[med-svn] r1088 - in trunk/packages/emboss/trunk: . debian debian/manpages debian/patches test/gb test/wormpep

charles-guest at alioth.debian.org charles-guest at alioth.debian.org
Thu Jan 10 05:26:47 UTC 2008 

Author: charles-guest
Date: 2008-01-10 05:26:47 +0000 (Thu, 10 Jan 2008)
New Revision: 1088

Added:
   trunk/packages/emboss/trunk/debian/
   trunk/packages/emboss/trunk/debian/EMBOSS_qg.doc.uu
   trunk/packages/emboss/trunk/debian/EMBOSS_qg_new.pdf.uu
   trunk/packages/emboss/trunk/debian/README.debian
   trunk/packages/emboss/trunk/debian/TODO
   trunk/packages/emboss/trunk/debian/acd2docbook.pl
   trunk/packages/emboss/trunk/debian/changelog
   trunk/packages/emboss/trunk/debian/compat
   trunk/packages/emboss/trunk/debian/control
   trunk/packages/emboss/trunk/debian/copyright.introduction
   trunk/packages/emboss/trunk/debian/emboss-data.dirs
   trunk/packages/emboss/trunk/debian/emboss-data.install
   trunk/packages/emboss/trunk/debian/emboss-doc.dirs
   trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.domainatrix
   trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-admin
   trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-apps
   trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-groups
   trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-qg
   trunk/packages/emboss/trunk/debian/emboss-doc.links
   trunk/packages/emboss/trunk/debian/emboss-java.dirs
   trunk/packages/emboss/trunk/debian/emboss-lib.dirs
   trunk/packages/emboss/trunk/debian/emboss-lib.postinst
   trunk/packages/emboss/trunk/debian/emboss.dirs
   trunk/packages/emboss/trunk/debian/emboss.docs
   trunk/packages/emboss/trunk/debian/emboss.install
   trunk/packages/emboss/trunk/debian/emboss.manpages
   trunk/packages/emboss/trunk/debian/emboss.menu
   trunk/packages/emboss/trunk/debian/libajax5-dev.dirs
   trunk/packages/emboss/trunk/debian/libnucleus5-dev.dirs
   trunk/packages/emboss/trunk/debian/manpages/
   trunk/packages/emboss/trunk/debian/manpages/aaindexextract.1e
   trunk/packages/emboss/trunk/debian/manpages/abiview.1e
   trunk/packages/emboss/trunk/debian/manpages/acdc.1e
   trunk/packages/emboss/trunk/debian/manpages/acdlog.1e
   trunk/packages/emboss/trunk/debian/manpages/acdpretty.1e
   trunk/packages/emboss/trunk/debian/manpages/acdtable.1e
   trunk/packages/emboss/trunk/debian/manpages/acdtrace.1e
   trunk/packages/emboss/trunk/debian/manpages/acdvalid.1e
   trunk/packages/emboss/trunk/debian/manpages/ajbad.1e
   trunk/packages/emboss/trunk/debian/manpages/ajfeatest.1e
   trunk/packages/emboss/trunk/debian/manpages/ajtest.1e
   trunk/packages/emboss/trunk/debian/manpages/antigenic.1e
   trunk/packages/emboss/trunk/debian/manpages/backtranambig.1e
   trunk/packages/emboss/trunk/debian/manpages/backtranseq.1e
   trunk/packages/emboss/trunk/debian/manpages/banana.1e
   trunk/packages/emboss/trunk/debian/manpages/biosed.1e
   trunk/packages/emboss/trunk/debian/manpages/btwisted.1e
   trunk/packages/emboss/trunk/debian/manpages/cai.1e
   trunk/packages/emboss/trunk/debian/manpages/chaos.1e
   trunk/packages/emboss/trunk/debian/manpages/charge.1e
   trunk/packages/emboss/trunk/debian/manpages/checktrans.1e
   trunk/packages/emboss/trunk/debian/manpages/chips.1e
   trunk/packages/emboss/trunk/debian/manpages/cirdna.1e
   trunk/packages/emboss/trunk/debian/manpages/codcmp.1e
   trunk/packages/emboss/trunk/debian/manpages/codcopy.1e
   trunk/packages/emboss/trunk/debian/manpages/coderet.1e
   trunk/packages/emboss/trunk/debian/manpages/complex.1e
   trunk/packages/emboss/trunk/debian/manpages/compseq.1e
   trunk/packages/emboss/trunk/debian/manpages/cons.1e
   trunk/packages/emboss/trunk/debian/manpages/corbatest.1e
   trunk/packages/emboss/trunk/debian/manpages/cpgplot.1e
   trunk/packages/emboss/trunk/debian/manpages/cpgreport.1e
   trunk/packages/emboss/trunk/debian/manpages/cusp.1e
   trunk/packages/emboss/trunk/debian/manpages/cutgextract.1e
   trunk/packages/emboss/trunk/debian/manpages/cutseq.1e
   trunk/packages/emboss/trunk/debian/manpages/dan.1e
   trunk/packages/emboss/trunk/debian/manpages/dbiblast.1e
   trunk/packages/emboss/trunk/debian/manpages/dbifasta.1e
   trunk/packages/emboss/trunk/debian/manpages/dbiflat.1e
   trunk/packages/emboss/trunk/debian/manpages/dbigcg.1e
   trunk/packages/emboss/trunk/debian/manpages/dbxfasta.1e
   trunk/packages/emboss/trunk/debian/manpages/dbxflat.1e
   trunk/packages/emboss/trunk/debian/manpages/dbxgcg.1e
   trunk/packages/emboss/trunk/debian/manpages/dbxstat.1e
   trunk/packages/emboss/trunk/debian/manpages/degapseq.1e
   trunk/packages/emboss/trunk/debian/manpages/demoalign.1e
   trunk/packages/emboss/trunk/debian/manpages/demofeatures.1e
   trunk/packages/emboss/trunk/debian/manpages/demolist.1e
   trunk/packages/emboss/trunk/debian/manpages/demoreport.1e
   trunk/packages/emboss/trunk/debian/manpages/demosequence.1e
   trunk/packages/emboss/trunk/debian/manpages/demostring.1e
   trunk/packages/emboss/trunk/debian/manpages/demostringnew.1e
   trunk/packages/emboss/trunk/debian/manpages/demotable.1e
   trunk/packages/emboss/trunk/debian/manpages/descseq.1e
   trunk/packages/emboss/trunk/debian/manpages/diffseq.1e
   trunk/packages/emboss/trunk/debian/manpages/digest.1e
   trunk/packages/emboss/trunk/debian/manpages/distmat.1e
   trunk/packages/emboss/trunk/debian/manpages/dotmatcher.1e
   trunk/packages/emboss/trunk/debian/manpages/dotpath.1e
   trunk/packages/emboss/trunk/debian/manpages/dottup.1e
   trunk/packages/emboss/trunk/debian/manpages/dreg.1e
   trunk/packages/emboss/trunk/debian/manpages/edialign.1e
   trunk/packages/emboss/trunk/debian/manpages/einverted.1e
   trunk/packages/emboss/trunk/debian/manpages/embossdata.1e
   trunk/packages/emboss/trunk/debian/manpages/embossversion.1e
   trunk/packages/emboss/trunk/debian/manpages/emma.1e
   trunk/packages/emboss/trunk/debian/manpages/emowse.1e
   trunk/packages/emboss/trunk/debian/manpages/entrails.1e
   trunk/packages/emboss/trunk/debian/manpages/entret.1e
   trunk/packages/emboss/trunk/debian/manpages/epestfind.1e
   trunk/packages/emboss/trunk/debian/manpages/eprimer3.1e
   trunk/packages/emboss/trunk/debian/manpages/equicktandem.1e
   trunk/packages/emboss/trunk/debian/manpages/est2genome.1e
   trunk/packages/emboss/trunk/debian/manpages/etandem.1e
   trunk/packages/emboss/trunk/debian/manpages/extractalign.1e
   trunk/packages/emboss/trunk/debian/manpages/extractfeat.1e
   trunk/packages/emboss/trunk/debian/manpages/extractseq.1e
   trunk/packages/emboss/trunk/debian/manpages/findkm.1e
   trunk/packages/emboss/trunk/debian/manpages/freak.1e
   trunk/packages/emboss/trunk/debian/manpages/fuzznuc.1e
   trunk/packages/emboss/trunk/debian/manpages/fuzzpro.1e
   trunk/packages/emboss/trunk/debian/manpages/fuzztran.1e
   trunk/packages/emboss/trunk/debian/manpages/garnier.1e
   trunk/packages/emboss/trunk/debian/manpages/geecee.1e
   trunk/packages/emboss/trunk/debian/manpages/getorf.1e
   trunk/packages/emboss/trunk/debian/manpages/giep.1e
   trunk/packages/emboss/trunk/debian/manpages/helixturnhelix.1e
   trunk/packages/emboss/trunk/debian/manpages/histogramtest.1e
   trunk/packages/emboss/trunk/debian/manpages/hmoment.1e
   trunk/packages/emboss/trunk/debian/manpages/iep.1e
   trunk/packages/emboss/trunk/debian/manpages/infoalign.1e
   trunk/packages/emboss/trunk/debian/manpages/infoseq.1e
   trunk/packages/emboss/trunk/debian/manpages/intconv.1e
   trunk/packages/emboss/trunk/debian/manpages/isochore.1e
   trunk/packages/emboss/trunk/debian/manpages/lindna.1e
   trunk/packages/emboss/trunk/debian/manpages/listor.1e
   trunk/packages/emboss/trunk/debian/manpages/makenucseq.1e
   trunk/packages/emboss/trunk/debian/manpages/makeprotseq.1e
   trunk/packages/emboss/trunk/debian/manpages/marscan.1e
   trunk/packages/emboss/trunk/debian/manpages/maskfeat.1e
   trunk/packages/emboss/trunk/debian/manpages/maskseq.1e
   trunk/packages/emboss/trunk/debian/manpages/matcher.1e
   trunk/packages/emboss/trunk/debian/manpages/megamerger.1e
   trunk/packages/emboss/trunk/debian/manpages/merger.1e
   trunk/packages/emboss/trunk/debian/manpages/msbar.1e
   trunk/packages/emboss/trunk/debian/manpages/mwcontam.1e
   trunk/packages/emboss/trunk/debian/manpages/mwfilter.1e
   trunk/packages/emboss/trunk/debian/manpages/needle.1e
   trunk/packages/emboss/trunk/debian/manpages/newcoils.1e
   trunk/packages/emboss/trunk/debian/manpages/newcpgreport.1e
   trunk/packages/emboss/trunk/debian/manpages/newcpgseek.1e
   trunk/packages/emboss/trunk/debian/manpages/newseq.1e
   trunk/packages/emboss/trunk/debian/manpages/noreturn.1e
   trunk/packages/emboss/trunk/debian/manpages/notseq.1e
   trunk/packages/emboss/trunk/debian/manpages/nthseq.1e
   trunk/packages/emboss/trunk/debian/manpages/octanol.1e
   trunk/packages/emboss/trunk/debian/manpages/oddcomp.1e
   trunk/packages/emboss/trunk/debian/manpages/origsplitter.1e
   trunk/packages/emboss/trunk/debian/manpages/origunion.1e
   trunk/packages/emboss/trunk/debian/manpages/palindrome.1e
   trunk/packages/emboss/trunk/debian/manpages/pasteseq.1e
   trunk/packages/emboss/trunk/debian/manpages/patmatdb.1e
   trunk/packages/emboss/trunk/debian/manpages/patmatmotifs.1e
   trunk/packages/emboss/trunk/debian/manpages/patmattest.1e
   trunk/packages/emboss/trunk/debian/manpages/pepcoil.1e
   trunk/packages/emboss/trunk/debian/manpages/pepinfo.1e
   trunk/packages/emboss/trunk/debian/manpages/pepnet.1e
   trunk/packages/emboss/trunk/debian/manpages/pepstats.1e
   trunk/packages/emboss/trunk/debian/manpages/pepwheel.1e
   trunk/packages/emboss/trunk/debian/manpages/pepwindow.1e
   trunk/packages/emboss/trunk/debian/manpages/pepwindowall.1e
   trunk/packages/emboss/trunk/debian/manpages/plotcon.1e
   trunk/packages/emboss/trunk/debian/manpages/plotorf.1e
   trunk/packages/emboss/trunk/debian/manpages/polydot.1e
   trunk/packages/emboss/trunk/debian/manpages/preg.1e
   trunk/packages/emboss/trunk/debian/manpages/prettyplot.1e
   trunk/packages/emboss/trunk/debian/manpages/prettyseq.1e
   trunk/packages/emboss/trunk/debian/manpages/prima.1e
   trunk/packages/emboss/trunk/debian/manpages/primers.1e
   trunk/packages/emboss/trunk/debian/manpages/primersearch.1e
   trunk/packages/emboss/trunk/debian/manpages/printsextract.1e
   trunk/packages/emboss/trunk/debian/manpages/profit.1e
   trunk/packages/emboss/trunk/debian/manpages/prophecy.1e
   trunk/packages/emboss/trunk/debian/manpages/prophet.1e
   trunk/packages/emboss/trunk/debian/manpages/prosextract.1e
   trunk/packages/emboss/trunk/debian/manpages/pscan.1e
   trunk/packages/emboss/trunk/debian/manpages/psiphi.1e
   trunk/packages/emboss/trunk/debian/manpages/rebaseextract.1e
   trunk/packages/emboss/trunk/debian/manpages/recoder.1e
   trunk/packages/emboss/trunk/debian/manpages/redata.1e
   trunk/packages/emboss/trunk/debian/manpages/remap.1e
   trunk/packages/emboss/trunk/debian/manpages/restover.1e
   trunk/packages/emboss/trunk/debian/manpages/restrict.1e
   trunk/packages/emboss/trunk/debian/manpages/revseq.1e
   trunk/packages/emboss/trunk/debian/manpages/seealso.1e
   trunk/packages/emboss/trunk/debian/manpages/seqinfo.1e
   trunk/packages/emboss/trunk/debian/manpages/seqmatchall.1e
   trunk/packages/emboss/trunk/debian/manpages/seqret.1e
   trunk/packages/emboss/trunk/debian/manpages/seqretall.1e
   trunk/packages/emboss/trunk/debian/manpages/seqretallfeat.1e
   trunk/packages/emboss/trunk/debian/manpages/seqretset.1e
   trunk/packages/emboss/trunk/debian/manpages/seqretsingle.1e
   trunk/packages/emboss/trunk/debian/manpages/seqretsplit.1e
   trunk/packages/emboss/trunk/debian/manpages/seqrettype.1e
   trunk/packages/emboss/trunk/debian/manpages/showalign.1e
   trunk/packages/emboss/trunk/debian/manpages/showdb.1e
   trunk/packages/emboss/trunk/debian/manpages/showfeat.1e
   trunk/packages/emboss/trunk/debian/manpages/showorf.1e
   trunk/packages/emboss/trunk/debian/manpages/showseq.1e
   trunk/packages/emboss/trunk/debian/manpages/shuffleseq.1e
   trunk/packages/emboss/trunk/debian/manpages/sigcleave.1e
   trunk/packages/emboss/trunk/debian/manpages/silent.1e
   trunk/packages/emboss/trunk/debian/manpages/sirna.1e
   trunk/packages/emboss/trunk/debian/manpages/sixpack.1e
   trunk/packages/emboss/trunk/debian/manpages/skipseq.1e
   trunk/packages/emboss/trunk/debian/manpages/splitter.1e
   trunk/packages/emboss/trunk/debian/manpages/stretcher.1e
   trunk/packages/emboss/trunk/debian/manpages/stssearch.1e
   trunk/packages/emboss/trunk/debian/manpages/supermatcher.1e
   trunk/packages/emboss/trunk/debian/manpages/syco.1e
   trunk/packages/emboss/trunk/debian/manpages/tcode.1e
   trunk/packages/emboss/trunk/debian/manpages/testplot.1e
   trunk/packages/emboss/trunk/debian/manpages/textsearch.1e
   trunk/packages/emboss/trunk/debian/manpages/tfextract.1e
   trunk/packages/emboss/trunk/debian/manpages/tfm.1e
   trunk/packages/emboss/trunk/debian/manpages/tfscan.1e
   trunk/packages/emboss/trunk/debian/manpages/tmap.1e
   trunk/packages/emboss/trunk/debian/manpages/tranalign.1e
   trunk/packages/emboss/trunk/debian/manpages/transeq.1e
   trunk/packages/emboss/trunk/debian/manpages/treetypedisplay.1e
   trunk/packages/emboss/trunk/debian/manpages/trimest.1e
   trunk/packages/emboss/trunk/debian/manpages/trimseq.1e
   trunk/packages/emboss/trunk/debian/manpages/twofeat.1e
   trunk/packages/emboss/trunk/debian/manpages/union.1e
   trunk/packages/emboss/trunk/debian/manpages/vectorstrip.1e
   trunk/packages/emboss/trunk/debian/manpages/water.1e
   trunk/packages/emboss/trunk/debian/manpages/whichdb.1e
   trunk/packages/emboss/trunk/debian/manpages/wobble.1e
   trunk/packages/emboss/trunk/debian/manpages/wordcount.1e
   trunk/packages/emboss/trunk/debian/manpages/wordfinder.1e
   trunk/packages/emboss/trunk/debian/manpages/wordmatch.1e
   trunk/packages/emboss/trunk/debian/manpages/wossname.1e
   trunk/packages/emboss/trunk/debian/manpages/yank.1e
   trunk/packages/emboss/trunk/debian/patches/
   trunk/packages/emboss/trunk/debian/patches/ajindex-fix-2008-01-09.patch
   trunk/packages/emboss/trunk/debian/patches/psiphi-fix-2007-07-27.patch
   trunk/packages/emboss/trunk/debian/patches/series
   trunk/packages/emboss/trunk/debian/rules
   trunk/packages/emboss/trunk/debian/watch
Modified:
   trunk/packages/emboss/trunk/test/gb/Makefile
   trunk/packages/emboss/trunk/test/wormpep/Makefile
Log:
[svn-inject] Applying Debian modifications to trunk


Property changes on: trunk/packages/emboss/trunk/debian
___________________________________________________________________
Name: mergeWithUpstream
   + 1

Added: trunk/packages/emboss/trunk/debian/EMBOSS_qg.doc.uu
===================================================================
--- trunk/packages/emboss/trunk/debian/EMBOSS_qg.doc.uu	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/EMBOSS_qg.doc.uu	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,1460 @@
+begin 644 EMBOSS_qg.doc
+MT,\1X*&Q&N$`````````````````````/@`#`/[_"0`&```````````````!
+M````>P``````````$```?0````$```#^____`````'H```#_____________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M_______________________LI<$`!V$)!```\!*_```````!$0`!``$`!@``
+M3B\```X`:F)J8H0LA"P````````````````````````)!!8`DG4``.Y.``#N
+M3@``3BD```````````````````````````````````````#__P\`````````
+M``#__P\```````````#__P\``````````````````````(@``````#8#````
+M````-@,``#8#````````-@,````````V`P```````#8#````````-@,``!0`
+M`````````````*X#````````UC4```````#6-0```````-8U````````UC4`
+M`"P````"-@``3````*X#````````OT<``'@!``!:-@```````%HV````````
+M6C8```````!:-@```````%HV````````6C8```````!:-@```````%HV````
+M````-D<```(````X1P```````#A'````````.$<````````X1P```````#A'
+M````````.$<``"P````W20``4@(``(E+``!.````9$<``!4`````````````
+M````````````-@,```````!:-@````````````````````````````!:-@``
+M`````%HV````````6C8```````!:-@```````&1'````````-D<````````V
+M`P```````#8#````````6C8``````````````````%HV````````>4<``!8`
+M```V1P```````#9'````````-D<```````!:-@``)@@``#8#````````6C8`
+M```````V`P```````%HV````````-D<``````````````````#9'````````
+M2@,``"0```!N`P``0````#8#````````-@,````````V`P```````#8#````
+M````6C8````````V1P``````````````````-D<``````````````````#9'
+M````````-@,````````V`P``````````````````````````````````````
+M````````````````````````````````````````````-D<`````````````
+M`````$XV```,````-D0QPP```````````````-8U````````@#X``+8(```V
+M1P``````````````````-D<```````"/1P``,````+]'````````-D<`````
+M``#72P```````#9'````````UTL````````V1P```````#9'````````````
+M````````````````````````````````````````````````````````````
+M```````````````````````````````````````````V`P``````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M`````````````````````````````````*X#````````K@,``,0>``!R(@``
+M9!,```````````````````````"N`P```````*X#````````<B(````````$
+M``$!#P`$`0``````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M``````````````````````````````!%34)/4U,-02!1=6EC:R!'=6ED90U%
+M=7)O<&5A;B!-;VQE8W5L87(@0FEO;&]G>2!/<&5N(%-O9G1W87)E(%-U:71E
+M#0U(:7-T;W)Y#5-I;F-E(#$Y.#@L('1H92!S97%U96YC92!A;F%L>7-I<R!P
+M86-K86=E($5'0T<@:&%S('!R;W9I9&5D#65X=&5N<VEO;G,@=&\@=&AE(&UA
+M<FME="!L96%D:6YG(&-O;6UE<F-I86P@<V5Q=65N8V4 at 86YA;'ES:7,@<&%C
+M:V%G92!'0T<N($5'0T<@9&5V96QO<&UE;G0@=V%S(&$@8V]L;&%B;W)A=&EO
+M;B!O9B!G<F]U<',@=VET:&EN($5-0FYE="!A;F0 at 96QS97=H97)E+ at U4:&%T
+M('!R;VIE8W0@:&%S(')E86-H960@=&AE(&QI;6ET<R!O9B!W:&%T('=E(&-A
+M;B!A8VAI979E('5S:6YG('1H92!'0T<@<&%C:V%G92X at 4W!E8VEF:6-A;&QY
+M+"!I="!I<R!N;R!L;VYG97(@<&]S<VEB;&4@=&\@9&ES=')I8G5T92!A8V%D
+M96UI8R!S;V9T=V%R92!S;W5R8V4 at 8V]D92!W:&EC:"!U<V5S('1H92!'0T<@
+M;&EB<F%R:65S(&%N9"!H87, at 8F5C;VUE(&1I9F9I8W5L="!E=F5N('1O(&1I
+M<W1R:6)U=&4 at 8FEN87)I97,N#4%S(&$@<F5S=6QT+"!T:&4 at 9F]R;65R($5'
+M0T<@9&5V96QO<&5R<R!H879E(&)E96X at 9&5S:6=N:6YG(&$-=&]T86QL>2!N
+M97<@9V5N97)A=&EO;B!O9B!A8V%D96UI8R!S97%U96YC92!A;F%L>7-I<R!S
+M;V9T=V%R92X-5&AI<R!H87,@<F5S=6QT960@:6X@=&AE('!R97-E;G0 at 14U"
+M3U-3('!R;VIE8W0N#45-0D]34R!I<R!A(&YE=R!S=6ET92!O9B!F<F5E;'D@
+M879A:6QA8FQE('!R;V=R86US(&%N9`UL:6)R87)I97, at 9F]R('-E<75E;F-E
+M(&%N86QY<VES+B!)="!I;F-O<G!O<F%T97, at 86YD(&EN=&5G<F%T97, at 80UR
+M86YG92!O9B!C=7)R96YT;'D at 879A:6QA8FQE('!U8FQI8R!P86-K86=E<R!A
+M;F0@=&]O;',@:6YT;R!A#6=E;F5R86PL('!U8FQI8VQY(&%V86EL86)L92P@
+M<W5I=&4@<W!E8VEA;&QY(&1E=F5L;W!E9"!F;W(@=&AE#6YE961S(&]F('1H
+M92!386YG97(@0V5N=')E(&%N9"!T:&4 at 14U";F5T('5S97(@8V]M;75N:71Y
+M+ at U,:6-E;G-I;F<-5&AE($5-0D]34R!C;W)E(&%P<&QI8V%T:6]N('-U:71E
+M(&ES(&QI8V5N<V5D('5N9&5R('1H90U'96YE<F%L(%!U8FQI8R!,:6-E;G-E
+M("A'4$PI(&%L;&]W:6YG(&9R964 at 8V]P>6EN9RP-;6]D:69I8V%T:6]N(&%N
+M9"!D:7-T<FEB=71I;VX@;V8@=&AE('!A8VMA9V4N#51H92!%34)/4U, at 3&EB
+M<F%R:65S(&%R92!L:6-E;G-E9"!U;F1E<B!T:&4@=&AE($QI8G)A<GD-1V5N
+M97)A;"!0=6)L:6, at 3&EC96YS92X-07-S;V-I871E9"!P86-K86=E<R!M87D@
+M8F4@;&EC96YS960@=6YD97(@9&EF9F5R96YT('1E<FUS+"!A;&P-;V8@=VAI
+M8V@@<&5R;6ET(&9R964@<F5D:7-T<FEB=71I;VX@;V8@=&AE('-O9G1W87)E
+M+ at U/8G1A:6YI;F<@14U"3U-3#45-0D]34R!A;F0@=&AE(&%S<V]C:6%T960@
+M<&%C:V%G97, at 8V%N(&)E(&]B=&%I;F5D('9I82!&5%`-9G)O;2!T:&4 at 4V%N
+M9V5R($-E;G1R92P at 54L@870 at 9G1P+G-A;F=E<BYA8RYU:R]P=6(O14U"3U-3
+M#45-0D]34R!H;VUE('!A9V4@:'1T<#HO+W=W=RYE;6)O<W,N;W)G#5)U;FYI
+M;F<@14U"3U-3#4%L;"!%34)/4U,@<')O9W)A;7, at 87)E(&1E<VEG;F5D('1O
+M(&)E(')U;B!F<F]M('1H90UC;VUM86YD(&QI;F4N($5A8V@@<')O9W)A;2!H
+M87, at 82!S<&5C:69I8R!D97-C<FEP=&EO;B!F:6QE#2A!0T0 at 9FEL92D@=&AA
+M="!D97-C<FEB97,@=&AE(&EN<'5T(&%N9"!O=71P=70@<&%R86UE=&5R<RX@
+M06QL#71H92!P87)A;65T97)S(&-A;B!B92!S<&5C:69I960@;VX@=&AE(&-O
+M;6UA;F0@;&EN92P at 86QL;W=I;F<-;6]D=6QA<B!I;G1E9W)A=&EO;B!I;G1O
+M(&=R87!H:6-A;"!I;G1E<F9A8V5S+ at U4;R!R=6X at 86X@14U"3U-3('!R;V=R
+M86TL(&IU<W0@='EP92!I=',@;F%M92X at 66]U<B!S>7-T96T-861M:6YI<W1R
+M871O<B!S:&]U;&0 at 96YS=7)E('1H870@=&AE('!R;V=R86US(&%R92!A=F%I
+M;&%B;&4@:6X->6]U<B`D4$%42"X-#E1H92!5;FEF;W)M(%-E<75E;F-E($%D
+M9')E<W,@*%5302D-5&AE(%5302!I<R!A(&UE=&AO9"!O9B!S<&5C:69Y:6YG
+M('1H92!L;V-A=&EO;B!O9B!A('-E<75E;F-E#6%N9"!I=', at 9F]R;6%T+B!4
+M:&4 at 9V5N97)A;"!F;W)M(&ES. at U&;W)M870Z.F1A=&%B87-E.G-E<75E;F-E
+M;F%M90UE9RX at 96UB;#HZ96TZ<V-A8W0-14U"3U-3(&ES(&YO<FUA;&QY('9E
+M<GD at 9V]O9"!A="!I9&5N=&EF>6EN9R!S97%U96YC92!F;W)M871S(&%U=&]M
+M871I8V%L;'D at 8G5T(&]C8V%S:6]N86QL>2!N965D<R!A(&AI;G0N($1A=&%B
+M87-E('=I;&P at 8F4@;VYE(&]F('1H92!D871A8F%S97, at 86QR96%D>2!S970@
+M=7`@870@>6]U<B!S:71E+B!4:&4 at 8V]M;6%N9`TE('-H;W=D8 at UL:7-T<R!T
+M:&4 at 9&%T86)A<V5S(&%V86EL86)L92!O;B!Y;W5R('-Y<W1E;2X-5&AE('-E
+M<75E;F-E;F%M92!C86X at 8F4@96ET:&5R(&ET<R!N86UE+"!A8V-E<W-I;VX@
+M;G5M8F5R+`UT:&4 at 9FEL96YA;64@:6X@=VAI8V@@=&AE('-E<75E;F-E(&ES
+M(&9O=6YD+"!O<B!T:&4@<V5Q=65N8V4-:71S96QF(&EF(&%S:7,Z.B!F;W)M
+M870@:7,@<W!E8VEF:65D+B!)9B!Y;W4 at 87)E('1A:VEN9R!O;F4-<V5Q=65N
+M8V4 at 9G)O;2!A(&UU;'1I<&QE('-E<75E;F-E(&9I;&4L('!U="!T:&4@<V5Q
+M=65N8V4-;G5M8F5R(&EN(&)R86-E<R!A9G1E<B!T:&4 at 9FEL96YA;64L(&5G
+M. at UA;&QM>7-E<7,N9F%S=&%[,S)]#45-0D]34R!P<F]G<F%M<PU9;W4 at 8V%N
+M(&]B=&%I;B!A(&QI<W0@;V8 at 14U"3U-3('!R;V=R86US('=I=&@@=&AE(&-O
+M;6UA;F0-=V]S<VYA;64N(%5S969U;"!Q=6%L:69I97)S(&9O<B!W;W-S;F%M
+M92!A<F4 at .@TM86QP:&%B970 at 3&ES="!A;&P@<')O9W)A;7,@:6X-86QP:&%B
+M971I8V%L(&]R9&5R#2UA=71O($QI<W0 at 86QL('!R;V=R86US('=I=&AO=70-
+M87-K:6YG(&9O<B!A(&ME>7=O<F0N#24@=V]S<VYA;64 at EF%L<&AA8F5T()9A
+M=71O#7=I;&P@;&ES="!A;&P@=&AE(&%V86EL86)L92!E;6)O<W,@<')O9W)A
+M;7,@=VET:"!A('-H;W)T#61E<V-R:7!T:6]N(&]F('1H92!F=6YC=&EO;B!O
+M9B!E86-H('!R;V=R86T-14U"3U-3('=I;&P at 8GD@9&5F875L="!O;FQY('!R
+M;VUP="!Y;W4 at 9F]R('1H92!M:6YI;6%L(&EN<'5T#6ET(&YE961S('1O(')U
+M;B!T:&4@<')O9W)A;2X at 5&AE(&1E9F%U;'0 at 8F5H879I;W5R(&-A;B!B90UC
+M:&%N9V5D('5S:6YG(&-O;6UA;F0@;&EN92!Q=6%L:69I97)S+ at U);7!O<G1A
+M;G0@<75A;&EF:65R<PU4:&4 at 8F5H879I;W5R(&]F($5-0D]34R!P<F]G<F%M
+M<R!C86X at 8F4@;6]D:69I960 at 8GD@=7-I;F<-82!L87)G92!N=6UB97(@;V8@
+M<75A;&EF:65R<RX at 5&AI<R!I<R!A(&QI<W0@;V8@=&AE(&UO<F4@=7-E9G5L
+M#6]N97,N#2UH96QP(%!R:6YT<R!A('-U;6UA<GD@;V8@=&AE(&]P=&EO;G,@
+M=&AE#7!R;V=R86T at 8V%N('1A:V4N(%=I=&@@+79E<F)O<V4@:70 at 9VEV97,@
+M80UM;W)E(&1E=&%I;&5D(&QI<W0N#2UO<'1I;VYS(%!R;VUP="!T:&4@=7-E
+M<B!F;W(@=&AE(&]P=&EO;F%L('!A<F%M971E<G,-+6%U=&\@06-C97!T(&%L
+M;"!T:&4 at 9&5F875L="!S971T:6YG<R!A;F0@<G5N#7=I=&AO=70@<')O;7!T
+M:6YG('1H92!U<V5R+ at TM<V%S:R!!<VL at 9F]R('1H92!S=&%R="P at 96YD(&%N
+M9"!R979E<G-E(&]F('1H90US97%U96YC92!I;G!U=`TM<W1D;W5T(%!R:6YT
+M(&]U='!U="!T;R!S=&1O=70@*'1H92!S8W)E96XI(&EN<W1E860-;V8@=&\@
+M82!F:6QE+ at TM9FEL=&5R(%1A:V4@:6YP=70 at 9G)O;2!S=&1I;B`H:V5Y8F]A
+M<F0I(&%N9`UO=71P=70@=&\@<W1D;W5T#0Y7:&%T("UH96QP('1E;&QS('EO
+M=0U4:&4 at EFAE;'`@;W!T:6]N(&QI<W1S('1H92!I;G!U=',@=&\@=&AE('!R
+M;V=R86T at 86QO;F<@=VET:"!T:&4@:6YP=70@='EP92`H<V5Q=65N8V4L(&EN
+M=&5G97(@971C*2X at 5&AE<F4 at 87)E(&%D9&ET:6]N86P@<75A;&EF:65R<R!A
+M<W-O8VEA=&5D('=I=&@@;6%N>2!T>7!E<RX at EG9E<F)O<V4@=VEL;"!L:7-T
+M(&%L;"!T:&4 at 861D:71I;VYA;"!Q=6%L:69I97)S(')E;&%T960@=&\@=&AE
+M(&EN<'5T('1Y<&5S(&9O<B!T:&4@<')O9W)A;2X at 5&AE('%U86QI9FEE<G,@
+M87)E(&QI<W1E9"!I;B!T:')E92!S96-T:6]N<SH-36%N9&%T;W)Y(%%U86QI
+M9FEE<G,-5&AE<V4 at 87)E('1H92!M:6YI;75M(&EN<'5T<R!T:&4@<')O9W)A
+M;2!N965D<R!T;R!R=6XN(%-O;64@;V8@=&AE<V4@:&%V92!D969A=6QT('9A
+M;'5E<R!W:&EC:"!C86X at 8F4@<V5L96-T960@=7-I;F<@+6%U=&\-3W!T:6]N
+M86P at 475A;&EF:65R<R!4:&5S92!A<F4@<75A;&EF:65R<R!F;W(@=VAI8V@@
+M>6]U#7=I;&P at 8F4@<')O;7!T960@:68@>6]U('5S92!T:&4 at EF]P=&EO;B!Q
+M=6%L:69I97(N($%L;"!T:&5S90UQ=6%L:69I97)S(&AA=F4 at 9&5F875L="!V
+M86QU97,N#4%D=F%N8V5D(%%U86QI9FEE<G, at 66]U('=I;&P@;F5V97(@8F4@
+M<')O;7!T960 at 9F]R#71H97-E+B!)9B!Y;W4@=VES:"!T;R!U<V4@=&AE;2!Y
+M;W4@;75S="!S<&5C:69Y('1H96T@;VX@=&AE#6-O;6UA;F0@;&EN92X-14U"
+M3U-3('!A<F%M971E<B!T>7!E<PU4>7!E($%L;&]W960@=F%L=65S#6)O;VP@
+M>65S.B`M<&%R86T@;F\Z("UN;W!A<F%M#6EN=&5G97(@5VAO;&4@;G5M8F5R
+M<R"6<&%R86T]-0UF;&]A="!D96-I;6%L(&YU;6)E<G, at EG!A<F%M/3(S+CD-
+M<F%N9V4@<V5Q=65N8V4@<F%N9V5S+B!E9RX at +7!A<F%M/3$M,3(L,S4M.3D-
+M<F5G97AP(&$@<F5G=6QA<B!E>'!R97-S:6]N('!A='1E<FX-<W1R:6YG(&]R
+M9&EN87)Y('1E>'0N("UP87)A;3V2=&5X="!W:71H("J2#6EN9FEL92!P871H
+M(&]F(&$@9FEL90UM871R:7@@:6YT96=E<B!S8V]R:6YG(&UA=')I>"!F;W(@
+M86QI9VYM96YT<PUM871R:7AF(&9L;V%T:6YG('!O:6YT('-C;W)I;F<@;6%T
+M<FEX#6-O9&]N(&-O9&]N('5S86=E('1A8FQE#7-E<75E;F-E('-E<7-E="!S
+M97%A;&P at 56YI9F]R;2!S97%U96YC92!A9&1R97-S("A54T$I(&9O<B!T:&4@
+M<V5Q=65N8V4@;W(@<V5T(&]F('-E<75E;F-E<RX-9F5A='5R97, at 1F5A='5R
+M92!T86)L90UL:7-T(&QI<W0@;V8@;W!T:6]N<PUS96QE8W1I;VX@<V5L96-T
+M:6]N(&QI<W0@;V8@;W!T:6]N<PUO=71F:6QE('!A=&@@=&\@82!F:6QE(&9O
+M<B!N;VYS97%U96YC92!O=71P=70-<V5Q;W5T(&]U='!U="!S97%U96YC92!5
+M4T$-<V5Q;W5T<V5T(&UU;'1I<&QE('-E<75E;F-E(&9I;&4 at 9F]R(&]U='!U
+M=`US97%O=71A;&P@;75L=&EP;&4@;W(@<VEN9VQE('-E<75E;F-E(&]U='!U
+M="!F:6QE<PUF96%T;W5T(&]U='!U="!F96%T=7)E('1A8FQE#6=R87!H(&]U
+M='!U="!D979I8V4 at 9F]R(&=R87!H:6-S(&EM86=E<PUX>6=R87!H(&]U='!U
+M="!D979I8V4 at 9F]R(%A9(&=R87!H<PU3964@=&AE(&1E<V-R:7!T:6]N<R!B
+M96QO=R!F;W(@;6%N>2!O9B!T:&5S92X-#D%S<V]C:6%T960@<75A;&EF:65R
+M<SH@<V5Q=65N8V4L('-E<7-E="P@<V5Q86QL#2US8F5G:6X@:6YT96=E<B!F
+M:7)S="!B87-E('5S960 at 6W-T87)T70TM<V5N9"!I;G1E9V5R(&QA<W0 at 8F%S
+M92!U<V5D(%ME;F1=#2US<F5V97)S92!B;V]L(')E=F5R<V4@<V5Q=65N8V4@
+M6TY=#2US87-K(&)O;VP@<')O;7!T(&9O<B!B96=I;B]E;F0O<F5V97)S92!;
+M3ET-+7-N=6-L96]T:61E(&)O;VP at 4V5Q=65N8V4@:7,@;G5C;&5O=&ED92!;
+M3ET-+7-P<F]T96EN(&)O;VP at 4V5Q=65N8V4@:7,@<')O=&5I;B!;3ET-+7-L
+M;W=E<B!B;V]L($UA:V4@<V5Q=65N8V4@;&]W97)C87-E6TY=#2US=7!P97(@
+M8F]O;"!-86ME('-E<75E;F-E('5P<&5R8V%S95M.70TM<V9O<FUA="!S=')I
+M;F<@:6YP=70@<V5Q=65N8V4 at 9F]R;6%T#2US;W!E;F9I;&4@<W1R:6YG(&EN
+M<'5T(&9I;&5N86UE#2US9&)N86UE('-T<FEN9R!D871A8F%S92!N86UE#2US
+M96YT<GD@<W1R:6YG(&5N=')Y(&YA;64O86-C97-S:6]N(&YU;6)E<@TM=69O
+M('-T<FEN9R!&96%T=7)E('1A8FQE("A51D\I#2UF9F]R;6%T('-T<FEN9R!F
+M96%T=7)E<R!F;W)M870-07-S;V-I871E9"!Q=6%L:69I97)S.B!S97%O=70L
+M('-E<6]U='-E="P@<V5Q;W5T86QL#2UO<V9O<FUA="!S=')I;F<@;W5T<'5T
+M('-E<75E;F-E(&9O<FUA=`TM;W-E>'1E;G-I;VX@<W1R:6YG(&9I;&5N86UE
+M(&5X=&5N<VEO;@TM;W-N86UE('-T<FEN9R!B87-E(&9I;&5N86UE#2UO<V1B
+M;F%M92!S=')I;F<@9&%T86)A<V4@;F%M92!T;R!A9&0-+6]S<VEN9VQE(&)O
+M;VP@<V5P97)A=&4 at 9FEL92!F;W(@96%C:"!E;G1R>5M.70TM;W5F;R!S=')I
+M;F<@9F5A='5R97, at 549/#2UO9F9O<FUA="!S=')I;F<@9F5A='5R97, at 9F]R
+M;6%T#2UO9FYA;64@<W1R:6YG(&9E871U<F5S(&9I;&5N86UE#4%S<V]C:6%T
+M960@<75A;&EF:65R<SH at 9F5A='5R97,-+69F;W)M870@<W1R:6YG(&9E871U
+M<F5S(&9O<FUA=`TM9F]P96YF:6QE('-T<FEN9R!F96%T=7)E<R!F:6QE;F%M
+M90TM9F%S:R!B;V]L('!R;VUP="!F;W(@9F)E9VEN+"!F96YD+"!A;F0 at 9G)E
+M=F5R<V4-+69B96=I;B!I;G1E9V5R(&9E871U<F5S('-T87)T:6YG('!O<VET
+M:6]N#2UF96YD(&EN=&5G97(@9F5A='5R97, at 96YD('!O<VET:6]N#2UF<F5V
+M97)S92!B;V]N(&9E871U<F5S(&]N('1H92!R979E<G-E('-T<F%N9"!;3ET-
+M07-S;V-I871E9"!Q=6%L:6EF97)S.B!F96%T;W5T#2UO9F9O<FUA="!S=')I
+M;F<@9F5A='5R92!F;W)M870-+6]F;W!E;F9I;&4@<W1R:6YG(&]U='!U="!F
+M:6QE;F%M90TM;V9E>'1E;G-I;VX@<W1R:6YG(&9I;&5N86UE(&5X=&5N<VEO
+M;@TM;V9N86UE('-T<FEN9R!F:6QE;F%M90TM;V9S:6YG;&4 at 8F]O;"!W<FET
+M92!O;F4 at 9F5A='5R92!P97(@9FEL90U!<W-O8VEA=&5D('%U86QI9FEE<G,Z
+M(&=R87!H+"!X>6=R87!H#2UG<')O;7!T(&)O;VP at 9W)A<&@@<')O;7!T:6YG
+M#2UG=&ET;&4@<W1R:6YG(&=R87!H('1I=&QE#2UG<W5B=&ET;&4@<W1R:6YG
+M(&=R87!H('-U8G1I=&QE#2UG>'1I=&QE('-T<FEN9R!X(&%X:7,@=&ET;&4-
+M+6=Y=&ET;&4@<W1R:6YG('D at 87AI<R!T:71L90TM9W)T:71L92!S=')I;F<@
+M<FEG:'0 at 87AI<R`H>3(I('1I=&QE#2UG<&%G97,@:6YT96=E<B!N=6UB97(@
+M;V8@<&%G97,-+6=O=71F:6QE('-T<FEN9R!O=71P=70 at 9FEL96YA;64-#D5-
+M0D]34R!A;F0 at 1W)A<&AI8W,-14U"3U-3(&-A;B!S=7!P;W)T(&$@;G5M8F5R
+M(&]F(&1I9F9E<F5N="!G<F%P:&EC<R!O=71P=70-='EP97, at 9&5P96YD:6YG
+M(&]N('1H92!F96%T=7)E<R!A=F%I;&%B;&4@;VX@>6]U<B!S>7-T96TN($ET
+M('=I;&P@<')O;7!T(&9O<B!A(&=R87!H:6-S(&1E=FEC93H-1W)A<&AI8W,@
+M9&5V:6-E(%MX,3%=. at U4>7!I;F<@<G5B8FES:"!H97)E('1H96X@<')E<W-I
+M;F<@<F5T=7)N('=I;&P at 9VEV92!A(&QE;F=T:'D@;&ES="!O9B!D979I8V5S
+M+"!M86YY(&]F('=H:6-H(&%R92!E<75I=F%L96YT+ at U4:&4@;6%I;B!G<F%P
+M:&EC<R!O<'1I;VYS(&%R93H-6UA=('@Q,2!/=71P=70@=&\@86X at 6"UW:6YD
+M;W<-<&]S='-C<FEP="!/=71P=70@=&\@82!P;W-T<V-R:7!T(&9I;&4@*&=O
+M;V0 at 9F]R#7!R:6YT:6YG(&]N(&$@;&%S97(@<')I;G1E<BD-8W!S($]U='!U
+M="!T;R!A(&-O;&]U<B!P;W-T<V-R:7!T(&9I;&4-=&5X="!/=71P=70@=&\@
+M82!T97AT(&9I;&4-9&%T82!/=71P=70 at 6%D at 9&%T82!P;VEN=',@=&\@82!F
+M:6QE+B`H9V]O9"!F;W(@:6UP;W)T:6YG(&EN=&\@82!G<F%P:&EN9R!P86-K
+M86=E*0U;4%T@<&YG($]U='!U="!T;R!A(%!.1R!I;6%G92!F:6QE("AG;V]D
+M(&9O<B!W96(@<&%G97,I#5M872!496L at 3W5T<'5T('1O('1E:W1R;VYI8W,@
+M=&5R;6EN86P-6UA=('AT97)M($]U='!U="!T;R!A;B!8=&5R;2!W:6YD;W<-
+M6UA=+2!R97%U:7)E<R!8+7=I;F1O=W, at 6U!=()8@<F5Q=6ER97, at 4$Y'('-U
+M<'!O<G0-5&AE(&1E9F%U;'0 at 9FEL96YA;64@:7,@<')O9RYF;W)M870 at 96<N
+M(&]C=&%N;VPN<',-4V]M92!U<V5F=6P@<')O9W)A;7,-1V5N97)A;`UW;W-S
+M;F%M92!L:7-T<R!A;&P at 14U"3U-3('!R;V=R86US#7-H;W=D8B!3:&]W<R!T
+M:&4 at 879A:6QA8FQE(&1A=&%B87-E<PU397%U96YC92!R971R96EV86P-<V5Q
+M<F5T(')E=')E:79E<R!A;F0O;W(@8VAA;F=E<R!F;W)M870@;V8 at 82!S97%U
+M96YC90US97%R971S970@<V5Q<F5T86QL(')E=')I979E(&%N9"!O<B!C:&%N
+M9V4 at 9F]R;6%T<R!O9B!A(&YU;6)E<@UO9B!S97%U96YC97, at 870@;VYC90UT
+M<F%N<V5Q('1R86YS;&%T92!A($1.02!S97%U96YC92!T;R!P<F]T96EN#6)A
+M8VMT<F%N<V5Q('1R86YS;&%T92!A('!R;W1E:6X@<V5Q=65N8V4@=&\@1$Y!
+M#65X=')A8W1S97$@97AT<F%C="!R96=I;VYS(&9R;VT at 82!S97%U96YC90UC
+M=71S97$@<F5M;W9E(&$@<F5G:6]N(&9R;VT at 82!S97%U96YC90UP87-T97-E
+M<2!I;G-E<G1S(&$@<V5Q=65N8V4@:6YT;R!A;F]T:&5R('-E<75E;F-E#6EN
+M9F]S97$@9&ES<&QA>2!I;F9O<FUA=&EO;B!A8F]U="!A('-E<75E;F-E#7-P
+M;&ET=&5R('-P;&ET(&$@<V5Q=65N8V4@:6YT;R!S;6%L;&5R('-E<75E;F-E
+M<PU397%U96YC92!C;VUP87)I<V]N#6YE961L92!.965D;&5M86XM5W5S8V@@
+M<V5Q=65N8V4 at 86QI9VYM96YT#7=A=&5R(%-M:71H+5=A=&5R;6%N('-E<75E
+M;F-E(&%L:6=N;65N=`US=')E=&-H97(@37EE<G, at 86YD($UI;&QE<B!G;&]B
+M86P at 86QI9VYM96YT#6UA=&-H97(@2'5A;F<@86YD($UI;&QE<B!L;V-A;"!A
+M;&EG;FUE;G0-9&]T='5P#61O=&UA=&-H97(-9&]T<&QO="!C;VUP87)I<V]N
+M<R!O9B!T=V\@<V5Q=65N8V5S+ at UP<F5T='EP;&]T('!L;W1S(&UU;'1I<&QE
+M('-E<75E;F-E(&%L:6=N;65N=',-<&]L>61O="!S=7!E<FUA=&-H97(@9&]T
+M<&QO="!C;VUP87)I<V]N<R!O9B!M=6QT:7!L92!S97%U96YC97,N#0Y397%U
+M96YC92!P87)A;65T97)S#6-U<W`@9V5N97)A=&5S(&$@8V]D;VX@=7-A9V4@
+M=&%B;&4-<WEC;R!S>6YO;GEM;W5S(&-O9&]N('5S86=E('!L;W0-9&%N(&-A
+M;&-U;&%T97, at 1$Y!+U).02!M96QT:6YG('1E;7!E<F%T=7)E#6-O;7!S97$@
+M<V5Q=65N8V4 at 8V]M<&]S:71I;VX@=&%B;&5S#41.02!397%U96YC92!F96%T
+M=7)E<PUR96UA<"!R97-T<FEC=&EO;B!M87`@;V8@=&AE('-E<75E;F-E#6-P
+M9W!L;W0L(&-P9W)E<&]R="!#<$<@:7-L86YD(&1E=&5C=&EO;@UE=&%N9&5M
+M+"!E:6YV97)T960 at 9FEN9',@=&%N9&5M(&%N9"!I;G9E<G1E9"!R97!E871S
+M#7!L;W1O<F8@<&QO=',@<&]T96YT:6%L($]21G,-<VAO=V]R9B!P<F5T='D@
+M9&ES<&QA>2!O9B!P;W1E;G1I86P at 3U)&<PUF=7IZ;G5C($1.02!P871T97)N
+M('-E87)C:`UT9G-C86X@<V-A;G,@<V5Q=65N8V4 at 9F]R(%1&(&)I;F1I;F<@
+M<VET97,-4')O=&5I;B!397%U96YC92!F96%T=7)E<PUI968 at 27-O96QE8W1R
+M:6,@<&]I;G0 at 8V%L8W5L871I;VX-86YT:6=E;FEC($9I;F1S('!O=&5N=&EA
+M;"!A;G1I9V5N:6,@<VET97,-9&EG97-T('!R;W1E:6X at 9&EG97-T:6]N(&UA
+M<`UF:6YD:VT at 5FUA>"!A;F0 at 2VT@8V%L8W5L871I;VYS#69U>GIP<F\@<')O
+M=&5I;B!P871T97)N('-E87)C:`UG87)N:65R('!R;W1E:6X@,D0@<W1R=6-T
+M=7)E('!R961I8W1I;VX-:&5L:7AT=7)N:&5L:7@@9FEN9',@;G5C;&5I8R!A
+M8VED(&)I;F1I;F<@;6]T:69S#6]C=&%N;VPL('!E<'=I;F1O=R!D:7-P;&%Y
+M<R!P<F]T96EN(&AY9')O<&%T:'D-<&%T;6%T9&(-<&%T;6%T;6]T:69S('-E
+M87)C:&EN9R!W:71H(&UO=&EF<R!V<R!P<F]T96EN('-E<75E;F-E<PUP97!C
+M;VEL('!R961I8W1S(&-O:6QE9"!C;VEL(')E9VEO;G,-<&5P:6YF;RP@<&5P
+M<W1A=', at 4')O=&5I;B!I;F9O<FUA=&EO;@UP97!W:&5E;"!S:&]W<R!P<F]T
+M96EN('-E<75E;F-E<R!A<R!A(&AE;&EX+ at T-1FEL92!F;W)M871S('-U<'!O
+M<G1E9"!B>2!%34)/4U,-#4EN=&5L;&E'96YE=&EC<RP at 1V5N8F%N:RP at 3D)2
+M1BP at 14U"3"P at 1T-'+"!$3D%3=')I9&5R+`U&:71C:"P at 1D%35$$L(%!H>6QI
+M<"P at 4$E2+"!-4T8L($%33BXQ+"!00550+"!#;'5S=&%L5PT-5&AI<R!1=6EC
+M:R!'=6ED92!W87,@=W)I='1E;B!B>2!A;F0@:7, at 8V]P>7)I9VAT($1R($1A
+M=FED#4UA<G1I;B!I;FET:6%L;'D at 870@=&AE($YO<G=E9VEA;B!%34)N970@
+M;F]D92!A;F0@<W5B<V5Q=65N=&QY(&%T('1H92!5;FEV97)S:71Y(&]F($1U
+M;F1E92X-0V]M;65N=', at 86YD('-U9V=E<W1I;VYS(&9O<B!I;7!R;W9I;F<@
+M=&AI<R!G=6ED92!S:&]U;&0 at 8F4-861D<F5S<V5D('1O(&AI;2!A="!D879I
+M9$!C;VUP8FEO+F1U;F1E92YA8RYU:PU%34)N970@:7, at 82!N971W;W)K(&]F
+M(&%C861E;6EC(&%N9"!C;VUM97)C:6%L(&)I;VEN9F]R;6%T:6-S(&EN<W1I
+M='5T97,L('-U<'!O<G1I;F<@8FEO:6YF;W)M871I8W,@<F5S96%R8V@@86YD
+M(&-O;&QA8F]R871I;VX@:6X@;6]R92!T:&%N(&-O=6YT<FEE<R!W;W)L9'=I
+M9&4N#4UO<F4@:6YF;W)M871I;VX at 86)O=70 at 14U";F5T(&%N9"!D971A:6QS
+M(&]F('EO=7(@;&]C86P@;F]D90UC86X at 8F4@9F]U;F0 at 870@:'1T<#HO+W=W
+M=RYE;6)N970N;W)G#0U4:&ES(&1O8W5M96YT(&UA>2!B92!C;W!I960 at 86YD
+M(&1I<W1R:6)U=&5D('5N9&5R('1H92!S86UE(&QI8V5N<V4@=&5R;7, at 87,@
+M=&AE($5-0D]34R!P86-K86=E+ at T-#0``````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M``````````````8```<&```5!@``308``/8)````"@``7 at L``&\+``#("P``
+MY`L``/4+```+#```&@P``+H-``#>#0``0`X``%X.``!B#@``<0X``*8.``"N
+M#@``VPX``.0.```L#P``,P\``&4/``!R#P``XP\``.H/``!W$```FQ```-40
+M``#=$```]1```/X0```$$0``#A$``#81```\$0``;A$``(<1``"*$@``GQ(`
+M`!\3``#GSK6>M9ZUGH>UA[6>M9YNGK6>;IYNGK6>;IZUGK6>M9ZUGK6>M9ZU
+MGK6>`#`5:($3;``6:)(XX@`V"(%"*@%#2A(`3TH#`%%*`P!A2A(`;4@)!'!H
+M`````'-("00`+15H at 1-L`!9HDCCB`$(J`D-*$@!/2@,`44H#`&%*$@!M2`D$
+M<&@``/\`<T@)!"T5:($3;``6:)(XX@!"*@%#2A(`3TH#`%%*`P!A2A(`;4@)
+M!'!H`````'-("00P%6B!$VP`%FB2..(`-0B!0BH!0TH2`$]*`P!12@,`84H2
+M`&U("01P:`````!S2`D$`#`5:($3;``6:)(XX@`U"(%"*@%#2B@`3TH#`%%*
+M`P!A2B@`;4@)!'!H`````'-("00`,!5H at 1-L`!9HDCCB`#4(@4(J`4-*2`!/
+M2@,`44H#`&%*2`!M2`D$<&@`````<T@)!"L`!@``!P8``!4&``!$!@``108`
+M`$T&``")!@``(`<``!@(``!6"```E0@``,8(``#]"```/PD``'T)``"\"0``
+M]@D````*```X"@``;`H``)H*``#2"@``Z at H``"D+``!>"P``;PL``*H+``#D
+M"P``"PP``/0```````````````#T````````````````]```````````````
+M`/0```````````````#T````````````````]````````````````/0`````
+M``````````#T````````````````]````````````````/0`````````````
+M``#T````````````````]````````````````/0```````````````#T````
+M````````````]````````````````/0```````````````#T````````````
+M````]````````````````/0```````````````#T````````````````]```
+M`````````````/0```````````````#T````````````````]```````````
+M`````/0```````````````#T````````````````]````````````````/0`
+M```````````````````````````*```Q)``W)``X)`!()`!G9)(XX@``'``&
+M``!.+P``_@``````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M```````````````"`0$!"PP``!H,``!.#```B0P``,@,```&#0``-0T``&\-
+M``"N#0``N at T``-X-```;#@``0`X``%X.``!Q#@``*@\``#,/``!A#P``G`\`
+M`-D/```5$```3A```'<0``"+$```FQ```-40```$$0``(Q$``#81``#T````
+M````````````]````````````````/0```````````````#T````````````
+M````]````````````````/0```````````````#T````````````````]```
+M`````````````/0```````````````#T````````````````]```````````
+M`````/0```````````````#T````````````````]````````````````/0`
+M``````````````#T````````````````]````````````````/0`````````
+M``````#T````````````````]````````````````/0```````````````#T
+M````````````````]````````````````/0```````````````#T````````
+M````````]````````````````/0```````````````#T````````````````
+M````````````"@``,20`-R0`."0`2"0`9V22..(``!PV$0``5A$``&P1``"'
+M$0``P!$``.P1```I$@``8Q(``(H2``"?$@``V1(``!D3```?$P``21,``'03
+M``"($P``O1,``.L3```'%```-Q0``$84``!Z%```B!0``+44``#&%```W!0`
+M``86```;%@``EA8``/0```````````````#T````````````````]```````
+M`````````/0```````````````#T````````````````]```````````````
+M`/0```````````````#T````````````````]````````````````/0`````
+M``````````#T````````````````]````````````````/0`````````````
+M``#T````````````````]````````````````/0```````````````#T````
+M````````````]````````````````/0```````````````#T````````````
+M````]````````````````/0```````````````#T````````````````]```
+M`````````````/0```````````````#T````````````````]```````````
+M`````/0````````````````````````````*```Q)``W)``X)`!()`!G9)(X
+MX@``'!\3```E$P``8!,``&D3``"($P``D1,``+T3``##$P``!Q0```T4``!&
+M%```3A0``(@4``"0%```QA0``-P4``#@%```YA0``'P5``"%%0``!A8``!L6
+M``"0%@``JA8``.T6``#U%@``*A<``#X7``"G%P``OA<``-(7``#7%P``W!<`
+M`.,7``#G%P``^!<```88```5&```)1@``#<8``!,&```91@``((8``")&```
+MF!@``+08``##&```RA@``/`8``#X&```%AD``!P9```N&0``11D``(H9``"3
+M&0``H1D``*89``"V&0``P!D``-H9``#B&0``"!H```\:```C&@``+1H``$\:
+M``!9&@``@AH``(H:``"?&@``I1H``,<:``#/&@``&!L``.?0Y]#GT.?0Y]#G
+MT.?0Y]#GT.?0Y]#GT.?0Y]#GT.?0Y]#GT.?0Y]#GT.?0Y]#GT.?0Y]#GT.?0
+MY]#GT.?0Y]#GT.?0Y]#GT.?0````````````````````````````````````
+M````````````````````+15H at 1-L`!9HDCCB`$(J`4-*$@!/2@,`44H#`&%*
+M$@!M2`D$<&@`````<T@)!#`5:($3;``6:)(XX@`U"(%"*@%#2A(`3TH#`%%*
+M`P!A2A(`;4@)!'!H`````'-("01*EA8``,T6```*%P``*A<``%T7``"9%P``
+MIQ<``+X7``#2%P``\!<```\8```Q&```7A@``((8``"M&```PQ@``/`8```6
+M&0``+AD``(H9``"A&0``MAD``-H9```(&@``(QH``$\:``""&@``GQH``,<:
+M``#T````````````````]````````````````/0```````````````#T````
+M````````````]````````````````/0```````````````#T````````````
+M````]````````````````/0```````````````#T````````````````]```
+M`````````````/0```````````````#T````````````````]```````````
+M`````/0```````````````#T````````````````]````````````````/0`
+M``````````````#T````````````````]````````````````/0`````````
+M``````#T````````````````]````````````````/0```````````````#T
+M````````````````]````````````````/0```````````````#T````````
+M````````````````````"@``,20`-R0`."0`2"0`9V22..(``!S'&@``ZQH`
+M`!D;``!*&P``<AL``)4;``"Y&P``Y1L``!(<```Y'```81P``(D<``"O'```
+MT!P``.X<```9'0``.1T``%D=``"-'0``M1T``-P=``#Y'0``'QX``$X>``!H
+M'@``B1X``*H>``#*'@``]````````````````/0```````````````#L````
+M````````````]````````````````/0```````````````#T````````````
+M````]````````````````/0```````````````#T````````````````]```
+M`````````````/0```````````````#T````````````````]```````````
+M`````/0```````````````#T````````````````]````````````````/0`
+M``````````````#T````````````````]````````````````/0`````````
+M``````#T````````````````]````````````````/0```````````````#T
+M````````````````]````````````````/0```````````````#T````````
+M``````````````````````<``#$D`#<D`#@D`$@D```*```Q)``W)``X)`!(
+M)`!G9)(XX@``&Q@;```9&P``&AL``%(;``!R&P``>!L``)4;``"?&P``N1L`
+M`+\;``#E&P``\AL``!(<```<'```.1P``$$<``!A'```:1P``(D<``"2'```
+MKQP``+H<``#0'```V1P``.X<``#V'```&1T``!X=```Y'0``0AT``%D=``!R
+M'0``C1T``)<=``"U'0``PAT``-P=``#D'0``^1T```,>```?'@``*1X``$X>
+M``!4'@``:!X``'(>``")'@``D1X``*H>``#3'@``ZAX``/4>```.'P``%!\`
+M`"0?```R'P``-A\``$<?``!J'P``<!\``(X?``"8'P``P!\``.D?``#_'P``
+M"R```"(@```O(```22```%$@``!A(```:R```.CDR[3+M,NTR[3+M,NTR[3+
+MM,NTR[3+M,NTR[3+M,NTR[3+M,NTR[3+M,NTR[3+M,NTR[3+M,NTR[3+M,NT
+MR[3+M,NTR[3+`"T5:($3;``6:)(XX@!"*@%#2A(`3TH#`%%*`P!A2A(`;4@)
+M!'!H`````'-("00P%6B!$VP`%FB2..(`-0B!0BH!0TH2`$]*`P!12@,`84H2
+M`&U("01P:`````!S2`D$``86:)(XX@``+15H at 1-L`!9HDCCB`$(J`4-*%`!/
+M2@,`44H#`&%*%`!M2`D$<&@`````<T@)!`!'RAX``.H>```.'P``/Q\``&H?
+M``".'P``P!\``-\?``#_'P``(B```$D@``!A(```BR```+$@``#/(```ZB``
+M``LA```H(0``12$``&LA``"+(0``K"$``,$A``#Z(0``6B(``'$B``#=(@``
+M_"(``!HC``#T````````````````]````````````````/0`````````````
+M``#T````````````````]````````````````/0```````````````#T````
+M````````````]````````````````/0```````````````#T````````````
+M````]````````````````/0```````````````#T````````````````]```
+M`````````````/0```````````````#T````````````````]```````````
+M`````/0```````````````#T````````````````]````````````````/0`
+M``````````````#T````````````````]````````````````/0`````````
+M``````#T````````````````]````````````````/0```````````````#T
+M````````````````````````````"@``,20`-R0`."0`2"0`9V22..(``!QK
+M(```BR```+H@``#/(```UR```.H@``#U(```"R$``!0A```H(0``,2$``$4A
+M``!.(0``:R$``',A``"+(0``E2$``*PA``#!(0``6B(``'$B``#\(@``!",`
+M`!HC```E(P``:",``&PC``"/(P``E",``*HC``"O(P``_2,```4D```U)```
+M/20``%LD``!E)```RB0``,XD``#/)```UB0``-HD```+)0``)24``"PE``!*
+M)0``9"4``)(E``"F)0``YB4``.XE```2)@``'B8``$(F``!-)@``;28``'0F
+M``"4)@``G28``,8F``#.)@``\R8``/PF```D)P``/R<``&(G``!H)P``BB<`
+M`)0G``"V)P``OB<``-\G``#Q)P``Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_HS^C/
+MZ,_HS^C/Z,_HS^C/Z+;HMNC/Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_H
+MS^C/,!5H at 1-L`!9HDCCB`#8(@4(J`4-*$@!/2@,`44H#`&%*$@!M2`D$<&@`
+M````<T@)!``P%6B!$VP`%FB2..(`-0B!0BH!0TH2`$]*`P!12@,`84H2`&U(
+M"01P:`````!S2`D$`"T5:($3;``6:)(XX@!"*@%#2A(`3TH#`%%*`P!A2A(`
+M;4@)!'!H`````'-("00`2!HC``!+(P``:",``(\C``"J(P``_2,``#4D``!;
+M)```?R0``+(D``#E)```^B0```(E```E)0``2B4``%TE``"2)0``T24``.8E
+M```2)@``0B8``&TF``"4)@``QB8``/,F```D)P``."<``&(G``"*)P``]```
+M`````````````/0```````````````#T````````````````]```````````
+M`````/0```````````````#T````````````````]````````````````/0`
+M``````````````#T````````````````]````````````````/0`````````
+M``````#T````````````````]````````````````/0```````````````#T
+M````````````````]````````````````/0```````````````#T````````
+M````````]````````````````/0```````````````#T````````````````
+M]````````````````/0```````````````#T````````````````]```````
+M`````````/0```````````````#T````````````````]```````````````
+M``````````````H``#$D`#<D`#@D`$@D`&=DDCCB```<BB<``+8G``#?)P``
+MYB<``/$G```7*```12@``(4H``":*```O2@``-XH```)*0``+2D``$,I``!I
+M*0``D2D``,8I``#C*0``#"H``"<J``!2*@``;"H``(XJ``"X*@``U2H``/4J
+M```4*P``/"L``&TK``#T````````````````]````````````````/0`````
+M``````````#T````````````````]````````````````/0`````````````
+M``#T````````````````]````````````````/0```````````````#T````
+M````````````]````````````````/0```````````````#T````````````
+M````]````````````````/0```````````````#T````````````````]```
+M`````````````/0```````````````#T````````````````]```````````
+M`````/0```````````````#T````````````````]````````````````/0`
+M``````````````#T````````````````]````````````````/0`````````
+M``````#T````````````````````````````"@``,20`-R0`."0`2"0`9V22
+M..(``!SQ)P``%R@``"(H``!%*```6B@``(8H``"?*```O2@``,(H``#>*```
+MXB@```DI```1*0``+2D``$DI``!I*0``?"D``)$I``"D*0``QBD``,XI``#C
+M*0``ZRD```PJ```4*@``)RH``"XJ``!2*@``<"H``(XJ``"8*@``N"H``+\J
+M``#5*@``W"H``/4J``#]*@``%"L``!PK```\*P``2RL``&TK``"`*P``G"L`
+M`+(K``#=*P``Y2L```(L```4+```*"P``#$L``!5+```Y2P``,PM``#G+0``
+MU2X``$PO``!-+P``3B\``.C/Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_H
+MS^C/Z,_HS^C/Z,_HS^C/Z,_HS^C/Z,_HN.BXZ+0`````````````````````
+M````````````````````````````````````````````````````````````
+M```````&%FB2..(``"T5:($3;``6:)(XX@!"*@)#2A(`3TH#`%%*`P!A2A(`
+M;4@)!'!H``#_`'-("00P%6B!$VP`%FB2..(`-0B!0BH!0TH2`$]*`P!12@,`
+M84H2`&U("01P:`````!S2`D$`"T5:($3;``6:)(XX@!"*@%#2A(`3TH#`%%*
+M`P!A2A(`;4@)!'!H`````'-("00`.FTK``"<*P``I2L``-TK```"+```*"P`
+M`%4L``!6+```=RP``'@L``"O+```Y2P``.8L```@+0``?"T``+ at M``#G+0``
+MB"X``,4N``#K+@``["X``$PO``!-+P``3B\``/0```````````````#T````
+M````````````]````````````````/0```````````````#T````````````
+M````]````````````````/0```````````````#T````````````````]```
+M`````````````/0```````````````#T````````````````]```````````
+M`````/0```````````````#T````````````````]````````````````/0`
+M``````````````#T````````````````]````````````````/0`````````
+M``````#T````````````````]````````````````/(```````````````#R
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M`````````````````0````H``#$D`#<D`#@D`$@D`&=DDCCB```7.``2,``=
+M,`(<4`$`.G"2..(`'[#(02"P?2XAL#<"(K`W`B.0-P(DD#<");```!>P```8
+ML```"U`"`%@C``P``P```2P!+``````)3`U/_\__S0E^#8$#905[`^```@``
+M`$@`2``````"V`(H``$```!D`````0`#`P,````!?_\``0`!````````````
+M````:`@`&0&0```````@```````````````````````````````````\/WAM
+M;"!V97)S:6]N/2(Q+C`B(&5N8V]D:6YG/2)55$8M."(_/@H\(41/0U194$4@
+M<&QI<W0 at 4%5"3$E#("(M+R]!<'!L92!#;VUP=71E<B\O1%1$(%!,25-4(#$N
+M,"\O14XB(")H='1P.B\O=W=W+F%P<&QE+F-O;2]$5$1S+U!R;W!E<G1Y3&ES
+M="TQ+C`N9'1D(CX*/'!L:7-T('9E<G-I;VX](C$N,"(^"CQD:6-T/@H)/&ME
+M>3YC;VTN87!P;&4N<')I;G0N4&%G949O<FUA="Y&;W)M871T:6YG4')I;G1E
+M<CPO:V5Y/@H)/&1I8W0^"@D)/&ME>3YC;VTN87!P;&4N<')I;G0N=&EC:V5T
+M+F-R96%T;W(\+VME>3X*"0D\<W1R:6YG/F-O;2YA<'!L92YP<FEN=&EN9VUA
+M;F%G97(\+W-T<FEN9SX*"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N
+M:71E;4%R<F%Y/"]K97D^"@D)/&%R<F%Y/@H)"0D\9&EC=#X*"0D)"3QK97D^
+M8V]M+F%P<&QE+G!R:6YT+E!A9V5&;W)M870N1F]R;6%T=&EN9U!R:6YT97(\
+M+VME>3X*"0D)"3QS=')I;F<^;&%S97)?-34P,%]O;E]H<#4U,#`N8V]M<&)I
+M;RYD=6YD964N86,N=6L\+W-T<FEN9SX*"0D)"3QK97D^8V]M+F%P<&QE+G!R
+M:6YT+G1I8VME="YC;&EE;G0\+VME>3X*"0D)"3QS=')I;F<^8V]M+F%P<&QE
+M+G!R:6YT:6YG;6%N86=E<CPO<W1R:6YG/@H)"0D)/&ME>3YC;VTN87!P;&4N
+M<')I;G0N=&EC:V5T+FUO9$1A=&4\+VME>3X*"0D)"3QD871E/C(P,#<M,3`M
+M,#E4,3`Z-#@Z,S):/"]D871E/@H)"0D)/&ME>3YC;VTN87!P;&4N<')I;G0N
+M=&EC:V5T+G-T871E1FQA9SPO:V5Y/@H)"0D)/&EN=&5G97(^,#PO:6YT96=E
+M<CX*"0D)/"]D:6-T/@H)"3PO87)R87D^"@D\+V1I8W0^"@D\:V5Y/F-O;2YA
+M<'!L92YP<FEN="Y086=E1F]R;6%T+E!-2&]R:7IO;G1A;%)E<SPO:V5Y/@H)
+M/&1I8W0^"@D)/&ME>3YC;VTN87!P;&4N<')I;G0N=&EC:V5T+F-R96%T;W(\
+M+VME>3X*"0D\<W1R:6YG/F-O;2YA<'!L92YP<FEN=&EN9VUA;F%G97(\+W-T
+M<FEN9SX*"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N:71E;4%R<F%Y
+M/"]K97D^"@D)/&%R<F%Y/@H)"0D\9&EC=#X*"0D)"3QK97D^8V]M+F%P<&QE
+M+G!R:6YT+E!A9V5&;W)M870N4$U(;W)I>F]N=&%L4F5S/"]K97D^"@D)"0D\
+M<F5A;#XS,#`\+W)E86P^"@D)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K
+M970N8VQI96YT/"]K97D^"@D)"0D\<W1R:6YG/F-O;2YA<'!L92YP<FEN=&EN
+M9VUA;F%G97(\+W-T<FEN9SX*"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I
+M8VME="YM;V1$871E/"]K97D^"@D)"0D\9&%T93XR,#`W+3$P+3`Y5#$P.C0X
+M.C$S6CPO9&%T93X*"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YS
+M=&%T949L86<\+VME>3X*"0D)"3QI;G1E9V5R/C`\+VEN=&5G97(^"@D)"3PO
+M9&EC=#X*"0D\+V%R<F%Y/@H)/"]D:6-T/@H)/&ME>3YC;VTN87!P;&4N<')I
+M;G0N4&%G949O<FUA="Y034]R:65N=&%T:6]N/"]K97D^"@D\9&EC=#X*"0D\
+M:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N8W)E871O<CPO:V5Y/@H)"3QS
+M=')I;F<^8V]M+F%P<&QE+G!R:6YT:6YG;6%N86=E<CPO<W1R:6YG/@H)"3QK
+M97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YI=&5M07)R87D\+VME>3X*"0D\
+M87)R87D^"@D)"3QD:6-T/@H)"0D)/&ME>3YC;VTN87!P;&4N<')I;G0N4&%G
+M949O<FUA="Y034]R:65N=&%T:6]N/"]K97D^"@D)"0D\:6YT96=E<CXR/"]I
+M;G1E9V5R/@H)"0D)/&ME>3YC;VTN87!P;&4N<')I;G0N=&EC:V5T+F-L:65N
+M=#PO:V5Y/@H)"0D)/'-T<FEN9SYC;VTN87!P;&4N<')I;G1I;F=M86YA9V5R
+M/"]S=')I;F<^"@D)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N;6]D
+M1&%T93PO:V5Y/@H)"0D)/&1A=&4^,C`P-RTQ,"TP.50Q,#HT.#HS,EH\+V1A
+M=&4^"@D)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N<W1A=&5&;&%G
+M/"]K97D^"@D)"0D\:6YT96=E<CXP/"]I;G1E9V5R/@H)"0D\+V1I8W0^"@D)
+M/"]A<G)A>3X*"3PO9&EC=#X*"3QK97D^8V]M+F%P<&QE+G!R:6YT+E!A9V5&
+M;W)M870N4$U38V%L:6YG/"]K97D^"@D\9&EC=#X*"0D\:V5Y/F-O;2YA<'!L
+M92YP<FEN="YT:6-K970N8W)E871O<CPO:V5Y/@H)"3QS=')I;F<^8V]M+F%P
+M<&QE+G!R:6YT:6YG;6%N86=E<CPO<W1R:6YG/@H)"3QK97D^8V]M+F%P<&QE
+M+G!R:6YT+G1I8VME="YI=&5M07)R87D\+VME>3X*"0D\87)R87D^"@D)"3QD
+M:6-T/@H)"0D)/&ME>3YC;VTN87!P;&4N<')I;G0N4&%G949O<FUA="Y035-C
+M86QI;F<\+VME>3X*"0D)"3QR96%L/C$\+W)E86P^"@D)"0D\:V5Y/F-O;2YA
+M<'!L92YP<FEN="YT:6-K970N8VQI96YT/"]K97D^"@D)"0D\<W1R:6YG/F-O
+M;2YA<'!L92YP<FEN=&EN9VUA;F%G97(\+W-T<FEN9SX*"0D)"3QK97D^8V]M
+M+F%P<&QE+G!R:6YT+G1I8VME="YM;V1$871E/"]K97D^"@D)"0D\9&%T93XR
+M,#`W+3$P+3`Y5#$P.C0X.C,R6CPO9&%T93X*"0D)"3QK97D^8V]M+F%P<&QE
+M+G!R:6YT+G1I8VME="YS=&%T949L86<\+VME>3X*"0D)"3QI;G1E9V5R/C`\
+M+VEN=&5G97(^"@D)"3PO9&EC=#X*"0D\+V%R<F%Y/@H)/"]D:6-T/@H)/&ME
+M>3YC;VTN87!P;&4N<')I;G0N4&%G949O<FUA="Y0359E<G1I8V%L4F5S/"]K
+M97D^"@D\9&EC=#X*"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N8W)E
+M871O<CPO:V5Y/@H)"3QS=')I;F<^8V]M+F%P<&QE+G!R:6YT:6YG;6%N86=E
+M<CPO<W1R:6YG/@H)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YI=&5M
+M07)R87D\+VME>3X*"0D\87)R87D^"@D)"3QD:6-T/@H)"0D)/&ME>3YC;VTN
+M87!P;&4N<')I;G0N4&%G949O<FUA="Y0359E<G1I8V%L4F5S/"]K97D^"@D)
+M"0D\<F5A;#XS,#`\+W)E86P^"@D)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT
+M:6-K970N8VQI96YT/"]K97D^"@D)"0D\<W1R:6YG/F-O;2YA<'!L92YP<FEN
+M=&EN9VUA;F%G97(\+W-T<FEN9SX*"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT
+M+G1I8VME="YM;V1$871E/"]K97D^"@D)"0D\9&%T93XR,#`W+3$P+3`Y5#$P
+M.C0X.C$S6CPO9&%T93X*"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME
+M="YS=&%T949L86<\+VME>3X*"0D)"3QI;G1E9V5R/C`\+VEN=&5G97(^"@D)
+M"3PO9&EC=#X*"0D\+V%R<F%Y/@H)/"]D:6-T/@H)/&ME>3YC;VTN87!P;&4N
+M<')I;G0N4&%G949O<FUA="Y0359E<G1I8V%L4V-A;&EN9SPO:V5Y/@H)/&1I
+M8W0^"@D)/&ME>3YC;VTN87!P;&4N<')I;G0N=&EC:V5T+F-R96%T;W(\+VME
+M>3X*"0D\<W1R:6YG/F-O;2YA<'!L92YP<FEN=&EN9VUA;F%G97(\+W-T<FEN
+M9SX*"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N:71E;4%R<F%Y/"]K
+M97D^"@D)/&%R<F%Y/@H)"0D\9&EC=#X*"0D)"3QK97D^8V]M+F%P<&QE+G!R
+M:6YT+E!A9V5&;W)M870N4$U697)T:6-A;%-C86QI;F<\+VME>3X*"0D)"3QR
+M96%L/C$\+W)E86P^"@D)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N
+M8VQI96YT/"]K97D^"@D)"0D\<W1R:6YG/F-O;2YA<'!L92YP<FEN=&EN9VUA
+M;F%G97(\+W-T<FEN9SX*"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME
+M="YM;V1$871E/"]K97D^"@D)"0D\9&%T93XR,#`W+3$P+3`Y5#$P.C0X.C,R
+M6CPO9&%T93X*"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YS=&%T
+M949L86<\+VME>3X*"0D)"3QI;G1E9V5R/C`\+VEN=&5G97(^"@D)"3PO9&EC
+M=#X*"0D\+V%R<F%Y/@H)/"]D:6-T/@H)/&ME>3YC;VTN87!P;&4N<')I;G0N
+M<W5B5&EC:V5T+G!A<&5R7VEN9F]?=&EC:V5T/"]K97D^"@D\9&EC=#X*"0D\
+M:V5Y/F-O;2YA<'!L92YP<FEN="Y086=E1F]R;6%T+E!-061J=7-T961086=E
+M4F5C=#PO:V5Y/@H)"3QD:6-T/@H)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT
+M:6-K970N8W)E871O<CPO:V5Y/@H)"0D\<W1R:6YG/F-O;2YA<'!L92YP<FEN
+M=&EN9VUA;F%G97(\+W-T<FEN9SX*"0D)/&ME>3YC;VTN87!P;&4N<')I;G0N
+M=&EC:V5T+FET96U!<G)A>3PO:V5Y/@H)"0D\87)R87D^"@D)"0D\9&EC=#X*
+M"0D)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="Y086=E1F]R;6%T+E!-061J=7-T
+M961086=E4F5C=#PO:V5Y/@H)"0D)"3QA<G)A>3X*"0D)"0D)/')E86P^,"XP
+M/"]R96%L/@H)"0D)"0D\<F5A;#XP+C`\+W)E86P^"@D)"0D)"3QR96%L/C(S
+M-SDN-3`P,#<Q,C`W-C at R-CPO<F5A;#X*"0D)"0D)/')E86P^,S0P-BXT.3DY
+M.#DX,C<T-S0Q/"]R96%L/@H)"0D)"3PO87)R87D^"@D)"0D)/&ME>3YC;VTN
+M87!P;&4N<')I;G0N=&EC:V5T+F-L:65N=#PO:V5Y/@H)"0D)"3QS=')I;F<^
+M8V]M+F%P<&QE+G!R:6YT:6YG;6%N86=E<CPO<W1R:6YG/@H)"0D)"3QK97D^
+M8V]M+F%P<&QE+G!R:6YT+G1I8VME="YM;V1$871E/"]K97D^"@D)"0D)/&1A
+M=&4^,C`P-RTQ,"TP.50Q,#HT.#HS,EH\+V1A=&4^"@D)"0D)/&ME>3YC;VTN
+M87!P;&4N<')I;G0N=&EC:V5T+G-T871E1FQA9SPO:V5Y/@H)"0D)"3QI;G1E
+M9V5R/C`\+VEN=&5G97(^"@D)"0D\+V1I8W0^"@D)"3PO87)R87D^"@D)/"]D
+M:6-T/@H)"3QK97D^8V]M+F%P<&QE+G!R:6YT+E!A9V5&;W)M870N4$U!9&IU
+M<W1E9%!A<&5R4F5C=#PO:V5Y/@H)"3QD:6-T/@H)"0D\:V5Y/F-O;2YA<'!L
+M92YP<FEN="YT:6-K970N8W)E871O<CPO:V5Y/@H)"0D\<W1R:6YG/F-O;2YA
+M<'!L92YP<FEN=&EN9VUA;F%G97(\+W-T<FEN9SX*"0D)/&ME>3YC;VTN87!P
+M;&4N<')I;G0N=&EC:V5T+FET96U!<G)A>3PO:V5Y/@H)"0D\87)R87D^"@D)
+M"0D\9&EC=#X*"0D)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="Y086=E1F]R;6%T
+M+E!-061J=7-T961087!E<E)E8W0\+VME>3X*"0D)"0D\87)R87D^"@D)"0D)
+M"3QR96%L/BTT.2XV-C8U.34T-3 at Y.#0S-S4\+W)E86P^"@D)"0D)"3QR96%L
+M/BTU,2XS,S,S-C,X-3`Y,3$T-C$\+W)E86P^"@D)"0D)"3QR96%L/C(T,CDN
+M-3`P,#<Q,C`W-C at R-CPO<F5A;#X*"0D)"0D)/')E86P^,S0U-BXY.3DY-CDT
+M.#(T,C(S/"]R96%L/@H)"0D)"3PO87)R87D^"@D)"0D)/&ME>3YC;VTN87!P
+M;&4N<')I;G0N=&EC:V5T+F-L:65N=#PO:V5Y/@H)"0D)"3QS=')I;F<^8V]M
+M+F%P<&QE+G!R:6YT:6YG;6%N86=E<CPO<W1R:6YG/@H)"0D)"3QK97D^8V]M
+M+F%P<&QE+G!R:6YT+G1I8VME="YM;V1$871E/"]K97D^"@D)"0D)/&1A=&4^
+M,C`P-RTQ,"TP.50Q,#HT.#HS,EH\+V1A=&4^"@D)"0D)/&ME>3YC;VTN87!P
+M;&4N<')I;G0N=&EC:V5T+G-T871E1FQA9SPO:V5Y/@H)"0D)"3QI;G1E9V5R
+M/C`\+VEN=&5G97(^"@D)"0D\+V1I8W0^"@D)"3PO87)R87D^"@D)/"]D:6-T
+M/@H)"3QK97D^8V]M+F%P<&QE+G!R:6YT+E!A<&5R26YF;RY034-U<W1O;5!A
+M<&5R/"]K97D^"@D)/&1I8W0^"@D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I
+M8VME="YC<F5A=&]R/"]K97D^"@D)"3QS=')I;F<^8V]M+F%P<&QE+G!R:6YT
+M:6YG;6%N86=E<CPO<W1R:6YG/@H)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT
+M:6-K970N:71E;4%R<F%Y/"]K97D^"@D)"3QA<G)A>3X*"0D)"3QD:6-T/@H)
+M"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+E!A<&5R26YF;RY034-U<W1O;5!A
+M<&5R/"]K97D^"@D)"0D)/&9A;'-E+SX*"0D)"0D\:V5Y/F-O;2YA<'!L92YP
+M<FEN="YT:6-K970N8VQI96YT/"]K97D^"@D)"0D)/'-T<FEN9SYC;VTN87!P
+M;&4N<')I;G1I;F=M86YA9V5R/"]S=')I;F<^"@D)"0D)/&ME>3YC;VTN87!P
+M;&4N<')I;G0N=&EC:V5T+FUO9$1A=&4\+VME>3X*"0D)"0D\9&%T93XR,#`W
+M+3$P+3`Y5#$P.C0X.C,R6CPO9&%T93X*"0D)"0D\:V5Y/F-O;2YA<'!L92YP
+M<FEN="YT:6-K970N<W1A=&5&;&%G/"]K97D^"@D)"0D)/&EN=&5G97(^,3PO
+M:6YT96=E<CX*"0D)"3PO9&EC=#X*"0D)/"]A<G)A>3X*"0D\+V1I8W0^"@D)
+M/&ME>3YC;VTN87!P;&4N<')I;G0N4&%P97));F9O+E!-4&%P97).86UE/"]K
+M97D^"@D)/&1I8W0^"@D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YC
+M<F5A=&]R/"]K97D^"@D)"3QS=')I;F<^8V]M+F%P<&QE+G!R:6YT:6YG;6%N
+M86=E<CPO<W1R:6YG/@H)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N
+M:71E;4%R<F%Y/"]K97D^"@D)"3QA<G)A>3X*"0D)"3QD:6-T/@H)"0D)"3QK
+M97D^8V]M+F%P<&QE+G!R:6YT+E!A<&5R26YF;RY035!A<&5R3F%M93PO:V5Y
+M/@H)"0D)"3QS=')I;F<^:7-O+6$T/"]S=')I;F<^"@D)"0D)/&ME>3YC;VTN
+M87!P;&4N<')I;G0N=&EC:V5T+F-L:65N=#PO:V5Y/@H)"0D)"3QS=')I;F<^
+M8V]M+F%P<&QE+G!R:6YT:6YG;6%N86=E<CPO<W1R:6YG/@H)"0D)"3QK97D^
+M8V]M+F%P<&QE+G!R:6YT+G1I8VME="YM;V1$871E/"]K97D^"@D)"0D)/&1A
+M=&4^,C`P-RTQ,"TP.50Q,#HT.#HS,EH\+V1A=&4^"@D)"0D)/&ME>3YC;VTN
+M87!P;&4N<')I;G0N=&EC:V5T+G-T871E1FQA9SPO:V5Y/@H)"0D)"3QI;G1E
+M9V5R/C$\+VEN=&5G97(^"@D)"0D\+V1I8W0^"@D)"3PO87)R87D^"@D)/"]D
+M:6-T/@H)"3QK97D^8V]M+F%P<&QE+G!R:6YT+E!A<&5R26YF;RY0355N861J
+M=7-T961086=E4F5C=#PO:V5Y/@H)"3QD:6-T/@H)"0D\:V5Y/F-O;2YA<'!L
+M92YP<FEN="YT:6-K970N8W)E871O<CPO:V5Y/@H)"0D\<W1R:6YG/F-O;2YA
+M<'!L92YP<FEN=&EN9VUA;F%G97(\+W-T<FEN9SX*"0D)/&ME>3YC;VTN87!P
+M;&4N<')I;G0N=&EC:V5T+FET96U!<G)A>3PO:V5Y/@H)"0D\87)R87D^"@D)
+M"0D\9&EC=#X*"0D)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="Y087!E<DEN9F\N
+M4$U5;F%D:G5S=&5D4&%G95)E8W0\+VME>3X*"0D)"0D\87)R87D^"@D)"0D)
+M"3QR96%L/C`N,#PO<F5A;#X*"0D)"0D)/')E86P^,"XP/"]R96%L/@H)"0D)
+M"0D\<F5A;#XX,3<N-34Y.3DW-34X-3DS-S4\+W)E86P^"@D)"0D)"3QR96%L
+M/C4W,2XP.#`P,3<P.#DX-#,W-3PO<F5A;#X*"0D)"0D\+V%R<F%Y/@H)"0D)
+M"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YC;&EE;G0\+VME>3X*"0D)
+M"0D\<W1R:6YG/F-O;2YA<'!L92YP<FEN=&EN9VUA;F%G97(\+W-T<FEN9SX*
+M"0D)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N;6]D1&%T93PO:V5Y
+M/@H)"0D)"3QD871E/C(P,#<M,3`M,#E4,3`Z-#@Z,S):/"]D871E/@H)"0D)
+M"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YS=&%T949L86<\+VME>3X*
+M"0D)"0D\:6YT96=E<CXQ/"]I;G1E9V5R/@H)"0D)/"]D:6-T/@H)"0D\+V%R
+M<F%Y/@H)"3PO9&EC=#X*"0D\:V5Y/F-O;2YA<'!L92YP<FEN="Y087!E<DEN
+M9F\N4$U5;F%D:G5S=&5D4&%P97)296-T/"]K97D^"@D)/&1I8W0^"@D)"3QK
+M97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YC<F5A=&]R/"]K97D^"@D)"3QS
+M=')I;F<^8V]M+F%P<&QE+G!R:6YT:6YG;6%N86=E<CPO<W1R:6YG/@H)"0D\
+M:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N:71E;4%R<F%Y/"]K97D^"@D)
+M"3QA<G)A>3X*"0D)"3QD:6-T/@H)"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT
+M+E!A<&5R26YF;RY0355N861J=7-T961087!E<E)E8W0\+VME>3X*"0D)"0D\
+M87)R87D^"@D)"0D)"3QR96%L/BTQ,BXS,C`P,#<S,C0R,3 at W-3PO<F5A;#X*
+M"0D)"0D)/')E86P^+3$R/"]R96%L/@H)"0D)"0D\<F5A;#XX,CDN-C<Y.3DR
+M-C<U-S at Q,C4\+W)E86P^"@D)"0D)"3QR96%L/C4X,SPO<F5A;#X*"0D)"0D\
+M+V%R<F%Y/@H)"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YC;&EE
+M;G0\+VME>3X*"0D)"0D\<W1R:6YG/F-O;2YA<'!L92YP<FEN=&EN9VUA;F%G
+M97(\+W-T<FEN9SX*"0D)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N
+M;6]D1&%T93PO:V5Y/@H)"0D)"3QD871E/C(P,#<M,3`M,#E4,3`Z-#@Z,S):
+M/"]D871E/@H)"0D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YS=&%T
+M949L86<\+VME>3X*"0D)"0D\:6YT96=E<CXQ/"]I;G1E9V5R/@H)"0D)/"]D
+M:6-T/@H)"0D\+V%R<F%Y/@H)"3PO9&EC=#X*"0D\:V5Y/F-O;2YA<'!L92YP
+M<FEN="Y087!E<DEN9F\N<'!D+E!-4&%P97).86UE/"]K97D^"@D)/&1I8W0^
+M"@D)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="YC<F5A=&]R/"]K97D^
+M"@D)"3QS=')I;F<^8V]M+F%P<&QE+G!R:6YT:6YG;6%N86=E<CPO<W1R:6YG
+M/@H)"0D\:V5Y/F-O;2YA<'!L92YP<FEN="YT:6-K970N:71E;4%R<F%Y/"]K
+M97D^"@D)"3QA<G)A>3X*"0D)"3QD:6-T/@H)"0D)"3QK97D^8V]M+F%P<&QE
+M+G!R:6YT+E!A<&5R26YF;RYP<&0N4$U087!E<DYA;64\+VME>3X*"0D)"0D\
+M<W1R:6YG/D$T/"]S=')I;F<^"@D)"0D)/&ME>3YC;VTN87!P;&4N<')I;G0N
+M=&EC:V5T+F-L:65N=#PO:V5Y/@H)"0D)"3QS=')I;F<^8V]M+F%P<&QE+G!R
+M:6YT:6YG;6%N86=E<CPO<W1R:6YG/@H)"0D)"3QK97D^8V]M+F%P<&QE+G!R
+M:6YT+G1I8VME="YM;V1$871E/"]K97D^"@D)"0D)/&1A=&4^,C`P-RTQ,"TP
+M.50Q,#HT.#HS,EH\+V1A=&4^"@D)"0D)/&ME>3YC;VTN87!P;&4N<')I;G0N
+M=&EC:V5T+G-T871E1FQA9SPO:V5Y/@H)"0D)"3QI;G1E9V5R/C$\+VEN=&5G
+M97(^"@D)"0D\+V1I8W0^"@D)"3PO87)R87D^"@D)/"]D:6-T/@H)"3QK97D^
+M8V]M+F%P<&QE+G!R:6YT+G1I8VME="Y!4$E697)S:6]N/"]K97D^"@D)/'-T
+M<FEN9SXP,"XR,#PO<W1R:6YG/@H)"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I
+M8VME="YP<FEV871E3&]C:SPO:V5Y/@H)"3QF86QS92\^"@D)/&ME>3YC;VTN
+M87!P;&4N<')I;G0N=&EC:V5T+G1Y<&4\+VME>3X*"0D\<W1R:6YG/F-O;2YA
+M<'!L92YP<FEN="Y087!E<DEN9F]4:6-K970\+W-T<FEN9SX*"3PO9&EC=#X*
+M"3QK97D^8V]M+F%P<&QE+G!R:6YT+G1I8VME="Y!4$E697)S:6]N/"]K97D^
+M"@D\<W1R:6YG/C`P+C(P/"]S=')I;F<^"@D\:V5Y/F-O;2YA<'!L92YP<FEN
+M="YT:6-K970N<')I=F%T94QO8VL\+VME>3X*"3QF86QS92\^"@D\:V5Y/F-O
+M;2YA<'!L92YP<FEN="YT:6-K970N='EP93PO:V5Y/@H)/'-T<FEN9SYC;VTN
+M87!P;&4N<')I;G0N4&%G949O<FUA=%1I8VME=#PO<W1R:6YG/@H\+V1I8W0^
+M"CPO<&QI<W0^"@``````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````%``0`!(``0"E``\``@``
+M`````````#P``$#Q_P(`/``,````````````!@!.`&\`<@!M`&$`;`````(`
+M```4`$-*&`!A2A@`;4@)"'-("0AT2`D$5``!0`$``@!4``P```!\/60````)
+M`$@`90!A`&0`:0!N`&<`(``Q````$``!``8D`1.D\``4I#P`0"8`%P`U"(%#
+M2B``2T@@`$]*`@!12@(`84H@``!2``)``0`"`%(`#````'P]9`````D`2`!E
+M`&$`9`!I`&X`9P`@`#(````0``(`!B0!$Z3P`!2D/`!`)@$6`#4(@38(@4-*
+M'`!/2@(`44H"`&%*'`!0``-``0`"`%``#````'P]9`````D`2`!E`&$`9`!I
+M`&X`9P`@`#,````0``,`!B0!$Z3P`!2D/`!`)@(3`#4(@4-*&@!/2@(`44H"
+M`&%*&@``2``$0`$``@!(``P```!\/60````)`$@`90!A`&0`:0!N`&<`(``T
+M````$``$``8D`1.D\``4I#P`0"8#"P`U"(%#2AP`84H<````````/@`'0`$`
+M`@`^``P```#/*_(````)`$@`90!A`&0`:0!N`&<`(``W````#0`'`!.D\``4
+MI#P`0"8&``,`- at B!`$8`"$`!``(`1@`,````/EBJ````"0!(`&4`80!D`&D`
+M;@!G`"``.`````T`"``3I/``%*0\`$`F!P`+`#8(@5!*!`!?2`$$````1`!!
+M0/+_H0!$``P!``!\/60````6`$0`90!F`&$`=0!L`'0`(`!0`&$`<@!A`&<`
+M<@!A`'``:``@`$8`;P!N`'0``````%(`:0#S_[,`4@`,`0``````````#`!4
+M`&$`8@!L`&4`(`!.`&\`<@!M`&$`;````!P`%_8#```TU at 8``0H#;``TU at 8`
+M`04#``!A]@,```(`"P```"@`:P#T_\$`*````0``````````!P!.`&\`(`!,
+M`&D`<P!T`````@````````!$`)D``0#R`$0`#`$``&U`C0````P`0@!A`&P`
+M;`!O`&\`;@`@`%0`90!X`'0````"``\`$`!#2A(`3TH%`%%*!0!A2A(`````
+M`$XI```%``!2```%`#I2```"````!"(``/__`0`/4',````````B``#__P(`
+M#U!S````````````NP<``,<.```:%0``K1L``(8B``!.*0`````````"````
+M``$"```P``("`0`````"`0````$"`0````("``````<````5````1````$4`
+M``!-````B0```"`!```8`@``5@(``)4"``#&`@``_0(``#\#``!]`P``O`,`
+M`/8#````!```.`0``&P$``":!```T at 0``.H$```I!0``7 at 4``&\%``"J!0``
+MY`4```L&```:!@``3 at 8``(D&``#(!@``!@<``#4'``!O!P``K@<``+H'``#>
+M!P``&P@``$`(``!>"```<0@``"H)```S"0``80D``)P)``#9"0``%0H``$X*
+M``!W"@``BPH``)L*``#5"@``!`L``",+```V"P``5 at L``&P+``"'"P``P`L`
+M`.P+```I#```8PP``(H,``"?#```V0P``!D-```?#0``20T``'0-``"(#0``
+MO0T``.L-```'#@``-PX``$8.``!Z#@``B`X``+4.``#&#@``W`X```80```;
+M$```EA```,T0```*$0``*A$``%T1``"9$0``IQ$``+X1``#2$0``\!$```\2
+M```Q$@``7A(``((2``"M$@``PQ(``/`2```6$P``+A,``(H3``"A$P``MA,`
+M`-H3```(%```(Q0``$\4``""%```GQ0``,<4``#K%```&14``$H5``!R%0``
+ME14``+D5``#E%0``$A8``#D6``!A%@``B18``*\6``#0%@``[A8``!D7```Y
+M%P``61<``(T7``"U%P``W!<``/D7```?&```3A@``&@8``")&```JA@``,H8
+M``#J&```#AD``#\9``!J&0``CAD``,`9``#?&0``_QD``"(:``!)&@``81H`
+M`(L:``"Q&@``SQH``.H:```+&P``*!L``$4;``!K&P``BQL``*P;``#!&P``
+M^AL``%H<``!Q'```W1P``/P<```:'0``2QT``&@=``"/'0``JAT``/T=```U
+M'@``6QX``'\>``"R'@``Y1X``/H>```"'P``)1\``$H?``!='P``DA\``-$?
+M``#F'P``$B```$(@``!M(```E"```,8@``#S(```)"$``#@A``!B(0``BB$`
+M`+8A``#?(0``YB$``/$A```7(@``12(``(4B``":(@``O2(``-XB```)(P``
+M+2,``$,C``!I(P``D2,``,8C``#C(P``#"0``"<D``!2)```;"0``(XD``"X
+M)```U20``/4D```4)0``/"4``&TE``"<)0``I24``-TE```")@``*"8``%4F
+M``!6)@``=R8``'@F``"O)@``Y28``.8F```@)P``?"<``+ at G``#G)P``B"@`
+M`,4H``#K*```["@``$PI``!-*0``4"D``)@`````,`````````"`````@```
+M`)````#*@`"8`````#``````````@````(````"0````RH``F``````P````
+M`````(````"`````D````,J``)@`````,`````````"`````@````-@``-">
+M@`"8`````#``````````@````(````"0````RH``F``````P`````````(``
+M``"`````D````,J``)@`````,`````````"`````@````)````#*@`"8````
+M`#``````````@````(````"0````RH``F``````P`````````(````"`````
+MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#``````
+M````@````(````"0````RH``F``````P`````````(````"`````D````,J`
+M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@```
+M`(````"0````RH``F``````P`````````(````"`````D````,J``)@`````
+M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0
+M````RH``F``````P`````````(````"`````D````,J``)@`````,```````
+M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH``
+MF``````P`````````(````"`````D````,J``)@`````,`````````"`````
+M@````)````#*@`"8`````#``````````@````(````"0````RH``F``````P
+M`````````(````"`````D````,J``)@`````,`````````"`````@````)``
+M``#*@`"8`````#``````````@````(````"0````RH``F``````P````````
+M`(````"`````D````,J``)@`````,`````````"`````@````)````#*@`"8
+M`````#``````````@````(````"0````RH``F``````P`````````(````"`
+M````D````,J``)@`````,`````````"`````@````)````#*@`"8`````#``
+M````````@````(````"0````RH``F``````P`````````(````"`````D```
+M`,J``)@`````,`````````"`````@````)````#*@`"8`````#``````````
+M@````(````"0````RH``F``````P`````````(````"`````D````,J``)@`
+M````,`````````"`````@````)````#*@`"8`````#``````````@````(``
+M``"0````RH``F``````P`````````(````"`````D````,J``)@`````,```
+M``````"`````@````)````#*@`"8`````#``````````@````(````"0````
+MRH``F``````P`````````(````"`````D````,J``)@`````,`````````"`
+M````@````)````#*@`"8`````#``````````@````(````"0````RH``F```
+M```P`````````(````"`````D````,J``)@`````,`````````"`````@```
+M`)````#*@`"8`````#``````````@````(````"0````RH``F``````P````
+M`````(````"`````D````,J``)@`````,`````````"`````@````)````#*
+M@`"8`````#``````````@````(````"0````RH``F``````P`````````(``
+M``"`````D````,J``)@`````,`````````"`````@````)````#*@`"8````
+M`#``````````@````(````"0````RH``F``````P`````````(````"`````
+MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#``````
+M````@````(````"0````RH``F``````P`````````(````"`````D````,J`
+M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@```
+M`(````"0````RH``F``````P`````````(````"`````D````,J``)@`````
+M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0
+M````RH``F``````P`````````(````"`````D````,J``)@`````,```````
+M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH``
+MF``````P`````````(````"`````D````,J``)@`````,`````````"`````
+M@````)````#*@`"8`````#``````````@````(````"0````RH``F``````P
+M`````````(````"`````D````,J``)@`````,`````````"`````@````)``
+M``#*@`"8`````#``````````@````(````"0````RH``F``````P````````
+M`(````"`````D````,J``)@`````,`````````"`````@````)````#*@`"8
+M`````#``````````@````(````"0````RH``F``````P`````````(````"`
+M````D````,J``)@`````,`````````"`````@````)````#*@`"8`````#``
+M````````@````(````"0````RH``F``````P`````````(````"`````D```
+M`,J``)@`````,`````````"`````@````)````#*@`"8`````#``````````
+M@````(````"0````RH``F``````P`````````(````"`````D````,J``)@`
+M````,`````````"`````@````)````#*@`"8`````#``````````@````(``
+M``"0````RH``F``````P`````````(````"`````D````,J``)@`````,```
+M``````"`````@````)````#*@`"8`````#``````````@````(````"0````
+MRH``F``````P`````````(````"`````D````,J``)@`````,`````````"`
+M````@````)````#*@`"8`````#``````````@````(````"0````RH``F```
+M```P`````````(````"`````D````,J``)@`````,`````````"`````@```
+M`)````#*@`"8`````#``````````@````(````"0````RH``F``````P````
+M`````(````"`````D````,J``)@`````,`````````"`````@````)````#*
+M@`"8`````#``````````@````(````"0````RH``F``````P`````````(``
+M``"`````D````,J``)@`````,`````````"`````@````)````#*@`"8````
+M`#``````````@````(````"0````RH``F``````P`````````(````"`````
+MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#``````
+M````@````(````"0````RH``F``````P`````````(````"`````D````,J`
+M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@```
+M`(````"0````RH``F``````P`````````(````"`````D````,J``)@`````
+M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0
+M````RH``F``````P`````````(````"`````D````,J``)@`````,```````
+M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH``
+MF``````P`````````(````"`````D````,J``)@`````,`````````"`````
+M@````)````#*@`"8`````#``````````@````(````"0````RH``F``````P
+M`````````(````"`````D````,J``)@`````,`````````"`````@````)``
+M``#*@`"8`````#``````````@````(````"0````RH``F``````P````````
+M`(````"`````D````,J``)@`````,`````````"`````@````)````#*@`"8
+M`````#``````````@````(````"0````RH``F``````P`````````(````"`
+M````D````,J``)@`````,`````````"`````@````)````#*@`"8`````#``
+M````````@````(````"0````RH``F``````P`````````(````"`````D```
+M`,J``)@`````,`````````"`````@````)````#*@`"8`````#``````````
+M@````(````"0````RH``F``````P`````````(````"`````D````,J``)@`
+M````,`````````"`````@````)````#*@`"8`````#``````````@````(``
+M``"0````RH``F``````P`````````(````"`````D````,J``)@`````,```
+M``````"`````@````)````#*@`"8`````#``````````@````(````"0````
+MRH``F``````P`````````(````"`````D````,J``)@`````,`````````"`
+M````@````)````#*@`"8`````#``````````@````(````"0````RH``F```
+M```P`````````(````"`````D````,J``)@`````,`````````"`````@```
+M`)````#*@`"8`````#``````````@````(````"0````RH``F``````P````
+M`````(````"`````D````,J``)@`````,`````````"`````@````)````#*
+M@`"8`````#``````````@````(````"0````RH``F``````P`````````(``
+M``"`````D````,J``)@`````,`````````"`````@````)````#*@`"8````
+M`#``````````@````(````"0````RH``F``````P`````````(````"`````
+MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#``````
+M````@````(````"0````RH``F``````P`````````(````"`````D````,J`
+M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@```
+M`(````"0````RH``F``````P`````````(````"`````D````,J``)@`````
+M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0
+M````RH``F``````P`````````(````"`````D````,J``)@`````,```````
+M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH``
+MF``````P`````````(````"`````D````,J``)@`````,`````````"`````
+M@````)````#*@`"8`````#``````````@````(````"0````RH``F``````P
+M`````````(````"`````D````,J``)@`````,`````````"`````@````)``
+M``#*@`"8`````#``````````@````(````"0````RH``F``````P````````
+M`(````"`````D````,J``)@`````,`````````"`````@````)````#*@`"8
+M`````#``````````@````(````"0````RH``F``````P`````````(````"`
+M````D````,J``)@`````,`````````"`````@````)````#*@`"8`````#``
+M````````@````(````"0````RH``F``````P`````````(````"`````D```
+M`,J``)@`````,`````````"`````@````)````#*@`"8`````#``````````
+M@````(````"0````RH``F``````P`````````(````"`````D````,J``)@`
+M````,`````````"`````@````)````#*@`"8`````#``````````@````(``
+M``"0````RH``F``````P`````````(````"`````D````,J``)@`````,```
+M``````"`````@````)````#*@`"8`````#``````````@````(````"0````
+MRH``F``````P`````````(````"`````D````,J``)@`````,`````````"`
+M````@````)````#*@`"8`````#``````````@````(````"0````RH``F```
+M```P`````````(````"`````D````,J``)@`````,`````````"`````@```
+M`)````#*@`"8`````#``````````@````(````"0````RH``F``````P````
+M`````(````"`````D````,J``)@`````,`````````"`````@````)````#*
+M@`"8`````#``````````@````(````"0````RH``F``````P`````````(``
+M``"`````D````,J``)@`````,`````````"`````@````)````#*@`"8````
+M`#``````````@````(````"0````RH``F``````P`````````(````"`````
+MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#``````
+M````@````(````"0````RH``F``````P`````````(````"`````D````,J`
+M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@```
+M`(````"0````RH``F``````P`````````(````"`````D````,J``)@`````
+M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0
+M````RH``F``````P`````````(````"`````D````,J``)@`````,```````
+M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH``
+MF``````P`````````(````"`````D````,J``)@`````,`````````"`````
+M@````)````#*@`"8`````#``````````@````(````"0````RH``F``````P
+M`````````(````"`````D````,J``)@`````,`````````"`````@````)``
+M``#*@`"8`````#``````````@````(````"0````RH``F``````P````````
+M`(````"`````D````,J``)@`````,`````````"`````@````)````#*@`"8
+M`````#``````````@````(````"0````RH``F``````P`````````(````"`
+M````D````,J``)@`````,`````````"`````@````)````#*@`"8`````#``
+M````````@````(````"0````RH``F``````P`````````(````"`````D```
+M`,J``)@`````,`````````"`````@````)````#*@`"8`````#``````````
+M@````(````"0````RH``F``````P`````````(````"`````D````,J``)@`
+M````,`````````"`````@````)````#*@`"8`````#``````````@````(``
+M``"0````RH``F``````P`````````(````"`````D````,J``)@`````,```
+M``````"`````@````)````#*@`"8`````#``````````@````(````"0````
+MRH``F``````P`````````(````"`````D````,J``)@`````,`````````"`
+M````@````)````#*@`"8`````#``````````@````(````"0````RH``F```
+M```P`````````(````"`````D````,J``)@`````,`````````"`````@```
+M`)````#*@`"8`````#``````````@````(````"0````RH``F``````P````
+M`````(````"`````D````,J``)@`````,`````````"`````@````)````#*
+M@`"8`````#``````````@````(````"0````RH``F``````P`````````(``
+M``"`````D````,J``)@`````,`````````"`````@````-@``,"N@`"8````
+M`#``````````@````(````"0````RH``F``````P`````````(````"`````
+MD````,J``)@`````,`````````"`````@````)````#*@`"8`````#``````
+M````@````(````"0````RH``F``````P`````````(````"`````D````,J`
+M`)@`````,`````````"`````@````)````#*@`"8`````#``````````@```
+M`(````"0````RH``F``````P`````````(````"`````D````,J``)@`````
+M,`````````"`````@````)````#*@`"8`````#``````````@````(````"0
+M````RH``F``````P`````````(````"`````D````,J``)@`````,```````
+M``"`````@````)````#*@`"8`````#``````````@````(````"0````RH``
+MF``````P`````````(````"`````D````,J````````'````%0```$4```!-
+M````B0```"`!```8`@``5@(``)4"``#&`@``_0(``#\#``!]`P``O`,``/8#
+M````!```.`0``&P$``":!```T at 0``.H$```I!0``7 at 4``&\%``"J!0``Y`4`
+M``L&```:!@``3 at 8``(D&``#(!@``!@<``#4'``!O!P``K@<``+H'``#>!P``
+M&P@``$`(``!>"```<0@``"H)```S"0``80D``)P)``#9"0``%0H``$X*``!W
+M"@``BPH``)L*``#5"@``!`L``",+```V"P``5 at L``&P+``"'"P``P`L``.P+
+M```I#```8PP``(H,``"?#```V0P``!D-```?#0``20T``'0-``"(#0``O0T`
+M`.L-```'#@``-PX``$8.``!Z#@``B`X``+4.``#&#@``W`X```80```;$```
+MEA```,T0```*$0``*A$``%T1``"9$0``IQ$``+X1``#2$0``\!$```\2```Q
+M$@``7A(``((2``"M$@``PQ(``/`2```6$P``+A,``(H3``"A$P``MA,``-H3
+M```(%```(Q0``$\4``""%```GQ0``,<4``#K%```&14``$H5``!R%0``E14`
+M`+D5``#E%0``$A8``#D6``!A%@``B18``*\6``#0%@``[A8``!D7```Y%P``
+M61<``(T7``"U%P``W!<``/D7```?&```3A@``&@8``")&```JA@``,H8``#J
+M&```#AD``#\9``!J&0``CAD``,`9``#?&0``_QD``"(:``!)&@``81H``(L:
+M``"Q&@``SQH``.H:``!,*0``4"D``#@`D)EW,````-`````````&``````#_
+MOP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!.@"0F7<P````T```
+M``````8``````/^_`0"`!S@`D)EW,````-`````````&``````#_OP$`@`$X
+M`)"9=S````#0````````!@``````_[\!`(`!.@"0F7<P````T`````````8`
+M`````/^_`0"`!SH`D)EW,````-`````````&``````#_OP$`@`<X`)"9=S``
+M``#0````````!@``````_[\!`(`!.`"0F7<P````T`````````8``````/^_
+M`0"``3@`D)EW,````-`````````&``````#_OP$`@`$X`)"9=S````#0````
+M````!@``````_[\!`(`!.`"0F7<P````T`````````8``````/^_`0"``3@`
+MD)EW,````-`````````&``````#_OP$`@`$X`)"9=S````#0````````!@``
+M````_[\!`(`!.`"0F7<P````T`````````8``````/^_`0"``3@`D)EW,```
+M`-`````````&``````#_OP$`@`$X`)"9=S````#0````````!@``````_[\!
+M`(`!.`"0F7<P````T`````````8``````/^_`0"``3@`D)EW,````-``````
+M```&``````#_OP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!.`"0
+MF7<P````T`````````8``````/^_`0"``3@`D)EW,````-`````````&````
+M``#_OP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!.`"0F7<P````
+MT`````````8``````/^_`0"``3@`D)EW,````-`````````&``````#_OP$`
+M@`$X`)"9=S````#0````````!@``````_[\!`(`!.@"0F7<P````T```````
+M``8``````/^_`0"`!S@`D)EW,````-`````````&``````#_OP$`@`$X`)"9
+M=S````#0````````!@``````_[\!`(`!.@"0F7<P````T`````````8`````
+M`/^_`0"`!S@`D)EW,````-`````````&``````#_OP$`@`$X`)"9=S````#0
+M````````!@``````_[\!`(`!.`"0F7<P````T`````````8``````/^_`0"`
+M`3@`D)EW,````-`````````&``````#_OP$`@`$X`)"9=S````#0````````
+M!@``````_[\!`(`!.`"0F7<P````T`````````8``````/^_`0"``3H`D)EW
+M,````-`````````&``````#_OP$`@`<X`)"9=S````#0````````!@``````
+M_[\!`(`!.`"0F7<P````T`````````8``````/^_`0"``3@`D)EW,````-``
+M```````&``````#_OP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!
+M.@"0F7<P````T`````````8``````/^_`0"`!S@`D)EW,````-`````````&
+M``````#_OP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!.`"0F7<P
+M````T`````````8``````/^_`0"``3@`D)EW,````-`````````&``````#_
+MOP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!.`"0F7<P````T```
+M``````8``````/^_`0"``3@`D)EW,````-`````````&``````#_OP$`@`$X
+M`)"9=S````#0````````!@``````_[\!`(`!.`"0F7<P````T`````````8`
+M`````/^_`0"``3@`D)EW,````-`````````&``````#_OP$`@`$X`)"9=S``
+M``#0````````!@``````_[\!`(`!.`"0F7<P````T`````````8``````/^_
+M`0"``3@`D)EW,````-`````````&``````#_OP$`@`$X`)"9=S````#0````
+M````!@``````_[\!`(`!.`"0F7<P````T`````````8``````/^_`0"``3@`
+MD)EW,````-`````````&``````#_OP$`@`$X`)"9=S````#0````````!@``
+M````_[\!`(`!.`"0F7<P````T`````````8``````/^_`0"``3@`D)EW,```
+M`-`````````&``````#_OP$`@`$X`)"9=S````#0````````!@``````_[\!
+M`(`!.`"0F7<P````T`````````8``````/^_`0"``3@`D)EW,````-``````
+M```&``````#_OP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!.`"0
+MF7<P````T`````````8``````/^_`0"``3@`D)EW,````-`````````&````
+M``#_OP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!.`"0F7<P````
+MT`````````8``````/^_`0"``3@`D)EW,````-`````````&``````#_OP$`
+M@`$X`)"9=S````#0````````!@``````_[\!`(`!.`"0F7<P````T```````
+M``8``````/^_`0"``3@`D)EW,````-`````````&``````#_OP$`@`$X`)"9
+M=S````#0````````!@``````_[\!`(`!.`"0F7<P````T`````````8`````
+M`/^_`0"``3@`D)EW,````-`````````&``````#_OP$`@`$X`)"9=S````#0
+M````````!@``````_[\!`(`!.`"0F7<P````T`````````8``````/^_`0"`
+M`3@`D)EW,````-`````````&``````#_OP$`@`$X`)"9=S````#0````````
+M!@``````_[\!`(`!.`"0F7<P````T`````````8``````/^_`0"``3@`D)EW
+M,````-`````````&``````#_OP$`@`$X`)"9=S````#0````````!@``````
+M_[\!`(`!.`"0F7<P````T`````````8``````/^_`0"``3@`D)EW,````-``
+M```````&``````#_OP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!
+M.`"0F7<P````T`````````8``````/^_`0"``3@`D)EW,````-`````````&
+M``````#_OP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!.`"0F7<P
+M````T`````````8``````/^_`0"``3@`D)EW,````-`````````&``````#_
+MOP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!.`"0F7<P````T```
+M``````8``````/^_`0"``3@`D)EW,````-`````````&``````#_OP$`@`$X
+M`)"9=S````#0````````!@``````_[\!`(`!.`"0F7<P````T`````````8`
+M`````/^_`0"``3@`D)EW,````-`````````&``````#_OP$`@`$X`)"9=S``
+M``#0````````!@``````_[\!`(`!.`"0F7<P````T`````````8``````/^_
+M`0"``3@`D)EW,````-`````````&``````#_OP$`@`$X`)"9=S````#0````
+M````!@``````_[\!`(`!.@"0F7<P````T`````````8``````/^_`0"`!S@`
+MD)EW,````-`````````&``````#_OP$`@`$X`)"9=S````#0````````!@``
+M````_[\!`(`!.`"0F7<P````T`````````8``````/^_`0"``3@`D)EW,```
+M`-`````````&``````#_OP$`@`$X`)"9=S````#0````````!@``````_[\!
+M`(`!.`"0F7<P````T`````````8``````/^_`0"``3@`D)EW,````-``````
+M```&``````#_OP$`@`$X`)"9=S````#0````````!@``````_[\!`(`!.`"0
+MF7<P````T`````````8``````/^_`0"``3@`D)EW,````-`````````&````
+M``#_OP$`@`$(`````#`````````````````````````!```!.0"PW7<`````
+MT```&!4```8``````/^_`0"``3D`L-UW`````-```!@5```&``````#_OP$`
+M@`$Y`+#==P````#0```8%0``!@``````_[\!`(`!.0"PW7<`````T```&!4`
+M``8``````/^_`0"``3D`L-UW`````-```!@5```&``````#_OP$`@`$Y`+#=
+M=P````#0```8%0``!@``````_[\!`(`!.0"PW7<`````T```&!4```8`````
+M`/^_`0"``3D`L-UW`````-```!@5```&``````#_OP$`@`$Y`+#==P````#0
+M```8%0``!@``````_[\!`(`!.0"PW7<`````T```&!4```8``````/^_`0"`
+M`3D`L-UW`````-```!@5```&``````#_OP$`@`$Y`+#==P````#0```8%0``
+M!@``````_[\!`(`!.0"PW7<`````T```&!4```8``````/^_`0"``3D`L-UW
+M`````-```!@5```&``````#_OP$`@`$Y`+#==P````#0```8%0``!@``````
+M_[\!`(`!.0"PW7<`````T```&!4```8``````/^_`0"``3D`L-UW`````-``
+M`!@5```&``````#_OP$`@`$Y`+#==P````#0```8%0``!@``````_[\!`(`!
+M.0"PW7<`````T```&!4```8``````/^_`0"``3D`L-UW`````-```!@5```&
+M``````#_OP$`@`$Y`+#==P````#0```8%0``!@``````_[\!`(`!.0"PW7<`
+M````T```&!4```8``````/^_`0"``3D`L-UW`````-```!@5```&``````#_
+MOP$`@`$Y`+#==P````#0```8%0``!@``````_[\!`(`!.0"PW7<`````T```
+M&!4```8``````/^_`0"``3D`L-UW`````-```!@5```&``````#_OP$`@`$Y
+M`+#==P````#0```8%0``!@``````_[\!`(`!.P"PW7<0````T```&!4```8`
+M`````/^_`0"`!SD`L-UW`````-```!@5```&``````#_OP$`@`$Y`+#==P``
+M``#0```8%0``!@``````_[\!`(`!.0"PW7<`````T```&!4```8``````/^_
+M`0"``3D`L-UW`````-```!@5```&``````#_OP$`@`$Y`+#==P````#0```8
+M%0``!@``````_[\!`(`!.0"PW7<`````T```&!4```8``````/^_`0"``3D`
+ML-UW`````-```!@5```&``````#_OP$`@`$Y`+#==P````#0```8%0``!@``
+M````_[\!`(`!.0"PW7<`````T```&!4```8``````/^_`0"``3D`L-UW````
+M`-```!@5```&``````#_OP$`@`$Y`+#==P````#0```8%0``!@``````_[\!
+M`(`!.0"PW7<`````T```&!4```8``````/^_`0"``3L`L-UW$````-```!@5
+M```&````!P#_OP$`Q0<Z`)"9`#`&`P$````XCP``!@``````_[\``,4'``8`
+M`!\3```8&P``:R```/$G``!.+P``&@```!\````B````)````"<`````!@``
+M"PP``#81``"6%@``QQH``,H>```:(P``BB<``&TK``!.+P``&P```!T````>
+M````(````"$````C````)0```"8````H``````8``$XO```<``````````H!
+M```0`0``WP,``.4#``#&!```R00``$`(``!="```7@@``&`(``!B"```<`@`
+M`"P)```R"0``90D``'$)``#C"0``YPD``',*``!U"@``=PH``(8*``#5"@``
+MW0H``/4*``#]"@``;@L``'8+``!2#```6PP``*,,``"L#```"`X```P.``!'
+M#@``30X``%X.``!D#@``H`X``*4.``"_#@``Q0X``-(1``#6$0``W1$``.(1
+M``#H$0``[Q$```<2```,$@``)A(``"L2``!($@``2A(``$T2``!2$@``7A(`
+M`&02``"9$@``GA(``*T2``"S$@``\!(``/<2```6$P``&Q,``!P3```A$P``
+M-Q,``#T3```^$P``1!,``*83``"J$P``P!,``,D3``#:$P``X1,``/43````
+M%```"!0```X4```C%```+!0``$\4``!8%```@A0``(D4``#'%```SA0``#L5
+M``!!%0``0Q4``$D5``!+%0``414``)85``">%0``GQ4``*,5``"Z%0``OA4`
+M`+\5``##%0``YA4``/$5``#R%0``]A4``!,6```;%@``'!8``"`6``!!%@``
+M118``&D6``!M%@``BA8``)$6``"P%@``N18``-$6``#8%@``&A<``!T7```Z
+M%P``01<``'`7``!V%P``>!<``($7``"#%P``C!<``(X7``"6%P``MA<``,$7
+M``#=%P``XQ<``/H7```"&```(!@``"@8```I&```+1@``"X8```V&```3Q@`
+M`%,8``!I&```<1@``(H8``"0&```RQ@``-(8``#K&```]!@```\9```3&0``
+M%!D``!@9```D&0``*AD``#89```^&0``0!D``$89``"/&0``EQD``,L9``#5
+M&0``UQD``-X9``#@&0``Z!D````:```*&@``(QH``"X:``!*&@``4!H``&(:
+M``!J&@``:QH``&\:``"I&@``L!H``+(:``"Y&@``NAH``+X:``#0&@``UAH`
+M`.L:``#T&@``#!L``!,;```I&P``,!L``$8;``!-&P``;!L``'(;``",&P``
+ME!L``'@=``!^'0```1X```0>```Y'@``/!X``$<>``!1'@``7QX``&0>``!R
+M'@``=QX``,H>``#5'@``UAX``-@>``#:'@``Y!X```(?```*'P``)1\``"L?
+M``!3'P``7!\``%T?``!C'P``9!\``&T?``"2'P``FQ\``)P?``"E'P``YA\`
+M`.T?```2(```'2```$(@``!,(```;2```',@``"4(```G"```,8@``#-(```
+M22$``$XA``#?(0``Y2$``.8A``#P(0``\2$``/@A```7(@``(2(``$4B``!,
+M(@``32(``%DB``!:(@``82(``*LB``"P(@``O2(``,$B``#-(@``TB(``-XB
+M``#A(@``"2,``!`C``!I(P``<",``'(C``![(P``?",``'\C``"1(P``F",`
+M`)HC``"C(P``QB,``,TC``#>(P``XB,``.,C``#J(P``!R0```LD```,)```
+M$R0``"<D```M)```;"0``&\D``!P)```>R0``-4D``#;)```W"0``.`D``#U
+M)```_"0``!0E```;)0``/"4``$HE``!M)0``="4``'8E``!_)0``D24``)LE
+M``"<)0``I"4``*4E``"Q)0``R"4``,HE``#=)0``Y"4```(F```))@``"R8`
+M`!,F```H)@``,"8``'@F``"')@``B28``)`F``"C)@``K28``+TF``##)@``
+MW"8``.0F``!")P``2"<``.<G``#M)P``GR@``*4H``!0*0``!P`<``<`'``'
+M`!L`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`
+M'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<
+M``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`
+M!P`;``<`&P`'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'
+M`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`
+M'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<
+M``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`
+M!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'
+M`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`
+M'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<
+M``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`
+M!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'
+M`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`
+M'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<
+M``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`!P`<``<`'``'`!P`
+M!P`<``<`'``'``````")````DP```,`!``#*`0``5@(``%T"``#]`@``!@,`
+M`#\#``!$`P``?0,``(0#``"\`P``P0,``&P$``!X!```*04``"L%``"J!0``
+MK at 4``$X&``!5!@``R`8``,L&```&!P``#0<``#\'``!-!P``3P<``&$'``!O
+M!P``?`<``*X'``"R!P``&P@``!X(``!&"```2`@``%X(``!@"```8@@``&8(
+M```L"0``, at D``#,)```X"0``G`D``)\)``#9"0``WPD``!4*```="@``3 at H`
+M`%0*``!W"@``A at H``-4*``#="@``_ at H```,+```%"P``#0L``",+```O"P``
+M-PL``#L+``!6"P``7`L``&X+``!V"P``APL``(L+``#`"P``RPL``"D,```K
+M#```8PP``&H,``#9#```V at P``!D-```=#0``(`T``"0-``!)#0``4`T``'0-
+M``!X#0``B0T``)`-``"^#0``P at T``.L-``#R#0``"`X```P.```W#@``/PX`
+M`$<.``!-#@``>@X``'P.``")#@``CPX``+4.``"[#@``V`X``-L.``!]#P``
+MA`\``&T0``!Y$```S1```-$0```*$0``%!$``%T1``!B$0``F1$``*`1``#2
+M$0``UA$``/`1``#W$0``#Q(``!02```Q$@``-A(``$@2``!*$@``31(``%(2
+M``!>$@``9!(``((2``"($@``F1(``)X2``"M$@``LQ(``,,2``#)$@``\!(`
+M`/<2```6$P``&Q,``"X3```V$P``BA,``)(3``"A$P``I1,``+83``"_$P``
+MVA,``.$3```(%```#A0``",4```L%```3Q0``%@4``""%```B10``)\4``"D
+M%```QQ0``,X4``!#%0``214``$L5``!1%0``<Q4``'<5``"6%0``GA4``+H5
+M``"^%0``YA4``/$5```3%@``&Q8``#H6``!`%@``8A8``&@6``"*%@``D18`
+M`+`6``"Y%@``T18``- at 6``#O%@``]18``!H7```=%P``.A<``$$7``".%P``
+MEA<``+87``#!%P``W1<``.,7``#Z%P```A@``"`8```H&```3Q@``%,8``!I
+M&```<1@``(H8``"0&```RQ@``-(8``#K&```]!@```\9```3&0``0!D``$89
+M``!K&0``;QD``(\9``"7&0``X!D``. at 9````&@``"AH``",:```N&@``2AH`
+M`%`:``!B&@``:AH``+(:``"Y&@``T!H``-8:``#K&@``]!H```P;```3&P``
+M*1L``#`;``!&&P``31L``&P;``!R&P``C!L``)0;``#Z&P``_QL````=```#
+M'0``&AT``"0=``!+'0``4QT``&@=``!K'0``CQT``),=``"J'0``KAT``-$=
+M``#5'0```1X```0>``!?'@``9!X``-H>``#D'@```A\```H?```E'P``*Q\`
+M`%T?``!C'P``DA\``)L?``#1'P``TQ\``.8?``#M'P``$B```!T@``!"(```
+M3"```&T@``!S(```E"```)P@``#&(```S2```/,@``#[(```."$``#XA``!B
+M(0``9R$``(HA``"3(0``MB$``+TA``#?(0``Y2$``.8A``#P(0``\2$``/@A
+M```7(@``(2(``$4B``!,(@``FB(``)XB``"](@``P2(``-XB``#A(@``"2,`
+M`!`C``!#(P``2",``&DC``!P(P``D2,``)@C``#&(P``S2,``.,C``#J(P``
+M#"0``!,D```G)```+20``&PD``!O)```CB0``)<D``"X)```OB0``-4D``#;
+M)```]20``/PD```4)0``&R4``#PE``!*)0``;24``'0E``"<)0``I"4``*4E
+M``"Q)0``W24``.0E```")@``"28``"@F```P)@``("<``'LG``"X)P``P2<`
+M`,4H``#(*```4"D```<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`
+M!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'
+M`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`
+M.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z
+M``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`
+M!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'
+M`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`
+M.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z
+M``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`
+M!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'
+M`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`
+M.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z
+M``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`
+M!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'
+M`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`
+M.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z
+M``<`.@`'`#H`!P`Z``<`.@`'`#H`!P`Z``<`.@`'`#H`!P#_0`.``0`7`@``
+M%P(``&`DA0DL`"P`%P(````````7`@````````,``P#C!&$#`A``````````
+M3BD``%````P`0```__\!````!P!5`&X`:P!N`&\`=P!N`/__`0`(````````
+M``````#__P$``````/__```"`/__`````/__```"`/__``````8```!'!I`!
+M`````@(&`P4$!0(#`````P````````````````$`````````5`!I`&T`90!S
+M`"``3@!E`'<`(`!2`&\`;0!A`&X````U!I`!`@```@`%````````````````
+M`````0```````````(``````4P!Y`&T`8@!O`&P````S!I`!`````@L&!`("
+M`@("`````P````````````````$`````````00!R`&D`80!L````21"0`4T+
+M``````````````````,````````````````!`````````%0`:0!M`&4`<P`M
+M`$(`;P!L`&0```!4`&D`;0!E`',````S!I`!`````@`%`````````````P``
+M``````````````$`````````5`!I`&T`90!S````0P:0`0````(+!@`$!0("
+M`@````,````````````````!`````````$P`=0!C`&D`9`!A`"``1P!R`&$`
+M;@!D`&4````@``0`<0B(&`#PT`(``&@!`````.Y*ND;L2[I&``````,`#P``
+M`/H%```4(@```@`1````!``#$$@```````````````(``0````$`````````
+M420`\!``````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````I0;`![0`M`"``#XT``````````````````#9*0``````````````````
+M````````````````````````````````````````````````````````````
+M``````````(```!"`P`````(`0!``/`0``@`````````````````````````
+M``````````````````````#P_P\`````````````____?____W____]_____
+M?____W____]_____?X`[,`#__Q(`````````!@!%`$T`0@!/`%,`4P``````
+M``````P`1`!A`'8`:0!D`"``30!A`'(`=`!I`&X`````````````````````
+M````````````````````````````````````````````````````````````
+M`/[_```#"@$```````````````````````$```#@A9_R^4]H$*N1"``K)[/9
+M,````'0@```1`````0```)`````"````F`````,```"H````!````+0````%
+M````P`````<```#,````"````-P````)````]````!(``````0``"@```!P!
+M```,````*`$```T````T`0``#@```$`!```/````2`$``!````!0`0``$P``
+M`%@!```1````8`$```(````0)P``'@````<```!%34)/4U,``1X````!````
+M`$U"3QX````!`````$U"3QX````!`````$U"3QX````'````3F]R;6%L``$>
+M````#0```$1A=FED($UA<G1I;@!I`&X>`````@```#,`?4`>````%````$UI
+M8W)O<V]F="!7;W)D(#$Q+C(`0``````:<1@"````0`````!DAI1A"L@!0```
+M``!X$=2""L@!`P````(````#````^@4```,````4(@```P````````!'````
+M#!\``/[___]024-4'P(``````%H`@``1`O\,`/_^````2````$@`````````
+M6@"````````>``$`"H`!@`%__W__`)H```#_ at 0```````%H`@`````,`````
+M`$@```!(````$``0``,`!0```!`'2^"H!TOD)```````6@"```````!:`(``
+M```#@0````D```"#?_\`````"0```(-__P`````)````@W__`````'H"``!_
+M_W___@``!'__`````'__?__]```$?_]__P````!___L``.Y__Q9C&%[W:UI6
+MM6<Y4I1O>U[W5K5K6F,88QAK6F<Y6M9*4DYS:UIK6DYS5K5C&&][[W__!DYS
+M<YQ>]VM:5K5K6EK6_FM:`F][9SEC&.5__P`````N!```?_]__P````#^?__\
+M```*?_\``'__``!__W__`````'__?_\``)I__P````#"`P``?_]__P``_G__
+M_@```'___0``"G__``!__W__``!__P````!__P````#N?_\48QAC&$I27O=C
+M&'.<;WMO>UK67O=6M6<Y:UIK6F][:UI6M5[W8QAO>UK6_FM:`6][6M;^:UH!
+M;WM>]_YK6@%O>VM:_'__(F,88QAK6EK6:UI:UFM::UI:UG__:UI:UF][;WM:
+MUFM:8QAK6F][;WM>]UK6:UIK6F,8;WMG.5K6;WMK6FM:;WMG.6<Y8QC[?_\`
+M````D@(``'__?__^```"?_\``'__^P```'__]P``[G__$V][6M9SG&][:UIS
+MG%K6;WMO>V,8:UIO>VM::UI:UFM::UI6M7__9SGL?_\);WMC&&M:8QAK6F][
+M;WMK6FM:7O?^:UH44I1__V,87O=O>V,8:UIO>V][8QAC&%:U?_]O>UK69SE>
+M]UK6:UIO>VM:^G__``````D```"#?_\`````I1<``'__?_]O>U:U?_]*4DYS
+M=[UK6FM:1C%"$'.<?_].<V,8:UIK6E:U9SE*4FM:>][L?_\";WMK6G.<_E[W
+M!6<Y7O=C&&<Y;WM>]_UK6 at -O>VM:4I1K6NQ__P5K6FM:7O=C&&,89SG^;WL9
+M8QAO>VM:9SESG%K66M9O>U[W;WM__VM:;WMWO6][7O=:UF<Y:UI:UF,8:UIC
+M&&][;WMK6OM__P`````W%P``?_]__V,8-:U__T8Q3G-[WD8Q2E(E*2UK7O=_
+M_TI21C%"$$I21C%&,4I2.<YWO9I__P````!O````^W__`%:UW'__"FM:;WMK
+M6E[W6M96M5[W9SEO>VM:7O?C?_\@;WMC&&M:6M9>]UK6:UIO>VM::UI>]V,8
+M8QAG.7.<:UIO>VM:7O=K6EK6:UIC&&M:7O=O>V][:UIO>VM:<YQ:UFM:^7__
+M`````,L```#^?_\=5K5:UF<Y9SEK6F<Y5K5C&&M:;WMC&&M:;WM.<UK66M9O
+M>V][5K5G.6M:9SE6M5*4:UIK6E[W2E)O>VM:]G__&U*45K5.<U:U7O=.<W__
+M:UIK6E:U;WMK6F][;WM>]V<Y:UIK6F<Y9SE__VM::UI2E&,8?_]O>U[W_FM:
+M`%*4^'__'6M:<YQ>]W.<4I1__V,88QAK6FM:7O=C&&,89SEO>V,86M9O>VM:
+M4I1__UK68QAK6F][7O=G.6M::UIO>_9__P`````)````@W__`````&0```#5
+M?_\/:UISG%[W9SEG.6][4I1:UF][9SEO>V][7O=C&&M:7O?^;WL*8QA>]VM:
+M;WMK6FM:9SEO>V,88QAO>_9__PI6M7>]6M92E&M:6M9O>V][6M96M6M:_E[W
+MYG__``````D```"#?_\`````J0```/Y__P1"$%[W6M9O>V][W7__"5K69SE>
+M]V,89SEO>UK68QAK6E:U_6M:%&][5K5G.6][;WM:UF][7O=O>U:U;WMG.6][
+M7O=>]VM:;WMO>VM::UISG/M__R-C&&,8:UI>]V][8QA:UFM:6M9C&'.<6M9K
+M6EK68QAK6E[W;WM:UFM::UIC&&][9SE:UFM::UI:UE[W?_]C&&M:7O=K6EK6
+M:UK\?_\`````MP```/Y__PE>]V,87O=K6F<Y8QAC&%K6:UIO>_YK6A9>]U[W
+M:UIO>U[W;WMG.6M:;WMO>V,81C%2E%[W6M9C&&][;WMK6F,89SEK6F<Y_'__
+M"F][9SEK6F,88QA>]VM:6M9:UE[W9SGC?_\B:UIK6EK6:UI>]V,8;WM>]V<Y
+M:UI>]VM:;WMO>VM:7O=G.6,89SEC&&][7O=C&&M:7O=K6F][7O=G.5[W8QAO
+M>W.<5K5:UOM__P`````)````@W__`````*$```#^?_\>7O=>]VM:;WMC&&M:
+M;WMK6EK6:UI:UF][6M9K6E*4;WMG.6,8;WMO>U*46M9K6F<Y9SEK6E[W:UIK
+M6E[W:UKW?_\&4I1__U*49SEK6E*46M;??_\?5K5G.6M:6M9G.6M:6M9C&&M:
+M4I1>]V][:UIC&&M:7O=O>V,8:UIK6E:U5K5G.7__:UISG&<Y8QA2E&][:UIK
+M6OA__P````"%````U7__"6M:9SEO>UK6:UIG.6][;WM:UE[W_F][`6,86M;^
+M:UH&;WMK6FM:9SEO>U[W6M;Q?_\B9SESG&M:8QAK6FM:8QA:UE[W:UI>]VM:
+M7O=K6FM:;WM>]U:U=[UG.6<Y4I1G.6M:7O=C&%:U<YQ__V,8:UI:UFM:;WMK
+M6OM__P````!#````_G__$F][7O=>]V][9SEK6F][8QAO>U[W6M9>]UK64I1:
+MUE[W6M9G.5[W_FM:!5K6:UIO>V<Y;WMO>Z)__P````"Y````_G__'E[W:UI>
+M]U:U9SE:UG__:UIK6E[W<YQK6FM:;WMG.5*4<YQK6E*45K5.<VM:;WM>]V<Y
+M:UI>]VM:4I1C&&M:]W__`V,88QAK6F][_FM:&V][:UI2E&M:;WM>]W__5K5K
+M6F<Y8QAC&&<Y;WMK6F][4I1O>V][7O=O>V][5K5K6FM:6M96M7.<^W__$&M:
+M:UI>]V,88QAG.6,8;WM>]V<Y:UI>]U[W;WM2E&M:;WOI?_\`````"0```(-_
+M_P````#3````_G__(&,86M9O>VM:8QAC&&][8QAO>W.<7O=O>U:U9SE:UFM:
+M8QA:UF<Y;WMK6F<Y8QAO>UK6:UIO>U[W;WMO>UK67O=K6OE__P]O>U:U:UIC
+M&&M:;WM:UFM:8QAG.6,89SEC&%K6:UI>]_YK6 at I2E'.<7O=K6FM:6M9K6G.<
+M6M9K6F][_FM:`6][:UK[?_\)8QA2E&][:UIG.5[W4I1:UF,8:UK]7O<0:UIK
+M6F<Y8QAK6FM:;WMC&&,8:UIC&%K6:UIO>VM:6M9C&/=__P````"4````U7__
+M''.<;WMK6G.<:UIK6E*4=[UK6G.<6M9O>V<Y;WMK6E[W8QAC&&<Y6M9O>VM:
+M:UIO>V,8;WMC&&,8;WO^:UKX?_\B;WMC&%[W:UI:UF][:UIK6F<Y9SEC&%[W
+M:UI>]V][8QA2E'__7O=K6EK6:UIO>V][:UI>]UK6?_]:UE*4?_]K6G__6M9K
+M6OM__P````!/````_G__%U[W8QAO>V][5K5:UE[W6M9K6F][;WMC&%[W;WM>
+M]VM:7O=2E&][:UIO>W__9SEG.?UK6 at 9O>V,8:UIK6F][6M9K6JE__P````"A
+M````_G__(%[W9SEG.5[W8QAK6E[W;WMO>V<Y4I1SG&][:UI2E'__6M9__U[W
+M:UIG.6M:7O=G.5K68QAG.6,8:UI>]V][6M9K6OE__P!O>_YK6 at IO>U:U?_]:
+MUF][6M9K6DYS?_]K6F][_FM:`F][:UIC&/YK6@)O>UK67O?^:UH!7O=K6OA_
+M_PAO>VM:6M9:UE[W9SEK6F,8:UKA?_\`````"0```(-__P````"=````_G__
+M'UK67O=:UF,88QAG.6,8;WMO>UK68QAO>UK6:UIO>VM:4I1G.6,88QA>]U[W
+M:UIO>VM:4I1G.7.<;WM:UFM:7O?X?_\":UIK6EK6_6,8#F<Y;WM>]V][4I1S
+MG%K6:UI6M6M::UIO>U*4?_]>]^Y__P]6M5:U=[U.<U:U5K5G.6M:7O=>]VM:
+M:UIO>U[W9SEK6NA__P````!%````U7__#&M::UI>]V][:UI6M6M:9SEK6FM:
+M9SEG.6M:Y7__#&,8;WMK6E:U:UIK6F<Y:UI>]V][:UIK6F][Y7__`````!<`
+M``#^?_\$8QAC&&<Y8QAO>XM__P````"9````_G__(V,8;WMO>V,87O=>]V][
+M8QAK6FM:5K5K6G.<4I1:UE[W3G-K6E[W:UIK6F,8;WMC&&][:UIC&&M::UIG
+M.5[W9SEK6F,8;WMO>_Q__P)6M5:U2E+^5K4%9SEO>V<Y7O=6M6M:Y'__$EK6
+M9SEG.5[W:UIO>W.<9SEK6E[W7O=K6FM:7O=G.6<Y:UI>]U[WZW__``````D`
+M``"#?_\`````OP```/Y__PM>]V][:UIO>VM::UIG.6][:UIK6DYS9SG^:UH%
+M;WMO>V<Y4I1G.6][_FM:!E*4;WMK6F][7O=O>W.<]W__(U[W:UI>]V][:UIK
+M6EK6;WMC&&][8QAO>VM::UI2E%:U3G-*4E[W:UIC&&][9SE:UF][9SEG.6,8
+M6M9K6F][4I1:UF][:UIG.?Q__P9:UG__:UIO>U[W4I1>]_YK6 at I2E&,8:UIG
+M.7>]9SEK6E[W7O=SG&<Y[7__`````'L```#^?_\$7O=K6EK6;WMC&-U__PAK
+M6F<Y:UIG.6M:7O=K6E*4;WO]:UH-5K56M7.<;WMK6G.<:UI:UFM:6M9>]VM:
+M;WMC&/-__Q1K6EK6:UI:UFM:;WM6M6][:UIK6EK65K5G.7>]9SEK6E[W7O=S
+MG&<Y4I3M?_\`````"0```(-__P````"G````_G__&V,86M9O>UK6;WMC&%[W
+M:UI>]V<Y8QAO>U:U:UIC&&][:UI>]U*45K5.<U:U7O=K6G.<5K5O>V][]'__
+M$7.<:UI2E&M:6M9K6E*49SEO>V][:UISG&M:;WMG.5K69SEK6NI__P1O>VM:
+M9SE>]V][_FM:$V][8QA>]V][:UIO>VM:;WM>]VM:;WMK6E:U:UIC&&<Y8QA>
+M]V<Y9SGT?_\`````"0```(-__P````"1````_G__$5*45K5.<U:U7O=G.7__
+M;WMK6F<Y;WMC&%[W:UIK6E:U:UI>]_YO>PI:UF,8:UIK6F,8;WMG.5K6;WM>
+M]V<Y^'__"F][:UIC&&][5K5>]V][:UI>]VM:<YSC?_\3;WMK6E[W<YQG.6][
+M8QA>]VM:;WM:UFM:8QAO>V][5K5__U[W7O=C&.Q__P````"Q````_G__!V,8
+M4I1SG&,8;WMK6G.<7O?^:UH`;WO^7O<4;WMG.7__7O=C&&][:UIC&&M:9SE>
+M]V][:UIG.6,87O=O>V<Y7O=O>V][_'__$G.<5K5K6F<Y3G-O>V][:UIK6F,8
+M;WMG.5K6;WMG.5*4:UIK6F][ZW__&&M:7O=:UF][:UI>]V,8;WMG.6][:UIO
+M>W.<9SEK6E[W7O=SG%K6<YQK6FM:7O=O>W>]\7__``````D```"#?_\`````
+MAP```/Y__PEG.6M:7O=K6FM:;WMK6F,8:UI6M?YO>Q5:UDYS?_]K6E:U8QAO
+M>VM:;WMO>V,85K5O>VM:9SE>]VM:7O=C&&][:UIO>_M__PMO>V][8QA:UFM:
+M<YQO>V,8:UI:UFM:7O?D?_\*6M9K6E*4?_]K6F][6M9K6F][8QAK6N-__P``
+M```)````@W__`````+,```#^?_\:;WMK6FM:7O=C&&M:8QAC&&][7O=O>V][
+M8QAO>U:U:UI>]W.<7O=O>VM::UIO>TYS9SEK6E[W_FM:!&<Y:UISG%K6:UK[
+M?_\14I1__VM:9SEK6EK67O=K6G>]:UIG.5[W:UI2E&<Y:UIC&%K6ZG__&E[W
+M:UIK6F<Y?_]C&%[W;WMC&&][7O=SG&M:;WM:UF][7O=O>VM:<YQO>UK6:UI:
+MUFM::UIO>_-__P````##````_G__(6M::UIG.5[W:UI:UFM:7O=>]V][8QA>
+M]VM:5K5K6F][6M9:UG__:UI2E%:U3G-K6E[W;WMC&&][4I1:UFM::UIG.6][
+M^G__'V<Y8QAK6F,8;WMO>VM:6M9K6F][;WMC&&][3G-K6EK68QAK6F][:UIC
+M&&][9SE:UF][9SEG.6,8;WMC&&M:9SGX?_\#7O=K6FM:9SG^:UH.;WM:UF][
+M:UIK6F,8;WMO>VM:<YQK6E*4;WM>]V][[G__``````D```"#?_\`````;0``
+M`/Y__P5>]V][6M9K6EK6;WO>?_\.9SEK6F<Y8QA:UG__:UIK6DYS?_]K6FM:
+M7O=:UG___FM:!F][6M9K6F,8;WMG.5K6\7__#6][9SE2E&<Y;WMK6EK6:UIK
+M6F][;WM6M7__3G/F?_\`````E0```-5__Q92E%:U3G-6M5[W7O=G.5:U8QAO
+M>V<Y:UI2E%[W:UIK6E[W:UIC&%K6:UIO>U[W_FM:!U*4:UI:UG.<3G-__V][
+M:UKZ?_\':UIK6F,8:UI>]VM::UI6M?UK6@=6M6M:4I1K6E:U<YQ:UE[W_FM:
+M#%*4;WMG.7.<7O=O>TI27O=C&%[W:UIG.5:U_'__`````$L```#^?_\%8QAC
+M&$I25K5.<U:U_E[W%F,8;WMK6FM:6M9O>UK6:UIO>VM:9SEC&&][6M9K6FM:
+M7O=G.6M:9SEK6E*4:UJF?_\`````>0```/Y__QU:UFM::UIG.5*4:UIC&%K6
+M7O=SG&][:UIO>U*47O=>]V][:UIK6F<Y8QAO>VM:8QAK6E[W:UIO>V,8;WOV
+M?_\#8QAK6FM:;WO<?_\`;WO^:UH,;WMK6F,8;WM>]VM::UI>]VM::UI>]VM:
+M;WOI?_\`````"0```(-__P````"@````_G__#EK6:UI*4G__;WM:UFM:;WMK
+M6F<Y7O=O>W.<5K5G.?YK6@=>]V,8:UIO>V][8QA>]V][\G__('.<7O=K6EK6
+M;WM>]V,8:UI:UG__:UISG&M:;WM.<W__8QAC&%K6:UI>]VM:7O=C&&M:6M9>
+M]V,8<YQO>VM:8QAK6OE___YK6 at EC&&][4I1K6E[W8QA__V][8QAK6N5__P``
+M``!3````U7__%F][8QA>]V][6M9K6EK6;WM__V][4I1:UF][:UI:UF,8:UIK
+M6F][8QA6M7.<;WOO?_\$:UI>]VM:8QAO>_YK6@):UG__7O?C?_\`````2P``
+M`/Y__P5C&&,82E)6M4YS5K7^7O<66M9G.7.<7O=O>V,8:UIG.6M:;WMK6EK6
+M6M9K6G.<6M9K6EK6:UI*4F<Y<YQO>Z9__P````!L````_G__#%K6:UIK6F<Y
+M4I1K6F,86M9>]W.<;WMK6E[WY7__#&<Y7O=G.6<Y4I1G.5:U8QAK6E[W4I1O
+M>VM:Y7___FM:"E:U9SEG.6][:UIO>UK6:UI__UK6;WO^:UH"6M9K6F][['__
+M``````D```"#?_\`````U0```/Y__R-C&&][:UIG.6][:UI:UF][;WM:UE[W
+M;WM:UF][6M9K6FM:9SEK6F][:UI:UFM:9SEK6E[W3G-SG&M:;WM>]U:U;WM_
+M_U[W:UK\?_\38QAC&&M:8QAK6EK66M9K6G.<:UI2E%:U3G-6M5[W4I1SG&M:
+M;WM.<_YO>PQK6E:U6M9K6F<Y8QAC&&<Y6M9K6F][8QAO>_Q__Q!G.6,8:UI2
+ME'__7O=:UF][:UIO>U:U:UIK6G.<:UIK6E[W_FM:!5[W:UIK6E*4:UIO>_)_
+M_P````!U````U7__`F][7O=G.?YK6AM:UE:U<YQK6FM:7O=C&%:U9SE__V,8
+M8QAG.7.<;WMC&&][;WMK6F][5K5:UFM:8QAK6F][:UIK6OI__Q!K6FM:8QA2
+ME&M::UI>]VM:;WM>]VM::UI>]VM:4I1>]V,8Z7__`````$<```#^?_\<:UI:
+MUF,89SEC&&M:8QA:UF<Y:UIC&&M:8QA6M6][<YQ6M5K6?_]K6FM:;WM6M6][
+M:UI2E&][<YQK6J-__P````!B````_G__"U:U6M9K6EK66M9O>U:U5K5WO4(0
+M5K56M>1___YK6@!O>]Q__PMK6FM:8QA2E&M::UI:UFM:3G-K6FM:;WO^:UH)
+M;WMK6F,8:UIK6F,8?_]K6E*4;WOQ?_\`````"0```(-__P````"_````_G__
+M(U*45K5.<U:U7O=O>VM:3G-__VM:;WMO>U[W9SE>]V<Y:UIO>V][8QA>]V][
+M;WMK6E:U:UIC&&][8QAK6F<Y;WMG.5K68QA>]_Q__P5SG%*46M9>]W.<8QC^
+M;WL&:UI:UE*49SE__VM:6M;^:UH$6M9K6F][6M9K6O!__PAK6FM:8QA2E&M:
+M:UI:UFM:3G/^:UH%<YQO>V,8;WMK6E[W_FM:!U[W:UIK6E[W7O=C&&M:;WOU
+M?_\`````J@```/Y__R)6M5K6?_]:UFM:7O=>]V][8QA>]VM:5K5K6G__4I12
+ME&][:U]>_V]_7O]O?VM?9S]O?VM?8Q]C'U:_3G]6OTY_5K]>_U[_^W__&&M:
+M8QAO>V<Y6M9O>U[W;WMC&&M:?_]2E&][8QAG.6M:4I1G.6M:<YQO>W.<7O=O
+M>V][\7___FM:#%K65K5K6FM:4I1O>VM:;WM>]V,8;WMC&&M:Z'__``````D`
+M``"#?_\`````BP```/Y__P)6M5:U2E+^5K437O=G.5[W6M9K6E[W8Q]>_W__
+M7O]__V<_9S]K7UK?8Q]K7U[_<Y]O?_)__PE:UFM:8QAG.6M:;WM6M6<Y6M9O
+M>^)__Q=O>V][6M9>]VM::UI>]VM:6M9K6F][6M9K6G.<;WMG.6M:6M9O>U:U
+M;WMO>VM:;WOP?_\`````"0```(-__P````"0````_G__!TYS4I1G.5K6;WM6
+MM5:U2E+^5K7C?_\1<YQG.6M:6M9G.5*48QA:UFM:;WM:UFM::UIO>V,8:UIS
+MG%K6_FM:"5K6:UI>]VM:;WM.<VM:7O=SG&][]W__%7.<;WMO>U[W9SE>]VM:
+M;WMK6F][9SE>]V<Y:UIK6E*47O=O>W.<;WMK6EK6[G__`````+<```#^?_\>
+M8QAK6E*45K5.<U:U7O=__VM:8QAO>V<Y6M9O>V,89SEK6E[W:UIK6E[W:UIC
+M&&M:8QA6M7__6M9__UK6:UKW?_\-<YQ6M6M:9SEC&&][4I1O>V][:UI:UFM:
+M9SEK6OY>]P=:UF][?_]O>U[W9SEC&&M:\7__&5[W:UIK6EK6:UI:UF][;WMC
+M&%K6:UIO>V,8:UIK6F<Y:UISG%K6;WM>]VM::UI:UFM:7O?R?_\`````"0``
+M`(-__P````!S````_G__(&][4I1:UF][:UI:UF,8:UI2E&][;WMC&&M:8QAO
+M>V<Y6M9:UF][;WM>]VM:;WM:UF][6M9O>V][8QA:UFM:8QAK6OE__P]G.5*4
+M?_]K6E[W8QA:UG__:UI:UF][;WM6M6M:;WMC&+]__P`````)````@W__````
+M`(L```#^?_\B5K5>]U*43G-__V][6M9O>UK6:UIO>V<Y6M9>]V][5K5SG&M:
+M:UIO>U[W9SEK6E[W:UIO>VM:7O=:UFM:7O=G.7__8QAK6OM__QESG&M:5K5_
+M_V,8;WM.<W.<;WM6M6][;WMG.6M::UIG.5[W9SESG%[W8QA>]VM::UI:UFM:
+MR7__`````&D```#^?_\C6M9K6FM:;WM.<VM:7O=SG&][;WMK6E:U;WMK6E[W
+M8QAC&&<Y:UIK6EK6:UIO>U*46M9O>UK6:UIC&&M:;WMK6FM:9SEC&&][_'__
+M`&][_FM:!&][5K5__VM:;WNX?_\`````"0```(-__P````!_````_G__&5K6
+M:UI:UE[W<YQC&%[W;WMG.5K6:UIC&&][:UIO>V<Y:UIC&%[W:UIC&%[W<YQ>
+M]V][7O?R?_\<<YQK6E*49SE6M5:U8QAO>VM:;WMK6F][7O=O>UK6:UIK6DI2
+M?_]>]V][8QAK6E[W8QAO>U[W;WMG.<Q__P`````9````U7__!6M::UI>]V][
+M8QAK6K5__P````!1````_G__(6,8:UIC&%[W:UI2E%:U3G-6M5[W7O=K6F,8
+M;WMG.5K6<YQK6F][;WMK6FM:9SEO>VM:;WM2E%[W:UIK6F<Y;WMO>TI2J'__
+M`````(D```#^?_\B6M9:UG.<:UIG.5[W7O=SG&][5K5K6EK6:UI>]VM:8QA:
+MUF][;WMC&&M:<YQ>]W.<4I1O>V][8QAO>V][<YQ>]U:U:UIC&/M__QASG$8Q
+M?_]O>V,86M9K6F,8:UIK6E[W8QA:UF][6M9C&%:U?_]K6EK6:UIG.6][;WM:
+MULA__P`````)````@W__`````#$```#^?_\&;WMK6FM:7O=.<V,82E+??_\!
+M:UIK6OY>]P1__V][6M9K6F][N7__``````D```"#?_\`````"0```(-__P``
+M```)````@W__``````D```"#?_\`````"0```(-__P`````)````@W__````
+M``D```"#?_\`````"0```(-__P`````#@0````#_````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M``````````````````````````#^_P```PH!```````````````````````!
+M`````M7-U9PN&Q"3EP@`*RSYKC`````<`0``#`````$```!H````#P```'``
+M```%````J`````8```"P````$0```+@````7````P`````L```#(````$```
+M`-`````3````V````!8```#@````#0```.@````,````^P````(````0)P``
+M'@```#````!0;W-T+4=E;F]M:6-S(&%N9"!-;VQE8W5L87(@26YT97)A8W1I
+M;VYS($-E;G1E<@`#````2`````,````1`````P```-DI```#````!`(+``L`
+M````````"P`````````+``````````L`````````'A````$````'````14U"
+M3U-3``P0```"````'@````8```!4:71L90`#`````0``````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M`````````````````````````````0````(````#````!`````4````&````
+M!P````@````)````"@````L````,````#0````X````/````$````!$````2
+M````$P```!0````5````%@```!<````8````&0```!H````;````'````!T`
+M```>````'P```"`````A````(@```",````D````)0```"8````G````*```
+M`"D````J````*P```"P````M````+@```"\````P````,0```#(````S````
+M-````#4````V````-P```#@````Y````.@```/[___\\````/0```#X````_
+M````0````$$```!"````0P```$0```!%````1@```$<```!(````20```$H`
+M``!+````3````$T```!.````3P```%````!1````4@```%,```!4````50``
+M`%8```!7````6````%D```!:````6P```%P```!=````7@```%\```!@````
+M_O___V(```!C````9````&4```!F````9P```&@```!I````:@```&L```!L
+M````;0```&X```!O````<````'$```#^____<P```'0```!U````=@```'<`
+M``!X````>0```/[____]____?````/[____^_____O________]2`&\`;P!T
+M`"``10!N`'0`<@!Y````````````````````````````````````````````
+M````````````````%@`%`?__________`P````8)`@``````P````````$8`
+M````````````````9VDYBPK(`7X```"``````````#$`5`!A`&(`;`!E````
+M````````````````````````````````````````````````````````````
+M```````.``(!_____P4```#_____````````````````````````````````
+M````````````````.P```-=+````````5P!O`'(`9`!$`&\`8P!U`&T`90!N
+M`'0``````````````````````````````````````````````````````!H`
+M`@$!````__________\`````````````````````````````````````````
+M````````````DG4````````%`%,`=0!M`&T`80!R`'D`20!N`&8`;P!R`&T`
+M80!T`&D`;P!N````````````````````````````````````*``"`0(````$
+M````_____P```````````````````````````````````````````````&$`
+M``"D(`````````4`1`!O`&,`=0!M`&4`;@!T`%,`=0!M`&T`80!R`'D`20!N
+M`&8`;P!R`&T`80!T`&D`;P!N```````````````X``(!________________
+M````````````````````````````````````````````````<@`````0````
+M`````0!#`&\`;0!P`$\`8@!J````````````````````````````````````
+M`````````````````````````````!(``@#_______________\`````````
+M````````````````````````````````````````````6```````````````
+M````````````````````````````````````````````````````````````
+M`````````````````````````/_______________P``````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````________________````````````````````````````
+M`````````````````````````````````````0```/[_________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M____________________________________________________________
+M__________________________________________________________\!
+M`/[_`@`!`/____\&"0(``````,````````!&&````$UI8W)O<V]F="!7;W)D
+M($1O8W5M96YT`/[___].0C97$````%=O<F0N1&]C=6UE;G0N.```````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+M````````````````````````````````````````````````````````````
+0````````````````````````
+`
+end

