[med-svn] r298 - in trunk/packages: . rnahybrid rnahybrid/branches	rnahybrid/branches/upstream rnahybrid/branches/upstream/current	rnahybrid/branches/upstream/current/examples	rnahybrid/branches/upstream/current/man	rnahybrid/branches/upstream/current/src
    charles-guest at alioth.debian.org 
    charles-guest at alioth.debian.org
       
    Fri Jun  1 01:40:59 UTC 2007
    
    
  
Author: charles-guest
Date: 2007-06-01 01:40:59 +0000 (Fri, 01 Jun 2007)
New Revision: 298
Added:
   trunk/packages/rnahybrid/
   trunk/packages/rnahybrid/branches/
   trunk/packages/rnahybrid/branches/upstream/
   trunk/packages/rnahybrid/branches/upstream/current/
   trunk/packages/rnahybrid/branches/upstream/current/AUTHORS
   trunk/packages/rnahybrid/branches/upstream/current/COPYING
   trunk/packages/rnahybrid/branches/upstream/current/ChangeLog
   trunk/packages/rnahybrid/branches/upstream/current/INSTALL
   trunk/packages/rnahybrid/branches/upstream/current/Makefile.am
   trunk/packages/rnahybrid/branches/upstream/current/Makefile.in
   trunk/packages/rnahybrid/branches/upstream/current/NEWS
   trunk/packages/rnahybrid/branches/upstream/current/README
   trunk/packages/rnahybrid/branches/upstream/current/aclocal.m4
   trunk/packages/rnahybrid/branches/upstream/current/config.guess
   trunk/packages/rnahybrid/branches/upstream/current/config.h.in
   trunk/packages/rnahybrid/branches/upstream/current/configure
   trunk/packages/rnahybrid/branches/upstream/current/configure.in
   trunk/packages/rnahybrid/branches/upstream/current/depcomp
   trunk/packages/rnahybrid/branches/upstream/current/examples/
   trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_fly.freq
   trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_human.freq
   trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_worm.freq
   trunk/packages/rnahybrid/branches/upstream/current/examples/cbr-hbl-1.fasta
   trunk/packages/rnahybrid/branches/upstream/current/examples/cel-hbl-1.fasta
   trunk/packages/rnahybrid/branches/upstream/current/examples/cel-let-7.fasta
   trunk/packages/rnahybrid/branches/upstream/current/examples/coding_fly.freq
   trunk/packages/rnahybrid/branches/upstream/current/examples/coding_worm.freq
   trunk/packages/rnahybrid/branches/upstream/current/examples/hbl-1.fasta
   trunk/packages/rnahybrid/branches/upstream/current/install-sh
   trunk/packages/rnahybrid/branches/upstream/current/man/
   trunk/packages/rnahybrid/branches/upstream/current/man/Makefile.am
   trunk/packages/rnahybrid/branches/upstream/current/man/Makefile.in
   trunk/packages/rnahybrid/branches/upstream/current/man/RNAcalibrate.1
   trunk/packages/rnahybrid/branches/upstream/current/man/RNAeffective.1
   trunk/packages/rnahybrid/branches/upstream/current/man/RNAhybrid.1
   trunk/packages/rnahybrid/branches/upstream/current/missing
   trunk/packages/rnahybrid/branches/upstream/current/mkinstalldirs
   trunk/packages/rnahybrid/branches/upstream/current/src/
   trunk/packages/rnahybrid/branches/upstream/current/src/Makefile.am
   trunk/packages/rnahybrid/branches/upstream/current/src/Makefile.in
   trunk/packages/rnahybrid/branches/upstream/current/src/energy.c
   trunk/packages/rnahybrid/branches/upstream/current/src/energy.h
   trunk/packages/rnahybrid/branches/upstream/current/src/fasta.c
   trunk/packages/rnahybrid/branches/upstream/current/src/fasta.h
   trunk/packages/rnahybrid/branches/upstream/current/src/globals.h
   trunk/packages/rnahybrid/branches/upstream/current/src/hybrid_core.c
   trunk/packages/rnahybrid/branches/upstream/current/src/hybrid_core.h
   trunk/packages/rnahybrid/branches/upstream/current/src/input.c
   trunk/packages/rnahybrid/branches/upstream/current/src/input.h
   trunk/packages/rnahybrid/branches/upstream/current/src/minmax.h
   trunk/packages/rnahybrid/branches/upstream/current/src/mt19937-1.c
   trunk/packages/rnahybrid/branches/upstream/current/src/mt19937-1.h
   trunk/packages/rnahybrid/branches/upstream/current/src/numerical.c
   trunk/packages/rnahybrid/branches/upstream/current/src/numerical.h
   trunk/packages/rnahybrid/branches/upstream/current/src/plot.c
   trunk/packages/rnahybrid/branches/upstream/current/src/plot.h
   trunk/packages/rnahybrid/branches/upstream/current/src/random.c
   trunk/packages/rnahybrid/branches/upstream/current/src/random.h
   trunk/packages/rnahybrid/branches/upstream/current/src/rnacalibrate.c
   trunk/packages/rnahybrid/branches/upstream/current/src/rnaeffective.c
   trunk/packages/rnahybrid/branches/upstream/current/src/rnahybrid.c
   trunk/packages/rnahybrid/tags/
Log:
[svn-inject] Installing original source of rnahybrid
Added: trunk/packages/rnahybrid/branches/upstream/current/AUTHORS
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/AUTHORS	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/AUTHORS	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,3 @@
+Marc Rehmsmeier (marc at techfak.uni-bielefeld.de)
+Peter Steffen (psteffen at techfak.uni-bielefeld.de)
+Matthias Hoechsmann (mhoechsm at techfak.uni-bielefeld.de)
Added: trunk/packages/rnahybrid/branches/upstream/current/COPYING
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/COPYING	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/COPYING	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,340 @@
+		    GNU GENERAL PUBLIC LICENSE
+		       Version 2, June 1991
+
+ Copyright (C) 1989, 1991 Free Software Foundation, Inc.
+     59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+			    Preamble
+
+  The licenses for most software are designed to take away your
+freedom to share and change it.  By contrast, the GNU General Public
+License is intended to guarantee your freedom to share and change free
+software--to make sure the software is free for all its users.  This
+General Public License applies to most of the Free Software
+Foundation's software and to any other program whose authors commit to
+using it.  (Some other Free Software Foundation software is covered by
+the GNU Library General Public License instead.)  You can apply it to
+your programs, too.
+
+  When we speak of free software, we are referring to freedom, not
+price.  Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+this service if you wish), that you receive source code or can get it
+if you want it, that you can change the software or use pieces of it
+in new free programs; and that you know you can do these things.
+
+  To protect your rights, we need to make restrictions that forbid
+anyone to deny you these rights or to ask you to surrender the rights.
+These restrictions translate to certain responsibilities for you if you
+distribute copies of the software, or if you modify it.
+
+  For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must give the recipients all the rights that
+you have.  You must make sure that they, too, receive or can get the
+source code.  And you must show them these terms so they know their
+rights.
+
+  We protect your rights with two steps: (1) copyright the software, and
+(2) offer you this license which gives you legal permission to copy,
+distribute and/or modify the software.
+
+  Also, for each author's protection and ours, we want to make certain
+that everyone understands that there is no warranty for this free
+software.  If the software is modified by someone else and passed on, we
+want its recipients to know that what they have is not the original, so
+that any problems introduced by others will not reflect on the original
+authors' reputations.
+
+  Finally, any free program is threatened constantly by software
+patents.  We wish to avoid the danger that redistributors of a free
+program will individually obtain patent licenses, in effect making the
+program proprietary.  To prevent this, we have made it clear that any
+patent must be licensed for everyone's free use or not licensed at all.
+
+  The precise terms and conditions for copying, distribution and
+modification follow.
+
+		    GNU GENERAL PUBLIC LICENSE
+   TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION
+
+  0. This License applies to any program or other work which contains
+a notice placed by the copyright holder saying it may be distributed
+under the terms of this General Public License.  The "Program", below,
+refers to any such program or work, and a "work based on the Program"
+means either the Program or any derivative work under copyright law:
+that is to say, a work containing the Program or a portion of it,
+either verbatim or with modifications and/or translated into another
+language.  (Hereinafter, translation is included without limitation in
+the term "modification".)  Each licensee is addressed as "you".
+
+Activities other than copying, distribution and modification are not
+covered by this License; they are outside its scope.  The act of
+running the Program is not restricted, and the output from the Program
+is covered only if its contents constitute a work based on the
+Program (independent of having been made by running the Program).
+Whether that is true depends on what the Program does.
+
+  1. You may copy and distribute verbatim copies of the Program's
+source code as you receive it, in any medium, provided that you
+conspicuously and appropriately publish on each copy an appropriate
+copyright notice and disclaimer of warranty; keep intact all the
+notices that refer to this License and to the absence of any warranty;
+and give any other recipients of the Program a copy of this License
+along with the Program.
+
+You may charge a fee for the physical act of transferring a copy, and
+you may at your option offer warranty protection in exchange for a fee.
+
+  2. You may modify your copy or copies of the Program or any portion
+of it, thus forming a work based on the Program, and copy and
+distribute such modifications or work under the terms of Section 1
+above, provided that you also meet all of these conditions:
+
+    a) You must cause the modified files to carry prominent notices
+    stating that you changed the files and the date of any change.
+
+    b) You must cause any work that you distribute or publish, that in
+    whole or in part contains or is derived from the Program or any
+    part thereof, to be licensed as a whole at no charge to all third
+    parties under the terms of this License.
+
+    c) If the modified program normally reads commands interactively
+    when run, you must cause it, when started running for such
+    interactive use in the most ordinary way, to print or display an
+    announcement including an appropriate copyright notice and a
+    notice that there is no warranty (or else, saying that you provide
+    a warranty) and that users may redistribute the program under
+    these conditions, and telling the user how to view a copy of this
+    License.  (Exception: if the Program itself is interactive but
+    does not normally print such an announcement, your work based on
+    the Program is not required to print an announcement.)
+
+These requirements apply to the modified work as a whole.  If
+identifiable sections of that work are not derived from the Program,
+and can be reasonably considered independent and separate works in
+themselves, then this License, and its terms, do not apply to those
+sections when you distribute them as separate works.  But when you
+distribute the same sections as part of a whole which is a work based
+on the Program, the distribution of the whole must be on the terms of
+this License, whose permissions for other licensees extend to the
+entire whole, and thus to each and every part regardless of who wrote it.
+
+Thus, it is not the intent of this section to claim rights or contest
+your rights to work written entirely by you; rather, the intent is to
+exercise the right to control the distribution of derivative or
+collective works based on the Program.
+
+In addition, mere aggregation of another work not based on the Program
+with the Program (or with a work based on the Program) on a volume of
+a storage or distribution medium does not bring the other work under
+the scope of this License.
+
+  3. You may copy and distribute the Program (or a work based on it,
+under Section 2) in object code or executable form under the terms of
+Sections 1 and 2 above provided that you also do one of the following:
+
+    a) Accompany it with the complete corresponding machine-readable
+    source code, which must be distributed under the terms of Sections
+    1 and 2 above on a medium customarily used for software interchange; or,
+
+    b) Accompany it with a written offer, valid for at least three
+    years, to give any third party, for a charge no more than your
+    cost of physically performing source distribution, a complete
+    machine-readable copy of the corresponding source code, to be
+    distributed under the terms of Sections 1 and 2 above on a medium
+    customarily used for software interchange; or,
+
+    c) Accompany it with the information you received as to the offer
+    to distribute corresponding source code.  (This alternative is
+    allowed only for noncommercial distribution and only if you
+    received the program in object code or executable form with such
+    an offer, in accord with Subsection b above.)
+
+The source code for a work means the preferred form of the work for
+making modifications to it.  For an executable work, complete source
+code means all the source code for all modules it contains, plus any
+associated interface definition files, plus the scripts used to
+control compilation and installation of the executable.  However, as a
+special exception, the source code distributed need not include
+anything that is normally distributed (in either source or binary
+form) with the major components (compiler, kernel, and so on) of the
+operating system on which the executable runs, unless that component
+itself accompanies the executable.
+
+If distribution of executable or object code is made by offering
+access to copy from a designated place, then offering equivalent
+access to copy the source code from the same place counts as
+distribution of the source code, even though third parties are not
+compelled to copy the source along with the object code.
+
+  4. You may not copy, modify, sublicense, or distribute the Program
+except as expressly provided under this License.  Any attempt
+otherwise to copy, modify, sublicense or distribute the Program is
+void, and will automatically terminate your rights under this License.
+However, parties who have received copies, or rights, from you under
+this License will not have their licenses terminated so long as such
+parties remain in full compliance.
+
+  5. You are not required to accept this License, since you have not
+signed it.  However, nothing else grants you permission to modify or
+distribute the Program or its derivative works.  These actions are
+prohibited by law if you do not accept this License.  Therefore, by
+modifying or distributing the Program (or any work based on the
+Program), you indicate your acceptance of this License to do so, and
+all its terms and conditions for copying, distributing or modifying
+the Program or works based on it.
+
+  6. Each time you redistribute the Program (or any work based on the
+Program), the recipient automatically receives a license from the
+original licensor to copy, distribute or modify the Program subject to
+these terms and conditions.  You may not impose any further
+restrictions on the recipients' exercise of the rights granted herein.
+You are not responsible for enforcing compliance by third parties to
+this License.
+
+  7. If, as a consequence of a court judgment or allegation of patent
+infringement or for any other reason (not limited to patent issues),
+conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License.  If you cannot
+distribute so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you
+may not distribute the Program at all.  For example, if a patent
+license would not permit royalty-free redistribution of the Program by
+all those who receive copies directly or indirectly through you, then
+the only way you could satisfy both it and this License would be to
+refrain entirely from distribution of the Program.
+
+If any portion of this section is held invalid or unenforceable under
+any particular circumstance, the balance of the section is intended to
+apply and the section as a whole is intended to apply in other
+circumstances.
+
+It is not the purpose of this section to induce you to infringe any
+patents or other property right claims or to contest validity of any
+such claims; this section has the sole purpose of protecting the
+integrity of the free software distribution system, which is
+implemented by public license practices.  Many people have made
+generous contributions to the wide range of software distributed
+through that system in reliance on consistent application of that
+system; it is up to the author/donor to decide if he or she is willing
+to distribute software through any other system and a licensee cannot
+impose that choice.
+
+This section is intended to make thoroughly clear what is believed to
+be a consequence of the rest of this License.
+
+  8. If the distribution and/or use of the Program is restricted in
+certain countries either by patents or by copyrighted interfaces, the
+original copyright holder who places the Program under this License
+may add an explicit geographical distribution limitation excluding
+those countries, so that distribution is permitted only in or among
+countries not thus excluded.  In such case, this License incorporates
+the limitation as if written in the body of this License.
+
+  9. The Free Software Foundation may publish revised and/or new versions
+of the General Public License from time to time.  Such new versions will
+be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+Each version is given a distinguishing version number.  If the Program
+specifies a version number of this License which applies to it and "any
+later version", you have the option of following the terms and conditions
+either of that version or of any later version published by the Free
+Software Foundation.  If the Program does not specify a version number of
+this License, you may choose any version ever published by the Free Software
+Foundation.
+
+  10. If you wish to incorporate parts of the Program into other free
+programs whose distribution conditions are different, write to the author
+to ask for permission.  For software which is copyrighted by the Free
+Software Foundation, write to the Free Software Foundation; we sometimes
+make exceptions for this.  Our decision will be guided by the two goals
+of preserving the free status of all derivatives of our free software and
+of promoting the sharing and reuse of software generally.
+
+			    NO WARRANTY
+
+  11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY
+FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW.  EXCEPT WHEN
+OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES
+PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED
+OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
+MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE.  THE ENTIRE RISK AS
+TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU.  SHOULD THE
+PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING,
+REPAIR OR CORRECTION.
+
+  12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR
+REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES,
+INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING
+OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED
+TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY
+YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER
+PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE
+POSSIBILITY OF SUCH DAMAGES.
+
+		     END OF TERMS AND CONDITIONS
+
+	    How to Apply These Terms to Your New Programs
+
+  If you develop a new program, and you want it to be of the greatest
+possible use to the public, the best way to achieve this is to make it
+free software which everyone can redistribute and change under these terms.
+
+  To do so, attach the following notices to the program.  It is safest
+to attach them to the start of each source file to most effectively
+convey the exclusion of warranty; and each file should have at least
+the "copyright" line and a pointer to where the full notice is found.
+
+    <one line to give the program's name and a brief idea of what it does.>
+    Copyright (C) <year>  <name of author>
+
+    This program is free software; you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation; either version 2 of the License, or
+    (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with this program; if not, write to the Free Software
+    Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA  02111-1307  USA
+
+
+Also add information on how to contact you by electronic and paper mail.
+
+If the program is interactive, make it output a short notice like this
+when it starts in an interactive mode:
+
+    Gnomovision version 69, Copyright (C) year  name of author
+    Gnomovision comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
+    This is free software, and you are welcome to redistribute it
+    under certain conditions; type `show c' for details.
+
+The hypothetical commands `show w' and `show c' should show the appropriate
+parts of the General Public License.  Of course, the commands you use may
+be called something other than `show w' and `show c'; they could even be
+mouse-clicks or menu items--whatever suits your program.
+
+You should also get your employer (if you work as a programmer) or your
+school, if any, to sign a "copyright disclaimer" for the program, if
+necessary.  Here is a sample; alter the names:
+
+  Yoyodyne, Inc., hereby disclaims all copyright interest in the program
+  `Gnomovision' (which makes passes at compilers) written by James Hacker.
+
+  <signature of Ty Coon>, 1 April 1989
+  Ty Coon, President of Vice
+
+This General Public License does not permit incorporating your program into
+proprietary programs.  If your program is a subroutine library, you may
+consider it more useful to permit linking proprietary applications with the
+library.  If this is what you want to do, use the GNU Library General
+Public License instead of this License.
Added: trunk/packages/rnahybrid/branches/upstream/current/ChangeLog
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/ChangeLog	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/ChangeLog	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,23 @@
+Tue Nov 16 16:46:51 2004  Marc Rehmsmeier  <marc at TechFak.Uni-Bielefeld.DE>
+
+	* RNAcalibrate man page: added description of output (number of
+	data points, location, scale)
+
+	* estimate_evd_parameters now returns the number of data
+	points evd parameters have been estimated on
+
+Mon Nov 15 20:32:43 2004  Marc Rehmsmeier  <marc at TechFak.Uni-Bielefeld.DE>
+
+	* Added GNU General Public License to *.c and *.h files.
+
+	* examples directory: renamed and added sequence files.
+
+	* README: augmented (and correct) examples.
+
+	* RNAeffective: proper behaviour for qflag now. Hadn't been
+	working before.
+
+	* Added options -u (maximum internal loop size per sequence) and
+	-v (maximum bulge loop size). (some time ago)
+	
+
Added: trunk/packages/rnahybrid/branches/upstream/current/INSTALL
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/INSTALL	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/INSTALL	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,16 @@
+Type
+
+        ./configure
+        make
+        make install
+
+to configure, make and install RNAhybrid. To enable graphical
+output for RNAhybrid, you need the libraries g2 for ps format
+and g2 and gd for png and jpg format. Without these libraries
+only textual output is supported.
+
+
+Type
+        make clean
+
+to remove object files.
Added: trunk/packages/rnahybrid/branches/upstream/current/Makefile.am
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/Makefile.am	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/Makefile.am	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,4 @@
+SUBDIRS = src man
+EXTRA_DIST = examples
+VERSION = 2.1
+
Added: trunk/packages/rnahybrid/branches/upstream/current/Makefile.in
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/Makefile.in	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/Makefile.in	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,501 @@
+# Makefile.in generated by automake 1.7.3 from Makefile.am.
+# @configure_input@
+
+# Copyright 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003
+# Free Software Foundation, Inc.
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+ at SET_MAKE@
+
+srcdir = @srcdir@
+top_srcdir = @top_srcdir@
+VPATH = @srcdir@
+pkgdatadir = $(datadir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+top_builddir = .
+
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+INSTALL = @INSTALL@
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+ACLOCAL = @ACLOCAL@
+AMDEP_FALSE = @AMDEP_FALSE@
+AMDEP_TRUE = @AMDEP_TRUE@
+AMTAR = @AMTAR@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+EXEEXT = @EXEEXT@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+OBJEXT = @OBJEXT@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = 2.1
+ac_ct_CC = @ac_ct_CC@
+ac_ct_STRIP = @ac_ct_STRIP@
+am__fastdepCC_FALSE = @am__fastdepCC_FALSE@
+am__fastdepCC_TRUE = @am__fastdepCC_TRUE@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+bindir = @bindir@
+build_alias = @build_alias@
+datadir = @datadir@
+exec_prefix = @exec_prefix@
+host_alias = @host_alias@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+oldincludedir = @oldincludedir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+SUBDIRS = src man
+EXTRA_DIST = examples
+subdir = .
+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
+mkinstalldirs = $(SHELL) $(top_srcdir)/mkinstalldirs
+CONFIG_HEADER = config.h
+CONFIG_CLEAN_FILES =
+DIST_SOURCES =
+
+RECURSIVE_TARGETS = info-recursive dvi-recursive pdf-recursive \
+	ps-recursive install-info-recursive uninstall-info-recursive \
+	all-recursive install-data-recursive install-exec-recursive \
+	installdirs-recursive install-recursive uninstall-recursive \
+	check-recursive installcheck-recursive
+DIST_COMMON = README AUTHORS COPYING ChangeLog INSTALL Makefile.am \
+	Makefile.in NEWS aclocal.m4 config.guess config.h.in configure \
+	configure.in depcomp install-sh missing mkinstalldirs
+DIST_SUBDIRS = $(SUBDIRS)
+all: config.h
+	$(MAKE) $(AM_MAKEFLAGS) all-recursive
+
+.SUFFIXES:
+
+am__CONFIG_DISTCLEAN_FILES = config.status config.cache config.log \
+ configure.lineno
+$(srcdir)/Makefile.in:  Makefile.am  $(top_srcdir)/configure.in $(ACLOCAL_M4)
+	cd $(top_srcdir) && \
+	  $(AUTOMAKE) --gnu  Makefile
+Makefile:  $(srcdir)/Makefile.in  $(top_builddir)/config.status
+	cd $(top_builddir) && $(SHELL) ./config.status $@ $(am__depfiles_maybe)
+
+$(top_builddir)/config.status: $(srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
+	$(SHELL) ./config.status --recheck
+$(srcdir)/configure:  $(srcdir)/configure.in $(ACLOCAL_M4) $(CONFIGURE_DEPENDENCIES)
+	cd $(srcdir) && $(AUTOCONF)
+
+$(ACLOCAL_M4):  configure.in 
+	cd $(srcdir) && $(ACLOCAL) $(ACLOCAL_AMFLAGS)
+
+config.h: stamp-h1
+	@if test ! -f $@; then \
+	  rm -f stamp-h1; \
+	  $(MAKE) stamp-h1; \
+	else :; fi
+
+stamp-h1: $(srcdir)/config.h.in $(top_builddir)/config.status
+	@rm -f stamp-h1
+	cd $(top_builddir) && $(SHELL) ./config.status config.h
+
+$(srcdir)/config.h.in:  $(top_srcdir)/configure.in $(ACLOCAL_M4) 
+	cd $(top_srcdir) && $(AUTOHEADER)
+	touch $(srcdir)/config.h.in
+
+distclean-hdr:
+	-rm -f config.h stamp-h1
+uninstall-info-am:
+
+# This directory's subdirectories are mostly independent; you can cd
+# into them and run `make' without going through this Makefile.
+# To change the values of `make' variables: instead of editing Makefiles,
+# (1) if the variable is set in `config.status', edit `config.status'
+#     (which will cause the Makefiles to be regenerated when you run `make');
+# (2) otherwise, pass the desired values on the `make' command line.
+$(RECURSIVE_TARGETS):
+	@set fnord $$MAKEFLAGS; amf=$$2; \
+	dot_seen=no; \
+	target=`echo $@ | sed s/-recursive//`; \
+	list='$(SUBDIRS)'; for subdir in $$list; do \
+	  echo "Making $$target in $$subdir"; \
+	  if test "$$subdir" = "."; then \
+	    dot_seen=yes; \
+	    local_target="$$target-am"; \
+	  else \
+	    local_target="$$target"; \
+	  fi; \
+	  (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \
+	   || case "$$amf" in *=*) exit 1;; *k*) fail=yes;; *) exit 1;; esac; \
+	done; \
+	if test "$$dot_seen" = "no"; then \
+	  $(MAKE) $(AM_MAKEFLAGS) "$$target-am" || exit 1; \
+	fi; test -z "$$fail"
+
+mostlyclean-recursive clean-recursive distclean-recursive \
+maintainer-clean-recursive:
+	@set fnord $$MAKEFLAGS; amf=$$2; \
+	dot_seen=no; \
+	case "$@" in \
+	  distclean-* | maintainer-clean-*) list='$(DIST_SUBDIRS)' ;; \
+	  *) list='$(SUBDIRS)' ;; \
+	esac; \
+	rev=''; for subdir in $$list; do \
+	  if test "$$subdir" = "."; then :; else \
+	    rev="$$subdir $$rev"; \
+	  fi; \
+	done; \
+	rev="$$rev ."; \
+	target=`echo $@ | sed s/-recursive//`; \
+	for subdir in $$rev; do \
+	  echo "Making $$target in $$subdir"; \
+	  if test "$$subdir" = "."; then \
+	    local_target="$$target-am"; \
+	  else \
+	    local_target="$$target"; \
+	  fi; \
+	  (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \
+	   || case "$$amf" in *=*) exit 1;; *k*) fail=yes;; *) exit 1;; esac; \
+	done && test -z "$$fail"
+tags-recursive:
+	list='$(SUBDIRS)'; for subdir in $$list; do \
+	  test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) tags); \
+	done
+ctags-recursive:
+	list='$(SUBDIRS)'; for subdir in $$list; do \
+	  test "$$subdir" = . || (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) ctags); \
+	done
+
+ETAGS = etags
+ETAGSFLAGS =
+
+CTAGS = ctags
+CTAGSFLAGS =
+
+tags: TAGS
+
+ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES)
+	list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \
+	unique=`for i in $$list; do \
+	    if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+	  done | \
+	  $(AWK) '    { files[$$0] = 1; } \
+	       END { for (i in files) print i; }'`; \
+	mkid -fID $$unique
+
+TAGS: tags-recursive $(HEADERS) $(SOURCES) config.h.in $(TAGS_DEPENDENCIES) \
+		$(TAGS_FILES) $(LISP)
+	tags=; \
+	here=`pwd`; \
+	list='$(SUBDIRS)'; for subdir in $$list; do \
+	  if test "$$subdir" = .; then :; else \
+	    test -f $$subdir/TAGS && tags="$$tags -i $$here/$$subdir/TAGS"; \
+	  fi; \
+	done; \
+	list='$(SOURCES) $(HEADERS) config.h.in $(LISP) $(TAGS_FILES)'; \
+	unique=`for i in $$list; do \
+	    if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+	  done | \
+	  $(AWK) '    { files[$$0] = 1; } \
+	       END { for (i in files) print i; }'`; \
+	test -z "$(ETAGS_ARGS)$$tags$$unique" \
+	  || $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+	     $$tags $$unique
+
+ctags: CTAGS
+CTAGS: ctags-recursive $(HEADERS) $(SOURCES) config.h.in $(TAGS_DEPENDENCIES) \
+		$(TAGS_FILES) $(LISP)
+	tags=; \
+	here=`pwd`; \
+	list='$(SOURCES) $(HEADERS) config.h.in $(LISP) $(TAGS_FILES)'; \
+	unique=`for i in $$list; do \
+	    if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+	  done | \
+	  $(AWK) '    { files[$$0] = 1; } \
+	       END { for (i in files) print i; }'`; \
+	test -z "$(CTAGS_ARGS)$$tags$$unique" \
+	  || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
+	     $$tags $$unique
+
+GTAGS:
+	here=`$(am__cd) $(top_builddir) && pwd` \
+	  && cd $(top_srcdir) \
+	  && gtags -i $(GTAGS_ARGS) $$here
+
+distclean-tags:
+	-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+
+top_distdir = .
+distdir = $(PACKAGE)-$(VERSION)
+
+am__remove_distdir = \
+  { test ! -d $(distdir) \
+    || { find $(distdir) -type d ! -perm -200 -exec chmod u+w {} ';' \
+         && rm -fr $(distdir); }; }
+
+GZIP_ENV = --best
+distuninstallcheck_listfiles = find . -type f -print
+distcleancheck_listfiles = find . -type f -print
+
+distdir: $(DISTFILES)
+	$(am__remove_distdir)
+	mkdir $(distdir)
+	@srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`; \
+	topsrcdirstrip=`echo "$(top_srcdir)" | sed 's|.|.|g'`; \
+	list='$(DISTFILES)'; for file in $$list; do \
+	  case $$file in \
+	    $(srcdir)/*) file=`echo "$$file" | sed "s|^$$srcdirstrip/||"`;; \
+	    $(top_srcdir)/*) file=`echo "$$file" | sed "s|^$$topsrcdirstrip/|$(top_builddir)/|"`;; \
+	  esac; \
+	  if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+	  dir=`echo "$$file" | sed -e 's,/[^/]*$$,,'`; \
+	  if test "$$dir" != "$$file" && test "$$dir" != "."; then \
+	    dir="/$$dir"; \
+	    $(mkinstalldirs) "$(distdir)$$dir"; \
+	  else \
+	    dir=''; \
+	  fi; \
+	  if test -d $$d/$$file; then \
+	    if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+	      cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \
+	    fi; \
+	    cp -pR $$d/$$file $(distdir)$$dir || exit 1; \
+	  else \
+	    test -f $(distdir)/$$file \
+	    || cp -p $$d/$$file $(distdir)/$$file \
+	    || exit 1; \
+	  fi; \
+	done
+	list='$(SUBDIRS)'; for subdir in $$list; do \
+	  if test "$$subdir" = .; then :; else \
+	    test -d $(distdir)/$$subdir \
+	    || mkdir $(distdir)/$$subdir \
+	    || exit 1; \
+	    (cd $$subdir && \
+	      $(MAKE) $(AM_MAKEFLAGS) \
+	        top_distdir="$(top_distdir)" \
+	        distdir=../$(distdir)/$$subdir \
+	        distdir) \
+	      || exit 1; \
+	  fi; \
+	done
+	-find $(distdir) -type d ! -perm -777 -exec chmod a+rwx {} \; -o \
+	  ! -type d ! -perm -444 -links 1 -exec chmod a+r {} \; -o \
+	  ! -type d ! -perm -400 -exec chmod a+r {} \; -o \
+	  ! -type d ! -perm -444 -exec $(SHELL) $(install_sh) -c -m a+r {} {} \; \
+	|| chmod -R a+r $(distdir)
+dist-gzip: distdir
+	$(AMTAR) chof - $(distdir) | GZIP=$(GZIP_ENV) gzip -c >$(distdir).tar.gz
+	$(am__remove_distdir)
+
+dist dist-all: distdir
+	$(AMTAR) chof - $(distdir) | GZIP=$(GZIP_ENV) gzip -c >$(distdir).tar.gz
+	$(am__remove_distdir)
+
+# This target untars the dist file and tries a VPATH configuration.  Then
+# it guarantees that the distribution is self-contained by making another
+# tarfile.
+distcheck: dist
+	$(am__remove_distdir)
+	GZIP=$(GZIP_ENV) gunzip -c $(distdir).tar.gz | $(AMTAR) xf -
+	chmod -R a-w $(distdir); chmod a+w $(distdir)
+	mkdir $(distdir)/_build
+	mkdir $(distdir)/_inst
+	chmod a-w $(distdir)
+	dc_install_base=`$(am__cd) $(distdir)/_inst && pwd | sed -e 's,^[^:\\/]:[\\/],/,'` \
+	  && dc_destdir="$${TMPDIR-/tmp}/am-dc-$$$$/" \
+	  && cd $(distdir)/_build \
+	  && ../configure --srcdir=.. --prefix="$$dc_install_base" \
+	    $(DISTCHECK_CONFIGURE_FLAGS) \
+	  && $(MAKE) $(AM_MAKEFLAGS) \
+	  && $(MAKE) $(AM_MAKEFLAGS) dvi \
+	  && $(MAKE) $(AM_MAKEFLAGS) check \
+	  && $(MAKE) $(AM_MAKEFLAGS) install \
+	  && $(MAKE) $(AM_MAKEFLAGS) installcheck \
+	  && $(MAKE) $(AM_MAKEFLAGS) uninstall \
+	  && $(MAKE) $(AM_MAKEFLAGS) distuninstallcheck_dir="$$dc_install_base" \
+	        distuninstallcheck \
+	  && chmod -R a-w "$$dc_install_base" \
+	  && ({ \
+	       (cd ../.. && $(mkinstalldirs) "$$dc_destdir") \
+	       && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" install \
+	       && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" uninstall \
+	       && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" \
+	            distuninstallcheck_dir="$$dc_destdir" distuninstallcheck; \
+	      } || { rm -rf "$$dc_destdir"; exit 1; }) \
+	  && rm -rf "$$dc_destdir" \
+	  && $(MAKE) $(AM_MAKEFLAGS) dist-gzip \
+	  && rm -f $(distdir).tar.gz \
+	  && $(MAKE) $(AM_MAKEFLAGS) distcleancheck
+	$(am__remove_distdir)
+	@echo "$(distdir).tar.gz is ready for distribution" | \
+	  sed 'h;s/./=/g;p;x;p;x'
+distuninstallcheck:
+	cd $(distuninstallcheck_dir) \
+	&& test `$(distuninstallcheck_listfiles) | wc -l` -le 1 \
+	   || { echo "ERROR: files left after uninstall:" ; \
+	        if test -n "$(DESTDIR)"; then \
+	          echo "  (check DESTDIR support)"; \
+	        fi ; \
+	        $(distuninstallcheck_listfiles) ; \
+	        exit 1; } >&2
+distcleancheck: distclean
+	if test '$(srcdir)' = . ; then \
+	  echo "ERROR: distcleancheck can only run from a VPATH build" ; \
+	  exit 1 ; \
+	fi
+	test `$(distcleancheck_listfiles) | wc -l` -eq 0 \
+	  || { echo "ERROR: files left in build directory after distclean:" ; \
+	       $(distcleancheck_listfiles) ; \
+	       exit 1; } >&2
+check-am: all-am
+check: check-recursive
+all-am: Makefile config.h
+installdirs: installdirs-recursive
+installdirs-am:
+
+install: install-recursive
+install-exec: install-exec-recursive
+install-data: install-data-recursive
+uninstall: uninstall-recursive
+
+install-am: all-am
+	@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-recursive
+install-strip:
+	$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	  INSTALL_STRIP_FLAG=-s \
+	  `test -z '$(STRIP)' || \
+	    echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+	-rm -f Makefile $(CONFIG_CLEAN_FILES)
+
+maintainer-clean-generic:
+	@echo "This command is intended for maintainers to use"
+	@echo "it deletes files that may require special tools to rebuild."
+clean: clean-recursive
+
+clean-am: clean-generic mostlyclean-am
+
+distclean: distclean-recursive
+	-rm -f $(am__CONFIG_DISTCLEAN_FILES)
+distclean-am: clean-am distclean-generic distclean-hdr distclean-tags
+
+dvi: dvi-recursive
+
+dvi-am:
+
+info: info-recursive
+
+info-am:
+
+install-data-am:
+
+install-exec-am:
+
+install-info: install-info-recursive
+
+install-man:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-recursive
+	-rm -f $(am__CONFIG_DISTCLEAN_FILES)
+	-rm -rf autom4te.cache
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-recursive
+
+mostlyclean-am: mostlyclean-generic
+
+pdf: pdf-recursive
+
+pdf-am:
+
+ps: ps-recursive
+
+ps-am:
+
+uninstall-am: uninstall-info-am
+
+uninstall-info: uninstall-info-recursive
+
+.PHONY: $(RECURSIVE_TARGETS) CTAGS GTAGS all all-am check check-am clean \
+	clean-generic clean-recursive ctags ctags-recursive dist \
+	dist-all dist-gzip distcheck distclean distclean-generic \
+	distclean-hdr distclean-recursive distclean-tags distcleancheck \
+	distdir distuninstallcheck dvi dvi-am dvi-recursive info \
+	info-am info-recursive install install-am install-data \
+	install-data-am install-data-recursive install-exec \
+	install-exec-am install-exec-recursive install-info \
+	install-info-am install-info-recursive install-man \
+	install-recursive install-strip installcheck installcheck-am \
+	installdirs installdirs-am installdirs-recursive \
+	maintainer-clean maintainer-clean-generic \
+	maintainer-clean-recursive mostlyclean mostlyclean-generic \
+	mostlyclean-recursive pdf pdf-am pdf-recursive ps ps-am \
+	ps-recursive tags tags-recursive uninstall uninstall-am \
+	uninstall-info-am uninstall-info-recursive uninstall-recursive
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
Added: trunk/packages/rnahybrid/branches/upstream/current/NEWS
===================================================================
Added: trunk/packages/rnahybrid/branches/upstream/current/README
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/README	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/README	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,130 @@
+RNAhybrid 2.0
+
+RNAhybrid is a tool for finding the minimum free energy hybridisation
+of a long (target) and a short (query) RNA. The hybridisation is
+performed in a kind of domain mode, ie. the short sequence is
+hybridised to the best fitting part of the long one. The tool is
+primarily meant as a means for microRNA target prediction.  In
+addition to mfes, the program calculates p-values based on extreme
+value distributions of length normalised energies.
+
+RNAcalibrate is a tool for calibrating minimum free energy (mfe)
+hybridisations performed with RNAhybrid. It searches a random database
+that can be given on the command line or otherwise generates random
+sequences according to given sample size, length distribution
+parameters and dinucleotide frequencies. To the empirical distribution
+of length normalised minimum free energies, parameters of an extreme
+value distribution (evd) are fitted. The resulting location and scale
+parameters of the evd can then be given to RNAhybrid for the
+calculation of mfe p-values.
+
+RNAeffective is a tool for determining the effective number of
+orthologous miRNA targets.  This number can be used for the
+calculation of more accurate joint p-values in multi-species
+analyses. RNAeffective searches a set of target sequences with random
+miRNAs that can be given on the command line or otherwise generates
+random sequences according to given sample size, length distribution
+parameters and dinucleotide frequencies. The empirical distribution of
+joint p-values is compared to the p-values themselves, and the
+effective number of independent targets is the one that reduces the
+deviation between the two distributions.
+
+
+For installation, see the file INSTALL.
+
+
+After installation, try the following examples (make sure that RNAhybrid,
+RNAcalibrate and RNAeffective are in your PATH by then):
+
+
+    RNAhybrid -s 3utr_worm -t examples/cel-hbl-1.fasta -q examples/cel-let-7.fasta
+
+
+This searches the C. elegans hbl-1 3'UTR with the C. elegans let-7
+miRNA. The option -s tells RNAhybrid to quickly estimate statistical
+parameters from "minimal duplex energies" under the assumption that
+the target sequences are worm (C. elegans, to be precise) 3'UTR
+sequences. You can also use 3utr_fly and 3utr_human.
+
+To get a better estimate of statistical parameters, use RNAcalibrate:
+
+
+    RNAcalibrate -d examples/3UTR_worm.freq -k 50 -l 50,30 -q examples/cel-let-7.fasta
+
+
+This generates 50 random sequences with lengths distributed according
+to a normal (Gaussian) distribution with mean 50 and standard
+deviation 30, following the dinucleotide distribution that is defined
+in the file 3UTR_worm.freq in the examples dicrectory. The output are
+the parameters of an extreme value distribution (location and
+shape). Since with 50 random sequences the estimate is not very
+accurate, you should use larger numbers of several thousand. Default
+values for -k and -l are 5000 and 500,300, respectively, so you can
+omit these options.
+
+The estimated parameters can be used with RNAhybrid for accurate
+p-value calculation of length normalised minimum free energies:
+
+
+RNAhybrid -d 1.9,0.28 -t examples/cel-hbl-1.fasta -q examples/cel-let-7.fasta
+
+
+Here, 1.9 is the location parameter and 0.28 the shape parameter of
+the assumed extreme value distribution.
+
+If you want to force miRNA/target duplexes to have a helix in a specified
+part, for example at the 5'-end of the miRNA, use the -f option:
+
+
+RNAhybrid -f 2,7 -d 1.9,0.28 -t examples/cel-hbl-1.fasta -q examples/cel-let-7.fasta
+
+
+-f 2,7 tells RNAhybrid to force the duplexes to have a helix (ie. an
+uninterrupted stretch of base pairs, no bulges, no internal loops)
+from nucleotide 2 to nucleotide 7 in the miRNA.
+
+Since such a structural constraint affects the statistical
+significance of matches, you should use RNAcalibrate with the same
+constraint:
+
+
+RNAcalibrate -f 2,7 -d examples/3UTR_worm.freq -k 50 -l 50,30 -q examples/cel-let-7.fasta
+
+
+Be aware that you might need a larger sample (larger -k value) to get
+a good estimate of statistical parameters, especially for shorter
+sequences. This is, because it is not for all miRNA/target
+combinations possible to form a helix at the specified positions.
+
+To get a feeling of how stable the parameter estimates are, repeat the
+calibration several times and have a look at the resulting values.
+
+
+In a cross-species analysis, you would search C. briggsae sequences as
+well:
+
+
+RNAhybrid -s 3utr_worm -t examples/cbr-hbl-1.fasta -q examples/cel-let-7.fasta
+
+
+To assess how much evidence the use of multiple species adds, you can
+calculate the effective number of orthologous sequences:
+
+
+RNAeffective -k 30 -s -t examples/hbl-1.fasta -q examples/cel-let-7.fasta
+
+
+Here, hbl-1.fasta contains both hbl-1 3'UTR sequences (C. elegans and
+C. briggsae). The output tells you an effective number of 1.3, which
+means that the two sequences are statistically rather dependent, and
+that it is not that surprising to find a good hit in cbr-hbl-1 if you
+have found one in cel-hbl-1. The closer the effective number is to the
+actual number (2 in this example), the statistically more independent
+the sequences are. Like in the RNAcalibrate examples, the -k option
+should take larger values, although the calculations are very time
+consuming.
+
+
+In general, target files (-t option) and query (miRNA) files (-q
+option) can be multiple fasta files. The searches are performed in all
+combinations (all queries vs. all targets).
Added: trunk/packages/rnahybrid/branches/upstream/current/aclocal.m4
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/aclocal.m4	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/aclocal.m4	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,852 @@
+# generated automatically by aclocal 1.7.3 -*- Autoconf -*-
+
+# Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2002
+# Free Software Foundation, Inc.
+# This file is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+# Do all the work for Automake.                            -*- Autoconf -*-
+
+# This macro actually does too much some checks are only needed if
+# your package does certain things.  But this isn't really a big deal.
+
+# Copyright 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003
+# Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+# serial 9
+
+# There are a few dirty hacks below to avoid letting `AC_PROG_CC' be
+# written in clear, in which case automake, when reading aclocal.m4,
+# will think it sees a *use*, and therefore will trigger all it's
+# C support machinery.  Also note that it means that autoscan, seeing
+# CC etc. in the Makefile, will ask for an AC_PROG_CC use...
+
+
+AC_PREREQ([2.54])
+
+# Autoconf 2.50 wants to disallow AM_ names.  We explicitly allow
+# the ones we care about.
+m4_pattern_allow([^AM_[A-Z]+FLAGS$])dnl
+
+# AM_INIT_AUTOMAKE(PACKAGE, VERSION, [NO-DEFINE])
+# AM_INIT_AUTOMAKE([OPTIONS])
+# -----------------------------------------------
+# The call with PACKAGE and VERSION arguments is the old style
+# call (pre autoconf-2.50), which is being phased out.  PACKAGE
+# and VERSION should now be passed to AC_INIT and removed from
+# the call to AM_INIT_AUTOMAKE.
+# We support both call styles for the transition.  After
+# the next Automake release, Autoconf can make the AC_INIT
+# arguments mandatory, and then we can depend on a new Autoconf
+# release and drop the old call support.
+AC_DEFUN([AM_INIT_AUTOMAKE],
+[AC_REQUIRE([AM_SET_CURRENT_AUTOMAKE_VERSION])dnl
+ AC_REQUIRE([AC_PROG_INSTALL])dnl
+# test to see if srcdir already configured
+if test "`cd $srcdir && pwd`" != "`pwd`" &&
+   test -f $srcdir/config.status; then
+  AC_MSG_ERROR([source directory already configured; run "make distclean" there first])
+fi
+
+# test whether we have cygpath
+if test -z "$CYGPATH_W"; then
+  if (cygpath --version) >/dev/null 2>/dev/null; then
+    CYGPATH_W='cygpath -w'
+  else
+    CYGPATH_W=echo
+  fi
+fi
+AC_SUBST([CYGPATH_W])
+
+# Define the identity of the package.
+dnl Distinguish between old-style and new-style calls.
+m4_ifval([$2],
+[m4_ifval([$3], [_AM_SET_OPTION([no-define])])dnl
+ AC_SUBST([PACKAGE], [$1])dnl
+ AC_SUBST([VERSION], [$2])],
+[_AM_SET_OPTIONS([$1])dnl
+ AC_SUBST([PACKAGE], ['AC_PACKAGE_TARNAME'])dnl
+ AC_SUBST([VERSION], ['AC_PACKAGE_VERSION'])])dnl
+
+_AM_IF_OPTION([no-define],,
+[AC_DEFINE_UNQUOTED(PACKAGE, "$PACKAGE", [Name of package])
+ AC_DEFINE_UNQUOTED(VERSION, "$VERSION", [Version number of package])])dnl
+
+# Some tools Automake needs.
+AC_REQUIRE([AM_SANITY_CHECK])dnl
+AC_REQUIRE([AC_ARG_PROGRAM])dnl
+AM_MISSING_PROG(ACLOCAL, aclocal-${am__api_version})
+AM_MISSING_PROG(AUTOCONF, autoconf)
+AM_MISSING_PROG(AUTOMAKE, automake-${am__api_version})
+AM_MISSING_PROG(AUTOHEADER, autoheader)
+AM_MISSING_PROG(MAKEINFO, makeinfo)
+AM_MISSING_PROG(AMTAR, tar)
+AM_PROG_INSTALL_SH
+AM_PROG_INSTALL_STRIP
+# We need awk for the "check" target.  The system "awk" is bad on
+# some platforms.
+AC_REQUIRE([AC_PROG_AWK])dnl
+AC_REQUIRE([AC_PROG_MAKE_SET])dnl
+AC_REQUIRE([AM_SET_LEADING_DOT])dnl
+
+_AM_IF_OPTION([no-dependencies],,
+[AC_PROVIDE_IFELSE([AC_PROG_CC],
+                  [_AM_DEPENDENCIES(CC)],
+                  [define([AC_PROG_CC],
+                          defn([AC_PROG_CC])[_AM_DEPENDENCIES(CC)])])dnl
+AC_PROVIDE_IFELSE([AC_PROG_CXX],
+                  [_AM_DEPENDENCIES(CXX)],
+                  [define([AC_PROG_CXX],
+                          defn([AC_PROG_CXX])[_AM_DEPENDENCIES(CXX)])])dnl
+])
+])
+
+
+# When config.status generates a header, we must update the stamp-h file.
+# This file resides in the same directory as the config header
+# that is generated.  The stamp files are numbered to have different names.
+
+# Autoconf calls _AC_AM_CONFIG_HEADER_HOOK (when defined) in the
+# loop where config.status creates the headers, so we can generate
+# our stamp files there.
+AC_DEFUN([_AC_AM_CONFIG_HEADER_HOOK],
+[# Compute $1's index in $config_headers.
+_am_stamp_count=1
+for _am_header in $config_headers :; do
+  case $_am_header in
+    $1 | $1:* )
+      break ;;
+    * )
+      _am_stamp_count=`expr $_am_stamp_count + 1` ;;
+  esac
+done
+echo "timestamp for $1" >`AS_DIRNAME([$1])`/stamp-h[]$_am_stamp_count])
+
+# Copyright 2002  Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+
+# AM_AUTOMAKE_VERSION(VERSION)
+# ----------------------------
+# Automake X.Y traces this macro to ensure aclocal.m4 has been
+# generated from the m4 files accompanying Automake X.Y.
+AC_DEFUN([AM_AUTOMAKE_VERSION],[am__api_version="1.7"])
+
+# AM_SET_CURRENT_AUTOMAKE_VERSION
+# -------------------------------
+# Call AM_AUTOMAKE_VERSION so it can be traced.
+# This function is AC_REQUIREd by AC_INIT_AUTOMAKE.
+AC_DEFUN([AM_SET_CURRENT_AUTOMAKE_VERSION],
+	 [AM_AUTOMAKE_VERSION([1.7.3])])
+
+# Helper functions for option handling.                    -*- Autoconf -*-
+
+# Copyright 2001, 2002  Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+# serial 2
+
+# _AM_MANGLE_OPTION(NAME)
+# -----------------------
+AC_DEFUN([_AM_MANGLE_OPTION],
+[[_AM_OPTION_]m4_bpatsubst($1, [[^a-zA-Z0-9_]], [_])])
+
+# _AM_SET_OPTION(NAME)
+# ------------------------------
+# Set option NAME.  Presently that only means defining a flag for this option.
+AC_DEFUN([_AM_SET_OPTION],
+[m4_define(_AM_MANGLE_OPTION([$1]), 1)])
+
+# _AM_SET_OPTIONS(OPTIONS)
+# ----------------------------------
+# OPTIONS is a space-separated list of Automake options.
+AC_DEFUN([_AM_SET_OPTIONS],
+[AC_FOREACH([_AM_Option], [$1], [_AM_SET_OPTION(_AM_Option)])])
+
+# _AM_IF_OPTION(OPTION, IF-SET, [IF-NOT-SET])
+# -------------------------------------------
+# Execute IF-SET if OPTION is set, IF-NOT-SET otherwise.
+AC_DEFUN([_AM_IF_OPTION],
+[m4_ifset(_AM_MANGLE_OPTION([$1]), [$2], [$3])])
+
+#
+# Check to make sure that the build environment is sane.
+#
+
+# Copyright 1996, 1997, 2000, 2001 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+# serial 3
+
+# AM_SANITY_CHECK
+# ---------------
+AC_DEFUN([AM_SANITY_CHECK],
+[AC_MSG_CHECKING([whether build environment is sane])
+# Just in case
+sleep 1
+echo timestamp > conftest.file
+# Do `set' in a subshell so we don't clobber the current shell's
+# arguments.  Must try -L first in case configure is actually a
+# symlink; some systems play weird games with the mod time of symlinks
+# (eg FreeBSD returns the mod time of the symlink's containing
+# directory).
+if (
+   set X `ls -Lt $srcdir/configure conftest.file 2> /dev/null`
+   if test "$[*]" = "X"; then
+      # -L didn't work.
+      set X `ls -t $srcdir/configure conftest.file`
+   fi
+   rm -f conftest.file
+   if test "$[*]" != "X $srcdir/configure conftest.file" \
+      && test "$[*]" != "X conftest.file $srcdir/configure"; then
+
+      # If neither matched, then we have a broken ls.  This can happen
+      # if, for instance, CONFIG_SHELL is bash and it inherits a
+      # broken ls alias from the environment.  This has actually
+      # happened.  Such a system could not be considered "sane".
+      AC_MSG_ERROR([ls -t appears to fail.  Make sure there is not a broken
+alias in your environment])
+   fi
+
+   test "$[2]" = conftest.file
+   )
+then
+   # Ok.
+   :
+else
+   AC_MSG_ERROR([newly created file is older than distributed files!
+Check your system clock])
+fi
+AC_MSG_RESULT(yes)])
+
+#  -*- Autoconf -*-
+
+
+# Copyright 1997, 1999, 2000, 2001 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+# serial 3
+
+# AM_MISSING_PROG(NAME, PROGRAM)
+# ------------------------------
+AC_DEFUN([AM_MISSING_PROG],
+[AC_REQUIRE([AM_MISSING_HAS_RUN])
+$1=${$1-"${am_missing_run}$2"}
+AC_SUBST($1)])
+
+
+# AM_MISSING_HAS_RUN
+# ------------------
+# Define MISSING if not defined so far and test if it supports --run.
+# If it does, set am_missing_run to use it, otherwise, to nothing.
+AC_DEFUN([AM_MISSING_HAS_RUN],
+[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
+test x"${MISSING+set}" = xset || MISSING="\${SHELL} $am_aux_dir/missing"
+# Use eval to expand $SHELL
+if eval "$MISSING --run true"; then
+  am_missing_run="$MISSING --run "
+else
+  am_missing_run=
+  AC_MSG_WARN([`missing' script is too old or missing])
+fi
+])
+
+# AM_AUX_DIR_EXPAND
+
+# Copyright 2001 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+# For projects using AC_CONFIG_AUX_DIR([foo]), Autoconf sets
+# $ac_aux_dir to `$srcdir/foo'.  In other projects, it is set to
+# `$srcdir', `$srcdir/..', or `$srcdir/../..'.
+#
+# Of course, Automake must honor this variable whenever it calls a
+# tool from the auxiliary directory.  The problem is that $srcdir (and
+# therefore $ac_aux_dir as well) can be either absolute or relative,
+# depending on how configure is run.  This is pretty annoying, since
+# it makes $ac_aux_dir quite unusable in subdirectories: in the top
+# source directory, any form will work fine, but in subdirectories a
+# relative path needs to be adjusted first.
+#
+# $ac_aux_dir/missing
+#    fails when called from a subdirectory if $ac_aux_dir is relative
+# $top_srcdir/$ac_aux_dir/missing
+#    fails if $ac_aux_dir is absolute,
+#    fails when called from a subdirectory in a VPATH build with
+#          a relative $ac_aux_dir
+#
+# The reason of the latter failure is that $top_srcdir and $ac_aux_dir
+# are both prefixed by $srcdir.  In an in-source build this is usually
+# harmless because $srcdir is `.', but things will broke when you
+# start a VPATH build or use an absolute $srcdir.
+#
+# So we could use something similar to $top_srcdir/$ac_aux_dir/missing,
+# iff we strip the leading $srcdir from $ac_aux_dir.  That would be:
+#   am_aux_dir='\$(top_srcdir)/'`expr "$ac_aux_dir" : "$srcdir//*\(.*\)"`
+# and then we would define $MISSING as
+#   MISSING="\${SHELL} $am_aux_dir/missing"
+# This will work as long as MISSING is not called from configure, because
+# unfortunately $(top_srcdir) has no meaning in configure.
+# However there are other variables, like CC, which are often used in
+# configure, and could therefore not use this "fixed" $ac_aux_dir.
+#
+# Another solution, used here, is to always expand $ac_aux_dir to an
+# absolute PATH.  The drawback is that using absolute paths prevent a
+# configured tree to be moved without reconfiguration.
+
+# Rely on autoconf to set up CDPATH properly.
+AC_PREREQ([2.50])
+
+AC_DEFUN([AM_AUX_DIR_EXPAND], [
+# expand $ac_aux_dir to an absolute path
+am_aux_dir=`cd $ac_aux_dir && pwd`
+])
+
+# AM_PROG_INSTALL_SH
+# ------------------
+# Define $install_sh.
+
+# Copyright 2001 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+AC_DEFUN([AM_PROG_INSTALL_SH],
+[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
+install_sh=${install_sh-"$am_aux_dir/install-sh"}
+AC_SUBST(install_sh)])
+
+# AM_PROG_INSTALL_STRIP
+
+# Copyright 2001 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+# One issue with vendor `install' (even GNU) is that you can't
+# specify the program used to strip binaries.  This is especially
+# annoying in cross-compiling environments, where the build's strip
+# is unlikely to handle the host's binaries.
+# Fortunately install-sh will honor a STRIPPROG variable, so we
+# always use install-sh in `make install-strip', and initialize
+# STRIPPROG with the value of the STRIP variable (set by the user).
+AC_DEFUN([AM_PROG_INSTALL_STRIP],
+[AC_REQUIRE([AM_PROG_INSTALL_SH])dnl
+# Installed binaries are usually stripped using `strip' when the user
+# run `make install-strip'.  However `strip' might not be the right
+# tool to use in cross-compilation environments, therefore Automake
+# will honor the `STRIP' environment variable to overrule this program.
+dnl Don't test for $cross_compiling = yes, because it might be `maybe'.
+if test "$cross_compiling" != no; then
+  AC_CHECK_TOOL([STRIP], [strip], :)
+fi
+INSTALL_STRIP_PROGRAM="\${SHELL} \$(install_sh) -c -s"
+AC_SUBST([INSTALL_STRIP_PROGRAM])])
+
+#                                                          -*- Autoconf -*-
+# Copyright (C) 2003  Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+# serial 1
+
+# Check whether the underlying file-system supports filenames
+# with a leading dot.  For instance MS-DOS doesn't.
+AC_DEFUN([AM_SET_LEADING_DOT],
+[rm -rf .tst 2>/dev/null
+mkdir .tst 2>/dev/null
+if test -d .tst; then
+  am__leading_dot=.
+else
+  am__leading_dot=_
+fi
+rmdir .tst 2>/dev/null
+AC_SUBST([am__leading_dot])])
+
+# serial 5						-*- Autoconf -*-
+
+# Copyright (C) 1999, 2000, 2001, 2002, 2003  Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+
+# There are a few dirty hacks below to avoid letting `AC_PROG_CC' be
+# written in clear, in which case automake, when reading aclocal.m4,
+# will think it sees a *use*, and therefore will trigger all it's
+# C support machinery.  Also note that it means that autoscan, seeing
+# CC etc. in the Makefile, will ask for an AC_PROG_CC use...
+
+
+
+# _AM_DEPENDENCIES(NAME)
+# ----------------------
+# See how the compiler implements dependency checking.
+# NAME is "CC", "CXX", "GCJ", or "OBJC".
+# We try a few techniques and use that to set a single cache variable.
+#
+# We don't AC_REQUIRE the corresponding AC_PROG_CC since the latter was
+# modified to invoke _AM_DEPENDENCIES(CC); we would have a circular
+# dependency, and given that the user is not expected to run this macro,
+# just rely on AC_PROG_CC.
+AC_DEFUN([_AM_DEPENDENCIES],
+[AC_REQUIRE([AM_SET_DEPDIR])dnl
+AC_REQUIRE([AM_OUTPUT_DEPENDENCY_COMMANDS])dnl
+AC_REQUIRE([AM_MAKE_INCLUDE])dnl
+AC_REQUIRE([AM_DEP_TRACK])dnl
+
+ifelse([$1], CC,   [depcc="$CC"   am_compiler_list=],
+       [$1], CXX,  [depcc="$CXX"  am_compiler_list=],
+       [$1], OBJC, [depcc="$OBJC" am_compiler_list='gcc3 gcc'],
+       [$1], GCJ,  [depcc="$GCJ"  am_compiler_list='gcc3 gcc'],
+                   [depcc="$$1"   am_compiler_list=])
+
+AC_CACHE_CHECK([dependency style of $depcc],
+               [am_cv_$1_dependencies_compiler_type],
+[if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
+  # We make a subdir and do the tests there.  Otherwise we can end up
+  # making bogus files that we don't know about and never remove.  For
+  # instance it was reported that on HP-UX the gcc test will end up
+  # making a dummy file named `D' -- because `-MD' means `put the output
+  # in D'.
+  mkdir conftest.dir
+  # Copy depcomp to subdir because otherwise we won't find it if we're
+  # using a relative directory.
+  cp "$am_depcomp" conftest.dir
+  cd conftest.dir
+
+  am_cv_$1_dependencies_compiler_type=none
+  if test "$am_compiler_list" = ""; then
+     am_compiler_list=`sed -n ['s/^#*\([a-zA-Z0-9]*\))$/\1/p'] < ./depcomp`
+  fi
+  for depmode in $am_compiler_list; do
+    # We need to recreate these files for each test, as the compiler may
+    # overwrite some of them when testing with obscure command lines.
+    # This happens at least with the AIX C compiler.
+    echo '#include "conftest.h"' > conftest.c
+    echo 'int i;' > conftest.h
+    echo "${am__include} ${am__quote}conftest.Po${am__quote}" > confmf
+
+    case $depmode in
+    nosideeffect)
+      # after this tag, mechanisms are not by side-effect, so they'll
+      # only be used when explicitly requested
+      if test "x$enable_dependency_tracking" = xyes; then
+	continue
+      else
+	break
+      fi
+      ;;
+    none) break ;;
+    esac
+    # We check with `-c' and `-o' for the sake of the "dashmstdout"
+    # mode.  It turns out that the SunPro C++ compiler does not properly
+    # handle `-M -o', and we need to detect this.
+    if depmode=$depmode \
+       source=conftest.c object=conftest.o \
+       depfile=conftest.Po tmpdepfile=conftest.TPo \
+       $SHELL ./depcomp $depcc -c -o conftest.o conftest.c \
+         >/dev/null 2>conftest.err &&
+       grep conftest.h conftest.Po > /dev/null 2>&1 &&
+       ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
+      # icc doesn't choke on unknown options, it will just issue warnings
+      # (even with -Werror).  So we grep stderr for any message
+      # that says an option was ignored.
+      if grep 'ignoring option' conftest.err >/dev/null 2>&1; then :; else
+        am_cv_$1_dependencies_compiler_type=$depmode
+        break
+      fi
+    fi
+  done
+
+  cd ..
+  rm -rf conftest.dir
+else
+  am_cv_$1_dependencies_compiler_type=none
+fi
+])
+AC_SUBST([$1DEPMODE], [depmode=$am_cv_$1_dependencies_compiler_type])
+AM_CONDITIONAL([am__fastdep$1], [
+  test "x$enable_dependency_tracking" != xno \
+  && test "$am_cv_$1_dependencies_compiler_type" = gcc3])
+])
+
+
+# AM_SET_DEPDIR
+# -------------
+# Choose a directory name for dependency files.
+# This macro is AC_REQUIREd in _AM_DEPENDENCIES
+AC_DEFUN([AM_SET_DEPDIR],
+[AC_REQUIRE([AM_SET_LEADING_DOT])dnl
+AC_SUBST([DEPDIR], ["${am__leading_dot}deps"])dnl
+])
+
+
+# AM_DEP_TRACK
+# ------------
+AC_DEFUN([AM_DEP_TRACK],
+[AC_ARG_ENABLE(dependency-tracking,
+[  --disable-dependency-tracking Speeds up one-time builds
+  --enable-dependency-tracking  Do not reject slow dependency extractors])
+if test "x$enable_dependency_tracking" != xno; then
+  am_depcomp="$ac_aux_dir/depcomp"
+  AMDEPBACKSLASH='\'
+fi
+AM_CONDITIONAL([AMDEP], [test "x$enable_dependency_tracking" != xno])
+AC_SUBST([AMDEPBACKSLASH])
+])
+
+# Generate code to set up dependency tracking.   -*- Autoconf -*-
+
+# Copyright 1999, 2000, 2001, 2002 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+#serial 2
+
+# _AM_OUTPUT_DEPENDENCY_COMMANDS
+# ------------------------------
+AC_DEFUN([_AM_OUTPUT_DEPENDENCY_COMMANDS],
+[for mf in $CONFIG_FILES; do
+  # Strip MF so we end up with the name of the file.
+  mf=`echo "$mf" | sed -e 's/:.*$//'`
+  # Check whether this is an Automake generated Makefile or not.
+  # We used to match only the files named `Makefile.in', but
+  # some people rename them; so instead we look at the file content.
+  # Grep'ing the first line is not enough: some people post-process
+  # each Makefile.in and add a new line on top of each file to say so.
+  # So let's grep whole file.
+  if grep '^#.*generated by automake' $mf > /dev/null 2>&1; then
+    dirpart=`AS_DIRNAME("$mf")`
+  else
+    continue
+  fi
+  grep '^DEP_FILES *= *[[^ @%:@]]' < "$mf" > /dev/null || continue
+  # Extract the definition of DEP_FILES from the Makefile without
+  # running `make'.
+  DEPDIR=`sed -n -e '/^DEPDIR = / s///p' < "$mf"`
+  test -z "$DEPDIR" && continue
+  # When using ansi2knr, U may be empty or an underscore; expand it
+  U=`sed -n -e '/^U = / s///p' < "$mf"`
+  test -d "$dirpart/$DEPDIR" || mkdir "$dirpart/$DEPDIR"
+  # We invoke sed twice because it is the simplest approach to
+  # changing $(DEPDIR) to its actual value in the expansion.
+  for file in `sed -n -e '
+    /^DEP_FILES = .*\\\\$/ {
+      s/^DEP_FILES = //
+      :loop
+	s/\\\\$//
+	p
+	n
+	/\\\\$/ b loop
+      p
+    }
+    /^DEP_FILES = / s/^DEP_FILES = //p' < "$mf" | \
+       sed -e 's/\$(DEPDIR)/'"$DEPDIR"'/g' -e 's/\$U/'"$U"'/g'`; do
+    # Make sure the directory exists.
+    test -f "$dirpart/$file" && continue
+    fdir=`AS_DIRNAME(["$file"])`
+    AS_MKDIR_P([$dirpart/$fdir])
+    # echo "creating $dirpart/$file"
+    echo '# dummy' > "$dirpart/$file"
+  done
+done
+])# _AM_OUTPUT_DEPENDENCY_COMMANDS
+
+
+# AM_OUTPUT_DEPENDENCY_COMMANDS
+# -----------------------------
+# This macro should only be invoked once -- use via AC_REQUIRE.
+#
+# This code is only required when automatic dependency tracking
+# is enabled.  FIXME.  This creates each `.P' file that we will
+# need in order to bootstrap the dependency handling code.
+AC_DEFUN([AM_OUTPUT_DEPENDENCY_COMMANDS],
+[AC_CONFIG_COMMANDS([depfiles],
+     [test x"$AMDEP_TRUE" != x"" || _AM_OUTPUT_DEPENDENCY_COMMANDS],
+     [AMDEP_TRUE="$AMDEP_TRUE" ac_aux_dir="$ac_aux_dir"])
+])
+
+# Check to see how 'make' treats includes.	-*- Autoconf -*-
+
+# Copyright (C) 2001, 2002 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+# serial 2
+
+# AM_MAKE_INCLUDE()
+# -----------------
+# Check to see how make treats includes.
+AC_DEFUN([AM_MAKE_INCLUDE],
+[am_make=${MAKE-make}
+cat > confinc << 'END'
+doit:
+	@echo done
+END
+# If we don't find an include directive, just comment out the code.
+AC_MSG_CHECKING([for style of include used by $am_make])
+am__include="#"
+am__quote=
+_am_result=none
+# First try GNU make style include.
+echo "include confinc" > confmf
+# We grep out `Entering directory' and `Leaving directory'
+# messages which can occur if `w' ends up in MAKEFLAGS.
+# In particular we don't look at `^make:' because GNU make might
+# be invoked under some other name (usually "gmake"), in which
+# case it prints its new name instead of `make'.
+if test "`$am_make -s -f confmf 2> /dev/null | grep -v 'ing directory'`" = "done"; then
+   am__include=include
+   am__quote=
+   _am_result=GNU
+fi
+# Now try BSD make style include.
+if test "$am__include" = "#"; then
+   echo '.include "confinc"' > confmf
+   if test "`$am_make -s -f confmf 2> /dev/null`" = "done"; then
+      am__include=.include
+      am__quote="\""
+      _am_result=BSD
+   fi
+fi
+AC_SUBST(am__include)
+AC_SUBST(am__quote)
+AC_MSG_RESULT($_am_result)
+rm -f confinc confmf
+])
+
+# AM_CONDITIONAL                                              -*- Autoconf -*-
+
+# Copyright 1997, 2000, 2001 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+# serial 5
+
+AC_PREREQ(2.52)
+
+# AM_CONDITIONAL(NAME, SHELL-CONDITION)
+# -------------------------------------
+# Define a conditional.
+AC_DEFUN([AM_CONDITIONAL],
+[ifelse([$1], [TRUE],  [AC_FATAL([$0: invalid condition: $1])],
+        [$1], [FALSE], [AC_FATAL([$0: invalid condition: $1])])dnl
+AC_SUBST([$1_TRUE])
+AC_SUBST([$1_FALSE])
+if $2; then
+  $1_TRUE=
+  $1_FALSE='#'
+else
+  $1_TRUE='#'
+  $1_FALSE=
+fi
+AC_CONFIG_COMMANDS_PRE(
+[if test -z "${$1_TRUE}" && test -z "${$1_FALSE}"; then
+  AC_MSG_ERROR([conditional "$1" was never defined.
+Usually this means the macro was only invoked conditionally.])
+fi])])
+
+# Like AC_CONFIG_HEADER, but automatically create stamp file. -*- Autoconf -*-
+
+# Copyright 1996, 1997, 2000, 2001 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+AC_PREREQ([2.52])
+
+# serial 6
+
+# AM_CONFIG_HEADER is obsolete.  It has been replaced by AC_CONFIG_HEADERS.
+AU_DEFUN([AM_CONFIG_HEADER], [AC_CONFIG_HEADERS($@)])
+
Added: trunk/packages/rnahybrid/branches/upstream/current/config.guess
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/config.guess	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/config.guess	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,1354 @@
+#! /bin/sh
+# Attempt to guess a canonical system name.
+#   Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999,
+#   2000, 2001, 2002 Free Software Foundation, Inc.
+
+timestamp='2002-07-23'
+
+# This file is free software; you can redistribute it and/or modify it
+# under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2 of the License, or
+# (at your option) any later version.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+# General Public License for more details.
+#
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.
+#
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+# Originally written by Per Bothner <per at bothner.com>.
+# Please send patches to <config-patches at gnu.org>.  Submit a context
+# diff and a properly formatted ChangeLog entry.
+#
+# This script attempts to guess a canonical system name similar to
+# config.sub.  If it succeeds, it prints the system name on stdout, and
+# exits with 0.  Otherwise, it exits with 1.
+#
+# The plan is that this can be called by configure scripts if you
+# don't specify an explicit build system type.
+
+me=`echo "$0" | sed -e 's,.*/,,'`
+
+usage="\
+Usage: $0 [OPTION]
+
+Output the configuration name of the system \`$me' is run on.
+
+Operation modes:
+  -h, --help         print this help, then exit
+  -t, --time-stamp   print date of last modification, then exit
+  -v, --version      print version number, then exit
+
+Report bugs and patches to <config-patches at gnu.org>."
+
+version="\
+GNU config.guess ($timestamp)
+
+Originally written by Per Bothner.
+Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001
+Free Software Foundation, Inc.
+
+This is free software; see the source for copying conditions.  There is NO
+warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE."
+
+help="
+Try \`$me --help' for more information."
+
+# Parse command line
+while test $# -gt 0 ; do
+  case $1 in
+    --time-stamp | --time* | -t )
+       echo "$timestamp" ; exit 0 ;;
+    --version | -v )
+       echo "$version" ; exit 0 ;;
+    --help | --h* | -h )
+       echo "$usage"; exit 0 ;;
+    -- )     # Stop option processing
+       shift; break ;;
+    - )	# Use stdin as input.
+       break ;;
+    -* )
+       echo "$me: invalid option $1$help" >&2
+       exit 1 ;;
+    * )
+       break ;;
+  esac
+done
+
+if test $# != 0; then
+  echo "$me: too many arguments$help" >&2
+  exit 1
+fi
+
+trap 'exit 1' 1 2 15
+
+# CC_FOR_BUILD -- compiler used by this script. Note that the use of a
+# compiler to aid in system detection is discouraged as it requires
+# temporary files to be created and, as you can see below, it is a
+# headache to deal with in a portable fashion.
+
+# Historically, `CC_FOR_BUILD' used to be named `HOST_CC'. We still
+# use `HOST_CC' if defined, but it is deprecated.
+
+# This shell variable is my proudest work .. or something. --bje
+
+set_cc_for_build='tmpdir=${TMPDIR-/tmp}/config-guess-$$ ;
+(old=`umask` && umask 077 && mkdir $tmpdir && umask $old && unset old)
+   || (echo "$me: cannot create $tmpdir" >&2 && exit 1) ;
+dummy=$tmpdir/dummy ;
+files="$dummy.c $dummy.o $dummy.rel $dummy" ;
+trap '"'"'rm -f $files; rmdir $tmpdir; exit 1'"'"' 1 2 15 ;
+case $CC_FOR_BUILD,$HOST_CC,$CC in
+ ,,)    echo "int x;" > $dummy.c ;
+	for c in cc gcc c89 c99 ; do
+	  if ($c $dummy.c -c -o $dummy.o) >/dev/null 2>&1 ; then
+	     CC_FOR_BUILD="$c"; break ;
+	  fi ;
+	done ;
+	rm -f $files ;
+	if test x"$CC_FOR_BUILD" = x ; then
+	  CC_FOR_BUILD=no_compiler_found ;
+	fi
+	;;
+ ,,*)   CC_FOR_BUILD=$CC ;;
+ ,*,*)  CC_FOR_BUILD=$HOST_CC ;;
+esac ;
+unset files'
+
+# This is needed to find uname on a Pyramid OSx when run in the BSD universe.
+# (ghazi at noc.rutgers.edu 1994-08-24)
+if (test -f /.attbin/uname) >/dev/null 2>&1 ; then
+	PATH=$PATH:/.attbin ; export PATH
+fi
+
+UNAME_MACHINE=`(uname -m) 2>/dev/null` || UNAME_MACHINE=unknown
+UNAME_RELEASE=`(uname -r) 2>/dev/null` || UNAME_RELEASE=unknown
+UNAME_SYSTEM=`(uname -s) 2>/dev/null`  || UNAME_SYSTEM=unknown
+UNAME_VERSION=`(uname -v) 2>/dev/null` || UNAME_VERSION=unknown
+
+# Note: order is significant - the case branches are not exclusive.
+
+case "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" in
+    *:NetBSD:*:*)
+	# NetBSD (nbsd) targets should (where applicable) match one or
+	# more of the tupples: *-*-netbsdelf*, *-*-netbsdaout*,
+	# *-*-netbsdecoff* and *-*-netbsd*.  For targets that recently
+	# switched to ELF, *-*-netbsd* would select the old
+	# object file format.  This provides both forward
+	# compatibility and a consistent mechanism for selecting the
+	# object file format.
+	#
+	# Note: NetBSD doesn't particularly care about the vendor
+	# portion of the name.  We always set it to "unknown".
+	sysctl="sysctl -n hw.machine_arch"
+	UNAME_MACHINE_ARCH=`(/sbin/$sysctl 2>/dev/null || \
+	    /usr/sbin/$sysctl 2>/dev/null || echo unknown)`
+	case "${UNAME_MACHINE_ARCH}" in
+	    armeb) machine=armeb-unknown ;;
+	    arm*) machine=arm-unknown ;;
+	    sh3el) machine=shl-unknown ;;
+	    sh3eb) machine=sh-unknown ;;
+	    *) machine=${UNAME_MACHINE_ARCH}-unknown ;;
+	esac
+	# The Operating System including object format, if it has switched
+	# to ELF recently, or will in the future.
+	case "${UNAME_MACHINE_ARCH}" in
+	    arm*|i386|m68k|ns32k|sh3*|sparc|vax)
+		eval $set_cc_for_build
+		if echo __ELF__ | $CC_FOR_BUILD -E - 2>/dev/null \
+			| grep __ELF__ >/dev/null
+		then
+		    # Once all utilities can be ECOFF (netbsdecoff) or a.out (netbsdaout).
+		    # Return netbsd for either.  FIX?
+		    os=netbsd
+		else
+		    os=netbsdelf
+		fi
+		;;
+	    *)
+	        os=netbsd
+		;;
+	esac
+	# The OS release
+	release=`echo ${UNAME_RELEASE}|sed -e 's/[-_].*/\./'`
+	# Since CPU_TYPE-MANUFACTURER-KERNEL-OPERATING_SYSTEM:
+	# contains redundant information, the shorter form:
+	# CPU_TYPE-MANUFACTURER-OPERATING_SYSTEM is used.
+	echo "${machine}-${os}${release}"
+	exit 0 ;;
+    amiga:OpenBSD:*:*)
+	echo m68k-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    arc:OpenBSD:*:*)
+	echo mipsel-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    hp300:OpenBSD:*:*)
+	echo m68k-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    mac68k:OpenBSD:*:*)
+	echo m68k-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    macppc:OpenBSD:*:*)
+	echo powerpc-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    mvme68k:OpenBSD:*:*)
+	echo m68k-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    mvme88k:OpenBSD:*:*)
+	echo m88k-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    mvmeppc:OpenBSD:*:*)
+	echo powerpc-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    pmax:OpenBSD:*:*)
+	echo mipsel-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    sgi:OpenBSD:*:*)
+	echo mipseb-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    sun3:OpenBSD:*:*)
+	echo m68k-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    wgrisc:OpenBSD:*:*)
+	echo mipsel-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    *:OpenBSD:*:*)
+	echo ${UNAME_MACHINE}-unknown-openbsd${UNAME_RELEASE}
+	exit 0 ;;
+    alpha:OSF1:*:*)
+	if test $UNAME_RELEASE = "V4.0"; then
+		UNAME_RELEASE=`/usr/sbin/sizer -v | awk '{print $3}'`
+	fi
+	# A Vn.n version is a released version.
+	# A Tn.n version is a released field test version.
+	# A Xn.n version is an unreleased experimental baselevel.
+	# 1.2 uses "1.2" for uname -r.
+	eval $set_cc_for_build
+	cat <<EOF >$dummy.s
+	.data
+\$Lformat:
+	.byte 37,100,45,37,120,10,0	# "%d-%x\n"
+
+	.text
+	.globl main
+	.align 4
+	.ent main
+main:
+	.frame \$30,16,\$26,0
+	ldgp \$29,0(\$27)
+	.prologue 1
+	.long 0x47e03d80 # implver \$0
+	lda \$2,-1
+	.long 0x47e20c21 # amask \$2,\$1
+	lda \$16,\$Lformat
+	mov \$0,\$17
+	not \$1,\$18
+	jsr \$26,printf
+	ldgp \$29,0(\$26)
+	mov 0,\$16
+	jsr \$26,exit
+	.end main
+EOF
+	$CC_FOR_BUILD $dummy.s -o $dummy 2>/dev/null
+	if test "$?" = 0 ; then
+		case `$dummy` in
+			0-0)
+				UNAME_MACHINE="alpha"
+				;;
+			1-0)
+				UNAME_MACHINE="alphaev5"
+				;;
+			1-1)
+				UNAME_MACHINE="alphaev56"
+				;;
+			1-101)
+				UNAME_MACHINE="alphapca56"
+				;;
+			2-303)
+				UNAME_MACHINE="alphaev6"
+				;;
+			2-307)
+				UNAME_MACHINE="alphaev67"
+				;;
+			2-1307)
+				UNAME_MACHINE="alphaev68"
+				;;
+			3-1307)
+				UNAME_MACHINE="alphaev7"
+				;;
+		esac
+	fi
+	rm -f $dummy.s $dummy && rmdir $tmpdir
+	echo ${UNAME_MACHINE}-dec-osf`echo ${UNAME_RELEASE} | sed -e 's/^[VTX]//' | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz'`
+	exit 0 ;;
+    Alpha\ *:Windows_NT*:*)
+	# How do we know it's Interix rather than the generic POSIX subsystem?
+	# Should we change UNAME_MACHINE based on the output of uname instead
+	# of the specific Alpha model?
+	echo alpha-pc-interix
+	exit 0 ;;
+    21064:Windows_NT:50:3)
+	echo alpha-dec-winnt3.5
+	exit 0 ;;
+    Amiga*:UNIX_System_V:4.0:*)
+	echo m68k-unknown-sysv4
+	exit 0;;
+    *:[Aa]miga[Oo][Ss]:*:*)
+	echo ${UNAME_MACHINE}-unknown-amigaos
+	exit 0 ;;
+    *:[Mm]orph[Oo][Ss]:*:*)
+	echo ${UNAME_MACHINE}-unknown-morphos
+	exit 0 ;;
+    *:OS/390:*:*)
+	echo i370-ibm-openedition
+	exit 0 ;;
+    arm:RISC*:1.[012]*:*|arm:riscix:1.[012]*:*)
+	echo arm-acorn-riscix${UNAME_RELEASE}
+	exit 0;;
+    SR2?01:HI-UX/MPP:*:* | SR8000:HI-UX/MPP:*:*)
+	echo hppa1.1-hitachi-hiuxmpp
+	exit 0;;
+    Pyramid*:OSx*:*:* | MIS*:OSx*:*:* | MIS*:SMP_DC-OSx*:*:*)
+	# akee at wpdis03.wpafb.af.mil (Earle F. Ake) contributed MIS and NILE.
+	if test "`(/bin/universe) 2>/dev/null`" = att ; then
+		echo pyramid-pyramid-sysv3
+	else
+		echo pyramid-pyramid-bsd
+	fi
+	exit 0 ;;
+    NILE*:*:*:dcosx)
+	echo pyramid-pyramid-svr4
+	exit 0 ;;
+    DRS?6000:UNIX_SV:4.2*:7*)
+	case `/usr/bin/uname -p` in
+	    sparc) echo sparc-icl-nx7 && exit 0 ;;
+	esac ;;
+    sun4H:SunOS:5.*:*)
+	echo sparc-hal-solaris2`echo ${UNAME_RELEASE}|sed -e 's/[^.]*//'`
+	exit 0 ;;
+    sun4*:SunOS:5.*:* | tadpole*:SunOS:5.*:*)
+	echo sparc-sun-solaris2`echo ${UNAME_RELEASE}|sed -e 's/[^.]*//'`
+	exit 0 ;;
+    i86pc:SunOS:5.*:*)
+	echo i386-pc-solaris2`echo ${UNAME_RELEASE}|sed -e 's/[^.]*//'`
+	exit 0 ;;
+    sun4*:SunOS:6*:*)
+	# According to config.sub, this is the proper way to canonicalize
+	# SunOS6.  Hard to guess exactly what SunOS6 will be like, but
+	# it's likely to be more like Solaris than SunOS4.
+	echo sparc-sun-solaris3`echo ${UNAME_RELEASE}|sed -e 's/[^.]*//'`
+	exit 0 ;;
+    sun4*:SunOS:*:*)
+	case "`/usr/bin/arch -k`" in
+	    Series*|S4*)
+		UNAME_RELEASE=`uname -v`
+		;;
+	esac
+	# Japanese Language versions have a version number like `4.1.3-JL'.
+	echo sparc-sun-sunos`echo ${UNAME_RELEASE}|sed -e 's/-/_/'`
+	exit 0 ;;
+    sun3*:SunOS:*:*)
+	echo m68k-sun-sunos${UNAME_RELEASE}
+	exit 0 ;;
+    sun*:*:4.2BSD:*)
+	UNAME_RELEASE=`(sed 1q /etc/motd | awk '{print substr($5,1,3)}') 2>/dev/null`
+	test "x${UNAME_RELEASE}" = "x" && UNAME_RELEASE=3
+	case "`/bin/arch`" in
+	    sun3)
+		echo m68k-sun-sunos${UNAME_RELEASE}
+		;;
+	    sun4)
+		echo sparc-sun-sunos${UNAME_RELEASE}
+		;;
+	esac
+	exit 0 ;;
+    aushp:SunOS:*:*)
+	echo sparc-auspex-sunos${UNAME_RELEASE}
+	exit 0 ;;
+    # The situation for MiNT is a little confusing.  The machine name
+    # can be virtually everything (everything which is not
+    # "atarist" or "atariste" at least should have a processor
+    # > m68000).  The system name ranges from "MiNT" over "FreeMiNT"
+    # to the lowercase version "mint" (or "freemint").  Finally
+    # the system name "TOS" denotes a system which is actually not
+    # MiNT.  But MiNT is downward compatible to TOS, so this should
+    # be no problem.
+    atarist[e]:*MiNT:*:* | atarist[e]:*mint:*:* | atarist[e]:*TOS:*:*)
+        echo m68k-atari-mint${UNAME_RELEASE}
+	exit 0 ;;
+    atari*:*MiNT:*:* | atari*:*mint:*:* | atarist[e]:*TOS:*:*)
+	echo m68k-atari-mint${UNAME_RELEASE}
+        exit 0 ;;
+    *falcon*:*MiNT:*:* | *falcon*:*mint:*:* | *falcon*:*TOS:*:*)
+        echo m68k-atari-mint${UNAME_RELEASE}
+	exit 0 ;;
+    milan*:*MiNT:*:* | milan*:*mint:*:* | *milan*:*TOS:*:*)
+        echo m68k-milan-mint${UNAME_RELEASE}
+        exit 0 ;;
+    hades*:*MiNT:*:* | hades*:*mint:*:* | *hades*:*TOS:*:*)
+        echo m68k-hades-mint${UNAME_RELEASE}
+        exit 0 ;;
+    *:*MiNT:*:* | *:*mint:*:* | *:*TOS:*:*)
+        echo m68k-unknown-mint${UNAME_RELEASE}
+        exit 0 ;;
+    powerpc:machten:*:*)
+	echo powerpc-apple-machten${UNAME_RELEASE}
+	exit 0 ;;
+    RISC*:Mach:*:*)
+	echo mips-dec-mach_bsd4.3
+	exit 0 ;;
+    RISC*:ULTRIX:*:*)
+	echo mips-dec-ultrix${UNAME_RELEASE}
+	exit 0 ;;
+    VAX*:ULTRIX*:*:*)
+	echo vax-dec-ultrix${UNAME_RELEASE}
+	exit 0 ;;
+    2020:CLIX:*:* | 2430:CLIX:*:*)
+	echo clipper-intergraph-clix${UNAME_RELEASE}
+	exit 0 ;;
+    mips:*:*:UMIPS | mips:*:*:RISCos)
+	eval $set_cc_for_build
+	sed 's/^	//' << EOF >$dummy.c
+#ifdef __cplusplus
+#include <stdio.h>  /* for printf() prototype */
+	int main (int argc, char *argv[]) {
+#else
+	int main (argc, argv) int argc; char *argv[]; {
+#endif
+	#if defined (host_mips) && defined (MIPSEB)
+	#if defined (SYSTYPE_SYSV)
+	  printf ("mips-mips-riscos%ssysv\n", argv[1]); exit (0);
+	#endif
+	#if defined (SYSTYPE_SVR4)
+	  printf ("mips-mips-riscos%ssvr4\n", argv[1]); exit (0);
+	#endif
+	#if defined (SYSTYPE_BSD43) || defined(SYSTYPE_BSD)
+	  printf ("mips-mips-riscos%sbsd\n", argv[1]); exit (0);
+	#endif
+	#endif
+	  exit (-1);
+	}
+EOF
+	$CC_FOR_BUILD $dummy.c -o $dummy \
+	  && $dummy `echo "${UNAME_RELEASE}" | sed -n 's/\([0-9]*\).*/\1/p'` \
+	  && rm -f $dummy.c $dummy && rmdir $tmpdir && exit 0
+	rm -f $dummy.c $dummy && rmdir $tmpdir
+	echo mips-mips-riscos${UNAME_RELEASE}
+	exit 0 ;;
+    Motorola:PowerMAX_OS:*:*)
+	echo powerpc-motorola-powermax
+	exit 0 ;;
+    Night_Hawk:*:*:PowerMAX_OS)
+	echo powerpc-harris-powermax
+	exit 0 ;;
+    Night_Hawk:Power_UNIX:*:*)
+	echo powerpc-harris-powerunix
+	exit 0 ;;
+    m88k:CX/UX:7*:*)
+	echo m88k-harris-cxux7
+	exit 0 ;;
+    m88k:*:4*:R4*)
+	echo m88k-motorola-sysv4
+	exit 0 ;;
+    m88k:*:3*:R3*)
+	echo m88k-motorola-sysv3
+	exit 0 ;;
+    AViiON:dgux:*:*)
+        # DG/UX returns AViiON for all architectures
+        UNAME_PROCESSOR=`/usr/bin/uname -p`
+	if [ $UNAME_PROCESSOR = mc88100 ] || [ $UNAME_PROCESSOR = mc88110 ]
+	then
+	    if [ ${TARGET_BINARY_INTERFACE}x = m88kdguxelfx ] || \
+	       [ ${TARGET_BINARY_INTERFACE}x = x ]
+	    then
+		echo m88k-dg-dgux${UNAME_RELEASE}
+	    else
+		echo m88k-dg-dguxbcs${UNAME_RELEASE}
+	    fi
+	else
+	    echo i586-dg-dgux${UNAME_RELEASE}
+	fi
+ 	exit 0 ;;
+    M88*:DolphinOS:*:*)	# DolphinOS (SVR3)
+	echo m88k-dolphin-sysv3
+	exit 0 ;;
+    M88*:*:R3*:*)
+	# Delta 88k system running SVR3
+	echo m88k-motorola-sysv3
+	exit 0 ;;
+    XD88*:*:*:*) # Tektronix XD88 system running UTekV (SVR3)
+	echo m88k-tektronix-sysv3
+	exit 0 ;;
+    Tek43[0-9][0-9]:UTek:*:*) # Tektronix 4300 system running UTek (BSD)
+	echo m68k-tektronix-bsd
+	exit 0 ;;
+    *:IRIX*:*:*)
+	echo mips-sgi-irix`echo ${UNAME_RELEASE}|sed -e 's/-/_/g'`
+	exit 0 ;;
+    ????????:AIX?:[12].1:2)   # AIX 2.2.1 or AIX 2.1.1 is RT/PC AIX.
+	echo romp-ibm-aix      # uname -m gives an 8 hex-code CPU id
+	exit 0 ;;              # Note that: echo "'`uname -s`'" gives 'AIX '
+    i*86:AIX:*:*)
+	echo i386-ibm-aix
+	exit 0 ;;
+    ia64:AIX:*:*)
+	if [ -x /usr/bin/oslevel ] ; then
+		IBM_REV=`/usr/bin/oslevel`
+	else
+		IBM_REV=${UNAME_VERSION}.${UNAME_RELEASE}
+	fi
+	echo ${UNAME_MACHINE}-ibm-aix${IBM_REV}
+	exit 0 ;;
+    *:AIX:2:3)
+	if grep bos325 /usr/include/stdio.h >/dev/null 2>&1; then
+		eval $set_cc_for_build
+		sed 's/^		//' << EOF >$dummy.c
+		#include <sys/systemcfg.h>
+
+		main()
+			{
+			if (!__power_pc())
+				exit(1);
+			puts("powerpc-ibm-aix3.2.5");
+			exit(0);
+			}
+EOF
+		$CC_FOR_BUILD $dummy.c -o $dummy && $dummy && rm -f $dummy.c $dummy && rmdir $tmpdir && exit 0
+		rm -f $dummy.c $dummy && rmdir $tmpdir
+		echo rs6000-ibm-aix3.2.5
+	elif grep bos324 /usr/include/stdio.h >/dev/null 2>&1; then
+		echo rs6000-ibm-aix3.2.4
+	else
+		echo rs6000-ibm-aix3.2
+	fi
+	exit 0 ;;
+    *:AIX:*:[45])
+	IBM_CPU_ID=`/usr/sbin/lsdev -C -c processor -S available | sed 1q | awk '{ print $1 }'`
+	if /usr/sbin/lsattr -El ${IBM_CPU_ID} | grep ' POWER' >/dev/null 2>&1; then
+		IBM_ARCH=rs6000
+	else
+		IBM_ARCH=powerpc
+	fi
+	if [ -x /usr/bin/oslevel ] ; then
+		IBM_REV=`/usr/bin/oslevel`
+	else
+		IBM_REV=${UNAME_VERSION}.${UNAME_RELEASE}
+	fi
+	echo ${IBM_ARCH}-ibm-aix${IBM_REV}
+	exit 0 ;;
+    *:AIX:*:*)
+	echo rs6000-ibm-aix
+	exit 0 ;;
+    ibmrt:4.4BSD:*|romp-ibm:BSD:*)
+	echo romp-ibm-bsd4.4
+	exit 0 ;;
+    ibmrt:*BSD:*|romp-ibm:BSD:*)            # covers RT/PC BSD and
+	echo romp-ibm-bsd${UNAME_RELEASE}   # 4.3 with uname added to
+	exit 0 ;;                           # report: romp-ibm BSD 4.3
+    *:BOSX:*:*)
+	echo rs6000-bull-bosx
+	exit 0 ;;
+    DPX/2?00:B.O.S.:*:*)
+	echo m68k-bull-sysv3
+	exit 0 ;;
+    9000/[34]??:4.3bsd:1.*:*)
+	echo m68k-hp-bsd
+	exit 0 ;;
+    hp300:4.4BSD:*:* | 9000/[34]??:4.3bsd:2.*:*)
+	echo m68k-hp-bsd4.4
+	exit 0 ;;
+    9000/[34678]??:HP-UX:*:*)
+	HPUX_REV=`echo ${UNAME_RELEASE}|sed -e 's/[^.]*.[0B]*//'`
+	case "${UNAME_MACHINE}" in
+	    9000/31? )            HP_ARCH=m68000 ;;
+	    9000/[34]?? )         HP_ARCH=m68k ;;
+	    9000/[678][0-9][0-9])
+		if [ -x /usr/bin/getconf ]; then
+		    sc_cpu_version=`/usr/bin/getconf SC_CPU_VERSION 2>/dev/null`
+                    sc_kernel_bits=`/usr/bin/getconf SC_KERNEL_BITS 2>/dev/null`
+                    case "${sc_cpu_version}" in
+                      523) HP_ARCH="hppa1.0" ;; # CPU_PA_RISC1_0
+                      528) HP_ARCH="hppa1.1" ;; # CPU_PA_RISC1_1
+                      532)                      # CPU_PA_RISC2_0
+                        case "${sc_kernel_bits}" in
+                          32) HP_ARCH="hppa2.0n" ;;
+                          64) HP_ARCH="hppa2.0w" ;;
+			  '') HP_ARCH="hppa2.0" ;;   # HP-UX 10.20
+                        esac ;;
+                    esac
+		fi
+		if [ "${HP_ARCH}" = "" ]; then
+		    eval $set_cc_for_build
+		    sed 's/^              //' << EOF >$dummy.c
+
+              #define _HPUX_SOURCE
+              #include <stdlib.h>
+              #include <unistd.h>
+
+              int main ()
+              {
+              #if defined(_SC_KERNEL_BITS)
+                  long bits = sysconf(_SC_KERNEL_BITS);
+              #endif
+                  long cpu  = sysconf (_SC_CPU_VERSION);
+
+                  switch (cpu)
+              	{
+              	case CPU_PA_RISC1_0: puts ("hppa1.0"); break;
+              	case CPU_PA_RISC1_1: puts ("hppa1.1"); break;
+              	case CPU_PA_RISC2_0:
+              #if defined(_SC_KERNEL_BITS)
+              	    switch (bits)
+              		{
+              		case 64: puts ("hppa2.0w"); break;
+              		case 32: puts ("hppa2.0n"); break;
+              		default: puts ("hppa2.0"); break;
+              		} break;
+              #else  /* !defined(_SC_KERNEL_BITS) */
+              	    puts ("hppa2.0"); break;
+              #endif
+              	default: puts ("hppa1.0"); break;
+              	}
+                  exit (0);
+              }
+EOF
+		    (CCOPTS= $CC_FOR_BUILD $dummy.c -o $dummy 2>/dev/null) && HP_ARCH=`$dummy`
+		    if test -z "$HP_ARCH"; then HP_ARCH=hppa; fi
+		    rm -f $dummy.c $dummy && rmdir $tmpdir
+		fi ;;
+	esac
+	echo ${HP_ARCH}-hp-hpux${HPUX_REV}
+	exit 0 ;;
+    ia64:HP-UX:*:*)
+	HPUX_REV=`echo ${UNAME_RELEASE}|sed -e 's/[^.]*.[0B]*//'`
+	echo ia64-hp-hpux${HPUX_REV}
+	exit 0 ;;
+    3050*:HI-UX:*:*)
+	eval $set_cc_for_build
+	sed 's/^	//' << EOF >$dummy.c
+	#include <unistd.h>
+	int
+	main ()
+	{
+	  long cpu = sysconf (_SC_CPU_VERSION);
+	  /* The order matters, because CPU_IS_HP_MC68K erroneously returns
+	     true for CPU_PA_RISC1_0.  CPU_IS_PA_RISC returns correct
+	     results, however.  */
+	  if (CPU_IS_PA_RISC (cpu))
+	    {
+	      switch (cpu)
+		{
+		  case CPU_PA_RISC1_0: puts ("hppa1.0-hitachi-hiuxwe2"); break;
+		  case CPU_PA_RISC1_1: puts ("hppa1.1-hitachi-hiuxwe2"); break;
+		  case CPU_PA_RISC2_0: puts ("hppa2.0-hitachi-hiuxwe2"); break;
+		  default: puts ("hppa-hitachi-hiuxwe2"); break;
+		}
+	    }
+	  else if (CPU_IS_HP_MC68K (cpu))
+	    puts ("m68k-hitachi-hiuxwe2");
+	  else puts ("unknown-hitachi-hiuxwe2");
+	  exit (0);
+	}
+EOF
+	$CC_FOR_BUILD $dummy.c -o $dummy && $dummy && rm -f $dummy.c $dummy && rmdir $tmpdir && exit 0
+	rm -f $dummy.c $dummy && rmdir $tmpdir
+	echo unknown-hitachi-hiuxwe2
+	exit 0 ;;
+    9000/7??:4.3bsd:*:* | 9000/8?[79]:4.3bsd:*:* )
+	echo hppa1.1-hp-bsd
+	exit 0 ;;
+    9000/8??:4.3bsd:*:*)
+	echo hppa1.0-hp-bsd
+	exit 0 ;;
+    *9??*:MPE/iX:*:* | *3000*:MPE/iX:*:*)
+	echo hppa1.0-hp-mpeix
+	exit 0 ;;
+    hp7??:OSF1:*:* | hp8?[79]:OSF1:*:* )
+	echo hppa1.1-hp-osf
+	exit 0 ;;
+    hp8??:OSF1:*:*)
+	echo hppa1.0-hp-osf
+	exit 0 ;;
+    i*86:OSF1:*:*)
+	if [ -x /usr/sbin/sysversion ] ; then
+	    echo ${UNAME_MACHINE}-unknown-osf1mk
+	else
+	    echo ${UNAME_MACHINE}-unknown-osf1
+	fi
+	exit 0 ;;
+    parisc*:Lites*:*:*)
+	echo hppa1.1-hp-lites
+	exit 0 ;;
+    C1*:ConvexOS:*:* | convex:ConvexOS:C1*:*)
+	echo c1-convex-bsd
+        exit 0 ;;
+    C2*:ConvexOS:*:* | convex:ConvexOS:C2*:*)
+	if getsysinfo -f scalar_acc
+	then echo c32-convex-bsd
+	else echo c2-convex-bsd
+	fi
+        exit 0 ;;
+    C34*:ConvexOS:*:* | convex:ConvexOS:C34*:*)
+	echo c34-convex-bsd
+        exit 0 ;;
+    C38*:ConvexOS:*:* | convex:ConvexOS:C38*:*)
+	echo c38-convex-bsd
+        exit 0 ;;
+    C4*:ConvexOS:*:* | convex:ConvexOS:C4*:*)
+	echo c4-convex-bsd
+        exit 0 ;;
+    CRAY*Y-MP:*:*:*)
+	echo ymp-cray-unicos${UNAME_RELEASE} | sed -e 's/\.[^.]*$/.X/'
+	exit 0 ;;
+    CRAY*[A-Z]90:*:*:*)
+	echo ${UNAME_MACHINE}-cray-unicos${UNAME_RELEASE} \
+	| sed -e 's/CRAY.*\([A-Z]90\)/\1/' \
+	      -e y/ABCDEFGHIJKLMNOPQRSTUVWXYZ/abcdefghijklmnopqrstuvwxyz/ \
+	      -e 's/\.[^.]*$/.X/'
+	exit 0 ;;
+    CRAY*TS:*:*:*)
+	echo t90-cray-unicos${UNAME_RELEASE} | sed -e 's/\.[^.]*$/.X/'
+	exit 0 ;;
+    CRAY*T3D:*:*:*)
+	echo alpha-cray-unicosmk${UNAME_RELEASE} | sed -e 's/\.[^.]*$/.X/'
+	exit 0 ;;
+    CRAY*T3E:*:*:*)
+	echo alphaev5-cray-unicosmk${UNAME_RELEASE} | sed -e 's/\.[^.]*$/.X/'
+	exit 0 ;;
+    CRAY*SV1:*:*:*)
+	echo sv1-cray-unicos${UNAME_RELEASE} | sed -e 's/\.[^.]*$/.X/'
+	exit 0 ;;
+    F30[01]:UNIX_System_V:*:* | F700:UNIX_System_V:*:*)
+	FUJITSU_PROC=`uname -m | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz'`
+        FUJITSU_SYS=`uname -p | tr 'ABCDEFGHIJKLMNOPQRSTUVWXYZ' 'abcdefghijklmnopqrstuvwxyz' | sed -e 's/\///'`
+        FUJITSU_REL=`echo ${UNAME_RELEASE} | sed -e 's/ /_/'`
+        echo "${FUJITSU_PROC}-fujitsu-${FUJITSU_SYS}${FUJITSU_REL}"
+        exit 0 ;;
+    i*86:BSD/386:*:* | i*86:BSD/OS:*:* | *:Ascend\ Embedded/OS:*:*)
+	echo ${UNAME_MACHINE}-pc-bsdi${UNAME_RELEASE}
+	exit 0 ;;
+    sparc*:BSD/OS:*:*)
+	echo sparc-unknown-bsdi${UNAME_RELEASE}
+	exit 0 ;;
+    *:BSD/OS:*:*)
+	echo ${UNAME_MACHINE}-unknown-bsdi${UNAME_RELEASE}
+	exit 0 ;;
+    *:FreeBSD:*:*)
+	# Determine whether the default compiler uses glibc.
+	eval $set_cc_for_build
+	sed 's/^	//' << EOF >$dummy.c
+	#include <features.h>
+	#if __GLIBC__ >= 2
+	LIBC=gnu
+	#else
+	LIBC=
+	#endif
+EOF
+	eval `$CC_FOR_BUILD -E $dummy.c 2>/dev/null | grep ^LIBC=`
+	rm -f $dummy.c && rmdir $tmpdir
+	echo ${UNAME_MACHINE}-unknown-freebsd`echo ${UNAME_RELEASE}|sed -e 's/[-(].*//'`${LIBC:+-$LIBC}
+	exit 0 ;;
+    i*:CYGWIN*:*)
+	echo ${UNAME_MACHINE}-pc-cygwin
+	exit 0 ;;
+    i*:MINGW*:*)
+	echo ${UNAME_MACHINE}-pc-mingw32
+	exit 0 ;;
+    i*:PW*:*)
+	echo ${UNAME_MACHINE}-pc-pw32
+	exit 0 ;;
+    x86:Interix*:3*)
+	echo i386-pc-interix3
+	exit 0 ;;
+    i*:Windows_NT*:* | Pentium*:Windows_NT*:*)
+	# How do we know it's Interix rather than the generic POSIX subsystem?
+	# It also conflicts with pre-2.0 versions of AT&T UWIN. Should we
+	# UNAME_MACHINE based on the output of uname instead of i386?
+	echo i386-pc-interix
+	exit 0 ;;
+    i*:UWIN*:*)
+	echo ${UNAME_MACHINE}-pc-uwin
+	exit 0 ;;
+    p*:CYGWIN*:*)
+	echo powerpcle-unknown-cygwin
+	exit 0 ;;
+    prep*:SunOS:5.*:*)
+	echo powerpcle-unknown-solaris2`echo ${UNAME_RELEASE}|sed -e 's/[^.]*//'`
+	exit 0 ;;
+    *:GNU:*:*)
+	echo `echo ${UNAME_MACHINE}|sed -e 's,[-/].*$,,'`-unknown-gnu`echo ${UNAME_RELEASE}|sed -e 's,/.*$,,'`
+	exit 0 ;;
+    i*86:Minix:*:*)
+	echo ${UNAME_MACHINE}-pc-minix
+	exit 0 ;;
+    arm*:Linux:*:*)
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	exit 0 ;;
+    ia64:Linux:*:*)
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	exit 0 ;;
+    m68*:Linux:*:*)
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	exit 0 ;;
+    mips:Linux:*:*)
+	eval $set_cc_for_build
+	sed 's/^	//' << EOF >$dummy.c
+	#undef CPU
+	#undef mips
+	#undef mipsel
+	#if defined(__MIPSEL__) || defined(__MIPSEL) || defined(_MIPSEL) || defined(MIPSEL)
+	CPU=mipsel
+	#else
+	#if defined(__MIPSEB__) || defined(__MIPSEB) || defined(_MIPSEB) || defined(MIPSEB)
+	CPU=mips
+	#else
+	CPU=
+	#endif
+	#endif
+EOF
+	eval `$CC_FOR_BUILD -E $dummy.c 2>/dev/null | grep ^CPU=`
+	rm -f $dummy.c && rmdir $tmpdir
+	test x"${CPU}" != x && echo "${CPU}-pc-linux-gnu" && exit 0
+	;;
+    ppc:Linux:*:*)
+	echo powerpc-unknown-linux-gnu
+	exit 0 ;;
+    ppc64:Linux:*:*)
+	echo powerpc64-unknown-linux-gnu
+	exit 0 ;;
+    alpha:Linux:*:*)
+	case `sed -n '/^cpu model/s/^.*: \(.*\)/\1/p' < /proc/cpuinfo` in
+	  EV5)   UNAME_MACHINE=alphaev5 ;;
+	  EV56)  UNAME_MACHINE=alphaev56 ;;
+	  PCA56) UNAME_MACHINE=alphapca56 ;;
+	  PCA57) UNAME_MACHINE=alphapca56 ;;
+	  EV6)   UNAME_MACHINE=alphaev6 ;;
+	  EV67)  UNAME_MACHINE=alphaev67 ;;
+	  EV68*) UNAME_MACHINE=alphaev68 ;;
+        esac
+	objdump --private-headers /bin/sh | grep ld.so.1 >/dev/null
+	if test "$?" = 0 ; then LIBC="libc1" ; else LIBC="" ; fi
+	echo ${UNAME_MACHINE}-unknown-linux-gnu${LIBC}
+	exit 0 ;;
+    parisc:Linux:*:* | hppa:Linux:*:*)
+	# Look for CPU level
+	case `grep '^cpu[^a-z]*:' /proc/cpuinfo 2>/dev/null | cut -d' ' -f2` in
+	  PA7*) echo hppa1.1-unknown-linux-gnu ;;
+	  PA8*) echo hppa2.0-unknown-linux-gnu ;;
+	  *)    echo hppa-unknown-linux-gnu ;;
+	esac
+	exit 0 ;;
+    parisc64:Linux:*:* | hppa64:Linux:*:*)
+	echo hppa64-unknown-linux-gnu
+	exit 0 ;;
+    s390:Linux:*:* | s390x:Linux:*:*)
+	echo ${UNAME_MACHINE}-ibm-linux
+	exit 0 ;;
+    sh*:Linux:*:*)
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	exit 0 ;;
+    sparc:Linux:*:* | sparc64:Linux:*:*)
+	echo ${UNAME_MACHINE}-unknown-linux-gnu
+	exit 0 ;;
+    x86_64:Linux:*:*)
+	echo x86_64-unknown-linux-gnu
+	exit 0 ;;
+    i*86:Linux:*:*)
+	# The BFD linker knows what the default object file format is, so
+	# first see if it will tell us. cd to the root directory to prevent
+	# problems with other programs or directories called `ld' in the path.
+	# Set LC_ALL=C to ensure ld outputs messages in English.
+	ld_supported_targets=`cd /; LC_ALL=C ld --help 2>&1 \
+			 | sed -ne '/supported targets:/!d
+				    s/[ 	][ 	]*/ /g
+				    s/.*supported targets: *//
+				    s/ .*//
+				    p'`
+        case "$ld_supported_targets" in
+	  elf32-i386)
+		TENTATIVE="${UNAME_MACHINE}-pc-linux-gnu"
+		;;
+	  a.out-i386-linux)
+		echo "${UNAME_MACHINE}-pc-linux-gnuaout"
+		exit 0 ;;
+	  coff-i386)
+		echo "${UNAME_MACHINE}-pc-linux-gnucoff"
+		exit 0 ;;
+	  "")
+		# Either a pre-BFD a.out linker (linux-gnuoldld) or
+		# one that does not give us useful --help.
+		echo "${UNAME_MACHINE}-pc-linux-gnuoldld"
+		exit 0 ;;
+	esac
+	# Determine whether the default compiler is a.out or elf
+	eval $set_cc_for_build
+	sed 's/^	//' << EOF >$dummy.c
+	#include <features.h>
+	#ifdef __ELF__
+	# ifdef __GLIBC__
+	#  if __GLIBC__ >= 2
+	LIBC=gnu
+	#  else
+	LIBC=gnulibc1
+	#  endif
+	# else
+	LIBC=gnulibc1
+	# endif
+	#else
+	#ifdef __INTEL_COMPILER
+	LIBC=gnu
+	#else
+	LIBC=gnuaout
+	#endif
+	#endif
+EOF
+	eval `$CC_FOR_BUILD -E $dummy.c 2>/dev/null | grep ^LIBC=`
+	rm -f $dummy.c && rmdir $tmpdir
+	test x"${LIBC}" != x && echo "${UNAME_MACHINE}-pc-linux-${LIBC}" && exit 0
+	test x"${TENTATIVE}" != x && echo "${TENTATIVE}" && exit 0
+	;;
+    i*86:DYNIX/ptx:4*:*)
+	# ptx 4.0 does uname -s correctly, with DYNIX/ptx in there.
+	# earlier versions are messed up and put the nodename in both
+	# sysname and nodename.
+	echo i386-sequent-sysv4
+	exit 0 ;;
+    i*86:UNIX_SV:4.2MP:2.*)
+        # Unixware is an offshoot of SVR4, but it has its own version
+        # number series starting with 2...
+        # I am not positive that other SVR4 systems won't match this,
+	# I just have to hope.  -- rms.
+        # Use sysv4.2uw... so that sysv4* matches it.
+	echo ${UNAME_MACHINE}-pc-sysv4.2uw${UNAME_VERSION}
+	exit 0 ;;
+    i*86:*:4.*:* | i*86:SYSTEM_V:4.*:*)
+	UNAME_REL=`echo ${UNAME_RELEASE} | sed 's/\/MP$//'`
+	if grep Novell /usr/include/link.h >/dev/null 2>/dev/null; then
+		echo ${UNAME_MACHINE}-univel-sysv${UNAME_REL}
+	else
+		echo ${UNAME_MACHINE}-pc-sysv${UNAME_REL}
+	fi
+	exit 0 ;;
+    i*86:*:5:[78]*)
+	case `/bin/uname -X | grep "^Machine"` in
+	    *486*)	     UNAME_MACHINE=i486 ;;
+	    *Pentium)	     UNAME_MACHINE=i586 ;;
+	    *Pent*|*Celeron) UNAME_MACHINE=i686 ;;
+	esac
+	echo ${UNAME_MACHINE}-unknown-sysv${UNAME_RELEASE}${UNAME_SYSTEM}${UNAME_VERSION}
+	exit 0 ;;
+    i*86:*:3.2:*)
+	if test -f /usr/options/cb.name; then
+		UNAME_REL=`sed -n 's/.*Version //p' </usr/options/cb.name`
+		echo ${UNAME_MACHINE}-pc-isc$UNAME_REL
+	elif /bin/uname -X 2>/dev/null >/dev/null ; then
+		UNAME_REL=`(/bin/uname -X|grep Release|sed -e 's/.*= //')`
+		(/bin/uname -X|grep i80486 >/dev/null) && UNAME_MACHINE=i486
+		(/bin/uname -X|grep '^Machine.*Pentium' >/dev/null) \
+			&& UNAME_MACHINE=i586
+		(/bin/uname -X|grep '^Machine.*Pent *II' >/dev/null) \
+			&& UNAME_MACHINE=i686
+		(/bin/uname -X|grep '^Machine.*Pentium Pro' >/dev/null) \
+			&& UNAME_MACHINE=i686
+		echo ${UNAME_MACHINE}-pc-sco$UNAME_REL
+	else
+		echo ${UNAME_MACHINE}-pc-sysv32
+	fi
+	exit 0 ;;
+    i*86:*DOS:*:*)
+	echo ${UNAME_MACHINE}-pc-msdosdjgpp
+	exit 0 ;;
+    pc:*:*:*)
+	# Left here for compatibility:
+        # uname -m prints for DJGPP always 'pc', but it prints nothing about
+        # the processor, so we play safe by assuming i386.
+	echo i386-pc-msdosdjgpp
+        exit 0 ;;
+    Intel:Mach:3*:*)
+	echo i386-pc-mach3
+	exit 0 ;;
+    paragon:*:*:*)
+	echo i860-intel-osf1
+	exit 0 ;;
+    i860:*:4.*:*) # i860-SVR4
+	if grep Stardent /usr/include/sys/uadmin.h >/dev/null 2>&1 ; then
+	  echo i860-stardent-sysv${UNAME_RELEASE} # Stardent Vistra i860-SVR4
+	else # Add other i860-SVR4 vendors below as they are discovered.
+	  echo i860-unknown-sysv${UNAME_RELEASE}  # Unknown i860-SVR4
+	fi
+	exit 0 ;;
+    mini*:CTIX:SYS*5:*)
+	# "miniframe"
+	echo m68010-convergent-sysv
+	exit 0 ;;
+    M68*:*:R3V[567]*:*)
+	test -r /sysV68 && echo 'm68k-motorola-sysv' && exit 0 ;;
+    3[34]??:*:4.0:3.0 | 3[34]??A:*:4.0:3.0 | 3[34]??,*:*:4.0:3.0 | 3[34]??/*:*:4.0:3.0 | 4400:*:4.0:3.0 | 4850:*:4.0:3.0 | SKA40:*:4.0:3.0)
+	OS_REL=''
+	test -r /etc/.relid \
+	&& OS_REL=.`sed -n 's/[^ ]* [^ ]* \([0-9][0-9]\).*/\1/p' < /etc/.relid`
+	/bin/uname -p 2>/dev/null | grep 86 >/dev/null \
+	  && echo i486-ncr-sysv4.3${OS_REL} && exit 0
+	/bin/uname -p 2>/dev/null | /bin/grep entium >/dev/null \
+	  && echo i586-ncr-sysv4.3${OS_REL} && exit 0 ;;
+    3[34]??:*:4.0:* | 3[34]??,*:*:4.0:*)
+        /bin/uname -p 2>/dev/null | grep 86 >/dev/null \
+          && echo i486-ncr-sysv4 && exit 0 ;;
+    m68*:LynxOS:2.*:* | m68*:LynxOS:3.0*:*)
+	echo m68k-unknown-lynxos${UNAME_RELEASE}
+	exit 0 ;;
+    mc68030:UNIX_System_V:4.*:*)
+	echo m68k-atari-sysv4
+	exit 0 ;;
+    i*86:LynxOS:2.*:* | i*86:LynxOS:3.[01]*:* | i*86:LynxOS:4.0*:*)
+	echo i386-unknown-lynxos${UNAME_RELEASE}
+	exit 0 ;;
+    TSUNAMI:LynxOS:2.*:*)
+	echo sparc-unknown-lynxos${UNAME_RELEASE}
+	exit 0 ;;
+    rs6000:LynxOS:2.*:*)
+	echo rs6000-unknown-lynxos${UNAME_RELEASE}
+	exit 0 ;;
+    PowerPC:LynxOS:2.*:* | PowerPC:LynxOS:3.[01]*:* | PowerPC:LynxOS:4.0*:*)
+	echo powerpc-unknown-lynxos${UNAME_RELEASE}
+	exit 0 ;;
+    SM[BE]S:UNIX_SV:*:*)
+	echo mips-dde-sysv${UNAME_RELEASE}
+	exit 0 ;;
+    RM*:ReliantUNIX-*:*:*)
+	echo mips-sni-sysv4
+	exit 0 ;;
+    RM*:SINIX-*:*:*)
+	echo mips-sni-sysv4
+	exit 0 ;;
+    *:SINIX-*:*:*)
+	if uname -p 2>/dev/null >/dev/null ; then
+		UNAME_MACHINE=`(uname -p) 2>/dev/null`
+		echo ${UNAME_MACHINE}-sni-sysv4
+	else
+		echo ns32k-sni-sysv
+	fi
+	exit 0 ;;
+    PENTIUM:*:4.0*:*) # Unisys `ClearPath HMP IX 4000' SVR4/MP effort
+                      # says <Richard.M.Bartel at ccMail.Census.GOV>
+        echo i586-unisys-sysv4
+        exit 0 ;;
+    *:UNIX_System_V:4*:FTX*)
+	# From Gerald Hewes <hewes at openmarket.com>.
+	# How about differentiating between stratus architectures? -djm
+	echo hppa1.1-stratus-sysv4
+	exit 0 ;;
+    *:*:*:FTX*)
+	# From seanf at swdc.stratus.com.
+	echo i860-stratus-sysv4
+	exit 0 ;;
+    *:VOS:*:*)
+	# From Paul.Green at stratus.com.
+	echo hppa1.1-stratus-vos
+	exit 0 ;;
+    mc68*:A/UX:*:*)
+	echo m68k-apple-aux${UNAME_RELEASE}
+	exit 0 ;;
+    news*:NEWS-OS:6*:*)
+	echo mips-sony-newsos6
+	exit 0 ;;
+    R[34]000:*System_V*:*:* | R4000:UNIX_SYSV:*:* | R*000:UNIX_SV:*:*)
+	if [ -d /usr/nec ]; then
+	        echo mips-nec-sysv${UNAME_RELEASE}
+	else
+	        echo mips-unknown-sysv${UNAME_RELEASE}
+	fi
+        exit 0 ;;
+    BeBox:BeOS:*:*)	# BeOS running on hardware made by Be, PPC only.
+	echo powerpc-be-beos
+	exit 0 ;;
+    BeMac:BeOS:*:*)	# BeOS running on Mac or Mac clone, PPC only.
+	echo powerpc-apple-beos
+	exit 0 ;;
+    BePC:BeOS:*:*)	# BeOS running on Intel PC compatible.
+	echo i586-pc-beos
+	exit 0 ;;
+    SX-4:SUPER-UX:*:*)
+	echo sx4-nec-superux${UNAME_RELEASE}
+	exit 0 ;;
+    SX-5:SUPER-UX:*:*)
+	echo sx5-nec-superux${UNAME_RELEASE}
+	exit 0 ;;
+    Power*:Rhapsody:*:*)
+	echo powerpc-apple-rhapsody${UNAME_RELEASE}
+	exit 0 ;;
+    *:Rhapsody:*:*)
+	echo ${UNAME_MACHINE}-apple-rhapsody${UNAME_RELEASE}
+	exit 0 ;;
+    *:Darwin:*:*)
+	echo `uname -p`-apple-darwin${UNAME_RELEASE}
+	exit 0 ;;
+    *:procnto*:*:* | *:QNX:[0123456789]*:*)
+	UNAME_PROCESSOR=`uname -p`
+	if test "$UNAME_PROCESSOR" = "x86"; then
+		UNAME_PROCESSOR=i386
+		UNAME_MACHINE=pc
+	fi
+	echo ${UNAME_PROCESSOR}-${UNAME_MACHINE}-nto-qnx${UNAME_RELEASE}
+	exit 0 ;;
+    *:QNX:*:4*)
+	echo i386-pc-qnx
+	exit 0 ;;
+    NSR-[GKLNPTVW]:NONSTOP_KERNEL:*:*)
+	echo nsr-tandem-nsk${UNAME_RELEASE}
+	exit 0 ;;
+    *:NonStop-UX:*:*)
+	echo mips-compaq-nonstopux
+	exit 0 ;;
+    BS2000:POSIX*:*:*)
+	echo bs2000-siemens-sysv
+	exit 0 ;;
+    DS/*:UNIX_System_V:*:*)
+	echo ${UNAME_MACHINE}-${UNAME_SYSTEM}-${UNAME_RELEASE}
+	exit 0 ;;
+    *:Plan9:*:*)
+	# "uname -m" is not consistent, so use $cputype instead. 386
+	# is converted to i386 for consistency with other x86
+	# operating systems.
+	if test "$cputype" = "386"; then
+	    UNAME_MACHINE=i386
+	else
+	    UNAME_MACHINE="$cputype"
+	fi
+	echo ${UNAME_MACHINE}-unknown-plan9
+	exit 0 ;;
+    i*86:OS/2:*:*)
+	# If we were able to find `uname', then EMX Unix compatibility
+	# is probably installed.
+	echo ${UNAME_MACHINE}-pc-os2-emx
+	exit 0 ;;
+    *:TOPS-10:*:*)
+	echo pdp10-unknown-tops10
+	exit 0 ;;
+    *:TENEX:*:*)
+	echo pdp10-unknown-tenex
+	exit 0 ;;
+    KS10:TOPS-20:*:* | KL10:TOPS-20:*:* | TYPE4:TOPS-20:*:*)
+	echo pdp10-dec-tops20
+	exit 0 ;;
+    XKL-1:TOPS-20:*:* | TYPE5:TOPS-20:*:*)
+	echo pdp10-xkl-tops20
+	exit 0 ;;
+    *:TOPS-20:*:*)
+	echo pdp10-unknown-tops20
+	exit 0 ;;
+    *:ITS:*:*)
+	echo pdp10-unknown-its
+	exit 0 ;;
+    i*86:XTS-300:*:STOP)
+	echo ${UNAME_MACHINE}-unknown-stop
+	exit 0 ;;
+    i*86:atheos:*:*)
+	echo ${UNAME_MACHINE}-unknown-atheos
+	exit 0 ;;
+esac
+
+#echo '(No uname command or uname output not recognized.)' 1>&2
+#echo "${UNAME_MACHINE}:${UNAME_SYSTEM}:${UNAME_RELEASE}:${UNAME_VERSION}" 1>&2
+
+eval $set_cc_for_build
+cat >$dummy.c <<EOF
+#ifdef _SEQUENT_
+# include <sys/types.h>
+# include <sys/utsname.h>
+#endif
+main ()
+{
+#if defined (sony)
+#if defined (MIPSEB)
+  /* BFD wants "bsd" instead of "newsos".  Perhaps BFD should be changed,
+     I don't know....  */
+  printf ("mips-sony-bsd\n"); exit (0);
+#else
+#include <sys/param.h>
+  printf ("m68k-sony-newsos%s\n",
+#ifdef NEWSOS4
+          "4"
+#else
+	  ""
+#endif
+         ); exit (0);
+#endif
+#endif
+
+#if defined (__arm) && defined (__acorn) && defined (__unix)
+  printf ("arm-acorn-riscix"); exit (0);
+#endif
+
+#if defined (hp300) && !defined (hpux)
+  printf ("m68k-hp-bsd\n"); exit (0);
+#endif
+
+#if defined (NeXT)
+#if !defined (__ARCHITECTURE__)
+#define __ARCHITECTURE__ "m68k"
+#endif
+  int version;
+  version=`(hostinfo | sed -n 's/.*NeXT Mach \([0-9]*\).*/\1/p') 2>/dev/null`;
+  if (version < 4)
+    printf ("%s-next-nextstep%d\n", __ARCHITECTURE__, version);
+  else
+    printf ("%s-next-openstep%d\n", __ARCHITECTURE__, version);
+  exit (0);
+#endif
+
+#if defined (MULTIMAX) || defined (n16)
+#if defined (UMAXV)
+  printf ("ns32k-encore-sysv\n"); exit (0);
+#else
+#if defined (CMU)
+  printf ("ns32k-encore-mach\n"); exit (0);
+#else
+  printf ("ns32k-encore-bsd\n"); exit (0);
+#endif
+#endif
+#endif
+
+#if defined (__386BSD__)
+  printf ("i386-pc-bsd\n"); exit (0);
+#endif
+
+#if defined (sequent)
+#if defined (i386)
+  printf ("i386-sequent-dynix\n"); exit (0);
+#endif
+#if defined (ns32000)
+  printf ("ns32k-sequent-dynix\n"); exit (0);
+#endif
+#endif
+
+#if defined (_SEQUENT_)
+    struct utsname un;
+
+    uname(&un);
+
+    if (strncmp(un.version, "V2", 2) == 0) {
+	printf ("i386-sequent-ptx2\n"); exit (0);
+    }
+    if (strncmp(un.version, "V1", 2) == 0) { /* XXX is V1 correct? */
+	printf ("i386-sequent-ptx1\n"); exit (0);
+    }
+    printf ("i386-sequent-ptx\n"); exit (0);
+
+#endif
+
+#if defined (vax)
+# if !defined (ultrix)
+#  include <sys/param.h>
+#  if defined (BSD)
+#   if BSD == 43
+      printf ("vax-dec-bsd4.3\n"); exit (0);
+#   else
+#    if BSD == 199006
+      printf ("vax-dec-bsd4.3reno\n"); exit (0);
+#    else
+      printf ("vax-dec-bsd\n"); exit (0);
+#    endif
+#   endif
+#  else
+    printf ("vax-dec-bsd\n"); exit (0);
+#  endif
+# else
+    printf ("vax-dec-ultrix\n"); exit (0);
+# endif
+#endif
+
+#if defined (alliant) && defined (i860)
+  printf ("i860-alliant-bsd\n"); exit (0);
+#endif
+
+  exit (1);
+}
+EOF
+
+$CC_FOR_BUILD $dummy.c -o $dummy 2>/dev/null && $dummy && rm -f $dummy.c $dummy && rmdir $tmpdir && exit 0
+rm -f $dummy.c $dummy && rmdir $tmpdir
+
+# Apollos put the system type in the environment.
+
+test -d /usr/apollo && { echo ${ISP}-apollo-${SYSTYPE}; exit 0; }
+
+# Convex versions that predate uname can use getsysinfo(1)
+
+if [ -x /usr/convex/getsysinfo ]
+then
+    case `getsysinfo -f cpu_type` in
+    c1*)
+	echo c1-convex-bsd
+	exit 0 ;;
+    c2*)
+	if getsysinfo -f scalar_acc
+	then echo c32-convex-bsd
+	else echo c2-convex-bsd
+	fi
+	exit 0 ;;
+    c34*)
+	echo c34-convex-bsd
+	exit 0 ;;
+    c38*)
+	echo c38-convex-bsd
+	exit 0 ;;
+    c4*)
+	echo c4-convex-bsd
+	exit 0 ;;
+    esac
+fi
+
+cat >&2 <<EOF
+$0: unable to guess system type
+
+This script, last modified $timestamp, has failed to recognize
+the operating system you are using. It is advised that you
+download the most up to date version of the config scripts from
+
+    ftp://ftp.gnu.org/pub/gnu/config/
+
+If the version you run ($0) is already up to date, please
+send the following data and any information you think might be
+pertinent to <config-patches at gnu.org> in order to provide the needed
+information to handle your system.
+
+config.guess timestamp = $timestamp
+
+uname -m = `(uname -m) 2>/dev/null || echo unknown`
+uname -r = `(uname -r) 2>/dev/null || echo unknown`
+uname -s = `(uname -s) 2>/dev/null || echo unknown`
+uname -v = `(uname -v) 2>/dev/null || echo unknown`
+
+/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null`
+/bin/uname -X     = `(/bin/uname -X) 2>/dev/null`
+
+hostinfo               = `(hostinfo) 2>/dev/null`
+/bin/universe          = `(/bin/universe) 2>/dev/null`
+/usr/bin/arch -k       = `(/usr/bin/arch -k) 2>/dev/null`
+/bin/arch              = `(/bin/arch) 2>/dev/null`
+/usr/bin/oslevel       = `(/usr/bin/oslevel) 2>/dev/null`
+/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null`
+
+UNAME_MACHINE = ${UNAME_MACHINE}
+UNAME_RELEASE = ${UNAME_RELEASE}
+UNAME_SYSTEM  = ${UNAME_SYSTEM}
+UNAME_VERSION = ${UNAME_VERSION}
+EOF
+
+exit 1
+
+# Local variables:
+# eval: (add-hook 'write-file-hooks 'time-stamp)
+# time-stamp-start: "timestamp='"
+# time-stamp-format: "%:y-%02m-%02d"
+# time-stamp-end: "'"
+# End:
Property changes on: trunk/packages/rnahybrid/branches/upstream/current/config.guess
___________________________________________________________________
Name: svn:executable
   + 
Added: trunk/packages/rnahybrid/branches/upstream/current/config.h.in
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/config.h.in	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/config.h.in	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,71 @@
+/* config.h.in.  Generated from configure.in by autoheader.  */
+
+/* Define to 1 if you have the <inttypes.h> header file. */
+#undef HAVE_INTTYPES_H
+
+/* Define to 1 if you have the `g2' library (-lg2). */
+#undef HAVE_LIBG2
+
+/* Define to 1 if you have the `gd' library (-lgd). */
+#undef HAVE_LIBGD
+
+/* Define to 1 if you have the `m' library (-lm). */
+#undef HAVE_LIBM
+
+/* Define to 1 if you have the <memory.h> header file. */
+#undef HAVE_MEMORY_H
+
+/* Define to 1 if you have the <stdint.h> header file. */
+#undef HAVE_STDINT_H
+
+/* Define to 1 if you have the <stdlib.h> header file. */
+#undef HAVE_STDLIB_H
+
+/* Define to 1 if you have the <strings.h> header file. */
+#undef HAVE_STRINGS_H
+
+/* Define to 1 if you have the <string.h> header file. */
+#undef HAVE_STRING_H
+
+/* Define to 1 if you have the <sys/stat.h> header file. */
+#undef HAVE_SYS_STAT_H
+
+/* Define to 1 if you have the <sys/types.h> header file. */
+#undef HAVE_SYS_TYPES_H
+
+/* Define to 1 if you have the <unistd.h> header file. */
+#undef HAVE_UNISTD_H
+
+/* Name of package */
+#undef PACKAGE
+
+/* Define to the address where bug reports for this package should be sent. */
+#undef PACKAGE_BUGREPORT
+
+/* Define to the full name of this package. */
+#undef PACKAGE_NAME
+
+/* Define to the full name and version of this package. */
+#undef PACKAGE_STRING
+
+/* Define to the one symbol short name of this package. */
+#undef PACKAGE_TARNAME
+
+/* Define to the version of this package. */
+#undef PACKAGE_VERSION
+
+/* Define to 1 if you have the ANSI C header files. */
+#undef STDC_HEADERS
+
+/* Version number of package */
+#undef VERSION
+
+/* Define to empty if `const' does not conform to ANSI C. */
+#undef const
+
+/* Define as `__inline' if that's what the C compiler calls it, or to nothing
+   if it is not supported. */
+#undef inline
+
+/* Define to `unsigned' if <sys/types.h> does not define. */
+#undef size_t
Added: trunk/packages/rnahybrid/branches/upstream/current/configure
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/configure	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/configure	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,5171 @@
+#! /bin/sh
+# From configure.in Revision: 1.0 .
+# Guess values for system-dependent variables and create Makefiles.
+# Generated by GNU Autoconf 2.57 for RNAhybrid 1.0.
+#
+# Report bugs to <marc at techfak.uni-bielefeld.de>.
+#
+# Copyright 1992, 1993, 1994, 1995, 1996, 1998, 1999, 2000, 2001, 2002
+# Free Software Foundation, Inc.
+# This configure script is free software; the Free Software Foundation
+# gives unlimited permission to copy, distribute and modify it.
+## --------------------- ##
+## M4sh Initialization.  ##
+## --------------------- ##
+
+# Be Bourne compatible
+if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then
+  emulate sh
+  NULLCMD=:
+  # Zsh 3.x and 4.x performs word splitting on ${1+"$@"}, which
+  # is contrary to our usage.  Disable this feature.
+  alias -g '${1+"$@"}'='"$@"'
+elif test -n "${BASH_VERSION+set}" && (set -o posix) >/dev/null 2>&1; then
+  set -o posix
+fi
+
+# Support unset when possible.
+if (FOO=FOO; unset FOO) >/dev/null 2>&1; then
+  as_unset=unset
+else
+  as_unset=false
+fi
+
+
+# Work around bugs in pre-3.0 UWIN ksh.
+$as_unset ENV MAIL MAILPATH
+PS1='$ '
+PS2='> '
+PS4='+ '
+
+# NLS nuisances.
+for as_var in \
+  LANG LANGUAGE LC_ADDRESS LC_ALL LC_COLLATE LC_CTYPE LC_IDENTIFICATION \
+  LC_MEASUREMENT LC_MESSAGES LC_MONETARY LC_NAME LC_NUMERIC LC_PAPER \
+  LC_TELEPHONE LC_TIME
+do
+  if (set +x; test -n "`(eval $as_var=C; export $as_var) 2>&1`"); then
+    eval $as_var=C; export $as_var
+  else
+    $as_unset $as_var
+  fi
+done
+
+# Required to use basename.
+if expr a : '\(a\)' >/dev/null 2>&1; then
+  as_expr=expr
+else
+  as_expr=false
+fi
+
+if (basename /) >/dev/null 2>&1 && test "X`basename / 2>&1`" = "X/"; then
+  as_basename=basename
+else
+  as_basename=false
+fi
+
+
+# Name of the executable.
+as_me=`$as_basename "$0" ||
+$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
+	 X"$0" : 'X\(//\)$' \| \
+	 X"$0" : 'X\(/\)$' \| \
+	 .     : '\(.\)' 2>/dev/null ||
+echo X/"$0" |
+    sed '/^.*\/\([^/][^/]*\)\/*$/{ s//\1/; q; }
+  	  /^X\/\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\/\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`
+
+
+# PATH needs CR, and LINENO needs CR and PATH.
+# Avoid depending upon Character Ranges.
+as_cr_letters='abcdefghijklmnopqrstuvwxyz'
+as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
+as_cr_Letters=$as_cr_letters$as_cr_LETTERS
+as_cr_digits='0123456789'
+as_cr_alnum=$as_cr_Letters$as_cr_digits
+
+# The user is always right.
+if test "${PATH_SEPARATOR+set}" != set; then
+  echo "#! /bin/sh" >conf$$.sh
+  echo  "exit 0"   >>conf$$.sh
+  chmod +x conf$$.sh
+  if (PATH="/nonexistent;."; conf$$.sh) >/dev/null 2>&1; then
+    PATH_SEPARATOR=';'
+  else
+    PATH_SEPARATOR=:
+  fi
+  rm -f conf$$.sh
+fi
+
+
+  as_lineno_1=$LINENO
+  as_lineno_2=$LINENO
+  as_lineno_3=`(expr $as_lineno_1 + 1) 2>/dev/null`
+  test "x$as_lineno_1" != "x$as_lineno_2" &&
+  test "x$as_lineno_3"  = "x$as_lineno_2"  || {
+  # Find who we are.  Look in the path if we contain no path at all
+  # relative or not.
+  case $0 in
+    *[\\/]* ) as_myself=$0 ;;
+    *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
+done
+
+       ;;
+  esac
+  # We did not find ourselves, most probably we were run as `sh COMMAND'
+  # in which case we are not to be found in the path.
+  if test "x$as_myself" = x; then
+    as_myself=$0
+  fi
+  if test ! -f "$as_myself"; then
+    { echo "$as_me: error: cannot find myself; rerun with an absolute path" >&2
+   { (exit 1); exit 1; }; }
+  fi
+  case $CONFIG_SHELL in
+  '')
+    as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in /bin$PATH_SEPARATOR/usr/bin$PATH_SEPARATOR$PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for as_base in sh bash ksh sh5; do
+	 case $as_dir in
+	 /*)
+	   if ("$as_dir/$as_base" -c '
+  as_lineno_1=$LINENO
+  as_lineno_2=$LINENO
+  as_lineno_3=`(expr $as_lineno_1 + 1) 2>/dev/null`
+  test "x$as_lineno_1" != "x$as_lineno_2" &&
+  test "x$as_lineno_3"  = "x$as_lineno_2" ') 2>/dev/null; then
+	     $as_unset BASH_ENV || test "${BASH_ENV+set}" != set || { BASH_ENV=; export BASH_ENV; }
+	     $as_unset ENV || test "${ENV+set}" != set || { ENV=; export ENV; }
+	     CONFIG_SHELL=$as_dir/$as_base
+	     export CONFIG_SHELL
+	     exec "$CONFIG_SHELL" "$0" ${1+"$@"}
+	   fi;;
+	 esac
+       done
+done
+;;
+  esac
+
+  # Create $as_me.lineno as a copy of $as_myself, but with $LINENO
+  # uniformly replaced by the line number.  The first 'sed' inserts a
+  # line-number line before each line; the second 'sed' does the real
+  # work.  The second script uses 'N' to pair each line-number line
+  # with the numbered line, and appends trailing '-' during
+  # substitution so that $LINENO is not a special case at line end.
+  # (Raja R Harinath suggested sed '=', and Paul Eggert wrote the
+  # second 'sed' script.  Blame Lee E. McMahon for sed's syntax.  :-)
+  sed '=' <$as_myself |
+    sed '
+      N
+      s,$,-,
+      : loop
+      s,^\(['$as_cr_digits']*\)\(.*\)[$]LINENO\([^'$as_cr_alnum'_]\),\1\2\1\3,
+      t loop
+      s,-$,,
+      s,^['$as_cr_digits']*\n,,
+    ' >$as_me.lineno &&
+  chmod +x $as_me.lineno ||
+    { echo "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2
+   { (exit 1); exit 1; }; }
+
+  # Don't try to exec as it changes $[0], causing all sort of problems
+  # (the dirname of $[0] is not the place where we might find the
+  # original and so on.  Autoconf is especially sensible to this).
+  . ./$as_me.lineno
+  # Exit status is that of the last command.
+  exit
+}
+
+
+case `echo "testing\c"; echo 1,2,3`,`echo -n testing; echo 1,2,3` in
+  *c*,-n*) ECHO_N= ECHO_C='
+' ECHO_T='	' ;;
+  *c*,*  ) ECHO_N=-n ECHO_C= ECHO_T= ;;
+  *)       ECHO_N= ECHO_C='\c' ECHO_T= ;;
+esac
+
+if expr a : '\(a\)' >/dev/null 2>&1; then
+  as_expr=expr
+else
+  as_expr=false
+fi
+
+rm -f conf$$ conf$$.exe conf$$.file
+echo >conf$$.file
+if ln -s conf$$.file conf$$ 2>/dev/null; then
+  # We could just check for DJGPP; but this test a) works b) is more generic
+  # and c) will remain valid once DJGPP supports symlinks (DJGPP 2.04).
+  if test -f conf$$.exe; then
+    # Don't use ln at all; we don't have any links
+    as_ln_s='cp -p'
+  else
+    as_ln_s='ln -s'
+  fi
+elif ln conf$$.file conf$$ 2>/dev/null; then
+  as_ln_s=ln
+else
+  as_ln_s='cp -p'
+fi
+rm -f conf$$ conf$$.exe conf$$.file
+
+if mkdir -p . 2>/dev/null; then
+  as_mkdir_p=:
+else
+  as_mkdir_p=false
+fi
+
+as_executable_p="test -f"
+
+# Sed expression to map a string onto a valid CPP name.
+as_tr_cpp="sed y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g"
+
+# Sed expression to map a string onto a valid variable name.
+as_tr_sh="sed y%*+%pp%;s%[^_$as_cr_alnum]%_%g"
+
+
+# IFS
+# We need space, tab and new line, in precisely that order.
+as_nl='
+'
+IFS=" 	$as_nl"
+
+# CDPATH.
+$as_unset CDPATH
+
+
+# Name of the host.
+# hostname on some systems (SVR3.2, Linux) returns a bogus exit status,
+# so uname gets run too.
+ac_hostname=`(hostname || uname -n) 2>/dev/null | sed 1q`
+
+exec 6>&1
+
+#
+# Initializations.
+#
+ac_default_prefix=/usr/local
+ac_config_libobj_dir=.
+cross_compiling=no
+subdirs=
+MFLAGS=
+MAKEFLAGS=
+SHELL=${CONFIG_SHELL-/bin/sh}
+
+# Maximum number of lines to put in a shell here document.
+# This variable seems obsolete.  It should probably be removed, and
+# only ac_max_sed_lines should be used.
+: ${ac_max_here_lines=38}
+
+# Identity of this package.
+PACKAGE_NAME='RNAhybrid'
+PACKAGE_TARNAME='RNAhybrid'
+PACKAGE_VERSION='1.0'
+PACKAGE_STRING='RNAhybrid 1.0'
+PACKAGE_BUGREPORT='marc at techfak.uni-bielefeld.de'
+
+# Factoring default headers for most tests.
+ac_includes_default="\
+#include <stdio.h>
+#if HAVE_SYS_TYPES_H
+# include <sys/types.h>
+#endif
+#if HAVE_SYS_STAT_H
+# include <sys/stat.h>
+#endif
+#if STDC_HEADERS
+# include <stdlib.h>
+# include <stddef.h>
+#else
+# if HAVE_STDLIB_H
+#  include <stdlib.h>
+# endif
+#endif
+#if HAVE_STRING_H
+# if !STDC_HEADERS && HAVE_MEMORY_H
+#  include <memory.h>
+# endif
+# include <string.h>
+#endif
+#if HAVE_STRINGS_H
+# include <strings.h>
+#endif
+#if HAVE_INTTYPES_H
+# include <inttypes.h>
+#else
+# if HAVE_STDINT_H
+#  include <stdint.h>
+# endif
+#endif
+#if HAVE_UNISTD_H
+# include <unistd.h>
+#endif"
+
+ac_subst_vars='SHELL PATH_SEPARATOR PACKAGE_NAME PACKAGE_TARNAME PACKAGE_VERSION PACKAGE_STRING PACKAGE_BUGREPORT exec_prefix prefix program_transform_name bindir sbindir libexecdir datadir sysconfdir sharedstatedir localstatedir libdir includedir oldincludedir infodir mandir build_alias host_alias target_alias DEFS ECHO_C ECHO_N ECHO_T LIBS INSTALL_PROGRAM INSTALL_SCRIPT INSTALL_DATA CYGPATH_W PACKAGE VERSION ACLOCAL AUTOCONF AUTOMAKE AUTOHEADER MAKEINFO AMTAR install_sh STRIP ac_ct_STRIP INSTALL_STRIP_PROGRAM AWK SET_MAKE am__leading_dot CC CFLAGS LDFLAGS CPPFLAGS ac_ct_CC EXEEXT OBJEXT DEPDIR am__include am__quote AMDEP_TRUE AMDEP_FALSE AMDEPBACKSLASH CCDEPMODE am__fastdepCC_TRUE am__fastdepCC_FALSE CPP EGREP LIBOBJS LTLIBOBJS'
+ac_subst_files=''
+
+# Initialize some variables set by options.
+ac_init_help=
+ac_init_version=false
+# The variables have the same names as the options, with
+# dashes changed to underlines.
+cache_file=/dev/null
+exec_prefix=NONE
+no_create=
+no_recursion=
+prefix=NONE
+program_prefix=NONE
+program_suffix=NONE
+program_transform_name=s,x,x,
+silent=
+site=
+srcdir=
+verbose=
+x_includes=NONE
+x_libraries=NONE
+
+# Installation directory options.
+# These are left unexpanded so users can "make install exec_prefix=/foo"
+# and all the variables that are supposed to be based on exec_prefix
+# by default will actually change.
+# Use braces instead of parens because sh, perl, etc. also accept them.
+bindir='${exec_prefix}/bin'
+sbindir='${exec_prefix}/sbin'
+libexecdir='${exec_prefix}/libexec'
+datadir='${prefix}/share'
+sysconfdir='${prefix}/etc'
+sharedstatedir='${prefix}/com'
+localstatedir='${prefix}/var'
+libdir='${exec_prefix}/lib'
+includedir='${prefix}/include'
+oldincludedir='/usr/include'
+infodir='${prefix}/info'
+mandir='${prefix}/man'
+
+ac_prev=
+for ac_option
+do
+  # If the previous option needs an argument, assign it.
+  if test -n "$ac_prev"; then
+    eval "$ac_prev=\$ac_option"
+    ac_prev=
+    continue
+  fi
+
+  ac_optarg=`expr "x$ac_option" : 'x[^=]*=\(.*\)'`
+
+  # Accept the important Cygnus configure options, so we can diagnose typos.
+
+  case $ac_option in
+
+  -bindir | --bindir | --bindi | --bind | --bin | --bi)
+    ac_prev=bindir ;;
+  -bindir=* | --bindir=* | --bindi=* | --bind=* | --bin=* | --bi=*)
+    bindir=$ac_optarg ;;
+
+  -build | --build | --buil | --bui | --bu)
+    ac_prev=build_alias ;;
+  -build=* | --build=* | --buil=* | --bui=* | --bu=*)
+    build_alias=$ac_optarg ;;
+
+  -cache-file | --cache-file | --cache-fil | --cache-fi \
+  | --cache-f | --cache- | --cache | --cach | --cac | --ca | --c)
+    ac_prev=cache_file ;;
+  -cache-file=* | --cache-file=* | --cache-fil=* | --cache-fi=* \
+  | --cache-f=* | --cache-=* | --cache=* | --cach=* | --cac=* | --ca=* | --c=*)
+    cache_file=$ac_optarg ;;
+
+  --config-cache | -C)
+    cache_file=config.cache ;;
+
+  -datadir | --datadir | --datadi | --datad | --data | --dat | --da)
+    ac_prev=datadir ;;
+  -datadir=* | --datadir=* | --datadi=* | --datad=* | --data=* | --dat=* \
+  | --da=*)
+    datadir=$ac_optarg ;;
+
+  -disable-* | --disable-*)
+    ac_feature=`expr "x$ac_option" : 'x-*disable-\(.*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_feature" : ".*[^-_$as_cr_alnum]" >/dev/null &&
+      { echo "$as_me: error: invalid feature name: $ac_feature" >&2
+   { (exit 1); exit 1; }; }
+    ac_feature=`echo $ac_feature | sed 's/-/_/g'`
+    eval "enable_$ac_feature=no" ;;
+
+  -enable-* | --enable-*)
+    ac_feature=`expr "x$ac_option" : 'x-*enable-\([^=]*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_feature" : ".*[^-_$as_cr_alnum]" >/dev/null &&
+      { echo "$as_me: error: invalid feature name: $ac_feature" >&2
+   { (exit 1); exit 1; }; }
+    ac_feature=`echo $ac_feature | sed 's/-/_/g'`
+    case $ac_option in
+      *=*) ac_optarg=`echo "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"`;;
+      *) ac_optarg=yes ;;
+    esac
+    eval "enable_$ac_feature='$ac_optarg'" ;;
+
+  -exec-prefix | --exec_prefix | --exec-prefix | --exec-prefi \
+  | --exec-pref | --exec-pre | --exec-pr | --exec-p | --exec- \
+  | --exec | --exe | --ex)
+    ac_prev=exec_prefix ;;
+  -exec-prefix=* | --exec_prefix=* | --exec-prefix=* | --exec-prefi=* \
+  | --exec-pref=* | --exec-pre=* | --exec-pr=* | --exec-p=* | --exec-=* \
+  | --exec=* | --exe=* | --ex=*)
+    exec_prefix=$ac_optarg ;;
+
+  -gas | --gas | --ga | --g)
+    # Obsolete; use --with-gas.
+    with_gas=yes ;;
+
+  -help | --help | --hel | --he | -h)
+    ac_init_help=long ;;
+  -help=r* | --help=r* | --hel=r* | --he=r* | -hr*)
+    ac_init_help=recursive ;;
+  -help=s* | --help=s* | --hel=s* | --he=s* | -hs*)
+    ac_init_help=short ;;
+
+  -host | --host | --hos | --ho)
+    ac_prev=host_alias ;;
+  -host=* | --host=* | --hos=* | --ho=*)
+    host_alias=$ac_optarg ;;
+
+  -includedir | --includedir | --includedi | --included | --include \
+  | --includ | --inclu | --incl | --inc)
+    ac_prev=includedir ;;
+  -includedir=* | --includedir=* | --includedi=* | --included=* | --include=* \
+  | --includ=* | --inclu=* | --incl=* | --inc=*)
+    includedir=$ac_optarg ;;
+
+  -infodir | --infodir | --infodi | --infod | --info | --inf)
+    ac_prev=infodir ;;
+  -infodir=* | --infodir=* | --infodi=* | --infod=* | --info=* | --inf=*)
+    infodir=$ac_optarg ;;
+
+  -libdir | --libdir | --libdi | --libd)
+    ac_prev=libdir ;;
+  -libdir=* | --libdir=* | --libdi=* | --libd=*)
+    libdir=$ac_optarg ;;
+
+  -libexecdir | --libexecdir | --libexecdi | --libexecd | --libexec \
+  | --libexe | --libex | --libe)
+    ac_prev=libexecdir ;;
+  -libexecdir=* | --libexecdir=* | --libexecdi=* | --libexecd=* | --libexec=* \
+  | --libexe=* | --libex=* | --libe=*)
+    libexecdir=$ac_optarg ;;
+
+  -localstatedir | --localstatedir | --localstatedi | --localstated \
+  | --localstate | --localstat | --localsta | --localst \
+  | --locals | --local | --loca | --loc | --lo)
+    ac_prev=localstatedir ;;
+  -localstatedir=* | --localstatedir=* | --localstatedi=* | --localstated=* \
+  | --localstate=* | --localstat=* | --localsta=* | --localst=* \
+  | --locals=* | --local=* | --loca=* | --loc=* | --lo=*)
+    localstatedir=$ac_optarg ;;
+
+  -mandir | --mandir | --mandi | --mand | --man | --ma | --m)
+    ac_prev=mandir ;;
+  -mandir=* | --mandir=* | --mandi=* | --mand=* | --man=* | --ma=* | --m=*)
+    mandir=$ac_optarg ;;
+
+  -nfp | --nfp | --nf)
+    # Obsolete; use --without-fp.
+    with_fp=no ;;
+
+  -no-create | --no-create | --no-creat | --no-crea | --no-cre \
+  | --no-cr | --no-c | -n)
+    no_create=yes ;;
+
+  -no-recursion | --no-recursion | --no-recursio | --no-recursi \
+  | --no-recurs | --no-recur | --no-recu | --no-rec | --no-re | --no-r)
+    no_recursion=yes ;;
+
+  -oldincludedir | --oldincludedir | --oldincludedi | --oldincluded \
+  | --oldinclude | --oldinclud | --oldinclu | --oldincl | --oldinc \
+  | --oldin | --oldi | --old | --ol | --o)
+    ac_prev=oldincludedir ;;
+  -oldincludedir=* | --oldincludedir=* | --oldincludedi=* | --oldincluded=* \
+  | --oldinclude=* | --oldinclud=* | --oldinclu=* | --oldincl=* | --oldinc=* \
+  | --oldin=* | --oldi=* | --old=* | --ol=* | --o=*)
+    oldincludedir=$ac_optarg ;;
+
+  -prefix | --prefix | --prefi | --pref | --pre | --pr | --p)
+    ac_prev=prefix ;;
+  -prefix=* | --prefix=* | --prefi=* | --pref=* | --pre=* | --pr=* | --p=*)
+    prefix=$ac_optarg ;;
+
+  -program-prefix | --program-prefix | --program-prefi | --program-pref \
+  | --program-pre | --program-pr | --program-p)
+    ac_prev=program_prefix ;;
+  -program-prefix=* | --program-prefix=* | --program-prefi=* \
+  | --program-pref=* | --program-pre=* | --program-pr=* | --program-p=*)
+    program_prefix=$ac_optarg ;;
+
+  -program-suffix | --program-suffix | --program-suffi | --program-suff \
+  | --program-suf | --program-su | --program-s)
+    ac_prev=program_suffix ;;
+  -program-suffix=* | --program-suffix=* | --program-suffi=* \
+  | --program-suff=* | --program-suf=* | --program-su=* | --program-s=*)
+    program_suffix=$ac_optarg ;;
+
+  -program-transform-name | --program-transform-name \
+  | --program-transform-nam | --program-transform-na \
+  | --program-transform-n | --program-transform- \
+  | --program-transform | --program-transfor \
+  | --program-transfo | --program-transf \
+  | --program-trans | --program-tran \
+  | --progr-tra | --program-tr | --program-t)
+    ac_prev=program_transform_name ;;
+  -program-transform-name=* | --program-transform-name=* \
+  | --program-transform-nam=* | --program-transform-na=* \
+  | --program-transform-n=* | --program-transform-=* \
+  | --program-transform=* | --program-transfor=* \
+  | --program-transfo=* | --program-transf=* \
+  | --program-trans=* | --program-tran=* \
+  | --progr-tra=* | --program-tr=* | --program-t=*)
+    program_transform_name=$ac_optarg ;;
+
+  -q | -quiet | --quiet | --quie | --qui | --qu | --q \
+  | -silent | --silent | --silen | --sile | --sil)
+    silent=yes ;;
+
+  -sbindir | --sbindir | --sbindi | --sbind | --sbin | --sbi | --sb)
+    ac_prev=sbindir ;;
+  -sbindir=* | --sbindir=* | --sbindi=* | --sbind=* | --sbin=* \
+  | --sbi=* | --sb=*)
+    sbindir=$ac_optarg ;;
+
+  -sharedstatedir | --sharedstatedir | --sharedstatedi \
+  | --sharedstated | --sharedstate | --sharedstat | --sharedsta \
+  | --sharedst | --shareds | --shared | --share | --shar \
+  | --sha | --sh)
+    ac_prev=sharedstatedir ;;
+  -sharedstatedir=* | --sharedstatedir=* | --sharedstatedi=* \
+  | --sharedstated=* | --sharedstate=* | --sharedstat=* | --sharedsta=* \
+  | --sharedst=* | --shareds=* | --shared=* | --share=* | --shar=* \
+  | --sha=* | --sh=*)
+    sharedstatedir=$ac_optarg ;;
+
+  -site | --site | --sit)
+    ac_prev=site ;;
+  -site=* | --site=* | --sit=*)
+    site=$ac_optarg ;;
+
+  -srcdir | --srcdir | --srcdi | --srcd | --src | --sr)
+    ac_prev=srcdir ;;
+  -srcdir=* | --srcdir=* | --srcdi=* | --srcd=* | --src=* | --sr=*)
+    srcdir=$ac_optarg ;;
+
+  -sysconfdir | --sysconfdir | --sysconfdi | --sysconfd | --sysconf \
+  | --syscon | --sysco | --sysc | --sys | --sy)
+    ac_prev=sysconfdir ;;
+  -sysconfdir=* | --sysconfdir=* | --sysconfdi=* | --sysconfd=* | --sysconf=* \
+  | --syscon=* | --sysco=* | --sysc=* | --sys=* | --sy=*)
+    sysconfdir=$ac_optarg ;;
+
+  -target | --target | --targe | --targ | --tar | --ta | --t)
+    ac_prev=target_alias ;;
+  -target=* | --target=* | --targe=* | --targ=* | --tar=* | --ta=* | --t=*)
+    target_alias=$ac_optarg ;;
+
+  -v | -verbose | --verbose | --verbos | --verbo | --verb)
+    verbose=yes ;;
+
+  -version | --version | --versio | --versi | --vers | -V)
+    ac_init_version=: ;;
+
+  -with-* | --with-*)
+    ac_package=`expr "x$ac_option" : 'x-*with-\([^=]*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_package" : ".*[^-_$as_cr_alnum]" >/dev/null &&
+      { echo "$as_me: error: invalid package name: $ac_package" >&2
+   { (exit 1); exit 1; }; }
+    ac_package=`echo $ac_package| sed 's/-/_/g'`
+    case $ac_option in
+      *=*) ac_optarg=`echo "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"`;;
+      *) ac_optarg=yes ;;
+    esac
+    eval "with_$ac_package='$ac_optarg'" ;;
+
+  -without-* | --without-*)
+    ac_package=`expr "x$ac_option" : 'x-*without-\(.*\)'`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_package" : ".*[^-_$as_cr_alnum]" >/dev/null &&
+      { echo "$as_me: error: invalid package name: $ac_package" >&2
+   { (exit 1); exit 1; }; }
+    ac_package=`echo $ac_package | sed 's/-/_/g'`
+    eval "with_$ac_package=no" ;;
+
+  --x)
+    # Obsolete; use --with-x.
+    with_x=yes ;;
+
+  -x-includes | --x-includes | --x-include | --x-includ | --x-inclu \
+  | --x-incl | --x-inc | --x-in | --x-i)
+    ac_prev=x_includes ;;
+  -x-includes=* | --x-includes=* | --x-include=* | --x-includ=* | --x-inclu=* \
+  | --x-incl=* | --x-inc=* | --x-in=* | --x-i=*)
+    x_includes=$ac_optarg ;;
+
+  -x-libraries | --x-libraries | --x-librarie | --x-librari \
+  | --x-librar | --x-libra | --x-libr | --x-lib | --x-li | --x-l)
+    ac_prev=x_libraries ;;
+  -x-libraries=* | --x-libraries=* | --x-librarie=* | --x-librari=* \
+  | --x-librar=* | --x-libra=* | --x-libr=* | --x-lib=* | --x-li=* | --x-l=*)
+    x_libraries=$ac_optarg ;;
+
+  -*) { echo "$as_me: error: unrecognized option: $ac_option
+Try \`$0 --help' for more information." >&2
+   { (exit 1); exit 1; }; }
+    ;;
+
+  *=*)
+    ac_envvar=`expr "x$ac_option" : 'x\([^=]*\)='`
+    # Reject names that are not valid shell variable names.
+    expr "x$ac_envvar" : ".*[^_$as_cr_alnum]" >/dev/null &&
+      { echo "$as_me: error: invalid variable name: $ac_envvar" >&2
+   { (exit 1); exit 1; }; }
+    ac_optarg=`echo "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"`
+    eval "$ac_envvar='$ac_optarg'"
+    export $ac_envvar ;;
+
+  *)
+    # FIXME: should be removed in autoconf 3.0.
+    echo "$as_me: WARNING: you should use --build, --host, --target" >&2
+    expr "x$ac_option" : ".*[^-._$as_cr_alnum]" >/dev/null &&
+      echo "$as_me: WARNING: invalid host type: $ac_option" >&2
+    : ${build_alias=$ac_option} ${host_alias=$ac_option} ${target_alias=$ac_option}
+    ;;
+
+  esac
+done
+
+if test -n "$ac_prev"; then
+  ac_option=--`echo $ac_prev | sed 's/_/-/g'`
+  { echo "$as_me: error: missing argument to $ac_option" >&2
+   { (exit 1); exit 1; }; }
+fi
+
+# Be sure to have absolute paths.
+for ac_var in exec_prefix prefix
+do
+  eval ac_val=$`echo $ac_var`
+  case $ac_val in
+    [\\/$]* | ?:[\\/]* | NONE | '' ) ;;
+    *)  { echo "$as_me: error: expected an absolute directory name for --$ac_var: $ac_val" >&2
+   { (exit 1); exit 1; }; };;
+  esac
+done
+
+# Be sure to have absolute paths.
+for ac_var in bindir sbindir libexecdir datadir sysconfdir sharedstatedir \
+              localstatedir libdir includedir oldincludedir infodir mandir
+do
+  eval ac_val=$`echo $ac_var`
+  case $ac_val in
+    [\\/$]* | ?:[\\/]* ) ;;
+    *)  { echo "$as_me: error: expected an absolute directory name for --$ac_var: $ac_val" >&2
+   { (exit 1); exit 1; }; };;
+  esac
+done
+
+# There might be people who depend on the old broken behavior: `$host'
+# used to hold the argument of --host etc.
+# FIXME: To remove some day.
+build=$build_alias
+host=$host_alias
+target=$target_alias
+
+# FIXME: To remove some day.
+if test "x$host_alias" != x; then
+  if test "x$build_alias" = x; then
+    cross_compiling=maybe
+    echo "$as_me: WARNING: If you wanted to set the --build type, don't use --host.
+    If a cross compiler is detected then cross compile mode will be used." >&2
+  elif test "x$build_alias" != "x$host_alias"; then
+    cross_compiling=yes
+  fi
+fi
+
+ac_tool_prefix=
+test -n "$host_alias" && ac_tool_prefix=$host_alias-
+
+test "$silent" = yes && exec 6>/dev/null
+
+
+# Find the source files, if location was not specified.
+if test -z "$srcdir"; then
+  ac_srcdir_defaulted=yes
+  # Try the directory containing this script, then its parent.
+  ac_confdir=`(dirname "$0") 2>/dev/null ||
+$as_expr X"$0" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+         X"$0" : 'X\(//\)[^/]' \| \
+         X"$0" : 'X\(//\)$' \| \
+         X"$0" : 'X\(/\)' \| \
+         .     : '\(.\)' 2>/dev/null ||
+echo X"$0" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ s//\1/; q; }
+  	  /^X\(\/\/\)[^/].*/{ s//\1/; q; }
+  	  /^X\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`
+  srcdir=$ac_confdir
+  if test ! -r $srcdir/$ac_unique_file; then
+    srcdir=..
+  fi
+else
+  ac_srcdir_defaulted=no
+fi
+if test ! -r $srcdir/$ac_unique_file; then
+  if test "$ac_srcdir_defaulted" = yes; then
+    { echo "$as_me: error: cannot find sources ($ac_unique_file) in $ac_confdir or .." >&2
+   { (exit 1); exit 1; }; }
+  else
+    { echo "$as_me: error: cannot find sources ($ac_unique_file) in $srcdir" >&2
+   { (exit 1); exit 1; }; }
+  fi
+fi
+(cd $srcdir && test -r ./$ac_unique_file) 2>/dev/null ||
+  { echo "$as_me: error: sources are in $srcdir, but \`cd $srcdir' does not work" >&2
+   { (exit 1); exit 1; }; }
+srcdir=`echo "$srcdir" | sed 's%\([^\\/]\)[\\/]*$%\1%'`
+ac_env_build_alias_set=${build_alias+set}
+ac_env_build_alias_value=$build_alias
+ac_cv_env_build_alias_set=${build_alias+set}
+ac_cv_env_build_alias_value=$build_alias
+ac_env_host_alias_set=${host_alias+set}
+ac_env_host_alias_value=$host_alias
+ac_cv_env_host_alias_set=${host_alias+set}
+ac_cv_env_host_alias_value=$host_alias
+ac_env_target_alias_set=${target_alias+set}
+ac_env_target_alias_value=$target_alias
+ac_cv_env_target_alias_set=${target_alias+set}
+ac_cv_env_target_alias_value=$target_alias
+ac_env_CC_set=${CC+set}
+ac_env_CC_value=$CC
+ac_cv_env_CC_set=${CC+set}
+ac_cv_env_CC_value=$CC
+ac_env_CFLAGS_set=${CFLAGS+set}
+ac_env_CFLAGS_value=$CFLAGS
+ac_cv_env_CFLAGS_set=${CFLAGS+set}
+ac_cv_env_CFLAGS_value=$CFLAGS
+ac_env_LDFLAGS_set=${LDFLAGS+set}
+ac_env_LDFLAGS_value=$LDFLAGS
+ac_cv_env_LDFLAGS_set=${LDFLAGS+set}
+ac_cv_env_LDFLAGS_value=$LDFLAGS
+ac_env_CPPFLAGS_set=${CPPFLAGS+set}
+ac_env_CPPFLAGS_value=$CPPFLAGS
+ac_cv_env_CPPFLAGS_set=${CPPFLAGS+set}
+ac_cv_env_CPPFLAGS_value=$CPPFLAGS
+ac_env_CPP_set=${CPP+set}
+ac_env_CPP_value=$CPP
+ac_cv_env_CPP_set=${CPP+set}
+ac_cv_env_CPP_value=$CPP
+
+#
+# Report the --help message.
+#
+if test "$ac_init_help" = "long"; then
+  # Omit some internal or obsolete options to make the list less imposing.
+  # This message is too long to be a string in the A/UX 3.1 sh.
+  cat <<_ACEOF
+\`configure' configures RNAhybrid 1.0 to adapt to many kinds of systems.
+
+Usage: $0 [OPTION]... [VAR=VALUE]...
+
+To assign environment variables (e.g., CC, CFLAGS...), specify them as
+VAR=VALUE.  See below for descriptions of some of the useful variables.
+
+Defaults for the options are specified in brackets.
+
+Configuration:
+  -h, --help              display this help and exit
+      --help=short        display options specific to this package
+      --help=recursive    display the short help of all the included packages
+  -V, --version           display version information and exit
+  -q, --quiet, --silent   do not print \`checking...' messages
+      --cache-file=FILE   cache test results in FILE [disabled]
+  -C, --config-cache      alias for \`--cache-file=config.cache'
+  -n, --no-create         do not create output files
+      --srcdir=DIR        find the sources in DIR [configure dir or \`..']
+
+_ACEOF
+
+  cat <<_ACEOF
+Installation directories:
+  --prefix=PREFIX         install architecture-independent files in PREFIX
+                          [$ac_default_prefix]
+  --exec-prefix=EPREFIX   install architecture-dependent files in EPREFIX
+                          [PREFIX]
+
+By default, \`make install' will install all the files in
+\`$ac_default_prefix/bin', \`$ac_default_prefix/lib' etc.  You can specify
+an installation prefix other than \`$ac_default_prefix' using \`--prefix',
+for instance \`--prefix=\$HOME'.
+
+For better control, use the options below.
+
+Fine tuning of the installation directories:
+  --bindir=DIR           user executables [EPREFIX/bin]
+  --sbindir=DIR          system admin executables [EPREFIX/sbin]
+  --libexecdir=DIR       program executables [EPREFIX/libexec]
+  --datadir=DIR          read-only architecture-independent data [PREFIX/share]
+  --sysconfdir=DIR       read-only single-machine data [PREFIX/etc]
+  --sharedstatedir=DIR   modifiable architecture-independent data [PREFIX/com]
+  --localstatedir=DIR    modifiable single-machine data [PREFIX/var]
+  --libdir=DIR           object code libraries [EPREFIX/lib]
+  --includedir=DIR       C header files [PREFIX/include]
+  --oldincludedir=DIR    C header files for non-gcc [/usr/include]
+  --infodir=DIR          info documentation [PREFIX/info]
+  --mandir=DIR           man documentation [PREFIX/man]
+_ACEOF
+
+  cat <<\_ACEOF
+
+Program names:
+  --program-prefix=PREFIX            prepend PREFIX to installed program names
+  --program-suffix=SUFFIX            append SUFFIX to installed program names
+  --program-transform-name=PROGRAM   run sed PROGRAM on installed program names
+_ACEOF
+fi
+
+if test -n "$ac_init_help"; then
+  case $ac_init_help in
+     short | recursive ) echo "Configuration of RNAhybrid 1.0:";;
+   esac
+  cat <<\_ACEOF
+
+Optional Features:
+  --disable-FEATURE       do not include FEATURE (same as --enable-FEATURE=no)
+  --enable-FEATURE[=ARG]  include FEATURE [ARG=yes]
+  --disable-dependency-tracking Speeds up one-time builds
+  --enable-dependency-tracking  Do not reject slow dependency extractors
+
+Some influential environment variables:
+  CC          C compiler command
+  CFLAGS      C compiler flags
+  LDFLAGS     linker flags, e.g. -L<lib dir> if you have libraries in a
+              nonstandard directory <lib dir>
+  CPPFLAGS    C/C++ preprocessor flags, e.g. -I<include dir> if you have
+              headers in a nonstandard directory <include dir>
+  CPP         C preprocessor
+
+Use these variables to override the choices made by `configure' or to help
+it to find libraries and programs with nonstandard names/locations.
+
+Report bugs to <marc at techfak.uni-bielefeld.de>.
+_ACEOF
+fi
+
+if test "$ac_init_help" = "recursive"; then
+  # If there are subdirs, report their specific --help.
+  ac_popdir=`pwd`
+  for ac_dir in : $ac_subdirs_all; do test "x$ac_dir" = x: && continue
+    test -d $ac_dir || continue
+    ac_builddir=.
+
+if test "$ac_dir" != .; then
+  ac_dir_suffix=/`echo "$ac_dir" | sed 's,^\.[\\/],,'`
+  # A "../" for each directory in $ac_dir_suffix.
+  ac_top_builddir=`echo "$ac_dir_suffix" | sed 's,/[^\\/]*,../,g'`
+else
+  ac_dir_suffix= ac_top_builddir=
+fi
+
+case $srcdir in
+  .)  # No --srcdir option.  We are building in place.
+    ac_srcdir=.
+    if test -z "$ac_top_builddir"; then
+       ac_top_srcdir=.
+    else
+       ac_top_srcdir=`echo $ac_top_builddir | sed 's,/$,,'`
+    fi ;;
+  [\\/]* | ?:[\\/]* )  # Absolute path.
+    ac_srcdir=$srcdir$ac_dir_suffix;
+    ac_top_srcdir=$srcdir ;;
+  *) # Relative path.
+    ac_srcdir=$ac_top_builddir$srcdir$ac_dir_suffix
+    ac_top_srcdir=$ac_top_builddir$srcdir ;;
+esac
+# Don't blindly perform a `cd "$ac_dir"/$ac_foo && pwd` since $ac_foo can be
+# absolute.
+ac_abs_builddir=`cd "$ac_dir" && cd $ac_builddir && pwd`
+ac_abs_top_builddir=`cd "$ac_dir" && cd ${ac_top_builddir}. && pwd`
+ac_abs_srcdir=`cd "$ac_dir" && cd $ac_srcdir && pwd`
+ac_abs_top_srcdir=`cd "$ac_dir" && cd $ac_top_srcdir && pwd`
+
+    cd $ac_dir
+    # Check for guested configure; otherwise get Cygnus style configure.
+    if test -f $ac_srcdir/configure.gnu; then
+      echo
+      $SHELL $ac_srcdir/configure.gnu  --help=recursive
+    elif test -f $ac_srcdir/configure; then
+      echo
+      $SHELL $ac_srcdir/configure  --help=recursive
+    elif test -f $ac_srcdir/configure.ac ||
+           test -f $ac_srcdir/configure.in; then
+      echo
+      $ac_configure --help
+    else
+      echo "$as_me: WARNING: no configuration information is in $ac_dir" >&2
+    fi
+    cd $ac_popdir
+  done
+fi
+
+test -n "$ac_init_help" && exit 0
+if $ac_init_version; then
+  cat <<\_ACEOF
+RNAhybrid configure 1.0
+generated by GNU Autoconf 2.57
+
+Copyright 1992, 1993, 1994, 1995, 1996, 1998, 1999, 2000, 2001, 2002
+Free Software Foundation, Inc.
+This configure script is free software; the Free Software Foundation
+gives unlimited permission to copy, distribute and modify it.
+_ACEOF
+  exit 0
+fi
+exec 5>config.log
+cat >&5 <<_ACEOF
+This file contains any messages produced by compilers while
+running configure, to aid debugging if configure makes a mistake.
+
+It was created by RNAhybrid $as_me 1.0, which was
+generated by GNU Autoconf 2.57.  Invocation command line was
+
+  $ $0 $@
+
+_ACEOF
+{
+cat <<_ASUNAME
+## --------- ##
+## Platform. ##
+## --------- ##
+
+hostname = `(hostname || uname -n) 2>/dev/null | sed 1q`
+uname -m = `(uname -m) 2>/dev/null || echo unknown`
+uname -r = `(uname -r) 2>/dev/null || echo unknown`
+uname -s = `(uname -s) 2>/dev/null || echo unknown`
+uname -v = `(uname -v) 2>/dev/null || echo unknown`
+
+/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null || echo unknown`
+/bin/uname -X     = `(/bin/uname -X) 2>/dev/null     || echo unknown`
+
+/bin/arch              = `(/bin/arch) 2>/dev/null              || echo unknown`
+/usr/bin/arch -k       = `(/usr/bin/arch -k) 2>/dev/null       || echo unknown`
+/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null || echo unknown`
+hostinfo               = `(hostinfo) 2>/dev/null               || echo unknown`
+/bin/machine           = `(/bin/machine) 2>/dev/null           || echo unknown`
+/usr/bin/oslevel       = `(/usr/bin/oslevel) 2>/dev/null       || echo unknown`
+/bin/universe          = `(/bin/universe) 2>/dev/null          || echo unknown`
+
+_ASUNAME
+
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  echo "PATH: $as_dir"
+done
+
+} >&5
+
+cat >&5 <<_ACEOF
+
+
+## ----------- ##
+## Core tests. ##
+## ----------- ##
+
+_ACEOF
+
+
+# Keep a trace of the command line.
+# Strip out --no-create and --no-recursion so they do not pile up.
+# Strip out --silent because we don't want to record it for future runs.
+# Also quote any args containing shell meta-characters.
+# Make two passes to allow for proper duplicate-argument suppression.
+ac_configure_args=
+ac_configure_args0=
+ac_configure_args1=
+ac_sep=
+ac_must_keep_next=false
+for ac_pass in 1 2
+do
+  for ac_arg
+  do
+    case $ac_arg in
+    -no-create | --no-c* | -n | -no-recursion | --no-r*) continue ;;
+    -q | -quiet | --quiet | --quie | --qui | --qu | --q \
+    | -silent | --silent | --silen | --sile | --sil)
+      continue ;;
+    *" "*|*"	"*|*[\[\]\~\#\$\^\&\*\(\)\{\}\\\|\;\<\>\?\"\']*)
+      ac_arg=`echo "$ac_arg" | sed "s/'/'\\\\\\\\''/g"` ;;
+    esac
+    case $ac_pass in
+    1) ac_configure_args0="$ac_configure_args0 '$ac_arg'" ;;
+    2)
+      ac_configure_args1="$ac_configure_args1 '$ac_arg'"
+      if test $ac_must_keep_next = true; then
+        ac_must_keep_next=false # Got value, back to normal.
+      else
+        case $ac_arg in
+          *=* | --config-cache | -C | -disable-* | --disable-* \
+          | -enable-* | --enable-* | -gas | --g* | -nfp | --nf* \
+          | -q | -quiet | --q* | -silent | --sil* | -v | -verb* \
+          | -with-* | --with-* | -without-* | --without-* | --x)
+            case "$ac_configure_args0 " in
+              "$ac_configure_args1"*" '$ac_arg' "* ) continue ;;
+            esac
+            ;;
+          -* ) ac_must_keep_next=true ;;
+        esac
+      fi
+      ac_configure_args="$ac_configure_args$ac_sep'$ac_arg'"
+      # Get rid of the leading space.
+      ac_sep=" "
+      ;;
+    esac
+  done
+done
+$as_unset ac_configure_args0 || test "${ac_configure_args0+set}" != set || { ac_configure_args0=; export ac_configure_args0; }
+$as_unset ac_configure_args1 || test "${ac_configure_args1+set}" != set || { ac_configure_args1=; export ac_configure_args1; }
+
+# When interrupted or exit'd, cleanup temporary files, and complete
+# config.log.  We remove comments because anyway the quotes in there
+# would cause problems or look ugly.
+# WARNING: Be sure not to use single quotes in there, as some shells,
+# such as our DU 5.0 friend, will then `close' the trap.
+trap 'exit_status=$?
+  # Save into config.log some information that might help in debugging.
+  {
+    echo
+
+    cat <<\_ASBOX
+## ---------------- ##
+## Cache variables. ##
+## ---------------- ##
+_ASBOX
+    echo
+    # The following way of writing the cache mishandles newlines in values,
+{
+  (set) 2>&1 |
+    case `(ac_space='"'"' '"'"'; set | grep ac_space) 2>&1` in
+    *ac_space=\ *)
+      sed -n \
+        "s/'"'"'/'"'"'\\\\'"'"''"'"'/g;
+    	  s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='"'"'\\2'"'"'/p"
+      ;;
+    *)
+      sed -n \
+        "s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1=\\2/p"
+      ;;
+    esac;
+}
+    echo
+
+    cat <<\_ASBOX
+## ----------------- ##
+## Output variables. ##
+## ----------------- ##
+_ASBOX
+    echo
+    for ac_var in $ac_subst_vars
+    do
+      eval ac_val=$`echo $ac_var`
+      echo "$ac_var='"'"'$ac_val'"'"'"
+    done | sort
+    echo
+
+    if test -n "$ac_subst_files"; then
+      cat <<\_ASBOX
+## ------------- ##
+## Output files. ##
+## ------------- ##
+_ASBOX
+      echo
+      for ac_var in $ac_subst_files
+      do
+	eval ac_val=$`echo $ac_var`
+        echo "$ac_var='"'"'$ac_val'"'"'"
+      done | sort
+      echo
+    fi
+
+    if test -s confdefs.h; then
+      cat <<\_ASBOX
+## ----------- ##
+## confdefs.h. ##
+## ----------- ##
+_ASBOX
+      echo
+      sed "/^$/d" confdefs.h | sort
+      echo
+    fi
+    test "$ac_signal" != 0 &&
+      echo "$as_me: caught signal $ac_signal"
+    echo "$as_me: exit $exit_status"
+  } >&5
+  rm -f core core.* *.core &&
+  rm -rf conftest* confdefs* conf$$* $ac_clean_files &&
+    exit $exit_status
+     ' 0
+for ac_signal in 1 2 13 15; do
+  trap 'ac_signal='$ac_signal'; { (exit 1); exit 1; }' $ac_signal
+done
+ac_signal=0
+
+# confdefs.h avoids OS command line length limits that DEFS can exceed.
+rm -rf conftest* confdefs.h
+# AIX cpp loses on an empty file, so make sure it contains at least a newline.
+echo >confdefs.h
+
+# Predefined preprocessor variables.
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_NAME "$PACKAGE_NAME"
+_ACEOF
+
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_TARNAME "$PACKAGE_TARNAME"
+_ACEOF
+
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_VERSION "$PACKAGE_VERSION"
+_ACEOF
+
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_STRING "$PACKAGE_STRING"
+_ACEOF
+
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE_BUGREPORT "$PACKAGE_BUGREPORT"
+_ACEOF
+
+
+# Let the site file select an alternate cache file if it wants to.
+# Prefer explicitly selected file to automatically selected ones.
+if test -z "$CONFIG_SITE"; then
+  if test "x$prefix" != xNONE; then
+    CONFIG_SITE="$prefix/share/config.site $prefix/etc/config.site"
+  else
+    CONFIG_SITE="$ac_default_prefix/share/config.site $ac_default_prefix/etc/config.site"
+  fi
+fi
+for ac_site_file in $CONFIG_SITE; do
+  if test -r "$ac_site_file"; then
+    { echo "$as_me:$LINENO: loading site script $ac_site_file" >&5
+echo "$as_me: loading site script $ac_site_file" >&6;}
+    sed 's/^/| /' "$ac_site_file" >&5
+    . "$ac_site_file"
+  fi
+done
+
+if test -r "$cache_file"; then
+  # Some versions of bash will fail to source /dev/null (special
+  # files actually), so we avoid doing that.
+  if test -f "$cache_file"; then
+    { echo "$as_me:$LINENO: loading cache $cache_file" >&5
+echo "$as_me: loading cache $cache_file" >&6;}
+    case $cache_file in
+      [\\/]* | ?:[\\/]* ) . $cache_file;;
+      *)                      . ./$cache_file;;
+    esac
+  fi
+else
+  { echo "$as_me:$LINENO: creating cache $cache_file" >&5
+echo "$as_me: creating cache $cache_file" >&6;}
+  >$cache_file
+fi
+
+# Check that the precious variables saved in the cache have kept the same
+# value.
+ac_cache_corrupted=false
+for ac_var in `(set) 2>&1 |
+               sed -n 's/^ac_env_\([a-zA-Z_0-9]*\)_set=.*/\1/p'`; do
+  eval ac_old_set=\$ac_cv_env_${ac_var}_set
+  eval ac_new_set=\$ac_env_${ac_var}_set
+  eval ac_old_val="\$ac_cv_env_${ac_var}_value"
+  eval ac_new_val="\$ac_env_${ac_var}_value"
+  case $ac_old_set,$ac_new_set in
+    set,)
+      { echo "$as_me:$LINENO: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&5
+echo "$as_me: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&2;}
+      ac_cache_corrupted=: ;;
+    ,set)
+      { echo "$as_me:$LINENO: error: \`$ac_var' was not set in the previous run" >&5
+echo "$as_me: error: \`$ac_var' was not set in the previous run" >&2;}
+      ac_cache_corrupted=: ;;
+    ,);;
+    *)
+      if test "x$ac_old_val" != "x$ac_new_val"; then
+        { echo "$as_me:$LINENO: error: \`$ac_var' has changed since the previous run:" >&5
+echo "$as_me: error: \`$ac_var' has changed since the previous run:" >&2;}
+        { echo "$as_me:$LINENO:   former value:  $ac_old_val" >&5
+echo "$as_me:   former value:  $ac_old_val" >&2;}
+        { echo "$as_me:$LINENO:   current value: $ac_new_val" >&5
+echo "$as_me:   current value: $ac_new_val" >&2;}
+        ac_cache_corrupted=:
+      fi;;
+  esac
+  # Pass precious variables to config.status.
+  if test "$ac_new_set" = set; then
+    case $ac_new_val in
+    *" "*|*"	"*|*[\[\]\~\#\$\^\&\*\(\)\{\}\\\|\;\<\>\?\"\']*)
+      ac_arg=$ac_var=`echo "$ac_new_val" | sed "s/'/'\\\\\\\\''/g"` ;;
+    *) ac_arg=$ac_var=$ac_new_val ;;
+    esac
+    case " $ac_configure_args " in
+      *" '$ac_arg' "*) ;; # Avoid dups.  Use of quotes ensures accuracy.
+      *) ac_configure_args="$ac_configure_args '$ac_arg'" ;;
+    esac
+  fi
+done
+if $ac_cache_corrupted; then
+  { echo "$as_me:$LINENO: error: changes in the environment can compromise the build" >&5
+echo "$as_me: error: changes in the environment can compromise the build" >&2;}
+  { { echo "$as_me:$LINENO: error: run \`make distclean' and/or \`rm $cache_file' and start over" >&5
+echo "$as_me: error: run \`make distclean' and/or \`rm $cache_file' and start over" >&2;}
+   { (exit 1); exit 1; }; }
+fi
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+am__api_version="1.7"
+ac_aux_dir=
+for ac_dir in $srcdir $srcdir/.. $srcdir/../..; do
+  if test -f $ac_dir/install-sh; then
+    ac_aux_dir=$ac_dir
+    ac_install_sh="$ac_aux_dir/install-sh -c"
+    break
+  elif test -f $ac_dir/install.sh; then
+    ac_aux_dir=$ac_dir
+    ac_install_sh="$ac_aux_dir/install.sh -c"
+    break
+  elif test -f $ac_dir/shtool; then
+    ac_aux_dir=$ac_dir
+    ac_install_sh="$ac_aux_dir/shtool install -c"
+    break
+  fi
+done
+if test -z "$ac_aux_dir"; then
+  { { echo "$as_me:$LINENO: error: cannot find install-sh or install.sh in $srcdir $srcdir/.. $srcdir/../.." >&5
+echo "$as_me: error: cannot find install-sh or install.sh in $srcdir $srcdir/.. $srcdir/../.." >&2;}
+   { (exit 1); exit 1; }; }
+fi
+ac_config_guess="$SHELL $ac_aux_dir/config.guess"
+ac_config_sub="$SHELL $ac_aux_dir/config.sub"
+ac_configure="$SHELL $ac_aux_dir/configure" # This should be Cygnus configure.
+
+# Find a good install program.  We prefer a C program (faster),
+# so one script is as good as another.  But avoid the broken or
+# incompatible versions:
+# SysV /etc/install, /usr/sbin/install
+# SunOS /usr/etc/install
+# IRIX /sbin/install
+# AIX /bin/install
+# AmigaOS /C/install, which installs bootblocks on floppy discs
+# AIX 4 /usr/bin/installbsd, which doesn't work without a -g flag
+# AFS /usr/afsws/bin/install, which mishandles nonexistent args
+# SVR4 /usr/ucb/install, which tries to use the nonexistent group "staff"
+# ./install, which can be erroneously created by make from ./install.sh.
+echo "$as_me:$LINENO: checking for a BSD-compatible install" >&5
+echo $ECHO_N "checking for a BSD-compatible install... $ECHO_C" >&6
+if test -z "$INSTALL"; then
+if test "${ac_cv_path_install+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  # Account for people who put trailing slashes in PATH elements.
+case $as_dir/ in
+  ./ | .// | /cC/* | \
+  /etc/* | /usr/sbin/* | /usr/etc/* | /sbin/* | /usr/afsws/bin/* | \
+  /usr/ucb/* ) ;;
+  *)
+    # OSF1 and SCO ODT 3.0 have their own names for install.
+    # Don't use installbsd from OSF since it installs stuff as root
+    # by default.
+    for ac_prog in ginstall scoinst install; do
+      for ac_exec_ext in '' $ac_executable_extensions; do
+        if $as_executable_p "$as_dir/$ac_prog$ac_exec_ext"; then
+          if test $ac_prog = install &&
+            grep dspmsg "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
+            # AIX install.  It has an incompatible calling convention.
+            :
+          elif test $ac_prog = install &&
+            grep pwplus "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
+            # program-specific install script used by HP pwplus--don't use.
+            :
+          else
+            ac_cv_path_install="$as_dir/$ac_prog$ac_exec_ext -c"
+            break 3
+          fi
+        fi
+      done
+    done
+    ;;
+esac
+done
+
+
+fi
+  if test "${ac_cv_path_install+set}" = set; then
+    INSTALL=$ac_cv_path_install
+  else
+    # As a last resort, use the slow shell script.  We don't cache a
+    # path for INSTALL within a source directory, because that will
+    # break other packages using the cache if that directory is
+    # removed, or if the path is relative.
+    INSTALL=$ac_install_sh
+  fi
+fi
+echo "$as_me:$LINENO: result: $INSTALL" >&5
+echo "${ECHO_T}$INSTALL" >&6
+
+# Use test -z because SunOS4 sh mishandles braces in ${var-val}.
+# It thinks the first close brace ends the variable substitution.
+test -z "$INSTALL_PROGRAM" && INSTALL_PROGRAM='${INSTALL}'
+
+test -z "$INSTALL_SCRIPT" && INSTALL_SCRIPT='${INSTALL}'
+
+test -z "$INSTALL_DATA" && INSTALL_DATA='${INSTALL} -m 644'
+
+echo "$as_me:$LINENO: checking whether build environment is sane" >&5
+echo $ECHO_N "checking whether build environment is sane... $ECHO_C" >&6
+# Just in case
+sleep 1
+echo timestamp > conftest.file
+# Do `set' in a subshell so we don't clobber the current shell's
+# arguments.  Must try -L first in case configure is actually a
+# symlink; some systems play weird games with the mod time of symlinks
+# (eg FreeBSD returns the mod time of the symlink's containing
+# directory).
+if (
+   set X `ls -Lt $srcdir/configure conftest.file 2> /dev/null`
+   if test "$*" = "X"; then
+      # -L didn't work.
+      set X `ls -t $srcdir/configure conftest.file`
+   fi
+   rm -f conftest.file
+   if test "$*" != "X $srcdir/configure conftest.file" \
+      && test "$*" != "X conftest.file $srcdir/configure"; then
+
+      # If neither matched, then we have a broken ls.  This can happen
+      # if, for instance, CONFIG_SHELL is bash and it inherits a
+      # broken ls alias from the environment.  This has actually
+      # happened.  Such a system could not be considered "sane".
+      { { echo "$as_me:$LINENO: error: ls -t appears to fail.  Make sure there is not a broken
+alias in your environment" >&5
+echo "$as_me: error: ls -t appears to fail.  Make sure there is not a broken
+alias in your environment" >&2;}
+   { (exit 1); exit 1; }; }
+   fi
+
+   test "$2" = conftest.file
+   )
+then
+   # Ok.
+   :
+else
+   { { echo "$as_me:$LINENO: error: newly created file is older than distributed files!
+Check your system clock" >&5
+echo "$as_me: error: newly created file is older than distributed files!
+Check your system clock" >&2;}
+   { (exit 1); exit 1; }; }
+fi
+echo "$as_me:$LINENO: result: yes" >&5
+echo "${ECHO_T}yes" >&6
+test "$program_prefix" != NONE &&
+  program_transform_name="s,^,$program_prefix,;$program_transform_name"
+# Use a double $ so make ignores it.
+test "$program_suffix" != NONE &&
+  program_transform_name="s,\$,$program_suffix,;$program_transform_name"
+# Double any \ or $.  echo might interpret backslashes.
+# By default was `s,x,x', remove it if useless.
