAA", 8);
+ b = get_match(C, "ACCGAGAA", 8);
+ assert_equal_lcp( &a, &b);
+ g_assert(strncmp("ACCGAGAA",C->S + C->SA[a.i], a.l) == 0);
+
+ a = get_match_cached(C, "AAAAAAAAAAAA", 12);
+ b = get_match(C, "AAAAAAAAAAAA", 12);
+ assert_equal_lcp( &a, &b);
+ g_assert(strncmp("AAAAAAAAAAAA",C->S + C->SA[a.i], a.l) == 0);
+
+ //g_assert_cmpint(count, >=, 1 << (2*8));
+}
+
+void normq_cached( esa_fixture *ef, gconstpointer test_data){
+ esa_s *C = ef->C;
+ g_assert( C->SA);
+ lcp_inter_t a, b;
+
+ a = get_match_cached(C, "A", 1);
+ b = get_match(C, "A", 1);
+ assert_equal_lcp( &a, &b);
+
+ a = get_match_cached(C, "C", 1);
+ b = get_match(C, "C", 1);
+ assert_equal_lcp( &a, &b);
+
+ a = get_match_cached(C, "CT", 2);
+ b = get_match(C, "CT", 2);
+ assert_equal_lcp( &a, &b);
+
+ a = get_match_cached(C, "AAGACTGG", 8);
+ b = get_match(C, "AAGACTGG", 8);
+ assert_equal_lcp( &a, &b);
+
+ a = get_match_cached(C, "AATTAAAA", 8);
+ b = get_match(C, "AATTAAAA", 8);
+ assert_equal_lcp( &a, &b);
+
+ a = get_match_cached(C, "ACCGAGAA", 8);
+ b = get_match(C, "ACCGAGAA", 8);
+ assert_equal_lcp( &a, &b);
+
+ a = get_match_cached(C, "AAAAAAAAAAAA", 12);
+ b = get_match(C, "AAAAAAAAAAAA", 12);
+ assert_equal_lcp( &a, &b);
+
+}
+
+size_t MAX_DEPTH = 11;
+
+void prefix_dfs( esa_s *C, char *str, size_t depth);
+
+void prefix( esa_fixture *ef, gconstpointer test_data){
+ esa_s *C = ef->C;
+ char str[MAX_DEPTH+1];
+ str[MAX_DEPTH] = '\0';
+ prefix_dfs( C, str, 0);
+}
+
+void prefix_dfs( esa_s *C, char *str, size_t depth){
+ if( depth < MAX_DEPTH){
+ for( int code = 0; code < 4; ++code){
+ str[depth] = code2char(code);
+ prefix_dfs( C, str, depth + 1);
+ }
+ } else {
+ assert_equal_cache_nocache(C, str, depth);
+ }
+}
+
+int main(int argc, char *argv[])
+{
+ g_test_init( &argc, &argv, NULL);
+ g_test_add("/esa/basic", esa_fixture, NULL, setup, basic, teardown);
+ g_test_add("/esa/sample cache", esa_fixture, NULL, setup, normq_cached, teardown);
+ g_test_add("/esa/sample cache 2", esa_fixture, NULL, setup2, normq_cached, teardown);
+ g_test_add("/esa/full cache", esa_fixture, NULL, setup, prefix, teardown);
+ g_test_add("/esa/full cache 2", esa_fixture, NULL, setup2, prefix, teardown);
+
+
+ return g_test_run();
+}
+
diff --git a/test/test_extra.sh b/test/test_extra.sh
new file mode 100755
index 0000000..ac931bd
--- /dev/null
+++ b/test/test_extra.sh
@@ -0,0 +1,16 @@
+#!/bin/sh -f
+
+# Test if andi exists, and can be executed
+./src/andi --version > /dev/null || exit 1
+
+# Test andi for more than just two sequences at a time
+./test/test_fasta -l 100000 -d 0.01 -d 0.01 -d 0.01 -d 0.01 | ./src/andi > /dev/null || exit 1
+
+# Test low-memory mode
+./test/test_fasta -l 10000 > test_extra.fasta
+./src/andi test_extra.fasta > extra.out
+./src/andi test_extra.fasta -m > extra_m.out
+diff extra.out extra_m.out || exit 1
+
+rm -f test_extra.fasta extra.out extra_m.out
+
diff --git a/test/test_fasta.cxx b/test/test_fasta.cxx
new file mode 100644
index 0000000..3426e25
--- /dev/null
+++ b/test/test_fasta.cxx
@@ -0,0 +1,106 @@
+/**
+ * This program can create genome sequences with a specific distance.
