[med-svn] [SCM] ray branch, upstream, created. upstream/2.1.0-3-gf641553
Sébastien Boisvert
sebastien.boisvert.3 at ulaval.ca
Sat Nov 3 20:43:56 UTC 2012
The branch, upstream has been created
at f641553b4fe50897c18dcd24836d19a461f575f9 (commit)
- Shortlog ------------------------------------------------------------
commit f641553b4fe50897c18dcd24836d19a461f575f9
Merge: 2aef580 7fe93d5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Nov 3 15:50:22 2012 -0400
Merge branch 'master' of git://github.com/sebhtml/ray into upstream
commit 2aef5807e59251bdfecde2a3b3b2b93090e90153
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Nov 3 15:48:42 2012 -0400
The initial state of the branch upstream must be empty
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 7fe93d5574e7ddd909164b1fa626842d5558e0b8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Oct 31 10:00:54 2012 -0400
Code names of old releases were added
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 765aa3d728d1fdd4eb5944a137d2f6f0900c9eac
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Oct 30 19:34:53 2012 -0400
Social networks were added to the release procedure
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit c8953003b7b3bdfda399fc49c11c0e15889332cd
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Oct 30 18:28:04 2012 -0400
Ray v2.1.0
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 89d43d50c61fe9621eb64972cf2497332ccd7627
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Oct 29 13:29:42 2012 -0400
Related git repositories were added in the README.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 282548e1fde95fb2a3883c6d1a1631c46421c684
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Oct 18 12:10:26 2012 -0400
This is the branch for Ray v2.1.0-rc1
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit c96f75264ab3f571fd574bfd40a00a3bbf198939
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Oct 16 12:49:16 2012 -0400
Searcher: GraphBrowsing.xml needs -one-color-per-file
The implementation of the virtual coloring layer is not optimal.
Therefore, it is required to use one color per file to generate
information in GraphBrowsing.xml.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 28e9401aa3dc23dd8a239ebd827a009fcd63fbb7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Oct 16 00:19:15 2012 -0400
Searcher: fixed compilation warnings
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit beb565ad8750d0bfb4c5eaab1bb8a93ec52b209a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Oct 14 05:48:36 2012 -0400
Searcher: fixed buffer overflow
This commit fixes a regression introduced by commit
c6f228900b05ef0534e82803eebce65b5ec5b828. The number of available
units must consider also the number of physical colors.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 13efb22270e4f563c9cafcebe9c47082b09e53ab
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Oct 10 14:27:36 2012 -0400
Documentation: added more documentation for gene ontology.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit ac55873ba51f761c419bfc03fff6537b5653bc3c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Oct 9 17:13:41 2012 -0400
Searcher: removed debug messages from stable release
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit fcd8150b7837daaac61bdad8e528ac9e46be3c69
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Oct 8 10:22:05 2012 -0400
SequencesLoader: fixed the scope of a buffer
The scope of a buffer was incorrect. However, only gcc 4.7.x caused
the behavior indicating that something was wrong with the code.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 75194b5c7c96f9201aaf35f5e47c11e804d0b8be
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Oct 6 17:22:54 2012 -0400
scripts: don't ship the example and only ship the bz2 distribution
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit cc00ad9214eafd4d242ad0e9d719ac4ef268f49a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Oct 6 17:21:13 2012 -0400
Searcher: fixed assertion code
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 42be6ac78c4a070c4261774fc49ea2112cd260f4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Oct 6 17:07:05 2012 -0400
Searcher: added physical color in SequenceAbundances.xml
To make sense of the file
orion/BiologicalAbundances/_Coloring/GraphBrowsing.xml, the file
orion/BiologicalAbundances/DatabaseTest-strept/SequenceAbundances.xml
(or any other namespace directory) is required.
GraphBrowsing.xml is usefull -- it contains information about
coloring. For instance, you can obtain the number of references that
have colors 0 and 1 in namespace 0. For the biologist, this is
useful because it gives the number of k-mers shared by reference
sequences, for instance.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit d1aeb8d838284313150e468ed5d55ba548785223
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Oct 6 16:30:52 2012 -0400
Searcher: find or create a virtual color from physical colors
The code for finding or creating a virtual color from physical
colors was added. The new code is only used for storing summary
information. The code that handles virtual coloring for kmers in
the graph is much more efficient as it is O(1) for most operations.
In particular, it is faster to obtain a hash value from a virtual
color and a physical color than with just an array of physical
colors.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit c6f228900b05ef0534e82803eebce65b5ec5b828
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Oct 6 00:14:48 2012 -0400
Searcher: browsing the distributed colored de Bruijn subgraph
This patch adds code paths for extracting colored summaries
from the distributed de Bruijn subgraph. Forthcoming patches
will implement the code that returns a virtual color from
an array of physical colors.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 80c83ca3fcbdcb41a2cd049981d0e13c96fb0022
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Oct 4 11:47:41 2012 -0400
This is Ray v2.1.0-rc0 "Ancient Granularity of Epochs"
This is the first release candidate (v2.1.0-rc0) for the v2.1.0.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 16877adef5cea7e50f269688938ef64ca72dd81d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 29 22:44:06 2012 -0400
Calls to deprecated methods were eliminated.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit d8a8d737481d657ad8979e025eecacb9f400f3b1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Sep 27 17:33:06 2012 -0400
Searcher: fixed a race condition where a message was lost
This patch registers a handler for RAY_MPI_TAG_GRAPH_COUNTS in the
software interruption message tag table. Software interruption table
is the best way to process messages anyway.
At some point, the process with rank 0 sends a message with the tag
RAY_MPI_TAG_GRAPH_COUNTS to everyone. But if a process receives its
message of type RAY_MPI_TAG_GRAPH_COUNTS before entering the first
condition (the first if statement) in
call_RAY_SLAVE_MODE_CONTIG_BIOLOGICAL_ABUNDANCES, then the received
message is lost. Hence the race condition.
Even if call_RAY_MPI_TAG_GRAPH_COUNTS is called before the first
call to call_RAY_SLAVE_MODE_CONTIG_BIOLOGICAL_ABUNDANCES -- which
is silly in some way -- the code path remains valid as the call to
call_RAY_MPI_TAG_GRAPH_COUNTS touches nothing that the first if() in
call_RAY_SLAVE_MODE_CONTIG_BIOLOGICAL_ABUNDANCES touches.
If the message is received after the first if statement has been
processed, then there is no problem regardless.
The software interruption in the message tag table can occur before
the software interruption in the slave mode table because the message
comes from another process.
It is unusual for the master process to send control messages in a
slave mode handler. This should be fixed too!
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 2ee566a09514ad368907a472e5d94db1d17d0dea
Merge: 4bcd490 9444844
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 25 14:16:25 2012 -0400
Merge branch 'for-seb-September-2012'
A few changes in the scalability and usability departments.
* for-seb-September-2012:
Parameters: throw a warning when distances are invalid
MachineHelper: don't run the AMOS code path if not necessary
Partitioner: also create a file FilePartition.txt
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 9444844f58b849874cdfff93d1a8583b21d5a281
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 25 14:10:26 2012 -0400
Parameters: throw a warning when distances are invalid
The option -p takes two files and possibly an average and a
standard deviation. The average and the standard deviation, if
provided, must be integers. Otherwise, the code path falls
back on automatic detection.
Reported-by: Adrian Platts plattsa at sbcglobal.net
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit d1935ac0843faa3de49fec30e84fe82c32d88bb9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 25 13:42:25 2012 -0400
MachineHelper: don't run the AMOS code path if not necessary
It seems that by default, the Ray process 0 was reading all the
provided files regadless of if -amos was provided or not. This silly
feature was fixed.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 015fe19bcf8f54208a1503b399493702c64769b4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 25 13:26:11 2012 -0400
Partitioner: also create a file FilePartition.txt
The new file FilePartition.txt tells the end user how many entries
there are in each of its files. The file SequencePartition.txt
tells the end user how many entries are picked up by each Ray
process.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 4bcd490ac821ee3a391dc66fd414088619f072e9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Sep 20 07:46:20 2012 -0400
Documentation: added information about XML files
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 223d2a1282a1c500edf2d715c02f0450f82b0fe2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 19 17:51:11 2012 -0400
scripts: the script that pulls NCBI stuff is ready
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit afd5a953f045b82e9471a5718c2bd6977d032232
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 19 17:05:17 2012 -0400
scripts: the script that pulls NCBI data is almost ready
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 9a52772688c2030db08bc8b49dedbcfb3791de56
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 19 16:26:15 2012 -0400
Documentation: simplified the usage of the tool to pull NCBI data
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit a0e07e076eab259c3984869e5c06ef3d0ce9ab31
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 19 14:55:30 2012 -0400
Documentation: added documentation for NCBI taxonomy
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit e1d5c730445e768cea0ae37241f18900e5227333
Merge: 933d7dc a25cb5c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 19 09:42:32 2012 -0400
Merge branch 'master' of github.com:sebhtml/ray
commit a25cb5ccc6b109fe57c76bd32063ba3ff35f107c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 19 09:40:22 2012 -0400
scripts: download NCBI bacterial genomes too
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 0a6c79c3e7f8d1ef65ec86ccffed6c295ebe6cc3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 19 09:34:54 2012 -0400
scripts: initial version of a script to create NCBI taxonomy
Ray Communities can use the NCBI taxonomy to classify k-mers.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 933d7dc3e01b08c9fdd06e2561452b78b44e5ea2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 17 21:50:03 2012 -0400
NetworkTest: added average round trip latency
The average round trip latency was added to the network test. Now,
there are the mode round trip latency and the average round trip
latency in the results. Passing a message of the type
RAY_MPI_TAG_TEST_NETWORK_MESSAGE and getting a reply of the type
RAY_MPI_TAG_TEST_NETWORK_MESSAGE_REPLY is faster between processes
on the same machine. Usually, this means that the mode latency is
a little bit lower than the average latency, globally.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 972a92e3bbd53bc94dd3a9ddc3327f0d760f862d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 12 07:40:29 2012 -0400
Documentation: updated the taxonomy documentation
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 3e07cb167badf9008295f3e4ad5b01e986dea968
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 11 10:00:51 2012 -0400
Documentation: added options for a 64-rank polytope
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 6b7b54e73a54a430e10a53c94ae7db1023122f2c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 9 11:29:45 2012 -0400
NetworkTest: the number of exchange can be changed with -exchanges
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit c7602f2f11175ce7ca69af156bc2655d23d092bf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 5 22:08:17 2012 -0400
application_core: added routing with a convex regular polytope
Since a hypercube is a polytope, and that most of the time other
polytopes are better than hypercubes, I added the name 'polytope'.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit a034922ec89ce3e734b0d068c0d54dbeaec5147f
Merge: 0cdd884 5179279
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 14:46:43 2012 -0400
Merge branch 'bug-hunting'
* bug-hunting:
KmerAcademyBuilder: added the number of filtered k-mers
MessageProcessor: the thresold is 50.0 (50.0%), not 0.5
MessageProcessor: coverage depth starts at 1 with Bloom filters
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 5179279b18692386ef1a5de8ed02e05c867cab62
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 14:44:12 2012 -0400
KmerAcademyBuilder: added the number of filtered k-mers
The number of filtered k-mers is now printed once the k-mers
are sampled from the data.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 4fbaea14e3ad331f798896aa0a21bfb62d80c452
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 14:00:47 2012 -0400
MessageProcessor: the thresold is 50.0 (50.0%), not 0.5
The ratio is in percentage, so the threshold must be 50.0.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit b5213c96233f469a9086498a6a742ea077b01dd9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 13:52:10 2012 -0400
MessageProcessor: coverage depth starts at 1 with Bloom filters
When using Bloom filters, the k-mer coverage depth must start at 1.
This is because the first observation is wasted in the Bloom filter.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 0cdd88446edda13fe4e98c6674324dfd3443c34a
Merge: 290544f a5f323b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 02:03:11 2012 -0400
Merge branch 'bloom-features'
* bloom-features:
KmerAcademyBuilder: the Bloom filter can have any number of bits
MessageProcessor: added a warning when the oracle is half full
KmerAcademyBuilder: added the number of set bits in the Bloom filter
MessageProcessor: new text to show when the Bloom filter is created
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit a5f323ba25daad8bcb9ea2f9d9096fbafee340b2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 01:59:47 2012 -0400
KmerAcademyBuilder: the Bloom filter can have any number of bits
Before this patch, the number of bits in the Bloom filter had to
be a multiple of 64. This constraint was removed.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 6323f5b526f48ca2b4aa7c4a9316db143f4a9ffd
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 01:50:08 2012 -0400
MessageProcessor: added a warning when the oracle is half full
A warning is displayed when at least half the bits of the Bloom
filter oracle are set. This indicates saturation.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 5ab026c042f0b39720ef9541a2a53cd45e8519a3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 01:43:32 2012 -0400
KmerAcademyBuilder: added the number of set bits in the Bloom filter
The number of set bits in the Bloom filter is now provided. This is
useful to detect Bloom filter saturation.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 4047bb13abf82e235b12e309fe92e4c85e72de40
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 01:25:04 2012 -0400
MessageProcessor: new text to show when the Bloom filter is created
Events such as the creation and the destruction of the Bloom filter
are shown on the screen.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 290544f2628ffad344246dd36e6fdee595976f50
Merge: 2334be6 06d281d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 01:12:28 2012 -0400
Merge branch 'kill-kmer-academy'
* kill-kmer-academy:
VerticesExtractor: this module extracts vertices to add edges
KmerAcademyBuilder: removed the k-mer academy
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 06d281d99943da448091142dd0378e90d789b53c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 01:02:45 2012 -0400
VerticesExtractor: this module extracts vertices to add edges
The plugin VerticesExtractor adds the edges while extracting
vertices. Because it no longer needs to populate the vertices,
the text displayed to the end user was updated.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 4209dc6f14547e3884cad533f2e318e4c0adc545
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 3 00:41:31 2012 -0400
KmerAcademyBuilder: removed the k-mer academy
The k-mer academy is mostly useless because there is the Bloom
filter that does the same thing, but with less memory. The k-mer
academy was created before the Bloom filter. When the Bloom
filter was added, the k-mer academy remained in the code. This
patch corrects this.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 2334be64c2741e0f676ad8842c2fb208a29cdea4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 2 09:38:26 2012 -0400
Documentation: updated the author file
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit aa42e01338c205cb5eeebae883e22eca5d2125c0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 31 21:29:00 2012 -0400
BuildSystem: replaced -ansi with -std=c++98 for more verbosity
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit ae054547b88308d6bccc07e096265885bf057af2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 31 17:42:27 2012 -0400
BuildSystem: added a strip command to reduce the memory footprint
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit e671d319588f552f2fee54eab2794dd69e8d6cb6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 31 17:42:10 2012 -0400
Documentation: added information about elapsed time
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 5b75e2fc1b00fd3f5f5572cd96a7bc994637a305
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 31 17:40:42 2012 -0400
Documentation: added a document about profiling Ray
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 905722b5d565df01fbc8bf4277be0cc867d2aa21
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 29 12:02:26 2012 -0400
MessageProcessor: removed a call to a private attribute
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 228ef203b23c3cb0a1e4d38689250c9ee8c8e19b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 29 12:00:05 2012 -0400
EdgePurger: any edge is removed only if a end is not in the graph
The previous behavior was to remove an edge if one of its end had
a coverage below the accepted value. But this is already
implemented elsewhere on a per k-mer basis. Therefore, edges are
now only removed if they are invalid, regardless of the coverage.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit f4ac1e4ad673d681a51b64a8cc86a2a36f49bcf1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 29 11:57:12 2012 -0400
VerticesExtractor: store twin edges in a single source
In Ray, the k-mers are stored in pairs. These twin k-mers are
reverse-complement. A k-mer can not be its own twin because Ray
disallows odd k-mer lengths. This patch remove the duplicated
data source for twin edges. Now, the k-mer and its reverse-
complement are stored together, and its edges and the edges
of its reverse-complement are also stored together.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 4e763bb3c18cb565ab414350bf8206ecf6b77490
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 28 17:33:41 2012 -0400
MessageProcessor: don't discard k-mers while receiving messages
This patch is a fix for the regression introduced by the
recent patch dc65e18327870ad5f57bb75d7b4760e0141e6493.
The plugin KmerAcademyBuilder was modified to be clearer and to fix a bug.
The change was to send any forward k-mer, not just the lower of a pair.
However, the current plugin sends messages to another one, which was still
implementing the old behavior. The handlers
call_RAY_MPI_TAG_VERTICES_DATA and call_RAY_MPI_TAG_KMER_ACADEMY_DATA
were modified accordingly.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit f744b41ed30daf93b4644354f095ee74b017260f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 28 15:05:05 2012 -0400
VerticesExtractor: improved the code quality for easier reading
The name of the variables was improved as this plugin contains
legacy code from early Ray prototypes.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit dc65e18327870ad5f57bb75d7b4760e0141e6493
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 28 15:00:39 2012 -0400
KmerAcademyBuilder: only send the forward k-mer, not the lower
This patch has no impact on the result generated by the assembly.