Added: trunk/packages/emboss/trunk/debian/EMBOSS_qg_new.pdf.uu
===================================================================
--- trunk/packages/emboss/trunk/debian/EMBOSS_qg_new.pdf.uu	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/EMBOSS_qg_new.pdf.uu	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,2718 @@
+begin 644 EMBOSS_qg_new.pdf
+M)5!$1BTQ+C0-)>+CS],-"C(P(#`@;V)J(#P\+TQI;F5A<FEZ960@,2],(#$R
+M,C$S-R]/(#(R+T4 at -C,P-3DO3B`R+U0@,3(Q-CDU+T@@6R`W.38@,C,U73X^
+M#65N9&]B:@T@("`@("`@("`@("`@("`@(`UX<F5F#3(P(#(U#3`P,#`P,#`P
+M,38@,#`P,#`@;@T*,#`P,#`P,3`S,2`P,#`P,"!N#0HP,#`P,#`Q,3$Q(#`P
+M,#`P(&X-"C`P,#`P,#$R.3@@,#`P,#`@;@T*,#`P,#`P,30S,"`P,#`P,"!N
+M#0HP,#`P,#`Q.3,X(#`P,#`P(&X-"C`P,#`P,#(S.#@@,#`P,#`@;@T*,#`P
+M,#`P,C0R,B`P,#`P,"!N#0HP,#`P,#`R-#DX(#`P,#`P(&X-"C`P,#`P,#0S
+M.#<@,#`P,#`@;@T*,#`P,#`P-C$Y,R`P,#`P,"!N#0HP,#`P,#`V-34X(#`P
+M,#`P(&X-"C`P,#`P,#@U-#@@,#`P,#`@;@T*,#`P,#`Q,#0Q."`P,#`P,"!N
+M#0HP,#`P,#$R,C(W(#`P,#`P(&X-"C`P,#`P,30P-C(@,#`P,#`@;@T*,#`P
+M,#`Q-3 at Y-2`P,#`P,"!N#0HP,#`P,#$W-#0X(#`P,#`P(&X-"C`P,#`P,C`Q
+M,38@,#`P,#`@;@T*,#`P,#`S-C4Y,2`P,#`P,"!N#0HP,#`P,#,V.#`Q(#`P
+M,#`P(&X-"C`P,#`P-30Q-#$@,#`P,#`@;@T*,#`P,#`U-#,T-B`P,#`P,"!N
+M#0HP,#`P,#8R.#4Q(#`P,#`P(&X-"C`P,#`P,#`W.38@,#`P,#`@;@T*=')A
+M:6QE<@T\/"]3:7IE(#0U+U!R978@,3(Q-C at V+U)O;W0@,C$@,"!2+TEN9F\@
+M,3D@,"!2+TE$6SQ#.4,P-S1#130R-$4S-#,W.$5$13 at X1CA!,$(S0C$S.3X\
+M-D,S-48X148W-C=!,3%$0T)"-C(P,#!$.3,R0T4S-3@^73X^#7-T87)T>')E
+M9 at TP#24E14]&#2`@("`@("`@("`@("`@("`@("`@#30T(#`@;V)J/#PO3&5N
+M9W1H(#$U,"]&:6QT97(O1FQA=&5$96-O9&4O22`Q-34O3"`Q,SDO4R`V,CX^
+M<W1R96%M#0IXVF)@8.!B8&#.86!A8#A_C(&/`0'X&)@96('B'`<Z;C`PW`$)
+MM9Y]V][`P*#!P&#6`!($`FX&QJ-Z0%H,B*7`(DH,_(Q&C!U\%T!<KN;Y;6^8
+MILE-L$S(^_!0\>"A[UU>#45,AV0N<&U1>J#=,)OQ/L,/MABHE?P,C*?N`6DF
+M(+8&8F$&QIM`^Q at 8@?@U0(`!`-,V)#(-96YD<W1R96%M#65N9&]B:@TR,2`P
+M(&]B:CP\+TUE=&%D871A(#$X(#`@4B]086=E<R`Q-R`P(%(O5'EP92]#871A
+M;&]G+U!A9V5,86)E;',@,34@,"!2/CX-96YD;V)J#3(R(#`@;V)J/#PO0W)O
+M<$)O>%LP(#`@-3DU+C(R(#@T,ETO4&%R96YT(#$W(#`@4B]#;VYT96YT<ULR
+M."`P(%(@,CD@,"!2(#,Q(#`@4B`S,B`P(%(@,S,@,"!2(#,T(#`@4B`S-2`P
+M(%(@,S8@,"!272]2;W1A=&4@,C<P+TUE9&EA0F]X6S`@,"`U.34N,C(@.#0R
+M72]297-O=7)C97,@,C,@,"!2+U1Y<&4O4&%G93X^#65N9&]B:@TR,R`P(&]B
+M:CP\+T-O;&]R4W!A8V4\/"]#<S8@,C8@,"!2/CXO1F]N=#P\+U14,B`R-"`P
+M(%(O5%0T(#(U(#`@4B]45#8@,S`@,"!2/CXO4')O8U-E=%LO4$1&+U1E>'1=
+M+T5X=$=3=&%T93P\+T=3,2`R-R`P(%(^/CX^#65N9&]B:@TR-"`P(&]B:CP\
+M+U-U8G1Y<&4O5')U951Y<&4O1F]N=$1E<V-R:7!T;W(@,SD@,"!2+TQA<W1#
+M:&%R(#$U,"]7:61T:'-;,C4P(#`@,"`P(#`@,"`P(#`@,S,S(#,S,R`U,#`@
+M,"`R-3`@,S,S(#(U,"`P(#`@-3`P(#4P,"`U,#`@,"`U,#`@,"`P(#`@-3`P
+M(#,S,R`P(#`@-3<P(#`@,"`P(#<R,B`V-C<@,"`P(#8V-R`P(#<W."`W-S@@
+M,S at Y(#`@,"`V-C<@.30T(#`@-S<X(#`@-S<X(#<R,B`U-38 at -C8W(#<R,B`P
+M(#$P,#`@,"`P(#`@,"`P(#`@,"`P(#`@-3`P(#4U-B`T-#0 at -34V(#0T-"`S
+M,S, at -3`P(#4U-B`R-S@@,"`U-38@,C<X(#@S,R`U-38 at -3`P(#4U-B`U-38@
+M-#0T(#,X.2`S,S, at -34V(#4P,"`W,C(@-3`P(#4P,"`P(#,Y-"`P(#,Y-"`P
+M(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,S,S(#`@
+M,"`P(#4P,%TO0F%S949O;G0O05!.1$I/*U1I;65S+4)O;&0O1FER<W1#:&%R
+M(#,R+T5N8V]D:6YG+U=I;D%N<VE%;F-O9&EN9R]4>7!E+T9O;G0^/@UE;F1O
+M8FH-,C4@,"!O8FH\/"]3=6)T>7!E+U1R=654>7!E+T9O;G1$97-C<FEP=&]R
+M(#0Q(#`@4B],87-T0VAA<B`Q,C$O5VED=&AS6S(U,"`P(#`@,"`U,#`@.#,S
+M(#`@,"`S,S,@,S,S(#`@,"`R-3`@,"`R-3`@,C<X(#`@-3`P(#`@,"`P(#`@
+M,"`P(#4P,"`U,#`@,C<X(#`@,"`P(#`@,"`P(#<R,B`V-C<@-C8W(#<R,B`V
+M,3$@-34V(#<R,B`W,C(@,S,S(#`@-S(R(#8Q,2`X.#D@,"`W,C(@-34V(#`@
+M,"`U-38 at -C$Q(#<R,B`P(#DT-"`W,C(@-S(R(#`@,"`P(#`@,"`P(#`@-#0T
+M(#4P,"`T-#0 at -3`P(#0T-"`S,S, at -3`P(#4P,"`R-S@@,C<X(#4P,"`R-S@@
+M-S<X(#4P,"`U,#`@-3`P(#4P,"`S,S,@,S at Y(#(W."`U,#`@-3`P(#<R,B`U
+M,#`@-3`P72]"87-E1F]N="]!4$Y$3T(K5&EM97,M4F]M86XO1FER<W1#:&%R
+M(#,R+T5N8V]D:6YG+U=I;D%N<VE%;F-O9&EN9R]4>7!E+T9O;G0^/@UE;F1O
+M8FH-,C8@,"!O8FI;+TE#0T)A<V5D(#,W(#`@4ET-96YD;V)J#3(W(#`@;V)J
+M/#PO3U!-(#$O3U`@9F%L<V4O;W`@9F%L<V4O5'EP92]%>'1'4W1A=&4O4T$@
+M9F%L<V4O4TT@,"XP,CX^#65N9&]B:@TR."`P(&]B:CP\+TQE;F=T:"`Q.#(P
+M+T9I;'1E<B]&;&%T941E8V]D93X^<W1R96%M#0I(B707VV[;-O0+\@]\%(=:
+ME2B2DAZ7+, at PH"B&^*WH at R++MAI%2BTY6?Y^YT;*23>T",W#<[_K\]U]K@[S
+MU?7VZO-V:U2NMONK3&T*K^!_IEQ1IK9255ZD7FV?KC[?S%ZU,[S at O[D=KS99
+MFF49/+9`MWV]2FZ_7'^]OU=Z^P,9Y75:`UOZ"^R`3VE6=DCK*J0E-J9"#M^2
+MWW5>IGFB_C[W>N-2E[2Z2.OD49=IF2B]R0V\WH7'G=[8M$@ZI;]O_T*955J!
+MRO at G4[:NT^J=P-SE0:#):Q9XJWUJDS-(*9/3]*PWID".&I!<THP at TJ!"7T!2
+M#N<$@@V\#%U[%MQ!;XH<>#1P=W">M/&`H:Z!I$Q]TJ.2=J44]'`_R/DFY.JK
+MKD'0,VG4,:^1+DH[F]Q/>PUBJV0!/JE)7H$[HD3I0L+(NLB`,&C::V/@*I01
+M47R7I\861FW_P&B&D,9 at IB;W_)AF-G.(\2WY$\+BT$"?S-I@*!8TMDZF$U[K
+MY(VY0X+9F&`7<C`D90R)<1R2>U`7]>Q1SPJ,WP"O"C(A`[^`UI0@$I=<'FOP
+M8 at X"J_4L*S at _!40T.@/$HQ"L?)R%<Y;[3VUJ\,U9&_80PD:ZM(&B"0JARSW(
+M&(3UF\B>220%GN`S)U,0]1S(V\?PZ_!!J5M=(*,[73B0?*,+&WZK8Y`ZA_"Q
+M?8'K"4Z0/8DN+W+VFC)@UVG28<=F<G2VOU$D2BH.+$:,#@:B^P>H4?6E&^47
+MV.(P><`VX,!9G%&&AO<,I)%2Z'+!@1),5+@>*1LM&EN1`:3_$]2V`])&YP`\
+M/1*2PT(T6.D+YA.4P-`U3+83+GV0?%#M)+`GG>?$$@Z(XJGM&V$SH'>@QF81
+M_A,+Q%/Y^Z#02)<VJK>ZR.:Q?]A2^@>HXX@(^32#-CF<;Q0C\A;YF=J5Y1JI
+MUY`);?LH/P[$!$*$_4!!Q-$#-]JAU^XT,DPUM)2:?`:=RY7\@%0K&MZH^G<8
+MZ\COI=/!!8X#1RH^/^F*RXK-8.C"=JA7UD'TFS7EDFI$PTO7V#K6L?7LFA:3
+MK"!)6,[#H*E#-0\"F+0-[=*C"$1>^H`^:NPGBI'VVE$.'2Y))DV-],S'L]"!
+MDHZ:)?GX5><9=SX4O1Q#:QF)D2!!N5GJ\18+_5H7'HZ1V7:+&"L*"GC'AS#H
+M^`U<BUZ;,7/([QZ`X,(2CB,)%)@8T*68$/Y]&?HZEJ%E/VZ/#:4_*,'SJ<0J
+MSV/UE<D/+OJNI32'RE-<9%[&`GK%T`0]45H7T'P"A@!V6`E at T/(!K@;*8>IF
+M*`/JU!9@<B]@J&KGR6C*NTFH]^APOT:A)A<4<4R623#I$B/(9%@KJD)'`+\+
+MD!0GH_M..+U\T/ABH%W,K(M!X\2QD#D8\%E37X*<P`Y[H+_H!T<CP/&8(.%0
+MDE at L-]I3I1&BEO9+K!KT(FI.QR.Q$!CSQ9"[-7'N->;&LX@*M.1>@TFXUY*]
+M>!&NS3!`?[$TW819OS`&]]V>#`+7LD$3&S1@:+!\1SD/EU)/V"LL)AB3,,H\
+MTU2!X#\(9(@.^75K at .2U14A>Z0$X=HUP9`UE_O"5&J/A/DFI!)<3+4B4843Z
+M<";D(KQ3JRJI(/%LL12*1&X[G?$<Q0O.E(H7"4?^8\(Y*+,72=3M:LA!#\\-
+M\X,2+:(HUF\Z$[`-4,G2:1<!9!NS.8K2439Q/0K16328D3*G*8>I*]<X/LG^
+MH^!&*9<S._:*@OU]A\T+AP9L"T6XB="!:]8E#S)<3^*ZDY025#%L-]0)(M%1
+M<)N`@>`J48%'UX:21V]+$=H8YW[/6N_)0BBREM_/0DX#6<8[M(ON);`=Y8>L
+M#8ZVB*C53EY[)I_7##%L%PL+]@9I2]1N]:$OUR^8;\E#C[E`.Q]U&VC^F`J&
+M<M6&24D"P2H:Q\7[06C6':&JPT=-87E\&AF?9`K4'"?K)EM?S[3_#"B2FBN-
+MF4^H5!4WR(6_*(XZYS%#W.2S8.+]B2]/&/\\;/HB+RP/%26(SVEY\!DO#_FZ
+M/(0AAMQ?PHU4%>TF6:J>`_]@H.PWQ^8E*">0!\&,GS7$5459O#3US/X@[$<Y
+MY3LJ7`]D/7:!]2M&0H!-/[1Z"<'"+<TFU"FQRC%EL9-236&G]-SL/4[L:IU=
+M!\+H>%$<+R\G1*BYOWO97'+2D'A.Q'./A5`'9H+;LJ"&CQW.CC)(AZV5%VS2
+M4S`5M?0ZX/S$9:_D^14)1[ZU+$*`[^6R9 at W.#](4N.*W at 3#_G\%9E!?U,4_[
+M!;=`VFL\<385SP]#^PT63ZII#?_O&7$QB%WXXMMB@=0)CUQ0QUU^V2"4+,#/
+M-)ELY'H;AI<0G(E\D%DH at VK'@UG)#!WE&BKIPY0/WU(\A][+H"6A"],S3-Q;
+M5AUVQP(V1]@+OO)><(_P`@Z/SE*R'Q#/(L[7'T'5B\F_D!)5$A>%[^I?`08`
+MS/S,A at UE;F1S=')E86T-96YD;V)J#3(Y(#`@;V)J/#PO3&5N9W1H(#$W,S<O
+M1FEL=&5R+T9L871E1&5C;V1E/CYS=')E86T-"DB)?%?)DMLV$/T"_P./1,JC
+M""#`Y1 at GDU02N^PJ*:<X!TJB1JS(U$3BC&O^/KV\IFC9R0D$T#NZ7S?7O[U:
+M?_=JN5CZ,EMO^6,9BVS]^=6?^;TKPB+D[YPO%D7^QA61EO>N2(N4KU:N\(LR
+MS_I+YD*U\'G+2\RSP=V%2#>=[C\K?79QH5S4^9,+M.O=7;&D=:25%I!F)V%-
+M^=[14N40C-V9+DE_UQW!_)*USV!H:2U)I\D]VL'&W24V\PA%V2,X(.V$^P<[
+MAA>?W%V,.6S.VF&7N;_6%JE8!`[5'7TFC=2QWYS9RD:C4.;GWH6"C.Y(!#FR
+MU\L3.<^.D,J&O+L3]T1)0S%('+5_7"J)AL+4,+L>#L*WU0W.,FC2N_;X(AZP
+MS6271R0*WHJ6A0MAIO37T:4ENT;^1R$7<Z'H!&<>(=/V[3AYE>(DZVH(F[S3
+M)9LDJ at CC=$N.]M?R.$HM/)N%VI?1LK)H--;$FT0KVS_(^P6\G]=,JBV3)'>8
+M&)FTU5O.P<;D8.F^$#=*]'Q^Q/HB')9O'OD6$&5O^1:0;T'SS7.^/6V$)TRR
+MC`?&("-)YO9O^[IZHU(O9%Q`&HHCXPEZ3C-]+/0BCS+IN/7G!#^@>I[3/EI.
+M!^\UT@\=QX:B at O7,KR7.0R4'[K4+GB/\R#(;BBW'<8/+GB\;<G7.\4(D:@0+
+M?99=V^O=41F at 8@/_<=J9+O&1<I#1Z4GXP3Z"D*]JHWN$^5M=8%-[-(USHS2\
+M._4%8IX[Z#_!G$=<@&R"J:0A7DIRR2:#00<YA!T:]F7&+OJ2H.0GS70_/4!`
+MJEOQ<'(")1-KI2(!:E at -GD`I0%-/Q_KND?2;(!&1K5K-C#0!7W<&YX^NFC0:
+MD<!TS,_&;H4_2+&75W6W>NZE=T3J'2QT$,LUJ9,A0O8$"PP'S9"M^?3)>4Y_
+M67S^-("^AV_F(P%@5=/Y0N/[_7H=, at KI'I$6T)9(%[7`]U)C_+9WOA9T#6I=
+M9(^&BR6P7`X,JD7^,(F.*AJUDYJI'X1*Q:ZY[7D*/+50CD>JB)\SA;LJW[QS
+ML2"OWKB2P>&]*Q/1K5S)\5YQJZ7P;97MY/CN/,&_B&J=X#NCAR<+;3WV6[UH
+MQ_Z$LT&-,*R_6(MAJ?W(89]9J"_97Z:7%9YCKV00WNDR0,$%W#M31-WA2;\'
+MEQI:=E_$X6Q`;UDJL@]BT&3(O`E\71J_N/I:$H,E38O<.B*W/@!]$P"2_-TB
+M-=_"=O2I;6?)?NFRC[F*4R4?>-*I\K?JPD>'_&R/)O,D>?V9,*M&7HKC\P*C
+MH.QA8V?%L3V!Q-KL"_:6V3,1DMFO:2CA/C`/3:RL/Z92(_-)[*"LV?5,7^=[
+MK-M6XMU(Q7A!0EW9#NX+ at W88>7!CYOFA)N]&W9[%M&IBW7#U,JA]0Z;V#JR9
+M'>PYWI&140D/..\X";RVP\3X+.V0;Z0=*HG:O^#:O)D3>&;5%(DUVM?Z((!;
+M*0SQE/>&G[#D$;8@<2M.\887!M*WTD*HYYS;,SX[\;VPIMJ>39X5!;D0=`I@
+M<DTA'I4O(-QEA%;2:G<XX18Z\8_*=T!;N9$^0OK7UV3+9"TNZ5TB&?CR7[WE
+MVMP9!JV`:IN7I(#2;+"A`HK7\ID-+S:U:/E$+I\X%4]@SS4$B[DE5^SU"I7R
+MEQ'5D!]<K7/J=5R-Z&<E3PZA1+[1ML5VU*U87TA'C-:&M9 at JG4J+'$/5E?5A
+M^CW1O;2=Z5^#BZ?"=%G0'\9F_C,#>$0P2C/*O*\FZ\VNS-5>6U80$,2Y`$&9
+M7RLM%/;34])R)T@)HDGVF(W=V<R[2(Y$183(6`23CE-1\&,O&X]HAP;1IL!*
+M@]MSO*>@,79Q%`ZX[5'U6P13SRNI3B'H<,$6Q:!3;4J*$\+)<&?!4%)R'BV0
+MI^YN1\=!50GC14`H3 at +.XF*:[C>@?X(I(\[MGARK2OQP,%UVZZDQF(^=C9$,
+M+L4\,*)WY!$T39%IS>$.[T$@)(]Z.VT`CYIKRTIH6>]Y%O+D2,7FD\`H[8(,
+M]@T9,'T\.$&W>R+@]'I'QTN"+L]>T)Q049FM7%T+ at A51<O=;4PE:@T[T^$^]
+MY[[=D$C/DT=1,!1R>:]6VM"I`3B*?J#4'0\`8 at -F&_JL(]AJP+X%.EL'F'6;
+M>,7WG6.8R![_!]XO'/GK=+!5QI:?D7L4CC<W?>,Z"$LOVV"%]O;&N.%+[EWV
+MC(/>Z%7JS^L/\S935J7%M#+\VCO*.R[JV$@:`4?*N0^C_K@<]+)S%36<%8]A
+M at 32ED`\/=I,8RT4 at 3>*IQE](/HR.LL6;%NX%5/Q1,.D/5S/O[[ID(G!T5=)1
+M(?M7@`$`217>A`UE;F1S=')E86T-96YD;V)J#3,P(#`@;V)J/#PO4W5B='EP
+M92]4<G5E5'EP92]&;VYT1&5S8W)I<'1O<B`T,R`P(%(O3&%S=$-H87(@,3$W
+M+U=I9'1H<ULR-3`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P
+M(#`@,"`P(#`@,"`P(#`@,"`S,S,@,"`P(#`@,"`P(#`@,"`P(#`@-S(R(#`@
+M-C$Q(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P
+M(#`@,"`P(#`@,"`U,#`@-3`P(#0T-"`U,#`@-#0T(#(W."`P(#`@,"`P(#`@
+M,"`W,C(@-3`P(#4P,"`P(#4P,"`S.#D@,S at Y(#(W."`U,#!=+T)A<V5&;VYT
+M+T%03D5$1RM4:6UE<RU)=&%L:6,O1FER<W1#:&%R(#,R+T5N8V]D:6YG+U=I
+M;D%N<VE%;F-O9&EN9R]4>7!E+T9O;G0^/@UE;F1O8FH-,S$@,"!O8FH\/"],
+M96YG=&@@,3DR,2]&:6QT97(O1FQA=&5$96-O9&4^/G-T<F5A;0T*2(E\5]MN
+M&T<,_0+_PS[T8:>(-CNWO?C-:5P4`8(4M?)0)'U82VM)K:R5=4G at OR\/R5E)
+MCEL8\&AF..3A&0[)G7ZX*HLRAK9T65G8)GB;V6P_VUQ95[0AMEF93=]#Q@:?
+M36=7-/U^]25_.)B)=X7+MV82?>'SPDRJ,M^;B6OSCOXWM+:AL:)QP:/+^QT=
+MLH6%L/<0L[0[4^G"..P=5?@?5?PV&3K>CRLDV.:WQA<Q_VBL+:K\G2&A*O]D
+MJJ+.[^XR\]?TP]7;Z=21-],'0HT_N#5)?I%M9RNGWOFZ at 7<3^EG;2GR\_6A\
+M)'7O/IDFDL$[8\N:3-Z9IBQ"GBT-`0WY8%P at 5(^&7.I-:`EK1C[41`WO=XMQ
+M54$%!?4Z\20:O!MYKYISWI<'.-_D.FQ-20"O94),13+SUM1`^]U4V/MNFIKV
+M=%:8T!#(NJ7?C_#.Y_?#WKB8[T%_/NR,(W[HQAQ._0^-BA(L8E068YU8#"X*
+MXC],!*JCL+0QT6ID$(25"?XT6\`VT42\5[A2HMT3"-`>B<<[.?J2Q>G/L!S*
+M.%JNO5B^04RT^1J.K<EQ"J[LUCCX3C<+_]Z9V-!`45.2>MJQL%)!<+L3-,-"
+M?W1PH"76$`)[3`BJ+JI(#X0M(:3+G^-?+]LJO:(GPF^A)@,;4R9Y%LT.S#__
+M5)'[49_,=Z:NA,F:CD/P0>PFJ*22+C40OG2$E2[9%",1\I0R%Q)ESEFA;(:0
+M;4B395<]XE>'3K;(<".8,61KB1=R+<"IOL#<, at 4TT!/%X^Q,Q$6J\J4>!<,X
+M-!!61,C"((AU48^H[6S9[;'`C/-&MM_VHDZUK at 3(@XXS%1,<BE9/[`TG&#VH
+M!M6#K8(YR%17$\2-ZGO0=?5>]9Z3:Z,#N5_RK[F))<G<4-Q4^2^4).AZWN.6
+M<'^LQY,>'GHS06+Y:HSS9_=^X*SIB3B at X+Q)ZT$P>@VW?C_;K53P7 at 5[%=S_
+MER8&7L%0'+WEYQ@='=L>5>P`-\F_;C//AJ.:_6%7;6Q/*.',3GSIQ-(CI7P\
+MO/[2!75\1^6#D at 77!PS9#8FWM+&^H.DBB)&L-8BMOGM6VI*3*"?TANC$%O8%
+MB^?8(B0-X0$!XH"5WP2!?<\0'8Q:(I[`W(LJ"3Q4+2M!1^%`M*805(MS/23Q
+M,B0=KT!C0P,O/$J]$6CGMN>&:9'7IO?4TFM[@\1/.KJUK. at PR*GOIAY%N00K
+M<^6+VF=KYI!^E:X6"G%/D6M;$/,-5V:-^2CI$'RBO&<KKN`M!TZ9'W"YD1.=
+MX]PX0>7I#BJ4A`<6WJC42QTG(=E^J6VK\R6+I\.SCDTK1*G"JTN-/7`_"/!N
+MUN\YUJDPGE-S*FC!CCDR-$ZXF1I?%A6G:B"CK%PS.3S=Z&H'",TXQ1.]E7-4
+M>AHT%2:B$*'T<&OA48%B+6G1(V86^D-5X4H0%V]0R=SX9O^FWH*,0\G^@-]I
+MXR!=TK.V4Q2U49]I>NM1,@*&_1ECR..CS8:"H$>?YKAW@,R?R&%-\E_]WB'+
+M482JHF1UK_K[I,\CJL8'#%ZM5&YT#V4C#'>B<TY*4'XF`3D3R8WCI6X4?HUV
+MD]/\@6<[ON(&F2=Z]:WF.*/:F279I6H86/N1=]=S?:@]X[8<A<3*D65V?2:J
+MEKQZIMZE+)V?"_09FF++%5L0#6IS(5A&G"57V4E=<DM1\E-.N[U"ZA32MPOC
+MXO^:.4EK]VI%5GL-?Q84?RX*%/6;&MFV;87W9XZ-F`_'G724V4^_WTAC/45;
+M%/+?3*3]PE!6;G_H#BF\&_31L2Z\P]>"9)=3AJ8N-STA)HO\0]/DR.W/\JV`
+M)#K!W5-*12<_Z*O%4R"FI,I&](*GLT]''C8S_!=M&L8W\_FN1\E#H%#AHX#)
+MJ!ZSYL^&OT3NJ,30"93<\I7F\B(?L`N2$)`K0Y6<F7#[A:**7,L71_H;[B;1
+M^-WP[XRO at MO!22E55RXXDZK(#RUR3?2EI+9:,F!(CP&D<SP+0TA<2<N>QRK?
+MZC976%0ITKA2C70D at L)GUIS@;'BV2/K']#&B$'UI8ZW'$HX9&^H2=-Y;G61J
+M-I!42S5\X4'WTH>>&M:G8Z)SDPSU%WFC;)LQ;]B4-]!Z!#:(0C_GJM)RCP+/
+M/5NHT#=/G.:`B&O?(<DX31U.^A*6+YB%L8[CJG%U2SW7HR[)KY/IB_DN:5R_
+M:M0B*W)@*#I^R->*>HS&ZOQ3IZK#V0?AKX,VL(\&NJC,!C!_C4].:'(NG].B
+MPUUV]VBC;?I2:61[7"(U3?Z$TLAIO9)J&:2,5=)46V[>>-ATC\@-X_SUMW/6
+M9C32$??$&8&K4LT])1!;Q(IZD3(="-I#<_5`\XA>\)X_Y8"]KI*C`!J=B*"1
+MO):^G#]L9Y)`?3X[R.I+G!,U^Z+R5WYL+/6AWYK*4?;[B(]6^CPU5:"!"GCD
+MCU0?N(Y75KH9_=*0Z-GPW0S\GZX+A=!*)^K1S:S7S[R5?>.AEU46?!:*N?]!
+MJS>H)EZ=ZV8J%'SL@"\?AL#C/-T1;VY4S4$!/CSKPBKM+)).O&K%3^36=/@)
+M+4M#H9%NO6:-/)N)?ETDBK-_!1@`)_CS.PUE;F1S=')E86T-96YD;V)J#3,R
+M(#`@;V)J/#PO3&5N9W1H(#$X,#$O1FEL=&5R+T9L871E1&5C;V1E/CYS=')E
+M86T-"DB)G%?);N-&$/T"_P,O`=B!Q;#9"\DY#F8."68PAU$.P2`'FI)L)38E
+M:XEA!/GW5+TJ-FG90`:YB.JMJOK5JZ67OUS]M%S&S&;+S=7RQZNR*+UOLV5_
+M56;+IZMO^69G%E55U/GAP2QLI#^=3ISHVQ0Q/QKZU'EF?E]"F!=AKJC+JLY(
+MS`>6:NL`J4595HV([OA at FY^-ST^LQ>6L(A2!5BPML((VW^*WQPRK#H7-[S$G
+MO\]T/+LYX_S)8#D3:7W?'7&@42$T'4I:'[#\MC!>R63#&CK78N4*4[@K;3!5
+M32?U`MD=UD3'H#K(^!#S(J&B$"\4EH4M*N\J!2?6<0;Y!Q-)=,FWL:SEAJX1
+M;.')E%"]PMD7OHEAPCG!')R(>S(UG27KG"5H[].7G!@).:`0^)J1MC%T at 1>&
+MU_,8;TSEV-LGE7-WL4^0674GD4\@E_09M3#F-7-F/?[).K+(T])AW8F(U7.6
+MEE6*2CWO1^!/<B9[5KF[\T'M`CH+!>4ERC:`V&1069$+`,X1B@!/@$+2'!PQ
+MILB6=VO61M[N^?*>5IF?K/_!M,S&827J*&Y$:)6\F/^0F>4?[*9*W&2+,G@[
+MN<EZWLL&T`TKP%B#H)%&3TPH^JYN+KV]4#E\,QO3S6(]>MU%N1CX+,PGD0TN
+M&H&HCC-H/(&[-`;-[<Q_W8VN2)RTXC/\&;WPU\6.K>H<=7,86_8]142;9D=-
+M.YT?#%^578DA7!F82L=Q:F9[Q0+(#=Z18S2ZRDL_S_SP+8<;'4CT,A1MT;BZ
+M21[1&&2/3,'V>):K8C#(_Y[_RT3W8!SGB;I]%9;Q(BQCBDNGZ:_O!D0?JR+!
+M[8C]&K>UB%A.`OQ[)_N`#&$U7SJ:LM"4Y3EMD"#)U"%)NAX=UO>B:5P08)OT
+M%;GL&*MIDMPPG$=Y-V3``BGOFC;2?HTV2HD$_ZMH2S?V>F/D#,D8DB_HSALD
+M)B:'SR7J17&0U&$UYJ8#6]XI._1:G.!:%8O57N7<96]I!.^/.GHT%5>@:EPE
+M'^?]3)4#2"4R"V1N=N=A!7G7'+E.,V-.KO'LFN_6V$XJ>6\O at W1$\PH#V20@
+MK0+)@=8 at E(.$I><ZMLFV&S9R5B.JL183T_TEU35`J+K0>=0O1+>I&Z+_.V,=
+M$XN^I4/)>\GOJ at C6S?C=Q&2DIM:-9,^=X2)+W8/5>D"<.O$M*P5F"V^QX at I1
+MC^O4^9Z^J+\]CM#5E*-K0QQ=Z6JAN>)G4:8Z41=X692?\9N*-AT_R#Z(RD[=
+MG\2:-ADR8'2K(N!?JWZ2AF!$@_!J6MM>$-]'/Y:9P)-29 at A,9(V:KO!H0HO&
+MQU60A\G!,/J]#'0NVTBN/,AGART/QI=\Y4[W/)C(\:'2[D];0:[B$B^4(MV-
+M@(V8_Y^F;"=Y-+XVR""CU+T(../DR02?5JC"A$DTS0;_O59 at U(OYZ?P\,-K$
+M.2\XL^4>5GC"R3HT'I9XQT8[<3M5 at NV@T]FX?C`EV`G.]]B\1G6KF9<MQ[\N
+M"@\#=0JC--1058)<O-EJ^W*O7]$^*NTPXKSF-=VSFC%)KXEXGAOJ=Y=17%Y4
+M_5B[>1B3>TH4W]J#)8Y!>.9JQN!9DOA(];B1`+<4.36KWQC?2JIU4OFL])TT
+M^;>K#$+N'^USWZRV7$.5[K75YN/C9]9>Y^^_F(:=_Y62"'/TJVE`W;UT>@?I
+M?7:W^J>31/1@)`^)AR[RCKY1I)Q*C&F?^YMQ#4(^EL0`^LG`X%:\BC[#)5;2
+M+N4&[EO#*90"!IJ7R&K3WOOM41L=[)R+V)B`@OQ1[OO9>-[VWD1/GR\F1KJR
+MX^3SU<2*PV7/1B"<JWRG^F]-'*=4,W/#$5Y''I+13\9:]%?2L<5Y<$4)C<G<
+M7J[+YB%5A/$SQV$E8+PDF&`;W;PZ/.VXHAZ96TP0S\WR0&9*:0X-0O/R11*I
+M]Y'2P!ZRI4V]C_JJX$:#F?`KJGNM'0@%W>:,ID]BIY`:3\3%;CSR.(#NT<1&
+M;3C9#50)BY#&TJG2FU7GN4>:'+=!$^/U.4C87^+0%K9LIE[=:>\V`>*L-$_.
+M(9Z`#8&"%ZSC2%LS4*^;0F(%29Z*9IV*YO@>Z0Y&<.`&(7N5`A:V*0*7[XL8
+M;/S,P at 4;9%%J6Y0!RW&Q9R#O$&(M=7(4]B"TKY'%7[TI0SL5=V]=>CA9T?$)
+MW4*5'TD"<@-\`FTRWA\0UHZ#FEWQ8!H0J$(IUM.#*:<N4I5>=I'I9>-C2G0+
+ME(0]^E3I_#C>\&+Q(.0"E>JD&[?Z[<V(2\1[I')C_\:GT,'1\W,M>5B'_Y6$
+MK:_GT'=G3>>LF[BU>Z-O8O\E:*<\-C9WGXSC3I*,MDS=D\$+EP"^UW^IY/H"
+M?6<L\'*LN+^ZG4]2F$84PH5%+ at D,]I-Q>/"B:O&1'5.6^P<^2:6[DJR;_2O`
+M`'Z'[]$-96YD<W1R96%M#65N9&]B:@TS,R`P(&]B:CP\+TQE;F=T:"`Q-S0P
+M+T9I;'1E<B]&;&%T941E8V]D93X^<W1R96%M#0I(B8Q7R8[;1A#]`OT#+P&Z
+M`Y`AF]U<C at F20PP8"1`!.1@^<+3'&E(6)0_F1_*]J5=534JR)_"IR=[J5=6K
+MI9?O%JG+0E5725IDSI<N6?ZZR+,<,\O5(J7/VOMD^;+X8#H;G!FM\UEI/AVL
+M*[+"]#OK:AJ3K?4MS0_R>[9U17])9^O6)#;ER4^RML$UKS9X^GZQ)<[PMYY9
+MRZ[,^AHWV(_+=XOECXS$.0=0.>"8'Q*[_&?QTW+IDB)9;A=%E@=?)+DJ4+8N
+M*E`TK2CP,A"2)O-F)"U*TW?6A:PVS[;T-$FX\JPRR;^=[CK:HJ7E$P`U9M\]
+MZ8X+H+78>+U8E]/G(!<)6(+D!5*JF.Y-ZT,=D;F at IB4[-*0T&;7*G#D>94R.
+MAY&P>)8I,YTM<]IXM'2\,7$?#&PN>QOHAT"R0\2,NO\++W4'/4"S-/E$QPI"
+MKY,;V9I$+_'?LRT<:?;$YP<]$$&1%=LLF.3$JV<<]-.FW>UD)Z">;5J`/:,-
+M%0Z*J!=;%+/RI$;I1%519-SKC8/>F-,-T1Z1'G`S,Y8^<E^*5=>";T,GR.<K
+M at 7*FVUH:#S8M:?%DTU"P at 5-2./`TQD'G>]:5L`[ZL44`U+/-978CER>Z>NU7
+MM%#]W[U?7RAV[U9[,J at L`2L'E9S9Q>E.I)%S\CL3^#Q,U,J=&.$WV+HV[VT)
+M%O]B0T/#'[;*S5\P3T$#;8#?8T0ZLC7"&RRKP`Y:?-(8?B7)$2HB%72#;SC\
+M0:RZH;\K'Z(X`:E94>SO=>1K7Y,3<0..'IYM+8[@U0O+>T4B,=<;:5O=C:FS
+M2$LNN&EO\XA"MX)F+=O<S5+Y1T0AP!D')+'Y<H[1HIIBM`I3IOE@#CTSL"",
+ME*ZN%EYE8]T>O at GP8G9"K3>0!TDP=`.7^@T2!J<<1\/:@ADC=&B@%&\:>#*)
+M^=0C%<$>--G+$'?N>:?>168==FS9VG0BA<U!"95251W=O$1XNX>CLK26VW5R
+M*Y*1R.F/'7NCR),JLN^^*-]5TT$N4<`*7Y59R<V*+BKS-*&X#>DIB3N-Z95$
+M7&FZGJ/":U24$H*5!+W(,M=1PJXTT^98C%:#'D,0D25 at I(K,W_7KY*B'.$64
+MF@(F`<EGD7"5H;.H"<?#EO.*,X?-6;\H3;)!LZDN:*E2Y<IJYHG6@=\MHZ2*
+M%`C+:2!'PMBI9T&P<*MP&O@`R2'Y?.T@"&&EH4L>0$2F)?BDOX+*C(\U2A/'
+M1%E?-P)E8L at M&VX<+N/WN5U,/FQG&E!:XNO?H_"52$OH'I"6Z!PGIDH24X7R
+MHK<QJ0>5N&/J3DQG>,+T&$C1TX+T at 6ZZ.+'NV381_?J`Q%69[4%8/D6I$O4U
+M7L$,L^P,U;^/X.Y8W(18F8HFME*D(>6K8W<&?5%\9:*WL%Z0NANX1$^+7$N=
+MY%.'?,A_$K2?R8!\L!,F at BC"Q&HJV`V8R%HO*0W6Y-K4MYP9J=]!,0>;[GXF
+MF#P9EU(V[^4!QX57]W?:S.G82^FCM?.TR,"O/,F=!$687 at 9%N"MY*S]K>ZKY
+M>>ACS^)";%#O^L<Y].YR-?B>-]R-?3`IH.=\BX0[*TU at 3CK_&#G$B="&J>'T
+MU1S.E2:K/Q''W`2!Y%)&S&4$]3TW.,32$6T.958J+6PKCW2B`_5I13S]*AO(
+MZA57PQ"@'C4 at E?3435PZB90#-V)@I(?31*0T+6*M>+*,JJ6JT5O5;$H-I^\*
+MQ9)"Y*W88]=K$='%3YM8H?Y&/]C.-9.'?3Q[[T_D;F"-7BBJ^H88*=)3263=
+ML!%CR\O(`QKW<2/SC[[U6=X4Q8UOY[ZJTK[J$'N`G38'!^I#OE!O0!;ED.,2
+M(EUL&RV,[I?P/IIX?FNU:F**?_1]I1/#(EPW0I1D+;,;<2DWPD'Z?&IJC[I+
+M-XG#Z1EQX7P7T`7<O53N*E+9^%OC6:;]@'AJS>DBO^25AF>YA>I'Z<H>[4<6
+MP*MKLM]<QHMZ"@TPG'0KX8]GVS)Q@[QUG+0WJ6?/:Q(NF<',W2O<QK&..KF!
+M#=#9ASR[[1?Y9CX=E_3J^RL'E3O+9[D'&>)JWQT5UZF+\EA")]=``P6B4B*L
+M\=LV3]5(]UPH_!V!NRLSN.9W!*$8OLY"`<EPXK^$*YQ9*E%_MB`(1^(T4(XK
+M]/%3QG9."W/':2]H.^&Y2Q;3R?^>@]YSLF6&-2#_6G^Y2V\DI@/:13D4!8P;
+MO?TR+<AXT+%71#L=1^&9(*/63&*.&XN&7EE3XF(C?+.'OPO:%[0;_+K1MUO!
+M7'[HZKG-YXR!]T;%P:@O%.R_3.^!'2U.#\%*(O2FLE4Q"^C"V>)0=OMT?:,R
+M<==0`G[RGP`#`-*]TPD-96YD<W1R96%M#65N9&]B:@TS-"`P(&]B:CP\+TQE
+M;F=T:"`Q-S8V+T9I;'1E<B]&;&%T941E8V]D93X^<W1R96%M#0I(B817S8[C
+M- at Q^@GD''ZUBXUJ2?WLKT%.!HETT0`^[/7 at 39Q*LU\G&SBSF1?9Y2WZD%">9
+M12^))5$4R>\C1>7)^MO3AW0UF94KT\ZLBC;SZ61<^ME469LFYM_U[T\_K]=%
+M8I/U[LEE955729ZL?WO*L]R6-+OAK[QTHNI74V<E:5C9S)(24IL5I,;5--P=
+M=7PVSF=-FLQFY2V-]SK?&U?1[H2&->MP3>92$BIHK3N3<$[6A4WOS*JDY:0?
+MMZJ_&PWMJ-(PUF-ZL\I)ZTL?-*AUX;1 at U>[_K.)8K#0$I,$5WG$@5AR)$`AO
+MO02"S:_)OM[DI./KA88%:>E',MO2QZ9/#O3)T:*IFNT^J<Q%1>88?B?A7_^$
+MP_*FQFD*7HP6[=A2L-CU(Z!TK`KC^1Y)G_FZ*:Y(%DU$LA2]?YT/"$3-]I6.
+M(C,;YQC-XP61J06:FNRV%-7KI$C-NON(U26F99#9ZI;C)6P2X#ZF0*H*!^Q5
+M#DBXH&MS[CF:6/EH&#P"Z=[FZXG0U'>B8JMH:A at 6:'(PVBH$(Z\E&,R1G!)B
+MQPSS<,YQ at API36R:=,;;R/*#K at U$O#*GF>P'.-K<+G'<P=0B95I4Y/Q`XU:"
+M@/E>?3T_9F7=^"9B63`%-SBA:*PH7QO/.=`9"DJ=?N[E'X$D`P^22B,,]X0G
+MS38$:`[0BX8KP<Z4.3(J/7XQO at R0TNY)1;91#;8GA"))?X:6_E5U?SH2`O""
+M]6U%E-"C0:(KHRD+FM2UF';PD8&R54P[E[<!'Q*N83(8:$%+F8-YDM=LMHHJ
+MB71Q>^1#%\)WB%'T&ILW"0'3UCX$.B]CH&M-^W],P8'>&\<%B;1Q%B8K^:?9
+M5 at I/P?P@,]E(GDJ0`.ZZM*KD9^()Q)KLL^DKY9YLN.-`?L]AYQ;<6N][SH_J
+MP2\K;L4RX.'1A_3['K6H37M8<7J#<KFKKY2K7, at 8:P,B)3!8.:ZE\^&H7R/F
+MD^$PS>`/EV-/X,][(RE.);%"+J6'4?><C'=`%_5E(A$$K$)U at 3H6?T/#R0C5
+MZ)PV#18\+R<[D?["L'%E092[X=;:9ST$B]^,YV)]H..\)!$(2H6;HW>+0E%&
+MAI1.&<)FLI%ROPJLY&D)+]E'XF_I`;'DU\RYPW0ZW6P,E1*WS,2L\&'UJRE;
+MTN1=F!CY>\,RA.@[3C-W3?Y1U7-$F8`D\XR3('YFK_F:Q;+JH(1%85--5%VD
+M3./$Y;9@;A=F]4X,LXWGPL'F;GGS@<\0KK!%')4.!@V\()&FXLE,;6*-MEJC
+MV6O:Q'XSALRJ`3ZVZ6&'\M.D!VX"\(6(T8W336"ZW$T%&$57)SE*(RZ,.4C"
+M at UD&/2LFDX&0,L+:(#KKB7L50(B_4,.!'L9X+K*D_E66 at _0K)B596A3Z at NTI
+MN8QEW*W4CYE;9<2SZPW.3<DUX;^_R,E<Z"GJ=9M^8G\=>9>3YM+B/BG=0QTA
+MT.K<+Q+[X2HD_E-`AT%Y08E,YGHIN[7ZG.)"'$"2(4Q+'<^E<BP*.=",[8?5
+M]D-"(W>_15I[9&@G_\P9(CSCX"7V==QRT']&DHOYJ"HZ&-JD@\+R571<H$/U
+M#D&',*:*C*F$,<1"D+@$2M`6U,Y]-`T56Y+W:.)=^4.?@L&C&GS"GHM*H=(5
+M at 2PUDT7OMZ!%SI^2W5&GU,3D1P<"B_RQB2UB%ZM at GT!"3ESN11#2FLO#[6Q'
+MI"*.U\RJ3!LP]7^-5'9IO$\T9[0AIMP:T`6WC)J7%HO;GR:.>X3NK+,30TT@
+M=.'L/EDHP/^$HHIH8TP=.#K-`G4S-#S0/:HC29#=WWDFA_>)=/.5CC=\0M0?
+MSI78C/@--ORB![W1`:)3JZZ=6B$1_P.UHJ*86E1`I92G7VHG"&CJ8,ZOW(92
+M3KWG3JSBDL?+S%,F<`&C4$$IF!ZQQ(C[Y_0\&7V4W69^;$I#QOO07*WU,A0,
+M+8)0X=*14MH+&@W at G>&QU4B2<$+,*+CWD#A9?>XX!4&J8P4O1'T8WV!UW792
+ML8L>,*O:R>3Q;?!HQ$F_P".&"J/GZRS,[]2S:,(8%/1;_9JBAT%)>&T&^X.A
+MF<1>E_]&B0][0DQZ=,?+BVW1O;O02J'WEOZ5,PD--5"4`L_9MN]>8E./!-/V
+M62>A0;O_BZP,HB[T]R^4B/BZA(UHQB?>$WVDVN^UG%2HN\2+AIL"%MVKD`YC
+M-R]M_*?EFR.-UJ_X<3B('CUR,X<A-FSE.:!NJ76Z_^[A\KQ\,ER3C6^GLEIT
+MN66[?'=U%]0HO!'Y$7H$CE6\L73W;6>7Q\RUKA%%?S+',M0%Z^16PEN`]%%[
+M5+*5WJ$+6%46[SN+EOS]Y6%!- at 8%G,2M/`RMEYN'+R(BK9=[R5;B=?*?``,`
+MZC#;1`UE;F1S=')E86T-96YD;V)J#3,U(#`@;V)J/#PO3&5N9W1H(#$W-C0O
+M1FEL=&5R+T9L871E1&5C;V1E/CYS=')E86T-"DB)G%?+;N-&$/P"_P./G$7(
+M<%[D<($])$@.62`(@A40!$8.LBW9`BQ12TFV]1M[R/>FJ[M)/;V'7$1R--/3
+M4UU=W3/Y?//C9!(RFTWF-VU9)6NS*IO\<E-4966K-IO<W]!;%6C"Z\UM/C&%
+MLV63/YDBVC+D,_JNRYAOZ-F4-I]E^C+5/WIZE@[CKLF_[N at KT++I,ZUOZ&5A
+M"E_1<T[?=>G'[]G1\I;6#_:SN0YTZD"?O9K")IHZN#28N*=O+^.\Y^#9WA0-
+MYG<ZOAO__V?R^:90$`I;.EL[0$'G#U4$$@#%54Z@>#7>E2UMYVQ.QZGIA]ZR
+MNYDA-]H\6_?&X>C=TC2TW5JWWV*6SGD`*$"&QMG.W`0<+MMW^&<G?\=`?_/[
+M!LO\L#K;8M<G4XT#?`**IY-X6E^ZMO$24#Z%Y7B*__]V:_A2)B!6$P#=RKA4
+M-@<S2 at M?UDUL1BNVJ4<L0A!;7TU,["1<G3XOYGQ8LCSK]:T$#\CV3Q2M!GC!
+M84(LXK at 4J<#0%.1`RQ$#M"`!J,5$T_#8NL21$)[@Q_"XT2/;#!XE1ZCO3(ST
+MF!JB0L"V@;X6"$P$YSSSA;]FQ@&$GC!VY&_V-)6!EYFLU3`]`"/,YL&YB16=
+M2LWOY#_=98M8UGGV0F3GM]VPE.UN`($G7#B?SD,W^<!0IP/MHI>#`<":'2EL
+M2R"]T&XM)US,5SIV;P0^US+).''^-%8`D2G(3P=7'45ISMG6:K at 0B@U9\!=,
+M:,N(3*B^DQ5_2U8H?V,8^/M.MJS(R8!3Z+/7!/B_6:0)U%%2#*:&M&;73WEC
+M0S,(7*S%?^*@1TZ`@Y&>,]ZPE7`A>$6,('-$:'\S3EC`CVRO:[K=>&C);.)#
+M8 at E+)1+6"N?)ZV&W3L?X#+L-4\1R at I\ZLS2<H,<;\9*EJ4':'9L9-MH".:\[
+M;=:#C7L]D;HU9[EL\OV[NW7ZO;KB^`$F\9C!%O)6M6)K at U*7=D8>D#V/!%DN
+MIS)`M$5L'^2101P\IVD1JI)9S?,)>U_3=$+?AF-VGN2,C\U`RKJ-LO&OOQM/
+M*I;__(=)GKS]8FP5*6)?#%4",K0&^3QR`H at 0XRI.*";>TA`\2*8 at O`N!RQ-/
+MZ65P@,2BHNW%B)J<05K!'DJZ>)%/U5F9L6X4LJ!\G.S7'$Z8<C@#%)0<8S%K
+M:/B9T?%`%7KRJM,>(*V-NO8RU9KX##\2BP`L$E/"!8S569+X-AY5C;NN8W^0
+MQ7KXTS,Y63MJA`M8?9OO9YN/AF7]?$-'\M$<NHXJ-;*BH),'[24XE46<O&@7
+MAT:(<EFPHO47,G6;KSI5CX^L/>?5LJQ#J@^KU`D3D`3@/C%W/>V--#"&VQ,B
+M1SS6&#IY.->85G=?K+A1:9&7"2V1\?3QB(9*WWNAVN5Q?+3A4']]'$2K3A*4
+MOXQ%C7SB8'=:35EE55:SU6[)PA_S.YXTRBW2&/QTUS*J+E-KVU-(AN[A'2@^
+M&8M'E,&A:%>"R!DRR0LR<RY#TM11H`\!WHJRGQ.,0#XT-3;8$0ZM00\SD#_F
+M]POH=&">)*EY5NHS1AD3$/F.JQ\G=926TR,[- at K=&2;-:31"Y:Z at 4@LJC:`2
+M!)60.T,$][F7_TK#E;@=V<-MUGF%J at 6C?DKT<1"O1Y9<+N_U%7"2;](!G&0/
+MO5HK/FZX+XC4(7G+70D_='"EXH(.(@Z#60^'$\XD4P)&'W7JC+.2KP`102N'
+M1GOVJ#/+*Q*3RI0R_JDR[ZE#S$@&2XC%\ICDXG(A4KSFG:1W:>1F0>(@5>J3
+M":B`E at I_(87?NA^@TH`;TR/_%J+.K>9(RX,#2ZD1 at Q(=18!O05:EH.=>`.?F
+MM at .M0,C?U*<UHY&N).^I'-HT*GQ2B>?NT3'*?N@/'6W#JH^2#I'G4JXS>W2=
+M%!:=^:8U>#T8V&RXMK,4C)7;CQ>@]70K?VN#H&9T]>H\6(4_).]1J6K\48`V
+MVYZWX at L<0K7B>Z*E4_ at KH%`5L*G];A_9:?OVP!WC:CKH%1-AS[J@/2"SX&WL
+M"PO/374URO*QG!WNM[<#3:A0 at T6]46HY3=J14M]DWE:V5N%\VVIW^:H'93=U
+M\`EI at P)C*^C+![3!WTZ[T0LI/*;[8NCCYPONSY]GEP#&-AS5*C<"&%IMMB3*
+M[,L8^6Z.CIF\8"+1.#9`5^"4!9=R5^A6I_X2>8_\11^7F$]<CB&@C5PK+6A&
+ML?'QZKW2-=71[;0^:%5,!R2<Y<N4JUFE/"M/E/>*=XO(Z&PCMYU[GM'QC-Z@
+ML24;^)!%8[],GJ*Q8!-J7*>_X:9",^>&+ZZ#*=E%EM,-]U$=$^-J3UT:G5:?
+MKF443GXF--KX#*!J<S/6PIYU1S(L2=HSI>9D/OM/@`$`&('5L0UE;F1S=')E
+M86T-96YD;V)J#3,V(#`@;V)J/#PO3&5N9W1H(#$T.#0O1FEL=&5R+T9L871E
+M1&5C;V1E/CYS=')E86T-"DB)C%?)DJ-&$/T"_0-'Z@"N%8KC1(Q]\'7D"#L\
+M/JAI6JT)-4@(S?+WSHVE05XN at BJRLC)?OERT_W7WTW[O$Y/L7W8N#Y4O$IWL
+M/^YTKKV!W7J7P:O5,=E_V_V9OBAK\YB>519RGW:'@5]._&A59HL\I,?DTLGK
+MZLN at K,F+-(%EF=Z4]7F5UBHS\*GK1]ECHFR9F_1-1?@]*!OFD[W*?.Y&M=^5
+M)FU_[<D/RWYDX at BHM=Y9<<<X]$:S'W7W#":0#V@*Z&\G+8*&S2L3JPD-`PI'
+M-(R?M'2DIH+C=WF[*=)[.,JZ498<#AZ<&=#\"GS*3/H$>PZAQ)UFXX3<OW(B
+M1/(BU]H'-N+67/%J"T`TB)L%L#T84,LJN<G+%6ZJ<H0=G/!I,R#\`;]?Y3R8
+M%0R'UVF0Q"<\UL at 8S:@@%L98,<@9,>@W<"Z"EI:TE1 at KTO8"MU08:-GO9?T&
+M\FPHA0(L at ZB"N>B5![FFE9>:2!3ENY#D\*Q`BTN?10BU at M)&9&\$?$AOR6<P
+M+(+ at IP]BWV<E`+"BA7FL*$%RE_#V*@9+C#+P'Z-B"CNA8"<4[!@64!/)&1"(
+M[$T0;X)%;YJDD]<><0X,@)P!HR.RQ>'%D^#+5G"CG%YJ at C(2#"7#$!&6'!18
+M\OD]V_0_\&S*>D^8(NX'P4?H,W*O;VYKGK@\&B@<4P:%$20=#"O^I8$*0A7E
+MWBOK)%LPI8?#$_GLB80&XK;-$-'_WG)?A(7EYY-4&F"@`Y-#(.:L^)R7VI8S
+MIRT&ED\CT(XB82D,!6#!.O#]`E\-9O6IDS?`WV/1H at OMMC+)56NP[<+D6R-I
+M<&[J at 5+'4 at HA!EQMW+9806V)E9U+=RA'J$TQ\I'8W2@'YIT198L+#:MZM!_*
+MF`)Z at -W@^<`RX"CZ"VYC4<%<27GG(D>6A_DI5VV<%R-7SB^)UA&9D%1(@N'E
+M1#P/`,666Y!^L\-%.55G7SI6=I$"`?48XD=A>>6MA)J)04>P*"<'559S&?`5
+M-1B2./.CV0ITO.I56<`J:;OVIJ!*>):]JHCG[GP!;;7\7JM at 19]<+T)BXF7<
+M)/6#*L,C'HG[ZPY7ON/153*UDUIXIUSS&_XOL>1J9J9JYN?`!`C)G9*RD,K$
+M&;#:]W.!<ER at 2BA04O8*+'OL&K8);$>?%):T#ZI<6O;`3RFWU(K]UD_QTJ"7
+M8!ML#UA1S,9;&!_*Z.=4*>:^7 at ASWE2!=1]92!2 at 2)R(\$!%%>(TP#CJI+AS
+M586FN-&#MEHZ7RLGZXE`!,U)Z5D[?Y<O'9WKL=`X9(ESK)CX0.*7]WO`F`<<
+M$4=7'"GB!CL,9$>%#GP><`C0/`18C,_YOP#D"8#'Q&H"T(+M=\53A#74+[(P
+M3FZ.B%-P=0_$$R)'TO6879`;-Y%K1>[X6'Z<(\.X<T4P2LZI<MQL:T4LG6X9
+MA33W,32/J at 7ZCVFXC!7,8:/1XDF#`ZL?Q]?_A[M_UT[A"E1CL:0>Q(".K]Z.
+M6R[W.LQXF[G463^EI^-RDY&YPT7YY1*]MT2O at K#C)A[&#W>2[J>O%>.*U*(N
+MK!%U\W!(%=M6ONIE"S[VC-/A at FV!:G#U("W!T,5_#Q/,-"M(,T9\, at 3L<I?1
+MG<H9XD45\[GY*OLGEJMIEICGNTX^TZ0!$3Y.:W##HGU8H0*->Y;_NI`:^8-P
+M0PS`;MGFJ;4:YWPOH]8L]V">W_PG\68!U'>B>)'^./:,5<%8%0]*F([PY^Q!
+M\RMG1D@#DC;R;[T%4NAYT:B^GEAZT:D>][S?5<3E'_P`/(.?OQ[P].55FJ),
+MSF+X"@2>-8G00:9G:`J>*VM)<PH]DN%52?+34N*.(XOC6<;R[%%@T<55KR at D
+M)^Y"/+'$:6*),J[%\53R)/J1#^>.%7]3+LY_-V at ."C0".2S1BS\0;\I5H.O`
+M5[=RQ0_6DO`).3YY(A<W5'TK&,\1)AC&09%/Z$<G!IH"1+B"@Q#G-Z2+<`9N
+MWG_9_;S?)7\+,`#,H7*6#65N9'-T<F5A;0UE;F1O8FH-,S<@,"!O8FH\/"],
+M96YG=&@@,C4W-2]&:6QT97(O1FQA=&5$96-O9&4O3B`S+T%L=&5R;F%T92]$
+M979I8V521T(^/G-T<F5A;0T*2(F<EGE44W<6QW]OR9Z0E;##8PU;@+`&D#5L
+M89$=!%$(20@!$D)(V`5!1`44142$JI4RUFUT1D]%G2ZN8ZT.UGWJT@/U,.KH
+M.+06UXZ=%SA'G4YGIM/O'^_W.?=W[^_=W[WWG?,`H">EJK75,`L`C=:@STJ,
+MQ185%&*D"0`#"B`"$0`R>:TN+3LA!^"2QDNP6MP)_(N>7@>0:;TB3,K`,/#_
+MB2W7Z0T`0!DX!RB4M7*<.W&NJC?H3/89G'FEE2:&41/K\01QMC2Q:IZ]YWSF
+M.=K$"HU6@;,I9YU"HS#Q:9Q7UQF5.".I.'?5J97U.%_%V:7*J%'C_-P4JU'*
+M:@%`Z2:[02DOQ]D/9[H^)TN"\P(`R'35.USZ#AN4#0;3I235ND:]6E5NP-SE
+M'I at H-%2,)2GKJY0&@S!#)J^4Z168I%JCDVD;`9B_\YPXIMIB>)&#1:'!P4)_
+M']$[A?JOF[]0IM[.TY/,N9Y!_`MO;3_G5ST*@'@6K\WZM[;2+0",KP3`\N9;
+MF\O[`##QOAV^^,Y]^*9Y*3<8=&&^OO7U]3YJI=S'5-`W^I\.OT#OO,_'=-R;
+M\F!QRC*9L<J`F>HFKZZJ-NJQ6IU,KL2$/QWB7QWX\WEX9RG+E'JE%H_(PZ=,
+MK57A[=8JU`9UM193:_]3$W]EV$\T/]>XN&.O`:_8![`N\@#RMPL`Y=(`4K0-
+MWX'>]"V5D@<R\#7?X=[\W,\)^O=3X3[3HU:MFHN39.5@<J.^;G[/]%D"`J`"
+M)N`!*V`/G($[$`)_$`+"032(!\D@'>2``K`4R$$YT``]J`<MH!UT at 1ZP'FP"
+MPV`[&`.[P7YP$(R#C\$)\$=P'GP)KH%;8!), at X=@!CP%KR`((D$,B`M900Z0
+M*^0%^4-B*!**AU*A+*@`*H%4D!8R0BW0"J@'ZH>&H1W0;NCWT%'H!'0.N at 1]
+M!4U!#Z#OH)<P`M-A'FP'N\&^L!B. at 5/@''@)K()KX":X$UX'#\&C\#[X,'P"
+M/@]?@R?AA_`L`A`:PD<<$2$B1B1(.E*(E"%ZI!7I1@:1460_<@PYBUQ!)I%'
+MR`N4B')1#!6BX6 at 2FHO*T1JT%>U%A]%=Z&'T-'H%G4)GT-<$!L&6X$4((T@)
+MBP at J0CVABS!(V$GXB'"&<(TP37A*)!+Y1`$QA)A$+"!6$)N)O<2MQ`/$X\1+
+MQ+O$61*)9$7R(D60TDDRDH'41=I"VD?ZC'29-$UZ3J:1'<C^Y`1R(5E+[B`/
+MDO>0/R5?)M\COZ*P**Z4,$HZ14%II/11QBC'*!<ITY175#950(V at YE`KJ.W4
+M(>I^ZAGJ;>H3&HWF1`NE9=+4M.6T(=KO:)_3IF at OZ!RZ)UU"+Z(;Z>OH']*/
+MT[^B/V$P&&Z,:$8AP\!8Q]C-.,7XFO'<C&OF8R8U4YBUF8V8'3:[;/:826&Z
+M,F.82YE-S$'F(>9%YB,6A>7&DK!DK%;6".LHZP9KELUEB]CI;`V[E[V'?8Y]
+MGT/BN''B.0I.)^<#SBG.72["=>9*N'+N"NX8]PQWFD?D"7A27 at 6OA_=;W at 1O
+MQIQC'FB>9]Y@/F+^B?DD'^&[\:7\*GX?_R#_.O^EA9U%C(728HW%?HO+%L\L
+M;2RC+966W98'+*]9OK3"K.*M*JTV6(U;W;%&K3VM,ZWKK;=9G[%^9,.S";>1
+MVW3;'+2Y:0O;>MIFV3;;?F![P7;6SMXNT4YGM\7NE-TC>[Y]M'V%_8#]I_8/
+M'+ at .D0YJAP&'SQS^BIEC,5 at 5-H2=QF8<;1V3'(V..QPG'%\Y"9QRG3J<#CC=
+M<:8ZBYW+G`><3SK/N#BXI+FTN.QUN>E*<16[EKMN=CWK^LQ-X);OMLIMW.V^
+MP%(@%30)]@INNS/<H]QKW$?=KWH0/<0>E1Y;/;[TA#V#/,L]1SPO>L%>P5YJ
+MKZU>E[P)WJ'>6N]1[QM"NC!&6"?<*YSRX?ND^G3XC/L\]G7Q+?3=X'O6][5?
+MD%^5WYC?+1%'E"SJ$!T3?>?OZ2_W'_&_&L`(2`AH"S at 2\&V at 5Z`R<%O at GX.X
+M06E!JX).!OTC."18'[P_^$&(2TA)R'LA-\0\<8:X5_QY*"$T-K0M]./0%V'!
+M88:P at V%_#Q>&5X;O";^_0+!`N6!LP=T(IPA9Q(Z(R4 at LLB3R_<C)*,<H6=1H
+MU#?1SM&*Z)W1]V(\8BIB]L4\CO6+U<=^%/M,$B99)CD>A\0EQG7'3<1SXG/C
+MA^._3G!*4"7L39A)#$IL3CR>1$A*2=J0=$-J)Y5+=TMGDD.2ER6?3J&G9*<,
+MIWR3ZIFJ3SV6!J<EIVU,N[W0=:%VX7 at Z2)>F;TR_DR'(J,GX0R8Q,R-S)/,O
+M6:*LEJRSV=SLXNP]V4]S8G/Z<F[ENN<:<T_F,?.*\G;G/<N/R^_/GUSDNVC9
+MHO,%U at 7J@B.%I,*\PIV%LXOC%V]:/%T45-15='V)8$G#DG-+K9=6+?VDF%DL
+M*SY40BC)+]E3\H,L738JFRV5EKY7.B.7R#?+'RJB%0.*!\H(9;_R7EE$67_9
+M?56$:J/J07E4^6#Y([5$/:S^MB*I8GO%L\KTR@\K?ZS*KSJ@(6M*-$>U'&VE
+M]G2U?75#]26=EZY+-UD35K.I9D:?HM]9"]4NJ3UBX.$_4Q>,[L:5QJFZR+J1
+MNN?U>?6'&M at -VH8+C9Z-:QKO-24T_:89;98WGVQQ;&EOF5H6LVQ'*]1:VGJR
+MS;FMLVUZ>>+R7>W4]LKV/W7X=?1W?+\B?\6Q3KO.Y9UW5R:NW-MEUJ7ONK$J
+M?-7VU>AJ]>J)-0%KMJQYW:WH_J+'KV>PYX=>>>\7:T5KA];^N*YLW41?<-^V
+M]<3UVO77-T1MV-7/[F_JO[LQ;>/A`6R@>^#[3<6;S at T&#F[?3-ULW#PYE/I/
+M`*0!6_Z8N)DDF9"9_)IHFM6;0INOG!R<B9SWG62=TIY`GJZ?'9^+G_J@::#8
+MH4>AMJ(FHI:C!J-VH^:D5J3'I3BEJ:8:IHNF_:=NI^"H4JC$J3>IJ:H<JH^K
+M`JMUJ^FL7*S0K42MN*XMKJ&O%J^+L`"P=;#JL6"QUK)+LL*S.+.NM"6TG+43
+MM8JV`;9YMO"W:+?@N%FXT;E*N<*Z.[JUNRZ[I[PAO)N]%;V/O at J^A+[_OWJ_
+M]<!PP.S!9\'CPE_"V\-8P]3$4<3.Q4O%R,9&QL/'0<>_R#W(O,DZR;G*.,JW
+MRS;+MLPUS+7--<VUSC;.ML\WS[C0.="ZT3S1OM(_TL'31-/&U$G4R]5.U='6
+M5=;8UUS7X-ADV.C9;-GQVG;:^]N`W`7<BMT0W9;>'-ZBWRG?K^`VX+WA1.',
+MXE/BV^-CX^OD<^3\Y83F#>:6YQ_GJ>@RZ+SI1NG0ZEOJY>MPZ_OLANT1[9SN
+M*.ZT[T#OS/!8\.7Q<O'_\HSS&?.G]#3TPO50]=[V;?;[]XKX&?BH^3CYQ_I7
+M^N?[=_P'_)C]*?VZ_DO^W/]M__\"#`#WA//[#0UE;F1S=')E86T-96YD;V)J
+M#3,X(#`@;V)J/#PO3&5N9W1H(#$V,SDQ+T9I;'1E<B]&;&%T941E8V]D92],
+M96YG=&@Q(#(Q.3(X/CYS=')E86T-"DB)O%9]<%17%3_GOGWY!@+A8TD">=O'
+M$IKL$@*!$$!F";N!&. at D!.AN6F&7?#2AA$3(4%*%IH4`W4``L8+8 at E,J(ICF
+M25-XS$@'*TQD0%N*2`=%4*@"DE:9%JK(/G_O;4JATW'ZA^,[<_=\W'//Q^_<
+M]V:)B2B)6D at B3V5]J+'CM\NF$,T90<17*U<T*:_O_O[[\#A-)"LUC4_5O]RT
+M*0;R3:P-3RUIKBGVO#&+:/!<HLG^VNI0U8>S+QTFFM>(,Q-J84C*3#A'E-@$
+M?41M?=/*V_L3!T'?`?W:DH;*T,[*MAJBLI]"7U$?6MD8MSKA5SA?"EU9&JJO
+M_M/I3,AS1Z$>9V/#\B;4B6=NG+G?N*RZ<>FM;TY#`RU$\6?D6DK'RL"R2YV4
+M2F2<Q[IBKDB%<4^N)T?DE'%!RD4T=W3AR:/%M)9RZ5W$/DTR_8 at .4B'[8#].
+M*>S`S@):R%/(QW[J at ZB5]'=^G&JH at SZB-I%`]>2!MYO&(5XZS:-N<E"=$:%B
+M6D%A:J=]V"NC=N-=XS*RY2);`ZVCS3P<<@<=H8N\Q.BF#"JDI72`SO-48Q_\
+M[, at TW9:-*B:3E[Y.LQ&Y at A92%2*^2GOH##<;ZXQN=!B+?&-H/.K:2X?0P5T>
+MQ\U2H;03.X6@]^@<]^5"H]QXPSB)/*.H`+$"M!&TA7;0:W28>BC".5S&'<;3
+MQC+C,#F1JY:>IPVTG5ZA7](_.9O=8JQH$)VH+9UR0&;L^:CF9=1SG"YP`B?Q
+M?%[*S=S%=T1`.F0T&KM((-989#Q`1^EM.DEGZ#H\$SB="[F>NT6'E")MDW;)
+M*^37#=6XAOJFTQQ:#H1>I$[XOT\7Z0K=H4_1 at YU3.8/'<!Z/YQ*N`.WE3B&)
+M5K%7=(@>*4YZ13IA2XI<,?YHW`8J(RD;&(]'1"_Y:!9Z-A%<!MH.K([2+S"K
+MDT#L'/T!]`%]R#9.X<'(E(8\#A[!C_(,4`GZ\O,R?A5TB:\+-"6$Z)**I:TV
+MLK7*>7*S\8B19^2#?H,>)"`_!"B-IZ_15&MR3P+-6GH:F==0*ZT'KNVT&U/L
+MHA.HX"/Z!]VBC^DN_9LEECD6%20#(95'82IC>`(HGSU<C$I*>!;F-(\?1T45
+MO)"KN(6W\G?X,. at M?IN[^<]\G6_Q7:M*621B:L6B3)2+56([Z*`X*V5*MVS#
+M;=DVC^V"[:J<*N?+%?)+\H&8^- at W[]V,=$2Z#)LQRV at W=AEGC1N40`-H'#V&
+MMV`1>FA`#TWX7FRF;:#MH-W`\L>XR8=PCXYAQMV at 4Z#3]'N@>@G3NPKZ&^Y8
+M#WK\%/TE`.,HF1--M29:P%/9B^[*07ZNP=UHY&=X%:B==_)N(/\:[\/-ZD*/
+M#]([?!GT%[Z&KC_FN^A[H,@!S;)Z?D(\)UI`K>)[N"$=X at 3HCC1(&BO-DYZ0
+MFJ4=TC[I)](IZ0;F6&,+VW;9WK*=D4G.D&?*E7*SO%[^@=PIGY;/RM=C1L1T
+MQ&Z.W19['5.9C]D4T,-/"F[8#^GG5"M6B"Y\$8:3#>]Z)S?1OT0<NGJ&4S#K
+M9J"7@[?^&[R:DL48\5UV849[Y!)I.^[$2_A6Y..-O8AWJYBVXLTY3T5\7,RG
+M:S0,7[(4HX?LQ at VY26["<$MH&)8=)U-ZOW,]6#<BA?@Z8R]RU/B=-!R5O8#O
+M0Q9E>3)'.D>HCSB4C.'#TM-2A]J'#!XT,&5`_^1^??LD)2;$Q\7&R#9),+E\
+M:E%0T48&-=M(=>9,MZFK(1A"#QB"F@)3T<,^FA*TW)2'/3WPK/F"IR?JZ;GO
+MR<G*%)KB=BD^5=%^[545G2O*_)`W>=6`HO58\FQ+WF+)?2`['#B@^.RU7D7C
+MH.+3BE;4AGU!+\(=\:#U!+<+8).'$LW`&DT/K:JU at YD>/BU5]?JTH:K7VI.<
+MOE"55EKF]WG3'(Z`VZ7Q]$IUD49JH=8ON_>X>4Z!ZQP_<KM==6;]U)94I5:U
+MZ1Y:%#2ET)-^30H%-!$T<_3/UH:H7FW(LQ_8/U<_DWP;']C4A+,H5!TN`C1M
+M,Z-JT-1"&Z&5E"L(*UH#?HU;`]$BK-JC752K/M,27*QH\6JA6AM>'`3F-,=_
+M,-63ZE-#WH!&I?Z#0SU#+<7M.F)?/=D!4(ZXI[FGF7RRP[XZRO^Z)FI_[UBB
+MY7?\,GC)G/NXL)E)+4:9FE)I)5%1ZT3SIWHBA2LGP at U/@-%EG18_/1A.GH13
+MFNQ,5I7P)X1!J3TW'[:$>BTQSN1/R!3-<=Z_$=COE77*=)7H%%_J_QES>T!G
+MHU4G[[`C%$_2P at 78'F5>ASHO3D-YU`5#E at -2EDLI0M5%YMR4L!(NK at HK14HM
+M!FYS6AP;U>%`#MHI]]?A=Z[?H7D":??%ZD!@$N)DFW%L5IQP`!$6]T98;$5`
+M@'MP<KE*`-'(4G^97VOQIFD>;P"0X/X<*_5KQX!B(``O]_U*P5?5V7MK'HV:
+MW5D0<J)1RA$#(0+A<%13'=JQ<#@M;+X'45UG^J+!TVO0R0J`JZ)S2ZFUU:(Z
+MTDR#ZE`=*"O at 1:HQN%Z?C5>GW/^.\-@'$1Z':L=:".?]CQ`>_U40GO"5$,[_
+M<H0GHN9\$^&"_Q_"DQY`F/"?.X8B^#KU71(9'1D=>]NT//1,BBD at IX`@]M,"
+MK!P;40/TQR!7F!SZ6BP5*P/+C96+O3VVS90K=Y-3GD\.<R%.B1E+&F;ISMA-
+ME`Z]T%SP<]B6TPS8\TP9?ZJ=B),'FRIMHBSP//#1B)L.>PYTARBPSE@\9G]4
+MMO(OQ]GEY(6_F2M/?+[GL/(0#3%E*9/BL="/T6/6B]N6C7<Z^\TM,5MBQ2!=
+MM!V<D3%0%V&P%%V\"#9`%QO`^NMB/5BR+M:!]=-%*UA?7:P%ZZ.+-6!)NG@!
+M+%$7SX,EZ*(%+%X7SX'%Z6(U6*PN5H'%Z.+;8+(NO at 5FT\6S8)(NFL&$+E:"
+M<50C:)Y!,S(N%?,[Q:QD_8?YJ@^*ZKKB][[]>,O"@]V%A64#7)9E%WCKLB`L
+ML&:!AX+XY$,C$5U=*4*(&HRZ*L0ZID63\0,:$DO'.J:CU$*F+:UA'XR!Z-1D
+MM),FU38?CLDX:<=)B9W.:&PZ3-I$P9Y[W[9)9^@?_:\[<\[OWG=^]YYSS[U[
+MWGTXNQR_%,(OY>(7:WQ<.^R<";2)ZX#KUAFN$_H/N2=`WV/Z7<;X/=<%^A*W
+M&?2K3*O,%YG>R3T)>A6T5W%;8!;"V(3;HF"#5!//E>*K*(($?(7I,:9Y*24B
+M7(T(KT>$5R)"7T1X-"*4180:(WX/[@\"CC+=Q;1;BB\7?EHN])8+SG)*^3-<
+MA`6\DND,IM.DE)`P$Q+>#`EG0D)[2&@-";DAH285]\/G at H"?8_H0T_N9WLKT
+M&J9%ILV2.5_X*%\XG2^\G"]TY`L5^<(%G`177`$;I<1)X4^30MZDD#4I3#XB
+MO([?04DX44E"<=/X'0S6K$=VD"G\I1*V`<RJ\#<EG`EP3PF[`#Y3PFY2DXYO
+MH[`!\H,_16'<"O@)&M;2_A]P-T?Q8]S-^C>1B%V`'RGB!1C^H0HW5+BNB!L`
+MWE7$?(!KBI@#\%L5?J.(60"_5N1L@#<5V0WPAB(7`EQ29!_`!47N`)A2Y!F`
+MUU284+S;`13%>Y!<Q./(RXV!^SXEG`Y/OZN$,P">5<)E``>4<`6I\>)GT#"+
+M<6]L#7N@?PHP`DC7M at L-,OM.-,CL.W`WZS\-2.U/X6Z6BVWP#4K';8$U4^Q4
+MQ)7 at IDT1%P&$%+D88+TBKR$U`EZ+9#;9XTAF$;8 at F0U:K7C'@+9*\<Y`_$VQ
+M^!L5[S52$X<;D`_343)R,?8*Q74:V,6Q7?'%=L,;6X$'(J=8@"2V*WE03RBZ
+M($+*<ZK[D*.(0P`.1:P'R%;$`H!,=0-L:N93%9FN)9EF]R(V(2\;'R^E@/^O
+MPH1\&<XE_QB>(7\'F9VFAT`AGXM3V"6ED;^*,^0S<3&Y*Q:3.Z*1?.IUD@\'
+M+]!(T`?`R+:2#T0S>5^VD&NN&7(%SMOE\&GRAMA!+L$!>56:TF(IB?Q2+"6_
+MD!/(F+R=_$RFSY+)CV#,*7F(_`#&O2!N)_TN]?DAR4X.PB%Y!N;9[<T at N[Q3
+M^-1YLM/K)T_[H*F0;A<$=YX\Y1HB6UU3!@BW<W"*PU(\V0BQ;)`7D;4R[1L)
+MKQ>)AA-IG=JC%K;=:@V+J(5MEUJU=JHUK$TM5VUJ??N66LK:)NI)O0^F.T^6
+MR3FD$CR-*21(@U5(0&;N2[Q3-&E%PS1I?K+(FT^(;"1KH_PZ?@GOYTOY0M[-
+M._A,/H-/,5@,)D.B(<%@-!@,>H/6P!F0(67JX2TI%T'=2M&;*.BU5&LYJNE[
+M#%YP'#9P:&6-C>M'!NXHR&&0YT$.@?2!?`?D`,A^D'T at O2#]#V]-T-'37#]W
+M8-*D-@]P^V,/]W.'8ZW#W+Y8:Q_7RUI3 at -0G8'0EHO>8<?R"+;6WVE9MJ3('
+MEM<NH-ICVO/US_;?!BS$_4839XZ?@'?^^,\S0^.+:>-A9JAAO(!>XZ>Y,JZT
+MKG::\U,(K9_&N[FRNC7T.=Y=&P):(Z.A8<X/-!2F`#1-#AJF-#2LR6&T8Y06
+M'1RNJXT.#S.*[B0:9)1!W4E&&5-G$L$!S"11`)K>B$1&$_5&2H-#P7BX&TDP
+MF20Q5GH2[J8LW)V>Q"9+9?Y<+J#(+DJ)>EQ`B+H\S)SWM=GK8.9NU=RM^L!?
+MVWWJ<(=J=X#=\__TZUKZOXZ8&+AU;(1^AK4[Z[I`VL<'>N%+LZ\C.SMZ[%;L
+M^\S=WM&YE>+FKO%;SJ[:\6/.VNSHP,@"YA%J'G#61M%(W>/KHR-25ZTR(`VP
+MK[>)YK.-Q__#U[%_^VH\N\!D9^EDC=17\_$%S,>IN9GZ.DY]':>^FJ5FYJMN
+M6\O2/=_X]>S=JS863L,>>GOED`MNN(FZK4B#>%0C9>CT!%X"6IYHD%&G)1H-
+M9X_3\P2C=`-4L<()QY;5\-=IG at TVS06;35\$FTQS050=G`M2*2XJ,3O,>2`N
+MW5_>NC^JV_K5R;<T-Q^XX3_>-C_*172#R(R"4K9=;S=R"4*R-D'0F(7DY+0T
+MN^:<8:,YW9)\W]&RB7EHFIMMKNNJO8VJJRV!``8I+L*;+.5E+JN>UYM-::EI
+M5G>>6]/6>Q1;1TL?6U,Z\MZ1,9/&_L>'/PST1)3Y3?/AB=U[`MT7[^%&Q`J;
+M#V)8"C$DHZ52K@$;S)Q>I]48$R$!26:=-MD*<21O-)Y+3$^QWG>L?T*-8W8N
+M%D>0!6*VI+%($,<G8J>_K+S,;,ISY_FU::EFKJ+_.4DQCOHAFE&<>/197#1_
+M<;!N;V!OCX)_C,].1'H"0U]\,C^CQK.32])\7_<]U("&I.Q07*NKU1-:'JI_
+MTK6MOM?U[?H3GE<\YST)A56V!'\#W)B73XK2TKXJ:$AQ&7R#!0>KI)P:(U>-
+M"I$-M`7VLQI5H02N6C([_):F/'+.4FQ=5I%TKD[;Z+L1G(4]"LP%;U3ZKM@?
+M7'E@`K'93==1]6RP\H[-_K$]6'G7=L=TW72=+A!#=OVE926+(=/EI6HSU9JB
+MMZ958=;2\M;4-/K$F>/.X[.P-86G32#Z2]T^#-EAG?(J7(Y_Y__5]H"XPKNZ
+M,7%==8&[<G7RZIZ:117S[R]:/-%3X5G>UY#`/R;8:[VE+1R7M+8GX*M84]VZ
+MW*NYF4XLZYQ5]7UVOGW(5UY<4>$\T6D,3"SQ;!3=IJRTI'#!DJNI_.:77;FV
+MPF7Y!6<6QYL3X at +18&[@44YC<=(\_V1^D,O`E<B&FB7/1?2:[6TX[C9;`H^T
+MVD1DBS=TFHL2XN.U`3L<@)3+B>GI]LN.'?\ZAFSWF^[24SYG+BEA!P"9WJ8I
+M2H;=]Y?FN9TYL86SO/!Z/KK)UV*,3S%FZ2M#FQK"/<^O.#)_02IJ66D5$G2M
+M<E/[P>VC1U8T0VP;<!O7P#5`0$2*0QILUZ%TK6X*ETPX=K`#.&.ZC7Q-UXJ+
+MDAU6QP;\^7P2UW#WGTQ7"W`3UQ5];S^2=E?2[NJS^JP_6FGULVQ+LF4;@1TO
+M4\#&0(D)--B@$+`-F$!)F=HI`89\((Y):J8$4]IF(*U;,LVTX6LCVC2DJ;&!
+M,1/^A0R%Z<"DS21*RY00)D;KOI7,D-$\Z;X=27/?V7//.9OGS\#$;9A%YV)`
+M0+%B,0-C0OV3,<9E-#V8_/6C_D']O$P\-GGC<LT.=#0V=FCK6D>^RO_G-@#P
+M7O(E8`-=BO&`<<@X8KQB_,9(XM,MB/,`TL`&SP`9/1.D4&U%M0\8T3L!AP`#
+MZ<&=QOU&S)B&9Q66)7#<9B:MQI,"%,QL&CXWA!\B("'8HV.74XB+8REMN!W)
+MKU.9A_#K2"0>`ZF:BNHJ/H$012A6^2MYFU!IEWK?7NR+NA)2$B/EQMU9$%_T
+M`FZ?J_"TD+ at U_J/GGXSG>T<W&[^(>B\"ZQ2AEX-Z'CH$2<LS>E`P"W@<T(%R
+MK&(L,AKUEU at 2$PA`:$&*M30H8J%4X%$8R0@\Q:B]R^YS;NZ&>WC,W7W9F>'1
+MX(/Z['!]-I5$>[35DYS[&JS5.H:I&J#1(-^S[Q'&>FB7*JIK*G')!QO:]G9M
+M6ML4*IXRX[][^OZ][F7U-/3M347C2Q_^,0I7O''Q-\^^.R<\\\JY4R?;+VY2
+MK_(5Z]3F_)F*)_Z)_X7<@D;\#\H"NS=8/$4_D^JTKG%V45W6C<7=WM?U/?;7
+M_/U4OWV/]P`U8K<(HH?RT!Z/1ZKV5$O5WF:JF=[CV2,9[8)@!W@$FFG)(]AI
+M2L>78^@A0J%"O)LL[PN9I#3\1*'E#\S0?'=^(2S\$WP?T)A)H3\@(7E7CD5B
+M400-=R.3RMQ+95+<'5"?J3_'9;2)0&.11!_1<SEM3`&ALB(W&L&JZL?@!%&-
+MT'$@=.QYO9#R8P/Q4\H/E[VU<&ASU9)-RQ8WA,HBL9:^#U_]F)ZS<-.&]PZK
+M=[<=JF^$EC/]RPZN?V*Z%`G-[%[YG"(W.%<^^=+N%Q9MC[#Q4^MN_&J@?4'I
+M_!QN91,9_&/D:T7 at 384UT"(M,KA5L4DLR[$:">B#-FAKL)%6BS4-VP9YCL#Z
+MT- at M4ARBR6JSH&_-UOA;9#AD^,APWH`;T%/94><N"Y_&VHYZBC227.74NF'G
+MO'N9E`:`LSOJK!MSYJF2R6A^B.KN:,J9R9'%7:LADV-'#AJDKNAEE7!)+S@(
+MW@:TH2R;,;7IVYG-W:\M;-W0-#"*O;4X.UKVU6XHJ,?&M_[^[XU'-RQOVQ$(
+M6XT,]C=U_(#^B1^KUZZIG[<OR'EY?.(V/HKX;P%AL$;Q7O?!&GNC_+346=A9
+M=%K^0GXH&YP.'!(DZW`60-Q8D(;S%+/%$C;N]I+6W6$3V>='QQN,A,^R?<5I
+M;,7A2$ET['[F#J=J^I>ISUB24;22CWU0HS_0)'[R0$@)[6AD(;K1UJ!NT@]`
+M907 at .5)'8K%I.M*,=,HN3V]4%K:I\N_6C\Z at 2USQZE]?A89CGT!&/3^!7'JY
+MQ:#;UMJ^?^K,@/+3WG]]GAV2FGJ at 56_6,3=/_ at -BZE_5;]7N_YP1<N?.Z2`^
+MBG30`:J4`D,,67/,QKB0&O(/'$@0&8?+Z7H@=>V<S"Y<AGLLB_5(&"W5CX61
+M^TX]L+*AL>.14&H+7]&1OY3]\)%L(MS!16(IWIK+4(6*25^LPXLQ$E(ZC#(@
+MFM1REVM!-'LSBPA at EZJT12P=OT)$QJ_`@0L7X/%+E[19Q[4L1OZ<[$&5C.HO
+ME%7;;5!'ZY at PE:1JZ"8XFYI-=]*K;%VV7O@&M8/N->ZP[;"?!A8,=Q<8*!>`
+M`LT(=1:&H7=R$QQ64&8Q&"C*8"B0:0IBA(\16$Y@#`6$FX#8=1K at 9:X)-W2G
+M8;^"]``GO#QN%F4?QQK\N-_/RD'$AN,*NY6[Q6%<&MX\XOM(/H&M`('H/?>-
+M^ZD;[L\0Q:.@'GEC;6W6H85`3=<YC?IY2=`T at 4\FMW##3KVY/$*F>LSESHB>
+M(X>'A_4<>LO+!<1]N,:9&E@)BQ!KI2J-44&4(B1$(KM-"WL2Q/W#_`FUKZFL
+ML!J.)N&9>7-G93O;ZSF:3ZB),I,XS3=+?08["V_#3]6`VDP^$=Q.+!\?&^S$
+M$@G"7>6,%X8WO^B?+Y?:&)A`.&N8(WL at _H=T0D2(Q\$^I5EGMIM7"CVF5\PC
+M)IW.O-:UIN1%UV?"?>%!B9X(`5&493(DTK*/B(4MUA at I^==$X^_$(!=38L_'
+MSL>(6$RDI2A#8^&HVRT:BM)P_7&6+7582Y<ZTMBJP4HY7D<2::S]<&5%=$S+
+M9-S][+`&I)8Q.*0<FM]$4ZD[&5[##FTT:]1 at JM&TE,^IJE21BUZ3$8P(0Y!7
+M69T=0?](?/6\])1<E_2V8!N/;[QS8NV&A;]51]3Q[#KLQ"N+-BH5D'4U_*SK
+MY>^_F\"MGE;\5FNQE4R4S+^PM=]F%1(KA]Z[A(UOWM?U3F2*FLB^Z2K=M^O3
+MQE)<U68.X49*",,@"(%32F at U^Q-VF]PO'Y#)FF!#\.G at JF!WD&0`@@JT>'4A
+MD6GQ`1=TI;$E at _8R5B,=MD2I*BKR\B8^RF#>:``80G at H%"`5LRB93"Z_(CI%
+MR>7R%RM^40KN#\!E@?6!G0$\@$`\5F(KKB,1AD=*&L+1[C'G0PW%5&K,Z481
+MUJWAYZ[+UKJ=DU7^$DH;8U_6?SFFU5LRJ6Q&BWB0J\V#6UGU'71Y7SG, at 2D@
+M"\]MM"22\W,H+?8GIWE;B+<K at G_^YIG*@YNE1$+H.?B]U<,/GDT^E?TJ@=L]
+MBR?!5-M&=@6GJ@'LU?>S<P_N5+GIT;T7U!]HY,/`G(GK. at J59<C=!Y5$AZ47
+M;.?/P)$(2:$L9;!0$1=P8[.)V>96RVI^([^]Y!?8+_F]I:Q_BBBU>,60Z$G#
+M`H7R42+=8109)@TKCM`=NC2T*&Z\'"\O+_,'`GX1%SR2)/R?[FH/CJ*^X_O;
+M1V[W7ME'[G9O-[F]O=O<7>YR69)<2"[<Q6TF&*8D\A"!D"S$!Q`>;8J#(!0&
+MQXZES%2EA1I%II,9.DJG9:R5,`E6&:L@:#!25!AKQ6EM0<W5ZJ102F[I;_<N
+MHSCU9O8Y]\?^/K_OYT5K&.;7:BAI%"1'7!T340"17'U4F<7UI4;1-<];YCZ5
+MIT]-P<&SQ+[`9'9H0M8B, at OGT*(Y/3F5!W1^*C\SD+".*0U%7)B(+?\H0[.-
+M#<VS<Z`(I,\+?$P9'@G%H at R8?W(<Y'9-RTK<DTE_MWOOL5/'?OWECU)BIGH3
+M^O+ZN1WFVW\P?S/^,GH.>__<A55UFJD<7/&,>=@\?1,Q!YOEVRX:5:S%Y>[U
+MYHW$D at MG@(9>@EX_TV$;D<?TQ32<-34<C$L!-9R(2]5JV&)M8X_-VIX(%Y<$
+M-2+'(8TCJ;C4`,\)&<=K&X,<3>!.)E5;JP8$R-[&AFJ5Y!+#06B$JT>:Z-1P
+MD;1-:6U\VB*M=;*%SSK at 1'47&*AU$*YDZ5<_Z^M\M5JKCU%N>2KJ6G'NE-)3
+M]>)PIE'N14=61%K!E>:P at 8ZM4)ISD<6%3CAWIM"FWE68G\:Y4`]V:9G,4NDT
+M`>_-Y>!PC\R5I=,.3EX^K:P(<5C:'D1PT8SWAE at LC2`EWJ)Y.'-^Z)6+]9HB
+M6A9"_AE=8^*2#YXA&K@?XN#WD3S&!RP0:)Z!((RA]R&"!G4KD_V'12FX?KCH
+M[F];L1W@@;(LVC9'[4/'^]5L?W\A#>Y+HURH%[O4*W,XW%%6[IM6EK9:JFSO
+M)R'"_0P@/Q@).,M;))<UYK7AXO<1Y4Z>TQ`)VCO\O``9>%/4_9)2+@`!X0?Y
+M7?SC/&X+K51.#^.62#POB3-":XP;4"%$`48`Z],S&IV?M&P*E(3 at EN^W1G>&
+M]4KU$C77"I5T?.>=G6O';O1F[[RQ\NNRF<;;MD]G.FH/39JSX!HJ$<2Q$JXA
+MAMS4:ZN<`*- at Z0@Z98X2795N4>ZD=E/.O21 at 6B2/:E&95\/8/8 at 4&P6\SJAX
+M7"+5"-L"MR42_J44M0!P1\(2B^$QQH57*:,W?Z*GG'(P!(MKB at T&JUS4?AG(
+M(34$0L,L13E#<K#*[7)2I!1VND)*1]4HZ-%]'H^;(E'7?^585`[R?K)2&F98
+M:V]KE'`*QZR]C6M%J++=I?G.VJ8$SX6/H0[8P0_?79<T".CJ!KD;^KEUET2L
+M!I"!'!"*XP^,DFE!*X>-#@(*S7T&5+YH\4P$1&QIA<^5#]R^<`V*@WT,^!F*
+M#W1U#126]_:5F\YFDZ"Z'C:5-%BT"!M?TD2FI[NPHVDRMW5ZZZ;;X?1 at S0;V
+MR8TN_.#TW6M6$FG;U]MO7B#^!:?)"QN`C`SIJY^27L1?)$\R;W`$A3M(DBX3
+M*(FX at GQ*7"8ONZ^77V.N<5?YZP&*1$C"03K<9719!250E4/,$/=DX$GI.'V\
+M8D08J:3+M"#FU?R4C,DR*U[%KCO19=A:#,7Z())K=4I9[AQPHLX^T5)5)60E
+M:(.&AU'R(#MQ`L-`-ADJ-[N)1B-AS,HX;"/"^QD:EB)++&DHK1$<65KWZK-7
+MEJ;J[KH"9I\]?_XM\TUS=.*5-\9!.Z@$S/Y_ at D[097ZV[[//]YF?$QM.GS5?
+M,E\Z>_K/;P$5M$_\J<CY=G-_"0L-^4#_>1E3QL&E):C:[T4.)TY$3H'7N5,5
+M9VK.)"XFKM65.P")DW#]C at H'S_,Q7Y1?']L8WY#86K$CLBVUI_8`-^0[F#@&
+MCN/'R3'Z6,7Q\%CJ)+@,/L&OD,%`5:6B!]Y[R%NF:1"D*`E'K(K]R`\6^@'M
+M!_Z.J!Y5O%[,>0W[SS=@JR_!EK1 at JY]U"VPY31P7H1M!IS<,@][YSFM"$4A:
+MG!;/O at -+YR-6$_G_<#J"P.(P;]<1-58'K*)BX_M->&_T'ZE]=7.\.>E>NV/!
+M=XZ8(SI)!A[>_.[KXV#NMZ%]<&))\_<?=7D:$JS[MX=\)*FMFP`M(#OQ[HS>
+M$H>@#H20)')$-WJXW>R0!ROS_-B#8BV(%%)5O$6BU(C4(LEJ!)/$$!Y+L@&!
+M7\\!CLNQ at A`(2*P@<;R7\XL!-CD at SA7]L9A&H2%9\$L\&>GS\JF$-(QC4.I>
+MF)?JK(6!:(O-X?<^L)S<LJB\W46%?"9K12)@4Q62>3>A)>N,1D?6(J^E at T(2
+ML63<`K/(VZ^R)@029G,KAY<(B]@9TTY)RD!7*K at .W7=VU]4?KEP'#C+12M,P
+ME\V>M['0A9XYHF2&%C>FB8[[L3U;58%*)Y?]]=G^>16%,:$<K4<?,@<WSL?3
+MZ,D-?]PZ]X$:K7`-XM9Y\V^X2#R&9)!6Y`L]RE<_Z-[NV>:%Z+&'W1=<GWHO
+MLU=9%\5N9U&]1<JL!E("0491]/<9O6D4>'0Z4:<')'%UI920X$7W6R_G)SSQ
+M)%WM##N:'*`U#*H=(!D&\6J/$\=EC<-PK8YJQ5I;:4E:]0L'<$S222TYF,22
+M8C:#U!\(@_"D1 at _"+A28DQT%Z`O*GC-VHS2Z\\94]@YH+_#FXZ]H#L40\MR>
+M8!M=)"=.BL+4.*!S(DQ1 at HC0]IO7\J4WHE#43*[1GMEB!8+3VI2&H6HF9Q63
+M*4P+,K##/ZJ$X;_LMXX(Z)S3<&GO3[>TU>QXY-2B11<^W'2^/"R2N4S-Q/Z!
+M;9F65PZLS=W_;_/+MEUM<:](A01J#O@"?/CWMQ]?T-<:S;7?T]__Z!,`[XB%
+MS/:G/]JTZ.Y9]:NZ&MLV/_.TF>>%<IRH#A._ at OX&59:@X%SSR"&]83FQCMA2
+M,52![_&-XJ?Q]WTXRO.(EV2\#G8`0;TNR>,F?Q<`H<#"0']@.(##.'&OSNB8
+MI)Q`88A;A0ZBSZ$X.HINU'T.]SERV'...<$"C5W%#K+/L3A4B(U'+9?GK?HI
+M:%<A6H(X;1C9?"&?A5?!=G78`*!C7<_>!@NHC;A6RO:<PEGQ-%9,(TT060:J
+M at 2,R&S^'SJG:T_W4 at IV%Z(,+GEBXCYM##)CW_N6.Y/^H+OO at ILT[CNN17^17
+M6;;E5RFV95E^D>/83OQ"G#A62,D;!!*($Q*6ED+)85@'89#LVL&EO1:.L16Z
+MZY:MXZ"PC1L,1J&%`=T+URMOHZQ=H=U==]#M!EUO6]8[2E=&L-DCR63=.98N
+M2OYY?OJ^?'[*F=^-=:=2\]<K,\IH[Y\D+\-.V0USE$."R+-"H$1=K$$)A`!=
+MN@'J)[HW:F[58-#,<-]QK*"L0WY\#V41VYQEF3D4-\0R#ERIY*P6!-5NH+5P
+MD0DZ&-P8<[[C``ZQ at L-*U2L^1N25<&B65^!U5D_0R#)=RH<"<I>*VYX$+;/,
+M4JT0^1&'OC_1R[7]YI]+ZOK&P9LK"ENV5&Y7]CX[+[\6O:=:G5+.'2\OV5W<
+M<W3Y$73#UY9`GK1F5Y;'*C,OO'!U_3'TR,9F0\HK]@CDL@<WL`_A.T\C%X1-
+M=[5`[7(C;F"/NA)!-\_R at 1R1,^NT.EW,8JR-U\4IFHY9^"CO=KGR\(E1 at V%Y
+M2S*1U&C=E%)7%U,D,:.+YM4)$&2M!$A1`7,:3<1KHUHAF4[`=21MK#77,M&H
+MF3.;N32736?BYZ^])]6!M-==D6(L+MZ at E:HH7I:(1804\4- at JBC1_/]7353U
+M<.>31 at C#S-I at S03%9I`G*#^!^?<_D,6`A"I`_!]TLCNK5D^;_X'F#8YL)SJY
+MM,E(O(]_I-9$W5U@(NZ.N2JCF<K/\,KVQLHB>@Z45`JCZXVLM9Q"EZH.DP$/
+MY$7,R>L:Z\M/HOLL$5>CU0!!!C-[%\S$%&?O"\JK?;6:>L at QJ0=_57RBN(3H
+M$0%I12X*&[L*I<++MH,M!PLJ.VL+T2T18X at -!8*A2$ND,!]LK_]1XN?@4.)0
+MRZ'":7`B?"9QIN5,X:WPY<1[86<KMEL`C7FEUX(K&1,.\&Y<;[%P'*;O2J;S
+M^M96/T\D03+9QC>:_`J>X,$DOXM'^5/HXP+>IA$$VK].>$?X2%`(I]`5Q]KF
+MPI(>N7:=*!-W1L;*-]\5W\J84]9K<_YMYW2U=Z`]K\@%,U*0RR4`05NT(!QU
+M0RW at TBFI1T@8:1XX?MC3,/(R#6+O5`E<;F_X.J1[,`W`9U$GL[BEE`]6O at YT
+M at .Y9D>W0:`RXN:>A:<F-_;_8M-&!&ZRDM[FKKF$9[]07U[86^K\+3F_R6((@
+M2D:[QMKF7=N_^'O+!B->`Z'%S1%'KM`^=_Q;;8^<K!!VKY:,MM.6M*>IR-K7
+MCBETT/\L["0>ZM^(L,AS0F=14R2WVTXZSI/G;1<=M\C/22U#!IS1FE'-*#EJ
+MFX"!J"%8X&4];!-+UQB])EJK\%I91-MOQ12<QZ57"SLA$XE9J.5P(^\1(,&?
+M0I<?XP+0_R-R`,`&;X9S+,C]+#9WXRQ:!T3O9ZK#<Z%P=VFHM]A(!`XHA+&2
+M_<%KED!_:;!G_=Q%B<C\P2-7*Y]=7+PENZ^FKK`ST'[C\KY/'K>5/U;N*T_'
+MG='*[7.5RK20VJB\+L2T]6+F\0_^HE@#]2=FWI10#-JBODA`,6`>]@TS`^Q`
+M8(UO#?,KVQG?.?*2[QYK(.D!9AD[RAP at 508&!#$W9=<8B:,JH%+9"0(JS=[E
+MU0>#J%^ETJ&M at IOYE`(4',#)L%58!_M5E)68?O#<\.SN2^X[UZ';JY*2Y10?
+M at 2.`/Z*2QD0/CR!V23)B3<XB"6D14[$J&S2=0AI8],5?S\^%:K*HR\T\UON#
+M9_H:_?7!)[9V])Z[![37ZQ27MJQ,+[3X^K4LF2')/VP[6[D?L,UA=Z0HX+[\
+M`8A)/`?]J'P$:@"'/'=<Z(X1\0AJ4]FL-K('688,8$/&`6(H,L2/:DJ&4:(4
+M*?%/1?8@/XS\U/]+_P7BO/^/_H_]?X]\X9^)4`3,3M;CGF1I%NYQIP`N!%DO
+MK52 at 0,G:`[1-"51JW&YV(^I^,X;WA\.LGGW:SE,TM.-K,9T0%8<5JQ5!&6YK
+MY5M0*,1#I3CD/8UX%R$^G[X/),5(OI.*@O5C$D`T(!;18PZY.R2JPP&6KEH,
+M;2\-=S\9LI%<J9+XV_Z^0JBI^5%P.M%^^(DMN<2"I=^_,3CN!+==*Z;Z7MK3
+M^R(Z"%QA9PN8Z.&4]3.C0E(=-YO9;<TU=94/$6DGJX-9MA)JR0VIV(],"`4[
+MR0'>642*8$`Q9!QR+G6M=KUAT5NL%BM.,1VP2G"/AT,QO,NA]V-^OUM+36O]
+M)BLX:OW4BEJA;DX$&+].<(N3"+!P$N6;4#9C=Z:_Q&`B!92;1>\0E\0AN"%9
+M06Z"T<+8Y>Y\N!J8.1FBK'4SQU8=3P1PK/QOC&F>ZA1"N?ACF_M*4Y6[:`)-
+M+>QM4GX'?1.HUCS:,9:FGQX^&*.$FMWYT+^`ZJLG=AW8"[9)?4G#0].JYY`P
+M/&OVO`YH=%J]4^?2YW0J)$R$T2"BR"*><%-`P:K"#LKBHS@#8%3K?5Y,K0Z'
+M=#!_8?2N$K0VD\?D87F-XC2Z'(G$[\/SO`W/=5^D';'VRA#PB<V_=YJEC(`E
+M]S`@)(9GTPWIE!@-]MEDK4:&N<%697FZD!T?CQ5O/76PHRG9'@O8ZC/'C^=+
+MY0M)55T7^O+P at IU?.;QN66.[$///U[CPW/+*%\/E'6L26!)1(O'*H.(J?*\&
+MA$+ZD2+R'^&`B<)I0XT^JLXB/5[*0],U5-2>)7J>3QG;PP/AP>Y5X?'PUNC6
+MVF]GM\]Y*7P@^N/4H>RA.:^G3F?O8K<A[?H23E-7I]>C;'>T%5H4\X(A16ZO
+M`Q0<(.X`)DA,T^W^>0HNE]#F>F-:+H:9N%Y3$2L6,R$ORJM]UEU0(`O:%V0&
+MU6>79T!FL/5(!^OGJ6?Z6PUG7^%?A:TV.!!_ZX.1Z3NPO<;+SH6$\]J(LZ>Z
+M*%T?$>UCKHJH+(/&].8;SIO3#X%>_#O\6AJ_&<^[K\CV0KX<R*@,9O`71FRZ
+M8":;EE`>WNN`5&]V!V-CQ<*3#,?*?>B`Z"_)DY0;#U;=,.DI]N3RW7V9B6V3
+M&[IW+%I=>=6'NU[O&FZF$E.=JR?__-O.;S``/Q"._I?NLH]MXC[C^/WNSJ_G
+ME_/+W?DMYWO)W?D<O\3V<LY[+ at YQDE*JL at 9"W'I0&"$@JBY5&XU4JEA%1WG1
+MV$3'6E9I16J[=6$2FRHZ$-K81'G9*&)2T at H-K7^,L*X2$II0I`WB[7=GYZ6J
+M%LF1=?8??K[/\WR>[_>C;<?B at 0#+"P+KW1Y];6K#\=LOGOGAY&EP$[5U5`Z^
+M>OB5@]][M'/8+SS=UA;Q\Q);]7B84,OPYIF0)_GV\T?/QKS/*9,]%X=DU!*-
+M*7$!1S$4C7?_].IZ)9:=PL_"N8:9UF1@`KFHSU`$Q:$$33"H at W8P5MFJA.DP
+M0\NTHM(J4Z$KS&YZ-S,I3RIOT6\Q']`?,.?H<PQ-VN-45,%H)2(&F)5%P$76
+MWB7ZBBREB7P$&N>(SXE9XPG<;4<X>!Q'W+:$0E/.:"1)^B`&SR8=@I at TDN^V
+M7R=5TS3?,5C877>#]ZJK,#2,,T)V=\^9)]3<CZG&@M3IUVMP@:JO0YOYN!%N
+MS2=\>UNJ'QSM.S(V?3);K,6+"4]HJ&TJ4:P%<K9L&0_TY.SYI8N//W7HO5IP
+ML,65RQ'R`+A?%ONV^Y=N#\A$#C'O!]0.=<`,04`Z[-+;22H>1=TNLNAB8UJS
+M3S0*9T0V.B4R/A*C8GUVD+4#NXX"RAJ+.BTZ1P!"(%E8^X<TD_21!A&:LD98
+MN`--F&$6X,!6S>F%!9-S!@G\:W8?TU:R0KVPEZNE_FJUOU2M:$$VV0L.P9)"
+MEF2U6BK!U\,1AS]:1BN]:2+_:-$LH][_];#_&>07^G=?#WWF1&E[1*93=%J-
+MJYPBJ;*24M*:I,E:2DN7I;)<3I73$]*$O#.U,WU8/-3\1NJ-])7P/\*Q$_()
+M!4V$$HH<"8<(ISV(V%@[X at NR?FN*:\(0ELTX0T08"R0"\"M8XA at +V%9G0DV:
+M+8<9X7H-&G[RTRD?TS%G%`T%6&*,`&@L+=-A7PO">M7`\/7+MMX+H.%L-!P^
+MQ&Q4O=M:.MD!]@.<"19+X*,^J=3[,W#41?MK0DKU\7],"^5:*.=N68<'^A/N
+M_*,?``NCNN)!:S9K]T1Z3RU][B.P7`[U!YQB%@3R7PQF'#GS)M3[/XEXD5$]
+M8;6Y``(WP8,:\^_5S/G71&>1]<#_.(9Y[8C7XS0F_4.'$\ZYT6W2[/9=H].P
+MP`VPRY8JTD/.72+G<JUKZEQ3R(%4^]J?^W!P7=*30Y9_C_55[`HR`+;KOS_'
+MGQ/.Y\\7\%E^5IC-SQ;P&7Y&F,G/%([P1X0C^2.%D_Q)X63^9,&E^E1>%=2\
+M6BCWETM[^#W"GOR>`N'@'8(C[RC at FENCA]QE>J!KS/>QZV-JWC5/S7<1%;XB
+M5/*5`DXZXAS*MTKI?$GK!?V%5@%'<"C"0%>S160=T#"++*>)W;V!8%KK[=;2
+M4HRPX([@`-<).D>\P0E.!>I(*.2U.:P#I7R.YYR#1DP)1V-)>1B1.`D](X&L
+MU"KITC'I'<DB_18TZY'A5#I9'$8T3D//:""KM6JZ=DQ[1[-H\..SPTZA-VG!
+M#977&2K?F5ZL5J>FH=PK;^Z89(%LZ>O>0"Y5[Y+WJLN`Z6 at PANGNJ4-F!33P
+M-$P99Z.XNGR4:=8AYPM:_32O!<\:[GSM`=]."9E^<*#0.O[<R^MDP=/9-KIC
+M[WN9SEJD/94MM;T$]Y?7,JG!OKUR>XW.V7S1$;2B9^SYXP/20">_?JBYZ_"/
+MEY:&%&LN9U<&P?TGMSP;J",J9U/*X/X3E5WN!K+0.NOA;4\@*G)!GPEPP$V[
+M&4S&E#`1HV.,`?DQSS@]SDQX]M)[F1,>`_.GZ=/,!?H"<XV^QH1<M(M!#=ZC
+M"BU&O at 9[DWFB`$F/8[9$@_)VJ\EYU::J/FR%]BVKM&])9J\_,FA?@TUIN#VS
+M+;`?=?1=NK1"^JFO$(#Z/Z2WU9\`B/J6$CB0^\DS!WZTBOKQD,%ZE#%H#WG8
+M"O5\[-G79VN^P81M%?8;E+IR4#$,2</L=`V^(Y`P]+S3^I`*)$RRJ0[\E\R7
+M^()UP?EO?-&ZZ+3!N$CO\^PCIX/3M'7,N<>SF\2V(%OP,2M&0?OKE>Q$Q!:)
+M6(C-?N#7+49>BHV'05 at G#.,;B\+#=Z]*+AJCN&Q[#3\"_T#5CQ3RB)D)D39\
+MU9Y`JQ%(`]N5/P/LO\B-J[7_@#0M3N[H[=\Z*3*GT%G`UF[?_*1V"\3G/]O\
+MVO6["Y^\-CX''I at W3*I5<*-"-[P`?]!?"4;$IA;^:=>FIDWLY?#EZ%5^GEMH
+M6F#_SGW)/VCR6IN`K4F)=$2&(ULB.RT331/L]RUO$R>:3K`NDHZGR0SF$SUL
+MIJO9+[)TEZ at 6V?1^426<#KL%4WRJD)%#?L)N<5M'8S;:ZAX5B$S:,X8!3#\&
+MAP6*H3M;&4%)^G4?\"V?A0=5TPI4[YD>^1[4Q,>8"PD:I[%AD:>JS<45.QRD
+M"V!U3!J+&40-%Z90AC&#XX%>5BA]>PE*M72CU)K6P<%D8O@[I^87WAU=GV@!
+MP#:X<>GFIN,;WSSSEQ<C-0^[M:;9LOVX14\[\@?+?.>_[G]>^VLNTOJKP[Z-
+MW9:DH><ZJ.<09+`;;MF;^E:1JLJHZ,W(SR";E-WR/AGF1_F<YYKG3_)5Y99\
+M2_FG_%`F+1[<ZY"Q>)2,H=PT&]LO&+ZA2PQ2#,=P4HR&@QS$,;=5HDB;>U0B
+M8E$/QB5IQDB/28>>,$;'\$PP/3ZH.R8H4_<2E.F%ADXP2M2#X]2:Y/B5X%@L
+MK-DB,T2A;>@+3PP^]OR3H>1,C7YT8]=Z-7<JEBDM_>U;/>GDX^._N?'-;P?0
+M2.^.+][_^?B[Z#9`)4.%EQYV]11LN6]8-FP&\70X!:C?&;=)@OEI!]2%0X[J
+M3XEDI^M]\BQYF?R4O$LNDG:+"\3C)(=R#DQ$6&[Y;D2GV?AY,4Q3F"^*1;DP
+M8<&8H$["Q##B@;>"BSM]$<$I1"'GX:SHCFW"?N&F@`E\]GK5M(]W&Q[*')@U
+M\T)V5^LF'Y*D[W]T5UN,$]<9GC/C\1F/+SL7VW.Q/9X9K^^768\OK+UV=B`!
+M[W))LV)#"6BA*G=5::%1G%*U*4E!T#ZT:1#1%JE-:0")1A6MEFXWJ5158;L"
+MM&V#LJ55!6D5+LI#>*G82)%8TS/V0NA#?#DSYS_GY;]]__>!_X.2+K7Z'*+C
+M0P4<1VSQR,I#X\.[6K65V_GTQJ'-2Q\68:;1P/,V&)]Z=N?8TXVGO[UK6^>[
+MNTM4T:Z#\H.;^,>HKVI8';MI90*<G-_D?L-S(3>7NY-;S%%>%L^EN7A^M_N2
+M;RXYEYI+7TO3KZ%`S8"/IFI35F4&N'ZG%=X,@=`,V#<E3UE!9+$V:GR<QAW1
+M.`\=\8*[#NMUF?%`0L?IN`XM29&GPHHV$GJB]0D$\%4L>RC[6I;(-JQ!I084
+MK:9C^DT=Z*_^@OD-\R?F?<;!-(:,>:2<)N[=DIMWF;NRR-B[]KTVVMZ[*\IV
+MZ1SX'(M0(!GY$QEA%+;\[`U%OH2DCHU'R80!>M((11-94%G%"F"YUJ*@*X;L
+M$!N@:X4Q4*XIIS=]:6TJ6)S\5KER]L3*USDI`//ER.'-3SVI1,;V[QUXYLR9
+M],9FC'=!5F**X#E0/7ZP55^1#(AKAU:OWO;2K[,!OO//O2^OS_7WQY-5TWCF
+MQ6_^F0UX(!Y2B3M=;O3 at -OYSTH4IV$XKZ at Z#0"O`NBV at N;']E,MIA35V5'*K
+MEE\+M-PS"(T]%M0H;R:"H2/%)A%1X[Y\29Y'W24W_R+*M]K7T786&[Z+'L/S
+MMG6^&ZRV80>$KU1M at H"<+P5BK+^+U2L$Y[(*9+50JF),K"]?O.CU%U+54+'?
+MW/R]D>I>XMF:I!?+NU_LG-VR-)F-Y&NF.%Z9")5_@$\N:XX'-QWK4%WUHXYZ
+MQUJC2V"]=[T/;W@;/MP%*4F"DC0461MY#NZ#)^$Y^"Z<#LX%KP7O!/L8']./
+MZS$ZIOC>C:DQI;\:\P\Q,5[QSP"?E1`LE[A*4$6&=I']/LQID(`<#8<%=QS&
+MXTQ4U&E7IH^QZ6L29-2H#<XHU[9,ZZJT6P\']P9$H]#XMNOD^A696;Q['RRB
+M$=Y<$,%RTZ%1U at L)"M!C!-<'8*4;H40/M>/@K3YY0]$(I4L;P.3`FC_N>'YT
+M8'SKCK<S#9PDSB^-/A$I1=D4OMHJ$>92U"HZ#8[5CP[+A9=/X:1-CN5E7OS@
+M)O$/XCS"GN]8-8"Q"2$AXBZ:;G$(]B@(,YPDB1*D at Z@21,#P1%3A5*<HN$>Z
+M-E+E+G`X-P,6+5J05'%`O"`2(MI.C:HVU%QK+TW4;BQ-"+6V#3>V9D%=0D(F
+MRS08B!:[()A_-0#RT)8D?(E_)%N0SR!&%$`2_2JX5EW1YSC)_)#VUE>`:KHL
+M=:;+G\K%4%C-$.=-W*]16;KS$M at FE?NR`C!-PFC>_SN^W=I?J88=YD-?R9/(
+MUQ*JX3\`#O"D3.N^&,=Q?$"2=3DFI*5"(I,T:E35-2BOH=;(X]2$:TM^CW2P
+M<$PZFCE6>"-TCCHG3W/3O!IV)*1>I/+Y7#:7R].94#C<XE+IE"R-G$:T)<.M
+MSM)TAH(C;R/`03NC8!B0<M'9G"2'PBE/`054CY.FPL;PDC./U%[!;>6-D4*K
+M4*+9C);J3UO8JO3(?O80^P%+L"VVU%\IE8VYA5FVUFX:$V*[)E^1#:[6E&^P
+MB)>+;:-=:]Z016P8B4/!#C="=4 at R[>Q$FVE`IO'PI9D5F0:%DH`W8)-!&[+1
+M)9"/)0)EP8Z\]H6I05]@WP`?QW).UZ3[B.IF(GGP[UP%TGL]QPE'J0B"\6RP
+M\Y[Q-]=G9N=JHM_.%2'$/$&A\PTP!K\6"/M(T\0YN2^I=7X"CM(<E94=I at GC
+M]?OS^/-+Q_'.]@IE]FI50'/R0Y2_(92_WU.\6W5I at TZ'0W5HH+Y::^F;/)N\
+M6Y);4CL].[U']'/2.7E>FI<9GM7]_A:G:BJK$TY>TU1=9YV$TRR;*!V:SI9-
+MU31 at N=SB",*I\;Q?/V&<-G`CP^FL;J*;\`1[AL79#`<-J/HARVM$V="=IH?&
+MO%*8H)60['$[02T5)S`E,51/TKUS9WRH=]T9<H<23?=0LX%:8H&YMF`/6_O?
+M55E+MI(2E]]LZU%?(3O!4(T&+)#9"9$YVF@@DR_+4`OD`J1F(3KKK0U(H5E%
+MHI/9WJQ!0]O^@<<S]RAM"$$@`;KTSF8R:![9&4;60'>>ATNCZZ*[M<YG:B*.
+M8RUQ7VJW61P$FQ-20;L*!MPAH<-GS8`GU#<HK%2?+)4Z9PW*W)HXE@''BR+*
+M(^WBA3?+AT9$A<%1#FE_NM/IY%G691 at X(R-LR0ACL8WY;2'5CQO+F-W9 at O#G
+M,E;"RDAWO0`-(;?7>]!W-GA6F`Y."[>#MX7%X*+@(4EO*9A,!M6($O5&(XJ*
+MJ4!M<:CME$@DP_E\WGS.Z_-%U!PZSU-^7$BD";^2##AQU_B`KPSMXW+YT854
+M`$N!5+44J!ASC>NS77%;,YH&^HCV-)\??IB,G at WU$$(K>^TF!K5-ES at R5VQH
+MMT,?[))HZ.]!]T/8^J+F\0$;RH$V-E@<)OU]9C946 at 8S'!MH0L\IYONTMS8(
+MJJE2J//7\8.O;/LJ^,][J^JIO#<X9K[^"-=,X->@&.WL!`>4/-L#OGCK_OL?
+M_7+'D.,JZAE7YPS^*?DC+(%MMTI0#LKO]!$`4JPL<QIO<8K6Q[*JI2E:O\ZG
+MDIRF$^S/(H&MF.>_:RSY*S!IS,GS<ON>B*;8/:'!S&/#E^0E>;:W(M\E0[Y\
+MN3AP!$QT'4:\I8+JKPG**ZJVIXC4H)I30`38%::B^0Y2)%E,ZZ^(T9_NJ>\"
+MQH^_CN-X\JF%7QT_=J#SP9XZ2&5R+8%/N&#LA4.G+GYYLNS^[>%#;ZT[_#_6
+MJS4TBBN,GCLSN[.;[&-F9]_=F-U5D[AQ,R8F&Y-:7$-43,S&:C1HE5 at Q$76M
+M^*I46YK:BE2E4,'82D-CI-0?(BJE)HV*J$1%$<6B&$2TB)2B?T1!$'/]]A&I
+M8(B"=YBY9RYG[LPYW\PWW[6I>[OZ#GYOJ>A>V)O)!_K@;V(@K6UQO,PL^^3C
+M#I'Y?:HLPVZ+VT>%'(K*XB!M!9H=!:+2*5D^"3M)F;S$5U2HW[[Q?VW#*]/2
+M at F*55+I-83&*8=#C3 at G*9RXJTFS,3B&6C2%]T]8]!_^N+20]JW8SO;6Z;5^^
+M]YO0N#*#H7KYX/7!`<N/77W[]SALW]4?:-]ZS%+^<_.9_>T;PK*Y0/-,CT:N
+M]"[L3NGBC]A:R2Q$(,+Q)WX1F0&2?N[V.>@-M-P50ZZ0)@6>WQ<BO>3!`>&F
+M$#!LI]Q8]L=>E7)D#RN).W,F*$R%1Y2L+59FW295:3XOR7WX8G$FZ3QY<2M=
+MB<4JTU7IZ'1A49Y9!E*\CB[2FW)RG>&<FOF+&ILW;4[L%*6XWE3GM%D-"Z8W
+M+/GZLU^_G9M(!8&^VG)\CE-L'3O-[@@FH4VX*B;%!])2J5OJ-[0;`\93\E+Y
+MF:G.=,B<-#_..9([RQ*P=%C=UJNV#KMB_TF)*8?5L,/OZ-'\6H\3+L5UV.UW
+MG_$D//W>'[R/?;O\@O^?#RX'O at S\ES<_+YEW")G,P=*]DUPBQ*B<84:,V%BV
+M%T0)!J,,T-\8N31 at L0(VZNT*H,*A.0&7FUSUIO[4R'LUP:C\8"@\>LS8`A06
+MC8L4CX^6Z!-*RR:65R"&RC?=L8KV22,_V/MJ$B[0L83J.8GT!!$A/!$5M-+Z
+M"#68AIEH0"/FH1DK\`6VX"OL1D=0"_HXI^N"*,)XE!*_BOA3B3\#LXC_,?$_
+MQ:K7^?P>'^"W^$U^@U_GU_ at 5?IE?XA?Y!7Z>]_.3_`3OXW_QWWGWW;%W at Z^,
+M?_LFCL at PH2T[KT at Q&PJN1%C-8B.A<.H-D<PTXB4G,E@@;^JS6"3&@BR6"&_)
+M8B/ASJFS$[5UC<5-*U:WKH_6K$DN&WF`;)N-!&I11\85HXF,7HU6K,<<.B['
+M1B3)RG7#LJ(4IC7$&7Z>=V%D7:E&"VG;1HX)4&C[$)#_-5^C,384F>3QZ(X6
+M^^2G3#6ES\^6UJ\<ZOFCP69Y@#(M8![BOQ1@`#*:M14-#65N9'-T<F5A;0UE
+M;F1O8FH-,SD@,"!O8FH\/"]3=&5M5B`Q,S,O1F]N=$YA;64O05!.1$I/*U1I
+M;65S+4)O;&0O1F]N=$9I;&4R(#,X(#`@4B]&;&%G<R`R-C(Q-S at O1&5S8V5N
+M="`M,C4P+T9O;G1"0F]X6RTQ-C@@+3(Q."`Q,#`P(#DS-5TO07-C96YT(#<U
+M,"]#87!(96EG:'0 at -C<V+UA(96EG:'0 at -#8Q+U1Y<&4O1F]N=$1E<V-R:7!T
+M;W(O271A;&EC06YG;&4@,"]3=&5M2"`Q,SD^/@UE;F1O8FH--#`@,"!O8FH\
+M/"],96YG=&@@,3<R-38O1FEL=&5R+T9L871E1&5C;V1E+TQE;F=T:#$@,C(W
+M.3(^/G-T<F5A;0T*2(E<5 at MP5-49_LZY=W>SP(5$Q(0\R%TOB0MD3:@8":\L
+ML!LA`5G>NXP#NR2!$(V))<T($LB@""Y0J"]P"J6TB at YBN3QDEG>D*%;HR-BA
+M4$:@%1P=E:GM^"QE;[][@Q2\__SG?S_.?\[=NQ``>J`#"H*U38F6RL?>S@*F
+M'P?$IMJV5OW7E945]#@%J/GS6N8WR77?-Y'_C%@\_]%%\WY8F!4$,C\"0BT-
+M]8FZJT]=^AB(GF9,>0,5/?IUVP%X,RGW;VAJ?>+K^[L]2WD(Y<\>;:Y-G/OT
+MQ-VL-X%R6U/BB9:,7WC^QGB3LOY8HJG^_E4=[P(S.]C/O2W-"UO9)Y^9<=O>
+M\O/ZEO(_363^;OF`^ZBK%=)5 at P)BCK(!O0'K,O$J\?/T&,"VI0];?U7Z,7JO
+MC3)=.0+%R$<[-C)S.R[B?F3#C\MB%.6].(U+F(!9.(YJO"$>1!(/H0)-8B3Z
+MBP]1CC!^@R.,6(1F^E;A5_`QZH!UC+IRO($4OH47!1B)*+.LP<O6<?P6G^$;
+M:ZOU.>[#"GJ<L3Y&*4]@#21R4<2<C6 at 1`=EJK<0HUMN(`[@H[K)&H0^&8`1"
+MF(\&-.$Q/$W;89S!6<'](X`RUJG"3*S&\]@`$^^*0O&DV*QZK0:K$3/802/C
+MGN-N3N-3_$MDB:/BA)5O[;4LUC8P%&,<^R9LQE;\SMX)3A"NX*J8*F8JAC+$
+MTJR?6=?HWXM3"Z(&#S.B"4NXDXUX!R<)EUC5+\K%=-$B.D12G)!CE-ZJQ_60
+MM9Q=9G#>(PF3V/]"=KH>+W*&K^--PA_Q%T[>*PPY6G;(KY4L):A.=K59RZR=
+MUA'K`YZ("STY_QK"!+3B":S"L^SW.>S#,9SC67V%Z\(C,D4V>]@K+H at O)&26
+M',!L[RO-2E+9J4+=I%YPC7*M3&]+7['F6R]:)ZWON7L)#V?OQP.$H:Q1B<F8
+MBACJ..M'G/OQ,G9B%_9S=F=P'A=P'6G1C_M\0(P1L\1B\7MQ7)P2WTDI,V4A
+M:PZ0*^460J<\)<\HN4J!XE<&*[.5EY0MRNOJ\ZXZU^.N%UR[W%]X5J5KTW7I
+MMO22]"&KQMI@[;`ZV8V/W=AG.@[CN=O)F,83G(?%SJR3]EUB/WOP%F$?NSJ(
+M0WQ+3^,?^)IW[K^<@]>90PXG428JQ`@QBGV.%2$Q7M2(26(:SV>FB(J$:!3M
+M8JEX6FPB;!9;N8^]A/WBH#@I3HNSA"OB2\)WTB4],D<:LE@&90UA)B$A:V6#
+M7"";Y%K"-KE3[I4I!<HHI4I)$$RE4SFCG%4N*3^HN6JK^J3ZMGI*/:]>4?^M
+M?NO*=)6YIKMFN'/<%>XV]RON/9Y'/&]ZSF,W9_P'[NG6IQ:+Y$OR/U at J'^1[
+M]AX at WY?C>!+M8H]XA9-ZE?=V".$C0I`PF-"-L)PS'!B\I[BHOW&W3R_L5Y"?
+ME]LW)_NN/G?VOB,KLU=/K4?W;MX,C]NE*E*@)&Q4Q76S.&ZJQ<:X<0%;-A)4
+M)&Y1Q$V=JJK;?4P][KCIMWL&Z3GO)Y[!+L_ at 34^1J8_`B$")'C9T\\\A0T^)
+M69.CY->&C)AN7G7XB0Z_WN$U\CX?`_1P3D-(-T5<#YM5;0W)<#S$=/OYHXQN
+M at 1)>#$ZBNYW8Q-A$>T,.B>T1-G.-4-CL:X0<FU(43M29D<G1<"C/YXL%2DPQ
+MMM:8:\(88_8:="/<CM/I.B7*VH&2!7;_6-VCSJA;G0IB;MSF$@]'3241,V7<
+MKI$UR,PV0F;VXD]R_B_^R(77W&(T95%5HCY9Q=&L'M<EQFTIL892S52=:>6*
+M6-04*V)=33B]=^VBW at C;FGBC;GJ-,49#LC'.F6-*='=N,#=L)$(Q$Y'H[K[!
+MOHX0*-F?LW2XCT/9'Q@=&&W3X;Z<I5WTTZ>Z]!]V=G?\CO^=M&;*S;D(NY(Q
+MGFV:>JU3Q&"O0^VE?BB2M4/IQB<FN,L%IG=L/)DYC%&FJRC3T)/?@`=E7/WR
+M=DWBAL9=E/D-;-8^SILW at O8;?`KWE-2DX(U$=PGQRUA*6"M2"!7LYQ=&F3.;
+M9K]]'1:$&$UA0`D5`WWD!I;H5>RZRCXW/:DGQ]<E]2J]@0>N%CF4AOIDK)3;
+MF1I=P'5:U&<&8WDWV?I8;!CS#++SJ$Z>9(P9&F]D:'0R,,%U.I64U'!$Q9'H
+MY*C9$<HS at Z$81\+[TQF)FIV<8BQ&K\#-3DG;%^3<Z/E>]AP82*:T*\M4YF"*
+M6#+9)1D^LS.9S$O:[T&7G!+XJ2)X0Y&"DX!7)24Z(HZIP_#EV0K#9_C85BS$
+M4F6\7C\>+U\:_A]R(TU&>R<=3^_P'+0UMSW#7"?@DV148)9[.]KE=LPFEE.W
+MG+A25D"E[3*QB3B2\JN,Z>>:`8-XGQVO7D:VNA#9Y`<[^;;#1UIDZST%CGXD
+M[3[B=.KR*>=[UL)+VH<84-:BAKD]I*6D at TG]S.$G7TZ\@S7]LL)*DE?)%[DK
+MF`L.#B%Z[1CZ>Y4"--#>UXXA%C'W0%*#F,_[-BC8R_O!--%KFJ@\/4!LF2:"
+MHS5QC2,I<U;=63.=%>):L+NM6N\1Z]WBJ]&3I$KU/Z7"M9._K()7W8))[JC,
+MX+=\)[F=Y"2V2!MM;AGGMTS:-`/KR*\CWR%=I!G\(C93TTQ-,S7-U*B80RG"
+M"G.<C),HV54G.5(9I4I*98Y4RFJEE$H=J5!F[!89P0/B$S%13'FK5^&QQWL6
+M'N*'<2+FHE`,WOW,I,(C8AMT:&*=LRX/]M2UB[IV7M?6Z=HR73LB5B-"PZ/.
+M*H(](]JYB#8VHE5&M&$1[:`8SN^W)I3 at G7[ML%]+^;77_-H2O];FUP)^1N_B
+M7TI-O.:L+P3U:NV[:NV]:FUCM;:B6EM<K<VKUGS5VMQ\K7^^EI>OI<32??_C
+MO.ICFSC/^/O>^7R7V(Z_OQ*<PW9BDSCU.?$7)HY]2>Q`,.$CN'PL2A8"X:-T
+MZT)*&A:*@NA"LHF.D8U.D'4P#0$K98Y#D*%(G42V#G5(3)O63BTK53,ZJ612
+M6XBT-';VW,5M52E_3#O[WN?N^3WW?-WSON]SRE/*DTI4`)?73BI.G03>DXEJ
+MCJW/X,\GO:RK*L!F\$@Z607D6#KY&ENOQT=1A01#1(.H at A#H8103Z2'L$6D_
+M]HCX"VFN`A[K34=>!=*3CDQ#.O8CMP@^D_9.`W=E.MG!UA=@;UYG#8HQ`GTJ
+M'1D%N#)==9>M5V,G<N-R8)<AKPC;D5<4M^6I-)UT@#AU#1Q=J,A at G&9SPQD"
+M7V>_X%K967=&`IPG[@P#Y,.*#/%:FKW/`>&-['M<!_OWR%IV"C3<3DZS;W+/
+MLC>KQ`<NQVX)VM$EZ';.\#+V`C?*_IH;87\5$>%S7E'?Z:1(?E8!S.OL"*CI
+M=6?PEC1[P"M8D+'[0>,S50EV)[#/\$K6715D-W-OL)NX`^R&14O-,9&LX6Z*
+MX7S.*^HM;#UG8>LB=]G:&$229D/"XVG6MVB\QBV&5QU9Q[H@/,EUMC)9S=K`
+M).:?8I_>0W^;?IH.TG[:0SOH<KJ4MM`Z1L.HF")&SA0R#"-E)`S4+:/++#S@
+M7<(BI9.J!"*5"*-$O%81PD at LKF$$9@@H+6&/2.$3AKZH*:J)J$--L26&SOSH
+M6NJPI$[#^ICZC65[JD:X6+!L3Z3\PH9\`W^,_QF/W<`/!;(=[JWXXWBKR+?&
+MMF\W)5+K-F[+X(?Q?1D`]D&_(X`/@0'[.@@D4EM$/:@"6+$;*"D0T$,$4(6@
+M!THV((J-+(IQH`7$8@(1Q*81)XIQQ+0H=E<0&Q^NB,?&*RI$$<J-AD618<HM
+MB$#"%SWWP*.Q<8X3I0I3V"/Z[2E,B8HLHB*O%T0B7D%DO,8+`N/>&A'FOH:K
+M%N'61;A5A-N^AMV+\+E%^!S`2^;X_SBZ&_XWN8FVLT?'A`ZITQ[OAK,S]:,^
+M:`('NY8O'S]Z-M\Z.3J[=NX5Z([NU%E[=RQUU!Y;/MXVM at 0\)L!M]M at X&HLG
+MMXV/\=VQ=!O?)C96$T,G>N+?L#7RE:V>$TLH.R$HZQ%L#<67 at .,"/"38B at NV
+MXH*M(7Y(M"7$%M^WN:%WB>/Y at P<[>GL[8!+`-Q2B7J$2L.+3J/$:@9LI*4QW
+M?AF2T,TD*J0DS21)%!=(Z6:,S$S!)]:F5I/+M?YQN"4;7J^:#;>HLF$4#6?#
+MJL<P5'N\:JO:":>5ZLM\,4<EYB8SY'OSY3#G2/2MA01YD;J'JI`?OF]?YUUF
+M7WE)N<]?XO=MJ=UMWN/>S0U0AWS':^3FNKJ8AJ)\/JJ90CI2$BC*X(&TW!3(
+MX+)K2KG$+[D)JZ<##_`*9YF<UY=8=5'=LOV>#)[C-45*L\]?5DZ;%/(Z2N)T
+MT`&!71#:7\"C$FM5A/M;<=U,L6DJ.V\,WS>&Y[.A/W!UQ5E3,<3Q*#L%P4RI
+M'JDUQE`?]SM:Y5)-57M0N]9 at -!C5#J?#[PL$_5Z]<*NWN[%378KU.EHJ_O1V
+M/T at XU2@8\/N$"[((0)#LM]2T3;[%[WGK8GSSKG9_J?'2LQ]<T96N";:T\/%C
+M6T+["9-OQVK7H=4=SV_V)7#/X89^DF@\&-UU_,`M9G"0*K%XIE\Z*<D5]DR>
+M7K5R:ZW;:*0F)\D2S4I<D'NGK/&'G<VNM=D/)1_(>[:VMM:XD-A\O;CPD=1-
+M[44VY$:K4#,:XUF94JXLJI(K%'*E7%;N4A35-2D-&IF&IIMES;9E&?P97]AH
+ML]GE,K3"5BW>NFW!PB*%K,YFSN!/)UA7_2J at O*S<YBM.--6SYK4)^!2;L/;O
+M%>NB90:JHF5F?D8U.P/YC,[,/XJ&'S^:AX2&#G-W80QA81#.$,?5T=FP<`\I
+M-AI87(J]-<%`T(OMN`C;;9!"(;N$W09I1UZD\?L<=ANAUQE at X_36&/*0R'>Z
+M<1XBGG?J=0YCLJIWAR^T<?Z3'<2=Q-JZ at --L9J2?_K;]YUC^.I&[W=KPPLUU
+MX=Q]K+VX=6CZC>[1W,"?2FRF>GK'G6@]E5`Q&IM.M=*R<FZ`0G8#+6%*[.77
+M<I=?'KF`^;G/<'0XV9'[Z0\:FO!Q[-U[XI7<J9&?X".X,A4M8Z1<[L*IAH2X
+MSW3D1HGGX!VH49Q?)E=(2`4CUTHD<@6I5FBU1F.QY"JS1FW6:#-8-F$]MCBY
+M6K*/U\>[8P]1-)K/%Q!T1W6GVJ/1!H)&J#6URJ at QT@XGH>ZX-WA5>SY^R+WI
+M0?'`CV?(#DR?[[(.'OI+[GQN_G+NW5%K[15L at 59%]"<`_JP&?W1H+;^\@,!*
+M%2V%/RE3TDJI2BV%.C<6Z];(KBK->H/H4\N619\>9[_IDS&$5*)+J!T18OD[
+M`\&`6N4DG$&#4:,F5J]/;'AI:ZWVS.HCJS;]M?C5X3_CG;G9OB/?66.Q'OS^
+MNW at G9J]C/&K=EL[].W<%?'LG]SZ>1?>0%GQS_%&"28(A"5*J($A&=9J6Z<&S
+M7TJQU*6=4IAU^BEK?]ZS[.&9`Z:\<RTS(:_W2^^J/;A=`GY%L%`XM%!%`:%L
+M\.RII+:S65/86-FTJB&Z:^-5QXK`D<HBA@[Z5JS;N0U\>7_A7_A-]#:2(0>O
+MI2IE, at 589RH)LUQQV]K_<M[P5T:K/9(OE>ND=ES:T,AQ#?4>DT`:.*Y1S+UD
+MX1\$![DG480W(9+<H"$(3)#0)"&2D.%B"KXRJ)NX$EGQI?%?@`GS^FG50Y,P
+MC<(8DGZ\Q>UZ4?5[B$J8(&_ORM7NIO;.]8FZ/P(=Y50',J#G>'.?;DA'.'0!
+M'2'/=C$/;.1_NN@'=MT#Z(>_F]9VZ:`_YM4*.4E(&#W%T'(3Q$:0&>R9E,L5
+M9J/I%NX''R[@=I1?ZV&1SX<:CD)J6Y[,S.,G+A>\^YYV9-"K=;`86OV09K4P
+M0:6TO]Q+=.'6[_V7Z3(!;N*ZP_B^?;O2:BVM5K*MW=7J6AVK8RW)MBP+$X'E
+M"\SAX`R8A$,%2N at D=MS$8'!H.$(<L$E-:2`0<*8<[9"#0"FE!M-,"N%,4F;"
+M3$,::">=21.&TJC0UM!DB):^E8T3C?3>/ATCZ?>^__?_7O[2ZNE\R#[;#YXV
+MDO-(P[V9+1'"X=)5SX=[RBN=K.,=K2]TWK\)^\FEB#6/)8"2.?B2?M"YP[5#
+M>E79&=T=VY$XX'I+>3UZ(/'?J(F,VJ*X0DPB)NHF5DRL;-!-Y:8$FRJF5LZ'
+M6>(IXDGR.6*%<95II6T%MY+O#@P0/R4W<J\&AN`0<9P\(5T-W27<(<+/)R&D
+M"3HHF`1_FI at HIX/SR07"`ON"1#O13K8+[?;V!-M()62>),REA:G(NL]-%NTK
+M,YD[O"?P#BR\+XRC\$UEBI*E'8[C5,>I.$`I7'\T616_-)+-C2`+U$:L-E>;
+MLW"C)5-1WK`Z4QF).26VQ$!C@(Y220Q3\"0H=I4F,8O'G`2&6%$2`Q$TE#BM
+M2<!*:,"T=@ZT88-V0SO3E05=67^UYGQ:D[$EK%K3T>BC!4<$Q^6("E,S45W!
+M1)&YXJM6K3TS]^$MG1W^R2M[%CZ[987Z>?GTOQS9_X<E$]8>W'[U^*_^\4BR
+MU_O\XLZ^S=6'6C?_$DZ.MG0NVM@]^P?[I]*UB[M?'/[UBI799-.Z=];__-S0
+M*^N7U#ZF>0N.3;I_&1Y!^\A@"G8RTWJ=OR[<X>\(Q!3'7&>/V./H$_L<@^Q.
+M<8?C(/O[\(?A:^RU,!.C!)X70AX((%DD!'CM@@K,6L0`9AK#4_L4DC>1_9@%
+M6!#K8]&B_I#&.%J&&!<`(S_*65&KSO(YQ!=998&SYI=:_2/:7CFB8TTRPFG0
+MF.K-9!(8 at TP2H\-4$NA8-(RQW;`!RR*RU2G-+_!1D at F[UH#&[0V]E-(6!9C6
+M!-[P,DWH!OI^N+KKE=.WEW>N/]OY.OU$TYH9[>M9W_3'JY2#%W,G\4DS[?2&
+MT&5`_/;HMJ^AK.[_=)=ZX;F?-05+0[Q8,779-W/L$TJ-_W[C"B at I<#QP_Q;8
+M#`^C>N"P9,:!1RB])<(5"9HS1YBB"$DR`B^<E;Y]^D%YYMCOK*@6F1$V^@,+
+M`L"_;TPO-I653\[$RIKVU&7B\2GU*6BJ;2R+U=7&O_U-?3S:4!<KFU+(:BZ4
+M"P^@O<0Q#[*"=.8 at -$-6@`)A-5M9T2UZ%*@085T-K"%J=&EWVM-&MW$#<(#H
+MIS89>DV]3*^YEQUP#W@&X2"QW;2=V6[>S at ZZ!SW^1E,C@^O1D0UU?!O`>1X]
+M!`$0(GQ#QXIFD\B$:`E]@=EC$W`>8AP#G at 64P4/I=&56]$8#38>MZ),Z`=IH
+M`R61#!!LM([@/8#"\#*.'P9M&:,A(QDHZ#$SD/+5&7`:8\!Y#(!F]'<@;L"\
+M\1&[D,_SFJ.ED;VF[9K'Y=.6&DT]#R34Q\04$CDNFOG"A:+%%G3GM3F.Y4"<
+MO:.-Z*%=]+'DVG/I/C:M9]-H8E`>1D4*B@!`WIA"KNT"8SY9)<>!-!8.2P'<
+MEKNI+ITU:S%X.P34Q*3F_/_F5Y58V_(W6MT1>S,(X at Q>E;^4_T_`\*//8>Y>
+M3W>*#@0H+FJ>&3G_P3Q[58E1%T";A?;-AX+?NRC/&[$`5HE=SK1N$C>Z\`FP
+M&2X0'W$=!Q?`)^!3Y4MP0Z%C%"N9Q$#4;Y'$TJC/&0P;6"/EK"`MP6CEC(KV
+MOY'@(Q*09*`T&D,R,L;\_@`5'@:)C%5X#)^3\3SO.>6!GJIR0]C"#N/P:%4"
+M%:5V%/AXU/?2;*XVG4.HXMFN_!>6T=!G'<U_6O-`Q>F)E$D^CL>`(GOE,B[<
+M!C`?W at 8B?+0-`,G8AGW/];3B+!B>+X)B-RI-<K3A!)-2)3'N<Z at VI;'\K56P
+M)86K'W]].B[8TYWY,VNF35N#3[X+I&4UR[>\_]G*M_./XZ<:7]@Y^ZV,Z^ST
+MGQP^M`ZH>-(=T->N@%N[ZG3RGO=>GJ$XO'NWWIX?QV^YTZ^=R/AL%6HEU.HT
+M<?\SDD78?9@?.Y2Q7W5<Y_[.PWG\DSP>HFP<*>K692A1TNN'05W&BQ;X?MFF
+M-Z-PA%CZH#4F&OQ^MW[)7NX4]Q$'N6%<=TPVSW$/X^11.5`P.#7[!<*GM1`$
+M<C0*8O9)-^S\"%(<.L;P=@1ZS.@<#J_)X at Q(LL5A3F$F+QI8ES6%,1YC"HQS
+M+%B<+5&)4G:Q3]8 at 8186*\1N+5?Z/$'9PJ:J)2]<=I-Q5M%*<3Q<O^[*G]5;
+MP/W7O9M:%LJ-RPY]H!X_<^S=BZ!63RZM]WC5JLUS]JB'U$]0D#LY4WE4GEOW
+MXS^=!7Z at _/'*V!ES+=(D at SCMSE1>%,&;U#`U;!\2OZ'(:LHJF45_R%\LB5S(
+M9RW&Z1C/<S@>\_E0E)YSR@$<",R0;&+"Q59-9 at 4TFLS4[`.1L1J<,4F%!"\T
+MN)QNI\<I.0D=$;`'*!EZ=2E@$-!`.O$4IA?I<21*9$Q:- at T"RJ^RI.GF.W%Y
+M.,(RV@)\*!15M-Q^[5_GWE3_V52AKGFFL7XY'@+<>V#AVG6M<W_Q9?[B4YY%
+MV\`2\-#>?E?BWJW5QIINN/69#"4O/*`^NEO]:E':/5'3#H?J]")B$L+"V(>9
+MCF7!5<&-0<B\7R2::4"O89R[[*)9`$+4"25,#(7\A"12(5_)+D[$>,!'2YPE
+M#!3<?@,?"-+0+WN)8H8RRT>\L9`Y1I44ESE=KE"80D(,AZ'`=QMFT-V8W"KC
+M\C!.#RE6=YB`&DPE,@;S;G9D9"1=$%NM-FG/Y=A<KG#X&#VV%0IX-%K?R8+<
+M5XHR.H\MM;2=&J=6[$,'L@))2=.:I;#4JE9;00EP70WURXF,OLK^Q._4F]%2
+M\%!OLZV\G&M^03W?<OKRA5DUV7N'\86!`L#.!DI6K_6W.D-JZN$>5>YI4<E)
+MM at 7_)[SJ8YLX[_"]=V??^1P[YV_[[GS.^7SGLR_^R`<)`6<83!*2-(-.,5^:
+M*3!HASJ at 1GP64M9M=(*M\`="5%TG!!/KH)6HVJ4%"=H5&CY;V"38!ZC2IC:,
+M3HGV1UDGC?C8^YZ=A*).RQ]OWO>U9>GWO,_O>9[?*>/7EO[J7(/P7`4/,>Q$
+M?ODWPMB'(98]#F-$XF5-KH))1,08A'$*/YG&8S*,)_^Q]6>91<SO&8)!X*E3
+MX$TQ\:O2``3/3,<UY#I<-=`@7/K_ at .O_@P7=(K!C-L2I0'7X-K]AW$L$@#:%
+MTY^[-E?.*XXY>XAM58!>[A<24P#ERW-LBIDGFAY^9CD*=2J#9;$/\OQ='&BT
+M_#POOAX-27Q8DQ\5*BK?5!6JC"*'"#=$(5Z7SF:@6,5MU"HY%$S$LED]=D2^
+M(>,9>:'\@4S(IW'RG>;Z01WI5G-3+9B5$(F at I[*?5]4+`0.Q8#NY,21:`&[&
+MD8S5NE;0T at Y70DFI+@V)5QJ)5Q*)5^/7Q>N;I*MM&D@?[%(XCI!3,B83Z^^Z
+M&A5'BLW,*>PX/V+<`LD[RII4;ZQ0QIDG0DGCR*^,F]<_&[X$>B4H9M$&X\E#
+MO3\T;ADGC%'CO+,^*$=!S]99E*I:O`UKC/6Q[:<^!%U`_/AO)N^0MAV&O-.A
+MLBWKYKOCN$/B;1I"UJ=%Y3X^HD41]?1)ZK$2[]5D3N)%358E/@E7F2-(10^Q
+M#I*DZYV-,441?5X;C>O)B$BS<B+$082'4PZU1CLS_"*6H<0R&6#,GAV`"29@
+MMJA>^T,CVB/PP,CADA[93P]N-;I)VW,0F([R?'P]E+:.<J%0KES:,;MR<#[\
+M7^7:AGFTJM+S-AAE<&!R/U%^;@Z,)'7Y/6"_L?RY/&2>J?OX;HB-!_-B2_,:
+M`B8517+F29E at I&2GQ+OAZB`)TH,J]KAIKQ\6F[<Y84="Q2>),SB!^3*H7-A/
+M[-T,:K(<8M)`M;S'BC.+`-)07]\0O@*ME6, at H]@ZME7]7+7.+4^4MW78%%,X
+M`$Q)F.4DW#<!7_XLQ5-A+[^6VR at _J_Y,V1M_4WA3O>/^BZ?.SP_6+PDO%E\2
+M]ZFO\J^*)\0SXA7A<OBR>%NX+8[Q7PA?B*.)T>2_U/L)?ZL])W0D6],DG?"$
+M/0DEW!KNYPMARIJP)GWPPI>TO-4"DHE$PAW6^;#`.IV-;CTIX+H`S_!&3R;"
+M`L\Z:0IC?$&"XOTT+F<PHH'/2C0?3L+/2&<@$$Y(>J"G0<I**R5"0LK4HCL;
+M$R9%6IHA12JY')2:K1^98161HC.3"4+\*H&<N=2N,D&*9@,YDM79C^!.9W.@
+M5(:\*<'H6GH,WK;JD&F>*-NC>38.J"KXRE"NL!5?L+W[W/8_]1;PX.KR&F,G
+M^'3/RE)E?S$73QJ[NJ!NG5.8KA\1VS;.A?RQSM]@?/=H^9-9"4Z5F%FKC1]7
+M*@=Z[+)"^"*N[C0X.=O8OZF3429U_ at I\+PXKYSO7AK:$7 at H="AT/#8>LT_3B
+M)GLM%/`33L+O)1UT\)0WS4&&<306;`@N"A)!!)A at 4@P!)O!34HX,<``Y'_0[
+MI.!F,WW=W":I)H*6!M/.3#?#"^6!0#S0T at U<OUO>NN;!V]/FI5J_]?2$%HU;
+M"'SY&>.74YYEO0=K4:`JK[LK04!M=JL0L@>$A+W#WBTL%IX1KMKLC(VQVQO=
+M/"\P-EO"+8IAD6<(C')0?)T=EH3)`<++^X5P3+'XZ+P at A7U:G>;R:UQ,B]":
+MHA'P!\*"A8OP7()U(2V)BY'&:MUQ=;)NL\. at 0(^-L6/0^<?&.C/<90[R)5`E
+M3*[V!0O%ZB0<<2R0*32:<$K8(\C8P./"`F3@,L<<*;![0?<N<`C<!B/@E4WS
+MYFV"@;RS<E^H5)H:-AH1Q;'L&)'?6+"J#_Y-VE2ZL+ZF*H at IKSS81*Z8N/&;
+M%JE.07-.)_2TG9;O8W:,QP3L>+[UHONJ]RI'_-%]VWN;(ZXY1]@1_[4@><=Y
+MB[WEOQ,D"S2=%NH)/!VP"0)O&5SI`1Z8*]\[;'_=CML'>61>8AB95^FKTOA4
+MZ#;-J1GC0HI/=:@N!03M[1CAM\`TZ80[BH4[C(.1DO3"A:FCVX'53;>;?@4F
+M1?A%4((@E3!W2S-R+#F*NW#H30T!OXNEK!+R*@`4X\PP`,;$VZ<?WKM^#GB!
+M[]PG-]\WOC3^^OZ'^!&PVK@&4J`?+`1)XYIQ%BRX./SNB'':>&?DK0N7P$S\
+M`F9Z/=1<LFAF[3 at VDE]PD;LJX.^&KH1Q=YX1==K=5\_')[-V5.+5E.R.BG$/
+M04EI,<WT4SV4&B#,`!Y7:><@RV?Y13S!HV9)6*.U!)[0IIIEW-1C%L7$K1EH
+MY^.N:EK4:[XNAL)V!X;7*4"UAYU%@(?@XA"8(H9Q1'':V5_$>@=WY&VV"/44
+M1E,-$F!S;$Y'W,)J at QSL-9C/9X#I7`Z'/E*.JG*5;,368TOVS`FW1]F7GSPX
+M\<:667,WX`(@@=>X?E=Z)M2SLW*!/-BMAO3*/RRXUGMYXMOVGMW$MF?GV]2K
+MQ_]PEC!^OCF'`A..%1^.$N.06VU8.\CD59>\@]EIWV??5_?WV*A"]=/+F**"
+MVQE*V<OL=?Q4N</<5*@V%)T<,U[(+VM:UX0W'6U,\^@FPKV07^Q_VH_[CZH>
+M37$P)!E)MWL(,IVVY5OY&:?!NGP]QK<Y6$:):CS5'N(Y>#<L\"*_%,:QEGQ]
+M.\]F]7_J#W5"[VA;&CT-=KV'L5D69SMF9CZ^61H:_SS(WBQ!S`>&QH/W@]SX
+M_?&,&=JA>K'PP-6F1]C:7.=8"66NJ4UYD_E(K0TIBSOFC!8Q6X(J`DL*+ at UN
+M>)3KE2(64YP..LD404*S,=9&LHA)KD at 18##/HC>J/M1D/O/X`RBAS6B%P@)@
+M1IO1VM;2/)G98*J%+PG%(`+ at UWQ>*WJ]J)62"?"3UN[GAU<?6)`Y?&IA9LGU
+MD]TC3C5,)U--S9_^8'`HFUW[VQ-=\[\\]]2-^EB(3'6"4?#:ON\<V+5Q35]F
+MQ?KFEE5;?G&]*R893XR\]KVE"V=V_)?N<H]MZKKC^#G'C_ORV[Z^U_?Z&?M>
+MO]]Q8@<[<5X$2*D8Y5G($&.C"]4$H2@!*AB;!AE-BZ at 86XNZ16@\"E.5#J+A
+MCG:J*HJJ@:JU:U'%D"9U+.K6Y8]506L'=G;N=7ATVFSYG'N/KBWY]_T]/M_.
+M[=]=NV[WR4^6)%QP6G.]V6_=N#9JN#8X<+S:J7]/(Z(I.(5P;4TBM`EN0L@'
+M?0A9EXG&9`L9$`W)H/T]IX at XNQ7H(4E:C7I["@)D-)`N7`\7T""L0;)J(LBH
+MS6?=9)VT3EFU5GQT`0QR;R`*\&ELJ89PG<S-S:AEHN"9Z at F4$@&WRJHIP+UA
+M:,BB^`&[Z@/B\)'FJ48GHCW(9$/;+^S$-/.K'U9WGG_6E],--DZ=VG+W,P5E
+M)+KGH!9\Z[22NV[<%W^ISA09O%C=N%I8)0YYUGM?8E[RGA8O>_[MHR1"8MJ(
+M-J:?Z&?6",/BL&?8>\YSSFO`,Q-$6KBM&,]:3%L5,`L$1"D2#'`FK5:6[#:`
+MJ)2;DF4_;S(F>$X9)!&M+NH/*#TA$O[:(%GHG_C59%&%)^`0;,X&)45P*3\Z
+M2YMM<.$(;1Y=G%CYU[MK,BMVP)MC2[MW-UYO3._N[M^%\.R7R:Z1^LC))T^]
+M^LTKB#V[FI%EX_J3]<\_&OO3)[M^AP[LZ*)D56]J_C-B%XY%$;Y1_5F&@A9@
+M at 0Z7'_AAA&['M5VDB[GUA:=<P^*8:[=X'!R'D^9)RVEP&IXQ3IE?LYR1SLC3
+M8!I>-E^V7)(NR5>EJW*+^LM68-,2+D)`1`9F,MDD'4\DDS&:IM+X+I5B\JV%
+M0 at Z*8)2TB=:W7+(HG8V914N$"8JA4;%=+$8*U80D)$"N-C]VD<IE_7BOKA)2
+M27\FZ\TF;!1%QY+)A$T01":5BN+=5<CEHOB<+.2RI+:8225=#*VGQ)@D%#(Q
+M4<!W%$GGBE((3QB4RZ:25`?'"5(-+I[V`P$*E^$2<`!0\)TJ[0?%`T54=)4Z
+M:O#3BX$=&_EX_/&Y(<&UO"[P=;S7^<?[O],W\\!;J,"MY&T)[[B3C"]/Q4W[
+M+._JQE/\_[B(XXMX'.#GE>\(O.4.P(;O_RR$Q50N$Q at E3&6RK-Z,-[%B1!F:
+M4'5TN""@/8S;R7V+AP\HJ,+H at S-"0VB"80T,,A#A,SA?$5(,`R,W-XMM_FX4
+M6NY)D188@<!)ZMJ\9?C3=D^K<'/UL[XGYAKO^HZ]_KW53^+<0I0UZ9"]]QJH
+MYU]]G`G*,J2M!9L8JP-T:5%*L)2<1H0MC]4S4)_\O/'\+!J]]W-X'OX91L9U
+M<K//L-A3G,1Y5X&&ZNE2J)A#A\R'[`>E"7DB/9&9R!)ZG=Z$[$3.J6'UK)WS
+M<%Z7[,HZ\^%05(YF2W(Q9]5H/0X/RR*'(`FR;-<*NIR0S>HE3\Z3SX<8CU]#
+MBM0B3/M`K.0DAU8;4U>J8I?EJ`T_&<KG$S:$V'Q6#K%V/2)C#ZXJ/B]-H4HY
+M'B-C0E?%U=E5@\[[:7#;\E!V572LM at G+C24=-V%M\0X4#(3XPP,+1D/E at YFP
+M'"^/X]6TL*OKOBO*@2)F$Q+;H28%'VB(H5#\;Q&_YBD8>/\Y-L`^L>;[L/J7
+M8V-;T+;U8M1!VS[^6][&),0!.+,R.3#<^",\W+7J&_63:_LW?O!%@0VT^I8U
+M0A*U^!7X'%SZ\;!6EC64,>$..X3&=2A4)*<M:::POH@/_Z!QI'Y]0]8 at 19`@
+M^7\"\XWW>WU9/F%C=(J/36(]?X'UC(`H.%]=&B-+9+_0']`><1Z1$$F0%)6P
+M<3Q'$D34%@H%0_B$TX6#_$"0#_G"T&+7A,6H%2"?6_20'&4C>2(4C$3COT4T
+ML,&OJM1`U!/AH]Y(\$WX%1@`$3P[8NFYT3E^MCY;&JWS,\N5B8[G.5Y`5UW1
+M1K5O)6S?1J_PBAPJCFL?4CEV;Y"5%PI%">;#$#\Z7Z`J!]JV9(F!A7A at VYBT
+MNP^^W9E];%/C@^6'ZD<F>AMS$SM6H)I2&T+<&/8W2O!]CTPE3$KP-"V%HXU<
+M8V1L$2%)9.\A^&UX^-HS6J40-&!P_I^:PYIIS.A5T(UK8>O?Y;LR(L*+]<@0
+M/$&?*)VCSS&O&M^D?D]=2U_+W*)N96YF_T'-9LQKR40VQKE]#A_(F\W0O#27
+M:BME$V8:Z!VD(R\1J<XVANRL,-U$=REL8=+=L6IV3S0=FXJA6`V!*MW+A\6^
+MEAYM7[6&X*][>Q2PGZO?QL1:GL&!JY=OXP&%)Q1^*^%3\76(G[VN!%5I6BH7
+M+>KL"D8,'"209)3ULDV&)OS7B$ZM%[`AS at N<G%VV>&$XHC$`&4)@,NNZ2"^P
+MAAW>!W@$542Z;P04T!V"(T/W$UM!I5![FZ3H$VQ1&QN+9R'F(A6<,"0UIV5;
+MNR(=/@XWMP)$@\\,'BV',SU[&N#%C=#N:'DZGTK1$NM)9EX[^TZ_1!JCG%?R
+M2\6.OHKFL;8-*]?LA_M03$ZM']D0=R\K/;VY_-3JK9%>04P;2F31:5P46OSR
+M_OX?-;9W.,,FL37LDM=5>OQM>X;0;--;$/.SFK=TNP"/Z>*%:NR.`>H-\(01
+M!DEXDUT!W/!H4"\1P8"H9QD-"'0RA+C%RGC[3#6$JG18"NO3CK=9R-;@?--W
+M8C;"BLP"50<EP1>"#^[,WH-W5`EXM]]@\1N\,G1;\.(S!F3H,8LXP53KL!!.
+M.T[F/(X5;B:8-ED'4$*$62((FC#:=!#$SM\02&C=N/O8'QI?W-I^P]\!J>=:
+MGQ_?_\+`C[5?M at A5O;X^F8D/?GGUH\:'ZQ+:0$?V[N;DA\>/U]?V-E`S!FD<
+M at T'-%&@!07"NNG2".T5>L=ZPWN`_M<YXB0*#F8K91FVCA]EAYUYJ#[V7W>MD
+M(B3'$[2%XQ''VPG:J#/FL=C'L`/M=C-!U!/T\3A$%R5+GT_)5BFD9.M_F*[^
+M("?J.[K?W<WOO61WDTURN4VRFTUVDTLNV?RX_+KDDKMP<"=0.)`?QWAX_!)!
+M07X,IZ"H,"/:TG'.:QFM5D1M&0LREM8J6!5JF5K:<U"D,Q74CM8ZCIUSF"G0
+MH5Q"O[N;PYO9V[W=S3^?M^]]WGOD-;J at D'1RN%*J3U"*_%5P($;D616;-B]O
+MIA%`>TD1L?+P9*9\=A&Q<2VB0C]`JH13.U0S;*N17,W@:@++N9ILRB!I`=WU
+MN[@L=!)$"\=GMSU_["=W#\:+;*&R\X6?7P;Z/\>PU_;,YPMR7.YT,N__\NG+
+MLZ0EU`.S]UW[^!QHU[!)0FPF=:-P7Q:12]5-SX1_%?YK^&SLG[$K,3VR*?Y0
+M?'_\N?C1Z*OQMZ*_CW\0G8C_*?]I]%+\;WDK%IT7006CY2*^T,Q:QB@?YUKH
+M97WC?"HI)W`7'I!2"<&%Z3)%G.Z at 0";=82AV2Q)O">`)6JJZ``RCR!NEW*R#
+M[:!=@;#4I=`+8CA\I5Y"E((ZS3!704TEK@)"JBQK7C2R=1;"L<Y83D0*87C*
+M1C,BR$>*,\BV56$;`@V)4CEEZ%1,#>)H@"$6<S2%:H,[5046[<S0:5H-NDW0
+MT7 at Y'&I+$[1_4<>*`!G2HP!%N3Z+TZ+?_[PA'QD8.?)Q_<WM(_M['_[Q at 9]B
+MQSDF!+K+<13C&<)#Z*SHAL+.KJES/1F`\JC<97JP[.D`AF.?@-S4*W=$P+&]
+M]_SCY1>GX.X-W_P&6XD=0>RP]7B13ZK#&XP;B?OH>YD'#3N-NXC=U"/T;L=N
+M9LIZS=:RQ'B7<80Z@[]/7\"_-GUI,Y:-)K/+C9G,J,F,Z6%QQ``V!].S[!JO
+MW3"N?TF/ZGM:+%XW#$E>\IP9F!7V^K%+I`*]WZ>Q=Y at NP":J\7>RN5_KTPJ'
+M1Y/$[=8V1,?`D.. at U8W:AKA]H-6MLV(BXJ18^#^`)]RF5[\"_`S3^U25OL)L
+MW@<4W&%8:R*NF!RO$#V'KKY0?\S\[MX-8V4A\L7+;W_PW:E72YP5'+:T);=W
+M8$?^^-MO+FQ>1SSR=\">/`N"`^NRB]8FEP_`#!>&!D9"+HO(_=5<S at R,IE9S
+M!((A8A6$%3\/\A4V]+F`\3K1[G13!]QI"_#K"CZO0:\70V;,QX5!&!:DJLGJ
+MY1.&!`3P)+B)2`FU#TY<'2Z0:B.$1EZJ3$Y2VNZ#X[G),VXE+ZEQ"?:_SG2F
+MN=,T_<:!8A->D&8$S<;#&VM'CT8775J^7PYXV[V450S,:[/=N%[>4_\WJ^N[
+M#]U;.[CIH]E=?$:(>1COW'#/9*W^\-:*B86:Q9%LHQ=[#^XS.]*/+$66(1]6
+M5PWT]M?V]_ZP=J1-IPOK<J::IU:H;<3NS1]V'':;>NQDO#\6]>!.,="&BO/(
+MGI0)WF.1I:9!V%#0I>E^?V1!Y%0$B\Q9D%[FX5H-:'?!NFR9Z)PW."8>$E%1
+M,6AB2)?.<D/Q<I_DM)\`YZO6TLG%LTBG[!QS'G+B3L4CAI8G)NK#DY!,\)BX
+M4(><FIQNEA,0N=%/AT<51B7J30O7A*W^%10+5V"D-0>`\0=&'7 at H)DMK[JJ\
+MZ0*,X'1I\$H!S9,YY1[7/+@"NX1RS:DY==JCT]C9=W8=_O#VS%.A10'G:C>1
+MD*5U;QT9^/4 at L\1.'*/-U#N'6GN\=\Z.YP&XX^G&"Z__XG1Z;B\1=X7[MEX-
+ME59M71VRCZXT-OY3W7Y[#38*@*'`JJM4LZCT[,B.\WW88+N_F-EVRK3:S]G,
+MWL1S!]]^;"#8-ZN+H"E_.#2TUN&3[[_SN^%D_Z[WT+F0KS3DZ[^@-\O(&U5G
+MGQ-<=P&3R^-"/48RX9=1H<+Z3X`;U:Z`PE^9"WHJK(\3HA4VP0G3:S<B1*,1
+MP4-A>DG&2<:&2-V,04[`MA`4$JT>9<6F2"F:P#'EZZ224.>J at 9?4%0LKPZT5
+M^[V)*ZD'?@95ZF1(=+I%9Q`F?'?()?F`&HZ:6U6E>W.I=H,*<&EFKB:@6W&U
+M:>3J`WI1VINW,"VQ/:TC:"6Y_*Z7NKCDO,:"9:F>%3\8SRQIS&$M79NQT_E.
+M#`VVA(P^0_W9_D#IB?X=C;LW5LTL2Q0W at P.K'MA"->Q;\@2K>1C4/6J%.%I@
+MQAFNB@)AJQ!LB`L*'.?FR(4NUCW.<G[2AK,AXP$480VAH%E2$R=G.:"3_-QG
+MI$U1NIB`V)0@;Y4V5:G,5U.F9C7D5;C`DC+]O:P[,74XJ6DIRN#38[]2BD7+
+MY6BL].@]>9--MC"IZ&M]K!'-K6IX=-GNLOKV!F7NW`$^ZVF-X%:_M>`E#,9Z
+M:EO1J,UT\T>-*CBNSA1']E7%F)'EF(5M+#O.$RV6!"/P\498&88W6->$K5&'
+M,H@,9WI=""8<S$D40Q+J-%\K,E3$5YDD)YMII##3/WVA=AL%O[)(AFP1VH?8
+M)-H'J'8KC,0A>-)<5%W=,X='M2R2[9SAJ16@`'`K"'\QC<)':\2*LP4`3\+:
+MX5[B7]-1PF,+O[QM>SP(P>B.*C^Z_M^'!V+K0T^AX[-ZS`8_:Q8H1F^<6GML
+MU6]**3X-M8)#K=S4;47RR/GJZ.S@<FZ4V<<<9KX-_B]HP#F1$_DLE^.''$/R
+M>FZC_#/&S`<"!=H1$!B'$*@&%M-\TL$D949V)).R$.!A8A=]FH1LB`\"JT>R
+M$4QD\SG)S"3A>\PKR*B4\HY(CTJG)4PJYA0M6AS)1)ZS7#P-S4$15+&@9):O
+MOH+=A+PP?$:-*B[8\!)N1"M\2O.[,CE%:4_A<X.1]$0]9`E>54K=LHW,#"9!
+MG*F0T@#5`F@%-N""`H2"RFD/@=(PX#T^4I8[["RU8GU_S*#'`.-C.HK at Q2U/
+M_*'KY)-C at XV:0+%F4^,O:=]`@V<-J<78MW-$%&7=;6Z;SC3UYI4VCG`1&,L:
+MYA[/7CZQT^!A44!8+78"/--XL at _:LP]B'U+U]1#B0FZK<@R"U1#6Q06='$U<
+MQ(L6EABC*1S#X8]=3G.KPD&*3F"XHBBWQD%%3A"`^3.EE)LIGVPN-2V>]N%>
+MBZ-LY5L??]>`E58V_D]WU<8V<=[Q>^[%9Y_?SCX[/I\O]IWM\]GQ6^SS2^S8
+MR1$[3@))".4E"F`0@[ZP at DHFEHU-;)6VE:X?!F,J+51:0=IH5[15=&N!?9BB
+M-2I,RBJ0REX0ZS8-MDY=U`^C?!B-V7-G)PRV?7G\W%F6_/R>W__WPO.FTD;L
+MVI"WQV`0PQ6+Z]Z&:86$4P(0$4$,.>QU9!+YE\H7O#D!=0BOV=#UL?45E.ZG
+M)P*3V&`Q6>-COP#W8/A78=OCD0J\Q?$@7D;X22$<+O-1(50<Y/N%T%B9GQ!"
+M%H&8 at D<Z;J^-^8KJV&A-+1:289^+P"W#DXP].SS at R0X$`AX[.3E1Z8]%J2E-
+M2,QPZE)'DU>3Z&CR(AA1K0VU4$RO.:I>5=%1%;ZYT,`9>2Q-Z*BL3^L:/'=G
+MKLE">%8W?]45N:)%C`E:&U?GJC`[5V:VW4D=*=!L9GJU,/7H%$+N=`/M`Q+D
+M?ZEQN[.2C[Y:>2-.<E$YZ7;;1N6W"`+=?6S\R:K at 7EO<N?M,(3#X6*LZ771+
+M^]:H4J&TO97?F7.)3U?GDOF95HDCF>YIE%B;PHD0:ZU3MB-;AQN1->O"`]]8
+M>[JU:T0Q<KRQL!&\N2OU6-Q;;"$;-F$<9ZE_"["GRI^K%9;_,%X&G*;G\%ZQ
+MOV`_010DAUQ09[S<!(>>L)VU06,,B'0VH*3%09&0!GE1"&ID5(0P7^8%(02[
+M3U:[PC8K[:FDQ#,X1BI.>VS`(]M))2L*5([,1:1T#O?Q\.8N%)QR*HUAN#;,
+MA;SFCK1NC\[2<@6&%MTB[T#A=*PX at 08_T<3;YBA'62[*1F#@Y61O[($Y-F<?
+MIO<@T&[E_YCCZFT`::1D8?I-C"UV<@>);<]-;JKW[2O76YO'RNJ6_FJPH`ZW
+MUH&;O"F_';*8 at Y,<LF0#E.E[6X2,//YN*SFJ`IZGJD^`<UMFHY[\\M71#,I#
+M)#$D=__/,#.^`?V$1;S(<37QGNFV"3U!G^PZ39_K^I0BNA`7[O%LIC;11-G(
+M*EZ4="I&L]==]YH)6!7>\=GK=C,P:VW!QW6*FK.DEP78%70X$HC'*EF`/8)X
+M,'<$.$QPQY!P9T/8".C"X4)3S at CB,L!%#QEM9]&R1).#E$7<+C041/*(%MB<
+M>@9$0\7<\N7W`/[9E?G673!3WG/FZ(%#IXY+Z$N`:7WVN\NM&X"[#KZ?V_;'
+MMUJ+[[_V8Y"M:!PRZ1GY/&*!+%I09PJF at GC">U)Z0_JA?$O^5#92$B&OE;"S
+M83`<!D$C7;/RRHUPJL9G/PRQ at D,/#3Z+F<*(%)V**<F`PT(1J-]G'`B1/A+=
+M'3,K61M1A[D85:F\'Y+(,4\#6J-1/J?!HZ>L)4WY-._5";2:=E=GN=U at PU&,
+MQ*)$!)!AN.`R&D$,DC$". at 56:Z^SS7`[$[?#%'C8,%;)U:4#"'-SAU"[GFSL
+M._GJWK5?:?URAR(I9L:YDU@@B*'LUITO7/[D[;Z86AAZIN4X6/OM_,5WMB5:
+MIN5SAOH8-C\>A^TU`.HFPY$AH>_CQ2NMG]O<?:U+CZ>,H7;FRD!\/X(=A(;I
+M]9JZF8IS\6(<>S'QH]2EU&+J]^A'J;L)<B(!^HQ2C1<_#/KT`<6,DI7UN#"?
+MP=/KDWK$B,N(X;27I91>DB7I at 1ZS*-@,LI3F5!_PZ>'56G\U"9(:[?3PJM%.
+MP_:_@'4H8*51='"-QM,DXX1`VN/6"&).P\7D,/@!X[(EZ`AB25$0<8;R:RP$
+M>CV-KP3;<.$_YE?K#DZHIA!H/W!WG%>?7D,G["`*BFP(];K8Y.'O'/GVU[;E
+M0B//F*!Z,MT;6_S,=$/9M/?P50!^_33-<-$B.+L^,?7Q2^=O8'7&$AW"`8Z;
+M[ZEY3C;R(BCO`8>'_9F__>E]D-8\S at 3!/@]QCB'/J^,+?E`, at D`,:*H7 at _95
+MT^S++."#,,<<IX,!/Q8/AX/0C&.N;D9XMAL(W;W=:/>+W;3L(:%9/<L!+L[(
+MX78=^-F;D&`]Z<6F;D<+30W3B5N+2[--IU;&/(^0%:PXSD.IOT,_W7C:X;`3
+M]XMNT;2](F4HT5GZLB>;)S'U2ZJB9J3(1%?HB:EFBQ&-F2GP[N[-!"ZZ>DP,
+M2]$_F-E33<7Z&K.55G5+#17;7'OJ_A+Z*SC+&20+,%5D$`9TH3%KR?J49:_U
+MD/F0Y7D+%3/V\IEK4/[@;RZ"[_X4[J$3BZH]V,/RWFNJCQ>Y`#R]]AU\=&O?
+MQ46G%:&,\!];*9P(*%DG22@]YJR=`Y]P]SF4:QC79)%>&<BYX$7P3Y5&Y`/V
+MT_9Y.V9O(#F04R!T<Q^PS5M+,/M!+9Q;:,ZR'4%T//#M*O</EKMSNPG@;@GN
+MEO17''OG-J"YZA+<M.63C\8$D=9(%3/Z@>`(^A$R2O at 1D0[X`=(1`\U<&*7+
+MTU&#-$@!+6QGM>>BPH0B'<H&P(/;($/@\Z)';AQ9-YT=//#5 at Z</Y;]N=-(&
+ME at RX@@-?;$R]\,WKYX]67K99G`0')-#_A>J!C4,]DY(Z]-RV`\>BE+GU]UV%
+M/5O*VT='#IZ:.Q%U6+!+D)M>>"_]^!D8K:;5'I,#^(*H"RWY at P;5+%(CY(#=
+MK%*B.:SZ122(IET^5G4D7+"6+M[DKG`WJPLLO;RP"+?T;^""#"[/?<"Q5[C!
+MQ>4*1`XF8T at V=PASZ6<M>D@;T*0M[PCI1X8LU(F'FA91*]L(YX-<5^Y at 8:['
+MLY\@3.QP==9*8*=&E^?'Y>&@U.5OE/>6'D=W8`:",KM*(R_CUKL:MYSWE[#K
+MT!?C2`)Y79U<1ZX+;"6W!O:3^P.'R%?(5P*F@#5 at 0[N-5)FW":%(F8\+(1=L
+ME0SO.N;EO9%NFC(1<1MB@#XY()H3)"]3:7LB(=%V&@K8VRD$I*6(Y at NII!8O
+M8-Z[JYTO36LBIFE8I0)EJ_20)3B#813'(G at 0YN]0&`U!%K0E"KH![`MZ_-<+
+MF$-O"/JTV0`,$L%(%>BJI`$%Y4O.2Z#*2+OK:Z1(92NH9=;_F_=JBXWC*L/G
+MS,S.;6^SLSL[>YG9RZQWU^N=O=KKV5UOVHUKU:Y+TC1NL0,U)4!QBDA:)^"T
+MB`>K0CBJJJKJ0Y*^5!C1/M"7JDI-*E4E`M>@!*$(1`B5"RJ*($`%4B4N5;T[
+M_&<OJ"!%@1?.:,[YYIQ_SNY\WSG_^7]K8E]DR4'-U!]\>/'`02,XA_]"O]A9
+MG\E]HA`VJ9$#94>RTYX9IS6O-R`8`KMY?[9UQ[[G*.Y0U,=I+N*3TL#957H3
+MI=!+[<]DG5G%<EK*$K\H+?H6U2/ZD=@Q?D5:\:VHQ_33PNG@$[$-82-X)O8"
+M>@&K/,<+0D.&!<RK08Y;D&,Q/<8)0=X1- at S)3V/-1ZA,\YP@!"GY(M[;FE5C
+M7(K2`;X^^UP*0ZB]L[RV%U)]C7?7.J&>R]\AD1ID6\1?<0Y(K/C6H"$)%@9N
+MP(FK47)L]D at A.16'R8*"7"I#>O#%B;S at O'K!K::#&:Q5\KGN;WA1$#U\]Z?I
+ML7"9WHRS`4/2M<Y'^')RSI_U"70\SC16.F6_1_51NT<2,ALG_ at JC,?M]Q[/`
+M3Q/S[6]FN$RYH32BC6338`6.]_!>/B"40T;..!W8"`A9"I)+QJ(LVF+8:BU2
+M+C?D0CFJ1;5:)*"`I#P/>2Q![()<C=;`HE!8D`TC:13*M6H4#`))37&'?.G1
+M.O(X?%HS*['QD+,5X"E%*DL8]>*23ML]J[#P`M.(E'N.D/0D&KB1T8P"E<PD
+MH>?UV40&9Z9*.ZM`,"'S76EW>:VSVL=K>\M]=(V<%*U_([S%2=O;>6F;(ZQO
+M0W(+"2Y!P/\J6;$?5P#H'A\*D,G2_08<65\7A1RP46R!6:^+OMAJNIU;K[FT
+MHMD-)_3N)89E7=1ONQ]2G,-%=7]1293PR6(E%TJ?O$#E`X'Q(MZDG^(B6:40
+MZZ;Q:]JGU72$U75'9G;O3P+/,E2I\W,'!^U[3^8Y$#&<TU?W+W=OX*=<@>/Y
+M0HH9Z`BA#OB&<V@*2^TW?L]A!C$8*2B(<U2)*NN32\DE8RFU%MQ at -AQ;VI;^
+M-ON[K'PW-^>=DV959K)FI6HBSXHU5N5%L194E!P+G\:J.64T9Z6 at AGO2JHE6
+M2FG(8JXAU\#L+/L2N\5>8QFU)*=8N*V49=5R*5416;[:Q%Z9;FJ2;XI&K%ZJ
+MTA%-*U?HJ&BQHL),^7SW3!';*1\;K9`0:E^E5=K9W5DF.I762CWUT)UJ:T]M
+M]6O242QRCKR47X86&J)=3SYIF^<`<D34@:)2:ZCG4"B2?4X,=I07XQ at FL9$U
+MV&>@']<7OA<P67Z:*(K?R=1J6GY*KXQE\/3X4O05S(_/%KN?U]5X1A[QW:5N
+MZI[X1/?ZY$3^#Y>:YCQ]3L/^F'^I>-?]Q?E at 1*8UC2EE_]Y]_&"1TC2*"LG^
+M_0DK^EGCHT),]+LX37,:=^`%G%I,<!KX>*W;IJ^`CR]!K/KM]HE/A3$GJJ'1
+ML9PY+\Q$Y\U/1H^99\0SYGGS#?.7IF?.Q-F\:.9A]SN=#3D$X:D at +,BFF3<%
+M9R@,8WPI3<D*7=+\B#72,YJGS)6'8V4A at -8#.%"-K\,2(C'KM>5M::``N*G.
+M]IW_N7&(GP*VAWO%GU18D@#]:[N4\,<=UO"XEPGO9->D-?QR-504W7]\DW:/
+M:''LS^6\W;</GSU5_]Q4(;(2K'^=9;J7C/$JWJ7/Q3'OSGATO?,AY>3K8B1$
+M4?&XHYC;>^OZ#^K[1L<A`3&%B$A=F"]Q)=0KDW#]&;^*_T'=33U#;5$WZ&DF
+MPUQVN!PWV1>Y*O<F_P7^`^%;8E%<=RXYWW(]Y+KI?MJSYKGI/2%]U_>\7/0'
+M_><#F<#[RC-!%+RAGE$_"'TM7`]_(_)X-!)]7IO6_J8_$9N)O1QOQZ\F+B3/
+M&W74C_QPKPU`_ at H(1^!FT6T+>8FB$6(<"+&(XTD,38KH=/6!V^.5?+(_`%M9
+M#:$P3!O5=!2+)P83)(W42#J3'<V-Y<U"L52N5,<G:I-6O7'[W_Z_%`:M0ZU!
+M[D5#?IM`:<@.3%C=%=1$]Z`#Z!!Z$!U!3]HV6"70"!J%T2*,UM%^="^Z#RV@
+M1734MNWW[%_;N_8[]J_LZ_;/[)_85^S+]H_M']F7!KS?NM"W_8\\^N)@%AK)
+M"`TP`U@>8!;0"%&6$:`G!&NLCRGD00<'F`:+AP:8`;P^P"S@[^P_='#FONG\
+M`X\>?^14X?!CQX^>^&]Z@(-#,/\,\#`-4=\#Z%%T'#V"3J'#4*^@KZ(OHZ/H
+MY"VM"F#W&."CZ-8S_:\V?7:::!6^\2PB#$AP51#B;K+?ASX\U.-LY,KW'O:V
+M_HI]?._YAY5[OS1L[:>[;>XKCJOP*`SM_RG``-C7P^\-#65N9'-T<F5A;0UE
+M;F1O8FH--#$@,"!O8FH\/"]3=&5M5B`X-"]&;VYT3F%M92]!4$Y$3T(K5&EM
+M97,M4F]M86XO1F]N=$9I;&4R(#0P(#`@4B]&;&%G<R`S-"]$97-C96YT("TR
+M-3`O1F]N=$)";WA;+3$V."`M,C$X(#$P,#`@.#DX72]!<V-E;G0 at -S4P+T-A
+M<$AE:6=H="`V-C(O6$AE:6=H="`T-3`O5'EP92]&;VYT1&5S8W)I<'1O<B])
+M=&%L:6-!;F=L92`P+U-T96U((#@T/CX-96YD;V)J#30R(#`@;V)J/#PO3&5N
+M9W1H(#@T,C(O1FEL=&5R+T9L871E1&5C;V1E+TQE;F=T:#$@,3$Y,C@^/G-T
+M<F5A;0T*2(F\5WMP5-4=_LZY]V83"6$1"2$/N-M+(B:[!&@@X>F2[";8@(9'
+M["[RV,W+$(@$S:0\"I,1*';!C+8B5EJMM$,1B=Q06C>C=%)E2D'Q at 8[C,"HX
+M1LL`\36(6LG>?G<34G`Z#G\XO2=GS_D]SN]\O^]WSMT-!(!DM$*!M[HQW#3Q
+MC/Y+(._G@%A9W=*LOY6P]N_T>`70BNN:[FX\OOJ6=4""D[WY[I5KZRH.!]8`
+M-P6`U,OUM>&:\VM/[P;&A;AF<CT5@[N=CW*#S93'U#<VKRD[*HY1WDMYSLI5
+MU>'\ADF7N-]"RF,;PVN:$L.)+W"]E[)^3[BQ=L>.SS\#/(G$4]BTZKYFZR(M
+M<)^U[4WWUC;YOOAH">-1ZZC2FHFR".E:)88IC4@'K%/L]+4^CRVR8EH!/+%]
+MU@=*)E?_OK_W/2[LPR-X$6NP@?/[$<58Y**4K.S%7`31+;P8#XE=V$J_2TA#
+M&5:(,]SC&=3C5?IEPX^=2*6^!BU<GX,2^OX%[Z(0=V$M.G`,;S.V&_-1B2.R
+MW3J)"7@,KXOG5,5ZB)'&83(:L1EMUGYX,(.16O$+88C[K!XL86LDKH>Q&V]9
+M)YF7`S?$,4ZGYSSNU"&2Q"CA%5N0@!0XB6<\*KC3G5QQ2"3*,NM>KAJ&`G at Q
+M"[,1(.[UV(['B>PEG!)+9;/2;OFLP]9K=JVX/H<HIN`GN`/WHID[[,1?T8EO
+MQ)TRQ1IC/65U6D>M3^DKH2$+H[EF!LH9=PGN1AOC1IGQ.SC%UHV/1;*8)F:)
+M"K%%/":.BC>E7_$H6Y6#JE,;;7V-3#)S,[/))>I"3"/NQ5B&,'=^$']$.S&>
+MPR61)L:(`N$33\DL>8NLDZOD$?FIJJC;U&[K7!R)9"4<9'(2D<_$'+9*\O8S
+M1(CH(?R:M7N4R/:B"R^S,J?1 at V]P66C"(1+%6)'/Z+<1WSOB?9DB4Z4AB^5I
+M)4^9J:Q2WU"[-7^L+?:%%;""UFKK>6;_/O>R,[=YN at M+B;B&N;>PVAM9.[MM
+M8GL`3V(/GN8).X"_<>=_<N]7<1+O<?_SN$`,/;B(KW$9O421+)QLPT4F6[;P
+MD+69K&J%F"=:Q$;1*C:)S:*-&'\G#HGGQ7$R628#<HG<(!^0+\@WY)OR77E6
+M7I!?*4E*EN(BQ\?4,G61NE]+T99IZ[56[4#"Y-Z+L<+83V-+8RVQ$Y;#2K%R
+MK19K at _6$%655/XLSF8 at A&`&#%<EC5>?@=K8*GK0EJ$(UZK""M5E#-G>2SUW,
+M\&GL9YV>XUDZSNS>8-7?P\?,["M\BU[$!(1*GD?R/.>*B<RHC!DM%)4B(!:+
+MI6*9J!/U8K58)]8SQVUL;>)A9OF4."`ZQ$OBG+ at H+K&\FDR60Z4NW:Q,F:QD
+M"_,<-,KU<JO\E=PA'Y=/RCWR3]*4A^3+9.,3&5,&*2E*ME+(YE?F*+<K866U
+MTJ;\0=FC/*.\HKRN]"B7E5ZE5RU0IZAWJ.O51]07U5-LGVE#M7RM2*O4:K05
+MVCU:1-NAM6L'M?>T;Q,F)Y at .PS'?<;_C`<=.1SN>P#_P&]ZTJY_#&([K?7;A
+M67E"^G$&Y\G`)EG$NS-!/(L*=1&.\.V3*?\M'Q7'>;+*42T.()7O.JF5(XL]
+M3=G)>PWK0_8>]G.Q8KX':8L=MMY61C%Z at _6VULH:1GCC;^2-.(&S:I*XG>^/
+M94H!SV\-WRSCX[</WHD3QN>/\[CS<F\9>W-.]ACC1RY]]*BLS(STD6DC4H??
+M-.S&H<XA*8.3!]V0E.A(T%1%"KC]1FE(-W-"IIICS)[ML64C3$7X*D7(U*DJ
+MO=;'U$-Q-_U:3R\]Z[[CZ>WS]`YX"J<^'=,];MUOZ.8)GZ%'Q:)Y`<X?]!E!
+MW>R)S^?&YVI.7!A,P>7B"MV?5N_331'2_69I2WW$'_(Q7N>,]D_.W^!QHW-H
+MZHSV079D$R7A#?5I'&P/OYEN^/SF2,,7MRG9_G"-63$OX/=EN%Q!C]L4)=5&
+ME0FCV!R2U[\\'METE)@))0RM+[<3P#:]P]T5V1YUHBJ4EUQCU(07!TPE'+2W
+M&)IGCC!\YHAUW6G_%:_,_-O[C1_1:,KLTG!MI)34;)O=)X9L*;R=4OD"G3'E
+MEF#`%%L86+?AVM#[DJ at U_+8FU*";24:Q41]I")'S](B)^6M=!]/3O9T6O]S\
+M>F1AP'"9MV88P;`OL^,F1.:O_?-(KS[R6HO'W9FV<9J+E'5Z9GEFV>,T5]K&
+MOO%?F_KT)[L&Q?V.G.%8/G^`-6$#,6YC%J9>K1-`P&`J1?9';1$BU45TXQ,4
+M)&&YF502BCBGVIQJV4Y#CWP)EM'HN7"M)MRO2<AV?@E[:A=[X,#0?F5NYN69
+MN;FL.>M3RS(1VLRX8I+'W6)F&$U.W<P at 5:@@C^'@U'SR[G+9)=L6]:**@MDZ
+M+]`GZZC*.`AO?E[0E"';TG7%,KS2MK1>L0PL#QD\C8=@_P0;;B;F#/P-<:8.
+M\]=/-47J]YAKX_8H)KK+HTBJ"'0(T1:,"FM+%+ZL3B1!6;:4YA_;QWVYC_E3
+M*'!3D>OB;));+R7OI60[J$?TR&TU$;U4K^>!5K/C(PVUD6`^4U\06,[/A0&7
+MZ0UF#$QK@\&IC#/9CJ/&XT2"C-#0'Z$A'H$!>NE4Z"YGD7,J`O,"9JLOP_3Z
+M at BPJ[T<7:>WB.0@&Z54T@)3CAN5I_9BG$'-1+B=3^Z(L8`R&"$8B?1)/85<D
+MDA&Q+WJ?'!7XKL+;KX at B'H!W(2I:*^*F5L.582L,E^$BK*"/6TWC_;ER0*.8
+M_OT,S[B:X9E$.R/.\*T_$,/>ZV%XUG4Q7/R_&2XAYF*;8=__CV'_50S;)SP!
+M,?L?D0]Z=_?N3DQ/A,R^YOMQF/JAU2/M'R;[L$\[:O6H_+93@='L8Y4',8WC
+M*(Y>.27VFG84(RAGLT]F]RA9*&!WR2F82[F2%<WCO<E[0?Y6)/,']&BYXV#%
+M?UBO^MBFKBM^[_7S>[:3YSP[\0<.SGTF<>S8(5_^(FX2O]AQ0D+3>9!1`DM+
+M02MIRPI-M?#1P&A+`DU89ZU=)W7--JFCZF#I at F'H1=#"MFR--$(WJ>O^V1BJ
+M4JFKYDV:H)H&"3OOVA5LVOZH-%OG_,Z]YW?/O>_<^^Z[MY6JY&4E")CELP*9
+M[IWI)3,C,U-D>F1ZBLS0F3B9IM-Q,B//9,BT/)TA*LF>C8>I3253N1Y:H9))
+M@'*5O`!@5<EQ`(M*C@%(*ID`*%/).(!9)4<!1)4\#U"JDN<`2E3R+(!))4<`
+MC"KY.H!!)8<!!)4<`N!5,@:@5\DS`)Q*#@+H5'(```:S'P"K9!\`4LFH4@:(
+M,49&K!WF#$IG!6G'3Z*]2,2/,[V-Z4U,5S`M,<V=VRONV2MVFO![<$<0\;M,
+M[V2Z7#$/BW\;%I>&Q7>'Q5\.B^_ at 8;@@B=C-M%ZIZ!<7^\79?G&R7VSK%UOZ
+MQ4"_%NKO<)$0\1+3'J:K%$>?^&F?^+L^\;=]XDR?N+-/#/>)WCY1Q;]7+./B
+M'\?%'XV+M>-B];CH'H?:M\Z5;2A#Q at MP+MH``7Z3R]33B_ at 72(:GI/AG.?D"
+M[5R%+Z,XIY7?*>(<+!(-SZ,4]@+^!`TP/(U\!JU^>RX3H2I^*)=I!_AR+K,5
+M8&LN\Q#`8"ZS`[IX$&58DX&<O$0[+7 at CDEG(!XI=]*,IHN']@*<!U^?H+FC=
+ME4OMH)U&W(E2C-8!/6\&7*T-O%/$MF(82W&$9A#-+YZCBS0?5_'F'/T$XGAS
+M]*,!E<,Y^B>?2DXK)?2:;XE>R;Q$?YU1"53_?`"J<_22#YJ<IV_1[]$W?:SF
+MI(\%F2[07I-5`\`K!?:W_2SDRWX5OWJ>?LNW2`]K74+T0Q#@H'^1/IEB?7^U
+M`+O\T!J\C_J7Z`[Z+-WH8^V_(#/O_0.L[][X(NWQL_C=,`1\GJ;E19KTLXX5
+MRAR)0BE6"!LME$*416N>8I6-A2=9"X]8/\#&'H1A>I4R6D-'J">UBWZ)&JDQ
+M>P$_#U>P+#ZLM`K9[PO9(T+V:2'[A)!]7,AN%K+KA>PZ(=L at 9-<(V2JAPF`U
+M2`:SH=1@,A@,O($S$'@O*M0[UQ4X^&)4P4L:\)RF.69+1-/:O at -;%,$&@OHZ
+MG602&<AQD`F0HR#/@1P!.0PR!G(09#_(*,CDG>MGM=9S9)*,G9,*YA at Y6*P\
+M2":*U at 397[3VDU%FP4M\5NL3,->'D/;AF<7?F.6/PU%D%K]8.0L'G1<'G7;[
+M:,*9L'986KN[_HO:7M3!NS_GYVX0O/>'-V0.7()E^E=(/<67F#YS7J!7!?IC
+M at 3$V;`)"EA&RC)#5"-FK0K9(<+IG7X']?_:4>W"V13/NN`<WS#9H9]8YDB#M
+MZ:XYTJ'!X)8Y=(TDTANU>G2M:Q!H6QD-=NT$T%!<`Z#A4XAJ-!C,*4;;6:#)
+MI$.C930`&MF'9$:3R3Y&6])H9T;BZ:XS\3BC<&^C$489X=Z^AS+U[Y0I1IDJ
+M4BH9Q><#2LJG4<ZL\0'AC&\-<]?<=0\4W`T%=P-SQ^ZZ_05W3\'=`^[@__'W
+ME>3G8:<?VY2THT3"&93:<*-0.LO#S4:H_E\QGB[^P-0^U-I=E*_6KT,Z6`!)
+MQ<@)::3GTP2^40&E7*=#)EY(8[3*0'1I/3=H7)G#NQ%T=:-MN>T!T/W+;2C1
+M)BU#$51S4[7%8_&!E/-1]59<O^Z?"ZINX?8Z[71`T*D['Y.MNF.H!#E0_1PJ
+M(;MS>@&^OKMSCA+#1;(;$?($JH"B>96S\<H'^1O+*)%/+#<WH=I(.!IJ at 9LM
+M7TWNL;&:3#4VII)-MXM(7M=0D^4TZ&02+/39<^I?@^>44`#]0'ED0CY1>Z%6
+M5R/75O>(/?(6YY95C^%AY_"J,;Q?/R&6!KH#-HL[X+:O=KOM-I.1XR6_T622
+MK3:;G?=75;F)Y*^K"QATF;W>ZU[BK;<%_7:IS$9MQ&8+FNJ#C5?8?`P%VX+2
+M92Q],)37\I37Y)BY(7A(F@]:K(Y6)Y+R6+I<T*.-SN8F/(2&:LJCD3"I7L,+
+MV(QM%?:0/AJ+QLH[<"1<ZXMX6NP.^-LD@:O#NA_^=.CBS52K<>5C`Q<=6!'6
+M5P8J;Y6(7=N(Y:5K#Z?6)O,KMU>V+W_8B?=>^M4ES+L\MVU5J\UPR.0KJA[6
+M3=;=9V_Q$4_XBVT;Q[Z[<N7#?Z#"1 at KY<D"^0NA3I=XAU\HQ^2/O3:^>]^(R
+M&<MUBN>DYQ(8-,0A=TC4E[I%>A15X2H5SRL#E4K520_M;0DTNUNX0%U([W)(
+M?G]E'769*^M<@8!LY3B]U%[VGJ-'K.LIJ\25O94M(@FU&!3II`<.1>8]YF^:
+M=>8(%_;K)8X+FR+A8D:+"7U_:/1]5_M?7$Y(:\+:.MHXY,Q+^>6E8G+GY['%
+MVHI`(,VMK9HX/TMRNROO="'IYM"->W(/`5WM>0 at GS0_!)#PU%&$I!U7(N<X7
+MC6BF-BFZFFC,H?-IT^&K#6*=-D<P(S8/R[U1;UK_H.Z6$M#A[-(CBND8%O9T
+M5[]:7<+?YWWJ:X?*]&O=FY9O>PK9]SB#]D at -\:PL<!Z+4QSJL-:L5!N:)DPK
+M'M-]?FMWA;C2&G%(T?)2O8>]0_3.GW57=5-(1&ET59DP<>FN;8GAQ`%NM&ZT
+M<5_7"]RQM1-=;Z9*2T/F<&G$%7*%79'*KKKDNN2`_*C\1M4;\EQ(#:N1A=!"
+M>"%27N*)Q61K*6<DNM*8U1J+4:LLNQS.)N)+"\I:3T.W-];<9$QUE&B%WH8>
+M%Q_O[):[_2XI*8_(1)9[3#W=_[G8\Q9M1MI=5R#/B?R-_.@?P'8YP9POSH\V
+M.PZDO0%8<BT45CV"Y`J\MMQ;(.NU#CO%L0Z<P"UVP8P%'5_T11-8JW68<?4:
+M;2^(@1-\K!"+AL at GR<;73SR3#GWGQ)&&H$/4VSG^7V27?6P3]QG'[]47W_GE
+M?/'+V8[/\<OYSK$=)^>WV(Z3LYU@$N<%PDL7(%K$^V`E!$JZ0NEH"P0ZU/*V
+M=DTG=:P;*J-3-:9N2C<HVZ`)6RI0*6PP)J0.:$%#F]:5:70)^YUM7MK)LNY^
+MEO\X/\_G^V)J6(TB&(8MX4R\GE*;](8JHZZ%7?U,DO?;M<R"EHY\M&'N]E__
+M]AQJ:[M[Y?4Y'9_]Y=BXW^S5=6G5L)90:_6ZF;%-"\;,.JU&HR.J=;)IQ]>C
+M at G>TGML8S]J9'9L_O':[M!_QWJ?H&7P+Y(4DZ/NRMQ!>&%X5_I;OB?!N[PO\
+M+M\1[DW?.$<1OIBOX$/#)B^Y'G2&:CDFJCUD46_R!B0CI+>*(7`UF9R,UPOI
+MH4#>2DA"+26F:KP1$5,JC]<;(:.1!Y(84.9^\;9BE[=;*R/^*OR?WP[\%_X<
+M'("?#L`#<-E-ZF$AUJ+,6;%4`@6\E[Q5F:?@2V"),O-H:?3P(A6N90E7HK8H
+M$VLMN!J96-2Z;M.Z'9?.?[QJX4("GAC[3E_+Z_N>D>+8VV:/1FLE$`3UX%4D
+MS%95::<UVU(K]JW]SZ7S]2%[X<;9MWH&9J[]^PTAK/A-&LQM)<@&+_2X+%L\
+M%SR(C+,PZ[(6(.`.#E*'XSK!2QAS#LJ0>J_V+$"OP,NLRVF%K554!$)D9!#9
+MANQ%<,3'AZ\`OYWZ:-B6`032(Q>!-Y229`K\>GJJY!Q3`ZQ-&014"I(22*5?
+MBMQGS/(H4W>_V>3C)9<_=.CVX&#WO at SAF)7=N&?GX?%?7D!'UT7#T7JWK5G-
+M6&?VGQG>UM]>9>YOF'?TX%_?.U%B at KOW*1;'1X!F\S`L_ZQ(M0=GU;]`304O
+MAVZB!$F9<P at 5U<;(.)E0-U%)WAT(UM4'8H%X(!%WI^K3L70\G2BX"YZ"MQ@?
+MT8^Z7J'&8F/QP]3A[.70+>PZ?BOUM_07J>FT)QBJ&6).BW9/39$SN-4(X^3R
+M8C(4=&%@64E,9<"8)I=3"+G!1V@[T]3D9-QN)P>IA3PA)B0DW]P at 4=I4J[M-
+M=-+KW;#;W4ZVMWU9W at IF_P)>^Y`TV&!1(&.2BIY+HOY_[N at S%9$/Q,OZCI;5
+M#@'C+`>;XJS`="T$50D]\"UP4I51+`O]_D+.->5?VOZTF/G>B]^&;[JJJ0TX
+MZK`;'.SPI!HY^3R&VTE'S!FWZ/C4JCZ[V:_1=+VS]K'G)B>.'UU\XT^_R<RY
+M<^6'R!L^<PP>,]A)P8@@+CU/4M.-,U[:3MGIB#-K-B62*S1LBVE)_(F#3S][
+M^<;U<H>1[WV"%@&G-9`?VB;/70MMAA#PB$:+<:5QQ#AJW,V_8CR%7<2N8Y]A
+M&AR#9;^+)-VT6T`)V>@R%>B\E?)K4S6%.N7HC$"J6I6L&E2=5?U=I5(%ZDKH
+M*GS:6``N.WT2@#MRQ9:99&VMBJV&2[>`W&&@8::B5DS_Z, at JX'KOQY7RDB??
+M/]^S9.;M=Y-:<F-O<7[#8EMH_G=?7O,#^.`_O)[L5BGF-%3#GYP[-[NP]P,+
+MX6_DO[94<A0MR>:U+^\Y?N$;OM#0K+ZB&%&ZP<S9F07H,OQQ*`J]*,=7-<!6
+M>E9P07`DB(7J&'UUM9,!S0A!](TU->88)33"3-W*D!C2JWC!K,<CT;@5_(^$
+MB[+)'Q-#=77TH'^]_Z`?]1?\0`*Q,FQ*G@>:04D"P-V9IC\J-4&`GU(W2V-0
+MW at I^N!+V],D*7!7%@EA6X"(BA`<E*S%1KHSWAU3M240J7H<N"PKN8+56:UJ:
+MX^NOZJX>2$^\5E at L".ZPR<(L2#MM[XSKCF>ZA@]WK<`^:`HXC(U:4GUHX$I^
+M^LF9+V9.]#1PT9"+X0FU9N>L+>BB_,WU;_5(BJ=9[MW"#Z&[H3ZX47XWW=O9
+MW)GI[=T4VM0\&B+P%B+OKQ'FQNE85ZP[/O=TYQ\[KW=2/3V]K=W=V<[U^=5B
+MAZ>SV)6/XCZ>UJNJ4L9N,BCVV*P&%9[*]71G57C40%MEJ\O68:/GZVG:R?"\