+ */
+
+#include <iostream>
+#include <random>
+#include <functional>
+#include <string>
+#include <getopt.h>
+
+using namespace std;
+
+void usage();
+void print_seq( unsigned, unsigned, int, int, double);
+
+int main(int argc, char *argv[]){
+
+ random_device rd{};
+ auto seed = rd();
+ int length = 1000;
+ int line_length = 70;
+
+ auto seqs = vector<double>{0};
+
+ int check;
+ while((check = getopt(argc, argv, "l:L:d:")) != -1){
+ switch(check) {
+ case 'l': length = stoi(optarg); break;
+ case 'L': line_length = stoi(optarg); break;
+ case 'd': seqs.push_back(stod(optarg)); break;
+ case '?':
+ default: usage(); return 1;
+ }
+ }
+
+ if( seqs.size() < 2){
+ seqs.push_back(0.1);
+ }
+
+ for( int i=0; i< seqs.size(); i++){
+ cout << ">S" << i << endl;
+ print_seq( seed, rd(), length, line_length, seqs[i]);
+ }
+
+ return 0;
+}
+
+
+static auto ACGT = "ACGT";
+static auto NO_A = "CGT";
+static auto NO_C = "AGT";
+static auto NO_G = "ACT";
+static auto NO_T = "ACG";
+
+void print_seq( unsigned base_seed, unsigned mut_seed, int length, int line_length, double divergence){
+ char line[line_length+1];
+ line[line_length] = '\0';
+
+ auto base_rand = default_random_engine{base_seed};
+ auto base_dist = uniform_int_distribution<int>{0,3};
+ auto base_acgt = [&]{return ACGT[base_dist(base_rand)];};
+
+ auto mut_rand = default_random_engine{mut_seed};
+ auto mut_dist = uniform_real_distribution<double>{0,1};
+ auto mut = bind( mut_dist, mut_rand);
+ auto mut_acgt = uniform_int_distribution<int>{0,2};
+ auto mutate = [&](char c){
+ int idx = mut_acgt(mut_rand);
+ switch(c){
+ case 'A': return NO_A[idx];
+ case 'C': return NO_C[idx];
+ case 'G': return NO_G[idx];
+ case 'T': return NO_T[idx];
+ default: return 'X';
+ }
+ };
+
+ double nucleotides = (double)length;
+ double mutations = nucleotides * divergence;
+
+ for(int i= length, j; i > 0; i -= j){
+ j = min(line_length, i);
+
+ for(auto k=0; k<j; k++){
+ char c = base_acgt();
+
+ if( mut() < mutations / nucleotides ){
+ c = mutate(c);
+ mutations--;
+ }
+
+ line[k] = c;
+ nucleotides--;
+ }
+
+ line[j] = '\0';
+ cout << line << endl;
+ }
+}
+
+void usage(){
+ const static char *str = {
+ "test_rand [-l length] [-d dist]\n"
+ };
+ cerr << str;
+}
diff --git a/test/test_join.sh b/test/test_join.sh
new file mode 100755
index 0000000..3053efb
--- /dev/null
+++ b/test/test_join.sh
@@ -0,0 +1,75 @@
+#!/bin/sh -f
+
+./src/andi --help > /dev/null || exit 1
+
+# Simple join test
+./test/test_fasta -l 1000 -L 1000 -d 0.1 > p1.fasta
+./test/test_fasta -l 1000 -L 1000 -d 0.1 > p2.fasta
+./test/test_fasta -l 10000 -L 10000 -d 0.1 > p3.fasta
+
+head -qn 2 p1.fasta p2.fasta p3.fasta > S0.fasta
+tail -qn 2 p1.fasta p2.fasta p3.fasta > S1.fasta
+
+rm p1.fasta p2.fasta p3.fasta;
+
+
+RES=$($srcdir/src/andi -rt 1 -j S0.fasta S1.fasta |
+ tail -n 1 |
+ awk '{print ($2 - 0.1)}' |
+ awk 'function abs(x){return ((x < 0.0) ? -x : x)} {print abs($1-$2) < 0.01}'
+ )
+
+if test $RES -ne 1; then
+ echo "The last test computed a distance deviating more than one percent from its intended value."
+ echo "See S0.fasta and S1.fasta for the used sequences."
+ exit 1;
+fi
+
+#unbalanced number of contigs
+./test/test_fasta -l 1000 -L 1000 -d 0.1 > p2.fasta
+./test/test_fasta -l 10000 -L 10000 -d 0.1 > p3.fasta
+
+head -qn 2 p3.fasta > S0.fasta
+tail -qn 2 p2.fasta p3.fasta > S1.fasta
+
+rm p2.fasta p3.fasta;
+
+
+RES=$($srcdir/src/andi -rt1 -j S0.fasta S1.fasta |
+ tail -n 1 |
+ awk '{print ($2 - 0.1)}' |
+ awk 'function abs(x){return ((x < 0.0) ? -x : x)} {print abs($1-$2) < 0.01}'
+ )
+
+if test $RES -ne 1; then
+ echo "The last test computed a distance deviating more than one percent from its intended value."
+ echo "See S0.fasta and S1.fasta for the used sequences."