Basically, each k-mer has a reverse-complement and sending both
will increase by one the coverage of both. But in the
implementation, a forward k-mer and its reverse-complement are
stored together to save memory. So, for any forward k-mer occurring
in a read (which can come from the forward strand or from the
reverse-complement strand) sending only the forward k-mer (as is)
is totally equivalent to sending the lowest k-mer between the
forward and the reverse-complement. But the code is clearer if it
sends simply just the forward instead of the lowest.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit ae1e69c093032333a2b912539dff8dd247db2c47
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 28 14:36:55 2012 -0400
VerticesExtractor: don't flush while waiting for messages
This patch does not change anything from the plugin's point of
view. However, it adds clarity because otherwise it is not clear
within the corresponding slave mode handler whether or not
flushing should occur in flushAll() if there is any pending message.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit dda2d53775b63582eb0e9907b5b8fd5841f1a5b4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 28 14:28:48 2012 -0400
MessageProcessor: k-mer data messages should never be discarded
In cases where the lexicographically-lower k-mer of a pair of
k-mers occur after the other in the sequence data and where the
collective k-mer coverage of the pair is the minimum accepted in
by the distributed storage engine, race conditions can
occur. These race conditions will produce an invalid degree
distribution where, for example, the number of vertices (k-mers)
with 1 parent and 2 children is not stricly the same than the
vertices with exactly 2 parents and 1 child while it should be the
case. Another consequence of this race condition is that
the graph will contain (u,v) in the directed edges, but not
(r(v),r(u)) where r(.) is the reverse complement of its operand.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit a812fc9de6c344df6a4b957ade60939fdc739fb5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 25 13:07:47 2012 -0400
SeedExtender: added additional information for an error
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit c10cecdc3a74bdc39d1be24843bea292ecd957e3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 24 18:54:44 2012 -0400
Searcher: large integer constants needs ULL for portability
Large integer constants need the suffix ULL, for unsigned long
long, for portability. Otherwise, the value may not fit. The code
was compiled with a TI UltraSparc IIe (Hummingbird) with gcc
(Debian 4.4.5-8) with Linux.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit c69f2b7e781ed8deb75ddbbd17b472d99135cbbc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 24 15:49:06 2012 -0400
build: the C++ standard is C++ 1998. gcc -ansi provides that
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 7703091ad958f51d5519f2e5197a51eff6648833
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 23 17:07:56 2012 -0400
SeedingData: seeds can not contain k-mers with too low coverage
The distributed de Bruijn graph may contain k-mers with a coverage
of 1 for various reasons, including false positives produced by
the Bloom filter. For this reason, k-mers with a coverage that is
below the minimum required by the policy should be discarded.
The plugin SeedExtender does that already, but it seems that
the plugin SeedingData should do it too.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit ee1186d9d3cb1a51ab7368c324106553ab759d52
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 22 21:45:58 2012 -0400
core: Ray -version provides more compile flags like popcnt and sse
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 6171892f2a2c6186196f70c6a2942c515cb63763
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 22 15:22:07 2012 -0400
documentation: added missing operands in the manual and -help page
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 47410c0b9277e2735859a5caa12958daa90fde9b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 22 15:17:23 2012 -0400
SeedingData: -use-minimum-seed-coverage changes the minimum
A new option was added to tell Ray to discard any path in the graph
whose coverage depth is lower than a given threshold.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 7fd5f7efad5c59edcbd0c73e609ada027f96181a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 22 12:06:04 2012 -0400
core: added documentation for class Parameters.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit e0f88dbecf49b52ccd6fee94dda1897572624f76
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 22 12:02:34 2012 -0400
documentation: moved assembly options up
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit a559b4047e1625a1b9138861366e2a7417c5c608
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 22 11:59:49 2012 -0400
normalized option names with -enable-* and -disable-*
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 92f29957532c3a9d00e4da086e91488c73e3b535
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 22 11:49:23 2012 -0400
scaffolder: it can be disabled with -disable-scaffolder
Also, the code was changed in the case that there are no paired
reads. Instead of skipping the whole plugin, no fetching is done,
but meta information is sent nonetheless to generate the content
of OutputNumbers.txt.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit b4288534dbe978bbf173b02475a0669c19609bc2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 21 00:57:35 2012 -0400
core: the default number of buckets is now 268435456 per rank.
The default number of bits in the Bloom filter is now 268435456.
The number of buckets can be changed with -hash-table-buckets xxx.
The number of bits in the Bloom filter can be changed with
-bloom-filter-bits yyy.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 0fd2dac374818346ee0a591c1d3fe9cc9a7b122a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Aug 19 11:27:48 2012 -0400
Documentation: documented the hypercube features of Ray.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit f27154d0f44464b208c645976f9bd70d1e648e00
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 18 06:43:35 2012 -0400
A new routing graph is available: the hypercube.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 07d481eb2057249ca9f32685be1b7750a4645c82
Merge: c6d91f8 1e6719e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 16 14:20:04 2012 -0400
Merge branch 'master' of github.com:sebhtml/ray
commit 1e6719eba3a919f32ab7132090e23e67b084df85
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 16 13:20:23 2012 -0400
A path with 0 k-mers has 0 nucleotides, not 0-k+1.
This fixes segmentation faults when using large k-mers for
assemblies.
Reported-by: Pier-Luc Plante <pier-luc.plante.1 at ulaval.ca>
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 268e21967eda5ac4c748f02fd6b11b607a308bb4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 15 14:27:53 2012 -0400
Fixed an integer overflow in the distributed storage engine.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit c6d91f8b2204fd95f0c79a488de55491c2331bca
Merge: 2bef656 268e219
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 15 14:23:54 2012 -0400
Merge branch 'master' of github.com:sebhtml/ray
commit 2bef656614ada11b8619d96dd13370b7b097f6c2
Merge: 7340772 3879d25
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 14 14:45:48 2012 -0400
Merge branch 'master' of github.com:sebhtml/ray
commit 3879d25fc089b542df8a1ec2d206c96a4f7da991
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 14 13:48:01 2012 -0400
GeneOntology: removed the use of argv
Configuration tokens should be fetched from the API common to
command line and to configuration file.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 3422d369a23a0ec8cd2dfaec36379c2abfe4571c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 14 13:47:42 2012 -0400
application_core: bugs were fixed in the configuration routines.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit ff6d8296457947b921a4eaa649cc3a8e8f929cc8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 14 09:26:51 2012 -0400
SequencesLoader: a bz2 file can contain many compressed streams.
Each of them needs to be opened, read (until BZ_STREAM_END), and
closed.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit f3e3ff1d5efcfd52aa63e3c2c0c71c21f25b4fb4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 14 09:23:02 2012 -0400
SequencesLoader: added a 'please wait' before counting entries in
a file.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 4cd2c6563e74b4a0a0c1987aca5077793e3dc5bc
Merge: 752ad1c 608b9c0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 13 15:46:57 2012 -0400
Merge branch 'master' of github.com:sebhtml/ray
commit 7340772f38dc1816c8ea0fd758ec570ff507c0d5
Merge: 404cd50 4cd2c65
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 13 15:45:59 2012 -0400
Merge branch 'master' of github.com:sebhtml/ray
commit 752ad1caa5f7900655a81f787d93ef8ea9c7e8fb
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 13 15:38:59 2012 -0400
KmerAcademyBuilder: Bloom filter has 64 M bits by default.
For E. coli K12 MG1655 (SRA001125; 34 911 784 sequences), with
k=31 and 28 MPI ranks, rank 0 has
- 2 147 132 k-mers with no Bloom filter;
- 482 568 k-mers with 64 M bits for the Bloom filter;
- 482 568 (the same) with 6.4 G bits for the Bloom filter.
The new default Bloom filter is as good as the old one, but
consumes 8 megabytes instead of 62.5 megabytes.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit e6e68bee70aaeeef08553ee41b36011183948b13
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 13 15:36:59 2012 -0400
KmerAcademyBuilder: option -bloom-filter-bits can sets the number
of bits.
A new runtime option to manually set the number of bits in the
Bloom filter was added.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 8b4e434191b170dc900a99dd5cbdea423289d902
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 13 11:15:00 2012 -0400
application_core: added a call to obtain a string configuration
token.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit b27abbe98d9a7fd04926f40921203b4522c8d2d5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 13 10:35:52 2012 -0400
NetworkTest: the number of test messages is now constant regardless
of the number of MPI ranks in the communicator.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 404cd50f092dcbf5b00ab9d522f53fe1e5915e43
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 13 10:24:27 2012 -0400
I added instructions to build Ray with link time optimization.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 608b9c0fbd0aee6af1c4aec75eb2bc0e0bded1f4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 11 22:07:05 2012 -0400
I added compilation flags for compression.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit d54427b0a9baa0d7a27a28803b13131ab6db1127
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 11 18:42:19 2012 -0400
I added -fwhole-program for better optimization.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 368d7391c893be96c3bca7340def3204dd3d28f4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 11 18:19:35 2012 -0400
The EXTRA commands are also given to the linking command.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 163eabc0620a3060647714bf7a7cf8f9c42c974a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 11 17:59:32 2012 -0400
I added a script to build Ray with link time optimization.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 9685a0d0b4e29c160a4f36741f9770f837994532
Merge: 991c42d 2765a4c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 10 12:50:01 2012 -0400
Merge branch 'master' of https://github.com/plpla/ray into pl
commit 991c42dfef64c58070d2b818e7b1ed697e3f23e6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 10 12:48:02 2012 -0400
The edge purging should be done in a massively parallel way unless
the option -write-kmers was provided.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 2765a4c6283a61d5860cd240157129a3f9861d53
Author: Pier-Luc Plante <pier-luc.plante.1 at ulaval.ca>
Date: Fri Aug 10 12:27:06 2012 -0400
Corrected the tet that determines the quality control results.
There was too much false negatives. The returned value is more
reliable now.
Signed-off-by: Pier-Luc Plante <pier-luc.plante.1 at ulaval.ca>
commit 5005de58ad7f7a5cac60e767fadec443a464e346
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 10 10:53:40 2012 -0400
The code that randomizes the arguments was removed because it can
lead to bugs. This also simplifies checkpointing.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit de27b5c57b1983196892dcbd90761e8285a33c12
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 10 10:45:06 2012 -0400
This fixes a input/output bug for the Ray configuration file.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 05f17a4b4bab63a3158a84ea584f6e9dbe9ac73e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 9 23:12:10 2012 -0400
The default number of buckets is now 1048576. The default number of
buckets per group is still 64, so that is only 16384 groups with
almost no memory usage because it is sparse.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit eb77dc7ceca911d7164e1cad06de8845bbd54da7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 17:02:30 2012 -0400
Information to compile Ray with gcc was added.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 12d7c89d6a40d00bd48c3c320587a2ca455463d6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 16:56:24 2012 -0400
If you run Ray with a configuration file (mpiexec -n 4 Ray Ray.conf)
you can start comments with the '#' symbol like in python.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 4ddb312d50472869595e4dce04b6a44dee7bb859
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 16:02:27 2012 -0400
The manual was updated to include pointers to documentation.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit f6a55eab42146ad419af3b8472752607a940ffc2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 15:58:36 2012 -0400
Removed some output from the computation of seeds.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 7eb7775132592ffed468adbb286f8a66978c52bd
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 15:52:10 2012 -0400
SeedExtender: changed the verbosity period.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 17d718521934229de310681b19cd61fb99d26bc2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 15:52:01 2012 -0400
Updating the manual.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 95ea5c01735da5ba465391567baa20cf7a051f56
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 15:08:38 2012 -0400
I removed handlers from the cmake file.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit d46428ddad00997a431f89c89eb3080c8c0ec8e2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 15:04:48 2012 -0400
Porting Ray to the new RayPlatform: Ray compiles with the simplified
RayPlatform adapters now.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit c13e1bd14cb2d67d91147fd49211221d1a4937b1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 13:59:21 2012 -0400
Porting Ray to the new RayPlatform: remove calls to setObject.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 363341330cef9573185bc873035a2dd2d2f912d8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 13:57:03 2012 -0400
Porting Ray to the new RayPlatform: removed adapter from plugin
class definitions.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 43137b4861784fc0a427ebf35c2bcf2e073dc09a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 13:52:16 2012 -0400
Porting Ray to the new RayPlatform: updated the macro names in C++
plugin files.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 31b078873c4135d81fb81cc37961a5d685614b26
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 13:48:36 2012 -0400
Porting Ray to the new RayPlatform: added CreatePlugin and BindPlugin
instructions.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 746681dc025fc572a24486433995ad1913cc3d4e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 13:38:04 2012 -0400
Porting Ray to the new RayPlatform: removed token 'generated_automatically'.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit d5285304359cacc22d23f7b5c94ab8ff836de3b4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 13:31:12 2012 -0400
Porting Ray to the new RayPlatform: removed remaining codes in .h.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 06d55912f535165a3d41492058ab2adc2d9a6d18
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 8 13:24:52 2012 -0400
Porting Ray to the new RayPlatform: removed macro calls in .h files.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit e3c59281a19fe47b6ccae81417fff9b689afb7c2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 7 18:30:48 2012 -0400
More parameters for compilation can be provided with EXTRA=...
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit fa22b73fbc2ce65dff178b52b558d9b8f0d59124
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 7 17:34:30 2012 -0400
I added some code to detect windows 32 bits and windows 64 bits.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 4ac0ff71bcd5aab5793cf086600bffc103e17b2c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 7 14:27:58 2012 -0400
Added a new option to enable genome neighbourhood calculation.
The option is -find-neighbourhoods
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit ca261b1f4382acb31b64c99d4d3b82cb5e17c146
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 7 13:52:18 2012 -0400
NetworkTest: added the option -skip-network-test to skip the network test.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 96a489a5a94f51fb8af2178be7d05e6233b1e5a3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 7 13:46:25 2012 -0400
If the hash table is verbose, ask it to display its status.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit b92ff8a3c5cbe3b5317e71e36f984ac1236ed9a1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 7 13:21:47 2012 -0400
The methods setKey() and getKey() were added to KmerCandidate
and Vertex classes for compatibility with MyHashTable.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit d3cffdf742074fa21ac3ac324946e663b2b1fbdf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 7 13:21:30 2012 -0400
The default load factor threshold was changed to 0.75.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 20edb5647759201ae6004998807e805502e0c11a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 7 10:39:12 2012 -0400
Documentation: Ray can be run with a single configuration file containing options.
mpiexec -n 99 Ray Ray.conf
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 2e53ba0d3952ef80ce45da69f06359019bc27194
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 7 10:32:07 2012 -0400
Parameters: 4 options were added to change distributed storage behavior.
Options to change the number of initial buckets, the number of buckets per group,
the load factor threshold and verbosity were added to Ray. The default load factor
threshold was changed from 90% to 60% thereby enhancing the number of
operations per second of the hash table.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit b7a839a8d0a5f3fe0fdff1d88b2eba280e8c49d4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 1 22:04:21 2012 -0400
SeedExtender: implemented hot skipping
But the code is not active as it is not complete.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 0b6bf3654947c2206b012e4f18ffde1ad32b6aed
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 1 21:28:47 2012 -0400
SeedExtender: modified the code for hot skipping
The code was changed so that hot skipping of seeds can be done
as a better alternative for extension scheduling.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 51775a1a49ff0cfb5432e68201c9be0dce870ed6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 1 16:58:43 2012 -0400
SeedExtender: moved system calls inside this plugin
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 7365e4965a9451e5f7a60f7fce7d6f5314734b71
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 25 22:54:10 2012 -0400
Searcher: added a missing value.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit ebe9210ad4c55f622762f8c5212b3a7700031015
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 25 20:38:48 2012 -0400
Searcher: fixed a race condition
Pier-Luc Plante and Sébastien Boisvert worked on this bug that
caused Ray to hang in a specific condition triggered by a race
condition.
The bug occured within one single iteration of the RayPlatform
virtual machine. A message of type
RAY_MPI_TAG_SEARCH_ELEMENTS_REPLY was first received. But it was
not consumed during the same iteration because all the files in
a directory were synced, therefore it was forever lost.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit dc516eb9590a365e23114ad064d10e69eb1d775e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 25 20:37:01 2012 -0400
Searcher: added verbose statements
The synchronization process is more verbose when counting entries in files.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit a0ac2e7d86b4170ad8025be6750c91d38f0d18c2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 25 19:42:43 2012 -0400
An assertion was added to make sure that data is not overwritten.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 815406737da962e82425936375dcb560faf80695
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 23 16:51:04 2012 -0400
I added the names 'Ray Méta', 'Ray Communities', and 'Ray Ontologies'.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 3520e5635f56aed7b0e73f4e13505fbe65648fa9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 16 21:16:31 2012 -0400
The return statement was misplaced in a recent patch.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 4ecdd828fb7e016c886b7b21340c346536929aef
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 16 15:29:32 2012 -0400
A error was fixed in the file that says how to submit changes.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit c9fd5dd70a19066efd37b2e3e6ef7b1a682a043e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 16 15:29:09 2012 -0400
The manual now includes the new option for overly-covered seeds.
commit de88a970a87125332b13143e2d6e17352f09a460
Author: Pier-Luc Plante <pier-luc.plante.1 at ulaval.ca>
Date: Mon Jul 16 14:29:25 2012 -0400
Patch Koala: Added an option (-use-maximum-seed-coverage) so that higly-covered seeds can be ignored.
commit f15baa38a52663b5c91da9cf1229efe3fbcff99e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 10 17:29:22 2012 -0400
I edited the guide to submit changes.
commit c3695743171a526220ae711292f9cea980841595
Author: Pier-Luc Plante <pier-luc.plante.1 at ulaval.ca>
Date: Tue Jul 10 17:02:45 2012 -0400
Scaffolder is not required when using unpaired reads.
commit 538550f8f2648a4b72bce949c9b69975ff76dabc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 10 10:25:03 2012 -0400
The peak finder was modified to pass new tests.
