[med-svn] r1024 - in trunk/packages/perlprimer/trunk: . debian
charles-guest at alioth.debian.org
charles-guest at alioth.debian.org
Wed Dec 26 16:15:53 UTC 2007
Author: charles-guest
Date: 2007-12-26 16:15:52 +0000 (Wed, 26 Dec 2007)
New Revision: 1024
Added:
trunk/packages/perlprimer/trunk/debian/perlprimer.1
Removed:
trunk/packages/perlprimer/trunk/Changelog
trunk/packages/perlprimer/trunk/ReadMe.txt
trunk/packages/perlprimer/trunk/copying
trunk/packages/perlprimer/trunk/gcg.603
trunk/packages/perlprimer/trunk/perlprimer.1
trunk/packages/perlprimer/trunk/todo
trunk/packages/perlprimer/trunk/tutorial.html
trunk/packages/perlprimer/trunk/tutorial_files/
Modified:
trunk/packages/perlprimer/trunk/debian/
Log:
swiching to mergewithupstream system
Deleted: trunk/packages/perlprimer/trunk/Changelog
===================================================================
--- trunk/packages/perlprimer/trunk/Changelog 2007-12-26 01:26:46 UTC (rev 1023)
+++ trunk/packages/perlprimer/trunk/Changelog 2007-12-26 16:15:52 UTC (rev 1024)
@@ -1,309 +0,0 @@
-18/10/06 (PerlPrimer-1.1.14)
-- Ensembl compatibility restored once again (slight change in the searchview output was causing problems)
-
-22/6/06 (PerlPrimer-1.1.13)
-- Ensembl compatibility restored again (back to searchview)
-- Added code to check for the presence of Genomic and mRNA seqs before running spidey (error message that resulted otherwise was confusing to users)
-
-5/6/06 (PerlPrimer-1.1.12)
-- Retrieval of un-annotated genes from Ensembl (using the Ensembl Gene ID) is now possible
-- BLAST search results compatibility restored
-- ORF calculation re-written to allow for transciption initiation from TTG, GTG and CTG codons, in the absence of an initiating ATG
-
-31/5/06 (PerlPrimer-1.1.11)
-- Ensembl compatibility restored yet again (Ensembl now apparently back to using a modified text view rather than searchview)
-- Better error notification if the Ensembl format changes yet again
-- Fixed a small bug related to finding the GCG restriction enzyme file in the user's home directory
-
-20/3/06 (PerlPrimer-1.1.10)
-- Ensembl compatibility yet again restored
-- Button in Ensembl transcripts dialogue to allow user to open a browser
-window to view the different transcripts (on the Ensembl gene web page)
-- Option in Preferences->Network to specify web browser to use (may not work
-under Win32 - seems to use default system browser regardless)
-- List of Ensembl genome databases updated
-- Translation from forward primer to ORF start is now shown in a lighter
-colour
-- Active buttons in dialogues are now invoked by pressing <Return>
-- Update to checkbutton referencing code to support later versions of Perl/Tk
-under *nix
-- Slight cosmetic changes to GUI colours
-
-8/9/05 (PerlPrimer-1.1.9)
-- Ensembl compatibility restored once again
-- Slight change to Spidey error dialogue to reflect the possibility that the error might be Ensembl-related
-
-9/8/05 (PerlPrimer-1.1.8)
-- Ensembl compatibility is restored, and now allows the user to select the desired transcripts from genes
-- View intron/exon structure now provides a indication of sequence length
-- Minor code tidying
-
-30/05/05 (PerlPrimer-1.1.7)
-- Added "Span Intron/Exon Boundary" option for QPCR - this is selected by default and was the previous default behaviour; however, it is now possible to design primers for sequences without introns (e.g. 18S)
-- Added GC% information for Primer information tab, and adjusted the layout
-- Ensembl genome databases updated (added Canis_familiaris, Gallus_gallus, Pan_troglodytes, Saccharomyces_cerevisiae, Tetraodon_nigroviridis, Xenopus_tropicalis; removed Caenorhabditis_briggsae)
-- Retieve gene from Ensembl function now always prompts user to select from the list of matching gene names, even if only one name matches - this ensures that the correct gene has been identified (Ensembl occasionally has some unexpected single matches to queries)
-- Some Ensembl search matches were not detected correctly due to a slight change in the HTML output from Ensembl - this is now adjusted for
-- Added word-size option to blast searching - BLAST now uses the more correct word size of 7 bases by default
-- Blast search now uses real clock measurments to show elapsed time, rather than just calculating the number of times the routine had been called
-- Default interface font on Windows is now Arial instead of MS Sans Serif - using a TrueType font such as Arial allows nice sub-pixel rendering on LCD displays
-- Updated Rebase restriction enzyme file to gcg.505
-- BUGFIX: Sequence right-click menu works again
-- BUGFIX: Save FASTA dialogue now works correctly
-- BUGFIX: DNA graphic and primers are now resized when window is resized
-
-01/04/05 (PerlPrimer-1.1.6)
-- BUGFIX: Problems in Tm and dG calculation that prevented program startup when [dNTPs] > [Mg++] - quick fix provided to prevent this by keeping the value of sqrt([Mg++] - [dNTPs]) as 0. A warning prompt is displayed if this situation is set in the preferences
-- BUGFIX: Oligo concentration in the preferences was incorrectly described as being in mM when it is in fact calculated as nM
-- Acknowledgment of Rebase files provided in the acknowledgements dialogue
-- Tutorial html file from http://perlprimer.sf.net added to distribution package
-
-21/12/04 (PerlPrimer-1.1.5)
-- Old preferences are automatically copied to the new home directory location when upgrading
-- Win32 executable built with ActivePerl 5.8.6 and PAR 0.86
-
-20/12/04
-- PerlPrimer now translates in frame from the forward primer if this starts upstream of the ORF (allows easy identification of stop codons when designing cloning primers)
-- Better handling of information from FASTA files - FASTA header now automatically becomes the file name
-- Several minor bug fixes and code-tidying
-
-03/11/04
-- Home and temporary directory fixes - directories are now set from Perl environmental variables if possible; tmp directory set to home if user does not have correct read/write permissions or if directory does not exist
-- Full primer-dimer values are calculated as well as extensible primer-dimers, and results are sorted based on both values
-
-01/09/04
-- BLAST search can now use a local blast database and server
-- "View intron/exon structure" button in QPCR tab graphically draws the exon/intron structure of the genomic DNA (thus showing the size of the introns)
-- New browse directory code (requires a recent version of Perl/Tk to run correctly)
-- BUGFIX: Saving .ppr files did not work correctly under some Perl distributions
-- Complete re-write of the internal GUI code (now made more extensible and more comprehensible)
-
-13/07/04 (PerlPrimer-1.1.4a)
-- BUGFIX: "Open Sequence" buttons did not work correctly when opening sequences in FASTA format (or genomic DNA sequence for QPCR tab)
-- BUGFIX: Bisulphite PCR tab did not display primer information in the status bar when dimer dG == 0
-- BUGFIX: Finding sequencing primers without a dG cutoff did not calculate dG for primers
-- Minor GUI changes for Win32 to work with ActivePerl v5.8.4 (some cosmetic Perl/Tk changes)
-
-21/06/04 (PerlPrimer-1.1.4)
-- View spidey output command now runs spidey directly
-- Win32::FileOp code disabled - causes redraw problems with Perl/Tk
-- Minor code tidying
-
-17/06/04
-- BUGFIX: Fixed a bug added in the last version that did not reverse the 3' restriction enzyme site and anchor when adding cloning sequences
-
-28/04/04
-- Work begun on unequal loops primer-dimer routines (not fully implemented as yet)
-
-22/04/04
-- Code to support Win32::FileOp if it exists under windows for selecting directories, as DirTree seems flakey at best with some extremely eratic behaviour. This is not currently an ActivePerl module, so will only be relevant for the Windows installer version.
-
-21/04/04 (PerlPrimer-1.1.3a)
-- Windows installer version only
-- PerlPrimer now searches for Spidey in the PerlPrimer directory on startup
-- Minor code tidying
-
-19/04/04 (PerlPrimer-1.1.3)
-- Trial self-executable format for Windows (warning: >3 Mb download) created using PAR (http://par.perl.org)
-- Save DNA sequence dialogue now has options for both .fasta and .txt formats (default is .fasta)
-- Saving DNA sequence in FASTA format now prompts the user for a description line (default is the open file name, if any)
-- Better processing of FASTA files when opening (whitespace and some illegal characters are removed from the description line when taking the file name)
-
-18/04/04
-- Buttons to choose home, tmp, and spidey-location directories in the Preferences dialogue
-- Rearranged Preferences dialogue: Separate sections for directories and behaviour when opening new files in the "General" tab; defer-to-capitalised-regions option is now in the "Bioinformatics" tab
-
-15/04/04
-- Checkbox now present to control whether QPCR primers need to span an intron/exon boundary or not (old method from 02/04/04 still works as well)
-- When QPCR data are retrieved from Ensembl, Spidey is run automatically and intron/exon boundaries are shown on the DNA graphic
-- QPCR exon limits can now be selected with the mouse on the DNA graphic - use the left button to select the 5' range and the middle button (or Ctrl-Button 1) to select the 3' range (i.e. just like setting the range for other PCR methods)
-- Species name is now added to the default file name when a sequence is retrieved from Ensembl
-- Path to system temporary directory can be set in the Preferences
-- BUGFIX: Generate report did not save a report if the perlprimer file had not been saved
-- BUGFIX: PerlPrimer now handles degenerate sequences better (including gapped sequences) when finding ORFs
-- BUGFIX: If default values were 0 they were not restored to default when opening a new file
-- Code tidying and new balloon help messages
-
-14/04/04
-- QPCR can now select primers targeting a range of exons or a single exon (suggested by Alf Eaton)
-- BUGFIX: temporary dna and mrna files for Spidey are now saved in the system tmp directory, rather than the directory where Spidey is located (suggested by Alf Eaton)
-
-02/04/04
-- QPCR can now design primers that surround an intron/exon boundary but do not span the boundary (delete the value in the "Minimum Intron/Exon boundary" box for this to work (now deprecated - see above)) (suggested by John Luckey)
-
-01/04/04
-- Changes to dialogue box code
-- Minor code tidying
-
-31/03/04
-- Preferences option to automatically find primers when receiving data from external applications through the tcp socket
-- Opening a new file when previous data exists now prompts the user to save (may be overridden in the preferences)
-- Opening a file now explicitly clears all data before opening
-
-30/03/04
-- TCP socket reading added for interaction between PerlPrimer and Contig Viewer
-
-29/03/04 (PerlPrimer-1.1.2)
-- BUGFIX: After finding sequencing primers, primer-dimer finding routine was not reset to only search for extensible dimers
-- Minor changes to DNA sequence opening routines to make use of the improved FASTA header functions
-
-24/03/04
-- BUGFIX: a simple bug in the CpG island detection algorithm prevented small islands from being reported
-- BUGFIX: PerlPrimer under MacOS X now correctly detects it is running under a unix environment
-- Better routines for finding the Spidey executable on all platforms (perlprimer now uses a *pidey.* glob and picks the largest file from all matches, in case the archive file is present in the same directory)
-- Perlprimer now screens each primer for degenerate/non-DNA symbols and will not calculate Tm if these are present
-
-22/03/04
-- All fonts (main gui font, primer list font and fixed font for sequences) can now be specified in the preferences (suggested by Alf Eaton)
-
-16/03/04 (PerlPrimer-1.1.1)
-- Added the .fasta file type to the Open File dialogue box
-
-15/03/04
-- New feature: PerlPrimer can save current parameters as defaults for each PCR tab (Use the Tools menu option "Save default values for this page"). Values are saved to files in the user's home directory, ".perlprimer.[name_of_page]". (Use the Tools menu option "Restore in-built default values" to delete this file)
-
-11/03/04
-- New feature: PerlPrimer can now open FASTA files with range information included in the FASTA header - syntax for the first line is ">Name of DNA sequence 5prime_region[?-?] 3prime_region[?-?] page[?]" where the page argument is optional (defaults to the standard PCR page) and where page 1 = standard PCR, page 2 = bisulphite PCR, etc. Suggested by Alexander Kozik, for use by Contig Viewer (http://www.atgc.org/Py_ContigViewer/)
-
-09/03/04 (PerlPrimer-1.1)
-- Minor code tidying
-
-02/03/04
-- New icons for opening and saving DNA sequences
-- BUGFIX: a workaround for a very weird Perl/Tk bug - if the Preferences dialogue was opened and closed twice, PerlPrimer stopped doing floating point arithmetic (?!).
-
-27/02/04
-- If multiple genes match the expression used to search the ensembl database, PerlPrimer now displays the complete list and allows the user to choose any of the descriptions (or to cancel and refine the search)
-- Primer-dimer routines revised again - previous method was not considering that initial/terminal mismatches will not contribute to dimer instability and thus should not be included when calculating dG values
-- New feature: Users can select the temperature at which to calculate primer-dimer dG in the preferences
-- Default MRU file list is now 8 files
-
-23/02/04
-- New feature: Users can disable repeat/run checking in the Preferences window
-- Completed abstraction of the add_cloning subroutine
-- BUGFIX: Preference writing routine now saves the MRU file list when closing preferences dialogue (previously the MRU file list was lost if the preferences were changed and then PerlPrimer was killed)
-- Several minor bug fixes
-- General code tidying
-
-18/02/04
-- New feature: "Find primers for cloning" menu option (in the tools menu) - only available in standard PCR mode, reduces the 5' outer range by 10 bp increments and the 3' inner range by 10 bp increments until primers are found
-- Renamed "Auto +", "Auto -" buttons to "Find outwards" and "Find inwards"
-
-05/02/04
-- New feature: "Add cloning sequences" dialogue. PerlPrimer now uses the GCG restriction enzyme database file from REBASE to list the non-cutting restriction enzymes within a sequence when in Standard PCR mode. To use, select "Add cloning sequences" from the Tools menu. (note: the file 'gcg.###' - included with the distribution - will need to be installed in either your home directory or in the same directory as PerlPrimer for this to work)
-- Minor bug fixes
-
-02/02/04 (PerlPrimer-1.0.2)
-- Added a Recently Opened Files menu (number of files is customisable through the preferences)
-- Added bindings for left and right arrow keys when focussed in the primer lists - allows the user to quickly switch to the primer-dimer tab (with the right arrow key) and back again (with the left arrow key). Note that up and down arrow keys will still move through the primer list as before
-- PerlPrimer now deletes the dna and mrna temporary files required by Spidey after use
-- The %GC above and below which to exclude primers automatically can now be set in the preferences (before it was between 40% and 60%)
-- Several cosmetic changes:
-- look-and-feel of menubar and toolbar is now OS dependent
-- fonts are consistent across all widgets (exception under windows is the HList font - set to be verdana at one point less than the user assigned font size)
-- most fonts may be overridden by system defaults if desired
-- the notebook widget on Win32 now has shaded inactive tabs
-- minor interface tidying
-- If sequencing primers cannot be found within the specified read length between primers, a dialogue is now displayed and the run is aborted (previously, the program would find the next best primer, which could be at a distance much greater than that specified)
-- Slight modifications to the preference reading/writing routines to allow array data to be saved (needed for the recently used files list)
-- Open and Save file functions now list the percentage opened/saved on the status line
-- The dG hash for calculating primer-dimer stability is now calculated from the current salt conditions and the enthalpy and entropy hashes - meaning that primer-dimer calculations are much more accurate. (note that if changing salt concentrations in the preferences, OK needs to be pressed before the hash is recalculated)
-- Reworked menus in the new (and more correct) Perl/Tk format
-- Re-ordering of File menu items
-- "Sort primers" popup menu is now a sub-menu
-- Minor bugfixes and code tidying
-
-23/1/04 (PerlPrimer-1.0.1)
-- PerlPrimer now uses eval routines to check for all perl modules, and either exits with a useful message or disables some functions if a module is not found.
-- Several minor bugs fixed/general code tidying.
-
-- NB: Previous public release (1.0) had an older copy of perlprimer (Beta 5) by mistake - please upgrade if using that release as several important bugs have been fixed.
-
-18/12/03 (PerlPrimer-1.0)
-- BUGFIX: Generate Report (and copy printable) now includes the last line of sequence
-- Minor code tidying
-
-16/12/03 (PerlPrimer-1.0_Beta_6)
-- Rehashed primer-dimer routine (again!) - routine now only searches for *extensible* 3' primer-dimers when searching for primer pairs, and pd_full now searches for all other primer-dimers (3' and 5'). This equates to approximately a 100% increase in speed when searching for primers, and provides more useful information to the end user.
-- BUGFIX: Generate Report now provides the correct information for amplicon size and primer positions.
-- Partially abstracted the added-cloning-sequence routines to a subroutine (only implemented for the dna_magnify routine as yet)
-
-12/12/03
-- BUGFIX: removed a few extraneous bitwise ands that were lying around (caused problems with some Perl distributions) - suggested by Chris Vega
-- BUGFIX: made all Tk calls use a dash for each option key (caused problems on some systems) - suggested by Chris Vega
-
-11/12/03 (PerlPrimer-1.0_Beta_5)
-
-10/12/03
-- BLAST search now has a (semi-fake) elapsed time display while searching (counts 15 seconds per search interval, which should be approximately correct!)