+cat <<\_ACEOF >conftest.sed
+s/[\\$]/&&/g;s/;s,x,x,$//
+_ACEOF
+program_transform_name=`echo $program_transform_name | sed -f conftest.sed`
+rm conftest.sed
+
+
+# expand $ac_aux_dir to an absolute path
+am_aux_dir=`cd $ac_aux_dir && pwd`
+
+test x"${MISSING+set}" = xset || MISSING="\${SHELL} $am_aux_dir/missing"
+# Use eval to expand $SHELL
+if eval "$MISSING --run true"; then
+  am_missing_run="$MISSING --run "
+else
+  am_missing_run=
+  { echo "$as_me:$LINENO: WARNING: \`missing' script is too old or missing" >&5
+echo "$as_me: WARNING: \`missing' script is too old or missing" >&2;}
+fi
+
+for ac_prog in gawk mawk nawk awk
+do
+  # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+echo "$as_me:$LINENO: checking for $ac_word" >&5
+echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6
+if test "${ac_cv_prog_AWK+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if test -n "$AWK"; then
+  ac_cv_prog_AWK="$AWK" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for ac_exec_ext in '' $ac_executable_extensions; do
+  if $as_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+    ac_cv_prog_AWK="$ac_prog"
+    echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+done
+
+fi
+fi
+AWK=$ac_cv_prog_AWK
+if test -n "$AWK"; then
+  echo "$as_me:$LINENO: result: $AWK" >&5
+echo "${ECHO_T}$AWK" >&6
+else
+  echo "$as_me:$LINENO: result: no" >&5
+echo "${ECHO_T}no" >&6
+fi
+
+  test -n "$AWK" && break
+done
+
+echo "$as_me:$LINENO: checking whether ${MAKE-make} sets \$(MAKE)" >&5
+echo $ECHO_N "checking whether ${MAKE-make} sets \$(MAKE)... $ECHO_C" >&6
+set dummy ${MAKE-make}; ac_make=`echo "$2" | sed 'y,./+-,__p_,'`
+if eval "test \"\${ac_cv_prog_make_${ac_make}_set+set}\" = set"; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  cat >conftest.make <<\_ACEOF
+all:
+	@echo 'ac_maketemp="$(MAKE)"'
+_ACEOF
+# GNU make sometimes prints "make[1]: Entering...", which would confuse us.
+eval `${MAKE-make} -f conftest.make 2>/dev/null | grep temp=`
+if test -n "$ac_maketemp"; then
+  eval ac_cv_prog_make_${ac_make}_set=yes
+else
+  eval ac_cv_prog_make_${ac_make}_set=no
+fi
+rm -f conftest.make
+fi
+if eval "test \"`echo '$ac_cv_prog_make_'${ac_make}_set`\" = yes"; then
+  echo "$as_me:$LINENO: result: yes" >&5
+echo "${ECHO_T}yes" >&6
+  SET_MAKE=
+else
+  echo "$as_me:$LINENO: result: no" >&5
+echo "${ECHO_T}no" >&6
+  SET_MAKE="MAKE=${MAKE-make}"
+fi
+
+rm -rf .tst 2>/dev/null
+mkdir .tst 2>/dev/null
+if test -d .tst; then
+  am__leading_dot=.
+else
+  am__leading_dot=_
+fi
+rmdir .tst 2>/dev/null
+
+ # test to see if srcdir already configured
+if test "`cd $srcdir && pwd`" != "`pwd`" &&
+   test -f $srcdir/config.status; then
+  { { echo "$as_me:$LINENO: error: source directory already configured; run \"make distclean\" there first" >&5
+echo "$as_me: error: source directory already configured; run \"make distclean\" there first" >&2;}
+   { (exit 1); exit 1; }; }
+fi
+
+# test whether we have cygpath
+if test -z "$CYGPATH_W"; then
+  if (cygpath --version) >/dev/null 2>/dev/null; then
+    CYGPATH_W='cygpath -w'
+  else
+    CYGPATH_W=echo
+  fi
+fi
+
+
+# Define the identity of the package.
+ PACKAGE='RNAhybrid'
+ VERSION='1.0'
+
+
+cat >>confdefs.h <<_ACEOF
+#define PACKAGE "$PACKAGE"
+_ACEOF
+
+
+cat >>confdefs.h <<_ACEOF
+#define VERSION "$VERSION"
+_ACEOF
+
+# Some tools Automake needs.
+
+ACLOCAL=${ACLOCAL-"${am_missing_run}aclocal-${am__api_version}"}
+
+
+AUTOCONF=${AUTOCONF-"${am_missing_run}autoconf"}
+
+
+AUTOMAKE=${AUTOMAKE-"${am_missing_run}automake-${am__api_version}"}
+
+
+AUTOHEADER=${AUTOHEADER-"${am_missing_run}autoheader"}
+
+
+MAKEINFO=${MAKEINFO-"${am_missing_run}makeinfo"}
+
+
+AMTAR=${AMTAR-"${am_missing_run}tar"}
+
+install_sh=${install_sh-"$am_aux_dir/install-sh"}
+
+# Installed binaries are usually stripped using `strip' when the user
+# run `make install-strip'.  However `strip' might not be the right
+# tool to use in cross-compilation environments, therefore Automake
+# will honor the `STRIP' environment variable to overrule this program.
+if test "$cross_compiling" != no; then
+  if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}strip", so it can be a program name with args.
+set dummy ${ac_tool_prefix}strip; ac_word=$2
+echo "$as_me:$LINENO: checking for $ac_word" >&5
+echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6
+if test "${ac_cv_prog_STRIP+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if test -n "$STRIP"; then
+  ac_cv_prog_STRIP="$STRIP" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for ac_exec_ext in '' $ac_executable_extensions; do
+  if $as_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+    ac_cv_prog_STRIP="${ac_tool_prefix}strip"
+    echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+done
+
+fi
+fi
+STRIP=$ac_cv_prog_STRIP
+if test -n "$STRIP"; then
+  echo "$as_me:$LINENO: result: $STRIP" >&5
+echo "${ECHO_T}$STRIP" >&6
+else
+  echo "$as_me:$LINENO: result: no" >&5
+echo "${ECHO_T}no" >&6
+fi
+
+fi
+if test -z "$ac_cv_prog_STRIP"; then
+  ac_ct_STRIP=$STRIP
+  # Extract the first word of "strip", so it can be a program name with args.
+set dummy strip; ac_word=$2
+echo "$as_me:$LINENO: checking for $ac_word" >&5
+echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6
+if test "${ac_cv_prog_ac_ct_STRIP+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if test -n "$ac_ct_STRIP"; then
+  ac_cv_prog_ac_ct_STRIP="$ac_ct_STRIP" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for ac_exec_ext in '' $ac_executable_extensions; do
+  if $as_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+    ac_cv_prog_ac_ct_STRIP="strip"
+    echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+done
+
+  test -z "$ac_cv_prog_ac_ct_STRIP" && ac_cv_prog_ac_ct_STRIP=":"
+fi
+fi
+ac_ct_STRIP=$ac_cv_prog_ac_ct_STRIP
+if test -n "$ac_ct_STRIP"; then
+  echo "$as_me:$LINENO: result: $ac_ct_STRIP" >&5
+echo "${ECHO_T}$ac_ct_STRIP" >&6
+else
+  echo "$as_me:$LINENO: result: no" >&5
+echo "${ECHO_T}no" >&6
+fi
+
+  STRIP=$ac_ct_STRIP
+else
+  STRIP="$ac_cv_prog_STRIP"
+fi
+
+fi
+INSTALL_STRIP_PROGRAM="\${SHELL} \$(install_sh) -c -s"
+
+# We need awk for the "check" target.  The system "awk" is bad on
+# some platforms.
+
+
+
+
+          ac_config_headers="$ac_config_headers config.h"
+
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}gcc", so it can be a program name with args.
+set dummy ${ac_tool_prefix}gcc; ac_word=$2
+echo "$as_me:$LINENO: checking for $ac_word" >&5
+echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6
+if test "${ac_cv_prog_CC+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for ac_exec_ext in '' $ac_executable_extensions; do
+  if $as_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+    ac_cv_prog_CC="${ac_tool_prefix}gcc"
+    echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+done
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  echo "$as_me:$LINENO: result: $CC" >&5
+echo "${ECHO_T}$CC" >&6
+else
+  echo "$as_me:$LINENO: result: no" >&5
+echo "${ECHO_T}no" >&6
+fi
+
+fi
+if test -z "$ac_cv_prog_CC"; then
+  ac_ct_CC=$CC
+  # Extract the first word of "gcc", so it can be a program name with args.
+set dummy gcc; ac_word=$2
+echo "$as_me:$LINENO: checking for $ac_word" >&5
+echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6
+if test "${ac_cv_prog_ac_ct_CC+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if test -n "$ac_ct_CC"; then
+  ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for ac_exec_ext in '' $ac_executable_extensions; do
+  if $as_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+    ac_cv_prog_ac_ct_CC="gcc"
+    echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+done
+
+fi
+fi
+ac_ct_CC=$ac_cv_prog_ac_ct_CC
+if test -n "$ac_ct_CC"; then
+  echo "$as_me:$LINENO: result: $ac_ct_CC" >&5
+echo "${ECHO_T}$ac_ct_CC" >&6
+else
+  echo "$as_me:$LINENO: result: no" >&5
+echo "${ECHO_T}no" >&6
+fi
+
+  CC=$ac_ct_CC
+else
+  CC="$ac_cv_prog_CC"
+fi
+
+if test -z "$CC"; then
+  if test -n "$ac_tool_prefix"; then
+  # Extract the first word of "${ac_tool_prefix}cc", so it can be a program name with args.
+set dummy ${ac_tool_prefix}cc; ac_word=$2
+echo "$as_me:$LINENO: checking for $ac_word" >&5
+echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6
+if test "${ac_cv_prog_CC+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for ac_exec_ext in '' $ac_executable_extensions; do
+  if $as_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+    ac_cv_prog_CC="${ac_tool_prefix}cc"
+    echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+done
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  echo "$as_me:$LINENO: result: $CC" >&5
+echo "${ECHO_T}$CC" >&6
+else
+  echo "$as_me:$LINENO: result: no" >&5
+echo "${ECHO_T}no" >&6
+fi
+
+fi
+if test -z "$ac_cv_prog_CC"; then
+  ac_ct_CC=$CC
+  # Extract the first word of "cc", so it can be a program name with args.
+set dummy cc; ac_word=$2
+echo "$as_me:$LINENO: checking for $ac_word" >&5
+echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6
+if test "${ac_cv_prog_ac_ct_CC+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if test -n "$ac_ct_CC"; then
+  ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for ac_exec_ext in '' $ac_executable_extensions; do
+  if $as_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+    ac_cv_prog_ac_ct_CC="cc"
+    echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+done
+
+fi
+fi
+ac_ct_CC=$ac_cv_prog_ac_ct_CC
+if test -n "$ac_ct_CC"; then
+  echo "$as_me:$LINENO: result: $ac_ct_CC" >&5
+echo "${ECHO_T}$ac_ct_CC" >&6
+else
+  echo "$as_me:$LINENO: result: no" >&5
+echo "${ECHO_T}no" >&6
+fi
+
+  CC=$ac_ct_CC
+else
+  CC="$ac_cv_prog_CC"
+fi
+
+fi
+if test -z "$CC"; then
+  # Extract the first word of "cc", so it can be a program name with args.
+set dummy cc; ac_word=$2
+echo "$as_me:$LINENO: checking for $ac_word" >&5
+echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6
+if test "${ac_cv_prog_CC+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+  ac_prog_rejected=no
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for ac_exec_ext in '' $ac_executable_extensions; do
+  if $as_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+    if test "$as_dir/$ac_word$ac_exec_ext" = "/usr/ucb/cc"; then
+       ac_prog_rejected=yes
+       continue
+     fi
+    ac_cv_prog_CC="cc"
+    echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+done
+
+if test $ac_prog_rejected = yes; then
+  # We found a bogon in the path, so make sure we never use it.
+  set dummy $ac_cv_prog_CC
+  shift
+  if test $# != 0; then
+    # We chose a different compiler from the bogus one.
+    # However, it has the same basename, so the bogon will be chosen
+    # first if we set CC to just the basename; use the full file name.
+    shift
+    ac_cv_prog_CC="$as_dir/$ac_word${1+' '}$@"
+  fi
+fi
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  echo "$as_me:$LINENO: result: $CC" >&5
+echo "${ECHO_T}$CC" >&6
+else
+  echo "$as_me:$LINENO: result: no" >&5
+echo "${ECHO_T}no" >&6
+fi
+
+fi
+if test -z "$CC"; then
+  if test -n "$ac_tool_prefix"; then
+  for ac_prog in cl
+  do
+    # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
+set dummy $ac_tool_prefix$ac_prog; ac_word=$2
+echo "$as_me:$LINENO: checking for $ac_word" >&5
+echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6
+if test "${ac_cv_prog_CC+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if test -n "$CC"; then
+  ac_cv_prog_CC="$CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for ac_exec_ext in '' $ac_executable_extensions; do
+  if $as_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+    ac_cv_prog_CC="$ac_tool_prefix$ac_prog"
+    echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+done
+
+fi
+fi
+CC=$ac_cv_prog_CC
+if test -n "$CC"; then
+  echo "$as_me:$LINENO: result: $CC" >&5
+echo "${ECHO_T}$CC" >&6
+else
+  echo "$as_me:$LINENO: result: no" >&5
+echo "${ECHO_T}no" >&6
+fi
+
+    test -n "$CC" && break
+  done
+fi
+if test -z "$CC"; then
+  ac_ct_CC=$CC
+  for ac_prog in cl
+do
+  # Extract the first word of "$ac_prog", so it can be a program name with args.
+set dummy $ac_prog; ac_word=$2
+echo "$as_me:$LINENO: checking for $ac_word" >&5
+echo $ECHO_N "checking for $ac_word... $ECHO_C" >&6
+if test "${ac_cv_prog_ac_ct_CC+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if test -n "$ac_ct_CC"; then
+  ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
+else
+as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for ac_exec_ext in '' $ac_executable_extensions; do
+  if $as_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
+    ac_cv_prog_ac_ct_CC="$ac_prog"
+    echo "$as_me:$LINENO: found $as_dir/$ac_word$ac_exec_ext" >&5
+    break 2
+  fi
+done
+done
+
+fi
+fi
+ac_ct_CC=$ac_cv_prog_ac_ct_CC
+if test -n "$ac_ct_CC"; then
+  echo "$as_me:$LINENO: result: $ac_ct_CC" >&5
+echo "${ECHO_T}$ac_ct_CC" >&6
+else
+  echo "$as_me:$LINENO: result: no" >&5
+echo "${ECHO_T}no" >&6
+fi
+
+  test -n "$ac_ct_CC" && break
+done
+
+  CC=$ac_ct_CC
+fi
+
+fi
+
+
+test -z "$CC" && { { echo "$as_me:$LINENO: error: no acceptable C compiler found in \$PATH
+See \`config.log' for more details." >&5
+echo "$as_me: error: no acceptable C compiler found in \$PATH
+See \`config.log' for more details." >&2;}
+   { (exit 1); exit 1; }; }
+
+# Provide some information about the compiler.
+echo "$as_me:$LINENO:" \
+     "checking for C compiler version" >&5
+ac_compiler=`set X $ac_compile; echo $2`
+{ (eval echo "$as_me:$LINENO: \"$ac_compiler --version </dev/null >&5\"") >&5
+  (eval $ac_compiler --version </dev/null >&5) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }
+{ (eval echo "$as_me:$LINENO: \"$ac_compiler -v </dev/null >&5\"") >&5
+  (eval $ac_compiler -v </dev/null >&5) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }
+{ (eval echo "$as_me:$LINENO: \"$ac_compiler -V </dev/null >&5\"") >&5
+  (eval $ac_compiler -V </dev/null >&5) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }
+
+cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+
+int
+main ()
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+ac_clean_files_save=$ac_clean_files
+ac_clean_files="$ac_clean_files a.out a.exe b.out"
+# Try to create an executable without -o first, disregard a.out.
+# It will help us diagnose broken compilers, and finding out an intuition
+# of exeext.
+echo "$as_me:$LINENO: checking for C compiler default output" >&5
+echo $ECHO_N "checking for C compiler default output... $ECHO_C" >&6
+ac_link_default=`echo "$ac_link" | sed 's/ -o *conftest[^ ]*//'`
+if { (eval echo "$as_me:$LINENO: \"$ac_link_default\"") >&5
+  (eval $ac_link_default) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; then
+  # Find the output, starting from the most likely.  This scheme is
+# not robust to junk in `.', hence go to wildcards (a.*) only as a last
+# resort.
+
+# Be careful to initialize this variable, since it used to be cached.
+# Otherwise an old cache value of `no' led to `EXEEXT = no' in a Makefile.
+ac_cv_exeext=
+# b.out is created by i960 compilers.
+for ac_file in a_out.exe a.exe conftest.exe a.out conftest a.* conftest.* b.out
+do
+  test -f "$ac_file" || continue
+  case $ac_file in
+    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.o | *.obj )
+        ;;
+    conftest.$ac_ext )
+        # This is the source file.
+        ;;
+    [ab].out )
+        # We found the default executable, but exeext='' is most
+        # certainly right.
+        break;;
+    *.* )
+        ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
+        # FIXME: I believe we export ac_cv_exeext for Libtool,
+        # but it would be cool to find out if it's true.  Does anybody
+        # maintain Libtool? --akim.
+        export ac_cv_exeext
+        break;;
+    * )
+        break;;
+  esac
+done
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+{ { echo "$as_me:$LINENO: error: C compiler cannot create executables
+See \`config.log' for more details." >&5
+echo "$as_me: error: C compiler cannot create executables
+See \`config.log' for more details." >&2;}
+   { (exit 77); exit 77; }; }
+fi
+
+ac_exeext=$ac_cv_exeext
+echo "$as_me:$LINENO: result: $ac_file" >&5
+echo "${ECHO_T}$ac_file" >&6
+
+# Check the compiler produces executables we can run.  If not, either
+# the compiler is broken, or we cross compile.
+echo "$as_me:$LINENO: checking whether the C compiler works" >&5
+echo $ECHO_N "checking whether the C compiler works... $ECHO_C" >&6
+# FIXME: These cross compiler hacks should be removed for Autoconf 3.0
+# If not cross compiling, check that we can run a simple program.
+if test "$cross_compiling" != yes; then
+  if { ac_try='./$ac_file'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+    cross_compiling=no
+  else
+    if test "$cross_compiling" = maybe; then
+	cross_compiling=yes
+    else
+	{ { echo "$as_me:$LINENO: error: cannot run C compiled programs.
+If you meant to cross compile, use \`--host'.
+See \`config.log' for more details." >&5
+echo "$as_me: error: cannot run C compiled programs.
+If you meant to cross compile, use \`--host'.
+See \`config.log' for more details." >&2;}
+   { (exit 1); exit 1; }; }
+    fi
+  fi
+fi
+echo "$as_me:$LINENO: result: yes" >&5
+echo "${ECHO_T}yes" >&6
+
+rm -f a.out a.exe conftest$ac_cv_exeext b.out
+ac_clean_files=$ac_clean_files_save
+# Check the compiler produces executables we can run.  If not, either
+# the compiler is broken, or we cross compile.
+echo "$as_me:$LINENO: checking whether we are cross compiling" >&5
+echo $ECHO_N "checking whether we are cross compiling... $ECHO_C" >&6
+echo "$as_me:$LINENO: result: $cross_compiling" >&5
+echo "${ECHO_T}$cross_compiling" >&6
+
+echo "$as_me:$LINENO: checking for suffix of executables" >&5
+echo $ECHO_N "checking for suffix of executables... $ECHO_C" >&6
+if { (eval echo "$as_me:$LINENO: \"$ac_link\"") >&5
+  (eval $ac_link) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; then
+  # If both `conftest.exe' and `conftest' are `present' (well, observable)
+# catch `conftest.exe'.  For instance with Cygwin, `ls conftest' will
+# work properly (i.e., refer to `conftest.exe'), while it won't with
+# `rm'.
+for ac_file in conftest.exe conftest conftest.*; do
+  test -f "$ac_file" || continue
+  case $ac_file in
+    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.o | *.obj ) ;;
+    *.* ) ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
+          export ac_cv_exeext
+          break;;
+    * ) break;;
+  esac
+done
+else
+  { { echo "$as_me:$LINENO: error: cannot compute suffix of executables: cannot compile and link
+See \`config.log' for more details." >&5
+echo "$as_me: error: cannot compute suffix of executables: cannot compile and link
+See \`config.log' for more details." >&2;}
+   { (exit 1); exit 1; }; }
+fi
+
+rm -f conftest$ac_cv_exeext
+echo "$as_me:$LINENO: result: $ac_cv_exeext" >&5
+echo "${ECHO_T}$ac_cv_exeext" >&6
+
+rm -f conftest.$ac_ext
+EXEEXT=$ac_cv_exeext
+ac_exeext=$EXEEXT
+echo "$as_me:$LINENO: checking for suffix of object files" >&5
+echo $ECHO_N "checking for suffix of object files... $ECHO_C" >&6
+if test "${ac_cv_objext+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+
+int
+main ()
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.o conftest.obj
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; then
+  for ac_file in `(ls conftest.o conftest.obj; ls conftest.*) 2>/dev/null`; do
+  case $ac_file in
+    *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg ) ;;
+    *) ac_cv_objext=`expr "$ac_file" : '.*\.\(.*\)'`
+       break;;
+  esac
+done
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+{ { echo "$as_me:$LINENO: error: cannot compute suffix of object files: cannot compile
+See \`config.log' for more details." >&5
+echo "$as_me: error: cannot compute suffix of object files: cannot compile
+See \`config.log' for more details." >&2;}
+   { (exit 1); exit 1; }; }
+fi
+
+rm -f conftest.$ac_cv_objext conftest.$ac_ext
+fi
+echo "$as_me:$LINENO: result: $ac_cv_objext" >&5
+echo "${ECHO_T}$ac_cv_objext" >&6
+OBJEXT=$ac_cv_objext
+ac_objext=$OBJEXT
+echo "$as_me:$LINENO: checking whether we are using the GNU C compiler" >&5
+echo $ECHO_N "checking whether we are using the GNU C compiler... $ECHO_C" >&6
+if test "${ac_cv_c_compiler_gnu+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+
+int
+main ()
+{
+#ifndef __GNUC__
+       choke me
+#endif
+
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_compiler_gnu=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ac_compiler_gnu=no
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+ac_cv_c_compiler_gnu=$ac_compiler_gnu
+
+fi
+echo "$as_me:$LINENO: result: $ac_cv_c_compiler_gnu" >&5
+echo "${ECHO_T}$ac_cv_c_compiler_gnu" >&6
+GCC=`test $ac_compiler_gnu = yes && echo yes`
+ac_test_CFLAGS=${CFLAGS+set}
+ac_save_CFLAGS=$CFLAGS
+CFLAGS="-g"
+echo "$as_me:$LINENO: checking whether $CC accepts -g" >&5
+echo $ECHO_N "checking whether $CC accepts -g... $ECHO_C" >&6
+if test "${ac_cv_prog_cc_g+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+
+int
+main ()
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_cv_prog_cc_g=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ac_cv_prog_cc_g=no
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+fi
+echo "$as_me:$LINENO: result: $ac_cv_prog_cc_g" >&5
+echo "${ECHO_T}$ac_cv_prog_cc_g" >&6
+if test "$ac_test_CFLAGS" = set; then
+  CFLAGS=$ac_save_CFLAGS
+elif test $ac_cv_prog_cc_g = yes; then
+  if test "$GCC" = yes; then
+    CFLAGS="-g -O2"
+  else
+    CFLAGS="-g"
+  fi
+else
+  if test "$GCC" = yes; then
+    CFLAGS="-O2"
+  else
+    CFLAGS=
+  fi
+fi
+echo "$as_me:$LINENO: checking for $CC option to accept ANSI C" >&5
+echo $ECHO_N "checking for $CC option to accept ANSI C... $ECHO_C" >&6
+if test "${ac_cv_prog_cc_stdc+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  ac_cv_prog_cc_stdc=no
+ac_save_CC=$CC
+cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#include <stdarg.h>
+#include <stdio.h>
+#include <sys/types.h>
+#include <sys/stat.h>
+/* Most of the following tests are stolen from RCS 5.7's src/conf.sh.  */
+struct buf { int x; };
+FILE * (*rcsopen) (struct buf *, struct stat *, int);
+static char *e (p, i)
+     char **p;
+     int i;
+{
+  return p[i];
+}
+static char *f (char * (*g) (char **, int), char **p, ...)
+{
+  char *s;
+  va_list v;
+  va_start (v,p);
+  s = g (p, va_arg (v,int));
+  va_end (v);
+  return s;
+}
+int test (int i, double x);
+struct s1 {int (*f) (int a);};
+struct s2 {int (*f) (double a);};
+int pairnames (int, char **, FILE *(*)(struct buf *, struct stat *, int), int, int);
+int argc;
+char **argv;
+int
+main ()
+{
+return f (e, argv, 0) != argv[0]  ||  f (e, argv, 1) != argv[1];
+  ;
+  return 0;
+}
+_ACEOF
+# Don't try gcc -ansi; that turns off useful extensions and
+# breaks some systems' header files.
+# AIX			-qlanglvl=ansi
+# Ultrix and OSF/1	-std1
+# HP-UX 10.20 and later	-Ae
+# HP-UX older versions	-Aa -D_HPUX_SOURCE
+# SVR4			-Xc -D__EXTENSIONS__
+for ac_arg in "" -qlanglvl=ansi -std1 -Ae "-Aa -D_HPUX_SOURCE" "-Xc -D__EXTENSIONS__"
+do
+  CC="$ac_save_CC $ac_arg"
+  rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_cv_prog_cc_stdc=$ac_arg
+break
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+fi
+rm -f conftest.$ac_objext
+done
+rm -f conftest.$ac_ext conftest.$ac_objext
+CC=$ac_save_CC
+
+fi
+
+case "x$ac_cv_prog_cc_stdc" in
+  x|xno)
+    echo "$as_me:$LINENO: result: none needed" >&5
+echo "${ECHO_T}none needed" >&6 ;;
+  *)
+    echo "$as_me:$LINENO: result: $ac_cv_prog_cc_stdc" >&5
+echo "${ECHO_T}$ac_cv_prog_cc_stdc" >&6
+    CC="$CC $ac_cv_prog_cc_stdc" ;;
+esac
+
+# Some people use a C++ compiler to compile C.  Since we use `exit',
+# in C++ we need to declare it.  In case someone uses the same compiler
+# for both compiling C and C++ we need to have the C++ compiler decide
+# the declaration of exit, since it's the most demanding environment.
+cat >conftest.$ac_ext <<_ACEOF
+#ifndef __cplusplus
+  choke me
+#endif
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  for ac_declaration in \
+   ''\
+   '#include <stdlib.h>' \
+   'extern "C" void std::exit (int) throw (); using std::exit;' \
+   'extern "C" void std::exit (int); using std::exit;' \
+   'extern "C" void exit (int) throw ();' \
+   'extern "C" void exit (int);' \
+   'void exit (int);'
+do
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#include <stdlib.h>
+$ac_declaration
+int
+main ()
+{
+exit (42);
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  :
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+continue
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+$ac_declaration
+int
+main ()
+{
+exit (42);
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  break
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+done
+rm -f conftest*
+if test -n "$ac_declaration"; then
+  echo '#ifdef __cplusplus' >>confdefs.h
+  echo $ac_declaration      >>confdefs.h
+  echo '#endif'             >>confdefs.h
+fi
+
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+DEPDIR="${am__leading_dot}deps"
+
+          ac_config_commands="$ac_config_commands depfiles"
+
+
+am_make=${MAKE-make}
+cat > confinc << 'END'
+doit:
+	@echo done
+END
+# If we don't find an include directive, just comment out the code.
+echo "$as_me:$LINENO: checking for style of include used by $am_make" >&5
+echo $ECHO_N "checking for style of include used by $am_make... $ECHO_C" >&6
+am__include="#"
+am__quote=
+_am_result=none
+# First try GNU make style include.
+echo "include confinc" > confmf
+# We grep out `Entering directory' and `Leaving directory'
+# messages which can occur if `w' ends up in MAKEFLAGS.
+# In particular we don't look at `^make:' because GNU make might
+# be invoked under some other name (usually "gmake"), in which
+# case it prints its new name instead of `make'.
+if test "`$am_make -s -f confmf 2> /dev/null | grep -v 'ing directory'`" = "done"; then
+   am__include=include
+   am__quote=
+   _am_result=GNU
+fi
+# Now try BSD make style include.
+if test "$am__include" = "#"; then
+   echo '.include "confinc"' > confmf
+   if test "`$am_make -s -f confmf 2> /dev/null`" = "done"; then
+      am__include=.include
+      am__quote="\""
+      _am_result=BSD
+   fi
+fi
+
+
+echo "$as_me:$LINENO: result: $_am_result" >&5
+echo "${ECHO_T}$_am_result" >&6
+rm -f confinc confmf
+
+# Check whether --enable-dependency-tracking or --disable-dependency-tracking was given.
+if test "${enable_dependency_tracking+set}" = set; then
+  enableval="$enable_dependency_tracking"
+
+fi;
+if test "x$enable_dependency_tracking" != xno; then
+  am_depcomp="$ac_aux_dir/depcomp"
+  AMDEPBACKSLASH='\'
+fi
+
+
+if test "x$enable_dependency_tracking" != xno; then
+  AMDEP_TRUE=
+  AMDEP_FALSE='#'
+else
+  AMDEP_TRUE='#'
+  AMDEP_FALSE=
+fi
+
+
+
+
+depcc="$CC"   am_compiler_list=
+
+echo "$as_me:$LINENO: checking dependency style of $depcc" >&5
+echo $ECHO_N "checking dependency style of $depcc... $ECHO_C" >&6
+if test "${am_cv_CC_dependencies_compiler_type+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
+  # We make a subdir and do the tests there.  Otherwise we can end up
+  # making bogus files that we don't know about and never remove.  For
+  # instance it was reported that on HP-UX the gcc test will end up
+  # making a dummy file named `D' -- because `-MD' means `put the output
+  # in D'.
+  mkdir conftest.dir
+  # Copy depcomp to subdir because otherwise we won't find it if we're
+  # using a relative directory.
+  cp "$am_depcomp" conftest.dir
+  cd conftest.dir
+
+  am_cv_CC_dependencies_compiler_type=none
+  if test "$am_compiler_list" = ""; then
+     am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
+  fi
+  for depmode in $am_compiler_list; do
+    # We need to recreate these files for each test, as the compiler may
+    # overwrite some of them when testing with obscure command lines.
+    # This happens at least with the AIX C compiler.
+    echo '#include "conftest.h"' > conftest.c
+    echo 'int i;' > conftest.h
+    echo "${am__include} ${am__quote}conftest.Po${am__quote}" > confmf
+
+    case $depmode in
+    nosideeffect)
+      # after this tag, mechanisms are not by side-effect, so they'll
+      # only be used when explicitly requested
+      if test "x$enable_dependency_tracking" = xyes; then
+	continue
+      else
+	break
+      fi
+      ;;
+    none) break ;;
+    esac
+    # We check with `-c' and `-o' for the sake of the "dashmstdout"
+    # mode.  It turns out that the SunPro C++ compiler does not properly
+    # handle `-M -o', and we need to detect this.
+    if depmode=$depmode \
+       source=conftest.c object=conftest.o \
+       depfile=conftest.Po tmpdepfile=conftest.TPo \
+       $SHELL ./depcomp $depcc -c -o conftest.o conftest.c \
+         >/dev/null 2>conftest.err &&
+       grep conftest.h conftest.Po > /dev/null 2>&1 &&
+       ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
+      # icc doesn't choke on unknown options, it will just issue warnings
+      # (even with -Werror).  So we grep stderr for any message
+      # that says an option was ignored.
+      if grep 'ignoring option' conftest.err >/dev/null 2>&1; then :; else
+        am_cv_CC_dependencies_compiler_type=$depmode
+        break
+      fi
+    fi
+  done
+
+  cd ..
+  rm -rf conftest.dir
+else
+  am_cv_CC_dependencies_compiler_type=none
+fi
+
+fi
+echo "$as_me:$LINENO: result: $am_cv_CC_dependencies_compiler_type" >&5
+echo "${ECHO_T}$am_cv_CC_dependencies_compiler_type" >&6
+CCDEPMODE=depmode=$am_cv_CC_dependencies_compiler_type
+
+
+
+if
+  test "x$enable_dependency_tracking" != xno \
+  && test "$am_cv_CC_dependencies_compiler_type" = gcc3; then
+  am__fastdepCC_TRUE=
+  am__fastdepCC_FALSE='#'
+else
+  am__fastdepCC_TRUE='#'
+  am__fastdepCC_FALSE=
+fi
+
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+
+
+
+echo "$as_me:$LINENO: checking for log in -lm" >&5
+echo $ECHO_N "checking for log in -lm... $ECHO_C" >&6
+if test "${ac_cv_lib_m_log+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  ac_check_lib_save_LIBS=$LIBS
+LIBS="-lm  $LIBS"
+cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+
+/* Override any gcc2 internal prototype to avoid an error.  */
+#ifdef __cplusplus
+extern "C"
+#endif
+/* We use char because int might match the return type of a gcc2
+   builtin and then its argument prototype would still apply.  */
+char log ();
+int
+main ()
+{
+log ();
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.$ac_objext conftest$ac_exeext
+if { (eval echo "$as_me:$LINENO: \"$ac_link\"") >&5
+  (eval $ac_link) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest$ac_exeext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_cv_lib_m_log=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ac_cv_lib_m_log=no
+fi
+rm -f conftest.$ac_objext conftest$ac_exeext conftest.$ac_ext
+LIBS=$ac_check_lib_save_LIBS
+fi
+echo "$as_me:$LINENO: result: $ac_cv_lib_m_log" >&5
+echo "${ECHO_T}$ac_cv_lib_m_log" >&6
+if test $ac_cv_lib_m_log = yes; then
+  cat >>confdefs.h <<_ACEOF
+#define HAVE_LIBM 1
+_ACEOF
+
+  LIBS="-lm $LIBS"
+
+else
+  { { echo "$as_me:$LINENO: error: math library is missing" >&5
+echo "$as_me: error: math library is missing" >&2;}
+   { (exit 1); exit 1; }; }
+fi
+
+
+echo "$as_me:$LINENO: checking for g2_open_vd in -lg2" >&5
+echo $ECHO_N "checking for g2_open_vd in -lg2... $ECHO_C" >&6
+if test "${ac_cv_lib_g2_g2_open_vd+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  ac_check_lib_save_LIBS=$LIBS
+LIBS="-lg2  $LIBS"
+cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+
+/* Override any gcc2 internal prototype to avoid an error.  */
+#ifdef __cplusplus
+extern "C"
+#endif
+/* We use char because int might match the return type of a gcc2
+   builtin and then its argument prototype would still apply.  */
+char g2_open_vd ();
+int
+main ()
+{
+g2_open_vd ();
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.$ac_objext conftest$ac_exeext
+if { (eval echo "$as_me:$LINENO: \"$ac_link\"") >&5
+  (eval $ac_link) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest$ac_exeext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_cv_lib_g2_g2_open_vd=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ac_cv_lib_g2_g2_open_vd=no
+fi
+rm -f conftest.$ac_objext conftest$ac_exeext conftest.$ac_ext
+LIBS=$ac_check_lib_save_LIBS
+fi
+echo "$as_me:$LINENO: result: $ac_cv_lib_g2_g2_open_vd" >&5
+echo "${ECHO_T}$ac_cv_lib_g2_g2_open_vd" >&6
+if test $ac_cv_lib_g2_g2_open_vd = yes; then
+  cat >>confdefs.h <<_ACEOF
+#define HAVE_LIBG2 1
+_ACEOF
+
+  LIBS="-lg2 $LIBS"
+
+else
+  { echo "$as_me:$LINENO: WARNING: libg2.a is missing. You can download it at http://g2.sourceforge.net/" >&5
+echo "$as_me: WARNING: libg2.a is missing. You can download it at http://g2.sourceforge.net/" >&2;}
+fi
+
+
+echo "$as_me:$LINENO: checking for gdImageLine in -lgd" >&5
+echo $ECHO_N "checking for gdImageLine in -lgd... $ECHO_C" >&6
+if test "${ac_cv_lib_gd_gdImageLine+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  ac_check_lib_save_LIBS=$LIBS
+LIBS="-lgd  $LIBS"
+cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+
+/* Override any gcc2 internal prototype to avoid an error.  */
+#ifdef __cplusplus
+extern "C"
+#endif
+/* We use char because int might match the return type of a gcc2
+   builtin and then its argument prototype would still apply.  */
+char gdImageLine ();
+int
+main ()
+{
+gdImageLine ();
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.$ac_objext conftest$ac_exeext
+if { (eval echo "$as_me:$LINENO: \"$ac_link\"") >&5
+  (eval $ac_link) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest$ac_exeext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_cv_lib_gd_gdImageLine=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ac_cv_lib_gd_gdImageLine=no
+fi
+rm -f conftest.$ac_objext conftest$ac_exeext conftest.$ac_ext
+LIBS=$ac_check_lib_save_LIBS
+fi
+echo "$as_me:$LINENO: result: $ac_cv_lib_gd_gdImageLine" >&5
+echo "${ECHO_T}$ac_cv_lib_gd_gdImageLine" >&6
+if test $ac_cv_lib_gd_gdImageLine = yes; then
+  cat >>confdefs.h <<_ACEOF
+#define HAVE_LIBGD 1
+_ACEOF
+
+  LIBS="-lgd $LIBS"
+
+fi
+
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+echo "$as_me:$LINENO: checking how to run the C preprocessor" >&5
+echo $ECHO_N "checking how to run the C preprocessor... $ECHO_C" >&6
+# On Suns, sometimes $CPP names a directory.
+if test -n "$CPP" && test -d "$CPP"; then
+  CPP=
+fi
+if test -z "$CPP"; then
+  if test "${ac_cv_prog_CPP+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+      # Double quotes because CPP needs to be expanded
+    for CPP in "$CC -E" "$CC -E -traditional-cpp" "/lib/cpp"
+    do
+      ac_preproc_ok=false
+for ac_c_preproc_warn_flag in '' yes
+do
+  # Use a header file that comes with gcc, so configuring glibc
+  # with a fresh cross-compiler works.
+  # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
+  # <limits.h> exists even on freestanding compilers.
+  # On the NeXT, cc -E runs the code through the compiler's parser,
+  # not just through cpp. "Syntax error" is here to catch this case.
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#ifdef __STDC__
+# include <limits.h>
+#else
+# include <assert.h>
+#endif
+                     Syntax error
+_ACEOF
+if { (eval echo "$as_me:$LINENO: \"$ac_cpp conftest.$ac_ext\"") >&5
+  (eval $ac_cpp conftest.$ac_ext) 2>conftest.er1
+  ac_status=$?
+  grep -v '^ *+' conftest.er1 >conftest.err
+  rm -f conftest.er1
+  cat conftest.err >&5
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } >/dev/null; then
+  if test -s conftest.err; then
+    ac_cpp_err=$ac_c_preproc_warn_flag
+  else
+    ac_cpp_err=
+  fi
+else
+  ac_cpp_err=yes
+fi
+if test -z "$ac_cpp_err"; then
+  :
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+  # Broken: fails on valid input.
+continue
+fi
+rm -f conftest.err conftest.$ac_ext
+
+  # OK, works on sane cases.  Now check whether non-existent headers
+  # can be detected and how.
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#include <ac_nonexistent.h>
+_ACEOF
+if { (eval echo "$as_me:$LINENO: \"$ac_cpp conftest.$ac_ext\"") >&5
+  (eval $ac_cpp conftest.$ac_ext) 2>conftest.er1
+  ac_status=$?
+  grep -v '^ *+' conftest.er1 >conftest.err
+  rm -f conftest.er1
+  cat conftest.err >&5
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } >/dev/null; then
+  if test -s conftest.err; then
+    ac_cpp_err=$ac_c_preproc_warn_flag
+  else
+    ac_cpp_err=
+  fi
+else
+  ac_cpp_err=yes
+fi
+if test -z "$ac_cpp_err"; then
+  # Broken: success on invalid input.
+continue
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+  # Passes both tests.
+ac_preproc_ok=:
+break
+fi
+rm -f conftest.err conftest.$ac_ext
+
+done
+# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
+rm -f conftest.err conftest.$ac_ext
+if $ac_preproc_ok; then
+  break
+fi
+
+    done
+    ac_cv_prog_CPP=$CPP
+
+fi
+  CPP=$ac_cv_prog_CPP
+else
+  ac_cv_prog_CPP=$CPP
+fi
+echo "$as_me:$LINENO: result: $CPP" >&5
+echo "${ECHO_T}$CPP" >&6
+ac_preproc_ok=false
+for ac_c_preproc_warn_flag in '' yes
+do
+  # Use a header file that comes with gcc, so configuring glibc
+  # with a fresh cross-compiler works.
+  # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
+  # <limits.h> exists even on freestanding compilers.
+  # On the NeXT, cc -E runs the code through the compiler's parser,
+  # not just through cpp. "Syntax error" is here to catch this case.
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#ifdef __STDC__
+# include <limits.h>
+#else
+# include <assert.h>
+#endif
+                     Syntax error
+_ACEOF
+if { (eval echo "$as_me:$LINENO: \"$ac_cpp conftest.$ac_ext\"") >&5
+  (eval $ac_cpp conftest.$ac_ext) 2>conftest.er1
+  ac_status=$?
+  grep -v '^ *+' conftest.er1 >conftest.err
+  rm -f conftest.er1
+  cat conftest.err >&5
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } >/dev/null; then
+  if test -s conftest.err; then
+    ac_cpp_err=$ac_c_preproc_warn_flag
+  else
+    ac_cpp_err=
+  fi
+else
+  ac_cpp_err=yes
+fi
+if test -z "$ac_cpp_err"; then
+  :
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+  # Broken: fails on valid input.
+continue
+fi
+rm -f conftest.err conftest.$ac_ext
+
+  # OK, works on sane cases.  Now check whether non-existent headers
+  # can be detected and how.
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#include <ac_nonexistent.h>
+_ACEOF
+if { (eval echo "$as_me:$LINENO: \"$ac_cpp conftest.$ac_ext\"") >&5
+  (eval $ac_cpp conftest.$ac_ext) 2>conftest.er1
+  ac_status=$?
+  grep -v '^ *+' conftest.er1 >conftest.err
+  rm -f conftest.er1
+  cat conftest.err >&5
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } >/dev/null; then
+  if test -s conftest.err; then
+    ac_cpp_err=$ac_c_preproc_warn_flag
+  else
+    ac_cpp_err=
+  fi
+else
+  ac_cpp_err=yes
+fi
+if test -z "$ac_cpp_err"; then
+  # Broken: success on invalid input.
+continue
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+  # Passes both tests.
+ac_preproc_ok=:
+break
+fi
+rm -f conftest.err conftest.$ac_ext
+
+done
+# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
+rm -f conftest.err conftest.$ac_ext
+if $ac_preproc_ok; then
+  :
+else
+  { { echo "$as_me:$LINENO: error: C preprocessor \"$CPP\" fails sanity check
+See \`config.log' for more details." >&5
+echo "$as_me: error: C preprocessor \"$CPP\" fails sanity check
+See \`config.log' for more details." >&2;}
+   { (exit 1); exit 1; }; }
+fi
+
+ac_ext=c
+ac_cpp='$CPP $CPPFLAGS'
+ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
+ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
+ac_compiler_gnu=$ac_cv_c_compiler_gnu
+
+
+echo "$as_me:$LINENO: checking for egrep" >&5
+echo $ECHO_N "checking for egrep... $ECHO_C" >&6
+if test "${ac_cv_prog_egrep+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  if echo a | (grep -E '(a|b)') >/dev/null 2>&1
+    then ac_cv_prog_egrep='grep -E'
+    else ac_cv_prog_egrep='egrep'
+    fi
+fi
+echo "$as_me:$LINENO: result: $ac_cv_prog_egrep" >&5
+echo "${ECHO_T}$ac_cv_prog_egrep" >&6
+ EGREP=$ac_cv_prog_egrep
+
+
+echo "$as_me:$LINENO: checking for ANSI C header files" >&5
+echo $ECHO_N "checking for ANSI C header files... $ECHO_C" >&6
+if test "${ac_cv_header_stdc+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#include <stdlib.h>
+#include <stdarg.h>
+#include <string.h>
+#include <float.h>
+
+int
+main ()
+{
+
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_cv_header_stdc=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ac_cv_header_stdc=no
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+
+if test $ac_cv_header_stdc = yes; then
+  # SunOS 4.x string.h does not declare mem*, contrary to ANSI.
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#include <string.h>
+
+_ACEOF
+if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
+  $EGREP "memchr" >/dev/null 2>&1; then
+  :
+else
+  ac_cv_header_stdc=no
+fi
+rm -f conftest*
+
+fi
+
+if test $ac_cv_header_stdc = yes; then
+  # ISC 2.0.2 stdlib.h does not declare free, contrary to ANSI.
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#include <stdlib.h>
+
+_ACEOF
+if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
+  $EGREP "free" >/dev/null 2>&1; then
+  :
+else
+  ac_cv_header_stdc=no
+fi
+rm -f conftest*
+
+fi
+
+if test $ac_cv_header_stdc = yes; then
+  # /bin/cc in Irix-4.0.5 gets non-ANSI ctype macros unless using -ansi.
+  if test "$cross_compiling" = yes; then
+  :
+else
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#include <ctype.h>
+#if ((' ' & 0x0FF) == 0x020)
+# define ISLOWER(c) ('a' <= (c) && (c) <= 'z')
+# define TOUPPER(c) (ISLOWER(c) ? 'A' + ((c) - 'a') : (c))
+#else
+# define ISLOWER(c) \
+                   (('a' <= (c) && (c) <= 'i') \
+                     || ('j' <= (c) && (c) <= 'r') \
+                     || ('s' <= (c) && (c) <= 'z'))
+# define TOUPPER(c) (ISLOWER(c) ? ((c) | 0x40) : (c))
+#endif
+
+#define XOR(e, f) (((e) && !(f)) || (!(e) && (f)))
+int
+main ()
+{
+  int i;
+  for (i = 0; i < 256; i++)
+    if (XOR (islower (i), ISLOWER (i))
+        || toupper (i) != TOUPPER (i))
+      exit(2);
+  exit (0);
+}
+_ACEOF
+rm -f conftest$ac_exeext
+if { (eval echo "$as_me:$LINENO: \"$ac_link\"") >&5
+  (eval $ac_link) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } && { ac_try='./conftest$ac_exeext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  :
+else
+  echo "$as_me: program exited with status $ac_status" >&5
+echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+( exit $ac_status )
+ac_cv_header_stdc=no
+fi
+rm -f core core.* *.core gmon.out bb.out conftest$ac_exeext conftest.$ac_objext conftest.$ac_ext
+fi
+fi
+fi
+echo "$as_me:$LINENO: result: $ac_cv_header_stdc" >&5
+echo "${ECHO_T}$ac_cv_header_stdc" >&6
+if test $ac_cv_header_stdc = yes; then
+
+cat >>confdefs.h <<\_ACEOF
+#define STDC_HEADERS 1
+_ACEOF
+
+fi
+
+# On IRIX 5.3, sys/types and inttypes.h are conflicting.
+
+
+
+
+
+
+
+
+
+for ac_header in sys/types.h sys/stat.h stdlib.h string.h memory.h strings.h \
+                  inttypes.h stdint.h unistd.h
+do
+as_ac_Header=`echo "ac_cv_header_$ac_header" | $as_tr_sh`
+echo "$as_me:$LINENO: checking for $ac_header" >&5
+echo $ECHO_N "checking for $ac_header... $ECHO_C" >&6
+if eval "test \"\${$as_ac_Header+set}\" = set"; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+$ac_includes_default
+
+#include <$ac_header>
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  eval "$as_ac_Header=yes"
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+eval "$as_ac_Header=no"
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+fi
+echo "$as_me:$LINENO: result: `eval echo '${'$as_ac_Header'}'`" >&5
+echo "${ECHO_T}`eval echo '${'$as_ac_Header'}'`" >&6
+if test `eval echo '${'$as_ac_Header'}'` = yes; then
+  cat >>confdefs.h <<_ACEOF
+#define `echo "HAVE_$ac_header" | $as_tr_cpp` 1
+_ACEOF
+
+fi
+
+done
+
+
+if test "${ac_cv_header_g2_h+set}" = set; then
+  echo "$as_me:$LINENO: checking for g2.h" >&5
+echo $ECHO_N "checking for g2.h... $ECHO_C" >&6
+if test "${ac_cv_header_g2_h+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+fi
+echo "$as_me:$LINENO: result: $ac_cv_header_g2_h" >&5
+echo "${ECHO_T}$ac_cv_header_g2_h" >&6
+else
+  # Is the header compilable?
+echo "$as_me:$LINENO: checking g2.h usability" >&5
+echo $ECHO_N "checking g2.h usability... $ECHO_C" >&6
+cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+$ac_includes_default
+#include <g2.h>
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_header_compiler=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ac_header_compiler=no
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+echo "$as_me:$LINENO: result: $ac_header_compiler" >&5
+echo "${ECHO_T}$ac_header_compiler" >&6
+
+# Is the header present?
+echo "$as_me:$LINENO: checking g2.h presence" >&5
+echo $ECHO_N "checking g2.h presence... $ECHO_C" >&6
+cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#include <g2.h>
+_ACEOF
+if { (eval echo "$as_me:$LINENO: \"$ac_cpp conftest.$ac_ext\"") >&5
+  (eval $ac_cpp conftest.$ac_ext) 2>conftest.er1
+  ac_status=$?
+  grep -v '^ *+' conftest.er1 >conftest.err
+  rm -f conftest.er1
+  cat conftest.err >&5
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } >/dev/null; then
+  if test -s conftest.err; then
+    ac_cpp_err=$ac_c_preproc_warn_flag
+  else
+    ac_cpp_err=
+  fi
+else
+  ac_cpp_err=yes
+fi
+if test -z "$ac_cpp_err"; then
+  ac_header_preproc=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+  ac_header_preproc=no
+fi
+rm -f conftest.err conftest.$ac_ext
+echo "$as_me:$LINENO: result: $ac_header_preproc" >&5
+echo "${ECHO_T}$ac_header_preproc" >&6
+
+# So?  What about this header?
+case $ac_header_compiler:$ac_header_preproc in
+  yes:no )
+    { echo "$as_me:$LINENO: WARNING: g2.h: accepted by the compiler, rejected by the preprocessor!" >&5
+echo "$as_me: WARNING: g2.h: accepted by the compiler, rejected by the preprocessor!" >&2;}
+    { echo "$as_me:$LINENO: WARNING: g2.h: proceeding with the preprocessor's result" >&5
+echo "$as_me: WARNING: g2.h: proceeding with the preprocessor's result" >&2;}
+    (
+      cat <<\_ASBOX
+## ------------------------------------ ##
+## Report this to bug-autoconf at gnu.org. ##
+## ------------------------------------ ##
+_ASBOX
+    ) |
+      sed "s/^/$as_me: WARNING:     /" >&2
+    ;;
+  no:yes )
+    { echo "$as_me:$LINENO: WARNING: g2.h: present but cannot be compiled" >&5
+echo "$as_me: WARNING: g2.h: present but cannot be compiled" >&2;}
+    { echo "$as_me:$LINENO: WARNING: g2.h: check for missing prerequisite headers?" >&5
+echo "$as_me: WARNING: g2.h: check for missing prerequisite headers?" >&2;}
+    { echo "$as_me:$LINENO: WARNING: g2.h: proceeding with the preprocessor's result" >&5
+echo "$as_me: WARNING: g2.h: proceeding with the preprocessor's result" >&2;}
+    (
+      cat <<\_ASBOX
+## ------------------------------------ ##
+## Report this to bug-autoconf at gnu.org. ##
+## ------------------------------------ ##
+_ASBOX
+    ) |
+      sed "s/^/$as_me: WARNING:     /" >&2
+    ;;
+esac
+echo "$as_me:$LINENO: checking for g2.h" >&5
+echo $ECHO_N "checking for g2.h... $ECHO_C" >&6
+if test "${ac_cv_header_g2_h+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  ac_cv_header_g2_h=$ac_header_preproc
+fi
+echo "$as_me:$LINENO: result: $ac_cv_header_g2_h" >&5
+echo "${ECHO_T}$ac_cv_header_g2_h" >&6
+
+fi
+
+
+if test "${ac_cv_header_g2_PS_h+set}" = set; then
+  echo "$as_me:$LINENO: checking for g2_PS.h" >&5
+echo $ECHO_N "checking for g2_PS.h... $ECHO_C" >&6
+if test "${ac_cv_header_g2_PS_h+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+fi
+echo "$as_me:$LINENO: result: $ac_cv_header_g2_PS_h" >&5
+echo "${ECHO_T}$ac_cv_header_g2_PS_h" >&6
+else
+  # Is the header compilable?
+echo "$as_me:$LINENO: checking g2_PS.h usability" >&5
+echo $ECHO_N "checking g2_PS.h usability... $ECHO_C" >&6
+cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+$ac_includes_default
+#include <g2_PS.h>
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_header_compiler=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ac_header_compiler=no
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+echo "$as_me:$LINENO: result: $ac_header_compiler" >&5
+echo "${ECHO_T}$ac_header_compiler" >&6
+
+# Is the header present?
+echo "$as_me:$LINENO: checking g2_PS.h presence" >&5
+echo $ECHO_N "checking g2_PS.h presence... $ECHO_C" >&6
+cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#include <g2_PS.h>
+_ACEOF
+if { (eval echo "$as_me:$LINENO: \"$ac_cpp conftest.$ac_ext\"") >&5
+  (eval $ac_cpp conftest.$ac_ext) 2>conftest.er1
+  ac_status=$?
+  grep -v '^ *+' conftest.er1 >conftest.err
+  rm -f conftest.er1
+  cat conftest.err >&5
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } >/dev/null; then
+  if test -s conftest.err; then
+    ac_cpp_err=$ac_c_preproc_warn_flag
+  else
+    ac_cpp_err=
+  fi
+else
+  ac_cpp_err=yes
+fi
+if test -z "$ac_cpp_err"; then
+  ac_header_preproc=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+  ac_header_preproc=no
+fi
+rm -f conftest.err conftest.$ac_ext
+echo "$as_me:$LINENO: result: $ac_header_preproc" >&5
+echo "${ECHO_T}$ac_header_preproc" >&6
+
+# So?  What about this header?
+case $ac_header_compiler:$ac_header_preproc in
+  yes:no )
+    { echo "$as_me:$LINENO: WARNING: g2_PS.h: accepted by the compiler, rejected by the preprocessor!" >&5
+echo "$as_me: WARNING: g2_PS.h: accepted by the compiler, rejected by the preprocessor!" >&2;}
+    { echo "$as_me:$LINENO: WARNING: g2_PS.h: proceeding with the preprocessor's result" >&5
+echo "$as_me: WARNING: g2_PS.h: proceeding with the preprocessor's result" >&2;}
+    (
+      cat <<\_ASBOX
+## ------------------------------------ ##
+## Report this to bug-autoconf at gnu.org. ##
+## ------------------------------------ ##
+_ASBOX
+    ) |
+      sed "s/^/$as_me: WARNING:     /" >&2
+    ;;
+  no:yes )
+    { echo "$as_me:$LINENO: WARNING: g2_PS.h: present but cannot be compiled" >&5
+echo "$as_me: WARNING: g2_PS.h: present but cannot be compiled" >&2;}
+    { echo "$as_me:$LINENO: WARNING: g2_PS.h: check for missing prerequisite headers?" >&5
+echo "$as_me: WARNING: g2_PS.h: check for missing prerequisite headers?" >&2;}
+    { echo "$as_me:$LINENO: WARNING: g2_PS.h: proceeding with the preprocessor's result" >&5
+echo "$as_me: WARNING: g2_PS.h: proceeding with the preprocessor's result" >&2;}
+    (
+      cat <<\_ASBOX
+## ------------------------------------ ##
+## Report this to bug-autoconf at gnu.org. ##
+## ------------------------------------ ##
+_ASBOX
+    ) |
+      sed "s/^/$as_me: WARNING:     /" >&2
+    ;;
+esac
+echo "$as_me:$LINENO: checking for g2_PS.h" >&5
+echo $ECHO_N "checking for g2_PS.h... $ECHO_C" >&6
+if test "${ac_cv_header_g2_PS_h+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  ac_cv_header_g2_PS_h=$ac_header_preproc
+fi
+echo "$as_me:$LINENO: result: $ac_cv_header_g2_PS_h" >&5
+echo "${ECHO_T}$ac_cv_header_g2_PS_h" >&6
+
+fi
+
+
+
+echo "$as_me:$LINENO: checking for an ANSI C-conforming const" >&5
+echo $ECHO_N "checking for an ANSI C-conforming const... $ECHO_C" >&6
+if test "${ac_cv_c_const+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+
+int
+main ()
+{
+/* FIXME: Include the comments suggested by Paul. */
+#ifndef __cplusplus
+  /* Ultrix mips cc rejects this.  */
+  typedef int charset[2];
+  const charset x;
+  /* SunOS 4.1.1 cc rejects this.  */
+  char const *const *ccp;
+  char **p;
+  /* NEC SVR4.0.2 mips cc rejects this.  */
+  struct point {int x, y;};
+  static struct point const zero = {0,0};
+  /* AIX XL C 1.02.0.0 rejects this.
+     It does not let you subtract one const X* pointer from another in
+     an arm of an if-expression whose if-part is not a constant
+     expression */
+  const char *g = "string";
+  ccp = &g + (g ? g-g : 0);
+  /* HPUX 7.0 cc rejects these. */
+  ++ccp;
+  p = (char**) ccp;
+  ccp = (char const *const *) p;
+  { /* SCO 3.2v4 cc rejects this.  */
+    char *t;
+    char const *s = 0 ? (char *) 0 : (char const *) 0;
+
+    *t++ = 0;
+  }
+  { /* Someone thinks the Sun supposedly-ANSI compiler will reject this.  */
+    int x[] = {25, 17};
+    const int *foo = &x[0];
+    ++foo;
+  }
+  { /* Sun SC1.0 ANSI compiler rejects this -- but not the above. */
+    typedef const int *iptr;
+    iptr p = 0;
+    ++p;
+  }
+  { /* AIX XL C 1.02.0.0 rejects this saying
+       "k.c", line 2.27: 1506-025 (S) Operand must be a modifiable lvalue. */
+    struct s { int j; const int *ap[3]; };
+    struct s *b; b->j = 5;
+  }
+  { /* ULTRIX-32 V3.1 (Rev 9) vcc rejects this */
+    const int foo = 10;
+  }
+#endif
+
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_cv_c_const=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ac_cv_c_const=no
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+fi
+echo "$as_me:$LINENO: result: $ac_cv_c_const" >&5
+echo "${ECHO_T}$ac_cv_c_const" >&6
+if test $ac_cv_c_const = no; then
+
+cat >>confdefs.h <<\_ACEOF
+#define const
+_ACEOF
+
+fi
+
+echo "$as_me:$LINENO: checking for inline" >&5
+echo $ECHO_N "checking for inline... $ECHO_C" >&6
+if test "${ac_cv_c_inline+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  ac_cv_c_inline=no
+for ac_kw in inline __inline__ __inline; do
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+#ifndef __cplusplus
+typedef int foo_t;
+static $ac_kw foo_t static_foo () {return 0; }
+$ac_kw foo_t foo () {return 0; }
+#endif
+
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_cv_c_inline=$ac_kw; break
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+done
+
+fi
+echo "$as_me:$LINENO: result: $ac_cv_c_inline" >&5
+echo "${ECHO_T}$ac_cv_c_inline" >&6
+case $ac_cv_c_inline in
+  inline | yes) ;;
+  no)
+cat >>confdefs.h <<\_ACEOF
+#define inline
+_ACEOF
+ ;;
+  *)  cat >>confdefs.h <<_ACEOF
+#define inline $ac_cv_c_inline
+_ACEOF
+ ;;
+esac
+
+echo "$as_me:$LINENO: checking for size_t" >&5
+echo $ECHO_N "checking for size_t... $ECHO_C" >&6
+if test "${ac_cv_type_size_t+set}" = set; then
+  echo $ECHO_N "(cached) $ECHO_C" >&6
+else
+  cat >conftest.$ac_ext <<_ACEOF
+#line $LINENO "configure"
+/* confdefs.h.  */
+_ACEOF
+cat confdefs.h >>conftest.$ac_ext
+cat >>conftest.$ac_ext <<_ACEOF
+/* end confdefs.h.  */
+$ac_includes_default
+int
+main ()
+{
+if ((size_t *) 0)
+  return 0;
+if (sizeof (size_t))
+  return 0;
+  ;
+  return 0;
+}
+_ACEOF
+rm -f conftest.$ac_objext
+if { (eval echo "$as_me:$LINENO: \"$ac_compile\"") >&5
+  (eval $ac_compile) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); } &&
+         { ac_try='test -s conftest.$ac_objext'
+  { (eval echo "$as_me:$LINENO: \"$ac_try\"") >&5
+  (eval $ac_try) 2>&5
+  ac_status=$?
+  echo "$as_me:$LINENO: \$? = $ac_status" >&5
+  (exit $ac_status); }; }; then
+  ac_cv_type_size_t=yes
+else
+  echo "$as_me: failed program was:" >&5
+sed 's/^/| /' conftest.$ac_ext >&5
+
+ac_cv_type_size_t=no
+fi
+rm -f conftest.$ac_objext conftest.$ac_ext
+fi
+echo "$as_me:$LINENO: result: $ac_cv_type_size_t" >&5
+echo "${ECHO_T}$ac_cv_type_size_t" >&6
+if test $ac_cv_type_size_t = yes; then
+  :
+else
+
+cat >>confdefs.h <<_ACEOF
+#define size_t unsigned
+_ACEOF
+
+fi
+
+
+
+
+                              ac_config_files="$ac_config_files Makefile src/Makefile man/Makefile"
+cat >confcache <<\_ACEOF
+# This file is a shell script that caches the results of configure
+# tests run on this system so they can be shared between configure
+# scripts and configure runs, see configure's option --config-cache.
+# It is not useful on other systems.  If it contains results you don't
+# want to keep, you may remove or edit it.
+#
+# config.status only pays attention to the cache file if you give it
+# the --recheck option to rerun configure.
+#
+# `ac_cv_env_foo' variables (set or unset) will be overridden when
+# loading this file, other *unset* `ac_cv_foo' will be assigned the
+# following values.
+
+_ACEOF
+
+# The following way of writing the cache mishandles newlines in values,
+# but we know of no workaround that is simple, portable, and efficient.
+# So, don't put newlines in cache variables' values.
+# Ultrix sh set writes to stderr and can't be redirected directly,
+# and sets the high bit in the cache file unless we assign to the vars.
+{
+  (set) 2>&1 |
+    case `(ac_space=' '; set | grep ac_space) 2>&1` in
+    *ac_space=\ *)
+      # `set' does not quote correctly, so add quotes (double-quote
+      # substitution turns \\\\ into \\, and sed turns \\ into \).
+      sed -n \
+        "s/'/'\\\\''/g;
+    	  s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\\2'/p"
+      ;;
+    *)
+      # `set' quotes correctly as required by POSIX, so do not add quotes.
+      sed -n \
+        "s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1=\\2/p"
+      ;;
+    esac;
+} |
+  sed '
+     t clear
+     : clear
+     s/^\([^=]*\)=\(.*[{}].*\)$/test "${\1+set}" = set || &/
+     t end
+     /^ac_cv_env/!s/^\([^=]*\)=\(.*\)$/\1=${\1=\2}/
+     : end' >>confcache
+if diff $cache_file confcache >/dev/null 2>&1; then :; else
+  if test -w $cache_file; then
+    test "x$cache_file" != "x/dev/null" && echo "updating cache $cache_file"
+    cat confcache >$cache_file
+  else
+    echo "not updating unwritable cache $cache_file"
+  fi
+fi
+rm -f confcache
+
+test "x$prefix" = xNONE && prefix=$ac_default_prefix
+# Let make expand exec_prefix.
+test "x$exec_prefix" = xNONE && exec_prefix='${prefix}'
+
+# VPATH may cause trouble with some makes, so we remove $(srcdir),
+# ${srcdir} and @srcdir@ from VPATH if srcdir is ".", strip leading and
+# trailing colons and then remove the whole line if VPATH becomes empty
+# (actually we leave an empty line to preserve line numbers).
+if test "x$srcdir" = x.; then
+  ac_vpsub='/^[ 	]*VPATH[ 	]*=/{
+s/:*\$(srcdir):*/:/;
+s/:*\${srcdir}:*/:/;
+s/:*@srcdir@:*/:/;
+s/^\([^=]*=[ 	]*\):*/\1/;
+s/:*$//;
+s/^[^=]*=[ 	]*$//;
+}'
+fi
+
+DEFS=-DHAVE_CONFIG_H
+
+ac_libobjs=
+ac_ltlibobjs=
+for ac_i in : $LIBOBJS; do test "x$ac_i" = x: && continue
+  # 1. Remove the extension, and $U if already installed.
+  ac_i=`echo "$ac_i" |
+         sed 's/\$U\././;s/\.o$//;s/\.obj$//'`
+  # 2. Add them.
+  ac_libobjs="$ac_libobjs $ac_i\$U.$ac_objext"
+  ac_ltlibobjs="$ac_ltlibobjs $ac_i"'$U.lo'
+done
+LIBOBJS=$ac_libobjs
+
+LTLIBOBJS=$ac_ltlibobjs
+
+
+if test -z "${AMDEP_TRUE}" && test -z "${AMDEP_FALSE}"; then
+  { { echo "$as_me:$LINENO: error: conditional \"AMDEP\" was never defined.
+Usually this means the macro was only invoked conditionally." >&5
+echo "$as_me: error: conditional \"AMDEP\" was never defined.
+Usually this means the macro was only invoked conditionally." >&2;}
+   { (exit 1); exit 1; }; }
+fi
+if test -z "${am__fastdepCC_TRUE}" && test -z "${am__fastdepCC_FALSE}"; then
+  { { echo "$as_me:$LINENO: error: conditional \"am__fastdepCC\" was never defined.
+Usually this means the macro was only invoked conditionally." >&5
+echo "$as_me: error: conditional \"am__fastdepCC\" was never defined.
+Usually this means the macro was only invoked conditionally." >&2;}
+   { (exit 1); exit 1; }; }
+fi
+
+: ${CONFIG_STATUS=./config.status}
+ac_clean_files_save=$ac_clean_files
+ac_clean_files="$ac_clean_files $CONFIG_STATUS"
+{ echo "$as_me:$LINENO: creating $CONFIG_STATUS" >&5
+echo "$as_me: creating $CONFIG_STATUS" >&6;}
+cat >$CONFIG_STATUS <<_ACEOF
+#! $SHELL
+# Generated by $as_me.
+# Run this file to recreate the current configuration.
+# Compiler output produced by configure, useful for debugging
+# configure, is in config.log if it exists.
+
+debug=false
+ac_cs_recheck=false
+ac_cs_silent=false
+SHELL=\${CONFIG_SHELL-$SHELL}
+_ACEOF
+
+cat >>$CONFIG_STATUS <<\_ACEOF
+## --------------------- ##
+## M4sh Initialization.  ##
+## --------------------- ##
+
+# Be Bourne compatible
+if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then
+  emulate sh
+  NULLCMD=:
+  # Zsh 3.x and 4.x performs word splitting on ${1+"$@"}, which
+  # is contrary to our usage.  Disable this feature.
+  alias -g '${1+"$@"}'='"$@"'
+elif test -n "${BASH_VERSION+set}" && (set -o posix) >/dev/null 2>&1; then
+  set -o posix
+fi
+
+# Support unset when possible.
+if (FOO=FOO; unset FOO) >/dev/null 2>&1; then
+  as_unset=unset
+else
+  as_unset=false
+fi
+
+
+# Work around bugs in pre-3.0 UWIN ksh.
+$as_unset ENV MAIL MAILPATH
+PS1='$ '
+PS2='> '
+PS4='+ '
+
+# NLS nuisances.
+for as_var in \
+  LANG LANGUAGE LC_ADDRESS LC_ALL LC_COLLATE LC_CTYPE LC_IDENTIFICATION \
+  LC_MEASUREMENT LC_MESSAGES LC_MONETARY LC_NAME LC_NUMERIC LC_PAPER \
+  LC_TELEPHONE LC_TIME
+do
+  if (set +x; test -n "`(eval $as_var=C; export $as_var) 2>&1`"); then
+    eval $as_var=C; export $as_var
+  else
+    $as_unset $as_var
+  fi
+done
+
+# Required to use basename.
+if expr a : '\(a\)' >/dev/null 2>&1; then
+  as_expr=expr
+else
+  as_expr=false
+fi
+
+if (basename /) >/dev/null 2>&1 && test "X`basename / 2>&1`" = "X/"; then
+  as_basename=basename
+else
+  as_basename=false
+fi
+
+
+# Name of the executable.
+as_me=`$as_basename "$0" ||
+$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
+	 X"$0" : 'X\(//\)$' \| \
+	 X"$0" : 'X\(/\)$' \| \
+	 .     : '\(.\)' 2>/dev/null ||
+echo X/"$0" |
+    sed '/^.*\/\([^/][^/]*\)\/*$/{ s//\1/; q; }
+  	  /^X\/\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\/\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`
+
+
+# PATH needs CR, and LINENO needs CR and PATH.
+# Avoid depending upon Character Ranges.
+as_cr_letters='abcdefghijklmnopqrstuvwxyz'
+as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
+as_cr_Letters=$as_cr_letters$as_cr_LETTERS
+as_cr_digits='0123456789'
+as_cr_alnum=$as_cr_Letters$as_cr_digits
+
+# The user is always right.
+if test "${PATH_SEPARATOR+set}" != set; then
+  echo "#! /bin/sh" >conf$$.sh
+  echo  "exit 0"   >>conf$$.sh
+  chmod +x conf$$.sh
+  if (PATH="/nonexistent;."; conf$$.sh) >/dev/null 2>&1; then
+    PATH_SEPARATOR=';'
+  else
+    PATH_SEPARATOR=:
+  fi
+  rm -f conf$$.sh
+fi
+
+
+  as_lineno_1=$LINENO
+  as_lineno_2=$LINENO
+  as_lineno_3=`(expr $as_lineno_1 + 1) 2>/dev/null`
+  test "x$as_lineno_1" != "x$as_lineno_2" &&
+  test "x$as_lineno_3"  = "x$as_lineno_2"  || {
+  # Find who we are.  Look in the path if we contain no path at all
+  # relative or not.
+  case $0 in
+    *[\\/]* ) as_myself=$0 ;;
+    *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in $PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
+done
+
+       ;;
+  esac
+  # We did not find ourselves, most probably we were run as `sh COMMAND'
+  # in which case we are not to be found in the path.
+  if test "x$as_myself" = x; then
+    as_myself=$0
+  fi
+  if test ! -f "$as_myself"; then
+    { { echo "$as_me:$LINENO: error: cannot find myself; rerun with an absolute path" >&5
+echo "$as_me: error: cannot find myself; rerun with an absolute path" >&2;}
+   { (exit 1); exit 1; }; }
+  fi
+  case $CONFIG_SHELL in
+  '')
+    as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
+for as_dir in /bin$PATH_SEPARATOR/usr/bin$PATH_SEPARATOR$PATH
+do
+  IFS=$as_save_IFS
+  test -z "$as_dir" && as_dir=.
+  for as_base in sh bash ksh sh5; do
+	 case $as_dir in
+	 /*)
+	   if ("$as_dir/$as_base" -c '
+  as_lineno_1=$LINENO
+  as_lineno_2=$LINENO
+  as_lineno_3=`(expr $as_lineno_1 + 1) 2>/dev/null`
+  test "x$as_lineno_1" != "x$as_lineno_2" &&
+  test "x$as_lineno_3"  = "x$as_lineno_2" ') 2>/dev/null; then
+	     $as_unset BASH_ENV || test "${BASH_ENV+set}" != set || { BASH_ENV=; export BASH_ENV; }
+	     $as_unset ENV || test "${ENV+set}" != set || { ENV=; export ENV; }
+	     CONFIG_SHELL=$as_dir/$as_base
+	     export CONFIG_SHELL
+	     exec "$CONFIG_SHELL" "$0" ${1+"$@"}
+	   fi;;
+	 esac
+       done
+done
+;;
+  esac
+
+  # Create $as_me.lineno as a copy of $as_myself, but with $LINENO
+  # uniformly replaced by the line number.  The first 'sed' inserts a
+  # line-number line before each line; the second 'sed' does the real
+  # work.  The second script uses 'N' to pair each line-number line
+  # with the numbered line, and appends trailing '-' during
+  # substitution so that $LINENO is not a special case at line end.
+  # (Raja R Harinath suggested sed '=', and Paul Eggert wrote the
+  # second 'sed' script.  Blame Lee E. McMahon for sed's syntax.  :-)
+  sed '=' <$as_myself |
+    sed '
+      N
+      s,$,-,
+      : loop
+      s,^\(['$as_cr_digits']*\)\(.*\)[$]LINENO\([^'$as_cr_alnum'_]\),\1\2\1\3,
+      t loop
+      s,-$,,
+      s,^['$as_cr_digits']*\n,,
+    ' >$as_me.lineno &&
+  chmod +x $as_me.lineno ||
+    { { echo "$as_me:$LINENO: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&5
+echo "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2;}
+   { (exit 1); exit 1; }; }
+
+  # Don't try to exec as it changes $[0], causing all sort of problems
+  # (the dirname of $[0] is not the place where we might find the
+  # original and so on.  Autoconf is especially sensible to this).
+  . ./$as_me.lineno
+  # Exit status is that of the last command.
+  exit
+}
+
+
+case `echo "testing\c"; echo 1,2,3`,`echo -n testing; echo 1,2,3` in
+  *c*,-n*) ECHO_N= ECHO_C='
+' ECHO_T='	' ;;
+  *c*,*  ) ECHO_N=-n ECHO_C= ECHO_T= ;;
+  *)       ECHO_N= ECHO_C='\c' ECHO_T= ;;
+esac
+
+if expr a : '\(a\)' >/dev/null 2>&1; then
+  as_expr=expr
+else
+  as_expr=false
+fi
+
+rm -f conf$$ conf$$.exe conf$$.file
+echo >conf$$.file
+if ln -s conf$$.file conf$$ 2>/dev/null; then
+  # We could just check for DJGPP; but this test a) works b) is more generic
+  # and c) will remain valid once DJGPP supports symlinks (DJGPP 2.04).
+  if test -f conf$$.exe; then
+    # Don't use ln at all; we don't have any links
+    as_ln_s='cp -p'
+  else
+    as_ln_s='ln -s'
+  fi
+elif ln conf$$.file conf$$ 2>/dev/null; then
+  as_ln_s=ln
+else
+  as_ln_s='cp -p'
+fi
+rm -f conf$$ conf$$.exe conf$$.file
+
+if mkdir -p . 2>/dev/null; then
+  as_mkdir_p=:
+else
+  as_mkdir_p=false
+fi
+
+as_executable_p="test -f"
+
+# Sed expression to map a string onto a valid CPP name.
+as_tr_cpp="sed y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g"
+
+# Sed expression to map a string onto a valid variable name.
+as_tr_sh="sed y%*+%pp%;s%[^_$as_cr_alnum]%_%g"
+
+
+# IFS
+# We need space, tab and new line, in precisely that order.
+as_nl='
+'
+IFS=" 	$as_nl"
+
+# CDPATH.
+$as_unset CDPATH
+
+exec 6>&1
+
+# Open the log real soon, to keep \$[0] and so on meaningful, and to
+# report actual input values of CONFIG_FILES etc. instead of their
+# values after options handling.  Logging --version etc. is OK.
+exec 5>>config.log
+{
+  echo
+  sed 'h;s/./-/g;s/^.../## /;s/...$/ ##/;p;x;p;x' <<_ASBOX
+## Running $as_me. ##
+_ASBOX
+} >&5
+cat >&5 <<_CSEOF
+
+This file was extended by RNAhybrid $as_me 1.0, which was
+generated by GNU Autoconf 2.57.  Invocation command line was
+
+  CONFIG_FILES    = $CONFIG_FILES
+  CONFIG_HEADERS  = $CONFIG_HEADERS
+  CONFIG_LINKS    = $CONFIG_LINKS
+  CONFIG_COMMANDS = $CONFIG_COMMANDS
+  $ $0 $@
+
+_CSEOF
+echo "on `(hostname || uname -n) 2>/dev/null | sed 1q`" >&5
+echo >&5
+_ACEOF
+
+# Files that config.status was made for.
+if test -n "$ac_config_files"; then
+  echo "config_files=\"$ac_config_files\"" >>$CONFIG_STATUS
+fi
+
+if test -n "$ac_config_headers"; then
+  echo "config_headers=\"$ac_config_headers\"" >>$CONFIG_STATUS
+fi
+
+if test -n "$ac_config_links"; then
+  echo "config_links=\"$ac_config_links\"" >>$CONFIG_STATUS
+fi
+
+if test -n "$ac_config_commands"; then
+  echo "config_commands=\"$ac_config_commands\"" >>$CONFIG_STATUS
+fi
+
+cat >>$CONFIG_STATUS <<\_ACEOF
+
+ac_cs_usage="\
+\`$as_me' instantiates files from templates according to the
+current configuration.
+
+Usage: $0 [OPTIONS] [FILE]...
+
+  -h, --help       print this help, then exit
+  -V, --version    print version number, then exit
+  -q, --quiet      do not print progress messages
+  -d, --debug      don't remove temporary files
+      --recheck    update $as_me by reconfiguring in the same conditions
+  --file=FILE[:TEMPLATE]
+                   instantiate the configuration file FILE
+  --header=FILE[:TEMPLATE]
+                   instantiate the configuration header FILE
+
+Configuration files:
+$config_files
+
+Configuration headers:
+$config_headers
+
+Configuration commands:
+$config_commands
+
+Report bugs to <bug-autoconf at gnu.org>."
+_ACEOF
+
+cat >>$CONFIG_STATUS <<_ACEOF
+ac_cs_version="\\
+RNAhybrid config.status 1.0
+configured by $0, generated by GNU Autoconf 2.57,
+  with options \\"`echo "$ac_configure_args" | sed 's/[\\""\`\$]/\\\\&/g'`\\"
+
+Copyright 1992, 1993, 1994, 1995, 1996, 1998, 1999, 2000, 2001
+Free Software Foundation, Inc.
+This config.status script is free software; the Free Software Foundation
+gives unlimited permission to copy, distribute and modify it."
+srcdir=$srcdir
+INSTALL="$INSTALL"
+_ACEOF
+
+cat >>$CONFIG_STATUS <<\_ACEOF
+# If no file are specified by the user, then we need to provide default
+# value.  By we need to know if files were specified by the user.
+ac_need_defaults=:
+while test $# != 0
+do
+  case $1 in
+  --*=*)
+    ac_option=`expr "x$1" : 'x\([^=]*\)='`
+    ac_optarg=`expr "x$1" : 'x[^=]*=\(.*\)'`
+    ac_shift=:
+    ;;
+  -*)
+    ac_option=$1
+    ac_optarg=$2
+    ac_shift=shift
+    ;;
+  *) # This is not an option, so the user has probably given explicit
+     # arguments.
+     ac_option=$1
+     ac_need_defaults=false;;
+  esac
+
+  case $ac_option in
+  # Handling of the options.
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF
+  -recheck | --recheck | --rechec | --reche | --rech | --rec | --re | --r)
+    ac_cs_recheck=: ;;
+  --version | --vers* | -V )
+    echo "$ac_cs_version"; exit 0 ;;
+  --he | --h)
+    # Conflict between --help and --header
+    { { echo "$as_me:$LINENO: error: ambiguous option: $1
+Try \`$0 --help' for more information." >&5
+echo "$as_me: error: ambiguous option: $1
+Try \`$0 --help' for more information." >&2;}
+   { (exit 1); exit 1; }; };;
+  --help | --hel | -h )
+    echo "$ac_cs_usage"; exit 0 ;;
+  --debug | --d* | -d )
+    debug=: ;;
+  --file | --fil | --fi | --f )
+    $ac_shift
+    CONFIG_FILES="$CONFIG_FILES $ac_optarg"
+    ac_need_defaults=false;;
+  --header | --heade | --head | --hea )
+    $ac_shift
+    CONFIG_HEADERS="$CONFIG_HEADERS $ac_optarg"
+    ac_need_defaults=false;;
+  -q | -quiet | --quiet | --quie | --qui | --qu | --q \
+  | -silent | --silent | --silen | --sile | --sil | --si | --s)
+    ac_cs_silent=: ;;
+
+  # This is an error.
+  -*) { { echo "$as_me:$LINENO: error: unrecognized option: $1
+Try \`$0 --help' for more information." >&5
+echo "$as_me: error: unrecognized option: $1
+Try \`$0 --help' for more information." >&2;}
+   { (exit 1); exit 1; }; } ;;
+
+  *) ac_config_targets="$ac_config_targets $1" ;;
+
+  esac
+  shift
+done
+
+ac_configure_extra_args=
+
+if $ac_cs_silent; then
+  exec 6>/dev/null
+  ac_configure_extra_args="$ac_configure_extra_args --silent"
+fi
+
+_ACEOF
+cat >>$CONFIG_STATUS <<_ACEOF
+if \$ac_cs_recheck; then
+  echo "running $SHELL $0 " $ac_configure_args \$ac_configure_extra_args " --no-create --no-recursion" >&6
+  exec $SHELL $0 $ac_configure_args \$ac_configure_extra_args --no-create --no-recursion
+fi
+
+_ACEOF
+
+cat >>$CONFIG_STATUS <<_ACEOF
+#
+# INIT-COMMANDS section.
+#
+
+AMDEP_TRUE="$AMDEP_TRUE" ac_aux_dir="$ac_aux_dir"
+
+_ACEOF
+
+
+
+cat >>$CONFIG_STATUS <<\_ACEOF
+for ac_config_target in $ac_config_targets
+do
+  case "$ac_config_target" in
+  # Handling of arguments.
+  "Makefile" ) CONFIG_FILES="$CONFIG_FILES Makefile" ;;
+  "src/Makefile" ) CONFIG_FILES="$CONFIG_FILES src/Makefile" ;;
+  "man/Makefile" ) CONFIG_FILES="$CONFIG_FILES man/Makefile" ;;
+  "depfiles" ) CONFIG_COMMANDS="$CONFIG_COMMANDS depfiles" ;;
+  "config.h" ) CONFIG_HEADERS="$CONFIG_HEADERS config.h" ;;
+  *) { { echo "$as_me:$LINENO: error: invalid argument: $ac_config_target" >&5
+echo "$as_me: error: invalid argument: $ac_config_target" >&2;}
+   { (exit 1); exit 1; }; };;
+  esac
+done
+
+# If the user did not use the arguments to specify the items to instantiate,
+# then the envvar interface is used.  Set only those that are not.
+# We use the long form for the default assignment because of an extremely
+# bizarre bug on SunOS 4.1.3.
+if $ac_need_defaults; then
+  test "${CONFIG_FILES+set}" = set || CONFIG_FILES=$config_files
+  test "${CONFIG_HEADERS+set}" = set || CONFIG_HEADERS=$config_headers
+  test "${CONFIG_COMMANDS+set}" = set || CONFIG_COMMANDS=$config_commands
+fi
+
+# Have a temporary directory for convenience.  Make it in the build tree
+# simply because there is no reason to put it here, and in addition,
+# creating and moving files from /tmp can sometimes cause problems.
+# Create a temporary directory, and hook for its removal unless debugging.
+$debug ||
+{
+  trap 'exit_status=$?; rm -rf $tmp && exit $exit_status' 0
+  trap '{ (exit 1); exit 1; }' 1 2 13 15
+}
+
+# Create a (secure) tmp directory for tmp files.
+
+{
+  tmp=`(umask 077 && mktemp -d -q "./confstatXXXXXX") 2>/dev/null` &&
+  test -n "$tmp" && test -d "$tmp"
+}  ||
+{
+  tmp=./confstat$$-$RANDOM
+  (umask 077 && mkdir $tmp)
+} ||
+{
+   echo "$me: cannot create a temporary directory in ." >&2
+   { (exit 1); exit 1; }
+}
+
+_ACEOF
+
+cat >>$CONFIG_STATUS <<_ACEOF
+
+#
+# CONFIG_FILES section.
+#
+
+# No need to generate the scripts if there are no CONFIG_FILES.
+# This happens for instance when ./config.status config.h
+if test -n "\$CONFIG_FILES"; then
+  # Protect against being on the right side of a sed subst in config.status.
+  sed 's/,@/@@/; s/@,/@@/; s/,;t t\$/@;t t/; /@;t t\$/s/[\\\\&,]/\\\\&/g;
+   s/@@/,@/; s/@@/@,/; s/@;t t\$/,;t t/' >\$tmp/subs.sed <<\\CEOF
+s, at SHELL@,$SHELL,;t t
+s, at PATH_SEPARATOR@,$PATH_SEPARATOR,;t t
+s, at PACKAGE_NAME@,$PACKAGE_NAME,;t t
+s, at PACKAGE_TARNAME@,$PACKAGE_TARNAME,;t t
+s, at PACKAGE_VERSION@,$PACKAGE_VERSION,;t t
+s, at PACKAGE_STRING@,$PACKAGE_STRING,;t t
+s, at PACKAGE_BUGREPORT@,$PACKAGE_BUGREPORT,;t t
+s, at exec_prefix@,$exec_prefix,;t t
+s, at prefix@,$prefix,;t t
+s, at program_transform_name@,$program_transform_name,;t t
+s, at bindir@,$bindir,;t t
+s, at sbindir@,$sbindir,;t t
+s, at libexecdir@,$libexecdir,;t t
+s, at datadir@,$datadir,;t t
+s, at sysconfdir@,$sysconfdir,;t t
+s, at sharedstatedir@,$sharedstatedir,;t t
+s, at localstatedir@,$localstatedir,;t t
+s, at libdir@,$libdir,;t t
+s, at includedir@,$includedir,;t t
+s, at oldincludedir@,$oldincludedir,;t t
+s, at infodir@,$infodir,;t t
+s, at mandir@,$mandir,;t t
+s, at build_alias@,$build_alias,;t t
+s, at host_alias@,$host_alias,;t t
+s, at target_alias@,$target_alias,;t t
+s, at DEFS@,$DEFS,;t t
+s, at ECHO_C@,$ECHO_C,;t t
+s, at ECHO_N@,$ECHO_N,;t t
+s, at ECHO_T@,$ECHO_T,;t t
+s, at LIBS@,$LIBS,;t t
+s, at INSTALL_PROGRAM@,$INSTALL_PROGRAM,;t t
+s, at INSTALL_SCRIPT@,$INSTALL_SCRIPT,;t t
+s, at INSTALL_DATA@,$INSTALL_DATA,;t t
+s, at CYGPATH_W@,$CYGPATH_W,;t t
+s, at PACKAGE@,$PACKAGE,;t t
+s, at VERSION@,$VERSION,;t t
+s, at ACLOCAL@,$ACLOCAL,;t t
+s, at AUTOCONF@,$AUTOCONF,;t t
+s, at AUTOMAKE@,$AUTOMAKE,;t t
+s, at AUTOHEADER@,$AUTOHEADER,;t t
+s, at MAKEINFO@,$MAKEINFO,;t t
+s, at AMTAR@,$AMTAR,;t t
+s, at install_sh@,$install_sh,;t t
+s, at STRIP@,$STRIP,;t t
+s, at ac_ct_STRIP@,$ac_ct_STRIP,;t t
+s, at INSTALL_STRIP_PROGRAM@,$INSTALL_STRIP_PROGRAM,;t t
+s, at AWK@,$AWK,;t t
+s, at SET_MAKE@,$SET_MAKE,;t t
+s, at am__leading_dot@,$am__leading_dot,;t t
+s, at CC@,$CC,;t t
+s, at CFLAGS@,$CFLAGS,;t t
+s, at LDFLAGS@,$LDFLAGS,;t t
+s, at CPPFLAGS@,$CPPFLAGS,;t t
+s, at ac_ct_CC@,$ac_ct_CC,;t t
+s, at EXEEXT@,$EXEEXT,;t t
+s, at OBJEXT@,$OBJEXT,;t t
+s, at DEPDIR@,$DEPDIR,;t t
+s, at am__include@,$am__include,;t t
+s, at am__quote@,$am__quote,;t t
+s, at AMDEP_TRUE@,$AMDEP_TRUE,;t t
+s, at AMDEP_FALSE@,$AMDEP_FALSE,;t t
+s, at AMDEPBACKSLASH@,$AMDEPBACKSLASH,;t t
+s, at CCDEPMODE@,$CCDEPMODE,;t t
+s, at am__fastdepCC_TRUE@,$am__fastdepCC_TRUE,;t t
+s, at am__fastdepCC_FALSE@,$am__fastdepCC_FALSE,;t t
+s, at CPP@,$CPP,;t t
+s, at EGREP@,$EGREP,;t t
+s, at LIBOBJS@,$LIBOBJS,;t t
+s, at LTLIBOBJS@,$LTLIBOBJS,;t t
+CEOF
+
+_ACEOF
+
+  cat >>$CONFIG_STATUS <<\_ACEOF
+  # Split the substitutions into bite-sized pieces for seds with
+  # small command number limits, like on Digital OSF/1 and HP-UX.
+  ac_max_sed_lines=48
+  ac_sed_frag=1 # Number of current file.
+  ac_beg=1 # First line for current file.
+  ac_end=$ac_max_sed_lines # Line after last line for current file.
+  ac_more_lines=:
+  ac_sed_cmds=
+  while $ac_more_lines; do
+    if test $ac_beg -gt 1; then
+      sed "1,${ac_beg}d; ${ac_end}q" $tmp/subs.sed >$tmp/subs.frag
+    else
+      sed "${ac_end}q" $tmp/subs.sed >$tmp/subs.frag
+    fi
+    if test ! -s $tmp/subs.frag; then
+      ac_more_lines=false
+    else
+      # The purpose of the label and of the branching condition is to
+      # speed up the sed processing (if there are no `@' at all, there
+      # is no need to browse any of the substitutions).
+      # These are the two extra sed commands mentioned above.
+      (echo ':t
+  /@[a-zA-Z_][a-zA-Z_0-9]*@/!b' && cat $tmp/subs.frag) >$tmp/subs-$ac_sed_frag.sed
+      if test -z "$ac_sed_cmds"; then
+  	ac_sed_cmds="sed -f $tmp/subs-$ac_sed_frag.sed"
+      else
+  	ac_sed_cmds="$ac_sed_cmds | sed -f $tmp/subs-$ac_sed_frag.sed"
+      fi
+      ac_sed_frag=`expr $ac_sed_frag + 1`
+      ac_beg=$ac_end
+      ac_end=`expr $ac_end + $ac_max_sed_lines`
+    fi
+  done
+  if test -z "$ac_sed_cmds"; then
+    ac_sed_cmds=cat
+  fi
+fi # test -n "$CONFIG_FILES"
+
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF
+for ac_file in : $CONFIG_FILES; do test "x$ac_file" = x: && continue
+  # Support "outfile[:infile[:infile...]]", defaulting infile="outfile.in".
+  case $ac_file in
+  - | *:- | *:-:* ) # input from stdin
+        cat >$tmp/stdin
+        ac_file_in=`echo "$ac_file" | sed 's,[^:]*:,,'`
+        ac_file=`echo "$ac_file" | sed 's,:.*,,'` ;;
+  *:* ) ac_file_in=`echo "$ac_file" | sed 's,[^:]*:,,'`
+        ac_file=`echo "$ac_file" | sed 's,:.*,,'` ;;
+  * )   ac_file_in=$ac_file.in ;;
+  esac
+
+  # Compute @srcdir@, @top_srcdir@, and @INSTALL@ for subdirectories.
+  ac_dir=`(dirname "$ac_file") 2>/dev/null ||
+$as_expr X"$ac_file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+         X"$ac_file" : 'X\(//\)[^/]' \| \
+         X"$ac_file" : 'X\(//\)$' \| \
+         X"$ac_file" : 'X\(/\)' \| \
+         .     : '\(.\)' 2>/dev/null ||
+echo X"$ac_file" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ s//\1/; q; }
+  	  /^X\(\/\/\)[^/].*/{ s//\1/; q; }
+  	  /^X\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`
+  { if $as_mkdir_p; then
+    mkdir -p "$ac_dir"
+  else
+    as_dir="$ac_dir"
+    as_dirs=
+    while test ! -d "$as_dir"; do
+      as_dirs="$as_dir $as_dirs"
+      as_dir=`(dirname "$as_dir") 2>/dev/null ||
+$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+         X"$as_dir" : 'X\(//\)[^/]' \| \
+         X"$as_dir" : 'X\(//\)$' \| \
+         X"$as_dir" : 'X\(/\)' \| \
+         .     : '\(.\)' 2>/dev/null ||
+echo X"$as_dir" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ s//\1/; q; }
+  	  /^X\(\/\/\)[^/].*/{ s//\1/; q; }
+  	  /^X\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`
+    done
+    test ! -n "$as_dirs" || mkdir $as_dirs
+  fi || { { echo "$as_me:$LINENO: error: cannot create directory \"$ac_dir\"" >&5
+echo "$as_me: error: cannot create directory \"$ac_dir\"" >&2;}
+   { (exit 1); exit 1; }; }; }
+
+  ac_builddir=.
+
+if test "$ac_dir" != .; then
+  ac_dir_suffix=/`echo "$ac_dir" | sed 's,^\.[\\/],,'`
+  # A "../" for each directory in $ac_dir_suffix.
+  ac_top_builddir=`echo "$ac_dir_suffix" | sed 's,/[^\\/]*,../,g'`
+else
+  ac_dir_suffix= ac_top_builddir=
+fi
+
+case $srcdir in
+  .)  # No --srcdir option.  We are building in place.
+    ac_srcdir=.
+    if test -z "$ac_top_builddir"; then
+       ac_top_srcdir=.
+    else
+       ac_top_srcdir=`echo $ac_top_builddir | sed 's,/$,,'`
+    fi ;;
+  [\\/]* | ?:[\\/]* )  # Absolute path.
+    ac_srcdir=$srcdir$ac_dir_suffix;
+    ac_top_srcdir=$srcdir ;;
+  *) # Relative path.
+    ac_srcdir=$ac_top_builddir$srcdir$ac_dir_suffix
+    ac_top_srcdir=$ac_top_builddir$srcdir ;;
+esac
+# Don't blindly perform a `cd "$ac_dir"/$ac_foo && pwd` since $ac_foo can be
+# absolute.
+ac_abs_builddir=`cd "$ac_dir" && cd $ac_builddir && pwd`
+ac_abs_top_builddir=`cd "$ac_dir" && cd ${ac_top_builddir}. && pwd`
+ac_abs_srcdir=`cd "$ac_dir" && cd $ac_srcdir && pwd`
+ac_abs_top_srcdir=`cd "$ac_dir" && cd $ac_top_srcdir && pwd`
+
+
+  case $INSTALL in
+  [\\/$]* | ?:[\\/]* ) ac_INSTALL=$INSTALL ;;
+  *) ac_INSTALL=$ac_top_builddir$INSTALL ;;
+  esac
+
+  if test x"$ac_file" != x-; then
+    { echo "$as_me:$LINENO: creating $ac_file" >&5
+echo "$as_me: creating $ac_file" >&6;}
+    rm -f "$ac_file"
+  fi
+  # Let's still pretend it is `configure' which instantiates (i.e., don't
+  # use $as_me), people would be surprised to read:
+  #    /* config.h.  Generated by config.status.  */
+  if test x"$ac_file" = x-; then
+    configure_input=
+  else
+    configure_input="$ac_file.  "
+  fi
+  configure_input=$configure_input"Generated from `echo $ac_file_in |
+                                     sed 's,.*/,,'` by configure."
+
+  # First look for the input files in the build tree, otherwise in the
+  # src tree.
+  ac_file_inputs=`IFS=:
+    for f in $ac_file_in; do
+      case $f in
+      -) echo $tmp/stdin ;;
+      [\\/$]*)
+         # Absolute (can't be DOS-style, as IFS=:)
+         test -f "$f" || { { echo "$as_me:$LINENO: error: cannot find input file: $f" >&5
+echo "$as_me: error: cannot find input file: $f" >&2;}
+   { (exit 1); exit 1; }; }
+         echo $f;;
+      *) # Relative
+         if test -f "$f"; then
+           # Build tree
+           echo $f
+         elif test -f "$srcdir/$f"; then
+           # Source tree
+           echo $srcdir/$f
+         else
+           # /dev/null tree
+           { { echo "$as_me:$LINENO: error: cannot find input file: $f" >&5
+echo "$as_me: error: cannot find input file: $f" >&2;}
+   { (exit 1); exit 1; }; }
+         fi;;
+      esac
+    done` || { (exit 1); exit 1; }
+_ACEOF
+cat >>$CONFIG_STATUS <<_ACEOF
+  sed "$ac_vpsub
+$extrasub
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF
+:t
+/@[a-zA-Z_][a-zA-Z_0-9]*@/!b
+s, at configure_input@,$configure_input,;t t
+s, at srcdir@,$ac_srcdir,;t t
+s, at abs_srcdir@,$ac_abs_srcdir,;t t
+s, at top_srcdir@,$ac_top_srcdir,;t t
+s, at abs_top_srcdir@,$ac_abs_top_srcdir,;t t
+s, at builddir@,$ac_builddir,;t t
+s, at abs_builddir@,$ac_abs_builddir,;t t
+s, at top_builddir@,$ac_top_builddir,;t t
+s, at abs_top_builddir@,$ac_abs_top_builddir,;t t
+s, at INSTALL@,$ac_INSTALL,;t t
+" $ac_file_inputs | (eval "$ac_sed_cmds") >$tmp/out
+  rm -f $tmp/stdin
+  if test x"$ac_file" != x-; then
+    mv $tmp/out $ac_file
+  else
+    cat $tmp/out
+    rm -f $tmp/out
+  fi
+
+done
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF
+
+#
+# CONFIG_HEADER section.
+#
+
+# These sed commands are passed to sed as "A NAME B NAME C VALUE D", where
+# NAME is the cpp macro being defined and VALUE is the value it is being given.
+#
+# ac_d sets the value in "#define NAME VALUE" lines.
+ac_dA='s,^\([ 	]*\)#\([ 	]*define[ 	][ 	]*\)'
+ac_dB='[ 	].*$,\1#\2'
+ac_dC=' '
+ac_dD=',;t'
+# ac_u turns "#undef NAME" without trailing blanks into "#define NAME VALUE".
+ac_uA='s,^\([ 	]*\)#\([ 	]*\)undef\([ 	][ 	]*\)'
+ac_uB='$,\1#\2define\3'
+ac_uC=' '
+ac_uD=',;t'
+
+for ac_file in : $CONFIG_HEADERS; do test "x$ac_file" = x: && continue
+  # Support "outfile[:infile[:infile...]]", defaulting infile="outfile.in".
+  case $ac_file in
+  - | *:- | *:-:* ) # input from stdin
+        cat >$tmp/stdin
+        ac_file_in=`echo "$ac_file" | sed 's,[^:]*:,,'`
+        ac_file=`echo "$ac_file" | sed 's,:.*,,'` ;;
+  *:* ) ac_file_in=`echo "$ac_file" | sed 's,[^:]*:,,'`
+        ac_file=`echo "$ac_file" | sed 's,:.*,,'` ;;
+  * )   ac_file_in=$ac_file.in ;;
+  esac
+
+  test x"$ac_file" != x- && { echo "$as_me:$LINENO: creating $ac_file" >&5
+echo "$as_me: creating $ac_file" >&6;}
+
+  # First look for the input files in the build tree, otherwise in the
+  # src tree.
+  ac_file_inputs=`IFS=:
+    for f in $ac_file_in; do
+      case $f in
+      -) echo $tmp/stdin ;;
+      [\\/$]*)
+         # Absolute (can't be DOS-style, as IFS=:)
+         test -f "$f" || { { echo "$as_me:$LINENO: error: cannot find input file: $f" >&5
+echo "$as_me: error: cannot find input file: $f" >&2;}
+   { (exit 1); exit 1; }; }
+         echo $f;;
+      *) # Relative
+         if test -f "$f"; then
+           # Build tree
+           echo $f
+         elif test -f "$srcdir/$f"; then
+           # Source tree
+           echo $srcdir/$f
+         else
+           # /dev/null tree
+           { { echo "$as_me:$LINENO: error: cannot find input file: $f" >&5
+echo "$as_me: error: cannot find input file: $f" >&2;}
+   { (exit 1); exit 1; }; }
+         fi;;
+      esac
+    done` || { (exit 1); exit 1; }
+  # Remove the trailing spaces.
+  sed 's/[ 	]*$//' $ac_file_inputs >$tmp/in
+
+_ACEOF
+
+# Transform confdefs.h into two sed scripts, `conftest.defines' and
+# `conftest.undefs', that substitutes the proper values into
+# config.h.in to produce config.h.  The first handles `#define'
+# templates, and the second `#undef' templates.
+# And first: Protect against being on the right side of a sed subst in
+# config.status.  Protect against being in an unquoted here document
+# in config.status.
+rm -f conftest.defines conftest.undefs
+# Using a here document instead of a string reduces the quoting nightmare.
+# Putting comments in sed scripts is not portable.
+#
+# `end' is used to avoid that the second main sed command (meant for
+# 0-ary CPP macros) applies to n-ary macro definitions.
+# See the Autoconf documentation for `clear'.
+cat >confdef2sed.sed <<\_ACEOF
+s/[\\&,]/\\&/g
+s,[\\$`],\\&,g
+t clear
+: clear
+s,^[ 	]*#[ 	]*define[ 	][ 	]*\([^ 	(][^ 	(]*\)\(([^)]*)\)[ 	]*\(.*\)$,${ac_dA}\1${ac_dB}\1\2${ac_dC}\3${ac_dD},gp
+t end
+s,^[ 	]*#[ 	]*define[ 	][ 	]*\([^ 	][^ 	]*\)[ 	]*\(.*\)$,${ac_dA}\1${ac_dB}\1${ac_dC}\2${ac_dD},gp
+: end
+_ACEOF
+# If some macros were called several times there might be several times
+# the same #defines, which is useless.  Nevertheless, we may not want to
+# sort them, since we want the *last* AC-DEFINE to be honored.
+uniq confdefs.h | sed -n -f confdef2sed.sed >conftest.defines
+sed 's/ac_d/ac_u/g' conftest.defines >conftest.undefs
+rm -f confdef2sed.sed
+
+# This sed command replaces #undef with comments.  This is necessary, for
+# example, in the case of _POSIX_SOURCE, which is predefined and required
+# on some systems where configure will not decide to define it.
+cat >>conftest.undefs <<\_ACEOF
+s,^[ 	]*#[ 	]*undef[ 	][ 	]*[a-zA-Z_][a-zA-Z_0-9]*,/* & */,
+_ACEOF
+
+# Break up conftest.defines because some shells have a limit on the size
+# of here documents, and old seds have small limits too (100 cmds).
+echo '  # Handle all the #define templates only if necessary.' >>$CONFIG_STATUS
+echo '  if grep "^[ 	]*#[ 	]*define" $tmp/in >/dev/null; then' >>$CONFIG_STATUS
+echo '  # If there are no defines, we may have an empty if/fi' >>$CONFIG_STATUS
+echo '  :' >>$CONFIG_STATUS
+rm -f conftest.tail
+while grep . conftest.defines >/dev/null
+do
+  # Write a limited-size here document to $tmp/defines.sed.
+  echo '  cat >$tmp/defines.sed <<CEOF' >>$CONFIG_STATUS
+  # Speed up: don't consider the non `#define' lines.
+  echo '/^[ 	]*#[ 	]*define/!b' >>$CONFIG_STATUS
+  # Work around the forget-to-reset-the-flag bug.
+  echo 't clr' >>$CONFIG_STATUS
+  echo ': clr' >>$CONFIG_STATUS
+  sed ${ac_max_here_lines}q conftest.defines >>$CONFIG_STATUS
+  echo 'CEOF
+  sed -f $tmp/defines.sed $tmp/in >$tmp/out
+  rm -f $tmp/in
+  mv $tmp/out $tmp/in
+' >>$CONFIG_STATUS
+  sed 1,${ac_max_here_lines}d conftest.defines >conftest.tail
+  rm -f conftest.defines
+  mv conftest.tail conftest.defines
+done
+rm -f conftest.defines
+echo '  fi # grep' >>$CONFIG_STATUS
+echo >>$CONFIG_STATUS
+
+# Break up conftest.undefs because some shells have a limit on the size
+# of here documents, and old seds have small limits too (100 cmds).
+echo '  # Handle all the #undef templates' >>$CONFIG_STATUS
+rm -f conftest.tail
+while grep . conftest.undefs >/dev/null
+do
+  # Write a limited-size here document to $tmp/undefs.sed.
+  echo '  cat >$tmp/undefs.sed <<CEOF' >>$CONFIG_STATUS
+  # Speed up: don't consider the non `#undef'
+  echo '/^[ 	]*#[ 	]*undef/!b' >>$CONFIG_STATUS
+  # Work around the forget-to-reset-the-flag bug.
+  echo 't clr' >>$CONFIG_STATUS
+  echo ': clr' >>$CONFIG_STATUS
+  sed ${ac_max_here_lines}q conftest.undefs >>$CONFIG_STATUS
+  echo 'CEOF
+  sed -f $tmp/undefs.sed $tmp/in >$tmp/out
+  rm -f $tmp/in
+  mv $tmp/out $tmp/in
+' >>$CONFIG_STATUS
+  sed 1,${ac_max_here_lines}d conftest.undefs >conftest.tail
+  rm -f conftest.undefs
+  mv conftest.tail conftest.undefs
+done
+rm -f conftest.undefs
+
+cat >>$CONFIG_STATUS <<\_ACEOF
+  # Let's still pretend it is `configure' which instantiates (i.e., don't
+  # use $as_me), people would be surprised to read:
+  #    /* config.h.  Generated by config.status.  */
+  if test x"$ac_file" = x-; then
+    echo "/* Generated by configure.  */" >$tmp/config.h
+  else
+    echo "/* $ac_file.  Generated by configure.  */" >$tmp/config.h
+  fi
+  cat $tmp/in >>$tmp/config.h
+  rm -f $tmp/in
+  if test x"$ac_file" != x-; then
+    if diff $ac_file $tmp/config.h >/dev/null 2>&1; then
+      { echo "$as_me:$LINENO: $ac_file is unchanged" >&5
+echo "$as_me: $ac_file is unchanged" >&6;}
+    else
+      ac_dir=`(dirname "$ac_file") 2>/dev/null ||
+$as_expr X"$ac_file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+         X"$ac_file" : 'X\(//\)[^/]' \| \
+         X"$ac_file" : 'X\(//\)$' \| \
+         X"$ac_file" : 'X\(/\)' \| \
+         .     : '\(.\)' 2>/dev/null ||
+echo X"$ac_file" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ s//\1/; q; }
+  	  /^X\(\/\/\)[^/].*/{ s//\1/; q; }
+  	  /^X\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`
+      { if $as_mkdir_p; then
+    mkdir -p "$ac_dir"
+  else
+    as_dir="$ac_dir"
+    as_dirs=
+    while test ! -d "$as_dir"; do
+      as_dirs="$as_dir $as_dirs"
+      as_dir=`(dirname "$as_dir") 2>/dev/null ||
+$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+         X"$as_dir" : 'X\(//\)[^/]' \| \
+         X"$as_dir" : 'X\(//\)$' \| \
+         X"$as_dir" : 'X\(/\)' \| \
+         .     : '\(.\)' 2>/dev/null ||
+echo X"$as_dir" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ s//\1/; q; }
+  	  /^X\(\/\/\)[^/].*/{ s//\1/; q; }
+  	  /^X\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`
+    done
+    test ! -n "$as_dirs" || mkdir $as_dirs
+  fi || { { echo "$as_me:$LINENO: error: cannot create directory \"$ac_dir\"" >&5
+echo "$as_me: error: cannot create directory \"$ac_dir\"" >&2;}
+   { (exit 1); exit 1; }; }; }
+
+      rm -f $ac_file
+      mv $tmp/config.h $ac_file
+    fi
+  else
+    cat $tmp/config.h
+    rm -f $tmp/config.h
+  fi
+# Compute $ac_file's index in $config_headers.
+_am_stamp_count=1
+for _am_header in $config_headers :; do
+  case $_am_header in
+    $ac_file | $ac_file:* )
+      break ;;
+    * )
+      _am_stamp_count=`expr $_am_stamp_count + 1` ;;
+  esac
+done
+echo "timestamp for $ac_file" >`(dirname $ac_file) 2>/dev/null ||
+$as_expr X$ac_file : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+         X$ac_file : 'X\(//\)[^/]' \| \
+         X$ac_file : 'X\(//\)$' \| \
+         X$ac_file : 'X\(/\)' \| \
+         .     : '\(.\)' 2>/dev/null ||
+echo X$ac_file |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ s//\1/; q; }
+  	  /^X\(\/\/\)[^/].*/{ s//\1/; q; }
+  	  /^X\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`/stamp-h$_am_stamp_count
+done
+_ACEOF
+cat >>$CONFIG_STATUS <<\_ACEOF
+
+#
+# CONFIG_COMMANDS section.
+#
+for ac_file in : $CONFIG_COMMANDS; do test "x$ac_file" = x: && continue
+  ac_dest=`echo "$ac_file" | sed 's,:.*,,'`
+  ac_source=`echo "$ac_file" | sed 's,[^:]*:,,'`
+  ac_dir=`(dirname "$ac_dest") 2>/dev/null ||
+$as_expr X"$ac_dest" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+         X"$ac_dest" : 'X\(//\)[^/]' \| \
+         X"$ac_dest" : 'X\(//\)$' \| \
+         X"$ac_dest" : 'X\(/\)' \| \
+         .     : '\(.\)' 2>/dev/null ||
+echo X"$ac_dest" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ s//\1/; q; }
+  	  /^X\(\/\/\)[^/].*/{ s//\1/; q; }
+  	  /^X\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`
+  ac_builddir=.
+
+if test "$ac_dir" != .; then
+  ac_dir_suffix=/`echo "$ac_dir" | sed 's,^\.[\\/],,'`
+  # A "../" for each directory in $ac_dir_suffix.
+  ac_top_builddir=`echo "$ac_dir_suffix" | sed 's,/[^\\/]*,../,g'`
+else
+  ac_dir_suffix= ac_top_builddir=
+fi
+
+case $srcdir in
+  .)  # No --srcdir option.  We are building in place.
+    ac_srcdir=.
+    if test -z "$ac_top_builddir"; then
+       ac_top_srcdir=.
+    else
+       ac_top_srcdir=`echo $ac_top_builddir | sed 's,/$,,'`
+    fi ;;
+  [\\/]* | ?:[\\/]* )  # Absolute path.
+    ac_srcdir=$srcdir$ac_dir_suffix;
+    ac_top_srcdir=$srcdir ;;
+  *) # Relative path.
+    ac_srcdir=$ac_top_builddir$srcdir$ac_dir_suffix
+    ac_top_srcdir=$ac_top_builddir$srcdir ;;
+esac
+# Don't blindly perform a `cd "$ac_dir"/$ac_foo && pwd` since $ac_foo can be
+# absolute.
+ac_abs_builddir=`cd "$ac_dir" && cd $ac_builddir && pwd`
+ac_abs_top_builddir=`cd "$ac_dir" && cd ${ac_top_builddir}. && pwd`
+ac_abs_srcdir=`cd "$ac_dir" && cd $ac_srcdir && pwd`
+ac_abs_top_srcdir=`cd "$ac_dir" && cd $ac_top_srcdir && pwd`
+
+
+  { echo "$as_me:$LINENO: executing $ac_dest commands" >&5
+echo "$as_me: executing $ac_dest commands" >&6;}
+  case $ac_dest in
+    depfiles ) test x"$AMDEP_TRUE" != x"" || for mf in $CONFIG_FILES; do
+  # Strip MF so we end up with the name of the file.
+  mf=`echo "$mf" | sed -e 's/:.*$//'`
+  # Check whether this is an Automake generated Makefile or not.
+  # We used to match only the files named `Makefile.in', but
+  # some people rename them; so instead we look at the file content.
+  # Grep'ing the first line is not enough: some people post-process
+  # each Makefile.in and add a new line on top of each file to say so.
+  # So let's grep whole file.
+  if grep '^#.*generated by automake' $mf > /dev/null 2>&1; then
+    dirpart=`(dirname "$mf") 2>/dev/null ||
+$as_expr X"$mf" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+         X"$mf" : 'X\(//\)[^/]' \| \
+         X"$mf" : 'X\(//\)$' \| \
+         X"$mf" : 'X\(/\)' \| \
+         .     : '\(.\)' 2>/dev/null ||
+echo X"$mf" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ s//\1/; q; }
+  	  /^X\(\/\/\)[^/].*/{ s//\1/; q; }
+  	  /^X\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`
+  else
+    continue
+  fi
+  grep '^DEP_FILES *= *[^ #]' < "$mf" > /dev/null || continue
+  # Extract the definition of DEP_FILES from the Makefile without
+  # running `make'.
+  DEPDIR=`sed -n -e '/^DEPDIR = / s///p' < "$mf"`
+  test -z "$DEPDIR" && continue
+  # When using ansi2knr, U may be empty or an underscore; expand it
+  U=`sed -n -e '/^U = / s///p' < "$mf"`
+  test -d "$dirpart/$DEPDIR" || mkdir "$dirpart/$DEPDIR"
+  # We invoke sed twice because it is the simplest approach to
+  # changing $(DEPDIR) to its actual value in the expansion.
+  for file in `sed -n -e '
+    /^DEP_FILES = .*\\\\$/ {
+      s/^DEP_FILES = //
+      :loop
+	s/\\\\$//
+	p
+	n
+	/\\\\$/ b loop
+      p
+    }
+    /^DEP_FILES = / s/^DEP_FILES = //p' < "$mf" | \
+       sed -e 's/\$(DEPDIR)/'"$DEPDIR"'/g' -e 's/\$U/'"$U"'/g'`; do
+    # Make sure the directory exists.
+    test -f "$dirpart/$file" && continue
+    fdir=`(dirname "$file") 2>/dev/null ||
+$as_expr X"$file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+         X"$file" : 'X\(//\)[^/]' \| \
+         X"$file" : 'X\(//\)$' \| \
+         X"$file" : 'X\(/\)' \| \
+         .     : '\(.\)' 2>/dev/null ||
+echo X"$file" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ s//\1/; q; }
+  	  /^X\(\/\/\)[^/].*/{ s//\1/; q; }
+  	  /^X\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`
+    { if $as_mkdir_p; then
+    mkdir -p $dirpart/$fdir
+  else
+    as_dir=$dirpart/$fdir
+    as_dirs=
+    while test ! -d "$as_dir"; do
+      as_dirs="$as_dir $as_dirs"
+      as_dir=`(dirname "$as_dir") 2>/dev/null ||
+$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
+         X"$as_dir" : 'X\(//\)[^/]' \| \
+         X"$as_dir" : 'X\(//\)$' \| \
+         X"$as_dir" : 'X\(/\)' \| \
+         .     : '\(.\)' 2>/dev/null ||
+echo X"$as_dir" |
+    sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{ s//\1/; q; }
+  	  /^X\(\/\/\)[^/].*/{ s//\1/; q; }
+  	  /^X\(\/\/\)$/{ s//\1/; q; }
+  	  /^X\(\/\).*/{ s//\1/; q; }
+  	  s/.*/./; q'`
+    done
+    test ! -n "$as_dirs" || mkdir $as_dirs
+  fi || { { echo "$as_me:$LINENO: error: cannot create directory $dirpart/$fdir" >&5
+echo "$as_me: error: cannot create directory $dirpart/$fdir" >&2;}
+   { (exit 1); exit 1; }; }; }
+
+    # echo "creating $dirpart/$file"
+    echo '# dummy' > "$dirpart/$file"
+  done
+done
+ ;;
+  esac
+done
+_ACEOF
+
+cat >>$CONFIG_STATUS <<\_ACEOF
+
+{ (exit 0); exit 0; }
+_ACEOF
+chmod +x $CONFIG_STATUS
+ac_clean_files=$ac_clean_files_save
+
+
+# configure is writing to config.log, and then calls config.status.
+# config.status does its own redirection, appending to config.log.
+# Unfortunately, on DOS this fails, as config.log is still kept open
+# by configure, so config.status won't be able to write to it; its
+# output is simply discarded.  So we exec the FD to /dev/null,
+# effectively closing config.log, so it can be properly (re)opened and
+# appended to by config.status.  When coming back to configure, we
+# need to make the FD available again.
+if test "$no_create" != yes; then
+  ac_cs_success=:
+  ac_config_status_args=
+  test "$silent" = yes &&
+    ac_config_status_args="$ac_config_status_args --quiet"
+  exec 5>/dev/null
+  $SHELL $CONFIG_STATUS $ac_config_status_args || ac_cs_success=false
+  exec 5>>config.log
+  # Use ||, not &&, to avoid exiting from the if with $? = 1, which
+  # would make configure fail if this is the last instruction.
+  $ac_cs_success || { (exit 1); exit 1; }
+fi
+
+
+
Property changes on: trunk/packages/rnahybrid/branches/upstream/current/configure
___________________________________________________________________
Name: svn:executable
   + 
Added: trunk/packages/rnahybrid/branches/upstream/current/configure.in
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/configure.in	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/configure.in	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,36 @@
+dnl Process this file with autoconf to produce a configure script.
+AC_REVISION($Revision: 1.0 $)
+AC_INIT(RNAhybrid,1.0,marc at techfak.uni-bielefeld.de,RNAhybrid)
+AC_PREREQ(2.53)
+AM_INIT_AUTOMAKE
+
+dnl create a config.h file (Automake will add -DHAVE_CONFIG_H)
+AM_CONFIG_HEADER(config.h)
+
+dnl Checks for programs.
+dnl AC_PROG_CXX
+AC_PROG_CC
+AC_LANG(C)
+
+dnl Checks for libraries.
+AC_CHECK_LIB(m,log,,AC_MSG_ERROR(math library is missing))
+AC_CHECK_LIB(g2,g2_open_vd,,AC_MSG_WARN(libg2.a is missing. You can download it at http://g2.sourceforge.net/))
+AC_CHECK_LIB(gd,gdImageLine,,)
+
+dnl Checks for header files.
+AC_HEADER_STDC
+AC_CHECK_HEADER(g2.h,,)
+AC_CHECK_HEADER(g2_PS.h,,)
+
+dnl Checks for typedefs, structures, and compiler characteristics.
+AC_C_CONST
+AC_C_INLINE
+AC_TYPE_SIZE_T
+
+dnl AC_SUBST(CXX)
+
+dnl Checks for library functions.
+
+AC_OUTPUT(Makefile src/Makefile man/Makefile)
+
+
Added: trunk/packages/rnahybrid/branches/upstream/current/depcomp
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/depcomp	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/depcomp	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,464 @@
+#! /bin/sh
+
+# depcomp - compile a program generating dependencies as side-effects
+# Copyright 1999, 2000 Free Software Foundation, Inc.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+# Originally written by Alexandre Oliva <oliva at dcc.unicamp.br>.
+
+if test -z "$depmode" || test -z "$source" || test -z "$object"; then
+  echo "depcomp: Variables source, object and depmode must be set" 1>&2
+  exit 1
+fi
+# `libtool' can also be set to `yes' or `no'.
+
+if test -z "$depfile"; then
+   base=`echo "$object" | sed -e 's,^.*/,,' -e 's,\.\([^.]*\)$,.P\1,'`
+   dir=`echo "$object" | sed 's,/.*$,/,'`
+   if test "$dir" = "$object"; then
+      dir=
+   fi
+   # FIXME: should be _deps on DOS.
+   depfile="$dir.deps/$base"
+fi
+
+tmpdepfile=${tmpdepfile-`echo "$depfile" | sed 's/\.\([^.]*\)$/.T\1/'`}
+
+rm -f "$tmpdepfile"
+
+# Some modes work just like other modes, but use different flags.  We
+# parameterize here, but still list the modes in the big case below,
+# to make depend.m4 easier to write.  Note that we *cannot* use a case
+# here, because this file can only contain one case statement.
+if test "$depmode" = hp; then
+  # HP compiler uses -M and no extra arg.
+  gccflag=-M
+  depmode=gcc
+fi
+
+if test "$depmode" = dashXmstdout; then
+   # This is just like dashmstdout with a different argument.
+   dashmflag=-xM
+   depmode=dashmstdout
+fi
+
+case "$depmode" in
+gcc3)
+## gcc 3 implements dependency tracking that does exactly what
+## we want.  Yay!  Note: for some reason libtool 1.4 doesn't like
+## it if -MD -MP comes after the -MF stuff.  Hmm.
+  "$@" -MT "$object" -MD -MP -MF "$tmpdepfile"
+  stat=$?
+  if test $stat -eq 0; then :
+  else
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+  mv "$tmpdepfile" "$depfile"
+  ;;
+
+gcc)
+## There are various ways to get dependency output from gcc.  Here's
+## why we pick this rather obscure method:
+## - Don't want to use -MD because we'd like the dependencies to end
+##   up in a subdir.  Having to rename by hand is ugly.
+##   (We might end up doing this anyway to support other compilers.)
+## - The DEPENDENCIES_OUTPUT environment variable makes gcc act like
+##   -MM, not -M (despite what the docs say).
+## - Using -M directly means running the compiler twice (even worse
+##   than renaming).
+  if test -z "$gccflag"; then
+    gccflag=-MD,
+  fi
+  "$@" -Wp,"$gccflag$tmpdepfile"
+  stat=$?
+  if test $stat -eq 0; then :
+  else
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+  rm -f "$depfile"
+  echo "$object : \\" > "$depfile"
+  alpha=ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz
+## The second -e expression handles DOS-style file names with drive letters.
+  sed -e 's/^[^:]*: / /' \
+      -e 's/^['$alpha']:\/[^:]*: / /' < "$tmpdepfile" >> "$depfile"
+## This next piece of magic avoids the `deleted header file' problem.
+## The problem is that when a header file which appears in a .P file
+## is deleted, the dependency causes make to die (because there is
+## typically no way to rebuild the header).  We avoid this by adding
+## dummy dependencies for each header file.  Too bad gcc doesn't do
+## this for us directly.
+  tr ' ' '
+' < "$tmpdepfile" |
+## Some versions of gcc put a space before the `:'.  On the theory
+## that the space means something, we add a space to the output as
+## well.
+## Some versions of the HPUX 10.20 sed can't process this invocation
+## correctly.  Breaking it into two sed invocations is a workaround.
+    sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+hp)
+  # This case exists only to let depend.m4 do its work.  It works by
+  # looking at the text of this script.  This case will never be run,
+  # since it is checked for above.
+  exit 1
+  ;;
+
+sgi)
+  if test "$libtool" = yes; then
+    "$@" "-Wp,-MDupdate,$tmpdepfile"
+  else
+    "$@" -MDupdate "$tmpdepfile"
+  fi
+  stat=$?
+  if test $stat -eq 0; then :
+  else
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+  rm -f "$depfile"
+
+  if test -f "$tmpdepfile"; then  # yes, the sourcefile depend on other files
+    echo "$object : \\" > "$depfile"
+
+    # Clip off the initial element (the dependent).  Don't try to be
+    # clever and replace this with sed code, as IRIX sed won't handle
+    # lines with more than a fixed number of characters (4096 in
+    # IRIX 6.2 sed, 8192 in IRIX 6.5).  We also remove comment lines;
+    # the IRIX cc adds comments like `#:fec' to the end of the
+    # dependency line.
+    tr ' ' '
+' < "$tmpdepfile" \
+    | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' | \
+    tr '
+' ' ' >> $depfile
+    echo >> $depfile
+
+    # The second pass generates a dummy entry for each header file.
+    tr ' ' '
+' < "$tmpdepfile" \
+   | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' -e 's/$/:/' \
+   >> $depfile
+  else
+    # The sourcefile does not contain any dependencies, so just
+    # store a dummy comment line, to avoid errors with the Makefile
+    # "include basename.Plo" scheme.
+    echo "#dummy" > "$depfile"
+  fi
+  rm -f "$tmpdepfile"
+  ;;
+
+aix)
+  # The C for AIX Compiler uses -M and outputs the dependencies
+  # in a .u file.  This file always lives in the current directory.
+  # Also, the AIX compiler puts `$object:' at the start of each line;
+  # $object doesn't have directory information.
+  stripped=`echo "$object" | sed -e 's,^.*/,,' -e 's/\(.*\)\..*$/\1/'`
+  tmpdepfile="$stripped.u"
+  outname="$stripped.o"
+  if test "$libtool" = yes; then
+    "$@" -Wc,-M
+  else
+    "$@" -M
+  fi
+
+  stat=$?
+  if test $stat -eq 0; then :
+  else
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+
+  if test -f "$tmpdepfile"; then
+    # Each line is of the form `foo.o: dependent.h'.
+    # Do two passes, one to just change these to
+    # `$object: dependent.h' and one to simply `dependent.h:'.
+    sed -e "s,^$outname:,$object :," < "$tmpdepfile" > "$depfile"
+    sed -e "s,^$outname: \(.*\)$,\1:," < "$tmpdepfile" >> "$depfile"
+  else
+    # The sourcefile does not contain any dependencies, so just
+    # store a dummy comment line, to avoid errors with the Makefile
+    # "include basename.Plo" scheme.
+    echo "#dummy" > "$depfile"
+  fi
+  rm -f "$tmpdepfile"
+  ;;
+
+icc)
+  # Must come before tru64.
+
+  # Intel's C compiler understands `-MD -MF file'.  However
+  #    icc -MD -MF foo.d -c -o sub/foo.o sub/foo.c
+  # will fill foo.d with something like
+  #    foo.o: sub/foo.c
+  #    foo.o: sub/foo.h
+  # which is wrong.  We want:
+  #    sub/foo.o: sub/foo.c
+  #    sub/foo.o: sub/foo.h
+  #    sub/foo.c:
+  #    sub/foo.h:
+
+  "$@" -MD -MF "$tmpdepfile"
+  stat=$?
+  if test $stat -eq 0; then :
+  else
+    rm -f "$tmpdepfile"
+    exit $stat
+  fi
+  rm -f "$depfile"
+  # Each line is of the form `foo.o: dependent.h'.
+  # Do two passes, one to just change these to
+  # `$object: dependent.h' and one to simply `dependent.h:'.
+  sed -e "s,^[^:]*:,$object :," < "$tmpdepfile" > "$depfile"
+  sed -e "s,^[^:]*: \(.*\)$,\1:," < "$tmpdepfile" >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+tru64)
+   # The Tru64 compiler uses -MD to generate dependencies as a side
+   # effect.  `cc -MD -o foo.o ...' puts the dependencies into `foo.o.d'.
+   # At least on Alpha/Redhat 6.1, Compaq CCC V6.2-504 seems to put
+   # dependencies in `foo.d' instead, so we check for that too.
+   # Subdirectories are respected.
+   dir=`echo "$object" | sed -e 's|/[^/]*$|/|'`
+   test "x$dir" = "x$object" && dir=
+   base=`echo "$object" | sed -e 's|^.*/||' -e 's/\.o$//' -e 's/\.lo$//'`
+
+   if test "$libtool" = yes; then
+      tmpdepfile1="$dir.libs/$base.lo.d"
+      tmpdepfile2="$dir.libs/$base.d"
+      "$@" -Wc,-MD
+   else
+      tmpdepfile1="$dir$base.o.d"
+      tmpdepfile2="$dir$base.d"
+      "$@" -MD
+   fi
+
+   stat=$?
+   if test $stat -eq 0; then :
+   else
+      rm -f "$tmpdepfile1" "$tmpdepfile2"
+      exit $stat
+   fi
+
+   if test -f "$tmpdepfile1"; then
+      tmpdepfile="$tmpdepfile1"
+   else
+      tmpdepfile="$tmpdepfile2"
+   fi
+   if test -f "$tmpdepfile"; then
+      sed -e "s,^.*\.[a-z]*:,$object:," < "$tmpdepfile" > "$depfile"
+      # That's a space and a tab in the [].
+      sed -e 's,^.*\.[a-z]*:[ 	]*,,' -e 's,$,:,' < "$tmpdepfile" >> "$depfile"
+   else
+      echo "#dummy" > "$depfile"
+   fi
+   rm -f "$tmpdepfile"
+   ;;
+
+#nosideeffect)
+  # This comment above is used by automake to tell side-effect
+  # dependency tracking mechanisms from slower ones.
+
+dashmstdout)
+  # Important note: in order to support this mode, a compiler *must*
+  # always write the proprocessed file to stdout, regardless of -o.
+  "$@" || exit $?
+
+  # Remove the call to Libtool.
+  if test "$libtool" = yes; then
+    while test $1 != '--mode=compile'; do
+      shift
+    done
+    shift
+  fi
+
+  # Remove `-o $object'.
+  IFS=" "
+  for arg
+  do
+    case $arg in
+    -o)
+      shift
+      ;;
+    $object)
+      shift
+      ;;
+    *)
+      set fnord "$@" "$arg"
+      shift # fnord
+      shift # $arg
+      ;;
+    esac
+  done
+
+  test -z "$dashmflag" && dashmflag=-M
+  # Require at least two characters before searching for `:'
+  # in the target name.  This is to cope with DOS-style filenames:
+  # a dependency such as `c:/foo/bar' could be seen as target `c' otherwise.
+  "$@" $dashmflag |
+    sed 's:^[  ]*[^: ][^:][^:]*\:[    ]*:'"$object"'\: :' > "$tmpdepfile"
+  rm -f "$depfile"
+  cat < "$tmpdepfile" > "$depfile"
+  tr ' ' '
+' < "$tmpdepfile" | \
+## Some versions of the HPUX 10.20 sed can't process this invocation
+## correctly.  Breaking it into two sed invocations is a workaround.
+    sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+dashXmstdout)
+  # This case only exists to satisfy depend.m4.  It is never actually
+  # run, as this mode is specially recognized in the preamble.
+  exit 1
+  ;;
+
+makedepend)
+  "$@" || exit $?
+  # Remove any Libtool call
+  if test "$libtool" = yes; then
+    while test $1 != '--mode=compile'; do
+      shift
+    done
+    shift
+  fi
+  # X makedepend
+  shift
+  cleared=no
+  for arg in "$@"; do
+    case $cleared in
+    no)
+      set ""; shift
+      cleared=yes ;;
+    esac
+    case "$arg" in
+    -D*|-I*)
+      set fnord "$@" "$arg"; shift ;;
+    # Strip any option that makedepend may not understand.  Remove
+    # the object too, otherwise makedepend will parse it as a source file.
+    -*|$object)
+      ;;
+    *)
+      set fnord "$@" "$arg"; shift ;;
+    esac
+  done
+  obj_suffix="`echo $object | sed 's/^.*\././'`"
+  touch "$tmpdepfile"
+  ${MAKEDEPEND-makedepend} -o"$obj_suffix" -f"$tmpdepfile" "$@"
+  rm -f "$depfile"
+  cat < "$tmpdepfile" > "$depfile"
+  sed '1,2d' "$tmpdepfile" | tr ' ' '
+' | \
+## Some versions of the HPUX 10.20 sed can't process this invocation
+## correctly.  Breaking it into two sed invocations is a workaround.
+    sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' | sed -e 's/$/ :/' >> "$depfile"
+  rm -f "$tmpdepfile" "$tmpdepfile".bak
+  ;;
+
+cpp)
+  # Important note: in order to support this mode, a compiler *must*
+  # always write the proprocessed file to stdout.
+  "$@" || exit $?
+
+  # Remove the call to Libtool.
+  if test "$libtool" = yes; then
+    while test $1 != '--mode=compile'; do
+      shift
+    done
+    shift
+  fi
+
+  # Remove `-o $object'.
+  IFS=" "
+  for arg
+  do
+    case $arg in
+    -o)
+      shift
+      ;;
+    $object)
+      shift
+      ;;
+    *)
+      set fnord "$@" "$arg"
+      shift # fnord
+      shift # $arg
+      ;;
+    esac
+  done
+
+  "$@" -E |
+    sed -n '/^# [0-9][0-9]* "\([^"]*\)".*/ s:: \1 \\:p' |
+    sed '$ s: \\$::' > "$tmpdepfile"
+  rm -f "$depfile"
+  echo "$object : \\" > "$depfile"
+  cat < "$tmpdepfile" >> "$depfile"
+  sed < "$tmpdepfile" '/^$/d;s/^ //;s/ \\$//;s/$/ :/' >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+msvisualcpp)
+  # Important note: in order to support this mode, a compiler *must*
+  # always write the proprocessed file to stdout, regardless of -o,
+  # because we must use -o when running libtool.
+  "$@" || exit $?
+  IFS=" "
+  for arg
+  do
+    case "$arg" in
+    "-Gm"|"/Gm"|"-Gi"|"/Gi"|"-ZI"|"/ZI")
+	set fnord "$@"
+	shift
+	shift
+	;;
+    *)
+	set fnord "$@" "$arg"
+	shift
+	shift
+	;;
+    esac
+  done
+  "$@" -E |
+  sed -n '/^#line [0-9][0-9]* "\([^"]*\)"/ s::echo "`cygpath -u \\"\1\\"`":p' | sort | uniq > "$tmpdepfile"
+  rm -f "$depfile"
+  echo "$object : \\" > "$depfile"
+  . "$tmpdepfile" | sed 's% %\\ %g' | sed -n '/^\(.*\)$/ s::	\1 \\:p' >> "$depfile"
+  echo "	" >> "$depfile"
+  . "$tmpdepfile" | sed 's% %\\ %g' | sed -n '/^\(.*\)$/ s::\1\::p' >> "$depfile"
+  rm -f "$tmpdepfile"
+  ;;
+
+none)
+  exec "$@"
+  ;;
+
+*)
+  echo "Unknown depmode $depmode" 1>&2
+  exit 1
+  ;;
+esac
+
+exit 0
Property changes on: trunk/packages/rnahybrid/branches/upstream/current/depcomp
___________________________________________________________________
Name: svn:executable
   + 
Added: trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_fly.freq
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_fly.freq	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_fly.freq	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,17 @@
+# dinucleotide frequencies from D. melanogaster 3'UTRs
+AA: 0.108608
+AC: 0.0547065
+AG: 0.0544599
+AT: 0.0872723
+CA: 0.0680076
+CC: 0.0442483
+CG: 0.0391952
+CT: 0.0523133
+GA: 0.0551463
+GC: 0.0514601
+GG: 0.0408221
+GT: 0.0517436
+TA: 0.0736475
+TC: 0.0534347
+TG: 0.0646163
+TT: 0.100022
Added: trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_human.freq
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_human.freq	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_human.freq	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,17 @@
+# dinucleotide frequencies from H. sapiens 3'UTRs
+AA: 0.0863875
+AC: 0.0486841
+AG: 0.0698675
+AT: 0.0687696
+CA: 0.0700628
+CC: 0.0617567
+CG: 0.0130357
+CT: 0.0729138
+GA: 0.0582891
+GC: 0.0477981
+GG: 0.0600536
+GT: 0.0525618
+TA: 0.0588781
+TC: 0.0595386
+TG: 0.0757252
+TT: 0.0956777
Added: trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_worm.freq
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_worm.freq	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/examples/3UTR_worm.freq	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,17 @@
+# dinucleotide frequencies from C. elegans 3'UTRs
+AA: 0.129275
+AC: 0.0478286
+AG: 0.0465314
+AT: 0.0924212
+CA: 0.0619208
+CC: 0.0341448
+CG: 0.0289974
+CT: 0.0525641
+GA: 0.0575875
+GC: 0.0311351
+GG: 0.029876
+GT: 0.0489973
+TA: 0.0672161
+TC: 0.064592
+TG: 0.0621619
+TT: 0.144751
Added: trunk/packages/rnahybrid/branches/upstream/current/examples/cbr-hbl-1.fasta
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/examples/cbr-hbl-1.fasta	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/examples/cbr-hbl-1.fasta	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,20 @@
+>ENSCBRT00000006770.1|ENSCBRG00000005546.1 assembly=CBR25|chr=cb25.fpc3857|strand=forward|downstream UTR
+TGAAGACTTCTCCCTTCATAGTCTTACCCTCATCTAGTCGACGAAACTTCCATTTGGGAATAGACTCGTTTTGTAGCTGG
+TTTTTCTTTTCCTAATATTTTAACTTATCAATGTTCGGGCGTTTTGTTATTTGTTTCCTTTTTTAATCTTGGCCATGTTC
+TTGCAATTGTACCTCAAACCATCCATTTCCATGGAATCTCAAAACCACTAGTTATCACTATATACTTTTTCTGTTTATCA
+TCCCTACCTCAAAACATATTCCCGTACTTGTTTCAATGACGCCAAAACGAAAATACCTAAAAGAGCCTTACTCTCTGTAC
+CCCCAATCTATTAAACGTGTCACTCTTAGAAGCAATTGTATACTGTTTGCCAAAGTACATGTAGTACCCCTTCTCCTCCA
+GAATACTTGTTTCTGTTACTATGTACCTTCTCAATATTTCGGGATATGGAAATTTTTCTTTGCGTGCTCCAAAAAAACCT
+TCAAATGATTTCATTCTCATTTTTTCTCAATTTCTAAGGCCCCTTCTCCACTAATAAGCTTTATTCTCTTTTGCATGTCT
+TTCAAACAACTTATTTATTTTCTATTCACCCAATTTTTTAATATGTGCATGATTCTTCTTTCTTGTTATAGCATTTTGTG
+TATTTTCCCCTTAATTATAGCCCCCTACAACCGTCCCCCTACCTCTCTCCCCAAAAATCATACGAACTCAGATTGTATTG
+CAGTTTTAACCGTTTCGAACTAGAATTCATGCCAATGATTCGTTTTTCATCTAGTTTGTCATTACTTTTTTTCATAACCG
+AAGTGACTTTTTCCCAAACCCGCTTACAACTTTTCTACCCCATCAAGCAATTTAATAATAACCGTTTTTTTTTGTTCATG
+CTACCTCAATTTGCTTATGTACCTCTTTCAAAAACTCCCATGTCCTCCCAAAAATTCTGATTTCAGTCTCCCCCTTACCT
+TCATACATCCCAAGCCTTTTGCCATACATTCTCCGTTTCAACCTAATTGCGTGCTTATTATTCATCCTTTGTATAGCCTT
+TTCAGCTTCATCAAAATTTATTGGCCCACCTCATCTCCCAGAACTCATCTCAGGAATTTACTATGCTCCATTTTCAGTAA
+AAACCTCCTCCTCTCTATGAACTACTTGTCTCTTGATTACTGTTATCCAATATTATGTACCTCATTGAATTTGCCATCCC
+CAATCCTTTTTTCTTTACCTCAAACTCATTTTTTCTCTCCATACTGGCCTATGACTGTATAATGCGTTCTACCTCCCCAA
+CTGTCCCCAATTCTAGTTATGTACCGTTTTTCTACCTCAAAAAATTAAACCCCATTATACAACCGTTCCACCTCAAACTC
+CCTCCCTTTTAGTCATGTACAATTTCTCTATCTCAAGTCGTATTCGGCTTCCACTATGAAAAATCCAATCCAATAAAAAT
+CATCATTAA
Added: trunk/packages/rnahybrid/branches/upstream/current/examples/cel-hbl-1.fasta
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/examples/cel-hbl-1.fasta	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/examples/cel-hbl-1.fasta	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,20 @@
+>F13D11.2.1|F13D11.2.1 assembly=CEL116|chr=X|strand=forward|downstream UTR
+TGAGGACGTCCTCGTTAAGGAAACACTTCCCATAGCCCCTTACCCTCGTCTAGTGACCCATTCTGAAATCGGCAGATAGA
+CTTTCATGTAGCTGGTTTAAGTTTTCTCTTCATTTTCTTTAACTTATCAATGTTCGGGCGTTACCACTTTTCTAATCATG
+GCCAGTTTCTTGCACGTACACCTCAACCGTCCATTTCCATGAAATCTCATACTTGTTACTGTTTTCTTTTACCTCTGATG
+TCACATTTTCTCTCTGTCTCACTTTCTACCTCCAAACATATTTTACTACTTGTATTGAATGCCAAAAAATACCATATTTA
+TTAAGGAGCATTGTTCATTTACAGTTTTGTACTCTCAGAGCGTGTTATTATCTAGAAGCAATTGTATACTGTTCTCAGTA
+CATGTAGTACCTCCCCCAGAATACTTGTTTCTGTTACTATGTACCCCTCTTATTAACTTCGGGATATGAAACTTTTTATG
+TTTCATTTTCTATTGATTTCATTTGTTTGTCATTTTCAAGCTCCTCTTTCCACATAAGCTTTAACTGCATGTCTTTCATT
+TTTATTTATTTCTATTTGCCAATTGTTTAACTATGCACACATTTGTTTCATGTTTCTCCAGAGATAACTTTCCCAAATTC
+AAGTTTGCGCCAACTCGTGCTGCTCTTTTATTGTACGGTTTTATAACGTTTCCGTCTTGAAATCAGAGATTGTAGCCGTT
+TTTTGAAAAGGATATGCCAAAGAATCGTCCCCCACCCTCTAGTTGTCATTTGTTAAATAGCCGAAGTGACCCAACAACCC
+GCTTTTGTCCCCTCTACTAATAACCGTTTTATTATTATTATCACTCAATATTTATCTTTTTATGTACTTCTTTCACTGCT
+CCCATGTCGTGATTTCTGATTTCACATTTTCCAGACTATCTCGCACTTTCATTCTACCTCAATACATCCCAGCTTTTTTG
+CCATACATTCTCCGATTCGAATTCATGTGTGCTCGTTTAACTATTATTACCTGTATCCACCGATTACTTTTTTGTTTATT
+CGCTCCCTTTTTTCTATCTCAGGAATGATTTATAGTTTTCAATTTGTCTTCTCACAACTCATCTAAACTACTTGTCCGCT
+ACCTTATGTACCTCATTGACTCATTTTGCCATCACCCAATACAATTTATACCTCAATACTGTCTCTTACCTGTATAATGC
+CTTCTACCTCCAATTTTTACCATCTATTCTAGTTAATTACCATTTTCTACCTCAACCCATTTTCTATTATACAACCGTTC
+CACCTCAAACTTCAGTGCGTTCTTCTGTCATCATGTACAATTTTCTTTCTTCGAATTTTGATTCGAATGTCAATTTATCA
+ATTTATAAAAACTCCAATAAAAAAGCATCTTGAAGCATCTTGTTTTACCACATATATCAAAACTTCAAAGTACACAATTA
+ATCGGATCATCAGAAAAA
Added: trunk/packages/rnahybrid/branches/upstream/current/examples/cel-let-7.fasta
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/examples/cel-let-7.fasta	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/examples/cel-let-7.fasta	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,2 @@
+>cel-let-7
+ugagguaguagguuguauaguu
Added: trunk/packages/rnahybrid/branches/upstream/current/examples/coding_fly.freq
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/examples/coding_fly.freq	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/examples/coding_fly.freq	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,17 @@
+# dinucleotide frequencies from D. melanogaster coding sequence
+AA: 0.0660328
+AC: 0.0611442
+AG: 0.068442
+AT: 0.0565617
+CA: 0.0815035
+CC: 0.0683901
+CG: 0.0653833
+CT: 0.0571172
+GA: 0.0734895
+GC: 0.0828927
+GG: 0.0674454
+GT: 0.0467295
+TA: 0.0306786
+TC: 0.059933
+TG: 0.0692581
+TT: 0.0449983
Added: trunk/packages/rnahybrid/branches/upstream/current/examples/coding_worm.freq
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/examples/coding_worm.freq	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/examples/coding_worm.freq	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,17 @@
+# dinucleotide frequencies from C. elegans coding sequence
+AA: 0.103789
+AC: 0.0565921
+AG: 0.0607529
+AT: 0.0817754
+CA: 0.0739273
+CC: 0.0398698
+CG: 0.0433821
+CT: 0.0545018
+GA: 0.0838167
+GC: 0.044407
+GG: 0.0442801
+GT: 0.0483436
+TA: 0.0412813
+TC: 0.0708102
+TG: 0.0725687
+TT: 0.0799021
Added: trunk/packages/rnahybrid/branches/upstream/current/examples/hbl-1.fasta
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/examples/hbl-1.fasta	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/examples/hbl-1.fasta	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,40 @@
+>F13D11.2.1|F13D11.2.1 assembly=CEL116|chr=X|strand=forward|downstream UTR
+TGAGGACGTCCTCGTTAAGGAAACACTTCCCATAGCCCCTTACCCTCGTCTAGTGACCCATTCTGAAATCGGCAGATAGA
+CTTTCATGTAGCTGGTTTAAGTTTTCTCTTCATTTTCTTTAACTTATCAATGTTCGGGCGTTACCACTTTTCTAATCATG
+GCCAGTTTCTTGCACGTACACCTCAACCGTCCATTTCCATGAAATCTCATACTTGTTACTGTTTTCTTTTACCTCTGATG
+TCACATTTTCTCTCTGTCTCACTTTCTACCTCCAAACATATTTTACTACTTGTATTGAATGCCAAAAAATACCATATTTA
+TTAAGGAGCATTGTTCATTTACAGTTTTGTACTCTCAGAGCGTGTTATTATCTAGAAGCAATTGTATACTGTTCTCAGTA
+CATGTAGTACCTCCCCCAGAATACTTGTTTCTGTTACTATGTACCCCTCTTATTAACTTCGGGATATGAAACTTTTTATG
+TTTCATTTTCTATTGATTTCATTTGTTTGTCATTTTCAAGCTCCTCTTTCCACATAAGCTTTAACTGCATGTCTTTCATT
+TTTATTTATTTCTATTTGCCAATTGTTTAACTATGCACACATTTGTTTCATGTTTCTCCAGAGATAACTTTCCCAAATTC
+AAGTTTGCGCCAACTCGTGCTGCTCTTTTATTGTACGGTTTTATAACGTTTCCGTCTTGAAATCAGAGATTGTAGCCGTT
+TTTTGAAAAGGATATGCCAAAGAATCGTCCCCCACCCTCTAGTTGTCATTTGTTAAATAGCCGAAGTGACCCAACAACCC
+GCTTTTGTCCCCTCTACTAATAACCGTTTTATTATTATTATCACTCAATATTTATCTTTTTATGTACTTCTTTCACTGCT
+CCCATGTCGTGATTTCTGATTTCACATTTTCCAGACTATCTCGCACTTTCATTCTACCTCAATACATCCCAGCTTTTTTG
+CCATACATTCTCCGATTCGAATTCATGTGTGCTCGTTTAACTATTATTACCTGTATCCACCGATTACTTTTTTGTTTATT
+CGCTCCCTTTTTTCTATCTCAGGAATGATTTATAGTTTTCAATTTGTCTTCTCACAACTCATCTAAACTACTTGTCCGCT
+ACCTTATGTACCTCATTGACTCATTTTGCCATCACCCAATACAATTTATACCTCAATACTGTCTCTTACCTGTATAATGC
+CTTCTACCTCCAATTTTTACCATCTATTCTAGTTAATTACCATTTTCTACCTCAACCCATTTTCTATTATACAACCGTTC
+CACCTCAAACTTCAGTGCGTTCTTCTGTCATCATGTACAATTTTCTTTCTTCGAATTTTGATTCGAATGTCAATTTATCA
+ATTTATAAAAACTCCAATAAAAAAGCATCTTGAAGCATCTTGTTTTACCACATATATCAAAACTTCAAAGTACACAATTA
+ATCGGATCATCAGAAAAA
+>ENSCBRT00000006770.1|ENSCBRG00000005546.1 assembly=CBR25|chr=cb25.fpc3857|strand=forward|downstream UTR
+TGAAGACTTCTCCCTTCATAGTCTTACCCTCATCTAGTCGACGAAACTTCCATTTGGGAATAGACTCGTTTTGTAGCTGG
+TTTTTCTTTTCCTAATATTTTAACTTATCAATGTTCGGGCGTTTTGTTATTTGTTTCCTTTTTTAATCTTGGCCATGTTC
+TTGCAATTGTACCTCAAACCATCCATTTCCATGGAATCTCAAAACCACTAGTTATCACTATATACTTTTTCTGTTTATCA
+TCCCTACCTCAAAACATATTCCCGTACTTGTTTCAATGACGCCAAAACGAAAATACCTAAAAGAGCCTTACTCTCTGTAC
+CCCCAATCTATTAAACGTGTCACTCTTAGAAGCAATTGTATACTGTTTGCCAAAGTACATGTAGTACCCCTTCTCCTCCA
+GAATACTTGTTTCTGTTACTATGTACCTTCTCAATATTTCGGGATATGGAAATTTTTCTTTGCGTGCTCCAAAAAAACCT
+TCAAATGATTTCATTCTCATTTTTTCTCAATTTCTAAGGCCCCTTCTCCACTAATAAGCTTTATTCTCTTTTGCATGTCT
+TTCAAACAACTTATTTATTTTCTATTCACCCAATTTTTTAATATGTGCATGATTCTTCTTTCTTGTTATAGCATTTTGTG
+TATTTTCCCCTTAATTATAGCCCCCTACAACCGTCCCCCTACCTCTCTCCCCAAAAATCATACGAACTCAGATTGTATTG
+CAGTTTTAACCGTTTCGAACTAGAATTCATGCCAATGATTCGTTTTTCATCTAGTTTGTCATTACTTTTTTTCATAACCG
+AAGTGACTTTTTCCCAAACCCGCTTACAACTTTTCTACCCCATCAAGCAATTTAATAATAACCGTTTTTTTTTGTTCATG
+CTACCTCAATTTGCTTATGTACCTCTTTCAAAAACTCCCATGTCCTCCCAAAAATTCTGATTTCAGTCTCCCCCTTACCT
+TCATACATCCCAAGCCTTTTGCCATACATTCTCCGTTTCAACCTAATTGCGTGCTTATTATTCATCCTTTGTATAGCCTT
+TTCAGCTTCATCAAAATTTATTGGCCCACCTCATCTCCCAGAACTCATCTCAGGAATTTACTATGCTCCATTTTCAGTAA
+AAACCTCCTCCTCTCTATGAACTACTTGTCTCTTGATTACTGTTATCCAATATTATGTACCTCATTGAATTTGCCATCCC
+CAATCCTTTTTTCTTTACCTCAAACTCATTTTTTCTCTCCATACTGGCCTATGACTGTATAATGCGTTCTACCTCCCCAA
+CTGTCCCCAATTCTAGTTATGTACCGTTTTTCTACCTCAAAAAATTAAACCCCATTATACAACCGTTCCACCTCAAACTC
+CCTCCCTTTTAGTCATGTACAATTTCTCTATCTCAAGTCGTATTCGGCTTCCACTATGAAAAATCCAATCCAATAAAAAT
+CATCATTAA
Added: trunk/packages/rnahybrid/branches/upstream/current/install-sh
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/install-sh	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/install-sh	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,276 @@
+#!/bin/sh
+#
+# install - install a program, script, or datafile
+# This comes from X11R5 (mit/util/scripts/install.sh).
+#
+# Copyright 1991 by the Massachusetts Institute of Technology
+#
+# Permission to use, copy, modify, distribute, and sell this software and its
+# documentation for any purpose is hereby granted without fee, provided that
+# the above copyright notice appear in all copies and that both that
+# copyright notice and this permission notice appear in supporting
+# documentation, and that the name of M.I.T. not be used in advertising or
+# publicity pertaining to distribution of the software without specific,
+# written prior permission.  M.I.T. makes no representations about the
+# suitability of this software for any purpose.  It is provided "as is"
+# without express or implied warranty.
+#
+# Calling this script install-sh is preferred over install.sh, to prevent
+# `make' implicit rules from creating a file called install from it
+# when there is no Makefile.
+#
+# This script is compatible with the BSD install script, but was written
+# from scratch.  It can only install one file at a time, a restriction
+# shared with many OS's install programs.
+
+
+# set DOITPROG to echo to test this script
+
+# Don't use :- since 4.3BSD and earlier shells don't like it.
+doit="${DOITPROG-}"
+
+
+# put in absolute paths if you don't have them in your path; or use env. vars.
+
+mvprog="${MVPROG-mv}"
+cpprog="${CPPROG-cp}"
+chmodprog="${CHMODPROG-chmod}"
+chownprog="${CHOWNPROG-chown}"
+chgrpprog="${CHGRPPROG-chgrp}"
+stripprog="${STRIPPROG-strip}"
+rmprog="${RMPROG-rm}"
+mkdirprog="${MKDIRPROG-mkdir}"
+
+transformbasename=""
+transform_arg=""
+instcmd="$mvprog"
+chmodcmd="$chmodprog 0755"
+chowncmd=""
+chgrpcmd=""
+stripcmd=""
+rmcmd="$rmprog -f"
+mvcmd="$mvprog"
+src=""
+dst=""
+dir_arg=""
+
+while [ x"$1" != x ]; do
+    case $1 in
+	-c) instcmd=$cpprog
+	    shift
+	    continue;;
+
+	-d) dir_arg=true
+	    shift
+	    continue;;
+
+	-m) chmodcmd="$chmodprog $2"
+	    shift
+	    shift
+	    continue;;
+
+	-o) chowncmd="$chownprog $2"
+	    shift
+	    shift
+	    continue;;
+
+	-g) chgrpcmd="$chgrpprog $2"
+	    shift
+	    shift
+	    continue;;
+
+	-s) stripcmd=$stripprog
+	    shift
+	    continue;;
+
+	-t=*) transformarg=`echo $1 | sed 's/-t=//'`
+	    shift
+	    continue;;
+
+	-b=*) transformbasename=`echo $1 | sed 's/-b=//'`
+	    shift
+	    continue;;
+
+	*)  if [ x"$src" = x ]
+	    then
+		src=$1
+	    else
+		# this colon is to work around a 386BSD /bin/sh bug
+		:
+		dst=$1
+	    fi
+	    shift
+	    continue;;
+    esac
+done
+
+if [ x"$src" = x ]
+then
+	echo "$0: no input file specified" >&2
+	exit 1
+else
+	:
+fi
+
+if [ x"$dir_arg" != x ]; then
+	dst=$src
+	src=""
+
+	if [ -d "$dst" ]; then
+		instcmd=:
+		chmodcmd=""
+	else
+		instcmd=$mkdirprog
+	fi
+else
+
+# Waiting for this to be detected by the "$instcmd $src $dsttmp" command
+# might cause directories to be created, which would be especially bad
+# if $src (and thus $dsttmp) contains '*'.
+
+	if [ -f "$src" ] || [ -d "$src" ]
+	then
+		:
+	else
+		echo "$0: $src does not exist" >&2
+		exit 1
+	fi
+
+	if [ x"$dst" = x ]
+	then
+		echo "$0: no destination specified" >&2
+		exit 1
+	else
+		:
+	fi
+
+# If destination is a directory, append the input filename; if your system
+# does not like double slashes in filenames, you may need to add some logic
+
+	if [ -d "$dst" ]
+	then
+		dst=$dst/`basename "$src"`
+	else
+		:
+	fi
+fi
+
+## this sed command emulates the dirname command
+dstdir=`echo "$dst" | sed -e 's,[^/]*$,,;s,/$,,;s,^$,.,'`
+
+# Make sure that the destination directory exists.
+#  this part is taken from Noah Friedman's mkinstalldirs script
+
+# Skip lots of stat calls in the usual case.
+if [ ! -d "$dstdir" ]; then
+defaultIFS='
+	'
+IFS="${IFS-$defaultIFS}"
+
+oIFS=$IFS
+# Some sh's can't handle IFS=/ for some reason.
+IFS='%'
+set - `echo "$dstdir" | sed -e 's@/@%@g' -e 's@^%@/@'`
+IFS=$oIFS
+
+pathcomp=''
+
+while [ $# -ne 0 ] ; do
+	pathcomp=$pathcomp$1
+	shift
+
+	if [ ! -d "$pathcomp" ] ;
+        then
+		$mkdirprog "$pathcomp"
+	else
+		:
+	fi
+
+	pathcomp=$pathcomp/
+done
+fi
+
+if [ x"$dir_arg" != x ]
+then
+	$doit $instcmd "$dst" &&
+
+	if [ x"$chowncmd" != x ]; then $doit $chowncmd "$dst"; else : ; fi &&
+	if [ x"$chgrpcmd" != x ]; then $doit $chgrpcmd "$dst"; else : ; fi &&
+	if [ x"$stripcmd" != x ]; then $doit $stripcmd "$dst"; else : ; fi &&
+	if [ x"$chmodcmd" != x ]; then $doit $chmodcmd "$dst"; else : ; fi
+else
+
+# If we're going to rename the final executable, determine the name now.
+
+	if [ x"$transformarg" = x ]
+	then
+		dstfile=`basename "$dst"`
+	else
+		dstfile=`basename "$dst" $transformbasename |
+			sed $transformarg`$transformbasename
+	fi
+
+# don't allow the sed command to completely eliminate the filename
+
+	if [ x"$dstfile" = x ]
+	then
+		dstfile=`basename "$dst"`
+	else
+		:
+	fi
+
+# Make a couple of temp file names in the proper directory.
+
+	dsttmp=$dstdir/#inst.$$#
+	rmtmp=$dstdir/#rm.$$#
+
+# Trap to clean up temp files at exit.
+
+	trap 'status=$?; rm -f "$dsttmp" "$rmtmp" && exit $status' 0
+	trap '(exit $?); exit' 1 2 13 15
+
+# Move or copy the file name to the temp name
+
+	$doit $instcmd "$src" "$dsttmp" &&
+
+# and set any options; do chmod last to preserve setuid bits
+
+# If any of these fail, we abort the whole thing.  If we want to
+# ignore errors from any of these, just make sure not to ignore
+# errors from the above "$doit $instcmd $src $dsttmp" command.
+
+	if [ x"$chowncmd" != x ]; then $doit $chowncmd "$dsttmp"; else :;fi &&
+	if [ x"$chgrpcmd" != x ]; then $doit $chgrpcmd "$dsttmp"; else :;fi &&
+	if [ x"$stripcmd" != x ]; then $doit $stripcmd "$dsttmp"; else :;fi &&
+	if [ x"$chmodcmd" != x ]; then $doit $chmodcmd "$dsttmp"; else :;fi &&
+
+# Now remove or move aside any old file at destination location.  We try this
+# two ways since rm can't unlink itself on some systems and the destination
+# file might be busy for other reasons.  In this case, the final cleanup
+# might fail but the new file should still install successfully.
+
+{
+	if [ -f "$dstdir/$dstfile" ]
+	then
+		$doit $rmcmd -f "$dstdir/$dstfile" 2>/dev/null ||
+		$doit $mvcmd -f "$dstdir/$dstfile" "$rmtmp" 2>/dev/null ||
+		{
+		  echo "$0: cannot unlink or rename $dstdir/$dstfile" >&2
+		  (exit 1); exit
+		}
+	else
+		:
+	fi
+} &&
+
+# Now rename the file to the real destination.
+
+	$doit $mvcmd "$dsttmp" "$dstdir/$dstfile"
+
+fi &&
+
+# The final little trick to "correctly" pass the exit status to the exit trap.
+
+{
+	(exit 0); exit
+}
Property changes on: trunk/packages/rnahybrid/branches/upstream/current/install-sh
___________________________________________________________________
Name: svn:executable
   + 
Added: trunk/packages/rnahybrid/branches/upstream/current/man/Makefile.am
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/man/Makefile.am	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/man/Makefile.am	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,2 @@
+man_MANS = RNAhybrid.1 RNAcalibrate.1 RNAeffective.1
+EXTRA_DIST = $(man_MANS)
Added: trunk/packages/rnahybrid/branches/upstream/current/man/Makefile.in
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/man/Makefile.in	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/man/Makefile.in	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,299 @@
+# Makefile.in generated by automake 1.7.3 from Makefile.am.
+# @configure_input@
+
+# Copyright 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003
+# Free Software Foundation, Inc.
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+ at SET_MAKE@
+
+srcdir = @srcdir@
+top_srcdir = @top_srcdir@
+VPATH = @srcdir@
+pkgdatadir = $(datadir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+top_builddir = ..
+
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+INSTALL = @INSTALL@
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+ACLOCAL = @ACLOCAL@
+AMDEP_FALSE = @AMDEP_FALSE@
+AMDEP_TRUE = @AMDEP_TRUE@
+AMTAR = @AMTAR@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+EXEEXT = @EXEEXT@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+OBJEXT = @OBJEXT@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_STRIP = @ac_ct_STRIP@
+am__fastdepCC_FALSE = @am__fastdepCC_FALSE@
+am__fastdepCC_TRUE = @am__fastdepCC_TRUE@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+bindir = @bindir@
+build_alias = @build_alias@
+datadir = @datadir@
+exec_prefix = @exec_prefix@
+host_alias = @host_alias@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+oldincludedir = @oldincludedir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+man_MANS = RNAhybrid.1 RNAcalibrate.1 RNAeffective.1
+EXTRA_DIST = $(man_MANS)
+subdir = man
+mkinstalldirs = $(SHELL) $(top_srcdir)/mkinstalldirs
+CONFIG_HEADER = $(top_builddir)/config.h
+CONFIG_CLEAN_FILES =
+DIST_SOURCES =
+
+NROFF = nroff
+MANS = $(man_MANS)
+DIST_COMMON = Makefile.am Makefile.in
+all: all-am
+
+.SUFFIXES:
+$(srcdir)/Makefile.in:  Makefile.am  $(top_srcdir)/configure.in $(ACLOCAL_M4)
+	cd $(top_srcdir) && \
+	  $(AUTOMAKE) --gnu  man/Makefile
+Makefile:  $(srcdir)/Makefile.in  $(top_builddir)/config.status
+	cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)
+uninstall-info-am:
+
+man1dir = $(mandir)/man1
+install-man1: $(man1_MANS) $(man_MANS)
+	@$(NORMAL_INSTALL)
+	$(mkinstalldirs) $(DESTDIR)$(man1dir)
+	@list='$(man1_MANS) $(dist_man1_MANS) $(nodist_man1_MANS)'; \
+	l2='$(man_MANS) $(dist_man_MANS) $(nodist_man_MANS)'; \
+	for i in $$l2; do \
+	  case "$$i" in \
+	    *.1*) list="$$list $$i" ;; \
+	  esac; \
+	done; \
+	for i in $$list; do \
+	  if test -f $(srcdir)/$$i; then file=$(srcdir)/$$i; \
+	  else file=$$i; fi; \
+	  ext=`echo $$i | sed -e 's/^.*\\.//'`; \
+	  case "$$ext" in \
+	    1*) ;; \
+	    *) ext='1' ;; \
+	  esac; \
+	  inst=`echo $$i | sed -e 's/\\.[0-9a-z]*$$//'`; \
+	  inst=`echo $$inst | sed -e 's/^.*\///'`; \
+	  inst=`echo $$inst | sed '$(transform)'`.$$ext; \
+	  echo " $(INSTALL_DATA) $$file $(DESTDIR)$(man1dir)/$$inst"; \
+	  $(INSTALL_DATA) $$file $(DESTDIR)$(man1dir)/$$inst; \
+	done
+uninstall-man1:
+	@$(NORMAL_UNINSTALL)
+	@list='$(man1_MANS) $(dist_man1_MANS) $(nodist_man1_MANS)'; \
+	l2='$(man_MANS) $(dist_man_MANS) $(nodist_man_MANS)'; \
+	for i in $$l2; do \
+	  case "$$i" in \
+	    *.1*) list="$$list $$i" ;; \
+	  esac; \
+	done; \
+	for i in $$list; do \
+	  ext=`echo $$i | sed -e 's/^.*\\.//'`; \
+	  case "$$ext" in \
+	    1*) ;; \
+	    *) ext='1' ;; \
+	  esac; \
+	  inst=`echo $$i | sed -e 's/\\.[0-9a-z]*$$//'`; \
+	  inst=`echo $$inst | sed -e 's/^.*\///'`; \
+	  inst=`echo $$inst | sed '$(transform)'`.$$ext; \
+	  echo " rm -f $(DESTDIR)$(man1dir)/$$inst"; \
+	  rm -f $(DESTDIR)$(man1dir)/$$inst; \
+	done
+tags: TAGS
+TAGS:
+
+ctags: CTAGS
+CTAGS:
+
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+
+top_distdir = ..
+distdir = $(top_distdir)/$(PACKAGE)-$(VERSION)
+
+distdir: $(DISTFILES)
+	@srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`; \
+	topsrcdirstrip=`echo "$(top_srcdir)" | sed 's|.|.|g'`; \
+	list='$(DISTFILES)'; for file in $$list; do \
+	  case $$file in \
+	    $(srcdir)/*) file=`echo "$$file" | sed "s|^$$srcdirstrip/||"`;; \
+	    $(top_srcdir)/*) file=`echo "$$file" | sed "s|^$$topsrcdirstrip/|$(top_builddir)/|"`;; \
+	  esac; \
+	  if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+	  dir=`echo "$$file" | sed -e 's,/[^/]*$$,,'`; \
+	  if test "$$dir" != "$$file" && test "$$dir" != "."; then \
+	    dir="/$$dir"; \
+	    $(mkinstalldirs) "$(distdir)$$dir"; \
+	  else \
+	    dir=''; \
+	  fi; \
+	  if test -d $$d/$$file; then \
+	    if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+	      cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \
+	    fi; \
+	    cp -pR $$d/$$file $(distdir)$$dir || exit 1; \
+	  else \
+	    test -f $(distdir)/$$file \
+	    || cp -p $$d/$$file $(distdir)/$$file \
+	    || exit 1; \
+	  fi; \
+	done
+check-am: all-am
+check: check-am
+all-am: Makefile $(MANS)
+
+installdirs:
+	$(mkinstalldirs) $(DESTDIR)$(man1dir)
+
+install: install-am
+install-exec: install-exec-am
+install-data: install-data-am
+uninstall: uninstall-am
+
+install-am: all-am
+	@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-am
+install-strip:
+	$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	  INSTALL_STRIP_FLAG=-s \
+	  `test -z '$(STRIP)' || \
+	    echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+	-rm -f Makefile $(CONFIG_CLEAN_FILES)
+
+maintainer-clean-generic:
+	@echo "This command is intended for maintainers to use"
+	@echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
+clean-am: clean-generic mostlyclean-am
+
+distclean: distclean-am
+
+distclean-am: clean-am distclean-generic
+
+dvi: dvi-am
+
+dvi-am:
+
+info: info-am
+
+info-am:
+
+install-data-am: install-man
+
+install-exec-am:
+
+install-info: install-info-am
+
+install-man: install-man1
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-am
+
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-am
+
+mostlyclean-am: mostlyclean-generic
+
+pdf: pdf-am
+
+pdf-am:
+
+ps: ps-am
+
+ps-am:
+
+uninstall-am: uninstall-info-am uninstall-man
+
+uninstall-man: uninstall-man1
+
+.PHONY: all all-am check check-am clean clean-generic distclean \
+	distclean-generic distdir dvi dvi-am info info-am install \
+	install-am install-data install-data-am install-exec \
+	install-exec-am install-info install-info-am install-man \
+	install-man1 install-strip installcheck installcheck-am \
+	installdirs maintainer-clean maintainer-clean-generic \
+	mostlyclean mostlyclean-generic pdf pdf-am ps ps-am uninstall \
+	uninstall-am uninstall-info-am uninstall-man uninstall-man1
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
Added: trunk/packages/rnahybrid/branches/upstream/current/man/RNAcalibrate.1
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/man/RNAcalibrate.1	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/man/RNAcalibrate.1	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,108 @@
+.TH RNACALIBRATE 1
+.ER
+.SH NAME
+RNAcalibrate \- calibrate statistics of secondary structure hybridisations of
+RNAs
+.SH SYNOPSIS
+\fBRNAcalibrate [\-h] [\-d \fIfrequency_file\fB] [\-f \fIfrom,to\fB] [\-k
+\fIsample_size\fB] [\-l \fImean,std\fB] [\-m \fImax_target_length\fB] [\-n
+\fImax_query_length\fB] [\-u \fIiloop_upper_limit\fB] [\-v
+\fIbloop_upper_limit\fB] [\-s] [\-t \fItarget_file\fB] [\-q \fIquery_file\fB]
+[\fItarget\fB] [\fIquery\fB]
+
+.SH DESCRIPTION
+.I RNAcalibrate
+is a tool for calibrating minimum free energy (mfe) hybridisations performed
+with RNAhybrid. It searches a random database that can be given on the command
+line or otherwise generates random sequences according to given sample size,
+length distribution parameters and dinucleotide frequencies. To the empirical
+distribution of length normalised minimum free energies, parameters of an
+extreme value distribution (evd) are fitted. The output gives for each miRNA
+its name (or "command_line" if it was submitted on the command line), the
+number of data points the evd fit was done on, the location and the scale
+parameter. The location and scale parameters of the evd can then be given to
+RNAhybrid for the calculation of mfe p-values.
+
+.SH OPTIONS
+.TP
+.B \-h
+Give a short summary of command line options.
+.TP
+.B \-d \fIfrequency_file
+Generate random sequences according to dinucleotide frequencies
+given in \fIfrequency_file\fP. See example directory for example
+files.
+.TP
+.B \-f \fIfrom,to
+Forces all structures to have a helix from position \fIfrom\fP to position
+\fIto\fP with respect to the query. The first base has position 1.
+.TP
+.B \-k \fIsample_size
+Generate \fIsample_size\fP random sequences. Default value is 5000.
+.TP
+.B \-l \fImean,std
+Generate random sequences with a normal length distribution of
+mean \fImean\fP and standard deviation \fIstd\fP. Default values are 500 and
+300, respectively.
+.TP
+.B \-m \fImax_target_length
+The maximum allowed length of a target sequence. The default value is
+2000. This option only has an effect if a target file is given with the \-t
+option (see below).
+.TP
+.B \-n \fImax_query_length
+The maximum allowed length of a query sequence. The default value is 30. This
+option only has an effect if a query file is given with the \-q option (see
+below).
+.TP
+.B \-u \fIiloop_upper_limit
+The maximally allowed number of unpaired nucleotides in either side of an
+internal loop.
+.TP
+.B \-v \fIbloop_upper_limit
+The maximally allowed number of unpaired nucleotides in a bulge loop.
+.TP
+.B \-s
+Generate random sequences according to the dinucleotide distribution of given
+targets (either with the \-t option or on command line. If no \-t is given,
+either the last argument (if a \-q is given) or the second last argument (if no
+\-q is given) to RNAcalibrate is taken as a target). See \-t option.
+.TP
+.B \-t \fItarget_file
+Without the \-s option, each of the target sequences in \fItarget_file\fP is
+subject to hybridisation with each of the queries (which either are from the
+\fIquery_file\fP or is the one query given on command line; see \-q below). The
+sequences in the \fItarget_file\fP have to be in FASTA format, ie. one line
+starting with a \> and directly followed by a name, then one or more following
+lines with the sequence itself. Each individual sequence line must not have
+more than 1000 characters.
+
+With the \-s option, the target (or target file) dinucleotide distribution is
+counted, and random sequences are generated according to this distribution.
+
+If no \-t is given, random sequences are generated as described above
+(see \-d option).
+.TP
+.B \-q \fIquery_file
+See \-t option above. If no \-q is given, the last argument to RNAcalibrate is
+taken as a query.
+.SH REFERENCES
+The energy parameters are taken from:
+
+Mathews DH, Sabina J, Zuker M, Turner DH.
+"Expanded sequence dependence of thermodynamic parameters improves 
+prediction of RNA secondary structure"
+J Mol Biol., 288 (5), pp 911-940, 1999
+
+.SH VERSION
+This man page documents version 2.0 of RNAcalibrate.
+
+.SH AUTHORS
+Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann.
+
+.SH LIMITATIONS
+Character dependent energy values are only defined for [acgtuACGTU].
+All other characters lead to values of zero in these cases.
+
+.SH SEE ALSO
+RNAhybrid, RNAeffective
Added: trunk/packages/rnahybrid/branches/upstream/current/man/RNAeffective.1
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/man/RNAeffective.1	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/man/RNAeffective.1	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,102 @@
+.TH RNAEFFECTIVE 1
+.ER
+.SH NAME
+RNAeffective \- calculation of effective numbers of orthologous miRNA targets
+.SH SYNOPSIS
+\fBRNAeffective [\-h] [\-d \fIfrequency_file\fB] [\-f \fIfrom,to\fB] [\-k
+\fIsample_size\fB] [\-l \fImean,std\fB] [\-m \fImax_target_length\fB] [\-n
+\fImax_query_length\fB] [\-u \fIiloop_upper_limit\fB] [\-v
+\fIbloop_upper_limit\fB] [\-s] [\-t \fItarget_file\fB] [\-q \fIquery_file\fB]
+[\fIquery\fB]
+
+.SH DESCRIPTION
+.I RNAeffective
+is a tool for determining the effective number of orthologous miRNA targets.
+This number can be used for the calculation of more accurate joint p-values in
+multi-species analyses. RNAeffective searches a set of target sequences with
+random miRNAs that can be given on the command line or otherwise generates
+random sequences according to given sample size, length distribution parameters
+and dinucleotide frequencies. The empirical distribution of joint p-values is
+compared to the p-values themselves, and the effective number of independent
+targets is the one that reduces the deviation between the two distributions.
+
+.SH OPTIONS
+.TP
+.B \-h
+Give a short summary of command line options.
+.TP
+.B \-d \fIfrequency_file
+Generate random sequences according to dinucleotide frequencies
+given in \fIfrequency_file\fP. See example directory for example
+files.
+.TP
+.B \-f \fIfrom,to
+Forces all structures to have a helix from position \fIfrom\fP to position
+\fIto\fP with respect to the query. The first base has position 1.
+.TP
+.B \-k \fIsample_size
+Generate \fIsample_size\fP random sequences. Default value is 5000.
+.TP
+.B \-l \fImean,std
+Generate random sequences with a normal length distribution of
+mean \fImean\fP and standard deviation \fIstd\fP. Default values are 22 and
+0, respectively.
+.TP
+.B \-m \fImax_target_length
+The maximum allowed length of a target sequence. The default value is
+2000. This option only has an effect if a target file is given with the \-t
+option (see below).
+.TP
+.B \-n \fImax_query_length
+The maximum allowed length of a query sequence. The default value is 30. This
+option only has an effect if a query file is given with the \-q option (see
+below).
+.TP
+.B \-u \fIiloop_upper_limit
+The maximally allowed number of unpaired nucleotides in either side of an
+internal loop.
+.TP
+.B \-v \fIbloop_upper_limit
+The maximally allowed number of unpaired nucleotides in a bulge loop.
+.TP
+.B \-s
+Generate random sequences according to the dinucleotide distribution of given
+queries (either with the \-q option or on command line. If no \-q is given,
+the last argument to RNAeffective is taken as a query). See \-q option.
+.TP
+.B \-q \fIquery_file
+Without the \-s option, each of the query sequences in \fIquery_file\fP is
+subject to hybridisation with each of the targets (which are from the
+\fItarget_file\fP; see \-t below). The sequences in the \fIquery_file\fP have
+to be in FASTA format, ie. one line starting with a \> and directly followed by
+a name, then one or more following lines with the sequence itself. Each
+individual sequence line must not have more than 1000 characters.
+
+With the \-s option, the query (or query file) dinucleotide distribution is
+counted, and random sequences are generated according to this distribution.
+
+If no \-q is given, random sequences are generated as described above
+(see \-d option).
+.TP
+.B \-t \fItarget_file
+See \-q option above.
+.SH REFERENCES
+The energy parameters are taken from:
+
+Mathews DH, Sabina J, Zuker M, Turner DH.
+"Expanded sequence dependence of thermodynamic parameters improves 
+prediction of RNA secondary structure"
+J Mol Biol., 288 (5), pp 911-940, 1999
+
+.SH VERSION
+This man page documents version 2.0 of RNAeffective.
+
+.SH AUTHORS
+Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann.
+
+.SH LIMITATIONS
+Character dependent energy values are only defined for [acgtuACGTU].
+All other characters lead to values of zero in these cases.
+
+.SH SEE ALSO
+RNAhybrid, RNAcalibrate
Added: trunk/packages/rnahybrid/branches/upstream/current/man/RNAhybrid.1
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/man/RNAhybrid.1	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/man/RNAhybrid.1	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,141 @@
+.TH RNAHYBRID 1
+.ER
+.SH NAME
+RNAhybrid \- calculate secondary structure hybridisations of RNAs
+.SH SYNOPSIS
+\fBRNAhybrid [\-h] [\-b \fIhit_number\fB] [\-e \fIenergy_cutoff\fB] [\-p
+\fIp-value_cutoff\fB] [\-c] [\-d \fIxi,theta\fB] [\-s \fIset_name\fB] [\-f
+\fIfrom,to\fB] [\-m \fImax_target_length\fB] [\-n \fImax_query_length\fB] [\-u
+\fIiloop_upper_limit\fB] [\-v \fIbloop_upper_limit\fB] [\-g (ps|png|jpg|all)]
+[\-t \fItarget_file\fB] [\-q \fIquery_file\fB] [\fItarget\fB] [\fIquery\fB]
+
+.SH DESCRIPTION
+.I RNAhybrid
+is a tool for finding minimum free energy (mfe) hybridisations of a long
+(target) and a short (query) RNA. The hybridisation is performed in a kind of
+domain mode, ie. the short sequence is hybridised to the best fitting parts of
+the long one. The tool is primarily meant as a means for microRNA target
+prediction.  In addition to mfes, the program calculates p-values based on
+extreme value distributions of length normalised energies.
+
+.SH OPTIONS
+.TP
+.B \-h
+Give a short summary of command line options.
+.TP
+.B \-b \fIhit_number
+Maximal number of hits to show. \fIhit_number\fP hits with increasing minimum
+free energy (reminder: larger energies are worse) are shown, unless the \-e
+option is used and the energy cut-off has been exceeded (see \-e option below) or
+there are no more hits. Hits may only overlap at dangling bases (5' or 3'
+unpaired end of target).
+.TP
+.B \-c
+Produce compact output. For each target/query pair one line of output
+is generated. Each line is a colon (:) separated list of the following
+fields: target name, query name, minimum free energy, position in target,
+alignment line 1, line 2, line 3, line 4. If a target or a query is given
+on command line (ie. no \-t or \-q respectively), its name in the output
+will be "command line".
+.TP
+.B \-d \fIxi,theta
+xi and theta are the position and shape parameters, respectively, of an extreme
+value distribution (evd). p-values of duplex energies are assumed to be
+distributed according to such an evd. For a length normalised energy en, we
+have P[X <= en] = 1 - exp(-exp(-(-en-xi)/theta)), where en = e/log(m*n) with m
+and n being the lengths of the target and the query, respectively. If the \-d
+option is omitted, xi and theta are estimated from the maximal duplex energy of
+the query, assuming a linear dependence. The parameters of this linear
+dependence are coded into the program, but the option \-s has to be given to
+choose from the appropriate set. Note that the evd is mirrored, since good mfes
+are large negative values.
+.TP
+.B \-s \fIset_name
+Used for quick estimate of extreme value distribution parameters (see \-d
+option above). Tells RNAhybrid which target dataset to assume. Valid parameters
+are 3utr_fly, 3utr_worm and 3utr_human.
+.TP
+.B \-e \fIenergy_cutoff
+Hits with increasing minimum free energy (reminder: larger energies are worse)
+less than or equal to \fIenergy_cutoff\fP are shown, unless the \-b option is
+used and the number of already reported hits has reached the maximal
+\fIhit_number\fP (see \-b option above). Hits may only overlap at dangling
+bases (5' or 3' unpaired end of target).
+.TP
+.B \-p \fIp-value_cutoff
+Only hits with p-values not larger than \fIp-value_cutoff\fP are reported.
+See also options \-d and \-s.
+.TP
+.B \-f \fIfrom,to
+Forces all structures to have a helix from position \fIfrom\fP to position
+\fIto\fP with respect to the query. The first base has position 1.
+.TP
+.B \-m \fImax_target_length
+The maximum allowed length of a target sequence. The default value is
+2000. This option only has an effect if a target file is given with the \-t
+option (see below).
+.TP
+.B \-n \fImax_query_length
+The maximum allowed length of a query sequence. The default value is 30. This
+option only has an effect if a query file is given with the \-q option (see
+below).
+.TP
+.B \-u \fIiloop_upper_limit
+The maximally allowed number of unpaired nucleotides in either side of an
+internal loop.
+.TP
+.B \-v \fIbloop_upper_limit
+The maximally allowed number of unpaired nucleotides in a bulge loop.
+.TP
+.B \-g (ps|png|jpg|all)
+Produce a plot of the hybridisation, either in ps, png or jpg format,
+or for all formats together. The plots are saved in files whose names are
+created from the target and query names ("command_line" if given on the
+command line). This option only works, if the appropriate graphics libraries
+are present.
+.TP
+.B \-t \fItarget_file
+Each of the target sequences in \fItarget_file\fP is subject to hybridisation
+with each of the queries (which either are from the \fIquery_file\fP or is the
+one query given on command line; see \-q below). The sequences in the
+\fItarget_file\fP have to be in FASTA format, ie. one line starting with a \>
+and directly followed by a name, then one or more following lines with the
+sequence itself. Each individual sequence line must not have more than 1000
+characters. If no \-t is given, either the last argument (if a \-q is given)
+or the second last argument (if no \-q is given) to RNAhybrid is taken as a
+target.
+.TP
+.B \-q \fIquery_file
+See \-t option above.
+.SH REFERENCES
+The energy parameters are taken from:
+
+Mathews DH, Sabina J, Zuker M, Turner DH.
+"Expanded sequence dependence of thermodynamic parameters improves 
+prediction of RNA secondary structure"
+J Mol Biol., 288 (5), pp 911-940, 1999
+
+The graphical output uses code from the Vienna RNA package:
+
+Hofacker IL.
+"Vienna RNA secondary structure server."
+Nucleic Acids Research, 31 (13), pp 3429-3431, 2003
+
+.SH VERSION
+This man page documents version 2.0 of RNAhybrid.
+
+.SH AUTHORS
+Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann.
+
+.SH LIMITATIONS
+Character dependent energy values are only defined for [acgtuACGTU].
+All other characters lead to values of zero in these cases.
+
+
+.SH BUGS
+In suboptimal hits, dangling ends appear as Ns if they were in the
+first or last hybridising position of a previous hit.
+
+
+.SH SEE ALSO
+RNAcalibrate, RNAeffective
Added: trunk/packages/rnahybrid/branches/upstream/current/missing
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/missing	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/missing	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,336 @@
+#! /bin/sh
+# Common stub for a few missing GNU programs while installing.
+# Copyright (C) 1996, 1997, 1999, 2000, 2002 Free Software Foundation, Inc.
+# Originally by Fran,cois Pinard <pinard at iro.umontreal.ca>, 1996.
+
+# This program is free software; you can redistribute it and/or modify
+# it under the terms of the GNU General Public License as published by
+# the Free Software Foundation; either version 2, or (at your option)
+# any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA
+# 02111-1307, USA.
+
+# As a special exception to the GNU General Public License, if you
+# distribute this file as part of a program that contains a
+# configuration script generated by Autoconf, you may include it under
+# the same distribution terms that you use for the rest of that program.
+
+if test $# -eq 0; then
+  echo 1>&2 "Try \`$0 --help' for more information"
+  exit 1
+fi
+
+run=:
+
+# In the cases where this matters, `missing' is being run in the
+# srcdir already.
+if test -f configure.ac; then
+  configure_ac=configure.ac
+else
+  configure_ac=configure.in
+fi
+
+case "$1" in
+--run)
+  # Try to run requested program, and just exit if it succeeds.
+  run=
+  shift
+  "$@" && exit 0
+  ;;
+esac
+
+# If it does not exist, or fails to run (possibly an outdated version),
+# try to emulate it.
+case "$1" in
+
+  -h|--h|--he|--hel|--help)
+    echo "\
+$0 [OPTION]... PROGRAM [ARGUMENT]...
+
+Handle \`PROGRAM [ARGUMENT]...' for when PROGRAM is missing, or return an
+error status if there is no known handling for PROGRAM.
+
+Options:
+  -h, --help      display this help and exit
+  -v, --version   output version information and exit
+  --run           try to run the given command, and emulate it if it fails
+
+Supported PROGRAM values:
+  aclocal      touch file \`aclocal.m4'
+  autoconf     touch file \`configure'
+  autoheader   touch file \`config.h.in'
+  automake     touch all \`Makefile.in' files
+  bison        create \`y.tab.[ch]', if possible, from existing .[ch]
+  flex         create \`lex.yy.c', if possible, from existing .c
+  help2man     touch the output file
+  lex          create \`lex.yy.c', if possible, from existing .c
+  makeinfo     touch the output file
+  tar          try tar, gnutar, gtar, then tar without non-portable flags
+  yacc         create \`y.tab.[ch]', if possible, from existing .[ch]"
+    ;;
+
+  -v|--v|--ve|--ver|--vers|--versi|--versio|--version)
+    echo "missing 0.4 - GNU automake"
+    ;;
+
+  -*)
+    echo 1>&2 "$0: Unknown \`$1' option"
+    echo 1>&2 "Try \`$0 --help' for more information"
+    exit 1
+    ;;
+
+  aclocal*)
+    if test -z "$run" && ($1 --version) > /dev/null 2>&1; then
+       # We have it, but it failed.
+       exit 1
+    fi
+
+    echo 1>&2 "\
+WARNING: \`$1' is missing on your system.  You should only need it if
+         you modified \`acinclude.m4' or \`${configure_ac}'.  You might want
+         to install the \`Automake' and \`Perl' packages.  Grab them from
+         any GNU archive site."
+    touch aclocal.m4
+    ;;
+
+  autoconf)
+    if test -z "$run" && ($1 --version) > /dev/null 2>&1; then
+       # We have it, but it failed.
+       exit 1
+    fi
+
+    echo 1>&2 "\
+WARNING: \`$1' is missing on your system.  You should only need it if
+         you modified \`${configure_ac}'.  You might want to install the
+         \`Autoconf' and \`GNU m4' packages.  Grab them from any GNU
+         archive site."
+    touch configure
+    ;;
+
+  autoheader)
+    if test -z "$run" && ($1 --version) > /dev/null 2>&1; then
+       # We have it, but it failed.
+       exit 1
+    fi
+
+    echo 1>&2 "\
+WARNING: \`$1' is missing on your system.  You should only need it if
+         you modified \`acconfig.h' or \`${configure_ac}'.  You might want
+         to install the \`Autoconf' and \`GNU m4' packages.  Grab them
+         from any GNU archive site."
+    files=`sed -n 's/^[ ]*A[CM]_CONFIG_HEADER(\([^)]*\)).*/\1/p' ${configure_ac}`
+    test -z "$files" && files="config.h"
+    touch_files=
+    for f in $files; do
+      case "$f" in
+      *:*) touch_files="$touch_files "`echo "$f" |
+				       sed -e 's/^[^:]*://' -e 's/:.*//'`;;
+      *) touch_files="$touch_files $f.in";;
+      esac
+    done
+    touch $touch_files
+    ;;
+
+  automake*)
+    if test -z "$run" && ($1 --version) > /dev/null 2>&1; then
+       # We have it, but it failed.
+       exit 1
+    fi
+
+    echo 1>&2 "\
+WARNING: \`$1' is missing on your system.  You should only need it if
+         you modified \`Makefile.am', \`acinclude.m4' or \`${configure_ac}'.
+         You might want to install the \`Automake' and \`Perl' packages.
+         Grab them from any GNU archive site."
+    find . -type f -name Makefile.am -print |
+	   sed 's/\.am$/.in/' |
+	   while read f; do touch "$f"; done
+    ;;
+
+  autom4te)
+    if test -z "$run" && ($1 --version) > /dev/null 2>&1; then
+       # We have it, but it failed.
+       exit 1
+    fi
+
+    echo 1>&2 "\
+WARNING: \`$1' is needed, and you do not seem to have it handy on your
+         system.  You might have modified some files without having the
+         proper tools for further handling them.
+         You can get \`$1Help2man' as part of \`Autoconf' from any GNU
+         archive site."
+
+    file=`echo "$*" | sed -n 's/.*--output[ =]*\([^ ]*\).*/\1/p'`
+    test -z "$file" && file=`echo "$*" | sed -n 's/.*-o[ ]*\([^ ]*\).*/\1/p'`
+    if test -f "$file"; then
+	touch $file
+    else
+	test -z "$file" || exec >$file
+	echo "#! /bin/sh"
+	echo "# Created by GNU Automake missing as a replacement of"
+	echo "#  $ $@"
+	echo "exit 0"
+	chmod +x $file
+	exit 1
+    fi
+    ;;
+
+  bison|yacc)
+    echo 1>&2 "\
+WARNING: \`$1' is missing on your system.  You should only need it if
+         you modified a \`.y' file.  You may need the \`Bison' package
+         in order for those modifications to take effect.  You can get
+         \`Bison' from any GNU archive site."