+ exit 1;
+fi
+
+
+#unbalanced number of contigs 2
+./test/test_fasta -l 1000 -L 1000 -d 0.1 > p1.fasta
+./test/test_fasta -l 1000 -L 1000 -d 0.1 > p2.fasta
+./test/test_fasta -l 10000 -L 10000 -d 0.1 > p3.fasta
+
+head -qn 2 p1.fasta p3.fasta > S0.fasta
+tail -qn 2 p1.fasta p2.fasta p3.fasta > S1.fasta
+
+rm p1.fasta p2.fasta p3.fasta;
+
+
+RES=$($srcdir/src/andi -rt 1 -j S0.fasta S1.fasta |
+ tail -n 1 |
+ awk '{print ($2 - 0.1)}' |
+ awk 'function abs(x){return ((x < 0.0) ? -x : x)} {print abs($1-$2) < 0.01}'
+ )
+
+if test $RES -ne 1; then
+ echo "The last test computed a distance deviating more than one percent from its intended value."
+ echo "See S0.fasta and S1.fasta for the used sequences."
+ exit 1;
+fi
+
+
+rm S0.fasta S1.fasta
diff --git a/test/test_random.sh b/test/test_random.sh
new file mode 100755
index 0000000..afb10c8
--- /dev/null
+++ b/test/test_random.sh
@@ -0,0 +1,25 @@
+#!/bin/sh -f
+
+./src/andi --help > /dev/null || exit 1
+
+LENGTH=100000
+
+for dist in 0.001 0.01 0.02 0.05 0.1 0.2 0.3
+do
+ for n in $(seq 10)
+ do
+ res=$(./test/test_fasta -l $LENGTH -d $dist |
+ tee ./test/test_random.fasta |
+ ./src/andi -r -t 1 |
+ tail -n 1 |
+ awk -v dist=$dist '{print $2, dist}' |
+ awk 'function abs(x){return ((x < 0.0) ? -x : x)} {print abs($1-$2) < 0.02 && abs($1-$2) < 0.02 * $2}')
+ if test $res -ne 1; then
+ echo "The last test computed a distance deviating more than two percent from its intended value."
+ echo "See test_random.fasta for the used sequences."
+ exit 1;
+ fi
+ done
+done
+
+rm ./test/test_random.fasta
diff --git a/test/test_seq.c b/test/test_seq.c
new file mode 100644
index 0000000..bbae326
--- /dev/null
+++ b/test/test_seq.c
@@ -0,0 +1,79 @@
+#include <glib.h>
+#include "global.h"
+#include <stdio.h>
+#include <string.h>
+#include "sequence.h"
+
+int FLAGS = F_NONE;
+
+void test_seq_basic(){
+
+ seq_t S;
+
+ seq_init( &S, "ACGT", "name");
+
+ g_assert_cmpstr(S.S, ==, "ACGT");
+ g_assert_cmpstr(S.name, ==, "name");
+ g_assert_cmpuint(S.len, ==, 4);
+
+ seq_free( &S);
+}
+
+void test_seq_full(){
+
+ seq_t S;
+
+ seq_init( &S, "ACGTTGCA", "name");
+ seq_subject_init( &S);
+
+ g_assert_cmpstr(S.RS, ==, "TGCAACGT#ACGTTGCA");
+ g_assert_cmpuint(S.RSlen, ==, 8*2+1);
+ g_assert( S.gc == 0.5);
+
+ seq_free( &S);
+}
+
+void test_seq_nonacgt(){
+ seq_t S;
+
+ seq_init( &S, "11ACGTNN7682394689NNTGCA11", "name");
+ seq_subject_init( &S);
+
+ g_assert_cmpstr(S.S, ==, "ACGTTGCA");
+ g_assert_cmpuint(S.len, ==, 8 );
+ g_assert( FLAGS & F_NON_ACGT);
+
+ g_assert_cmpstr(S.RS, ==, "TGCAACGT#ACGTTGCA");
+ g_assert_cmpuint(S.RSlen, ==, 8*2+1);
+ g_assert( S.gc == 0.5);
+
+ seq_free( &S);
+
+ FLAGS = F_NONE;
+
+ seq_init( &S, "@ACGT_!0TGCA ", "name");
+ seq_subject_init( &S);
+
+ g_assert_cmpstr(S.S, ==, "ACGT!TGCA");
+ g_assert_cmpuint(S.len, ==, 9 );
+ g_assert( FLAGS & F_NON_ACGT);
+
+ g_assert_cmpstr(S.RS, ==, "TGCA;ACGT#ACGT!TGCA");
+ g_assert_cmpuint(S.RSlen, ==, 9*2+1);
+
+ seq_free( &S);
+
+ FLAGS = F_NONE;
+
+}
+
+int main(int argc, char *argv[])
+{
+ g_test_init( &argc, &argv, NULL);
+ g_test_add_func("/seq/basic", test_seq_basic);
+ g_test_add_func("/seq/full", test_seq_full);
+ g_test_add_func("/seq/non acgt", test_seq_nonacgt);
+
+ return g_test_run();
+}
+
--
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/andi.git
More information about the debian-med-commit
mailing list