[@colosse1 unit-tests]$ bash test_peakFinder.sh > log
[@colosse1 unit-tests]$ grep PASS log|wc -l
58
[@colosse1 unit-tests]$ grep FAIL log|wc -l
0
[@colosse1 unit-tests]$ grep error log|wc -l
0
main.sh runs all tests.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit a519e0cab61ddba77d917859a8fc13a25eb9f176
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 30 16:44:15 2012 -0400
The help page was update to add the data reliability option.
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 063d86b22c88bce73a45d11b61d86293e7015399
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 29 14:58:20 2012 -0400
Two assertions were added to detect possible message corruption.
commit 9857b2e965f3b4b3ec568f11a577f3912d353aa9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 29 14:11:46 2012 -0400
An assertion was added for the performance scaled messaging related
bug.
commit f128c5beae2250b33ae9722d8e4d8d2525663158
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 26 16:25:17 2012 -0400
The codename of the next release will be "Ancient Granularity of Epochs".
commit d090bf1514635b3cc89e1644b22a97559310cc7d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 26 16:18:25 2012 -0400
A list of releases was added.
commit 174f800125491a4280516bcfe577e2292e7d07a8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 26 15:50:58 2012 -0400
When there are 508 reads and 32 MPI ranks, the number of reads
per rank is 508/32= 15. Therefore, assuming a perfect division
read number 495 would be on MPI rank 33 (495/15 = 33). This makes
Ray crash. This change set corrects this.
Reported-by: Pier-Luc Plante
commit 2a065f8850a211b7bc2e82793f4ff1da8f78ff46
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 26 13:30:27 2012 -0400
The copyright was updated to add 2012.
commit 6adeef3d814dc2acbc32444ec3ed5a49a709e98c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 22 20:58:37 2012 -0400
This is Ray v2.0.0.
commit 2243df732615cb2419e81c57a233cb1ffd214583
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 21 20:27:15 2012 -0400
Floating numbers must not be stored with the integer type 'int'.
commit 4b4815772354ea402b0ce5a9500d66eed37be8d7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 21 16:23:35 2012 -0400
This solves a division by 0.
commit d96047c2040bed3395ae36a13505608b617b3346
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 21 15:21:24 2012 -0400
This change set improves the fidelity of Ray when computing peak
coverage for short seeds (let's say that a short seed has a length
lower than 512 vertices).
This closes an old ticket.
https://github.com/sebhtml/ray/issues/47
commit 22d4ec0f29d31a659fe5c4791039dd2497264039
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 21 15:00:04 2012 -0400
The multiplicator used for spawning read helpers was changed from 2.0 to 1.5.
This should remove any assemblies and should not affect contiguity.
commit 048ba764c0424bb74f416276ef7f16cf463cc0fd
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 21 14:12:24 2012 -0400
The peak finder should detects simulated data as well.
commit 7102b16f1f282a0003f9982b42a3a744d9bffe59
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 20 14:48:20 2012 -0400
A compilation warning was removed for an integer comparison.
commit dcc738984c61a478d7da699f19dfae4e2d1ec1f2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 20 14:32:23 2012 -0400
Routing strategies were updated.
commit 91052b31051fb58561231c0cd2f3bab720184b56
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 20 11:12:34 2012 -0400
Patch information was updated.
commit 8c950405d1695c2ca691537c1eba341155c9731a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 20 09:53:36 2012 -0400
The release procedure was updated.
commit 95f458950e9856c93b2af120845899975b74851e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 14 14:33:57 2012 -0400
A new option is available to disable read recycling.
commit 459f26f59076ffabe603f0d8b7163a69e2f51837
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 14 14:10:11 2012 -0400
The options for using checkpointing features requires a
directory.
commit b9a2c2fd0e550883e2a627cdf11f2c26b49c00a2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 29 16:38:07 2012 -0400
Ray v2.0.0-rc8 has even less misassemblies (Ray v2.0.0-rc7 had so few already).
commit b617b037f176d64712d96a329fd4e481e4e96acc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri May 25 18:22:27 2012 -0400
ParallelPaths.txt contains parallel path data.
commit 7c52141ec786b26adb2eadde340bb84e4a21a973
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri May 25 17:48:33 2012 -0400
The code that put together paths was modified to avoid creating misassemblies.
Reported-by: Mitchell Stanton-Cook m.stantoncook at gmail.com
Reported-by: Maxime Déraspe maximilien1er at GMAIL.COM
commit 63e71665e79c14eef13377fe542eda5ba766d233
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed May 23 16:12:49 2012 -0400
I added an error message for unknown extensions.
commit ec56e559a5848c8842dcef19914f4ded9d1224dd
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 22 12:02:33 2012 -0400
Deprecated parameters were removed from the help page.
commit bcef79ae87c40ea1de5525ef3ff7f8089baccb5d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri May 18 11:46:24 2012 -0400
I fixed again the CMAKELIST file.
commit 7443278e3ae184e8a31203800498cedc9444123f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu May 17 10:31:13 2012 -0400
This is Ray v2.0.0-rc7.
commit c71116d28e78ef9090e791fff3c5edc5a5369247
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu May 17 01:20:58 2012 -0400
The maximum number of message tags was moved in RayPlatform.
commit 504f912ac7d8a6445c131588e3db1c2d2a1c1628
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu May 17 01:13:55 2012 -0400
These data types were added to avoid elusive bugs:
LargeIndex LargeCount PathHandle ReadHandle MessageUnit.
commit 40b9641303c7c71c91a3b636c820568b78e22549
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed May 16 17:54:11 2012 -0400
A elusive bug that caused runtime problems was finally solved.
The problem occured when a k-mer with coverage 65536 or 65537
was part of a seed. The new declaration of the culprit is
CoverageDepth VertexMessenger::getCoverageValue.
commit 30ee3e7b5fd8881c82a4cc2092070c55eab8303c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed May 16 11:20:47 2012 -0400
I added more information to zero in on the bug.
commit 2688f0d6eace4e62dbf1c91bac6262fbef09b8fc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 15 21:26:23 2012 -0400
The code was polished and more information was added
when the strange error occurs.
commit 4eece0070527253dceef97fec11a28315af92470
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 15 16:24:21 2012 -0400
I added more details to an obscure error message in Ray.
commit c1f25c566561fedd6e391266a83ee922d8d5ccad
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 15 16:06:30 2012 -0400
A bug concerning the file name for -write-kmers was fixed.
commit 4c11abf6fa7485a5fbc9bed5855c4972f0c2fbb9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 15 14:23:09 2012 -0400
A new XSL sheet was created to obtain the assembled proportions
for genomes.
commit 5ce6a7b442ec08d8f4f05667dc2291648fe64273
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon May 14 17:14:10 2012 -0400
I added the percentage of assembled k-mers for each
genome of interest.
commit 88668dd526739f332718ae862c2362075bce85e0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon May 14 16:17:17 2012 -0400
A critical bug was fixed in the gene ontology plugin.
The bug caused proportions to be wrong because the
synchronization was not occuring before writing files
commit ae054e3944bbb731c7735fcde3bb5fdfc9502be9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed May 9 22:37:36 2012 -0400
This change set fixes a bug introduced in the commit 19c1838382cda4bcc19dffcdc25745a076ffc38a.
This bug caused some contigs to be wrongly duplicated in the assembly.
The bug was introduced on Sat Apr 21 23:22:21 2012 -0400.
To solve it, the code path introduced is now disabled, but its effect remains
because of the reduced number of cycles.
Paul H Roy and Maxime Déraspe reported this bug.
commit 51ab01a8005ea7c8a47554d98f9fb52a0344392e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed May 9 10:34:54 2012 -0400
I removed the superfluous branding.
commit 6dae9cc4fd20e7ea48420e6ef9618d085c3051ce
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 8 19:10:33 2012 -0400
I added the brandname to profile files.
commit 8253bd76c141b3c9665302627be43e1fcc2a3656
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 8 15:01:26 2012 -0400
The number of dereferenced handles was added.
commit 0979439a31ef6a8c558c84ce3a6acc3ca1484471
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 8 14:44:07 2012 -0400
Profile files are also produced with -search option.
commit af47f746036539e45d5497258086dfdd1f551aef
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 8 14:00:39 2012 -0400
Some code was added to derefence alternate identifiers for gene ontology analysis.
Also, profile files are generated for gene ontology too.
commit 99e893a62b5de3a9085b457ed0b86bb24d268547
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 8 11:43:54 2012 -0400
Profile files for taxonomy are automatically generated.
commit dab0b3a6448b6d2f0a13efe838cf235a633c39b8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 8 10:58:07 2012 -0400
K-mer observations are not required to be assembled
to be used.
commit 30b79bcb7c6244135cb616f1f93773a37d674c21
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon May 7 14:01:59 2012 -0400
I fixed a bug occuring when -gene-ontology Operand1 Operand2
was not at the end.
commit 4dd51d103425c922739d4b523ccf55b529988ac6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri May 4 20:53:39 2012 -0400
A bug was fixed for the synchronization of counts. The master rank does not need to send
anything to itself.
commit 6a4ca25a36e5131fbabecbb9ae503fe086387930
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri May 4 20:53:06 2012 -0400
The total number of observations used for computing g ne ontology proportion
considers only a single namespace.
commit 2b9332a5bbbe539b058c8bb3db0724e1b5d2fe37
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri May 4 15:41:22 2012 -0400
Gene ontology information is extracted for each domain.
commit dc19ce1e0567740bb26b4bbc96b1d7a694d681ba
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu May 3 17:01:49 2012 -0400
Domains are loaded from gene ontology, and depths are computed too.
commit 2f4a2c00d7a078a8b21df9661ebc51f7eab3be17
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 3 07:52:09 2012 -0400
I created a XSL sheet to convert the gene ontology Terms.xml file
to TSV.
commit 75b25dc5f87613751c4034e36fd7de0e5e8b0988
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 3 07:51:43 2012 -0400
Proportions are now available automatically in the
gene ontology TSV file too.
commit 6ffc940fd780f9470f691c0198385c4a868be7b9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed May 2 23:32:32 2012 -0400
The paths to the root are written to the XML file too.
commit 55756df01ca54f9c2c7318326328a25cd009a015
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed May 2 17:31:58 2012 -0400
Relationships are now loaded from the gene ontology file.
commit 3a495ce74feeb80a5fc80445ee8543e5126d7a3d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed May 2 17:03:23 2012 -0400
I updated the formula for computing proportions of DNA sequences.
commit 919f09524a01c19f6fe71bc3133f38b5852710ec
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed May 2 16:45:50 2012 -0400
I fixed a division by zero.
commit a4df09107ac114783d39e16d33fa2d6dc92f162f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed May 2 16:38:09 2012 -0400
I added proportions for gene ontology terms.
commit d8e85540b3975d60fbb96de31a760ab500a3d411
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed May 2 16:09:58 2012 -0400
Any k-mer should only be counted at most once for each gene
ontology term.
commit 2b5319ade9f212eeebef1d70771a5f6e350f45bd
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 20:04:41 2012 -0400
This patch fixes a bug that makes Ray hangs.
commit 2045ab1fa65297024ff65f477fa9bff93782f153
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 16:09:05 2012 -0400
I forgot to update the manual.
commit 2039f50ad27cfc7211c7efe87df90d28f9a3d988
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 15:54:17 2012 -0400
This is Ray version v2.0.0-rc6 (release candidate 6).
The code name for v2.0.0 is "Dark Astrocyte of Knowledge".
Some issues with file system input/output operations were fixed.
The release v2.0.0 should be shipped shortly.
commit 1e6ff4c6ac65e7500c7d15fb8d1337f103f9c3a8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 15:30:42 2012 -0400
The CMakeLists.txt file was updated.
commit 3f94610b6599f5f55743f4184bfa904cf7be5817
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 15:30:23 2012 -0400
I fixed a linking error when ASSERT is not provided.
commit 06f735e92504ae81dd235a8d58c16d66e55fc446
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 15:23:15 2012 -0400
Old declarations and implementations of adapters were removed from the tree.
commit efbe7215a9f3f714ae939325c8a5ab8a62c0216d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 15:02:11 2012 -0400
Plugins interact indirectly with the compute core using adapters, which
are a design pattern. These adapters are now created automatically
using macro commands provided by RayPlatform.
commit 96ddc3bb0f9a1bb5e5e384c1c156b1a9233eb4db
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 14:49:12 2012 -0400
Callback methods are public by convention.
commit 99dbebc91bf04bf26d24830ee3063b05177b2dcf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 14:43:48 2012 -0400
A missing header was added.
commit 7457c1e9cb02241fc1052b5bd8d8f297e31f8fd4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 14:37:36 2012 -0400
The switchman handle should not be in the plugin MessageProcessor.
commit 4fa04f114ad93724499030338a3d9fe5dc955c76
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 14:11:23 2012 -0400
A missing header was added.
commit 150e09bdf27777ef5249a04b6d6588c961b35529
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 13:36:52 2012 -0400
Gene ontology profiles are now generated in a compact format too.
commit 64ab206e015c03f550a175a40578854021382baf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 13:13:52 2012 -0400
Ray now produces gene ontology profiling.
commit 455566fa2f3342c791ded6670fe187cb23b8c04a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue May 1 13:13:26 2012 -0400
The documentation of Ray was updated to include gene ontology profiling.
commit 17895e5e853c96fd451113c8dada7646ed15b390
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 30 17:36:33 2012 -0400
Ontology terms are counted and synchronized.
commit a9200a50fd63a2ce85319e0aad1ad8cfe315c6a8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 30 15:02:38 2012 -0400
A compilation warning was fixed regarding a comparison between two
integers.
commit 32e2adf70b8f29d535a89dbe9cca6b081903efc6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 30 14:55:55 2012 -0400
I ported the plugin GeneOntology to the new macro commands.
commit 0dca45c368a31d9f67c5fd24a6c8e691926d05ad
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 30 13:56:24 2012 -0400
Biological signal for ontology terms are extracted from
the de Bruijn graph.
commit 54a39c6fec4049cc80c39d27b5d62adc7185da70
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 30 11:59:04 2012 -0400
The code path should continue as usual for de novo assemblies.
commit dc6a063e88f24865a4af12ea46778ed2709cd251
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 27 17:45:35 2012 -0400
Gene ontology annotations are loaded by Ray.
commit 56a8e4d989b1f59a4edadd12ab10ba6af5f33399
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 27 16:47:20 2012 -0400
The period for reporting to the user the progression of loading sequences
was changed.
commit f491c683e4b950b0e674d0f446211a6de4371cee
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 27 16:41:28 2012 -0400
Two bugs were fixed. Hangs could be encountered depending on
the mood of the compiler.
commit cf7c753b2307f3e924b5701132311c11885a94b1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 27 16:38:24 2012 -0400
Ray now counts colors related to EMBL_CDS objects.
commit 53495ad591bf0c9ac665595d5a1feef979767411
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 27 16:08:41 2012 -0400
A variable shadowing caused a compilation error on OS X using openmpicxx.
