[med-svn] [SCM] emboss branch, master, updated. debian/6.3.1-6-19-g1dd0d58
Charles Plessy
plessy at debian.org
Fri May 11 05:28:57 UTC 2012
The following commit has been merged in the master branch:
commit daba12cd7a44ed0f1c48560425ac0e87a0ff17d2
Author: Charles Plessy <plessy at debian.org>
Date: Fri May 11 14:23:12 2012 +0900
Updated or added manpages. emboss/acd/template.acd was left aside.
diff --git a/debian/emboss.manpages b/debian/emboss.manpages
index ec99dc3..d00a4fd 100644
--- a/debian/emboss.manpages
+++ b/debian/emboss.manpages
@@ -18,6 +18,10 @@ debian/manpages/backtranseq.1e
debian/manpages/banana.1e
debian/manpages/biosed.1e
debian/manpages/btwisted.1e
+debian/manpages/cachedas.1e
+debian/manpages/cachedbfetch.1e
+debian/manpages/cacheebeyesearch.1e
+debian/manpages/cacheensembl.1e
debian/manpages/cai.1e
debian/manpages/chaos.1e
debian/manpages/charge.1e
@@ -38,21 +42,37 @@ debian/manpages/cusp.1e
debian/manpages/cutgextract.1e
debian/manpages/cutseq.1e
debian/manpages/dan.1e
+debian/manpages/dastest.1e
+debian/manpages/dbfetchtest.1e
+debian/manpages/dbget.1e
+debian/manpages/dbgeturl.1e
debian/manpages/dbiblast.1e
debian/manpages/dbifasta.1e
debian/manpages/dbiflat.1e
debian/manpages/dbigcg.1e
+debian/manpages/dbshowdat.1e
+debian/manpages/dbshowquery.1e
+debian/manpages/dbtell.1e
+debian/manpages/dbtellquery.1e
+debian/manpages/dbxcompress.1e
+debian/manpages/dbxedam.1e
debian/manpages/dbxfasta.1e
debian/manpages/dbxflat.1e
debian/manpages/dbxgcg.1e
+debian/manpages/dbxobo.1e
debian/manpages/dbxreport.1e
+debian/manpages/dbxresource.1e
debian/manpages/dbxstat.1e
+debian/manpages/dbxtax.1e
+debian/manpages/dbxuncompress.1e
debian/manpages/degapseq.1e
debian/manpages/density.1e
debian/manpages/descseq.1e
debian/manpages/diffseq.1e
debian/manpages/digest.1e
debian/manpages/distmat.1e
+debian/manpages/docxmlvalid.1e
+debian/manpages/docxmlwell.1e
debian/manpages/domtesta.1e
debian/manpages/domtestb.1e
debian/manpages/domtestc.1e
@@ -61,7 +81,19 @@ debian/manpages/dotmatcher.1e
debian/manpages/dotpath.1e
debian/manpages/dottup.1e
debian/manpages/dreg.1e
+debian/manpages/drfinddata.1e
+debian/manpages/drfindformat.1e
+debian/manpages/drfindid.1e
+debian/manpages/drfindresource.1e
+debian/manpages/drget.1e
+debian/manpages/drtext.1e
debian/manpages/edamclean.1e
+debian/manpages/edamdef.1e
+debian/manpages/edamhasinput.1e
+debian/manpages/edamhasoutput.1e
+debian/manpages/edamisformat.1e
+debian/manpages/edamisid.1e
+debian/manpages/edamname.1e
debian/manpages/edialign.1e
debian/manpages/einverted.1e
debian/manpages/embossdata.1e
@@ -74,7 +106,10 @@ debian/manpages/entrailsbook.1e
debian/manpages/entrailshtml.1e
debian/manpages/entrailswiki.1e
debian/manpages/entret.1e
+debian/manpages/entrygo.1e
+debian/manpages/entrytax.1e
debian/manpages/epestfind.1e
+debian/manpages/eprimer32.1e
debian/manpages/eprimer3.1e
debian/manpages/equicktandem.1e
debian/manpages/est2genome.1e
@@ -84,7 +119,7 @@ debian/manpages/extractfeat.1e
debian/manpages/extractseq.1e
debian/manpages/featcopy.1e
debian/manpages/featreport.1e
-debian/manpages/finddb.1e
+debian/manpages/feattext.1e
debian/manpages/findkm.1e
debian/manpages/freak.1e
debian/manpages/fuzznuc.1e
@@ -93,6 +128,9 @@ debian/manpages/fuzztran.1e
debian/manpages/garnier.1e
debian/manpages/geecee.1e
debian/manpages/getorf.1e
+debian/manpages/godef.1e
+debian/manpages/goname.1e
+debian/manpages/goseq.1e
debian/manpages/helixturnhelix.1e
debian/manpages/histogramtest.1e
debian/manpages/hmoment.1e
@@ -103,6 +141,8 @@ debian/manpages/infobase.1e
debian/manpages/inforesidue.1e
debian/manpages/infoseq.1e
debian/manpages/intconv.1e
+debian/manpages/isdbdata.1e
+debian/manpages/isdbname.1e
debian/manpages/isochore.1e
debian/manpages/jaspextract.1e
debian/manpages/jaspscan.1e
@@ -142,6 +182,16 @@ debian/manpages/nthseq.1e
debian/manpages/nthseqset.1e
debian/manpages/octanol.1e
debian/manpages/oddcomp.1e
+debian/manpages/ontocount.1e
+debian/manpages/ontoget.1e
+debian/manpages/ontogetcommon.1e
+debian/manpages/ontogetdown.1e
+debian/manpages/ontogetobsolete.1e
+debian/manpages/ontogetroot.1e
+debian/manpages/ontogetsibs.1e
+debian/manpages/ontogetup.1e
+debian/manpages/ontoisobsolete.1e
+debian/manpages/ontotext.1e
debian/manpages/origsplitter.1e
debian/manpages/origunion.1e
debian/manpages/palindrome.1e
@@ -150,6 +200,7 @@ debian/manpages/patmatdb.1e
debian/manpages/patmatmotifs.1e
debian/manpages/patmattest.1e
debian/manpages/pepcoil.1e
+debian/manpages/pepdigest.1e
debian/manpages/pepinfo.1e
debian/manpages/pepnet.1e
debian/manpages/pepstats.1e
@@ -180,6 +231,8 @@ debian/manpages/restover.1e
debian/manpages/restrict.1e
debian/manpages/revseq.1e
debian/manpages/seealso.1e
+debian/manpages/seqcount.1e
+debian/manpages/seqgo.1e
debian/manpages/seqinfo.1e
debian/manpages/seqmatchall.1e
debian/manpages/seqret.1e
@@ -190,14 +243,18 @@ debian/manpages/seqretsetall.1e
debian/manpages/seqretsingle.1e
debian/manpages/seqretsplit.1e
debian/manpages/seqrettype.1e
+debian/manpages/seqtax.1e
+debian/manpages/seqxref.1e
debian/manpages/seqxrefall.1e
+debian/manpages/seqxrefget.1e
+debian/manpages/servertell.1e
debian/manpages/showalign.1e
debian/manpages/showdb.1e
-debian/manpages/showdball.1e
debian/manpages/showfeat.1e
debian/manpages/showorf.1e
debian/manpages/showpep.1e
debian/manpages/showseq.1e
+debian/manpages/showserver.1e
debian/manpages/shuffleseq.1e
debian/manpages/sigcleave.1e
debian/manpages/silent.1e
@@ -213,9 +270,19 @@ debian/manpages/stretcher.1e
debian/manpages/stssearch.1e
debian/manpages/supermatcher.1e
debian/manpages/syco.1e
+debian/manpages/taxget.1e
+debian/manpages/taxgetdown.1e
+debian/manpages/taxgetrank.1e
+debian/manpages/taxgetspecies.1e
+debian/manpages/taxgetup.1e
+debian/manpages/taxseq.1e
debian/manpages/tcode.1e
debian/manpages/testplot.1e
+debian/manpages/textget.1e
debian/manpages/textsearch.1e
+debian/manpages/texttotext.1e
+debian/manpages/texttoxml.1e
+debian/manpages/textvalid.1e
debian/manpages/tfextract.1e
debian/manpages/tfm.1e
debian/manpages/tfscan.1e
@@ -228,6 +295,7 @@ debian/manpages/trimseq.1e
debian/manpages/trimspace.1e
debian/manpages/twofeat.1e
debian/manpages/union.1e
+debian/manpages/urlget.1e
debian/manpages/vectorstrip.1e
debian/manpages/water.1e
debian/manpages/whichdb.1e
@@ -235,5 +303,14 @@ debian/manpages/wobble.1e
debian/manpages/wordcount.1e
debian/manpages/wordfinder.1e
debian/manpages/wordmatch.1e
+debian/manpages/wossdata.1e
+debian/manpages/wossinput.1e
debian/manpages/wossname.1e
+debian/manpages/wossoperation.1e
+debian/manpages/wossoutput.1e
+debian/manpages/wossparam.1e
+debian/manpages/wosstopic.1e
+debian/manpages/xmltotext.1e
+debian/manpages/xmltoxml.1e
+debian/manpages/xmltransform.1e
debian/manpages/yank.1e
diff --git a/debian/manpages/aaindexextract.1e b/debian/manpages/aaindexextract.1e
index e1d9c62..aab229b 100644
--- a/debian/manpages/aaindexextract.1e
+++ b/debian/manpages/aaindexextract.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: AAINDEXEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "AAINDEXEXTRACT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "AAINDEXEXTRACT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/abiview.1e b/debian/manpages/abiview.1e
index e9a5147..7aacfde 100644
--- a/debian/manpages/abiview.1e
+++ b/debian/manpages/abiview.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ABIVIEW
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ABIVIEW" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ABIVIEW" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ abiview \- Display the trace in an ABI sequencer file
.SH "DESCRIPTION"
.PP
\fBabiview\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Sequence data,Display" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/acdc.1e b/debian/manpages/acdc.1e
index de81474..79679c3 100644
--- a/debian/manpages/acdc.1e
+++ b/debian/manpages/acdc.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ACDC
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ACDC" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ACDC" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ acdc \- Test an application ACD file
.SH "DESCRIPTION"
.PP
\fBacdc\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd,Data retrieval:Tool data" command group(s)\&.
.SH "OPTIONS"
.SH "BUGS"
.PP
diff --git a/debian/manpages/acdlog.1e b/debian/manpages/acdlog.1e
index df90dec..7c46861 100644
--- a/debian/manpages/acdlog.1e
+++ b/debian/manpages/acdlog.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ACDLOG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ACDLOG" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ACDLOG" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ acdlog \- Test application ACD file processing and trace data structures
.SH "DESCRIPTION"
.PP
\fBacdlog\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd,Data retrieval:Tool data" command group(s)\&.
.SH "OPTIONS"
.SH "BUGS"
.PP
diff --git a/debian/manpages/acdpretty.1e b/debian/manpages/acdpretty.1e
index 4edc800..0ee9a81 100644
--- a/debian/manpages/acdpretty.1e
+++ b/debian/manpages/acdpretty.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ACDPRETTY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ACDPRETTY" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ACDPRETTY" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ acdpretty \- Correctly reformat an application ACD file
.SH "DESCRIPTION"
.PP
\fBacdpretty\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd,Data retrieval:Tool data" command group(s)\&.
.SH "OPTIONS"
.SH "BUGS"
.PP
diff --git a/debian/manpages/acdrelations.1e b/debian/manpages/acdrelations.1e
index 529c5cc..a889919 100644
--- a/debian/manpages/acdrelations.1e
+++ b/debian/manpages/acdrelations.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ACDRELATIONS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ACDRELATIONS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ACDRELATIONS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -31,16 +31,21 @@
acdrelations \- Add relations: attribute to ACD files
.SH "SYNOPSIS"
.HP \w'\fBacdrelations\fR\ 'u
-\fBacdrelations\fR \fB\-indir\ \fR\fB\fIdirlist\fR\fR \fB\-inedamfile\ \fR\fB\fIdatafile\fR\fR \fB\-intypefile\ \fR\fB\fIinfile\fR\fR \fB\-outdir\ \fR\fB\fIoutdir\fR\fR
+\fBacdrelations\fR \fB\-mode\ \fR\fB\fIlist\fR\fR \fB\-indir\ \fR\fB\fIdirlist\fR\fR \fB\-inedamfile\ \fR\fB\fIdatafile\fR\fR \fB\-intypefile\ \fR\fB\fIinfile\fR\fR \fB\-outdir\ \fR\fB\fIoutdir\fR\fR
.HP \w'\fBacdrelations\fR\ 'u
\fBacdrelations\fR \fB\-help\fR
.SH "DESCRIPTION"
.PP
\fBacdrelations\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd,Data retrieval:Tool data" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
+\fB\-mode\fR \fIlist\fR
+.RS 4
+Default value: 1
+.RE
+.PP
\fB\-indir\fR \fIdirlist\fR
.RS 4
Default value: acdin
diff --git a/debian/manpages/acdtable.1e b/debian/manpages/acdtable.1e
index 4056b26..7de2712 100644
--- a/debian/manpages/acdtable.1e
+++ b/debian/manpages/acdtable.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ACDTABLE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ACDTABLE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ACDTABLE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ acdtable \- Generate an HTML table of parameters from an application ACD file
.SH "DESCRIPTION"
.PP
\fBacdtable\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd,Data retrieval:Tool data" command group(s)\&.
.SH "OPTIONS"
.SH "BUGS"
.PP
diff --git a/debian/manpages/acdtrace.1e b/debian/manpages/acdtrace.1e
index cb7e2f5..9dac332 100644
--- a/debian/manpages/acdtrace.1e
+++ b/debian/manpages/acdtrace.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ACDTRACE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ACDTRACE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ACDTRACE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ acdtrace \- Trace processing of an application ACD file (for testing)
.SH "DESCRIPTION"
.PP
\fBacdtrace\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd,Data retrieval:Tool data" command group(s)\&.
.SH "OPTIONS"
.SS "Required section"
.PP
diff --git a/debian/manpages/acdvalid.1e b/debian/manpages/acdvalid.1e
index 2875baa..0d09d0e 100644
--- a/debian/manpages/acdvalid.1e
+++ b/debian/manpages/acdvalid.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ACDVALID
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ACDVALID" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ACDVALID" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ acdvalid \- Validate an application ACD file
.SH "DESCRIPTION"
.PP
\fBacdvalid\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Acd,Data retrieval:Tool data" command group(s)\&.
.SH "OPTIONS"
.SH "BUGS"
.PP
diff --git a/debian/manpages/ajbad.1e b/debian/manpages/ajbad.1e
index 6eb9d32..84fb770 100644
--- a/debian/manpages/ajbad.1e
+++ b/debian/manpages/ajbad.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: AJBAD
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "AJBAD" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "AJBAD" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/ajfeatest.1e b/debian/manpages/ajfeatest.1e
index 52c30ba..a27d3f7 100644
--- a/debian/manpages/ajfeatest.1e
+++ b/debian/manpages/ajfeatest.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: AJFEATEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "AJFEATEST" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "AJFEATEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/ajtest.1e b/debian/manpages/ajtest.1e
index 82216e2..bdfdf64 100644
--- a/debian/manpages/ajtest.1e
+++ b/debian/manpages/ajtest.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: AJTEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "AJTEST" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "AJTEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -31,7 +31,7 @@
ajtest \- Test file for ACD parsing
.SH "SYNOPSIS"
.HP \w'\fBajtest\fR\ 'u
-\fBajtest\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-bsequence\ \fR\fB\fIseqset\fR\fR \fB\-obofile\ \fR\fB\fIinfile\fR\fR \fB\-dbxreffile\ \fR\fB\fIinfile\fR\fR \fB\-taxdir\ \fR\fB\fIdirectory\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR \fB\-outdir\ \fR\fB\fIoutdir\fR\fR
+\fBajtest\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-bsequence\ \fR\fB\fIseqset\fR\fR \fB\-idresource\ \fR\fB\fIstring\fR\fR \fB\-taxdir\ \fR\fB\fIdirectory\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-outseq\ \fR\fB\fIseqout\fR\fR \fB\-outfeat\ \fR\fB\fIfeatout\fR\fR \fB\-outdir\ \fR\fB\fIoutdir\fR\fR
.HP \w'\fBajtest\fR\ 'u
\fBajtest\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -49,11 +49,7 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.RS 4
.RE
.PP
-\fB\-obofile\fR \fIinfile\fR
-.RS 4
-.RE
-.PP
-\fB\-dbxreffile\fR \fIinfile\fR
+\fB\-idresource\fR \fIstring\fR
.RS 4
.RE
.PP
diff --git a/debian/manpages/aligncopy.1e b/debian/manpages/aligncopy.1e
index 2a42bc8..011c553 100644
--- a/debian/manpages/aligncopy.1e
+++ b/debian/manpages/aligncopy.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ALIGNCOPY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ALIGNCOPY" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ALIGNCOPY" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/aligncopypair.1e b/debian/manpages/aligncopypair.1e
index 0f59e6e..a91ec6d 100644
--- a/debian/manpages/aligncopypair.1e
+++ b/debian/manpages/aligncopypair.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ALIGNCOPYPAIR
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ALIGNCOPYPAIR" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ALIGNCOPYPAIR" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/antigenic.1e b/debian/manpages/antigenic.1e
index c582ac0..d993fee 100644
--- a/debian/manpages/antigenic.1e
+++ b/debian/manpages/antigenic.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ANTIGENIC
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ANTIGENIC" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ANTIGENIC" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/backtranambig.1e b/debian/manpages/backtranambig.1e
index dfa8c49..cd53c0c 100644
--- a/debian/manpages/backtranambig.1e
+++ b/debian/manpages/backtranambig.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: BACKTRANAMBIG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "BACKTRANAMBIG" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "BACKTRANAMBIG" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/backtranseq.1e b/debian/manpages/backtranseq.1e
index 0c5a31c..b448024 100644
--- a/debian/manpages/backtranseq.1e
+++ b/debian/manpages/backtranseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: BACKTRANSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "BACKTRANSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "BACKTRANSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/banana.1e b/debian/manpages/banana.1e
index cc61660..b270a6a 100644
--- a/debian/manpages/banana.1e
+++ b/debian/manpages/banana.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: BANANA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "BANANA" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "BANANA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ banana \- Plot bending and curvature data for B\-DNA
.SH "DESCRIPTION"
.PP
\fBbanana\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Properties,Nucleic:Composition,Nucleic:2D structure" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/biosed.1e b/debian/manpages/biosed.1e
index 0e32173..eb681c3 100644
--- a/debian/manpages/biosed.1e
+++ b/debian/manpages/biosed.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: BIOSED
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "BIOSED" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "BIOSED" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/btwisted.1e b/debian/manpages/btwisted.1e
index 510ff8f..b5d4aea 100644
--- a/debian/manpages/btwisted.1e
+++ b/debian/manpages/btwisted.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: BTWISTED
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "BTWISTED" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "BTWISTED" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ btwisted \- Calculate the twisting in a B\-DNA sequence
.SH "DESCRIPTION"
.PP
\fBbtwisted\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Properties,Nucleic:Composition,Nucleic:2D structure" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/cachedas.1e b/debian/manpages/cachedas.1e
new file mode 100644
index 0000000..d5fab35
--- /dev/null
+++ b/debian/manpages/cachedas.1e
@@ -0,0 +1,97 @@
+'\" t
+.\" Title: CACHEDAS
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "CACHEDAS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+cachedas \- Generates server cache file for DAS servers or for the DAS registry
+.SH "SYNOPSIS"
+.HP \w'\fBcachedas\fR\ 'u
+\fBcachedas\fR [\fB\-sequencesourcesonly\ \fR\fB\fIboolean\fR\fR] \fB\-host\ \fR\fB\fIstring\fR\fR \fB\-path\ \fR\fB\fIstring\fR\fR \fB\-port\ \fR\fB\fIinteger\fR\fR \fB\-servername\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] \fB\-cachefile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBcachedas\fR\ 'u
+\fBcachedas\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcachedas\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data resources" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequencesourcesonly\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-host\fR \fIstring\fR
+.RS 4
+Default value: www\&.dasregistry\&.org
+.RE
+.PP
+\fB\-path\fR \fIstring\fR
+.RS 4
+Default value: /das
+.RE
+.PP
+\fB\-port\fR \fIinteger\fR
+.RS 4
+Default value: 80
+.RE
+.PP
+\fB\-servername\fR \fIstring\fR
+.RS 4
+Default value: das
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.PP
+\fB\-cachefile\fR \fIoutfile\fR
+.RS 4
+Default value: server\&.$(servername)
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+cachedas is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/cachedbfetch.1e b/debian/manpages/cachedbfetch.1e
new file mode 100644
index 0000000..cbbc086
--- /dev/null
+++ b/debian/manpages/cachedbfetch.1e
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: CACHEDBFETCH
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "CACHEDBFETCH" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+cachedbfetch \- Generates server cache file for Dbfetch/WSDbfetch data sources
+.SH "SYNOPSIS"
+.HP \w'\fBcachedbfetch\fR\ 'u
+\fBcachedbfetch\fR \fB\-servername\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] \fB\-cachefile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBcachedbfetch\fR\ 'u
+\fBcachedbfetch\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcachedbfetch\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data resources" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-servername\fR \fIstring\fR
+.RS 4
+Default value: dbfetch
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.PP
+\fB\-cachefile\fR \fIoutfile\fR
+.RS 4
+Default value: server\&.$(servername)
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+cachedbfetch is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/cacheebeyesearch.1e b/debian/manpages/cacheebeyesearch.1e
new file mode 100644
index 0000000..863fb9a
--- /dev/null
+++ b/debian/manpages/cacheebeyesearch.1e
@@ -0,0 +1,72 @@
+'\" t
+.\" Title: CACHEEBEYESEARCH
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "CACHEEBEYESEARCH" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+cacheebeyesearch \- Generates server cache file for EB\-eye search domains
+.SH "SYNOPSIS"
+.HP \w'\fBcacheebeyesearch\fR\ 'u
+\fBcacheebeyesearch\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] \fB\-cachefile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBcacheebeyesearch\fR\ 'u
+\fBcacheebeyesearch\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcacheebeyesearch\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data resources" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.PP
+\fB\-cachefile\fR \fIoutfile\fR
+.RS 4
+Default value: server\&.$(servername)
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+cacheebeyesearch is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/cacheensembl.1e b/debian/manpages/cacheensembl.1e
new file mode 100644
index 0000000..e0a4010
--- /dev/null
+++ b/debian/manpages/cacheensembl.1e
@@ -0,0 +1,76 @@
+'\" t
+.\" Title: CACHEENSEMBL
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "CACHEENSEMBL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+cacheensembl \- Generates server cache file for an Ensembl server
+.SH "SYNOPSIS"
+.HP \w'\fBcacheensembl\fR\ 'u
+\fBcacheensembl\fR \fB\-servername\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] \fB\-cachefile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBcacheensembl\fR\ 'u
+\fBcacheensembl\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBcacheensembl\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data resources" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-servername\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.PP
+\fB\-cachefile\fR \fIoutfile\fR
+.RS 4
+Default value: server\&.$(servername)
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+cacheensembl is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/cai.1e b/debian/manpages/cai.1e
index 8c485f6..bea7754 100644
--- a/debian/manpages/cai.1e
+++ b/debian/manpages/cai.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CAI
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CAI" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CAI" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/chaos.1e b/debian/manpages/chaos.1e
index de7ebe1..0abbca7 100644
--- a/debian/manpages/chaos.1e
+++ b/debian/manpages/chaos.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CHAOS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CHAOS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CHAOS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/charge.1e b/debian/manpages/charge.1e
index 4a4d4b7..7bafa09 100644
--- a/debian/manpages/charge.1e
+++ b/debian/manpages/charge.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CHARGE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CHARGE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CHARGE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ charge \- Draw a protein charge plot
.SH "DESCRIPTION"
.PP
\fBcharge\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Properties" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/checktrans.1e b/debian/manpages/checktrans.1e
index 25db0a9..8d0895f 100644
--- a/debian/manpages/checktrans.1e
+++ b/debian/manpages/checktrans.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CHECKTRANS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CHECKTRANS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CHECKTRANS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ checktrans \- Reports STOP codons and ORF statistics of a protein
.SH "DESCRIPTION"
.PP
\fBchecktrans\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Gene finding,Nucleic:Translation" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/chips.1e b/debian/manpages/chips.1e
index 2ef564d..70cc164 100644
--- a/debian/manpages/chips.1e
+++ b/debian/manpages/chips.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CHIPS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CHIPS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CHIPS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cirdna.1e b/debian/manpages/cirdna.1e
index b54d9d6..07f851e 100644
--- a/debian/manpages/cirdna.1e
+++ b/debian/manpages/cirdna.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CIRDNA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CIRDNA" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CIRDNA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/codcmp.1e b/debian/manpages/codcmp.1e
index a1c6cde..b44522c 100644
--- a/debian/manpages/codcmp.1e
+++ b/debian/manpages/codcmp.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CODCMP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CODCMP" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CODCMP" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/codcopy.1e b/debian/manpages/codcopy.1e
index 5c4bed5..d54a55c 100644
--- a/debian/manpages/codcopy.1e
+++ b/debian/manpages/codcopy.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CODCOPY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CODCOPY" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CODCOPY" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ codcopy \- Copy and reformat a codon usage table
.SH "DESCRIPTION"
.PP
\fBcodcopy\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval,Nucleic:Codon usage,Edit" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/coderet.1e b/debian/manpages/coderet.1e
index b2f48a1..953a3e2 100644
--- a/debian/manpages/coderet.1e
+++ b/debian/manpages/coderet.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CODERET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CODERET" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CODERET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ coderet \- Extract CDS, mRNA and translations from feature tables
.SH "DESCRIPTION"
.PP
\fBcoderet\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Feature tables,Nucleic:Translation" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Translation,Data retrieval:Sequence data" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/complex.1e b/debian/manpages/complex.1e
index f7f7cf5..4157a84 100644
--- a/debian/manpages/complex.1e
+++ b/debian/manpages/complex.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: COMPLEX
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "COMPLEX" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "COMPLEX" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/compseq.1e b/debian/manpages/compseq.1e
index 7645459..dda90ed 100644
--- a/debian/manpages/compseq.1e
+++ b/debian/manpages/compseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: COMPSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "COMPSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "COMPSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cons.1e b/debian/manpages/cons.1e
index 9077eac..f5b27bf 100644
--- a/debian/manpages/cons.1e
+++ b/debian/manpages/cons.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CONS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CONS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CONS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/consambig.1e b/debian/manpages/consambig.1e
index 64c7ad0..0d154e7 100644
--- a/debian/manpages/consambig.1e
+++ b/debian/manpages/consambig.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CONSAMBIG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CONSAMBIG" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CONSAMBIG" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/corbatest.1e b/debian/manpages/corbatest.1e
index 11b1b92..d9c7b18 100644
--- a/debian/manpages/corbatest.1e
+++ b/debian/manpages/corbatest.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CORBATEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CORBATEST" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CORBATEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cpgplot.1e b/debian/manpages/cpgplot.1e
index 0ba687a..d6b8587 100644
--- a/debian/manpages/cpgplot.1e
+++ b/debian/manpages/cpgplot.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CPGPLOT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CPGPLOT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CPGPLOT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cpgreport.1e b/debian/manpages/cpgreport.1e
index f0ec093..2316520 100644
--- a/debian/manpages/cpgreport.1e
+++ b/debian/manpages/cpgreport.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CPGREPORT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CPGREPORT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CPGREPORT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cusp.1e b/debian/manpages/cusp.1e
index aec9b9f..267c1dd 100644
--- a/debian/manpages/cusp.1e
+++ b/debian/manpages/cusp.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CUSP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CUSP" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CUSP" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cutgextract.1e b/debian/manpages/cutgextract.1e
index 871228e..5659e9c 100644
--- a/debian/manpages/cutgextract.1e
+++ b/debian/manpages/cutgextract.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CUTGEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CUTGEXTRACT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CUTGEXTRACT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/cutseq.1e b/debian/manpages/cutseq.1e
index d4b8d0b..0aa4f26 100644
--- a/debian/manpages/cutseq.1e
+++ b/debian/manpages/cutseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: CUTSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "CUTSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "CUTSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dan.1e b/debian/manpages/dan.1e
index 957f990..d87fb49 100644
--- a/debian/manpages/dan.1e
+++ b/debian/manpages/dan.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DAN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DAN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ dan \- Calculates nucleic acid melting temperature
.SH "DESCRIPTION"
.PP
\fBdan\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Properties,Nucleic:Composition" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/dastest.1e b/debian/manpages/dastest.1e
new file mode 100644
index 0000000..038f074
--- /dev/null
+++ b/debian/manpages/dastest.1e
@@ -0,0 +1,124 @@
+'\" t
+.\" Title: DASTEST
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DASTEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dastest \- Return DAS sources from a DAS server or from the DAS registry
+.SH "SYNOPSIS"
+.HP \w'\fBdastest\fR\ 'u
+\fBdastest\fR [\fB\-sequencesourcesonly\ \fR\fB\fIboolean\fR\fR] [\fB\-entrypoints\ \fR\fB\fIboolean\fR\fR] [\fB\-showtestqueries\ \fR\fB\fIboolean\fR\fR] [\fB\-runtestqueries\ \fR\fB\fIboolean\fR\fR] \fB\-host\ \fR\fB\fIstring\fR\fR \fB\-path\ \fR\fB\fIstring\fR\fR \fB\-port\ \fR\fB\fIinteger\fR\fR \fB\-servername\ \fR\fB\fIstring\fR\fR \fB\-maxtests\ \fR\fB\fIinteger\fR\fR \fB\-maxfeatures\ \fR\fB\fIinteger\fR\fR \fB\-maxsegments\ \fR\fB\fIinteger\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
+.HP \w'\fBdastest\fR\ 'u
+\fBdastest\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdastest\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Information" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.SS "Additional section"
+.PP
+\fB\-sequencesourcesonly\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-entrypoints\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-showtestqueries\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-runtestqueries\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-host\fR \fIstring\fR
+.RS 4
+Default value: www\&.dasregistry\&.org
+.RE
+.PP
+\fB\-path\fR \fIstring\fR
+.RS 4
+Default value: /das
+.RE
+.PP
+\fB\-port\fR \fIinteger\fR
+.RS 4
+Default value: 80
+.RE
+.PP
+\fB\-servername\fR \fIstring\fR
+.RS 4
+Default value: das
+.RE
+.PP
+\fB\-maxtests\fR \fIinteger\fR
+.RS 4
+Default value: 80
+.RE
+.PP
+\fB\-maxfeatures\fR \fIinteger\fR
+.RS 4
+Default value: 80
+.RE
+.PP
+\fB\-maxsegments\fR \fIinteger\fR
+.RS 4
+Default value: 5
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dastest is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbfetchtest.1e b/debian/manpages/dbfetchtest.1e
new file mode 100644
index 0000000..45ae911
--- /dev/null
+++ b/debian/manpages/dbfetchtest.1e
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: DBFETCHTEST
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBFETCHTEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbfetchtest \- Generates server cache file for WSDbfetch data sources
+.SH "SYNOPSIS"
+.HP \w'\fBdbfetchtest\fR\ 'u
+\fBdbfetchtest\fR \fB\-servername\ \fR\fB\fIstring\fR\fR [\fB\-runtestqueries\ \fR\fB\fIboolean\fR\fR] [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
+.HP \w'\fBdbfetchtest\fR\ 'u
+\fBdbfetchtest\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbfetchtest\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Information" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-servername\fR \fIstring\fR
+.RS 4
+Default value: dbfetch
+.RE
+.PP
+\fB\-runtestqueries\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbfetchtest is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbget.1e b/debian/manpages/dbget.1e
new file mode 100644
index 0000000..f5c5ae8
--- /dev/null
+++ b/debian/manpages/dbget.1e
@@ -0,0 +1,90 @@
+'\" t
+.\" Title: DBGET
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBGET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbget \- Retrieve database entries for a named database, data type and data identifier
+.SH "SYNOPSIS"
+.HP \w'\fBdbget\fR\ 'u
+\fBdbget\fR \fB\-database\ \fR\fB\fIstring\fR\fR \fB\-datatype\ \fR\fB\fIstring\fR\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] \fB\-outdir\ \fR\fB\fIoutdir\fR\fR
+.HP \w'\fBdbget\fR\ 'u
+\fBdbget\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbget\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-database\fR \fIstring\fR
+.RS 4
+This is the name of a database from the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. If you are unsure of the available databases use dbfind\&. If you have a database name but are not sure its valid, use isdbname\&.