+M+QJ).!E)PO.YG)/)9KN#"3*5Z.OK(HE<-B)*I#'/4?P\T4=OXV&:;^/G\_OY
+M8SS.\_-(G)XO+9>>DXY*OY#^+%V3"*F;SK;L90, at 8"KJ5Z[#)1M0]A%H;E;:
+M/ZBTH-3B]0$=V`6XLN4;';BI)'VI"]A8@^(0R7(O*WM$I0*7+6*4UFT]5=5<
+M6:5%61?Q((]0E6++(*>`)2@^4':$A\X!2H#GX4EY58XE3RGE&NIV-K@"0W/V
+M#85[J@]@NFK&;C):TTYR]OY"K=F-XWM1U%J=/Y9K;LR^=@)!36SK>#H5JXV-
+M_0[%XMTK/J[:-+1LUVITM]G5Y7YJYT_Z#\D%\X+IJUH[8S)RLUG=RJ=H6T;O
+M-B$-&KJ*M?U^]9J7_HE,J`UJUO[AXOZ#BXX@$Y21$FC434O$S+(?K=M?[MK\
+MO5OH!<")#!OD-W&!:Q4%/I4TQOUK,J\*1X1QX8SP?OJ2<#YY,:W',EB+4!-O
+MCF4*K?W4PLR3W"ASP$11<76"A<T93!9JQ8+H"%)PQL500Z2'*NHC$N>`&572
+M:TCJ15EPB1UBCHM(DI/A'%RK at 9%E)P.>(YDPZPE9A$AO/DBU.98[MCM0AY=K
+MXY9RVSF,*^0<',UQ.1*FH=SL;'ADBE7*.`2 at V!H&?PE/T?C(Y,#D`%M&`X#Q
+M`(I37Z&AE,M?VC\("-LD/04]+(X-C:"$0P.11\)!J7WF\BZE,AYHQ?8>NMXC
+M4!`E*OB?F at E7@\:BRR9J?ZY"=FSNV[LA6)LAJY['2!UM:^MV]#7T%=VM./8,
+M25@<Q0WY]E at FAZSI<54[7"CB)DE"P/"9OE\M/F1P+62CW(Q+'U#KV<QRVU"H
+M-Y0V^'3P#3%"L9Y=<]<_]N-+("/B8)_'04?7 at 908E&?/PF9K.K3]QH7V$6R+
+M=H_V5<T?F-/6R\P%ZW7]3?--ZQW]73.CIM0:A-``(.W_X[WZ8]LXR_#WW6^?
+M[?/9YU\Y^WRVSS_.<1PWM1W'3M+<F..T"TG#VJ33HK24-=DR6H6L;1`;384@
+M8\WH*M9FZQC;D#IE6Z.!NDVB;#"V4:1"@RI&J:`K2*BM1"<%A%0F#928[WQV
+M\09EB#_PR7?OG5_=^9[O?=_G>0X1!!OWTUC<9>:*1Y`(DJBB_8Z`E+Z,"&'%
+ML)*(?:M],GV33N,U/JV)-X,GKVP9.C'[>8<R]M3#L]C0_!MOOS>_^/J;O_O:
+MG@]^=:J_==NUB^>QUUY]\,+RA>]\\[VSO]#Y+85F^V7TWV60`A>T02&@1 at H1
+MG(HTM12M!7[4.FH;Y>^W[E-F(G/*7.21Y#.N%YPON98\B]*?B+\13I:`SA2.
+M"P0E>'G5)O"*C:.L"H<[PPD\=1IV:S:"T"F"HLAP7)-IXC3D-'^0I!)YK]G&
+M<;&BKY5*(]/'4Y"BTFRZ]5_,A>[X5GI$V+2"2DU<J;,`HJ$;5<=7\#;XNJH2
+M at 7J=55U==;!X\AEH>+:,*Z2K7Z%!Z[D_XD*P7\8]3?+"VBL0BXO#:\)$G_"]
+MR=(79_L.__S<.W,#S8\?/=2??'3A"/YHS-T]^O?MI)E4+70L9`YKV."3VO3^
+M^=]>NS:E7?GUTMWEZ[]_V>CW+`"X at C^&$'Y:&_QI`@[9($&2-.63)"PQ)?]9
+M595$?XML"V`FMTH&G(@U9:<KC4D2ZMB`W$+;W!D3'5`EUE).4S*4^9G`(P$L
+MT*>#93#G&-35`ZCVX<IR3[T1H1W)LBI(CMK\_=CX1?.7.V,8!%1)J,%JSJ"J
+MD=.P%7YLNE;[4L^!)VD(=[DWOKTMG<FDY*#)0IB9^-&BDO2EOK7(V0-12Z1)
+M'?P!B3]FIEER[4#R\/4-:JK3R[LI^M+!@8-#1[&[LW>*@2"!AQ@^HN,4JES!
+M5M!<S()+FC0>/<(>-C\<O4R1?KLSF;)'DEWV3'+2?B')(`LU\6JVDO*AHZ:*
+M%4&-6EDB2%H5GHTJC-K,:.Y8,"[09%Q;%TN9CS'/,QAS&AO[?G/?T\J2 at BDH
+MUL).'O+-O`]H34I(7-3\2LC7KF644'91 at TH(+.GBY,`'8O>*Z+U1W?,7&T[T
+M0DM/KX[-I+VK8Z at PD4Q#7:H?H('T3>;C;ZP`]#6(3LBX/?H$0V"F82Q>DRKZ
+M2,O at 2DSO:KT891B`QB+HB"N;0NY`?D_W%A>_I5^0#NQMF_4T>5DI$;**Z^YK
+MZ97S??G6TP<3QRU. at 0G!YB]UW#O2U]+A>>@+L4)AVUS4:5^[NK-M-)]+;-@\
+ML7E7<?>QL,-AU.9`Y7UL.[$=Q,$+VB at ID0%2'I$GY!EY3EZ0&<I;(J^[/G01
+MFAP*!C=YO1CNPW`"9P6-#.&X!\,%C]?CD1VX5W8@[^=9X)R4GEOVW1XQ8ZJ*
+M\U at 94]F$6I=YWKJ:T$4NT@@]RZM0[V@^R9-T%\;P70`Q`Q3Y9?XL at U6;F9\Y
+MBQCD9Z+7`%#O7R6K2X,>Y&D1F@%H@[KRH^H6PO`-`QC^P^,,/S[U61XWD2R!
+M0U at X83GY&LD+8MJGB=S(5SLSK7>XS-@;/HY.#CT@$"2&T6;JTNVK.QRAK'^+
+MS?65\?:P@=-PY3I^#O\&*($/M<>'W!#K%-O$]5$IVA9=GY.V4MN\(QUW%7=)
+MN_(+TA/M-JTYF-R8+$OYCHYBH5#,Y7ST%+A/I12ZG]5*.8DC?&HXDG86.L(A
+M(B=9.4YVE$K`E\O)#DGRL[1?]5'.?'I=M[G4*Y55P)=+(Z5CI3.EJR6R5.IE
+M_?RGI*W2.<384IDM]S8.39V?QPR<^;?03+AJT'-];C90L\>8GTD4B`US at 4&R
+M[`R'$GB=NYN6=?]1+5UC!.1Z8+O;!O_)Q?J6^>AI`SVW]T"EP=2]C^&9\M'G
+M2`;BIVA*='6>ZMV0#78]^2.2L=AL0:]9<D3]K>OO&6[I8,T.OYN>WWSHP9`O
+MBQ;G7=9N2 at I^*0!9DEN]J\E/><1WI\>_//#B:J<S;+:B6C1'W"GAT_FI=1EQ
+M0[P\.7QMQPG.O]$E>O15;$?;/FB!O\%>Q$OX*\1Q4B2_2[U#GV08YG73(,NP
+MWS;/5ET?U-.!$^!Z!$7TI<`G?N`M?\%N1C@@;GT#DJ(9$VO$9HL5<#;>[OCD
+MY_[?/@080GL>;3 at Z!D$1=4,93(`IL+]2:;BR$^P!TY5*Y0^5LY4?5]ZL/%]Y
+MMO+,OX4'W:?RE__X3`;=']9R!5`'F4"Q4(LI%,7TE2),Z(H7%&HQAO389VHQ
+MCC)VU&("Q7.UF$+QTFU#@[VEON36R3WC>U.;]NW</7G/?W<)W(8`&02]Z*7[
+M0!)L!9/HQ<?!7G`GVM\+]H/="(H';IF5`IO`/I2Q&UVY];W^EZPJ, at +X.GK+
+MMQ""6'7-R@#0?Z0_A]X?UM?B_/S%S3ML77^%=J9Z_I.V_OOKQ[7S:\.40CZ$
+M3DWU_'\(,``4D1_C#0UE;F1S=')E86T-96YD;V)J#30S(#`@;V)J/#PO4W1E
+M;58 at -S8O1F]N=$YA;64O05!.141'*U1I;65S+4ET86QI8R]&;VYT1FEL93(@
+M-#(@,"!2+T9L86=S(#DX+T1E<V-E;G0 at +3(U,"]&;VYT0D)O>%LM,38Y("TR
+M,3<@,3`Q,"`X.#-=+T%S8V5N="`W-3`O0V%P2&5I9VAT(#8U,R]82&5I9VAT
+M(#0T,2]4>7!E+T9O;G1$97-C<FEP=&]R+TET86QI8T%N9VQE("TQ-2]3=&5M
+M2"`W-CX^#65N9&]B:@TQ(#`@;V)J/#PO0W)O<$)O>%LP(#`@-3DU+C(R(#@T
+M,ETO4&%R96YT(#$W(#`@4B]#;VYT96YT<R`S(#`@4B]2;W1A=&4@,C<P+TUE
+M9&EA0F]X6S`@,"`U.34N,C(@.#0R72]297-O=7)C97,@,B`P(%(O5'EP92]0
+M86=E/CX-96YD;V)J#3(@,"!O8FH\/"]#;VQO<E-P86-E/#PO0W,V(#(V(#`@
+M4CX^+T9O;G0\/"]45#@@,30@,"!2+U14,3`@,3(@,"!2+U14,3(@,3$@,"!2
+M+U14,30@,3,@,"!2/CXO4')O8U-E=%LO4$1&+U1E>'1=+T5X=$=3=&%T93P\
+M+T=3,2`R-R`P(%(^/CX^#65N9&]B:@TS(#`@;V)J/#PO3&5N9W1H(#$R-C<P
+M+T9I;'1E<B]&;&%T941E8V]D93X^<W1R96%M#0I(B>Q7RX[CR!'\@OX''EG&
+M2,-Z\3&WM8TQ8&#7A^T]]<Y!#ZHMC%I2B^R9]=\[,S*+HBC.8->'/1D--,5Z
+ML3(K,B+J_3]^MMES]_#7QX?WCX]U9K/'W4.1+>IE76?X5V0Q5O2CL%EM_;+,
+M'E\>WO^M*[--1WW\UVV.#\6R"$6=/6X>%ORSHF%?'Y[R'\S"%<LZ[[H3_2KI
+MUV9O%G%9Y:O>.+>,>6NB6[I\:URS#'GV*L\WX^C_2N<<9,K>.+OT^<XLPK),
+M;ZUQD>9?.E/5U/K!A(96S3KCPG7UZZK\T,;C1J;JZSL3*EH at HV]62YM/%L!K
+MF;[6RU?FII3#E,GN#[+?S'QZ_"=GV"Y=\"Y[_#OGSE:><U=(UA;=FN9:6K(U
+MEJ8^TPH%S:748>,F+AM=B`[-%G)J?AFMCW0>NF3MTW&X:&7A_9%RU]!*/:U4
+M(W8GZSLWO%V,J_)LIT'1-RWG=XAQX6+>IY#7.I-C#;1NUW**:?J;"7SL!HMR
+MR]9X2RW9DZZPNO2?AA`4=PL-89(;%\>YX6SRRC2XRMOC]BX/;EDZ6X[RT&#Z
+MLBAL&*6AINE]2YOQF@&+L_,4!6>`S_6PTNX.X05.6\$=:QT^]-.\`H>+K+QI
+M=R>A:R=E@$&M8Y[D&_)!/M%``_C_)_WX-#<:UB0WI;W!S:7]HEMM+X!?Q)%4
+M7!+3/(6EJPH_Y*GDFA6\5$$3M3Z=#H8R9?/L8@`<!G?^14+`;VWO3)1JK!B9
+MBQB`%6H+TO9J:HO,H`=-1_F]X55DWI.I2EKD)U,6E`;\ODN#[IK38$MWB_4A
+M#8#82K%.IT"?^6S*N:(A"FK"%2R!(:)%8VU*`C+I\O1$)=-:9\*)IZ5/+Z:F
+M.,_:W6OW3GM-06\70Q5,:5R#06H`C@>##2WE0E[?R]SVR!EN\JV^ZVR=^T6?
+MQ'DNZCEP:25 at 8>Q/QGMJ_*3?O4<3XIZ at J;Y%TY%R5M&9\?\-<!7S0WM"S4=P
+M2,6LM`7)>ZGT&:#%91GJ2G+,F2V:5)&^<)IC,%S@%%<,UO0D[A1=D-A^1F%Y
+MT&(D3'FNQC<48>"DR2*;-N.TEO2S0UXI_J,.2H,YG#CZ0*OOZ<.]+L#!T:(D
+M!->ZY=S_1+3(X^XY3*.=\GNXR2QCQ=*Q,B6>L"4GY$)G3^Q4SE9K4_D_*XEQ
+M-HEG_<!%U6.4K)3$R,A($].!9$_?3I?&-07B3#T?KE]%77^E-4N!G:@6A&=&
+M%<<%/F*YP)H[83G)T(_&D^,A`B%F^IRXC at GJ#S,:J((Y`!U?F=C0<1%VP\@5
+M(>K*G]3P>VC0S];O=Y3R[7QNP5>SSN%&,8.]IJB^X<`R3T\$1K7^H[%V*3%0
+M8CZ#BL*M(ZIS;7WE+$1V855R5HP1O&UD at 6&^J](XVK?T06FJ-'*%M:M<.Y^D
+M$ZS'&AINP'#-VIR&5O4-V'9"<`HIE[\0SOCT5MI,_%[.ZVE1DV8,%6JM%FBL
+M%6@=A!'NRW.-71+)T)-#I7J!B7U6KN4*Q,#4<=8.JM;(!J-'HCHEXM9PL;V^
+MZ2"4LI52%OSM4*>>#Q'3+_K^@DIJ.,+H>5G][$RQ(L2I^-J[8E6U=)#%4HZI
+MD4`@%;L]BCF0G,SD\1:-X2K)026YZ_GPJ8SV1R7/9P-D#^]GIK6&$L7-/5>5
+MUO9N?Y"Y+<CW2$7.5?+".`;^(J3T+O`YX#AW6VZE&&1R<FL1=)^O7DR%=9U?
+MSK)Z#,75LP<W>/:J',7*\G[9\[V'W/]S1I>E&OSD2L&CN[ZMN3!*<04>-2!F
+M[*C]+T9MG)\K$-W/),YX6R`$+)CARW]FF(2FAZOW+D/RWKX9:L"5.),%NR-`
+M,!><PP9%B]-T?)IM>J=/`=0JY%*-KL*Y,71+Z#<,U&JSD9[4DCZ8GNE;)UW[
+M.*S\EA9;,U/&.=ND\8WR`RTFO1\EZ`T at EW*KM`[<G/6DI>QWE0D<QWP!=;H8
+M++0733D^2U$KKC\*64%=H"B]J;@,59]4<$25=#WHVUJE3WI^S67<+ZP]'TW-
+MI?0O4_,'?C7?D"*-X_LYV0W)"`VNDPY87(1"KU$<63^#IR;$9H2G:N`"NB>.
+M``720IF`6"H^9DI(K1ZD`:>"(G;MJI>TOEV2Z#!C,4+THB3BM1-CQDMBV(OZ
+MC54_`PML<U97A+A*V>P/%+$748;=3$_)2ZTNN\[W&L55<Q8PH7+(6\.JD;WB
+M(6 at K];I3JTVB!"#CU+''53#@J\1N9?Y!!8QNAI-TVV)9-W:4[Q!3_49U`J\G
+M(A]\5'3"Y>_$9_!R2./K:>A%@!;TSYNR:&N&&8#$:!IFK`Y8]<"_[Q*=-CA1
+MH%L%3\G\CI)+57U+QV_TQY;-P&%A#+D at D"L5<E$A5RKD*H4<L?[I37_UY^&7
+M$87GZ&O:#&QX@%Y!+;CMB)>-OB7].ND*0&6IJ+1SJ)P5+;WA#J*E=]3$E9!N
+MO5_^UDNOWB\3479Z9SW1_HJYVUY=ABN$@A^J(!;E6+[](-\UY)M"5'&6NXF#
+M9M4X-R^,'GEW62NMO^G<_F:*-G:&ZV6?2O at X<TW#-B<E6TYP!)O4'=7*K%[$
+M[;9\%&'.1P]7-(CYE:Q<N$;.G,IB[H><,CL!H)FJ-]PQR'W'P<$A>M0V9K/1
+M$T5G1+"B5\.$&6JZOUZY9GI/P*TQLJ'NQ+PP*U&\(@U(\,Q)6[*#UT*I![&W
+M([$/(O96Q1[,;$7K(07/2"[O'`%L38`39<3UJ[4JPPH+.9`%EW9VU%DR4`J[
+MS%-O?QH618I6TKXUWM+B^IB!!.*9U(OWM_4"LD9".JH$ET[1:2C<<9!F',G,
+ME90"J0K_>Z^DPYV3OGQ.E]'HY#KD1<3[L8;OI$-MPB#O(PLL`T[R=AG+>C,Y
+MTK(<N*^2G;6KS;_5F*DM8U5]8L;@*VM#=R_\O*=NJO"J#E,HAAN;H$Q9L7=B
+MDCO-N"9<?(<=QNOM at .UX0ETEJ!/K0X8/%:2PB^FL8/'$#X@;", at 4SP87,B5F
+MOQCFGH^$&7)"/LP!1_<T$J49!W3C?_Y'.T2287W\D^W0U0=]QP'ISJ87AV;"
+MIXZK%)Q6:M5$954KK#I#,WXB*&X0E-"48UKU2JL5WY%V(K!8U,EM@>LDBLKB
+MVGOARJ(AG<&M-]OI[(,LQBSKE&6A066J:3='LS-R$IP=MEHW at P.T#3N_[J0L
+MN]D#@+*XIX8M>X&*_1V>[`G$"?+H`X.:!<$YI'+AI=:=T!]KQZ4C'J`#_,#1
+MUDP(>&HO-+645-1\Z/AFVXD+D\`>__)_#R]%;`M[DP+L3,22HS[3.S#$:L8>
+M,`U at C\01'=03ROYFQ>"FI(.OKG8ICNV2&^Q2`[LDYB`FNVCE8-EB$ZH]HZ;`
+M(45V+HQQ^$UU6`YVR:K#LC<.:\9$W%?W'#R`#L(!]`0WF_PS+B?V/FS:5%V.
+MPB[B`(K")0W40TQ/VCFM=+X8`.WT8OBDS]K9HS,)G(PPA:CD?;U62Y(YU3D)
+M9;CH6!6ZW1J5VN#H6!B>$9F5NQEC$KWO"(SI]S:UR:5GQC"5%/7H=C6VFZOC
+M5LYBNE=:JB`K>54\\-]3K at QW$7YJOV";9`0O**8:7JD:8F?<-[9NOJ%2?'YK
+M/:Q6;<RS'J5<1L5;SQZF*OMPF'$XS.C4T.R38>-;%R,6*-8;;<,P!:WN-!AI
+M7<FC9XJRC&B7!C*>Q;4LX!H[++M*B_$N^^&3SSPQ,<)9&Y-#),*@]>1,^WUJ
+M/9J9R^>\@9G>IPH`<%$".0X7I^V<B[D1\NBN+D83QCSOU:X$\3)>S4E0]X)W
+M%K2+2;QHP*,K'=;+!MZTO^W(N6VSLTX^Z=H=SM>J1?+\K5C+N>,]C3OJO#G_
+M,T,/5FKZECJ)B5O at T^9?X"'3&Z$6IRQ20#">84J"K1OY`#_-V?H:F#R/_V6^
+M2G;<1I+HK_`H`JV"R&1R\;&!AC&'F39@'VI0[8-<4DD:RR*MI5SU(_.]$^]%
+M9)*4Z-XP/9B+J"1SC8QX2P\(A?(?`(J/,X"A at 13@IE)LY:2)EH3Q!_V8,/CY
+M;"N0:20MQ:U#=+)G>QXI&K/8AXAXLEN`O at RKV\PK6T!W^9!6M4AHARK^B-DG
+M<)@AN,;A)@O@%<I-5$8%[7#JKYC/EB5=S1YI;<FP at OA,F*(Q`D;BK%>L=0\1
+MHG]$F!<5Y8/.L+>1N_Y)7?$49C`X.MI*IY24_ at 8YJE]4,?1KMK:'BZUX_C4M
+M\I>HZ=Y*N'PH3&@EG!G8AG6Q,"N11=N71UEBHL04;6T*6JT(WZL**7^_CJZR
+M:QWM)&!/K<H/IPK``[74.N56O@*'!25(4`E^BI1Z*L1:C8M,V,>``*1Z0LMU
+M9RY)=0^Y(D<LI'8\$,>:YV[<3!G-4)5ADOV:)R+:L=^2DE=\@>/&50Y?A\HV
+M/N`SH,(U'#MB/=0C93`O!5MZ.>NW-002Z9PW=$(^8\A!5IT*5N7+>J#6ZEZM
+ME4.UYJ):JZG67)1>CM*+QD(*!\8B6P3I)?'C->6S%QM['@VQEZ<4];$+VO8P
+M$1IN\__(C?VWK54VAH.6B5//GDYV*@2_*!E\)&B#*M`PNTD)<T4N956&8U5%
+M$?1HNT\K7M*WM#1I2>^54=<4-<-6-5%K2!+QJ2^?M#\;<G(!.)WMDGK%!HJM
+MT02=C-<W]C5,8HON]8$<_CUDP?HH>TM:1++(%V9(2[&C8#O9XCG<E7=J27.S
+MI#DM:4YD+=60-FI!,S6D=6B!%LV.%FI'Y0@;E;E'*K9.)]SJXP<$L9 at E+Z^<
+M>C/5)[("%?0H"S8=*X*D at XH7BP".[UA_/$XQ=?-B/HH_XT0VYD26J"`L,T=J
+M;;_O4.:D2:TUO-E,W!DW<YWKY>B4S'7AI-W9E/Y>C[N>A*Q<?6TOSJ/!S'W1
+M%VP9#6:F!A,GD+OR2J@@Z*763F=]MM:'W"N;V5_75B\/N8,Q4%\5<"C3TR4%
+M['SB[]FTX"[\N5GB.U1>9$T\9#9`)?#@D?E=FIJMY*@9LY(:N52!YF;=-CF!
+M&:K9Y=-9!]BX,U6QY7VI"G!"$T\3N9'KZ"85[)4>C5S#G_TU]_4H/#ZO[\_K
+MR^&E%O%2*[U45)<]>9_.5I<HGV"?JNL+G3B;^P-G>_W?GNWU+SI;=GLVV"Y'
+MH<H3N7`T9T>;T%INC#4#EBDJ%]06"=_HQ)#$X/ZP4:I(QM2SV5IOTU5+T,%+
+MN at C?)9&QV^27F0Y[E4^Y=OTE-5XY:]=(9B(AP)G&:5/TXB:A:JPQ",BYN@:O
+MUZ3TO+:"/JD=F at A4E3=5+TJ+,HA2P!?F5G/:4(03*0HBH$A?+N*UQ0A2?1TN
+M7U+XDT_K\*:U;D_6[I:#@3+-:>+(W-45HXYMKE[8IKT at X1!)MI_"/<X)'`B`
+MSZB$;X!LI,8+WWL2G_7)CUUJ\G.UE*&0$_%Y20M:%O;JQN^\B^I;'SM)5MDI
+M%'`AOTMMB`A4S^!+^M-Q('!GT)?>=*;NU95]-CMCEI_^#COK9S_^G-;P?.]%
+M["+?WD,2Y"A3BO`#]IJ+RN`C>8OR*7%U2&;VZ/33=I=FV/4C8BC)LYAB],6-
+MYND9W;+GI]1#><KN8%Y^3#WJXF=1=;+7]PA!*0\/CV;1>@09%-1M\J"ND_IF
+M98F]Z;KVR`KRPQK$WJSG11^B=+UDH'YC$4ONMT_V1XM[M4/5E9HR<'/\N-:%
+MCZ/6 at 54$2M*E59!489>=?=[:<Z?='@DQ-=+%]J8 at QH^=O3OK)H9B:XI4C1I?
+MC4N[]0E+E_$LD'I%X,C.G@=]NTJ!2CME9?$([2&QZ;;\`N%Y-TQ7U].ML?09
+MX6!T:P;'(VW61MR)=7KF;$NC[[VNMX1DJD1GZ,;M;5BRM=>VTR2<K]7V>+V$
+M9ZYB$$[GD3+X(B@$%+U#@&,^_<VV/@[P39Y^2YW3(.%R]H!EKZI?AG9VW:(S
+MZWC9XS2T)&IYQ2'A0FYN]*[_6-+$B\50R\/GT$F;P%T9^2;L9`P>BRLAN(BH
+MD<%+XM1O1;\WU&)S$]"85G;D$3*YR,QQM;G##D]I1I!:25LOD8.?!2(RE6VA
+M>\-;R:!EDP=YG:M"P!I9FC5\L/4Q+6L)R9NTR*;8Z1I at IGC\@T+GJ\:KNV9P
+MO1YS=>8`/^G+3T/FIAC8ZH=D&^RDSX/[5+MH_!^_B[D\V$)=6,FZRR>;U1[]
+MSG21Z$,G'"KG"#/K`QDZV^GZ^^!*58UL;.KGL"UL=<G?H;(X;$Q\;%_#S%83
+M3(J%,^IW"P,=E$%)DSFO839/D`"JS$E>*%^IS!IF=%!R*YK#&AG`3<VKBKY5
+M!SWVW"_5T<1)?Y"L8I6CCA5ZM./!)GBU:;^SZC=I571+^G6P'M?9AN'+(U0'
+M,M1&KK^JX;U8CS#RV69:V at Q[>[^^VMC9PG,73C"`FE_)V*U>@MZ6[N1+RDJB
+MK at SI8E>U&:47>W1;2X='3385GVTWEICM(7QA1 at SS\TU0LV/@"`F1!2WH0$C8
+M^0,CT,SN!7CA8S\F+XQ%-A,I=2LM757W&CQS59"6I>47=4!.7LQ5"@N\7KA]
+M*F7`3$U,A8(Y6)#N4[B:.<Y1R*W3Z^C8PZK5]H2 at Y%ZN-'0Y-!NJH-VLI7(N
+MR"XY0G5Z/!*B"8C.D#LG*1I2WTC+:I$/-+7/HJ;.P\$=B.N29EI-6(\')YVJ
+M\2UD)TQOLBM8B*'&:Z0C+AQIK($#2W*?]%H[FZ"SGK9"I*IQK[U^7=LROT#6
+M<U@;%ER%D2TE?3CRW`XZIIDB*WOU8AG?'7?J&RBD at HD8O:,LB9+.`;DD&FC,
+M"<_>MJAB`"[B>DYVMRXT&N*Y_)3U'+&*9OHP$1XE;)0,IYN;E?LHZL'-UKXW
+M#2Y>;0T<GYV[U!-2<$.Y9N6<YSNW?)O0`DCM/[9<,"/`(-\])S at B&GD<Q:R;
+MA:XG9FE-**YC2X``?H7IJHA+O5*H09)`)D^C;_OU3:78$:\BM*BK083.:ZY'
+M3B\:IN#BM at Q$L#<"''VP8OUG??T;ZV&.+O4&PAD/1E&'8I#C,RKJ8R1WY1SG
+M-=:N%7T73,F0W#2Z.QMV>T*Y_?JNKA/^+)(BD\`5B7>BV&1;7XAW=3$X[6J)
+M.J?/6S`AV;HY;JY%$`UEV>=&&<N^1-$[0D<%Q^A"<RA6[M'MG_A)TCHCH9:+
+M&4_>Z, at E7%4#2"A9I83[@_TYGU*G:2\A0++)`DD8$=4JD&,GU[;'?&LR7P[I
+M#%@7#-`.F\'\G&?%R<(D'E?2IJQ)WLX.DXFE=2HF;9Q\/\?=;70&;(V]XZ[1
+MSW#%0GF-UGG('^AWQ'.)C92P8TM`76;:5=V. at MS!VD*?@-;.$G?Y^#G\8\*@
+M@[;7 at AKC"^Y9D6#>>[/<O,/#.YZA$36;`]9EE>+.\V2`T<T$,Q:^\7UE%`._
+M5PT8HB!#%,'\&4/X'DB(X"6)HHAOS8TE[Y`&?O8/G>FM/I*=3A',TG)#D(\F
+M*E%V\,8.I;)#_]G6($EPG+)1!9(PY]C:EZ,VD2U"TQ5%AWK!(:1YM1]XWV\%
+MG\7?X2I<%%0C.F<`Q\23U2Z$L6HL0Q[N34Q^Q"Z2#ZDZDQSV[#,LWT0AR^1U
+MV=_.0,'EBPCR68:"-;UNKJ#35GQ)2<_CFR)KK<S/`U'^V1HTAU)-ARE--QQ@
+MMN&+2HBH$L/5^^@*)H*&<UU5501EYP8A0UE]!.E*T%X(#E`1;*^/P(8"99[S
+M?#?JQV?._P9'ECYPI,M_ at R0/^KQ/,X6_>:87V`2"Y$:D*+YI#]A0J&;:D)QL
+M:E^B:N$&K^)0#%1+$=0NY<-]6B$64!1S?20F,"@VO at +[,E8J-3>"`B%VI[!:
+M!_&28)ZY3BGE$-4/-.L\7\1N#SJW5"\$MBUH0?EW<EQ#''W%%7QGS5/RCB6?
+M:<E+1"6+<L.24',-M:&S6J5D<`N5$SWV&>(5192O9@,^;&$?2+I,Z)4U"0#4
+M;]#MEST%?$9I)L"RLR9<)9-9Y2OEFPD]WB:`B47*%<(HAF>8;KFFFU1R[>KK
+M:@V:_I at 2U-O-+5L+<`2VQ at CAO@__&DXL]R3YT?.Y at O2#B&#B>C4[JE$%&T,%
+M55H at Q12@Y-7"#2I")UIO.*Z<W5V7:G;G<8XPP#69CFC_0WJU++EM),%?X9&(
+M,,=`H_$Z:JT-[\7:B-7!9PZ(F6&8`B at 2E';^?BNSJAL@"-NAV`M!-/I17965
+ME=4F(1.M+P4[]`,]B<3/N%WB&>`K<!%1+RF=I77V('WSB=QJ==KGX4L"4==A
+M>R'?FY70*_LA&7\!2*!<=I4>NRM"^=F>K7NZT"86 at SJ5)WH*F"[CA5$^VPWQ
+MH0?BL'D,KP'/"KY:]2MR&$:QY/?=96]FG71-NJ@&95ZJT[Y#,@,^2+QKXBNX
+M;(\\S.1TZ9QJV;0JUHBL+OVD7WT:B<Q71F1R=5"P_-!^YD^.4XBZ64'&%3E9
+MY)9DY#^U`OV6Y-"H_U`K_ at V5]QE?,GD4),-S*`NO]L?V^B+UM)C.63"]6;Y@
+MN#R?N?/ZQLS/6+\]*0D:1A3>\PI^IWY6VZ6 at Q/*L,,P8E%5^5>05Z0ZQJT<:
+M7Z'C"Q3U,*/;*`3J[3<;V1,B-?S)F2=RTC3^3+S5<;PS'7JPL\)^X[2.[\^+
+M_:\,"[K)^_>5 at AG;V[MF,?*A+\/M\\RP*=0,=JBUJ!%;J2E!:<\Z\#=5.7-)
+M.$2^P at YOMV[,&PVLK1J[ZX*0BWH>R$Y/+$,Y[$:@8 at 7/0 at 99/<.S-KUWJ7])
+M)(JU9GZAJJ5492*#1WW]UEU-($-M4.<R)0\_Z_?!-K'HM#KI+4F9];9"D_\U
+M;A7;$L=6+YV._9+4)FQHD4@;D23#BYW!4E. at Q'&?3E^_HBR5*L3*,-B;)?;Z
+M$&USS[+I**,^JN8.1XL*(01W@^D$1AWY7]+QVN'#-(N"A;@,,&01I(8Y/82I
+MOJ\[UARP_/H0):KB().M.[A,PEUO34W];2'O]_W!G#W,]#GB]#:)<6[;V_M#
+M@[#0][&3F,QAXW#=A(DO=P>%]J2_(;3-]KF[S%7^SNZ_C$/T0FY>&"A+N3L.
+M4:\_01N)&Z!V<N8XQWJ^M!T-JL";L'2S'S=AE]Z>DJ(+8-P5%F1+6E>S_!LO
+M4R/I&]4SOJ)@D<,8)$^K1./-5?E$KJ5L/B?7<--<](D>08]ZB[`S3S.-JH9E
+M`#75L1!#F>])Z45<)U1K0NUC at DS]I*W#![Y85*Y$<:91E at RZT56RMK<_K1U*
+M7!5;\CD.&^S[YLQ&<+)R,.NB%6;5T1;V-G^%=NF1>P#D33%S^C-`)"85X,8_
+MJ&M)#4Y!*>Q)BD&@5:=SHJGFAQ`()(JRGH?`Q_I632%(52>3MQD"#0#=[[5>
+MD<'I_K@"SC\;IX?5=,TTXX[_>P*F,3FEM:ED%6%,R')A#F/";YNPV6!'65 at _
+MDCTEX"CU'Y+5OM"NOTPX/_-W]U^>*%Z&[.*_-F&_`#9<UTYY-:ER[3)9:O)Z
+MVK(`S\N6[2AU\=7>CW12P9NDFIE\7GG at YN4R6#\J?5_&(E0']0D<=_I.%BC(
+M`L76QGJ^M%U8\:B:8/.?E'NUN at UE'?`OHWB0`(6ZOY+ at 43S1$SZZPEM^7VA1
+M328M5#.SC_IF3_L\DY-\#2YSYK+,7.9XT69R5497X<K[^YVNMC.=U=!933A-
+M]VCCV0])NI!&5!3SUFO/FLRNR+$OQ6NM?1WBXYK(^7?`D28E6P"'M&^2^SCA
+M8<="TB59[#>\"2OAQ*G:,- at _@(L`P'#0&`&):9M]&!\6W]\,E\$@EIH?.?@1
+MD/3%(C&K9N9E>,-A7U1E-J%(R')-_DD%+(1$)UV1!]>:BCW(Q7/T&&STT,D5
+M($^V=UIT4$K?E9B..JI*SDD1!LD3 at 7P'#9LRJ.+2T?8/YPQV0K_9/]NZX69_
+MJ#V#QC0WXL]7A!7JF@\;#%:T^FJC*YBE!^[[Q*`L3-S)K3WZ5M5GRD:(\0B5
+M4L^;K<FO199/?I4C8H(7Y;2K at _8['4?45V:BL'U.X=K09+X*ES:J71PK)@=[
+M?6L!H#P,;AAY[#D.^CT4#.XG">]8BKCFA)K-WK/DMAR\J#J^6_8C9O!AZU9<
+M3:<LH.N*X)JLR4/K5!2D.*W0MT[K-\2ZD1&IK!W0\58"RLRD9FU"(R.</$";
+MIVP>\*WGO- at U/1)Y:,FZ[L#$J6.KQ7+Z$.0I;\HBB(/0-7VBCD7WIRT(2C.;
+MTNW)!B4<2-)]DH8*O]T!I&[[>^(S=?7VVKX1YA6E2IYRT-[%^>2)BJ6=6FY/
+M at WG[%"*]P(UU;R0>.`!"@</C8X`6L2FS<N:=[WND'T65ZB</N5^MH%]\F*6S
+M0E^42^GT&=943UXM?9ITSYNIF%U"A?Q[DH$-]\PT#(1UXC6A"'I&RT:&]&^T
+M,%;;20RE.G#G'_D0SH6/7)P>=J>/W(J'[&9+6327H=?QTHVM1N4M(8XO(48/
+M=4THQ\U88E(!YJ??D at R`>$^\-JFE5C7T,E<D";M=UVC9R&3.01]6Z&SY49O<
+MTRDTNUPAN9XC35^)>K);IA*+K\\\<V]K0N4\'</TGM_!*6'#WKZ,8<E#Z>)U
+MEUHJG7.MRATM#QZE&RVHI*+@[;+"LO<X"S!+O1')OY+2L;XZ)IJKS$I8_HJV
+M-V&1CM[:"=IJPT9AR:]/N.VBVF43Q@?;J=VSU)!+V;/NPXRPDV9B&<\FSD(F
+MEFN9..%L5I7NR.I`CH8-S,E=R2QB/WD[ZX;IHZ_I(B[VC5U`5JO7M4G4%-^A
+MT*KOUSPO]$G940>/@\75*F2I8DC*T'GB45=KD\/W4<C;YNC9#M*"[_O+T29?
+MV446<5%OSVL"IVW"!B_:G6K-&E5)?@>W0DQXUE,"U(%`,WF_<=3&>MNEU=>.
+M+JGCV4_P[R.6[?[Y//'/Q(>XB^(6:@7=@^0N[#H;PP`9ZA\3P6Z-%BK73-V!
+M+\O("Z4!F]I!-DM-7B%D^']%!9:R_R4I41EOHOHPC?`>C[9*>*2.)9[S.2(2
+MD>!)<NTO"NK]G&U=;@-10,N`4@'*2ZG=1,Z>-->"(^==50ZL\`#O]X#-.E:)
+M+-[2-Z8),U.=4!WO]GY8?!\W[+RVVH\%2&E0R9RAF=J'!9H]QC%N#>G-4U/E
+MLUBX$(LB#XC/G2+;H6B/9_MSBB/`I]`&11(ZA$*U6$X+E>SXY<)F]G at -"WM[
+MPH^Q/=/E+RHH),X>.+^I#2<+,4[70SO=66^UT[LL_>[F'=K59'F'(B.E]<8\
+M**TBRA\1'+O":W;6T'Y/%.Z/G0J$%V(J5:HJROK_EWMGF at +]NLNVE[UJOP[<
+MG&EGX,);$(&0?[%/?23#.SIM;Y%=X.C2P%.OJ1M7I3-(I/%&OK(;O79*!;T]
+M+PGAM0]D[3)BDB92UD#ZL[5I=<$`S7(8>I4N at +1-W.OW5^H:76+`X*YVPK.-
+MG?0D+EG1,KS'O9;Q+I^CX5UH6O#P]UXHJTA2E?<!2S3Y'5)->6/HW_7/ER3W
+MF at M>E5M%7U1L>=ND<.'3P1;JH]?!S4V?5W@`54OFO^J,+JDFEYQ/JE@'D:QU
+ME/Y_YX*\OBNSYG$+Q<(+$H"L;B8L^(D>C,-:@!N,DZE`\*PU'+LA.:LPN!_U
+MV4'8;3<?DQ+J[%/28,Z')(?`^!D7KK?_27+4ID\ZY8,^"!/Q:\T\<.Q71S:$
+MTN**>WC6ALE+L/`LG2=DE)&,\FE,U"&;Q5&/-%MMM-,+//C3W+&0+7Y.,&C:
+M(.>T($J#TZE:_+I2!M-:*L%?(XP`8-"_)G5&+/'!(4-=B_\*#(/6'(/GP7`J
+MLJ-0#96Q at 53H3."=?$<P$77/)WW!)=2:U7K'BRS[WB9>)S>U_U$HJ&;0]?F!
+M9"Y1^]RIB>1&_.E;?=HK38,0REB"=\X4=*5J/"/85-!<NJL:*!+FD04OG;:)
+MS at 1X\^<TF(L<F8D4YZ-(<09]ZB'ZI at 2O4NX(%Q[UV5(?P=%\#+1/])C4M+QD
+M5G/9&7"4R`TO":5IE'F._56F:%2:5T7C2F8`Q[X"J`T(IIXF]OK6Z@%Q]8,$
+MQ_T6-2-MHN(UJF_/#!8(")E&8%>%BA77J!8N((/&GS;SN1R[\-("X/!A6'P8
+M']PN#)F+KV//XR>_9TY-^H6P at 26HI[\FN.7FR#*=68&G$"V>M&#@X/ZP$4[=
+M'BA>MQV"P^EA&0S+32Z7:U1J=BU`/AD'=0?C.A7H#'Z^U<ZID.-M'.3 at MC\E
+MOH+1W5'!VULW^,VF=Q<"H`J[2968T]'DJP+5.?JJR"9?-6K."Z5"KBC\'^O5
+MMN,V<D2_(/_`1S'(#,0FFY>W^+HP$GL=VYL\<R3.C&*-I)6HM<=?GSJGJDCJ
+M8 at 0!`@/6L"_5U=55I\X1RK6TP!]2<HVQYCG=@A69MR5U7(-84$C6]$`;CULC
+M9XITF\^LV_=FS8PL5<[L07-J7[,;MG"-%G.$'SDIX97X\ZYGK<S2U>CT&O(P
+M1SN4J(JN8H$&B8'D7KQ6X7E5%]<`>"`ZDP[+7P/D9.<ME\"X$1`]A=46PVOO
+MRHS9KR(_I+-%).?;-**(G1!<EB8=.VLS2LV=N3P:]U=M`$5X4R"@6^L[(-LE
+M(/.$&XU7;XIR!+<LC'G<C&I/6R'Y<8]RROU'*(]U9*<PE;87Z7<[$R.,'&$:
+M[CWK(L"<4$6PW:VMZW5=I^LVPRBMF5$S8B:'@.909)^@#:*$-"B[C>%:0''=
+M"T$V[=OW1^):.?LA9\T!*3^8W15<8OX<"3MQMK at 232J!H0Y'/1MJ[WS.:.#K
+M"_U*=FW/\M2\9]TK$L2AT at Y=NX=\L\&+>_'@<Q"OJ\G%^GNK\8-UO(5E2&NB
+M$$?.IY`W4N!IDF3EB"[!DN2P:#?,OXB*M6.ZE*7\.QX$?9D_-NA`MTAQ:QM,
+M[K<VS(*ME>I]2?'R;].<3WYG*U8,F`$9!]R!AV1RSTKNY4M[^^T,7"^Q)9RG
+M!WE#/?"74.IU/\("U9<XN65G0:N^(63SE!JG(M$WX#01VM7T7C"]%V;VZ9QF
+MV"V;V\%F0'R.>[=Z4$0=F`T<5+BR5UYU]T#2_!J%E[YU5<@,*/<N)9083]RZ
+MTA at AK$-5+3!@L+?7'2O](@&5BC;PV_0GP$=.. at 5$+C>)LW:R2=L_9:87/)QW
+M.I-VV10@)3$)"/U*0>/!@&QCW_#J6D^5",2LF"B>@<:&PM+ at +0NFQ%-K\V;+
+M6J8%^ZH0,LG7';^V!&F^IS4[<%L?7+7KE/TS:5-2J7'F@=L['UCI_H4N2PZK
+M7E04,^4*&:?_I[WC1/"M-+D>8`))Q]>ZHOW"F?;+XI`X=3XVB5R;$%D34'O6
+M`;1)0F<)>`.\#SB.G(N0/FP@&XXD`.0CNVNUZ9)K6IS3&[&&&AA&*FV67Y^T
+M,_RWAF\=E6]K%_HGO(',S%"Z[7>E/HW+S[^E*B?S"L^P2"E`6G;:M7T=#5W7
+M&MQV[&?.P_CK;7MCOP?0HBN9/J$"/T5XMBX0';8N),H/6B57+RJ6ZXV5MD+^
+MM0XFYTR89.DRH##MMK/NL5?U!?^#MJV&R%K9U1K#>`""_=&:I-%IW[/?F*!A
+MA[O6VN#1><\^>7B1&17-1\@D],[*$H$GJ5O[*Y<MI3;.)08N&YOQLJ7&#;ZZ
+M..A54W2F*5P[;)+P6D6(BP];R.K()"7FJ@>E#(XV1C2J'2)W>_M><NE*MR^`
+M+QKD_TFJV/W.T+&,D\@](L_A!0.U7GU/0?%XJZ-.[=-8\3'Y]9C6Y\LOPEJ>
+MAS5X6,$<7(QD0^!R;>)H6E`CLV1S7*R5[QD9-/:W4.1.6OU=,,B%]@D-V<`)
+M[\S at Q0EF:L/8%2`+7/\D!]7:S#G>VS[?[QY?<H;R6I#S>N!(;!RX]':!7HGN
+MEC4&"*A[(&!SRYX(Q!%%:#4C[H(-%YC<":L/((:K-*O9:CB[],W?+AY!]%K=
+MA`EHCPHUR\8&@'HQIAZ45C=*LH,P=1VE0A2HV%G&;FW<B\"2E"U:''^TZ6?]
+M7NJ/[R73U42R91<!-<_/1,])O>]8T(Q at IAP)+U at 2@Q&087!YI^;GYT60D]3!
+M4J3<)1;WVH4%UB4(TX^MS:^4&-T?P%FN9CY='OO*R!ER at T^@G*6OA"#.53"1
+M&F_L^X%O+>:_I8VF(*?[1Q]'LI8&`'-EGER!E=1ZJ`OAMU80*B#^L,6GHSNS
+MN=="FUHD6;\)\=1#]6!"\6MQ\?>4Q/J8&K_FH"]>=->*AH$Z:^9ABDP[TF-A
+M`@LX%0WWH/UNKG`4J=E:@&U^"G*,/')(DP;7)+1UBFE+H0=`#Y!`;4D'?>C$
+MOK=4>G+R>KICI+/5R1HELLEP!DT\^+2P6%^ZL5\_[1*W>9ESJC,D4U97TQCE
+MUJ:B:@YY)A(A><V_`"U`0L=U$4]"%9&K8BE,;)3$O)QY0ZYY$6.1,Z&IQAC'
+MZ+B>U:Z+E&10=BGG92E*)HD\$\Z7R$^4!+4%T=>BRD#^^I7OPKJ+P)@'YUA[
+M"@W!4+,&:E(T/7:X43VS'T':JWR_F$?CA,HPG/KDF:M<IGT#[*H:NR$24\"Y
+M(%*"Z<1@/*O1Y.#*GNV#C"$6VOABK9G`]8EJ5;AXHUK13'>^8N%;#TGK?V&M
+M4(>6F!LGYM=FWH_Y#CX(#V_I1W--+?#VT\@.09757_X-")4&62?\;YX$B7!3
+M)J$4("KG8N1)D[0>DW1425$;:2%9M;;?3 at 5#8KIW:X+7=,03E54&%+[)-6-#
+MF`+/<:<Y7TYVWJB(H:@Q\\ODSI8]`^`DJ=\0E9K9>_D&>7_YJ^2E?'].ZTSV
+M?481%Q:?+W^^B`*&<,VAO6>5)<<[J">27FTE;/(="BWRTN at S_DN%4LQ^(0XT
+MOFK3]:C?X-,+/E9DVLF=I9C98'])]:E))C9W3)Q<9.Y77V#0_N'EI[<^](8,
+MO)1;-[.7?Q\MZ?FO4I2]VCTS\MIXQP<VACA[@8HJ)4S36^[5?W-[J7/=7CT<
+M#%I$*5O*>E*RDB!59NVK5%@*2GOA\B.961`[\\$KV5%@[D6:`:D^@YO6LR^R
+M,M)'CG+#1SXSK11124U5Z$O$W)IKJ<BHI_ at 1OO%=FF>S3VY1L"5Y#U#-$`+N
+M>&L+>=S at D,Y)U#*<=HN-65H.-CX.%[@I$;/?[-=/'=QX91-K\Q,*+Y`HR[L,
+MD6K'6W'5OU at U]27(>4:?)',^4L.Y]<HOCW;^BI;0J@*`)?F'5LM152H()&FX
+M3'V5=#J=*VK-!29K82)'P#*2_7+$S>H@\XBJIV3?T*-[_>P(J:)V/#1W!G;/
+M>H8/MYME<NZU39%)8&`W;@V5R;O at YS[8Y*/]VOG):_.1[8E7>3V]RA]#Q"0F
+MRRGM'%EL488AU"XQWZ<%"JP%FQ""TJ-#`JA6RA($+/I5NUX_ZVBK]=<K_T^$
+M$T:"*3<;,?F0YC6!,0_$1?:L;SK8Z?Z'5&D=K8A-<KL\C/KI34J@,N=>IGD%
+ML+'#3ES003MLJ3^G_IC/FY,E/^'E<>1M,7C7C9KYD:HNZ+LV5(<RTPC[C,BZ
+MV/C`QIF'1`VD`UP>Z<!P^2)S[C=<;=R"D,A3LH$TU"W(K<.J?P8?V9*\1,TI
+MP\<R at O<&!(?\,/@!9N'6Y-/049`&^<A.]9*OTFSN;U9+^RL`H4]IEO.:.3BY
+MYD-N)#6S7*@TKK7&M7:_#GB!C)[)X`,35?\7:U`!RK0RX^D9(47-"CNKP<V8
+M[%%NS32IW9N=S2 at _CI;Y,+!R2WI00L'""3=-V?:@/AVY:)76<^752M#$ZPIL
+MB.M]_W:Z8XVWQ([8C->]\_WY?, at MZS7&F\'C at F54FY(M+Y?[CD6K+38JI0JU
+M@@VZW9+X*G1`^5MAC*^@RJT:[7F<>")P-V/*`SLBL*,8&+ZX$(M&(%;N5A=Y
+M)I!\6&S^5*O>'41CWDQZX[)%^N14;[F6+"C!\J^IM+I&L)>SVW1N/C2JZ;CV
+M;M at CZ*9,J49X;D&14(CBJHBVS;)3*YTQJ5N3!8OAF^N/QJ2^>NGB'RYP8S>8
+ME+(&/@P$.NIMWH!UX?5>TE667<P(&#?,,<19:5Z at WTP'Y<8%B.Z&/(;K(]G>
+M-_;UF@]3*`L,>)>O]IUL[81[="E)9MX*1[5+M_7$9DS\9_HLTOE8X*TM]Y-]
+MEXM`/U at 3@,R5QOQ&>SUW80[[&:U]K_W"$W08.73PP-TQ[[B](-J>?&[NMU*I
+M2-BGM&9'HC#H=7:%CI7/%@>\<HERUDUFXZ"Y7;FQ'MI)TJ+7;9V6!'@<,T^?
+M1N`%&24L?+L?CCDQ^Y#\/WU.K4V3BW:ZU.8Z%'-`_P3AMR4+'7P4*!O+[[P9
+MQ\KC'$-T9"#P$%*#8HQDPD)'@7:BK=:VZ,[8LP[OM9K02Z7Q&+ at V;LEUR\J_
+MGY0HGNSM%+.=K;"WA]&E>.(*S1PYJ%.]7GF_TM^./3*"6N7UN&-/^,S]:C:Y
+M^@_?5=.<(`Q$?P'_(4<XJ`230'OL3,^=3IGIF2K6SBA8A8/_OOL9T$Y[$2'9
+M9+/9?>^M?J0Y+>]!Q.7^(&KKUE+<>5`=P^J[I\3GFT@)64K*.5JZD\%=G'4D
+MJ5QRIU=(%>*S%X6N)EJ/'_*]'V5 at R`IN:2G"`#$6FXDGM6-46\=IH`]QI4H-
+MMN+C@%T6AGMAN2\@+[!/P$!=C'J\PW.9J[SU(YW3'-A:)VT:V?4 at NW;JM6XW
+MKWCKO`;35QQ-`O8']@8NG]M8#B>LMNM'/$6DOV905?H/SP#EN=Q'GG$AS'B&
+MJ#8=AA,]'U=TCH=TQ6('T at 059$`=3/^7&?49D+&B"P*7`]P6:W67#DNJ`<@#
+M2!P at _1#]6X at G\XSZW914,;_\K"<)D<]*5O<1'+;]AI76>,SP>MM.IM/%.RRY
+MDG'&PN/*$24J87VVZ0623Q-4^VE\F^6$)$(*!1=>3E4#W]8QG<3L(D0T\.N9
+M0#9$WS_&Z-WM+O.UQHY?MS)*O8=7)\1R?W<.QN=&@O!;?%H_T8NJSX.P4F3`
+MEHD90+:-<-2>E>,N1EGQDI$D4'@;Q'X?:;HHI72I,!$;H9?`J2^`^D7ZEI%Z
+M>LNP>S6G9J.\W7Q.3$\[+9$8?'JO/6Y!/28TI])SG7PGUGR9!,`6U`C\%L[X
+M$A1G,!4<Q3ES;I-WTR5/=;*J:^N at 5NH=K8K381/`1U_DUA28_`'^U,=I]=?D
+M1X`!`'MYYG(-#65N9'-T<F5A;0UE;F1O8FH--"`P(&]B:CP\+TQE;F=T:"`Q
+M-34Y,"]&:6QT97(O1FQA=&5$96-O9&4O3&5N9W1H,2`R,3$P.#X^<W1R96%M
+M#0I(B;Q6?5!4UQ4_Y[Y]?*LH?JR`\C;/50.[X@<(J'%6W$4I:OF(9)>D<5<^
+MLAA0JHR1M!H2Q8]5$6M3;6JT$U-KXQ!>+='G3,W85(<ZVD9C4C.V5J<FK5A)
+M6L?$I-9]_;U=8C33Z>2/3M^9N^?<<\\]'[]S[P5B(DJB5I+(5=T8:'ID3>40
+MHF_F$_'NZI7-RNM[?_@^+,X0R4I=TU.-NYNWQD"^@;'QJ8:6NL[*["E$PUU$
+M^5N"M8&:C^9?/D)4/@-[I@:A2!J7<)8HL1GS,<'&YE6]&?&?8[X+\W<;EE4'
+MRD_['R5:`/_4T!A8U137DO`;[$_'7%D::*P]<6KP'*+26\C'WK1L13/RQ%?Z
+MKKG>M+RV:>G-;\]"`0U$\>?D(*5C9&!8I2Y*)3(N8%PU1[C*N"LWDBU\VK at H
+M38(W9W3 at RZ$EM(XFT5GX/D,R_80.42%[H#]!*6S#RI.TB&>0A[TT`%ZKZ>_\
+M&-51)WU,FT4"-9(+UDZ:`G_IM)!ZR$;U1IB*:26%J)T.8*V,VHVSQA5$FX1H
+MRV@];>/1D#OI*%WB!J.',JB0EM)!NL`SC0.PLR+2;$L6LIA.;OH&S8?G*EI$
+M-?#X"NVC<]QBK#=Z4&$LXDVD7.2UGPZC at CL\A5ND0NDEK!2"WJ'W>"`7&A7&
+M+XQ3B#.>"N#+1UM`';2+7J4CU$=ASN8R[C2>-I8;1\B.6$%ZGC;23GJ9?DV?
+M<Q8[Q62Q3'0AMW3*!IF^*Y'-;N1S at BYR`B=Q)2_E%N[FV\(G'3::C#TDX&LR
+M(AZD8_06G:)SU`O+!$[G0F[D'M$II4@[I#WR2OEU0S6N(;_95$XK at -`FZH+]
+M^W2)KM)M^@PU6#F5,W at BYW`NEW`5:#]W"4FTB?VB4_1)<=++TDE+4OBJ\2?C
+M4Z`REK*`<2X\NLE#\U"SB>!RT$Y@=8Q^A5Z=`F+OT1]!'])';.$4'HY(:8AC
+MXS'\,,\!E:`N+R_G5T"7N5>@*"%$MU0L;;>0I4W.D5N,AXP<(P_T.]0@`?D1
+M0"F7'J&9D<X]`32#]#0BKZ4VV@!<VVDONMA-)Y'!Q_0/NDFWZ`[]BR66.189
+M)`,AE<>C*Q-Y*BB/75R,3$IX'OJTD!]#1E6\B&NXE;?S]_@(Z$U^BWOXS]S+
+M-_E.)$M9)*)KQ:),5(C58B?HD#@OC9-N6D9;LBPNRT7+!W*JG"=7R2_*!V/B
+M8]^X>R/<&>XV+,8\H]W88YPWKE,"#:$IM`"W8#%J6(8:FO%>;*,=H)V at O<#R
+MISC)AW&.CJ/'/:#3H#/T!Z!Z&=W[`/0WG+$^U/@9ZDL`QE$R.YH:Z6@!SV0W
+MJJL`>;D.9Z.)G^'5H'9^B?<"^5?Y`$Y6-VJ\G][F*Z"_\#54?8OOH.ZA(ALT
+M+U+SX^(YT0IJ$S_`">D4)T&WI6'29&FA]+C4(NV2#D at _DTY+U]''.DO(LL?R
+MIN6<3'*&/%>NEEOD#?*/Y"[YC'Q>[HT9$],9NRUV1VPONE*)WA30 at U\*3MB/
+MZ9<4%"M%-UZ$T63!7>_B9OJGB$-5SW`*>MT"]+)QZ[_%:RA93!3?9P=ZM$\N
+MD7;B3+R(MR(/-_82[E8Q;<?-N4!%?$)4TC4:A9<LQ>@CJW%=;I:;T=P2&H5A
+MQ<Z4_G>N#^-ZN!"O,];"QXS?2Z.1V0MX'S(ITS5NK'V,^I!-R1@]*CTM=:1U
+MQ/!A0U.&#$X>-'!`4F)"?%QLC&R1!)/#HQ;Y%6VL7[.,5>?.=9IS-0!%X#Z%
+M7U.@*GK01E/\$3/E04L7+.N^8NF*6KKN67*R,H-F.!V*1U6TW[I51>>J,B_D
+MK6[5IVA]$7E^1.Z(R`, at VVS8H'BL0;>BL5_Q:$4K at R&/WPUW1_%'B1*<#H!-
+M+DHT'6LT.[`Z:`4S+3Q:JNKV:"-5=V1-LGL"-5IIF=?C3K/9?$Z'QK.KU<4:
+MJ87:H*S^[>8^!:;E7L1V.NK-_&ES4HU:LUEWT6*_*06>\&I2P*<)OQEC<)8V
+M0G5K(Y[]T/KE]`O)L^6^14W8BP*UH2)`LWEN=.HW9X$MF)54*'`KVGQ>C=M\
+MT20BN4>KJ%4]IL:_1-'BU4(U&%KB!^94[CV4ZDKUJ`&W3Z-2[Z&1KI&1B=-Q
+MU+IFN at V@''7.<LXR^72;=4V4_W5M5/_.\<2(W8DKX"7E]W!A,Y):C#0UI3H2
+M1$6N^>9/;3Z%JO-AAL_'J+)>BY_M#R5/PRY-MB>K2N at 30J/4OAL/:@+]FAA[
+M\B=DBF8[[YT(K/?+.HUSE. at 47^K].7.[3V>C32?WJ*,43]*B)[$\WCP.]6[L
+MQN1A!Q29-DB9#J4(61>9?5-"2JBX)J04*4$TW&*/<"S4AGS9**?"6X_?1[TV
+MS>5+NR?6^GS3X"?+]&.)^`GYX&%)OX<E$0]P<!=&#D<)(!I;ZBWS:JWN-,WE
+M]@$2G)_CI5[M.%#T^6#EO)<I^.IZ:W_.$Y"S,Q-"=M1+!7S`A2\4BLY4FW8\
+M%$H+F?<@.M>9OJIP]2MTBCC`4=&YM32RU*K:TDR%:E-M2,OG1JB).%Y?M%>G
+M2?\=X<GW(SP%V4Z.()SS/T(X]^L@//5K(9SWGQ'.1\YY)L(%_S^$I]V',.%_
+M[A@*XW4:V!">$)X0^ZFI>>#+C2D at NX"`L4"\1E4FMQ"M@[Q/[B&[7$DV\!*,
+M=%.V7"4;]I1(HZ"O)'OL5NA[(KI"<\V4+2MH#M9R3#F.X`,<_C9A%,)W#M95
+M:2ME at N>`3X`^'?ILS&VB(+(_PF->B\I8<X+;,=RPMR-VCOAR+1J3:(0IFWYQ
+MLK)P?[/>Z(CIB!7#=+'YT)R,H;H(@:7H8A/8$%UL!!NLBPU at R;I8#S9(%VU@
+M`W6Q#FR`+M:")>GB!;!$73P/EJ"+5K!X73P'%J>+-6"QNE at -%J.+[X+)NO at .
+MF$47SX))NF@!$[I8!<;1&6'F&C8GXW(QOUW,2B8K>=SAXXXQ_&_FJSXVBN.*
+MS^S>Q]['WH=]/M\=-N/S^6RSYK at S_HI;@]>I7;S^`D&@'+VCCIV+(2:`^18B
+M#5`*M:T8(=(6T0 at L(%%;MXIO[9IS0(4(MP0*:MJD#8UH at QJ'JFJ=-!5)R(=Q
+MW\P>A4KN'_VO*[WW>[OO-_/>OIF=G3E<%^;:890<H!U<!PS+2:X3[F>X)T!_
+MP/3KC/%K+@'Z`O<XZ)>9UIB'F=[$/0EZ*=A+N2[HA3`VX;I4+,AU%JX<7T,]
+M2,033`\Q;91=/>*U'O&5'O&E'G%OC_CE'K&R1ZPSX]_`7D'$2:833!?*EBKQ
+MAU7BCBHQ4$4I?X%-KXB;F,YA.EMV1<7)J/AJ5#P9%=NCXJJH6!`5Z]RX#XX&
+M(OX6T_N9WLWT.J:7,RTQ[92=Q>*-8O%$L?B#8K&C6'RD6#R'[;"=%;%9MHV*
+M[XZ*1:/BW%%Q=([X"KZ*[-BFVI%I'%_%X)T[9R-)X4_5F`?@C@;_5&.Y`!^H
+ML2#`^VJLD-1Y\6T4$Z`^^#T4PZL`_XP&=?3^C[B;HW at 3=[/[MY&$@X`W5.D<
+M-']+@]]K\*8JK0%X796*`:ZK4C[`KS1X397F`OQ"5?(`7E650H"+JK(`X(*J
+MA`'.J4H'0$I5)@'.:C"BAC8`J&IH'SF/AU&(&X+P>]68%YX^J\9R`)Y18Y4`
+M>]38(Z0NA'>B09;CMO0[;(7[XX`]@/3=-J,!YM^$!IA_(^YF]T\#4O]3N)O5
+M8CV<-VF[+GAGBIVJU`1AUJK2?("HJI0"K%:5Y:1.Q"N1PCI[#"DLPQ5(88V6
+MJ:$AH"U50Y.0?VLZ_Q8U=)W4F7`S"F/:2D%!QFY4 at R>`79H>E7!Z-$+I-RB!
+MS"G.0S(;E2)80R@&(4/*"VCCD*]*1P'\JK0$($^5Y@'D:@/@T2KO5A7Z+IFT
+MNN>Q`X58>XOL at OB?Q0CY-%9`[@Y.DD]`[HS32:"2#Z44#LK9Y!_2)'E?6DBF
+MI%+R=\E,W at L%R%L#YV at FZ`U at Y&61-R0G^:V20:X')\D$S+=+L1/DHM1!+L`$
+M>5E.Z;!L)S^5RLE/%"L94C:0'RGT629Y`=H<5XZ2YZ'=<](&TA?4GN^7?60?
+M3)*=T,^64`[9'$KAXV-D4ZB"/!T&4R7=04ANC#P5/$K6!5,"I-LYD.*P;"%?
+MAUS6*//)2H7>FXG1(!&>D^@ZM55;V+9H:UB/MK!MUE:M3=H:ME9;KM9JZ]LW
+MM*5L[<@2LB0,W8V1KRCY9!%$&E))#4U6)=4*"U\62M&B109IT2K(_%`Q(8J9
+MK$P:OV;\DK'"6&Y<8"PT^HVYQARC2\@0'()-L`IF01`, at D[@!"2X4C.WY`($
+MZY;+X*!@T%&MXZBF_RSXF7%8X%!3G8?K0P+W'9"#(`=`]H/L!?DFR!Z0W2"[
+M0':`],W<&J&MQ[D^;L^H0S/W<+O3#W=S!]/606Y7VMK%[6!6"I#&!$PV(;IG
+M&<;/>=P[:CVU&8N=U5^MGT6UIW7)@\OSWQK,QGW(Q+G#WX/_^_"/<Z/#"ZDQ
+MDQMM'IY'M^SC7"57WE`_SE50B*X>QUNXRH;E]#G>4A\%6 at NCH4&N`F at H1@%H
+M?#X:I#0TR.<S6B^E)0<&&^J3 at X.,HC^&!AAE0'^,48:TGB0(`#W)%(!F,".)
+MT22#F=)@4C`>[D8R=";+C.6UXV[*PMU>.^O,S>(%@T!1 at I22+`D"(1DL8>ZB
+M!^Z0G[F[-7>W%@,_\(>UYG[-[P=_R?_3E7CT?VTQTG^K]PP]<K4'&A(@[</]
+M.^!4N;<C+R_9>RM]%BML[^A<1_'QQ/"M0*)^N#=0GY?L/S.+^PQU]P?JD^A,
+MPV.KDV?D1+W:+_>SD]I(VZF6(_\1J_??L5I.S=+9*=I9"XW5=F06]Q'J;J.Q
+MCM!81VBL-KF-Q6I8O^+1K0]=V[=MTXS9R[`5L0UJ$':S-OTZQ",CJI-S]`8"
+M/P&=D?#(K-<1GN=\)H.18.058!5;,.+O6@:?3MN=FM;IFC;'QS6MCND:5%LS
+M74.E-%+F]#N+0(+ZOU[^_$7]NL^.7>;?_J(0OO'3]P:X'+P(>5";7'(>G?5<
+M at 9`>C]6(=#H;\EB$3F?$:K'HJGW9V3[7)9O7Z[ODWQAGP5JGVQH2];=;IVBD
+M:6=9&79F9%<CQY72"(YG5E955I07%0;R#8'\PHKRRK*%[BR7T6!,QL,KS!:7
+M>:YA433>'-M^H/'0O7-R9$53EFC5KU):V_=M>/%08QODM@:OY9JY9DB(R'!.
+MPCX]\NKT*5PVXM_X!,U at TG$;A5NOET8R_5G^-?C#>W:N>0JQQ?+TS+MX&M[+
+M@@KE3"XB6$3(7Q^Q>*WBW73K^_FCVM:ITLABS!)DR9Y.-#8FJ-Q(:);6YP&$
+M^%[]7N1"VV7K2]8QZR^MO[-^8M7S=1DX#@0S<N$KJ`#V97&P,\$.("MH'1Y#
+M%FS^V6'K22MG3>&KLMVNXWF739]IO>#&;IL]A;O'^&$=UKFSPM?>C,.878NC
+MVEJHYD?QJ2_P1R4EI1$4KUI86>$LAXI"%2N"94Z7NRS+W_O"ZD#86^ZOYO0%
+MC<]/H]*5._FL%MEI=I>_\WG/YF6EVGQB]>`O0SVR486<(T0XHRWBLGBA*LZ[
+MV5`82[;7X[WKWWXX/8\<4XX'Y:F%`F54/BB0XR'[])-+&A/W"T:%[TAHCZ9_
+M?K]\/)W/^N_K#X%5`/;?Y*YON[#!;+#,,U6;JLQ-6#$IYO7F+M=V5R_N-_69
+M>ZU]KKZLUU`&Q_MR!),78;?9XEZ48;&8#SMF'%Q.*$,03"9!R"DPFS"G"UC<
+M=H?;(N3H?#K,_<&,^)!WQH=]*?Q=.<MLXG7Y3MXVIR#@L`M!/ABT%Q2EN,ZS
+MLOU9QSL.SI'"?U(#%PO&X1!2&+[CN_EQ_*;OMC.C.HQJ86[7U$QGTP^)C at M\
+M5W22PTROK at 9T5E<_XYCP&&T+2O3Q0[8%GA*C0S\Q,6%T@**?`8IC/L!C^!BJ
+M<!F>BZNR_!6+,?TPPMAO,!JR7-GN["P_YH,3SO%[_R*\W&*CN.XP/F<NNSNS
+MMYE9[\SLSMYF=_;BRWK7]A#;X(TG"C%-,!"'2UCL-23%QG&#($B0F$M128B)
+M5(4$@N*DU'5O;IJJ150V6=0JO2 at 83#8EJ&HHM!(/09%`WCY0BZ;8.^XYNW9*
+MI$I]6<_QTSF_\WW?_SNO/Y'T/P0NMH+I-9T=I>>VM[,,IQE:TBZOB'08O?AE
+M\#FX8<2,+NKA^%'RF;G"Y'.XII'>95*#O_K at _N@ZM:[*"C3(&4H54S",_"?,
+M$!D2;\!&]2Z3P^WH%X;M1QQ3=I/)\;QGL&:_YPOAGO!EC9E,8+*LJE1"9M0(
+MF:[F76E*B0ZF&L;2@$WKZ=WI3]-D.BTS2LK*X-4IKU>V!/)@UP=.9YWHJNL1
+M\_B.R2:U(4/!(K7];%-CJC"+>-TK?81`HHQ at B^UM1;3(Y6X5.<0.+I"T$:9F
+ME!<<Y!)?IC2*2%QFMX#^DM4`@TF"@L0-T0M-C>5<,7/*>C73&L[B0Q\,W3K_
+M_)X-/S&FC+G23OS\D8U#>B-P>E:]N?<[:W^F$:[0%N+FEJ"+TFK673U\JLHE
+M:/WGWO\S/G=P=.]8;8NAE;[KJ1L]<>,;=82!O+)ZX1K5!QDBI7ZL]^[D#]@/
+M\*_XOV=_VS\2'%'>C>29B<!D>-I]1;@L_DV\(\Z+O"`(BACI<#\B='@WB)ND
+M'=(^]Y#XJGW8/2P,B^/N<6%<G'9<X"X$IL-%7A0E2C;U662S.0\:?VWJP_.`
+MUP.J:'9*HN2RI53"M<='(Z6:0^:5F)26<`D"UNGX9N>`$W?VA/)X_UDHHL)L
+M,<?>R]VJB+4=.A5B32%Y8NS,;!&PQ=DB"F2HPQQ&0G;-35PDAF(9YZI$7FF$
+MW$6HPT at H'N/8YH>4.#$"3,YXRM2J/;'FC7-_^F735H"/'EL[F'FI^T=3QM5/
+M/K]>``F*.K*U33&4TUO&C>\;?_G[Z\:]S4V[&U]M^];$1=`%UE[Y(U7)'1_T
+M_5&HP2J8A<?T[#YNDKMDG^(N29\YKOMN2[<]]Z7['JO);N+<=C>_T;;1TV?K
+M\QSSG;2=<IQBW^)'_..>O#WOXY`^J[)E?68C)"4&4C`*<#'E<E59O#U.I+YH
+M.+*HOJBZI+XEW;&(R__26D at 4.-9LJ@8J5!;/E2<6M"7G6Q-N:U6Z\#W at P,7)
+M<Y\8/RP- at 7]7/WKN3GO_W2<E5J.XX%/$W75!WJQ=SAN7C3M_N/[M%@#`SNNG
+MY\)"^SQ;.3_T(*5`+<6Q!'9!3PPX7W*^HIY2QU6J.;XJ_G1\1WQ?G+)B\%A8
+M-FQ*R-9L!/,`3Q[OGG0GG2C`\&Y]62`0YNQ<RHJ'4S',DB`2B1BE.V3%;O=$
+M=5F2%8\G&M2CLA+_00QLC>V*'8\1,8ADHJ8JF(%OG^WP=5B=VE>0YA&37*X@
+M>3-%R8M$X\V4VKS2XE?E7U!'A9GVF0+Z/E3,E8IHW`.VK0*O:=D#]+A(/2@;
+M4R at +"R[05$(J(X"R.=JZ(IPE3S?&?_.OWJ8S!Q5-$X;//#KPT9?;6M>7_J$1
+M[M#F16,:WYPZ$5]NQ/"7?U7J/'/<8!])C5PU-J$@`^4<>Q]J*(*=U)DA!\@Z
+M`"8!"3&J2CHKM'3.[U=86K:Q*097,#EL">>!J*L!W2O*2L5`4L"NV^'"IMM^
+M;R-L45<@0S(1];^*F47QSA[Z+`?QE!"*@ZE<QHOXL/-8.RQ3,X72`U`JKFK^
+M?SA at Y",4+>$>\K7&V,3=+0WC>P.:YC[\TUU[2L%%"MF at RP0I_.Z=ZA8C1IP8
+M*W6.CQB1K4VX5M'1ZH7K)AKB2&+UV*2N]?&O84>Y:3!52]&P6UAXNM:#>?''
+MR<<=6_@!;H@[6O,._BXW4N>,MLA*-BPGY%`>^'0Z0LM,GTVV6E'N,'TFE#M>
+MHIZHKT]&8[&H3`@A11'8%$$(J6I:SH/:2>O**S$`U=0WH:1=/4D4/.D4"AYV
+M:A8&.09#I\1!5%(;&HP\S'4T-K]*GR73\3!<&H6O)Q#+-\$`RH`*/;<#N#D3
+M68XBL/I"`60.SP>5A+V21%/G?G[WY:2W-?H"_N'@8RN-3W]K_*+P(7Z5N''U
+MVM;Z5"6+WC,N+6#&KN9@^U]S?A[-QC6#QES-AFO3((7?K/@1+T*.`NQ!3^G5
+M+'2<&D;9(BS-/BXAN^$O2Y&D`!-&<%M$0H02ZYMD16Z,(L_CVS$I!=.EM>T+
+M9!78#."YUZ#NWI!^4`QN--XK)0TH3\<>7J'VX(5M:MNV;24-;-=P5ZB;N-D=
+M=)%PEWRP9U[9M!Q-;E#N2EZH=P^V>]+#.%MD*[JZNG!E?Y23$5TI3(;5#6[/
+M8_%\[-4%67%"1V#B+O&P>%PDR\-8=K)C)#+_6=F[%(>Y0 at XZWRO!>H>VWIIB
+MBS.HRH!%@W]M_^@ZEMRL1#>HF>5PVA8.K5^UX_Q<=]OZN=X'1ZM&/KQ_OG5E
+MW8]GC#0\`\Q]<R\\0QQ;T.O\#"!HF\T<8((NVFOUV;S!5?0PS;QA`5R+;%>1
+M/$4U3#R+R7'D6DXE$[)%C?`M\%HBX5$YA@#8(F&9)\@X9R7]2G[AF)YD at H$0
+M?)PD^4#`;Z7?"H)@2`V!T!A/TTPH&/#;K`QMD<.,-:2L].=!5G?;[3;:@EOO
+M!^.Q8$`4+#YYC./1W58KX21)H+M-I"JHT%.J7/[:R@,$_I9N06V7WSCD<'UM
+MCH+-+V<9AIT/?=5BD",4O]@J51YR(+<X;&#=@ZT=`H4%<`FJ6*F!7`1$RAD!
+MU[Z]'4_VXR0XR8$W<7*@LW. at M+F[QVDPS09%=QXQ%`UT=1&%#<LLVGPG,:%9
+M,B_.O_A"!U0/T9PC;L]UDJ?GG^GOI;3*W%FX09V&:@I!Q5_2'XNB&_`Y?6Q(
+MU,1!V*_?IM\3:2O#T/08#RN')<18)=%#>B0K0V%F][,RERW?1TA5S;+E%F4;
+ME6%+%B<BWE$YB.[(#RT"48:"%D&D%4)1")LU*>BB(F!NX$9((QXO1(KT%PE_
+MI;__4%WVL4V<=QR_Y_&=[\Z)S^<[QS[?.2]^3W*Q+R^V$SLVF(PLO(1`A at ID
+MPQ!@T*3`0B((+6PMHH,N4L>0TA$H'4M5M**IB+5=U0`JM%UI*1`8[Q+M8!IM
+M04#6M:)A#'S=<^>$%%F)[5^>/^*OG]_W^_DFQ10*'V2SN9Q):H]D$N@!\QV&
+MS`(;QVLNSB*,EED\B8U'CRYE&.A2YB35Y=0ES&&TNZ=A444`O`7?-S7W@(/M
+M4^(/-S)BV7-J);P0,;3.-ISH]!.1AZ_")1UM="3"QA8]F($W/?Q\47`RD<-F
+MQ,T-B/_^@]XP6!%6C`VDE^^2#N.'J6/6$SQ!XR1%L4:!EHB;V"WB!G4C_[[E
+MGO4>/^JX[Z0IC")(BLPWLD8;+="N`>L`O].Y4SK$'K*]([SC8HU*D8%1['2Q
+MH;B8$T<-]TUPON%)`S0LY'2\<R\P=9B@::&HN:R[1#DUJN'=2"8SP7>:%!FL
+M.^/C8U$6>CT&K4-P-5B.8]SC'.?%L7GAO[U^<UXH_,1-$!L^?_ZT>E(=.O/!
+MB5.@`;B`]:5_ at R;0K-[NO_UUO_HUL?+XL/J>^M[P\<].`Q]H.'/N$;_@)]$>
+MFU#Z[DIGIH,%H%-<5]!K[Q6W(K3=*GY!F%;`'?:=XBWXA3`*[MI)IBY/\K;Y
+MD&_Q;=ZB.LGC\S)%+J_%:')524\5FX"IR>3AC8K-QJ-_GS(L['(<=5Q#)JLS
+M'%TT:&$>9[B,!G$ZPG'Q7B4C9#7:U5Q+MUR=;&L?-03P:-U*<*U$,./[!4^G
+MEBS:DHJJIN6-/_XY[`=&8%VY,7/H7;1H\^"[P4G#+[Y16)Z]DMU$-JTV]*U-
+MY47^?&;YF[$`JV[6UFR"YUY#>I1@,K8_G6GC7^`&S`:C>:L9&NKT=<'K)-KG
+ME>JD8I_7((DE>%#FG(+C*1[P?(H3!*=3X at 2)=S"\771R<H?8*-J#085&JR38
+M)0?E7<@X0N72H+XZ;T\+-54@<.O5E;CTN9:V:%\FYZ001N))#=URZX+,Z05"
+MD<.9&C*)C2DDR-BX1CD?FNA7I)%$?51;FC&!,+U7Z2*Z.YI#19VP?_BYT8V+
+M.L$KUH!+S:CS8]-699OAI_O=\8&?U$2(J3V&OO4^@8[(\__U>OLT6_:@8(%5
+M<)/:M6HF'H''5GZXOG%=F9*]AW1K^OXZ+A+;L#B6P+Y)!QS^I_,WF)]AD'K<
+MOOS+>;>8&]PHET=S&SB8KI/BRX%4CF%#$+X53T>'@#G-EH?33DE<[I+*)?24
+MMFO#F>7F4IGUFSQDE`0)#_"30/:`4K_9A./%"F_`E3"=,"02K"0M_CT)R#NL
+MK,A=LD$6DW&LZF4/\-Q1V"X6LL[ZY!"`;[O[/D5&U'(W,VLD<S?9 at FX>>O'#
+M:H6<*9/1EU%7%TN)=T3A[BG`ID1$.H*(L?KDHY&QB2CDC(NO*0)CO54!B'VB
+M$00^XRR40T9D8,5`+[S0[4&G]"GI!4WUU=>VO]@[J>R76SYN;;U\M?N\Q2-2
+MJ7C9F9<ZGHG7??#RDZF>[]1O)STWJ901Z1*!K@??@*M?_OUWLQ<F`JF&I>WM
+MO]T!\*G!$K5A]S^[6Y=45BUNKIFT]D^[U1&'8,$)OX?8B_(:76^"1O?:@;V6
+MKEY`=!*]M@$;WE<PA!_'KQ3 at T.'`&,K*D%P'!ID\R9Q/_<4)2IQSG.W.010;
+M0W!9VIHV2.ZC$('68M@%#T`<#L%5Z0(R_RPU:#YK/<H!A5O,=7$'.!R9W:J_
+M:M3B.`B7(IH:16H)XL-,)CF2'4FB9T&G%-14T.;?3R+TMNJ**V-!P+MY#2&#
+M.;J*(F6M"+9(;PP_"^L+^V;MFOVK;.#IV3OF]//U1(>Z[!\M,O[@1/>,2&3F
+M&CR&RW,^RV7D93TC_5@`VYSV=4K'"R&+L6"Z:9ZTUW2X\,M"$BTSZF6.I<C*
+M/,P>B=.2S^MUUTG^-J_;P>"XG^<P2/>X:%2X`@XW8PX)9QS`H>5?*4X,EK at U
+M*RL-3N0?^BCC]PDMLB.>XT;M0X$<&SCL&A-'?Y!O8[:>&_GAQ?5S_#\Z<F=N
+MN+47?+AT\K//JM^J?]S<F%H)_T=T1/"&WNS<5Y[8<Z!]/^SYQ5P4<GSMLFRW
+M^F#;MO-KWH3[UR;S(\6:ER'._/XJ>05]YU'LD_2Z_]+`Z!0Q$=AE9V5`+/>6
+M^Q)LPFJB3:809ZY0PHKD<H6X<KE<=#I3:&*F2#+%55564;0HX:9PR%!%FIVN
+M<F,E"'AY%D0DGS4**Y4*F4Y712M198B:*ZP5;EFV^JU6?]1?&XTI'U\XA^1(
+M*7K_'-9M3-&>T"II\J"?K$Y@&A1H#Y8D9#;Y^&]*)L8!09<0F1E?P\<"09T4
+M)B;(_R;`G`0Z>@'M#-PTH]9H'+'>AJE\1^TTN&E!O9F]R%PS4K(X':Q7Q)!3
+M71%3]S%J7UR=[:I#5RI"NJK-7CX;@0N(-VR^(L2_I%!NBE=G5\-7N3)GG,]'
+M8$9:BYL?A`SO/TSCYULKJ.I<ER4&D.8)[%SZUQ>9RQ9(UI'Q,BZ.Q]W;\[;G
+M[V#Z+;124EQ='>)XPAC&<5L);\-M86!#=,/U<6`#!R0.Y'&`&^2,"F'#C>A4
+M==AMY&S%%$87BOFTY))0-?`%ZS!,2L0#?DK[&^XR:<?PA-^UQH^^?.!/UIL2
+M]<JEC]@+ES*9"RQR-TUF77A=]?$7VI0,4XB`4[)F?VPRDT'O!'TFLRET1),?
+M10QJ#[4T>$SW"=498,@%3C2FQW700&H-2;OP!6YWBZ<V#%:H*T-3:^"Q95-8
+MRR?[IE87-D'L-WM4L'9Z8SS;]-/"$"^<;EGF3325UJI8A+$XZ\$Q.'=*C2$2
+M(>QEG,>AGKJ]RE?!TFA at _H.Z.WND.T:A:D*9 at Y9H`#1W;(FV^6.V_(A^__O4
+MD["#6(V9L<:TCSQR'3[OH4Y?-S_O)2DS!*R9LS@<(DG]#)UU,I9S[J\. at KV8
+M'A#)68A at 6QJ73_U*8UB4!+.T)>:M[@(]/FWV>E#P?Z;+!;:)^X[C][_S^W$^
+MV_>P?8X?=WZ><6PGL4V>OI#B/"`TT#AIG(526K*8KJ+N:)CH0*$/(@H3=.O&
+MH*@=L"*%T15H20E[15.A(+:.K:B3I@*;@*Z:Y'6B]`78W?_.AE:R=/+)TE__
+MG[^_[_?SW0:N3(TD/-E?5LZK#G2E\K>NMD=[Y',7P7.]\KE=(J=\[RKR+*?Z
+M_57]L[Q2A>@)1#[68#".JI3RL2?!D\<.UHZ%IQ*U8^^=FI22!7I#!"2]YD4'
+MLYY8?@I<J9SOB;8KZT;275^MA$S;]/55[&/L'*)'1*03-H+UO9E"9B\UTS&3
+M4=(\%71VA(U!/N at +!,,=X<P2L*WAY?BOP.'XX8[#F3EP(G0J?JKC5.:=T/GX
+MWT*V3O4^$32W*]P67.$UX0#OP_46B]^OUO<FDNWZSDY.(!(@D>@2FDT<)A`"
+MF!)V":AP$GU8Q+LTHNCDUHE_$:^(F'@277VL:Q'DW+&+EX at R<7.L6+YV07*#
+MHJWJDVVP+Y0R=]%/]@CX&<M4H<8'!6>6540W+@#^&@22,$I=4'XJGH-1FVJ4
+M>*?69!GX8YZ#@I2?@20`GT9LWA4=A?9`Y?M`!YS]J]/=&HT!-_<WMCYP^<"O
+MGUK/X`8KZ6[KK6\<%6SZW&.=F<$?@[FG7)8`B)"1WF+7XHL'5OQT=#CL-A!:
+MW!QF6C+919,O=-TW6R%HMY:,9)V6I*LUQ]./%3$=S!T>LI``/<`(F?HYL2>G
+MR9';J%GF#'F&.LM<)S\CM5[29XO4C6O&R7%J`PQB#<$#-^_B6WEGG=%M<FHQ
+MMY5'M(-6->9WV?4J<2<-:"F#M7[<*+A$-W"?1%=5$7KL&X:&<\Q4N1#(^'RW
+MHOJDS+E+T'84KF=C at X4B$3B at H)J78P>\:?$-%H;[GUAT?SR\9/CU]RN?GEVQ
+M.;V_KCZSTY>]?'[_QP]3Y8\4^\NEF"U2N7&Z4BF)3>L5E\2HMD'*6N'K?V%K
+MH?ZDK-TMY@)4Q!/V84/FO"?O'>*'?&L]:[V_I4YY3I/G/+=X`^D<\H[RX]Y#
+MI-+@!0&U at Z4U1N(-)5`J:8*`2J-[W?I``.642AW:*3J\G["`A0.8#5G%=9#K
+M)%E)J0OO#>_N..>X>0FF3$U253G%QN`(X$=24G%,;A&T+!D)S^ZA,&F1TK at F
+M&S39A#3RZ(N_6](2K$NC=H?WH8&?;UG>S#4$'MW:/7#Z%M!>JL?.;7XDN<SB
+M&=3R9(HD_SH]7[GCHQ;RVYM8X#C_`8C*/0+NH^(^J`$<]HCC8E^4B(512DE9
+M*;(?&46&U"/&(6(D/"*,:PJ&<:(0+@@;PZ\@>\*O<6]S[Q)GN+]S'W'_"7_!
+MW0ZS!,QLWN68XIV\V^4Y"7`QP+N="@P%"I[V.2D%4*IPVNQ`5(-F-3X8"O%Z
+M_FE:8)UP'=^,ZL2(-*SH`JEK$I^WE:\C4M6J*861E`)C]P)"?%:Z`V3%R'LG
+M.P[/U?P;L4@[QE2916X3.%`G:RN&9 at OYOL>#%.DO5.+_/K`\$VQM6PGFXMDC
+MCVYNB2]]\&>7AR=MX(9]]>[E+[TR\"(Z#.PA6P?8T.]7--P>%Q.JF-G,3[?5
+MU5?^(7$+AM1#+WL$:LD!TY1#-H at 9FO0#P99#<F`(&S&.V!ZT3]A_8]%;K!8K
+MSGJ[(<+ at +I<?5>.]C)Y3<YQ#RY:TG,D*WK!^8D6M4#<G?%Y.)SJD2?AX.(GR
+M-2B;XLW2M]A?HL^RY/6`."<-P0&)'O(ZM!8O766VFDI\9G\5WJWUMX^M.1[W
+MX>KRYVIOV^X>,=@2>VC3\L+NRI=H'&U:-M"J^!'Z1Z!<N[*[F'0^G9^)LF+=
+MOO;@?X'R>R=V'7H53,MYX827=BJ?0T+PKNDS.J#1:?4VG5W?HE,B(2*$!A`L
+MC;A"K3Z,5X88UN)A_0;@53[A<:M5JE!0!_T76N\:44N97"87+VBP.705$H[=
+M@??Y$[S7'8FRJV&?*1&;WK.998^`<'77(.3NR"<;DTV2-=#WG+5F&>9&JM8A
+MG9GTY&0T=WWC3'=K(AOU40VIX\?;"^5W$\KZ7G1O?NG.[QQ9-]J<%:/<$HT=
+M;UE5^2)?WKXVKDX@"B16&<;>A_^K`6&1022'?"4>,K&XTU"GCZC22+^;=3F=
+M=6R$3A/]SS<9LZ&AT'#?FM!D:&MDZX(=Z6T+7PH=BAQL.IP^O/"MIKGTE^H;
+ML&5YXC93;X_;I<@R79D.;#&DCI97&9!A0(P!)DCJI2RW&/.WQ+4M`U&M/ZHV
+M^0=,.74NEPJZ44'EL>Z"`EF:79H:5LVO2H'4<.?KW3PGL%L&.PWSOQ".PE0;
+M'HJ]\\%8Z29,K\FR;1EANSAFZZ\&ENW2F+0^YIJ(RE7`+6VZ;+M6NELD+57L
+MLC3_,-;N^'-UO9!O&S):+03PBU=*ND`JG90K)'S6`SG>:`:"AQ1X\L+QU3QD
+M8.64Y4E6$P]&79YTY?I;VON6IS9,3SW9M_W^B<I1#VY_JS??QL9W]TQ,_?,/
+M/3_P`OQ0*/+VJIUNJ]7EY3B7:37[?+'_)Q^N/[IKX at BX@*J;\]//O+!Y>LN=
+M-3T6;C29=%B\?M<8CC.V2,_01ALN[%NW8]9I>CPXT3[?'4"5K#/HYA0HAJ+N
+MMI?/+ at DZ8T7%;)6%90\,(?/B1DI/>5`]K6=0+:UE5`%5T$[;&3I`!\-TF,G3
+M>:9`%YB)P$1P#[V'F:%GF#EZCJ$)C9MB at Q@==/!6YMXB*'B7II4WIUU4BO<Z
+M8&%SF'68RAU2&#6(!X9CKU$="M*4CG4(A!G:X*R at Y7A!@4FA*83ELG9-\L*V
+M:@LIC7UCAE)A0XBVMHMRA,K[4:PM2-7].B1?H*KKD)1?5Y.D^L:[,+F@$^S(
+M;!^>W!M+5]SI$&[K3A8ASUH3ZEA686U/:!K*\TL?V/9:A5P<,202^D`7^%^6
+MSZRVE#_L"N at 3B)P?<':H%G97/72'[XH+"<K-HD8#D3:XG"F?F9<NSO`NML at S
+M9@*CG!D-B/V?[K*/;>(^X_C][LX^O^?\=K;/SOE\E[-]ML^OY$)L)[DXKT#+
+M8`1(LAK:4E)`3&O0R$JJ51&"M85J=*/-$)I4D(!-2RNAP3I`:&\J`3:*F$3H
+MT*96&B1C52.A*8NT0=S][FR2H&J6XOA^R1]^OL_S^SS?KP$8%!2X]0&_2:>P
+M9F#F2`;6?I[RQ.RD2H3ZE!I2[T,3IIH%.+!E;7IAP>1ME02.97<?DQ<S:K6P
+MU\JE]G*YO50>E%U,K!6\!4ORZF+E<JD$?QZM,CK\W>A at JV3./I[7RJCV?PWL
+M?Q+YN?+JF]Y/32AEH,-4 at I+$H,A&!#$<240D69##<D*6NH7N<'>B6QH2AL+;
+M$]NE0_Q;#>\FWI6N^O[A"XR'QR-HU!N-A&F?UVPRN!"",2!V%^/0)]AZ#&&8
+MI,EK]F'.J!/^"Q8]P@`F;8J*,:WE,)O>J,"D0]X9AB'H=BT%+7B*;9"("^JC
+M83D(JU4#-=D\B9-UH!9MJH<8X:YV6Y9BS6`,X!Y74PG\NDTHM;X/WK90C at J7
+M$.VA/TA<=\6;L<8[<6=[U)I]_$.@\XB6H$N?2AEL=.O)A<_M9BR301U.$Y\"
+MSNR#KJ0QH^V$:O]W('5(GQ+5$Q:`P)M at 0]7YKY.U^9=Y4Q-C@^\XAM49D#J;
+M29WT\T83G'.UVZ36[1FUT[!`&"7BNC+20MZ&<3"37E;GLD(.)%8N_[J/NCIC
+M-FT>M>^CWX]=13K`B\IO+X8N<I>REW+X1&B"F\A.Y/#1T"@WFAW-'0X=Y at YG
+M#^>.AXYSQ[/'<Q;1+H9$3LR*N>[V[M*NT"YN5W97SFP,&3ECUIC#9:M,]5B[
+MJ8["9OL5RQ7WE&7*/54P#X8&N<'L8`XGC4$6#:4%*5N26T%[+LWA"`Y%Z"@T
+MZ'C&"`TSS[`R7VQUNB2YM2A+0L"LPXVN#C8/\JOJ7$.L",157F\=8=1WE+*9
+M$&OJ4F.*SQ^(A7L1 at 170LP)("6E!$8X()P2=<`$T*'1O0HHU]2(R*Z-G99"2
+MT[(B'Y%/R#H9_OFC7A/7&M/AJLJ=JLKW1^;+Y>$1*/?BA_L:62!;VM0L69XA
+M9\M/`--<8XRGV%*%S")HX&H85M=&T]+E<VMF'7(^)U=7\W+P+./.UPY"*]U<
+MLAT<R*4'OOU:9YBSY1O[MNT^G<Q7Z)6)5*EQ+[R_(3F9Z&K;'5Y9H3*$W;\*
+M'522ANS1#J$C'UK3TU`X]-["0D]$G\D8(EW at X;K^%YQ51&6(2#=XN';P96L-
+M66B5]7"W1Q$1N:R,.EE at I:P>+(Q%?.8`%?"HD-]L&Z`&/$.VW=1NS[A-Q?P'
+MU`>>R]1ESW7JNL=KH2P>5.4]&J%X^FNPUYC'<Y#T.$9$:Y0WZ#7.BX0HVK%%
+MVL>7:!^/I6X\5FE?@4VIN3VM+;`?5?1]_/$BZ8>?(H#[_Y">J)X`B/IX"1S(
+M_.2Y`S]:0OV`5V4]ZE%I#WF8AGJN?N'-B8J]*THLP?[92%4YJ!B&2#`[78>?
+MS(@/>MX1I4<$`B80HA'_A><+?%H_;?H//J^?-Q$P+E+[;/O($=<(I=]LVF7;
+M26+]2#^^68^YH?VM$PQFFJ!IG7F3`S at 4G9J7`@,^X%/,JO$-^.'BFRV3\^HH
+M/K&]JA^!+U!V(+DLHF5"I!%?LB?0:C at E0%S]$\"^0FY>J_P72!2_8UMK^]8=
+MO.<D.@&8RM]N?5*Y"X)3GVXZ>&-F^I.#`[?!G+;#A,H at KE9HA1O@]\KK+IJO
+MCX>^9=E8OY&9]$WZKX6FV.GZ:>8>^T5HKKY.7P^(^@C=3/?2_?1VW5#]$/,#
+MW4_-X_7CC(6D at A*9Q.R\C4D6&AP\0Q5XL8F1QGC1;#(:=%C$+G+)L-=A-NBL
+M^KX`0>FM?9PY*=DV8P!3CL!A at 6(HIK2'B\0<BAW8GZR%N;)F!<JSFD>>A9K8
+M/=J%!+756+/(P^6&ID4[[*)R8&E,:A?3A:HN+.)6C1D<#W0RXE9>+$&I%FZ6
+MTI("WHA%>U\Y.35]JF]--`X`T;5^X=;&H^N/G?WS=^F*C=E:D8E4.ZY3)&/V
+MC>Y0_E\//Z_\-4.G/SQD7U_4Q50].Z&>/9#!5GC+CBE;>7<YC/)UR?!SR,;(
+MSO"^,,R/X8NVZ[8_AJ]%[H;O1OX9?A0F=3:\SAC&@GXR at +(C3&",4WU#@7>Y
+M/:R'%0(4'&07CEGU at ILDK'V".>"W86R,\JCI,694HNKHJ)X)IL>YJF.",A47
+MH$Q[:CK!*%$-CL/+DN-3P;$IM^P6:2$*;43WK.U:_9UUWMAHA7I\\^4U8N9D
+M(%E:^&Q+BQ1[9N"7-[_YDA.E6[<]./.S at 5/H\\`=\^;V/BJTY(C,"MVSFT!0
+M\B6`^S?J;A)@?MH&=6&1MY4-/)FWG"$_(B?).^0,.4\:=!80#)(LRAHQ'F'8
+M)WO#/\($+_$^RHW9_9B?]9EUF,>ED#`QK++!7<$&37::,W%^R'DX*XKQ>6Z,
+MN\5A7"AUHZS9QYF:A](&9MF\D,5RU>1#DK2!IU"B6:LE1`N%)(I"MWBP?:RO
+M;7M/<_M6I[BAT+_P68:(%8NHI,+XY,:7UJ\MKAW=OJ7R_:&<(:/.P8JO[J$/
+MX+UJ1O+(/27F=M#2)O.XY7QB,C&3^'?"8+6C"=$A2$/F:[;)R&1T4KPCFMZ!
+M0ET`?S_7?$YIO`",OPHEW_<#_P6P\QQ]3J'@B;(AY!1,*!X4G`0N),UY(I^G
+M20N!<:A)X`C%Q]#G`DRHU]_:\R4!B/U(?"S^3AR+%Y653#- at 0LT<PMWC`+?_
+M!'F6_!UYB\3)8B%U`R:G\MQ]NF66G*6]I/HT,C<"'^=FO;0Z.L-++()"DO27
+M-&044OM=78K.'(PZ*H\BX12H1B.H)CR!8\4G06W6 at D`+0ZK$*:"=$CQ8T<R<
+MVO2-U5$J<^S5%8UGWFO_L</G)J05]0?Z.SN8^O6O[$BO.WU:W-#".XV$W4=F
+MP`"0C^[KR3=%W-[5A:ZN+=_[,.YV5OZRX_5G$@T-0D3.IM;MW7/%[K80J)_]
+M'^_5&MM$=H7OG?$\/+;',^/'/.PX,^/$<>S8DXSM$"=V8RC$"2]!F]U":*`M
+M`8)V$12T6;%MM]M6;&A_M-JB;2E];+?=(J&M1+5=I2PK4152M$7I`S6E4 at 7=
+MM at MH?Y15?P#22HG=,[:#J%2$^J<39WSFG&LG]WSG?N<[Y.V&-JK?(GY`N5$,
+M357:/5$<JH9$3P4;'G2(==.5J"&.J1Z]$C1"5<\Y8&-OA3%87ZH-02CFB(AV
+M:TE[1UN`TZ65?ZMH-V>NP^,\&KX#;\,+CG>AD:P9RTE(H-#O"`38?"X4%X,-
+MKEXETZTI4#0BR8(UN3%_Z9(OF$WV1_HZ[&U?'.V?)I\HJF9??N\SM=,3RR?3
+M;9FBK8P7)B/YKQ(G6S-'_3W7!JBK#CA1;U5&3!5O]&WDB9*OQ!-NAE551E6'
+MVM:W;6?V,Z>8,\QY9BY\.7PM?#OL%WBA at S#C7#S&GX_K\5A'?SPX),0#L>`Y
+MS%<2<L6MK)%U1>#<5`>/:(O"U%@T*GLZF<Y.H5TQ.7?*+SCRM0NG]':'G`%K
+M9TQK3&DW5QKW)I!1T+Z=.KE^11/NW5G"]Z"%EQ<5W#ITT,J:*8$$/21P><P4
+M&AE*-%F[$__8KVWJLR+=N4WX9._(A=T'QGK'=^Q^/54B*/+L\MA'VG+M8I)8
+M5\F1]G)[I8^V)-&<'=:RS[]*4(XXUEJZN/X>^6?R+'#/YRM%C,2$G%`(-\=5
+M):`]EF%2DJHJ*L.%H1(4+`3(]IBDTXKL&6WX*%UZ4R*D<_A>A9-57>E5WE1(
+M!1Y_/J8[5'-M9GFR>&-Y4B[..'3CS"QP2BA&2`LE at 8&;4Q#"7TH8=NB,)(%<
+MX,'8`GO&<3*+N^!5((S^57[7*>%KG&]P%>[OSJNUN?Q]K2\2U5/D69L(&FR:
+MJSV+=ZIY?UK&MDU:Y:4_$;LJAPK]49>]LE?J%.PU!S7\-I9P at -(XDX]+DA0(
+MJ9JIQ>5N-9M(=5E%MM\]H(VP(]HX.^F>R.Q3CV:/J[.IX]EO1<ZP9[0Y:2Z@
+M1UT)M9FI3*8GW=.3X5*1:+0J);N3FCKZ&LB6E+0NS7$IEAE]'0@'GJRL93&L
+MFTOWJ%HDFO1F(:%F)V7'Q#B1HS,P[64]E8PUFJUF<YR8,I(=W16TIGOTD/B"
+M^$>1%*MBKJ.0RUN7%^?%XDS9FE1FBMH5S9**9>V&"+I<F;%FBN4;FH*&83B4
+MG70#JS.4,).>G!%*C%!:,<II12BQ``)18LH"/%"EAH!\"`A`P<F\\4AHX`<[
+M*_#[\1[:?=)S3/<(;1G\;D^!X::])TA7K@^'.]/AVD7K]^X/[=K51(>#%2G'
+MO6&Y=A!O99X*17G*M at E)\W<9M9?P+">Q:<UEVTSGX-("<6#Y!%';56#M9JW*
+MT"?_"O at -`7Z_8`,>W6T,T"Z7[C+PX#JC:C[I?=(WT361G/).^8Z99]0SVH*Z
+MH`D!T0P&JY)NZ*))T@'#T$U3I$G:SML`AV&*>5NW+2:?KTHD21N!0-!\V7K-
+M(JR49(JF#2N9E\6?B(28DAB+T8.,&##(O&72MI=#/C5*<K&(YO70N)CL)%$L
+M,338Q37C=.=0<SD=\4029<]0N01'8E&XMN at T6^>W,64M.Y.4TK(<[RR?34\*
+M;*G$9*GTI"+,EDK at XM,"NT at M,NP\`['FO<2PT*LHB,PW>PTT;>>%'T;N`6S`
+M(`R)&_+.43+0CQR$P1MJ]/-H;FQ#^UZC]J&>Z"105=F?W&OW#>!M"35K7,6]
+MGHA<"Z3MD#?B'Y!7ZQ_-Y6JG+=;>D3B>PB?Z%,"1<P?D5_(OC"HQ at 0`,N6!W
+MK5;+B*+;L at A!`VY)R5OC'\_LC.A!PFIQ=FT"^.<W*(?R,'<=82RY9]IWE#\=
+M/BW/A>?D6^%;\KWP/=E+4;Y<N*LKK+?%VGWM;3$=Z5BO2G#L8FUM*8GG?9D>
+M'\^WZ3T0S[!!0DYTD\%85X at FW..]?)YQPOG\@P7)$$KB9'\N5+`NEZ[/-X;;
+MHE6VX%*<;KXPO`)&TP=G"-C*N3>`@6/3$(["%8?:G=2'&R*:"3:I>X6V'G5X
+M>.Q0.3:V#O0-4T&_G8[D6F1&H-XRXWU5^`KG*P[@_F0N4OO=^-$O[?P,_MO%
+M-8/)C"^\U?[F`UZS<=!@E/;:%/YL+",VB:^SNO2'?_QH]Y#K*N07A#?Y2<BO
+M@$3TW<KX/OPL_C8FNXAN;CLF?7[.1=`.B:4DC`F"$QC,(3<#OBI#^ZM<%7$B
+M(XJ,(*QFW6:%-_Q:@#$-RJ!78Z1*@1>-C2\IZ?3FNZ5-=YNM?[-P?Q-8FG+W
+M0=>[,P/%?0=*WIE+&EF;S:9GOS"/FIYFW>8*.`&")V"$<$,;D#B%W[W\G62>
+M)^[7NM]9.YTO&K57\F216/<];.27+E)F[F>UMV!G""HGC[Z,?HBNX"2>)DSB
+M`CE%WG2]2+'43ZD:_2E&9RZP:]D%]S0WP+WAL3W_]+[A_<"7]'W`3_/_\G]=
+MH(7GQ,.2(!T."(%MP>D0'3H<UJ``8_)M9;UR4YW0!B,=D<7H2*-BL5.X*`AS
+M+U at 8VBBFT6,O_)!-D"Z$J)6GUH>=MN#Q^A"/D%\0I0`*PB"&%!4A#44@'H6Z
+MUPTS#MHFT97L3J5[,EFKM\_.Y1__Q_\?EPN]`/<HU!F)O*`FLJ@/U'T5C:$M
+MZ`FT#>U`DV at _>JY>AU4ZZFE$5T-T(_H8^D0C^FGT5+U>_WO]6GVQOE"_7/]U
+M_5+]8OU7]5_6+]3?KI__CQ3^MXM\[/_(HKVM;R'A-*R`X@);;-DT6*:#K,L-
+M'@58J6D3@,N&EDW"BNTMVP7VYUHV#?;W5V_9/+)V?7I\_X$]1S)K#CX]]7@'
+MI&$+VHQ&T%JT'J71.*3I`-J#CD!B]J!]Z!GT-*3F\"-79=`:=!#6//I[_I<5
+MK:P4T"[8VS'(&`&("F@("O1]]U7PX14<]G^#?7[7O\5O\Y51D`/,/VSHG06C
+M_[_]%\Y^B[4/R.6$J0<(,`#L\+C)#0UE;F1S=')E86T-96YD;V)J#34@,"!O
+M8FH\/"]3=&5M5B`Q,S,O1F]N=$YA;64O05!.1D1**U1I;65S+4)O;&0O1F]N
+M=$9I;&4R(#0@,"!2+T9L86=S(#(V,C$W."]$97-C96YT("TR-3`O1F]N=$)"
+M;WA;+3$V."`M,C$X(#$P,#`@.3,U72]!<V-E;G0 at -S4P+T-A<$AE:6=H="`V
+M-S8O6$AE:6=H="`T-C$O5'EP92]&;VYT1&5S8W)I<'1O<B])=&%L:6-!;F=L
+M92`P+U-T96U((#$S.3X^#65N9&]B:@TV(#`@;V)J/#PO3&5N9W1H(#$W,S at T
+M+T9I;'1E<B]&;&%T941E8V]D92],96YG=&@Q(#(S,#4V/CYS=')E86T-"DB)
+M7%8-<!3E&7Z^;_=R.6`AB)J0'[+7)>&`G`F51E!"#KB+(1&Y0(0[QL$[DL`E
+M$A-K)@-(((,B](!"_<4IE-(B.HK- at I&Y`$)JL5BE(V.'0ID"K<#HB$QM!W]:
+MZFV?W2`5]YWW>_]_OO?[]O8@``Q!-Q0$&EKC[1N/7'D&F'<4$+L:.COTGU=6
+M3J;'<4#-7]R^I%5N_KJ5_"?$XB5+ER^^'"_8#V11#L423?'&*T^<_PB(GF9,
+M>8**(:,&]0">+,JC$ZT=R]3.P3,I3Z1\=6E;0_S2F"\7L%XUY96M\67MF<O<
+M?V%\BK+^2+RU:?R>I<>`R'KV<T=[VV,=[)-/)&';VW_<U%[^AUE[@$$^(..(
+MJP/258L"8H[R`D8`U at 7B%>*GZ>F`;4N_9?U9&<7H7AMENG(*BI&/+FQEYBZ<
+MPX^0#1\NB*F4>W$"YW$?%N`H:O":N!=)W(_):!45&"T^1#E"^`4.,V(YVNA;
+MA9_!RZ@#UMO4E>,UI/`E/"A`!2+,LA$O6D?Q2WR"+ZR=UJ>X$VOI<=+Z"*4\
+M at 8V0R$41<[:@7?AEA[4.4UEO*P[@G+C=FHK;,!%3$,02)-"*1_`D;6_A)$Z)
+M?.[&CS+6J<)\;,`S>`$F?B\*Q>-BN^JQ$E8+YK&#%L8]S=V<P,?XIQ at NCHAC
+M5K[5:UFL;6`2ICOV;=B.G?B5O1,<(US$%3%7S%<,9:*E63^TKM%_&*<60"T>
+M9$0K5G(G6_$.WB><9U6?*!</B';1+9+BF)RNC%#=KONM->PRD_.N(,QF_X^Q
+MTRUXCC-\!:\3?H<_<?(>8<AILEM>588K`;7.U6FMMGJLP]8'/!$7AG+^M83[
+MT(%E6(^?L-^GL1]OXS3/ZG-\(]PB2V2SAUYQ5ER6D,/E6&9[3VE3DDJ/"G6;
+M>M8UU;4NO3M]T5IB/6>];WW-W4NX.7L?[B),8HU*U&$NHFCDK!]V[L>+Z,%>
+M]'%V)W$&9_$-TF(4]WF7F"X6B!7BU^*H."Z^DE)FR4+6'"O7R1V$?GE<GE1R
+ME0+%ITQ0%BK/*SN45]1G7(VN1UW/NO9F7':O3S>D&].=Z97I0U:M]8*UQ^IG
+M-UYV8Y]I-69RMW6HYPDNQ at IGUDG[+K&?-_`F83^[.HA#?$M/X.^XRCOW7\[!
+MX\PAAY,H$Y/%%#&5?<X003%3U(K9HI[G,U]$1%RTB"ZQ2CPIMA&VBYW<1R^A
+M3QP4[XL3XA3AHOB,\)5T2;?,D88LE@%92YA/B,L&F9#-LE5N(NR6/;)7IA0H
+M4Y4J)4XPE7[EI')*.:_\6\U5.]3'U=^JQ]4SZD7U7^J7KBQ7F>L!U[R,G(S)
+M&9T9NS+><#_L?MU]!OLXX]]P3]]]&K!</B__ at U7R7KYG[P+R/5G-D^@2;XA=
+MG-1+O+<3"7\E!`@3"(,(:SC#<8$QQ46CC1]X]<)1!?EYN2-SLF^_[=81MPS/
+M&C94&S)XD"?3G>%2%2E0$C*J8KI9'#/58J.ZVF_+1IR*^'<4,5.GJNIF'U./
+M.6[ZS9X!>B[^GF=@P#-PPU-DZ5,PQ5^BAPS=_&/0T%-B05V$_*:@$=7-*PX_
+MR^&W.+Q&WNME@![*201U4\3TD%G5F4B&8D&FZPMP8(/\);P8G,1 at .[&)&?&N
+M1`Z)[1$R<XU at R!QI!!V;4A2*-YKAND at HF.?U1OTEIIC18"PR84PWAXV_'F['
+MZ72=$V%M?TFSW3\V#&DT&C>D`E at 4L[GX at Q%3B4=-&;-K#!]O9AM!,WO%I9S_
+MB]]RH8W?,9JRJ"K>E*SB:#94#X at Q6XIOI%0[5V=:N38:,<7:Z$`33N\#NV at R
+M0K8FUJ*;'F.ZD4BVQ#ASS(GLRPWDAHQX,&HB'-DW,C#2$?PE?3FK[O%R*'W^
+M:?YI-KW'F[-J@'[\Q(#^P_[!CM_1OY'6SKDQ%V%7,F:R35-O<(H8['62O31-
+M0K)A$MWX1`5WV6QZ9L2267<SRG0591EZ\@OPH(PKG]VLB5_79!1E?0&;M8_S
+MQHV at _3J?PIB2VA0\X<A>(7X:30EK;0K!@CY^892'%M+LLZ]#<Y#1%,:64#'.
+M2VY<B5[%KJOL<].3>G)F8U*OTA,\<+7(H30T):.EW,[<2#/7^HC7#$3S;K!-
+MT>C=S#/>SJ,Z>9)19FBYGJ'%R<`$W]"II*26(RH.1^HB9G<PSPP$HQP)[T]_
+M.&+V<XK1*+W\-SHE[6K.N=[S'>S9/XY,Z4"6N<S!%-%D<D`RO&9_,IF7M-^#
+M`3DE\'U%X+HB!2<!KTI*=(<=4[?AS;,5AM?PLJUHD*7*>+V^/5Z^-/P_E($T
+M&>V=="R]QWW0UMST5+B.P2O)R%>QD%A.?@UIF'2=G`Q5I0_I2^Z%Z*/O*-<\
+M&,0[[3CU`K+5QY!-?H*3YU5X28O<!8[.Q at K:;5T%8VS?!QB33]E&KWL3/*2W
+M$?V,[24&E4VH94TW:2GI!%(?]3[RY<1;V(O-JZ1%&9/9`QR<2/38_O3U*`5(
+MT#[2]B<6,?\X4H.8K\*ZQKLW/C#,\T&]&%8O*D^,%3OJ16":)JYQ/&7.JCMK
+MEK-"7`L,ME5;W&)+AOA\VFRI4OT/J7#MYZ^LX+6W8)([(C/Y7>\AUT-.8H>T
+MT>96<YZKI4TSL9G\9O+=TD6:R:]C&S5MU+11TT:-BH<HA5GA(2?C;$IVU=F.
+M5$:IDE*9(Y6R6BFE4D<JE)G[1&;@@+ at D9HDY;PXK?/O1H86'^)&<A44H%!/V
+M/36[\+#8#1V:V.RL:P)#=>V<KIW1M<VZMEK7#HL-"-.PU%E%8&A8.QW69H2U
+MRK!V=U@[*.[AMUP32N!6G_:63TOYM)=]VDJ?UNG3_#Y&[^7?2TV\[*S/!O0:
+M[:L:[=T:;6N-MK9&6U&C+:[1O#7:HGQM=+Z6EZ^EQ*K]_^.\ZH/:.*[X[IU.
+M=T@(G3Y`'P:.DXP4)%FG#T"6`>D`B8\`_B#8-64 at Q$!JXC8>3$WLQO&8289`
+M.TY=.W&FF+HF8\_$3N((V?'(3IJTM=NQQW8GF;9).G%2)Z4DGI3D#SNT=8SH
+MNQ.QFQG^Z/1&VK=ZOW?O_7;?[MN5=K]VGQ9E0??T/LW^?:#[ZI1?X*I3^.9K
+M0<[M*>=2>"S9Y@'Q9++M):XZ%P^C$@6&$>U!)80D=Z&8+'=BGRQW8)^,/Y84
+M2N"UP63D,(B!9&0:IF,+\LK@(\G at -&A7)MNZN.HL'%ST&4`Q1I(KDI$#`+N2
+MGJM<M0X[D1<7 at WHY"LJP'05E<]NB5";;'&!.G0:B"R4IC)-<>C1%X#/<UT(K
+M-^=-*4#SE3?%@/BX)$6\E.0^%$"()NX#H8O[2^1^[@)X.-\VS;TE?)\[YY%?
+M.!Y[0_*.7H2;S[BHYHX)![BCPACW0D2&CP1E?P?;9/%<"2C/<&/@9M";PAN2
+MW+:@%$'-;0&/CWB:N!Y0CXM:SNL)<0\(KW/KA&W<FDRDQI at L&H1S\G!NBIKJ
+M`JY:*."J(E>YBAB,),F%I=>37&DF>,`K#\\?:>;<,#S%&<[5YN=L$!*+*[CU
+MWZ,?I-?3(;J,]M$.NI at NI`MH(Z-G6":'R694#,,H&04#ZY8QIA:NBVZI8!F5
+MK"24"JE5R'V6D%HB4\\(S!"PM*3S(H'WY at U%S5%]1!>NBRW1="^V[J6>@L1!
+MJ)6)$P7MB8#462AH;TJ428?S6?PI_GL\=A;/2*(=?O/XTWBKK.=C[>WFID3S
+MVHTI/!/O3P'0#W<?"9P!!9SQ8-"4V"#[026 at BIU%;9(`/T0Y*I'\P)(ME\W&
+M,F8">`&SF"0DLVDDR&8",2V;797,ID9+XK&IDA+9A/*B4=EDE/)*)C#A&>8^
+M>#4V)0BRE2J!?3)OGRHA.RJ0'06#8!()2B93 at 2`83`4#,BS<@ST9N#4#M\IP
+MQSW8FX&/9.`C`"\YQ__'TU?SO]F=ZC at T/"'=EKKM\3[X=B=^, at 07PCV;BHJF
+MA@\M7J,<W9MZ-DORH;[$(7M?+#%LCQ5-=4PL`4](<(<]-H4FXFT;IR;$OEBR
+M0^R0+UFG1O8.Q+\5:^QNK(&]2SC;*SD;D&*-Q)>`XQ(\(L6*2['B4JP1<42.
+M)8TMWO]`S>`2SP^W;^\:'.R"30#_IQ#U/-4$%9]&M:<)W$@I8;N+^4A!-Y)(
+M12D:29*P9BGI1HPL3-;G?%VKV>U>?:NR9;YR-3M7V<+.5Z)HY7PE>PL:OR^H
+MXW5.^/+44.KKVU33[==2Y`=WBN4]UY4^0&RE-B,=BHOYV1H%J6&R#0I%MH;4
+M:0P&D\FJ.,DTZ"QZ0PJK3_%/9@*US-]:'>^+S:!H5!\.8YT^#`)=8B_Y?7I#
+M><BDI)4ZUJ0WT0XGH>MZ>\])PV1\IW?==>OC/YTENS`]N8G?L_./Z<GTG>/I
+M]P_P%2_C`BC;,I]RX%,/?(SH?K$HB\!:EE;"AU1K::V2U2D-><#)V*`^J;7D
+MYLF<6C9D.-V:_S8G4QBQ,B74B0@:*-'.\E"YCG42SE">2:\CZE<WK7GJ.Q6&
+M\?K=J];]R7IX]!W<DYX;VOV#A@)^^X_>QSV8.X/Q`7YC,OU%^F7@]E[Z&IZ#
+M?ZX&X.:XJ,`DP9`$J=00),,>I-6YP.R72JQT&RYH+,;<"_R.16;SNV:WF1?)
+MM<R&@\%OV/E]N%,!O"*XK-1AIVV.LM+R8"`O%\_M;S-T-^I5M:ZZ5371WK4G
+M'?>5[W;E,'2H]+[FGHW`92U^AJ at G<F"-%(DJ5$5B*P5W(BJ%7X4LR7&GV1DD
+MM,SZ?08^EU^+_YG.(G+VR'-\;>$S_!:ZC-3((1HHEUJM`>:,B[!D:\[S.YY9
+M)'V7L-^G^(:846G'A36U at E!3[3-+HD80:F6?BH6/"`'R1J*(:$8DN49/$)@@
+MX;!!)*%>9'<.NQ"/7YSZ!82P2`3-L$RCE1 at 2]G2+U_T$^SN8D2"VX\N]Z8J'
+MJ<VWAV3?5>#C,M6+EJ&4V%RLA\O+H[C?0/82![5SVCFC at M(JC;G:8J/"S1AA
+M[V"S1:7&:A5)(BMIMN at L9K4*4TJC<DL.E6L\:A41ORR;'-6]87D=CJ<"V''T
+M5$&^<&6:G;LUBZ+6JBMF*^R;Z*R4I<SBEGK28J(IU at H<:W>*^0J6*:8UJC*4
+MI<I64UJR#&=E*\NP at H4&N=W8S5:RE6[W,![H1)T#(49.L8V6LRU/)8'Y`.P5
+MDJ_"CV+ED:UCZP6W._#EV/%W/DF/X,O=J_W6K7<^-N%=N/?XLX=Z0]NR9D[]
+M>?QH^NWTX][V[/0-:;\0Z-C"EWB,?`5R:4)E8C[A8FB=RZ2V2+O$E:-V452.
+MQ6PYS]_9NE at BV%GV7FJCD%RDM-]=>,1_)_JIN,<7$;V>^.%J41#J:D*D)AKS
+M>*NCPIU$C;"BMMKKJ9,YI!;^IGP.<J]&3>A-<7O8'LMZMFC2-^F?#$P&+SLN
+M"5GFG+Q0<5YQ**PJ"]75QQI^K!H)C:O4A2Z"86R>5YUXC1-'G=A99B-L5BV/
+M^7K>65$K5M@,J-96U*1N\*RD7&ZRT%]8Z%?[/>KZY9[E*Z,K;<B$32W14FU+
+MLW#AW5GVHP'(63 at L#%TU"U>@5R68I<Q!3TKK#7.TZH;5+%D,"9WF"[/_>$+H
+M[(3.O*22Z at 3N1'G!@%[.%)%+.!TZ-E3.%YFD;-EM3H<S!\MSA6"*3*&@5%1R
+MC:;,*\OM17+5R^,#(:D$*NS$;.W*QWZVJK0O,7C]DW_-X4ZL_=7OTR]L"=JP
+M::1YX!"F)^I[M?S1D,WJRC$''OI#^N?OI6^^^]EO4SCOP8%7=CD.IN<F\.EF
+M/-Q>6IF^,C;_Q9N_P48<_O#:\T?^?3&=J/&45CT\/GP<+VLLZSO1_]W]Q4:+
+M"ZM__?GMLQ?3?TW?/#:1[^H*=[="CDA4"&?*,:H'LE4$6[!2/$%J2=9"6A1Z
+MK9Y=QBTK<I-NQ7\(+Q<8I^T[COMOYV&'B^,\[<2Q$\>Q8\>7Y!Z!+"7TPMW1
+M'1PWKMH=%,JM0X5I6P<C[-8K%;"NB$<W.K2B=NU5ZZF;NI9Q%:L8W2&MND)+
+M#S8TD`9=2Z=.&P]11D8U'>Q!X^[_=W)75G6:%?\?EJWH__'W]_U_K3N*1-%6
+M=)1BI?B@:Y#=0^RQ[29W4MO=V^GMGNW,GMB>^"@Q:MOGWD?O\^QC1F.C\62W
+MNYO&G3#N86PH!'". at V<X#&P\\:*#X3UNGM9<$OP#3SP4QCD"8VF8WTDJ3CH<
+MS3YX(^5RZ3[XI"-,A%P4*=EI$`ZY'#8N#N#'53/+38#!<A-5EBB2B'MH at I07
+M4K at +H\%Q#(`>N!P"I[!$;CH2KM4XJ.I2"5I**8(VP5K)6VP4,8NVJ%UTUK!#
+MEX$]9PT,].;ASQ)%#JN"'',#M?!$@UV,?>N;I5U,R<F48$?#O126,Y@#P-P[
+M00$ZE0C8H#37LN\<D&B`U,`&`?%$]:IY_[)E7P8'-&"V+^BI_6-5/N`;K%WI
+MCZ4C/2"%TWB^=JKV=X7ZRE^(ZJV1X8)+44 at VXUF:/GYR920?:'(H\&7!]R9C
+MF.TUF`6:,`5KP\Z4^W?R.T3\<T0/<2]_M_ at J>`N\#=XQ+H$KABM+,I*;5S))
+MK\0',[*0TBFFB11:[=Y4IJVW]>M_LH/3=F"W*\%,%I9Z4S:95$CX*=->]H7O
+MP0?*\4?BDW$BGF^A="\S at 1.OY-MSIU""8,X.59$SEIAJ1PE56&ZH4KOH+1;K
+M])!%%@W#LL5XNEF260X#AII0FUE]$&`R/@C27&80`*EIT')&>'P7'JC>DO-0
+ML:5!RAL(M=LA2&]>3<V5VFS!`*PN$:!.EK`"O"T%B](1]!9P\^P_7\^%(Z7U
+MM6-;%B_>@M]Y$TCKBIL>/_'^MP_4UN*3W8\^]<7]9?&-)0^_/+X-F/C<F.+L
+M^!:QM[+0H3YW](>]1C0QMO?#53G\>JST[*_*<JC5;".0C[5__+Z=@=AE+(F-
+MER/O1B^S%SAB)?<U#M?($&OG'=O*)"\YG1- at 83D!)_CS:LCI at 6$"LI0)7Y:G
+MDLF8<\T8.\F>9 at EV`G<<4CT#L0G<_HJJ0)95QARZ"/%A'1;(>G3"(@NN1+AI
+MJ+C(@BH7@:!1,$!;3#3A]@J*I'JCG at +F3L"&$7T%C(XW%<`LQQG7FE=H]\LJ
+M at H1Y&6A0A7H.D^,-%TL0ZZ[20MYE^'-ZY[9S?S"O@]@?QW;VK5:[UXV?-%\]
+M=NBU*=#AM-_?&4^8^<<&GC/'S;=A\#FRU%BA+E^XX?=O@"0P?GNND4^W0DW2
+MD-,SY;8I'KQ$3I`3D</\OTC[/-(G>?BDEO1+/*O)/C_NRG(<B^-964Z2CH')
+M*(A",(=5-ZW[?4AF%AHD,W-H1F0, at M.0E!9.$)0HQ(2X(`DVATV)**1*)!P%
+M0(5A8Q?P`N;D7;-(C'1#6B$$`>8]54*Z^41<<=;F#5B)4);`"ZU]'S[[MS=?
+M,O^ZJ-7<LK&[<Q.N`?8H6+UU6__R'U^J37TC?M\38`V8/[9;;+]U?7-3<9C8
+MN[%,JJM?,%<\8UZ[KQ2[`VF'A74Z!9EHF([]IOS`NM2#J1TI at CXQA_>X@&L+
+M+3P=X3UA$,X(A(3QFI:T23RIR8&G61[C`)<)"`&:",>2%*>D7$123=C\-.E1
+M#R:RFB=+!OS- at BAJ.@F%J.M$F!NF>EW#F-JOXNH$[CIL^&*ZC4`PC70#YLVA
+MZ>GIDB6V#M2A:U6F6FWD&:0]JX#K4?3&$*A>,XQZWYBB=%J8I>:7LT"V2*+8
+MTNZUIJAJT8R0`%OIZMQD*SOSD:_^TKR:"8+YVWM"+2ULSZ/F\;[7S[RUK#AT
+MZV5\M6(!7-]%JN;YW?V"9A:^,&*J(WVF?4'HWH/FSR!"*_,AGFO@)(GM+Z_Z
+M3(Q+,*2R3V.,2;RLR7681$Q,0HRS_&023\IDF/LWU=OBZG>=<1$N!$^=A3>K
+MQ)M#?1`>"J<SY(K>!C2(R_@?N/X_++A;L)OG0TY=SF)P^(!Y16>!-LOIG47#
+MM6.*NV,',5(']'AO5)\%5*YT4(J5MUH_OF!_'OI4#FO!)LO\91QHI/PP+[Z8
+M"$N\H,FW&Y6SW%HWJIPBAPD?I)!JRK;DH%FE*.<:.<SIR986(SDFGY;QG+Q,
+MGI0)>0*W'6KS#!C(M]I:+=^Z.32$1`3W5.9BW;T0&)2*%T2N(=,"<%!%-M:H
+MVJB6=7MU):-Z-61>661>:61>S?]M7I]E7?,^`1E$$<L;L,W:F$RLO^QM5MP9
+M)M?1M?G8<?,<2+^GK,TL3G95<-?2<-H<^ZEY]G<7#D^!Q1(TLT3<O/O)Q8^8
+MY\S]YB7S&.WAY`3X_(-W.%75'HBO-=<G'SIX%"P"XJD_6[I#WO8CJ#L#.MO*
+MN_B[4KA;XBD-D0UJ"7D)'],22'K&C/08B0]H<D3B14U6)3X-6SE"V!0CS+AM
+M-M)#-R<510P&*!(WTC&19&0]'(&$#V?<:D-VF>:&[%!BF0DP5LWVP03#6B5J
+M-`X84RNWX8&1PRO=-K8DA@*)MR$WZ:$2!%.L=./KH;45*UU=E=K4YOFU?=VP
+MKVMM0R>IJF3G!K,"]LZ,/ZIL[("1I*F\`_S`7+6Q#)5G^3[^'<C&CP6P>\H:
+M`I-)(#OS9RP8&9F6>!]LW3;"YD<K]OO(0`@NMDS1L"*AX]N((SB!!7-HN;">
+MF,LYZPL0*:FOOKQ/+<Y:!)"V+EFR%?\2:FL_`3F%*H[4]W/5L;#R466D2"F6
+M<0"8DC#[S^&X%03+OW;R3B'`KXM\4WY`_;[R6&H\.JZ^YWO7WQ3B!SPKA.7B
+M3O%[ZB at _*NX7CX at GHR>$$^+YZ'GQ&O]!]`/QDGXI?4.=UD/Y.:5H,9W/VDC=
+M+_AU1<@+O7R7X'3HCG007 at BF[;]H!VE=UWV"P0M1AJ:;?48ZBAM1.(=7C+0N
+M1'F&)IV8*\@13CY$XG(.^P_=90/;Q'F'\?>]#]_YSG;.=N*S[\YV[NP[VW%B
+MYP,2H$XY"(1`-FBGN,!4-Q3:%;32*%$)=)"6=D6H:"O;$"K3*B%:8!14P:"A
+MH2ML*P18^%*EM%M)T;H)&$*V-JE1UXWXLO?.#D%=%RFGNXL5)<_[^_^?Y\&K
+MQ7J9%H,UZ&>$B^>#"3G)+ZJ6Z^55,BZ;FZDIZ:I-6(@T-2)$BID,6C7]YZRP
+M:D+1FD[[D7Y%/F-=RJ_2?HKF^`S!);ESZ`X549CK->L-BJZY;\C;W&(%,.N)
+MLC^89V.0*HFO#F3:^K&.3>VG-_UI<1OF7]W[E+$9WMBV*E=\/9N)U1A;%J*]
+M=5IE%KZ";^R9A_BQ+7C.>'Q?[Y4Y"4&3F3FKC1\7BSL7L1$5KPJ[VU/P\$/&
+MZWVMC%K>\[8[Z+Q4M,G6W9;1'V%G;5*`Y:4$.YMMEQZ3GI%&["QC9UBVUB.*
+M$F.W)SRA4#`D,CB at G)3H8!%H(,+CE:)/"D95LHK6)3E8%7?$W;ZX$(V'Z;@:
+MQ]$O"$JD$!:%!.<VYR\6"M>6YB^F3:U]BTJTU/)Y+H_<,I]O30L7!:0Q7Q(Y
+M4_X`27%)`M4"$JE+FZT@!QY0U at Z_.8PP`MU6-9#YESK:M\#=\#H<AGOZYL_O
+M0R&VM3 at N%8L-U3U&6'6N?`O7>]ILVKU_$7:-;EM?GD13W3WW^H at G)JX=:I(=
+MJI4Y)N^0AY!VJ-&!/?K\S_QP16!MX`9[UW6WZI9D8\UB%0CX`ZR?#A`T\'+(
+M$SP,%@)BF/;;91GW^7E&8-UQ!UO+\YZX-:F.2"`<%VH)>[PZ;JD349`Z^7RF
+MF$<"Y3-FK\I/A0 at S7$R8NB`T32K1=RO"CR.3')$QD2L#%TM!I`MTHQ`_1=Y]
+M12"21*J;.Q=VXU6-<B_\ZX:ED8E^2PWLJJ7'=GEF`-,F-.S==YID1M,<W]]W
+M;X18,_$W2PES\''0BCQQ,[D6L$`$$CB at SSCO&:D<$?!//=<KKPOX)=<P-^R[
+MY"?&7)]PG_C&_$0;3:>D"AQ+\79)$LFN55[H1;GT_3?87[,8VR6:YA<*FN:7
+M^RI7N!_:+7-K!$)`K=*<FEN%?K8%X#X2I5$7ND/_>@L$`HJD1"6Z,`ZZ!=H\
+M=(OE=W!JB;\,<PB8'/`T-9J.%U$P-X:\K9KWN3G*)IM>!Z%JG!J$T)@X/C1Y
+MY^II6`FK3E\9/6-\:7QQY at _87KC:N`3K8"=<!FN,2\:'L./\X,EA8\@X,7SL
+M[`4X"SL+K*R`=C:1M;)Z#`SK'>>%$0D[&?AC$//H3"A)>Y94B+&IK*[(HE87
+M\2BAF!>GY%0HQ712BRB-QZT`']-H5Q<GUHN/B+AH;J>$32DG^$3\?FXJ6/N<
+M,V-F?QK%@8*[E#:3Y5P0"@19)\`<*M38H"L+L0"Z."4F"X"`9Z>3P<M@<=<+
+MNMT>IKH!357+D,MPF:0Y9Z!<!$/0S/<SX72N1Z61B"A:I#1X>/];R[?-#;8H
+MW$\?W35Q9,.<><]A$B1 at I7'UMOQ,8-'FXEEB5[L62!;ODEA\\<6)I>RBE_"-
+M/UQ at UT8.?/PA;OSD^8S=FK-68Q>YVV(K#OZBIU7_07;$]1'WD6\D>D4=<XUR
+MH[ZQZ)CJ0,#%/JN\$2,>I751E"6>3B'`/H`*4&!01X\Z'Y$Q/H*1K/0DV17V
+M[O7^SGO-.^DE3?).U+!=<9.ZFD2Y*A9NFLJAB1(&+E_V"V#N5X6Y!>YS5!,%
+MOR5F1HD!GQ938]$8;BOS&/T6'F-3//KX:2(!RJ^9:2C+K>G_,$GZS%F-*%$T
+MR6FHF8#^#Y_<F8^W_<SX>LNQ-8>Z#AJ3Z]:=8(3#N7>_C=03P\:@\9_!LTTG
+M.FLJ561"OR<=RY[^+4R#<I<B'T+,LJ`&_%/?U"%\*F(QZ51D6!E5;BI?2^,*
+M12A52E6D1E(54J(/!S\(8A5+'"A\14MQK$*-UG`4&U$4Y,E!Y`J*)$59R*8B
+MCT171;=&CT6):-3A]8I4JA*K=L3%A$)+024B05)6\:[`>AUE#I/Q6D9-<!4F
+MX[7)Z6)5*#FMY;THK%F0IW/GB@/G_*4-B*[;D3<,<!E0YM^?3(*<=6@>GY^P
+M\2JIV7P(>,)/(>JAQ3SL-?$V';F,^#3;C;ROJM)&E0QZRIFQY[O?_L72EY?'
+MC*W]<^;U8"V_Z?_BPA%X,+:TU3AI^/N0+5_`AK6V4\?G10(I at RJN9=NWXAN?
+M;;-K==F;O]PO%/]=7VM3L7[26%_R8PQD)V_A!<1Z,VB!:5US1UY at -K,[V!V.
+MOT=OJ50GO9+)JAC+4.IKS&O.[>H8,ZI2S6;-<,Y\45_9L*X!:]A7FQ+--V'A
+M1?TQWP]\F&^?YHVK3H8 at PJD6+TZD4G9]ACAS"*[3*X#8[.0858F+5$M`%-"[
+M04D,B2M0=6G2*UI$KC[YC^1D$D_.;EZA#,$M[P.NGL.XV;/2ET=S`X6;?FXT
+MA_3][D#!/^X7"N.%M.5-J*YQZ$$H+6V4H3FA-9\S^\G]F]X^ZSAF5->1GJA+
+MR0)[`AT%68<NU1[TB"#*@JCJ<M(U3!8FXG;&5DMD@>P.9TNS at Z:GM)2FNHP7
+M#0EJ+^;Q63,R<T9S4^-4OT$-$!TILKPP]%F':6XJQ49%</CJC/8?#:[>V9%^
+MX^BR]/*KA]N'75J0KJEK:+SQ;-=`??W3[[VS<,&7I[NO540#1%TKO`7?W/&]
+MG5MZGEJ2?F)]8].3&WYU=6%4-KXS_.::%<MFS7ZX9^WR%9OV_;FC-@#?PR\#
+M*Q=+R`>&T$SQ8+?^L.TB+F)'X5$,^<A>#.N&W1 at 6AF$,<R\1G74*+8N.NHCW
+MHD_$>*\;V"!-NYTV;PH"S.F@`V at NCF.=<`C2NHNB$YZPN]N]UWW43;C1J^.@
+MDS^%V8$_/3X^GD/C,3Y^V[($L\K,G at U+XP`^S\!"'BV?'/KB"OF&>J]L2I2$
+M#X0F2YTXL8UMB/8<[T/)_\@K>M_AS>%&LM/8OW_-O3MF[%>9^=L(L/J`R:Z$
+M,L#;5I;4P,_UQ[-"EY at +_I?N<H]MZZKC^/D=/^Z]OGY<O^\C?L6^UV_'UXX3
+MN[$3Y]W'4G7=VM%'0*70*1UHC58EK:"CDR!5"93"&)0.J"I(NTZ:VJD13>DZ
+MH6D/0:M)$VQBI1(2E`H8^0.4"JV=;SC73DJ+AJU[S_61K2.?[_?\?I_OMN`)
+M]D1P3KH2N!MB9$IFNZ at N=I@:9K>*$])$8")X+G`N:"7Q!27:_7M(E&FW[]%#
+M3"0BR8EHQ&\W&A79[4*8R;4QBA+F[;8,[]<!,F$T)<,1O38DX@\!Y`HKD%<K
+MM[5`"%I,J%N$'/$'(TZKY:],X5U3(YG-?[FW-;]I']R87M=_0+N at S1_H']Z/
+M?VW:H-!]DXW)T]M__M)GW\3>LUM81;%M.]WXZ'?3?_C]_M?QX7U]C-+*L80-
+MOT?V(H0:]<&]PEX1^X5I849X)_A.Z(/@!Z&[[KL>AG$S'L$M>!+NA,=,,PQ%
+M()M!ZQ!#N;.\:]3%L!XG!*705Z7ZPO),765$(<P+0L9%(%T2Q209*4D4*&.(
+MY=V,Q+,,10A;WRQ18!RM$GKQ11VLX/+%%QE@%F!CW1;>%#H<PO40(.(YW2OA
+MCB5B`U%HC#?&^=OCK42H1T+=+14R'AG+I>V'N+=,1W)\\R$M\MP=1&IO%5J@
+M`=R=E:<CG+VJ7P3*]7(*7C-%CIW/S^C%=(4_R11%D%R'4CPPUJ9&\U"'J-M3
+M#`[#S_I#'3FM)Z11];'U9,.!X51A^]Y&M\%8'/'U>*U8B3)B?.K>8>.>[XR8
+MHF2OF>6_4OO)7I?A<OV'>08XQ(%'"*,P)"S=I(Z6+>7"MM*3PH0T+1R07D`O
+MP"G'*6X.S<$9VWG'*]P9^8PRC^;ABN,*=TF^I+PMOZVT-U5T(I>1$B at 14WG(
+MY]6L)9W)9E,6"]-!/N5R;+&S5"J`A*9HE^2\*BB2?#;ED+@$&Y5B4U*W5$Z4
+MZAE9S*#"PO+T1::@ALE8?US,9<-Y-:CJ0EI2V6S&)8H2F\LER2B4"@5=6+I4
+M4&EC.9_+"JS%S$@I62SE4T1MDL5H2Z$LQP at EX(*:RS)K_'Y17H"1^3`20;P"
+M:]%AQ,`;=4L8E0^7<5FHK%F`/UV,[-M)NN#&):+T6$/D&[KB_,;A+P[I!:+:
+MU/PAU9V?(OS##VG="FF]Q>J_:7IB$?[?C2*FJ%(DKMFK=+7YX4 at KNDV./^@3
+M<!./K+JD99RN5DM>=8Z!,D3C!HBR@,D<+-?$',M"XL8NJ2O<CV-C at 1S-00*0
+MCS9U!:OP@^Y`IWACRU="CRUI;X6>O_#E+=N)K3#CS'J4X"<:'OCWD-\.B@(6
+M9\DEI1H(7^K)B5S%9\.*0CL#HXU3'VG?6L13G_P$7H8_0N*(26G5="_AI-/$
+M=S6PUN<JL7(!SSAFW-^09Y79CMG\K$JPS6S';JK@,WC-7K<_X`\*BJ#ZBO%8
+M4DFJ%:5<<!J,`4_`Z\4>4185Q6T430515<URH!`H%F-L(&R@):8GDS0 at J5:0
+M/49CJGEG:FY%2;K(-V/%8L:%L;>H*C&OVXSIU/VG6BAH87"MFD[1*;&O)O3V
+M+8!OU0:WN/_*WA2=J&TG<A-)C]B)MF1$.F8!N7C$-?Q5_:*X=#5-SG>:J-@:
+MF_=#;^H3NIA$2I(XN\'03)PM#0FZ2O\K(M-"*;W1="HLK'[/&_$^MO5K4/_S
+M\].[\=YM4M)C<;W_MZ*+S4BC<'MS=G1"^RT<[7O\T<;I)X9WOO>ODC?2&5JO
+MQ61FY,?P35CW_H1140R,+=,6]XC:=1!KLL^5=3!$7\S'G]..-:[O4*UR`HMR
+M^/M0U-X=#*E\QL6:9-*_LD3/GQ(]$RB)7JZO2]$5>E@<CAB/^8[)F*9(@<ZX
+M_+R?IJBD*Q:+QLB,WQ2/\J-1/A:*`^<VQ*6D$^%0FQ2 at _8R+YJE8-)%,_Q);
+MD`L^KC.CR4""3P83T=?@8S2*$J3VICJ6II;XQ<9B9:K!WQ[3Z8FP$[FAOH:N
+M#=ES?:K6,:6SK;]"$:SEC-7FH!\?-#X)7N73*^P#O;Q9:R-X[]JU5J\>(%QL
+M1]L0_*I7?>1SVGMC,XUCLX/:TNR^37A!/QMBVA8/:Q5X-Z`P&;N^>8;VTG&M
+MH$U.]U"R3`_.P!?@Z+5GC*U>-Z]=Q;O)OCG0<#U&O1Z#0^WTS9C]4)2B[8`X
+MN\M)"A1%SSD<2."<'T:^=!G\J%F*JF-<H[I2 at OJJY'^.Z=W:'2%)AQA";]8]
+MX(W,P_E?5+U6FZ__O/:H:8.J>*)W3^5\\4ZR]I!V%9;(VG8T6&^_O[9-7QML
+M'+ at XLK3=CN9H2G!P'T86X,2K3Z\L35;F5I9>71DBI54Z2$,I`DO:IDL]/C9>
+MO0`7M*ODY$5-GU<KG<B`-BS_TW#4,$\R4AWUD_._Y^_*/053\1$SMD9/6DY6
+MSEG.L2_97F-^PUSKN):_R=S,WU#_P2SF'4_0&37E;PMY0JCH<(!C72'755$S
+M#@LR>VA/4:9RO5TLW5MC^ZG^2IQC._I3=?5 at LB-U/H53"QC5+8-\7!IJ'S`.
+MU1<PO#HXH,?5I<8MDHRJMXE9&M5;!(`(`9&W;IEF7Q[G%Z_K1M(+=9.[>WK[
+MH at FK'R at LVQ2SXE+`3N2D>HU!Y(WY at R2JNA4N"/&$P8H4`&1WF/KH('+&/<'[
+M^`U-!%\)L,\]UTRPD^.KAUE'\5AWE]R*4\UB[B6L1;B[">8$PELTUM6MVY5,
+MQUM#"?"&9S8<K\;S`P<U]-V=X/:T/U7,Y2RR-Y#-OW+VC6&9MB7]03DLE]<,
+MU0R/=.W8O/59.(132F[;Y(YTV_K*4[NJ3V[9DQ at 4I0YKA2[[;#VQD1\]._QU
+M[>DUOKA=ZHP+RF=J`^&N@^-X$34S+[6\:+AJVH]X0J_?KJ?N6,%LA9,VB-)P
+MP[L)M<'QJ%FFHA')[&4-*-++4M)N)QL<LB]@7+?$_\-TU0<W;=YAO9)MV;)B
+M2[9E.;9LRY8MV;%CR[$=?\2)G9A`<J&#0"$)1]K`2EO2\GVDD!9:N&O+EJ['
+M8+EV[0KT8UP+Y1C7C4+7#M9Q[=C2@]&,6POM;EW7ZW67'K<!UX[8[)5L:._D
+M5Y;TU_N\S^_Y"$JZN.TT`Y at 3X.8Q6#^FE.P-3V0&4<]!&>HZ^,BUF5EP33T"
+M!\>3%$]Z1,!1</$V^$3 at -KO@4$644E.'TPH'.`FQ@@(*VPQC0Q2(($$%I%9V
+M:E45WW@<1YVIY5OVGJ_^Y_*ZBWP>&'Z<>NK)[3^9MTOSC=]9TNDJ^^5(WS?O
+M35<O#$8UOGSBQHKF"Y.3E8%R%:UA$(<8]&%'$3\B(*^5>B?85_1GZ(OT1<=G
+M]!<>/&V$F=TX:A at E5C.K[>.&K<0X,VXWAO2L`R<HUH&R#BM.-&@;DO"P]\+0
+MV<D9!;1+\#H at 1&\$J3E>A:W!@,)6ZKHEIY!T9KA8J$S1BN2IX$",J+,J-BZW
+MC[`@P.*F1,3D at PM!>ZPB8N8;1(5^@%()!Z#=(/4RIU8^M>.I"3_#UMF40I("
+M.OZ;F"RD2;*!][5N?.'(WOO[8WDN5]RZ_Q=7 at .Z/4>SHCCM\.3DFI^W,^[]\
+MYLH<:0F]9>X3US\\!YIJV"0 at -C/:,>@1>>12:<VSH=="?PZ=C?XS>C6J0];$
+M'HE-Q)Z/'8Z\'GLK\MO8!Y&IV'O9RY%+L;]F35AD?A at 5],:/-0L)SKB;]O#L
+M0C?GV>-K2<AQ#:OQ2RUQ@<6TJ;S&TDR#5+(9SW=(DL_HU\0M4HD%L.P at QPN9
+M.?N:0),"8:%-H1?$</AJI0`]G+K-,#:G)C$VAU`JR^JW&MG2N5`T'<V(2"X$
+ME]9(2 at 39</Y[9-N at L`V!)DRKG,+3BI%#''%8DC!;?5#-T$=48-%TRI*TJ%)9
+M!QV-M8>"KB1I\2YJ7N:G at CH4H"C?;;0;=1,OX-EP[\BA#RMO;AJ9Z-K^U.3/
+ML&,\$P0=[3$4\S&DD]2:T-6YK6VSYSI3`/6A<IOAX79G,\"/?`0RLZ\N#X,C
+M.Q_X^\LOSD+M#=W\$KL+.X18$0YQ(Q^5AE?K1\EUE@>9A_&M^G%R&_VH99MM
+M&S-KNFYN6**_5S]"G]&\;YG6?&'XS*QOUQL(UH$9"-1`8#HV1V$`FX?I..Z'
+M;BN^1_>2#M5U-AC=#A@,W=0Y`A`*>[W8)4J!WNNIL7?8DKLZ4^?O3%U?*[<F
+M'%YU$C>97(B6@<'.9E$5U84X/*#1H35A(F*G.?@?P$5CUJFG`(_AEIZJHZ\P
+MV^<!"NXPH-815XS=IQ`]@ZZ<KCQ._&[GZMWM0O@?+[_]P=>G7B_P)G#0Z$IL
+M:L8._>&-+Z?7KB(?_1O at 3IX%@=Y5K8ON20SV0L\,(0A&02Z+R$.E3(8`>D,C
+M$89 at B%@1X<1/`[XB%_Q4P'Q:T6IWT)..I!%XM3F/&]?IQ""!>?@0")U`-26#
+MR>V+XW$(X$EP$Y'BBN85IJX-YZAZA80)9F:&KFD?W)Z#.N-0,J(:$=.TD$ZF
+MZII6F]\84&S"#9*,4(LNH='RX<.119<&)V2_N\E-FT3_?)?YQK?M.RK_YK3=
+MZ]"=Y7UK_C*WS9<2HD[&W1?JG"E7MF\H&C at XLQJDM=J%O0OUS(KT($N1`>1\
+M:45O5T]YHNM'Y4,NK3:DS1C*SG*N/(H]F#UH.^@P=%JI6$\TXM381;\+%>=3
+MG2T&^(R%EQKZ82M#ER9[O.$%X5-A+#QO07+`R3?B:$?.-#`@VN?W[Q8/B*BH
+M&#0YI$VV\D.Q]F[);CT!+I1,A9.+YU!VV;[;?L"NL2L>,308GZH,ST`RP6MJ
+MN@(YI1!)X51Q"B(W=GEX3&%4O%*W\-I at J[^<8N$*C)::`\#(!^,=O!23M=3<
+M5?D"LY- at 9VOP2OZ:)_/*LZ;FP478GY1[1LWFMSPZB9U]9_S@^3M3/PTN\MM7
+M.LBX+*UZZU#OK_J9)5;RB(6 at WSG0V.F^>VXL"\#R9ZK[?_W*Z61?%QEC0]T;
+MK at 4+*S:L#%K'[M)7_UO:=&<9MBB`H<"D+99:4>FYD<T7NK'^)F\^M?&48:67
+M-Q/N^//[WGZ\-]`]IXVTT-Y0<.@>FT=^Z.ZOAQ,]X^^B?9"O%LC7?T%OEI'C
+M)7NW'7S+`@/K9%&GGHI[950H<MX3X$:IS:_P5^8#SB+GX85(D8OSPBW9#0N1
+M2%APTIA.DC448T:D#@:7X[`A!81XHU.1V!9*BL0UF'(Z+0DXYZJ!%U2)A37I
+MML1^9^)*ZH''H(XZ%13M#M$>@*W&$60E#U##45U55;K71;4#%`%;,W,U`=V.
+MZ'4C5U]8%B7=62/3$-W1.((6$X/WOM3&)^97%PRT="[[P9[4DNH\SMBV%CN=
+M36-HH"&H]^"5YWK\A5T]FZOWCY8(CB/S:\'DBBWKZ:IU?9;D:AX&YQXU01R-
+M,.,,ET2!-!=)+L@'!)YW\-1"EG/LX7 at O9=9P0?TDBG!X,$!(:N+DC9-:R<M_
+M0IF521?C$)L"Y*W2((O%.]246;,:ZAH4L(1L^6ZLTYBZ.:EN*<K&;VW[U4(T
+MTMX>B18>>R!K,,M&IB5RM)O3HYD55:>VM:-=_7J#)M*;P2>=C6&-R6O*N4E<
+M7VG9F->K>P)PRA'LIG8#DD4NE,;F!@;Y,>8)YB#S5>!_`5S#B[SH:^4SOB';
+MD'P?/RK_G"%\?G_.8O,+C$WPE_R++;Z$C4G(C&Q+)&3![X,)5?34*&-&/"Z.
+MTR&M84SDLAF)8!+P.^869%1J<8](CTFG)4S*9Q3N&6V)>)8W?GP:BJ%"H'Q.
+M\>C//X=9G)H>/J-:,PM;7-R!U$J=TNZNSLS2M;?P/:ZGG!$G58!W%<+;,IGZ
+M'G(05#JHM#RUY)F`&;"0<)!`F=I+H"1J^*P9:9>;K1R][+Z>**[#`.-AFO/@
+MQ?6[?M]V\NG=_=6R0'.$H?JGI*>WZN/PEL785_-$%.4<+H=9:YA]\ZJ+)UD2
+MXSB\[UCKE1-;<2>'`M)DM)+ at V>K3W="./!#[H,JG1Q#V_W27?6P3YQW'[[D7
+MGWU^._OL^'R^V'>VSV?';XG/+[%CQT?B."\D(927*(!!#/K""BJ96#8VL57:
+M5KK^,1A3::%2"U)'NZ*MHFL+[(\J6J/"I*P"J>P%L6[38.O41?UCE#]&8_;<
+MV0FPEW^>/#G'4N[[?)_O]_-#QE3!C6"#".\1PAV"TW(=+YEYRU&G`\=P^,>>
+M#LH+??2VPYG&<,U!K.X at W3Y0@(D'K5-XT"[Y0F;%+%V-`;.K8A.]A]\CL?+V
+M)L^;BANPJP/>+H-!#)<MKKOKIQ62USPA(H at AB[V.3"+_4OF\-RN@#N$U&[HN
+MMJZ,TGWT1&`2JQ:2 at WSL/7`7PJX*IQL>*<-3'`_B)82?%,+A$A\50H4JWR>$
+M1DO\A!"R",04?*5C]L%17T$='1E4"_EDV.<B<,O0)&//#/5[,OV!@,=.3DZ4
+M^V)1:DJ[..90.)TZDKR21$>2%\"P:JVK^4)ZS1'UBHJ.J/#)^3K.R*-I0E=E
+M75K/G+G;<PT6RK.Z^:N>0&6M4B?H)7I)9PQ/&YC;C->:P1PIT&CT=&OPH(?Z
+M`R0'O=,)M!_0(/\K?5HS&OF?CU:>B)-<5$ZZW;81^2V"0'<='7^\(KC'"CMV
+MG<X'JH\T*],%M[1WC2KEB]N:N1U9E_AD92Z9FVD6.9+IG$:)L11.A%AKC;(=
+MWC)4CZQ9&^[_SMBIYLYAQ<CQQOP&\.;.U"-Q;Z&)K-^(<9RE]CW`GBQ]:3"_
+M_(?Q$N"T_(+GBOT%^QFB(%GDO#KCY28X]+CMC`T604"D,P$E+59%0JKRHA#4
+MS*@(8;[$"T((LGY&.\*6*^VII,0S.$8J3GNLWR/;224C"E26S$:D=!;W\?#D
+MSN>=<BJ-8;AVF?,YK0UHO0Z<Q>4R+&F]$FY#MG&L))\F/]'`6V4 at 1UDNRD8@
+MX'&R-W:_#!JS#]N["K13^3]EL'H:0!HN6I@^$V.+G=A.8MNRDQMKO7M+M>:F
+MT9*ZN:\2S*M#S;7@!F_*;8,NYN!-#EDR`<KTH\U"CSS^?C,YH@*>IRJ/@;.;
+M9Z.>W/*5D1Z4ATIB2/;>GR$CO0$[@46\R#$U\8'IE at D]3I_H.$6?[?B<(CH0
+M%^[Q;*(VTD3)R"I>E'0J1K/77?.:"8C&[_KL-;L9F#4Z]G'MP<19U.$8LK$N
+M1P+Q6"4+L$<0#^:.`(<)[A at 2[FP(&P$=.%QHRAE!7`:XZ*6JFUGOS at 8'+8NX
+M76 at HB.00#5"<.O. at H4)V^=('`/_B\GSS#I at I[3Y]9/_!D\<D]`7`-+_XW:7F
+M=<!=`R]GM_[QK>;BAZ_]%&3*FH=,.A.>0RS010OJ3-Z4%X][3TAO2#^6;\J?
+MRT9*(N0Q"3L3!D-A$#32 at U9>N1Y.#?*9CT.LX-!+TF<Q4QB1HE,Q)1EP6"@"
+M]?N,_2'21Z*[8F8E8R-JD`-1E<KYH8D<\S2 at -1OELIH\.E4L:<FW5*VV#+1*
+M=ZMWN36QA:,8B46)""##<,%E-((8)&,$M`<V;5J;;81;#-B"!_!P8:R:JT,7
+M$')BVU`['Z_O/?'*GK%O-'^Y79$4,^/<02P0Q$!FRX[G+GWV3F],S0\\U70<
+M&/SM_(5WMR::IN6SAMHH-C\>A]-:`-1,AL,#0N^GBY>;O["Y>YL7'TT90RW&
+MZ('Z?@*9FX:T=E7=1,6Y>"&./9_X2>IB:C'U>_23U)T$.9$`O49ID!<_#OKT
+M"XH9)2OK<6$^@Z?;)W6)$9<1PVDO2RG=)$O2_5UF4;`99"G-J3[@TV'-6GLE
+M"9*:[718TVRG:?M?PCH4L$+0;5VC\33).*&0]K at U@IC3<#$Y#'[`N&P).H)8
+M4A14G*'\F at N!/H[%5T`NG'_ at _FJL[(1I"H7V`W>[>?7;"X<TG;`1!476A[I=
+M;/+0#PY__UM;LZ'AITPP/9G.#4U^9KJN;-QSZ`H`OWZ29KAH`9Q9EYCZ](5S
+MU[$:8XD.X`#'S7?5'"<;>1&4=H-#0_Z>O_WI0Y#6.LX$Q3X'=8XASZKC"WY0
+M"()`#&BI%X/U-:C5EUG`JY!CCM'!@!^+A\-!6,8Q5R<C/-T)A,[N3K3S^4Y:
+M]I"PK)[F`!=GY'`+?]]^$QJL*[W8T.MHH:%I.G%S<6D6CKV.8JMY'C`K6&F<
+MARBW;3^]>%HDV,;;@ELT;2M+/93H+'[=D\F1F/HU55%[I,A$1^BQJ4:3$8T]
+M4^#]79L(7'1UF1B6HE^=V5U)Q7KKL^5F9?,@*K:\]L2])?17\"[W(!F`J2*#
+M,*`#C5F+UB<L>ZP'S0<MSUJHF+&;[[D*XP]^YP+XX<_A'C:QJ-J#72SOO:KZ
+M>)$+P+?7/H._NK7/XJ+3BE!&^!];*9P(*!DG22A=YHR=`Y]Q]SB4JQO79)!N
+M&<C9X`7P3Y5&Y/WV4_9Y.V:O(UF05:!T<Q^QC9M+D/U@%LXM-&;9=B`Z[O=V
+MA?L'R]V^U0!PMP1W2_HCCKU]"]!<90EN6O')1V."2&NFBAG]0'`$_0 at 9)?R(
+M2`?\`&F'@58NC`*GO58:I$$*K,Z!!84)1=J6#8#[IT&&P)=%CUP_O'8Z4]W_
+MS0.G#N:^;732!I8,N(+]7ZU//??=:^>.E%^T69P$!R30]Y7*_ at T#79.2.O#,
+MUOU'HY2Y^?>=^=V;2]M&A@^<G#L>=5BPB]";7G at N??AIB%;3:I?)`7Q!U(46
+M_4&#:A:I8;+?;E8IT1Q6_2(21-,N'ZLZ$BXXABW>X"YS-RH+++V\L`BW]&_@
+M at E27YS[BV,M<=7&Y#)6#9`S-Y at YA+OU="Q[2!K1HRSE"^BM#%^K&0TV+J)6M
+MAW-!KB-[(#_7Y=E'$"9VJ#)K);"3(\OSX_)04.KPUTM[BH^BVS$#09E=Q>$7
+M<>L=S5O.>TO8-=B+<22!O*Y.KB77!K:06P+[R'V!@^1+Y$L!4\`:L*&=1JK$
+MVX10I,3'A9`+3E$,[SKJY;V13IHR$7$;8H`]V2^:$R0O4VE[(B'1=AH&V#O_
+M9KU:8^.XJO"],[/S6GMW=G9G9Q\S^YCUSGJ]C]F'U^NUU^F:N+'K)":-"W92
+M3`E1<0I-6R?@4*E"5GY@"R%4I"II48 at PHOW#'U2E5BI5)6I=$TH%D0`31:EH
+M452>`@F!4(EWAW-WUU6+%`(2LYI[C^X]<W?F^^[Y[CEYA*VD2<Z%?*Y=;-8A
+MNX#OLR0B8D3#ZG60K=I'C at 39Z*,8VF0,R+\3?50"=D%'HN`T@'JAG?Z72Q!Z
+MGG:%T(XV%X9$PC#'<%N5"%`@7ZE*$H]YD\<GQI-F_2C>6_QX=7`L-.^@)H8_
+M\=#<P1G#/X7_0E]LKDRD#^2"6:KO8,$1;S8FRK3F=OL$0V#7[T_5]XP]37&'
+MPAY.ZR&:E`3,KM'K*(&>;WPZY4PI56=5F>?GI#G/G'I$/Q(YP2]*BYY%]81^
+M1CCC_W)D55CUKT6>0\]AE>=X0:C)L(%YU<]QLW(DHD<XP<\[@H8A>6FL>0B4
+M29X3!#\E7\8[&Y-JA$M0.I at O33Z=P)!J;RTL[P143^WMY6:@+?E;)%.#:HOH
+M%>>`PHJO=SM28&'`!D1<#9-CLPT*J:DX3#84U%(F&<&7!S."\]JE7C7I-[%6
+MS*1;O^9%073QK9\F!X(%>CW*^@Q)UYJW\9OQ*6_*(]#1*%-;;!:\+M5#W3P2
+MD]EHIU8=L/_D^`;@,X+YQE=-SBS4E%JX%A\Q6('C7;R;]PF%@)$VSOA6?4**
+M at N*2J5)5NLJPI4JH4*C)N4)8"VN5D$\!2GD>ZEABL;-R*5P!CUQN5C:,N)$K
+M5$IA</#%-:4WX$GV#R.7PZ.-I"0V&G#6?3RE2`4)HW9>TFST3BHL/,#40H6V
+M$)*16`W73,W(47$S#B,O3<9,;(Y:6TL`,`'S;>GFPG)SJ6,O[RQTK&UR4M0_
+M`GB=DS8W,](F1U#?A.(6"EQB`?Y+9,=^F`&`N[Q+@)FB.QT(68<7A1RP85P%
+MM_80?;D^TNO<>+%'RV=;P9C>NL*P;`_UF];[%.?HH5J_+,8L?"I?3`>2IRY1
+M&9^OG,?K]%DNE%)RD582OZ@]J"9#K*X[S,F=/PH\RU!6\^<.#OIWG\QP0&(P
+MK2^-+[1NX;,]OI.97(+I\@BI#FC#>32*I<;+O^4P at QB,%.3':<JB"OK0?'S>
+MF$\L^U>95<>&MJ&_P;Z7DO=Q4^XI:5)EABK51$7D6;'"JKPH5OR*DF;ATU at U
+MK?2GJPEHX1ZJ5L1J0JG)8KHF5\#M'/L\N\%NLXQJR0D6[FJB6JVD$ZHBLGQI
+M!+ME>D23/*,T8G6K1(<TK5"DPV*5%15FU..Y;Y3XCGK8<)&D4&/%NK5U<VN!
+M\&0M6VWVT#UJ?4>M=UHRD,]SCHR468`>.L)=FSYID^?`Y`BI74:E^BZ?NT21
+MZG.P&U%NC".8Y$;5;IP!?UR'^';"5/72A%%\PZQ4M,RH7APP\<?*\^'O8[X\
+MF6\=U]6H*?=Y]JKKNBLZV+H^-)CY_961[#1]7L/>B'<^O_?^_+0_)-.:QEBI
+M?[2>F,E3FD91`=D['JN&/V/<SD5$;P^G:4YC#Y[%B;D8IX'&:ZT&_1/0>`MR
+MU>\V'CL:Q)RH!OH'TMEI82(\G?UD^$1V35S+/IM].?NKK&LJBU,9,9N!Z'<Z
+M:W(`TE-!F)6SV4Q6<`:",,=;24I6:$OS(M9(3FBN`E?8G2L(/K3BP[Y2=`6V
+M$,E9MQ<VI2X#(%/-S7O^/7"(3@':N['BC2LL*8`^"!<+?UBP=H][F>!.HB:I
+MX1=*@;S8^X=7Z-X^+8J]Z;2[]<;A<Z>'/SN:"RWZAY]BF=85HUS"-^GS4<SW
+MFBY=;[Y/.?EA,12 at J&C4D4_OO'K]M>&Q_C(4(%DA)%*7IBW.:L>!?1M?H&UL
+M0Q6I-]QHC$(A!Q5D'%^/7_IV().9N26]AZR#D,- at 8)FV;^]@^_AQ\N00_+Z"
+MWL(R+N"C>(WR4_/T`,,RKS at ..6ZP9SF)>Y4_P%\4ED6?^"VGZ;S:L]*[QS7@
+MNN`VW-<]/L^._*R\[96]__0]I8C*-?\3_EOJU<"C@>W@,\%W0F^%E\-_UB[J
+MA_5?1+X3I:(78MFX%/^;\8SQ at W;6B,DK(!^\-5 at X!#>+[GKA;D_1"#$.ED.(
+M[XX([59T]O2ZW))']L+*BE\-!$-A38]$8Y#B$+U`?4DSU9\>R&11+F\5BJ7R
+M8&6H.EP;&?U/_UJ_^XO]ORX&K4$;@;J-1BX4@[K"0B4T at NY#^]$1]"!:0(^@
+M)]&YF->VP2^&^B$O(O,-F#_8GC^&OM"9M]^U;]C7[6W[9_:;]H_MJ_:/["W[
+M=?LU^X5WTA\`>>>+OJL'CS[778=&,MHEAP%;[MHL6'V$84:`D0#LMXY-P;?-
+M=&T:/#[5M1FP5[HV"_;WQ at _-[+MW?^:!1TX^?#IW^/&3QQ[[;T;0.#H$Z^]#
+M]P(J&?0`8'82/8Q.H\/0+J(OH4<!I5-W],J!W^-@'T-W7NE_]>F@,X:6X!O/
+M(8*`!+\B0MSOV!_"&-YEY*\'0M]\R%W_._9T=O;KQ?V?W^WMK[4:W!<=UQ#9
+M[EW_?PDP`(#,`-4-#65N9'-T<F5A;0UE;F1O8FH--R`P(&]B:CP\+U-T96U6
+M(#@T+T9O;G1.86UE+T%03D9%2RM4:6UE<RU2;VUA;B]&;VYT1FEL93(@-B`P
+M(%(O1FQA9W,@,S0O1&5S8V5N="`M,C4P+T9O;G1"0F]X6RTQ-C@@+3(Q."`Q
+M,#`P(#@Y.%TO07-C96YT(#<U,"]#87!(96EG:'0 at -C8R+UA(96EG:'0 at -#4P
+M+U1Y<&4O1F]N=$1E<V-R:7!T;W(O271A;&EC06YG;&4@,"]3=&5M2"`X-#X^
+M#65N9&]B:@TX(#`@;V)J/#PO3&5N9W1H(#8Q-S8O1FEL=&5R+T9L871E1&5C
+M;V1E+TQE;F=T:#$@.3`P,#X^<W1R96%M#0I(B;Q7>W!4U1G_G7/OS280PB(0
+M\B#DKI=$3'8%:2`)$%R2W00:'PD:NXL"N^1!>$0"9E(>`Y,1J<Z"&6QYJ54K
+M=:ROR`VE=3-J)U5:*HHB.HS#B.`8+0-$D4'42O;V=S<A!:?C^$>G]^3L.=_Y
+MOO.=W_?[OG-W`P$@&6U0X*UM"C<GGQOU-*`G`V)Y;6N+_D'"FK_2XFU`*VUH
+M7MQT<.7U:X$$)WO+XN5K&B;_K3T=&%4`#.UNK`_7G5ES8C=P[3GNF=K(A6$]
+MSH=XP/V4QS<VM:P>/]T:2_E9RA.6KZ at -#^])/@AD7Z"<VA1>W9P82'R5^P]3
+MUN\)-]4_LN/\5X!K%_$4-J^XM\6R+>%:;>N;5]4W^\Y_-I_^:.]8I+4091$R
+MM!J,5)J0`5C'V$^Q?Q6;9\6T`GABSUN?*$2`WPWT_L>%Y[$-KV,UUG-^'Z*8
+M@#R4DY5G<0N"Z!%>3(+$8WB`=A>1A at HL$R=YQ at MHQ#NTRX$?.Y'*]3JT<G\N
+MRFC[)WR$0MR%->C$FSA*WV[,10WVRP[K"&[$+AP6+ZN*M96>;L!4-.%^M%LO
+MPH,2>FK#KX0A[K5Z,9^MB;@>QFY\8!UA7`X,B6.<0<MJGM0IDL0XX16;D(`4
+M.(EG$JIXTIW<L4\DR at IK%7>-1`&\F(79"!#W.FS!HT3V!HZ)!;)%Z;!\UFO6
+MNW:NN#^7*(KQ<]R&56CA"3OQ9W3A.W&G3+'&6T]97=8!ZTO:2FC(0C;WE*"2
+M?N=C,=KI-\J(/\0QMAY\+I+%=#%+5(E-8I<X(-Z7?L6C/*#L59U:MO4MQI*9
+MZQA-'E$78CIQWXV%"//DA_`T.HCQ-"Z*-#%>%`B?>$IFR>ME at UPA]\LO547=
+MK/98I^-()#/A()-3B'PF;F:K(6^_1(2(MN(WS-T.(GL6W7B+F3F!7GR'2T(3
+M#I$H)HB)]#Z'^#X4'\L4F2H-62I/*/G*3&6%^I[:H_EC[;'S5L`*6BNM5QC]
+MQSS+CMSFZ2XL(.(ZQM[*;&]@[NRVD>U!/(EG\!PK;`_^PI/_P;/?P1$<Y_EG
+M<)88>G$!W^(2^H at B63C91HNQ;#G"0]9F,JM5HEJTB at VB36P4]XMV8GQ<[!.O
+MB(-DLD(&Y'RY7CXH7Y7OR??E1_*4/"N_49*4+,5%CM]4*]1YZHM:BK906Z>U
+M:7L2IO9=B!7&?A%;$&N-';(<5HJ59[5:ZZTGK"BS>B[.9"*&8PP,9B2?6;T9
+MM[)5L=+F8Q%JT8!ES,UJLKF3?#[&")_#B\S3RZRE at XSN/6;].#YG9-_@>_0A
+M)B!4\IS.>LX3DQE1!2.Z0]2(@+A;+!`+18-H%"O%6K&.,6YF:Q</,\JGQ![1
+M*=X0I\4%<9'IU62R'"%UZ69F*F0-6YAUT"37R0?DK^5V^:A\4CXC_R!-N4^^
+M13:^D#%EJ)*BY"B%;'[E9N56):RL5-J5WRO/*"\H;RN'E5[EDM*G]*D%:K%Z
+MF[I.W::^KAYC.Z>-T"9J15J-5J<MT^[1(MIVK4/;JQW7OD^8FF`Z#,=<QWV.
+M!QT['1UX`G_'([QI5SZO831^ZO,87I*'I!\G<88,;)1%O#LWBI=0I<[#?KY]
+MQLI_R1WB("NK$K5B#U+YKI-:);+8TY2=O->P/F7O93\=*^5[D+K8:]9191R]
+M+[6.:FW,880W_AK>B$,XI2:)6_G^6*@4L'[K^&:9%+]]\$Z^<=+$&SSN_+SK
+M)UR7FS/>N-:E9X_+&IN9D9XV)G7TJ)'7C'`.3QF6/'1(4J(C05,5*>#V&^4A
+MW<P-F6JN,7NVQY:-,!?"5RR$3)U+Y5?;F'HH;J9?;>FE9<,/++W]EMY!2^'4
+M9V"&QZW[#=T\Y#/TJ)A7'>#\(9\1U,W>^/R6^%S-C0O#*+A<W*'[TQI]NBE"
+MNM\L;VV,^$,^^NLJZ?CBS!"/&UTC4DLZAMJ>392%US>F<;`M_&:&X?.;Z88O
+MKE-R_.$ZLZHZX/=ENEQ!C]L49;7&(A-&J3D\?V![W+/I*#,3RNA:7V('@,UZ
+MI[L[LB7JQ*)0?G*=41>^.V`JX:!]Q(A\<XSA,\>L[4G[CWAYYM\RH/R,2E/F
+ME(?K(^6D9O/L?C%D2^$ME"IOU^E3;@H&3+&)CG4;K at V]/XAZPV^OA);J9I)1
+M:C1&EH;(>4;$Q-PUKKT9&=XNBU]N?CUR1\!PF3=E&L&P;VSG*$3FKOECNE=/
+MOUKC<7>E;9CN(F5=GEF>6?8XW96VH7_\Y\;^]2/=0^-V^T]RK)P[R)JP at 1AS
+M&(6IU^H$$#`82I']45^$2&T1S?@$!4E88B:5A2+.:3:G6H[3T"-?@VDT>L]>
+MO1(>6$G(<7X->VHG>[!@J+\\-_/SS;P\YISYJ6>:"&UF?&&*Q]UJ9AK-3MW,
+M)%6H(H_AX+2)Y-WELE.V.>K%(@IF6W6 at 7]:Q*',OO!/S at Z8,V9KNRYK1-;:F
+M[;)F<'O(8#7N at _T3;+29F#OX-]R9.M+?.,T4J3^BKH_KHYCLKHPBJ2K0*41[
+M,"JL35'XLKJ0!&7A`JI_9I?[$A_CIU#@YD*>B[,I;KV<O)>3[:`>T2-SZB)Z
+MN=[(@E9SXB,5]9'@1(9^>V`)/^\(N$QO,'-P6A\,3J.?J;8?->XG$J2'I0,>
+MEL8]T$$?C0K=E4QR;E6 at .F"V^3)-KR_(I/)^=)/6;M9!,$BKHD&D'-<O21O`
+M7$S,17F<3.OW<CM]T$4P$NF76(7=D4AFQ+[H_7)4X(<+WH&%*.(.>!>BHJTJ
+MKFHS7)GV at N$R7(05]/&HZ;P_EPLTBAD_SG#)E0S/)-J2.,,W_8\8]OX4AF?]
+M)(9+_SO#9<1<:C/L^_\Q[+^"8;O"$Q"S_Q'YI&]WW^[$C$3(G*N^'X>HGUJ]
+MDA.5_RS(XMB[')W:`8SA.%6%5:MDH4`6XQ9F*Y]W(O]5^5N1S!_'V7+[WJKB
+M[*C<YLWGN#5AJT,^/J=CCNQ8U;'YWZQ7;6Q3UQF^Y]CQM1-?V_%7'`?GW"0D
+MUXX_\N&OQ"2Q$]L)Y(-ZD#`"#45$A8RM+$VT!`*DM)`$DA9Y*Z4J6X:F::B#
+MPH)AZ$:4CU(F(HW0;F+=CZ70'^F/5DLG;14_2A/VWF-7=-+VH]*N]+[/.>=]
+MSGN.'Y][[CEX>F!Z"I\GYT-XFDR'\'G^?`)/\],)+.+DI9"/F$0\E6HA1A%/
+M`AA$?`Q`+^*C`+DBG@#0B7@<0"OB,0"-B(\`<"(^#*`6\2L`.2)^&2!;Q(<`
+M5")^"4`IXE$`5L0'`10B/@"0)>+]`'(1CP#(1+P/`":S%P")>!B`$?%01`N(
+M$&)42#JH*2.-1ER/]C#]#(=V4[^5^HW4&ZG742^_W,_]N)]KS$8?P/F?0W>H
+M[Z7>$-'T<?_HXQ;[N#M]W!_ZN.NH#RX_'+)1GQ4Q=G#S'=Q,!S?9P=5U<-4=
+M7'F'E.J?<$G at T"+U1=071O):N4>MW%]:N3^U<N=;N=Y6SM?*E;9R(OIK)'>,
+M^WB,^^T85S;&E8QQMC%HO7!9VZ9E5%?AS-,&"3Y,)5SD7?0^P\.O).B]%'^5
+M-.:CFTQ(+M6O9W"6(12O,%%4"O@[II/B.4902NW;4PD_$=&V5*(>X-E48 at O`
+MEE1B&T!W*K$#AO@^DZ!=.E/\(FG,11L8GJ9<GQFB at YG"$K8#G at -<FR*[H'<L
+M%=U!&E6HD8E26 at .,O`EPE33Q1 at Z9,FER,S/4@$EQ[C*9)TLA$6U*D<\A3VF*
+M?-HIRE&*/!1$?"Z20QX(B^1NXG7RQX2(H?E6)S2GR`T!NEPA%\@OR=L";?F-
+M0)-,IVF_X$4EP,DT^PT[37G"+J)35\C/A'DR*@T)V0]"@A'[/-D3I6._D(9=
+M=N at -T9WV1;*#O$PV"+3_,SR-MG?2L=>%YDF+G>9OABF@*R3.SY,F.QTX0F@@
+MG*X%TVD#Z9J7T&Q54[2Q(OU+W/`379UT[DZ89FE$2U:3`5(4W46ZB(JHDE?1
+M8;A>)=%HI)9-GF:3A]CD()O\(9O<S28WL<FU;+*&37K89#&;+&2-2KU2I]0H
+MU<ILI5*I4,J5&-X+H_CDDP@<:A%C5. at D4, at E+Z=E'9:\M*?`]H.1$C.MC18\
+MR2CQ4;!QL"- at KX`=`AL%.P`V`K87;`AL\LDGEZ3>LW at 2'[BL2Q</X)%,XP@>
+MSY3&\=Y,:2\>HB5XB2])8P*F6AE&^JC,H-=F%$?AF#&#CA?,P"'F>+?%;!X*
+M6\+ZAMS:YMA_<=LSWOGTL7SG#LYO/Z at ML>\&+-,O0'J";E!_\0I+[K'D'98R
+MVC8"(4D)24I(2H3D/3:9(5AL,R=A;Y\Y:^N>J98*3VS=;3,>Z3PZB\.X/AZ;
+MQ0T2=&^>91[@<'R#U,X\B'4#;0NEP:X=!AH3D@!HZ"Q#)!I,YBRE]:9I/&Z0
+M:`D)@(:'&9[2>#Q,:8L2[>)`*!Z[&`I1BOP:,T`I`_)KWZ),_2=EBE*F,I0"
+M2A$$H$0%B7*Q6`#"1:&8AE<_#7>FPYYTV$/#P:=A>SK<D at ZW0-CY?WR>;_HN
+M[/@/-C:9F7#8XM35H0I6/:.`6PM;\K]R#&8>*,(+ at Z5[IJ(DJX:1P0)HBJCD
+M;)S)4L0Q?*/*(P:9C,E6L''$Y"NQ+)XE[U:MS*(?,3#4EW7+=>O!=RS7,>$Z
+MW3)4P555EN06Y0I@!D5`?!S*JOEJ3I3-?5TC??DQ0YY\)KLGFV(X)L[<BXQG
+MR^.QK>&^\#[YD&.H8CAV3#[A'H^]'56KO1J?VF_U6GU6?T',T533U,GOY,\4
+MGN%GO:)/],]YYWQS?D-.43#(Z]5R%9:I at WI],$CT/&_-LU1B(<Y&W$6>YM)@
+M5:4JVI`C5=9Y6JR*4&,SWVRWZIKX`1[S?$MV2W/%72I<C[/.J;N)=!\MY>IK
+MARKJK7<M5B:\].72T`*4K18HWI[0>)P'=;<1,/*87'U>+=)9YZHJ40_3PY25
+M%+,*D]'LK0X&_&5Y9H*"#2B,JLVL!K$R1286"".I-4^#2HK+_+Y`$((0HY5@
+MP(L_;ZKX]:O[X]XW7SWD<>9Q66:Y(N=%E0S+Y?)G"TVEVAR529NK-&H:+'VC
+MM:6.`D[?U;`NZJO\WI%W;WTHL\:^6CB=6/>OCU.S#O-J33NG0ARKXK2:E5,_
+MZ3IEUG!JM88U:"*FL>=\PNH)3^%@H+%`/S;RY\4E:?-<^6"E2]:;]0+C8XY'
+M`KLJ4;ZNV=7E&G+)W>5ZK<%`]`Y'.<;:JE6KS/X<H0KIRW>Z[6ZMHE0P:[.\
+MOD`^?!]06\3D\-O=Y>6Z[8Y^QPF'S-'B\&<'_&F=ARIZ+,XZW6U)ZT?+NOO+
+MH'$8E)>6D:1\A622SED@]&W=S8RZ&85\`I69];(ELNR,A-YJL\GXC?)!0TG0
+M&PC21EFO2RAV&3C.M*.IU/-0\_#U-7=^WK)5$(HK3'GZKC7$^OM9S;7Z]A?/
+MM#\OGZ]QVHQ57+;J5ST+T>7AE<<KU]=7%OK<1?I25J4>;]XOVQ+]K/^=]=4,
+MO"FZE<VR.[)CC)JQP1GGO<C!G>YA]Q'KA/MP[(3]+=?)F#+'E5.):^3-[?)8
+M]G/NC;6[72.NP9JWY">SN9BM*<K+S$*#+&3B&TN$!JVZRA>,F\VVD$R(A$(V
+ME>\-OOJZ2O"P-F&M-C_8VJX.]3N33NQLUX9>BI^.XWA<$?*>ZP\F at SC8T5ZQ
+M<+]G<;FVHF=)=Q_LHR5)TN5'UOPEBR2FE<HJK=G:;XR1'"S?W-J,O'G2TO3[
+M0%R%20\%H4SP(*EBA`@3"'J0M#R#94)&\#ROJ:00@>SP%PATW>>9TS4_ZC7P
+M&[>\%@KU'SLU[3!7.=[76D\.UFU>F1P\F,_7\FLCGIJ_7]@ZFC.Q4Z%X_%.M
+MU:"U%BS\;>'!J<OH5FG]IY--;5_L^?K(P#-U#G.^L6UJ\UBU%>&)J*[$YO`7
+M5EE<:[:].5?[;]:K/[:IXX[?>_=^V,_.\_GWLU_LYY_Q"[9Q8B>.XCB)'6=.
+M[,3&)"D55"GI:/C1P1)^166L%-8"!:V_8&PMJ!*L6Z?1_;%UW=32K:(B+&S+
+M5&D%)D&G;@.DP11-FP32IA'OWK-#T;2VT[9[]MWW3E^?=9_[W.=SSURQ!;S?
+M/`,IE\ON&QD]^?B/GEX+U`N`O7J+/H7W9H1HS9SI6E%,%[M7K- at 9W9D^&&7I
+M'C;7W!A:F43MP^VEY,KSQ=\4;Q1UY?**WE(I6YS.;90+_N+0<*Z-;@HB`Z-)
+M64I<1"X['4:&3O652UF&;C,B1\;A=1:<:,R`D&0*!IO:$@G)%(_3N;X^R93-
+MEB(=7*IC9&288_NR"3G.67)N77!4;D)[@P0*]@?'@D>";P3I8'"4H]%8_-'X
+M5^*OQW\<OQJ_'F?C)93M>4$(Q\)+HJ2T6U5U4C8VG$XKBIM&"VCA(+T\S.-S
+M at ENA%O`XJ"N4JF%.A0*UCRI8836V=PH`W5X(_X.X?1#Q3\QJTO=X@'>1K9\?
+M"Y8MA1=8QSKLK*)8ZO9WF'N(&E449?-_W%.>>I=M3W;8H3(/]$DMWO!4Y<6I
+M6-E\E.+-)M%J<71)W."1`8_-1],O0. at PY][H2[=F3[Q+0JO0^W97JMW3?OP<
+MI)*ER3]H=DZM>V8C/&3S#OMV'3B]^E1FP/;`W8\:1)/5XAX4^/6[D+/;X+.2
+M+7JD$9R_V/C8\W\EY[1&K2#^^J'57UOS77).9]&%$/2A.+NX[EM?/%+SHF3U
+M%OPI]B(>-(*)S&">&M07&E9;5HDSU.Z&KS:\K/^EZ;SCBNF2XX;AINVFXX[A
+M[S:35J?5DZP>+T`\1%%<J)$E0U8=GWI>(`07DS(6W:[8AS.7!7P(Q]53N*#B
+MNG4\6;.%NGQ9 at 0+N/=&_-EIY=<\73/[QEP_L(2N'WWGOZN'7SKS[VZ>WW/G@
+M!T/+'[QQ^7WRS1]^Z>+\Q9,O7KWP*\6SURVN at 6?A81`!W:":F4ZY\UV?2\^V
+M4FQCT)@P)EWM[@+8U?4S_A)_C;]AOA/1FRT6F\^?2`8"Q@@$_D at F/!%8Y at _S
+MT]2<W.#GAQ`,2!&JTRBTR#[)$F_I]%$!2]R8I""43/A'+3G4(K"=(4D7"?/)
+MMXA]&7]WRB-FQ`EQ6MPKGA09<:`WT",;T41 at .K`W``,!KK<'*_Y]QCIS>5Q8
+MN(ZIBW&YOG"?E=;)B15)I:=*UH\)"M""XK).M3VKTA47S2Q?YRR,W\_(4#!I
+M9PS$/0:K`L76W-=N]8)0C:GDDE&_DN[F%SFZ-<:9.)+H82`DD_V=&Z:V[IL[
+M?W%9:ADO<,ZV$H;[VTAZH/"]N)SOC7S_P..+NZ-)^'[`H_5Z"-(7(S0\>VY-
+M;-7^0W^Z]`$R=VV(;#<TVR at WM;ZI</C$GL4%(13\:&Y6U:<V;"!^^!R(@A.9
+M\OEFHF(@*)IF&='E(INGI#_+LK]Y*"(9W*36)M-N"W96R6*-D2Z79'*[I0AK
+ML"6TK%MV<?I\C)$("<VXGW&3[H'8\MA\S5W'%;`%@*4"<W"^=TDE"".&6D7:
+M5->!?Y$!K`/\;&L+&,>XVJP,"_')K[DK1C%&J(YP_RE7NNU*#G&:)8A';8/O
+M/1A+)**21ZNG=)K0T90_+$:/O\8;W4%]P"&7WZ;A<SJ6HQ>?"#][LT>.=@G(
+MQK!7GBP]63E*KFD;<;H]%/1J4$#!J52]13Y,/0Q"X#N9AV at 7[::E5=)Z:4;:
+M+QV3-(S03]^T_LU*922OQU,0!!**)*0 at 9\[07 at CM)#3;!;M=,D%!,I$DM!_C
+M+8R2FQ=S`1TIRQ"1>5+FFN6E:XFPI+`S'SJ[E?O>_%U"(2D*(YI-DQJ4!IB&
+MA!/-HPL:4J$H1OE"S-G]<Z=08R*62;._+:E>^S`H-KN;,!#*386I74UJ&MK4
+M7B+A3U[2H,FI"02U-$=!@NA\57_Z31J9G3$QX^17/=656%ZTZLAW1)X-5[:9
+M*9HD61US)7=WK<G;UCAJL.Z;3/J`6I(@23#$<7(C_#*\0KU%#]._`S6%(]36
+M at N\K."*<^,N`SRS$9Z=\>B&5"E)J3`.&!1J at _5_G_'\6"E1PC?`#<>L!CX`-
+M8`N8!MO`CFJU/K(>CTS51JJ_KYZJOE)]J?J-ZM>KQ_XM/'B>ZE\^]3\U>$:B
+MGFL&2R!3.#;78P9'3<I.45H\(H#.>DQB?UI9CR'.6%N/*1SOK\<,CE_/5LH#
+M_?GPV*8MD]NCA1V/;-ZT[C\;`ED,2!D,@'Z0!V$P!C;AQ4^"[6`$UQO`3K`9
+M`[+M$[.BH`!VX(S->.23Y_IOLE1D.'`0K_(L1I!4]RP/`/M']O-X_<327EQZ
+M5KZVUI"^31 at U:O]<Z]!C2ZWR1H/?;G?CKG8I_Y\"#`!B$X:D#0UE;F1S=')E
+M86T-96YD;V)J#3D@,"!O8FH\/"]3=&5M5B`W-B]&;VYT3F%M92]!4$Y'1$8K
+M5&EM97,M271A;&EC+T9O;G1&:6QE,B`X(#`@4B]&;&%G<R`Y."]$97-C96YT
+M("TR-3`O1F]N=$)";WA;+3$V.2`M,C$W(#$P,3`@.#@S72]!<V-E;G0 at -S4P
+M+T-A<$AE:6=H="`V-3,O6$AE:6=H="`T-#$O5'EP92]&;VYT1&5S8W)I<'1O
+M<B])=&%L:6-!;F=L92`M,34O4W1E;4@@-S8^/@UE;F1O8FH-,3`@,"!O8FH\
+M/"]3=&5M5B`P+T9O;G1.86UE+U1I;65S3F5W4F]M86Y04TU4+T9L86=S(#,R
+M+T1E<V-E;G0 at +3(Q-B]&;VYT0D)O>%LQ,C0@,"`V,C4 at -C(U72]!<V-E;G0@
+M.#DQ+T-A<$AE:6=H="`P+U1Y<&4O1F]N=$1E<V-R:7!T;W(O271A;&EC06YG
+M;&4@,#X^#65N9&]B:@TQ,2`P(&]B:CP\+U-U8G1Y<&4O5')U951Y<&4O1F]N
+M=$1E<V-R:7!T;W(@.2`P(%(O3&%S=$-H87(@,3$V+U=I9'1H<ULR-3`@,"`P
+M(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@
+M,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P
+M(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`U,#`@,"`P(#`@
+M,"`R-S@@-3`P(#`@,"`P(#`@,"`W,C(@,"`U,#`@-3`P(#`@,S at Y(#`@,C<X
+M72]"87-E1F]N="]!4$Y'1$8K5&EM97,M271A;&EC+T9I<G-T0VAA<B`S,B]%
+M;F-O9&EN9R]7:6Y!;G-I16YC;V1I;F<O5'EP92]&;VYT/CX-96YD;V)J#3$R
+M(#`@;V)J/#PO4W5B='EP92]4<G5E5'EP92]&;VYT1&5S8W)I<'1O<B`W(#`@
+M4B],87-T0VAA<B`Q-3`O5VED=&AS6S(U,"`P(#`@,"`P(#`@,"`P(#,S,R`S
+M,S,@,"`P(#(U,"`S,S,@,C4P(#(W."`P(#`@-3`P(#`@,"`P(#`@,"`P(#`@
+M,C<X(#`@,"`P(#`@,"`Y,C$@-S(R(#8V-R`V-C<@-S(R(#8Q,2`U-38 at -S(R
+M(#<R,B`S,S,@,"`W,C(@,"`X.#D at -S(R(#<R,B`U-38 at -S(R(#8V-R`U-38@
+M-C$Q(#<R,B`W,C(@.30T(#<R,B`W,C(@,"`S,S,@,"`S,S,@,"`P(#`@-#0T
+M(#4P,"`T-#0 at -3`P(#0T-"`S,S, at -3`P(#4P,"`R-S@@,"`U,#`@,C<X(#<W
+M."`U,#`@-3`P(#4P,"`U,#`@,S,S(#,X.2`R-S@@-3`P(#4P,"`W,C(@-3`P
+M(#4P,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`P(#`@
+M,"`P(#`@,"`P(#`@,"`P(#4P,%TO0F%S949O;G0O05!.1D5+*U1I;65S+5)O
+M;6%N+T9I<G-T0VAA<B`S,B]%;F-O9&EN9R]7:6Y!;G-I16YC;V1I;F<O5'EP
+M92]&;VYT/CX-96YD;V)J#3$S(#`@;V)J/#PO4W5B='EP92]4<G5E5'EP92]&
+M;VYT1&5S8W)I<'1O<B`Q,"`P(%(O3&%S=$-H87(@,S(O5VED=&AS6S(U,%TO
+M0F%S949O;G0O5&EM97-.97=2;VUA;E!3350O1FER<W1#:&%R(#,R+T5N8V]D
+M:6YG+U=I;D%N<VE%;F-O9&EN9R]4>7!E+T9O;G0^/@UE;F1O8FH-,30@,"!O
+M8FH\/"]3=6)T>7!E+U1R=654>7!E+T9O;G1$97-C<FEP=&]R(#4@,"!2+TQA
+M<W1#:&%R(#$R,B]7:61T:'-;,C4P(#`@,"`P(#`@,"`P(#`@,"`P(#`@,"`R
+M-3`@,S,S(#(U,"`P(#`@-3`P(#`@,"`P(#`@,"`P(#`@,"`S,S,@,"`P(#`@
+M,"`P(#`@-S(R(#8V-R`W,C(@-S(R(#8V-R`V,3$@-S<X(#`@,S at Y(#`@,"`V
+M-C<@.30T(#<R,B`W-S@@-C$Q(#`@-S(R(#4U-B`V-C<@-S(R(#`@,3`P,"`W
+M,C(@,"`P(#,S,R`P(#,S,R`P(#`@,"`U,#`@-34V(#0T-"`U-38 at -#0T(#,S
+M,R`U,#`@-34V(#(W."`P(#4U-B`R-S@@.#,S(#4U-B`U,#`@-34V(#4U-B`T
+M-#0@,S at Y(#,S,R`U-38 at -3`P(#<R,B`U,#`@-3`P(#0T-%TO0F%S949O;G0O
+M05!.1D1**U1I;65S+4)O;&0O1FER<W1#:&%R(#,R+T5N8V]D:6YG+U=I;D%N
+M<VE%;F-O9&EN9R]4>7!E+T9O;G0^/@UE;F1O8FH-,34@,"!O8FH\/"].=6US
+M6S`@,38@,"!273X^#65N9&]B:@TQ-B`P(&]B:CP\+U,O1#X^#65N9&]B:@TQ
+M-R`P(&]B:CP\+T-O=6YT(#(O5'EP92]086=E<R]+:61S6S(R(#`@4B`Q(#`@
+M4ET^/@UE;F1O8FH-,3@@,"!O8FH\/"]3=6)T>7!E+UA-3"],96YG=&@@,S4U
+M,R]4>7!E+TUE=&%D871A/CYS=')E86T-"CP_>'!A8VME="!B96=I;CTB[[N_
+M(B!I9#TB5S5-,$UP0V5H:4AZ<F53>DY48WIK8SED(C\^"CQX.GAM<&UE=&$@
+M>&UL;G,Z>#TB861O8F4Z;G,Z;65T82\B('@Z>&UP=&L](C,N,2TW,#$B/@H@
+M("`\<F1F.E)$1B!X;6QN<SIR9&8](FAT='`Z+R]W=W<N=S,N;W)G+S$Y.3DO
+M,#(O,C(M<F1F+7-Y;G1A>"UN<R,B/@H@("`@("`\<F1F.D1E<V-R:7!T:6]N
+M(')D9CIA8F]U=#TB(@H@("`@("`@("`@("!X;6QN<SIP9&8](FAT='`Z+R]N
+M<RYA9&]B92YC;VTO<&1F+S$N,R\B/@H@("`@("`@("`\<&1F.E!R;V1U8V5R
+M/D%C<F]B870 at 1&ES=&EL;&5R(#<N,"XU(&9O<B!-86-I;G1O<V@\+W!D9CI0
+M<F]D=6-E<CX*("`@("`@/"]R9&8Z1&5S8W)I<'1I;VX^"B`@("`@(#QR9&8Z
+M1&5S8W)I<'1I;VX@<F1F.F%B;W5T/2(B"B`@("`@("`@("`@('AM;&YS.GAA
+M<#TB:'1T<#HO+VYS+F%D;V)E+F-O;2]X87`O,2XP+R(^"B`@("`@("`@(#QX
+M87`Z36]D:69Y1&%T93XR,#`W+3$P+3`Y5#$V.C$U.C`V*S`Q.C`P/"]X87`Z
+M36]D:69Y1&%T93X*("`@("`@("`@/'AA<#I#<F5A=&]R5&]O;#Y7;W)D.B!C
+M9W!D9G1O<', at 0U504R!F:6QT97(\+WAA<#I#<F5A=&]R5&]O;#X*("`@("`@
+M("`@/'AA<#I#<F5A=&5$871E/C(P,#<M,3`M,#E4,38Z,34Z,#8K,#$Z,#`\
+M+WAA<#I#<F5A=&5$871E/@H@("`@("`\+W)D9CI$97-C<FEP=&EO;CX*("`@
+M("`@/')D9CI$97-C<FEP=&EO;B!R9&8Z86)O=70](B(*("`@("`@("`@("`@
+M>&UL;G,Z9&,](FAT='`Z+R]P=7)L+F]R9R]D8R]E;&5M96YT<R\Q+C$O(CX*
+M("`@("`@("`@/&1C.F9O<FUA=#YA<'!L:6-A=&EO;B]P9&8\+V1C.F9O<FUA
+M=#X*("`@("`@("`@/&1C.F-R96%T;W(^"B`@("`@("`@("`@(#QR9&8Z4V5Q
+M/@H@("`@("`@("`@("`@("`\<F1F.FQI/D1A=FED($UA<G1I;CPO<F1F.FQI
+M/@H@("`@("`@("`@("`\+W)D9CI397$^"B`@("`@("`@(#PO9&,Z8W)E871O
+M<CX*("`@("`@("`@/&1C.G1I=&QE/@H@("`@("`@("`@("`\<F1F.D%L=#X*
+M("`@("`@("`@("`@("`@/')D9CIL:2!X;6PZ;&%N9STB>"UD969A=6QT(CY-
+M:6-R;W-O9G0 at 5V]R9"`M($5-0D]34U]Q9RYD;V,\+W)D9CIL:3X*("`@("`@
+M("`@("`@/"]R9&8Z06QT/@H@("`@("`@("`\+V1C.G1I=&QE/@H@("`@("`\
+M+W)D9CI$97-C<FEP=&EO;CX*("`@("`@/')D9CI$97-C<FEP=&EO;B!R9&8Z
+M86)O=70](B(*("`@("`@("`@("`@>&UL;G,Z>&%P34T](FAT='`Z+R]N<RYA
+M9&]B92YC;VTO>&%P+S$N,"]M;2\B/@H@("`@("`@("`\>&%P34TZ1&]C=6UE
+M;G1)1#YU=6ED.C9C,S9C93,W+3<V-V$M,3%D8RUB8C8R+3`P,&0Y,S)C93,U
+M.#PO>&%P34TZ1&]C=6UE;G1)1#X*("`@("`@("`@/'AA<$U-.DEN<W1A;F-E
+M240^=75I9#HV8S,V9#8Y,RTW-C=A+3$Q9&,M8F(V,BTP,#!D.3,R8V4S-3@\
+M+WAA<$U-.DEN<W1A;F-E240^"B`@("`@(#PO<F1F.D1E<V-R:7!T:6]N/@H@
+M("`\+W)D9CI21$8^"CPO>#IX;7!M971A/@H@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@"B`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`*("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@(`H@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@"B`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`*("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M(`H@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@"B`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`*("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@(`H@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M"B`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`*("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@(`H@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@"B`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`*
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@(`H@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@"B`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`*("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@(`H@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@"B`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@("`@("`@("`@("`@("`@("`*("`@("`@("`@("`@("`@("`@("`@("`@
+M("`@"CP_>'!A8VME="!E;F0](G<B/SX-96YD<W1R96%M#65N9&]B:@TQ.2`P
+M(&]B:CP\+T-R96%T:6]N1&%T92A$.C(P,#<Q,#`Y,38Q-3`V*S`Q)S`P)RDO
+M075T:&]R*$1A=FED($UA<G1I;BDO0W)E871O<BA7;W)D.B!C9W!D9G1O<',@
+M0U504R!F:6QT97(I+U!R;V1U8V5R*$%C<F]B870 at 1&ES=&EL;&5R(#<N,"XU
+M(&9O<B!-86-I;G1O<V at I+TUO9$1A=&4H1#HR,#`W,3`P.3$V,34P-BLP,2<P
+M,"<I+U1I=&QE*$UI8W)O<V]F="!7;W)D("T at 14U"3U-37W%G+F1O8RD^/@UE
+M;F1O8FH->')E9 at TP(#(P#3`P,#`P,#`P,#`@-C4U,S4 at 9@T*,#`P,#`V,S`U
+M.2`P,#`P,"!N#0HP,#`P,#8S,3DS(#`P,#`P(&X-"C`P,#`P-C,S,S@@,#`P
+M,#`@;@T*,#`P,#`W-C`W-R`P,#`P,"!N#0HP,#`P,#DQ-S4P(#`P,#`P(&X-
+M"C`P,#`P.3$Y-3@@,#`P,#`@;@T*,#`P,#$P.30R-2`P,#`P,"!N#0HP,#`P
+M,3`Y-C(X(#`P,#`P(&X-"C`P,#`Q,34X.#4@,#`P,#`@;@T*,#`P,#$Q-C`Y
+M,2`P,#`P,"!N#0HP,#`P,3$V,C0Y(#`P,#`P(&X-"C`P,#`Q,38U.3,@,#`P
+M,#`@;@T*,#`P,#$Q-S$P-B`P,#`P,"!N#0HP,#`P,3$W,C8T(#`P,#`P(&X-
+M"C`P,#`Q,3<W,#4@,#`P,#`@;@T*,#`P,#$Q-S<T,"`P,#`P,"!N#0HP,#`P
+M,3$W-S8T(#`P,#`P(&X-"C`P,#`Q,3<X,C(@,#`P,#`@;@T*,#`P,#$R,30U
+M,2`P,#`P,"!N#0IT<F%I;&5R#3P\+U-I>F4@,C`^/@US=&%R='AR968-,3$V
+'#24E14]&#0``
+`
+end