+    rm -f y.tab.c y.tab.h
+    if [ $# -ne 1 ]; then
+        eval LASTARG="\${$#}"
+	case "$LASTARG" in
+	*.y)
+	    SRCFILE=`echo "$LASTARG" | sed 's/y$/c/'`
+	    if [ -f "$SRCFILE" ]; then
+	         cp "$SRCFILE" y.tab.c
+	    fi
+	    SRCFILE=`echo "$LASTARG" | sed 's/y$/h/'`
+	    if [ -f "$SRCFILE" ]; then
+	         cp "$SRCFILE" y.tab.h
+	    fi
+	  ;;
+	esac
+    fi
+    if [ ! -f y.tab.h ]; then
+	echo >y.tab.h
+    fi
+    if [ ! -f y.tab.c ]; then
+	echo 'main() { return 0; }' >y.tab.c
+    fi
+    ;;
+
+  lex|flex)
+    echo 1>&2 "\
+WARNING: \`$1' is missing on your system.  You should only need it if
+         you modified a \`.l' file.  You may need the \`Flex' package
+         in order for those modifications to take effect.  You can get
+         \`Flex' from any GNU archive site."
+    rm -f lex.yy.c
+    if [ $# -ne 1 ]; then
+        eval LASTARG="\${$#}"
+	case "$LASTARG" in
+	*.l)
+	    SRCFILE=`echo "$LASTARG" | sed 's/l$/c/'`
+	    if [ -f "$SRCFILE" ]; then
+	         cp "$SRCFILE" lex.yy.c
+	    fi
+	  ;;
+	esac
+    fi
+    if [ ! -f lex.yy.c ]; then
+	echo 'main() { return 0; }' >lex.yy.c
+    fi
+    ;;
+
+  help2man)
+    if test -z "$run" && ($1 --version) > /dev/null 2>&1; then
+       # We have it, but it failed.
+       exit 1
+    fi
+
+    echo 1>&2 "\
+WARNING: \`$1' is missing on your system.  You should only need it if
+	 you modified a dependency of a manual page.  You may need the
+	 \`Help2man' package in order for those modifications to take
+	 effect.  You can get \`Help2man' from any GNU archive site."
+
+    file=`echo "$*" | sed -n 's/.*-o \([^ ]*\).*/\1/p'`
+    if test -z "$file"; then
+	file=`echo "$*" | sed -n 's/.*--output=\([^ ]*\).*/\1/p'`
+    fi
+    if [ -f "$file" ]; then
+	touch $file
+    else
+	test -z "$file" || exec >$file
+	echo ".ab help2man is required to generate this page"
+	exit 1
+    fi
+    ;;
+
+  makeinfo)
+    if test -z "$run" && (makeinfo --version) > /dev/null 2>&1; then
+       # We have makeinfo, but it failed.
+       exit 1
+    fi
+
+    echo 1>&2 "\
+WARNING: \`$1' is missing on your system.  You should only need it if
+         you modified a \`.texi' or \`.texinfo' file, or any other file
+         indirectly affecting the aspect of the manual.  The spurious
+         call might also be the consequence of using a buggy \`make' (AIX,
+         DU, IRIX).  You might want to install the \`Texinfo' package or
+         the \`GNU make' package.  Grab either from any GNU archive site."
+    file=`echo "$*" | sed -n 's/.*-o \([^ ]*\).*/\1/p'`
+    if test -z "$file"; then
+      file=`echo "$*" | sed 's/.* \([^ ]*\) *$/\1/'`
+      file=`sed -n '/^@setfilename/ { s/.* \([^ ]*\) *$/\1/; p; q; }' $file`
+    fi
+    touch $file
+    ;;
+
+  tar)
+    shift
+    if test -n "$run"; then
+      echo 1>&2 "ERROR: \`tar' requires --run"
+      exit 1
+    fi
+
+    # We have already tried tar in the generic part.
+    # Look for gnutar/gtar before invocation to avoid ugly error
+    # messages.
+    if (gnutar --version > /dev/null 2>&1); then
+       gnutar "$@" && exit 0
+    fi
+    if (gtar --version > /dev/null 2>&1); then
+       gtar "$@" && exit 0
+    fi
+    firstarg="$1"
+    if shift; then
+	case "$firstarg" in
+	*o*)
+	    firstarg=`echo "$firstarg" | sed s/o//`
+	    tar "$firstarg" "$@" && exit 0
+	    ;;
+	esac
+	case "$firstarg" in
+	*h*)
+	    firstarg=`echo "$firstarg" | sed s/h//`
+	    tar "$firstarg" "$@" && exit 0
+	    ;;
+	esac
+    fi
+
+    echo 1>&2 "\
+WARNING: I can't seem to be able to run \`tar' with the given arguments.
+         You may want to install GNU tar or Free paxutils, or check the
+         command line arguments."
+    exit 1
+    ;;
+
+  *)
+    echo 1>&2 "\
+WARNING: \`$1' is needed, and you do not seem to have it handy on your
+         system.  You might have modified some files without having the
+         proper tools for further handling them.  Check the \`README' file,
+         it often tells you about the needed prerequirements for installing
+         this package.  You may also peek at any GNU archive site, in case
+         some other package would contain this missing \`$1' program."
+    exit 1
+    ;;
+esac
+
+exit 0
Property changes on: trunk/packages/rnahybrid/branches/upstream/current/missing
___________________________________________________________________
Name: svn:executable
   + 
Added: trunk/packages/rnahybrid/branches/upstream/current/mkinstalldirs
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/mkinstalldirs	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/mkinstalldirs	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,111 @@
+#! /bin/sh
+# mkinstalldirs --- make directory hierarchy
+# Author: Noah Friedman <friedman at prep.ai.mit.edu>
+# Created: 1993-05-16
+# Public domain
+
+errstatus=0
+dirmode=""
+
+usage="\
+Usage: mkinstalldirs [-h] [--help] [-m mode] dir ..."
+
+# process command line arguments
+while test $# -gt 0 ; do
+  case $1 in
+    -h | --help | --h*)         # -h for help
+      echo "$usage" 1>&2
+      exit 0
+      ;;
+    -m)                         # -m PERM arg
+      shift
+      test $# -eq 0 && { echo "$usage" 1>&2; exit 1; }
+      dirmode=$1
+      shift
+      ;;
+    --)                         # stop option processing
+      shift
+      break
+      ;;
+    -*)                         # unknown option
+      echo "$usage" 1>&2
+      exit 1
+      ;;
+    *)                          # first non-opt arg
+      break
+      ;;
+  esac
+done
+
+for file
+do
+  if test -d "$file"; then
+    shift
+  else
+    break
+  fi
+done
+
+case $# in
+  0) exit 0 ;;
+esac
+
+case $dirmode in
+  '')
+    if mkdir -p -- . 2>/dev/null; then
+      echo "mkdir -p -- $*"
+      exec mkdir -p -- "$@"
+    fi
+    ;;
+  *)
+    if mkdir -m "$dirmode" -p -- . 2>/dev/null; then
+      echo "mkdir -m $dirmode -p -- $*"
+      exec mkdir -m "$dirmode" -p -- "$@"
+    fi
+    ;;
+esac
+
+for file
+do
+  set fnord `echo ":$file" | sed -ne 's/^:\//#/;s/^://;s/\// /g;s/^#/\//;p'`
+  shift
+
+  pathcomp=
+  for d
+  do
+    pathcomp="$pathcomp$d"
+    case $pathcomp in
+      -*) pathcomp=./$pathcomp ;;
+    esac
+
+    if test ! -d "$pathcomp"; then
+      echo "mkdir $pathcomp"
+
+      mkdir "$pathcomp" || lasterr=$?
+
+      if test ! -d "$pathcomp"; then
+  	errstatus=$lasterr
+      else
+  	if test ! -z "$dirmode"; then
+	  echo "chmod $dirmode $pathcomp"
+    	  lasterr=""
+  	  chmod "$dirmode" "$pathcomp" || lasterr=$?
+
+  	  if test ! -z "$lasterr"; then
+  	    errstatus=$lasterr
+  	  fi
+  	fi
+      fi
+    fi
+
+    pathcomp="$pathcomp/"
+  done
+done
+
+exit $errstatus
+
+# Local Variables:
+# mode: shell-script
+# sh-indentation: 2
+# End:
+# mkinstalldirs ends here
Property changes on: trunk/packages/rnahybrid/branches/upstream/current/mkinstalldirs
___________________________________________________________________
Name: svn:executable
   + 
Added: trunk/packages/rnahybrid/branches/upstream/current/src/Makefile.am
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/Makefile.am	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/Makefile.am	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,62 @@
+## Process this file with automake to produce Makefile.in
+
+bin_PROGRAMS = RNAhybrid RNAcalibrate RNAeffective
+
+RNAhybrid_SOURCES = \
+	rnahybrid.c\
+	hybrid_core.c\
+	hybrid_core.h\
+	energy.c\
+	energy.h\
+	input.c\
+	input.h\
+	fasta.c\
+	fasta.h\
+	globals.h\
+	minmax.h\
+	plot.c\
+	plot.h
+
+RNAcalibrate_SOURCES = \
+	rnacalibrate.c\
+	hybrid_core.c\
+	hybrid_core.h\
+	numerical.c\
+	numerical.h\
+	energy.c\
+	energy.h\
+	input.c\
+	input.h\
+	fasta.c\
+	fasta.h\
+	random.c\
+	random.h\
+	mt19937-1.c\
+	mt19937-1.h\
+	globals.h\
+	minmax.h\
+	plot.c\
+	plot.h
+
+RNAeffective_SOURCES = \
+	rnaeffective.c\
+	hybrid_core.c\
+	hybrid_core.h\
+	numerical.c\
+	numerical.h\
+	energy.c\
+	energy.h\
+	input.c\
+	input.h\
+	fasta.c\
+	fasta.h\
+	random.c\
+	random.h\
+	mt19937-1.c\
+	mt19937-1.h\
+	globals.h\
+	minmax.h\
+	plot.c\
+	plot.h
+
+INCLUDES = -I${includedir}
Added: trunk/packages/rnahybrid/branches/upstream/current/src/Makefile.in
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/Makefile.in	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/Makefile.in	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,481 @@
+# Makefile.in generated by automake 1.7.3 from Makefile.am.
+# @configure_input@
+
+# Copyright 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003
+# Free Software Foundation, Inc.
+# This Makefile.in is free software; the Free Software Foundation
+# gives unlimited permission to copy and/or distribute it,
+# with or without modifications, as long as this notice is preserved.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
+# PARTICULAR PURPOSE.
+
+ at SET_MAKE@
+
+srcdir = @srcdir@
+top_srcdir = @top_srcdir@
+VPATH = @srcdir@
+pkgdatadir = $(datadir)/@PACKAGE@
+pkglibdir = $(libdir)/@PACKAGE@
+pkgincludedir = $(includedir)/@PACKAGE@
+top_builddir = ..
+
+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
+INSTALL = @INSTALL@
+install_sh_DATA = $(install_sh) -c -m 644
+install_sh_PROGRAM = $(install_sh) -c
+install_sh_SCRIPT = $(install_sh) -c
+INSTALL_HEADER = $(INSTALL_DATA)
+transform = $(program_transform_name)
+NORMAL_INSTALL = :
+PRE_INSTALL = :
+POST_INSTALL = :
+NORMAL_UNINSTALL = :
+PRE_UNINSTALL = :
+POST_UNINSTALL = :
+ACLOCAL = @ACLOCAL@
+AMDEP_FALSE = @AMDEP_FALSE@
+AMDEP_TRUE = @AMDEP_TRUE@
+AMTAR = @AMTAR@
+AUTOCONF = @AUTOCONF@
+AUTOHEADER = @AUTOHEADER@
+AUTOMAKE = @AUTOMAKE@
+AWK = @AWK@
+CC = @CC@
+CCDEPMODE = @CCDEPMODE@
+CFLAGS = @CFLAGS@
+CPP = @CPP@
+CPPFLAGS = @CPPFLAGS@
+CYGPATH_W = @CYGPATH_W@
+DEFS = @DEFS@
+DEPDIR = @DEPDIR@
+ECHO_C = @ECHO_C@
+ECHO_N = @ECHO_N@
+ECHO_T = @ECHO_T@
+EGREP = @EGREP@
+EXEEXT = @EXEEXT@
+INSTALL_DATA = @INSTALL_DATA@
+INSTALL_PROGRAM = @INSTALL_PROGRAM@
+INSTALL_SCRIPT = @INSTALL_SCRIPT@
+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
+LDFLAGS = @LDFLAGS@
+LIBOBJS = @LIBOBJS@
+LIBS = @LIBS@
+LTLIBOBJS = @LTLIBOBJS@
+MAKEINFO = @MAKEINFO@
+OBJEXT = @OBJEXT@
+PACKAGE = @PACKAGE@
+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
+PACKAGE_NAME = @PACKAGE_NAME@
+PACKAGE_STRING = @PACKAGE_STRING@
+PACKAGE_TARNAME = @PACKAGE_TARNAME@
+PACKAGE_VERSION = @PACKAGE_VERSION@
+PATH_SEPARATOR = @PATH_SEPARATOR@
+SET_MAKE = @SET_MAKE@
+SHELL = @SHELL@
+STRIP = @STRIP@
+VERSION = @VERSION@
+ac_ct_CC = @ac_ct_CC@
+ac_ct_STRIP = @ac_ct_STRIP@
+am__fastdepCC_FALSE = @am__fastdepCC_FALSE@
+am__fastdepCC_TRUE = @am__fastdepCC_TRUE@
+am__include = @am__include@
+am__leading_dot = @am__leading_dot@
+am__quote = @am__quote@
+bindir = @bindir@
+build_alias = @build_alias@
+datadir = @datadir@
+exec_prefix = @exec_prefix@
+host_alias = @host_alias@
+includedir = @includedir@
+infodir = @infodir@
+install_sh = @install_sh@
+libdir = @libdir@
+libexecdir = @libexecdir@
+localstatedir = @localstatedir@
+mandir = @mandir@
+oldincludedir = @oldincludedir@
+prefix = @prefix@
+program_transform_name = @program_transform_name@
+sbindir = @sbindir@
+sharedstatedir = @sharedstatedir@
+sysconfdir = @sysconfdir@
+target_alias = @target_alias@
+
+bin_PROGRAMS = RNAhybrid RNAcalibrate RNAeffective
+
+RNAhybrid_SOURCES = \
+	rnahybrid.c\
+	hybrid_core.c\
+	hybrid_core.h\
+	energy.c\
+	energy.h\
+	input.c\
+	input.h\
+	fasta.c\
+	fasta.h\
+	globals.h\
+	minmax.h\
+	plot.c\
+	plot.h
+
+
+RNAcalibrate_SOURCES = \
+	rnacalibrate.c\
+	hybrid_core.c\
+	hybrid_core.h\
+	numerical.c\
+	numerical.h\
+	energy.c\
+	energy.h\
+	input.c\
+	input.h\
+	fasta.c\
+	fasta.h\
+	random.c\
+	random.h\
+	mt19937-1.c\
+	mt19937-1.h\
+	globals.h\
+	minmax.h\
+	plot.c\
+	plot.h
+
+
+RNAeffective_SOURCES = \
+	rnaeffective.c\
+	hybrid_core.c\
+	hybrid_core.h\
+	numerical.c\
+	numerical.h\
+	energy.c\
+	energy.h\
+	input.c\
+	input.h\
+	fasta.c\
+	fasta.h\
+	random.c\
+	random.h\
+	mt19937-1.c\
+	mt19937-1.h\
+	globals.h\
+	minmax.h\
+	plot.c\
+	plot.h
+
+
+INCLUDES = -I${includedir}
+subdir = src
+mkinstalldirs = $(SHELL) $(top_srcdir)/mkinstalldirs
+CONFIG_HEADER = $(top_builddir)/config.h
+CONFIG_CLEAN_FILES =
+bin_PROGRAMS = RNAhybrid$(EXEEXT) RNAcalibrate$(EXEEXT) \
+	RNAeffective$(EXEEXT)
+PROGRAMS = $(bin_PROGRAMS)
+
+am_RNAcalibrate_OBJECTS = rnacalibrate.$(OBJEXT) hybrid_core.$(OBJEXT) \
+	numerical.$(OBJEXT) energy.$(OBJEXT) input.$(OBJEXT) \
+	fasta.$(OBJEXT) random.$(OBJEXT) mt19937-1.$(OBJEXT) \
+	plot.$(OBJEXT)
+RNAcalibrate_OBJECTS = $(am_RNAcalibrate_OBJECTS)
+RNAcalibrate_LDADD = $(LDADD)
+RNAcalibrate_DEPENDENCIES =
+RNAcalibrate_LDFLAGS =
+am_RNAeffective_OBJECTS = rnaeffective.$(OBJEXT) hybrid_core.$(OBJEXT) \
+	numerical.$(OBJEXT) energy.$(OBJEXT) input.$(OBJEXT) \
+	fasta.$(OBJEXT) random.$(OBJEXT) mt19937-1.$(OBJEXT) \
+	plot.$(OBJEXT)
+RNAeffective_OBJECTS = $(am_RNAeffective_OBJECTS)
+RNAeffective_LDADD = $(LDADD)
+RNAeffective_DEPENDENCIES =
+RNAeffective_LDFLAGS =
+am_RNAhybrid_OBJECTS = rnahybrid.$(OBJEXT) hybrid_core.$(OBJEXT) \
+	energy.$(OBJEXT) input.$(OBJEXT) fasta.$(OBJEXT) plot.$(OBJEXT)
+RNAhybrid_OBJECTS = $(am_RNAhybrid_OBJECTS)
+RNAhybrid_LDADD = $(LDADD)
+RNAhybrid_DEPENDENCIES =
+RNAhybrid_LDFLAGS =
+
+DEFAULT_INCLUDES =  -I. -I$(srcdir) -I$(top_builddir)
+depcomp = $(SHELL) $(top_srcdir)/depcomp
+am__depfiles_maybe = depfiles
+ at AMDEP_TRUE@DEP_FILES = ./$(DEPDIR)/energy.Po ./$(DEPDIR)/fasta.Po \
+ at AMDEP_TRUE@	./$(DEPDIR)/hybrid_core.Po ./$(DEPDIR)/input.Po \
+ at AMDEP_TRUE@	./$(DEPDIR)/mt19937-1.Po ./$(DEPDIR)/numerical.Po \
+ at AMDEP_TRUE@	./$(DEPDIR)/plot.Po ./$(DEPDIR)/random.Po \
+ at AMDEP_TRUE@	./$(DEPDIR)/rnacalibrate.Po \
+ at AMDEP_TRUE@	./$(DEPDIR)/rnaeffective.Po \
+ at AMDEP_TRUE@	./$(DEPDIR)/rnahybrid.Po
+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
+	$(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
+CCLD = $(CC)
+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
+DIST_SOURCES = $(RNAcalibrate_SOURCES) $(RNAeffective_SOURCES) \
+	$(RNAhybrid_SOURCES)
+DIST_COMMON = Makefile.am Makefile.in
+SOURCES = $(RNAcalibrate_SOURCES) $(RNAeffective_SOURCES) $(RNAhybrid_SOURCES)
+
+all: all-am
+
+.SUFFIXES:
+.SUFFIXES: .c .o .obj
+$(srcdir)/Makefile.in:  Makefile.am  $(top_srcdir)/configure.in $(ACLOCAL_M4)
+	cd $(top_srcdir) && \
+	  $(AUTOMAKE) --gnu  src/Makefile
+Makefile:  $(srcdir)/Makefile.in  $(top_builddir)/config.status
+	cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)
+binPROGRAMS_INSTALL = $(INSTALL_PROGRAM)
+install-binPROGRAMS: $(bin_PROGRAMS)
+	@$(NORMAL_INSTALL)
+	$(mkinstalldirs) $(DESTDIR)$(bindir)
+	@list='$(bin_PROGRAMS)'; for p in $$list; do \
+	  p1=`echo $$p|sed 's/$(EXEEXT)$$//'`; \
+	  if test -f $$p \
+	  ; then \
+	    f=`echo "$$p1" | sed 's,^.*/,,;$(transform);s/$$/$(EXEEXT)/'`; \
+	   echo " $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) $$p $(DESTDIR)$(bindir)/$$f"; \
+	   $(INSTALL_PROGRAM_ENV) $(binPROGRAMS_INSTALL) $$p $(DESTDIR)$(bindir)/$$f || exit 1; \
+	  else :; fi; \
+	done
+
+uninstall-binPROGRAMS:
+	@$(NORMAL_UNINSTALL)
+	@list='$(bin_PROGRAMS)'; for p in $$list; do \
+	  f=`echo "$$p" | sed 's,^.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/'`; \
+	  echo " rm -f $(DESTDIR)$(bindir)/$$f"; \
+	  rm -f $(DESTDIR)$(bindir)/$$f; \
+	done
+
+clean-binPROGRAMS:
+	-test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
+RNAcalibrate$(EXEEXT): $(RNAcalibrate_OBJECTS) $(RNAcalibrate_DEPENDENCIES) 
+	@rm -f RNAcalibrate$(EXEEXT)
+	$(LINK) $(RNAcalibrate_LDFLAGS) $(RNAcalibrate_OBJECTS) $(RNAcalibrate_LDADD) $(LIBS)
+RNAeffective$(EXEEXT): $(RNAeffective_OBJECTS) $(RNAeffective_DEPENDENCIES) 
+	@rm -f RNAeffective$(EXEEXT)
+	$(LINK) $(RNAeffective_LDFLAGS) $(RNAeffective_OBJECTS) $(RNAeffective_LDADD) $(LIBS)
+RNAhybrid$(EXEEXT): $(RNAhybrid_OBJECTS) $(RNAhybrid_DEPENDENCIES) 
+	@rm -f RNAhybrid$(EXEEXT)
+	$(LINK) $(RNAhybrid_LDFLAGS) $(RNAhybrid_OBJECTS) $(RNAhybrid_LDADD) $(LIBS)
+
+mostlyclean-compile:
+	-rm -f *.$(OBJEXT) core *.core
+
+distclean-compile:
+	-rm -f *.tab.c
+
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/energy.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/fasta.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/hybrid_core.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/input.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/mt19937-1.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/numerical.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/plot.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/random.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/rnacalibrate.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/rnaeffective.Po at am__quote@
+ at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/rnahybrid.Po at am__quote@
+
+distclean-depend:
+	-rm -rf ./$(DEPDIR)
+
+.c.o:
+ at am__fastdepCC_TRUE@	if $(COMPILE) -MT $@ -MD -MP -MF "$(DEPDIR)/$*.Tpo" \
+ at am__fastdepCC_TRUE@	  -c -o $@ `test -f '$<' || echo '$(srcdir)/'`$<; \
+ at am__fastdepCC_TRUE@	then mv "$(DEPDIR)/$*.Tpo" "$(DEPDIR)/$*.Po"; \
+ at am__fastdepCC_TRUE@	else rm -f "$(DEPDIR)/$*.Tpo"; exit 1; \
+ at am__fastdepCC_TRUE@	fi
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@	source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@	depfile='$(DEPDIR)/$*.Po' tmpdepfile='$(DEPDIR)/$*.TPo' @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@	$(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@	$(COMPILE) -c `test -f '$<' || echo '$(srcdir)/'`$<
+
+.c.obj:
+ at am__fastdepCC_TRUE@	if $(COMPILE) -MT $@ -MD -MP -MF "$(DEPDIR)/$*.Tpo" \
+ at am__fastdepCC_TRUE@	  -c -o $@ `if test -f '$<'; then $(CYGPATH_W) '$<'; else $(CYGPATH_W) '$(srcdir)/$<'; fi`; \
+ at am__fastdepCC_TRUE@	then mv "$(DEPDIR)/$*.Tpo" "$(DEPDIR)/$*.Po"; \
+ at am__fastdepCC_TRUE@	else rm -f "$(DEPDIR)/$*.Tpo"; exit 1; \
+ at am__fastdepCC_TRUE@	fi
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@	source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@	depfile='$(DEPDIR)/$*.Po' tmpdepfile='$(DEPDIR)/$*.TPo' @AMDEPBACKSLASH@
+ at AMDEP_TRUE@@am__fastdepCC_FALSE@	$(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
+ at am__fastdepCC_FALSE@	$(COMPILE) -c `if test -f '$<'; then $(CYGPATH_W) '$<'; else $(CYGPATH_W) '$(srcdir)/$<'; fi`
+uninstall-info-am:
+
+ETAGS = etags
+ETAGSFLAGS =
+
+CTAGS = ctags
+CTAGSFLAGS =
+
+tags: TAGS
+
+ID: $(HEADERS) $(SOURCES) $(LISP) $(TAGS_FILES)
+	list='$(SOURCES) $(HEADERS) $(LISP) $(TAGS_FILES)'; \
+	unique=`for i in $$list; do \
+	    if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+	  done | \
+	  $(AWK) '    { files[$$0] = 1; } \
+	       END { for (i in files) print i; }'`; \
+	mkid -fID $$unique
+
+TAGS:  $(HEADERS) $(SOURCES)  $(TAGS_DEPENDENCIES) \
+		$(TAGS_FILES) $(LISP)
+	tags=; \
+	here=`pwd`; \
+	list='$(SOURCES) $(HEADERS)  $(LISP) $(TAGS_FILES)'; \
+	unique=`for i in $$list; do \
+	    if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+	  done | \
+	  $(AWK) '    { files[$$0] = 1; } \
+	       END { for (i in files) print i; }'`; \
+	test -z "$(ETAGS_ARGS)$$tags$$unique" \
+	  || $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
+	     $$tags $$unique
+
+ctags: CTAGS
+CTAGS:  $(HEADERS) $(SOURCES)  $(TAGS_DEPENDENCIES) \
+		$(TAGS_FILES) $(LISP)
+	tags=; \
+	here=`pwd`; \
+	list='$(SOURCES) $(HEADERS)  $(LISP) $(TAGS_FILES)'; \
+	unique=`for i in $$list; do \
+	    if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
+	  done | \
+	  $(AWK) '    { files[$$0] = 1; } \
+	       END { for (i in files) print i; }'`; \
+	test -z "$(CTAGS_ARGS)$$tags$$unique" \
+	  || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
+	     $$tags $$unique
+
+GTAGS:
+	here=`$(am__cd) $(top_builddir) && pwd` \
+	  && cd $(top_srcdir) \
+	  && gtags -i $(GTAGS_ARGS) $$here
+
+distclean-tags:
+	-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
+
+top_distdir = ..
+distdir = $(top_distdir)/$(PACKAGE)-$(VERSION)
+
+distdir: $(DISTFILES)
+	@srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`; \
+	topsrcdirstrip=`echo "$(top_srcdir)" | sed 's|.|.|g'`; \
+	list='$(DISTFILES)'; for file in $$list; do \
+	  case $$file in \
+	    $(srcdir)/*) file=`echo "$$file" | sed "s|^$$srcdirstrip/||"`;; \
+	    $(top_srcdir)/*) file=`echo "$$file" | sed "s|^$$topsrcdirstrip/|$(top_builddir)/|"`;; \
+	  esac; \
+	  if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
+	  dir=`echo "$$file" | sed -e 's,/[^/]*$$,,'`; \
+	  if test "$$dir" != "$$file" && test "$$dir" != "."; then \
+	    dir="/$$dir"; \
+	    $(mkinstalldirs) "$(distdir)$$dir"; \
+	  else \
+	    dir=''; \
+	  fi; \
+	  if test -d $$d/$$file; then \
+	    if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
+	      cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \
+	    fi; \
+	    cp -pR $$d/$$file $(distdir)$$dir || exit 1; \
+	  else \
+	    test -f $(distdir)/$$file \
+	    || cp -p $$d/$$file $(distdir)/$$file \
+	    || exit 1; \
+	  fi; \
+	done
+check-am: all-am
+check: check-am
+all-am: Makefile $(PROGRAMS)
+
+installdirs:
+	$(mkinstalldirs) $(DESTDIR)$(bindir)
+
+install: install-am
+install-exec: install-exec-am
+install-data: install-data-am
+uninstall: uninstall-am
+
+install-am: all-am
+	@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
+
+installcheck: installcheck-am
+install-strip:
+	$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
+	  INSTALL_STRIP_FLAG=-s \
+	  `test -z '$(STRIP)' || \
+	    echo "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'"` install
+mostlyclean-generic:
+
+clean-generic:
+
+distclean-generic:
+	-rm -f Makefile $(CONFIG_CLEAN_FILES)
+
+maintainer-clean-generic:
+	@echo "This command is intended for maintainers to use"
+	@echo "it deletes files that may require special tools to rebuild."
+clean: clean-am
+
+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
+
+distclean: distclean-am
+
+distclean-am: clean-am distclean-compile distclean-depend \
+	distclean-generic distclean-tags
+
+dvi: dvi-am
+
+dvi-am:
+
+info: info-am
+
+info-am:
+
+install-data-am:
+
+install-exec-am: install-binPROGRAMS
+
+install-info: install-info-am
+
+install-man:
+
+installcheck-am:
+
+maintainer-clean: maintainer-clean-am
+
+maintainer-clean-am: distclean-am maintainer-clean-generic
+
+mostlyclean: mostlyclean-am
+
+mostlyclean-am: mostlyclean-compile mostlyclean-generic
+
+pdf: pdf-am
+
+pdf-am:
+
+ps: ps-am
+
+ps-am:
+
+uninstall-am: uninstall-binPROGRAMS uninstall-info-am
+
+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \
+	clean-generic ctags distclean distclean-compile \
+	distclean-depend distclean-generic distclean-tags distdir dvi \
+	dvi-am info info-am install install-am install-binPROGRAMS \
+	install-data install-data-am install-exec install-exec-am \
+	install-info install-info-am install-man install-strip \
+	installcheck installcheck-am installdirs maintainer-clean \
+	maintainer-clean-generic mostlyclean mostlyclean-compile \
+	mostlyclean-generic pdf pdf-am ps ps-am tags uninstall \
+	uninstall-am uninstall-binPROGRAMS uninstall-info-am
+
+# Tell versions [3.59,3.63) of GNU make to not export all variables.
+# Otherwise a system limit (for SysV at least) may be exceeded.
+.NOEXPORT:
Added: trunk/packages/rnahybrid/branches/upstream/current/src/energy.c
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/energy.c	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/energy.c	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,12783 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#include "energy.h"
+
+void init_constants()
+{
+  e = 2.718281828459;
+  t = 273.15;
+  temp = t + 37.0;
+  r = 8.3143;
+
+  wkn = 0.83;
+
+  npp = 0.2;
+  pbp = 0.1 * wkn;
+
+  mloop_close = 4.6;
+  free_base_penalty = 0.4;
+  helix_penalty = 0.1;
+}
+
+
+#define compl(I,J) canPair[I][J]
+
+
+double sr_energy(int i, int j){
+  return(stack_dg_ar[inpx(i)][inpx(i+1)][inpy(j+1)][inpy(j)]);
+}
+
+
+double dr_energy(int i, int j){
+  return(dr_dangle_dg_ar[inpx(i)][inpy(j)][inpy(j-1)]);
+}
+
+double dli_energy(int i, int j){
+  return(dr_dangle_dg_ar[inpy(j)][inpx(i)][inpx(i+1)]);
+}
+
+double dl_energy(int i, int j){
+  return(dl_dangle_dg_ar[inpx(i-1)][inpx(i)][inpy(j)]);
+}
+
+double dri_energy(int i, int j){
+  return(dl_dangle_dg_ar[inpy(j+1)][inpy(j)][inpx(i)]);
+}
+
+ 
+double dangles (int i, int j, int i2, int j2, int k, int l, int k2,int l2) {
+  return((dli_energy(j,k+1)+dri_energy(j2,k2+1))*wkn);
+}
+
+double sspenalty(int a){
+  return(npp*a);
+}
+
+double log_interp(int size){
+  return(1.079*log(((double)size)/30.0));
+}
+
+
+double hl_ent(int size){
+  return (size<=30 ? hl_ent_ar[size] : hl_ent_ar[30] + log_interp(size));
+}
+
+double bl_ent(int size){
+  return (size<=30 ? bl_ent_ar[size] : bl_ent_ar[30] + log_interp(size));
+}
+
+#define il_ent(size) ((size)<=30 ? il_ent_ar[(size)] : il_ent_ar[30] + log_interp((size)))
+
+int lengthOf(int i, int j){
+  return(j-i);
+}
+
+
+void init_il_asym_ar()
+{
+  int i, j;
+
+  for (i=1; i<=15; i++)
+    for (j=1; j<=15; j++)
+      il_asym_ar[i][j] = min(3.0, abs(i-j)*0.3);
+}
+
+
+/* double il_asym (int sl, int sr){ */
+/*   return(min(3.0, abs(sl-sr)*0.3)); */
+/* } */
+
+
+double bl_stacking (int t, int b, int i, int j){
+  if ((t==0) && (b==1)) return(stack_dg_ar[inpx(i)][inpx(i+1)][inpy(j+2)][inpy(j)]);
+  else if ((t==1) && (b==0)) return(stack_dg_ar[inpx(i)][inpx(i+2)][inpy(j+1)][inpy(j)]);
+  else return(0);
+}
+
+
+
+
+double int_special(int i, int j, int t, int b)
+{
+  if ((t==1) && (b==1)) return(int11_ar[inpx(i)][inpy(j)][inpx(i+1)][inpy(j+1)][inpx(i+2)][inpy(j+2)]);
+  else if ((t==1) && (b==2)) return(int21_ar[inpx(i)][inpy(j)][inpx(i+1)][inpy(j+1)][inpy(j+2)][inpx(i+2)][inpy(j+3)]);
+  else if ((t==2) && (b==1)) return(int21_ar[inpy(j+2)][inpx(i+3)][inpy(j+1)][inpx(i+2)][inpx(i+1)][inpy(j)][inpx(i)]);
+  else if ((t==2) && (b==2)) return(int22_ar[inpx(i)][inpy(j)][inpx(i+1)][inpx(i+2)][inpy(j+1)][inpy(j+2)][inpx(i+3)][inpy(j+3)]);
+}
+
+
+double do_il_special(int i, int j, int k, int l, int u, int v, double e)
+{
+  return(e+int_special(i,j,l-k,v-u));
+}
+
+
+/* double do_il(int i, int j, int k, int l, int u, int v, double e){ */
+/*   return(e+ il_stack_close (l+1,v+1) + il_ent (l-k+v-u) + il_asym (l-k,v-u)); */
+/* } */
+
+
+void init_hl_ent_ar()
+{
+
+  int i;
+  for(i=0;i<=2;i++) hl_ent_ar[i] = 0;
+
+  hl_ent_ar[ 3] = 5.7000;
+  hl_ent_ar[ 4] = 5.6000;
+  hl_ent_ar[ 5] = 5.6000;
+  hl_ent_ar[ 6] = 5.4000;
+  hl_ent_ar[ 7] = 5.9000;
+  hl_ent_ar[ 8] = 5.6000;
+  hl_ent_ar[ 9] = 6.4000;
+  hl_ent_ar[10] = 6.5000;
+  hl_ent_ar[11] = 6.6000;
+  hl_ent_ar[12] = 6.7000;
+  hl_ent_ar[13] = 6.7800;
+  hl_ent_ar[14] = 6.8600;
+  hl_ent_ar[15] = 6.9400;
+  hl_ent_ar[16] = 7.0100;
+  hl_ent_ar[17] = 7.0700;
+  hl_ent_ar[18] = 7.1300;
+  hl_ent_ar[19] = 7.1900;
+  hl_ent_ar[20] = 7.2500;
+  hl_ent_ar[21] = 7.3000;
+  hl_ent_ar[22] = 7.3500;
+  hl_ent_ar[23] = 7.4000;
+  hl_ent_ar[24] = 7.4400;
+  hl_ent_ar[25] = 7.4900;
+  hl_ent_ar[26] = 7.5300;
+  hl_ent_ar[27] = 7.5700;
+  hl_ent_ar[28] = 7.6100;
+  hl_ent_ar[29] = 7.6500;
+  hl_ent_ar[30] = 7.6900;
+}
+
+void init_stack_dg_ar()
+{
+
+  int i,j,k,l;
+  for(i=0;i<ALPHASIZE;i++) for(j=0;j<ALPHASIZE;j++) for(k=0;k<ALPHASIZE;k++) for(l=0;l<ALPHASIZE;l++) stack_dg_ar[i][j][k][l] = 0;
+
+  stack_dg_ar[A][A][U][U] = -0.900;
+  stack_dg_ar[A][C][G][U] = -2.200;
+  stack_dg_ar[A][G][C][U] = -2.100;
+  stack_dg_ar[A][G][U][U] = -0.600;
+  stack_dg_ar[A][U][A][U] = -1.100;
+  stack_dg_ar[A][U][G][U] = -1.400;
+  stack_dg_ar[C][A][U][G] = -2.100;
+  stack_dg_ar[C][C][G][G] = -3.300;
+  stack_dg_ar[C][G][C][G] = -2.400;
+  stack_dg_ar[C][G][U][G] = -1.400;
+  stack_dg_ar[C][U][A][G] = -2.100;
+  stack_dg_ar[C][U][G][G] = -2.100;
+  stack_dg_ar[G][A][U][C] = -2.400;
+  stack_dg_ar[G][A][U][U] = -1.300;
+  stack_dg_ar[G][C][G][C] = -3.400;
+  stack_dg_ar[G][C][G][U] = -2.500;
+  stack_dg_ar[G][G][C][C] = -3.300;
+  stack_dg_ar[G][G][C][U] = -2.100;
+  stack_dg_ar[G][G][U][C] = -1.500;
+  stack_dg_ar[G][G][U][U] = -0.500;
+  stack_dg_ar[G][U][A][C] = -2.200;
+  stack_dg_ar[G][U][A][U] = -1.400;
+  stack_dg_ar[G][U][G][C] = -2.500;
+  stack_dg_ar[G][U][G][U] =  1.300;
+  stack_dg_ar[U][A][U][A] = -1.300;
+  stack_dg_ar[U][A][U][G] = -1.000;
+  stack_dg_ar[U][C][G][A] = -2.400;
+  stack_dg_ar[U][C][G][G] = -1.500;
+  stack_dg_ar[U][G][C][A] = -2.100;
+  stack_dg_ar[U][G][C][G] = -1.400;
+  stack_dg_ar[U][G][U][A] = -1.000;
+  stack_dg_ar[U][G][U][G] =  0.300;
+  stack_dg_ar[U][U][A][A] = -0.900;
+  stack_dg_ar[U][U][A][G] = -0.600;
+  stack_dg_ar[U][U][G][A] = -1.300;
+  stack_dg_ar[U][U][G][G] = -0.500;
+}
+
+void init_tstackh_dg_ar()
+{
+
+  int i,j,k,l;
+  for(i=0;i<ALPHASIZE;i++) for(j=0;j<ALPHASIZE;j++) for(k=0;k<ALPHASIZE;k++) for(l=0;l<ALPHASIZE;l++) tstackh_dg_ar[i][j][k][l] = 0;
+
+  tstackh_dg_ar[A][A][A][U] = -0.300;
+  tstackh_dg_ar[A][A][C][U] = -0.500;
+  tstackh_dg_ar[A][A][G][U] = -0.300;
+  tstackh_dg_ar[A][A][U][U] = -0.300;
+  tstackh_dg_ar[A][C][A][U] = -0.100;
+  tstackh_dg_ar[A][C][C][U] = -0.200;
+  tstackh_dg_ar[A][C][G][U] = -1.500;
+  tstackh_dg_ar[A][C][U][U] = -0.200;
+  tstackh_dg_ar[A][G][A][U] = -1.100;
+  tstackh_dg_ar[A][G][C][U] = -1.200;
+  tstackh_dg_ar[A][G][G][U] = -0.200;
+  tstackh_dg_ar[A][G][U][U] =  0.200;
+  tstackh_dg_ar[A][U][A][U] = -0.300;
+  tstackh_dg_ar[A][U][C][U] = -0.300;
+  tstackh_dg_ar[A][U][G][U] = -0.600;
+  tstackh_dg_ar[A][U][U][U] = -1.100;
+  tstackh_dg_ar[C][A][A][G] = -1.500;
+  tstackh_dg_ar[C][A][C][G] = -1.500;
+  tstackh_dg_ar[C][A][G][G] = -1.400;
+  tstackh_dg_ar[C][A][U][G] = -1.800;
+  tstackh_dg_ar[C][C][A][G] = -1.000;
+  tstackh_dg_ar[C][C][C][G] = -0.900;
+  tstackh_dg_ar[C][C][G][G] = -2.900;
+  tstackh_dg_ar[C][C][U][G] = -0.800;
+  tstackh_dg_ar[C][G][A][G] = -2.200;
+  tstackh_dg_ar[C][G][C][G] = -2.000;
+  tstackh_dg_ar[C][G][G][G] = -1.600;
+  tstackh_dg_ar[C][G][U][G] = -1.100;
+  tstackh_dg_ar[C][U][A][G] = -1.700;
+  tstackh_dg_ar[C][U][C][G] = -1.400;
+  tstackh_dg_ar[C][U][G][G] = -1.800;
+  tstackh_dg_ar[C][U][U][G] = -2.000;
+  tstackh_dg_ar[G][A][A][C] = -1.100;
+  tstackh_dg_ar[G][A][A][U] =  0.200;
+  tstackh_dg_ar[G][A][C][C] = -1.500;
+  tstackh_dg_ar[G][A][C][U] = -0.500;
+  tstackh_dg_ar[G][A][G][C] = -1.300;
+  tstackh_dg_ar[G][A][G][U] = -0.300;
+  tstackh_dg_ar[G][A][U][C] = -2.100;
+  tstackh_dg_ar[G][A][U][U] = -0.300;
+  tstackh_dg_ar[G][C][A][C] = -1.100;
+  tstackh_dg_ar[G][C][A][U] = -0.100;
+  tstackh_dg_ar[G][C][C][C] = -0.700;
+  tstackh_dg_ar[G][C][C][U] = -0.200;
+  tstackh_dg_ar[G][C][G][C] = -2.400;
+  tstackh_dg_ar[G][C][G][U] = -1.500;
+  tstackh_dg_ar[G][C][U][C] = -0.500;
+  tstackh_dg_ar[G][C][U][U] = -0.200;
+  tstackh_dg_ar[G][G][A][C] = -2.400;
+  tstackh_dg_ar[G][G][A][U] = -0.900;
+  tstackh_dg_ar[G][G][C][C] = -2.900;
+  tstackh_dg_ar[G][G][C][U] = -1.100;
+  tstackh_dg_ar[G][G][G][C] = -1.400;
+  tstackh_dg_ar[G][G][G][U] = -0.300;
+  tstackh_dg_ar[G][G][U][C] = -1.200;
+  tstackh_dg_ar[G][G][U][U] =  0.000;
+  tstackh_dg_ar[G][U][A][C] = -1.900;
+  tstackh_dg_ar[G][U][A][U] = -0.300;
+  tstackh_dg_ar[G][U][C][C] = -1.000;
+  tstackh_dg_ar[G][U][C][U] = -0.300;
+  tstackh_dg_ar[G][U][G][C] = -2.200;
+  tstackh_dg_ar[G][U][G][U] = -0.400;
+  tstackh_dg_ar[G][U][U][C] = -1.500;
+  tstackh_dg_ar[G][U][U][U] = -1.100;
+  tstackh_dg_ar[U][A][A][A] = -0.500;
+  tstackh_dg_ar[U][A][A][G] = -0.500;
+  tstackh_dg_ar[U][A][C][A] = -0.300;
+  tstackh_dg_ar[U][A][C][G] = -0.300;
+  tstackh_dg_ar[U][A][G][A] = -0.600;
+  tstackh_dg_ar[U][A][G][G] = -0.600;
+  tstackh_dg_ar[U][A][U][A] = -0.500;
+  tstackh_dg_ar[U][A][U][G] = -0.500;
+  tstackh_dg_ar[U][C][A][A] = -0.200;
+  tstackh_dg_ar[U][C][A][G] = -0.200;
+  tstackh_dg_ar[U][C][C][A] = -0.100;
+  tstackh_dg_ar[U][C][C][G] = -0.100;
+  tstackh_dg_ar[U][C][G][A] = -1.200;
+  tstackh_dg_ar[U][C][G][G] = -1.700;
+  tstackh_dg_ar[U][C][U][A] =  0.000;
+  tstackh_dg_ar[U][C][U][G] =  0.000;
+  tstackh_dg_ar[U][G][A][A] = -1.400;
+  tstackh_dg_ar[U][G][A][G] = -0.800;
+  tstackh_dg_ar[U][G][C][A] = -1.200;
+  tstackh_dg_ar[U][G][C][G] = -1.200;
+  tstackh_dg_ar[U][G][G][A] = -0.700;
+  tstackh_dg_ar[U][G][G][G] = -0.300;
+  tstackh_dg_ar[U][G][U][A] = -0.200;
+  tstackh_dg_ar[U][G][U][G] = -0.700;
+  tstackh_dg_ar[U][U][A][A] = -0.300;
+  tstackh_dg_ar[U][U][A][G] = -0.600;
+  tstackh_dg_ar[U][U][C][A] = -0.100;
+  tstackh_dg_ar[U][U][C][G] = -0.100;
+  tstackh_dg_ar[U][U][G][A] = -0.500;
+  tstackh_dg_ar[U][U][G][G] = -0.600;
+  tstackh_dg_ar[U][U][U][A] = -0.800;
+  tstackh_dg_ar[U][U][U][G] = -0.800;
+
+}
+
+void init_hl_tetra_ar()
+{
+  int k1,k2,k3,k4,k5,k6;
+
+  for (k1=0;k1<ALPHASIZE;k1++)
+    for (k2=0;k2<ALPHASIZE;k2++)
+      for (k3=0;k3<ALPHASIZE;k3++)
+         for (k4=0;k4<ALPHASIZE;k4++)
+            for (k5=0;k5<ALPHASIZE;k5++)
+               for (k6=0;k6<ALPHASIZE;k6++)
+                  hl_tetra_ar[k1][k2][k3][k4][k5][k6]=0.0;
+
+  hl_tetra_ar[G][G][G][G][A][C] = -3.000;
+  hl_tetra_ar[G][G][U][G][A][C] = -3.000;
+  hl_tetra_ar[C][G][A][A][A][G] = -3.000;
+  hl_tetra_ar[G][G][A][G][A][C] = -3.000;
+  hl_tetra_ar[C][G][C][A][A][G] = -3.000;
+  hl_tetra_ar[G][G][A][A][A][C] = -3.000;
+  hl_tetra_ar[C][G][G][A][A][G] = -3.000;
+  hl_tetra_ar[C][U][U][C][G][G] = -3.000;
+  hl_tetra_ar[C][G][U][G][A][G] = -3.000;
+  hl_tetra_ar[C][G][A][A][G][G] = -2.500;
+  hl_tetra_ar[C][U][A][C][G][G] = -2.500;
+  hl_tetra_ar[G][G][C][A][A][C] = -2.500;
+  hl_tetra_ar[C][G][C][G][A][G] = -2.500;
+  hl_tetra_ar[U][G][A][G][A][G] = -2.500;
+  hl_tetra_ar[C][G][A][G][A][G] = -2.000;
+  hl_tetra_ar[A][G][A][A][A][U] = -2.000;
+  hl_tetra_ar[C][G][U][A][A][G] = -2.000;
+  hl_tetra_ar[C][U][A][A][C][G] = -2.000;
+  hl_tetra_ar[U][G][A][A][A][G] = -2.000;
+  hl_tetra_ar[G][G][A][A][G][C] = -1.500;
+  hl_tetra_ar[G][G][G][A][A][C] = -1.500;
+  hl_tetra_ar[U][G][A][A][A][A] = -1.500;
+  hl_tetra_ar[A][G][C][A][A][U] = -1.500;
+  hl_tetra_ar[A][G][U][A][A][U] = -1.500;
+  hl_tetra_ar[C][G][G][G][A][G] = -1.500;
+  hl_tetra_ar[A][G][U][G][A][U] = -1.500;
+  hl_tetra_ar[G][G][C][G][A][C] = -1.500;
+  hl_tetra_ar[G][G][G][A][G][C] = -1.500;
+  hl_tetra_ar[G][U][G][A][A][C] = -1.500;
+  hl_tetra_ar[U][G][G][A][A][A] = -1.500;
+
+}
+
+void init_bl_ent_ar()
+{
+
+  bl_ent_ar[ 0] = 0.0;
+  bl_ent_ar[ 1] = 3.8000;
+  bl_ent_ar[ 2] = 2.8000;
+  bl_ent_ar[ 3] = 3.2000;
+  bl_ent_ar[ 4] = 3.6000;
+  bl_ent_ar[ 5] = 4.0000;
+  bl_ent_ar[ 6] = 4.4000;
+  bl_ent_ar[ 7] = 4.5900;
+  bl_ent_ar[ 8] = 4.7000;
+  bl_ent_ar[ 9] = 4.8000;
+  bl_ent_ar[10] = 4.9000;
+  bl_ent_ar[11] = 5.0000;
+  bl_ent_ar[12] = 5.1000;
+  bl_ent_ar[13] = 5.1900;
+  bl_ent_ar[14] = 5.2700;
+  bl_ent_ar[15] = 5.3400;
+  bl_ent_ar[16] = 5.4100;
+  bl_ent_ar[17] = 5.4800;
+  bl_ent_ar[18] = 5.5400;
+  bl_ent_ar[19] = 5.6000;
+  bl_ent_ar[20] = 5.6500;
+  bl_ent_ar[21] = 5.7100;
+  bl_ent_ar[22] = 5.7600;
+  bl_ent_ar[23] = 5.8000;
+  bl_ent_ar[24] = 5.8500;
+  bl_ent_ar[25] = 5.8900;
+  bl_ent_ar[26] = 5.9400;
+  bl_ent_ar[27] = 5.9800;
+  bl_ent_ar[28] = 6.0200;
+  bl_ent_ar[29] = 6.0500;
+  bl_ent_ar[30] = 6.0900;
+
+}
+
+void init_il_ent_ar()
+{
+
+  il_ent_ar[ 0] = 0.0;
+  il_ent_ar[ 1] = 0.0;
+  il_ent_ar[ 2] = 4.1000;
+  il_ent_ar[ 3] = 5.1000;
+  il_ent_ar[ 4] = 1.7000;
+  il_ent_ar[ 5] = 1.8000;
+  il_ent_ar[ 6] = 2.0000;
+  il_ent_ar[ 7] = 2.2000;
+  il_ent_ar[ 8] = 2.3000;
+  il_ent_ar[ 9] = 2.4000;
+  il_ent_ar[10] = 2.5000;
+  il_ent_ar[11] = 2.6000;
+  il_ent_ar[12] = 2.7000;
+  il_ent_ar[13] = 2.7800;
+  il_ent_ar[14] = 2.8600;
+  il_ent_ar[15] = 2.9400;
+  il_ent_ar[16] = 3.0100;
+  il_ent_ar[17] = 3.0700;
+  il_ent_ar[18] = 3.1300;
+  il_ent_ar[19] = 3.1900;
+  il_ent_ar[20] = 3.2500;
+  il_ent_ar[21] = 3.3000;
+  il_ent_ar[22] = 3.3500;
+  il_ent_ar[23] = 3.4000;
+  il_ent_ar[24] = 3.4500;
+  il_ent_ar[25] = 3.4900;
+  il_ent_ar[26] = 3.5300;
+  il_ent_ar[27] = 3.5700;
+  il_ent_ar[28] = 3.6100;
+  il_ent_ar[29] = 3.6500;
+  il_ent_ar[30] = 3.6900;
+
+
+
+}
+
+void init_tstacki_dg_ar()
+{
+
+  int i,j,k,l;
+  for(i=0;i<ALPHASIZE;i++) for(j=0;j<ALPHASIZE;j++) for(k=0;k<ALPHASIZE;k++) for(l=0;l<ALPHASIZE;l++) tstacki_dg_ar[i][j][k][l] = 0;
+
+  tstacki_dg_ar[A][A][A][U] =  0.700;
+  tstacki_dg_ar[A][A][C][U] =  0.700;
+  tstacki_dg_ar[A][A][G][U] = -0.400;
+  tstacki_dg_ar[A][A][U][U] =  0.700;
+  tstacki_dg_ar[A][C][A][U] =  0.700;
+  tstacki_dg_ar[A][C][C][U] =  0.700;
+  tstacki_dg_ar[A][C][G][U] =  0.700;
+  tstacki_dg_ar[A][C][U][U] =  0.700;
+  tstacki_dg_ar[A][G][A][U] = -0.400;
+  tstacki_dg_ar[A][G][C][U] =  0.700;
+  tstacki_dg_ar[A][G][G][U] =  0.700;
+  tstacki_dg_ar[A][G][U][U] =  0.700;
+  tstacki_dg_ar[A][U][A][U] =  0.700;
+  tstacki_dg_ar[A][U][C][U] =  0.700;
+  tstacki_dg_ar[A][U][G][U] =  0.700;
+  tstacki_dg_ar[A][U][U][U] =  0.000;
+  tstacki_dg_ar[C][A][A][G] =  0.000;
+  tstacki_dg_ar[C][A][C][G] =  0.000;
+  tstacki_dg_ar[C][A][G][G] = -1.100;
+  tstacki_dg_ar[C][A][U][G] =  0.000;
+  tstacki_dg_ar[C][C][A][G] =  0.000;
+  tstacki_dg_ar[C][C][C][G] =  0.000;
+  tstacki_dg_ar[C][C][G][G] =  0.000;
+  tstacki_dg_ar[C][C][U][G] =  0.000;
+  tstacki_dg_ar[C][G][A][G] = -1.100;
+  tstacki_dg_ar[C][G][C][G] =  0.000;
+  tstacki_dg_ar[C][G][G][G] =  0.000;
+  tstacki_dg_ar[C][G][U][G] =  0.000;
+  tstacki_dg_ar[C][U][A][G] =  0.000;
+  tstacki_dg_ar[C][U][C][G] =  0.000;
+  tstacki_dg_ar[C][U][G][G] =  0.000;
+  tstacki_dg_ar[C][U][U][G] = -0.700;
+  tstacki_dg_ar[G][A][A][C] =  0.000;
+  tstacki_dg_ar[G][A][A][U] =  0.700;
+  tstacki_dg_ar[G][A][C][C] =  0.000;
+  tstacki_dg_ar[G][A][C][U] =  0.700;
+  tstacki_dg_ar[G][A][G][C] = -1.100;
+  tstacki_dg_ar[G][A][G][U] = -0.400;
+  tstacki_dg_ar[G][A][U][C] =  0.000;
+  tstacki_dg_ar[G][A][U][U] =  0.700;
+  tstacki_dg_ar[G][C][A][C] =  0.000;
+  tstacki_dg_ar[G][C][A][U] =  0.700;
+  tstacki_dg_ar[G][C][C][C] =  0.000;
+  tstacki_dg_ar[G][C][C][U] =  0.700;
+  tstacki_dg_ar[G][C][G][C] =  0.000;
+  tstacki_dg_ar[G][C][G][U] =  0.700;
+  tstacki_dg_ar[G][C][U][C] =  0.000;
+  tstacki_dg_ar[G][C][U][U] =  0.700;
+  tstacki_dg_ar[G][G][A][C] = -1.100;
+  tstacki_dg_ar[G][G][A][U] = -0.400;
+  tstacki_dg_ar[G][G][C][C] =  0.000;
+  tstacki_dg_ar[G][G][C][U] =  0.700;
+  tstacki_dg_ar[G][G][G][C] =  0.000;
+  tstacki_dg_ar[G][G][G][U] =  0.700;
+  tstacki_dg_ar[G][G][U][C] =  0.000;
+  tstacki_dg_ar[G][G][U][U] =  0.700;
+  tstacki_dg_ar[G][U][A][C] =  0.000;
+  tstacki_dg_ar[G][U][A][U] =  0.700;
+  tstacki_dg_ar[G][U][C][C] =  0.000;
+  tstacki_dg_ar[G][U][C][U] =  0.700;
+  tstacki_dg_ar[G][U][G][C] =  0.000;
+  tstacki_dg_ar[G][U][G][U] =  0.700;
+  tstacki_dg_ar[G][U][U][C] = -0.700;
+  tstacki_dg_ar[G][U][U][U] =  0.000;
+  tstacki_dg_ar[U][A][A][A] =  0.700;
+  tstacki_dg_ar[U][A][A][G] =  0.700;
+  tstacki_dg_ar[U][A][C][A] =  0.700;
+  tstacki_dg_ar[U][A][C][G] =  0.700;
+  tstacki_dg_ar[U][A][G][A] = -0.400;
+  tstacki_dg_ar[U][A][G][G] = -0.400;
+  tstacki_dg_ar[U][A][U][A] =  0.700;
+  tstacki_dg_ar[U][A][U][G] =  0.700;
+  tstacki_dg_ar[U][C][A][A] =  0.700;
+  tstacki_dg_ar[U][C][A][G] =  0.700;
+  tstacki_dg_ar[U][C][C][A] =  0.700;
+  tstacki_dg_ar[U][C][C][G] =  0.700;
+  tstacki_dg_ar[U][C][G][A] =  0.700;
+  tstacki_dg_ar[U][C][G][G] =  0.700;
+  tstacki_dg_ar[U][C][U][A] =  0.700;
+  tstacki_dg_ar[U][C][U][G] =  0.700;
+  tstacki_dg_ar[U][G][A][A] = -0.400;
+  tstacki_dg_ar[U][G][A][G] = -0.400;
+  tstacki_dg_ar[U][G][C][A] =  0.700;
+  tstacki_dg_ar[U][G][C][G] =  0.700;
+  tstacki_dg_ar[U][G][G][A] =  0.700;
+  tstacki_dg_ar[U][G][G][G] =  0.700;
+  tstacki_dg_ar[U][G][U][A] =  0.700;
+  tstacki_dg_ar[U][G][U][G] =  0.700;
+  tstacki_dg_ar[U][U][A][A] =  0.700;
+  tstacki_dg_ar[U][U][A][G] =  0.700;
+  tstacki_dg_ar[U][U][C][A] =  0.700;
+  tstacki_dg_ar[U][U][C][G] =  0.700;
+  tstacki_dg_ar[U][U][G][A] =  0.700;
+  tstacki_dg_ar[U][U][G][G] =  0.700;
+  tstacki_dg_ar[U][U][U][A] =  0.000;
+  tstacki_dg_ar[U][U][U][G] =  0.000;
+}
+
+void init_dr_dangle_dg_ar()
+{
+  int i,j,k;
+  for(i=0;i<ALPHASIZE;i++) for(j=0;j<ALPHASIZE;j++) for(k=0;k<=ALPHASIZE;k++) dr_dangle_dg_ar[i][j][k] = 0;
+
+  dr_dangle_dg_ar[A][U][A] = -0.700;
+  dr_dangle_dg_ar[A][U][C] = -0.100;
+  dr_dangle_dg_ar[A][U][G] = -0.700;
+  dr_dangle_dg_ar[A][U][U] = -0.100;
+  dr_dangle_dg_ar[C][G][A] = -1.100;
+  dr_dangle_dg_ar[C][G][C] = -0.400;
+  dr_dangle_dg_ar[C][G][G] = -1.300;
+  dr_dangle_dg_ar[C][G][U] = -0.600;
+  dr_dangle_dg_ar[G][C][A] = -1.700;
+  dr_dangle_dg_ar[G][C][C] = -0.800;
+  dr_dangle_dg_ar[G][C][G] = -1.700;
+  dr_dangle_dg_ar[G][C][U] = -1.200;
+  dr_dangle_dg_ar[G][U][A] = -0.700;
+  dr_dangle_dg_ar[G][U][C] = -0.100;
+  dr_dangle_dg_ar[G][U][G] = -0.700;
+  dr_dangle_dg_ar[G][U][U] = -0.100;
+  dr_dangle_dg_ar[U][A][A] = -0.800;
+  dr_dangle_dg_ar[U][A][C] = -0.500;
+  dr_dangle_dg_ar[U][A][G] = -0.800;
+  dr_dangle_dg_ar[U][A][U] = -0.600;
+  dr_dangle_dg_ar[U][G][A] = -0.800;
+  dr_dangle_dg_ar[U][G][C] = -0.500;
+  dr_dangle_dg_ar[U][G][G] = -0.800;
+  dr_dangle_dg_ar[U][G][U] = -0.600;
+
+}
+
+void init_dl_dangle_dg_ar()
+{
+  int i,j,k;
+  for(i=0;i<=ALPHASIZE;i++) for(j=0;j<ALPHASIZE;j++) for(k=0;k<ALPHASIZE;k++) dl_dangle_dg_ar[i][j][k] = 0;
+
+  dl_dangle_dg_ar[A][A][U] = -0.300;
+  dl_dangle_dg_ar[C][A][U] = -0.300;
+  dl_dangle_dg_ar[G][A][U] = -0.400;
+  dl_dangle_dg_ar[U][A][U] = -0.200;
+  dl_dangle_dg_ar[A][C][G] = -0.500;
+  dl_dangle_dg_ar[C][C][G] = -0.300;
+  dl_dangle_dg_ar[G][C][G] = -0.200;
+  dl_dangle_dg_ar[U][C][G] = -0.100;
+  dl_dangle_dg_ar[A][G][C] = -0.200;
+  dl_dangle_dg_ar[C][G][C] = -0.300;
+  dl_dangle_dg_ar[G][G][C] =  0.000;
+  dl_dangle_dg_ar[U][G][C] =  0.000;
+  dl_dangle_dg_ar[A][G][U] = -0.300;
+  dl_dangle_dg_ar[C][G][U] = -0.300;
+  dl_dangle_dg_ar[G][G][U] = -0.400;
+  dl_dangle_dg_ar[U][G][U] = -0.200;
+  dl_dangle_dg_ar[A][U][A] = -0.300;
+  dl_dangle_dg_ar[C][U][A] = -0.100;
+  dl_dangle_dg_ar[G][U][A] = -0.200;
+  dl_dangle_dg_ar[U][U][A] = -0.200;
+  dl_dangle_dg_ar[A][U][G] = -0.300;
+  dl_dangle_dg_ar[C][U][G] = -0.100;
+  dl_dangle_dg_ar[G][U][G] = -0.200;
+  dl_dangle_dg_ar[U][U][G] = -0.200;
+
+}
+
+void init_int11_ar()
+{
+  int k1,k2,k3,k4,k5,k6;
+
+  for (k1=0;k1<ALPHASIZE;k1++)
+    for (k2=0;k2<ALPHASIZE;k2++)
+      for (k3=0;k3<ALPHASIZE;k3++)
+         for (k4=0;k4<ALPHASIZE;k4++)
+            for (k5=0;k5<ALPHASIZE;k5++)
+               for (k6=0;k6<ALPHASIZE;k6++)
+                  int11_ar[k1][k2][k3][k4][k5][k6]=0.0;
+
+ int11_ar[A][U][A][A][A][U] =  1.700;
+ int11_ar[A][U][A][C][A][U] =  1.700;
+ int11_ar[A][U][A][G][A][U] =  1.700;
+ int11_ar[A][U][A][U][A][U] =  1.700;
+ int11_ar[A][U][C][A][A][U] =  1.700;
+ int11_ar[A][U][C][C][A][U] =  1.700;
+ int11_ar[A][U][C][G][A][U] =  1.700;
+ int11_ar[A][U][C][U][A][U] =  1.700;
+ int11_ar[A][U][G][A][A][U] =  1.700;
+ int11_ar[A][U][G][C][A][U] =  1.700;
+ int11_ar[A][U][G][G][A][U] = -0.400;
+ int11_ar[A][U][G][U][A][U] =  1.700;
+ int11_ar[A][U][U][A][A][U] =  1.700;
+ int11_ar[A][U][U][C][A][U] =  1.700;
+ int11_ar[A][U][U][G][A][U] =  1.700;
+ int11_ar[A][U][U][U][A][U] =  1.200;
+ int11_ar[A][U][A][A][C][G] =  1.100;
+ int11_ar[A][U][A][C][C][G] =  1.100;
+ int11_ar[A][U][A][G][C][G] =  1.100;
+ int11_ar[A][U][A][U][C][G] =  1.100;
+ int11_ar[A][U][C][A][C][G] =  1.100;
+ int11_ar[A][U][C][C][C][G] =  1.100;
+ int11_ar[A][U][C][G][C][G] =  1.100;
+ int11_ar[A][U][C][U][C][G] =  1.100;
+ int11_ar[A][U][G][A][C][G] =  1.100;
+ int11_ar[A][U][G][C][C][G] =  1.100;
+ int11_ar[A][U][G][G][C][G] = -1.000;
+ int11_ar[A][U][G][U][C][G] =  1.100;
+ int11_ar[A][U][U][A][C][G] =  1.100;
+ int11_ar[A][U][U][C][C][G] =  1.100;
+ int11_ar[A][U][U][G][C][G] =  1.100;
+ int11_ar[A][U][U][U][C][G] =  1.100;
+ int11_ar[A][U][A][A][G][C] =  1.100;
+ int11_ar[A][U][A][C][G][C] =  1.100;
+ int11_ar[A][U][A][G][G][C] =  1.100;
+ int11_ar[A][U][A][U][G][C] =  1.100;
+ int11_ar[A][U][C][A][G][C] =  1.100;
+ int11_ar[A][U][C][C][G][C] =  1.100;
+ int11_ar[A][U][C][G][G][C] =  1.100;
+ int11_ar[A][U][C][U][G][C] =  1.100;
+ int11_ar[A][U][G][A][G][C] =  1.100;
+ int11_ar[A][U][G][C][G][C] =  1.100;
+ int11_ar[A][U][G][G][G][C] = -1.000;
+ int11_ar[A][U][G][U][G][C] =  1.100;
+ int11_ar[A][U][U][A][G][C] =  1.100;
+ int11_ar[A][U][U][C][G][C] =  1.100;
+ int11_ar[A][U][U][G][G][C] =  1.100;
+ int11_ar[A][U][U][U][G][C] =  1.000;
+ int11_ar[A][U][A][A][G][U] =  1.700;
+ int11_ar[A][U][A][C][G][U] =  1.700;
+ int11_ar[A][U][A][G][G][U] =  1.700;
+ int11_ar[A][U][A][U][G][U] =  1.700;
+ int11_ar[A][U][C][A][G][U] =  1.700;
+ int11_ar[A][U][C][C][G][U] =  1.700;
+ int11_ar[A][U][C][G][G][U] =  1.700;
+ int11_ar[A][U][C][U][G][U] =  1.700;
+ int11_ar[A][U][G][A][G][U] =  1.700;
+ int11_ar[A][U][G][C][G][U] =  1.700;
+ int11_ar[A][U][G][G][G][U] = -0.400;
+ int11_ar[A][U][G][U][G][U] =  1.700;
+ int11_ar[A][U][U][A][G][U] =  1.700;
+ int11_ar[A][U][U][C][G][U] =  1.700;
+ int11_ar[A][U][U][G][G][U] =  1.700;
+ int11_ar[A][U][U][U][G][U] =  1.700;
+ int11_ar[A][U][A][A][U][A] =  1.700;
+ int11_ar[A][U][A][C][U][A] =  1.700;
+ int11_ar[A][U][A][G][U][A] =  1.700;
+ int11_ar[A][U][A][U][U][A] =  1.700;
+ int11_ar[A][U][C][A][U][A] =  1.700;
+ int11_ar[A][U][C][C][U][A] =  1.700;
+ int11_ar[A][U][C][G][U][A] =  1.700;
+ int11_ar[A][U][C][U][U][A] =  1.700;
+ int11_ar[A][U][G][A][U][A] =  1.700;
+ int11_ar[A][U][G][C][U][A] =  1.700;
+ int11_ar[A][U][G][G][U][A] = -0.400;
+ int11_ar[A][U][G][U][U][A] =  1.700;
+ int11_ar[A][U][U][A][U][A] =  1.700;
+ int11_ar[A][U][U][C][U][A] =  1.700;
+ int11_ar[A][U][U][G][U][A] =  1.700;
+ int11_ar[A][U][U][U][U][A] =  1.500;
+ int11_ar[A][U][A][A][U][G] =  1.700;
+ int11_ar[A][U][A][C][U][G] =  1.700;
+ int11_ar[A][U][A][G][U][G] =  1.700;
+ int11_ar[A][U][A][U][U][G] =  1.700;
+ int11_ar[A][U][C][A][U][G] =  1.700;
+ int11_ar[A][U][C][C][U][G] =  1.700;
+ int11_ar[A][U][C][G][U][G] =  1.700;
+ int11_ar[A][U][C][U][U][G] =  1.700;
+ int11_ar[A][U][G][A][U][G] =  1.700;
+ int11_ar[A][U][G][C][U][G] =  1.700;
+ int11_ar[A][U][G][G][U][G] = -0.400;
+ int11_ar[A][U][G][U][U][G] =  1.700;
+ int11_ar[A][U][U][A][U][G] =  1.700;
+ int11_ar[A][U][U][C][U][G] =  1.700;
+ int11_ar[A][U][U][G][U][G] =  1.700;
+ int11_ar[A][U][U][U][U][G] =  1.700;
+ int11_ar[C][G][A][A][A][U] =  1.100;
+ int11_ar[C][G][A][C][A][U] =  1.100;
+ int11_ar[C][G][A][G][A][U] =  1.100;
+ int11_ar[C][G][A][U][A][U] =  1.100;
+ int11_ar[C][G][C][A][A][U] =  1.100;
+ int11_ar[C][G][C][C][A][U] =  1.100;
+ int11_ar[C][G][C][G][A][U] =  1.100;
+ int11_ar[C][G][C][U][A][U] =  1.100;
+ int11_ar[C][G][G][A][A][U] =  1.100;
+ int11_ar[C][G][G][C][A][U] =  1.100;
+ int11_ar[C][G][G][G][A][U] = -1.000;
+ int11_ar[C][G][G][U][A][U] =  1.100;
+ int11_ar[C][G][U][A][A][U] =  1.100;
+ int11_ar[C][G][U][C][A][U] =  1.100;
+ int11_ar[C][G][U][G][A][U] =  1.100;
+ int11_ar[C][G][U][U][A][U] =  1.100;
+ int11_ar[C][G][A][A][C][G] =  1.100;
+ int11_ar[C][G][A][C][C][G] =  0.400;
+ int11_ar[C][G][A][G][C][G] =  0.400;
+ int11_ar[C][G][A][U][C][G] =  0.400;
+ int11_ar[C][G][C][A][C][G] =  0.400;
+ int11_ar[C][G][C][C][C][G] =  0.400;
+ int11_ar[C][G][C][G][C][G] =  0.400;
+ int11_ar[C][G][C][U][C][G] =  0.400;
+ int11_ar[C][G][G][A][C][G] =  0.400;
+ int11_ar[C][G][G][C][C][G] =  0.400;
+ int11_ar[C][G][G][G][C][G] = -1.400;
+ int11_ar[C][G][G][U][C][G] =  0.400;
+ int11_ar[C][G][U][A][C][G] =  0.400;
+ int11_ar[C][G][U][C][C][G] =  0.400;
+ int11_ar[C][G][U][G][C][G] =  0.400;
+ int11_ar[C][G][U][U][C][G] =  0.400;
+ int11_ar[C][G][A][A][G][C] =  0.400;
+ int11_ar[C][G][A][C][G][C] = -0.400;
+ int11_ar[C][G][A][G][G][C] =  0.400;
+ int11_ar[C][G][A][U][G][C] =  0.400;
+ int11_ar[C][G][C][A][G][C] =  0.300;
+ int11_ar[C][G][C][C][G][C] =  0.500;
+ int11_ar[C][G][C][G][G][C] =  0.400;
+ int11_ar[C][G][C][U][G][C] =  0.500;
+ int11_ar[C][G][G][A][G][C] = -0.100;
+ int11_ar[C][G][G][C][G][C] =  0.400;
+ int11_ar[C][G][G][G][G][C] = -1.700;
+ int11_ar[C][G][G][U][G][C] =  0.400;
+ int11_ar[C][G][U][A][G][C] =  0.400;
+ int11_ar[C][G][U][C][G][C] =  0.000;
+ int11_ar[C][G][U][G][G][C] =  0.400;
+ int11_ar[C][G][U][U][G][C] = -0.300;
+ int11_ar[C][G][A][A][G][U] =  1.100;
+ int11_ar[C][G][A][C][G][U] =  1.100;
+ int11_ar[C][G][A][G][G][U] =  1.100;
+ int11_ar[C][G][A][U][G][U] =  1.100;
+ int11_ar[C][G][C][A][G][U] =  1.100;
+ int11_ar[C][G][C][C][G][U] =  1.100;
+ int11_ar[C][G][C][G][G][U] =  1.100;
+ int11_ar[C][G][C][U][G][U] =  1.100;
+ int11_ar[C][G][G][A][G][U] =  1.100;
+ int11_ar[C][G][G][C][G][U] =  1.100;
+ int11_ar[C][G][G][G][G][U] = -1.000;
+ int11_ar[C][G][G][U][G][U] =  1.100;
+ int11_ar[C][G][U][A][G][U] =  1.100;
+ int11_ar[C][G][U][C][G][U] =  1.100;
+ int11_ar[C][G][U][G][G][U] =  1.100;
+ int11_ar[C][G][U][U][G][U] =  1.100;
+ int11_ar[C][G][A][A][U][A] =  1.100;
+ int11_ar[C][G][A][C][U][A] =  1.100;
+ int11_ar[C][G][A][G][U][A] =  1.100;
+ int11_ar[C][G][A][U][U][A] =  1.100;
+ int11_ar[C][G][C][A][U][A] =  1.100;
+ int11_ar[C][G][C][C][U][A] =  1.100;
+ int11_ar[C][G][C][G][U][A] =  1.100;
+ int11_ar[C][G][C][U][U][A] =  1.100;
+ int11_ar[C][G][G][A][U][A] =  1.100;
+ int11_ar[C][G][G][C][U][A] =  1.100;
+ int11_ar[C][G][G][G][U][A] = -1.000;
+ int11_ar[C][G][G][U][U][A] =  1.100;
+ int11_ar[C][G][U][A][U][A] =  1.100;
+ int11_ar[C][G][U][C][U][A] =  1.100;
+ int11_ar[C][G][U][G][U][A] =  1.100;
+ int11_ar[C][G][U][U][U][A] =  1.100;
+ int11_ar[C][G][A][A][U][G] =  1.100;
+ int11_ar[C][G][A][C][U][G] =  1.100;
+ int11_ar[C][G][A][G][U][G] =  1.100;
+ int11_ar[C][G][A][U][U][G] =  1.100;
+ int11_ar[C][G][C][A][U][G] =  1.100;
+ int11_ar[C][G][C][C][U][G] =  1.100;
+ int11_ar[C][G][C][G][U][G] =  1.100;
+ int11_ar[C][G][C][U][U][G] =  1.100;
+ int11_ar[C][G][G][A][U][G] =  1.100;
+ int11_ar[C][G][G][C][U][G] =  1.100;
+ int11_ar[C][G][G][G][U][G] = -1.000;
+ int11_ar[C][G][G][U][U][G] =  1.100;
+ int11_ar[C][G][U][A][U][G] =  1.100;
+ int11_ar[C][G][U][C][U][G] =  1.100;
+ int11_ar[C][G][U][G][U][G] =  1.100;
+ int11_ar[C][G][U][U][U][G] =  1.100;
+ int11_ar[G][C][A][A][A][U] =  1.100;
+ int11_ar[G][C][A][C][A][U] =  1.100;
+ int11_ar[G][C][A][G][A][U] =  1.100;
+ int11_ar[G][C][A][U][A][U] =  1.100;
+ int11_ar[G][C][C][A][A][U] =  1.100;
+ int11_ar[G][C][C][C][A][U] =  1.100;
+ int11_ar[G][C][C][G][A][U] =  1.100;
+ int11_ar[G][C][C][U][A][U] =  1.100;
+ int11_ar[G][C][G][A][A][U] =  1.100;
+ int11_ar[G][C][G][C][A][U] =  1.100;
+ int11_ar[G][C][G][G][A][U] = -1.000;
+ int11_ar[G][C][G][U][A][U] =  1.100;
+ int11_ar[G][C][U][A][A][U] =  1.100;
+ int11_ar[G][C][U][C][A][U] =  1.100;
+ int11_ar[G][C][U][G][A][U] =  1.100;
+ int11_ar[G][C][U][U][A][U] =  1.000;
+ int11_ar[G][C][A][A][C][G] =  0.400;
+ int11_ar[G][C][A][C][C][G] =  0.300;
+ int11_ar[G][C][A][G][C][G] = -0.100;
+ int11_ar[G][C][A][U][C][G] =  0.400;
+ int11_ar[G][C][C][A][C][G] = -0.400;
+ int11_ar[G][C][C][C][C][G] =  0.500;
+ int11_ar[G][C][C][G][C][G] =  0.400;
+ int11_ar[G][C][C][U][C][G] =  0.000;
+ int11_ar[G][C][G][A][C][G] =  0.400;
+ int11_ar[G][C][G][C][C][G] =  0.400;
+ int11_ar[G][C][G][G][C][G] = -1.700;
+ int11_ar[G][C][G][U][C][G] =  0.400;
+ int11_ar[G][C][U][A][C][G] =  0.400;
+ int11_ar[G][C][U][C][C][G] =  0.500;
+ int11_ar[G][C][U][G][C][G] =  0.400;
+ int11_ar[G][C][U][U][C][G] = -0.300;
+ int11_ar[G][C][A][A][G][C] =  0.800;
+ int11_ar[G][C][A][C][G][C] =  0.400;
+ int11_ar[G][C][A][G][G][C] =  0.400;
+ int11_ar[G][C][A][U][G][C] =  0.400;
+ int11_ar[G][C][C][A][G][C] =  0.400;
+ int11_ar[G][C][C][C][G][C] =  0.400;
+ int11_ar[G][C][C][G][G][C] =  0.400;
+ int11_ar[G][C][C][U][G][C] =  0.400;
+ int11_ar[G][C][G][A][G][C] =  0.400;
+ int11_ar[G][C][G][C][G][C] =  0.400;
+ int11_ar[G][C][G][G][G][C] = -2.100;
+ int11_ar[G][C][G][U][G][C] =  0.400;
+ int11_ar[G][C][U][A][G][C] =  0.400;
+ int11_ar[G][C][U][C][G][C] =  0.400;
+ int11_ar[G][C][U][G][G][C] =  0.400;
+ int11_ar[G][C][U][U][G][C] = -0.700;
+ int11_ar[G][C][A][A][G][U] =  1.100;
+ int11_ar[G][C][A][C][G][U] =  1.100;
+ int11_ar[G][C][A][G][G][U] =  1.100;
+ int11_ar[G][C][A][U][G][U] =  1.100;
+ int11_ar[G][C][C][A][G][U] =  1.100;
+ int11_ar[G][C][C][C][G][U] =  1.100;
+ int11_ar[G][C][C][G][G][U] =  1.100;
+ int11_ar[G][C][C][U][G][U] =  1.100;
+ int11_ar[G][C][G][A][G][U] =  1.100;
+ int11_ar[G][C][G][C][G][U] =  1.100;
+ int11_ar[G][C][G][G][G][U] = -1.000;
+ int11_ar[G][C][G][U][G][U] =  1.100;
+ int11_ar[G][C][U][A][G][U] =  1.100;
+ int11_ar[G][C][U][C][G][U] =  1.100;
+ int11_ar[G][C][U][G][G][U] =  1.100;
+ int11_ar[G][C][U][U][G][U] =  1.100;
+ int11_ar[G][C][A][A][U][A] =  1.100;
+ int11_ar[G][C][A][C][U][A] =  1.100;
+ int11_ar[G][C][A][G][U][A] =  1.100;
+ int11_ar[G][C][A][U][U][A] =  1.100;
+ int11_ar[G][C][C][A][U][A] =  1.100;
+ int11_ar[G][C][C][C][U][A] =  1.100;
+ int11_ar[G][C][C][G][U][A] =  1.100;
+ int11_ar[G][C][C][U][U][A] =  1.100;
+ int11_ar[G][C][G][A][U][A] =  1.100;
+ int11_ar[G][C][G][C][U][A] =  1.100;
+ int11_ar[G][C][G][G][U][A] = -1.000;
+ int11_ar[G][C][G][U][U][A] =  1.100;
+ int11_ar[G][C][U][A][U][A] =  1.100;
+ int11_ar[G][C][U][C][U][A] =  1.100;
+ int11_ar[G][C][U][G][U][A] =  1.100;
+ int11_ar[G][C][U][U][U][A] =  1.100;
+ int11_ar[G][C][A][A][U][G] =  1.100;
+ int11_ar[G][C][A][C][U][G] =  1.100;
+ int11_ar[G][C][A][G][U][G] =  1.100;
+ int11_ar[G][C][A][U][U][G] =  1.100;
+ int11_ar[G][C][C][A][U][G] =  1.100;
+ int11_ar[G][C][C][C][U][G] =  1.100;
+ int11_ar[G][C][C][G][U][G] =  1.100;
+ int11_ar[G][C][C][U][U][G] =  1.100;
+ int11_ar[G][C][G][A][U][G] =  1.100;
+ int11_ar[G][C][G][C][U][G] =  1.100;
+ int11_ar[G][C][G][G][U][G] = -1.000;
+ int11_ar[G][C][G][U][U][G] =  1.100;
+ int11_ar[G][C][U][A][U][G] =  1.100;
+ int11_ar[G][C][U][C][U][G] =  1.100;
+ int11_ar[G][C][U][G][U][G] =  1.100;
+ int11_ar[G][C][U][U][U][G] =  1.100;
+ int11_ar[G][U][A][A][A][U] =  1.700;
+ int11_ar[G][U][A][C][A][U] =  1.700;
+ int11_ar[G][U][A][G][A][U] =  1.700;
+ int11_ar[G][U][A][U][A][U] =  1.700;
+ int11_ar[G][U][C][A][A][U] =  1.700;
+ int11_ar[G][U][C][C][A][U] =  1.700;
+ int11_ar[G][U][C][G][A][U] =  1.700;
+ int11_ar[G][U][C][U][A][U] =  1.700;
+ int11_ar[G][U][G][A][A][U] =  1.700;
+ int11_ar[G][U][G][C][A][U] =  1.700;
+ int11_ar[G][U][G][G][A][U] = -0.400;
+ int11_ar[G][U][G][U][A][U] =  1.700;
+ int11_ar[G][U][U][A][A][U] =  1.700;
+ int11_ar[G][U][U][C][A][U] =  1.700;
+ int11_ar[G][U][U][G][A][U] =  1.700;
+ int11_ar[G][U][U][U][A][U] =  1.700;
+ int11_ar[G][U][A][A][C][G] =  1.100;
+ int11_ar[G][U][A][C][C][G] =  1.100;
+ int11_ar[G][U][A][G][C][G] =  1.100;
+ int11_ar[G][U][A][U][C][G] =  1.100;
+ int11_ar[G][U][C][A][C][G] =  1.100;
+ int11_ar[G][U][C][C][C][G] =  1.100;
+ int11_ar[G][U][C][G][C][G] =  1.100;
+ int11_ar[G][U][C][U][C][G] =  1.100;
+ int11_ar[G][U][G][A][C][G] =  1.100;
+ int11_ar[G][U][G][C][C][G] =  1.100;
+ int11_ar[G][U][G][G][C][G] = -1.000;
+ int11_ar[G][U][G][U][C][G] =  1.100;
+ int11_ar[G][U][U][A][C][G] =  1.100;
+ int11_ar[G][U][U][C][C][G] =  1.100;
+ int11_ar[G][U][U][G][C][G] =  1.100;
+ int11_ar[G][U][U][U][C][G] =  1.100;
+ int11_ar[G][U][A][A][G][C] =  1.100;
+ int11_ar[G][U][A][C][G][C] =  1.100;
+ int11_ar[G][U][A][G][G][C] =  1.100;
+ int11_ar[G][U][A][U][G][C] =  1.100;
+ int11_ar[G][U][C][A][G][C] =  1.100;
+ int11_ar[G][U][C][C][G][C] =  1.100;
+ int11_ar[G][U][C][G][G][C] =  1.100;
+ int11_ar[G][U][C][U][G][C] =  1.100;
+ int11_ar[G][U][G][A][G][C] =  1.100;
+ int11_ar[G][U][G][C][G][C] =  1.100;
+ int11_ar[G][U][G][G][G][C] = -1.000;
+ int11_ar[G][U][G][U][G][C] =  1.100;
+ int11_ar[G][U][U][A][G][C] =  1.100;
+ int11_ar[G][U][U][C][G][C] =  1.100;
+ int11_ar[G][U][U][G][G][C] =  1.100;
+ int11_ar[G][U][U][U][G][C] =  1.100;
+ int11_ar[G][U][A][A][G][U] =  1.700;
+ int11_ar[G][U][A][C][G][U] =  1.700;
+ int11_ar[G][U][A][G][G][U] =  1.700;
+ int11_ar[G][U][A][U][G][U] =  1.700;
+ int11_ar[G][U][C][A][G][U] =  1.700;
+ int11_ar[G][U][C][C][G][U] =  1.700;
+ int11_ar[G][U][C][G][G][U] =  1.700;
+ int11_ar[G][U][C][U][G][U] =  1.700;
+ int11_ar[G][U][G][A][G][U] =  1.700;
+ int11_ar[G][U][G][C][G][U] =  1.700;
+ int11_ar[G][U][G][G][G][U] = -0.400;
+ int11_ar[G][U][G][U][G][U] =  1.700;
+ int11_ar[G][U][U][A][G][U] =  1.700;
+ int11_ar[G][U][U][C][G][U] =  1.700;
+ int11_ar[G][U][U][G][G][U] =  1.700;
+ int11_ar[G][U][U][U][G][U] =  1.700;
+ int11_ar[G][U][A][A][U][A] =  1.700;
+ int11_ar[G][U][A][C][U][A] =  1.700;
+ int11_ar[G][U][A][G][U][A] =  1.700;
+ int11_ar[G][U][A][U][U][A] =  1.700;
+ int11_ar[G][U][C][A][U][A] =  1.700;
+ int11_ar[G][U][C][C][U][A] =  1.700;
+ int11_ar[G][U][C][G][U][A] =  1.700;
+ int11_ar[G][U][C][U][U][A] =  1.700;
+ int11_ar[G][U][G][A][U][A] =  1.700;
+ int11_ar[G][U][G][C][U][A] =  1.700;
+ int11_ar[G][U][G][G][U][A] = -0.400;
+ int11_ar[G][U][G][U][U][A] =  1.700;
+ int11_ar[G][U][U][A][U][A] =  1.700;
+ int11_ar[G][U][U][C][U][A] =  1.700;
+ int11_ar[G][U][U][G][U][A] =  1.700;
+ int11_ar[G][U][U][U][U][A] =  1.700;
+ int11_ar[G][U][A][A][U][G] =  1.700;
+ int11_ar[G][U][A][C][U][G] =  1.700;
+ int11_ar[G][U][A][G][U][G] =  1.700;
+ int11_ar[G][U][A][U][U][G] =  1.700;
+ int11_ar[G][U][C][A][U][G] =  1.700;
+ int11_ar[G][U][C][C][U][G] =  1.700;
+ int11_ar[G][U][C][G][U][G] =  1.700;
+ int11_ar[G][U][C][U][U][G] =  1.700;
+ int11_ar[G][U][G][A][U][G] =  1.700;
+ int11_ar[G][U][G][C][U][G] =  1.700;
+ int11_ar[G][U][G][G][U][G] = -0.400;
+ int11_ar[G][U][G][U][U][G] =  1.700;
+ int11_ar[G][U][U][A][U][G] =  1.700;
+ int11_ar[G][U][U][C][U][G] =  1.700;
+ int11_ar[G][U][U][G][U][G] =  1.700;
+ int11_ar[G][U][U][U][U][G] =  1.700;
+ int11_ar[U][A][A][A][A][U] =  1.700;
+ int11_ar[U][A][A][C][A][U] =  1.700;
+ int11_ar[U][A][A][G][A][U] =  1.700;
+ int11_ar[U][A][A][U][A][U] =  1.700;
+ int11_ar[U][A][C][A][A][U] =  1.700;
+ int11_ar[U][A][C][C][A][U] =  1.700;
+ int11_ar[U][A][C][G][A][U] =  1.700;
+ int11_ar[U][A][C][U][A][U] =  1.700;
+ int11_ar[U][A][G][A][A][U] =  1.700;
+ int11_ar[U][A][G][C][A][U] =  1.700;
+ int11_ar[U][A][G][G][A][U] = -0.400;
+ int11_ar[U][A][G][U][A][U] =  1.700;
+ int11_ar[U][A][U][A][A][U] =  1.700;
+ int11_ar[U][A][U][C][A][U] =  1.700;
+ int11_ar[U][A][U][G][A][U] =  1.700;
+ int11_ar[U][A][U][U][A][U] =  1.500;
+ int11_ar[U][A][A][A][C][G] =  1.100;
+ int11_ar[U][A][A][C][C][G] =  1.100;
+ int11_ar[U][A][A][G][C][G] =  1.100;
+ int11_ar[U][A][A][U][C][G] =  1.100;
+ int11_ar[U][A][C][A][C][G] =  1.100;
+ int11_ar[U][A][C][C][C][G] =  1.100;
+ int11_ar[U][A][C][G][C][G] =  1.100;
+ int11_ar[U][A][C][U][C][G] =  1.100;
+ int11_ar[U][A][G][A][C][G] =  1.100;
+ int11_ar[U][A][G][C][C][G] =  1.100;
+ int11_ar[U][A][G][G][C][G] = -1.000;
+ int11_ar[U][A][G][U][C][G] =  1.100;
+ int11_ar[U][A][U][A][C][G] =  1.100;
+ int11_ar[U][A][U][C][C][G] =  1.100;
+ int11_ar[U][A][U][G][C][G] =  1.100;
+ int11_ar[U][A][U][U][C][G] =  1.100;
+ int11_ar[U][A][A][A][G][C] =  1.100;
+ int11_ar[U][A][A][C][G][C] =  1.100;
+ int11_ar[U][A][A][G][G][C] =  1.100;
+ int11_ar[U][A][A][U][G][C] =  1.100;
+ int11_ar[U][A][C][A][G][C] =  1.100;
+ int11_ar[U][A][C][C][G][C] =  1.100;
+ int11_ar[U][A][C][G][G][C] =  1.100;
+ int11_ar[U][A][C][U][G][C] =  1.100;
+ int11_ar[U][A][G][A][G][C] =  1.100;
+ int11_ar[U][A][G][C][G][C] =  1.100;
+ int11_ar[U][A][G][G][G][C] = -1.000;
+ int11_ar[U][A][G][U][G][C] =  1.100;
+ int11_ar[U][A][U][A][G][C] =  1.100;
+ int11_ar[U][A][U][C][G][C] =  1.100;
+ int11_ar[U][A][U][G][G][C] =  1.100;
+ int11_ar[U][A][U][U][G][C] =  1.100;
+ int11_ar[U][A][A][A][G][U] =  1.700;
+ int11_ar[U][A][A][C][G][U] =  1.700;
+ int11_ar[U][A][A][G][G][U] =  1.700;
+ int11_ar[U][A][A][U][G][U] =  1.700;
+ int11_ar[U][A][C][A][G][U] =  1.700;
+ int11_ar[U][A][C][C][G][U] =  1.700;
+ int11_ar[U][A][C][G][G][U] =  1.700;
+ int11_ar[U][A][C][U][G][U] =  1.700;
+ int11_ar[U][A][G][A][G][U] =  1.700;
+ int11_ar[U][A][G][C][G][U] =  1.700;
+ int11_ar[U][A][G][G][G][U] = -0.400;
+ int11_ar[U][A][G][U][G][U] =  1.700;
+ int11_ar[U][A][U][A][G][U] =  1.700;
+ int11_ar[U][A][U][C][G][U] =  1.700;
+ int11_ar[U][A][U][G][G][U] =  1.700;
+ int11_ar[U][A][U][U][G][U] =  1.700;
+ int11_ar[U][A][A][A][U][A] =  1.700;
+ int11_ar[U][A][A][C][U][A] =  1.700;
+ int11_ar[U][A][A][G][U][A] =  1.700;
+ int11_ar[U][A][A][U][U][A] =  1.700;
+ int11_ar[U][A][C][A][U][A] =  1.700;
+ int11_ar[U][A][C][C][U][A] =  1.700;
+ int11_ar[U][A][C][G][U][A] =  1.700;
+ int11_ar[U][A][C][U][U][A] =  1.700;
+ int11_ar[U][A][G][A][U][A] =  1.700;
+ int11_ar[U][A][G][C][U][A] =  1.700;
+ int11_ar[U][A][G][G][U][A] = -0.400;
+ int11_ar[U][A][G][U][U][A] =  1.700;
+ int11_ar[U][A][U][A][U][A] =  1.700;
+ int11_ar[U][A][U][C][U][A] =  1.700;
+ int11_ar[U][A][U][G][U][A] =  1.700;
+ int11_ar[U][A][U][U][U][A] =  1.800;
+ int11_ar[U][A][A][A][U][G] =  1.700;
+ int11_ar[U][A][A][C][U][G] =  1.700;
+ int11_ar[U][A][A][G][U][G] =  1.700;
+ int11_ar[U][A][A][U][U][G] =  1.700;
+ int11_ar[U][A][C][A][U][G] =  1.700;
+ int11_ar[U][A][C][C][U][G] =  1.700;
+ int11_ar[U][A][C][G][U][G] =  1.700;
+ int11_ar[U][A][C][U][U][G] =  1.700;
+ int11_ar[U][A][G][A][U][G] =  1.700;
+ int11_ar[U][A][G][C][U][G] =  1.700;
+ int11_ar[U][A][G][G][U][G] = -0.400;
+ int11_ar[U][A][G][U][U][G] =  1.700;
+ int11_ar[U][A][U][A][U][G] =  1.700;
+ int11_ar[U][A][U][C][U][G] =  1.700;
+ int11_ar[U][A][U][G][U][G] =  1.700;
+ int11_ar[U][A][U][U][U][G] =  1.700;
+ int11_ar[U][G][A][A][A][U] =  1.700;
+ int11_ar[U][G][A][C][A][U] =  1.700;
+ int11_ar[U][G][A][G][A][U] =  1.700;
+ int11_ar[U][G][A][U][A][U] =  1.700;
+ int11_ar[U][G][C][A][A][U] =  1.700;
+ int11_ar[U][G][C][C][A][U] =  1.700;
+ int11_ar[U][G][C][G][A][U] =  1.700;
+ int11_ar[U][G][C][U][A][U] =  1.700;
+ int11_ar[U][G][G][A][A][U] =  1.700;
+ int11_ar[U][G][G][C][A][U] =  1.700;
+ int11_ar[U][G][G][G][A][U] = -0.400;
+ int11_ar[U][G][G][U][A][U] =  1.700;
+ int11_ar[U][G][U][A][A][U] =  1.700;
+ int11_ar[U][G][U][C][A][U] =  1.700;
+ int11_ar[U][G][U][G][A][U] =  1.700;
+ int11_ar[U][G][U][U][A][U] =  1.700;
+ int11_ar[U][G][A][A][C][G] =  1.100;
+ int11_ar[U][G][A][C][C][G] =  1.100;
+ int11_ar[U][G][A][G][C][G] =  1.100;
+ int11_ar[U][G][A][U][C][G] =  1.100;
+ int11_ar[U][G][C][A][C][G] =  1.100;
+ int11_ar[U][G][C][C][C][G] =  1.100;
+ int11_ar[U][G][C][G][C][G] =  1.100;
+ int11_ar[U][G][C][U][C][G] =  1.100;
+ int11_ar[U][G][G][A][C][G] =  1.100;
+ int11_ar[U][G][G][C][C][G] =  1.100;
+ int11_ar[U][G][G][G][C][G] = -1.000;
+ int11_ar[U][G][G][U][C][G] =  1.100;
+ int11_ar[U][G][U][A][C][G] =  1.100;
+ int11_ar[U][G][U][C][C][G] =  1.100;
+ int11_ar[U][G][U][G][C][G] =  1.100;
+ int11_ar[U][G][U][U][C][G] =  1.100;
+ int11_ar[U][G][A][A][G][C] =  1.100;
+ int11_ar[U][G][A][C][G][C] =  1.100;
+ int11_ar[U][G][A][G][G][C] =  1.100;
+ int11_ar[U][G][A][U][G][C] =  1.100;
+ int11_ar[U][G][C][A][G][C] =  1.100;
+ int11_ar[U][G][C][C][G][C] =  1.100;
+ int11_ar[U][G][C][G][G][C] =  1.100;
+ int11_ar[U][G][C][U][G][C] =  1.100;
+ int11_ar[U][G][G][A][G][C] =  1.100;
+ int11_ar[U][G][G][C][G][C] =  1.100;
+ int11_ar[U][G][G][G][G][C] = -1.000;
+ int11_ar[U][G][G][U][G][C] =  1.100;
+ int11_ar[U][G][U][A][G][C] =  1.100;
+ int11_ar[U][G][U][C][G][C] =  1.100;
+ int11_ar[U][G][U][G][G][C] =  1.100;
+ int11_ar[U][G][U][U][G][C] =  1.100;
+ int11_ar[U][G][A][A][G][U] =  1.700;
+ int11_ar[U][G][A][C][G][U] =  1.700;
+ int11_ar[U][G][A][G][G][U] =  1.700;
+ int11_ar[U][G][A][U][G][U] =  1.700;
+ int11_ar[U][G][C][A][G][U] =  1.700;
+ int11_ar[U][G][C][C][G][U] =  1.700;
+ int11_ar[U][G][C][G][G][U] =  1.700;
+ int11_ar[U][G][C][U][G][U] =  1.700;
+ int11_ar[U][G][G][A][G][U] =  1.700;
+ int11_ar[U][G][G][C][G][U] =  1.700;
+ int11_ar[U][G][G][G][G][U] = -0.400;
+ int11_ar[U][G][G][U][G][U] =  1.700;
+ int11_ar[U][G][U][A][G][U] =  1.700;
+ int11_ar[U][G][U][C][G][U] =  1.700;
+ int11_ar[U][G][U][G][G][U] =  1.700;
+ int11_ar[U][G][U][U][G][U] =  1.700;
+ int11_ar[U][G][A][A][U][A] =  1.700;
+ int11_ar[U][G][A][C][U][A] =  1.700;
+ int11_ar[U][G][A][G][U][A] =  1.700;
+ int11_ar[U][G][A][U][U][A] =  1.700;
+ int11_ar[U][G][C][A][U][A] =  1.700;
+ int11_ar[U][G][C][C][U][A] =  1.700;
+ int11_ar[U][G][C][G][U][A] =  1.700;
+ int11_ar[U][G][C][U][U][A] =  1.700;
+ int11_ar[U][G][G][A][U][A] =  1.700;
+ int11_ar[U][G][G][C][U][A] =  1.700;
+ int11_ar[U][G][G][G][U][A] = -0.400;
+ int11_ar[U][G][G][U][U][A] =  1.700;
+ int11_ar[U][G][U][A][U][A] =  1.700;
+ int11_ar[U][G][U][C][U][A] =  1.700;
+ int11_ar[U][G][U][G][U][A] =  1.700;
+ int11_ar[U][G][U][U][U][A] =  1.700;
+ int11_ar[U][G][A][A][U][G] =  1.700;
+ int11_ar[U][G][A][C][U][G] =  1.700;
+ int11_ar[U][G][A][G][U][G] =  1.700;
+ int11_ar[U][G][A][U][U][G] =  1.700;
+ int11_ar[U][G][C][A][U][G] =  1.700;
+ int11_ar[U][G][C][C][U][G] =  1.700;
+ int11_ar[U][G][C][G][U][G] =  1.700;
+ int11_ar[U][G][C][U][U][G] =  1.700;
+ int11_ar[U][G][G][A][U][G] =  1.700;
+ int11_ar[U][G][G][C][U][G] =  1.700;
+ int11_ar[U][G][G][G][U][G] = -0.400;
+ int11_ar[U][G][G][U][U][G] =  1.700;
+ int11_ar[U][G][U][A][U][G] =  1.700;
+ int11_ar[U][G][U][C][U][G] =  1.700;
+ int11_ar[U][G][U][G][U][G] =  1.700;
+ int11_ar[U][G][U][U][U][G] =  1.700;
+}
+
+void init_int21_ar()
+{
+  int k1,k2,k3,k4,k5,k6,k7;
+
+  for (k1=0;k1<ALPHASIZE;k1++)
+    for (k2=0;k2<ALPHASIZE;k2++)
+      for (k3=0;k3<ALPHASIZE;k3++)
+         for (k4=0;k4<ALPHASIZE;k4++)
+            for (k5=0;k5<ALPHASIZE;k5++)
+               for (k6=0;k6<ALPHASIZE;k6++)
+                 for (k7=0;k7<ALPHASIZE;k7++)
+                    int21_ar[k1][k2][k3][k4][k5][k6][k7]=0.0;
+
+ int21_ar[A][U][A][A][A][A][U] =  3.900;
+ int21_ar[A][U][A][A][C][A][U] =  3.700;
+ int21_ar[A][U][A][A][G][A][U] =  3.100;
+ int21_ar[A][U][A][A][U][A][U] =  5.500;
+ int21_ar[A][U][A][C][A][A][U] =  3.600;
+ int21_ar[A][U][A][C][C][A][U] =  3.200;
+ int21_ar[A][U][A][C][G][A][U] =  3.100;
+ int21_ar[A][U][A][C][U][A][U] =  5.500;
+ int21_ar[A][U][A][G][A][A][U] =  2.500;
+ int21_ar[A][U][A][G][C][A][U] =  2.100;
+ int21_ar[A][U][A][G][G][A][U] =  1.900;
+ int21_ar[A][U][A][G][U][A][U] =  5.500;
+ int21_ar[A][U][A][U][A][A][U] =  5.500;
+ int21_ar[A][U][A][U][C][A][U] =  5.500;
+ int21_ar[A][U][A][U][G][A][U] =  5.500;
+ int21_ar[A][U][A][U][U][A][U] =  5.500;
+ int21_ar[A][U][C][A][A][A][U] =  3.800;
+ int21_ar[A][U][C][A][C][A][U] =  3.700;
+ int21_ar[A][U][C][A][G][A][U] =  5.500;
+ int21_ar[A][U][C][A][U][A][U] =  3.700;
+ int21_ar[A][U][C][C][A][A][U] =  3.700;
+ int21_ar[A][U][C][C][C][A][U] =  4.000;
+ int21_ar[A][U][C][C][G][A][U] =  5.500;
+ int21_ar[A][U][C][C][U][A][U] =  3.700;
+ int21_ar[A][U][C][G][A][A][U] =  5.500;
+ int21_ar[A][U][C][G][C][A][U] =  5.500;
+ int21_ar[A][U][C][G][G][A][U] =  5.500;
+ int21_ar[A][U][C][G][U][A][U] =  5.500;
+ int21_ar[A][U][C][U][A][A][U] =  4.000;
+ int21_ar[A][U][C][U][C][A][U] =  3.400;
+ int21_ar[A][U][C][U][G][A][U] =  5.500;
+ int21_ar[A][U][C][U][U][A][U] =  3.700;
+ int21_ar[A][U][G][A][A][A][U] =  3.200;
+ int21_ar[A][U][G][A][C][A][U] =  5.500;
+ int21_ar[A][U][G][A][G][A][U] =  2.300;
+ int21_ar[A][U][G][A][U][A][U] =  5.500;
+ int21_ar[A][U][G][C][A][A][U] =  5.500;
+ int21_ar[A][U][G][C][C][A][U] =  5.500;
+ int21_ar[A][U][G][C][G][A][U] =  5.500;
+ int21_ar[A][U][G][C][U][A][U] =  5.500;
+ int21_ar[A][U][G][G][A][A][U] =  2.300;
+ int21_ar[A][U][G][G][C][A][U] =  5.500;
+ int21_ar[A][U][G][G][G][A][U] =  3.700;
+ int21_ar[A][U][G][G][U][A][U] =  5.500;
+ int21_ar[A][U][G][U][A][A][U] =  5.500;
+ int21_ar[A][U][G][U][C][A][U] =  5.500;
+ int21_ar[A][U][G][U][G][A][U] =  5.500;
+ int21_ar[A][U][G][U][U][A][U] =  5.500;
+ int21_ar[A][U][U][A][A][A][U] =  5.500;
+ int21_ar[A][U][U][A][C][A][U] =  5.500;
+ int21_ar[A][U][U][A][G][A][U] =  5.500;
+ int21_ar[A][U][U][A][U][A][U] =  5.500;
+ int21_ar[A][U][U][C][A][A][U] =  5.500;
+ int21_ar[A][U][U][C][C][A][U] =  3.700;
+ int21_ar[A][U][U][C][G][A][U] =  5.500;
+ int21_ar[A][U][U][C][U][A][U] =  2.800;
+ int21_ar[A][U][U][G][A][A][U] =  5.500;
+ int21_ar[A][U][U][G][C][A][U] =  5.500;
+ int21_ar[A][U][U][G][G][A][U] =  5.500;
+ int21_ar[A][U][U][G][U][A][U] =  5.500;
+ int21_ar[A][U][U][U][A][A][U] =  5.500;
+ int21_ar[A][U][U][U][C][A][U] =  3.200;
+ int21_ar[A][U][U][U][G][A][U] =  5.500;
+ int21_ar[A][U][U][U][U][A][U] =  2.700;
+ int21_ar[A][U][A][A][A][C][G] =  3.200;
+ int21_ar[A][U][A][A][C][C][G] =  3.000;
+ int21_ar[A][U][A][A][G][C][G] =  2.400;
+ int21_ar[A][U][A][A][U][C][G] =  4.800;
+ int21_ar[A][U][A][C][A][C][G] =  2.900;
+ int21_ar[A][U][A][C][C][C][G] =  2.500;
+ int21_ar[A][U][A][C][G][C][G] =  2.400;
+ int21_ar[A][U][A][C][U][C][G] =  4.800;
+ int21_ar[A][U][A][G][A][C][G] =  1.800;
+ int21_ar[A][U][A][G][C][C][G] =  1.400;
+ int21_ar[A][U][A][G][G][C][G] =  1.200;
+ int21_ar[A][U][A][G][U][C][G] =  4.800;
+ int21_ar[A][U][A][U][A][C][G] =  4.800;
+ int21_ar[A][U][A][U][C][C][G] =  4.800;
+ int21_ar[A][U][A][U][G][C][G] =  4.800;
+ int21_ar[A][U][A][U][U][C][G] =  4.800;
+ int21_ar[A][U][C][A][A][C][G] =  3.100;
+ int21_ar[A][U][C][A][C][C][G] =  3.000;
+ int21_ar[A][U][C][A][G][C][G] =  4.800;
+ int21_ar[A][U][C][A][U][C][G] =  3.000;
+ int21_ar[A][U][C][C][A][C][G] =  3.000;
+ int21_ar[A][U][C][C][C][C][G] =  3.300;
+ int21_ar[A][U][C][C][G][C][G] =  4.800;
+ int21_ar[A][U][C][C][U][C][G] =  3.000;
+ int21_ar[A][U][C][G][A][C][G] =  4.800;
+ int21_ar[A][U][C][G][C][C][G] =  4.800;
+ int21_ar[A][U][C][G][G][C][G] =  4.800;
+ int21_ar[A][U][C][G][U][C][G] =  4.800;
+ int21_ar[A][U][C][U][A][C][G] =  3.300;
+ int21_ar[A][U][C][U][C][C][G] =  2.700;
+ int21_ar[A][U][C][U][G][C][G] =  4.800;
+ int21_ar[A][U][C][U][U][C][G] =  3.000;
+ int21_ar[A][U][G][A][A][C][G] =  2.500;
+ int21_ar[A][U][G][A][C][C][G] =  4.800;
+ int21_ar[A][U][G][A][G][C][G] =  1.600;
+ int21_ar[A][U][G][A][U][C][G] =  4.800;
+ int21_ar[A][U][G][C][A][C][G] =  4.800;
+ int21_ar[A][U][G][C][C][C][G] =  4.800;
+ int21_ar[A][U][G][C][G][C][G] =  4.800;
+ int21_ar[A][U][G][C][U][C][G] =  4.800;
+ int21_ar[A][U][G][G][A][C][G] =  1.600;
+ int21_ar[A][U][G][G][C][C][G] =  4.800;
+ int21_ar[A][U][G][G][G][C][G] =  3.000;
+ int21_ar[A][U][G][G][U][C][G] =  4.800;
+ int21_ar[A][U][G][U][A][C][G] =  4.800;
+ int21_ar[A][U][G][U][C][C][G] =  4.800;
+ int21_ar[A][U][G][U][G][C][G] =  4.800;
+ int21_ar[A][U][G][U][U][C][G] =  4.800;
+ int21_ar[A][U][U][A][A][C][G] =  4.800;
+ int21_ar[A][U][U][A][C][C][G] =  4.800;
+ int21_ar[A][U][U][A][G][C][G] =  4.800;
+ int21_ar[A][U][U][A][U][C][G] =  4.800;
+ int21_ar[A][U][U][C][A][C][G] =  4.800;
+ int21_ar[A][U][U][C][C][C][G] =  3.000;
+ int21_ar[A][U][U][C][G][C][G] =  4.800;
+ int21_ar[A][U][U][C][U][C][G] =  2.100;
+ int21_ar[A][U][U][G][A][C][G] =  4.800;
+ int21_ar[A][U][U][G][C][C][G] =  4.800;
+ int21_ar[A][U][U][G][G][C][G] =  4.800;
+ int21_ar[A][U][U][G][U][C][G] =  4.800;
+ int21_ar[A][U][U][U][A][C][G] =  4.800;
+ int21_ar[A][U][U][U][C][C][G] =  2.500;
+ int21_ar[A][U][U][U][G][C][G] =  4.800;
+ int21_ar[A][U][U][U][U][C][G] =  2.000;
+ int21_ar[A][U][A][A][A][G][C] =  3.200;
+ int21_ar[A][U][A][A][C][G][C] =  3.000;
+ int21_ar[A][U][A][A][G][G][C] =  2.400;
+ int21_ar[A][U][A][A][U][G][C] =  4.800;
+ int21_ar[A][U][A][C][A][G][C] =  2.900;
+ int21_ar[A][U][A][C][C][G][C] =  2.500;
+ int21_ar[A][U][A][C][G][G][C] =  2.400;
+ int21_ar[A][U][A][C][U][G][C] =  4.800;
+ int21_ar[A][U][A][G][A][G][C] =  1.800;
+ int21_ar[A][U][A][G][C][G][C] =  1.400;
+ int21_ar[A][U][A][G][G][G][C] =  1.200;
+ int21_ar[A][U][A][G][U][G][C] =  4.800;
+ int21_ar[A][U][A][U][A][G][C] =  4.800;
+ int21_ar[A][U][A][U][C][G][C] =  4.800;
+ int21_ar[A][U][A][U][G][G][C] =  4.800;
+ int21_ar[A][U][A][U][U][G][C] =  4.800;
+ int21_ar[A][U][C][A][A][G][C] =  3.100;
+ int21_ar[A][U][C][A][C][G][C] =  3.000;
+ int21_ar[A][U][C][A][G][G][C] =  4.800;
+ int21_ar[A][U][C][A][U][G][C] =  3.000;
+ int21_ar[A][U][C][C][A][G][C] =  3.000;
+ int21_ar[A][U][C][C][C][G][C] =  3.300;
+ int21_ar[A][U][C][C][G][G][C] =  4.800;
+ int21_ar[A][U][C][C][U][G][C] =  3.000;
+ int21_ar[A][U][C][G][A][G][C] =  4.800;
+ int21_ar[A][U][C][G][C][G][C] =  4.800;
+ int21_ar[A][U][C][G][G][G][C] =  4.800;
+ int21_ar[A][U][C][G][U][G][C] =  4.800;
+ int21_ar[A][U][C][U][A][G][C] =  3.300;
+ int21_ar[A][U][C][U][C][G][C] =  2.700;
+ int21_ar[A][U][C][U][G][G][C] =  4.800;
+ int21_ar[A][U][C][U][U][G][C] =  3.000;
+ int21_ar[A][U][G][A][A][G][C] =  2.500;
+ int21_ar[A][U][G][A][C][G][C] =  4.800;
+ int21_ar[A][U][G][A][G][G][C] =  1.600;
+ int21_ar[A][U][G][A][U][G][C] =  4.800;
+ int21_ar[A][U][G][C][A][G][C] =  4.800;
+ int21_ar[A][U][G][C][C][G][C] =  4.800;
+ int21_ar[A][U][G][C][G][G][C] =  4.800;
+ int21_ar[A][U][G][C][U][G][C] =  4.800;
+ int21_ar[A][U][G][G][A][G][C] =  1.600;
+ int21_ar[A][U][G][G][C][G][C] =  4.800;
+ int21_ar[A][U][G][G][G][G][C] =  3.000;
+ int21_ar[A][U][G][G][U][G][C] =  4.800;
+ int21_ar[A][U][G][U][A][G][C] =  4.800;
+ int21_ar[A][U][G][U][C][G][C] =  4.800;
+ int21_ar[A][U][G][U][G][G][C] =  4.800;
+ int21_ar[A][U][G][U][U][G][C] =  4.800;
+ int21_ar[A][U][U][A][A][G][C] =  4.800;
+ int21_ar[A][U][U][A][C][G][C] =  4.800;
+ int21_ar[A][U][U][A][G][G][C] =  4.800;
+ int21_ar[A][U][U][A][U][G][C] =  4.800;
+ int21_ar[A][U][U][C][A][G][C] =  4.800;
+ int21_ar[A][U][U][C][C][G][C] =  3.000;
+ int21_ar[A][U][U][C][G][G][C] =  4.800;
+ int21_ar[A][U][U][C][U][G][C] =  2.100;
+ int21_ar[A][U][U][G][A][G][C] =  4.800;
+ int21_ar[A][U][U][G][C][G][C] =  4.800;
+ int21_ar[A][U][U][G][G][G][C] =  4.800;
+ int21_ar[A][U][U][G][U][G][C] =  4.800;
+ int21_ar[A][U][U][U][A][G][C] =  4.800;
+ int21_ar[A][U][U][U][C][G][C] =  2.500;
+ int21_ar[A][U][U][U][G][G][C] =  4.800;
+ int21_ar[A][U][U][U][U][G][C] =  2.000;
+ int21_ar[A][U][A][A][A][G][U] =  3.900;
+ int21_ar[A][U][A][A][C][G][U] =  3.700;
+ int21_ar[A][U][A][A][G][G][U] =  3.100;
+ int21_ar[A][U][A][A][U][G][U] =  5.500;
+ int21_ar[A][U][A][C][A][G][U] =  3.600;
+ int21_ar[A][U][A][C][C][G][U] =  3.200;
+ int21_ar[A][U][A][C][G][G][U] =  3.100;
+ int21_ar[A][U][A][C][U][G][U] =  5.500;
+ int21_ar[A][U][A][G][A][G][U] =  2.500;
+ int21_ar[A][U][A][G][C][G][U] =  2.100;
+ int21_ar[A][U][A][G][G][G][U] =  1.900;
+ int21_ar[A][U][A][G][U][G][U] =  5.500;
+ int21_ar[A][U][A][U][A][G][U] =  5.500;
+ int21_ar[A][U][A][U][C][G][U] =  5.500;
+ int21_ar[A][U][A][U][G][G][U] =  5.500;
+ int21_ar[A][U][A][U][U][G][U] =  5.500;
+ int21_ar[A][U][C][A][A][G][U] =  3.800;
+ int21_ar[A][U][C][A][C][G][U] =  3.700;
+ int21_ar[A][U][C][A][G][G][U] =  5.500;
+ int21_ar[A][U][C][A][U][G][U] =  3.700;
+ int21_ar[A][U][C][C][A][G][U] =  3.700;
+ int21_ar[A][U][C][C][C][G][U] =  4.000;
+ int21_ar[A][U][C][C][G][G][U] =  5.500;
+ int21_ar[A][U][C][C][U][G][U] =  3.700;
+ int21_ar[A][U][C][G][A][G][U] =  5.500;
+ int21_ar[A][U][C][G][C][G][U] =  5.500;
+ int21_ar[A][U][C][G][G][G][U] =  5.500;
+ int21_ar[A][U][C][G][U][G][U] =  5.500;
+ int21_ar[A][U][C][U][A][G][U] =  4.000;
+ int21_ar[A][U][C][U][C][G][U] =  3.400;
+ int21_ar[A][U][C][U][G][G][U] =  5.500;
+ int21_ar[A][U][C][U][U][G][U] =  3.700;
+ int21_ar[A][U][G][A][A][G][U] =  3.200;
+ int21_ar[A][U][G][A][C][G][U] =  5.500;
+ int21_ar[A][U][G][A][G][G][U] =  2.300;
+ int21_ar[A][U][G][A][U][G][U] =  5.500;
+ int21_ar[A][U][G][C][A][G][U] =  5.500;
+ int21_ar[A][U][G][C][C][G][U] =  5.500;
+ int21_ar[A][U][G][C][G][G][U] =  5.500;
+ int21_ar[A][U][G][C][U][G][U] =  5.500;
+ int21_ar[A][U][G][G][A][G][U] =  2.300;
+ int21_ar[A][U][G][G][C][G][U] =  5.500;
+ int21_ar[A][U][G][G][G][G][U] =  3.700;
+ int21_ar[A][U][G][G][U][G][U] =  5.500;
+ int21_ar[A][U][G][U][A][G][U] =  5.500;
+ int21_ar[A][U][G][U][C][G][U] =  5.500;
+ int21_ar[A][U][G][U][G][G][U] =  5.500;
+ int21_ar[A][U][G][U][U][G][U] =  5.500;
+ int21_ar[A][U][U][A][A][G][U] =  5.500;
+ int21_ar[A][U][U][A][C][G][U] =  5.500;
+ int21_ar[A][U][U][A][G][G][U] =  5.500;
+ int21_ar[A][U][U][A][U][G][U] =  5.500;
+ int21_ar[A][U][U][C][A][G][U] =  5.500;
+ int21_ar[A][U][U][C][C][G][U] =  3.700;
+ int21_ar[A][U][U][C][G][G][U] =  5.500;
+ int21_ar[A][U][U][C][U][G][U] =  2.800;
+ int21_ar[A][U][U][G][A][G][U] =  5.500;
+ int21_ar[A][U][U][G][C][G][U] =  5.500;
+ int21_ar[A][U][U][G][G][G][U] =  5.500;
+ int21_ar[A][U][U][G][U][G][U] =  5.500;
+ int21_ar[A][U][U][U][A][G][U] =  5.500;
+ int21_ar[A][U][U][U][C][G][U] =  3.200;
+ int21_ar[A][U][U][U][G][G][U] =  5.500;
+ int21_ar[A][U][U][U][U][G][U] =  2.700;
+ int21_ar[A][U][A][A][A][U][A] =  3.900;
+ int21_ar[A][U][A][A][C][U][A] =  3.700;
+ int21_ar[A][U][A][A][G][U][A] =  3.100;
+ int21_ar[A][U][A][A][U][U][A] =  5.500;
+ int21_ar[A][U][A][C][A][U][A] =  3.600;
+ int21_ar[A][U][A][C][C][U][A] =  3.200;
+ int21_ar[A][U][A][C][G][U][A] =  3.100;
+ int21_ar[A][U][A][C][U][U][A] =  5.500;
+ int21_ar[A][U][A][G][A][U][A] =  2.500;
+ int21_ar[A][U][A][G][C][U][A] =  2.100;
+ int21_ar[A][U][A][G][G][U][A] =  1.900;
+ int21_ar[A][U][A][G][U][U][A] =  5.500;
+ int21_ar[A][U][A][U][A][U][A] =  5.500;
+ int21_ar[A][U][A][U][C][U][A] =  5.500;
+ int21_ar[A][U][A][U][G][U][A] =  5.500;
+ int21_ar[A][U][A][U][U][U][A] =  5.500;
+ int21_ar[A][U][C][A][A][U][A] =  3.800;
+ int21_ar[A][U][C][A][C][U][A] =  3.700;
+ int21_ar[A][U][C][A][G][U][A] =  5.500;
+ int21_ar[A][U][C][A][U][U][A] =  3.700;
+ int21_ar[A][U][C][C][A][U][A] =  3.700;
+ int21_ar[A][U][C][C][C][U][A] =  4.000;
+ int21_ar[A][U][C][C][G][U][A] =  5.500;
+ int21_ar[A][U][C][C][U][U][A] =  3.700;
+ int21_ar[A][U][C][G][A][U][A] =  5.500;
+ int21_ar[A][U][C][G][C][U][A] =  5.500;
+ int21_ar[A][U][C][G][G][U][A] =  5.500;
+ int21_ar[A][U][C][G][U][U][A] =  5.500;
+ int21_ar[A][U][C][U][A][U][A] =  4.000;
+ int21_ar[A][U][C][U][C][U][A] =  3.400;
+ int21_ar[A][U][C][U][G][U][A] =  5.500;
+ int21_ar[A][U][C][U][U][U][A] =  3.700;
+ int21_ar[A][U][G][A][A][U][A] =  3.200;
+ int21_ar[A][U][G][A][C][U][A] =  5.500;
+ int21_ar[A][U][G][A][G][U][A] =  2.300;
+ int21_ar[A][U][G][A][U][U][A] =  5.500;
+ int21_ar[A][U][G][C][A][U][A] =  5.500;
+ int21_ar[A][U][G][C][C][U][A] =  5.500;
+ int21_ar[A][U][G][C][G][U][A] =  5.500;
+ int21_ar[A][U][G][C][U][U][A] =  5.500;
+ int21_ar[A][U][G][G][A][U][A] =  2.300;
+ int21_ar[A][U][G][G][C][U][A] =  5.500;
+ int21_ar[A][U][G][G][G][U][A] =  3.700;
+ int21_ar[A][U][G][G][U][U][A] =  5.500;
+ int21_ar[A][U][G][U][A][U][A] =  5.500;
+ int21_ar[A][U][G][U][C][U][A] =  5.500;
+ int21_ar[A][U][G][U][G][U][A] =  5.500;
+ int21_ar[A][U][G][U][U][U][A] =  5.500;
+ int21_ar[A][U][U][A][A][U][A] =  5.500;
+ int21_ar[A][U][U][A][C][U][A] =  5.500;
+ int21_ar[A][U][U][A][G][U][A] =  5.500;
+ int21_ar[A][U][U][A][U][U][A] =  5.500;
+ int21_ar[A][U][U][C][A][U][A] =  5.500;
+ int21_ar[A][U][U][C][C][U][A] =  3.700;
+ int21_ar[A][U][U][C][G][U][A] =  5.500;
+ int21_ar[A][U][U][C][U][U][A] =  2.800;
+ int21_ar[A][U][U][G][A][U][A] =  5.500;
+ int21_ar[A][U][U][G][C][U][A] =  5.500;
+ int21_ar[A][U][U][G][G][U][A] =  5.500;
+ int21_ar[A][U][U][G][U][U][A] =  5.500;
+ int21_ar[A][U][U][U][A][U][A] =  5.500;
+ int21_ar[A][U][U][U][C][U][A] =  3.200;
+ int21_ar[A][U][U][U][G][U][A] =  5.500;
+ int21_ar[A][U][U][U][U][U][A] =  2.700;
+ int21_ar[A][U][A][A][A][U][G] =  3.900;
+ int21_ar[A][U][A][A][C][U][G] =  3.700;
+ int21_ar[A][U][A][A][G][U][G] =  3.100;
+ int21_ar[A][U][A][A][U][U][G] =  5.500;
+ int21_ar[A][U][A][C][A][U][G] =  3.600;
+ int21_ar[A][U][A][C][C][U][G] =  3.200;
+ int21_ar[A][U][A][C][G][U][G] =  3.100;
+ int21_ar[A][U][A][C][U][U][G] =  5.500;
+ int21_ar[A][U][A][G][A][U][G] =  2.500;
+ int21_ar[A][U][A][G][C][U][G] =  2.100;
+ int21_ar[A][U][A][G][G][U][G] =  1.900;
+ int21_ar[A][U][A][G][U][U][G] =  5.500;
+ int21_ar[A][U][A][U][A][U][G] =  5.500;
+ int21_ar[A][U][A][U][C][U][G] =  5.500;
+ int21_ar[A][U][A][U][G][U][G] =  5.500;
+ int21_ar[A][U][A][U][U][U][G] =  5.500;
+ int21_ar[A][U][C][A][A][U][G] =  3.800;
+ int21_ar[A][U][C][A][C][U][G] =  3.700;
+ int21_ar[A][U][C][A][G][U][G] =  5.500;
+ int21_ar[A][U][C][A][U][U][G] =  3.700;
+ int21_ar[A][U][C][C][A][U][G] =  3.700;
+ int21_ar[A][U][C][C][C][U][G] =  4.000;
+ int21_ar[A][U][C][C][G][U][G] =  5.500;
+ int21_ar[A][U][C][C][U][U][G] =  3.700;
+ int21_ar[A][U][C][G][A][U][G] =  5.500;
+ int21_ar[A][U][C][G][C][U][G] =  5.500;
+ int21_ar[A][U][C][G][G][U][G] =  5.500;
+ int21_ar[A][U][C][G][U][U][G] =  5.500;
+ int21_ar[A][U][C][U][A][U][G] =  4.000;
+ int21_ar[A][U][C][U][C][U][G] =  3.400;
+ int21_ar[A][U][C][U][G][U][G] =  5.500;
+ int21_ar[A][U][C][U][U][U][G] =  3.700;
+ int21_ar[A][U][G][A][A][U][G] =  3.200;
+ int21_ar[A][U][G][A][C][U][G] =  5.500;
+ int21_ar[A][U][G][A][G][U][G] =  2.300;
+ int21_ar[A][U][G][A][U][U][G] =  5.500;
+ int21_ar[A][U][G][C][A][U][G] =  5.500;
+ int21_ar[A][U][G][C][C][U][G] =  5.500;
+ int21_ar[A][U][G][C][G][U][G] =  5.500;
+ int21_ar[A][U][G][C][U][U][G] =  5.500;
+ int21_ar[A][U][G][G][A][U][G] =  2.300;
+ int21_ar[A][U][G][G][C][U][G] =  5.500;
+ int21_ar[A][U][G][G][G][U][G] =  3.700;
+ int21_ar[A][U][G][G][U][U][G] =  5.500;
+ int21_ar[A][U][G][U][A][U][G] =  5.500;
+ int21_ar[A][U][G][U][C][U][G] =  5.500;
+ int21_ar[A][U][G][U][G][U][G] =  5.500;
+ int21_ar[A][U][G][U][U][U][G] =  5.500;
+ int21_ar[A][U][U][A][A][U][G] =  5.500;
+ int21_ar[A][U][U][A][C][U][G] =  5.500;
+ int21_ar[A][U][U][A][G][U][G] =  5.500;
+ int21_ar[A][U][U][A][U][U][G] =  5.500;
+ int21_ar[A][U][U][C][A][U][G] =  5.500;
+ int21_ar[A][U][U][C][C][U][G] =  3.700;
+ int21_ar[A][U][U][C][G][U][G] =  5.500;
+ int21_ar[A][U][U][C][U][U][G] =  2.800;
+ int21_ar[A][U][U][G][A][U][G] =  5.500;
+ int21_ar[A][U][U][G][C][U][G] =  5.500;
+ int21_ar[A][U][U][G][G][U][G] =  5.500;
+ int21_ar[A][U][U][G][U][U][G] =  5.500;
+ int21_ar[A][U][U][U][A][U][G] =  5.500;
+ int21_ar[A][U][U][U][C][U][G] =  3.200;
+ int21_ar[A][U][U][U][G][U][G] =  5.500;
+ int21_ar[A][U][U][U][U][U][G] =  2.700;
+ int21_ar[C][G][A][A][A][A][U] =  3.200;
+ int21_ar[C][G][A][A][C][A][U] =  3.000;
+ int21_ar[C][G][A][A][G][A][U] =  2.400;
+ int21_ar[C][G][A][A][U][A][U] =  4.800;
+ int21_ar[C][G][A][C][A][A][U] =  2.900;
+ int21_ar[C][G][A][C][C][A][U] =  2.500;
+ int21_ar[C][G][A][C][G][A][U] =  2.400;
+ int21_ar[C][G][A][C][U][A][U] =  4.800;
+ int21_ar[C][G][A][G][A][A][U] =  1.800;
+ int21_ar[C][G][A][G][C][A][U] =  1.400;
+ int21_ar[C][G][A][G][G][A][U] =  1.200;
+ int21_ar[C][G][A][G][U][A][U] =  4.800;
+ int21_ar[C][G][A][U][A][A][U] =  4.800;
+ int21_ar[C][G][A][U][C][A][U] =  4.800;
+ int21_ar[C][G][A][U][G][A][U] =  4.800;
+ int21_ar[C][G][A][U][U][A][U] =  4.800;
+ int21_ar[C][G][C][A][A][A][U] =  3.100;
+ int21_ar[C][G][C][A][C][A][U] =  3.000;
+ int21_ar[C][G][C][A][G][A][U] =  4.800;
+ int21_ar[C][G][C][A][U][A][U] =  3.000;
+ int21_ar[C][G][C][C][A][A][U] =  3.000;
+ int21_ar[C][G][C][C][C][A][U] =  3.300;
+ int21_ar[C][G][C][C][G][A][U] =  4.800;
+ int21_ar[C][G][C][C][U][A][U] =  3.000;
+ int21_ar[C][G][C][G][A][A][U] =  4.800;
+ int21_ar[C][G][C][G][C][A][U] =  4.800;
+ int21_ar[C][G][C][G][G][A][U] =  4.800;
+ int21_ar[C][G][C][G][U][A][U] =  4.800;
+ int21_ar[C][G][C][U][A][A][U] =  3.300;
+ int21_ar[C][G][C][U][C][A][U] =  2.700;
+ int21_ar[C][G][C][U][G][A][U] =  4.800;
+ int21_ar[C][G][C][U][U][A][U] =  3.000;
+ int21_ar[C][G][G][A][A][A][U] =  2.500;
+ int21_ar[C][G][G][A][C][A][U] =  4.800;
+ int21_ar[C][G][G][A][G][A][U] =  1.600;
+ int21_ar[C][G][G][A][U][A][U] =  4.800;
+ int21_ar[C][G][G][C][A][A][U] =  4.800;
+ int21_ar[C][G][G][C][C][A][U] =  4.800;
+ int21_ar[C][G][G][C][G][A][U] =  4.800;
+ int21_ar[C][G][G][C][U][A][U] =  4.800;
+ int21_ar[C][G][G][G][A][A][U] =  1.600;
+ int21_ar[C][G][G][G][C][A][U] =  4.800;
+ int21_ar[C][G][G][G][G][A][U] =  3.000;
+ int21_ar[C][G][G][G][U][A][U] =  4.800;
+ int21_ar[C][G][G][U][A][A][U] =  4.800;
+ int21_ar[C][G][G][U][C][A][U] =  4.800;
+ int21_ar[C][G][G][U][G][A][U] =  4.800;
+ int21_ar[C][G][G][U][U][A][U] =  4.800;
+ int21_ar[C][G][U][A][A][A][U] =  4.800;
+ int21_ar[C][G][U][A][C][A][U] =  4.800;
+ int21_ar[C][G][U][A][G][A][U] =  4.800;
+ int21_ar[C][G][U][A][U][A][U] =  4.800;
+ int21_ar[C][G][U][C][A][A][U] =  4.800;
+ int21_ar[C][G][U][C][C][A][U] =  3.000;
+ int21_ar[C][G][U][C][G][A][U] =  4.800;
+ int21_ar[C][G][U][C][U][A][U] =  2.100;
+ int21_ar[C][G][U][G][A][A][U] =  4.800;
+ int21_ar[C][G][U][G][C][A][U] =  4.800;
+ int21_ar[C][G][U][G][G][A][U] =  4.800;
+ int21_ar[C][G][U][G][U][A][U] =  4.800;
+ int21_ar[C][G][U][U][A][A][U] =  4.800;
+ int21_ar[C][G][U][U][C][A][U] =  2.500;
+ int21_ar[C][G][U][U][G][A][U] =  4.800;
+ int21_ar[C][G][U][U][U][A][U] =  2.000;
+ int21_ar[C][G][A][A][A][C][G] =  2.400;
+ int21_ar[C][G][A][A][C][C][G] =  2.200;
+ int21_ar[C][G][A][A][G][C][G] =  1.600;
+ int21_ar[C][G][A][A][U][C][G] =  4.000;
+ int21_ar[C][G][A][C][A][C][G] =  2.100;
+ int21_ar[C][G][A][C][C][C][G] =  1.700;
+ int21_ar[C][G][A][C][G][C][G] =  1.600;
+ int21_ar[C][G][A][C][U][C][G] =  4.000;
+ int21_ar[C][G][A][G][A][C][G] =  1.000;
+ int21_ar[C][G][A][G][C][C][G] =  0.600;
+ int21_ar[C][G][A][G][G][C][G] =  0.400;
+ int21_ar[C][G][A][G][U][C][G] =  4.000;
+ int21_ar[C][G][A][U][A][C][G] =  4.000;
+ int21_ar[C][G][A][U][C][C][G] =  4.000;
+ int21_ar[C][G][A][U][G][C][G] =  4.000;
+ int21_ar[C][G][A][U][U][C][G] =  4.000;
+ int21_ar[C][G][C][A][A][C][G] =  2.300;
+ int21_ar[C][G][C][A][C][C][G] =  2.200;
+ int21_ar[C][G][C][A][G][C][G] =  4.000;
+ int21_ar[C][G][C][A][U][C][G] =  2.200;
+ int21_ar[C][G][C][C][A][C][G] =  2.200;
+ int21_ar[C][G][C][C][C][C][G] =  2.500;
+ int21_ar[C][G][C][C][G][C][G] =  4.000;
+ int21_ar[C][G][C][C][U][C][G] =  2.200;
+ int21_ar[C][G][C][G][A][C][G] =  4.000;
+ int21_ar[C][G][C][G][C][C][G] =  4.000;
+ int21_ar[C][G][C][G][G][C][G] =  4.000;
+ int21_ar[C][G][C][G][U][C][G] =  4.000;
+ int21_ar[C][G][C][U][A][C][G] =  2.500;
+ int21_ar[C][G][C][U][C][C][G] =  1.900;
+ int21_ar[C][G][C][U][G][C][G] =  4.000;
+ int21_ar[C][G][C][U][U][C][G] =  2.200;
+ int21_ar[C][G][G][A][A][C][G] =  1.700;
+ int21_ar[C][G][G][A][C][C][G] =  4.000;
+ int21_ar[C][G][G][A][G][C][G] =  0.800;
+ int21_ar[C][G][G][A][U][C][G] =  4.000;
+ int21_ar[C][G][G][C][A][C][G] =  4.000;
+ int21_ar[C][G][G][C][C][C][G] =  4.000;
+ int21_ar[C][G][G][C][G][C][G] =  4.000;
+ int21_ar[C][G][G][C][U][C][G] =  4.000;
+ int21_ar[C][G][G][G][A][C][G] =  0.800;
+ int21_ar[C][G][G][G][C][C][G] =  4.000;
+ int21_ar[C][G][G][G][G][C][G] =  2.200;
+ int21_ar[C][G][G][G][U][C][G] =  4.000;
+ int21_ar[C][G][G][U][A][C][G] =  4.000;
+ int21_ar[C][G][G][U][C][C][G] =  4.000;
+ int21_ar[C][G][G][U][G][C][G] =  4.000;
+ int21_ar[C][G][G][U][U][C][G] =  4.000;
+ int21_ar[C][G][U][A][A][C][G] =  4.000;
+ int21_ar[C][G][U][A][C][C][G] =  4.000;
+ int21_ar[C][G][U][A][G][C][G] =  4.000;
+ int21_ar[C][G][U][A][U][C][G] =  4.000;
+ int21_ar[C][G][U][C][A][C][G] =  4.000;
+ int21_ar[C][G][U][C][C][C][G] =  2.200;
+ int21_ar[C][G][U][C][G][C][G] =  4.000;
+ int21_ar[C][G][U][C][U][C][G] =  1.300;
+ int21_ar[C][G][U][G][A][C][G] =  4.000;
+ int21_ar[C][G][U][G][C][C][G] =  4.000;
+ int21_ar[C][G][U][G][G][C][G] =  4.000;
+ int21_ar[C][G][U][G][U][C][G] =  4.000;
+ int21_ar[C][G][U][U][A][C][G] =  4.000;
+ int21_ar[C][G][U][U][C][C][G] =  1.700;
+ int21_ar[C][G][U][U][G][C][G] =  4.000;
+ int21_ar[C][G][U][U][U][C][G] =  1.200;
+ int21_ar[C][G][A][A][A][G][C] =  2.300;
+ int21_ar[C][G][A][A][C][G][C] =  2.200;
+ int21_ar[C][G][A][A][G][G][C] =  1.100;
+ int21_ar[C][G][A][A][U][G][C] =  4.000;
+ int21_ar[C][G][A][C][A][G][C] =  2.100;
+ int21_ar[C][G][A][C][C][G][C] =  1.700;
+ int21_ar[C][G][A][C][G][G][C] =  1.600;
+ int21_ar[C][G][A][C][U][G][C] =  4.000;
+ int21_ar[C][G][A][G][A][G][C] =  0.800;
+ int21_ar[C][G][A][G][C][G][C] =  0.600;
+ int21_ar[C][G][A][G][G][G][C] =  0.400;
+ int21_ar[C][G][A][G][U][G][C] =  4.000;
+ int21_ar[C][G][A][U][A][G][C] =  4.000;
+ int21_ar[C][G][A][U][C][G][C] =  4.000;
+ int21_ar[C][G][A][U][G][G][C] =  4.000;
+ int21_ar[C][G][A][U][U][G][C] =  4.000;
+ int21_ar[C][G][C][A][A][G][C] =  2.300;
+ int21_ar[C][G][C][A][C][G][C] =  2.200;
+ int21_ar[C][G][C][A][G][G][C] =  4.000;
+ int21_ar[C][G][C][A][U][G][C] =  2.200;
+ int21_ar[C][G][C][C][A][G][C] =  2.200;
+ int21_ar[C][G][C][C][C][G][C] =  2.500;
+ int21_ar[C][G][C][C][G][G][C] =  4.000;
+ int21_ar[C][G][C][C][U][G][C] =  2.200;
+ int21_ar[C][G][C][G][A][G][C] =  4.000;
+ int21_ar[C][G][C][G][C][G][C] =  4.000;
+ int21_ar[C][G][C][G][G][G][C] =  4.000;
+ int21_ar[C][G][C][G][U][G][C] =  4.000;
+ int21_ar[C][G][C][U][A][G][C] =  2.500;
+ int21_ar[C][G][C][U][C][G][C] =  1.900;
+ int21_ar[C][G][C][U][G][G][C] =  4.000;
+ int21_ar[C][G][C][U][U][G][C] =  2.200;
+ int21_ar[C][G][G][A][A][G][C] =  1.700;
+ int21_ar[C][G][G][A][C][G][C] =  4.000;
+ int21_ar[C][G][G][A][G][G][C] =  0.800;
+ int21_ar[C][G][G][A][U][G][C] =  4.000;
+ int21_ar[C][G][G][C][A][G][C] =  4.000;
+ int21_ar[C][G][G][C][C][G][C] =  4.000;
+ int21_ar[C][G][G][C][G][G][C] =  4.000;
+ int21_ar[C][G][G][C][U][G][C] =  4.000;
+ int21_ar[C][G][G][G][A][G][C] =  0.800;
+ int21_ar[C][G][G][G][C][G][C] =  4.000;
+ int21_ar[C][G][G][G][G][G][C] =  2.200;
+ int21_ar[C][G][G][G][U][G][C] =  4.000;
+ int21_ar[C][G][G][U][A][G][C] =  4.000;
+ int21_ar[C][G][G][U][C][G][C] =  4.000;
+ int21_ar[C][G][G][U][G][G][C] =  4.000;
+ int21_ar[C][G][G][U][U][G][C] =  4.000;
+ int21_ar[C][G][U][A][A][G][C] =  4.000;
+ int21_ar[C][G][U][A][C][G][C] =  4.000;
+ int21_ar[C][G][U][A][G][G][C] =  4.000;
+ int21_ar[C][G][U][A][U][G][C] =  4.000;
+ int21_ar[C][G][U][C][A][G][C] =  4.000;
+ int21_ar[C][G][U][C][C][G][C] =  2.200;
+ int21_ar[C][G][U][C][G][G][C] =  4.000;
+ int21_ar[C][G][U][C][U][G][C] =  1.500;
+ int21_ar[C][G][U][G][A][G][C] =  4.000;
+ int21_ar[C][G][U][G][C][G][C] =  4.000;
+ int21_ar[C][G][U][G][G][G][C] =  4.000;
+ int21_ar[C][G][U][G][U][G][C] =  4.000;
+ int21_ar[C][G][U][U][A][G][C] =  4.000;
+ int21_ar[C][G][U][U][C][G][C] =  1.700;
+ int21_ar[C][G][U][U][G][G][C] =  4.000;
+ int21_ar[C][G][U][U][U][G][C] =  1.200;
+ int21_ar[C][G][A][A][A][G][U] =  3.200;
+ int21_ar[C][G][A][A][C][G][U] =  3.000;
+ int21_ar[C][G][A][A][G][G][U] =  2.400;
+ int21_ar[C][G][A][A][U][G][U] =  4.800;
+ int21_ar[C][G][A][C][A][G][U] =  2.900;
+ int21_ar[C][G][A][C][C][G][U] =  2.500;
+ int21_ar[C][G][A][C][G][G][U] =  2.400;
+ int21_ar[C][G][A][C][U][G][U] =  4.800;
+ int21_ar[C][G][A][G][A][G][U] =  1.800;
+ int21_ar[C][G][A][G][C][G][U] =  1.400;
+ int21_ar[C][G][A][G][G][G][U] =  1.200;
+ int21_ar[C][G][A][G][U][G][U] =  4.800;
+ int21_ar[C][G][A][U][A][G][U] =  4.800;
+ int21_ar[C][G][A][U][C][G][U] =  4.800;
+ int21_ar[C][G][A][U][G][G][U] =  4.800;
+ int21_ar[C][G][A][U][U][G][U] =  4.800;
+ int21_ar[C][G][C][A][A][G][U] =  3.100;
+ int21_ar[C][G][C][A][C][G][U] =  3.000;
+ int21_ar[C][G][C][A][G][G][U] =  4.800;
+ int21_ar[C][G][C][A][U][G][U] =  3.000;
+ int21_ar[C][G][C][C][A][G][U] =  3.000;
+ int21_ar[C][G][C][C][C][G][U] =  3.300;
+ int21_ar[C][G][C][C][G][G][U] =  4.800;
+ int21_ar[C][G][C][C][U][G][U] =  3.000;
+ int21_ar[C][G][C][G][A][G][U] =  4.800;
+ int21_ar[C][G][C][G][C][G][U] =  4.800;
+ int21_ar[C][G][C][G][G][G][U] =  4.800;
+ int21_ar[C][G][C][G][U][G][U] =  4.800;
+ int21_ar[C][G][C][U][A][G][U] =  3.300;
+ int21_ar[C][G][C][U][C][G][U] =  2.700;
+ int21_ar[C][G][C][U][G][G][U] =  4.800;
+ int21_ar[C][G][C][U][U][G][U] =  3.000;
+ int21_ar[C][G][G][A][A][G][U] =  2.500;
+ int21_ar[C][G][G][A][C][G][U] =  4.800;
+ int21_ar[C][G][G][A][G][G][U] =  1.600;
+ int21_ar[C][G][G][A][U][G][U] =  4.800;
+ int21_ar[C][G][G][C][A][G][U] =  4.800;
+ int21_ar[C][G][G][C][C][G][U] =  4.800;
+ int21_ar[C][G][G][C][G][G][U] =  4.800;
+ int21_ar[C][G][G][C][U][G][U] =  4.800;
+ int21_ar[C][G][G][G][A][G][U] =  1.600;
+ int21_ar[C][G][G][G][C][G][U] =  4.800;
+ int21_ar[C][G][G][G][G][G][U] =  3.000;
+ int21_ar[C][G][G][G][U][G][U] =  4.800;
+ int21_ar[C][G][G][U][A][G][U] =  4.800;
+ int21_ar[C][G][G][U][C][G][U] =  4.800;
+ int21_ar[C][G][G][U][G][G][U] =  4.800;
+ int21_ar[C][G][G][U][U][G][U] =  4.800;
+ int21_ar[C][G][U][A][A][G][U] =  4.800;
+ int21_ar[C][G][U][A][C][G][U] =  4.800;
+ int21_ar[C][G][U][A][G][G][U] =  4.800;
+ int21_ar[C][G][U][A][U][G][U] =  4.800;
+ int21_ar[C][G][U][C][A][G][U] =  4.800;
+ int21_ar[C][G][U][C][C][G][U] =  3.000;
+ int21_ar[C][G][U][C][G][G][U] =  4.800;
+ int21_ar[C][G][U][C][U][G][U] =  2.100;
+ int21_ar[C][G][U][G][A][G][U] =  4.800;
+ int21_ar[C][G][U][G][C][G][U] =  4.800;
+ int21_ar[C][G][U][G][G][G][U] =  4.800;
+ int21_ar[C][G][U][G][U][G][U] =  4.800;
+ int21_ar[C][G][U][U][A][G][U] =  4.800;
+ int21_ar[C][G][U][U][C][G][U] =  2.500;
+ int21_ar[C][G][U][U][G][G][U] =  4.800;
+ int21_ar[C][G][U][U][U][G][U] =  2.000;
+ int21_ar[C][G][A][A][A][U][A] =  3.200;
+ int21_ar[C][G][A][A][C][U][A] =  3.000;
+ int21_ar[C][G][A][A][G][U][A] =  2.400;
+ int21_ar[C][G][A][A][U][U][A] =  4.800;
+ int21_ar[C][G][A][C][A][U][A] =  2.900;
+ int21_ar[C][G][A][C][C][U][A] =  2.500;
+ int21_ar[C][G][A][C][G][U][A] =  2.400;
+ int21_ar[C][G][A][C][U][U][A] =  4.800;
+ int21_ar[C][G][A][G][A][U][A] =  1.800;
+ int21_ar[C][G][A][G][C][U][A] =  1.400;
+ int21_ar[C][G][A][G][G][U][A] =  1.200;
+ int21_ar[C][G][A][G][U][U][A] =  4.800;
+ int21_ar[C][G][A][U][A][U][A] =  4.800;
+ int21_ar[C][G][A][U][C][U][A] =  4.800;
+ int21_ar[C][G][A][U][G][U][A] =  4.800;
+ int21_ar[C][G][A][U][U][U][A] =  4.800;
+ int21_ar[C][G][C][A][A][U][A] =  3.100;
+ int21_ar[C][G][C][A][C][U][A] =  3.000;
+ int21_ar[C][G][C][A][G][U][A] =  4.800;
+ int21_ar[C][G][C][A][U][U][A] =  3.000;
+ int21_ar[C][G][C][C][A][U][A] =  3.000;
+ int21_ar[C][G][C][C][C][U][A] =  3.300;
+ int21_ar[C][G][C][C][G][U][A] =  4.800;
+ int21_ar[C][G][C][C][U][U][A] =  3.000;
+ int21_ar[C][G][C][G][A][U][A] =  4.800;
+ int21_ar[C][G][C][G][C][U][A] =  4.800;
+ int21_ar[C][G][C][G][G][U][A] =  4.800;
+ int21_ar[C][G][C][G][U][U][A] =  4.800;
+ int21_ar[C][G][C][U][A][U][A] =  3.300;
+ int21_ar[C][G][C][U][C][U][A] =  2.700;
+ int21_ar[C][G][C][U][G][U][A] =  4.800;
+ int21_ar[C][G][C][U][U][U][A] =  3.000;
+ int21_ar[C][G][G][A][A][U][A] =  2.500;
+ int21_ar[C][G][G][A][C][U][A] =  4.800;
+ int21_ar[C][G][G][A][G][U][A] =  1.600;
+ int21_ar[C][G][G][A][U][U][A] =  4.800;
+ int21_ar[C][G][G][C][A][U][A] =  4.800;
+ int21_ar[C][G][G][C][C][U][A] =  4.800;
+ int21_ar[C][G][G][C][G][U][A] =  4.800;
+ int21_ar[C][G][G][C][U][U][A] =  4.800;
+ int21_ar[C][G][G][G][A][U][A] =  1.600;
+ int21_ar[C][G][G][G][C][U][A] =  4.800;
+ int21_ar[C][G][G][G][G][U][A] =  3.000;
+ int21_ar[C][G][G][G][U][U][A] =  4.800;
+ int21_ar[C][G][G][U][A][U][A] =  4.800;
+ int21_ar[C][G][G][U][C][U][A] =  4.800;
+ int21_ar[C][G][G][U][G][U][A] =  4.800;
+ int21_ar[C][G][G][U][U][U][A] =  4.800;
+ int21_ar[C][G][U][A][A][U][A] =  4.800;
+ int21_ar[C][G][U][A][C][U][A] =  4.800;
+ int21_ar[C][G][U][A][G][U][A] =  4.800;
+ int21_ar[C][G][U][A][U][U][A] =  4.800;
+ int21_ar[C][G][U][C][A][U][A] =  4.800;
+ int21_ar[C][G][U][C][C][U][A] =  3.000;
+ int21_ar[C][G][U][C][G][U][A] =  4.800;
+ int21_ar[C][G][U][C][U][U][A] =  2.100;
+ int21_ar[C][G][U][G][A][U][A] =  4.800;
+ int21_ar[C][G][U][G][C][U][A] =  4.800;
+ int21_ar[C][G][U][G][G][U][A] =  4.800;
+ int21_ar[C][G][U][G][U][U][A] =  4.800;
+ int21_ar[C][G][U][U][A][U][A] =  4.800;
+ int21_ar[C][G][U][U][C][U][A] =  2.500;
+ int21_ar[C][G][U][U][G][U][A] =  4.800;
+ int21_ar[C][G][U][U][U][U][A] =  2.000;
+ int21_ar[C][G][A][A][A][U][G] =  3.200;
+ int21_ar[C][G][A][A][C][U][G] =  3.000;
+ int21_ar[C][G][A][A][G][U][G] =  2.400;
+ int21_ar[C][G][A][A][U][U][G] =  4.800;
+ int21_ar[C][G][A][C][A][U][G] =  2.900;
+ int21_ar[C][G][A][C][C][U][G] =  2.500;
+ int21_ar[C][G][A][C][G][U][G] =  2.400;
+ int21_ar[C][G][A][C][U][U][G] =  4.800;
+ int21_ar[C][G][A][G][A][U][G] =  1.800;
+ int21_ar[C][G][A][G][C][U][G] =  1.400;
+ int21_ar[C][G][A][G][G][U][G] =  1.200;
+ int21_ar[C][G][A][G][U][U][G] =  4.800;
+ int21_ar[C][G][A][U][A][U][G] =  4.800;
+ int21_ar[C][G][A][U][C][U][G] =  4.800;
+ int21_ar[C][G][A][U][G][U][G] =  4.800;
+ int21_ar[C][G][A][U][U][U][G] =  4.800;
+ int21_ar[C][G][C][A][A][U][G] =  3.100;
+ int21_ar[C][G][C][A][C][U][G] =  3.000;
+ int21_ar[C][G][C][A][G][U][G] =  4.800;
+ int21_ar[C][G][C][A][U][U][G] =  3.000;
+ int21_ar[C][G][C][C][A][U][G] =  3.000;
+ int21_ar[C][G][C][C][C][U][G] =  3.300;
+ int21_ar[C][G][C][C][G][U][G] =  4.800;
+ int21_ar[C][G][C][C][U][U][G] =  3.000;
+ int21_ar[C][G][C][G][A][U][G] =  4.800;
+ int21_ar[C][G][C][G][C][U][G] =  4.800;
+ int21_ar[C][G][C][G][G][U][G] =  4.800;
+ int21_ar[C][G][C][G][U][U][G] =  4.800;
+ int21_ar[C][G][C][U][A][U][G] =  3.300;
+ int21_ar[C][G][C][U][C][U][G] =  2.700;
+ int21_ar[C][G][C][U][G][U][G] =  4.800;
+ int21_ar[C][G][C][U][U][U][G] =  3.000;
+ int21_ar[C][G][G][A][A][U][G] =  2.500;
+ int21_ar[C][G][G][A][C][U][G] =  4.800;
+ int21_ar[C][G][G][A][G][U][G] =  1.600;
+ int21_ar[C][G][G][A][U][U][G] =  4.800;
+ int21_ar[C][G][G][C][A][U][G] =  4.800;
+ int21_ar[C][G][G][C][C][U][G] =  4.800;
+ int21_ar[C][G][G][C][G][U][G] =  4.800;
+ int21_ar[C][G][G][C][U][U][G] =  4.800;
+ int21_ar[C][G][G][G][A][U][G] =  1.600;
+ int21_ar[C][G][G][G][C][U][G] =  4.800;
+ int21_ar[C][G][G][G][G][U][G] =  3.000;
+ int21_ar[C][G][G][G][U][U][G] =  4.800;
+ int21_ar[C][G][G][U][A][U][G] =  4.800;
+ int21_ar[C][G][G][U][C][U][G] =  4.800;
+ int21_ar[C][G][G][U][G][U][G] =  4.800;
+ int21_ar[C][G][G][U][U][U][G] =  4.800;
+ int21_ar[C][G][U][A][A][U][G] =  4.800;
+ int21_ar[C][G][U][A][C][U][G] =  4.800;
+ int21_ar[C][G][U][A][G][U][G] =  4.800;
+ int21_ar[C][G][U][A][U][U][G] =  4.800;
+ int21_ar[C][G][U][C][A][U][G] =  4.800;
+ int21_ar[C][G][U][C][C][U][G] =  3.000;
+ int21_ar[C][G][U][C][G][U][G] =  4.800;
+ int21_ar[C][G][U][C][U][U][G] =  2.100;
+ int21_ar[C][G][U][G][A][U][G] =  4.800;
+ int21_ar[C][G][U][G][C][U][G] =  4.800;
+ int21_ar[C][G][U][G][G][U][G] =  4.800;
+ int21_ar[C][G][U][G][U][U][G] =  4.800;
+ int21_ar[C][G][U][U][A][U][G] =  4.800;
+ int21_ar[C][G][U][U][C][U][G] =  2.500;
+ int21_ar[C][G][U][U][G][U][G] =  4.800;
+ int21_ar[C][G][U][U][U][U][G] =  2.000;
+ int21_ar[G][C][A][A][A][A][U] =  3.200;
+ int21_ar[G][C][A][A][C][A][U] =  3.000;
+ int21_ar[G][C][A][A][G][A][U] =  2.400;
+ int21_ar[G][C][A][A][U][A][U] =  4.800;
+ int21_ar[G][C][A][C][A][A][U] =  2.900;
+ int21_ar[G][C][A][C][C][A][U] =  2.500;
+ int21_ar[G][C][A][C][G][A][U] =  2.400;
+ int21_ar[G][C][A][C][U][A][U] =  4.800;
+ int21_ar[G][C][A][G][A][A][U] =  1.800;
+ int21_ar[G][C][A][G][C][A][U] =  1.400;
+ int21_ar[G][C][A][G][G][A][U] =  1.200;
+ int21_ar[G][C][A][G][U][A][U] =  4.800;
+ int21_ar[G][C][A][U][A][A][U] =  4.800;
+ int21_ar[G][C][A][U][C][A][U] =  4.800;
+ int21_ar[G][C][A][U][G][A][U] =  4.800;
+ int21_ar[G][C][A][U][U][A][U] =  4.800;
+ int21_ar[G][C][C][A][A][A][U] =  3.100;
+ int21_ar[G][C][C][A][C][A][U] =  3.000;
+ int21_ar[G][C][C][A][G][A][U] =  4.800;
+ int21_ar[G][C][C][A][U][A][U] =  3.000;
+ int21_ar[G][C][C][C][A][A][U] =  3.000;
+ int21_ar[G][C][C][C][C][A][U] =  3.300;
+ int21_ar[G][C][C][C][G][A][U] =  4.800;
+ int21_ar[G][C][C][C][U][A][U] =  3.000;
+ int21_ar[G][C][C][G][A][A][U] =  4.800;
+ int21_ar[G][C][C][G][C][A][U] =  4.800;
+ int21_ar[G][C][C][G][G][A][U] =  4.800;
+ int21_ar[G][C][C][G][U][A][U] =  4.800;
+ int21_ar[G][C][C][U][A][A][U] =  3.300;
+ int21_ar[G][C][C][U][C][A][U] =  2.700;
+ int21_ar[G][C][C][U][G][A][U] =  4.800;
+ int21_ar[G][C][C][U][U][A][U] =  3.000;
+ int21_ar[G][C][G][A][A][A][U] =  2.500;
+ int21_ar[G][C][G][A][C][A][U] =  4.800;
+ int21_ar[G][C][G][A][G][A][U] =  1.600;
+ int21_ar[G][C][G][A][U][A][U] =  4.800;
+ int21_ar[G][C][G][C][A][A][U] =  4.800;
+ int21_ar[G][C][G][C][C][A][U] =  4.800;
+ int21_ar[G][C][G][C][G][A][U] =  4.800;
+ int21_ar[G][C][G][C][U][A][U] =  4.800;
+ int21_ar[G][C][G][G][A][A][U] =  1.600;
+ int21_ar[G][C][G][G][C][A][U] =  4.800;
+ int21_ar[G][C][G][G][G][A][U] =  3.000;
+ int21_ar[G][C][G][G][U][A][U] =  4.800;
+ int21_ar[G][C][G][U][A][A][U] =  4.800;
+ int21_ar[G][C][G][U][C][A][U] =  4.800;
+ int21_ar[G][C][G][U][G][A][U] =  4.800;
+ int21_ar[G][C][G][U][U][A][U] =  4.800;
+ int21_ar[G][C][U][A][A][A][U] =  4.800;
+ int21_ar[G][C][U][A][C][A][U] =  4.800;
+ int21_ar[G][C][U][A][G][A][U] =  4.800;
+ int21_ar[G][C][U][A][U][A][U] =  4.800;
+ int21_ar[G][C][U][C][A][A][U] =  4.800;
+ int21_ar[G][C][U][C][C][A][U] =  3.000;
+ int21_ar[G][C][U][C][G][A][U] =  4.800;
+ int21_ar[G][C][U][C][U][A][U] =  2.100;
+ int21_ar[G][C][U][G][A][A][U] =  4.800;
+ int21_ar[G][C][U][G][C][A][U] =  4.800;
+ int21_ar[G][C][U][G][G][A][U] =  4.800;
+ int21_ar[G][C][U][G][U][A][U] =  4.800;
+ int21_ar[G][C][U][U][A][A][U] =  4.800;
+ int21_ar[G][C][U][U][C][A][U] =  2.500;
+ int21_ar[G][C][U][U][G][A][U] =  4.800;
+ int21_ar[G][C][U][U][U][A][U] =  2.000;
+ int21_ar[G][C][A][A][A][C][G] =  2.500;
+ int21_ar[G][C][A][A][C][C][G] =  2.200;
+ int21_ar[G][C][A][A][G][C][G] =  2.100;
+ int21_ar[G][C][A][A][U][C][G] =  4.000;
+ int21_ar[G][C][A][C][A][C][G] =  2.100;
+ int21_ar[G][C][A][C][C][C][G] =  1.700;
+ int21_ar[G][C][A][C][G][C][G] =  1.600;
+ int21_ar[G][C][A][C][U][C][G] =  4.000;
+ int21_ar[G][C][A][G][A][C][G] =  1.200;
+ int21_ar[G][C][A][G][C][C][G] =  0.600;
+ int21_ar[G][C][A][G][G][C][G] =  0.400;
+ int21_ar[G][C][A][G][U][C][G] =  4.000;
+ int21_ar[G][C][A][U][A][C][G] =  4.000;
+ int21_ar[G][C][A][U][C][C][G] =  4.000;
+ int21_ar[G][C][A][U][G][C][G] =  4.000;
+ int21_ar[G][C][A][U][U][C][G] =  4.000;
+ int21_ar[G][C][C][A][A][C][G] =  2.300;
+ int21_ar[G][C][C][A][C][C][G] =  2.200;
+ int21_ar[G][C][C][A][G][C][G] =  4.000;
+ int21_ar[G][C][C][A][U][C][G] =  2.200;
+ int21_ar[G][C][C][C][A][C][G] =  2.200;
+ int21_ar[G][C][C][C][C][C][G] =  2.500;
+ int21_ar[G][C][C][C][G][C][G] =  4.000;
+ int21_ar[G][C][C][C][U][C][G] =  2.200;
+ int21_ar[G][C][C][G][A][C][G] =  4.000;
+ int21_ar[G][C][C][G][C][C][G] =  4.000;
+ int21_ar[G][C][C][G][G][C][G] =  4.000;
+ int21_ar[G][C][C][G][U][C][G] =  4.000;
+ int21_ar[G][C][C][U][A][C][G] =  2.500;
+ int21_ar[G][C][C][U][C][C][G] =  1.900;
+ int21_ar[G][C][C][U][G][C][G] =  4.000;
+ int21_ar[G][C][C][U][U][C][G] =  2.200;
+ int21_ar[G][C][G][A][A][C][G] =  1.700;
+ int21_ar[G][C][G][A][C][C][G] =  4.000;
+ int21_ar[G][C][G][A][G][C][G] =  0.800;
+ int21_ar[G][C][G][A][U][C][G] =  4.000;
+ int21_ar[G][C][G][C][A][C][G] =  4.000;
+ int21_ar[G][C][G][C][C][C][G] =  4.000;
+ int21_ar[G][C][G][C][G][C][G] =  4.000;
+ int21_ar[G][C][G][C][U][C][G] =  4.000;
+ int21_ar[G][C][G][G][A][C][G] =  0.800;
+ int21_ar[G][C][G][G][C][C][G] =  4.000;
+ int21_ar[G][C][G][G][G][C][G] =  2.200;
+ int21_ar[G][C][G][G][U][C][G] =  4.000;
+ int21_ar[G][C][G][U][A][C][G] =  4.000;
+ int21_ar[G][C][G][U][C][C][G] =  4.000;
+ int21_ar[G][C][G][U][G][C][G] =  4.000;
+ int21_ar[G][C][G][U][U][C][G] =  4.000;
+ int21_ar[G][C][U][A][A][C][G] =  4.000;
+ int21_ar[G][C][U][A][C][C][G] =  4.000;
+ int21_ar[G][C][U][A][G][C][G] =  4.000;
+ int21_ar[G][C][U][A][U][C][G] =  4.000;
+ int21_ar[G][C][U][C][A][C][G] =  4.000;
+ int21_ar[G][C][U][C][C][C][G] =  2.200;
+ int21_ar[G][C][U][C][G][C][G] =  4.000;
+ int21_ar[G][C][U][C][U][C][G] =  1.200;
+ int21_ar[G][C][U][G][A][C][G] =  4.000;
+ int21_ar[G][C][U][G][C][C][G] =  4.000;
+ int21_ar[G][C][U][G][G][C][G] =  4.000;
+ int21_ar[G][C][U][G][U][C][G] =  4.000;
+ int21_ar[G][C][U][U][A][C][G] =  4.000;
+ int21_ar[G][C][U][U][C][C][G] =  1.700;
+ int21_ar[G][C][U][U][G][C][G] =  4.000;
+ int21_ar[G][C][U][U][U][C][G] =  1.200;
+ int21_ar[G][C][A][A][A][G][C] =  2.400;
+ int21_ar[G][C][A][A][C][G][C] =  2.200;
+ int21_ar[G][C][A][A][G][G][C] =  1.600;
+ int21_ar[G][C][A][A][U][G][C] =  4.000;
+ int21_ar[G][C][A][C][A][G][C] =  2.100;
+ int21_ar[G][C][A][C][C][G][C] =  1.700;
+ int21_ar[G][C][A][C][G][G][C] =  1.600;
+ int21_ar[G][C][A][C][U][G][C] =  4.000;
+ int21_ar[G][C][A][G][A][G][C] =  1.000;
+ int21_ar[G][C][A][G][C][G][C] =  0.600;
+ int21_ar[G][C][A][G][G][G][C] =  0.400;
+ int21_ar[G][C][A][G][U][G][C] =  4.000;
+ int21_ar[G][C][A][U][A][G][C] =  4.000;
+ int21_ar[G][C][A][U][C][G][C] =  4.000;
+ int21_ar[G][C][A][U][G][G][C] =  4.000;
+ int21_ar[G][C][A][U][U][G][C] =  4.000;
+ int21_ar[G][C][C][A][A][G][C] =  2.300;
+ int21_ar[G][C][C][A][C][G][C] =  2.200;
+ int21_ar[G][C][C][A][G][G][C] =  4.000;
+ int21_ar[G][C][C][A][U][G][C] =  2.200;
+ int21_ar[G][C][C][C][A][G][C] =  2.200;
+ int21_ar[G][C][C][C][C][G][C] =  2.500;
+ int21_ar[G][C][C][C][G][G][C] =  4.000;
+ int21_ar[G][C][C][C][U][G][C] =  2.200;
+ int21_ar[G][C][C][G][A][G][C] =  4.000;
+ int21_ar[G][C][C][G][C][G][C] =  4.000;
+ int21_ar[G][C][C][G][G][G][C] =  4.000;
+ int21_ar[G][C][C][G][U][G][C] =  4.000;
+ int21_ar[G][C][C][U][A][G][C] =  2.500;
+ int21_ar[G][C][C][U][C][G][C] =  1.900;
+ int21_ar[G][C][C][U][G][G][C] =  4.000;
+ int21_ar[G][C][C][U][U][G][C] =  2.200;
+ int21_ar[G][C][G][A][A][G][C] =  1.700;
+ int21_ar[G][C][G][A][C][G][C] =  4.000;
+ int21_ar[G][C][G][A][G][G][C] =  0.800;
+ int21_ar[G][C][G][A][U][G][C] =  4.000;
+ int21_ar[G][C][G][C][A][G][C] =  4.000;
+ int21_ar[G][C][G][C][C][G][C] =  4.000;
+ int21_ar[G][C][G][C][G][G][C] =  4.000;
+ int21_ar[G][C][G][C][U][G][C] =  4.000;
+ int21_ar[G][C][G][G][A][G][C] =  0.800;
+ int21_ar[G][C][G][G][C][G][C] =  4.000;
+ int21_ar[G][C][G][G][G][G][C] =  2.200;
+ int21_ar[G][C][G][G][U][G][C] =  4.000;
+ int21_ar[G][C][G][U][A][G][C] =  4.000;
+ int21_ar[G][C][G][U][C][G][C] =  4.000;
+ int21_ar[G][C][G][U][G][G][C] =  4.000;
+ int21_ar[G][C][G][U][U][G][C] =  4.000;
+ int21_ar[G][C][U][A][A][G][C] =  4.000;
+ int21_ar[G][C][U][A][C][G][C] =  4.000;
+ int21_ar[G][C][U][A][G][G][C] =  4.000;
+ int21_ar[G][C][U][A][U][G][C] =  4.000;
+ int21_ar[G][C][U][C][A][G][C] =  4.000;
+ int21_ar[G][C][U][C][C][G][C] =  2.200;
+ int21_ar[G][C][U][C][G][G][C] =  4.000;
+ int21_ar[G][C][U][C][U][G][C] =  1.300;
+ int21_ar[G][C][U][G][A][G][C] =  4.000;
+ int21_ar[G][C][U][G][C][G][C] =  4.000;
+ int21_ar[G][C][U][G][G][G][C] =  4.000;
+ int21_ar[G][C][U][G][U][G][C] =  4.000;
+ int21_ar[G][C][U][U][A][G][C] =  4.000;
+ int21_ar[G][C][U][U][C][G][C] =  1.700;
+ int21_ar[G][C][U][U][G][G][C] =  4.000;
+ int21_ar[G][C][U][U][U][G][C] =  1.200;
+ int21_ar[G][C][A][A][A][G][U] =  3.200;
+ int21_ar[G][C][A][A][C][G][U] =  3.000;
+ int21_ar[G][C][A][A][G][G][U] =  2.400;
+ int21_ar[G][C][A][A][U][G][U] =  4.800;
+ int21_ar[G][C][A][C][A][G][U] =  2.900;
+ int21_ar[G][C][A][C][C][G][U] =  2.500;
+ int21_ar[G][C][A][C][G][G][U] =  2.400;
+ int21_ar[G][C][A][C][U][G][U] =  4.800;
+ int21_ar[G][C][A][G][A][G][U] =  1.800;
+ int21_ar[G][C][A][G][C][G][U] =  1.400;
+ int21_ar[G][C][A][G][G][G][U] =  1.200;
+ int21_ar[G][C][A][G][U][G][U] =  4.800;
+ int21_ar[G][C][A][U][A][G][U] =  4.800;
+ int21_ar[G][C][A][U][C][G][U] =  4.800;
+ int21_ar[G][C][A][U][G][G][U] =  4.800;
+ int21_ar[G][C][A][U][U][G][U] =  4.800;
+ int21_ar[G][C][C][A][A][G][U] =  3.100;
+ int21_ar[G][C][C][A][C][G][U] =  3.000;
+ int21_ar[G][C][C][A][G][G][U] =  4.800;
+ int21_ar[G][C][C][A][U][G][U] =  3.000;
+ int21_ar[G][C][C][C][A][G][U] =  3.000;
+ int21_ar[G][C][C][C][C][G][U] =  3.300;
+ int21_ar[G][C][C][C][G][G][U] =  4.800;
+ int21_ar[G][C][C][C][U][G][U] =  3.000;
+ int21_ar[G][C][C][G][A][G][U] =  4.800;
+ int21_ar[G][C][C][G][C][G][U] =  4.800;
+ int21_ar[G][C][C][G][G][G][U] =  4.800;
+ int21_ar[G][C][C][G][U][G][U] =  4.800;
+ int21_ar[G][C][C][U][A][G][U] =  3.300;
+ int21_ar[G][C][C][U][C][G][U] =  2.700;
+ int21_ar[G][C][C][U][G][G][U] =  4.800;
+ int21_ar[G][C][C][U][U][G][U] =  3.000;
+ int21_ar[G][C][G][A][A][G][U] =  2.500;
+ int21_ar[G][C][G][A][C][G][U] =  4.800;
+ int21_ar[G][C][G][A][G][G][U] =  1.600;
+ int21_ar[G][C][G][A][U][G][U] =  4.800;
+ int21_ar[G][C][G][C][A][G][U] =  4.800;
+ int21_ar[G][C][G][C][C][G][U] =  4.800;
+ int21_ar[G][C][G][C][G][G][U] =  4.800;
+ int21_ar[G][C][G][C][U][G][U] =  4.800;
+ int21_ar[G][C][G][G][A][G][U] =  1.600;
+ int21_ar[G][C][G][G][C][G][U] =  4.800;
+ int21_ar[G][C][G][G][G][G][U] =  3.000;
+ int21_ar[G][C][G][G][U][G][U] =  4.800;
+ int21_ar[G][C][G][U][A][G][U] =  4.800;
+ int21_ar[G][C][G][U][C][G][U] =  4.800;
+ int21_ar[G][C][G][U][G][G][U] =  4.800;
+ int21_ar[G][C][G][U][U][G][U] =  4.800;
+ int21_ar[G][C][U][A][A][G][U] =  4.800;
+ int21_ar[G][C][U][A][C][G][U] =  4.800;
+ int21_ar[G][C][U][A][G][G][U] =  4.800;
+ int21_ar[G][C][U][A][U][G][U] =  4.800;
+ int21_ar[G][C][U][C][A][G][U] =  4.800;
+ int21_ar[G][C][U][C][C][G][U] =  3.000;
+ int21_ar[G][C][U][C][G][G][U] =  4.800;
+ int21_ar[G][C][U][C][U][G][U] =  2.100;
+ int21_ar[G][C][U][G][A][G][U] =  4.800;
+ int21_ar[G][C][U][G][C][G][U] =  4.800;
+ int21_ar[G][C][U][G][G][G][U] =  4.800;
+ int21_ar[G][C][U][G][U][G][U] =  4.800;
+ int21_ar[G][C][U][U][A][G][U] =  4.800;
+ int21_ar[G][C][U][U][C][G][U] =  2.500;
+ int21_ar[G][C][U][U][G][G][U] =  4.800;
+ int21_ar[G][C][U][U][U][G][U] =  2.000;
+ int21_ar[G][C][A][A][A][U][A] =  3.200;
+ int21_ar[G][C][A][A][C][U][A] =  3.000;
+ int21_ar[G][C][A][A][G][U][A] =  2.400;
+ int21_ar[G][C][A][A][U][U][A] =  4.800;
+ int21_ar[G][C][A][C][A][U][A] =  2.900;
+ int21_ar[G][C][A][C][C][U][A] =  2.500;
+ int21_ar[G][C][A][C][G][U][A] =  2.400;
+ int21_ar[G][C][A][C][U][U][A] =  4.800;
+ int21_ar[G][C][A][G][A][U][A] =  1.800;
+ int21_ar[G][C][A][G][C][U][A] =  1.400;
+ int21_ar[G][C][A][G][G][U][A] =  1.200;
+ int21_ar[G][C][A][G][U][U][A] =  4.800;
+ int21_ar[G][C][A][U][A][U][A] =  4.800;
+ int21_ar[G][C][A][U][C][U][A] =  4.800;
+ int21_ar[G][C][A][U][G][U][A] =  4.800;
+ int21_ar[G][C][A][U][U][U][A] =  4.800;
+ int21_ar[G][C][C][A][A][U][A] =  3.100;
+ int21_ar[G][C][C][A][C][U][A] =  3.000;
+ int21_ar[G][C][C][A][G][U][A] =  4.800;
+ int21_ar[G][C][C][A][U][U][A] =  3.000;
+ int21_ar[G][C][C][C][A][U][A] =  3.000;
+ int21_ar[G][C][C][C][C][U][A] =  3.300;
+ int21_ar[G][C][C][C][G][U][A] =  4.800;
+ int21_ar[G][C][C][C][U][U][A] =  3.000;
+ int21_ar[G][C][C][G][A][U][A] =  4.800;
+ int21_ar[G][C][C][G][C][U][A] =  4.800;
+ int21_ar[G][C][C][G][G][U][A] =  4.800;
+ int21_ar[G][C][C][G][U][U][A] =  4.800;
+ int21_ar[G][C][C][U][A][U][A] =  3.300;
+ int21_ar[G][C][C][U][C][U][A] =  2.700;
+ int21_ar[G][C][C][U][G][U][A] =  4.800;
+ int21_ar[G][C][C][U][U][U][A] =  3.000;
+ int21_ar[G][C][G][A][A][U][A] =  2.500;
+ int21_ar[G][C][G][A][C][U][A] =  4.800;
+ int21_ar[G][C][G][A][G][U][A] =  1.600;
+ int21_ar[G][C][G][A][U][U][A] =  4.800;
+ int21_ar[G][C][G][C][A][U][A] =  4.800;
+ int21_ar[G][C][G][C][C][U][A] =  4.800;
+ int21_ar[G][C][G][C][G][U][A] =  4.800;
+ int21_ar[G][C][G][C][U][U][A] =  4.800;
+ int21_ar[G][C][G][G][A][U][A] =  1.600;
+ int21_ar[G][C][G][G][C][U][A] =  4.800;
+ int21_ar[G][C][G][G][G][U][A] =  3.000;
+ int21_ar[G][C][G][G][U][U][A] =  4.800;
+ int21_ar[G][C][G][U][A][U][A] =  4.800;
+ int21_ar[G][C][G][U][C][U][A] =  4.800;
+ int21_ar[G][C][G][U][G][U][A] =  4.800;
+ int21_ar[G][C][G][U][U][U][A] =  4.800;
+ int21_ar[G][C][U][A][A][U][A] =  4.800;
+ int21_ar[G][C][U][A][C][U][A] =  4.800;
+ int21_ar[G][C][U][A][G][U][A] =  4.800;
+ int21_ar[G][C][U][A][U][U][A] =  4.800;
+ int21_ar[G][C][U][C][A][U][A] =  4.800;
+ int21_ar[G][C][U][C][C][U][A] =  3.000;
+ int21_ar[G][C][U][C][G][U][A] =  4.800;
+ int21_ar[G][C][U][C][U][U][A] =  2.100;
+ int21_ar[G][C][U][G][A][U][A] =  4.800;
+ int21_ar[G][C][U][G][C][U][A] =  4.800;
+ int21_ar[G][C][U][G][G][U][A] =  4.800;
+ int21_ar[G][C][U][G][U][U][A] =  4.800;
+ int21_ar[G][C][U][U][A][U][A] =  4.800;
+ int21_ar[G][C][U][U][C][U][A] =  2.500;
+ int21_ar[G][C][U][U][G][U][A] =  4.800;
+ int21_ar[G][C][U][U][U][U][A] =  2.000;
+ int21_ar[G][C][A][A][A][U][G] =  3.200;
+ int21_ar[G][C][A][A][C][U][G] =  3.000;
+ int21_ar[G][C][A][A][G][U][G] =  2.400;
+ int21_ar[G][C][A][A][U][U][G] =  4.800;
+ int21_ar[G][C][A][C][A][U][G] =  2.900;
+ int21_ar[G][C][A][C][C][U][G] =  2.500;
+ int21_ar[G][C][A][C][G][U][G] =  2.400;
+ int21_ar[G][C][A][C][U][U][G] =  4.800;
+ int21_ar[G][C][A][G][A][U][G] =  1.800;
+ int21_ar[G][C][A][G][C][U][G] =  1.400;
+ int21_ar[G][C][A][G][G][U][G] =  1.200;
+ int21_ar[G][C][A][G][U][U][G] =  4.800;
+ int21_ar[G][C][A][U][A][U][G] =  4.800;
+ int21_ar[G][C][A][U][C][U][G] =  4.800;
+ int21_ar[G][C][A][U][G][U][G] =  4.800;
+ int21_ar[G][C][A][U][U][U][G] =  4.800;
+ int21_ar[G][C][C][A][A][U][G] =  3.100;
+ int21_ar[G][C][C][A][C][U][G] =  3.000;
+ int21_ar[G][C][C][A][G][U][G] =  4.800;
+ int21_ar[G][C][C][A][U][U][G] =  3.000;
+ int21_ar[G][C][C][C][A][U][G] =  3.000;
+ int21_ar[G][C][C][C][C][U][G] =  3.300;
+ int21_ar[G][C][C][C][G][U][G] =  4.800;
+ int21_ar[G][C][C][C][U][U][G] =  3.000;
+ int21_ar[G][C][C][G][A][U][G] =  4.800;
+ int21_ar[G][C][C][G][C][U][G] =  4.800;
+ int21_ar[G][C][C][G][G][U][G] =  4.800;
+ int21_ar[G][C][C][G][U][U][G] =  4.800;
+ int21_ar[G][C][C][U][A][U][G] =  3.300;
+ int21_ar[G][C][C][U][C][U][G] =  2.700;
+ int21_ar[G][C][C][U][G][U][G] =  4.800;
+ int21_ar[G][C][C][U][U][U][G] =  3.000;
+ int21_ar[G][C][G][A][A][U][G] =  2.500;
+ int21_ar[G][C][G][A][C][U][G] =  4.800;
+ int21_ar[G][C][G][A][G][U][G] =  1.600;
+ int21_ar[G][C][G][A][U][U][G] =  4.800;
+ int21_ar[G][C][G][C][A][U][G] =  4.800;
+ int21_ar[G][C][G][C][C][U][G] =  4.800;
+ int21_ar[G][C][G][C][G][U][G] =  4.800;
+ int21_ar[G][C][G][C][U][U][G] =  4.800;
+ int21_ar[G][C][G][G][A][U][G] =  1.600;
+ int21_ar[G][C][G][G][C][U][G] =  4.800;
+ int21_ar[G][C][G][G][G][U][G] =  3.000;
+ int21_ar[G][C][G][G][U][U][G] =  4.800;
+ int21_ar[G][C][G][U][A][U][G] =  4.800;
+ int21_ar[G][C][G][U][C][U][G] =  4.800;
+ int21_ar[G][C][G][U][G][U][G] =  4.800;
+ int21_ar[G][C][G][U][U][U][G] =  4.800;
+ int21_ar[G][C][U][A][A][U][G] =  4.800;
+ int21_ar[G][C][U][A][C][U][G] =  4.800;
+ int21_ar[G][C][U][A][G][U][G] =  4.800;
+ int21_ar[G][C][U][A][U][U][G] =  4.800;
+ int21_ar[G][C][U][C][A][U][G] =  4.800;
+ int21_ar[G][C][U][C][C][U][G] =  3.000;
+ int21_ar[G][C][U][C][G][U][G] =  4.800;
+ int21_ar[G][C][U][C][U][U][G] =  2.100;
+ int21_ar[G][C][U][G][A][U][G] =  4.800;
+ int21_ar[G][C][U][G][C][U][G] =  4.800;
+ int21_ar[G][C][U][G][G][U][G] =  4.800;
+ int21_ar[G][C][U][G][U][U][G] =  4.800;
+ int21_ar[G][C][U][U][A][U][G] =  4.800;
+ int21_ar[G][C][U][U][C][U][G] =  2.500;
+ int21_ar[G][C][U][U][G][U][G] =  4.800;
+ int21_ar[G][C][U][U][U][U][G] =  2.000;
+ int21_ar[G][U][A][A][A][A][U] =  3.900;
+ int21_ar[G][U][A][A][C][A][U] =  3.700;
+ int21_ar[G][U][A][A][G][A][U] =  3.100;
+ int21_ar[G][U][A][A][U][A][U] =  5.500;
+ int21_ar[G][U][A][C][A][A][U] =  3.600;
+ int21_ar[G][U][A][C][C][A][U] =  3.200;
+ int21_ar[G][U][A][C][G][A][U] =  3.100;
+ int21_ar[G][U][A][C][U][A][U] =  5.500;
+ int21_ar[G][U][A][G][A][A][U] =  2.500;
+ int21_ar[G][U][A][G][C][A][U] =  2.100;
+ int21_ar[G][U][A][G][G][A][U] =  1.900;
+ int21_ar[G][U][A][G][U][A][U] =  5.500;
+ int21_ar[G][U][A][U][A][A][U] =  5.500;
+ int21_ar[G][U][A][U][C][A][U] =  5.500;
+ int21_ar[G][U][A][U][G][A][U] =  5.500;
+ int21_ar[G][U][A][U][U][A][U] =  5.500;
+ int21_ar[G][U][C][A][A][A][U] =  3.800;
+ int21_ar[G][U][C][A][C][A][U] =  3.700;
+ int21_ar[G][U][C][A][G][A][U] =  5.500;
+ int21_ar[G][U][C][A][U][A][U] =  3.700;
+ int21_ar[G][U][C][C][A][A][U] =  3.700;
+ int21_ar[G][U][C][C][C][A][U] =  4.000;
+ int21_ar[G][U][C][C][G][A][U] =  5.500;
+ int21_ar[G][U][C][C][U][A][U] =  3.700;
+ int21_ar[G][U][C][G][A][A][U] =  5.500;
+ int21_ar[G][U][C][G][C][A][U] =  5.500;
+ int21_ar[G][U][C][G][G][A][U] =  5.500;
+ int21_ar[G][U][C][G][U][A][U] =  5.500;
+ int21_ar[G][U][C][U][A][A][U] =  4.000;
+ int21_ar[G][U][C][U][C][A][U] =  3.400;
+ int21_ar[G][U][C][U][G][A][U] =  5.500;
+ int21_ar[G][U][C][U][U][A][U] =  3.700;
+ int21_ar[G][U][G][A][A][A][U] =  3.200;
+ int21_ar[G][U][G][A][C][A][U] =  5.500;
+ int21_ar[G][U][G][A][G][A][U] =  2.300;
+ int21_ar[G][U][G][A][U][A][U] =  5.500;
+ int21_ar[G][U][G][C][A][A][U] =  5.500;
+ int21_ar[G][U][G][C][C][A][U] =  5.500;
+ int21_ar[G][U][G][C][G][A][U] =  5.500;
+ int21_ar[G][U][G][C][U][A][U] =  5.500;
+ int21_ar[G][U][G][G][A][A][U] =  2.300;
+ int21_ar[G][U][G][G][C][A][U] =  5.500;
+ int21_ar[G][U][G][G][G][A][U] =  3.700;
+ int21_ar[G][U][G][G][U][A][U] =  5.500;
+ int21_ar[G][U][G][U][A][A][U] =  5.500;
+ int21_ar[G][U][G][U][C][A][U] =  5.500;
+ int21_ar[G][U][G][U][G][A][U] =  5.500;
+ int21_ar[G][U][G][U][U][A][U] =  5.500;
+ int21_ar[G][U][U][A][A][A][U] =  5.500;
+ int21_ar[G][U][U][A][C][A][U] =  5.500;
+ int21_ar[G][U][U][A][G][A][U] =  5.500;
+ int21_ar[G][U][U][A][U][A][U] =  5.500;
+ int21_ar[G][U][U][C][A][A][U] =  5.500;
+ int21_ar[G][U][U][C][C][A][U] =  3.700;
+ int21_ar[G][U][U][C][G][A][U] =  5.500;
+ int21_ar[G][U][U][C][U][A][U] =  2.800;
+ int21_ar[G][U][U][G][A][A][U] =  5.500;
+ int21_ar[G][U][U][G][C][A][U] =  5.500;
+ int21_ar[G][U][U][G][G][A][U] =  5.500;
+ int21_ar[G][U][U][G][U][A][U] =  5.500;
+ int21_ar[G][U][U][U][A][A][U] =  5.500;
+ int21_ar[G][U][U][U][C][A][U] =  3.200;
+ int21_ar[G][U][U][U][G][A][U] =  5.500;
+ int21_ar[G][U][U][U][U][A][U] =  2.700;
+ int21_ar[G][U][A][A][A][C][G] =  3.200;
+ int21_ar[G][U][A][A][C][C][G] =  3.000;
+ int21_ar[G][U][A][A][G][C][G] =  2.400;
+ int21_ar[G][U][A][A][U][C][G] =  4.800;
+ int21_ar[G][U][A][C][A][C][G] =  2.900;
+ int21_ar[G][U][A][C][C][C][G] =  2.500;
+ int21_ar[G][U][A][C][G][C][G] =  2.400;
+ int21_ar[G][U][A][C][U][C][G] =  4.800;
+ int21_ar[G][U][A][G][A][C][G] =  1.800;
+ int21_ar[G][U][A][G][C][C][G] =  1.400;
+ int21_ar[G][U][A][G][G][C][G] =  1.200;
+ int21_ar[G][U][A][G][U][C][G] =  4.800;
+ int21_ar[G][U][A][U][A][C][G] =  4.800;
+ int21_ar[G][U][A][U][C][C][G] =  4.800;
+ int21_ar[G][U][A][U][G][C][G] =  4.800;
+ int21_ar[G][U][A][U][U][C][G] =  4.800;
+ int21_ar[G][U][C][A][A][C][G] =  3.100;
+ int21_ar[G][U][C][A][C][C][G] =  3.000;
+ int21_ar[G][U][C][A][G][C][G] =  4.800;
+ int21_ar[G][U][C][A][U][C][G] =  3.000;
+ int21_ar[G][U][C][C][A][C][G] =  3.000;
+ int21_ar[G][U][C][C][C][C][G] =  3.300;
+ int21_ar[G][U][C][C][G][C][G] =  4.800;
+ int21_ar[G][U][C][C][U][C][G] =  3.000;
+ int21_ar[G][U][C][G][A][C][G] =  4.800;
+ int21_ar[G][U][C][G][C][C][G] =  4.800;
+ int21_ar[G][U][C][G][G][C][G] =  4.800;
+ int21_ar[G][U][C][G][U][C][G] =  4.800;
+ int21_ar[G][U][C][U][A][C][G] =  3.300;
+ int21_ar[G][U][C][U][C][C][G] =  2.700;
+ int21_ar[G][U][C][U][G][C][G] =  4.800;
+ int21_ar[G][U][C][U][U][C][G] =  3.000;
+ int21_ar[G][U][G][A][A][C][G] =  2.500;
+ int21_ar[G][U][G][A][C][C][G] =  4.800;
+ int21_ar[G][U][G][A][G][C][G] =  1.600;
+ int21_ar[G][U][G][A][U][C][G] =  4.800;
+ int21_ar[G][U][G][C][A][C][G] =  4.800;
+ int21_ar[G][U][G][C][C][C][G] =  4.800;
+ int21_ar[G][U][G][C][G][C][G] =  4.800;
+ int21_ar[G][U][G][C][U][C][G] =  4.800;
+ int21_ar[G][U][G][G][A][C][G] =  1.600;
+ int21_ar[G][U][G][G][C][C][G] =  4.800;
+ int21_ar[G][U][G][G][G][C][G] =  3.000;
+ int21_ar[G][U][G][G][U][C][G] =  4.800;
+ int21_ar[G][U][G][U][A][C][G] =  4.800;
+ int21_ar[G][U][G][U][C][C][G] =  4.800;
+ int21_ar[G][U][G][U][G][C][G] =  4.800;
+ int21_ar[G][U][G][U][U][C][G] =  4.800;
+ int21_ar[G][U][U][A][A][C][G] =  4.800;
+ int21_ar[G][U][U][A][C][C][G] =  4.800;
+ int21_ar[G][U][U][A][G][C][G] =  4.800;
+ int21_ar[G][U][U][A][U][C][G] =  4.800;
+ int21_ar[G][U][U][C][A][C][G] =  4.800;
+ int21_ar[G][U][U][C][C][C][G] =  3.000;
+ int21_ar[G][U][U][C][G][C][G] =  4.800;
+ int21_ar[G][U][U][C][U][C][G] =  2.100;
+ int21_ar[G][U][U][G][A][C][G] =  4.800;
+ int21_ar[G][U][U][G][C][C][G] =  4.800;
+ int21_ar[G][U][U][G][G][C][G] =  4.800;
+ int21_ar[G][U][U][G][U][C][G] =  4.800;
+ int21_ar[G][U][U][U][A][C][G] =  4.800;
+ int21_ar[G][U][U][U][C][C][G] =  2.500;
+ int21_ar[G][U][U][U][G][C][G] =  4.800;
+ int21_ar[G][U][U][U][U][C][G] =  2.000;
+ int21_ar[G][U][A][A][A][G][C] =  3.200;
+ int21_ar[G][U][A][A][C][G][C] =  3.000;
+ int21_ar[G][U][A][A][G][G][C] =  2.400;
+ int21_ar[G][U][A][A][U][G][C] =  4.800;
+ int21_ar[G][U][A][C][A][G][C] =  2.900;
+ int21_ar[G][U][A][C][C][G][C] =  2.500;
+ int21_ar[G][U][A][C][G][G][C] =  2.400;
+ int21_ar[G][U][A][C][U][G][C] =  4.800;
+ int21_ar[G][U][A][G][A][G][C] =  1.800;
+ int21_ar[G][U][A][G][C][G][C] =  1.400;
+ int21_ar[G][U][A][G][G][G][C] =  1.200;
+ int21_ar[G][U][A][G][U][G][C] =  4.800;
+ int21_ar[G][U][A][U][A][G][C] =  4.800;
+ int21_ar[G][U][A][U][C][G][C] =  4.800;
+ int21_ar[G][U][A][U][G][G][C] =  4.800;
+ int21_ar[G][U][A][U][U][G][C] =  4.800;
+ int21_ar[G][U][C][A][A][G][C] =  3.100;
+ int21_ar[G][U][C][A][C][G][C] =  3.000;
+ int21_ar[G][U][C][A][G][G][C] =  4.800;
+ int21_ar[G][U][C][A][U][G][C] =  3.000;
+ int21_ar[G][U][C][C][A][G][C] =  3.000;
+ int21_ar[G][U][C][C][C][G][C] =  3.300;
+ int21_ar[G][U][C][C][G][G][C] =  4.800;
+ int21_ar[G][U][C][C][U][G][C] =  3.000;
+ int21_ar[G][U][C][G][A][G][C] =  4.800;
+ int21_ar[G][U][C][G][C][G][C] =  4.800;
+ int21_ar[G][U][C][G][G][G][C] =  4.800;
+ int21_ar[G][U][C][G][U][G][C] =  4.800;
+ int21_ar[G][U][C][U][A][G][C] =  3.300;
+ int21_ar[G][U][C][U][C][G][C] =  2.700;
+ int21_ar[G][U][C][U][G][G][C] =  4.800;
+ int21_ar[G][U][C][U][U][G][C] =  3.000;
+ int21_ar[G][U][G][A][A][G][C] =  2.500;
+ int21_ar[G][U][G][A][C][G][C] =  4.800;
+ int21_ar[G][U][G][A][G][G][C] =  1.600;
+ int21_ar[G][U][G][A][U][G][C] =  4.800;
+ int21_ar[G][U][G][C][A][G][C] =  4.800;
+ int21_ar[G][U][G][C][C][G][C] =  4.800;
+ int21_ar[G][U][G][C][G][G][C] =  4.800;
+ int21_ar[G][U][G][C][U][G][C] =  4.800;
+ int21_ar[G][U][G][G][A][G][C] =  1.600;
+ int21_ar[G][U][G][G][C][G][C] =  4.800;
+ int21_ar[G][U][G][G][G][G][C] =  3.000;
+ int21_ar[G][U][G][G][U][G][C] =  4.800;
+ int21_ar[G][U][G][U][A][G][C] =  4.800;