This was reported by Adam Caldwell. This is fixed now.
commit 0c54728f9459888758bc0d69f333ceb50ab4a259
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 27 12:09:37 2012 -0400
4 compilation warnings were weeded out.
commit e91bfa61c482eccf89d63c5764a38285c3e6c9be
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 27 11:50:50 2012 -0400
The CorePlugin GenomeNeighbourhood is reinstated, but it is still disabled.
commit 91b484367093bfbbb579dacff9f803465c5c3ce4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 27 11:38:16 2012 -0400
The backbone for a GeneOntology CorePlugin is ready.
commit a8110bf4a4c7261b00ffd95dcd1a78965b5fda3d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 27 11:09:30 2012 -0400
Support was added for a EMBL_CDS namespace.
commit a004fd7e3e9bd7d4003d4278e6e74a338263ffdb
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Apr 25 12:02:28 2012 -0400
I added the Number of k-mers in the distributed de Bruijn graph.
commit 19c1838382cda4bcc19dffcdc25745a076ffc38a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Apr 21 23:22:21 2012 -0400
This is an experimental patch to accelerate one of the slowest computational
steps of Ray. Basically, the patch tells Ray instances that completed
previously to not try to do anything else after completion.
commit 43ee45300966e39fefbe9b2f81d7e2e60bcb395f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 20 19:56:50 2012 -0400
I disabled the plugin for neighbourhoods since it is buggy.
commit 593758b7b7880ecd1637eb7398a684eafb0fb4fc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 20 09:30:04 2012 -0400
I added <totalColoredKmerObservations> and <totalColoredKmers> to XML objects.
commit fbd811927761ed9dad95593486c7586ec681f227
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Apr 19 14:16:40 2012 -0400
I increased the sensitivity of the method while not changing the specificity (which is very high).
commit a9756b26054b4e3388447643e19b3f8cc049f8da
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Apr 19 13:52:37 2012 -0400
Total counts for parts of the distributed graph are shared correctly.
commit c2f150aafbe2a4d3a507b593479fd63f861b89b6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Apr 19 10:37:44 2012 -0400
I fixed a integer overflow in the profiler.
commit fbd01da5fd51451c09c454e3e2c9309373126d36
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 19 09:55:20 2012 -0400
I created another XSL sheet for sequence abundances.
commit 7dd116fa565e9c933e28618929a8c7a4ed8d7efb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 19 08:36:42 2012 -0400
I added a guide for message routing.
commit f6795482c0332c0c0bee3081bdb261e0819dff02
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 18 21:00:48 2012 -0400
The neighbourhood file is generated with buffering.
commit 5348165e9a00d9d8c366cd7a23a1f7cdc2ecddb4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Apr 18 11:24:27 2012 -0400
The buffering code was optimized.
commit b60c8e96b8d894aec40b89dd26b671be7da8ff67
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Apr 18 10:33:42 2012 -0400
A integer overflow was fixed in the scaffolder.
commit ca5004b3aa3969f57599a3e96dc98bf2b30aad71
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Apr 18 10:32:16 2012 -0400
Progression indicators were added for scaffolding.
commit a997244ac66d4251c9fe7c6723c870901c74a077
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 17 20:20:35 2012 -0400
I added a XSL sheet to fetch proportions.
commit 31775b31e3d05f1698c1025326ea8b35b7efa152
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Apr 17 14:05:02 2012 -0400
The total number of colored k-mers and k-mer observations are now computed too.
commit 13ff64ec02a963816287670af96886adcf5176cc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Apr 17 13:15:50 2012 -0400
A progression indicator was added for the network test.
commit 0a6d4609e18dcb72289671905b2a7d0f123a074a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Apr 17 13:10:38 2012 -0400
The number of assembled k-mers was added.
commit 5323b54b1a86f2b2fc14c7dfd7ea6994d8a90cc6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Apr 17 10:38:24 2012 -0400
Memory usage will be reported during the joining of paths.
commit b28bad4a7cdbde013bb6282e7e814680cf2c951f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 16 17:13:19 2012 -0400
I changed CONFIG_FILE_IO_BUFFER_SIZE to 16 MB.
commit 4978a3f57deaab1e6d9290f787fc5c8c23483f56
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 16 10:32:55 2012 -0400
Scaffold lengths and scaffold components are written to disk with buffering.
commit 3cec107075ade083bbb5b1e50d701626a3ae4428
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 16 10:20:39 2012 -0400
Scaffold links are written to disk with buffering.
commit c00e01d0b91d6d45d8d7cf7687425dfda71db1d1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 16 10:01:19 2012 -0400
Scaffolds.fasta is now written with buffering in mind.
commit ec152b1dc42912101d2087c8a56325313b3bc5b5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 16 09:50:12 2012 -0400
Contigs.fasta is written using buffering.
commit 397ffe08415dd6def0c47833579dc08065de0704
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 16 09:43:16 2012 -0400
Contig lengths are written to disk using buffering.
commit 26403e3072acab0ac21b58f5e5f8c1c1ec878ada
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 16 09:30:37 2012 -0400
File intput/output operations for taxons are buffered.
commit d5c6b35f7850d5c8426f8bd5f17bd3dfe264e3a5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 16 09:12:42 2012 -0400
File system operations are buffered for colored coverage distributions.
commit 1cb0ed700376ac54a60a5e5d55679d052bf5fd53
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 16 09:12:19 2012 -0400
The buffer size for input/output operations on the file system is 32 MB.
commit 89cae09a69421aab7c88e9e3e19487e7388737c3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 13 20:32:31 2012 -0400
More documentation was added.
commit b949513d81cb6280ee5cdc924b584e96fe573011
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 13 16:33:21 2012 -0400
I added a comment for getWriter()
commit d8da8893b0b8776475482ace07fb63c73e762c2b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 13 15:37:01 2012 -0400
The input/output operations for contig identifications are grouped
for better performance.
commit d331115bf029d3f20488466c0b7fc442395546af
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Apr 13 14:42:39 2012 -0400
The sequence abundance XML files are now written with buffered input/output
operations.
commit 32402fff119db8751af041bc878e92abb46e40d0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Apr 12 17:43:23 2012 -0400
The XML files for contig coverage are generated with a few input/output operations.
commit 59c547d7ad3bf267a09069374c4cf4570e33da1e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Apr 12 17:09:16 2012 -0400
Using append mode makes operations faster.
commit 79c3fdacff3768f0f48f695a9af2d2f70534f09f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Apr 12 17:04:50 2012 -0400
Input/output file operations are faster in "append" mode than in normal mode.
One of the reasons is that one can not use fseek in "append" mode. Calls to
fseek are ignored in "append" mode.
Thanks to Jean-François Le Fillâtre from the CLUMEQ.
commit 57b73440714cd8a1671ee486e299fe2e09f1a5bc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 2 15:49:42 2012 -0400
The manual page was updated.
commit 5970b23c4b8cb1c8ab0dbfe379c188e1c9cb9f87
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Apr 2 15:25:26 2012 -0400
The new option -one-color-per-file will force Ray to use one color per file.
commit 6fba705b870997f057f544cb69ac3f219c65c790
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Mar 29 11:57:27 2012 -0400
GC content can be useful when plotting contig coverage depths.
commit 20991d4a3013fd1e79980206c4992f84863e0460
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Mar 29 11:45:53 2012 -0400
The CMake file was updated.
commit 46725307884dcef6955fa3c4ca23f9effbbffc40
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 28 16:14:18 2012 -0400
This is Ray release candidate 5.
commit 6be91a36ced1f303bd796ddd9513189bdd48e011
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 22 17:24:30 2012 -0400
New XSL sheets are necessary to convert taxonomic profiling XML files.
commit ab5262377b3ccd04a3d3f16c87985fd1202b5ae2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Mar 22 14:03:26 2012 -0400
Position is strand-specific.
commit 57f18c5583149d451404b5cd39b7525cd5d17763
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Mar 22 12:10:45 2012 -0400
A new output file called NeighbourhoodRelations.txt is created.
commit d0cca3507cd4b442d7c7be98e331d37a56b7d78c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Mar 21 21:47:58 2012 -0400
The final list for neighbours is agglomerated on master.
commit 2021a225b7543d58965c84a8a4cdb8a15cfb02e8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Mar 21 17:20:31 2012 -0400
Right neighbours are communicated too.
commit 33f2dc23af8e1ae7fe6fa2f9c702cc8f8ed45a3e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Mar 21 17:11:29 2012 -0400
Left neighbours are communicated to master.
commit 735fba5ddaa203037d67733c9ac52dfcf99d35f6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Mar 21 16:02:49 2012 -0400
The exploration stops locally when something gets in the way.
commit 654e79af785240e49c63416b9cd6ec550490317d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Mar 21 15:44:41 2012 -0400
Nearby paths are detected automatically.
commit b5315bafe80a21dc4ebcb2049a3c2d2dd98ee43c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Mar 21 08:52:29 2012 -0400
The code that gets neighbourhoods is almost operational.
commit 648bc664a19a980edbed9c64fd44adc538f8f418
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 20 19:45:32 2012 -0400
Paths are fetched with message passing to get neighbourhoods.
commit 128995e321ce902eb9b19d8c75e9b0fef26565ee
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 20 17:05:50 2012 -0400
Detailed information is not required in the standard output.
commit c213717a5ae579bc13e610d635b1c29b2b5e359c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 20 17:05:17 2012 -0400
Fetching the number of paths is a good step for implementing neighbourhood discovery.
commit 0b3da7593703cfc9532b58ea408a429a95eeceb2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 20 16:40:48 2012 -0400
Exploration of the graph highlights path relationships.
commit 23f4d2653f1d7b911ae50c2e5b7428a84b92962d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 20 15:00:42 2012 -0400
The CMakeList.txt file is now correct.
commit 49606ff12def8f35564daf9e057ace315e0b94c0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 20 14:48:06 2012 -0400
The design for computation of neighbourhoods is written.
commit 9546ae9d31b7cbef2e73988284c2cdfd60800f15
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 20 14:04:39 2012 -0400
The plugin GenomeNeighbourhood is not linked with the rest.
commit f1941c02dd00b417ba80ecfe0ad34c726b345f9e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 20 12:29:13 2012 -0400
The plugin GenomeNeighbourhood (compatible with RayPlatform) produces
a sophisticated bird's-eye view of a sample's DNA.
commit a2332af4cafc7173a4fe811acf9a6ad418d08988
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 16 21:52:50 2012 -0400
Two new XSL sheets can fetch the most abundant phylum and family taxons.
commit ea5ac5658b4d8ff1fad02a5da76ebb744a000a5f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Mar 14 11:07:17 2012 -0400
The code that fetches the base name of a virtual file system path is buggy.
This bug was reported by Habib Rijzaani.
commit 329eec332db8dda641301e994bd77438ba19938d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 12 15:04:40 2012 -0400
Sorted entries are easied to read.
commit 824c8db9b3db82bfe81cb5ab8bba927899b09963
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Mar 12 13:50:46 2012 -0400
The estimated genome length is not very accurate sometimes.
commit 252dfcfdfb63f43dd4036d6160550db7f2e2ce5b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 11 18:59:53 2012 -0400
Only the printed position should be 1-based.
commit 14096a2c57028955d7d346572188f86e99ee1bfa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 10 10:36:02 2012 -0500
1-based positions are easier to understand with a proper file header.
commit f4d88c950b345e10cc30eddd8ee816b7a0c2af8a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Mar 9 20:52:39 2012 -0500
Paths should not be tested in production settings.
commit 8a1333843de01e68266c2e8f8b2dda359d15beb7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Mar 9 20:50:31 2012 -0500
More details are required for not-a-tree errors.
commit 793819185817731020270666f7cdabe1b7808651
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Mar 9 20:48:53 2012 -0500
<MPIrank>.CoverageData.xml contains contig coverage values.
commit 8eebac0e345476d287bad3732195a890fb255bd5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Mar 9 15:59:01 2012 -0500
Reading reference frequencies and color frequency is useful.
commit cfc9a997bbb54961fd05b2fc9654e38352239f23
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Mar 9 15:43:11 2012 -0500
The colored proportions should be constrained to a given rank for better
taxonomic profiling.
commit 4c5869382db8bbe59843bec0bfeb639fbb0ff468
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 9 10:26:13 2012 -0500
A taxon not being in the tree should not be fatal.
commit 1e2c9aeececd2bef2da882da4f102c15d3f4a4c1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 8 12:59:37 2012 -0500
Entries are now sorted in the taxon tables.
commit 547217a6a2ffdcbae52c26d8db26b34aa4ac8233
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Mar 8 13:00:25 2012 -0500
The sequence names can not contain special characters reserved for XML.
commit 0ce437e8c99d7a3514987b635e956db3c22d4c11
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Mar 7 15:45:06 2012 -0500
A blueprint for l-mers was authored.
commit a9d38f8aeea67869879a1ac98beafcc1b41d10d0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 6 14:06:49 2012 -0500
Two new XSL sheets were created to generate visually appealing tables.
commit 23a4ba625cb4681660efc53f92ed0cc08751ca60
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 6 14:06:00 2012 -0500
Only 1 XML file is necessary for each search directory. The transformation is done by XSLT.
commit d5da4b2c9fe9aba66f335141e79caa2c4bec9e2c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 6 00:43:24 2012 -0500
All taxons with a non-null recursive count are reported.
commit 920c376bf2ed572e90526b8cff45f97764681f51
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Mar 6 00:25:29 2012 -0500
Recursive counts are now computed too.
commit e17e4975b031622e30a92a90d0f7b16f9faeed8c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 3 19:48:06 2012 -0500
The <coloredProportion> node was added for unknown stuff.
commit cd82e5c4df0d8e75969483f43a0ed5d87f350cfe
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 3 19:47:46 2012 -0500
I fixed the XSL sheet.
commit 001e3ab07c16d1942513e678bfed223e7c403ce5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Mar 2 10:30:12 2012 -0500
A new chunk that prints a warning if a taxon has no parent was added.
commit c4d41a57ae906c1843f85101cec5e5ece248fdc1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Mar 2 10:07:35 2012 -0500
The list of pairs from Genome-to-Taxon should not be printed with warnings.
commit 07f74ad300d60d1a61a0c679c38c976360cc0b2b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Mar 1 22:35:32 2012 -0500
Ray now issues a warning (and an error) is the taxonomic tree contains loops.
commit fa122655057d1f405bc2354a7362839bd3951e98
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Mar 1 17:00:01 2012 -0500
The XML files with distributions now contain directly the directory and file names.
commit fa1b99d0fc97f0fc73b20193a18cd453d42324a4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Mar 1 12:04:35 2012 -0500
I added a colored ratio for taxonomy outputs to consider only conserved sequences.
commit 7098a9ef624bd3a32b0b0a6e8b08d1a1e3385ac4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Feb 29 15:03:49 2012 -0500
The format of Taxons.txt was updated to include the taxonomic rank too.
commit fda1888527a1671b0d9b25bddd3e603c42778e14
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 28 22:12:31 2012 -0500
I added file names too.
commit 46302ebf8d2e50101192eb9e9f86b4c966f1bdee
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 28 22:07:12 2012 -0500
The XSL sheets were updated.
commit 2b8df2120ea0e03ddbb4ca5d8d8db6ff5062a615
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 28 22:06:40 2012 -0500
Biological abundances are now produced in XML.
commit 72976f0f522799bf0c9b5b3e77aae81ee8cd716e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 28 21:05:38 2012 -0500
The sample name was added in _Phylogeny/Taxons.xml.
commit ab5ad6eaaa89be4048868cff567e0f42c392fcd5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 28 20:49:37 2012 -0500
The symbols '<' and '>' are not directly allowed in XML files.
commit 83bb4e0f169cc1dbff7cab2a9a0836a96dc9f56e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 28 20:35:35 2012 -0500
I added a simple test to filter out some false positives.
commit 6e1f59453d97b0dc1dd5a479fbc13b70249badc1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 28 17:53:40 2012 -0500
The code contributed by Éric Normandeau is broken and does not work.
I restored the old code.
commit 16fb25702ba260cd505a58418b3c6ced5a0011c3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 28 12:00:49 2012 -0500
I edited the solutions section.
commit a5072e5781f4d66d52c06d0f05700571aca8003d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 27 11:56:10 2012 -0500
A XSL sheet was added for Taxons.xml.
commit 1f14b8d54a05c7accc5c7045ab629ea033fa3e21
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 26 19:04:49 2012 -0500
Discovered k-mers in the graph should be sufficient to cover a search entry.
commit 9ad8cc1938b9af170b8387846463090de9a3dff3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 26 19:04:29 2012 -0500
I fixed 3 compilation warnings.
commit bf0d6b4a7dd9d069f5509b9702f674229a0827fb
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Feb 26 18:35:28 2012 -0500
The code that computes the total number of k-mer observations has been fixed.
commit 50125fc837cf851e93e41116bd045aedc4c3fad1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Feb 26 17:42:55 2012 -0500
The number of colored k-mers is reported in _DeNovoAssembly for each contig.
commit 3a39376af5745625fe709c05f34a5f87385c5f0e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Feb 26 16:26:12 2012 -0500
call_RAY_MASTER_MODE_COUNT_SEARCH_ELEMENTS is now the entry point of plugin_Searcher.
commit 85441a8521e6cc09267ed1fd6d6f01e61449fc12
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Feb 26 15:39:29 2012 -0500
Ray writes SequenceAbundancesRaw.tsv too.
commit bf47449fae5646312e144c834e45f846780c5026
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Feb 26 14:39:19 2012 -0500
Taxon observations are now reported along with a proportion and in XML.
commit 0f8ca671b724f2953cc4cd64070ef33ab9da49af
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Feb 25 07:30:57 2012 -0500
The number of responses initially has to be m_size, not 0.
commit 10bb891e05a9eca4923c1d60f30ee34abc13099c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 23:44:33 2012 -0500
I updated the manual.
commit 6e179829bb0e36ac2aad84c20427e98d89a81ebc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 23:15:36 2012 -0500
Taxon hits are written in a file.
commit 700609ec4917198a3be90eaf2db506d6624f5348
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 22:57:38 2012 -0500
Taxon observations are synced with master.
commit 025394cda4a2d8e7c58202c2fdf8c239d8feaa77
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 22:10:20 2012 -0500
Only consider assembled k-mers for unknown observations.
commit a1f9671864d5f8ee1b6390db3de95b8da5a178ca
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 21:56:50 2012 -0500
K-mer observations are placed in the tree of life.
commit c6b2dbd2ca12f20646b3586028b02f9e516d140e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 19:04:01 2012 -0500
Ray now loads taxon names too.
commit 74fd217d7ae074d23a1f12d50a57e405a793afd9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 18:19:16 2012 -0500
The phylogenetic tree is now loaded properly.
commit 7ff0970e5b1975d55cb4123dc10dae705c1cdd4e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 17:23:16 2012 -0500
Added some code for syncing taxons across the tribe.
commit 5c81439d9108d3fefe3e73ff46623d027468c82f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 15:25:02 2012 -0500
Taxon are now fetched using the phylogeny colors.
commit 598e646b69712c19071ffccb1d8dfafcb993643b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 13:47:44 2012 -0500
Physical colors for the phylogeny are fetched from the graph.
commit c121d1823778041e1dfb392e80fa8d89725bbeb8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 13:08:05 2012 -0500
Proportions are automatically calculated from now on.
commit 3a7908a2865cb6eab1cb179d267a91702344bee5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 12:02:23 2012 -0500
The PhylogenyViewer core plugin is now wired.
commit c71d7c6c00be45fb232f7d3e154c4e18b43a0a06
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 11:18:54 2012 -0500
Phylogeny colors are forwarded to call_RAY_MPI_TAG_ADD_KMER_COLOR().
commit a7d5ca794c92f4592a82b1991c76473cdd1397d7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Feb 24 10:55:59 2012 -0500
Added a new plugin for phylogeny analyses.
commit ce97ad69fce4bd06c14f5db3a5601a71e7306ccc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Feb 22 12:42:58 2012 -0500
I modified the peak caller to pass new tests.
commit a055c64eb61282e027d4eee5943e3da8aefcdc2a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Feb 22 11:26:54 2012 -0500
This commit finally fixes a very critical bug that happens once in a while.