Added: trunk/packages/emboss/trunk/debian/README.debian
===================================================================
--- trunk/packages/emboss/trunk/debian/README.debian	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/README.debian	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,28 @@
+EMBOSS for Debian
+=================
+
+Some programs renamed
+---------------------
+
+Some programs in EMBOSS have a name which is also used by other programs from
+other packages. The Debian distribution does not allow two packages to conflict
+in this way. Therfore 'cons' has been renamed 'em_cons' and 'pscan has been
+renamed 'em_pscan'.
+
+There is a directory in which the program names are guaranteed to be always
+unchanged, /usr/lib/emboss. You can prepend it to your PATH, with a command
+such as 'PATH = /usr/lib/emboss:$PATH' with Bourne shells, so that when you run
+'cons' or 'pscan', it is always the EMBOSS program.  Other programs could be
+renamed in the future, so it is strongly recommended to use this path in your
+scripts.
+
+
+EMBOSS Quick Guide relicenced
+-----------------------------
+
+This packages contains a relicenced version of the EMBOSS Quick Guide. Its
+uuencoded sources (in MS Word format) are included in the Debian source package
+'emboss'.
+
+
+ -- Charles Plessy <charles-debian-nospam at plessy.org>  Wed, 10 Oct 2007 09:07:24 +0900