-- BUGFIX: Many minor bugs squashed, including several problems that occured when range values were defined but 0
-- Open sequence will accept and work with multi-lined entries (preventing slowdowns, although ORF finding will still convert to a single lined entry - this needs to be changed)
-- Many other minor changes/tidying
-- Balloon help texts updated for the new options (sequencing page, pref options, etc)
-
-
-07/12/03
-- New feature: Sequencing page (finds primers spaced at a user-defined interval along a sequence)
-- Gui packing system greatly reworked, now uses far less reliance on the grid geometry manager and less frames to achieve layout. A new subroutine, nr() (=newrow) is used to create new frame rows, and all widgets are packed into the last row created from the left - simpler and easier. Should also be slight faster when redrawing on old systems.
-- BUGFIX: QPCR tab was not assigned a "File not saved" description, thus not displaying the open file name correctly.
-- Reworked the primer windowing subroutines to now use a two dimensional array to store primer details (slightly faster and much neater)
-- New feature: PerlPrimer no longer defers to capitalised regions by default but uses the ORF/CpG finding algorithms instead (less confusing and more useful) Defer to capitalised regions is now a preferences option.
-- New feature: PerlPrimer no longer emulates cpgplot behaviour by default, but uses the "correct" algorithm instead. Emulate cpgplot behaviour is now a preferences option.
-- Dialogues are now unique (for non-static dialogues the old is destroyed before the new one is created);
-- Main window now has a minimum size (= the default packing size when the program is started) to prevent widgets disappearing when the window is resized too small.
-- General code tidying and far too many small changes to list independantly.
-
-27/11/03 (perlprimer-1.0_Beta_4)
-- Redesigned Tm and Primer Size widgets, and amplicon size widgets in QPCR tab
-
-26/11/03
-- File saving reworked: PerlPrimer now has standard "Save"/"Save as" functionality and behaves as expected
-- Title of program now displays the name of the file being worked on, even if multiple files are open at the same time
-- Default extention of saved sequences and reports is now .txt
-
-25/11/03
-- New feature: proxy server support (enter in preferences) - will still use env_proxy if box unchecked
-- File open/save now allows multiple line DNA sequences - prevents slowdown for large genomic sequences used for QPCR
-- Default exclude_ie value is now 7 (was 5, which generates far too many primers for most genes and is not as specific)
-- BUGFIX: intron-exon boundary checking was not quite right with exclude_ie - this is now fixed.
-
-24/11/03 (perlprimer-1.0_Beta_3)
-- New feature: retrieve genes from Ensembl - which also will automatically retrieve genomic and cdna sequence for QPCR
-- New QPCR option: minimum intron/exon boundary - sets minimum overlap of primers across intron/exon boundary
-- Minor code tidying/fixes
-
-20/11/03 (perlprimer-1.0_Beta_2)
-- BUGFIX: fixed infinite loop that occurred when no primers were found using the "Auto +" button
-- pp_open_file routine now checks that a PerlPrimer file has in fact been selected and prompts if not
-- "Generate Report" now includes Amplicon size and primer position information
-- Minor code tidying
-
-13/11/03 (perlprimer-1.0_Beta_1)
-- Preferences dialogue now in NoteBook format
-- Preference options for BLAST searching (and associated modification of BLAST subroutine)
-- "Generate Report" now includes modified primers, file name and date
-- pack_gui subroutine now supports BrowseEntry widgets (needed for BLAST preferences)
-- Minor code tidying
-
-11/11/03 (perlprimer-0.99.95)
-- BUGFIX: primer Tm was not calculated for lower-case primers
-- get_tm subroutine is now specific for a single primer if only one is entered
-- Minor code changes/tidying
-
-28/10/03 (perlprimer-0.99.9)
-- "New File" feature added (see new_file subroutine)
-- Changes to dialogue subroutine to allow different dialogue types
-- New button-packing code for toolbars
-- Code tidying (especially GUI packing routines)/bug fixes
-
-26/10/03
-- "Generate Report" feature added
-- Toolbar added
-- Magnify button created next to canvas display
-- "New File" feature added to menus, but not yet implemented
-- Several icons added
-- General code tidying
-- "Reset" buttons removed - functionality taken over by "Set from ..." buttons
-
-24/10/03
-- Initial public release (perlprimer-0.99.8)
Deleted: trunk/packages/perlprimer/trunk/ReadMe.txt
===================================================================
--- trunk/packages/perlprimer/trunk/ReadMe.txt 2007-12-26 01:26:46 UTC (rev 1023)
+++ trunk/packages/perlprimer/trunk/ReadMe.txt 2007-12-26 16:15:52 UTC (rev 1024)
@@ -1,91 +0,0 @@
-PerlPrimer
-----------
-
-Copyright © 2003-2006, Owen Marshall (owenjm at users.sourceforge.net)
-
-
-Contents
---------
-
-1. Introduction
-2. Installation / Using the program
-3. Links to external programs
-4. Suggestions/patches/bugs/support
-
-
-1. Introduction
----------------
-
-Perlprimer is a GUI application that designs primers for standard PCR, bisulphite PCR, Real-time PCR (QPCR) and sequencing.
-
-Perlprimer's current features include the following:
-
-* Calculation of possible primer-dimers
-* Retrieval of genomic or cdna sequences from Ensembl (including both sequences automatically for QPCR)
-* Ability to BLAST search primers using either the NCBI server or a local server
-* Results can be saved or optionally exported in a tab-delimited format that is compatible with most spreadsheet applications.
-* ORF and CpG island detection algorithms
-* Ability to add cloning sequences to primers, automatically adjusted to be in-frame
-* QPCR primer design without manual intron-exon boundary entry
-
-Perlprimer calculates primer melting temperature using J. SantaLucia's extensive nearest-neighbour thermodynamic parameters. To adjust for the salt conditions of the PCR, PerlPrimer uses the empirical formula derived by von Ahsen, et al. (2001) and allows the user to specify the concentration of Mg2+, dNTPs and primers, or use default, standard, PCR conditions. The result is a highly accurate prediction of primer melting temperature, giving rise to a maximum yeild of product when amplified.
-
-Perlprimer is written in Perl and requires Perl/Tk. In addition, for QPCR functionality perlprimer requires the open-source Spidey executable from NCBI. The program is designed to be cross-platform and has been tested on both Microsoft Windows and GNU/Linux-based operating systems. Users have also had success using the program under Mac OS X.
-
-Restriction enzyme data is provided by the REBASE project (http://rebase.neb.com/)
-
-
-2. Installation / Using the program
------------------------------------
-
-PerlPrimer requires Perl and Perl/Tk. These should be provided by your distribution if using a UNIX-based operating system; if using Windows I recommend using ActiveState's distribution of Perl 5.8, which includes Perl/Tk, freely available from
-
- http://www.activestate.com/Products/ActivePerl/
-
-After installing ActivePerl under Windows, the file "perlprimer.pl" should run if double-clicked.
-
-PerlPrimer can also be started from the commandline, and this would be the normal mode of operation for UNIX-based OSes (including Mac OS X):
-
- $ perl perlprimer.pl [file to open]
-
-(the file to open parameter is optional)
-
-
-Users under UNIX-based OSes may need to install Perl/Tk manually if it is not included in your distribution. Perl/Tk can be downloaded from
-
- http://search.cpan.org/~ni-s/Tk/
-
-and can be installed by following the instructions included in the archive. Users may also need the Perl modules HTTP::Request and LWP::UserAgent for BLAST searching and gene retieval from Ensembl; these are part of libwww-perl-5.76 which can be found at
-
- http://search.cpan.org/~gaas/libwww-perl-5.76/
-
-In addition to installing Perl/Tk (and libwww-perl if required), Mac OS X users will generally require OS 10.3 (Panther) or later and an X-server. (Please note that as I do not have access to a Mac OS X system I cannot guarantee compatibility, although I will try to fix any issues that are reported).
-
-
-Using PerlPrimer should be fairly self-explanatory, with extensive "balloon help" (turned on by default) and a separate help window detailing the operation of the graphical display of the DNA sequence, selection ranges and primers. A tutorial is provided with this distribution, and is also available at
-
- http://perlprimer.sourceforge.net/tutorial.html
-
-which covers the most commonly used features of the program.
-
-
-3. Links to external programs
------------------------------
-
-For Real-time PCR (QPCR) functionality, PerlPrimer uses the program Spidey, released freely by the NCBI, to calculate intron/exon boundaries. This may be obtained from
-
- http://www.ncbi.nlm.nih.gov/spidey/
-
-The program by default expects the spidey executable to be in your home directory on UNIX-based systems, or at C:\Spidey.exe for Windows. The location may be changed in the preferences window.
-
-
-4. Suggestions/patches/bugs/support
-------------------------------------
-
-The latest release of PerlPrimer can be obtained from
-
- http://perlprimer.sourceforge.net/
-
-Please check the lastest version before reporting bugs.
-
-Bugs, feature suggestions and support requests can be placed on the web forums provided at the above address, or alternatively by emailing me directly.
Deleted: trunk/packages/perlprimer/trunk/copying
===================================================================
--- trunk/packages/perlprimer/trunk/copying 2007-12-26 01:26:46 UTC (rev 1023)
+++ trunk/packages/perlprimer/trunk/copying 2007-12-26 16:15:52 UTC (rev 1024)
@@ -1,281 +0,0 @@
- GNU GENERAL PUBLIC LICENSE
- Version 2, June 1991
-
- Copyright (C) 1989, 1991 Free Software Foundation, Inc.
- 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
- Preamble
-
- The licenses for most software are designed to take away your
-freedom to share and change it. By contrast, the GNU General Public
-License is intended to guarantee your freedom to share and change free
-software--to make sure the software is free for all its users. This
-General Public License applies to most of the Free Software
-Foundation's software and to any other program whose authors commit to
-using it. (Some other Free Software Foundation software is covered by
-the GNU Library General Public License instead.) You can apply it to
-your programs, too.
-
- When we speak of free software, we are referring to freedom, not
-price. Our General Public Licenses are designed to make sure that you
-have the freedom to distribute copies of free software (and charge for
-this service if you wish), that you receive source code or can get it
-if you want it, that you can change the software or use pieces of it
-in new free programs; and that you know you can do these things.
-
- To protect your rights, we need to make restrictions that forbid
-anyone to deny you these rights or to ask you to surrender the rights.
-These restrictions translate to certain responsibilities for you if you
-distribute copies of the software, or if you modify it.
-
- For example, if you distribute copies of such a program, whether
-gratis or for a fee, you must give the recipients all the rights that
-you have. You must make sure that they, too, receive or can get the
-source code. And you must show them these terms so they know their
-rights.
-
- We protect your rights with two steps: (1) copyright the software, and
-(2) offer you this license which gives you legal permission to copy,
-distribute and/or modify the software.
-
- Also, for each author's protection and ours, we want to make certain
-that everyone understands that there is no warranty for this free
-software. If the software is modified by someone else and passed on, we
-want its recipients to know that what they have is not the original, so
-that any problems introduced by others will not reflect on the original
-authors' reputations.
-
- Finally, any free program is threatened constantly by software
-patents. We wish to avoid the danger that redistributors of a free
-program will individually obtain patent licenses, in effect making the
-program proprietary. To prevent this, we have made it clear that any
-patent must be licensed for everyone's free use or not licensed at all.
-
- The precise terms and conditions for copying, distribution and
-modification follow.
-
- GNU GENERAL PUBLIC LICENSE
- TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
-
- 0. This License applies to any program or other work which contains
-a notice placed by the copyright holder saying it may be distributed
-under the terms of this General Public License. The "Program", below,
-refers to any such program or work, and a "work based on the Program"
-means either the Program or any derivative work under copyright law:
-that is to say, a work containing the Program or a portion of it,
-either verbatim or with modifications and/or translated into another
-language. (Hereinafter, translation is included without limitation in
-the term "modification".) Each licensee is addressed as "you".
-
-Activities other than copying, distribution and modification are not
-covered by this License; they are outside its scope. The act of
-running the Program is not restricted, and the output from the Program
-is covered only if its contents constitute a work based on the
-Program (independent of having been made by running the Program).
-Whether that is true depends on what the Program does.
-
- 1. You may copy and distribute verbatim copies of the Program's
-source code as you receive it, in any medium, provided that you
-conspicuously and appropriately publish on each copy an appropriate
-copyright notice and disclaimer of warranty; keep intact all the
-notices that refer to this License and to the absence of any warranty;
-and give any other recipients of the Program a copy of this License
-along with the Program.
-
-You may charge a fee for the physical act of transferring a copy, and
-you may at your option offer warranty protection in exchange for a fee.
-
- 2. You may modify your copy or copies of the Program or any portion
-of it, thus forming a work based on the Program, and copy and
-distribute such modifications or work under the terms of Section 1
-above, provided that you also meet all of these conditions:
-
- a) You must cause the modified files to carry prominent notices
- stating that you changed the files and the date of any change.
-
- b) You must cause any work that you distribute or publish, that in
- whole or in part contains or is derived from the Program or any
- part thereof, to be licensed as a whole at no charge to all third
- parties under the terms of this License.
-
- c) If the modified program normally reads commands interactively
- when run, you must cause it, when started running for such
- interactive use in the most ordinary way, to print or display an
- announcement including an appropriate copyright notice and a
- notice that there is no warranty (or else, saying that you provide
- a warranty) and that users may redistribute the program under
- these conditions, and telling the user how to view a copy of this
- License. (Exception: if the Program itself is interactive but
- does not normally print such an announcement, your work based on
- the Program is not required to print an announcement.)
-
-These requirements apply to the modified work as a whole. If
-identifiable sections of that work are not derived from the Program,
-and can be reasonably considered independent and separate works in
-themselves, then this License, and its terms, do not apply to those
-sections when you distribute them as separate works. But when you
-distribute the same sections as part of a whole which is a work based
-on the Program, the distribution of the whole must be on the terms of
-this License, whose permissions for other licensees extend to the
-entire whole, and thus to each and every part regardless of who wrote it.
-
-Thus, it is not the intent of this section to claim rights or contest
-your rights to work written entirely by you; rather, the intent is to
-exercise the right to control the distribution of derivative or
-collective works based on the Program.
-
-In addition, mere aggregation of another work not based on the Program
-with the Program (or with a work based on the Program) on a volume of
-a storage or distribution medium does not bring the other work under
-the scope of this License.
-
- 3. You may copy and distribute the Program (or a work based on it,
-under Section 2) in object code or executable form under the terms of
-Sections 1 and 2 above provided that you also do one of the following:
-
- a) Accompany it with the complete corresponding machine-readable
- source code, which must be distributed under the terms of Sections
- 1 and 2 above on a medium customarily used for software interchange; or,
-
- b) Accompany it with a written offer, valid for at least three
- years, to give any third party, for a charge no more than your
- cost of physically performing source distribution, a complete
- machine-readable copy of the corresponding source code, to be
- distributed under the terms of Sections 1 and 2 above on a medium
- customarily used for software interchange; or,
-
- c) Accompany it with the information you received as to the offer
- to distribute corresponding source code. (This alternative is
- allowed only for noncommercial distribution and only if you
- received the program in object code or executable form with such
- an offer, in accord with Subsection b above.)
-
-The source code for a work means the preferred form of the work for
-making modifications to it. For an executable work, complete source
-code means all the source code for all modules it contains, plus any
-associated interface definition files, plus the scripts used to
-control compilation and installation of the executable. However, as a
-special exception, the source code distributed need not include
-anything that is normally distributed (in either source or binary
-form) with the major components (compiler, kernel, and so on) of the
-operating system on which the executable runs, unless that component
-itself accompanies the executable.
-
-If distribution of executable or object code is made by offering
-access to copy from a designated place, then offering equivalent
-access to copy the source code from the same place counts as
-distribution of the source code, even though third parties are not
-compelled to copy the source along with the object code.
-
- 4. You may not copy, modify, sublicense, or distribute the Program
-except as expressly provided under this License. Any attempt
-otherwise to copy, modify, sublicense or distribute the Program is
-void, and will automatically terminate your rights under this License.
-However, parties who have received copies, or rights, from you under
-this License will not have their licenses terminated so long as such
-parties remain in full compliance.
-
- 5. You are not required to accept this License, since you have not
-signed it. However, nothing else grants you permission to modify or
-distribute the Program or its derivative works. These actions are
-prohibited by law if you do not accept this License. Therefore, by
-modifying or distributing the Program (or any work based on the
-Program), you indicate your acceptance of this License to do so, and
-all its terms and conditions for copying, distributing or modifying
-the Program or works based on it.
-
- 6. Each time you redistribute the Program (or any work based on the
-Program), the recipient automatically receives a license from the
-original licensor to copy, distribute or modify the Program subject to
-these terms and conditions. You may not impose any further
-restrictions on the recipients' exercise of the rights granted herein.
-You are not responsible for enforcing compliance by third parties to
-this License.
-
- 7. If, as a consequence of a court judgment or allegation of patent
-infringement or for any other reason (not limited to patent issues),
-conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License. If you cannot
-distribute so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you
-may not distribute the Program at all. For example, if a patent
-license would not permit royalty-free redistribution of the Program by
-all those who receive copies directly or indirectly through you, then
-the only way you could satisfy both it and this License would be to
-refrain entirely from distribution of the Program.