+ int21_ar[G][U][G][U][C][G][C] =  4.800;
+ int21_ar[G][U][G][U][G][G][C] =  4.800;
+ int21_ar[G][U][G][U][U][G][C] =  4.800;
+ int21_ar[G][U][U][A][A][G][C] =  4.800;
+ int21_ar[G][U][U][A][C][G][C] =  4.800;
+ int21_ar[G][U][U][A][G][G][C] =  4.800;
+ int21_ar[G][U][U][A][U][G][C] =  4.800;
+ int21_ar[G][U][U][C][A][G][C] =  4.800;
+ int21_ar[G][U][U][C][C][G][C] =  3.000;
+ int21_ar[G][U][U][C][G][G][C] =  4.800;
+ int21_ar[G][U][U][C][U][G][C] =  2.100;
+ int21_ar[G][U][U][G][A][G][C] =  4.800;
+ int21_ar[G][U][U][G][C][G][C] =  4.800;
+ int21_ar[G][U][U][G][G][G][C] =  4.800;
+ int21_ar[G][U][U][G][U][G][C] =  4.800;
+ int21_ar[G][U][U][U][A][G][C] =  4.800;
+ int21_ar[G][U][U][U][C][G][C] =  2.500;
+ int21_ar[G][U][U][U][G][G][C] =  4.800;
+ int21_ar[G][U][U][U][U][G][C] =  2.000;
+ int21_ar[G][U][A][A][A][G][U] =  3.900;
+ int21_ar[G][U][A][A][C][G][U] =  3.700;
+ int21_ar[G][U][A][A][G][G][U] =  3.100;
+ int21_ar[G][U][A][A][U][G][U] =  5.500;
+ int21_ar[G][U][A][C][A][G][U] =  3.600;
+ int21_ar[G][U][A][C][C][G][U] =  3.200;
+ int21_ar[G][U][A][C][G][G][U] =  3.100;
+ int21_ar[G][U][A][C][U][G][U] =  5.500;
+ int21_ar[G][U][A][G][A][G][U] =  2.500;
+ int21_ar[G][U][A][G][C][G][U] =  2.100;
+ int21_ar[G][U][A][G][G][G][U] =  1.900;
+ int21_ar[G][U][A][G][U][G][U] =  5.500;
+ int21_ar[G][U][A][U][A][G][U] =  5.500;
+ int21_ar[G][U][A][U][C][G][U] =  5.500;
+ int21_ar[G][U][A][U][G][G][U] =  5.500;
+ int21_ar[G][U][A][U][U][G][U] =  5.500;
+ int21_ar[G][U][C][A][A][G][U] =  3.800;
+ int21_ar[G][U][C][A][C][G][U] =  3.700;
+ int21_ar[G][U][C][A][G][G][U] =  5.500;
+ int21_ar[G][U][C][A][U][G][U] =  3.700;
+ int21_ar[G][U][C][C][A][G][U] =  3.700;
+ int21_ar[G][U][C][C][C][G][U] =  4.000;
+ int21_ar[G][U][C][C][G][G][U] =  5.500;
+ int21_ar[G][U][C][C][U][G][U] =  3.700;
+ int21_ar[G][U][C][G][A][G][U] =  5.500;
+ int21_ar[G][U][C][G][C][G][U] =  5.500;
+ int21_ar[G][U][C][G][G][G][U] =  5.500;
+ int21_ar[G][U][C][G][U][G][U] =  5.500;
+ int21_ar[G][U][C][U][A][G][U] =  4.000;
+ int21_ar[G][U][C][U][C][G][U] =  3.400;
+ int21_ar[G][U][C][U][G][G][U] =  5.500;
+ int21_ar[G][U][C][U][U][G][U] =  3.700;
+ int21_ar[G][U][G][A][A][G][U] =  3.200;
+ int21_ar[G][U][G][A][C][G][U] =  5.500;
+ int21_ar[G][U][G][A][G][G][U] =  2.300;
+ int21_ar[G][U][G][A][U][G][U] =  5.500;
+ int21_ar[G][U][G][C][A][G][U] =  5.500;
+ int21_ar[G][U][G][C][C][G][U] =  5.500;
+ int21_ar[G][U][G][C][G][G][U] =  5.500;
+ int21_ar[G][U][G][C][U][G][U] =  5.500;
+ int21_ar[G][U][G][G][A][G][U] =  2.300;
+ int21_ar[G][U][G][G][C][G][U] =  5.500;
+ int21_ar[G][U][G][G][G][G][U] =  3.700;
+ int21_ar[G][U][G][G][U][G][U] =  5.500;
+ int21_ar[G][U][G][U][A][G][U] =  5.500;
+ int21_ar[G][U][G][U][C][G][U] =  5.500;
+ int21_ar[G][U][G][U][G][G][U] =  5.500;
+ int21_ar[G][U][G][U][U][G][U] =  5.500;
+ int21_ar[G][U][U][A][A][G][U] =  5.500;
+ int21_ar[G][U][U][A][C][G][U] =  5.500;
+ int21_ar[G][U][U][A][G][G][U] =  5.500;
+ int21_ar[G][U][U][A][U][G][U] =  5.500;
+ int21_ar[G][U][U][C][A][G][U] =  5.500;
+ int21_ar[G][U][U][C][C][G][U] =  3.700;
+ int21_ar[G][U][U][C][G][G][U] =  5.500;
+ int21_ar[G][U][U][C][U][G][U] =  2.800;
+ int21_ar[G][U][U][G][A][G][U] =  5.500;
+ int21_ar[G][U][U][G][C][G][U] =  5.500;
+ int21_ar[G][U][U][G][G][G][U] =  5.500;
+ int21_ar[G][U][U][G][U][G][U] =  5.500;
+ int21_ar[G][U][U][U][A][G][U] =  5.500;
+ int21_ar[G][U][U][U][C][G][U] =  3.200;
+ int21_ar[G][U][U][U][G][G][U] =  5.500;
+ int21_ar[G][U][U][U][U][G][U] =  2.700;
+ int21_ar[G][U][A][A][A][U][A] =  3.900;
+ int21_ar[G][U][A][A][C][U][A] =  3.700;
+ int21_ar[G][U][A][A][G][U][A] =  3.100;
+ int21_ar[G][U][A][A][U][U][A] =  5.500;
+ int21_ar[G][U][A][C][A][U][A] =  3.600;
+ int21_ar[G][U][A][C][C][U][A] =  3.200;
+ int21_ar[G][U][A][C][G][U][A] =  3.100;
+ int21_ar[G][U][A][C][U][U][A] =  5.500;
+ int21_ar[G][U][A][G][A][U][A] =  2.500;
+ int21_ar[G][U][A][G][C][U][A] =  2.100;
+ int21_ar[G][U][A][G][G][U][A] =  1.900;
+ int21_ar[G][U][A][G][U][U][A] =  5.500;
+ int21_ar[G][U][A][U][A][U][A] =  5.500;
+ int21_ar[G][U][A][U][C][U][A] =  5.500;
+ int21_ar[G][U][A][U][G][U][A] =  5.500;
+ int21_ar[G][U][A][U][U][U][A] =  5.500;
+ int21_ar[G][U][C][A][A][U][A] =  3.800;
+ int21_ar[G][U][C][A][C][U][A] =  3.700;
+ int21_ar[G][U][C][A][G][U][A] =  5.500;
+ int21_ar[G][U][C][A][U][U][A] =  3.700;
+ int21_ar[G][U][C][C][A][U][A] =  3.700;
+ int21_ar[G][U][C][C][C][U][A] =  4.000;
+ int21_ar[G][U][C][C][G][U][A] =  5.500;
+ int21_ar[G][U][C][C][U][U][A] =  3.700;
+ int21_ar[G][U][C][G][A][U][A] =  5.500;
+ int21_ar[G][U][C][G][C][U][A] =  5.500;
+ int21_ar[G][U][C][G][G][U][A] =  5.500;
+ int21_ar[G][U][C][G][U][U][A] =  5.500;
+ int21_ar[G][U][C][U][A][U][A] =  4.000;
+ int21_ar[G][U][C][U][C][U][A] =  3.400;
+ int21_ar[G][U][C][U][G][U][A] =  5.500;
+ int21_ar[G][U][C][U][U][U][A] =  3.700;
+ int21_ar[G][U][G][A][A][U][A] =  3.200;
+ int21_ar[G][U][G][A][C][U][A] =  5.500;
+ int21_ar[G][U][G][A][G][U][A] =  2.300;
+ int21_ar[G][U][G][A][U][U][A] =  5.500;
+ int21_ar[G][U][G][C][A][U][A] =  5.500;
+ int21_ar[G][U][G][C][C][U][A] =  5.500;
+ int21_ar[G][U][G][C][G][U][A] =  5.500;
+ int21_ar[G][U][G][C][U][U][A] =  5.500;
+ int21_ar[G][U][G][G][A][U][A] =  2.300;
+ int21_ar[G][U][G][G][C][U][A] =  5.500;
+ int21_ar[G][U][G][G][G][U][A] =  3.700;
+ int21_ar[G][U][G][G][U][U][A] =  5.500;
+ int21_ar[G][U][G][U][A][U][A] =  5.500;
+ int21_ar[G][U][G][U][C][U][A] =  5.500;
+ int21_ar[G][U][G][U][G][U][A] =  5.500;
+ int21_ar[G][U][G][U][U][U][A] =  5.500;
+ int21_ar[G][U][U][A][A][U][A] =  5.500;
+ int21_ar[G][U][U][A][C][U][A] =  5.500;
+ int21_ar[G][U][U][A][G][U][A] =  5.500;
+ int21_ar[G][U][U][A][U][U][A] =  5.500;
+ int21_ar[G][U][U][C][A][U][A] =  5.500;
+ int21_ar[G][U][U][C][C][U][A] =  3.700;
+ int21_ar[G][U][U][C][G][U][A] =  5.500;
+ int21_ar[G][U][U][C][U][U][A] =  2.800;
+ int21_ar[G][U][U][G][A][U][A] =  5.500;
+ int21_ar[G][U][U][G][C][U][A] =  5.500;
+ int21_ar[G][U][U][G][G][U][A] =  5.500;
+ int21_ar[G][U][U][G][U][U][A] =  5.500;
+ int21_ar[G][U][U][U][A][U][A] =  5.500;
+ int21_ar[G][U][U][U][C][U][A] =  3.200;
+ int21_ar[G][U][U][U][G][U][A] =  5.500;
+ int21_ar[G][U][U][U][U][U][A] =  2.700;
+ int21_ar[G][U][A][A][A][U][G] =  3.900;
+ int21_ar[G][U][A][A][C][U][G] =  3.700;
+ int21_ar[G][U][A][A][G][U][G] =  3.100;
+ int21_ar[G][U][A][A][U][U][G] =  5.500;
+ int21_ar[G][U][A][C][A][U][G] =  3.600;
+ int21_ar[G][U][A][C][C][U][G] =  3.200;
+ int21_ar[G][U][A][C][G][U][G] =  3.100;
+ int21_ar[G][U][A][C][U][U][G] =  5.500;
+ int21_ar[G][U][A][G][A][U][G] =  2.500;
+ int21_ar[G][U][A][G][C][U][G] =  2.100;
+ int21_ar[G][U][A][G][G][U][G] =  1.900;
+ int21_ar[G][U][A][G][U][U][G] =  5.500;
+ int21_ar[G][U][A][U][A][U][G] =  5.500;
+ int21_ar[G][U][A][U][C][U][G] =  5.500;
+ int21_ar[G][U][A][U][G][U][G] =  5.500;
+ int21_ar[G][U][A][U][U][U][G] =  5.500;
+ int21_ar[G][U][C][A][A][U][G] =  3.800;
+ int21_ar[G][U][C][A][C][U][G] =  3.700;
+ int21_ar[G][U][C][A][G][U][G] =  5.500;
+ int21_ar[G][U][C][A][U][U][G] =  3.700;
+ int21_ar[G][U][C][C][A][U][G] =  3.700;
+ int21_ar[G][U][C][C][C][U][G] =  4.000;
+ int21_ar[G][U][C][C][G][U][G] =  5.500;
+ int21_ar[G][U][C][C][U][U][G] =  3.700;
+ int21_ar[G][U][C][G][A][U][G] =  5.500;
+ int21_ar[G][U][C][G][C][U][G] =  5.500;
+ int21_ar[G][U][C][G][G][U][G] =  5.500;
+ int21_ar[G][U][C][G][U][U][G] =  5.500;
+ int21_ar[G][U][C][U][A][U][G] =  4.000;
+ int21_ar[G][U][C][U][C][U][G] =  3.400;
+ int21_ar[G][U][C][U][G][U][G] =  5.500;
+ int21_ar[G][U][C][U][U][U][G] =  3.700;
+ int21_ar[G][U][G][A][A][U][G] =  3.200;
+ int21_ar[G][U][G][A][C][U][G] =  5.500;
+ int21_ar[G][U][G][A][G][U][G] =  2.300;
+ int21_ar[G][U][G][A][U][U][G] =  5.500;
+ int21_ar[G][U][G][C][A][U][G] =  5.500;
+ int21_ar[G][U][G][C][C][U][G] =  5.500;
+ int21_ar[G][U][G][C][G][U][G] =  5.500;
+ int21_ar[G][U][G][C][U][U][G] =  5.500;
+ int21_ar[G][U][G][G][A][U][G] =  2.300;
+ int21_ar[G][U][G][G][C][U][G] =  5.500;
+ int21_ar[G][U][G][G][G][U][G] =  3.700;
+ int21_ar[G][U][G][G][U][U][G] =  5.500;
+ int21_ar[G][U][G][U][A][U][G] =  5.500;
+ int21_ar[G][U][G][U][C][U][G] =  5.500;
+ int21_ar[G][U][G][U][G][U][G] =  5.500;
+ int21_ar[G][U][G][U][U][U][G] =  5.500;
+ int21_ar[G][U][U][A][A][U][G] =  5.500;
+ int21_ar[G][U][U][A][C][U][G] =  5.500;
+ int21_ar[G][U][U][A][G][U][G] =  5.500;
+ int21_ar[G][U][U][A][U][U][G] =  5.500;
+ int21_ar[G][U][U][C][A][U][G] =  5.500;
+ int21_ar[G][U][U][C][C][U][G] =  3.700;
+ int21_ar[G][U][U][C][G][U][G] =  5.500;
+ int21_ar[G][U][U][C][U][U][G] =  2.800;
+ int21_ar[G][U][U][G][A][U][G] =  5.500;
+ int21_ar[G][U][U][G][C][U][G] =  5.500;
+ int21_ar[G][U][U][G][G][U][G] =  5.500;
+ int21_ar[G][U][U][G][U][U][G] =  5.500;
+ int21_ar[G][U][U][U][A][U][G] =  5.500;
+ int21_ar[G][U][U][U][C][U][G] =  3.200;
+ int21_ar[G][U][U][U][G][U][G] =  5.500;
+ int21_ar[G][U][U][U][U][U][G] =  2.700;
+ int21_ar[U][A][A][A][A][A][U] =  3.900;
+ int21_ar[U][A][A][A][C][A][U] =  3.700;
+ int21_ar[U][A][A][A][G][A][U] =  3.100;
+ int21_ar[U][A][A][A][U][A][U] =  5.500;
+ int21_ar[U][A][A][C][A][A][U] =  3.600;
+ int21_ar[U][A][A][C][C][A][U] =  3.200;
+ int21_ar[U][A][A][C][G][A][U] =  3.100;
+ int21_ar[U][A][A][C][U][A][U] =  5.500;
+ int21_ar[U][A][A][G][A][A][U] =  2.500;
+ int21_ar[U][A][A][G][C][A][U] =  2.100;
+ int21_ar[U][A][A][G][G][A][U] =  1.900;
+ int21_ar[U][A][A][G][U][A][U] =  5.500;
+ int21_ar[U][A][A][U][A][A][U] =  5.500;
+ int21_ar[U][A][A][U][C][A][U] =  5.500;
+ int21_ar[U][A][A][U][G][A][U] =  5.500;
+ int21_ar[U][A][A][U][U][A][U] =  5.500;
+ int21_ar[U][A][C][A][A][A][U] =  3.800;
+ int21_ar[U][A][C][A][C][A][U] =  3.700;
+ int21_ar[U][A][C][A][G][A][U] =  5.500;
+ int21_ar[U][A][C][A][U][A][U] =  3.700;
+ int21_ar[U][A][C][C][A][A][U] =  3.700;
+ int21_ar[U][A][C][C][C][A][U] =  4.000;
+ int21_ar[U][A][C][C][G][A][U] =  5.500;
+ int21_ar[U][A][C][C][U][A][U] =  3.700;
+ int21_ar[U][A][C][G][A][A][U] =  5.500;
+ int21_ar[U][A][C][G][C][A][U] =  5.500;
+ int21_ar[U][A][C][G][G][A][U] =  5.500;
+ int21_ar[U][A][C][G][U][A][U] =  5.500;
+ int21_ar[U][A][C][U][A][A][U] =  4.000;
+ int21_ar[U][A][C][U][C][A][U] =  3.400;
+ int21_ar[U][A][C][U][G][A][U] =  5.500;
+ int21_ar[U][A][C][U][U][A][U] =  3.700;
+ int21_ar[U][A][G][A][A][A][U] =  3.200;
+ int21_ar[U][A][G][A][C][A][U] =  5.500;
+ int21_ar[U][A][G][A][G][A][U] =  2.300;
+ int21_ar[U][A][G][A][U][A][U] =  5.500;
+ int21_ar[U][A][G][C][A][A][U] =  5.500;
+ int21_ar[U][A][G][C][C][A][U] =  5.500;
+ int21_ar[U][A][G][C][G][A][U] =  5.500;
+ int21_ar[U][A][G][C][U][A][U] =  5.500;
+ int21_ar[U][A][G][G][A][A][U] =  2.300;
+ int21_ar[U][A][G][G][C][A][U] =  5.500;
+ int21_ar[U][A][G][G][G][A][U] =  3.700;
+ int21_ar[U][A][G][G][U][A][U] =  5.500;
+ int21_ar[U][A][G][U][A][A][U] =  5.500;
+ int21_ar[U][A][G][U][C][A][U] =  5.500;
+ int21_ar[U][A][G][U][G][A][U] =  5.500;
+ int21_ar[U][A][G][U][U][A][U] =  5.500;
+ int21_ar[U][A][U][A][A][A][U] =  5.500;
+ int21_ar[U][A][U][A][C][A][U] =  5.500;
+ int21_ar[U][A][U][A][G][A][U] =  5.500;
+ int21_ar[U][A][U][A][U][A][U] =  5.500;
+ int21_ar[U][A][U][C][A][A][U] =  5.500;
+ int21_ar[U][A][U][C][C][A][U] =  3.700;
+ int21_ar[U][A][U][C][G][A][U] =  5.500;
+ int21_ar[U][A][U][C][U][A][U] =  2.800;
+ int21_ar[U][A][U][G][A][A][U] =  5.500;
+ int21_ar[U][A][U][G][C][A][U] =  5.500;
+ int21_ar[U][A][U][G][G][A][U] =  5.500;
+ int21_ar[U][A][U][G][U][A][U] =  5.500;
+ int21_ar[U][A][U][U][A][A][U] =  5.500;
+ int21_ar[U][A][U][U][C][A][U] =  3.200;
+ int21_ar[U][A][U][U][G][A][U] =  5.500;
+ int21_ar[U][A][U][U][U][A][U] =  2.700;
+ int21_ar[U][A][A][A][A][C][G] =  3.200;
+ int21_ar[U][A][A][A][C][C][G] =  3.000;
+ int21_ar[U][A][A][A][G][C][G] =  2.400;
+ int21_ar[U][A][A][A][U][C][G] =  4.800;
+ int21_ar[U][A][A][C][A][C][G] =  2.900;
+ int21_ar[U][A][A][C][C][C][G] =  2.500;
+ int21_ar[U][A][A][C][G][C][G] =  2.400;
+ int21_ar[U][A][A][C][U][C][G] =  4.800;
+ int21_ar[U][A][A][G][A][C][G] =  1.800;
+ int21_ar[U][A][A][G][C][C][G] =  1.400;
+ int21_ar[U][A][A][G][G][C][G] =  1.200;
+ int21_ar[U][A][A][G][U][C][G] =  4.800;
+ int21_ar[U][A][A][U][A][C][G] =  4.800;
+ int21_ar[U][A][A][U][C][C][G] =  4.800;
+ int21_ar[U][A][A][U][G][C][G] =  4.800;
+ int21_ar[U][A][A][U][U][C][G] =  4.800;
+ int21_ar[U][A][C][A][A][C][G] =  3.100;
+ int21_ar[U][A][C][A][C][C][G] =  3.000;
+ int21_ar[U][A][C][A][G][C][G] =  4.800;
+ int21_ar[U][A][C][A][U][C][G] =  3.000;
+ int21_ar[U][A][C][C][A][C][G] =  3.000;
+ int21_ar[U][A][C][C][C][C][G] =  3.300;
+ int21_ar[U][A][C][C][G][C][G] =  4.800;
+ int21_ar[U][A][C][C][U][C][G] =  3.000;
+ int21_ar[U][A][C][G][A][C][G] =  4.800;
+ int21_ar[U][A][C][G][C][C][G] =  4.800;
+ int21_ar[U][A][C][G][G][C][G] =  4.800;
+ int21_ar[U][A][C][G][U][C][G] =  4.800;
+ int21_ar[U][A][C][U][A][C][G] =  3.300;
+ int21_ar[U][A][C][U][C][C][G] =  2.700;
+ int21_ar[U][A][C][U][G][C][G] =  4.800;
+ int21_ar[U][A][C][U][U][C][G] =  3.000;
+ int21_ar[U][A][G][A][A][C][G] =  2.500;
+ int21_ar[U][A][G][A][C][C][G] =  4.800;
+ int21_ar[U][A][G][A][G][C][G] =  1.600;
+ int21_ar[U][A][G][A][U][C][G] =  4.800;
+ int21_ar[U][A][G][C][A][C][G] =  4.800;
+ int21_ar[U][A][G][C][C][C][G] =  4.800;
+ int21_ar[U][A][G][C][G][C][G] =  4.800;
+ int21_ar[U][A][G][C][U][C][G] =  4.800;
+ int21_ar[U][A][G][G][A][C][G] =  1.600;
+ int21_ar[U][A][G][G][C][C][G] =  4.800;
+ int21_ar[U][A][G][G][G][C][G] =  3.000;
+ int21_ar[U][A][G][G][U][C][G] =  4.800;
+ int21_ar[U][A][G][U][A][C][G] =  4.800;
+ int21_ar[U][A][G][U][C][C][G] =  4.800;
+ int21_ar[U][A][G][U][G][C][G] =  4.800;
+ int21_ar[U][A][G][U][U][C][G] =  4.800;
+ int21_ar[U][A][U][A][A][C][G] =  4.800;
+ int21_ar[U][A][U][A][C][C][G] =  4.800;
+ int21_ar[U][A][U][A][G][C][G] =  4.800;
+ int21_ar[U][A][U][A][U][C][G] =  4.800;
+ int21_ar[U][A][U][C][A][C][G] =  4.800;
+ int21_ar[U][A][U][C][C][C][G] =  3.000;
+ int21_ar[U][A][U][C][G][C][G] =  4.800;
+ int21_ar[U][A][U][C][U][C][G] =  2.100;
+ int21_ar[U][A][U][G][A][C][G] =  4.800;
+ int21_ar[U][A][U][G][C][C][G] =  4.800;
+ int21_ar[U][A][U][G][G][C][G] =  4.800;
+ int21_ar[U][A][U][G][U][C][G] =  4.800;
+ int21_ar[U][A][U][U][A][C][G] =  4.800;
+ int21_ar[U][A][U][U][C][C][G] =  2.500;
+ int21_ar[U][A][U][U][G][C][G] =  4.800;
+ int21_ar[U][A][U][U][U][C][G] =  2.000;
+ int21_ar[U][A][A][A][A][G][C] =  3.200;
+ int21_ar[U][A][A][A][C][G][C] =  3.000;
+ int21_ar[U][A][A][A][G][G][C] =  2.400;
+ int21_ar[U][A][A][A][U][G][C] =  4.800;
+ int21_ar[U][A][A][C][A][G][C] =  2.900;
+ int21_ar[U][A][A][C][C][G][C] =  2.500;
+ int21_ar[U][A][A][C][G][G][C] =  2.400;
+ int21_ar[U][A][A][C][U][G][C] =  4.800;
+ int21_ar[U][A][A][G][A][G][C] =  1.800;
+ int21_ar[U][A][A][G][C][G][C] =  1.400;
+ int21_ar[U][A][A][G][G][G][C] =  1.200;
+ int21_ar[U][A][A][G][U][G][C] =  4.800;
+ int21_ar[U][A][A][U][A][G][C] =  4.800;
+ int21_ar[U][A][A][U][C][G][C] =  4.800;
+ int21_ar[U][A][A][U][G][G][C] =  4.800;
+ int21_ar[U][A][A][U][U][G][C] =  4.800;
+ int21_ar[U][A][C][A][A][G][C] =  3.100;
+ int21_ar[U][A][C][A][C][G][C] =  3.000;
+ int21_ar[U][A][C][A][G][G][C] =  4.800;
+ int21_ar[U][A][C][A][U][G][C] =  3.000;
+ int21_ar[U][A][C][C][A][G][C] =  3.000;
+ int21_ar[U][A][C][C][C][G][C] =  3.300;
+ int21_ar[U][A][C][C][G][G][C] =  4.800;
+ int21_ar[U][A][C][C][U][G][C] =  3.000;
+ int21_ar[U][A][C][G][A][G][C] =  4.800;
+ int21_ar[U][A][C][G][C][G][C] =  4.800;
+ int21_ar[U][A][C][G][G][G][C] =  4.800;
+ int21_ar[U][A][C][G][U][G][C] =  4.800;
+ int21_ar[U][A][C][U][A][G][C] =  3.300;
+ int21_ar[U][A][C][U][C][G][C] =  2.700;
+ int21_ar[U][A][C][U][G][G][C] =  4.800;
+ int21_ar[U][A][C][U][U][G][C] =  3.000;
+ int21_ar[U][A][G][A][A][G][C] =  2.500;
+ int21_ar[U][A][G][A][C][G][C] =  4.800;
+ int21_ar[U][A][G][A][G][G][C] =  1.600;
+ int21_ar[U][A][G][A][U][G][C] =  4.800;
+ int21_ar[U][A][G][C][A][G][C] =  4.800;
+ int21_ar[U][A][G][C][C][G][C] =  4.800;
+ int21_ar[U][A][G][C][G][G][C] =  4.800;
+ int21_ar[U][A][G][C][U][G][C] =  4.800;
+ int21_ar[U][A][G][G][A][G][C] =  1.600;
+ int21_ar[U][A][G][G][C][G][C] =  4.800;
+ int21_ar[U][A][G][G][G][G][C] =  3.000;
+ int21_ar[U][A][G][G][U][G][C] =  4.800;
+ int21_ar[U][A][G][U][A][G][C] =  4.800;
+ int21_ar[U][A][G][U][C][G][C] =  4.800;
+ int21_ar[U][A][G][U][G][G][C] =  4.800;
+ int21_ar[U][A][G][U][U][G][C] =  4.800;
+ int21_ar[U][A][U][A][A][G][C] =  4.800;
+ int21_ar[U][A][U][A][C][G][C] =  4.800;
+ int21_ar[U][A][U][A][G][G][C] =  4.800;
+ int21_ar[U][A][U][A][U][G][C] =  4.800;
+ int21_ar[U][A][U][C][A][G][C] =  4.800;
+ int21_ar[U][A][U][C][C][G][C] =  3.000;
+ int21_ar[U][A][U][C][G][G][C] =  4.800;
+ int21_ar[U][A][U][C][U][G][C] =  2.100;
+ int21_ar[U][A][U][G][A][G][C] =  4.800;
+ int21_ar[U][A][U][G][C][G][C] =  4.800;
+ int21_ar[U][A][U][G][G][G][C] =  4.800;
+ int21_ar[U][A][U][G][U][G][C] =  4.800;
+ int21_ar[U][A][U][U][A][G][C] =  4.800;
+ int21_ar[U][A][U][U][C][G][C] =  2.500;
+ int21_ar[U][A][U][U][G][G][C] =  4.800;
+ int21_ar[U][A][U][U][U][G][C] =  2.000;
+ int21_ar[U][A][A][A][A][G][U] =  3.900;
+ int21_ar[U][A][A][A][C][G][U] =  3.700;
+ int21_ar[U][A][A][A][G][G][U] =  3.100;
+ int21_ar[U][A][A][A][U][G][U] =  5.500;
+ int21_ar[U][A][A][C][A][G][U] =  3.600;
+ int21_ar[U][A][A][C][C][G][U] =  3.200;
+ int21_ar[U][A][A][C][G][G][U] =  3.100;
+ int21_ar[U][A][A][C][U][G][U] =  5.500;
+ int21_ar[U][A][A][G][A][G][U] =  2.500;
+ int21_ar[U][A][A][G][C][G][U] =  2.100;
+ int21_ar[U][A][A][G][G][G][U] =  1.900;
+ int21_ar[U][A][A][G][U][G][U] =  5.500;
+ int21_ar[U][A][A][U][A][G][U] =  5.500;
+ int21_ar[U][A][A][U][C][G][U] =  5.500;
+ int21_ar[U][A][A][U][G][G][U] =  5.500;
+ int21_ar[U][A][A][U][U][G][U] =  5.500;
+ int21_ar[U][A][C][A][A][G][U] =  3.800;
+ int21_ar[U][A][C][A][C][G][U] =  3.700;
+ int21_ar[U][A][C][A][G][G][U] =  5.500;
+ int21_ar[U][A][C][A][U][G][U] =  3.700;
+ int21_ar[U][A][C][C][A][G][U] =  3.700;
+ int21_ar[U][A][C][C][C][G][U] =  4.000;
+ int21_ar[U][A][C][C][G][G][U] =  5.500;
+ int21_ar[U][A][C][C][U][G][U] =  3.700;
+ int21_ar[U][A][C][G][A][G][U] =  5.500;
+ int21_ar[U][A][C][G][C][G][U] =  5.500;
+ int21_ar[U][A][C][G][G][G][U] =  5.500;
+ int21_ar[U][A][C][G][U][G][U] =  5.500;
+ int21_ar[U][A][C][U][A][G][U] =  4.000;
+ int21_ar[U][A][C][U][C][G][U] =  3.400;
+ int21_ar[U][A][C][U][G][G][U] =  5.500;
+ int21_ar[U][A][C][U][U][G][U] =  3.700;
+ int21_ar[U][A][G][A][A][G][U] =  3.200;
+ int21_ar[U][A][G][A][C][G][U] =  5.500;
+ int21_ar[U][A][G][A][G][G][U] =  2.300;
+ int21_ar[U][A][G][A][U][G][U] =  5.500;
+ int21_ar[U][A][G][C][A][G][U] =  5.500;
+ int21_ar[U][A][G][C][C][G][U] =  5.500;
+ int21_ar[U][A][G][C][G][G][U] =  5.500;
+ int21_ar[U][A][G][C][U][G][U] =  5.500;
+ int21_ar[U][A][G][G][A][G][U] =  2.300;
+ int21_ar[U][A][G][G][C][G][U] =  5.500;
+ int21_ar[U][A][G][G][G][G][U] =  3.700;
+ int21_ar[U][A][G][G][U][G][U] =  5.500;
+ int21_ar[U][A][G][U][A][G][U] =  5.500;
+ int21_ar[U][A][G][U][C][G][U] =  5.500;
+ int21_ar[U][A][G][U][G][G][U] =  5.500;
+ int21_ar[U][A][G][U][U][G][U] =  5.500;
+ int21_ar[U][A][U][A][A][G][U] =  5.500;
+ int21_ar[U][A][U][A][C][G][U] =  5.500;
+ int21_ar[U][A][U][A][G][G][U] =  5.500;
+ int21_ar[U][A][U][A][U][G][U] =  5.500;
+ int21_ar[U][A][U][C][A][G][U] =  5.500;
+ int21_ar[U][A][U][C][C][G][U] =  3.700;
+ int21_ar[U][A][U][C][G][G][U] =  5.500;
+ int21_ar[U][A][U][C][U][G][U] =  2.800;
+ int21_ar[U][A][U][G][A][G][U] =  5.500;
+ int21_ar[U][A][U][G][C][G][U] =  5.500;
+ int21_ar[U][A][U][G][G][G][U] =  5.500;
+ int21_ar[U][A][U][G][U][G][U] =  5.500;
+ int21_ar[U][A][U][U][A][G][U] =  5.500;
+ int21_ar[U][A][U][U][C][G][U] =  3.200;
+ int21_ar[U][A][U][U][G][G][U] =  5.500;
+ int21_ar[U][A][U][U][U][G][U] =  2.700;
+ int21_ar[U][A][A][A][A][U][A] =  3.900;
+ int21_ar[U][A][A][A][C][U][A] =  3.700;
+ int21_ar[U][A][A][A][G][U][A] =  3.100;
+ int21_ar[U][A][A][A][U][U][A] =  5.500;
+ int21_ar[U][A][A][C][A][U][A] =  3.600;
+ int21_ar[U][A][A][C][C][U][A] =  3.200;
+ int21_ar[U][A][A][C][G][U][A] =  3.100;
+ int21_ar[U][A][A][C][U][U][A] =  5.500;
+ int21_ar[U][A][A][G][A][U][A] =  2.500;
+ int21_ar[U][A][A][G][C][U][A] =  2.100;
+ int21_ar[U][A][A][G][G][U][A] =  1.900;
+ int21_ar[U][A][A][G][U][U][A] =  5.500;
+ int21_ar[U][A][A][U][A][U][A] =  5.500;
+ int21_ar[U][A][A][U][C][U][A] =  5.500;
+ int21_ar[U][A][A][U][G][U][A] =  5.500;
+ int21_ar[U][A][A][U][U][U][A] =  5.500;
+ int21_ar[U][A][C][A][A][U][A] =  3.800;
+ int21_ar[U][A][C][A][C][U][A] =  3.700;
+ int21_ar[U][A][C][A][G][U][A] =  5.500;
+ int21_ar[U][A][C][A][U][U][A] =  3.700;
+ int21_ar[U][A][C][C][A][U][A] =  3.700;
+ int21_ar[U][A][C][C][C][U][A] =  4.000;
+ int21_ar[U][A][C][C][G][U][A] =  5.500;
+ int21_ar[U][A][C][C][U][U][A] =  3.700;
+ int21_ar[U][A][C][G][A][U][A] =  5.500;
+ int21_ar[U][A][C][G][C][U][A] =  5.500;
+ int21_ar[U][A][C][G][G][U][A] =  5.500;
+ int21_ar[U][A][C][G][U][U][A] =  5.500;
+ int21_ar[U][A][C][U][A][U][A] =  4.000;
+ int21_ar[U][A][C][U][C][U][A] =  3.400;
+ int21_ar[U][A][C][U][G][U][A] =  5.500;
+ int21_ar[U][A][C][U][U][U][A] =  3.700;
+ int21_ar[U][A][G][A][A][U][A] =  3.200;
+ int21_ar[U][A][G][A][C][U][A] =  5.500;
+ int21_ar[U][A][G][A][G][U][A] =  2.300;
+ int21_ar[U][A][G][A][U][U][A] =  5.500;
+ int21_ar[U][A][G][C][A][U][A] =  5.500;
+ int21_ar[U][A][G][C][C][U][A] =  5.500;
+ int21_ar[U][A][G][C][G][U][A] =  5.500;
+ int21_ar[U][A][G][C][U][U][A] =  5.500;
+ int21_ar[U][A][G][G][A][U][A] =  2.300;
+ int21_ar[U][A][G][G][C][U][A] =  5.500;
+ int21_ar[U][A][G][G][G][U][A] =  3.700;
+ int21_ar[U][A][G][G][U][U][A] =  5.500;
+ int21_ar[U][A][G][U][A][U][A] =  5.500;
+ int21_ar[U][A][G][U][C][U][A] =  5.500;
+ int21_ar[U][A][G][U][G][U][A] =  5.500;
+ int21_ar[U][A][G][U][U][U][A] =  5.500;
+ int21_ar[U][A][U][A][A][U][A] =  5.500;
+ int21_ar[U][A][U][A][C][U][A] =  5.500;
+ int21_ar[U][A][U][A][G][U][A] =  5.500;
+ int21_ar[U][A][U][A][U][U][A] =  5.500;
+ int21_ar[U][A][U][C][A][U][A] =  5.500;
+ int21_ar[U][A][U][C][C][U][A] =  3.700;
+ int21_ar[U][A][U][C][G][U][A] =  5.500;
+ int21_ar[U][A][U][C][U][U][A] =  2.800;
+ int21_ar[U][A][U][G][A][U][A] =  5.500;
+ int21_ar[U][A][U][G][C][U][A] =  5.500;
+ int21_ar[U][A][U][G][G][U][A] =  5.500;
+ int21_ar[U][A][U][G][U][U][A] =  5.500;
+ int21_ar[U][A][U][U][A][U][A] =  5.500;
+ int21_ar[U][A][U][U][C][U][A] =  3.200;
+ int21_ar[U][A][U][U][G][U][A] =  5.500;
+ int21_ar[U][A][U][U][U][U][A] =  2.700;
+ int21_ar[U][A][A][A][A][U][G] =  3.900;
+ int21_ar[U][A][A][A][C][U][G] =  3.700;
+ int21_ar[U][A][A][A][G][U][G] =  3.100;
+ int21_ar[U][A][A][A][U][U][G] =  5.500;
+ int21_ar[U][A][A][C][A][U][G] =  3.600;
+ int21_ar[U][A][A][C][C][U][G] =  3.200;
+ int21_ar[U][A][A][C][G][U][G] =  3.100;
+ int21_ar[U][A][A][C][U][U][G] =  5.500;
+ int21_ar[U][A][A][G][A][U][G] =  2.500;
+ int21_ar[U][A][A][G][C][U][G] =  2.100;
+ int21_ar[U][A][A][G][G][U][G] =  1.900;
+ int21_ar[U][A][A][G][U][U][G] =  5.500;
+ int21_ar[U][A][A][U][A][U][G] =  5.500;
+ int21_ar[U][A][A][U][C][U][G] =  5.500;
+ int21_ar[U][A][A][U][G][U][G] =  5.500;
+ int21_ar[U][A][A][U][U][U][G] =  5.500;
+ int21_ar[U][A][C][A][A][U][G] =  3.800;
+ int21_ar[U][A][C][A][C][U][G] =  3.700;
+ int21_ar[U][A][C][A][G][U][G] =  5.500;
+ int21_ar[U][A][C][A][U][U][G] =  3.700;
+ int21_ar[U][A][C][C][A][U][G] =  3.700;
+ int21_ar[U][A][C][C][C][U][G] =  4.000;
+ int21_ar[U][A][C][C][G][U][G] =  5.500;
+ int21_ar[U][A][C][C][U][U][G] =  3.700;
+ int21_ar[U][A][C][G][A][U][G] =  5.500;
+ int21_ar[U][A][C][G][C][U][G] =  5.500;
+ int21_ar[U][A][C][G][G][U][G] =  5.500;
+ int21_ar[U][A][C][G][U][U][G] =  5.500;
+ int21_ar[U][A][C][U][A][U][G] =  4.000;
+ int21_ar[U][A][C][U][C][U][G] =  3.400;
+ int21_ar[U][A][C][U][G][U][G] =  5.500;
+ int21_ar[U][A][C][U][U][U][G] =  3.700;
+ int21_ar[U][A][G][A][A][U][G] =  3.200;
+ int21_ar[U][A][G][A][C][U][G] =  5.500;
+ int21_ar[U][A][G][A][G][U][G] =  2.300;
+ int21_ar[U][A][G][A][U][U][G] =  5.500;
+ int21_ar[U][A][G][C][A][U][G] =  5.500;
+ int21_ar[U][A][G][C][C][U][G] =  5.500;
+ int21_ar[U][A][G][C][G][U][G] =  5.500;
+ int21_ar[U][A][G][C][U][U][G] =  5.500;
+ int21_ar[U][A][G][G][A][U][G] =  2.300;
+ int21_ar[U][A][G][G][C][U][G] =  5.500;
+ int21_ar[U][A][G][G][G][U][G] =  3.700;
+ int21_ar[U][A][G][G][U][U][G] =  5.500;
+ int21_ar[U][A][G][U][A][U][G] =  5.500;
+ int21_ar[U][A][G][U][C][U][G] =  5.500;
+ int21_ar[U][A][G][U][G][U][G] =  5.500;
+ int21_ar[U][A][G][U][U][U][G] =  5.500;
+ int21_ar[U][A][U][A][A][U][G] =  5.500;
+ int21_ar[U][A][U][A][C][U][G] =  5.500;
+ int21_ar[U][A][U][A][G][U][G] =  5.500;
+ int21_ar[U][A][U][A][U][U][G] =  5.500;
+ int21_ar[U][A][U][C][A][U][G] =  5.500;
+ int21_ar[U][A][U][C][C][U][G] =  3.700;
+ int21_ar[U][A][U][C][G][U][G] =  5.500;
+ int21_ar[U][A][U][C][U][U][G] =  2.800;
+ int21_ar[U][A][U][G][A][U][G] =  5.500;
+ int21_ar[U][A][U][G][C][U][G] =  5.500;
+ int21_ar[U][A][U][G][G][U][G] =  5.500;
+ int21_ar[U][A][U][G][U][U][G] =  5.500;
+ int21_ar[U][A][U][U][A][U][G] =  5.500;
+ int21_ar[U][A][U][U][C][U][G] =  3.200;
+ int21_ar[U][A][U][U][G][U][G] =  5.500;
+ int21_ar[U][A][U][U][U][U][G] =  2.700;
+ int21_ar[U][G][A][A][A][A][U] =  3.900;
+ int21_ar[U][G][A][A][C][A][U] =  3.700;
+ int21_ar[U][G][A][A][G][A][U] =  3.100;
+ int21_ar[U][G][A][A][U][A][U] =  5.500;
+ int21_ar[U][G][A][C][A][A][U] =  3.600;
+ int21_ar[U][G][A][C][C][A][U] =  3.200;
+ int21_ar[U][G][A][C][G][A][U] =  3.100;
+ int21_ar[U][G][A][C][U][A][U] =  5.500;
+ int21_ar[U][G][A][G][A][A][U] =  2.500;
+ int21_ar[U][G][A][G][C][A][U] =  2.100;
+ int21_ar[U][G][A][G][G][A][U] =  1.900;
+ int21_ar[U][G][A][G][U][A][U] =  5.500;
+ int21_ar[U][G][A][U][A][A][U] =  5.500;
+ int21_ar[U][G][A][U][C][A][U] =  5.500;
+ int21_ar[U][G][A][U][G][A][U] =  5.500;
+ int21_ar[U][G][A][U][U][A][U] =  5.500;
+ int21_ar[U][G][C][A][A][A][U] =  3.800;
+ int21_ar[U][G][C][A][C][A][U] =  3.700;
+ int21_ar[U][G][C][A][G][A][U] =  5.500;
+ int21_ar[U][G][C][A][U][A][U] =  3.700;
+ int21_ar[U][G][C][C][A][A][U] =  3.700;
+ int21_ar[U][G][C][C][C][A][U] =  4.000;
+ int21_ar[U][G][C][C][G][A][U] =  5.500;
+ int21_ar[U][G][C][C][U][A][U] =  3.700;
+ int21_ar[U][G][C][G][A][A][U] =  5.500;
+ int21_ar[U][G][C][G][C][A][U] =  5.500;
+ int21_ar[U][G][C][G][G][A][U] =  5.500;
+ int21_ar[U][G][C][G][U][A][U] =  5.500;
+ int21_ar[U][G][C][U][A][A][U] =  4.000;
+ int21_ar[U][G][C][U][C][A][U] =  3.400;
+ int21_ar[U][G][C][U][G][A][U] =  5.500;
+ int21_ar[U][G][C][U][U][A][U] =  3.700;
+ int21_ar[U][G][G][A][A][A][U] =  3.200;
+ int21_ar[U][G][G][A][C][A][U] =  5.500;
+ int21_ar[U][G][G][A][G][A][U] =  2.300;
+ int21_ar[U][G][G][A][U][A][U] =  5.500;
+ int21_ar[U][G][G][C][A][A][U] =  5.500;
+ int21_ar[U][G][G][C][C][A][U] =  5.500;
+ int21_ar[U][G][G][C][G][A][U] =  5.500;
+ int21_ar[U][G][G][C][U][A][U] =  5.500;
+ int21_ar[U][G][G][G][A][A][U] =  2.300;
+ int21_ar[U][G][G][G][C][A][U] =  5.500;
+ int21_ar[U][G][G][G][G][A][U] =  3.700;
+ int21_ar[U][G][G][G][U][A][U] =  5.500;
+ int21_ar[U][G][G][U][A][A][U] =  5.500;
+ int21_ar[U][G][G][U][C][A][U] =  5.500;
+ int21_ar[U][G][G][U][G][A][U] =  5.500;
+ int21_ar[U][G][G][U][U][A][U] =  5.500;
+ int21_ar[U][G][U][A][A][A][U] =  5.500;
+ int21_ar[U][G][U][A][C][A][U] =  5.500;
+ int21_ar[U][G][U][A][G][A][U] =  5.500;
+ int21_ar[U][G][U][A][U][A][U] =  5.500;
+ int21_ar[U][G][U][C][A][A][U] =  5.500;
+ int21_ar[U][G][U][C][C][A][U] =  3.700;
+ int21_ar[U][G][U][C][G][A][U] =  5.500;
+ int21_ar[U][G][U][C][U][A][U] =  2.800;
+ int21_ar[U][G][U][G][A][A][U] =  5.500;
+ int21_ar[U][G][U][G][C][A][U] =  5.500;
+ int21_ar[U][G][U][G][G][A][U] =  5.500;
+ int21_ar[U][G][U][G][U][A][U] =  5.500;
+ int21_ar[U][G][U][U][A][A][U] =  5.500;
+ int21_ar[U][G][U][U][C][A][U] =  3.200;
+ int21_ar[U][G][U][U][G][A][U] =  5.500;
+ int21_ar[U][G][U][U][U][A][U] =  2.700;
+ int21_ar[U][G][A][A][A][C][G] =  3.200;
+ int21_ar[U][G][A][A][C][C][G] =  3.000;
+ int21_ar[U][G][A][A][G][C][G] =  2.400;
+ int21_ar[U][G][A][A][U][C][G] =  4.800;
+ int21_ar[U][G][A][C][A][C][G] =  2.900;
+ int21_ar[U][G][A][C][C][C][G] =  2.500;
+ int21_ar[U][G][A][C][G][C][G] =  2.400;
+ int21_ar[U][G][A][C][U][C][G] =  4.800;
+ int21_ar[U][G][A][G][A][C][G] =  1.800;
+ int21_ar[U][G][A][G][C][C][G] =  1.400;
+ int21_ar[U][G][A][G][G][C][G] =  1.200;
+ int21_ar[U][G][A][G][U][C][G] =  4.800;
+ int21_ar[U][G][A][U][A][C][G] =  4.800;
+ int21_ar[U][G][A][U][C][C][G] =  4.800;
+ int21_ar[U][G][A][U][G][C][G] =  4.800;
+ int21_ar[U][G][A][U][U][C][G] =  4.800;
+ int21_ar[U][G][C][A][A][C][G] =  3.100;
+ int21_ar[U][G][C][A][C][C][G] =  3.000;
+ int21_ar[U][G][C][A][G][C][G] =  4.800;
+ int21_ar[U][G][C][A][U][C][G] =  3.000;
+ int21_ar[U][G][C][C][A][C][G] =  3.000;
+ int21_ar[U][G][C][C][C][C][G] =  3.300;
+ int21_ar[U][G][C][C][G][C][G] =  4.800;
+ int21_ar[U][G][C][C][U][C][G] =  3.000;
+ int21_ar[U][G][C][G][A][C][G] =  4.800;
+ int21_ar[U][G][C][G][C][C][G] =  4.800;
+ int21_ar[U][G][C][G][G][C][G] =  4.800;
+ int21_ar[U][G][C][G][U][C][G] =  4.800;
+ int21_ar[U][G][C][U][A][C][G] =  3.300;
+ int21_ar[U][G][C][U][C][C][G] =  2.700;
+ int21_ar[U][G][C][U][G][C][G] =  4.800;
+ int21_ar[U][G][C][U][U][C][G] =  3.000;
+ int21_ar[U][G][G][A][A][C][G] =  2.500;
+ int21_ar[U][G][G][A][C][C][G] =  4.800;
+ int21_ar[U][G][G][A][G][C][G] =  1.600;
+ int21_ar[U][G][G][A][U][C][G] =  4.800;
+ int21_ar[U][G][G][C][A][C][G] =  4.800;
+ int21_ar[U][G][G][C][C][C][G] =  4.800;
+ int21_ar[U][G][G][C][G][C][G] =  4.800;
+ int21_ar[U][G][G][C][U][C][G] =  4.800;
+ int21_ar[U][G][G][G][A][C][G] =  1.600;
+ int21_ar[U][G][G][G][C][C][G] =  4.800;
+ int21_ar[U][G][G][G][G][C][G] =  3.000;
+ int21_ar[U][G][G][G][U][C][G] =  4.800;
+ int21_ar[U][G][G][U][A][C][G] =  4.800;
+ int21_ar[U][G][G][U][C][C][G] =  4.800;
+ int21_ar[U][G][G][U][G][C][G] =  4.800;
+ int21_ar[U][G][G][U][U][C][G] =  4.800;
+ int21_ar[U][G][U][A][A][C][G] =  4.800;
+ int21_ar[U][G][U][A][C][C][G] =  4.800;
+ int21_ar[U][G][U][A][G][C][G] =  4.800;
+ int21_ar[U][G][U][A][U][C][G] =  4.800;
+ int21_ar[U][G][U][C][A][C][G] =  4.800;
+ int21_ar[U][G][U][C][C][C][G] =  3.000;
+ int21_ar[U][G][U][C][G][C][G] =  4.800;
+ int21_ar[U][G][U][C][U][C][G] =  2.100;
+ int21_ar[U][G][U][G][A][C][G] =  4.800;
+ int21_ar[U][G][U][G][C][C][G] =  4.800;
+ int21_ar[U][G][U][G][G][C][G] =  4.800;
+ int21_ar[U][G][U][G][U][C][G] =  4.800;
+ int21_ar[U][G][U][U][A][C][G] =  4.800;
+ int21_ar[U][G][U][U][C][C][G] =  2.500;
+ int21_ar[U][G][U][U][G][C][G] =  4.800;
+ int21_ar[U][G][U][U][U][C][G] =  2.000;
+ int21_ar[U][G][A][A][A][G][C] =  3.200;
+ int21_ar[U][G][A][A][C][G][C] =  3.000;
+ int21_ar[U][G][A][A][G][G][C] =  2.400;
+ int21_ar[U][G][A][A][U][G][C] =  4.800;
+ int21_ar[U][G][A][C][A][G][C] =  2.900;
+ int21_ar[U][G][A][C][C][G][C] =  2.500;
+ int21_ar[U][G][A][C][G][G][C] =  2.400;
+ int21_ar[U][G][A][C][U][G][C] =  4.800;
+ int21_ar[U][G][A][G][A][G][C] =  1.800;
+ int21_ar[U][G][A][G][C][G][C] =  1.400;
+ int21_ar[U][G][A][G][G][G][C] =  1.200;
+ int21_ar[U][G][A][G][U][G][C] =  4.800;
+ int21_ar[U][G][A][U][A][G][C] =  4.800;
+ int21_ar[U][G][A][U][C][G][C] =  4.800;
+ int21_ar[U][G][A][U][G][G][C] =  4.800;
+ int21_ar[U][G][A][U][U][G][C] =  4.800;
+ int21_ar[U][G][C][A][A][G][C] =  3.100;
+ int21_ar[U][G][C][A][C][G][C] =  3.000;
+ int21_ar[U][G][C][A][G][G][C] =  4.800;
+ int21_ar[U][G][C][A][U][G][C] =  3.000;
+ int21_ar[U][G][C][C][A][G][C] =  3.000;
+ int21_ar[U][G][C][C][C][G][C] =  3.300;
+ int21_ar[U][G][C][C][G][G][C] =  4.800;
+ int21_ar[U][G][C][C][U][G][C] =  3.000;
+ int21_ar[U][G][C][G][A][G][C] =  4.800;
+ int21_ar[U][G][C][G][C][G][C] =  4.800;
+ int21_ar[U][G][C][G][G][G][C] =  4.800;
+ int21_ar[U][G][C][G][U][G][C] =  4.800;
+ int21_ar[U][G][C][U][A][G][C] =  3.300;
+ int21_ar[U][G][C][U][C][G][C] =  2.700;
+ int21_ar[U][G][C][U][G][G][C] =  4.800;
+ int21_ar[U][G][C][U][U][G][C] =  3.000;
+ int21_ar[U][G][G][A][A][G][C] =  2.500;
+ int21_ar[U][G][G][A][C][G][C] =  4.800;
+ int21_ar[U][G][G][A][G][G][C] =  1.600;
+ int21_ar[U][G][G][A][U][G][C] =  4.800;
+ int21_ar[U][G][G][C][A][G][C] =  4.800;
+ int21_ar[U][G][G][C][C][G][C] =  4.800;
+ int21_ar[U][G][G][C][G][G][C] =  4.800;
+ int21_ar[U][G][G][C][U][G][C] =  4.800;
+ int21_ar[U][G][G][G][A][G][C] =  1.600;
+ int21_ar[U][G][G][G][C][G][C] =  4.800;
+ int21_ar[U][G][G][G][G][G][C] =  3.000;
+ int21_ar[U][G][G][G][U][G][C] =  4.800;
+ int21_ar[U][G][G][U][A][G][C] =  4.800;
+ int21_ar[U][G][G][U][C][G][C] =  4.800;
+ int21_ar[U][G][G][U][G][G][C] =  4.800;
+ int21_ar[U][G][G][U][U][G][C] =  4.800;
+ int21_ar[U][G][U][A][A][G][C] =  4.800;
+ int21_ar[U][G][U][A][C][G][C] =  4.800;
+ int21_ar[U][G][U][A][G][G][C] =  4.800;
+ int21_ar[U][G][U][A][U][G][C] =  4.800;
+ int21_ar[U][G][U][C][A][G][C] =  4.800;
+ int21_ar[U][G][U][C][C][G][C] =  3.000;
+ int21_ar[U][G][U][C][G][G][C] =  4.800;
+ int21_ar[U][G][U][C][U][G][C] =  2.100;
+ int21_ar[U][G][U][G][A][G][C] =  4.800;
+ int21_ar[U][G][U][G][C][G][C] =  4.800;
+ int21_ar[U][G][U][G][G][G][C] =  4.800;
+ int21_ar[U][G][U][G][U][G][C] =  4.800;
+ int21_ar[U][G][U][U][A][G][C] =  4.800;
+ int21_ar[U][G][U][U][C][G][C] =  2.500;
+ int21_ar[U][G][U][U][G][G][C] =  4.800;
+ int21_ar[U][G][U][U][U][G][C] =  2.000;
+ int21_ar[U][G][A][A][A][G][U] =  3.900;
+ int21_ar[U][G][A][A][C][G][U] =  3.700;
+ int21_ar[U][G][A][A][G][G][U] =  3.100;
+ int21_ar[U][G][A][A][U][G][U] =  5.500;
+ int21_ar[U][G][A][C][A][G][U] =  3.600;
+ int21_ar[U][G][A][C][C][G][U] =  3.200;
+ int21_ar[U][G][A][C][G][G][U] =  3.100;
+ int21_ar[U][G][A][C][U][G][U] =  5.500;
+ int21_ar[U][G][A][G][A][G][U] =  2.500;
+ int21_ar[U][G][A][G][C][G][U] =  2.100;
+ int21_ar[U][G][A][G][G][G][U] =  1.900;
+ int21_ar[U][G][A][G][U][G][U] =  5.500;
+ int21_ar[U][G][A][U][A][G][U] =  5.500;
+ int21_ar[U][G][A][U][C][G][U] =  5.500;
+ int21_ar[U][G][A][U][G][G][U] =  5.500;
+ int21_ar[U][G][A][U][U][G][U] =  5.500;
+ int21_ar[U][G][C][A][A][G][U] =  3.800;
+ int21_ar[U][G][C][A][C][G][U] =  3.700;
+ int21_ar[U][G][C][A][G][G][U] =  5.500;
+ int21_ar[U][G][C][A][U][G][U] =  3.700;
+ int21_ar[U][G][C][C][A][G][U] =  3.700;
+ int21_ar[U][G][C][C][C][G][U] =  4.000;
+ int21_ar[U][G][C][C][G][G][U] =  5.500;
+ int21_ar[U][G][C][C][U][G][U] =  3.700;
+ int21_ar[U][G][C][G][A][G][U] =  5.500;
+ int21_ar[U][G][C][G][C][G][U] =  5.500;
+ int21_ar[U][G][C][G][G][G][U] =  5.500;
+ int21_ar[U][G][C][G][U][G][U] =  5.500;
+ int21_ar[U][G][C][U][A][G][U] =  4.000;
+ int21_ar[U][G][C][U][C][G][U] =  3.400;
+ int21_ar[U][G][C][U][G][G][U] =  5.500;
+ int21_ar[U][G][C][U][U][G][U] =  3.700;
+ int21_ar[U][G][G][A][A][G][U] =  3.200;
+ int21_ar[U][G][G][A][C][G][U] =  5.500;
+ int21_ar[U][G][G][A][G][G][U] =  2.300;
+ int21_ar[U][G][G][A][U][G][U] =  5.500;
+ int21_ar[U][G][G][C][A][G][U] =  5.500;
+ int21_ar[U][G][G][C][C][G][U] =  5.500;
+ int21_ar[U][G][G][C][G][G][U] =  5.500;
+ int21_ar[U][G][G][C][U][G][U] =  5.500;
+ int21_ar[U][G][G][G][A][G][U] =  2.300;
+ int21_ar[U][G][G][G][C][G][U] =  5.500;
+ int21_ar[U][G][G][G][G][G][U] =  3.700;
+ int21_ar[U][G][G][G][U][G][U] =  5.500;
+ int21_ar[U][G][G][U][A][G][U] =  5.500;
+ int21_ar[U][G][G][U][C][G][U] =  5.500;
+ int21_ar[U][G][G][U][G][G][U] =  5.500;
+ int21_ar[U][G][G][U][U][G][U] =  5.500;
+ int21_ar[U][G][U][A][A][G][U] =  5.500;
+ int21_ar[U][G][U][A][C][G][U] =  5.500;
+ int21_ar[U][G][U][A][G][G][U] =  5.500;
+ int21_ar[U][G][U][A][U][G][U] =  5.500;
+ int21_ar[U][G][U][C][A][G][U] =  5.500;
+ int21_ar[U][G][U][C][C][G][U] =  3.700;
+ int21_ar[U][G][U][C][G][G][U] =  5.500;
+ int21_ar[U][G][U][C][U][G][U] =  2.800;
+ int21_ar[U][G][U][G][A][G][U] =  5.500;
+ int21_ar[U][G][U][G][C][G][U] =  5.500;
+ int21_ar[U][G][U][G][G][G][U] =  5.500;
+ int21_ar[U][G][U][G][U][G][U] =  5.500;
+ int21_ar[U][G][U][U][A][G][U] =  5.500;
+ int21_ar[U][G][U][U][C][G][U] =  3.200;
+ int21_ar[U][G][U][U][G][G][U] =  5.500;
+ int21_ar[U][G][U][U][U][G][U] =  2.700;
+ int21_ar[U][G][A][A][A][U][A] =  3.900;
+ int21_ar[U][G][A][A][C][U][A] =  3.700;
+ int21_ar[U][G][A][A][G][U][A] =  3.100;
+ int21_ar[U][G][A][A][U][U][A] =  5.500;
+ int21_ar[U][G][A][C][A][U][A] =  3.600;
+ int21_ar[U][G][A][C][C][U][A] =  3.200;
+ int21_ar[U][G][A][C][G][U][A] =  3.100;
+ int21_ar[U][G][A][C][U][U][A] =  5.500;
+ int21_ar[U][G][A][G][A][U][A] =  2.500;
+ int21_ar[U][G][A][G][C][U][A] =  2.100;
+ int21_ar[U][G][A][G][G][U][A] =  1.900;
+ int21_ar[U][G][A][G][U][U][A] =  5.500;
+ int21_ar[U][G][A][U][A][U][A] =  5.500;
+ int21_ar[U][G][A][U][C][U][A] =  5.500;
+ int21_ar[U][G][A][U][G][U][A] =  5.500;
+ int21_ar[U][G][A][U][U][U][A] =  5.500;
+ int21_ar[U][G][C][A][A][U][A] =  3.800;
+ int21_ar[U][G][C][A][C][U][A] =  3.700;
+ int21_ar[U][G][C][A][G][U][A] =  5.500;
+ int21_ar[U][G][C][A][U][U][A] =  3.700;
+ int21_ar[U][G][C][C][A][U][A] =  3.700;
+ int21_ar[U][G][C][C][C][U][A] =  4.000;
+ int21_ar[U][G][C][C][G][U][A] =  5.500;
+ int21_ar[U][G][C][C][U][U][A] =  3.700;
+ int21_ar[U][G][C][G][A][U][A] =  5.500;
+ int21_ar[U][G][C][G][C][U][A] =  5.500;
+ int21_ar[U][G][C][G][G][U][A] =  5.500;
+ int21_ar[U][G][C][G][U][U][A] =  5.500;
+ int21_ar[U][G][C][U][A][U][A] =  4.000;
+ int21_ar[U][G][C][U][C][U][A] =  3.400;
+ int21_ar[U][G][C][U][G][U][A] =  5.500;
+ int21_ar[U][G][C][U][U][U][A] =  3.700;
+ int21_ar[U][G][G][A][A][U][A] =  3.200;
+ int21_ar[U][G][G][A][C][U][A] =  5.500;
+ int21_ar[U][G][G][A][G][U][A] =  2.300;
+ int21_ar[U][G][G][A][U][U][A] =  5.500;
+ int21_ar[U][G][G][C][A][U][A] =  5.500;
+ int21_ar[U][G][G][C][C][U][A] =  5.500;
+ int21_ar[U][G][G][C][G][U][A] =  5.500;
+ int21_ar[U][G][G][C][U][U][A] =  5.500;
+ int21_ar[U][G][G][G][A][U][A] =  2.300;
+ int21_ar[U][G][G][G][C][U][A] =  5.500;
+ int21_ar[U][G][G][G][G][U][A] =  3.700;
+ int21_ar[U][G][G][G][U][U][A] =  5.500;
+ int21_ar[U][G][G][U][A][U][A] =  5.500;
+ int21_ar[U][G][G][U][C][U][A] =  5.500;
+ int21_ar[U][G][G][U][G][U][A] =  5.500;
+ int21_ar[U][G][G][U][U][U][A] =  5.500;
+ int21_ar[U][G][U][A][A][U][A] =  5.500;
+ int21_ar[U][G][U][A][C][U][A] =  5.500;
+ int21_ar[U][G][U][A][G][U][A] =  5.500;
+ int21_ar[U][G][U][A][U][U][A] =  5.500;
+ int21_ar[U][G][U][C][A][U][A] =  5.500;
+ int21_ar[U][G][U][C][C][U][A] =  3.700;
+ int21_ar[U][G][U][C][G][U][A] =  5.500;
+ int21_ar[U][G][U][C][U][U][A] =  2.800;
+ int21_ar[U][G][U][G][A][U][A] =  5.500;
+ int21_ar[U][G][U][G][C][U][A] =  5.500;
+ int21_ar[U][G][U][G][G][U][A] =  5.500;
+ int21_ar[U][G][U][G][U][U][A] =  5.500;
+ int21_ar[U][G][U][U][A][U][A] =  5.500;
+ int21_ar[U][G][U][U][C][U][A] =  3.200;
+ int21_ar[U][G][U][U][G][U][A] =  5.500;
+ int21_ar[U][G][U][U][U][U][A] =  2.700;
+ int21_ar[U][G][A][A][A][U][G] =  3.900;
+ int21_ar[U][G][A][A][C][U][G] =  3.700;
+ int21_ar[U][G][A][A][G][U][G] =  3.100;
+ int21_ar[U][G][A][A][U][U][G] =  5.500;
+ int21_ar[U][G][A][C][A][U][G] =  3.600;
+ int21_ar[U][G][A][C][C][U][G] =  3.200;
+ int21_ar[U][G][A][C][G][U][G] =  3.100;
+ int21_ar[U][G][A][C][U][U][G] =  5.500;
+ int21_ar[U][G][A][G][A][U][G] =  2.500;
+ int21_ar[U][G][A][G][C][U][G] =  2.100;
+ int21_ar[U][G][A][G][G][U][G] =  1.900;
+ int21_ar[U][G][A][G][U][U][G] =  5.500;
+ int21_ar[U][G][A][U][A][U][G] =  5.500;
+ int21_ar[U][G][A][U][C][U][G] =  5.500;
+ int21_ar[U][G][A][U][G][U][G] =  5.500;
+ int21_ar[U][G][A][U][U][U][G] =  5.500;
+ int21_ar[U][G][C][A][A][U][G] =  3.800;
+ int21_ar[U][G][C][A][C][U][G] =  3.700;
+ int21_ar[U][G][C][A][G][U][G] =  5.500;
+ int21_ar[U][G][C][A][U][U][G] =  3.700;
+ int21_ar[U][G][C][C][A][U][G] =  3.700;
+ int21_ar[U][G][C][C][C][U][G] =  4.000;
+ int21_ar[U][G][C][C][G][U][G] =  5.500;
+ int21_ar[U][G][C][C][U][U][G] =  3.700;
+ int21_ar[U][G][C][G][A][U][G] =  5.500;
+ int21_ar[U][G][C][G][C][U][G] =  5.500;
+ int21_ar[U][G][C][G][G][U][G] =  5.500;
+ int21_ar[U][G][C][G][U][U][G] =  5.500;
+ int21_ar[U][G][C][U][A][U][G] =  4.000;
+ int21_ar[U][G][C][U][C][U][G] =  3.400;
+ int21_ar[U][G][C][U][G][U][G] =  5.500;
+ int21_ar[U][G][C][U][U][U][G] =  3.700;
+ int21_ar[U][G][G][A][A][U][G] =  3.200;
+ int21_ar[U][G][G][A][C][U][G] =  5.500;
+ int21_ar[U][G][G][A][G][U][G] =  2.300;
+ int21_ar[U][G][G][A][U][U][G] =  5.500;
+ int21_ar[U][G][G][C][A][U][G] =  5.500;
+ int21_ar[U][G][G][C][C][U][G] =  5.500;
+ int21_ar[U][G][G][C][G][U][G] =  5.500;
+ int21_ar[U][G][G][C][U][U][G] =  5.500;
+ int21_ar[U][G][G][G][A][U][G] =  2.300;
+ int21_ar[U][G][G][G][C][U][G] =  5.500;
+ int21_ar[U][G][G][G][G][U][G] =  3.700;
+ int21_ar[U][G][G][G][U][U][G] =  5.500;
+ int21_ar[U][G][G][U][A][U][G] =  5.500;
+ int21_ar[U][G][G][U][C][U][G] =  5.500;
+ int21_ar[U][G][G][U][G][U][G] =  5.500;
+ int21_ar[U][G][G][U][U][U][G] =  5.500;
+ int21_ar[U][G][U][A][A][U][G] =  5.500;
+ int21_ar[U][G][U][A][C][U][G] =  5.500;
+ int21_ar[U][G][U][A][G][U][G] =  5.500;
+ int21_ar[U][G][U][A][U][U][G] =  5.500;
+ int21_ar[U][G][U][C][A][U][G] =  5.500;
+ int21_ar[U][G][U][C][C][U][G] =  3.700;
+ int21_ar[U][G][U][C][G][U][G] =  5.500;
+ int21_ar[U][G][U][C][U][U][G] =  2.800;
+ int21_ar[U][G][U][G][A][U][G] =  5.500;
+ int21_ar[U][G][U][G][C][U][G] =  5.500;
+ int21_ar[U][G][U][G][G][U][G] =  5.500;
+ int21_ar[U][G][U][G][U][U][G] =  5.500;
+ int21_ar[U][G][U][U][A][U][G] =  5.500;
+ int21_ar[U][G][U][U][C][U][G] =  3.200;
+ int21_ar[U][G][U][U][G][U][G] =  5.500;
+ int21_ar[U][G][U][U][U][U][G] =  2.700;
+}
+
+void init_int22_ar()
+{
+  int k1,k2,k3,k4,k5,k6,k7,k8;
+
+  for (k1=0;k1<ALPHASIZE;k1++)
+    for (k2=0;k2<ALPHASIZE;k2++)
+      for (k3=0;k3<ALPHASIZE;k3++)
+         for (k4=0;k4<ALPHASIZE;k4++)
+            for (k5=0;k5<ALPHASIZE;k5++)
+               for (k6=0;k6<ALPHASIZE;k6++)
+                 for (k7=0;k7<ALPHASIZE;k7++)
+                   for (k8=0;k8<ALPHASIZE;k8++)
+                     int22_ar[k1][k2][k3][k4][k5][k6][k7][k8]=0.0;
+
+ int22_ar[A][U][A][A][A][A][A][U] =  2.800;
+ int22_ar[A][U][A][A][A][C][A][U] =  2.600;
+ int22_ar[A][U][A][A][A][G][A][U] =  1.500;
+ int22_ar[A][U][A][A][A][U][A][U] =  2.000;
+ int22_ar[A][U][A][A][C][A][A][U] =  2.500;
+ int22_ar[A][U][A][A][C][C][A][U] =  2.400;
+ int22_ar[A][U][A][A][C][G][A][U] =  1.300;
+ int22_ar[A][U][A][A][C][U][A][U] =  2.000;
+ int22_ar[A][U][A][A][G][A][A][U] =  1.500;
+ int22_ar[A][U][A][A][G][C][A][U] =  1.400;
+ int22_ar[A][U][A][A][G][G][A][U] =  0.300;
+ int22_ar[A][U][A][A][G][U][A][U] =  2.000;
+ int22_ar[A][U][A][A][U][A][A][U] =  2.000;
+ int22_ar[A][U][A][A][U][C][A][U] =  2.000;
+ int22_ar[A][U][A][A][U][G][A][U] =  2.000;
+ int22_ar[A][U][A][A][U][U][A][U] =  2.000;
+ int22_ar[A][U][A][C][A][A][A][U] =  2.600;
+ int22_ar[A][U][A][C][A][C][A][U] =  2.500;
+ int22_ar[A][U][A][C][A][G][A][U] =  1.400;
+ int22_ar[A][U][A][C][A][U][A][U] =  2.000;
+ int22_ar[A][U][A][C][C][A][A][U] =  3.100;
+ int22_ar[A][U][A][C][C][C][A][U] =  2.300;
+ int22_ar[A][U][A][C][C][G][A][U] =  2.200;
+ int22_ar[A][U][A][C][C][U][A][U] =  2.000;
+ int22_ar[A][U][A][C][G][A][A][U] =  2.000;
+ int22_ar[A][U][A][C][G][C][A][U] =  2.000;
+ int22_ar[A][U][A][C][G][G][A][U] =  2.000;
+ int22_ar[A][U][A][C][G][U][A][U] =  2.000;
+ int22_ar[A][U][A][C][U][A][A][U] =  3.100;
+ int22_ar[A][U][A][C][U][C][A][U] =  2.300;
+ int22_ar[A][U][A][C][U][G][A][U] =  2.200;
+ int22_ar[A][U][A][C][U][U][A][U] =  2.000;
+ int22_ar[A][U][A][G][A][A][A][U] =  1.500;
+ int22_ar[A][U][A][G][A][C][A][U] =  1.400;
+ int22_ar[A][U][A][G][A][G][A][U] =  0.300;
+ int22_ar[A][U][A][G][A][U][A][U] =  2.000;
+ int22_ar[A][U][A][G][C][A][A][U] =  2.000;
+ int22_ar[A][U][A][G][C][C][A][U] =  2.000;
+ int22_ar[A][U][A][G][C][G][A][U] =  2.000;
+ int22_ar[A][U][A][G][C][U][A][U] =  2.000;
+ int22_ar[A][U][A][G][G][A][A][U] =  2.100;
+ int22_ar[A][U][A][G][G][C][A][U] =  1.900;
+ int22_ar[A][U][A][G][G][G][A][U] =  0.800;
+ int22_ar[A][U][A][G][G][U][A][U] =  2.000;
+ int22_ar[A][U][A][G][U][A][A][U] =  1.300;
+ int22_ar[A][U][A][G][U][C][A][U] =  0.200;
+ int22_ar[A][U][A][G][U][G][A][U] =  0.900;
+ int22_ar[A][U][A][G][U][U][A][U] =  2.000;
+ int22_ar[A][U][A][U][A][A][A][U] =  2.000;
+ int22_ar[A][U][A][U][A][C][A][U] =  2.000;
+ int22_ar[A][U][A][U][A][G][A][U] =  2.000;
+ int22_ar[A][U][A][U][A][U][A][U] =  2.000;
+ int22_ar[A][U][A][U][C][A][A][U] =  3.100;
+ int22_ar[A][U][A][U][C][C][A][U] =  2.300;
+ int22_ar[A][U][A][U][C][G][A][U] =  2.200;
+ int22_ar[A][U][A][U][C][U][A][U] =  2.000;
+ int22_ar[A][U][A][U][G][A][A][U] =  2.300;
+ int22_ar[A][U][A][U][G][C][A][U] =  1.200;
+ int22_ar[A][U][A][U][G][G][A][U] =  1.900;
+ int22_ar[A][U][A][U][G][U][A][U] =  2.000;
+ int22_ar[A][U][A][U][U][A][A][U] =  2.700;
+ int22_ar[A][U][A][U][U][C][A][U] =  1.500;
+ int22_ar[A][U][A][U][U][G][A][U] =  2.200;
+ int22_ar[A][U][A][U][U][U][A][U] =  2.000;
+ int22_ar[A][U][C][A][A][A][A][U] =  2.500;
+ int22_ar[A][U][C][A][A][C][A][U] =  3.100;
+ int22_ar[A][U][C][A][A][G][A][U] =  2.000;
+ int22_ar[A][U][C][A][A][U][A][U] =  3.100;
+ int22_ar[A][U][C][A][C][A][A][U] =  2.300;
+ int22_ar[A][U][C][A][C][C][A][U] =  2.200;
+ int22_ar[A][U][C][A][C][G][A][U] =  2.000;
+ int22_ar[A][U][C][A][C][U][A][U] =  2.200;
+ int22_ar[A][U][C][A][G][A][A][U] =  1.300;
+ int22_ar[A][U][C][A][G][C][A][U] =  2.200;
+ int22_ar[A][U][C][A][G][G][A][U] =  2.000;
+ int22_ar[A][U][C][A][G][U][A][U] =  2.200;
+ int22_ar[A][U][C][A][U][A][A][U] =  2.000;
+ int22_ar[A][U][C][A][U][C][A][U] =  2.000;
+ int22_ar[A][U][C][A][U][G][A][U] =  2.000;
+ int22_ar[A][U][C][A][U][U][A][U] =  2.000;
+ int22_ar[A][U][C][C][A][A][A][U] =  2.400;
+ int22_ar[A][U][C][C][A][C][A][U] =  2.300;
+ int22_ar[A][U][C][C][A][G][A][U] =  2.000;
+ int22_ar[A][U][C][C][A][U][A][U] =  2.300;
+ int22_ar[A][U][C][C][C][A][A][U] =  2.200;
+ int22_ar[A][U][C][C][C][C][A][U] =  2.200;
+ int22_ar[A][U][C][C][C][G][A][U] =  2.000;
+ int22_ar[A][U][C][C][C][U][A][U] =  2.200;
+ int22_ar[A][U][C][C][G][A][A][U] =  2.000;
+ int22_ar[A][U][C][C][G][C][A][U] =  2.000;
+ int22_ar[A][U][C][C][G][G][A][U] =  2.000;
+ int22_ar[A][U][C][C][G][U][A][U] =  2.000;
+ int22_ar[A][U][C][C][U][A][A][U] =  2.200;
+ int22_ar[A][U][C][C][U][C][A][U] =  2.200;
+ int22_ar[A][U][C][C][U][G][A][U] =  2.000;
+ int22_ar[A][U][C][C][U][U][A][U] =  2.200;
+ int22_ar[A][U][C][G][A][A][A][U] =  1.300;
+ int22_ar[A][U][C][G][A][C][A][U] =  2.200;
+ int22_ar[A][U][C][G][A][G][A][U] =  2.000;
+ int22_ar[A][U][C][G][A][U][A][U] =  2.200;
+ int22_ar[A][U][C][G][C][A][A][U] =  2.000;
+ int22_ar[A][U][C][G][C][C][A][U] =  2.000;
+ int22_ar[A][U][C][G][C][G][A][U] =  2.000;
+ int22_ar[A][U][C][G][C][U][A][U] =  2.000;
+ int22_ar[A][U][C][G][G][A][A][U] =  1.800;
+ int22_ar[A][U][C][G][G][C][A][U] =  2.400;
+ int22_ar[A][U][C][G][G][G][A][U] =  2.000;
+ int22_ar[A][U][C][G][G][U][A][U] =  2.400;
+ int22_ar[A][U][C][G][U][A][A][U] =  0.100;
+ int22_ar[A][U][C][G][U][C][A][U] =  1.000;
+ int22_ar[A][U][C][G][U][G][A][U] =  2.000;
+ int22_ar[A][U][C][G][U][U][A][U] =  1.000;
+ int22_ar[A][U][C][U][A][A][A][U] =  2.000;
+ int22_ar[A][U][C][U][A][C][A][U] =  2.000;
+ int22_ar[A][U][C][U][A][G][A][U] =  2.000;
+ int22_ar[A][U][C][U][A][U][A][U] =  2.000;
+ int22_ar[A][U][C][U][C][A][A][U] =  2.200;
+ int22_ar[A][U][C][U][C][C][A][U] =  2.200;
+ int22_ar[A][U][C][U][C][G][A][U] =  2.000;
+ int22_ar[A][U][C][U][C][U][A][U] =  2.200;
+ int22_ar[A][U][C][U][G][A][A][U] =  1.100;
+ int22_ar[A][U][C][U][G][C][A][U] =  2.000;
+ int22_ar[A][U][C][U][G][G][A][U] =  2.000;
+ int22_ar[A][U][C][U][G][U][A][U] =  2.000;
+ int22_ar[A][U][C][U][U][A][A][U] =  1.400;
+ int22_ar[A][U][C][U][U][C][A][U] =  1.400;
+ int22_ar[A][U][C][U][U][G][A][U] =  2.000;
+ int22_ar[A][U][C][U][U][U][A][U] =  1.400;
+ int22_ar[A][U][G][A][A][A][A][U] =  1.500;
+ int22_ar[A][U][G][A][A][C][A][U] =  2.000;
+ int22_ar[A][U][G][A][A][G][A][U] =  2.100;
+ int22_ar[A][U][G][A][A][U][A][U] =  2.300;
+ int22_ar[A][U][G][A][C][A][A][U] =  1.300;
+ int22_ar[A][U][G][A][C][C][A][U] =  2.000;
+ int22_ar[A][U][G][A][C][G][A][U] =  1.800;
+ int22_ar[A][U][G][A][C][U][A][U] =  1.100;
+ int22_ar[A][U][G][A][G][A][A][U] =  0.300;
+ int22_ar[A][U][G][A][G][C][A][U] =  2.000;
+ int22_ar[A][U][G][A][G][G][A][U] =  0.800;
+ int22_ar[A][U][G][A][G][U][A][U] =  1.900;
+ int22_ar[A][U][G][A][U][A][A][U] =  2.000;
+ int22_ar[A][U][G][A][U][C][A][U] =  2.000;
+ int22_ar[A][U][G][A][U][G][A][U] =  2.000;
+ int22_ar[A][U][G][A][U][U][A][U] =  2.000;
+ int22_ar[A][U][G][C][A][A][A][U] =  1.400;
+ int22_ar[A][U][G][C][A][C][A][U] =  2.000;
+ int22_ar[A][U][G][C][A][G][A][U] =  1.900;
+ int22_ar[A][U][G][C][A][U][A][U] =  1.200;
+ int22_ar[A][U][G][C][C][A][A][U] =  2.200;
+ int22_ar[A][U][G][C][C][C][A][U] =  2.000;
+ int22_ar[A][U][G][C][C][G][A][U] =  2.400;
+ int22_ar[A][U][G][C][C][U][A][U] =  2.000;
+ int22_ar[A][U][G][C][G][A][A][U] =  2.000;
+ int22_ar[A][U][G][C][G][C][A][U] =  2.000;
+ int22_ar[A][U][G][C][G][G][A][U] =  2.000;
+ int22_ar[A][U][G][C][G][U][A][U] =  2.000;
+ int22_ar[A][U][G][C][U][A][A][U] =  2.200;
+ int22_ar[A][U][G][C][U][C][A][U] =  2.000;
+ int22_ar[A][U][G][C][U][G][A][U] =  2.400;
+ int22_ar[A][U][G][C][U][U][A][U] =  2.000;
+ int22_ar[A][U][G][G][A][A][A][U] =  0.300;
+ int22_ar[A][U][G][G][A][C][A][U] =  2.000;
+ int22_ar[A][U][G][G][A][G][A][U] =  0.800;
+ int22_ar[A][U][G][G][A][U][A][U] =  1.900;
+ int22_ar[A][U][G][G][C][A][A][U] =  2.000;
+ int22_ar[A][U][G][G][C][C][A][U] =  2.000;
+ int22_ar[A][U][G][G][C][G][A][U] =  2.000;
+ int22_ar[A][U][G][G][C][U][A][U] =  2.000;
+ int22_ar[A][U][G][G][G][A][A][U] =  0.800;
+ int22_ar[A][U][G][G][G][C][A][U] =  2.000;
+ int22_ar[A][U][G][G][G][G][A][U] =  1.400;
+ int22_ar[A][U][G][G][G][U][A][U] =  1.600;
+ int22_ar[A][U][G][G][U][A][A][U] =  0.900;
+ int22_ar[A][U][G][G][U][C][A][U] =  2.000;
+ int22_ar[A][U][G][G][U][G][A][U] =  0.700;
+ int22_ar[A][U][G][G][U][U][A][U] = -1.100;
+ int22_ar[A][U][G][U][A][A][A][U] =  2.000;
+ int22_ar[A][U][G][U][A][C][A][U] =  2.000;
+ int22_ar[A][U][G][U][A][G][A][U] =  2.000;
+ int22_ar[A][U][G][U][A][U][A][U] =  2.000;
+ int22_ar[A][U][G][U][C][A][A][U] =  2.200;
+ int22_ar[A][U][G][U][C][C][A][U] =  2.000;
+ int22_ar[A][U][G][U][C][G][A][U] =  2.400;
+ int22_ar[A][U][G][U][C][U][A][U] =  2.000;
+ int22_ar[A][U][G][U][G][A][A][U] =  1.900;
+ int22_ar[A][U][G][U][G][C][A][U] =  2.000;
+ int22_ar[A][U][G][U][G][G][A][U] =  1.600;
+ int22_ar[A][U][G][U][G][U][A][U] = -0.100;
+ int22_ar[A][U][G][U][U][A][A][U] =  2.200;
+ int22_ar[A][U][G][U][U][C][A][U] =  2.000;
+ int22_ar[A][U][G][U][U][G][A][U] =  2.000;
+ int22_ar[A][U][G][U][U][U][A][U] =  2.000;
+ int22_ar[A][U][U][A][A][A][A][U] =  2.000;
+ int22_ar[A][U][U][A][A][C][A][U] =  3.100;
+ int22_ar[A][U][U][A][A][G][A][U] =  1.300;
+ int22_ar[A][U][U][A][A][U][A][U] =  2.700;
+ int22_ar[A][U][U][A][C][A][A][U] =  2.000;
+ int22_ar[A][U][U][A][C][C][A][U] =  2.200;
+ int22_ar[A][U][U][A][C][G][A][U] =  0.100;
+ int22_ar[A][U][U][A][C][U][A][U] =  1.400;
+ int22_ar[A][U][U][A][G][A][A][U] =  2.000;
+ int22_ar[A][U][U][A][G][C][A][U] =  2.200;
+ int22_ar[A][U][U][A][G][G][A][U] =  0.900;
+ int22_ar[A][U][U][A][G][U][A][U] =  2.200;
+ int22_ar[A][U][U][A][U][A][A][U] =  2.000;
+ int22_ar[A][U][U][A][U][C][A][U] =  2.000;
+ int22_ar[A][U][U][A][U][G][A][U] =  2.000;
+ int22_ar[A][U][U][A][U][U][A][U] =  2.000;
+ int22_ar[A][U][U][C][A][A][A][U] =  2.000;
+ int22_ar[A][U][U][C][A][C][A][U] =  2.300;
+ int22_ar[A][U][U][C][A][G][A][U] =  0.200;
+ int22_ar[A][U][U][C][A][U][A][U] =  1.500;
+ int22_ar[A][U][U][C][C][A][A][U] =  2.000;
+ int22_ar[A][U][U][C][C][C][A][U] =  2.200;
+ int22_ar[A][U][U][C][C][G][A][U] =  1.000;
+ int22_ar[A][U][U][C][C][U][A][U] =  1.400;
+ int22_ar[A][U][U][C][G][A][A][U] =  2.000;
+ int22_ar[A][U][U][C][G][C][A][U] =  2.000;
+ int22_ar[A][U][U][C][G][G][A][U] =  2.000;
+ int22_ar[A][U][U][C][G][U][A][U] =  2.000;
+ int22_ar[A][U][U][C][U][A][A][U] =  2.000;
+ int22_ar[A][U][U][C][U][C][A][U] =  2.200;
+ int22_ar[A][U][U][C][U][G][A][U] =  1.000;
+ int22_ar[A][U][U][C][U][U][A][U] =  1.400;
+ int22_ar[A][U][U][G][A][A][A][U] =  2.000;
+ int22_ar[A][U][U][G][A][C][A][U] =  2.200;
+ int22_ar[A][U][U][G][A][G][A][U] =  0.900;
+ int22_ar[A][U][U][G][A][U][A][U] =  2.200;
+ int22_ar[A][U][U][G][C][A][A][U] =  2.000;
+ int22_ar[A][U][U][G][C][C][A][U] =  2.000;
+ int22_ar[A][U][U][G][C][G][A][U] =  2.000;
+ int22_ar[A][U][U][G][C][U][A][U] =  2.000;
+ int22_ar[A][U][U][G][G][A][A][U] =  2.000;
+ int22_ar[A][U][U][G][G][C][A][U] =  2.400;
+ int22_ar[A][U][U][G][G][G][A][U] =  0.700;
+ int22_ar[A][U][U][G][G][U][A][U] =  2.000;
+ int22_ar[A][U][U][G][U][A][A][U] =  2.000;
+ int22_ar[A][U][U][G][U][C][A][U] =  1.000;
+ int22_ar[A][U][U][G][U][G][A][U] = -2.100;
+ int22_ar[A][U][U][G][U][U][A][U] =  1.100;
+ int22_ar[A][U][U][U][A][A][A][U] =  2.000;
+ int22_ar[A][U][U][U][A][C][A][U] =  2.000;
+ int22_ar[A][U][U][U][A][G][A][U] =  2.000;
+ int22_ar[A][U][U][U][A][U][A][U] =  2.000;
+ int22_ar[A][U][U][U][C][A][A][U] =  2.000;
+ int22_ar[A][U][U][U][C][C][A][U] =  2.200;
+ int22_ar[A][U][U][U][C][G][A][U] =  1.000;
+ int22_ar[A][U][U][U][C][U][A][U] =  1.400;
+ int22_ar[A][U][U][U][G][A][A][U] =  2.000;
+ int22_ar[A][U][U][U][G][C][A][U] =  2.000;
+ int22_ar[A][U][U][U][G][G][A][U] = -1.100;
+ int22_ar[A][U][U][U][G][U][A][U] =  2.000;
+ int22_ar[A][U][U][U][U][A][A][U] =  2.000;
+ int22_ar[A][U][U][U][U][C][A][U] =  1.400;
+ int22_ar[A][U][U][U][U][G][A][U] =  1.100;
+ int22_ar[A][U][U][U][U][U][A][U] =  0.600;
+ int22_ar[A][U][A][A][A][A][C][G] =  2.000;
+ int22_ar[A][U][A][A][A][C][C][G] =  1.900;
+ int22_ar[A][U][A][A][A][G][C][G] =  0.800;
+ int22_ar[A][U][A][A][A][U][C][G] =  2.000;
+ int22_ar[A][U][A][A][C][A][C][G] =  1.900;
+ int22_ar[A][U][A][A][C][C][C][G] =  1.800;
+ int22_ar[A][U][A][A][C][G][C][G] =  0.700;
+ int22_ar[A][U][A][A][C][U][C][G] =  2.000;
+ int22_ar[A][U][A][A][G][A][C][G] =  1.000;
+ int22_ar[A][U][A][A][G][C][C][G] =  0.900;
+ int22_ar[A][U][A][A][G][G][C][G] = -0.200;
+ int22_ar[A][U][A][A][G][U][C][G] =  2.000;
+ int22_ar[A][U][A][A][U][A][C][G] =  2.000;
+ int22_ar[A][U][A][A][U][C][C][G] =  2.000;
+ int22_ar[A][U][A][A][U][G][C][G] =  2.000;
+ int22_ar[A][U][A][A][U][U][C][G] =  2.000;
+ int22_ar[A][U][A][C][A][A][C][G] =  2.400;
+ int22_ar[A][U][A][C][A][C][C][G] =  2.200;
+ int22_ar[A][U][A][C][A][G][C][G] =  1.100;
+ int22_ar[A][U][A][C][A][U][C][G] =  2.000;
+ int22_ar[A][U][A][C][C][A][C][G] =  2.800;
+ int22_ar[A][U][A][C][C][C][C][G] =  2.100;
+ int22_ar[A][U][A][C][C][G][C][G] =  2.000;
+ int22_ar[A][U][A][C][C][U][C][G] =  2.000;
+ int22_ar[A][U][A][C][G][A][C][G] =  2.000;
+ int22_ar[A][U][A][C][G][C][C][G] =  2.000;
+ int22_ar[A][U][A][C][G][G][C][G] =  2.000;
+ int22_ar[A][U][A][C][G][U][C][G] =  2.000;
+ int22_ar[A][U][A][C][U][A][C][G] =  2.700;
+ int22_ar[A][U][A][C][U][C][C][G] =  1.900;
+ int22_ar[A][U][A][C][U][G][C][G] =  1.800;
+ int22_ar[A][U][A][C][U][U][C][G] =  2.000;
+ int22_ar[A][U][A][G][A][A][C][G] =  1.000;
+ int22_ar[A][U][A][G][A][C][C][G] =  0.900;
+ int22_ar[A][U][A][G][A][G][C][G] = -0.200;
+ int22_ar[A][U][A][G][A][U][C][G] =  2.000;
+ int22_ar[A][U][A][G][C][A][C][G] =  2.000;
+ int22_ar[A][U][A][G][C][C][C][G] =  2.000;
+ int22_ar[A][U][A][G][C][G][C][G] =  2.000;
+ int22_ar[A][U][A][G][C][U][C][G] =  2.000;
+ int22_ar[A][U][A][G][G][A][C][G] =  1.800;
+ int22_ar[A][U][A][G][G][C][C][G] =  1.600;
+ int22_ar[A][U][A][G][G][G][C][G] =  0.500;
+ int22_ar[A][U][A][G][G][U][C][G] =  2.000;
+ int22_ar[A][U][A][G][U][A][C][G] =  0.300;
+ int22_ar[A][U][A][G][U][C][C][G] = -0.800;
+ int22_ar[A][U][A][G][U][G][C][G] = -0.100;
+ int22_ar[A][U][A][G][U][U][C][G] =  2.000;
+ int22_ar[A][U][A][U][A][A][C][G] =  2.000;
+ int22_ar[A][U][A][U][A][C][C][G] =  2.000;
+ int22_ar[A][U][A][U][A][G][C][G] =  2.000;
+ int22_ar[A][U][A][U][A][U][C][G] =  2.000;
+ int22_ar[A][U][A][U][C][A][C][G] =  2.700;
+ int22_ar[A][U][A][U][C][C][C][G] =  1.900;
+ int22_ar[A][U][A][U][C][G][C][G] =  1.800;
+ int22_ar[A][U][A][U][C][U][C][G] =  2.000;
+ int22_ar[A][U][A][U][G][A][C][G] =  1.800;
+ int22_ar[A][U][A][U][G][C][C][G] =  0.700;
+ int22_ar[A][U][A][U][G][G][C][G] =  1.400;
+ int22_ar[A][U][A][U][G][U][C][G] =  2.000;
+ int22_ar[A][U][A][U][U][A][C][G] =  2.200;
+ int22_ar[A][U][A][U][U][C][C][G] =  1.000;
+ int22_ar[A][U][A][U][U][G][C][G] =  1.800;
+ int22_ar[A][U][A][U][U][U][C][G] =  2.000;
+ int22_ar[A][U][C][A][A][A][C][G] =  1.800;
+ int22_ar[A][U][C][A][A][C][C][G] =  2.300;
+ int22_ar[A][U][C][A][A][G][C][G] =  2.000;
+ int22_ar[A][U][C][A][A][U][C][G] =  2.300;
+ int22_ar[A][U][C][A][C][A][C][G] =  1.700;
+ int22_ar[A][U][C][A][C][C][C][G] =  1.600;
+ int22_ar[A][U][C][A][C][G][C][G] =  2.000;
+ int22_ar[A][U][C][A][C][U][C][G] =  1.600;
+ int22_ar[A][U][C][A][G][A][C][G] =  0.800;
+ int22_ar[A][U][C][A][G][C][C][G] =  1.700;
+ int22_ar[A][U][C][A][G][G][C][G] =  2.000;
+ int22_ar[A][U][C][A][G][U][C][G] =  1.700;
+ int22_ar[A][U][C][A][U][A][C][G] =  2.000;
+ int22_ar[A][U][C][A][U][C][C][G] =  2.000;
+ int22_ar[A][U][C][A][U][G][C][G] =  2.000;
+ int22_ar[A][U][C][A][U][U][C][G] =  2.000;
+ int22_ar[A][U][C][C][A][A][C][G] =  2.100;
+ int22_ar[A][U][C][C][A][C][C][G] =  2.100;
+ int22_ar[A][U][C][C][A][G][C][G] =  2.000;
+ int22_ar[A][U][C][C][A][U][C][G] =  2.100;
+ int22_ar[A][U][C][C][C][A][C][G] =  2.000;
+ int22_ar[A][U][C][C][C][C][C][G] =  1.900;
+ int22_ar[A][U][C][C][C][G][C][G] =  2.000;
+ int22_ar[A][U][C][C][C][U][C][G] =  1.900;
+ int22_ar[A][U][C][C][G][A][C][G] =  2.000;
+ int22_ar[A][U][C][C][G][C][C][G] =  2.000;
+ int22_ar[A][U][C][C][G][G][C][G] =  2.000;
+ int22_ar[A][U][C][C][G][U][C][G] =  2.000;
+ int22_ar[A][U][C][C][U][A][C][G] =  1.800;
+ int22_ar[A][U][C][C][U][C][C][G] =  1.800;
+ int22_ar[A][U][C][C][U][G][C][G] =  2.000;
+ int22_ar[A][U][C][C][U][U][C][G] =  1.800;
+ int22_ar[A][U][C][G][A][A][C][G] =  0.800;
+ int22_ar[A][U][C][G][A][C][C][G] =  1.700;
+ int22_ar[A][U][C][G][A][G][C][G] =  2.000;
+ int22_ar[A][U][C][G][A][U][C][G] =  1.700;
+ int22_ar[A][U][C][G][C][A][C][G] =  2.000;
+ int22_ar[A][U][C][G][C][C][C][G] =  2.000;
+ int22_ar[A][U][C][G][C][G][C][G] =  2.000;
+ int22_ar[A][U][C][G][C][U][C][G] =  2.000;
+ int22_ar[A][U][C][G][G][A][C][G] =  1.500;
+ int22_ar[A][U][C][G][G][C][C][G] =  2.100;
+ int22_ar[A][U][C][G][G][G][C][G] =  2.000;
+ int22_ar[A][U][C][G][G][U][C][G] =  2.100;
+ int22_ar[A][U][C][G][U][A][C][G] = -0.900;
+ int22_ar[A][U][C][G][U][C][C][G] =  0.000;
+ int22_ar[A][U][C][G][U][G][C][G] =  2.000;
+ int22_ar[A][U][C][G][U][U][C][G] =  0.000;
+ int22_ar[A][U][C][U][A][A][C][G] =  2.000;
+ int22_ar[A][U][C][U][A][C][C][G] =  2.000;
+ int22_ar[A][U][C][U][A][G][C][G] =  2.000;
+ int22_ar[A][U][C][U][A][U][C][G] =  2.000;
+ int22_ar[A][U][C][U][C][A][C][G] =  1.800;
+ int22_ar[A][U][C][U][C][C][C][G] =  1.800;
+ int22_ar[A][U][C][U][C][G][C][G] =  2.000;
+ int22_ar[A][U][C][U][C][U][C][G] =  1.800;
+ int22_ar[A][U][C][U][G][A][C][G] =  0.600;
+ int22_ar[A][U][C][U][G][C][C][G] =  1.500;
+ int22_ar[A][U][C][U][G][G][C][G] =  2.000;
+ int22_ar[A][U][C][U][G][U][C][G] =  1.500;
+ int22_ar[A][U][C][U][U][A][C][G] =  0.900;
+ int22_ar[A][U][C][U][U][C][C][G] =  0.900;
+ int22_ar[A][U][C][U][U][G][C][G] =  2.000;
+ int22_ar[A][U][C][U][U][U][C][G] =  0.900;
+ int22_ar[A][U][G][A][A][A][C][G] =  0.800;
+ int22_ar[A][U][G][A][A][C][C][G] =  2.000;
+ int22_ar[A][U][G][A][A][G][C][G] =  1.300;
+ int22_ar[A][U][G][A][A][U][C][G] =  1.600;
+ int22_ar[A][U][G][A][C][A][C][G] =  0.700;
+ int22_ar[A][U][G][A][C][C][C][G] =  2.000;
+ int22_ar[A][U][G][A][C][G][C][G] =  1.200;
+ int22_ar[A][U][G][A][C][U][C][G] =  0.500;
+ int22_ar[A][U][G][A][G][A][C][G] = -0.200;
+ int22_ar[A][U][G][A][G][C][C][G] =  2.000;
+ int22_ar[A][U][G][A][G][G][C][G] =  0.300;
+ int22_ar[A][U][G][A][G][U][C][G] =  1.400;
+ int22_ar[A][U][G][A][U][A][C][G] =  2.000;
+ int22_ar[A][U][G][A][U][C][C][G] =  2.000;
+ int22_ar[A][U][G][A][U][G][C][G] =  2.000;
+ int22_ar[A][U][G][A][U][U][C][G] =  2.000;
+ int22_ar[A][U][G][C][A][A][C][G] =  1.100;
+ int22_ar[A][U][G][C][A][C][C][G] =  2.000;
+ int22_ar[A][U][G][C][A][G][C][G] =  1.700;
+ int22_ar[A][U][G][C][A][U][C][G] =  0.900;
+ int22_ar[A][U][G][C][C][A][C][G] =  2.000;
+ int22_ar[A][U][G][C][C][C][C][G] =  2.000;
+ int22_ar[A][U][G][C][C][G][C][G] =  2.100;
+ int22_ar[A][U][G][C][C][U][C][G] =  1.800;
+ int22_ar[A][U][G][C][G][A][C][G] =  2.000;
+ int22_ar[A][U][G][C][G][C][C][G] =  2.000;
+ int22_ar[A][U][G][C][G][G][C][G] =  2.000;
+ int22_ar[A][U][G][C][G][U][C][G] =  2.000;
+ int22_ar[A][U][G][C][U][A][C][G] =  1.800;
+ int22_ar[A][U][G][C][U][C][C][G] =  2.000;
+ int22_ar[A][U][G][C][U][G][C][G] =  2.000;
+ int22_ar[A][U][G][C][U][U][C][G] =  1.600;
+ int22_ar[A][U][G][G][A][A][C][G] = -0.200;
+ int22_ar[A][U][G][G][A][C][C][G] =  2.000;
+ int22_ar[A][U][G][G][A][G][C][G] =  0.300;
+ int22_ar[A][U][G][G][A][U][C][G] =  1.400;
+ int22_ar[A][U][G][G][C][A][C][G] =  2.000;
+ int22_ar[A][U][G][G][C][C][C][G] =  2.000;
+ int22_ar[A][U][G][G][C][G][C][G] =  2.000;
+ int22_ar[A][U][G][G][C][U][C][G] =  2.000;
+ int22_ar[A][U][G][G][G][A][C][G] =  0.500;
+ int22_ar[A][U][G][G][G][C][C][G] =  2.000;
+ int22_ar[A][U][G][G][G][G][C][G] =  1.100;
+ int22_ar[A][U][G][G][G][U][C][G] =  1.300;
+ int22_ar[A][U][G][G][U][A][C][G] = -0.100;
+ int22_ar[A][U][G][G][U][C][C][G] =  2.000;
+ int22_ar[A][U][G][G][U][G][C][G] = -0.400;
+ int22_ar[A][U][G][G][U][U][C][G] = -2.100;
+ int22_ar[A][U][G][U][A][A][C][G] =  2.000;
+ int22_ar[A][U][G][U][A][C][C][G] =  2.000;
+ int22_ar[A][U][G][U][A][G][C][G] =  2.000;
+ int22_ar[A][U][G][U][A][U][C][G] =  2.000;
+ int22_ar[A][U][G][U][C][A][C][G] =  1.800;
+ int22_ar[A][U][G][U][C][C][C][G] =  2.000;
+ int22_ar[A][U][G][U][C][G][C][G] =  2.000;
+ int22_ar[A][U][G][U][C][U][C][G] =  1.600;
+ int22_ar[A][U][G][U][G][A][C][G] =  1.400;
+ int22_ar[A][U][G][U][G][C][C][G] =  2.000;
+ int22_ar[A][U][G][U][G][G][C][G] =  1.100;
+ int22_ar[A][U][G][U][G][U][C][G] = -0.600;
+ int22_ar[A][U][G][U][U][A][C][G] =  1.800;
+ int22_ar[A][U][G][U][U][C][C][G] =  2.000;
+ int22_ar[A][U][G][U][U][G][C][G] =  1.500;
+ int22_ar[A][U][G][U][U][U][C][G] =  1.600;
+ int22_ar[A][U][U][A][A][A][C][G] =  2.000;
+ int22_ar[A][U][U][A][A][C][C][G] =  2.300;
+ int22_ar[A][U][U][A][A][G][C][G] =  0.600;
+ int22_ar[A][U][U][A][A][U][C][G] =  1.900;
+ int22_ar[A][U][U][A][C][A][C][G] =  2.000;
+ int22_ar[A][U][U][A][C][C][C][G] =  1.600;
+ int22_ar[A][U][U][A][C][G][C][G] = -0.500;
+ int22_ar[A][U][U][A][C][U][C][G] =  0.800;
+ int22_ar[A][U][U][A][G][A][C][G] =  2.000;
+ int22_ar[A][U][U][A][G][C][C][G] =  1.700;
+ int22_ar[A][U][U][A][G][G][C][G] =  0.400;
+ int22_ar[A][U][U][A][G][U][C][G] =  1.800;
+ int22_ar[A][U][U][A][U][A][C][G] =  2.000;
+ int22_ar[A][U][U][A][U][C][C][G] =  2.000;
+ int22_ar[A][U][U][A][U][G][C][G] =  2.000;
+ int22_ar[A][U][U][A][U][U][C][G] =  2.000;
+ int22_ar[A][U][U][C][A][A][C][G] =  2.000;
+ int22_ar[A][U][U][C][A][C][C][G] =  2.100;
+ int22_ar[A][U][U][C][A][G][C][G] =  0.000;
+ int22_ar[A][U][U][C][A][U][C][G] =  1.300;
+ int22_ar[A][U][U][C][C][A][C][G] =  2.000;
+ int22_ar[A][U][U][C][C][C][C][G] =  1.900;
+ int22_ar[A][U][U][C][C][G][C][G] =  0.800;
+ int22_ar[A][U][U][C][C][U][C][G] =  1.100;
+ int22_ar[A][U][U][C][G][A][C][G] =  2.000;
+ int22_ar[A][U][U][C][G][C][C][G] =  2.000;
+ int22_ar[A][U][U][C][G][G][C][G] =  2.000;
+ int22_ar[A][U][U][C][G][U][C][G] =  2.000;
+ int22_ar[A][U][U][C][U][A][C][G] =  2.000;
+ int22_ar[A][U][U][C][U][C][C][G] =  1.800;
+ int22_ar[A][U][U][C][U][G][C][G] =  0.700;
+ int22_ar[A][U][U][C][U][U][C][G] =  1.000;
+ int22_ar[A][U][U][G][A][A][C][G] =  2.000;
+ int22_ar[A][U][U][G][A][C][C][G] =  1.700;
+ int22_ar[A][U][U][G][A][G][C][G] =  0.400;
+ int22_ar[A][U][U][G][A][U][C][G] =  1.800;
+ int22_ar[A][U][U][G][C][A][C][G] =  2.000;
+ int22_ar[A][U][U][G][C][C][C][G] =  2.000;
+ int22_ar[A][U][U][G][C][G][C][G] =  2.000;
+ int22_ar[A][U][U][G][C][U][C][G] =  2.000;
+ int22_ar[A][U][U][G][G][A][C][G] =  2.000;
+ int22_ar[A][U][U][G][G][C][C][G] =  2.100;
+ int22_ar[A][U][U][G][G][G][C][G] =  0.400;
+ int22_ar[A][U][U][G][G][U][C][G] =  1.700;
+ int22_ar[A][U][U][G][U][A][C][G] =  2.000;
+ int22_ar[A][U][U][G][U][C][C][G] =  0.000;
+ int22_ar[A][U][U][G][U][G][C][G] = -3.100;
+ int22_ar[A][U][U][G][U][U][C][G] =  0.000;
+ int22_ar[A][U][U][U][A][A][C][G] =  2.000;
+ int22_ar[A][U][U][U][A][C][C][G] =  2.000;
+ int22_ar[A][U][U][U][A][G][C][G] =  2.000;
+ int22_ar[A][U][U][U][A][U][C][G] =  2.000;
+ int22_ar[A][U][U][U][C][A][C][G] =  2.000;
+ int22_ar[A][U][U][U][C][C][C][G] =  1.800;
+ int22_ar[A][U][U][U][C][G][C][G] =  0.700;
+ int22_ar[A][U][U][U][C][U][C][G] =  1.000;
+ int22_ar[A][U][U][U][G][A][C][G] =  2.000;
+ int22_ar[A][U][U][U][G][C][C][G] =  1.500;
+ int22_ar[A][U][U][U][G][G][C][G] = -1.600;
+ int22_ar[A][U][U][U][G][U][C][G] =  1.600;
+ int22_ar[A][U][U][U][U][A][C][G] =  2.000;
+ int22_ar[A][U][U][U][U][C][C][G] =  0.900;
+ int22_ar[A][U][U][U][U][G][C][G] =  0.600;
+ int22_ar[A][U][U][U][U][U][C][G] =  0.100;
+ int22_ar[A][U][A][A][A][A][G][C] =  2.100;
+ int22_ar[A][U][A][A][A][C][G][C] =  2.000;
+ int22_ar[A][U][A][A][A][G][G][C] =  0.900;
+ int22_ar[A][U][A][A][A][U][G][C] =  2.000;
+ int22_ar[A][U][A][A][C][A][G][C] =  1.900;
+ int22_ar[A][U][A][A][C][C][G][C] =  1.700;
+ int22_ar[A][U][A][A][C][G][G][C] =  0.600;
+ int22_ar[A][U][A][A][C][U][G][C] =  2.000;
+ int22_ar[A][U][A][A][G][A][G][C] =  0.100;
+ int22_ar[A][U][A][A][G][C][G][C] =  0.000;
+ int22_ar[A][U][A][A][G][G][G][C] = -1.100;
+ int22_ar[A][U][A][A][G][U][G][C] =  2.000;
+ int22_ar[A][U][A][A][U][A][G][C] =  2.000;
+ int22_ar[A][U][A][A][U][C][G][C] =  2.000;
+ int22_ar[A][U][A][A][U][G][G][C] =  2.000;
+ int22_ar[A][U][A][A][U][U][G][C] =  2.000;
+ int22_ar[A][U][A][C][A][A][G][C] =  1.800;
+ int22_ar[A][U][A][C][A][C][G][C] =  1.700;
+ int22_ar[A][U][A][C][A][G][G][C] =  0.600;
+ int22_ar[A][U][A][C][A][U][G][C] =  2.000;
+ int22_ar[A][U][A][C][C][A][G][C] =  2.500;
+ int22_ar[A][U][A][C][C][C][G][C] =  1.700;
+ int22_ar[A][U][A][C][C][G][G][C] =  1.600;
+ int22_ar[A][U][A][C][C][U][G][C] =  2.000;
+ int22_ar[A][U][A][C][G][A][G][C] =  2.000;
+ int22_ar[A][U][A][C][G][C][G][C] =  2.000;
+ int22_ar[A][U][A][C][G][G][G][C] =  2.000;
+ int22_ar[A][U][A][C][G][U][G][C] =  2.000;
+ int22_ar[A][U][A][C][U][A][G][C] =  1.500;
+ int22_ar[A][U][A][C][U][C][G][C] =  0.700;
+ int22_ar[A][U][A][C][U][G][G][C] =  0.700;
+ int22_ar[A][U][A][C][U][U][G][C] =  2.000;
+ int22_ar[A][U][A][G][A][A][G][C] =  0.700;
+ int22_ar[A][U][A][G][A][C][G][C] =  0.600;
+ int22_ar[A][U][A][G][A][G][G][C] = -0.500;
+ int22_ar[A][U][A][G][A][U][G][C] =  2.000;
+ int22_ar[A][U][A][G][C][A][G][C] =  2.000;
+ int22_ar[A][U][A][G][C][C][G][C] =  2.000;
+ int22_ar[A][U][A][G][C][G][G][C] =  2.000;
+ int22_ar[A][U][A][G][C][U][G][C] =  2.000;
+ int22_ar[A][U][A][G][G][A][G][C] =  1.800;
+ int22_ar[A][U][A][G][G][C][G][C] =  1.600;
+ int22_ar[A][U][A][G][G][G][G][C] =  0.500;
+ int22_ar[A][U][A][G][G][U][G][C] =  2.000;
+ int22_ar[A][U][A][G][U][A][G][C] =  0.000;
+ int22_ar[A][U][A][G][U][C][G][C] = -1.200;
+ int22_ar[A][U][A][G][U][G][G][C] = -0.500;
+ int22_ar[A][U][A][G][U][U][G][C] =  2.000;
+ int22_ar[A][U][A][U][A][A][G][C] =  2.000;
+ int22_ar[A][U][A][U][A][C][G][C] =  2.000;
+ int22_ar[A][U][A][U][A][G][G][C] =  2.000;
+ int22_ar[A][U][A][U][A][U][G][C] =  2.000;
+ int22_ar[A][U][A][U][C][A][G][C] =  2.500;
+ int22_ar[A][U][A][U][C][C][G][C] =  1.800;
+ int22_ar[A][U][A][U][C][G][G][C] =  1.700;
+ int22_ar[A][U][A][U][C][U][G][C] =  2.000;
+ int22_ar[A][U][A][U][G][A][G][C] =  0.400;
+ int22_ar[A][U][A][U][G][C][G][C] = -0.800;
+ int22_ar[A][U][A][U][G][G][G][C] = -0.100;
+ int22_ar[A][U][A][U][G][U][G][C] =  2.000;
+ int22_ar[A][U][A][U][U][A][G][C] =  2.100;
+ int22_ar[A][U][A][U][U][C][G][C] =  1.000;
+ int22_ar[A][U][A][U][U][G][G][C] =  1.700;
+ int22_ar[A][U][A][U][U][U][G][C] =  2.000;
+ int22_ar[A][U][C][A][A][A][G][C] =  1.900;
+ int22_ar[A][U][C][A][A][C][G][C] =  2.400;
+ int22_ar[A][U][C][A][A][G][G][C] =  2.000;
+ int22_ar[A][U][C][A][A][U][G][C] =  2.400;
+ int22_ar[A][U][C][A][C][A][G][C] =  1.600;
+ int22_ar[A][U][C][A][C][C][G][C] =  1.600;
+ int22_ar[A][U][C][A][C][G][G][C] =  2.000;
+ int22_ar[A][U][C][A][C][U][G][C] =  1.600;
+ int22_ar[A][U][C][A][G][A][G][C] = -0.100;
+ int22_ar[A][U][C][A][G][C][G][C] =  0.800;
+ int22_ar[A][U][C][A][G][G][G][C] =  2.000;
+ int22_ar[A][U][C][A][G][U][G][C] =  0.800;
+ int22_ar[A][U][C][A][U][A][G][C] =  2.000;
+ int22_ar[A][U][C][A][U][C][G][C] =  2.000;
+ int22_ar[A][U][C][A][U][G][G][C] =  2.000;
+ int22_ar[A][U][C][A][U][U][G][C] =  2.000;
+ int22_ar[A][U][C][C][A][A][G][C] =  1.600;
+ int22_ar[A][U][C][C][A][C][G][C] =  1.500;
+ int22_ar[A][U][C][C][A][G][G][C] =  2.000;
+ int22_ar[A][U][C][C][A][U][G][C] =  1.500;
+ int22_ar[A][U][C][C][C][A][G][C] =  1.600;
+ int22_ar[A][U][C][C][C][C][G][C] =  1.600;
+ int22_ar[A][U][C][C][C][G][G][C] =  2.000;
+ int22_ar[A][U][C][C][C][U][G][C] =  1.600;
+ int22_ar[A][U][C][C][G][A][G][C] =  2.000;
+ int22_ar[A][U][C][C][G][C][G][C] =  2.000;
+ int22_ar[A][U][C][C][G][G][G][C] =  2.000;
+ int22_ar[A][U][C][C][G][U][G][C] =  2.000;
+ int22_ar[A][U][C][C][U][A][G][C] =  0.600;
+ int22_ar[A][U][C][C][U][C][G][C] =  0.600;
+ int22_ar[A][U][C][C][U][G][G][C] =  2.000;
+ int22_ar[A][U][C][C][U][U][G][C] =  0.600;
+ int22_ar[A][U][C][G][A][A][G][C] =  0.500;
+ int22_ar[A][U][C][G][A][C][G][C] =  1.400;
+ int22_ar[A][U][C][G][A][G][G][C] =  2.000;
+ int22_ar[A][U][C][G][A][U][G][C] =  1.400;
+ int22_ar[A][U][C][G][C][A][G][C] =  2.000;
+ int22_ar[A][U][C][G][C][C][G][C] =  2.000;
+ int22_ar[A][U][C][G][C][G][G][C] =  2.000;
+ int22_ar[A][U][C][G][C][U][G][C] =  2.000;
+ int22_ar[A][U][C][G][G][A][G][C] =  1.500;
+ int22_ar[A][U][C][G][G][C][G][C] =  2.100;
+ int22_ar[A][U][C][G][G][G][G][C] =  2.000;
+ int22_ar[A][U][C][G][G][U][G][C] =  2.100;
+ int22_ar[A][U][C][G][U][A][G][C] = -1.300;
+ int22_ar[A][U][C][G][U][C][G][C] = -0.300;
+ int22_ar[A][U][C][G][U][G][G][C] =  2.000;
+ int22_ar[A][U][C][G][U][U][G][C] = -0.300;
+ int22_ar[A][U][C][U][A][A][G][C] =  2.000;
+ int22_ar[A][U][C][U][A][C][G][C] =  2.000;
+ int22_ar[A][U][C][U][A][G][G][C] =  2.000;
+ int22_ar[A][U][C][U][A][U][G][C] =  2.000;
+ int22_ar[A][U][C][U][C][A][G][C] =  1.700;
+ int22_ar[A][U][C][U][C][C][G][C] =  1.600;
+ int22_ar[A][U][C][U][C][G][G][C] =  2.000;
+ int22_ar[A][U][C][U][C][U][G][C] =  1.600;
+ int22_ar[A][U][C][U][G][A][G][C] = -0.900;
+ int22_ar[A][U][C][U][G][C][G][C] =  0.100;
+ int22_ar[A][U][C][U][G][G][G][C] =  2.000;
+ int22_ar[A][U][C][U][G][U][G][C] =  0.100;
+ int22_ar[A][U][C][U][U][A][G][C] =  0.900;
+ int22_ar[A][U][C][U][U][C][G][C] =  0.800;
+ int22_ar[A][U][C][U][U][G][G][C] =  2.000;
+ int22_ar[A][U][C][U][U][U][G][C] =  0.800;
+ int22_ar[A][U][G][A][A][A][G][C] =  0.900;
+ int22_ar[A][U][G][A][A][C][G][C] =  2.000;
+ int22_ar[A][U][G][A][A][G][G][C] =  1.400;
+ int22_ar[A][U][G][A][A][U][G][C] =  1.700;
+ int22_ar[A][U][G][A][C][A][G][C] =  0.600;
+ int22_ar[A][U][G][A][C][C][G][C] =  2.000;
+ int22_ar[A][U][G][A][C][G][G][C] =  1.200;
+ int22_ar[A][U][G][A][C][U][G][C] =  0.400;
+ int22_ar[A][U][G][A][G][A][G][C] = -1.100;
+ int22_ar[A][U][G][A][G][C][G][C] =  2.000;
+ int22_ar[A][U][G][A][G][G][G][C] = -0.600;
+ int22_ar[A][U][G][A][G][U][G][C] =  0.500;
+ int22_ar[A][U][G][A][U][A][G][C] =  2.000;
+ int22_ar[A][U][G][A][U][C][G][C] =  2.000;
+ int22_ar[A][U][G][A][U][G][G][C] =  2.000;
+ int22_ar[A][U][G][A][U][U][G][C] =  2.000;
+ int22_ar[A][U][G][C][A][A][G][C] =  0.600;
+ int22_ar[A][U][G][C][A][C][G][C] =  2.000;
+ int22_ar[A][U][G][C][A][G][G][C] =  1.100;
+ int22_ar[A][U][G][C][A][U][G][C] =  0.400;
+ int22_ar[A][U][G][C][C][A][G][C] =  1.600;
+ int22_ar[A][U][G][C][C][C][G][C] =  2.000;
+ int22_ar[A][U][G][C][C][G][G][C] =  1.800;
+ int22_ar[A][U][G][C][C][U][G][C] =  1.400;
+ int22_ar[A][U][G][C][G][A][G][C] =  2.000;
+ int22_ar[A][U][G][C][G][C][G][C] =  2.000;
+ int22_ar[A][U][G][C][G][G][G][C] =  2.000;
+ int22_ar[A][U][G][C][G][U][G][C] =  2.000;
+ int22_ar[A][U][G][C][U][A][G][C] =  0.700;
+ int22_ar[A][U][G][C][U][C][G][C] =  2.000;
+ int22_ar[A][U][G][C][U][G][G][C] =  0.800;
+ int22_ar[A][U][G][C][U][U][G][C] =  0.500;
+ int22_ar[A][U][G][G][A][A][G][C] = -0.500;
+ int22_ar[A][U][G][G][A][C][G][C] =  2.000;
+ int22_ar[A][U][G][G][A][G][G][C] =  0.000;
+ int22_ar[A][U][G][G][A][U][G][C] =  1.100;
+ int22_ar[A][U][G][G][C][A][G][C] =  2.000;
+ int22_ar[A][U][G][G][C][C][G][C] =  2.000;
+ int22_ar[A][U][G][G][C][G][G][C] =  2.000;
+ int22_ar[A][U][G][G][C][U][G][C] =  2.000;
+ int22_ar[A][U][G][G][G][A][G][C] =  0.500;
+ int22_ar[A][U][G][G][G][C][G][C] =  2.000;
+ int22_ar[A][U][G][G][G][G][G][C] =  1.100;
+ int22_ar[A][U][G][G][G][U][G][C] =  1.300;
+ int22_ar[A][U][G][G][U][A][G][C] = -0.500;
+ int22_ar[A][U][G][G][U][C][G][C] =  2.000;
+ int22_ar[A][U][G][G][U][G][G][C] = -0.700;
+ int22_ar[A][U][G][G][U][U][G][C] = -2.500;
+ int22_ar[A][U][G][U][A][A][G][C] =  2.000;
+ int22_ar[A][U][G][U][A][C][G][C] =  2.000;
+ int22_ar[A][U][G][U][A][G][G][C] =  2.000;
+ int22_ar[A][U][G][U][A][U][G][C] =  2.000;
+ int22_ar[A][U][G][U][C][A][G][C] =  1.700;
+ int22_ar[A][U][G][U][C][C][G][C] =  2.000;
+ int22_ar[A][U][G][U][C][G][G][C] =  1.800;
+ int22_ar[A][U][G][U][C][U][G][C] =  1.500;
+ int22_ar[A][U][G][U][G][A][G][C] = -0.100;
+ int22_ar[A][U][G][U][G][C][G][C] =  2.000;
+ int22_ar[A][U][G][U][G][G][G][C] = -0.300;
+ int22_ar[A][U][G][U][G][U][G][C] = -2.100;
+ int22_ar[A][U][G][U][U][A][G][C] =  1.700;
+ int22_ar[A][U][G][U][U][C][G][C] =  2.000;
+ int22_ar[A][U][G][U][U][G][G][C] =  1.400;
+ int22_ar[A][U][G][U][U][U][G][C] =  1.500;
+ int22_ar[A][U][U][A][A][A][G][C] =  2.000;
+ int22_ar[A][U][U][A][A][C][G][C] =  2.400;
+ int22_ar[A][U][U][A][A][G][G][C] =  0.700;
+ int22_ar[A][U][U][A][A][U][G][C] =  2.000;
+ int22_ar[A][U][U][A][C][A][G][C] =  2.000;
+ int22_ar[A][U][U][A][C][C][G][C] =  1.600;
+ int22_ar[A][U][U][A][C][G][G][C] = -0.500;
+ int22_ar[A][U][U][A][C][U][G][C] =  0.800;
+ int22_ar[A][U][U][A][G][A][G][C] =  2.000;
+ int22_ar[A][U][U][A][G][C][G][C] =  0.800;
+ int22_ar[A][U][U][A][G][G][G][C] = -0.500;
+ int22_ar[A][U][U][A][G][U][G][C] =  0.800;
+ int22_ar[A][U][U][A][U][A][G][C] =  2.000;
+ int22_ar[A][U][U][A][U][C][G][C] =  2.000;
+ int22_ar[A][U][U][A][U][G][G][C] =  2.000;
+ int22_ar[A][U][U][A][U][U][G][C] =  2.000;
+ int22_ar[A][U][U][C][A][A][G][C] =  2.000;
+ int22_ar[A][U][U][C][A][C][G][C] =  1.500;
+ int22_ar[A][U][U][C][A][G][G][C] = -0.600;
+ int22_ar[A][U][U][C][A][U][G][C] =  0.700;
+ int22_ar[A][U][U][C][C][A][G][C] =  2.000;
+ int22_ar[A][U][U][C][C][C][G][C] =  1.600;
+ int22_ar[A][U][U][C][C][G][G][C] =  0.500;
+ int22_ar[A][U][U][C][C][U][G][C] =  0.800;
+ int22_ar[A][U][U][C][G][A][G][C] =  2.000;
+ int22_ar[A][U][U][C][G][C][G][C] =  2.000;
+ int22_ar[A][U][U][C][G][G][G][C] =  2.000;
+ int22_ar[A][U][U][C][G][U][G][C] =  2.000;
+ int22_ar[A][U][U][C][U][A][G][C] =  2.000;
+ int22_ar[A][U][U][C][U][C][G][C] =  0.600;
+ int22_ar[A][U][U][C][U][G][G][C] = -0.500;
+ int22_ar[A][U][U][C][U][U][G][C] = -0.200;
+ int22_ar[A][U][U][G][A][A][G][C] =  2.000;
+ int22_ar[A][U][U][G][A][C][G][C] =  1.400;
+ int22_ar[A][U][U][G][A][G][G][C] =  0.100;
+ int22_ar[A][U][U][G][A][U][G][C] =  1.500;
+ int22_ar[A][U][U][G][C][A][G][C] =  2.000;
+ int22_ar[A][U][U][G][C][C][G][C] =  2.000;
+ int22_ar[A][U][U][G][C][G][G][C] =  2.000;
+ int22_ar[A][U][U][G][C][U][G][C] =  2.000;
+ int22_ar[A][U][U][G][G][A][G][C] =  2.000;
+ int22_ar[A][U][U][G][G][C][G][C] =  2.100;
+ int22_ar[A][U][U][G][G][G][G][C] =  0.400;
+ int22_ar[A][U][U][G][G][U][G][C] =  1.700;
+ int22_ar[A][U][U][G][U][A][G][C] =  2.000;
+ int22_ar[A][U][U][G][U][C][G][C] = -0.300;
+ int22_ar[A][U][U][G][U][G][G][C] = -3.500;
+ int22_ar[A][U][U][G][U][U][G][C] = -0.300;
+ int22_ar[A][U][U][U][A][A][G][C] =  2.000;
+ int22_ar[A][U][U][U][A][C][G][C] =  2.000;
+ int22_ar[A][U][U][U][A][G][G][C] =  2.000;
+ int22_ar[A][U][U][U][A][U][G][C] =  2.000;
+ int22_ar[A][U][U][U][C][A][G][C] =  2.000;
+ int22_ar[A][U][U][U][C][C][G][C] =  1.600;
+ int22_ar[A][U][U][U][C][G][G][C] =  0.500;
+ int22_ar[A][U][U][U][C][U][G][C] =  0.800;
+ int22_ar[A][U][U][U][G][A][G][C] =  2.000;
+ int22_ar[A][U][U][U][G][C][G][C] =  0.100;
+ int22_ar[A][U][U][U][G][G][G][C] = -3.100;
+ int22_ar[A][U][U][U][G][U][G][C] =  0.100;
+ int22_ar[A][U][U][U][U][A][G][C] =  2.000;
+ int22_ar[A][U][U][U][U][C][G][C] =  0.800;
+ int22_ar[A][U][U][U][U][G][G][C] =  0.500;
+ int22_ar[A][U][U][U][U][U][G][C] =  0.000;
+ int22_ar[A][U][A][A][A][A][G][U] =  2.800;
+ int22_ar[A][U][A][A][A][C][G][U] =  2.600;
+ int22_ar[A][U][A][A][A][G][G][U] =  1.500;
+ int22_ar[A][U][A][A][A][U][G][U] =  2.000;
+ int22_ar[A][U][A][A][C][A][G][U] =  2.500;
+ int22_ar[A][U][A][A][C][C][G][U] =  2.400;
+ int22_ar[A][U][A][A][C][G][G][U] =  1.300;
+ int22_ar[A][U][A][A][C][U][G][U] =  2.000;
+ int22_ar[A][U][A][A][G][A][G][U] =  1.500;
+ int22_ar[A][U][A][A][G][C][G][U] =  1.400;
+ int22_ar[A][U][A][A][G][G][G][U] =  0.300;
+ int22_ar[A][U][A][A][G][U][G][U] =  2.000;
+ int22_ar[A][U][A][A][U][A][G][U] =  2.000;
+ int22_ar[A][U][A][A][U][C][G][U] =  2.000;
+ int22_ar[A][U][A][A][U][G][G][U] =  2.000;
+ int22_ar[A][U][A][A][U][U][G][U] =  2.000;
+ int22_ar[A][U][A][C][A][A][G][U] =  2.600;
+ int22_ar[A][U][A][C][A][C][G][U] =  2.500;
+ int22_ar[A][U][A][C][A][G][G][U] =  1.400;
+ int22_ar[A][U][A][C][A][U][G][U] =  2.000;
+ int22_ar[A][U][A][C][C][A][G][U] =  3.100;
+ int22_ar[A][U][A][C][C][C][G][U] =  2.300;
+ int22_ar[A][U][A][C][C][G][G][U] =  2.200;
+ int22_ar[A][U][A][C][C][U][G][U] =  2.000;
+ int22_ar[A][U][A][C][G][A][G][U] =  2.000;
+ int22_ar[A][U][A][C][G][C][G][U] =  2.000;
+ int22_ar[A][U][A][C][G][G][G][U] =  2.000;
+ int22_ar[A][U][A][C][G][U][G][U] =  2.000;
+ int22_ar[A][U][A][C][U][A][G][U] =  3.100;
+ int22_ar[A][U][A][C][U][C][G][U] =  2.300;
+ int22_ar[A][U][A][C][U][G][G][U] =  2.200;
+ int22_ar[A][U][A][C][U][U][G][U] =  2.000;
+ int22_ar[A][U][A][G][A][A][G][U] =  1.500;
+ int22_ar[A][U][A][G][A][C][G][U] =  1.400;
+ int22_ar[A][U][A][G][A][G][G][U] =  0.300;
+ int22_ar[A][U][A][G][A][U][G][U] =  2.000;
+ int22_ar[A][U][A][G][C][A][G][U] =  2.000;
+ int22_ar[A][U][A][G][C][C][G][U] =  2.000;
+ int22_ar[A][U][A][G][C][G][G][U] =  2.000;
+ int22_ar[A][U][A][G][C][U][G][U] =  2.000;
+ int22_ar[A][U][A][G][G][A][G][U] =  2.100;
+ int22_ar[A][U][A][G][G][C][G][U] =  1.900;
+ int22_ar[A][U][A][G][G][G][G][U] =  0.800;
+ int22_ar[A][U][A][G][G][U][G][U] =  2.000;
+ int22_ar[A][U][A][G][U][A][G][U] =  1.300;
+ int22_ar[A][U][A][G][U][C][G][U] =  0.200;
+ int22_ar[A][U][A][G][U][G][G][U] =  0.900;
+ int22_ar[A][U][A][G][U][U][G][U] =  2.000;
+ int22_ar[A][U][A][U][A][A][G][U] =  2.000;
+ int22_ar[A][U][A][U][A][C][G][U] =  2.000;
+ int22_ar[A][U][A][U][A][G][G][U] =  2.000;
+ int22_ar[A][U][A][U][A][U][G][U] =  2.000;
+ int22_ar[A][U][A][U][C][A][G][U] =  3.100;
+ int22_ar[A][U][A][U][C][C][G][U] =  2.300;
+ int22_ar[A][U][A][U][C][G][G][U] =  2.200;
+ int22_ar[A][U][A][U][C][U][G][U] =  2.000;
+ int22_ar[A][U][A][U][G][A][G][U] =  2.300;
+ int22_ar[A][U][A][U][G][C][G][U] =  1.200;
+ int22_ar[A][U][A][U][G][G][G][U] =  1.900;
+ int22_ar[A][U][A][U][G][U][G][U] =  2.000;
+ int22_ar[A][U][A][U][U][A][G][U] =  2.700;
+ int22_ar[A][U][A][U][U][C][G][U] =  1.500;
+ int22_ar[A][U][A][U][U][G][G][U] =  2.200;
+ int22_ar[A][U][A][U][U][U][G][U] =  2.000;
+ int22_ar[A][U][C][A][A][A][G][U] =  2.500;
+ int22_ar[A][U][C][A][A][C][G][U] =  3.100;
+ int22_ar[A][U][C][A][A][G][G][U] =  2.000;
+ int22_ar[A][U][C][A][A][U][G][U] =  3.100;
+ int22_ar[A][U][C][A][C][A][G][U] =  2.300;
+ int22_ar[A][U][C][A][C][C][G][U] =  2.200;
+ int22_ar[A][U][C][A][C][G][G][U] =  2.000;
+ int22_ar[A][U][C][A][C][U][G][U] =  2.200;
+ int22_ar[A][U][C][A][G][A][G][U] =  1.300;
+ int22_ar[A][U][C][A][G][C][G][U] =  2.200;
+ int22_ar[A][U][C][A][G][G][G][U] =  2.000;
+ int22_ar[A][U][C][A][G][U][G][U] =  2.200;
+ int22_ar[A][U][C][A][U][A][G][U] =  2.000;
+ int22_ar[A][U][C][A][U][C][G][U] =  2.000;
+ int22_ar[A][U][C][A][U][G][G][U] =  2.000;
+ int22_ar[A][U][C][A][U][U][G][U] =  2.000;
+ int22_ar[A][U][C][C][A][A][G][U] =  2.400;
+ int22_ar[A][U][C][C][A][C][G][U] =  2.300;
+ int22_ar[A][U][C][C][A][G][G][U] =  2.000;
+ int22_ar[A][U][C][C][A][U][G][U] =  2.300;
+ int22_ar[A][U][C][C][C][A][G][U] =  2.200;
+ int22_ar[A][U][C][C][C][C][G][U] =  2.200;
+ int22_ar[A][U][C][C][C][G][G][U] =  2.000;
+ int22_ar[A][U][C][C][C][U][G][U] =  2.200;
+ int22_ar[A][U][C][C][G][A][G][U] =  2.000;
+ int22_ar[A][U][C][C][G][C][G][U] =  2.000;
+ int22_ar[A][U][C][C][G][G][G][U] =  2.000;
+ int22_ar[A][U][C][C][G][U][G][U] =  2.000;
+ int22_ar[A][U][C][C][U][A][G][U] =  2.200;
+ int22_ar[A][U][C][C][U][C][G][U] =  2.200;
+ int22_ar[A][U][C][C][U][G][G][U] =  2.000;
+ int22_ar[A][U][C][C][U][U][G][U] =  2.200;
+ int22_ar[A][U][C][G][A][A][G][U] =  1.300;
+ int22_ar[A][U][C][G][A][C][G][U] =  2.200;
+ int22_ar[A][U][C][G][A][G][G][U] =  2.000;
+ int22_ar[A][U][C][G][A][U][G][U] =  2.200;
+ int22_ar[A][U][C][G][C][A][G][U] =  2.000;
+ int22_ar[A][U][C][G][C][C][G][U] =  2.000;
+ int22_ar[A][U][C][G][C][G][G][U] =  2.000;
+ int22_ar[A][U][C][G][C][U][G][U] =  2.000;
+ int22_ar[A][U][C][G][G][A][G][U] =  1.800;
+ int22_ar[A][U][C][G][G][C][G][U] =  2.400;
+ int22_ar[A][U][C][G][G][G][G][U] =  2.000;
+ int22_ar[A][U][C][G][G][U][G][U] =  2.400;
+ int22_ar[A][U][C][G][U][A][G][U] =  0.100;
+ int22_ar[A][U][C][G][U][C][G][U] =  1.000;
+ int22_ar[A][U][C][G][U][G][G][U] =  2.000;
+ int22_ar[A][U][C][G][U][U][G][U] =  1.000;
+ int22_ar[A][U][C][U][A][A][G][U] =  2.000;
+ int22_ar[A][U][C][U][A][C][G][U] =  2.000;
+ int22_ar[A][U][C][U][A][G][G][U] =  2.000;
+ int22_ar[A][U][C][U][A][U][G][U] =  2.000;
+ int22_ar[A][U][C][U][C][A][G][U] =  2.200;
+ int22_ar[A][U][C][U][C][C][G][U] =  2.200;
+ int22_ar[A][U][C][U][C][G][G][U] =  2.000;
+ int22_ar[A][U][C][U][C][U][G][U] =  2.200;
+ int22_ar[A][U][C][U][G][A][G][U] =  1.100;
+ int22_ar[A][U][C][U][G][C][G][U] =  2.000;
+ int22_ar[A][U][C][U][G][G][G][U] =  2.000;
+ int22_ar[A][U][C][U][G][U][G][U] =  2.000;
+ int22_ar[A][U][C][U][U][A][G][U] =  1.400;
+ int22_ar[A][U][C][U][U][C][G][U] =  1.400;
+ int22_ar[A][U][C][U][U][G][G][U] =  2.000;
+ int22_ar[A][U][C][U][U][U][G][U] =  1.400;
+ int22_ar[A][U][G][A][A][A][G][U] =  1.500;
+ int22_ar[A][U][G][A][A][C][G][U] =  2.000;
+ int22_ar[A][U][G][A][A][G][G][U] =  2.100;
+ int22_ar[A][U][G][A][A][U][G][U] =  2.300;
+ int22_ar[A][U][G][A][C][A][G][U] =  1.300;
+ int22_ar[A][U][G][A][C][C][G][U] =  2.000;
+ int22_ar[A][U][G][A][C][G][G][U] =  1.800;
+ int22_ar[A][U][G][A][C][U][G][U] =  1.100;
+ int22_ar[A][U][G][A][G][A][G][U] =  0.300;
+ int22_ar[A][U][G][A][G][C][G][U] =  2.000;
+ int22_ar[A][U][G][A][G][G][G][U] =  0.800;
+ int22_ar[A][U][G][A][G][U][G][U] =  1.900;
+ int22_ar[A][U][G][A][U][A][G][U] =  2.000;
+ int22_ar[A][U][G][A][U][C][G][U] =  2.000;
+ int22_ar[A][U][G][A][U][G][G][U] =  2.000;
+ int22_ar[A][U][G][A][U][U][G][U] =  2.000;
+ int22_ar[A][U][G][C][A][A][G][U] =  1.400;
+ int22_ar[A][U][G][C][A][C][G][U] =  2.000;
+ int22_ar[A][U][G][C][A][G][G][U] =  1.900;
+ int22_ar[A][U][G][C][A][U][G][U] =  1.200;
+ int22_ar[A][U][G][C][C][A][G][U] =  2.200;
+ int22_ar[A][U][G][C][C][C][G][U] =  2.000;
+ int22_ar[A][U][G][C][C][G][G][U] =  2.400;
+ int22_ar[A][U][G][C][C][U][G][U] =  2.000;
+ int22_ar[A][U][G][C][G][A][G][U] =  2.000;
+ int22_ar[A][U][G][C][G][C][G][U] =  2.000;
+ int22_ar[A][U][G][C][G][G][G][U] =  2.000;
+ int22_ar[A][U][G][C][G][U][G][U] =  2.000;
+ int22_ar[A][U][G][C][U][A][G][U] =  2.200;
+ int22_ar[A][U][G][C][U][C][G][U] =  2.000;
+ int22_ar[A][U][G][C][U][G][G][U] =  2.400;
+ int22_ar[A][U][G][C][U][U][G][U] =  2.000;
+ int22_ar[A][U][G][G][A][A][G][U] =  0.300;
+ int22_ar[A][U][G][G][A][C][G][U] =  2.000;
+ int22_ar[A][U][G][G][A][G][G][U] =  0.800;
+ int22_ar[A][U][G][G][A][U][G][U] =  1.900;
+ int22_ar[A][U][G][G][C][A][G][U] =  2.000;
+ int22_ar[A][U][G][G][C][C][G][U] =  2.000;
+ int22_ar[A][U][G][G][C][G][G][U] =  2.000;
+ int22_ar[A][U][G][G][C][U][G][U] =  2.000;
+ int22_ar[A][U][G][G][G][A][G][U] =  0.800;
+ int22_ar[A][U][G][G][G][C][G][U] =  2.000;
+ int22_ar[A][U][G][G][G][G][G][U] =  1.400;
+ int22_ar[A][U][G][G][G][U][G][U] =  1.600;
+ int22_ar[A][U][G][G][U][A][G][U] =  0.900;
+ int22_ar[A][U][G][G][U][C][G][U] =  2.000;
+ int22_ar[A][U][G][G][U][G][G][U] =  0.700;
+ int22_ar[A][U][G][G][U][U][G][U] = -1.100;
+ int22_ar[A][U][G][U][A][A][G][U] =  2.000;
+ int22_ar[A][U][G][U][A][C][G][U] =  2.000;
+ int22_ar[A][U][G][U][A][G][G][U] =  2.000;
+ int22_ar[A][U][G][U][A][U][G][U] =  2.000;
+ int22_ar[A][U][G][U][C][A][G][U] =  2.200;
+ int22_ar[A][U][G][U][C][C][G][U] =  2.000;
+ int22_ar[A][U][G][U][C][G][G][U] =  2.400;
+ int22_ar[A][U][G][U][C][U][G][U] =  2.000;
+ int22_ar[A][U][G][U][G][A][G][U] =  1.900;
+ int22_ar[A][U][G][U][G][C][G][U] =  2.000;
+ int22_ar[A][U][G][U][G][G][G][U] =  1.600;
+ int22_ar[A][U][G][U][G][U][G][U] = -0.100;
+ int22_ar[A][U][G][U][U][A][G][U] =  2.200;
+ int22_ar[A][U][G][U][U][C][G][U] =  2.000;
+ int22_ar[A][U][G][U][U][G][G][U] =  2.000;
+ int22_ar[A][U][G][U][U][U][G][U] =  2.000;
+ int22_ar[A][U][U][A][A][A][G][U] =  2.000;
+ int22_ar[A][U][U][A][A][C][G][U] =  3.100;
+ int22_ar[A][U][U][A][A][G][G][U] =  1.300;
+ int22_ar[A][U][U][A][A][U][G][U] =  2.700;
+ int22_ar[A][U][U][A][C][A][G][U] =  2.000;
+ int22_ar[A][U][U][A][C][C][G][U] =  2.200;
+ int22_ar[A][U][U][A][C][G][G][U] =  0.100;
+ int22_ar[A][U][U][A][C][U][G][U] =  1.400;
+ int22_ar[A][U][U][A][G][A][G][U] =  2.000;
+ int22_ar[A][U][U][A][G][C][G][U] =  2.200;
+ int22_ar[A][U][U][A][G][G][G][U] =  0.900;
+ int22_ar[A][U][U][A][G][U][G][U] =  2.200;
+ int22_ar[A][U][U][A][U][A][G][U] =  2.000;
+ int22_ar[A][U][U][A][U][C][G][U] =  2.000;
+ int22_ar[A][U][U][A][U][G][G][U] =  2.000;
+ int22_ar[A][U][U][A][U][U][G][U] =  2.000;
+ int22_ar[A][U][U][C][A][A][G][U] =  2.000;
+ int22_ar[A][U][U][C][A][C][G][U] =  2.300;
+ int22_ar[A][U][U][C][A][G][G][U] =  0.200;
+ int22_ar[A][U][U][C][A][U][G][U] =  1.500;
+ int22_ar[A][U][U][C][C][A][G][U] =  2.000;
+ int22_ar[A][U][U][C][C][C][G][U] =  2.200;
+ int22_ar[A][U][U][C][C][G][G][U] =  1.000;
+ int22_ar[A][U][U][C][C][U][G][U] =  1.400;
+ int22_ar[A][U][U][C][G][A][G][U] =  2.000;
+ int22_ar[A][U][U][C][G][C][G][U] =  2.000;
+ int22_ar[A][U][U][C][G][G][G][U] =  2.000;
+ int22_ar[A][U][U][C][G][U][G][U] =  2.000;
+ int22_ar[A][U][U][C][U][A][G][U] =  2.000;
+ int22_ar[A][U][U][C][U][C][G][U] =  2.200;
+ int22_ar[A][U][U][C][U][G][G][U] =  1.000;
+ int22_ar[A][U][U][C][U][U][G][U] =  1.400;
+ int22_ar[A][U][U][G][A][A][G][U] =  2.000;
+ int22_ar[A][U][U][G][A][C][G][U] =  2.200;
+ int22_ar[A][U][U][G][A][G][G][U] =  0.900;
+ int22_ar[A][U][U][G][A][U][G][U] =  2.200;
+ int22_ar[A][U][U][G][C][A][G][U] =  2.000;
+ int22_ar[A][U][U][G][C][C][G][U] =  2.000;
+ int22_ar[A][U][U][G][C][G][G][U] =  2.000;
+ int22_ar[A][U][U][G][C][U][G][U] =  2.000;
+ int22_ar[A][U][U][G][G][A][G][U] =  2.000;
+ int22_ar[A][U][U][G][G][C][G][U] =  2.400;
+ int22_ar[A][U][U][G][G][G][G][U] =  0.700;
+ int22_ar[A][U][U][G][G][U][G][U] =  2.000;
+ int22_ar[A][U][U][G][U][A][G][U] =  2.000;
+ int22_ar[A][U][U][G][U][C][G][U] =  1.000;
+ int22_ar[A][U][U][G][U][G][G][U] = -2.100;
+ int22_ar[A][U][U][G][U][U][G][U] =  1.100;
+ int22_ar[A][U][U][U][A][A][G][U] =  2.000;
+ int22_ar[A][U][U][U][A][C][G][U] =  2.000;
+ int22_ar[A][U][U][U][A][G][G][U] =  2.000;
+ int22_ar[A][U][U][U][A][U][G][U] =  2.000;
+ int22_ar[A][U][U][U][C][A][G][U] =  2.000;
+ int22_ar[A][U][U][U][C][C][G][U] =  2.200;
+ int22_ar[A][U][U][U][C][G][G][U] =  1.000;
+ int22_ar[A][U][U][U][C][U][G][U] =  1.400;
+ int22_ar[A][U][U][U][G][A][G][U] =  2.000;
+ int22_ar[A][U][U][U][G][C][G][U] =  2.000;
+ int22_ar[A][U][U][U][G][G][G][U] = -1.100;
+ int22_ar[A][U][U][U][G][U][G][U] =  2.000;
+ int22_ar[A][U][U][U][U][A][G][U] =  2.000;
+ int22_ar[A][U][U][U][U][C][G][U] =  1.400;
+ int22_ar[A][U][U][U][U][G][G][U] =  1.100;
+ int22_ar[A][U][U][U][U][U][G][U] =  0.600;
+ int22_ar[A][U][A][A][A][A][U][A] =  2.800;
+ int22_ar[A][U][A][A][A][C][U][A] =  2.600;
+ int22_ar[A][U][A][A][A][G][U][A] =  1.500;
+ int22_ar[A][U][A][A][A][U][U][A] =  2.000;
+ int22_ar[A][U][A][A][C][A][U][A] =  2.300;
+ int22_ar[A][U][A][A][C][C][U][A] =  2.200;
+ int22_ar[A][U][A][A][C][G][U][A] =  1.100;
+ int22_ar[A][U][A][A][C][U][U][A] =  2.000;
+ int22_ar[A][U][A][A][G][A][U][A] =  1.700;
+ int22_ar[A][U][A][A][G][C][U][A] =  1.600;
+ int22_ar[A][U][A][A][G][G][U][A] =  0.500;
+ int22_ar[A][U][A][A][G][U][U][A] =  2.000;
+ int22_ar[A][U][A][A][U][A][U][A] =  2.000;
+ int22_ar[A][U][A][A][U][C][U][A] =  2.000;
+ int22_ar[A][U][A][A][U][G][U][A] =  2.000;
+ int22_ar[A][U][A][A][U][U][U][A] =  2.000;
+ int22_ar[A][U][A][C][A][A][U][A] =  2.800;
+ int22_ar[A][U][A][C][A][C][U][A] =  2.600;
+ int22_ar[A][U][A][C][A][G][U][A] =  1.500;
+ int22_ar[A][U][A][C][A][U][U][A] =  2.000;
+ int22_ar[A][U][A][C][C][A][U][A] =  3.400;
+ int22_ar[A][U][A][C][C][C][U][A] =  2.600;
+ int22_ar[A][U][A][C][C][G][U][A] =  2.500;
+ int22_ar[A][U][A][C][C][U][U][A] =  2.000;
+ int22_ar[A][U][A][C][G][A][U][A] =  2.000;
+ int22_ar[A][U][A][C][G][C][U][A] =  2.000;
+ int22_ar[A][U][A][C][G][G][U][A] =  2.000;
+ int22_ar[A][U][A][C][G][U][U][A] =  2.000;
+ int22_ar[A][U][A][C][U][A][U][A] =  3.400;
+ int22_ar[A][U][A][C][U][C][U][A] =  2.600;
+ int22_ar[A][U][A][C][U][G][U][A] =  2.500;
+ int22_ar[A][U][A][C][U][U][U][A] =  2.000;
+ int22_ar[A][U][A][G][A][A][U][A] =  1.700;
+ int22_ar[A][U][A][G][A][C][U][A] =  1.600;
+ int22_ar[A][U][A][G][A][G][U][A] =  0.500;
+ int22_ar[A][U][A][G][A][U][U][A] =  2.000;
+ int22_ar[A][U][A][G][C][A][U][A] =  2.000;
+ int22_ar[A][U][A][G][C][C][U][A] =  2.000;
+ int22_ar[A][U][A][G][C][G][U][A] =  2.000;
+ int22_ar[A][U][A][G][C][U][U][A] =  2.000;
+ int22_ar[A][U][A][G][G][A][U][A] =  2.100;
+ int22_ar[A][U][A][G][G][C][U][A] =  2.000;
+ int22_ar[A][U][A][G][G][G][U][A] =  0.900;
+ int22_ar[A][U][A][G][G][U][U][A] =  2.000;
+ int22_ar[A][U][A][G][U][A][U][A] =  1.000;
+ int22_ar[A][U][A][G][U][C][U][A] = -0.200;
+ int22_ar[A][U][A][G][U][G][U][A] =  0.500;
+ int22_ar[A][U][A][G][U][U][U][A] =  2.000;
+ int22_ar[A][U][A][U][A][A][U][A] =  2.000;
+ int22_ar[A][U][A][U][A][C][U][A] =  2.000;
+ int22_ar[A][U][A][U][A][G][U][A] =  2.000;
+ int22_ar[A][U][A][U][A][U][U][A] =  2.000;
+ int22_ar[A][U][A][U][C][A][U][A] =  3.100;
+ int22_ar[A][U][A][U][C][C][U][A] =  2.300;
+ int22_ar[A][U][A][U][C][G][U][A] =  2.200;
+ int22_ar[A][U][A][U][C][U][U][A] =  2.000;
+ int22_ar[A][U][A][U][G][A][U][A] =  2.200;
+ int22_ar[A][U][A][U][G][C][U][A] =  1.100;
+ int22_ar[A][U][A][U][G][G][U][A] =  1.800;
+ int22_ar[A][U][A][U][G][U][U][A] =  2.000;
+ int22_ar[A][U][A][U][U][A][U][A] =  2.900;
+ int22_ar[A][U][A][U][U][C][U][A] =  1.800;
+ int22_ar[A][U][A][U][U][G][U][A] =  2.500;
+ int22_ar[A][U][A][U][U][U][U][A] =  2.000;
+ int22_ar[A][U][C][A][A][A][U][A] =  2.500;
+ int22_ar[A][U][C][A][A][C][U][A] =  3.100;
+ int22_ar[A][U][C][A][A][G][U][A] =  2.000;
+ int22_ar[A][U][C][A][A][U][U][A] =  3.100;
+ int22_ar[A][U][C][A][C][A][U][A] =  2.100;
+ int22_ar[A][U][C][A][C][C][U][A] =  2.000;
+ int22_ar[A][U][C][A][C][G][U][A] =  2.000;
+ int22_ar[A][U][C][A][C][U][U][A] =  2.000;
+ int22_ar[A][U][C][A][G][A][U][A] =  1.500;
+ int22_ar[A][U][C][A][G][C][U][A] =  2.400;
+ int22_ar[A][U][C][A][G][G][U][A] =  2.000;
+ int22_ar[A][U][C][A][G][U][U][A] =  2.400;
+ int22_ar[A][U][C][A][U][A][U][A] =  2.000;
+ int22_ar[A][U][C][A][U][C][U][A] =  2.000;
+ int22_ar[A][U][C][A][U][G][U][A] =  2.000;
+ int22_ar[A][U][C][A][U][U][U][A] =  2.000;
+ int22_ar[A][U][C][C][A][A][U][A] =  2.500;
+ int22_ar[A][U][C][C][A][C][U][A] =  2.500;
+ int22_ar[A][U][C][C][A][G][U][A] =  2.000;
+ int22_ar[A][U][C][C][A][U][U][A] =  2.500;
+ int22_ar[A][U][C][C][C][A][U][A] =  2.500;
+ int22_ar[A][U][C][C][C][C][U][A] =  2.500;
+ int22_ar[A][U][C][C][C][G][U][A] =  2.000;
+ int22_ar[A][U][C][C][C][U][U][A] =  2.500;
+ int22_ar[A][U][C][C][G][A][U][A] =  2.000;
+ int22_ar[A][U][C][C][G][C][U][A] =  2.000;
+ int22_ar[A][U][C][C][G][G][U][A] =  2.000;
+ int22_ar[A][U][C][C][G][U][U][A] =  2.000;
+ int22_ar[A][U][C][C][U][A][U][A] =  2.500;
+ int22_ar[A][U][C][C][U][C][U][A] =  2.500;
+ int22_ar[A][U][C][C][U][G][U][A] =  2.000;
+ int22_ar[A][U][C][C][U][U][U][A] =  2.500;
+ int22_ar[A][U][C][G][A][A][U][A] =  1.500;
+ int22_ar[A][U][C][G][A][C][U][A] =  2.400;
+ int22_ar[A][U][C][G][A][G][U][A] =  2.000;
+ int22_ar[A][U][C][G][A][U][U][A] =  2.400;
+ int22_ar[A][U][C][G][C][A][U][A] =  2.000;
+ int22_ar[A][U][C][G][C][C][U][A] =  2.000;
+ int22_ar[A][U][C][G][C][G][U][A] =  2.000;
+ int22_ar[A][U][C][G][C][U][U][A] =  2.000;
+ int22_ar[A][U][C][G][G][A][U][A] =  1.900;
+ int22_ar[A][U][C][G][G][C][U][A] =  2.400;
+ int22_ar[A][U][C][G][G][G][U][A] =  2.000;
+ int22_ar[A][U][C][G][G][U][U][A] =  2.400;
+ int22_ar[A][U][C][G][U][A][U][A] = -0.300;
+ int22_ar[A][U][C][G][U][C][U][A] =  0.700;
+ int22_ar[A][U][C][G][U][G][U][A] =  2.000;
+ int22_ar[A][U][C][G][U][U][U][A] =  0.700;
+ int22_ar[A][U][C][U][A][A][U][A] =  2.000;
+ int22_ar[A][U][C][U][A][C][U][A] =  2.000;
+ int22_ar[A][U][C][U][A][G][U][A] =  2.000;
+ int22_ar[A][U][C][U][A][U][U][A] =  2.000;
+ int22_ar[A][U][C][U][C][A][U][A] =  2.200;
+ int22_ar[A][U][C][U][C][C][U][A] =  2.200;
+ int22_ar[A][U][C][U][C][G][U][A] =  2.000;
+ int22_ar[A][U][C][U][C][U][U][A] =  2.200;
+ int22_ar[A][U][C][U][G][A][U][A] =  1.000;
+ int22_ar[A][U][C][U][G][C][U][A] =  1.900;
+ int22_ar[A][U][C][U][G][G][U][A] =  2.000;
+ int22_ar[A][U][C][U][G][U][U][A] =  1.900;
+ int22_ar[A][U][C][U][U][A][U][A] =  1.700;
+ int22_ar[A][U][C][U][U][C][U][A] =  1.600;
+ int22_ar[A][U][C][U][U][G][U][A] =  2.000;
+ int22_ar[A][U][C][U][U][U][U][A] =  1.600;
+ int22_ar[A][U][G][A][A][A][U][A] =  1.500;
+ int22_ar[A][U][G][A][A][C][U][A] =  2.000;
+ int22_ar[A][U][G][A][A][G][U][A] =  2.100;
+ int22_ar[A][U][G][A][A][U][U][A] =  2.300;
+ int22_ar[A][U][G][A][C][A][U][A] =  1.100;
+ int22_ar[A][U][G][A][C][C][U][A] =  2.000;
+ int22_ar[A][U][G][A][C][G][U][A] =  1.600;
+ int22_ar[A][U][G][A][C][U][U][A] =  0.900;
+ int22_ar[A][U][G][A][G][A][U][A] =  0.500;
+ int22_ar[A][U][G][A][G][C][U][A] =  2.000;
+ int22_ar[A][U][G][A][G][G][U][A] =  1.000;
+ int22_ar[A][U][G][A][G][U][U][A] =  2.100;
+ int22_ar[A][U][G][A][U][A][U][A] =  2.000;
+ int22_ar[A][U][G][A][U][C][U][A] =  2.000;
+ int22_ar[A][U][G][A][U][G][U][A] =  2.000;
+ int22_ar[A][U][G][A][U][U][U][A] =  2.000;
+ int22_ar[A][U][G][C][A][A][U][A] =  1.500;
+ int22_ar[A][U][G][C][A][C][U][A] =  2.000;
+ int22_ar[A][U][G][C][A][G][U][A] =  2.100;
+ int22_ar[A][U][G][C][A][U][U][A] =  1.300;
+ int22_ar[A][U][G][C][C][A][U][A] =  2.500;
+ int22_ar[A][U][G][C][C][C][U][A] =  2.000;
+ int22_ar[A][U][G][C][C][G][U][A] =  2.700;
+ int22_ar[A][U][G][C][C][U][U][A] =  2.300;
+ int22_ar[A][U][G][C][G][A][U][A] =  2.000;
+ int22_ar[A][U][G][C][G][C][U][A] =  2.000;
+ int22_ar[A][U][G][C][G][G][U][A] =  2.000;
+ int22_ar[A][U][G][C][G][U][U][A] =  2.000;
+ int22_ar[A][U][G][C][U][A][U][A] =  2.500;
+ int22_ar[A][U][G][C][U][C][U][A] =  2.000;
+ int22_ar[A][U][G][C][U][G][U][A] =  2.700;
+ int22_ar[A][U][G][C][U][U][U][A] =  2.300;
+ int22_ar[A][U][G][G][A][A][U][A] =  0.500;
+ int22_ar[A][U][G][G][A][C][U][A] =  2.000;
+ int22_ar[A][U][G][G][A][G][U][A] =  1.000;
+ int22_ar[A][U][G][G][A][U][U][A] =  2.100;
+ int22_ar[A][U][G][G][C][A][U][A] =  2.000;
+ int22_ar[A][U][G][G][C][C][U][A] =  2.000;
+ int22_ar[A][U][G][G][C][G][U][A] =  2.000;
+ int22_ar[A][U][G][G][C][U][U][A] =  2.000;
+ int22_ar[A][U][G][G][G][A][U][A] =  0.900;
+ int22_ar[A][U][G][G][G][C][U][A] =  2.000;
+ int22_ar[A][U][G][G][G][G][U][A] =  1.400;
+ int22_ar[A][U][G][G][G][U][U][A] =  1.700;
+ int22_ar[A][U][G][G][U][A][U][A] =  0.500;
+ int22_ar[A][U][G][G][U][C][U][A] =  2.000;
+ int22_ar[A][U][G][G][U][G][U][A] =  0.300;
+ int22_ar[A][U][G][G][U][U][U][A] = -1.500;
+ int22_ar[A][U][G][U][A][A][U][A] =  2.000;
+ int22_ar[A][U][G][U][A][C][U][A] =  2.000;
+ int22_ar[A][U][G][U][A][G][U][A] =  2.000;
+ int22_ar[A][U][G][U][A][U][U][A] =  2.000;
+ int22_ar[A][U][G][U][C][A][U][A] =  2.200;
+ int22_ar[A][U][G][U][C][C][U][A] =  2.000;
+ int22_ar[A][U][G][U][C][G][U][A] =  2.400;
+ int22_ar[A][U][G][U][C][U][U][A] =  2.000;
+ int22_ar[A][U][G][U][G][A][U][A] =  1.800;
+ int22_ar[A][U][G][U][G][C][U][A] =  2.000;
+ int22_ar[A][U][G][U][G][G][U][A] =  1.500;
+ int22_ar[A][U][G][U][G][U][U][A] = -0.200;
+ int22_ar[A][U][G][U][U][A][U][A] =  2.500;
+ int22_ar[A][U][G][U][U][C][U][A] =  2.000;
+ int22_ar[A][U][G][U][U][G][U][A] =  2.200;
+ int22_ar[A][U][G][U][U][U][U][A] =  2.300;
+ int22_ar[A][U][U][A][A][A][U][A] =  2.000;
+ int22_ar[A][U][U][A][A][C][U][A] =  3.100;
+ int22_ar[A][U][U][A][A][G][U][A] =  1.300;
+ int22_ar[A][U][U][A][A][U][U][A] =  2.700;
+ int22_ar[A][U][U][A][C][A][U][A] =  2.000;
+ int22_ar[A][U][U][A][C][C][U][A] =  2.000;
+ int22_ar[A][U][U][A][C][G][U][A] = -0.100;
+ int22_ar[A][U][U][A][C][U][U][A] =  1.200;
+ int22_ar[A][U][U][A][G][A][U][A] =  2.000;
+ int22_ar[A][U][U][A][G][C][U][A] =  2.400;
+ int22_ar[A][U][U][A][G][G][U][A] =  1.100;
+ int22_ar[A][U][U][A][G][U][U][A] =  2.400;
+ int22_ar[A][U][U][A][U][A][U][A] =  2.000;
+ int22_ar[A][U][U][A][U][C][U][A] =  2.000;
+ int22_ar[A][U][U][A][U][G][U][A] =  2.000;
+ int22_ar[A][U][U][A][U][U][U][A] =  2.000;
+ int22_ar[A][U][U][C][A][A][U][A] =  2.000;
+ int22_ar[A][U][U][C][A][C][U][A] =  2.500;
+ int22_ar[A][U][U][C][A][G][U][A] =  0.300;
+ int22_ar[A][U][U][C][A][U][U][A] =  1.700;
+ int22_ar[A][U][U][C][C][A][U][A] =  2.000;
+ int22_ar[A][U][U][C][C][C][U][A] =  2.500;
+ int22_ar[A][U][U][C][C][G][U][A] =  1.300;
+ int22_ar[A][U][U][C][C][U][U][A] =  1.700;
+ int22_ar[A][U][U][C][G][A][U][A] =  2.000;
+ int22_ar[A][U][U][C][G][C][U][A] =  2.000;
+ int22_ar[A][U][U][C][G][G][U][A] =  2.000;
+ int22_ar[A][U][U][C][G][U][U][A] =  2.000;
+ int22_ar[A][U][U][C][U][A][U][A] =  2.000;
+ int22_ar[A][U][U][C][U][C][U][A] =  2.500;
+ int22_ar[A][U][U][C][U][G][U][A] =  1.300;
+ int22_ar[A][U][U][C][U][U][U][A] =  1.700;
+ int22_ar[A][U][U][G][A][A][U][A] =  2.000;
+ int22_ar[A][U][U][G][A][C][U][A] =  2.400;
+ int22_ar[A][U][U][G][A][G][U][A] =  1.100;
+ int22_ar[A][U][U][G][A][U][U][A] =  2.400;
+ int22_ar[A][U][U][G][C][A][U][A] =  2.000;
+ int22_ar[A][U][U][G][C][C][U][A] =  2.000;
+ int22_ar[A][U][U][G][C][G][U][A] =  2.000;
+ int22_ar[A][U][U][G][C][U][U][A] =  2.000;
+ int22_ar[A][U][U][G][G][A][U][A] =  2.000;
+ int22_ar[A][U][U][G][G][C][U][A] =  2.400;
+ int22_ar[A][U][U][G][G][G][U][A] =  0.700;
+ int22_ar[A][U][U][G][G][U][U][A] =  2.000;
+ int22_ar[A][U][U][G][U][A][U][A] =  2.000;
+ int22_ar[A][U][U][G][U][C][U][A] =  0.700;
+ int22_ar[A][U][U][G][U][G][U][A] = -2.500;
+ int22_ar[A][U][U][G][U][U][U][A] =  0.700;
+ int22_ar[A][U][U][U][A][A][U][A] =  2.000;
+ int22_ar[A][U][U][U][A][C][U][A] =  2.000;
+ int22_ar[A][U][U][U][A][G][U][A] =  2.000;
+ int22_ar[A][U][U][U][A][U][U][A] =  2.000;
+ int22_ar[A][U][U][U][C][A][U][A] =  2.000;
+ int22_ar[A][U][U][U][C][C][U][A] =  2.200;
+ int22_ar[A][U][U][U][C][G][U][A] =  1.000;
+ int22_ar[A][U][U][U][C][U][U][A] =  1.400;
+ int22_ar[A][U][U][U][G][A][U][A] =  2.000;
+ int22_ar[A][U][U][U][G][C][U][A] =  1.900;
+ int22_ar[A][U][U][U][G][G][U][A] = -1.200;
+ int22_ar[A][U][U][U][G][U][U][A] =  1.900;
+ int22_ar[A][U][U][U][U][A][U][A] =  2.000;
+ int22_ar[A][U][U][U][U][C][U][A] =  1.600;
+ int22_ar[A][U][U][U][U][G][U][A] =  1.300;
+ int22_ar[A][U][U][U][U][U][U][A] =  0.800;
+ int22_ar[A][U][A][A][A][A][U][G] =  2.800;
+ int22_ar[A][U][A][A][A][C][U][G] =  2.600;
+ int22_ar[A][U][A][A][A][G][U][G] =  1.500;
+ int22_ar[A][U][A][A][A][U][U][G] =  2.000;
+ int22_ar[A][U][A][A][C][A][U][G] =  2.300;
+ int22_ar[A][U][A][A][C][C][U][G] =  2.200;
+ int22_ar[A][U][A][A][C][G][U][G] =  1.100;
+ int22_ar[A][U][A][A][C][U][U][G] =  2.000;
+ int22_ar[A][U][A][A][G][A][U][G] =  1.700;
+ int22_ar[A][U][A][A][G][C][U][G] =  1.600;
+ int22_ar[A][U][A][A][G][G][U][G] =  0.500;
+ int22_ar[A][U][A][A][G][U][U][G] =  2.000;
+ int22_ar[A][U][A][A][U][A][U][G] =  2.000;
+ int22_ar[A][U][A][A][U][C][U][G] =  2.000;
+ int22_ar[A][U][A][A][U][G][U][G] =  2.000;
+ int22_ar[A][U][A][A][U][U][U][G] =  2.000;
+ int22_ar[A][U][A][C][A][A][U][G] =  2.800;
+ int22_ar[A][U][A][C][A][C][U][G] =  2.600;
+ int22_ar[A][U][A][C][A][G][U][G] =  1.500;
+ int22_ar[A][U][A][C][A][U][U][G] =  2.000;
+ int22_ar[A][U][A][C][C][A][U][G] =  3.400;
+ int22_ar[A][U][A][C][C][C][U][G] =  2.600;
+ int22_ar[A][U][A][C][C][G][U][G] =  2.500;
+ int22_ar[A][U][A][C][C][U][U][G] =  2.000;
+ int22_ar[A][U][A][C][G][A][U][G] =  2.000;
+ int22_ar[A][U][A][C][G][C][U][G] =  2.000;
+ int22_ar[A][U][A][C][G][G][U][G] =  2.000;
+ int22_ar[A][U][A][C][G][U][U][G] =  2.000;
+ int22_ar[A][U][A][C][U][A][U][G] =  3.400;
+ int22_ar[A][U][A][C][U][C][U][G] =  2.600;
+ int22_ar[A][U][A][C][U][G][U][G] =  2.500;
+ int22_ar[A][U][A][C][U][U][U][G] =  2.000;
+ int22_ar[A][U][A][G][A][A][U][G] =  1.700;
+ int22_ar[A][U][A][G][A][C][U][G] =  1.600;
+ int22_ar[A][U][A][G][A][G][U][G] =  0.500;
+ int22_ar[A][U][A][G][A][U][U][G] =  2.000;
+ int22_ar[A][U][A][G][C][A][U][G] =  2.000;
+ int22_ar[A][U][A][G][C][C][U][G] =  2.000;
+ int22_ar[A][U][A][G][C][G][U][G] =  2.000;
+ int22_ar[A][U][A][G][C][U][U][G] =  2.000;
+ int22_ar[A][U][A][G][G][A][U][G] =  2.100;
+ int22_ar[A][U][A][G][G][C][U][G] =  2.000;
+ int22_ar[A][U][A][G][G][G][U][G] =  0.900;
+ int22_ar[A][U][A][G][G][U][U][G] =  2.000;
+ int22_ar[A][U][A][G][U][A][U][G] =  1.000;
+ int22_ar[A][U][A][G][U][C][U][G] = -0.200;
+ int22_ar[A][U][A][G][U][G][U][G] =  0.500;
+ int22_ar[A][U][A][G][U][U][U][G] =  2.000;
+ int22_ar[A][U][A][U][A][A][U][G] =  2.000;
+ int22_ar[A][U][A][U][A][C][U][G] =  2.000;
+ int22_ar[A][U][A][U][A][G][U][G] =  2.000;
+ int22_ar[A][U][A][U][A][U][U][G] =  2.000;
+ int22_ar[A][U][A][U][C][A][U][G] =  3.100;
+ int22_ar[A][U][A][U][C][C][U][G] =  2.300;
+ int22_ar[A][U][A][U][C][G][U][G] =  2.200;
+ int22_ar[A][U][A][U][C][U][U][G] =  2.000;
+ int22_ar[A][U][A][U][G][A][U][G] =  2.200;
+ int22_ar[A][U][A][U][G][C][U][G] =  1.100;
+ int22_ar[A][U][A][U][G][G][U][G] =  1.800;
+ int22_ar[A][U][A][U][G][U][U][G] =  2.000;
+ int22_ar[A][U][A][U][U][A][U][G] =  2.900;
+ int22_ar[A][U][A][U][U][C][U][G] =  1.800;
+ int22_ar[A][U][A][U][U][G][U][G] =  2.500;
+ int22_ar[A][U][A][U][U][U][U][G] =  2.000;
+ int22_ar[A][U][C][A][A][A][U][G] =  2.500;
+ int22_ar[A][U][C][A][A][C][U][G] =  3.100;
+ int22_ar[A][U][C][A][A][G][U][G] =  2.000;
+ int22_ar[A][U][C][A][A][U][U][G] =  3.100;
+ int22_ar[A][U][C][A][C][A][U][G] =  2.100;
+ int22_ar[A][U][C][A][C][C][U][G] =  2.000;
+ int22_ar[A][U][C][A][C][G][U][G] =  2.000;
+ int22_ar[A][U][C][A][C][U][U][G] =  2.000;
+ int22_ar[A][U][C][A][G][A][U][G] =  1.500;
+ int22_ar[A][U][C][A][G][C][U][G] =  2.400;
+ int22_ar[A][U][C][A][G][G][U][G] =  2.000;
+ int22_ar[A][U][C][A][G][U][U][G] =  2.400;
+ int22_ar[A][U][C][A][U][A][U][G] =  2.000;
+ int22_ar[A][U][C][A][U][C][U][G] =  2.000;
+ int22_ar[A][U][C][A][U][G][U][G] =  2.000;
+ int22_ar[A][U][C][A][U][U][U][G] =  2.000;
+ int22_ar[A][U][C][C][A][A][U][G] =  2.500;
+ int22_ar[A][U][C][C][A][C][U][G] =  2.500;
+ int22_ar[A][U][C][C][A][G][U][G] =  2.000;
+ int22_ar[A][U][C][C][A][U][U][G] =  2.500;
+ int22_ar[A][U][C][C][C][A][U][G] =  2.500;
+ int22_ar[A][U][C][C][C][C][U][G] =  2.500;
+ int22_ar[A][U][C][C][C][G][U][G] =  2.000;
+ int22_ar[A][U][C][C][C][U][U][G] =  2.500;
+ int22_ar[A][U][C][C][G][A][U][G] =  2.000;
+ int22_ar[A][U][C][C][G][C][U][G] =  2.000;
+ int22_ar[A][U][C][C][G][G][U][G] =  2.000;
+ int22_ar[A][U][C][C][G][U][U][G] =  2.000;
+ int22_ar[A][U][C][C][U][A][U][G] =  2.500;
+ int22_ar[A][U][C][C][U][C][U][G] =  2.500;
+ int22_ar[A][U][C][C][U][G][U][G] =  2.000;
+ int22_ar[A][U][C][C][U][U][U][G] =  2.500;
+ int22_ar[A][U][C][G][A][A][U][G] =  1.500;
+ int22_ar[A][U][C][G][A][C][U][G] =  2.400;
+ int22_ar[A][U][C][G][A][G][U][G] =  2.000;
+ int22_ar[A][U][C][G][A][U][U][G] =  2.400;
+ int22_ar[A][U][C][G][C][A][U][G] =  2.000;
+ int22_ar[A][U][C][G][C][C][U][G] =  2.000;
+ int22_ar[A][U][C][G][C][G][U][G] =  2.000;
+ int22_ar[A][U][C][G][C][U][U][G] =  2.000;
+ int22_ar[A][U][C][G][G][A][U][G] =  1.900;
+ int22_ar[A][U][C][G][G][C][U][G] =  2.400;
+ int22_ar[A][U][C][G][G][G][U][G] =  2.000;
+ int22_ar[A][U][C][G][G][U][U][G] =  2.400;
+ int22_ar[A][U][C][G][U][A][U][G] = -0.300;
+ int22_ar[A][U][C][G][U][C][U][G] =  0.700;
+ int22_ar[A][U][C][G][U][G][U][G] =  2.000;
+ int22_ar[A][U][C][G][U][U][U][G] =  0.700;
+ int22_ar[A][U][C][U][A][A][U][G] =  2.000;
+ int22_ar[A][U][C][U][A][C][U][G] =  2.000;
+ int22_ar[A][U][C][U][A][G][U][G] =  2.000;
+ int22_ar[A][U][C][U][A][U][U][G] =  2.000;
+ int22_ar[A][U][C][U][C][A][U][G] =  2.200;
+ int22_ar[A][U][C][U][C][C][U][G] =  2.200;
+ int22_ar[A][U][C][U][C][G][U][G] =  2.000;
+ int22_ar[A][U][C][U][C][U][U][G] =  2.200;
+ int22_ar[A][U][C][U][G][A][U][G] =  1.000;
+ int22_ar[A][U][C][U][G][C][U][G] =  1.900;
+ int22_ar[A][U][C][U][G][G][U][G] =  2.000;
+ int22_ar[A][U][C][U][G][U][U][G] =  1.900;
+ int22_ar[A][U][C][U][U][A][U][G] =  1.700;
+ int22_ar[A][U][C][U][U][C][U][G] =  1.600;
+ int22_ar[A][U][C][U][U][G][U][G] =  2.000;
+ int22_ar[A][U][C][U][U][U][U][G] =  1.600;
+ int22_ar[A][U][G][A][A][A][U][G] =  1.500;
+ int22_ar[A][U][G][A][A][C][U][G] =  2.000;
+ int22_ar[A][U][G][A][A][G][U][G] =  2.100;
+ int22_ar[A][U][G][A][A][U][U][G] =  2.300;
+ int22_ar[A][U][G][A][C][A][U][G] =  1.100;
+ int22_ar[A][U][G][A][C][C][U][G] =  2.000;
+ int22_ar[A][U][G][A][C][G][U][G] =  1.600;
+ int22_ar[A][U][G][A][C][U][U][G] =  0.900;
+ int22_ar[A][U][G][A][G][A][U][G] =  0.500;
+ int22_ar[A][U][G][A][G][C][U][G] =  2.000;
+ int22_ar[A][U][G][A][G][G][U][G] =  1.000;
+ int22_ar[A][U][G][A][G][U][U][G] =  2.100;
+ int22_ar[A][U][G][A][U][A][U][G] =  2.000;
+ int22_ar[A][U][G][A][U][C][U][G] =  2.000;
+ int22_ar[A][U][G][A][U][G][U][G] =  2.000;
+ int22_ar[A][U][G][A][U][U][U][G] =  2.000;
+ int22_ar[A][U][G][C][A][A][U][G] =  1.500;
+ int22_ar[A][U][G][C][A][C][U][G] =  2.000;
+ int22_ar[A][U][G][C][A][G][U][G] =  2.100;
+ int22_ar[A][U][G][C][A][U][U][G] =  1.300;
+ int22_ar[A][U][G][C][C][A][U][G] =  2.500;
+ int22_ar[A][U][G][C][C][C][U][G] =  2.000;
+ int22_ar[A][U][G][C][C][G][U][G] =  2.700;
+ int22_ar[A][U][G][C][C][U][U][G] =  2.300;
+ int22_ar[A][U][G][C][G][A][U][G] =  2.000;
+ int22_ar[A][U][G][C][G][C][U][G] =  2.000;
+ int22_ar[A][U][G][C][G][G][U][G] =  2.000;
+ int22_ar[A][U][G][C][G][U][U][G] =  2.000;
+ int22_ar[A][U][G][C][U][A][U][G] =  2.500;
+ int22_ar[A][U][G][C][U][C][U][G] =  2.000;
+ int22_ar[A][U][G][C][U][G][U][G] =  2.700;
+ int22_ar[A][U][G][C][U][U][U][G] =  2.300;
+ int22_ar[A][U][G][G][A][A][U][G] =  0.500;
+ int22_ar[A][U][G][G][A][C][U][G] =  2.000;
+ int22_ar[A][U][G][G][A][G][U][G] =  1.000;
+ int22_ar[A][U][G][G][A][U][U][G] =  2.100;
+ int22_ar[A][U][G][G][C][A][U][G] =  2.000;
+ int22_ar[A][U][G][G][C][C][U][G] =  2.000;
+ int22_ar[A][U][G][G][C][G][U][G] =  2.000;
+ int22_ar[A][U][G][G][C][U][U][G] =  2.000;
+ int22_ar[A][U][G][G][G][A][U][G] =  0.900;
+ int22_ar[A][U][G][G][G][C][U][G] =  2.000;
+ int22_ar[A][U][G][G][G][G][U][G] =  1.400;
+ int22_ar[A][U][G][G][G][U][U][G] =  1.700;
+ int22_ar[A][U][G][G][U][A][U][G] =  0.500;
+ int22_ar[A][U][G][G][U][C][U][G] =  2.000;
+ int22_ar[A][U][G][G][U][G][U][G] =  0.300;
+ int22_ar[A][U][G][G][U][U][U][G] = -1.500;
+ int22_ar[A][U][G][U][A][A][U][G] =  2.000;
+ int22_ar[A][U][G][U][A][C][U][G] =  2.000;
+ int22_ar[A][U][G][U][A][G][U][G] =  2.000;
+ int22_ar[A][U][G][U][A][U][U][G] =  2.000;
+ int22_ar[A][U][G][U][C][A][U][G] =  2.200;
+ int22_ar[A][U][G][U][C][C][U][G] =  2.000;
+ int22_ar[A][U][G][U][C][G][U][G] =  2.400;
+ int22_ar[A][U][G][U][C][U][U][G] =  2.000;
+ int22_ar[A][U][G][U][G][A][U][G] =  1.800;
+ int22_ar[A][U][G][U][G][C][U][G] =  2.000;
+ int22_ar[A][U][G][U][G][G][U][G] =  1.500;
+ int22_ar[A][U][G][U][G][U][U][G] = -0.200;
+ int22_ar[A][U][G][U][U][A][U][G] =  2.500;
+ int22_ar[A][U][G][U][U][C][U][G] =  2.000;
+ int22_ar[A][U][G][U][U][G][U][G] =  2.200;
+ int22_ar[A][U][G][U][U][U][U][G] =  2.300;
+ int22_ar[A][U][U][A][A][A][U][G] =  2.000;
+ int22_ar[A][U][U][A][A][C][U][G] =  3.100;
+ int22_ar[A][U][U][A][A][G][U][G] =  1.300;
+ int22_ar[A][U][U][A][A][U][U][G] =  2.700;
+ int22_ar[A][U][U][A][C][A][U][G] =  2.000;
+ int22_ar[A][U][U][A][C][C][U][G] =  2.000;
+ int22_ar[A][U][U][A][C][G][U][G] = -0.100;
+ int22_ar[A][U][U][A][C][U][U][G] =  1.200;
+ int22_ar[A][U][U][A][G][A][U][G] =  2.000;
+ int22_ar[A][U][U][A][G][C][U][G] =  2.400;
+ int22_ar[A][U][U][A][G][G][U][G] =  1.100;
+ int22_ar[A][U][U][A][G][U][U][G] =  2.400;
+ int22_ar[A][U][U][A][U][A][U][G] =  2.000;
+ int22_ar[A][U][U][A][U][C][U][G] =  2.000;
+ int22_ar[A][U][U][A][U][G][U][G] =  2.000;
+ int22_ar[A][U][U][A][U][U][U][G] =  2.000;
+ int22_ar[A][U][U][C][A][A][U][G] =  2.000;
+ int22_ar[A][U][U][C][A][C][U][G] =  2.500;
+ int22_ar[A][U][U][C][A][G][U][G] =  0.300;
+ int22_ar[A][U][U][C][A][U][U][G] =  1.700;
+ int22_ar[A][U][U][C][C][A][U][G] =  2.000;
+ int22_ar[A][U][U][C][C][C][U][G] =  2.500;
+ int22_ar[A][U][U][C][C][G][U][G] =  1.300;
+ int22_ar[A][U][U][C][C][U][U][G] =  1.700;
+ int22_ar[A][U][U][C][G][A][U][G] =  2.000;
+ int22_ar[A][U][U][C][G][C][U][G] =  2.000;
+ int22_ar[A][U][U][C][G][G][U][G] =  2.000;
+ int22_ar[A][U][U][C][G][U][U][G] =  2.000;
+ int22_ar[A][U][U][C][U][A][U][G] =  2.000;
+ int22_ar[A][U][U][C][U][C][U][G] =  2.500;
+ int22_ar[A][U][U][C][U][G][U][G] =  1.300;
+ int22_ar[A][U][U][C][U][U][U][G] =  1.700;
+ int22_ar[A][U][U][G][A][A][U][G] =  2.000;
+ int22_ar[A][U][U][G][A][C][U][G] =  2.400;
+ int22_ar[A][U][U][G][A][G][U][G] =  1.100;
+ int22_ar[A][U][U][G][A][U][U][G] =  2.400;
+ int22_ar[A][U][U][G][C][A][U][G] =  2.000;
+ int22_ar[A][U][U][G][C][C][U][G] =  2.000;
+ int22_ar[A][U][U][G][C][G][U][G] =  2.000;
+ int22_ar[A][U][U][G][C][U][U][G] =  2.000;
+ int22_ar[A][U][U][G][G][A][U][G] =  2.000;
+ int22_ar[A][U][U][G][G][C][U][G] =  2.400;
+ int22_ar[A][U][U][G][G][G][U][G] =  0.700;
+ int22_ar[A][U][U][G][G][U][U][G] =  2.000;
+ int22_ar[A][U][U][G][U][A][U][G] =  2.000;
+ int22_ar[A][U][U][G][U][C][U][G] =  0.700;
+ int22_ar[A][U][U][G][U][G][U][G] = -2.500;
+ int22_ar[A][U][U][G][U][U][U][G] =  0.700;
+ int22_ar[A][U][U][U][A][A][U][G] =  2.000;
+ int22_ar[A][U][U][U][A][C][U][G] =  2.000;
+ int22_ar[A][U][U][U][A][G][U][G] =  2.000;
+ int22_ar[A][U][U][U][A][U][U][G] =  2.000;
+ int22_ar[A][U][U][U][C][A][U][G] =  2.000;
+ int22_ar[A][U][U][U][C][C][U][G] =  2.200;
+ int22_ar[A][U][U][U][C][G][U][G] =  1.000;
+ int22_ar[A][U][U][U][C][U][U][G] =  1.400;
+ int22_ar[A][U][U][U][G][A][U][G] =  2.000;
+ int22_ar[A][U][U][U][G][C][U][G] =  1.900;
+ int22_ar[A][U][U][U][G][G][U][G] = -1.200;
+ int22_ar[A][U][U][U][G][U][U][G] =  1.900;
+ int22_ar[A][U][U][U][U][A][U][G] =  2.000;
+ int22_ar[A][U][U][U][U][C][U][G] =  1.600;
+ int22_ar[A][U][U][U][U][G][U][G] =  1.300;
+ int22_ar[A][U][U][U][U][U][U][G] =  0.800;
+ int22_ar[C][G][A][A][A][A][A][U] =  2.000;
+ int22_ar[C][G][A][A][A][C][A][U] =  2.400;
+ int22_ar[C][G][A][A][A][G][A][U] =  1.000;
+ int22_ar[C][G][A][A][A][U][A][U] =  2.000;
+ int22_ar[C][G][A][A][C][A][A][U] =  1.800;
+ int22_ar[C][G][A][A][C][C][A][U] =  2.100;
+ int22_ar[C][G][A][A][C][G][A][U] =  0.800;
+ int22_ar[C][G][A][A][C][U][A][U] =  2.000;
+ int22_ar[C][G][A][A][G][A][A][U] =  0.800;
+ int22_ar[C][G][A][A][G][C][A][U] =  1.100;
+ int22_ar[C][G][A][A][G][G][A][U] = -0.200;
+ int22_ar[C][G][A][A][G][U][A][U] =  2.000;
+ int22_ar[C][G][A][A][U][A][A][U] =  2.000;
+ int22_ar[C][G][A][A][U][C][A][U] =  2.000;
+ int22_ar[C][G][A][A][U][G][A][U] =  2.000;
+ int22_ar[C][G][A][A][U][U][A][U] =  2.000;
+ int22_ar[C][G][A][C][A][A][A][U] =  1.900;
+ int22_ar[C][G][A][C][A][C][A][U] =  2.200;
+ int22_ar[C][G][A][C][A][G][A][U] =  0.900;
+ int22_ar[C][G][A][C][A][U][A][U] =  2.000;
+ int22_ar[C][G][A][C][C][A][A][U] =  2.300;
+ int22_ar[C][G][A][C][C][C][A][U] =  2.100;
+ int22_ar[C][G][A][C][C][G][A][U] =  1.700;
+ int22_ar[C][G][A][C][C][U][A][U] =  2.000;
+ int22_ar[C][G][A][C][G][A][A][U] =  2.000;
+ int22_ar[C][G][A][C][G][C][A][U] =  2.000;
+ int22_ar[C][G][A][C][G][G][A][U] =  2.000;
+ int22_ar[C][G][A][C][G][U][A][U] =  2.000;
+ int22_ar[C][G][A][C][U][A][A][U] =  2.300;
+ int22_ar[C][G][A][C][U][C][A][U] =  2.100;
+ int22_ar[C][G][A][C][U][G][A][U] =  1.700;
+ int22_ar[C][G][A][C][U][U][A][U] =  2.000;
+ int22_ar[C][G][A][G][A][A][A][U] =  0.800;
+ int22_ar[C][G][A][G][A][C][A][U] =  1.100;
+ int22_ar[C][G][A][G][A][G][A][U] = -0.200;
+ int22_ar[C][G][A][G][A][U][A][U] =  2.000;
+ int22_ar[C][G][A][G][C][A][A][U] =  2.000;
+ int22_ar[C][G][A][G][C][C][A][U] =  2.000;
+ int22_ar[C][G][A][G][C][G][A][U] =  2.000;
+ int22_ar[C][G][A][G][C][U][A][U] =  2.000;
+ int22_ar[C][G][A][G][G][A][A][U] =  1.300;
+ int22_ar[C][G][A][G][G][C][A][U] =  1.700;
+ int22_ar[C][G][A][G][G][G][A][U] =  0.300;
+ int22_ar[C][G][A][G][G][U][A][U] =  2.000;
+ int22_ar[C][G][A][G][U][A][A][U] =  0.600;
+ int22_ar[C][G][A][G][U][C][A][U] =  0.000;
+ int22_ar[C][G][A][G][U][G][A][U] =  0.400;
+ int22_ar[C][G][A][G][U][U][A][U] =  2.000;
+ int22_ar[C][G][A][U][A][A][A][U] =  2.000;
+ int22_ar[C][G][A][U][A][C][A][U] =  2.000;
+ int22_ar[C][G][A][U][A][G][A][U] =  2.000;
+ int22_ar[C][G][A][U][A][U][A][U] =  2.000;
+ int22_ar[C][G][A][U][C][A][A][U] =  2.300;
+ int22_ar[C][G][A][U][C][C][A][U] =  2.100;
+ int22_ar[C][G][A][U][C][G][A][U] =  1.700;
+ int22_ar[C][G][A][U][C][U][A][U] =  2.000;
+ int22_ar[C][G][A][U][G][A][A][U] =  1.600;
+ int22_ar[C][G][A][U][G][C][A][U] =  0.900;
+ int22_ar[C][G][A][U][G][G][A][U] =  1.400;
+ int22_ar[C][G][A][U][G][U][A][U] =  2.000;
+ int22_ar[C][G][A][U][U][A][A][U] =  1.900;
+ int22_ar[C][G][A][U][U][C][A][U] =  1.300;
+ int22_ar[C][G][A][U][U][G][A][U] =  1.800;
+ int22_ar[C][G][A][U][U][U][A][U] =  2.000;
+ int22_ar[C][G][C][A][A][A][A][U] =  1.900;
+ int22_ar[C][G][C][A][A][C][A][U] =  2.800;
+ int22_ar[C][G][C][A][A][G][A][U] =  2.000;
+ int22_ar[C][G][C][A][A][U][A][U] =  2.700;
+ int22_ar[C][G][C][A][C][A][A][U] =  1.700;
+ int22_ar[C][G][C][A][C][C][A][U] =  2.000;
+ int22_ar[C][G][C][A][C][G][A][U] =  2.000;
+ int22_ar[C][G][C][A][C][U][A][U] =  1.800;
+ int22_ar[C][G][C][A][G][A][A][U] =  0.700;
+ int22_ar[C][G][C][A][G][C][A][U] =  2.000;
+ int22_ar[C][G][C][A][G][G][A][U] =  2.000;
+ int22_ar[C][G][C][A][G][U][A][U] =  1.800;
+ int22_ar[C][G][C][A][U][A][A][U] =  2.000;
+ int22_ar[C][G][C][A][U][C][A][U] =  2.000;
+ int22_ar[C][G][C][A][U][G][A][U] =  2.000;
+ int22_ar[C][G][C][A][U][U][A][U] =  2.000;
+ int22_ar[C][G][C][C][A][A][A][U] =  1.800;
+ int22_ar[C][G][C][C][A][C][A][U] =  2.100;
+ int22_ar[C][G][C][C][A][G][A][U] =  2.000;
+ int22_ar[C][G][C][C][A][U][A][U] =  1.900;
+ int22_ar[C][G][C][C][C][A][A][U] =  1.600;
+ int22_ar[C][G][C][C][C][C][A][U] =  1.900;
+ int22_ar[C][G][C][C][C][G][A][U] =  2.000;
+ int22_ar[C][G][C][C][C][U][A][U] =  1.800;
+ int22_ar[C][G][C][C][G][A][A][U] =  2.000;
+ int22_ar[C][G][C][C][G][C][A][U] =  2.000;
+ int22_ar[C][G][C][C][G][G][A][U] =  2.000;
+ int22_ar[C][G][C][C][G][U][A][U] =  2.000;
+ int22_ar[C][G][C][C][U][A][A][U] =  1.600;
+ int22_ar[C][G][C][C][U][C][A][U] =  1.900;
+ int22_ar[C][G][C][C][U][G][A][U] =  2.000;
+ int22_ar[C][G][C][C][U][U][A][U] =  1.800;
+ int22_ar[C][G][C][G][A][A][A][U] =  0.700;
+ int22_ar[C][G][C][G][A][C][A][U] =  2.000;
+ int22_ar[C][G][C][G][A][G][A][U] =  2.000;
+ int22_ar[C][G][C][G][A][U][A][U] =  1.800;
+ int22_ar[C][G][C][G][C][A][A][U] =  2.000;
+ int22_ar[C][G][C][G][C][C][A][U] =  2.000;
+ int22_ar[C][G][C][G][C][G][A][U] =  2.000;
+ int22_ar[C][G][C][G][C][U][A][U] =  2.000;
+ int22_ar[C][G][C][G][G][A][A][U] =  1.200;
+ int22_ar[C][G][C][G][G][C][A][U] =  2.100;
+ int22_ar[C][G][C][G][G][G][A][U] =  2.000;
+ int22_ar[C][G][C][G][G][U][A][U] =  2.000;
+ int22_ar[C][G][C][G][U][A][A][U] = -0.500;
+ int22_ar[C][G][C][G][U][C][A][U] =  0.800;
+ int22_ar[C][G][C][G][U][G][A][U] =  2.000;
+ int22_ar[C][G][C][G][U][U][A][U] =  0.700;
+ int22_ar[C][G][C][U][A][A][A][U] =  2.000;
+ int22_ar[C][G][C][U][A][C][A][U] =  2.000;
+ int22_ar[C][G][C][U][A][G][A][U] =  2.000;
+ int22_ar[C][G][C][U][A][U][A][U] =  2.000;
+ int22_ar[C][G][C][U][C][A][A][U] =  1.600;
+ int22_ar[C][G][C][U][C][C][A][U] =  1.900;
+ int22_ar[C][G][C][U][C][G][A][U] =  2.000;
+ int22_ar[C][G][C][U][C][U][A][U] =  1.800;
+ int22_ar[C][G][C][U][G][A][A][U] =  0.500;
+ int22_ar[C][G][C][U][G][C][A][U] =  1.800;
+ int22_ar[C][G][C][U][G][G][A][U] =  2.000;
+ int22_ar[C][G][C][U][G][U][A][U] =  1.600;
+ int22_ar[C][G][C][U][U][A][A][U] =  0.800;
+ int22_ar[C][G][C][U][U][C][A][U] =  1.100;
+ int22_ar[C][G][C][U][U][G][A][U] =  2.000;
+ int22_ar[C][G][C][U][U][U][A][U] =  1.000;
+ int22_ar[C][G][G][A][A][A][A][U] =  1.000;
+ int22_ar[C][G][G][A][A][C][A][U] =  2.000;
+ int22_ar[C][G][G][A][A][G][A][U] =  1.800;
+ int22_ar[C][G][G][A][A][U][A][U] =  1.800;
+ int22_ar[C][G][G][A][C][A][A][U] =  0.800;
+ int22_ar[C][G][G][A][C][C][A][U] =  2.000;
+ int22_ar[C][G][G][A][C][G][A][U] =  1.500;
+ int22_ar[C][G][G][A][C][U][A][U] =  0.600;
+ int22_ar[C][G][G][A][G][A][A][U] = -0.200;
+ int22_ar[C][G][G][A][G][C][A][U] =  2.000;
+ int22_ar[C][G][G][A][G][G][A][U] =  0.500;
+ int22_ar[C][G][G][A][G][U][A][U] =  1.400;
+ int22_ar[C][G][G][A][U][A][A][U] =  2.000;
+ int22_ar[C][G][G][A][U][C][A][U] =  2.000;
+ int22_ar[C][G][G][A][U][G][A][U] =  2.000;
+ int22_ar[C][G][G][A][U][U][A][U] =  2.000;
+ int22_ar[C][G][G][C][A][A][A][U] =  0.900;
+ int22_ar[C][G][G][C][A][C][A][U] =  2.000;
+ int22_ar[C][G][G][C][A][G][A][U] =  1.600;
+ int22_ar[C][G][G][C][A][U][A][U] =  0.700;
+ int22_ar[C][G][G][C][C][A][A][U] =  1.700;
+ int22_ar[C][G][G][C][C][C][A][U] =  2.000;
+ int22_ar[C][G][G][C][C][G][A][U] =  2.100;
+ int22_ar[C][G][G][C][C][U][A][U] =  1.500;
+ int22_ar[C][G][G][C][G][A][A][U] =  2.000;
+ int22_ar[C][G][G][C][G][C][A][U] =  2.000;
+ int22_ar[C][G][G][C][G][G][A][U] =  2.000;
+ int22_ar[C][G][G][C][G][U][A][U] =  2.000;
+ int22_ar[C][G][G][C][U][A][A][U] =  1.700;
+ int22_ar[C][G][G][C][U][C][A][U] =  2.000;
+ int22_ar[C][G][G][C][U][G][A][U] =  2.100;
+ int22_ar[C][G][G][C][U][U][A][U] =  1.500;
+ int22_ar[C][G][G][G][A][A][A][U] = -0.200;
+ int22_ar[C][G][G][G][A][C][A][U] =  2.000;
+ int22_ar[C][G][G][G][A][G][A][U] =  0.500;
+ int22_ar[C][G][G][G][A][U][A][U] =  1.400;
+ int22_ar[C][G][G][G][C][A][A][U] =  2.000;
+ int22_ar[C][G][G][G][C][C][A][U] =  2.000;
+ int22_ar[C][G][G][G][C][G][A][U] =  2.000;
+ int22_ar[C][G][G][G][C][U][A][U] =  2.000;
+ int22_ar[C][G][G][G][G][A][A][U] =  0.300;
+ int22_ar[C][G][G][G][G][C][A][U] =  2.000;
+ int22_ar[C][G][G][G][G][G][A][U] =  1.100;
+ int22_ar[C][G][G][G][G][U][A][U] =  1.100;
+ int22_ar[C][G][G][G][U][A][A][U] =  0.400;
+ int22_ar[C][G][G][G][U][C][A][U] =  2.000;
+ int22_ar[C][G][G][G][U][G][A][U] =  0.400;
+ int22_ar[C][G][G][G][U][U][A][U] = -1.600;
+ int22_ar[C][G][G][U][A][A][A][U] =  2.000;
+ int22_ar[C][G][G][U][A][C][A][U] =  2.000;
+ int22_ar[C][G][G][U][A][G][A][U] =  2.000;
+ int22_ar[C][G][G][U][A][U][A][U] =  2.000;
+ int22_ar[C][G][G][U][C][A][A][U] =  1.700;
+ int22_ar[C][G][G][U][C][C][A][U] =  2.000;
+ int22_ar[C][G][G][U][C][G][A][U] =  2.100;
+ int22_ar[C][G][G][U][C][U][A][U] =  1.500;
+ int22_ar[C][G][G][U][G][A][A][U] =  1.400;
+ int22_ar[C][G][G][U][G][C][A][U] =  2.000;
+ int22_ar[C][G][G][U][G][G][A][U] =  1.300;
+ int22_ar[C][G][G][U][G][U][A][U] = -0.600;
+ int22_ar[C][G][G][U][U][A][A][U] =  1.800;
+ int22_ar[C][G][G][U][U][C][A][U] =  2.000;
+ int22_ar[C][G][G][U][U][G][A][U] =  1.700;
+ int22_ar[C][G][G][U][U][U][A][U] =  1.600;
+ int22_ar[C][G][U][A][A][A][A][U] =  2.000;
+ int22_ar[C][G][U][A][A][C][A][U] =  2.700;
+ int22_ar[C][G][U][A][A][G][A][U] =  0.300;
+ int22_ar[C][G][U][A][A][U][A][U] =  2.200;
+ int22_ar[C][G][U][A][C][A][A][U] =  2.000;
+ int22_ar[C][G][U][A][C][C][A][U] =  1.800;
+ int22_ar[C][G][U][A][C][G][A][U] = -0.900;
+ int22_ar[C][G][U][A][C][U][A][U] =  0.900;
+ int22_ar[C][G][U][A][G][A][A][U] =  2.000;
+ int22_ar[C][G][U][A][G][C][A][U] =  1.800;
+ int22_ar[C][G][U][A][G][G][A][U] = -0.100;
+ int22_ar[C][G][U][A][G][U][A][U] =  1.800;
+ int22_ar[C][G][U][A][U][A][A][U] =  2.000;
+ int22_ar[C][G][U][A][U][C][A][U] =  2.000;
+ int22_ar[C][G][U][A][U][G][A][U] =  2.000;
+ int22_ar[C][G][U][A][U][U][A][U] =  2.000;
+ int22_ar[C][G][U][C][A][A][A][U] =  2.000;
+ int22_ar[C][G][U][C][A][C][A][U] =  1.900;
+ int22_ar[C][G][U][C][A][G][A][U] = -0.800;
+ int22_ar[C][G][U][C][A][U][A][U] =  1.000;
+ int22_ar[C][G][U][C][C][A][A][U] =  2.000;
+ int22_ar[C][G][U][C][C][C][A][U] =  1.800;
+ int22_ar[C][G][U][C][C][G][A][U] =  0.000;
+ int22_ar[C][G][U][C][C][U][A][U] =  0.900;
+ int22_ar[C][G][U][C][G][A][A][U] =  2.000;
+ int22_ar[C][G][U][C][G][C][A][U] =  2.000;
+ int22_ar[C][G][U][C][G][G][A][U] =  2.000;
+ int22_ar[C][G][U][C][G][U][A][U] =  2.000;
+ int22_ar[C][G][U][C][U][A][A][U] =  2.000;
+ int22_ar[C][G][U][C][U][C][A][U] =  1.800;
+ int22_ar[C][G][U][C][U][G][A][U] =  0.000;
+ int22_ar[C][G][U][C][U][U][A][U] =  0.900;
+ int22_ar[C][G][U][G][A][A][A][U] =  2.000;