Added: trunk/packages/emboss/trunk/debian/TODO
===================================================================
--- trunk/packages/emboss/trunk/debian/TODO	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/TODO	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,6 @@
+- Use libpcre from Debian (needs #387557)
+- Check if external applications use the nucleus or ajax libraries (as a
+  consequence, emboss-lib would need to be separated into libnucleus4 and
+  libajax4).
+- Design an easy build system for embassy (makefile includes shipped in emboss-data?)
+- Implement tests.

Added: trunk/packages/emboss/trunk/debian/acd2docbook.pl
===================================================================
--- trunk/packages/emboss/trunk/debian/acd2docbook.pl	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/acd2docbook.pl	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,171 @@
+#!/usr/bin/perl
+
+# acd2docbook.pl was made for Debian by Charles Plessy in 2007, and can be
+# used, modified and redistributed as if it were in the public domain.
+#
+# You can report bugs to bugs.debian.org/emboss, and access the latest version here:
+# http://svn.debian.org/wsvn/pkg-emboss/emboss/trunk/debian/acd2docbook.pl?op=file&rev=0&sc=0
+#
+# Many thanks to David Bauer for the original idea.
+
+use strict;
+use warnings;
+
+use EMBOSS::ACD;
+
+my $acdfile = shift; 
+my $embossversion = shift;
+my $date = qx(822-date);
+chop $date;
+
+my $acd = EMBOSS::ACD->new($acdfile) ;
+
+my $name = $acd->name or die "No name !";
+my $NAME = $name;
+$NAME =~ s/(.)/\U$1/g;
+my $purpose = $acd->documentation;
+my $groups = join(",", $acd->groups);
+
+print <<"__XML__";
+<?xml version='1.0' encoding='ISO-8859-1'?>
+<?xml-stylesheet type="text/xsl"
+	href="http://docbook.sourceforge.net/release/xsl/current/manpages/docbook.xsl"?>
+<!DOCTYPE refentry PUBLIC "-//OASIS//DTD DocBook XML V4.4//EN"
+	"http://www.oasis-open.org/docbook/xml/4.4/docbookx.dtd" [
+
+<!-- Autogenerated by the acd2docbook.pl script from the emboss Debian pacakge.    -->
+<!-- Template from docbook-xsl version 1.72.0.dfsg.1-1                             -->
+
+  <!ENTITY dhemail     "pkg-emboss-devel\@lists.alioth.debian.org">
+  <!ENTITY dhusername  "Debian EMBOSS Packaging Team">
+  <!ENTITY dhrelease   "$embossversion">
+  <!ENTITY dhtitle     "EMBOSS Manual for Debian">
+  <!ENTITY dhucpackage "$NAME">
+  <!ENTITY dhpackage   "$name">
+  <!ENTITY dhproduct   "EMBOSS">
+  <!ENTITY dhsection   "1e">
+]>
+
+<refentry>
+	<refentryinfo>
+		<title>&dhtitle;</title>
+		<productname>&dhproduct;</productname>
+		<releaseinfo role="version">&dhrelease;</releaseinfo>
+		<authorgroup>
+			<author>
+				<othername>&dhusername;</othername>
+				<contrib>Wrote the script used to autogenerate this manual page.</contrib>
+				<address>
+					<email>&dhemail;</email>
+				</address>
+			</author>
+		</authorgroup>
+		<copyright>
+			<year>2007</year>
+			<holder>&dhusername;</holder>
+		</copyright>
+		<legalnotice>
+			<para>This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.</para>
+		</legalnotice>
+	</refentryinfo>
+
+	<refmeta>
+		<refentrytitle>&dhucpackage;</refentrytitle>
+		<manvolnum>&dhsection;</manvolnum>
+	</refmeta>
+
+	<refnamediv>
+		<refname>&dhpackage;</refname>
+		<refpurpose>$purpose</refpurpose>
+	</refnamediv>
+
+	<refsynopsisdiv>
+		<cmdsynopsis>
+			<command>&dhpackage;</command>
+__XML__
+
+foreach my $parameter ( $acd->param) {
+	next if $$parameter{datatype} =~ /section/;
+	my ($paraname, $argname, $paratype) = ( $$parameter{name}, $$parameter{datatype}, $$parameter{type} );
+	my $additional = 'choice="plain"';
+	$additional = 'choice="opt"' if $$parameter{additional} eq 'Y';
+	print qq(\t\t\t<arg $additional><option>-$paraname <replaceable>$argname</replaceable></option></arg>\n);
+}
+
+
+print <<"__XML__";
+		</cmdsynopsis>
+		<cmdsynopsis>
+			<command>&dhpackage;</command>
+			<arg choice="plain"><option>-help</option></arg>
+		</cmdsynopsis>
+	</refsynopsisdiv>
+	<refsect1 id="description">
+		<title>DESCRIPTION</title>
+		<para><command>&dhpackage;</command> is a command line program from EMBOSS (<quote>the European Molecular Biology Open Software Suite</quote>). It is part of the "$groups" command group(s). 
+		</para>
+	</refsect1>
+
+	<refsect1 id="options">
+			<!-- Use the variablelist.term.separator and the
+			     variablelist.term.break.after parameters to
+			     control the term elements. -->
+		<title>OPTIONS</title>
+__XML__
+
+foreach my $parameter( $acd->param) {
+
+	# Does a section begin ?
+	if ($$parameter{datatype} eq "section") {
+		print qq(\t\t<refsect2 id="$$parameter{name}">\n\t\t\t<title>$$parameter{information}</title>\n\t\t\t<variablelist>\n);
+		next;
+	}
+
+	# Does a section end ?
+	if ($$parameter{datatype} eq "endsection") {
+		print "\t\t\t</variablelist>\n\t\t</refsect2>\n";
+		next;
+	}
+
+	# Is there a Default value ?
+	my $default;
+	$default = " Default value: $$parameter{default}" if $$parameter{default};
+
+	# Use entities when necessary:
+	$$parameter{help} =~ s/&/&amp;/g ;
+	$$parameter{help} =~ s/</&lt;/g ;
+	$$parameter{help} =~ s/>/&gt;/g ;
+        $default =~ s/&/&amp;/g ;
+        $default =~ s/</&lt;/g ;
+        $default =~ s/>/&gt;/g ;
+
+
+
+	print<<"__XML__";
+				<varlistentry>
+					<term>
+						<option>-$$parameter{name}</option>
+						<parameter>$$parameter{datatype}</parameter>
+					</term>
+					<listitem>
+						<para>$$parameter{help}$default</para>
+					</listitem>
+				</varlistentry>
+__XML__
+}
+
+print<<"__XML__";
+	</refsect1>
+
+	<refsect1 id="bugs">
+		<!-- Or use this section to tell about upstream BTS. -->
+		<title>BUGS</title>
+		<para>Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&amp;atid=605031).</para>
+	</refsect1>
+
+	<refsect1 id="see_also">
+		<title>SEE ALSO</title>
+		<para>&dhpackage; is fully documented via the <citerefentry><refentrytitle>tfm</refentrytitle><manvolnum>1</manvolnum></citerefentry> system.</para>
+	</refsect1>
+</refentry>
+__XML__

Added: trunk/packages/emboss/trunk/debian/changelog
===================================================================
--- trunk/packages/emboss/trunk/debian/changelog	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/changelog	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,120 @@
+emboss (5.0.0-3) UNRELEASED; urgency=low
+
+  [ Nelson A. de Oliveira ]
+  * Using bzip2 compression for packages. This saves about 832KB of space.
+
+  [ Charles Plessy ]
+  * debian/patches/ajindex-fix-2008-01-09.patch: Fixes rare secondary index
+    problem with input files over 2Gb.
+  * debian/control:
+    - Swiched maintainership to the Debian-Med packaging team.
+    - Relocated the package to the Debian-Med Subversion repository.
+    - Allowed upload by Debian Maintainers.
+    - Checked that the package is compliant to Policy 3.7.3
+    - Added dialign again to the Recommends: field. It only disapperared from
+      the documentation; the edialign program is still there.
+    - -dev packages now depend on their corresponding libraries.
+    - Replaced occurences of $(source:Version} by ${bin:Version} to make the
+      packages binNMU safe.
+    - emboss-data and emboss-doc do not Suggest: emboss anymore.
+
+ -- Nelson A. de Oliveira <naoliv at debian.org>  Mon, 29 Oct 2007 21:04:11 -0200
+
+emboss (5.0.0-2) unstable; urgency=low
+
+  [ Charles Plessy ]
+  * Using a emboss/psiphi.c file fixed by upstream
+    ftp://emboss.open-bio.org/pub/EMBOSS/fixes/psiphi.c
+  * Documentation:
+    - Building the manpages offline to save buildd time, therefore not
+      depending anymore on the XML toolchain.
+    - Added a "e" suffix to the manpages, to avoid conflicts.
+      (Closes: #427439)
+    - Linked /usr/share/emboss-doc/doc/ to /usr/share/EMBOSS/docs, and
+      registered documentation in doc-base. (Closes: #423941)
+  * Gave their own packages to the AJAX and NUCLEUS libraries.
+    - Header files are in /usr/include/ajax and /usr/include/nucleus.
+    - The private pcre files are kept under /usr/include/ajax. (Closes: #433316)
+  * Packaging:
+    - Removed the extra Tag field in debian/control.
+    - Removed the recommendation on dialign, as edialign disappeared.
+    - Tightened the Depends: relationship between emboss and
+      emboss-lib (Closes: #435232).
+    - Removed inactive developer from the uploaders list.
+    - Suggests: embassy.
+  * Temporarly incorporates a relicenced version of the EMBOSS Quick
+    Guide, until it becomes part of the original tarball. Its sources
+    are shipped uuencoded, therfore emboss now build-depends on sharutils.
+
+  [ Nelson A. de Oliveira ]
+  * Checked and fixed clean target. (Closes: #442554).
+
+ -- Charles Plessy <charles-debian-nospam at plessy.org>  Sat, 13 Oct 2007 15:05:53 +0900
+
+emboss (5.0.0-1) unstable; urgency=low
+
+  * New upstream version
+  * Renaming cons and pscan to em_cons and em_pscan, see README.Debian
+    for more information.
+  * Moved all the binaries to /usr/lib/emboss. /usr/bin contains only
+    symbolic links (Closes : #427439, #427440).
+  * Makes sure that there is a Makefile befor invoking the clean rule.
+  * Added /etc/emboss/embossrc.d directory for future modular
+    configuration.
+  * Swiched from dpatch to quilt (no patches for the moment).
+  * Build-depend on libemboss-acd-perl to generate manpages with
+    acd2docbook.pl, written especially for this package (Closes: #423938).
+  * Adding a placeholder file to force the includion of debian/manpages.
+  * Removing the entries in the Debian menu until we agree that we
+    want them.
+
+ -- Charles Plessy <charles-debian-nospam at plessy.org>  Thu, 19 Jul 2007 13:56:11 +0900
+
+emboss (4.1.0-1) experimental; urgency=low
+
+  * New maintainer and uploaders
+  * First official relase (Closes: #156276)
+  * Xlib transition.
+  * Using dpatch and /usr/share/dpatch/dpatch.make to manage patches.
+  * Added XS-Vcs entries in debian/changelog.
+  * Removed the pcre includes from the emboss-libs package.
+  * Fixed watch file.
+  * Emboss Recommends:dialign and Suggests:clustalw. 
+
+ -- Charles Plessy <charles-debian-nospam at plessy.org>  Mon, 12 Mar 2007 08:26:15 +0900
+
+emboss (2.8.0-2) unstable; urgency=low
+
+  * Fixed manpages being in both emboss and emboss-lib
+  * Removed circ.dep. emboss <-> emboss-lib
+
+ -- Matt Hope <dopey at debian.org>  Fri, 21 May 2004 12:47:47 +1000
+
+emboss (2.8.0-1) unstable; urgency=low
+
+  * New upstream release
+
+ -- Matt Hope <dopey at debian.org>  Fri,  5 Dec 2003 15:08:54 +1100
+
+emboss (2.7.1-1) unstable; urgency=low
+
+  * New upstream release
+  * emboss-lib
+    - Fixed the shlibs.
+
+ -- Matt Hope <matth at bioinformatics.unsw.edu.au>  Mon,  7 Jul 2003 14:36:14 +1000
+
+emboss (2.6.0-1) unstable; urgency=low
+
+  * New upstream release
+
+ -- Matt Hope <matth at bioinformatics.unsw.edu.au>  Fri,  7 Apr 2003 21:41:12 +1000
+
+emboss (2.4.1-1) unstable; urgency=low
+
+  * Initial package.
+    Thanks for the feedback from everyone.
+    (Closes: Bug#156276 ITP)
+
+ -- Matt Hope <matth at bioinformatics.unsw.edu.au>  Sat,  6 Jul 2002 01:11:17 +1000
+

Added: trunk/packages/emboss/trunk/debian/compat
===================================================================
--- trunk/packages/emboss/trunk/debian/compat	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/compat	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1 @@
+5

Added: trunk/packages/emboss/trunk/debian/control
===================================================================
--- trunk/packages/emboss/trunk/debian/control	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/control	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,101 @@
+Source: emboss
+Section: science
+Priority: optional
+Maintainer: Debian-Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+XS-DM-Upload-Allowed: Yes
+Uploaders: Charles Plessy <charles-debian-nospam at plessy.org>, Nelson A. de Oliveira <naoliv at debian.org>
+Build-Depends: debhelper (>= 5), quilt, libx11-dev, x-dev, libgdchart-gd2-xpm-dev, zlib1g-dev, libpng12-dev, libpcre3-dev, antiword, sharutils
+XS-Vcs-Browser: http://svn.debian.org/wsvn/debian-med/trunk/packages/emboss/trunk
+XS-Vcs-Svn: svn://svn.debian.org/svn/debian-med/trunk/packages/emboss
+Standards-Version: 3.7.3
+Homepage: http://www.emboss.org
+
+Package: emboss
+Architecture: any
+Depends: ${shlibs:Depends}, ${misc:Depends}, emboss-data (= ${binary:Version}), csh | c-shell
+Recommends: primer3, dialign
+Suggests: emboss-doc, embassy, clustalw
+Description: The European Molecular Biology Open Software Suite
+ EMBOSS is a free Open Source software analysis package specially developed for
+ the needs of the molecular biology (e.g. EMBnet) user community. The software
+ automatically copes with data in a variety of formats and even allows
+ transparent retrieval of sequence data from the web. Also, as extensive
+ libraries are provided with the package, it is a platform to allow other
+ scientists to develop and release software in true open source spirit. EMBOSS
+ also integrates a range of currently available packages and tools for sequence
+ analysis into a seamless whole. EMBOSS breaks the historical trend towards
+ commercial software packages.
+ .
+ Reference for EMBOSS: Rice,P. Longden,I. and Bleasby,A.
+ "EMBOSS: The European Molecular Biology Open Software Suite"
+ Trends in Genetics June 2000, vol 16, No 6. pp.276-277
+
+Package: emboss-data
+Architecture: all
+Description: Data files for the EMBOSS package
+ This package includes data files needed by EMBOSS, the European Molecular
+ Biology Open Software Suite.
+
+Package: emboss-doc
+Section: doc
+Architecture: all
+Suggests: pdf-viewer | postscript-viewer
+Description: Documentation for EMBOSS
+ This package includes non-essential user documentation for EMBOSS, the
+ European Molecular Biology Open Software Suite.
+
+Package: emboss-lib
+Section: libs
+Architecture: any
+Depends: ${shlibs:Depends}, ${misc:Depends}
+Description: EMBOSS Libraries
+ This package is being emptied. For the moment it contains a eplplot, an EMBOSS
+ fork of the plplot library.
+
+Package: libajax5
+Section: libs
+Architecture: any
+Depends: ${shlibs:Depends}, ${misc:Depends}
+Description: EMBOSS library for commands
+ This package contains a core library of the European Molecular Biology Open
+ Software Suite, EMBOSS.
+ .
+ AJAX covers standard data structures, including strings, sequences, file
+ handles, queues, hashes, heaps, lists, dictionaries, trees and dynamic
+ arrays. It also covers standard algorithms including comparisons, pattern
+ matching, sorting, and iterators. AJAX will also provide a set of high level
+ graphics functions suited to the needs of sequence analysis applications.
+ .
+ This package contains the runtime library files needed to run software
+ using libajax.
+
+Package: libajax5-dev
+Section: libdevel
+Architecture: any
+Depends: ${shlibs:Depends}, ${misc:Depends}, libajax5 (= ${binary:Version})
+Description: Development files for libajax
+ This package contains the header and development files needed to build
+ programs and packages using libajax.
+
+Package: libnucleus5
+Section: libs
+Architecture: any
+Depends: ${shlibs:Depends}, ${misc:Depends}
+Description: EMBOSS library for molecular sequence analysis
+ This package contains a core library of the European Molecular Biology Open
+ Software Suite, EMBOSS.
+ .
+ The NUCLEUS library provides higher-level functions specific to molecular
+ sequence analysis, including sequence comparisons, translation, codon usage
+ and annotation.
+ .
+ This package contains the runtime library files needed to run software
+ using libnucleus.
+
+Package: libnucleus5-dev
+Section: libdevel
+Architecture: any
+Depends: ${shlibs:Depends}, ${misc:Depends}, libnucleus5 (= ${binary:Version})
+Description: Development files for libajax
+ This package contains the header and development files needed to build
+ programs and packages using libnucleus.