This bug is critical and v1.7 is affected. It causes strange behaviors
usually leading to segmentation faults or Ray errors.
In fact, the bug appears randomly and only on certain versions of the tool chain
and only on particular super-computers (see the diff).
The bug happened because forceFlush() can not be called if there
are active workers ready to do some work.
Here, forceFlush() was called without checking if there were any
active workers.
Checking for active workers before calling forceFlush fixes
the problem.
This is already fixed upstream
in RayPlatform and all use cases where the VirtualProcessor is utilised
should be ported to the TaskCreator interface to weed out these bugs.
commit 327ecb64307f12c5f09652a8751f51c6a9e580af
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 21 16:40:10 2012 -0500
A bug was fixed for call_RAY_MPI_TAG_REQUEST_VERTEX_READS().
commit 8bb2d17a511ccfeb09d11bd637a929a14e77be87
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 21 15:51:38 2012 -0500
Modified the colored peak finder to pass tests.
commit ad67e91e66cd4c176d15dcdb9807ac55e576decd
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 21 14:58:34 2012 -0500
The test suite has moved to a different project.
commit 87108c80b256ee6a9a06c0b0d203e214dafd99e4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 21 14:45:54 2012 -0500
ColoredPeakCaller is now utilised to weed out false positives.
commit f8dc6c8c3786a2dda541cf194b399c8afbba30c0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 21 13:56:14 2012 -0500
I reduced the complexity of QualityCaller.
commit 395353c3aba094bf6c805cfc79b8ceb33d3dafe1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 21 13:54:15 2012 -0500
K-mers with a coverage < 2 are not valid.
commit 4059c327e91ee1b966a2e8edce698e4bf87449f8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 21 11:05:05 2012 -0500
I removed outdated scores.
commit 0f8269b1e1973b7f64c9759e34a9e175cad663d4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 21 09:58:15 2012 -0500
Observations are 0 if some quality values are 0.
commit 1d6fb1fb8261413c29c0c0b9759c408c58f78215
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 21 09:52:09 2012 -0500
Files containing virtual colors are just too large to be written.
commit 7e11853bc3ec936fd0982abe7460156c7ff229f4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 21 09:47:38 2012 -0500
A file containing directories is now created.
commit 2f370607bfe48d6bc611165d5862b4569393e224
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 21 09:33:59 2012 -0500
I added pack_pointer and unpack_pointer functions.
commit 44e59ae4bc1eee8b2f4d96a790b4fd5a86ee7b16
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 21:52:20 2012 -0500
I modified another part that may cause segmentation faults.
commit 51214fdd12ad0593106db62262328a3a5c7f88b4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 21:30:54 2012 -0500
I added placeholders to transmit pointers.
commit 6d9b990375bff09e2474c4b9541eb1aac9214953
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 21:20:53 2012 -0500
PeakFinder now supports simulated data too.
commit a548a119cdd95986a441a9037d982a4d5d5d06d4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 18:12:36 2012 -0500
I fixed the quality values.
commit 5c498106809485af546bf095fc7c5bfc62fbb3a7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 17:29:15 2012 -0500
Ray now generates a file per directory containing sequence counts.
commit 44dad30b904c46aa5a427f027ae85e408a728baf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 17:13:50 2012 -0500
Ray now writes all coloring distributions in XML.
commit cc570ba15539114663bacd0b4346e6645b019200
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 15:49:39 2012 -0500
I modified the instructions to require signed-off patches.
commit b68f2825514ad75911138776802e596af7f3195b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 15:48:55 2012 -0500
The new directory _Coloring contains a coloring summary.
commit 95b7537881e891c3a0e8c0fff571eb24d87c8fcc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 15:28:54 2012 -0500
Sequence abundances are now written in a single file per
search directory.
commit 314f6b2f87feab08a4182620bcaf0e92c4cb2203
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 11:42:21 2012 -0500
Writing files can not be distributed yet because only rank 0 has some of
the required bits.
commit d3b51ee72d511fdbc3f1f4400642302c7fa33f36
Merge: b827575 49855ad
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 10:47:25 2012 -0500
Merge branch 'master' of git://github.com/enormandeau/ray
commit b8275750e53c76fc0175058734d2215c0823eb13
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 10:46:40 2012 -0500
I added some documentation for people who want to submit changes.
commit eabf4c72c192c617a96177e571589850fee04d4e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Feb 20 10:46:08 2012 -0500
The callback call_RAY_MPI_TAG_SEARCHER_CLOSE() was added.
commit 49855ad98adf4fdabfe6fb8a304d64b8caa48ee8
Author: Eric Normandeau - Bioinformatics <eric.normandeau.qc at gmail.com>
Date: Sun Feb 19 16:00:53 2012 -0500
Updated script
commit 75b06c5f5716eb030d78ce2c8f0df1f8d670c8b6
Author: Eric Normandeau - Bioinformatics <eric.normandeau.qc at gmail.com>
Date: Sun Feb 19 15:49:10 2012 -0500
Updated script
commit d1a1b1d8de3ccc23f5e283e119ed0d1f70727288
Author: Eric Normandeau - Bioinformatics <eric.normandeau.qc at gmail.com>
Date: Sun Feb 19 15:48:10 2012 -0500
Updated script
commit 21cb9ef1593bc2b210084b4f08984a04ec871241
Author: Eric Normandeau - Bioinformatics <eric.normandeau.qc at gmail.com>
Date: Sun Feb 19 15:39:46 2012 -0500
Updated script
commit 1b8e19ad36b7bdb47197aff870610d2fd2dadd80
Author: Eric Normandeau - Bioinformatics <eric.normandeau.qc at gmail.com>
Date: Sun Feb 19 15:27:36 2012 -0500
Updated script
commit f7389d7df90069b910eccea7c2629fe42cb65f3a
Author: Eric Normandeau - Bioinformatics <eric.normandeau.qc at gmail.com>
Date: Sun Feb 19 15:20:26 2012 -0500
Updated script
commit da9272baf0705bc9125f9031d612179bcf3b3d60
Author: Eric Normandeau - Bioinformatics <eric.normandeau.qc at gmail.com>
Date: Sun Feb 19 15:18:39 2012 -0500
Updated script
commit f92795c65d07b06408aa71fc82be37b49dca5012
Author: Eric Normandeau - Bioinformatics <eric.normandeau.qc at gmail.com>
Date: Sun Feb 19 15:10:05 2012 -0500
Updated script
commit c13d5934adf5392cdd332998ba191705e1d997ea
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Feb 16 14:15:38 2012 -0500
HAVE_LIBBZ2=y works as expected now.
commit 5a9a7fbac59d772aee7be9352c774e4aea606b35
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Feb 16 14:15:16 2012 -0500
mpiexec and exit() are not friends after all.
commit a6e48115f87238f06b3557646ce1c0c417e75e14
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Feb 16 14:14:53 2012 -0500
The script that ships the product is now enhanced.
commit aab0c630f9c61aa77c2aeddbf47d339c793b9936
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Feb 15 12:29:07 2012 -0500
I fixed double-to-int conversions.
commit 860e94833cca50603996a7e730d2e11724ebd9ef
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Feb 15 12:21:52 2012 -0500
The CMakeList.txt has been updated to use the new files in RayPlatform.
commit 2b7314098ad77e07c652711f6dc6307f51eeb793
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Feb 14 20:46:17 2012 -0500
I updated the routing tests.
commit e2e202f6281eea42db5ddd9864b10bc006670fea
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 10 12:07:56 2012 -0500
Buggy correlations are now printed in color plots.
commit bea94b9cd3ee611cae2e7f2077025c1d93370c2c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 10 12:02:17 2012 -0500
Code for flagging false positives have been added.
commit 070bfde7faa889945b802c70f92aca933c53d479
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 9 11:53:12 2012 -0500
I resolved a compilation warning in plugin_Searcher.
commit 21ed820b3dc6ccd72fcd1d89e1dadebaedf9680f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 9 11:36:28 2012 -0500
I removed the threshold for uniquely colored and assembled k-mers.
commit 01feee027ffd8c75bc84beaabe819c6153085ba4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 9 11:33:27 2012 -0500
I fixed headers of distributions.
commit ca3b3c75c9464bcf5e5c5db0e9238718eef2225f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 9 10:31:24 2012 -0500
New script to plot colored distributions.
commit 7db65b45abbfa1e4f70a398456ea01caa0aafbae
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 8 19:39:01 2012 -0500
I added a configuration command for buffers.
commit 7ba87bd79bf095c9d0ce1741fee4565f3fecabba
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 8 14:12:16 2012 -0500
A more robust algorithm to detect library peaks is now shipped with Ray.
The following provided data or suggestions:
Egon Ozer <e-ozer at fsm.northwestern.edu>
Louis Letourneau <louis.letourneau at mail.mcgill.ca>
Mitchell J Stanton-Cook <m.stantoncook at gmail.com>
commit 6744876f6be55015d0123c2b9982e99ee9bbc97d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 8 11:16:24 2012 -0500
I added unit tests for the algorithm that finds peaks.
commit 3b0e5cce3ec41c47a5706b3009525d943894f11e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 7 17:11:49 2012 -0500
The plugin plugin_Searcher now writes distributions too.
commit 2832ae8596e97d2334678391cba6a5497cb0a951
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 7 16:41:39 2012 -0500
I changed the threshold for strangely assembled but colored k-mers.
commit 162fdac039ea724402164999d77b845eb423b3d0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 7 16:35:42 2012 -0500
Outer distances (insert sizes) are not estimated if there are no paired reads.
Reported by Ola Wallerman.
commit b33f3f3802d8d3af5392c5a4765f9af49c4975e4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 7 15:59:13 2012 -0500
Entries with no colored and assembled k-mers are not written at all.
commit 176182a516b7ad5517d4e7670b3550a8c3c1de56
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 7 13:32:07 2012 -0500
Memory usage is now reported by default.
commit 66d5ed28548db3ab089a6868ad60b6cceb95a794
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 6 16:52:02 2012 -0500
I fixed unit-tests/test_uniformity.sh.
commit 363c334b3d27bb6bcaf1225de36f0206335a6d8a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 6 16:15:26 2012 -0500
I fixed the test for test_peakFinder.sh.
commit 75f7a29704981e5bb725ec0fb52bdf3bdb9e2654
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 6 16:07:36 2012 -0500
Fixed test_novaengine.sh.
commit e76e80e9f3000a011004be457f4765cc71ed4f6d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 6 16:04:41 2012 -0500
I updated the test test_limit_kmer.sh.
commit 74db3b7eb6dcb9697a93f7618ef9a58e1836af4e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 4 22:44:35 2012 -0500
I added a simple test to weed out false positives.
commit 81fc9a336d5d204d746cae82bca37c416988a2fc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 4 22:35:15 2012 -0500
I changed the minimum threshold for nicely assembled.
commit 0b9422c0c3d67d8c6467de4fe59bee6fe6386840
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 4 17:38:00 2012 -0500
Colored assembled k-mers need to be in contigs.
commit 053c9c1c9cc55eeba27df22c151319490e351dd2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 4 09:49:01 2012 -0500
I added in-place operations for virtual colors with 1 reference.
commit fd5419297ceeb4aa0a728156247236ca6eb5c323
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 3 23:26:30 2012 -0500
I added uniquely colored assembled k-mer readouts.
commit aa1572b8d99b4dbbddb4696421b83535b23296c9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 3 16:28:40 2012 -0500
A header in ScaffoldLinks.txt was added.
commit b8bd90ad101b09223d1c382b59546c23d89b568f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 3 16:09:58 2012 -0500
The coloring code is now using stdio.h instead of iostream.
commit bd95a93d2d1d29afc0502a864cba70f3a9cd0d01
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 3 13:20:26 2012 -0500
Two bugs were fixed for message multiplexing when coloring.
commit 7f51552d7b4983fe16e116b2c59ecf43857e90bf
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 3 12:06:04 2012 -0500
I refactored the unit test framework.
commit 6fdc748ae8309d2e44c772199720a3d92fa90cb9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 3 08:46:25 2012 -0500
I added a script to automate product shipment.
commit ee7a89e6315dd1d6d4a39c7276de11458632f578
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 2 22:19:00 2012 -0500
I modified the coloring code to fully exploit message multiplexing of RayPlatform.
commit fa2faa0f10b6819bbd509118fb36a20581b5264f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 2 19:14:27 2012 -0500
I removed calls to seekg() and tellg().
commit 29850dad173a3963d862e69573df482dc3bec535
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 2 13:36:40 2012 -0500
A progression indicator was added for sequence abundances.
commit 34ea7b2de0f18ca4c981670551cd32eb591fc127
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 2 13:08:30 2012 -0500
I added a progression indicator.
commit 39f4e0e6b0d7974b4d63ef8a8838da265373b4b8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 2 10:29:05 2012 -0500
Unit tests test_invert.sh, test_coverage_distribution.sh and scaffolder_test.sh are now updated.
commit 3a0fcb72950f883aae77400e68c4047c0b8ba4b4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 2 01:02:49 2012 -0500
I simplified the indexing algorithm.
commit 8a297fbb59681910a0183fa8497e9ea4ede93858
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 2 00:09:18 2012 -0500
I modified the virtual color handle code.
commit 909100ce859ae799d7c85c0a40475b5042c35a82
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 1 17:20:03 2012 -0500
The indexing strategy is now better for virtual colors.
commit 7a24a7a5159bbcdbe0b1e9e345ad279dbeba03df
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 1 11:16:59 2012 -0500
The virtual color algorithms should now be faster.
commit feb3b8df88d569bdeed9fae6a2a8aee98c973351
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 31 16:31:20 2012 -0500
Builds are now performed with 4 slots for g++.
commit d10821f7bcd1caf7b2e9d0bafcdab7fa3856d42e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 31 16:22:15 2012 -0500
The maximum coverage is not set to 2^sizeof(COVERAGE_TYPE)-1
commit 52b333efbdb092039cda34eab3c43f8c7220cffa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 30 22:35:46 2012 -0500
I fixed the install script again.
commit 82b4a0e3f7826776c38b79ba879be7e736d272d4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 30 22:33:41 2012 -0500
v2.0.0-rc4
commit 955955bd1fdbbce28f90209da1f8155643d1462d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 30 22:30:51 2012 -0500
I added the code to print virtual color summary.
commit 6de3cd5416937263be5399433284f4cf35a820e2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 30 18:59:05 2012 -0500
I added a CMakeLists.txt to compile Ray on Microsoft Windows.
commit 79f9cdcea419ae6b7cdea77e8ffe6acd3c327e63
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 30 18:55:14 2012 -0500
Moved license.
commit 3855f594629907a6a1ec54ef903c6b60c2a7ab9b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 30 18:51:20 2012 -0500
Moved files in plugin directories.
commit 57848f3216c0fa0d8fd1d24254d47fe7dabda65b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 30 18:10:10 2012 -0500
I created plugin_EdgePurger.
commit cc2762541a1540d126a1d0d71ab1029ac2dc3645
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 30 18:06:49 2012 -0500
I removed an extra new line.
commit 79fdde465c9b8f8f67dfc8cf5f424feff19e4d19
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 30 18:05:15 2012 -0500
I created directories plugin_Amos and plugin_CoverageGatherer.
commit 80eb04b8a06bc9074f678a11e4258292885edc6e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 30 17:55:52 2012 -0500
I created application_core/
commit bcb603bf8812c8d6d195e7d963b65cd137e15808
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 30 08:41:03 2012 -0500
I removed desired values from call to allocate*Handle().
commit 8f8a4619b99cdce797aae6616dad2e8df2217ea4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 23:18:33 2012 -0500
I updated Ray to updates to Ray Platform.
commit 0fd55f1946127bfb472852f7b534932a8298c440
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 20:37:33 2012 -0500
The version of RayPlatform is now printed with option -version.
commit dba63127a8d0cf2ea0e5abff4a23208d6a3750c3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 20:10:25 2012 -0500
The version of the RayPlatform is now written in a file called RayPlatform_Version.txt.
commit d1f6475d7434bdbf5cfca01cec27da2affe54319
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 20:03:11 2012 -0500
I moved the RayPlatform to another git repository.
commit 3ce4ee14a25f74fcd4be837b2c377f23fdbcdfcb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 18:55:54 2012 -0500
Fixed the Makefile, yet again.
commit c187bbb45fafe8ec9455acaaae70b074a54d5dba
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 16:41:50 2012 -0500
I fixed a bug in the Makefile files.
commit c122c588f9e2dbb88b6f00e6676f40f18e70c553
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 16:41:21 2012 -0500
Don't register plugins before the first call to registerPlugin().
commit 72992eee7bdc0cd58f0fd1ccadb22ec1dbedb5c3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 15:55:39 2012 -0500
I updated plugin descriptions.
commit 2e8c28a6f7d6ad68263d0e11b537b081971c17f2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 15:39:46 2012 -0500
Plugins now register their next master modes.
commit efdb36ddecd7420fb6d689dc43189eb2c0293036
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 14:35:00 2012 -0500
MessageTag sizes are now registered by plugins.