+.RE
+.PP
+\fB\-datatype\fR \fIstring\fR
+.RS 4
+This is the name of a retrievable datatype from the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. The names are terms from the \*(Aqdata\*(Aq branch of the EDAM ontology, http://edamontology\&.sourceforge\&.net/\&. If you are unsure of the available retrievable datatypes for a given database, use dbtellquery\&. If you have a datatype name but are not sure its valid, use isdbdata\&.
+.RE
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+This is a data identifier (e\&.g\&. a sequence accession number) that is used to specify the data (of type \*(Aqdatatype\*(Aq) to retrieve\&. If you\*(Aqre unsure of the data identifier(s) that are used for a given query (database/datatype) use dbtellquery\&. The types of data identifier are listed under the \*(AqData identifier\*(Aq branch of the EDAM ontology (http://edamontology\&.sourceforge\&.net/)\&. For example values, see the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. If you have a data identifier but are unsure of its type, use idtell\&.
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.PP
+\fB\-outdir\fR \fIoutdir\fR
+.RS 4
+Default value: \&.
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbget is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbgeturl.1e b/debian/manpages/dbgeturl.1e
new file mode 100644
index 0000000..2fd0e69
--- /dev/null
+++ b/debian/manpages/dbgeturl.1e
@@ -0,0 +1,85 @@
+'\" t
+.\" Title: DBGETURL
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBGETURL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbgeturl \- Retrieve links to database entries for a named database, data type and data identifier
+.SH "SYNOPSIS"
+.HP \w'\fBdbgeturl\fR\ 'u
+\fBdbgeturl\fR \fB\-database\ \fR\fB\fIstring\fR\fR \fB\-datatype\ \fR\fB\fIstring\fR\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
+.HP \w'\fBdbgeturl\fR\ 'u
+\fBdbgeturl\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbgeturl\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-database\fR \fIstring\fR
+.RS 4
+This is the name of a database from the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. If you are unsure of the available databases use dbfind\&. If you have a database name but are not sure its valid, use isdbname\&.
+.RE
+.PP
+\fB\-datatype\fR \fIstring\fR
+.RS 4
+This is the name of a retrievable datatype from the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. The names are terms from the \*(Aqdata\*(Aq branch of the EDAM ontology, http://edamontology\&.sourceforge\&.net/\&. If you are unsure of the available retrievable datatypes for a given database, use dbtellquery\&. If you have a datatype name but are not sure its valid, use isdbdata\&.
+.RE
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+This is a data identifier (e\&.g\&. a sequence accession number) that is used to specify the data (of type \*(Aqdatatype\*(Aq) to retrieve\&. If you\*(Aqre unsure of the data identifier(s) that are used for a given query (database/datatype) use dbtellquery\&. The types of data identifier are listed under the \*(AqData identifier\*(Aq branch of the EDAM ontology (http://edamontology\&.sourceforge\&.net/)\&. For example values, see the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. If you have a data identifier but are unsure of its type, use idtell\&.
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbgeturl is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbiblast.1e b/debian/manpages/dbiblast.1e
index 1664fb6..ab44b14 100644
--- a/debian/manpages/dbiblast.1e
+++ b/debian/manpages/dbiblast.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DBIBLAST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DBIBLAST" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DBIBLAST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dbifasta.1e b/debian/manpages/dbifasta.1e
index 1461c45..df27254 100644
--- a/debian/manpages/dbifasta.1e
+++ b/debian/manpages/dbifasta.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DBIFASTA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DBIFASTA" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DBIFASTA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dbiflat.1e b/debian/manpages/dbiflat.1e
index a71e24d..9fa1a81 100644
--- a/debian/manpages/dbiflat.1e
+++ b/debian/manpages/dbiflat.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DBIFLAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DBIFLAT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DBIFLAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dbigcg.1e b/debian/manpages/dbigcg.1e
index 3cc5b3a..1cb27f5 100644
--- a/debian/manpages/dbigcg.1e
+++ b/debian/manpages/dbigcg.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DBIGCG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DBIGCG" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DBIGCG" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dbshowdat.1e b/debian/manpages/dbshowdat.1e
new file mode 100644
index 0000000..c3223eb
--- /dev/null
+++ b/debian/manpages/dbshowdat.1e
@@ -0,0 +1,91 @@
+'\" t
+.\" Title: DBSHOWDAT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBSHOWDAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbshowdat \- Show possible database queries that return a given data type
+.SH "SYNOPSIS"
+.HP \w'\fBdbshowdat\fR\ 'u
+\fBdbshowdat\fR \fB\-datatype\ \fR\fB\fIstring\fR\fR \fB\-database\ \fR\fB\fIstring\fR\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR]
+.HP \w'\fBdbshowdat\fR\ 'u
+\fBdbshowdat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbshowdat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-datatype\fR \fIstring\fR
+.RS 4
+This is the name of a retrievable datatype from the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. The names are terms from the \*(Aqdata\*(Aq branch of the EDAM ontology, http://edamontology\&.sourceforge\&.net/\&. If you are unsure of the available retrievable datatypes for a given database, use dbtellquery\&. If you have a datatype name but are not sure its valid, use isdbdata\&.
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.PP
+\fB\-database\fR \fIstring\fR
+.RS 4
+This is the name of a database from the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. If you are unsure of the available databases use dbfind\&. If you have a database name but are not sure its valid, use isdbname\&.
+.RE
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+This is a data identifier (e\&.g\&. a sequence accession number) that is used to specify the data (of type \*(Aqdatatype\*(Aq) to retrieve\&. If you\*(Aqre unsure of the data identifier(s) that are used for a given query (database/datatype) use dbtellquery\&. The types of data identifier are listed under the \*(AqData identifier\*(Aq branch of the EDAM ontology (http://edamontology\&.sourceforge\&.net/)\&. For example values, see the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. If you have a data identifier but are unsure of its type, use idtell\&.
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbshowdat is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbshowquery.1e b/debian/manpages/dbshowquery.1e
new file mode 100644
index 0000000..a8e5cbc
--- /dev/null
+++ b/debian/manpages/dbshowquery.1e
@@ -0,0 +1,91 @@
+'\" t
+.\" Title: DBSHOWQUERY
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBSHOWQUERY" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbshowquery \- Show possible database queries that use a given data identifier
+.SH "SYNOPSIS"
+.HP \w'\fBdbshowquery\fR\ 'u
+\fBdbshowquery\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR \fB\-database\ \fR\fB\fIstring\fR\fR \fB\-datatype\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR]
+.HP \w'\fBdbshowquery\fR\ 'u
+\fBdbshowquery\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbshowquery\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+This is a data identifier (e\&.g\&. a sequence accession number) that is used to specify the data (of type \*(Aqdatatype\*(Aq) to retrieve\&. If you\*(Aqre unsure of the data identifier(s) that are used for a given query (database/datatype) use dbtellquery\&. The types of data identifier are listed under the \*(AqData identifier\*(Aq branch of the EDAM ontology (http://edamontology\&.sourceforge\&.net/)\&. For example values, see the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. If you have a data identifier but are unsure of its type, use idtell\&.
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.PP
+\fB\-database\fR \fIstring\fR
+.RS 4
+This is the name of a database from the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. If you are unsure of the available databases use drfind\&. If you have a database name but are not sure its valid, use isdbname\&.
+.RE
+.PP
+\fB\-datatype\fR \fIstring\fR
+.RS 4
+This is the name of a retrievable datatype from the catalogue of public databases in the EMBOSS data file DRCAT\&.dat\&. The names are terms from the \*(Aqdata\*(Aq branch of the EDAM ontology, http://edamontology\&.sourceforge\&.net/\&. If you are unsure of the available retrievable datatypes for a given database, use dbtellquery\&. If you have a datatype name but are not sure its valid, use isdbdata\&.
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbshowquery is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbtell.1e b/debian/manpages/dbtell.1e
new file mode 100644
index 0000000..4d922af
--- /dev/null
+++ b/debian/manpages/dbtell.1e
@@ -0,0 +1,79 @@
+'\" t
+.\" Title: DBTELL
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBTELL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbtell \- Display information about a public database
+.SH "SYNOPSIS"
+.HP \w'\fBdbtell\fR\ 'u
+\fBdbtell\fR \fB\-database\ \fR\fB\fIstring\fR\fR [\fB\-full\ \fR\fB\fIboolean\fR\fR] [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
+.HP \w'\fBdbtell\fR\ 'u
+\fBdbtell\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbtell\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data resources" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-database\fR \fIstring\fR
+.RS 4
+The name of the database defined locally for use by EMBOSS\&.
+.RE
+.SS "Additional section"
+.PP
+\fB\-full\fR \fIboolean\fR
+.RS 4
+The default behaviour is to report for relevant databases only basic information from the EMBOSS database definition Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbtell is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbtellquery.1e b/debian/manpages/dbtellquery.1e
new file mode 100644
index 0000000..091fd93
--- /dev/null
+++ b/debian/manpages/dbtellquery.1e
@@ -0,0 +1,81 @@
+'\" t
+.\" Title: DBTELLQUERY
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBTELLQUERY" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbtellquery \- Show possible queries of a database
+.SH "SYNOPSIS"
+.HP \w'\fBdbtellquery\fR\ 'u
+\fBdbtellquery\fR \fB\-database\ \fR\fB\fIstring\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR]
+.HP \w'\fBdbtellquery\fR\ 'u
+\fBdbtellquery\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbtellquery\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-database\fR \fIstring\fR
+.RS 4
+The unique identifier of the database\&. These are listed in the EMBOSS data file DRCAT\&.dat (field names in parenthesis) and can be the recommended or official unique identifier (\*(AqID\*(Aq), the alternative identifier (\*(AqIDalt\*(Aq), or the accession number (\*(AqAcc\*(Aq) of the database\&. Any of these are acceptable\&. Official database identifiers and accession numbers are taken from http://www\&.uniprot\&.org/docs/dbxref where available\&. You can use dbfind to find databases by keyword and return unique identifiers and other information\&.
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbtellquery is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbxcompress.1e b/debian/manpages/dbxcompress.1e
new file mode 100644
index 0000000..c1d9d3a
--- /dev/null
+++ b/debian/manpages/dbxcompress.1e
@@ -0,0 +1,80 @@
+'\" t
+.\" Title: DBXCOMPRESS
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBXCOMPRESS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbxcompress \- Compress an uncompressed dbx index
+.SH "SYNOPSIS"
+.HP \w'\fBdbxcompress\fR\ 'u
+\fBdbxcompress\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-field\ \fR\fB\fIstring\fR\fR \fB\-indexdir\ \fR\fB\fIdirectory\fR\fR \fB\-$(dbname)\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdbxcompress\fR\ 'u
+\fBdbxcompress\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbxcompress\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-field\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-indexdir\fR \fIdirectory\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-$(dbname)\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbxcompress is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbxedam.1e b/debian/manpages/dbxedam.1e
new file mode 100644
index 0000000..68fe3eb
--- /dev/null
+++ b/debian/manpages/dbxedam.1e
@@ -0,0 +1,122 @@
+'\" t
+.\" Title: DBXEDAM
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBXEDAM" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbxedam \- Index the EDAM ontology using b+tree indices
+.SH "SYNOPSIS"
+.HP \w'\fBdbxedam\fR\ 'u
+\fBdbxedam\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-standardname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-compressed\ \fR\fB\fIboolean\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdbxedam\fR\ 'u
+\fBdbxedam\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbxedam\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+Default value: edam
+.RE
+.PP
+\fB\-standardname\fR \fIstring\fR
+.RS 4
+Default value: $(dbname)
+.RE
+.PP
+\fB\-dbresource\fR \fIstring\fR
+.RS 4
+Default value: edamresource
+.RE
+.PP
+\fB\-directory\fR \fIdirectory\fR
+.RS 4
+Default value: \&.
+.RE
+.PP
+\fB\-filenames\fR \fIstring\fR
+.RS 4
+Default value: EDAM*\&.obo
+.RE
+.SS "Required section"
+.PP
+\fB\-fields\fR \fIlist\fR
+.RS 4
+Default value: *
+.RE
+.PP
+\fB\-compressed\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Advanced section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+Default value: 0\&.0
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.PP
+\fB\-exclude\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-indexoutdir\fR \fIoutdir\fR
+.RS 4
+Default value: \&.
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbxedam is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbxfasta.1e b/debian/manpages/dbxfasta.1e
index 292fb65..68aab32 100644
--- a/debian/manpages/dbxfasta.1e
+++ b/debian/manpages/dbxfasta.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DBXFASTA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DBXFASTA" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DBXFASTA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -31,7 +31,7 @@
dbxfasta \- Index a fasta file database using b+tree indices
.SH "SYNOPSIS"
.HP \w'\fBdbxfasta\fR\ 'u
-\fBdbxfasta\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+\fBdbxfasta\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-compressed\ \fR\fB\fIboolean\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
.HP \w'\fBdbxfasta\fR\ 'u
\fBdbxfasta\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -69,6 +69,11 @@ Default value: *\&.fasta
.RS 4
Default value: id,acc
.RE
+.PP
+\fB\-compressed\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
.SS "Advanced section"
.PP
\fB\-release\fR \fIstring\fR
diff --git a/debian/manpages/dbxflat.1e b/debian/manpages/dbxflat.1e
index ee1137f..f518413 100644
--- a/debian/manpages/dbxflat.1e
+++ b/debian/manpages/dbxflat.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DBXFLAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DBXFLAT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DBXFLAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -31,7 +31,7 @@
dbxflat \- Index a flat file database using b+tree indices
.SH "SYNOPSIS"
.HP \w'\fBdbxflat\fR\ 'u
-\fBdbxflat\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+\fBdbxflat\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-compressed\ \fR\fB\fIboolean\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-statistics\ \fR\fB\fIboolean\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
.HP \w'\fBdbxflat\fR\ 'u
\fBdbxflat\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -69,6 +69,11 @@ Default value: \&.
.RS 4
Default value: id,acc
.RE
+.PP
+\fB\-compressed\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
.SS "Advanced section"
.PP
\fB\-release\fR \fIstring\fR
@@ -84,6 +89,11 @@ Default value: 00/00/00
\fB\-exclude\fR \fIstring\fR
.RS 4
.RE
+.PP
+\fB\-statistics\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
.SS "Output section"
.PP
\fB\-indexoutdir\fR \fIoutdir\fR
diff --git a/debian/manpages/dbxgcg.1e b/debian/manpages/dbxgcg.1e
index c615ae4..c315809 100644
--- a/debian/manpages/dbxgcg.1e
+++ b/debian/manpages/dbxgcg.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DBXGCG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DBXGCG" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DBXGCG" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -31,7 +31,7 @@
dbxgcg \- Index a GCG formatted database using b+tree indices
.SH "SYNOPSIS"
.HP \w'\fBdbxgcg\fR\ 'u
-\fBdbxgcg\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+\fBdbxgcg\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-idformat\ \fR\fB\fIlist\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-compressed\ \fR\fB\fIboolean\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
.HP \w'\fBdbxgcg\fR\ 'u
\fBdbxgcg\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -69,6 +69,11 @@ Default value: *\&.seq
.RS 4
Default value: id,acc
.RE
+.PP
+\fB\-compressed\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
.SS "Advanced section"
.PP
\fB\-release\fR \fIstring\fR
diff --git a/debian/manpages/dbxobo.1e b/debian/manpages/dbxobo.1e
new file mode 100644
index 0000000..7b6b277
--- /dev/null
+++ b/debian/manpages/dbxobo.1e
@@ -0,0 +1,121 @@
+'\" t
+.\" Title: DBXOBO
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBXOBO" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbxobo \- Index an obo ontology using b+tree indices
+.SH "SYNOPSIS"
+.HP \w'\fBdbxobo\fR\ 'u
+\fBdbxobo\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-standardname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-compressed\ \fR\fB\fIboolean\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdbxobo\fR\ 'u
+\fBdbxobo\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbxobo\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-standardname\fR \fIstring\fR
+.RS 4
+Default value: $(dbname)
+.RE
+.PP
+\fB\-dbresource\fR \fIstring\fR
+.RS 4
+Default value: oboresource
+.RE
+.PP
+\fB\-directory\fR \fIdirectory\fR
+.RS 4
+Default value: \&.
+.RE
+.PP
+\fB\-filenames\fR \fIstring\fR
+.RS 4
+Default value: *\&.obo
+.RE
+.SS "Required section"
+.PP
+\fB\-fields\fR \fIlist\fR
+.RS 4
+Default value: *
+.RE
+.PP
+\fB\-compressed\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Advanced section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+Default value: 0\&.0
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.PP
+\fB\-exclude\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-indexoutdir\fR \fIoutdir\fR
+.RS 4
+Default value: \&.
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbxobo is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbxreport.1e b/debian/manpages/dbxreport.1e
index 1156a0e..1f39f37 100644
--- a/debian/manpages/dbxreport.1e
+++ b/debian/manpages/dbxreport.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DBXREPORT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DBXREPORT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DBXREPORT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -31,7 +31,7 @@
dbxreport \- Validate index and report internals for dbx databases
.SH "SYNOPSIS"
.HP \w'\fBdbxreport\fR\ 'u
-\fBdbxreport\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-indexdir\ \fR\fB\fIdirectory\fR\fR \fB\-idtype\ \fR\fB\fIlist\fR\fR \fB\-fullreport\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+\fBdbxreport\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIstring\fR\fR \fB\-indexdir\ \fR\fB\fIdirectory\fR\fR \fB\-fullreport\ \fR\fB\fIboolean\fR\fR \fB\-$(dbname)\ \fR\fB\fIoutfile\fR\fR
.HP \w'\fBdbxreport\fR\ 'u
\fBdbxreport\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -45,14 +45,13 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.RS 4
.RE
.PP
-\fB\-indexdir\fR \fIdirectory\fR
+\fB\-fields\fR \fIstring\fR
.RS 4
-Default value: \&.
+A list of index fields separated by spaces or commas\&. Default value: id
.RE
.PP
-\fB\-idtype\fR \fIlist\fR
+\fB\-indexdir\fR \fIdirectory\fR
.RS 4
-Default value: all
.RE
.SS "Required section"
.SS "Advanced section"
@@ -63,7 +62,7 @@ Default value: N
.RE
.SS "Output section"
.PP
-\fB\-outfile\fR \fIoutfile\fR
+\fB\-$(dbname)\fR \fIoutfile\fR
.RS 4
.RE
.SH "BUGS"
diff --git a/debian/manpages/dbxresource.1e b/debian/manpages/dbxresource.1e
new file mode 100644
index 0000000..9f19c7d
--- /dev/null
+++ b/debian/manpages/dbxresource.1e
@@ -0,0 +1,122 @@
+'\" t
+.\" Title: DBXRESOURCE
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBXRESOURCE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbxresource \- Index a data resource catalogue using b+tree indices
+.SH "SYNOPSIS"
+.HP \w'\fBdbxresource\fR\ 'u
+\fBdbxresource\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-standardname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-filenames\ \fR\fB\fIstring\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-compressed\ \fR\fB\fIboolean\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-exclude\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdbxresource\fR\ 'u
+\fBdbxresource\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbxresource\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+Default value: drcat
+.RE
+.PP
+\fB\-standardname\fR \fIstring\fR
+.RS 4
+Default value: $(dbname)
+.RE
+.PP
+\fB\-dbresource\fR \fIstring\fR
+.RS 4
+Default value: drcatresource
+.RE
+.PP
+\fB\-directory\fR \fIdirectory\fR
+.RS 4
+Default value: \&.
+.RE
+.PP
+\fB\-filenames\fR \fIstring\fR
+.RS 4
+Default value: DRCAT\&.dat
+.RE
+.SS "Required section"
+.PP
+\fB\-fields\fR \fIlist\fR
+.RS 4
+Default value: *
+.RE
+.PP
+\fB\-compressed\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Advanced section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+Default value: 0\&.0
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.PP
+\fB\-exclude\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-indexoutdir\fR \fIoutdir\fR
+.RS 4
+Default value: \&.
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbxresource is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbxstat.1e b/debian/manpages/dbxstat.1e
index 0fd99ff..00bb5f7 100644
--- a/debian/manpages/dbxstat.1e
+++ b/debian/manpages/dbxstat.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DBXSTAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DBXSTAT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DBXSTAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -31,7 +31,7 @@
dbxstat \- Dump statistics for dbx databases
.SH "SYNOPSIS"
.HP \w'\fBdbxstat\fR\ 'u
-\fBdbxstat\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-indexdir\ \fR\fB\fIdirectory\fR\fR \fB\-idtype\ \fR\fB\fIlist\fR\fR \fB\-minimum\ \fR\fB\fIinteger\fR\fR \fB\-maximum\ \fR\fB\fIinteger\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+\fBdbxstat\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-field\ \fR\fB\fIstring\fR\fR \fB\-indexdir\ \fR\fB\fIdirectory\fR\fR \fB\-minimum\ \fR\fB\fIinteger\fR\fR \fB\-maximum\ \fR\fB\fIinteger\fR\fR \fB\-$(dbname)\ \fR\fB\fIoutfile\fR\fR
.HP \w'\fBdbxstat\fR\ 'u
\fBdbxstat\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -45,14 +45,13 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.RS 4
.RE
.PP
-\fB\-indexdir\fR \fIdirectory\fR
+\fB\-field\fR \fIstring\fR
.RS 4
-Default value: \&.
+Default value: id
.RE
.PP
-\fB\-idtype\fR \fIlist\fR
+\fB\-indexdir\fR \fIdirectory\fR
.RS 4
-Default value: id
.RE
.SS "Required section"
.SS "Advanced section"
@@ -67,7 +66,7 @@ Default value: 1
.RE
.SS "Output section"
.PP
-\fB\-outfile\fR \fIoutfile\fR
+\fB\-$(dbname)\fR \fIoutfile\fR
.RS 4
.RE
.SH "BUGS"
diff --git a/debian/manpages/dbxtax.1e b/debian/manpages/dbxtax.1e
new file mode 100644
index 0000000..b15d795
--- /dev/null
+++ b/debian/manpages/dbxtax.1e
@@ -0,0 +1,108 @@
+'\" t
+.\" Title: DBXTAX
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBXTAX" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbxtax \- Index NCBI taxonomy using b+tree indices
+.SH "SYNOPSIS"
+.HP \w'\fBdbxtax\fR\ 'u
+\fBdbxtax\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-dbresource\ \fR\fB\fIstring\fR\fR \fB\-directory\ \fR\fB\fIdirectory\fR\fR \fB\-fields\ \fR\fB\fIlist\fR\fR \fB\-compressed\ \fR\fB\fIboolean\fR\fR \fB\-release\ \fR\fB\fIstring\fR\fR \fB\-date\ \fR\fB\fIstring\fR\fR \fB\-indexoutdir\ \fR\fB\fIoutdir\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdbxtax\fR\ 'u
+\fBdbxtax\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbxtax\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+Default value: taxon
+.RE
+.PP
+\fB\-dbresource\fR \fIstring\fR
+.RS 4
+Default value: taxresource
+.RE
+.PP
+\fB\-directory\fR \fIdirectory\fR
+.RS 4
+Default value: \&.