+ int22_ar[C][G][U][G][A][C][A][U] =  1.800;
+ int22_ar[C][G][U][G][A][G][A][U] = -0.100;
+ int22_ar[C][G][U][G][A][U][A][U] =  1.800;
+ int22_ar[C][G][U][G][C][A][A][U] =  2.000;
+ int22_ar[C][G][U][G][C][C][A][U] =  2.000;
+ int22_ar[C][G][U][G][C][G][A][U] =  2.000;
+ int22_ar[C][G][U][G][C][U][A][U] =  2.000;
+ int22_ar[C][G][U][G][G][A][A][U] =  2.000;
+ int22_ar[C][G][U][G][G][C][A][U] =  2.000;
+ int22_ar[C][G][U][G][G][G][A][U] = -0.400;
+ int22_ar[C][G][U][G][G][U][A][U] =  1.500;
+ int22_ar[C][G][U][G][U][A][A][U] =  2.000;
+ int22_ar[C][G][U][G][U][C][A][U] =  0.700;
+ int22_ar[C][G][U][G][U][G][A][U] = -3.100;
+ int22_ar[C][G][U][G][U][U][A][U] =  0.600;
+ int22_ar[C][G][U][U][A][A][A][U] =  2.000;
+ int22_ar[C][G][U][U][A][C][A][U] =  2.000;
+ int22_ar[C][G][U][U][A][G][A][U] =  2.000;
+ int22_ar[C][G][U][U][A][U][A][U] =  2.000;
+ int22_ar[C][G][U][U][C][A][A][U] =  2.000;
+ int22_ar[C][G][U][U][C][C][A][U] =  1.800;
+ int22_ar[C][G][U][U][C][G][A][U] =  0.000;
+ int22_ar[C][G][U][U][C][U][A][U] =  0.900;
+ int22_ar[C][G][U][U][G][A][A][U] =  2.000;
+ int22_ar[C][G][U][U][G][C][A][U] =  1.600;
+ int22_ar[C][G][U][U][G][G][A][U] = -2.100;
+ int22_ar[C][G][U][U][G][U][A][U] =  1.600;
+ int22_ar[C][G][U][U][U][A][A][U] =  2.000;
+ int22_ar[C][G][U][U][U][C][A][U] =  1.000;
+ int22_ar[C][G][U][U][U][G][A][U] =  0.000;
+ int22_ar[C][G][U][U][U][U][A][U] =  0.100;
+ int22_ar[C][G][A][A][A][A][C][G] =  1.300;
+ int22_ar[C][G][A][A][A][C][C][G] =  1.600;
+ int22_ar[C][G][A][A][A][G][C][G] =  0.300;
+ int22_ar[C][G][A][A][A][U][C][G] =  2.000;
+ int22_ar[C][G][A][A][C][A][C][G] =  1.200;
+ int22_ar[C][G][A][A][C][C][C][G] =  1.500;
+ int22_ar[C][G][A][A][C][G][C][G] =  0.200;
+ int22_ar[C][G][A][A][C][U][C][G] =  2.000;
+ int22_ar[C][G][A][A][G][A][C][G] =  0.300;
+ int22_ar[C][G][A][A][G][C][C][G] =  0.600;
+ int22_ar[C][G][A][A][G][G][C][G] = -0.700;
+ int22_ar[C][G][A][A][G][U][C][G] =  2.000;
+ int22_ar[C][G][A][A][U][A][C][G] =  2.000;
+ int22_ar[C][G][A][A][U][C][C][G] =  2.000;
+ int22_ar[C][G][A][A][U][G][C][G] =  2.000;
+ int22_ar[C][G][A][A][U][U][C][G] =  2.000;
+ int22_ar[C][G][A][C][A][A][C][G] =  1.600;
+ int22_ar[C][G][A][C][A][C][C][G] =  2.000;
+ int22_ar[C][G][A][C][A][G][C][G] =  0.600;
+ int22_ar[C][G][A][C][A][U][C][G] =  2.000;
+ int22_ar[C][G][A][C][C][A][C][G] =  2.100;
+ int22_ar[C][G][A][C][C][C][C][G] =  1.800;
+ int22_ar[C][G][A][C][C][G][C][G] =  1.500;
+ int22_ar[C][G][A][C][C][U][C][G] =  2.000;
+ int22_ar[C][G][A][C][G][A][C][G] =  2.000;
+ int22_ar[C][G][A][C][G][C][C][G] =  2.000;
+ int22_ar[C][G][A][C][G][G][C][G] =  2.000;
+ int22_ar[C][G][A][C][G][U][C][G] =  2.000;
+ int22_ar[C][G][A][C][U][A][C][G] =  1.900;
+ int22_ar[C][G][A][C][U][C][C][G] =  1.700;
+ int22_ar[C][G][A][C][U][G][C][G] =  1.300;
+ int22_ar[C][G][A][C][U][U][C][G] =  2.000;
+ int22_ar[C][G][A][G][A][A][C][G] =  0.300;
+ int22_ar[C][G][A][G][A][C][C][G] =  0.600;
+ int22_ar[C][G][A][G][A][G][C][G] = -0.700;
+ int22_ar[C][G][A][G][A][U][C][G] =  2.000;
+ int22_ar[C][G][A][G][C][A][C][G] =  2.000;
+ int22_ar[C][G][A][G][C][C][C][G] =  2.000;
+ int22_ar[C][G][A][G][C][G][C][G] =  2.000;
+ int22_ar[C][G][A][G][C][U][C][G] =  2.000;
+ int22_ar[C][G][A][G][G][A][C][G] =  1.000;
+ int22_ar[C][G][A][G][G][C][C][G] =  1.400;
+ int22_ar[C][G][A][G][G][G][C][G] =  0.000;
+ int22_ar[C][G][A][G][G][U][C][G] =  2.000;
+ int22_ar[C][G][A][G][U][A][C][G] = -0.400;
+ int22_ar[C][G][A][G][U][C][C][G] = -1.100;
+ int22_ar[C][G][A][G][U][G][C][G] = -0.600;
+ int22_ar[C][G][A][G][U][U][C][G] =  2.000;
+ int22_ar[C][G][A][U][A][A][C][G] =  2.000;
+ int22_ar[C][G][A][U][A][C][C][G] =  2.000;
+ int22_ar[C][G][A][U][A][G][C][G] =  2.000;
+ int22_ar[C][G][A][U][A][U][C][G] =  2.000;
+ int22_ar[C][G][A][U][C][A][C][G] =  1.900;
+ int22_ar[C][G][A][U][C][C][C][G] =  1.700;
+ int22_ar[C][G][A][U][C][G][C][G] =  1.300;
+ int22_ar[C][G][A][U][C][U][C][G] =  2.000;
+ int22_ar[C][G][A][U][G][A][C][G] =  1.100;
+ int22_ar[C][G][A][U][G][C][C][G] =  0.400;
+ int22_ar[C][G][A][U][G][G][C][G] =  0.900;
+ int22_ar[C][G][A][U][G][U][C][G] =  2.000;
+ int22_ar[C][G][A][U][U][A][C][G] =  1.400;
+ int22_ar[C][G][A][U][U][C][C][G] =  0.800;
+ int22_ar[C][G][A][U][U][G][C][G] =  1.300;
+ int22_ar[C][G][A][U][U][U][C][G] =  2.000;
+ int22_ar[C][G][C][A][A][A][C][G] =  1.200;
+ int22_ar[C][G][C][A][A][C][C][G] =  2.100;
+ int22_ar[C][G][C][A][A][G][C][G] =  2.000;
+ int22_ar[C][G][C][A][A][U][C][G] =  1.900;
+ int22_ar[C][G][C][A][C][A][C][G] =  1.100;
+ int22_ar[C][G][C][A][C][C][C][G] =  1.400;
+ int22_ar[C][G][C][A][C][G][C][G] =  2.000;
+ int22_ar[C][G][C][A][C][U][C][G] =  1.200;
+ int22_ar[C][G][C][A][G][A][C][G] =  0.200;
+ int22_ar[C][G][C][A][G][C][C][G] =  1.500;
+ int22_ar[C][G][C][A][G][G][C][G] =  2.000;
+ int22_ar[C][G][C][A][G][U][C][G] =  1.300;
+ int22_ar[C][G][C][A][U][A][C][G] =  2.000;
+ int22_ar[C][G][C][A][U][C][C][G] =  2.000;
+ int22_ar[C][G][C][A][U][G][C][G] =  2.000;
+ int22_ar[C][G][C][A][U][U][C][G] =  2.000;
+ int22_ar[C][G][C][C][A][A][C][G] =  1.500;
+ int22_ar[C][G][C][C][A][C][C][G] =  1.800;
+ int22_ar[C][G][C][C][A][G][C][G] =  2.000;
+ int22_ar[C][G][C][C][A][U][C][G] =  1.700;
+ int22_ar[C][G][C][C][C][A][C][G] =  1.400;
+ int22_ar[C][G][C][C][C][C][C][G] =  1.700;
+ int22_ar[C][G][C][C][C][G][C][G] =  2.000;
+ int22_ar[C][G][C][C][C][U][C][G] =  1.500;
+ int22_ar[C][G][C][C][G][A][C][G] =  2.000;
+ int22_ar[C][G][C][C][G][C][C][G] =  2.000;
+ int22_ar[C][G][C][C][G][G][C][G] =  2.000;
+ int22_ar[C][G][C][C][G][U][C][G] =  2.000;
+ int22_ar[C][G][C][C][U][A][C][G] =  1.200;
+ int22_ar[C][G][C][C][U][C][C][G] =  1.500;
+ int22_ar[C][G][C][C][U][G][C][G] =  2.000;
+ int22_ar[C][G][C][C][U][U][C][G] =  1.400;
+ int22_ar[C][G][C][G][A][A][C][G] =  0.200;
+ int22_ar[C][G][C][G][A][C][C][G] =  1.500;
+ int22_ar[C][G][C][G][A][G][C][G] =  2.000;
+ int22_ar[C][G][C][G][A][U][C][G] =  1.300;
+ int22_ar[C][G][C][G][C][A][C][G] =  2.000;
+ int22_ar[C][G][C][G][C][C][C][G] =  2.000;
+ int22_ar[C][G][C][G][C][G][C][G] =  2.000;
+ int22_ar[C][G][C][G][C][U][C][G] =  2.000;
+ int22_ar[C][G][C][G][G][A][C][G] =  0.900;
+ int22_ar[C][G][C][G][G][C][C][G] =  1.800;
+ int22_ar[C][G][C][G][G][G][C][G] =  2.000;
+ int22_ar[C][G][C][G][G][U][C][G] =  1.700;
+ int22_ar[C][G][C][G][U][A][C][G] = -1.500;
+ int22_ar[C][G][C][G][U][C][C][G] = -0.200;
+ int22_ar[C][G][C][G][U][G][C][G] =  2.000;
+ int22_ar[C][G][C][G][U][U][C][G] = -0.400;
+ int22_ar[C][G][C][U][A][A][C][G] =  2.000;
+ int22_ar[C][G][C][U][A][C][C][G] =  2.000;
+ int22_ar[C][G][C][U][A][G][C][G] =  2.000;
+ int22_ar[C][G][C][U][A][U][C][G] =  2.000;
+ int22_ar[C][G][C][U][C][A][C][G] =  1.200;
+ int22_ar[C][G][C][U][C][C][C][G] =  1.500;
+ int22_ar[C][G][C][U][C][G][C][G] =  2.000;
+ int22_ar[C][G][C][U][C][U][C][G] =  1.400;
+ int22_ar[C][G][C][U][G][A][C][G] =  0.000;
+ int22_ar[C][G][C][U][G][C][C][G] =  1.300;
+ int22_ar[C][G][C][U][G][G][C][G] =  2.000;
+ int22_ar[C][G][C][U][G][U][C][G] =  1.100;
+ int22_ar[C][G][C][U][U][A][C][G] =  0.300;
+ int22_ar[C][G][C][U][U][C][C][G] =  0.600;
+ int22_ar[C][G][C][U][U][G][C][G] =  2.000;
+ int22_ar[C][G][C][U][U][U][C][G] =  0.500;
+ int22_ar[C][G][G][A][A][A][C][G] =  0.300;
+ int22_ar[C][G][G][A][A][C][C][G] =  2.000;
+ int22_ar[C][G][G][A][A][G][C][G] =  1.000;
+ int22_ar[C][G][G][A][A][U][C][G] =  1.100;
+ int22_ar[C][G][G][A][C][A][C][G] =  0.200;
+ int22_ar[C][G][G][A][C][C][C][G] =  2.000;
+ int22_ar[C][G][G][A][C][G][C][G] =  0.900;
+ int22_ar[C][G][G][A][C][U][C][G] =  0.000;
+ int22_ar[C][G][G][A][G][A][C][G] = -0.700;
+ int22_ar[C][G][G][A][G][C][C][G] =  2.000;
+ int22_ar[C][G][G][A][G][G][C][G] =  0.000;
+ int22_ar[C][G][G][A][G][U][C][G] =  0.900;
+ int22_ar[C][G][G][A][U][A][C][G] =  2.000;
+ int22_ar[C][G][G][A][U][C][C][G] =  2.000;
+ int22_ar[C][G][G][A][U][G][C][G] =  2.000;
+ int22_ar[C][G][G][A][U][U][C][G] =  2.000;
+ int22_ar[C][G][G][C][A][A][C][G] =  0.600;
+ int22_ar[C][G][G][C][A][C][C][G] =  2.000;
+ int22_ar[C][G][G][C][A][G][C][G] =  1.400;
+ int22_ar[C][G][G][C][A][U][C][G] =  0.400;
+ int22_ar[C][G][G][C][C][A][C][G] =  1.500;
+ int22_ar[C][G][G][C][C][C][C][G] =  2.000;
+ int22_ar[C][G][G][C][C][G][C][G] =  1.800;
+ int22_ar[C][G][G][C][C][U][C][G] =  1.300;
+ int22_ar[C][G][G][C][G][A][C][G] =  2.000;
+ int22_ar[C][G][G][C][G][C][C][G] =  2.000;
+ int22_ar[C][G][G][C][G][G][C][G] =  2.000;
+ int22_ar[C][G][G][C][G][U][C][G] =  2.000;
+ int22_ar[C][G][G][C][U][A][C][G] =  1.300;
+ int22_ar[C][G][G][C][U][C][C][G] =  2.000;
+ int22_ar[C][G][G][C][U][G][C][G] =  1.700;
+ int22_ar[C][G][G][C][U][U][C][G] =  1.100;
+ int22_ar[C][G][G][G][A][A][C][G] = -0.700;
+ int22_ar[C][G][G][G][A][C][C][G] =  2.000;
+ int22_ar[C][G][G][G][A][G][C][G] =  0.000;
+ int22_ar[C][G][G][G][A][U][C][G] =  0.900;
+ int22_ar[C][G][G][G][C][A][C][G] =  2.000;
+ int22_ar[C][G][G][G][C][C][C][G] =  2.000;
+ int22_ar[C][G][G][G][C][G][C][G] =  2.000;
+ int22_ar[C][G][G][G][C][U][C][G] =  2.000;
+ int22_ar[C][G][G][G][G][A][C][G] =  0.000;
+ int22_ar[C][G][G][G][G][C][C][G] =  2.000;
+ int22_ar[C][G][G][G][G][G][C][G] =  0.800;
+ int22_ar[C][G][G][G][G][U][C][G] =  0.900;
+ int22_ar[C][G][G][G][U][A][C][G] = -0.600;
+ int22_ar[C][G][G][G][U][C][C][G] =  2.000;
+ int22_ar[C][G][G][G][U][G][C][G] = -0.700;
+ int22_ar[C][G][G][G][U][U][C][G] = -2.600;
+ int22_ar[C][G][G][U][A][A][C][G] =  2.000;
+ int22_ar[C][G][G][U][A][C][C][G] =  2.000;
+ int22_ar[C][G][G][U][A][G][C][G] =  2.000;
+ int22_ar[C][G][G][U][A][U][C][G] =  2.000;
+ int22_ar[C][G][G][U][C][A][C][G] =  1.300;
+ int22_ar[C][G][G][U][C][C][C][G] =  2.000;
+ int22_ar[C][G][G][U][C][G][C][G] =  1.700;
+ int22_ar[C][G][G][U][C][U][C][G] =  1.100;
+ int22_ar[C][G][G][U][G][A][C][G] =  0.900;
+ int22_ar[C][G][G][U][G][C][C][G] =  2.000;
+ int22_ar[C][G][G][U][G][G][C][G] =  0.900;
+ int22_ar[C][G][G][U][G][U][C][G] = -1.100;
+ int22_ar[C][G][G][U][U][A][C][G] =  1.300;
+ int22_ar[C][G][G][U][U][C][C][G] =  2.000;
+ int22_ar[C][G][G][U][U][G][C][G] =  1.200;
+ int22_ar[C][G][G][U][U][U][C][G] =  1.100;
+ int22_ar[C][G][U][A][A][A][C][G] =  2.000;
+ int22_ar[C][G][U][A][A][C][C][G] =  1.900;
+ int22_ar[C][G][U][A][A][G][C][G] = -0.400;
+ int22_ar[C][G][U][A][A][U][C][G] =  1.400;
+ int22_ar[C][G][U][A][C][A][C][G] =  2.000;
+ int22_ar[C][G][U][A][C][C][C][G] =  1.200;
+ int22_ar[C][G][U][A][C][G][C][G] = -1.500;
+ int22_ar[C][G][U][A][C][U][C][G] =  0.300;
+ int22_ar[C][G][U][A][G][A][C][G] =  2.000;
+ int22_ar[C][G][U][A][G][C][C][G] =  1.300;
+ int22_ar[C][G][U][A][G][G][C][G] = -0.600;
+ int22_ar[C][G][U][A][G][U][C][G] =  1.300;
+ int22_ar[C][G][U][A][U][A][C][G] =  2.000;
+ int22_ar[C][G][U][A][U][C][C][G] =  2.000;
+ int22_ar[C][G][U][A][U][G][C][G] =  2.000;
+ int22_ar[C][G][U][A][U][U][C][G] =  2.000;
+ int22_ar[C][G][U][C][A][A][C][G] =  2.000;
+ int22_ar[C][G][U][C][A][C][C][G] =  1.700;
+ int22_ar[C][G][U][C][A][G][C][G] = -1.100;
+ int22_ar[C][G][U][C][A][U][C][G] =  0.800;
+ int22_ar[C][G][U][C][C][A][C][G] =  2.000;
+ int22_ar[C][G][U][C][C][C][C][G] =  1.500;
+ int22_ar[C][G][U][C][C][G][C][G] = -0.200;
+ int22_ar[C][G][U][C][C][U][C][G] =  0.600;
+ int22_ar[C][G][U][C][G][A][C][G] =  2.000;
+ int22_ar[C][G][U][C][G][C][C][G] =  2.000;
+ int22_ar[C][G][U][C][G][G][C][G] =  2.000;
+ int22_ar[C][G][U][C][G][U][C][G] =  2.000;
+ int22_ar[C][G][U][C][U][A][C][G] =  2.000;
+ int22_ar[C][G][U][C][U][C][C][G] =  1.400;
+ int22_ar[C][G][U][C][U][G][C][G] = -0.400;
+ int22_ar[C][G][U][C][U][U][C][G] =  0.500;
+ int22_ar[C][G][U][G][A][A][C][G] =  2.000;
+ int22_ar[C][G][U][G][A][C][C][G] =  1.300;
+ int22_ar[C][G][U][G][A][G][C][G] = -0.600;
+ int22_ar[C][G][U][G][A][U][C][G] =  1.300;
+ int22_ar[C][G][U][G][C][A][C][G] =  2.000;
+ int22_ar[C][G][U][G][C][C][C][G] =  2.000;
+ int22_ar[C][G][U][G][C][G][C][G] =  2.000;
+ int22_ar[C][G][U][G][C][U][C][G] =  2.000;
+ int22_ar[C][G][U][G][G][A][C][G] =  2.000;
+ int22_ar[C][G][U][G][G][C][C][G] =  1.700;
+ int22_ar[C][G][U][G][G][G][C][G] = -0.700;
+ int22_ar[C][G][U][G][G][U][C][G] =  1.200;
+ int22_ar[C][G][U][G][U][A][C][G] =  2.000;
+ int22_ar[C][G][U][G][U][C][C][G] = -0.400;
+ int22_ar[C][G][U][G][U][G][C][G] = -4.200;
+ int22_ar[C][G][U][G][U][U][C][G] = -0.500;
+ int22_ar[C][G][U][U][A][A][C][G] =  2.000;
+ int22_ar[C][G][U][U][A][C][C][G] =  2.000;
+ int22_ar[C][G][U][U][A][G][C][G] =  2.000;
+ int22_ar[C][G][U][U][A][U][C][G] =  2.000;
+ int22_ar[C][G][U][U][C][A][C][G] =  2.000;
+ int22_ar[C][G][U][U][C][C][C][G] =  1.400;
+ int22_ar[C][G][U][U][C][G][C][G] = -0.400;
+ int22_ar[C][G][U][U][C][U][C][G] =  0.500;
+ int22_ar[C][G][U][U][G][A][C][G] =  2.000;
+ int22_ar[C][G][U][U][G][C][C][G] =  1.100;
+ int22_ar[C][G][U][U][G][G][C][G] = -2.600;
+ int22_ar[C][G][U][U][G][U][C][G] =  1.100;
+ int22_ar[C][G][U][U][U][A][C][G] =  2.000;
+ int22_ar[C][G][U][U][U][C][C][G] =  0.500;
+ int22_ar[C][G][U][U][U][G][C][G] = -0.500;
+ int22_ar[C][G][U][U][U][U][C][G] = -0.400;
+ int22_ar[C][G][A][A][A][A][G][C] =  0.500;
+ int22_ar[C][G][A][A][A][C][G][C] =  0.600;
+ int22_ar[C][G][A][A][A][G][G][C] =  0.000;
+ int22_ar[C][G][A][A][A][U][G][C] =  2.000;
+ int22_ar[C][G][A][A][C][A][G][C] =  1.100;
+ int22_ar[C][G][A][A][C][C][G][C] =  1.500;
+ int22_ar[C][G][A][A][C][G][G][C] = -0.700;
+ int22_ar[C][G][A][A][C][U][G][C] =  2.000;
+ int22_ar[C][G][A][A][G][A][G][C] = -0.300;
+ int22_ar[C][G][A][A][G][C][G][C] =  0.100;
+ int22_ar[C][G][A][A][G][G][G][C] = -1.600;
+ int22_ar[C][G][A][A][G][U][G][C] =  2.000;
+ int22_ar[C][G][A][A][U][A][G][C] =  2.000;
+ int22_ar[C][G][A][A][U][C][G][C] =  2.000;
+ int22_ar[C][G][A][A][U][G][G][C] =  2.000;
+ int22_ar[C][G][A][A][U][U][G][C] =  2.000;
+ int22_ar[C][G][A][C][A][A][G][C] =  1.100;
+ int22_ar[C][G][A][C][A][C][G][C] =  1.100;
+ int22_ar[C][G][A][C][A][G][G][C] = -1.000;
+ int22_ar[C][G][A][C][A][U][G][C] =  2.000;
+ int22_ar[C][G][A][C][C][A][G][C] =  1.700;
+ int22_ar[C][G][A][C][C][C][G][C] =  1.500;
+ int22_ar[C][G][A][C][C][G][G][C] = -0.600;
+ int22_ar[C][G][A][C][C][U][G][C] =  2.000;
+ int22_ar[C][G][A][C][G][A][G][C] =  2.000;
+ int22_ar[C][G][A][C][G][C][G][C] =  2.000;
+ int22_ar[C][G][A][C][G][G][G][C] =  2.000;
+ int22_ar[C][G][A][C][G][U][G][C] =  2.000;
+ int22_ar[C][G][A][C][U][A][G][C] =  0.700;
+ int22_ar[C][G][A][C][U][C][G][C] =  0.500;
+ int22_ar[C][G][A][C][U][G][G][C] =  0.200;
+ int22_ar[C][G][A][C][U][U][G][C] =  2.000;
+ int22_ar[C][G][A][G][A][A][G][C] =  0.400;
+ int22_ar[C][G][A][G][A][C][G][C] =  0.500;
+ int22_ar[C][G][A][G][A][G][G][C] = -0.700;
+ int22_ar[C][G][A][G][A][U][G][C] =  2.000;
+ int22_ar[C][G][A][G][C][A][G][C] =  2.000;
+ int22_ar[C][G][A][G][C][C][G][C] =  2.000;
+ int22_ar[C][G][A][G][C][G][G][C] =  2.000;
+ int22_ar[C][G][A][G][C][U][G][C] =  2.000;
+ int22_ar[C][G][A][G][G][A][G][C] =  1.000;
+ int22_ar[C][G][A][G][G][C][G][C] =  1.400;
+ int22_ar[C][G][A][G][G][G][G][C] =  0.000;
+ int22_ar[C][G][A][G][G][U][G][C] =  2.000;
+ int22_ar[C][G][A][G][U][A][G][C] =  0.100;
+ int22_ar[C][G][A][G][U][C][G][C] = -0.700;
+ int22_ar[C][G][A][G][U][G][G][C] = -0.800;
+ int22_ar[C][G][A][G][U][U][G][C] =  2.000;
+ int22_ar[C][G][A][U][A][A][G][C] =  2.000;
+ int22_ar[C][G][A][U][A][C][G][C] =  2.000;
+ int22_ar[C][G][A][U][A][G][G][C] =  2.000;
+ int22_ar[C][G][A][U][A][U][G][C] =  2.000;
+ int22_ar[C][G][A][U][C][A][G][C] =  1.800;
+ int22_ar[C][G][A][U][C][C][G][C] =  1.500;
+ int22_ar[C][G][A][U][C][G][G][C] =  1.200;
+ int22_ar[C][G][A][U][C][U][G][C] =  2.000;
+ int22_ar[C][G][A][U][G][A][G][C] = -0.500;
+ int22_ar[C][G][A][U][G][C][G][C] = -0.600;
+ int22_ar[C][G][A][U][G][G][G][C] = -0.600;
+ int22_ar[C][G][A][U][G][U][G][C] =  2.000;
+ int22_ar[C][G][A][U][U][A][G][C] =  1.500;
+ int22_ar[C][G][A][U][U][C][G][C] =  0.000;
+ int22_ar[C][G][A][U][U][G][G][C] =  0.900;
+ int22_ar[C][G][A][U][U][U][G][C] =  2.000;
+ int22_ar[C][G][C][A][A][A][G][C] =  1.300;
+ int22_ar[C][G][C][A][A][C][G][C] =  2.200;
+ int22_ar[C][G][C][A][A][G][G][C] =  2.000;
+ int22_ar[C][G][C][A][A][U][G][C] =  2.000;
+ int22_ar[C][G][C][A][C][A][G][C] =  1.000;
+ int22_ar[C][G][C][A][C][C][G][C] =  1.300;
+ int22_ar[C][G][C][A][C][G][G][C] =  2.000;
+ int22_ar[C][G][C][A][C][U][G][C] =  1.200;
+ int22_ar[C][G][C][A][G][A][G][C] = -0.700;
+ int22_ar[C][G][C][A][G][C][G][C] =  0.700;
+ int22_ar[C][G][C][A][G][G][G][C] =  2.000;
+ int22_ar[C][G][C][A][G][U][G][C] =  0.400;
+ int22_ar[C][G][C][A][U][A][G][C] =  2.000;
+ int22_ar[C][G][C][A][U][C][G][C] =  2.000;
+ int22_ar[C][G][C][A][U][G][G][C] =  2.000;
+ int22_ar[C][G][C][A][U][U][G][C] =  2.000;
+ int22_ar[C][G][C][C][A][A][G][C] =  1.000;
+ int22_ar[C][G][C][C][A][C][G][C] =  1.900;
+ int22_ar[C][G][C][C][A][G][G][C] =  2.000;
+ int22_ar[C][G][C][C][A][U][G][C] =  1.100;
+ int22_ar[C][G][C][C][C][A][G][C] =  1.000;
+ int22_ar[C][G][C][C][C][C][G][C] =  1.300;
+ int22_ar[C][G][C][C][C][G][G][C] =  2.000;
+ int22_ar[C][G][C][C][C][U][G][C] =  1.200;
+ int22_ar[C][G][C][C][G][A][G][C] =  2.000;
+ int22_ar[C][G][C][C][G][C][G][C] =  2.000;
+ int22_ar[C][G][C][C][G][G][G][C] =  2.000;
+ int22_ar[C][G][C][C][G][U][G][C] =  2.000;
+ int22_ar[C][G][C][C][U][A][G][C] =  0.000;
+ int22_ar[C][G][C][C][U][C][G][C] =  0.300;
+ int22_ar[C][G][C][C][U][G][G][C] =  2.000;
+ int22_ar[C][G][C][C][U][U][G][C] =  1.700;
+ int22_ar[C][G][C][G][A][A][G][C] =  0.700;
+ int22_ar[C][G][C][G][A][C][G][C] =  0.700;
+ int22_ar[C][G][C][G][A][G][G][C] =  2.000;
+ int22_ar[C][G][C][G][A][U][G][C] =  1.000;
+ int22_ar[C][G][C][G][C][A][G][C] =  2.000;
+ int22_ar[C][G][C][G][C][C][G][C] =  2.000;
+ int22_ar[C][G][C][G][C][G][G][C] =  2.000;
+ int22_ar[C][G][C][G][C][U][G][C] =  2.000;
+ int22_ar[C][G][C][G][G][A][G][C] =  0.900;
+ int22_ar[C][G][C][G][G][C][G][C] =  1.800;
+ int22_ar[C][G][C][G][G][G][G][C] =  2.000;
+ int22_ar[C][G][C][G][G][U][G][C] =  1.700;
+ int22_ar[C][G][C][G][U][A][G][C] = -1.900;
+ int22_ar[C][G][C][G][U][C][G][C] = -0.300;
+ int22_ar[C][G][C][G][U][G][G][C] =  2.000;
+ int22_ar[C][G][C][G][U][U][G][C] = -0.700;
+ int22_ar[C][G][C][U][A][A][G][C] =  2.000;
+ int22_ar[C][G][C][U][A][C][G][C] =  2.000;
+ int22_ar[C][G][C][U][A][G][G][C] =  2.000;
+ int22_ar[C][G][C][U][A][U][G][C] =  2.000;
+ int22_ar[C][G][C][U][C][A][G][C] =  1.100;
+ int22_ar[C][G][C][U][C][C][G][C] =  1.400;
+ int22_ar[C][G][C][U][C][G][G][C] =  2.000;
+ int22_ar[C][G][C][U][C][U][G][C] =  1.200;
+ int22_ar[C][G][C][U][G][A][G][C] = -1.500;
+ int22_ar[C][G][C][U][G][C][G][C] = -0.200;
+ int22_ar[C][G][C][U][G][G][G][C] =  2.000;
+ int22_ar[C][G][C][U][G][U][G][C] = -0.300;
+ int22_ar[C][G][C][U][U][A][G][C] = -0.200;
+ int22_ar[C][G][C][U][U][C][G][C] = -0.100;
+ int22_ar[C][G][C][U][U][G][G][C] =  2.000;
+ int22_ar[C][G][C][U][U][U][G][C] =  0.200;
+ int22_ar[C][G][G][A][A][A][G][C] = -0.200;
+ int22_ar[C][G][G][A][A][C][G][C] =  2.000;
+ int22_ar[C][G][G][A][A][G][G][C] =  1.100;
+ int22_ar[C][G][G][A][A][U][G][C] =  0.900;
+ int22_ar[C][G][G][A][C][A][G][C] = -0.400;
+ int22_ar[C][G][G][A][C][C][G][C] =  2.000;
+ int22_ar[C][G][G][A][C][G][G][C] =  0.900;
+ int22_ar[C][G][G][A][C][U][G][C] =  0.000;
+ int22_ar[C][G][G][A][G][A][G][C] = -1.700;
+ int22_ar[C][G][G][A][G][C][G][C] =  2.000;
+ int22_ar[C][G][G][A][G][G][G][C] = -0.900;
+ int22_ar[C][G][G][A][G][U][G][C] =  0.300;
+ int22_ar[C][G][G][A][U][A][G][C] =  2.000;
+ int22_ar[C][G][G][A][U][C][G][C] =  2.000;
+ int22_ar[C][G][G][A][U][G][G][C] =  2.000;
+ int22_ar[C][G][G][A][U][U][G][C] =  2.000;
+ int22_ar[C][G][G][C][A][A][G][C] =  0.700;
+ int22_ar[C][G][G][C][A][C][G][C] =  2.000;
+ int22_ar[C][G][G][C][A][G][G][C] =  0.800;
+ int22_ar[C][G][G][C][A][U][G][C] = -0.100;
+ int22_ar[C][G][G][C][C][A][G][C] =  1.100;
+ int22_ar[C][G][G][C][C][C][G][C] =  2.000;
+ int22_ar[C][G][G][C][C][G][G][C] =  1.500;
+ int22_ar[C][G][G][C][C][U][G][C] =  1.000;
+ int22_ar[C][G][G][C][G][A][G][C] =  2.000;
+ int22_ar[C][G][G][C][G][C][G][C] =  2.000;
+ int22_ar[C][G][G][C][G][G][G][C] =  2.000;
+ int22_ar[C][G][G][C][G][U][G][C] =  2.000;
+ int22_ar[C][G][G][C][U][A][G][C] =  0.200;
+ int22_ar[C][G][G][C][U][C][G][C] =  2.000;
+ int22_ar[C][G][G][C][U][G][G][C] =  0.500;
+ int22_ar[C][G][G][C][U][U][G][C] =  0.000;
+ int22_ar[C][G][G][G][A][A][G][C] = -0.500;
+ int22_ar[C][G][G][G][A][C][G][C] =  2.000;
+ int22_ar[C][G][G][G][A][G][G][C] = -0.200;
+ int22_ar[C][G][G][G][A][U][G][C] =  0.600;
+ int22_ar[C][G][G][G][C][A][G][C] =  2.000;
+ int22_ar[C][G][G][G][C][C][G][C] =  2.000;
+ int22_ar[C][G][G][G][C][G][G][C] =  2.000;
+ int22_ar[C][G][G][G][C][U][G][C] =  2.000;
+ int22_ar[C][G][G][G][G][A][G][C] =  0.000;
+ int22_ar[C][G][G][G][G][C][G][C] =  2.000;
+ int22_ar[C][G][G][G][G][G][G][C] =  0.800;
+ int22_ar[C][G][G][G][G][U][G][C] =  0.900;
+ int22_ar[C][G][G][G][U][A][G][C] = -0.900;
+ int22_ar[C][G][G][G][U][C][G][C] =  2.000;
+ int22_ar[C][G][G][G][U][G][G][C] = -1.000;
+ int22_ar[C][G][G][G][U][U][G][C] = -3.000;
+ int22_ar[C][G][G][U][A][A][G][C] =  2.000;
+ int22_ar[C][G][G][U][A][C][G][C] =  2.000;
+ int22_ar[C][G][G][U][A][G][G][C] =  2.000;
+ int22_ar[C][G][G][U][A][U][G][C] =  2.000;
+ int22_ar[C][G][G][U][C][A][G][C] =  1.200;
+ int22_ar[C][G][G][U][C][C][G][C] =  2.000;
+ int22_ar[C][G][G][U][C][G][G][C] =  1.500;
+ int22_ar[C][G][G][U][C][U][G][C] =  1.000;
+ int22_ar[C][G][G][U][G][A][G][C] = -1.300;
+ int22_ar[C][G][G][U][G][C][G][C] =  2.000;
+ int22_ar[C][G][G][U][G][G][G][C] = -0.600;
+ int22_ar[C][G][G][U][G][U][G][C] = -2.400;
+ int22_ar[C][G][G][U][U][A][G][C] =  0.900;
+ int22_ar[C][G][G][U][U][C][G][C] =  2.000;
+ int22_ar[C][G][G][U][U][G][G][C] =  1.100;
+ int22_ar[C][G][G][U][U][U][G][C] =  0.600;
+ int22_ar[C][G][U][A][A][A][G][C] =  2.000;
+ int22_ar[C][G][U][A][A][C][G][C] =  2.000;
+ int22_ar[C][G][U][A][A][G][G][C] = -0.100;
+ int22_ar[C][G][U][A][A][U][G][C] =  1.400;
+ int22_ar[C][G][U][A][C][A][G][C] =  2.000;
+ int22_ar[C][G][U][A][C][C][G][C] =  1.200;
+ int22_ar[C][G][U][A][C][G][G][C] = -1.600;
+ int22_ar[C][G][U][A][C][U][G][C] =  0.300;
+ int22_ar[C][G][U][A][G][A][G][C] =  2.000;
+ int22_ar[C][G][U][A][G][C][G][C] =  0.400;
+ int22_ar[C][G][U][A][G][G][G][C] = -1.600;
+ int22_ar[C][G][U][A][G][U][G][C] =  0.500;
+ int22_ar[C][G][U][A][U][A][G][C] =  2.000;
+ int22_ar[C][G][U][A][U][C][G][C] =  2.000;
+ int22_ar[C][G][U][A][U][G][G][C] =  2.000;
+ int22_ar[C][G][U][A][U][U][G][C] =  2.000;
+ int22_ar[C][G][U][C][A][A][G][C] =  2.000;
+ int22_ar[C][G][U][C][A][C][G][C] =  1.100;
+ int22_ar[C][G][U][C][A][G][G][C] = -1.600;
+ int22_ar[C][G][U][C][A][U][G][C] =  0.300;
+ int22_ar[C][G][U][C][C][A][G][C] =  2.000;
+ int22_ar[C][G][U][C][C][C][G][C] =  1.200;
+ int22_ar[C][G][U][C][C][G][G][C] = -0.600;
+ int22_ar[C][G][U][C][C][U][G][C] =  0.300;
+ int22_ar[C][G][U][C][G][A][G][C] =  2.000;
+ int22_ar[C][G][U][C][G][C][G][C] =  2.000;
+ int22_ar[C][G][U][C][G][G][G][C] =  2.000;
+ int22_ar[C][G][U][C][G][U][G][C] =  2.000;
+ int22_ar[C][G][U][C][U][A][G][C] =  2.000;
+ int22_ar[C][G][U][C][U][C][G][C] =  0.200;
+ int22_ar[C][G][U][C][U][G][G][C] = -1.600;
+ int22_ar[C][G][U][C][U][U][G][C] =  0.100;
+ int22_ar[C][G][U][G][A][A][G][C] =  2.000;
+ int22_ar[C][G][U][G][A][C][G][C] =  0.500;
+ int22_ar[C][G][U][G][A][G][G][C] = -0.600;
+ int22_ar[C][G][U][G][A][U][G][C] =  1.400;
+ int22_ar[C][G][U][G][C][A][G][C] =  2.000;
+ int22_ar[C][G][U][G][C][C][G][C] =  2.000;
+ int22_ar[C][G][U][G][C][G][G][C] =  2.000;
+ int22_ar[C][G][U][G][C][U][G][C] =  2.000;
+ int22_ar[C][G][U][G][G][A][G][C] =  2.000;
+ int22_ar[C][G][U][G][G][C][G][C] =  1.700;
+ int22_ar[C][G][U][G][G][G][G][C] = -0.700;
+ int22_ar[C][G][U][G][G][U][G][C] =  1.200;
+ int22_ar[C][G][U][G][U][A][G][C] =  2.000;
+ int22_ar[C][G][U][G][U][C][G][C] = -0.700;
+ int22_ar[C][G][U][G][U][G][G][C] = -4.400;
+ int22_ar[C][G][U][G][U][U][G][C] = -1.000;
+ int22_ar[C][G][U][U][A][A][G][C] =  2.000;
+ int22_ar[C][G][U][U][A][C][G][C] =  2.000;
+ int22_ar[C][G][U][U][A][G][G][C] =  2.000;
+ int22_ar[C][G][U][U][A][U][G][C] =  2.000;
+ int22_ar[C][G][U][U][C][A][G][C] =  2.000;
+ int22_ar[C][G][U][U][C][C][G][C] =  1.200;
+ int22_ar[C][G][U][U][C][G][G][C] = -0.500;
+ int22_ar[C][G][U][U][C][U][G][C] =  0.300;
+ int22_ar[C][G][U][U][G][A][G][C] =  2.000;
+ int22_ar[C][G][U][U][G][C][G][C] = -0.100;
+ int22_ar[C][G][U][U][G][G][G][C] = -4.100;
+ int22_ar[C][G][U][U][G][U][G][C] =  0.100;
+ int22_ar[C][G][U][U][U][A][G][C] =  2.000;
+ int22_ar[C][G][U][U][U][C][G][C] =  0.400;
+ int22_ar[C][G][U][U][U][G][G][C] = -1.000;
+ int22_ar[C][G][U][U][U][U][G][C] =  0.600;
+ int22_ar[C][G][A][A][A][A][G][U] =  2.000;
+ int22_ar[C][G][A][A][A][C][G][U] =  2.400;
+ int22_ar[C][G][A][A][A][G][G][U] =  1.000;
+ int22_ar[C][G][A][A][A][U][G][U] =  2.000;
+ int22_ar[C][G][A][A][C][A][G][U] =  1.800;
+ int22_ar[C][G][A][A][C][C][G][U] =  2.100;
+ int22_ar[C][G][A][A][C][G][G][U] =  0.800;
+ int22_ar[C][G][A][A][C][U][G][U] =  2.000;
+ int22_ar[C][G][A][A][G][A][G][U] =  0.800;
+ int22_ar[C][G][A][A][G][C][G][U] =  1.100;
+ int22_ar[C][G][A][A][G][G][G][U] = -0.200;
+ int22_ar[C][G][A][A][G][U][G][U] =  2.000;
+ int22_ar[C][G][A][A][U][A][G][U] =  2.000;
+ int22_ar[C][G][A][A][U][C][G][U] =  2.000;
+ int22_ar[C][G][A][A][U][G][G][U] =  2.000;
+ int22_ar[C][G][A][A][U][U][G][U] =  2.000;
+ int22_ar[C][G][A][C][A][A][G][U] =  1.900;
+ int22_ar[C][G][A][C][A][C][G][U] =  2.200;
+ int22_ar[C][G][A][C][A][G][G][U] =  0.900;
+ int22_ar[C][G][A][C][A][U][G][U] =  2.000;
+ int22_ar[C][G][A][C][C][A][G][U] =  2.300;
+ int22_ar[C][G][A][C][C][C][G][U] =  2.100;
+ int22_ar[C][G][A][C][C][G][G][U] =  1.700;
+ int22_ar[C][G][A][C][C][U][G][U] =  2.000;
+ int22_ar[C][G][A][C][G][A][G][U] =  2.000;
+ int22_ar[C][G][A][C][G][C][G][U] =  2.000;
+ int22_ar[C][G][A][C][G][G][G][U] =  2.000;
+ int22_ar[C][G][A][C][G][U][G][U] =  2.000;
+ int22_ar[C][G][A][C][U][A][G][U] =  2.300;
+ int22_ar[C][G][A][C][U][C][G][U] =  2.100;
+ int22_ar[C][G][A][C][U][G][G][U] =  1.700;
+ int22_ar[C][G][A][C][U][U][G][U] =  2.000;
+ int22_ar[C][G][A][G][A][A][G][U] =  0.800;
+ int22_ar[C][G][A][G][A][C][G][U] =  1.100;
+ int22_ar[C][G][A][G][A][G][G][U] = -0.200;
+ int22_ar[C][G][A][G][A][U][G][U] =  2.000;
+ int22_ar[C][G][A][G][C][A][G][U] =  2.000;
+ int22_ar[C][G][A][G][C][C][G][U] =  2.000;
+ int22_ar[C][G][A][G][C][G][G][U] =  2.000;
+ int22_ar[C][G][A][G][C][U][G][U] =  2.000;
+ int22_ar[C][G][A][G][G][A][G][U] =  1.300;
+ int22_ar[C][G][A][G][G][C][G][U] =  1.700;
+ int22_ar[C][G][A][G][G][G][G][U] =  0.300;
+ int22_ar[C][G][A][G][G][U][G][U] =  2.000;
+ int22_ar[C][G][A][G][U][A][G][U] =  0.600;
+ int22_ar[C][G][A][G][U][C][G][U] =  0.000;
+ int22_ar[C][G][A][G][U][G][G][U] =  0.400;
+ int22_ar[C][G][A][G][U][U][G][U] =  2.000;
+ int22_ar[C][G][A][U][A][A][G][U] =  2.000;
+ int22_ar[C][G][A][U][A][C][G][U] =  2.000;
+ int22_ar[C][G][A][U][A][G][G][U] =  2.000;
+ int22_ar[C][G][A][U][A][U][G][U] =  2.000;
+ int22_ar[C][G][A][U][C][A][G][U] =  2.300;
+ int22_ar[C][G][A][U][C][C][G][U] =  2.100;
+ int22_ar[C][G][A][U][C][G][G][U] =  1.700;
+ int22_ar[C][G][A][U][C][U][G][U] =  2.000;
+ int22_ar[C][G][A][U][G][A][G][U] =  1.600;
+ int22_ar[C][G][A][U][G][C][G][U] =  0.900;
+ int22_ar[C][G][A][U][G][G][G][U] =  1.400;
+ int22_ar[C][G][A][U][G][U][G][U] =  2.000;
+ int22_ar[C][G][A][U][U][A][G][U] =  1.900;
+ int22_ar[C][G][A][U][U][C][G][U] =  1.300;
+ int22_ar[C][G][A][U][U][G][G][U] =  1.800;
+ int22_ar[C][G][A][U][U][U][G][U] =  2.000;
+ int22_ar[C][G][C][A][A][A][G][U] =  1.900;
+ int22_ar[C][G][C][A][A][C][G][U] =  2.800;
+ int22_ar[C][G][C][A][A][G][G][U] =  2.000;
+ int22_ar[C][G][C][A][A][U][G][U] =  2.700;
+ int22_ar[C][G][C][A][C][A][G][U] =  1.700;
+ int22_ar[C][G][C][A][C][C][G][U] =  2.000;
+ int22_ar[C][G][C][A][C][G][G][U] =  2.000;
+ int22_ar[C][G][C][A][C][U][G][U] =  1.800;
+ int22_ar[C][G][C][A][G][A][G][U] =  0.700;
+ int22_ar[C][G][C][A][G][C][G][U] =  2.000;
+ int22_ar[C][G][C][A][G][G][G][U] =  2.000;
+ int22_ar[C][G][C][A][G][U][G][U] =  1.800;
+ int22_ar[C][G][C][A][U][A][G][U] =  2.000;
+ int22_ar[C][G][C][A][U][C][G][U] =  2.000;
+ int22_ar[C][G][C][A][U][G][G][U] =  2.000;
+ int22_ar[C][G][C][A][U][U][G][U] =  2.000;
+ int22_ar[C][G][C][C][A][A][G][U] =  1.800;
+ int22_ar[C][G][C][C][A][C][G][U] =  2.100;
+ int22_ar[C][G][C][C][A][G][G][U] =  2.000;
+ int22_ar[C][G][C][C][A][U][G][U] =  1.900;
+ int22_ar[C][G][C][C][C][A][G][U] =  1.600;
+ int22_ar[C][G][C][C][C][C][G][U] =  1.900;
+ int22_ar[C][G][C][C][C][G][G][U] =  2.000;
+ int22_ar[C][G][C][C][C][U][G][U] =  1.800;
+ int22_ar[C][G][C][C][G][A][G][U] =  2.000;
+ int22_ar[C][G][C][C][G][C][G][U] =  2.000;
+ int22_ar[C][G][C][C][G][G][G][U] =  2.000;
+ int22_ar[C][G][C][C][G][U][G][U] =  2.000;
+ int22_ar[C][G][C][C][U][A][G][U] =  1.600;
+ int22_ar[C][G][C][C][U][C][G][U] =  1.900;
+ int22_ar[C][G][C][C][U][G][G][U] =  2.000;
+ int22_ar[C][G][C][C][U][U][G][U] =  1.800;
+ int22_ar[C][G][C][G][A][A][G][U] =  0.700;
+ int22_ar[C][G][C][G][A][C][G][U] =  2.000;
+ int22_ar[C][G][C][G][A][G][G][U] =  2.000;
+ int22_ar[C][G][C][G][A][U][G][U] =  1.800;
+ int22_ar[C][G][C][G][C][A][G][U] =  2.000;
+ int22_ar[C][G][C][G][C][C][G][U] =  2.000;
+ int22_ar[C][G][C][G][C][G][G][U] =  2.000;
+ int22_ar[C][G][C][G][C][U][G][U] =  2.000;
+ int22_ar[C][G][C][G][G][A][G][U] =  1.200;
+ int22_ar[C][G][C][G][G][C][G][U] =  2.100;
+ int22_ar[C][G][C][G][G][G][G][U] =  2.000;
+ int22_ar[C][G][C][G][G][U][G][U] =  2.000;
+ int22_ar[C][G][C][G][U][A][G][U] = -0.500;
+ int22_ar[C][G][C][G][U][C][G][U] =  0.800;
+ int22_ar[C][G][C][G][U][G][G][U] =  2.000;
+ int22_ar[C][G][C][G][U][U][G][U] =  0.700;
+ int22_ar[C][G][C][U][A][A][G][U] =  2.000;
+ int22_ar[C][G][C][U][A][C][G][U] =  2.000;
+ int22_ar[C][G][C][U][A][G][G][U] =  2.000;
+ int22_ar[C][G][C][U][A][U][G][U] =  2.000;
+ int22_ar[C][G][C][U][C][A][G][U] =  1.600;
+ int22_ar[C][G][C][U][C][C][G][U] =  1.900;
+ int22_ar[C][G][C][U][C][G][G][U] =  2.000;
+ int22_ar[C][G][C][U][C][U][G][U] =  1.800;
+ int22_ar[C][G][C][U][G][A][G][U] =  0.500;
+ int22_ar[C][G][C][U][G][C][G][U] =  1.800;
+ int22_ar[C][G][C][U][G][G][G][U] =  2.000;
+ int22_ar[C][G][C][U][G][U][G][U] =  1.600;
+ int22_ar[C][G][C][U][U][A][G][U] =  0.800;
+ int22_ar[C][G][C][U][U][C][G][U] =  1.100;
+ int22_ar[C][G][C][U][U][G][G][U] =  2.000;
+ int22_ar[C][G][C][U][U][U][G][U] =  1.000;
+ int22_ar[C][G][G][A][A][A][G][U] =  1.000;
+ int22_ar[C][G][G][A][A][C][G][U] =  2.000;
+ int22_ar[C][G][G][A][A][G][G][U] =  1.800;
+ int22_ar[C][G][G][A][A][U][G][U] =  1.800;
+ int22_ar[C][G][G][A][C][A][G][U] =  0.800;
+ int22_ar[C][G][G][A][C][C][G][U] =  2.000;
+ int22_ar[C][G][G][A][C][G][G][U] =  1.500;
+ int22_ar[C][G][G][A][C][U][G][U] =  0.600;
+ int22_ar[C][G][G][A][G][A][G][U] = -0.200;
+ int22_ar[C][G][G][A][G][C][G][U] =  2.000;
+ int22_ar[C][G][G][A][G][G][G][U] =  0.500;
+ int22_ar[C][G][G][A][G][U][G][U] =  1.400;
+ int22_ar[C][G][G][A][U][A][G][U] =  2.000;
+ int22_ar[C][G][G][A][U][C][G][U] =  2.000;
+ int22_ar[C][G][G][A][U][G][G][U] =  2.000;
+ int22_ar[C][G][G][A][U][U][G][U] =  2.000;
+ int22_ar[C][G][G][C][A][A][G][U] =  0.900;
+ int22_ar[C][G][G][C][A][C][G][U] =  2.000;
+ int22_ar[C][G][G][C][A][G][G][U] =  1.600;
+ int22_ar[C][G][G][C][A][U][G][U] =  0.700;
+ int22_ar[C][G][G][C][C][A][G][U] =  1.700;
+ int22_ar[C][G][G][C][C][C][G][U] =  2.000;
+ int22_ar[C][G][G][C][C][G][G][U] =  2.100;
+ int22_ar[C][G][G][C][C][U][G][U] =  1.500;
+ int22_ar[C][G][G][C][G][A][G][U] =  2.000;
+ int22_ar[C][G][G][C][G][C][G][U] =  2.000;
+ int22_ar[C][G][G][C][G][G][G][U] =  2.000;
+ int22_ar[C][G][G][C][G][U][G][U] =  2.000;
+ int22_ar[C][G][G][C][U][A][G][U] =  1.700;
+ int22_ar[C][G][G][C][U][C][G][U] =  2.000;
+ int22_ar[C][G][G][C][U][G][G][U] =  2.100;
+ int22_ar[C][G][G][C][U][U][G][U] =  1.500;
+ int22_ar[C][G][G][G][A][A][G][U] = -0.200;
+ int22_ar[C][G][G][G][A][C][G][U] =  2.000;
+ int22_ar[C][G][G][G][A][G][G][U] =  0.500;
+ int22_ar[C][G][G][G][A][U][G][U] =  1.400;
+ int22_ar[C][G][G][G][C][A][G][U] =  2.000;
+ int22_ar[C][G][G][G][C][C][G][U] =  2.000;
+ int22_ar[C][G][G][G][C][G][G][U] =  2.000;
+ int22_ar[C][G][G][G][C][U][G][U] =  2.000;
+ int22_ar[C][G][G][G][G][A][G][U] =  0.300;
+ int22_ar[C][G][G][G][G][C][G][U] =  2.000;
+ int22_ar[C][G][G][G][G][G][G][U] =  1.100;
+ int22_ar[C][G][G][G][G][U][G][U] =  1.100;
+ int22_ar[C][G][G][G][U][A][G][U] =  0.400;
+ int22_ar[C][G][G][G][U][C][G][U] =  2.000;
+ int22_ar[C][G][G][G][U][G][G][U] =  0.400;
+ int22_ar[C][G][G][G][U][U][G][U] = -1.600;
+ int22_ar[C][G][G][U][A][A][G][U] =  2.000;
+ int22_ar[C][G][G][U][A][C][G][U] =  2.000;
+ int22_ar[C][G][G][U][A][G][G][U] =  2.000;
+ int22_ar[C][G][G][U][A][U][G][U] =  2.000;
+ int22_ar[C][G][G][U][C][A][G][U] =  1.700;
+ int22_ar[C][G][G][U][C][C][G][U] =  2.000;
+ int22_ar[C][G][G][U][C][G][G][U] =  2.100;
+ int22_ar[C][G][G][U][C][U][G][U] =  1.500;
+ int22_ar[C][G][G][U][G][A][G][U] =  1.400;
+ int22_ar[C][G][G][U][G][C][G][U] =  2.000;
+ int22_ar[C][G][G][U][G][G][G][U] =  1.300;
+ int22_ar[C][G][G][U][G][U][G][U] = -0.600;
+ int22_ar[C][G][G][U][U][A][G][U] =  1.800;
+ int22_ar[C][G][G][U][U][C][G][U] =  2.000;
+ int22_ar[C][G][G][U][U][G][G][U] =  1.700;
+ int22_ar[C][G][G][U][U][U][G][U] =  1.600;
+ int22_ar[C][G][U][A][A][A][G][U] =  2.000;
+ int22_ar[C][G][U][A][A][C][G][U] =  2.700;
+ int22_ar[C][G][U][A][A][G][G][U] =  0.300;
+ int22_ar[C][G][U][A][A][U][G][U] =  2.200;
+ int22_ar[C][G][U][A][C][A][G][U] =  2.000;
+ int22_ar[C][G][U][A][C][C][G][U] =  1.800;
+ int22_ar[C][G][U][A][C][G][G][U] = -0.900;
+ int22_ar[C][G][U][A][C][U][G][U] =  0.900;
+ int22_ar[C][G][U][A][G][A][G][U] =  2.000;
+ int22_ar[C][G][U][A][G][C][G][U] =  1.800;
+ int22_ar[C][G][U][A][G][G][G][U] = -0.100;
+ int22_ar[C][G][U][A][G][U][G][U] =  1.800;
+ int22_ar[C][G][U][A][U][A][G][U] =  2.000;
+ int22_ar[C][G][U][A][U][C][G][U] =  2.000;
+ int22_ar[C][G][U][A][U][G][G][U] =  2.000;
+ int22_ar[C][G][U][A][U][U][G][U] =  2.000;
+ int22_ar[C][G][U][C][A][A][G][U] =  2.000;
+ int22_ar[C][G][U][C][A][C][G][U] =  1.900;
+ int22_ar[C][G][U][C][A][G][G][U] = -0.800;
+ int22_ar[C][G][U][C][A][U][G][U] =  1.000;
+ int22_ar[C][G][U][C][C][A][G][U] =  2.000;
+ int22_ar[C][G][U][C][C][C][G][U] =  1.800;
+ int22_ar[C][G][U][C][C][G][G][U] =  0.000;
+ int22_ar[C][G][U][C][C][U][G][U] =  0.900;
+ int22_ar[C][G][U][C][G][A][G][U] =  2.000;
+ int22_ar[C][G][U][C][G][C][G][U] =  2.000;
+ int22_ar[C][G][U][C][G][G][G][U] =  2.000;
+ int22_ar[C][G][U][C][G][U][G][U] =  2.000;
+ int22_ar[C][G][U][C][U][A][G][U] =  2.000;
+ int22_ar[C][G][U][C][U][C][G][U] =  1.800;
+ int22_ar[C][G][U][C][U][G][G][U] =  0.000;
+ int22_ar[C][G][U][C][U][U][G][U] =  0.900;
+ int22_ar[C][G][U][G][A][A][G][U] =  2.000;
+ int22_ar[C][G][U][G][A][C][G][U] =  1.800;
+ int22_ar[C][G][U][G][A][G][G][U] = -0.100;
+ int22_ar[C][G][U][G][A][U][G][U] =  1.800;
+ int22_ar[C][G][U][G][C][A][G][U] =  2.000;
+ int22_ar[C][G][U][G][C][C][G][U] =  2.000;
+ int22_ar[C][G][U][G][C][G][G][U] =  2.000;
+ int22_ar[C][G][U][G][C][U][G][U] =  2.000;
+ int22_ar[C][G][U][G][G][A][G][U] =  2.000;
+ int22_ar[C][G][U][G][G][C][G][U] =  2.000;
+ int22_ar[C][G][U][G][G][G][G][U] = -0.400;
+ int22_ar[C][G][U][G][G][U][G][U] =  1.500;
+ int22_ar[C][G][U][G][U][A][G][U] =  2.000;
+ int22_ar[C][G][U][G][U][C][G][U] =  0.700;
+ int22_ar[C][G][U][G][U][G][G][U] = -3.100;
+ int22_ar[C][G][U][G][U][U][G][U] =  0.600;
+ int22_ar[C][G][U][U][A][A][G][U] =  2.000;
+ int22_ar[C][G][U][U][A][C][G][U] =  2.000;
+ int22_ar[C][G][U][U][A][G][G][U] =  2.000;
+ int22_ar[C][G][U][U][A][U][G][U] =  2.000;
+ int22_ar[C][G][U][U][C][A][G][U] =  2.000;
+ int22_ar[C][G][U][U][C][C][G][U] =  1.800;
+ int22_ar[C][G][U][U][C][G][G][U] =  0.000;
+ int22_ar[C][G][U][U][C][U][G][U] =  0.900;
+ int22_ar[C][G][U][U][G][A][G][U] =  2.000;
+ int22_ar[C][G][U][U][G][C][G][U] =  1.600;
+ int22_ar[C][G][U][U][G][G][G][U] = -2.100;
+ int22_ar[C][G][U][U][G][U][G][U] =  1.600;
+ int22_ar[C][G][U][U][U][A][G][U] =  2.000;
+ int22_ar[C][G][U][U][U][C][G][U] =  1.000;
+ int22_ar[C][G][U][U][U][G][G][U] =  0.000;
+ int22_ar[C][G][U][U][U][U][G][U] =  0.100;
+ int22_ar[C][G][A][A][A][A][U][A] =  2.000;
+ int22_ar[C][G][A][A][A][C][U][A] =  2.400;
+ int22_ar[C][G][A][A][A][G][U][A] =  1.000;
+ int22_ar[C][G][A][A][A][U][U][A] =  2.000;
+ int22_ar[C][G][A][A][C][A][U][A] =  1.600;
+ int22_ar[C][G][A][A][C][C][U][A] =  1.900;
+ int22_ar[C][G][A][A][C][G][U][A] =  0.600;
+ int22_ar[C][G][A][A][C][U][U][A] =  2.000;
+ int22_ar[C][G][A][A][G][A][U][A] =  1.000;
+ int22_ar[C][G][A][A][G][C][U][A] =  1.300;
+ int22_ar[C][G][A][A][G][G][U][A] =  0.000;
+ int22_ar[C][G][A][A][G][U][U][A] =  2.000;
+ int22_ar[C][G][A][A][U][A][U][A] =  2.000;
+ int22_ar[C][G][A][A][U][C][U][A] =  2.000;
+ int22_ar[C][G][A][A][U][G][U][A] =  2.000;
+ int22_ar[C][G][A][A][U][U][U][A] =  2.000;
+ int22_ar[C][G][A][C][A][A][U][A] =  2.000;
+ int22_ar[C][G][A][C][A][C][U][A] =  2.400;
+ int22_ar[C][G][A][C][A][G][U][A] =  1.000;
+ int22_ar[C][G][A][C][A][U][U][A] =  2.000;
+ int22_ar[C][G][A][C][C][A][U][A] =  2.600;
+ int22_ar[C][G][A][C][C][C][U][A] =  2.400;
+ int22_ar[C][G][A][C][C][G][U][A] =  2.000;
+ int22_ar[C][G][A][C][C][U][U][A] =  2.000;
+ int22_ar[C][G][A][C][G][A][U][A] =  2.000;
+ int22_ar[C][G][A][C][G][C][U][A] =  2.000;
+ int22_ar[C][G][A][C][G][G][U][A] =  2.000;
+ int22_ar[C][G][A][C][G][U][U][A] =  2.000;
+ int22_ar[C][G][A][C][U][A][U][A] =  2.600;
+ int22_ar[C][G][A][C][U][C][U][A] =  2.400;
+ int22_ar[C][G][A][C][U][G][U][A] =  2.000;
+ int22_ar[C][G][A][C][U][U][U][A] =  2.000;
+ int22_ar[C][G][A][G][A][A][U][A] =  1.000;
+ int22_ar[C][G][A][G][A][C][U][A] =  1.300;
+ int22_ar[C][G][A][G][A][G][U][A] =  0.000;
+ int22_ar[C][G][A][G][A][U][U][A] =  2.000;
+ int22_ar[C][G][A][G][C][A][U][A] =  2.000;
+ int22_ar[C][G][A][G][C][C][U][A] =  2.000;
+ int22_ar[C][G][A][G][C][G][U][A] =  2.000;
+ int22_ar[C][G][A][G][C][U][U][A] =  2.000;
+ int22_ar[C][G][A][G][G][A][U][A] =  1.400;
+ int22_ar[C][G][A][G][G][C][U][A] =  1.700;
+ int22_ar[C][G][A][G][G][G][U][A] =  0.400;
+ int22_ar[C][G][A][G][G][U][U][A] =  2.000;
+ int22_ar[C][G][A][G][U][A][U][A] =  0.200;
+ int22_ar[C][G][A][G][U][C][U][A] = -0.400;
+ int22_ar[C][G][A][G][U][G][U][A] =  0.000;
+ int22_ar[C][G][A][G][U][U][U][A] =  2.000;
+ int22_ar[C][G][A][U][A][A][U][A] =  2.000;
+ int22_ar[C][G][A][U][A][C][U][A] =  2.000;
+ int22_ar[C][G][A][U][A][G][U][A] =  2.000;
+ int22_ar[C][G][A][U][A][U][U][A] =  2.000;
+ int22_ar[C][G][A][U][C][A][U][A] =  2.300;
+ int22_ar[C][G][A][U][C][C][U][A] =  2.100;
+ int22_ar[C][G][A][U][C][G][U][A] =  1.700;
+ int22_ar[C][G][A][U][C][U][U][A] =  2.000;
+ int22_ar[C][G][A][U][G][A][U][A] =  1.500;
+ int22_ar[C][G][A][U][G][C][U][A] =  0.800;
+ int22_ar[C][G][A][U][G][G][U][A] =  1.300;
+ int22_ar[C][G][A][U][G][U][U][A] =  2.000;
+ int22_ar[C][G][A][U][U][A][U][A] =  2.200;
+ int22_ar[C][G][A][U][U][C][U][A] =  1.500;
+ int22_ar[C][G][A][U][U][G][U][A] =  2.000;
+ int22_ar[C][G][A][U][U][U][U][A] =  2.000;
+ int22_ar[C][G][C][A][A][A][U][A] =  1.900;
+ int22_ar[C][G][C][A][A][C][U][A] =  2.800;
+ int22_ar[C][G][C][A][A][G][U][A] =  2.000;
+ int22_ar[C][G][C][A][A][U][U][A] =  2.700;
+ int22_ar[C][G][C][A][C][A][U][A] =  1.500;
+ int22_ar[C][G][C][A][C][C][U][A] =  1.800;
+ int22_ar[C][G][C][A][C][G][U][A] =  2.000;
+ int22_ar[C][G][C][A][C][U][U][A] =  1.600;
+ int22_ar[C][G][C][A][G][A][U][A] =  0.900;
+ int22_ar[C][G][C][A][G][C][U][A] =  2.200;
+ int22_ar[C][G][C][A][G][G][U][A] =  2.000;
+ int22_ar[C][G][C][A][G][U][U][A] =  2.000;
+ int22_ar[C][G][C][A][U][A][U][A] =  2.000;
+ int22_ar[C][G][C][A][U][C][U][A] =  2.000;
+ int22_ar[C][G][C][A][U][G][U][A] =  2.000;
+ int22_ar[C][G][C][A][U][U][U][A] =  2.000;
+ int22_ar[C][G][C][C][A][A][U][A] =  1.900;
+ int22_ar[C][G][C][C][A][C][U][A] =  2.200;
+ int22_ar[C][G][C][C][A][G][U][A] =  2.000;
+ int22_ar[C][G][C][C][A][U][U][A] =  2.100;
+ int22_ar[C][G][C][C][C][A][U][A] =  1.900;
+ int22_ar[C][G][C][C][C][C][U][A] =  2.200;
+ int22_ar[C][G][C][C][C][G][U][A] =  2.000;
+ int22_ar[C][G][C][C][C][U][U][A] =  2.100;
+ int22_ar[C][G][C][C][G][A][U][A] =  2.000;
+ int22_ar[C][G][C][C][G][C][U][A] =  2.000;
+ int22_ar[C][G][C][C][G][G][U][A] =  2.000;
+ int22_ar[C][G][C][C][G][U][U][A] =  2.000;
+ int22_ar[C][G][C][C][U][A][U][A] =  1.900;
+ int22_ar[C][G][C][C][U][C][U][A] =  2.200;
+ int22_ar[C][G][C][C][U][G][U][A] =  2.000;
+ int22_ar[C][G][C][C][U][U][U][A] =  2.100;
+ int22_ar[C][G][C][G][A][A][U][A] =  0.900;
+ int22_ar[C][G][C][G][A][C][U][A] =  2.200;
+ int22_ar[C][G][C][G][A][G][U][A] =  2.000;
+ int22_ar[C][G][C][G][A][U][U][A] =  2.000;
+ int22_ar[C][G][C][G][C][A][U][A] =  2.000;
+ int22_ar[C][G][C][G][C][C][U][A] =  2.000;
+ int22_ar[C][G][C][G][C][G][U][A] =  2.000;
+ int22_ar[C][G][C][G][C][U][U][A] =  2.000;
+ int22_ar[C][G][C][G][G][A][U][A] =  1.300;
+ int22_ar[C][G][C][G][G][C][U][A] =  2.200;
+ int22_ar[C][G][C][G][G][G][U][A] =  2.000;
+ int22_ar[C][G][C][G][G][U][U][A] =  2.000;
+ int22_ar[C][G][C][G][U][A][U][A] = -0.900;
+ int22_ar[C][G][C][G][U][C][U][A] =  0.400;
+ int22_ar[C][G][C][G][U][G][U][A] =  2.000;
+ int22_ar[C][G][C][G][U][U][U][A] =  0.300;
+ int22_ar[C][G][C][U][A][A][U][A] =  2.000;
+ int22_ar[C][G][C][U][A][C][U][A] =  2.000;
+ int22_ar[C][G][C][U][A][G][U][A] =  2.000;
+ int22_ar[C][G][C][U][A][U][U][A] =  2.000;
+ int22_ar[C][G][C][U][C][A][U][A] =  1.600;
+ int22_ar[C][G][C][U][C][C][U][A] =  1.900;
+ int22_ar[C][G][C][U][C][G][U][A] =  2.000;
+ int22_ar[C][G][C][U][C][U][U][A] =  1.800;
+ int22_ar[C][G][C][U][G][A][U][A] =  0.400;
+ int22_ar[C][G][C][U][G][C][U][A] =  1.700;
+ int22_ar[C][G][C][U][G][G][U][A] =  2.000;
+ int22_ar[C][G][C][U][G][U][U][A] =  1.500;
+ int22_ar[C][G][C][U][U][A][U][A] =  1.100;
+ int22_ar[C][G][C][U][U][C][U][A] =  1.400;
+ int22_ar[C][G][C][U][U][G][U][A] =  2.000;
+ int22_ar[C][G][C][U][U][U][U][A] =  1.200;
+ int22_ar[C][G][G][A][A][A][U][A] =  1.000;
+ int22_ar[C][G][G][A][A][C][U][A] =  2.000;
+ int22_ar[C][G][G][A][A][G][U][A] =  1.800;
+ int22_ar[C][G][G][A][A][U][U][A] =  1.800;
+ int22_ar[C][G][G][A][C][A][U][A] =  0.600;
+ int22_ar[C][G][G][A][C][C][U][A] =  2.000;
+ int22_ar[C][G][G][A][C][G][U][A] =  1.300;
+ int22_ar[C][G][G][A][C][U][U][A] =  0.400;
+ int22_ar[C][G][G][A][G][A][U][A] =  0.000;
+ int22_ar[C][G][G][A][G][C][U][A] =  2.000;
+ int22_ar[C][G][G][A][G][G][U][A] =  0.700;
+ int22_ar[C][G][G][A][G][U][U][A] =  1.600;
+ int22_ar[C][G][G][A][U][A][U][A] =  2.000;
+ int22_ar[C][G][G][A][U][C][U][A] =  2.000;
+ int22_ar[C][G][G][A][U][G][U][A] =  2.000;
+ int22_ar[C][G][G][A][U][U][U][A] =  2.000;
+ int22_ar[C][G][G][C][A][A][U][A] =  1.000;
+ int22_ar[C][G][G][C][A][C][U][A] =  2.000;
+ int22_ar[C][G][G][C][A][G][U][A] =  1.800;
+ int22_ar[C][G][G][C][A][U][U][A] =  0.800;
+ int22_ar[C][G][G][C][C][A][U][A] =  2.000;
+ int22_ar[C][G][G][C][C][C][U][A] =  2.000;
+ int22_ar[C][G][G][C][C][G][U][A] =  2.400;
+ int22_ar[C][G][G][C][C][U][U][A] =  1.800;
+ int22_ar[C][G][G][C][G][A][U][A] =  2.000;
+ int22_ar[C][G][G][C][G][C][U][A] =  2.000;
+ int22_ar[C][G][G][C][G][G][U][A] =  2.000;
+ int22_ar[C][G][G][C][G][U][U][A] =  2.000;
+ int22_ar[C][G][G][C][U][A][U][A] =  2.000;
+ int22_ar[C][G][G][C][U][C][U][A] =  2.000;
+ int22_ar[C][G][G][C][U][G][U][A] =  2.400;
+ int22_ar[C][G][G][C][U][U][U][A] =  1.800;
+ int22_ar[C][G][G][G][A][A][U][A] =  0.000;
+ int22_ar[C][G][G][G][A][C][U][A] =  2.000;
+ int22_ar[C][G][G][G][A][G][U][A] =  0.700;
+ int22_ar[C][G][G][G][A][U][U][A] =  1.600;
+ int22_ar[C][G][G][G][C][A][U][A] =  2.000;
+ int22_ar[C][G][G][G][C][C][U][A] =  2.000;
+ int22_ar[C][G][G][G][C][G][U][A] =  2.000;
+ int22_ar[C][G][G][G][C][U][U][A] =  2.000;
+ int22_ar[C][G][G][G][G][A][U][A] =  0.400;
+ int22_ar[C][G][G][G][G][C][U][A] =  2.000;
+ int22_ar[C][G][G][G][G][G][U][A] =  1.100;
+ int22_ar[C][G][G][G][G][U][U][A] =  1.200;
+ int22_ar[C][G][G][G][U][A][U][A] =  0.000;
+ int22_ar[C][G][G][G][U][C][U][A] =  2.000;
+ int22_ar[C][G][G][G][U][G][U][A] =  0.000;
+ int22_ar[C][G][G][G][U][U][U][A] = -2.000;
+ int22_ar[C][G][G][U][A][A][U][A] =  2.000;
+ int22_ar[C][G][G][U][A][C][U][A] =  2.000;
+ int22_ar[C][G][G][U][A][G][U][A] =  2.000;
+ int22_ar[C][G][G][U][A][U][U][A] =  2.000;
+ int22_ar[C][G][G][U][C][A][U][A] =  1.700;
+ int22_ar[C][G][G][U][C][C][U][A] =  2.000;
+ int22_ar[C][G][G][U][C][G][U][A] =  2.100;
+ int22_ar[C][G][G][U][C][U][U][A] =  1.500;
+ int22_ar[C][G][G][U][G][A][U][A] =  1.300;
+ int22_ar[C][G][G][U][G][C][U][A] =  2.000;
+ int22_ar[C][G][G][U][G][G][U][A] =  1.200;
+ int22_ar[C][G][G][U][G][U][U][A] = -0.700;
+ int22_ar[C][G][G][U][U][A][U][A] =  2.000;
+ int22_ar[C][G][G][U][U][C][U][A] =  2.000;
+ int22_ar[C][G][G][U][U][G][U][A] =  1.900;
+ int22_ar[C][G][G][U][U][U][U][A] =  1.800;
+ int22_ar[C][G][U][A][A][A][U][A] =  2.000;
+ int22_ar[C][G][U][A][A][C][U][A] =  2.700;
+ int22_ar[C][G][U][A][A][G][U][A] =  0.300;
+ int22_ar[C][G][U][A][A][U][U][A] =  2.200;
+ int22_ar[C][G][U][A][C][A][U][A] =  2.000;
+ int22_ar[C][G][U][A][C][C][U][A] =  1.600;
+ int22_ar[C][G][U][A][C][G][U][A] = -1.100;
+ int22_ar[C][G][U][A][C][U][U][A] =  0.700;
+ int22_ar[C][G][U][A][G][A][U][A] =  2.000;
+ int22_ar[C][G][U][A][G][C][U][A] =  2.000;
+ int22_ar[C][G][U][A][G][G][U][A] =  0.100;
+ int22_ar[C][G][U][A][G][U][U][A] =  1.900;
+ int22_ar[C][G][U][A][U][A][U][A] =  2.000;
+ int22_ar[C][G][U][A][U][C][U][A] =  2.000;
+ int22_ar[C][G][U][A][U][G][U][A] =  2.000;
+ int22_ar[C][G][U][A][U][U][U][A] =  2.000;
+ int22_ar[C][G][U][C][A][A][U][A] =  2.000;
+ int22_ar[C][G][U][C][A][C][U][A] =  2.100;
+ int22_ar[C][G][U][C][A][G][U][A] = -0.700;
+ int22_ar[C][G][U][C][A][U][U][A] =  1.200;
+ int22_ar[C][G][U][C][C][A][U][A] =  2.000;
+ int22_ar[C][G][U][C][C][C][U][A] =  2.100;
+ int22_ar[C][G][U][C][C][G][U][A] =  0.300;
+ int22_ar[C][G][U][C][C][U][U][A] =  1.200;
+ int22_ar[C][G][U][C][G][A][U][A] =  2.000;
+ int22_ar[C][G][U][C][G][C][U][A] =  2.000;
+ int22_ar[C][G][U][C][G][G][U][A] =  2.000;
+ int22_ar[C][G][U][C][G][U][U][A] =  2.000;
+ int22_ar[C][G][U][C][U][A][U][A] =  2.000;
+ int22_ar[C][G][U][C][U][C][U][A] =  2.100;
+ int22_ar[C][G][U][C][U][G][U][A] =  0.300;
+ int22_ar[C][G][U][C][U][U][U][A] =  1.200;
+ int22_ar[C][G][U][G][A][A][U][A] =  2.000;
+ int22_ar[C][G][U][G][A][C][U][A] =  2.000;
+ int22_ar[C][G][U][G][A][G][U][A] =  0.100;
+ int22_ar[C][G][U][G][A][U][U][A] =  1.900;
+ int22_ar[C][G][U][G][C][A][U][A] =  2.000;
+ int22_ar[C][G][U][G][C][C][U][A] =  2.000;
+ int22_ar[C][G][U][G][C][G][U][A] =  2.000;
+ int22_ar[C][G][U][G][C][U][U][A] =  2.000;
+ int22_ar[C][G][U][G][G][A][U][A] =  2.000;
+ int22_ar[C][G][U][G][G][C][U][A] =  2.000;
+ int22_ar[C][G][U][G][G][G][U][A] = -0.300;
+ int22_ar[C][G][U][G][G][U][U][A] =  1.500;
+ int22_ar[C][G][U][G][U][A][U][A] =  2.000;
+ int22_ar[C][G][U][G][U][C][U][A] =  0.300;
+ int22_ar[C][G][U][G][U][G][U][A] = -3.500;
+ int22_ar[C][G][U][G][U][U][U][A] =  0.200;
+ int22_ar[C][G][U][U][A][A][U][A] =  2.000;
+ int22_ar[C][G][U][U][A][C][U][A] =  2.000;
+ int22_ar[C][G][U][U][A][G][U][A] =  2.000;
+ int22_ar[C][G][U][U][A][U][U][A] =  2.000;
+ int22_ar[C][G][U][U][C][A][U][A] =  2.000;
+ int22_ar[C][G][U][U][C][C][U][A] =  1.800;
+ int22_ar[C][G][U][U][C][G][U][A] =  0.000;
+ int22_ar[C][G][U][U][C][U][U][A] =  0.900;
+ int22_ar[C][G][U][U][G][A][U][A] =  2.000;
+ int22_ar[C][G][U][U][G][C][U][A] =  1.500;
+ int22_ar[C][G][U][U][G][G][U][A] = -2.200;
+ int22_ar[C][G][U][U][G][U][U][A] =  1.500;
+ int22_ar[C][G][U][U][U][A][U][A] =  2.000;
+ int22_ar[C][G][U][U][U][C][U][A] =  1.200;
+ int22_ar[C][G][U][U][U][G][U][A] =  0.300;
+ int22_ar[C][G][U][U][U][U][U][A] =  0.300;
+ int22_ar[C][G][A][A][A][A][U][G] =  2.000;
+ int22_ar[C][G][A][A][A][C][U][G] =  2.400;
+ int22_ar[C][G][A][A][A][G][U][G] =  1.000;
+ int22_ar[C][G][A][A][A][U][U][G] =  2.000;
+ int22_ar[C][G][A][A][C][A][U][G] =  1.600;
+ int22_ar[C][G][A][A][C][C][U][G] =  1.900;
+ int22_ar[C][G][A][A][C][G][U][G] =  0.600;
+ int22_ar[C][G][A][A][C][U][U][G] =  2.000;
+ int22_ar[C][G][A][A][G][A][U][G] =  1.000;
+ int22_ar[C][G][A][A][G][C][U][G] =  1.300;
+ int22_ar[C][G][A][A][G][G][U][G] =  0.000;
+ int22_ar[C][G][A][A][G][U][U][G] =  2.000;
+ int22_ar[C][G][A][A][U][A][U][G] =  2.000;
+ int22_ar[C][G][A][A][U][C][U][G] =  2.000;
+ int22_ar[C][G][A][A][U][G][U][G] =  2.000;
+ int22_ar[C][G][A][A][U][U][U][G] =  2.000;
+ int22_ar[C][G][A][C][A][A][U][G] =  2.000;
+ int22_ar[C][G][A][C][A][C][U][G] =  2.400;
+ int22_ar[C][G][A][C][A][G][U][G] =  1.000;
+ int22_ar[C][G][A][C][A][U][U][G] =  2.000;
+ int22_ar[C][G][A][C][C][A][U][G] =  2.600;
+ int22_ar[C][G][A][C][C][C][U][G] =  2.400;
+ int22_ar[C][G][A][C][C][G][U][G] =  2.000;
+ int22_ar[C][G][A][C][C][U][U][G] =  2.000;
+ int22_ar[C][G][A][C][G][A][U][G] =  2.000;
+ int22_ar[C][G][A][C][G][C][U][G] =  2.000;
+ int22_ar[C][G][A][C][G][G][U][G] =  2.000;
+ int22_ar[C][G][A][C][G][U][U][G] =  2.000;
+ int22_ar[C][G][A][C][U][A][U][G] =  2.600;
+ int22_ar[C][G][A][C][U][C][U][G] =  2.400;
+ int22_ar[C][G][A][C][U][G][U][G] =  2.000;
+ int22_ar[C][G][A][C][U][U][U][G] =  2.000;
+ int22_ar[C][G][A][G][A][A][U][G] =  1.000;
+ int22_ar[C][G][A][G][A][C][U][G] =  1.300;
+ int22_ar[C][G][A][G][A][G][U][G] =  0.000;
+ int22_ar[C][G][A][G][A][U][U][G] =  2.000;
+ int22_ar[C][G][A][G][C][A][U][G] =  2.000;
+ int22_ar[C][G][A][G][C][C][U][G] =  2.000;
+ int22_ar[C][G][A][G][C][G][U][G] =  2.000;
+ int22_ar[C][G][A][G][C][U][U][G] =  2.000;
+ int22_ar[C][G][A][G][G][A][U][G] =  1.400;
+ int22_ar[C][G][A][G][G][C][U][G] =  1.700;
+ int22_ar[C][G][A][G][G][G][U][G] =  0.400;
+ int22_ar[C][G][A][G][G][U][U][G] =  2.000;
+ int22_ar[C][G][A][G][U][A][U][G] =  0.200;
+ int22_ar[C][G][A][G][U][C][U][G] = -0.400;
+ int22_ar[C][G][A][G][U][G][U][G] =  0.000;
+ int22_ar[C][G][A][G][U][U][U][G] =  2.000;
+ int22_ar[C][G][A][U][A][A][U][G] =  2.000;
+ int22_ar[C][G][A][U][A][C][U][G] =  2.000;
+ int22_ar[C][G][A][U][A][G][U][G] =  2.000;
+ int22_ar[C][G][A][U][A][U][U][G] =  2.000;
+ int22_ar[C][G][A][U][C][A][U][G] =  2.300;
+ int22_ar[C][G][A][U][C][C][U][G] =  2.100;
+ int22_ar[C][G][A][U][C][G][U][G] =  1.700;
+ int22_ar[C][G][A][U][C][U][U][G] =  2.000;
+ int22_ar[C][G][A][U][G][A][U][G] =  1.500;
+ int22_ar[C][G][A][U][G][C][U][G] =  0.800;
+ int22_ar[C][G][A][U][G][G][U][G] =  1.300;
+ int22_ar[C][G][A][U][G][U][U][G] =  2.000;
+ int22_ar[C][G][A][U][U][A][U][G] =  2.200;
+ int22_ar[C][G][A][U][U][C][U][G] =  1.500;
+ int22_ar[C][G][A][U][U][G][U][G] =  2.000;
+ int22_ar[C][G][A][U][U][U][U][G] =  2.000;
+ int22_ar[C][G][C][A][A][A][U][G] =  1.900;
+ int22_ar[C][G][C][A][A][C][U][G] =  2.800;
+ int22_ar[C][G][C][A][A][G][U][G] =  2.000;
+ int22_ar[C][G][C][A][A][U][U][G] =  2.700;
+ int22_ar[C][G][C][A][C][A][U][G] =  1.500;
+ int22_ar[C][G][C][A][C][C][U][G] =  1.800;
+ int22_ar[C][G][C][A][C][G][U][G] =  2.000;
+ int22_ar[C][G][C][A][C][U][U][G] =  1.600;
+ int22_ar[C][G][C][A][G][A][U][G] =  0.900;
+ int22_ar[C][G][C][A][G][C][U][G] =  2.200;
+ int22_ar[C][G][C][A][G][G][U][G] =  2.000;
+ int22_ar[C][G][C][A][G][U][U][G] =  2.000;
+ int22_ar[C][G][C][A][U][A][U][G] =  2.000;
+ int22_ar[C][G][C][A][U][C][U][G] =  2.000;
+ int22_ar[C][G][C][A][U][G][U][G] =  2.000;
+ int22_ar[C][G][C][A][U][U][U][G] =  2.000;
+ int22_ar[C][G][C][C][A][A][U][G] =  1.900;
+ int22_ar[C][G][C][C][A][C][U][G] =  2.200;
+ int22_ar[C][G][C][C][A][G][U][G] =  2.000;
+ int22_ar[C][G][C][C][A][U][U][G] =  2.100;
+ int22_ar[C][G][C][C][C][A][U][G] =  1.900;
+ int22_ar[C][G][C][C][C][C][U][G] =  2.200;
+ int22_ar[C][G][C][C][C][G][U][G] =  2.000;
+ int22_ar[C][G][C][C][C][U][U][G] =  2.100;
+ int22_ar[C][G][C][C][G][A][U][G] =  2.000;
+ int22_ar[C][G][C][C][G][C][U][G] =  2.000;
+ int22_ar[C][G][C][C][G][G][U][G] =  2.000;
+ int22_ar[C][G][C][C][G][U][U][G] =  2.000;
+ int22_ar[C][G][C][C][U][A][U][G] =  1.900;
+ int22_ar[C][G][C][C][U][C][U][G] =  2.200;
+ int22_ar[C][G][C][C][U][G][U][G] =  2.000;
+ int22_ar[C][G][C][C][U][U][U][G] =  2.100;
+ int22_ar[C][G][C][G][A][A][U][G] =  0.900;
+ int22_ar[C][G][C][G][A][C][U][G] =  2.200;
+ int22_ar[C][G][C][G][A][G][U][G] =  2.000;
+ int22_ar[C][G][C][G][A][U][U][G] =  2.000;
+ int22_ar[C][G][C][G][C][A][U][G] =  2.000;
+ int22_ar[C][G][C][G][C][C][U][G] =  2.000;
+ int22_ar[C][G][C][G][C][G][U][G] =  2.000;
+ int22_ar[C][G][C][G][C][U][U][G] =  2.000;
+ int22_ar[C][G][C][G][G][A][U][G] =  1.300;
+ int22_ar[C][G][C][G][G][C][U][G] =  2.200;
+ int22_ar[C][G][C][G][G][G][U][G] =  2.000;
+ int22_ar[C][G][C][G][G][U][U][G] =  2.000;
+ int22_ar[C][G][C][G][U][A][U][G] = -0.900;
+ int22_ar[C][G][C][G][U][C][U][G] =  0.400;
+ int22_ar[C][G][C][G][U][G][U][G] =  2.000;
+ int22_ar[C][G][C][G][U][U][U][G] =  0.300;
+ int22_ar[C][G][C][U][A][A][U][G] =  2.000;
+ int22_ar[C][G][C][U][A][C][U][G] =  2.000;
+ int22_ar[C][G][C][U][A][G][U][G] =  2.000;
+ int22_ar[C][G][C][U][A][U][U][G] =  2.000;
+ int22_ar[C][G][C][U][C][A][U][G] =  1.600;
+ int22_ar[C][G][C][U][C][C][U][G] =  1.900;
+ int22_ar[C][G][C][U][C][G][U][G] =  2.000;
+ int22_ar[C][G][C][U][C][U][U][G] =  1.800;
+ int22_ar[C][G][C][U][G][A][U][G] =  0.400;
+ int22_ar[C][G][C][U][G][C][U][G] =  1.700;
+ int22_ar[C][G][C][U][G][G][U][G] =  2.000;
+ int22_ar[C][G][C][U][G][U][U][G] =  1.500;
+ int22_ar[C][G][C][U][U][A][U][G] =  1.100;
+ int22_ar[C][G][C][U][U][C][U][G] =  1.400;
+ int22_ar[C][G][C][U][U][G][U][G] =  2.000;
+ int22_ar[C][G][C][U][U][U][U][G] =  1.200;
+ int22_ar[C][G][G][A][A][A][U][G] =  1.000;
+ int22_ar[C][G][G][A][A][C][U][G] =  2.000;
+ int22_ar[C][G][G][A][A][G][U][G] =  1.800;
+ int22_ar[C][G][G][A][A][U][U][G] =  1.800;
+ int22_ar[C][G][G][A][C][A][U][G] =  0.600;
+ int22_ar[C][G][G][A][C][C][U][G] =  2.000;
+ int22_ar[C][G][G][A][C][G][U][G] =  1.300;
+ int22_ar[C][G][G][A][C][U][U][G] =  0.400;
+ int22_ar[C][G][G][A][G][A][U][G] =  0.000;
+ int22_ar[C][G][G][A][G][C][U][G] =  2.000;
+ int22_ar[C][G][G][A][G][G][U][G] =  0.700;
+ int22_ar[C][G][G][A][G][U][U][G] =  1.600;
+ int22_ar[C][G][G][A][U][A][U][G] =  2.000;
+ int22_ar[C][G][G][A][U][C][U][G] =  2.000;
+ int22_ar[C][G][G][A][U][G][U][G] =  2.000;
+ int22_ar[C][G][G][A][U][U][U][G] =  2.000;
+ int22_ar[C][G][G][C][A][A][U][G] =  1.000;
+ int22_ar[C][G][G][C][A][C][U][G] =  2.000;
+ int22_ar[C][G][G][C][A][G][U][G] =  1.800;
+ int22_ar[C][G][G][C][A][U][U][G] =  0.800;
+ int22_ar[C][G][G][C][C][A][U][G] =  2.000;
+ int22_ar[C][G][G][C][C][C][U][G] =  2.000;
+ int22_ar[C][G][G][C][C][G][U][G] =  2.400;
+ int22_ar[C][G][G][C][C][U][U][G] =  1.800;
+ int22_ar[C][G][G][C][G][A][U][G] =  2.000;
+ int22_ar[C][G][G][C][G][C][U][G] =  2.000;
+ int22_ar[C][G][G][C][G][G][U][G] =  2.000;
+ int22_ar[C][G][G][C][G][U][U][G] =  2.000;
+ int22_ar[C][G][G][C][U][A][U][G] =  2.000;
+ int22_ar[C][G][G][C][U][C][U][G] =  2.000;
+ int22_ar[C][G][G][C][U][G][U][G] =  2.400;
+ int22_ar[C][G][G][C][U][U][U][G] =  1.800;
+ int22_ar[C][G][G][G][A][A][U][G] =  0.000;
+ int22_ar[C][G][G][G][A][C][U][G] =  2.000;
+ int22_ar[C][G][G][G][A][G][U][G] =  0.700;
+ int22_ar[C][G][G][G][A][U][U][G] =  1.600;
+ int22_ar[C][G][G][G][C][A][U][G] =  2.000;
+ int22_ar[C][G][G][G][C][C][U][G] =  2.000;
+ int22_ar[C][G][G][G][C][G][U][G] =  2.000;
+ int22_ar[C][G][G][G][C][U][U][G] =  2.000;
+ int22_ar[C][G][G][G][G][A][U][G] =  0.400;
+ int22_ar[C][G][G][G][G][C][U][G] =  2.000;
+ int22_ar[C][G][G][G][G][G][U][G] =  1.100;
+ int22_ar[C][G][G][G][G][U][U][G] =  1.200;
+ int22_ar[C][G][G][G][U][A][U][G] =  0.000;
+ int22_ar[C][G][G][G][U][C][U][G] =  2.000;
+ int22_ar[C][G][G][G][U][G][U][G] =  0.000;
+ int22_ar[C][G][G][G][U][U][U][G] = -2.000;
+ int22_ar[C][G][G][U][A][A][U][G] =  2.000;
+ int22_ar[C][G][G][U][A][C][U][G] =  2.000;
+ int22_ar[C][G][G][U][A][G][U][G] =  2.000;
+ int22_ar[C][G][G][U][A][U][U][G] =  2.000;
+ int22_ar[C][G][G][U][C][A][U][G] =  1.700;
+ int22_ar[C][G][G][U][C][C][U][G] =  2.000;
+ int22_ar[C][G][G][U][C][G][U][G] =  2.100;
+ int22_ar[C][G][G][U][C][U][U][G] =  1.500;
+ int22_ar[C][G][G][U][G][A][U][G] =  1.300;
+ int22_ar[C][G][G][U][G][C][U][G] =  2.000;
+ int22_ar[C][G][G][U][G][G][U][G] =  1.200;
+ int22_ar[C][G][G][U][G][U][U][G] = -0.700;
+ int22_ar[C][G][G][U][U][A][U][G] =  2.000;
+ int22_ar[C][G][G][U][U][C][U][G] =  2.000;
+ int22_ar[C][G][G][U][U][G][U][G] =  1.900;
+ int22_ar[C][G][G][U][U][U][U][G] =  1.800;
+ int22_ar[C][G][U][A][A][A][U][G] =  2.000;
+ int22_ar[C][G][U][A][A][C][U][G] =  2.700;
+ int22_ar[C][G][U][A][A][G][U][G] =  0.300;
+ int22_ar[C][G][U][A][A][U][U][G] =  2.200;
+ int22_ar[C][G][U][A][C][A][U][G] =  2.000;
+ int22_ar[C][G][U][A][C][C][U][G] =  1.600;
+ int22_ar[C][G][U][A][C][G][U][G] = -1.100;
+ int22_ar[C][G][U][A][C][U][U][G] =  0.700;
+ int22_ar[C][G][U][A][G][A][U][G] =  2.000;
+ int22_ar[C][G][U][A][G][C][U][G] =  2.000;
+ int22_ar[C][G][U][A][G][G][U][G] =  0.100;
+ int22_ar[C][G][U][A][G][U][U][G] =  1.900;
+ int22_ar[C][G][U][A][U][A][U][G] =  2.000;
+ int22_ar[C][G][U][A][U][C][U][G] =  2.000;
+ int22_ar[C][G][U][A][U][G][U][G] =  2.000;
+ int22_ar[C][G][U][A][U][U][U][G] =  2.000;
+ int22_ar[C][G][U][C][A][A][U][G] =  2.000;
+ int22_ar[C][G][U][C][A][C][U][G] =  2.100;
+ int22_ar[C][G][U][C][A][G][U][G] = -0.700;
+ int22_ar[C][G][U][C][A][U][U][G] =  1.200;
+ int22_ar[C][G][U][C][C][A][U][G] =  2.000;
+ int22_ar[C][G][U][C][C][C][U][G] =  2.100;
+ int22_ar[C][G][U][C][C][G][U][G] =  0.300;
+ int22_ar[C][G][U][C][C][U][U][G] =  1.200;
+ int22_ar[C][G][U][C][G][A][U][G] =  2.000;
+ int22_ar[C][G][U][C][G][C][U][G] =  2.000;
+ int22_ar[C][G][U][C][G][G][U][G] =  2.000;
+ int22_ar[C][G][U][C][G][U][U][G] =  2.000;
+ int22_ar[C][G][U][C][U][A][U][G] =  2.000;
+ int22_ar[C][G][U][C][U][C][U][G] =  2.100;
+ int22_ar[C][G][U][C][U][G][U][G] =  0.300;
+ int22_ar[C][G][U][C][U][U][U][G] =  1.200;
+ int22_ar[C][G][U][G][A][A][U][G] =  2.000;
+ int22_ar[C][G][U][G][A][C][U][G] =  2.000;
+ int22_ar[C][G][U][G][A][G][U][G] =  0.100;
+ int22_ar[C][G][U][G][A][U][U][G] =  1.900;
+ int22_ar[C][G][U][G][C][A][U][G] =  2.000;
+ int22_ar[C][G][U][G][C][C][U][G] =  2.000;
+ int22_ar[C][G][U][G][C][G][U][G] =  2.000;
+ int22_ar[C][G][U][G][C][U][U][G] =  2.000;
+ int22_ar[C][G][U][G][G][A][U][G] =  2.000;
+ int22_ar[C][G][U][G][G][C][U][G] =  2.000;
+ int22_ar[C][G][U][G][G][G][U][G] = -0.300;
+ int22_ar[C][G][U][G][G][U][U][G] =  1.500;
+ int22_ar[C][G][U][G][U][A][U][G] =  2.000;
+ int22_ar[C][G][U][G][U][C][U][G] =  0.300;
+ int22_ar[C][G][U][G][U][G][U][G] = -3.500;
+ int22_ar[C][G][U][G][U][U][U][G] =  0.200;
+ int22_ar[C][G][U][U][A][A][U][G] =  2.000;
+ int22_ar[C][G][U][U][A][C][U][G] =  2.000;
+ int22_ar[C][G][U][U][A][G][U][G] =  2.000;
+ int22_ar[C][G][U][U][A][U][U][G] =  2.000;
+ int22_ar[C][G][U][U][C][A][U][G] =  2.000;
+ int22_ar[C][G][U][U][C][C][U][G] =  1.800;
+ int22_ar[C][G][U][U][C][G][U][G] =  0.000;
+ int22_ar[C][G][U][U][C][U][U][G] =  0.900;
+ int22_ar[C][G][U][U][G][A][U][G] =  2.000;
+ int22_ar[C][G][U][U][G][C][U][G] =  1.500;
+ int22_ar[C][G][U][U][G][G][U][G] = -2.200;
+ int22_ar[C][G][U][U][G][U][U][G] =  1.500;
+ int22_ar[C][G][U][U][U][A][U][G] =  2.000;
+ int22_ar[C][G][U][U][U][C][U][G] =  1.200;
+ int22_ar[C][G][U][U][U][G][U][G] =  0.300;
+ int22_ar[C][G][U][U][U][U][U][G] =  0.300;
+ int22_ar[G][C][A][A][A][A][A][U] =  2.100;
+ int22_ar[G][C][A][A][A][C][A][U] =  1.800;
+ int22_ar[G][C][A][A][A][G][A][U] =  0.700;
+ int22_ar[G][C][A][A][A][U][A][U] =  2.000;
+ int22_ar[G][C][A][A][C][A][A][U] =  1.900;
+ int22_ar[G][C][A][A][C][C][A][U] =  1.600;
+ int22_ar[G][C][A][A][C][G][A][U] =  0.500;
+ int22_ar[G][C][A][A][C][U][A][U] =  2.000;
+ int22_ar[G][C][A][A][G][A][A][U] =  0.900;
+ int22_ar[G][C][A][A][G][C][A][U] =  0.600;
+ int22_ar[G][C][A][A][G][G][A][U] = -0.500;
+ int22_ar[G][C][A][A][G][U][A][U] =  2.000;
+ int22_ar[G][C][A][A][U][A][A][U] =  2.000;
+ int22_ar[G][C][A][A][U][C][A][U] =  2.000;
+ int22_ar[G][C][A][A][U][G][A][U] =  2.000;
+ int22_ar[G][C][A][A][U][U][A][U] =  2.000;
+ int22_ar[G][C][A][C][A][A][A][U] =  2.000;
+ int22_ar[G][C][A][C][A][C][A][U] =  1.700;
+ int22_ar[G][C][A][C][A][G][A][U] =  0.600;
+ int22_ar[G][C][A][C][A][U][A][U] =  2.000;
+ int22_ar[G][C][A][C][C][A][A][U] =  2.400;
+ int22_ar[G][C][A][C][C][C][A][U] =  1.500;
+ int22_ar[G][C][A][C][C][G][A][U] =  1.400;
+ int22_ar[G][C][A][C][C][U][A][U] =  2.000;
+ int22_ar[G][C][A][C][G][A][A][U] =  2.000;
+ int22_ar[G][C][A][C][G][C][A][U] =  2.000;
+ int22_ar[G][C][A][C][G][G][A][U] =  2.000;
+ int22_ar[G][C][A][C][G][U][A][U] =  2.000;
+ int22_ar[G][C][A][C][U][A][A][U] =  2.400;
+ int22_ar[G][C][A][C][U][C][A][U] =  1.500;
+ int22_ar[G][C][A][C][U][G][A][U] =  1.400;
+ int22_ar[G][C][A][C][U][U][A][U] =  2.000;
+ int22_ar[G][C][A][G][A][A][A][U] =  0.900;
+ int22_ar[G][C][A][G][A][C][A][U] =  0.600;
+ int22_ar[G][C][A][G][A][G][A][U] = -0.500;
+ int22_ar[G][C][A][G][A][U][A][U] =  2.000;
+ int22_ar[G][C][A][G][C][A][A][U] =  2.000;
+ int22_ar[G][C][A][G][C][C][A][U] =  2.000;
+ int22_ar[G][C][A][G][C][G][A][U] =  2.000;
+ int22_ar[G][C][A][G][C][U][A][U] =  2.000;
+ int22_ar[G][C][A][G][G][A][A][U] =  1.400;
+ int22_ar[G][C][A][G][G][C][A][U] =  1.100;
+ int22_ar[G][C][A][G][G][G][A][U] =  0.000;
+ int22_ar[G][C][A][G][G][U][A][U] =  2.000;
+ int22_ar[G][C][A][G][U][A][A][U] =  0.700;
+ int22_ar[G][C][A][G][U][C][A][U] = -0.600;
+ int22_ar[G][C][A][G][U][G][A][U] =  0.100;
+ int22_ar[G][C][A][G][U][U][A][U] =  2.000;
+ int22_ar[G][C][A][U][A][A][A][U] =  2.000;
+ int22_ar[G][C][A][U][A][C][A][U] =  2.000;
+ int22_ar[G][C][A][U][A][G][A][U] =  2.000;
+ int22_ar[G][C][A][U][A][U][A][U] =  2.000;
+ int22_ar[G][C][A][U][C][A][A][U] =  2.400;
+ int22_ar[G][C][A][U][C][C][A][U] =  1.500;
+ int22_ar[G][C][A][U][C][G][A][U] =  1.400;
+ int22_ar[G][C][A][U][C][U][A][U] =  2.000;
+ int22_ar[G][C][A][U][G][A][A][U] =  1.700;
+ int22_ar[G][C][A][U][G][C][A][U] =  0.400;
+ int22_ar[G][C][A][U][G][G][A][U] =  1.100;
+ int22_ar[G][C][A][U][G][U][A][U] =  2.000;
+ int22_ar[G][C][A][U][U][A][A][U] =  2.000;
+ int22_ar[G][C][A][U][U][C][A][U] =  0.700;
+ int22_ar[G][C][A][U][U][G][A][U] =  1.500;
+ int22_ar[G][C][A][U][U][U][A][U] =  2.000;
+ int22_ar[G][C][C][A][A][A][A][U] =  1.900;
+ int22_ar[G][C][C][A][A][C][A][U] =  2.500;
+ int22_ar[G][C][C][A][A][G][A][U] =  2.000;
+ int22_ar[G][C][C][A][A][U][A][U] =  2.500;
+ int22_ar[G][C][C][A][C][A][A][U] =  1.600;
+ int22_ar[G][C][C][A][C][C][A][U] =  1.600;
+ int22_ar[G][C][C][A][C][G][A][U] =  2.000;
+ int22_ar[G][C][C][A][C][U][A][U] =  1.700;
+ int22_ar[G][C][C][A][G][A][A][U] =  0.600;
+ int22_ar[G][C][C][A][G][C][A][U] =  1.600;
+ int22_ar[G][C][C][A][G][G][A][U] =  2.000;
+ int22_ar[G][C][C][A][G][U][A][U] =  1.700;
+ int22_ar[G][C][C][A][U][A][A][U] =  2.000;
+ int22_ar[G][C][C][A][U][C][A][U] =  2.000;
+ int22_ar[G][C][C][A][U][G][A][U] =  2.000;
+ int22_ar[G][C][C][A][U][U][A][U] =  2.000;
+ int22_ar[G][C][C][C][A][A][A][U] =  1.700;
+ int22_ar[G][C][C][C][A][C][A][U] =  1.700;
+ int22_ar[G][C][C][C][A][G][A][U] =  2.000;
+ int22_ar[G][C][C][C][A][U][A][U] =  1.800;
+ int22_ar[G][C][C][C][C][A][A][U] =  1.600;
+ int22_ar[G][C][C][C][C][C][A][U] =  1.600;
+ int22_ar[G][C][C][C][C][G][A][U] =  2.000;
+ int22_ar[G][C][C][C][C][U][A][U] =  1.600;
+ int22_ar[G][C][C][C][G][A][A][U] =  2.000;
+ int22_ar[G][C][C][C][G][C][A][U] =  2.000;
+ int22_ar[G][C][C][C][G][G][A][U] =  2.000;
+ int22_ar[G][C][C][C][G][U][A][U] =  2.000;
+ int22_ar[G][C][C][C][U][A][A][U] =  1.600;
+ int22_ar[G][C][C][C][U][C][A][U] =  1.600;
+ int22_ar[G][C][C][C][U][G][A][U] =  2.000;
+ int22_ar[G][C][C][C][U][U][A][U] =  1.600;
+ int22_ar[G][C][C][G][A][A][A][U] =  0.600;
+ int22_ar[G][C][C][G][A][C][A][U] =  1.600;
+ int22_ar[G][C][C][G][A][G][A][U] =  2.000;
+ int22_ar[G][C][C][G][A][U][A][U] =  1.700;
+ int22_ar[G][C][C][G][C][A][A][U] =  2.000;
+ int22_ar[G][C][C][G][C][C][A][U] =  2.000;
+ int22_ar[G][C][C][G][C][G][A][U] =  2.000;
+ int22_ar[G][C][C][G][C][U][A][U] =  2.000;
+ int22_ar[G][C][C][G][G][A][A][U] =  1.200;
+ int22_ar[G][C][C][G][G][C][A][U] =  1.800;
+ int22_ar[G][C][C][G][G][G][A][U] =  2.000;
+ int22_ar[G][C][C][G][G][U][A][U] =  1.800;
+ int22_ar[G][C][C][G][U][A][A][U] = -0.500;
+ int22_ar[G][C][C][G][U][C][A][U] =  0.500;
+ int22_ar[G][C][C][G][U][G][A][U] =  2.000;
+ int22_ar[G][C][C][G][U][U][A][U] =  0.500;
+ int22_ar[G][C][C][U][A][A][A][U] =  2.000;
+ int22_ar[G][C][C][U][A][C][A][U] =  2.000;
+ int22_ar[G][C][C][U][A][G][A][U] =  2.000;
+ int22_ar[G][C][C][U][A][U][A][U] =  2.000;
+ int22_ar[G][C][C][U][C][A][A][U] =  1.600;
+ int22_ar[G][C][C][U][C][C][A][U] =  1.600;
+ int22_ar[G][C][C][U][C][G][A][U] =  2.000;
+ int22_ar[G][C][C][U][C][U][A][U] =  1.600;
+ int22_ar[G][C][C][U][G][A][A][U] =  0.400;
+ int22_ar[G][C][C][U][G][C][A][U] =  1.400;
+ int22_ar[G][C][C][U][G][G][A][U] =  2.000;
+ int22_ar[G][C][C][U][G][U][A][U] =  1.500;
+ int22_ar[G][C][C][U][U][A][A][U] =  0.800;
+ int22_ar[G][C][C][U][U][C][A][U] =  0.800;
+ int22_ar[G][C][C][U][U][G][A][U] =  2.000;
+ int22_ar[G][C][C][U][U][U][A][U] =  0.800;
+ int22_ar[G][C][G][A][A][A][A][U] =  0.100;
+ int22_ar[G][C][G][A][A][C][A][U] =  2.000;
+ int22_ar[G][C][G][A][A][G][A][U] =  1.800;
+ int22_ar[G][C][G][A][A][U][A][U] =  0.400;
+ int22_ar[G][C][G][A][C][A][A][U] = -0.100;
+ int22_ar[G][C][G][A][C][C][A][U] =  2.000;
+ int22_ar[G][C][G][A][C][G][A][U] =  1.500;
+ int22_ar[G][C][G][A][C][U][A][U] = -0.900;
+ int22_ar[G][C][G][A][G][A][A][U] = -1.100;
+ int22_ar[G][C][G][A][G][C][A][U] =  2.000;
+ int22_ar[G][C][G][A][G][G][A][U] =  0.500;
+ int22_ar[G][C][G][A][G][U][A][U] = -0.100;
+ int22_ar[G][C][G][A][U][A][A][U] =  2.000;
+ int22_ar[G][C][G][A][U][C][A][U] =  2.000;
+ int22_ar[G][C][G][A][U][G][A][U] =  2.000;
+ int22_ar[G][C][G][A][U][U][A][U] =  2.000;
+ int22_ar[G][C][G][C][A][A][A][U] =  0.000;
+ int22_ar[G][C][G][C][A][C][A][U] =  2.000;
+ int22_ar[G][C][G][C][A][G][A][U] =  1.600;
+ int22_ar[G][C][G][C][A][U][A][U] = -0.800;
+ int22_ar[G][C][G][C][C][A][A][U] =  0.800;
+ int22_ar[G][C][G][C][C][C][A][U] =  2.000;
+ int22_ar[G][C][G][C][C][G][A][U] =  2.100;
+ int22_ar[G][C][G][C][C][U][A][U] =  0.100;
+ int22_ar[G][C][G][C][G][A][A][U] =  2.000;
+ int22_ar[G][C][G][C][G][C][A][U] =  2.000;
+ int22_ar[G][C][G][C][G][G][A][U] =  2.000;
+ int22_ar[G][C][G][C][G][U][A][U] =  2.000;
+ int22_ar[G][C][G][C][U][A][A][U] =  0.800;
+ int22_ar[G][C][G][C][U][C][A][U] =  2.000;
+ int22_ar[G][C][G][C][U][G][A][U] =  2.100;
+ int22_ar[G][C][G][C][U][U][A][U] =  0.100;
+ int22_ar[G][C][G][G][A][A][A][U] = -1.100;
+ int22_ar[G][C][G][G][A][C][A][U] =  2.000;
+ int22_ar[G][C][G][G][A][G][A][U] =  0.500;
+ int22_ar[G][C][G][G][A][U][A][U] = -0.100;
+ int22_ar[G][C][G][G][C][A][A][U] =  2.000;
+ int22_ar[G][C][G][G][C][C][A][U] =  2.000;
+ int22_ar[G][C][G][G][C][G][A][U] =  2.000;
+ int22_ar[G][C][G][G][C][U][A][U] =  2.000;
+ int22_ar[G][C][G][G][G][A][A][U] = -0.600;
+ int22_ar[G][C][G][G][G][C][A][U] =  2.000;
+ int22_ar[G][C][G][G][G][G][A][U] =  1.100;
+ int22_ar[G][C][G][G][G][U][A][U] = -0.300;
+ int22_ar[G][C][G][G][U][A][A][U] = -0.500;
+ int22_ar[G][C][G][G][U][C][A][U] =  2.000;
+ int22_ar[G][C][G][G][U][G][A][U] =  0.400;
+ int22_ar[G][C][G][G][U][U][A][U] = -3.100;
+ int22_ar[G][C][G][U][A][A][A][U] =  2.000;
+ int22_ar[G][C][G][U][A][C][A][U] =  2.000;
+ int22_ar[G][C][G][U][A][G][A][U] =  2.000;
+ int22_ar[G][C][G][U][A][U][A][U] =  2.000;
+ int22_ar[G][C][G][U][C][A][A][U] =  0.800;
+ int22_ar[G][C][G][U][C][C][A][U] =  2.000;
+ int22_ar[G][C][G][U][C][G][A][U] =  2.100;
+ int22_ar[G][C][G][U][C][U][A][U] =  0.100;
+ int22_ar[G][C][G][U][G][A][A][U] =  0.500;
+ int22_ar[G][C][G][U][G][C][A][U] =  2.000;
+ int22_ar[G][C][G][U][G][G][A][U] =  1.300;
+ int22_ar[G][C][G][U][G][U][A][U] = -2.100;
+ int22_ar[G][C][G][U][U][A][A][U] =  0.800;
+ int22_ar[G][C][G][U][U][C][A][U] =  2.000;
+ int22_ar[G][C][G][U][U][G][A][U] =  1.700;
+ int22_ar[G][C][G][U][U][U][A][U] =  0.100;
+ int22_ar[G][C][U][A][A][A][A][U] =  2.000;
+ int22_ar[G][C][U][A][A][C][A][U] =  1.500;
+ int22_ar[G][C][U][A][A][G][A][U] =  0.000;
+ int22_ar[G][C][U][A][A][U][A][U] =  2.100;
+ int22_ar[G][C][U][A][C][A][A][U] =  2.000;
+ int22_ar[G][C][U][A][C][C][A][U] =  0.600;
+ int22_ar[G][C][U][A][C][G][A][U] = -1.300;
+ int22_ar[G][C][U][A][C][U][A][U] =  0.900;
+ int22_ar[G][C][U][A][G][A][A][U] =  2.000;
+ int22_ar[G][C][U][A][G][C][A][U] =  0.700;
+ int22_ar[G][C][U][A][G][G][A][U] = -0.500;
+ int22_ar[G][C][U][A][G][U][A][U] =  1.700;
+ int22_ar[G][C][U][A][U][A][A][U] =  2.000;
+ int22_ar[G][C][U][A][U][C][A][U] =  2.000;
+ int22_ar[G][C][U][A][U][G][A][U] =  2.000;
+ int22_ar[G][C][U][A][U][U][A][U] =  2.000;
+ int22_ar[G][C][U][C][A][A][A][U] =  2.000;
+ int22_ar[G][C][U][C][A][C][A][U] =  0.700;
+ int22_ar[G][C][U][C][A][G][A][U] = -1.200;
+ int22_ar[G][C][U][C][A][U][A][U] =  1.000;
+ int22_ar[G][C][U][C][C][A][A][U] =  2.000;
+ int22_ar[G][C][U][C][C][C][A][U] =  0.600;
+ int22_ar[G][C][U][C][C][G][A][U] = -0.300;
+ int22_ar[G][C][U][C][C][U][A][U] =  0.800;
+ int22_ar[G][C][U][C][G][A][A][U] =  2.000;
+ int22_ar[G][C][U][C][G][C][A][U] =  2.000;
+ int22_ar[G][C][U][C][G][G][A][U] =  2.000;
+ int22_ar[G][C][U][C][G][U][A][U] =  2.000;
+ int22_ar[G][C][U][C][U][A][A][U] =  2.000;
+ int22_ar[G][C][U][C][U][C][A][U] =  0.600;
+ int22_ar[G][C][U][C][U][G][A][U] = -0.300;
+ int22_ar[G][C][U][C][U][U][A][U] =  0.800;
+ int22_ar[G][C][U][G][A][A][A][U] =  2.000;
+ int22_ar[G][C][U][G][A][C][A][U] =  0.700;
+ int22_ar[G][C][U][G][A][G][A][U] = -0.500;
+ int22_ar[G][C][U][G][A][U][A][U] =  1.700;
+ int22_ar[G][C][U][G][C][A][A][U] =  2.000;
+ int22_ar[G][C][U][G][C][C][A][U] =  2.000;
+ int22_ar[G][C][U][G][C][G][A][U] =  2.000;
+ int22_ar[G][C][U][G][C][U][A][U] =  2.000;
+ int22_ar[G][C][U][G][G][A][A][U] =  2.000;
+ int22_ar[G][C][U][G][G][C][A][U] =  0.800;
+ int22_ar[G][C][U][G][G][G][A][U] = -0.700;
+ int22_ar[G][C][U][G][G][U][A][U] =  1.400;
+ int22_ar[G][C][U][G][U][A][A][U] =  2.000;
+ int22_ar[G][C][U][G][U][C][A][U] = -0.500;
+ int22_ar[G][C][U][G][U][G][A][U] = -3.500;
+ int22_ar[G][C][U][G][U][U][A][U] =  0.500;
+ int22_ar[G][C][U][U][A][A][A][U] =  2.000;
+ int22_ar[G][C][U][U][A][C][A][U] =  2.000;
+ int22_ar[G][C][U][U][A][G][A][U] =  2.000;
+ int22_ar[G][C][U][U][A][U][A][U] =  2.000;
+ int22_ar[G][C][U][U][C][A][A][U] =  2.000;
+ int22_ar[G][C][U][U][C][C][A][U] =  0.600;
+ int22_ar[G][C][U][U][C][G][A][U] = -0.300;
+ int22_ar[G][C][U][U][C][U][A][U] =  0.800;
+ int22_ar[G][C][U][U][G][A][A][U] =  2.000;
+ int22_ar[G][C][U][U][G][C][A][U] =  0.500;
+ int22_ar[G][C][U][U][G][G][A][U] = -2.500;
+ int22_ar[G][C][U][U][G][U][A][U] =  1.500;
+ int22_ar[G][C][U][U][U][A][A][U] =  2.000;
+ int22_ar[G][C][U][U][U][C][A][U] = -0.200;
+ int22_ar[G][C][U][U][U][G][A][U] = -0.300;
+ int22_ar[G][C][U][U][U][U][A][U] =  0.000;
+ int22_ar[G][C][A][A][A][A][C][G] =  0.500;
+ int22_ar[G][C][A][A][A][C][C][G] =  1.100;
+ int22_ar[G][C][A][A][A][G][C][G] =  0.400;
+ int22_ar[G][C][A][A][A][U][C][G] =  2.000;
+ int22_ar[G][C][A][A][C][A][C][G] =  1.300;
+ int22_ar[G][C][A][A][C][C][C][G] =  1.000;
+ int22_ar[G][C][A][A][C][G][C][G] =  0.700;
+ int22_ar[G][C][A][A][C][U][C][G] =  2.000;
+ int22_ar[G][C][A][A][G][A][C][G] = -0.200;
+ int22_ar[G][C][A][A][G][C][C][G] =  0.700;
+ int22_ar[G][C][A][A][G][G][C][G] = -0.500;
+ int22_ar[G][C][A][A][G][U][C][G] =  2.000;
+ int22_ar[G][C][A][A][U][A][C][G] =  2.000;
+ int22_ar[G][C][A][A][U][C][C][G] =  2.000;
+ int22_ar[G][C][A][A][U][G][C][G] =  2.000;
+ int22_ar[G][C][A][A][U][U][C][G] =  2.000;
+ int22_ar[G][C][A][C][A][A][C][G] =  0.600;
+ int22_ar[G][C][A][C][A][C][C][G] =  1.100;
+ int22_ar[G][C][A][C][A][G][C][G] =  0.500;
+ int22_ar[G][C][A][C][A][U][C][G] =  2.000;
+ int22_ar[G][C][A][C][C][A][C][G] =  2.200;
+ int22_ar[G][C][A][C][C][C][C][G] =  1.900;
+ int22_ar[G][C][A][C][C][G][C][G] =  0.700;
+ int22_ar[G][C][A][C][C][U][C][G] =  2.000;
+ int22_ar[G][C][A][C][G][A][C][G] =  2.000;
+ int22_ar[G][C][A][C][G][C][C][G] =  2.000;
+ int22_ar[G][C][A][C][G][G][C][G] =  2.000;
+ int22_ar[G][C][A][C][G][U][C][G] =  2.000;
+ int22_ar[G][C][A][C][U][A][C][G] =  2.000;
+ int22_ar[G][C][A][C][U][C][C][G] =  1.100;
+ int22_ar[G][C][A][C][U][G][C][G] =  0.500;
+ int22_ar[G][C][A][C][U][U][C][G] =  2.000;
+ int22_ar[G][C][A][G][A][A][C][G] =  0.000;
+ int22_ar[G][C][A][G][A][C][C][G] = -1.000;
+ int22_ar[G][C][A][G][A][G][C][G] = -0.700;
+ int22_ar[G][C][A][G][A][U][C][G] =  2.000;
+ int22_ar[G][C][A][G][C][A][C][G] =  2.000;
+ int22_ar[G][C][A][G][C][C][C][G] =  2.000;
+ int22_ar[G][C][A][G][C][G][C][G] =  2.000;
+ int22_ar[G][C][A][G][C][U][C][G] =  2.000;
+ int22_ar[G][C][A][G][G][A][C][G] =  1.100;
+ int22_ar[G][C][A][G][G][C][C][G] =  0.800;
+ int22_ar[G][C][A][G][G][G][C][G] = -0.200;
+ int22_ar[G][C][A][G][G][U][C][G] =  2.000;
+ int22_ar[G][C][A][G][U][A][C][G] = -0.100;
+ int22_ar[G][C][A][G][U][C][C][G] = -1.600;
+ int22_ar[G][C][A][G][U][G][C][G] = -0.600;
+ int22_ar[G][C][A][G][U][U][C][G] =  2.000;
+ int22_ar[G][C][A][U][A][A][C][G] =  2.000;
+ int22_ar[G][C][A][U][A][C][C][G] =  2.000;
+ int22_ar[G][C][A][U][A][G][C][G] =  2.000;
+ int22_ar[G][C][A][U][A][U][C][G] =  2.000;
+ int22_ar[G][C][A][U][C][A][C][G] =  2.000;
+ int22_ar[G][C][A][U][C][C][C][G] =  1.100;
+ int22_ar[G][C][A][U][C][G][C][G] =  1.000;
+ int22_ar[G][C][A][U][C][U][C][G] =  2.000;
+ int22_ar[G][C][A][U][G][A][C][G] =  0.900;
+ int22_ar[G][C][A][U][G][C][C][G] = -0.100;
+ int22_ar[G][C][A][U][G][G][C][G] =  0.600;
+ int22_ar[G][C][A][U][G][U][C][G] =  2.000;
+ int22_ar[G][C][A][U][U][A][C][G] =  1.400;
+ int22_ar[G][C][A][U][U][C][C][G] =  0.300;
+ int22_ar[G][C][A][U][U][G][C][G] =  1.400;
+ int22_ar[G][C][A][U][U][U][C][G] =  2.000;
+ int22_ar[G][C][C][A][A][A][C][G] =  1.100;
+ int22_ar[G][C][C][A][A][C][C][G] =  1.700;
+ int22_ar[G][C][C][A][A][G][C][G] =  2.000;
+ int22_ar[G][C][C][A][A][U][C][G] =  1.800;
+ int22_ar[G][C][C][A][C][A][C][G] =  1.000;
+ int22_ar[G][C][C][A][C][C][C][G] =  1.000;
+ int22_ar[G][C][C][A][C][G][C][G] =  2.000;
+ int22_ar[G][C][C][A][C][U][C][G] =  1.100;
+ int22_ar[G][C][C][A][G][A][C][G] = -0.400;
+ int22_ar[G][C][C][A][G][C][C][G] =  1.100;
+ int22_ar[G][C][C][A][G][G][C][G] =  2.000;
+ int22_ar[G][C][C][A][G][U][C][G] =  1.200;
+ int22_ar[G][C][C][A][U][A][C][G] =  2.000;
+ int22_ar[G][C][C][A][U][C][C][G] =  2.000;
+ int22_ar[G][C][C][A][U][G][C][G] =  2.000;
+ int22_ar[G][C][C][A][U][U][C][G] =  2.000;
+ int22_ar[G][C][C][C][A][A][C][G] =  1.500;
+ int22_ar[G][C][C][C][A][C][C][G] =  1.500;
+ int22_ar[G][C][C][C][A][G][C][G] =  2.000;
+ int22_ar[G][C][C][C][A][U][C][G] =  1.500;
+ int22_ar[G][C][C][C][C][A][C][G] =  1.300;
+ int22_ar[G][C][C][C][C][C][C][G] =  1.300;
+ int22_ar[G][C][C][C][C][G][C][G] =  2.000;
+ int22_ar[G][C][C][C][C][U][C][G] =  1.400;
+ int22_ar[G][C][C][C][G][A][C][G] =  2.000;
+ int22_ar[G][C][C][C][G][C][C][G] =  2.000;
+ int22_ar[G][C][C][C][G][G][C][G] =  2.000;
+ int22_ar[G][C][C][C][G][U][C][G] =  2.000;
+ int22_ar[G][C][C][C][U][A][C][G] =  1.200;
+ int22_ar[G][C][C][C][U][C][C][G] =  1.200;
+ int22_ar[G][C][C][C][U][G][C][G] =  2.000;
+ int22_ar[G][C][C][C][U][U][C][G] =  1.200;
+ int22_ar[G][C][C][G][A][A][C][G] = -0.700;
+ int22_ar[G][C][C][G][A][C][C][G] = -0.600;
+ int22_ar[G][C][C][G][A][G][C][G] =  2.000;
+ int22_ar[G][C][C][G][A][U][C][G] =  1.200;
+ int22_ar[G][C][C][G][C][A][C][G] =  2.000;
+ int22_ar[G][C][C][G][C][C][C][G] =  2.000;
+ int22_ar[G][C][C][G][C][G][C][G] =  2.000;
+ int22_ar[G][C][C][G][C][U][C][G] =  2.000;
+ int22_ar[G][C][C][G][G][A][C][G] =  0.900;
+ int22_ar[G][C][C][G][G][C][C][G] =  1.500;
+ int22_ar[G][C][C][G][G][G][C][G] =  2.000;
+ int22_ar[G][C][C][G][G][U][C][G] =  1.500;
+ int22_ar[G][C][C][G][U][A][C][G] = -1.600;
+ int22_ar[G][C][C][G][U][C][C][G] = -0.600;
+ int22_ar[G][C][C][G][U][G][C][G] =  2.000;
+ int22_ar[G][C][C][G][U][U][C][G] = -0.500;
+ int22_ar[G][C][C][U][A][A][C][G] =  2.000;
+ int22_ar[G][C][C][U][A][C][C][G] =  2.000;
+ int22_ar[G][C][C][U][A][G][C][G] =  2.000;
+ int22_ar[G][C][C][U][A][U][C][G] =  2.000;
+ int22_ar[G][C][C][U][C][A][C][G] =  1.200;
+ int22_ar[G][C][C][U][C][C][C][G] =  1.200;
+ int22_ar[G][C][C][U][C][G][C][G] =  2.000;
+ int22_ar[G][C][C][U][C][U][C][G] =  1.200;
+ int22_ar[G][C][C][U][G][A][C][G] =  0.000;
+ int22_ar[G][C][C][U][G][C][C][G] =  1.000;
+ int22_ar[G][C][C][U][G][G][C][G] =  2.000;
+ int22_ar[G][C][C][U][G][U][C][G] =  1.000;
+ int22_ar[G][C][C][U][U][A][C][G] =  0.300;
+ int22_ar[G][C][C][U][U][C][C][G] =  0.300;
+ int22_ar[G][C][C][U][U][G][C][G] =  2.000;
+ int22_ar[G][C][C][U][U][U][C][G] =  0.300;
+ int22_ar[G][C][G][A][A][A][C][G] = -0.300;
+ int22_ar[G][C][G][A][A][C][C][G] =  2.000;
+ int22_ar[G][C][G][A][A][G][C][G] =  1.000;
+ int22_ar[G][C][G][A][A][U][C][G] = -0.500;
+ int22_ar[G][C][G][A][C][A][C][G] = -0.700;
+ int22_ar[G][C][G][A][C][C][C][G] =  2.000;
+ int22_ar[G][C][G][A][C][G][C][G] =  0.900;
+ int22_ar[G][C][G][A][C][U][C][G] = -1.500;
+ int22_ar[G][C][G][A][G][A][C][G] = -1.700;
+ int22_ar[G][C][G][A][G][C][C][G] =  2.000;
+ int22_ar[G][C][G][A][G][G][C][G] =  0.000;
+ int22_ar[G][C][G][A][G][U][C][G] = -1.300;
+ int22_ar[G][C][G][A][U][A][C][G] =  2.000;
+ int22_ar[G][C][G][A][U][C][C][G] =  2.000;
+ int22_ar[G][C][G][A][U][G][C][G] =  2.000;
+ int22_ar[G][C][G][A][U][U][C][G] =  2.000;
+ int22_ar[G][C][G][C][A][A][C][G] =  0.100;
+ int22_ar[G][C][G][C][A][C][C][G] =  2.000;
+ int22_ar[G][C][G][C][A][G][C][G] =  1.400;
+ int22_ar[G][C][G][C][A][U][C][G] = -0.600;
+ int22_ar[G][C][G][C][C][A][C][G] =  0.700;
+ int22_ar[G][C][G][C][C][C][C][G] =  2.000;
+ int22_ar[G][C][G][C][C][G][C][G] =  1.800;
+ int22_ar[G][C][G][C][C][U][C][G] = -0.200;
+ int22_ar[G][C][G][C][G][A][C][G] =  2.000;
+ int22_ar[G][C][G][C][G][C][C][G] =  2.000;
+ int22_ar[G][C][G][C][G][G][C][G] =  2.000;
+ int22_ar[G][C][G][C][G][U][C][G] =  2.000;
+ int22_ar[G][C][G][C][U][A][C][G] =  0.400;
+ int22_ar[G][C][G][C][U][C][C][G] =  2.000;
+ int22_ar[G][C][G][C][U][G][C][G] =  1.700;
+ int22_ar[G][C][G][C][U][U][C][G] = -0.100;
+ int22_ar[G][C][G][G][A][A][C][G] = -1.600;
+ int22_ar[G][C][G][G][A][C][C][G] =  2.000;
+ int22_ar[G][C][G][G][A][G][C][G] =  0.000;
+ int22_ar[G][C][G][G][A][U][C][G] = -0.600;
+ int22_ar[G][C][G][G][C][A][C][G] =  2.000;
+ int22_ar[G][C][G][G][C][C][C][G] =  2.000;
+ int22_ar[G][C][G][G][C][G][C][G] =  2.000;
+ int22_ar[G][C][G][G][C][U][C][G] =  2.000;
+ int22_ar[G][C][G][G][G][A][C][G] = -0.900;
+ int22_ar[G][C][G][G][G][C][C][G] =  2.000;
+ int22_ar[G][C][G][G][G][G][C][G] =  0.800;
+ int22_ar[G][C][G][G][G][U][C][G] = -0.600;
+ int22_ar[G][C][G][G][U][A][C][G] = -1.600;
+ int22_ar[G][C][G][G][U][C][C][G] =  2.000;
+ int22_ar[G][C][G][G][U][G][C][G] = -0.700;
+ int22_ar[G][C][G][G][U][U][C][G] = -4.100;
+ int22_ar[G][C][G][U][A][A][C][G] =  2.000;
+ int22_ar[G][C][G][U][A][C][C][G] =  2.000;
+ int22_ar[G][C][G][U][A][G][C][G] =  2.000;
+ int22_ar[G][C][G][U][A][U][C][G] =  2.000;
+ int22_ar[G][C][G][U][C][A][C][G] =  0.400;
+ int22_ar[G][C][G][U][C][C][C][G] =  2.000;
+ int22_ar[G][C][G][U][C][G][C][G] =  1.700;
+ int22_ar[G][C][G][U][C][U][C][G] = -0.300;
+ int22_ar[G][C][G][U][G][A][C][G] =  0.300;
+ int22_ar[G][C][G][U][G][C][C][G] =  2.000;
+ int22_ar[G][C][G][U][G][G][C][G] =  0.900;
+ int22_ar[G][C][G][U][G][U][C][G] = -2.400;
+ int22_ar[G][C][G][U][U][A][C][G] =  0.500;
+ int22_ar[G][C][G][U][U][C][C][G] =  2.000;
+ int22_ar[G][C][G][U][U][G][C][G] =  1.200;
+ int22_ar[G][C][G][U][U][U][C][G] =  0.100;
+ int22_ar[G][C][U][A][A][A][C][G] =  2.000;
+ int22_ar[G][C][U][A][A][C][C][G] =  0.700;
+ int22_ar[G][C][U][A][A][G][C][G] =  0.100;
+ int22_ar[G][C][U][A][A][U][C][G] =  1.500;
+ int22_ar[G][C][U][A][C][A][C][G] =  2.000;
+ int22_ar[G][C][U][A][C][C][C][G] =  0.000;
+ int22_ar[G][C][U][A][C][G][C][G] = -1.900;
+ int22_ar[G][C][U][A][C][U][C][G] = -0.200;
+ int22_ar[G][C][U][A][G][A][C][G] =  2.000;
+ int22_ar[G][C][U][A][G][C][C][G] =  0.200;
+ int22_ar[G][C][U][A][G][G][C][G] = -0.900;
+ int22_ar[G][C][U][A][G][U][C][G] =  0.900;
+ int22_ar[G][C][U][A][U][A][C][G] =  2.000;
+ int22_ar[G][C][U][A][U][C][C][G] =  2.000;
+ int22_ar[G][C][U][A][U][G][C][G] =  2.000;
+ int22_ar[G][C][U][A][U][U][C][G] =  2.000;
+ int22_ar[G][C][U][C][A][A][C][G] =  2.000;
+ int22_ar[G][C][U][C][A][C][C][G] =  0.500;
+ int22_ar[G][C][U][C][A][G][C][G] = -0.700;
+ int22_ar[G][C][U][C][A][U][C][G] =  0.000;
+ int22_ar[G][C][U][C][C][A][C][G] =  2.000;
+ int22_ar[G][C][U][C][C][C][C][G] =  0.300;
+ int22_ar[G][C][U][C][C][G][C][G] = -0.300;
+ int22_ar[G][C][U][C][C][U][C][G] = -0.100;
+ int22_ar[G][C][U][C][G][A][C][G] =  2.000;
+ int22_ar[G][C][U][C][G][C][C][G] =  2.000;
+ int22_ar[G][C][U][C][G][G][C][G] =  2.000;
+ int22_ar[G][C][U][C][G][U][C][G] =  2.000;
+ int22_ar[G][C][U][C][U][A][C][G] =  2.000;
+ int22_ar[G][C][U][C][U][C][C][G] =  0.200;
+ int22_ar[G][C][U][C][U][G][C][G] = -0.700;
+ int22_ar[G][C][U][C][U][U][C][G] =  0.400;
+ int22_ar[G][C][U][G][A][A][C][G] =  2.000;
+ int22_ar[G][C][U][G][A][C][C][G] =  0.200;
+ int22_ar[G][C][U][G][A][G][C][G] = -0.800;
+ int22_ar[G][C][U][G][A][U][C][G] =  0.900;
+ int22_ar[G][C][U][G][C][A][C][G] =  2.000;
+ int22_ar[G][C][U][G][C][C][C][G] =  2.000;
+ int22_ar[G][C][U][G][C][G][C][G] =  2.000;
+ int22_ar[G][C][U][G][C][U][C][G] =  2.000;
+ int22_ar[G][C][U][G][G][A][C][G] =  2.000;
+ int22_ar[G][C][U][G][G][C][C][G] =  0.500;
+ int22_ar[G][C][U][G][G][G][C][G] = -1.000;
+ int22_ar[G][C][U][G][G][U][C][G] =  1.100;
+ int22_ar[G][C][U][G][U][A][C][G] =  2.000;
+ int22_ar[G][C][U][G][U][C][C][G] = -1.600;
+ int22_ar[G][C][U][G][U][G][C][G] = -4.400;
+ int22_ar[G][C][U][G][U][U][C][G] = -1.000;
+ int22_ar[G][C][U][U][A][A][C][G] =  2.000;
+ int22_ar[G][C][U][U][A][C][C][G] =  2.000;
+ int22_ar[G][C][U][U][A][G][C][G] =  2.000;
+ int22_ar[G][C][U][U][A][U][C][G] =  2.000;
+ int22_ar[G][C][U][U][C][A][C][G] =  2.000;
+ int22_ar[G][C][U][U][C][C][C][G] =  1.700;
+ int22_ar[G][C][U][U][C][G][C][G] = -0.700;
+ int22_ar[G][C][U][U][C][U][C][G] =  0.200;
+ int22_ar[G][C][U][U][G][A][C][G] =  2.000;
+ int22_ar[G][C][U][U][G][C][C][G] =  0.000;
+ int22_ar[G][C][U][U][G][G][C][G] = -3.000;
+ int22_ar[G][C][U][U][G][U][C][G] =  0.600;
+ int22_ar[G][C][U][U][U][A][C][G] =  2.000;
+ int22_ar[G][C][U][U][U][C][C][G] =  0.100;
+ int22_ar[G][C][U][U][U][G][C][G] = -1.000;
+ int22_ar[G][C][U][U][U][U][C][G] =  0.600;
+ int22_ar[G][C][A][A][A][A][G][C] =  1.500;
+ int22_ar[G][C][A][A][A][C][G][C] =  1.200;
+ int22_ar[G][C][A][A][A][G][G][C] =  0.100;
+ int22_ar[G][C][A][A][A][U][G][C] =  2.000;
+ int22_ar[G][C][A][A][C][A][G][C] =  1.200;
+ int22_ar[G][C][A][A][C][C][G][C] =  0.900;
+ int22_ar[G][C][A][A][C][G][G][C] = -0.100;
+ int22_ar[G][C][A][A][C][U][G][C] =  2.000;
+ int22_ar[G][C][A][A][G][A][G][C] = -0.500;
+ int22_ar[G][C][A][A][G][C][G][C] = -0.800;
+ int22_ar[G][C][A][A][G][G][G][C] = -1.900;
+ int22_ar[G][C][A][A][G][U][G][C] =  2.000;
+ int22_ar[G][C][A][A][U][A][G][C] =  2.000;
+ int22_ar[G][C][A][A][U][C][G][C] =  2.000;
+ int22_ar[G][C][A][A][U][G][G][C] =  2.000;
+ int22_ar[G][C][A][A][U][U][G][C] =  2.000;
+ int22_ar[G][C][A][C][A][A][G][C] =  1.200;
+ int22_ar[G][C][A][C][A][C][G][C] =  0.900;
+ int22_ar[G][C][A][C][A][G][G][C] = -0.200;
+ int22_ar[G][C][A][C][A][U][G][C] =  2.000;
+ int22_ar[G][C][A][C][C][A][G][C] =  1.800;
+ int22_ar[G][C][A][C][C][C][G][C] =  0.900;
+ int22_ar[G][C][A][C][C][G][G][C] =  0.900;
+ int22_ar[G][C][A][C][C][U][G][C] =  2.000;
+ int22_ar[G][C][A][C][G][A][G][C] =  2.000;
+ int22_ar[G][C][A][C][G][C][G][C] =  2.000;
+ int22_ar[G][C][A][C][G][G][G][C] =  2.000;
+ int22_ar[G][C][A][C][G][U][G][C] =  2.000;
+ int22_ar[G][C][A][C][U][A][G][C] =  0.800;
+ int22_ar[G][C][A][C][U][C][G][C] =  0.000;
+ int22_ar[G][C][A][C][U][G][G][C] = -0.100;
+ int22_ar[G][C][A][C][U][U][G][C] =  2.000;
+ int22_ar[G][C][A][G][A][A][G][C] =  0.100;
+ int22_ar[G][C][A][G][A][C][G][C] = -0.200;
+ int22_ar[G][C][A][G][A][G][G][C] = -1.300;
+ int22_ar[G][C][A][G][A][U][G][C] =  2.000;
+ int22_ar[G][C][A][G][C][A][G][C] =  2.000;
+ int22_ar[G][C][A][G][C][C][G][C] =  2.000;
+ int22_ar[G][C][A][G][C][G][G][C] =  2.000;
+ int22_ar[G][C][A][G][C][U][G][C] =  2.000;
+ int22_ar[G][C][A][G][G][A][G][C] =  1.100;
+ int22_ar[G][C][A][G][G][C][G][C] =  0.800;
+ int22_ar[G][C][A][G][G][G][G][C] = -0.200;
+ int22_ar[G][C][A][G][G][U][G][C] =  2.000;
+ int22_ar[G][C][A][G][U][A][G][C] = -0.700;
+ int22_ar[G][C][A][G][U][C][G][C] = -2.000;
+ int22_ar[G][C][A][G][U][G][G][C] = -1.300;
+ int22_ar[G][C][A][G][U][U][G][C] =  2.000;
+ int22_ar[G][C][A][U][A][A][G][C] =  2.000;
+ int22_ar[G][C][A][U][A][C][G][C] =  2.000;
+ int22_ar[G][C][A][U][A][G][G][C] =  2.000;
+ int22_ar[G][C][A][U][A][U][G][C] =  2.000;
+ int22_ar[G][C][A][U][C][A][G][C] =  1.900;
+ int22_ar[G][C][A][U][C][C][G][C] =  1.000;
+ int22_ar[G][C][A][U][C][G][G][C] =  0.900;
+ int22_ar[G][C][A][U][C][U][G][C] =  2.000;
+ int22_ar[G][C][A][U][G][A][G][C] = -0.300;
+ int22_ar[G][C][A][U][G][C][G][C] = -1.600;
+ int22_ar[G][C][A][U][G][G][G][C] = -0.900;
+ int22_ar[G][C][A][U][G][U][G][C] =  2.000;
+ int22_ar[G][C][A][U][U][A][G][C] =  1.500;
+ int22_ar[G][C][A][U][U][C][G][C] =  0.200;
+ int22_ar[G][C][A][U][U][G][G][C] =  0.900;
+ int22_ar[G][C][A][U][U][U][G][C] =  2.000;
+ int22_ar[G][C][C][A][A][A][G][C] =  1.200;
+ int22_ar[G][C][C][A][A][C][G][C] =  1.800;
+ int22_ar[G][C][C][A][A][G][G][C] =  2.000;
+ int22_ar[G][C][C][A][A][U][G][C] =  1.900;
+ int22_ar[G][C][C][A][C][A][G][C] =  1.000;
+ int22_ar[G][C][C][A][C][C][G][C] =  1.000;
+ int22_ar[G][C][C][A][C][G][G][C] =  2.000;
+ int22_ar[G][C][C][A][C][U][G][C] =  1.000;
+ int22_ar[G][C][C][A][G][A][G][C] = -0.800;
+ int22_ar[G][C][C][A][G][C][G][C] =  0.200;
+ int22_ar[G][C][C][A][G][G][G][C] =  2.000;
+ int22_ar[G][C][C][A][G][U][G][C] =  0.300;
+ int22_ar[G][C][C][A][U][A][G][C] =  2.000;
+ int22_ar[G][C][C][A][U][C][G][C] =  2.000;
+ int22_ar[G][C][C][A][U][G][G][C] =  2.000;
+ int22_ar[G][C][C][A][U][U][G][C] =  2.000;
+ int22_ar[G][C][C][C][A][A][G][C] =  0.900;
+ int22_ar[G][C][C][C][A][C][G][C] =  0.900;
+ int22_ar[G][C][C][C][A][G][G][C] =  2.000;
+ int22_ar[G][C][C][C][A][U][G][C] =  1.000;
+ int22_ar[G][C][C][C][C][A][G][C] =  1.000;
+ int22_ar[G][C][C][C][C][C][G][C] =  1.000;
+ int22_ar[G][C][C][C][C][G][G][C] =  2.000;
+ int22_ar[G][C][C][C][C][U][G][C] =  1.000;
+ int22_ar[G][C][C][C][G][A][G][C] =  2.000;
+ int22_ar[G][C][C][C][G][C][G][C] =  2.000;
+ int22_ar[G][C][C][C][G][G][G][C] =  2.000;
+ int22_ar[G][C][C][C][G][U][G][C] =  2.000;
+ int22_ar[G][C][C][C][U][A][G][C] =  0.000;
+ int22_ar[G][C][C][C][U][C][G][C] =  0.000;
+ int22_ar[G][C][C][C][U][G][G][C] =  2.000;
+ int22_ar[G][C][C][C][U][U][G][C] =  0.000;
+ int22_ar[G][C][C][G][A][A][G][C] = -0.100;
+ int22_ar[G][C][C][G][A][C][G][C] =  0.900;
+ int22_ar[G][C][C][G][A][G][G][C] =  2.000;
+ int22_ar[G][C][C][G][A][U][G][C] =  0.900;
+ int22_ar[G][C][C][G][C][A][G][C] =  2.000;
+ int22_ar[G][C][C][G][C][C][G][C] =  2.000;
+ int22_ar[G][C][C][G][C][G][G][C] =  2.000;
+ int22_ar[G][C][C][G][C][U][G][C] =  2.000;
+ int22_ar[G][C][C][G][G][A][G][C] =  0.900;
+ int22_ar[G][C][C][G][G][C][G][C] =  1.500;
+ int22_ar[G][C][C][G][G][G][G][C] =  2.000;
+ int22_ar[G][C][C][G][G][U][G][C] =  1.500;
+ int22_ar[G][C][C][G][U][A][G][C] = -1.900;
+ int22_ar[G][C][C][G][U][C][G][C] = -0.900;
+ int22_ar[G][C][C][G][U][G][G][C] =  2.000;
+ int22_ar[G][C][C][G][U][U][G][C] = -0.900;
+ int22_ar[G][C][C][U][A][A][G][C] =  2.000;
+ int22_ar[G][C][C][U][A][C][G][C] =  2.000;
+ int22_ar[G][C][C][U][A][G][G][C] =  2.000;
+ int22_ar[G][C][C][U][A][U][G][C] =  2.000;
+ int22_ar[G][C][C][U][C][A][G][C] =  1.000;
+ int22_ar[G][C][C][U][C][C][G][C] =  1.000;
+ int22_ar[G][C][C][U][C][G][G][C] =  2.000;
+ int22_ar[G][C][C][U][C][U][G][C] =  1.100;
+ int22_ar[G][C][C][U][G][A][G][C] = -1.500;
+ int22_ar[G][C][C][U][G][C][G][C] = -0.500;
+ int22_ar[G][C][C][U][G][G][G][C] =  2.000;
+ int22_ar[G][C][C][U][G][U][G][C] = -0.500;
+ int22_ar[G][C][C][U][U][A][G][C] =  0.200;
+ int22_ar[G][C][C][U][U][C][G][C] =  0.200;
+ int22_ar[G][C][C][U][U][G][G][C] =  2.000;
+ int22_ar[G][C][C][U][U][U][G][C] =  0.300;
+ int22_ar[G][C][G][A][A][A][G][C] = -0.500;
+ int22_ar[G][C][G][A][A][C][G][C] =  2.000;
+ int22_ar[G][C][G][A][A][G][G][C] =  1.100;
+ int22_ar[G][C][G][A][A][U][G][C] = -0.300;
+ int22_ar[G][C][G][A][C][A][G][C] = -0.800;
+ int22_ar[G][C][G][A][C][C][G][C] =  2.000;
+ int22_ar[G][C][G][A][C][G][G][C] =  0.900;
+ int22_ar[G][C][G][A][C][U][G][C] = -1.500;
+ int22_ar[G][C][G][A][G][A][G][C] = -2.600;
+ int22_ar[G][C][G][A][G][C][G][C] =  2.000;
+ int22_ar[G][C][G][A][G][G][G][C] = -0.900;
+ int22_ar[G][C][G][A][G][U][G][C] = -1.500;
+ int22_ar[G][C][G][A][U][A][G][C] =  2.000;
+ int22_ar[G][C][G][A][U][C][G][C] =  2.000;
+ int22_ar[G][C][G][A][U][G][G][C] =  2.000;
+ int22_ar[G][C][G][A][U][U][G][C] =  2.000;
+ int22_ar[G][C][G][C][A][A][G][C] = -0.800;
+ int22_ar[G][C][G][C][A][C][G][C] =  2.000;
+ int22_ar[G][C][G][C][A][G][G][C] =  0.800;
+ int22_ar[G][C][G][C][A][U][G][C] = -1.600;
+ int22_ar[G][C][G][C][C][A][G][C] =  0.200;
+ int22_ar[G][C][G][C][C][C][G][C] =  2.000;
+ int22_ar[G][C][G][C][C][G][G][C] =  1.500;
+ int22_ar[G][C][G][C][C][U][G][C] = -0.500;
+ int22_ar[G][C][G][C][G][A][G][C] =  2.000;
+ int22_ar[G][C][G][C][G][C][G][C] =  2.000;
+ int22_ar[G][C][G][C][G][G][G][C] =  2.000;
+ int22_ar[G][C][G][C][G][U][G][C] =  2.000;
+ int22_ar[G][C][G][C][U][A][G][C] = -0.800;
+ int22_ar[G][C][G][C][U][C][G][C] =  2.000;
+ int22_ar[G][C][G][C][U][G][G][C] =  0.500;
+ int22_ar[G][C][G][C][U][U][G][C] = -1.500;
+ int22_ar[G][C][G][G][A][A][G][C] = -1.900;
+ int22_ar[G][C][G][G][A][C][G][C] =  2.000;
+ int22_ar[G][C][G][G][A][G][G][C] = -0.200;
+ int22_ar[G][C][G][G][A][U][G][C] = -0.900;
+ int22_ar[G][C][G][G][C][A][G][C] =  2.000;
+ int22_ar[G][C][G][G][C][C][G][C] =  2.000;
+ int22_ar[G][C][G][G][C][G][G][C] =  2.000;
+ int22_ar[G][C][G][G][C][U][G][C] =  2.000;
+ int22_ar[G][C][G][G][G][A][G][C] = -0.900;
+ int22_ar[G][C][G][G][G][C][G][C] =  2.000;
+ int22_ar[G][C][G][G][G][G][G][C] =  0.800;
+ int22_ar[G][C][G][G][G][U][G][C] = -0.600;
+ int22_ar[G][C][G][G][U][A][G][C] = -1.900;
+ int22_ar[G][C][G][G][U][C][G][C] =  2.000;
+ int22_ar[G][C][G][G][U][G][G][C] = -1.000;
+ int22_ar[G][C][G][G][U][U][G][C] = -4.500;
+ int22_ar[G][C][G][U][A][A][G][C] =  2.000;
+ int22_ar[G][C][G][U][A][C][G][C] =  2.000;
+ int22_ar[G][C][G][U][A][G][G][C] =  2.000;
+ int22_ar[G][C][G][U][A][U][G][C] =  2.000;
+ int22_ar[G][C][G][U][C][A][G][C] =  0.300;
+ int22_ar[G][C][G][U][C][C][G][C] =  2.000;
+ int22_ar[G][C][G][U][C][G][G][C] =  1.500;
+ int22_ar[G][C][G][U][C][U][G][C] = -0.500;
+ int22_ar[G][C][G][U][G][A][G][C] = -1.500;
+ int22_ar[G][C][G][U][G][C][G][C] =  2.000;
+ int22_ar[G][C][G][U][G][G][G][C] = -0.600;
+ int22_ar[G][C][G][U][G][U][G][C] = -4.100;
+ int22_ar[G][C][G][U][U][A][G][C] =  0.300;
+ int22_ar[G][C][G][U][U][C][G][C] =  2.000;
+ int22_ar[G][C][G][U][U][G][G][C] =  1.100;
+ int22_ar[G][C][G][U][U][U][G][C] = -0.500;
+ int22_ar[G][C][U][A][A][A][G][C] =  2.000;
+ int22_ar[G][C][U][A][A][C][G][C] =  0.800;
+ int22_ar[G][C][U][A][A][G][G][C] = -0.700;
+ int22_ar[G][C][U][A][A][U][G][C] =  1.500;
+ int22_ar[G][C][U][A][C][A][G][C] =  2.000;
+ int22_ar[G][C][U][A][C][C][G][C] =  0.000;
+ int22_ar[G][C][U][A][C][G][G][C] = -1.900;
+ int22_ar[G][C][U][A][C][U][G][C] =  0.200;
+ int22_ar[G][C][U][A][G][A][G][C] =  2.000;
+ int22_ar[G][C][U][A][G][C][G][C] = -0.800;
+ int22_ar[G][C][U][A][G][G][G][C] = -1.900;
+ int22_ar[G][C][U][A][G][U][G][C] =  0.300;
+ int22_ar[G][C][U][A][U][A][G][C] =  2.000;
+ int22_ar[G][C][U][A][U][C][G][C] =  2.000;
+ int22_ar[G][C][U][A][U][G][G][C] =  2.000;
+ int22_ar[G][C][U][A][U][U][G][C] =  2.000;
+ int22_ar[G][C][U][C][A][A][G][C] =  2.000;
+ int22_ar[G][C][U][C][A][C][G][C] =  0.000;
+ int22_ar[G][C][U][C][A][G][G][C] = -2.000;
+ int22_ar[G][C][U][C][A][U][G][C] =  0.200;
+ int22_ar[G][C][U][C][C][A][G][C] =  2.000;
+ int22_ar[G][C][U][C][C][C][G][C] =  0.000;
+ int22_ar[G][C][U][C][C][G][G][C] = -0.900;
+ int22_ar[G][C][U][C][C][U][G][C] =  0.200;
+ int22_ar[G][C][U][C][G][A][G][C] =  2.000;
+ int22_ar[G][C][U][C][G][C][G][C] =  2.000;
+ int22_ar[G][C][U][C][G][G][G][C] =  2.000;
+ int22_ar[G][C][U][C][G][U][G][C] =  2.000;
+ int22_ar[G][C][U][C][U][A][G][C] =  2.000;
+ int22_ar[G][C][U][C][U][C][G][C] = -1.000;
+ int22_ar[G][C][U][C][U][G][G][C] = -1.900;
+ int22_ar[G][C][U][C][U][U][G][C] = -0.700;
+ int22_ar[G][C][U][G][A][A][G][C] =  2.000;
+ int22_ar[G][C][U][G][A][C][G][C] = -0.100;
+ int22_ar[G][C][U][G][A][G][G][C] = -1.300;
+ int22_ar[G][C][U][G][A][U][G][C] =  0.900;
+ int22_ar[G][C][U][G][C][A][G][C] =  2.000;
+ int22_ar[G][C][U][G][C][C][G][C] =  2.000;
+ int22_ar[G][C][U][G][C][G][G][C] =  2.000;
+ int22_ar[G][C][U][G][C][U][G][C] =  2.000;
+ int22_ar[G][C][U][G][G][A][G][C] =  2.000;
+ int22_ar[G][C][U][G][G][C][G][C] =  0.500;
+ int22_ar[G][C][U][G][G][G][G][C] = -1.000;
+ int22_ar[G][C][U][G][G][U][G][C] =  1.100;
+ int22_ar[G][C][U][G][U][A][G][C] =  2.000;
+ int22_ar[G][C][U][G][U][C][G][C] = -1.900;
+ int22_ar[G][C][U][G][U][G][G][C] = -4.900;
+ int22_ar[G][C][U][G][U][U][G][C] = -0.900;
+ int22_ar[G][C][U][U][A][A][G][C] =  2.000;
+ int22_ar[G][C][U][U][A][C][G][C] =  2.000;
+ int22_ar[G][C][U][U][A][G][G][C] =  2.000;
+ int22_ar[G][C][U][U][A][U][G][C] =  2.000;
+ int22_ar[G][C][U][U][C][A][G][C] =  2.000;
+ int22_ar[G][C][U][U][C][C][G][C] =  0.000;
+ int22_ar[G][C][U][U][C][G][G][C] = -0.900;
+ int22_ar[G][C][U][U][C][U][G][C] =  0.300;
+ int22_ar[G][C][U][U][G][A][G][C] =  2.000;
+ int22_ar[G][C][U][U][G][C][G][C] = -1.500;
+ int22_ar[G][C][U][U][G][G][G][C] = -4.500;
+ int22_ar[G][C][U][U][G][U][G][C] = -0.500;
+ int22_ar[G][C][U][U][U][A][G][C] =  2.000;
+ int22_ar[G][C][U][U][U][C][G][C] = -0.700;
+ int22_ar[G][C][U][U][U][G][G][C] = -0.900;
+ int22_ar[G][C][U][U][U][U][G][C] = -0.500;
+ int22_ar[G][C][A][A][A][A][G][U] =  2.100;
+ int22_ar[G][C][A][A][A][C][G][U] =  1.800;
+ int22_ar[G][C][A][A][A][G][G][U] =  0.700;
+ int22_ar[G][C][A][A][A][U][G][U] =  2.000;
+ int22_ar[G][C][A][A][C][A][G][U] =  1.900;
+ int22_ar[G][C][A][A][C][C][G][U] =  1.600;
+ int22_ar[G][C][A][A][C][G][G][U] =  0.500;
+ int22_ar[G][C][A][A][C][U][G][U] =  2.000;
+ int22_ar[G][C][A][A][G][A][G][U] =  0.900;
+ int22_ar[G][C][A][A][G][C][G][U] =  0.600;
+ int22_ar[G][C][A][A][G][G][G][U] = -0.500;
+ int22_ar[G][C][A][A][G][U][G][U] =  2.000;
+ int22_ar[G][C][A][A][U][A][G][U] =  2.000;
+ int22_ar[G][C][A][A][U][C][G][U] =  2.000;
+ int22_ar[G][C][A][A][U][G][G][U] =  2.000;
+ int22_ar[G][C][A][A][U][U][G][U] =  2.000;
+ int22_ar[G][C][A][C][A][A][G][U] =  2.000;
+ int22_ar[G][C][A][C][A][C][G][U] =  1.700;
+ int22_ar[G][C][A][C][A][G][G][U] =  0.600;
+ int22_ar[G][C][A][C][A][U][G][U] =  2.000;
+ int22_ar[G][C][A][C][C][A][G][U] =  2.400;
+ int22_ar[G][C][A][C][C][C][G][U] =  1.500;
+ int22_ar[G][C][A][C][C][G][G][U] =  1.400;
+ int22_ar[G][C][A][C][C][U][G][U] =  2.000;
+ int22_ar[G][C][A][C][G][A][G][U] =  2.000;
+ int22_ar[G][C][A][C][G][C][G][U] =  2.000;
+ int22_ar[G][C][A][C][G][G][G][U] =  2.000;
+ int22_ar[G][C][A][C][G][U][G][U] =  2.000;
+ int22_ar[G][C][A][C][U][A][G][U] =  2.400;
+ int22_ar[G][C][A][C][U][C][G][U] =  1.500;
+ int22_ar[G][C][A][C][U][G][G][U] =  1.400;
+ int22_ar[G][C][A][C][U][U][G][U] =  2.000;
+ int22_ar[G][C][A][G][A][A][G][U] =  0.900;
+ int22_ar[G][C][A][G][A][C][G][U] =  0.600;
+ int22_ar[G][C][A][G][A][G][G][U] = -0.500;
+ int22_ar[G][C][A][G][A][U][G][U] =  2.000;
+ int22_ar[G][C][A][G][C][A][G][U] =  2.000;
+ int22_ar[G][C][A][G][C][C][G][U] =  2.000;
+ int22_ar[G][C][A][G][C][G][G][U] =  2.000;
+ int22_ar[G][C][A][G][C][U][G][U] =  2.000;
+ int22_ar[G][C][A][G][G][A][G][U] =  1.400;
+ int22_ar[G][C][A][G][G][C][G][U] =  1.100;
+ int22_ar[G][C][A][G][G][G][G][U] =  0.000;
+ int22_ar[G][C][A][G][G][U][G][U] =  2.000;
+ int22_ar[G][C][A][G][U][A][G][U] =  0.700;
+ int22_ar[G][C][A][G][U][C][G][U] = -0.600;
+ int22_ar[G][C][A][G][U][G][G][U] =  0.100;
+ int22_ar[G][C][A][G][U][U][G][U] =  2.000;
+ int22_ar[G][C][A][U][A][A][G][U] =  2.000;
+ int22_ar[G][C][A][U][A][C][G][U] =  2.000;
+ int22_ar[G][C][A][U][A][G][G][U] =  2.000;
+ int22_ar[G][C][A][U][A][U][G][U] =  2.000;
+ int22_ar[G][C][A][U][C][A][G][U] =  2.400;
+ int22_ar[G][C][A][U][C][C][G][U] =  1.500;
+ int22_ar[G][C][A][U][C][G][G][U] =  1.400;
+ int22_ar[G][C][A][U][C][U][G][U] =  2.000;
+ int22_ar[G][C][A][U][G][A][G][U] =  1.700;
+ int22_ar[G][C][A][U][G][C][G][U] =  0.400;
+ int22_ar[G][C][A][U][G][G][G][U] =  1.100;
+ int22_ar[G][C][A][U][G][U][G][U] =  2.000;
+ int22_ar[G][C][A][U][U][A][G][U] =  2.000;
+ int22_ar[G][C][A][U][U][C][G][U] =  0.700;
+ int22_ar[G][C][A][U][U][G][G][U] =  1.500;
+ int22_ar[G][C][A][U][U][U][G][U] =  2.000;
+ int22_ar[G][C][C][A][A][A][G][U] =  1.900;
+ int22_ar[G][C][C][A][A][C][G][U] =  2.500;
+ int22_ar[G][C][C][A][A][G][G][U] =  2.000;
+ int22_ar[G][C][C][A][A][U][G][U] =  2.500;
+ int22_ar[G][C][C][A][C][A][G][U] =  1.600;
+ int22_ar[G][C][C][A][C][C][G][U] =  1.600;
+ int22_ar[G][C][C][A][C][G][G][U] =  2.000;
+ int22_ar[G][C][C][A][C][U][G][U] =  1.700;
+ int22_ar[G][C][C][A][G][A][G][U] =  0.600;
+ int22_ar[G][C][C][A][G][C][G][U] =  1.600;
+ int22_ar[G][C][C][A][G][G][G][U] =  2.000;
+ int22_ar[G][C][C][A][G][U][G][U] =  1.700;
+ int22_ar[G][C][C][A][U][A][G][U] =  2.000;
+ int22_ar[G][C][C][A][U][C][G][U] =  2.000;
+ int22_ar[G][C][C][A][U][G][G][U] =  2.000;
+ int22_ar[G][C][C][A][U][U][G][U] =  2.000;
+ int22_ar[G][C][C][C][A][A][G][U] =  1.700;
+ int22_ar[G][C][C][C][A][C][G][U] =  1.700;
+ int22_ar[G][C][C][C][A][G][G][U] =  2.000;
+ int22_ar[G][C][C][C][A][U][G][U] =  1.800;
+ int22_ar[G][C][C][C][C][A][G][U] =  1.600;
+ int22_ar[G][C][C][C][C][C][G][U] =  1.600;
+ int22_ar[G][C][C][C][C][G][G][U] =  2.000;
+ int22_ar[G][C][C][C][C][U][G][U] =  1.600;
+ int22_ar[G][C][C][C][G][A][G][U] =  2.000;
+ int22_ar[G][C][C][C][G][C][G][U] =  2.000;
+ int22_ar[G][C][C][C][G][G][G][U] =  2.000;
+ int22_ar[G][C][C][C][G][U][G][U] =  2.000;
+ int22_ar[G][C][C][C][U][A][G][U] =  1.600;
+ int22_ar[G][C][C][C][U][C][G][U] =  1.600;
+ int22_ar[G][C][C][C][U][G][G][U] =  2.000;
+ int22_ar[G][C][C][C][U][U][G][U] =  1.600;
+ int22_ar[G][C][C][G][A][A][G][U] =  0.600;
+ int22_ar[G][C][C][G][A][C][G][U] =  1.600;
+ int22_ar[G][C][C][G][A][G][G][U] =  2.000;
+ int22_ar[G][C][C][G][A][U][G][U] =  1.700;
+ int22_ar[G][C][C][G][C][A][G][U] =  2.000;
+ int22_ar[G][C][C][G][C][C][G][U] =  2.000;
+ int22_ar[G][C][C][G][C][G][G][U] =  2.000;
+ int22_ar[G][C][C][G][C][U][G][U] =  2.000;
+ int22_ar[G][C][C][G][G][A][G][U] =  1.200;
+ int22_ar[G][C][C][G][G][C][G][U] =  1.800;
+ int22_ar[G][C][C][G][G][G][G][U] =  2.000;
+ int22_ar[G][C][C][G][G][U][G][U] =  1.800;
+ int22_ar[G][C][C][G][U][A][G][U] = -0.500;
+ int22_ar[G][C][C][G][U][C][G][U] =  0.500;
+ int22_ar[G][C][C][G][U][G][G][U] =  2.000;
+ int22_ar[G][C][C][G][U][U][G][U] =  0.500;
+ int22_ar[G][C][C][U][A][A][G][U] =  2.000;
+ int22_ar[G][C][C][U][A][C][G][U] =  2.000;
+ int22_ar[G][C][C][U][A][G][G][U] =  2.000;
+ int22_ar[G][C][C][U][A][U][G][U] =  2.000;
+ int22_ar[G][C][C][U][C][A][G][U] =  1.600;
+ int22_ar[G][C][C][U][C][C][G][U] =  1.600;
+ int22_ar[G][C][C][U][C][G][G][U] =  2.000;
+ int22_ar[G][C][C][U][C][U][G][U] =  1.600;
+ int22_ar[G][C][C][U][G][A][G][U] =  0.400;
+ int22_ar[G][C][C][U][G][C][G][U] =  1.400;
+ int22_ar[G][C][C][U][G][G][G][U] =  2.000;
+ int22_ar[G][C][C][U][G][U][G][U] =  1.500;
+ int22_ar[G][C][C][U][U][A][G][U] =  0.800;
+ int22_ar[G][C][C][U][U][C][G][U] =  0.800;
+ int22_ar[G][C][C][U][U][G][G][U] =  2.000;
+ int22_ar[G][C][C][U][U][U][G][U] =  0.800;
+ int22_ar[G][C][G][A][A][A][G][U] =  0.100;
+ int22_ar[G][C][G][A][A][C][G][U] =  2.000;
+ int22_ar[G][C][G][A][A][G][G][U] =  1.800;
+ int22_ar[G][C][G][A][A][U][G][U] =  0.400;
+ int22_ar[G][C][G][A][C][A][G][U] = -0.100;
+ int22_ar[G][C][G][A][C][C][G][U] =  2.000;
+ int22_ar[G][C][G][A][C][G][G][U] =  1.500;
+ int22_ar[G][C][G][A][C][U][G][U] = -0.900;
+ int22_ar[G][C][G][A][G][A][G][U] = -1.100;
+ int22_ar[G][C][G][A][G][C][G][U] =  2.000;
+ int22_ar[G][C][G][A][G][G][G][U] =  0.500;
+ int22_ar[G][C][G][A][G][U][G][U] = -0.100;
+ int22_ar[G][C][G][A][U][A][G][U] =  2.000;
+ int22_ar[G][C][G][A][U][C][G][U] =  2.000;
+ int22_ar[G][C][G][A][U][G][G][U] =  2.000;
+ int22_ar[G][C][G][A][U][U][G][U] =  2.000;
+ int22_ar[G][C][G][C][A][A][G][U] =  0.000;
+ int22_ar[G][C][G][C][A][C][G][U] =  2.000;
+ int22_ar[G][C][G][C][A][G][G][U] =  1.600;
+ int22_ar[G][C][G][C][A][U][G][U] = -0.800;
+ int22_ar[G][C][G][C][C][A][G][U] =  0.800;
+ int22_ar[G][C][G][C][C][C][G][U] =  2.000;
+ int22_ar[G][C][G][C][C][G][G][U] =  2.100;
+ int22_ar[G][C][G][C][C][U][G][U] =  0.100;
+ int22_ar[G][C][G][C][G][A][G][U] =  2.000;
+ int22_ar[G][C][G][C][G][C][G][U] =  2.000;
+ int22_ar[G][C][G][C][G][G][G][U] =  2.000;
+ int22_ar[G][C][G][C][G][U][G][U] =  2.000;
+ int22_ar[G][C][G][C][U][A][G][U] =  0.800;
+ int22_ar[G][C][G][C][U][C][G][U] =  2.000;
+ int22_ar[G][C][G][C][U][G][G][U] =  2.100;
+ int22_ar[G][C][G][C][U][U][G][U] =  0.100;
+ int22_ar[G][C][G][G][A][A][G][U] = -1.100;
+ int22_ar[G][C][G][G][A][C][G][U] =  2.000;
+ int22_ar[G][C][G][G][A][G][G][U] =  0.500;
+ int22_ar[G][C][G][G][A][U][G][U] = -0.100;
+ int22_ar[G][C][G][G][C][A][G][U] =  2.000;
+ int22_ar[G][C][G][G][C][C][G][U] =  2.000;
+ int22_ar[G][C][G][G][C][G][G][U] =  2.000;
+ int22_ar[G][C][G][G][C][U][G][U] =  2.000;
+ int22_ar[G][C][G][G][G][A][G][U] = -0.600;
+ int22_ar[G][C][G][G][G][C][G][U] =  2.000;
+ int22_ar[G][C][G][G][G][G][G][U] =  1.100;
+ int22_ar[G][C][G][G][G][U][G][U] = -0.300;
+ int22_ar[G][C][G][G][U][A][G][U] = -0.500;
+ int22_ar[G][C][G][G][U][C][G][U] =  2.000;
+ int22_ar[G][C][G][G][U][G][G][U] =  0.400;
+ int22_ar[G][C][G][G][U][U][G][U] = -3.100;
+ int22_ar[G][C][G][U][A][A][G][U] =  2.000;
+ int22_ar[G][C][G][U][A][C][G][U] =  2.000;
+ int22_ar[G][C][G][U][A][G][G][U] =  2.000;
+ int22_ar[G][C][G][U][A][U][G][U] =  2.000;
+ int22_ar[G][C][G][U][C][A][G][U] =  0.800;
+ int22_ar[G][C][G][U][C][C][G][U] =  2.000;
+ int22_ar[G][C][G][U][C][G][G][U] =  2.100;
+ int22_ar[G][C][G][U][C][U][G][U] =  0.100;
+ int22_ar[G][C][G][U][G][A][G][U] =  0.500;
+ int22_ar[G][C][G][U][G][C][G][U] =  2.000;
+ int22_ar[G][C][G][U][G][G][G][U] =  1.300;
+ int22_ar[G][C][G][U][G][U][G][U] = -2.100;
+ int22_ar[G][C][G][U][U][A][G][U] =  0.800;
+ int22_ar[G][C][G][U][U][C][G][U] =  2.000;
+ int22_ar[G][C][G][U][U][G][G][U] =  1.700;
+ int22_ar[G][C][G][U][U][U][G][U] =  0.100;
+ int22_ar[G][C][U][A][A][A][G][U] =  2.000;
+ int22_ar[G][C][U][A][A][C][G][U] =  1.500;
+ int22_ar[G][C][U][A][A][G][G][U] =  0.000;
+ int22_ar[G][C][U][A][A][U][G][U] =  2.100;
+ int22_ar[G][C][U][A][C][A][G][U] =  2.000;
+ int22_ar[G][C][U][A][C][C][G][U] =  0.600;
+ int22_ar[G][C][U][A][C][G][G][U] = -1.300;
+ int22_ar[G][C][U][A][C][U][G][U] =  0.900;
+ int22_ar[G][C][U][A][G][A][G][U] =  2.000;
+ int22_ar[G][C][U][A][G][C][G][U] =  0.700;
+ int22_ar[G][C][U][A][G][G][G][U] = -0.500;
+ int22_ar[G][C][U][A][G][U][G][U] =  1.700;
+ int22_ar[G][C][U][A][U][A][G][U] =  2.000;
+ int22_ar[G][C][U][A][U][C][G][U] =  2.000;
+ int22_ar[G][C][U][A][U][G][G][U] =  2.000;
+ int22_ar[G][C][U][A][U][U][G][U] =  2.000;
+ int22_ar[G][C][U][C][A][A][G][U] =  2.000;
+ int22_ar[G][C][U][C][A][C][G][U] =  0.700;
+ int22_ar[G][C][U][C][A][G][G][U] = -1.200;
+ int22_ar[G][C][U][C][A][U][G][U] =  1.000;
+ int22_ar[G][C][U][C][C][A][G][U] =  2.000;
+ int22_ar[G][C][U][C][C][C][G][U] =  0.600;
+ int22_ar[G][C][U][C][C][G][G][U] = -0.300;
+ int22_ar[G][C][U][C][C][U][G][U] =  0.800;
+ int22_ar[G][C][U][C][G][A][G][U] =  2.000;
+ int22_ar[G][C][U][C][G][C][G][U] =  2.000;
+ int22_ar[G][C][U][C][G][G][G][U] =  2.000;
+ int22_ar[G][C][U][C][G][U][G][U] =  2.000;
+ int22_ar[G][C][U][C][U][A][G][U] =  2.000;
+ int22_ar[G][C][U][C][U][C][G][U] =  0.600;
+ int22_ar[G][C][U][C][U][G][G][U] = -0.300;
+ int22_ar[G][C][U][C][U][U][G][U] =  0.800;
+ int22_ar[G][C][U][G][A][A][G][U] =  2.000;
+ int22_ar[G][C][U][G][A][C][G][U] =  0.700;
+ int22_ar[G][C][U][G][A][G][G][U] = -0.500;
+ int22_ar[G][C][U][G][A][U][G][U] =  1.700;
+ int22_ar[G][C][U][G][C][A][G][U] =  2.000;
+ int22_ar[G][C][U][G][C][C][G][U] =  2.000;
+ int22_ar[G][C][U][G][C][G][G][U] =  2.000;
+ int22_ar[G][C][U][G][C][U][G][U] =  2.000;
+ int22_ar[G][C][U][G][G][A][G][U] =  2.000;
+ int22_ar[G][C][U][G][G][C][G][U] =  0.800;
+ int22_ar[G][C][U][G][G][G][G][U] = -0.700;
+ int22_ar[G][C][U][G][G][U][G][U] =  1.400;
+ int22_ar[G][C][U][G][U][A][G][U] =  2.000;
+ int22_ar[G][C][U][G][U][C][G][U] = -0.500;
+ int22_ar[G][C][U][G][U][G][G][U] = -3.500;
+ int22_ar[G][C][U][G][U][U][G][U] =  0.500;
+ int22_ar[G][C][U][U][A][A][G][U] =  2.000;
+ int22_ar[G][C][U][U][A][C][G][U] =  2.000;
+ int22_ar[G][C][U][U][A][G][G][U] =  2.000;
+ int22_ar[G][C][U][U][A][U][G][U] =  2.000;
+ int22_ar[G][C][U][U][C][A][G][U] =  2.000;
+ int22_ar[G][C][U][U][C][C][G][U] =  0.600;
+ int22_ar[G][C][U][U][C][G][G][U] = -0.300;
+ int22_ar[G][C][U][U][C][U][G][U] =  0.800;
+ int22_ar[G][C][U][U][G][A][G][U] =  2.000;
+ int22_ar[G][C][U][U][G][C][G][U] =  0.500;
+ int22_ar[G][C][U][U][G][G][G][U] = -2.500;
+ int22_ar[G][C][U][U][G][U][G][U] =  1.500;
+ int22_ar[G][C][U][U][U][A][G][U] =  2.000;
+ int22_ar[G][C][U][U][U][C][G][U] = -0.200;
+ int22_ar[G][C][U][U][U][G][G][U] = -0.300;
+ int22_ar[G][C][U][U][U][U][G][U] =  0.000;
+ int22_ar[G][C][A][A][A][A][U][A] =  2.100;
+ int22_ar[G][C][A][A][A][C][U][A] =  1.800;
+ int22_ar[G][C][A][A][A][G][U][A] =  0.700;
+ int22_ar[G][C][A][A][A][U][U][A] =  2.000;
+ int22_ar[G][C][A][A][C][A][U][A] =  1.700;
+ int22_ar[G][C][A][A][C][C][U][A] =  1.400;
+ int22_ar[G][C][A][A][C][G][U][A] =  0.300;
+ int22_ar[G][C][A][A][C][U][U][A] =  2.000;
+ int22_ar[G][C][A][A][G][A][U][A] =  1.100;
+ int22_ar[G][C][A][A][G][C][U][A] =  0.800;
+ int22_ar[G][C][A][A][G][G][U][A] = -0.300;
+ int22_ar[G][C][A][A][G][U][U][A] =  2.000;
+ int22_ar[G][C][A][A][U][A][U][A] =  2.000;
+ int22_ar[G][C][A][A][U][C][U][A] =  2.000;
+ int22_ar[G][C][A][A][U][G][U][A] =  2.000;
+ int22_ar[G][C][A][A][U][U][U][A] =  2.000;
+ int22_ar[G][C][A][C][A][A][U][A] =  2.100;
+ int22_ar[G][C][A][C][A][C][U][A] =  1.800;
+ int22_ar[G][C][A][C][A][G][U][A] =  0.700;
+ int22_ar[G][C][A][C][A][U][U][A] =  2.000;
+ int22_ar[G][C][A][C][C][A][U][A] =  2.700;
+ int22_ar[G][C][A][C][C][C][U][A] =  1.800;
+ int22_ar[G][C][A][C][C][G][U][A] =  1.700;
+ int22_ar[G][C][A][C][C][U][U][A] =  2.000;
+ int22_ar[G][C][A][C][G][A][U][A] =  2.000;
+ int22_ar[G][C][A][C][G][C][U][A] =  2.000;
+ int22_ar[G][C][A][C][G][G][U][A] =  2.000;
+ int22_ar[G][C][A][C][G][U][U][A] =  2.000;
+ int22_ar[G][C][A][C][U][A][U][A] =  2.700;
+ int22_ar[G][C][A][C][U][C][U][A] =  1.800;
+ int22_ar[G][C][A][C][U][G][U][A] =  1.700;
+ int22_ar[G][C][A][C][U][U][U][A] =  2.000;
+ int22_ar[G][C][A][G][A][A][U][A] =  1.100;
+ int22_ar[G][C][A][G][A][C][U][A] =  0.800;
+ int22_ar[G][C][A][G][A][G][U][A] = -0.300;
+ int22_ar[G][C][A][G][A][U][U][A] =  2.000;
+ int22_ar[G][C][A][G][C][A][U][A] =  2.000;
+ int22_ar[G][C][A][G][C][C][U][A] =  2.000;
+ int22_ar[G][C][A][G][C][G][U][A] =  2.000;
+ int22_ar[G][C][A][G][C][U][U][A] =  2.000;
+ int22_ar[G][C][A][G][G][A][U][A] =  1.500;
+ int22_ar[G][C][A][G][G][C][U][A] =  1.200;
+ int22_ar[G][C][A][G][G][G][U][A] =  0.100;
+ int22_ar[G][C][A][G][G][U][U][A] =  2.000;
+ int22_ar[G][C][A][G][U][A][U][A] =  0.300;
+ int22_ar[G][C][A][G][U][C][U][A] = -1.000;
+ int22_ar[G][C][A][G][U][G][U][A] = -0.300;
+ int22_ar[G][C][A][G][U][U][U][A] =  2.000;
+ int22_ar[G][C][A][U][A][A][U][A] =  2.000;
+ int22_ar[G][C][A][U][A][C][U][A] =  2.000;
+ int22_ar[G][C][A][U][A][G][U][A] =  2.000;
+ int22_ar[G][C][A][U][A][U][U][A] =  2.000;
+ int22_ar[G][C][A][U][C][A][U][A] =  2.400;
+ int22_ar[G][C][A][U][C][C][U][A] =  1.500;
+ int22_ar[G][C][A][U][C][G][U][A] =  1.400;
+ int22_ar[G][C][A][U][C][U][U][A] =  2.000;
+ int22_ar[G][C][A][U][G][A][U][A] =  1.600;
+ int22_ar[G][C][A][U][G][C][U][A] =  0.300;
+ int22_ar[G][C][A][U][G][G][U][A] =  1.000;
+ int22_ar[G][C][A][U][G][U][U][A] =  2.000;
+ int22_ar[G][C][A][U][U][A][U][A] =  2.300;
+ int22_ar[G][C][A][U][U][C][U][A] =  1.000;
+ int22_ar[G][C][A][U][U][G][U][A] =  1.700;
+ int22_ar[G][C][A][U][U][U][U][A] =  2.000;
+ int22_ar[G][C][C][A][A][A][U][A] =  1.900;
+ int22_ar[G][C][C][A][A][C][U][A] =  2.500;
+ int22_ar[G][C][C][A][A][G][U][A] =  2.000;
+ int22_ar[G][C][C][A][A][U][U][A] =  2.500;
+ int22_ar[G][C][C][A][C][A][U][A] =  1.400;
+ int22_ar[G][C][C][A][C][C][U][A] =  1.400;
+ int22_ar[G][C][C][A][C][G][U][A] =  2.000;
+ int22_ar[G][C][C][A][C][U][U][A] =  1.500;
+ int22_ar[G][C][C][A][G][A][U][A] =  0.800;
+ int22_ar[G][C][C][A][G][C][U][A] =  1.800;
+ int22_ar[G][C][C][A][G][G][U][A] =  2.000;
+ int22_ar[G][C][C][A][G][U][U][A] =  1.900;
+ int22_ar[G][C][C][A][U][A][U][A] =  2.000;
+ int22_ar[G][C][C][A][U][C][U][A] =  2.000;
+ int22_ar[G][C][C][A][U][G][U][A] =  2.000;
+ int22_ar[G][C][C][A][U][U][U][A] =  2.000;
+ int22_ar[G][C][C][C][A][A][U][A] =  1.900;
+ int22_ar[G][C][C][C][A][C][U][A] =  1.900;
+ int22_ar[G][C][C][C][A][G][U][A] =  2.000;
+ int22_ar[G][C][C][C][A][U][U][A] =  1.900;
+ int22_ar[G][C][C][C][C][A][U][A] =  1.900;
+ int22_ar[G][C][C][C][C][C][U][A] =  1.900;
+ int22_ar[G][C][C][C][C][G][U][A] =  2.000;
+ int22_ar[G][C][C][C][C][U][U][A] =  1.900;
+ int22_ar[G][C][C][C][G][A][U][A] =  2.000;
+ int22_ar[G][C][C][C][G][C][U][A] =  2.000;
+ int22_ar[G][C][C][C][G][G][U][A] =  2.000;
+ int22_ar[G][C][C][C][G][U][U][A] =  2.000;
+ int22_ar[G][C][C][C][U][A][U][A] =  1.900;
+ int22_ar[G][C][C][C][U][C][U][A] =  1.900;
+ int22_ar[G][C][C][C][U][G][U][A] =  2.000;
+ int22_ar[G][C][C][C][U][U][U][A] =  1.900;
+ int22_ar[G][C][C][G][A][A][U][A] =  0.800;
+ int22_ar[G][C][C][G][A][C][U][A] =  1.800;
+ int22_ar[G][C][C][G][A][G][U][A] =  2.000;
+ int22_ar[G][C][C][G][A][U][U][A] =  1.900;
+ int22_ar[G][C][C][G][C][A][U][A] =  2.000;
+ int22_ar[G][C][C][G][C][C][U][A] =  2.000;
+ int22_ar[G][C][C][G][C][G][U][A] =  2.000;
+ int22_ar[G][C][C][G][C][U][U][A] =  2.000;
+ int22_ar[G][C][C][G][G][A][U][A] =  1.200;
+ int22_ar[G][C][C][G][G][C][U][A] =  1.800;
+ int22_ar[G][C][C][G][G][G][U][A] =  2.000;
+ int22_ar[G][C][C][G][G][U][U][A] =  1.900;
+ int22_ar[G][C][C][G][U][A][U][A] = -0.900;
+ int22_ar[G][C][C][G][U][C][U][A] =  0.100;
+ int22_ar[G][C][C][G][U][G][U][A] =  2.000;
+ int22_ar[G][C][C][G][U][U][U][A] =  0.100;
+ int22_ar[G][C][C][U][A][A][U][A] =  2.000;
+ int22_ar[G][C][C][U][A][C][U][A] =  2.000;
+ int22_ar[G][C][C][U][A][G][U][A] =  2.000;
+ int22_ar[G][C][C][U][A][U][U][A] =  2.000;
+ int22_ar[G][C][C][U][C][A][U][A] =  1.600;
+ int22_ar[G][C][C][U][C][C][U][A] =  1.600;
+ int22_ar[G][C][C][U][C][G][U][A] =  2.000;
+ int22_ar[G][C][C][U][C][U][U][A] =  1.600;
+ int22_ar[G][C][C][U][G][A][U][A] =  0.300;
+ int22_ar[G][C][C][U][G][C][U][A] =  1.300;
+ int22_ar[G][C][C][U][G][G][U][A] =  2.000;
+ int22_ar[G][C][C][U][G][U][U][A] =  1.400;
+ int22_ar[G][C][C][U][U][A][U][A] =  1.000;
+ int22_ar[G][C][C][U][U][C][U][A] =  1.000;
+ int22_ar[G][C][C][U][U][G][U][A] =  2.000;
+ int22_ar[G][C][C][U][U][U][U][A] =  1.100;
+ int22_ar[G][C][G][A][A][A][U][A] =  0.100;
+ int22_ar[G][C][G][A][A][C][U][A] =  2.000;
+ int22_ar[G][C][G][A][A][G][U][A] =  1.800;
+ int22_ar[G][C][G][A][A][U][U][A] =  0.400;
+ int22_ar[G][C][G][A][C][A][U][A] = -0.300;
+ int22_ar[G][C][G][A][C][C][U][A] =  2.000;
+ int22_ar[G][C][G][A][C][G][U][A] =  1.300;
+ int22_ar[G][C][G][A][C][U][U][A] = -1.100;
+ int22_ar[G][C][G][A][G][A][U][A] = -0.900;
+ int22_ar[G][C][G][A][G][C][U][A] =  2.000;
+ int22_ar[G][C][G][A][G][G][U][A] =  0.700;
+ int22_ar[G][C][G][A][G][U][U][A] =  0.100;
+ int22_ar[G][C][G][A][U][A][U][A] =  2.000;
+ int22_ar[G][C][G][A][U][C][U][A] =  2.000;
+ int22_ar[G][C][G][A][U][G][U][A] =  2.000;
+ int22_ar[G][C][G][A][U][U][U][A] =  2.000;
+ int22_ar[G][C][G][C][A][A][U][A] =  0.100;
+ int22_ar[G][C][G][C][A][C][U][A] =  2.000;
+ int22_ar[G][C][G][C][A][G][U][A] =  1.800;
+ int22_ar[G][C][G][C][A][U][U][A] = -0.600;
+ int22_ar[G][C][G][C][C][A][U][A] =  1.100;
+ int22_ar[G][C][G][C][C][C][U][A] =  2.000;
+ int22_ar[G][C][G][C][C][G][U][A] =  2.400;
+ int22_ar[G][C][G][C][C][U][U][A] =  0.400;
+ int22_ar[G][C][G][C][G][A][U][A] =  2.000;
+ int22_ar[G][C][G][C][G][C][U][A] =  2.000;
+ int22_ar[G][C][G][C][G][G][U][A] =  2.000;
+ int22_ar[G][C][G][C][G][U][U][A] =  2.000;
+ int22_ar[G][C][G][C][U][A][U][A] =  1.100;
+ int22_ar[G][C][G][C][U][C][U][A] =  2.000;
+ int22_ar[G][C][G][C][U][G][U][A] =  2.400;
+ int22_ar[G][C][G][C][U][U][U][A] =  0.400;
+ int22_ar[G][C][G][G][A][A][U][A] = -0.900;
+ int22_ar[G][C][G][G][A][C][U][A] =  2.000;
+ int22_ar[G][C][G][G][A][G][U][A] =  0.700;
+ int22_ar[G][C][G][G][A][U][U][A] =  0.100;
+ int22_ar[G][C][G][G][C][A][U][A] =  2.000;
+ int22_ar[G][C][G][G][C][C][U][A] =  2.000;
+ int22_ar[G][C][G][G][C][G][U][A] =  2.000;
+ int22_ar[G][C][G][G][C][U][U][A] =  2.000;
+ int22_ar[G][C][G][G][G][A][U][A] = -0.500;
+ int22_ar[G][C][G][G][G][C][U][A] =  2.000;
+ int22_ar[G][C][G][G][G][G][U][A] =  1.100;
+ int22_ar[G][C][G][G][G][U][U][A] = -0.300;
+ int22_ar[G][C][G][G][U][A][U][A] = -0.900;
+ int22_ar[G][C][G][G][U][C][U][A] =  2.000;
+ int22_ar[G][C][G][G][U][G][U][A] =  0.000;
+ int22_ar[G][C][G][G][U][U][U][A] = -3.500;
+ int22_ar[G][C][G][U][A][A][U][A] =  2.000;
+ int22_ar[G][C][G][U][A][C][U][A] =  2.000;
+ int22_ar[G][C][G][U][A][G][U][A] =  2.000;
+ int22_ar[G][C][G][U][A][U][U][A] =  2.000;
+ int22_ar[G][C][G][U][C][A][U][A] =  0.800;
+ int22_ar[G][C][G][U][C][C][U][A] =  2.000;
+ int22_ar[G][C][G][U][C][G][U][A] =  2.100;
+ int22_ar[G][C][G][U][C][U][U][A] =  0.100;
+ int22_ar[G][C][G][U][G][A][U][A] =  0.400;
+ int22_ar[G][C][G][U][G][C][U][A] =  2.000;
+ int22_ar[G][C][G][U][G][G][U][A] =  1.200;
+ int22_ar[G][C][G][U][G][U][U][A] = -2.200;
+ int22_ar[G][C][G][U][U][A][U][A] =  1.100;
+ int22_ar[G][C][G][U][U][C][U][A] =  2.000;
+ int22_ar[G][C][G][U][U][G][U][A] =  1.900;
+ int22_ar[G][C][G][U][U][U][U][A] =  0.300;
+ int22_ar[G][C][U][A][A][A][U][A] =  2.000;
+ int22_ar[G][C][U][A][A][C][U][A] =  1.500;
+ int22_ar[G][C][U][A][A][G][U][A] =  0.000;
+ int22_ar[G][C][U][A][A][U][U][A] =  2.100;
+ int22_ar[G][C][U][A][C][A][U][A] =  2.000;
+ int22_ar[G][C][U][A][C][C][U][A] =  0.400;
+ int22_ar[G][C][U][A][C][G][U][A] = -1.500;
+ int22_ar[G][C][U][A][C][U][U][A] =  0.700;
+ int22_ar[G][C][U][A][G][A][U][A] =  2.000;
+ int22_ar[G][C][U][A][G][C][U][A] =  0.900;
+ int22_ar[G][C][U][A][G][G][U][A] = -0.300;
+ int22_ar[G][C][U][A][G][U][U][A] =  1.900;
+ int22_ar[G][C][U][A][U][A][U][A] =  2.000;
+ int22_ar[G][C][U][A][U][C][U][A] =  2.000;
+ int22_ar[G][C][U][A][U][G][U][A] =  2.000;
+ int22_ar[G][C][U][A][U][U][U][A] =  2.000;
+ int22_ar[G][C][U][C][A][A][U][A] =  2.000;
+ int22_ar[G][C][U][C][A][C][U][A] =  0.900;
+ int22_ar[G][C][U][C][A][G][U][A] = -1.000;
+ int22_ar[G][C][U][C][A][U][U][A] =  1.100;
+ int22_ar[G][C][U][C][C][A][U][A] =  2.000;
+ int22_ar[G][C][U][C][C][C][U][A] =  0.900;
+ int22_ar[G][C][U][C][C][G][U][A] =  0.000;
+ int22_ar[G][C][U][C][C][U][U][A] =  1.100;
+ int22_ar[G][C][U][C][G][A][U][A] =  2.000;
+ int22_ar[G][C][U][C][G][C][U][A] =  2.000;
+ int22_ar[G][C][U][C][G][G][U][A] =  2.000;
+ int22_ar[G][C][U][C][G][U][U][A] =  2.000;
+ int22_ar[G][C][U][C][U][A][U][A] =  2.000;
+ int22_ar[G][C][U][C][U][C][U][A] =  0.900;
+ int22_ar[G][C][U][C][U][G][U][A] =  0.000;
+ int22_ar[G][C][U][C][U][U][U][A] =  1.100;
+ int22_ar[G][C][U][G][A][A][U][A] =  2.000;
+ int22_ar[G][C][U][G][A][C][U][A] =  0.900;
+ int22_ar[G][C][U][G][A][G][U][A] = -0.300;
+ int22_ar[G][C][U][G][A][U][U][A] =  1.900;
+ int22_ar[G][C][U][G][C][A][U][A] =  2.000;
+ int22_ar[G][C][U][G][C][C][U][A] =  2.000;
+ int22_ar[G][C][U][G][C][G][U][A] =  2.000;
+ int22_ar[G][C][U][G][C][U][U][A] =  2.000;
+ int22_ar[G][C][U][G][G][A][U][A] =  2.000;
+ int22_ar[G][C][U][G][G][C][U][A] =  0.800;
+ int22_ar[G][C][U][G][G][G][U][A] = -0.700;
+ int22_ar[G][C][U][G][G][U][U][A] =  1.500;
+ int22_ar[G][C][U][G][U][A][U][A] =  2.000;
+ int22_ar[G][C][U][G][U][C][U][A] = -0.900;
+ int22_ar[G][C][U][G][U][G][U][A] = -3.900;
+ int22_ar[G][C][U][G][U][U][U][A] =  0.100;
+ int22_ar[G][C][U][U][A][A][U][A] =  2.000;
+ int22_ar[G][C][U][U][A][C][U][A] =  2.000;
+ int22_ar[G][C][U][U][A][G][U][A] =  2.000;
+ int22_ar[G][C][U][U][A][U][U][A] =  2.000;
+ int22_ar[G][C][U][U][C][A][U][A] =  2.000;
+ int22_ar[G][C][U][U][C][C][U][A] =  0.600;
+ int22_ar[G][C][U][U][C][G][U][A] = -0.300;
+ int22_ar[G][C][U][U][C][U][U][A] =  0.800;
+ int22_ar[G][C][U][U][G][A][U][A] =  2.000;
+ int22_ar[G][C][U][U][G][C][U][A] =  0.400;
+ int22_ar[G][C][U][U][G][G][U][A] = -2.600;
+ int22_ar[G][C][U][U][G][U][U][A] =  1.400;
+ int22_ar[G][C][U][U][U][A][U][A] =  2.000;
+ int22_ar[G][C][U][U][U][C][U][A] =  0.000;
+ int22_ar[G][C][U][U][U][G][U][A] = -0.100;
+ int22_ar[G][C][U][U][U][U][U][A] =  0.300;
+ int22_ar[G][C][A][A][A][A][U][G] =  2.100;
+ int22_ar[G][C][A][A][A][C][U][G] =  1.800;
+ int22_ar[G][C][A][A][A][G][U][G] =  0.700;
+ int22_ar[G][C][A][A][A][U][U][G] =  2.000;
+ int22_ar[G][C][A][A][C][A][U][G] =  1.700;
+ int22_ar[G][C][A][A][C][C][U][G] =  1.400;
+ int22_ar[G][C][A][A][C][G][U][G] =  0.300;
+ int22_ar[G][C][A][A][C][U][U][G] =  2.000;
+ int22_ar[G][C][A][A][G][A][U][G] =  1.100;
+ int22_ar[G][C][A][A][G][C][U][G] =  0.800;
+ int22_ar[G][C][A][A][G][G][U][G] = -0.300;
+ int22_ar[G][C][A][A][G][U][U][G] =  2.000;
+ int22_ar[G][C][A][A][U][A][U][G] =  2.000;
+ int22_ar[G][C][A][A][U][C][U][G] =  2.000;
+ int22_ar[G][C][A][A][U][G][U][G] =  2.000;
+ int22_ar[G][C][A][A][U][U][U][G] =  2.000;
+ int22_ar[G][C][A][C][A][A][U][G] =  2.100;
+ int22_ar[G][C][A][C][A][C][U][G] =  1.800;
+ int22_ar[G][C][A][C][A][G][U][G] =  0.700;
+ int22_ar[G][C][A][C][A][U][U][G] =  2.000;
+ int22_ar[G][C][A][C][C][A][U][G] =  2.700;
+ int22_ar[G][C][A][C][C][C][U][G] =  1.800;
+ int22_ar[G][C][A][C][C][G][U][G] =  1.700;
+ int22_ar[G][C][A][C][C][U][U][G] =  2.000;
+ int22_ar[G][C][A][C][G][A][U][G] =  2.000;
+ int22_ar[G][C][A][C][G][C][U][G] =  2.000;
+ int22_ar[G][C][A][C][G][G][U][G] =  2.000;
+ int22_ar[G][C][A][C][G][U][U][G] =  2.000;
+ int22_ar[G][C][A][C][U][A][U][G] =  2.700;
+ int22_ar[G][C][A][C][U][C][U][G] =  1.800;
+ int22_ar[G][C][A][C][U][G][U][G] =  1.700;
+ int22_ar[G][C][A][C][U][U][U][G] =  2.000;
+ int22_ar[G][C][A][G][A][A][U][G] =  1.100;
+ int22_ar[G][C][A][G][A][C][U][G] =  0.800;
+ int22_ar[G][C][A][G][A][G][U][G] = -0.300;
+ int22_ar[G][C][A][G][A][U][U][G] =  2.000;
+ int22_ar[G][C][A][G][C][A][U][G] =  2.000;
+ int22_ar[G][C][A][G][C][C][U][G] =  2.000;
+ int22_ar[G][C][A][G][C][G][U][G] =  2.000;
+ int22_ar[G][C][A][G][C][U][U][G] =  2.000;
+ int22_ar[G][C][A][G][G][A][U][G] =  1.500;
+ int22_ar[G][C][A][G][G][C][U][G] =  1.200;
+ int22_ar[G][C][A][G][G][G][U][G] =  0.100;
+ int22_ar[G][C][A][G][G][U][U][G] =  2.000;
+ int22_ar[G][C][A][G][U][A][U][G] =  0.300;
+ int22_ar[G][C][A][G][U][C][U][G] = -1.000;
+ int22_ar[G][C][A][G][U][G][U][G] = -0.300;
+ int22_ar[G][C][A][G][U][U][U][G] =  2.000;
+ int22_ar[G][C][A][U][A][A][U][G] =  2.000;
+ int22_ar[G][C][A][U][A][C][U][G] =  2.000;
+ int22_ar[G][C][A][U][A][G][U][G] =  2.000;
+ int22_ar[G][C][A][U][A][U][U][G] =  2.000;
+ int22_ar[G][C][A][U][C][A][U][G] =  2.400;
+ int22_ar[G][C][A][U][C][C][U][G] =  1.500;
+ int22_ar[G][C][A][U][C][G][U][G] =  1.400;
+ int22_ar[G][C][A][U][C][U][U][G] =  2.000;
+ int22_ar[G][C][A][U][G][A][U][G] =  1.600;
+ int22_ar[G][C][A][U][G][C][U][G] =  0.300;
+ int22_ar[G][C][A][U][G][G][U][G] =  1.000;
+ int22_ar[G][C][A][U][G][U][U][G] =  2.000;
+ int22_ar[G][C][A][U][U][A][U][G] =  2.300;
+ int22_ar[G][C][A][U][U][C][U][G] =  1.000;
+ int22_ar[G][C][A][U][U][G][U][G] =  1.700;
+ int22_ar[G][C][A][U][U][U][U][G] =  2.000;
+ int22_ar[G][C][C][A][A][A][U][G] =  1.900;
+ int22_ar[G][C][C][A][A][C][U][G] =  2.500;
+ int22_ar[G][C][C][A][A][G][U][G] =  2.000;
+ int22_ar[G][C][C][A][A][U][U][G] =  2.500;
+ int22_ar[G][C][C][A][C][A][U][G] =  1.400;
+ int22_ar[G][C][C][A][C][C][U][G] =  1.400;
+ int22_ar[G][C][C][A][C][G][U][G] =  2.000;
+ int22_ar[G][C][C][A][C][U][U][G] =  1.500;
+ int22_ar[G][C][C][A][G][A][U][G] =  0.800;
+ int22_ar[G][C][C][A][G][C][U][G] =  1.800;
+ int22_ar[G][C][C][A][G][G][U][G] =  2.000;
+ int22_ar[G][C][C][A][G][U][U][G] =  1.900;
+ int22_ar[G][C][C][A][U][A][U][G] =  2.000;
+ int22_ar[G][C][C][A][U][C][U][G] =  2.000;
+ int22_ar[G][C][C][A][U][G][U][G] =  2.000;
+ int22_ar[G][C][C][A][U][U][U][G] =  2.000;
+ int22_ar[G][C][C][C][A][A][U][G] =  1.900;
+ int22_ar[G][C][C][C][A][C][U][G] =  1.900;
+ int22_ar[G][C][C][C][A][G][U][G] =  2.000;
+ int22_ar[G][C][C][C][A][U][U][G] =  1.900;
+ int22_ar[G][C][C][C][C][A][U][G] =  1.900;
+ int22_ar[G][C][C][C][C][C][U][G] =  1.900;
+ int22_ar[G][C][C][C][C][G][U][G] =  2.000;
+ int22_ar[G][C][C][C][C][U][U][G] =  1.900;
+ int22_ar[G][C][C][C][G][A][U][G] =  2.000;
+ int22_ar[G][C][C][C][G][C][U][G] =  2.000;
+ int22_ar[G][C][C][C][G][G][U][G] =  2.000;
+ int22_ar[G][C][C][C][G][U][U][G] =  2.000;
+ int22_ar[G][C][C][C][U][A][U][G] =  1.900;
+ int22_ar[G][C][C][C][U][C][U][G] =  1.900;