Added: trunk/packages/emboss/trunk/debian/copyright.introduction
===================================================================
--- trunk/packages/emboss/trunk/debian/copyright.introduction	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/copyright.introduction	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,118 @@
+The EMBOSS package for Debian was initially prepared by Matt Hope
+(dopey at debian.org) in 2002-2004 and released on
+(http://debian.bioinformatics.unsw.edu.au/). The package distributed in Debian
+was prepared by the "pkg-emboss" project in 2006, using the work of Matt Hope
+as a starting point. The packaging work of the pkg-emboss project is in the
+public domain unless stated otherwise.
+
+------------------------------------------------------------------------
+EMBOSS License (http://emboss.sourceforge.net/licence/)
+
+The AJAX and NUCLEUS libraries are released under the GNU Library General
+Public Licence.
+
+The EMBOSS Administrator’s Guide can be copied, distributed and/or modified
+under the terms of the GNU Free Documentation License, Version 1.1 or any
+later version published by the Free Software Foundation; with no Invariant
+Sections, with no Front-Cover Texts, and with no Back-Cover Texts.  A copy of
+the license is included in the chapter entitled ”GNU Free Documentation
+License”.
+
+The EMBOSS Quick Guide has been relicenced and can be used, modified and
+distributed under the same terms as EMBOSS itself.
+
+EMBOSS applications are released under the GNU General Public Licence.
+
+Parsing of ACD files does not constitute a "derived work" and developers are
+encouraged to do this, for example to write their own GUIs.
+
+For developers who have their own licensing conditions already in effect, there
+will be an additional way to contribute. The EMBASSY collection can include
+packages that use the EMBOSS core libraries and interfaces but under their own
+licensing conditions. They will be bound by the Library GPL of the AJAX and
+NUCLEUS libraries, but not necessarily by the full GPL.
+------------------------------------------------------------------------
+
+On Debian systems, the complete text of the GNU General Public License, the
+GNU Free Documentation License, and the GNU Lesser Public License can be found
+in `/usr/share/common-licenses/GPL', `/usr/share/common-licenses/GFDL' and
+`/usr/share/common-licenses/LGPL' respectively.
+
+
+EMBOSS uses the libpcre and libplplot.
+
+
+PCRE LICENCE
+------------
+
+PCRE is a library of functions to support regular expressions whose syntax
+and semantics are as close as possible to those of the Perl 5 language.
+
+Written by: Philip Hazel <ph10 at cam.ac.uk>
+
+University of Cambridge Computing Service,
+Cambridge, England. Phone: +44 1223 334714.
+
+Copyright (c) 1997-2000 University of Cambridge
+
+Permission is granted to anyone to use this software for any purpose on any
+computer system, and to redistribute it freely, subject to the following
+restrictions:
+
+1. This software is distributed in the hope that it will be useful,
+   but WITHOUT ANY WARRANTY; without even the implied warranty of
+   MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+2. The origin of this software must not be misrepresented, either by
+   explicit claim or by omission. In practice, this means that if you use
+   PCRE in software which you distribute to others, commercially or
+   otherwise, you must put a sentence like this
+
+     Regular expression support is provided by the PCRE library package,
+     which is open source software, written by Philip Hazel, and copyright
+     by the University of Cambridge, England.
+
+   somewhere reasonably visible in your documentation and in any relevant
+   files or online help data or similar. A reference to the ftp site for
+   the source, that is, to
+
+     ftp://ftp.csx.cam.ac.uk/pub/software/programming/pcre/
+
+   should also be given in the documentation.
+
+3. Altered versions must be plainly marked as such, and must not be
+   misrepresented as being the original software.
+
+4. If PCRE is embedded in any software that is released under the GNU
+   General Purpose Licence (GPL), then the terms of that licence shall
+   supersede any condition above with which it is incompatible.
+
+
+PLPLOT LICENCE
+--------------
+
+The PLplot package may be distributed under the following terms:
+
+    This library is free software; you can redistribute it and/or
+    modify it under the terms of the GNU Library General Public
+    License as published by the Free Software Foundation; either
+    version 2 of the License, or (at your option) any later version.
+
+    This library is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
+    Library General Public License for more details.
+
+    You should have received a copy of the GNU Library General Public
+    License along with this library; if not, write to the Free Software
+    Foundation, Inc. 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA
+
+
+AUTHORS OF EMBOSS
+-----------------
+
+EMBOSS has been develped by many programmers, who are acknowledged it the
+AUTHORS and THANK files in the original sources. These two files are reproduced
+below:
+
+

Added: trunk/packages/emboss/trunk/debian/emboss-data.dirs
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-data.dirs	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-data.dirs	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1 @@
+usr/share/EMBOSS

Added: trunk/packages/emboss/trunk/debian/emboss-data.install
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-data.install	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-data.install	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1 @@
+debian/emboss_tmp/usr/share/EMBOSS usr/share

Added: trunk/packages/emboss/trunk/debian/emboss-doc.dirs
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-doc.dirs	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-doc.dirs	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1 @@
+usr/share/EMBOSS/doc

Added: trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.domainatrix
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.domainatrix	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.domainatrix	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,13 @@
+Document: domainatrix
+Title: Domainatrix guide.
+Abstract: This document describes the  use  of  EMBOSS  applications  in  the  EMBASSY
+ package domainatrix.  Most of these directly or indirectly make use  of  the
+ protein structure databases pdb and scop.   All  of  the  applications  here
+ were written by Jon Ison, Ranjeeva Ranasinghe, Matt Blades  and  Waqas  Awan
+ and coordinated by  Jon  Ison  to  whom  enquiries  should  be  sent  (email
+ jison at hgmp.mrc.ac.uk).  This software is part of  an  experimental  analysis
+ pipeline and we provide it  in  the  hope  that  it  will  be  useful.
+Section: Applications/Science/Biology
+
+Format: Text
+Files: /usr/share/doc/emboss-doc/doc/manuals/domainatrix.txt

Added: trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-admin
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-admin	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-admin	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,24 @@
+Document: emboss-admin
+Title: The EMBOSS Administrator’s Guide
+Author: David Martin, EMBnet Norway
+ Peter Rice, LION Bioscience
+ Alan Bleasby, HGMP (EMBnet UK)
+Section: Applications/Science/Biology
+Abstract: This guide has been written to assist system administrators and developers
+ with the installation and configuration of EMBOSS. If you are reading this to
+ find out how to do bioinformatics then you are wasting your time. You are
+ referred instead to the Resources chapter below where there is a list of more
+ relevant literature and web sites. Experienced users may find this document
+ useful for configuring their own databases and customising their EMBOSS
+ experience.
+ .
+ This guide relates to EMBOSS 2.5.0
+
+Format: PostScript
+Files: /usr/share/doc/emboss-doc/doc/manuals/admin.ps
+
+Format: PDF
+Files: /usr/share/doc/emboss-doc/doc/manuals/admin.pdf
+
+Format: DVI
+Files: /usr/share/doc/emboss-doc/doc/manuals/admin.dvi

Added: trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-apps
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-apps	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-apps	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,7 @@
+Document: emboss-apps
+Title: EMBOSS Application
+Section: Applications/Science/Biology
+
+Format: HTML
+Index: /usr/share/doc/emboss-doc/doc/html/emboss/apps/index.html
+Files: /usr/share/doc/emboss-doc/doc/html/emboss/apps/*.html

Added: trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-groups
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-groups	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-groups	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,7 @@
+Document: emboss-groups
+Title: EMBOSS Application Groups
+Section: Applications/Science/Biology
+
+Format: HTML
+Index: /usr/share/doc/emboss-doc/doc/html/emboss/apps/groups.html
+Files: /usr/share/doc/emboss-doc/doc/html/emboss/apps/*.html

Added: trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-qg
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-qg	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-doc.doc-base.emboss-qg	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,11 @@
+Document: emboss-qg
+Title: EMBOSS, a quick guide.
+Author: David Martin, EMBnet Norway
+Abstract: Summary of emboss programs and their options on a recto-verso page.
+Section: Applications/Science/Biology
+
+Format: PostScript
+Files: /usr/share/doc/emboss-doc/doc/manuals/emboss_qg.ps
+
+Format: PDF
+Files: /usr/share/doc/emboss-doc/doc/manuals/emboss_qg.pdf

Added: trunk/packages/emboss/trunk/debian/emboss-doc.links
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-doc.links	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-doc.links	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1 @@
+usr/share/EMBOSS/doc	usr/share/doc/emboss-doc/doc

Added: trunk/packages/emboss/trunk/debian/emboss-java.dirs
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-java.dirs	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-java.dirs	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1 @@
+usr/bin usr/share/EMBOSS/jemboss/org/

Added: trunk/packages/emboss/trunk/debian/emboss-lib.dirs
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-lib.dirs	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-lib.dirs	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1 @@
+usr/lib

Added: trunk/packages/emboss/trunk/debian/emboss-lib.postinst
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss-lib.postinst	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss-lib.postinst	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,10 @@
+#!/bin/sh
+set -e
+
+case "$1" in
+    configure) if [ -x /sbin/ldconfig ]; then /sbin/ldconfig ; fi ;;
+    abort-*) exit 1 ;;
+    *) ;;
+esac
+
+#DEBHELPER#

Added: trunk/packages/emboss/trunk/debian/emboss.dirs
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss.dirs	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss.dirs	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,4 @@
+usr/bin
+usr/lib
+etc/emboss/embossrc.d
+usr/share/man/man1

Added: trunk/packages/emboss/trunk/debian/emboss.docs
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss.docs	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss.docs	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,6 @@
+AUTHORS
+FAQ
+NEWS
+KNOWN_BUGS
+PROBLEMS
+THANKS 

Added: trunk/packages/emboss/trunk/debian/emboss.install
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss.install	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss.install	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,2 @@
+debian/emboss_tmp/usr/bin usr
+debian/emboss_tmp/usr/lib usr

Added: trunk/packages/emboss/trunk/debian/emboss.manpages
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss.manpages	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss.manpages	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,203 @@
+debian/manpages/aaindexextract.1e
+debian/manpages/abiview.1e
+debian/manpages/acdc.1e
+debian/manpages/acdlog.1e
+debian/manpages/acdpretty.1e
+debian/manpages/acdtable.1e
+debian/manpages/acdtrace.1e
+debian/manpages/acdvalid.1e
+debian/manpages/ajbad.1e
+debian/manpages/ajfeatest.1e
+debian/manpages/ajtest.1e
+debian/manpages/antigenic.1e
+debian/manpages/backtranambig.1e
+debian/manpages/backtranseq.1e
+debian/manpages/banana.1e
+debian/manpages/biosed.1e
+debian/manpages/btwisted.1e
+debian/manpages/cai.1e
+debian/manpages/chaos.1e
+debian/manpages/charge.1e
+debian/manpages/checktrans.1e
+debian/manpages/chips.1e
+debian/manpages/cirdna.1e
+debian/manpages/codcmp.1e
+debian/manpages/codcopy.1e
+debian/manpages/coderet.1e
+debian/manpages/complex.1e
+debian/manpages/compseq.1e
+debian/manpages/cons.1e
+debian/manpages/corbatest.1e
+debian/manpages/cpgplot.1e
+debian/manpages/cpgreport.1e
+debian/manpages/cusp.1e
+debian/manpages/cutgextract.1e
+debian/manpages/cutseq.1e
+debian/manpages/dan.1e
+debian/manpages/dbiblast.1e
+debian/manpages/dbifasta.1e
+debian/manpages/dbiflat.1e
+debian/manpages/dbigcg.1e
+debian/manpages/dbxfasta.1e
+debian/manpages/dbxflat.1e
+debian/manpages/dbxgcg.1e
+debian/manpages/dbxstat.1e
+debian/manpages/degapseq.1e
+debian/manpages/demoalign.1e
+debian/manpages/demofeatures.1e
+debian/manpages/demolist.1e
+debian/manpages/demoreport.1e
+debian/manpages/demosequence.1e
+debian/manpages/demostring.1e
+debian/manpages/demostringnew.1e
+debian/manpages/demotable.1e
+debian/manpages/descseq.1e
+debian/manpages/diffseq.1e
+debian/manpages/digest.1e
+debian/manpages/distmat.1e
+debian/manpages/dotmatcher.1e
+debian/manpages/dotpath.1e
+debian/manpages/dottup.1e
+debian/manpages/dreg.1e
+debian/manpages/edialign.1e
+debian/manpages/einverted.1e
+debian/manpages/embossdata.1e
+debian/manpages/embossversion.1e
+debian/manpages/emma.1e
+debian/manpages/emowse.1e
+debian/manpages/entrails.1e
+debian/manpages/entret.1e
+debian/manpages/epestfind.1e
+debian/manpages/eprimer3.1e
+debian/manpages/equicktandem.1e
+debian/manpages/est2genome.1e
+debian/manpages/etandem.1e
+debian/manpages/extractalign.1e
+debian/manpages/extractfeat.1e
+debian/manpages/extractseq.1e
+debian/manpages/findkm.1e
+debian/manpages/freak.1e
+debian/manpages/fuzznuc.1e
+debian/manpages/fuzzpro.1e
+debian/manpages/fuzztran.1e
+debian/manpages/garnier.1e
+debian/manpages/geecee.1e
+debian/manpages/getorf.1e
+debian/manpages/giep.1e
+debian/manpages/helixturnhelix.1e
+debian/manpages/histogramtest.1e
+debian/manpages/hmoment.1e
+debian/manpages/iep.1e
+debian/manpages/infoalign.1e
+debian/manpages/infoseq.1e
+debian/manpages/intconv.1e
+debian/manpages/isochore.1e
+debian/manpages/lindna.1e
+debian/manpages/listor.1e
+debian/manpages/makenucseq.1e
+debian/manpages/makeprotseq.1e
+debian/manpages/marscan.1e
+debian/manpages/maskfeat.1e
+debian/manpages/maskseq.1e
+debian/manpages/matcher.1e
+debian/manpages/megamerger.1e
+debian/manpages/merger.1e
+debian/manpages/msbar.1e
+debian/manpages/mwcontam.1e
+debian/manpages/mwfilter.1e
+debian/manpages/needle.1e
+debian/manpages/newcoils.1e
+debian/manpages/newcpgreport.1e
+debian/manpages/newcpgseek.1e
+debian/manpages/newseq.1e
+debian/manpages/noreturn.1e
+debian/manpages/notseq.1e
+debian/manpages/nthseq.1e
+debian/manpages/octanol.1e
+debian/manpages/oddcomp.1e
+debian/manpages/origsplitter.1e
+debian/manpages/origunion.1e
+debian/manpages/palindrome.1e
+debian/manpages/pasteseq.1e
+debian/manpages/patmatdb.1e
+debian/manpages/patmatmotifs.1e
+debian/manpages/patmattest.1e
+debian/manpages/pepcoil.1e
+debian/manpages/pepinfo.1e
+debian/manpages/pepnet.1e
+debian/manpages/pepstats.1e
+debian/manpages/pepwheel.1e
+debian/manpages/pepwindow.1e
+debian/manpages/pepwindowall.1e
+debian/manpages/plotcon.1e
+debian/manpages/plotorf.1e
+debian/manpages/polydot.1e
+debian/manpages/preg.1e
+debian/manpages/prettyplot.1e
+debian/manpages/prettyseq.1e
+debian/manpages/prima.1e
+debian/manpages/primers.1e
+debian/manpages/primersearch.1e
+debian/manpages/printsextract.1e
+debian/manpages/profit.1e
+debian/manpages/prophecy.1e
+debian/manpages/prophet.1e
+debian/manpages/prosextract.1e
+debian/manpages/pscan.1e
+debian/manpages/psiphi.1e
+debian/manpages/rebaseextract.1e
+debian/manpages/recoder.1e
+debian/manpages/redata.1e
+debian/manpages/remap.1e
+debian/manpages/restover.1e
+debian/manpages/restrict.1e
+debian/manpages/revseq.1e
+debian/manpages/seealso.1e
+debian/manpages/seqinfo.1e
+debian/manpages/seqmatchall.1e
+debian/manpages/seqret.1e
+debian/manpages/seqretall.1e
+debian/manpages/seqretallfeat.1e
+debian/manpages/seqretset.1e
+debian/manpages/seqretsingle.1e
+debian/manpages/seqretsplit.1e
+debian/manpages/seqrettype.1e
+debian/manpages/showalign.1e
+debian/manpages/showdb.1e
+debian/manpages/showfeat.1e
+debian/manpages/showorf.1e
+debian/manpages/showseq.1e
+debian/manpages/shuffleseq.1e
+debian/manpages/sigcleave.1e
+debian/manpages/silent.1e
+debian/manpages/sirna.1e
+debian/manpages/sixpack.1e
+debian/manpages/skipseq.1e
+debian/manpages/splitter.1e
+debian/manpages/stretcher.1e
+debian/manpages/stssearch.1e
+debian/manpages/supermatcher.1e
+debian/manpages/syco.1e
+debian/manpages/tcode.1e
+debian/manpages/testplot.1e
+debian/manpages/textsearch.1e
+debian/manpages/tfextract.1e
+debian/manpages/tfm.1e
+debian/manpages/tfscan.1e
+debian/manpages/tmap.1e
+debian/manpages/tranalign.1e
+debian/manpages/transeq.1e
+debian/manpages/treetypedisplay.1e
+debian/manpages/trimest.1e
+debian/manpages/trimseq.1e
+debian/manpages/twofeat.1e
+debian/manpages/union.1e
+debian/manpages/vectorstrip.1e
+debian/manpages/water.1e
+debian/manpages/whichdb.1e
+debian/manpages/wobble.1e
+debian/manpages/wordcount.1e
+debian/manpages/wordfinder.1e
+debian/manpages/wordmatch.1e
+debian/manpages/wossname.1e
+debian/manpages/yank.1e

Added: trunk/packages/emboss/trunk/debian/emboss.menu
===================================================================
--- trunk/packages/emboss/trunk/debian/emboss.menu	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/emboss.menu	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,636 @@
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="aaindexextract" \
+	description="Extract data from AAINDEX" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/aaindexextract;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="abiview" \
+	description="Reads ABI file and display the trace" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/abiview;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="antigenic" \
+	description="Finds antigenic sites in proteins" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/antigenic;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="backtranambig" \
+	description="Back translate a protein sequence to ambiguous codons" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/backtranambig;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="backtranseq" \
+	description="Back translate a protein sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/backtranseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="banana" \
+	description="Bending and curvature plot in B-DNA" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/banana;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="biosed" \
+	description="Replace or delete sequence sections" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/biosed;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="btwisted" \
+	description="Calculates the twisting in a B-DNA sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/btwisted;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="cai" \
+	description="CAI codon adaptation index" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cai;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="chaos" \
+	description="Create a chaos game representation plot for a sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/chaos;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="charge" \
+	description="Protein charge plot" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/charge;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="checktrans" \
+	description="Reports STOP codons and ORF statistics of a protein" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/checktrans;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="chips" \
+	description="Codon usage statistics" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/chips;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="cirdna" \
+	description="Draws circular maps of DNA constructs" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cirdna;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="codcmp" \
+	description="Codon usage table comparison" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/codcmp;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="codcopy" \
+	description="Reads and writes a codon usage table" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/codcopy;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="coderet" \
+	description="Extract CDS, mRNA and translations from feature tables" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/coderet;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="compseq" \
+	description="Count composition of dimer/trimer/etc words in a sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/compseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="cons" \
+	description="Creates a consensus from multiple alignments" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cons;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="cpgplot" \
+	description="Plot CpG rich areas" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cpgplot;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="cpgreport" \
+	description="Reports all CpG rich regions" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cpgreport;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="cusp" \
+	description="Create a codon usage table" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cusp;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="cutgextract" \
+	description="Extract data from CUTG" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cutgextract;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="cutseq" \
+	description="Removes a specified section from a sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/cutseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dan" \
+	description="Calculates DNA RNA/DNA melting temperature" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dan;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dbiblast" \
+	description="Index a BLAST database" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbiblast;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dbifasta" \
+	description="Database indexing for fasta file databases" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbifasta;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dbiflat" \
+	description="Index a flat file database" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbiflat;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dbigcg" \
+	description="Index a GCG formatted database" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbigcg;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dbxfasta" \
+	description="Database b+tree indexing for fasta file databases" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbxfasta;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dbxflat" \
+	description="Database b+tree indexing for flat file databases" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbxflat;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dbxgcg" \
+	description="Database b+tree indexing for GCG formatted databases" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dbxgcg;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="degapseq" \
+	description="Removes gap characters from sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/degapseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="descseq" \
+	description="Alter the name or description of a sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/descseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="diffseq" \
+	description="Find differences between nearly identical sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/diffseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="digest" \
+	description="Protein proteolytic enzyme or reagent cleavage digest" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/digest;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="distmat" \
+	description="Creates a distance matrix from multiple alignments" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/distmat;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dotmatcher" \
+	description="Displays a thresholded dotplot of two sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dotmatcher;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dotpath" \
+	description="Non-overlapping wordmatch dotplot of two sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dotpath;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dottup" \
+	description="Displays a wordmatch dotplot of two sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dottup;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="dreg" \
+	description="Regular expression search of a nucleotide sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/dreg;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="einverted" \
+	description="Finds DNA inverted repeats" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/einverted;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="emma" \
+	description="Multiple alignment program - interface to ClustalW program" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/emma;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="emowse" \
+	description="Protein identification by mass spectrometry" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/emowse;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="entret" \
+	description="Reads and writes (returns) flatfile entries" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/entret;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="epestfind" \
+	description="Finds PEST motifs as potential proteolytic cleavage sites" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/epestfind;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="eprimer3" \
+	description="Picks PCR primers and hybridization oligos" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/eprimer3;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="equicktandem" \
+	description="Finds tandem repeats" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/equicktandem;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="est2genome" \
+	description="Align EST and genomic DNA sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/est2genome;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="etandem" \
+	description="Looks for tandem repeats in a nucleotide sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/etandem;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="extractfeat" \
+	description="Extract features from a sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/extractfeat;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="extractseq" \
+	description="Extract regions from a sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/extractseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="findkm" \
+	description="Find Km and Vmax for an enzyme reaction" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/findkm;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="freak" \
+	description="Residue/base frequency table or plot" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/freak;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="fuzznuc" \
+	description="Nucleic acid pattern search" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/fuzznuc;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="fuzzpro" \
+	description="Protein pattern search" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/fuzzpro;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="fuzztran" \
+	description="Protein pattern search after translation" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/fuzztran;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="garnier" \
+	description="Predicts protein secondary structure" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/garnier;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="geecee" \
+	description="Calculates fractional GC content of nucleic acid sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/geecee;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="getorf" \
+	description="Finds and extracts open reading frames (ORFs)" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/getorf;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="helixturnhelix" \
+	description="Report nucleic acid binding motifs" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/helixturnhelix;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="hmoment" \
+	description="Hydrophobic moment calculation" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/hmoment;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="iep" \
+	description="Calculates the isoelectric point of a protein" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/iep;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="infoalign" \
+	description="Information on a multiple sequence alignment" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/infoalign;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="infoseq" \
+	description="Displays some simple information about sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/infoseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="isochore" \
+	description="Plots isochores in large DNA sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/isochore;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="lindna" \
+	description="Draws linear maps of DNA constructs" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/lindna;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="listor" \
+	description="Write a list file of the logical OR of two sets of sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/listor;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="makenucseq" \
+	description="Creates random nucleotide sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/makenucseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="makeprotseq" \
+	description="Creates random protein sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/makeprotseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="marscan" \
+	description="Finds MAR/SAR sites in nucleic sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/marscan;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="maskfeat" \
+	description="Mask off features of a sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/maskfeat;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="maskseq" \
+	description="Mask off regions of a sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/maskseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="matcher" \
+	description="Finds the best local alignments between two sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/matcher;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="megamerger" \
+	description="Merge two large overlapping nucleic acid sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/megamerger;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="merger" \
+	description="Merge two overlapping sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/merger;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="msbar" \
+	description="Mutate sequence beyond all recognition" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/msbar;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="mwcontam" \
+	description="Shows molwts that match across a set of files" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/mwcontam;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="mwfilter" \
+	description="Filter noisy molwts from mass spec output" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/mwfilter;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="needle" \
+	description="Needleman-Wunsch global alignment" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/needle;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="newcpgreport" \
+	description="Report CpG rich areas" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/newcpgreport;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="newcpgseek" \
+	description="Reports CpG rich regions" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/newcpgseek;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="newseq" \
+	description="Type in a short new sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/newseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="noreturn" \
+	description="Removes carriage return from ASCII files" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/noreturn;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="notseq" \
+	description="Exclude a set of sequences and write out the remaining ones" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/notseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="nthseq" \
+	description="Writes one sequence from a multiple set of sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/nthseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="octanol" \
+	description="Displays protein hydropathy" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/octanol;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="oddcomp" \
+	description="Find protein sequence regions with a biased composition" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/oddcomp;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="palindrome" \
+	description="Looks for inverted repeats in a nucleotide sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/palindrome;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="pasteseq" \
+	description="Insert one sequence into another" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pasteseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="patmatdb" \
+	description="Search a protein sequence with a motif" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/patmatdb;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="patmatmotifs" \
+	description="Search a PROSITE motif database with a protein sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/patmatmotifs;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="pepcoil" \
+	description="Predicts coiled coil regions" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepcoil;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="pepinfo" \
+	description="Plots simple amino acid properties in parallel" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepinfo;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="pepnet" \
+	description="Displays proteins as a helical net" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepnet;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="pepstats" \
+	description="Protein statistics" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepstats;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="pepwheel" \
+	description="Shows protein sequences as helices" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepwheel;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="pepwindow" \
+	description="Displays protein hydropathy" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepwindow;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="pepwindowall" \
+	description="Displays protein hydropathy of a set of sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pepwindowall;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="plotcon" \
+	description="Plot quality of conservation of a sequence alignment" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/plotcon;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="plotorf" \
+	description="Plot potential open reading frames" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/plotorf;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="polydot" \
+	description="Displays all-against-all dotplots of a set of sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/polydot;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="preg" \
+	description="Regular expression search of a protein sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/preg;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="prettyplot" \
+	description="Displays aligned sequences, with colouring and boxing" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/prettyplot;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="prettyseq" \
+	description="Output sequence with translated ranges" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/prettyseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="primersearch" \
+	description="Searches DNA sequences for matches with primer pairs" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/primersearch;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="printsextract" \
+	description="Extract data from PRINTS" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/printsextract;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="profit" \
+	description="Scan a sequence or database with a matrix or profile" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/profit;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="prophecy" \
+	description="Creates matrices/profiles from multiple alignments" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/prophecy;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="prophet" \
+	description="Gapped alignment for profiles" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/prophet;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="prosextract" \
+	description="Build the PROSITE motif database for use by patmatmotifs" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/prosextract;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="pscan" \
+	description="Scans proteins using PRINTS" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/pscan;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="psiphi" \
+	description="Phi and psi torsion angles from protein coordinates" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/psiphi;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="rebaseextract" \
+	description="Extract data from REBASE" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/rebaseextract;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="recoder" \
+	description="Remove restriction sites but maintain same translation" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/recoder;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="redata" \
+	description="Search REBASE for enzyme name, references, suppliers etc." \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/redata;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="remap" \
+	description="Display sequence with restriction sites, translation etc." \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/remap;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="restover" \
+	description="Find restriction enzymes producing specific overhang" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/restover;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="restrict" \
+	description="Finds restriction enzyme cleavage sites" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/restrict;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="revseq" \
+	description="Reverse and complement a sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/revseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="seealso" \
+	description="Finds programs sharing group names" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/seealso;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="seqmatchall" \
+	description="All-against-all comparison of a set of sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/seqmatchall;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="seqret" \
+	description="Reads and writes (returns) sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/seqret;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="seqretsplit" \
+	description="Reads and writes (returns) sequences in individual files" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/seqretsplit;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="showalign" \
+	description="Displays a multiple sequence alignment" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/showalign;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="showfeat" \
+	description="Show features of a sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/showfeat;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="showorf" \
+	description="Pretty output of DNA translations" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/showorf;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="showseq" \
+	description="Display a sequence with features, translation etc." \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/showseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="shuffleseq" \
+	description="Shuffles a set of sequences maintaining composition" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/shuffleseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="sigcleave" \
+	description="Reports protein signal cleavage sites" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/sigcleave;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="silent" \
+	description="Silent mutation restriction enzyme scan" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/silent;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="sirna" \
+	description="Finds siRNA duplexes in mRNA" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/sirna;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="sixpack" \
+	description="Display a DNA sequence with 6-frame translation and ORFs" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/sixpack;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="skipseq" \
+	description="Reads and writes (returns) sequences, skipping first few" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/skipseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="splitter" \
+	description="Split a sequence into (overlapping) smaller sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/splitter;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="stretcher" \
+	description="Finds the best global alignment between two sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/stretcher;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="stssearch" \
+	description="Search a DNA database for matches with a set of STS primers" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/stssearch;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="supermatcher" \
+	description="Match large sequences against one or more other sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/supermatcher;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="syco" \
+	description="Synonymous codon usage Gribskov statistic plot" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/syco;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="tcode" \
+	description="Fickett TESTCODE statistic to identify protein-coding DNA" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tcode;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="textsearch" \
+	description="Search sequence documentation. Slow, use SRS and Entrez!" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/textsearch;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="tfextract" \
+	description="Extract data from TRANSFAC" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tfextract;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="tfm" \
+	description="Displays a program's help documentation manual" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tfm;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="tfscan" \
+	description="Scans DNA sequences for transcription factors" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tfscan;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="tmap" \
+	description="Displays membrane spanning regions" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tmap;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="tranalign" \
+	description="Align nucleic coding regions given the aligned proteins" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/tranalign;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="transeq" \
+	description="Translate nucleic acid sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/transeq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="trimest" \
+	description="Trim poly-A tails off EST sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/trimest;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="trimseq" \
+	description="Trim ambiguous bits off the ends of sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/trimseq;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="twofeat" \
+	description="Finds neighbouring pairs of features in sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/twofeat;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="union" \
+	description="Reads sequence fragments and builds one sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/union;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="vectorstrip" \
+	description="Strips out DNA between a pair of vector sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/vectorstrip;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="water" \
+	description="Smith-Waterman local alignment" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/water;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="whichdb" \
+	description="Search all databases for an entry" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/whichdb;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="wobble" \
+	description="Wobble base plot" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/wobble;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="wordcount" \
+	description="Counts words of a specified size in a DNA sequence" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/wordcount;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="wordmatch" \
+	description="Finds all exact matches of a given size between 2 sequences" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/wordmatch;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="wossname" \
+	description="Finds programs by keywords in their one-line documentation" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/wossname;echo press any key to continue; read\""
+?package(emboss):needs="X11" section="Apps/Science/EMBOSS" \
+	title="yank" \
+	description="Reads a sequence range, appends the full USA to a list file" \
+	command="/usr/bin/x-terminal-emulator -e /bin/sh -c \"/usr/bin/yank;echo press any key to continue; read\""

Added: trunk/packages/emboss/trunk/debian/libajax5-dev.dirs
===================================================================
--- trunk/packages/emboss/trunk/debian/libajax5-dev.dirs	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/libajax5-dev.dirs	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,2 @@
+usr/lib
+usr/include

Added: trunk/packages/emboss/trunk/debian/libnucleus5-dev.dirs
===================================================================
--- trunk/packages/emboss/trunk/debian/libnucleus5-dev.dirs	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/libnucleus5-dev.dirs	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,2 @@
+usr/lib
+usr/include