+.RE
+.SS "Required section"
+.PP
+\fB\-fields\fR \fIlist\fR
+.RS 4
+Default value: *
+.RE
+.PP
+\fB\-compressed\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.SS "Advanced section"
+.PP
+\fB\-release\fR \fIstring\fR
+.RS 4
+Default value: 0\&.0
+.RE
+.PP
+\fB\-date\fR \fIstring\fR
+.RS 4
+Default value: 00/00/00
+.RE
+.SS "Output section"
+.PP
+\fB\-indexoutdir\fR \fIoutdir\fR
+.RS 4
+Default value: \&.
+.RE
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbxtax is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/dbxuncompress.1e b/debian/manpages/dbxuncompress.1e
new file mode 100644
index 0000000..50a2143
--- /dev/null
+++ b/debian/manpages/dbxuncompress.1e
@@ -0,0 +1,80 @@
+'\" t
+.\" Title: DBXUNCOMPRESS
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DBXUNCOMPRESS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+dbxuncompress \- Uncompress a compressed dbx index
+.SH "SYNOPSIS"
+.HP \w'\fBdbxuncompress\fR\ 'u
+\fBdbxuncompress\fR \fB\-dbname\ \fR\fB\fIstring\fR\fR \fB\-field\ \fR\fB\fIstring\fR\fR \fB\-indexdir\ \fR\fB\fIdirectory\fR\fR \fB\-$(dbname)\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdbxuncompress\fR\ 'u
+\fBdbxuncompress\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdbxuncompress\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Database indexing" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-dbname\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-field\fR \fIstring\fR
+.RS 4
+.RE
+.PP
+\fB\-indexdir\fR \fIdirectory\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-$(dbname)\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+dbxuncompress is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/degapseq.1e b/debian/manpages/degapseq.1e
index 6370e8a..9204310 100644
--- a/debian/manpages/degapseq.1e
+++ b/debian/manpages/degapseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DEGAPSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DEGAPSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DEGAPSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/density.1e b/debian/manpages/density.1e
index 1e498ff..7db46c4 100644
--- a/debian/manpages/density.1e
+++ b/debian/manpages/density.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DENSITY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DENSITY" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DENSITY" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/descseq.1e b/debian/manpages/descseq.1e
index 899e399..4129a78 100644
--- a/debian/manpages/descseq.1e
+++ b/debian/manpages/descseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DESCSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DESCSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DESCSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/diffseq.1e b/debian/manpages/diffseq.1e
index 679c0fa..b7ba76e 100644
--- a/debian/manpages/diffseq.1e
+++ b/debian/manpages/diffseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DIFFSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DIFFSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DIFFSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/digest.1e b/debian/manpages/digest.1e
index a0f3b22..5288887 100644
--- a/debian/manpages/digest.1e
+++ b/debian/manpages/digest.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DIGEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DIGEST" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DIGEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/distmat.1e b/debian/manpages/distmat.1e
index e664209..1360376 100644
--- a/debian/manpages/distmat.1e
+++ b/debian/manpages/distmat.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DISTMAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DISTMAT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DISTMAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/docxmlvalid.1e b/debian/manpages/docxmlvalid.1e
new file mode 100644
index 0000000..0276b1b
--- /dev/null
+++ b/debian/manpages/docxmlvalid.1e
@@ -0,0 +1,82 @@
+'\" t
+.\" Title: DOCXMLVALID
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DOCXMLVALID" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+docxmlvalid \- Check an XML document is well formed and conforms to a schema
+.SH "SYNOPSIS"
+.HP \w'\fBdocxmlvalid\fR\ 'u
+\fBdocxmlvalid\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-schema\ \fR\fB\fIinfile\fR\fR \fB\-validate\ \fR\fB\fIlist\fR\fR \fB\-logfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdocxmlvalid\fR\ 'u
+\fBdocxmlvalid\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdocxmlvalid\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.PP
+\fB\-schema\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-validate\fR \fIlist\fR
+.RS 4
+This option specifies the type (DTD, XSD or Relax\-NG) of the supplied which will be used to validated the supplied XML file\&. Default value: D
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-logfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+docxmlvalid is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/docxmlwell.1e b/debian/manpages/docxmlwell.1e
new file mode 100644
index 0000000..08301cc
--- /dev/null
+++ b/debian/manpages/docxmlwell.1e
@@ -0,0 +1,73 @@
+'\" t
+.\" Title: DOCXMLWELL
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DOCXMLWELL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+docxmlwell \- Check an XML document is well formed
+.SH "SYNOPSIS"
+.HP \w'\fBdocxmlwell\fR\ 'u
+\fBdocxmlwell\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-logfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdocxmlwell\fR\ 'u
+\fBdocxmlwell\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdocxmlwell\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-logfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+docxmlwell is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/domtesta.1e b/debian/manpages/domtesta.1e
index e6afcd4..8c38cfc 100644
--- a/debian/manpages/domtesta.1e
+++ b/debian/manpages/domtesta.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DOMTESTA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DOMTESTA" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DOMTESTA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/domtestb.1e b/debian/manpages/domtestb.1e
index 62b53f1..8eba77d 100644
--- a/debian/manpages/domtestb.1e
+++ b/debian/manpages/domtestb.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DOMTESTB
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DOMTESTB" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DOMTESTB" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/domtestc.1e b/debian/manpages/domtestc.1e
index 45c6955..61eb816 100644
--- a/debian/manpages/domtestc.1e
+++ b/debian/manpages/domtestc.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DOMTESTC
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DOMTESTC" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DOMTESTC" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/domtestd.1e b/debian/manpages/domtestd.1e
index 589f881..8935d04 100644
--- a/debian/manpages/domtestd.1e
+++ b/debian/manpages/domtestd.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DOMTESTD
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DOMTESTD" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DOMTESTD" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dotmatcher.1e b/debian/manpages/dotmatcher.1e
index 7ce68b8..f4c112f 100644
--- a/debian/manpages/dotmatcher.1e
+++ b/debian/manpages/dotmatcher.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DOTMATCHER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DOTMATCHER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DOTMATCHER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dotpath.1e b/debian/manpages/dotpath.1e
index 98ea891..3e6cf33 100644
--- a/debian/manpages/dotpath.1e
+++ b/debian/manpages/dotpath.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DOTPATH
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DOTPATH" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DOTPATH" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dottup.1e b/debian/manpages/dottup.1e
index 0da7c2b..988ad80 100644
--- a/debian/manpages/dottup.1e
+++ b/debian/manpages/dottup.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DOTTUP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DOTTUP" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DOTTUP" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/dreg.1e b/debian/manpages/dreg.1e
index cc52e7e..9769ecf 100644
--- a/debian/manpages/dreg.1e
+++ b/debian/manpages/dreg.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: DREG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "DREG" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "DREG" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/drfinddata.1e b/debian/manpages/drfinddata.1e
new file mode 100644
index 0000000..3d6fe12
--- /dev/null
+++ b/debian/manpages/drfinddata.1e
@@ -0,0 +1,82 @@
+'\" t
+.\" Title: DRFINDDATA
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DRFINDDATA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+drfinddata \- Find public databases by data type
+.SH "SYNOPSIS"
+.HP \w'\fBdrfinddata\fR\ 'u
+\fBdrfinddata\fR \fB\-query\ \fR\fB\fIstring\fR\fR \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-drfinddata\ \fR\fB\fIoutresource\fR\fR
+.HP \w'\fBdrfinddata\fR\ 'u
+\fBdrfinddata\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdrfinddata\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Data retrieval:Resource data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-query\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-drfinddata\fR \fIoutresource\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+drfinddata is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/drfindformat.1e b/debian/manpages/drfindformat.1e
new file mode 100644
index 0000000..2aba988
--- /dev/null
+++ b/debian/manpages/drfindformat.1e
@@ -0,0 +1,82 @@
+'\" t
+.\" Title: DRFINDFORMAT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DRFINDFORMAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+drfindformat \- Find public databases by format
+.SH "SYNOPSIS"
+.HP \w'\fBdrfindformat\fR\ 'u
+\fBdrfindformat\fR \fB\-query\ \fR\fB\fIstring\fR\fR \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-drfindformat\ \fR\fB\fIoutresource\fR\fR
+.HP \w'\fBdrfindformat\fR\ 'u
+\fBdrfindformat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdrfindformat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Data retrieval:Resource data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-query\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-drfindformat\fR \fIoutresource\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+drfindformat is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/drfindid.1e b/debian/manpages/drfindid.1e
new file mode 100644
index 0000000..8e4d0f8
--- /dev/null
+++ b/debian/manpages/drfindid.1e
@@ -0,0 +1,82 @@
+'\" t
+.\" Title: DRFINDID
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DRFINDID" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+drfindid \- Find public databases by identifier
+.SH "SYNOPSIS"
+.HP \w'\fBdrfindid\fR\ 'u
+\fBdrfindid\fR \fB\-query\ \fR\fB\fIstring\fR\fR \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-drfindid\ \fR\fB\fIoutresource\fR\fR
+.HP \w'\fBdrfindid\fR\ 'u
+\fBdrfindid\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdrfindid\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Data retrieval:Resource data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-query\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-drfindid\fR \fIoutresource\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+drfindid is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/drfindresource.1e b/debian/manpages/drfindresource.1e
new file mode 100644
index 0000000..9badd09
--- /dev/null
+++ b/debian/manpages/drfindresource.1e
@@ -0,0 +1,82 @@
+'\" t
+.\" Title: DRFINDRESOURCE
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DRFINDRESOURCE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+drfindresource \- Find public databases by resource
+.SH "SYNOPSIS"
+.HP \w'\fBdrfindresource\fR\ 'u
+\fBdrfindresource\fR \fB\-query\ \fR\fB\fIstring\fR\fR \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-drfindresource\ \fR\fB\fIoutresource\fR\fR
+.HP \w'\fBdrfindresource\fR\ 'u
+\fBdrfindresource\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdrfindresource\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Data retrieval:Resource data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-query\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: Y
+.RE
+.SS "Output section"
+.PP
+\fB\-drfindresource\fR \fIoutresource\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+drfindresource is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/drget.1e b/debian/manpages/drget.1e
new file mode 100644
index 0000000..9e18a29
--- /dev/null
+++ b/debian/manpages/drget.1e
@@ -0,0 +1,72 @@
+'\" t
+.\" Title: DRGET
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DRGET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+drget \- Get data resource entries
+.SH "SYNOPSIS"
+.HP \w'\fBdrget\fR\ 'u
+\fBdrget\fR \fB\-resources\ \fR\fB\fIresource\fR\fR \fB\-outfile\ \fR\fB\fIoutresource\fR\fR
+.HP \w'\fBdrget\fR\ 'u
+\fBdrget\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdrget\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Resource data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-resources\fR \fIresource\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutresource\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+drget is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/drtext.1e b/debian/manpages/drtext.1e
new file mode 100644
index 0000000..015d979
--- /dev/null
+++ b/debian/manpages/drtext.1e
@@ -0,0 +1,72 @@
+'\" t
+.\" Title: DRTEXT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "DRTEXT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+drtext \- Get data resource entries complete text
+.SH "SYNOPSIS"
+.HP \w'\fBdrtext\fR\ 'u
+\fBdrtext\fR \fB\-resources\ \fR\fB\fIresource\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBdrtext\fR\ 'u
+\fBdrtext\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBdrtext\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Resource data,Data retrieval:Text data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-resources\fR \fIresource\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+drtext is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/edamclean.1e b/debian/manpages/edamclean.1e
index 66b787e..889d25e 100644
--- a/debian/manpages/edamclean.1e
+++ b/debian/manpages/edamclean.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EDAMCLEAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EDAMCLEAN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EDAMCLEAN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -31,7 +31,7 @@
edamclean \- Validate and fix EDAM OBO ontology
.SH "SYNOPSIS"
.HP \w'\fBedamclean\fR\ 'u
-\fBedamclean\fR \fB\-edamin\ \fR\fB\fIinfile\fR\fR \fB\-mode\ \fR\fB\fIselection\fR\fR \fB\-edamout\ \fR\fB\fIoutfile\fR\fR \fB\-log\ \fR\fB\fIoutfile\fR\fR \fB\-xml\ \fR\fB\fIoutfile\fR\fR
+\fBedamclean\fR \fB\-edaminfile\ \fR\fB\fIinfile\fR\fR \fB\-taxdirectory\ \fR\fB\fIdirectory\fR\fR \fB\-mode\ \fR\fB\fIselection\fR\fR \fB\-edamoutfile\ \fR\fB\fIoutfile\fR\fR \fB\-logfile\ \fR\fB\fIoutfile\fR\fR \fB\-xmlfile\ \fR\fB\fIoutfile\fR\fR \fB\-xmloutdir\ \fR\fB\fIoutdir\fR\fR
.HP \w'\fBedamclean\fR\ 'u
\fBedamclean\fR \fB\-help\fR
.SH "DESCRIPTION"
@@ -41,10 +41,14 @@ is a command line program from EMBOSS (\(lqthe European Molecular Biology Open S
.SH "OPTIONS"
.SS "Input section"
.PP
-\fB\-edamin\fR \fIinfile\fR
+\fB\-edaminfile\fR \fIinfile\fR
.RS 4
Default value: /homes/jison/edam/EDAM\&.obo
.RE
+.PP
+\fB\-taxdirectory\fR \fIdirectory\fR
+.RS 4
+.RE
.SS "Required section"
.PP
\fB\-mode\fR \fIselection\fR
@@ -54,20 +58,24 @@ Default value: Report only
.SS "Advanced section"
.SS "Output section"
.PP
-\fB\-edamout\fR \fIoutfile\fR
+\fB\-edamoutfile\fR \fIoutfile\fR
.RS 4
Default value: EDAM_out\&.obo
.RE
.PP
-\fB\-log\fR \fIoutfile\fR
+\fB\-logfile\fR \fIoutfile\fR
.RS 4
Default value: EDAM_out\&.log
.RE
.PP
-\fB\-xml\fR \fIoutfile\fR
+\fB\-xmlfile\fR \fIoutfile\fR
.RS 4
Default value: EDAM_out\&.xml
.RE
+.PP
+\fB\-xmloutdir\fR \fIoutdir\fR
+.RS 4
+.RE
.SH "BUGS"
.PP
Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
diff --git a/debian/manpages/edamdef.1e b/debian/manpages/edamdef.1e
new file mode 100644
index 0000000..4dd5add
--- /dev/null
+++ b/debian/manpages/edamdef.1e
@@ -0,0 +1,87 @@
+'\" t
+.\" Title: EDAMDEF
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "EDAMDEF" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+edamdef \- Find EDAM ontology terms by definition
+.SH "SYNOPSIS"
+.HP \w'\fBedamdef\fR\ 'u
+\fBedamdef\fR \fB\-query\ \fR\fB\fIstring\fR\fR [\fB\-namespace\ \fR\fB\fIlist\fR\fR] \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-edamdef\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBedamdef\fR\ 'u
+\fBedamdef\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBedamdef\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-query\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-namespace\fR \fIlist\fR
+.RS 4
+By default all terms are returned\&. Searches can be limited to one or a few namespaces\&. Default value: *
+.RE
+.SS "Advanced section"
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: N
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-edamdef\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+edamdef is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/edamhasinput.1e b/debian/manpages/edamhasinput.1e
new file mode 100644
index 0000000..85fc908
--- /dev/null
+++ b/debian/manpages/edamhasinput.1e
@@ -0,0 +1,92 @@
+'\" t
+.\" Title: EDAMHASINPUT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "EDAMHASINPUT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+edamhasinput \- Find EDAM ontology terms by has_input relation
+.SH "SYNOPSIS"
+.HP \w'\fBedamhasinput\fR\ 'u
+\fBedamhasinput\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-namespace\ \fR\fB\fIlist\fR\fR] \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-edamhasinput\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBedamhasinput\fR\ 'u
+\fBedamhasinput\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBedamhasinput\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-namespace\fR \fIlist\fR
+.RS 4
+By default all terms are returned\&. Searches can be limited to one or a few namespaces\&. Default value: *
+.RE
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: N
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-edamhasinput\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+edamhasinput is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/edamhasoutput.1e b/debian/manpages/edamhasoutput.1e
new file mode 100644
index 0000000..16e9063
--- /dev/null
+++ b/debian/manpages/edamhasoutput.1e
@@ -0,0 +1,92 @@
+'\" t
+.\" Title: EDAMHASOUTPUT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "EDAMHASOUTPUT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+edamhasoutput \- Find EDAM ontology terms by has_output relation
+.SH "SYNOPSIS"
+.HP \w'\fBedamhasoutput\fR\ 'u
+\fBedamhasoutput\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-namespace\ \fR\fB\fIlist\fR\fR] \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-edamhasoutput\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBedamhasoutput\fR\ 'u
+\fBedamhasoutput\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBedamhasoutput\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-namespace\fR \fIlist\fR
+.RS 4
+By default all terms are returned\&. Searches can be limited to one or a few namespaces\&. Default value: *
+.RE
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: N
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-edamhasoutput\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+edamhasoutput is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/edamisformat.1e b/debian/manpages/edamisformat.1e
new file mode 100644
index 0000000..900bc40
--- /dev/null
+++ b/debian/manpages/edamisformat.1e
@@ -0,0 +1,92 @@
+'\" t
+.\" Title: EDAMISFORMAT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "EDAMISFORMAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+edamisformat \- Find EDAM ontology terms by is_format_of relation
+.SH "SYNOPSIS"
+.HP \w'\fBedamisformat\fR\ 'u
+\fBedamisformat\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-namespace\ \fR\fB\fIlist\fR\fR] \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-edamisformat\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBedamisformat\fR\ 'u
+\fBedamisformat\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBedamisformat\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-namespace\fR \fIlist\fR
+.RS 4
+By default all terms are returned\&. Searches can be limited to one or a few namespaces\&. Default value: *
+.RE
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: N
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-edamisformat\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+edamisformat is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/edamisid.1e b/debian/manpages/edamisid.1e
new file mode 100644
index 0000000..099cb7e
--- /dev/null
+++ b/debian/manpages/edamisid.1e
@@ -0,0 +1,92 @@
+'\" t
+.\" Title: EDAMISID
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "EDAMISID" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+edamisid \- Find EDAM ontology terms by is_identifier_of relation
+.SH "SYNOPSIS"
+.HP \w'\fBedamisid\fR\ 'u
+\fBedamisid\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-namespace\ \fR\fB\fIlist\fR\fR] \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-edamisid\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBedamisid\fR\ 'u
+\fBedamisid\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBedamisid\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-namespace\fR \fIlist\fR
+.RS 4
+By default all terms are returned\&. Searches can be limited to one or a few namespaces\&. Default value: *
+.RE
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: N
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-edamisid\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+edamisid is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/edamname.1e b/debian/manpages/edamname.1e
new file mode 100644
index 0000000..e77aa33
--- /dev/null
+++ b/debian/manpages/edamname.1e
@@ -0,0 +1,87 @@
+'\" t
+.\" Title: EDAMNAME
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "EDAMNAME" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+edamname \- Find EDAM ontology terms by name
+.SH "SYNOPSIS"
+.HP \w'\fBedamname\fR\ 'u
+\fBedamname\fR \fB\-query\ \fR\fB\fIstring\fR\fR [\fB\-namespace\ \fR\fB\fIlist\fR\fR] \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-edamname\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBedamname\fR\ 'u
+\fBedamname\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBedamname\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-query\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-namespace\fR \fIlist\fR
+.RS 4
+By default all terms are returned\&. Searches can be limited to one or a few namespaces\&. Default value: *
+.RE
+.SS "Advanced section"
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: N
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-edamname\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+edamname is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/edialign.1e b/debian/manpages/edialign.1e
index e2d92e5..483f80a 100644
--- a/debian/manpages/edialign.1e
+++ b/debian/manpages/edialign.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EDIALIGN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EDIALIGN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EDIALIGN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/einverted.1e b/debian/manpages/einverted.1e
index 61bc04a..52a7fbf 100644
--- a/debian/manpages/einverted.1e
+++ b/debian/manpages/einverted.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EINVERTED
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EINVERTED" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EINVERTED" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -69,7 +69,7 @@ Default value: \-4
.PP
\fB\-maxrepeat\fR \fIinteger\fR
.RS 4
-Maximum separation between the start of repeat and the end of the inverted repeat (the default is 2000 bases)\&. Default value: 2000
+Maximum separation between the start of repeat and the end of the inverted repeat\&. Default value: 2000
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/embossdata.1e b/debian/manpages/embossdata.1e
index 46380b8..862d8a5 100644
--- a/debian/manpages/embossdata.1e
+++ b/debian/manpages/embossdata.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EMBOSSDATA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EMBOSSDATA" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EMBOSSDATA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ embossdata \- Find and retrieve EMBOSS data files
.SH "DESCRIPTION"
.PP
\fBembossdata\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/embossversion.1e b/debian/manpages/embossversion.1e
index f1174e5..0c7c2a0 100644
--- a/debian/manpages/embossversion.1e
+++ b/debian/manpages/embossversion.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EMBOSSVERSION
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EMBOSSVERSION" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EMBOSSVERSION" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ embossversion \- Reports the current EMBOSS version number
.SH "DESCRIPTION"
.PP
\fBembossversion\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils" command group(s)\&.
.SH "OPTIONS"
.SS "Additional section"
.PP
diff --git a/debian/manpages/emma.1e b/debian/manpages/emma.1e
index 8abff68..343253f 100644
--- a/debian/manpages/emma.1e
+++ b/debian/manpages/emma.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EMMA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EMMA" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EMMA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/emowse.1e b/debian/manpages/emowse.1e
index 569a4d7..84818c7 100644
--- a/debian/manpages/emowse.1e
+++ b/debian/manpages/emowse.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EMOWSE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EMOWSE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EMOWSE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/ensembltest.1e b/debian/manpages/ensembltest.1e
index 67badc8..7f83ab9 100644
--- a/debian/manpages/ensembltest.1e
+++ b/debian/manpages/ensembltest.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ENSEMBLTEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ENSEMBLTEST" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ENSEMBLTEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/entrails.1e b/debian/manpages/entrails.1e
index 13ced9a..abbb1ef 100644
--- a/debian/manpages/entrails.1e
+++ b/debian/manpages/entrails.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ENTRAILS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ENTRAILS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ENTRAILS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/entrailsbook.1e b/debian/manpages/entrailsbook.1e
index 5019ca1..175ec14 100644
--- a/debian/manpages/entrailsbook.1e
+++ b/debian/manpages/entrailsbook.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ENTRAILSBOOK
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ENTRAILSBOOK" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ENTRAILSBOOK" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/entrailshtml.1e b/debian/manpages/entrailshtml.1e
index 028d77b..1484f59 100644
--- a/debian/manpages/entrailshtml.1e
+++ b/debian/manpages/entrailshtml.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ENTRAILSHTML
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ENTRAILSHTML" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ENTRAILSHTML" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/entrailswiki.1e b/debian/manpages/entrailswiki.1e
index b3c50c2..67682eb 100644
--- a/debian/manpages/entrailswiki.1e
+++ b/debian/manpages/entrailswiki.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ENTRAILSWIKI
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ENTRAILSWIKI" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ENTRAILSWIKI" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/entret.1e b/debian/manpages/entret.1e
index 538994a..e0b6d92 100644
--- a/debian/manpages/entret.1e
+++ b/debian/manpages/entret.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ENTRET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ENTRET" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ENTRET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ entret \- Retrieves sequence entries from flatfile databases and files
.SH "DESCRIPTION"
.PP
\fBentret\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit,Data retrieval:Sequence data,Data retrieval:Text data" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/entrygo.1e b/debian/manpages/entrygo.1e
new file mode 100644
index 0000000..bf7e73e
--- /dev/null
+++ b/debian/manpages/entrygo.1e
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: ENTRYGO
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ENTRYGO" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+entrygo \- Identify and retrieve sequence entries containing GO terms
+.SH "SYNOPSIS"
+.HP \w'\fBentrygo\fR\ 'u
+\fBentrygo\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-term\ \fR\fB\fIstring\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP \w'\fBentrygo\fR\ 'u
+\fBentrygo\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBentrygo\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-term\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+entrygo is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/entrytax.1e b/debian/manpages/entrytax.1e
new file mode 100644
index 0000000..26aafca
--- /dev/null
+++ b/debian/manpages/entrytax.1e
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: ENTRYTAX
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ENTRYTAX" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+entrytax \- Identify and retrieve sequence entries containing taxonomy IDs
+.SH "SYNOPSIS"
+.HP \w'\fBentrytax\fR\ 'u
+\fBentrytax\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-ids\ \fR\fB\fIstring\fR\fR \fB\-outseq\ \fR\fB\fIseqoutall\fR\fR
+.HP \w'\fBentrytax\fR\ 'u
+\fBentrytax\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBentrytax\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-ids\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outseq\fR \fIseqoutall\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+entrytax is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/epestfind.1e b/debian/manpages/epestfind.1e
index 3dbfe13..7af2f18 100644
--- a/debian/manpages/epestfind.1e
+++ b/debian/manpages/epestfind.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EPESTFIND
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EPESTFIND" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EPESTFIND" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/eprimer3.1e b/debian/manpages/eprimer3.1e
index 3220ec6..5e620fe 100644
--- a/debian/manpages/eprimer3.1e
+++ b/debian/manpages/eprimer3.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EPRIMER3
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EPRIMER3" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EPRIMER3" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/eprimer32.1e b/debian/manpages/eprimer32.1e
new file mode 100644
index 0000000..1d0d6ec
--- /dev/null
+++ b/debian/manpages/eprimer32.1e
@@ -0,0 +1,375 @@
+'\" t
+.\" Title: EPRIMER32
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "EPRIMER32" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+eprimer32 \- Picks PCR primers and hybridization oligos
+.SH "SYNOPSIS"
+.HP \w'\fBeprimer32\fR\ 'u
+\fBeprimer32\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR [\fB\-primer\ \fR\fB\fItoggle\fR\fR] \fB\-task\ \fR\fB\fIlist\fR\fR [\fB\-hybridprobe\ \fR\fB\fItoggle\fR\fR] \fB\-mishyblibraryfile\ \fR\fB\fIinfile\fR\fR \fB\-mispriminglibraryfile\ \fR\fB\fIinfile\fR\fR [\fB\-numreturn\ \fR\fB\fIinteger\fR\fR] [\fB\-includedregion\ \fR\fB\fIrange\fR\fR] [\fB\-targetregion\ \fR\fB\fIrange\fR\fR] [\fB\-excludedregion\ \fR\fB\fIrange\fR\fR] [\fB\-forwardinput\ \fR\fB\fIstring\fR\fR] [\fB\-reverseinput\ \fR\fB\fIstring\fR\fR] \fB\-gcclamp\ \fR\fB\fIinteger\fR\fR \fB\-osize\ \fR\fB\fIinteger\fR\fR \fB\-minsize\ \fR\fB\fIinteger\fR\fR \fB\-maxsize\ \fR\fB\fIinteger\fR\fR \fB\-otm\ \fR\fB\fIfloat\fR\fR \fB\-mintm\ \fR\fB\fIfloat\fR\fR \fB\-maxtm\ \fR\fB\fIfloat\fR\fR \fB\-maxdifftm\ \fR\fB\fIfloat\fR\fR \fB\-ogcpercent\ \fR\fB\fIfloat\fR\fR \fB\-mingc\ \fR\fB\fIfloat\fR\fR \fB\-maxgc\ \fR\fB\fIfloat\fR\fR \fB\-saltconc\ \fR\fB\fIfloat\fR\fR \fB\-dnaconc\ \fR\fB\fIfloat\fR\fR \fB\-maxpolyx\ \fR\fB\fIinteger\fR\fR \fB\-psizeopt\ \fR\fB\fIinteger\fR\fR \fB\-prange\ \fR\fB\fIrange\fR\fR \fB\-ptmopt\ \fR\fB\fIfloat\fR\fR \fB\-ptmmin\ \fR\fB\fIfloat\fR\fR \fB\-ptmmax\ \fR\fB\fIfloat\fR\fR \fB\-oexcludedregion\ \fR\fB\fIrange\fR\fR \fB\-oligoinput\ \fR\fB\fIstring\fR\fR \fB\-osizeopt\ \fR\fB\fIinteger\fR\fR \fB\-ominsize\ \fR\fB\fIinteger\fR\fR \fB\-omaxsize\ \fR\fB\fIinteger\fR\fR \fB\-otmopt\ \fR\fB\fIfloat\fR\fR \fB\-otmmin\ \fR\fB\fIfloat\fR\fR \fB\-otmmax\ \fR\fB\fIfloat\fR\fR \fB\-ogcopt\ \fR\fB\fIfloat\fR\fR \fB\-ogcmin\ \fR\fB\fIfloat\fR\fR \fB\-ogcmax\ \fR\fB\fIfloat\fR\fR \fB\-osaltconc\ \fR\fB\fIfloat\fR\fR \fB\-odnaconc\ \fR\fB\fIfloat\fR\fR \fB\-oanyself\ \fR\fB\fIfloat\fR\fR \fB\-oendself\ \fR\fB\fIfloat\fR\fR \fB\-opolyxmax\ \fR\fB\fIinteger\fR\fR \fB\-omishybmax\ \fR\fB\fIfloat\fR\fR \fB\-explainflag\ \fR\fB\fIboolean\fR\fR \fB\-fileflag\ \fR\fB\fIboolean\fR\fR \fB\-firstbaseindex\ \fR\fB\fIinteger\fR\fR \fB\-pickanyway\ \fR\fB\fIboolean\fR\fR \fB\-maxmispriming\ \fR\fB\fIfloat\fR\fR \fB\-pairmaxmispriming\ \fR\fB\fIfloat\fR\fR \fB\-numnsaccepted\ \fR\fB\fIinteger\fR\fR \fB\-selfany\ \fR\fB\fIfloat\fR\fR \fB\-selfend\ \fR\fB\fIfloat\fR\fR \fB\-scorrection\ \fR\fB\fIlist\fR\fR \fB\-tmformula\ \fR\fB\fIlist\fR\fR \fB\-maxendstability\ \fR\fB\fIfloat\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBeprimer32\fR\ 'u
+\fBeprimer32\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBeprimer32\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Primers" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+The sequence from which to choose primers\&. The sequence must be presented 5\*(Aq to 3\*(Aq
+.RE
+.PP
+\fB\-primer\fR \fItoggle\fR
+.RS 4
+Tell Eprimer32 to pick primer(s) Default value: Y
+.RE
+.PP
+\fB\-task\fR \fIlist\fR
+.RS 4
+Tell Eprimer32 what task to perform\&. Legal values are 1: \*(AqPick PCR primers\*(Aq, 2: \*(AqPick forward primer only\*(Aq, 3: \*(AqPick reverse primer only\*(Aq, 4: \*(AqNo primers needed\*(Aq\&. Default value: 1
+.RE
+.PP
+\fB\-hybridprobe\fR \fItoggle\fR
+.RS 4
+An \*(Aqinternal oligo\*(Aq is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification\&. Default value: N
+.RE
+.PP
+\fB\-mishyblibraryfile\fR \fIinfile\fR
+.RS 4
+Similar to MISPRIMING\-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them\&. The file must be in (a slightly restricted) FASTA format (W\&. B\&. Pearson and D\&.J\&. Lipman, PNAS 85:8 pp 2444\-2448 [1988]); we briefly discuss the organization of this file below\&. If this parameter is specified then Eprimer32 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL\-OLIGO\-MAX\-MISHYB\&. (The maximum value of the weight is arbitrarily set to 12\&.0\&.) Each sequence entry in the FASTA\-format file must begin with an \*(Aqid line\*(Aq that starts with \*(Aq>\*(Aq\&. The contents of the id line is \*(Aqslightly restricted\*(Aq in that Eprimer32 parses everything after any optional asterisk (\*(Aq*\*(Aq) as a floating point number to use as the weight mentioned above\&. If the id line contains no asterisk then the weight defaults to 1\&.0\&. The alignment scoring system used is the same as for calculating complementarity among oligos (e\&.g\&. SELF\-ANY)\&. The remainder of an entry contains the sequence as lines following the id line up until a line starting with \*(Aq>\*(Aq or the end of the file\&. Whitespace and newlines are ignored\&. Characters \*(AqA\*(Aq, \*(AqT\*(Aq, \*(AqG\*(Aq, \*(AqC\*(Aq, \*(Aqa\*(Aq, \*(Aqt\*(Aq, \*(Aqg\*(Aq, \*(Aqc\*(Aq are retained and any other character is converted to \*(AqN\*(Aq (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to \*(AqN\*(Aq)\&. There are no restrictions on line length\&. An empty value for this parameter indicates that no library should be used\&.