-
-If any portion of this section is held invalid or unenforceable under
-any particular circumstance, the balance of the section is intended to
-apply and the section as a whole is intended to apply in other
-circumstances.
-
-It is not the purpose of this section to induce you to infringe any
-patents or other property right claims or to contest validity of any
-such claims; this section has the sole purpose of protecting the
-integrity of the free software distribution system, which is
-implemented by public license practices. Many people have made
-generous contributions to the wide range of software distributed
-through that system in reliance on consistent application of that
-system; it is up to the author/donor to decide if he or she is willing
-to distribute software through any other system and a licensee cannot
-impose that choice.
-
-This section is intended to make thoroughly clear what is believed to
-be a consequence of the rest of this License.
-
- 8. If the distribution and/or use of the Program is restricted in
-certain countries either by patents or by copyrighted interfaces, the
-original copyright holder who places the Program under this License
-may add an explicit geographical distribution limitation excluding
-those countries, so that distribution is permitted only in or among
-countries not thus excluded. In such case, this License incorporates
-the limitation as if written in the body of this License.
-
- 9. The Free Software Foundation may publish revised and/or new versions
-of the General Public License from time to time. Such new versions will
-be similar in spirit to the present version, but may differ in detail to
-address new problems or concerns.
-
-Each version is given a distinguishing version number. If the Program
-specifies a version number of this License which applies to it and "any
-later version", you have the option of following the terms and conditions
-either of that version or of any later version published by the Free
-Software Foundation. If the Program does not specify a version number of
-this License, you may choose any version ever published by the Free Software
-Foundation.
-
- 10. If you wish to incorporate parts of the Program into other free
-programs whose distribution conditions are different, write to the author
-to ask for permission. For software which is copyrighted by the Free
-Software Foundation, write to the Free Software Foundation; we sometimes
-make exceptions for this. Our decision will be guided by the two goals
-of preserving the free status of all derivatives of our free software and
-of promoting the sharing and reuse of software generally.
-
- NO WARRANTY
-
- 11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
-FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN
-OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
-PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
-OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
-MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS
-TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE
-PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
-REPAIR OR CORRECTION.
-
- 12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
-WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
-REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
-INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
-OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
-TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
-YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
-PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
-POSSIBILITY OF SUCH DAMAGES.
-
- END OF TERMS AND CONDITIONS
-
Property changes on: trunk/packages/perlprimer/trunk/debian
___________________________________________________________________
Name: mergeWithUpstream
+ 1
Copied: trunk/packages/perlprimer/trunk/debian/perlprimer.1 (from rev 907, trunk/packages/perlprimer/trunk/perlprimer.1)
===================================================================
--- trunk/packages/perlprimer/trunk/debian/perlprimer.1 (rev 0)
+++ trunk/packages/perlprimer/trunk/debian/perlprimer.1 2007-12-26 16:15:52 UTC (rev 1024)
@@ -0,0 +1,21 @@
+.\" Hey, EMACS: -*- nroff -*-
+.TH PERLPRIMER 1 "6 January 2005"
+.SH NAME
+perlprimer \- graphically specify amplicon of DNA or mRNA sequences and design primers
+.SH SYNOPSIS
+.B perlprimer
+.SH DESCRIPTION
+.B PerlPrimer
+calculates primer melting temperature using J. SantaLucia's extensive nearest-neighbour thermodynamic parameters. To adjust for the salt conditions of the PCR, PerlPrimer uses the empirical formula derived by von Ahsen, et al. (2001) and allows the user to specify the concentration of Mg2+, dNTPs and primers, or use standard PCR conditions. The result is a highly accurate prediction of primer melting temperature, giving rise to a maximum yeild of product when amplified.
+.BR
+PerlPrimer is written in Perl and requires Perl/Tk. In addition, for QPCR functionality PerlPrimer requires the open-source Spidey executable from NCBI. The program is designed to be cross-platform compatible and has been developed and tested on both Microsoft Windows and GNU/Linux-based operating systems. Users have also reported success using the program under Mac OS X.
+.SH SEE ALSO
+.BR
+A very nice tutorial on http://perlprimer.sourceforge.net is also distributed
+as a debian package perlprimer-doc.
+.br
+.SH AUTHOR
+perlprimer was written by Owen Marshall <owenjm at users.sourceforge.net>
+.PP
+This manual page was assembled by Steffen Moeller <steffen_moeller at gmx.de>,
+for the Debian project (but may be used by others).
Deleted: trunk/packages/perlprimer/trunk/gcg.603
===================================================================
--- trunk/packages/perlprimer/trunk/gcg.603 2007-12-26 01:26:46 UTC (rev 1023)
+++ trunk/packages/perlprimer/trunk/gcg.603 2007-12-26 16:15:52 UTC (rev 1024)
@@ -1,746 +0,0 @@
-
-REBASE version 603 gcg.603
-
- =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
- REBASE, The Restriction Enzyme Database http://rebase.neb.com
- Copyright (c) Dr. Richard J. Roberts, 2006. All rights reserved.
- =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
-
-Rich Roberts Mar 01 2006
-
-
-REBASE codes for commercial sources of enzymes
-
- A GE Healthcare (8/05)
- B Invitrogen Corporation (8/05)
- C Minotech Biotechnology (9/05)
- E Stratagene (9/05)
- F Fermentas International Inc. (2/06)
- G Qbiogene (9/05)
- H American Allied Biochemical, Inc. (9/05)
- I SibEnzyme Ltd. (2/06)
- J Nippon Gene Co., Ltd. (8/05)
- K Takara Bio Inc. (9/05)
- M Roche Applied Science (8/05)
- N New England Biolabs (2/06)
- O Toyobo Biochemicals (9/05)
- Q Molecular Biology Resources (8/05)
- R Promega Corporation (9/05)
- S Sigma Chemical Corporation (9/05)
- U Bangalore Genei (9/05)
- V Vivantis Technologies (1/06)
- X EURx Ltd. (9/05)
- Y CinnaGen Inc. (9/05)
-
-..
-AarI 11 CACCTGCnnnn'nnnn_ 4 ! >F
-;AasI 7 GACnn_nn'nnGTC -2 ! DrdI,DseDI >F
-;AatI 3 AGG'CCT 0 ! StuI,Eco147I,PceI,SseBI >O
-AatII 5 G_ACGT'C -4 ! ZraI >AFGIKMNORV
-AccI 2 GT'mk_AC 2 ! FblI,XmiI >ABGJKMNORSU
-;AccII 2 CG'CG 0 ! Bsh1236I,BstFNI,BstUI,MvnI >AJK
-;AccIII 1 T'CCGG_A 4 ! Aor13HI,BlfI,BseAI,Bsp13I,BspEI,Kpn2I,MroI >GJKR
-;Acc16I 3 TGC'GCA 0 ! AviII,FspI,NsbI >IV
-;Acc36I 10 ACCTGCnnnn'nnnn_ 4 ! BspMI,BfuAI,BveI >I
-Acc65I 1 G'GTAC_C 4 ! KpnI,Asp718I >FGINRV
-;AccB1I 1 G'GyrC_C 4 ! BanI,BshNI,BspT107I >IV
-;AccB7I 7 CCAn_nnn'nTGG -3 ! PflMI,Van91I >IRV
-;AccBSI 3 CCG'CTC 0 ! BsrBI,MbiI >IV
-;AceIII 13 CAGCTCnnnnnnn'nnnn_ 4 ! >
-AciI 1 C'CG_C 2 ! BspACI,SsiI >N
-AclI 2 AA'CG_TT 2 ! Psp1406I >INV
-;AclWI 9 GGATCnnnn'n_ 1 ! AlwI,BspPI >I
-AcoI 1 y'CCGG_r 4 ! >I
-;AcsI 1 r'AATT_y 4 ! ApoI,XapI >IMV
-AcuI 22 CTGAAGnnnnnnnnnnnnnn_nn' -2 ! Eco57I >IN
-;AcvI 3 CAC'GTG 0 ! PmaCI,BbrPI,Eco72I,PmlI,PspCI >QX
-;AcyI 2 Gr'CG_yC 2 ! BsaHI,BssNI,BstACI,Hin1I,Hsp92I >JM
-;AdeI 6 CAC_nnn'GTG -3 ! DraIII >F
-;AfaI 2 GT'AC 0 ! RsaI,Csp6I >AK
-AfeI 3 AGC'GCT 0 ! Eco47III,Aor51HI >IN
-;AfiI 7 CCnn_nnn'nnGG -3 ! BsiYI,Bsc4I,BseLI,BslI >V
-AflII 1 C'TTAA_G 4 ! BfrI,BspTI,Bst98I,MspCI,Vha464I >AJKNO
-AflIII 1 A'CryG_T 4 ! >GMNS
-AgeI 1 A'CCGG_T 4 ! AsiGI,BshTI,CspAI,PinAI >GJNR
-;AhaIII 3 TTT'AAA 0 ! DraI >
-AhdI 6 GACnn_n'nnGTC -1 ! Eam1105I,AspEI,BmeRI,DriI,EclHKI >GN
-;AhlI 1 A'CTAG_T 4 ! SpeI,BcuI >IV
-;AjiI 3 CAC'GTC 0 ! BtrI,BmgBI >F
-;AjnI 0 'CCwGG_ 5 ! EcoRII,BptI,BseBI,BstNI,BstOI,Bst2UI,MvaI,Psp6I,PspGI >I
-AjuI 25 GAAnnnnnnnTTGGnnnnnn_nnnnn' -5 ! >F
-AjuI 26 CCAAnnnnnnnTTCnnnnnnn_nnnnn' -5 ! >F
-AleI 5 CACnn'nnGTG 0 ! OliI >N
-AlfI 24 GCAnnnnnnTGCnnnnnnnnnn_nn' -2 ! >F
-AloI 25 GAACnnnnnnTCCnnnnnnn_nnnnn' -5 ! >F
-AloI 25 GGAnnnnnnGTTCnnnnnnn_nnnnn' -5 ! >F
-AluI 2 AG'CT 0 ! >ABCFGHIJKMNOQRSUVXY
-AlwI 9 GGATCnnnn'n_ 1 ! AclWI,BspPI >N
-;Alw21I 5 G_wGCw'C -4 ! Bbv12I,BsiHKAI >F
-;Alw26I 6 GTCTCn'nnnn_ 4 ! BsmAI,BstMAI >FR
-;Alw44I 1 G'TGCA_C 4 ! ApaLI,VneI >FJMORS
-;AlwFI 6 GAAAynnnnnrTG 0 ? ! >
-AlwNI 6 CAG_nnn'CTG -3 ! CaiI >N
-;Ama87I 1 C'yCGr_G 4 ! AvaI,BmeT110I,BsiHKCI,BsoBI,Eco88I >IV
-;Aor13HI 1 T'CCGG_A 4 ! AccIII,BlfI,BseAI,Bsp13I,BspEI,Kpn2I,MroI >K
-;Aor51HI 3 AGC'GCT 0 ! Eco47III,AfeI >AK
-ApaI 5 G_GGCC'C -4 ! Bsp120I,PspOMI >ABFGIJKMNOQRSUVX
-;ApaBI 8 GCA_nnnnn'TGC -5 ! BstAPI >
-ApaLI 1 G'TGCA_C 4 ! Alw44I,VneI >AKNU
-;ApeKI 1 G'CwG_C 3 ! TseI >N
-ApoI 1 r'AATT_y 4 ! AcsI,XapI >N
-AscI 2 GG'CGCG_CC 4 ! PalAI,SgsI >GN
-AseI 2 AT'TA_AT 2 ! VspI,PshBI >JNO
-;AsiGI 1 A'CCGG_T 4 ! AgeI,BshTI,CspAI,PinAI >IV
-AsiSI 5 GCG_AT'CGC -2 ! SgfI,RgaI >N
-;AspI 4 GACn'n_nGTC 1 ! Tth111I,PflFI,PsyI >M
-;Asp700I 5 GAAnn'nnTTC 0 ! XmnI,MroXI,PdmI >M
-;Asp718I 1 G'GTAC_C 4 ! KpnI,Acc65I >M
-;AspA2I 1 C'CTAG_G 4 ! AvrII,BlnI,XmaJI >IV