+ int22_ar[G][C][C][C][U][G][U][G] =  2.000;
+ int22_ar[G][C][C][C][U][U][U][G] =  1.900;
+ int22_ar[G][C][C][G][A][A][U][G] =  0.800;
+ int22_ar[G][C][C][G][A][C][U][G] =  1.800;
+ int22_ar[G][C][C][G][A][G][U][G] =  2.000;
+ int22_ar[G][C][C][G][A][U][U][G] =  1.900;
+ int22_ar[G][C][C][G][C][A][U][G] =  2.000;
+ int22_ar[G][C][C][G][C][C][U][G] =  2.000;
+ int22_ar[G][C][C][G][C][G][U][G] =  2.000;
+ int22_ar[G][C][C][G][C][U][U][G] =  2.000;
+ int22_ar[G][C][C][G][G][A][U][G] =  1.200;
+ int22_ar[G][C][C][G][G][C][U][G] =  1.800;
+ int22_ar[G][C][C][G][G][G][U][G] =  2.000;
+ int22_ar[G][C][C][G][G][U][U][G] =  1.900;
+ int22_ar[G][C][C][G][U][A][U][G] = -0.900;
+ int22_ar[G][C][C][G][U][C][U][G] =  0.100;
+ int22_ar[G][C][C][G][U][G][U][G] =  2.000;
+ int22_ar[G][C][C][G][U][U][U][G] =  0.100;
+ int22_ar[G][C][C][U][A][A][U][G] =  2.000;
+ int22_ar[G][C][C][U][A][C][U][G] =  2.000;
+ int22_ar[G][C][C][U][A][G][U][G] =  2.000;
+ int22_ar[G][C][C][U][A][U][U][G] =  2.000;
+ int22_ar[G][C][C][U][C][A][U][G] =  1.600;
+ int22_ar[G][C][C][U][C][C][U][G] =  1.600;
+ int22_ar[G][C][C][U][C][G][U][G] =  2.000;
+ int22_ar[G][C][C][U][C][U][U][G] =  1.600;
+ int22_ar[G][C][C][U][G][A][U][G] =  0.300;
+ int22_ar[G][C][C][U][G][C][U][G] =  1.300;
+ int22_ar[G][C][C][U][G][G][U][G] =  2.000;
+ int22_ar[G][C][C][U][G][U][U][G] =  1.400;
+ int22_ar[G][C][C][U][U][A][U][G] =  1.000;
+ int22_ar[G][C][C][U][U][C][U][G] =  1.000;
+ int22_ar[G][C][C][U][U][G][U][G] =  2.000;
+ int22_ar[G][C][C][U][U][U][U][G] =  1.100;
+ int22_ar[G][C][G][A][A][A][U][G] =  0.100;
+ int22_ar[G][C][G][A][A][C][U][G] =  2.000;
+ int22_ar[G][C][G][A][A][G][U][G] =  1.800;
+ int22_ar[G][C][G][A][A][U][U][G] =  0.400;
+ int22_ar[G][C][G][A][C][A][U][G] = -0.300;
+ int22_ar[G][C][G][A][C][C][U][G] =  2.000;
+ int22_ar[G][C][G][A][C][G][U][G] =  1.300;
+ int22_ar[G][C][G][A][C][U][U][G] = -1.100;
+ int22_ar[G][C][G][A][G][A][U][G] = -0.900;
+ int22_ar[G][C][G][A][G][C][U][G] =  2.000;
+ int22_ar[G][C][G][A][G][G][U][G] =  0.700;
+ int22_ar[G][C][G][A][G][U][U][G] =  0.100;
+ int22_ar[G][C][G][A][U][A][U][G] =  2.000;
+ int22_ar[G][C][G][A][U][C][U][G] =  2.000;
+ int22_ar[G][C][G][A][U][G][U][G] =  2.000;
+ int22_ar[G][C][G][A][U][U][U][G] =  2.000;
+ int22_ar[G][C][G][C][A][A][U][G] =  0.100;
+ int22_ar[G][C][G][C][A][C][U][G] =  2.000;
+ int22_ar[G][C][G][C][A][G][U][G] =  1.800;
+ int22_ar[G][C][G][C][A][U][U][G] = -0.600;
+ int22_ar[G][C][G][C][C][A][U][G] =  1.100;
+ int22_ar[G][C][G][C][C][C][U][G] =  2.000;
+ int22_ar[G][C][G][C][C][G][U][G] =  2.400;
+ int22_ar[G][C][G][C][C][U][U][G] =  0.400;
+ int22_ar[G][C][G][C][G][A][U][G] =  2.000;
+ int22_ar[G][C][G][C][G][C][U][G] =  2.000;
+ int22_ar[G][C][G][C][G][G][U][G] =  2.000;
+ int22_ar[G][C][G][C][G][U][U][G] =  2.000;
+ int22_ar[G][C][G][C][U][A][U][G] =  1.100;
+ int22_ar[G][C][G][C][U][C][U][G] =  2.000;
+ int22_ar[G][C][G][C][U][G][U][G] =  2.400;
+ int22_ar[G][C][G][C][U][U][U][G] =  0.400;
+ int22_ar[G][C][G][G][A][A][U][G] = -0.900;
+ int22_ar[G][C][G][G][A][C][U][G] =  2.000;
+ int22_ar[G][C][G][G][A][G][U][G] =  0.700;
+ int22_ar[G][C][G][G][A][U][U][G] =  0.100;
+ int22_ar[G][C][G][G][C][A][U][G] =  2.000;
+ int22_ar[G][C][G][G][C][C][U][G] =  2.000;
+ int22_ar[G][C][G][G][C][G][U][G] =  2.000;
+ int22_ar[G][C][G][G][C][U][U][G] =  2.000;
+ int22_ar[G][C][G][G][G][A][U][G] = -0.500;
+ int22_ar[G][C][G][G][G][C][U][G] =  2.000;
+ int22_ar[G][C][G][G][G][G][U][G] =  1.100;
+ int22_ar[G][C][G][G][G][U][U][G] = -0.300;
+ int22_ar[G][C][G][G][U][A][U][G] = -0.900;
+ int22_ar[G][C][G][G][U][C][U][G] =  2.000;
+ int22_ar[G][C][G][G][U][G][U][G] =  0.000;
+ int22_ar[G][C][G][G][U][U][U][G] = -3.500;
+ int22_ar[G][C][G][U][A][A][U][G] =  2.000;
+ int22_ar[G][C][G][U][A][C][U][G] =  2.000;
+ int22_ar[G][C][G][U][A][G][U][G] =  2.000;
+ int22_ar[G][C][G][U][A][U][U][G] =  2.000;
+ int22_ar[G][C][G][U][C][A][U][G] =  0.800;
+ int22_ar[G][C][G][U][C][C][U][G] =  2.000;
+ int22_ar[G][C][G][U][C][G][U][G] =  2.100;
+ int22_ar[G][C][G][U][C][U][U][G] =  0.100;
+ int22_ar[G][C][G][U][G][A][U][G] =  0.400;
+ int22_ar[G][C][G][U][G][C][U][G] =  2.000;
+ int22_ar[G][C][G][U][G][G][U][G] =  1.200;
+ int22_ar[G][C][G][U][G][U][U][G] = -2.200;
+ int22_ar[G][C][G][U][U][A][U][G] =  1.100;
+ int22_ar[G][C][G][U][U][C][U][G] =  2.000;
+ int22_ar[G][C][G][U][U][G][U][G] =  1.900;
+ int22_ar[G][C][G][U][U][U][U][G] =  0.300;
+ int22_ar[G][C][U][A][A][A][U][G] =  2.000;
+ int22_ar[G][C][U][A][A][C][U][G] =  1.500;
+ int22_ar[G][C][U][A][A][G][U][G] =  0.000;
+ int22_ar[G][C][U][A][A][U][U][G] =  2.100;
+ int22_ar[G][C][U][A][C][A][U][G] =  2.000;
+ int22_ar[G][C][U][A][C][C][U][G] =  0.400;
+ int22_ar[G][C][U][A][C][G][U][G] = -1.500;
+ int22_ar[G][C][U][A][C][U][U][G] =  0.700;
+ int22_ar[G][C][U][A][G][A][U][G] =  2.000;
+ int22_ar[G][C][U][A][G][C][U][G] =  0.900;
+ int22_ar[G][C][U][A][G][G][U][G] = -0.300;
+ int22_ar[G][C][U][A][G][U][U][G] =  1.900;
+ int22_ar[G][C][U][A][U][A][U][G] =  2.000;
+ int22_ar[G][C][U][A][U][C][U][G] =  2.000;
+ int22_ar[G][C][U][A][U][G][U][G] =  2.000;
+ int22_ar[G][C][U][A][U][U][U][G] =  2.000;
+ int22_ar[G][C][U][C][A][A][U][G] =  2.000;
+ int22_ar[G][C][U][C][A][C][U][G] =  0.900;
+ int22_ar[G][C][U][C][A][G][U][G] = -1.000;
+ int22_ar[G][C][U][C][A][U][U][G] =  1.100;
+ int22_ar[G][C][U][C][C][A][U][G] =  2.000;
+ int22_ar[G][C][U][C][C][C][U][G] =  0.900;
+ int22_ar[G][C][U][C][C][G][U][G] =  0.000;
+ int22_ar[G][C][U][C][C][U][U][G] =  1.100;
+ int22_ar[G][C][U][C][G][A][U][G] =  2.000;
+ int22_ar[G][C][U][C][G][C][U][G] =  2.000;
+ int22_ar[G][C][U][C][G][G][U][G] =  2.000;
+ int22_ar[G][C][U][C][G][U][U][G] =  2.000;
+ int22_ar[G][C][U][C][U][A][U][G] =  2.000;
+ int22_ar[G][C][U][C][U][C][U][G] =  0.900;
+ int22_ar[G][C][U][C][U][G][U][G] =  0.000;
+ int22_ar[G][C][U][C][U][U][U][G] =  1.100;
+ int22_ar[G][C][U][G][A][A][U][G] =  2.000;
+ int22_ar[G][C][U][G][A][C][U][G] =  0.900;
+ int22_ar[G][C][U][G][A][G][U][G] = -0.300;
+ int22_ar[G][C][U][G][A][U][U][G] =  1.900;
+ int22_ar[G][C][U][G][C][A][U][G] =  2.000;
+ int22_ar[G][C][U][G][C][C][U][G] =  2.000;
+ int22_ar[G][C][U][G][C][G][U][G] =  2.000;
+ int22_ar[G][C][U][G][C][U][U][G] =  2.000;
+ int22_ar[G][C][U][G][G][A][U][G] =  2.000;
+ int22_ar[G][C][U][G][G][C][U][G] =  0.800;
+ int22_ar[G][C][U][G][G][G][U][G] = -0.700;
+ int22_ar[G][C][U][G][G][U][U][G] =  1.500;
+ int22_ar[G][C][U][G][U][A][U][G] =  2.000;
+ int22_ar[G][C][U][G][U][C][U][G] = -0.900;
+ int22_ar[G][C][U][G][U][G][U][G] = -3.900;
+ int22_ar[G][C][U][G][U][U][U][G] =  0.100;
+ int22_ar[G][C][U][U][A][A][U][G] =  2.000;
+ int22_ar[G][C][U][U][A][C][U][G] =  2.000;
+ int22_ar[G][C][U][U][A][G][U][G] =  2.000;
+ int22_ar[G][C][U][U][A][U][U][G] =  2.000;
+ int22_ar[G][C][U][U][C][A][U][G] =  2.000;
+ int22_ar[G][C][U][U][C][C][U][G] =  0.600;
+ int22_ar[G][C][U][U][C][G][U][G] = -0.300;
+ int22_ar[G][C][U][U][C][U][U][G] =  0.800;
+ int22_ar[G][C][U][U][G][A][U][G] =  2.000;
+ int22_ar[G][C][U][U][G][C][U][G] =  0.400;
+ int22_ar[G][C][U][U][G][G][U][G] = -2.600;
+ int22_ar[G][C][U][U][G][U][U][G] =  1.400;
+ int22_ar[G][C][U][U][U][A][U][G] =  2.000;
+ int22_ar[G][C][U][U][U][C][U][G] =  0.000;
+ int22_ar[G][C][U][U][U][G][U][G] = -0.100;
+ int22_ar[G][C][U][U][U][U][U][G] =  0.300;
+ int22_ar[G][U][A][A][A][A][A][U] =  2.800;
+ int22_ar[G][U][A][A][A][C][A][U] =  2.600;
+ int22_ar[G][U][A][A][A][G][A][U] =  1.500;
+ int22_ar[G][U][A][A][A][U][A][U] =  2.000;
+ int22_ar[G][U][A][A][C][A][A][U] =  2.500;
+ int22_ar[G][U][A][A][C][C][A][U] =  2.400;
+ int22_ar[G][U][A][A][C][G][A][U] =  1.300;
+ int22_ar[G][U][A][A][C][U][A][U] =  2.000;
+ int22_ar[G][U][A][A][G][A][A][U] =  1.500;
+ int22_ar[G][U][A][A][G][C][A][U] =  1.400;
+ int22_ar[G][U][A][A][G][G][A][U] =  0.300;
+ int22_ar[G][U][A][A][G][U][A][U] =  2.000;
+ int22_ar[G][U][A][A][U][A][A][U] =  2.000;
+ int22_ar[G][U][A][A][U][C][A][U] =  2.000;
+ int22_ar[G][U][A][A][U][G][A][U] =  2.000;
+ int22_ar[G][U][A][A][U][U][A][U] =  2.000;
+ int22_ar[G][U][A][C][A][A][A][U] =  2.600;
+ int22_ar[G][U][A][C][A][C][A][U] =  2.500;
+ int22_ar[G][U][A][C][A][G][A][U] =  1.400;
+ int22_ar[G][U][A][C][A][U][A][U] =  2.000;
+ int22_ar[G][U][A][C][C][A][A][U] =  3.100;
+ int22_ar[G][U][A][C][C][C][A][U] =  2.300;
+ int22_ar[G][U][A][C][C][G][A][U] =  2.200;
+ int22_ar[G][U][A][C][C][U][A][U] =  2.000;
+ int22_ar[G][U][A][C][G][A][A][U] =  2.000;
+ int22_ar[G][U][A][C][G][C][A][U] =  2.000;
+ int22_ar[G][U][A][C][G][G][A][U] =  2.000;
+ int22_ar[G][U][A][C][G][U][A][U] =  2.000;
+ int22_ar[G][U][A][C][U][A][A][U] =  3.100;
+ int22_ar[G][U][A][C][U][C][A][U] =  2.300;
+ int22_ar[G][U][A][C][U][G][A][U] =  2.200;
+ int22_ar[G][U][A][C][U][U][A][U] =  2.000;
+ int22_ar[G][U][A][G][A][A][A][U] =  1.500;
+ int22_ar[G][U][A][G][A][C][A][U] =  1.400;
+ int22_ar[G][U][A][G][A][G][A][U] =  0.300;
+ int22_ar[G][U][A][G][A][U][A][U] =  2.000;
+ int22_ar[G][U][A][G][C][A][A][U] =  2.000;
+ int22_ar[G][U][A][G][C][C][A][U] =  2.000;
+ int22_ar[G][U][A][G][C][G][A][U] =  2.000;
+ int22_ar[G][U][A][G][C][U][A][U] =  2.000;
+ int22_ar[G][U][A][G][G][A][A][U] =  2.100;
+ int22_ar[G][U][A][G][G][C][A][U] =  1.900;
+ int22_ar[G][U][A][G][G][G][A][U] =  0.800;
+ int22_ar[G][U][A][G][G][U][A][U] =  2.000;
+ int22_ar[G][U][A][G][U][A][A][U] =  1.300;
+ int22_ar[G][U][A][G][U][C][A][U] =  0.200;
+ int22_ar[G][U][A][G][U][G][A][U] =  0.900;
+ int22_ar[G][U][A][G][U][U][A][U] =  2.000;
+ int22_ar[G][U][A][U][A][A][A][U] =  2.000;
+ int22_ar[G][U][A][U][A][C][A][U] =  2.000;
+ int22_ar[G][U][A][U][A][G][A][U] =  2.000;
+ int22_ar[G][U][A][U][A][U][A][U] =  2.000;
+ int22_ar[G][U][A][U][C][A][A][U] =  3.100;
+ int22_ar[G][U][A][U][C][C][A][U] =  2.300;
+ int22_ar[G][U][A][U][C][G][A][U] =  2.200;
+ int22_ar[G][U][A][U][C][U][A][U] =  2.000;
+ int22_ar[G][U][A][U][G][A][A][U] =  2.300;
+ int22_ar[G][U][A][U][G][C][A][U] =  1.200;
+ int22_ar[G][U][A][U][G][G][A][U] =  1.900;
+ int22_ar[G][U][A][U][G][U][A][U] =  2.000;
+ int22_ar[G][U][A][U][U][A][A][U] =  2.700;
+ int22_ar[G][U][A][U][U][C][A][U] =  1.500;
+ int22_ar[G][U][A][U][U][G][A][U] =  2.200;
+ int22_ar[G][U][A][U][U][U][A][U] =  2.000;
+ int22_ar[G][U][C][A][A][A][A][U] =  2.500;
+ int22_ar[G][U][C][A][A][C][A][U] =  3.100;
+ int22_ar[G][U][C][A][A][G][A][U] =  2.000;
+ int22_ar[G][U][C][A][A][U][A][U] =  3.100;
+ int22_ar[G][U][C][A][C][A][A][U] =  2.300;
+ int22_ar[G][U][C][A][C][C][A][U] =  2.200;
+ int22_ar[G][U][C][A][C][G][A][U] =  2.000;
+ int22_ar[G][U][C][A][C][U][A][U] =  2.200;
+ int22_ar[G][U][C][A][G][A][A][U] =  1.300;
+ int22_ar[G][U][C][A][G][C][A][U] =  2.200;
+ int22_ar[G][U][C][A][G][G][A][U] =  2.000;
+ int22_ar[G][U][C][A][G][U][A][U] =  2.200;
+ int22_ar[G][U][C][A][U][A][A][U] =  2.000;
+ int22_ar[G][U][C][A][U][C][A][U] =  2.000;
+ int22_ar[G][U][C][A][U][G][A][U] =  2.000;
+ int22_ar[G][U][C][A][U][U][A][U] =  2.000;
+ int22_ar[G][U][C][C][A][A][A][U] =  2.400;
+ int22_ar[G][U][C][C][A][C][A][U] =  2.300;
+ int22_ar[G][U][C][C][A][G][A][U] =  2.000;
+ int22_ar[G][U][C][C][A][U][A][U] =  2.300;
+ int22_ar[G][U][C][C][C][A][A][U] =  2.200;
+ int22_ar[G][U][C][C][C][C][A][U] =  2.200;
+ int22_ar[G][U][C][C][C][G][A][U] =  2.000;
+ int22_ar[G][U][C][C][C][U][A][U] =  2.200;
+ int22_ar[G][U][C][C][G][A][A][U] =  2.000;
+ int22_ar[G][U][C][C][G][C][A][U] =  2.000;
+ int22_ar[G][U][C][C][G][G][A][U] =  2.000;
+ int22_ar[G][U][C][C][G][U][A][U] =  2.000;
+ int22_ar[G][U][C][C][U][A][A][U] =  2.200;
+ int22_ar[G][U][C][C][U][C][A][U] =  2.200;
+ int22_ar[G][U][C][C][U][G][A][U] =  2.000;
+ int22_ar[G][U][C][C][U][U][A][U] =  2.200;
+ int22_ar[G][U][C][G][A][A][A][U] =  1.300;
+ int22_ar[G][U][C][G][A][C][A][U] =  2.200;
+ int22_ar[G][U][C][G][A][G][A][U] =  2.000;
+ int22_ar[G][U][C][G][A][U][A][U] =  2.200;
+ int22_ar[G][U][C][G][C][A][A][U] =  2.000;
+ int22_ar[G][U][C][G][C][C][A][U] =  2.000;
+ int22_ar[G][U][C][G][C][G][A][U] =  2.000;
+ int22_ar[G][U][C][G][C][U][A][U] =  2.000;
+ int22_ar[G][U][C][G][G][A][A][U] =  1.800;
+ int22_ar[G][U][C][G][G][C][A][U] =  2.400;
+ int22_ar[G][U][C][G][G][G][A][U] =  2.000;
+ int22_ar[G][U][C][G][G][U][A][U] =  2.400;
+ int22_ar[G][U][C][G][U][A][A][U] =  0.100;
+ int22_ar[G][U][C][G][U][C][A][U] =  1.000;
+ int22_ar[G][U][C][G][U][G][A][U] =  2.000;
+ int22_ar[G][U][C][G][U][U][A][U] =  1.000;
+ int22_ar[G][U][C][U][A][A][A][U] =  2.000;
+ int22_ar[G][U][C][U][A][C][A][U] =  2.000;
+ int22_ar[G][U][C][U][A][G][A][U] =  2.000;
+ int22_ar[G][U][C][U][A][U][A][U] =  2.000;
+ int22_ar[G][U][C][U][C][A][A][U] =  2.200;
+ int22_ar[G][U][C][U][C][C][A][U] =  2.200;
+ int22_ar[G][U][C][U][C][G][A][U] =  2.000;
+ int22_ar[G][U][C][U][C][U][A][U] =  2.200;
+ int22_ar[G][U][C][U][G][A][A][U] =  1.100;
+ int22_ar[G][U][C][U][G][C][A][U] =  2.000;
+ int22_ar[G][U][C][U][G][G][A][U] =  2.000;
+ int22_ar[G][U][C][U][G][U][A][U] =  2.000;
+ int22_ar[G][U][C][U][U][A][A][U] =  1.400;
+ int22_ar[G][U][C][U][U][C][A][U] =  1.400;
+ int22_ar[G][U][C][U][U][G][A][U] =  2.000;
+ int22_ar[G][U][C][U][U][U][A][U] =  1.400;
+ int22_ar[G][U][G][A][A][A][A][U] =  1.500;
+ int22_ar[G][U][G][A][A][C][A][U] =  2.000;
+ int22_ar[G][U][G][A][A][G][A][U] =  2.100;
+ int22_ar[G][U][G][A][A][U][A][U] =  2.300;
+ int22_ar[G][U][G][A][C][A][A][U] =  1.300;
+ int22_ar[G][U][G][A][C][C][A][U] =  2.000;
+ int22_ar[G][U][G][A][C][G][A][U] =  1.800;
+ int22_ar[G][U][G][A][C][U][A][U] =  1.100;
+ int22_ar[G][U][G][A][G][A][A][U] =  0.300;
+ int22_ar[G][U][G][A][G][C][A][U] =  2.000;
+ int22_ar[G][U][G][A][G][G][A][U] =  0.800;
+ int22_ar[G][U][G][A][G][U][A][U] =  1.900;
+ int22_ar[G][U][G][A][U][A][A][U] =  2.000;
+ int22_ar[G][U][G][A][U][C][A][U] =  2.000;
+ int22_ar[G][U][G][A][U][G][A][U] =  2.000;
+ int22_ar[G][U][G][A][U][U][A][U] =  2.000;
+ int22_ar[G][U][G][C][A][A][A][U] =  1.400;
+ int22_ar[G][U][G][C][A][C][A][U] =  2.000;
+ int22_ar[G][U][G][C][A][G][A][U] =  1.900;
+ int22_ar[G][U][G][C][A][U][A][U] =  1.200;
+ int22_ar[G][U][G][C][C][A][A][U] =  2.200;
+ int22_ar[G][U][G][C][C][C][A][U] =  2.000;
+ int22_ar[G][U][G][C][C][G][A][U] =  2.400;
+ int22_ar[G][U][G][C][C][U][A][U] =  2.000;
+ int22_ar[G][U][G][C][G][A][A][U] =  2.000;
+ int22_ar[G][U][G][C][G][C][A][U] =  2.000;
+ int22_ar[G][U][G][C][G][G][A][U] =  2.000;
+ int22_ar[G][U][G][C][G][U][A][U] =  2.000;
+ int22_ar[G][U][G][C][U][A][A][U] =  2.200;
+ int22_ar[G][U][G][C][U][C][A][U] =  2.000;
+ int22_ar[G][U][G][C][U][G][A][U] =  2.400;
+ int22_ar[G][U][G][C][U][U][A][U] =  2.000;
+ int22_ar[G][U][G][G][A][A][A][U] =  0.300;
+ int22_ar[G][U][G][G][A][C][A][U] =  2.000;
+ int22_ar[G][U][G][G][A][G][A][U] =  0.800;
+ int22_ar[G][U][G][G][A][U][A][U] =  1.900;
+ int22_ar[G][U][G][G][C][A][A][U] =  2.000;
+ int22_ar[G][U][G][G][C][C][A][U] =  2.000;
+ int22_ar[G][U][G][G][C][G][A][U] =  2.000;
+ int22_ar[G][U][G][G][C][U][A][U] =  2.000;
+ int22_ar[G][U][G][G][G][A][A][U] =  0.800;
+ int22_ar[G][U][G][G][G][C][A][U] =  2.000;
+ int22_ar[G][U][G][G][G][G][A][U] =  1.400;
+ int22_ar[G][U][G][G][G][U][A][U] =  1.600;
+ int22_ar[G][U][G][G][U][A][A][U] =  0.900;
+ int22_ar[G][U][G][G][U][C][A][U] =  2.000;
+ int22_ar[G][U][G][G][U][G][A][U] =  0.700;
+ int22_ar[G][U][G][G][U][U][A][U] = -1.100;
+ int22_ar[G][U][G][U][A][A][A][U] =  2.000;
+ int22_ar[G][U][G][U][A][C][A][U] =  2.000;
+ int22_ar[G][U][G][U][A][G][A][U] =  2.000;
+ int22_ar[G][U][G][U][A][U][A][U] =  2.000;
+ int22_ar[G][U][G][U][C][A][A][U] =  2.200;
+ int22_ar[G][U][G][U][C][C][A][U] =  2.000;
+ int22_ar[G][U][G][U][C][G][A][U] =  2.400;
+ int22_ar[G][U][G][U][C][U][A][U] =  2.000;
+ int22_ar[G][U][G][U][G][A][A][U] =  1.900;
+ int22_ar[G][U][G][U][G][C][A][U] =  2.000;
+ int22_ar[G][U][G][U][G][G][A][U] =  1.600;
+ int22_ar[G][U][G][U][G][U][A][U] = -0.100;
+ int22_ar[G][U][G][U][U][A][A][U] =  2.200;
+ int22_ar[G][U][G][U][U][C][A][U] =  2.000;
+ int22_ar[G][U][G][U][U][G][A][U] =  2.000;
+ int22_ar[G][U][G][U][U][U][A][U] =  2.000;
+ int22_ar[G][U][U][A][A][A][A][U] =  2.000;
+ int22_ar[G][U][U][A][A][C][A][U] =  3.100;
+ int22_ar[G][U][U][A][A][G][A][U] =  1.300;
+ int22_ar[G][U][U][A][A][U][A][U] =  2.700;
+ int22_ar[G][U][U][A][C][A][A][U] =  2.000;
+ int22_ar[G][U][U][A][C][C][A][U] =  2.200;
+ int22_ar[G][U][U][A][C][G][A][U] =  0.100;
+ int22_ar[G][U][U][A][C][U][A][U] =  1.400;
+ int22_ar[G][U][U][A][G][A][A][U] =  2.000;
+ int22_ar[G][U][U][A][G][C][A][U] =  2.200;
+ int22_ar[G][U][U][A][G][G][A][U] =  0.900;
+ int22_ar[G][U][U][A][G][U][A][U] =  2.200;
+ int22_ar[G][U][U][A][U][A][A][U] =  2.000;
+ int22_ar[G][U][U][A][U][C][A][U] =  2.000;
+ int22_ar[G][U][U][A][U][G][A][U] =  2.000;
+ int22_ar[G][U][U][A][U][U][A][U] =  2.000;
+ int22_ar[G][U][U][C][A][A][A][U] =  2.000;
+ int22_ar[G][U][U][C][A][C][A][U] =  2.300;
+ int22_ar[G][U][U][C][A][G][A][U] =  0.200;
+ int22_ar[G][U][U][C][A][U][A][U] =  1.500;
+ int22_ar[G][U][U][C][C][A][A][U] =  2.000;
+ int22_ar[G][U][U][C][C][C][A][U] =  2.200;
+ int22_ar[G][U][U][C][C][G][A][U] =  1.000;
+ int22_ar[G][U][U][C][C][U][A][U] =  1.400;
+ int22_ar[G][U][U][C][G][A][A][U] =  2.000;
+ int22_ar[G][U][U][C][G][C][A][U] =  2.000;
+ int22_ar[G][U][U][C][G][G][A][U] =  2.000;
+ int22_ar[G][U][U][C][G][U][A][U] =  2.000;
+ int22_ar[G][U][U][C][U][A][A][U] =  2.000;
+ int22_ar[G][U][U][C][U][C][A][U] =  2.200;
+ int22_ar[G][U][U][C][U][G][A][U] =  1.000;
+ int22_ar[G][U][U][C][U][U][A][U] =  1.400;
+ int22_ar[G][U][U][G][A][A][A][U] =  2.000;
+ int22_ar[G][U][U][G][A][C][A][U] =  2.200;
+ int22_ar[G][U][U][G][A][G][A][U] =  0.900;
+ int22_ar[G][U][U][G][A][U][A][U] =  2.200;
+ int22_ar[G][U][U][G][C][A][A][U] =  2.000;
+ int22_ar[G][U][U][G][C][C][A][U] =  2.000;
+ int22_ar[G][U][U][G][C][G][A][U] =  2.000;
+ int22_ar[G][U][U][G][C][U][A][U] =  2.000;
+ int22_ar[G][U][U][G][G][A][A][U] =  2.000;
+ int22_ar[G][U][U][G][G][C][A][U] =  2.400;
+ int22_ar[G][U][U][G][G][G][A][U] =  0.700;
+ int22_ar[G][U][U][G][G][U][A][U] =  2.000;
+ int22_ar[G][U][U][G][U][A][A][U] =  2.000;
+ int22_ar[G][U][U][G][U][C][A][U] =  1.000;
+ int22_ar[G][U][U][G][U][G][A][U] = -2.100;
+ int22_ar[G][U][U][G][U][U][A][U] =  1.100;
+ int22_ar[G][U][U][U][A][A][A][U] =  2.000;
+ int22_ar[G][U][U][U][A][C][A][U] =  2.000;
+ int22_ar[G][U][U][U][A][G][A][U] =  2.000;
+ int22_ar[G][U][U][U][A][U][A][U] =  2.000;
+ int22_ar[G][U][U][U][C][A][A][U] =  2.000;
+ int22_ar[G][U][U][U][C][C][A][U] =  2.200;
+ int22_ar[G][U][U][U][C][G][A][U] =  1.000;
+ int22_ar[G][U][U][U][C][U][A][U] =  1.400;
+ int22_ar[G][U][U][U][G][A][A][U] =  2.000;
+ int22_ar[G][U][U][U][G][C][A][U] =  2.000;
+ int22_ar[G][U][U][U][G][G][A][U] = -1.100;
+ int22_ar[G][U][U][U][G][U][A][U] =  2.000;
+ int22_ar[G][U][U][U][U][A][A][U] =  2.000;
+ int22_ar[G][U][U][U][U][C][A][U] =  1.400;
+ int22_ar[G][U][U][U][U][G][A][U] =  1.100;
+ int22_ar[G][U][U][U][U][U][A][U] =  0.600;
+ int22_ar[G][U][A][A][A][A][C][G] =  2.000;
+ int22_ar[G][U][A][A][A][C][C][G] =  1.900;
+ int22_ar[G][U][A][A][A][G][C][G] =  0.800;
+ int22_ar[G][U][A][A][A][U][C][G] =  2.000;
+ int22_ar[G][U][A][A][C][A][C][G] =  1.900;
+ int22_ar[G][U][A][A][C][C][C][G] =  1.800;
+ int22_ar[G][U][A][A][C][G][C][G] =  0.700;
+ int22_ar[G][U][A][A][C][U][C][G] =  2.000;
+ int22_ar[G][U][A][A][G][A][C][G] =  1.000;
+ int22_ar[G][U][A][A][G][C][C][G] =  0.900;
+ int22_ar[G][U][A][A][G][G][C][G] = -0.200;
+ int22_ar[G][U][A][A][G][U][C][G] =  2.000;
+ int22_ar[G][U][A][A][U][A][C][G] =  2.000;
+ int22_ar[G][U][A][A][U][C][C][G] =  2.000;
+ int22_ar[G][U][A][A][U][G][C][G] =  2.000;
+ int22_ar[G][U][A][A][U][U][C][G] =  2.000;
+ int22_ar[G][U][A][C][A][A][C][G] =  2.400;
+ int22_ar[G][U][A][C][A][C][C][G] =  2.200;
+ int22_ar[G][U][A][C][A][G][C][G] =  1.100;
+ int22_ar[G][U][A][C][A][U][C][G] =  2.000;
+ int22_ar[G][U][A][C][C][A][C][G] =  2.800;
+ int22_ar[G][U][A][C][C][C][C][G] =  2.100;
+ int22_ar[G][U][A][C][C][G][C][G] =  2.000;
+ int22_ar[G][U][A][C][C][U][C][G] =  2.000;
+ int22_ar[G][U][A][C][G][A][C][G] =  2.000;
+ int22_ar[G][U][A][C][G][C][C][G] =  2.000;
+ int22_ar[G][U][A][C][G][G][C][G] =  2.000;
+ int22_ar[G][U][A][C][G][U][C][G] =  2.000;
+ int22_ar[G][U][A][C][U][A][C][G] =  2.700;
+ int22_ar[G][U][A][C][U][C][C][G] =  1.900;
+ int22_ar[G][U][A][C][U][G][C][G] =  1.800;
+ int22_ar[G][U][A][C][U][U][C][G] =  2.000;
+ int22_ar[G][U][A][G][A][A][C][G] =  1.000;
+ int22_ar[G][U][A][G][A][C][C][G] =  0.900;
+ int22_ar[G][U][A][G][A][G][C][G] = -0.200;
+ int22_ar[G][U][A][G][A][U][C][G] =  2.000;
+ int22_ar[G][U][A][G][C][A][C][G] =  2.000;
+ int22_ar[G][U][A][G][C][C][C][G] =  2.000;
+ int22_ar[G][U][A][G][C][G][C][G] =  2.000;
+ int22_ar[G][U][A][G][C][U][C][G] =  2.000;
+ int22_ar[G][U][A][G][G][A][C][G] =  1.800;
+ int22_ar[G][U][A][G][G][C][C][G] =  1.600;
+ int22_ar[G][U][A][G][G][G][C][G] =  0.500;
+ int22_ar[G][U][A][G][G][U][C][G] =  2.000;
+ int22_ar[G][U][A][G][U][A][C][G] =  0.300;
+ int22_ar[G][U][A][G][U][C][C][G] = -0.800;
+ int22_ar[G][U][A][G][U][G][C][G] = -0.100;
+ int22_ar[G][U][A][G][U][U][C][G] =  2.000;
+ int22_ar[G][U][A][U][A][A][C][G] =  2.000;
+ int22_ar[G][U][A][U][A][C][C][G] =  2.000;
+ int22_ar[G][U][A][U][A][G][C][G] =  2.000;
+ int22_ar[G][U][A][U][A][U][C][G] =  2.000;
+ int22_ar[G][U][A][U][C][A][C][G] =  2.700;
+ int22_ar[G][U][A][U][C][C][C][G] =  1.900;
+ int22_ar[G][U][A][U][C][G][C][G] =  1.800;
+ int22_ar[G][U][A][U][C][U][C][G] =  2.000;
+ int22_ar[G][U][A][U][G][A][C][G] =  1.800;
+ int22_ar[G][U][A][U][G][C][C][G] =  0.700;
+ int22_ar[G][U][A][U][G][G][C][G] =  1.400;
+ int22_ar[G][U][A][U][G][U][C][G] =  2.000;
+ int22_ar[G][U][A][U][U][A][C][G] =  2.200;
+ int22_ar[G][U][A][U][U][C][C][G] =  1.000;
+ int22_ar[G][U][A][U][U][G][C][G] =  1.800;
+ int22_ar[G][U][A][U][U][U][C][G] =  2.000;
+ int22_ar[G][U][C][A][A][A][C][G] =  1.800;
+ int22_ar[G][U][C][A][A][C][C][G] =  2.300;
+ int22_ar[G][U][C][A][A][G][C][G] =  2.000;
+ int22_ar[G][U][C][A][A][U][C][G] =  2.300;
+ int22_ar[G][U][C][A][C][A][C][G] =  1.700;
+ int22_ar[G][U][C][A][C][C][C][G] =  1.600;
+ int22_ar[G][U][C][A][C][G][C][G] =  2.000;
+ int22_ar[G][U][C][A][C][U][C][G] =  1.600;
+ int22_ar[G][U][C][A][G][A][C][G] =  0.800;
+ int22_ar[G][U][C][A][G][C][C][G] =  1.700;
+ int22_ar[G][U][C][A][G][G][C][G] =  2.000;
+ int22_ar[G][U][C][A][G][U][C][G] =  1.700;
+ int22_ar[G][U][C][A][U][A][C][G] =  2.000;
+ int22_ar[G][U][C][A][U][C][C][G] =  2.000;
+ int22_ar[G][U][C][A][U][G][C][G] =  2.000;
+ int22_ar[G][U][C][A][U][U][C][G] =  2.000;
+ int22_ar[G][U][C][C][A][A][C][G] =  2.100;
+ int22_ar[G][U][C][C][A][C][C][G] =  2.100;
+ int22_ar[G][U][C][C][A][G][C][G] =  2.000;
+ int22_ar[G][U][C][C][A][U][C][G] =  2.100;
+ int22_ar[G][U][C][C][C][A][C][G] =  2.000;
+ int22_ar[G][U][C][C][C][C][C][G] =  1.900;
+ int22_ar[G][U][C][C][C][G][C][G] =  2.000;
+ int22_ar[G][U][C][C][C][U][C][G] =  1.900;
+ int22_ar[G][U][C][C][G][A][C][G] =  2.000;
+ int22_ar[G][U][C][C][G][C][C][G] =  2.000;
+ int22_ar[G][U][C][C][G][G][C][G] =  2.000;
+ int22_ar[G][U][C][C][G][U][C][G] =  2.000;
+ int22_ar[G][U][C][C][U][A][C][G] =  1.800;
+ int22_ar[G][U][C][C][U][C][C][G] =  1.800;
+ int22_ar[G][U][C][C][U][G][C][G] =  2.000;
+ int22_ar[G][U][C][C][U][U][C][G] =  1.800;
+ int22_ar[G][U][C][G][A][A][C][G] =  0.800;
+ int22_ar[G][U][C][G][A][C][C][G] =  1.700;
+ int22_ar[G][U][C][G][A][G][C][G] =  2.000;
+ int22_ar[G][U][C][G][A][U][C][G] =  1.700;
+ int22_ar[G][U][C][G][C][A][C][G] =  2.000;
+ int22_ar[G][U][C][G][C][C][C][G] =  2.000;
+ int22_ar[G][U][C][G][C][G][C][G] =  2.000;
+ int22_ar[G][U][C][G][C][U][C][G] =  2.000;
+ int22_ar[G][U][C][G][G][A][C][G] =  1.500;
+ int22_ar[G][U][C][G][G][C][C][G] =  2.100;
+ int22_ar[G][U][C][G][G][G][C][G] =  2.000;
+ int22_ar[G][U][C][G][G][U][C][G] =  2.100;
+ int22_ar[G][U][C][G][U][A][C][G] = -0.900;
+ int22_ar[G][U][C][G][U][C][C][G] =  0.000;
+ int22_ar[G][U][C][G][U][G][C][G] =  2.000;
+ int22_ar[G][U][C][G][U][U][C][G] =  0.000;
+ int22_ar[G][U][C][U][A][A][C][G] =  2.000;
+ int22_ar[G][U][C][U][A][C][C][G] =  2.000;
+ int22_ar[G][U][C][U][A][G][C][G] =  2.000;
+ int22_ar[G][U][C][U][A][U][C][G] =  2.000;
+ int22_ar[G][U][C][U][C][A][C][G] =  1.800;
+ int22_ar[G][U][C][U][C][C][C][G] =  1.800;
+ int22_ar[G][U][C][U][C][G][C][G] =  2.000;
+ int22_ar[G][U][C][U][C][U][C][G] =  1.800;
+ int22_ar[G][U][C][U][G][A][C][G] =  0.600;
+ int22_ar[G][U][C][U][G][C][C][G] =  1.500;
+ int22_ar[G][U][C][U][G][G][C][G] =  2.000;
+ int22_ar[G][U][C][U][G][U][C][G] =  1.500;
+ int22_ar[G][U][C][U][U][A][C][G] =  0.900;
+ int22_ar[G][U][C][U][U][C][C][G] =  0.900;
+ int22_ar[G][U][C][U][U][G][C][G] =  2.000;
+ int22_ar[G][U][C][U][U][U][C][G] =  0.900;
+ int22_ar[G][U][G][A][A][A][C][G] =  0.800;
+ int22_ar[G][U][G][A][A][C][C][G] =  2.000;
+ int22_ar[G][U][G][A][A][G][C][G] =  1.300;
+ int22_ar[G][U][G][A][A][U][C][G] =  1.600;
+ int22_ar[G][U][G][A][C][A][C][G] =  0.700;
+ int22_ar[G][U][G][A][C][C][C][G] =  2.000;
+ int22_ar[G][U][G][A][C][G][C][G] =  1.200;
+ int22_ar[G][U][G][A][C][U][C][G] =  0.500;
+ int22_ar[G][U][G][A][G][A][C][G] = -0.200;
+ int22_ar[G][U][G][A][G][C][C][G] =  2.000;
+ int22_ar[G][U][G][A][G][G][C][G] =  0.300;
+ int22_ar[G][U][G][A][G][U][C][G] =  1.400;
+ int22_ar[G][U][G][A][U][A][C][G] =  2.000;
+ int22_ar[G][U][G][A][U][C][C][G] =  2.000;
+ int22_ar[G][U][G][A][U][G][C][G] =  2.000;
+ int22_ar[G][U][G][A][U][U][C][G] =  2.000;
+ int22_ar[G][U][G][C][A][A][C][G] =  1.100;
+ int22_ar[G][U][G][C][A][C][C][G] =  2.000;
+ int22_ar[G][U][G][C][A][G][C][G] =  1.700;
+ int22_ar[G][U][G][C][A][U][C][G] =  0.900;
+ int22_ar[G][U][G][C][C][A][C][G] =  2.000;
+ int22_ar[G][U][G][C][C][C][C][G] =  2.000;
+ int22_ar[G][U][G][C][C][G][C][G] =  2.100;
+ int22_ar[G][U][G][C][C][U][C][G] =  1.800;
+ int22_ar[G][U][G][C][G][A][C][G] =  2.000;
+ int22_ar[G][U][G][C][G][C][C][G] =  2.000;
+ int22_ar[G][U][G][C][G][G][C][G] =  2.000;
+ int22_ar[G][U][G][C][G][U][C][G] =  2.000;
+ int22_ar[G][U][G][C][U][A][C][G] =  1.800;
+ int22_ar[G][U][G][C][U][C][C][G] =  2.000;
+ int22_ar[G][U][G][C][U][G][C][G] =  2.000;
+ int22_ar[G][U][G][C][U][U][C][G] =  1.600;
+ int22_ar[G][U][G][G][A][A][C][G] = -0.200;
+ int22_ar[G][U][G][G][A][C][C][G] =  2.000;
+ int22_ar[G][U][G][G][A][G][C][G] =  0.300;
+ int22_ar[G][U][G][G][A][U][C][G] =  1.400;
+ int22_ar[G][U][G][G][C][A][C][G] =  2.000;
+ int22_ar[G][U][G][G][C][C][C][G] =  2.000;
+ int22_ar[G][U][G][G][C][G][C][G] =  2.000;
+ int22_ar[G][U][G][G][C][U][C][G] =  2.000;
+ int22_ar[G][U][G][G][G][A][C][G] =  0.500;
+ int22_ar[G][U][G][G][G][C][C][G] =  2.000;
+ int22_ar[G][U][G][G][G][G][C][G] =  1.100;
+ int22_ar[G][U][G][G][G][U][C][G] =  1.300;
+ int22_ar[G][U][G][G][U][A][C][G] = -0.100;
+ int22_ar[G][U][G][G][U][C][C][G] =  2.000;
+ int22_ar[G][U][G][G][U][G][C][G] = -0.400;
+ int22_ar[G][U][G][G][U][U][C][G] = -2.100;
+ int22_ar[G][U][G][U][A][A][C][G] =  2.000;
+ int22_ar[G][U][G][U][A][C][C][G] =  2.000;
+ int22_ar[G][U][G][U][A][G][C][G] =  2.000;
+ int22_ar[G][U][G][U][A][U][C][G] =  2.000;
+ int22_ar[G][U][G][U][C][A][C][G] =  1.800;
+ int22_ar[G][U][G][U][C][C][C][G] =  2.000;
+ int22_ar[G][U][G][U][C][G][C][G] =  2.000;
+ int22_ar[G][U][G][U][C][U][C][G] =  1.600;
+ int22_ar[G][U][G][U][G][A][C][G] =  1.400;
+ int22_ar[G][U][G][U][G][C][C][G] =  2.000;
+ int22_ar[G][U][G][U][G][G][C][G] =  1.100;
+ int22_ar[G][U][G][U][G][U][C][G] = -0.600;
+ int22_ar[G][U][G][U][U][A][C][G] =  1.800;
+ int22_ar[G][U][G][U][U][C][C][G] =  2.000;
+ int22_ar[G][U][G][U][U][G][C][G] =  1.500;
+ int22_ar[G][U][G][U][U][U][C][G] =  1.600;
+ int22_ar[G][U][U][A][A][A][C][G] =  2.000;
+ int22_ar[G][U][U][A][A][C][C][G] =  2.300;
+ int22_ar[G][U][U][A][A][G][C][G] =  0.600;
+ int22_ar[G][U][U][A][A][U][C][G] =  1.900;
+ int22_ar[G][U][U][A][C][A][C][G] =  2.000;
+ int22_ar[G][U][U][A][C][C][C][G] =  1.600;
+ int22_ar[G][U][U][A][C][G][C][G] = -0.500;
+ int22_ar[G][U][U][A][C][U][C][G] =  0.800;
+ int22_ar[G][U][U][A][G][A][C][G] =  2.000;
+ int22_ar[G][U][U][A][G][C][C][G] =  1.700;
+ int22_ar[G][U][U][A][G][G][C][G] =  0.400;
+ int22_ar[G][U][U][A][G][U][C][G] =  1.800;
+ int22_ar[G][U][U][A][U][A][C][G] =  2.000;
+ int22_ar[G][U][U][A][U][C][C][G] =  2.000;
+ int22_ar[G][U][U][A][U][G][C][G] =  2.000;
+ int22_ar[G][U][U][A][U][U][C][G] =  2.000;
+ int22_ar[G][U][U][C][A][A][C][G] =  2.000;
+ int22_ar[G][U][U][C][A][C][C][G] =  2.100;
+ int22_ar[G][U][U][C][A][G][C][G] =  0.000;
+ int22_ar[G][U][U][C][A][U][C][G] =  1.300;
+ int22_ar[G][U][U][C][C][A][C][G] =  2.000;
+ int22_ar[G][U][U][C][C][C][C][G] =  1.900;
+ int22_ar[G][U][U][C][C][G][C][G] =  0.800;
+ int22_ar[G][U][U][C][C][U][C][G] =  1.100;
+ int22_ar[G][U][U][C][G][A][C][G] =  2.000;
+ int22_ar[G][U][U][C][G][C][C][G] =  2.000;
+ int22_ar[G][U][U][C][G][G][C][G] =  2.000;
+ int22_ar[G][U][U][C][G][U][C][G] =  2.000;
+ int22_ar[G][U][U][C][U][A][C][G] =  2.000;
+ int22_ar[G][U][U][C][U][C][C][G] =  1.800;
+ int22_ar[G][U][U][C][U][G][C][G] =  0.700;
+ int22_ar[G][U][U][C][U][U][C][G] =  1.000;
+ int22_ar[G][U][U][G][A][A][C][G] =  2.000;
+ int22_ar[G][U][U][G][A][C][C][G] =  1.700;
+ int22_ar[G][U][U][G][A][G][C][G] =  0.400;
+ int22_ar[G][U][U][G][A][U][C][G] =  1.800;
+ int22_ar[G][U][U][G][C][A][C][G] =  2.000;
+ int22_ar[G][U][U][G][C][C][C][G] =  2.000;
+ int22_ar[G][U][U][G][C][G][C][G] =  2.000;
+ int22_ar[G][U][U][G][C][U][C][G] =  2.000;
+ int22_ar[G][U][U][G][G][A][C][G] =  2.000;
+ int22_ar[G][U][U][G][G][C][C][G] =  2.100;
+ int22_ar[G][U][U][G][G][G][C][G] =  0.400;
+ int22_ar[G][U][U][G][G][U][C][G] =  1.700;
+ int22_ar[G][U][U][G][U][A][C][G] =  2.000;
+ int22_ar[G][U][U][G][U][C][C][G] =  0.000;
+ int22_ar[G][U][U][G][U][G][C][G] = -3.100;
+ int22_ar[G][U][U][G][U][U][C][G] =  0.000;
+ int22_ar[G][U][U][U][A][A][C][G] =  2.000;
+ int22_ar[G][U][U][U][A][C][C][G] =  2.000;
+ int22_ar[G][U][U][U][A][G][C][G] =  2.000;
+ int22_ar[G][U][U][U][A][U][C][G] =  2.000;
+ int22_ar[G][U][U][U][C][A][C][G] =  2.000;
+ int22_ar[G][U][U][U][C][C][C][G] =  1.800;
+ int22_ar[G][U][U][U][C][G][C][G] =  0.700;
+ int22_ar[G][U][U][U][C][U][C][G] =  1.000;
+ int22_ar[G][U][U][U][G][A][C][G] =  2.000;
+ int22_ar[G][U][U][U][G][C][C][G] =  1.500;
+ int22_ar[G][U][U][U][G][G][C][G] = -1.600;
+ int22_ar[G][U][U][U][G][U][C][G] =  1.600;
+ int22_ar[G][U][U][U][U][A][C][G] =  2.000;
+ int22_ar[G][U][U][U][U][C][C][G] =  0.900;
+ int22_ar[G][U][U][U][U][G][C][G] =  0.600;
+ int22_ar[G][U][U][U][U][U][C][G] =  0.100;
+ int22_ar[G][U][A][A][A][A][G][C] =  2.100;
+ int22_ar[G][U][A][A][A][C][G][C] =  2.000;
+ int22_ar[G][U][A][A][A][G][G][C] =  0.900;
+ int22_ar[G][U][A][A][A][U][G][C] =  2.000;
+ int22_ar[G][U][A][A][C][A][G][C] =  1.900;
+ int22_ar[G][U][A][A][C][C][G][C] =  1.700;
+ int22_ar[G][U][A][A][C][G][G][C] =  0.600;
+ int22_ar[G][U][A][A][C][U][G][C] =  2.000;
+ int22_ar[G][U][A][A][G][A][G][C] =  0.100;
+ int22_ar[G][U][A][A][G][C][G][C] =  0.000;
+ int22_ar[G][U][A][A][G][G][G][C] = -1.100;
+ int22_ar[G][U][A][A][G][U][G][C] =  2.000;
+ int22_ar[G][U][A][A][U][A][G][C] =  2.000;
+ int22_ar[G][U][A][A][U][C][G][C] =  2.000;
+ int22_ar[G][U][A][A][U][G][G][C] =  2.000;
+ int22_ar[G][U][A][A][U][U][G][C] =  2.000;
+ int22_ar[G][U][A][C][A][A][G][C] =  1.800;
+ int22_ar[G][U][A][C][A][C][G][C] =  1.700;
+ int22_ar[G][U][A][C][A][G][G][C] =  0.600;
+ int22_ar[G][U][A][C][A][U][G][C] =  2.000;
+ int22_ar[G][U][A][C][C][A][G][C] =  2.500;
+ int22_ar[G][U][A][C][C][C][G][C] =  1.700;
+ int22_ar[G][U][A][C][C][G][G][C] =  1.600;
+ int22_ar[G][U][A][C][C][U][G][C] =  2.000;
+ int22_ar[G][U][A][C][G][A][G][C] =  2.000;
+ int22_ar[G][U][A][C][G][C][G][C] =  2.000;
+ int22_ar[G][U][A][C][G][G][G][C] =  2.000;
+ int22_ar[G][U][A][C][G][U][G][C] =  2.000;
+ int22_ar[G][U][A][C][U][A][G][C] =  1.500;
+ int22_ar[G][U][A][C][U][C][G][C] =  0.700;
+ int22_ar[G][U][A][C][U][G][G][C] =  0.700;
+ int22_ar[G][U][A][C][U][U][G][C] =  2.000;
+ int22_ar[G][U][A][G][A][A][G][C] =  0.700;
+ int22_ar[G][U][A][G][A][C][G][C] =  0.600;
+ int22_ar[G][U][A][G][A][G][G][C] = -0.500;
+ int22_ar[G][U][A][G][A][U][G][C] =  2.000;
+ int22_ar[G][U][A][G][C][A][G][C] =  2.000;
+ int22_ar[G][U][A][G][C][C][G][C] =  2.000;
+ int22_ar[G][U][A][G][C][G][G][C] =  2.000;
+ int22_ar[G][U][A][G][C][U][G][C] =  2.000;
+ int22_ar[G][U][A][G][G][A][G][C] =  1.800;
+ int22_ar[G][U][A][G][G][C][G][C] =  1.600;
+ int22_ar[G][U][A][G][G][G][G][C] =  0.500;
+ int22_ar[G][U][A][G][G][U][G][C] =  2.000;
+ int22_ar[G][U][A][G][U][A][G][C] =  0.000;
+ int22_ar[G][U][A][G][U][C][G][C] = -1.200;
+ int22_ar[G][U][A][G][U][G][G][C] = -0.500;
+ int22_ar[G][U][A][G][U][U][G][C] =  2.000;
+ int22_ar[G][U][A][U][A][A][G][C] =  2.000;
+ int22_ar[G][U][A][U][A][C][G][C] =  2.000;
+ int22_ar[G][U][A][U][A][G][G][C] =  2.000;
+ int22_ar[G][U][A][U][A][U][G][C] =  2.000;
+ int22_ar[G][U][A][U][C][A][G][C] =  2.500;
+ int22_ar[G][U][A][U][C][C][G][C] =  1.800;
+ int22_ar[G][U][A][U][C][G][G][C] =  1.700;
+ int22_ar[G][U][A][U][C][U][G][C] =  2.000;
+ int22_ar[G][U][A][U][G][A][G][C] =  0.400;
+ int22_ar[G][U][A][U][G][C][G][C] = -0.800;
+ int22_ar[G][U][A][U][G][G][G][C] = -0.100;
+ int22_ar[G][U][A][U][G][U][G][C] =  2.000;
+ int22_ar[G][U][A][U][U][A][G][C] =  2.100;
+ int22_ar[G][U][A][U][U][C][G][C] =  1.000;
+ int22_ar[G][U][A][U][U][G][G][C] =  1.700;
+ int22_ar[G][U][A][U][U][U][G][C] =  2.000;
+ int22_ar[G][U][C][A][A][A][G][C] =  1.900;
+ int22_ar[G][U][C][A][A][C][G][C] =  2.400;
+ int22_ar[G][U][C][A][A][G][G][C] =  2.000;
+ int22_ar[G][U][C][A][A][U][G][C] =  2.400;
+ int22_ar[G][U][C][A][C][A][G][C] =  1.600;
+ int22_ar[G][U][C][A][C][C][G][C] =  1.600;
+ int22_ar[G][U][C][A][C][G][G][C] =  2.000;
+ int22_ar[G][U][C][A][C][U][G][C] =  1.600;
+ int22_ar[G][U][C][A][G][A][G][C] = -0.100;
+ int22_ar[G][U][C][A][G][C][G][C] =  0.800;
+ int22_ar[G][U][C][A][G][G][G][C] =  2.000;
+ int22_ar[G][U][C][A][G][U][G][C] =  0.800;
+ int22_ar[G][U][C][A][U][A][G][C] =  2.000;
+ int22_ar[G][U][C][A][U][C][G][C] =  2.000;
+ int22_ar[G][U][C][A][U][G][G][C] =  2.000;
+ int22_ar[G][U][C][A][U][U][G][C] =  2.000;
+ int22_ar[G][U][C][C][A][A][G][C] =  1.600;
+ int22_ar[G][U][C][C][A][C][G][C] =  1.500;
+ int22_ar[G][U][C][C][A][G][G][C] =  2.000;
+ int22_ar[G][U][C][C][A][U][G][C] =  1.500;
+ int22_ar[G][U][C][C][C][A][G][C] =  1.600;
+ int22_ar[G][U][C][C][C][C][G][C] =  1.600;
+ int22_ar[G][U][C][C][C][G][G][C] =  2.000;
+ int22_ar[G][U][C][C][C][U][G][C] =  1.600;
+ int22_ar[G][U][C][C][G][A][G][C] =  2.000;
+ int22_ar[G][U][C][C][G][C][G][C] =  2.000;
+ int22_ar[G][U][C][C][G][G][G][C] =  2.000;
+ int22_ar[G][U][C][C][G][U][G][C] =  2.000;
+ int22_ar[G][U][C][C][U][A][G][C] =  0.600;
+ int22_ar[G][U][C][C][U][C][G][C] =  0.600;
+ int22_ar[G][U][C][C][U][G][G][C] =  2.000;
+ int22_ar[G][U][C][C][U][U][G][C] =  0.600;
+ int22_ar[G][U][C][G][A][A][G][C] =  0.500;
+ int22_ar[G][U][C][G][A][C][G][C] =  1.400;
+ int22_ar[G][U][C][G][A][G][G][C] =  2.000;
+ int22_ar[G][U][C][G][A][U][G][C] =  1.400;
+ int22_ar[G][U][C][G][C][A][G][C] =  2.000;
+ int22_ar[G][U][C][G][C][C][G][C] =  2.000;
+ int22_ar[G][U][C][G][C][G][G][C] =  2.000;
+ int22_ar[G][U][C][G][C][U][G][C] =  2.000;
+ int22_ar[G][U][C][G][G][A][G][C] =  1.500;
+ int22_ar[G][U][C][G][G][C][G][C] =  2.100;
+ int22_ar[G][U][C][G][G][G][G][C] =  2.000;
+ int22_ar[G][U][C][G][G][U][G][C] =  2.100;
+ int22_ar[G][U][C][G][U][A][G][C] = -1.300;
+ int22_ar[G][U][C][G][U][C][G][C] = -0.300;
+ int22_ar[G][U][C][G][U][G][G][C] =  2.000;
+ int22_ar[G][U][C][G][U][U][G][C] = -0.300;
+ int22_ar[G][U][C][U][A][A][G][C] =  2.000;
+ int22_ar[G][U][C][U][A][C][G][C] =  2.000;
+ int22_ar[G][U][C][U][A][G][G][C] =  2.000;
+ int22_ar[G][U][C][U][A][U][G][C] =  2.000;
+ int22_ar[G][U][C][U][C][A][G][C] =  1.700;
+ int22_ar[G][U][C][U][C][C][G][C] =  1.600;
+ int22_ar[G][U][C][U][C][G][G][C] =  2.000;
+ int22_ar[G][U][C][U][C][U][G][C] =  1.600;
+ int22_ar[G][U][C][U][G][A][G][C] = -0.900;
+ int22_ar[G][U][C][U][G][C][G][C] =  0.100;
+ int22_ar[G][U][C][U][G][G][G][C] =  2.000;
+ int22_ar[G][U][C][U][G][U][G][C] =  0.100;
+ int22_ar[G][U][C][U][U][A][G][C] =  0.900;
+ int22_ar[G][U][C][U][U][C][G][C] =  0.800;
+ int22_ar[G][U][C][U][U][G][G][C] =  2.000;
+ int22_ar[G][U][C][U][U][U][G][C] =  0.800;
+ int22_ar[G][U][G][A][A][A][G][C] =  0.900;
+ int22_ar[G][U][G][A][A][C][G][C] =  2.000;
+ int22_ar[G][U][G][A][A][G][G][C] =  1.400;
+ int22_ar[G][U][G][A][A][U][G][C] =  1.700;
+ int22_ar[G][U][G][A][C][A][G][C] =  0.600;
+ int22_ar[G][U][G][A][C][C][G][C] =  2.000;
+ int22_ar[G][U][G][A][C][G][G][C] =  1.200;
+ int22_ar[G][U][G][A][C][U][G][C] =  0.400;
+ int22_ar[G][U][G][A][G][A][G][C] = -1.100;
+ int22_ar[G][U][G][A][G][C][G][C] =  2.000;
+ int22_ar[G][U][G][A][G][G][G][C] = -0.600;
+ int22_ar[G][U][G][A][G][U][G][C] =  0.500;
+ int22_ar[G][U][G][A][U][A][G][C] =  2.000;
+ int22_ar[G][U][G][A][U][C][G][C] =  2.000;
+ int22_ar[G][U][G][A][U][G][G][C] =  2.000;
+ int22_ar[G][U][G][A][U][U][G][C] =  2.000;
+ int22_ar[G][U][G][C][A][A][G][C] =  0.600;
+ int22_ar[G][U][G][C][A][C][G][C] =  2.000;
+ int22_ar[G][U][G][C][A][G][G][C] =  1.100;
+ int22_ar[G][U][G][C][A][U][G][C] =  0.400;
+ int22_ar[G][U][G][C][C][A][G][C] =  1.600;
+ int22_ar[G][U][G][C][C][C][G][C] =  2.000;
+ int22_ar[G][U][G][C][C][G][G][C] =  1.800;
+ int22_ar[G][U][G][C][C][U][G][C] =  1.400;
+ int22_ar[G][U][G][C][G][A][G][C] =  2.000;
+ int22_ar[G][U][G][C][G][C][G][C] =  2.000;
+ int22_ar[G][U][G][C][G][G][G][C] =  2.000;
+ int22_ar[G][U][G][C][G][U][G][C] =  2.000;
+ int22_ar[G][U][G][C][U][A][G][C] =  0.700;
+ int22_ar[G][U][G][C][U][C][G][C] =  2.000;
+ int22_ar[G][U][G][C][U][G][G][C] =  0.800;
+ int22_ar[G][U][G][C][U][U][G][C] =  0.500;
+ int22_ar[G][U][G][G][A][A][G][C] = -0.500;
+ int22_ar[G][U][G][G][A][C][G][C] =  2.000;
+ int22_ar[G][U][G][G][A][G][G][C] =  0.000;
+ int22_ar[G][U][G][G][A][U][G][C] =  1.100;
+ int22_ar[G][U][G][G][C][A][G][C] =  2.000;
+ int22_ar[G][U][G][G][C][C][G][C] =  2.000;
+ int22_ar[G][U][G][G][C][G][G][C] =  2.000;
+ int22_ar[G][U][G][G][C][U][G][C] =  2.000;
+ int22_ar[G][U][G][G][G][A][G][C] =  0.500;
+ int22_ar[G][U][G][G][G][C][G][C] =  2.000;
+ int22_ar[G][U][G][G][G][G][G][C] =  1.100;
+ int22_ar[G][U][G][G][G][U][G][C] =  1.300;
+ int22_ar[G][U][G][G][U][A][G][C] = -0.500;
+ int22_ar[G][U][G][G][U][C][G][C] =  2.000;
+ int22_ar[G][U][G][G][U][G][G][C] = -0.700;
+ int22_ar[G][U][G][G][U][U][G][C] = -2.500;
+ int22_ar[G][U][G][U][A][A][G][C] =  2.000;
+ int22_ar[G][U][G][U][A][C][G][C] =  2.000;
+ int22_ar[G][U][G][U][A][G][G][C] =  2.000;
+ int22_ar[G][U][G][U][A][U][G][C] =  2.000;
+ int22_ar[G][U][G][U][C][A][G][C] =  1.700;
+ int22_ar[G][U][G][U][C][C][G][C] =  2.000;
+ int22_ar[G][U][G][U][C][G][G][C] =  1.800;
+ int22_ar[G][U][G][U][C][U][G][C] =  1.500;
+ int22_ar[G][U][G][U][G][A][G][C] = -0.100;
+ int22_ar[G][U][G][U][G][C][G][C] =  2.000;
+ int22_ar[G][U][G][U][G][G][G][C] = -0.300;
+ int22_ar[G][U][G][U][G][U][G][C] = -2.100;
+ int22_ar[G][U][G][U][U][A][G][C] =  1.700;
+ int22_ar[G][U][G][U][U][C][G][C] =  2.000;
+ int22_ar[G][U][G][U][U][G][G][C] =  1.400;
+ int22_ar[G][U][G][U][U][U][G][C] =  1.500;
+ int22_ar[G][U][U][A][A][A][G][C] =  2.000;
+ int22_ar[G][U][U][A][A][C][G][C] =  2.400;
+ int22_ar[G][U][U][A][A][G][G][C] =  0.700;
+ int22_ar[G][U][U][A][A][U][G][C] =  2.000;
+ int22_ar[G][U][U][A][C][A][G][C] =  2.000;
+ int22_ar[G][U][U][A][C][C][G][C] =  1.600;
+ int22_ar[G][U][U][A][C][G][G][C] = -0.500;
+ int22_ar[G][U][U][A][C][U][G][C] =  0.800;
+ int22_ar[G][U][U][A][G][A][G][C] =  2.000;
+ int22_ar[G][U][U][A][G][C][G][C] =  0.800;
+ int22_ar[G][U][U][A][G][G][G][C] = -0.500;
+ int22_ar[G][U][U][A][G][U][G][C] =  0.800;
+ int22_ar[G][U][U][A][U][A][G][C] =  2.000;
+ int22_ar[G][U][U][A][U][C][G][C] =  2.000;
+ int22_ar[G][U][U][A][U][G][G][C] =  2.000;
+ int22_ar[G][U][U][A][U][U][G][C] =  2.000;
+ int22_ar[G][U][U][C][A][A][G][C] =  2.000;
+ int22_ar[G][U][U][C][A][C][G][C] =  1.500;
+ int22_ar[G][U][U][C][A][G][G][C] = -0.600;
+ int22_ar[G][U][U][C][A][U][G][C] =  0.700;
+ int22_ar[G][U][U][C][C][A][G][C] =  2.000;
+ int22_ar[G][U][U][C][C][C][G][C] =  1.600;
+ int22_ar[G][U][U][C][C][G][G][C] =  0.500;
+ int22_ar[G][U][U][C][C][U][G][C] =  0.800;
+ int22_ar[G][U][U][C][G][A][G][C] =  2.000;
+ int22_ar[G][U][U][C][G][C][G][C] =  2.000;
+ int22_ar[G][U][U][C][G][G][G][C] =  2.000;
+ int22_ar[G][U][U][C][G][U][G][C] =  2.000;
+ int22_ar[G][U][U][C][U][A][G][C] =  2.000;
+ int22_ar[G][U][U][C][U][C][G][C] =  0.600;
+ int22_ar[G][U][U][C][U][G][G][C] = -0.500;
+ int22_ar[G][U][U][C][U][U][G][C] = -0.200;
+ int22_ar[G][U][U][G][A][A][G][C] =  2.000;
+ int22_ar[G][U][U][G][A][C][G][C] =  1.400;
+ int22_ar[G][U][U][G][A][G][G][C] =  0.100;
+ int22_ar[G][U][U][G][A][U][G][C] =  1.500;
+ int22_ar[G][U][U][G][C][A][G][C] =  2.000;
+ int22_ar[G][U][U][G][C][C][G][C] =  2.000;
+ int22_ar[G][U][U][G][C][G][G][C] =  2.000;
+ int22_ar[G][U][U][G][C][U][G][C] =  2.000;
+ int22_ar[G][U][U][G][G][A][G][C] =  2.000;
+ int22_ar[G][U][U][G][G][C][G][C] =  2.100;
+ int22_ar[G][U][U][G][G][G][G][C] =  0.400;
+ int22_ar[G][U][U][G][G][U][G][C] =  1.700;
+ int22_ar[G][U][U][G][U][A][G][C] =  2.000;
+ int22_ar[G][U][U][G][U][C][G][C] = -0.300;
+ int22_ar[G][U][U][G][U][G][G][C] = -3.500;
+ int22_ar[G][U][U][G][U][U][G][C] = -0.300;
+ int22_ar[G][U][U][U][A][A][G][C] =  2.000;
+ int22_ar[G][U][U][U][A][C][G][C] =  2.000;
+ int22_ar[G][U][U][U][A][G][G][C] =  2.000;
+ int22_ar[G][U][U][U][A][U][G][C] =  2.000;
+ int22_ar[G][U][U][U][C][A][G][C] =  2.000;
+ int22_ar[G][U][U][U][C][C][G][C] =  1.600;
+ int22_ar[G][U][U][U][C][G][G][C] =  0.500;
+ int22_ar[G][U][U][U][C][U][G][C] =  0.800;
+ int22_ar[G][U][U][U][G][A][G][C] =  2.000;
+ int22_ar[G][U][U][U][G][C][G][C] =  0.100;
+ int22_ar[G][U][U][U][G][G][G][C] = -3.100;
+ int22_ar[G][U][U][U][G][U][G][C] =  0.100;
+ int22_ar[G][U][U][U][U][A][G][C] =  2.000;
+ int22_ar[G][U][U][U][U][C][G][C] =  0.800;
+ int22_ar[G][U][U][U][U][G][G][C] =  0.500;
+ int22_ar[G][U][U][U][U][U][G][C] =  0.000;
+ int22_ar[G][U][A][A][A][A][G][U] =  2.800;
+ int22_ar[G][U][A][A][A][C][G][U] =  2.600;
+ int22_ar[G][U][A][A][A][G][G][U] =  1.500;
+ int22_ar[G][U][A][A][A][U][G][U] =  2.000;
+ int22_ar[G][U][A][A][C][A][G][U] =  2.500;
+ int22_ar[G][U][A][A][C][C][G][U] =  2.400;
+ int22_ar[G][U][A][A][C][G][G][U] =  1.300;
+ int22_ar[G][U][A][A][C][U][G][U] =  2.000;
+ int22_ar[G][U][A][A][G][A][G][U] =  1.500;
+ int22_ar[G][U][A][A][G][C][G][U] =  1.400;
+ int22_ar[G][U][A][A][G][G][G][U] =  0.300;
+ int22_ar[G][U][A][A][G][U][G][U] =  2.000;
+ int22_ar[G][U][A][A][U][A][G][U] =  2.000;
+ int22_ar[G][U][A][A][U][C][G][U] =  2.000;
+ int22_ar[G][U][A][A][U][G][G][U] =  2.000;
+ int22_ar[G][U][A][A][U][U][G][U] =  2.000;
+ int22_ar[G][U][A][C][A][A][G][U] =  2.600;
+ int22_ar[G][U][A][C][A][C][G][U] =  2.500;
+ int22_ar[G][U][A][C][A][G][G][U] =  1.400;
+ int22_ar[G][U][A][C][A][U][G][U] =  2.000;
+ int22_ar[G][U][A][C][C][A][G][U] =  3.100;
+ int22_ar[G][U][A][C][C][C][G][U] =  2.300;
+ int22_ar[G][U][A][C][C][G][G][U] =  2.200;
+ int22_ar[G][U][A][C][C][U][G][U] =  2.000;
+ int22_ar[G][U][A][C][G][A][G][U] =  2.000;
+ int22_ar[G][U][A][C][G][C][G][U] =  2.000;
+ int22_ar[G][U][A][C][G][G][G][U] =  2.000;
+ int22_ar[G][U][A][C][G][U][G][U] =  2.000;
+ int22_ar[G][U][A][C][U][A][G][U] =  3.100;
+ int22_ar[G][U][A][C][U][C][G][U] =  2.300;
+ int22_ar[G][U][A][C][U][G][G][U] =  2.200;
+ int22_ar[G][U][A][C][U][U][G][U] =  2.000;
+ int22_ar[G][U][A][G][A][A][G][U] =  1.500;
+ int22_ar[G][U][A][G][A][C][G][U] =  1.400;
+ int22_ar[G][U][A][G][A][G][G][U] =  0.300;
+ int22_ar[G][U][A][G][A][U][G][U] =  2.000;
+ int22_ar[G][U][A][G][C][A][G][U] =  2.000;
+ int22_ar[G][U][A][G][C][C][G][U] =  2.000;
+ int22_ar[G][U][A][G][C][G][G][U] =  2.000;
+ int22_ar[G][U][A][G][C][U][G][U] =  2.000;
+ int22_ar[G][U][A][G][G][A][G][U] =  2.100;
+ int22_ar[G][U][A][G][G][C][G][U] =  1.900;
+ int22_ar[G][U][A][G][G][G][G][U] =  0.800;
+ int22_ar[G][U][A][G][G][U][G][U] =  2.000;
+ int22_ar[G][U][A][G][U][A][G][U] =  1.300;
+ int22_ar[G][U][A][G][U][C][G][U] =  0.200;
+ int22_ar[G][U][A][G][U][G][G][U] =  0.900;
+ int22_ar[G][U][A][G][U][U][G][U] =  2.000;
+ int22_ar[G][U][A][U][A][A][G][U] =  2.000;
+ int22_ar[G][U][A][U][A][C][G][U] =  2.000;
+ int22_ar[G][U][A][U][A][G][G][U] =  2.000;
+ int22_ar[G][U][A][U][A][U][G][U] =  2.000;
+ int22_ar[G][U][A][U][C][A][G][U] =  3.100;
+ int22_ar[G][U][A][U][C][C][G][U] =  2.300;
+ int22_ar[G][U][A][U][C][G][G][U] =  2.200;
+ int22_ar[G][U][A][U][C][U][G][U] =  2.000;
+ int22_ar[G][U][A][U][G][A][G][U] =  2.300;
+ int22_ar[G][U][A][U][G][C][G][U] =  1.200;
+ int22_ar[G][U][A][U][G][G][G][U] =  1.900;
+ int22_ar[G][U][A][U][G][U][G][U] =  2.000;
+ int22_ar[G][U][A][U][U][A][G][U] =  2.700;
+ int22_ar[G][U][A][U][U][C][G][U] =  1.500;
+ int22_ar[G][U][A][U][U][G][G][U] =  2.200;
+ int22_ar[G][U][A][U][U][U][G][U] =  2.000;
+ int22_ar[G][U][C][A][A][A][G][U] =  2.500;
+ int22_ar[G][U][C][A][A][C][G][U] =  3.100;
+ int22_ar[G][U][C][A][A][G][G][U] =  2.000;
+ int22_ar[G][U][C][A][A][U][G][U] =  3.100;
+ int22_ar[G][U][C][A][C][A][G][U] =  2.300;
+ int22_ar[G][U][C][A][C][C][G][U] =  2.200;
+ int22_ar[G][U][C][A][C][G][G][U] =  2.000;
+ int22_ar[G][U][C][A][C][U][G][U] =  2.200;
+ int22_ar[G][U][C][A][G][A][G][U] =  1.300;
+ int22_ar[G][U][C][A][G][C][G][U] =  2.200;
+ int22_ar[G][U][C][A][G][G][G][U] =  2.000;
+ int22_ar[G][U][C][A][G][U][G][U] =  2.200;
+ int22_ar[G][U][C][A][U][A][G][U] =  2.000;
+ int22_ar[G][U][C][A][U][C][G][U] =  2.000;
+ int22_ar[G][U][C][A][U][G][G][U] =  2.000;
+ int22_ar[G][U][C][A][U][U][G][U] =  2.000;
+ int22_ar[G][U][C][C][A][A][G][U] =  2.400;
+ int22_ar[G][U][C][C][A][C][G][U] =  2.300;
+ int22_ar[G][U][C][C][A][G][G][U] =  2.000;
+ int22_ar[G][U][C][C][A][U][G][U] =  2.300;
+ int22_ar[G][U][C][C][C][A][G][U] =  2.200;
+ int22_ar[G][U][C][C][C][C][G][U] =  2.200;
+ int22_ar[G][U][C][C][C][G][G][U] =  2.000;
+ int22_ar[G][U][C][C][C][U][G][U] =  2.200;
+ int22_ar[G][U][C][C][G][A][G][U] =  2.000;
+ int22_ar[G][U][C][C][G][C][G][U] =  2.000;
+ int22_ar[G][U][C][C][G][G][G][U] =  2.000;
+ int22_ar[G][U][C][C][G][U][G][U] =  2.000;
+ int22_ar[G][U][C][C][U][A][G][U] =  2.200;
+ int22_ar[G][U][C][C][U][C][G][U] =  2.200;
+ int22_ar[G][U][C][C][U][G][G][U] =  2.000;
+ int22_ar[G][U][C][C][U][U][G][U] =  2.200;
+ int22_ar[G][U][C][G][A][A][G][U] =  1.300;
+ int22_ar[G][U][C][G][A][C][G][U] =  2.200;
+ int22_ar[G][U][C][G][A][G][G][U] =  2.000;
+ int22_ar[G][U][C][G][A][U][G][U] =  2.200;
+ int22_ar[G][U][C][G][C][A][G][U] =  2.000;
+ int22_ar[G][U][C][G][C][C][G][U] =  2.000;
+ int22_ar[G][U][C][G][C][G][G][U] =  2.000;
+ int22_ar[G][U][C][G][C][U][G][U] =  2.000;
+ int22_ar[G][U][C][G][G][A][G][U] =  1.800;
+ int22_ar[G][U][C][G][G][C][G][U] =  2.400;
+ int22_ar[G][U][C][G][G][G][G][U] =  2.000;
+ int22_ar[G][U][C][G][G][U][G][U] =  2.400;
+ int22_ar[G][U][C][G][U][A][G][U] =  0.100;
+ int22_ar[G][U][C][G][U][C][G][U] =  1.000;
+ int22_ar[G][U][C][G][U][G][G][U] =  2.000;
+ int22_ar[G][U][C][G][U][U][G][U] =  1.000;
+ int22_ar[G][U][C][U][A][A][G][U] =  2.000;
+ int22_ar[G][U][C][U][A][C][G][U] =  2.000;
+ int22_ar[G][U][C][U][A][G][G][U] =  2.000;
+ int22_ar[G][U][C][U][A][U][G][U] =  2.000;
+ int22_ar[G][U][C][U][C][A][G][U] =  2.200;
+ int22_ar[G][U][C][U][C][C][G][U] =  2.200;
+ int22_ar[G][U][C][U][C][G][G][U] =  2.000;
+ int22_ar[G][U][C][U][C][U][G][U] =  2.200;
+ int22_ar[G][U][C][U][G][A][G][U] =  1.100;
+ int22_ar[G][U][C][U][G][C][G][U] =  2.000;
+ int22_ar[G][U][C][U][G][G][G][U] =  2.000;
+ int22_ar[G][U][C][U][G][U][G][U] =  2.000;
+ int22_ar[G][U][C][U][U][A][G][U] =  1.400;
+ int22_ar[G][U][C][U][U][C][G][U] =  1.400;
+ int22_ar[G][U][C][U][U][G][G][U] =  2.000;
+ int22_ar[G][U][C][U][U][U][G][U] =  1.400;
+ int22_ar[G][U][G][A][A][A][G][U] =  1.500;
+ int22_ar[G][U][G][A][A][C][G][U] =  2.000;
+ int22_ar[G][U][G][A][A][G][G][U] =  2.100;
+ int22_ar[G][U][G][A][A][U][G][U] =  2.300;
+ int22_ar[G][U][G][A][C][A][G][U] =  1.300;
+ int22_ar[G][U][G][A][C][C][G][U] =  2.000;
+ int22_ar[G][U][G][A][C][G][G][U] =  1.800;
+ int22_ar[G][U][G][A][C][U][G][U] =  1.100;
+ int22_ar[G][U][G][A][G][A][G][U] =  0.300;
+ int22_ar[G][U][G][A][G][C][G][U] =  2.000;
+ int22_ar[G][U][G][A][G][G][G][U] =  0.800;
+ int22_ar[G][U][G][A][G][U][G][U] =  1.900;
+ int22_ar[G][U][G][A][U][A][G][U] =  2.000;
+ int22_ar[G][U][G][A][U][C][G][U] =  2.000;
+ int22_ar[G][U][G][A][U][G][G][U] =  2.000;
+ int22_ar[G][U][G][A][U][U][G][U] =  2.000;
+ int22_ar[G][U][G][C][A][A][G][U] =  1.400;
+ int22_ar[G][U][G][C][A][C][G][U] =  2.000;
+ int22_ar[G][U][G][C][A][G][G][U] =  1.900;
+ int22_ar[G][U][G][C][A][U][G][U] =  1.200;
+ int22_ar[G][U][G][C][C][A][G][U] =  2.200;
+ int22_ar[G][U][G][C][C][C][G][U] =  2.000;
+ int22_ar[G][U][G][C][C][G][G][U] =  2.400;
+ int22_ar[G][U][G][C][C][U][G][U] =  2.000;
+ int22_ar[G][U][G][C][G][A][G][U] =  2.000;
+ int22_ar[G][U][G][C][G][C][G][U] =  2.000;
+ int22_ar[G][U][G][C][G][G][G][U] =  2.000;
+ int22_ar[G][U][G][C][G][U][G][U] =  2.000;
+ int22_ar[G][U][G][C][U][A][G][U] =  2.200;
+ int22_ar[G][U][G][C][U][C][G][U] =  2.000;
+ int22_ar[G][U][G][C][U][G][G][U] =  2.400;
+ int22_ar[G][U][G][C][U][U][G][U] =  2.000;
+ int22_ar[G][U][G][G][A][A][G][U] =  0.300;
+ int22_ar[G][U][G][G][A][C][G][U] =  2.000;
+ int22_ar[G][U][G][G][A][G][G][U] =  0.800;
+ int22_ar[G][U][G][G][A][U][G][U] =  1.900;
+ int22_ar[G][U][G][G][C][A][G][U] =  2.000;
+ int22_ar[G][U][G][G][C][C][G][U] =  2.000;
+ int22_ar[G][U][G][G][C][G][G][U] =  2.000;
+ int22_ar[G][U][G][G][C][U][G][U] =  2.000;
+ int22_ar[G][U][G][G][G][A][G][U] =  0.800;
+ int22_ar[G][U][G][G][G][C][G][U] =  2.000;
+ int22_ar[G][U][G][G][G][G][G][U] =  1.400;
+ int22_ar[G][U][G][G][G][U][G][U] =  1.600;
+ int22_ar[G][U][G][G][U][A][G][U] =  0.900;
+ int22_ar[G][U][G][G][U][C][G][U] =  2.000;
+ int22_ar[G][U][G][G][U][G][G][U] =  0.700;
+ int22_ar[G][U][G][G][U][U][G][U] = -1.100;
+ int22_ar[G][U][G][U][A][A][G][U] =  2.000;
+ int22_ar[G][U][G][U][A][C][G][U] =  2.000;
+ int22_ar[G][U][G][U][A][G][G][U] =  2.000;
+ int22_ar[G][U][G][U][A][U][G][U] =  2.000;
+ int22_ar[G][U][G][U][C][A][G][U] =  2.200;
+ int22_ar[G][U][G][U][C][C][G][U] =  2.000;
+ int22_ar[G][U][G][U][C][G][G][U] =  2.400;
+ int22_ar[G][U][G][U][C][U][G][U] =  2.000;
+ int22_ar[G][U][G][U][G][A][G][U] =  1.900;
+ int22_ar[G][U][G][U][G][C][G][U] =  2.000;
+ int22_ar[G][U][G][U][G][G][G][U] =  1.600;
+ int22_ar[G][U][G][U][G][U][G][U] = -0.100;
+ int22_ar[G][U][G][U][U][A][G][U] =  2.200;
+ int22_ar[G][U][G][U][U][C][G][U] =  2.000;
+ int22_ar[G][U][G][U][U][G][G][U] =  2.000;
+ int22_ar[G][U][G][U][U][U][G][U] =  2.000;
+ int22_ar[G][U][U][A][A][A][G][U] =  2.000;
+ int22_ar[G][U][U][A][A][C][G][U] =  3.100;
+ int22_ar[G][U][U][A][A][G][G][U] =  1.300;
+ int22_ar[G][U][U][A][A][U][G][U] =  2.700;
+ int22_ar[G][U][U][A][C][A][G][U] =  2.000;
+ int22_ar[G][U][U][A][C][C][G][U] =  2.200;
+ int22_ar[G][U][U][A][C][G][G][U] =  0.100;
+ int22_ar[G][U][U][A][C][U][G][U] =  1.400;
+ int22_ar[G][U][U][A][G][A][G][U] =  2.000;
+ int22_ar[G][U][U][A][G][C][G][U] =  2.200;
+ int22_ar[G][U][U][A][G][G][G][U] =  0.900;
+ int22_ar[G][U][U][A][G][U][G][U] =  2.200;
+ int22_ar[G][U][U][A][U][A][G][U] =  2.000;
+ int22_ar[G][U][U][A][U][C][G][U] =  2.000;
+ int22_ar[G][U][U][A][U][G][G][U] =  2.000;
+ int22_ar[G][U][U][A][U][U][G][U] =  2.000;
+ int22_ar[G][U][U][C][A][A][G][U] =  2.000;
+ int22_ar[G][U][U][C][A][C][G][U] =  2.300;
+ int22_ar[G][U][U][C][A][G][G][U] =  0.200;
+ int22_ar[G][U][U][C][A][U][G][U] =  1.500;
+ int22_ar[G][U][U][C][C][A][G][U] =  2.000;
+ int22_ar[G][U][U][C][C][C][G][U] =  2.200;
+ int22_ar[G][U][U][C][C][G][G][U] =  1.000;
+ int22_ar[G][U][U][C][C][U][G][U] =  1.400;
+ int22_ar[G][U][U][C][G][A][G][U] =  2.000;
+ int22_ar[G][U][U][C][G][C][G][U] =  2.000;
+ int22_ar[G][U][U][C][G][G][G][U] =  2.000;
+ int22_ar[G][U][U][C][G][U][G][U] =  2.000;
+ int22_ar[G][U][U][C][U][A][G][U] =  2.000;
+ int22_ar[G][U][U][C][U][C][G][U] =  2.200;
+ int22_ar[G][U][U][C][U][G][G][U] =  1.000;
+ int22_ar[G][U][U][C][U][U][G][U] =  1.400;
+ int22_ar[G][U][U][G][A][A][G][U] =  2.000;
+ int22_ar[G][U][U][G][A][C][G][U] =  2.200;
+ int22_ar[G][U][U][G][A][G][G][U] =  0.900;
+ int22_ar[G][U][U][G][A][U][G][U] =  2.200;
+ int22_ar[G][U][U][G][C][A][G][U] =  2.000;
+ int22_ar[G][U][U][G][C][C][G][U] =  2.000;
+ int22_ar[G][U][U][G][C][G][G][U] =  2.000;
+ int22_ar[G][U][U][G][C][U][G][U] =  2.000;
+ int22_ar[G][U][U][G][G][A][G][U] =  2.000;
+ int22_ar[G][U][U][G][G][C][G][U] =  2.400;
+ int22_ar[G][U][U][G][G][G][G][U] =  0.700;
+ int22_ar[G][U][U][G][G][U][G][U] =  2.000;
+ int22_ar[G][U][U][G][U][A][G][U] =  2.000;
+ int22_ar[G][U][U][G][U][C][G][U] =  1.000;
+ int22_ar[G][U][U][G][U][G][G][U] = -2.100;
+ int22_ar[G][U][U][G][U][U][G][U] =  1.100;
+ int22_ar[G][U][U][U][A][A][G][U] =  2.000;
+ int22_ar[G][U][U][U][A][C][G][U] =  2.000;
+ int22_ar[G][U][U][U][A][G][G][U] =  2.000;
+ int22_ar[G][U][U][U][A][U][G][U] =  2.000;
+ int22_ar[G][U][U][U][C][A][G][U] =  2.000;
+ int22_ar[G][U][U][U][C][C][G][U] =  2.200;
+ int22_ar[G][U][U][U][C][G][G][U] =  1.000;
+ int22_ar[G][U][U][U][C][U][G][U] =  1.400;
+ int22_ar[G][U][U][U][G][A][G][U] =  2.000;
+ int22_ar[G][U][U][U][G][C][G][U] =  2.000;
+ int22_ar[G][U][U][U][G][G][G][U] = -1.100;
+ int22_ar[G][U][U][U][G][U][G][U] =  2.000;
+ int22_ar[G][U][U][U][U][A][G][U] =  2.000;
+ int22_ar[G][U][U][U][U][C][G][U] =  1.400;
+ int22_ar[G][U][U][U][U][G][G][U] =  1.100;
+ int22_ar[G][U][U][U][U][U][G][U] =  0.600;
+ int22_ar[G][U][A][A][A][A][U][A] =  2.800;
+ int22_ar[G][U][A][A][A][C][U][A] =  2.600;
+ int22_ar[G][U][A][A][A][G][U][A] =  1.500;
+ int22_ar[G][U][A][A][A][U][U][A] =  2.000;
+ int22_ar[G][U][A][A][C][A][U][A] =  2.300;
+ int22_ar[G][U][A][A][C][C][U][A] =  2.200;
+ int22_ar[G][U][A][A][C][G][U][A] =  1.100;
+ int22_ar[G][U][A][A][C][U][U][A] =  2.000;
+ int22_ar[G][U][A][A][G][A][U][A] =  1.700;
+ int22_ar[G][U][A][A][G][C][U][A] =  1.600;
+ int22_ar[G][U][A][A][G][G][U][A] =  0.500;
+ int22_ar[G][U][A][A][G][U][U][A] =  2.000;
+ int22_ar[G][U][A][A][U][A][U][A] =  2.000;
+ int22_ar[G][U][A][A][U][C][U][A] =  2.000;
+ int22_ar[G][U][A][A][U][G][U][A] =  2.000;
+ int22_ar[G][U][A][A][U][U][U][A] =  2.000;
+ int22_ar[G][U][A][C][A][A][U][A] =  2.800;
+ int22_ar[G][U][A][C][A][C][U][A] =  2.600;
+ int22_ar[G][U][A][C][A][G][U][A] =  1.500;
+ int22_ar[G][U][A][C][A][U][U][A] =  2.000;
+ int22_ar[G][U][A][C][C][A][U][A] =  3.400;
+ int22_ar[G][U][A][C][C][C][U][A] =  2.600;
+ int22_ar[G][U][A][C][C][G][U][A] =  2.500;
+ int22_ar[G][U][A][C][C][U][U][A] =  2.000;
+ int22_ar[G][U][A][C][G][A][U][A] =  2.000;
+ int22_ar[G][U][A][C][G][C][U][A] =  2.000;
+ int22_ar[G][U][A][C][G][G][U][A] =  2.000;
+ int22_ar[G][U][A][C][G][U][U][A] =  2.000;
+ int22_ar[G][U][A][C][U][A][U][A] =  3.400;
+ int22_ar[G][U][A][C][U][C][U][A] =  2.600;
+ int22_ar[G][U][A][C][U][G][U][A] =  2.500;
+ int22_ar[G][U][A][C][U][U][U][A] =  2.000;
+ int22_ar[G][U][A][G][A][A][U][A] =  1.700;
+ int22_ar[G][U][A][G][A][C][U][A] =  1.600;
+ int22_ar[G][U][A][G][A][G][U][A] =  0.500;
+ int22_ar[G][U][A][G][A][U][U][A] =  2.000;
+ int22_ar[G][U][A][G][C][A][U][A] =  2.000;
+ int22_ar[G][U][A][G][C][C][U][A] =  2.000;
+ int22_ar[G][U][A][G][C][G][U][A] =  2.000;
+ int22_ar[G][U][A][G][C][U][U][A] =  2.000;
+ int22_ar[G][U][A][G][G][A][U][A] =  2.100;
+ int22_ar[G][U][A][G][G][C][U][A] =  2.000;
+ int22_ar[G][U][A][G][G][G][U][A] =  0.900;
+ int22_ar[G][U][A][G][G][U][U][A] =  2.000;
+ int22_ar[G][U][A][G][U][A][U][A] =  1.000;
+ int22_ar[G][U][A][G][U][C][U][A] = -0.200;
+ int22_ar[G][U][A][G][U][G][U][A] =  0.500;
+ int22_ar[G][U][A][G][U][U][U][A] =  2.000;
+ int22_ar[G][U][A][U][A][A][U][A] =  2.000;
+ int22_ar[G][U][A][U][A][C][U][A] =  2.000;
+ int22_ar[G][U][A][U][A][G][U][A] =  2.000;
+ int22_ar[G][U][A][U][A][U][U][A] =  2.000;
+ int22_ar[G][U][A][U][C][A][U][A] =  3.100;
+ int22_ar[G][U][A][U][C][C][U][A] =  2.300;
+ int22_ar[G][U][A][U][C][G][U][A] =  2.200;
+ int22_ar[G][U][A][U][C][U][U][A] =  2.000;
+ int22_ar[G][U][A][U][G][A][U][A] =  2.200;
+ int22_ar[G][U][A][U][G][C][U][A] =  1.100;
+ int22_ar[G][U][A][U][G][G][U][A] =  1.800;
+ int22_ar[G][U][A][U][G][U][U][A] =  2.000;
+ int22_ar[G][U][A][U][U][A][U][A] =  2.900;
+ int22_ar[G][U][A][U][U][C][U][A] =  1.800;
+ int22_ar[G][U][A][U][U][G][U][A] =  2.500;
+ int22_ar[G][U][A][U][U][U][U][A] =  2.000;
+ int22_ar[G][U][C][A][A][A][U][A] =  2.500;
+ int22_ar[G][U][C][A][A][C][U][A] =  3.100;
+ int22_ar[G][U][C][A][A][G][U][A] =  2.000;
+ int22_ar[G][U][C][A][A][U][U][A] =  3.100;
+ int22_ar[G][U][C][A][C][A][U][A] =  2.100;
+ int22_ar[G][U][C][A][C][C][U][A] =  2.000;
+ int22_ar[G][U][C][A][C][G][U][A] =  2.000;
+ int22_ar[G][U][C][A][C][U][U][A] =  2.000;
+ int22_ar[G][U][C][A][G][A][U][A] =  1.500;
+ int22_ar[G][U][C][A][G][C][U][A] =  2.400;
+ int22_ar[G][U][C][A][G][G][U][A] =  2.000;
+ int22_ar[G][U][C][A][G][U][U][A] =  2.400;
+ int22_ar[G][U][C][A][U][A][U][A] =  2.000;
+ int22_ar[G][U][C][A][U][C][U][A] =  2.000;
+ int22_ar[G][U][C][A][U][G][U][A] =  2.000;
+ int22_ar[G][U][C][A][U][U][U][A] =  2.000;
+ int22_ar[G][U][C][C][A][A][U][A] =  2.500;
+ int22_ar[G][U][C][C][A][C][U][A] =  2.500;
+ int22_ar[G][U][C][C][A][G][U][A] =  2.000;
+ int22_ar[G][U][C][C][A][U][U][A] =  2.500;
+ int22_ar[G][U][C][C][C][A][U][A] =  2.500;
+ int22_ar[G][U][C][C][C][C][U][A] =  2.500;
+ int22_ar[G][U][C][C][C][G][U][A] =  2.000;
+ int22_ar[G][U][C][C][C][U][U][A] =  2.500;
+ int22_ar[G][U][C][C][G][A][U][A] =  2.000;
+ int22_ar[G][U][C][C][G][C][U][A] =  2.000;
+ int22_ar[G][U][C][C][G][G][U][A] =  2.000;
+ int22_ar[G][U][C][C][G][U][U][A] =  2.000;
+ int22_ar[G][U][C][C][U][A][U][A] =  2.500;
+ int22_ar[G][U][C][C][U][C][U][A] =  2.500;
+ int22_ar[G][U][C][C][U][G][U][A] =  2.000;
+ int22_ar[G][U][C][C][U][U][U][A] =  2.500;
+ int22_ar[G][U][C][G][A][A][U][A] =  1.500;
+ int22_ar[G][U][C][G][A][C][U][A] =  2.400;
+ int22_ar[G][U][C][G][A][G][U][A] =  2.000;
+ int22_ar[G][U][C][G][A][U][U][A] =  2.400;
+ int22_ar[G][U][C][G][C][A][U][A] =  2.000;
+ int22_ar[G][U][C][G][C][C][U][A] =  2.000;
+ int22_ar[G][U][C][G][C][G][U][A] =  2.000;
+ int22_ar[G][U][C][G][C][U][U][A] =  2.000;
+ int22_ar[G][U][C][G][G][A][U][A] =  1.900;
+ int22_ar[G][U][C][G][G][C][U][A] =  2.400;
+ int22_ar[G][U][C][G][G][G][U][A] =  2.000;
+ int22_ar[G][U][C][G][G][U][U][A] =  2.400;
+ int22_ar[G][U][C][G][U][A][U][A] = -0.300;
+ int22_ar[G][U][C][G][U][C][U][A] =  0.700;
+ int22_ar[G][U][C][G][U][G][U][A] =  2.000;
+ int22_ar[G][U][C][G][U][U][U][A] =  0.700;
+ int22_ar[G][U][C][U][A][A][U][A] =  2.000;
+ int22_ar[G][U][C][U][A][C][U][A] =  2.000;
+ int22_ar[G][U][C][U][A][G][U][A] =  2.000;
+ int22_ar[G][U][C][U][A][U][U][A] =  2.000;
+ int22_ar[G][U][C][U][C][A][U][A] =  2.200;
+ int22_ar[G][U][C][U][C][C][U][A] =  2.200;
+ int22_ar[G][U][C][U][C][G][U][A] =  2.000;
+ int22_ar[G][U][C][U][C][U][U][A] =  2.200;
+ int22_ar[G][U][C][U][G][A][U][A] =  1.000;
+ int22_ar[G][U][C][U][G][C][U][A] =  1.900;
+ int22_ar[G][U][C][U][G][G][U][A] =  2.000;
+ int22_ar[G][U][C][U][G][U][U][A] =  1.900;
+ int22_ar[G][U][C][U][U][A][U][A] =  1.700;
+ int22_ar[G][U][C][U][U][C][U][A] =  1.600;
+ int22_ar[G][U][C][U][U][G][U][A] =  2.000;
+ int22_ar[G][U][C][U][U][U][U][A] =  1.600;
+ int22_ar[G][U][G][A][A][A][U][A] =  1.500;
+ int22_ar[G][U][G][A][A][C][U][A] =  2.000;
+ int22_ar[G][U][G][A][A][G][U][A] =  2.100;
+ int22_ar[G][U][G][A][A][U][U][A] =  2.300;
+ int22_ar[G][U][G][A][C][A][U][A] =  1.100;
+ int22_ar[G][U][G][A][C][C][U][A] =  2.000;
+ int22_ar[G][U][G][A][C][G][U][A] =  1.600;
+ int22_ar[G][U][G][A][C][U][U][A] =  0.900;
+ int22_ar[G][U][G][A][G][A][U][A] =  0.500;
+ int22_ar[G][U][G][A][G][C][U][A] =  2.000;
+ int22_ar[G][U][G][A][G][G][U][A] =  1.000;
+ int22_ar[G][U][G][A][G][U][U][A] =  2.100;
+ int22_ar[G][U][G][A][U][A][U][A] =  2.000;
+ int22_ar[G][U][G][A][U][C][U][A] =  2.000;
+ int22_ar[G][U][G][A][U][G][U][A] =  2.000;
+ int22_ar[G][U][G][A][U][U][U][A] =  2.000;
+ int22_ar[G][U][G][C][A][A][U][A] =  1.500;
+ int22_ar[G][U][G][C][A][C][U][A] =  2.000;
+ int22_ar[G][U][G][C][A][G][U][A] =  2.100;
+ int22_ar[G][U][G][C][A][U][U][A] =  1.300;
+ int22_ar[G][U][G][C][C][A][U][A] =  2.500;
+ int22_ar[G][U][G][C][C][C][U][A] =  2.000;
+ int22_ar[G][U][G][C][C][G][U][A] =  2.700;
+ int22_ar[G][U][G][C][C][U][U][A] =  2.300;
+ int22_ar[G][U][G][C][G][A][U][A] =  2.000;
+ int22_ar[G][U][G][C][G][C][U][A] =  2.000;
+ int22_ar[G][U][G][C][G][G][U][A] =  2.000;
+ int22_ar[G][U][G][C][G][U][U][A] =  2.000;
+ int22_ar[G][U][G][C][U][A][U][A] =  2.500;
+ int22_ar[G][U][G][C][U][C][U][A] =  2.000;
+ int22_ar[G][U][G][C][U][G][U][A] =  2.700;
+ int22_ar[G][U][G][C][U][U][U][A] =  2.300;
+ int22_ar[G][U][G][G][A][A][U][A] =  0.500;
+ int22_ar[G][U][G][G][A][C][U][A] =  2.000;
+ int22_ar[G][U][G][G][A][G][U][A] =  1.000;
+ int22_ar[G][U][G][G][A][U][U][A] =  2.100;
+ int22_ar[G][U][G][G][C][A][U][A] =  2.000;
+ int22_ar[G][U][G][G][C][C][U][A] =  2.000;
+ int22_ar[G][U][G][G][C][G][U][A] =  2.000;
+ int22_ar[G][U][G][G][C][U][U][A] =  2.000;
+ int22_ar[G][U][G][G][G][A][U][A] =  0.900;
+ int22_ar[G][U][G][G][G][C][U][A] =  2.000;
+ int22_ar[G][U][G][G][G][G][U][A] =  1.400;
+ int22_ar[G][U][G][G][G][U][U][A] =  1.700;
+ int22_ar[G][U][G][G][U][A][U][A] =  0.500;
+ int22_ar[G][U][G][G][U][C][U][A] =  2.000;
+ int22_ar[G][U][G][G][U][G][U][A] =  0.300;
+ int22_ar[G][U][G][G][U][U][U][A] = -1.500;
+ int22_ar[G][U][G][U][A][A][U][A] =  2.000;
+ int22_ar[G][U][G][U][A][C][U][A] =  2.000;
+ int22_ar[G][U][G][U][A][G][U][A] =  2.000;
+ int22_ar[G][U][G][U][A][U][U][A] =  2.000;
+ int22_ar[G][U][G][U][C][A][U][A] =  2.200;
+ int22_ar[G][U][G][U][C][C][U][A] =  2.000;
+ int22_ar[G][U][G][U][C][G][U][A] =  2.400;
+ int22_ar[G][U][G][U][C][U][U][A] =  2.000;
+ int22_ar[G][U][G][U][G][A][U][A] =  1.800;
+ int22_ar[G][U][G][U][G][C][U][A] =  2.000;
+ int22_ar[G][U][G][U][G][G][U][A] =  1.500;
+ int22_ar[G][U][G][U][G][U][U][A] = -0.200;
+ int22_ar[G][U][G][U][U][A][U][A] =  2.500;
+ int22_ar[G][U][G][U][U][C][U][A] =  2.000;
+ int22_ar[G][U][G][U][U][G][U][A] =  2.200;
+ int22_ar[G][U][G][U][U][U][U][A] =  2.300;
+ int22_ar[G][U][U][A][A][A][U][A] =  2.000;
+ int22_ar[G][U][U][A][A][C][U][A] =  3.100;
+ int22_ar[G][U][U][A][A][G][U][A] =  1.300;
+ int22_ar[G][U][U][A][A][U][U][A] =  2.700;
+ int22_ar[G][U][U][A][C][A][U][A] =  2.000;
+ int22_ar[G][U][U][A][C][C][U][A] =  2.000;
+ int22_ar[G][U][U][A][C][G][U][A] = -0.100;
+ int22_ar[G][U][U][A][C][U][U][A] =  1.200;
+ int22_ar[G][U][U][A][G][A][U][A] =  2.000;
+ int22_ar[G][U][U][A][G][C][U][A] =  2.400;
+ int22_ar[G][U][U][A][G][G][U][A] =  1.100;
+ int22_ar[G][U][U][A][G][U][U][A] =  2.400;
+ int22_ar[G][U][U][A][U][A][U][A] =  2.000;
+ int22_ar[G][U][U][A][U][C][U][A] =  2.000;
+ int22_ar[G][U][U][A][U][G][U][A] =  2.000;
+ int22_ar[G][U][U][A][U][U][U][A] =  2.000;
+ int22_ar[G][U][U][C][A][A][U][A] =  2.000;
+ int22_ar[G][U][U][C][A][C][U][A] =  2.500;
+ int22_ar[G][U][U][C][A][G][U][A] =  0.300;
+ int22_ar[G][U][U][C][A][U][U][A] =  1.700;
+ int22_ar[G][U][U][C][C][A][U][A] =  2.000;
+ int22_ar[G][U][U][C][C][C][U][A] =  2.500;
+ int22_ar[G][U][U][C][C][G][U][A] =  1.300;
+ int22_ar[G][U][U][C][C][U][U][A] =  1.700;
+ int22_ar[G][U][U][C][G][A][U][A] =  2.000;
+ int22_ar[G][U][U][C][G][C][U][A] =  2.000;
+ int22_ar[G][U][U][C][G][G][U][A] =  2.000;
+ int22_ar[G][U][U][C][G][U][U][A] =  2.000;
+ int22_ar[G][U][U][C][U][A][U][A] =  2.000;
+ int22_ar[G][U][U][C][U][C][U][A] =  2.500;
+ int22_ar[G][U][U][C][U][G][U][A] =  1.300;
+ int22_ar[G][U][U][C][U][U][U][A] =  1.700;
+ int22_ar[G][U][U][G][A][A][U][A] =  2.000;
+ int22_ar[G][U][U][G][A][C][U][A] =  2.400;
+ int22_ar[G][U][U][G][A][G][U][A] =  1.100;
+ int22_ar[G][U][U][G][A][U][U][A] =  2.400;
+ int22_ar[G][U][U][G][C][A][U][A] =  2.000;
+ int22_ar[G][U][U][G][C][C][U][A] =  2.000;
+ int22_ar[G][U][U][G][C][G][U][A] =  2.000;
+ int22_ar[G][U][U][G][C][U][U][A] =  2.000;
+ int22_ar[G][U][U][G][G][A][U][A] =  2.000;
+ int22_ar[G][U][U][G][G][C][U][A] =  2.400;
+ int22_ar[G][U][U][G][G][G][U][A] =  0.700;
+ int22_ar[G][U][U][G][G][U][U][A] =  2.000;
+ int22_ar[G][U][U][G][U][A][U][A] =  2.000;
+ int22_ar[G][U][U][G][U][C][U][A] =  0.700;
+ int22_ar[G][U][U][G][U][G][U][A] = -2.500;
+ int22_ar[G][U][U][G][U][U][U][A] =  0.700;
+ int22_ar[G][U][U][U][A][A][U][A] =  2.000;
+ int22_ar[G][U][U][U][A][C][U][A] =  2.000;
+ int22_ar[G][U][U][U][A][G][U][A] =  2.000;
+ int22_ar[G][U][U][U][A][U][U][A] =  2.000;
+ int22_ar[G][U][U][U][C][A][U][A] =  2.000;
+ int22_ar[G][U][U][U][C][C][U][A] =  2.200;
+ int22_ar[G][U][U][U][C][G][U][A] =  1.000;
+ int22_ar[G][U][U][U][C][U][U][A] =  1.400;
+ int22_ar[G][U][U][U][G][A][U][A] =  2.000;
+ int22_ar[G][U][U][U][G][C][U][A] =  1.900;
+ int22_ar[G][U][U][U][G][G][U][A] = -1.200;
+ int22_ar[G][U][U][U][G][U][U][A] =  1.900;
+ int22_ar[G][U][U][U][U][A][U][A] =  2.000;
+ int22_ar[G][U][U][U][U][C][U][A] =  1.600;
+ int22_ar[G][U][U][U][U][G][U][A] =  1.300;
+ int22_ar[G][U][U][U][U][U][U][A] =  0.800;
+ int22_ar[G][U][A][A][A][A][U][G] =  2.800;
+ int22_ar[G][U][A][A][A][C][U][G] =  2.600;
+ int22_ar[G][U][A][A][A][G][U][G] =  1.500;
+ int22_ar[G][U][A][A][A][U][U][G] =  2.000;
+ int22_ar[G][U][A][A][C][A][U][G] =  2.300;
+ int22_ar[G][U][A][A][C][C][U][G] =  2.200;
+ int22_ar[G][U][A][A][C][G][U][G] =  1.100;
+ int22_ar[G][U][A][A][C][U][U][G] =  2.000;
+ int22_ar[G][U][A][A][G][A][U][G] =  1.700;
+ int22_ar[G][U][A][A][G][C][U][G] =  1.600;
+ int22_ar[G][U][A][A][G][G][U][G] =  0.500;
+ int22_ar[G][U][A][A][G][U][U][G] =  2.000;
+ int22_ar[G][U][A][A][U][A][U][G] =  2.000;
+ int22_ar[G][U][A][A][U][C][U][G] =  2.000;
+ int22_ar[G][U][A][A][U][G][U][G] =  2.000;
+ int22_ar[G][U][A][A][U][U][U][G] =  2.000;
+ int22_ar[G][U][A][C][A][A][U][G] =  2.800;
+ int22_ar[G][U][A][C][A][C][U][G] =  2.600;
+ int22_ar[G][U][A][C][A][G][U][G] =  1.500;
+ int22_ar[G][U][A][C][A][U][U][G] =  2.000;
+ int22_ar[G][U][A][C][C][A][U][G] =  3.400;
+ int22_ar[G][U][A][C][C][C][U][G] =  2.600;
+ int22_ar[G][U][A][C][C][G][U][G] =  2.500;
+ int22_ar[G][U][A][C][C][U][U][G] =  2.000;
+ int22_ar[G][U][A][C][G][A][U][G] =  2.000;
+ int22_ar[G][U][A][C][G][C][U][G] =  2.000;
+ int22_ar[G][U][A][C][G][G][U][G] =  2.000;
+ int22_ar[G][U][A][C][G][U][U][G] =  2.000;
+ int22_ar[G][U][A][C][U][A][U][G] =  3.400;
+ int22_ar[G][U][A][C][U][C][U][G] =  2.600;
+ int22_ar[G][U][A][C][U][G][U][G] =  2.500;
+ int22_ar[G][U][A][C][U][U][U][G] =  2.000;
+ int22_ar[G][U][A][G][A][A][U][G] =  1.700;
+ int22_ar[G][U][A][G][A][C][U][G] =  1.600;
+ int22_ar[G][U][A][G][A][G][U][G] =  0.500;
+ int22_ar[G][U][A][G][A][U][U][G] =  2.000;
+ int22_ar[G][U][A][G][C][A][U][G] =  2.000;
+ int22_ar[G][U][A][G][C][C][U][G] =  2.000;
+ int22_ar[G][U][A][G][C][G][U][G] =  2.000;
+ int22_ar[G][U][A][G][C][U][U][G] =  2.000;
+ int22_ar[G][U][A][G][G][A][U][G] =  2.100;
+ int22_ar[G][U][A][G][G][C][U][G] =  2.000;
+ int22_ar[G][U][A][G][G][G][U][G] =  0.900;
+ int22_ar[G][U][A][G][G][U][U][G] =  2.000;
+ int22_ar[G][U][A][G][U][A][U][G] =  1.000;
+ int22_ar[G][U][A][G][U][C][U][G] = -0.200;
+ int22_ar[G][U][A][G][U][G][U][G] =  0.500;
+ int22_ar[G][U][A][G][U][U][U][G] =  2.000;
+ int22_ar[G][U][A][U][A][A][U][G] =  2.000;
+ int22_ar[G][U][A][U][A][C][U][G] =  2.000;
+ int22_ar[G][U][A][U][A][G][U][G] =  2.000;
+ int22_ar[G][U][A][U][A][U][U][G] =  2.000;
+ int22_ar[G][U][A][U][C][A][U][G] =  3.100;
+ int22_ar[G][U][A][U][C][C][U][G] =  2.300;
+ int22_ar[G][U][A][U][C][G][U][G] =  2.200;
+ int22_ar[G][U][A][U][C][U][U][G] =  2.000;
+ int22_ar[G][U][A][U][G][A][U][G] =  2.200;
+ int22_ar[G][U][A][U][G][C][U][G] =  1.100;
+ int22_ar[G][U][A][U][G][G][U][G] =  1.800;
+ int22_ar[G][U][A][U][G][U][U][G] =  2.000;
+ int22_ar[G][U][A][U][U][A][U][G] =  2.900;
+ int22_ar[G][U][A][U][U][C][U][G] =  1.800;
+ int22_ar[G][U][A][U][U][G][U][G] =  2.500;
+ int22_ar[G][U][A][U][U][U][U][G] =  2.000;
+ int22_ar[G][U][C][A][A][A][U][G] =  2.500;
+ int22_ar[G][U][C][A][A][C][U][G] =  3.100;
+ int22_ar[G][U][C][A][A][G][U][G] =  2.000;
+ int22_ar[G][U][C][A][A][U][U][G] =  3.100;
+ int22_ar[G][U][C][A][C][A][U][G] =  2.100;
+ int22_ar[G][U][C][A][C][C][U][G] =  2.000;
+ int22_ar[G][U][C][A][C][G][U][G] =  2.000;
+ int22_ar[G][U][C][A][C][U][U][G] =  2.000;
+ int22_ar[G][U][C][A][G][A][U][G] =  1.500;
+ int22_ar[G][U][C][A][G][C][U][G] =  2.400;
+ int22_ar[G][U][C][A][G][G][U][G] =  2.000;
+ int22_ar[G][U][C][A][G][U][U][G] =  2.400;
+ int22_ar[G][U][C][A][U][A][U][G] =  2.000;
+ int22_ar[G][U][C][A][U][C][U][G] =  2.000;
+ int22_ar[G][U][C][A][U][G][U][G] =  2.000;
+ int22_ar[G][U][C][A][U][U][U][G] =  2.000;
+ int22_ar[G][U][C][C][A][A][U][G] =  2.500;
+ int22_ar[G][U][C][C][A][C][U][G] =  2.500;
+ int22_ar[G][U][C][C][A][G][U][G] =  2.000;
+ int22_ar[G][U][C][C][A][U][U][G] =  2.500;
+ int22_ar[G][U][C][C][C][A][U][G] =  2.500;
+ int22_ar[G][U][C][C][C][C][U][G] =  2.500;
+ int22_ar[G][U][C][C][C][G][U][G] =  2.000;
+ int22_ar[G][U][C][C][C][U][U][G] =  2.500;
+ int22_ar[G][U][C][C][G][A][U][G] =  2.000;
+ int22_ar[G][U][C][C][G][C][U][G] =  2.000;
+ int22_ar[G][U][C][C][G][G][U][G] =  2.000;
+ int22_ar[G][U][C][C][G][U][U][G] =  2.000;
+ int22_ar[G][U][C][C][U][A][U][G] =  2.500;
+ int22_ar[G][U][C][C][U][C][U][G] =  2.500;
+ int22_ar[G][U][C][C][U][G][U][G] =  2.000;
+ int22_ar[G][U][C][C][U][U][U][G] =  2.500;
+ int22_ar[G][U][C][G][A][A][U][G] =  1.500;
+ int22_ar[G][U][C][G][A][C][U][G] =  2.400;
+ int22_ar[G][U][C][G][A][G][U][G] =  2.000;
+ int22_ar[G][U][C][G][A][U][U][G] =  2.400;
+ int22_ar[G][U][C][G][C][A][U][G] =  2.000;
+ int22_ar[G][U][C][G][C][C][U][G] =  2.000;
+ int22_ar[G][U][C][G][C][G][U][G] =  2.000;
+ int22_ar[G][U][C][G][C][U][U][G] =  2.000;
+ int22_ar[G][U][C][G][G][A][U][G] =  1.900;
+ int22_ar[G][U][C][G][G][C][U][G] =  2.400;
+ int22_ar[G][U][C][G][G][G][U][G] =  2.000;
+ int22_ar[G][U][C][G][G][U][U][G] =  2.400;
+ int22_ar[G][U][C][G][U][A][U][G] = -0.300;
+ int22_ar[G][U][C][G][U][C][U][G] =  0.700;
+ int22_ar[G][U][C][G][U][G][U][G] =  2.000;
+ int22_ar[G][U][C][G][U][U][U][G] =  0.700;
+ int22_ar[G][U][C][U][A][A][U][G] =  2.000;
+ int22_ar[G][U][C][U][A][C][U][G] =  2.000;
+ int22_ar[G][U][C][U][A][G][U][G] =  2.000;
+ int22_ar[G][U][C][U][A][U][U][G] =  2.000;
+ int22_ar[G][U][C][U][C][A][U][G] =  2.200;
+ int22_ar[G][U][C][U][C][C][U][G] =  2.200;
+ int22_ar[G][U][C][U][C][G][U][G] =  2.000;
+ int22_ar[G][U][C][U][C][U][U][G] =  2.200;
+ int22_ar[G][U][C][U][G][A][U][G] =  1.000;
+ int22_ar[G][U][C][U][G][C][U][G] =  1.900;
+ int22_ar[G][U][C][U][G][G][U][G] =  2.000;
+ int22_ar[G][U][C][U][G][U][U][G] =  1.900;
+ int22_ar[G][U][C][U][U][A][U][G] =  1.700;
+ int22_ar[G][U][C][U][U][C][U][G] =  1.600;
+ int22_ar[G][U][C][U][U][G][U][G] =  2.000;
+ int22_ar[G][U][C][U][U][U][U][G] =  1.600;
+ int22_ar[G][U][G][A][A][A][U][G] =  1.500;
+ int22_ar[G][U][G][A][A][C][U][G] =  2.000;
+ int22_ar[G][U][G][A][A][G][U][G] =  2.100;
+ int22_ar[G][U][G][A][A][U][U][G] =  2.300;
+ int22_ar[G][U][G][A][C][A][U][G] =  1.100;
+ int22_ar[G][U][G][A][C][C][U][G] =  2.000;
+ int22_ar[G][U][G][A][C][G][U][G] =  1.600;
+ int22_ar[G][U][G][A][C][U][U][G] =  0.900;
+ int22_ar[G][U][G][A][G][A][U][G] =  0.500;
+ int22_ar[G][U][G][A][G][C][U][G] =  2.000;
+ int22_ar[G][U][G][A][G][G][U][G] =  1.000;
+ int22_ar[G][U][G][A][G][U][U][G] =  2.100;
+ int22_ar[G][U][G][A][U][A][U][G] =  2.000;
+ int22_ar[G][U][G][A][U][C][U][G] =  2.000;
+ int22_ar[G][U][G][A][U][G][U][G] =  2.000;
+ int22_ar[G][U][G][A][U][U][U][G] =  2.000;
+ int22_ar[G][U][G][C][A][A][U][G] =  1.500;
+ int22_ar[G][U][G][C][A][C][U][G] =  2.000;
+ int22_ar[G][U][G][C][A][G][U][G] =  2.100;
+ int22_ar[G][U][G][C][A][U][U][G] =  1.300;
+ int22_ar[G][U][G][C][C][A][U][G] =  2.500;
+ int22_ar[G][U][G][C][C][C][U][G] =  2.000;
+ int22_ar[G][U][G][C][C][G][U][G] =  2.700;
+ int22_ar[G][U][G][C][C][U][U][G] =  2.300;
+ int22_ar[G][U][G][C][G][A][U][G] =  2.000;
+ int22_ar[G][U][G][C][G][C][U][G] =  2.000;
+ int22_ar[G][U][G][C][G][G][U][G] =  2.000;
+ int22_ar[G][U][G][C][G][U][U][G] =  2.000;
+ int22_ar[G][U][G][C][U][A][U][G] =  2.500;
+ int22_ar[G][U][G][C][U][C][U][G] =  2.000;
+ int22_ar[G][U][G][C][U][G][U][G] =  2.700;
+ int22_ar[G][U][G][C][U][U][U][G] =  2.300;
+ int22_ar[G][U][G][G][A][A][U][G] =  0.500;
+ int22_ar[G][U][G][G][A][C][U][G] =  2.000;
+ int22_ar[G][U][G][G][A][G][U][G] =  1.000;
+ int22_ar[G][U][G][G][A][U][U][G] =  2.100;
+ int22_ar[G][U][G][G][C][A][U][G] =  2.000;
+ int22_ar[G][U][G][G][C][C][U][G] =  2.000;
+ int22_ar[G][U][G][G][C][G][U][G] =  2.000;
+ int22_ar[G][U][G][G][C][U][U][G] =  2.000;
+ int22_ar[G][U][G][G][G][A][U][G] =  0.900;
+ int22_ar[G][U][G][G][G][C][U][G] =  2.000;
+ int22_ar[G][U][G][G][G][G][U][G] =  1.400;
+ int22_ar[G][U][G][G][G][U][U][G] =  1.700;
+ int22_ar[G][U][G][G][U][A][U][G] =  0.500;
+ int22_ar[G][U][G][G][U][C][U][G] =  2.000;
+ int22_ar[G][U][G][G][U][G][U][G] =  0.300;
+ int22_ar[G][U][G][G][U][U][U][G] = -1.500;
+ int22_ar[G][U][G][U][A][A][U][G] =  2.000;
+ int22_ar[G][U][G][U][A][C][U][G] =  2.000;
+ int22_ar[G][U][G][U][A][G][U][G] =  2.000;
+ int22_ar[G][U][G][U][A][U][U][G] =  2.000;
+ int22_ar[G][U][G][U][C][A][U][G] =  2.200;
+ int22_ar[G][U][G][U][C][C][U][G] =  2.000;
+ int22_ar[G][U][G][U][C][G][U][G] =  2.400;
+ int22_ar[G][U][G][U][C][U][U][G] =  2.000;
+ int22_ar[G][U][G][U][G][A][U][G] =  1.800;
+ int22_ar[G][U][G][U][G][C][U][G] =  2.000;
+ int22_ar[G][U][G][U][G][G][U][G] =  1.500;
+ int22_ar[G][U][G][U][G][U][U][G] = -0.200;
+ int22_ar[G][U][G][U][U][A][U][G] =  2.500;
+ int22_ar[G][U][G][U][U][C][U][G] =  2.000;
+ int22_ar[G][U][G][U][U][G][U][G] =  2.200;
+ int22_ar[G][U][G][U][U][U][U][G] =  2.300;
+ int22_ar[G][U][U][A][A][A][U][G] =  2.000;
+ int22_ar[G][U][U][A][A][C][U][G] =  3.100;
+ int22_ar[G][U][U][A][A][G][U][G] =  1.300;
+ int22_ar[G][U][U][A][A][U][U][G] =  2.700;
+ int22_ar[G][U][U][A][C][A][U][G] =  2.000;
+ int22_ar[G][U][U][A][C][C][U][G] =  2.000;
+ int22_ar[G][U][U][A][C][G][U][G] = -0.100;
+ int22_ar[G][U][U][A][C][U][U][G] =  1.200;
+ int22_ar[G][U][U][A][G][A][U][G] =  2.000;
+ int22_ar[G][U][U][A][G][C][U][G] =  2.400;
+ int22_ar[G][U][U][A][G][G][U][G] =  1.100;
+ int22_ar[G][U][U][A][G][U][U][G] =  2.400;
+ int22_ar[G][U][U][A][U][A][U][G] =  2.000;
+ int22_ar[G][U][U][A][U][C][U][G] =  2.000;
+ int22_ar[G][U][U][A][U][G][U][G] =  2.000;
+ int22_ar[G][U][U][A][U][U][U][G] =  2.000;
+ int22_ar[G][U][U][C][A][A][U][G] =  2.000;
+ int22_ar[G][U][U][C][A][C][U][G] =  2.500;
+ int22_ar[G][U][U][C][A][G][U][G] =  0.300;
+ int22_ar[G][U][U][C][A][U][U][G] =  1.700;
+ int22_ar[G][U][U][C][C][A][U][G] =  2.000;
+ int22_ar[G][U][U][C][C][C][U][G] =  2.500;
+ int22_ar[G][U][U][C][C][G][U][G] =  1.300;
+ int22_ar[G][U][U][C][C][U][U][G] =  1.700;
+ int22_ar[G][U][U][C][G][A][U][G] =  2.000;
+ int22_ar[G][U][U][C][G][C][U][G] =  2.000;
+ int22_ar[G][U][U][C][G][G][U][G] =  2.000;
+ int22_ar[G][U][U][C][G][U][U][G] =  2.000;
+ int22_ar[G][U][U][C][U][A][U][G] =  2.000;
+ int22_ar[G][U][U][C][U][C][U][G] =  2.500;
+ int22_ar[G][U][U][C][U][G][U][G] =  1.300;
+ int22_ar[G][U][U][C][U][U][U][G] =  1.700;
+ int22_ar[G][U][U][G][A][A][U][G] =  2.000;
+ int22_ar[G][U][U][G][A][C][U][G] =  2.400;
+ int22_ar[G][U][U][G][A][G][U][G] =  1.100;
+ int22_ar[G][U][U][G][A][U][U][G] =  2.400;
+ int22_ar[G][U][U][G][C][A][U][G] =  2.000;
+ int22_ar[G][U][U][G][C][C][U][G] =  2.000;
+ int22_ar[G][U][U][G][C][G][U][G] =  2.000;
+ int22_ar[G][U][U][G][C][U][U][G] =  2.000;
+ int22_ar[G][U][U][G][G][A][U][G] =  2.000;
+ int22_ar[G][U][U][G][G][C][U][G] =  2.400;
+ int22_ar[G][U][U][G][G][G][U][G] =  0.700;
+ int22_ar[G][U][U][G][G][U][U][G] =  2.000;
+ int22_ar[G][U][U][G][U][A][U][G] =  2.000;
+ int22_ar[G][U][U][G][U][C][U][G] =  0.700;
+ int22_ar[G][U][U][G][U][G][U][G] = -2.500;
+ int22_ar[G][U][U][G][U][U][U][G] =  0.700;
+ int22_ar[G][U][U][U][A][A][U][G] =  2.000;
+ int22_ar[G][U][U][U][A][C][U][G] =  2.000;
+ int22_ar[G][U][U][U][A][G][U][G] =  2.000;
+ int22_ar[G][U][U][U][A][U][U][G] =  2.000;
+ int22_ar[G][U][U][U][C][A][U][G] =  2.000;
+ int22_ar[G][U][U][U][C][C][U][G] =  2.200;
+ int22_ar[G][U][U][U][C][G][U][G] =  1.000;
+ int22_ar[G][U][U][U][C][U][U][G] =  1.400;
+ int22_ar[G][U][U][U][G][A][U][G] =  2.000;
+ int22_ar[G][U][U][U][G][C][U][G] =  1.900;
+ int22_ar[G][U][U][U][G][G][U][G] = -1.200;
+ int22_ar[G][U][U][U][G][U][U][G] =  1.900;
+ int22_ar[G][U][U][U][U][A][U][G] =  2.000;
+ int22_ar[G][U][U][U][U][C][U][G] =  1.600;
+ int22_ar[G][U][U][U][U][G][U][G] =  1.300;
+ int22_ar[G][U][U][U][U][U][U][G] =  0.800;
+ int22_ar[U][A][A][A][A][A][A][U] =  2.800;
+ int22_ar[U][A][A][A][A][C][A][U] =  2.800;
+ int22_ar[U][A][A][A][A][G][A][U] =  1.700;
+ int22_ar[U][A][A][A][A][U][A][U] =  2.000;
+ int22_ar[U][A][A][A][C][A][A][U] =  2.500;
+ int22_ar[U][A][A][A][C][C][A][U] =  2.500;
+ int22_ar[U][A][A][A][C][G][A][U] =  1.500;
+ int22_ar[U][A][A][A][C][U][A][U] =  2.000;
+ int22_ar[U][A][A][A][G][A][A][U] =  1.500;
+ int22_ar[U][A][A][A][G][C][A][U] =  1.500;
+ int22_ar[U][A][A][A][G][G][A][U] =  0.500;
+ int22_ar[U][A][A][A][G][U][A][U] =  2.000;
+ int22_ar[U][A][A][A][U][A][A][U] =  2.000;
+ int22_ar[U][A][A][A][U][C][A][U] =  2.000;
+ int22_ar[U][A][A][A][U][G][A][U] =  2.000;
+ int22_ar[U][A][A][A][U][U][A][U] =  2.000;
+ int22_ar[U][A][A][C][A][A][A][U] =  2.600;
+ int22_ar[U][A][A][C][A][C][A][U] =  2.600;
+ int22_ar[U][A][A][C][A][G][A][U] =  1.600;
+ int22_ar[U][A][A][C][A][U][A][U] =  2.000;
+ int22_ar[U][A][A][C][C][A][A][U] =  3.100;
+ int22_ar[U][A][A][C][C][C][A][U] =  2.500;
+ int22_ar[U][A][A][C][C][G][A][U] =  2.400;
+ int22_ar[U][A][A][C][C][U][A][U] =  2.000;
+ int22_ar[U][A][A][C][G][A][A][U] =  2.000;
+ int22_ar[U][A][A][C][G][C][A][U] =  2.000;
+ int22_ar[U][A][A][C][G][G][A][U] =  2.000;
+ int22_ar[U][A][A][C][G][U][A][U] =  2.000;
+ int22_ar[U][A][A][C][U][A][A][U] =  3.100;
+ int22_ar[U][A][A][C][U][C][A][U] =  2.500;
+ int22_ar[U][A][A][C][U][G][A][U] =  2.400;
+ int22_ar[U][A][A][C][U][U][A][U] =  2.000;
+ int22_ar[U][A][A][G][A][A][A][U] =  1.500;
+ int22_ar[U][A][A][G][A][C][A][U] =  1.500;
+ int22_ar[U][A][A][G][A][G][A][U] =  0.500;
+ int22_ar[U][A][A][G][A][U][A][U] =  2.000;
+ int22_ar[U][A][A][G][C][A][A][U] =  2.000;
+ int22_ar[U][A][A][G][C][C][A][U] =  2.000;
+ int22_ar[U][A][A][G][C][G][A][U] =  2.000;
+ int22_ar[U][A][A][G][C][U][A][U] =  2.000;
+ int22_ar[U][A][A][G][G][A][A][U] =  2.100;
+ int22_ar[U][A][A][G][G][C][A][U] =  2.100;
+ int22_ar[U][A][A][G][G][G][A][U] =  1.000;
+ int22_ar[U][A][A][G][G][U][A][U] =  2.000;
+ int22_ar[U][A][A][G][U][A][A][U] =  1.300;
+ int22_ar[U][A][A][G][U][C][A][U] =  0.300;
+ int22_ar[U][A][A][G][U][G][A][U] =  1.100;
+ int22_ar[U][A][A][G][U][U][A][U] =  2.000;
+ int22_ar[U][A][A][U][A][A][A][U] =  2.000;
+ int22_ar[U][A][A][U][A][C][A][U] =  2.000;
+ int22_ar[U][A][A][U][A][G][A][U] =  2.000;
+ int22_ar[U][A][A][U][A][U][A][U] =  2.000;
+ int22_ar[U][A][A][U][C][A][A][U] =  3.100;
+ int22_ar[U][A][A][U][C][C][A][U] =  2.500;
+ int22_ar[U][A][A][U][C][G][A][U] =  2.400;
+ int22_ar[U][A][A][U][C][U][A][U] =  2.000;
+ int22_ar[U][A][A][U][G][A][A][U] =  2.300;
+ int22_ar[U][A][A][U][G][C][A][U] =  1.300;
+ int22_ar[U][A][A][U][G][G][A][U] =  2.100;
+ int22_ar[U][A][A][U][G][U][A][U] =  2.000;
+ int22_ar[U][A][A][U][U][A][A][U] =  2.700;
+ int22_ar[U][A][A][U][U][C][A][U] =  1.700;
+ int22_ar[U][A][A][U][U][G][A][U] =  2.400;
+ int22_ar[U][A][A][U][U][U][A][U] =  2.000;
+ int22_ar[U][A][C][A][A][A][A][U] =  2.300;
+ int22_ar[U][A][C][A][A][C][A][U] =  3.400;
+ int22_ar[U][A][C][A][A][G][A][U] =  2.000;
+ int22_ar[U][A][C][A][A][U][A][U] =  3.100;
+ int22_ar[U][A][C][A][C][A][A][U] =  2.100;
+ int22_ar[U][A][C][A][C][C][A][U] =  2.500;
+ int22_ar[U][A][C][A][C][G][A][U] =  2.000;
+ int22_ar[U][A][C][A][C][U][A][U] =  2.200;
+ int22_ar[U][A][C][A][G][A][A][U] =  1.100;
+ int22_ar[U][A][C][A][G][C][A][U] =  2.500;
+ int22_ar[U][A][C][A][G][G][A][U] =  2.000;
+ int22_ar[U][A][C][A][G][U][A][U] =  2.200;
+ int22_ar[U][A][C][A][U][A][A][U] =  2.000;
+ int22_ar[U][A][C][A][U][C][A][U] =  2.000;
+ int22_ar[U][A][C][A][U][G][A][U] =  2.000;
+ int22_ar[U][A][C][A][U][U][A][U] =  2.000;
+ int22_ar[U][A][C][C][A][A][A][U] =  2.200;
+ int22_ar[U][A][C][C][A][C][A][U] =  2.600;
+ int22_ar[U][A][C][C][A][G][A][U] =  2.000;
+ int22_ar[U][A][C][C][A][U][A][U] =  2.300;
+ int22_ar[U][A][C][C][C][A][A][U] =  2.000;
+ int22_ar[U][A][C][C][C][C][A][U] =  2.500;
+ int22_ar[U][A][C][C][C][G][A][U] =  2.000;
+ int22_ar[U][A][C][C][C][U][A][U] =  2.200;
+ int22_ar[U][A][C][C][G][A][A][U] =  2.000;
+ int22_ar[U][A][C][C][G][C][A][U] =  2.000;
+ int22_ar[U][A][C][C][G][G][A][U] =  2.000;
+ int22_ar[U][A][C][C][G][U][A][U] =  2.000;
+ int22_ar[U][A][C][C][U][A][A][U] =  2.000;
+ int22_ar[U][A][C][C][U][C][A][U] =  2.500;
+ int22_ar[U][A][C][C][U][G][A][U] =  2.000;
+ int22_ar[U][A][C][C][U][U][A][U] =  2.200;
+ int22_ar[U][A][C][G][A][A][A][U] =  1.100;
+ int22_ar[U][A][C][G][A][C][A][U] =  2.500;
+ int22_ar[U][A][C][G][A][G][A][U] =  2.000;
+ int22_ar[U][A][C][G][A][U][A][U] =  2.200;
+ int22_ar[U][A][C][G][C][A][A][U] =  2.000;
+ int22_ar[U][A][C][G][C][C][A][U] =  2.000;
+ int22_ar[U][A][C][G][C][G][A][U] =  2.000;
+ int22_ar[U][A][C][G][C][U][A][U] =  2.000;
+ int22_ar[U][A][C][G][G][A][A][U] =  1.600;
+ int22_ar[U][A][C][G][G][C][A][U] =  2.700;
+ int22_ar[U][A][C][G][G][G][A][U] =  2.000;
+ int22_ar[U][A][C][G][G][U][A][U] =  2.400;
+ int22_ar[U][A][C][G][U][A][A][U] = -0.100;
+ int22_ar[U][A][C][G][U][C][A][U] =  1.300;
+ int22_ar[U][A][C][G][U][G][A][U] =  2.000;
+ int22_ar[U][A][C][G][U][U][A][U] =  1.000;
+ int22_ar[U][A][C][U][A][A][A][U] =  2.000;
+ int22_ar[U][A][C][U][A][C][A][U] =  2.000;
+ int22_ar[U][A][C][U][A][G][A][U] =  2.000;
+ int22_ar[U][A][C][U][A][U][A][U] =  2.000;
+ int22_ar[U][A][C][U][C][A][A][U] =  2.000;
+ int22_ar[U][A][C][U][C][C][A][U] =  2.500;
+ int22_ar[U][A][C][U][C][G][A][U] =  2.000;
+ int22_ar[U][A][C][U][C][U][A][U] =  2.200;
+ int22_ar[U][A][C][U][G][A][A][U] =  0.900;
+ int22_ar[U][A][C][U][G][C][A][U] =  2.300;
+ int22_ar[U][A][C][U][G][G][A][U] =  2.000;
+ int22_ar[U][A][C][U][G][U][A][U] =  2.000;
+ int22_ar[U][A][C][U][U][A][A][U] =  1.200;
+ int22_ar[U][A][C][U][U][C][A][U] =  1.700;
+ int22_ar[U][A][C][U][U][G][A][U] =  2.000;
+ int22_ar[U][A][C][U][U][U][A][U] =  1.400;
+ int22_ar[U][A][G][A][A][A][A][U] =  1.700;
+ int22_ar[U][A][G][A][A][C][A][U] =  2.000;
+ int22_ar[U][A][G][A][A][G][A][U] =  2.100;
+ int22_ar[U][A][G][A][A][U][A][U] =  2.200;
+ int22_ar[U][A][G][A][C][A][A][U] =  1.500;
+ int22_ar[U][A][G][A][C][C][A][U] =  2.000;
+ int22_ar[U][A][G][A][C][G][A][U] =  1.900;
+ int22_ar[U][A][G][A][C][U][A][U] =  1.000;
+ int22_ar[U][A][G][A][G][A][A][U] =  0.500;
+ int22_ar[U][A][G][A][G][C][A][U] =  2.000;
+ int22_ar[U][A][G][A][G][G][A][U] =  0.900;
+ int22_ar[U][A][G][A][G][U][A][U] =  1.800;
+ int22_ar[U][A][G][A][U][A][A][U] =  2.000;
+ int22_ar[U][A][G][A][U][C][A][U] =  2.000;
+ int22_ar[U][A][G][A][U][G][A][U] =  2.000;
+ int22_ar[U][A][G][A][U][U][A][U] =  2.000;
+ int22_ar[U][A][G][C][A][A][A][U] =  1.600;
+ int22_ar[U][A][G][C][A][C][A][U] =  2.000;
+ int22_ar[U][A][G][C][A][G][A][U] =  2.000;
+ int22_ar[U][A][G][C][A][U][A][U] =  1.100;
+ int22_ar[U][A][G][C][C][A][A][U] =  2.400;
+ int22_ar[U][A][G][C][C][C][A][U] =  2.000;
+ int22_ar[U][A][G][C][C][G][A][U] =  2.400;
+ int22_ar[U][A][G][C][C][U][A][U] =  1.900;
+ int22_ar[U][A][G][C][G][A][A][U] =  2.000;
+ int22_ar[U][A][G][C][G][C][A][U] =  2.000;
+ int22_ar[U][A][G][C][G][G][A][U] =  2.000;
+ int22_ar[U][A][G][C][G][U][A][U] =  2.000;
+ int22_ar[U][A][G][C][U][A][A][U] =  2.400;
+ int22_ar[U][A][G][C][U][C][A][U] =  2.000;
+ int22_ar[U][A][G][C][U][G][A][U] =  2.400;
+ int22_ar[U][A][G][C][U][U][A][U] =  1.900;
+ int22_ar[U][A][G][G][A][A][A][U] =  0.500;
+ int22_ar[U][A][G][G][A][C][A][U] =  2.000;
+ int22_ar[U][A][G][G][A][G][A][U] =  0.900;
+ int22_ar[U][A][G][G][A][U][A][U] =  1.800;
+ int22_ar[U][A][G][G][C][A][A][U] =  2.000;
+ int22_ar[U][A][G][G][C][C][A][U] =  2.000;
+ int22_ar[U][A][G][G][C][G][A][U] =  2.000;
+ int22_ar[U][A][G][G][C][U][A][U] =  2.000;
+ int22_ar[U][A][G][G][G][A][A][U] =  1.000;
+ int22_ar[U][A][G][G][G][C][A][U] =  2.000;
+ int22_ar[U][A][G][G][G][G][A][U] =  1.400;
+ int22_ar[U][A][G][G][G][U][A][U] =  1.500;
+ int22_ar[U][A][G][G][U][A][A][U] =  1.100;
+ int22_ar[U][A][G][G][U][C][A][U] =  2.000;
+ int22_ar[U][A][G][G][U][G][A][U] =  0.700;
+ int22_ar[U][A][G][G][U][U][A][U] = -1.200;
+ int22_ar[U][A][G][U][A][A][A][U] =  2.000;
+ int22_ar[U][A][G][U][A][C][A][U] =  2.000;
+ int22_ar[U][A][G][U][A][G][A][U] =  2.000;
+ int22_ar[U][A][G][U][A][U][A][U] =  2.000;
+ int22_ar[U][A][G][U][C][A][A][U] =  2.400;
+ int22_ar[U][A][G][U][C][C][A][U] =  2.000;
+ int22_ar[U][A][G][U][C][G][A][U] =  2.400;
+ int22_ar[U][A][G][U][C][U][A][U] =  1.900;
+ int22_ar[U][A][G][U][G][A][A][U] =  2.100;
+ int22_ar[U][A][G][U][G][C][A][U] =  2.000;
+ int22_ar[U][A][G][U][G][G][A][U] =  1.700;
+ int22_ar[U][A][G][U][G][U][A][U] = -0.200;
+ int22_ar[U][A][G][U][U][A][A][U] =  2.400;
+ int22_ar[U][A][G][U][U][C][A][U] =  2.000;
+ int22_ar[U][A][G][U][U][G][A][U] =  2.000;
+ int22_ar[U][A][G][U][U][U][A][U] =  1.900;
+ int22_ar[U][A][U][A][A][A][A][U] =  2.000;
+ int22_ar[U][A][U][A][A][C][A][U] =  3.400;
+ int22_ar[U][A][U][A][A][G][A][U] =  1.000;
+ int22_ar[U][A][U][A][A][U][A][U] =  2.900;
+ int22_ar[U][A][U][A][C][A][A][U] =  2.000;
+ int22_ar[U][A][U][A][C][C][A][U] =  2.500;
+ int22_ar[U][A][U][A][C][G][A][U] = -0.300;
+ int22_ar[U][A][U][A][C][U][A][U] =  1.700;
+ int22_ar[U][A][U][A][G][A][A][U] =  2.000;
+ int22_ar[U][A][U][A][G][C][A][U] =  2.500;
+ int22_ar[U][A][U][A][G][G][A][U] =  0.500;
+ int22_ar[U][A][U][A][G][U][A][U] =  2.500;
+ int22_ar[U][A][U][A][U][A][A][U] =  2.000;
+ int22_ar[U][A][U][A][U][C][A][U] =  2.000;
+ int22_ar[U][A][U][A][U][G][A][U] =  2.000;
+ int22_ar[U][A][U][A][U][U][A][U] =  2.000;
+ int22_ar[U][A][U][C][A][A][A][U] =  2.000;
+ int22_ar[U][A][U][C][A][C][A][U] =  2.600;
+ int22_ar[U][A][U][C][A][G][A][U] = -0.200;
+ int22_ar[U][A][U][C][A][U][A][U] =  1.800;
+ int22_ar[U][A][U][C][C][A][A][U] =  2.000;
+ int22_ar[U][A][U][C][C][C][A][U] =  2.500;
+ int22_ar[U][A][U][C][C][G][A][U] =  0.700;
+ int22_ar[U][A][U][C][C][U][A][U] =  1.600;
+ int22_ar[U][A][U][C][G][A][A][U] =  2.000;
+ int22_ar[U][A][U][C][G][C][A][U] =  2.000;
+ int22_ar[U][A][U][C][G][G][A][U] =  2.000;
+ int22_ar[U][A][U][C][G][U][A][U] =  2.000;
+ int22_ar[U][A][U][C][U][A][A][U] =  2.000;
+ int22_ar[U][A][U][C][U][C][A][U] =  2.500;
+ int22_ar[U][A][U][C][U][G][A][U] =  0.700;
+ int22_ar[U][A][U][C][U][U][A][U] =  1.600;
+ int22_ar[U][A][U][G][A][A][A][U] =  2.000;
+ int22_ar[U][A][U][G][A][C][A][U] =  2.500;
+ int22_ar[U][A][U][G][A][G][A][U] =  0.500;
+ int22_ar[U][A][U][G][A][U][A][U] =  2.500;
+ int22_ar[U][A][U][G][C][A][A][U] =  2.000;
+ int22_ar[U][A][U][G][C][C][A][U] =  2.000;
+ int22_ar[U][A][U][G][C][G][A][U] =  2.000;
+ int22_ar[U][A][U][G][C][U][A][U] =  2.000;
+ int22_ar[U][A][U][G][G][A][A][U] =  2.000;
+ int22_ar[U][A][U][G][G][C][A][U] =  2.700;
+ int22_ar[U][A][U][G][G][G][A][U] =  0.300;
+ int22_ar[U][A][U][G][G][U][A][U] =  2.200;
+ int22_ar[U][A][U][G][U][A][A][U] =  2.000;
+ int22_ar[U][A][U][G][U][C][A][U] =  1.300;
+ int22_ar[U][A][U][G][U][G][A][U] = -2.500;
+ int22_ar[U][A][U][G][U][U][A][U] =  1.300;
+ int22_ar[U][A][U][U][A][A][A][U] =  2.000;
+ int22_ar[U][A][U][U][A][C][A][U] =  2.000;
+ int22_ar[U][A][U][U][A][G][A][U] =  2.000;
+ int22_ar[U][A][U][U][A][U][A][U] =  2.000;
+ int22_ar[U][A][U][U][C][A][A][U] =  2.000;
+ int22_ar[U][A][U][U][C][C][A][U] =  2.500;
+ int22_ar[U][A][U][U][C][G][A][U] =  0.700;
+ int22_ar[U][A][U][U][C][U][A][U] =  1.600;
+ int22_ar[U][A][U][U][G][A][A][U] =  2.000;
+ int22_ar[U][A][U][U][G][C][A][U] =  2.300;
+ int22_ar[U][A][U][U][G][G][A][U] = -1.500;
+ int22_ar[U][A][U][U][G][U][A][U] =  2.300;
+ int22_ar[U][A][U][U][U][A][A][U] =  2.000;
+ int22_ar[U][A][U][U][U][C][A][U] =  1.700;
+ int22_ar[U][A][U][U][U][G][A][U] =  0.700;
+ int22_ar[U][A][U][U][U][U][A][U] =  0.800;
+ int22_ar[U][A][A][A][A][A][C][G] =  2.000;
+ int22_ar[U][A][A][A][A][C][C][G] =  2.000;
+ int22_ar[U][A][A][A][A][G][C][G] =  1.000;
+ int22_ar[U][A][A][A][A][U][C][G] =  2.000;
+ int22_ar[U][A][A][A][C][A][C][G] =  1.900;
+ int22_ar[U][A][A][A][C][C][C][G] =  1.900;
+ int22_ar[U][A][A][A][C][G][C][G] =  0.900;
+ int22_ar[U][A][A][A][C][U][C][G] =  2.000;
+ int22_ar[U][A][A][A][G][A][C][G] =  1.000;
+ int22_ar[U][A][A][A][G][C][C][G] =  1.000;
+ int22_ar[U][A][A][A][G][G][C][G] =  0.000;
+ int22_ar[U][A][A][A][G][U][C][G] =  2.000;
+ int22_ar[U][A][A][A][U][A][C][G] =  2.000;
+ int22_ar[U][A][A][A][U][C][C][G] =  2.000;
+ int22_ar[U][A][A][A][U][G][C][G] =  2.000;
+ int22_ar[U][A][A][A][U][U][C][G] =  2.000;
+ int22_ar[U][A][A][C][A][A][C][G] =  2.400;
+ int22_ar[U][A][A][C][A][C][C][G] =  2.400;
+ int22_ar[U][A][A][C][A][G][C][G] =  1.300;
+ int22_ar[U][A][A][C][A][U][C][G] =  2.000;
+ int22_ar[U][A][A][C][C][A][C][G] =  2.800;
+ int22_ar[U][A][A][C][C][C][C][G] =  2.200;
+ int22_ar[U][A][A][C][C][G][C][G] =  2.200;
+ int22_ar[U][A][A][C][C][U][C][G] =  2.000;
+ int22_ar[U][A][A][C][G][A][C][G] =  2.000;
+ int22_ar[U][A][A][C][G][C][C][G] =  2.000;
+ int22_ar[U][A][A][C][G][G][C][G] =  2.000;
+ int22_ar[U][A][A][C][G][U][C][G] =  2.000;
+ int22_ar[U][A][A][C][U][A][C][G] =  2.700;
+ int22_ar[U][A][A][C][U][C][C][G] =  2.100;
+ int22_ar[U][A][A][C][U][G][C][G] =  2.000;
+ int22_ar[U][A][A][C][U][U][C][G] =  2.000;
+ int22_ar[U][A][A][G][A][A][C][G] =  1.000;
+ int22_ar[U][A][A][G][A][C][C][G] =  1.000;
+ int22_ar[U][A][A][G][A][G][C][G] =  0.000;
+ int22_ar[U][A][A][G][A][U][C][G] =  2.000;
+ int22_ar[U][A][A][G][C][A][C][G] =  2.000;
+ int22_ar[U][A][A][G][C][C][C][G] =  2.000;
+ int22_ar[U][A][A][G][C][G][C][G] =  2.000;
+ int22_ar[U][A][A][G][C][U][C][G] =  2.000;
+ int22_ar[U][A][A][G][G][A][C][G] =  1.800;
+ int22_ar[U][A][A][G][G][C][C][G] =  1.800;
+ int22_ar[U][A][A][G][G][G][C][G] =  0.700;
+ int22_ar[U][A][A][G][G][U][C][G] =  2.000;
+ int22_ar[U][A][A][G][U][A][C][G] =  0.300;
+ int22_ar[U][A][A][G][U][C][C][G] = -0.700;
+ int22_ar[U][A][A][G][U][G][C][G] =  0.100;
+ int22_ar[U][A][A][G][U][U][C][G] =  2.000;
+ int22_ar[U][A][A][U][A][A][C][G] =  2.000;
+ int22_ar[U][A][A][U][A][C][C][G] =  2.000;
+ int22_ar[U][A][A][U][A][G][C][G] =  2.000;
+ int22_ar[U][A][A][U][A][U][C][G] =  2.000;
+ int22_ar[U][A][A][U][C][A][C][G] =  2.700;
+ int22_ar[U][A][A][U][C][C][C][G] =  2.100;
+ int22_ar[U][A][A][U][C][G][C][G] =  2.000;
+ int22_ar[U][A][A][U][C][U][C][G] =  2.000;
+ int22_ar[U][A][A][U][G][A][C][G] =  1.800;
+ int22_ar[U][A][A][U][G][C][C][G] =  0.800;
+ int22_ar[U][A][A][U][G][G][C][G] =  1.600;
+ int22_ar[U][A][A][U][G][U][C][G] =  2.000;
+ int22_ar[U][A][A][U][U][A][C][G] =  2.200;
+ int22_ar[U][A][A][U][U][C][C][G] =  1.200;
+ int22_ar[U][A][A][U][U][G][C][G] =  1.900;
+ int22_ar[U][A][A][U][U][U][C][G] =  2.000;
+ int22_ar[U][A][C][A][A][A][C][G] =  1.600;
+ int22_ar[U][A][C][A][A][C][C][G] =  2.600;
+ int22_ar[U][A][C][A][A][G][C][G] =  2.000;
+ int22_ar[U][A][C][A][A][U][C][G] =  2.300;
+ int22_ar[U][A][C][A][C][A][C][G] =  1.500;
+ int22_ar[U][A][C][A][C][C][C][G] =  1.900;
+ int22_ar[U][A][C][A][C][G][C][G] =  2.000;
+ int22_ar[U][A][C][A][C][U][C][G] =  1.600;
+ int22_ar[U][A][C][A][G][A][C][G] =  0.600;
+ int22_ar[U][A][C][A][G][C][C][G] =  2.000;
+ int22_ar[U][A][C][A][G][G][C][G] =  2.000;
+ int22_ar[U][A][C][A][G][U][C][G] =  1.700;
+ int22_ar[U][A][C][A][U][A][C][G] =  2.000;
+ int22_ar[U][A][C][A][U][C][C][G] =  2.000;
+ int22_ar[U][A][C][A][U][G][C][G] =  2.000;
+ int22_ar[U][A][C][A][U][U][C][G] =  2.000;
+ int22_ar[U][A][C][C][A][A][C][G] =  1.900;
+ int22_ar[U][A][C][C][A][C][C][G] =  2.400;
+ int22_ar[U][A][C][C][A][G][C][G] =  2.000;
+ int22_ar[U][A][C][C][A][U][C][G] =  2.100;
+ int22_ar[U][A][C][C][C][A][C][G] =  1.800;
+ int22_ar[U][A][C][C][C][C][C][G] =  2.200;
+ int22_ar[U][A][C][C][C][G][C][G] =  2.000;
+ int22_ar[U][A][C][C][C][U][C][G] =  1.900;
+ int22_ar[U][A][C][C][G][A][C][G] =  2.000;
+ int22_ar[U][A][C][C][G][C][C][G] =  2.000;
+ int22_ar[U][A][C][C][G][G][C][G] =  2.000;
+ int22_ar[U][A][C][C][G][U][C][G] =  2.000;
+ int22_ar[U][A][C][C][U][A][C][G] =  1.600;
+ int22_ar[U][A][C][C][U][C][C][G] =  2.100;
+ int22_ar[U][A][C][C][U][G][C][G] =  2.000;
+ int22_ar[U][A][C][C][U][U][C][G] =  1.800;
+ int22_ar[U][A][C][G][A][A][C][G] =  0.600;
+ int22_ar[U][A][C][G][A][C][C][G] =  2.000;
+ int22_ar[U][A][C][G][A][G][C][G] =  2.000;
+ int22_ar[U][A][C][G][A][U][C][G] =  1.700;
+ int22_ar[U][A][C][G][C][A][C][G] =  2.000;
+ int22_ar[U][A][C][G][C][C][C][G] =  2.000;
+ int22_ar[U][A][C][G][C][G][C][G] =  2.000;
+ int22_ar[U][A][C][G][C][U][C][G] =  2.000;
+ int22_ar[U][A][C][G][G][A][C][G] =  1.300;
+ int22_ar[U][A][C][G][G][C][C][G] =  2.400;
+ int22_ar[U][A][C][G][G][G][C][G] =  2.000;
+ int22_ar[U][A][C][G][G][U][C][G] =  2.100;
+ int22_ar[U][A][C][G][U][A][C][G] = -1.100;
+ int22_ar[U][A][C][G][U][C][C][G] =  0.300;
+ int22_ar[U][A][C][G][U][G][C][G] =  2.000;
+ int22_ar[U][A][C][G][U][U][C][G] =  0.000;
+ int22_ar[U][A][C][U][A][A][C][G] =  2.000;
+ int22_ar[U][A][C][U][A][C][C][G] =  2.000;
+ int22_ar[U][A][C][U][A][G][C][G] =  2.000;
+ int22_ar[U][A][C][U][A][U][C][G] =  2.000;
+ int22_ar[U][A][C][U][C][A][C][G] =  1.600;
+ int22_ar[U][A][C][U][C][C][C][G] =  2.100;
+ int22_ar[U][A][C][U][C][G][C][G] =  2.000;
+ int22_ar[U][A][C][U][C][U][C][G] =  1.800;
+ int22_ar[U][A][C][U][G][A][C][G] =  0.400;
+ int22_ar[U][A][C][U][G][C][C][G] =  1.800;
+ int22_ar[U][A][C][U][G][G][C][G] =  2.000;
+ int22_ar[U][A][C][U][G][U][C][G] =  1.500;
+ int22_ar[U][A][C][U][U][A][C][G] =  0.700;
+ int22_ar[U][A][C][U][U][C][C][G] =  1.200;
+ int22_ar[U][A][C][U][U][G][C][G] =  2.000;
+ int22_ar[U][A][C][U][U][U][C][G] =  0.900;
+ int22_ar[U][A][G][A][A][A][C][G] =  1.000;
+ int22_ar[U][A][G][A][A][C][C][G] =  2.000;
+ int22_ar[U][A][G][A][A][G][C][G] =  1.400;
+ int22_ar[U][A][G][A][A][U][C][G] =  1.500;
+ int22_ar[U][A][G][A][C][A][C][G] =  0.900;
+ int22_ar[U][A][G][A][C][C][C][G] =  2.000;
+ int22_ar[U][A][G][A][C][G][C][G] =  1.300;
+ int22_ar[U][A][G][A][C][U][C][G] =  0.400;
+ int22_ar[U][A][G][A][G][A][C][G] =  0.000;
+ int22_ar[U][A][G][A][G][C][C][G] =  2.000;
+ int22_ar[U][A][G][A][G][G][C][G] =  0.400;
+ int22_ar[U][A][G][A][G][U][C][G] =  1.300;
+ int22_ar[U][A][G][A][U][A][C][G] =  2.000;
+ int22_ar[U][A][G][A][U][C][C][G] =  2.000;
+ int22_ar[U][A][G][A][U][G][C][G] =  2.000;
+ int22_ar[U][A][G][A][U][U][C][G] =  2.000;
+ int22_ar[U][A][G][C][A][A][C][G] =  1.300;
+ int22_ar[U][A][G][C][A][C][C][G] =  2.000;
+ int22_ar[U][A][G][C][A][G][C][G] =  1.700;
+ int22_ar[U][A][G][C][A][U][C][G] =  0.800;
+ int22_ar[U][A][G][C][C][A][C][G] =  2.200;
+ int22_ar[U][A][G][C][C][C][C][G] =  2.000;
+ int22_ar[U][A][G][C][C][G][C][G] =  2.200;
+ int22_ar[U][A][G][C][C][U][C][G] =  1.700;
+ int22_ar[U][A][G][C][G][A][C][G] =  2.000;
+ int22_ar[U][A][G][C][G][C][C][G] =  2.000;
+ int22_ar[U][A][G][C][G][G][C][G] =  2.000;
+ int22_ar[U][A][G][C][G][U][C][G] =  2.000;
+ int22_ar[U][A][G][C][U][A][C][G] =  2.000;
+ int22_ar[U][A][G][C][U][C][C][G] =  2.000;
+ int22_ar[U][A][G][C][U][G][C][G] =  2.000;
+ int22_ar[U][A][G][C][U][U][C][G] =  1.500;
+ int22_ar[U][A][G][G][A][A][C][G] =  0.000;
+ int22_ar[U][A][G][G][A][C][C][G] =  2.000;
+ int22_ar[U][A][G][G][A][G][C][G] =  0.400;
+ int22_ar[U][A][G][G][A][U][C][G] =  1.300;
+ int22_ar[U][A][G][G][C][A][C][G] =  2.000;
+ int22_ar[U][A][G][G][C][C][C][G] =  2.000;
+ int22_ar[U][A][G][G][C][G][C][G] =  2.000;
+ int22_ar[U][A][G][G][C][U][C][G] =  2.000;
+ int22_ar[U][A][G][G][G][A][C][G] =  0.700;
+ int22_ar[U][A][G][G][G][C][C][G] =  2.000;
+ int22_ar[U][A][G][G][G][G][C][G] =  1.100;
+ int22_ar[U][A][G][G][G][U][C][G] =  1.200;
+ int22_ar[U][A][G][G][U][A][C][G] =  0.100;
+ int22_ar[U][A][G][G][U][C][C][G] =  2.000;
+ int22_ar[U][A][G][G][U][G][C][G] = -0.300;
+ int22_ar[U][A][G][G][U][U][C][G] = -2.200;
+ int22_ar[U][A][G][U][A][A][C][G] =  2.000;
+ int22_ar[U][A][G][U][A][C][C][G] =  2.000;
+ int22_ar[U][A][G][U][A][G][C][G] =  2.000;
+ int22_ar[U][A][G][U][A][U][C][G] =  2.000;
+ int22_ar[U][A][G][U][C][A][C][G] =  2.000;
+ int22_ar[U][A][G][U][C][C][C][G] =  2.000;
+ int22_ar[U][A][G][U][C][G][C][G] =  2.000;
+ int22_ar[U][A][G][U][C][U][C][G] =  1.500;
+ int22_ar[U][A][G][U][G][A][C][G] =  1.600;
+ int22_ar[U][A][G][U][G][C][C][G] =  2.000;
+ int22_ar[U][A][G][U][G][G][C][G] =  1.200;
+ int22_ar[U][A][G][U][G][U][C][G] = -0.700;
+ int22_ar[U][A][G][U][U][A][C][G] =  1.900;
+ int22_ar[U][A][G][U][U][C][C][G] =  2.000;
+ int22_ar[U][A][G][U][U][G][C][G] =  1.500;
+ int22_ar[U][A][G][U][U][U][C][G] =  1.500;
+ int22_ar[U][A][U][A][A][A][C][G] =  2.000;
+ int22_ar[U][A][U][A][A][C][C][G] =  2.600;
+ int22_ar[U][A][U][A][A][G][C][G] =  0.200;
+ int22_ar[U][A][U][A][A][U][C][G] =  2.200;
+ int22_ar[U][A][U][A][C][A][C][G] =  2.000;
+ int22_ar[U][A][U][A][C][C][C][G] =  1.900;
+ int22_ar[U][A][U][A][C][G][C][G] = -0.900;
+ int22_ar[U][A][U][A][C][U][C][G] =  1.100;
+ int22_ar[U][A][U][A][G][A][C][G] =  2.000;
+ int22_ar[U][A][U][A][G][C][C][G] =  2.000;
+ int22_ar[U][A][U][A][G][G][C][G] =  0.000;
+ int22_ar[U][A][U][A][G][U][C][G] =  2.000;
+ int22_ar[U][A][U][A][U][A][C][G] =  2.000;
+ int22_ar[U][A][U][A][U][C][C][G] =  2.000;
+ int22_ar[U][A][U][A][U][G][C][G] =  2.000;
+ int22_ar[U][A][U][A][U][U][C][G] =  2.000;
+ int22_ar[U][A][U][C][A][A][C][G] =  2.000;
+ int22_ar[U][A][U][C][A][C][C][G] =  2.400;
+ int22_ar[U][A][U][C][A][G][C][G] = -0.400;
+ int22_ar[U][A][U][C][A][U][C][G] =  1.500;
+ int22_ar[U][A][U][C][C][A][C][G] =  2.000;
+ int22_ar[U][A][U][C][C][C][C][G] =  2.200;
+ int22_ar[U][A][U][C][C][G][C][G] =  0.400;
+ int22_ar[U][A][U][C][C][U][C][G] =  1.400;
+ int22_ar[U][A][U][C][G][A][C][G] =  2.000;
+ int22_ar[U][A][U][C][G][C][C][G] =  2.000;
+ int22_ar[U][A][U][C][G][G][C][G] =  2.000;
+ int22_ar[U][A][U][C][G][U][C][G] =  2.000;
+ int22_ar[U][A][U][C][U][A][C][G] =  2.000;
+ int22_ar[U][A][U][C][U][C][C][G] =  2.100;
+ int22_ar[U][A][U][C][U][G][C][G] =  0.300;
+ int22_ar[U][A][U][C][U][U][C][G] =  1.200;
+ int22_ar[U][A][U][G][A][A][C][G] =  2.000;
+ int22_ar[U][A][U][G][A][C][C][G] =  2.000;
+ int22_ar[U][A][U][G][A][G][C][G] =  0.000;
+ int22_ar[U][A][U][G][A][U][C][G] =  2.000;
+ int22_ar[U][A][U][G][C][A][C][G] =  2.000;
+ int22_ar[U][A][U][G][C][C][C][G] =  2.000;
+ int22_ar[U][A][U][G][C][G][C][G] =  2.000;
+ int22_ar[U][A][U][G][C][U][C][G] =  2.000;
+ int22_ar[U][A][U][G][G][A][C][G] =  2.000;
+ int22_ar[U][A][U][G][G][C][C][G] =  2.400;
+ int22_ar[U][A][U][G][G][G][C][G] =  0.000;
+ int22_ar[U][A][U][G][G][U][C][G] =  1.900;
+ int22_ar[U][A][U][G][U][A][C][G] =  2.000;
+ int22_ar[U][A][U][G][U][C][C][G] =  0.300;
+ int22_ar[U][A][U][G][U][G][C][G] = -3.500;
+ int22_ar[U][A][U][G][U][U][C][G] =  0.300;
+ int22_ar[U][A][U][U][A][A][C][G] =  2.000;
+ int22_ar[U][A][U][U][A][C][C][G] =  2.000;
+ int22_ar[U][A][U][U][A][G][C][G] =  2.000;
+ int22_ar[U][A][U][U][A][U][C][G] =  2.000;
+ int22_ar[U][A][U][U][C][A][C][G] =  2.000;
+ int22_ar[U][A][U][U][C][C][C][G] =  2.100;
+ int22_ar[U][A][U][U][C][G][C][G] =  0.300;
+ int22_ar[U][A][U][U][C][U][C][G] =  1.200;
+ int22_ar[U][A][U][U][G][A][C][G] =  2.000;
+ int22_ar[U][A][U][U][G][C][C][G] =  1.800;
+ int22_ar[U][A][U][U][G][G][C][G] = -2.000;
+ int22_ar[U][A][U][U][G][U][C][G] =  1.800;
+ int22_ar[U][A][U][U][U][A][C][G] =  2.000;
+ int22_ar[U][A][U][U][U][C][C][G] =  1.200;
+ int22_ar[U][A][U][U][U][G][C][G] =  0.200;
+ int22_ar[U][A][U][U][U][U][C][G] =  0.300;
+ int22_ar[U][A][A][A][A][A][G][C] =  2.100;
+ int22_ar[U][A][A][A][A][C][G][C] =  2.100;
+ int22_ar[U][A][A][A][A][G][G][C] =  1.100;
+ int22_ar[U][A][A][A][A][U][G][C] =  2.000;
+ int22_ar[U][A][A][A][C][A][G][C] =  1.900;
+ int22_ar[U][A][A][A][C][C][G][C] =  1.900;
+ int22_ar[U][A][A][A][C][G][G][C] =  0.800;
+ int22_ar[U][A][A][A][C][U][G][C] =  2.000;
+ int22_ar[U][A][A][A][G][A][G][C] =  0.100;
+ int22_ar[U][A][A][A][G][C][G][C] =  0.100;
+ int22_ar[U][A][A][A][G][G][G][C] = -0.900;
+ int22_ar[U][A][A][A][G][U][G][C] =  2.000;
+ int22_ar[U][A][A][A][U][A][G][C] =  2.000;
+ int22_ar[U][A][A][A][U][C][G][C] =  2.000;
+ int22_ar[U][A][A][A][U][G][G][C] =  2.000;
+ int22_ar[U][A][A][A][U][U][G][C] =  2.000;
+ int22_ar[U][A][A][C][A][A][G][C] =  1.800;
+ int22_ar[U][A][A][C][A][C][G][C] =  1.800;
+ int22_ar[U][A][A][C][A][G][G][C] =  0.800;
+ int22_ar[U][A][A][C][A][U][G][C] =  2.000;
+ int22_ar[U][A][A][C][C][A][G][C] =  2.500;
+ int22_ar[U][A][A][C][C][C][G][C] =  1.900;
+ int22_ar[U][A][A][C][C][G][G][C] =  1.800;
+ int22_ar[U][A][A][C][C][U][G][C] =  2.000;
+ int22_ar[U][A][A][C][G][A][G][C] =  2.000;
+ int22_ar[U][A][A][C][G][C][G][C] =  2.000;
+ int22_ar[U][A][A][C][G][G][G][C] =  2.000;
+ int22_ar[U][A][A][C][G][U][G][C] =  2.000;
+ int22_ar[U][A][A][C][U][A][G][C] =  1.500;
+ int22_ar[U][A][A][C][U][C][G][C] =  0.900;
+ int22_ar[U][A][A][C][U][G][G][C] =  0.900;
+ int22_ar[U][A][A][C][U][U][G][C] =  2.000;
+ int22_ar[U][A][A][G][A][A][G][C] =  0.700;
+ int22_ar[U][A][A][G][A][C][G][C] =  0.700;
+ int22_ar[U][A][A][G][A][G][G][C] = -0.300;
+ int22_ar[U][A][A][G][A][U][G][C] =  2.000;
+ int22_ar[U][A][A][G][C][A][G][C] =  2.000;
+ int22_ar[U][A][A][G][C][C][G][C] =  2.000;
+ int22_ar[U][A][A][G][C][G][G][C] =  2.000;
+ int22_ar[U][A][A][G][C][U][G][C] =  2.000;
+ int22_ar[U][A][A][G][G][A][G][C] =  1.800;
+ int22_ar[U][A][A][G][G][C][G][C] =  1.800;
+ int22_ar[U][A][A][G][G][G][G][C] =  0.700;
+ int22_ar[U][A][A][G][G][U][G][C] =  2.000;
+ int22_ar[U][A][A][G][U][A][G][C] =  0.000;
+ int22_ar[U][A][A][G][U][C][G][C] = -1.000;
+ int22_ar[U][A][A][G][U][G][G][C] = -0.300;
+ int22_ar[U][A][A][G][U][U][G][C] =  2.000;
+ int22_ar[U][A][A][U][A][A][G][C] =  2.000;
+ int22_ar[U][A][A][U][A][C][G][C] =  2.000;
+ int22_ar[U][A][A][U][A][G][G][C] =  2.000;
+ int22_ar[U][A][A][U][A][U][G][C] =  2.000;
+ int22_ar[U][A][A][U][C][A][G][C] =  2.500;
+ int22_ar[U][A][A][U][C][C][G][C] =  1.900;
+ int22_ar[U][A][A][U][C][G][G][C] =  1.900;
+ int22_ar[U][A][A][U][C][U][G][C] =  2.000;
+ int22_ar[U][A][A][U][G][A][G][C] =  0.400;
+ int22_ar[U][A][A][U][G][C][G][C] = -0.600;
+ int22_ar[U][A][A][U][G][G][G][C] =  0.100;
+ int22_ar[U][A][A][U][G][U][G][C] =  2.000;
+ int22_ar[U][A][A][U][U][A][G][C] =  2.100;
+ int22_ar[U][A][A][U][U][C][G][C] =  1.100;
+ int22_ar[U][A][A][U][U][G][G][C] =  1.900;
+ int22_ar[U][A][A][U][U][U][G][C] =  2.000;
+ int22_ar[U][A][C][A][A][A][G][C] =  1.700;
+ int22_ar[U][A][C][A][A][C][G][C] =  2.700;
+ int22_ar[U][A][C][A][A][G][G][C] =  2.000;
+ int22_ar[U][A][C][A][A][U][G][C] =  2.400;
+ int22_ar[U][A][C][A][C][A][G][C] =  1.400;
+ int22_ar[U][A][C][A][C][C][G][C] =  1.900;
+ int22_ar[U][A][C][A][C][G][G][C] =  2.000;
+ int22_ar[U][A][C][A][C][U][G][C] =  1.600;
+ int22_ar[U][A][C][A][G][A][G][C] = -0.300;
+ int22_ar[U][A][C][A][G][C][G][C] =  1.100;
+ int22_ar[U][A][C][A][G][G][G][C] =  2.000;
+ int22_ar[U][A][C][A][G][U][G][C] =  0.800;
+ int22_ar[U][A][C][A][U][A][G][C] =  2.000;
+ int22_ar[U][A][C][A][U][C][G][C] =  2.000;
+ int22_ar[U][A][C][A][U][G][G][C] =  2.000;
+ int22_ar[U][A][C][A][U][U][G][C] =  2.000;
+ int22_ar[U][A][C][C][A][A][G][C] =  1.400;
+ int22_ar[U][A][C][C][A][C][G][C] =  1.800;
+ int22_ar[U][A][C][C][A][G][G][C] =  2.000;
+ int22_ar[U][A][C][C][A][U][G][C] =  1.500;
+ int22_ar[U][A][C][C][C][A][G][C] =  1.400;
+ int22_ar[U][A][C][C][C][C][G][C] =  1.900;
+ int22_ar[U][A][C][C][C][G][G][C] =  2.000;
+ int22_ar[U][A][C][C][C][U][G][C] =  1.600;
+ int22_ar[U][A][C][C][G][A][G][C] =  2.000;
+ int22_ar[U][A][C][C][G][C][G][C] =  2.000;
+ int22_ar[U][A][C][C][G][G][G][C] =  2.000;
+ int22_ar[U][A][C][C][G][U][G][C] =  2.000;
+ int22_ar[U][A][C][C][U][A][G][C] =  0.400;
+ int22_ar[U][A][C][C][U][C][G][C] =  0.900;
+ int22_ar[U][A][C][C][U][G][G][C] =  2.000;
+ int22_ar[U][A][C][C][U][U][G][C] =  0.600;
+ int22_ar[U][A][C][G][A][A][G][C] =  0.300;
+ int22_ar[U][A][C][G][A][C][G][C] =  1.700;
+ int22_ar[U][A][C][G][A][G][G][C] =  2.000;
+ int22_ar[U][A][C][G][A][U][G][C] =  1.400;
+ int22_ar[U][A][C][G][C][A][G][C] =  2.000;
+ int22_ar[U][A][C][G][C][C][G][C] =  2.000;
+ int22_ar[U][A][C][G][C][G][G][C] =  2.000;
+ int22_ar[U][A][C][G][C][U][G][C] =  2.000;
+ int22_ar[U][A][C][G][G][A][G][C] =  1.300;
+ int22_ar[U][A][C][G][G][C][G][C] =  2.400;
+ int22_ar[U][A][C][G][G][G][G][C] =  2.000;
+ int22_ar[U][A][C][G][G][U][G][C] =  2.100;
+ int22_ar[U][A][C][G][U][A][G][C] = -1.500;
+ int22_ar[U][A][C][G][U][C][G][C] =  0.000;
+ int22_ar[U][A][C][G][U][G][G][C] =  2.000;
+ int22_ar[U][A][C][G][U][U][G][C] = -0.300;
+ int22_ar[U][A][C][U][A][A][G][C] =  2.000;
+ int22_ar[U][A][C][U][A][C][G][C] =  2.000;
+ int22_ar[U][A][C][U][A][G][G][C] =  2.000;
+ int22_ar[U][A][C][U][A][U][G][C] =  2.000;
+ int22_ar[U][A][C][U][C][A][G][C] =  1.500;
+ int22_ar[U][A][C][U][C][C][G][C] =  1.900;
+ int22_ar[U][A][C][U][C][G][G][C] =  2.000;
+ int22_ar[U][A][C][U][C][U][G][C] =  1.600;
+ int22_ar[U][A][C][U][G][A][G][C] = -1.100;
+ int22_ar[U][A][C][U][G][C][G][C] =  0.400;
+ int22_ar[U][A][C][U][G][G][G][C] =  2.000;
+ int22_ar[U][A][C][U][G][U][G][C] =  0.100;
+ int22_ar[U][A][C][U][U][A][G][C] =  0.700;
+ int22_ar[U][A][C][U][U][C][G][C] =  1.100;
+ int22_ar[U][A][C][U][U][G][G][C] =  2.000;
+ int22_ar[U][A][C][U][U][U][G][C] =  0.800;
+ int22_ar[U][A][G][A][A][A][G][C] =  1.100;
+ int22_ar[U][A][G][A][A][C][G][C] =  2.000;
+ int22_ar[U][A][G][A][A][G][G][C] =  1.500;
+ int22_ar[U][A][G][A][A][U][G][C] =  1.600;
+ int22_ar[U][A][G][A][C][A][G][C] =  0.800;
+ int22_ar[U][A][G][A][C][C][G][C] =  2.000;
+ int22_ar[U][A][G][A][C][G][G][C] =  1.200;
+ int22_ar[U][A][G][A][C][U][G][C] =  0.300;
+ int22_ar[U][A][G][A][G][A][G][C] = -0.900;
+ int22_ar[U][A][G][A][G][C][G][C] =  2.000;
+ int22_ar[U][A][G][A][G][G][G][C] = -0.500;
+ int22_ar[U][A][G][A][G][U][G][C] =  0.400;
+ int22_ar[U][A][G][A][U][A][G][C] =  2.000;
+ int22_ar[U][A][G][A][U][C][G][C] =  2.000;
+ int22_ar[U][A][G][A][U][G][G][C] =  2.000;
+ int22_ar[U][A][G][A][U][U][G][C] =  2.000;
+ int22_ar[U][A][G][C][A][A][G][C] =  0.800;
+ int22_ar[U][A][G][C][A][C][G][C] =  2.000;
+ int22_ar[U][A][G][C][A][G][G][C] =  1.200;
+ int22_ar[U][A][G][C][A][U][G][C] =  0.300;
+ int22_ar[U][A][G][C][C][A][G][C] =  1.800;
+ int22_ar[U][A][G][C][C][C][G][C] =  2.000;
+ int22_ar[U][A][G][C][C][G][G][C] =  1.800;
+ int22_ar[U][A][G][C][C][U][G][C] =  1.300;
+ int22_ar[U][A][G][C][G][A][G][C] =  2.000;
+ int22_ar[U][A][G][C][G][C][G][C] =  2.000;
+ int22_ar[U][A][G][C][G][G][G][C] =  2.000;
+ int22_ar[U][A][G][C][G][U][G][C] =  2.000;
+ int22_ar[U][A][G][C][U][A][G][C] =  0.900;
+ int22_ar[U][A][G][C][U][C][G][C] =  2.000;
+ int22_ar[U][A][G][C][U][G][G][C] =  0.800;
+ int22_ar[U][A][G][C][U][U][G][C] =  0.400;
+ int22_ar[U][A][G][G][A][A][G][C] = -0.300;
+ int22_ar[U][A][G][G][A][C][G][C] =  2.000;
+ int22_ar[U][A][G][G][A][G][G][C] =  0.100;
+ int22_ar[U][A][G][G][A][U][G][C] =  1.000;
+ int22_ar[U][A][G][G][C][A][G][C] =  2.000;
+ int22_ar[U][A][G][G][C][C][G][C] =  2.000;
+ int22_ar[U][A][G][G][C][G][G][C] =  2.000;
+ int22_ar[U][A][G][G][C][U][G][C] =  2.000;
+ int22_ar[U][A][G][G][G][A][G][C] =  0.700;
+ int22_ar[U][A][G][G][G][C][G][C] =  2.000;
+ int22_ar[U][A][G][G][G][G][G][C] =  1.100;
+ int22_ar[U][A][G][G][G][U][G][C] =  1.200;
+ int22_ar[U][A][G][G][U][A][G][C] = -0.300;
+ int22_ar[U][A][G][G][U][C][G][C] =  2.000;
+ int22_ar[U][A][G][G][U][G][G][C] = -0.700;
+ int22_ar[U][A][G][G][U][U][G][C] = -2.600;
+ int22_ar[U][A][G][U][A][A][G][C] =  2.000;
+ int22_ar[U][A][G][U][A][C][G][C] =  2.000;
+ int22_ar[U][A][G][U][A][G][G][C] =  2.000;
+ int22_ar[U][A][G][U][A][U][G][C] =  2.000;
+ int22_ar[U][A][G][U][C][A][G][C] =  1.900;
+ int22_ar[U][A][G][U][C][C][G][C] =  2.000;
+ int22_ar[U][A][G][U][C][G][G][C] =  1.900;
+ int22_ar[U][A][G][U][C][U][G][C] =  1.400;
+ int22_ar[U][A][G][U][G][A][G][C] =  0.100;
+ int22_ar[U][A][G][U][G][C][G][C] =  2.000;
+ int22_ar[U][A][G][U][G][G][G][C] = -0.300;
+ int22_ar[U][A][G][U][G][U][G][C] = -2.200;
+ int22_ar[U][A][G][U][U][A][G][C] =  1.900;
+ int22_ar[U][A][G][U][U][C][G][C] =  2.000;
+ int22_ar[U][A][G][U][U][G][G][C] =  1.500;
+ int22_ar[U][A][G][U][U][U][G][C] =  1.400;
+ int22_ar[U][A][U][A][A][A][G][C] =  2.000;
+ int22_ar[U][A][U][A][A][C][G][C] =  2.700;
+ int22_ar[U][A][U][A][A][G][G][C] =  0.300;
+ int22_ar[U][A][U][A][A][U][G][C] =  2.300;
+ int22_ar[U][A][U][A][C][A][G][C] =  2.000;
+ int22_ar[U][A][U][A][C][C][G][C] =  1.900;
+ int22_ar[U][A][U][A][C][G][G][C] = -0.900;
+ int22_ar[U][A][U][A][C][U][G][C] =  1.000;
+ int22_ar[U][A][U][A][G][A][G][C] =  2.000;
+ int22_ar[U][A][U][A][G][C][G][C] =  1.100;
+ int22_ar[U][A][U][A][G][G][G][C] = -0.900;
+ int22_ar[U][A][U][A][G][U][G][C] =  1.100;
+ int22_ar[U][A][U][A][U][A][G][C] =  2.000;
+ int22_ar[U][A][U][A][U][C][G][C] =  2.000;
+ int22_ar[U][A][U][A][U][G][G][C] =  2.000;
+ int22_ar[U][A][U][A][U][U][G][C] =  2.000;
+ int22_ar[U][A][U][C][A][A][G][C] =  2.000;
+ int22_ar[U][A][U][C][A][C][G][C] =  1.800;
+ int22_ar[U][A][U][C][A][G][G][C] = -1.000;
+ int22_ar[U][A][U][C][A][U][G][C] =  1.000;
+ int22_ar[U][A][U][C][C][A][G][C] =  2.000;
+ int22_ar[U][A][U][C][C][C][G][C] =  1.900;
+ int22_ar[U][A][U][C][C][G][G][C] =  0.100;
+ int22_ar[U][A][U][C][C][U][G][C] =  1.000;
+ int22_ar[U][A][U][C][G][A][G][C] =  2.000;
+ int22_ar[U][A][U][C][G][C][G][C] =  2.000;
+ int22_ar[U][A][U][C][G][G][G][C] =  2.000;
+ int22_ar[U][A][U][C][G][U][G][C] =  2.000;
+ int22_ar[U][A][U][C][U][A][G][C] =  2.000;
+ int22_ar[U][A][U][C][U][C][G][C] =  0.900;
+ int22_ar[U][A][U][C][U][G][G][C] = -0.900;
+ int22_ar[U][A][U][C][U][U][G][C] =  0.000;
+ int22_ar[U][A][U][G][A][A][G][C] =  2.000;
+ int22_ar[U][A][U][G][A][C][G][C] =  1.700;
+ int22_ar[U][A][U][G][A][G][G][C] = -0.300;
+ int22_ar[U][A][U][G][A][U][G][C] =  1.700;
+ int22_ar[U][A][U][G][C][A][G][C] =  2.000;
+ int22_ar[U][A][U][G][C][C][G][C] =  2.000;
+ int22_ar[U][A][U][G][C][G][G][C] =  2.000;
+ int22_ar[U][A][U][G][C][U][G][C] =  2.000;
+ int22_ar[U][A][U][G][G][A][G][C] =  2.000;
+ int22_ar[U][A][U][G][G][C][G][C] =  2.400;
+ int22_ar[U][A][U][G][G][G][G][C] =  0.000;
+ int22_ar[U][A][U][G][G][U][G][C] =  1.900;
+ int22_ar[U][A][U][G][U][A][G][C] =  2.000;
+ int22_ar[U][A][U][G][U][C][G][C] =  0.000;
+ int22_ar[U][A][U][G][U][G][G][C] = -3.900;
+ int22_ar[U][A][U][G][U][U][G][C] = -0.100;
+ int22_ar[U][A][U][U][A][A][G][C] =  2.000;
+ int22_ar[U][A][U][U][A][C][G][C] =  2.000;
+ int22_ar[U][A][U][U][A][G][G][C] =  2.000;
+ int22_ar[U][A][U][U][A][U][G][C] =  2.000;
+ int22_ar[U][A][U][U][C][A][G][C] =  2.000;
+ int22_ar[U][A][U][U][C][C][G][C] =  1.900;
+ int22_ar[U][A][U][U][C][G][G][C] =  0.100;
+ int22_ar[U][A][U][U][C][U][G][C] =  1.100;
+ int22_ar[U][A][U][U][G][A][G][C] =  2.000;
+ int22_ar[U][A][U][U][G][C][G][C] =  0.400;
+ int22_ar[U][A][U][U][G][G][G][C] = -3.500;
+ int22_ar[U][A][U][U][G][U][G][C] =  0.300;
+ int22_ar[U][A][U][U][U][A][G][C] =  2.000;
+ int22_ar[U][A][U][U][U][C][G][C] =  1.100;
+ int22_ar[U][A][U][U][U][G][G][C] =  0.100;
+ int22_ar[U][A][U][U][U][U][G][C] =  0.300;
+ int22_ar[U][A][A][A][A][A][G][U] =  2.800;
+ int22_ar[U][A][A][A][A][C][G][U] =  2.800;
+ int22_ar[U][A][A][A][A][G][G][U] =  1.700;
+ int22_ar[U][A][A][A][A][U][G][U] =  2.000;
+ int22_ar[U][A][A][A][C][A][G][U] =  2.500;
+ int22_ar[U][A][A][A][C][C][G][U] =  2.500;
+ int22_ar[U][A][A][A][C][G][G][U] =  1.500;
+ int22_ar[U][A][A][A][C][U][G][U] =  2.000;
+ int22_ar[U][A][A][A][G][A][G][U] =  1.500;
+ int22_ar[U][A][A][A][G][C][G][U] =  1.500;
+ int22_ar[U][A][A][A][G][G][G][U] =  0.500;
+ int22_ar[U][A][A][A][G][U][G][U] =  2.000;
+ int22_ar[U][A][A][A][U][A][G][U] =  2.000;
+ int22_ar[U][A][A][A][U][C][G][U] =  2.000;
+ int22_ar[U][A][A][A][U][G][G][U] =  2.000;
+ int22_ar[U][A][A][A][U][U][G][U] =  2.000;
+ int22_ar[U][A][A][C][A][A][G][U] =  2.600;
+ int22_ar[U][A][A][C][A][C][G][U] =  2.600;
+ int22_ar[U][A][A][C][A][G][G][U] =  1.600;
+ int22_ar[U][A][A][C][A][U][G][U] =  2.000;
+ int22_ar[U][A][A][C][C][A][G][U] =  3.100;
+ int22_ar[U][A][A][C][C][C][G][U] =  2.500;
+ int22_ar[U][A][A][C][C][G][G][U] =  2.400;
+ int22_ar[U][A][A][C][C][U][G][U] =  2.000;
+ int22_ar[U][A][A][C][G][A][G][U] =  2.000;
+ int22_ar[U][A][A][C][G][C][G][U] =  2.000;
+ int22_ar[U][A][A][C][G][G][G][U] =  2.000;
+ int22_ar[U][A][A][C][G][U][G][U] =  2.000;
+ int22_ar[U][A][A][C][U][A][G][U] =  3.100;
+ int22_ar[U][A][A][C][U][C][G][U] =  2.500;
+ int22_ar[U][A][A][C][U][G][G][U] =  2.400;
+ int22_ar[U][A][A][C][U][U][G][U] =  2.000;
+ int22_ar[U][A][A][G][A][A][G][U] =  1.500;
+ int22_ar[U][A][A][G][A][C][G][U] =  1.500;
+ int22_ar[U][A][A][G][A][G][G][U] =  0.500;
+ int22_ar[U][A][A][G][A][U][G][U] =  2.000;
+ int22_ar[U][A][A][G][C][A][G][U] =  2.000;
+ int22_ar[U][A][A][G][C][C][G][U] =  2.000;
+ int22_ar[U][A][A][G][C][G][G][U] =  2.000;
+ int22_ar[U][A][A][G][C][U][G][U] =  2.000;
+ int22_ar[U][A][A][G][G][A][G][U] =  2.100;
+ int22_ar[U][A][A][G][G][C][G][U] =  2.100;
+ int22_ar[U][A][A][G][G][G][G][U] =  1.000;
+ int22_ar[U][A][A][G][G][U][G][U] =  2.000;
+ int22_ar[U][A][A][G][U][A][G][U] =  1.300;
+ int22_ar[U][A][A][G][U][C][G][U] =  0.300;
+ int22_ar[U][A][A][G][U][G][G][U] =  1.100;
+ int22_ar[U][A][A][G][U][U][G][U] =  2.000;
+ int22_ar[U][A][A][U][A][A][G][U] =  2.000;
+ int22_ar[U][A][A][U][A][C][G][U] =  2.000;
+ int22_ar[U][A][A][U][A][G][G][U] =  2.000;
+ int22_ar[U][A][A][U][A][U][G][U] =  2.000;
+ int22_ar[U][A][A][U][C][A][G][U] =  3.100;
+ int22_ar[U][A][A][U][C][C][G][U] =  2.500;
+ int22_ar[U][A][A][U][C][G][G][U] =  2.400;
+ int22_ar[U][A][A][U][C][U][G][U] =  2.000;
+ int22_ar[U][A][A][U][G][A][G][U] =  2.300;
+ int22_ar[U][A][A][U][G][C][G][U] =  1.300;
+ int22_ar[U][A][A][U][G][G][G][U] =  2.100;
+ int22_ar[U][A][A][U][G][U][G][U] =  2.000;
+ int22_ar[U][A][A][U][U][A][G][U] =  2.700;
+ int22_ar[U][A][A][U][U][C][G][U] =  1.700;
+ int22_ar[U][A][A][U][U][G][G][U] =  2.400;
+ int22_ar[U][A][A][U][U][U][G][U] =  2.000;
+ int22_ar[U][A][C][A][A][A][G][U] =  2.300;
+ int22_ar[U][A][C][A][A][C][G][U] =  3.400;
+ int22_ar[U][A][C][A][A][G][G][U] =  2.000;
+ int22_ar[U][A][C][A][A][U][G][U] =  3.100;
+ int22_ar[U][A][C][A][C][A][G][U] =  2.100;
+ int22_ar[U][A][C][A][C][C][G][U] =  2.500;
+ int22_ar[U][A][C][A][C][G][G][U] =  2.000;
+ int22_ar[U][A][C][A][C][U][G][U] =  2.200;
+ int22_ar[U][A][C][A][G][A][G][U] =  1.100;
+ int22_ar[U][A][C][A][G][C][G][U] =  2.500;
+ int22_ar[U][A][C][A][G][G][G][U] =  2.000;
+ int22_ar[U][A][C][A][G][U][G][U] =  2.200;
+ int22_ar[U][A][C][A][U][A][G][U] =  2.000;
+ int22_ar[U][A][C][A][U][C][G][U] =  2.000;
+ int22_ar[U][A][C][A][U][G][G][U] =  2.000;
+ int22_ar[U][A][C][A][U][U][G][U] =  2.000;
+ int22_ar[U][A][C][C][A][A][G][U] =  2.200;
+ int22_ar[U][A][C][C][A][C][G][U] =  2.600;
+ int22_ar[U][A][C][C][A][G][G][U] =  2.000;
+ int22_ar[U][A][C][C][A][U][G][U] =  2.300;
+ int22_ar[U][A][C][C][C][A][G][U] =  2.000;
+ int22_ar[U][A][C][C][C][C][G][U] =  2.500;
+ int22_ar[U][A][C][C][C][G][G][U] =  2.000;
+ int22_ar[U][A][C][C][C][U][G][U] =  2.200;
+ int22_ar[U][A][C][C][G][A][G][U] =  2.000;
+ int22_ar[U][A][C][C][G][C][G][U] =  2.000;
+ int22_ar[U][A][C][C][G][G][G][U] =  2.000;
+ int22_ar[U][A][C][C][G][U][G][U] =  2.000;
+ int22_ar[U][A][C][C][U][A][G][U] =  2.000;
+ int22_ar[U][A][C][C][U][C][G][U] =  2.500;
+ int22_ar[U][A][C][C][U][G][G][U] =  2.000;
+ int22_ar[U][A][C][C][U][U][G][U] =  2.200;
+ int22_ar[U][A][C][G][A][A][G][U] =  1.100;
+ int22_ar[U][A][C][G][A][C][G][U] =  2.500;
+ int22_ar[U][A][C][G][A][G][G][U] =  2.000;
+ int22_ar[U][A][C][G][A][U][G][U] =  2.200;
+ int22_ar[U][A][C][G][C][A][G][U] =  2.000;
+ int22_ar[U][A][C][G][C][C][G][U] =  2.000;
+ int22_ar[U][A][C][G][C][G][G][U] =  2.000;
+ int22_ar[U][A][C][G][C][U][G][U] =  2.000;
+ int22_ar[U][A][C][G][G][A][G][U] =  1.600;
+ int22_ar[U][A][C][G][G][C][G][U] =  2.700;
+ int22_ar[U][A][C][G][G][G][G][U] =  2.000;
+ int22_ar[U][A][C][G][G][U][G][U] =  2.400;
+ int22_ar[U][A][C][G][U][A][G][U] = -0.100;
+ int22_ar[U][A][C][G][U][C][G][U] =  1.300;
+ int22_ar[U][A][C][G][U][G][G][U] =  2.000;
+ int22_ar[U][A][C][G][U][U][G][U] =  1.000;
+ int22_ar[U][A][C][U][A][A][G][U] =  2.000;
+ int22_ar[U][A][C][U][A][C][G][U] =  2.000;
+ int22_ar[U][A][C][U][A][G][G][U] =  2.000;
+ int22_ar[U][A][C][U][A][U][G][U] =  2.000;
+ int22_ar[U][A][C][U][C][A][G][U] =  2.000;
+ int22_ar[U][A][C][U][C][C][G][U] =  2.500;
+ int22_ar[U][A][C][U][C][G][G][U] =  2.000;
+ int22_ar[U][A][C][U][C][U][G][U] =  2.200;
+ int22_ar[U][A][C][U][G][A][G][U] =  0.900;
+ int22_ar[U][A][C][U][G][C][G][U] =  2.300;
+ int22_ar[U][A][C][U][G][G][G][U] =  2.000;
+ int22_ar[U][A][C][U][G][U][G][U] =  2.000;
+ int22_ar[U][A][C][U][U][A][G][U] =  1.200;
+ int22_ar[U][A][C][U][U][C][G][U] =  1.700;
+ int22_ar[U][A][C][U][U][G][G][U] =  2.000;
+ int22_ar[U][A][C][U][U][U][G][U] =  1.400;
+ int22_ar[U][A][G][A][A][A][G][U] =  1.700;
+ int22_ar[U][A][G][A][A][C][G][U] =  2.000;
+ int22_ar[U][A][G][A][A][G][G][U] =  2.100;
+ int22_ar[U][A][G][A][A][U][G][U] =  2.200;
+ int22_ar[U][A][G][A][C][A][G][U] =  1.500;
+ int22_ar[U][A][G][A][C][C][G][U] =  2.000;
+ int22_ar[U][A][G][A][C][G][G][U] =  1.900;
+ int22_ar[U][A][G][A][C][U][G][U] =  1.000;
+ int22_ar[U][A][G][A][G][A][G][U] =  0.500;
+ int22_ar[U][A][G][A][G][C][G][U] =  2.000;
+ int22_ar[U][A][G][A][G][G][G][U] =  0.900;
+ int22_ar[U][A][G][A][G][U][G][U] =  1.800;
+ int22_ar[U][A][G][A][U][A][G][U] =  2.000;
+ int22_ar[U][A][G][A][U][C][G][U] =  2.000;
+ int22_ar[U][A][G][A][U][G][G][U] =  2.000;
+ int22_ar[U][A][G][A][U][U][G][U] =  2.000;
+ int22_ar[U][A][G][C][A][A][G][U] =  1.600;
+ int22_ar[U][A][G][C][A][C][G][U] =  2.000;
+ int22_ar[U][A][G][C][A][G][G][U] =  2.000;
+ int22_ar[U][A][G][C][A][U][G][U] =  1.100;
+ int22_ar[U][A][G][C][C][A][G][U] =  2.400;
+ int22_ar[U][A][G][C][C][C][G][U] =  2.000;
+ int22_ar[U][A][G][C][C][G][G][U] =  2.400;
+ int22_ar[U][A][G][C][C][U][G][U] =  1.900;
+ int22_ar[U][A][G][C][G][A][G][U] =  2.000;
+ int22_ar[U][A][G][C][G][C][G][U] =  2.000;
+ int22_ar[U][A][G][C][G][G][G][U] =  2.000;
+ int22_ar[U][A][G][C][G][U][G][U] =  2.000;
+ int22_ar[U][A][G][C][U][A][G][U] =  2.400;
+ int22_ar[U][A][G][C][U][C][G][U] =  2.000;
+ int22_ar[U][A][G][C][U][G][G][U] =  2.400;
+ int22_ar[U][A][G][C][U][U][G][U] =  1.900;
+ int22_ar[U][A][G][G][A][A][G][U] =  0.500;
+ int22_ar[U][A][G][G][A][C][G][U] =  2.000;
+ int22_ar[U][A][G][G][A][G][G][U] =  0.900;
+ int22_ar[U][A][G][G][A][U][G][U] =  1.800;
+ int22_ar[U][A][G][G][C][A][G][U] =  2.000;
+ int22_ar[U][A][G][G][C][C][G][U] =  2.000;
+ int22_ar[U][A][G][G][C][G][G][U] =  2.000;
+ int22_ar[U][A][G][G][C][U][G][U] =  2.000;
+ int22_ar[U][A][G][G][G][A][G][U] =  1.000;
+ int22_ar[U][A][G][G][G][C][G][U] =  2.000;
+ int22_ar[U][A][G][G][G][G][G][U] =  1.400;
+ int22_ar[U][A][G][G][G][U][G][U] =  1.500;
+ int22_ar[U][A][G][G][U][A][G][U] =  1.100;
+ int22_ar[U][A][G][G][U][C][G][U] =  2.000;
+ int22_ar[U][A][G][G][U][G][G][U] =  0.700;
+ int22_ar[U][A][G][G][U][U][G][U] = -1.200;
+ int22_ar[U][A][G][U][A][A][G][U] =  2.000;
+ int22_ar[U][A][G][U][A][C][G][U] =  2.000;
+ int22_ar[U][A][G][U][A][G][G][U] =  2.000;
+ int22_ar[U][A][G][U][A][U][G][U] =  2.000;
+ int22_ar[U][A][G][U][C][A][G][U] =  2.400;
+ int22_ar[U][A][G][U][C][C][G][U] =  2.000;
+ int22_ar[U][A][G][U][C][G][G][U] =  2.400;
+ int22_ar[U][A][G][U][C][U][G][U] =  1.900;
+ int22_ar[U][A][G][U][G][A][G][U] =  2.100;
+ int22_ar[U][A][G][U][G][C][G][U] =  2.000;
+ int22_ar[U][A][G][U][G][G][G][U] =  1.700;
+ int22_ar[U][A][G][U][G][U][G][U] = -0.200;
+ int22_ar[U][A][G][U][U][A][G][U] =  2.400;
+ int22_ar[U][A][G][U][U][C][G][U] =  2.000;
+ int22_ar[U][A][G][U][U][G][G][U] =  2.000;
+ int22_ar[U][A][G][U][U][U][G][U] =  1.900;
+ int22_ar[U][A][U][A][A][A][G][U] =  2.000;
+ int22_ar[U][A][U][A][A][C][G][U] =  3.400;
+ int22_ar[U][A][U][A][A][G][G][U] =  1.000;
+ int22_ar[U][A][U][A][A][U][G][U] =  2.900;
+ int22_ar[U][A][U][A][C][A][G][U] =  2.000;
+ int22_ar[U][A][U][A][C][C][G][U] =  2.500;
+ int22_ar[U][A][U][A][C][G][G][U] = -0.300;
+ int22_ar[U][A][U][A][C][U][G][U] =  1.700;
+ int22_ar[U][A][U][A][G][A][G][U] =  2.000;
+ int22_ar[U][A][U][A][G][C][G][U] =  2.500;
+ int22_ar[U][A][U][A][G][G][G][U] =  0.500;
+ int22_ar[U][A][U][A][G][U][G][U] =  2.500;
+ int22_ar[U][A][U][A][U][A][G][U] =  2.000;
+ int22_ar[U][A][U][A][U][C][G][U] =  2.000;
+ int22_ar[U][A][U][A][U][G][G][U] =  2.000;
+ int22_ar[U][A][U][A][U][U][G][U] =  2.000;
+ int22_ar[U][A][U][C][A][A][G][U] =  2.000;
+ int22_ar[U][A][U][C][A][C][G][U] =  2.600;
+ int22_ar[U][A][U][C][A][G][G][U] = -0.200;
+ int22_ar[U][A][U][C][A][U][G][U] =  1.800;
+ int22_ar[U][A][U][C][C][A][G][U] =  2.000;
+ int22_ar[U][A][U][C][C][C][G][U] =  2.500;
+ int22_ar[U][A][U][C][C][G][G][U] =  0.700;
+ int22_ar[U][A][U][C][C][U][G][U] =  1.600;
+ int22_ar[U][A][U][C][G][A][G][U] =  2.000;
+ int22_ar[U][A][U][C][G][C][G][U] =  2.000;
+ int22_ar[U][A][U][C][G][G][G][U] =  2.000;
+ int22_ar[U][A][U][C][G][U][G][U] =  2.000;