+.RE
+.PP
+\fB\-mispriminglibraryfile\fR \fIinfile\fR
+.RS 4
+The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified\&.) The file must be in (a slightly restricted) FASTA format (W\&. B\&. Pearson and D\&.J\&. Lipman, PNAS 85:8 pp 2444\-2448 [1988]); we briefly discuss the organization of this file below\&. If this parameter is specified then Eprimer32 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX\-MISPRIMING\&. (The maximum value of the weight is arbitrarily set to 100\&.0\&.) Each sequence entry in the FASTA\-format file must begin with an \*(Aqid line\*(Aq that starts with \*(Aq>\*(Aq\&. The contents of the id line is \*(Aqslightly restricted\*(Aq in that Eprimer32 parses everything after any optional asterisk (\*(Aq*\*(Aq) as a floating point number to use as the weight mentioned above\&. If the id line contains no asterisk then the weight defaults to 1\&.0\&. The alignment scoring system used is the same as for calculating complementarity among oligos (e\&.g\&. SELF\-ANY)\&. The remainder of an entry contains the sequence as lines following the id line up until a line starting with \*(Aq>\*(Aq or the end of the file\&. Whitespace and newlines are ignored\&. Characters \*(AqA\*(Aq, \*(AqT\*(Aq, \*(AqG\*(Aq, \*(AqC\*(Aq, \*(Aqa\*(Aq, \*(Aqt\*(Aq, \*(Aqg\*(Aq, \*(Aqc\*(Aq are retained and any other character is converted to \*(AqN\*(Aq (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to \*(AqN\*(Aq)\&. There are no restrictions on line length\&. An empty value for this parameter indicates that no repeat library should be used\&.
+.RE
+.SS "Additional section"
+.SS "Program options"
+.PP
+\fB\-numreturn\fR \fIinteger\fR
+.RS 4
+The maximum number of primer pairs to return\&. Primer pairs returned are sorted by their \*(Aqquality\*(Aq, in other words by the value of the objective function (where a lower number indicates a better primer pair)\&. Caution: setting this parameter to a large value will increase running time\&. Default value: 5
+.RE
+.SS "Sequence options"
+.PP
+\fB\-includedregion\fR \fIrange\fR
+.RS 4
+A sub\-region of the given sequence in which to pick primers\&. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration\&. The value for this parameter has the form (start),(end) where (start) is the index of the first base to consider, and (end) is the last in the primer\-picking region\&.
+.RE
+.PP
+\fB\-targetregion\fR \fIrange\fR
+.RS 4
+If one or more Targets is specified then a legal primer pair must flank at least one of them\&. A Target might be a simple sequence repeat site (for example a CA repeat) or a single\-base\-pair polymorphism\&. The value should be a space\-separated list of (start),(end) pairs where (start) is the index of the first base of a Target, and (end) is the last E\&.g\&. 50,51 requires primers to surround the 2 bases at positions 50 and 51\&.
+.RE
+.PP
+\fB\-excludedregion\fR \fIrange\fR
+.RS 4
+Primer oligos may not overlap any region specified in this tag\&. The associated value must be a space\-separated list of (start),(end) pairs where (start) is the index of the first base of the excluded region, and and (end) is the last\&. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs\&. E\&.g\&. 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68\&.
+.RE
+.PP
+\fB\-forwardinput\fR \fIstring\fR
+.RS 4
+The sequence of a forward primer to check and around which to design reverse primers and optional internal oligos\&. Must be a substring of SEQUENCE\&.
+.RE
+.PP
+\fB\-reverseinput\fR \fIstring\fR
+.RS 4
+The sequence of a reverse primer to check and around which to design forward primers and optional internal oligos\&. Must be a substring of the reverse strand of SEQUENCE\&.
+.RE
+.SS "Primer options"
+.PP
+\fB\-gcclamp\fR \fIinteger\fR
+.RS 4
+Require the specified number of consecutive Gs and Cs at the 3\*(Aq end of both the forward and reverse primer\&. (This parameter has no effect on the internal oligo if one is requested\&.)
+.RE
+.PP
+\fB\-osize\fR \fIinteger\fR
+.RS 4
+Optimum length (in bases) of a primer oligo\&. Eprimer32 will attempt to pick primers close to this length\&. Default value: 20
+.RE
+.PP
+\fB\-minsize\fR \fIinteger\fR
+.RS 4
+Minimum acceptable length of a primer\&. Must be greater than 0 and less than or equal to MAX\-SIZE\&. Default value: 18
+.RE
+.PP
+\fB\-maxsize\fR \fIinteger\fR
+.RS 4
+Maximum acceptable length (in bases) of a primer\&. Currently this parameter cannot be larger than 35\&. This limit is governed by the maximum oligo size for which Eprimer32\*(Aqs melting\-temperature is valid\&. Default value: 27
+.RE
+.PP
+\fB\-otm\fR \fIfloat\fR
+.RS 4
+Optimum melting temperature(Celsius) for a primer oligo\&. Eprimer32 will try to pick primers with melting temperatures are close to this temperature\&. The oligo melting temperature formula in Eprimer32 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409\-6412 and Breslauer, Frank, Bloecker and Marky, Proc\&. Natl\&. Acad\&. Sci\&. USA, vol 83, pp 3746\-3750\&. Please refer to the former paper for background discussion\&. Default value: 60\&.0
+.RE
+.PP
+\fB\-mintm\fR \fIfloat\fR
+.RS 4
+Minimum acceptable melting temperature(Celsius) for a primer oligo\&. Default value: 57\&.0
+.RE
+.PP
+\fB\-maxtm\fR \fIfloat\fR
+.RS 4
+Maximum acceptable melting temperature(Celsius) for a primer oligo\&. Default value: 63\&.0
+.RE
+.PP
+\fB\-maxdifftm\fR \fIfloat\fR
+.RS 4
+Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers\&. Default value: 100\&.0
+.RE
+.PP
+\fB\-ogcpercent\fR \fIfloat\fR
+.RS 4
+Primer optimum GC percent\&. Default value: 50\&.0
+.RE
+.PP
+\fB\-mingc\fR \fIfloat\fR
+.RS 4
+Minimum allowable percentage of Gs and Cs in any primer\&. Default value: 20\&.0
+.RE
+.PP
+\fB\-maxgc\fR \fIfloat\fR
+.RS 4
+Maximum allowable percentage of Gs and Cs in any primer generated by Primer\&. Default value: 80\&.0
+.RE
+.PP
+\fB\-saltconc\fR \fIfloat\fR
+.RS 4
+The millimolar concentration of salt (usually KCl) in the PCR\&. Eprimer32 uses this argument to calculate oligo melting temperatures\&. Default value: 50\&.0
+.RE
+.PP
+\fB\-dnaconc\fR \fIfloat\fR
+.RS 4
+The nanomolar concentration of annealing oligos in the PCR\&. Eprimer32 uses this argument to calculate oligo melting temperatures\&. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research\-\-0\&.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0\&.025 units/microliter Taq polymerase in 0\&.1 mM each dNTP, 1\&.5mM MgCl2, 50mM KCl, 10mM Tris\-HCL (pH 9\&.3) using 35 cycles with an annealing temperature of 56 degrees Celsius\&. This parameter corresponds to \*(Aqc\*(Aq in Rychlik, Spencer and Rhoads\*(Aq equation (ii) (Nucleic Acids Research, vol 18, num 21) where a suitable value (for a lower initial concentration of template) is \*(Aqempirically determined\*(Aq\&. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle\&. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures\&. See ADVICE FOR PICKING PRIMERS\&. Default value: 50\&.0
+.RE
+.PP
+\fB\-maxpolyx\fR \fIinteger\fR
+.RS 4
+The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA\&. Default value: 5
+.RE
+.SS "Product options"
+.PP
+\fB\-psizeopt\fR \fIinteger\fR
+.RS 4
+The optimum size for the PCR product\&. 0 indicates that there is no optimum product size\&. Default value: 200
+.RE
+.PP
+\fB\-prange\fR \fIrange\fR
+.RS 4
+The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form (x)\-(y) where an (x)\-(y) pair is a legal range of lengths for the product\&. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100\-150\&. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100\-150 200\-250\&. Eprimer32 favours ranges to the left side of the parameter string\&. Eprimer32 will return legal primers pairs in the first range regardless the value of the objective function for these pairs\&. Only if there are an insufficient number of primers in the first range will Eprimer32 return primers in a subsequent range\&. Default value: 100\-300
+.RE
+.PP
+\fB\-ptmopt\fR \fIfloat\fR
+.RS 4
+The optimum melting temperature for the PCR product\&. 0 indicates that there is no optimum temperature\&. Default value: 0\&.0
+.RE
+.PP
+\fB\-ptmmin\fR \fIfloat\fR
+.RS 4
+The minimum allowed melting temperature of the amplicon\&. Please see the documentation on the maximum melting temperature of the product for details\&. Default value: \-1000000\&.0
+.RE
+.PP
+\fB\-ptmmax\fR \fIfloat\fR
+.RS 4
+The maximum allowed melting temperature of the amplicon\&. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11\&.46 (1989, CSHL Press)\&. Tm = 81\&.5 + 16\&.6(log10([Na+])) + \&.41*(%GC) \- 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence\&. A similar formula is used by the prime primer selection program in GCG, which instead uses 675\&.0/length in the last term (after F\&. Baldino, Jr, M\&.\-F\&. Chesselet, and M\&.E\&. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms)\&. The formulas here and in Baldino et al\&. assume Na+ rather than K+\&. According to J\&.G\&. Wetmur, Critical Reviews in BioChem\&. and Mol\&. Bio\&. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to \&.2 M Na+\&. Eprimer32 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature\&. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions\&. Default value: 1000000\&.0
+.RE
+.SS "Internal oligo input"
+.PP
+\fB\-oexcludedregion\fR \fIrange\fR
+.RS 4
+Middle oligos may not overlap any region specified by this tag\&. The associated value must be a space\-separated list of (start),(end) pairs, where (start) is the index of the first base of an excluded region, and (end) is the last\&. Often one would make Target regions excluded regions for internal oligos\&.
+.RE
+.PP
+\fB\-oligoinput\fR \fIstring\fR
+.RS 4
+The sequence of an internal oligo to check and around which to design forward and reverse primers\&. Must be a substring of SEQUENCE\&.
+.RE
+.SS "Internal oligo options"
+.PP
+\fB\-osizeopt\fR \fIinteger\fR
+.RS 4
+Optimum length (in bases) of an internal oligo\&. Eprimer32 will attempt to pick primers close to this length\&. Default value: 20
+.RE
+.PP
+\fB\-ominsize\fR \fIinteger\fR
+.RS 4
+Minimum acceptable length of an internal oligo\&. Must be greater than 0 and less than or equal to INTERNAL\-OLIGO\-MAX\-SIZE\&. Default value: 18
+.RE
+.PP
+\fB\-omaxsize\fR \fIinteger\fR
+.RS 4
+Maximum acceptable length (in bases) of an internal oligo\&. Currently this parameter cannot be larger than 35\&. This limit is governed by maximum oligo size for which Eprimer32\*(Aqs melting\-temperature is valid\&. Default value: 27
+.RE
+.PP
+\fB\-otmopt\fR \fIfloat\fR
+.RS 4
+Optimum melting temperature (Celsius) for an internal oligo\&. Eprimer32 will try to pick oligos with melting temperatures that are close to this temperature\&. The oligo melting temperature formula in Eprimer32 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409\-6412 and Breslauer, Frank, Bloecker and Marky, Proc\&. Natl\&. Acad\&. Sci\&. USA, vol 83, pp 3746\-3750\&. Please refer to the former paper for background discussion\&. Default value: 60\&.0
+.RE
+.PP
+\fB\-otmmin\fR \fIfloat\fR
+.RS 4
+Minimum acceptable melting temperature(Celsius) for an internal oligo\&. Default value: 57\&.0
+.RE
+.PP
+\fB\-otmmax\fR \fIfloat\fR
+.RS 4
+Maximum acceptable melting temperature (Celsius) for an internal oligo\&. Default value: 63\&.0
+.RE
+.PP
+\fB\-ogcopt\fR \fIfloat\fR
+.RS 4
+Internal oligo optimum GC percent\&. Default value: 50\&.0
+.RE
+.PP
+\fB\-ogcmin\fR \fIfloat\fR
+.RS 4
+Minimum allowable percentage of Gs and Cs in an internal oligo\&. Default value: 20\&.0
+.RE
+.PP
+\fB\-ogcmax\fR \fIfloat\fR
+.RS 4
+Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer\&. Default value: 80\&.0
+.RE
+.PP
+\fB\-osaltconc\fR \fIfloat\fR
+.RS 4
+The millimolar concentration of salt (usually KCl) in the hybridization\&. Eprimer32 uses this argument to calculate internal oligo melting temperatures\&. Default value: 50\&.0
+.RE
+.PP
+\fB\-odnaconc\fR \fIfloat\fR
+.RS 4
+The nanomolar concentration of annealing internal oligo in the hybridization\&. Default value: 50\&.0
+.RE
+.PP
+\fB\-oanyself\fR \fIfloat\fR
+.RS 4
+The maximum allowable local alignment score when testing an internal oligo for (local) self\-complementarity\&. Local self\-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1\&.00 for complementary bases, \-0\&.25 for a match of any base (or N) with an N, \-1\&.00 for a mismatch, and \-2\&.00 for a gap\&. Only single\-base\-pair gaps are allowed\&. For example, the alignment 5\*(Aq ATCGNA 3\*(Aq || | | 3\*(Aq TA\-CGT 5\*(Aq is allowed (and yields a score of 1\&.75), but the alignment 5\*(Aq ATCCGNA 3\*(Aq || | | 3\*(Aq TA\-\-CGT 5\*(Aq is not considered\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable local alignment between two oligos\&. Default value: 12\&.00
+.RE
+.PP
+\fB\-oendself\fR \fIfloat\fR
+.RS 4
+The maximum allowable 3\*(Aq\-anchored global alignment score when testing a single oligo for self\-complementarity\&. The scoring system is as for the Maximum Complementarity argument\&. In the examples above the scores are 7\&.00 and 6\&.00 respectively\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable 3\*(Aq\-anchored global alignment between two oligos\&. In order to estimate 3\*(Aq\-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5\*(Aq to 3\*(Aq\&. INTERNAL\-OLIGO\-SELF\-END is meaningless when applied to internal oligos used for hybridization\-based detection, since primer\-dimer will not occur\&. We recommend that INTERNAL\-OLIGO\-SELF\-END be set at least as high as INTERNAL\-OLIGO\-SELF\-ANY\&. Default value: 12\&.00
+.RE
+.PP
+\fB\-opolyxmax\fR \fIinteger\fR
+.RS 4
+The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA\&. Default value: 5
+.RE
+.PP
+\fB\-omishybmax\fR \fIfloat\fR
+.RS 4
+Similar to MAX\-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL\-OLIGO\-MISHYB\-LIBRARY\&. Default value: 12\&.0
+.RE
+.SS "Advanced section"
+.PP
+\fB\-explainflag\fR \fIboolean\fR
+.RS 4
+If this flag is true, produce LEFT\-EXPLAIN, RIGHT\-EXPLAIN, and INTERNAL\-OLIGO\-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that Eprimer32 examined, and statistics on the number discarded for various reasons\&. Default value: N
+.RE
+.PP
+\fB\-fileflag\fR \fIboolean\fR
+.RS 4
+If the associated value is true, then Eprimer32 creates two output files for each input SEQUENCE\&. File (sequence\-id)\&.for lists all acceptable forward primers for (sequence\-id), and (sequence\-id)\&.rev lists all acceptable reverse primers for (sequence\-id), where (sequence\-id) is the value of the SEQUENCE\-ID tag (which must be supplied)\&. In addition, if the input tag TASK is 1 or 4, Eprimer32 produces a file (sequence\-id)\&.int, which lists all acceptable internal oligos\&. Default value: N
+.RE
+.PP
+\fB\-firstbaseindex\fR \fIinteger\fR
+.RS 4
+This parameter is the index of the first base in the input sequence\&. For input and output using 1\-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1\&. For input and output using 0\-based indexing set this parameter to 0\&. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set\&.) Default value: 1
+.RE
+.PP
+\fB\-pickanyway\fR \fIboolean\fR
+.RS 4
+If true pick a primer pair even if LEFT\-INPUT, RIGHT\-INPUT, or INTERNAL\-OLIGO\-INPUT violates specific constraints\&. Default value: N
+.RE
+.PP
+\fB\-maxmispriming\fR \fIfloat\fR
+.RS 4
+The maximum allowed weighted similarity with any sequence in MISPRIMING\-LIBRARY\&. Default value: 12\&.00
+.RE
+.PP
+\fB\-pairmaxmispriming\fR \fIfloat\fR
+.RS 4
+The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING\-LIBRARY\&. Default value: 24\&.00
+.RE
+.PP
+\fB\-numnsaccepted\fR \fIinteger\fR
+.RS 4
+Maximum number of unknown bases (N) allowable in any primer\&.