-;AspCNI 2 GCCGC 0 ? ! >
-;AspEI 6 GACnn_n'nnGTC -1 ! Eam1105I,AhdI,BmeRI,DriI,EclHKI >M
-;AspLEI 3 G_CG'C -2 ! HhaI,BstHHI,CfoI,Hin6I,HinP1I,HspAI >IV
-;AspS9I 1 G'GnC_C 3 ! BmgT120I,Cfr13I,Sau96I >IV
-;AssI 3 AGT'ACT 0 ! ScaI,BmcAI,ZrmI >U
-;AsuI 1 G'GnC_C 3 ! AspS9I,BmgT120I,Cfr13I,Sau96I >
-;AsuII 2 TT'CG_AA 2 ! Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI >C
-;AsuC2I 2 CC's_GG 1 ! BcnI,BpuMI,NciI >I
-;AsuHPI 13 GGTGAnnnnnnn_n' -1 ! HphI >IV
-;AsuNHI 1 G'CTAG_C 4 ! NheI,BmtI >IV
-AvaI 1 C'yCGr_G 4 ! Ama87I,BmeT110I,BsiHKCI,BsoBI,Eco88I >ABGJKMNORSUX
-AvaII 1 G'GwC_C 3 ! Bme18I,Eco47I,SinI,VpaK11BI >AGJKMNRSY
-;AvaIII 3 ATGCAT 0 ? ! EcoT22I,Mph1103I,NsiI,Zsp2I >
-;AviII 3 TGC'GCA 0 ! Acc16I,FspI,NsbI >M
-AvrII 1 C'CTAG_G 4 ! AspA2I,BlnI,XmaJI >N
-;AxyI 2 CC'TnA_GG 3 ! Bse21I,Bsu36I,Eco81I >J
-BaeI 23 ACnnnnGTAyCnnnnnnn_nnnnn' -5 ! >N
-BaeI 26 GrTACnnnnGTnnnnnnnnnn_nnnnn' -5 ! >N
-;BalI 3 TGG'CCA 0 ! MlsI,MluNI,MscI,Msp20I >AJKR
-BamHI 1 G'GATC_C 4 ! >ABCFGHIJKMNOQRSUVXY
-BanI 1 G'GyrC_C 4 ! AccB1I,BshNI,BspT107I >NORU
-BanII 5 G_rGCy'C -4 ! Eco24I,EcoT38I,FriOI >AGKMNOQRSX
-;BanIII 2 AT'CG_AT 2 ! ClaI,Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI >O
-;BauI 1 C'ACGA_G 4 ! BssSI,Bst2BI >F
-BbeI 5 G_GCGC'C -4 ! NarI,DinI,EgeI,EheI,KasI,Mly113I,SfoI >AK
-;Bbr7I 13 GAAGACnnnnnnn'nnnn_ 4 ! BbsI,BpiI,BpuAI,BstV2I >
-;BbrPI 3 CAC'GTG 0 ! PmaCI,AcvI,Eco72I,PmlI,PspCI >MO
-BbsI 8 GAAGACnn'nnnn_ 4 ! BpiI,BpuAI,BstV2I >N
-;BbuI 5 G_CATG'C -4 ! SphI,PaeI >R
-BbvI 13 GCAGCnnnnnnnn'nnnn_ 4 ! BseXI,BstV1I >N
-;BbvII 8 GAAGACnn'nnnn_ 4 ! BbsI,BpiI,BpuAI,BstV2I >
-;Bbv12I 5 G_wGCw'C -4 ! Alw21I,BsiHKAI >IV
-BbvCI 2 CC'TCA_GC 3 ! >N
-BccI 9 CCATCnnnn'n_ 1 ! >N
-;Bce83I 22 CTTGAGnnnnnnnnnnnnnn_nn' -2 ! BpuEI >
-BceAI 17 ACGGCnnnnnnnnnnnn'nn_ 2 ! >N
-;BcefI 17 ACGGCnnnnnnnnnnnn'n_ 1 ! BceAI >
-BcgI 24 CGAnnnnnnTGCnnnnnnnnnn_nn' -2 ! >N
-BcgI 24 GCAnnnnnnTCGnnnnnnnnnn_nn' -2 ! >N
-BciVI 12 GTATCCnnnnn_n' -1 ! BfuI >N
-BclI 1 T'GATC_A 4 ! FbaI,Ksp22I >CFGJMNORSUY
-;BcnI 2 CC's_GG 1 ! AsuC2I,BpuMI,NciI >FK
-;BcuI 1 A'CTAG_T 4 ! SpeI,AhlI >F
-BdaI 24 TGAnnnnnnTCAnnnnnnnnnn_nn' -2 ! >F
-;BetI 1 w'CCGG_w 4 ! BsaWI >
-BfaI 1 C'TA_G 2 ! MaeI,FspBI,XspI >N
-;BfiI 11 ACTGGGnnnn_n' -1 ! BmrI,BmuI >F
-;BfmI 1 C'TryA_G 4 ! BpcI,BstSFI,SfcI >F
-;BfrI 1 C'TTAA_G 4 ! AflII,BspTI,Bst98I,MspCI,Vha464I >MO
-;BfuI 12 GTATCCnnnnn_n' -1 ! BciVI >F
-;BfuAI 10 ACCTGCnnnn'nnnn_ 4 ! BspMI,Acc36I,BveI >N
-;BfuCI 0 'GATC_ 4 ! MboI,Bsp143I,BssMI,BstKTI,BstMBI,DpnII,Kzo9I,NdeII,Sau3AI >N
-BglI 7 GCCn_nnn'nGGC -3 ! >ACFGHIJKMNOQRSUVXY
-BglII 1 A'GATC_T 4 ! >ABCFGHIJKMNOQRSUVXY
-;BinI 9 GGATCnnnn'n_ 1 ! AclWI,AlwI,BspPI >
-BisI 2 GC'n_GC 1 ! >I
-;BlfI 1 T'CCGG_A 4 ! AccIII,Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI >U
-;BlnI 1 C'CTAG_G 4 ! AvrII,AspA2I,XmaJI >AKMS
-BlpI 2 GC'TnA_GC 3 ! Bpu1102I,Bsp1720I,CelII >N
-;BmcAI 3 AGT'ACT 0 ! ScaI,AssI,ZrmI >V
-;Bme18I 1 G'GwC_C 3 ! AvaII,Eco47I,SinI,VpaK11BI >IV
-;Bme1390I 2 CC'n_GG 1 ! ScrFI,BmrFI,BssKI,BstSCI,MspR9I,StyD4I >F
-Bme1580I 5 G_kGCm'C -4 ! BseSI >N
-;BmeRI 6 GACnn_n'nnGTC -1 ! Eam1105I,AhdI,AspEI,DriI,EclHKI >V
-BmeT110I 2 Cy'CG_rG 2 ! AvaI,Ama87I,BsiHKCI,BsoBI,Eco88I >K
-;BmgI 3 GkGCCC 0 ? ! >
-BmgBI 3 CAC'GTC 0 ! BtrI,AjiI >N
-BmgT120I 2 GG'n_CC 1 ! AspS9I,Cfr13I,Sau96I >K
-;BmiI 3 GGn'nCC 0 ! NlaIV,BspLI,PspN4I >V
-BmrI 11 ACTGGGnnnn_n' -1 ! BfiI,BmuI >N
-;BmrFI 2 CC'n_GG 1 ! ScrFI,Bme1390I,BssKI,BstSCI,MspR9I,StyD4I >V
-BmtI 5 G_CTAG'C -4 ! NheI,AsuNHI >INV
-;BmuI 11 ACTGGGnnnn_n' -1 ! BfiI,BmrI >I
-;BoxI 5 GACnn'nnGTC 0 ! PshAI,BstPAI >F
-;BpcI 1 C'TryA_G 4 ! BfmI,BstSFI,SfcI >U
-;BpiI 8 GAAGACnn'nnnn_ 4 ! BbsI,BpuAI,BstV2I >F
-BplI 24 GAGnnnnnCTCnnnnnnnn_nnnnn' -5 ! >F
-BpmI 22 CTGGAGnnnnnnnnnnnnnn_nn' -2 ! GsuI >IN
-;BptI 2 CC'w_GG 1 ! EcoRII,AjnI,BseBI,BstNI,BstOI,Bst2UI,MvaI,Psp6I,PspGI >U
-Bpu10I 2 CC'TnA_GC 3 ! >FINV
-;Bpu14I 2 TT'CG_AA 2 ! AsuII,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI >IV
-;Bpu1102I 2 GC'TnA_GC 3 ! BlpI,Bsp1720I,CelII >AFK
-;BpuAI 8 GAAGACnn'nnnn_ 4 ! BbsI,BpiI,BstV2I >M
-BpuEI 22 CTTGAGnnnnnnnnnnnnnn_nn' -2 ! >N
-;BpuMI 2 CC's_GG 1 ! AsuC2I,BcnI,NciI >V
-;BpvUI 4 CG_AT'CG -2 ! PvuI,MvrI,Ple19I >V
-BsaI 7 GGTCTCn'nnnn_ 4 ! Eco31I,Bso31I,BspTNI >N
-;Bsa29I 2 AT'CG_AT 2 ! ClaI,BanIII,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI >I
-BsaAI 3 yAC'GTr 0 ! BstBAI,Ppu21I >N
-BsaBI 5 GATnn'nnATC 0 ! Bse8I,BseJI,MamI >N
-BsaHI 2 Gr'CG_yC 2 ! AcyI,BssNI,BstACI,Hin1I,Hsp92I >N
-BsaJI 1 C'CnnG_G 4 ! BseDI,BssECI >N
-;BsaMI 7 GAATG_Cn' -2 ! BsmI,Mva1269I,PctI >GR
-BsaWI 1 w'CCGG_w 4 ! >N
-BsaXI 21 ACnnnnnCTCCnnnnnnn_nnn' -3 ! >N
-BsaXI 23 GGAGnnnnnGTnnnnnnnnn_nnn' -3 ! >N
-;BsbI 3 CAACAC 0 ? ! >
-;Bsc4I 7 CCnn_nnn'nnGG -3 ! BsiYI,AfiI,BseLI,BslI >I
-;BscAI 9 GCATCnnnn'nn_ 2 ! SfaNI,LweI >
-;BscGI 2 CCCGT 0 ? ! >
-;Bse1I 6 ACTG_Gn' -2 ! BsrI,BseNI,BsrSI >IV
-;Bse8I 5 GATnn'nnATC 0 ! BsaBI,BseJI,MamI >IV
-;Bse21I 2 CC'TnA_GG 3 ! AxyI,Bsu36I,Eco81I >IV
-;Bse118I 1 r'CCGG_y 4 ! Cfr10I,BsrFI,BssAI >IV
-;BseAI 1 T'CCGG_A 4 ! AccIII,Aor13HI,BlfI,Bsp13I,BspEI,Kpn2I,MroI >CM
-;BseBI 2 CC'w_GG 1 ! EcoRII,AjnI,BptI,BstNI,BstOI,Bst2UI,MvaI,Psp6I,PspGI >C
-;BseCI 2 AT'CG_AT 2 ! ClaI,BanIII,Bsa29I,BshVI,BspDI,BspXI,Bsu15I,BsuTUI >C
-;BseDI 1 C'CnnG_G 4 ! BsaJI,BssECI >F
-;Bse3DI 8 GCAATG_nn' -2 ! BsrDI,BseMI >IV
-;BseGI 7 GGATG_nn' -2 ! FokI,BstF5I,BtsCI >F
-;BseJI 5 GATnn'nnATC 0 ! BsaBI,Bse8I,MamI >F
-;BseLI 7 CCnn_nnn'nnGG -3 ! BsiYI,AfiI,Bsc4I,BslI >F
-;BseMI 8 GCAATG_nn' -2 ! BsrDI,Bse3DI >F
-BseMII 15 CTCAGnnnnnnnn_nn' -2 ! BspCNI >F
-;BseNI 6 ACTG_Gn' -2 ! BsrI,Bse1I,BsrSI >FG
-;BsePI 1 G'CGCG_C 4 ! BssHII,PauI >IV
-BseRI 16 GAGGAGnnnnnnnn_nn' -2 ! >N
-;BseSI 5 G_kGCm'C -4 ! Bme1580I >F
-;BseXI 13 GCAGCnnnnnnnn'nnnn_ 4 ! BbvI,BstV1I >F
-;BseX3I 1 C'GGCC_G 4 ! BstZI,EagI,EclXI,Eco52I >IV
-BseYI 1 C'CCAG_C 4 ! >N
-BsgI 22 GTGCAGnnnnnnnnnnnnnn_nn' -2 ! >N
-;Bsh1236I 2 CG'CG 0 ! AccII,BstFNI,BstUI,MvnI >F
-;Bsh1285I 4 CG_ry'CG -2 ! BsiEI,BstMCI >F
-;BshFI 2 GG'CC 0 ! HaeIII,BsnI,BspANI,BsuRI,PhoI >C
-;BshNI 1 G'GyrC_C 4 ! AccB1I,BanI,BspT107I >F
-;BshTI 1 A'CCGG_T 4 ! AgeI,AsiGI,CspAI,PinAI >F
-;BshVI 2 AT'CG_AT 2 ! ClaI,BanIII,Bsa29I,BseCI,BspDI,BspXI,Bsu15I,BsuTUI >V
-;BsiI 1 C'ACGA_G 4 ! BauI,BssSI,Bst2BI >
-BsiEI 4 CG_ry'CG -2 ! Bsh1285I,BstMCI >N
-BsiHKAI 5 G_wGCw'C -4 ! Alw21I,Bbv12I >N
-;BsiHKCI 1 C'yCGr_G 4 ! AvaI,Ama87I,BmeT110I,BsoBI,Eco88I >QX
-;BsiSI 1 C'CG_G 2 ! HpaII,HapII,MspI >C
-BsiWI 1 C'GTAC_G 4 ! Pfl23II,PspLI >MNO
-;BsiYI 7 CCnn_nnn'nnGG -3 ! AfiI,Bsc4I,BseLI,BslI >M
-BslI 7 CCnn_nnn'nnGG -3 ! BsiYI,AfiI,Bsc4I,BseLI >GN
-;BslFI 15 GGGACnnnnnnnnnn'nnnn_ 4 ! BsmFI,FaqI >I
-BsmI 7 GAATG_Cn' -2 ! BsaMI,Mva1269I,PctI >JMNOS
-BsmAI 6 GTCTCn'nnnn_ 4 ! Alw26I,BstMAI >N
-BsmBI 7 CGTCTCn'nnnn_ 4 ! Esp3I >N
-BsmFI 15 GGGACnnnnnnnnnn'nnnn_ 4 ! BslFI,FaqI >N
-;BsnI 2 GG'CC 0 ! HaeIII,BshFI,BspANI,BsuRI,PhoI >V
-;Bso31I 7 GGTCTCn'nnnn_ 4 ! Eco31I,BsaI,BspTNI >IV
-;BsoBI 1 C'yCGr_G 4 ! AvaI,Ama87I,BmeT110I,BsiHKCI,Eco88I >N
-;Bsp13I 1 T'CCGG_A 4 ! AccIII,Aor13HI,BlfI,BseAI,BspEI,Kpn2I,MroI >IV
-;Bsp19I 1 C'CATG_G 4 ! NcoI >IV
-;Bsp24I 24 GACnnnnnnTGGnnnnnnn_nnnnn' -5 ! >
-;Bsp24I 25 CCAnnnnnnGTCnnnnnnnn_nnnnn' -5 ! >
-;Bsp68I 3 TCG'CGA 0 ! NruI,BtuMI >F
-;Bsp119I 2 TT'CG_AA 2 ! AsuII,Bpu14I,BspT104I,BstBI,Csp45I,NspV,SfuI >F
-;Bsp120I 1 G'GGCC_C 4 ! ApaI,PspOMI >FG
-;Bsp143I 0 'GATC_ 4 ! MboI,BfuCI,BssMI,BstKTI,BstMBI,DpnII,Kzo9I,NdeII,Sau3AI >F
-;Bsp143II 5 r_GCGC'y -4 ! HaeII,BstH2I >F
-Bsp1286I 5 G_dGCh'C -4 ! SduI,MhlI >JKNR
-;Bsp1407I 1 T'GTAC_A 4 ! BsrGI,BstAUI,SspBI >FK
-;Bsp1720I 2 GC'TnA_GC 3 ! BlpI,Bpu1102I,CelII >IV
-;BspACI 1 C'CG_C 2 ! AciI,SsiI >I
-;BspANI 2 GG'CC 0 ! HaeIII,BshFI,BsnI,BsuRI,PhoI >X
-BspCNI 14 CTCAGnnnnnnn_nn' -2 ! BseMII >N
-;BspDI 2 AT'CG_AT 2 ! ClaI,BanIII,Bsa29I,BseCI,BshVI,BspXI,Bsu15I,BsuTUI >N
-BspEI 1 T'CCGG_A 4 ! AccIII,Aor13HI,BlfI,BseAI,Bsp13I,Kpn2I,MroI >N
-;BspGI 3 CTGGAC 0 ? ! >
-BspHI 1 T'CATG_A 4 ! PagI,RcaI >N
-;BspLI 3 GGn'nCC 0 ! NlaIV,BmiI,PspN4I >F
-;BspLU11I 1 A'CATG_T 4 ! PciI,PscI >M
-BspMI 10 ACCTGCnnnn'nnnn_ 4 ! Acc36I,BfuAI,BveI >N
-;BspMII 1 T'CCGG_A 4 ! AccIII,Aor13HI,BlfI,BseAI,Bsp13I,BspEI,Kpn2I,MroI >
-;BspMAI 5 C_TGCA'G -4 ! PstI >X
-;BspNCI 2 CCAGA 0 ? ! >
-;BspPI 9 GGATCnnnn'n_ 1 ! AclWI,AlwI >F
-;BspTI 1 C'TTAA_G 4 ! AflII,BfrI,Bst98I,MspCI,Vha464I >F
-;BspT104I 2 TT'CG_AA 2 ! AsuII,Bpu14I,Bsp119I,BstBI,Csp45I,NspV,SfuI >K
-;BspT107I 1 G'GyrC_C 4 ! AccB1I,BanI,BshNI >K
-;BspTNI 7 GGTCTCn'nnnn_ 4 ! Eco31I,BsaI,Bso31I >X
-;BspXI 2 AT'CG_AT 2 ! ClaI,BanIII,Bsa29I,BseCI,BshVI,BspDI,Bsu15I,BsuTUI >G
-BsrI 6 ACTG_Gn' -2 ! Bse1I,BseNI,BsrSI >N
-BsrBI 3 CCG'CTC 0 ! AccBSI,MbiI >N
-BsrDI 8 GCAATG_nn' -2 ! Bse3DI,BseMI >N
-BsrFI 1 r'CCGG_y 4 ! Cfr10I,Bse118I,BssAI >N
-BsrGI 1 T'GTAC_A 4 ! Bsp1407I,BstAUI,SspBI >N
-;BsrSI 6 ACTG_Gn' -2 ! BsrI,Bse1I,BseNI >R
-;BssAI 1 r'CCGG_y 4 ! Cfr10I,Bse118I,BsrFI >C
-;BssECI 1 C'CnnG_G 4 ! BsaJI,BseDI >I
-BssHII 1 G'CGCG_C 4 ! BsePI,PauI >AJKMNOQRSX
-;BssKI 0 'CCnGG_ 5 ! ScrFI,Bme1390I,BmrFI,BstSCI,MspR9I,StyD4I >N
-;BssMI 0 'GATC_ 4 ! MboI,BfuCI,Bsp143I,BstKTI,BstMBI,DpnII,Kzo9I,NdeII,Sau3AI >V
-;BssNI 2 Gr'CG_yC 2 ! AcyI,BsaHI,BstACI,Hin1I,Hsp92I >V
-;BssNAI 3 GTA'TAC 0 ! Bst1107I,BstZ17I >IV
-BssSI 1 C'ACGA_G 4 ! BauI,Bst2BI >N
-;BssT1I 1 C'CwwG_G 4 ! StyI,Eco130I,EcoT14I,ErhI >IV
-;Bst6I 7 CTCTTCn'nnn_ 3 ! Ksp632I,Eam1104I,EarI >IV
-;Bst98I 1 C'TTAA_G 4 ! AflII,BfrI,BspTI,MspCI,Vha464I >R
-;Bst1107I 3 GTA'TAC 0 ! BssNAI,BstZ17I >FKM
-;BstACI 2 Gr'CG_yC 2 ! AcyI,BsaHI,BssNI,Hin1I,Hsp92I >I
-BstAPI 7 GCAn_nnn'nTGC -3 ! >IN
-;BstAUI 1 T'GTAC_A 4 ! Bsp1407I,BsrGI,SspBI >IV
-BstBI 2 TT'CG_AA 2 ! AsuII,Bpu14I,Bsp119I,BspT104I,Csp45I,NspV,SfuI >N
-;Bst2BI 1 C'ACGA_G 4 ! BauI,BssSI >IV
-;BstBAI 3 yAC'GTr 0 ! BsaAI,Ppu21I >IV
-;Bst4CI 3 AC_n'GT -1 ! HpyCH4III,TaaI >IV