+ int22_ar[U][A][U][C][U][A][G][U] =  2.000;
+ int22_ar[U][A][U][C][U][C][G][U] =  2.500;
+ int22_ar[U][A][U][C][U][G][G][U] =  0.700;
+ int22_ar[U][A][U][C][U][U][G][U] =  1.600;
+ int22_ar[U][A][U][G][A][A][G][U] =  2.000;
+ int22_ar[U][A][U][G][A][C][G][U] =  2.500;
+ int22_ar[U][A][U][G][A][G][G][U] =  0.500;
+ int22_ar[U][A][U][G][A][U][G][U] =  2.500;
+ int22_ar[U][A][U][G][C][A][G][U] =  2.000;
+ int22_ar[U][A][U][G][C][C][G][U] =  2.000;
+ int22_ar[U][A][U][G][C][G][G][U] =  2.000;
+ int22_ar[U][A][U][G][C][U][G][U] =  2.000;
+ int22_ar[U][A][U][G][G][A][G][U] =  2.000;
+ int22_ar[U][A][U][G][G][C][G][U] =  2.700;
+ int22_ar[U][A][U][G][G][G][G][U] =  0.300;
+ int22_ar[U][A][U][G][G][U][G][U] =  2.200;
+ int22_ar[U][A][U][G][U][A][G][U] =  2.000;
+ int22_ar[U][A][U][G][U][C][G][U] =  1.300;
+ int22_ar[U][A][U][G][U][G][G][U] = -2.500;
+ int22_ar[U][A][U][G][U][U][G][U] =  1.300;
+ int22_ar[U][A][U][U][A][A][G][U] =  2.000;
+ int22_ar[U][A][U][U][A][C][G][U] =  2.000;
+ int22_ar[U][A][U][U][A][G][G][U] =  2.000;
+ int22_ar[U][A][U][U][A][U][G][U] =  2.000;
+ int22_ar[U][A][U][U][C][A][G][U] =  2.000;
+ int22_ar[U][A][U][U][C][C][G][U] =  2.500;
+ int22_ar[U][A][U][U][C][G][G][U] =  0.700;
+ int22_ar[U][A][U][U][C][U][G][U] =  1.600;
+ int22_ar[U][A][U][U][G][A][G][U] =  2.000;
+ int22_ar[U][A][U][U][G][C][G][U] =  2.300;
+ int22_ar[U][A][U][U][G][G][G][U] = -1.500;
+ int22_ar[U][A][U][U][G][U][G][U] =  2.300;
+ int22_ar[U][A][U][U][U][A][G][U] =  2.000;
+ int22_ar[U][A][U][U][U][C][G][U] =  1.700;
+ int22_ar[U][A][U][U][U][G][G][U] =  0.700;
+ int22_ar[U][A][U][U][U][U][G][U] =  0.800;
+ int22_ar[U][A][A][A][A][A][U][A] =  2.800;
+ int22_ar[U][A][A][A][A][C][U][A] =  2.800;
+ int22_ar[U][A][A][A][A][G][U][A] =  1.700;
+ int22_ar[U][A][A][A][A][U][U][A] =  2.000;
+ int22_ar[U][A][A][A][C][A][U][A] =  2.300;
+ int22_ar[U][A][A][A][C][C][U][A] =  2.300;
+ int22_ar[U][A][A][A][C][G][U][A] =  1.300;
+ int22_ar[U][A][A][A][C][U][U][A] =  2.000;
+ int22_ar[U][A][A][A][G][A][U][A] =  1.700;
+ int22_ar[U][A][A][A][G][C][U][A] =  1.700;
+ int22_ar[U][A][A][A][G][G][U][A] =  0.700;
+ int22_ar[U][A][A][A][G][U][U][A] =  2.000;
+ int22_ar[U][A][A][A][U][A][U][A] =  2.000;
+ int22_ar[U][A][A][A][U][C][U][A] =  2.000;
+ int22_ar[U][A][A][A][U][G][U][A] =  2.000;
+ int22_ar[U][A][A][A][U][U][U][A] =  2.000;
+ int22_ar[U][A][A][C][A][A][U][A] =  2.800;
+ int22_ar[U][A][A][C][A][C][U][A] =  2.800;
+ int22_ar[U][A][A][C][A][G][U][A] =  1.700;
+ int22_ar[U][A][A][C][A][U][U][A] =  2.000;
+ int22_ar[U][A][A][C][C][A][U][A] =  3.400;
+ int22_ar[U][A][A][C][C][C][U][A] =  2.800;
+ int22_ar[U][A][A][C][C][G][U][A] =  2.700;
+ int22_ar[U][A][A][C][C][U][U][A] =  2.000;
+ int22_ar[U][A][A][C][G][A][U][A] =  2.000;
+ int22_ar[U][A][A][C][G][C][U][A] =  2.000;
+ int22_ar[U][A][A][C][G][G][U][A] =  2.000;
+ int22_ar[U][A][A][C][G][U][U][A] =  2.000;
+ int22_ar[U][A][A][C][U][A][U][A] =  3.400;
+ int22_ar[U][A][A][C][U][C][U][A] =  2.800;
+ int22_ar[U][A][A][C][U][G][U][A] =  2.700;
+ int22_ar[U][A][A][C][U][U][U][A] =  2.000;
+ int22_ar[U][A][A][G][A][A][U][A] =  1.700;
+ int22_ar[U][A][A][G][A][C][U][A] =  1.700;
+ int22_ar[U][A][A][G][A][G][U][A] =  0.700;
+ int22_ar[U][A][A][G][A][U][U][A] =  2.000;
+ int22_ar[U][A][A][G][C][A][U][A] =  2.000;
+ int22_ar[U][A][A][G][C][C][U][A] =  2.000;
+ int22_ar[U][A][A][G][C][G][U][A] =  2.000;
+ int22_ar[U][A][A][G][C][U][U][A] =  2.000;
+ int22_ar[U][A][A][G][G][A][U][A] =  2.100;
+ int22_ar[U][A][A][G][G][C][U][A] =  2.100;
+ int22_ar[U][A][A][G][G][G][U][A] =  1.100;
+ int22_ar[U][A][A][G][G][U][U][A] =  2.000;
+ int22_ar[U][A][A][G][U][A][U][A] =  1.000;
+ int22_ar[U][A][A][G][U][C][U][A] =  0.000;
+ int22_ar[U][A][A][G][U][G][U][A] =  0.700;
+ int22_ar[U][A][A][G][U][U][U][A] =  2.000;
+ int22_ar[U][A][A][U][A][A][U][A] =  2.000;
+ int22_ar[U][A][A][U][A][C][U][A] =  2.000;
+ int22_ar[U][A][A][U][A][G][U][A] =  2.000;
+ int22_ar[U][A][A][U][A][U][U][A] =  2.000;
+ int22_ar[U][A][A][U][C][A][U][A] =  3.100;
+ int22_ar[U][A][A][U][C][C][U][A] =  2.500;
+ int22_ar[U][A][A][U][C][G][U][A] =  2.400;
+ int22_ar[U][A][A][U][C][U][U][A] =  2.000;
+ int22_ar[U][A][A][U][G][A][U][A] =  2.200;
+ int22_ar[U][A][A][U][G][C][U][A] =  1.200;
+ int22_ar[U][A][A][U][G][G][U][A] =  2.000;
+ int22_ar[U][A][A][U][G][U][U][A] =  2.000;
+ int22_ar[U][A][A][U][U][A][U][A] =  2.900;
+ int22_ar[U][A][A][U][U][C][U][A] =  1.900;
+ int22_ar[U][A][A][U][U][G][U][A] =  2.700;
+ int22_ar[U][A][A][U][U][U][U][A] =  2.000;
+ int22_ar[U][A][C][A][A][A][U][A] =  2.300;
+ int22_ar[U][A][C][A][A][C][U][A] =  3.400;
+ int22_ar[U][A][C][A][A][G][U][A] =  2.000;
+ int22_ar[U][A][C][A][A][U][U][A] =  3.100;
+ int22_ar[U][A][C][A][C][A][U][A] =  1.900;
+ int22_ar[U][A][C][A][C][C][U][A] =  2.300;
+ int22_ar[U][A][C][A][C][G][U][A] =  2.000;
+ int22_ar[U][A][C][A][C][U][U][A] =  2.000;
+ int22_ar[U][A][C][A][G][A][U][A] =  1.300;
+ int22_ar[U][A][C][A][G][C][U][A] =  2.700;
+ int22_ar[U][A][C][A][G][G][U][A] =  2.000;
+ int22_ar[U][A][C][A][G][U][U][A] =  2.400;
+ int22_ar[U][A][C][A][U][A][U][A] =  2.000;
+ int22_ar[U][A][C][A][U][C][U][A] =  2.000;
+ int22_ar[U][A][C][A][U][G][U][A] =  2.000;
+ int22_ar[U][A][C][A][U][U][U][A] =  2.000;
+ int22_ar[U][A][C][C][A][A][U][A] =  2.300;
+ int22_ar[U][A][C][C][A][C][U][A] =  2.800;
+ int22_ar[U][A][C][C][A][G][U][A] =  2.000;
+ int22_ar[U][A][C][C][A][U][U][A] =  2.500;
+ int22_ar[U][A][C][C][C][A][U][A] =  2.300;
+ int22_ar[U][A][C][C][C][C][U][A] =  2.800;
+ int22_ar[U][A][C][C][C][G][U][A] =  2.000;
+ int22_ar[U][A][C][C][C][U][U][A] =  2.500;
+ int22_ar[U][A][C][C][G][A][U][A] =  2.000;
+ int22_ar[U][A][C][C][G][C][U][A] =  2.000;
+ int22_ar[U][A][C][C][G][G][U][A] =  2.000;
+ int22_ar[U][A][C][C][G][U][U][A] =  2.000;
+ int22_ar[U][A][C][C][U][A][U][A] =  2.300;
+ int22_ar[U][A][C][C][U][C][U][A] =  2.800;
+ int22_ar[U][A][C][C][U][G][U][A] =  2.000;
+ int22_ar[U][A][C][C][U][U][U][A] =  2.500;
+ int22_ar[U][A][C][G][A][A][U][A] =  1.300;
+ int22_ar[U][A][C][G][A][C][U][A] =  2.700;
+ int22_ar[U][A][C][G][A][G][U][A] =  2.000;
+ int22_ar[U][A][C][G][A][U][U][A] =  2.400;
+ int22_ar[U][A][C][G][C][A][U][A] =  2.000;
+ int22_ar[U][A][C][G][C][C][U][A] =  2.000;
+ int22_ar[U][A][C][G][C][G][U][A] =  2.000;
+ int22_ar[U][A][C][G][C][U][U][A] =  2.000;
+ int22_ar[U][A][C][G][G][A][U][A] =  1.700;
+ int22_ar[U][A][C][G][G][C][U][A] =  2.700;
+ int22_ar[U][A][C][G][G][G][U][A] =  2.000;
+ int22_ar[U][A][C][G][G][U][U][A] =  2.400;
+ int22_ar[U][A][C][G][U][A][U][A] = -0.500;
+ int22_ar[U][A][C][G][U][C][U][A] =  1.000;
+ int22_ar[U][A][C][G][U][G][U][A] =  2.000;
+ int22_ar[U][A][C][G][U][U][U][A] =  0.700;
+ int22_ar[U][A][C][U][A][A][U][A] =  2.000;
+ int22_ar[U][A][C][U][A][C][U][A] =  2.000;
+ int22_ar[U][A][C][U][A][G][U][A] =  2.000;
+ int22_ar[U][A][C][U][A][U][U][A] =  2.000;
+ int22_ar[U][A][C][U][C][A][U][A] =  2.000;
+ int22_ar[U][A][C][U][C][C][U][A] =  2.500;
+ int22_ar[U][A][C][U][C][G][U][A] =  2.000;
+ int22_ar[U][A][C][U][C][U][U][A] =  2.200;
+ int22_ar[U][A][C][U][G][A][U][A] =  0.800;
+ int22_ar[U][A][C][U][G][C][U][A] =  2.200;
+ int22_ar[U][A][C][U][G][G][U][A] =  2.000;
+ int22_ar[U][A][C][U][G][U][U][A] =  1.900;
+ int22_ar[U][A][C][U][U][A][U][A] =  1.500;
+ int22_ar[U][A][C][U][U][C][U][A] =  1.900;
+ int22_ar[U][A][C][U][U][G][U][A] =  2.000;
+ int22_ar[U][A][C][U][U][U][U][A] =  1.600;
+ int22_ar[U][A][G][A][A][A][U][A] =  1.700;
+ int22_ar[U][A][G][A][A][C][U][A] =  2.000;
+ int22_ar[U][A][G][A][A][G][U][A] =  2.100;
+ int22_ar[U][A][G][A][A][U][U][A] =  2.200;
+ int22_ar[U][A][G][A][C][A][U][A] =  1.300;
+ int22_ar[U][A][G][A][C][C][U][A] =  2.000;
+ int22_ar[U][A][G][A][C][G][U][A] =  1.700;
+ int22_ar[U][A][G][A][C][U][U][A] =  0.800;
+ int22_ar[U][A][G][A][G][A][U][A] =  0.700;
+ int22_ar[U][A][G][A][G][C][U][A] =  2.000;
+ int22_ar[U][A][G][A][G][G][U][A] =  1.100;
+ int22_ar[U][A][G][A][G][U][U][A] =  2.000;
+ int22_ar[U][A][G][A][U][A][U][A] =  2.000;
+ int22_ar[U][A][G][A][U][C][U][A] =  2.000;
+ int22_ar[U][A][G][A][U][G][U][A] =  2.000;
+ int22_ar[U][A][G][A][U][U][U][A] =  2.000;
+ int22_ar[U][A][G][C][A][A][U][A] =  1.700;
+ int22_ar[U][A][G][C][A][C][U][A] =  2.000;
+ int22_ar[U][A][G][C][A][G][U][A] =  2.100;
+ int22_ar[U][A][G][C][A][U][U][A] =  1.200;
+ int22_ar[U][A][G][C][C][A][U][A] =  2.700;
+ int22_ar[U][A][G][C][C][C][U][A] =  2.000;
+ int22_ar[U][A][G][C][C][G][U][A] =  2.700;
+ int22_ar[U][A][G][C][C][U][U][A] =  2.200;
+ int22_ar[U][A][G][C][G][A][U][A] =  2.000;
+ int22_ar[U][A][G][C][G][C][U][A] =  2.000;
+ int22_ar[U][A][G][C][G][G][U][A] =  2.000;
+ int22_ar[U][A][G][C][G][U][U][A] =  2.000;
+ int22_ar[U][A][G][C][U][A][U][A] =  2.700;
+ int22_ar[U][A][G][C][U][C][U][A] =  2.000;
+ int22_ar[U][A][G][C][U][G][U][A] =  2.700;
+ int22_ar[U][A][G][C][U][U][U][A] =  2.200;
+ int22_ar[U][A][G][G][A][A][U][A] =  0.700;
+ int22_ar[U][A][G][G][A][C][U][A] =  2.000;
+ int22_ar[U][A][G][G][A][G][U][A] =  1.100;
+ int22_ar[U][A][G][G][A][U][U][A] =  2.000;
+ int22_ar[U][A][G][G][C][A][U][A] =  2.000;
+ int22_ar[U][A][G][G][C][C][U][A] =  2.000;
+ int22_ar[U][A][G][G][C][G][U][A] =  2.000;
+ int22_ar[U][A][G][G][C][U][U][A] =  2.000;
+ int22_ar[U][A][G][G][G][A][U][A] =  1.100;
+ int22_ar[U][A][G][G][G][C][U][A] =  2.000;
+ int22_ar[U][A][G][G][G][G][U][A] =  1.500;
+ int22_ar[U][A][G][G][G][U][U][A] =  1.600;
+ int22_ar[U][A][G][G][U][A][U][A] =  0.700;
+ int22_ar[U][A][G][G][U][C][U][A] =  2.000;
+ int22_ar[U][A][G][G][U][G][U][A] =  0.300;
+ int22_ar[U][A][G][G][U][U][U][A] = -1.600;
+ int22_ar[U][A][G][U][A][A][U][A] =  2.000;
+ int22_ar[U][A][G][U][A][C][U][A] =  2.000;
+ int22_ar[U][A][G][U][A][G][U][A] =  2.000;
+ int22_ar[U][A][G][U][A][U][U][A] =  2.000;
+ int22_ar[U][A][G][U][C][A][U][A] =  2.400;
+ int22_ar[U][A][G][U][C][C][U][A] =  2.000;
+ int22_ar[U][A][G][U][C][G][U][A] =  2.400;
+ int22_ar[U][A][G][U][C][U][U][A] =  1.900;
+ int22_ar[U][A][G][U][G][A][U][A] =  2.000;
+ int22_ar[U][A][G][U][G][C][U][A] =  2.000;
+ int22_ar[U][A][G][U][G][G][U][A] =  1.600;
+ int22_ar[U][A][G][U][G][U][U][A] = -0.300;
+ int22_ar[U][A][G][U][U][A][U][A] =  2.700;
+ int22_ar[U][A][G][U][U][C][U][A] =  2.000;
+ int22_ar[U][A][G][U][U][G][U][A] =  2.300;
+ int22_ar[U][A][G][U][U][U][U][A] =  2.200;
+ int22_ar[U][A][U][A][A][A][U][A] =  2.000;
+ int22_ar[U][A][U][A][A][C][U][A] =  3.400;
+ int22_ar[U][A][U][A][A][G][U][A] =  1.000;
+ int22_ar[U][A][U][A][A][U][U][A] =  2.900;
+ int22_ar[U][A][U][A][C][A][U][A] =  2.000;
+ int22_ar[U][A][U][A][C][C][U][A] =  2.300;
+ int22_ar[U][A][U][A][C][G][U][A] = -0.500;
+ int22_ar[U][A][U][A][C][U][U][A] =  1.500;
+ int22_ar[U][A][U][A][G][A][U][A] =  2.000;
+ int22_ar[U][A][U][A][G][C][U][A] =  2.700;
+ int22_ar[U][A][U][A][G][G][U][A] =  0.700;
+ int22_ar[U][A][U][A][G][U][U][A] =  2.700;
+ int22_ar[U][A][U][A][U][A][U][A] =  2.000;
+ int22_ar[U][A][U][A][U][C][U][A] =  2.000;
+ int22_ar[U][A][U][A][U][G][U][A] =  2.000;
+ int22_ar[U][A][U][A][U][U][U][A] =  2.000;
+ int22_ar[U][A][U][C][A][A][U][A] =  2.000;
+ int22_ar[U][A][U][C][A][C][U][A] =  2.800;
+ int22_ar[U][A][U][C][A][G][U][A] =  0.000;
+ int22_ar[U][A][U][C][A][U][U][A] =  1.900;
+ int22_ar[U][A][U][C][C][A][U][A] =  2.000;
+ int22_ar[U][A][U][C][C][C][U][A] =  2.800;
+ int22_ar[U][A][U][C][C][G][U][A] =  1.000;
+ int22_ar[U][A][U][C][C][U][U][A] =  1.900;
+ int22_ar[U][A][U][C][G][A][U][A] =  2.000;
+ int22_ar[U][A][U][C][G][C][U][A] =  2.000;
+ int22_ar[U][A][U][C][G][G][U][A] =  2.000;
+ int22_ar[U][A][U][C][G][U][U][A] =  2.000;
+ int22_ar[U][A][U][C][U][A][U][A] =  2.000;
+ int22_ar[U][A][U][C][U][C][U][A] =  2.800;
+ int22_ar[U][A][U][C][U][G][U][A] =  1.000;
+ int22_ar[U][A][U][C][U][U][U][A] =  1.900;
+ int22_ar[U][A][U][G][A][A][U][A] =  2.000;
+ int22_ar[U][A][U][G][A][C][U][A] =  2.700;
+ int22_ar[U][A][U][G][A][G][U][A] =  0.700;
+ int22_ar[U][A][U][G][A][U][U][A] =  2.700;
+ int22_ar[U][A][U][G][C][A][U][A] =  2.000;
+ int22_ar[U][A][U][G][C][C][U][A] =  2.000;
+ int22_ar[U][A][U][G][C][G][U][A] =  2.000;
+ int22_ar[U][A][U][G][C][U][U][A] =  2.000;
+ int22_ar[U][A][U][G][G][A][U][A] =  2.000;
+ int22_ar[U][A][U][G][G][C][U][A] =  2.700;
+ int22_ar[U][A][U][G][G][G][U][A] =  0.300;
+ int22_ar[U][A][U][G][G][U][U][A] =  2.300;
+ int22_ar[U][A][U][G][U][A][U][A] =  2.000;
+ int22_ar[U][A][U][G][U][C][U][A] =  1.000;
+ int22_ar[U][A][U][G][U][G][U][A] = -2.900;
+ int22_ar[U][A][U][G][U][U][U][A] =  0.900;
+ int22_ar[U][A][U][U][A][A][U][A] =  2.000;
+ int22_ar[U][A][U][U][A][C][U][A] =  2.000;
+ int22_ar[U][A][U][U][A][G][U][A] =  2.000;
+ int22_ar[U][A][U][U][A][U][U][A] =  2.000;
+ int22_ar[U][A][U][U][C][A][U][A] =  2.000;
+ int22_ar[U][A][U][U][C][C][U][A] =  2.500;
+ int22_ar[U][A][U][U][C][G][U][A] =  0.700;
+ int22_ar[U][A][U][U][C][U][U][A] =  1.600;
+ int22_ar[U][A][U][U][G][A][U][A] =  2.000;
+ int22_ar[U][A][U][U][G][C][U][A] =  2.200;
+ int22_ar[U][A][U][U][G][G][U][A] = -1.600;
+ int22_ar[U][A][U][U][G][U][U][A] =  2.200;
+ int22_ar[U][A][U][U][U][A][U][A] =  2.000;
+ int22_ar[U][A][U][U][U][C][U][A] =  1.900;
+ int22_ar[U][A][U][U][U][G][U][A] =  0.900;
+ int22_ar[U][A][U][U][U][U][U][A] =  1.100;
+ int22_ar[U][A][A][A][A][A][U][G] =  2.800;
+ int22_ar[U][A][A][A][A][C][U][G] =  2.800;
+ int22_ar[U][A][A][A][A][G][U][G] =  1.700;
+ int22_ar[U][A][A][A][A][U][U][G] =  2.000;
+ int22_ar[U][A][A][A][C][A][U][G] =  2.300;
+ int22_ar[U][A][A][A][C][C][U][G] =  2.300;
+ int22_ar[U][A][A][A][C][G][U][G] =  1.300;
+ int22_ar[U][A][A][A][C][U][U][G] =  2.000;
+ int22_ar[U][A][A][A][G][A][U][G] =  1.700;
+ int22_ar[U][A][A][A][G][C][U][G] =  1.700;
+ int22_ar[U][A][A][A][G][G][U][G] =  0.700;
+ int22_ar[U][A][A][A][G][U][U][G] =  2.000;
+ int22_ar[U][A][A][A][U][A][U][G] =  2.000;
+ int22_ar[U][A][A][A][U][C][U][G] =  2.000;
+ int22_ar[U][A][A][A][U][G][U][G] =  2.000;
+ int22_ar[U][A][A][A][U][U][U][G] =  2.000;
+ int22_ar[U][A][A][C][A][A][U][G] =  2.800;
+ int22_ar[U][A][A][C][A][C][U][G] =  2.800;
+ int22_ar[U][A][A][C][A][G][U][G] =  1.700;
+ int22_ar[U][A][A][C][A][U][U][G] =  2.000;
+ int22_ar[U][A][A][C][C][A][U][G] =  3.400;
+ int22_ar[U][A][A][C][C][C][U][G] =  2.800;
+ int22_ar[U][A][A][C][C][G][U][G] =  2.700;
+ int22_ar[U][A][A][C][C][U][U][G] =  2.000;
+ int22_ar[U][A][A][C][G][A][U][G] =  2.000;
+ int22_ar[U][A][A][C][G][C][U][G] =  2.000;
+ int22_ar[U][A][A][C][G][G][U][G] =  2.000;
+ int22_ar[U][A][A][C][G][U][U][G] =  2.000;
+ int22_ar[U][A][A][C][U][A][U][G] =  3.400;
+ int22_ar[U][A][A][C][U][C][U][G] =  2.800;
+ int22_ar[U][A][A][C][U][G][U][G] =  2.700;
+ int22_ar[U][A][A][C][U][U][U][G] =  2.000;
+ int22_ar[U][A][A][G][A][A][U][G] =  1.700;
+ int22_ar[U][A][A][G][A][C][U][G] =  1.700;
+ int22_ar[U][A][A][G][A][G][U][G] =  0.700;
+ int22_ar[U][A][A][G][A][U][U][G] =  2.000;
+ int22_ar[U][A][A][G][C][A][U][G] =  2.000;
+ int22_ar[U][A][A][G][C][C][U][G] =  2.000;
+ int22_ar[U][A][A][G][C][G][U][G] =  2.000;
+ int22_ar[U][A][A][G][C][U][U][G] =  2.000;
+ int22_ar[U][A][A][G][G][A][U][G] =  2.100;
+ int22_ar[U][A][A][G][G][C][U][G] =  2.100;
+ int22_ar[U][A][A][G][G][G][U][G] =  1.100;
+ int22_ar[U][A][A][G][G][U][U][G] =  2.000;
+ int22_ar[U][A][A][G][U][A][U][G] =  1.000;
+ int22_ar[U][A][A][G][U][C][U][G] =  0.000;
+ int22_ar[U][A][A][G][U][G][U][G] =  0.700;
+ int22_ar[U][A][A][G][U][U][U][G] =  2.000;
+ int22_ar[U][A][A][U][A][A][U][G] =  2.000;
+ int22_ar[U][A][A][U][A][C][U][G] =  2.000;
+ int22_ar[U][A][A][U][A][G][U][G] =  2.000;
+ int22_ar[U][A][A][U][A][U][U][G] =  2.000;
+ int22_ar[U][A][A][U][C][A][U][G] =  3.100;
+ int22_ar[U][A][A][U][C][C][U][G] =  2.500;
+ int22_ar[U][A][A][U][C][G][U][G] =  2.400;
+ int22_ar[U][A][A][U][C][U][U][G] =  2.000;
+ int22_ar[U][A][A][U][G][A][U][G] =  2.200;
+ int22_ar[U][A][A][U][G][C][U][G] =  1.200;
+ int22_ar[U][A][A][U][G][G][U][G] =  2.000;
+ int22_ar[U][A][A][U][G][U][U][G] =  2.000;
+ int22_ar[U][A][A][U][U][A][U][G] =  2.900;
+ int22_ar[U][A][A][U][U][C][U][G] =  1.900;
+ int22_ar[U][A][A][U][U][G][U][G] =  2.700;
+ int22_ar[U][A][A][U][U][U][U][G] =  2.000;
+ int22_ar[U][A][C][A][A][A][U][G] =  2.300;
+ int22_ar[U][A][C][A][A][C][U][G] =  3.400;
+ int22_ar[U][A][C][A][A][G][U][G] =  2.000;
+ int22_ar[U][A][C][A][A][U][U][G] =  3.100;
+ int22_ar[U][A][C][A][C][A][U][G] =  1.900;
+ int22_ar[U][A][C][A][C][C][U][G] =  2.300;
+ int22_ar[U][A][C][A][C][G][U][G] =  2.000;
+ int22_ar[U][A][C][A][C][U][U][G] =  2.000;
+ int22_ar[U][A][C][A][G][A][U][G] =  1.300;
+ int22_ar[U][A][C][A][G][C][U][G] =  2.700;
+ int22_ar[U][A][C][A][G][G][U][G] =  2.000;
+ int22_ar[U][A][C][A][G][U][U][G] =  2.400;
+ int22_ar[U][A][C][A][U][A][U][G] =  2.000;
+ int22_ar[U][A][C][A][U][C][U][G] =  2.000;
+ int22_ar[U][A][C][A][U][G][U][G] =  2.000;
+ int22_ar[U][A][C][A][U][U][U][G] =  2.000;
+ int22_ar[U][A][C][C][A][A][U][G] =  2.300;
+ int22_ar[U][A][C][C][A][C][U][G] =  2.800;
+ int22_ar[U][A][C][C][A][G][U][G] =  2.000;
+ int22_ar[U][A][C][C][A][U][U][G] =  2.500;
+ int22_ar[U][A][C][C][C][A][U][G] =  2.300;
+ int22_ar[U][A][C][C][C][C][U][G] =  2.800;
+ int22_ar[U][A][C][C][C][G][U][G] =  2.000;
+ int22_ar[U][A][C][C][C][U][U][G] =  2.500;
+ int22_ar[U][A][C][C][G][A][U][G] =  2.000;
+ int22_ar[U][A][C][C][G][C][U][G] =  2.000;
+ int22_ar[U][A][C][C][G][G][U][G] =  2.000;
+ int22_ar[U][A][C][C][G][U][U][G] =  2.000;
+ int22_ar[U][A][C][C][U][A][U][G] =  2.300;
+ int22_ar[U][A][C][C][U][C][U][G] =  2.800;
+ int22_ar[U][A][C][C][U][G][U][G] =  2.000;
+ int22_ar[U][A][C][C][U][U][U][G] =  2.500;
+ int22_ar[U][A][C][G][A][A][U][G] =  1.300;
+ int22_ar[U][A][C][G][A][C][U][G] =  2.700;
+ int22_ar[U][A][C][G][A][G][U][G] =  2.000;
+ int22_ar[U][A][C][G][A][U][U][G] =  2.400;
+ int22_ar[U][A][C][G][C][A][U][G] =  2.000;
+ int22_ar[U][A][C][G][C][C][U][G] =  2.000;
+ int22_ar[U][A][C][G][C][G][U][G] =  2.000;
+ int22_ar[U][A][C][G][C][U][U][G] =  2.000;
+ int22_ar[U][A][C][G][G][A][U][G] =  1.700;
+ int22_ar[U][A][C][G][G][C][U][G] =  2.700;
+ int22_ar[U][A][C][G][G][G][U][G] =  2.000;
+ int22_ar[U][A][C][G][G][U][U][G] =  2.400;
+ int22_ar[U][A][C][G][U][A][U][G] = -0.500;
+ int22_ar[U][A][C][G][U][C][U][G] =  1.000;
+ int22_ar[U][A][C][G][U][G][U][G] =  2.000;
+ int22_ar[U][A][C][G][U][U][U][G] =  0.700;
+ int22_ar[U][A][C][U][A][A][U][G] =  2.000;
+ int22_ar[U][A][C][U][A][C][U][G] =  2.000;
+ int22_ar[U][A][C][U][A][G][U][G] =  2.000;
+ int22_ar[U][A][C][U][A][U][U][G] =  2.000;
+ int22_ar[U][A][C][U][C][A][U][G] =  2.000;
+ int22_ar[U][A][C][U][C][C][U][G] =  2.500;
+ int22_ar[U][A][C][U][C][G][U][G] =  2.000;
+ int22_ar[U][A][C][U][C][U][U][G] =  2.200;
+ int22_ar[U][A][C][U][G][A][U][G] =  0.800;
+ int22_ar[U][A][C][U][G][C][U][G] =  2.200;
+ int22_ar[U][A][C][U][G][G][U][G] =  2.000;
+ int22_ar[U][A][C][U][G][U][U][G] =  1.900;
+ int22_ar[U][A][C][U][U][A][U][G] =  1.500;
+ int22_ar[U][A][C][U][U][C][U][G] =  1.900;
+ int22_ar[U][A][C][U][U][G][U][G] =  2.000;
+ int22_ar[U][A][C][U][U][U][U][G] =  1.600;
+ int22_ar[U][A][G][A][A][A][U][G] =  1.700;
+ int22_ar[U][A][G][A][A][C][U][G] =  2.000;
+ int22_ar[U][A][G][A][A][G][U][G] =  2.100;
+ int22_ar[U][A][G][A][A][U][U][G] =  2.200;
+ int22_ar[U][A][G][A][C][A][U][G] =  1.300;
+ int22_ar[U][A][G][A][C][C][U][G] =  2.000;
+ int22_ar[U][A][G][A][C][G][U][G] =  1.700;
+ int22_ar[U][A][G][A][C][U][U][G] =  0.800;
+ int22_ar[U][A][G][A][G][A][U][G] =  0.700;
+ int22_ar[U][A][G][A][G][C][U][G] =  2.000;
+ int22_ar[U][A][G][A][G][G][U][G] =  1.100;
+ int22_ar[U][A][G][A][G][U][U][G] =  2.000;
+ int22_ar[U][A][G][A][U][A][U][G] =  2.000;
+ int22_ar[U][A][G][A][U][C][U][G] =  2.000;
+ int22_ar[U][A][G][A][U][G][U][G] =  2.000;
+ int22_ar[U][A][G][A][U][U][U][G] =  2.000;
+ int22_ar[U][A][G][C][A][A][U][G] =  1.700;
+ int22_ar[U][A][G][C][A][C][U][G] =  2.000;
+ int22_ar[U][A][G][C][A][G][U][G] =  2.100;
+ int22_ar[U][A][G][C][A][U][U][G] =  1.200;
+ int22_ar[U][A][G][C][C][A][U][G] =  2.700;
+ int22_ar[U][A][G][C][C][C][U][G] =  2.000;
+ int22_ar[U][A][G][C][C][G][U][G] =  2.700;
+ int22_ar[U][A][G][C][C][U][U][G] =  2.200;
+ int22_ar[U][A][G][C][G][A][U][G] =  2.000;
+ int22_ar[U][A][G][C][G][C][U][G] =  2.000;
+ int22_ar[U][A][G][C][G][G][U][G] =  2.000;
+ int22_ar[U][A][G][C][G][U][U][G] =  2.000;
+ int22_ar[U][A][G][C][U][A][U][G] =  2.700;
+ int22_ar[U][A][G][C][U][C][U][G] =  2.000;
+ int22_ar[U][A][G][C][U][G][U][G] =  2.700;
+ int22_ar[U][A][G][C][U][U][U][G] =  2.200;
+ int22_ar[U][A][G][G][A][A][U][G] =  0.700;
+ int22_ar[U][A][G][G][A][C][U][G] =  2.000;
+ int22_ar[U][A][G][G][A][G][U][G] =  1.100;
+ int22_ar[U][A][G][G][A][U][U][G] =  2.000;
+ int22_ar[U][A][G][G][C][A][U][G] =  2.000;
+ int22_ar[U][A][G][G][C][C][U][G] =  2.000;
+ int22_ar[U][A][G][G][C][G][U][G] =  2.000;
+ int22_ar[U][A][G][G][C][U][U][G] =  2.000;
+ int22_ar[U][A][G][G][G][A][U][G] =  1.100;
+ int22_ar[U][A][G][G][G][C][U][G] =  2.000;
+ int22_ar[U][A][G][G][G][G][U][G] =  1.500;
+ int22_ar[U][A][G][G][G][U][U][G] =  1.600;
+ int22_ar[U][A][G][G][U][A][U][G] =  0.700;
+ int22_ar[U][A][G][G][U][C][U][G] =  2.000;
+ int22_ar[U][A][G][G][U][G][U][G] =  0.300;
+ int22_ar[U][A][G][G][U][U][U][G] = -1.600;
+ int22_ar[U][A][G][U][A][A][U][G] =  2.000;
+ int22_ar[U][A][G][U][A][C][U][G] =  2.000;
+ int22_ar[U][A][G][U][A][G][U][G] =  2.000;
+ int22_ar[U][A][G][U][A][U][U][G] =  2.000;
+ int22_ar[U][A][G][U][C][A][U][G] =  2.400;
+ int22_ar[U][A][G][U][C][C][U][G] =  2.000;
+ int22_ar[U][A][G][U][C][G][U][G] =  2.400;
+ int22_ar[U][A][G][U][C][U][U][G] =  1.900;
+ int22_ar[U][A][G][U][G][A][U][G] =  2.000;
+ int22_ar[U][A][G][U][G][C][U][G] =  2.000;
+ int22_ar[U][A][G][U][G][G][U][G] =  1.600;
+ int22_ar[U][A][G][U][G][U][U][G] = -0.300;
+ int22_ar[U][A][G][U][U][A][U][G] =  2.700;
+ int22_ar[U][A][G][U][U][C][U][G] =  2.000;
+ int22_ar[U][A][G][U][U][G][U][G] =  2.300;
+ int22_ar[U][A][G][U][U][U][U][G] =  2.200;
+ int22_ar[U][A][U][A][A][A][U][G] =  2.000;
+ int22_ar[U][A][U][A][A][C][U][G] =  3.400;
+ int22_ar[U][A][U][A][A][G][U][G] =  1.000;
+ int22_ar[U][A][U][A][A][U][U][G] =  2.900;
+ int22_ar[U][A][U][A][C][A][U][G] =  2.000;
+ int22_ar[U][A][U][A][C][C][U][G] =  2.300;
+ int22_ar[U][A][U][A][C][G][U][G] = -0.500;
+ int22_ar[U][A][U][A][C][U][U][G] =  1.500;
+ int22_ar[U][A][U][A][G][A][U][G] =  2.000;
+ int22_ar[U][A][U][A][G][C][U][G] =  2.700;
+ int22_ar[U][A][U][A][G][G][U][G] =  0.700;
+ int22_ar[U][A][U][A][G][U][U][G] =  2.700;
+ int22_ar[U][A][U][A][U][A][U][G] =  2.000;
+ int22_ar[U][A][U][A][U][C][U][G] =  2.000;
+ int22_ar[U][A][U][A][U][G][U][G] =  2.000;
+ int22_ar[U][A][U][A][U][U][U][G] =  2.000;
+ int22_ar[U][A][U][C][A][A][U][G] =  2.000;
+ int22_ar[U][A][U][C][A][C][U][G] =  2.800;
+ int22_ar[U][A][U][C][A][G][U][G] =  0.000;
+ int22_ar[U][A][U][C][A][U][U][G] =  1.900;
+ int22_ar[U][A][U][C][C][A][U][G] =  2.000;
+ int22_ar[U][A][U][C][C][C][U][G] =  2.800;
+ int22_ar[U][A][U][C][C][G][U][G] =  1.000;
+ int22_ar[U][A][U][C][C][U][U][G] =  1.900;
+ int22_ar[U][A][U][C][G][A][U][G] =  2.000;
+ int22_ar[U][A][U][C][G][C][U][G] =  2.000;
+ int22_ar[U][A][U][C][G][G][U][G] =  2.000;
+ int22_ar[U][A][U][C][G][U][U][G] =  2.000;
+ int22_ar[U][A][U][C][U][A][U][G] =  2.000;
+ int22_ar[U][A][U][C][U][C][U][G] =  2.800;
+ int22_ar[U][A][U][C][U][G][U][G] =  1.000;
+ int22_ar[U][A][U][C][U][U][U][G] =  1.900;
+ int22_ar[U][A][U][G][A][A][U][G] =  2.000;
+ int22_ar[U][A][U][G][A][C][U][G] =  2.700;
+ int22_ar[U][A][U][G][A][G][U][G] =  0.700;
+ int22_ar[U][A][U][G][A][U][U][G] =  2.700;
+ int22_ar[U][A][U][G][C][A][U][G] =  2.000;
+ int22_ar[U][A][U][G][C][C][U][G] =  2.000;
+ int22_ar[U][A][U][G][C][G][U][G] =  2.000;
+ int22_ar[U][A][U][G][C][U][U][G] =  2.000;
+ int22_ar[U][A][U][G][G][A][U][G] =  2.000;
+ int22_ar[U][A][U][G][G][C][U][G] =  2.700;
+ int22_ar[U][A][U][G][G][G][U][G] =  0.300;
+ int22_ar[U][A][U][G][G][U][U][G] =  2.300;
+ int22_ar[U][A][U][G][U][A][U][G] =  2.000;
+ int22_ar[U][A][U][G][U][C][U][G] =  1.000;
+ int22_ar[U][A][U][G][U][G][U][G] = -2.900;
+ int22_ar[U][A][U][G][U][U][U][G] =  0.900;
+ int22_ar[U][A][U][U][A][A][U][G] =  2.000;
+ int22_ar[U][A][U][U][A][C][U][G] =  2.000;
+ int22_ar[U][A][U][U][A][G][U][G] =  2.000;
+ int22_ar[U][A][U][U][A][U][U][G] =  2.000;
+ int22_ar[U][A][U][U][C][A][U][G] =  2.000;
+ int22_ar[U][A][U][U][C][C][U][G] =  2.500;
+ int22_ar[U][A][U][U][C][G][U][G] =  0.700;
+ int22_ar[U][A][U][U][C][U][U][G] =  1.600;
+ int22_ar[U][A][U][U][G][A][U][G] =  2.000;
+ int22_ar[U][A][U][U][G][C][U][G] =  2.200;
+ int22_ar[U][A][U][U][G][G][U][G] = -1.600;
+ int22_ar[U][A][U][U][G][U][U][G] =  2.200;
+ int22_ar[U][A][U][U][U][A][U][G] =  2.000;
+ int22_ar[U][A][U][U][U][C][U][G] =  1.900;
+ int22_ar[U][A][U][U][U][G][U][G] =  0.900;
+ int22_ar[U][A][U][U][U][U][U][G] =  1.100;
+ int22_ar[U][G][A][A][A][A][A][U] =  2.800;
+ int22_ar[U][G][A][A][A][C][A][U] =  2.800;
+ int22_ar[U][G][A][A][A][G][A][U] =  1.700;
+ int22_ar[U][G][A][A][A][U][A][U] =  2.000;
+ int22_ar[U][G][A][A][C][A][A][U] =  2.500;
+ int22_ar[U][G][A][A][C][C][A][U] =  2.500;
+ int22_ar[U][G][A][A][C][G][A][U] =  1.500;
+ int22_ar[U][G][A][A][C][U][A][U] =  2.000;
+ int22_ar[U][G][A][A][G][A][A][U] =  1.500;
+ int22_ar[U][G][A][A][G][C][A][U] =  1.500;
+ int22_ar[U][G][A][A][G][G][A][U] =  0.500;
+ int22_ar[U][G][A][A][G][U][A][U] =  2.000;
+ int22_ar[U][G][A][A][U][A][A][U] =  2.000;
+ int22_ar[U][G][A][A][U][C][A][U] =  2.000;
+ int22_ar[U][G][A][A][U][G][A][U] =  2.000;
+ int22_ar[U][G][A][A][U][U][A][U] =  2.000;
+ int22_ar[U][G][A][C][A][A][A][U] =  2.600;
+ int22_ar[U][G][A][C][A][C][A][U] =  2.600;
+ int22_ar[U][G][A][C][A][G][A][U] =  1.600;
+ int22_ar[U][G][A][C][A][U][A][U] =  2.000;
+ int22_ar[U][G][A][C][C][A][A][U] =  3.100;
+ int22_ar[U][G][A][C][C][C][A][U] =  2.500;
+ int22_ar[U][G][A][C][C][G][A][U] =  2.400;
+ int22_ar[U][G][A][C][C][U][A][U] =  2.000;
+ int22_ar[U][G][A][C][G][A][A][U] =  2.000;
+ int22_ar[U][G][A][C][G][C][A][U] =  2.000;
+ int22_ar[U][G][A][C][G][G][A][U] =  2.000;
+ int22_ar[U][G][A][C][G][U][A][U] =  2.000;
+ int22_ar[U][G][A][C][U][A][A][U] =  3.100;
+ int22_ar[U][G][A][C][U][C][A][U] =  2.500;
+ int22_ar[U][G][A][C][U][G][A][U] =  2.400;
+ int22_ar[U][G][A][C][U][U][A][U] =  2.000;
+ int22_ar[U][G][A][G][A][A][A][U] =  1.500;
+ int22_ar[U][G][A][G][A][C][A][U] =  1.500;
+ int22_ar[U][G][A][G][A][G][A][U] =  0.500;
+ int22_ar[U][G][A][G][A][U][A][U] =  2.000;
+ int22_ar[U][G][A][G][C][A][A][U] =  2.000;
+ int22_ar[U][G][A][G][C][C][A][U] =  2.000;
+ int22_ar[U][G][A][G][C][G][A][U] =  2.000;
+ int22_ar[U][G][A][G][C][U][A][U] =  2.000;
+ int22_ar[U][G][A][G][G][A][A][U] =  2.100;
+ int22_ar[U][G][A][G][G][C][A][U] =  2.100;
+ int22_ar[U][G][A][G][G][G][A][U] =  1.000;
+ int22_ar[U][G][A][G][G][U][A][U] =  2.000;
+ int22_ar[U][G][A][G][U][A][A][U] =  1.300;
+ int22_ar[U][G][A][G][U][C][A][U] =  0.300;
+ int22_ar[U][G][A][G][U][G][A][U] =  1.100;
+ int22_ar[U][G][A][G][U][U][A][U] =  2.000;
+ int22_ar[U][G][A][U][A][A][A][U] =  2.000;
+ int22_ar[U][G][A][U][A][C][A][U] =  2.000;
+ int22_ar[U][G][A][U][A][G][A][U] =  2.000;
+ int22_ar[U][G][A][U][A][U][A][U] =  2.000;
+ int22_ar[U][G][A][U][C][A][A][U] =  3.100;
+ int22_ar[U][G][A][U][C][C][A][U] =  2.500;
+ int22_ar[U][G][A][U][C][G][A][U] =  2.400;
+ int22_ar[U][G][A][U][C][U][A][U] =  2.000;
+ int22_ar[U][G][A][U][G][A][A][U] =  2.300;
+ int22_ar[U][G][A][U][G][C][A][U] =  1.300;
+ int22_ar[U][G][A][U][G][G][A][U] =  2.100;
+ int22_ar[U][G][A][U][G][U][A][U] =  2.000;
+ int22_ar[U][G][A][U][U][A][A][U] =  2.700;
+ int22_ar[U][G][A][U][U][C][A][U] =  1.700;
+ int22_ar[U][G][A][U][U][G][A][U] =  2.400;
+ int22_ar[U][G][A][U][U][U][A][U] =  2.000;
+ int22_ar[U][G][C][A][A][A][A][U] =  2.300;
+ int22_ar[U][G][C][A][A][C][A][U] =  3.400;
+ int22_ar[U][G][C][A][A][G][A][U] =  2.000;
+ int22_ar[U][G][C][A][A][U][A][U] =  3.100;
+ int22_ar[U][G][C][A][C][A][A][U] =  2.100;
+ int22_ar[U][G][C][A][C][C][A][U] =  2.500;
+ int22_ar[U][G][C][A][C][G][A][U] =  2.000;
+ int22_ar[U][G][C][A][C][U][A][U] =  2.200;
+ int22_ar[U][G][C][A][G][A][A][U] =  1.100;
+ int22_ar[U][G][C][A][G][C][A][U] =  2.500;
+ int22_ar[U][G][C][A][G][G][A][U] =  2.000;
+ int22_ar[U][G][C][A][G][U][A][U] =  2.200;
+ int22_ar[U][G][C][A][U][A][A][U] =  2.000;
+ int22_ar[U][G][C][A][U][C][A][U] =  2.000;
+ int22_ar[U][G][C][A][U][G][A][U] =  2.000;
+ int22_ar[U][G][C][A][U][U][A][U] =  2.000;
+ int22_ar[U][G][C][C][A][A][A][U] =  2.200;
+ int22_ar[U][G][C][C][A][C][A][U] =  2.600;
+ int22_ar[U][G][C][C][A][G][A][U] =  2.000;
+ int22_ar[U][G][C][C][A][U][A][U] =  2.300;
+ int22_ar[U][G][C][C][C][A][A][U] =  2.000;
+ int22_ar[U][G][C][C][C][C][A][U] =  2.500;
+ int22_ar[U][G][C][C][C][G][A][U] =  2.000;
+ int22_ar[U][G][C][C][C][U][A][U] =  2.200;
+ int22_ar[U][G][C][C][G][A][A][U] =  2.000;
+ int22_ar[U][G][C][C][G][C][A][U] =  2.000;
+ int22_ar[U][G][C][C][G][G][A][U] =  2.000;
+ int22_ar[U][G][C][C][G][U][A][U] =  2.000;
+ int22_ar[U][G][C][C][U][A][A][U] =  2.000;
+ int22_ar[U][G][C][C][U][C][A][U] =  2.500;
+ int22_ar[U][G][C][C][U][G][A][U] =  2.000;
+ int22_ar[U][G][C][C][U][U][A][U] =  2.200;
+ int22_ar[U][G][C][G][A][A][A][U] =  1.100;
+ int22_ar[U][G][C][G][A][C][A][U] =  2.500;
+ int22_ar[U][G][C][G][A][G][A][U] =  2.000;
+ int22_ar[U][G][C][G][A][U][A][U] =  2.200;
+ int22_ar[U][G][C][G][C][A][A][U] =  2.000;
+ int22_ar[U][G][C][G][C][C][A][U] =  2.000;
+ int22_ar[U][G][C][G][C][G][A][U] =  2.000;
+ int22_ar[U][G][C][G][C][U][A][U] =  2.000;
+ int22_ar[U][G][C][G][G][A][A][U] =  1.600;
+ int22_ar[U][G][C][G][G][C][A][U] =  2.700;
+ int22_ar[U][G][C][G][G][G][A][U] =  2.000;
+ int22_ar[U][G][C][G][G][U][A][U] =  2.400;
+ int22_ar[U][G][C][G][U][A][A][U] = -0.100;
+ int22_ar[U][G][C][G][U][C][A][U] =  1.300;
+ int22_ar[U][G][C][G][U][G][A][U] =  2.000;
+ int22_ar[U][G][C][G][U][U][A][U] =  1.000;
+ int22_ar[U][G][C][U][A][A][A][U] =  2.000;
+ int22_ar[U][G][C][U][A][C][A][U] =  2.000;
+ int22_ar[U][G][C][U][A][G][A][U] =  2.000;
+ int22_ar[U][G][C][U][A][U][A][U] =  2.000;
+ int22_ar[U][G][C][U][C][A][A][U] =  2.000;
+ int22_ar[U][G][C][U][C][C][A][U] =  2.500;
+ int22_ar[U][G][C][U][C][G][A][U] =  2.000;
+ int22_ar[U][G][C][U][C][U][A][U] =  2.200;
+ int22_ar[U][G][C][U][G][A][A][U] =  0.900;
+ int22_ar[U][G][C][U][G][C][A][U] =  2.300;
+ int22_ar[U][G][C][U][G][G][A][U] =  2.000;
+ int22_ar[U][G][C][U][G][U][A][U] =  2.000;
+ int22_ar[U][G][C][U][U][A][A][U] =  1.200;
+ int22_ar[U][G][C][U][U][C][A][U] =  1.700;
+ int22_ar[U][G][C][U][U][G][A][U] =  2.000;
+ int22_ar[U][G][C][U][U][U][A][U] =  1.400;
+ int22_ar[U][G][G][A][A][A][A][U] =  1.700;
+ int22_ar[U][G][G][A][A][C][A][U] =  2.000;
+ int22_ar[U][G][G][A][A][G][A][U] =  2.100;
+ int22_ar[U][G][G][A][A][U][A][U] =  2.200;
+ int22_ar[U][G][G][A][C][A][A][U] =  1.500;
+ int22_ar[U][G][G][A][C][C][A][U] =  2.000;
+ int22_ar[U][G][G][A][C][G][A][U] =  1.900;
+ int22_ar[U][G][G][A][C][U][A][U] =  1.000;
+ int22_ar[U][G][G][A][G][A][A][U] =  0.500;
+ int22_ar[U][G][G][A][G][C][A][U] =  2.000;
+ int22_ar[U][G][G][A][G][G][A][U] =  0.900;
+ int22_ar[U][G][G][A][G][U][A][U] =  1.800;
+ int22_ar[U][G][G][A][U][A][A][U] =  2.000;
+ int22_ar[U][G][G][A][U][C][A][U] =  2.000;
+ int22_ar[U][G][G][A][U][G][A][U] =  2.000;
+ int22_ar[U][G][G][A][U][U][A][U] =  2.000;
+ int22_ar[U][G][G][C][A][A][A][U] =  1.600;
+ int22_ar[U][G][G][C][A][C][A][U] =  2.000;
+ int22_ar[U][G][G][C][A][G][A][U] =  2.000;
+ int22_ar[U][G][G][C][A][U][A][U] =  1.100;
+ int22_ar[U][G][G][C][C][A][A][U] =  2.400;
+ int22_ar[U][G][G][C][C][C][A][U] =  2.000;
+ int22_ar[U][G][G][C][C][G][A][U] =  2.400;
+ int22_ar[U][G][G][C][C][U][A][U] =  1.900;
+ int22_ar[U][G][G][C][G][A][A][U] =  2.000;
+ int22_ar[U][G][G][C][G][C][A][U] =  2.000;
+ int22_ar[U][G][G][C][G][G][A][U] =  2.000;
+ int22_ar[U][G][G][C][G][U][A][U] =  2.000;
+ int22_ar[U][G][G][C][U][A][A][U] =  2.400;
+ int22_ar[U][G][G][C][U][C][A][U] =  2.000;
+ int22_ar[U][G][G][C][U][G][A][U] =  2.400;
+ int22_ar[U][G][G][C][U][U][A][U] =  1.900;
+ int22_ar[U][G][G][G][A][A][A][U] =  0.500;
+ int22_ar[U][G][G][G][A][C][A][U] =  2.000;
+ int22_ar[U][G][G][G][A][G][A][U] =  0.900;
+ int22_ar[U][G][G][G][A][U][A][U] =  1.800;
+ int22_ar[U][G][G][G][C][A][A][U] =  2.000;
+ int22_ar[U][G][G][G][C][C][A][U] =  2.000;
+ int22_ar[U][G][G][G][C][G][A][U] =  2.000;
+ int22_ar[U][G][G][G][C][U][A][U] =  2.000;
+ int22_ar[U][G][G][G][G][A][A][U] =  1.000;
+ int22_ar[U][G][G][G][G][C][A][U] =  2.000;
+ int22_ar[U][G][G][G][G][G][A][U] =  1.400;
+ int22_ar[U][G][G][G][G][U][A][U] =  1.500;
+ int22_ar[U][G][G][G][U][A][A][U] =  1.100;
+ int22_ar[U][G][G][G][U][C][A][U] =  2.000;
+ int22_ar[U][G][G][G][U][G][A][U] =  0.700;
+ int22_ar[U][G][G][G][U][U][A][U] = -1.200;
+ int22_ar[U][G][G][U][A][A][A][U] =  2.000;
+ int22_ar[U][G][G][U][A][C][A][U] =  2.000;
+ int22_ar[U][G][G][U][A][G][A][U] =  2.000;
+ int22_ar[U][G][G][U][A][U][A][U] =  2.000;
+ int22_ar[U][G][G][U][C][A][A][U] =  2.400;
+ int22_ar[U][G][G][U][C][C][A][U] =  2.000;
+ int22_ar[U][G][G][U][C][G][A][U] =  2.400;
+ int22_ar[U][G][G][U][C][U][A][U] =  1.900;
+ int22_ar[U][G][G][U][G][A][A][U] =  2.100;
+ int22_ar[U][G][G][U][G][C][A][U] =  2.000;
+ int22_ar[U][G][G][U][G][G][A][U] =  1.700;
+ int22_ar[U][G][G][U][G][U][A][U] = -0.200;
+ int22_ar[U][G][G][U][U][A][A][U] =  2.400;
+ int22_ar[U][G][G][U][U][C][A][U] =  2.000;
+ int22_ar[U][G][G][U][U][G][A][U] =  2.000;
+ int22_ar[U][G][G][U][U][U][A][U] =  1.900;
+ int22_ar[U][G][U][A][A][A][A][U] =  2.000;
+ int22_ar[U][G][U][A][A][C][A][U] =  3.400;
+ int22_ar[U][G][U][A][A][G][A][U] =  1.000;
+ int22_ar[U][G][U][A][A][U][A][U] =  2.900;
+ int22_ar[U][G][U][A][C][A][A][U] =  2.000;
+ int22_ar[U][G][U][A][C][C][A][U] =  2.500;
+ int22_ar[U][G][U][A][C][G][A][U] = -0.300;
+ int22_ar[U][G][U][A][C][U][A][U] =  1.700;
+ int22_ar[U][G][U][A][G][A][A][U] =  2.000;
+ int22_ar[U][G][U][A][G][C][A][U] =  2.500;
+ int22_ar[U][G][U][A][G][G][A][U] =  0.500;
+ int22_ar[U][G][U][A][G][U][A][U] =  2.500;
+ int22_ar[U][G][U][A][U][A][A][U] =  2.000;
+ int22_ar[U][G][U][A][U][C][A][U] =  2.000;
+ int22_ar[U][G][U][A][U][G][A][U] =  2.000;
+ int22_ar[U][G][U][A][U][U][A][U] =  2.000;
+ int22_ar[U][G][U][C][A][A][A][U] =  2.000;
+ int22_ar[U][G][U][C][A][C][A][U] =  2.600;
+ int22_ar[U][G][U][C][A][G][A][U] = -0.200;
+ int22_ar[U][G][U][C][A][U][A][U] =  1.800;
+ int22_ar[U][G][U][C][C][A][A][U] =  2.000;
+ int22_ar[U][G][U][C][C][C][A][U] =  2.500;
+ int22_ar[U][G][U][C][C][G][A][U] =  0.700;
+ int22_ar[U][G][U][C][C][U][A][U] =  1.600;
+ int22_ar[U][G][U][C][G][A][A][U] =  2.000;
+ int22_ar[U][G][U][C][G][C][A][U] =  2.000;
+ int22_ar[U][G][U][C][G][G][A][U] =  2.000;
+ int22_ar[U][G][U][C][G][U][A][U] =  2.000;
+ int22_ar[U][G][U][C][U][A][A][U] =  2.000;
+ int22_ar[U][G][U][C][U][C][A][U] =  2.500;
+ int22_ar[U][G][U][C][U][G][A][U] =  0.700;
+ int22_ar[U][G][U][C][U][U][A][U] =  1.600;
+ int22_ar[U][G][U][G][A][A][A][U] =  2.000;
+ int22_ar[U][G][U][G][A][C][A][U] =  2.500;
+ int22_ar[U][G][U][G][A][G][A][U] =  0.500;
+ int22_ar[U][G][U][G][A][U][A][U] =  2.500;
+ int22_ar[U][G][U][G][C][A][A][U] =  2.000;
+ int22_ar[U][G][U][G][C][C][A][U] =  2.000;
+ int22_ar[U][G][U][G][C][G][A][U] =  2.000;
+ int22_ar[U][G][U][G][C][U][A][U] =  2.000;
+ int22_ar[U][G][U][G][G][A][A][U] =  2.000;
+ int22_ar[U][G][U][G][G][C][A][U] =  2.700;
+ int22_ar[U][G][U][G][G][G][A][U] =  0.300;
+ int22_ar[U][G][U][G][G][U][A][U] =  2.200;
+ int22_ar[U][G][U][G][U][A][A][U] =  2.000;
+ int22_ar[U][G][U][G][U][C][A][U] =  1.300;
+ int22_ar[U][G][U][G][U][G][A][U] = -2.500;
+ int22_ar[U][G][U][G][U][U][A][U] =  1.300;
+ int22_ar[U][G][U][U][A][A][A][U] =  2.000;
+ int22_ar[U][G][U][U][A][C][A][U] =  2.000;
+ int22_ar[U][G][U][U][A][G][A][U] =  2.000;
+ int22_ar[U][G][U][U][A][U][A][U] =  2.000;
+ int22_ar[U][G][U][U][C][A][A][U] =  2.000;
+ int22_ar[U][G][U][U][C][C][A][U] =  2.500;
+ int22_ar[U][G][U][U][C][G][A][U] =  0.700;
+ int22_ar[U][G][U][U][C][U][A][U] =  1.600;
+ int22_ar[U][G][U][U][G][A][A][U] =  2.000;
+ int22_ar[U][G][U][U][G][C][A][U] =  2.300;
+ int22_ar[U][G][U][U][G][G][A][U] = -1.500;
+ int22_ar[U][G][U][U][G][U][A][U] =  2.300;
+ int22_ar[U][G][U][U][U][A][A][U] =  2.000;
+ int22_ar[U][G][U][U][U][C][A][U] =  1.700;
+ int22_ar[U][G][U][U][U][G][A][U] =  0.700;
+ int22_ar[U][G][U][U][U][U][A][U] =  0.800;
+ int22_ar[U][G][A][A][A][A][C][G] =  2.000;
+ int22_ar[U][G][A][A][A][C][C][G] =  2.000;
+ int22_ar[U][G][A][A][A][G][C][G] =  1.000;
+ int22_ar[U][G][A][A][A][U][C][G] =  2.000;
+ int22_ar[U][G][A][A][C][A][C][G] =  1.900;
+ int22_ar[U][G][A][A][C][C][C][G] =  1.900;
+ int22_ar[U][G][A][A][C][G][C][G] =  0.900;
+ int22_ar[U][G][A][A][C][U][C][G] =  2.000;
+ int22_ar[U][G][A][A][G][A][C][G] =  1.000;
+ int22_ar[U][G][A][A][G][C][C][G] =  1.000;
+ int22_ar[U][G][A][A][G][G][C][G] =  0.000;
+ int22_ar[U][G][A][A][G][U][C][G] =  2.000;
+ int22_ar[U][G][A][A][U][A][C][G] =  2.000;
+ int22_ar[U][G][A][A][U][C][C][G] =  2.000;
+ int22_ar[U][G][A][A][U][G][C][G] =  2.000;
+ int22_ar[U][G][A][A][U][U][C][G] =  2.000;
+ int22_ar[U][G][A][C][A][A][C][G] =  2.400;
+ int22_ar[U][G][A][C][A][C][C][G] =  2.400;
+ int22_ar[U][G][A][C][A][G][C][G] =  1.300;
+ int22_ar[U][G][A][C][A][U][C][G] =  2.000;
+ int22_ar[U][G][A][C][C][A][C][G] =  2.800;
+ int22_ar[U][G][A][C][C][C][C][G] =  2.200;
+ int22_ar[U][G][A][C][C][G][C][G] =  2.200;
+ int22_ar[U][G][A][C][C][U][C][G] =  2.000;
+ int22_ar[U][G][A][C][G][A][C][G] =  2.000;
+ int22_ar[U][G][A][C][G][C][C][G] =  2.000;
+ int22_ar[U][G][A][C][G][G][C][G] =  2.000;
+ int22_ar[U][G][A][C][G][U][C][G] =  2.000;
+ int22_ar[U][G][A][C][U][A][C][G] =  2.700;
+ int22_ar[U][G][A][C][U][C][C][G] =  2.100;
+ int22_ar[U][G][A][C][U][G][C][G] =  2.000;
+ int22_ar[U][G][A][C][U][U][C][G] =  2.000;
+ int22_ar[U][G][A][G][A][A][C][G] =  1.000;
+ int22_ar[U][G][A][G][A][C][C][G] =  1.000;
+ int22_ar[U][G][A][G][A][G][C][G] =  0.000;
+ int22_ar[U][G][A][G][A][U][C][G] =  2.000;
+ int22_ar[U][G][A][G][C][A][C][G] =  2.000;
+ int22_ar[U][G][A][G][C][C][C][G] =  2.000;
+ int22_ar[U][G][A][G][C][G][C][G] =  2.000;
+ int22_ar[U][G][A][G][C][U][C][G] =  2.000;
+ int22_ar[U][G][A][G][G][A][C][G] =  1.800;
+ int22_ar[U][G][A][G][G][C][C][G] =  1.800;
+ int22_ar[U][G][A][G][G][G][C][G] =  0.700;
+ int22_ar[U][G][A][G][G][U][C][G] =  2.000;
+ int22_ar[U][G][A][G][U][A][C][G] =  0.300;
+ int22_ar[U][G][A][G][U][C][C][G] = -0.700;
+ int22_ar[U][G][A][G][U][G][C][G] =  0.100;
+ int22_ar[U][G][A][G][U][U][C][G] =  2.000;
+ int22_ar[U][G][A][U][A][A][C][G] =  2.000;
+ int22_ar[U][G][A][U][A][C][C][G] =  2.000;
+ int22_ar[U][G][A][U][A][G][C][G] =  2.000;
+ int22_ar[U][G][A][U][A][U][C][G] =  2.000;
+ int22_ar[U][G][A][U][C][A][C][G] =  2.700;
+ int22_ar[U][G][A][U][C][C][C][G] =  2.100;
+ int22_ar[U][G][A][U][C][G][C][G] =  2.000;
+ int22_ar[U][G][A][U][C][U][C][G] =  2.000;
+ int22_ar[U][G][A][U][G][A][C][G] =  1.800;
+ int22_ar[U][G][A][U][G][C][C][G] =  0.800;
+ int22_ar[U][G][A][U][G][G][C][G] =  1.600;
+ int22_ar[U][G][A][U][G][U][C][G] =  2.000;
+ int22_ar[U][G][A][U][U][A][C][G] =  2.200;
+ int22_ar[U][G][A][U][U][C][C][G] =  1.200;
+ int22_ar[U][G][A][U][U][G][C][G] =  1.900;
+ int22_ar[U][G][A][U][U][U][C][G] =  2.000;
+ int22_ar[U][G][C][A][A][A][C][G] =  1.600;
+ int22_ar[U][G][C][A][A][C][C][G] =  2.600;
+ int22_ar[U][G][C][A][A][G][C][G] =  2.000;
+ int22_ar[U][G][C][A][A][U][C][G] =  2.300;
+ int22_ar[U][G][C][A][C][A][C][G] =  1.500;
+ int22_ar[U][G][C][A][C][C][C][G] =  1.900;
+ int22_ar[U][G][C][A][C][G][C][G] =  2.000;
+ int22_ar[U][G][C][A][C][U][C][G] =  1.600;
+ int22_ar[U][G][C][A][G][A][C][G] =  0.600;
+ int22_ar[U][G][C][A][G][C][C][G] =  2.000;
+ int22_ar[U][G][C][A][G][G][C][G] =  2.000;
+ int22_ar[U][G][C][A][G][U][C][G] =  1.700;
+ int22_ar[U][G][C][A][U][A][C][G] =  2.000;
+ int22_ar[U][G][C][A][U][C][C][G] =  2.000;
+ int22_ar[U][G][C][A][U][G][C][G] =  2.000;
+ int22_ar[U][G][C][A][U][U][C][G] =  2.000;
+ int22_ar[U][G][C][C][A][A][C][G] =  1.900;
+ int22_ar[U][G][C][C][A][C][C][G] =  2.400;
+ int22_ar[U][G][C][C][A][G][C][G] =  2.000;
+ int22_ar[U][G][C][C][A][U][C][G] =  2.100;
+ int22_ar[U][G][C][C][C][A][C][G] =  1.800;
+ int22_ar[U][G][C][C][C][C][C][G] =  2.200;
+ int22_ar[U][G][C][C][C][G][C][G] =  2.000;
+ int22_ar[U][G][C][C][C][U][C][G] =  1.900;
+ int22_ar[U][G][C][C][G][A][C][G] =  2.000;
+ int22_ar[U][G][C][C][G][C][C][G] =  2.000;
+ int22_ar[U][G][C][C][G][G][C][G] =  2.000;
+ int22_ar[U][G][C][C][G][U][C][G] =  2.000;
+ int22_ar[U][G][C][C][U][A][C][G] =  1.600;
+ int22_ar[U][G][C][C][U][C][C][G] =  2.100;
+ int22_ar[U][G][C][C][U][G][C][G] =  2.000;
+ int22_ar[U][G][C][C][U][U][C][G] =  1.800;
+ int22_ar[U][G][C][G][A][A][C][G] =  0.600;
+ int22_ar[U][G][C][G][A][C][C][G] =  2.000;
+ int22_ar[U][G][C][G][A][G][C][G] =  2.000;
+ int22_ar[U][G][C][G][A][U][C][G] =  1.700;
+ int22_ar[U][G][C][G][C][A][C][G] =  2.000;
+ int22_ar[U][G][C][G][C][C][C][G] =  2.000;
+ int22_ar[U][G][C][G][C][G][C][G] =  2.000;
+ int22_ar[U][G][C][G][C][U][C][G] =  2.000;
+ int22_ar[U][G][C][G][G][A][C][G] =  1.300;
+ int22_ar[U][G][C][G][G][C][C][G] =  2.400;
+ int22_ar[U][G][C][G][G][G][C][G] =  2.000;
+ int22_ar[U][G][C][G][G][U][C][G] =  2.100;
+ int22_ar[U][G][C][G][U][A][C][G] = -1.100;
+ int22_ar[U][G][C][G][U][C][C][G] =  0.300;
+ int22_ar[U][G][C][G][U][G][C][G] =  2.000;
+ int22_ar[U][G][C][G][U][U][C][G] =  0.000;
+ int22_ar[U][G][C][U][A][A][C][G] =  2.000;
+ int22_ar[U][G][C][U][A][C][C][G] =  2.000;
+ int22_ar[U][G][C][U][A][G][C][G] =  2.000;
+ int22_ar[U][G][C][U][A][U][C][G] =  2.000;
+ int22_ar[U][G][C][U][C][A][C][G] =  1.600;
+ int22_ar[U][G][C][U][C][C][C][G] =  2.100;
+ int22_ar[U][G][C][U][C][G][C][G] =  2.000;
+ int22_ar[U][G][C][U][C][U][C][G] =  1.800;
+ int22_ar[U][G][C][U][G][A][C][G] =  0.400;
+ int22_ar[U][G][C][U][G][C][C][G] =  1.800;
+ int22_ar[U][G][C][U][G][G][C][G] =  2.000;
+ int22_ar[U][G][C][U][G][U][C][G] =  1.500;
+ int22_ar[U][G][C][U][U][A][C][G] =  0.700;
+ int22_ar[U][G][C][U][U][C][C][G] =  1.200;
+ int22_ar[U][G][C][U][U][G][C][G] =  2.000;
+ int22_ar[U][G][C][U][U][U][C][G] =  0.900;
+ int22_ar[U][G][G][A][A][A][C][G] =  1.000;
+ int22_ar[U][G][G][A][A][C][C][G] =  2.000;
+ int22_ar[U][G][G][A][A][G][C][G] =  1.400;
+ int22_ar[U][G][G][A][A][U][C][G] =  1.500;
+ int22_ar[U][G][G][A][C][A][C][G] =  0.900;
+ int22_ar[U][G][G][A][C][C][C][G] =  2.000;
+ int22_ar[U][G][G][A][C][G][C][G] =  1.300;
+ int22_ar[U][G][G][A][C][U][C][G] =  0.400;
+ int22_ar[U][G][G][A][G][A][C][G] =  0.000;
+ int22_ar[U][G][G][A][G][C][C][G] =  2.000;
+ int22_ar[U][G][G][A][G][G][C][G] =  0.400;
+ int22_ar[U][G][G][A][G][U][C][G] =  1.300;
+ int22_ar[U][G][G][A][U][A][C][G] =  2.000;
+ int22_ar[U][G][G][A][U][C][C][G] =  2.000;
+ int22_ar[U][G][G][A][U][G][C][G] =  2.000;
+ int22_ar[U][G][G][A][U][U][C][G] =  2.000;
+ int22_ar[U][G][G][C][A][A][C][G] =  1.300;
+ int22_ar[U][G][G][C][A][C][C][G] =  2.000;
+ int22_ar[U][G][G][C][A][G][C][G] =  1.700;
+ int22_ar[U][G][G][C][A][U][C][G] =  0.800;
+ int22_ar[U][G][G][C][C][A][C][G] =  2.200;
+ int22_ar[U][G][G][C][C][C][C][G] =  2.000;
+ int22_ar[U][G][G][C][C][G][C][G] =  2.200;
+ int22_ar[U][G][G][C][C][U][C][G] =  1.700;
+ int22_ar[U][G][G][C][G][A][C][G] =  2.000;
+ int22_ar[U][G][G][C][G][C][C][G] =  2.000;
+ int22_ar[U][G][G][C][G][G][C][G] =  2.000;
+ int22_ar[U][G][G][C][G][U][C][G] =  2.000;
+ int22_ar[U][G][G][C][U][A][C][G] =  2.000;
+ int22_ar[U][G][G][C][U][C][C][G] =  2.000;
+ int22_ar[U][G][G][C][U][G][C][G] =  2.000;
+ int22_ar[U][G][G][C][U][U][C][G] =  1.500;
+ int22_ar[U][G][G][G][A][A][C][G] =  0.000;
+ int22_ar[U][G][G][G][A][C][C][G] =  2.000;
+ int22_ar[U][G][G][G][A][G][C][G] =  0.400;
+ int22_ar[U][G][G][G][A][U][C][G] =  1.300;
+ int22_ar[U][G][G][G][C][A][C][G] =  2.000;
+ int22_ar[U][G][G][G][C][C][C][G] =  2.000;
+ int22_ar[U][G][G][G][C][G][C][G] =  2.000;
+ int22_ar[U][G][G][G][C][U][C][G] =  2.000;
+ int22_ar[U][G][G][G][G][A][C][G] =  0.700;
+ int22_ar[U][G][G][G][G][C][C][G] =  2.000;
+ int22_ar[U][G][G][G][G][G][C][G] =  1.100;
+ int22_ar[U][G][G][G][G][U][C][G] =  1.200;
+ int22_ar[U][G][G][G][U][A][C][G] =  0.100;
+ int22_ar[U][G][G][G][U][C][C][G] =  2.000;
+ int22_ar[U][G][G][G][U][G][C][G] = -0.300;
+ int22_ar[U][G][G][G][U][U][C][G] = -2.200;
+ int22_ar[U][G][G][U][A][A][C][G] =  2.000;
+ int22_ar[U][G][G][U][A][C][C][G] =  2.000;
+ int22_ar[U][G][G][U][A][G][C][G] =  2.000;
+ int22_ar[U][G][G][U][A][U][C][G] =  2.000;
+ int22_ar[U][G][G][U][C][A][C][G] =  2.000;
+ int22_ar[U][G][G][U][C][C][C][G] =  2.000;
+ int22_ar[U][G][G][U][C][G][C][G] =  2.000;
+ int22_ar[U][G][G][U][C][U][C][G] =  1.500;
+ int22_ar[U][G][G][U][G][A][C][G] =  1.600;
+ int22_ar[U][G][G][U][G][C][C][G] =  2.000;
+ int22_ar[U][G][G][U][G][G][C][G] =  1.200;
+ int22_ar[U][G][G][U][G][U][C][G] = -0.700;
+ int22_ar[U][G][G][U][U][A][C][G] =  1.900;
+ int22_ar[U][G][G][U][U][C][C][G] =  2.000;
+ int22_ar[U][G][G][U][U][G][C][G] =  1.500;
+ int22_ar[U][G][G][U][U][U][C][G] =  1.500;
+ int22_ar[U][G][U][A][A][A][C][G] =  2.000;
+ int22_ar[U][G][U][A][A][C][C][G] =  2.600;
+ int22_ar[U][G][U][A][A][G][C][G] =  0.200;
+ int22_ar[U][G][U][A][A][U][C][G] =  2.200;
+ int22_ar[U][G][U][A][C][A][C][G] =  2.000;
+ int22_ar[U][G][U][A][C][C][C][G] =  1.900;
+ int22_ar[U][G][U][A][C][G][C][G] = -0.900;
+ int22_ar[U][G][U][A][C][U][C][G] =  1.100;
+ int22_ar[U][G][U][A][G][A][C][G] =  2.000;
+ int22_ar[U][G][U][A][G][C][C][G] =  2.000;
+ int22_ar[U][G][U][A][G][G][C][G] =  0.000;
+ int22_ar[U][G][U][A][G][U][C][G] =  2.000;
+ int22_ar[U][G][U][A][U][A][C][G] =  2.000;
+ int22_ar[U][G][U][A][U][C][C][G] =  2.000;
+ int22_ar[U][G][U][A][U][G][C][G] =  2.000;
+ int22_ar[U][G][U][A][U][U][C][G] =  2.000;
+ int22_ar[U][G][U][C][A][A][C][G] =  2.000;
+ int22_ar[U][G][U][C][A][C][C][G] =  2.400;
+ int22_ar[U][G][U][C][A][G][C][G] = -0.400;
+ int22_ar[U][G][U][C][A][U][C][G] =  1.500;
+ int22_ar[U][G][U][C][C][A][C][G] =  2.000;
+ int22_ar[U][G][U][C][C][C][C][G] =  2.200;
+ int22_ar[U][G][U][C][C][G][C][G] =  0.400;
+ int22_ar[U][G][U][C][C][U][C][G] =  1.400;
+ int22_ar[U][G][U][C][G][A][C][G] =  2.000;
+ int22_ar[U][G][U][C][G][C][C][G] =  2.000;
+ int22_ar[U][G][U][C][G][G][C][G] =  2.000;
+ int22_ar[U][G][U][C][G][U][C][G] =  2.000;
+ int22_ar[U][G][U][C][U][A][C][G] =  2.000;
+ int22_ar[U][G][U][C][U][C][C][G] =  2.100;
+ int22_ar[U][G][U][C][U][G][C][G] =  0.300;
+ int22_ar[U][G][U][C][U][U][C][G] =  1.200;
+ int22_ar[U][G][U][G][A][A][C][G] =  2.000;
+ int22_ar[U][G][U][G][A][C][C][G] =  2.000;
+ int22_ar[U][G][U][G][A][G][C][G] =  0.000;
+ int22_ar[U][G][U][G][A][U][C][G] =  2.000;
+ int22_ar[U][G][U][G][C][A][C][G] =  2.000;
+ int22_ar[U][G][U][G][C][C][C][G] =  2.000;
+ int22_ar[U][G][U][G][C][G][C][G] =  2.000;
+ int22_ar[U][G][U][G][C][U][C][G] =  2.000;
+ int22_ar[U][G][U][G][G][A][C][G] =  2.000;
+ int22_ar[U][G][U][G][G][C][C][G] =  2.400;
+ int22_ar[U][G][U][G][G][G][C][G] =  0.000;
+ int22_ar[U][G][U][G][G][U][C][G] =  1.900;
+ int22_ar[U][G][U][G][U][A][C][G] =  2.000;
+ int22_ar[U][G][U][G][U][C][C][G] =  0.300;
+ int22_ar[U][G][U][G][U][G][C][G] = -3.500;
+ int22_ar[U][G][U][G][U][U][C][G] =  0.300;
+ int22_ar[U][G][U][U][A][A][C][G] =  2.000;
+ int22_ar[U][G][U][U][A][C][C][G] =  2.000;
+ int22_ar[U][G][U][U][A][G][C][G] =  2.000;
+ int22_ar[U][G][U][U][A][U][C][G] =  2.000;
+ int22_ar[U][G][U][U][C][A][C][G] =  2.000;
+ int22_ar[U][G][U][U][C][C][C][G] =  2.100;
+ int22_ar[U][G][U][U][C][G][C][G] =  0.300;
+ int22_ar[U][G][U][U][C][U][C][G] =  1.200;
+ int22_ar[U][G][U][U][G][A][C][G] =  2.000;
+ int22_ar[U][G][U][U][G][C][C][G] =  1.800;
+ int22_ar[U][G][U][U][G][G][C][G] = -2.000;
+ int22_ar[U][G][U][U][G][U][C][G] =  1.800;
+ int22_ar[U][G][U][U][U][A][C][G] =  2.000;
+ int22_ar[U][G][U][U][U][C][C][G] =  1.200;
+ int22_ar[U][G][U][U][U][G][C][G] =  0.200;
+ int22_ar[U][G][U][U][U][U][C][G] =  0.300;
+ int22_ar[U][G][A][A][A][A][G][C] =  2.100;
+ int22_ar[U][G][A][A][A][C][G][C] =  2.100;
+ int22_ar[U][G][A][A][A][G][G][C] =  1.100;
+ int22_ar[U][G][A][A][A][U][G][C] =  2.000;
+ int22_ar[U][G][A][A][C][A][G][C] =  1.900;
+ int22_ar[U][G][A][A][C][C][G][C] =  1.900;
+ int22_ar[U][G][A][A][C][G][G][C] =  0.800;
+ int22_ar[U][G][A][A][C][U][G][C] =  2.000;
+ int22_ar[U][G][A][A][G][A][G][C] =  0.100;
+ int22_ar[U][G][A][A][G][C][G][C] =  0.100;
+ int22_ar[U][G][A][A][G][G][G][C] = -0.900;
+ int22_ar[U][G][A][A][G][U][G][C] =  2.000;
+ int22_ar[U][G][A][A][U][A][G][C] =  2.000;
+ int22_ar[U][G][A][A][U][C][G][C] =  2.000;
+ int22_ar[U][G][A][A][U][G][G][C] =  2.000;
+ int22_ar[U][G][A][A][U][U][G][C] =  2.000;
+ int22_ar[U][G][A][C][A][A][G][C] =  1.800;
+ int22_ar[U][G][A][C][A][C][G][C] =  1.800;
+ int22_ar[U][G][A][C][A][G][G][C] =  0.800;
+ int22_ar[U][G][A][C][A][U][G][C] =  2.000;
+ int22_ar[U][G][A][C][C][A][G][C] =  2.500;
+ int22_ar[U][G][A][C][C][C][G][C] =  1.900;
+ int22_ar[U][G][A][C][C][G][G][C] =  1.800;
+ int22_ar[U][G][A][C][C][U][G][C] =  2.000;
+ int22_ar[U][G][A][C][G][A][G][C] =  2.000;
+ int22_ar[U][G][A][C][G][C][G][C] =  2.000;
+ int22_ar[U][G][A][C][G][G][G][C] =  2.000;
+ int22_ar[U][G][A][C][G][U][G][C] =  2.000;
+ int22_ar[U][G][A][C][U][A][G][C] =  1.500;
+ int22_ar[U][G][A][C][U][C][G][C] =  0.900;
+ int22_ar[U][G][A][C][U][G][G][C] =  0.900;
+ int22_ar[U][G][A][C][U][U][G][C] =  2.000;
+ int22_ar[U][G][A][G][A][A][G][C] =  0.700;
+ int22_ar[U][G][A][G][A][C][G][C] =  0.700;
+ int22_ar[U][G][A][G][A][G][G][C] = -0.300;
+ int22_ar[U][G][A][G][A][U][G][C] =  2.000;
+ int22_ar[U][G][A][G][C][A][G][C] =  2.000;
+ int22_ar[U][G][A][G][C][C][G][C] =  2.000;
+ int22_ar[U][G][A][G][C][G][G][C] =  2.000;
+ int22_ar[U][G][A][G][C][U][G][C] =  2.000;
+ int22_ar[U][G][A][G][G][A][G][C] =  1.800;
+ int22_ar[U][G][A][G][G][C][G][C] =  1.800;
+ int22_ar[U][G][A][G][G][G][G][C] =  0.700;
+ int22_ar[U][G][A][G][G][U][G][C] =  2.000;
+ int22_ar[U][G][A][G][U][A][G][C] =  0.000;
+ int22_ar[U][G][A][G][U][C][G][C] = -1.000;
+ int22_ar[U][G][A][G][U][G][G][C] = -0.300;
+ int22_ar[U][G][A][G][U][U][G][C] =  2.000;
+ int22_ar[U][G][A][U][A][A][G][C] =  2.000;
+ int22_ar[U][G][A][U][A][C][G][C] =  2.000;
+ int22_ar[U][G][A][U][A][G][G][C] =  2.000;
+ int22_ar[U][G][A][U][A][U][G][C] =  2.000;
+ int22_ar[U][G][A][U][C][A][G][C] =  2.500;
+ int22_ar[U][G][A][U][C][C][G][C] =  1.900;
+ int22_ar[U][G][A][U][C][G][G][C] =  1.900;
+ int22_ar[U][G][A][U][C][U][G][C] =  2.000;
+ int22_ar[U][G][A][U][G][A][G][C] =  0.400;
+ int22_ar[U][G][A][U][G][C][G][C] = -0.600;
+ int22_ar[U][G][A][U][G][G][G][C] =  0.100;
+ int22_ar[U][G][A][U][G][U][G][C] =  2.000;
+ int22_ar[U][G][A][U][U][A][G][C] =  2.100;
+ int22_ar[U][G][A][U][U][C][G][C] =  1.100;
+ int22_ar[U][G][A][U][U][G][G][C] =  1.900;
+ int22_ar[U][G][A][U][U][U][G][C] =  2.000;
+ int22_ar[U][G][C][A][A][A][G][C] =  1.700;
+ int22_ar[U][G][C][A][A][C][G][C] =  2.700;
+ int22_ar[U][G][C][A][A][G][G][C] =  2.000;
+ int22_ar[U][G][C][A][A][U][G][C] =  2.400;
+ int22_ar[U][G][C][A][C][A][G][C] =  1.400;
+ int22_ar[U][G][C][A][C][C][G][C] =  1.900;
+ int22_ar[U][G][C][A][C][G][G][C] =  2.000;
+ int22_ar[U][G][C][A][C][U][G][C] =  1.600;
+ int22_ar[U][G][C][A][G][A][G][C] = -0.300;
+ int22_ar[U][G][C][A][G][C][G][C] =  1.100;
+ int22_ar[U][G][C][A][G][G][G][C] =  2.000;
+ int22_ar[U][G][C][A][G][U][G][C] =  0.800;
+ int22_ar[U][G][C][A][U][A][G][C] =  2.000;
+ int22_ar[U][G][C][A][U][C][G][C] =  2.000;
+ int22_ar[U][G][C][A][U][G][G][C] =  2.000;
+ int22_ar[U][G][C][A][U][U][G][C] =  2.000;
+ int22_ar[U][G][C][C][A][A][G][C] =  1.400;
+ int22_ar[U][G][C][C][A][C][G][C] =  1.800;
+ int22_ar[U][G][C][C][A][G][G][C] =  2.000;
+ int22_ar[U][G][C][C][A][U][G][C] =  1.500;
+ int22_ar[U][G][C][C][C][A][G][C] =  1.400;
+ int22_ar[U][G][C][C][C][C][G][C] =  1.900;
+ int22_ar[U][G][C][C][C][G][G][C] =  2.000;
+ int22_ar[U][G][C][C][C][U][G][C] =  1.600;
+ int22_ar[U][G][C][C][G][A][G][C] =  2.000;
+ int22_ar[U][G][C][C][G][C][G][C] =  2.000;
+ int22_ar[U][G][C][C][G][G][G][C] =  2.000;
+ int22_ar[U][G][C][C][G][U][G][C] =  2.000;
+ int22_ar[U][G][C][C][U][A][G][C] =  0.400;
+ int22_ar[U][G][C][C][U][C][G][C] =  0.900;
+ int22_ar[U][G][C][C][U][G][G][C] =  2.000;
+ int22_ar[U][G][C][C][U][U][G][C] =  0.600;
+ int22_ar[U][G][C][G][A][A][G][C] =  0.300;
+ int22_ar[U][G][C][G][A][C][G][C] =  1.700;
+ int22_ar[U][G][C][G][A][G][G][C] =  2.000;
+ int22_ar[U][G][C][G][A][U][G][C] =  1.400;
+ int22_ar[U][G][C][G][C][A][G][C] =  2.000;
+ int22_ar[U][G][C][G][C][C][G][C] =  2.000;
+ int22_ar[U][G][C][G][C][G][G][C] =  2.000;
+ int22_ar[U][G][C][G][C][U][G][C] =  2.000;
+ int22_ar[U][G][C][G][G][A][G][C] =  1.300;
+ int22_ar[U][G][C][G][G][C][G][C] =  2.400;
+ int22_ar[U][G][C][G][G][G][G][C] =  2.000;
+ int22_ar[U][G][C][G][G][U][G][C] =  2.100;
+ int22_ar[U][G][C][G][U][A][G][C] = -1.500;
+ int22_ar[U][G][C][G][U][C][G][C] =  0.000;
+ int22_ar[U][G][C][G][U][G][G][C] =  2.000;
+ int22_ar[U][G][C][G][U][U][G][C] = -0.300;
+ int22_ar[U][G][C][U][A][A][G][C] =  2.000;
+ int22_ar[U][G][C][U][A][C][G][C] =  2.000;
+ int22_ar[U][G][C][U][A][G][G][C] =  2.000;
+ int22_ar[U][G][C][U][A][U][G][C] =  2.000;
+ int22_ar[U][G][C][U][C][A][G][C] =  1.500;
+ int22_ar[U][G][C][U][C][C][G][C] =  1.900;
+ int22_ar[U][G][C][U][C][G][G][C] =  2.000;
+ int22_ar[U][G][C][U][C][U][G][C] =  1.600;
+ int22_ar[U][G][C][U][G][A][G][C] = -1.100;
+ int22_ar[U][G][C][U][G][C][G][C] =  0.400;
+ int22_ar[U][G][C][U][G][G][G][C] =  2.000;
+ int22_ar[U][G][C][U][G][U][G][C] =  0.100;
+ int22_ar[U][G][C][U][U][A][G][C] =  0.700;
+ int22_ar[U][G][C][U][U][C][G][C] =  1.100;
+ int22_ar[U][G][C][U][U][G][G][C] =  2.000;
+ int22_ar[U][G][C][U][U][U][G][C] =  0.800;
+ int22_ar[U][G][G][A][A][A][G][C] =  1.100;
+ int22_ar[U][G][G][A][A][C][G][C] =  2.000;
+ int22_ar[U][G][G][A][A][G][G][C] =  1.500;
+ int22_ar[U][G][G][A][A][U][G][C] =  1.600;
+ int22_ar[U][G][G][A][C][A][G][C] =  0.800;
+ int22_ar[U][G][G][A][C][C][G][C] =  2.000;
+ int22_ar[U][G][G][A][C][G][G][C] =  1.200;
+ int22_ar[U][G][G][A][C][U][G][C] =  0.300;
+ int22_ar[U][G][G][A][G][A][G][C] = -0.900;
+ int22_ar[U][G][G][A][G][C][G][C] =  2.000;
+ int22_ar[U][G][G][A][G][G][G][C] = -0.500;
+ int22_ar[U][G][G][A][G][U][G][C] =  0.400;
+ int22_ar[U][G][G][A][U][A][G][C] =  2.000;
+ int22_ar[U][G][G][A][U][C][G][C] =  2.000;
+ int22_ar[U][G][G][A][U][G][G][C] =  2.000;
+ int22_ar[U][G][G][A][U][U][G][C] =  2.000;
+ int22_ar[U][G][G][C][A][A][G][C] =  0.800;
+ int22_ar[U][G][G][C][A][C][G][C] =  2.000;
+ int22_ar[U][G][G][C][A][G][G][C] =  1.200;
+ int22_ar[U][G][G][C][A][U][G][C] =  0.300;
+ int22_ar[U][G][G][C][C][A][G][C] =  1.800;
+ int22_ar[U][G][G][C][C][C][G][C] =  2.000;
+ int22_ar[U][G][G][C][C][G][G][C] =  1.800;
+ int22_ar[U][G][G][C][C][U][G][C] =  1.300;
+ int22_ar[U][G][G][C][G][A][G][C] =  2.000;
+ int22_ar[U][G][G][C][G][C][G][C] =  2.000;
+ int22_ar[U][G][G][C][G][G][G][C] =  2.000;
+ int22_ar[U][G][G][C][G][U][G][C] =  2.000;
+ int22_ar[U][G][G][C][U][A][G][C] =  0.900;
+ int22_ar[U][G][G][C][U][C][G][C] =  2.000;
+ int22_ar[U][G][G][C][U][G][G][C] =  0.800;
+ int22_ar[U][G][G][C][U][U][G][C] =  0.400;
+ int22_ar[U][G][G][G][A][A][G][C] = -0.300;
+ int22_ar[U][G][G][G][A][C][G][C] =  2.000;
+ int22_ar[U][G][G][G][A][G][G][C] =  0.100;
+ int22_ar[U][G][G][G][A][U][G][C] =  1.000;
+ int22_ar[U][G][G][G][C][A][G][C] =  2.000;
+ int22_ar[U][G][G][G][C][C][G][C] =  2.000;
+ int22_ar[U][G][G][G][C][G][G][C] =  2.000;
+ int22_ar[U][G][G][G][C][U][G][C] =  2.000;
+ int22_ar[U][G][G][G][G][A][G][C] =  0.700;
+ int22_ar[U][G][G][G][G][C][G][C] =  2.000;
+ int22_ar[U][G][G][G][G][G][G][C] =  1.100;
+ int22_ar[U][G][G][G][G][U][G][C] =  1.200;
+ int22_ar[U][G][G][G][U][A][G][C] = -0.300;
+ int22_ar[U][G][G][G][U][C][G][C] =  2.000;
+ int22_ar[U][G][G][G][U][G][G][C] = -0.700;
+ int22_ar[U][G][G][G][U][U][G][C] = -2.600;
+ int22_ar[U][G][G][U][A][A][G][C] =  2.000;
+ int22_ar[U][G][G][U][A][C][G][C] =  2.000;
+ int22_ar[U][G][G][U][A][G][G][C] =  2.000;
+ int22_ar[U][G][G][U][A][U][G][C] =  2.000;
+ int22_ar[U][G][G][U][C][A][G][C] =  1.900;
+ int22_ar[U][G][G][U][C][C][G][C] =  2.000;
+ int22_ar[U][G][G][U][C][G][G][C] =  1.900;
+ int22_ar[U][G][G][U][C][U][G][C] =  1.400;
+ int22_ar[U][G][G][U][G][A][G][C] =  0.100;
+ int22_ar[U][G][G][U][G][C][G][C] =  2.000;
+ int22_ar[U][G][G][U][G][G][G][C] = -0.300;
+ int22_ar[U][G][G][U][G][U][G][C] = -2.200;
+ int22_ar[U][G][G][U][U][A][G][C] =  1.900;
+ int22_ar[U][G][G][U][U][C][G][C] =  2.000;
+ int22_ar[U][G][G][U][U][G][G][C] =  1.500;
+ int22_ar[U][G][G][U][U][U][G][C] =  1.400;
+ int22_ar[U][G][U][A][A][A][G][C] =  2.000;
+ int22_ar[U][G][U][A][A][C][G][C] =  2.700;
+ int22_ar[U][G][U][A][A][G][G][C] =  0.300;
+ int22_ar[U][G][U][A][A][U][G][C] =  2.300;
+ int22_ar[U][G][U][A][C][A][G][C] =  2.000;
+ int22_ar[U][G][U][A][C][C][G][C] =  1.900;
+ int22_ar[U][G][U][A][C][G][G][C] = -0.900;
+ int22_ar[U][G][U][A][C][U][G][C] =  1.000;
+ int22_ar[U][G][U][A][G][A][G][C] =  2.000;
+ int22_ar[U][G][U][A][G][C][G][C] =  1.100;
+ int22_ar[U][G][U][A][G][G][G][C] = -0.900;
+ int22_ar[U][G][U][A][G][U][G][C] =  1.100;
+ int22_ar[U][G][U][A][U][A][G][C] =  2.000;
+ int22_ar[U][G][U][A][U][C][G][C] =  2.000;
+ int22_ar[U][G][U][A][U][G][G][C] =  2.000;
+ int22_ar[U][G][U][A][U][U][G][C] =  2.000;
+ int22_ar[U][G][U][C][A][A][G][C] =  2.000;
+ int22_ar[U][G][U][C][A][C][G][C] =  1.800;
+ int22_ar[U][G][U][C][A][G][G][C] = -1.000;
+ int22_ar[U][G][U][C][A][U][G][C] =  1.000;
+ int22_ar[U][G][U][C][C][A][G][C] =  2.000;
+ int22_ar[U][G][U][C][C][C][G][C] =  1.900;
+ int22_ar[U][G][U][C][C][G][G][C] =  0.100;
+ int22_ar[U][G][U][C][C][U][G][C] =  1.000;
+ int22_ar[U][G][U][C][G][A][G][C] =  2.000;
+ int22_ar[U][G][U][C][G][C][G][C] =  2.000;
+ int22_ar[U][G][U][C][G][G][G][C] =  2.000;
+ int22_ar[U][G][U][C][G][U][G][C] =  2.000;
+ int22_ar[U][G][U][C][U][A][G][C] =  2.000;
+ int22_ar[U][G][U][C][U][C][G][C] =  0.900;
+ int22_ar[U][G][U][C][U][G][G][C] = -0.900;
+ int22_ar[U][G][U][C][U][U][G][C] =  0.000;
+ int22_ar[U][G][U][G][A][A][G][C] =  2.000;
+ int22_ar[U][G][U][G][A][C][G][C] =  1.700;
+ int22_ar[U][G][U][G][A][G][G][C] = -0.300;
+ int22_ar[U][G][U][G][A][U][G][C] =  1.700;
+ int22_ar[U][G][U][G][C][A][G][C] =  2.000;
+ int22_ar[U][G][U][G][C][C][G][C] =  2.000;
+ int22_ar[U][G][U][G][C][G][G][C] =  2.000;
+ int22_ar[U][G][U][G][C][U][G][C] =  2.000;
+ int22_ar[U][G][U][G][G][A][G][C] =  2.000;
+ int22_ar[U][G][U][G][G][C][G][C] =  2.400;
+ int22_ar[U][G][U][G][G][G][G][C] =  0.000;
+ int22_ar[U][G][U][G][G][U][G][C] =  1.900;
+ int22_ar[U][G][U][G][U][A][G][C] =  2.000;
+ int22_ar[U][G][U][G][U][C][G][C] =  0.000;
+ int22_ar[U][G][U][G][U][G][G][C] = -3.900;
+ int22_ar[U][G][U][G][U][U][G][C] = -0.100;
+ int22_ar[U][G][U][U][A][A][G][C] =  2.000;
+ int22_ar[U][G][U][U][A][C][G][C] =  2.000;
+ int22_ar[U][G][U][U][A][G][G][C] =  2.000;
+ int22_ar[U][G][U][U][A][U][G][C] =  2.000;
+ int22_ar[U][G][U][U][C][A][G][C] =  2.000;
+ int22_ar[U][G][U][U][C][C][G][C] =  1.900;
+ int22_ar[U][G][U][U][C][G][G][C] =  0.100;
+ int22_ar[U][G][U][U][C][U][G][C] =  1.100;
+ int22_ar[U][G][U][U][G][A][G][C] =  2.000;
+ int22_ar[U][G][U][U][G][C][G][C] =  0.400;
+ int22_ar[U][G][U][U][G][G][G][C] = -3.500;
+ int22_ar[U][G][U][U][G][U][G][C] =  0.300;
+ int22_ar[U][G][U][U][U][A][G][C] =  2.000;
+ int22_ar[U][G][U][U][U][C][G][C] =  1.100;
+ int22_ar[U][G][U][U][U][G][G][C] =  0.100;
+ int22_ar[U][G][U][U][U][U][G][C] =  0.300;
+ int22_ar[U][G][A][A][A][A][G][U] =  2.800;
+ int22_ar[U][G][A][A][A][C][G][U] =  2.800;
+ int22_ar[U][G][A][A][A][G][G][U] =  1.700;
+ int22_ar[U][G][A][A][A][U][G][U] =  2.000;
+ int22_ar[U][G][A][A][C][A][G][U] =  2.500;
+ int22_ar[U][G][A][A][C][C][G][U] =  2.500;
+ int22_ar[U][G][A][A][C][G][G][U] =  1.500;
+ int22_ar[U][G][A][A][C][U][G][U] =  2.000;
+ int22_ar[U][G][A][A][G][A][G][U] =  1.500;
+ int22_ar[U][G][A][A][G][C][G][U] =  1.500;
+ int22_ar[U][G][A][A][G][G][G][U] =  0.500;
+ int22_ar[U][G][A][A][G][U][G][U] =  2.000;
+ int22_ar[U][G][A][A][U][A][G][U] =  2.000;
+ int22_ar[U][G][A][A][U][C][G][U] =  2.000;
+ int22_ar[U][G][A][A][U][G][G][U] =  2.000;
+ int22_ar[U][G][A][A][U][U][G][U] =  2.000;
+ int22_ar[U][G][A][C][A][A][G][U] =  2.600;
+ int22_ar[U][G][A][C][A][C][G][U] =  2.600;
+ int22_ar[U][G][A][C][A][G][G][U] =  1.600;
+ int22_ar[U][G][A][C][A][U][G][U] =  2.000;
+ int22_ar[U][G][A][C][C][A][G][U] =  3.100;
+ int22_ar[U][G][A][C][C][C][G][U] =  2.500;
+ int22_ar[U][G][A][C][C][G][G][U] =  2.400;
+ int22_ar[U][G][A][C][C][U][G][U] =  2.000;
+ int22_ar[U][G][A][C][G][A][G][U] =  2.000;
+ int22_ar[U][G][A][C][G][C][G][U] =  2.000;
+ int22_ar[U][G][A][C][G][G][G][U] =  2.000;
+ int22_ar[U][G][A][C][G][U][G][U] =  2.000;
+ int22_ar[U][G][A][C][U][A][G][U] =  3.100;
+ int22_ar[U][G][A][C][U][C][G][U] =  2.500;
+ int22_ar[U][G][A][C][U][G][G][U] =  2.400;
+ int22_ar[U][G][A][C][U][U][G][U] =  2.000;
+ int22_ar[U][G][A][G][A][A][G][U] =  1.500;
+ int22_ar[U][G][A][G][A][C][G][U] =  1.500;
+ int22_ar[U][G][A][G][A][G][G][U] =  0.500;
+ int22_ar[U][G][A][G][A][U][G][U] =  2.000;
+ int22_ar[U][G][A][G][C][A][G][U] =  2.000;
+ int22_ar[U][G][A][G][C][C][G][U] =  2.000;
+ int22_ar[U][G][A][G][C][G][G][U] =  2.000;
+ int22_ar[U][G][A][G][C][U][G][U] =  2.000;
+ int22_ar[U][G][A][G][G][A][G][U] =  2.100;
+ int22_ar[U][G][A][G][G][C][G][U] =  2.100;
+ int22_ar[U][G][A][G][G][G][G][U] =  1.000;
+ int22_ar[U][G][A][G][G][U][G][U] =  2.000;
+ int22_ar[U][G][A][G][U][A][G][U] =  1.300;
+ int22_ar[U][G][A][G][U][C][G][U] =  0.300;
+ int22_ar[U][G][A][G][U][G][G][U] =  1.100;
+ int22_ar[U][G][A][G][U][U][G][U] =  2.000;
+ int22_ar[U][G][A][U][A][A][G][U] =  2.000;
+ int22_ar[U][G][A][U][A][C][G][U] =  2.000;
+ int22_ar[U][G][A][U][A][G][G][U] =  2.000;
+ int22_ar[U][G][A][U][A][U][G][U] =  2.000;
+ int22_ar[U][G][A][U][C][A][G][U] =  3.100;
+ int22_ar[U][G][A][U][C][C][G][U] =  2.500;
+ int22_ar[U][G][A][U][C][G][G][U] =  2.400;
+ int22_ar[U][G][A][U][C][U][G][U] =  2.000;
+ int22_ar[U][G][A][U][G][A][G][U] =  2.300;
+ int22_ar[U][G][A][U][G][C][G][U] =  1.300;
+ int22_ar[U][G][A][U][G][G][G][U] =  2.100;
+ int22_ar[U][G][A][U][G][U][G][U] =  2.000;
+ int22_ar[U][G][A][U][U][A][G][U] =  2.700;
+ int22_ar[U][G][A][U][U][C][G][U] =  1.700;
+ int22_ar[U][G][A][U][U][G][G][U] =  2.400;
+ int22_ar[U][G][A][U][U][U][G][U] =  2.000;
+ int22_ar[U][G][C][A][A][A][G][U] =  2.300;
+ int22_ar[U][G][C][A][A][C][G][U] =  3.400;
+ int22_ar[U][G][C][A][A][G][G][U] =  2.000;
+ int22_ar[U][G][C][A][A][U][G][U] =  3.100;
+ int22_ar[U][G][C][A][C][A][G][U] =  2.100;
+ int22_ar[U][G][C][A][C][C][G][U] =  2.500;
+ int22_ar[U][G][C][A][C][G][G][U] =  2.000;
+ int22_ar[U][G][C][A][C][U][G][U] =  2.200;
+ int22_ar[U][G][C][A][G][A][G][U] =  1.100;
+ int22_ar[U][G][C][A][G][C][G][U] =  2.500;
+ int22_ar[U][G][C][A][G][G][G][U] =  2.000;
+ int22_ar[U][G][C][A][G][U][G][U] =  2.200;
+ int22_ar[U][G][C][A][U][A][G][U] =  2.000;
+ int22_ar[U][G][C][A][U][C][G][U] =  2.000;
+ int22_ar[U][G][C][A][U][G][G][U] =  2.000;
+ int22_ar[U][G][C][A][U][U][G][U] =  2.000;
+ int22_ar[U][G][C][C][A][A][G][U] =  2.200;
+ int22_ar[U][G][C][C][A][C][G][U] =  2.600;
+ int22_ar[U][G][C][C][A][G][G][U] =  2.000;
+ int22_ar[U][G][C][C][A][U][G][U] =  2.300;
+ int22_ar[U][G][C][C][C][A][G][U] =  2.000;
+ int22_ar[U][G][C][C][C][C][G][U] =  2.500;
+ int22_ar[U][G][C][C][C][G][G][U] =  2.000;
+ int22_ar[U][G][C][C][C][U][G][U] =  2.200;
+ int22_ar[U][G][C][C][G][A][G][U] =  2.000;
+ int22_ar[U][G][C][C][G][C][G][U] =  2.000;
+ int22_ar[U][G][C][C][G][G][G][U] =  2.000;
+ int22_ar[U][G][C][C][G][U][G][U] =  2.000;
+ int22_ar[U][G][C][C][U][A][G][U] =  2.000;
+ int22_ar[U][G][C][C][U][C][G][U] =  2.500;
+ int22_ar[U][G][C][C][U][G][G][U] =  2.000;
+ int22_ar[U][G][C][C][U][U][G][U] =  2.200;
+ int22_ar[U][G][C][G][A][A][G][U] =  1.100;
+ int22_ar[U][G][C][G][A][C][G][U] =  2.500;
+ int22_ar[U][G][C][G][A][G][G][U] =  2.000;
+ int22_ar[U][G][C][G][A][U][G][U] =  2.200;
+ int22_ar[U][G][C][G][C][A][G][U] =  2.000;
+ int22_ar[U][G][C][G][C][C][G][U] =  2.000;
+ int22_ar[U][G][C][G][C][G][G][U] =  2.000;
+ int22_ar[U][G][C][G][C][U][G][U] =  2.000;
+ int22_ar[U][G][C][G][G][A][G][U] =  1.600;
+ int22_ar[U][G][C][G][G][C][G][U] =  2.700;
+ int22_ar[U][G][C][G][G][G][G][U] =  2.000;
+ int22_ar[U][G][C][G][G][U][G][U] =  2.400;
+ int22_ar[U][G][C][G][U][A][G][U] = -0.100;
+ int22_ar[U][G][C][G][U][C][G][U] =  1.300;
+ int22_ar[U][G][C][G][U][G][G][U] =  2.000;
+ int22_ar[U][G][C][G][U][U][G][U] =  1.000;
+ int22_ar[U][G][C][U][A][A][G][U] =  2.000;
+ int22_ar[U][G][C][U][A][C][G][U] =  2.000;
+ int22_ar[U][G][C][U][A][G][G][U] =  2.000;
+ int22_ar[U][G][C][U][A][U][G][U] =  2.000;
+ int22_ar[U][G][C][U][C][A][G][U] =  2.000;
+ int22_ar[U][G][C][U][C][C][G][U] =  2.500;
+ int22_ar[U][G][C][U][C][G][G][U] =  2.000;
+ int22_ar[U][G][C][U][C][U][G][U] =  2.200;
+ int22_ar[U][G][C][U][G][A][G][U] =  0.900;
+ int22_ar[U][G][C][U][G][C][G][U] =  2.300;
+ int22_ar[U][G][C][U][G][G][G][U] =  2.000;
+ int22_ar[U][G][C][U][G][U][G][U] =  2.000;
+ int22_ar[U][G][C][U][U][A][G][U] =  1.200;
+ int22_ar[U][G][C][U][U][C][G][U] =  1.700;
+ int22_ar[U][G][C][U][U][G][G][U] =  2.000;
+ int22_ar[U][G][C][U][U][U][G][U] =  1.400;
+ int22_ar[U][G][G][A][A][A][G][U] =  1.700;
+ int22_ar[U][G][G][A][A][C][G][U] =  2.000;
+ int22_ar[U][G][G][A][A][G][G][U] =  2.100;
+ int22_ar[U][G][G][A][A][U][G][U] =  2.200;
+ int22_ar[U][G][G][A][C][A][G][U] =  1.500;
+ int22_ar[U][G][G][A][C][C][G][U] =  2.000;
+ int22_ar[U][G][G][A][C][G][G][U] =  1.900;
+ int22_ar[U][G][G][A][C][U][G][U] =  1.000;
+ int22_ar[U][G][G][A][G][A][G][U] =  0.500;
+ int22_ar[U][G][G][A][G][C][G][U] =  2.000;
+ int22_ar[U][G][G][A][G][G][G][U] =  0.900;
+ int22_ar[U][G][G][A][G][U][G][U] =  1.800;
+ int22_ar[U][G][G][A][U][A][G][U] =  2.000;
+ int22_ar[U][G][G][A][U][C][G][U] =  2.000;
+ int22_ar[U][G][G][A][U][G][G][U] =  2.000;
+ int22_ar[U][G][G][A][U][U][G][U] =  2.000;
+ int22_ar[U][G][G][C][A][A][G][U] =  1.600;
+ int22_ar[U][G][G][C][A][C][G][U] =  2.000;
+ int22_ar[U][G][G][C][A][G][G][U] =  2.000;
+ int22_ar[U][G][G][C][A][U][G][U] =  1.100;
+ int22_ar[U][G][G][C][C][A][G][U] =  2.400;
+ int22_ar[U][G][G][C][C][C][G][U] =  2.000;
+ int22_ar[U][G][G][C][C][G][G][U] =  2.400;
+ int22_ar[U][G][G][C][C][U][G][U] =  1.900;
+ int22_ar[U][G][G][C][G][A][G][U] =  2.000;
+ int22_ar[U][G][G][C][G][C][G][U] =  2.000;
+ int22_ar[U][G][G][C][G][G][G][U] =  2.000;
+ int22_ar[U][G][G][C][G][U][G][U] =  2.000;
+ int22_ar[U][G][G][C][U][A][G][U] =  2.400;
+ int22_ar[U][G][G][C][U][C][G][U] =  2.000;
+ int22_ar[U][G][G][C][U][G][G][U] =  2.400;
+ int22_ar[U][G][G][C][U][U][G][U] =  1.900;
+ int22_ar[U][G][G][G][A][A][G][U] =  0.500;
+ int22_ar[U][G][G][G][A][C][G][U] =  2.000;
+ int22_ar[U][G][G][G][A][G][G][U] =  0.900;
+ int22_ar[U][G][G][G][A][U][G][U] =  1.800;
+ int22_ar[U][G][G][G][C][A][G][U] =  2.000;
+ int22_ar[U][G][G][G][C][C][G][U] =  2.000;
+ int22_ar[U][G][G][G][C][G][G][U] =  2.000;
+ int22_ar[U][G][G][G][C][U][G][U] =  2.000;
+ int22_ar[U][G][G][G][G][A][G][U] =  1.000;
+ int22_ar[U][G][G][G][G][C][G][U] =  2.000;
+ int22_ar[U][G][G][G][G][G][G][U] =  1.400;
+ int22_ar[U][G][G][G][G][U][G][U] =  1.500;
+ int22_ar[U][G][G][G][U][A][G][U] =  1.100;
+ int22_ar[U][G][G][G][U][C][G][U] =  2.000;
+ int22_ar[U][G][G][G][U][G][G][U] =  0.700;
+ int22_ar[U][G][G][G][U][U][G][U] = -1.200;
+ int22_ar[U][G][G][U][A][A][G][U] =  2.000;
+ int22_ar[U][G][G][U][A][C][G][U] =  2.000;
+ int22_ar[U][G][G][U][A][G][G][U] =  2.000;
+ int22_ar[U][G][G][U][A][U][G][U] =  2.000;
+ int22_ar[U][G][G][U][C][A][G][U] =  2.400;
+ int22_ar[U][G][G][U][C][C][G][U] =  2.000;
+ int22_ar[U][G][G][U][C][G][G][U] =  2.400;
+ int22_ar[U][G][G][U][C][U][G][U] =  1.900;
+ int22_ar[U][G][G][U][G][A][G][U] =  2.100;
+ int22_ar[U][G][G][U][G][C][G][U] =  2.000;
+ int22_ar[U][G][G][U][G][G][G][U] =  1.700;
+ int22_ar[U][G][G][U][G][U][G][U] = -0.200;
+ int22_ar[U][G][G][U][U][A][G][U] =  2.400;
+ int22_ar[U][G][G][U][U][C][G][U] =  2.000;
+ int22_ar[U][G][G][U][U][G][G][U] =  2.000;
+ int22_ar[U][G][G][U][U][U][G][U] =  1.900;
+ int22_ar[U][G][U][A][A][A][G][U] =  2.000;
+ int22_ar[U][G][U][A][A][C][G][U] =  3.400;
+ int22_ar[U][G][U][A][A][G][G][U] =  1.000;
+ int22_ar[U][G][U][A][A][U][G][U] =  2.900;
+ int22_ar[U][G][U][A][C][A][G][U] =  2.000;
+ int22_ar[U][G][U][A][C][C][G][U] =  2.500;
+ int22_ar[U][G][U][A][C][G][G][U] = -0.300;
+ int22_ar[U][G][U][A][C][U][G][U] =  1.700;
+ int22_ar[U][G][U][A][G][A][G][U] =  2.000;
+ int22_ar[U][G][U][A][G][C][G][U] =  2.500;
+ int22_ar[U][G][U][A][G][G][G][U] =  0.500;
+ int22_ar[U][G][U][A][G][U][G][U] =  2.500;
+ int22_ar[U][G][U][A][U][A][G][U] =  2.000;
+ int22_ar[U][G][U][A][U][C][G][U] =  2.000;
+ int22_ar[U][G][U][A][U][G][G][U] =  2.000;
+ int22_ar[U][G][U][A][U][U][G][U] =  2.000;
+ int22_ar[U][G][U][C][A][A][G][U] =  2.000;
+ int22_ar[U][G][U][C][A][C][G][U] =  2.600;
+ int22_ar[U][G][U][C][A][G][G][U] = -0.200;
+ int22_ar[U][G][U][C][A][U][G][U] =  1.800;
+ int22_ar[U][G][U][C][C][A][G][U] =  2.000;
+ int22_ar[U][G][U][C][C][C][G][U] =  2.500;
+ int22_ar[U][G][U][C][C][G][G][U] =  0.700;
+ int22_ar[U][G][U][C][C][U][G][U] =  1.600;
+ int22_ar[U][G][U][C][G][A][G][U] =  2.000;
+ int22_ar[U][G][U][C][G][C][G][U] =  2.000;
+ int22_ar[U][G][U][C][G][G][G][U] =  2.000;
+ int22_ar[U][G][U][C][G][U][G][U] =  2.000;
+ int22_ar[U][G][U][C][U][A][G][U] =  2.000;
+ int22_ar[U][G][U][C][U][C][G][U] =  2.500;
+ int22_ar[U][G][U][C][U][G][G][U] =  0.700;
+ int22_ar[U][G][U][C][U][U][G][U] =  1.600;
+ int22_ar[U][G][U][G][A][A][G][U] =  2.000;
+ int22_ar[U][G][U][G][A][C][G][U] =  2.500;
+ int22_ar[U][G][U][G][A][G][G][U] =  0.500;
+ int22_ar[U][G][U][G][A][U][G][U] =  2.500;
+ int22_ar[U][G][U][G][C][A][G][U] =  2.000;
+ int22_ar[U][G][U][G][C][C][G][U] =  2.000;
+ int22_ar[U][G][U][G][C][G][G][U] =  2.000;
+ int22_ar[U][G][U][G][C][U][G][U] =  2.000;
+ int22_ar[U][G][U][G][G][A][G][U] =  2.000;
+ int22_ar[U][G][U][G][G][C][G][U] =  2.700;
+ int22_ar[U][G][U][G][G][G][G][U] =  0.300;
+ int22_ar[U][G][U][G][G][U][G][U] =  2.200;
+ int22_ar[U][G][U][G][U][A][G][U] =  2.000;
+ int22_ar[U][G][U][G][U][C][G][U] =  1.300;
+ int22_ar[U][G][U][G][U][G][G][U] = -2.500;
+ int22_ar[U][G][U][G][U][U][G][U] =  1.300;
+ int22_ar[U][G][U][U][A][A][G][U] =  2.000;
+ int22_ar[U][G][U][U][A][C][G][U] =  2.000;
+ int22_ar[U][G][U][U][A][G][G][U] =  2.000;
+ int22_ar[U][G][U][U][A][U][G][U] =  2.000;
+ int22_ar[U][G][U][U][C][A][G][U] =  2.000;
+ int22_ar[U][G][U][U][C][C][G][U] =  2.500;
+ int22_ar[U][G][U][U][C][G][G][U] =  0.700;
+ int22_ar[U][G][U][U][C][U][G][U] =  1.600;
+ int22_ar[U][G][U][U][G][A][G][U] =  2.000;
+ int22_ar[U][G][U][U][G][C][G][U] =  2.300;
+ int22_ar[U][G][U][U][G][G][G][U] = -1.500;
+ int22_ar[U][G][U][U][G][U][G][U] =  2.300;
+ int22_ar[U][G][U][U][U][A][G][U] =  2.000;
+ int22_ar[U][G][U][U][U][C][G][U] =  1.700;
+ int22_ar[U][G][U][U][U][G][G][U] =  0.700;
+ int22_ar[U][G][U][U][U][U][G][U] =  0.800;
+ int22_ar[U][G][A][A][A][A][U][A] =  2.800;
+ int22_ar[U][G][A][A][A][C][U][A] =  2.800;
+ int22_ar[U][G][A][A][A][G][U][A] =  1.700;
+ int22_ar[U][G][A][A][A][U][U][A] =  2.000;
+ int22_ar[U][G][A][A][C][A][U][A] =  2.300;
+ int22_ar[U][G][A][A][C][C][U][A] =  2.300;
+ int22_ar[U][G][A][A][C][G][U][A] =  1.300;
+ int22_ar[U][G][A][A][C][U][U][A] =  2.000;
+ int22_ar[U][G][A][A][G][A][U][A] =  1.700;
+ int22_ar[U][G][A][A][G][C][U][A] =  1.700;
+ int22_ar[U][G][A][A][G][G][U][A] =  0.700;
+ int22_ar[U][G][A][A][G][U][U][A] =  2.000;
+ int22_ar[U][G][A][A][U][A][U][A] =  2.000;
+ int22_ar[U][G][A][A][U][C][U][A] =  2.000;
+ int22_ar[U][G][A][A][U][G][U][A] =  2.000;
+ int22_ar[U][G][A][A][U][U][U][A] =  2.000;
+ int22_ar[U][G][A][C][A][A][U][A] =  2.800;
+ int22_ar[U][G][A][C][A][C][U][A] =  2.800;
+ int22_ar[U][G][A][C][A][G][U][A] =  1.700;
+ int22_ar[U][G][A][C][A][U][U][A] =  2.000;
+ int22_ar[U][G][A][C][C][A][U][A] =  3.400;
+ int22_ar[U][G][A][C][C][C][U][A] =  2.800;
+ int22_ar[U][G][A][C][C][G][U][A] =  2.700;
+ int22_ar[U][G][A][C][C][U][U][A] =  2.000;
+ int22_ar[U][G][A][C][G][A][U][A] =  2.000;
+ int22_ar[U][G][A][C][G][C][U][A] =  2.000;
+ int22_ar[U][G][A][C][G][G][U][A] =  2.000;
+ int22_ar[U][G][A][C][G][U][U][A] =  2.000;
+ int22_ar[U][G][A][C][U][A][U][A] =  3.400;
+ int22_ar[U][G][A][C][U][C][U][A] =  2.800;
+ int22_ar[U][G][A][C][U][G][U][A] =  2.700;
+ int22_ar[U][G][A][C][U][U][U][A] =  2.000;
+ int22_ar[U][G][A][G][A][A][U][A] =  1.700;
+ int22_ar[U][G][A][G][A][C][U][A] =  1.700;
+ int22_ar[U][G][A][G][A][G][U][A] =  0.700;
+ int22_ar[U][G][A][G][A][U][U][A] =  2.000;
+ int22_ar[U][G][A][G][C][A][U][A] =  2.000;
+ int22_ar[U][G][A][G][C][C][U][A] =  2.000;
+ int22_ar[U][G][A][G][C][G][U][A] =  2.000;
+ int22_ar[U][G][A][G][C][U][U][A] =  2.000;
+ int22_ar[U][G][A][G][G][A][U][A] =  2.100;
+ int22_ar[U][G][A][G][G][C][U][A] =  2.100;
+ int22_ar[U][G][A][G][G][G][U][A] =  1.100;
+ int22_ar[U][G][A][G][G][U][U][A] =  2.000;
+ int22_ar[U][G][A][G][U][A][U][A] =  1.000;
+ int22_ar[U][G][A][G][U][C][U][A] =  0.000;
+ int22_ar[U][G][A][G][U][G][U][A] =  0.700;
+ int22_ar[U][G][A][G][U][U][U][A] =  2.000;
+ int22_ar[U][G][A][U][A][A][U][A] =  2.000;
+ int22_ar[U][G][A][U][A][C][U][A] =  2.000;
+ int22_ar[U][G][A][U][A][G][U][A] =  2.000;
+ int22_ar[U][G][A][U][A][U][U][A] =  2.000;
+ int22_ar[U][G][A][U][C][A][U][A] =  3.100;
+ int22_ar[U][G][A][U][C][C][U][A] =  2.500;
+ int22_ar[U][G][A][U][C][G][U][A] =  2.400;
+ int22_ar[U][G][A][U][C][U][U][A] =  2.000;
+ int22_ar[U][G][A][U][G][A][U][A] =  2.200;
+ int22_ar[U][G][A][U][G][C][U][A] =  1.200;
+ int22_ar[U][G][A][U][G][G][U][A] =  2.000;
+ int22_ar[U][G][A][U][G][U][U][A] =  2.000;
+ int22_ar[U][G][A][U][U][A][U][A] =  2.900;
+ int22_ar[U][G][A][U][U][C][U][A] =  1.900;
+ int22_ar[U][G][A][U][U][G][U][A] =  2.700;
+ int22_ar[U][G][A][U][U][U][U][A] =  2.000;
+ int22_ar[U][G][C][A][A][A][U][A] =  2.300;
+ int22_ar[U][G][C][A][A][C][U][A] =  3.400;
+ int22_ar[U][G][C][A][A][G][U][A] =  2.000;
+ int22_ar[U][G][C][A][A][U][U][A] =  3.100;
+ int22_ar[U][G][C][A][C][A][U][A] =  1.900;
+ int22_ar[U][G][C][A][C][C][U][A] =  2.300;
+ int22_ar[U][G][C][A][C][G][U][A] =  2.000;
+ int22_ar[U][G][C][A][C][U][U][A] =  2.000;
+ int22_ar[U][G][C][A][G][A][U][A] =  1.300;
+ int22_ar[U][G][C][A][G][C][U][A] =  2.700;
+ int22_ar[U][G][C][A][G][G][U][A] =  2.000;
+ int22_ar[U][G][C][A][G][U][U][A] =  2.400;
+ int22_ar[U][G][C][A][U][A][U][A] =  2.000;
+ int22_ar[U][G][C][A][U][C][U][A] =  2.000;
+ int22_ar[U][G][C][A][U][G][U][A] =  2.000;
+ int22_ar[U][G][C][A][U][U][U][A] =  2.000;
+ int22_ar[U][G][C][C][A][A][U][A] =  2.300;
+ int22_ar[U][G][C][C][A][C][U][A] =  2.800;
+ int22_ar[U][G][C][C][A][G][U][A] =  2.000;
+ int22_ar[U][G][C][C][A][U][U][A] =  2.500;
+ int22_ar[U][G][C][C][C][A][U][A] =  2.300;
+ int22_ar[U][G][C][C][C][C][U][A] =  2.800;
+ int22_ar[U][G][C][C][C][G][U][A] =  2.000;
+ int22_ar[U][G][C][C][C][U][U][A] =  2.500;
+ int22_ar[U][G][C][C][G][A][U][A] =  2.000;
+ int22_ar[U][G][C][C][G][C][U][A] =  2.000;
+ int22_ar[U][G][C][C][G][G][U][A] =  2.000;
+ int22_ar[U][G][C][C][G][U][U][A] =  2.000;
+ int22_ar[U][G][C][C][U][A][U][A] =  2.300;
+ int22_ar[U][G][C][C][U][C][U][A] =  2.800;
+ int22_ar[U][G][C][C][U][G][U][A] =  2.000;
+ int22_ar[U][G][C][C][U][U][U][A] =  2.500;
+ int22_ar[U][G][C][G][A][A][U][A] =  1.300;
+ int22_ar[U][G][C][G][A][C][U][A] =  2.700;
+ int22_ar[U][G][C][G][A][G][U][A] =  2.000;
+ int22_ar[U][G][C][G][A][U][U][A] =  2.400;
+ int22_ar[U][G][C][G][C][A][U][A] =  2.000;
+ int22_ar[U][G][C][G][C][C][U][A] =  2.000;
+ int22_ar[U][G][C][G][C][G][U][A] =  2.000;
+ int22_ar[U][G][C][G][C][U][U][A] =  2.000;
+ int22_ar[U][G][C][G][G][A][U][A] =  1.700;
+ int22_ar[U][G][C][G][G][C][U][A] =  2.700;
+ int22_ar[U][G][C][G][G][G][U][A] =  2.000;
+ int22_ar[U][G][C][G][G][U][U][A] =  2.400;
+ int22_ar[U][G][C][G][U][A][U][A] = -0.500;
+ int22_ar[U][G][C][G][U][C][U][A] =  1.000;
+ int22_ar[U][G][C][G][U][G][U][A] =  2.000;
+ int22_ar[U][G][C][G][U][U][U][A] =  0.700;
+ int22_ar[U][G][C][U][A][A][U][A] =  2.000;
+ int22_ar[U][G][C][U][A][C][U][A] =  2.000;
+ int22_ar[U][G][C][U][A][G][U][A] =  2.000;
+ int22_ar[U][G][C][U][A][U][U][A] =  2.000;
+ int22_ar[U][G][C][U][C][A][U][A] =  2.000;
+ int22_ar[U][G][C][U][C][C][U][A] =  2.500;
+ int22_ar[U][G][C][U][C][G][U][A] =  2.000;
+ int22_ar[U][G][C][U][C][U][U][A] =  2.200;
+ int22_ar[U][G][C][U][G][A][U][A] =  0.800;
+ int22_ar[U][G][C][U][G][C][U][A] =  2.200;
+ int22_ar[U][G][C][U][G][G][U][A] =  2.000;
+ int22_ar[U][G][C][U][G][U][U][A] =  1.900;
+ int22_ar[U][G][C][U][U][A][U][A] =  1.500;
+ int22_ar[U][G][C][U][U][C][U][A] =  1.900;
+ int22_ar[U][G][C][U][U][G][U][A] =  2.000;
+ int22_ar[U][G][C][U][U][U][U][A] =  1.600;
+ int22_ar[U][G][G][A][A][A][U][A] =  1.700;
+ int22_ar[U][G][G][A][A][C][U][A] =  2.000;
+ int22_ar[U][G][G][A][A][G][U][A] =  2.100;
+ int22_ar[U][G][G][A][A][U][U][A] =  2.200;
+ int22_ar[U][G][G][A][C][A][U][A] =  1.300;
+ int22_ar[U][G][G][A][C][C][U][A] =  2.000;
+ int22_ar[U][G][G][A][C][G][U][A] =  1.700;
+ int22_ar[U][G][G][A][C][U][U][A] =  0.800;
+ int22_ar[U][G][G][A][G][A][U][A] =  0.700;
+ int22_ar[U][G][G][A][G][C][U][A] =  2.000;
+ int22_ar[U][G][G][A][G][G][U][A] =  1.100;
+ int22_ar[U][G][G][A][G][U][U][A] =  2.000;
+ int22_ar[U][G][G][A][U][A][U][A] =  2.000;
+ int22_ar[U][G][G][A][U][C][U][A] =  2.000;
+ int22_ar[U][G][G][A][U][G][U][A] =  2.000;
+ int22_ar[U][G][G][A][U][U][U][A] =  2.000;
+ int22_ar[U][G][G][C][A][A][U][A] =  1.700;
+ int22_ar[U][G][G][C][A][C][U][A] =  2.000;
+ int22_ar[U][G][G][C][A][G][U][A] =  2.100;
+ int22_ar[U][G][G][C][A][U][U][A] =  1.200;
+ int22_ar[U][G][G][C][C][A][U][A] =  2.700;
+ int22_ar[U][G][G][C][C][C][U][A] =  2.000;
+ int22_ar[U][G][G][C][C][G][U][A] =  2.700;
+ int22_ar[U][G][G][C][C][U][U][A] =  2.200;
+ int22_ar[U][G][G][C][G][A][U][A] =  2.000;
+ int22_ar[U][G][G][C][G][C][U][A] =  2.000;
+ int22_ar[U][G][G][C][G][G][U][A] =  2.000;
+ int22_ar[U][G][G][C][G][U][U][A] =  2.000;
+ int22_ar[U][G][G][C][U][A][U][A] =  2.700;
+ int22_ar[U][G][G][C][U][C][U][A] =  2.000;
+ int22_ar[U][G][G][C][U][G][U][A] =  2.700;
+ int22_ar[U][G][G][C][U][U][U][A] =  2.200;
+ int22_ar[U][G][G][G][A][A][U][A] =  0.700;
+ int22_ar[U][G][G][G][A][C][U][A] =  2.000;
+ int22_ar[U][G][G][G][A][G][U][A] =  1.100;
+ int22_ar[U][G][G][G][A][U][U][A] =  2.000;
+ int22_ar[U][G][G][G][C][A][U][A] =  2.000;
+ int22_ar[U][G][G][G][C][C][U][A] =  2.000;
+ int22_ar[U][G][G][G][C][G][U][A] =  2.000;
+ int22_ar[U][G][G][G][C][U][U][A] =  2.000;
+ int22_ar[U][G][G][G][G][A][U][A] =  1.100;
+ int22_ar[U][G][G][G][G][C][U][A] =  2.000;
+ int22_ar[U][G][G][G][G][G][U][A] =  1.500;
+ int22_ar[U][G][G][G][G][U][U][A] =  1.600;
+ int22_ar[U][G][G][G][U][A][U][A] =  0.700;
+ int22_ar[U][G][G][G][U][C][U][A] =  2.000;
+ int22_ar[U][G][G][G][U][G][U][A] =  0.300;
+ int22_ar[U][G][G][G][U][U][U][A] = -1.600;
+ int22_ar[U][G][G][U][A][A][U][A] =  2.000;
+ int22_ar[U][G][G][U][A][C][U][A] =  2.000;
+ int22_ar[U][G][G][U][A][G][U][A] =  2.000;
+ int22_ar[U][G][G][U][A][U][U][A] =  2.000;
+ int22_ar[U][G][G][U][C][A][U][A] =  2.400;
+ int22_ar[U][G][G][U][C][C][U][A] =  2.000;
+ int22_ar[U][G][G][U][C][G][U][A] =  2.400;
+ int22_ar[U][G][G][U][C][U][U][A] =  1.900;
+ int22_ar[U][G][G][U][G][A][U][A] =  2.000;
+ int22_ar[U][G][G][U][G][C][U][A] =  2.000;
+ int22_ar[U][G][G][U][G][G][U][A] =  1.600;
+ int22_ar[U][G][G][U][G][U][U][A] = -0.300;
+ int22_ar[U][G][G][U][U][A][U][A] =  2.700;
+ int22_ar[U][G][G][U][U][C][U][A] =  2.000;
+ int22_ar[U][G][G][U][U][G][U][A] =  2.300;
+ int22_ar[U][G][G][U][U][U][U][A] =  2.200;
+ int22_ar[U][G][U][A][A][A][U][A] =  2.000;
+ int22_ar[U][G][U][A][A][C][U][A] =  3.400;
+ int22_ar[U][G][U][A][A][G][U][A] =  1.000;
+ int22_ar[U][G][U][A][A][U][U][A] =  2.900;
+ int22_ar[U][G][U][A][C][A][U][A] =  2.000;
+ int22_ar[U][G][U][A][C][C][U][A] =  2.300;
+ int22_ar[U][G][U][A][C][G][U][A] = -0.500;
+ int22_ar[U][G][U][A][C][U][U][A] =  1.500;
+ int22_ar[U][G][U][A][G][A][U][A] =  2.000;
+ int22_ar[U][G][U][A][G][C][U][A] =  2.700;
+ int22_ar[U][G][U][A][G][G][U][A] =  0.700;
+ int22_ar[U][G][U][A][G][U][U][A] =  2.700;
+ int22_ar[U][G][U][A][U][A][U][A] =  2.000;
+ int22_ar[U][G][U][A][U][C][U][A] =  2.000;
+ int22_ar[U][G][U][A][U][G][U][A] =  2.000;
+ int22_ar[U][G][U][A][U][U][U][A] =  2.000;
+ int22_ar[U][G][U][C][A][A][U][A] =  2.000;
+ int22_ar[U][G][U][C][A][C][U][A] =  2.800;
+ int22_ar[U][G][U][C][A][G][U][A] =  0.000;
+ int22_ar[U][G][U][C][A][U][U][A] =  1.900;
+ int22_ar[U][G][U][C][C][A][U][A] =  2.000;
+ int22_ar[U][G][U][C][C][C][U][A] =  2.800;
+ int22_ar[U][G][U][C][C][G][U][A] =  1.000;
+ int22_ar[U][G][U][C][C][U][U][A] =  1.900;
+ int22_ar[U][G][U][C][G][A][U][A] =  2.000;
+ int22_ar[U][G][U][C][G][C][U][A] =  2.000;
+ int22_ar[U][G][U][C][G][G][U][A] =  2.000;
+ int22_ar[U][G][U][C][G][U][U][A] =  2.000;
+ int22_ar[U][G][U][C][U][A][U][A] =  2.000;
+ int22_ar[U][G][U][C][U][C][U][A] =  2.800;
+ int22_ar[U][G][U][C][U][G][U][A] =  1.000;
+ int22_ar[U][G][U][C][U][U][U][A] =  1.900;
+ int22_ar[U][G][U][G][A][A][U][A] =  2.000;
+ int22_ar[U][G][U][G][A][C][U][A] =  2.700;
+ int22_ar[U][G][U][G][A][G][U][A] =  0.700;
+ int22_ar[U][G][U][G][A][U][U][A] =  2.700;
+ int22_ar[U][G][U][G][C][A][U][A] =  2.000;
+ int22_ar[U][G][U][G][C][C][U][A] =  2.000;
+ int22_ar[U][G][U][G][C][G][U][A] =  2.000;
+ int22_ar[U][G][U][G][C][U][U][A] =  2.000;
+ int22_ar[U][G][U][G][G][A][U][A] =  2.000;
+ int22_ar[U][G][U][G][G][C][U][A] =  2.700;
+ int22_ar[U][G][U][G][G][G][U][A] =  0.300;
+ int22_ar[U][G][U][G][G][U][U][A] =  2.300;
+ int22_ar[U][G][U][G][U][A][U][A] =  2.000;
+ int22_ar[U][G][U][G][U][C][U][A] =  1.000;
+ int22_ar[U][G][U][G][U][G][U][A] = -2.900;
+ int22_ar[U][G][U][G][U][U][U][A] =  0.900;
+ int22_ar[U][G][U][U][A][A][U][A] =  2.000;
+ int22_ar[U][G][U][U][A][C][U][A] =  2.000;
+ int22_ar[U][G][U][U][A][G][U][A] =  2.000;
+ int22_ar[U][G][U][U][A][U][U][A] =  2.000;
+ int22_ar[U][G][U][U][C][A][U][A] =  2.000;
+ int22_ar[U][G][U][U][C][C][U][A] =  2.500;
+ int22_ar[U][G][U][U][C][G][U][A] =  0.700;
+ int22_ar[U][G][U][U][C][U][U][A] =  1.600;
+ int22_ar[U][G][U][U][G][A][U][A] =  2.000;
+ int22_ar[U][G][U][U][G][C][U][A] =  2.200;
+ int22_ar[U][G][U][U][G][G][U][A] = -1.600;
+ int22_ar[U][G][U][U][G][U][U][A] =  2.200;
+ int22_ar[U][G][U][U][U][A][U][A] =  2.000;
+ int22_ar[U][G][U][U][U][C][U][A] =  1.900;
+ int22_ar[U][G][U][U][U][G][U][A] =  0.900;
+ int22_ar[U][G][U][U][U][U][U][A] =  1.100;
+ int22_ar[U][G][A][A][A][A][U][G] =  2.800;
+ int22_ar[U][G][A][A][A][C][U][G] =  2.800;
+ int22_ar[U][G][A][A][A][G][U][G] =  1.700;
+ int22_ar[U][G][A][A][A][U][U][G] =  2.000;
+ int22_ar[U][G][A][A][C][A][U][G] =  2.300;
+ int22_ar[U][G][A][A][C][C][U][G] =  2.300;
+ int22_ar[U][G][A][A][C][G][U][G] =  1.300;
+ int22_ar[U][G][A][A][C][U][U][G] =  2.000;
+ int22_ar[U][G][A][A][G][A][U][G] =  1.700;
+ int22_ar[U][G][A][A][G][C][U][G] =  1.700;
+ int22_ar[U][G][A][A][G][G][U][G] =  0.700;
+ int22_ar[U][G][A][A][G][U][U][G] =  2.000;
+ int22_ar[U][G][A][A][U][A][U][G] =  2.000;
+ int22_ar[U][G][A][A][U][C][U][G] =  2.000;
+ int22_ar[U][G][A][A][U][G][U][G] =  2.000;
+ int22_ar[U][G][A][A][U][U][U][G] =  2.000;
+ int22_ar[U][G][A][C][A][A][U][G] =  2.800;
+ int22_ar[U][G][A][C][A][C][U][G] =  2.800;
+ int22_ar[U][G][A][C][A][G][U][G] =  1.700;
+ int22_ar[U][G][A][C][A][U][U][G] =  2.000;
+ int22_ar[U][G][A][C][C][A][U][G] =  3.400;
+ int22_ar[U][G][A][C][C][C][U][G] =  2.800;
+ int22_ar[U][G][A][C][C][G][U][G] =  2.700;
+ int22_ar[U][G][A][C][C][U][U][G] =  2.000;
+ int22_ar[U][G][A][C][G][A][U][G] =  2.000;
+ int22_ar[U][G][A][C][G][C][U][G] =  2.000;
+ int22_ar[U][G][A][C][G][G][U][G] =  2.000;
+ int22_ar[U][G][A][C][G][U][U][G] =  2.000;
+ int22_ar[U][G][A][C][U][A][U][G] =  3.400;
+ int22_ar[U][G][A][C][U][C][U][G] =  2.800;
+ int22_ar[U][G][A][C][U][G][U][G] =  2.700;
+ int22_ar[U][G][A][C][U][U][U][G] =  2.000;
+ int22_ar[U][G][A][G][A][A][U][G] =  1.700;
+ int22_ar[U][G][A][G][A][C][U][G] =  1.700;
+ int22_ar[U][G][A][G][A][G][U][G] =  0.700;
+ int22_ar[U][G][A][G][A][U][U][G] =  2.000;
+ int22_ar[U][G][A][G][C][A][U][G] =  2.000;
+ int22_ar[U][G][A][G][C][C][U][G] =  2.000;
+ int22_ar[U][G][A][G][C][G][U][G] =  2.000;
+ int22_ar[U][G][A][G][C][U][U][G] =  2.000;
+ int22_ar[U][G][A][G][G][A][U][G] =  2.100;
+ int22_ar[U][G][A][G][G][C][U][G] =  2.100;
+ int22_ar[U][G][A][G][G][G][U][G] =  1.100;
+ int22_ar[U][G][A][G][G][U][U][G] =  2.000;
+ int22_ar[U][G][A][G][U][A][U][G] =  1.000;
+ int22_ar[U][G][A][G][U][C][U][G] =  0.000;
+ int22_ar[U][G][A][G][U][G][U][G] =  0.700;
+ int22_ar[U][G][A][G][U][U][U][G] =  2.000;
+ int22_ar[U][G][A][U][A][A][U][G] =  2.000;
+ int22_ar[U][G][A][U][A][C][U][G] =  2.000;
+ int22_ar[U][G][A][U][A][G][U][G] =  2.000;
+ int22_ar[U][G][A][U][A][U][U][G] =  2.000;
+ int22_ar[U][G][A][U][C][A][U][G] =  3.100;
+ int22_ar[U][G][A][U][C][C][U][G] =  2.500;
+ int22_ar[U][G][A][U][C][G][U][G] =  2.400;
+ int22_ar[U][G][A][U][C][U][U][G] =  2.000;
+ int22_ar[U][G][A][U][G][A][U][G] =  2.200;
+ int22_ar[U][G][A][U][G][C][U][G] =  1.200;
+ int22_ar[U][G][A][U][G][G][U][G] =  2.000;
+ int22_ar[U][G][A][U][G][U][U][G] =  2.000;
+ int22_ar[U][G][A][U][U][A][U][G] =  2.900;
+ int22_ar[U][G][A][U][U][C][U][G] =  1.900;
+ int22_ar[U][G][A][U][U][G][U][G] =  2.700;
+ int22_ar[U][G][A][U][U][U][U][G] =  2.000;
+ int22_ar[U][G][C][A][A][A][U][G] =  2.300;
+ int22_ar[U][G][C][A][A][C][U][G] =  3.400;
+ int22_ar[U][G][C][A][A][G][U][G] =  2.000;
+ int22_ar[U][G][C][A][A][U][U][G] =  3.100;
+ int22_ar[U][G][C][A][C][A][U][G] =  1.900;
+ int22_ar[U][G][C][A][C][C][U][G] =  2.300;
+ int22_ar[U][G][C][A][C][G][U][G] =  2.000;
+ int22_ar[U][G][C][A][C][U][U][G] =  2.000;
+ int22_ar[U][G][C][A][G][A][U][G] =  1.300;
+ int22_ar[U][G][C][A][G][C][U][G] =  2.700;
+ int22_ar[U][G][C][A][G][G][U][G] =  2.000;
+ int22_ar[U][G][C][A][G][U][U][G] =  2.400;
+ int22_ar[U][G][C][A][U][A][U][G] =  2.000;
+ int22_ar[U][G][C][A][U][C][U][G] =  2.000;
+ int22_ar[U][G][C][A][U][G][U][G] =  2.000;
+ int22_ar[U][G][C][A][U][U][U][G] =  2.000;
+ int22_ar[U][G][C][C][A][A][U][G] =  2.300;
+ int22_ar[U][G][C][C][A][C][U][G] =  2.800;
+ int22_ar[U][G][C][C][A][G][U][G] =  2.000;
+ int22_ar[U][G][C][C][A][U][U][G] =  2.500;
+ int22_ar[U][G][C][C][C][A][U][G] =  2.300;
+ int22_ar[U][G][C][C][C][C][U][G] =  2.800;
+ int22_ar[U][G][C][C][C][G][U][G] =  2.000;
+ int22_ar[U][G][C][C][C][U][U][G] =  2.500;
+ int22_ar[U][G][C][C][G][A][U][G] =  2.000;
+ int22_ar[U][G][C][C][G][C][U][G] =  2.000;
+ int22_ar[U][G][C][C][G][G][U][G] =  2.000;
+ int22_ar[U][G][C][C][G][U][U][G] =  2.000;
+ int22_ar[U][G][C][C][U][A][U][G] =  2.300;
+ int22_ar[U][G][C][C][U][C][U][G] =  2.800;
+ int22_ar[U][G][C][C][U][G][U][G] =  2.000;
+ int22_ar[U][G][C][C][U][U][U][G] =  2.500;
+ int22_ar[U][G][C][G][A][A][U][G] =  1.300;
+ int22_ar[U][G][C][G][A][C][U][G] =  2.700;
+ int22_ar[U][G][C][G][A][G][U][G] =  2.000;
+ int22_ar[U][G][C][G][A][U][U][G] =  2.400;
+ int22_ar[U][G][C][G][C][A][U][G] =  2.000;
+ int22_ar[U][G][C][G][C][C][U][G] =  2.000;
+ int22_ar[U][G][C][G][C][G][U][G] =  2.000;
+ int22_ar[U][G][C][G][C][U][U][G] =  2.000;
+ int22_ar[U][G][C][G][G][A][U][G] =  1.700;
+ int22_ar[U][G][C][G][G][C][U][G] =  2.700;
+ int22_ar[U][G][C][G][G][G][U][G] =  2.000;
+ int22_ar[U][G][C][G][G][U][U][G] =  2.400;
+ int22_ar[U][G][C][G][U][A][U][G] = -0.500;
+ int22_ar[U][G][C][G][U][C][U][G] =  1.000;
+ int22_ar[U][G][C][G][U][G][U][G] =  2.000;
+ int22_ar[U][G][C][G][U][U][U][G] =  0.700;
+ int22_ar[U][G][C][U][A][A][U][G] =  2.000;
+ int22_ar[U][G][C][U][A][C][U][G] =  2.000;
+ int22_ar[U][G][C][U][A][G][U][G] =  2.000;
+ int22_ar[U][G][C][U][A][U][U][G] =  2.000;
+ int22_ar[U][G][C][U][C][A][U][G] =  2.000;
+ int22_ar[U][G][C][U][C][C][U][G] =  2.500;
+ int22_ar[U][G][C][U][C][G][U][G] =  2.000;
+ int22_ar[U][G][C][U][C][U][U][G] =  2.200;
+ int22_ar[U][G][C][U][G][A][U][G] =  0.800;
+ int22_ar[U][G][C][U][G][C][U][G] =  2.200;
+ int22_ar[U][G][C][U][G][G][U][G] =  2.000;
+ int22_ar[U][G][C][U][G][U][U][G] =  1.900;
+ int22_ar[U][G][C][U][U][A][U][G] =  1.500;
+ int22_ar[U][G][C][U][U][C][U][G] =  1.900;
+ int22_ar[U][G][C][U][U][G][U][G] =  2.000;
+ int22_ar[U][G][C][U][U][U][U][G] =  1.600;
+ int22_ar[U][G][G][A][A][A][U][G] =  1.700;
+ int22_ar[U][G][G][A][A][C][U][G] =  2.000;
+ int22_ar[U][G][G][A][A][G][U][G] =  2.100;
+ int22_ar[U][G][G][A][A][U][U][G] =  2.200;
+ int22_ar[U][G][G][A][C][A][U][G] =  1.300;
+ int22_ar[U][G][G][A][C][C][U][G] =  2.000;
+ int22_ar[U][G][G][A][C][G][U][G] =  1.700;
+ int22_ar[U][G][G][A][C][U][U][G] =  0.800;
+ int22_ar[U][G][G][A][G][A][U][G] =  0.700;
+ int22_ar[U][G][G][A][G][C][U][G] =  2.000;
+ int22_ar[U][G][G][A][G][G][U][G] =  1.100;
+ int22_ar[U][G][G][A][G][U][U][G] =  2.000;
+ int22_ar[U][G][G][A][U][A][U][G] =  2.000;
+ int22_ar[U][G][G][A][U][C][U][G] =  2.000;
+ int22_ar[U][G][G][A][U][G][U][G] =  2.000;
+ int22_ar[U][G][G][A][U][U][U][G] =  2.000;
+ int22_ar[U][G][G][C][A][A][U][G] =  1.700;
+ int22_ar[U][G][G][C][A][C][U][G] =  2.000;
+ int22_ar[U][G][G][C][A][G][U][G] =  2.100;
+ int22_ar[U][G][G][C][A][U][U][G] =  1.200;
+ int22_ar[U][G][G][C][C][A][U][G] =  2.700;
+ int22_ar[U][G][G][C][C][C][U][G] =  2.000;
+ int22_ar[U][G][G][C][C][G][U][G] =  2.700;
+ int22_ar[U][G][G][C][C][U][U][G] =  2.200;
+ int22_ar[U][G][G][C][G][A][U][G] =  2.000;
+ int22_ar[U][G][G][C][G][C][U][G] =  2.000;
+ int22_ar[U][G][G][C][G][G][U][G] =  2.000;
+ int22_ar[U][G][G][C][G][U][U][G] =  2.000;
+ int22_ar[U][G][G][C][U][A][U][G] =  2.700;
+ int22_ar[U][G][G][C][U][C][U][G] =  2.000;
+ int22_ar[U][G][G][C][U][G][U][G] =  2.700;
+ int22_ar[U][G][G][C][U][U][U][G] =  2.200;
+ int22_ar[U][G][G][G][A][A][U][G] =  0.700;
+ int22_ar[U][G][G][G][A][C][U][G] =  2.000;
+ int22_ar[U][G][G][G][A][G][U][G] =  1.100;
+ int22_ar[U][G][G][G][A][U][U][G] =  2.000;
+ int22_ar[U][G][G][G][C][A][U][G] =  2.000;
+ int22_ar[U][G][G][G][C][C][U][G] =  2.000;
+ int22_ar[U][G][G][G][C][G][U][G] =  2.000;
+ int22_ar[U][G][G][G][C][U][U][G] =  2.000;
+ int22_ar[U][G][G][G][G][A][U][G] =  1.100;
+ int22_ar[U][G][G][G][G][C][U][G] =  2.000;
+ int22_ar[U][G][G][G][G][G][U][G] =  1.500;
+ int22_ar[U][G][G][G][G][U][U][G] =  1.600;
+ int22_ar[U][G][G][G][U][A][U][G] =  0.700;
+ int22_ar[U][G][G][G][U][C][U][G] =  2.000;
+ int22_ar[U][G][G][G][U][G][U][G] =  0.300;
+ int22_ar[U][G][G][G][U][U][U][G] = -1.600;
+ int22_ar[U][G][G][U][A][A][U][G] =  2.000;
+ int22_ar[U][G][G][U][A][C][U][G] =  2.000;
+ int22_ar[U][G][G][U][A][G][U][G] =  2.000;
+ int22_ar[U][G][G][U][A][U][U][G] =  2.000;
+ int22_ar[U][G][G][U][C][A][U][G] =  2.400;
+ int22_ar[U][G][G][U][C][C][U][G] =  2.000;
+ int22_ar[U][G][G][U][C][G][U][G] =  2.400;
+ int22_ar[U][G][G][U][C][U][U][G] =  1.900;
+ int22_ar[U][G][G][U][G][A][U][G] =  2.000;
+ int22_ar[U][G][G][U][G][C][U][G] =  2.000;
+ int22_ar[U][G][G][U][G][G][U][G] =  1.600;
+ int22_ar[U][G][G][U][G][U][U][G] = -0.300;
+ int22_ar[U][G][G][U][U][A][U][G] =  2.700;
+ int22_ar[U][G][G][U][U][C][U][G] =  2.000;
+ int22_ar[U][G][G][U][U][G][U][G] =  2.300;
+ int22_ar[U][G][G][U][U][U][U][G] =  2.200;
+ int22_ar[U][G][U][A][A][A][U][G] =  2.000;
+ int22_ar[U][G][U][A][A][C][U][G] =  3.400;
+ int22_ar[U][G][U][A][A][G][U][G] =  1.000;
+ int22_ar[U][G][U][A][A][U][U][G] =  2.900;
+ int22_ar[U][G][U][A][C][A][U][G] =  2.000;
+ int22_ar[U][G][U][A][C][C][U][G] =  2.300;
+ int22_ar[U][G][U][A][C][G][U][G] = -0.500;
+ int22_ar[U][G][U][A][C][U][U][G] =  1.500;
+ int22_ar[U][G][U][A][G][A][U][G] =  2.000;
+ int22_ar[U][G][U][A][G][C][U][G] =  2.700;
+ int22_ar[U][G][U][A][G][G][U][G] =  0.700;
+ int22_ar[U][G][U][A][G][U][U][G] =  2.700;
+ int22_ar[U][G][U][A][U][A][U][G] =  2.000;
+ int22_ar[U][G][U][A][U][C][U][G] =  2.000;
+ int22_ar[U][G][U][A][U][G][U][G] =  2.000;
+ int22_ar[U][G][U][A][U][U][U][G] =  2.000;
+ int22_ar[U][G][U][C][A][A][U][G] =  2.000;
+ int22_ar[U][G][U][C][A][C][U][G] =  2.800;
+ int22_ar[U][G][U][C][A][G][U][G] =  0.000;
+ int22_ar[U][G][U][C][A][U][U][G] =  1.900;
+ int22_ar[U][G][U][C][C][A][U][G] =  2.000;
+ int22_ar[U][G][U][C][C][C][U][G] =  2.800;
+ int22_ar[U][G][U][C][C][G][U][G] =  1.000;
+ int22_ar[U][G][U][C][C][U][U][G] =  1.900;
+ int22_ar[U][G][U][C][G][A][U][G] =  2.000;
+ int22_ar[U][G][U][C][G][C][U][G] =  2.000;
+ int22_ar[U][G][U][C][G][G][U][G] =  2.000;
+ int22_ar[U][G][U][C][G][U][U][G] =  2.000;
+ int22_ar[U][G][U][C][U][A][U][G] =  2.000;
+ int22_ar[U][G][U][C][U][C][U][G] =  2.800;
+ int22_ar[U][G][U][C][U][G][U][G] =  1.000;
+ int22_ar[U][G][U][C][U][U][U][G] =  1.900;
+ int22_ar[U][G][U][G][A][A][U][G] =  2.000;
+ int22_ar[U][G][U][G][A][C][U][G] =  2.700;
+ int22_ar[U][G][U][G][A][G][U][G] =  0.700;
+ int22_ar[U][G][U][G][A][U][U][G] =  2.700;
+ int22_ar[U][G][U][G][C][A][U][G] =  2.000;
+ int22_ar[U][G][U][G][C][C][U][G] =  2.000;
+ int22_ar[U][G][U][G][C][G][U][G] =  2.000;
+ int22_ar[U][G][U][G][C][U][U][G] =  2.000;
+ int22_ar[U][G][U][G][G][A][U][G] =  2.000;
+ int22_ar[U][G][U][G][G][C][U][G] =  2.700;
+ int22_ar[U][G][U][G][G][G][U][G] =  0.300;
+ int22_ar[U][G][U][G][G][U][U][G] =  2.300;
+ int22_ar[U][G][U][G][U][A][U][G] =  2.000;
+ int22_ar[U][G][U][G][U][C][U][G] =  1.000;
+ int22_ar[U][G][U][G][U][G][U][G] = -2.900;
+ int22_ar[U][G][U][G][U][U][U][G] =  0.900;
+ int22_ar[U][G][U][U][A][A][U][G] =  2.000;
+ int22_ar[U][G][U][U][A][C][U][G] =  2.000;
+ int22_ar[U][G][U][U][A][G][U][G] =  2.000;
+ int22_ar[U][G][U][U][A][U][U][G] =  2.000;
+ int22_ar[U][G][U][U][C][A][U][G] =  2.000;
+ int22_ar[U][G][U][U][C][C][U][G] =  2.500;
+ int22_ar[U][G][U][U][C][G][U][G] =  0.700;
+ int22_ar[U][G][U][U][C][U][U][G] =  1.600;
+ int22_ar[U][G][U][U][G][A][U][G] =  2.000;
+ int22_ar[U][G][U][U][G][C][U][G] =  2.200;
+ int22_ar[U][G][U][U][G][G][U][G] = -1.600;
+ int22_ar[U][G][U][U][G][U][U][G] =  2.200;
+ int22_ar[U][G][U][U][U][A][U][G] =  2.000;
+ int22_ar[U][G][U][U][U][C][U][G] =  1.900;
+ int22_ar[U][G][U][U][U][G][U][G] =  0.900;
+ int22_ar[U][G][U][U][U][U][U][G] =  1.100;
+}
+
+
+
+void init_canPair(){
+  int i,j;
+  for (i=0;i<ALPHASIZE+1;i++)   /* +1 because of masking letter X */
+    for(j=0;j<ALPHASIZE+1;j++)
+      canPair[i][j]=0;
+    
+  canPair [A][U] = 1;
+  canPair [U][A] = 1;
+  canPair [C][G] = 1;
+  canPair [G][C] = 1;
+  canPair [G][U] = 1;
+  canPair [U][G] = 1;
+}
+
+
+void init_energies()
+{
+  init_il_asym_ar();
+
+   init_stack_dg_ar();
+   init_tstackh_dg_ar();
+   init_tstacki_dg_ar();
+   init_hl_tetra_ar();
+
+   init_hl_ent_ar();
+   init_bl_ent_ar();
+   init_il_ent_ar();
+
+   init_dr_dangle_dg_ar();
+   init_dl_dangle_dg_ar();
+
+   init_int11_ar();
+   init_int21_ar();
+   init_int22_ar();
+
+   init_canPair();
+}
+
+
+
+
Added: trunk/packages/rnahybrid/branches/upstream/current/src/energy.h
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/energy.h	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/energy.h	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,133 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#ifndef energy_h
+#define energy_h
+
+#include <stdio.h>
+#include <stdlib.h>
+#include <math.h>
+#include "minmax.h"
+#include "input.h"
+
+double e;
+double t;
+double temp;
+double r;
+
+double mloop_close;
+double free_base_penalty;
+double helix_penalty;
+
+double wkn;
+
+double npp;
+double pbp;
+
+double il_asym_ar[16][16];
+
+double stack_dg_ar  [ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE];
+double tstackh_dg_ar[ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE];
+double tstacki_dg_ar[ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE];
+double hl_tetra_ar[ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE];
+
+double hl_ent_ar[31];
+double bl_ent_ar[31];
+double il_ent_ar[31];
+
+double dr_dangle_dg_ar[ALPHASIZE][ALPHASIZE][ALPHASIZE+1];
+double dl_dangle_dg_ar[ALPHASIZE+1][ALPHASIZE][ALPHASIZE];
+
+double int11_ar[ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE];
+double int21_ar[ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE];
+double int22_ar[ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE][ALPHASIZE];
+
+char canPair[ALPHASIZE][ALPHASIZE];
+
+void init_constants();
+
+#define compl(I,J) canPair[I][J]
+
+double sr_energy(int i, int j);
+
+double dr_energy(int i, int j);
+
+double dli_energy(int i, int j);
+
+double dl_energy(int i, int j);
+
+double dri_energy(int i, int j);
+ 
+double dangles (int i, int j, int i2, int j2, int k, int l, int k2,int l2);
+
+double sspenalty(int a);
+
+double log_interp(int size);
+
+double hl_ent(int size);
+
+double bl_ent(int size);
+
+#define il_ent(size) ((size)<=30 ? il_ent_ar[(size)] : il_ent_ar[30] + log_interp((size)))
+
+int lengthOf(int i, int j);
+
+#define il_asym(u,v) (il_asym_ar[u][v])
+
+/* double il_asym (int sl, int sr); */
+
+double top_stack(int lb, int rb);
+
+double bot_stack(int lb, int rb);
+
+double bl_stacking (int t, int b, int i, int j);
+
+#define il_stack_open(i,j) tstacki_dg_ar[inpx(i)][inpx((i)+1)][inpy((j)+1)][inpy(j)]
+
+#define il_stack_close(i,j) tstacki_dg_ar[inpy(j)][inpy((j)-1)][inpx((i)-1)][inpx(i)]
+
+double int_special(int i, int j, int t, int b);
+
+double do_il_special(int i, int j, int k, int l, int u, int v, double e);
+
+/* double do_il(int i, int j, int k, int l, int u, int v, double e); */
+
+#define do_il(i,j,k,l,u,v,e) ((e)+il_stack_close((l)+1,(v)+1)+il_ent((l)-(k)+(v)-(u))+il_asym((l)-(k),(v)-(u)))
+
+void init_il_asym_ar();
+
+void init_stack_dg_ar();
+
+void init_tstackh_dg_ar();
+
+void init_hl_tetra_ar();
+
+void init_bl_ent_ar();
+
+void init_il_ent_ar();
+
+void init_tstacki_dg_ar();
+
+void init_dr_dangle_dg_ar();
+
+void init_dl_dangle_dg_ar();
+
+void init_int11_ar();
+
+void init_int21_ar();
+
+void init_int22_ar();
+
+void init_canPair();
+
+void init_energies();
+
+
+
+
+#endif
Added: trunk/packages/rnahybrid/branches/upstream/current/src/fasta.c
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/fasta.c	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/fasta.c	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,80 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#include "fasta.h"
+
+
+void nextAC(FILE *f, char *ac)
+{
+  fpos_t startloc;
+  char s [MAXLINE];
+  
+  fgetpos(f,&startloc);
+  while (fgets(s,MAXLINE,f)!=NULL && s[0]!='>');
+  if (s==NULL) {
+    fsetpos(f,&startloc);
+    printf("Error in nextAC. Aborting\n");
+    exit(2);
+  }
+  sscanf(s,">%s",ac);
+}
+
+
+void nextSQ(FILE *f, char *sq, int maxseqlength)
+{
+  fpos_t startloc;
+  char s [MAXLINE];
+  
+  int offset = 0;
+  fgetpos(f,&startloc);
+  if (fgets(sq,MAXLINE,f)!=NULL) {
+    while (sq[offset]!='\0')
+      offset++;
+    offset--; // remove newline
+    if (offset > maxseqlength) {
+      return;
+    }
+    fgetpos(f,&startloc);
+    while (fgets(sq+offset,MAXLINE,f)!=NULL)
+      if (sq[offset]=='>') {
+	sq[offset]='\0';
+	fsetpos(f,&startloc);
+	break;
+      }
+      else {
+	while (sq[offset]!='\0')
+	  offset++;
+	offset--; // remove newline
+	if (offset > maxseqlength) {
+	  return;
+	}
+	fgetpos(f,&startloc);
+      }
+    sq[offset]='\0';
+    return;
+  }
+  fsetpos(f,&startloc);
+  printf("Error in nextSQ. Aborting\n");
+  exit(2);
+}
+
+
+int end(FILE *f)
+{
+  fpos_t startloc;
+  char s [MAXLINE];
+  
+  fgetpos(f,&startloc);
+  if (fgets(s,MAXLINE,f)==NULL)
+    return 1;
+  else {
+    fsetpos(f,&startloc);
+    return 0;
+  }
+}
+
Added: trunk/packages/rnahybrid/branches/upstream/current/src/fasta.h
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/fasta.h	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/fasta.h	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,23 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#ifndef fasta_h
+#define fasta_h
+
+#include "globals.h"
+#include <stdio.h>
+
+
+void nextAC(FILE *f, char *ac);
+
+void nextSQ(FILE *f, char *sq, int maxseqlength);
+
+int end(FILE *f);
+
+
+#endif
Added: trunk/packages/rnahybrid/branches/upstream/current/src/globals.h
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/globals.h	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/globals.h	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,57 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#ifndef globals_h
+#define globals_h
+
+
+#define MAXTARGET     2000
+#define MAXQUERY        30
+#define MAXLINE       1000
+#define MAXSEQUENCE 100000
+
+#define ILOOPUPPERLIMITDEFAULT 15
+#define BLOOPUPPERLIMITDEFAULT 15
+
+#define MEAN 500
+#define STDDEV 300
+#define SAMPLESIZE 5000
+
+#define MIRNA_LENGTH_MEAN 22
+#define MIRNA_LENGTH_STDDEV 0
+
+#define MAXTARGETNUMBER 100000
+#define MAXQUERYNUMBER 100000
+
+#define MAXORTHOLOGNUMBER 10
+
+#define BINNUMBER 500
+#define FITLOWERCUTOFFABSOLUTE 2.0
+#define FITUPPERCUTOFFPERCENT 1.0
+
+#define SETNAME_3UTR_FLY   "3utr_fly"
+#define SETNAME_3UTR_WORM  "3utr_worm"
+#define SETNAME_3UTR_HUMAN "3utr_human"
+
+#define XI_SLOPE_3UTR_FLY (-0.03144)
+#define XI_INTERCEPT_3UTR_FLY (0.7201)
+#define THETA_SLOPE_3UTR_FLY (-0.003429)
+#define THETA_INTERCEPT_3UTR_FLY (0.01634)
+
+#define XI_SLOPE_3UTR_WORM (-0.01074)
+#define XI_INTERCEPT_3UTR_WORM (1.769)
+#define THETA_SLOPE_3UTR_WORM (-0.001154)
+#define THETA_INTERCEPT_3UTR_WORM (0.1419)
+
+#define XI_SLOPE_3UTR_HUMAN (-0.01237)
+#define XI_INTERCEPT_3UTR_HUMAN (1.901)
+#define THETA_SLOPE_3UTR_HUMAN (-0.001678)
+#define THETA_INTERCEPT_3UTR_HUMAN (0.1349)
+
+
+#endif
Added: trunk/packages/rnahybrid/branches/upstream/current/src/hybrid_core.c
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/hybrid_core.c	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/hybrid_core.c	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,1894 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+/* compiled by the ADP compiler, version 0.8.342                                    */
+/* source file: rnahybrid/HybridMFE3_simple_3tab.lhs                                */
+/* command:                                                                         */
+/* adpcompile -c rnahybrid/HybridMFE3_simple_3tab.lhs -al mfe enum -bt -bts -o rnahybrid/hybridBack4.c */
+/* -------------------------------------------------------------------------------- */
+
+#include "config.h"
+#include "hybrid_core.h"
+#include "plot.h"
+#include "minmax.h"
+#include "fasta.h"
+#include "input.h"
+#include "energy.h"
+#include "globals.h"
+#include <stdio.h>  
+#include <string.h> 
+
+
+static char const rcsid[] = "$Id: hybrid_core.c,v 1.6 2004/11/15 20:41:36 marc Exp $";
+
+
+extern int iloop_upper_limit;
+extern int bloop_upper_limit;
+
+/* data structures                                                                  */
+/* -------------------------------------------------------------------------------- */
+
+struct str1 {
+   double alg_mfe;
+   struct str_Hybrid *alg_enum;
+};
+
+/* signature                                                                        */
+/* -------------------------------------------------------------------------------- */
+
+#define SIGID__NTID 1
+#define SIGID_Ult 2
+#define SIGID_Ulb 3
+#define SIGID_Eds 4
+#define SIGID_Edt 5
+#define SIGID_Edb 6
+#define SIGID_Sr 7
+#define SIGID_Bt 8
+#define SIGID_Bb 9
+#define SIGID_Il 10
+#define SIGID_El 11
+#define SIGID_Nil 12
+
+
+struct str_Hybrid {
+   int utype;
+   void *entry;
+};
+
+struct str_Hybrid *new_Hybrid(int u, void *entry)
+{
+   struct str_Hybrid *t;
+
+   t=(struct str_Hybrid *) calloc(1, sizeof(struct str_Hybrid ));
+   t->utype = u;
+   t->entry = entry;
+   return(t);
+}
+
+/* signature operators                                                              */
+/* -------------------------------------------------------------------------------- */
+
+/* operator _NTID                                                                   */
+/* -------------------------------------------------------------------------------- */
+
+struct str__NTID {
+   struct str1 a1;
+   struct str1 (*f1)(int , int , int , int );
+   int i11, j11, i21, j21;
+};
+
+struct str_Hybrid *new__NTID(struct str1 (*f1)(int , int , int , int ), int i11, int j11, int i21, int j21)
+{
+   struct str__NTID *t;
+
+   t=(struct str__NTID *) calloc(1, sizeof(struct str__NTID ));
+   t->f1 = f1;
+   t->i11 = i11;
+   t->j11 = j11;
+   t->i21 = i21;
+   t->j21 = j21;
+   return(new_Hybrid(SIGID__NTID, t));
+}
+
+
+/* operator Ult                                                                     */
+/* -------------------------------------------------------------------------------- */
+
+struct str_Ult {
+   int a1;
+   int a2;
+   struct str1 a3;
+   struct str1 (*f3)(int , int , int , int );
+   int i13, j13, i23, j23;
+};
+
+struct str_Hybrid *new_Ult(int a1, int a2, struct str1 (*f3)(int , int , int , int ), int i13, int j13, int i23, int j23)
+{
+   struct str_Ult *t;
+
+   t=(struct str_Ult *) calloc(1, sizeof(struct str_Ult ));
+   t->a1 = a1;
+   t->a2 = a2;
+   t->f3 = f3;
+   t->i13 = i13;
+   t->j13 = j13;
+   t->i23 = i23;
+   t->j23 = j23;
+   return(new_Hybrid(SIGID_Ult, t));
+}
+
+
+/* operator Ulb                                                                     */
+/* -------------------------------------------------------------------------------- */
+
+struct str_Ulb {
+   int a1;
+   int a2;
+   struct str1 a3;
+   struct str1 (*f3)(int , int , int , int );
+   int i13, j13, i23, j23;
+};
+
+struct str_Hybrid *new_Ulb(int a1, int a2, struct str1 (*f3)(int , int , int , int ), int i13, int j13, int i23, int j23)
+{
+   struct str_Ulb *t;
+
+   t=(struct str_Ulb *) calloc(1, sizeof(struct str_Ulb ));
+   t->a1 = a1;
+   t->a2 = a2;
+   t->f3 = f3;
+   t->i13 = i13;
+   t->j13 = j13;
+   t->i23 = i23;
+   t->j23 = j23;
+   return(new_Hybrid(SIGID_Ulb, t));
+}
+
+
+/* operator Eds                                                                     */
+/* -------------------------------------------------------------------------------- */
+
+struct str_Eds {
+   int a1;
+   int a2;
+   struct str1 a3;
+   struct str1 (*f3)(int , int , int , int );
+   int i13, j13, i23, j23;
+};
+
+struct str_Hybrid *new_Eds(int a1, int a2, struct str1 (*f3)(int , int , int , int ), int i13, int j13, int i23, int j23)
+{
+   struct str_Eds *t;
+
+   t=(struct str_Eds *) calloc(1, sizeof(struct str_Eds ));
+   t->a1 = a1;
+   t->a2 = a2;
+   t->f3 = f3;
+   t->i13 = i13;
+   t->j13 = j13;
+   t->i23 = i23;
+   t->j23 = j23;
+   return(new_Hybrid(SIGID_Eds, t));
+}
+
+
+/* operator Edt                                                                     */
+/* -------------------------------------------------------------------------------- */
+
+struct str_Edt {
+   int a1;
+   int a2;
+   struct str1 a3;
+   struct str1 (*f3)(int , int , int , int );
+   int i13, j13, i23, j23;
+};
+
+struct str_Hybrid *new_Edt(int a1, int a2, struct str1 (*f3)(int , int , int , int ), int i13, int j13, int i23, int j23)
+{
+   struct str_Edt *t;
+
+   t=(struct str_Edt *) calloc(1, sizeof(struct str_Edt ));
+   t->a1 = a1;
+   t->a2 = a2;
+   t->f3 = f3;
+   t->i13 = i13;
+   t->j13 = j13;
+   t->i23 = i23;
+   t->j23 = j23;
+   return(new_Hybrid(SIGID_Edt, t));
+}
+
+
+/* operator Edb                                                                     */
+/* -------------------------------------------------------------------------------- */
+
+struct str_Edb {
+   int a1;
+   int a2;
+   struct str1 a3;
+   struct str1 (*f3)(int , int , int , int );
+   int i13, j13, i23, j23;
+};
+
+struct str_Hybrid *new_Edb(int a1, int a2, struct str1 (*f3)(int , int , int , int ), int i13, int j13, int i23, int j23)
+{
+   struct str_Edb *t;
+
+   t=(struct str_Edb *) calloc(1, sizeof(struct str_Edb ));
+   t->a1 = a1;
+   t->a2 = a2;
+   t->f3 = f3;
+   t->i13 = i13;
+   t->j13 = j13;
+   t->i23 = i23;
+   t->j23 = j23;
+   return(new_Hybrid(SIGID_Edb, t));
+}
+
+
+/* operator Sr                                                                      */
+/* -------------------------------------------------------------------------------- */
+
+struct str_Sr {
+   int a1;
+   int a2;
+   struct str1 a3;
+   struct str1 (*f3)(int , int , int , int );
+   int i13, j13, i23, j23;
+};
+
+struct str_Hybrid *new_Sr(int a1, int a2, struct str1 (*f3)(int , int , int , int ), int i13, int j13, int i23, int j23)
+{
+   struct str_Sr *t;
+
+   t=(struct str_Sr *) calloc(1, sizeof(struct str_Sr ));
+   t->a1 = a1;
+   t->a2 = a2;
+   t->f3 = f3;
+   t->i13 = i13;
+   t->j13 = j13;
+   t->i23 = i23;
+   t->j23 = j23;
+   return(new_Hybrid(SIGID_Sr, t));
+}
+
+
+/* operator Bt                                                                      */
+/* -------------------------------------------------------------------------------- */
+
+struct str_Bt {
+   int a1;
+   int a2;
+   int a3;
+   int a4;
+   int a5;
+   struct str1 a6;
+   struct str1 (*f6)(int , int , int , int );
+   int i16, j16, i26, j26;
+};
+
+struct str_Hybrid *new_Bt(int a1, int a2, int a3, int a4, int a5, struct str1 (*f6)(int , int , int , int ), int i16, int j16, int i26, int j26)
+{
+   struct str_Bt *t;
+
+   t=(struct str_Bt *) calloc(1, sizeof(struct str_Bt ));
+   t->a1 = a1;
+   t->a2 = a2;
+   t->a3 = a3;
+   t->a4 = a4;
+   t->a5 = a5;
+   t->f6 = f6;
+   t->i16 = i16;
+   t->j16 = j16;
+   t->i26 = i26;
+   t->j26 = j26;
+   return(new_Hybrid(SIGID_Bt, t));
+}
+
+
+/* operator Bb                                                                      */
+/* -------------------------------------------------------------------------------- */
+
+struct str_Bb {
+   int a1;
+   int a2;
+   int a3;
+   int a4;
+   int a5;
+   struct str1 a6;
+   struct str1 (*f6)(int , int , int , int );
+   int i16, j16, i26, j26;
+};
+
+struct str_Hybrid *new_Bb(int a1, int a2, int a3, int a4, int a5, struct str1 (*f6)(int , int , int , int ), int i16, int j16, int i26, int j26)
+{
+   struct str_Bb *t;
+
+   t=(struct str_Bb *) calloc(1, sizeof(struct str_Bb ));
+   t->a1 = a1;
+   t->a2 = a2;
+   t->a3 = a3;
+   t->a4 = a4;
+   t->a5 = a5;
+   t->f6 = f6;
+   t->i16 = i16;
+   t->j16 = j16;
+   t->i26 = i26;
+   t->j26 = j26;
+   return(new_Hybrid(SIGID_Bb, t));
+}
+
+
+/* operator Il                                                                      */
+/* -------------------------------------------------------------------------------- */
+
+struct str_Il {
+   int a1;
+   int a2;
+   int a3;
+   int a4;
+   int a5;
+   int a6;
+   struct str1 a7;
+   struct str1 (*f7)(int , int , int , int );
+   int i17, j17, i27, j27;
+};
+
+struct str_Hybrid *new_Il(int a1, int a2, int a3, int a4, int a5, int a6, struct str1 (*f7)(int , int , int , int ), int i17, int j17, int i27, int j27)
+{
+   struct str_Il *t;
+
+   t=(struct str_Il *) calloc(1, sizeof(struct str_Il ));
+   t->a1 = a1;
+   t->a2 = a2;
+   t->a3 = a3;
+   t->a4 = a4;
+   t->a5 = a5;
+   t->a6 = a6;
+   t->f7 = f7;
+   t->i17 = i17;
+   t->j17 = j17;
+   t->i27 = i27;
+   t->j27 = j27;
+   return(new_Hybrid(SIGID_Il, t));
+}
+
+/* operator El                                                                      */
+/* -------------------------------------------------------------------------------- */
+
+struct str_El {
+   int a1;
+   int a2;
+   int a3;
+   int a4;
+   int a5;
+   int a6;
+};
+
+struct str_Hybrid *new_El(int a1, int a2, int a3, int a4, int a5, int a6)
+{
+   struct str_El *t;
+
+   t=(struct str_El *) calloc(1, sizeof(struct str_El ));
+   t->a1 = a1;
+   t->a2 = a2;
+   t->a3 = a3;
+   t->a4 = a4;
+   t->a5 = a5;
+   t->a6 = a6;
+   return(new_Hybrid(SIGID_El, t));
+}
+
+
+/* operator Nil                                                                     */
+/* -------------------------------------------------------------------------------- */
+
+struct str_Nil {
+   int a1;
+   int a2;
+   int a3;
+   int a4;
+};
+
+struct str_Hybrid *new_Nil(int a1, int a2, int a3, int a4)
+{
+   struct str_Nil *t;
+
+   t=(struct str_Nil *) calloc(1, sizeof(struct str_Nil ));
+   t->a1 = a1;
+   t->a2 = a2;
+   t->a3 = a3;
+   t->a4 = a4;
+   return(new_Hybrid(SIGID_Nil, t));
+};
+
+
+/* signature pretty printer                                                         */
+/* -------------------------------------------------------------------------------- */
+
+/* int gx; */
+/* char *t1, *t2, *t3, *t4; */
+/* char *r1, *r2, *r3, *r4; */
+
+/* int a1, a2, a3, a4, a5, a6; */
+
+char *sx(char *t, int i)
+{
+  if (x[i]==A) t[0]='A'; else 
+  if (x[i]==C) t[0]='C'; else 
+  if (x[i]==G) t[0]='G'; else 
+  if (x[i]==U) t[0]='U'; else
+               t[0]='N';
+  t[1]=0;
+  return(&t[1]);
+}
+
+char *shift(char *t, int u, int v)
+{
+  if ((v-u)==0) {t[0]=' '; t[1] = ' '; t[2] = 0;  return(&t[2]);}
+  else {t[0]=' '; t[1] = 0;   return(&t[1]);}
+}
+
+char *one_space(char *t)
+{
+  t[0]=' '; t[1] = 0; return(&t[1]);
+}
+
+
+char *ssx(char *t, int i, int j)
+{
+  int k;
+  for (k=i+1;k<=j;k++) t=sx(t,k); 
+  return(&t[0]);
+}
+
+
+char *sy(char *t, int i)
+{
+  if (y[i]==A) t[0]='A'; else 
+  if (y[i]==C) t[0]='C'; else 
+  if (y[i]==G) t[0]='G'; else 
+  if (y[i]==U) t[0]='U'; else
+               t[0]='N';
+  t[1]=0;
+  return(&t[1]);
+}
+
+char *ssy(char *t, int i, int j)
+{
+  int k;
+  for (k=i+1;k<=j;k++) t=sy(t,k);
+  return(&t[0]);
+}
+
+
+char *blanks(char *t, int i, int j)
+{
+  int k,l;
+  l=j-i;
+  for (k=0;k<=l-1;k++) t[k]=' ';
+  t[l]=0;
+  return(&t[l]);
+}
+
+char *blanks2(char *t, int i, int j)
+{
+  int k,l;
+  l=max(j-i-1,0);
+  for (k=0;k<=l-1;k++) t[k]=' ';
+  t[l]=0;
+  return(&t[l]);
+}
+
+char *asym1(char *t, int l,int r,int u,int v)
+{
+  int k,ln;
+  ln=max((v-u)-(r-l),0);
+  for (k=0;k<=ln-1;k++) t[k]=' ';
+  t[ln]=0;
+  return(&t[ln]);
+}
+
+char *asym2(char *t, int l,int r,int u,int v)
+{
+  int k,ln;
+  ln=max((r-l)-(v-u),0);
+  for (k=0;k<=ln-1;k++) t[k]=' ';
+  t[ln]=0;
+  return(&t[ln]);
+}
+
+
+void pp_str_Hybrid(struct str1 l)
+{
+   struct str_Hybrid *c;
+
+   c = l.alg_enum;
+
+      if (c->utype == SIGID__NTID) {
+            pp_str_Hybrid(((struct str__NTID *)(c->entry))->a1);
+      } else 
+      if (c->utype == SIGID_Ult) {
+/* 	   gx++; */
+           pp_str_Hybrid(((struct str_Ult *)(c->entry))->a3);
+      } else 
+      if (c->utype == SIGID_Ulb) {
+            r1 = one_space(r1);
+            r2 = one_space(r2);
+            r3 = one_space(r3);
+            a2 =((struct str_Ulb *)(c->entry))->a2; 
+            r4 = sy(r4,a2);
+            pp_str_Hybrid(((struct str_Ulb *)(c->entry))->a3);
+      } else 
+      if (c->utype == SIGID_Eds) {
+	   a1=((struct str_Eds *)(c->entry))->a1; 
+           a2=((struct str_Eds *)(c->entry))->a2;
+            r1 = sx(r1,a1);
+            r2 = one_space(r2);
+            r3 = one_space(r3);
+            r4 = sy(r4,a2);
+            pp_str_Hybrid(((struct str_Eds *)(c->entry))->a3);
+      } else 
+      if (c->utype == SIGID_Edt) {
+	   a1=((struct str_Edt *)(c->entry))->a1;
+            r1 = sx(r1,a1);
+            r2 = one_space(r2);
+            r3 = one_space(r3);
+            r4 = one_space(r4);
+            pp_str_Hybrid(((struct str_Edt *)(c->entry))->a3);
+      } else 
+      if (c->utype == SIGID_Edb) {
+	   a2=((struct str_Edb *)(c->entry))->a2;
+            r1 = one_space(r1);
+            r2 = one_space(r2);
+            r3 = one_space(r3);
+            r4 = sy(r4,a2);
+            pp_str_Hybrid(((struct str_Edb *)(c->entry))->a3);
+      } else 
+      if (c->utype == SIGID_Sr) {
+	   a1=((struct str_Sr *)(c->entry))->a1;
+           a2=((struct str_Sr *)(c->entry))->a2;
+            r1 = one_space(r1);
+            r2 = sx(r2,a1);
+            r3 = sy(r3,a2);
+            r4 = one_space(r4);
+            pp_str_Hybrid(((struct str_Sr *)(c->entry))->a3);
+      } else 
+      if (c->utype == SIGID_Bt) {
+	   a1=((struct str_Bt *)(c->entry))->a1;
+	   a2=((struct str_Bt *)(c->entry))->a2;
+	   a3=((struct str_Bt *)(c->entry))->a3;
+	   a4=((struct str_Bt *)(c->entry))->a4;
+            r1 = one_space(r1);
+            r1 = ssx(r1,a3,a4);
+            r2 = sx(r2,a1);
+            r2 = blanks(r2,a3,a4);
+            r3 = sy(r3,a2);
+            r3 = blanks(r3,a3,a4);
+            r4 = one_space(r4);
+            r4 = blanks(r4,a3,a4);
+            pp_str_Hybrid(((struct str_Bt *)(c->entry))->a6);
+      } else 
+      if (c->utype == SIGID_Bb) {
+	   a1=((struct str_Bb *)(c->entry))->a1;
+	   a2=((struct str_Bb *)(c->entry))->a2;
+	   a3=((struct str_Bb *)(c->entry))->a3;
+	   a4=((struct str_Bb *)(c->entry))->a4;
+	   a5=((struct str_Bb *)(c->entry))->a5;
+
+            r1 = one_space(r1);
+            r1 = blanks(r1,a4,a5);
+            r2 = sx(r2,a1);
+            r2 = blanks(r2,a4,a5);
+            r3 = sy(r3,a2);
+            r3 = blanks(r3,a4,a5);
+            r4 = one_space(r4);
+            r4 = ssy(r4,a4,a5);
+            pp_str_Hybrid(((struct str_Bb *)(c->entry))->a6);
+      } else 
+      if (c->utype == SIGID_Il) {
+	   a1=((struct str_Il *)(c->entry))->a1;
+	   a2=((struct str_Il *)(c->entry))->a2;
+	   a3=((struct str_Il *)(c->entry))->a3;
+	   a4=((struct str_Il *)(c->entry))->a4;
+	   a5=((struct str_Il *)(c->entry))->a5;
+	   a6=((struct str_Il *)(c->entry))->a6;
+
+            r1 = one_space(r1);
+            r1 = ssx(r1,a3,a4);
+            r1 = asym1(r1,a3,a4,a5,a6);
+
+            r2 = sx(r2,a1);
+            r2 = blanks(r2,a3,a4);
+            r2 = asym1(r2,a3,a4,a5,a6);
+
+            r3 = sy(r3,a2);
+            r3 = blanks(r3,a5,a6);
+            r3 = asym2(r3,a3,a4,a5,a6);
+
+            r4 = one_space(r4);
+            r4 = ssy(r4,a5,a6);
+            r4 = asym2(r4,a3,a4,a5,a6);
+
+            pp_str_Hybrid(((struct str_Il *)(c->entry))->a7);
+      } else 
+      if (c->utype == SIGID_El) {
+	   a1=((struct str_El *)(c->entry))->a1;
+	   a2=((struct str_El *)(c->entry))->a2;
+	   a3=((struct str_El *)(c->entry))->a3;
+	   a4=((struct str_El *)(c->entry))->a4;
+	   a5=((struct str_El *)(c->entry))->a5;
+	   a6=((struct str_El *)(c->entry))->a6;
+ 	if ((a4-a3) == 0) {
+            r1 = one_space(r1);
+            r1 = blanks(r1,a5,a6);
+
+            r2 = sx(r2,a3);
+            r2 = blanks(r2,a5,a6);
+
+            r3 = sy(r3,a5);
+            r3 = blanks(r3,a5,a6);
+
+            r4 = one_space(r4);
+            r4 = ssy(r4,a5,a6);
+	} else {
+            r1 = one_space(r1);
+            r1 = sx(r1,a3+1);
+            r1 = blanks2(r1,a5,a6);
+
+            r2 = sx(r2,a3);
+            r2 = one_space(r2);
+            r2 = blanks2(r2,a5,a6);
+
+            r3 = sy(r3,a5);
+            r3 = one_space(r3);
+            r3 = blanks2(r3,a5,a6);
+
+            r4 = shift(r4,a5,a6);
+            r4 = ssy(r4,a5,a6);
+	}
+      } else 
+      if (c->utype == SIGID_Nil) {
+	r1[0] = '\0';
+	r2[0] = '\0';
+	r3[0] = '\0';
+	r4[0] = '\0';
+      }
+}
+
+
+/* free structures                                                                  */
+/* -------------------------------------------------------------------------------- */
+
+void free_str_Hybrid(struct str_Hybrid *c)
+{
+   struct str1 l, l2;
+
+   if (c != NULL) {
+      if (c->utype == SIGID__NTID) {
+         l = ((struct str__NTID *)(c->entry))->a1;
+         free_str_Hybrid(l.alg_enum);
+         free(c->entry);
+      } else 
+      if (c->utype == SIGID_Ult) {
+         l = ((struct str_Ult *)(c->entry))->a3;
+         free_str_Hybrid(l.alg_enum);
+         free(c->entry);
+      } else 
+      if (c->utype == SIGID_Ulb) {
+         l = ((struct str_Ulb *)(c->entry))->a3;
+         free_str_Hybrid(l.alg_enum);
+         free(c->entry);
+      } else 
+      if (c->utype == SIGID_Eds) {
+         l = ((struct str_Eds *)(c->entry))->a3;
+         free_str_Hybrid(l.alg_enum);
+         free(c->entry);
+      } else 
+      if (c->utype == SIGID_Edt) {
+         l = ((struct str_Edt *)(c->entry))->a3;
+         free_str_Hybrid(l.alg_enum);
+         free(c->entry);
+      } else 
+      if (c->utype == SIGID_Edb) {
+         l = ((struct str_Edb *)(c->entry))->a3;
+         free_str_Hybrid(l.alg_enum);
+         free(c->entry);
+      } else 
+      if (c->utype == SIGID_Sr) {
+         l = ((struct str_Sr *)(c->entry))->a3;
+         free_str_Hybrid(l.alg_enum);
+         free(c->entry);
+      } else 
+      if (c->utype == SIGID_Bt) {
+         l = ((struct str_Bt *)(c->entry))->a6;
+         free_str_Hybrid(l.alg_enum);
+         free(c->entry);
+      } else 
+      if (c->utype == SIGID_Bb) {
+         l = ((struct str_Bb *)(c->entry))->a6;
+         free_str_Hybrid(l.alg_enum);
+         free(c->entry);
+      } else 
+      if (c->utype == SIGID_Il) {
+         l = ((struct str_Il *)(c->entry))->a7;
+         free_str_Hybrid(l.alg_enum);
+         free(c->entry);
+      } else 
+      if (c->utype == SIGID_El) {
+         free(c->entry);
+      } else 
+      if (c->utype == SIGID_Nil) {
+         free(c->entry);
+      }
+   }
+   free(c);
+}
+
+/* structure builder                                                                */
+/* -------------------------------------------------------------------------------- */
+
+struct str1 build_str_Hybrid(struct str1 cl)
+{
+   struct str1 l;