+.RE
+.PP
+\fB\-selfany\fR \fIfloat\fR
+.RS 4
+The maximum allowable local alignment score when testing a single primer for (local) self\-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers\&. Local self\-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self\-priming in the PCR\&. The scoring system gives 1\&.00 for complementary bases, \-0\&.25 for a match of any base (or N) with an N, \-1\&.00 for a mismatch, and \-2\&.00 for a gap\&. Only single\-base\-pair gaps are allowed\&. For example, the alignment 5\*(Aq ATCGNA 3\*(Aq \&.\&.\&.|| | | 3\*(Aq TA\-CGT 5\*(Aq is allowed (and yields a score of 1\&.75), but the alignment 5\*(Aq ATCCGNA 3\*(Aq \&.\&.\&.|| | | 3\*(Aq TA\-\-CGT 5\*(Aq is not considered\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable local alignment between two oligos\&. Default value: 8\&.00
+.RE
+.PP
+\fB\-selfend\fR \fIfloat\fR
+.RS 4
+The maximum allowable 3\*(Aq\-anchored global alignment score when testing a single primer for self\-complementarity, and the maximum allowable 3\*(Aq\-anchored global alignment score when testing for complementarity between forward and reverse primers\&. The 3\*(Aq\-anchored global alignment score is taken to predict the likelihood of PCR\-priming primer\-dimers, for example 5\*(Aq ATGCCCTAGCTTCCGGATG 3\*(Aq \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.||| ||||| \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.3\*(Aq AAGTCCTACATTTAGCCTAGT 5\*(Aq or 5\*(Aq AGGCTATGGGCCTCGCGA 3\*(Aq \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.|||||| \&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.\&.3\*(Aq AGCGCTCCGGGTATCGGA 5\*(Aq The scoring system is as for the Maximum Complementarity argument\&. In the examples above the scores are 7\&.00 and 6\&.00 respectively\&. Scores are non\-negative, and a score of 0\&.00 indicates that there is no reasonable 3\*(Aq\-anchored global alignment between two oligos\&. In order to estimate 3\*(Aq\-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5\*(Aq to 3\*(Aq\&. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment\&. Default value: 3\&.00
+.RE
+.PP
+\fB\-scorrection\fR \fIlist\fR
+.RS 4
+Specifies the salt correction formula for the melting temperature calculation\&. Default value: 1
+.RE
+.PP
+\fB\-tmformula\fR \fIlist\fR
+.RS 4
+Specifies details of melting temperature calculation\&. Default value: 1
+.RE
+.SS "Primer penalty weights"
+.PP
+\fB\-maxendstability\fR \fIfloat\fR
+.RS 4
+The maximum stability for the five 3\*(Aq bases of a forward or reverse primer\&. Bigger numbers mean more stable 3\*(Aq ends\&. The value is the maximum delta G for duplex disruption for the five 3\*(Aq bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloecker and Marky, Proc\&. Natl\&. Acad\&. Sci\&. USA, vol 83, pp 3746\-3750\&. Eprimer32 uses a completely permissive default value for backward compatibility (which we may change in the next release)\&. Rychlik recommends a maximum value of 9 (Wojciech Rychlik, \*(AqSelection of Primers for Polymerase Chain Reaction\*(Aq in BA White, Ed\&., \*(AqMethods in Molecular Biology, Vol\&. 15: PCR Protocols: Current Methods and Applications\*(Aq, 1993, pp 31\-40, Humana Press, Totowa NJ)\&. Default value: 9\&.0
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+eprimer32 is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/equicktandem.1e b/debian/manpages/equicktandem.1e
index 06f7e56..a598c09 100644
--- a/debian/manpages/equicktandem.1e
+++ b/debian/manpages/equicktandem.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EQUICKTANDEM
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EQUICKTANDEM" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EQUICKTANDEM" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/est2genome.1e b/debian/manpages/est2genome.1e
index 4d4d79f..ce2616f 100644
--- a/debian/manpages/est2genome.1e
+++ b/debian/manpages/est2genome.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EST2GENOME
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EST2GENOME" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EST2GENOME" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/etandem.1e b/debian/manpages/etandem.1e
index d0c9c50..cf7fee2 100644
--- a/debian/manpages/etandem.1e
+++ b/debian/manpages/etandem.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ETANDEM
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ETANDEM" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ETANDEM" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/extractalign.1e b/debian/manpages/extractalign.1e
index c40298d..6186e5a 100644
--- a/debian/manpages/extractalign.1e
+++ b/debian/manpages/extractalign.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EXTRACTALIGN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EXTRACTALIGN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EXTRACTALIGN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ extractalign \- Extract regions from a sequence alignment
.SH "DESCRIPTION"
.PP
\fBextractalign\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment,Data retrieval:Sequence data,Edit" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/extractfeat.1e b/debian/manpages/extractfeat.1e
index ae19ee7..309ff10 100644
--- a/debian/manpages/extractfeat.1e
+++ b/debian/manpages/extractfeat.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EXTRACTFEAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EXTRACTFEAT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EXTRACTFEAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/extractseq.1e b/debian/manpages/extractseq.1e
index 319bf1a..3af9357 100644
--- a/debian/manpages/extractseq.1e
+++ b/debian/manpages/extractseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: EXTRACTSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "EXTRACTSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "EXTRACTSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/featcopy.1e b/debian/manpages/featcopy.1e
index 99413ed..149167a 100644
--- a/debian/manpages/featcopy.1e
+++ b/debian/manpages/featcopy.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: FEATCOPY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "FEATCOPY" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "FEATCOPY" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ featcopy \- Reads and writes a feature table
.SH "DESCRIPTION"
.PP
\fBfeatcopy\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Feature data,Edit" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/featreport.1e b/debian/manpages/featreport.1e
index b495f58..a8a0a4b 100644
--- a/debian/manpages/featreport.1e
+++ b/debian/manpages/featreport.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: FEATREPORT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "FEATREPORT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "FEATREPORT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/feattext.1e b/debian/manpages/feattext.1e
new file mode 100644
index 0000000..f418771
--- /dev/null
+++ b/debian/manpages/feattext.1e
@@ -0,0 +1,70 @@
+'\" t
+.\" Title: FEATTEXT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "FEATTEXT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+feattext \- Return a feature table original text
+.SH "SYNOPSIS"
+.HP \w'\fBfeattext\fR\ 'u
+\fBfeattext\fR \fB\-features\ \fR\fB\fIfeatures\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBfeattext\fR\ 'u
+\fBfeattext\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBfeattext\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-features\fR \fIfeatures\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+feattext is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/findkm.1e b/debian/manpages/findkm.1e
index d665468..7064284 100644
--- a/debian/manpages/findkm.1e
+++ b/debian/manpages/findkm.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: FINDKM
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "FINDKM" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "FINDKM" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/freak.1e b/debian/manpages/freak.1e
index 05ef3e6..e50e84b 100644
--- a/debian/manpages/freak.1e
+++ b/debian/manpages/freak.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: FREAK
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "FREAK" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "FREAK" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/fuzznuc.1e b/debian/manpages/fuzznuc.1e
index cb668a4..bcb6366 100644
--- a/debian/manpages/fuzznuc.1e
+++ b/debian/manpages/fuzznuc.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: FUZZNUC
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "FUZZNUC" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "FUZZNUC" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/fuzzpro.1e b/debian/manpages/fuzzpro.1e
index 70b7d23..c37e010 100644
--- a/debian/manpages/fuzzpro.1e
+++ b/debian/manpages/fuzzpro.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: FUZZPRO
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "FUZZPRO" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "FUZZPRO" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/fuzztran.1e b/debian/manpages/fuzztran.1e
index d382d41..caf6adb 100644
--- a/debian/manpages/fuzztran.1e
+++ b/debian/manpages/fuzztran.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: FUZZTRAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "FUZZTRAN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "FUZZTRAN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/garnier.1e b/debian/manpages/garnier.1e
index 5be4f6a..79976c5 100644
--- a/debian/manpages/garnier.1e
+++ b/debian/manpages/garnier.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: GARNIER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "GARNIER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "GARNIER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/geecee.1e b/debian/manpages/geecee.1e
index 29827b7..58eb015 100644
--- a/debian/manpages/geecee.1e
+++ b/debian/manpages/geecee.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: GEECEE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "GEECEE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "GEECEE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/getorf.1e b/debian/manpages/getorf.1e
index a73b60c..d0641c1 100644
--- a/debian/manpages/getorf.1e
+++ b/debian/manpages/getorf.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: GETORF
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "GETORF" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "GETORF" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/godef.1e b/debian/manpages/godef.1e
new file mode 100644
index 0000000..4c840e3
--- /dev/null
+++ b/debian/manpages/godef.1e
@@ -0,0 +1,87 @@
+'\" t
+.\" Title: GODEF
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "GODEF" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+godef \- Find GO ontology terms by definition
+.SH "SYNOPSIS"
+.HP \w'\fBgodef\fR\ 'u
+\fBgodef\fR \fB\-query\ \fR\fB\fIstring\fR\fR [\fB\-namespace\ \fR\fB\fIlist\fR\fR] \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-godef\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBgodef\fR\ 'u
+\fBgodef\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBgodef\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:GO,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-query\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-namespace\fR \fIlist\fR
+.RS 4
+By default all terms are returned\&. Searches can be limited to one or a few namespaces\&. Default value: *
+.RE
+.SS "Advanced section"
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (GO sub\-classes) of the matched type\&. Default value: N
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-godef\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+godef is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/goname.1e b/debian/manpages/goname.1e
new file mode 100644
index 0000000..4579d01
--- /dev/null
+++ b/debian/manpages/goname.1e
@@ -0,0 +1,87 @@
+'\" t
+.\" Title: GONAME
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "GONAME" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+goname \- Find GO ontology terms by name
+.SH "SYNOPSIS"
+.HP \w'\fBgoname\fR\ 'u
+\fBgoname\fR \fB\-query\ \fR\fB\fIstring\fR\fR [\fB\-namespace\ \fR\fB\fIlist\fR\fR] \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-goname\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBgoname\fR\ 'u
+\fBgoname\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBgoname\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:GO,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-query\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-namespace\fR \fIlist\fR
+.RS 4
+By default all terms are returned\&. Searches can be limited to one or a few namespaces\&. Default value: *
+.RE
+.SS "Advanced section"
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (GO sub\-classes) of the matched type\&. Default value: N
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-goname\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+goname is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/goseq.1e b/debian/manpages/goseq.1e
new file mode 100644
index 0000000..9a61da5
--- /dev/null
+++ b/debian/manpages/goseq.1e
@@ -0,0 +1,79 @@
+'\" t
+.\" Title: GOSEQ
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "GOSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+goseq \- Identify sequence entries containing GO terms
+.SH "SYNOPSIS"
+.HP \w'\fBgoseq\fR\ 'u
+\fBgoseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-term\ \fR\fB\fIstring\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBgoseq\fR\ 'u
+\fBgoseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBgoseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-term\fR \fIstring\fR
+.RS 4
+This is the name of a term from the GO ontology\&. If you are not sure what names are available, use ontoget\&.
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+The list of sequence names will be written to this list file
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+goseq is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/helixturnhelix.1e b/debian/manpages/helixturnhelix.1e
index ea46010..cfaad34 100644
--- a/debian/manpages/helixturnhelix.1e
+++ b/debian/manpages/helixturnhelix.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: HELIXTURNHELIX
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "HELIXTURNHELIX" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "HELIXTURNHELIX" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ helixturnhelix \- Identify nucleic acid\-binding motifs in protein sequences
.SH "DESCRIPTION"
.PP
\fBhelixturnhelix\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:2D Structure,Protein:Motifs" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:2D Structure,Protein:Domains" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/histogramtest.1e b/debian/manpages/histogramtest.1e
index 6bfe936..526bb1b 100644
--- a/debian/manpages/histogramtest.1e
+++ b/debian/manpages/histogramtest.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: HISTOGRAMTEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "HISTOGRAMTEST" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "HISTOGRAMTEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/hmoment.1e b/debian/manpages/hmoment.1e
index 0dbe12a..052316d 100644
--- a/debian/manpages/hmoment.1e
+++ b/debian/manpages/hmoment.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: HMOMENT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "HMOMENT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "HMOMENT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ hmoment \- Calculate and plot hydrophobic moment for protein sequence(s)
.SH "DESCRIPTION"
.PP
\fBhmoment\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:2D Structure" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Properties" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/idtell.1e b/debian/manpages/idtell.1e
index 4c4f881..18b9478 100644
--- a/debian/manpages/idtell.1e
+++ b/debian/manpages/idtell.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: IDTELL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "IDTELL" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "IDTELL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/iep.1e b/debian/manpages/iep.1e
index 3c54c16..faf7159 100644
--- a/debian/manpages/iep.1e
+++ b/debian/manpages/iep.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: IEP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "IEP" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "IEP" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ iep \- Calculate the isoelectric point of proteins
.SH "DESCRIPTION"
.PP
\fBiep\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Properties,Display" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/infoalign.1e b/debian/manpages/infoalign.1e
index 9dc18db..231d33f 100644
--- a/debian/manpages/infoalign.1e
+++ b/debian/manpages/infoalign.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: INFOALIGN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "INFOALIGN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "INFOALIGN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ infoalign \- Display basic information about a multiple sequence alignment
.SH "DESCRIPTION"
.PP
\fBinfoalign\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Multiple,Information" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Multiple,Data retrieval:Sequence data" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/infobase.1e b/debian/manpages/infobase.1e
index a0adb25..831f5df 100644
--- a/debian/manpages/infobase.1e
+++ b/debian/manpages/infobase.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: INFOBASE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "INFOBASE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "INFOBASE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ infobase \- Return information on a given nucleotide base
.SH "DESCRIPTION"
.PP
\fBinfobase\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Chemistry data" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/inforesidue.1e b/debian/manpages/inforesidue.1e
index b791cf6..c4438b5 100644
--- a/debian/manpages/inforesidue.1e
+++ b/debian/manpages/inforesidue.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: INFORESIDUE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "INFORESIDUE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "INFORESIDUE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ inforesidue \- Return information on a given amino acid residue
.SH "DESCRIPTION"
.PP
\fBinforesidue\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Chemistry data" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/infoseq.1e b/debian/manpages/infoseq.1e
index 7662dd7..de4a5b5 100644
--- a/debian/manpages/infoseq.1e
+++ b/debian/manpages/infoseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: INFOSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "INFOSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "INFOSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ infoseq \- Display basic information about sequences
.SH "DESCRIPTION"
.PP
\fBinfoseq\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Sequence data" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/intconv.1e b/debian/manpages/intconv.1e
index 42e995d..7357f42 100644
--- a/debian/manpages/intconv.1e
+++ b/debian/manpages/intconv.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: INTCONV
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "INTCONV" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "INTCONV" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/isdbdata.1e b/debian/manpages/isdbdata.1e
new file mode 100644
index 0000000..6da105a
--- /dev/null
+++ b/debian/manpages/isdbdata.1e
@@ -0,0 +1,79 @@
+'\" t
+.\" Title: ISDBDATA
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ISDBDATA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+isdbdata \- Check whether a supplied string is a known data type/identifier name
+.SH "SYNOPSIS"
+.HP \w'\fBisdbdata\fR\ 'u
+\fBisdbdata\fR [\fB\-term\ \fR\fB\fIstring\fR\fR] [\fB\-termout\ \fR\fB\fItoggle\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBisdbdata\fR\ 'u
+\fBisdbdata\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBisdbdata\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-term\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.PP
+\fB\-termout\fR \fItoggle\fR
+.RS 4
+This option will write to file the term statement from the EDAM ontology with a name that matches the supplied string\&. Only the EDAM \*(Aqdata\*(Aq branch (data type or identifier) is checked\&. Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+isdbdata is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/isdbname.1e b/debian/manpages/isdbname.1e
new file mode 100644
index 0000000..4f03ec1
--- /dev/null
+++ b/debian/manpages/isdbname.1e
@@ -0,0 +1,79 @@
+'\" t
+.\" Title: ISDBNAME
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ISDBNAME" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+isdbname \- Check whether a supplied string is a known database name
+.SH "SYNOPSIS"
+.HP \w'\fBisdbname\fR\ 'u
+\fBisdbname\fR [\fB\-term\ \fR\fB\fIstring\fR\fR] [\fB\-infout\ \fR\fB\fItoggle\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBisdbname\fR\ 'u
+\fBisdbname\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBisdbname\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-term\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.PP
+\fB\-infout\fR \fItoggle\fR
+.RS 4
+This option will write to file information (from the EMBOSS data file DRCAT\&.dat) for the database with a name that matches the supplied string\&. Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+isdbname is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/isochore.1e b/debian/manpages/isochore.1e
index bcd8c72..8cfc714 100644
--- a/debian/manpages/isochore.1e
+++ b/debian/manpages/isochore.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ISOCHORE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ISOCHORE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ISOCHORE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/jaspextract.1e b/debian/manpages/jaspextract.1e
index a3f37b1..feb3457 100644
--- a/debian/manpages/jaspextract.1e
+++ b/debian/manpages/jaspextract.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: JASPEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "JASPEXTRACT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "JASPEXTRACT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/jaspscan.1e b/debian/manpages/jaspscan.1e
index 2cef145..1fb71b7 100644
--- a/debian/manpages/jaspscan.1e
+++ b/debian/manpages/jaspscan.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: JASPSCAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "JASPSCAN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "JASPSCAN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/lindna.1e b/debian/manpages/lindna.1e
index 86a6c96..2842245 100644
--- a/debian/manpages/lindna.1e
+++ b/debian/manpages/lindna.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: LINDNA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "LINDNA" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "LINDNA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -85,7 +85,7 @@ Default value: N
.PP
\fB\-gapsize\fR \fIinteger\fR
.RS 4
-Default value: 500
+A zero value allows the application to choose a gap size
.RE
.PP
\fB\-ticklines\fR \fIboolean\fR
diff --git a/debian/manpages/listor.1e b/debian/manpages/listor.1e
index ff2b00c..8461087 100644
--- a/debian/manpages/listor.1e
+++ b/debian/manpages/listor.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: LISTOR
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "LISTOR" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "LISTOR" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/makenucseq.1e b/debian/manpages/makenucseq.1e
index 44856bf..64e199c 100644
--- a/debian/manpages/makenucseq.1e
+++ b/debian/manpages/makenucseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MAKENUCSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MAKENUCSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MAKENUCSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/makeprotseq.1e b/debian/manpages/makeprotseq.1e
index 8fadcc8..1264c7b 100644
--- a/debian/manpages/makeprotseq.1e
+++ b/debian/manpages/makeprotseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MAKEPROTSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MAKEPROTSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MAKEPROTSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/marscan.1e b/debian/manpages/marscan.1e
index 2044c5a..364dfe8 100644
--- a/debian/manpages/marscan.1e
+++ b/debian/manpages/marscan.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MARSCAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MARSCAN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MARSCAN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ marscan \- Finds matrix/scaffold recognition (MRS) signatures in DNA sequences
.SH "DESCRIPTION"
.PP
\fBmarscan\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Gene finding,Nucleic:Motifs" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Gene finding,Nucleic:Functional sites,Nucleic:Transcription" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/martattributes.1e b/debian/manpages/martattributes.1e
index 1fa1b92..deb59e9 100644
--- a/debian/manpages/martattributes.1e
+++ b/debian/manpages/martattributes.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MARTATTRIBUTES
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MARTATTRIBUTES" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MARTATTRIBUTES" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/martdatasets.1e b/debian/manpages/martdatasets.1e
index b08d28b..2dfda6f 100644
--- a/debian/manpages/martdatasets.1e
+++ b/debian/manpages/martdatasets.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MARTDATASETS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MARTDATASETS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MARTDATASETS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/martfilters.1e b/debian/manpages/martfilters.1e
index 5dca20b..186fc2f 100644
--- a/debian/manpages/martfilters.1e
+++ b/debian/manpages/martfilters.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MARTFILTERS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MARTFILTERS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MARTFILTERS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/martquery.1e b/debian/manpages/martquery.1e
index ab68925..860a9a0 100644
--- a/debian/manpages/martquery.1e
+++ b/debian/manpages/martquery.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MARTQUERY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MARTQUERY" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MARTQUERY" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/martregistry.1e b/debian/manpages/martregistry.1e
index df9cf21..0ac437b 100644
--- a/debian/manpages/martregistry.1e
+++ b/debian/manpages/martregistry.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MARTREGISTRY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MARTREGISTRY" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MARTREGISTRY" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/martseqs.1e b/debian/manpages/martseqs.1e
index 4e4dee2..b8d9e46 100644
--- a/debian/manpages/martseqs.1e
+++ b/debian/manpages/martseqs.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MARTSEQS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MARTSEQS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MARTSEQS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/maskambignuc.1e b/debian/manpages/maskambignuc.1e
index a4c7725..f0c605b 100644
--- a/debian/manpages/maskambignuc.1e
+++ b/debian/manpages/maskambignuc.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MASKAMBIGNUC
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MASKAMBIGNUC" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MASKAMBIGNUC" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/maskambigprot.1e b/debian/manpages/maskambigprot.1e
index 8187a5d..8761948 100644
--- a/debian/manpages/maskambigprot.1e
+++ b/debian/manpages/maskambigprot.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MASKAMBIGPROT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MASKAMBIGPROT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MASKAMBIGPROT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/maskfeat.1e b/debian/manpages/maskfeat.1e
index a093606..20a3c95 100644
--- a/debian/manpages/maskfeat.1e
+++ b/debian/manpages/maskfeat.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MASKFEAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MASKFEAT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MASKFEAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/maskseq.1e b/debian/manpages/maskseq.1e
index 2f30cba..cc51f18 100644
--- a/debian/manpages/maskseq.1e
+++ b/debian/manpages/maskseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MASKSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MASKSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MASKSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/matcher.1e b/debian/manpages/matcher.1e
index f54e133..b3a8cf9 100644
--- a/debian/manpages/matcher.1e
+++ b/debian/manpages/matcher.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MATCHER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MATCHER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MATCHER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/megamerger.1e b/debian/manpages/megamerger.1e
index 012fb4d..e9cbe81 100644
--- a/debian/manpages/megamerger.1e
+++ b/debian/manpages/megamerger.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MEGAMERGER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MEGAMERGER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MEGAMERGER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/merger.1e b/debian/manpages/merger.1e
index c2c45e4..20e949f 100644
--- a/debian/manpages/merger.1e
+++ b/debian/manpages/merger.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MERGER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MERGER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MERGER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/msbar.1e b/debian/manpages/msbar.1e
index a07d397..8aaf21d 100644
--- a/debian/manpages/msbar.1e
+++ b/debian/manpages/msbar.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MSBAR
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MSBAR" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MSBAR" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/mwcontam.1e b/debian/manpages/mwcontam.1e
index 5c80bc2..248be4f 100644
--- a/debian/manpages/mwcontam.1e
+++ b/debian/manpages/mwcontam.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MWCONTAM
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MWCONTAM" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MWCONTAM" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/mwfilter.1e b/debian/manpages/mwfilter.1e
index 6ebc5ad..1b52417 100644
--- a/debian/manpages/mwfilter.1e
+++ b/debian/manpages/mwfilter.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: MWFILTER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "MWFILTER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "MWFILTER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/needle.1e b/debian/manpages/needle.1e
index 96ea596..eab85a5 100644
--- a/debian/manpages/needle.1e
+++ b/debian/manpages/needle.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NEEDLE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NEEDLE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NEEDLE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/needleall.1e b/debian/manpages/needleall.1e
index b8a27ea..a873c0d 100644
--- a/debian/manpages/needleall.1e
+++ b/debian/manpages/needleall.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NEEDLEALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NEEDLEALL" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NEEDLEALL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/newcoils.1e b/debian/manpages/newcoils.1e
index 5bc9586..98e2b07 100644
--- a/debian/manpages/newcoils.1e
+++ b/debian/manpages/newcoils.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NEWCOILS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NEWCOILS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NEWCOILS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/newcpgreport.1e b/debian/manpages/newcpgreport.1e
index f95db2e..34877a4 100644
--- a/debian/manpages/newcpgreport.1e
+++ b/debian/manpages/newcpgreport.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NEWCPGREPORT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NEWCPGREPORT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NEWCPGREPORT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/newcpgseek.1e b/debian/manpages/newcpgseek.1e
index 72fa1f2..278a507 100644
--- a/debian/manpages/newcpgseek.1e
+++ b/debian/manpages/newcpgseek.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NEWCPGSEEK
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NEWCPGSEEK" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NEWCPGSEEK" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/newseq.1e b/debian/manpages/newseq.1e
index ea664d3..632bd2b 100644
--- a/debian/manpages/newseq.1e
+++ b/debian/manpages/newseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NEWSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NEWSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NEWSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/nohtml.1e b/debian/manpages/nohtml.1e
index 06fcc23..91c7dda 100644
--- a/debian/manpages/nohtml.1e
+++ b/debian/manpages/nohtml.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NOHTML
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NOHTML" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NOHTML" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/noreturn.1e b/debian/manpages/noreturn.1e
index f2672d6..c665a62 100644
--- a/debian/manpages/noreturn.1e
+++ b/debian/manpages/noreturn.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NORETURN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NORETURN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NORETURN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/nospace.1e b/debian/manpages/nospace.1e
index 121ae88..40b0543 100644
--- a/debian/manpages/nospace.1e
+++ b/debian/manpages/nospace.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NOSPACE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NOSPACE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NOSPACE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/notab.1e b/debian/manpages/notab.1e
index dce5a02..4f6c67b 100644
--- a/debian/manpages/notab.1e
+++ b/debian/manpages/notab.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NOTAB
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NOTAB" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NOTAB" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/notseq.1e b/debian/manpages/notseq.1e
index 080691b..c466280 100644
--- a/debian/manpages/notseq.1e
+++ b/debian/manpages/notseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NOTSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NOTSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NOTSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/nthseq.1e b/debian/manpages/nthseq.1e
index 911d3e4..7d27810 100644
--- a/debian/manpages/nthseq.1e
+++ b/debian/manpages/nthseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NTHSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NTHSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NTHSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/nthseqset.1e b/debian/manpages/nthseqset.1e
index 24a17d4..aa136e9 100644
--- a/debian/manpages/nthseqset.1e
+++ b/debian/manpages/nthseqset.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: NTHSEQSET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "NTHSEQSET" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "NTHSEQSET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/octanol.1e b/debian/manpages/octanol.1e
index 028e29b..f06ff30 100644
--- a/debian/manpages/octanol.1e
+++ b/debian/manpages/octanol.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: OCTANOL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "OCTANOL" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "OCTANOL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ octanol \- Draw a White\-Wimley protein hydropathy plot
.SH "DESCRIPTION"
.PP
\fBoctanol\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Properties" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/oddcomp.1e b/debian/manpages/oddcomp.1e
index c797ba5..56f042b 100644
--- a/debian/manpages/oddcomp.1e
+++ b/debian/manpages/oddcomp.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ODDCOMP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ODDCOMP" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ODDCOMP" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ oddcomp \- Identify proteins with specified sequence word composition
.SH "DESCRIPTION"
.PP
\fBoddcomp\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Motifs" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/ontocount.1e b/debian/manpages/ontocount.1e
new file mode 100644
index 0000000..16db3f3
--- /dev/null
+++ b/debian/manpages/ontocount.1e
@@ -0,0 +1,83 @@
+'\" t
+.\" Title: ONTOCOUNT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ONTOCOUNT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+ontocount \- Count ontology term(s)
+.SH "SYNOPSIS"
+.HP \w'\fBontocount\fR\ 'u
+\fBontocount\fR \fB\-oboterms\ \fR\fB\fIobo\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBontocount\fR\ 'u
+\fBontocount\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBontocount\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-oboterms\fR \fIobo\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (sub\-classes) of the matched terms\&. Default value: N
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+ontocount is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/ontoget.1e b/debian/manpages/ontoget.1e
new file mode 100644
index 0000000..368f25d
--- /dev/null
+++ b/debian/manpages/ontoget.1e
@@ -0,0 +1,82 @@
+'\" t
+.\" Title: ONTOGET
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ONTOGET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+ontoget \- Get ontology term(s)
+.SH "SYNOPSIS"
+.HP \w'\fBontoget\fR\ 'u
+\fBontoget\fR \fB\-oboterms\ \fR\fB\fIobo\fR\fR [\fB\-subclasses\ \fR\fB\fIboolean\fR\fR] [\fB\-obsolete\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBontoget\fR\ 'u
+\fBontoget\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBontoget\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-oboterms\fR \fIobo\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (sub\-classes) of the matched terms\&. Default value: N
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+ontoget is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/ontogetcommon.1e b/debian/manpages/ontogetcommon.1e
new file mode 100644
index 0000000..0fea00e
--- /dev/null
+++ b/debian/manpages/ontogetcommon.1e
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: ONTOGETCOMMON
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ONTOGETCOMMON" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+ontogetcommon \- Get common ancestor for terms
+.SH "SYNOPSIS"
+.HP \w'\fBontogetcommon\fR\ 'u
+\fBontogetcommon\fR \fB\-oboterms\ \fR\fB\fIobo\fR\fR [\fB\-obsolete\ \fR\fB\fIboolean\fR\fR] \fB\-ontogetcommon\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBontogetcommon\fR\ 'u
+\fBontogetcommon\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBontogetcommon\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-oboterms\fR \fIobo\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-ontogetcommon\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+ontogetcommon is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/ontogetdown.1e b/debian/manpages/ontogetdown.1e
new file mode 100644
index 0000000..94d8323
--- /dev/null
+++ b/debian/manpages/ontogetdown.1e
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: ONTOGETDOWN
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ONTOGETDOWN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+ontogetdown \- Get ontology term(s) by parent id
+.SH "SYNOPSIS"
+.HP \w'\fBontogetdown\fR\ 'u
+\fBontogetdown\fR \fB\-oboterms\ \fR\fB\fIobo\fR\fR [\fB\-obsolete\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBontogetdown\fR\ 'u
+\fBontogetdown\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBontogetdown\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-oboterms\fR \fIobo\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+ontogetdown is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/ontogetobsolete.1e b/debian/manpages/ontogetobsolete.1e
new file mode 100644
index 0000000..672e05c
--- /dev/null
+++ b/debian/manpages/ontogetobsolete.1e
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: ONTOGETOBSOLETE
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ONTOGETOBSOLETE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+ontogetobsolete \- Get ontology ontology terms
+.SH "SYNOPSIS"
+.HP \w'\fBontogetobsolete\fR\ 'u
+\fBontogetobsolete\fR \fB\-oboterms\ \fR\fB\fIobo\fR\fR [\fB\-subclasses\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBontogetobsolete\fR\ 'u
+\fBontogetobsolete\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBontogetobsolete\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-oboterms\fR \fIobo\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (sub\-classes) of the matched terms\&. Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+ontogetobsolete is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/ontogetroot.1e b/debian/manpages/ontogetroot.1e
new file mode 100644
index 0000000..0dad7fb
--- /dev/null
+++ b/debian/manpages/ontogetroot.1e
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: ONTOGETROOT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ONTOGETROOT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+ontogetroot \- Get ontology root terms by child identifier
+.SH "SYNOPSIS"
+.HP \w'\fBontogetroot\fR\ 'u
+\fBontogetroot\fR \fB\-oboterms\ \fR\fB\fIobo\fR\fR [\fB\-obsolete\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBontogetroot\fR\ 'u
+\fBontogetroot\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBontogetroot\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-oboterms\fR \fIobo\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+ontogetroot is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/ontogetsibs.1e b/debian/manpages/ontogetsibs.1e
new file mode 100644
index 0000000..3ba6910
--- /dev/null
+++ b/debian/manpages/ontogetsibs.1e
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: ONTOGETSIBS
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ONTOGETSIBS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+ontogetsibs \- Get ontology term(s) by id with common parent
+.SH "SYNOPSIS"
+.HP \w'\fBontogetsibs\fR\ 'u
+\fBontogetsibs\fR \fB\-oboterms\ \fR\fB\fIobo\fR\fR [\fB\-obsolete\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBontogetsibs\fR\ 'u
+\fBontogetsibs\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBontogetsibs\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-oboterms\fR \fIobo\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+ontogetsibs is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/ontogetup.1e b/debian/manpages/ontogetup.1e
new file mode 100644
index 0000000..9c513ad
--- /dev/null
+++ b/debian/manpages/ontogetup.1e
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: ONTOGETUP
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ONTOGETUP" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+ontogetup \- Get ontology term(s) by id of child
+.SH "SYNOPSIS"
+.HP \w'\fBontogetup\fR\ 'u
+\fBontogetup\fR \fB\-oboterms\ \fR\fB\fIobo\fR\fR [\fB\-obsolete\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutobo\fR\fR
+.HP \w'\fBontogetup\fR\ 'u
+\fBontogetup\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBontogetup\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-oboterms\fR \fIobo\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutobo\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+ontogetup is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/ontoisobsolete.1e b/debian/manpages/ontoisobsolete.1e
new file mode 100644
index 0000000..06fa74b
--- /dev/null
+++ b/debian/manpages/ontoisobsolete.1e
@@ -0,0 +1,73 @@
+'\" t
+.\" Title: ONTOISOBSOLETE
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ONTOISOBSOLETE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+ontoisobsolete \- Report whether an ontology term id is obsolete
+.SH "SYNOPSIS"
+.HP \w'\fBontoisobsolete\fR\ 'u
+\fBontoisobsolete\fR \fB\-oboterms\ \fR\fB\fIobo\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBontoisobsolete\fR\ 'u
+\fBontoisobsolete\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBontoisobsolete\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology,Data retrieval:Ontology data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-oboterms\fR \fIobo\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+ontoisobsolete is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/ontotext.1e b/debian/manpages/ontotext.1e
new file mode 100644
index 0000000..5b13ca9
--- /dev/null
+++ b/debian/manpages/ontotext.1e
@@ -0,0 +1,82 @@
+'\" t
+.\" Title: ONTOTEXT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "ONTOTEXT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+ontotext \- Get ontology term(s) original full text
+.SH "SYNOPSIS"
+.HP \w'\fBontotext\fR\ 'u
+\fBontotext\fR \fB\-oboterms\ \fR\fB\fIobo\fR\fR [\fB\-subclasses\ \fR\fB\fIboolean\fR\fR] [\fB\-obsolete\ \fR\fB\fIboolean\fR\fR] \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBontotext\fR\ 'u
+\fBontotext\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBontotext\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology,Data retrieval:Ontology data,Data retrieval:Text data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-oboterms\fR \fIobo\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (sub\-classes) of the matched terms\&. Default value: N
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+ontotext is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/origsplitter.1e b/debian/manpages/origsplitter.1e
index 8549b90..64ed7ae 100644
--- a/debian/manpages/origsplitter.1e
+++ b/debian/manpages/origsplitter.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ORIGSPLITTER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ORIGSPLITTER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ORIGSPLITTER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/origunion.1e b/debian/manpages/origunion.1e
index 6095746..45dc816 100644
--- a/debian/manpages/origunion.1e
+++ b/debian/manpages/origunion.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: ORIGUNION
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "ORIGUNION" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "ORIGUNION" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/palindrome.1e b/debian/manpages/palindrome.1e
index 6e5bb07..235d9dd 100644
--- a/debian/manpages/palindrome.1e
+++ b/debian/manpages/palindrome.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PALINDROME
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PALINDROME" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PALINDROME" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pasteseq.1e b/debian/manpages/pasteseq.1e
index a3426fb..dd07156 100644
--- a/debian/manpages/pasteseq.1e
+++ b/debian/manpages/pasteseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PASTESEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PASTESEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PASTESEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/patmatdb.1e b/debian/manpages/patmatdb.1e
index 301793b..f910ed9 100644
--- a/debian/manpages/patmatdb.1e
+++ b/debian/manpages/patmatdb.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PATMATDB
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PATMATDB" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PATMATDB" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/patmatmotifs.1e b/debian/manpages/patmatmotifs.1e
index 630c8df..5f5c1bc 100644
--- a/debian/manpages/patmatmotifs.1e
+++ b/debian/manpages/patmatmotifs.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PATMATMOTIFS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PATMATMOTIFS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PATMATMOTIFS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/patmattest.1e b/debian/manpages/patmattest.1e
index 1b6754c..4f1f1c0 100644
--- a/debian/manpages/patmattest.1e
+++ b/debian/manpages/patmattest.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PATMATTEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PATMATTEST" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PATMATTEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pepcoil.1e b/debian/manpages/pepcoil.1e
index edf9fef..69f5146 100644
--- a/debian/manpages/pepcoil.1e
+++ b/debian/manpages/pepcoil.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PEPCOIL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PEPCOIL" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PEPCOIL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ pepcoil \- Predicts coiled coil regions in protein sequences
.SH "DESCRIPTION"
.PP
\fBpepcoil\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:2D Structure,Protein:Motifs" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:2D Structure,Protein:Domains" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/pepdigest.1e b/debian/manpages/pepdigest.1e
new file mode 100644
index 0000000..4f64d6d
--- /dev/null
+++ b/debian/manpages/pepdigest.1e
@@ -0,0 +1,112 @@
+'\" t
+.\" Title: PEPDIGEST
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "PEPDIGEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+pepdigest \- Reports on protein proteolytic enzyme or reagent cleavage sites
+.SH "SYNOPSIS"
+.HP \w'\fBpepdigest\fR\ 'u
+\fBpepdigest\fR \fB\-seqall\ \fR\fB\fIseqall\fR\fR \fB\-mwdata\ \fR\fB\fIdatafile\fR\fR \fB\-menu\ \fR\fB\fIlist\fR\fR \fB\-mono\ \fR\fB\fIboolean\fR\fR \fB\-unfavoured\ \fR\fB\fIboolean\fR\fR \fB\-ragging\ \fR\fB\fIboolean\fR\fR \fB\-termini\ \fR\fB\fIlist\fR\fR \fB\-overlap\ \fR\fB\fIboolean\fR\fR \fB\-allpartials\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIreport\fR\fR
+.HP \w'\fBpepdigest\fR\ 'u
+\fBpepdigest\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBpepdigest\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-seqall\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-mwdata\fR \fIdatafile\fR
+.RS 4
+Molecular weight data for amino acids Default value: Emolwt\&.dat
+.RE
+.SS "Required section"
+.PP
+\fB\-menu\fR \fIlist\fR
+.RS 4
+Default value: 1
+.RE
+.PP
+\fB\-mono\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-unfavoured\fR \fIboolean\fR
+.RS 4
+Trypsin will not normally cut after \*(AqKR\*(Aq if they are followed by any of \*(AqKRIFLP\*(Aq\&. Lys\-C will not normally cut after \*(AqK\*(Aq if it is followed by \*(AqP\*(Aq\&. Arg\-C will not normally cut after \*(AqR\*(Aq if it is followed by \*(AqP\*(Aq\&. V8\-bicarb will not normally cut after \*(AqE\*(Aq if it is followed by any of \*(AqKREP\*(Aq\&. V8\-phosph will not normally cut after \*(AqDE\*(Aq if they are followed by \*(AqP\*(Aq\&. Chymotrypsin will not normally cut after \*(AqFYWLM\*(Aq if they are followed by \*(AqP\*(Aq\&. Specifying unfavoured shows these unfavoured cuts as well as the favoured ones\&.