-;BstC8I 3 GCn'nGC 0 ! Cac8I >I
-;BstDEI 1 C'TnA_G 3 ! DdeI,HpyF3I >IV
-;BstDSI 1 C'CryG_G 4 ! BtgI >IV
-BstEII 1 G'GTnAC_C 5 ! BstPI,Eco91I,EcoO65I,PspEI >GHJMNORSU
-;BstENI 5 CCTnn'n_nnAGG 1 ! EcoNI,XagI >IV
-BstF5I 7 GGATG_nn' -2 ! FokI,BseGI,BtsCI >INV
-;BstFNI 2 CG'CG 0 ! AccII,Bsh1236I,BstUI,MvnI >IV
-;BstH2I 5 r_GCGC'y -4 ! HaeII,Bsp143II >IV
-;BstHHI 3 G_CG'C -2 ! HhaI,AspLEI,CfoI,Hin6I,HinP1I,HspAI >IV
-BstKTI 3 G_AT'C -2 ! MboI,BfuCI,Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,NdeII,Sau3AI >I
-;BstMAI 6 GTCTCn'nnnn_ 4 ! BsmAI,Alw26I >IV
-;BstMBI 0 'GATC_ 4 ! MboI,BfuCI,Bsp143I,BssMI,BstKTI,DpnII,Kzo9I,NdeII,Sau3AI >IV
-;BstMCI 4 CG_ry'CG -2 ! Bsh1285I,BsiEI >IV
-;BstMWI 7 GCnn_nnn'nnGC -3 ! MwoI,HpyF10VI >I
-BstNI 2 CC'w_GG 1 ! EcoRII,AjnI,BptI,BseBI,BstOI,Bst2UI,MvaI,Psp6I,PspGI >N
-;BstNSI 5 r_CATG'y -4 ! NspI,XceI >IV
-;BstOI 2 CC'w_GG 1 ! EcoRII,AjnI,BptI,BseBI,BstNI,Bst2UI,MvaI,Psp6I,PspGI >R
-;BstPI 1 G'GTnAC_C 5 ! BstEII,Eco91I,EcoO65I,PspEI >K
-;BstPAI 5 GACnn'nnGTC 0 ! PshAI,BoxI >IV
-;BstSCI 0 'CCnGG_ 5 ! ScrFI,Bme1390I,BmrFI,BssKI,MspR9I,StyD4I >I
-;BstSFI 1 C'TryA_G 4 ! BfmI,BpcI,SfcI >I
-;BstSNI 3 TAC'GTA 0 ! SnaBI,Eco105I >IV
-BstUI 2 CG'CG 0 ! AccII,Bsh1236I,BstFNI,MvnI >N
-;Bst2UI 2 CC'w_GG 1 ! EcoRII,AjnI,BptI,BseBI,BstNI,BstOI,MvaI,Psp6I,PspGI >IV
-;BstV1I 13 GCAGCnnnnnnnn'nnnn_ 4 ! BbvI,BseXI >I
-;BstV2I 8 GAAGACnn'nnnn_ 4 ! BbsI,BpiI,BpuAI >IV
-BstXI 8 CCAn_nnnn'nTGG -4 ! >AFGHIJKMNOQRVX
-;BstX2I 1 r'GATC_y 4 ! XhoII,BstYI,MflI,PsuI >IV
-BstYI 1 r'GATC_y 4 ! XhoII,BstX2I,MflI,PsuI >N
-;BstZI 1 C'GGCC_G 4 ! BseX3I,EagI,EclXI,Eco52I >R
-BstZ17I 3 GTA'TAC 0 ! BssNAI,Bst1107I >N
-;Bsu15I 2 AT'CG_AT 2 ! ClaI,BanIII,Bsa29I,BseCI,BshVI,BspDI,BspXI,BsuTUI >F
-Bsu36I 2 CC'TnA_GG 3 ! AxyI,Bse21I,Eco81I >NR
-;BsuRI 2 GG'CC 0 ! HaeIII,BshFI,BsnI,BspANI,PhoI >FI
-;BsuTUI 2 AT'CG_AT 2 ! ClaI,BanIII,Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I >X
-BtgI 1 C'CryG_G 4 ! BstDSI >N
-BtgZI 16 GCGATGnnnnnnnnnn'nnnn_ 4 ! >N
-;BthCI 4 G_CnG'C -3 ! Fnu4HI,Fsp4HI,ItaI,SatI >
-;BtrI 3 CAC'GTC 0 ! AjiI,BmgBI >IV
-BtsI 8 GCAGTG_nn' -2 ! >N
-;BtsCI 7 GGATG_nn' -2 ! FokI,BseGI,BstF5I >N
-;BtuMI 3 TCG'CGA 0 ! NruI,Bsp68I >V
-;BveI 10 ACCTGCnnnn'nnnn_ 4 ! BspMI,Acc36I,BfuAI >F
-Cac8I 3 GCn'nGC 0 ! BstC8I >N
-;CaiI 6 CAG_nnn'CTG -3 ! AlwNI >F
-;CauII 2 CC's_GG 1 ! AsuC2I,BcnI,BpuMI,NciI >
-;CciNI 2 GC'GGCC_GC 4 ! NotI >IV
-;CdiI 4 CATC'G 0 ! >
-;CelII 2 GC'TnA_GC 3 ! BlpI,Bpu1102I,Bsp1720I >M
-;CfoI 3 G_CG'C -2 ! HhaI,AspLEI,BstHHI,Hin6I,HinP1I,HspAI >GMRS
-;CfrI 1 y'GGCC_r 4 ! EaeI >F
-;Cfr9I 1 C'CCGG_G 4 ! SmaI,XmaI,XmaCI >FO
-;Cfr10I 1 r'CCGG_y 4 ! Bse118I,BsrFI,BssAI >FGKO
-;Cfr13I 1 G'GnC_C 3 ! AspS9I,BmgT120I,Sau96I >AFKO
-;Cfr42I 4 CC_GC'GG -2 ! SacII,KspI,Sfr303I,SgrBI,SstII >F
-;ChaI 4 _GATC' -4 ! MboI,BfuCI,Bsp143I,BssMI,BstKTI,BstMBI,DpnII,Kzo9I,NdeII,Sau3AI >
-;CjeI 26 CCAnnnnnnGTnnnnnnnnn_nnnnnn' -6 ! >
-;CjeI 25 ACnnnnnnTGGnnnnnnnn_nnnnnn' -6 ! >
-;CjeNII 5 GAGnnnnnGT 0 ? ! >
-;CjePI 26 CCAnnnnnnnTCnnnnnnnn_nnnnnn' -6 ! >
-;CjePI 25 GAnnnnnnnTGGnnnnnnn_nnnnnn' -6 ! >
-;CjuI 5 CAynnnnnrTG 0 ? ! >
-;CjuII 5 CAynnnnnCTC 0 ? ! >
-ClaI 2 AT'CG_AT 2 ! BanIII,Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI >ABHKMNRSU
-;CpoI 2 CG'GwC_CG 3 ! RsrII,CspI,Rsr2I >AFK
-;CseI 10 GACGCnnnnn'nnnnn_ 5 ! HgaI >F
-;CspI 2 CG'GwC_CG 3 ! RsrII,CpoI,Rsr2I >OR
-Csp6I 1 G'TA_C 2 ! RsaI,AfaI >F
-;Csp45I 2 TT'CG_AA 2 ! AsuII,Bpu14I,Bsp119I,BspT104I,BstBI,NspV,SfuI >OR
-;CspAI 1 A'CCGG_T 4 ! AgeI,AsiGI,BshTI,PinAI >C
-CspCI 24 CAAnnnnnGTGGnnnnnnnnnn_nn' -2 ! >N
-CspCI 25 CCACnnnnnTTGnnnnnnnnnnn_nn' -2 ! >N
-;CstMI 26 AAGGAGnnnnnnnnnnnnnnnnnn_nn' -2 ! >
-CviAII 1 C'AT_G 2 ! NlaIII,FaeI,FatI,Hin1II,Hsp92II >N
-CviJI 2 rG'Cy 0 ! >VX
-;CviRI 2 TG'CA 0 ! HpyCH4V >
-DdeI 1 C'TnA_G 3 ! BstDEI,HpyF3I >BGMNORS
-;DinI 3 GGC'GCC 0 ! NarI,BbeI,EgeI,EheI,KasI,Mly113I,SfoI >V
-DpnI 2 GA'TC 0 ! MalI >BEFGMNRS
-;DpnII 0 'GATC_ 4 ! MboI,BfuCI,Bsp143I,BssMI,BstKTI,BstMBI,Kzo9I,NdeII,Sau3AI >N
-DraI 3 TTT'AAA 0 ! >ABFGIJKMNOQRSUVXY
-;DraII 2 rG'GnC_Cy 3 ! EcoO109I >GM
-DraIII 6 CAC_nnn'GTG -3 ! AdeI >GIMNV
-DrdI 7 GACnn_nn'nnGTC -2 ! AasI,DseDI >N
-;DrdII 3 GAACCA 0 ? ! >
-;DriI 6 GACnn_n'nnGTC -1 ! Eam1105I,AhdI,AspEI,BmeRI,EclHKI >I
-;DsaI 1 C'CryG_G 4 ! BstDSI,BtgI >
-;DseDI 7 GACnn_nn'nnGTC -2 ! DrdI,AasI >I
-EaeI 1 y'GGCC_r 4 ! CfrI >AKMN
-EagI 1 C'GGCC_G 4 ! BseX3I,BstZI,EclXI,Eco52I >GN
-;Eam1104I 7 CTCTTCn'nnn_ 3 ! Ksp632I,Bst6I,EarI >F
-;Eam1105I 6 GACnn_n'nnGTC -1 ! AhdI,AspEI,BmeRI,DriI,EclHKI >FK
-EarI 7 CTCTTCn'nnn_ 3 ! Ksp632I,Bst6I,Eam1104I >N
-EciI 17 GGCGGAnnnnnnnnn_nn' -2 ! >N
-;Ecl136II 3 GAG'CTC 0 ! SacI,EcoICRI,Psp124BI,SstI >F
-;EclHKI 6 GACnn_n'nnGTC -1 ! Eam1105I,AhdI,AspEI,BmeRI,DriI >R
-;EclXI 1 C'GGCC_G 4 ! BseX3I,BstZI,EagI,Eco52I >MS
-;Eco24I 5 G_rGCy'C -4 ! BanII,EcoT38I,FriOI >F
-;Eco31I 7 GGTCTCn'nnnn_ 4 ! BsaI,Bso31I,BspTNI >F
-;Eco32I 3 GAT'ATC 0 ! EcoRV >F
-;Eco47I 1 G'GwC_C 3 ! AvaII,Bme18I,SinI,VpaK11BI >FO
-;Eco47III 3 AGC'GCT 0 ! AfeI,Aor51HI >FGMOR
-;Eco52I 1 C'GGCC_G 4 ! BseX3I,BstZI,EagI,EclXI >FKO
-;Eco57I 22 CTGAAGnnnnnnnnnnnnnn_nn' -2 ! AcuI >F
-;Eco72I 3 CAC'GTG 0 ! PmaCI,AcvI,BbrPI,PmlI,PspCI >F
-;Eco81I 2 CC'TnA_GG 3 ! AxyI,Bse21I,Bsu36I >AFKO
-;Eco88I 1 C'yCGr_G 4 ! AvaI,Ama87I,BmeT110I,BsiHKCI,BsoBI >F
-;Eco91I 1 G'GTnAC_C 5 ! BstEII,BstPI,EcoO65I,PspEI >F
-;Eco105I 3 TAC'GTA 0 ! SnaBI,BstSNI >FO
-;Eco130I 1 C'CwwG_G 4 ! StyI,BssT1I,EcoT14I,ErhI >F
-;Eco147I 3 AGG'CCT 0 ! StuI,AatI,PceI,SseBI >F
-;EcoHI 0 'CCsGG_ 5 ! AsuC2I,BcnI,BpuMI,NciI >
-EcoICRI 3 GAG'CTC 0 ! SacI,Ecl136II,Psp124BI,SstI >IRV
-Eco57MI 22 CTGrAGnnnnnnnnnnnnnn_nn' -2 ! >F
-EcoNI 5 CCTnn'n_nnAGG 1 ! BstENI,XagI >N
-;EcoO65I 1 G'GTnAC_C 5 ! BstEII,BstPI,Eco91I,PspEI >K
-EcoO109I 2 rG'GnC_Cy 3 ! DraII >AFJKN
-EcoRI 1 G'AATT_C 4 ! >ABCFGHIJKMNOQRSUVXY
-;EcoRII 0 'CCwGG_ 5 ! AjnI,BptI,BseBI,BstNI,BstOI,Bst2UI,MvaI,Psp6I,PspGI >FJMOS
-EcoRV 3 GAT'ATC 0 ! Eco32I >ABCGHIJKMNOQRSUVXY
-;EcoT14I 1 C'CwwG_G 4 ! StyI,BssT1I,Eco130I,ErhI >K
-;EcoT22I 5 A_TGCA'T -4 ! Mph1103I,NsiI,Zsp2I >AKO
-;EcoT38I 5 G_rGCy'C -4 ! BanII,Eco24I,FriOI >J
-;EgeI 3 GGC'GCC 0 ! NarI,BbeI,DinI,EheI,KasI,Mly113I,SfoI >I
-;EheI 3 GGC'GCC 0 ! NarI,BbeI,DinI,EgeI,KasI,Mly113I,SfoI >FO
-;ErhI 1 C'CwwG_G 4 ! StyI,BssT1I,Eco130I,EcoT14I >IV
-;EsaBC3I 2 TC'GA 0 ! TaqI >
-;EspI 2 GC'TnA_GC 3 ! BlpI,Bpu1102I,Bsp1720I,CelII >
-;Esp3I 7 CGTCTCn'nnnn_ 4 ! BsmBI >F
-;FaeI 4 _CATG' -4 ! NlaIII,CviAII,FatI,Hin1II,Hsp92II >I
-FalI 24 AAGnnnnnCTTnnnnnnnn_nnnnn' -5 ! >I
-;FaqI 15 GGGACnnnnnnnnnn'nnnn_ 4 ! BslFI,BsmFI >F
-FatI 0 'CATG_ 4 ! NlaIII,CviAII,FaeI,Hin1II,Hsp92II >IN
-FauI 9 CCCGCnnnn'nn_ 2 ! SmuI >IN
-;FauNDI 2 CA'TA_TG 2 ! NdeI >IV
-;FbaI 1 T'GATC_A 4 ! BclI,Ksp22I >AK
-;FblI 2 GT'mk_AC 2 ! AccI,XmiI >IV
-;FinI 2 GGGAC 0 ? ! BslFI,BsmFI,FaqI >
-;FmuI 4 G_GnC'C -3 ! AspS9I,BmgT120I,Cfr13I,Sau96I >
-;FnuDII 2 CG'CG 0 ! AccII,Bsh1236I,BstFNI,BstUI,MvnI >
-Fnu4HI 2 GC'n_GC 1 ! Fsp4HI,ItaI,SatI >N
-FokI 14 GGATGnnnnnnnnn'nnnn_ 4 ! BseGI,BstF5I,BtsCI >AGIJKMNRV
-;FriOI 5 G_rGCy'C -4 ! BanII,Eco24I,EcoT38I >IV
-FseI 6 GG_CCGG'CC -4 ! >AKN
-FspI 3 TGC'GCA 0 ! Acc16I,AviII,NsbI >JNO
-FspAI 4 rTGC'GCAy 0 ! >F
-;FspBI 1 C'TA_G 2 ! MaeI,BfaI,XspI >F
-;Fsp4HI 2 GC'n_GC 1 ! Fnu4HI,ItaI,SatI >I
-;GdiII 1 C'GGCC_r 4 ! >
-;GsuI 22 CTGGAGnnnnnnnnnnnnnn_nn' -2 ! BpmI >F
-;HaeI 3 wGG'CCw 0 ! >
-HaeII 5 r_GCGC'y -4 ! Bsp143II,BstH2I >GJKMNORS
-HaeIII 2 GG'CC 0 ! BshFI,BsnI,BspANI,BsuRI,PhoI >ABGHIJKMNOQRSUXY
-;HaeIV 25 GAynnnnnrTCnnnnnnnnn_nnnnn' -5 ! >
-;HaeIV 24 GAynnnnnrTCnnnnnnn_nnnnnn' -6 ! >
-;HapII 1 C'CG_G 2 ! HpaII,BsiSI,MspI >AK
-HgaI 10 GACGCnnnnn'nnnnn_ 5 ! CseI >IN
-;HgiAI 5 G_wGCw'C -4 ! Alw21I,Bbv12I,BsiHKAI >
-;HgiCI 1 G'GyrC_C 4 ! AccB1I,BanI,BshNI,BspT107I >
-;HgiEII 6 ACCnnnnnnGGT 0 ? ! >
-;HgiJII 5 G_rGCy'C -4 ! BanII,Eco24I,EcoT38I,FriOI >
-HhaI 3 G_CG'C -2 ! AspLEI,BstHHI,CfoI,Hin6I,HinP1I,HspAI >ABFGJKNORUY
-;Hin1I 2 Gr'CG_yC 2 ! AcyI,BsaHI,BssNI,BstACI,Hsp92I >FKO
-;Hin1II 4 _CATG' -4 ! NlaIII,CviAII,FaeI,FatI,Hsp92II >F
-Hin4I 24 GAynnnnnvTCnnnnnnnn_nnnnn' -5 ! >F
-Hin4I 24 GAbnnnnnrTCnnnnnnnn_nnnnn' -5 ! >F
-;Hin4II 2 CCTTC 0 ? ! >
-;Hin6I 1 G'CG_C 2 ! HhaI,AspLEI,BstHHI,CfoI,HinP1I,HspAI >F
-HinP1I 1 G'CG_C 2 ! HhaI,AspLEI,BstHHI,CfoI,Hin6I,HspAI >N
-HincII 3 GTy'rAC 0 ! HindII >ABFGHJKNOQRUXY
-;HindII 3 GTy'rAC 0 ! HincII >IMSV
-HindIII 1 A'AGCT_T 4 ! >ABCFGHIJKMNOQRSUVXY
-HinfI 1 G'AnT_C 3 ! >ABCFGHIJKMNOQRUVXY
-HpaI 3 GTT'AAC 0 ! KspAI >ABCGHIJKMNOQRSUVX
-HpaII 1 C'CG_G 2 ! BsiSI,HapII,MspI >BFGIMNOQRSUVX
-HphI 13 GGTGAnnnnnnn_n' -1 ! AsuHPI >FN
-Hpy8I 3 GTn'nAC 0 ! >F
-Hpy99I 5 _CGwCG' -5 ! >N
-;Hpy178III 2 TC'nn_GA 2 ! Hpy188III >
-Hpy188I 3 TC_n'GA -1 ! >N
-Hpy188III 2 TC'nn_GA 2 ! >N
-;HpyAV 11 CCTTCnnnnn_n' -1 ! >
-HpyCH4III 3 AC_n'GT -1 ! Bst4CI,TaaI >N
-HpyCH4IV 1 A'CG_T 2 ! MaeII,TaiI >N
-HpyCH4V 2 TG'CA 0 ! >N
-;HpyF3I 1 C'TnA_G 3 ! DdeI,BstDEI >F
-;HpyF10VI 7 GCnn_nnn'nnGC -3 ! MwoI,BstMWI >F
-;Hsp92I 2 Gr'CG_yC 2 ! AcyI,BsaHI,BssNI,BstACI,Hin1I >R
-;Hsp92II 4 _CATG' -4 ! NlaIII,CviAII,FaeI,FatI,Hin1II >R
-;HspAI 1 G'CG_C 2 ! HhaI,AspLEI,BstHHI,CfoI,Hin6I,HinP1I >IV
-;ItaI 2 GC'n_GC 1 ! Fnu4HI,Fsp4HI,SatI >M
-KasI 1 G'GCGC_C 4 ! NarI,BbeI,DinI,EgeI,EheI,Mly113I,SfoI >N
-KpnI 5 G_GTAC'C -4 ! Acc65I,Asp718I >ABCFGHIJKMNOQRSUVXY
-;Kpn2I 1 T'CCGG_A 4 ! AccIII,Aor13HI,BlfI,BseAI,Bsp13I,BspEI,MroI >F
-;KspI 4 CC_GC'GG -2 ! SacII,Cfr42I,Sfr303I,SgrBI,SstII >MS
-;Ksp22I 1 T'GATC_A 4 ! BclI,FbaI >IV
-;Ksp632I 7 CTCTTCn'nnn_ 3 ! Bst6I,Eam1104I,EarI >M
-;KspAI 3 GTT'AAC 0 ! HpaI >F
-;Kzo9I 0 'GATC_ 4 ! MboI,BfuCI,Bsp143I,BssMI,BstKTI,BstMBI,DpnII,NdeII,Sau3AI >I
-;LguI 8 GCTCTTCn'nnn_ 3 ! SapI,PciSI >F
-;LpnI 3 rGC'GCy 0 ! HaeII,Bsp143II,BstH2I >
-;LweI 10 GCATCnnnnn'nnnn_ 4 ! SfaNI >F
-;MabI 1 A'CCwGG_T 5 ! SexAI >I