Added: trunk/packages/emboss/trunk/debian/manpages/aaindexextract.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/aaindexextract.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/aaindexextract.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,49 @@
+.\"     Title: AAINDEXEXTRACT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "AAINDEXEXTRACT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+aaindexextract \- Extract data from AAINDEX
+.SH "SYNOPSIS"
+.HP 15
+\fBaaindexextract\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR
+.HP 15
+\fBaaindexextract\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBaaindexextract\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database creation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+aaindexextract is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/abiview.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/abiview.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/abiview.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,92 @@
+.\"     Title: ABIVIEW
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ABIVIEW" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+abiview \- Reads ABI file and display the trace
+.SH "SYNOPSIS"
+.HP 8
+\fBabiview\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR [\fB\-startbase\ \fR\fB\fIinteger\fR\fR] [\fB\-endbase\ \fR\fB\fIinteger\fR\fR] \fB\-separate\ \fR\fB\fIboolean\fR\fR [\fB\-yticks\ \fR\fB\fIboolean\fR\fR] [\fB\-sequence\ \fR\fB\fIboolean\fR\fR] [\fB\-window\ \fR\fB\fIinteger\fR\fR] [\fB\-bases\ \fR\fB\fIstring\fR\fR]
+.HP 8
+\fBabiview\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBabiview\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-startbase\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-endbase\fR \fIinteger\fR
+.RS 4
+Last sequence base to report or display. If the default is set to zero then the value of this is taken as the maximum number of bases.
+.RE
+.PP
+\fB\-separate\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-yticks\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-sequence\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+Default value: 40
+.RE
+.PP
+\fB\-bases\fR \fIstring\fR
+.RS 4
+Default value: GATC
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+abiview is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/acdc.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/acdc.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/acdc.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,44 @@
+.\"     Title: ACDC
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ACDC" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+acdc \- ACD compiler
+.SH "SYNOPSIS"
+.HP 5
+\fBacdc\fR
+.HP 5
+\fBacdc\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBacdc\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Acd" command group(s).
+.SH "OPTIONS"
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+acdc is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/acdlog.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/acdlog.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/acdlog.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,44 @@
+.\"     Title: ACDLOG
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ACDLOG" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+acdlog \- ACD compiler logging
+.SH "SYNOPSIS"
+.HP 7
+\fBacdlog\fR
+.HP 7
+\fBacdlog\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBacdlog\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Acd" command group(s).
+.SH "OPTIONS"
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+acdlog is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/acdpretty.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/acdpretty.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/acdpretty.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,44 @@
+.\"     Title: ACDPRETTY
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ACDPRETTY" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+acdpretty \- ACD pretty printing utility
+.SH "SYNOPSIS"
+.HP 10
+\fBacdpretty\fR
+.HP 10
+\fBacdpretty\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBacdpretty\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Acd" command group(s).
+.SH "OPTIONS"
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+acdpretty is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/acdtable.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/acdtable.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/acdtable.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,44 @@
+.\"     Title: ACDTABLE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ACDTABLE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+acdtable \- Creates an HTML table from an ACD file
+.SH "SYNOPSIS"
+.HP 9
+\fBacdtable\fR
+.HP 9
+\fBacdtable\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBacdtable\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Acd" command group(s).
+.SH "OPTIONS"
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+acdtable is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/acdtrace.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/acdtrace.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/acdtrace.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,49 @@
+.\"     Title: ACDTRACE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ACDTRACE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+acdtrace \- ACD compiler on\-screen trace
+.SH "SYNOPSIS"
+.HP 9
+\fBacdtrace\fR \fB\-program\ \fR\fB\fIstring\fR\fR
+.HP 9
+\fBacdtrace\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBacdtrace\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Acd" command group(s).
+.SH "OPTIONS"
+.SS "Required section"
+.PP
+\fB\-program\fR \fIstring\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+acdtrace is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/acdvalid.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/acdvalid.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/acdvalid.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,44 @@
+.\"     Title: ACDVALID
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ACDVALID" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+acdvalid \- ACD file validation
+.SH "SYNOPSIS"
+.HP 9
+\fBacdvalid\fR
+.HP 9
+\fBacdvalid\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBacdvalid\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Acd" command group(s).
+.SH "OPTIONS"
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+acdvalid is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/ajbad.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/ajbad.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/ajbad.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,92 @@
+.\"     Title: AJBAD
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "AJBAD" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+ajbad \- Test file for ACD parsing
+.SH "SYNOPSIS"
+.HP 6
+\fBajbad\fR \fB\-typea\ \fR\fB\fIstring\fR\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-eco\ \fR\fB\fIcodon\fR\fR \fB\-typeb\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-a\ \fR\fB\fIinteger\fR\fR \fB\-b\ \fR\fB\fIinteger\fR\fR \fB\-c\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 6
+\fBajbad\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBajbad\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-typea\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-eco\fR \fIcodon\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-typeb\fR \fIstring\fR
+.RS 4
+Default value: $(seqa.type)
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.SS "Advanced section"
+.PP
+\fB\-a\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-b\fR \fIinteger\fR
+.RS 4
+Default value: 15
+.RE
+.PP
+\fB\-c\fR \fIfloat\fR
+.RS 4
+Default value: 1.6
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+ajbad is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/ajfeatest.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/ajfeatest.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/ajfeatest.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,54 @@
+.\"     Title: AJFEATEST
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "AJFEATEST" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+ajfeatest \- Reads and writes (returns) a sequence and its features
+.SH "SYNOPSIS"
+.HP 10
+\fBajfeatest\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 10
+\fBajfeatest\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBajfeatest\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+ajfeatest is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/ajtest.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/ajtest.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/ajtest.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,71 @@
+.\"     Title: AJTEST
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "AJTEST" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+ajtest \- Test file for ACD parsing
+.SH "SYNOPSIS"
+.HP 7
+\fBajtest\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-bsequence\ \fR\fB\fIseqset\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR \fB\-outdir\ \fR\fB\fIoutdir\fR\fR
+.HP 7
+\fBajtest\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBajtest\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIseqset\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.PP
+\fB\-outfeat\fR \fIfeatout\fR
+.RS 4
+.RE
+.PP
+\fB\-outdir\fR \fIoutdir\fR
+.RS 4
+Default value: /tmp
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+ajtest is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/antigenic.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/antigenic.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/antigenic.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: ANTIGENIC
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ANTIGENIC" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+antigenic \- Finds antigenic sites in proteins
+.SH "SYNOPSIS"
+.HP 10
+\fBantigenic\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-minlen\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 10
+\fBantigenic\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBantigenic\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-minlen\fR \fIinteger\fR
+.RS 4
+Default value: 6
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+antigenic is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/backtranambig.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/backtranambig.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/backtranambig.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,59 @@
+.\"     Title: BACKTRANAMBIG
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "BACKTRANAMBIG" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+backtranambig \- Back translate a protein sequence to ambiguous codons
+.SH "SYNOPSIS"
+.HP 14
+\fBbacktranambig\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-table\ \fR\fB\fIlist\fR\fR] \fB\-outfile\ \fR\fB\fIseqout\fR\fR
+.HP 14
+\fBbacktranambig\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBbacktranambig\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Translation,Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-table\fR \fIlist\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+backtranambig is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/backtranseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/backtranseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/backtranseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,59 @@
+.\"     Title: BACKTRANSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "BACKTRANSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+backtranseq \- Back translate a protein sequence
+.SH "SYNOPSIS"
+.HP 12
+\fBbacktranseq\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-cfile\ \fR\fB\fIcodon\fR\fR] \fB\-outfile\ \fR\fB\fIseqout\fR\fR
+.HP 12
+\fBbacktranseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBbacktranseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Translation,Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-cfile\fR \fIcodon\fR
+.RS 4
+Default value: Ehuman.cut
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+backtranseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/banana.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/banana.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/banana.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,69 @@
+.\"     Title: BANANA
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "BANANA" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+banana \- Bending and curvature plot in B\-DNA
+.SH "SYNOPSIS"
+.HP 7
+\fBbanana\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-anglesfile\ \fR\fB\fIdatafile\fR\fR] \fB\-graph\ \fR\fB\fIgraph\fR\fR [\fB\-residuesperline\ \fR\fB\fIinteger\fR\fR] [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
+.HP 7
+\fBbanana\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBbanana\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-anglesfile\fR \fIdatafile\fR
+.RS 4
+Default value: Eangles_tri.dat
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIgraph\fR
+.RS 4
+.RE
+.PP
+\fB\-residuesperline\fR \fIinteger\fR
+.RS 4
+Default value: 50
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: banana.profile
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+banana is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/biosed.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/biosed.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/biosed.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,75 @@
+.\"     Title: BIOSED
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "BIOSED" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+biosed \- Replace or delete sequence sections
+.SH "SYNOPSIS"
+.HP 7
+\fBbiosed\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-target\ \fR\fB\fIstring\fR\fR \fB\-delete\ \fR\fB\fItoggle\fR\fR \fB\-replace\ \fR\fB\fIstring\fR\fR [\fB\-position\ \fR\fB\fIinteger\fR\fR] \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 7
+\fBbiosed\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBbiosed\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-target\fR \fIstring\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-delete\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-replace\fR \fIstring\fR
+.RS 4
+Default value: A
+.RE
+.SS "Additional section"
+.PP
+\fB\-position\fR \fIinteger\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+biosed is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/btwisted.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/btwisted.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/btwisted.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,64 @@
+.\"     Title: BTWISTED
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "BTWISTED" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+btwisted \- Calculates the twisting in a B\-DNA sequence
+.SH "SYNOPSIS"
+.HP 9
+\fBbtwisted\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-angledata\ \fR\fB\fIdatafile\fR\fR \fB\-energydata\ \fR\fB\fIdatafile\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 9
+\fBbtwisted\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBbtwisted\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-angledata\fR \fIdatafile\fR
+.RS 4
+Default value: Eangles.dat
+.RE
+.PP
+\fB\-energydata\fR \fIdatafile\fR
+.RS 4
+Default value: Eenergy.dat
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+btwisted is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/cai.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/cai.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/cai.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,59 @@
+.\"     Title: CAI
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CAI" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+cai \- CAI codon adaptation index
+.SH "SYNOPSIS"
+.HP 4
+\fBcai\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-cfile\ \fR\fB\fIcodon\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 4
+\fBcai\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcai\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Codon usage" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-seqall\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-cfile\fR \fIcodon\fR
+.RS 4
+Default value: Eyeast_cai.cut
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+cai is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/chaos.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/chaos.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/chaos.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,54 @@
+.\"     Title: CHAOS
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CHAOS" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+chaos \- Create a chaos game representation plot for a sequence
+.SH "SYNOPSIS"
+.HP 6
+\fBchaos\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-graph\ \fR\fB\fIgraph\fR\fR
+.HP 6
+\fBchaos\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBchaos\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIgraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+chaos is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/charge.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/charge.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/charge.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,74 @@
+.\"     Title: CHARGE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CHARGE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+charge \- Protein charge plot
+.SH "SYNOPSIS"
+.HP 7
+\fBcharge\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-aadata\ \fR\fB\fIdatafile\fR\fR [\fB\-window\ \fR\fB\fIinteger\fR\fR] \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 7
+\fBcharge\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcharge\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-seqall\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-aadata\fR \fIdatafile\fR
+.RS 4
+Default value: Eamino.dat
+.RE
+.SS "Additional section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+Default value: 5
+.RE
+.SS "Output section"
+.PP
+\fB\-plot\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+charge is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/checktrans.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/checktrans.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/checktrans.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,76 @@
+.\"     Title: CHECKTRANS
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CHECKTRANS" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+checktrans \- Reports STOP codons and ORF statistics of a protein
+.SH "SYNOPSIS"
+.HP 11
+\fBchecktrans\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-orfml\ \fR\fB\fIinteger\fR\fR [\fB\-addlast\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR
+.HP 11
+\fBchecktrans\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBchecktrans\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-orfml\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.SS "Additional section"
+.PP
+\fB\-addlast\fR \fIboolean\fR
+.RS 4
+An asterisk in the protein sequence indicates the position of a STOP codon. Checktrans assumes that all ORFs end in a STOP codon. Forcing the sequence to end with an asterisk, if there is not one there already, makes checktrans treat the end as a potential ORF. If an asterisk is added, it is not included in the reported count of STOPs. Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+Sequence file to hold output ORF sequences
+.RE
+.PP
+\fB\-outfeat\fR \fIfeatout\fR
+.RS 4
+File for output features
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+checktrans is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/chips.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/chips.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/chips.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: CHIPS
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CHIPS" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+chips \- Codon usage statistics
+.SH "SYNOPSIS"
+.HP 6
+\fBchips\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-sum\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 6
+\fBchips\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBchips\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Codon usage" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-seqall\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-sum\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+chips is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/cirdna.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/cirdna.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/cirdna.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,151 @@
+.\"     Title: CIRDNA
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CIRDNA" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+cirdna \- Draws circular maps of DNA constructs
+.SH "SYNOPSIS"
+.HP 7
+\fBcirdna\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR [\fB\-maxgroups\ \fR\fB\fIinteger\fR\fR] [\fB\-maxlabels\ \fR\fB\fIinteger\fR\fR] \fB\-ruler\ \fR\fB\fIboolean\fR\fR \fB\-blocktype\ \fR\fB\fIlist\fR\fR [\fB\-originangle\ \fR\fB\fIfloat\fR\fR] \fB\-posticks\ \fR\fB\fIselection\fR\fR \fB\-posblocks\ \fR\fB\fIselection\fR\fR [\fB\-intersymbol\ \fR\fB\fIboolean\fR\fR] [\fB\-intercolour\ \fR\fB\fIinteger\fR\fR] [\fB\-interticks\ \fR\fB\fIboolean\fR\fR] [\fB\-gapsize\ \fR\fB\fIinteger\fR\fR] [\fB\-ticklines\ \fR\fB\fIboolean\fR\fR] [\fB\-textheight\ \fR\fB\fIfloat\fR\fR] [\fB\-textlength\ \fR\fB\fIfloat\fR\fR] [\fB\-tickheight\ \fR\fB\fIfloat\fR\fR] [\fB\-blockheight\ \fR\fB\fIfloat\fR\fR] [\fB\-rangeheight\ \fR\fB\fIfloat\fR\fR] [\fB\-gapgroup\ \fR\fB\fIfloat\fR\fR] [\fB\-postext\ \fR\fB\fIfloat\fR\fR] \fB\-graphout\ \fR\fB\fIgraph\fR\fR
+.HP 7
+\fBcirdna\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcirdna\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+Default value: inputfile
+.RE
+.SS "Additional section"
+.PP
+\fB\-maxgroups\fR \fIinteger\fR
+.RS 4
+Default value: 20
+.RE
+.PP
+\fB\-maxlabels\fR \fIinteger\fR
+.RS 4
+Default value: 10000
+.RE
+.SS "Output section"
+.PP
+\fB\-ruler\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-blocktype\fR \fIlist\fR
+.RS 4
+Default value: Filled
+.RE
+.PP
+\fB\-originangle\fR \fIfloat\fR
+.RS 4
+Default value: 90
+.RE
+.PP
+\fB\-posticks\fR \fIselection\fR
+.RS 4
+Default value: Out
+.RE
+.PP
+\fB\-posblocks\fR \fIselection\fR
+.RS 4
+Default value: In
+.RE
+.PP
+\fB\-intersymbol\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-intercolour\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-interticks\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-gapsize\fR \fIinteger\fR
+.RS 4
+Default value: 500
+.RE
+.PP
+\fB\-ticklines\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-textheight\fR \fIfloat\fR
+.RS 4
+Height of text. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-textlength\fR \fIfloat\fR
+.RS 4
+Length of text. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-tickheight\fR \fIfloat\fR
+.RS 4
+Height of ticks. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-blockheight\fR \fIfloat\fR
+.RS 4
+Height of blocks. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-rangeheight\fR \fIfloat\fR
+.RS 4
+Height of range ends. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-gapgroup\fR \fIfloat\fR
+.RS 4
+Space between groups. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-postext\fR \fIfloat\fR
+.RS 4
+Space between text and ticks, blocks, and ranges. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-graphout\fR \fIgraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+cirdna is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/codcmp.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/codcmp.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/codcmp.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: CODCMP
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CODCMP" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+codcmp \- Codon usage table comparison
+.SH "SYNOPSIS"
+.HP 7
+\fBcodcmp\fR \fB\-first\ \fR\fB\fIcodon\fR\fR \fB\-second\ \fR\fB\fIcodon\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 7
+\fBcodcmp\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcodcmp\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Codon usage" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-first\fR \fIcodon\fR
+.RS 4
+First codon usage file
+.RE
+.PP
+\fB\-second\fR \fIcodon\fR
+.RS 4
+Second codon usage file for comparison
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+codcmp is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/codcopy.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/codcopy.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/codcopy.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,55 @@
+.\"     Title: CODCOPY
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CODCOPY" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+codcopy \- Reads and writes a codon usage table
+.SH "SYNOPSIS"
+.HP 8
+\fBcodcopy\fR \fB\-infile\ \fR\fB\fIcodon\fR\fR \fB\-outfile\ \fR\fB\fIoutcodon\fR\fR
+.HP 8
+\fBcodcopy\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcodcopy\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIcodon\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutcodon\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+codcopy is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/coderet.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/coderet.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/coderet.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,70 @@
+.\"     Title: CODERET
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CODERET" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+coderet \- Extract CDS, mRNA and translations from feature tables
+.SH "SYNOPSIS"
+.HP 8
+\fBcoderet\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-cdsoutseq\ \fR\fB\fIseqoutall\fR\fR \fB\-mrnaoutseq\ \fR\fB\fIseqoutall\fR\fR \fB\-translationoutseq\ \fR\fB\fIseqoutall\fR\fR \fB\-restoutseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 8
+\fBcoderet\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcoderet\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Feature tables,Nucleic:Translation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-seqall\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-cdsoutseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.PP
+\fB\-mrnaoutseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.PP
+\fB\-translationoutseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.PP
+\fB\-restoutseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+coderet is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/complex.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/complex.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/complex.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,104 @@
+.\"     Title: COMPLEX
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "COMPLEX" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+complex \- Find the linguistic complexity in nucleotide sequences
+.SH "SYNOPSIS"
+.HP 8
+\fBcomplex\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-lwin\ \fR\fB\fIinteger\fR\fR \fB\-step\ \fR\fB\fIinteger\fR\fR \fB\-jmin\ \fR\fB\fIinteger\fR\fR \fB\-jmax\ \fR\fB\fIinteger\fR\fR \fB\-omnia\ \fR\fB\fItoggle\fR\fR \fB\-sim\ \fR\fB\fIinteger\fR\fR \fB\-freq\ \fR\fB\fIboolean\fR\fR \fB\-print\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-ujtablefile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 8
+\fBcomplex\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcomplex\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-lwin\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.PP
+\fB\-step\fR \fIinteger\fR
+.RS 4
+Displacement of the window over the sequence Default value: 5
+.RE
+.PP
+\fB\-jmin\fR \fIinteger\fR
+.RS 4
+Default value: 4
+.RE
+.PP
+\fB\-jmax\fR \fIinteger\fR
+.RS 4
+Default value: 6
+.RE
+.SS "Advanced section"
+.PP
+\fB\-omnia\fR \fItoggle\fR
+.RS 4
+Calculate over a set of sequences Default value: N
+.RE
+.PP
+\fB\-sim\fR \fIinteger\fR
+.RS 4
+Calculate the linguistic complexity by comparison with a number of simulations having a uniform distribution of bases
+.RE
+.PP
+\fB\-freq\fR \fIboolean\fR
+.RS 4
+Execute the simulation of a sequence based on the base frequency of the original sequence Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-print\fR \fIboolean\fR
+.RS 4
+Generate a file named UjTable containing the values of Uj for each word j in the real sequence(s) and in any simulated sequences Default value: N
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-ujtablefile\fR \fIoutfile\fR
+.RS 4
+Default value: complex.ujtable
+.RE
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+complex is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/compseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/compseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/compseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,92 @@
+.\"     Title: COMPSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "COMPSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+compseq \- Count composition of dimer/trimer/etc words in a sequence
+.SH "SYNOPSIS"
+.HP 8
+\fBcompseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-infile\ \fR\fB\fIinfile\fR\fR] \fB\-word\ \fR\fB\fIinteger\fR\fR [\fB\-frame\ \fR\fB\fIinteger\fR\fR] \fB\-ignorebz\ \fR\fB\fIboolean\fR\fR \fB\-reverse\ \fR\fB\fIboolean\fR\fR [\fB\-calcfreq\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR [\fB\-zerocount\ \fR\fB\fIboolean\fR\fR]
+.HP 8
+\fBcompseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcompseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Composition,Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+This is a file previously produced by 'compseq' that can be used to set the expected frequencies of words in this analysis. The word size in the current run must be the same as the one in this results file. Obviously, you should use a file produced from protein sequences if you are counting protein sequence word frequencies, and you must use one made from nucleotide frequencies if you are analysing a nucleotide sequence.
+.RE
+.SS "Required section"
+.PP
+\fB\-word\fR \fIinteger\fR
+.RS 4
+This is the size of word (n\-mer) to count. Thus if you want to count codon frequencies, you should enter 3 here. Default value: 2
+.RE
+.SS "Additional section"
+.PP
+\fB\-frame\fR \fIinteger\fR
+.RS 4
+The normal behaviour of 'compseq' is to count the frequencies of all words that occur by moving a window of length 'word' up by one each time. This option allows you to move the window up by the length of the word each time, skipping over the intervening words. You can count only those words that occur in a single frame of the word by setting this value to a number other than zero. If you set it to 1 it will only count the words in frame 1, 2 will only count the words in frame 2 and so on.
+.RE
+.PP
+\fB\-ignorebz\fR \fIboolean\fR
+.RS 4
+The amino acid code B represents Asparagine or Aspartic acid and the code Z represents Glutamine or Glutamic acid. These are not commonly used codes and you may wish not to count words containing them, just noting them in the count of 'Other' words. Default value: Y
+.RE
+.PP
+\fB\-reverse\fR \fIboolean\fR
+.RS 4
+Set this to be true if you also wish to also count words in the reverse complement of a nucleic sequence. Default value: N
+.RE
+.PP
+\fB\-calcfreq\fR \fIboolean\fR
+.RS 4
+If this is set true then the expected frequencies of words are calculated from the observed frequency of single bases or residues in the sequences. If you are reporting a word size of 1 (single bases or residues) then there is no point in using this option because the calculated expected frequency will be equal to the observed frequency. Calculating the expected frequencies like this will give an approximation of the expected frequencies that you might get by using an input file of frequencies produced by a previous run of this program. If an input file of expected word frequencies has been specified then the values from that file will be used instead of this calculation of expected frequency from the sequence, even if 'calcfreq' is set to be true. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+This is the results file.
+.RE
+.PP
+\fB\-zerocount\fR \fIboolean\fR
+.RS 4
+You can make the output results file much smaller if you do not display the words with a zero count. Default value: Y
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+compseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/cons.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/cons.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/cons.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,80 @@
+.\"     Title: CONS
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CONS" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+cons \- Creates a consensus from multiple alignments
+.SH "SYNOPSIS"
+.HP 5
+\fBcons\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR [\fB\-datafile\ \fR\fB\fImatrix\fR\fR] [\fB\-plurality\ \fR\fB\fIfloat\fR\fR] [\fB\-identity\ \fR\fB\fIinteger\fR\fR] [\fB\-setcase\ \fR\fB\fIfloat\fR\fR] \fB\-outseq\ \fR\fB\fIseqout\fR\fR [\fB\-name\ \fR\fB\fIstring\fR\fR]
+.HP 5
+\fBcons\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcons\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Consensus" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqset\fR
+.RS 4
+File containing a sequence alignment.
+.RE
+.PP
+\fB\-datafile\fR \fImatrix\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Additional section"
+.PP
+\fB\-plurality\fR \fIfloat\fR
+.RS 4
+Set a cut\-off for the number of positive matches below which there is no consensus. The default plurality is taken as half the total weight of all the sequences in the alignment. Default value: @( $(sequence.totweight) / 2)
+.RE
+.PP
+\fB\-identity\fR \fIinteger\fR
+.RS 4
+Provides the facility of setting the required number of identities at a site for it to give a consensus at that position. Therefore, if this is set to the number of sequences in the alignment only columns of identities contribute to the consensus.
+.RE
+.PP
+\fB\-setcase\fR \fIfloat\fR
+.RS 4
+Sets the threshold for the positive matches above which the consensus is is upper\-case and below which the consensus is in lower\-case. Default value: @( $(sequence.totweight) / 2)
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.PP
+\fB\-name\fR \fIstring\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+cons is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/corbatest.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/corbatest.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/corbatest.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,55 @@
+.\"     Title: CORBATEST
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CORBATEST" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+corbatest \- Test of EMBL corba retrieval
+.SH "SYNOPSIS"
+.HP 10
+\fBcorbatest\fR \fB\-entry\ \fR\fB\fIstring\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 10
+\fBcorbatest\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcorbatest\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-entry\fR \fIstring\fR
+.RS 4
+Default value: hsfau
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+corbatest is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/cpgplot.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/cpgplot.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/cpgplot.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,105 @@
+.\"     Title: CPGPLOT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CPGPLOT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+cpgplot \- Plot CpG rich areas
+.SH "SYNOPSIS"
+.HP 8
+\fBcpgplot\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-minlen\ \fR\fB\fIinteger\fR\fR \fB\-minoe\ \fR\fB\fIfloat\fR\fR \fB\-minpc\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-obsexp\ \fR\fB\fIboolean\fR\fR \fB\-cg\ \fR\fB\fIboolean\fR\fR \fB\-pc\ \fR\fB\fIboolean\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR
+.HP 8
+\fBcpgplot\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcpgplot\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:CpG Islands" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+The percentage CG content and the Observed frequency of CG is calculated within a window whose size is set by this parameter. The window is moved down the sequence and these statistics are calculated at each postition that the window is moved to. Default value: 100
+.RE
+.PP
+\fB\-minlen\fR \fIinteger\fR
+.RS 4
+This sets the minimum length that a CpG island has to be before it is reported. Default value: 200
+.RE
+.PP
+\fB\-minoe\fR \fIfloat\fR
+.RS 4
+This sets the minimum average observed to expected ratio of C plus G to CpG in a set of 10 windows that are required before a CpG island is reported. Default value: 0.6
+.RE
+.PP
+\fB\-minpc\fR \fIfloat\fR
+.RS 4
+This sets the minimum average percentage of G plus C a set of 10 windows that are required before a CpG island is reported. Default value: 50.
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+This sets the name of the file holding the report of the input sequence name, CpG island parameters and the output details of any CpG islands that are found.
+.RE
+.PP
+\fB\-plot\fR \fItoggle\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-obsexp\fR \fIboolean\fR
+.RS 4
+If this is set to true then the graph of the observed to expected ratio of C plus G to CpG within a window is displayed. Default value: Y
+.RE
+.PP
+\fB\-cg\fR \fIboolean\fR
+.RS 4
+If this is set to true then the graph of the regions which have been determined to be CpG islands is displayed. Default value: Y
+.RE
+.PP
+\fB\-pc\fR \fIboolean\fR
+.RS 4
+If this is set to true then the graph of the percentage C plus G within a window is displayed. Default value: Y
+.RE
+.PP
+\fB\-outfeat\fR \fIfeatout\fR
+.RS 4
+File for output features
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+cpgplot is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/cpgreport.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/cpgreport.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/cpgreport.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,65 @@
+.\"     Title: CPGREPORT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CPGREPORT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+cpgreport \- Reports all CpG rich regions
+.SH "SYNOPSIS"
+.HP 10
+\fBcpgreport\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-score\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR
+.HP 10
+\fBcpgreport\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcpgreport\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:CpG Islands" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-score\fR \fIinteger\fR
+.RS 4
+This sets the score for each CG sequence found. A value of 17 is more sensitive, but 28 has also been used with some success. Default value: 17
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-outfeat\fR \fIfeatout\fR
+.RS 4
+File for output features
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+cpgreport is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/cusp.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/cusp.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/cusp.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,54 @@
+.\"     Title: CUSP
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CUSP" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+cusp \- Create a codon usage table
+.SH "SYNOPSIS"
+.HP 5
+\fBcusp\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 5
+\fBcusp\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcusp\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Codon usage" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+cusp is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/cutgextract.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/cutgextract.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/cutgextract.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,80 @@
+.\"     Title: CUTGEXTRACT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CUTGEXTRACT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+cutgextract \- Extract data from CUTG
+.SH "SYNOPSIS"
+.HP 12
+\fBcutgextract\fR \fB\-directory\ \fR\fB\fIdirlist\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-wildspec\ \fR\fB\fIstring\fR\fR \fB\-species\ \fR\fB\fIstring\fR\fR \fB\-allrecords\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-filename\ \fR\fB\fIstring\fR\fR
+.HP 12
+\fBcutgextract\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcutgextract\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database creation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-directory\fR \fIdirlist\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Advanced section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-wildspec\fR \fIstring\fR
+.RS 4
+Default value: *.codon
+.RE
+.PP
+\fB\-species\fR \fIstring\fR
+.RS 4
+Default value: *
+.RE
+.PP
+\fB\-allrecords\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-filename\fR \fIstring\fR
+.RS 4
+Single output filename to override automatic one file for each species. Leave blank to generate the filenames. Specify a filename to combine several species into one file.
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+cutgextract is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/cutseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/cutseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/cutseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,65 @@
+.\"     Title: CUTSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "CUTSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+cutseq \- Removes a specified section from a sequence.
+.SH "SYNOPSIS"
+.HP 7
+\fBcutseq\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-from\ \fR\fB\fIinteger\fR\fR \fB\-to\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 7
+\fBcutseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcutseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-from\fR \fIinteger\fR
+.RS 4
+This is the start position (inclusive) of the section of the sequence that you wish to remove. Default value: $(sequence.begin)
+.RE
+.PP
+\fB\-to\fR \fIinteger\fR
+.RS 4
+This is the end position (inclusive) of the section of the sequence that you wish to remove. Default value: $(sequence.end)
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+cutseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dan.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dan.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dan.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,129 @@
+.\"     Title: DAN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DAN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dan \- Calculates DNA RNA/DNA melting temperature
+.SH "SYNOPSIS"
+.HP 4
+\fBdan\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-windowsize\ \fR\fB\fIinteger\fR\fR \fB\-shiftincrement\ \fR\fB\fIinteger\fR\fR \fB\-dnaconc\ \fR\fB\fIfloat\fR\fR \fB\-saltconc\ \fR\fB\fIfloat\fR\fR [\fB\-product\ \fR\fB\fItoggle\fR\fR] \fB\-formamide\ \fR\fB\fIfloat\fR\fR \fB\-mismatch\ \fR\fB\fIfloat\fR\fR \fB\-prodlen\ \fR\fB\fIinteger\fR\fR [\fB\-thermo\ \fR\fB\fItoggle\fR\fR] \fB\-temperature\ \fR\fB\fIfloat\fR\fR \fB\-rna\ \fR\fB\fIboolean\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-mintemp\ \fR\fB\fIfloat\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 4
+\fBdan\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdan\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-windowsize\fR \fIinteger\fR
+.RS 4
+The values of melting point and other thermodynamic properties of the sequence are determined by taking a short length of sequence known as a window and determining the properties of the sequence in that window. The window is incrementally moved along the sequence with the properties being calculated at each new position. Default value: 20
+.RE
+.PP
+\fB\-shiftincrement\fR \fIinteger\fR
+.RS 4
+This is the amount by which the window is moved at each increment in order to find the melting point and other properties along the sequence. Default value: 1
+.RE
+.PP
+\fB\-dnaconc\fR \fIfloat\fR
+.RS 4
+Default value: 50.
+.RE
+.PP
+\fB\-saltconc\fR \fIfloat\fR
+.RS 4
+Default value: 50.
+.RE
+.SS "Additional section"
+.SS "Product options"
+.PP
+\fB\-product\fR \fItoggle\fR
+.RS 4
+This prompts for percent formamide, percent of mismatches allowed and product length.
+.RE
+.PP
+\fB\-formamide\fR \fIfloat\fR
+.RS 4
+This specifies the percent formamide to be used in calculations (it is ignored unless \-product is used). Default value: 0.
+.RE
+.PP
+\fB\-mismatch\fR \fIfloat\fR
+.RS 4
+This specifies the percent mismatch to be used in calculations (it is ignored unless \-product is used). Default value: 0.
+.RE
+.PP
+\fB\-prodlen\fR \fIinteger\fR
+.RS 4
+This specifies the product length to be used in calculations (it is ignored unless \-product is used). Default value: $(windowSize)
+.RE
+.SS "Thermodynamic options"
+.PP
+\fB\-thermo\fR \fItoggle\fR
+.RS 4
+Output the DeltaG, DeltaH and DeltaS values of the sequence windows to the output data file.
+.RE
+.PP
+\fB\-temperature\fR \fIfloat\fR
+.RS 4
+If \-thermo has been specified then this specifies the temperature at which to calculate the DeltaG, DeltaH and DeltaS values. Default value: 25.
+.RE
+.SS "Advanced section"
+.PP
+\fB\-rna\fR \fIboolean\fR
+.RS 4
+This specifies that the sequence is an RNA sequence and not a DNA sequence.
+.RE
+.SS "Output section"
+.PP
+\fB\-plot\fR \fItoggle\fR
+.RS 4
+If this is not specified then the file of output data is produced, else a plot of the melting point along the sequence is produced.
+.RE
+.PP
+\fB\-mintemp\fR \fIfloat\fR
+.RS 4
+Enter a minimum value for the temperature scale (y\-axis) of the plot. Default value: 55.
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+If a plot is not being produced then data on the melting point etc. in each window along the sequence is output to the file.
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dan is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dbiblast.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dbiblast.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dbiblast.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,123 @@
+.\"     Title: DBIBLAST
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DBIBLAST" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dbiblast \- Index a BLAST database
+.SH "SYNOPSIS"
+.HP 9
+\fBdbiblast\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-seqtype\ \fR\fB\fIlist\fR\fR \fB\-blastversion\ \fR\fB\fIlist\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-sortoptions\ \fR\fB\fIstring\fR\fR \fB\-maxindex\ \fR\fB\fIinteger\fR\fR \fB\-systemsort\ \fR\fB\fIboolean\fR\fR \fB\-cleanup\ \fR\fB\fIboolean\fR\fR \fB\-sourcefile\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR
+.HP 9
+\fBdbiblast\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbiblast\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database indexing" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-directory\fR \fIdirectory\fR
+.RS 4
+Default value: .
+.RE
+.PP
+\fB\-filenames\fR \fIstring\fR
+.RS 4
+Default value: $(dbname)
+.RE
+.SS "Required section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+Default value: 0.0
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.PP
+\fB\-seqtype\fR \fIlist\fR
+.RS 4
+Default value: unknown
+.RE
+.PP
+\fB\-blastversion\fR \fIlist\fR
+.RS 4
+Default value: unknown
+.RE
+.SS "Advanced section"
+.PP
+\fB\-fields\fR \fIlist\fR
+.RS 4
+Default value: acc
+.RE
+.PP
+\fB\-exclude\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-sortoptions\fR \fIstring\fR
+.RS 4
+Sort options, typically '\-T .' to use current directory for work files and '\-k 1,1' to force GNU sort to use the first field Default value: \-T . \-k 1,1
+.RE
+.PP
+\fB\-maxindex\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-systemsort\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-cleanup\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-sourcefile\fR \fIboolean\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-indexoutdir\fR \fIoutdir\fR
+.RS 4
+Default value: .
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dbiblast is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dbifasta.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dbifasta.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dbifasta.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,114 @@
+.\"     Title: DBIFASTA
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DBIFASTA" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dbifasta \- Database indexing for fasta file databases
+.SH "SYNOPSIS"
+.HP 9
+\fBdbifasta\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-maxindex\ \fR\fB\fIinteger\fR\fR \fB\-sortoptions\ \fR\fB\fIstring\fR\fR \fB\-systemsort\ \fR\fB\fIboolean\fR\fR \fB\-cleanup\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR
+.HP 9
+\fBdbifasta\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbifasta\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database indexing" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-idformat\fR \fIlist\fR
+.RS 4
+Default value: idacc
+.RE
+.PP
+\fB\-directory\fR \fIdirectory\fR
+.RS 4
+Default value: .
+.RE
+.PP
+\fB\-filenames\fR \fIstring\fR
+.RS 4
+Default value: *.dat
+.RE
+.SS "Required section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+Default value: 0.0
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.SS "Advanced section"
+.PP
+\fB\-fields\fR \fIlist\fR
+.RS 4
+Default value: acc
+.RE
+.PP
+\fB\-exclude\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-maxindex\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-sortoptions\fR \fIstring\fR
+.RS 4
+Sort options, typically '\-T .' to use current directory for work files and '\-k 1,1' to force GNU sort to use the first field Default value: \-T . \-k 1,1
+.RE
+.PP
+\fB\-systemsort\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-cleanup\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-indexoutdir\fR \fIoutdir\fR
+.RS 4
+Default value: .
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dbifasta is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dbiflat.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dbiflat.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dbiflat.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,114 @@
+.\"     Title: DBIFLAT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DBIFLAT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dbiflat \- Index a flat file database
+.SH "SYNOPSIS"
+.HP 8
+\fBdbiflat\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-maxindex\ \fR\fB\fIinteger\fR\fR \fB\-sortoptions\ \fR\fB\fIstring\fR\fR \fB\-systemsort\ \fR\fB\fIboolean\fR\fR \fB\-cleanup\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR
+.HP 8
+\fBdbiflat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbiflat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database indexing" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-idformat\fR \fIlist\fR
+.RS 4
+Default value: SWISS
+.RE
+.PP
+\fB\-directory\fR \fIdirectory\fR
+.RS 4
+Default value: .
+.RE
+.PP
+\fB\-filenames\fR \fIstring\fR
+.RS 4
+Default value: *.dat
+.RE
+.SS "Required section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+Default value: 0.0
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.SS "Advanced section"
+.PP
+\fB\-fields\fR \fIlist\fR
+.RS 4
+Default value: acc
+.RE
+.PP
+\fB\-exclude\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-maxindex\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-sortoptions\fR \fIstring\fR
+.RS 4
+Sort options, typically '\-T .' to use current directory for work files and '\-k 1,1' to force GNU sort to use the first field Default value: \-T . \-k 1,1
+.RE
+.PP
+\fB\-systemsort\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-cleanup\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-indexoutdir\fR \fIoutdir\fR
+.RS 4
+Default value: .
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dbiflat is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dbigcg.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dbigcg.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dbigcg.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,114 @@
+.\"     Title: DBIGCG
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DBIGCG" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dbigcg \- Index a GCG formatted database
+.SH "SYNOPSIS"
+.HP 7
+\fBdbigcg\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-maxindex\ \fR\fB\fIinteger\fR\fR \fB\-sortoptions\ \fR\fB\fIstring\fR\fR \fB\-systemsort\ \fR\fB\fIboolean\fR\fR \fB\-cleanup\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR
+.HP 7
+\fBdbigcg\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbigcg\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database indexing" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-idformat\fR \fIlist\fR
+.RS 4
+Default value: EMBL
+.RE
+.PP
+\fB\-directory\fR \fIdirectory\fR
+.RS 4
+Default value: .
+.RE
+.PP
+\fB\-filenames\fR \fIstring\fR
+.RS 4
+Default value: *.seq
+.RE
+.SS "Required section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+Default value: 0.0
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.SS "Advanced section"
+.PP
+\fB\-fields\fR \fIlist\fR
+.RS 4
+Default value: acc
+.RE
+.PP
+\fB\-exclude\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-maxindex\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-sortoptions\fR \fIstring\fR
+.RS 4
+Sort options, typically '\-T .' to use current directory for work files and '\-k 1,1' to force GNU sort to use the first field Default value: \-T . \-k 1,1
+.RE
+.PP
+\fB\-systemsort\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-cleanup\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-indexoutdir\fR \fIoutdir\fR
+.RS 4
+Default value: .
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dbigcg is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dbxfasta.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dbxfasta.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dbxfasta.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,95 @@
+.\"     Title: DBXFASTA
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DBXFASTA" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dbxfasta \- Database b+tree indexing for fasta file databases
+.SH "SYNOPSIS"
+.HP 9
+\fBdbxfasta\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR
+.HP 9
+\fBdbxfasta\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbxfasta\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database indexing" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-dbresource\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-idformat\fR \fIlist\fR
+.RS 4
+Default value: idacc
+.RE
+.PP
+\fB\-directory\fR \fIdirectory\fR
+.RS 4
+Default value: .
+.RE
+.PP
+\fB\-filenames\fR \fIstring\fR
+.RS 4
+Default value: *.dat
+.RE
+.SS "Required section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+Default value: 0.0
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.SS "Advanced section"
+.PP
+\fB\-fields\fR \fIlist\fR
+.RS 4
+Default value: id,acc
+.RE
+.PP
+\fB\-exclude\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-indexoutdir\fR \fIoutdir\fR
+.RS 4
+Default value: .
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dbxfasta is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dbxflat.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dbxflat.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dbxflat.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,95 @@
+.\"     Title: DBXFLAT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DBXFLAT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dbxflat \- Database b+tree indexing for flat file databases
+.SH "SYNOPSIS"
+.HP 8
+\fBdbxflat\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR
+.HP 8
+\fBdbxflat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbxflat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database indexing" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-dbresource\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-idformat\fR \fIlist\fR
+.RS 4
+Default value: SWISS
+.RE
+.PP
+\fB\-filenames\fR \fIstring\fR
+.RS 4
+Default value: *.dat
+.RE
+.PP
+\fB\-directory\fR \fIdirectory\fR
+.RS 4
+Default value: .
+.RE
+.SS "Required section"
+.PP
+\fB\-fields\fR \fIlist\fR
+.RS 4
+Default value: id,acc
+.RE
+.SS "Advanced section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+Default value: 0.0
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.PP
+\fB\-exclude\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-indexoutdir\fR \fIoutdir\fR
+.RS 4
+Default value: .
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dbxflat is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dbxgcg.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dbxgcg.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dbxgcg.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,95 @@
+.\"     Title: DBXGCG
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DBXGCG" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dbxgcg \- Database b+tree indexing for GCG formatted databases
+.SH "SYNOPSIS"
+.HP 7
+\fBdbxgcg\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR
+.HP 7
+\fBdbxgcg\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbxgcg\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database indexing" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-dbresource\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-idformat\fR \fIlist\fR
+.RS 4
+Default value: SWISS
+.RE
+.PP
+\fB\-directory\fR \fIdirectory\fR
+.RS 4
+Default value: .
+.RE
+.PP
+\fB\-filenames\fR \fIstring\fR
+.RS 4
+Default value: *.seq
+.RE
+.SS "Required section"
+.PP
+\fB\-fields\fR \fIlist\fR
+.RS 4
+Default value: id,acc
+.RE
+.SS "Advanced section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+Default value: 0.0
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.PP
+\fB\-exclude\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-indexoutdir\fR \fIoutdir\fR
+.RS 4
+Default value: .
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dbxgcg is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dbxstat.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dbxstat.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dbxstat.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,75 @@
+.\"     Title: DBXSTAT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DBXSTAT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dbxstat \- Dump statistics for dbx databases
+.SH "SYNOPSIS"
+.HP 8
+\fBdbxstat\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-indexdir\ \fR\fB\fIstring\fR\fR \fB\-idtype\ \fR\fB\fIlist\fR\fR \fB\-minimum\ \fR\fB\fIinteger\fR\fR \fB\-maximum\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 8
+\fBdbxstat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbxstat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database indexing" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-indexdir\fR \fIstring\fR
+.RS 4
+Default value: .
+.RE
+.PP
+\fB\-idtype\fR \fIlist\fR
+.RS 4
+Default value: id
+.RE
+.SS "Required section"
+.SS "Advanced section"
+.PP
+\fB\-minimum\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-maximum\fR \fIinteger\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dbxstat is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/degapseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/degapseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/degapseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,54 @@
+.\"     Title: DEGAPSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DEGAPSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+degapseq \- Removes gap characters from sequences
+.SH "SYNOPSIS"
+.HP 9
+\fBdegapseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 9
+\fBdegapseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdegapseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+degapseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/demoalign.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/demoalign.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/demoalign.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,69 @@
+.\"     Title: DEMOALIGN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DEMOALIGN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+demoalign \- Reads a sequence set, writes an alignment file
+.SH "SYNOPSIS"
+.HP 10
+\fBdemoalign\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR [\fB\-floatmatrix\ \fR\fB\fImatrixf\fR\fR] [\fB\-intmatrix\ \fR\fB\fImatrix\fR\fR] \fB\-dofloat\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR
+.HP 10
+\fBdemoalign\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdemoalign\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqset\fR
+.RS 4
+.RE
+.PP
+\fB\-floatmatrix\fR \fImatrixf\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.PP
+\fB\-intmatrix\fR \fImatrix\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Advanced section"
+.PP
+\fB\-dofloat\fR \fIboolean\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIalign\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+demoalign is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/demofeatures.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/demofeatures.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/demofeatures.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,61 @@
+.\"     Title: DEMOFEATURES
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DEMOFEATURES" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+demofeatures \- Demonstration of the feature functions
+.SH "SYNOPSIS"
+.HP 13
+\fBdemofeatures\fR \fB\-typesort\ \fR\fB\fIboolean\fR\fR \fB\-startsort\ \fR\fB\fIboolean\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR
+.HP 13
+\fBdemofeatures\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdemofeatures\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Advanced section"
+.PP
+\fB\-typesort\fR \fIboolean\fR
+.RS 4
+Sort output features by their type Default value: N
+.RE
+.PP
+\fB\-startsort\fR \fIboolean\fR
+.RS 4
+Sort output features by their start position Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfeat\fR \fIfeatout\fR
+.RS 4
+File for output of normal tab delimited gff's Default value: gff:demofeatures.gff
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+demofeatures is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/demolist.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/demolist.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/demolist.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,50 @@
+.\"     Title: DEMOLIST
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DEMOLIST" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+demolist \- Demonstration of the list functions
+.SH "SYNOPSIS"
+.HP 9
+\fBdemolist\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR
+.HP 9
+\fBdemolist\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdemolist\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+File containing normal tab delimited gff's
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+demolist is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/demoreport.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/demoreport.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/demoreport.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,54 @@
+.\"     Title: DEMOREPORT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DEMOREPORT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+demoreport \- Reads a sequence and feature table, writes a report
+.SH "SYNOPSIS"
+.HP 11
+\fBdemoreport\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 11
+\fBdemoreport\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdemoreport\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+demoreport is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/demosequence.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/demosequence.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/demosequence.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,45 @@
+.\"     Title: DEMOSEQUENCE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DEMOSEQUENCE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+demosequence \- Demonstration of the sequence functions
+.SH "SYNOPSIS"
+.HP 13
+\fBdemosequence\fR
+.HP 13
+\fBdemosequence\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdemosequence\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+demosequence is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/demostring.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/demostring.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/demostring.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,49 @@
+.\"     Title: DEMOSTRING
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DEMOSTRING" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+demostring \- Demonstration of the string functions
+.SH "SYNOPSIS"
+.HP 11
+\fBdemostring\fR \fB\-instring\ \fR\fB\fIstring\fR\fR
+.HP 11
+\fBdemostring\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdemostring\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-instring\fR \fIstring\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+demostring is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/demostringnew.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/demostringnew.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/demostringnew.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,45 @@
+.\"     Title: DEMOSTRINGNEW
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DEMOSTRINGNEW" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+demostringnew \- Illustrates use of the AJAX string library.
+.SH "SYNOPSIS"
+.HP 14
+\fBdemostringnew\fR
+.HP 14
+\fBdemostringnew\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdemostringnew\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+demostringnew is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/demotable.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/demotable.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/demotable.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,50 @@
+.\"     Title: DEMOTABLE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DEMOTABLE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+demotable \- Demonstration of the table functions
+.SH "SYNOPSIS"
+.HP 10
+\fBdemotable\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR
+.HP 10
+\fBdemotable\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdemotable\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+File containing normal tab delimited gff's
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+demotable is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/descseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/descseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/descseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,69 @@
+.\"     Title: DESCSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DESCSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+descseq \- Alter the name or description of a sequence.
+.SH "SYNOPSIS"
+.HP 8
+\fBdescseq\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-name\ \fR\fB\fIstring\fR\fR] [\fB\-description\ \fR\fB\fIstring\fR\fR] \fB\-append\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 8
+\fBdescseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdescseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-name\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-description\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-append\fR \fIboolean\fR
+.RS 4
+This allows you to append the name or description you have given on to the end of the existing name or description of the sequence. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+descseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/diffseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/diffseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/diffseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,80 @@
+.\"     Title: DIFFSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DIFFSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+diffseq \- Find differences between nearly identical sequences
+.SH "SYNOPSIS"
+.HP 8
+\fBdiffseq\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR [\fB\-globaldifferences\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR \fB\-aoutfeat\ \fR\fB\fIfeatout\fR\fR \fB\-boutfeat\ \fR\fB\fIfeatout\fR\fR
+.HP 8
+\fBdiffseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdiffseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Differences" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-wordsize\fR \fIinteger\fR
+.RS 4
+The similar regions between the two sequences are found by creating a hash table of 'wordsize'd subsequences. 10 is a reasonable default. Making this value larger (20?) may speed up the program slightly, but will mean that any two differences within 'wordsize' of each other will be grouped as a single region of difference. This value may be made smaller (4?) to improve the resolution of nearby differences, but the program will go much slower. Default value: 10
+.RE
+.SS "Additional section"
+.PP
+\fB\-globaldifferences\fR \fIboolean\fR
+.RS 4
+Normally this program will find regions of identity that are the length of the specified word\-size or greater and will then report the regions of difference between these matching regions. This works well and is what most people want if they are working with long overlapping nucleic acid sequences. You are usually not interested in the non\-overlapping ends of these sequences. If you have protein sequences or short RNA sequences however, you will be interested in differences at the very ends . It this option is set to be true then the differences at the ends will also be reported. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.PP
+\fB\-aoutfeat\fR \fIfeatout\fR
+.RS 4
+File for output of first sequence's features Default value: $(asequence.name).diffgff
+.RE
+.PP
+\fB\-boutfeat\fR \fIfeatout\fR
+.RS 4
+File for output of second sequence's features Default value: $(bsequence.name).diffgff
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+diffseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/digest.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/digest.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/digest.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,91 @@
+.\"     Title: DIGEST
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DIGEST" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+digest \- Protein proteolytic enzyme or reagent cleavage digest
+.SH "SYNOPSIS"
+.HP 7
+\fBdigest\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-aadata\ \fR\fB\fIdatafile\fR\fR \fB\-menu\ \fR\fB\fIlist\fR\fR \fB\-unfavoured\ \fR\fB\fIboolean\fR\fR \fB\-ragging\ \fR\fB\fIboolean\fR\fR \fB\-termini\ \fR\fB\fIlist\fR\fR \fB\-overlap\ \fR\fB\fIboolean\fR\fR \fB\-allpartials\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 7
+\fBdigest\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdigest\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-seqall\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-aadata\fR \fIdatafile\fR
+.RS 4
+Molecular weight data for amino acids Default value: Eamino.dat
+.RE
+.SS "Required section"
+.PP
+\fB\-menu\fR \fIlist\fR
+.RS 4
+Default value: 1
+.RE
+.SS "Advanced section"
+.PP
+\fB\-unfavoured\fR \fIboolean\fR
+.RS 4
+Trypsin will not normally cut after a K if it is followed by (e.g.) another K or a P. Specifying this shows those cuts. as well as the favoured ones.
+.RE
+.PP
+\fB\-ragging\fR \fIboolean\fR
+.RS 4
+Allows semi\-specific and non\-specific digestion. This option is particularly useful for generating lists of peptide sequences for protein identification using mass\-spectrometry.
+.RE
+.PP
+\fB\-termini\fR \fIlist\fR
+.RS 4
+Default value: 1
+.RE
+.SS "Output section"
+.PP
+\fB\-overlap\fR \fIboolean\fR
+.RS 4
+Used for partial digestion. Shows all cuts from favoured cut sites plus 1..3, 2..4, 3..5 etc but not (e.g.) 2..5. Overlaps are therefore fragments with exactly one potential cut site within it.
+.RE
+.PP
+\fB\-allpartials\fR \fIboolean\fR
+.RS 4
+As for overlap but fragments containing more than one potential cut site are included.
+.RE
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+digest is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/distmat.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/distmat.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/distmat.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,92 @@
+.\"     Title: DISTMAT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DISTMAT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+distmat \- Creates a distance matrix from multiple alignments
+.SH "SYNOPSIS"
+.HP 8
+\fBdistmat\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR \fB\-nucmethod\ \fR\fB\fIlist\fR\fR \fB\-protmethod\ \fR\fB\fIlist\fR\fR \fB\-ambiguous\ \fR\fB\fIboolean\fR\fR \fB\-gapweight\ \fR\fB\fIfloat\fR\fR \fB\-position\ \fR\fB\fIinteger\fR\fR \fB\-calculatea\ \fR\fB\fIboolean\fR\fR \fB\-parametera\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 8
+\fBdistmat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdistmat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Phylogeny:Molecular sequence" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqset\fR
+.RS 4
+File containing a sequence alignment.
+.RE
+.SS "Required section"
+.PP
+\fB\-nucmethod\fR \fIlist\fR
+.RS 4
+Multiple substitution correction methods for nucleotides.
+.RE
+.PP
+\fB\-protmethod\fR \fIlist\fR
+.RS 4
+Multiple substitution correction methods for proteins.
+.RE
+.SS "Additional section"
+.PP
+\fB\-ambiguous\fR \fIboolean\fR
+.RS 4
+Option to use the ambiguous codes in the calculation of the Jukes\-Cantor method or if the sequences are proteins. Default value: N
+.RE
+.PP
+\fB\-gapweight\fR \fIfloat\fR
+.RS 4
+Option to weight gaps in the uncorrected (nucleotide) and Jukes\-Cantor distance methods. Default value: 0.
+.RE
+.PP
+\fB\-position\fR \fIinteger\fR
+.RS 4
+Choose base positions to analyse in each codon i.e. 123 (all bases), 12 (the first two bases), 1, 2, or 3 individual bases. Default value: 123
+.RE
+.PP
+\fB\-calculatea\fR \fIboolean\fR
+.RS 4
+This will force the calculation of parameter 'a' in the Jin\-Nei Gamma distance calculation, otherwise the default is 1.0 (see \-parametera option). Default value: N
+.RE
+.PP
+\fB\-parametera\fR \fIfloat\fR
+.RS 4
+User defined parameter 'a' to be use in the Jin\-Nei Gamma distance calculation. The suggested value to be used is 1.0 (Jin et al.) and this is the default. Default value: 1.0
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+distmat is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dotmatcher.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dotmatcher.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dotmatcher.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,83 @@
+.\"     Title: DOTMATCHER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DOTMATCHER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dotmatcher \- Displays a thresholded dotplot of two sequences
+.SH "SYNOPSIS"
+.HP 11
+\fBdotmatcher\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR [\fB\-matrixfile\ \fR\fB\fImatrix\fR\fR] [\fB\-windowsize\ \fR\fB\fIinteger\fR\fR] [\fB\-threshold\ \fR\fB\fIinteger\fR\fR] \fB\-stretch\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIgraph\fR\fR \fB\-xygraph\ \fR\fB\fIxygraph\fR\fR
+.HP 11
+\fBdotmatcher\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdotmatcher\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Dot plots" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-matrixfile\fR \fImatrix\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Additional section"
+.PP
+\fB\-windowsize\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.PP
+\fB\-threshold\fR \fIinteger\fR
+.RS 4
+Default value: 23
+.RE
+.SS "Output section"
+.PP
+\fB\-stretch\fR \fItoggle\fR
+.RS 4
+Display a non\-proportional graph Default value: N
+.RE
+.PP
+\fB\-graph\fR \fIgraph\fR
+.RS 4
+.RE
+.PP
+\fB\-xygraph\fR \fIxygraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dotmatcher is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dotpath.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dotpath.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dotpath.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,74 @@
+.\"     Title: DOTPATH
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DOTPATH" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dotpath \- Non\-overlapping wordmatch dotplot of two sequences
+.SH "SYNOPSIS"
+.HP 8
+\fBdotpath\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR [\fB\-overlaps\ \fR\fB\fIboolean\fR\fR] [\fB\-boxit\ \fR\fB\fIboolean\fR\fR] \fB\-graph\ \fR\fB\fIgraph\fR\fR
+.HP 8
+\fBdotpath\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdotpath\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Dot plots" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-wordsize\fR \fIinteger\fR
+.RS 4
+Default value: 4
+.RE
+.SS "Output section"
+.PP
+\fB\-overlaps\fR \fIboolean\fR
+.RS 4
+Displays the overlapping matches (in red) as well as the minimal set of non\-overlapping matches Default value: N
+.RE
+.PP
+\fB\-boxit\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-graph\fR \fIgraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dotpath is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dottup.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dottup.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dottup.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,78 @@
+.\"     Title: DOTTUP
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DOTTUP" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dottup \- Displays a wordmatch dotplot of two sequences
+.SH "SYNOPSIS"
+.HP 7
+\fBdottup\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR \fB\-stretch\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIgraph\fR\fR \fB\-xygraph\ \fR\fB\fIxygraph\fR\fR \fB\-boxit\ \fR\fB\fIboolean\fR\fR
+.HP 7
+\fBdottup\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdottup\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Dot plots" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-wordsize\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.SS "Output section"
+.PP
+\fB\-stretch\fR \fItoggle\fR
+.RS 4
+Use non\-proportional axes Default value: N
+.RE
+.PP
+\fB\-graph\fR \fIgraph\fR
+.RS 4
+.RE
+.PP
+\fB\-xygraph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-boxit\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dottup is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/dreg.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/dreg.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/dreg.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,58 @@
+.\"     Title: DREG
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "DREG" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+dreg \- Regular expression search of a nucleotide sequence
+.SH "SYNOPSIS"
+.HP 5
+\fBdreg\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-pattern\ \fR\fB\fIregexp\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 5
+\fBdreg\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdreg\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-pattern\fR \fIregexp\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+dreg is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/edialign.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/edialign.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/edialign.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,119 @@
+.\"     Title: EDIALIGN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EDIALIGN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+edialign \- Local multiple alignment of sequences
+.SH "SYNOPSIS"
+.HP 9
+\fBedialign\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR \fB\-nucmode\ \fR\fB\fIlist\fR\fR \fB\-revcomp\ \fR\fB\fIboolean\fR\fR [\fB\-overlapw\ \fR\fB\fIselection\fR\fR] [\fB\-linkage\ \fR\fB\fIlist\fR\fR] [\fB\-maxfragl\ \fR\fB\fIinteger\fR\fR] \fB\-fragmat\ \fR\fB\fIboolean\fR\fR \fB\-fragsim\ \fR\fB\fIinteger\fR\fR [\fB\-itscore\ \fR\fB\fIboolean\fR\fR] [\fB\-threshold\ \fR\fB\fIfloat\fR\fR] \fB\-mask\ \fR\fB\fIboolean\fR\fR \fB\-dostars\ \fR\fB\fIboolean\fR\fR \fB\-starnum\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 9
+\fBedialign\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBedialign\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Multiple" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequences\fR \fIseqset\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-nucmode\fR \fIlist\fR
+.RS 4
+Nucleic acid sequence alignment mode (simple, translated or mixed) Default value: n
+.RE
+.PP
+\fB\-revcomp\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-overlapw\fR \fIselection\fR
+.RS 4
+By default overlap weights are used when Nseq =<35 but you can set this to 'yes' or 'no' Default value: default (when Nseq =< 35)
+.RE
+.PP
+\fB\-linkage\fR \fIlist\fR
+.RS 4
+Clustering method to construct sequence tree (UPGMA, minimum linkage or maximum linkage) Default value: UPGMA
+.RE
+.PP
+\fB\-maxfragl\fR \fIinteger\fR
+.RS 4
+Default value: 40
+.RE
+.PP
+\fB\-fragmat\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-fragsim\fR \fIinteger\fR
+.RS 4
+Default value: 4
+.RE
+.PP
+\fB\-itscore\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-threshold\fR \fIfloat\fR
+.RS 4
+Default value: 0.0
+.RE
+.SS "Output section"
+.PP
+\fB\-mask\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-dostars\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-starnum\fR \fIinteger\fR
+.RS 4
+Default value: 4
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+edialign is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/einverted.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/einverted.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/einverted.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,86 @@
+.\"     Title: EINVERTED
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EINVERTED" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+einverted \- Finds DNA inverted repeats
+.SH "SYNOPSIS"
+.HP 10
+\fBeinverted\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-gap\ \fR\fB\fIinteger\fR\fR \fB\-threshold\ \fR\fB\fIinteger\fR\fR \fB\-match\ \fR\fB\fIinteger\fR\fR \fB\-mismatch\ \fR\fB\fIinteger\fR\fR [\fB\-maxrepeat\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 10
+\fBeinverted\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBeinverted\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Repeats,Nucleic:2D structure" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-gap\fR \fIinteger\fR
+.RS 4
+Default value: 12
+.RE
+.PP
+\fB\-threshold\fR \fIinteger\fR
+.RS 4
+Default value: 50
+.RE
+.PP
+\fB\-match\fR \fIinteger\fR
+.RS 4
+Default value: 3
+.RE
+.PP
+\fB\-mismatch\fR \fIinteger\fR
+.RS 4
+Default value: \-4
+.RE
+.SS "Additional section"
+.PP
+\fB\-maxrepeat\fR \fIinteger\fR
+.RS 4
+Maximum separation between the start of repeat and the end of the inverted repeat (the default is 2000 bases). Default value: 2000
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+The sequence of the inverted repeat regions without gap characters.
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+einverted is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/embossdata.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/embossdata.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/embossdata.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,70 @@
+.\"     Title: EMBOSSDATA
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EMBOSSDATA" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+embossdata \- Finds or fetches data files read by EMBOSS programs
+.SH "SYNOPSIS"
+.HP 11
+\fBembossdata\fR [\fB\-showall\ \fR\fB\fItoggle\fR\fR] \fB\-fetch\ \fR\fB\fIboolean\fR\fR \fB\-filename\ \fR\fB\fIstring\fR\fR \fB\-reject\ \fR\fB\fIselection\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
+.HP 11
+\fBembossdata\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBembossdata\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Misc" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-showall\fR \fItoggle\fR
+.RS 4
+.RE
+.PP
+\fB\-fetch\fR \fIboolean\fR
+.RS 4
+.RE
+.PP
+\fB\-filename\fR \fIstring\fR
+.RS 4
+This specifies the name of the file that should be fetched into the current directory or searched for in all of the directories that EMBOSS programs search when looking for a data file. The name of the file is not altered when it is fetched.
+.RE
+.SS "Advanced section"
+.PP
+\fB\-reject\fR \fIselection\fR
+.RS 4
+This specifies the names of the sub\-directories of the EMBOSS data directory that should be ignored when displaying data directories. Default value: 3, 5, 6
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+This specifies the name of the file that the results of a search for a file in the various data directories is written to. By default these results are written to the screen (stdout). Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+embossdata is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/embossversion.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/embossversion.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/embossversion.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,55 @@
+.\"     Title: EMBOSSVERSION
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EMBOSSVERSION" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+embossversion \- Writes the current EMBOSS version number
+.SH "SYNOPSIS"
+.HP 14
+\fBembossversion\fR [\fB\-full\ \fR\fB\fIboolean\fR\fR] [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
+.HP 14
+\fBembossversion\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBembossversion\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Misc" command group(s).
+.SH "OPTIONS"
+.SS "Additional section"
+.PP
+\fB\-full\fR \fIboolean\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+embossversion is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/emma.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/emma.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/emma.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,198 @@
+.\"     Title: EMMA
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EMMA" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+emma \- Multiple alignment program \- interface to ClustalW program
+.SH "SYNOPSIS"
+.HP 5
+\fBemma\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-onlydend\ \fR\fB\fItoggle\fR\fR] \fB\-dend\ \fR\fB\fItoggle\fR\fR \fB\-dendfile\ \fR\fB\fIinfile\fR\fR \fB\-pwmatrix\ \fR\fB\fIlist\fR\fR \fB\-pwdnamatrix\ \fR\fB\fIlist\fR\fR \fB\-usermatrix\ \fR\fB\fIvariable\fR\fR \fB\-pairwisedatafile\ \fR\fB\fIinfile\fR\fR \fB\-matrix\ \fR\fB\fIlist\fR\fR \fB\-usermamatrix\ \fR\fB\fIvariable\fR\fR \fB\-dnamatrix\ \fR\fB\fIlist\fR\fR \fB\-umamatrix\ \fR\fB\fIvariable\fR\fR \fB\-mamatrixfile\ \fR\fB\fIinfile\fR\fR [\fB\-slow\ \fR\fB\fItoggle\fR\fR] \fB\-pwgapopen\ \fR\fB\fIfloat\fR\fR \fB\-pwgapextend\ \fR\fB\fIfloat\fR\fR \fB\-ktup\ \fR\fB\fIinteger\fR\fR \fB\-gapw\ \fR\fB\fIinteger\fR\fR \fB\-topdiags\ \fR\fB\fIinteger\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-nopercent\ \fR\fB\fIboolean\fR\fR [\fB\-gapopen\ \fR\fB\fIfloat\fR\fR] [\fB\-gapextend\ \fR\fB\fIfloat\fR\fR] [\fB\-endgaps\ \fR\fB\fIboolean\fR\fR] [\fB\-gapdist\ \fR\fB\fIinteger\fR\fR] \fB\-norgap\ \fR\fB\fIboolean\fR\fR \fB\-hgapres\ \fR\fB\fIstring\fR\fR \fB\-nohgap\ \fR\fB\fIboolean\fR\fR [\fB\-maxdiv\ \fR\fB\fIinteger\fR\fR] \fB\-outseq\ \fR\fB\fIseqoutset\fR\fR \fB\-dendoutfile\ \fR\fB\fIoutfile\fR\fR
+.HP 5
+\fBemma\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBemma\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Multiple" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-onlydend\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-dend\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-dendfile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Protein align options"
+.PP
+\fB\-pwmatrix\fR \fIlist\fR
+.RS 4
+The scoring table which describes the similarity of each amino acid to each other. There are three 'in\-built' series of weight matrices offered. Each consists of several matrices which work differently at different evolutionary distances. To see the exact details, read the documentation. Crudely, we store several matrices in memory, spanning the full range of amino acid distance (from almost identical sequences to highly divergent ones). For very similar sequences, it is best to use a strict weight matrix which only gives a high score to identities and the most favoured conservative substitutions. For more divergent sequences, it is appropriate to use 'softer' matrices which give a high score to many other frequent substitutions. 1) BLOSUM (Henikoff). These matrices appear to be the best available for carrying out data base similarity (homology searches). The matrices used are: Blosum80, 62, 45 and 30. 2) PAM (Dayhoff). These have been extremely widely used since the late '70s. We use the PAM 120, 160, 250 and 350 matrices. 3) GONNET . These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set. They appear to be more sensitive than the Dayhoff series. We use the GONNET 40, 80, 120, 160, 250 and 350 matrices. We also supply an identity matrix which gives a score of 1.0 to two identical amino acids and a score of zero otherwise. This matrix is not very useful. Default value: b
+.RE
+.PP
+\fB\-pwdnamatrix\fR \fIlist\fR
+.RS 4
+The scoring table which describes the scores assigned to matches and mismatches (including IUB ambiguity codes). Default value: i
+.RE
+.PP
+\fB\-usermatrix\fR \fIvariable\fR
+.RS 4
+.RE
+.PP
+\fB\-pairwisedatafile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Matrix options"
+.PP
+\fB\-matrix\fR \fIlist\fR
+.RS 4
+This gives a menu where you are offered a choice of weight matrices. The default for proteins is the PAM series derived by Gonnet and colleagues. Note, a series is used! The actual matrix that is used depends on how similar the sequences to be aligned at this alignment step are. Different matrices work differently at each evolutionary distance. There are three 'in\-built' series of weight matrices offered. Each consists of several matrices which work differently at different evolutionary distances. To see the exact details, read the documentation. Crudely, we store several matrices in memory, spanning the full range of amino acid distance (from almost identical sequences to highly divergent ones). For very similar sequences, it is best to use a strict weight matrix which only gives a high score to identities and the most favoured conservative substitutions. For more divergent sequences, it is appropriate to use 'softer' matrices which give a high score to many other frequent substitutions. 1) BLOSUM (Henikoff). These matrices appear to be the best available for carrying out data base similarity (homology searches). The matrices used are: Blosum80, 62, 45 and 30. 2) PAM (Dayhoff). These have been extremely widely used since the late '70s. We use the PAM 120, 160, 250 and 350 matrices. 3) GONNET . These matrices were derived using almost the same procedure as the Dayhoff one (above) but are much more up to date and are based on a far larger data set. They appear to be more sensitive than the Dayhoff series. We use the GONNET 40, 80, 120, 160, 250 and 350 matrices. We also supply an identity matrix which gives a score of 1.0 to two identical amino acids and a score of zero otherwise. This matrix is not very useful. Alternatively, you can read in your own (just one matrix, not a series). Default value: b
+.RE
+.PP
+\fB\-usermamatrix\fR \fIvariable\fR
+.RS 4
+.RE
+.PP
+\fB\-dnamatrix\fR \fIlist\fR
+.RS 4
+This gives a menu where a single matrix (not a series) can be selected. Default value: i
+.RE
+.PP
+\fB\-umamatrix\fR \fIvariable\fR
+.RS 4
+.RE
+.PP
+\fB\-mamatrixfile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Slow align options"
+.PP
+\fB\-slow\fR \fItoggle\fR
+.RS 4
+A distance is calculated between every pair of sequences and these are used to construct the dendrogram which guides the final multiple alignment. The scores are calculated from separate pairwise alignments. These can be calculated using 2 methods: dynamic programming (slow but accurate) or by the method of Wilbur and Lipman (extremely fast but approximate). The slow\-accurate method is fine for short sequences but will be VERY SLOW for many (e.g. >100) long (e.g. >1000 residue) sequences. Default value: Y
+.RE
+.PP
+\fB\-pwgapopen\fR \fIfloat\fR
+.RS 4
+The penalty for opening a gap in the pairwise alignments. Default value: 10.0
+.RE
+.PP
+\fB\-pwgapextend\fR \fIfloat\fR
+.RS 4
+The penalty for extending a gap by 1 residue in the pairwise alignments. Default value: 0.1
+.RE
+.SS "Fast align options"
+.PP
+\fB\-ktup\fR \fIinteger\fR
+.RS 4
+This is the size of exactly matching fragment that is used. INCREASE for speed (max= 2 for proteins; 4 for DNA), DECREASE for sensitivity. For longer sequences (e.g. >1000 residues) you may need to increase the default. Default value: @($(acdprotein)?1:2)
+.RE
+.PP
+\fB\-gapw\fR \fIinteger\fR
+.RS 4
+This is a penalty for each gap in the fast alignments. It has little affect on the speed or sensitivity except for extreme values. Default value: @($(acdprotein)?3:5)
+.RE
+.PP
+\fB\-topdiags\fR \fIinteger\fR
+.RS 4
+The number of k\-tuple matches on each diagonal (in an imaginary dot\-matrix plot) is calculated. Only the best ones (with most matches) are used in the alignment. This parameter specifies how many. Decrease for speed; increase for sensitivity. Default value: @($(acdprotein)?5:4)
+.RE
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+This is the number of diagonals around each of the 'best' diagonals that will be used. Decrease for speed; increase for sensitivity. Default value: @($(acdprotein)?5:4)
+.RE
+.PP
+\fB\-nopercent\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Gap options"
+.PP
+\fB\-gapopen\fR \fIfloat\fR
+.RS 4
+The penalty for opening a gap in the alignment. Increasing the gap opening penalty will make gaps less frequent. Default value: 10.0
+.RE
+.PP
+\fB\-gapextend\fR \fIfloat\fR
+.RS 4
+The penalty for extending a gap by 1 residue. Increasing the gap extension penalty will make gaps shorter. Terminal gaps are not penalised. Default value: 5.0
+.RE
+.PP
+\fB\-endgaps\fR \fIboolean\fR
+.RS 4
+End gap separation: treats end gaps just like internal gaps for the purposes of avoiding gaps that are too close (set by 'gap separation distance'). If you turn this off, end gaps will be ignored for this purpose. This is useful when you wish to align fragments where the end gaps are not biologically meaningful. Default value: Y
+.RE
+.PP
+\fB\-gapdist\fR \fIinteger\fR
+.RS 4
+Gap separation distance: tries to decrease the chances of gaps being too close to each other. Gaps that are less than this distance apart are penalised more than other gaps. This does not prevent close gaps; it makes them less frequent, promoting a block\-like appearance of the alignment. Default value: 8
+.RE
+.PP
+\fB\-norgap\fR \fIboolean\fR
+.RS 4
+Residue specific penalties: amino acid specific gap penalties that reduce or increase the gap opening penalties at each position in the alignment or sequence. As an example, positions that are rich in glycine are more likely to have an adjacent gap than positions that are rich in valine. Default value: N
+.RE
+.PP
+\fB\-hgapres\fR \fIstring\fR
+.RS 4
+This is a set of the residues 'considered' to be hydrophilic. It is used when introducing Hydrophilic gap penalties. Default value: GPSNDQEKR
+.RE
+.PP
+\fB\-nohgap\fR \fIboolean\fR
+.RS 4
+Hydrophilic gap penalties: used to increase the chances of a gap within a run (5 or more residues) of hydrophilic amino acids; these are likely to be loop or random coil regions where gaps are more common. The residues that are 'considered' to be hydrophilic are set by '\-hgapres'. Default value: N
+.RE
+.PP
+\fB\-maxdiv\fR \fIinteger\fR
+.RS 4
+This switch, delays the alignment of the most distantly related sequences until after the most closely related sequences have been aligned. The setting shows the percent identity level required to delay the addition of a sequence; sequences that are less identical than this level to any other sequences will be aligned later. Default value: 30
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutset\fR
+.RS 4
+.RE
+.PP
+\fB\-dendoutfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+emma is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/emowse.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/emowse.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/emowse.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,94 @@
+.\"     Title: EMOWSE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EMOWSE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+emowse \- Protein identification by mass spectrometry
+.SH "SYNOPSIS"
+.HP 7
+\fBemowse\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-aadata\ \fR\fB\fIdatafile\fR\fR \fB\-frequencies\ \fR\fB\fIdatafile\fR\fR \fB\-weight\ \fR\fB\fIinteger\fR\fR \fB\-enzyme\ \fR\fB\fIlist\fR\fR \fB\-pcrange\ \fR\fB\fIinteger\fR\fR \fB\-tolerance\ \fR\fB\fIfloat\fR\fR \fB\-partials\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 7
+\fBemowse\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBemowse\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.PP
+\fB\-aadata\fR \fIdatafile\fR
+.RS 4
+Default value: Eamino.dat
+.RE
+.PP
+\fB\-frequencies\fR \fIdatafile\fR
+.RS 4
+Default value: Efreqs.dat
+.RE
+.SS "Required section"
+.PP
+\fB\-weight\fR \fIinteger\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-enzyme\fR \fIlist\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-pcrange\fR \fIinteger\fR
+.RS 4
+Default value: 25
+.RE
+.PP
+\fB\-tolerance\fR \fIfloat\fR
+.RS 4
+Default value: 0.1
+.RE
+.PP
+\fB\-partials\fR \fIfloat\fR
+.RS 4
+Default value: 0.4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+emowse is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/entrails.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/entrails.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/entrails.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,55 @@
+.\"     Title: ENTRAILS
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ENTRAILS" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+entrails \- Reports the internal data from the EMBOSS code
+.SH "SYNOPSIS"
+.HP 9
+\fBentrails\fR [\fB\-fullreport\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 9
+\fBentrails\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBentrails\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Misc" command group(s).
+.SH "OPTIONS"
+.SS "Additional section"
+.PP
+\fB\-fullreport\fR \fIboolean\fR
+.RS 4
+By default, only the essential details are reported Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+entrails is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/entret.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/entret.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/entret.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,59 @@
+.\"     Title: ENTRET
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ENTRET" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+entret \- Reads and writes (returns) flatfile entries
+.SH "SYNOPSIS"
+.HP 7
+\fBentret\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-firstonly\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 7
+\fBentret\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBentret\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-firstonly\fR \fIboolean\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+entret is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/epestfind.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/epestfind.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/epestfind.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,103 @@
+.\"     Title: EPESTFIND
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EPESTFIND" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+epestfind \- Finds PEST motifs as potential proteolytic cleavage sites
+.SH "SYNOPSIS"
+.HP 10
+\fBepestfind\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-aadata\ \fR\fB\fIdatafile\fR\fR] \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-order\ \fR\fB\fIselection\fR\fR [\fB\-threshold\ \fR\fB\fIfloat\fR\fR] \fB\-potential\ \fR\fB\fIboolean\fR\fR \fB\-poor\ \fR\fB\fIboolean\fR\fR \fB\-invalid\ \fR\fB\fIboolean\fR\fR \fB\-map\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR
+.HP 10
+\fBepestfind\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBepestfind\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+Protein sequence USA to be analysed.
+.RE
+.PP
+\fB\-aadata\fR \fIdatafile\fR
+.RS 4
+Default value: Eamino.dat
+.RE
+.SS "Required section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+Minimal distance between positively charged amino acids. Default value: 10
+.RE
+.PP
+\fB\-order\fR \fIselection\fR
+.RS 4
+Name of the output file which holds the results of the analysis. Results may be sorted by length, position and score. Default value: score
+.RE
+.SS "Additional section"
+.PP
+\fB\-threshold\fR \fIfloat\fR
+.RS 4
+Threshold value to discriminate weak from potential PEST motifs. Valid PEST motifs are discriminated into 'poor' and 'potential' motifs depending on this threshold score. By default, the default value is set to +5.0 based on experimental data. Alterations are not recommended since significance is a matter of biology, not mathematics. Default value: +5.0
+.RE
+.SS "Advanced section"
+.PP
+\fB\-potential\fR \fIboolean\fR
+.RS 4
+Decide whether potential PEST motifs should be printed. Default value: Y
+.RE
+.PP
+\fB\-poor\fR \fIboolean\fR
+.RS 4
+Decide whether poor PEST motifs should be printed. Default value: Y
+.RE
+.PP
+\fB\-invalid\fR \fIboolean\fR
+.RS 4
+Decide whether invalid PEST motifs should be printed. Default value: N
+.RE
+.PP
+\fB\-map\fR \fIboolean\fR
+.RS 4
+Decide whether PEST motifs should be mapped to sequence. Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Name of file to which results will be written.
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+epestfind is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/eprimer3.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/eprimer3.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/eprimer3.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,349 @@
+.\"     Title: EPRIMER3
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EPRIMER3" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+eprimer3 \- Picks PCR primers and hybridization oligos
+.SH "SYNOPSIS"
+.HP 9
+\fBeprimer3\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-primer\ \fR\fB\fItoggle\fR\fR] \fB\-task\ \fR\fB\fIlist\fR\fR [\fB\-hybridprobe\ \fR\fB\fItoggle\fR\fR] \fB\-oligomishyblibraryfile\ \fR\fB\fIinfile\fR\fR \fB\-mispriminglibraryfile\ \fR\fB\fIinfile\fR\fR [\fB\-numreturn\ \fR\fB\fIinteger\fR\fR] [\fB\-includedregion\ \fR\fB\fIrange\fR\fR] [\fB\-target\ \fR\fB\fIrange\fR\fR] [\fB\-excludedregion\ \fR\fB\fIrange\fR\fR] [\fB\-forwardinput\ \fR\fB\fIstring\fR\fR] [\fB\-reverseinput\ \fR\fB\fIstring\fR\fR] \fB\-gcclamp\ \fR\fB\fIinteger\fR\fR \fB\-osize\ \fR\fB\fIinteger\fR\fR \fB\-minsize\ \fR\fB\fIinteger\fR\fR \fB\-maxsize\ \fR\fB\fIinteger\fR\fR \fB\-otm\ \fR\fB\fIfloat\fR\fR \fB\-mintm\ \fR\fB\fIfloat\fR\fR \fB\-maxtm\ \fR\fB\fIfloat\fR\fR \fB\-maxdifftm\ \fR\fB\fIfloat\fR\fR \fB\-ogcpercent\ \fR\fB\fIfloat\fR\fR \fB\-mingc\ \fR\fB\fIfloat\fR\fR \fB\-maxgc\ \fR\fB\fIfloat\fR\fR \fB\-saltconc\ \fR\fB\fIfloat\fR\fR \fB\-dnaconc\ \fR\fB\fIfloat\fR\fR \fB\-maxpolyx\ \fR\fB\fIinteger\fR\fR \fB\-productosize\ \fR\fB\fIinteger\fR\fR \fB\-productsizerange\ \fR\fB\fIrange\fR\fR \fB\-productotm\ \fR\fB\fIfloat\fR\fR \fB\-productmintm\ \fR\fB\fIfloat\fR\fR \fB\-productmaxtm\ \fR\fB\fIfloat\fR\fR \fB\-oligoexcludedregion\ \fR\fB\fIrange\fR\fR \fB\-oligoinput\ \fR\fB\fIstring\fR\fR \fB\-oligoosize\ \fR\fB\fIinteger\fR\fR \fB\-oligominsize\ \fR\fB\fIinteger\fR\fR \fB\-oligomaxsize\ \fR\fB\fIinteger\fR\fR \fB\-oligootm\ \fR\fB\fIfloat\fR\fR \fB\-oligomintm\ \fR\fB\fIfloat\fR\fR \fB\-oligomaxtm\ \fR\fB\fIfloat\fR\fR \fB\-oligoogcpercent\ \fR\fB\fIfloat\fR\fR \fB\-oligomingc\ \fR\fB\fIfloat\fR\fR \fB\-oligomaxgc\ \fR\fB\fIfloat\fR\fR \fB\-oligosaltconc\ \fR\fB\fIfloat\fR\fR \fB\-oligodnaconc\ \fR\fB\fIfloat\fR\fR \fB\-oligoselfany\ \fR\fB\fIfloat\fR\fR \fB\-oligoselfend\ \fR\fB\fIfloat\fR\fR \fB\-oligomaxpolyx\ \fR\fB\fIinteger\fR\fR \fB\-oligomaxmishyb\ \fR\fB\fIfloat\fR\fR \fB\-explainflag\ \fR\fB\fIboolean\fR\fR \fB\-fileflag\ \fR\fB\fIboolean\fR\fR \fB\-firstbaseindex\ \fR\fB\fIinteger\fR\fR \fB\-pickanyway\ \fR\fB\fIboolean\fR\fR \fB\-maxmispriming\ \fR\fB\fIfloat\fR\fR \fB\-pairmaxmispriming\ \fR\fB\fIfloat\fR\fR \fB\-numnsaccepted\ \fR\fB\fIinteger\fR\fR \fB\-selfany\ \fR\fB\fIfloat\fR\fR \fB\-selfend\ \fR\fB\fIfloat\fR\fR \fB\-maxendstability\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 9
+\fBeprimer3\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBeprimer3\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Primers" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+The sequence from which to choose primers. The sequence must be presented 5' to 3'
+.RE
+.PP
+\fB\-primer\fR \fItoggle\fR
+.RS 4
+Tell EPrimer3 to pick primer(s) Default value: Y
+.RE
+.PP
+\fB\-task\fR \fIlist\fR
+.RS 4
+Tell EPrimer3 what task to perform. Legal values are 1: 'Pick PCR primers', 2: 'Pick forward primer only', 3: 'Pick reverse primer only', 4: 'No primers needed'. Default value: 1
+.RE
+.PP
+\fB\-hybridprobe\fR \fItoggle\fR
+.RS 4
+An 'internal oligo' is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification. Default value: N
+.RE
+.PP
+\fB\-oligomishyblibraryfile\fR \fIinfile\fR
+.RS 4
+Similar to MISPRIMING\-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them. The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444\-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then EPrimer3 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL\-OLIGO\-MAX\-MISHYB. (The maximum value of the weight is arbitrarily set to 12.0.) Each sequence entry in the FASTA\-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that EPrimer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF\-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length. An empty value for this parameter indicates that no library should be used.
+.RE
+.PP
+\fB\-mispriminglibraryfile\fR \fIinfile\fR
+.RS 4
+The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified.) The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444\-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then EPrimer3 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX\-MISPRIMING. (The maximum value of the weight is arbitrarily set to 100.0.) Each sequence entry in the FASTA\-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that EPrimer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF\-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length. An empty value for this parameter indicates that no repeat library should be used.
+.RE
+.SS "Additional section"
+.SS "Program options"
+.PP
+\fB\-numreturn\fR \fIinteger\fR
+.RS 4
+The maximum number of primer pairs to return. Primer pairs returned are sorted by their 'quality', in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time. Default value: 5
+.RE
+.SS "Sequence options"
+.PP
+\fB\-includedregion\fR \fIrange\fR
+.RS 4
+A sub\-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form (start),(end) where (start) is the index of the first base to consider, and (end) is the last in the primer\-picking region.
+.RE
+.PP
+\fB\-target\fR \fIrange\fR
+.RS 4
+If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single\-base\-pair polymorphism. The value should be a space\-separated list of (start),(end) pairs where (start) is the index of the first base of a Target, and (end) is the last E.g. 50,51 requires primers to surround the 2 bases at positions 50 and 51.
+.RE
+.PP
+\fB\-excludedregion\fR \fIrange\fR
+.RS 4
+Primer oligos may not overlap any region specified in this tag. The associated value must be a space\-separated list of (start),(end) pairs where (start) is the index of the first base of the excluded region, and and (end) is the last. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs. E.g. 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68.
+.RE
+.PP
+\fB\-forwardinput\fR \fIstring\fR
+.RS 4
+The sequence of a forward primer to check and around which to design reverse primers and optional internal oligos. Must be a substring of SEQUENCE.
+.RE
+.PP
+\fB\-reverseinput\fR \fIstring\fR
+.RS 4
+The sequence of a reverse primer to check and around which to design forward primers and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE.
+.RE
+.SS "Primer options"
+.PP
+\fB\-gcclamp\fR \fIinteger\fR
+.RS 4
+Require the specified number of consecutive Gs and Cs at the 3' end of both the forward and reverse primer. (This parameter has no effect on the internal oligo if one is requested.)
+.RE
+.PP
+\fB\-osize\fR \fIinteger\fR
+.RS 4
+Optimum length (in bases) of a primer oligo. EPrimer3 will attempt to pick primers close to this length. Default value: 20
+.RE
+.PP
+\fB\-minsize\fR \fIinteger\fR
+.RS 4
+Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX\-SIZE. Default value: 18
+.RE
+.PP
+\fB\-maxsize\fR \fIinteger\fR
+.RS 4
+Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which EPrimer3's melting\-temperature is valid. Default value: 27
+.RE
+.PP
+\fB\-otm\fR \fIfloat\fR
+.RS 4
+Optimum melting temperature(Celsius) for a primer oligo. EPrimer3 will try to pick primers with melting temperatures are close to this temperature. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409\-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746\-3750. Please refer to the former paper for background discussion. Default value: 60.0
+.RE
+.PP
+\fB\-mintm\fR \fIfloat\fR
+.RS 4
+Minimum acceptable melting temperature(Celsius) for a primer oligo. Default value: 57.0
+.RE
+.PP
+\fB\-maxtm\fR \fIfloat\fR
+.RS 4
+Maximum acceptable melting temperature(Celsius) for a primer oligo. Default value: 63.0
+.RE
+.PP
+\fB\-maxdifftm\fR \fIfloat\fR
+.RS 4
+Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers. Default value: 100.0
+.RE
+.PP
+\fB\-ogcpercent\fR \fIfloat\fR
+.RS 4
+Primer optimum GC percent. Default value: 50.0
+.RE
+.PP
+\fB\-mingc\fR \fIfloat\fR
+.RS 4
+Minimum allowable percentage of Gs and Cs in any primer. Default value: 20.0
+.RE
+.PP
+\fB\-maxgc\fR \fIfloat\fR
+.RS 4
+Maximum allowable percentage of Gs and Cs in any primer generated by Primer. Default value: 80.0
+.RE
+.PP
+\fB\-saltconc\fR \fIfloat\fR
+.RS 4
+The millimolar concentration of salt (usually KCl) in the PCR. EPrimer3 uses this argument to calculate oligo melting temperatures. Default value: 50.0
+.RE
+.PP
+\fB\-dnaconc\fR \fIfloat\fR
+.RS 4
+The nanomolar concentration of annealing oligos in the PCR. EPrimer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research\-\-0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris\-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 12) where a suitable value (for a lower initial concentration of template) is 'empirically determined'. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures. See ADVICE FOR PICKING PRIMERS. Default value: 50.0
+.RE
+.PP
+\fB\-maxpolyx\fR \fIinteger\fR
+.RS 4
+The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA. Default value: 5
+.RE
+.SS "Product options"
+.PP
+\fB\-productosize\fR \fIinteger\fR
+.RS 4
+The optimum size for the PCR product. 0 indicates that there is no optimum product size. Default value: 200
+.RE
+.PP
+\fB\-productsizerange\fR \fIrange\fR
+.RS 4
+The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form (x)\-(y) where an (x)\-(y) pair is a legal range of lengths for the product. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100\-150. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100\-150 200\-250. EPrimer3 favors ranges to the left side of the parameter string. EPrimer3 will return legal primers pairs in the first range regardless the value of the objective function for these pairs. Only if there are an insufficient number of primers in the first range will EPrimer3 return primers in a subsequent range. Default value: 100\-300
+.RE
+.PP
+\fB\-productotm\fR \fIfloat\fR
+.RS 4
+The optimum melting temperature for the PCR product. 0 indicates that there is no optimum temperature. Default value: 0.0
+.RE
+.PP
+\fB\-productmintm\fR \fIfloat\fR
+.RS 4
+The minimum allowed melting temperature of the amplicon. Please see the documentation on the maximum melting temperature of the product for details. Default value: \-1000000.0
+.RE
+.PP
+\fB\-productmaxtm\fR \fIfloat\fR
+.RS 4
+The maximum allowed melting temperature of the amplicon. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) \- 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence. A similar formula is used by the prime primer selection program in GCG http://www.gcg.com), which instead uses 675.0/length in the last term (after F. Baldino, Jr, M.\-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms). The formulas here and in Baldino et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to .2 M Na+. EPrimer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions. Default value: 1000000.0
+.RE
+.SS "Internal oligo input"
+.PP
+\fB\-oligoexcludedregion\fR \fIrange\fR
+.RS 4
+Middle oligos may not overlap any region specified by this tag. The associated value must be a space\-separated list of (start),(end) pairs, where (start) is the index of the first base of an excluded region, and (end) is the last. Often one would make Target regions excluded regions for internal oligos.
+.RE
+.PP
+\fB\-oligoinput\fR \fIstring\fR
+.RS 4
+The sequence of an internal oligo to check and around which to design forward and reverse primers. Must be a substring of SEQUENCE.
+.RE
+.SS "Internal oligo options"
+.PP
+\fB\-oligoosize\fR \fIinteger\fR
+.RS 4
+Optimum length (in bases) of an internal oligo. EPrimer3 will attempt to pick primers close to this length. Default value: 20
+.RE
+.PP
+\fB\-oligominsize\fR \fIinteger\fR
+.RS 4
+Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL\-OLIGO\-MAX\-SIZE. Default value: 18
+.RE
+.PP
+\fB\-oligomaxsize\fR \fIinteger\fR
+.RS 4
+Maximum acceptable length (in bases) of an internal oligo. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which EPrimer3's melting\-temperature is valid. Default value: 27
+.RE
+.PP
+\fB\-oligootm\fR \fIfloat\fR
+.RS 4
+Optimum melting temperature (Celsius) for an internal oligo. EPrimer3 will try to pick oligos with melting temperatures that are close to this temperature. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409\-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746\-3750. Please refer to the former paper for background discussion. Default value: 60.0
+.RE
+.PP
+\fB\-oligomintm\fR \fIfloat\fR
+.RS 4
+Minimum acceptable melting temperature(Celsius) for an internal oligo. Default value: 57.0
+.RE
+.PP
+\fB\-oligomaxtm\fR \fIfloat\fR
+.RS 4
+Maximum acceptable melting temperature (Celsius) for an internal oligo. Default value: 63.0
+.RE
+.PP
+\fB\-oligoogcpercent\fR \fIfloat\fR
+.RS 4
+Internal oligo optimum GC percent. Default value: 50.0
+.RE
+.PP
+\fB\-oligomingc\fR \fIfloat\fR
+.RS 4
+Minimum allowable percentage of Gs and Cs in an internal oligo. Default value: 20.0
+.RE
+.PP
+\fB\-oligomaxgc\fR \fIfloat\fR
+.RS 4
+Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer. Default value: 80.0
+.RE
+.PP
+\fB\-oligosaltconc\fR \fIfloat\fR
+.RS 4
+The millimolar concentration of salt (usually KCl) in the hybridization. EPrimer3 uses this argument to calculate internal oligo melting temperatures. Default value: 50.0
+.RE
+.PP
+\fB\-oligodnaconc\fR \fIfloat\fR
+.RS 4
+The nanomolar concentration of annealing internal oligo in the hybridization. Default value: 50.0
+.RE
+.PP
+\fB\-oligoselfany\fR \fIfloat\fR
+.RS 4
+The maximum allowable local alignment score when testing an internal oligo for (local) self\-complementarity. Local self\-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1.00 for complementary bases, \-0.25 for a match of any base (or N) with an N, \-1.00 for a mismatch, and \-2.00 for a gap. Only single\-base\-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' || | | 3' TA\-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' || | | 3' TA\-\-CGT 5' is not considered. Scores are non\-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. Default value: 12.00
+.RE
+.PP
+\fB\-oligoselfend\fR \fIfloat\fR
+.RS 4
+The maximum allowable 3'\-anchored global alignment score when testing a single oligo for self\-complementarity. The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non\-negative, and a score of 0.00 indicates that there is no reasonable 3'\-anchored global alignment between two oligos. In order to estimate 3'\-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5' to 3'. INTERNAL\-OLIGO\-SELF\-END is meaningless when applied to internal oligos used for hybridization\-based detection, since primer\-dimer will not occur. We recommend that INTERNAL\-OLIGO\-SELF\-END be set at least as high as INTERNAL\-OLIGO\-SELF\-ANY. Default value: 12.00
+.RE
+.PP
+\fB\-oligomaxpolyx\fR \fIinteger\fR
+.RS 4
+The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA. Default value: 5
+.RE
+.PP
+\fB\-oligomaxmishyb\fR \fIfloat\fR
+.RS 4
+Similar to MAX\-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL\-OLIGO\-MISHYB\-LIBRARY. Default value: 12.0
+.RE
+.SS "Advanced section"
+.PP
+\fB\-explainflag\fR \fIboolean\fR
+.RS 4
+If this flag is true, produce LEFT\-EXPLAIN, RIGHT\-EXPLAIN, and INTERNAL\-OLIGO\-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that EPrimer3 examined, and statistics on the number discarded for various reasons. Default value: N
+.RE
+.PP
+\fB\-fileflag\fR \fIboolean\fR
+.RS 4
+If the associated value is true, then EPrimer3 creates two output files for each input SEQUENCE. File (sequence\-id).for lists all acceptable forward primers for (sequence\-id), and (sequence\-id).rev lists all acceptable reverse primers for (sequence\-id), where (sequence\-id) is the value of the SEQUENCE\-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, EPrimer3 produces a file (sequence\-id).int, which lists all acceptable internal oligos. Default value: N
+.RE
+.PP
+\fB\-firstbaseindex\fR \fIinteger\fR
+.RS 4
+This parameter is the index of the first base in the input sequence. For input and output using 1\-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0\-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) Default value: 1
+.RE
+.PP
+\fB\-pickanyway\fR \fIboolean\fR
+.RS 4
+If true pick a primer pair even if LEFT\-INPUT, RIGHT\-INPUT, or INTERNAL\-OLIGO\-INPUT violates specific constraints. Default value: N
+.RE
+.PP
+\fB\-maxmispriming\fR \fIfloat\fR
+.RS 4
+The maximum allowed weighted similarity with any sequence in MISPRIMING\-LIBRARY. Default value: 12.00
+.RE
+.PP
+\fB\-pairmaxmispriming\fR \fIfloat\fR
+.RS 4
+The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING\-LIBRARY. Default value: 24.00
+.RE
+.PP
+\fB\-numnsaccepted\fR \fIinteger\fR
+.RS 4
+Maximum number of unknown bases (N) allowable in any primer.
+.RE
+.PP
+\fB\-selfany\fR \fIfloat\fR
+.RS 4
+The maximum allowable local alignment score when testing a single primer for (local) self\-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers. Local self\-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self\-priming in the PCR. The scoring system gives 1.00 for complementary bases, \-0.25 for a match of any base (or N) with an N, \-1.00 for a mismatch, and \-2.00 for a gap. Only single\-base\-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' ...|| | | 3' TA\-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' ...|| | | 3' TA\-\-CGT 5' is not considered. Scores are non\-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. Default value: 8.00
+.RE
+.PP
+\fB\-selfend\fR \fIfloat\fR
+.RS 4
+The maximum allowable 3'\-anchored global alignment score when testing a single primer for self\-complementarity, and the maximum allowable 3'\-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3'\-anchored global alignment score is taken to predict the likelihood of PCR\-priming primer\-dimers, for example 5' ATGCCCTAGCTTCCGGATG 3' .............||| ||||| ..........3' AAGTCCTACATTTAGCCTAGT 5' or 5' AGGCTATGGGCCTCGCGA 3' ...............|||||| ............3' AGCGCTCCGGGTATCGGA 5' The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non\-negative, and a score of 0.00 indicates that there is no reasonable 3'\-anchored global alignment between two oligos. In order to estimate 3'\-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5' to 3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment. Default value: 3.00
+.RE
+.SS "Primer penalty weights"
+.PP
+\fB\-maxendstability\fR \fIfloat\fR
+.RS 4
+The maximum stability for the five 3' bases of a forward or reverse primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746\-3750. EPrimer3 uses a completely permissive default value for backward compatibility (which we may change in the next release). Rychlik recommends a maximum value of 9 (Wojciech Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in BA White, Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications', 1993, pp 31\-40, Humana Press, Totowa NJ). Default value: 9.0
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+eprimer3 is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/equicktandem.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/equicktandem.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/equicktandem.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,69 @@
+.\"     Title: EQUICKTANDEM
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EQUICKTANDEM" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+equicktandem \- Finds tandem repeats
+.SH "SYNOPSIS"
+.HP 13
+\fBequicktandem\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-maxrepeat\ \fR\fB\fIinteger\fR\fR \fB\-threshold\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR \fB\-origfile\ \fR\fB\fIoutfile\fR\fR
+.HP 13
+\fBequicktandem\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBequicktandem\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Repeats" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-maxrepeat\fR \fIinteger\fR
+.RS 4
+Default value: 600
+.RE
+.PP
+\fB\-threshold\fR \fIinteger\fR
+.RS 4
+Default value: 20
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.PP
+\fB\-origfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+equicktandem is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/est2genome.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/est2genome.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/est2genome.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,134 @@
+.\"     Title: EST2GENOME
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EST2GENOME" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+est2genome \- Align EST and genomic DNA sequences
+.SH "SYNOPSIS"
+.HP 11
+\fBest2genome\fR \fB\-estsequence\ \fR\fB\fIseqall\fR\fR \fB\-genomesequence\ \fR\fB\fIsequence\fR\fR [\fB\-match\ \fR\fB\fIinteger\fR\fR] [\fB\-mismatch\ \fR\fB\fIinteger\fR\fR] [\fB\-gappenalty\ \fR\fB\fIinteger\fR\fR] [\fB\-intronpenalty\ \fR\fB\fIinteger\fR\fR] [\fB\-splicepenalty\ \fR\fB\fIinteger\fR\fR] [\fB\-minscore\ \fR\fB\fIinteger\fR\fR] \fB\-reverse\ \fR\fB\fIboolean\fR\fR \fB\-splice\ \fR\fB\fIboolean\fR\fR \fB\-mode\ \fR\fB\fIlist\fR\fR \fB\-best\ \fR\fB\fIboolean\fR\fR \fB\-space\ \fR\fB\fIfloat\fR\fR \fB\-shuffle\ \fR\fB\fIinteger\fR\fR \fB\-seed\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-align\ \fR\fB\fIboolean\fR\fR \fB\-width\ \fR\fB\fIinteger\fR\fR
+.HP 11
+\fBest2genome\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBest2genome\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Global" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-estsequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-genomesequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-match\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-mismatch\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-gappenalty\fR \fIinteger\fR
+.RS 4
+Cost for deleting a single base in either sequence, excluding introns Default value: 2
+.RE
+.PP
+\fB\-intronpenalty\fR \fIinteger\fR
+.RS 4
+Cost for an intron, independent of length. Default value: 40
+.RE
+.PP
+\fB\-splicepenalty\fR \fIinteger\fR
+.RS 4
+Cost for an intron, independent of length and starting/ending on donor\-acceptor sites Default value: 20
+.RE
+.PP
+\fB\-minscore\fR \fIinteger\fR
+.RS 4
+Exclude alignments with scores below this threshold score. Default value: 30
+.RE
+.SS "Advanced section"
+.PP
+\fB\-reverse\fR \fIboolean\fR
+.RS 4
+Reverse the orientation of the EST sequence
+.RE
+.PP
+\fB\-splice\fR \fIboolean\fR
+.RS 4
+Use donor and acceptor splice sites. If you want to ignore donor\-acceptor sites then set this to be false. Default value: Y
+.RE
+.PP
+\fB\-mode\fR \fIlist\fR
+.RS 4
+This determines the comparion mode. The default value is 'both', in which case both strands of the est are compared assuming a forward gene direction (ie GT/AG splice sites), and the best comparsion redone assuming a reversed (CT/AC) gene splicing direction. The other allowed modes are 'forward', when just the forward strand is searched, and 'reverse', ditto for the reverse strand. Default value: both
+.RE
+.PP
+\fB\-best\fR \fIboolean\fR
+.RS 4
+You can print out all comparisons instead of just the best one by setting this to be false. Default value: Y
+.RE
+.PP
+\fB\-space\fR \fIfloat\fR
+.RS 4
+For linear\-space recursion. If product of sequence lengths divided by 4 exceeds this then a divide\-and\-conquer strategy is used to control the memory requirements. In this way very long sequences can be aligned. If you have a machine with plenty of memory you can raise this parameter (but do not exceed the machine's physical RAM) Default value: 10.0
+.RE
+.PP
+\fB\-shuffle\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-seed\fR \fIinteger\fR
+.RS 4
+Default value: 20825
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-align\fR \fIboolean\fR
+.RS 4
+Show the alignment. The alignment includes the first and last 5 bases of each intron, together with the intron width. The direction of splicing is indicated by angle brackets (forward or reverse) or ???? (unknown).
+.RE
+.PP
+\fB\-width\fR \fIinteger\fR
+.RS 4
+Default value: 50
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+est2genome is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/etandem.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/etandem.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/etandem.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,83 @@
+.\"     Title: ETANDEM
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ETANDEM" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+etandem \- Looks for tandem repeats in a nucleotide sequence
+.SH "SYNOPSIS"
+.HP 8
+\fBetandem\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-minrepeat\ \fR\fB\fIinteger\fR\fR \fB\-maxrepeat\ \fR\fB\fIinteger\fR\fR \fB\-threshold\ \fR\fB\fIinteger\fR\fR \fB\-mismatch\ \fR\fB\fIboolean\fR\fR \fB\-uniform\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR \fB\-origfile\ \fR\fB\fIoutfile\fR\fR
+.HP 8
+\fBetandem\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBetandem\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Repeats" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-minrepeat\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.PP
+\fB\-maxrepeat\fR \fIinteger\fR
+.RS 4
+Default value: $(minrepeat)
+.RE
+.SS "Advanced section"
+.PP
+\fB\-threshold\fR \fIinteger\fR
+.RS 4
+Default value: 20
+.RE
+.PP
+\fB\-mismatch\fR \fIboolean\fR
+.RS 4
+.RE
+.PP
+\fB\-uniform\fR \fIboolean\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.PP
+\fB\-origfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+etandem is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/extractalign.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/extractalign.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/extractalign.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: EXTRACTALIGN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EXTRACTALIGN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+extractalign \- Extract regions from a sequence alignment
+.SH "SYNOPSIS"
+.HP 13
+\fBextractalign\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR \fB\-regions\ \fR\fB\fIrange\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 13
+\fBextractalign\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBextractalign\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqset\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-regions\fR \fIrange\fR
+.RS 4
+Regions to extract. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non\-digit, non\-alpha character. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 Default value: $(sequence.begin)\-$(sequence.end)
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+extractalign is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/extractfeat.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/extractfeat.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/extractfeat.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,115 @@
+.\"     Title: EXTRACTFEAT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EXTRACTFEAT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+extractfeat \- Extract features from a sequence
+.SH "SYNOPSIS"
+.HP 12
+\fBextractfeat\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-before\ \fR\fB\fIinteger\fR\fR] [\fB\-after\ \fR\fB\fIinteger\fR\fR] [\fB\-source\ \fR\fB\fIstring\fR\fR] [\fB\-type\ \fR\fB\fIstring\fR\fR] [\fB\-sense\ \fR\fB\fIinteger\fR\fR] [\fB\-minscore\ \fR\fB\fIfloat\fR\fR] [\fB\-maxscore\ \fR\fB\fIfloat\fR\fR] [\fB\-tag\ \fR\fB\fIstring\fR\fR] [\fB\-value\ \fR\fB\fIstring\fR\fR] [\fB\-join\ \fR\fB\fIboolean\fR\fR] [\fB\-featinname\ \fR\fB\fIboolean\fR\fR] [\fB\-describe\ \fR\fB\fIstring\fR\fR] \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 12
+\fBextractfeat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBextractfeat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit,Feature tables" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-before\fR \fIinteger\fR
+.RS 4
+If this value is greater than 0 then that number of bases or residues before the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the start of the extracted sequence will be this number of bases/residues before the end of the feature. So a value of '10' will start the extraction 10 bases/residues before the start of the sequence, and a value of '\-10' will start the extraction 10 bases/residues before the end of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence starts after the required start of the extraction.
+.RE
+.PP
+\fB\-after\fR \fIinteger\fR
+.RS 4
+If this value is greater than 0 then that number of bases or residues after the feature are included in the extracted sequence. This allows you to get the context of the feature. If this value is negative then the end of the extracted sequence will be this number of bases/residues after the start of the feature. So a value of '10' will end the extraction 10 bases/residues after the end of the sequence, and a value of '\-10' will end the extraction 10 bases/residues after the start of the feature. The output sequence will be padded with 'N' or 'X' characters if the sequence ends before the required end of the extraction.
+.RE
+.PP
+\fB\-source\fR \fIstring\fR
+.RS 4
+By default any feature source in the feature table is shown. You can set this to match any feature source you wish to show. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from. The source may be wildcarded by using '*'. If you wish to show more than one source, separate their names with the character '|', eg: gene* | embl Default value: *
+.RE
+.PP
+\fB\-type\fR \fIstring\fR
+.RS 4
+By default every feature in the feature table is extracted. You can set this to be any feature type you wish to extract. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to extract more than one type, separate their names with the character '|', eg: *UTR | intron Default value: *
+.RE
+.PP
+\fB\-sense\fR \fIinteger\fR
+.RS 4
+By default any feature type in the feature table is extracted. You can set this to match any feature sense you wish. 0 \- any sense, 1 \- forward sense, \-1 \- reverse sense
+.RE
+.PP
+\fB\-minscore\fR \fIfloat\fR
+.RS 4
+If this is greater than or equal to the maximum score, then any score is permitted Default value: 0.0
+.RE
+.PP
+\fB\-maxscore\fR \fIfloat\fR
+.RS 4
+If this is less than or equal to the maximum score, then any score is permitted Default value: 0.0
+.RE
+.PP
+\fB\-tag\fR \fIstring\fR
+.RS 4
+Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default any feature tag in the feature table is extracted. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to extract more than one tag, separate their names with the character '|', eg: gene | label Default value: *
+.RE
+.PP
+\fB\-value\fR \fIstring\fR
+.RS 4
+Tag values are the values associated with a feature tag. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Only some of these tags can have values, for example '/gene' can have the value of the gene name. By default any feature tag value in the feature table is shown. You can set this to match any feature tag valueyou wish to show. The tag value may be wildcarded by using '*'. If you wish to show more than one tag value, separate their names with a space or the character '|', eg: pax* | 10 Default value: *
+.RE
+.SS "Output section"
+.PP
+\fB\-join\fR \fIboolean\fR
+.RS 4
+Some features, such as CDS (coding sequence) and mRNA are composed of introns concatenated together. There may be other forms of 'joined' sequence, depending on the feature table. If this option is set TRUE, then any group of these features will be output as a single sequence. If the 'before' and 'after' qualifiers have been set, then only the sequence before the first feature and after the last feature are added. Default value: N
+.RE
+.PP
+\fB\-featinname\fR \fIboolean\fR
+.RS 4
+To aid you in identifying the type of feature that has been output, the type of feature is added to the start of the description of the output sequence. Sometimes the description of a sequence is lost in subsequent processing of the sequences file, so it is useful for the type to be a part of the sequence ID name. If you set this to be TRUE then the name is added to the ID name of the output sequence. Default value: N
+.RE
+.PP
+\fB\-describe\fR \fIstring\fR
+.RS 4
+To aid you in identifying some further properties of a feature that has been output, this lets you specify one or more tag names that should be added to the output sequence Description text, together with their values (if any). For example, if this is set to be 'gene', then if any output feature has the tag (for example) '/gene=BRCA1' associated with it, then the text '(gene=BRCA1)' will be added to the Description line. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default no feature tag is displayed. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to extract more than one tag, separate their names with the character '|', eg: gene | label
+.RE
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+extractfeat is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/extractseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/extractseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/extractseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,66 @@
+.\"     Title: EXTRACTSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "EXTRACTSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+extractseq \- Extract regions from a sequence
+.SH "SYNOPSIS"
+.HP 11
+\fBextractseq\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-regions\ \fR\fB\fIrange\fR\fR [\fB\-separate\ \fR\fB\fIboolean\fR\fR] \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 11
+\fBextractseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBextractseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-regions\fR \fIrange\fR
+.RS 4
+Regions to extract. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non\-digit, non\-alpha character. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 Default value: $(sequence.begin)\-$(sequence.end)
+.RE
+.SS "Additional section"
+.PP
+\fB\-separate\fR \fIboolean\fR
+.RS 4
+If this is set true then each specified region is written out as a separate sequence. The name of the sequence is created from the name of the original sequence with the start and end positions of the range appended with underscore characters between them, eg: XYZ region 2 to 34 is written as: XYZ_2_34 Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+extractseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/findkm.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/findkm.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/findkm.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,64 @@
+.\"     Title: FINDKM
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "FINDKM" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+findkm \- Find Km and Vmax for an enzyme reaction
+.SH "SYNOPSIS"
+.HP 7
+\fBfindkm\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-plot\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-graphlb\ \fR\fB\fIxygraph\fR\fR
+.HP 7
+\fBfindkm\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBfindkm\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Enzyme Kinetics" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-plot\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-graphlb\fR \fIxygraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+findkm is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/freak.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/freak.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/freak.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,80 @@
+.\"     Title: FREAK
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "FREAK" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+freak \- Residue/base frequency table or plot
+.SH "SYNOPSIS"
+.HP 6
+\fBfreak\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-letters\ \fR\fB\fIstring\fR\fR [\fB\-step\ \fR\fB\fIinteger\fR\fR] [\fB\-window\ \fR\fB\fIinteger\fR\fR] \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 6
+\fBfreak\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBfreak\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Composition,Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-seqall\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-letters\fR \fIstring\fR
+.RS 4
+Default value: gc
+.RE
+.SS "Additional section"
+.PP
+\fB\-step\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+Default value: 30
+.RE
+.SS "Output section"
+.PP
+\fB\-plot\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+freak is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/fuzznuc.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/fuzznuc.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/fuzznuc.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,65 @@
+.\"     Title: FUZZNUC
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "FUZZNUC" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+fuzznuc \- Nucleic acid pattern search
+.SH "SYNOPSIS"
+.HP 8
+\fBfuzznuc\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-pattern\ \fR\fB\fIpattern\fR\fR \fB\-complement\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 8
+\fBfuzznuc\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBfuzznuc\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-pattern\fR \fIpattern\fR
+.RS 4
+The standard IUPAC one\-letter codes for the nucleotides are used. The symbol 'n' is used for a position where any nucleotide is accepted. Ambiguities are indicated by listing the acceptable nucleotides for a given position, between square parentheses '[ ]'. For example: [ACG] stands for A or C or G. Ambiguities are also indicated by listing between a pair of curly brackets '{ }' the nucleotides that are not accepted at a given position. For example: {AG} stands for any nucleotides except A and G. Each element in a pattern is separated from its neighbor by a '\-'. (Optional in fuzznuc). Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis. Examples: N(3) corresponds to N\-N\-N, N(2,4) corresponds to N\-N or N\-N\-N or N\-N\-N\-N. When a pattern is restricted to either the 5' or 3' end of a sequence, that pattern either starts with a '<' symbol or respectively ends with a '>' symbol. A period ends the pattern. (Optional in fuzznuc). For example, [CG](5)TG{A}N(1,5)C
+.RE
+.SS "Advanced section"
+.PP
+\fB\-complement\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+fuzznuc is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/fuzzpro.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/fuzzpro.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/fuzzpro.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,59 @@
+.\"     Title: FUZZPRO
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "FUZZPRO" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+fuzzpro \- Protein pattern search
+.SH "SYNOPSIS"
+.HP 8
+\fBfuzzpro\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-pattern\ \fR\fB\fIpattern\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 8
+\fBfuzzpro\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBfuzzpro\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-pattern\fR \fIpattern\fR
+.RS 4
+The standard IUPAC one\-letter codes for the amino acids are used. The symbol 'x' is used for a position where any amino acid is accepted. Ambiguities are indicated by listing the acceptable amino acids for a given position, between square parentheses '[ ]'. For example: [ALT] stands for Ala or Leu or Thr. Ambiguities are also indicated by listing between a pair of curly brackets '{ }' the amino acids that are not accepted at a given position. For example: {AM} stands for any amino acid except Ala and Met. Each element in a pattern is separated from its neighbor by a '\-'. (Optional in fuzzpro). Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis. Examples: x(3) corresponds to x\-x\-x, x(2,4) corresponds to x\-x or x\-x\-x or x\-x\-x\-x. When a pattern is restricted to either the N\- or C\-terminal of a sequence, that pattern either starts with a '<' symbol or respectively ends with a '>' symbol. A period ends the pattern. (Optional in fuzzpro). For example, [DE](2)HS{P}X(2)PX(2,4)C
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+fuzzpro is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/fuzztran.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/fuzztran.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/fuzztran.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,69 @@
+.\"     Title: FUZZTRAN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "FUZZTRAN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+fuzztran \- Protein pattern search after translation
+.SH "SYNOPSIS"
+.HP 9
+\fBfuzztran\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-pattern\ \fR\fB\fIpattern\fR\fR [\fB\-frame\ \fR\fB\fIlist\fR\fR] [\fB\-table\ \fR\fB\fIlist\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 9
+\fBfuzztran\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBfuzztran\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Motifs,Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-pattern\fR \fIpattern\fR
+.RS 4
+The standard IUPAC one\-letter codes for the amino acids are used. The symbol 'x' is used for a position where any amino acid is accepted. Ambiguities are indicated by listing the acceptable amino acids for a given position, between square parentheses '[ ]'. For example: [ALT] stands for Ala or Leu or Thr. Ambiguities are also indicated by listing between a pair of curly brackets '{ }' the amino acids that are not accepted at a gven position. For example: {AM} stands for any amino acid except Ala and Met. Each element in a pattern is separated from its neighbor by a '\-'. (Optional in fuzztran) Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis. Examples: x(3) corresponds to x\-x\-x, x(2,4) corresponds to x\-x or x\-x\-x or x\-x\-x\-x. When a pattern is restricted to either the N\- or C\-terminal of a sequence, that pattern either starts with a '<' symbol or respectively ends with a '>' symbol. A period ends the pattern. (Optional in fuzztran). For example, [DE](2)HS{P}X(2)PX(2,4)C
+.RE
+.SS "Additional section"
+.PP
+\fB\-frame\fR \fIlist\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-table\fR \fIlist\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+fuzztran is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/garnier.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/garnier.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/garnier.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: GARNIER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "GARNIER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+garnier \- Predicts protein secondary structure
+.SH "SYNOPSIS"
+.HP 8
+\fBgarnier\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-idc\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 8
+\fBgarnier\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBgarnier\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:2D Structure" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-idc\fR \fIinteger\fR
+.RS 4
+In their paper, GOR mention that if you know something about the secondary structure content of the protein you are analyzing, you can do better in prediction. 'idc' is an index into a set of arrays, dharr[] and dsarr[], which provide 'decision constants' (dch, dcs), which are offsets that are applied to the weights for the helix and sheet (extend) terms. So, idc=0 says don't use the decision constant offsets, and idc=1 to 6 indicates that various combinations of dch,dcs offsets should be used.
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+garnier is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/geecee.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/geecee.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/geecee.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,54 @@
+.\"     Title: GEECEE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "GEECEE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+geecee \- Calculates fractional GC content of nucleic acid sequences
+.SH "SYNOPSIS"
+.HP 7
+\fBgeecee\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 7
+\fBgeecee\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBgeecee\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:CpG Islands" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+geecee is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/getorf.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/getorf.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/getorf.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,95 @@
+.\"     Title: GETORF
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "GETORF" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+getorf \- Finds and extracts open reading frames (ORFs)
+.SH "SYNOPSIS"
+.HP 7
+\fBgetorf\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-minsize\ \fR\fB\fIinteger\fR\fR] [\fB\-maxsize\ \fR\fB\fIinteger\fR\fR] [\fB\-find\ \fR\fB\fIlist\fR\fR] \fB\-methionine\ \fR\fB\fIboolean\fR\fR \fB\-circular\ \fR\fB\fIboolean\fR\fR \fB\-reverse\ \fR\fB\fIboolean\fR\fR \fB\-flanking\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 7
+\fBgetorf\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBgetorf\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Gene finding" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-table\fR \fIlist\fR
+.RS 4
+.RE
+.PP
+\fB\-minsize\fR \fIinteger\fR
+.RS 4
+Default value: 30
+.RE
+.PP
+\fB\-maxsize\fR \fIinteger\fR
+.RS 4
+Default value: 1000000
+.RE
+.PP
+\fB\-find\fR \fIlist\fR
+.RS 4
+This is a small menu of possible output options. The first four options are to select either the protein translation or the original nucleic acid sequence of the open reading frame. There are two possible definitions of an open reading frame: it can either be a region that is free of STOP codons or a region that begins with a START codon and ends with a STOP codon. The last three options are probably only of interest to people who wish to investigate the statistical properties of the regions around potential START or STOP codons. The last option assumes that ORF lengths are calculated between two STOP codons.
+.RE
+.SS "Advanced section"
+.PP
+\fB\-methionine\fR \fIboolean\fR
+.RS 4
+START codons at the beginning of protein products will usually code for Methionine, despite what the codon will code for when it is internal to a protein. This qualifier sets all such START codons to code for Methionine by default. Default value: Y
+.RE
+.PP
+\fB\-circular\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-reverse\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to find ORFs in the reverse complement of the sequence. Default value: Y
+.RE
+.PP
+\fB\-flanking\fR \fIinteger\fR
+.RS 4
+If you have chosen one of the options of the type of sequence to find that gives the flanking sequence around a STOP or START codon, this allows you to set the number of nucleotides either side of that codon to output. If the region of flanking nucleotides crosses the start or end of the sequence, no output is given for this codon. Default value: 100
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+getorf is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/giep.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/giep.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/giep.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,84 @@
+.\"     Title: GIEP
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "GIEP" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+giep \- Calculates the isoelectric point of a protein
+.SH "SYNOPSIS"
+.HP 5
+\fBgiep\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-step\ \fR\fB\fIfloat\fR\fR \fB\-amino\ \fR\fB\fIinteger\fR\fR \fB\-termini\ \fR\fB\fIboolean\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-report\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 5
+\fBgiep\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBgiep\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-step\fR \fIfloat\fR
+.RS 4
+Default value: .5
+.RE
+.PP
+\fB\-amino\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-termini\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-plot\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-report\fR \fItoggle\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+giep is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/helixturnhelix.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/helixturnhelix.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/helixturnhelix.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,74 @@
+.\"     Title: HELIXTURNHELIX
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "HELIXTURNHELIX" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+helixturnhelix \- Report nucleic acid binding motifs
+.SH "SYNOPSIS"
+.HP 15
+\fBhelixturnhelix\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-mean\ \fR\fB\fIfloat\fR\fR] [\fB\-sd\ \fR\fB\fIfloat\fR\fR] [\fB\-minsd\ \fR\fB\fIfloat\fR\fR] [\fB\-eightyseven\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 15
+\fBhelixturnhelix\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBhelixturnhelix\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:2D Structure,Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-mean\fR \fIfloat\fR
+.RS 4
+Default value: 238.71
+.RE
+.PP
+\fB\-sd\fR \fIfloat\fR
+.RS 4
+Default value: 293.61
+.RE
+.PP
+\fB\-minsd\fR \fIfloat\fR
+.RS 4
+Default value: 2.5
+.RE
+.PP
+\fB\-eightyseven\fR \fIboolean\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+helixturnhelix is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/histogramtest.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/histogramtest.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/histogramtest.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,74 @@
+.\"     Title: HISTOGRAMTEST
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "HISTOGRAMTEST" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+histogramtest \- Test of graphics
+.SH "SYNOPSIS"
+.HP 14
+\fBhistogramtest\fR \fB\-sets\ \fR\fB\fIinteger\fR\fR \fB\-points\ \fR\fB\fIinteger\fR\fR \fB\-bins\ \fR\fB\fIinteger\fR\fR \fB\-xstart\ \fR\fB\fIinteger\fR\fR \fB\-xend\ \fR\fB\fIinteger\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR
+.HP 14
+\fBhistogramtest\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBhistogramtest\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sets\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-points\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.PP
+\fB\-bins\fR \fIinteger\fR
+.RS 4
+Default value: $(points)
+.RE
+.PP
+\fB\-xstart\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-xend\fR \fIinteger\fR
+.RS 4
+Default value: @($(xstart)+$(points))
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+histogramtest is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/hmoment.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/hmoment.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/hmoment.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,90 @@
+.\"     Title: HMOMENT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "HMOMENT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+hmoment \- Hydrophobic moment calculation
+.SH "SYNOPSIS"
+.HP 8
+\fBhmoment\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR [\fB\-window\ \fR\fB\fIinteger\fR\fR] [\fB\-aangle\ \fR\fB\fIinteger\fR\fR] [\fB\-bangle\ \fR\fB\fIinteger\fR\fR] \fB\-baseline\ \fR\fB\fIfloat\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-double\ \fR\fB\fIboolean\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 8
+\fBhmoment\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBhmoment\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:2D Structure" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-seqall\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.PP
+\fB\-aangle\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.PP
+\fB\-bangle\fR \fIinteger\fR
+.RS 4
+Default value: 160
+.RE
+.SS "Advanced section"
+.PP
+\fB\-baseline\fR \fIfloat\fR
+.RS 4
+Default value: 0.35
+.RE
+.SS "Output section"
+.PP
+\fB\-plot\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-double\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+hmoment is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/iep.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/iep.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/iep.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,93 @@
+.\"     Title: IEP
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "IEP" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+iep \- Calculates the isoelectric point of a protein
+.SH "SYNOPSIS"
+.HP 4
+\fBiep\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-amino\ \fR\fB\fIinteger\fR\fR] [\fB\-termini\ \fR\fB\fIboolean\fR\fR] [\fB\-lysinemodified\ \fR\fB\fIinteger\fR\fR] [\fB\-disulphides\ \fR\fB\fIinteger\fR\fR] \fB\-step\ \fR\fB\fIfloat\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-report\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 4
+\fBiep\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBiep\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-amino\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-termini\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-lysinemodified\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-disulphides\fR \fIinteger\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-step\fR \fIfloat\fR
+.RS 4
+Default value: .5
+.RE
+.SS "Output section"
+.PP
+\fB\-plot\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-report\fR \fItoggle\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+iep is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/infoalign.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/infoalign.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/infoalign.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,152 @@
+.\"     Title: INFOALIGN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "INFOALIGN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+infoalign \- Information on a multiple sequence alignment
+.SH "SYNOPSIS"
+.HP 10
+\fBinfoalign\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR [\fB\-matrix\ \fR\fB\fImatrix\fR\fR] [\fB\-refseq\ \fR\fB\fIstring\fR\fR] \fB\-plurality\ \fR\fB\fIfloat\fR\fR \fB\-identity\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR [\fB\-html\ \fR\fB\fIboolean\fR\fR] \fB\-only\ \fR\fB\fIboolean\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-usa\ \fR\fB\fIboolean\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-seqlength\ \fR\fB\fIboolean\fR\fR \fB\-alignlength\ \fR\fB\fIboolean\fR\fR \fB\-gaps\ \fR\fB\fIboolean\fR\fR \fB\-gapcount\ \fR\fB\fIboolean\fR\fR \fB\-idcount\ \fR\fB\fIboolean\fR\fR \fB\-simcount\ \fR\fB\fIboolean\fR\fR \fB\-diffcount\ \fR\fB\fIboolean\fR\fR \fB\-change\ \fR\fB\fIboolean\fR\fR \fB\-weight\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR
+.HP 10
+\fBinfoalign\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBinfoalign\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Multiple,Information" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqset\fR
+.RS 4
+The sequence alignment to be displayed.
+.RE
+.PP
+\fB\-matrix\fR \fImatrix\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.PP
+\fB\-refseq\fR \fIstring\fR
+.RS 4
+If you give the number in the alignment or the name of a sequence, it will be taken to be the reference sequence. The reference sequence is the one against which all the other sequences are compared. If this is set to 0 then the consensus sequence will be used as the reference sequence. By default the consensus sequence is used as the reference sequence.
+.RE
+.SS "Advanced section"
+.PP
+\fB\-plurality\fR \fIfloat\fR
+.RS 4
+Set a cut\-off for the % of positive scoring matches below which there is no consensus. The default plurality is taken as 50% of the total weight of all the sequences in the alignment. Default value: 50.0
+.RE
+.PP
+\fB\-identity\fR \fIfloat\fR
+.RS 4
+Provides the facility of setting the required number of identities at a position for it to give a consensus. Therefore, if this is set to 100% only columns of identities contribute to the consensus. Default value: 0.0
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+If you enter the name of a file here then this program will write the sequence details into that file.
+.RE
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-only\fR \fIboolean\fR
+.RS 4
+This is a way of shortening the command line if you only want a few things to be displayed. Instead of specifying: '\-nohead \-nousa \-noname \-noalign \-nogaps \-nogapcount \-nosimcount \-noidcount \-nodiffcount \-noweight' to get only the sequence length output, you can specify '\-only \-seqlength' Default value: N
+.RE
+.PP
+\fB\-heading\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-usa\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-name\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-seqlength\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-alignlength\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-gaps\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-gapcount\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-idcount\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-simcount\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-diffcount\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-change\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-weight\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-description\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+infoalign is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/infoseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/infoseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/infoseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,131 @@
+.\"     Title: INFOSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "INFOSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+infoseq \- Displays some simple information about sequences
+.SH "SYNOPSIS"
+.HP 8
+\fBinfoseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-columns\ \fR\fB\fIboolean\fR\fR \fB\-delimiter\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] \fB\-only\ \fR\fB\fIboolean\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-usa\ \fR\fB\fIboolean\fR\fR \fB\-database\ \fR\fB\fIboolean\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-accession\ \fR\fB\fIboolean\fR\fR \fB\-gi\ \fR\fB\fIboolean\fR\fR \fB\-version\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIboolean\fR\fR \fB\-length\ \fR\fB\fIboolean\fR\fR \fB\-pgc\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR
+.HP 8
+\fBinfoseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBinfoseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Information" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-columns\fR \fIboolean\fR
+.RS 4
+Set this option on (Y) to print the sequence information into neat, aligned columns in the output file. Alternatively, leave it unset (N), in which case the information records will be delimited by a character, which you may specify by using the \-delimiter option. In other words, if \-columns is set on, the \-delimiter option is overriden. Default value: Y
+.RE
+.PP
+\fB\-delimiter\fR \fIstring\fR
+.RS 4
+This string, which is usually a single character only, is used to delimit individual records in the text output file. It could be a space character, a tab character, a pipe character or any other character or string. Default value: |
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+If you enter the name of a file here then this program will write the sequence details into that file. Default value: stdout
+.RE
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-only\fR \fIboolean\fR
+.RS 4
+This is a way of shortening the command line if you only want a few things to be displayed. Instead of specifying: '\-nohead \-noname \-noacc \-notype \-nopgc \-nodesc' to get only the length output, you can specify '\-only \-length' Default value: N
+.RE
+.PP
+\fB\-heading\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-usa\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-database\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-name\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-accession\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-gi\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-version\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-type\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-length\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-pgc\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-description\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+infoseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/intconv.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/intconv.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/intconv.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,54 @@
+.\"     Title: INTCONV
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "INTCONV" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+intconv \- Convert ints to ajints and longs to ajlongs
+.SH "SYNOPSIS"
+.HP 8
+\fBintconv\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 8
+\fBintconv\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBintconv\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+intconv is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/isochore.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/isochore.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/isochore.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,69 @@
+.\"     Title: ISOCHORE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ISOCHORE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+isochore \- Plots isochores in large DNA sequences
+.SH "SYNOPSIS"
+.HP 9
+\fBisochore\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-window\ \fR\fB\fIinteger\fR\fR] [\fB\-shift\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR
+.HP 9
+\fBisochore\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBisochore\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+Default value: 1000
+.RE
+.PP
+\fB\-shift\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+isochore is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/lindna.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/lindna.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/lindna.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,141 @@
+.\"     Title: LINDNA
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "LINDNA" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+lindna \- Draws linear maps of DNA constructs
+.SH "SYNOPSIS"
+.HP 7
+\fBlindna\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR [\fB\-maxgroups\ \fR\fB\fIinteger\fR\fR] [\fB\-maxlabels\ \fR\fB\fIinteger\fR\fR] \fB\-ruler\ \fR\fB\fIboolean\fR\fR \fB\-blocktype\ \fR\fB\fIlist\fR\fR [\fB\-intersymbol\ \fR\fB\fIselection\fR\fR] [\fB\-intercolour\ \fR\fB\fIinteger\fR\fR] [\fB\-interticks\ \fR\fB\fIboolean\fR\fR] [\fB\-gapsize\ \fR\fB\fIinteger\fR\fR] [\fB\-ticklines\ \fR\fB\fIboolean\fR\fR] [\fB\-textheight\ \fR\fB\fIfloat\fR\fR] [\fB\-textlength\ \fR\fB\fIfloat\fR\fR] [\fB\-margin\ \fR\fB\fIfloat\fR\fR] [\fB\-tickheight\ \fR\fB\fIfloat\fR\fR] [\fB\-blockheight\ \fR\fB\fIfloat\fR\fR] [\fB\-rangeheight\ \fR\fB\fIfloat\fR\fR] [\fB\-gapgroup\ \fR\fB\fIfloat\fR\fR] [\fB\-postext\ \fR\fB\fIfloat\fR\fR] \fB\-graphout\ \fR\fB\fIgraph\fR\fR
+.HP 7
+\fBlindna\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBlindna\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+Default value: inputfile
+.RE
+.SS "Additional section"
+.PP
+\fB\-maxgroups\fR \fIinteger\fR
+.RS 4
+Default value: 20
+.RE
+.PP
+\fB\-maxlabels\fR \fIinteger\fR
+.RS 4
+Default value: 10000
+.RE
+.SS "Output section"
+.PP
+\fB\-ruler\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-blocktype\fR \fIlist\fR
+.RS 4
+Default value: Filled
+.RE
+.PP
+\fB\-intersymbol\fR \fIselection\fR
+.RS 4
+Default value: Straight
+.RE
+.PP
+\fB\-intercolour\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-interticks\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-gapsize\fR \fIinteger\fR
+.RS 4
+Default value: 500
+.RE
+.PP
+\fB\-ticklines\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-textheight\fR \fIfloat\fR
+.RS 4
+Height of text. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-textlength\fR \fIfloat\fR
+.RS 4
+Length of text. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-margin\fR \fIfloat\fR
+.RS 4
+Width of left margin. This is the region left to the groups where the names of the groups are displayed. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-tickheight\fR \fIfloat\fR
+.RS 4
+Height of ticks. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-blockheight\fR \fIfloat\fR
+.RS 4
+Height of blocks. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1
+.RE
+.PP
+\fB\-rangeheight\fR \fIfloat\fR
+.RS 4
+Height of range ends. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-gapgroup\fR \fIfloat\fR
+.RS 4
+Space between groups. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-postext\fR \fIfloat\fR
+.RS 4
+Space between text and ticks, blocks, and ranges. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively Default value: 1.0
+.RE
+.PP
+\fB\-graphout\fR \fIgraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+lindna is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/listor.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/listor.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/listor.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,65 @@
+.\"     Title: LISTOR
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "LISTOR" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+listor \- Write a list file of the logical OR of two sets of sequences
+.SH "SYNOPSIS"
+.HP 7
+\fBlistor\fR \fB\-firstsequences\ \fR\fB\fIseqset\fR\fR \fB\-secondsequences\ \fR\fB\fIseqset\fR\fR [\fB\-operator\ \fR\fB\fIlist\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 7
+\fBlistor\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBlistor\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-firstsequences\fR \fIseqset\fR
+.RS 4
+.RE
+.PP
+\fB\-secondsequences\fR \fIseqset\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-operator\fR \fIlist\fR
+.RS 4
+The following logical operators combine the sequences in the following ways: OR \- gives all that occur in one set or the other AND \- gives only those which occur in both sets XOR \- gives those which only occur in one set or the other, but not in both NOT \- gives those which occur in the first set except for those that also occur in the second Default value: OR
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+The list of sequence names will be written to this list file
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+listor is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/makenucseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/makenucseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/makenucseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,81 @@
+.\"     Title: MAKENUCSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "MAKENUCSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+makenucseq \- Creates random nucleotide sequences
+.SH "SYNOPSIS"
+.HP 11
+\fBmakenucseq\fR \fB\-codonfile\ \fR\fB\fIcodon\fR\fR \fB\-amount\ \fR\fB\fIinteger\fR\fR \fB\-length\ \fR\fB\fIinteger\fR\fR [\fB\-useinsert\ \fR\fB\fItoggle\fR\fR] \fB\-insert\ \fR\fB\fIstring\fR\fR \fB\-start\ \fR\fB\fIinteger\fR\fR \fB\-makeseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 11
+\fBmakenucseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmakenucseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-codonfile\fR \fIcodon\fR
+.RS 4
+Optional codon usage file. Nucleotide sequences will be created as triplets matching the frequencies in the file, with the end trimmed to be in the correct reading frame.
+.RE
+.SS "Required section"
+.PP
+\fB\-amount\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.PP
+\fB\-length\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.PP
+\fB\-useinsert\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-insert\fR \fIstring\fR
+.RS 4
+String that is inserted into sequence
+.RE
+.PP
+\fB\-start\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.SS "Output section"
+.PP
+\fB\-makeseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+makenucseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/makeprotseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/makeprotseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/makeprotseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,81 @@
+.\"     Title: MAKEPROTSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "MAKEPROTSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+makeprotseq \- Creates random protein sequences
+.SH "SYNOPSIS"
+.HP 12
+\fBmakeprotseq\fR \fB\-pepstatsfile\ \fR\fB\fIinfile\fR\fR \fB\-amount\ \fR\fB\fIinteger\fR\fR \fB\-length\ \fR\fB\fIinteger\fR\fR [\fB\-useinsert\ \fR\fB\fItoggle\fR\fR] \fB\-insert\ \fR\fB\fIstring\fR\fR \fB\-start\ \fR\fB\fIinteger\fR\fR \fB\-makeseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 12
+\fBmakeprotseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmakeprotseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-pepstatsfile\fR \fIinfile\fR
+.RS 4
+This file should be a pepstats output file. Protein sequences will be created with the composition in the pepstats output file.
+.RE
+.SS "Required section"
+.PP
+\fB\-amount\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.PP
+\fB\-length\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.PP
+\fB\-useinsert\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-insert\fR \fIstring\fR
+.RS 4
+String that is inserted into sequence
+.RE
+.PP
+\fB\-start\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.SS "Output section"
+.PP
+\fB\-makeseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+makeprotseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/marscan.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/marscan.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/marscan.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,55 @@
+.\"     Title: MARSCAN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "MARSCAN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+marscan \- Finds MAR/SAR sites in nucleic sequences
+.SH "SYNOPSIS"
+.HP 8
+\fBmarscan\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 8
+\fBmarscan\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmarscan\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Gene finding,Nucleic:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+File for output of MAR/SAR recognition signature (MRS) regions. This contains details of the MRS in normal GFF format. The MRS consists of two recognition sites, one of 8 bp and one of 16 bp on either sense strand of the genomic DNA, within 200 bp of each other.
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+marscan is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/maskfeat.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/maskfeat.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/maskfeat.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,70 @@
+.\"     Title: MASKFEAT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "MASKFEAT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+maskfeat \- Mask off features of a sequence.
+.SH "SYNOPSIS"
+.HP 9
+\fBmaskfeat\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-type\ \fR\fB\fIstring\fR\fR] [\fB\-tolower\ \fR\fB\fItoggle\fR\fR] \fB\-maskchar\ \fR\fB\fIstring\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 9
+\fBmaskfeat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmaskfeat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit,Feature tables" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-type\fR \fIstring\fR
+.RS 4
+By default any feature in the feature table with a type starting 'repeat' is masked. You can set this to be any feature type you wish to mask. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to mask more than one type, separate their names with spaces or commas, eg: *UTR repeat* Default value: repeat*
+.RE
+.PP
+\fB\-tolower\fR \fItoggle\fR
+.RS 4
+The region can be 'masked' by converting the sequence characters to lower\-case, some non\-EMBOSS programs e.g. fasta can interpret this as a masked region. The sequence is unchanged apart from the case change. You might like to ensure that the whole sequence is in upper\-case before masking the specified regions to lower\-case by using the '\-supper' flag. Default value: N
+.RE
+.PP
+\fB\-maskchar\fR \fIstring\fR
+.RS 4
+Character to use when masking. Default is 'X' for protein sequences, 'N' for nucleic sequences. If the mask character is set to be the SPACE character or a null character, then the sequence is 'masked' by changing it to lower\-case, just as with the '\-lowercase' flag. Default value: @($(acdprotein)?X:N)
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+maskfeat is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/maskseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/maskseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/maskseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,71 @@
+.\"     Title: MASKSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "MASKSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+maskseq \- Mask off regions of a sequence.
+.SH "SYNOPSIS"
+.HP 8
+\fBmaskseq\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-regions\ \fR\fB\fIrange\fR\fR [\fB\-tolower\ \fR\fB\fItoggle\fR\fR] \fB\-maskchar\ \fR\fB\fIstring\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 8
+\fBmaskseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmaskseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-regions\fR \fIrange\fR
+.RS 4
+Regions to mask. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non\-digit, non\-alpha character. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99
+.RE
+.SS "Additional section"
+.PP
+\fB\-tolower\fR \fItoggle\fR
+.RS 4
+The region can be 'masked' by converting the sequence characters to lower\-case, some non\-EMBOSS programs e.g. fasta can interpret this as a masked region. The sequence is unchanged apart from the case change. You might like to ensure that the whole sequence is in upper\-case before masking the specified regions to lower\-case by using the '\-supper' flag. Default value: N
+.RE
+.PP
+\fB\-maskchar\fR \fIstring\fR
+.RS 4
+Character to use when masking. Default is 'X' for protein sequences, 'N' for nucleic sequences. If the mask character is set to be the SPACE character or a null character, then the sequence is 'masked' by changing it to lower\-case, just as with the '\-lowercase' flag. Default value: @($(acdprotein)?X:N)
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+maskseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/matcher.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/matcher.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/matcher.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,79 @@
+.\"     Title: MATCHER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "MATCHER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+matcher \- Finds the best local alignments between two sequences
+.SH "SYNOPSIS"
+.HP 8
+\fBmatcher\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR [\fB\-datafile\ \fR\fB\fImatrix\fR\fR] [\fB\-alternatives\ \fR\fB\fIinteger\fR\fR] [\fB\-gapopen\ \fR\fB\fIinteger\fR\fR] [\fB\-gapextend\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR
+.HP 8
+\fBmatcher\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmatcher\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Local" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fImatrix\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Additional section"
+.PP
+\fB\-alternatives\fR \fIinteger\fR
+.RS 4
+This sets the number of alternative matches output. By default only the highest scoring alignment is shown. A value of 2 gives you other reasonable alignments. In some cases, for example multidomain proteins of cDNA and genomic DNA comparisons, there may be other interesting and significant alignments. Default value: 1
+.RE
+.PP
+\fB\-gapopen\fR \fIinteger\fR
+.RS 4
+The gap penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value of 14 assumes you are using the EBLOSUM62 matrix for protein sequences, or a value of 16 and the EDNAFULL matrix for nucleotide sequences. Default value: @($(acdprotein)? 14 : 16)
+.RE
+.PP
+\fB\-gapextend\fR \fIinteger\fR
+.RS 4
+The gap length, or gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap penalty to zero (or very low) and using the gap extension penalty to control gap scoring. Default value: @($(acdprotein)? 4 : 4)
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIalign\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+matcher is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/megamerger.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/megamerger.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/megamerger.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,74 @@
+.\"     Title: MEGAMERGER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "MEGAMERGER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+megamerger \- Merge two large overlapping nucleic acid sequences
+.SH "SYNOPSIS"
+.HP 11
+\fBmegamerger\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR [\fB\-prefer\ \fR\fB\fIboolean\fR\fR] \fB\-outseq\ \fR\fB\fIseqout\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 11
+\fBmegamerger\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmegamerger\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Consensus" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-wordsize\fR \fIinteger\fR
+.RS 4
+Default value: 20
+.RE
+.SS "Additional section"
+.PP
+\fB\-prefer\fR \fIboolean\fR
+.RS 4
+When a mismatch between the two sequence is discovered, one or other of the two sequences must be used to create the merged sequence over this mismatch region. The default action is to create the merged sequence using the sequence where the mismatch is closest to that sequence's centre. If this option is used, then the first sequence (seqa) will always be used in preference to the other sequence when there is a mismatch. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+megamerger is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/merger.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/merger.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/merger.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,78 @@
+.\"     Title: MERGER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "MERGER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+merger \- Merge two overlapping sequences
+.SH "SYNOPSIS"
+.HP 7
+\fBmerger\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] [\fB\-gapopen\ \fR\fB\fIfloat\fR\fR] [\fB\-gapextend\ \fR\fB\fIfloat\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 7
+\fBmerger\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmerger\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Consensus" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fImatrixf\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Additional section"
+.PP
+\fB\-gapopen\fR \fIfloat\fR
+.RS 4
+Default value: @($(acdprotein)? 50.0 : 50.0 )
+.RE
+.PP
+\fB\-gapextend\fR \fIfloat\fR
+.RS 4
+Default value: @($(acdprotein)? 5.0 : 5.0)
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIalign\fR
+.RS 4
+.RE
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+merger is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/msbar.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/msbar.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/msbar.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,95 @@
+.\"     Title: MSBAR
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "MSBAR" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+msbar \- Mutate sequence beyond all recognition
+.SH "SYNOPSIS"
+.HP 6
+\fBmsbar\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-othersequence\ \fR\fB\fIseqall\fR\fR \fB\-count\ \fR\fB\fIinteger\fR\fR \fB\-point\ \fR\fB\fIlist\fR\fR \fB\-block\ \fR\fB\fIlist\fR\fR \fB\-codon\ \fR\fB\fIlist\fR\fR \fB\-inframe\ \fR\fB\fIboolean\fR\fR \fB\-minimum\ \fR\fB\fIinteger\fR\fR \fB\-maximum\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 6
+\fBmsbar\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmsbar\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Mutation,Protein:Mutation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-othersequence\fR \fIseqall\fR
+.RS 4
+If you require that the resulting mutated sequence should not match a set of other sequences, then you can specify that set of sequences here. For example, if you require that the mutated sequence should not be the same as the input sequence, enter the input sequence here. If you want the result to be different to previous results of this program, specify the previous result sequences here. The program will check that the result does not match the sequences specified here before writing it out. If a match is found, then the mutation is started again with a fresh copy of the input sequence. If, after 10 such retries, there is still a match to the set of sequence given here, then the matching mutated sequence is written with a warning message. Default value: asis:N
+.RE
+.SS "Required section"
+.PP
+\fB\-count\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-point\fR \fIlist\fR
+.RS 4
+.RE
+.PP
+\fB\-block\fR \fIlist\fR
+.RS 4
+.RE
+.PP
+\fB\-codon\fR \fIlist\fR
+.RS 4
+Types of codon mutations to perform. These are only done if the sequence is nucleic.
+.RE
+.SS "Additional section"
+.PP
+\fB\-inframe\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-minimum\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-maximum\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+msbar is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/mwcontam.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/mwcontam.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/mwcontam.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: MWCONTAM
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "MWCONTAM" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+mwcontam \- Shows molwts that match across a set of files
+.SH "SYNOPSIS"
+.HP 9
+\fBmwcontam\fR \fB\-files\ \fR\fB\fIfilelist\fR\fR \fB\-tolerance\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 9
+\fBmwcontam\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmwcontam\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-files\fR \fIfilelist\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-tolerance\fR \fIfloat\fR
+.RS 4
+Default value: 50.0
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+mwcontam is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/mwfilter.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/mwfilter.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/mwfilter.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,71 @@
+.\"     Title: MWFILTER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "MWFILTER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+mwfilter \- Filter noisy molwts from mass spec output
+.SH "SYNOPSIS"
+.HP 9
+\fBmwfilter\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-datafile\ \fR\fB\fIdatafile\fR\fR \fB\-tolerance\ \fR\fB\fIfloat\fR\fR [\fB\-showdel\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 9
+\fBmwfilter\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBmwfilter\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fIdatafile\fR
+.RS 4
+Default value: Emwfilter.dat
+.RE
+.SS "Required section"
+.PP
+\fB\-tolerance\fR \fIfloat\fR
+.RS 4
+Default value: 50.0
+.RE
+.SS "Additional section"
+.PP
+\fB\-showdel\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+mwfilter is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/needle.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/needle.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/needle.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,79 @@
+.\"     Title: NEEDLE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "NEEDLE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+needle \- Needleman\-Wunsch global alignment.
+.SH "SYNOPSIS"
+.HP 7
+\fBneedle\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIseqall\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR \fB\-brief\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR
+.HP 7
+\fBneedle\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBneedle\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Global" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fImatrixf\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Required section"
+.PP
+\fB\-gapopen\fR \fIfloat\fR
+.RS 4
+The gap open penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. Default value: @($(acdprotein)? 10.0 : 10.0 )
+.RE
+.PP
+\fB\-gapextend\fR \fIfloat\fR
+.RS 4
+The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. Default value: @($(acdprotein)? 0.5 : 0.5 )
+.RE
+.SS "Output section"
+.PP
+\fB\-brief\fR \fIboolean\fR
+.RS 4
+Brief identity and similarity Default value: Y
+.RE
+.PP
+\fB\-outfile\fR \fIalign\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+needle is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/newcoils.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/newcoils.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/newcoils.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,87 @@
+.\"     Title: NEWCOILS
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "NEWCOILS" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+newcoils \- Predicts coils protein secondary structure
+.SH "SYNOPSIS"
+.HP 9
+\fBnewcoils\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-datafile\ \fR\fB\fIdatafile\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-weighted\ \fR\fB\fIinteger\fR\fR \fB\-verb\ \fR\fB\fIinteger\fR\fR \fB\-mode\ \fR\fB\fIinteger\fR\fR \fB\-minseg\ \fR\fB\fIinteger\fR\fR \fB\-minp\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 9
+\fBnewcoils\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBnewcoils\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:2D Structure" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fIdatafile\fR
+.RS 4
+Default value: Enewcoils.mat
+.RE
+.SS "Required section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+Default value: 21
+.RE
+.PP
+\fB\-weighted\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-verb\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-mode\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-minseg\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-minp\fR \fIfloat\fR
+.RS 4
+Default value: 0.50
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+newcoils is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/newcpgreport.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/newcpgreport.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/newcpgreport.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,80 @@
+.\"     Title: NEWCPGREPORT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "NEWCPGREPORT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+newcpgreport \- Report CpG rich areas
+.SH "SYNOPSIS"
+.HP 13
+\fBnewcpgreport\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-shift\ \fR\fB\fIinteger\fR\fR \fB\-minlen\ \fR\fB\fIinteger\fR\fR \fB\-minoe\ \fR\fB\fIfloat\fR\fR \fB\-minpc\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 13
+\fBnewcpgreport\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBnewcpgreport\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:CpG Islands" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.PP
+\fB\-shift\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-minlen\fR \fIinteger\fR
+.RS 4
+Default value: 200
+.RE
+.PP
+\fB\-minoe\fR \fIfloat\fR
+.RS 4
+Default value: 0.6
+.RE
+.PP
+\fB\-minpc\fR \fIfloat\fR
+.RS 4
+Default value: 50.
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+newcpgreport is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/newcpgseek.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/newcpgseek.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/newcpgseek.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: NEWCPGSEEK
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "NEWCPGSEEK" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+newcpgseek \- Reports CpG rich regions
+.SH "SYNOPSIS"
+.HP 11
+\fBnewcpgseek\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-score\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 11
+\fBnewcpgseek\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBnewcpgseek\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:CpG Islands" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-score\fR \fIinteger\fR
+.RS 4
+Default value: 17
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+newcpgseek is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/newseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/newseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/newseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,70 @@
+.\"     Title: NEWSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "NEWSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+newseq \- Type in a short new sequence.
+.SH "SYNOPSIS"
+.HP 7
+\fBnewseq\fR \fB\-name\ \fR\fB\fIstring\fR\fR \fB\-description\ \fR\fB\fIstring\fR\fR \fB\-type\ \fR\fB\fIlist\fR\fR \fB\-sequence\ \fR\fB\fIstring\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 7
+\fBnewseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBnewseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-name\fR \fIstring\fR
+.RS 4
+The name of of the sequence should be a single word that you will use to identify the sequence. It should have no (or few) punctuation characters in it.
+.RE
+.PP
+\fB\-description\fR \fIstring\fR
+.RS 4
+Enter any description of the sequence that you require.
+.RE
+.PP
+\fB\-type\fR \fIlist\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-sequence\fR \fIstring\fR
+.RS 4
+The sequence itself. Because of the limitation of the operating system, you will only be able to type in a short sequence of (typically) 250 characters, or so. The keyboard will beep at you when you have reached this limit and you will not be able to press the RETURN/ENTER key until you have deleted a few characters.
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+newseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/noreturn.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/noreturn.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/noreturn.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: NORETURN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "NORETURN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+noreturn \- Removes carriage return from ASCII files
+.SH "SYNOPSIS"
+.HP 9
+\fBnoreturn\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-system\ \fR\fB\fIlist\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 9
+\fBnoreturn\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBnoreturn\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-system\fR \fIlist\fR
+.RS 4
+Default value: unix
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+noreturn is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/notseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/notseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/notseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,65 @@
+.\"     Title: NOTSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "NOTSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+notseq \- Exclude a set of sequences and write out the remaining ones
+.SH "SYNOPSIS"
+.HP 7
+\fBnotseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR [\fB\-junkoutseq\ \fR\fB\fIseqoutall\fR\fR]
+.HP 7
+\fBnotseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBnotseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-exclude\fR \fIstring\fR
+.RS 4
+Enter a list of sequence names or accession numbers to exclude from the sequences read in. The excluded sequences will be written to the file specified in the 'junkout' parameter. The remainder will be written out to the file specified in the 'outseq' parameter. The list of sequence names can be separated by either spaces or commas. The sequence names can be wildcarded. The sequence names are case independent. An example of a list of sequences to be excluded is: myseq, hs*, one two three a file containing a list of sequence names can be specified by giving the file name preceeded by a '@', eg: '@names.dat'
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.PP
+\fB\-junkoutseq\fR \fIseqoutall\fR
+.RS 4
+This file collects the sequences which you have excluded from the main output file of sequences. Default value: /dev/null
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+notseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/nthseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/nthseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/nthseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: NTHSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "NTHSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+nthseq \- Writes one sequence from a multiple set of sequences
+.SH "SYNOPSIS"
+.HP 7
+\fBnthseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-number\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 7
+\fBnthseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBnthseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-number\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+nthseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/octanol.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/octanol.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/octanol.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,80 @@
+.\"     Title: OCTANOL
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "OCTANOL" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+octanol \- Displays protein hydropathy
+.SH "SYNOPSIS"
+.HP 8
+\fBoctanol\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-datafile\ \fR\fB\fIdatafile\fR\fR] [\fB\-width\ \fR\fB\fIinteger\fR\fR] \fB\-graph\ \fR\fB\fIxygraph\fR\fR [\fB\-octanolplot\ \fR\fB\fIboolean\fR\fR] [\fB\-interfaceplot\ \fR\fB\fIboolean\fR\fR] [\fB\-differenceplot\ \fR\fB\fIboolean\fR\fR]
+.HP 8
+\fBoctanol\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBoctanol\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fIdatafile\fR
+.RS 4
+Default value: Ewhite\-wimley.dat
+.RE
+.SS "Additional section"
+.PP
+\fB\-width\fR \fIinteger\fR
+.RS 4
+Default value: 19
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-octanolplot\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-interfaceplot\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-differenceplot\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+octanol is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/oddcomp.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/oddcomp.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/oddcomp.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,77 @@
+.\"     Title: ODDCOMP
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ODDCOMP" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+oddcomp \- Find protein sequence regions with a biased composition
+.SH "SYNOPSIS"
+.HP 8
+\fBoddcomp\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-fullwindow\ \fR\fB\fItoggle\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-ignorebz\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 8
+\fBoddcomp\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBoddcomp\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+This is a file in the format of the output produced by 'compseq' that is used to set the minimum frequencies of words in this analysis.
+.RE
+.SS "Required section"
+.PP
+\fB\-fullwindow\fR \fItoggle\fR
+.RS 4
+Set this option on (Y) if you want the window size to be set to the length of the current protein. Otherwise, leave this option unset, in which case you'll be prompted for a window size to use. Default value: N
+.RE
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+This is the size of window in which to count. Thus if you want to count frequencies in a 40 aa stretch you should enter 40 here. Default value: 30
+.RE
+.SS "Advanced section"
+.PP
+\fB\-ignorebz\fR \fIboolean\fR
+.RS 4
+The amino acid code B represents Asparagine or Aspartic acid and the code Z represents Glutamine or Glutamic acid. These are not commonly used codes and you may wish not to count words containing them, just noting them in the count of 'Other' words. Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+This is the results file.
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+oddcomp is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/origsplitter.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/origsplitter.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/origsplitter.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,70 @@
+.\"     Title: ORIGSPLITTER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ORIGSPLITTER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+origsplitter \- Split a sequence into (overlapping) smaller sequences
+.SH "SYNOPSIS"
+.HP 13
+\fBorigsplitter\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-size\ \fR\fB\fIinteger\fR\fR] [\fB\-overlap\ \fR\fB\fIinteger\fR\fR] \fB\-addoverlap\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 13
+\fBorigsplitter\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBorigsplitter\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-size\fR \fIinteger\fR
+.RS 4
+Default value: 10000
+.RE
+.PP
+\fB\-overlap\fR \fIinteger\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-addoverlap\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+origsplitter is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/origunion.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/origunion.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/origunion.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,54 @@
+.\"     Title: ORIGUNION
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "ORIGUNION" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+origunion \- Reads sequence fragments and builds one sequence
+.SH "SYNOPSIS"
+.HP 10
+\fBorigunion\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 10
+\fBorigunion\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBorigunion\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+origunion is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/palindrome.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/palindrome.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/palindrome.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,79 @@
+.\"     Title: PALINDROME
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PALINDROME" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+palindrome \- Looks for inverted repeats in a nucleotide sequence
+.SH "SYNOPSIS"
+.HP 11
+\fBpalindrome\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-minpallen\ \fR\fB\fIinteger\fR\fR \fB\-maxpallen\ \fR\fB\fIinteger\fR\fR \fB\-gaplimit\ \fR\fB\fIinteger\fR\fR \fB\-nummismatches\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-overlap\ \fR\fB\fIboolean\fR\fR
+.HP 11
+\fBpalindrome\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpalindrome\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Repeats" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-minpallen\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.PP
+\fB\-maxpallen\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.PP
+\fB\-gaplimit\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.PP
+\fB\-nummismatches\fR \fIinteger\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-overlap\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+palindrome is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/pasteseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/pasteseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/pasteseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,64 @@
+.\"     Title: PASTESEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PASTESEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+pasteseq \- Insert one sequence into another
+.SH "SYNOPSIS"
+.HP 9
+\fBpasteseq\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-pos\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 9
+\fBpasteseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpasteseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-pos\fR \fIinteger\fR
+.RS 4
+The position in the main input sequence to insert after. To insert before the start use the position 0. Default value: $(asequence.end)
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+pasteseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/patmatdb.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/patmatdb.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/patmatdb.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: PATMATDB
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PATMATDB" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+patmatdb \- Search a protein sequence with a motif
+.SH "SYNOPSIS"
+.HP 9
+\fBpatmatdb\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-motif\ \fR\fB\fIstring\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 9
+\fBpatmatdb\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpatmatdb\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-motif\fR \fIstring\fR
+.RS 4
+Patterns for patmatdb are based on the format of pattern used in the PROSITE database. For example: '[DE](2)HS{P}X(2)PX(2,4)C' means two Asps or Glus in any order followed by His, Ser, any residue other then Pro, then two of any residue followed by Pro followed by two to four of any residue followed by Cys. The search is case\-independent, so 'AAA' matches 'aaa'.
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+patmatdb is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/patmatmotifs.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/patmatmotifs.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/patmatmotifs.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,65 @@
+.\"     Title: PATMATMOTIFS
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PATMATMOTIFS" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+patmatmotifs \- Search a PROSITE motif database with a protein sequence
+.SH "SYNOPSIS"
+.HP 13
+\fBpatmatmotifs\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-full\ \fR\fB\fIboolean\fR\fR] [\fB\-prune\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 13
+\fBpatmatmotifs\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpatmatmotifs\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-full\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-prune\fR \fIboolean\fR
+.RS 4
+Ignore simple patterns. If this is true then these simple post\-translational modification sites are not reported: myristyl, asn_glycosylation, camp_phospho_site, pkc_phospho_site, ck2_phospho_site, and tyr_phospho_site. Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+patmatmotifs is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/patmattest.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/patmattest.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/patmattest.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,59 @@
+.\"     Title: PATMATTEST
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PATMATTEST" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+patmattest \- Test of pattern matching
+.SH "SYNOPSIS"
+.HP 11
+\fBpatmattest\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-expression\ \fR\fB\fIstring\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 11
+\fBpatmattest\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpatmattest\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-expression\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+patmattest is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/pepcoil.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/pepcoil.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/pepcoil.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,75 @@
+.\"     Title: PEPCOIL
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PEPCOIL" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+pepcoil \- Predicts coiled coil regions
+.SH "SYNOPSIS"
+.HP 8
+\fBpepcoil\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-coil\ \fR\fB\fIboolean\fR\fR \fB\-frame\ \fR\fB\fIboolean\fR\fR \fB\-other\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 8
+\fBpepcoil\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpepcoil\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:2D Structure,Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+Default value: 28
+.RE
+.SS "Output section"
+.PP
+\fB\-coil\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-frame\fR \fIboolean\fR
+.RS 4
+Default value: $(coil)
+.RE
+.PP
+\fB\-other\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+pepcoil is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/pepinfo.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/pepinfo.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/pepinfo.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,84 @@
+.\"     Title: PEPINFO
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PEPINFO" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+pepinfo \- Plots simple amino acid properties in parallel
+.SH "SYNOPSIS"
+.HP 8
+\fBpepinfo\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-aaproperties\ \fR\fB\fIdatafile\fR\fR] [\fB\-aahydropathy\ \fR\fB\fIdatafile\fR\fR] [\fB\-hwindow\ \fR\fB\fIinteger\fR\fR] \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-generalplot\ \fR\fB\fIboolean\fR\fR \fB\-hydropathyplot\ \fR\fB\fIboolean\fR\fR
+.HP 8
+\fBpepinfo\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpepinfo\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-aaproperties\fR \fIdatafile\fR
+.RS 4
+Default value: Eaa_properties.dat
+.RE
+.PP
+\fB\-aahydropathy\fR \fIdatafile\fR
+.RS 4
+Default value: Eaa_hydropathy.dat
+.RE
+.SS "Additional section"
+.PP
+\fB\-hwindow\fR \fIinteger\fR
+.RS 4
+Default value: 9
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-generalplot\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-hydropathyplot\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+pepinfo is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/pepnet.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/pepnet.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/pepnet.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,74 @@
+.\"     Title: PEPNET
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PEPNET" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+pepnet \- Displays proteins as a helical net
+.SH "SYNOPSIS"
+.HP 7
+\fBpepnet\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-amphipathic\ \fR\fB\fItoggle\fR\fR \fB\-squares\ \fR\fB\fIstring\fR\fR \fB\-diamonds\ \fR\fB\fIstring\fR\fR \fB\-octags\ \fR\fB\fIstring\fR\fR \fB\-graph\ \fR\fB\fIgraph\fR\fR
+.HP 7
+\fBpepnet\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpepnet\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display,Protein:2D Structure" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-amphipathic\fR \fItoggle\fR
+.RS 4
+If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked. This overrides any other markup that you may have specified using the qualifiers '\-squares', '\-diamonds' and '\-octags'.
+.RE
+.PP
+\fB\-squares\fR \fIstring\fR
+.RS 4
+By default the aliphatic residues ILVM are marked with squares. Default value: ILVM
+.RE
+.PP
+\fB\-diamonds\fR \fIstring\fR
+.RS 4
+By default the residues DENQST are marked with diamonds. Default value: DENQST
+.RE
+.PP
+\fB\-octags\fR \fIstring\fR
+.RS 4
+By default the positively charged residues HKR are marked with octagons. Default value: HKR
+.RE
+.PP
+\fB\-graph\fR \fIgraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+pepnet is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/pepstats.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/pepstats.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/pepstats.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,65 @@
+.\"     Title: PEPSTATS
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PEPSTATS" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+pepstats \- Protein statistics
+.SH "SYNOPSIS"
+.HP 9
+\fBpepstats\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-aadata\ \fR\fB\fIdatafile\fR\fR \fB\-termini\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 9
+\fBpepstats\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpepstats\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-aadata\fR \fIdatafile\fR
+.RS 4
+Molecular weight data for amino acids Default value: Eamino.dat
+.RE
+.SS "Advanced section"
+.PP
+\fB\-termini\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+pepstats is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/pepwheel.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/pepwheel.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/pepwheel.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,90 @@
+.\"     Title: PEPWHEEL
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PEPWHEEL" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+pepwheel \- Shows protein sequences as helices
+.SH "SYNOPSIS"
+.HP 9
+\fBpepwheel\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-wheel\ \fR\fB\fIboolean\fR\fR [\fB\-steps\ \fR\fB\fIinteger\fR\fR] [\fB\-turns\ \fR\fB\fIinteger\fR\fR] \fB\-graph\ \fR\fB\fIgraph\fR\fR \fB\-amphipathic\ \fR\fB\fItoggle\fR\fR \fB\-squares\ \fR\fB\fIstring\fR\fR \fB\-diamonds\ \fR\fB\fIstring\fR\fR \fB\-octags\ \fR\fB\fIstring\fR\fR
+.HP 9
+\fBpepwheel\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpepwheel\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display,Protein:2D Structure" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-wheel\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-steps\fR \fIinteger\fR
+.RS 4
+The number of residues plotted per turn is this value divided by the 'turns' value. Default value: 18
+.RE
+.PP
+\fB\-turns\fR \fIinteger\fR
+.RS 4
+The number of residues plotted per turn is the 'steps' value divided by this value. Default value: 5
+.RE
+.PP
+\fB\-graph\fR \fIgraph\fR
+.RS 4
+.RE
+.SS "Markup section"
+.PP
+\fB\-amphipathic\fR \fItoggle\fR
+.RS 4
+If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked. This overrides any other markup that you may have specified using the qualifiers '\-squares', '\-diamonds' and '\-octags'.
+.RE
+.PP
+\fB\-squares\fR \fIstring\fR
+.RS 4
+By default the aliphatic residues ILVM are marked with squares. Default value: ILVM
+.RE
+.PP
+\fB\-diamonds\fR \fIstring\fR
+.RS 4
+By default the residues DENQST are marked with diamonds. Default value: DENQST
+.RE
+.PP
+\fB\-octags\fR \fIstring\fR
+.RS 4
+By default the positively charged residues HKR are marked with octagons. Default value: HKR
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+pepwheel is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/pepwindow.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/pepwindow.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/pepwindow.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,65 @@
+.\"     Title: PEPWINDOW
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PEPWINDOW" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+pepwindow \- Displays protein hydropathy
+.SH "SYNOPSIS"
+.HP 10
+\fBpepwindow\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-datafile\ \fR\fB\fIdatafile\fR\fR] [\fB\-length\ \fR\fB\fIinteger\fR\fR] \fB\-graph\ \fR\fB\fIxygraph\fR\fR
+.HP 10
+\fBpepwindow\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpepwindow\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fIdatafile\fR
+.RS 4
+Default value: Enakai.dat
+.RE
+.SS "Additional section"
+.PP
+\fB\-length\fR \fIinteger\fR
+.RS 4
+Default value: 7
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+pepwindow is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/pepwindowall.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/pepwindowall.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/pepwindowall.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,66 @@
+.\"     Title: PEPWINDOWALL
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PEPWINDOWALL" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+pepwindowall \- Displays protein hydropathy of a set of sequences
+.SH "SYNOPSIS"
+.HP 13
+\fBpepwindowall\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR [\fB\-datafile\ \fR\fB\fIdatafile\fR\fR] [\fB\-length\ \fR\fB\fIinteger\fR\fR] \fB\-graph\ \fR\fB\fIxygraph\fR\fR
+.HP 13
+\fBpepwindowall\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpepwindowall\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequences\fR \fIseqset\fR
+.RS 4
+File containing a sequence alignment
+.RE
+.PP
+\fB\-datafile\fR \fIdatafile\fR
+.RS 4
+Default value: Enakai.dat
+.RE
+.SS "Additional section"
+.PP
+\fB\-length\fR \fIinteger\fR
+.RS 4
+Default value: 7
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+pepwindowall is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/plotcon.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/plotcon.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/plotcon.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,66 @@
+.\"     Title: PLOTCON
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PLOTCON" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+plotcon \- Plot quality of conservation of a sequence alignment
+.SH "SYNOPSIS"
+.HP 8
+\fBplotcon\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR [\fB\-scorefile\ \fR\fB\fImatrix\fR\fR] \fB\-winsize\ \fR\fB\fIinteger\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR
+.HP 8
+\fBplotcon\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBplotcon\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Multiple" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequences\fR \fIseqset\fR
+.RS 4
+File containing a sequence alignment
+.RE
+.PP
+\fB\-scorefile\fR \fImatrix\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Required section"
+.PP
+\fB\-winsize\fR \fIinteger\fR
+.RS 4
+Number of columns to average alignment quality over. The larger this value is, the smoother the plot will be. Default value: 4
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+plotcon is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/plotorf.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/plotorf.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/plotorf.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,65 @@
+.\"     Title: PLOTORF
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PLOTORF" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+plotorf \- Plot potential open reading frames
+.SH "SYNOPSIS"
+.HP 8
+\fBplotorf\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-start\ \fR\fB\fIstring\fR\fR \fB\-stop\ \fR\fB\fIstring\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR
+.HP 8
+\fBplotorf\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBplotorf\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Gene finding,Nucleic:Translation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-start\fR \fIstring\fR
+.RS 4
+Default value: ATG
+.RE
+.PP
+\fB\-stop\fR \fIstring\fR
+.RS 4
+Default value: TAA,TAG,TGA
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+plotorf is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/polydot.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/polydot.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/polydot.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,80 @@
+.\"     Title: POLYDOT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "POLYDOT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+polydot \- Displays all\-against\-all dotplots of a set of sequences
+.SH "SYNOPSIS"
+.HP 8
+\fBpolydot\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR \fB\-gap\ \fR\fB\fIinteger\fR\fR [\fB\-boxit\ \fR\fB\fIboolean\fR\fR] [\fB\-dumpfeat\ \fR\fB\fItoggle\fR\fR] \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR \fB\-graph\ \fR\fB\fIgraph\fR\fR
+.HP 8
+\fBpolydot\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpolydot\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Dot plots" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequences\fR \fIseqset\fR
+.RS 4
+File containing a sequence alignment
+.RE
+.SS "Required section"
+.PP
+\fB\-wordsize\fR \fIinteger\fR
+.RS 4
+Default value: 6
+.RE
+.SS "Output section"
+.PP
+\fB\-gap\fR \fIinteger\fR
+.RS 4
+This specifies the size of the gap that is used to separate the individual dotplots in the display. The size is measured in residues, as displayed in the output. Default value: 10
+.RE
+.PP
+\fB\-boxit\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-dumpfeat\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-outfeat\fR \fIfeatout\fR
+.RS 4
+.RE
+.PP
+\fB\-graph\fR \fIgraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+polydot is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/preg.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/preg.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/preg.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,58 @@
+.\"     Title: PREG
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PREG" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+preg \- Regular expression search of a protein sequence
+.SH "SYNOPSIS"
+.HP 5
+\fBpreg\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-pattern\ \fR\fB\fIregexp\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 5
+\fBpreg\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpreg\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-pattern\fR \fIregexp\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+preg is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/prettyplot.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/prettyplot.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/prettyplot.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,175 @@
+.\"     Title: PRETTYPLOT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PRETTYPLOT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+prettyplot \- Displays aligned sequences, with colouring and boxing
+.SH "SYNOPSIS"
+.HP 11
+\fBprettyplot\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR [\fB\-matrixfile\ \fR\fB\fImatrix\fR\fR] [\fB\-residuesperline\ \fR\fB\fIinteger\fR\fR] [\fB\-resbreak\ \fR\fB\fIinteger\fR\fR] [\fB\-ccolours\ \fR\fB\fIboolean\fR\fR] [\fB\-cidentity\ \fR\fB\fIstring\fR\fR] [\fB\-csimilarity\ \fR\fB\fIstring\fR\fR] [\fB\-cother\ \fR\fB\fIstring\fR\fR] [\fB\-docolour\ \fR\fB\fIboolean\fR\fR] [\fB\-shade\ \fR\fB\fIstring\fR\fR] [\fB\-pair\ \fR\fB\fIarray\fR\fR] [\fB\-identity\ \fR\fB\fIinteger\fR\fR] [\fB\-box\ \fR\fB\fIboolean\fR\fR] [\fB\-boxcol\ \fR\fB\fIboolean\fR\fR] [\fB\-boxcolval\ \fR\fB\fIstring\fR\fR] [\fB\-name\ \fR\fB\fIboolean\fR\fR] [\fB\-maxnamelen\ \fR\fB\fIinteger\fR\fR] [\fB\-number\ \fR\fB\fIboolean\fR\fR] [\fB\-listoptions\ \fR\fB\fIboolean\fR\fR] [\fB\-plurality\ \fR\fB\fIfloat\fR\fR] [\fB\-consensus\ \fR\fB\fIboolean\fR\fR] [\fB\-collision\ \fR\fB\fIboolean\fR\fR] [\fB\-alternative\ \fR\fB\fIlist\fR\fR] [\fB\-showscore\ \fR\fB\fIinteger\fR\fR] [\fB\-portrait\ \fR\fB\fIboolean\fR\fR] \fB\-graph\ \fR\fB\fIgraph\fR\fR
+.HP 11
+\fBprettyplot\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBprettyplot\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Multiple,Display" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequences\fR \fIseqset\fR
+.RS 4
+.RE
+.PP
+\fB\-matrixfile\fR \fImatrix\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Additional section"
+.PP
+\fB\-residuesperline\fR \fIinteger\fR
+.RS 4
+The number of residues to be displayed on each line Default value: 50
+.RE
+.PP
+\fB\-resbreak\fR \fIinteger\fR
+.RS 4
+Default value: $(residuesperline)
+.RE
+.PP
+\fB\-ccolours\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-cidentity\fR \fIstring\fR
+.RS 4
+Default value: RED
+.RE
+.PP
+\fB\-csimilarity\fR \fIstring\fR
+.RS 4
+Default value: GREEN
+.RE
+.PP
+\fB\-cother\fR \fIstring\fR
+.RS 4
+Default value: BLACK
+.RE
+.PP
+\fB\-docolour\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-shade\fR \fIstring\fR
+.RS 4
+Set to BPLW for normal shading (black, pale, light, white) so for pair = 1.5,1.0,0.5 and shade = BPLW Residues score Colour 1.5 or over... BLACK (B) 1.0 to 1.5 ... BROWN (P) 0.5 to 1.0 ... WHEAT (L) under 0.5 .... WHITE (W) The only four letters allowed are BPLW, in any order.
+.RE
+.PP
+\fB\-pair\fR \fIarray\fR
+.RS 4
+Default value: 1.5,1.0,0.5
+.RE
+.PP
+\fB\-identity\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-box\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-boxcol\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-boxcolval\fR \fIstring\fR
+.RS 4
+Default value: GREY
+.RE
+.PP
+\fB\-name\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-maxnamelen\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.PP
+\fB\-number\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-listoptions\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-plurality\fR \fIfloat\fR
+.RS 4
+Default value: @( $(sequences.totweight) / 2)
+.RE
+.SS "Consensus section"
+.PP
+\fB\-consensus\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-collision\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-alternative\fR \fIlist\fR
+.RS 4
+Values are 0:Normal collision check. (default) 1:Compares identical scores with the max score found. So if any other residue matches the identical score then a collision has occurred. 2:If another residue has a greater than or equal to matching score and these do not match then a collision has occurred. 3:Checks all those not in the current consensus.If any of these give a top score for matching or identical scores then a collision has occured.
+.RE
+.PP
+\fB\-showscore\fR \fIinteger\fR
+.RS 4
+Default value: \-1
+.RE
+.PP
+\fB\-portrait\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIgraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+prettyplot is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/prettyseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/prettyseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/prettyseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,86 @@
+.\"     Title: PRETTYSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PRETTYSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+prettyseq \- Output sequence with translated ranges
+.SH "SYNOPSIS"
+.HP 10
+\fBprettyseq\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-range\ \fR\fB\fIrange\fR\fR [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-ruler\ \fR\fB\fIboolean\fR\fR] [\fB\-plabel\ \fR\fB\fIboolean\fR\fR] [\fB\-nlabel\ \fR\fB\fIboolean\fR\fR] \fB\-width\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 10
+\fBprettyseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBprettyseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display,Nucleic:Translation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-range\fR \fIrange\fR
+.RS 4
+Default value: $(sequence.begin)\-$(sequence.end)
+.RE
+.SS "Additional section"
+.PP
+\fB\-table\fR \fIlist\fR
+.RS 4
+.RE
+.PP
+\fB\-ruler\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-plabel\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-nlabel\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Advanced section"
+.PP
+\fB\-width\fR \fIinteger\fR
+.RS 4
+Default value: 60
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+prettyseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/prima.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/prima.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/prima.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,150 @@
+.\"     Title: PRIMA
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PRIMA" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+prima \- Selects primers for PCR and DNA amplification.
+.SH "SYNOPSIS"
+.HP 6
+\fBprima\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-targetrange\ \fR\fB\fItoggle\fR\fR \fB\-targetstart\ \fR\fB\fIinteger\fR\fR \fB\-targetend\ \fR\fB\fIinteger\fR\fR \fB\-minprimertm\ \fR\fB\fIfloat\fR\fR \fB\-maxprimertm\ \fR\fB\fIfloat\fR\fR \fB\-minprodlen\ \fR\fB\fIinteger\fR\fR \fB\-maxprodlen\ \fR\fB\fIinteger\fR\fR \fB\-minprodgccont\ \fR\fB\fIfloat\fR\fR \fB\-maxprodgccont\ \fR\fB\fIfloat\fR\fR [\fB\-primer\ \fR\fB\fItoggle\fR\fR] \fB\-minprimerlen\ \fR\fB\fIinteger\fR\fR \fB\-maxprimerlen\ \fR\fB\fIinteger\fR\fR \fB\-minpmgccont\ \fR\fB\fIfloat\fR\fR \fB\-maxpmgccont\ \fR\fB\fIfloat\fR\fR \fB\-overlap\ \fR\fB\fIinteger\fR\fR \fB\-saltconc\ \fR\fB\fIfloat\fR\fR \fB\-dnaconc\ \fR\fB\fIfloat\fR\fR \fB\-list\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 6
+\fBprima\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBprima\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Primers" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Target options"
+.PP
+\fB\-targetrange\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-targetstart\fR \fIinteger\fR
+.RS 4
+Default value: $(sequence.begin)
+.RE
+.PP
+\fB\-targetend\fR \fIinteger\fR
+.RS 4
+Default value: $(sequence.length)
+.RE
+.PP
+\fB\-minprimertm\fR \fIfloat\fR
+.RS 4
+Default value: 53
+.RE
+.PP
+\fB\-maxprimertm\fR \fIfloat\fR
+.RS 4
+Default value: 58
+.RE
+.SS "Additional section"
+.SS "Product options"
+.PP
+\fB\-minprodlen\fR \fIinteger\fR
+.RS 4
+Default value: 100
+.RE
+.PP
+\fB\-maxprodlen\fR \fIinteger\fR
+.RS 4
+Default value: 300
+.RE
+.PP
+\fB\-minprodgccont\fR \fIfloat\fR
+.RS 4
+Default value: .40
+.RE
+.PP
+\fB\-maxprodgccont\fR \fIfloat\fR
+.RS 4
+Default value: .55
+.RE
+.SS "Primer options"
+.PP
+\fB\-primer\fR \fItoggle\fR
+.RS 4
+Specify primer properties Default value: Y
+.RE
+.PP
+\fB\-minprimerlen\fR \fIinteger\fR
+.RS 4
+Default value: 18
+.RE
+.PP
+\fB\-maxprimerlen\fR \fIinteger\fR
+.RS 4
+Default value: 22
+.RE
+.PP
+\fB\-minpmgccont\fR \fIfloat\fR
+.RS 4
+Default value: .40
+.RE
+.PP
+\fB\-maxpmgccont\fR \fIfloat\fR
+.RS 4
+Default value: .55
+.RE
+.SS "Advanced section"
+.PP
+\fB\-overlap\fR \fIinteger\fR
+.RS 4
+Default value: 50
+.RE
+.PP
+\fB\-saltconc\fR \fIfloat\fR
+.RS 4
+Default value: 50
+.RE
+.PP
+\fB\-dnaconc\fR \fIfloat\fR
+.RS 4
+Default value: 50
+.RE
+.PP
+\fB\-list\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+prima is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/primers.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/primers.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/primers.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,86 @@
+.\"     Title: PRIMERS
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PRIMERS" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+primers \- Simple version of primer3 to pick PCR primers
+.SH "SYNOPSIS"
+.HP 8
+\fBprimers\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-target\ \fR\fB\fIrange\fR\fR] [\fB\-minsize\ \fR\fB\fIinteger\fR\fR] [\fB\-maxsize\ \fR\fB\fIinteger\fR\fR] [\fB\-maxdifftm\ \fR\fB\fIfloat\fR\fR] [\fB\-explainflag\ \fR\fB\fIboolean\fR\fR] [\fB\-numreturn\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 8
+\fBprimers\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBprimers\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Primers" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+The sequence from which to choose primers. The sequence must be presented 5' \-> 3'
+.RE
+.SS "Additional section"
+.PP
+\fB\-target\fR \fIrange\fR
+.RS 4
+If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single\-base\-pair polymorphism. The value should be a space\-separated list of <start>,<end> pairs where <start> is the index of the first base of a Target, and <end> is the last E.g. 50,51 requires primers to surround the 2 bases at positions 50 and 51.
+.RE
+.PP
+\fB\-minsize\fR \fIinteger\fR
+.RS 4
+Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX\-SIZE. Default value: 18
+.RE
+.PP
+\fB\-maxsize\fR \fIinteger\fR
+.RS 4
+Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which Primer3's melting\-temperature is valid. Default value: 27
+.RE
+.PP
+\fB\-maxdifftm\fR \fIfloat\fR
+.RS 4
+Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers. Default value: 100.0
+.RE
+.SS "Output section"
+.PP
+\fB\-explainflag\fR \fIboolean\fR
+.RS 4
+If this flag is non\-0, produce LEFT\-EXPLAIN and RIGHT\-EXPLAIN, output, which are intended to provide information on the number of primer pairs that Primer3 examined, and statistics on the number discarded for various reasons. Default value: N
+.RE
+.PP
+\fB\-numreturn\fR \fIinteger\fR
+.RS 4
+The maximum number of primer pairs to return. Primer pairs returned are sorted by their 'quality', in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time. Default value: 5
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+primers is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/primersearch.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/primersearch.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/primersearch.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,63 @@
+.\"     Title: PRIMERSEARCH
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PRIMERSEARCH" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+primersearch \- Searches DNA sequences for matches with primer pairs
+.SH "SYNOPSIS"
+.HP 13
+\fBprimersearch\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-mismatchpercent\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 13
+\fBprimersearch\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBprimersearch\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Primers" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-seqall\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-mismatchpercent\fR \fIinteger\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+primersearch is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/printsextract.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/printsextract.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/printsextract.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,49 @@
+.\"     Title: PRINTSEXTRACT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PRINTSEXTRACT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+printsextract \- Extract data from PRINTS
+.SH "SYNOPSIS"
+.HP 14
+\fBprintsextract\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR
+.HP 14
+\fBprintsextract\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBprintsextract\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database creation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+printsextract is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/profit.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/profit.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/profit.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,58 @@
+.\"     Title: PROFIT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PROFIT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+profit \- Scan a sequence or database with a matrix or profile
+.SH "SYNOPSIS"
+.HP 7
+\fBprofit\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 7
+\fBprofit\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBprofit\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Profiles,Protein:Profiles" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+profit is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/prophecy.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/prophecy.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/prophecy.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,87 @@
+.\"     Title: PROPHECY
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PROPHECY" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+prophecy \- Creates matrices/profiles from multiple alignments
+.SH "SYNOPSIS"
+.HP 9
+\fBprophecy\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR \fB\-type\ \fR\fB\fIlist\fR\fR \fB\-datafile\ \fR\fB\fImatrixf\fR\fR \fB\-name\ \fR\fB\fIstring\fR\fR \fB\-threshold\ \fR\fB\fIinteger\fR\fR \fB\-open\ \fR\fB\fIfloat\fR\fR \fB\-extension\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 9
+\fBprophecy\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBprophecy\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Profiles,Protein:Profiles" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqset\fR
+.RS 4
+.RE
+.PP
+\fB\-type\fR \fIlist\fR
+.RS 4
+Default value: F
+.RE
+.PP
+\fB\-datafile\fR \fImatrixf\fR
+.RS 4
+Default value: @($(type) = G: Epprofile H: EBLOSUM62 F: EBLOSUM62)
+.RE
+.SS "Required section"
+.PP
+\fB\-name\fR \fIstring\fR
+.RS 4
+Default value: mymatrix
+.RE
+.SS "Profile type specific options"
+.PP
+\fB\-threshold\fR \fIinteger\fR
+.RS 4
+Default value: 75
+.RE
+.SS "Gap options"
+.PP
+\fB\-open\fR \fIfloat\fR
+.RS 4
+Default value: 3.0
+.RE
+.PP
+\fB\-extension\fR \fIfloat\fR
+.RS 4
+Default value: 0.3
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+prophecy is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/prophet.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/prophet.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/prophet.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,69 @@
+.\"     Title: PROPHET
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PROPHET" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+prophet \- Gapped alignment for profiles
+.SH "SYNOPSIS"
+.HP 8
+\fBprophet\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR
+.HP 8
+\fBprophet\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBprophet\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Profiles,Protein:Profiles" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-gapopen\fR \fIfloat\fR
+.RS 4
+Default value: 1.0
+.RE
+.PP
+\fB\-gapextend\fR \fIfloat\fR
+.RS 4
+Default value: 1.0
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIalign\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+prophet is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/prosextract.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/prosextract.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/prosextract.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,49 @@
+.\"     Title: PROSEXTRACT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PROSEXTRACT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+prosextract \- Build the PROSITE motif database for use by patmatmotifs
+.SH "SYNOPSIS"
+.HP 12
+\fBprosextract\fR \fB\-prositedir\ \fR\fB\fIdirectory\fR\fR
+.HP 12
+\fBprosextract\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBprosextract\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database creation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-prositedir\fR \fIdirectory\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+prosextract is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/pscan.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/pscan.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/pscan.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,65 @@
+.\"     Title: PSCAN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PSCAN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+pscan \- Scans proteins using PRINTS
+.SH "SYNOPSIS"
+.HP 6
+\fBpscan\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-emin\ \fR\fB\fIinteger\fR\fR \fB\-emax\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 6
+\fBpscan\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpscan\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-emin\fR \fIinteger\fR
+.RS 4
+Default value: 2
+.RE
+.PP
+\fB\-emax\fR \fIinteger\fR
+.RS 4
+Default value: 20
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+pscan is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/psiphi.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/psiphi.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/psiphi.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,71 @@
+.\"     Title: PSIPHI
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "PSIPHI" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+psiphi \- Phi and psi torsion angles from protein coordinates
+.SH "SYNOPSIS"
+.HP 7
+\fBpsiphi\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-chainnumber\ \fR\fB\fIinteger\fR\fR \fB\-startresiduenumber\ \fR\fB\fIinteger\fR\fR \fB\-finishresiduenumber\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 7
+\fBpsiphi\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpsiphi\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "protein:3D structure" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-chainnumber\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-startresiduenumber\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-finishresiduenumber\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+psiphi is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/rebaseextract.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/rebaseextract.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/rebaseextract.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,58 @@
+.\"     Title: REBASEEXTRACT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "REBASEEXTRACT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+rebaseextract \- Extract data from REBASE
+.SH "SYNOPSIS"
+.HP 14
+\fBrebaseextract\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-protofile\ \fR\fB\fIinfile\fR\fR [\fB\-equivalences\ \fR\fB\fIboolean\fR\fR]
+.HP 14
+\fBrebaseextract\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBrebaseextract\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database creation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.PP
+\fB\-protofile\fR \fIinfile\fR
+.RS 4
+.RE
+.PP
+\fB\-equivalences\fR \fIboolean\fR
+.RS 4
+This option calculates an embossre.equ file using restriction enzyme prototypes in the withrefm file. Default value: Y
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+rebaseextract is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/recoder.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/recoder.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/recoder.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,70 @@
+.\"     Title: RECODER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "RECODER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+recoder \- Remove restriction sites but maintain same translation
+.SH "SYNOPSIS"
+.HP 8
+\fBrecoder\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-enzymes\ \fR\fB\fIstring\fR\fR \fB\-sshow\ \fR\fB\fIboolean\fR\fR \fB\-tshow\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 8
+\fBrecoder\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBrecoder\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Restriction" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-enzymes\fR \fIstring\fR
+.RS 4
+Default value: all
+.RE
+.SS "Output section"
+.PP
+\fB\-sshow\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-tshow\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+recoder is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/redata.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/redata.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/redata.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,70 @@
+.\"     Title: REDATA
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "REDATA" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+redata \- Search REBASE for enzyme name, references, suppliers etc.
+.SH "SYNOPSIS"
+.HP 7
+\fBredata\fR \fB\-enzyme\ \fR\fB\fIstring\fR\fR \fB\-isoschizomers\ \fR\fB\fIboolean\fR\fR \fB\-references\ \fR\fB\fIboolean\fR\fR \fB\-suppliers\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 7
+\fBredata\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBredata\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Restriction" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-enzyme\fR \fIstring\fR
+.RS 4
+Enter the name of the restriction enzyme that you wish to get details of. The names often have a 'I' in them \- this is a capital 'i', not a '1' or an 'l'. The names are case\-independent ('AaeI' is the same as 'aaei') Default value: BamHI
+.RE
+.SS "Output section"
+.PP
+\fB\-isoschizomers\fR \fIboolean\fR
+.RS 4
+Show other enzymes with this specificity. (Isoschizomers) Default value: Y
+.RE
+.PP
+\fB\-references\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-suppliers\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+redata is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/remap.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/remap.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/remap.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,199 @@
+.\"     Title: REMAP
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "REMAP" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+remap \- Display sequence with restriction sites, translation etc.
+.SH "SYNOPSIS"
+.HP 6
+\fBremap\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-enzymes\ \fR\fB\fIstring\fR\fR \fB\-sitelen\ \fR\fB\fIinteger\fR\fR [\fB\-mincuts\ \fR\fB\fIinteger\fR\fR] [\fB\-maxcuts\ \fR\fB\fIinteger\fR\fR] [\fB\-single\ \fR\fB\fIboolean\fR\fR] [\fB\-blunt\ \fR\fB\fIboolean\fR\fR] [\fB\-sticky\ \fR\fB\fIboolean\fR\fR] [\fB\-ambiguity\ \fR\fB\fIboolean\fR\fR] [\fB\-plasmid\ \fR\fB\fIboolean\fR\fR] [\fB\-commercial\ \fR\fB\fIboolean\fR\fR] [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-frame\ \fR\fB\fIlist\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR [\fB\-cutlist\ \fR\fB\fIboolean\fR\fR] [\fB\-flatreformat\ \fR\fB\fIboolean\fR\fR] [\fB\-limit\ \fR\fB\fIboolean\fR\fR] \fB\-translation\ \fR\fB\fIboolean\fR\fR \fB\-reverse\ \fR\fB\fIboolean\fR\fR \fB\-orfminsize\ \fR\fB\fIinteger\fR\fR \fB\-uppercase\ \fR\fB\fIrange\fR\fR \fB\-highlight\ \fR\fB\fIrange\fR\fR \fB\-threeletter\ \fR\fB\fIboolean\fR\fR \fB\-number\ \fR\fB\fIboolean\fR\fR \fB\-width\ \fR\fB\fIinteger\fR\fR \fB\-length\ \fR\fB\fIinteger\fR\fR \fB\-margin\ \fR\fB\fIinteger\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR \fB\-offset\ \fR\fB\fIinteger\fR\fR \fB\-html\ \fR\fB\fIboolean\fR\fR
+.HP 6
+\fBremap\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBremap\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display,Nucleic:Restriction,Nucleic:Translation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-enzymes\fR \fIstring\fR
+.RS 4
+The name 'all' reads in all enzyme names from the REBASE database. You can specify enzymes by giving their names with commas between then, such as: 'HincII,hinfI,ppiI,hindiii'. The case of the names is not important. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a '@' character in front of it, for example, '@enz.list'. Blank lines and lines starting with a hash character or '!' are ignored and all other lines are concatenated together with a comma character ',' and then treated as the list of enzymes to search for. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all
+.RE
+.PP
+\fB\-sitelen\fR \fIinteger\fR
+.RS 4
+This sets the minimum length of the restriction enzyme recognition site. Any enzymes with sites shorter than this will be ignored. Default value: 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-mincuts\fR \fIinteger\fR
+.RS 4
+This sets the minimum number of cuts for any restriction enzyme that will be considered. Any enzymes that cut fewer times than this will be ignored. Default value: 1
+.RE
+.PP
+\fB\-maxcuts\fR \fIinteger\fR
+.RS 4
+This sets the maximum number of cuts for any restriction enzyme that will be considered. Any enzymes that cut more times than this will be ignored. Default value: 2000000000
+.RE
+.PP
+\fB\-single\fR \fIboolean\fR
+.RS 4
+If this is set then this forces the values of the mincuts and maxcuts qualifiers to both be 1. Any other value you may have set them to will be ignored. Default value: N
+.RE
+.PP
+\fB\-blunt\fR \fIboolean\fR
+.RS 4
+This allows those enzymes which cut at the same position on the forward and reverse strands to be considered. Default value: Y
+.RE
+.PP
+\fB\-sticky\fR \fIboolean\fR
+.RS 4
+This allows those enzymes which cut at different positions on the forward and reverse strands, leaving an overhang, to be considered. Default value: Y
+.RE
+.PP
+\fB\-ambiguity\fR \fIboolean\fR
+.RS 4
+This allows those enzymes which have one or more 'N' ambiguity codes in their pattern to be considered Default value: Y
+.RE
+.PP
+\fB\-plasmid\fR \fIboolean\fR
+.RS 4
+If this is set then this allows searches for restriction enzyme recognition site and cut postions that span the end of the sequence to be considered. Default value: N
+.RE
+.PP
+\fB\-commercial\fR \fIboolean\fR
+.RS 4
+If this is set, then only those enzymes with a commercial supplier will be searched for. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through 'all' the enzymes in the REBASE database. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier. Default value: Y
+.RE
+.PP
+\fB\-table\fR \fIlist\fR
+.RS 4
+.RE
+.PP
+\fB\-frame\fR \fIlist\fR
+.RS 4
+This allows you to specify the frames that are translated. If you are not displaying cut sites on the reverse sense, then the reverse sense translations will not be displayed even if you have requested frames 4, 5 or 6. By default, all six frames will be displayed. Default value: 6
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-cutlist\fR \fIboolean\fR
+.RS 4
+This produces lists in the output of the enzymes that cut, those that cut but are excluded because that cut fewer times than mincut or more times than maxcut and those enzymes that do not cut. Default value: Y
+.RE
+.PP
+\fB\-flatreformat\fR \fIboolean\fR
+.RS 4
+This changes the output format to one where the recognition site is indicated by a row of '===' characters and the cut site is pointed to by a '>' character in the forward sense, or a '<' in the reverse sense strand. Default value: N
+.RE
+.PP
+\fB\-limit\fR \fIboolean\fR
+.RS 4
+This limits the reporting of enzymes to just one enzyme from each group of isoschizomers. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file 'embossre.equ', which is created by the program 'rebaseextract'. If you prefer different prototypes to be used, make a copy of embossre.equ in your home directory and edit it. If this value is set to be false then all of the input enzymes will be reported. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching 'all' of them. Default value: Y
+.RE
+.PP
+\fB\-translation\fR \fIboolean\fR
+.RS 4
+This displays the 6\-frame translations of the sequence in the output. Default value: Y
+.RE
+.PP
+\fB\-reverse\fR \fIboolean\fR
+.RS 4
+This displays the cut sites and translation of the reverse sense. Default value: Y
+.RE
+.PP
+\fB\-orfminsize\fR \fIinteger\fR
+.RS 4
+This sets the minimum size of Open Reading Frames (ORFs) to display in the translations. All other translation regions are masked by changing the amino acids to '\-' characters.
+.RE
+.PP
+\fB\-uppercase\fR \fIrange\fR
+.RS 4
+Regions to put in uppercase. If this is left blank, then the sequence case is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non\-digit, non\-alpha character. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99
+.RE
+.PP
+\fB\-highlight\fR \fIrange\fR
+.RS 4
+Regions to colour if formatting for HTML. If this is left blank, then the sequence is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are followed by any valid HTML font colour. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specifed as '@filename'.
+.RE
+.PP
+\fB\-threeletter\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-number\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-width\fR \fIinteger\fR
+.RS 4
+Default value: 60
+.RE
+.PP
+\fB\-length\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-margin\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.PP
+\fB\-name\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the ID name of the sequence Default value: Y
+.RE
+.PP
+\fB\-description\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the description of the sequence Default value: Y
+.RE
+.PP
+\fB\-offset\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+remap is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/restover.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/restover.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/restover.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,129 @@
+.\"     Title: RESTOVER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "RESTOVER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+restover \- Find restriction enzymes producing specific overhang
+.SH "SYNOPSIS"
+.HP 9
+\fBrestover\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-datafile\ \fR\fB\fIdatafile\fR\fR \fB\-seqcomp\ \fR\fB\fIstring\fR\fR \fB\-min\ \fR\fB\fIinteger\fR\fR \fB\-max\ \fR\fB\fIinteger\fR\fR \fB\-single\ \fR\fB\fIboolean\fR\fR \fB\-threeprime\ \fR\fB\fIboolean\fR\fR \fB\-blunt\ \fR\fB\fIboolean\fR\fR \fB\-sticky\ \fR\fB\fIboolean\fR\fR \fB\-ambiguity\ \fR\fB\fIboolean\fR\fR \fB\-plasmid\ \fR\fB\fIboolean\fR\fR \fB\-commercial\ \fR\fB\fIboolean\fR\fR \fB\-html\ \fR\fB\fIboolean\fR\fR \fB\-limit\ \fR\fB\fIboolean\fR\fR \fB\-alphabetic\ \fR\fB\fIboolean\fR\fR \fB\-fragments\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 9
+\fBrestover\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBrestover\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Restriction" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fIdatafile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-seqcomp\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-min\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-max\fR \fIinteger\fR
+.RS 4
+Default value: 2000000000
+.RE
+.PP
+\fB\-single\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-threeprime\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-blunt\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-sticky\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-ambiguity\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-plasmid\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-commercial\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-limit\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-alphabetic\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-fragments\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+restover is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/restrict.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/restrict.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/restrict.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,135 @@
+.\"     Title: RESTRICT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "RESTRICT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+restrict \- Finds restriction enzyme cleavage sites
+.SH "SYNOPSIS"
+.HP 9
+\fBrestrict\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-datafile\ \fR\fB\fIdatafile\fR\fR \fB\-sitelen\ \fR\fB\fIinteger\fR\fR \fB\-enzymes\ \fR\fB\fIstring\fR\fR \fB\-min\ \fR\fB\fIinteger\fR\fR \fB\-max\ \fR\fB\fIinteger\fR\fR \fB\-solofragment\ \fR\fB\fIboolean\fR\fR \fB\-single\ \fR\fB\fIboolean\fR\fR \fB\-blunt\ \fR\fB\fIboolean\fR\fR \fB\-sticky\ \fR\fB\fIboolean\fR\fR \fB\-ambiguity\ \fR\fB\fIboolean\fR\fR \fB\-plasmid\ \fR\fB\fIboolean\fR\fR \fB\-commercial\ \fR\fB\fIboolean\fR\fR \fB\-limit\ \fR\fB\fIboolean\fR\fR \fB\-alphabetic\ \fR\fB\fIboolean\fR\fR \fB\-fragments\ \fR\fB\fIboolean\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 9
+\fBrestrict\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBrestrict\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Restriction" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fIdatafile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-sitelen\fR \fIinteger\fR
+.RS 4
+This sets the minimum length of the restriction enzyme recognition site. Any enzymes with sites shorter than this will be ignored. Default value: 4
+.RE
+.PP
+\fB\-enzymes\fR \fIstring\fR
+.RS 4
+The name 'all' reads in all enzyme names from the REBASE database. You can specify enzymes by giving their names with commas between then, such as: 'HincII,hinfI,ppiI,hindiii'. The case of the names is not important. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a '@' character in front of it, for example, '@enz.list'. Blank lines and lines starting with a hash character or '!' are ignored and all other lines are concatenated together with a comma character ',' and then treated as the list of enzymes to search for. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all
+.RE
+.SS "Advanced section"
+.PP
+\fB\-min\fR \fIinteger\fR
+.RS 4
+This sets the minimum number of cuts for any restriction enzyme that will be considered. Any enzymes that cut fewer times than this will be ignored. Default value: 1
+.RE
+.PP
+\fB\-max\fR \fIinteger\fR
+.RS 4
+This sets the maximum number of cuts for any restriction enzyme that will be considered. Any enzymes that cut more times than this will be ignored. Default value: 2000000000
+.RE
+.PP
+\fB\-solofragment\fR \fIboolean\fR
+.RS 4
+This gives the fragment lengths of the forward sense strand produced by complete restriction by each restriction enzyme on its own. Results are added to the tail section of the report. Default value: N
+.RE
+.PP
+\fB\-single\fR \fIboolean\fR
+.RS 4
+If this is set then this forces the values of the mincuts and maxcuts qualifiers to both be 1. Any other value you may have set them to will be ignored. Default value: N
+.RE
+.PP
+\fB\-blunt\fR \fIboolean\fR
+.RS 4
+This allows those enzymes which cut at the same position on the forward and reverse strands to be considered. Default value: Y
+.RE
+.PP
+\fB\-sticky\fR \fIboolean\fR
+.RS 4
+This allows those enzymes which cut at different positions on the forward and reverse strands, leaving an overhang, to be considered. Default value: Y
+.RE
+.PP
+\fB\-ambiguity\fR \fIboolean\fR
+.RS 4
+This allows those enzymes which have one or more 'N' ambiguity codes in their pattern to be considered Default value: Y
+.RE
+.PP
+\fB\-plasmid\fR \fIboolean\fR
+.RS 4
+If this is set then this allows searches for restriction enzyme recognition site and cut postions that span the end of the sequence to be considered. Default value: N
+.RE
+.PP
+\fB\-commercial\fR \fIboolean\fR
+.RS 4
+If this is set, then only those enzymes with a commercial supplier will be searched for. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through 'all' the enzymes in the REBASE database. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier. Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-limit\fR \fIboolean\fR
+.RS 4
+This limits the reporting of enzymes to just one enzyme from each group of isoschizomers. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file 'embossre.equ', which is created by the program 'rebaseextract'. If you prefer different prototypes to be used, make a copy of embossre.equ in your home directory and edit it. If this value is set to be false then all of the input enzymes will be reported. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching 'all' of them. Default value: Y
+.RE
+.PP
+\fB\-alphabetic\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-fragments\fR \fIboolean\fR
+.RS 4
+This gives the fragment lengths of the forward sense strand produced by complete restriction using all of the input enzymes together. Results are added to the tail section of the report. Default value: N
+.RE
+.PP
+\fB\-name\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+restrict is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/revseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/revseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/revseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,65 @@
+.\"     Title: REVSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "REVSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+revseq \- Reverse and complement a sequence
+.SH "SYNOPSIS"
+.HP 7
+\fBrevseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-reverse\ \fR\fB\fIboolean\fR\fR \fB\-complement\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 7
+\fBrevseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBrevseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-reverse\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to reverse the output sequence Default value: Y
+.RE
+.PP
+\fB\-complement\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to complement the output sequence Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+revseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/seealso.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/seealso.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/seealso.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,94 @@
+.\"     Title: SEEALSO
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SEEALSO" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+seealso \- Finds programs sharing group names
+.SH "SYNOPSIS"
+.HP 8
+\fBseealso\fR \fB\-search\ \fR\fB\fIstring\fR\fR [\fB\-explode\ \fR\fB\fIboolean\fR\fR] \fB\-emboss\ \fR\fB\fIboolean\fR\fR \fB\-embassy\ \fR\fB\fIboolean\fR\fR \fB\-showembassy\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fItoggle\fR\fR] [\fB\-groups\ \fR\fB\fIboolean\fR\fR] \fB\-colon\ \fR\fB\fIboolean\fR\fR
+.HP 8
+\fBseealso\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseealso\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display,Information" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-search\fR \fIstring\fR
+.RS 4
+Enter the name of an EMBOSS program
+.RE
+.SS "Additional section"
+.PP
+\fB\-explode\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to have two forms, exploded and not exploded. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: 'NAME1', 'NAME2', 'NAME1 NAME2', NAME2 NAME1'. The non\-expanded names are simply like: 'NAME1 NAME2'. Using expanded group names will find many more programs which share at least some of the expanded names than using the non\-exploded names and so you will get more programs reported as sharing a similar function than you will if you specify that you wish to use non\-exploded names Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-emboss\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBOSS program documentation will be searched. If this option is set to be false, then only the EMBASSY programs will be searched (if the \-embassy option is true). EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-embassy\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBASSY program documentation will be searched. If this option is set to be false, then only the EMBOSS programs will be searched (if the \-emboss option is true). EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-showembassy\fR \fIstring\fR
+.RS 4
+If you use this option then this EMBASSY package program documentation will be searched. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fItoggle\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document. Default value: N
+.RE
+.PP
+\fB\-groups\fR \fIboolean\fR
+.RS 4
+If you use this option, then only the group names will output to the file Default value: N
+.RE
+.PP
+\fB\-colon\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to have up to two levels, for example the primary group 'ALIGNMENT' has several sub\-groups, or second\-level groups, e.g.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE. To aid programs that parse the output of seealso that require the names of these subgroups, a colon ':' will be placed between the first and second level of the group name if this option is true. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+seealso is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/seqinfo.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/seqinfo.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/seqinfo.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,55 @@
+.\"     Title: SEQINFO
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SEQINFO" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+seqinfo \- Returns sequence information
+.SH "SYNOPSIS"
+.HP 8
+\fBseqinfo\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 8
+\fBseqinfo\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqinfo\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+seqinfo is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/seqmatchall.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/seqmatchall.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/seqmatchall.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: SEQMATCHALL
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SEQMATCHALL" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+seqmatchall \- All\-against\-all comparison of a set of sequences
+.SH "SYNOPSIS"
+.HP 12
+\fBseqmatchall\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR
+.HP 12
+\fBseqmatchall\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqmatchall\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Local" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqset\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-wordsize\fR \fIinteger\fR
+.RS 4
+Default value: 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIalign\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+seqmatchall is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/seqret.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/seqret.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/seqret.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,63 @@
+.\"     Title: SEQRET
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SEQRET" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+seqret \- Reads and writes (returns) sequences
+.SH "SYNOPSIS"
+.HP 7
+\fBseqret\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-firstonly\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 7
+\fBseqret\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqret\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-feature\fR \fIboolean\fR
+.RS 4
+.RE
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-firstonly\fR \fIboolean\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+seqret is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/seqretall.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/seqretall.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/seqretall.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,54 @@
+.\"     Title: SEQRETALL
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SEQRETALL" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+seqretall \- Reads and writes (returns) a set of sequences one at a time
+.SH "SYNOPSIS"
+.HP 10
+\fBseqretall\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 10
+\fBseqretall\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqretall\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+seqretall is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/seqretallfeat.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/seqretallfeat.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/seqretallfeat.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,54 @@
+.\"     Title: SEQRETALLFEAT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SEQRETALLFEAT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+seqretallfeat \- Reads and writes (returns) one or more sequences
+.SH "SYNOPSIS"
+.HP 14
+\fBseqretallfeat\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 14
+\fBseqretallfeat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqretallfeat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+seqretallfeat is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/seqretset.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/seqretset.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/seqretset.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,58 @@
+.\"     Title: SEQRETSET
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SEQRETSET" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+seqretset \- Reads and writes (returns) a set of sequences all at once
+.SH "SYNOPSIS"
+.HP 10
+\fBseqretset\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR \fB\-outseq\ \fR\fB\fIseqoutset\fR\fR
+.HP 10
+\fBseqretset\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqretset\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-feature\fR \fIboolean\fR
+.RS 4
+.RE
+.PP
+\fB\-sequence\fR \fIseqset\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutset\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+seqretset is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/seqretsingle.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/seqretsingle.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/seqretsingle.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,58 @@
+.\"     Title: SEQRETSINGLE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SEQRETSINGLE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+seqretsingle \- Reads and writes (returns) a single sequence
+.SH "SYNOPSIS"
+.HP 13
+\fBseqretsingle\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR
+.HP 13
+\fBseqretsingle\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqretsingle\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-feature\fR \fIboolean\fR
+.RS 4
+.RE
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+seqretsingle is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/seqretsplit.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/seqretsplit.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/seqretsplit.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,63 @@
+.\"     Title: SEQRETSPLIT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SEQRETSPLIT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+seqretsplit \- Reads and writes (returns) sequences in individual files
+.SH "SYNOPSIS"
+.HP 12
+\fBseqretsplit\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-firstonly\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 12
+\fBseqretsplit\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqretsplit\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-feature\fR \fIboolean\fR
+.RS 4
+.RE
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-firstonly\fR \fIboolean\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+seqretsplit is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/seqrettype.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/seqrettype.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/seqrettype.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,68 @@
+.\"     Title: SEQRETTYPE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SEQRETTYPE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+seqrettype \- Reads and writes (returns) sequences
+.SH "SYNOPSIS"
+.HP 11
+\fBseqrettype\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIlist\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-firstonly\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 11
+\fBseqrettype\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqrettype\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-feature\fR \fIboolean\fR
+.RS 4
+.RE
+.PP
+\fB\-type\fR \fIlist\fR
+.RS 4
+Default value: any
+.RE
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-firstonly\fR \fIboolean\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+seqrettype is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/showalign.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/showalign.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/showalign.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,147 @@
+.\"     Title: SHOWALIGN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SHOWALIGN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+showalign \- Displays a multiple sequence alignment
+.SH "SYNOPSIS"
+.HP 10
+\fBshowalign\fR \fB\-sequence\ \fR\fB\fIseqset\fR\fR [\fB\-matrix\ \fR\fB\fImatrix\fR\fR] [\fB\-refseq\ \fR\fB\fIstring\fR\fR] [\fB\-bottom\ \fR\fB\fIboolean\fR\fR] [\fB\-show\ \fR\fB\fIlist\fR\fR] [\fB\-order\ \fR\fB\fIlist\fR\fR] [\fB\-similarcase\ \fR\fB\fIboolean\fR\fR] [\fB\-consensus\ \fR\fB\fIboolean\fR\fR] \fB\-uppercase\ \fR\fB\fIrange\fR\fR \fB\-number\ \fR\fB\fIboolean\fR\fR \fB\-ruler\ \fR\fB\fIboolean\fR\fR \fB\-width\ \fR\fB\fIinteger\fR\fR \fB\-margin\ \fR\fB\fIinteger\fR\fR \fB\-html\ \fR\fB\fIboolean\fR\fR \fB\-highlight\ \fR\fB\fIrange\fR\fR \fB\-plurality\ \fR\fB\fIfloat\fR\fR \fB\-setcase\ \fR\fB\fIfloat\fR\fR \fB\-identity\ \fR\fB\fIfloat\fR\fR \fB\-gaps\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 10
+\fBshowalign\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBshowalign\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Multiple,Display" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqset\fR
+.RS 4
+The sequence alignment to be displayed.
+.RE
+.PP
+\fB\-matrix\fR \fImatrix\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Additional section"
+.PP
+\fB\-refseq\fR \fIstring\fR
+.RS 4
+If you give the number in the alignment or the name of a sequence, it will be taken to be the reference sequence. The reference sequence is always show in full and is the one against which all the other sequences are compared. If this is set to 0 then the consensus sequence will be used as the reference sequence. By default the consensus sequence is used as the reference sequence.
+.RE
+.PP
+\fB\-bottom\fR \fIboolean\fR
+.RS 4
+If this is true then the reference sequence is displayed at the bottom of the alignment as well as at the top. Default value: Y
+.RE
+.PP
+\fB\-show\fR \fIlist\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-order\fR \fIlist\fR
+.RS 4
+Default value: I
+.RE
+.PP
+\fB\-similarcase\fR \fIboolean\fR
+.RS 4
+If this is set True, then when \-show is set to 'Similarities' or 'Non\-identities' and a residue is similar but not identical to the reference sequence residue, it will be changed to lower\-case. If \-show is set to 'All' then non\-identical, non\-similar residues will be changed to lower\-case. If this is False then no change to the case of the residues is made on the basis of their similarity to the reference sequence. Default value: Y
+.RE
+.PP
+\fB\-consensus\fR \fIboolean\fR
+.RS 4
+If this is true then the consensus line is displayed. Default value: Y
+.RE
+.SS "Advanced section"
+.PP
+\fB\-uppercase\fR \fIrange\fR
+.RS 4
+Regions to put in uppercase. If this is left blank, then the sequence case is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non\-digit, non\-alpha character. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99
+.RE
+.PP
+\fB\-number\fR \fIboolean\fR
+.RS 4
+If this option is true then a line giving the positions in the alignment is displayed every 10 characters above the alignment. Default value: Y
+.RE
+.PP
+\fB\-ruler\fR \fIboolean\fR
+.RS 4
+If this option is true then a ruler line marking every 5th and 10th character in the alignment is displayed. Default value: Y
+.RE
+.PP
+\fB\-width\fR \fIinteger\fR
+.RS 4
+Default value: 60
+.RE
+.PP
+\fB\-margin\fR \fIinteger\fR
+.RS 4
+This sets the length of the left\-hand margin for sequence names. If the margin is set at 0 then no margin and no names are displayed. If the margin is set to a value that is less than the length of a sequence name then the sequence name is displayed truncated to the length of the margin. If the margin is set to \-1 then the minimum margin width that will allow all the sequence names to be displayed in full plus a space at the end of the name will automatically be selected. Default value: \-1
+.RE
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-highlight\fR \fIrange\fR
+.RS 4
+Regions to colour if formatting for HTML. If this is left blank, then the sequence is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are followed by any valid HTML font colour. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as '@filename'.
+.RE
+.PP
+\fB\-plurality\fR \fIfloat\fR
+.RS 4
+Set a cut\-off for the % of positive scoring matches below which there is no consensus. The default plurality is taken as 50% of the total weight of all the sequences in the alignment. Default value: 50.0
+.RE
+.PP
+\fB\-setcase\fR \fIfloat\fR
+.RS 4
+Sets the threshold for the scores of the positive matches above which the consensus is in upper\-case and below which the consensus is in lower\-case. By default this is set to be half of the (weight\-adjusted) number of sequences in the alignment. Default value: @( $(sequence.totweight) / 2)
+.RE
+.PP
+\fB\-identity\fR \fIfloat\fR
+.RS 4
+Provides the facility of setting the required number of identities at a position for it to give a consensus. Therefore, if this is set to 100% only columns of identities contribute to the consensus. Default value: 0.0
+.RE
+.PP
+\fB\-gaps\fR \fIboolean\fR
+.RS 4
+If this option is true then gap characters can appear in the consensus. The alternative is 'N' for nucleotide, or 'X' for protein Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+showalign is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/showdb.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/showdb.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/showdb.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,132 @@
+.\"     Title: SHOWDB
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SHOWDB" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+showdb \- Displays information on the currently available databases
+.SH "SYNOPSIS"
+.HP 7
+\fBshowdb\fR [\fB\-database\ \fR\fB\fIstring\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] [\fB\-protein\ \fR\fB\fIboolean\fR\fR] [\fB\-nucleic\ \fR\fB\fIboolean\fR\fR] [\fB\-full\ \fR\fB\fIboolean\fR\fR] [\fB\-methods\ \fR\fB\fIboolean\fR\fR] [\fB\-fields\ \fR\fB\fIboolean\fR\fR] [\fB\-defined\ \fR\fB\fIboolean\fR\fR] [\fB\-release\ \fR\fB\fIboolean\fR\fR] \fB\-only\ \fR\fB\fItoggle\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIboolean\fR\fR \fB\-id\ \fR\fB\fIboolean\fR\fR \fB\-query\ \fR\fB\fIboolean\fR\fR \fB\-all\ \fR\fB\fIboolean\fR\fR \fB\-comment\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
+.HP 7
+\fBshowdb\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBshowdb\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display,Information" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-database\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-protein\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-nucleic\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-full\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-methods\fR \fIboolean\fR
+.RS 4
+This displays the access methods that can be used on this database, for all, query or ID access Default value: $(full)
+.RE
+.PP
+\fB\-fields\fR \fIboolean\fR
+.RS 4
+This displays the search fields that can be used on this database, other than the standard 'id' or 'acc' fields. Default value: $(full)
+.RE
+.PP
+\fB\-defined\fR \fIboolean\fR
+.RS 4
+This displays a short name for the file containing the database definition Default value: $(full)
+.RE
+.PP
+\fB\-release\fR \fIboolean\fR
+.RS 4
+Default value: $(full)
+.RE
+.SS "Advanced section"
+.PP
+\fB\-only\fR \fItoggle\fR
+.RS 4
+This is a way of shortening the command line if you only want a few standard columns to be displayed. Instead of specifying: '\-nohead \-notype \-noid \-noquery \-noall' to get only the comment output, you can specify '\-only \-comment' Default value: N
+.RE
+.PP
+\fB\-heading\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-type\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-id\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-query\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-all\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-comment\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+showdb is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/showfeat.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/showfeat.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/showfeat.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,166 @@
+.\"     Title: SHOWFEAT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SHOWFEAT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+showfeat \- Show features of a sequence.
+.SH "SYNOPSIS"
+.HP 9
+\fBshowfeat\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-matchsource\ \fR\fB\fIstring\fR\fR] [\fB\-matchtype\ \fR\fB\fIstring\fR\fR] [\fB\-matchtag\ \fR\fB\fIstring\fR\fR] [\fB\-matchvalue\ \fR\fB\fIstring\fR\fR] [\fB\-sort\ \fR\fB\fIlist\fR\fR] [\fB\-annotation\ \fR\fB\fIrange\fR\fR] \fB\-html\ \fR\fB\fIboolean\fR\fR \fB\-id\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR \fB\-scale\ \fR\fB\fIboolean\fR\fR \fB\-width\ \fR\fB\fIinteger\fR\fR \fB\-collapse\ \fR\fB\fIboolean\fR\fR \fB\-forward\ \fR\fB\fIboolean\fR\fR \fB\-reverse\ \fR\fB\fIboolean\fR\fR \fB\-unknown\ \fR\fB\fIboolean\fR\fR \fB\-strand\ \fR\fB\fIboolean\fR\fR \fB\-source\ \fR\fB\fIboolean\fR\fR \fB\-position\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIboolean\fR\fR \fB\-tags\ \fR\fB\fIboolean\fR\fR \fB\-values\ \fR\fB\fIboolean\fR\fR \fB\-stricttags\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 9
+\fBshowfeat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBshowfeat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display,Feature tables" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-matchsource\fR \fIstring\fR
+.RS 4
+By default any feature source in the feature table is shown. You can set this to match any feature source you wish to show. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from. The source may be wildcarded by using '*'. If you wish to show more than one source, separate their names with the character '|', eg: gene* | embl Default value: *
+.RE
+.PP
+\fB\-matchtype\fR \fIstring\fR
+.RS 4
+By default any feature type in the feature table is shown. You can set this to match any feature type you wish to show. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to show more than one type, separate their names with the character '|', eg: *UTR | intron Default value: *
+.RE
+.PP
+\fB\-matchtag\fR \fIstring\fR
+.RS 4
+Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default any feature tag in the feature table is shown. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to show more than one tag, separate their names with the character '|', eg: gene | label Default value: *
+.RE
+.PP
+\fB\-matchvalue\fR \fIstring\fR
+.RS 4
+Tag values are the values associated with a feature tag. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Only some of these tags can have values, for example '/gene' can have the value of the gene name. By default any feature tag value in the feature table is shown. You can set this to match any feature tag valueyou wish to show. The tag value may be wildcarded by using '*'. If you wish to show more than one tag value, separate their names with the character '|', eg: pax* | 10 Default value: *
+.RE
+.PP
+\fB\-sort\fR \fIlist\fR
+.RS 4
+Default value: start
+.RE
+.PP
+\fB\-annotation\fR \fIrange\fR
+.RS 4
+Regions to annotate by marking. If this is left blank, then no annotation is added. A set of regions is specified by a set of pairs of positions followed by optional text. The positions are integers. They are followed by any text (but not digits when on the command\-line). Examples of region specifications are: 24\-45 new domain 56\-78 match to Mouse 1\-100 First part 120\-156 oligo A file of ranges to annotate (one range per line) can be specified as '@filename'.
+.RE
+.SS "Advanced section"
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-id\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the ID name of the sequence. Default value: Y
+.RE
+.PP
+\fB\-description\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the description of the sequence. Default value: Y
+.RE
+.PP
+\fB\-scale\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the scale line. Default value: Y
+.RE
+.PP
+\fB\-width\fR \fIinteger\fR
+.RS 4
+You can expand (or contract) the width of the ASCII\-character graphics display of the positions of the features using this value. For example, a width of 80 characters would cover a standard page width and a width a 10 characters would be nearly unreadable. If the width is set to less than 4, the graphics lines and the scale line will not be displayed. Default value: 60
+.RE
+.PP
+\fB\-collapse\fR \fIboolean\fR
+.RS 4
+If this is set, then features from the same source and of the same type and sense are all printed on the same line. For instance if there are several features from the EMBL feature table (ie. the same source) which are all of type 'exon' in the same sense, then they will all be displayed on the same line. This makes it hard to distinguish overlapping features. If this is set to false then each feature is displayed on a separate line making it easier to distinguish where features start and end. Default value: N
+.RE
+.PP
+\fB\-forward\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display forward sense features. Default value: Y
+.RE
+.PP
+\fB\-reverse\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display reverse sense features. Default value: Y
+.RE
+.PP
+\fB\-unknown\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display unknown sense features. (ie. features with no directionality \- all protein features are of this type and some nucleic features (for example, CG\-rich regions)). Default value: Y
+.RE
+.PP
+\fB\-strand\fR \fIboolean\fR
+.RS 4
+Set this if you wish to display the strand of the features. Protein features are always directionless (indicated by '0'), forward is indicated by '+' and reverse is '\-'. Default value: N
+.RE
+.PP
+\fB\-source\fR \fIboolean\fR
+.RS 4
+Set this if you wish to display the source of the features. The source name is usually either the name of the program that detected the feature or it is the name of the feature table (eg: EMBL) that the feature came from. Default value: N
+.RE
+.PP
+\fB\-position\fR \fIboolean\fR
+.RS 4
+Set this if you wish to display the start and end position of the features. If several features are being displayed on the same line, then the start and end positions will be joined by a comma, for example: '189\-189,225\-225'. Default value: N
+.RE
+.PP
+\fB\-type\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the type of the features. Default value: Y
+.RE
+.PP
+\fB\-tags\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the tags and values of the features. Default value: N
+.RE
+.PP
+\fB\-values\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the tag values of the features. If this is set to be false, only the tag names will be displayed. If the tags are not displayed, then the values will not be displayed. The value of the 'translation' tag is never displayed as it is often extremely long. Default value: Y
+.RE
+.PP
+\fB\-stricttags\fR \fIboolean\fR
+.RS 4
+By default if any tag/value pair in a feature matches the specified tag and value, then all the tags/value pairs of that feature will be displayed. If this is set to be true, then only those tag/value pairs in a feature that match the specified tag and value will be displayed. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+showfeat is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/showorf.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/showorf.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/showorf.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,85 @@
+.\"     Title: SHOWORF
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SHOWORF" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+showorf \- Pretty output of DNA translations
+.SH "SYNOPSIS"
+.HP 8
+\fBshoworf\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-frames\ \fR\fB\fIlist\fR\fR [\fB\-table\ \fR\fB\fIlist\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR [\fB\-ruler\ \fR\fB\fIboolean\fR\fR] [\fB\-plabel\ \fR\fB\fIboolean\fR\fR] [\fB\-nlabel\ \fR\fB\fIboolean\fR\fR] \fB\-width\ \fR\fB\fIinteger\fR\fR
+.HP 8
+\fBshoworf\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBshoworf\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Gene finding,Nucleic:Translation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-frames\fR \fIlist\fR
+.RS 4
+Default value: 1,2,3,4,5,6
+.RE
+.SS "Additional section"
+.PP
+\fB\-table\fR \fIlist\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-ruler\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-plabel\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-nlabel\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-width\fR \fIinteger\fR
+.RS 4
+Default value: 50
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+showorf is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/showseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/showseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/showseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,242 @@
+.\"     Title: SHOWSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SHOWSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+showseq \- Display a sequence with features, translation etc..
+.SH "SYNOPSIS"
+.HP 8
+\fBshowseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-format\ \fR\fB\fIlist\fR\fR \fB\-things\ \fR\fB\fIlist\fR\fR [\fB\-translate\ \fR\fB\fIrange\fR\fR] [\fB\-uppercase\ \fR\fB\fIrange\fR\fR] [\fB\-highlight\ \fR\fB\fIrange\fR\fR] [\fB\-annotation\ \fR\fB\fIrange\fR\fR] [\fB\-enzymes\ \fR\fB\fIstring\fR\fR] [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-matchsource\ \fR\fB\fIstring\fR\fR] [\fB\-matchtype\ \fR\fB\fIstring\fR\fR] [\fB\-matchsense\ \fR\fB\fIinteger\fR\fR] [\fB\-minscore\ \fR\fB\fIfloat\fR\fR] [\fB\-maxscore\ \fR\fB\fIfloat\fR\fR] [\fB\-matchtag\ \fR\fB\fIstring\fR\fR] [\fB\-matchvalue\ \fR\fB\fIstring\fR\fR] [\fB\-stricttags\ \fR\fB\fIboolean\fR\fR] \fB\-flatreformat\ \fR\fB\fIboolean\fR\fR \fB\-mincuts\ \fR\fB\fIinteger\fR\fR \fB\-maxcuts\ \fR\fB\fIinteger\fR\fR \fB\-sitelen\ \fR\fB\fIinteger\fR\fR \fB\-single\ \fR\fB\fIboolean\fR\fR \fB\-blunt\ \fR\fB\fIboolean\fR\fR \fB\-sticky\ \fR\fB\fIboolean\fR\fR \fB\-ambiguity\ \fR\fB\fIboolean\fR\fR \fB\-plasmid\ \fR\fB\fIboolean\fR\fR \fB\-commercial\ \fR\fB\fIboolean\fR\fR \fB\-limit\ \fR\fB\fIboolean\fR\fR \fB\-orfminsize\ \fR\fB\fIinteger\fR\fR \fB\-threeletter\ \fR\fB\fIboolean\fR\fR \fB\-number\ \fR\fB\fIboolean\fR\fR \fB\-width\ \fR\fB\fIinteger\fR\fR \fB\-length\ \fR\fB\fIinteger\fR\fR \fB\-margin\ \fR\fB\fIinteger\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR \fB\-offset\ \fR\fB\fIinteger\fR\fR \fB\-html\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 8
+\fBshowseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBshowseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display,Nucleic:Translation,Nucleic:Restriction" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-format\fR \fIlist\fR
+.RS 4
+Default value: 2
+.RE
+.PP
+\fB\-things\fR \fIlist\fR
+.RS 4
+Specify a list of one or more code characters in the order in which you wish things to be displayed one above the other down the page. For example if you wish to see things displayed in the order: sequence, complement sequence, ticks line, frame 1 translation, blank line; then you should enter 'S,C,T,1,B'. Default value: B,N,T,S,A,F
+.RE
+.SS "Additional section"
+.PP
+\fB\-translate\fR \fIrange\fR
+.RS 4
+Regions to translate (if translating). If this is left blank the complete sequence is translated. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non\-digit, non\-alpha character. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99
+.RE
+.PP
+\fB\-uppercase\fR \fIrange\fR
+.RS 4
+Regions to put in uppercase. If this is left blank, then the sequence case is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non\-digit, non\-alpha character. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99
+.RE
+.PP
+\fB\-highlight\fR \fIrange\fR
+.RS 4
+Regions to colour if formatting for HTML. If this is left blank, then the sequence is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are followed by any valid HTML font colour. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specified as '@filename'.
+.RE
+.PP
+\fB\-annotation\fR \fIrange\fR
+.RS 4
+Regions to annotate by marking. If this is left blank, then no annotation is added. A set of regions is specified by a set of pairs of positions followed by optional text. The positions are integers. They are followed by any text (but not digits when on the command\-line). Examples of region specifications are: 24\-45 new domain 56\-78 match to Mouse 1\-100 First part 120\-156 oligo A file of ranges to annotate (one range per line) can be specified as '@filename'.
+.RE
+.PP
+\fB\-enzymes\fR \fIstring\fR
+.RS 4
+The name 'all' reads in all enzyme names from the REBASE database. You can specify enzymes by giving their names with commas between then, such as: 'HincII,hinfI,ppiI,hindiii'. The case of the names is not important. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a '@' character in front of it, for example, '@enz.list'. Blank lines and lines starting with a hash character or '!' are ignored and all other lines are concatenated together with a comma character ',' and then treated as the list of enzymes to search for. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI Default value: all
+.RE
+.PP
+\fB\-table\fR \fIlist\fR
+.RS 4
+.RE
+.SS "Feature display options"
+.PP
+\fB\-matchsource\fR \fIstring\fR
+.RS 4
+By default any feature source in the feature table is shown. You can set this to match any feature source you wish to show. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from. The source may be wildcarded by using '*'. If you wish to show more than one source, separate their names with the character '|', eg: gene* | embl Default value: *
+.RE
+.PP
+\fB\-matchtype\fR \fIstring\fR
+.RS 4
+By default any feature type in the feature table is shown. You can set this to match any feature type you wish to show. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to show more than one type, separate their names with the character '|', eg: *UTR | intron Default value: *
+.RE
+.PP
+\fB\-matchsense\fR \fIinteger\fR
+.RS 4
+By default any feature type in the feature table is shown. You can set this to match any feature sense you wish to show. 0 \- any sense, 1 \- forward sense, \-1 \- reverse sense
+.RE
+.PP
+\fB\-minscore\fR \fIfloat\fR
+.RS 4
+If this is greater than or equal to the maximum score, then any score is permitted Default value: 0.0
+.RE
+.PP
+\fB\-maxscore\fR \fIfloat\fR
+.RS 4
+If this is less than or equal to the maximum score, then any score is permitted Default value: 0.0
+.RE
+.PP
+\fB\-matchtag\fR \fIstring\fR
+.RS 4
+Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default any feature tag in the feature table is shown. You can set this to match any feature tag you wish to show. The tag may be wildcarded by using '*'. If you wish to show more than one tag, separate their names with the character '|', eg: gene | label Default value: *
+.RE
+.PP
+\fB\-matchvalue\fR \fIstring\fR
+.RS 4
+Tag values are the values associated with a feature tag. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Only some of these tags can have values, for example '/gene' can have the value of the gene name. By default any feature tag value in the feature table is shown. You can set this to match any feature tag valueyou wish to show. The tag value may be wildcarded by using '*'. If you wish to show more than one tag value, separate their names with the character '|', eg: pax* | 10 Default value: *
+.RE
+.PP
+\fB\-stricttags\fR \fIboolean\fR
+.RS 4
+By default if any tag/value pair in a feature matches the specified tag and value, then all the tags/value pairs of that feature will be displayed. If this is set to be true, then only those tag/value pairs in a feature that match the specified tag and value will be displayed. Default value: N
+.RE
+.SS "Advanced section"
+.SS "Restriction map options"
+.PP
+\fB\-flatreformat\fR \fIboolean\fR
+.RS 4
+This changes the output format to one where the recognition site is indicated by a row of '===' characters and the cut site is pointed to by a '>' character in the forward sense, or a '<' in the reverse sense strand. Default value: N
+.RE
+.PP
+\fB\-mincuts\fR \fIinteger\fR
+.RS 4
+This sets the minimum number of cuts for any restriction enzyme that will be considered. Any enzymes that cut fewer times than this will be ignored. Default value: 1
+.RE
+.PP
+\fB\-maxcuts\fR \fIinteger\fR
+.RS 4
+This sets the maximum number of cuts for any restriction enzyme that will be considered. Any enzymes that cut more times than this will be ignored. Default value: 2000000000
+.RE
+.PP
+\fB\-sitelen\fR \fIinteger\fR
+.RS 4
+This sets the minimum length of the restriction enzyme recognition site. Any enzymes with sites shorter than this will be ignored. Default value: 4
+.RE
+.PP
+\fB\-single\fR \fIboolean\fR
+.RS 4
+If this is set then this forces the values of the mincuts and maxcuts qualifiers to both be 1. Any other value you may have set them to will be ignored. Default value: N
+.RE
+.PP
+\fB\-blunt\fR \fIboolean\fR
+.RS 4
+This allows those enzymes which cut at the same position on the forward and reverse strands to be considered. Default value: Y
+.RE
+.PP
+\fB\-sticky\fR \fIboolean\fR
+.RS 4
+This allows those enzymes which cut at different positions on the forward and reverse strands, leaving an overhang, to be considered. Default value: Y
+.RE
+.PP
+\fB\-ambiguity\fR \fIboolean\fR
+.RS 4
+This allows those enzymes which have one or more 'N' ambiguity codes in their pattern to be considered Default value: Y
+.RE
+.PP
+\fB\-plasmid\fR \fIboolean\fR
+.RS 4
+If this is set then this allows searches for restriction enzyme recognition site and cut postions that span the end of the sequence to be considered. Default value: N
+.RE
+.PP
+\fB\-commercial\fR \fIboolean\fR
+.RS 4
+If this is set, then only those enzymes with a commercial supplier will be searched for. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through 'all' the enzymes in the REBASE database. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier. Default value: Y
+.RE
+.PP
+\fB\-limit\fR \fIboolean\fR
+.RS 4
+This limits the reporting of enzymes to just one enzyme from each group of isoschizomers. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file 'embossre.equ', which is created by the program 'rebaseextract'. If you prefer different prototypes to be used, make a copy of embossre.equ in your home directory and edit it. If this value is set to be false then all of the input enzymes will be reported. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching 'all' of them. Default value: Y
+.RE
+.PP
+\fB\-orfminsize\fR \fIinteger\fR
+.RS 4
+This sets the minimum size of Open Reading Frames (ORFs) to display in the translations. All other translation regions are masked by changing the amino acids to '\-' characters.
+.RE
+.PP
+\fB\-threeletter\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-number\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-width\fR \fIinteger\fR
+.RS 4
+Default value: 60
+.RE
+.PP
+\fB\-length\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-margin\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.PP
+\fB\-name\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the ID name of the sequence Default value: Y
+.RE
+.PP
+\fB\-description\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the description of the sequence Default value: Y
+.RE
+.PP
+\fB\-offset\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+showseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/shuffleseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/shuffleseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/shuffleseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: SHUFFLESEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SHUFFLESEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+shuffleseq \- Shuffles a set of sequences maintaining composition
+.SH "SYNOPSIS"
+.HP 11
+\fBshuffleseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-shuffle\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 11
+\fBshuffleseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBshuffleseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Mutation,Protein:Mutation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-shuffle\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+shuffleseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/sigcleave.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/sigcleave.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/sigcleave.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,66 @@
+.\"     Title: SIGCLEAVE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SIGCLEAVE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+sigcleave \- Reports protein signal cleavage sites
+.SH "SYNOPSIS"
+.HP 10
+\fBsigcleave\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-minweight\ \fR\fB\fIfloat\fR\fR [\fB\-prokaryote\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 10
+\fBsigcleave\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBsigcleave\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:Motifs" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-minweight\fR \fIfloat\fR
+.RS 4
+Minimum scoring weight value for the predicted cleavage site Default value: 3.5
+.RE
+.SS "Additional section"
+.PP
+\fB\-prokaryote\fR \fIboolean\fR
+.RS 4
+Specifies the sequence is prokaryotic and changes the default scoring data file name
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+sigcleave is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/silent.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/silent.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/silent.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,75 @@
+.\"     Title: SILENT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SILENT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+silent \- Silent mutation restriction enzyme scan
+.SH "SYNOPSIS"
+.HP 7
+\fBsilent\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-enzymes\ \fR\fB\fIstring\fR\fR \fB\-sshow\ \fR\fB\fIboolean\fR\fR \fB\-tshow\ \fR\fB\fIboolean\fR\fR \fB\-allmut\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 7
+\fBsilent\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBsilent\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Restriction" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-enzymes\fR \fIstring\fR
+.RS 4
+Default value: all
+.RE
+.SS "Output section"
+.PP
+\fB\-sshow\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-tshow\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-allmut\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+silent is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/sirna.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/sirna.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/sirna.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,86 @@
+.\"     Title: SIRNA
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SIRNA" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+sirna \- Finds siRNA duplexes in mRNA
+.SH "SYNOPSIS"
+.HP 6
+\fBsirna\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-poliii\ \fR\fB\fIboolean\fR\fR] [\fB\-aa\ \fR\fB\fIboolean\fR\fR] [\fB\-tt\ \fR\fB\fIboolean\fR\fR] [\fB\-polybase\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIreport\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR [\fB\-context\ \fR\fB\fIboolean\fR\fR]
+.HP 6
+\fBsirna\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBsirna\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Sequence input options"
+.PP
+\fB\-poliii\fR \fIboolean\fR
+.RS 4
+This option allows you to select only the 21 base probes that start with a purine and so can be expressed from Pol III expression vectors. This is the NARN(17)YNN pattern that has been suggested by Tuschl et al. Default value: N
+.RE
+.PP
+\fB\-aa\fR \fIboolean\fR
+.RS 4
+This option allows you to select only those 23 base regions that start with AA. If this option is not selected then regions that start with AA will be favoured by giving them a higher score, but regions that do not start with AA will also be reported. Default value: N
+.RE
+.PP
+\fB\-tt\fR \fIboolean\fR
+.RS 4
+This option allows you to select only those 23 base regions that end with TT. If this option is not selected then regions that end with TT will be favoured by giving them a higher score, but regions that do not end with TT will also be reported. Default value: N
+.RE
+.PP
+\fB\-polybase\fR \fIboolean\fR
+.RS 4
+If this option is FALSE then only those 23 base regions that have no repeat of 4 or more of any bases in a row will be reported. No regions will ever be reported that have 4 or more G's in a row. Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+The output is a table of the forward and reverse parts of the 21 base siRNA duplex. Both the forward and reverse sequences are written 5' to 3', ready to be ordered. The last two bases have been replaced by 'dTdT'. The starting position of the 23 base region and the %GC content is also given. If you wish to see the complete 23 base sequence, then either look at the sequence in the other output file, or use the qualifier '\-context' which will display the 23 bases of the forward sequence in this report withthe first two bases in brackets. These first two bases do not form part of the siRNA probe to be ordered.
+.RE
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+This is a file of the sequences of the 23 base regions that the siRNAs are selected from. You may use it to do searches of mRNA databases (e.g. REFSEQ) to confirm that the probes are unique to the gene you wish to use it on.
+.RE
+.PP
+\fB\-context\fR \fIboolean\fR
+.RS 4
+The output report file gives the sequences of the 21 base siRNA regions ready to be ordered. This does not give you an indication of the 2 bases before the 21 bases. It is often interesting to see which of the suggested possible probe regions have an 'AA' in front of them (i.e. it is useful to see which of the 23 base regions start with an 'AA'). This option displays the whole 23 bases of the region with the first two bases in brackets, e.g. '(AA)' to give you some context for the probe region. YOU SHOULD NOT INCLUDE THE TWO BASES IN BRACKETS WHEN YOU PLACE AN ORDER FOR THE PROBES. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+sirna is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/sixpack.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/sixpack.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/sixpack.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,139 @@
+.\"     Title: SIXPACK
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SIXPACK" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+sixpack \- Display a DNA sequence with 6\-frame translation and ORFs
+.SH "SYNOPSIS"
+.HP 8
+\fBsixpack\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-firstorf\ \fR\fB\fIboolean\fR\fR] [\fB\-lastorf\ \fR\fB\fIboolean\fR\fR] [\fB\-mstart\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR \fB\-reverse\ \fR\fB\fIboolean\fR\fR \fB\-orfminsize\ \fR\fB\fIinteger\fR\fR \fB\-uppercase\ \fR\fB\fIrange\fR\fR \fB\-highlight\ \fR\fB\fIrange\fR\fR \fB\-number\ \fR\fB\fIboolean\fR\fR \fB\-width\ \fR\fB\fIinteger\fR\fR \fB\-length\ \fR\fB\fIinteger\fR\fR \fB\-margin\ \fR\fB\fIinteger\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR \fB\-offset\ \fR\fB\fIinteger\fR\fR \fB\-html\ \fR\fB\fIboolean\fR\fR
+.HP 8
+\fBsixpack\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBsixpack\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display,Nucleic:Gene finding,Nucleic:Translation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-table\fR \fIlist\fR
+.RS 4
+Genetics code used for the translation
+.RE
+.PP
+\fB\-firstorf\fR \fIboolean\fR
+.RS 4
+Count the beginning of a sequence as a possible ORF, even if it's inferior to the minimal ORF size. Default value: Y
+.RE
+.PP
+\fB\-lastorf\fR \fIboolean\fR
+.RS 4
+Count the end of a sequence as a possible ORF, even if it's not finishing with a STOP, or inferior to the minimal ORF size. Default value: Y
+.RE
+.PP
+\fB\-mstart\fR \fIboolean\fR
+.RS 4
+Displays only ORFs starting with an M. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+ORF sequence output
+.RE
+.PP
+\fB\-reverse\fR \fIboolean\fR
+.RS 4
+Display also the translation of the DNA sequence in the 3 reverse frames Default value: Y
+.RE
+.PP
+\fB\-orfminsize\fR \fIinteger\fR
+.RS 4
+Minimum size of Open Reading Frames (ORFs) to display in the translations. Default value: 1
+.RE
+.PP
+\fB\-uppercase\fR \fIrange\fR
+.RS 4
+Regions to put in uppercase. If this is left blank, then the sequence case is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non\-digit, non\-alpha character. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99
+.RE
+.PP
+\fB\-highlight\fR \fIrange\fR
+.RS 4
+Regions to colour if formatting for HTML. If this is left blank, then the sequence is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are followed by any valid HTML font colour. Examples of region specifications are: 24\-45 blue 56\-78 orange 1\-100 green 120\-156 red A file of ranges to colour (one range per line) can be specifed as '@filename'.
+.RE
+.PP
+\fB\-number\fR \fIboolean\fR
+.RS 4
+Number the sequence at the beginning and the end of each line. Default value: Y
+.RE
+.PP
+\fB\-width\fR \fIinteger\fR
+.RS 4
+Number of nucleotides displayed on each line Default value: 60
+.RE
+.PP
+\fB\-length\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-margin\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.PP
+\fB\-name\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the ID name of the sequence. Default value: Y
+.RE
+.PP
+\fB\-description\fR \fIboolean\fR
+.RS 4
+Set this to be false if you do not wish to display the description of the sequence. Default value: Y
+.RE
+.PP
+\fB\-offset\fR \fIinteger\fR
+.RS 4
+Number from which you want the DNA sequence to be numbered. Default value: 1
+.RE
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+sixpack is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/skipseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/skipseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/skipseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,62 @@
+.\"     Title: SKIPSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SKIPSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+skipseq \- Reads and writes (returns) sequences, skipping first few
+.SH "SYNOPSIS"
+.HP 8
+\fBskipseq\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-skip\ \fR\fB\fIinteger\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 8
+\fBskipseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBskipseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-feature\fR \fIboolean\fR
+.RS 4
+.RE
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-skip\fR \fIinteger\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+skipseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/splitter.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/splitter.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/splitter.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,85 @@
+.\"     Title: SPLITTER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SPLITTER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+splitter \- Split a sequence into (overlapping) smaller sequences
+.SH "SYNOPSIS"
+.HP 9
+\fBsplitter\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-size\ \fR\fB\fIinteger\fR\fR] [\fB\-overlap\ \fR\fB\fIinteger\fR\fR] [\fB\-source\ \fR\fB\fIboolean\fR\fR] [\fB\-multifile\ \fR\fB\fIboolean\fR\fR] \fB\-addoverlap\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 9
+\fBsplitter\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBsplitter\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-feature\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-size\fR \fIinteger\fR
+.RS 4
+Default value: 10000
+.RE
+.PP
+\fB\-overlap\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-source\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-multifile\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-addoverlap\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+splitter is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/stretcher.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/stretcher.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/stretcher.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,74 @@
+.\"     Title: STRETCHER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "STRETCHER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+stretcher \- Finds the best global alignment between two sequences
+.SH "SYNOPSIS"
+.HP 10
+\fBstretcher\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR [\fB\-datafile\ \fR\fB\fImatrix\fR\fR] [\fB\-gapopen\ \fR\fB\fIinteger\fR\fR] [\fB\-gapextend\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR
+.HP 10
+\fBstretcher\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBstretcher\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Global" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fImatrix\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Additional section"
+.PP
+\fB\-gapopen\fR \fIinteger\fR
+.RS 4
+Default value: @($(acdprotein)? 12 : 16)
+.RE
+.PP
+\fB\-gapextend\fR \fIinteger\fR
+.RS 4
+Default value: @($(acdprotein)? 2 : 4)
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIalign\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+stretcher is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/stssearch.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/stssearch.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/stssearch.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,58 @@
+.\"     Title: STSSEARCH
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "STSSEARCH" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+stssearch \- Search a DNA database for matches with a set of STS primers
+.SH "SYNOPSIS"
+.HP 10
+\fBstssearch\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 10
+\fBstssearch\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBstssearch\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Primers" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-seqall\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+stssearch is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/supermatcher.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/supermatcher.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/supermatcher.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,90 @@
+.\"     Title: SUPERMATCHER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SUPERMATCHER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+supermatcher \- Match large sequences against one or more other sequences
+.SH "SYNOPSIS"
+.HP 13
+\fBsupermatcher\fR \fB\-asequence\ \fR\fB\fIseqall\fR\fR \fB\-bsequence\ \fR\fB\fIseqset\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR [\fB\-width\ \fR\fB\fIinteger\fR\fR] [\fB\-wordlen\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR [\fB\-errorfile\ \fR\fB\fIoutfile\fR\fR]
+.HP 13
+\fBsupermatcher\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBsupermatcher\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Local" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIseqset\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fImatrixf\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Required section"
+.PP
+\fB\-gapopen\fR \fIfloat\fR
+.RS 4
+Default value: @($(acdprotein)? 10.0 : 10.0)
+.RE
+.PP
+\fB\-gapextend\fR \fIfloat\fR
+.RS 4
+Default value: @($(acdprotein)? 0.5 : 0.5)
+.RE
+.SS "Additional section"
+.PP
+\fB\-width\fR \fIinteger\fR
+.RS 4
+Default value: 16
+.RE
+.PP
+\fB\-wordlen\fR \fIinteger\fR
+.RS 4
+Default value: 6
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIalign\fR
+.RS 4
+.RE
+.PP
+\fB\-errorfile\fR \fIoutfile\fR
+.RS 4
+Error file to be written to Default value: supermatcher.error
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+supermatcher is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/syco.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/syco.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/syco.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,84 @@
+.\"     Title: SYCO
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "SYCO" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+syco \- Synonymous codon usage Gribskov statistic plot
+.SH "SYNOPSIS"
+.HP 5
+\fBsyco\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-cfile\ \fR\fB\fIcodon\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-uncommon\ \fR\fB\fIboolean\fR\fR \fB\-minimum\ \fR\fB\fIfloat\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 5
+\fBsyco\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBsyco\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Codon usage,Nucleic:Gene finding" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-cfile\fR \fIcodon\fR
+.RS 4
+Codon usage file
+.RE
+.SS "Advanced section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+Default value: 30
+.RE
+.PP
+\fB\-uncommon\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-minimum\fR \fIfloat\fR
+.RS 4
+Default value: .15
+.RE
+.SS "Output section"
+.PP
+\fB\-plot\fR \fItoggle\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+syco is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/tcode.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/tcode.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/tcode.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,80 @@
+.\"     Title: TCODE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TCODE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+tcode \- Fickett TESTCODE statistic to identify protein\-coding DNA
+.SH "SYNOPSIS"
+.HP 6
+\fBtcode\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-datafile\ \fR\fB\fIdatafile\fR\fR \fB\-window\ \fR\fB\fIinteger\fR\fR \fB\-step\ \fR\fB\fIinteger\fR\fR \fB\-plot\ \fR\fB\fItoggle\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR
+.HP 6
+\fBtcode\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtcode\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Gene finding" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fIdatafile\fR
+.RS 4
+The default data file is Etcode.dat and contains coding probabilities for each base. The probabilities are for both positional and compositional information. Default value: Etcode.dat
+.RE
+.SS "Required section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+This is the number of nucleotide bases over which the TESTCODE statistic will be performed each time. The window will then slide along the sequence, covering the same number of bases each time. Default value: 200
+.RE
+.SS "Advanced section"
+.PP
+\fB\-step\fR \fIinteger\fR
+.RS 4
+The selected window will, by default, slide along the nucleotide sequence by three bases at a time, retaining the frame (although the algorithm is not frame sensitive). This may be altered to increase or decrease the increment of the slide. Default value: 3
+.RE
+.SS "Output section"
+.PP
+\fB\-plot\fR \fItoggle\fR
+.RS 4
+On selection a graph of the sequence (X axis) plotted against the coding score (Y axis) will be displayed. Sequence above the green line is coding, that below the red line is non\-coding. Default value: N
+.RE
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+tcode is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/testplot.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/testplot.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/testplot.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,60 @@
+.\"     Title: TESTPLOT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TESTPLOT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+testplot \- Test plot
+.SH "SYNOPSIS"
+.HP 9
+\fBtestplot\fR \fB\-points\ \fR\fB\fIinteger\fR\fR \fB\-overlap\ \fR\fB\fIboolean\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR
+.HP 9
+\fBtestplot\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtestplot\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Required section"
+.PP
+\fB\-points\fR \fIinteger\fR
+.RS 4
+Default value: 90
+.RE
+.SS "Output section"
+.PP
+\fB\-overlap\fR \fIboolean\fR
+.RS 4
+Default value: y
+.RE
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+testplot is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/textsearch.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/textsearch.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/textsearch.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,101 @@
+.\"     Title: TEXTSEARCH
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TEXTSEARCH" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+textsearch \- Search sequence documentation. Slow, use SRS and Entrez!
+.SH "SYNOPSIS"
+.HP 11
+\fBtextsearch\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-pattern\ \fR\fB\fIstring\fR\fR [\fB\-casesensitive\ \fR\fB\fIboolean\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] \fB\-only\ \fR\fB\fIboolean\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-usa\ \fR\fB\fIboolean\fR\fR \fB\-accession\ \fR\fB\fIboolean\fR\fR \fB\-name\ \fR\fB\fIboolean\fR\fR \fB\-description\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 11
+\fBtextsearch\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtextsearch\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Display,Information" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-pattern\fR \fIstring\fR
+.RS 4
+The search pattern is a regular expression. Use a | to indicate OR. For example: human|mouse will find text with either 'human' OR 'mouse' in the text
+.RE
+.SS "Additional section"
+.PP
+\fB\-casesensitive\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-only\fR \fIboolean\fR
+.RS 4
+This is a way of shortening the command line if you only want a few things to be displayed. Instead of specifying: '\-nohead \-noname \-nousa \-noacc \-nodesc' to get only the name output, you can specify '\-only \-name' Default value: N
+.RE
+.PP
+\fB\-heading\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-usa\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-accession\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-name\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-description\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+textsearch is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/tfextract.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/tfextract.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/tfextract.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,49 @@
+.\"     Title: TFEXTRACT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TFEXTRACT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+tfextract \- Extract data from TRANSFAC
+.SH "SYNOPSIS"
+.HP 10
+\fBtfextract\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR
+.HP 10
+\fBtfextract\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtfextract\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Utils:Database creation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+tfextract is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/tfm.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/tfm.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/tfm.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,66 @@
+.\"     Title: TFM
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TFM" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+tfm \- Displays a program's help documentation manual
+.SH "SYNOPSIS"
+.HP 4
+\fBtfm\fR \fB\-program\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] [\fB\-more\ \fR\fB\fIboolean\fR\fR]
+.HP 4
+\fBtfm\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtfm\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Information" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-program\fR \fIstring\fR
+.RS 4
+Enter the name of an EMBOSS program
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+This will format the output for displaying as a WWW document. Default value: N
+.RE
+.PP
+\fB\-more\fR \fIboolean\fR
+.RS 4
+This uses the standard UNIX utility 'more' to display the text page\-by\-page, waiting for you to read one screen\-full before going on to the next page. When you have finished reading a page, press the SPACE bar to proceed to the next page. Default value: @(!$(html))
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+tfm is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/tfscan.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/tfscan.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/tfscan.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,74 @@
+.\"     Title: TFSCAN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TFSCAN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+tfscan \- Scans DNA sequences for transcription factors
+.SH "SYNOPSIS"
+.HP 7
+\fBtfscan\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-menu\ \fR\fB\fIlist\fR\fR \fB\-custom\ \fR\fB\fIdatafile\fR\fR \fB\-mismatch\ \fR\fB\fIinteger\fR\fR [\fB\-minlength\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 7
+\fBtfscan\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtfscan\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Transcription" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-menu\fR \fIlist\fR
+.RS 4
+Default value: V
+.RE
+.PP
+\fB\-custom\fR \fIdatafile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-mismatch\fR \fIinteger\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-minlength\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+tfscan is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/tmap.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/tmap.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/tmap.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,59 @@
+.\"     Title: TMAP
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TMAP" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+tmap \- Displays membrane spanning regions
+.SH "SYNOPSIS"
+.HP 5
+\fBtmap\fR \fB\-sequences\ \fR\fB\fIseqset\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 5
+\fBtmap\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtmap\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Protein:2D Structure" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequences\fR \fIseqset\fR
+.RS 4
+File containing a sequence alignment
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+tmap is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/tranalign.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/tranalign.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/tranalign.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,63 @@
+.\"     Title: TRANALIGN
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TRANALIGN" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+tranalign \- Align nucleic coding regions given the aligned proteins
+.SH "SYNOPSIS"
+.HP 10
+\fBtranalign\fR \fB\-asequence\ \fR\fB\fIseqall\fR\fR \fB\-bsequence\ \fR\fB\fIseqset\fR\fR [\fB\-table\ \fR\fB\fIlist\fR\fR] \fB\-outseq\ \fR\fB\fIseqoutset\fR\fR
+.HP 10
+\fBtranalign\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtranalign\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Multiple" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIseqset\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-table\fR \fIlist\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutset\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+tranalign is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/transeq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/transeq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/transeq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,85 @@
+.\"     Title: TRANSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TRANSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+transeq \- Translate nucleic acid sequences
+.SH "SYNOPSIS"
+.HP 8
+\fBtranseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-frame\ \fR\fB\fIlist\fR\fR] [\fB\-table\ \fR\fB\fIlist\fR\fR] [\fB\-regions\ \fR\fB\fIrange\fR\fR] [\fB\-trim\ \fR\fB\fIboolean\fR\fR] [\fB\-clean\ \fR\fB\fIboolean\fR\fR] \fB\-alternative\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 8
+\fBtranseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtranseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Translation" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-frame\fR \fIlist\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-table\fR \fIlist\fR
+.RS 4
+.RE
+.PP
+\fB\-regions\fR \fIrange\fR
+.RS 4
+Regions to translate. If this is left blank, then the complete sequence is translated. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non\-digit, non\-alpha character. Examples of region specifications are: 24\-45, 56\-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 Note: you should not try to use this option with any other frame than the default, \-frame=1
+.RE
+.PP
+\fB\-trim\fR \fIboolean\fR
+.RS 4
+This removes all 'X' and '*' characters from the right end of the translation. The trimming process starts at the end and continues until the next character is not a 'X' or a '*' Default value: N
+.RE
+.PP
+\fB\-clean\fR \fIboolean\fR
+.RS 4
+This changes all STOP codon positions from the '*' character to 'X' (an unknown residue). This is useful because some programs will not accept protein sequences with '*' characters in them. Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-alternative\fR \fIboolean\fR
+.RS 4
+The default definition of frame '\-1' is the reverse\-complement of the set of codons used in frame 1. (Frame \-2 is the set of codons used by frame 2, similarly frames \-3 and 3). This is a common standard, used by the Staden package and other programs. If you prefer to define frame '\-1' as using the set of codons starting with the last codon of the sequence, then set this to be true. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+transeq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/treetypedisplay.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/treetypedisplay.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/treetypedisplay.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,49 @@
+.\"     Title: TREETYPEDISPLAY
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TREETYPEDISPLAY" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+treetypedisplay \- Test of graphics
+.SH "SYNOPSIS"
+.HP 16
+\fBtreetypedisplay\fR \fB\-graph\ \fR\fB\fIgraph\fR\fR
+.HP 16
+\fBtreetypedisplay\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtreetypedisplay\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Test" command group(s).
+.SH "OPTIONS"
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIgraph\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+treetypedisplay is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/trimest.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/trimest.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/trimest.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,81 @@
+.\"     Title: TRIMEST
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TRIMEST" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+trimest \- Trim poly\-A tails off EST sequences
+.SH "SYNOPSIS"
+.HP 8
+\fBtrimest\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-minlength\ \fR\fB\fIinteger\fR\fR] [\fB\-mismatches\ \fR\fB\fIinteger\fR\fR] [\fB\-reverse\ \fR\fB\fIboolean\fR\fR] [\fB\-tolower\ \fR\fB\fItoggle\fR\fR] \fB\-fiveprime\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 8
+\fBtrimest\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtrimest\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-minlength\fR \fIinteger\fR
+.RS 4
+This is the minimum length that a poly\-A (or poly\-T) tail must have before it is removed. If there are mismatches in the tail than there must be at least this length of poly\-A tail before the mismatch for the mismatch to be considered part of the tail. Default value: 4
+.RE
+.PP
+\fB\-mismatches\fR \fIinteger\fR
+.RS 4
+If there are this number or fewer contiguous non\-A bases in a poly\-A tail then, if there are '\-minlength' 'A' bases before them, they will be considered part of the tail and removed . For example the terminal 4 A's of GCAGAAAA would be removed with the default values of \-minlength=4 and \-mismatches=1 (There are not at least 4 A's before the last 'G' and so only the A's after it are considered to be part of the tail). The terminal 9 bases of GCAAAAGAAAA would be removed; There are at least \-minlength A's preceeding the last 'G', so it is part of the tail. Default value: 1
+.RE
+.PP
+\fB\-reverse\fR \fIboolean\fR
+.RS 4
+When a poly\-T region at the 5' end of the sequence is found and removed, it is likely that the sequence is in the reverse sense. This option will change the sequence to the forward sense when it is written out. If this option is not set, then the sense will not be changed. Default value: Y
+.RE
+.PP
+\fB\-tolower\fR \fItoggle\fR
+.RS 4
+The poly\-A region can be 'masked' by converting the sequence characters to lower\-case. Some non\-EMBOSS programs e.g. fasta can interpret this as a masked region. The sequence is unchanged apart from the case change. You might like to ensure that the whole sequence is in upper\-case before masking the specified regions to lower\-case by using the '\-supper' sequence qualifier. Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-fiveprime\fR \fIboolean\fR
+.RS 4
+If this is set true, then the 5' end of teh sequence is inspected for poly\-T tails. These will be removed if they are longer than any 3' poly\-A tails. If this is false, then the 5' end is ignored. Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+trimest is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/trimseq.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/trimseq.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/trimseq.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,86 @@
+.\"     Title: TRIMSEQ
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TRIMSEQ" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+trimseq \- Trim ambiguous bits off the ends of sequences
+.SH "SYNOPSIS"
+.HP 8
+\fBtrimseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-window\ \fR\fB\fIinteger\fR\fR] [\fB\-percent\ \fR\fB\fIfloat\fR\fR] [\fB\-strict\ \fR\fB\fIboolean\fR\fR] [\fB\-star\ \fR\fB\fIboolean\fR\fR] \fB\-left\ \fR\fB\fIboolean\fR\fR \fB\-right\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 8
+\fBtrimseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtrimseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+This determines the size of the region that is considered when deciding whether the percentage of ambiguity is greater than the threshold. A value of 5 means that a region of 5 letters in the sequence is shifted along the sequence from the ends and trimming is done only if there is a greater or equal percentage of ambiguity than the threshold percentage. Default value: 1
+.RE
+.PP
+\fB\-percent\fR \fIfloat\fR
+.RS 4
+This is the threshold of the percentage ambiguity in the window required in order to trim a sequence. Default value: 100.0
+.RE
+.PP
+\fB\-strict\fR \fIboolean\fR
+.RS 4
+In nucleic sequences, trim off not only N's and X's, but also the nucleotide IUPAC ambiguity codes M, R, W, S, Y, K, V, H, D and B. In protein sequences, trim off not only X's but also B and Z. Default value: N
+.RE
+.PP
+\fB\-star\fR \fIboolean\fR
+.RS 4
+In protein sequences, trim off not only X's, but also the *'s Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-left\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-right\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+trimseq is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/twofeat.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/twofeat.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/twofeat.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,167 @@
+.\"     Title: TWOFEAT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "TWOFEAT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+twofeat \- Finds neighbouring pairs of features in sequences
+.SH "SYNOPSIS"
+.HP 8
+\fBtwofeat\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-asource\ \fR\fB\fIstring\fR\fR] \fB\-atype\ \fR\fB\fIstring\fR\fR [\fB\-asense\ \fR\fB\fIlist\fR\fR] [\fB\-aminscore\ \fR\fB\fIfloat\fR\fR] [\fB\-amaxscore\ \fR\fB\fIfloat\fR\fR] [\fB\-atag\ \fR\fB\fIstring\fR\fR] [\fB\-avalue\ \fR\fB\fIstring\fR\fR] [\fB\-bsource\ \fR\fB\fIstring\fR\fR] \fB\-btype\ \fR\fB\fIstring\fR\fR [\fB\-bsense\ \fR\fB\fIlist\fR\fR] [\fB\-bminscore\ \fR\fB\fIfloat\fR\fR] [\fB\-bmaxscore\ \fR\fB\fIfloat\fR\fR] [\fB\-btag\ \fR\fB\fIstring\fR\fR] [\fB\-bvalue\ \fR\fB\fIstring\fR\fR] [\fB\-overlap\ \fR\fB\fIlist\fR\fR] \fB\-minrange\ \fR\fB\fIinteger\fR\fR \fB\-maxrange\ \fR\fB\fIinteger\fR\fR [\fB\-rangetype\ \fR\fB\fIlist\fR\fR] [\fB\-sense\ \fR\fB\fIlist\fR\fR] [\fB\-order\ \fR\fB\fIlist\fR\fR] [\fB\-twoout\ \fR\fB\fItoggle\fR\fR] \fB\-typeout\ \fR\fB\fIstring\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP 8
+\fBtwofeat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtwofeat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Feature tables" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "First feature options"
+.PP
+\fB\-asource\fR \fIstring\fR
+.RS 4
+By default any feature source in the feature table is allowed. You can set this to match any feature source you wish to allow. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from. The source may be wildcarded by using '*'. If you wish to allow more than one source, separate their names with the character '|', eg: gene* | embl Default value: *
+.RE
+.PP
+\fB\-atype\fR \fIstring\fR
+.RS 4
+By default every feature in the feature table is allowed. You can set this to be any feature type you wish to allow. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to allow more than one type, separate their names with the character '|', eg: *UTR | intron Default value: *
+.RE
+.PP
+\fB\-asense\fR \fIlist\fR
+.RS 4
+By default any feature sense is allowed. You can set this to match the required sense.
+.RE
+.PP
+\fB\-aminscore\fR \fIfloat\fR
+.RS 4
+If this is greater than or equal to the maximum score, then any score is allowed. Default value: 0.0
+.RE
+.PP
+\fB\-amaxscore\fR \fIfloat\fR
+.RS 4
+If this is less than or equal to the maximum score, then any score is permitted. Default value: 0.0
+.RE
+.PP
+\fB\-atag\fR \fIstring\fR
+.RS 4
+Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default any feature tag in the feature table is allowed. You can set this to match any feature tag you wish to allow. The tag may be wildcarded by using '*'. If you wish to allow more than one tag, separate their names with the character '|', eg: gene | label Default value: *
+.RE
+.PP
+\fB\-avalue\fR \fIstring\fR
+.RS 4
+Tag values are the values associated with a feature tag. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Only some of these tags can have values, for example '/gene' can have the value of the gene name. By default any feature tag value in the feature table is allowed. You can set this to match any feature tag value you wish to allow. The tag value may be wildcarded by using '*'. If you wish to allow more than one tag value, separate their names with the character '|', eg: pax* | 10 Default value: *
+.RE
+.SS "Second feature options"
+.PP
+\fB\-bsource\fR \fIstring\fR
+.RS 4
+By default any feature source in the feature table is allowed. You can set this to match any feature source you wish to allow. The source name is usually either the name of the program that detected the feature or it is the feature table (eg: EMBL) that the feature came from. The source may be wildcarded by using '*'. If you wish to allow more than one source, separate their names with the character '|', eg: gene* | embl Default value: *
+.RE
+.PP
+\fB\-btype\fR \fIstring\fR
+.RS 4
+By default every feature in the feature table is allowed. You can set this to be any feature type you wish to allow. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to allow more than one type, separate their names with the character '|', eg: *UTR | intron Default value: *
+.RE
+.PP
+\fB\-bsense\fR \fIlist\fR
+.RS 4
+By default any feature sense is allowed. You can set this to match the required sense.
+.RE
+.PP
+\fB\-bminscore\fR \fIfloat\fR
+.RS 4
+If this is greater than or equal to the maximum score, then any score is allowed. Default value: 0.0
+.RE
+.PP
+\fB\-bmaxscore\fR \fIfloat\fR
+.RS 4
+If this is less than or equal to the maximum score, then any score is permitted. Default value: 0.0
+.RE
+.PP
+\fB\-btag\fR \fIstring\fR
+.RS 4
+Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Some of these tags also have values, for example '/gene' can have the value of the gene name. By default any feature tag in the feature table is allowed. You can set this to match any feature tag you wish to allow. The tag may be wildcarded by using '*'. If you wish to allow more than one tag, separate their names with the character '|', eg: gene | label Default value: *
+.RE
+.PP
+\fB\-bvalue\fR \fIstring\fR
+.RS 4
+Tag values are the values associated with a feature tag. Tags are the types of extra values that a feature may have. For example in the EMBL feature table, a 'CDS' type of feature may have the tags '/codon', '/codon_start', '/db_xref', '/EC_number', '/evidence', '/exception', '/function', '/gene', '/label', '/map', '/note', '/number', '/partial', '/product', '/protein_id', '/pseudo', '/standard_name', '/translation', '/transl_except', '/transl_table', or '/usedin'. Only some of these tags can have values, for example '/gene' can have the value of the gene name. By default any feature tag value in the feature table is allowed. You can set this to match any feature tag value you wish to allow. The tag value may be wildcarded by using '*'. If you wish to allow more than one tag value, separate their names with the character '|', eg: pax* | 10 Default value: *
+.RE
+.SS "Feature relation options"
+.PP
+\fB\-overlap\fR \fIlist\fR
+.RS 4
+This allows you to specify the allowed overlaps of the features A and B. You can allow any or no overlaps, specify that they must or must not overlap, that one must or must not be wholly enclosed within another feature. Default value: A
+.RE
+.PP
+\fB\-minrange\fR \fIinteger\fR
+.RS 4
+If this is greater or equal to 'maxrange', then no min or max range is specified
+.RE
+.PP
+\fB\-maxrange\fR \fIinteger\fR
+.RS 4
+If this is less than or equal to 'minrange', then no min or max range is specified
+.RE
+.PP
+\fB\-rangetype\fR \fIlist\fR
+.RS 4
+This allows you to specify the positions from which the allowed minimum or maximum distance between the features is measured Default value: N
+.RE
+.PP
+\fB\-sense\fR \fIlist\fR
+.RS 4
+This allows you to specify the required sense that the two features must be on. This is ignored (always 'Any') when looking at protein sequence features. Default value: A
+.RE
+.PP
+\fB\-order\fR \fIlist\fR
+.RS 4
+This allows you to specify the required order of the two features. The order is measured from the start positions of the features. This criterion is always applied despite the specified overlap type required. Default value: A
+.RE
+.SS "Output section"
+.PP
+\fB\-twoout\fR \fItoggle\fR
+.RS 4
+If you set this to be true, then the two features themselves will be written out. If it is left as false, then a single feature will be written out covering the two features you found. Default value: N
+.RE
+.PP
+\fB\-typeout\fR \fIstring\fR
+.RS 4
+If you have specified that the pairs of features that are found should be reported as one feature in the ouput, then you can specify the 'type' name of the new feature here. By default every feature in the feature table is allowed. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. If you specify an invalid feature type name, then the default name 'misc_feature' is used. Default value: misc_feature
+.RE
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+twofeat is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/union.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/union.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/union.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,74 @@
+.\"     Title: UNION
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "UNION" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+union \- Reads sequence fragments and builds one sequence
+.SH "SYNOPSIS"
+.HP 6
+\fBunion\fR \fB\-feature\ \fR\fB\fIboolean\fR\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-source\ \fR\fB\fIboolean\fR\fR \fB\-findoverlap\ \fR\fB\fIboolean\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR [\fB\-overlapfile\ \fR\fB\fIoutfile\fR\fR]
+.HP 6
+\fBunion\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBunion\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-feature\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Advanced section"
+.PP
+\fB\-source\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-findoverlap\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqout\fR
+.RS 4
+.RE
+.PP
+\fB\-overlapfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+union is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/vectorstrip.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/vectorstrip.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/vectorstrip.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,92 @@
+.\"     Title: VECTORSTRIP
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "VECTORSTRIP" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+vectorstrip \- Strips out DNA between a pair of vector sequences
+.SH "SYNOPSIS"
+.HP 12
+\fBvectorstrip\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-vectorfile\ \fR\fB\fItoggle\fR\fR \fB\-vectorsfile\ \fR\fB\fIinfile\fR\fR \fB\-mismatch\ \fR\fB\fIinteger\fR\fR \fB\-besthits\ \fR\fB\fIboolean\fR\fR \fB\-linkera\ \fR\fB\fIstring\fR\fR \fB\-linkerb\ \fR\fB\fIstring\fR\fR [\fB\-allsequences\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP 12
+\fBvectorstrip\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBvectorstrip\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Vector input options"
+.PP
+\fB\-vectorfile\fR \fItoggle\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-vectorsfile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-mismatch\fR \fIinteger\fR
+.RS 4
+Default value: 10
+.RE
+.PP
+\fB\-besthits\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-linkera\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-linkerb\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-allsequences\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+vectorstrip is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/water.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/water.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/water.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,79 @@
+.\"     Title: WATER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "WATER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+water \- Smith\-Waterman local alignment.
+.SH "SYNOPSIS"
+.HP 6
+\fBwater\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIseqall\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR \fB\-brief\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR
+.HP 6
+\fBwater\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwater\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Local" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fImatrixf\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Required section"
+.PP
+\fB\-gapopen\fR \fIfloat\fR
+.RS 4
+The gap open penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. Default value: @($(acdprotein)? 10.0 : 10.0)
+.RE
+.PP
+\fB\-gapextend\fR \fIfloat\fR
+.RS 4
+The gap extension penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. Default value: @($(acdprotein)? 0.5 : 0.5)
+.RE
+.SS "Output section"
+.PP
+\fB\-brief\fR \fIboolean\fR
+.RS 4
+Brief identity and similarity Default value: Y
+.RE
+.PP
+\fB\-outfile\fR \fIalign\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+water is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/whichdb.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/whichdb.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/whichdb.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,64 @@
+.\"     Title: WHICHDB
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "WHICHDB" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+whichdb \- Search all databases for an entry
+.SH "SYNOPSIS"
+.HP 8
+\fBwhichdb\fR \fB\-entry\ \fR\fB\fIstring\fR\fR \fB\-get\ \fR\fB\fItoggle\fR\fR \fB\-showall\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 8
+\fBwhichdb\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwhichdb\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Information" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-entry\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-get\fR \fItoggle\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-showall\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+whichdb is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/wobble.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/wobble.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/wobble.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,70 @@
+.\"     Title: WOBBLE
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "WOBBLE" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+wobble \- Wobble base plot
+.SH "SYNOPSIS"
+.HP 7
+\fBwobble\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR [\fB\-window\ \fR\fB\fIinteger\fR\fR] \fB\-bases\ \fR\fB\fIstring\fR\fR \fB\-graph\ \fR\fB\fIxygraph\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 7
+\fBwobble\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwobble\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Gene finding" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-window\fR \fIinteger\fR
+.RS 4
+Default value: 30
+.RE
+.SS "Advanced section"
+.PP
+\fB\-bases\fR \fIstring\fR
+.RS 4
+Default value: GC
+.RE
+.SS "Output section"
+.PP
+\fB\-graph\fR \fIxygraph\fR
+.RS 4
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+wobble is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/wordcount.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/wordcount.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/wordcount.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,66 @@
+.\"     Title: WORDCOUNT
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "WORDCOUNT" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+wordcount \- Counts words of a specified size in a DNA sequence
+.SH "SYNOPSIS"
+.HP 10
+\fBwordcount\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR [\fB\-mincount\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 10
+\fBwordcount\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwordcount\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Nucleic:Composition" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-wordsize\fR \fIinteger\fR
+.RS 4
+Default value: 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-mincount\fR \fIinteger\fR
+.RS 4
+Default value: 1
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+wordcount is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/wordfinder.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/wordfinder.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/wordfinder.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,106 @@
+.\"     Title: WORDFINDER
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "WORDFINDER" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+wordfinder \- Match large sequences against one or more other sequences
+.SH "SYNOPSIS"
+.HP 11
+\fBwordfinder\fR \fB\-asequence\ \fR\fB\fIseqset\fR\fR \fB\-bsequence\ \fR\fB\fIseqall\fR\fR [\fB\-datafile\ \fR\fB\fImatrixf\fR\fR] \fB\-gapopen\ \fR\fB\fIfloat\fR\fR \fB\-gapextend\ \fR\fB\fIfloat\fR\fR [\fB\-width\ \fR\fB\fIinteger\fR\fR] [\fB\-wordlen\ \fR\fB\fIinteger\fR\fR] [\fB\-limitmatch\ \fR\fB\fIinteger\fR\fR] [\fB\-limitalign\ \fR\fB\fIinteger\fR\fR] [\fB\-lowmatch\ \fR\fB\fIinteger\fR\fR] [\fB\-lowalign\ \fR\fB\fIinteger\fR\fR] \fB\-outfile\ \fR\fB\fIalign\fR\fR [\fB\-errorfile\ \fR\fB\fIoutfile\fR\fR]
+.HP 11
+\fBwordfinder\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwordfinder\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Local" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIseqset\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-datafile\fR \fImatrixf\fR
+.RS 4
+This is the scoring matrix file used when comparing sequences. By default it is the file 'EBLOSUM62' (for proteins) or the file 'EDNAFULL' (for nucleic sequences). These files are found in the 'data' directory of the EMBOSS installation.
+.RE
+.SS "Required section"
+.PP
+\fB\-gapopen\fR \fIfloat\fR
+.RS 4
+Default value: @($(acdprotein)? 30.0 : 30.0)
+.RE
+.PP
+\fB\-gapextend\fR \fIfloat\fR
+.RS 4
+Default value: @($(acdprotein)? 1.5 : 1.5)
+.RE
+.SS "Additional section"
+.PP
+\fB\-width\fR \fIinteger\fR
+.RS 4
+Default value: 16
+.RE
+.PP
+\fB\-wordlen\fR \fIinteger\fR
+.RS 4
+Default value: 6
+.RE
+.PP
+\fB\-limitmatch\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-limitalign\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-lowmatch\fR \fIinteger\fR
+.RS 4
+.RE
+.PP
+\fB\-lowalign\fR \fIinteger\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIalign\fR
+.RS 4
+.RE
+.PP
+\fB\-errorfile\fR \fIoutfile\fR
+.RS 4
+Error file to be written to Default value: wordfinder.error
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+wordfinder is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/wordmatch.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/wordmatch.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/wordmatch.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,72 @@
+.\"     Title: WORDMATCH
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "WORDMATCH" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+wordmatch \- Finds all exact matches of a given size between 2 sequences
+.SH "SYNOPSIS"
+.HP 10
+\fBwordmatch\fR \fB\-asequence\ \fR\fB\fIsequence\fR\fR \fB\-bsequence\ \fR\fB\fIsequence\fR\fR \fB\-wordsize\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIalign\fR\fR \fB\-aoutfeat\ \fR\fB\fIfeatout\fR\fR \fB\-boutfeat\ \fR\fB\fIfeatout\fR\fR
+.HP 10
+\fBwordmatch\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwordmatch\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Alignment:Local" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-asequence\fR \fIsequence\fR
+.RS 4
+.RE
+.PP
+\fB\-bsequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-wordsize\fR \fIinteger\fR
+.RS 4
+Default value: 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIalign\fR
+.RS 4
+.RE
+.PP
+\fB\-aoutfeat\fR \fIfeatout\fR
+.RS 4
+.RE
+.PP
+\fB\-boutfeat\fR \fIfeatout\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+wordmatch is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/wossname.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/wossname.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/wossname.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,114 @@
+.\"     Title: WOSSNAME
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "WOSSNAME" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+wossname \- Finds programs by keywords in their one\-line documentation
+.SH "SYNOPSIS"
+.HP 9
+\fBwossname\fR \fB\-search\ \fR\fB\fIstring\fR\fR [\fB\-explode\ \fR\fB\fIboolean\fR\fR] [\fB\-allmatch\ \fR\fB\fIboolean\fR\fR] [\fB\-showkeywords\ \fR\fB\fIboolean\fR\fR] \fB\-emboss\ \fR\fB\fIboolean\fR\fR \fB\-embassy\ \fR\fB\fIboolean\fR\fR \fB\-showembassy\ \fR\fB\fIstring\fR\fR \fB\-colon\ \fR\fB\fIboolean\fR\fR \fB\-gui\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fItoggle\fR\fR] [\fB\-groups\ \fR\fB\fIboolean\fR\fR] [\fB\-alphabetic\ \fR\fB\fIboolean\fR\fR]
+.HP 9
+\fBwossname\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwossname\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Information" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-search\fR \fIstring\fR
+.RS 4
+Enter a word or words here and a case\-independent search for it will be made in the one\-line documentation, group names and keywords of all of the EMBOSS programs. If no keyword is specified, all programs will be listed.
+.RE
+.SS "Additional section"
+.PP
+\fB\-explode\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to have two forms, exploded and not exploded. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: 'NAME1', 'NAME2', 'NAME1 NAME2', NAME2 NAME1'. The non\-expanded names are simply like: 'NAME1 NAME2'. Default value: N
+.RE
+.PP
+\fB\-allmatch\fR \fIboolean\fR
+.RS 4
+By default, all words in the search string must match. This option searches for a match to any word in a list of possibilities Default value: Y
+.RE
+.PP
+\fB\-showkeywords\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-emboss\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBOSS program documentation will be searched. If this option is set to be false, then only the EMBASSY programs will be searched (if the \-embassy option is true). EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-embassy\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBASSY program documentation will be searched. If this option is set to be false, then only the EMBOSS programs will be searched (if the \-emboss option is true). EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-showembassy\fR \fIstring\fR
+.RS 4
+If you use this option then this EMBASSY package program documentation will be searched. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme
+.RE
+.PP
+\fB\-colon\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to up to two levels, for example the primary group 'ALIGNMENT' has several sub\-groups, or second\-level groups, e.g.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE. To aid programs that parse the output of wossname that require the names of these subgroups, a colon ':' will be placed between the first and second level of the group name if this option is true. Note: This does not apply if the group names have been exploded with the 'explode' option. Default value: N
+.RE
+.PP
+\fB\-gui\fR \fIboolean\fR
+.RS 4
+This option is intended to help those who are designing Graphical User Interfaces to the EMBOSS applications. Some EMBOSS programs are inappropriate for running in a GUI, these include other menu programs and interactive editors. This option allows you to only report those programs that can be run from a GUI Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fItoggle\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document. Default value: N
+.RE
+.PP
+\fB\-groups\fR \fIboolean\fR
+.RS 4
+If you use this option, then only the group names will output to the file Default value: N
+.RE
+.PP
+\fB\-alphabetic\fR \fIboolean\fR
+.RS 4
+If you use this option, then you will get a single list of the program names and descriptions instead of the programs being listed in their functional groups. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+wossname is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/manpages/yank.1e
===================================================================
--- trunk/packages/emboss/trunk/debian/manpages/yank.1e	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/manpages/yank.1e	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,59 @@
+.\"     Title: YANK
+.\"    Author: Debian EMBOSS Packaging Team <pkg-emboss-devel at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.72.0 <http://docbook.sf.net/>
+.\"      Date: 10/11/2007
+.\"    Manual: EMBOSS Manual for Debian
+.\"    Source: EMBOSS 5.0.0
+.\"
+.TH "YANK" "1e" "10/11/2007" "EMBOSS 5.0.0" "EMBOSS Manual for Debian"
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.SH "NAME"
+yank \- Reads a sequence range, appends the full USA to a list file
+.SH "SYNOPSIS"
+.HP 5
+\fByank\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-newfile\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP 5
+\fByank\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fByank\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq). It is part of the "Edit" command group(s).
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-newfile\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs.debian.org/emboss), or directly to the EMBOSS developers (http://sourceforge.net/tracker/?group_id=93650&atid=605031).
+.SH "SEE ALSO"
+.PP
+yank is fully documented via the
+\fBtfm\fR(1)
+system.
+.SH "AUTHOR"
+.PP
+\fBDebian EMBOSS Packaging Team\fR <\&pkg\-emboss\-devel at lists.alioth.debian.org\&>
+.sp -1n
+.IP "" 4
+Wrote the script used to autogenerate this manual page.
+.SH "COPYRIGHT"
+Copyright \(co 2007 Debian EMBOSS Packaging Team
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package. It can be redistributed under the same terms as EMBOSS itself.
+.br