+.RE
+.PP
+\fB\-ragging\fR \fIboolean\fR
+.RS 4
+Allows semi\-specific and non\-specific digestion\&. This option is particularly useful for generating lists of peptide sequences for protein identification using mass\-spectrometry\&.
+.RE
+.PP
+\fB\-termini\fR \fIlist\fR
+.RS 4
+Default value: 1
+.RE
+.SS "Output section"
+.PP
+\fB\-overlap\fR \fIboolean\fR
+.RS 4
+Used for partial digestion\&. Shows all cuts from favoured cut sites plus 1\&.\&.3, 2\&.\&.4, 3\&.\&.5 etc but not (e\&.g\&.) 2\&.\&.5\&. Overlaps are therefore fragments with exactly one potential cut site within it\&.
+.RE
+.PP
+\fB\-allpartials\fR \fIboolean\fR
+.RS 4
+As for overlap but fragments containing more than one potential cut site are included\&.
+.RE
+.PP
+\fB\-outfile\fR \fIreport\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+pepdigest is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/pepinfo.1e b/debian/manpages/pepinfo.1e
index 5577df9..85f2e07 100644
--- a/debian/manpages/pepinfo.1e
+++ b/debian/manpages/pepinfo.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PEPINFO
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PEPINFO" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PEPINFO" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ pepinfo \- Plot amino acid properties of a protein sequence in parallel\&.
.SH "DESCRIPTION"
.PP
\fBpepinfo\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition,Protein:Properties,Display" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/pepnet.1e b/debian/manpages/pepnet.1e
index 232247b..413e04f 100644
--- a/debian/manpages/pepnet.1e
+++ b/debian/manpages/pepnet.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PEPNET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PEPNET" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PEPNET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pepstats.1e b/debian/manpages/pepstats.1e
index e2742c7..f744cff 100644
--- a/debian/manpages/pepstats.1e
+++ b/debian/manpages/pepstats.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PEPSTATS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PEPSTATS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PEPSTATS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ pepstats \- Calculates statistics of protein properties
.SH "DESCRIPTION"
.PP
\fBpepstats\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition,Protein:Properties" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/pepwheel.1e b/debian/manpages/pepwheel.1e
index 6689261..18ecbdc 100644
--- a/debian/manpages/pepwheel.1e
+++ b/debian/manpages/pepwheel.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PEPWHEEL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PEPWHEEL" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PEPWHEEL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pepwindow.1e b/debian/manpages/pepwindow.1e
index 10503e6..fac9991 100644
--- a/debian/manpages/pepwindow.1e
+++ b/debian/manpages/pepwindow.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PEPWINDOW
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PEPWINDOW" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PEPWINDOW" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ pepwindow \- Draw a hydropathy plot for a protein sequence
.SH "DESCRIPTION"
.PP
\fBpepwindow\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Properties" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/pepwindowall.1e b/debian/manpages/pepwindowall.1e
index ab057f8..5e73e84 100644
--- a/debian/manpages/pepwindowall.1e
+++ b/debian/manpages/pepwindowall.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PEPWINDOWALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PEPWINDOWALL" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PEPWINDOWALL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ pepwindowall \- Draw Kyte\-Doolittle hydropathy plot for a protein alignment
.SH "DESCRIPTION"
.PP
\fBpepwindowall\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Properties" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/plotcon.1e b/debian/manpages/plotcon.1e
index a53a01a..3c6fc74 100644
--- a/debian/manpages/plotcon.1e
+++ b/debian/manpages/plotcon.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PLOTCON
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PLOTCON" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PLOTCON" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/plotorf.1e b/debian/manpages/plotorf.1e
index 97c003f..1b33544 100644
--- a/debian/manpages/plotorf.1e
+++ b/debian/manpages/plotorf.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PLOTORF
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PLOTORF" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PLOTORF" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ plotorf \- Plot potential open reading frames in a nucleotide sequence
.SH "DESCRIPTION"
.PP
\fBplotorf\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Gene finding,Nucleic:Translation" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Gene finding,Nucleic:Translation,Display" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/polydot.1e b/debian/manpages/polydot.1e
index f54c754..4efd5da 100644
--- a/debian/manpages/polydot.1e
+++ b/debian/manpages/polydot.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: POLYDOT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "POLYDOT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "POLYDOT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/preg.1e b/debian/manpages/preg.1e
index 6d0ce1f..f740ffe 100644
--- a/debian/manpages/preg.1e
+++ b/debian/manpages/preg.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PREG
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PREG" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PREG" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/prettyplot.1e b/debian/manpages/prettyplot.1e
index 526a714..351d9c4 100644
--- a/debian/manpages/prettyplot.1e
+++ b/debian/manpages/prettyplot.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PRETTYPLOT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PRETTYPLOT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PRETTYPLOT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/prettyseq.1e b/debian/manpages/prettyseq.1e
index c11f255..0c3be8c 100644
--- a/debian/manpages/prettyseq.1e
+++ b/debian/manpages/prettyseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PRETTYSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PRETTYSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PRETTYSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ prettyseq \- Write a nucleotide sequence and its translation to file
.SH "DESCRIPTION"
.PP
\fBprettyseq\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Nucleic:Translation" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Translation,Display" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/prima.1e b/debian/manpages/prima.1e
index d04e46b..9bef402 100644
--- a/debian/manpages/prima.1e
+++ b/debian/manpages/prima.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PRIMA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PRIMA" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PRIMA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/primers.1e b/debian/manpages/primers.1e
index f0bad29..98bee3a 100644
--- a/debian/manpages/primers.1e
+++ b/debian/manpages/primers.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PRIMERS
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PRIMERS" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PRIMERS" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/primersearch.1e b/debian/manpages/primersearch.1e
index 17aa526..b73484c 100644
--- a/debian/manpages/primersearch.1e
+++ b/debian/manpages/primersearch.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PRIMERSEARCH
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PRIMERSEARCH" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PRIMERSEARCH" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/printsextract.1e b/debian/manpages/printsextract.1e
index a1fcc95..70031ff 100644
--- a/debian/manpages/printsextract.1e
+++ b/debian/manpages/printsextract.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PRINTSEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PRINTSEXTRACT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PRINTSEXTRACT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/profit.1e b/debian/manpages/profit.1e
index 8c01dea..f93a23e 100644
--- a/debian/manpages/profit.1e
+++ b/debian/manpages/profit.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PROFIT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PROFIT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PROFIT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/prophecy.1e b/debian/manpages/prophecy.1e
index e3bbba8..a3b9c71 100644
--- a/debian/manpages/prophecy.1e
+++ b/debian/manpages/prophecy.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PROPHECY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PROPHECY" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PROPHECY" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/prophet.1e b/debian/manpages/prophet.1e
index 1a3947c..f5203ce 100644
--- a/debian/manpages/prophet.1e
+++ b/debian/manpages/prophet.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PROPHET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PROPHET" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PROPHET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/prosextract.1e b/debian/manpages/prosextract.1e
index 9b3c730..3778727 100644
--- a/debian/manpages/prosextract.1e
+++ b/debian/manpages/prosextract.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PROSEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PROSEXTRACT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PROSEXTRACT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/pscan.1e b/debian/manpages/pscan.1e
index 79b4aa3..39d1ccc 100644
--- a/debian/manpages/pscan.1e
+++ b/debian/manpages/pscan.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PSCAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PSCAN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PSCAN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/psiphi.1e b/debian/manpages/psiphi.1e
index 5a618ab..dfe8789 100644
--- a/debian/manpages/psiphi.1e
+++ b/debian/manpages/psiphi.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: PSIPHI
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "PSIPHI" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "PSIPHI" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/rebaseextract.1e b/debian/manpages/rebaseextract.1e
index 7e91054..054f4a8 100644
--- a/debian/manpages/rebaseextract.1e
+++ b/debian/manpages/rebaseextract.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: REBASEEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "REBASEEXTRACT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "REBASEEXTRACT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/recoder.1e b/debian/manpages/recoder.1e
index 41a5069..cecc6af 100644
--- a/debian/manpages/recoder.1e
+++ b/debian/manpages/recoder.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: RECODER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "RECODER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "RECODER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/redata.1e b/debian/manpages/redata.1e
index bfd7b64..a2a6730 100644
--- a/debian/manpages/redata.1e
+++ b/debian/manpages/redata.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: REDATA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "REDATA" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "REDATA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/remap.1e b/debian/manpages/remap.1e
index bc5e268..1cd2032 100644
--- a/debian/manpages/remap.1e
+++ b/debian/manpages/remap.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: REMAP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "REMAP" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "REMAP" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/restover.1e b/debian/manpages/restover.1e
index 6e6dc5d..983fbfd 100644
--- a/debian/manpages/restover.1e
+++ b/debian/manpages/restover.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: RESTOVER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "RESTOVER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "RESTOVER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/restrict.1e b/debian/manpages/restrict.1e
index 9adbfab..893bed0 100644
--- a/debian/manpages/restrict.1e
+++ b/debian/manpages/restrict.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: RESTRICT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "RESTRICT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "RESTRICT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/revseq.1e b/debian/manpages/revseq.1e
index e5bd4f0..9f626d3 100644
--- a/debian/manpages/revseq.1e
+++ b/debian/manpages/revseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: REVSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "REVSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "REVSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seealso.1e b/debian/manpages/seealso.1e
index c0be16e..adad426 100644
--- a/debian/manpages/seealso.1e
+++ b/debian/manpages/seealso.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEEALSO
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEEALSO" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEEALSO" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ seealso \- Finds programs with similar function to a specified program
.SH "DESCRIPTION"
.PP
\fBseealso\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Information" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Documentation" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/seqcount.1e b/debian/manpages/seqcount.1e
new file mode 100644
index 0000000..e8dd65d
--- /dev/null
+++ b/debian/manpages/seqcount.1e
@@ -0,0 +1,70 @@
+'\" t
+.\" Title: SEQCOUNT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "SEQCOUNT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+seqcount \- Reads and counts sequences
+.SH "SYNOPSIS"
+.HP \w'\fBseqcount\fR\ 'u
+\fBseqcount\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBseqcount\fR\ 'u
+\fBseqcount\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqcount\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+seqcount is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/seqgo.1e b/debian/manpages/seqgo.1e
new file mode 100644
index 0000000..1aad104
--- /dev/null
+++ b/debian/manpages/seqgo.1e
@@ -0,0 +1,80 @@
+'\" t
+.\" Title: SEQGO
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "SEQGO" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+seqgo \- Extract a list of GO terms from a sequence entry
+.SH "SYNOPSIS"
+.HP \w'\fBseqgo\fR\ 'u
+\fBseqgo\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR [\fB\-html\ \fR\fB\fIboolean\fR\fR]
+.HP \w'\fBseqgo\fR\ 'u
+\fBseqgo\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqgo\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:GO" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+This is the file of GO ontology terms that were found in the input sequnce entry\&.
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+seqgo is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/seqinfo.1e b/debian/manpages/seqinfo.1e
index 928a021..d3e50a1 100644
--- a/debian/manpages/seqinfo.1e
+++ b/debian/manpages/seqinfo.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEQINFO
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEQINFO" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEQINFO" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqmatchall.1e b/debian/manpages/seqmatchall.1e
index d2b1852..4fed3aa 100644
--- a/debian/manpages/seqmatchall.1e
+++ b/debian/manpages/seqmatchall.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEQMATCHALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEQMATCHALL" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEQMATCHALL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqret.1e b/debian/manpages/seqret.1e
index 596a3a0..ae34226 100644
--- a/debian/manpages/seqret.1e
+++ b/debian/manpages/seqret.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEQRET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEQRET" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEQRET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ seqret \- Reads and writes (returns) sequences
.SH "DESCRIPTION"
.PP
\fBseqret\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval,Edit" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/seqretall.1e b/debian/manpages/seqretall.1e
index a7efd21..9b893b6 100644
--- a/debian/manpages/seqretall.1e
+++ b/debian/manpages/seqretall.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEQRETALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEQRETALL" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEQRETALL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqretallfeat.1e b/debian/manpages/seqretallfeat.1e
index 875d560..ed34cd9 100644
--- a/debian/manpages/seqretallfeat.1e
+++ b/debian/manpages/seqretallfeat.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEQRETALLFEAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEQRETALLFEAT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEQRETALLFEAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqretset.1e b/debian/manpages/seqretset.1e
index 40388df..17f6103 100644
--- a/debian/manpages/seqretset.1e
+++ b/debian/manpages/seqretset.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEQRETSET
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEQRETSET" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEQRETSET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqretsetall.1e b/debian/manpages/seqretsetall.1e
index 2a81a10..7d67f93 100644
--- a/debian/manpages/seqretsetall.1e
+++ b/debian/manpages/seqretsetall.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEQRETSETALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEQRETSETALL" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEQRETSETALL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqretsingle.1e b/debian/manpages/seqretsingle.1e
index bf1b074..ce24f9b 100644
--- a/debian/manpages/seqretsingle.1e
+++ b/debian/manpages/seqretsingle.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEQRETSINGLE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEQRETSINGLE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEQRETSINGLE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqretsplit.1e b/debian/manpages/seqretsplit.1e
index 3929ba1..94000de 100644
--- a/debian/manpages/seqretsplit.1e
+++ b/debian/manpages/seqretsplit.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEQRETSPLIT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEQRETSPLIT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEQRETSPLIT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqrettype.1e b/debian/manpages/seqrettype.1e
index b98b10e..4d559a8 100644
--- a/debian/manpages/seqrettype.1e
+++ b/debian/manpages/seqrettype.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEQRETTYPE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEQRETTYPE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEQRETTYPE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqtax.1e b/debian/manpages/seqtax.1e
new file mode 100644
index 0000000..65ddab9
--- /dev/null
+++ b/debian/manpages/seqtax.1e
@@ -0,0 +1,80 @@
+'\" t
+.\" Title: SEQTAX
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "SEQTAX" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+seqtax \- Extract a list of taxonomy ids from a sequence entry
+.SH "SYNOPSIS"
+.HP \w'\fBseqtax\fR\ 'u
+\fBseqtax\fR \fB\-sequence\ \fR\fB\fIsequence\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR [\fB\-html\ \fR\fB\fIboolean\fR\fR]
+.HP \w'\fBseqtax\fR\ 'u
+\fBseqtax\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqtax\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:Taxonomy" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIsequence\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+This is the file of NCBI taxonomy IDs that were found in the input sequnce entry\&.
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+seqtax is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/seqxref.1e b/debian/manpages/seqxref.1e
new file mode 100644
index 0000000..d5db8c7
--- /dev/null
+++ b/debian/manpages/seqxref.1e
@@ -0,0 +1,73 @@
+'\" t
+.\" Title: SEQXREF
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "SEQXREF" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+seqxref \- Retrieve all database cross\-references for a sequence entry
+.SH "SYNOPSIS"
+.HP \w'\fBseqxref\fR\ 'u
+\fBseqxref\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBseqxref\fR\ 'u
+\fBseqxref\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqxref\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Sequence data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+seqxref is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/seqxrefall.1e b/debian/manpages/seqxrefall.1e
index 6ee820f..6f19515 100644
--- a/debian/manpages/seqxrefall.1e
+++ b/debian/manpages/seqxrefall.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SEQXREFALL
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SEQXREFALL" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SEQXREFALL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/seqxrefget.1e b/debian/manpages/seqxrefget.1e
new file mode 100644
index 0000000..479fb31
--- /dev/null
+++ b/debian/manpages/seqxrefget.1e
@@ -0,0 +1,73 @@
+'\" t
+.\" Title: SEQXREFGET
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "SEQXREFGET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+seqxrefget \- Retrieve all cross\-referenced data for a sequence entry
+.SH "SYNOPSIS"
+.HP \w'\fBseqxrefget\fR\ 'u
+\fBseqxrefget\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBseqxrefget\fR\ 'u
+\fBseqxrefget\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBseqxrefget\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Sequence data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+seqxrefget is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/servertell.1e b/debian/manpages/servertell.1e
new file mode 100644
index 0000000..52e7e8f
--- /dev/null
+++ b/debian/manpages/servertell.1e
@@ -0,0 +1,79 @@
+'\" t
+.\" Title: SERVERTELL
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "SERVERTELL" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+servertell \- Display information about a public server
+.SH "SYNOPSIS"
+.HP \w'\fBservertell\fR\ 'u
+\fBservertell\fR \fB\-server\ \fR\fB\fIstring\fR\fR [\fB\-full\ \fR\fB\fIboolean\fR\fR] [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
+.HP \w'\fBservertell\fR\ 'u
+\fBservertell\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBservertell\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data resources" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-server\fR \fIstring\fR
+.RS 4
+The name of the database defined locally for use by EMBOSS\&.