-;MaeI 1 C'TA_G 2 ! BfaI,FspBI,XspI >M
-;MaeII 1 A'CG_T 2 ! HpyCH4IV,TaiI >M
-MaeIII 0 'GTnAC_ 5 ! >M
-;MalI 2 GA'TC 0 ! DpnI >I
-;MamI 5 GATnn'nnATC 0 ! BsaBI,Bse8I,BseJI >M
-;MbiI 3 CCG'CTC 0 ! BsrBI,AccBSI >F
-MboI 0 'GATC_ 4 ! BfuCI,Bsp143I,BssMI,BstKTI,BstMBI,DpnII,Kzo9I,NdeII,Sau3AI >ABCFGKNQRUXY
-MboII 13 GAAGAnnnnnnn_n' -1 ! >AFGIJKNOQRVX
-;McrI 4 CG_ry'CG -2 ! Bsh1285I,BsiEI,BstMCI >
-MfeI 1 C'AATT_G 4 ! MunI >N
-;MflI 1 r'GATC_y 4 ! XhoII,BstX2I,BstYI,PsuI >K
-;MhlI 5 G_dGCh'C -4 ! SduI,Bsp1286I >IV
-;MjaIV 3 GTnnAC 0 ? ! Hpy8I >
-;MlsI 3 TGG'CCA 0 ! BalI,MluNI,MscI,Msp20I >F
-MluI 1 A'CGCG_T 4 ! >ABFGHIJKMNOQRSUVX
-;MluNI 3 TGG'CCA 0 ! BalI,MlsI,MscI,Msp20I >MS
-MlyI 10 GAGTCnnnnn' 0 ! PleI,PpsI,SchI >N
-;Mly113I 2 GG'CG_CC 2 ! NarI,BbeI,DinI,EgeI,EheI,KasI,SfoI >I
-MmeI 26 TCCrACnnnnnnnnnnnnnnnnnn_nn' -2 ! >NX
-MnlI 11 CCTCnnnnnn_n' -1 ! >FGINQVX
-;Mph1103I 5 A_TGCA'T -4 ! EcoT22I,NsiI,Zsp2I >F
-;MroI 1 T'CCGG_A 4 ! AccIII,Aor13HI,BlfI,BseAI,Bsp13I,BspEI,Kpn2I >MO
-;MroNI 1 G'CCGG_C 4 ! NaeI,NgoMIV,PdiI >IV
-;MroXI 5 GAAnn'nnTTC 0 ! XmnI,Asp700I,PdmI >IV
-MscI 3 TGG'CCA 0 ! BalI,MlsI,MluNI,Msp20I >BNO
-MseI 1 T'TA_A 2 ! Tru1I,Tru9I >BN
-MslI 5 CAynn'nnrTG 0 ! SmiMI >N
-;MspI 1 C'CG_G 2 ! HpaII,BsiSI,HapII >AFGHIJKMNOQRSUVXY
-;Msp20I 3 TGG'CCA 0 ! BalI,MlsI,MluNI,MscI >IV
-MspA1I 3 CmG'CkG 0 ! >INRV
-;MspCI 1 C'TTAA_G 4 ! AflII,BfrI,BspTI,Bst98I,Vha464I >C
-;MspR9I 2 CC'n_GG 1 ! ScrFI,Bme1390I,BmrFI,BssKI,BstSCI,StyD4I >I
-;MssI 4 GTTT'AAAC 0 ! PmeI >F
-;MstI 3 TGC'GCA 0 ! Acc16I,AviII,FspI,NsbI >
-;MunI 1 C'AATT_G 4 ! MfeI >FKM
-;MvaI 2 CC'w_GG 1 ! EcoRII,AjnI,BptI,BseBI,BstNI,BstOI,Bst2UI,Psp6I,PspGI >AFGKMOS
-;Mva1269I 7 GAATG_Cn' -2 ! BsmI,BsaMI,PctI >F
-;MvnI 2 CG'CG 0 ! AccII,Bsh1236I,BstFNI,BstUI >M
-;MvrI 4 CG_AT'CG -2 ! PvuI,BpvUI,Ple19I >U
-MwoI 7 GCnn_nnn'nnGC -3 ! BstMWI,HpyF10VI >N
-NaeI 3 GCC'GGC 0 ! MroNI,NgoMIV,PdiI >ACKMNORU
-NarI 2 GG'CG_CC 2 ! BbeI,DinI,EgeI,EheI,KasI,Mly113I,SfoI >GJMNOQRUX
-NciI 2 CC's_GG 1 ! AsuC2I,BcnI,BpuMI >GJNORS
-NcoI 1 C'CATG_G 4 ! Bsp19I >ABCFGHJKMNOQRSUXY
-NdeI 2 CA'TA_TG 2 ! FauNDI >ABFGJKMNRSXY
-;NdeII 0 'GATC_ 4 ! MboI,BfuCI,Bsp143I,BssMI,BstKTI,BstMBI,DpnII,Kzo9I,Sau3AI >GJMRS
-NgoMIV 1 G'CCGG_C 4 ! NaeI,MroNI,PdiI >NR
-NheI 1 G'CTAG_C 4 ! AsuNHI,BmtI >ABFGJKMNORSU
-NlaIII 4 _CATG' -4 ! CviAII,FaeI,FatI,Hin1II,Hsp92II >GN
-NlaIV 3 GGn'nCC 0 ! BmiI,BspLI,PspN4I >GN
-;Nli3877I 5 C_yCGr'G -4 ! AvaI,Ama87I,BmeT110I,BsiHKCI,BsoBI,Eco88I >
-;NmuCI 0 'GTsAC_ 5 ! Tsp45I >F
-NotI 2 GC'GGCC_GC 4 ! CciNI >ABCFGHJKMNOQRSUXY
-NruI 3 TCG'CGA 0 ! Bsp68I,BtuMI >ABCGIJKMNOQRSUX
-;NsbI 3 TGC'GCA 0 ! Acc16I,AviII,FspI >FK
-NsiI 5 A_TGCA'T -4 ! EcoT22I,Mph1103I,Zsp2I >BGHJMNRSU
-NspI 5 r_CATG'y -4 ! BstNSI,XceI >MN
-;NspV 2 TT'CG_AA 2 ! AsuII,Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,SfuI >JO
-;NspBII 3 CmG'CkG 0 ! MspA1I >
-;OliI 5 CACnn'nnGTG 0 ! AleI >F
-;PabI 3 G_TA'C -2 ! RsaI,AfaI,Csp6I >
-PacI 5 TTA_AT'TAA -2 ! >GNO
-;PaeI 5 G_CATG'C -4 ! SphI,BbuI >F
-;PaeR7I 1 C'TCGA_G 4 ! XhoI,Sfr274I,SlaI,StrI,TliI >N
-;PagI 1 T'CATG_A 4 ! BspHI,RcaI >F
-;PalAI 2 GG'CGCG_CC 4 ! AscI,SgsI >I
-PasI 2 CC'CwG_GG 3 ! >F
-;PauI 1 G'CGCG_C 4 ! BsePI,BssHII >F
-;PceI 3 AGG'CCT 0 ! StuI,AatI,Eco147I,SseBI >IV
-PciI 1 A'CATG_T 4 ! BspLU11I,PscI >IN
-;PciSI 8 GCTCTTCn'nnn_ 3 ! SapI,LguI >I
-;PctI 7 GAATG_Cn' -2 ! BsmI,BsaMI,Mva1269I >IV
-;PdiI 3 GCC'GGC 0 ! NaeI,MroNI,NgoMIV >F
-;PdmI 5 GAAnn'nnTTC 0 ! XmnI,Asp700I,MroXI >F
-;PfeI 1 G'AwT_C 3 ! TfiI >F
-;Pfl23II 1 C'GTAC_G 4 ! BsiWI,PspLI >F
-;Pfl1108I 3 TCGTAG 0 ? ! >
-;PflFI 4 GACn'n_nGTC 1 ! Tth111I,AspI,PsyI >N
-PflMI 7 CCAn_nnn'nTGG -3 ! AccB7I,Van91I >N
-PfoI 1 T'CCnGG_A 5 ! >F
-;PhoI 2 GG'CC 0 ! HaeIII,BshFI,BsnI,BspANI,BsuRI >N
-;PinAI 1 A'CCGG_T 4 ! AgeI,AsiGI,BshTI,CspAI >BM
-PleI 9 GAGTCnnnn'n_ 1 ! MlyI,PpsI,SchI >N
-;Ple19I 4 CG_AT'CG -2 ! PvuI,BpvUI,MvrI >I
-;PmaCI 3 CAC'GTG 0 ! AcvI,BbrPI,Eco72I,PmlI,PspCI >AK
-PmeI 4 GTTT'AAAC 0 ! MssI >GN
-PmlI 3 CAC'GTG 0 ! PmaCI,AcvI,BbrPI,Eco72I,PspCI >N
-PpiI 25 GAACnnnnnCTCnnnnnnnn_nnnnn' -5 ! >F
-PpiI 24 GAGnnnnnGTTCnnnnnnn_nnnnn' -5 ! >F
-;PpsI 9 GAGTCnnnn'n_ 1 ! PleI,MlyI,SchI >I
-;Ppu10I 1 A'TGCA_T 4 ! EcoT22I,Mph1103I,NsiI,Zsp2I >
-;Ppu21I 3 yAC'GTr 0 ! BsaAI,BstBAI >F
-PpuMI 2 rG'GwC_Cy 3 ! Psp5II,PspPPI >NO
-;PscI 1 A'CATG_T 4 ! BspLU11I,PciI >F
-PshAI 5 GACnn'nnGTC 0 ! BoxI,BstPAI >AKN
-;PshBI 2 AT'TA_AT 2 ! VspI,AseI >K
-PsiI 3 TTA'TAA 0 ! >IN
-;Psp03I 4 G_GwC'C -3 ! AvaII,Bme18I,Eco47I,SinI,VpaK11BI >
-;Psp5II 2 rG'GwC_Cy 3 ! PpuMI,PspPPI >F
-;Psp6I 0 'CCwGG_ 5 ! EcoRII,AjnI,BptI,BseBI,BstNI,BstOI,Bst2UI,MvaI,PspGI >I
-;Psp1406I 2 AA'CG_TT 2 ! AclI >FKM
-;Psp124BI 5 G_AGCT'C -4 ! SacI,Ecl136II,EcoICRI,SstI >IV
-;PspCI 3 CAC'GTG 0 ! PmaCI,AcvI,BbrPI,Eco72I,PmlI >IV
-;PspEI 1 G'GTnAC_C 5 ! BstEII,BstPI,Eco91I,EcoO65I >IV
-PspGI 0 'CCwGG_ 5 ! EcoRII,AjnI,BptI,BseBI,BstNI,BstOI,Bst2UI,MvaI,Psp6I >N
-;PspLI 1 C'GTAC_G 4 ! BsiWI,Pfl23II >I
-;PspN4I 3 GGn'nCC 0 ! NlaIV,BmiI,BspLI >I
-PspOMI 1 G'GGCC_C 4 ! ApaI,Bsp120I >INV
-;PspPPI 2 rG'GwC_Cy 3 ! PpuMI,Psp5II >I
-PspXI 2 vC'TCGA_Gb 4 ! >IN
-PsrI 25 GAACnnnnnnTACnnnnnnn_nnnnn' -5 ! >I
-PsrI 25 GTAnnnnnnGTTCnnnnnnn_nnnnn' -5 ! >I
-;PssI 5 rG_GnC'Cy -3 ! DraII,EcoO109I >
-PstI 5 C_TGCA'G -4 ! BspMAI >ABCFGHIJKMNOQRSUVXY
-;PsuI 1 r'GATC_y 4 ! XhoII,BstX2I,BstYI,MflI >F
-;PsyI 4 GACn'n_nGTC 1 ! Tth111I,AspI,PflFI >F
-PvuI 4 CG_AT'CG -2 ! BpvUI,MvrI,Ple19I >ABFGKMNOQRSUXY
-PvuII 3 CAG'CTG 0 ! >ABCFGHIJKMNOQRSUVXY
-;RcaI 1 T'CATG_A 4 ! BspHI,PagI >M
-;RgaI 5 GCG_AT'CGC -2 ! SgfI,AsiSI >I
-;RleAI 18 CCCACAnnnnnnnnn_nnn' -3 ! >
-RsaI 2 GT'AC 0 ! AfaI,Csp6I >BCFGHIJMNOQRSVXY
-RsrII 2 CG'GwC_CG 3 ! CpoI,CspI,Rsr2I >MNQX
-;Rsr2I 2 CG'GwC_CG 3 ! RsrII,CpoI,CspI >I
-SacI 5 G_AGCT'C -4 ! Ecl136II,EcoICRI,Psp124BI,SstI >AFGHJKMNOQRSUX
-SacII 4 CC_GC'GG -2 ! Cfr42I,KspI,Sfr303I,SgrBI,SstII >AGHJKNOQRX
-SalI 1 G'TCGA_C 4 ! >ABCFGHIJKMNOQRSUVXY
-SanDI 2 GG'GwC_CC 3 ! >E
-SapI 8 GCTCTTCn'nnn_ 3 ! LguI,PciSI >N
-;SatI 2 GC'n_GC 1 ! Fnu4HI,Fsp4HI,ItaI >F
-;SauI 2 CC'TnA_GG 3 ! AxyI,Bse21I,Bsu36I,Eco81I >
-Sau96I 1 G'GnC_C 3 ! AspS9I,BmgT120I,Cfr13I >GJMNOU
-;Sau3AI 0 'GATC_ 4 ! MboI,BfuCI,Bsp143I,BssMI,BstKTI,BstMBI,DpnII,Kzo9I,NdeII >AGHJKMNOQRSUX
-SbfI 6 CC_TGCA'GG -4 ! Sse8387I,SdaI >INV
-ScaI 3 AGT'ACT 0 ! AssI,BmcAI,ZrmI >ABCFGJKMNOQRSX
-;SchI 10 GAGTCnnnnn' 0 ! PleI,MlyI,PpsI >F
-;SciI 3 CTC'GAG 0 ! XhoI,PaeR7I,Sfr274I,SlaI,StrI,TliI >
-ScrFI 2 CC'n_GG 1 ! Bme1390I,BmrFI,BssKI,BstSCI,MspR9I,StyD4I >JMNOS
-;SdaI 6 CC_TGCA'GG -4 ! Sse8387I,SbfI >F
-;SduI 5 G_dGCh'C -4 ! Bsp1286I,MhlI >F
-;SecI 1 C'CnnG_G 4 ! BsaJI,BseDI,BssECI >
-;SelI 0 'CGCG_ 4 ! AccII,Bsh1236I,BstFNI,BstUI,MvnI >
-SexAI 1 A'CCwGG_T 5 ! MabI >MN
-SfaNI 10 GCATCnnnnn'nnnn_ 4 ! LweI >IN
-SfcI 1 C'TryA_G 4 ! BfmI,BpcI,BstSFI >N
-;SfeI 1 C'TryA_G 4 ! BfmI,BpcI,BstSFI,SfcI >
-SfiI 8 GGCCn_nnn'nGGCC -3 ! >ACFGIJKMNOQRSUVX
-SfoI 3 GGC'GCC 0 ! NarI,BbeI,DinI,EgeI,EheI,KasI,Mly113I >N
-;Sfr274I 1 C'TCGA_G 4 ! XhoI,PaeR7I,SlaI,StrI,TliI >IV
-;Sfr303I 4 CC_GC'GG -2 ! SacII,Cfr42I,KspI,SgrBI,SstII >IV
-;SfuI 2 TT'CG_AA 2 ! AsuII,Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV >M
-;SgfI 5 GCG_AT'CGC -2 ! AsiSI,RgaI >R
-SgrAI 2 Cr'CCGG_yG 4 ! >MN
-;SgrBI 4 CC_GC'GG -2 ! SacII,Cfr42I,KspI,Sfr303I,SstII >C
-;SgrDI 4 CGTCGACG 0 ? ! >
-;SgsI 2 GG'CGCG_CC 4 ! AscI,PalAI >F
-;SimI 2 GG'GTC_ 3 ! >
-;SinI 1 G'GwC_C 3 ! AvaII,Bme18I,Eco47I,VpaK11BI >GR
-;SlaI 1 C'TCGA_G 4 ! XhoI,PaeR7I,Sfr274I,StrI,TliI >C
-SmaI 3 CCC'GGG 0 ! Cfr9I,XmaI,XmaCI >ABCFGHIJKMNOQRSUVXY
-;SmiI 4 ATTT'AAAT 0 ! SwaI >FIV
-;SmiMI 5 CAynn'nnrTG 0 ! MslI >I
-SmlI 1 C'TyrA_G 4 ! SmoI >N
-;SmoI 1 C'TyrA_G 4 ! SmlI >F
-;SmuI 9 CCCGCnnnn'nn_ 2 ! FauI >F
-;SnaI 3 GTATAC 0 ? ! BssNAI,Bst1107I,BstZ17I >
-SnaBI 3 TAC'GTA 0 ! BstSNI,Eco105I >ACKMNR
-SpeI 1 A'CTAG_T 4 ! AhlI,BcuI >ABGHJKMNOQRSUX
-SphI 5 G_CATG'C -4 ! BbuI,PaeI >ABCGHIJKMNOQRSVX
-;SplI 1 C'GTAC_G 4 ! BsiWI,Pfl23II,PspLI >
-SrfI 4 GCCC'GGGC 0 ! >EO
-;Sse9I 0 'AATT_ 4 ! TspEI,TasI,Tsp509I >IV
-;Sse232I 2 CG'CCGG_CG 4 ! >
-;Sse8387I 6 CC_TGCA'GG -4 ! SbfI,SdaI >AK
-;Sse8647I 2 AG'GwC_CT 3 ! >
-;SseBI 3 AGG'CCT 0 ! StuI,AatI,Eco147I,PceI >C
-;SsiI 1 C'CG_C 2 ! AciI,BspACI >F
-SspI 3 AAT'ATT 0 ! >ABCFGIJKMNOQRSUVX
-;SspBI 1 T'GTAC_A 4 ! Bsp1407I,BsrGI,BstAUI >M
-;SspD5I 13 GGTGAnnnnnnnn' 0 ! HphI,AsuHPI >
-;SstI 5 G_AGCT'C -4 ! SacI,Ecl136II,EcoICRI,Psp124BI >BC
-;SstII 4 CC_GC'GG -2 ! SacII,Cfr42I,KspI,Sfr303I,SgrBI >B
-;Sth132I 8 CCCGnnnn'nnnn_ 4 ! >
-;Sth302II 2 CC'GG 0 ! HpaII,BsiSI,HapII,MspI >
-;StrI 1 C'TCGA_G 4 ! XhoI,PaeR7I,Sfr274I,SlaI,TliI >U
-;StsI 15 GGATGnnnnnnnnnn'nnnn_ 4 ! FokI,BseGI,BstF5I,BtsCI >
-StuI 3 AGG'CCT 0 ! AatI,Eco147I,PceI,SseBI >ABJKMNQRSUX
-StyI 1 C'CwwG_G 4 ! BssT1I,Eco130I,EcoT14I,ErhI >CJMNRS
-StyD4I 0 'CCnGG_ 5 ! ScrFI,Bme1390I,BmrFI,BssKI,BstSCI,MspR9I >N
-SwaI 4 ATTT'AAAT 0 ! SmiI >GKMNS
-;TaaI 3 AC_n'GT -1 ! Bst4CI,HpyCH4III >F
-TaiI 4 _ACGT' -4 ! MaeII,HpyCH4IV >F
-TaqI 1 T'CG_A 2 ! >ABCFGIJKMNOQRSUVXY
-TaqII 17 GACCGAnnnnnnnnn_nn' -2 ! >VX
-TaqII 17 CACCCAnnnnnnnnn_nn' -2 ! >VX
-;TasI 0 'AATT_ 4 ! TspEI,Sse9I,Tsp509I >F
-TatI 1 w'GTAC_w 4 ! >F
-TauI 4 G_CsG'C -3 ! >F
-TfiI 1 G'AwT_C 3 ! PfeI >N
-;TliI 1 C'TCGA_G 4 ! XhoI,PaeR7I,Sfr274I,SlaI,StrI >N
-;Tru1I 1 T'TA_A 2 ! MseI,Tru9I >F
-;Tru9I 1 T'TA_A 2 ! MseI,Tru1I >GIMRV
-TseI 1 G'CwG_C 3 ! ApeKI >N
-TsoI 17 TArCCAnnnnnnnnn_nn' -2 ! >F
-Tsp45I 0 'GTsAC_ 5 ! NmuCI >N
-Tsp509I 0 'AATT_ 4 ! TspEI,Sse9I,TasI >N
-;Tsp4CI 3 AC_n'GT -1 ! Bst4CI,HpyCH4III,TaaI >
-TspDTI 16 ATGAAnnnnnnnnn_nn' -2 ! >VX
-;TspEI 0 'AATT_ 4 ! Sse9I,TasI,Tsp509I >O
-TspGWI 16 ACGGAnnnnnnnnn_nn' -2 ! >VX
-TspRI 9 _nnCAsTGnn' -9 ! >GN
-;TssI 4 GAGnnnCTC 0 ? ! >
-TstI 24 CACnnnnnnTCCnnnnnnn_nnnnn' -5 ! >F
-TstI 25 GGAnnnnnnGTGnnnnnnnn_nnnnn' -5 ! >F
-;TsuI 2 GCGAC 0 ? ! >
-Tth111I 4 GACn'n_nGTC 1 ! AspI,PflFI,PsyI >GIKNQRVX