commit ca9746522a8ede702904ae866c56ce26cfec1823
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 14:15:08 2012 -0500
Reply MessageTag handles are now registered by plugins.
commit 12e06de41c9c6079d8917f9f9f4153287af2bc75
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 14:00:22 2012 -0500
Plugin descriptions are now written in the directory <RayOutput>/Plugin/.
commit 302e87760b318fc1b18aef8ee69532beb81bcc7a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 13:37:14 2012 -0500
Added VirtualCommunicator and VirtualProcessor in the plugin list.
commit ccac002b9378bbb631ea7e25050f5cecb795e3b0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 13:24:19 2012 -0500
MessageTag-to-SlaveMode switches are now registered by plugins using the ComputeCore API.
commit f0921c6ca8fdafd5de54af099b3d4433227f5f9e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 12:10:12 2012 -0500
Master switches are now registered by the plugins using the ComputeCore API.
commit 02918c54f989ad16c17d1e042b9b9ed31e899e22
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 11:11:02 2012 -0500
I added a CMakeLists.txt file for Ray, but it does not work yet.
commit 3fcfeb3f76947702e832030baf963b07b8b41810
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 29 00:05:58 2012 -0500
I added a cmake file for RayPlatform.
commit 0f1541a658ef46b669f602cec83c47549f3a47b2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 28 23:37:28 2012 -0500
I fixed a bug in setPluginDescription().
commit 5d234c450899faeecd19b371f946a3f4cab150ef
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 28 23:20:37 2012 -0500
I updated the makefiles.
commit df2249d007bf850dfc0763e165df7b38aa7c35ea
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 28 20:46:33 2012 -0500
RayPlatform now compiles independently without knowledge of an application.
commit 2559f1fccf5ed8b65a1a797330d1a726094faf6f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 28 20:31:47 2012 -0500
The memory allocation types were removed.
commit bfb8d61b37151e05de009abcb3625624e0a6f8c7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 28 18:19:50 2012 -0500
Message tags are now allocated by the core. Plugins have to resolve symbols.
commit e54ad7e62722feb6cd6db242c87bdb3fc38b5b23
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 28 14:48:39 2012 -0500
Plugins now register their own master modes.
commit 47b2bdc14bc2ec4aa98c4f5b2788ad963833e338
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 28 12:15:36 2012 -0500
The macros for listing slave modes were removed.
commit 4b3d9e598dc872c5a83ba75bc90c09c434af16ef
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 28 09:55:04 2012 -0500
A system of symbol registration was added.
commit edcb9e72d39ad224b6006ed4a9ad374879218df7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 28 08:38:37 2012 -0500
The handle RAY_SLAVE_MODE_COUNT_FILE_ENTRIES is now in the plugin Partitioner.
commit 8ebbf297673e3f5033aa851f01aa198c734d6997
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 28 08:19:40 2012 -0500
The plugin VerticesExtrator now uses adapters to register with the core.
commit 507d985d607496ff7f888c6906012aea81e68dd5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 23:13:33 2012 -0500
The plugin EdgePurger now uses adapters to register with the core.
commit b47e005dcdcf7cb1058429716e4875091a677d85
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 23:03:05 2012 -0500
The plugin KmerAcademyBuilder now uses adapters to register with the code.
commit eb53adb22e62860c464406eb61285d59bd624cc1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 22:25:19 2012 -0500
The plugin SequencesLoader now uses adapters to register with the core.
commit 576e172dbc2d6bed50d898f5dc94273551be66a3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 22:01:07 2012 -0500
The plugin FusionData now utilises adapters to register with the core.
commit 6a38424e24bf97ef94944dab2a56882e1e8942ab
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 21:42:37 2012 -0500
The plugin SequencesIndexer now utilises adapters to register with the core.
commit 6c2deddbee1963459ba6d45cdd9cd61e0ead49e8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 21:09:57 2012 -0500
Ratios for slave mode ticks are not printed anymore.
commit 17b4c3693d002aa4758fd9e7b1f596c6a87541a0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 17:51:32 2012 -0500
I added the rank in the SwitchMan.
commit e07dac8d34edbc21b220180ee2db6fc47b86acd4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 16:37:19 2012 -0500
Registered plugins are now printed in <RayOutput>/Plugins/*.Plugins.txt.
commit 59fa1249fb3b3ce300e573bd9f632024873fe610
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 16:23:53 2012 -0500
The plugin SeedExtender is now using adapters to register with the core.
commit f494d5dc5fc206500ff7993ddb8ee1e4276e839f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 15:10:35 2012 -0500
Things in the Makefile file in code/ are now grouped per plugin.
commit 97360c8053bcf84e60aeee8eae21b73541adfd11
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 14:40:57 2012 -0500
A plugin now must ask the core to allocate handles.
commit ec9c58b5b1938bdd1983926217dc689ec1d78c06
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 10:42:54 2012 -0500
I removed the script engine from the RayPlatform.
commit 5354cdc7b0539162f8235c195581b42064df6c68
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 10:24:43 2012 -0500
I fixed the Makefile for adapters.
commit d64a43ebd642486a4b1f4170254816ed59281ee2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 10:20:48 2012 -0500
The plugin CoverageGatherer is now using adapters to register with the core.
commit 8be5ffe2b54ef9126797ad25a2e27833e2d0dae4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 10:14:57 2012 -0500
The plugin JoinerTaskCreator now utilises adapters to register with the core.
commit 0127585e39504d5dfde84cae8e94a98a5fd73a8b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 10:08:38 2012 -0500
The plugin SeedingData now uses adapters to register with the core.
commit e66d032fe43083d0bd3689f68f1d891ace14a23a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 10:00:32 2012 -0500
The plugin FusionTaskCreator now uses adapters to register with the core.
commit a638b5aaebbae8bf142793c14c863fbafa6926be
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 09:53:43 2012 -0500
The plugin Amos now uses adapters to register with the core.
commit fa4b070a827b8f0b8b23dbb51f313a8fa8f853ab
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 09:44:15 2012 -0500
The plugin MachineHelper now uses adapters to register with the core.
commit 21be5d43df119301d98dd5a9e559427d4a3edadc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 09:28:31 2012 -0500
The plugin Scaffolder now utilises adapters to register with the core.
commit feeef021da971ed21fe1901c72bb13a3cc8fa43e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 09:17:05 2012 -0500
The Makefile was updated to add adapters.
commit 6cff56f207f4d590a58491f3f7066b807f767b9f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 09:16:46 2012 -0500
The plugin MessageProcessor now utilises adapters to register with the core.
commit 1d7f7edb07ccb563ca7296984bca04ed21c8b062
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 09:15:56 2012 -0500
The plugin NetworkTest now utilises adapters to register with the core.
commit 60583ab722fb07107037d94a212d8dd973b0571f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 09:15:03 2012 -0500
The plugin Partitioner now uses adapters (a design pattern) to register itself
with the core.
commit 83826be049712eb07835b7f7f05ed333721361aa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 09:14:19 2012 -0500
The Searcher plugin now utilises adapters to register itself.
commit 41b45ac12ea2a42bbf7c41cbe4b09c9b1ee735ae
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 09:12:45 2012 -0500
The Library plugin now uses adapters.
commit e287f3052ec22284354e03f457ee8ff2a61c0d0e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 27 09:10:02 2012 -0500
Handlers now have only one method called call().
commit 249e667145774fa4bfaa52be1ca67364ca5bce15
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 26 21:56:42 2012 -0500
I corrected performance issues in the graph coloring algorithms.
commit 83fcff9a7e8903cc3269384da7835687c60a576c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 26 17:53:13 2012 -0500
A set of available handles reduced the time complexity to constant time.
commit 5c4134f0e0e3a19c4ce20c3fe5ed81adcaed8d23
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 26 15:16:32 2012 -0500
I removed useless code in allocateVirtualColor().
commit 5d90312221d3396ecd008eee02fbde5aa21bdc77
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 26 15:05:04 2012 -0500
Biological abundances are now computed with colors.
commit e5460aea9668c40cbb083050133998ec529820be
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 26 14:17:16 2012 -0500
Physical colors are not embedded in namespaces.
commit f7030e18122ed66984e6e66bdc2137384e6be43a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 26 13:32:14 2012 -0500
The index in the color set has been removed.
commit b6c03eacf8c08056e888eeb69c5476168a6e9870
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 26 07:53:01 2012 -0500
Virtual colors with 0 references are recycled.
commit 967e5947f8c241bf1c9ca5d7f596f0b4259ca947
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 25 21:45:38 2012 -0500
I added documentation for virtual colors.
commit 654f73244d5bcb2c8fa50f6ab2d2450f9c4d8ae6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 25 21:42:17 2012 -0500
Unidentified sequences are not colored.
commit 96dd35504a79b01f3663f2ecc34610a785c5597a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 25 21:39:18 2012 -0500
I implemented virtual colors in Ray.
commit e6328d2dade434551594975e69d1953cf2379999
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 25 19:54:05 2012 -0500
I added a slave mode for coloring the graph.
commit 6356dd1c19280505825bb52e8a36aa6cd4edd44b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 25 16:27:05 2012 -0500
The GenBank identifiers are now detected in files.
commit 75f23e655a5982a3abcc9c5f0a735b13bb1c002a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 25 14:56:26 2012 -0500
K-mers with Ns are not counted anymore by the search engine.
commit 5c47e9a6059def22ab4d89df381fe91adeb1f756
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 25 14:04:04 2012 -0500
I changed the threshold to report something.
commit 2361aba268099c24b306d35d1456f634ba295a72
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 25 14:03:14 2012 -0500
I started to implement color virtualization.
commit 65038558765bd421bf95cf1f6377882bb5033841
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 25 13:51:03 2012 -0500
I removed the mean coverage in the search results.
commit f89330ee710849f9d68e3c6576f5e45202c43a6a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 25 09:13:54 2012 -0500
I started to work on graph coloring with Ray.
commit 0acc5c14836f9dfaadcae02a82a2323b593e145e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 24 20:04:42 2012 -0500
I simplified the way the ComputeCore is utilised.
commit 45fa8a28ccb09aee1f1873d16071edd2518bd716
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 24 18:58:41 2012 -0500
I ported JoinerTaskCreator, Library, Partitioner, SeedingData, and CoverageGatherer to the CorePlugin architecture.
commit cc8d87daede8d5e729bb7e84686d5bb12abbd425
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 24 18:42:52 2012 -0500
I ported MachineHelper, Amos and FusionTaskCreator to the CorePlugin architecture.
commit 775875c51ffda32a64f919e5fc639c544f9d03f3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 24 18:20:00 2012 -0500
I ported the scaffolder, the network test and the message processor to the plugin architecture.
commit fda31f4536c531fed06627d4dd09ccf008ecc268
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 24 17:51:55 2012 -0500
I removed ratio for ticks counts.
commit 854468997fd2260a86e59677ba94b74977930d6f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 24 17:49:30 2012 -0500
I created a new interface called CorePlugin for modularity.
commit b67aa9ceb031fed46acffce3db662014503b29c3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 24 15:07:44 2012 -0500
I fixed a compilation error with gcc (GCC) 4.6.2 20111027 (Red Hat 4.6.2-1).
commit bddc377d71c8f1380f56ce0aa2e97825ea0e3e8b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jan 20 23:02:53 2012 -0500
I fixed a bug in the file creation.
commit b7010bc60a9fc360bf592d2989b0727efa3c1bbc
Merge: d537fe6 b6c9585
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 20 18:01:55 2012 -0500
Merge branch 'master' of git at github.com:sebhtml/ray
commit d537fe66763c3d9dc3305e39c099a64fd3390a30
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 20 18:01:34 2012 -0500
I fixed a fatal bug in the search engine for k-mers.
commit b6c9585bf8096d33f3bf0f6fa13fd7c9e8597da2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jan 20 07:57:05 2012 -0500
Fixed install.sh script.
commit e1e3ab124293abc276e860e194bac3a60088f75e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 20 07:53:26 2012 -0500
Modified the version to 2.0.0-beta6.
commit f701c2743491e77a52e05c7f99cabd2c2ed1d083
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 20 07:52:00 2012 -0500
I added threshold to remove some false positives.
commit dd3643d18b75b6457a8d6cb3e35765eb85f60b14
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 20 06:54:59 2012 -0500
Contig identification is now working properly.
commit de95f5a300095d461dd71fd2e9804bb3c0fa3ad9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 19 21:13:01 2012 -0500
Cleaned the sorting code.
commit ac4866834e36d132f67ca8b62ddb2b8d3b9dee83
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 19 20:36:15 2012 -0500
Fixed greater-than-1 ratios for contig identifications.
commit acb4521ea943b18d50cdcc2fcb6083c63fb8ab7a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 19 15:55:56 2012 -0500
I explained why latency data files can not be written before the end for everyone.
commit 15dc1b01cb2ea500acdaa8d794b0af3ef967587f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 19 15:26:41 2012 -0500
Added an error message in the switchman is not configured properly.
commit b25c0b2ca6d1e3a64ecdb3497c25ec51bda3a887
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 19 14:10:47 2012 -0500
Added more documentation for the Ray Platform.
commit e5b7df76749b1835fbf809629ac7ec39066b79af
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 19 13:59:09 2012 -0500
Added a README for the Ray Platform.
commit ef2b265a8a104b76107e0e01bfd273ffbc3efc4f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 19 13:38:26 2012 -0500
Fixed paths in the README.
commit 873c3562a51a0e2c8fc6175358d3b39be908bac4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 18 16:49:43 2012 -0500
I removed license notices in scripts.
commit 251715aa93565adaf3b1621467c40e4360862692
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 18 16:46:18 2012 -0500
Moved code/Application/* to code/*.
commit 4707448bad77803f5732d2feb1018806f1bd0f7c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 18 16:41:35 2012 -0500
Moved Ray Platform to RayPlatform.
commit cfbde6ce7eed11ec4dca38b57939f7506e5da450
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 18 16:31:57 2012 -0500
I created a working prototype for contig identification.
commit 16897a53b4b9f04d27598e9c9abbdb7badeaa83c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 18 09:53:15 2012 -0500
Started to implement contig identification.
commit ffb03493253b9d2282984de91aa3d2c6a5636052
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jan 16 17:33:05 2012 -0500
We don't need to configure the virtual communicator twice.
commit ef0d35d3d6373e949b7deb7da85b7e36a9ef8d0f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jan 16 17:25:10 2012 -0500
Fixed the EXTRAVERSION for beta5.
commit 702f832fadcd48be3fefd50049cdc8c17cabb03c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jan 16 17:24:26 2012 -0500
Now adding the license to installations.
commit 13534db74cd94c0c891133ef0d288ad6a2cf87c5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jan 16 17:08:18 2012 -0500
Changed the maximum line length for fasta files.
commit dee142f10982a17099a9dc265af567db99ab2a35
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jan 16 17:07:11 2012 -0500
Now converting bases to upper case if necessary.
commit 779277bb26c18d9546f27298a57a2cfd391110c3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jan 16 13:25:49 2012 -0500
Ray Platform is now licensed under the LGPLv3.
commit 1c1e52089baab7226a473efbf90e575dba585f4e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jan 16 13:24:54 2012 -0500
Ray Platform is now licensed under the LGPLv3.
commit 414cb08c5f1f4235aa659bd5f576abe9da3a3a61
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 16 11:36:18 2012 -0500
Ray is now distributed as Ray Application and Ray Platform.