+.RE
+.SS "Additional section"
+.PP
+\fB\-full\fR \fIboolean\fR
+.RS 4
+The default behaviour is to report for relevant databases only basic information from the EMBOSS database definition Default value: N
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+servertell is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/showalign.1e b/debian/manpages/showalign.1e
index f6365d7..0c5c656 100644
--- a/debian/manpages/showalign.1e
+++ b/debian/manpages/showalign.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SHOWALIGN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SHOWALIGN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SHOWALIGN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ showalign \- Display a multiple sequence alignment in pretty format
.SH "DESCRIPTION"
.PP
\fBshowalign\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Multiple,Display" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Alignment:Multiple,Data retrieval:Sequence data" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/showdb.1e b/debian/manpages/showdb.1e
index 671c532..80545ed 100644
--- a/debian/manpages/showdb.1e
+++ b/debian/manpages/showdb.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SHOWDB
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SHOWDB" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SHOWDB" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -31,13 +31,13 @@
showdb \- Displays information on configured databases
.SH "SYNOPSIS"
.HP \w'\fBshowdb\fR\ 'u
-\fBshowdb\fR [\fB\-database\ \fR\fB\fIstring\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] [\fB\-protein\ \fR\fB\fIboolean\fR\fR] [\fB\-nucleic\ \fR\fB\fIboolean\fR\fR] [\fB\-full\ \fR\fB\fIboolean\fR\fR] [\fB\-methods\ \fR\fB\fIboolean\fR\fR] [\fB\-fields\ \fR\fB\fIboolean\fR\fR] [\fB\-defined\ \fR\fB\fIboolean\fR\fR] [\fB\-release\ \fR\fB\fIboolean\fR\fR] \fB\-only\ \fR\fB\fItoggle\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIboolean\fR\fR \fB\-id\ \fR\fB\fIboolean\fR\fR \fB\-query\ \fR\fB\fIboolean\fR\fR \fB\-all\ \fR\fB\fIboolean\fR\fR \fB\-comment\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
+\fBshowdb\fR [\fB\-database\ \fR\fB\fIstring\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] [\fB\-protein\ \fR\fB\fIboolean\fR\fR] [\fB\-nucleic\ \fR\fB\fIboolean\fR\fR] [\fB\-sequence\ \fR\fB\fIboolean\fR\fR] [\fB\-feature\ \fR\fB\fIboolean\fR\fR] [\fB\-text\ \fR\fB\fIboolean\fR\fR] [\fB\-taxonomy\ \fR\fB\fIboolean\fR\fR] [\fB\-resource\ \fR\fB\fIboolean\fR\fR] [\fB\-assembly\ \fR\fB\fIboolean\fR\fR] [\fB\-obo\ \fR\fB\fIboolean\fR\fR] [\fB\-full\ \fR\fB\fIboolean\fR\fR] [\fB\-methods\ \fR\fB\fIboolean\fR\fR] [\fB\-fields\ \fR\fB\fIboolean\fR\fR] [\fB\-defined\ \fR\fB\fIboolean\fR\fR] [\fB\-release\ \fR\fB\fIboolean\fR\fR] \fB\-only\ \fR\fB\fItoggle\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIboolean\fR\fR \fB\-id\ \fR\fB\fIboolean\fR\fR \fB\-query\ \fR\fB\fIboolean\fR\fR \fB\-all\ \fR\fB\fIboolean\fR\fR \fB\-comment\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
.HP \w'\fBshowdb\fR\ 'u
\fBshowdb\fR \fB\-help\fR
.SH "DESCRIPTION"
.PP
\fBshowdb\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Information" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data resources" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
@@ -61,6 +61,41 @@ Default value: Y
Default value: Y
.RE
.PP
+\fB\-sequence\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-feature\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-text\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-taxonomy\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-resource\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-assembly\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-obo\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
\fB\-full\fR \fIboolean\fR
.RS 4
Default value: N
diff --git a/debian/manpages/showfeat.1e b/debian/manpages/showfeat.1e
index 7460749..9137c5f 100644
--- a/debian/manpages/showfeat.1e
+++ b/debian/manpages/showfeat.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SHOWFEAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SHOWFEAT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SHOWFEAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/showorf.1e b/debian/manpages/showorf.1e
index 8f1aad1..49291e3 100644
--- a/debian/manpages/showorf.1e
+++ b/debian/manpages/showorf.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SHOWORF
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SHOWORF" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SHOWORF" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/showpep.1e b/debian/manpages/showpep.1e
index aba095e..5d23319 100644
--- a/debian/manpages/showpep.1e
+++ b/debian/manpages/showpep.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SHOWPEP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SHOWPEP" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SHOWPEP" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/showseq.1e b/debian/manpages/showseq.1e
index b688078..2713c38 100644
--- a/debian/manpages/showseq.1e
+++ b/debian/manpages/showseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SHOWSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SHOWSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SHOWSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ showseq \- Displays sequences with features in pretty format
.SH "DESCRIPTION"
.PP
\fBshowseq\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Nucleic:Translation,Nucleic:Restriction" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Translation,Nucleic:Restriction" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/showserver.1e b/debian/manpages/showserver.1e
new file mode 100644
index 0000000..32bdf28
--- /dev/null
+++ b/debian/manpages/showserver.1e
@@ -0,0 +1,168 @@
+'\" t
+.\" Title: SHOWSERVER
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "SHOWSERVER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+showserver \- Displays information on configured servers
+.SH "SYNOPSIS"
+.HP \w'\fBshowserver\fR\ 'u
+\fBshowserver\fR [\fB\-server\ \fR\fB\fIstring\fR\fR] [\fB\-showtypes\ \fR\fB\fIlist\fR\fR] [\fB\-html\ \fR\fB\fIboolean\fR\fR] [\fB\-full\ \fR\fB\fIboolean\fR\fR] [\fB\-methods\ \fR\fB\fIboolean\fR\fR] [\fB\-count\ \fR\fB\fIboolean\fR\fR] [\fB\-cachefile\ \fR\fB\fIboolean\fR\fR] [\fB\-url\ \fR\fB\fIboolean\fR\fR] [\fB\-fields\ \fR\fB\fIboolean\fR\fR] [\fB\-defined\ \fR\fB\fIboolean\fR\fR] [\fB\-serverversion\ \fR\fB\fIboolean\fR\fR] [\fB\-sortby\ \fR\fB\fIlist\fR\fR] \fB\-only\ \fR\fB\fItoggle\fR\fR \fB\-heading\ \fR\fB\fIboolean\fR\fR \fB\-scope\ \fR\fB\fIboolean\fR\fR \fB\-type\ \fR\fB\fIboolean\fR\fR \fB\-id\ \fR\fB\fIboolean\fR\fR \fB\-query\ \fR\fB\fIboolean\fR\fR \fB\-all\ \fR\fB\fIboolean\fR\fR \fB\-comment\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR]
+.HP \w'\fBshowserver\fR\ 'u
+\fBshowserver\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBshowserver\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data resources" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-server\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-showtypes\fR \fIlist\fR
+.RS 4
+Default value: *
+.RE
+.PP
+\fB\-html\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-full\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.PP
+\fB\-methods\fR \fIboolean\fR
+.RS 4
+This displays the access methods that can be used on this server, for all, query or ID access Default value: $(full)
+.RE
+.PP
+\fB\-count\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-cachefile\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-url\fR \fIboolean\fR
+.RS 4
+Default value: Y
+.RE
+.PP
+\fB\-fields\fR \fIboolean\fR
+.RS 4
+This displays the search fields that can be used on this server, other than the standard \*(Aqid\*(Aq or \*(Aqacc\*(Aq fields\&. Default value: $(full)
+.RE
+.PP
+\fB\-defined\fR \fIboolean\fR
+.RS 4
+This displays a short name for the file containing the server definition Default value: $(full)
+.RE
+.PP
+\fB\-serverversion\fR \fIboolean\fR
+.RS 4
+Default value: $(full)
+.RE
+.PP
+\fB\-sortby\fR \fIlist\fR
+.RS 4
+Default value: type
+.RE
+.SS "Advanced section"
+.PP
+\fB\-only\fR \fItoggle\fR
+.RS 4
+This is a way of shortening the command line if you only want a few standard columns to be displayed\&. Instead of specifying: \*(Aq\-nohead \-notype \-noid \-noquery \-noall\*(Aq to get only the comment output, you can specify \*(Aq\-only \-comment\*(Aq Default value: N
+.RE
+.PP
+\fB\-heading\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-scope\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-type\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-id\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-query\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-all\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.PP
+\fB\-comment\fR \fIboolean\fR
+.RS 4
+Default value: @(!$(only))
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+showserver is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/shuffleseq.1e b/debian/manpages/shuffleseq.1e
index dce3bcd..fa1a701 100644
--- a/debian/manpages/shuffleseq.1e
+++ b/debian/manpages/shuffleseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SHUFFLESEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SHUFFLESEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SHUFFLESEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/sigcleave.1e b/debian/manpages/sigcleave.1e
index 04f610e..e9e6078 100644
--- a/debian/manpages/sigcleave.1e
+++ b/debian/manpages/sigcleave.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SIGCLEAVE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SIGCLEAVE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SIGCLEAVE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ sigcleave \- Reports on signal cleavage sites in a protein sequence
.SH "DESCRIPTION"
.PP
\fBsigcleave\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Motifs" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Functional sites,Protein:Motifs" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/silent.1e b/debian/manpages/silent.1e
index e310d74..8f8246a 100644
--- a/debian/manpages/silent.1e
+++ b/debian/manpages/silent.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SILENT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SILENT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SILENT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/sirna.1e b/debian/manpages/sirna.1e
index d2bfb0f..fe9ba57 100644
--- a/debian/manpages/sirna.1e
+++ b/debian/manpages/sirna.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SIRNA
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SIRNA" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SIRNA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ sirna \- Finds siRNA duplexes in mRNA
.SH "DESCRIPTION"
.PP
\fBsirna\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Composition" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Functional sites,Nucleic:2D structure" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/sixpack.1e b/debian/manpages/sixpack.1e
index 2c43af9..1337063 100644
--- a/debian/manpages/sixpack.1e
+++ b/debian/manpages/sixpack.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SIXPACK
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SIXPACK" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SIXPACK" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ sixpack \- Display a DNA sequence with 6\-frame translation and ORFs
.SH "DESCRIPTION"
.PP
\fBsixpack\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Nucleic:Gene finding,Nucleic:Translation" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Gene finding,Nucleic:Translation,Display" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/sizeseq.1e b/debian/manpages/sizeseq.1e
index 900ffe7..6ea42b1 100644
--- a/debian/manpages/sizeseq.1e
+++ b/debian/manpages/sizeseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SIZESEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SIZESEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SIZESEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/skipredundant.1e b/debian/manpages/skipredundant.1e
index 5530e28..e840a45 100644
--- a/debian/manpages/skipredundant.1e
+++ b/debian/manpages/skipredundant.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SKIPREDUNDANT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SKIPREDUNDANT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SKIPREDUNDANT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/skipseq.1e b/debian/manpages/skipseq.1e
index 7d7b065..ec886b5 100644
--- a/debian/manpages/skipseq.1e
+++ b/debian/manpages/skipseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SKIPSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SKIPSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SKIPSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/splitsource.1e b/debian/manpages/splitsource.1e
index e949a28..a4a8dc8 100644
--- a/debian/manpages/splitsource.1e
+++ b/debian/manpages/splitsource.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SPLITSOURCE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SPLITSOURCE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SPLITSOURCE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/splitter.1e b/debian/manpages/splitter.1e
index 14830e9..df74bc0 100644
--- a/debian/manpages/splitter.1e
+++ b/debian/manpages/splitter.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SPLITTER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SPLITTER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SPLITTER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/sqltest.1e b/debian/manpages/sqltest.1e
index 85c13bf..cb7aab7 100644
--- a/debian/manpages/sqltest.1e
+++ b/debian/manpages/sqltest.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SQLTEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SQLTEST" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SQLTEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/stretcher.1e b/debian/manpages/stretcher.1e
index 238a173..61a2da7 100644
--- a/debian/manpages/stretcher.1e
+++ b/debian/manpages/stretcher.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: STRETCHER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "STRETCHER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "STRETCHER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/stssearch.1e b/debian/manpages/stssearch.1e
index 83ed561..34ddff8 100644
--- a/debian/manpages/stssearch.1e
+++ b/debian/manpages/stssearch.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: STSSEARCH
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "STSSEARCH" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "STSSEARCH" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/supermatcher.1e b/debian/manpages/supermatcher.1e
index 019eaea..db95210 100644
--- a/debian/manpages/supermatcher.1e
+++ b/debian/manpages/supermatcher.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SUPERMATCHER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SUPERMATCHER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SUPERMATCHER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -88,7 +88,7 @@ Default value: 6
.PP
\fB\-errorfile\fR \fIoutfile\fR
.RS 4
-Error file to be written to Default value: supermatcher\&.error
+Error file to be written to for failed alignments Default value: supermatcher\&.error
.RE
.SH "BUGS"
.PP
diff --git a/debian/manpages/syco.1e b/debian/manpages/syco.1e
index 6118b1b..e043de4 100644
--- a/debian/manpages/syco.1e
+++ b/debian/manpages/syco.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: SYCO
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "SYCO" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "SYCO" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/taxget.1e b/debian/manpages/taxget.1e
new file mode 100644
index 0000000..9678d08
--- /dev/null
+++ b/debian/manpages/taxget.1e
@@ -0,0 +1,72 @@
+'\" t
+.\" Title: TAXGET
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "TAXGET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+taxget \- Get taxon(s)
+.SH "SYNOPSIS"
+.HP \w'\fBtaxget\fR\ 'u
+\fBtaxget\fR \fB\-taxons\ \fR\fB\fItaxon\fR\fR \fB\-outfile\ \fR\fB\fIouttaxon\fR\fR
+.HP \w'\fBtaxget\fR\ 'u
+\fBtaxget\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtaxget\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:Taxonomy" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-taxons\fR \fItaxon\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIouttaxon\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+taxget is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/taxgetdown.1e b/debian/manpages/taxgetdown.1e
new file mode 100644
index 0000000..41185b9
--- /dev/null
+++ b/debian/manpages/taxgetdown.1e
@@ -0,0 +1,73 @@
+'\" t
+.\" Title: TAXGETDOWN
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "TAXGETDOWN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+taxgetdown \- Get descendants of taxon(s)
+.SH "SYNOPSIS"
+.HP \w'\fBtaxgetdown\fR\ 'u
+\fBtaxgetdown\fR \fB\-taxons\ \fR\fB\fItaxon\fR\fR \fB\-outfile\ \fR\fB\fIouttaxon\fR\fR
+.HP \w'\fBtaxgetdown\fR\ 'u
+\fBtaxgetdown\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtaxgetdown\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:Taxonomy" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-taxons\fR \fItaxon\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIouttaxon\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+taxgetdown is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/taxgetrank.1e b/debian/manpages/taxgetrank.1e
new file mode 100644
index 0000000..eb6b7e6
--- /dev/null
+++ b/debian/manpages/taxgetrank.1e
@@ -0,0 +1,83 @@
+'\" t
+.\" Title: TAXGETRANK
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "TAXGETRANK" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+taxgetrank \- Get parents of taxon(s)
+.SH "SYNOPSIS"
+.HP \w'\fBtaxgetrank\fR\ 'u
+\fBtaxgetrank\fR \fB\-taxons\ \fR\fB\fItaxon\fR\fR \fB\-rank\ \fR\fB\fIlist\fR\fR \fB\-hidden\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIouttaxon\fR\fR
+.HP \w'\fBtaxgetrank\fR\ 'u
+\fBtaxgetrank\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtaxgetrank\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:Taxonomy" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-taxons\fR \fItaxon\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-rank\fR \fIlist\fR
+.RS 4
+Multiple ranks can be specified, or \*(Aq*\*(Aq for all Default value: kingdom,phylum,class,order,family,genus,species
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.PP
+\fB\-hidden\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIouttaxon\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+taxgetrank is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/taxgetspecies.1e b/debian/manpages/taxgetspecies.1e
new file mode 100644
index 0000000..9ce55ca
--- /dev/null
+++ b/debian/manpages/taxgetspecies.1e
@@ -0,0 +1,73 @@
+'\" t
+.\" Title: TAXGETSPECIES
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "TAXGETSPECIES" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+taxgetspecies \- Get all species under taxon(s)
+.SH "SYNOPSIS"
+.HP \w'\fBtaxgetspecies\fR\ 'u
+\fBtaxgetspecies\fR \fB\-taxons\ \fR\fB\fItaxon\fR\fR \fB\-outfile\ \fR\fB\fIouttaxon\fR\fR
+.HP \w'\fBtaxgetspecies\fR\ 'u
+\fBtaxgetspecies\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtaxgetspecies\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:Taxonomy" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-taxons\fR \fItaxon\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIouttaxon\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+taxgetspecies is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/taxgetup.1e b/debian/manpages/taxgetup.1e
new file mode 100644
index 0000000..a89c7bf
--- /dev/null
+++ b/debian/manpages/taxgetup.1e
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: TAXGETUP
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "TAXGETUP" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+taxgetup \- Get parents of taxon(s)
+.SH "SYNOPSIS"
+.HP \w'\fBtaxgetup\fR\ 'u
+\fBtaxgetup\fR \fB\-taxons\ \fR\fB\fItaxon\fR\fR \fB\-hidden\ \fR\fB\fIboolean\fR\fR \fB\-outfile\ \fR\fB\fIouttaxon\fR\fR
+.HP \w'\fBtaxgetup\fR\ 'u
+\fBtaxgetup\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtaxgetup\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:Taxonomy" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-taxons\fR \fItaxon\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.PP
+\fB\-hidden\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIouttaxon\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+taxgetup is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/taxseq.1e b/debian/manpages/taxseq.1e
new file mode 100644
index 0000000..1ff9530
--- /dev/null
+++ b/debian/manpages/taxseq.1e
@@ -0,0 +1,78 @@
+'\" t
+.\" Title: TAXSEQ
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "TAXSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+taxseq \- Identify sequence entries containing taxonomy IDs
+.SH "SYNOPSIS"
+.HP \w'\fBtaxseq\fR\ 'u
+\fBtaxseq\fR \fB\-sequence\ \fR\fB\fIseqall\fR\fR \fB\-ids\ \fR\fB\fIstring\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBtaxseq\fR\ 'u
+\fBtaxseq\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtaxseq\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-sequence\fR \fIseqall\fR
+.RS 4
+.RE
+.PP
+\fB\-ids\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+The list of sequence names will be written to this list file
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+taxseq is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/tcode.1e b/debian/manpages/tcode.1e
index 8ecc4c1..3a92b5f 100644
--- a/debian/manpages/tcode.1e
+++ b/debian/manpages/tcode.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TCODE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TCODE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TCODE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/testplot.1e b/debian/manpages/testplot.1e
index 236c935..222e0ed 100644
--- a/debian/manpages/testplot.1e
+++ b/debian/manpages/testplot.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TESTPLOT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TESTPLOT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TESTPLOT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/textget.1e b/debian/manpages/textget.1e
new file mode 100644
index 0000000..958f377
--- /dev/null
+++ b/debian/manpages/textget.1e
@@ -0,0 +1,72 @@
+'\" t
+.\" Title: TEXTGET
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "TEXTGET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+textget \- Get text data entries
+.SH "SYNOPSIS"
+.HP \w'\fBtextget\fR\ 'u
+\fBtextget\fR \fB\-text\ \fR\fB\fItext\fR\fR \fB\-outfile\ \fR\fB\fIouttext\fR\fR
+.HP \w'\fBtextget\fR\ 'u
+\fBtextget\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtextget\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Text data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-text\fR \fItext\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIouttext\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+textget is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/textsearch.1e b/debian/manpages/textsearch.1e
index f62f749..4cc8911 100644
--- a/debian/manpages/textsearch.1e
+++ b/debian/manpages/textsearch.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TEXTSEARCH
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TEXTSEARCH" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TEXTSEARCH" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ textsearch \- Search the textual description of sequence(s)
.SH "DESCRIPTION"
.PP
\fBtextsearch\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Display,Information" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Text data" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/texttotext.1e b/debian/manpages/texttotext.1e
new file mode 100644
index 0000000..2ad3221
--- /dev/null
+++ b/debian/manpages/texttotext.1e
@@ -0,0 +1,93 @@
+'\" t
+.\" Title: TEXTTOTEXT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "TEXTTOTEXT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+texttotext \- Convert a plain text format to a different format
+.SH "SYNOPSIS"
+.HP \w'\fBtexttotext\fR\ 'u
+\fBtexttotext\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-type\ \fR\fB\fIlist\fR\fR \fB\-seq\ \fR\fB\fIlist\fR\fR \fB\-feat\ \fR\fB\fIlist\fR\fR \fB\-align\ \fR\fB\fIlist\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBtexttotext\fR\ 'u
+\fBtexttotext\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtexttotext\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-type\fR \fIlist\fR
+.RS 4
+You must specify the type of file content so that appropriate output format options may be generated\&.
+.RE
+.PP
+\fB\-seq\fR \fIlist\fR
+.RS 4
+This option sets the format of a sequence output file\&. Default value: X
+.RE
+.PP
+\fB\-feat\fR \fIlist\fR
+.RS 4
+This option sets the format of a sequence feature output file\&. Default value: X
+.RE
+.PP
+\fB\-align\fR \fIlist\fR
+.RS 4
+This option sets the format of a sequence alignment output file\&. Default value: X
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+texttotext is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/texttoxml.1e b/debian/manpages/texttoxml.1e
new file mode 100644
index 0000000..ee25efd
--- /dev/null
+++ b/debian/manpages/texttoxml.1e
@@ -0,0 +1,93 @@
+'\" t
+.\" Title: TEXTTOXML
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "TEXTTOXML" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+texttoxml \- Convert a plain text format to an XML format
+.SH "SYNOPSIS"
+.HP \w'\fBtexttoxml\fR\ 'u
+\fBtexttoxml\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-type\ \fR\fB\fIlist\fR\fR \fB\-seq\ \fR\fB\fIlist\fR\fR \fB\-feat\ \fR\fB\fIlist\fR\fR \fB\-align\ \fR\fB\fIlist\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBtexttoxml\fR\ 'u
+\fBtexttoxml\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtexttoxml\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-type\fR \fIlist\fR
+.RS 4
+You must specify the type of file content so that appropriate output format options may be generated\&.
+.RE
+.PP
+\fB\-seq\fR \fIlist\fR
+.RS 4
+This option sets the format of a sequence output file\&. Default value: X
+.RE
+.PP
+\fB\-feat\fR \fIlist\fR
+.RS 4
+This option sets the format of a sequence feature output file\&. Default value: X
+.RE
+.PP
+\fB\-align\fR \fIlist\fR
+.RS 4
+This option sets the format of a sequence alignment output file\&. Default value: X
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+texttoxml is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/textvalid.1e b/debian/manpages/textvalid.1e
new file mode 100644
index 0000000..9777665
--- /dev/null
+++ b/debian/manpages/textvalid.1e
@@ -0,0 +1,78 @@
+'\" t
+.\" Title: TEXTVALID
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "TEXTVALID" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+textvalid \- Check a plain text format is valid
+.SH "SYNOPSIS"
+.HP \w'\fBtextvalid\fR\ 'u
+\fBtextvalid\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR [\fB\-type\ \fR\fB\fIlist\fR\fR] \fB\-logfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBtextvalid\fR\ 'u
+\fBtextvalid\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBtextvalid\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.PP
+\fB\-type\fR \fIlist\fR
+.RS 4
+If you know the type of file content then specify it using this option\&. This will help textvalid to identify and validate the file format\&.
+.RE
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-logfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+textvalid is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/tfextract.1e b/debian/manpages/tfextract.1e
index f3446f1..8d194be 100644
--- a/debian/manpages/tfextract.1e
+++ b/debian/manpages/tfextract.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TFEXTRACT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TFEXTRACT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TFEXTRACT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/tfm.1e b/debian/manpages/tfm.1e
index 1650782..e7eb7cb 100644
--- a/debian/manpages/tfm.1e
+++ b/debian/manpages/tfm.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TFM
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TFM" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TFM" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ tfm \- Displays full documentation for an application
.SH "DESCRIPTION"
.PP
\fBtfm\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Documentation" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/tfscan.1e b/debian/manpages/tfscan.1e
index 47ff7cc..54ac093 100644
--- a/debian/manpages/tfscan.1e
+++ b/debian/manpages/tfscan.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TFSCAN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TFSCAN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TFSCAN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/tmap.1e b/debian/manpages/tmap.1e
index 168e99e..cd1ee77 100644
--- a/debian/manpages/tmap.1e
+++ b/debian/manpages/tmap.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TMAP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TMAP" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TMAP" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,13 +37,13 @@ tmap \- Predict and plot transmembrane segments in protein sequences
.SH "DESCRIPTION"
.PP
\fBtmap\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:2D Structure" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Protein:Functional sites" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
\fB\-sequences\fR \fIseqset\fR
.RS 4
-File containing a sequence alignment
+File containing a protein sequence alignment
.RE
.SS "Output section"
.PP
diff --git a/debian/manpages/tranalign.1e b/debian/manpages/tranalign.1e
index a1a13a8..5e10fe6 100644
--- a/debian/manpages/tranalign.1e
+++ b/debian/manpages/tranalign.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TRANALIGN
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TRANALIGN" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TRANALIGN" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/transeq.1e b/debian/manpages/transeq.1e
index f25e30d..5c9780e 100644
--- a/debian/manpages/transeq.1e
+++ b/debian/manpages/transeq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TRANSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TRANSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TRANSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/treetypedisplay.1e b/debian/manpages/treetypedisplay.1e
index 1d6d9c1..971630b 100644
--- a/debian/manpages/treetypedisplay.1e
+++ b/debian/manpages/treetypedisplay.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TREETYPEDISPLAY
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TREETYPEDISPLAY" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TREETYPEDISPLAY" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/trimest.1e b/debian/manpages/trimest.1e
index 53f5f40..a2ee29d 100644
--- a/debian/manpages/trimest.1e
+++ b/debian/manpages/trimest.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TRIMEST
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TRIMEST" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TRIMEST" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ trimest \- Remove poly\-A tails from nucleotide sequences
.SH "DESCRIPTION"
.PP
\fBtrimest\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Edit" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Nucleic:Functional sites,Edit" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/trimseq.1e b/debian/manpages/trimseq.1e
index 06f2660..465174b 100644
--- a/debian/manpages/trimseq.1e
+++ b/debian/manpages/trimseq.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TRIMSEQ
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TRIMSEQ" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TRIMSEQ" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/trimspace.1e b/debian/manpages/trimspace.1e
index aee3a66..b57a62d 100644
--- a/debian/manpages/trimspace.1e
+++ b/debian/manpages/trimspace.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TRIMSPACE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TRIMSPACE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TRIMSPACE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/twofeat.1e b/debian/manpages/twofeat.1e
index 88d8fbe..40d659c 100644
--- a/debian/manpages/twofeat.1e
+++ b/debian/manpages/twofeat.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: TWOFEAT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "TWOFEAT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "TWOFEAT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/union.1e b/debian/manpages/union.1e
index a3fdf6e..650c9fc 100644
--- a/debian/manpages/union.1e
+++ b/debian/manpages/union.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: UNION
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "UNION" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "UNION" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/urlget.1e b/debian/manpages/urlget.1e
new file mode 100644
index 0000000..f43c37e
--- /dev/null
+++ b/debian/manpages/urlget.1e
@@ -0,0 +1,72 @@
+'\" t
+.\" Title: URLGET
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "URLGET" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+urlget \- Get URLs of data resources
+.SH "SYNOPSIS"
+.HP \w'\fBurlget\fR\ 'u
+\fBurlget\fR \fB\-url\ \fR\fB\fIurl\fR\fR \fB\-outfile\ \fR\fB\fIouturl\fR\fR
+.HP \w'\fBurlget\fR\ 'u
+\fBurlget\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBurlget\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Url data" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-url\fR \fIurl\fR
+.RS 4
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIouturl\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+urlget is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/vectorstrip.1e b/debian/manpages/vectorstrip.1e
index f0c8e34..2e38089 100644
--- a/debian/manpages/vectorstrip.1e
+++ b/debian/manpages/vectorstrip.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: VECTORSTRIP
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "VECTORSTRIP" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "VECTORSTRIP" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/water.1e b/debian/manpages/water.1e
index da73dd3..217da4f 100644
--- a/debian/manpages/water.1e
+++ b/debian/manpages/water.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: WATER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "WATER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "WATER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/whichdb.1e b/debian/manpages/whichdb.1e
index 86448b2..c8a0a80 100644
--- a/debian/manpages/whichdb.1e
+++ b/debian/manpages/whichdb.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: WHICHDB
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "WHICHDB" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "WHICHDB" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ whichdb \- Search all sequence databases for an entry and retrieve it
.SH "DESCRIPTION"
.PP
\fBwhichdb\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Data retrieval:Sequence data" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
diff --git a/debian/manpages/wobble.1e b/debian/manpages/wobble.1e
index efe9be3..e6b9db1 100644
--- a/debian/manpages/wobble.1e
+++ b/debian/manpages/wobble.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: WOBBLE
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "WOBBLE" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "WOBBLE" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/wordcount.1e b/debian/manpages/wordcount.1e
index a3df1db..fed0d0c 100644
--- a/debian/manpages/wordcount.1e
+++ b/debian/manpages/wordcount.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: WORDCOUNT
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "WORDCOUNT" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "WORDCOUNT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/wordfinder.1e b/debian/manpages/wordfinder.1e
index 38abc7b..48cc75c 100644
--- a/debian/manpages/wordfinder.1e
+++ b/debian/manpages/wordfinder.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: WORDFINDER
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "WORDFINDER" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "WORDFINDER" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/wordmatch.1e b/debian/manpages/wordmatch.1e
index 9c00962..559e416 100644
--- a/debian/manpages/wordmatch.1e
+++ b/debian/manpages/wordmatch.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: WORDMATCH
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "WORDMATCH" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "WORDMATCH" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
diff --git a/debian/manpages/wossdata.1e b/debian/manpages/wossdata.1e
new file mode 100644
index 0000000..8347ec5
--- /dev/null
+++ b/debian/manpages/wossdata.1e
@@ -0,0 +1,139 @@
+'\" t
+.\" Title: WOSSDATA
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "WOSSDATA" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+wossdata \- Finds programs by EDAM data
+.SH "SYNOPSIS"
+.HP \w'\fBwossdata\fR\ 'u
+\fBwossdata\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-explode\ \fR\fB\fIboolean\fR\fR] [\fB\-showkeywords\ \fR\fB\fIboolean\fR\fR] \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-emboss\ \fR\fB\fIboolean\fR\fR \fB\-embassy\ \fR\fB\fIboolean\fR\fR \fB\-showembassy\ \fR\fB\fIstring\fR\fR \fB\-colon\ \fR\fB\fIboolean\fR\fR \fB\-gui\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fItoggle\fR\fR] [\fB\-groups\ \fR\fB\fIboolean\fR\fR] [\fB\-alphabetic\ \fR\fB\fIboolean\fR\fR]
+.HP \w'\fBwossdata\fR\ 'u
+\fBwossdata\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwossdata\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Documentation" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-explode\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \*(AqNAME1\*(Aq, \*(AqNAME2\*(Aq, \*(AqNAME1 NAME2\*(Aq, NAME2 NAME1\*(Aq\&. The non\-expanded names are simply like: \*(AqNAME1 NAME2\*(Aq\&. Default value: N
+.RE
+.PP
+\fB\-showkeywords\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: Y
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.PP
+\fB\-emboss\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBOSS program documentation will be searched\&. If this option is set to be false, then only the EMBASSY programs will be searched (if the \-embassy option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-embassy\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBASSY program documentation will be searched\&. If this option is set to be false, then only the EMBOSS programs will be searched (if the \-emboss option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-showembassy\fR \fIstring\fR
+.RS 4
+If you use this option then this EMBASSY package program documentation will be searched\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme
+.RE
+.PP
+\fB\-colon\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to up to two levels, for example the primary group \*(AqALIGNMENT\*(Aq has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of wossname that require the names of these subgroups, a colon \*(Aq:\*(Aq will be placed between the first and second level of the group name if this option is true\&. Note: This does not apply if the group names have been exploded with the \*(Aqexplode\*(Aq option\&. Default value: N
+.RE
+.PP
+\fB\-gui\fR \fIboolean\fR
+.RS 4
+This option is intended to help those who are designing Graphical User Interfaces to the EMBOSS applications\&. Some EMBOSS programs are inappropriate for running in a GUI, these include other menu programs and interactive editors\&. This option allows you to only report those programs that can be run from a GUI Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fItoggle\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N
+.RE
+.PP
+\fB\-groups\fR \fIboolean\fR
+.RS 4
+If you use this option, then only the group names will be output to the file Default value: N
+.RE
+.PP
+\fB\-alphabetic\fR \fIboolean\fR
+.RS 4
+If you use this option, then you will get a single list of the program names and descriptions instead of the programs being listed in their functional groups\&. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+wossdata is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/wossinput.1e b/debian/manpages/wossinput.1e
new file mode 100644
index 0000000..2e60ba1
--- /dev/null
+++ b/debian/manpages/wossinput.1e
@@ -0,0 +1,139 @@
+'\" t
+.\" Title: WOSSINPUT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "WOSSINPUT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+wossinput \- Finds programs by EDAM input data
+.SH "SYNOPSIS"
+.HP \w'\fBwossinput\fR\ 'u
+\fBwossinput\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-explode\ \fR\fB\fIboolean\fR\fR] [\fB\-showkeywords\ \fR\fB\fIboolean\fR\fR] \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-emboss\ \fR\fB\fIboolean\fR\fR \fB\-embassy\ \fR\fB\fIboolean\fR\fR \fB\-showembassy\ \fR\fB\fIstring\fR\fR \fB\-colon\ \fR\fB\fIboolean\fR\fR \fB\-gui\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fItoggle\fR\fR] [\fB\-groups\ \fR\fB\fIboolean\fR\fR] [\fB\-alphabetic\ \fR\fB\fIboolean\fR\fR]
+.HP \w'\fBwossinput\fR\ 'u
+\fBwossinput\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwossinput\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Documentation" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-explode\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \*(AqNAME1\*(Aq, \*(AqNAME2\*(Aq, \*(AqNAME1 NAME2\*(Aq, NAME2 NAME1\*(Aq\&. The non\-expanded names are simply like: \*(AqNAME1 NAME2\*(Aq\&. Default value: N
+.RE
+.PP
+\fB\-showkeywords\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: Y
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.PP
+\fB\-emboss\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBOSS program documentation will be searched\&. If this option is set to be false, then only the EMBASSY programs will be searched (if the \-embassy option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-embassy\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBASSY program documentation will be searched\&. If this option is set to be false, then only the EMBOSS programs will be searched (if the \-emboss option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-showembassy\fR \fIstring\fR
+.RS 4
+If you use this option then this EMBASSY package program documentation will be searched\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme
+.RE
+.PP
+\fB\-colon\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to up to two levels, for example the primary group \*(AqALIGNMENT\*(Aq has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of wossname that require the names of these subgroups, a colon \*(Aq:\*(Aq will be placed between the first and second level of the group name if this option is true\&. Note: This does not apply if the group names have been exploded with the \*(Aqexplode\*(Aq option\&. Default value: N
+.RE
+.PP
+\fB\-gui\fR \fIboolean\fR
+.RS 4
+This option is intended to help those who are designing Graphical User Interfaces to the EMBOSS applications\&. Some EMBOSS programs are inappropriate for running in a GUI, these include other menu programs and interactive editors\&. This option allows you to only report those programs that can be run from a GUI Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fItoggle\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N
+.RE
+.PP
+\fB\-groups\fR \fIboolean\fR
+.RS 4
+If you use this option, then only the group names will be output to the file Default value: N
+.RE
+.PP
+\fB\-alphabetic\fR \fIboolean\fR
+.RS 4
+If you use this option, then you will get a single list of the program names and descriptions instead of the programs being listed in their functional groups\&. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+wossinput is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/wossname.1e b/debian/manpages/wossname.1e
index b9f38f0..bf0cb65 100644
--- a/debian/manpages/wossname.1e
+++ b/debian/manpages/wossname.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: WOSSNAME
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "WOSSNAME" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "WOSSNAME" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
@@ -37,7 +37,7 @@ wossname \- Finds programs by keywords in their short description
.SH "DESCRIPTION"
.PP
\fBwossname\fR
-is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Information" command group(s)\&.