-;Tth111II 17 CAArCAnnnnnnnnn_nn' -2 ! >
-;UbaF9I 6 TACnnnnnrTGT 0 ? ! >
-;UbaF11I 2 TCGTA 0 ? ! >
-;UbaPI 3 CGAACG 0 ? ! >
-;UnbI 0 'GGnCC_ 5 ! AspS9I,BmgT120I,Cfr13I,Sau96I >
-;Van91I 7 CCAn_nnn'nTGG -3 ! PflMI,AccB7I >AFGKM
-;Vha464I 1 C'TTAA_G 4 ! AflII,BfrI,BspTI,Bst98I,MspCI >IV
-;VneI 1 G'TGCA_C 4 ! ApaLI,Alw44I >IV
-;VpaK11AI 0 'GGwCC_ 5 ! AvaII,Bme18I,Eco47I,SinI,VpaK11BI >
-;VpaK11BI 1 G'GwC_C 3 ! AvaII,Bme18I,Eco47I,SinI >K
-;VspI 2 AT'TA_AT 2 ! AseI,PshBI >FIRV
-;XagI 5 CCTnn'n_nnAGG 1 ! EcoNI,BstENI >F
-;XapI 1 r'AATT_y 4 ! ApoI,AcsI >F
-XbaI 1 T'CTAG_A 4 ! >ABCFGHIJKMNOQRSUVXY
-;XceI 5 r_CATG'y -4 ! NspI,BstNSI >F
-XcmI 8 CCAnnnn_n'nnnnTGG -1 ! >N
-XhoI 1 C'TCGA_G 4 ! PaeR7I,Sfr274I,SlaI,StrI,TliI >ABFGHJKMNOQRSUXY
-;XhoII 1 r'GATC_y 4 ! BstX2I,BstYI,MflI,PsuI >GMR
-XmaI 1 C'CCGG_G 4 ! SmaI,Cfr9I,XmaCI >INRUV
-;XmaIII 1 C'GGCC_G 4 ! BseX3I,BstZI,EagI,EclXI,Eco52I >
-;XmaCI 1 C'CCGG_G 4 ! SmaI,Cfr9I,XmaI >M
-;XmaJI 1 C'CTAG_G 4 ! AvrII,AspA2I,BlnI >F
-;XmiI 2 GT'mk_AC 2 ! AccI,FblI >F
-XmnI 5 GAAnn'nnTTC 0 ! Asp700I,MroXI,PdmI >GNRU
-;XspI 1 C'TA_G 2 ! MaeI,BfaI,FspBI >K
-ZraI 3 GAC'GTC 0 ! AatII >INV
-;ZrmI 3 AGT'ACT 0 ! ScaI,AssI,BmcAI >I
-;Zsp2I 5 A_TGCA'T -4 ! EcoT22I,Mph1103I,NsiI >IV
-
Deleted: trunk/packages/perlprimer/trunk/perlprimer.1
===================================================================
--- trunk/packages/perlprimer/trunk/perlprimer.1 2007-12-26 01:26:46 UTC (rev 1023)
+++ trunk/packages/perlprimer/trunk/perlprimer.1 2007-12-26 16:15:52 UTC (rev 1024)
@@ -1,21 +0,0 @@
-.\" Hey, EMACS: -*- nroff -*-
-.TH PERLPRIMER 1 "6 January 2005"
-.SH NAME
-perlprimer \- graphically specify amplicon of DNA or mRNA sequences and design primers
-.SH SYNOPSIS
-.B perlprimer
-.SH DESCRIPTION
-.B PerlPrimer
-calculates primer melting temperature using J. SantaLucia's extensive nearest-neighbour thermodynamic parameters. To adjust for the salt conditions of the PCR, PerlPrimer uses the empirical formula derived by von Ahsen, et al. (2001) and allows the user to specify the concentration of Mg2+, dNTPs and primers, or use standard PCR conditions. The result is a highly accurate prediction of primer melting temperature, giving rise to a maximum yeild of product when amplified.
-.BR
-PerlPrimer is written in Perl and requires Perl/Tk. In addition, for QPCR functionality PerlPrimer requires the open-source Spidey executable from NCBI. The program is designed to be cross-platform compatible and has been developed and tested on both Microsoft Windows and GNU/Linux-based operating systems. Users have also reported success using the program under Mac OS X.
-.SH SEE ALSO
-.BR
-A very nice tutorial on http://perlprimer.sourceforge.net is also distributed
-as a debian package perlprimer-doc.
-.br
-.SH AUTHOR
-perlprimer was written by Owen Marshall <owenjm at users.sourceforge.net>
-.PP
-This manual page was assembled by Steffen Moeller <steffen_moeller at gmx.de>,
-for the Debian project (but may be used by others).
Deleted: trunk/packages/perlprimer/trunk/todo
===================================================================
--- trunk/packages/perlprimer/trunk/todo 2007-12-26 01:26:46 UTC (rev 1023)
+++ trunk/packages/perlprimer/trunk/todo 2007-12-26 16:15:52 UTC (rev 1024)
@@ -1,14 +0,0 @@
-For v1.2
-
-* Blast search dialogue should include a list of sequences that match both the forward and reverse primers
-
-* More intelligent sequencing primer design - search for primers around the midpoint between minimum and maximum distances, and then gradually move out
-
-* More complex primer-dimer routines - including detection of hair-pins and unequal primer-dimer internal loops
-
-* Ability to designate regions with starting/ending coordinates or starting/ending sequence strings, and assign colours and PCR ranges to such regions
-
-
-Post v1.2
-
-* Methylation specific PCR?
Deleted: trunk/packages/perlprimer/trunk/tutorial.html
===================================================================
--- trunk/packages/perlprimer/trunk/tutorial.html 2007-12-26 01:26:46 UTC (rev 1023)
+++ trunk/packages/perlprimer/trunk/tutorial.html 2007-12-26 16:15:52 UTC (rev 1024)
@@ -1,424 +0,0 @@
-<html><head><style type="text/css">
-
-BODY {
- background: #FBFBFB;
- padding: 0px;
- font-family: Georgia, "Times New Roman", serif;
- font-size: 90%;
- line-height: 130%;
- height: 100%;
- margin: 0px;
-}
-
-TABLE TD {
- margin: 0px;
- padding: 0px;
- border: 0px;
- spacing: 0px;
-}
-
-br, p {
- line-height: 130%;
-}
-
-UL, OL {
- line-height: 130%;
-}
-
-A {
- color: #336699;
- text-decoration: none;
-}
-
-A:hover {
- color: #993333;
- text-decoration: underline;
-}
-
-SUP {
- font-family: Verdana, sans-serif;
- font-size: smallest;
- line-height: 100%;
-}
-
-
-/* HEADER */
-
-.shadow1 {
- background-color: #999999;
- border-bottom: 1px solid #BBBBBB;
- height:1px;
- font-size: 1px;
- width: 100%;
-}
-
-.shadow2 {
- background-color: #DDDDDD;
- height:1px;
- font-size: 1px;
- width: 100%;
-}
-
-.header {
- background: #555555;
- border-bottom: 1px solid #333333;
- padding: 3px 10px 3px 10px;
-}
-
-.framework {
- width: 100%;
-}
-
-
-/* FOOTER */
-
-.footer {
-/* background: #CCCCCC; */
- color: #666666;
- border-top: 1px dotted #333333;
- font-family: Verdana, sans-serif;
- font-size: 80%;
- margin-top: 3em;
- padding-top: 0.5em;
- padding-bottom: 1em;
- margin-left: 5%;
- margin-right: 5%;
-}
-
-
-/* CONTENT */
-
-H1 {
- color: #111111;
- font-family: Trebuchet MS, "Times New Roman", serif;
- font-size: 200%;
- font-weight: normal;
- margin-bottom: 0px;
-}
-
-H2 {
- color: #444444;
- font-family: Trebuchet MS, "Times New Roman", serif;
- font-size: 160%;
- font-weight: normal;
- width: 100%;
- margin-top: 0em;
- padding-bottom: 0.25em;
- margin-bottom: 0.25em;
- border-bottom: 1px dotted #666666;
-}
-
-H3 {
- color: #000000;
- font-family: Trebuchet MS, "Times New Roman", serif;
- font-size: 130%;
- font-weight: normal;
- margin-top: 1.5em;
- margin-bottom: 0.75em;
- padding: 0em;
- text-decoration: underline;
-}
-
-H4 {
- color: #000000;
- font-family: Trebuchet MS, "Times New Roman", serif;
- font-size: 130%;
- font-weight: normal;
- margin-top: 1.5em;
- margin-bottom: 0.25em;
- padding: 0em;
-}
-
-.date {
- font-size: 80%;
- color: #333333;
- text-decoration: none;
-}
-
-.toc {
- margin-left: 2em;
- line-height: 130%;
-}
-
-.top {
- padding: 0em;
- border: 0px;
- margin-top: 1em;
- margin-bottom: 1em;
- margin-left: 5%;
- margin-right: 5%;
-}
-
-.content {
- margin-top: 1em;
- margin-bottom: 1em;
- margin-left: 5%;
- margin-right: 5%;
-}
-
-.reference {
- font-family: Verdana, sans-serif;
- font-size: 80%;
- color: #303030;
- margin-left: 5%;
- margin-right: 5%;
-}
-
-.rule {
- height: 1px;
- padding: 0px;
- margin-top: 1em;
- margin-bottom: 1em;
-}
-
-</style>
-
-<title>PerlPrimer</title><link rel="shortcut icon" href="http://perlprimer.sourceforge.net/favicon.ico" type="image/x-icon"></head>
-
-
-<body><div class="header"><br></div>
-<div class="shadow1"></div>
-
-<div class="shadow2"></div>
-<div class="top"><br>
-<table border="0" cellpadding="0" cellspacing="0"><tbody><tr>
-<td width="100%">
-<table border="0" cellpadding="0" cellspacing="0"><tbody><tr>
-<td>
-<h2><b>PerlPrimer - open-source PCR primer design</b></h2>
-<a href="http://perlprimer.sourceforge.net/index.html">About</a> | <a href="http://perlprimer.sourceforge.net/news.html">News</a> | <a href="http://perlprimer.sourceforge.net/download.html">Download</a> | Tutorial | <a href="http://perlprimer.sourceforge.net/methodology.html">Methodology</a> | <a href="http://perlprimer.sourceforge.net/links.html">Links</a> | <a href="http://perlprimer.sourceforge.net/screenshots.html">Screenshots</a> | <a href="http://perlprimer.sourceforge.net/contact.html">Contact</a> </td></tr></tbody></table>
-</td><td halign="right" valign="middle">
-<a href="http://sourceforge.net/"> <img src="tutorial_files/sflogo.png" alt="SourceForge.net Logo" align="middle" border="0" height="62" width="210"></a>
-</td></tr></tbody></table>
-</div>
-<div class="content">
-
-<h3>Contents</h3>
-<a href="#introduction">Introduction (and sample files)</a>
-<p><a href="#standard">Standard PCR</a>
-<br><span class="toc"><a href="#standard_restriction">Adding restriction enzyme cloning sequences</a></span>
-<br><span class="toc"><a href="#standard_saving">Saving a printable summary of the selected primer pair</a></span>
-<br><span class="toc"><a href="#standard_exporting">Exporting selected primers to a spreadsheet</a></span>
-</p><p><a href="#realtime">Real-time PCR</a>
-</p><p><a href="#sequencing">Sequencing Primers</a>
-</p><p><a href="#advanced">Advanced Features</a>
-<br><span class="toc"><a href="#advanced_finding">Finding primers</a></span>
-<br><span class="toc"><a href="#advanced_amplifying">Amplifying user-defined regions</a></span>
-<br><span class="toc"><a href="#advanced_specifying">Specifying PCR component concentrations</a></span>
-<br><span class="toc"><a href="#advanced_blast">Advanced BLAST searching</a></span>
-<br><span class="toc"><a href="#advanced_blast_local">Using a local BLAST server</a></span>
-<br><span class="toc"><a href="#advanced_ipc">Using other programs to communicate with PerlPrimer</a></span>
-<a name="introduction"><h3>Introduction</h3></a>
-</p><p>This tutorial covers most of the commonly used features of
-PerlPrimer, for standard PCR, real-time PCR and sequencing, using the
-human gene <i>PGR</i> (encoding the Progesterone Receptor protein) as
-an example. Example files for each section may be downloaded below
-(right-click on the links and choose either "Save Target As ..." or
-"Save Link to Disk ...", depending on your browser).