The Ray Platform can be re-used for any other massively parallel
software. Ray Application has 29776 source lines of code (including
comment lines and blank lines). Ray Platform has 12774 source lines of code
(also including comment lines and blank lines). The Ray Platform is compiled
independently from the Ray Application.
commit c8e39bf95bf1a5983a04289550bff5556fe96ef9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 16 00:35:11 2012 -0500
Added a file describing the handler design.
commit dae0f539a0a50ea03bbda307808543afe1271c3c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 16 00:34:55 2012 -0500
Moved all handlers in Machine to MachineHelper.
commit 2fc48be4ca96f185153c7bc606bebd1ee4c7ecaf
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 15 22:28:00 2012 -0500
Added comments for the compute core.
commit 1df3882763ff75b2ed68defa13a1a6468cbd3db1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 15 22:07:56 2012 -0500
I added a new class representing a compure core.
commit ddc674e1ba74383cff6212ea20362ca8502c523d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 15 13:40:03 2012 -0500
I removed reference to Ray in type names in the platform.
commit 012bad9b38c43fa81083593cbd1d9609de8c3429
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 15 13:07:06 2012 -0500
Now using setObjectHandler() for master and slave methods too.
commit ef85cacc2fdd9a2c1c5c7fdbb3d759952e4d52d7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 15 12:24:10 2012 -0500
Ported the code to use slave and master handlers.
commit 331ecf487d6150e5c24c219ce3d4aa62b53940a3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 15 11:13:34 2012 -0500
I separated application code from platform code.
commit 094e3cdea332644396f81b88cf002a80bc913bc6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 15 10:27:46 2012 -0500
Removed the empty tag list.
commit fb7e4713e137285f581772fc6e6ffb056dc68ec3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 15 10:17:34 2012 -0500
Added handlers for slave modes, master modes and message tags.
commit 8b871ee0727d8be4ade79d82f65aa7a4ab7844b5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 23:03:27 2012 -0500
Added a tick logger that outputs in RayOutput/Scheduling/.
commit d84bb776716d454d0488a784dedab760f6c72dbd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 21:37:03 2012 -0500
Ported the scheduling of the k-mer academy step to the switchman framework.
commit 107cd84c276acb5856a99bfcd31c02e3bb8b88e3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 20:16:50 2012 -0500
Added slave switches for RAY_MPI_TAG_WRITE_KMERS, RAY_MPI_TAG_EXTENSION_END and RAY_SLAVE_MODE_EXTRACT_VERTICES.
commit 8fcf5d246f5582a284715690c1664fbb389c8a4c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 20:04:11 2012 -0500
Moved the code of call_RAY_MASTER_MODE_SEND_COVERAGE_VALUES() in the machine helper.
commit 3cef40b308d66ade537ad80121b2047eab6badee
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 19:40:08 2012 -0500
Added a machine helper class to delegate things.
commit 104d1c6322be01344f3bcd028ada4a635bc90464
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 15:57:43 2012 -0500
Changed the default to DEBUG=n to disable debugging symbols.
commit 76f72248bbc30dcfbb681184f89546b2602701f1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 15:50:12 2012 -0500
Changed column names to more verbose ones.
commit e08f957536dc12ebf7a2ed654d0cb8cd135f69b4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 15:11:54 2012 -0500
Renamed the script engine and the nova engine.
commit 39471f26d6df2737c781810ce7cbf9d47529c7fd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 14:42:44 2012 -0500
Normalised method names for slave modes.
commit bb3bd19252f4a62c43d82f0dd7da9280205d3740
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 14:17:30 2012 -0500
Normalised method names for master modes.
commit a854bcbdf4dde52fa0a947738e7f34b0d90da56c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 13:09:39 2012 -0500
K-mer coverage depth proportion values are now computed by Ray.
commit 6699516cc8c0b0a20ae1251c0b1f59eb665c2d61
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 14 11:05:21 2012 -0500
Fixed a compilation warning with fprintf()
commit 05612c47925d79490fd631348aa87bc14179dd04
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jan 13 15:57:04 2012 -0500
Documented the memory management code.
commit 8f4d50624e3479d700cb8adf4d79d08ed6ff58e3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 13 10:38:50 2012 -0500
Fixed the contig mean coverage and an assertion.
commit e80b3444880a79c7b5d7c646c7a067780b693429
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 13 01:47:07 2012 -0500
Each rank now writes their own files instead of sending data to master.
commit fbb71338ef62623f3dbf35253e6eba4dd210c689
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 13 01:07:38 2012 -0500
Added some comments in the switchman
commit e706b57ece88e3e18d2ec4dcf98e86d4563b830d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 13 00:42:34 2012 -0500
Added comments in the virtual communicator.
commit 0f200e2fa99e074f5f02968b064776f8e3f49724
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 13 00:36:48 2012 -0500
Added new MPI tags to eventually distribute more the inputs and outputs.
commit 1c52de565ef662cb7c9e5db6228711d9dd8c5f1f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 12 23:19:52 2012 -0500
Now using the BufferedData object to compute contig abundances.
commit 2f4bcefe6de933a9381cee5509beba4c6febb3f7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 12 21:27:45 2012 -0500
Ray is now tested with these C++ compilers too: pathscale and pgi.
commit af5228414ac9a5100138b746c0f18bd90f4fde51
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 12 14:56:17 2012 -0500
Added the mean k-mer coverage in the list of metrics.
commit 3b660e86070effbea3412b0b9eb1a02d7259bcb0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 12 01:11:21 2012 -0500
Communications are now buffered in the search engine.
commit c7ed07fe215d1decea5eeae1538577d7d1a3b64d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 11 23:01:56 2012 -0500
Prototyped a use-case for buffering messages in the search engine.
commit 613e231fa897dc7d7771d8cdaffc5f0f2ac13f38
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 11 22:29:23 2012 -0500
Switched to BufferedData for buffered messages.
commit 5a7405e0885e8bf8d704fde31fb5cad26281bdbd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 11 22:01:44 2012 -0500
Added speed during the biological abundance computation.
commit 77ccc596b9f00ddfa46d6b3f2333b427a6963c1f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 11 21:43:54 2012 -0500
Fixed directory names for option -search.
commit 2e04a0e82d420a2afb16d9bece36923c5492dfcc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 11 11:45:58 2012 -0500
Files are now written correctly to BiologicalAbundances.
commit ff6eef56c9f66473d4b98c28803d12ad2c6b685e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 11 10:31:18 2012 -0500
Biological abundances are now operational.
commit 33eaf80172c0172bd91a8f2f732a13667268ca68
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 10 19:34:07 2012 -0500
Almost done implementing biological abundances.
commit 5dd61001158395134343506a848b2b84275abac4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 10 14:52:59 2012 -0500
Counting sequences to search is now implemented.
commit b58cfe3f5597784aa5d18ec1ccc95ea1561c6b27
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 10 11:41:53 2012 -0500
Added option -minimum-contig-length.
commit d927f3ed9a83a1cb70a4d71261a7657599f569d1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 10 11:15:33 2012 -0500
Disabled detailed reports and added an option to enable them.
commit 6353f9603bbed871c94e07fd704a1ac1b7579f62
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 10 00:34:13 2012 -0500
Implemented entry counting for biological abundances.
commit 778e5b001b0ac7d5a645396cace7bcb4570c3b80
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jan 9 08:59:09 2012 -0500
Moved the license in the main directory.
commit 9b5d4254999c6d7b89c75446c0287d7cc47d45f4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jan 9 08:41:18 2012 -0500
The frequency table must be cleared regularly
commit 649f6d8544d1d47a3abe2495a119a91ae55ca15e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 9 01:16:50 2012 -0500
Implemented contig biological abundances (enabled by default).
commit 06af89e838b0944722e78f0a1371656b8da0d869
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 8 22:44:46 2012 -0500
Added 3 new list for compilation (empty tags, slave modes & master modes).
commit d9ab90e63bf10fdf89cc9c5d2109c307f24b99ec
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jan 8 07:18:06 2012 -0500
Updated the design ideas for biological abundances
commit 5dcb9510ce4cf4ecd0621503291022ae519af43a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 4 21:14:15 2012 -0500
Migrated some scripting code in the ScriptEngine.
commit caad35d2b3bc4219d5b00fe43509681c45508bed
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 4 13:25:28 2012 -0500
New structure for scripting-related files.
commit c524570246b6faa6e58110277194a92d94c86dc0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 4 13:07:31 2012 -0500
Added master switches in the SwitchMan.
commit 4afa8d5eb66e270394a60b781bc505b7eb7fbfd8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 3 16:00:37 2012 -0500
Enhanced the layout
commit f91a34f75544e41a370da6933fc87ae64c41f75d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 3 15:59:29 2012 -0500
Updated the README.
commit ccef34f848c4639f46867be07e2900fd93bcd3b9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 3 15:39:09 2012 -0500
Added design blueprints for Ray Biological Abundances.
commit bb6f9598ca6f45778e3277979ab3fb08b9f52244
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 3 15:09:01 2012 -0500
Added a scripting directory and some methods to the switchman.
commit 784071bba75b6e747490eab9e2f8e0bb971e6bd4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 2 21:00:45 2012 -0500
Created the SwitchMan module and ported the network test code.
commit 50433bb5e8fc8a91b5eaad8c4a418ae77e416211
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Dec 25 08:24:10 2011 -0500
Added a maximum number of flow cycles
commit 0daec6bb174b1c92f132cce625ee6cdb66cfe078
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Dec 15 18:39:10 2011 -0500
Added a script to compile Ray with fancy options.
commit f69cc9847947b9a72b3442e98fca05e8c1064b7f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 15 17:18:40 2011 -0500
Removed the restriction about peak coverage values within the scaffolding bits.
commit 256bfbff6394f36d175056fa2852ae475549245a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 15 15:35:00 2011 -0500
Removed the peak coverage dependency from the bubble objects.
commit b5b719da373adb71a4ab47d2b0e41416bd7f1dea
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 15 14:17:57 2011 -0500
Removed the repeat coverage from the seed extender.
commit 11bfb01b1f979bfd1dc468d419c458a55aff864f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 15 13:45:00 2011 -0500
Removed the dependency on the peak coverage from the OpenAssembler engine.
commit 1799f47c9a514b04f221aa2b173dd5e3634c204e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 15 11:35:02 2011 -0500
Removed the peak coverage dependency in the vertex messenger.
commit d1dd73fa6f6a4cf58e7469a32c8fd74ef5fa94ce
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 14 11:04:13 2011 -0500
The k-mer peak coverage is no longer an issue.
commit c049b76a6096a66632c82de06795dc505cf262c6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 13 15:12:32 2011 -0500
The peak coverage is not utilised in the read k-mer indexing.
commit cbc6229c5ef1d447ea18e81391cf19c2f084cdab
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Dec 12 14:59:14 2011 -0500
The seed extension is now done independently from
the coverage distribution.
commit 29afc189b4b709f4ae248f6365c1a9b2e75140c4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 6 16:55:21 2011 -0500
Added a class for assembly seeds.
commit 8c88e47f3a24f20bb94a33e6dcd305d6c47bc190
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 6 13:56:06 2011 -0500
Added average values for each profiled steps.
commit b86c868f257ab0c5e0dbdecab6bcb782b031195f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Dec 5 17:23:22 2011 -0500
The slave mode is now shown with the speed of Ray.
commit 5b8850d843d9ff1c7260231df9665e7d435a4362
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 30 11:47:45 2011 -0500
The mode latency is measured instead of the average during the network test.
commit 39204f519426c2cda1ecbaf6abd39fd1ba41642e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 25 14:56:48 2011 -0500
Added option -routing-graph-degree to change the degree of the routing graph.
commit 05035f33e8f5517fcff7e6463c693892bbff8587
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 25 13:13:20 2011 -0500
Added software components to get speed readouts throughout the seed extension iterations.
commit 8feb467346a78dcf3d6ad611a095559ab007ea86
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 21 16:50:31 2011 -0500
Added speed indicators and some estimation of remaining time to
complete the assembly.
commit 41ec0fe541aa49b54f58f8871c2cb1af4c3a554a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 18 15:29:07 2011 -0500
Removed a comment in the seed extension code.
commit 40baffa54c7f821712c0ca0c2c832fbbe8f078e9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Nov 16 19:16:41 2011 -0500
Added an experimental graph implementation.
commit 305334fefb9a6e1631f98615e77c6e0e1641a101
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 15 17:00:55 2011 -0500
Modified de Bruijn and Kautz graph implementations to avoid copying bytes.
commit 96d1e8adea0e78b5842bf75c9e308fa9cb513cc1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 15 13:46:54 2011 -0500
Implemented message routing with Kautz graphs.
commit 1afbce834e4318687a12582557116f8736129fa8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Nov 14 22:03:31 2011 -0500
Corrected the number of edges in Routing.Summary.txt.
commit 242a397d7ab79554e429a112f6585a30aa92ff73
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Nov 14 22:02:27 2011 -0500
Fixed a bug that created files with strange names (unexpected behavior).
commit 525f32cc29b8db991ced21a0fbfa1e153c0dd7f1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Nov 14 13:12:24 2011 -0500
Simplified the implementation of de Bruijn message routing.
commit 4427ab762ada4bbf95dfc48b4351904fd39c85a8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Nov 11 15:48:58 2011 -0500
Simplified the code that finds the next vertex in the de Bruijn routing.
commit d6f5a19e4e23a704e0080efecff687b534760b51
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 11 12:48:33 2011 -0500
Optimized isConnected and getNextRankInRoute for de Bruijn routing.
commit bd2f02a59d11d4ed1af66d7f4f35eac56888c2c6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 11 11:56:09 2011 -0500
The code for de Bruijn routing is now working just fine when
the number of ranks is a power of something. Otherwise it does not work
as expected.
commit ef9a11733815ebe0042e6b566be77541febdf190
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 11 10:59:36 2011 -0500
Changed the code so that no routes are computed with de Bruijn routing.
commit 27f06449c14e9aed457363fab909a728b29646b9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 11 01:13:39 2011 -0500
Implemented various types of graphs for message routing.
commit 6eb972fbbfa33ae71dbace8d6c0a0fb92753c8d3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 11 01:08:51 2011 -0500
Implemented de Bruijn message routing.
commit f2ef10e18da20b977e71cd228845191d13d05f76
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 10 17:26:06 2011 -0500
The route are now computed with more verbosity.
commit aeecaa2428c4de8d11395045da2b41aaf2800ecc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Nov 10 17:09:36 2011 -0500
Decoupled the creation of the connection graph from the actual message routing.
commit 22557ff0527cd0673d6a59ca7436d5034061de34
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Nov 9 00:01:32 2011 -0500
Fixed the number of edges in the complete graph.
commit ccebd11bcfa7c388d6d2590df5957ce56b7c1fd7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 8 17:31:24 2011 -0500
Improved the algorithm that generates the random graph for message routing.
commit d09305d46d584c07c0552c4de9cbcf6eb5608730
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 8 08:59:07 2011 -0500
Don't show the final message if the option -test-network-only was provided.
commit 0c47d31c25c3709d1f85fdb17135ffc753358096
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 8 08:46:39 2011 -0500
The order in which the routes are computed is now random.
commit fcccec16330261808b031c1a15ae14caf96281a0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Nov 7 16:39:43 2011 -0500
In the network test, the length of the vector is reserved once if raw data are to be stored.
commit 0a79c1ee473612b20affcd06d4519acb64b42405
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 6 22:32:08 2011 -0500
Connections not present in routes are removed automatically by the message router.
commit 803df88ba2037faf4ea426c9d55b34c96a0ce8c2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 6 22:17:29 2011 -0500
Routes are now computed by minimizing the relay events for each rank.
commit ac32749654fa3e5b3747f7cd11c756ac12ca317a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 6 21:25:07 2011 -0500
The route from B to A is now computed independently from the route from A to B.
commit 33e9f999db0b5846ed7c68e7ece7f37b1a20c515
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 6 20:53:38 2011 -0500
Added relay event counting to avoid hanging code with routes generated
with random connections.
commit bc7fb0c120cf70da2fbfa361e15f4e74199c091f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 6 01:17:15 2011 -0400
Assertions are not compiled by default now. (ASSERT=n)
commit 56d42d4add8ceb07b5bc12a8f3bc3ee2cd3f8574
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 5 11:56:05 2011 -0400
Added some type definitions and enhanced the routing algorithms.
commit 470318bbb5adabb4609b537a66a2a53e93579968
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 5 10:12:18 2011 -0400
Added option -connection-type to specify the type of connections to use with -route-messages.
Accepted values are complete, group and random.
random is the best.
commit 602935c4e34e461e2fa6ed6a709bea945cdba450
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Nov 4 17:05:11 2011 -0400
Added option -cores-per-node to help creating better routes with option -route-messages.
commit 27ce68027c3484b73dc559acb8925a308eb38c84
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Nov 4 14:48:09 2011 -0400
Added automatic route generation.
commit 8e3d63a58be733d9034f9e78b7ce9d78c7b9fd4b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Nov 3 22:11:04 2011 -0400
Don't append message statistics when the count is null.
commit 697e1e113294d90e1fdb69e4a9b1bda55626fded
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Nov 3 21:55:21 2011 -0400
Added a working prototype router for message routing.
commit d1b499a0039d10b1629537720d78bfeac4b18aa0
Merge: 67be2cc 1648df4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Nov 3 10:21:20 2011 -0400
Merge branch 'master' of git at github.com:sebhtml/ray
commit 67be2cc51bee2e4e1d978f238368f15958dd18f8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Nov 3 10:20:35 2011 -0400
Removed some debugging messages in the creator of fusion tasks.
commit 1648df4215edb9b835fa9bcca61318301289b3e1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Nov 3 10:16:40 2011 -0400
Changed the threshold for the repeated vertices.
commit 19d6da3b7b1a125b5d911a3dc0ca04094991e0f4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Oct 27 10:36:04 2011 -0400
Added the Open-MPI option -output-filename in system tests.
commit 518e06f4ce9bf31e0ec5859c940d2ea5b05a81be
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Oct 27 10:35:18 2011 -0400
Improved the algorithm that compute seeds, less (none) assembly errors
are generated.
commit 01342a5164b7113958741d14a596eb627b0ecd8f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Oct 26 18:35:18 2011 -0400
Some code refactoring for the extension of seeds.
commit f6f12c66cabd13d78e0a350ce84c0ccdcd9a2d22
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Oct 26 10:58:06 2011 -0400
Added memory usage reporting in the fusion step.
commit e329c9e2be33a7cd4e3e6ca2cddbc69c26bdd4f3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Oct 23 20:11:04 2011 -0400
Corrected the accuracy of expiry positions.
commit 64fe9f76d7528013b64b0e99d192c02e7163716e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Oct 22 17:08:04 2011 -0400
Refactored some code to ease further enhancements.
commit 1b9764bf4c504970d79216cb3d566a9c3e8d9061
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Oct 22 00:52:43 2011 -0400
Added some code to store agreement values during read threading.
commit 4b9bf54fd58ff6e46eb15521253649d190cb133e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Oct 21 12:55:40 2011 -0400
Added a new output file called ElapsedTime.txt.