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Documentation" command group(s)\&.
.SH "OPTIONS"
.SS "Input section"
.PP
@@ -102,7 +102,7 @@ If you are sending the output to a file, this will format it for displaying as a
.PP
\fB\-groups\fR \fIboolean\fR
.RS 4
-If you use this option, then only the group names will output to the file Default value: N
+If you use this option, then only the group names will be output to the file Default value: N
.RE
.PP
\fB\-alphabetic\fR \fIboolean\fR
diff --git a/debian/manpages/wossoperation.1e b/debian/manpages/wossoperation.1e
new file mode 100644
index 0000000..60827a8
--- /dev/null
+++ b/debian/manpages/wossoperation.1e
@@ -0,0 +1,139 @@
+'\" t
+.\" Title: WOSSOPERATION
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "WOSSOPERATION" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+wossoperation \- Finds programs by EDAM operation
+.SH "SYNOPSIS"
+.HP \w'\fBwossoperation\fR\ 'u
+\fBwossoperation\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-explode\ \fR\fB\fIboolean\fR\fR] [\fB\-showkeywords\ \fR\fB\fIboolean\fR\fR] \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-emboss\ \fR\fB\fIboolean\fR\fR \fB\-embassy\ \fR\fB\fIboolean\fR\fR \fB\-showembassy\ \fR\fB\fIstring\fR\fR \fB\-colon\ \fR\fB\fIboolean\fR\fR \fB\-gui\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fItoggle\fR\fR] [\fB\-groups\ \fR\fB\fIboolean\fR\fR] [\fB\-alphabetic\ \fR\fB\fIboolean\fR\fR]
+.HP \w'\fBwossoperation\fR\ 'u
+\fBwossoperation\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwossoperation\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Documentation" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-explode\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \*(AqNAME1\*(Aq, \*(AqNAME2\*(Aq, \*(AqNAME1 NAME2\*(Aq, NAME2 NAME1\*(Aq\&. The non\-expanded names are simply like: \*(AqNAME1 NAME2\*(Aq\&. Default value: N
+.RE
+.PP
+\fB\-showkeywords\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: Y
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.PP
+\fB\-emboss\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBOSS program documentation will be searched\&. If this option is set to be false, then only the EMBASSY programs will be searched (if the \-embassy option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-embassy\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBASSY program documentation will be searched\&. If this option is set to be false, then only the EMBOSS programs will be searched (if the \-emboss option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-showembassy\fR \fIstring\fR
+.RS 4
+If you use this option then this EMBASSY package program documentation will be searched\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme
+.RE
+.PP
+\fB\-colon\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to up to two levels, for example the primary group \*(AqALIGNMENT\*(Aq has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of wossname that require the names of these subgroups, a colon \*(Aq:\*(Aq will be placed between the first and second level of the group name if this option is true\&. Note: This does not apply if the group names have been exploded with the \*(Aqexplode\*(Aq option\&. Default value: N
+.RE
+.PP
+\fB\-gui\fR \fIboolean\fR
+.RS 4
+This option is intended to help those who are designing Graphical User Interfaces to the EMBOSS applications\&. Some EMBOSS programs are inappropriate for running in a GUI, these include other menu programs and interactive editors\&. This option allows you to only report those programs that can be run from a GUI Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fItoggle\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N
+.RE
+.PP
+\fB\-groups\fR \fIboolean\fR
+.RS 4
+If you use this option, then only the group names will be output to the file Default value: N
+.RE
+.PP
+\fB\-alphabetic\fR \fIboolean\fR
+.RS 4
+If you use this option, then you will get a single list of the program names and descriptions instead of the programs being listed in their functional groups\&. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+wossoperation is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/wossoutput.1e b/debian/manpages/wossoutput.1e
new file mode 100644
index 0000000..cbe4e00
--- /dev/null
+++ b/debian/manpages/wossoutput.1e
@@ -0,0 +1,139 @@
+'\" t
+.\" Title: WOSSOUTPUT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "WOSSOUTPUT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+wossoutput \- Finds programs by EDAM output data
+.SH "SYNOPSIS"
+.HP \w'\fBwossoutput\fR\ 'u
+\fBwossoutput\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-explode\ \fR\fB\fIboolean\fR\fR] [\fB\-showkeywords\ \fR\fB\fIboolean\fR\fR] \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-emboss\ \fR\fB\fIboolean\fR\fR \fB\-embassy\ \fR\fB\fIboolean\fR\fR \fB\-showembassy\ \fR\fB\fIstring\fR\fR \fB\-colon\ \fR\fB\fIboolean\fR\fR \fB\-gui\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fItoggle\fR\fR] [\fB\-groups\ \fR\fB\fIboolean\fR\fR] [\fB\-alphabetic\ \fR\fB\fIboolean\fR\fR]
+.HP \w'\fBwossoutput\fR\ 'u
+\fBwossoutput\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwossoutput\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Documentation" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-explode\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \*(AqNAME1\*(Aq, \*(AqNAME2\*(Aq, \*(AqNAME1 NAME2\*(Aq, NAME2 NAME1\*(Aq\&. The non\-expanded names are simply like: \*(AqNAME1 NAME2\*(Aq\&. Default value: N
+.RE
+.PP
+\fB\-showkeywords\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: Y
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.PP
+\fB\-emboss\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBOSS program documentation will be searched\&. If this option is set to be false, then only the EMBASSY programs will be searched (if the \-embassy option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-embassy\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBASSY program documentation will be searched\&. If this option is set to be false, then only the EMBOSS programs will be searched (if the \-emboss option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-showembassy\fR \fIstring\fR
+.RS 4
+If you use this option then this EMBASSY package program documentation will be searched\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme
+.RE
+.PP
+\fB\-colon\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to up to two levels, for example the primary group \*(AqALIGNMENT\*(Aq has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of wossname that require the names of these subgroups, a colon \*(Aq:\*(Aq will be placed between the first and second level of the group name if this option is true\&. Note: This does not apply if the group names have been exploded with the \*(Aqexplode\*(Aq option\&. Default value: N
+.RE
+.PP
+\fB\-gui\fR \fIboolean\fR
+.RS 4
+This option is intended to help those who are designing Graphical User Interfaces to the EMBOSS applications\&. Some EMBOSS programs are inappropriate for running in a GUI, these include other menu programs and interactive editors\&. This option allows you to only report those programs that can be run from a GUI Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fItoggle\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N
+.RE
+.PP
+\fB\-groups\fR \fIboolean\fR
+.RS 4
+If you use this option, then only the group names will be output to the file Default value: N
+.RE
+.PP
+\fB\-alphabetic\fR \fIboolean\fR
+.RS 4
+If you use this option, then you will get a single list of the program names and descriptions instead of the programs being listed in their functional groups\&. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+wossoutput is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/wossparam.1e b/debian/manpages/wossparam.1e
new file mode 100644
index 0000000..f560a03
--- /dev/null
+++ b/debian/manpages/wossparam.1e
@@ -0,0 +1,139 @@
+'\" t
+.\" Title: WOSSPARAM
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "WOSSPARAM" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+wossparam \- Finds programs by EDAM parameter
+.SH "SYNOPSIS"
+.HP \w'\fBwossparam\fR\ 'u
+\fBwossparam\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-explode\ \fR\fB\fIboolean\fR\fR] [\fB\-showkeywords\ \fR\fB\fIboolean\fR\fR] \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-emboss\ \fR\fB\fIboolean\fR\fR \fB\-embassy\ \fR\fB\fIboolean\fR\fR \fB\-showembassy\ \fR\fB\fIstring\fR\fR \fB\-colon\ \fR\fB\fIboolean\fR\fR \fB\-gui\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fItoggle\fR\fR] [\fB\-groups\ \fR\fB\fIboolean\fR\fR] [\fB\-alphabetic\ \fR\fB\fIboolean\fR\fR]
+.HP \w'\fBwossparam\fR\ 'u
+\fBwossparam\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwossparam\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Documentation" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-explode\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \*(AqNAME1\*(Aq, \*(AqNAME2\*(Aq, \*(AqNAME1 NAME2\*(Aq, NAME2 NAME1\*(Aq\&. The non\-expanded names are simply like: \*(AqNAME1 NAME2\*(Aq\&. Default value: N
+.RE
+.PP
+\fB\-showkeywords\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: Y
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.PP
+\fB\-emboss\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBOSS program documentation will be searched\&. If this option is set to be false, then only the EMBASSY programs will be searched (if the \-embassy option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-embassy\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBASSY program documentation will be searched\&. If this option is set to be false, then only the EMBOSS programs will be searched (if the \-emboss option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-showembassy\fR \fIstring\fR
+.RS 4
+If you use this option then this EMBASSY package program documentation will be searched\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme
+.RE
+.PP
+\fB\-colon\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to up to two levels, for example the primary group \*(AqALIGNMENT\*(Aq has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of wossname that require the names of these subgroups, a colon \*(Aq:\*(Aq will be placed between the first and second level of the group name if this option is true\&. Note: This does not apply if the group names have been exploded with the \*(Aqexplode\*(Aq option\&. Default value: N
+.RE
+.PP
+\fB\-gui\fR \fIboolean\fR
+.RS 4
+This option is intended to help those who are designing Graphical User Interfaces to the EMBOSS applications\&. Some EMBOSS programs are inappropriate for running in a GUI, these include other menu programs and interactive editors\&. This option allows you to only report those programs that can be run from a GUI Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fItoggle\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N
+.RE
+.PP
+\fB\-groups\fR \fIboolean\fR
+.RS 4
+If you use this option, then only the group names will be output to the file Default value: N
+.RE
+.PP
+\fB\-alphabetic\fR \fIboolean\fR
+.RS 4
+If you use this option, then you will get a single list of the program names and descriptions instead of the programs being listed in their functional groups\&. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+wossparam is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/wosstopic.1e b/debian/manpages/wosstopic.1e
new file mode 100644
index 0000000..7f79b61
--- /dev/null
+++ b/debian/manpages/wosstopic.1e
@@ -0,0 +1,139 @@
+'\" t
+.\" Title: WOSSTOPIC
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "WOSSTOPIC" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+wosstopic \- Finds programs by EDAM topic
+.SH "SYNOPSIS"
+.HP \w'\fBwosstopic\fR\ 'u
+\fBwosstopic\fR \fB\-identifier\ \fR\fB\fIstring\fR\fR [\fB\-explode\ \fR\fB\fIboolean\fR\fR] [\fB\-showkeywords\ \fR\fB\fIboolean\fR\fR] \fB\-sensitive\ \fR\fB\fIboolean\fR\fR \fB\-subclasses\ \fR\fB\fIboolean\fR\fR \fB\-obsolete\ \fR\fB\fIboolean\fR\fR \fB\-emboss\ \fR\fB\fIboolean\fR\fR \fB\-embassy\ \fR\fB\fIboolean\fR\fR \fB\-showembassy\ \fR\fB\fIstring\fR\fR \fB\-colon\ \fR\fB\fIboolean\fR\fR \fB\-gui\ \fR\fB\fIboolean\fR\fR [\fB\-outfile\ \fR\fB\fIoutfile\fR\fR] [\fB\-html\ \fR\fB\fItoggle\fR\fR] [\fB\-groups\ \fR\fB\fIboolean\fR\fR] [\fB\-alphabetic\ \fR\fB\fIboolean\fR\fR]
+.HP \w'\fBwosstopic\fR\ 'u
+\fBwosstopic\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBwosstopic\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Ontology:EDAM,Documentation" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-identifier\fR \fIstring\fR
+.RS 4
+.RE
+.SS "Additional section"
+.PP
+\fB\-explode\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to have two forms, exploded and not exploded\&. The exploded group names are more numerous and often vaguely phrased than the non\-exploded ones\&. The exploded names are formed from definitions of the group names that start like NAME1:NAME2 and which are then expanded into many combinations of the names as: \*(AqNAME1\*(Aq, \*(AqNAME2\*(Aq, \*(AqNAME1 NAME2\*(Aq, NAME2 NAME1\*(Aq\&. The non\-expanded names are simply like: \*(AqNAME1 NAME2\*(Aq\&. Default value: N
+.RE
+.PP
+\fB\-showkeywords\fR \fIboolean\fR
+.RS 4
+Default value: N
+.RE
+.SS "Advanced section"
+.PP
+\fB\-sensitive\fR \fIboolean\fR
+.RS 4
+By default, the query keywords are matched against the EDAM term names (and synonyms) only\&. This option also matches the keywords against the EDAM term definitions and will therefore (typically) report more matches\&. Default value: N
+.RE
+.PP
+\fB\-subclasses\fR \fIboolean\fR
+.RS 4
+Extend the query matches to include all terms which are specialisations (EDAM sub\-classes) of the matched type\&. Default value: Y
+.RE
+.PP
+\fB\-obsolete\fR \fIboolean\fR
+.RS 4
+The default behaviour is to not use or return obsolete terms\&. This option if set will include all terms\&. Default value: N
+.RE
+.PP
+\fB\-emboss\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBOSS program documentation will be searched\&. If this option is set to be false, then only the EMBASSY programs will be searched (if the \-embassy option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-embassy\fR \fIboolean\fR
+.RS 4
+If you use this option then EMBASSY program documentation will be searched\&. If this option is set to be false, then only the EMBOSS programs will be searched (if the \-emboss option is true)\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme Default value: Y
+.RE
+.PP
+\fB\-showembassy\fR \fIstring\fR
+.RS 4
+If you use this option then this EMBASSY package program documentation will be searched\&. EMBASSY programs are not strictly part of EMBOSS, but use the same code libraries and share the same look and feel, but are generally developed by people who wish the programs to be outside of the GNU Public Licence scheme
+.RE
+.PP
+\fB\-colon\fR \fIboolean\fR
+.RS 4
+The groups that EMBOSS applications belong to up to two levels, for example the primary group \*(AqALIGNMENT\*(Aq has several sub\-groups, or second\-level groups, e\&.g\&.: CONSENSUS, DIFFERENCES, DOT PLOTS, GLOBAL, LOCAL, MULTIPLE\&. To aid programs that parse the output of wossname that require the names of these subgroups, a colon \*(Aq:\*(Aq will be placed between the first and second level of the group name if this option is true\&. Note: This does not apply if the group names have been exploded with the \*(Aqexplode\*(Aq option\&. Default value: N
+.RE
+.PP
+\fB\-gui\fR \fIboolean\fR
+.RS 4
+This option is intended to help those who are designing Graphical User Interfaces to the EMBOSS applications\&. Some EMBOSS programs are inappropriate for running in a GUI, these include other menu programs and interactive editors\&. This option allows you to only report those programs that can be run from a GUI Default value: N
+.RE
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+Default value: stdout
+.RE
+.SS "Html section"
+.PP
+\fB\-html\fR \fItoggle\fR
+.RS 4
+If you are sending the output to a file, this will format it for displaying as a table in a WWW document\&. Default value: N
+.RE
+.PP
+\fB\-groups\fR \fIboolean\fR
+.RS 4
+If you use this option, then only the group names will be output to the file Default value: N
+.RE
+.PP
+\fB\-alphabetic\fR \fIboolean\fR
+.RS 4
+If you use this option, then you will get a single list of the program names and descriptions instead of the programs being listed in their functional groups\&. Default value: N
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+wosstopic is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/xmltotext.1e b/debian/manpages/xmltotext.1e
new file mode 100644
index 0000000..79d5de6
--- /dev/null
+++ b/debian/manpages/xmltotext.1e
@@ -0,0 +1,93 @@
+'\" t
+.\" Title: XMLTOTEXT
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "XMLTOTEXT" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+xmltotext \- Convert an XML document to a plain text format
+.SH "SYNOPSIS"
+.HP \w'\fBxmltotext\fR\ 'u
+\fBxmltotext\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-type\ \fR\fB\fIlist\fR\fR \fB\-seq\ \fR\fB\fIlist\fR\fR \fB\-feat\ \fR\fB\fIlist\fR\fR \fB\-align\ \fR\fB\fIlist\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBxmltotext\fR\ 'u
+\fBxmltotext\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBxmltotext\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-type\fR \fIlist\fR
+.RS 4
+You must specify the type of file content so that appropriate output format options may be generated\&.
+.RE
+.PP
+\fB\-seq\fR \fIlist\fR
+.RS 4
+This option sets the format of a sequence output file\&. Default value: X
+.RE
+.PP
+\fB\-feat\fR \fIlist\fR
+.RS 4
+This option sets the format of a sequence feature output file\&. Default value: X
+.RE
+.PP
+\fB\-align\fR \fIlist\fR
+.RS 4
+This option sets the format of a sequence alignment output file\&. Default value: X
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+xmltotext is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/xmltoxml.1e b/debian/manpages/xmltoxml.1e
new file mode 100644
index 0000000..3420aae
--- /dev/null
+++ b/debian/manpages/xmltoxml.1e
@@ -0,0 +1,93 @@
+'\" t
+.\" Title: XMLTOXML
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "XMLTOXML" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+xmltoxml \- Convert an XML document to a different format
+.SH "SYNOPSIS"
+.HP \w'\fBxmltoxml\fR\ 'u
+\fBxmltoxml\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-type\ \fR\fB\fIlist\fR\fR \fB\-seq\ \fR\fB\fIlist\fR\fR \fB\-feat\ \fR\fB\fIlist\fR\fR \fB\-align\ \fR\fB\fIlist\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBxmltoxml\fR\ 'u
+\fBxmltoxml\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBxmltoxml\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.PP
+\fB\-type\fR \fIlist\fR
+.RS 4
+You must specify the type of file content so that appropriate output format options may be generated\&.
+.RE
+.PP
+\fB\-seq\fR \fIlist\fR
+.RS 4
+This option sets the XML format of a sequence output file\&. Default value: X
+.RE
+.PP
+\fB\-feat\fR \fIlist\fR
+.RS 4
+This option sets the XML format of a sequence feature output file\&. Default value: X
+.RE
+.PP
+\fB\-align\fR \fIlist\fR
+.RS 4
+This option sets the XML format of a sequence alignment output file\&. Default value: X
+.RE
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+xmltoxml is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/xmltransform.1e b/debian/manpages/xmltransform.1e
new file mode 100644
index 0000000..7e2d64c
--- /dev/null
+++ b/debian/manpages/xmltransform.1e
@@ -0,0 +1,81 @@
+'\" t
+.\" Title: XMLTRANSFORM
+.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
+.\" Manual: EMBOSS Manual for Debian
+.\" Source: EMBOSS 6.4.0
+.\" Language: English
+.\"
+.TH "XMLTRANSFORM" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
+.\" -----------------------------------------------------------------
+.\" * Define some portability stuff
+.\" -----------------------------------------------------------------
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.\" http://bugs.debian.org/507673
+.\" http://lists.gnu.org/archive/html/groff/2009-02/msg00013.html
+.\" ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.\" -----------------------------------------------------------------
+.\" * set default formatting
+.\" -----------------------------------------------------------------
+.\" disable hyphenation
+.nh
+.\" disable justification (adjust text to left margin only)
+.ad l
+.\" -----------------------------------------------------------------
+.\" * MAIN CONTENT STARTS HERE *
+.\" -----------------------------------------------------------------
+.SH "NAME"
+xmltransform \- Convert an XML document to a different format using a supplied XSLT file
+.SH "SYNOPSIS"
+.HP \w'\fBxmltransform\fR\ 'u
+\fBxmltransform\fR \fB\-infile\ \fR\fB\fIinfile\fR\fR \fB\-xslt\ \fR\fB\fIinfile\fR\fR \fB\-outfile\ \fR\fB\fIoutfile\fR\fR \fB\-logfile\ \fR\fB\fIoutfile\fR\fR
+.HP \w'\fBxmltransform\fR\ 'u
+\fBxmltransform\fR \fB\-help\fR
+.SH "DESCRIPTION"
+.PP
+\fBxmltransform\fR
+is a command line program from EMBOSS (\(lqthe European Molecular Biology Open Software Suite\(rq)\&. It is part of the "Utils:Misc" command group(s)\&.
+.SH "OPTIONS"
+.SS "Input section"
+.PP
+\fB\-infile\fR \fIinfile\fR
+.RS 4
+.RE
+.PP
+\fB\-xslt\fR \fIinfile\fR
+.RS 4
+.RE
+.SS "Required section"
+.SS "Additional section"
+.SS "Advanced section"
+.SS "Output section"
+.PP
+\fB\-outfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.PP
+\fB\-logfile\fR \fIoutfile\fR
+.RS 4
+.RE
+.SH "BUGS"
+.PP
+Bugs can be reported to the Debian Bug Tracking system (http://bugs\&.debian\&.org/emboss), or directly to the EMBOSS developers (http://sourceforge\&.net/tracker/?group_id=93650&atid=605031)\&.
+.SH "SEE ALSO"
+.PP
+xmltransform is fully documented via the
+\fBtfm\fR(1)
+system\&.
+.SH "AUTHOR"
+.PP
+\fBDebian Med Packaging Team\fR <\&debian\-med\-packaging at lists\&.alioth\&.debian\&.org\&>
+.RS 4
+Wrote the script used to autogenerate this manual page\&.
+.RE
+.SH "COPYRIGHT"
+.br
+.PP
+This manual page was autogenerated from an Ajax Control Definition of the EMBOSS package\&. It can be redistributed under the same terms as EMBOSS itself\&.
+.sp
diff --git a/debian/manpages/yank.1e b/debian/manpages/yank.1e
index 1dffd56..67ba7ae 100644
--- a/debian/manpages/yank.1e
+++ b/debian/manpages/yank.1e
@@ -1,13 +1,13 @@
'\" t
.\" Title: YANK
.\" Author: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-.\" Generator: DocBook XSL Stylesheets v1.75.2 <http://docbook.sf.net/>
-.\" Date: 07/20/2010
+.\" Generator: DocBook XSL Stylesheets v1.76.1 <http://docbook.sf.net/>
+.\" Date: 05/11/2012
.\" Manual: EMBOSS Manual for Debian
-.\" Source: EMBOSS 6.3.1
+.\" Source: EMBOSS 6.4.0
.\" Language: English
.\"
-.TH "YANK" "1e" "07/20/2010" "EMBOSS 6.3.1" "EMBOSS Manual for Debian"
+.TH "YANK" "1e" "05/11/2012" "EMBOSS 6.4.0" "EMBOSS Manual for Debian"
.\" -----------------------------------------------------------------
.\" * Define some portability stuff
.\" -----------------------------------------------------------------
--
The European Molecular Biology Open Software Suite.
More information about the debian-med-commit
mailing list