+   struct str_Hybrid *c;
+
+   c = cl.alg_enum;
+   if (c->utype == SIGID__NTID) {
+     ((struct str__NTID *)(c->entry))->a1 = (*((struct str__NTID *)(c->entry))->f1)(((struct str__NTID *)(c->entry))->i11, ((struct str__NTID *)(c->entry))->j11, ((struct str__NTID *)(c->entry))->i21, ((struct str__NTID *)(c->entry))->j21);
+   } else 
+   if (c->utype == SIGID_Ult) {
+      ((struct str_Ult *)(c->entry))->a3 = (*((struct str_Ult *)(c->entry))->f3)(((struct str_Ult *)(c->entry))->i13, ((struct str_Ult *)(c->entry))->j13, ((struct str_Ult *)(c->entry))->i23, ((struct str_Ult *)(c->entry))->j23);
+   } else 
+   if (c->utype == SIGID_Ulb) {
+     ((struct str_Ulb *)(c->entry))->a3 = (*((struct str_Ulb *)(c->entry))->f3)(((struct str_Ulb *)(c->entry))->i13, ((struct str_Ulb *)(c->entry))->j13, ((struct str_Ulb *)(c->entry))->i23, ((struct str_Ulb *)(c->entry))->j23);
+   } else 
+   if (c->utype == SIGID_Eds) {
+     ((struct str_Eds *)(c->entry))->a3 = (*((struct str_Eds *)(c->entry))->f3)(((struct str_Eds *)(c->entry))->i13, ((struct str_Eds *)(c->entry))->j13, ((struct str_Eds *)(c->entry))->i23, ((struct str_Eds *)(c->entry))->j23);
+   } else 
+   if (c->utype == SIGID_Edt) {
+     ((struct str_Edt *)(c->entry))->a3 = (*((struct str_Edt *)(c->entry))->f3)(((struct str_Edt *)(c->entry))->i13, ((struct str_Edt *)(c->entry))->j13, ((struct str_Edt *)(c->entry))->i23, ((struct str_Edt *)(c->entry))->j23);
+   } else 
+   if (c->utype == SIGID_Edb) {
+     ((struct str_Edb *)(c->entry))->a3 = (*((struct str_Edb *)(c->entry))->f3)(((struct str_Edb *)(c->entry))->i13, ((struct str_Edb *)(c->entry))->j13, ((struct str_Edb *)(c->entry))->i23, ((struct str_Edb *)(c->entry))->j23);
+   } else 
+   if (c->utype == SIGID_Sr) {
+     ((struct str_Sr *)(c->entry))->a3 = (*((struct str_Sr *)(c->entry))->f3)(((struct str_Sr *)(c->entry))->i13, ((struct str_Sr *)(c->entry))->j13, ((struct str_Sr *)(c->entry))->i23, ((struct str_Sr *)(c->entry))->j23);
+   } else 
+   if (c->utype == SIGID_Bt) {
+     ((struct str_Bt *)(c->entry))->a6 = (*((struct str_Bt *)(c->entry))->f6)(((struct str_Bt *)(c->entry))->i16, ((struct str_Bt *)(c->entry))->j16, ((struct str_Bt *)(c->entry))->i26, ((struct str_Bt *)(c->entry))->j26);
+   } else 
+   if (c->utype == SIGID_Bb) {
+     ((struct str_Bb *)(c->entry))->a6 = (*((struct str_Bb *)(c->entry))->f6)(((struct str_Bb *)(c->entry))->i16, ((struct str_Bb *)(c->entry))->j16, ((struct str_Bb *)(c->entry))->i26, ((struct str_Bb *)(c->entry))->j26);
+   } else 
+   if (c->utype == SIGID_Il) {
+     ((struct str_Il *)(c->entry))->a7 = (*((struct str_Il *)(c->entry))->f7)(((struct str_Il *)(c->entry))->i17, ((struct str_Il *)(c->entry))->j17, ((struct str_Il *)(c->entry))->i27, ((struct str_Il *)(c->entry))->j27);
+   } else 
+   if (c->utype == SIGID_El) {
+   } else 
+   if (c->utype == SIGID_Nil) {
+   }
+   return(cl);
+}
+
+/* table declarations                                                               */
+/* -------------------------------------------------------------------------------- */
+
+double **tbl_unpaired_left_top;
+double **tbl_unpaired_left_bot;
+double **tbl_closed;
+
+/* forward declarations                                                             */
+/* -------------------------------------------------------------------------------- */
+
+double calc_hybrid(int i1, int j1, int i2, int j2);
+
+/* table calculations                                                               */
+/* -------------------------------------------------------------------------------- */
+
+/* table calculation for production hybrid                                          */
+/* -------------------------------------------------------------------------------- */
+
+double calc_hybrid(int i1, int j1, int i2, int j2)
+{
+   double v1, v2, v3, v4, v5;
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* --------------------- v1 = nil <<< tt(uregion, uregion) --------------------- */
+   if (((j1-i1) >= 0) && ((j2-i2) >= 0)) {
+      v1 = 0;
+      /* No iteration neccessary! */
+   }
+   else {
+      v1 = 65000;
+   }
+   /* --------------------- v1 = nil <<< tt(uregion, uregion) --------------------- */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* -------------------------- v2 = p unpaired_left_top ------------------------- */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 1)) {
+      v2 = tbl_unpaired_left_top[i1][i2];
+   }
+   else {
+      v2 = 65000;
+   }
+   /* ------------------------------- v3 = p closed ------------------------------- */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 1)) {
+      v3 = tbl_closed[i1][i2];
+   }
+   else {
+      v3 = 65000;
+   }
+   v4 = v2 < v3 ? v2 : v3;
+   v5 = v1 < v4 ? v1 : v4;
+   return(v5);
+}
+
+/* table calculation for production unpaired_left_top                               */
+/* -------------------------------------------------------------------------------- */
+
+void calc_unpaired_left_top(int i1, int j1, int i2, int j2)
+{
+   double v1, v2, v3;
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* ---------- v1 = ult <<< (tt(lbase, empty)) ~~~ p unpaired_left_top ---------- */
+   if (((j1-i1) >= 2) && ((j2-i2) >= 1)) {
+      v1 = tbl_unpaired_left_top[i1+1][i2];
+      /* No iteration neccessary! */
+   }
+   else {
+      v1 = 65000;
+   }
+   /* ---------- v1 = ult <<< (tt(lbase, empty)) ~~~ p unpaired_left_top ---------- */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* -------------------------- v2 = p unpaired_left_bot ------------------------- */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 1) && ((i2 < helix_start) || (i2 >= helix_end))) {
+      v2 = tbl_unpaired_left_bot[i1][i2];
+   }
+   else {
+      v2 = 65000;
+   }
+   v3 = v1 < v2 ? v1 : v2;
+   /* ------------------------- assign table entry result ------------------------- */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 1)) {
+      tbl_unpaired_left_top[i1][i2] = v3;
+   }
+}
+
+/* table calculation for production unpaired_left_bot                               */
+/* -------------------------------------------------------------------------------- */
+
+void calc_unpaired_left_bot(int i1, int j1, int i2, int j2)
+{
+   double v1, v2, v3, v4, v5, v6, v7;
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* ---------- v1 = ulb <<< (tt(empty, lbase)) ~~~ p unpaired_left_bot ---------- */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 2) && ((i2 < helix_start-1) || (i2 >= helix_end))) {
+      v1 = tbl_unpaired_left_bot[i1][i2+1];
+      /* No iteration neccessary! */
+   }
+   else {
+      v1 = 65000;
+   }
+   /* ---------- v1 = ulb <<< (tt(empty, lbase)) ~~~ p unpaired_left_bot ---------- */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* ---------------- v2 = eds <<< (tt(lbase, lbase)) ~~~ p closed --------------- */
+   if (((j1-i1) >= 2) && ((j2-i2) >= 2) && compl(x[i1+2],y[i2+2]) && ((i2 < helix_start) || (i2 >= helix_end))) {
+      v2 = (tbl_closed[i1+1][i2+1] + dl_energy((i1+1) + 1, (i2+1) + 1)) + dr_energy((i1+1) + 1, (i2+1) + 1);
+      /* No iteration neccessary! */
+   }
+   else {
+      v2 = 65000;
+   }
+   /* ---------------- v2 = eds <<< (tt(lbase, lbase)) ~~~ p closed --------------- */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* ---------------- v3 = edt <<< (tt(lbase, empty)) ~~~ p closed --------------- */
+   if (((j1-i1) >= 2) && ((j2-i2) >= 1) && compl(x[i1+2],y[i2+1])) {
+      v3 = tbl_closed[i1+1][i2] + dl_energy((i1+1) + 1, (i2) + 1);
+      /* No iteration neccessary! */
+   }
+   else {
+      v3 = 65000;
+   }
+   /* ---------------- v3 = edt <<< (tt(lbase, empty)) ~~~ p closed --------------- */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* ---------------- v4 = edb <<< (tt(empty, lbase)) ~~~ p closed --------------- */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 2) && compl(x[i1+1],y[i2+2]) && ((i2 < helix_start) || (i2 >= helix_end))) {
+      v4 = tbl_closed[i1][i2+1] + dr_energy((i1) + 1, (i2+1) + 1);
+      /* No iteration neccessary! */
+   }
+   else {
+      v4 = 65000;
+   }
+   /* ---------------- v4 = edb <<< (tt(empty, lbase)) ~~~ p closed --------------- */
+   /* ---------------------------------- finished --------------------------------- */
+
+   v5 = v3 < v4 ? v3 : v4;
+   v6 = v2 < v5 ? v2 : v5;
+   v7 = v1 < v6 ? v1 : v6;
+   /* ------------------------- assign table entry result ------------------------- */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 1)) {
+      tbl_unpaired_left_bot[i1][i2] = v7;
+   }
+}
+
+/* table calculation for production closed                                          */
+/* -------------------------------------------------------------------------------- */
+
+void calc_closed(int i1, int j1, int i2, int j2)
+{
+   double v1, v2, v3, v4, v5, v6, v7, v7b, v7c, v7d, v7e, v7f, v7g, v8, v9, v10, v11, v12;
+   int k;
+   int k2;
+   int k3;
+   int k4;
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* - v1 = sr <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ p closed - */
+   if (((j1-i1) >= 2) && ((j2-i2) >= 2)) {
+      if (compl(x[i1+1], y[i2+1])) {
+         v1 = sr_energy(i1+1, i2+1) + tbl_closed[i1+1][i2+1];
+         /* No iteration neccessary! */
+      }
+      else {
+         v1 = 65000;
+      }
+   }
+   else {
+      v1 = 65000;
+   }
+   /* - v1 = sr <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ p closed - */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /*  v3 = bt <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(region, empty) `with` (sizeTT 1 15 0 0)) ~~~ p closed  */
+   if (((j1-i1) >= 3) && ((j2-i2) >= 2) && compl(x[i1+1], y[i2+1]) && ((i2 < helix_start) || (i2 >= helix_end-1))) {
+      v3 = 65000;
+      for (k=i1+2; k<=min(i1+bloop_upper_limit+1, j1-1); k++) {
+	if (x[k]==X)
+	  break;
+	  v2 = (tbl_closed[k][i2+1] + bl_stacking((k) - (i1+1), 0, i1+1, i2+1)) + bl_ent((k) - (i1+1));
+	  /* No iteration neccessary! */
+	v3 = v2 < v3 ? v2 : v3;
+      }
+   }
+   else {
+     v3 = 65000;
+   }
+   /*  v3 = bt <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(region, empty) `with` (sizeTT 1 15 0 0)) ~~~ p closed  */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /*  v5 = bb <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(empty, region) `with` (sizeTT 0 0 1 15)) ~~~ p closed  */
+   if (((j1-i1) >= 2) && ((j2-i2) >= 3) & compl(x[i1+1], y[i2+1])) {
+      v5 = 65000;
+      for (k2=i2+2; k2<=min(i2+bloop_upper_limit+1, j2-1); k2++) {
+        if ((k2 > helix_start) && (k2 <= helix_end))
+	  break;
+	v4 = (tbl_closed[i1+1][k2] + bl_stacking(0, (k2) - (i2+1), i1+1, i2+1)) + bl_ent((k2) - (i2+1));
+	  /* No iteration neccessary! */
+	v5 = v4 < v5 ? v4 : v5;
+      }
+   }
+   else {
+     v5 = 65000;
+   }
+   /*  v5 = bb <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(empty, region) `with` (sizeTT 0 0 1 15)) ~~~ p closed  */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /*  v7 = il <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(region, region) `with` (sizeTT 1 15 1 15)) ~~~ p closed  */
+   
+   if (((j1-i1) >= 3) && ((j2-i2) >= 3) && compl(x[i1+1], y[i2+1])) {
+     v7 = 65000;
+     /* special internal loops: */
+     for (k3=i1+2; k3<=min(i1+min(3,iloop_upper_limit+1), j1-1); k3++) {
+       if (x[k3]==X)
+	 break;
+       for (k4=i2+2; k4<=min(i2+min(3,iloop_upper_limit+1), j2-1); k4++) {
+	 if ((k4 > helix_start) && (i2 < helix_end-1))
+	   break;
+	 if (compl(x[k3+1],y[k4+1])) {
+	   v6 = do_il_special(i1+1, i2+1, i1+1, k3, i2+1, k4, tbl_closed[k3][k4]);
+	   /* No iteration neccessary! */
+	   v7 = v6 < v7 ? v6 : v7;
+	 }
+       }
+     }
+     v7g = 65000; 
+     v7b = 65000;
+     if ((x[k3]!=X)) { /*  && !((k4 > helix_start) && (i2 < helix_end-1))) { */
+       /* normal internal loops: */
+       for (k3=i1+2; k3<=min(i1+3, j1-1); k3++) {
+	 if (x[k3]==X)
+	   break;
+	 for (k4=i2+4; k4<=min(i2+iloop_upper_limit+1, j2-1); k4++) {
+	   if ((k4 > helix_start) && (i2 < helix_end-1))
+	     break;
+	   if (compl(x[k3+1],y[k4+1])) {
+	     v6 = do_il(i1+1, i2+1, i1+1, k3, i2+1, k4, tbl_closed[k3][k4]);
+	     /* No iteration neccessary! */
+	     v7b = v6 < v7b ? v6 : v7b;
+	   }
+	 }
+       }
+       if (v7b < 65000)
+	 v7b += il_stack_open(i1+1,i2+1);
+       v7c = 65000;
+       /* normal internal loops: */
+       if ((x[k3]!=X)) { /*  && !((k4 > helix_start) && (i2 < helix_end-1))) { */
+	 for (k3=i1+4; k3<=min(i1+iloop_upper_limit+1, j1-1); k3++) {
+	   if (x[k3]==X)
+	     break;
+	   for (k4=i2+2; k4<=min(i2+3, j2-1); k4++) {
+	     if ((k4 > helix_start) && (i2 < helix_end-1))
+	       break;
+	     if (compl(x[k3+1],y[k4+1])) {
+	       v6 = do_il(i1+1, i2+1, i1+1, k3, i2+1, k4, tbl_closed[k3][k4]);
+	       /* No iteration neccessary! */
+	       v7c = v6 < v7c ? v6 : v7c;
+	     }
+	   }
+	 }
+	 if (v7c < 65000)
+	   v7c += il_stack_open(i1+1,i2+1);
+	 v7d = 65000;
+	 /* normal internal loops: */
+	 if ((x[k3]!=X)) { /*  && !((k4 > helix_start) && (i2 < helix_end-1))) { */
+	   for (k3=i1+4; k3<=min(i1+iloop_upper_limit+1, j1-1); k3++) {
+	     if (x[k3]==X)
+	       break;
+	     for (k4=i2+4; k4<=min(i2+iloop_upper_limit+1, j2-1); k4++) {
+	       if ((k4 > helix_start) && (i2 < helix_end-1))
+		 break;
+	       if (compl(x[k3+1],y[k4+1])) {
+		 v6 = do_il(i1+1, i2+1, i1+1, k3, i2+1, k4, tbl_closed[k3][k4]);
+		 /* No iteration neccessary! */
+		 v7d = v6 < v7d ? v6 : v7d;
+	       }
+	     }
+	   }
+	   if (v7d < 65000)
+	     v7d += il_stack_open(i1+1,i2+1);
+	 }
+
+       }
+       v7e = v7b < v7c ? v7b : v7c;
+       v7f = v7d < v7e ? v7d : v7e;
+       v7g = v7g < v7f ? v7g : v7f;
+     }
+     v7 = v7g < v7 ? v7g : v7;
+   }
+   else {
+     v7 = 65000;
+   }
+   /*  v7 = il <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(region, region) `with` (sizeTT 1 15 1 15)) ~~~ p closed  */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /*  v8 = el <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(uregion, uregion))  */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 1) && (j1==i1+1 || x[i1+2]!='X') && ((i2 >= helix_end-1) || (helix_end > j2))) {
+      if (compl(x[i1+1], y[i2+1])) {
+         v8 = ((((j1) - (i1+1)) > 0) ? dli_energy(i1+1, i2+1) : 0) + ((((j2) - (i2+1)) > 0) ? dri_energy(i1+1, i2+1) : 0);
+         /* No iteration neccessary! */
+      }
+      else {
+         v8 = 65000;
+      }
+   }
+   else {
+      v8 = 65000;
+   }
+   /*  v8 = el <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(uregion, uregion))  */
+   /* ---------------------------------- finished --------------------------------- */
+
+
+   v9 = v7 < v8 ? v7 : v8;
+   v10 = v5 < v9 ? v5 : v9;
+   v11 = v3 < v10 ? v3 : v10;
+   v12 = v1 < v11 ? v1 : v11;
+   /* ------------------------- assign table entry result ------------------------- */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 1)) {
+      tbl_closed[i1][i2] = v12;
+   }
+}
+
+/* forward declarations for backtracing functions                                   */
+/* -------------------------------------------------------------------------------- */
+
+struct str1 back_unpaired_left_bot(int i1, int j1, int i2, int j2);
+
+struct str1 back_closed(int i1, int j1, int i2, int j2);
+
+struct str1 back_hybrid(int i1, int j1, int i2, int j2);
+
+/* backtracing code                                                                 */
+/* -------------------------------------------------------------------------------- */
+
+/* table calculation for production hybrid                                          */
+/* -------------------------------------------------------------------------------- */
+
+struct str1 back_hybrid(int i1, int j1, int i2, int j2)
+{
+   struct str1 v1, v2, v3, v4, v5;
+
+   int k, best_k;
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* --------------------- v1 = nil <<< tt(uregion, uregion) --------------------- */
+   if (((j1-i1) >= 0) && ((j2-i2) >= 0)) {
+      v1.alg_mfe = 0;
+      v1.alg_enum = new_Nil(i1, j1, i2, j2);
+      /* No iteration neccessary! */
+   }
+   else {
+      v1.alg_mfe = 65000;
+      v1.alg_enum = NULL;
+   }
+   /* --------------------- v1 = nil <<< tt(uregion, uregion) --------------------- */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* -------------------------- v2 = p unpaired_left_top ------------------------- */
+   /* +------------------------------------------------------------------------------------ */
+   /* Nonterminal unpaired_left_top is implemented as a tabulated                           */
+   /* function which yields atomar results. Since we are in list context,                   */
+   /* we need to wrap the result of unpaired_left_top into a single list element.           */
+   /* +------------------------------------------------------------------------------------ */
+
+
+/*    Find best unpaired_left_bot without backtracking recursion to avoid */
+/*      stack overflow (hand made): */
+
+   if (((j1-i1) >= 1) && ((j2-i2) >= 1) && ((i2 < helix_start) || (i2 >= helix_end))) {
+
+     v2.alg_mfe = 65000;
+     v2.alg_enum = NULL;
+
+     best_k = -1;
+
+     for (k=i1; k<j1; k++) {
+       if (tbl_unpaired_left_bot[k][i2] < v2.alg_mfe) {
+	 v2.alg_mfe = tbl_unpaired_left_bot[k][i2];
+	 best_k = k;
+       }
+     }
+
+     if (best_k != -1)
+       v2.alg_enum = new__NTID(back_unpaired_left_bot, best_k, j1, i2, j2);
+
+   }
+   else {
+     v2.alg_mfe = 65000;
+     v2.alg_enum = NULL;
+   }
+
+/*    if (((j1-i1) >= 1) && ((j2-i2) >= 1)) { */
+/*       v2.alg_mfe = tbl_unpaired_left_top[i1][i2]; */
+/*       v2.alg_enum = new__NTID(back_unpaired_left_top, i1, j1, i2, j2); */
+/*    } */
+/*    else { */
+/*       v2.alg_mfe = 65000; */
+/*       v2.alg_enum = NULL; */
+/*    } */
+
+
+
+
+   /* ------------------------------- v3 = p closed ------------------------------- */
+   /* +---------------------------------------------------------------------------- */
+   /* Nonterminal closed is implemented as a tabulated                              */
+   /* function which yields atomar results. Since we are in list context,           */
+   /* we need to wrap the result of closed into a single list element.              */
+   /* +---------------------------------------------------------------------------- */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 1)) {
+      v3.alg_mfe = tbl_closed[i1][i2];
+      v3.alg_enum = new__NTID(back_closed, i1, j1, i2, j2);
+   }
+   else {
+      v3.alg_mfe = 65000;
+      v3.alg_enum = NULL;
+   }
+   /* ---------------------------- v4 = minimum(v2, v3) --------------------------- */
+   if (v2.alg_mfe < v3.alg_mfe) {
+     gx = best_k + 1;
+     v4 = v2;
+     free_str_Hybrid(v3.alg_enum);
+   }
+   else {
+     gx = 0 + 1;
+     v4 = v3;
+     free_str_Hybrid(v2.alg_enum);
+   }
+/*    v4 = v2.alg_mfe < v3.alg_mfe ? v2 : v3; */
+   /* ---------------------------- v5 = minimum(v1, v4) --------------------------- */
+   if (v1.alg_mfe < v4.alg_mfe) {
+     gx = 0;
+     v5 = v1;
+     free_str_Hybrid(v4.alg_enum);
+   }
+   else {
+     v5 = v4;
+     free_str_Hybrid(v1.alg_enum);
+   }
+/*    v5 = v1.alg_mfe < v4.alg_mfe ? v1 : v4; */
+   /* ------------------------- build candidate structures ------------------------ */
+
+   return(build_str_Hybrid(v5));
+}
+
+/* table calculation for production unpaired_left_top                               */
+/* -------------------------------------------------------------------------------- */
+
+/* removed after hand made back_hybrid optimisation !*/
+
+
+
+/* table calculation for production unpaired_left_bot                               */
+/* -------------------------------------------------------------------------------- */
+
+struct str1 back_unpaired_left_bot(int i1, int j1, int i2, int j2)
+{
+   struct str1 v1, v2, v3, v4, v5, v6, v7;
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* ---------- v1 = ulb <<< (tt(empty, lbase)) ~~~ p unpaired_left_bot ---------- */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 2) && ((i2 < helix_start-1) || (i2 >= helix_end))) {
+      v1.alg_mfe = tbl_unpaired_left_bot[i1][i2+1];
+      v1.alg_enum = new_Ulb(i1, i2+1, back_unpaired_left_bot, i1, j1, i2+1, j2);
+      /* No iteration neccessary! */
+   }
+   else {
+      v1.alg_mfe = 65000;
+      v1.alg_enum = NULL;
+   }
+   /* ---------- v1 = ulb <<< (tt(empty, lbase)) ~~~ p unpaired_left_bot ---------- */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* ---------------- v2 = eds <<< (tt(lbase, lbase)) ~~~ p closed --------------- */
+   if (((j1-i1) >= 2) && ((j2-i2) >= 2) && compl(x[i1+2],y[i2+2]) && ((i2 < helix_start) || (i2 >= helix_end))) {
+      v2.alg_mfe = (tbl_closed[i1+1][i2+1] + dl_energy((i1+1) + 1, (i2+1) + 1)) + dr_energy((i1+1) + 1, (i2+1) + 1);
+      v2.alg_enum = new_Eds(i1+1, i2+1, back_closed, i1+1, j1, i2+1, j2);
+      /* No iteration neccessary! */
+   }
+   else {
+      v2.alg_mfe = 65000;
+      v2.alg_enum = NULL;
+   }
+   /* ---------------- v2 = eds <<< (tt(lbase, lbase)) ~~~ p closed --------------- */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* ---------------- v3 = edt <<< (tt(lbase, empty)) ~~~ p closed --------------- */
+   if (((j1-i1) >= 2) && ((j2-i2) >= 1) && compl(x[i1+2],y[i2+1])) {
+      v3.alg_mfe = tbl_closed[i1+1][i2] + dl_energy((i1+1) + 1, (i2) + 1);
+      v3.alg_enum = new_Edt(i1+1, i2, back_closed, i1+1, j1, i2, j2);
+      /* No iteration neccessary! */
+   }
+   else {
+      v3.alg_mfe = 65000;
+      v3.alg_enum = NULL;
+   }
+   /* ---------------- v3 = edt <<< (tt(lbase, empty)) ~~~ p closed --------------- */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* ---------------- v4 = edb <<< (tt(empty, lbase)) ~~~ p closed --------------- */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 2) && compl(x[i1+1],y[i2+2]) && ((i2 < helix_start) || (i2 >= helix_end))) {
+      v4.alg_mfe = tbl_closed[i1][i2+1] + dr_energy((i1) + 1, (i2+1) + 1);
+      v4.alg_enum = new_Edb(i1, i2+1, back_closed, i1, j1, i2+1, j2);
+      /* No iteration neccessary! */
+   }
+   else {
+      v4.alg_mfe = 65000;
+      v4.alg_enum = NULL;
+   }
+   /* ---------------- v4 = edb <<< (tt(empty, lbase)) ~~~ p closed --------------- */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------- v5 = minimum(v3, v4) --------------------------- */
+   if (v3.alg_mfe < v4.alg_mfe) {
+     v5 = v3;
+     free_str_Hybrid(v4.alg_enum);
+   }
+   else {
+     v5 = v4;
+     free_str_Hybrid(v3.alg_enum);
+   }
+/*    v5 = v3.alg_mfe < v4.alg_mfe ? v3 : v4; */
+   /* ---------------------------- v6 = minimum(v2, v5) --------------------------- */
+   if (v2.alg_mfe < v5.alg_mfe) {
+     v6 = v2;
+     free_str_Hybrid(v5.alg_enum);
+   }
+   else {
+     v6 = v5;
+     free_str_Hybrid(v2.alg_enum);
+   }
+/*    v6 = v2.alg_mfe < v5.alg_mfe ? v2 : v5; */
+   /* ---------------------------- v7 = minimum(v1, v6) --------------------------- */
+   if (v1.alg_mfe < v6.alg_mfe) {
+     v7 = v1;
+     free_str_Hybrid(v6.alg_enum);
+   }
+   else {
+     v7 = v6;
+     free_str_Hybrid(v1.alg_enum);
+   }
+/*    v7 = v1.alg_mfe < v6.alg_mfe ? v1 : v6; */
+   /* ------------------------- build candidate structures ------------------------ */
+
+   return(build_str_Hybrid(v7));
+}
+
+/* table calculation for production closed                                          */
+/* -------------------------------------------------------------------------------- */
+
+struct str1 back_closed(int i1, int j1, int i2, int j2)
+{
+   struct str1 v1, v2, v3, v4, v5, v6, v7, v7b, v7c, v7d, v7e, v7f, v7g, v8, v9, v10, v11, v12;
+   int k;
+   int k2;
+   int k3;
+   int k4;
+
+   /* ---------------------------------- start of --------------------------------- */
+   /* - v1 = sr <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ p closed - */
+   if (((j1-i1) >= 2) && ((j2-i2) >= 2)) {
+      if (compl(x[i1+1], y[i2+1])) {
+         v1.alg_mfe = sr_energy(i1+1, i2+1) + tbl_closed[i1+1][i2+1];
+         v1.alg_enum = new_Sr(i1+1, i2+1, back_closed, i1+1, j1, i2+1, j2);
+         /* No iteration neccessary! */
+      }
+      else {
+         v1.alg_mfe = 65000;
+         v1.alg_enum = NULL;
+      }
+   }
+   else {
+      v1.alg_mfe = 65000;
+      v1.alg_enum = NULL;
+   }
+   /* - v1 = sr <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ p closed - */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /*  v3 = bt <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(region, empty) `with` (sizeTT 1 15 0 0)) ~~~ p closed  */
+   if (((j1-i1) >= 3) && ((j2-i2) >= 2) && compl(x[i1+1], y[i2+1]) && ((i2 < helix_start) || (i2 >= helix_end-1))) {
+      v3.alg_mfe = 65000;
+      v3.alg_enum = NULL;
+      for (k=i1+2; k<=min(i1+bloop_upper_limit+1, j1-1); k++) {
+	if (x[k]==X)
+	  break;
+            v2.alg_mfe = (tbl_closed[k][i2+1] + bl_stacking((k) - (i1+1), 0, i1+1, i2+1)) + bl_ent((k) - (i1+1));
+            v2.alg_enum = new_Bt(i1+1, i2+1, i1+1, k, i2+1, back_closed, k, j1, i2+1, j2);
+            /* No iteration neccessary! */
+         /* ------------------------- v3 = minimum(v2, v3) ------------------------ */
+         if (v2.alg_mfe < v3.alg_mfe) {
+           free_str_Hybrid(v3.alg_enum);
+           v3 = v2;
+         } else free_str_Hybrid(v2.alg_enum);
+      }
+   }
+   else {
+      v3.alg_mfe = 65000;
+      v3.alg_enum = NULL;
+   }
+   /*  v3 = bt <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(region, empty) `with` (sizeTT 1 15 0 0)) ~~~ p closed  */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /*  v5 = bb <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(empty, region) `with` (sizeTT 0 0 1 15)) ~~~ p closed  */
+   if (((j1-i1) >= 2) && ((j2-i2) >= 3) && compl(x[i1+1], y[i2+1])) {
+      v5.alg_mfe = 65000;
+      v5.alg_enum = NULL;
+      for (k2=i2+2; k2<=min(i2+bloop_upper_limit+1, j2-1); k2++) {
+        if ((k2 > helix_start) && (k2 <= helix_end))
+	  break;
+	v4.alg_mfe = (tbl_closed[i1+1][k2] + bl_stacking(0, (k2) - (i2+1), i1+1, i2+1)) + bl_ent((k2) - (i2+1));
+	v4.alg_enum = new_Bb(i1+1, i2+1, i1+1, i2+1, k2, back_closed, i1+1, j1, k2, j2);
+	/* No iteration neccessary! */
+	/* ------------------------- v5 = minimum(v4, v5) ------------------------ */
+	/* v5 = v4.alg_mfe < v5.alg_mfe ? v4 : v5; */
+	if (v4.alg_mfe < v5.alg_mfe) {
+	  free_str_Hybrid(v5.alg_enum);
+	  v5 = v4;
+	} else free_str_Hybrid(v4.alg_enum);
+      }
+   }
+   else {
+      v5.alg_mfe = 65000;
+      v5.alg_enum = NULL;
+   }
+   /*  v5 = bb <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(empty, region) `with` (sizeTT 0 0 1 15)) ~~~ p closed  */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /*  v7 = il <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(region, region) `with` (sizeTT 1 15 1 15)) ~~~ p closed  */
+   if (((j1-i1) >= 3) && ((j2-i2) >= 3) && compl(x[i1+1], y[i2+1])) {
+
+     v7.alg_mfe = 65000;
+     v7.alg_enum = NULL;
+     /* special internal loops: */
+     for (k3=i1+2; k3<=min(i1+min(3,iloop_upper_limit+1), j1-1); k3++) {
+       if (x[k3]==X)
+	 break;
+       for (k4=i2+2; k4<=min(i2+min(3,iloop_upper_limit+1), j2-1); k4++) {
+	 if ((k4 > helix_start) && (i2 < helix_end-1))
+	   break;
+	 if (compl(x[k3+1],y[k4+1])) {
+	   v6.alg_mfe = do_il_special(i1+1, i2+1, i1+1, k3, i2+1, k4, tbl_closed[k3][k4]);
+	   v6.alg_enum = new_Il(i1+1, i2+1, i1+1, k3, i2+1, k4, back_closed, k3, j1, k4, j2);
+	   /* No iteration neccessary! */
+	   if (v6.alg_mfe < v7.alg_mfe) {
+	     free_str_Hybrid(v7.alg_enum);
+	     v7 = v6;
+	   } else free_str_Hybrid(v6.alg_enum);
+	 }
+       }
+     }
+     v7g.alg_mfe = 65000;
+     v7g.alg_enum = NULL;
+     v7b.alg_mfe = 65000;
+     v7b.alg_enum = NULL;
+     if ((x[k3]!=X)) { /*  && !((k4 > helix_start) && (i2 < helix_end-1))) { */
+
+       /* normal internal loops: */
+       for (k3=i1+2; k3<=min(i1+3, j1-1); k3++) {
+	 if (x[k3]==X)
+	   break;
+	 for (k4=i2+4; k4<=min(i2+iloop_upper_limit+1, j2-1); k4++) {
+	   if ((k4 > helix_start) && (i2 < helix_end-1))
+	     break;
+	   if (compl(x[k3+1],y[k4+1])) {
+	     v6.alg_mfe = do_il(i1+1, i2+1, i1+1, k3, i2+1, k4, tbl_closed[k3][k4]);
+	     v6.alg_enum = new_Il(i1+1, i2+1, i1+1, k3, i2+1, k4, back_closed, k3, j1, k4, j2);
+	     /* No iteration neccessary! */
+	     if (v6.alg_mfe < v7b.alg_mfe) {
+	       free_str_Hybrid(v7b.alg_enum);
+	       v7b = v6;
+	     } else free_str_Hybrid(v6.alg_enum);
+	   }
+	 }
+       }
+       if (v7b.alg_mfe < 65000)
+	 v7b.alg_mfe += il_stack_open(i1+1,i2+1);
+       
+       v7c.alg_mfe = 65000;
+       v7c.alg_enum = NULL;
+       if ((x[k3]!=X)) { /*  && !((k4 > helix_start) && (i2 < helix_end-1))) { */
+
+	 for (k3=i1+4; k3<=min(i1+iloop_upper_limit+1, j1-1); k3++) {
+	   if (x[k3]==X)
+	     break;
+	   for (k4=i2+2; k4<=min(i2+3, j2-1); k4++) {
+	     if ((k4 > helix_start) && (i2 < helix_end-1))
+	       break;
+	     if (compl(x[k3+1],y[k4+1])) {
+	       v6.alg_mfe = do_il(i1+1, i2+1, i1+1, k3, i2+1, k4, tbl_closed[k3][k4]);
+	       v6.alg_enum = new_Il(i1+1, i2+1, i1+1, k3, i2+1, k4, back_closed, k3, j1, k4, j2);
+	       /* No iteration neccessary! */
+	       if (v6.alg_mfe < v7c.alg_mfe) {
+		 free_str_Hybrid(v7c.alg_enum);
+		 v7c = v6;
+	       } else free_str_Hybrid(v6.alg_enum);
+	     }
+	   }
+	 }
+	 if (v7c.alg_mfe < 65000)
+	   v7c.alg_mfe += il_stack_open(i1+1,i2+1);
+       }
+
+       v7d.alg_mfe = 65000;
+       v7d.alg_enum = NULL;
+       if ((x[k3]!=X)) { /*  && !((k4 > helix_start) && (i2 < helix_end-1))) { */
+
+	 /* normal internal loops: */
+	 for (k3=i1+4; k3<=min(i1+iloop_upper_limit+1, j1-1); k3++) {
+	   if (x[k3]==X)
+	     break;
+	   for (k4=i2+4; k4<=min(i2+iloop_upper_limit+1, j2-1); k4++) {
+	     if ((k4 > helix_start) && (i2 < helix_end-1))
+	       break;
+	     if (compl(x[k3+1],y[k4+1])) {
+	       v6.alg_mfe = do_il(i1+1, i2+1, i1+1, k3, i2+1, k4, tbl_closed[k3][k4]);
+	       v6.alg_enum = new_Il(i1+1, i2+1, i1+1, k3, i2+1, k4, back_closed, k3, j1, k4, j2);
+	       /* No iteration neccessary! */
+	       if (v6.alg_mfe < v7d.alg_mfe) {
+		 free_str_Hybrid(v7d.alg_enum);
+		 v7d = v6;
+	       } else free_str_Hybrid(v6.alg_enum);
+	     }
+	   }
+	 }
+	 if (v7d.alg_mfe < 65000)
+	   v7d.alg_mfe += il_stack_open(i1+1,i2+1);
+
+       }
+
+       if (v7b.alg_mfe < v7c.alg_mfe) {
+	 free_str_Hybrid(v7c.alg_enum);
+	 v7e = v7b;
+       }
+       else {
+	 free_str_Hybrid(v7b.alg_enum);
+	 v7e = v7c;
+       }
+
+       if (v7e.alg_mfe < v7d.alg_mfe) {
+	 free_str_Hybrid(v7d.alg_enum);
+	 v7f = v7e;
+       }
+       else {
+	 free_str_Hybrid(v7e.alg_enum);
+	 v7f = v7d;
+       }
+
+       if (v7g.alg_mfe < v7f.alg_mfe) {
+	 free_str_Hybrid(v7f.alg_enum);
+       }
+       else {
+	 free_str_Hybrid(v7g.alg_enum);
+	 v7g = v7f;
+       }
+     }
+     if (v7.alg_mfe < v7g.alg_mfe) {
+       free_str_Hybrid(v7g.alg_enum);
+     }
+     else {
+       free_str_Hybrid(v7.alg_enum);
+       v7 = v7g;
+     }
+   }
+   else {
+      v7.alg_mfe = 65000;
+      v7.alg_enum = NULL;
+   }
+   /*  v7 = il <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(region, region) `with` (sizeTT 1 15 1 15)) ~~~ p closed  */
+   /* ---------------------------------- finished --------------------------------- */
+
+   /* ---------------------------------- start of --------------------------------- */
+   /*  v8 = el <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(uregion, uregion))  */
+   if (((j1-i1) >= 1) && ((j2-i2) >= 1)  && (j1==i1+1 || x[i1+2]!='X') && ((i2 >= helix_end-1) || (helix_end > j2))) {
+      if (compl(x[i1+1], y[i2+1])) {
+         v8.alg_mfe = ((((j1) - (i1+1)) > 0) ? dli_energy(i1+1, i2+1) : 0) + ((((j2) - (i2+1)) > 0) ? dri_energy(i1+1, i2+1) : 0);
+         v8.alg_enum = new_El(i1+1, i2+1, i1+1, j1, i2+1, j2);
+         /* No iteration neccessary! */
+      }
+      else {
+         v8.alg_mfe = 65000;
+         v8.alg_enum = NULL;
+      }
+   }
+   else {
+      v8.alg_mfe = 65000;
+      v8.alg_enum = NULL;
+   }
+   /*  v8 = el <<< (tt(lbase, lbase) `with` (pairingTTcross compl)) ~~~ (tt(uregion, uregion))  */
+   /* ---------------------------------- finished --------------------------------- */
+
+
+   /* ---------------------------- v9 = minimum(v7, v8) --------------------------- */
+   if (v7.alg_mfe < v8.alg_mfe) {
+     v9 = v7;
+     free_str_Hybrid(v8.alg_enum);
+   }
+   else {
+     v9 = v8;
+     free_str_Hybrid(v7.alg_enum);
+   }
+/*    v9 = v7.alg_mfe < v8.alg_mfe ? v7 : v8; */
+
+   /* --------------------------- v10 = minimum(v5, v9) --------------------------- */
+   if (v5.alg_mfe < v9.alg_mfe) {
+     v10 = v5;
+     free_str_Hybrid(v9.alg_enum);
+   }
+   else {
+     v10 = v9;
+     free_str_Hybrid(v5.alg_enum);
+   }
+/*    v10 = v5.alg_mfe < v9.alg_mfe ? v5 : v9; */
+
+   /* --------------------------- v11 = minimum(v3, v10) -------------------------- */
+   if (v3.alg_mfe < v10.alg_mfe) {
+     v11 = v3;
+     free_str_Hybrid(v10.alg_enum);
+   }
+   else {
+     v11 = v10;
+     free_str_Hybrid(v3.alg_enum);
+   }
+/*    v11 = v3.alg_mfe < v10.alg_mfe ? v3 : v10; */
+
+   /* --------------------------- v12 = minimum(v1, v11) -------------------------- */
+   if (v1.alg_mfe < v11.alg_mfe) {
+     v12 = v1;
+     free_str_Hybrid(v11.alg_enum);
+   }
+   else {
+     v12 = v11;
+     free_str_Hybrid(v1.alg_enum);
+   }
+/*    v12 = v1.alg_mfe < v11.alg_mfe ? v1 : v11; */
+
+   /* ------------------------- build candidate structures ------------------------ */
+
+   return(build_str_Hybrid(v12));
+}
+
+/* table memory allocation                                                          */
+/* -------------------------------------------------------------------------------- */
+
+void tableAlloc(int m, int n)
+{
+   int i, j, k, dim1, dim2;
+
+   /* --- memory allocation for tbl_unpaired_left_bot, yield size: ((1,m),(1,n)) -- */
+   dim1 = m-1;
+   tbl_unpaired_left_bot=(double **) calloc(dim1+1, sizeof(double *));
+   for (i=0; i<=dim1; i++) {
+      dim2 = n-1;
+      tbl_unpaired_left_bot[i]=(double *) calloc(dim2+1, sizeof(double));
+   }
+   /* -------- memory allocation for tbl_closed, yield size: ((1,m),(1,n)) -------- */
+   dim1 = m-1;
+   tbl_closed=(double **) calloc(dim1+1, sizeof(double *));
+   for (i=0; i<=dim1; i++) {
+      dim2 = n-1;
+      tbl_closed[i]=(double *) calloc(dim2+1, sizeof(double));
+   }
+   /* --- memory allocation for tbl_unpaired_left_top, yield size: ((1,m),(1,n)) -- */
+   dim1 = m-1;
+   tbl_unpaired_left_top=(double **) calloc(dim1+1, sizeof(double *));
+   for (i=0; i<=dim1; i++) {
+      dim2 = n-1;
+      tbl_unpaired_left_top[i]=(double *) calloc(dim2+1, sizeof(double));
+   }
+}
+
+/* main dynamic programming loop                                                    */
+/* -------------------------------------------------------------------------------- */
+
+
+void mainloop(int bflag, int hit_number, int eflag, float energy_cutoff, int pflag, float pvalue_cutoff, int compact_output, char *target_ac, char *target_sq, char *query_ac, char *query_sq, int gflag, int plot_format, float xi, float theta)
+{
+   int i1, i2;
+   double v2;
+   struct str1 l;
+
+   int
+     no_nil_so_far,
+     iterate,
+     hit_count,
+     k, k1, k2, sepPos,
+     ali_length,
+     hit_length,
+     t_len;
+
+   float
+     normalised_energy,
+     pvalue;
+
+   char hitcount_str[50];
+   char *filename;
+
+   char *conc_seq;
+   char *conc_struct;
+
+
+   no_nil_so_far = 1;
+   hit_count = 0;
+
+   for (iterate=1; iterate && (!bflag || hit_count<hit_number); ) {
+
+     for (i1=m; i1>=0; i1--) {
+       for (i2=n; i2>=0; i2--) {
+	 calc_unpaired_left_bot(i1, m, i2, n);
+	 calc_closed           (i1, m, i2, n);
+	 calc_unpaired_left_top(i1, m, i2, n);
+       }
+     }
+
+     /* ----------------------------- show axiom: hybrid ---------------------------- */
+     v2 = calc_hybrid(0, m, 0, n);
+
+
+     l = back_hybrid(0, m, 0, n);
+
+/*      gx = 1; */
+
+     pp_str_Hybrid(l);
+
+     normalised_energy = v2/log(m*n);
+     pvalue = 1-exp(-exp(-(-normalised_energy-xi)/theta));
+
+     if ((!eflag || v2 <= energy_cutoff) && (!pflag || pvalue <= pvalue_cutoff) && no_nil_so_far) {
+
+       hit_count++;
+
+       if (compact_output) { /* compact output */
+	 printf("%s:%d:%s:%d:%.1f:%.6f:%d:%s:%s:%s:%s\n",target_ac,m,query_ac,n,v2,pvalue,gx,t1,t2,t3,t4);
+       }
+       else { /* verbose output */
+	 printf("target: %s\n", target_ac);
+         printf("length: %d\n", m);
+	 printf("miRNA : %s\n", query_ac);
+         printf("length: %d\n", n);
+	 printf("\n");
+	 printf("mfe: %.1f kcal/mol\n", v2);
+	 printf("p-value: %.6f\n", pvalue);
+	 printf("\n");
+	 printf("position  %d\n", gx);
+	 printf("target 5' %s 3'\n", t1);
+	 printf("          %s   \n", t2);
+	 printf("          %s   \n", t3);
+	 printf("miRNA  3' %s 5'\n", t4);
+	 printf("\n");
+	 printf("\n");
+       }
+
+       if (gflag) { /* plot hybridisation */
+	 ali_length = strlen(t1);
+
+	 conc_seq    = (char *) calloc(4 * ali_length +3 + 1,sizeof(char));
+	 conc_struct = (char *) calloc(4 * ali_length +3 + 1,sizeof(char));
+
+	 /* make dot-parantheses notation: */
+
+	 k1 = 0;
+	 for (k2=0; k2<ali_length; k2++) {
+	   if (t1[k2]!=' ') {
+	     conc_seq[k1]=t1[k2];
+	     conc_struct[k1]='.';
+	     k1++;
+	   }
+	   else if (t2[k2]!=' ') {
+	     conc_seq[k1]=t2[k2];
+	     conc_struct[k1]='(';
+	     k1++;
+	   }
+	 }
+	 conc_seq[k1]='N';
+	 conc_seq[k1+1]='N';
+	 conc_seq[k1+2]='N';
+	 conc_struct[k1]='.';
+	 conc_struct[k1+1]='.';
+	 conc_struct[k1+2]='.';
+	 k1+=3;
+	 sepPos = k1;
+	 for (k2=ali_length-1; k2>=0; k2--) {
+	   if (t4[k2]!=' ') {
+	     conc_seq[k1]=t4[k2];
+	     conc_struct[k1]='.';
+	     k1++;
+	   }
+	   else if (t3[k2]!=' ') {
+	     conc_seq[k1]=t3[k2];
+	     conc_struct[k1]=')';
+	     k1++;
+	   }
+	 }
+
+	 conc_seq[k1]    = '\0';
+	 conc_struct[k1] = '\0';
+
+/* 	 printf("\n%s\n%s\n",conc_seq,conc_struct); */
+
+	 sprintf(hitcount_str,"%d",hit_count);
+	 filename = (char *) calloc(strlen(target_ac)+strlen(query_ac)+strlen(hitcount_str)+7, sizeof(char));
+
+	 if (plot_format==PSPLOT || plot_format==ALLPLOT) {
+	   strcpy(filename,target_ac);
+	   strcat(filename,"_");
+	   strcat(filename,query_ac);
+	   strcat(filename,"_");
+	   strcat(filename,hitcount_str);
+	   strcat(filename,".ps");
+
+#ifdef HAVE_LIBG2	 
+	   hybridPlot(conc_seq,conc_struct,v2,sepPos,filename,0,PSPLOT);
+#endif
+	 }
+	 if (plot_format==PNGPLOT || plot_format==ALLPLOT) {
+	   strcpy(filename,target_ac);
+	   strcat(filename,"_");
+	   strcat(filename,query_ac);
+	   strcat(filename,"_");
+	   strcat(filename,hitcount_str);
+	   strcat(filename,".png");
+
+#ifdef HAVE_LIBG2	 
+	   hybridPlot(conc_seq,conc_struct,v2,sepPos,filename,0,PNGPLOT);
+#endif
+	 }
+	 if (plot_format==JPGPLOT || plot_format==ALLPLOT) {
+	   strcpy(filename,target_ac);
+	   strcat(filename,"_");
+	   strcat(filename,query_ac);
+	   strcat(filename,"_");
+	   strcat(filename,hitcount_str);
+	   strcat(filename,".jpg");
+
+#ifdef HAVE_LIBG2	 
+	   hybridPlot(conc_seq,conc_struct,v2,sepPos,filename,0,JPGPLOT);
+#endif
+	 }
+
+	 free(filename);
+	 free(conc_seq);
+	 free(conc_struct);
+       }
+
+       t_len = strlen(t1);
+
+       if (t_len==0)
+	 no_nil_so_far = 0;
+
+       k = 0;
+       while (k < t_len && t1[k]==' ' && t2[k]==' ')
+	 k++;
+       if (k<t_len)
+	 t1[k]=' '; /* hide left dangle */
+
+       k = t_len-1;
+       while (k >= 0 && t1[k]==' ' && t2[k]==' ')
+	 k--;
+       if (k>=0)
+	 t1[k]=' '; /* hide right dangle */
+
+       /* count hit length: */
+       hit_length = 0;
+
+       for (k=0; k<t_len; k++)
+	 if (t1[k]!=' ')
+	   hit_length++;
+
+       for (k=0; k<t_len; k++)
+	 if (t2[k]!=' ')
+	   hit_length++;
+
+/*        printf("\n\nhitlength:%d\n\n",hit_length);  */
+
+       /* mask hit: */
+       for (k=0; k<hit_length; k++)
+	 x[gx+(t1[0]!=' ')+k]=X;
+
+/*        for (k=1; k<=m; k++) */
+/* 	 printf("%d",x[k]); */
+/*        printf("\n\n"); */
+
+       if (!eflag && !bflag)
+	 iterate = 0;
+
+     }
+     else
+       iterate = 0;
+
+
+     /* free candidate */
+     free_str_Hybrid(l.alg_enum);
+     /* initialize strings */
+     r1 = t1;
+     r2 = t2;
+     r3 = t3;
+     r4 = t4;
+   }
+}
+
+
+
Added: trunk/packages/rnahybrid/branches/upstream/current/src/hybrid_core.h
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/hybrid_core.h	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/hybrid_core.h	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,43 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#ifndef hybrid_core_h
+#define hybrid_core_h
+
+
+char *x;   /* input string */
+int  m;    /* input length */
+char *y;   /* input string */
+int  n;    /* input length */
+
+
+int iloop_upper_limit;
+int bloop_upper_limit;
+
+
+int helix_start, helix_end;
+
+
+int gx;
+char *t1, *t2, *t3, *t4;
+char *r1, *r2, *r3, *r4;
+
+int a1, a2, a3, a4, a5, a6;
+
+void calc_unpaired_left_top(int i1, int j1, int i2, int j2);
+
+void calc_unpaired_left_bot(int i1, int j1, int i2, int j2);
+
+void calc_closed(int i1, int j1, int i2, int j2);
+
+double calc_hybrid(int i1, int j1, int i2, int j2);
+
+void mainloop(int bflag, int hit_number, int eflag, float energy_cutoff, int pflag, float pvalue_cutoff, int compact_output, char *target_ac, char *target_sq, char *query_ac, char *query_sq, int gflag, int plot_format, float xi, float theta);
+
+
+#endif
Added: trunk/packages/rnahybrid/branches/upstream/current/src/input.c
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/input.c	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/input.c	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,56 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#include "input.h"
+#include <string.h>
+
+
+void convert_x(){
+  int i;
+  char c;
+  for (i=0; i<=m; i++) {
+    c=x[i];
+    if      (c=='a' || c=='A') x[i]=A;
+    else if (c=='c' || c=='C') x[i]=C;
+    else if (c=='g' || c=='G') x[i]=G;
+    else if (c=='u' || c=='U') x[i]=U;
+    else if (c=='t' || c=='T') x[i]=U;
+    else                       x[i]=N;
+  }
+}
+
+void convert_y(){
+  int i;
+  char c;
+  for (i=0; i<=n; i++) {
+    c=y[i];
+    if      (c=='a' || c=='A') y[i]=A;
+    else if (c=='c' || c=='C') y[i]=C;
+    else if (c=='g' || c=='G') y[i]=G;
+    else if (c=='u' || c=='U') y[i]=U;
+    else if (c=='t' || c=='T') y[i]=U;
+    else                       y[i]=N;
+  }
+}
+
+
+void remove_whitespace(char *sequence)
+{
+  int len = strlen(sequence);
+  int i;
+
+  for (i=0; i<len; i++)
+    if (sequence[i]<33) {
+      memmove(sequence+i,sequence+i+1,len-i-1);
+      len--;
+      i--;
+    }
+
+  sequence[len] = 0;
+}
+
Added: trunk/packages/rnahybrid/branches/upstream/current/src/input.h
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/input.h	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/input.h	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,38 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#ifndef input_h
+#define input_h
+
+
+extern char *x;   /* input string */
+extern int  m;    /* input length */
+extern char *y;   /* input string */
+extern int  n;    /* input length */
+
+
+#define A 0
+#define C 1
+#define G 2
+#define U 3
+#define N 4
+#define X 5 /* this is an additional letter for masking out hits */
+
+#define ALPHASIZE 5
+
+
+#define inpx(I) x[I]
+#define inpy(I) y[I]
+
+
+void convert_x();
+void convert_y();
+
+void remove_whitespace(char *sequence);
+
+#endif
Added: trunk/packages/rnahybrid/branches/upstream/current/src/minmax.h
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/minmax.h	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/minmax.h	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,15 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#ifndef minmax_h
+#define minmax_h
+
+#define min(A, B) ((A) < (B) ? (A) : (B))
+#define max(A, B) ((A) > (B) ? (A) : (B))
+
+#endif
Added: trunk/packages/rnahybrid/branches/upstream/current/src/mt19937-1.c
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/mt19937-1.c	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/mt19937-1.c	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,130 @@
+/* A C-program for MT19937: Real number version (1999/10/28)    */
+/*   genrand() generates one pseudorandom real number (double)  */
+/* which is uniformly distributed on [0,1]-interval, for each   */
+/* call. sgenrand(seed) sets initial values to the working area */
+/* of 624 words. Before genrand(), sgenrand(seed) must be       */
+/* called once. (seed is any 32-bit integer.)                   */
+/* Integer generator is obtained by modifying two lines.        */
+/*   Coded by Takuji Nishimura, considering the suggestions by  */
+/* Topher Cooper and Marc Rieffel in July-Aug. 1997.            */
+
+/* This library is free software; you can redistribute it and/or   */
+/* modify it under the terms of the GNU Library General Public     */
+/* License as published by the Free Software Foundation; either    */
+/* version 2 of the License, or (at your option) any later         */
+/* version.                                                        */
+/* This library is distributed in the hope that it will be useful, */
+/* but WITHOUT ANY WARRANTY; without even the implied warranty of  */
+/* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.            */
+/* See the GNU Library General Public License for more details.    */
+/* You should have received a copy of the GNU Library General      */
+/* Public License along with this library; if not, write to the    */
+/* Free Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA   */ 
+/* 02111-1307  USA                                                 */
+
+/* Copyright (C) 1997, 1999 Makoto Matsumoto and Takuji Nishimura. */
+/* Any feedback is very welcome. For any question, comments,       */
+/* see http://www.math.keio.ac.jp/matumoto/emt.html or email       */
+/* matumoto at math.keio.ac.jp                                        */
+
+/* REFERENCE                                                       */
+/* M. Matsumoto and T. Nishimura,                                  */
+/* "Mersenne Twister: A 623-Dimensionally Equidistributed Uniform  */
+/* Pseudo-Random Number Generator",                                */
+/* ACM Transactions on Modeling and Computer Simulation,           */
+/* Vol. 8, No. 1, January 1998, pp 3--30.                          */
+
+#include<stdio.h>
+
+/* Period parameters */  
+#define N 624
+#define M 397
+#define MATRIX_A 0x9908b0df   /* constant vector a */
+#define UPPER_MASK 0x80000000 /* most significant w-r bits */
+#define LOWER_MASK 0x7fffffff /* least significant r bits */
+
+/* Tempering parameters */   
+#define TEMPERING_MASK_B 0x9d2c5680
+#define TEMPERING_MASK_C 0xefc60000
+#define TEMPERING_SHIFT_U(y)  (y >> 11)
+#define TEMPERING_SHIFT_S(y)  (y << 7)
+#define TEMPERING_SHIFT_T(y)  (y << 15)
+#define TEMPERING_SHIFT_L(y)  (y >> 18)
+
+static unsigned long mt[N]; /* the array for the state vector  */
+static int mti=N+1; /* mti==N+1 means mt[N] is not initialized */
+
+/* Initializing the array with a seed */
+void
+sgenrand(seed)
+    unsigned long seed;	
+{
+    int i;
+
+    for (i=0;i<N;i++) {
+         mt[i] = seed & 0xffff0000;
+         seed = 69069 * seed + 1;
+         mt[i] |= (seed & 0xffff0000) >> 16;
+         seed = 69069 * seed + 1;
+    }
+    mti = N;
+}
+
+/* Initialization by "sgenrand()" is an example. Theoretically,      */
+/* there are 2^19937-1 possible states as an intial state.           */
+/* This function allows to choose any of 2^19937-1 ones.             */
+/* Essential bits in "seed_array[]" is following 19937 bits:         */
+/*  (seed_array[0]&UPPER_MASK), seed_array[1], ..., seed_array[N-1]. */
+/* (seed_array[0]&LOWER_MASK) is discarded.                          */ 
+/* Theoretically,                                                    */
+/*  (seed_array[0]&UPPER_MASK), seed_array[1], ..., seed_array[N-1]  */
+/* can take any values except all zeros.                             */
+void
+lsgenrand(seed_array)
+    unsigned long seed_array[];
+    /* the length of seed_array[] must be at least N */
+{
+    int i;
+
+    for (i=0;i<N;i++) 
+      mt[i] = seed_array[i];
+    mti=N;
+}
+
+double /* generating reals */
+/* unsigned long */ /* for integer generation */
+genrand()
+{
+    unsigned long y;
+    static unsigned long mag01[2]={0x0, MATRIX_A};
+    /* mag01[x] = x * MATRIX_A  for x=0,1 */
+
+    if (mti >= N) { /* generate N words at one time */
+        int kk;
+
+        if (mti == N+1)   /* if sgenrand() has not been called, */
+            sgenrand(4357); /* a default initial seed is used   */
+
+        for (kk=0;kk<N-M;kk++) {
+            y = (mt[kk]&UPPER_MASK)|(mt[kk+1]&LOWER_MASK);
+            mt[kk] = mt[kk+M] ^ (y >> 1) ^ mag01[y & 0x1];
+        }
+        for (;kk<N-1;kk++) {
+            y = (mt[kk]&UPPER_MASK)|(mt[kk+1]&LOWER_MASK);
+            mt[kk] = mt[kk+(M-N)] ^ (y >> 1) ^ mag01[y & 0x1];
+        }
+        y = (mt[N-1]&UPPER_MASK)|(mt[0]&LOWER_MASK);
+        mt[N-1] = mt[M-1] ^ (y >> 1) ^ mag01[y & 0x1];
+
+        mti = 0;
+    }
+  
+    y = mt[mti++];
+    y ^= TEMPERING_SHIFT_U(y);
+    y ^= TEMPERING_SHIFT_S(y) & TEMPERING_MASK_B;
+    y ^= TEMPERING_SHIFT_T(y) & TEMPERING_MASK_C;
+    y ^= TEMPERING_SHIFT_L(y);
+
+    return ( (double)y * 2.3283064370807974e-10 ); /* reals */
+    /* return y; */ /* for integer generation */
+}
Added: trunk/packages/rnahybrid/branches/upstream/current/src/mt19937-1.h
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/mt19937-1.h	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/mt19937-1.h	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,12 @@
+#ifdef __cplusplus
+extern "C" {
+#endif
+
+void sgenrand(unsigned long seed);
+
+double genrand();
+
+
+#ifdef __cplusplus
+}
+#endif
Added: trunk/packages/rnahybrid/branches/upstream/current/src/numerical.c
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/numerical.c	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/numerical.c	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,298 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#include "globals.h"
+#include "minmax.h"
+#include "math.h"
+
+
+int compare_floats (const void *a, const void *b)
+{
+  const float *da = (const float *) a;
+  const float *db = (const float *) b;
+
+  return (*da > *db) - (*da < *db);
+}
+
+
+void empirical_cumulative_distribution_function(float **xcdf, float **ycdf, float *bin_number, float *xs, int sample_size)
+{
+  float min_e;
+  float max_e;
+
+  float bin_width, bin;
+
+  int k, i;
+
+  qsort(xs,sample_size,sizeof(float),compare_floats);
+
+  (*bin_number) = min(sample_size,BINNUMBER);
+
+  *xcdf = (float *) calloc(BINNUMBER,sizeof(float));
+  *ycdf = (float *) calloc(BINNUMBER+1,sizeof(float));
+
+
+  min_e = 0.0;
+  max_e = xs[sample_size-1];
+
+  bin_width = fabs(max_e - min_e) / ((float) (*bin_number));
+
+  k = 0;
+  (*ycdf)[0] = 0.0;
+
+  bin = 0.0;
+
+  i = 0;
+
+  for (k=1; k<=(*bin_number); k++) {
+    bin = bin + bin_width;
+    (*xcdf)[k-1] = bin;
+    (*ycdf)[k] = (*ycdf)[k-1];
+    while (i<sample_size && xs[i] <= bin) {
+      (*ycdf)[k]++;
+      i++;
+    }
+  }
+
+  for (k=1;k<=(*bin_number);k++)
+    (*ycdf)[k] /= sample_size;
+}
+
+
+float mean(float *xs, int sample_size)
+{
+  float sum = 0.0;
+
+  int k;
+  for (k=0; k<sample_size; k++)
+    sum += xs[k];
+
+  return (sum/sample_size);
+}
+
+
+
+float variance(float *xs, int sample_size)
+{
+  float m = mean(xs,sample_size);
+
+  float sum = 0.0;
+  int k;
+  for (k=0; k<sample_size; k++)
+    sum += pow(m-xs[k],2);
+
+  return (sum / (sample_size-1));
+}
+
+void linear_regression(float *slope, float *intercept, float *xs, float *ys, int sample_size)
+{
+  float var, s, sx, sy, sxx, sxy, delta;
+  int k;
+
+  var = variance(ys,sample_size);
+  s = 0.0;
+  for (k=0; k<sample_size; k++)
+    s += 1.0/var;
+  sx = 0.0;
+  for (k=0; k<sample_size; k++)
+    sx += xs[k]/var;
+  sy = 0.0;
+  for (k=0; k<sample_size; k++)
+    sy += ys[k]/var;
+  sxx = 0.0;
+  for (k=0; k<sample_size; k++)
+    sxx += xs[k]*xs[k]/var;
+  sxy = 0.0;
+  for (k=0; k<sample_size; k++)
+    sxy += xs[k]*ys[k]/var;
+  delta = s*sxx-sx*sx;
+  (*slope) = (s*sxy-sx*sy)/delta;
+  (*intercept) = (sxx*sy-sx*sxy)/delta;
+}
+
+
+void estimate_evd_parameters(int *used_sample_size, float *xi, float *theta, float *normalised_energies, int sample_size)
+{
+  float *xcdf, *ycdf;
+  float bin_number;
+  int start, end;
+  
+  /*   calculate empirical cdf: */
+  empirical_cumulative_distribution_function(&xcdf,&ycdf,&bin_number,normalised_energies,sample_size);
+
+  /*   delete values below normalised energy of FITLOWERCUTOFFABSOLUTE: */
+  start=0;
+
+  while (start<bin_number && xcdf[start] < FITLOWERCUTOFFABSOLUTE)
+    start++;
+
+  /*   delete top FITUPPERCUTOFFPERCENT values: */
+  end = (int) bin_number * (100.0 - FITUPPERCUTOFFPERCENT) / 100.0 - 1;
+
+  (*used_sample_size) = end-start+1;
+
+  if (end<=start) {
+    (*xi) = 0.0;
+    (*theta) = 0.0;
+  }
+  else {
+    /*   do linear regression on log(-log) transformed cdf: */
+    float slope, intercept;
+    int k;
+    for (k=start; k<=end; k++)
+      ycdf[k+1] = log(-log(ycdf[k+1]));
+
+    linear_regression(&slope,&intercept,xcdf+start,ycdf+start+1,end-start+1);
+
+    (*theta) = -1.0/slope;
+    (*xi) = intercept * (*theta);
+  }
+
+  free(xcdf);
+  free(ycdf);
+}
+
+
+#define GOLD 1.618034
+#define GLIMIT 100.0
+#define TINY 1.0e-20
+#define MAX(a,b) ((a) > (b) ? (a) : (b))
+#define SIGN(a,b) ((b) > 0.0 ? fabs(a) : -fabs(a))
+#define SHFT(a,b,c,d) (a)=(b);(b)=(c);(c)=(d);
+
+void mnbrak(float *ax, float *bx, float *cx, float *fa, float *fb, float *fc, float (*func)(float))
+{
+	float ulim,u,r,q,fu,dum;
+
+	*fa=(*func)(*ax);
+	*fb=(*func)(*bx);
+	if (*fb > *fa) {
+		SHFT(dum,*ax,*bx,dum)
+		SHFT(dum,*fb,*fa,dum)
+	}
+	*cx=(*bx)+GOLD*(*bx-*ax);
+	*fc=(*func)(*cx);
+	while (*fb > *fc) {
+		r=(*bx-*ax)*(*fb-*fc);
+		q=(*bx-*cx)*(*fb-*fa);
+		u=(*bx)-((*bx-*cx)*q-(*bx-*ax)*r)/
+			(2.0*SIGN(MAX(fabs(q-r),TINY),q-r));
+		ulim=(*bx)+GLIMIT*(*cx-*bx);
+		if ((*bx-u)*(u-*cx) > 0.0) {
+			fu=(*func)(u);
+			if (fu < *fc) {
+				*ax=(*bx);
+				*bx=u;
+				*fa=(*fb);
+				*fb=fu;
+				return;
+			} else if (fu > *fb) {
+				*cx=u;
+				*fc=fu;
+				return;
+			}
+			u=(*cx)+GOLD*(*cx-*bx);
+			fu=(*func)(u);
+		} else if ((*cx-u)*(u-ulim) > 0.0) {
+			fu=(*func)(u);
+			if (fu < *fc) {
+				SHFT(*bx,*cx,u,*cx+GOLD*(*cx-*bx))
+				SHFT(*fb,*fc,fu,(*func)(u))
+			}
+		} else if ((u-ulim)*(ulim-*cx) >= 0.0) {
+			u=ulim;
+			fu=(*func)(u);
+		} else {
+			u=(*cx)+GOLD*(*cx-*bx);
+			fu=(*func)(u);
+		}
+		SHFT(*ax,*bx,*cx,u)
+		SHFT(*fa,*fb,*fc,fu)
+	}
+}
+
+#undef GOLD
+#undef GLIMIT
+#undef TINY
+#undef MAX
+#undef SIGN
+#undef SHFT
+
+
+#define ITMAX 100
+#define CGOLD 0.3819660
+#define ZEPS 1.0e-10
+#define SIGN(a,b) ((b) > 0.0 ? fabs(a) : -fabs(a))
+#define SHFT(a,b,c,d) (a)=(b);(b)=(c);(c)=(d);
+
+float brent(float ax, float bx, float cx, float (*f)(float), float tol, float *xmin)
+{
+	int iter;
+	float a,b,d,etemp,fu,fv,fw,fx,p,q,r,tol1,tol2,u,v,w,x,xm;
+	float e=0.0;
+
+	a=((ax < cx) ? ax : cx);
+	b=((ax > cx) ? ax : cx);
+	x=w=v=bx;
+	fw=fv=fx=(*f)(x);
+	for (iter=1;iter<=ITMAX;iter++) {
+		xm=0.5*(a+b);
+		tol2=2.0*(tol1=tol*fabs(x)+ZEPS);
+		if (fabs(x-xm) <= (tol2-0.5*(b-a))) {
+			*xmin=x;
+			return fx;
+		}
+		if (fabs(e) > tol1) {
+			r=(x-w)*(fx-fv);
+			q=(x-v)*(fx-fw);
+			p=(x-v)*q-(x-w)*r;
+			q=2.0*(q-r);
+			if (q > 0.0) p = -p;
+			q=fabs(q);
+			etemp=e;
+			e=d;
+			if (fabs(p) >= fabs(0.5*q*etemp) || p <= q*(a-x) || p >= q*(b-x))
+				d=CGOLD*(e=(x >= xm ? a-x : b-x));
+			else {
+				d=p/q;
+				u=x+d;
+				if (u-a < tol2 || b-u < tol2)
+					d=SIGN(tol1,xm-x);
+			}
+		} else {
+			d=CGOLD*(e=(x >= xm ? a-x : b-x));
+		}
+		u=(fabs(d) >= tol1 ? x+d : x+SIGN(tol1,d));
+		fu=(*f)(u);
+		if (fu <= fx) {
+			if (u >= x) a=x; else b=x;
+			SHFT(v,w,x,u)
+			SHFT(fv,fw,fx,fu)
+		} else {
+			if (u < x) a=u; else b=u;
+			if (fu <= fw || w == x) {
+				v=w;
+				w=u;
+				fv=fw;
+				fw=fu;
+			} else if (fu <= fv || v == x || v == w) {
+				v=u;
+				fv=fu;
+			}
+		}
+	}
+	printf("Too many iterations in BRENT\n");
+	*xmin=x;
+	return fx;
+}
+
+#undef ITMAX
+#undef CGOLD
+#undef ZEPS
+#undef SIGN
+
Added: trunk/packages/rnahybrid/branches/upstream/current/src/numerical.h
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/numerical.h	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/numerical.h	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,29 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#ifndef numerical_h
+#define numerical_h
+
+
+int compare_floats (const void *a, const void *b);
+
+void empirical_cumulative_distribution_function(float **xcdf, float **ycdf, float *bin_number, float *xs, int sample_size);
+
+float mean(float *xs, int sample_size);
+
+float variance(float *xs, int sample_size);
+
+void linear_regression(float *slope, float *intercept, float *xs, float *ys, int sample_size);
+
+void estimate_evd_parameters(int *used_sample_size, float *xi, float *theta, float *normalised_energies, int sample_size);
+
+void mnbrak(float *ax, float *bx, float *cx, float *fa, float *fb, float *fc, float (*func)(float));
+
+float brent(float ax, float bx, float cx, float (*)(float), float tol, float *xmin);
+
+#endif
Added: trunk/packages/rnahybrid/branches/upstream/current/src/plot.c
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/plot.c	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/plot.c	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,424 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#include "config.h"
+#include "plot.h"
+
+#ifdef HAVE_LIBG2
+
+#ifdef HAVE_LIBGD
+#include <g2_gd.h>
+#endif
+
+void   loop(int i, int j, short *pair_table);
+
+short *make_pair_table(const char *structure);
+
+void *space(unsigned size);
+
+void nrerror(const char message[]);
+
+/* local variables for parsing routines */
+
+float  *angle;
+int    *loop_size, *stack_size;
+int     lp, stk;
+
+#ifndef PI
+#define  PI       3.141592654
+#endif
+#define  PIHALF       PI/2.
+
+
+
+void hybridPlot(char *seq, char *str, double energy, int sepPos, char *filename, int blackWhite, int format)
+{
+  double base_fontsize=12;
+  float *X, *Y,min_X=0,max_X=0,min_Y=0,max_Y=0;
+  unsigned int i;
+  short *pair_table;
+  int id_PS,id;
+  int ps_color_black,ps_color_red,ps_color_blue;
+  char energy_str[50];
+
+#ifdef HAVE_LIBGD
+  int id_PNG=0,id_JPG=0;
+  int png_color_black,png_color_red,png_color_blue;
+  int jpg_color_black,jpg_color_red,jpg_color_blue;
+#endif
+
+  unsigned int basenr_x=0, basenr_y=0;
+  double xpos,ypos;
+  char buf[2];
+
+  buf[1]=0;
+  
+  //  assert(strlen(str) == strlen(seq));
+
+  X = (float *) calloc(strlen(seq)+1,sizeof(float));
+  Y = (float *) calloc(strlen(seq)+1,sizeof(float));
+
+  pair_table = make_pair_table(str);
+  i = simple_xy_coordinates(pair_table, X, Y);
+  if(i!=strlen(str))
+    printf("strange things happening in squigglePlot ...");
+    
+  // scale image
+  //  for(i=0;i<strlen(str);i++)
+  //    {
+  //      X[i]*=options.scale;
+  //      Y[i]*=options.scale;
+  //    }  
+
+  // calculate image dimensions
+  for(i=0;i<strlen(str);i++)
+    {
+      min_X=min(min_X,X[i]);
+      max_X=max(max_X,X[i]);
+      min_Y=min(min_Y,Y[i]);
+      max_Y=max(max_Y,Y[i]);
+    }
+
+  // add a border to image size
+  min_X-=10;
+  max_X+=10;
+  min_Y-=10;
+  max_Y+=10;
+
+  // open device with respect to "format"
+  id     = g2_open_vd();
+
+  if(format==PSPLOT)
+    {
+      id_PS  = g2_open_EPSF(filename);
+      g2_attach(id,id_PS);
+    }
+
+#ifdef HAVE_LIBGD
+  if(format==PNGPLOT)
+    {
+      id_PNG=g2_open_gd(filename,(int)(max_X-min_X),(int)(max_Y-min_Y),g2_gd_png);
+      g2_attach(id,id_PNG);
+    }
+  if(format==JPGPLOT)
+    {
+      id_JPG=g2_open_gd(filename,(int)(max_X-min_X),(int)(max_Y-min_Y),g2_gd_jpeg);
+      g2_attach(id,id_JPG);
+    }
+#endif  
+  
+  g2_set_coordinate_system(id,-min_X,-min_Y,1,1);
+
+  // drawing parameters
+  g2_set_line_width(id,0.6);
+
+  // mark 5' end
+  g2_string(id,X[0]-20,Y[0],"5'");
+
+  // print energy:
+  sprintf(energy_str,"mfe: %.1f kcal/mol",energy);
+  g2_string(id,min_X+40,min_Y+20,energy_str);
+
+  // define colors
+  if(blackWhite)
+    {
+      switch(format)
+	{
+	case PSPLOT:
+	  ps_color_black=g2_ink(id_PS,0,0,0);
+	  ps_color_red=g2_ink(id_PS,0,0,0);
+	  ps_color_blue=g2_ink(id_PS,0,0,0);
+	  break;
+#ifdef HAVE_LIBGD
+	case PNGPLOT:
+	  png_color_black=g2_ink(id_PNG,0,0,0);
+	  png_color_red=g2_ink(id_PNG,0,0,0);
+	  png_color_blue=g2_ink(id_PNG,0,0,0);
+
+	  ps_color_black=png_color_black;
+	  ps_color_red=png_color_red;
+	  ps_color_blue=png_color_blue;
+
+	  break;
+	case JPGPLOT:
+	  jpg_color_black=g2_ink(id_JPG,0,0,0);
+	  jpg_color_red=g2_ink(id_JPG,0,0,0);
+	  jpg_color_blue=g2_ink(id_JPG,0,0,0);
+
+	  ps_color_black=jpg_color_black;
+	  ps_color_red=jpg_color_red;
+	  ps_color_blue=jpg_color_blue;
+
+	  break;  
+#endif
+	}
+    }
+  else
+    {
+      switch(format)
+	{
+	case PSPLOT:
+	  ps_color_black=g2_ink(id_PS,0,0,0);
+	  ps_color_red=g2_ink(id_PS,1,0,0);
+	  ps_color_blue=g2_ink(id_PS,0,0.75,0);
+	  break;
+#ifdef HAVE_LIBGD
+	case PNGPLOT:
+	  png_color_black=g2_ink(id_PNG,0,0,0);
+	  png_color_red=g2_ink(id_PNG,1,0,0);
+	  png_color_blue=g2_ink(id_PNG,0,0.75,0);
+
+	  ps_color_black=png_color_black;
+	  ps_color_red=png_color_red;
+	  ps_color_blue=png_color_blue;
+
+	  break;
+	case JPGPLOT:
+	  jpg_color_black=g2_ink(id_JPG,0,0,0);
+	  jpg_color_red=g2_ink(id_JPG,1,0,0);
+	  jpg_color_blue=g2_ink(id_JPG,0,0.75,0);
+
+	  ps_color_black=jpg_color_black;
+	  ps_color_red=jpg_color_red;
+	  ps_color_blue=jpg_color_blue;
+
+	  break;
+#endif
+	}
+    }
+
+  // draw sequence
+  g2_set_font_size(id,base_fontsize);
+    for(i=0;i<strlen(str);i++)
+   {
+     if(i<sepPos)
+       g2_pen(id,ps_color_red);
+     else
+       g2_pen(id,ps_color_blue);
+         
+     buf[0]=seq[i];
+     xpos=X[i]-base_fontsize/2;
+     ypos=Y[i]-4;
+     if (i<=sepPos-4 || i > sepPos-1)
+       g2_string(id,xpos,ypos,buf);
+     
+     // connection to next base
+     if(i<strlen(str)-1)
+       {
+	 if(i<sepPos-4 || i>sepPos-1)
+	   {
+	     if(i<sepPos)
+	       g2_pen(id,ps_color_red);
+	     else
+	       g2_pen(id,ps_color_blue);
+	     g2_line(id,X[i],Y[i],X[i+1],Y[i+1]);
+	   }
+
+	 // draw circles at line endpoints
+/* 	 if(i<sepPos) */
+/* 	   g2_pen(id,ps_color_red); */
+/* 	 else */
+/* 	   g2_pen(id,ps_color_blue); */
+/* 	 g2_filled_circle(id,X[i],Y[i],0.7);       // circles are drawn twice, but thats ok ... */
+       }
+   }
+   
+    // draw pairings
+    // !!! pair_table indexing begins at 1 !!!
+    for(i=0;i<strlen(str);i++)
+      {
+	if((unsigned short)pair_table[i+1]>i+1)
+	  {
+	    // pairs in both structures
+	    g2_pen(id,ps_color_black);
+	    g2_pen(id,ps_color_black);	   	    
+	    g2_line(id,X[i],Y[i],X[pair_table[i+1]-1],Y[pair_table[i+1]-1]);
+	  }
+      }
+
+
+    g2_flush(id);
+    g2_close(id);
+
+    free(pair_table);
+    free(X);
+    free(Y);
+}
+
+
+
+short *make_pair_table(const char *structure)
+{
+    /* returns array representation of structure.
+       table[i] is 0 if unpaired or j if (i.j) pair.  */
+   short i,j,hx;
+   short length;
+   short *stack;
+   short *table;
+   
+   length = (short) strlen(structure);
+   stack = (short *) space(sizeof(short)*(length+1));
+   table = (short *) space(sizeof(short)*(length+2));
+   table[0] = length;
+   
+   for (hx=0, i=1; i<=length; i++) {
+      switch (structure[i-1]) {
+       case '(': 
+	 stack[hx++]=i;
+	 break;
+       case ')':
+	 j = stack[--hx];
+	 if (hx<0) {
+	    fprintf(stderr, "%s\n", structure);
+	    nrerror("unbalanced brackets in make_pair_table");
+	 }
+	 table[i]=j;
+	 table[j]=i;
+	 break;
+       default:   /* unpaired base, usually '.' */
+	 table[i]= 0;
+	 break;
+      }
+   }
+   if (hx!=0) {
+      fprintf(stderr, "%s\n", structure);
+      nrerror("unbalanced brackets in make_pair_table");
+   }
+   free(stack);
+   return(table);
+}
+
+
+void *space(unsigned size)
+{
+  void *pointer;
+  
+  if ( (pointer = (void *) calloc(1, (size_t) size)) == NULL) {
+      nrerror("SPACE allocation failure -> no memory");
+  }
+  return  pointer;
+}
+
+
+void nrerror(const char message[])       /* output message upon error */
+{
+  fprintf(stderr, "\n%s\n", message);
+  exit(2);
+}
+
+
+int simple_xy_coordinates(short *pair_table, float *x, float *y)
+{
+  float INIT_ANGLE=0.;     /* initial bending angle */
+  float INIT_X = 100.;     /* coordinate of first digit */
+  float INIT_Y = 100.;     /* see above */
+  float RADIUS =  15.;
+
+  int i, length;
+  float  alpha;
+
+  length = pair_table[0];
+  angle =      (float*) space( (length+5)*sizeof(float) );
+  loop_size  =   (int*) space( 16+(length/5)*sizeof(int) );
+  stack_size =   (int*) space( 16+(length/5)*sizeof(int) );
+  lp = stk = 0;
+  loop(0, length+1, pair_table);
+  loop_size[lp] -= 2;     /* correct for cheating with function loop */
+  
+  alpha = INIT_ANGLE;
+  x[0]  = INIT_X;
+  y[0]  = INIT_Y;   
+
+  for (i = 1; i <= length; i++) {
+    x[i] = x[i-1]+RADIUS*cos(alpha);
+    y[i] = y[i-1]+RADIUS*sin(alpha);
+    alpha += PI-angle[i+1];
+  }
+  free(angle);
+  free(loop_size);  
+  free(stack_size); 
+
+  return length;
+
+}
+
+/*---------------------------------------------------------------------------*/
+
+void loop(int i, int j, short *pair_table)
+             /* i, j are the positions AFTER the last pair of a stack; i.e
+		i-1 and j+1 are paired. */
+{
+  int    count = 2;   /* counts the VERTICES of a loop polygon; that's
+			   NOT necessarily the number of unpaired bases!
+			   Upon entry the loop has already 2 vertices, namely
+			   the pair i-1/j+1.  */
+
+  int    r = 0, bubble = 0; /* bubble counts the unpaired digits in loops */
+
+  int    i_old, partner, k, l, start_k, start_l, fill, ladder;
+  int    begin, v, diff;
+  float  polygon;
+
+  short *remember;  
+
+  remember = (short *) space((1+(j-i)/5)*2*sizeof(short));
+    
+  i_old = i-1, j++;         /* j has now been set to the partner of the
+			       previous pair for correct while-loop
+			       termination.  */
+  while (i != j) {
+    partner = pair_table[i];
+    if ((!partner) || (i==0))
+      i++, count++, bubble++;
+    else {
+      count += 2;
+      k = i, l = partner;    /* beginning of stack */
+      remember[++r] = k;
+      remember[++r] = l;
+      i = partner+1;         /* next i for the current loop */
+
+      start_k = k, start_l = l;
+      ladder = 0;
+      do {
+	k++, l--, ladder++;        /* go along the stack region */
+      }
+      while (pair_table[k] == l);
+
+      fill = ladder-2;
+      if (ladder >= 2) {
+	angle[start_k+1+fill] += PIHALF;   /*  Loop entries and    */
+	angle[start_l-1-fill] += PIHALF;   /*  exits get an        */
+	angle[start_k]        += PIHALF;   /*  additional PI/2.    */
+	angle[start_l]        += PIHALF;   /*  Why ? (exercise)    */
+	if (ladder > 2) {
+	  for (; fill >= 1; fill--) {
+	    angle[start_k+fill] = PI;    /*  fill in the angles  */
+	    angle[start_l-fill] = PI;    /*  for the backbone    */
+	  }
+	}
+      }
+      stack_size[++stk] = ladder;
+      loop(k, l, pair_table);
+    }
+  }
+  polygon = PI*(count-2)/(float)count; /* bending angle in loop polygon */
+  remember[++r] = j;
+  begin = i_old < 0 ? 0 : i_old;
+  for (v = 1; v <= r; v++) {
+    diff  = remember[v]-begin;
+    for (fill = 0; fill <= diff; fill++)
+      angle[begin+fill] += polygon;
+    if (v > r)
+      break;
+    begin = remember[++v];
+  }
+  loop_size[++lp] = bubble;
+  free(remember);
+}
+
+#endif
Added: trunk/packages/rnahybrid/branches/upstream/current/src/plot.h
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/plot.h	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/plot.h	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,35 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#ifndef plot_h
+#define plot_h
+
+#include "config.h"
+
+#define  PSPLOT 0
+#define PNGPLOT 1
+#define JPGPLOT 2
+#define ALLPLOT 3
+
+
+
+#ifdef HAVE_LIBG2
+
+#include <stdio.h>  
+#include <g2.h>
+#include <g2_PS.h>
+#include "minmax.h"
+
+
+
+void hybridPlot(char *seq, char *str, double energy, int sepPos, char *filename, int blackWhite, int format);
+
+
+#endif
+
+#endif
Added: trunk/packages/rnahybrid/branches/upstream/current/src/random.c
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/random.c	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/random.c	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,112 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#include "random.h"
+#include "globals.h"
+#include "mt19937-1.h"
+#include <sys/types.h>
+#include <stdio.h>
+#include <string.h>
+#include <math.h>
+
+
+
+char *alphabet = "ACGT";
+
+
+void read_dinucleotide_frequencies(float **freq_di, FILE *f)
+{
+  char s [MAXLINE];
+  int i,j;
+
+  while (fgets(s,MAXLINE,f)!=NULL) {
+    if (s[0] != '#') {
+      switch (toupper(s[0])) {
+      case 'A':
+	i=0;
+	break;
+      case 'C':
+	i=1;
+	break;
+      case 'G':
+	i=2;
+	break;
+      case 'T':
+	i=3;
+	break;
+      case 'U':
+	i=3;
+	break;
+      }
+      switch (toupper(s[1])) {
+      case 'A':
+	j=0;
+	break;
+      case 'C':
+	j=1;
+	break;
+      case 'G':
+	j=2;
+	break;
+      case 'T':
+	j=3;
+	break;
+      case 'U':
+	j=3;
+	break;
+      }
+      sscanf(s,"%*s %f",&(freq_di[i][j]));
+    }
+  }
+}
+
+
+char* random_sequence(int seqlen, float *fdf, float **fdf_di)
+{
+  int i, c;
+  float s;
+
+  char *sequence = (char *) calloc(seqlen+1,sizeof(char));
+
+  for (i=0; i<seqlen; i++) {
+    s = genrand();
+    c = 0;
+    if (i==0) {
+      while (fdf[c]<s) c++;
+    }
+    else {
+      while (fdf_di[strchr(alphabet,sequence[i-1])-alphabet][c]<s) c++;
+    }
+    sequence[i]=alphabet[c];
+  }
+  sequence[seqlen] = '\0';
+
+  return sequence;
+}
+
+
+float normal_random_number()
+{
+  float u1, u2, v1,v2,s,z;
+
+  do {
+
+    u1 = genrand();
+    u2 = genrand();
+
+    v1 = 2*u1-1;
+    v2 = 2*u2-1;
+
+    s = pow(v1,2) + pow(v2,2);
+
+  } while (s > 1);
+
+  z = sqrt(-2*log(s)/s)*v1;
+
+  return z;
+}
Added: trunk/packages/rnahybrid/branches/upstream/current/src/random.h
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/random.h	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/random.h	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,33 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#ifndef random_h
+#define random_h
+
+#include <stdio.h>
+
+
+extern char *alphabet;
+
+
+void read_dinucleotide_frequencies(float **freq_di, FILE *f);
+
+char *random_sequence(int seqlen, float *fdf, float **fdf_di);
+
+float normal_random_number();
+
+
+#endif
Added: trunk/packages/rnahybrid/branches/upstream/current/src/rnacalibrate.c
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/rnacalibrate.c	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/rnacalibrate.c	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,705 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#include "hybrid_core.h"
+#include "numerical.h"
+#include "random.h"
+#include "globals.h"
+#include "minmax.h"
+#include "mt19937-1.h"
+#include <stdio.h>
+#include <sys/types.h>
+#include <time.h>
+#include <math.h>
+#include <stdlib.h>
+
+
+static char const rcsid[] = "$Id: rnacalibrate.c,v 1.11 2004/11/16 15:42:33 marc Exp $";
+
+
+struct output {
+  char query_ac[MAXLINE];
+  int used_sample_size;
+  float location, scale;
+};
+
+
+int main(int argc, char **argv)
+{
+  extern char *optarg;
+  extern int optind;
+  int c;
+  int
+    dflag = 0, // file with dinucleotide parameters
+    fflag = 0, // force helix, arguments: from,to (positions in miRNA)
+    hflag = 0, // help
+    kflag = 0, // number of sequences to generate
+    lflag = 0, // length distribution parameters (mean, std deviation)
+    mflag = 0, // max target length
+    nflag = 0, // max query length
+    qflag = 0, // query  input file
+    sflag = 0, // make random sequences according to target file
+    tflag = 0, // target input file
+    uflag = 0, // upper size for internal loops (per side)
+    vflag = 0, // upper size for bulge loops
+    errflag = 0;
+
+  int
+    maxtargetlength,
+    maxquerylength;
+  char
+    *query_fn,  // query filename
+    *target_fn;
+
+  char target_ac[MAXLINE];
+  char query_ac[MAXLINE];
+
+  char *target_sq;
+  char *query_sq;
+
+  char *freq_filename;
+
+  int i1, i2;
+  double v2, normalised_energy;
+
+  int
+    fflag_start,
+    fflag_end;
+  int
+    targetlength,
+    querylength;
+
+  int mean, stddev, sample_size;
+
+  struct output output;
+
+  FILE *f;
+
+  int i,j,k,seqlen;
+
+  char letter_one, letter_two;
+
+  int index_one, index_two;
+
+  int counter;
+
+  
+
+  float *normalised_energies;
+
+  float **freq_di = (float **) calloc(4,sizeof(float*));
+  float **fdf_di = (float **) calloc(4,sizeof(float*));
+  float *freq;
+  float *fdf;
+
+  for (i=0; i<4; i++) {
+    freq_di[i] = (float *) calloc(4,sizeof(float));
+    fdf_di[i]  = (float *) calloc(4,sizeof(float));
+  }
+  freq = (float *) calloc(4,sizeof(float));
+  fdf  = (float *) calloc(4,sizeof(float));
+
+
+
+  while ((c = getopt(argc,argv,"d:f:hk:l:m:n:q:st:u:v:")) != EOF)
+    switch(c) {
+    case 'd':
+      dflag = 1;
+      freq_filename = optarg;
+      break;
+    case 'f':
+      fflag=1;
+      sscanf(optarg,"%d,%d",&fflag_start,&fflag_end);
+      break;
+    case 'h':
+      hflag=1;
+      break;
+    case 'k':
+      kflag = 1;
+      sscanf(optarg,"%d",&sample_size);
+      break;
+    case 'l':
+      lflag = 1;
+      sscanf(optarg,"%d,%d",&mean,&stddev);
+      break;
+    case 'm':
+      mflag=1;
+      sscanf(optarg,"%d",&maxtargetlength);
+      break;
+    case 'n':
+      nflag=1;
+      sscanf(optarg,"%d",&maxquerylength);
+      break;
+    case 'q':
+      qflag = 1;
+      query_fn = optarg;
+      break;
+    case 's':
+      sflag = 1;
+      break;
+    case 't':
+      tflag = 1;
+      target_fn = optarg;
+      break;
+    case 'u':
+      uflag = 1;
+      sscanf(optarg,"%d",&iloop_upper_limit);
+      break;
+    case 'v':
+      vflag = 1;
+      sscanf(optarg,"%d",&bloop_upper_limit);
+      break;
+    case '?':
+      errflag = 1;
+      break;
+    }
+
+  if ((errflag || sflag && dflag || argc < 3) && !hflag) {
+    printf("\nOption error. Type %s -h for usage.\n\n", argv[0]);
+    exit(1);
+  }
+  else if (hflag) {
+    printf("\nUsage: %s [options] [target sequence] [query sequence].\n\noptions:\n\n  -d <dinucleotide frequencies file>\n  -f helix constraint\n  -h help\n  -k <sample size>\n  -l <mean sequence length>,<std sequence length>\n  -m <max targetlength>\n  -n <max query length>\n  -u <max internal loop size (per side)>\n  -v <max bulge loop size>\n  -s randomise targets (only with -t, without -d)\n  -t <target file>\n  -q <query file>\n\nIf no target file is given, random sequences are generated according\nto the given dinucleotide distribution. Then <sample size> sequences\nare generated whose lengths are normally distributed with given mean\nand standard deviation. Default sample size is 5000, default mean\nand std are 500 and 300, respectively.\n\nIf a target file is given, and additionally the -s option, random sequences are generated according to the dinucleotide distribution of the target file.\n\nIf only a target file is given, it is used directly as a random database.\n\nThe target can also be given directly (makes only sense with the -s option).\n\nEither a query file has to be given (FASTA format)\nor one query sequence directly.\n\nThe helix constraint format is \"from,to\", eg. -f 2,7 forces\nstructures to have a helix from position 2 to 7 with respect to the query.\n\n", argv[0]);
+    exit(0);
+  }
+
+  if (!uflag)
+    iloop_upper_limit = ILOOPUPPERLIMITDEFAULT;
+  if (!vflag)
+    bloop_upper_limit = BLOOPUPPERLIMITDEFAULT;
+
+  if (!lflag) {
+    mean = MEAN;
+    stddev = STDDEV;
+  }
+
+  if (!kflag)
+    sample_size = SAMPLESIZE;
+
+  if (tflag && !sflag)
+    normalised_energies = (float *) calloc(MAXTARGETNUMBER,sizeof(float));
+  else
+    normalised_energies = (float *) calloc(sample_size,sizeof(float));
+
+  if (!mflag)
+    maxtargetlength = MAXTARGET;
+  if (!nflag)
+    maxquerylength = MAXQUERY;
+
+  if (qflag) {
+    query_sq = (char *) calloc(maxquerylength+MAXLINE+1, sizeof(char));
+    querylength = maxquerylength;
+  }
+  else {
+    query_sq  = (char *) calloc(strlen(argv[argc-1])+1,sizeof(char));
+    strcpy(query_ac,"command_line");
+    strcpy(query_sq,argv[argc-1]);
+    remove_whitespace(query_sq);
+    querylength = strlen(argv[argc-1]);
+  }
+
+  if (tflag)
+    target_sq = (char *) calloc(maxtargetlength+MAXLINE+1,sizeof(char));
+
+
+  if (!tflag && argv[argc-1-(!qflag)][0] != '-') {
+    /* target sequence given on command line */
+    target_sq = (char *) calloc(strlen(argv[argc-1-(!qflag)])+1,sizeof(char));
+    strcpy(target_ac,"command_line");
+    strcpy(target_sq,argv[argc-1-(!qflag)]);
+    remove_whitespace(target_sq);
+    targetlength = strlen(target_sq);
+  }
+
+  if (sflag) {
+    /* initialise dinucleotide frequencies: */
+    for (i=0; i<4; i++)
+      for (j=0; j<4; j++)
+	freq_di[i][j] = 0.0;
+
+    if (tflag) {
+      /* open target file: */
+      FILE *target = fopen(target_fn,"r");
+      if (target==NULL) {
+	printf("Error: Could not open target file. Aborting.\n");
+	exit(2);
+      }
+
+      /* iterate over target sequences: */
+      counter = 0;
+      while (!end(target)) {
+
+	nextAC(target,target_ac);
+	nextSQ(target,target_sq,maxtargetlength);
+
+	remove_whitespace(target_sq);
+
+	seqlen = strlen(target_sq);
+	/* count dinucleotides: */
+	for (k=0; k<seqlen-1; k++) {
+	  letter_one = toupper(target_sq[k]);
+	  letter_two = toupper(target_sq[k+1]);
+
+	  if (letter_one == 'U')
+	    letter_one = 'T';
+	  if (letter_two == 'U')
+	    letter_two = 'T';
+
+	  index_one = (int) strchr(alphabet,letter_one);
+	  index_two = (int) strchr(alphabet,letter_two);
+
+	  if (index_one != 0 && index_two != 0) {
+	    freq_di[index_one-(int) alphabet][index_two-(int) alphabet]++;
+	    counter++;
+	  }
+	}
+      }
+      /* close target file: */
+      fclose(target);
+    } /* if tflag */
+    else { /* !tflag */
+
+      counter = 0;
+      seqlen = strlen(target_sq);
+      /* count dinucleotides: */
+      for (k=0; k<seqlen-1; k++) {
+	letter_one = toupper(target_sq[k]);
+	letter_two = toupper(target_sq[k+1]);
+
+	if (letter_one == 'U')
+	  letter_one = 'T';
+	if (letter_two == 'U')
+	  letter_two = 'T';
+
+	index_one = (int) strchr(alphabet,letter_one);
+	index_two = (int) strchr(alphabet,letter_two);
+
+	if (index_one != 0 && index_two != 0) {
+	  freq_di[index_one-(int) alphabet][index_two-(int) alphabet]++;
+	  counter++;
+	}
+      }
+
+    }
+
+    /* turn counts into relative frequencies: */
+    for (i=0; i<4; i++)
+      for (j=0; j<4; j++)
+	freq_di[i][j] /= (float) counter;
+    
+  } /* if sflag */
+
+
+  targetlength = maxtargetlength;
+
+  init_constants();                                            
+  init_energies();
+
+  tableAlloc(targetlength,querylength);
+
+  /* allocate string space */
+  r1 = t1 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+  r2 = t2 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+  r3 = t3 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+  r4 = t4 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+
+  x = (char *) calloc(targetlength+2, sizeof(char));     
+  y = (char *) calloc( querylength+2, sizeof(char));     
+ 
+
+  if (tflag && sflag || !tflag && argv[argc-1-(!qflag)][0] != '-' && sflag)
+    free(target_sq);
+
+
+
+  if (dflag) {
+    /*   read dinucleotide frequencies: */
+    f = fopen(freq_filename,"r");
+    read_dinucleotide_frequencies(freq_di,f);
+    fclose(f);
+  }
+
+
+  /*   calculate single nucleotide frequencies: */
+  for (i=0; i<strlen(alphabet); i++) {
+    freq[i]=2*freq_di[i][i];
+    for (j=0; j<strlen(alphabet); j++)
+      if (i!=j)
+	freq[i] += freq_di[i][j];
+    for (j=0; j<strlen(alphabet); j++)
+      if (i!=j)
+	freq[i] += freq_di[j][i];
+    freq[i] /= 2.0;
+  }
+
+  /*   make distribution functions: */
+  fdf[0] = freq[0];
+  for (i=1; i<strlen(alphabet); i++)
+    fdf[i]=fdf[i-1]+freq[i];
+  fdf[strlen(alphabet)-1]=1.0;
+    
+  for (i=0; i<strlen(alphabet); i++) {
+    float row_sum = 0;
+    for (j=0; j<strlen(alphabet); j++)
+      row_sum+=freq_di[i][j];
+    fdf_di[i][0]=freq_di[i][0]/row_sum;
+    for (j=1; j<strlen(alphabet); j++)
+      fdf_di[i][j]=fdf_di[i][j-1]+freq_di[i][j]/row_sum;
+    fdf_di[i][strlen(alphabet)-1]=1.0;
+  }
+
+
+  sgenrand(time(NULL));
+
+  if (qflag) {
+
+    FILE *query  = fopen( query_fn,"r");
+    if (query==NULL) {
+      printf("Error: Could not open query file. Aborting.\n");
+      exit(2);
+    }
+
+    while (!end(query)) {
+
+      nextAC(query,query_ac);
+      nextSQ(query,query_sq,maxquerylength);
+
+      remove_whitespace(query_sq);
+    
+      n = strlen(query_sq);
+
+      if (fflag) {
+	helix_start = n - fflag_end;
+	helix_end   = n - fflag_start + 1;
+      }
+      else {
+	helix_start = 0;
+	helix_end   = 0;
+      }
+
+      if (n > maxquerylength) {
+	printf("query too long: %s\n", query_ac);
+      }
+      else {
+
+	y[0]=' ';
+	for (i=0;i<=n-1;i++) y[i+1] = query_sq[n-i-1];
+	y[n+1]=0;
+	convert_y();
+
+	if (tflag && !sflag) {
+	  FILE *target = fopen(target_fn,"r");
+	  if (target==NULL) {
+	    printf("Error: Could not open target file. Aborting.\n");
+	    exit(2);
+	  }
+
+	  k = 0;
+	  while (!end(target) && k<MAXTARGETNUMBER) {
+
+	    nextAC(target,target_ac);
+	    nextSQ(target,target_sq,maxtargetlength);
+
+	    remove_whitespace(target_sq);
+
+	    m = strlen(target_sq);
+
+	    if (m > maxtargetlength) {
+	      printf("target too long: %s\n", target_ac);
+	    }
+	    else {
+	      strcpy(x, " ");                             
+	      strcat(x, target_sq);
+	      convert_x();
+
+	      for (i1=m; i1>=0; i1--) {
+		for (i2=n; i2>=0; i2--) {
+		  calc_unpaired_left_bot(i1, m, i2, n);
+		  calc_closed           (i1, m, i2, n);
+		  calc_unpaired_left_top(i1, m, i2, n);
+		}
+	      }
+	      v2 = calc_hybrid(0, m, 0, n);
+	      
+	      normalised_energy = -v2/log(m*n);
+	      normalised_energies[k] = normalised_energy;
+
+	      free(target_sq);
+
+	      /* initialize strings */
+	      r1 = t1;
+	      r2 = t2;
+	      r3 = t3;
+	      r4 = t4;
+
+	      k++;
+	    }
+	  }
+	  strcpy(output.query_ac,query_ac);
+	  estimate_evd_parameters(&output.used_sample_size,&output.location,&output.scale,normalised_energies,k);
+	  printf("%s %d %f %f\n",output.query_ac,output.used_sample_size,output.location,output.scale);
+/* 	  printf("%s %f %f\n",query_ac,xi,theta); */
+
+	  fclose(target);
+	} /* if tflag && !sflag */
+	else if (!tflag && !sflag && !dflag) {
+	  m = strlen(target_sq);
+
+	  k = 0;
+	  if (m > maxtargetlength) {
+	    printf("target too long: %s\n", target_ac);
+	  }
+	  else {
+	    strcpy(x, " ");                             
+	    strcat(x, target_sq);
+	    convert_x();
+
+	    for (i1=m; i1>=0; i1--) {
+	      for (i2=n; i2>=0; i2--) {
+		calc_unpaired_left_bot(i1, m, i2, n);
+		calc_closed           (i1, m, i2, n);
+		calc_unpaired_left_top(i1, m, i2, n);
+	      }
+	    }
+	    v2 = calc_hybrid(0, m, 0, n);
+
+	    normalised_energy = -v2/log(m*n);
+	    normalised_energies[k] = normalised_energy;
+
+	    free(target_sq);
+
+	    /* initialize strings */
+	    r1 = t1;
+	    r2 = t2;
+	    r3 = t3;
+	    r4 = t4;
+	
+	    k++;
+	  }
+
+	  strcpy(output.query_ac,query_ac);
+	  estimate_evd_parameters(&output.used_sample_size,&output.location,&output.scale,normalised_energies,k);
+	  printf("%s %d %f %f\n",output.query_ac,output.used_sample_size,output.location,output.scale);
+
+/* 	  printf("%s %f %f\n",query_ac,xi,theta); */
+
+	} /* if !tflag && !sflag %% !dflag*/
+	else { /* !tflag or sflag or dflag*/
+	  k = 0;
+	  while (k<sample_size) {
+	    do seqlen = (int) (normal_random_number()*stddev+mean); while (seqlen < 1 || seqlen > maxtargetlength);
+	    target_sq = random_sequence(seqlen,fdf,fdf_di);
+	    
+	    m = strlen(target_sq);
+
+	    strcpy(x, " ");                             
+	    strcat(x, target_sq);
+	    convert_x();
+
+	    for (i1=m; i1>=0; i1--) {
+	      for (i2=n; i2>=0; i2--) {
+		calc_unpaired_left_bot(i1, m, i2, n);
+		calc_closed           (i1, m, i2, n);
+		calc_unpaired_left_top(i1, m, i2, n);
+	      }
+	    }
+	    v2 = calc_hybrid(0, m, 0, n);
+
+	    normalised_energy = -v2/log(m*n);
+	    normalised_energies[k] = normalised_energy;
+
+/* 	    printf("%f\n",normalised_energy); */
+
+	    free(target_sq);
+
+	    /* initialize strings */
+	    r1 = t1;
+	    r2 = t2;
+	    r3 = t3;
+	    r4 = t4;
+
+	    k++;
+	  }
+	  strcpy(output.query_ac,query_ac);
+	  estimate_evd_parameters(&output.used_sample_size,&output.location,&output.scale,normalised_energies,k);
+	  printf("%s %d %f %f\n",output.query_ac,output.used_sample_size,output.location,output.scale);
+	}
+      }
+
+    }
+    fclose(query);
+  } /* if qflag */
+  else { /* !qflag */
+    n = strlen(query_sq);
+    
+    if (fflag) {
+      helix_start = n - fflag_end;
+      helix_end   = n - fflag_start + 1;
+    }
+    else {
+      helix_start = 0;
+      helix_end   = 0;
+    }
+
+
+    y[0]=' ';
+    for (i=0;i<=n-1;i++) y[i+1] = query_sq[n-i-1];
+    y[n+1]=0;
+    convert_y();
+
+    if (tflag && !sflag) {
+      FILE *target = fopen(target_fn,"r");
+      if (target==NULL) {
+	printf("Error: Could not open target file. Aborting.\n");
+	exit(2);
+      }
+
+      k = 0;
+      while (!end(target) && k<MAXTARGETNUMBER) {
+
+	nextAC(target,target_ac);
+	nextSQ(target,target_sq,maxtargetlength);
+
+	remove_whitespace(target_sq);
+
+	m = strlen(target_sq);
+
+	if (m > maxtargetlength) {
+	  printf("target too long: %s\n", target_ac);
+	}
+	else {
+	  strcpy(x, " ");                             
+	  strcat(x, target_sq);
+	  convert_x();
+
+	  for (i1=m; i1>=0; i1--) {
+	    for (i2=n; i2>=0; i2--) {
+	      calc_unpaired_left_bot(i1, m, i2, n);
+	      calc_closed           (i1, m, i2, n);
+	      calc_unpaired_left_top(i1, m, i2, n);
+	    }
+	  }
+	  v2 = calc_hybrid(0, m, 0, n);
+
+	  normalised_energy = -v2/log(m*n);
+	  normalised_energies[k] = normalised_energy;
+
+	  /* initialize strings */
+	  r1 = t1;
+	  r2 = t2;
+	  r3 = t3;
+	  r4 = t4;
+
+	  k++;
+	}
+      }
+      strcpy(output.query_ac,query_ac);
+      estimate_evd_parameters(&output.used_sample_size,&output.location,&output.scale,normalised_energies,k);
+      printf("%s %d %f %f\n",output.query_ac,output.used_sample_size,output.location,output.scale);
+
+      fclose(target);
+    } /* if tflag && !sflag */
+    else if (!tflag && !sflag && !dflag) {
+      m = strlen(target_sq);
+
+      k = 0;
+      if (m > maxtargetlength) {
+	printf("target too long: %s\n", target_ac);
+      }
+      else {
+	strcpy(x, " ");                             
+	strcat(x, target_sq);
+	convert_x();
+
+	for (i1=m; i1>=0; i1--) {
+	  for (i2=n; i2>=0; i2--) {
+	    calc_unpaired_left_bot(i1, m, i2, n);
+	    calc_closed           (i1, m, i2, n);
+	    calc_unpaired_left_top(i1, m, i2, n);
+	  }
+	}
+	v2 = calc_hybrid(0, m, 0, n);
+
+	normalised_energy = -v2/log(m*n);
+	normalised_energies[k] = normalised_energy;
+
+	free(target_sq);
+
+	/* initialize strings */
+	r1 = t1;
+	r2 = t2;
+	r3 = t3;
+	r4 = t4;
+
+	k++;
+      }
+      strcpy(output.query_ac,query_ac);
+      estimate_evd_parameters(&output.used_sample_size,&output.location,&output.scale,normalised_energies,k);
+      printf("%s %d %f %f\n",output.query_ac,output.used_sample_size,output.location,output.scale);
+    } /* if !tflag && !sflag && !dflag */
+    else { /* !tflag or sflag or dflag */
+      k = 0;
+      while (k<sample_size) {
+	do seqlen = (int) (normal_random_number()*stddev+mean); while (seqlen < 1 || seqlen > maxtargetlength);
+	target_sq = random_sequence(seqlen,fdf,fdf_di);
+	
+	m = strlen(target_sq);
+
+	strcpy(x, " ");                             
+	strcat(x, target_sq);
+	convert_x();
+
+	for (i1=m; i1>=0; i1--) {
+	  for (i2=n; i2>=0; i2--) {
+	    calc_unpaired_left_bot(i1, m, i2, n);
+	    calc_closed           (i1, m, i2, n);
+	    calc_unpaired_left_top(i1, m, i2, n);
+	  }
+	}
+	v2 = calc_hybrid(0, m, 0, n);
+
+	normalised_energy = -v2/log(m*n);
+	normalised_energies[k] = normalised_energy;
+
+	free(target_sq);
+
+	/* initialize strings */
+	r1 = t1;
+	r2 = t2;
+	r3 = t3;
+	r4 = t4;
+
+	k++;
+      }
+      strcpy(output.query_ac,query_ac);
+      estimate_evd_parameters(&output.used_sample_size,&output.location,&output.scale,normalised_energies,k);
+      printf("%s %d %f %f\n",output.query_ac,output.used_sample_size,output.location,output.scale);
+    } /* !tflag or sflag */
+  }
+
+  if (tflag && !sflag)
+    free(target_sq);
+
+  for (i=0; i<4; i++) {
+    free(freq_di[i]);
+    free(fdf_di[i]);
+  }
+  free(freq_di);
+  free(fdf_di);
+  free(freq);
+  free(fdf);
+
+  free(normalised_energies);
+
+  free(query_sq);
+
+  return 0;
+}
+
+ 	
+
Added: trunk/packages/rnahybrid/branches/upstream/current/src/rnaeffective.c
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/rnaeffective.c	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/rnaeffective.c	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,659 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#include "hybrid_core.h"
+#include "numerical.h"
+#include "random.h"
+#include "globals.h"
+#include "minmax.h"
+#include "mt19937-1.h"
+#include <stdio.h>
+#include <sys/types.h>
+#include <time.h>
+#include <math.h>
+#include <stdlib.h>
+
+
+static char const rcsid[] = "$Id: rnaeffective.c,v 1.6 2004/11/16 15:41:12 marc Exp $";
+
+
+
+int main(int argc, char **argv)
+{
+  extern char *optarg;
+  extern int optind;
+  int c;
+  int
+    dflag = 0, // file with dinucleotide parameters
+    fflag = 0, // force helix, arguments: from,to (positions in miRNA)
+    hflag = 0, // help
+    kflag = 0, // number of sequences to generate
+    lflag = 0, // length distribution parameters (mean, std deviation)
+    mflag = 0, // max target length
+    nflag = 0, // max query length
+    qflag = 0, // query  input file
+    sflag = 0, // make random sequences according to target file
+    tflag = 0, // target input file
+    uflag = 0, // upper size for internal loops (per side)
+    vflag = 0, // upper size for bulge loops
+    errflag = 0;
+
+  int
+    maxtargetlength,
+    maxquerylength;
+  char
+    *query_fn,  // query filename
+    *target_fn;
+
+  char target_ac[MAXLINE];
+  char query_ac[MAXLINE];
+
+  char *target_sq;
+  char *query_sq;
+
+  char *freq_filename;
+
+  int i1, i2;
+  double v2, normalised_energy;
+
+  int
+    fflag_start,
+    fflag_end;
+  int
+    targetlength,
+    querylength;
+
+  int mean, stddev, sample_size, used_sample_size;
+
+  float pvalue;
+
+  float *xi, *theta;
+
+  FILE *f;
+
+  int i,j,k,l,seqlen;
+
+  char letter_one, letter_two;
+
+  int index_one, index_two;
+
+  int counter;
+
+  float exponent, effective_number;
+
+  float *xcdf, *ycdf, bin_number, error_sum, smallest_error_sum;
+
+  
+
+  float **normalised_energies;
+  float *temp_energies;
+  float *maximal_pvalues;
+  float *joint_pvalues;
+
+  float **freq_di = (float **) calloc(4,sizeof(float*));
+  float **fdf_di = (float **) calloc(4,sizeof(float*));
+  float *freq;
+  float *fdf;
+
+  for (i=0; i<4; i++) {
+    freq_di[i] = (float *) calloc(4,sizeof(float));
+    fdf_di[i]  = (float *) calloc(4,sizeof(float));
+  }
+  freq = (float *) calloc(4,sizeof(float));
+  fdf  = (float *) calloc(4,sizeof(float));
+
+
+
+  while ((c = getopt(argc,argv,"d:f:hk:l:m:n:q:st:u:v:")) != EOF)
+    switch(c) {
+    case 'd':
+      dflag = 1;
+      freq_filename = optarg;
+      break;
+    case 'f':
+      fflag=1;
+      sscanf(optarg,"%d,%d",&fflag_start,&fflag_end);
+      break;
+    case 'h':
+      hflag=1;
+      break;
+    case 'k':
+      kflag = 1;
+      sscanf(optarg,"%d",&sample_size);
+      break;
+    case 'l':
+      lflag = 1;
+      sscanf(optarg,"%d,%d",&mean,&stddev);
+      break;
+    case 'm':
+      mflag=1;
+      sscanf(optarg,"%d",&maxtargetlength);
+      break;
+    case 'n':
+      nflag=1;
+      sscanf(optarg,"%d",&maxquerylength);
+      break;
+    case 'q':
+      qflag = 1;
+      query_fn = optarg;
+      break;
+    case 's':
+      sflag = 1;
+      break;
+    case 't':
+      tflag = 1;
+      target_fn = optarg;
+      break;
+    case 'u':
+      uflag = 1;
+      sscanf(optarg,"%d",&iloop_upper_limit);
+      break;
+    case 'v':
+      vflag = 1;
+      sscanf(optarg,"%d",&bloop_upper_limit);
+      break;
+    case '?':
+      errflag = 1;
+      break;
+    }
+
+  if ((errflag || sflag && dflag || argc < 3) && !hflag) {
+    printf("\nOption error. Type %s -h for usage.\n\n", argv[0]);
+    exit(1);
+  }
+  else if (hflag) {
+    printf("\nUsage: %s [options] [query sequence].\n\noptions:\n\n  -d <dinucleotide frequencies file>\n  -f helix constraint\n  -h help\n  -k <sample size>\n  -l <mean sequence length>,<std sequence length>\n  -m <max targetlength>\n  -n <max query length>\n  -u <max internal loop size (per side)>\n  -v <max bulge loop size>\n  -s randomise queries (only with -q, without -d)\n  -t <target file>\n  -q <query file>\n\nIf no query file is given, random sequences are generated according\nto the given dinucleotide distribution. Then <sample size> sequences\nare generated whose lengths are normally distributed with given mean\nand standard deviation. Default sample size is 5000, default mean\nand std are 22 and 0, respectively.\n\nIf a query file is given, and additionally the -s option, random sequences\nare generated according to the dinucleotide distribution of the query file.\n\nIf only a query file is given, it is used directly as a random database.\n\nThe query can also be given directly (makes only sense with the -s option).\n\nA target file has to be given (FASTA format).\n\n\nThe helix constraint format is \"from,to\", eg. -f 2,7 forces\nstructures to have a helix from position 2 to 7 with respect to the query.\n\n", argv[0]);
+    exit(0);
+  }
+
+  if (!uflag)
+    iloop_upper_limit = ILOOPUPPERLIMITDEFAULT;
+  if (!vflag)
+    bloop_upper_limit = BLOOPUPPERLIMITDEFAULT;
+
+  if (!lflag) {
+    mean = MIRNA_LENGTH_MEAN;
+    stddev = MIRNA_LENGTH_STDDEV;
+  }
+
+  if (!kflag)
+    sample_size = SAMPLESIZE;
+
+  normalised_energies = (float **) calloc(MAXORTHOLOGNUMBER,sizeof(float *));
+  xi = (float *) calloc(MAXORTHOLOGNUMBER,sizeof(float));
+  theta = (float *) calloc(MAXORTHOLOGNUMBER,sizeof(float));
+  
+  if (qflag && !sflag) {
+    for (i=0; i<MAXORTHOLOGNUMBER; i++)
+      normalised_energies[i] = (float *) calloc(MAXQUERYNUMBER,sizeof(float));
+    temp_energies = (float *) calloc(MAXQUERYNUMBER,sizeof(float));
+    maximal_pvalues = (float *) calloc(MAXQUERYNUMBER,sizeof(float));
+    joint_pvalues = (float *) calloc(MAXQUERYNUMBER,sizeof(float));
+  }
+  else {
+    for (i=0; i<MAXORTHOLOGNUMBER; i++)
+      normalised_energies[i] = (float *) calloc(sample_size,sizeof(float));
+    temp_energies = (float *) calloc(sample_size,sizeof(float));
+    maximal_pvalues = (float *) calloc(sample_size,sizeof(float));
+    joint_pvalues = (float *) calloc(sample_size,sizeof(float));
+  }
+
+  if (!mflag)
+    maxtargetlength = MAXTARGET;
+  if (!nflag)
+    maxquerylength = MAXQUERY;
+
+  if (qflag) {
+    query_sq = (char *) calloc(maxquerylength+MAXLINE+1, sizeof(char));
+    querylength = maxquerylength;
+  }
+  else {
+    query_sq  = (char *) calloc(strlen(argv[argc-1])+1,sizeof(char));
+    strcpy(query_ac,"command_line");
+    strcpy(query_sq,argv[argc-1]);
+    remove_whitespace(query_sq);
+    querylength = strlen(argv[argc-1]);
+  }
+
+  if (tflag) {
+    target_sq = (char *) calloc(maxtargetlength+MAXLINE+1,sizeof(char));
+    targetlength = maxtargetlength;
+  }
+
+
+  if (!tflag && argv[argc-1-(!qflag)][0] != '-') {
+    /* target sequence given on command line */
+    target_sq = (char *) calloc(strlen(argv[argc-1-(!qflag)])+1,sizeof(char));
+    strcpy(target_ac,"command_line");
+    strcpy(target_sq,argv[argc-1-(!qflag)]);
+    remove_whitespace(target_sq);
+    targetlength = strlen(target_sq);
+  }
+
+
+  if (sflag) {
+    /* initialise dinucleotide frequencies: */
+    for (i=0; i<4; i++)
+      for (j=0; j<4; j++)
+	freq_di[i][j] = 0.0;
+
+    if (qflag) {
+      /* open query file: */
+      FILE *query = fopen(query_fn,"r");
+      if (query==NULL) {
+	printf("Error: Could not open query file. Aborting.\n");
+	exit(2);
+      }
+
+      /* iterate over query sequences: */
+      counter = 0;
+      while (!end(query)) {
+
+	nextAC(query,query_ac);
+	nextSQ(query,query_sq,maxquerylength);
+
+	remove_whitespace(query_sq);
+
+	seqlen = strlen(query_sq);
+	/* count dinucleotides: */
+	for (k=0; k<seqlen-1; k++) {
+	  letter_one = toupper(query_sq[k]);
+	  letter_two = toupper(query_sq[k+1]);
+
+	  if (letter_one == 'U')
+	    letter_one = 'T';
+	  if (letter_two == 'U')
+	    letter_two = 'T';
+
+	  index_one = (int) strchr(alphabet,letter_one);
+	  index_two = (int) strchr(alphabet,letter_two);
+
+	  if (index_one != 0 && index_two != 0) {
+	    freq_di[index_one-(int) alphabet][index_two-(int) alphabet]++;
+	    counter++;
+	  }
+	}
+      }
+      /* close query file: */
+      fclose(query);
+    } /* if qflag */
+    else { /* !qflag */
+
+      counter = 0;
+      seqlen = strlen(query_sq);
+      /* count dinucleotides: */
+      for (k=0; k<seqlen-1; k++) {
+	letter_one = toupper(query_sq[k]);
+	letter_two = toupper(query_sq[k+1]);
+
+	if (letter_one == 'U')
+	  letter_one = 'T';
+	if (letter_two == 'U')
+	  letter_two = 'T';
+
+	index_one = (int) strchr(alphabet,letter_one);
+	index_two = (int) strchr(alphabet,letter_two);
+
+	if (index_one != 0 && index_two != 0) {
+	  freq_di[index_one-(int) alphabet][index_two-(int) alphabet]++;
+	  counter++;
+	}
+      }
+
+    }
+
+    /* turn counts into relative frequencies: */
+    for (i=0; i<4; i++)
+      for (j=0; j<4; j++)
+	freq_di[i][j] /= (float) counter;
+    
+  } /* if sflag */
+
+
+  init_constants();                                            
+  init_energies();
+
+  tableAlloc(targetlength,querylength);
+
+  /* allocate string space */
+  r1 = t1 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+  r2 = t2 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+  r3 = t3 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+  r4 = t4 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+
+  x = (char *) calloc(targetlength+2, sizeof(char));     
+  y = (char *) calloc( querylength+2, sizeof(char));     
+ 
+
+  if (qflag && sflag || !qflag && argv[argc-1][0] != '-' && sflag)
+    free(query_sq);
+
+
+  if (dflag) {
+    /*   read dinucleotide frequencies: */
+    f = fopen(freq_filename,"r");
+    read_dinucleotide_frequencies(freq_di,f);
+    fclose(f);
+  }
+
+
+  /*   calculate single nucleotide frequencies: */
+  for (i=0; i<strlen(alphabet); i++) {
+    freq[i]=2*freq_di[i][i];
+    for (j=0; j<strlen(alphabet); j++)
+      if (i!=j)
+	freq[i] += freq_di[i][j];
+    for (j=0; j<strlen(alphabet); j++)
+      if (i!=j)
+	freq[i] += freq_di[j][i];
+    freq[i] /= 2.0;
+  }
+
+  /*   make distribution functions: */
+  fdf[0] = freq[0];
+  for (i=1; i<strlen(alphabet); i++)
+    fdf[i]=fdf[i-1]+freq[i];
+  fdf[strlen(alphabet)-1]=1.0;
+    
+  for (i=0; i<strlen(alphabet); i++) {
+    float row_sum = 0;
+    for (j=0; j<strlen(alphabet); j++)
+      row_sum+=freq_di[i][j];
+    fdf_di[i][0]=freq_di[i][0]/row_sum;
+    for (j=1; j<strlen(alphabet); j++)
+      fdf_di[i][j]=fdf_di[i][j-1]+freq_di[i][j]/row_sum;
+    fdf_di[i][strlen(alphabet)-1]=1.0;
+  }
+
+
+  sgenrand(time(NULL));
+
+  /*  Search: */
+
+  if (qflag && !sflag) {
+
+    /* open query file: */
+    FILE *query = fopen(query_fn,"r");
+    if (query==NULL) {
+      printf("Error: Could not open query file. Aborting.\n");
+      exit(2);
+    }
+
+    /* iterate over query sequences: */
+    counter = 0;
+    while (!end(query)) {
+
+      nextAC(query,query_ac);
+      nextSQ(query,query_sq,maxquerylength);
+
+      remove_whitespace(query_sq);
+
+      seqlen = strlen(query_sq);
+
+      n = strlen(query_sq);
+    
+      if (fflag) {
+	helix_start = n - fflag_end;
+	helix_end   = n - fflag_start + 1;
+      }
+      else {
+	helix_start = 0;
+	helix_end   = 0;
+      }
+
+      y[0]=' ';
+      for (i=0;i<=n-1;i++) y[i+1] = query_sq[n-i-1];
+      y[n+1]=0;
+      convert_y();
+
+      if (tflag) {
+
+	FILE *target = fopen(target_fn,"r");
+	if (target==NULL) {
+	  printf("Error: Could not open target file. Aborting.\n");
+	  exit(2);
+	}
+
+	k = 0;
+	while (!end(target) && k<MAXTARGETNUMBER) {
+
+	  nextAC(target,target_ac);
+	  nextSQ(target,target_sq,maxtargetlength);
+
+	  remove_whitespace(target_sq);
+
+	  m = strlen(target_sq);
+
+	  if (m > maxtargetlength) {
+	    printf("target too long: %s\n", target_ac);
+	  }
+	  else {
+	    strcpy(x, " ");                             
+	    strcat(x, target_sq);
+	    convert_x();
+
+	    for (i1=m; i1>=0; i1--) {
+	      for (i2=n; i2>=0; i2--) {
+		calc_unpaired_left_bot(i1, m, i2, n);
+		calc_closed           (i1, m, i2, n);
+		calc_unpaired_left_top(i1, m, i2, n);
+	      }
+	    }
+	    v2 = calc_hybrid(0, m, 0, n);
+	      
+ 	    normalised_energy = -v2/log(m*n);
+ 	    normalised_energies[k][l] = normalised_energy;
+
+	    /* initialize strings */
+	    r1 = t1;
+	    r2 = t2;
+	    r3 = t3;
+	    r4 = t4;
+
+	    k++;
+	  }
+	}
+	fclose(target);
+      }
+      else { /* !tflag */
+	printf("Shouldn't happen.\n");
+	exit(1);
+      }
+
+      free(query_sq);
+
+      l++;
+    }
+    for (i=0; i<k; i++) {
+      for (j=0; j<l; j++)
+	temp_energies[j] = normalised_energies[i][j];
+      estimate_evd_parameters(&used_sample_size,&xi[i],&theta[i],temp_energies,l);
+/*       printf("%f %f\n",xi[i],theta[i]); */
+    }
+    
+    /* calculate p-values: */
+    for (j=0; j<l; j++) {
+      for (i=0; i<k; i++) {
+	pvalue = 1-exp(-exp(-(normalised_energies[i][j]-xi[i])/theta[i]));
+	if (i==0 || pvalue > maximal_pvalues[j])
+	  maximal_pvalues[j] = pvalue;
+      }
+    }
+
+/*     for (i=0; i<sample_size; i++) */
+/*       printf("%f\n",maximal_pvalues[i]); */
+
+
+    /* find effective number of orthologs: */
+    effective_number = -1.0;
+    for (exponent=1.0; exponent<(float) k+0.01; exponent=exponent+0.1) {
+
+      /* joint pvalues: */
+      for (j=0; j<l; j++)
+	joint_pvalues[j] = pow(maximal_pvalues[j],exponent);
+
+      /* empirical cdf: */
+      empirical_cumulative_distribution_function(&xcdf,&ycdf,&bin_number,joint_pvalues,l);
+
+      /* weighted squared error: */
+      error_sum = 0.0;
+      for (j=0; j<bin_number; j++)
+	error_sum += 1.0/xcdf[j]*pow(ycdf[j+1]-xcdf[j],2.0);
+
+      printf("%f %f\n",exponent,error_sum);
+
+      /* check for new minimum: */
+      if (effective_number == -1.0 || error_sum < smallest_error_sum) {
+	smallest_error_sum = error_sum;
+	effective_number = exponent;
+      }
+    }
+
+    printf("Effective number: %f\n",effective_number);
+
+  }
+  else if (qflag && sflag || !qflag && sflag) {
+
+    l = 0;
+    while (l<sample_size) {
+      do seqlen = (int) (normal_random_number()*stddev+mean); while (seqlen < 1 || seqlen > maxquerylength);
+      query_sq = random_sequence(seqlen,fdf,fdf_di);
+
+      n = strlen(query_sq);
+    
+      if (fflag) {
+	helix_start = n - fflag_end;
+	helix_end   = n - fflag_start + 1;
+      }
+      else {
+	helix_start = 0;
+	helix_end   = 0;
+      }
+
+      y[0]=' ';
+      for (i=0;i<=n-1;i++) y[i+1] = query_sq[n-i-1];
+      y[n+1]=0;
+      convert_y();
+
+      if (tflag) {
+
+	FILE *target = fopen(target_fn,"r");
+	if (target==NULL) {
+	  printf("Error: Could not open target file. Aborting.\n");
+	  exit(2);
+	}
+
+	k = 0;
+	while (!end(target) && k<MAXTARGETNUMBER) {
+
+	  nextAC(target,target_ac);
+	  nextSQ(target,target_sq,maxtargetlength);
+
+	  remove_whitespace(target_sq);
+
+	  m = strlen(target_sq);
+
+	  if (m > maxtargetlength) {
+	    printf("target too long: %s\n", target_ac);
+	  }
+	  else {
+	    strcpy(x, " ");                             
+	    strcat(x, target_sq);
+	    convert_x();
+
+	    for (i1=m; i1>=0; i1--) {
+	      for (i2=n; i2>=0; i2--) {
+		calc_unpaired_left_bot(i1, m, i2, n);
+		calc_closed           (i1, m, i2, n);
+		calc_unpaired_left_top(i1, m, i2, n);
+	      }
+	    }
+	    v2 = calc_hybrid(0, m, 0, n);
+	      
+ 	    normalised_energy = -v2/log(m*n);
+ 	    normalised_energies[k][l] = normalised_energy;
+
+	    /* initialize strings */
+	    r1 = t1;
+	    r2 = t2;
+	    r3 = t3;
+	    r4 = t4;
+
+	    k++;
+	  }
+	}
+	fclose(target);
+      }
+      else { /* !tflag */
+	printf("Shouldn't happen.\n");
+	exit(1);
+      }
+
+      free(query_sq);
+
+      l++;
+    }
+    for (i=0; i<k; i++) {
+      for (j=0; j<l; j++)
+	temp_energies[j] = normalised_energies[i][j];
+      estimate_evd_parameters(&used_sample_size,&xi[i],&theta[i],temp_energies,l);
+/*       printf("%f %f\n",xi[i],theta[i]); */
+    }
+    
+    /* calculate p-values: */
+    for (j=0; j<l; j++) {
+      for (i=0; i<k; i++) {
+	pvalue = 1-exp(-exp(-(normalised_energies[i][j]-xi[i])/theta[i]));
+	if (i==0 || pvalue > maximal_pvalues[j])
+	  maximal_pvalues[j] = pvalue;
+      }
+    }
+
+/*     for (i=0; i<sample_size; i++) */
+/*       printf("%f\n",maximal_pvalues[i]); */
+
+
+    /* find effective number of orthologs: */
+    effective_number = -1.0;
+    for (exponent=1.0; exponent<(float) k+0.01; exponent=exponent+0.1) {
+
+      /* joint pvalues: */
+      for (j=0; j<l; j++)
+	joint_pvalues[j] = pow(maximal_pvalues[j],exponent);
+
+      /* empirical cdf: */
+      empirical_cumulative_distribution_function(&xcdf,&ycdf,&bin_number,joint_pvalues,l);
+
+      /* weighted squared error: */
+      error_sum = 0.0;
+      for (j=0; j<bin_number; j++)
+	error_sum += 1.0/xcdf[j]*pow(ycdf[j+1]-xcdf[j],2.0);
+
+      printf("%f %f\n",exponent,error_sum);
+
+      /* check for new minimum: */
+      if (effective_number == -1.0 || error_sum < smallest_error_sum) {
+	smallest_error_sum = error_sum;
+	effective_number = exponent;
+      }
+    }
+
+    printf("Effective number: %f\n",effective_number);
+
+
+  }
+  else { /* !qflag && !sflag */
+    printf("Refusing to base analysis on one query sequence. Aborting.\n");
+    exit(2);
+  }
+
+
+
+
+
+}
Added: trunk/packages/rnahybrid/branches/upstream/current/src/rnahybrid.c
===================================================================
--- trunk/packages/rnahybrid/branches/upstream/current/src/rnahybrid.c	                        (rev 0)
+++ trunk/packages/rnahybrid/branches/upstream/current/src/rnahybrid.c	2007-06-01 01:40:59 UTC (rev 298)
@@ -0,0 +1,492 @@
+/* Copyright (C) 2004 Marc Rehmsmeier, Peter Steffen, Matthias Hoechsmann */
+
+/* This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. */
+
+/* This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. */
+
+/* You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA */
+
+#include <stdio.h>  
+#include <string.h> 
+#include "config.h"
+#include "plot.h"
+#include "minmax.h"
+#include "fasta.h"
+#include "input.h"
+#include "energy.h"
+#include "globals.h"
+#include "hybrid_core.h"
+
+
+static char const rcsid[] = "$Id: rnahybrid.c,v 1.1.1.9.1.13 2004/11/15 20:41:38 marc Exp $";
+
+
+float maximal_duplex_energy(char *seq);
+
+
+int main(int argc, char **argv)                
+{       
+  int i;
+ 
+  extern char *optarg;
+  extern int optind;
+  int c;
+  int
+    bflag = 0, // number of hits per target to show
+    cflag = 0, // compact output
+    dflag = 0, // parameters of extreme value distribution
+               // for p-value calculation
+    eflag = 0, // report all hits with energy better (ie. lower) than or equal to e
+    fflag = 0, // force helix, arguments: from,to (positions in miRNA)
+    gflag = 0, // make plots (graphics) of hybridisations
+    hflag = 0, // help
+    mflag = 0, // max target length
+    nflag = 0, // max query length
+    pflag = 0, // report all hits with p-values better than or equal to p
+    sflag = 0, // data set flag, for organism and sequence specific settings
+    qflag = 0, // query  input file
+    tflag = 0, // target input file
+    uflag = 0, // upper size for internal loops (per side)
+    vflag = 0, // upper size for bulge loops
+    errflag = 0;
+  int
+    maxtargetlength,
+    maxquerylength;
+  char
+    *target_fn, // target filename
+    *query_fn;  // query  filename
+  float
+    energy_cutoff = 0.0,
+    pvalue_cutoff = 1.0,
+    xi, theta,
+    mde;
+
+  int
+    hit_number = 1;
+
+  char target_ac[MAXLINE];
+  char query_ac[MAXLINE];
+
+  char *target_sq;
+  char *query_sq;
+
+  char *gflag_argument;
+  char *plotfileextension;
+
+  char *setname;
+
+  int
+    targetlength,
+    querylength,
+    plot_format;
+
+  int
+    fflag_start,
+    fflag_end;
+
+  float xi_slope, xi_intercept, theta_slope, theta_intercept;
+
+
+  while ((c = getopt(argc,argv,"b:cd:e:f:g:hm:n:p:q:s:t:u:v:")) != EOF)
+    switch(c) {
+    case 'b':
+      bflag=1;
+      sscanf(optarg,"%d",&hit_number);
+      break;
+    case 'c':
+      cflag=1;
+      break;
+    case 'd':
+      dflag=1;
+      sscanf(optarg,"%f,%f",&xi,&theta);
+      break;
+    case 'e':
+      eflag=1;
+      sscanf(optarg,"%f",&energy_cutoff);
+      break;
+    case 'f':
+      fflag=1;
+      sscanf(optarg,"%d,%d",&fflag_start,&fflag_end);
+      break;
+    case 'g':
+      gflag=1;
+      gflag_argument = optarg;
+      break;
+    case 'h':
+      hflag=1;
+      break;
+    case 'm':
+      mflag=1;
+      sscanf(optarg,"%d",&maxtargetlength);
+      break;
+    case 'n':
+      nflag=1;
+      sscanf(optarg,"%d",&maxquerylength);
+      break;
+    case 'p':
+      pflag=1;
+      sscanf(optarg,"%f",&pvalue_cutoff);
+      break;
+    case 'q':
+      qflag = 1;
+      query_fn = optarg;
+      break;
+    case 's':
+      sflag=1;
+      setname = optarg;
+      break;
+    case 't':
+      tflag = 1;
+      target_fn = optarg;
+      break;
+    case 'u':
+      uflag = 1;
+      sscanf(optarg,"%d",&iloop_upper_limit);
+      break;
+    case 'v':
+      vflag = 1;
+      sscanf(optarg,"%d",&bloop_upper_limit);
+      break;
+    case '?':
+      errflag = 1;
+      break;
+    }
+
+  if (eflag && (energy_cutoff > 0)) {
+    printf("Warning: energy cut-off positive. I'm converting it to minus the value you gave.\n");
+    energy_cutoff = -energy_cutoff;
+  }
+
+  if (!uflag)
+    iloop_upper_limit = ILOOPUPPERLIMITDEFAULT;
+  if (!vflag)
+    bloop_upper_limit = BLOOPUPPERLIMITDEFAULT;
+
+
+#ifdef HAVE_LIBG2
+  if (gflag) {
+    if (strcmp(gflag_argument,"ps")==0)
+      plot_format = PSPLOT;
+#ifdef HAVE_LIBGD
+    else if (strcmp(gflag_argument,"png")==0)
+      plot_format = PNGPLOT;
+    else if (strcmp(gflag_argument,"jpg")==0)
+      plot_format = JPGPLOT;
+    else if (strcmp(gflag_argument,"all")==0)
+      plot_format = ALLPLOT;
+#endif
+    else {
+      printf("\nWrong plot format.\n");
+      errflag = 1;
+    }
+  }
+#endif
+
+  if (errflag || argc < 3 && !hflag) {
+    printf("\nOption error. Type %s -h for usage.\n\n", argv[0]);
+    exit(1);
+  }
+  else if (hflag) {
+    printf("\nUsage: %s [options] [target sequence] [query sequence].\n\noptions:\n\n  -b <number of hits per target>\n  -c compact output\n  -d <xi>,<theta>\n  -f helix constraint\n  -h help\n  -m <max targetlength>\n  -n <max query length>\n  -u <max internal loop size (per side)>\n  -v <max bulge loop size>\n  -e <energy cut-off>\n  -p <p-value cut-off>\n  -s (3utr_fly|3utr_worm|3utr_human)\n  -g (ps|png|jpg|all)\n  -t <target file>\n  -q <query file>\n\nEither a target file has to be given (FASTA format)\nor one target sequence directly.\n\nEither a query file has to be given (FASTA format)\nor one query sequence directly.\n\nThe helix constraint format is \"from,to\", eg. -f 2,7 forces\nstructures to have a helix from position 2 to 7 with respect to the query.\n\n<xi> and <theta> are the position and shape parameters, respectively,\nof the extreme value distribution assumed for p-value calculation.\nIf omitted, they are estimated from the maximal duplex energy of the query.\nIn that case, a data set name has to be given with the -s flag.\n\n", argv[0]);
+
+#ifndef HAVE_LIBG2
+    printf("\nPS graphical output not supported.\n\n");
+#endif
+
+#ifndef HAVE_LIBGD
+    printf("\nPNG and JPG graphical output not supported.\n\n");
+#endif
+    exit(0);
+  }
+
+  if (!dflag && !sflag) {
+    printf("Error: without -d you have to give -s option. Aborting.\n");
+    exit(2);
+  }
+
+  if (sflag) {
+    if (strcmp(setname,SETNAME_3UTR_FLY) == 0) {
+      xi_slope = XI_SLOPE_3UTR_FLY;
+      xi_intercept = XI_INTERCEPT_3UTR_FLY;
+      theta_slope = THETA_SLOPE_3UTR_FLY;
+      theta_intercept = THETA_INTERCEPT_3UTR_FLY;
+    }
+    else if (strcmp(setname,SETNAME_3UTR_WORM) == 0) {
+      xi_slope = XI_SLOPE_3UTR_WORM;
+      xi_intercept = XI_INTERCEPT_3UTR_WORM;
+      theta_slope = THETA_SLOPE_3UTR_WORM;
+      theta_intercept = THETA_INTERCEPT_3UTR_WORM;
+    }
+    else if (strcmp(setname,SETNAME_3UTR_HUMAN) == 0) {
+      xi_slope = XI_SLOPE_3UTR_HUMAN;
+      xi_intercept = XI_INTERCEPT_3UTR_HUMAN;
+      theta_slope = THETA_SLOPE_3UTR_HUMAN;
+      theta_intercept = THETA_INTERCEPT_3UTR_HUMAN;
+    }
+    else {
+      printf("Error: unknown set name. Aborting.\n");
+      exit(2);
+    }
+  }
+
+  if (!mflag)
+    maxtargetlength = MAXTARGET;
+  if (!nflag)
+    maxquerylength = MAXQUERY;
+
+  if (tflag && qflag) {
+    target_sq = (char *) calloc(maxtargetlength+MAXLINE+1,sizeof(char));
+    query_sq = (char *) calloc(maxquerylength+MAXLINE+1, sizeof(char));
+    targetlength = maxtargetlength;
+    querylength = maxquerylength;
+  }
+
+  if (tflag && !qflag) {
+    target_sq = (char *) calloc(maxtargetlength+MAXLINE+1,sizeof(char));
+    query_sq  = (char *) calloc(strlen(argv[argc-1])+1,sizeof(char));
+    strcpy(query_ac,"command_line");
+    strcpy(query_sq,argv[argc-1]);
+    remove_whitespace(query_sq);
+    targetlength = maxtargetlength;
+    querylength = strlen(argv[argc-1]);
+  }
+
+  if (!tflag && qflag) {
+    target_sq = (char *) calloc(strlen(argv[argc-1])+1,sizeof(char));
+    query_sq = (char *) calloc(maxquerylength+MAXLINE+1, sizeof(char));
+    strcpy(target_ac,"command_line");
+    strcpy(target_sq,argv[argc-1]);
+    remove_whitespace(target_sq);
+    targetlength = strlen(argv[argc-1]);
+    querylength = maxquerylength;
+  }
+
+  if (!tflag && !qflag) {
+    target_sq = (char *) calloc(strlen(argv[argc-2])+1,sizeof(char));
+    query_sq  = (char *) calloc(strlen(argv[argc-1])+1,sizeof(char));
+    strcpy(target_ac,"command_line");
+    strcpy(query_ac,"command_line");
+    strcpy(target_sq,argv[argc-2]);
+    remove_whitespace(target_sq);
+    strcpy(query_sq,argv[argc-1]);
+    remove_whitespace(query_sq);
+    targetlength = strlen(argv[argc-2]);
+    querylength = strlen(argv[argc-1]);
+  }
+                                             
+  init_constants();                                            
+  init_energies();
+
+  tableAlloc(targetlength,querylength);
+
+  /* allocate string space */
+  r1 = t1 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+  r2 = t2 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+  r3 = t3 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+  r4 = t4 = (char *) calloc(2*max(targetlength,querylength), sizeof(char));
+
+  x = (char *) calloc(targetlength+2, sizeof(char));     
+  y = (char *) calloc( querylength+2, sizeof(char));     
+ 
+
+  if (qflag) {
+
+    FILE *query  = fopen( query_fn,"r");
+    if (query==NULL) {
+      printf("Error: Could not open query file. Aborting.\n");
+      exit(2);
+    }
+
+    while (!end(query)) {
+
+      nextAC(query,query_ac);
+      nextSQ(query,query_sq,maxquerylength);
+
+      remove_whitespace(query_sq);
+    
+      n = strlen(query_sq);
+
+      if (!dflag) {
+	// estimate evd parameters from maximal duplex energy
+	mde = maximal_duplex_energy(query_sq);
+        xi    =    xi_slope * mde +    xi_intercept;
+        theta = theta_slope * mde + theta_intercept;
+      }
+
+      if (fflag) {
+	helix_start = n - fflag_end;
+	helix_end   = n - fflag_start + 1;
+      }
+      else {
+	helix_start = 0;
+	helix_end   = 0;
+      }
+
+      if (n > maxquerylength) {
+	printf("query too long: %s\n", query_ac);
+      }
+      else {
+
+	y[0]=' ';
+	for (i=0;i<=n-1;i++) y[i+1] = query_sq[n-i-1];
+	y[n+1]=0;
+	convert_y();
+
+	if (tflag) {
+	  FILE *target = fopen(target_fn,"r");
+	  if (target==NULL) {
+	    printf("Error: Could not open target file. Aborting.\n");
+	    exit(2);
+	  }
+
+	  while (!end(target)) {
+
+	    nextAC(target,target_ac);
+	    nextSQ(target,target_sq,maxtargetlength);
+
+	    remove_whitespace(target_sq);
+
+	    m = strlen(target_sq);
+
+	    if (m > maxtargetlength) {
+	      printf("target too long: %s\n", target_ac);
+	    }
+	    else {
+	      strcpy(x, " ");                             
+	      strcat(x, target_sq);
+	      convert_x();
+
+	      mainloop(bflag, hit_number,eflag,energy_cutoff,pflag,pvalue_cutoff,cflag,target_ac,target_sq,query_ac,query_sq,gflag,plot_format,xi,theta);
+	    }
+	    
+	  }
+
+	  fclose(target);
+	}
+	else {
+	  m = strlen(target_sq);
+
+	  strcpy(x, " ");                             
+	  strcat(x, target_sq);
+	  convert_x();
+
+	  mainloop(bflag, hit_number,eflag,energy_cutoff,pflag,pvalue_cutoff,cflag,target_ac,target_sq,query_ac,query_sq,gflag,plot_format,xi,theta);
+	}
+      }
+    }
+
+    fclose(query);
+  }
+  else { /* !qflag */
+    n = strlen(query_sq);
+
+    if (!dflag) {
+      // estimate evd parameters from maximal duplex energy
+      mde = maximal_duplex_energy(query_sq);
+      xi    =    xi_slope * mde +    xi_intercept;
+      theta = theta_slope * mde + theta_intercept;
+    }
+
+    if (fflag) {
+      helix_start = n - fflag_end;
+      helix_end   = n - fflag_start + 1;
+    }
+    else {
+      helix_start = 0;
+      helix_end   = 0;
+    }
+
+
+    y[0]=' ';
+    for (i=0;i<=n-1;i++) y[i+1] = query_sq[n-i-1];
+    y[n+1]=0;
+    convert_y();
+
+    if (tflag) { /* !qflag && tflag */
+      FILE *target = fopen(target_fn,"r");
+
+      while (!end(target)) {
+
+	nextAC(target,target_ac);
+	nextSQ(target,target_sq,maxtargetlength);
+
+	remove_whitespace(target_sq);
+
+	m = strlen(target_sq);
+
+	if (m > maxtargetlength) {
+	  printf("target too long: %s\n", target_ac);
+	}
+	else {
+	  strcpy(x, " ");                             
+	  strcat(x, target_sq);
+	  convert_x();
+
+	  mainloop(bflag,hit_number,eflag,energy_cutoff,pflag,pvalue_cutoff,cflag,target_ac,target_sq,query_ac,query_sq,gflag,plot_format,xi,theta);
+	}
+
+      }
+
+      fclose(target);
+    }
+    else { /* !qflag && !tflag */
+      m = strlen(target_sq);
+
+      strcpy(x, " ");                             
+      strcat(x, target_sq);
+      convert_x();
+
+      mainloop(bflag, hit_number,eflag,energy_cutoff,pflag,pvalue_cutoff,cflag,target_ac,target_sq,query_ac,query_sq,gflag,plot_format,xi,theta);
+    }
+  }
+
+
+   exit(0);                                    
+}
+
+
+
+float maximal_duplex_energy(char *seq_arg)
+{
+  int seq_len = strlen(seq_arg);
+  char *seq = (char *) calloc(seq_len+1, sizeof(char));
+  char *rc  = (char *) calloc(seq_len+1, sizeof(char));
+  int i;
+  char letter, compl_letter;
+  float mde;
+  char c;
+
+  // convert sequence:
+  for (i=0; i<seq_len; i++) {
+    c=seq_arg[i];
+    if      (c=='a' || c=='A') seq[i]=A;
+    else if (c=='c' || c=='C') seq[i]=C;
+    else if (c=='g' || c=='G') seq[i]=G;
+    else if (c=='u' || c=='U') seq[i]=U;
+    else if (c=='t' || c=='T') seq[i]=U;
+    else                       seq[i]=N;
+  }
+
+  // make reverse complement:
+  for (i=0; i<seq_len; i++) {
+    c = seq[seq_len-i-1];
+    if      (c==A) rc[i]=U;
+    else if (c==C) rc[i]=G;
+    else if (c==G) rc[i]=C;
+    else if (c==U) rc[i]=A;
+    else           rc[i]=N;
+  }
+  rc[seq_len] = '\0';
+
+
+  // sum up stacked pair energies:
+  mde = 0;
+  for (i=0; i<seq_len-1; i++)
+    mde += stack_dg_ar[rc[seq_len-i-1]][rc[seq_len-(i+1)-1]][seq[i+1]][seq[i]];
+
+  free(seq);
+  free(rc);
+
+  return mde;
+}
+
    
    
More information about the debian-med-commit
mailing list