-</p><p><a href="http://perlprimer.sourceforge.net/hs_pgr_cDNA.txt">Human <i>PGR</i> cDNA sequence</a>
-<br><a href="http://perlprimer.sourceforge.net/hs_pgr_genomic.txt">Human <i>PGR</i> genomic sequence</a>
-</p><p><a href="http://perlprimer.sourceforge.net/hs_pgr_cloning.ppr">standard PCR perlprimer file</a>
-<br><a href="http://perlprimer.sourceforge.net/hs_pgr_qpcr.ppr">real-time PCR perlprimer file</a>
-<br><a href="http://perlprimer.sourceforge.net/hs_pgr_sequencing.ppr">sequencing perlprimer file</a>
-</p><p>The tutorial is based upon PerlPrimer 1.1 - users of older
-versions may find some features unavailable and are advised to upgrade
-to the latest version. All screenshots were made using the program
-running under Linux, however, the program should behave identically
-under Windows and MacOS X.
-</p><p>In addition to this tutorial, PerlPrimer also comes with
-extensive "Balloon Help", enabled by default (and which can be turned
-on or off in the Help menu). Simply hold the mouse pointer over a
-button or feature and a explanatory message should be displayed.
-</p><p><a name="standard"><h3>Standard PCR</h3></a>
-</p><p>While a DNA sequence may be opened from the sequence input area (click on the <img src="tutorial_files/open_dna_20.png">
-icon), the simplest means of retrieving a sequence is to use the
-Ensembl database tool. Click on the "Retrieve gene from Ensembl" icon <img src="tutorial_files/ensembl_20.png">
-or select it from the File menu. Enter "pgr" as the gene name and
-select "Homo_sapiens" as the organism. Make sure that "cdna" is set as
-the retrieval type, and click OK.
-</p><p>You should see a screen similar to that shown below (note that
-on earlier versions the amplification range will not be set
-automatically - click the "Set from ORF" button to do so) The range
-will now be set by default to the largest Open Reading Frame (or ORF)
-present in the sequence. The range is displayed by two boxes around the
-DNA sequence - one orange (the outer range) and one blue (the inner
-range). All primers will be found within the orange box and outside of
-the blue box.
-</p><p><img src="tutorial_files/img1.png">
-</p><p>(The following example considers cloning a gene by PCR
-amplification into an expression plasmid. Note, however, that primers
-may be designed around other regions of interest as well as genes or
-that amplification boundaries may be entered manually (see the section
-"Advanced uses" below))
-</p><p>To clone the cDNA ORF into an expression plasmid, we will
-generally want a forward primer before or encompassing the initiating
-ATG, and a reverse primer before the terminal stop codon. The simplest
-way to do this to use the "Find primers for cloning" command from the
-Tools menu - this will automatically decrease the 5' outer range and 3'
-inner range until primers pairs are found. (There is another way to do
-this - see the "Advanced Features" section below). Using the standard
-default parameters, this should find four primer pairs, the first one
-amplifying from bases 1443 -> 4226. (see screen shot below)
-</p><p><img src="tutorial_files/img2.png">
-</p><p>Double-clicking on this primer pair (or pressing the right arrow
-key on the keyboard) will switch to the Primers tab, showing primer
-information and stable primer-dimers. The most stable extensible
-primer-dimer is fairly weak (dG°37 of -2.00 kcal/mol), and although the
-non-extensible Forward vs. Forward dimer may slightly reduce the primer
-population, it should not cause problems for the purpose of cloning the
-gene. (screen shot)
-</p><p><img src="tutorial_files/img3.png">
-</p><p>There is also a button on this page to BLAST primers using the
-NCBI BLAST server. Click on this and wait for the BLAST results to come
-up (this may take a minute or two - the server can be quite slow at
-times) Limit the results to human only by typing "Homo" into the search
-box and clicking the Search button. (screen shot) The forward primer is
-fairly unique, and although the reverse primer is less so it should be
-OK to amplify from. Return to the Standard PCR page and select this
-primer pair.
-</p><p><img src="tutorial_files/img4.png">
-</p><p><a name="standard_restriction"><h4>Adding restriction enzyme cloning sequences</h4></a>
-</p><p>The example provided here will clone the <i>PGR</i> ORF into
-GFP-fusion constructs (Clontech plasmids EGFP-C1 and EGFP-C2), creating
-both an N-terminal and a C-terminal fusion protein when translated.
-Select "Add cloning sequences" from the Tools menu. This will bring up
-a dialogue box with the ability to select restriction enzyme sites to
-add to the 5' end of each primer. By default, only those 6-base cutting
-enzymes that will not cut the DNA sequence within the outer range are
-listed. Looking at the restriction sites present in the plasmid MCS and
-comparing to the list of non-cutting enzymes, we can see that BglII and
-EcoRI can be used. Select these (see below) and click OK. Finally, we
-need to add the frame that the sites lie in, relevant to the EGFP gene
-(this is obviously only necessary when creating fusion proteins).
-Looking at the plasmid MCS, it should be clear that both BglII for
-EGFP-C1 and EcoRI for EGFP-N2 are in frame 0 (where the frame can be
-one of 0, 1 or 2 and 0 represents a sequence in frame). Enter "0" into
-each frame box.
-</p><p>EGFP-C1 MCS:
-</p><p><img src="tutorial_files/egfp_c1_mcs.png">
-</p><p>EGFP-N2 MCS:
-</p><p><img src="tutorial_files/egfp_n2_mcs.png">
-</p><p><img src="tutorial_files/img5.png">
-</p><p>Clicking on the <img src="tutorial_files/magnify.png"> icon next
-to the DNA graphic (also by right-clicking on the DNA graphic) will
-bring up an alignment of the DNA sequence and primers with cloning
-sequences attached. The ORF is translated and codons are highlighted
-(see below). Note the inserted Adenine base between the forward primer
-and the cloning site.
-</p><p><img src="tutorial_files/img6.png">
-</p><p><a name="standard_saving"><h4>Saving a printable summary of the selected primer pair</h4></a>
-</p><p>Clicking on the <img src="tutorial_files/report_20.png"> icon
-(or selecting "Generate Report" from the Tools menu) will save a text
-file listing the selected primer pair, statistics and primer-dimers of
-each primer and an alignment of the primers against the DNA sequence.
-</p><p>
-<a name="standard_exporting"><h4>Exporting selected primers to a spreadsheet</h4></a>
-</p><p>If satisfied with a primer pair or a group of primer pairs,
-right-click on the primer list and choose "Copy", or simply press
-Ctrl-C. The primers are copied in a tab-delimited format that can be
-pasted into any spreadsheet application.
-</p><p><a name="realtime"><h3>Real-time PCR</h3></a>
-</p><p>Designing real-time PCR primers with PerlPrimer is a simple and straightforward process. This tutorial uses the Human <i>PGR</i> gene as an example.
-</p><p>Click on the "Retrieve gene from Ensembl" icon (picture) or
-select it from the File menu, enter "pgr" as the gene name and select
-"Homo_sapiens" as the organism. Click OK. PerlPrimer will automatically
-download the genomic and cDNA sequences for the gene. You should have a
-screen similar to that below. </p><p><img src="tutorial_files/img7.png">
-</p><p>Click on the "Find Primers" button. PerlPrimer runs the
-application Spidey, which finds intron/exon boundaries (displayed as
-white lines across the DNA graphic). It then selects primer pairs that
-will produce an amplicon within the bounds specified, which span at
-least one intron/exon boundary and in which at least one primer pair
-lies across an intron/exon boundary. (Thus the primers should only
-amplify cDNA and will not amplify genomic DNA) Primers are sorted by
-extensible primer-dimer stability. In this case, no primers are found
-on the first run - probably because the regions around the intron/exon
-boundaries have an abnormally high or low GC content. To test this, try
-changing the cutoffs for GC% from 40%-60% to 35%-65% (you can do this
-in the Preferences, under the "Exclusions" tab).
-</p><p>Searching for primers again now yields over 400 primer pairs (see below).
-</p><p><img src="tutorial_files/img8.png">
-</p><p>Of these, the first primer pair should be fine - BLAST searching
-as detailed above suggests that both primers are specific. Clicking on
-the <img src="tutorial_files/magnify.png"> icon now displays the intron/exon boundaries with the primers aligned (see below).
-</p><p><img src="tutorial_files/img9.png">
-</p><p><a name="sequencing"><h3>Sequencing Primers</h3></a>
-</p><p>Finding sequencing primers for any sequence is also extremely simple. Using the example above of the human <i>PGR</i>
-cDNA sequence, open the sequence (or retrieve it from Ensembl), check
-that the default "Primers every ... bases" is appropriate for your
-average sequence read-length, and click the "Find Primers" button.
-Suitable primers will be listed, or if a gap is found where no primers
-match the required parameters, a dialogue will displayed informing the
-user that the search parameters will need to be relaxed. By default,
-primers are only listed if all primer-dimers have a dG°37 less than -5
-kcal/mol - this can be varied if required. In this case, we need to
-increase the maximum read length to 800bp to find primers (screenshot).
-</p><p><img src="tutorial_files/img10.png">
-</p><p><a name="advanced"><h3>Advanced Features</h3></a>
-</p><p><a name="advanced_finding"><h4>Finding primers</h4></a>
-</p><p>Two other buttons in the "Standard PCR" and "Bisulphite PCR"
-pages that have not been mentioned above are the "Find Inwards" and
-"Find Outwards" buttons - useful for amplifying regions of interest.
-The "Find Inwards" button reduces the inner amplified range by 10 base
-increments until suitable primers are found; the "Find Outwards" does
-the opposite - increasing the outer amplified range by 10 base
-increments until primers are found.
-</p><p>The inner and outer ranges can also be adjusted by using the
-mouse - dragging with the left mouse button affects the inner range;
-dragging with the middle mouse button (or the left button with the Ctrl
-key held down) affects the outer range.
-</p><p><a name="advanced_amplifying"><h4>Amplifying user-defined regions</h4></a>
-</p><p>While PerlPrimer will by default automatically find the largest
-ORF (or CpG islands) in a sequence, it is also possible to use a
-user-defined region, or number of regions. This can be achieved by
-capitalising the region of interest (most word processing/text editor
-programs should be able to do this) before opening the sequence in
-PerlPrimer, and selecting "Defer to capitalised regions" in the
-Preferences under the "General" tab. (click on the <img src="tutorial_files/preferences_20.png"> icon or select "Preferences" from the Tools menu). The internal ORF and CpG island detection algorithms are now bypassed.
-</p><p>It is also possible to manually specify the base positions to
-amplify from by typing in the numbers into the Amplified Range section.
-</p><p><a name="advanced_specifying"><h4>Specifying PCR component concentrations</h4></a>
-</p><p>PCR component concentrations are set by default to the standard PCR conditions of 1.5mM Mg<sup>++</sup>, 50mM Monovalent cations (i.e. Na<sup>+</sup>, K<sup>+</sup>, etc), 0.2 mM dNTPs and a final concentration of each primer as 200mM.
-</p><p>These concentrations can be changed in the Preferences under the "General" tab (click on the <img src="tutorial_files/preferences_20.png">
-icon or select "Preferences" from the Tools menu). Please note that
-changing any of these values (including the primer concentration) will
-affect the <i>T<sub>m</sub></i>.
-</p><p><a name="advanced_blast"><h4>Advanced BLAST searching</h4></a>
-</p><p>Most parameters of BLAST searches (including the Expect value,
-the database and the ability to limit searches to an organism) can be
-set in the Preferences, under the "Bioinformatics" tab.
-</p><p><a name="advanced_blast_local"><h4>Using a local BLAST server</h4></a>
-</p><p>As of version 1.1.5, users may install and use a local BLAST server and data files. <a href="ftp://ftp.ncbi.nlm.nih.gov/blast/executables/LATEST-BLAST/">Binaries</a> and <a href="ftp://ftp.ncbi.nih.gov/blast/db/">databases</a>
-are available from the NCBI ftp site - please see the README file for
-stand-alone BLAST included with the BLAST distribution for details on
-setting up the server and database files.
-</p><p>Once a local BLAST server has been setup, select "Use local
-BLAST server" from the "BLAST" tab in the Preferences dialogue, select
-the directory where BLAST server executables are located and select the
-relevant database file.
-</p><p><a name="advanced_ipc"><h4>Using other programs to communicate with PerlPrimer</h4></a>
-</p><p>As of version 1.1.3, PerlPrimer now establishes a listening
-socket on local port 2500 which other applications can use to send data
-directly to PerlPrimer (see <a href="http://www.atgc.org/Py_ContigViewer/">Contig Viewer</a>
-for an example of an application that uses this feature). The data
-format uses a modified FASTA format with optional PCR amplification
-boundaries set in the FASTA header; the syntax for the modified
-description line is
-</p><p><tt>>Name of DNA sequence 5prime_region[?-?] 3prime_region[?-?] page[?]</tt>
-</p><p>where the optional page argument represents the PCR tab (thus 1
-= Standard PCR, 2 = Bisulphite PCR, 3 = Real-time PCR, etc). An example
-is:
-</p><p><tt>>Contig2942 test file 5prime_region[53-185] 3prime_region[324-464]
-GGTTCCAATGGAGTTGTGATAAACGAAGAGCAGCACAAGCTCCCAATACCAAATTTAGTACTACTGACCAATTATAAAGAGTAAATATAGAAGATT
-AGGGTTTTAAGATCTCTAACAAAATTGCACTGGGAAGAATCTGGTTCTTCAATTTTCTGGGATTTATCAGATCTGAAGAAACTGAAGAGTGAAGTG
-GTAATCGTTGATAAGTGTATGTTCAAGGGAGGATTGTTTGGATTTACTGAACTGTTGTTTGATGTGGTTTTGGAGAAGATAAGATCTGTGATTTGT
-AAAACCCAAAACGGATTCTTTTTGTACTTGATTGATAGATCTTCAGTTTTTTTGGGAGTTGAATCAGTTATTGTTTAATTTAGAAATGGAGACACT
-TGTTGTTGTTTCTCAGCATAAGAATCACTACTATGATAGAACTAGGGGTCAAGCTCCTATTCGATTTGGATCCTTTGGGTCACCTCCTTCTGTAGG
-GTTCAAAGAGATAAATTGCCGGAATTTTGAATCAAGTGCCGGTATACTTCCTACCCCGTTAAAGGCCTATTCCACACCAGTCACTAAAAAGGGTTA
-TTCATCCTCGTTTCGTTCCAAAACACCTTCACCCCCATCATCTATCCAGGGTAAATCTCACTCTGAAAGTCAAAAGAAGTCG</tt>
-</p><p>To change the PCR amplification boundaries without resending the
-DNA sequence, simply send the FASTA description line only. The modified
-FASTA above can also be opened manually using the <img src="tutorial_files/open_dna_20.png"> button in the sequence boxes.
-</p></div>
-<p></p><div class="footer">© 2003-2005 Owen Marshall ... Last updated Fri Feb 4 16:46:40 2005</div>
-</body></html>
\ No newline at end of file
More information about the debian-med-commit
mailing list