Added: trunk/packages/emboss/trunk/debian/patches/ajindex-fix-2008-01-09.patch
===================================================================
--- trunk/packages/emboss/trunk/debian/patches/ajindex-fix-2008-01-09.patch	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/patches/ajindex-fix-2008-01-09.patch	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,36 @@
+Fixes rare secondary index problem with input files over 2Gb.
+--- a/ajax/ajindex.c
++++ b/ajax/ajindex.c
+@@ -2516,7 +2516,14 @@
+ 
+ static ajint btreeNumIdCompare(const void *a, const void *b)
+ {
+-    return (*(AjPBtNumId const *)a)->offset - (*(AjPBtNumId const *)b)->offset;
++  ajlong val;
++
++    val = (*(AjPBtNumId const *)a)->offset - (*(AjPBtNumId const *)b)->offset;
++
++    if(!val)
++      return 0;
++
++    return (val < 0L) ? -1 : 1;
+ }
+ 
+ 
+@@ -11956,8 +11963,14 @@
+ 
+ static ajint btreeOffsetCompare(const void *a, const void *b)
+ {
+-    return (*(AjPBtId const *)a)->offset -
+-		  (*(AjPBtId const *)b)->offset;
++  ajlong val;
++
++    val = (*(AjPBtId const *)a)->offset - (*(AjPBtId const *)b)->offset;
++
++    if(!val)
++      return 0;
++
++    return (val < 0L) ? -1 : 1;
+ }
+ 
+ 

Added: trunk/packages/emboss/trunk/debian/patches/psiphi-fix-2007-07-27.patch
===================================================================
--- trunk/packages/emboss/trunk/debian/patches/psiphi-fix-2007-07-27.patch	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/patches/psiphi-fix-2007-07-27.patch	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,25 @@
+Fixes a problem with reading more recent CCF files.
+Error traps cases where chains have no atom information.
+Index: EMBOSS-5.0.0/emboss/psiphi.c
+===================================================================
+--- EMBOSS-5.0.0.orig/emboss/psiphi.c
++++ EMBOSS-5.0.0/emboss/psiphi.c
+@@ -160,7 +160,7 @@
+     finishres = ajAcdGetInt("finishresiduenumber");
+ 
+     /* reserve memory for and read in structure */
+-    /* JISON */    pdb = ajPdbReadoldNew(pdbfile);
++    /* JISON */    pdb = ajPdbReadNew(pdbfile,0);
+     
+     /* check and set number of chain to be analysed */
+     highest = pdb->Nchn;
+@@ -440,6 +440,9 @@
+     ajint lowestres = 0;
+ 
+     AjPAtom inlist   = NULL;
++
++    if(!ajListGetLength(pdb->Chains[myindex]->Atoms))
++	ajFatal("Chain %d has no atoms",myindex+1);
+     
+     /* read first atom in list into memory, but keep it on list */
+     ajListPeek(pdb->Chains[myindex]->Atoms,

Added: trunk/packages/emboss/trunk/debian/patches/series
===================================================================
--- trunk/packages/emboss/trunk/debian/patches/series	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/patches/series	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,2 @@
+psiphi-fix-2007-07-27.patch
+ajindex-fix-2008-01-09.patch

Added: trunk/packages/emboss/trunk/debian/rules
===================================================================
--- trunk/packages/emboss/trunk/debian/rules	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/rules	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,142 @@
+#!/usr/bin/make -f
+
+#export DH_VERBOSE=1
+
+VERSION := $(shell dpkg-parsechangelog | grep Ver | cut -d' ' -f2 | cut -d- -f1)
+RENAMED := cons pscan
+
+EMBOSS-TMP = $(CURDIR)/debian/emboss_tmp
+AJAX = $(CURDIR)/debian/libajax5
+NUCLEUS = $(CURDIR)/debian/libnucleus5
+
+config.status:
+	dh_testdir
+	./configure \
+		--prefix=/usr \
+		#--with-java=/usr/lib/j2sdk1.3/include \
+		#--with-javaos=/usr/lib/j2sdk1.3/include/linux \
+		#--with-x \
+
+include /usr/share/quilt/quilt.make
+
+build: patch build-stamp debian/copyright
+build-stamp: config.status
+	dh_testdir
+	$(MAKE)
+
+# In order to use this rule you must install libemboss-acd-perl, xsltproc, docbook-xml and docbook-xsl
+manpages: debian/manpages/success
+debian/manpages/success:
+	if [ -f debian/emboss.manpages ] ; then rm debian/emboss.manpages ; fi
+	rm -f debian/manpages/*.1e debian/manpages/*.xml
+	for acd in $(shell ls emboss/acd/*acd | sed -r 's#.*/.*/(.+).acd#\1#'); \
+		do perl debian/acd2docbook.pl emboss/acd/$$acd.acd $(VERSION) > debian/manpages/$$acd.xml ;\
+		xsltproc --nonet --param man.charmap.use.subset 0 -o debian/manpages/ debian/manpages/$$acd.xml ;\
+		echo "debian/manpages/$$acd.1e" >> debian/emboss.manpages ;\
+		done
+	echo "The manpages have been sucessfully built" > debian/manpages/success
+
+debian/copyright:
+	cat debian/copyright.introduction > $@
+	cat "AUTHORS" >> $@
+	cat "THANKS" >> $@
+
+clean: unpatch config.status
+	dh_testdir
+	dh_testroot
+	$(MAKE) distclean
+
+	find jemboss/ -type f -name "*.class" | xargs -r rm -f
+
+	rm -rf ajax/.libs/*
+	rm -rf emboss/.libs/*
+	rm -rf plplot/.libs/*
+	rm -rf nucleus/.libs/*
+
+	rm -rf debian/emboss_tmp
+
+	rm -rf config.status install-stamp
+	dh_clean debian/copyright
+
+install: install-stamp
+install-stamp: build-stamp
+	dh_testdir
+	dh_testroot
+	dh_clean -k
+	dh_installdirs
+
+	### Binaries and data go to a temporary dir before being moved to their own package ###
+	$(MAKE) -C emboss install DESTDIR=$(EMBOSS-TMP)
+
+	### Binaries will be in /usr/lib/emboss, and symlinks are provided in /usr/bin. ###
+	if [ ! -d $(EMBOSS-TMP)/usr/lib/emboss ] ; \
+		then mkdir -p $(EMBOSS-TMP)/usr/lib/emboss ; \
+		fi
+	mv $(EMBOSS-TMP)/usr/bin/* $(EMBOSS-TMP)/usr/lib/emboss
+	cd $(EMBOSS-TMP)/usr/lib/emboss/ ; \
+		for i in * ; \
+		do ln -sf ../lib/emboss/$$i ../../bin/$$i ; \
+		done
+
+	### Renaming conflicting binaries (see also in binary-arch) ###
+	for i in $(RENAMED) ; \
+		do mv $(EMBOSS-TMP)/usr/bin/$$i $(EMBOSS-TMP)/usr/bin/em_$$i ; \
+		done
+
+	### Ajax library: lib and libdevel packages. ###
+	$(MAKE) -C ajax install DESTDIR=$(AJAX)
+#	rm $(AJAX)/usr/include/pcre*	# Not very elegant way to solve the conflict with libpcre-dev
+	mv $(AJAX)/usr/include 		$(AJAX)-dev/usr/include/ajax
+	mv $(AJAX)/usr/lib/*a $(AJAX)/usr/lib/*so 	$(AJAX)-dev/usr/lib
+
+	### Nuleus library: lib and libdevel packages. ###
+	$(MAKE) -C nucleus install DESTDIR=$(NUCLEUS)
+	mv $(NUCLEUS)/usr/include 	$(NUCLEUS)-dev/usr/include/nucleus
+	mv $(NUCLEUS)/usr/lib/*a $(NUCLEUS)/usr/lib/*so	$(NUCLEUS)-dev/usr/lib
+
+	### eplplot goes in emboss-lib, but lets'hope building on plplot some day. ###
+	$(MAKE) -C plplot install DESTDIR=$(CURDIR)/debian/emboss-lib
+
+	### Documentation goes in emboss-doc. ###
+	$(MAKE) -C doc install DESTDIR=$(CURDIR)/debian/emboss-doc
+	antiword $(CURDIR)/debian/emboss-doc/usr/share/EMBOSS/doc/manuals/domainatrix.doc > $(CURDIR)/debian/emboss-doc/usr/share/EMBOSS/doc/manuals/domainatrix.txt
+	# Remove this file when the relicenced file becomes part of the upstream tarball.
+	uudecode -o $(CURDIR)/debian/emboss-doc/usr/share/EMBOSS/doc/manuals/EMBOSS_qg.pdf $(CURDIR)/debian/EMBOSS_qg_new.pdf.uu
+
+	### Java is disabled until it becomes understandable. ###
+	#$(MAKE) -C jemboss install prefix=$(CURDIR)/debian/emboss-java/usr
+	# dangling LICEN[CS]E FILE
+	#-rm -f $(CURDIR)/debian/emboss-java/usr/share/EMBOSS/jemboss/LICENSE
+
+	dh_makeshlibs	# Should it be invoked now ?
+
+	touch install-stamp
+
+binary-indep:
+
+binary-arch: build install
+	dh_testdir
+	dh_testroot
+	dh_installchangelogs ChangeLog
+	dh_installdocs
+#	dh_installmenu
+	dh_install
+	
+	# Install the manpages and provide a symlink for the renamed binaries.
+	dh_installman -p emboss
+	for i in $(RENAMED) ; \
+		do dh_link usr/share/man/man1/$$i.1.gz usr/share/man/man1/em_$$i.1.gz ; \
+		done
+	
+	dh_strip
+	dh_compress
+	dh_fixperms
+	dh_makeshlibs
+	dh_installdeb
+	dh_shlibdeps
+	dh_gencontrol
+	dh_md5sums
+	dh_builddeb -- -Z bzip2
+
+binary: binary-indep binary-arch
+.PHONY: build clean binary-indep binary-arch binary


Property changes on: trunk/packages/emboss/trunk/debian/rules
___________________________________________________________________
Name: svn:executable
   + *

Added: trunk/packages/emboss/trunk/debian/watch
===================================================================
--- trunk/packages/emboss/trunk/debian/watch	                        (rev 0)
+++ trunk/packages/emboss/trunk/debian/watch	2008-01-10 05:26:47 UTC (rev 1088)
@@ -0,0 +1,2 @@
+version=3
+ftp://emboss.open-bio.org/pub/EMBOSS/EMBOSS-([\d.]*)\.tar\.gz

Modified: trunk/packages/emboss/trunk/test/gb/Makefile
===================================================================
--- trunk/packages/emboss/trunk/test/gb/Makefile	2008-01-10 05:26:06 UTC (rev 1087)
+++ trunk/packages/emboss/trunk/test/gb/Makefile	2008-01-10 05:26:47 UTC (rev 1088)
@@ -29,8 +29,8 @@
 NORMAL_UNINSTALL = :
 PRE_UNINSTALL = :
 POST_UNINSTALL = :
-build_triplet = x86_64-unknown-linux-gnu
-host_triplet = x86_64-unknown-linux-gnu
+build_triplet = i686-pc-linux-gnu
+host_triplet = i686-pc-linux-gnu
 subdir = test/gb
 DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in
 ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
@@ -56,17 +56,17 @@
 DATA = $(pkgdata_DATA)
 DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
 pkgdatadir = $(prefix)/share/$(PACKAGE)/test/gb
-ACLOCAL = ${SHELL} /m2/emboss/emboss/missing --run aclocal-1.10
-AJAX_FIXED_ROOT = \"/m2/emboss/emboss/emboss\"
-AMTAR = ${SHELL} /m2/emboss/emboss/missing --run tar
+ACLOCAL = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run aclocal-1.10
+AJAX_FIXED_ROOT = \"/home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/emboss\"
+AMTAR = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run tar
 AR = ar
-AUTOCONF = ${SHELL} /m2/emboss/emboss/missing --run autoconf
-AUTOHEADER = ${SHELL} /m2/emboss/emboss/missing --run autoheader
-AUTOMAKE = ${SHELL} /m2/emboss/emboss/missing --run automake-1.10
+AUTOCONF = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run autoconf
+AUTOHEADER = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run autoheader
+AUTOMAKE = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run automake-1.10
 AWK = gawk
 CC = gcc
 CCDEPMODE = depmode=gcc3
-CFLAGS =   -O2 -D__amd64__
+CFLAGS =   -O2
 CPP = gcc -E
 CPPFLAGS = -DAJ_LinuxLF -D_FILE_OFFSET_BITS=64 -D_LARGEFILE_SOURCE -D_LARGEFILE64_SOURCE  -DLENDIAN -DNO_AUTH
 CXX = g++
@@ -81,9 +81,9 @@
 ECHO_N = -n
 ECHO_T = 
 EGREP = /bin/grep -E
-EMBOSS_TOP = /m2/emboss/emboss
+EMBOSS_TOP = /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0
 EXEEXT = 
-F77 = gfortran
+F77 = g77
 FFLAGS = -g -O2
 GREP = /bin/grep
 HAVE_MEMMOVE = 
@@ -102,7 +102,7 @@
 LIBTOOL = $(SHELL) $(top_builddir)/libtool
 LN_S = ln -s
 LTLIBOBJS = 
-MAKEINFO = ${SHELL} /m2/emboss/emboss/missing --run makeinfo
+MAKEINFO = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run makeinfo
 MKDIR_P = /bin/mkdir -p
 NEEDAJAX = 
 OBJEXT = o
@@ -126,30 +126,30 @@
 SHELL = /bin/sh
 STRIP = strip
 VERSION = 5.0.0
-XLIB =  -L/usr/lib64 -lX11 
+XLIB =  -lX11 
 XMKMF = 
 X_CFLAGS = 
 X_EXTRA_LIBS = 
-X_LIBS =  -L/usr/lib64
+X_LIBS = 
 X_PRE_LIBS =  -lSM -lICE
-abs_builddir = /m2/emboss/emboss/test/gb
-abs_srcdir = /m2/emboss/emboss/test/gb
-abs_top_builddir = /m2/emboss/emboss
-abs_top_srcdir = /m2/emboss/emboss
+abs_builddir = /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/test/gb
+abs_srcdir = /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/test/gb
+abs_top_builddir = /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0
+abs_top_srcdir = /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0
 ac_ct_CC = gcc
 ac_ct_CXX = g++
-ac_ct_F77 = gfortran
+ac_ct_F77 = g77
 am__include = include
 am__leading_dot = .
 am__quote = 
 am__tar = ${AMTAR} chof - "$$tardir"
 am__untar = ${AMTAR} xf -
 bindir = ${exec_prefix}/bin
-build = x86_64-unknown-linux-gnu
+build = i686-pc-linux-gnu
 build_alias = 
-build_cpu = x86_64
+build_cpu = i686
 build_os = linux-gnu
-build_vendor = unknown
+build_vendor = pc
 builddir = .
 datadir = ${datarootdir}
 datarootdir = ${prefix}/share
@@ -157,15 +157,15 @@
 dvidir = ${docdir}
 exec_prefix = ${prefix}
 havejavac = 
-host = x86_64-unknown-linux-gnu
+host = i686-pc-linux-gnu
 host_alias = 
-host_cpu = x86_64
+host_cpu = i686
 host_os = linux-gnu
-host_vendor = unknown
+host_vendor = pc
 htmldir = ${docdir}
 includedir = ${prefix}/include
 infodir = ${datarootdir}/info
-install_sh = $(SHELL) /m2/emboss/emboss/install-sh
+install_sh = $(SHELL) /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/install-sh
 libdir = ${exec_prefix}/lib
 libexecdir = ${exec_prefix}/libexec
 localedir = ${datarootdir}/locale
@@ -174,7 +174,7 @@
 mkdir_p = /bin/mkdir -p
 oldincludedir = /usr/include
 pdfdir = ${docdir}
-prefix = /usr/local
+prefix = /usr
 program_transform_name = s,x,x,
 psdir = ${docdir}
 sbindir = ${exec_prefix}/sbin

Modified: trunk/packages/emboss/trunk/test/wormpep/Makefile
===================================================================
--- trunk/packages/emboss/trunk/test/wormpep/Makefile	2008-01-10 05:26:06 UTC (rev 1087)
+++ trunk/packages/emboss/trunk/test/wormpep/Makefile	2008-01-10 05:26:47 UTC (rev 1088)
@@ -29,8 +29,8 @@
 NORMAL_UNINSTALL = :
 PRE_UNINSTALL = :
 POST_UNINSTALL = :
-build_triplet = x86_64-unknown-linux-gnu
-host_triplet = x86_64-unknown-linux-gnu
+build_triplet = i686-pc-linux-gnu
+host_triplet = i686-pc-linux-gnu
 subdir = test/wormpep
 DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in
 ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
@@ -56,17 +56,17 @@
 DATA = $(pkgdata_DATA)
 DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
 pkgdatadir = $(prefix)/share/$(PACKAGE)/test/wormpep
-ACLOCAL = ${SHELL} /m2/emboss/emboss/missing --run aclocal-1.10
-AJAX_FIXED_ROOT = \"/m2/emboss/emboss/emboss\"
-AMTAR = ${SHELL} /m2/emboss/emboss/missing --run tar
+ACLOCAL = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run aclocal-1.10
+AJAX_FIXED_ROOT = \"/home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/emboss\"
+AMTAR = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run tar
 AR = ar
-AUTOCONF = ${SHELL} /m2/emboss/emboss/missing --run autoconf
-AUTOHEADER = ${SHELL} /m2/emboss/emboss/missing --run autoheader
-AUTOMAKE = ${SHELL} /m2/emboss/emboss/missing --run automake-1.10
+AUTOCONF = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run autoconf
+AUTOHEADER = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run autoheader
+AUTOMAKE = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run automake-1.10
 AWK = gawk
 CC = gcc
 CCDEPMODE = depmode=gcc3
-CFLAGS =   -O2 -D__amd64__
+CFLAGS =   -O2
 CPP = gcc -E
 CPPFLAGS = -DAJ_LinuxLF -D_FILE_OFFSET_BITS=64 -D_LARGEFILE_SOURCE -D_LARGEFILE64_SOURCE  -DLENDIAN -DNO_AUTH
 CXX = g++
@@ -81,9 +81,9 @@
 ECHO_N = -n
 ECHO_T = 
 EGREP = /bin/grep -E
-EMBOSS_TOP = /m2/emboss/emboss
+EMBOSS_TOP = /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0
 EXEEXT = 
-F77 = gfortran
+F77 = g77
 FFLAGS = -g -O2
 GREP = /bin/grep
 HAVE_MEMMOVE = 
@@ -102,7 +102,7 @@
 LIBTOOL = $(SHELL) $(top_builddir)/libtool
 LN_S = ln -s
 LTLIBOBJS = 
-MAKEINFO = ${SHELL} /m2/emboss/emboss/missing --run makeinfo
+MAKEINFO = ${SHELL} /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/missing --run makeinfo
 MKDIR_P = /bin/mkdir -p
 NEEDAJAX = 
 OBJEXT = o
@@ -126,30 +126,30 @@
 SHELL = /bin/sh
 STRIP = strip
 VERSION = 5.0.0
-XLIB =  -L/usr/lib64 -lX11 
+XLIB =  -lX11 
 XMKMF = 
 X_CFLAGS = 
 X_EXTRA_LIBS = 
-X_LIBS =  -L/usr/lib64
+X_LIBS = 
 X_PRE_LIBS =  -lSM -lICE
-abs_builddir = /m2/emboss/emboss/test/wormpep
-abs_srcdir = /m2/emboss/emboss/test/wormpep
-abs_top_builddir = /m2/emboss/emboss
-abs_top_srcdir = /m2/emboss/emboss
+abs_builddir = /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/test/wormpep
+abs_srcdir = /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/test/wormpep
+abs_top_builddir = /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0
+abs_top_srcdir = /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0
 ac_ct_CC = gcc
 ac_ct_CXX = g++
-ac_ct_F77 = gfortran
+ac_ct_F77 = g77
 am__include = include
 am__leading_dot = .
 am__quote = 
 am__tar = ${AMTAR} chof - "$$tardir"
 am__untar = ${AMTAR} xf -
 bindir = ${exec_prefix}/bin
-build = x86_64-unknown-linux-gnu
+build = i686-pc-linux-gnu
 build_alias = 
-build_cpu = x86_64
+build_cpu = i686
 build_os = linux-gnu
-build_vendor = unknown
+build_vendor = pc
 builddir = .
 datadir = ${datarootdir}
 datarootdir = ${prefix}/share
@@ -157,15 +157,15 @@
 dvidir = ${docdir}
 exec_prefix = ${prefix}
 havejavac = 
-host = x86_64-unknown-linux-gnu
+host = i686-pc-linux-gnu
 host_alias = 
-host_cpu = x86_64
+host_cpu = i686
 host_os = linux-gnu
-host_vendor = unknown
+host_vendor = pc
 htmldir = ${docdir}
 includedir = ${prefix}/include
 infodir = ${datarootdir}/info
-install_sh = $(SHELL) /m2/emboss/emboss/install-sh
+install_sh = $(SHELL) /home/charles/debian/pkg-emboss/emboss/build-area/tmp.pHflC16796/unpdir/emboss-5.0.0/install-sh
 libdir = ${exec_prefix}/lib
 libexecdir = ${exec_prefix}/libexec
 localedir = ${datarootdir}/locale
@@ -174,7 +174,7 @@
 mkdir_p = /bin/mkdir -p
 oldincludedir = /usr/include
 pdfdir = ${docdir}
-prefix = /usr/local
+prefix = /usr
 program_transform_name = s,x,x,
 psdir = ${docdir}
 sbindir = ${exec_prefix}/sbin

More information about the debian-med-commit mailing list