ElapsedTime.txt contains the consumed time for reach algorithm
steps.
commit 32b18ee77744673f42afb8aee07c1c7f1823f76a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Oct 19 14:44:50 2011 -0400
Added some profiling points inside the source code of Ray.
commit 1385f96f54c4ae18657e5a8603241d48ce80facc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Oct 14 10:27:24 2011 -0400
New option -write-marker-summary which writes marker files for further inspection.
commit d0e858e7e6bbd099873e72f7ba8132bf8bbecfbb
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Oct 7 15:33:59 2011 -0400
Added option -write-marker-summary.
commit 737388b98e0f216cd2e96b31380e2b9bf20ed4b7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Oct 7 13:40:33 2011 -0400
Added option -show-consensus to display read sequences and consensus during the extension.
commit cb5ebc591e3336364dccab9db9ab0d9811ab2d96
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Oct 7 10:17:54 2011 -0400
Added option -write-read-markers.
commit d28e76a3ee1b95e6748db8c082010b3b515121eb
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Oct 3 10:42:01 2011 -0400
Removed data files in unit tests.
commit 2943c44ae682d49e04eaa86adb0816365e88a185
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Oct 3 10:37:25 2011 -0400
Updated the manual page.
commit 1f712cdd8123a9d456cf35b08f3abd9823970c67
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Oct 3 10:36:00 2011 -0400
Fixed PATH problems in unit tests.
commit ddc513c7316fb9086c5efdee462834442cc02cfe
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Oct 3 10:29:01 2011 -0400
Simplified the release procedure.
commit 41f96034218c9f10afa10e74bd6596a64f113c07
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Oct 3 10:20:05 2011 -0400
Fixed some PATH issues in system tests.
commit b388cfcb2f77cb814631bdfe1e6a8acdffcf07c0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 30 23:04:12 2011 -0400
Migrated the version in the Makefile.
commit 28b2a69047c11bda3dc06bade577fd7b21b97020
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 30 15:36:58 2011 -0400
Added granularity summary for option -run-profiler.
commit f49a434cb7f681db5df9db59a20e8858d10a4c78
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 28 22:40:40 2011 -0400
Added the compilation option CONFIG_CLOCK_GETTIME for the profiler.
commit 95f2488f99e6a3e6229a96d0a9216a63f747e3f8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 28 15:57:02 2011 -0400
Remove expired reads from the list of unmated reads to reduce the computation granularity.
commit 9bf6e6920a22cf37bd51a72b9cd83ff37effc093
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 28 15:19:03 2011 -0400
Reduced the granularity in call_RAY_SLAVE_MODE_EXTENSION() by cleaning expiration positions.
commit d705e55ae29564612a6c0c69ac703d8710d6de25
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 28 12:19:37 2011 -0400
Reduced the computation granularity for the code that computes reverse-complement extensions.
commit f76e565d82789c8cf0bbeeb298006abb226643a5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 28 10:20:17 2011 -0400
Added timer warnings with -run-profiler.
commit 0ee6fcc92188b14d93e66c31f9e5381eac59be74
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 27 12:12:16 2011 -0400
Added comments in the communication layer of Ray.
commit 57099e33a22391736da71b96ec96f05a70ab2c50
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 27 09:43:31 2011 -0400
Disabled persistent communication in the round-robin reception.
Persistent communication with the round-robin reception causes starvation.
commit f75bfa63f0ffc24e044e9cc5cf2f568755773e0d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 26 16:59:17 2011 -0400
Removed inline code because compilers optimize the code anyway.
commit 6b345f91695e5d5f27579ec39f410ba6800543e2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 26 16:45:24 2011 -0400
Changed mpirun to mpiexec as mpiexec is in the standard.
see http://www.mpi-forum.org/docs/mpi-20-html/node42.htm
commit ec32cf488e691bebf249513cfe9f9b965b5046fc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 26 16:40:46 2011 -0400
Merged the persistent communication layer with the round-robin reception.
commit 714875d283b8c4db303d6fc79c1971bfed9a47c5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 26 08:04:21 2011 -0400
Implemented a round-robin algorithm for the reception of messages.
commit 63a3131a5ea0b61248fcf43261acbc345e810e70
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 25 23:35:29 2011 -0400
Write raw data for network tests if -test-network-only is provided.
commit dc196b2c24450c700d8be8fb890d647f2104d0d6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 25 21:04:32 2011 -0400
Added option -write-network-test-raw-data.
commit fd3c033ba9eb826ff3545fc3b38ad754eff60194
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 25 20:13:38 2011 -0400
Added a time period during which other messages are more important than urgent messages.
This avoids having one MPI rank that dominates all the others.
commit 7c2d6f6168aa7a80366bfdeb59021b96847397d3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 24 14:05:26 2011 -0400
Fixed a bug in the code that loads the checkpoint GenomeGraph.
This bug caused the sparse hash table to remain in a state that required further calls to
resize() because its resizing was not completed. A call to completeResizing() solves the issue.
commit 58733de8c0e40dd64e6abf7bdc94554bb6aec770
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 24 11:18:05 2011 -0400
Enabled the communication optimizer for the network test too.
commit a08888b26c8f95706bde180eb9bb648fedb552e4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 24 10:50:07 2011 -0400
The option -show-communication-events now shows all messages with overlays too.
commit c97ea8ef2dd41bf4ff5a50df7322dca63d9bf8c8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 23 23:13:45 2011 -0400
Added a communication optimizer with urgent messages.
commit b63035e126d6bbd2950dfbff8e698ea1b7ae35bf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 23 21:31:49 2011 -0400
Added overlays for option -show-communication-events.
commit 9779cedbf48d7739418e63654a01c4bd9e79e0ea
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 23 19:27:51 2011 -0400
Added option -show-communication-events.
commit 7619e842254227d94e4590764a5ac585447a862f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 23 17:24:29 2011 -0400
Added option -show-read-placement.
commit d6b1f5d393a768a7ad2c66e5286967a8775e361e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 23 16:40:22 2011 -0400
Added more details in the output of -run-profiler.
commit 6aa7b5938f5e766a604093ab89d835b2b5b0bc87
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Sep 22 23:10:27 2011 -0400
Removed dependency for clock_gettime.
commit 078148a8fd00de8823050aa101788fb209c93f38
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Sep 22 22:34:08 2011 -0400
Added option -debug-scaffolder.
commit 9181dd877ca6ee681b17f79418fd203e6e27ea8c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Sep 22 22:27:03 2011 -0400
Added assertions and fixed a bug in GridTable.
commit 0df6381b40720846a6742cb8e83831cd36ef7337
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 18 20:08:41 2011 -0400
Fixed some divisions by 0 in the scaffolder.
commit 0554af15c9e9d7aa46576d71e2baa436daee59c0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 18 20:07:50 2011 -0400
Regression bug on phix system test fixed.
commit 76b0b0d4f5302977f182b47e7e7c290364f32d8d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 18 13:24:56 2011 -0400
Fixed a bug in JoinerWorker in which two overlapping paths would not be joined together.
commit bc7b314aae9428b94b0cf4d09a7b2cbeb290b947
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 17 22:02:21 2011 -0400
Added some debugging information for -debug-fusions.
commit 783d522b8f0ced2073eb107c404f9c442d64f6fe
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 17 22:02:00 2011 -0400
Fixed a communication problem in MessageProcessor.
commit 4e2b599d6a66174933b45d42e851789aeb11c6fa
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 17 15:55:16 2011 -0400
The number of enabled MPI ranks can be changed during the network test by changing a variable in the source code.
commit 95d825d9e948abe75965a7b03c08ff8650ee4531
Merge: 5cd9848 bdf49a2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 17 12:20:05 2011 -0400
Merge branch 'master' of git at github.com:sebhtml/ray
commit bdf49a2d60b5f1588f10d07b6aa972a89c4bb907
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 16 16:10:06 2011 -0400
Fixed an integer overflow in the computation of standard deviations.
commit 53eb012a25fb6ddc476e4e107dd6bc257d347cef
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 16 15:29:15 2011 -0400
Fixed scripts to accomodate new prefix directory option.
commit 2828d85c2ec500b2faa13ae66734717a686ab418
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 16 13:16:10 2011 -0400
Added more debugging information in the scaffolding test.
commit 2afa3cf2984c5f243a60a0b8d0d31ec763bba5e7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 16 12:18:43 2011 -0400
Updated for ScaffoldLinks.txt format to v2.0.
commit 5cd984807c810ad427dc28daac267d7d69b609cc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 16 10:39:40 2011 -0400
Added some documentation for Infiniband.
commit 1dab4e3ae0ae858d7d47da305dad6a9d4ce9202a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Sep 15 16:21:45 2011 -0400
Restored the default number of words in the network test to 500.
commit 21e312c058445ab6175fedd565371948afc16a6f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Sep 15 14:55:45 2011 -0400
Modified some scaffolding code to obtain the correct side of a contig when it allows both.
commit a90856719c1ffa348f0684549d61601255d419af
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Sep 15 13:47:04 2011 -0400
Implemented a new greedy scaffolding algorithm as discussed with François Laviolette.
commit 81be6d9758b29c4bbc8534d59047cefc5a588df9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Sep 15 09:16:02 2011 -0400
Added the standard deviation in ScaffoldLinks.txt
commit 32646f2a50fcef5a7a2d6d24bcf2a4f61dec3336
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 14 19:27:49 2011 -0400
Added non-persistent MPI communication just to compare.
commit 06c7695cd843fba21f83bd246bc3507961572f80
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 14 17:42:29 2011 -0400
Added information in ScaffoldLinks.txt
commit f0fcdd37eb820bf77a36c2a8e3ba807aacd8c8a8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 14 17:29:32 2011 -0400
Changed the default message size for network testing.
commit eb9f8c7200f05f9c3b394f4929b414330ec5aa43
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 13 17:32:52 2011 -0400
Limiting scaffolding links to vertices that have one parent, one child and a coverage value near the peak.
commit b5a98d257d9fcdba8a2f650f67b541c7b9c62ca8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 12 13:24:54 2011 -0400
RayVersion and RayCommand are now written (a bug was introduced).
commit 8dc676617789e619c86d15c68beb7f32e4e1ff14
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 12 13:15:48 2011 -0400
Fixed the code that counts the number of extended seeds.
commit 862b5fcb7177b8c4440d0ab301b89d1a5616089b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 12 13:07:16 2011 -0400
Added option -write-contig-paths to write contig paths with coverage values. This is enabled by default.
commit 1db286541173fd8c5f393c2c331c86c03bc4fe9a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 12 12:39:24 2011 -0400
The checkpoint ContigPaths is now fully operational (read and write).
commit edbfcd77ccf4872988d272de4dba79659854edd8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 12 11:34:10 2011 -0400
The checkpoint ContigPaths is now written on demand.
commit 9150bc1a855194024e6d6ebdd8de8b1a89b12dd7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 12 10:41:24 2011 -0400
Removed the minimum number of raw scaffolding links.
commit 77e4a01479289e35346f76a1bb3b42467289d8a8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 12 10:33:11 2011 -0400
Modified the scaffolder routines to check the vertex coverage values in paths.
commit 18edfd0056be312f99c43a0c39357d36dde860d3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 12 10:04:33 2011 -0400
Fixed the content of a displayed text in the fusion task creator.
commit eaadc7c76b4ca748c93c34d6e5dcb50e566a8c3d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 11 21:59:03 2011 -0400
Modified the Sun Grid Engine job template to erase the directory before running the whole thing.
commit 672b5f3861e8c77772ab31a02cbf6f1ce0bd9231
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 11 21:35:22 2011 -0400
Changed --oneline to --pretty=oneline for compatibility with older versions of git.
commit fdad4e946086f7cd6f7fad84a9031a74f9d22699
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 11 21:28:03 2011 -0400
Cleaned some code in the task creator routines for edge purging.
commit b9fe00bf8b930df2344cd2b3ffc99f663abd20ca
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 11 21:27:12 2011 -0400
Cleaned some code in the task creator routines for edge purging.
commit e6a4fd888cd4fbf634b2733c43af94f7ab51a543
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Sep 11 21:25:37 2011 -0400
Fixed a bug in the virtual processor wherein it was not force-flushing messages when needed.
commit 32c1384d80110927c925d6e76883c4a065c825fa
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 10 21:50:09 2011 -0400
Corrected the number of flowed vertices in the seed extension.
commit 6538859dce0eef9da75c2fbed27475dd21df2421
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 10 21:49:36 2011 -0400
Improved heuristics for selection.
commit 221e7b4d36fa5d401052a6f0f5d2451eb04434df
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 9 11:03:29 2011 -0400
Implemented the reverse strand case in JoinerWorker.
commit 2754a549ce745f213cb87d5fb14100f32f05589e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 7 09:48:54 2011 -0400
Added 3 unit tests for NovaEngine and improved the heuristics.
commit f704b0f000d437fc026105531168c49313f988c3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Sep 7 09:48:12 2011 -0400
Corrected positions in JoinerWorker when on the other strand.
commit ef069305f27107060d6bad9f7221ac50092367a4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 6 17:25:36 2011 -0400
The default is now ASSERT=y in the Makefile.
commit e77388e7926d96f76dec6d8be998fe87d4150313
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 6 17:13:44 2011 -0400
All output files are written in a directory provided with option -o.
commit e5f0ac76d6084b35da248d14cebb2b91b8e7792b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 6 12:02:43 2011 -0400
Joiner software stack now joins otherwise un-joined paths in the distributed graph.
commit e53c0cf9289d55d323d4bd5b7adce70e78b34f8c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 6 11:33:51 2011 -0400
Now printing hit information in JoinerWorker.
commit 3d49b7140bd00159e08cd4e0e975fc8f74ecc43a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 6 10:22:18 2011 -0400
Added selected hit in standard output for JoinerWorker.
commit 1ef78fb2cdc47b32996087343cb515b53757eccc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 6 09:42:49 2011 -0400
Updated a threshold in FusionWorker.
commit 9595b0d36e58c932ac3e3693fdf35982ad55ad74
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Sep 6 00:01:47 2011 -0400
Added debugging information in JoinerWorker.
commit 441d133a4f95b9b7ed119292928a0493efb60758
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 5 23:02:02 2011 -0400
Added Joiner code.
commit b3b8dde9ec6626c1f178e2bce382b70df29849d4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Sep 5 21:14:53 2011 -0400
Disabled the reverse-complement copies of extensions.
commit e42c2d104c8c1acc95974cae8c8ef8c6503e9720
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 3 16:20:34 2011 -0400
Workers push virtual messages, not real messages.
commit 80d8fc898becdfa9a5c2f14a94922e583738d6b5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 3 16:07:14 2011 -0400
Fixed a state-machine bug in TaskCreator/FusionTaskCreator.
commit ae4af42f24cf3d836a6bf46f7391502d10a186d5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Sep 3 08:32:39 2011 -0400
Fixed a machine-state bug in FusionWorker.
commit 15fc7d1f8433a6da430cd94481175223d013e46a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 2 16:47:36 2011 -0400
Added an AUTHORS file.
commit 6a5954b6dfbfe1d79d978bd984ce8b53e39980df
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 2 14:29:47 2011 -0400
Changed the default algorithm in VirtualProcessor -- now using a minimum work unit.
commit 3cbc5fd5f5008c73586b488473d2495f9551d845
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Sep 2 12:53:44 2011 -0400
Added some debugging information for FusionTaskCreator.
commit 45280ff505934c2d896ebe15c963149b3188e20e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 31 20:04:04 2011 -0400
Removed OperatingSystem dependency in unit tests.
commit f778c5b28b81d4076cc7304b2375102a91c3310e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 31 19:46:17 2011 -0400
Implemented a new better and simpler merger module -- FusionTaskCreator/FusionWorker.
commit 57753e7a30bff6449855562bab09b9049c76bdab
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 31 19:45:28 2011 -0400
Fixed some unit tests by moving scaffolder methods.
commit 84656aec73b9536efda3b0155f20e56791328fb4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 31 11:53:12 2011 -0400
Using the VirtualProcessor for edge purge.
commit c801302b4d2b594b9c968dee254c7fffdc75292f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 31 08:09:52 2011 -0400
Added some debugging information for fusions.
commit 53085bbd7e7bf19b0b2129abfb93ef753ee2d9f9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 30 20:48:46 2011 -0400
Restored worker codes.
commit d05a902fbcf6bfdc381ec34ca6485ffa0a8b7b6d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 30 16:48:26 2011 -0400
Added interface Worker for worker classes.
commit 3547950e1b7aba5d1af0c1f4472ee86edf40acab
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 30 16:34:34 2011 -0400
Added method hasWorkToDo to VirtualProcessor.
commit 75f29f15be41c6b09b99030ac766f3b57da30b3d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 30 16:34:03 2011 -0400
Added debugging messages in FusionData.
commit b826e68e8edecab9e99ae745373ae0dfb4226e9b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 30 16:33:31 2011 -0400
Added TaskCreator and Merger classes.
commit 173a2f3753279a1a0a4e0707ef3886171ffbd6b7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 30 16:32:12 2011 -0400
Removed hard-coded parameter -debug-fusions.
commit 778e0d20ae0e3202f984d0c57efda83900f86dd9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 30 13:53:07 2011 -0400
Changed the maximum number of cycles to 16 in merging code.
commit 10d33466bf5b5bf7077539466fc57c45645c38ee
Merge: 1048b06 45ecca1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 27 09:48:09 2011 -0400
Merge branch 'master' of git at github.com:sebhtml/ray
commit 1048b06d9454965ccc5a46a04ef1f9ac9bc40b77
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 27 09:47:08 2011 -0400
Added scaffolder cases in Documentation/
commit 45ecca10f14cc842b0a6807eb05439dce5fadff0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 26 23:16:26 2011 -0400
The ChangeLog file will not be maintained anymore, use ./scripts/dump-ChangeLog.sh
commit b01fe11936808c77bafc419ca21f5126912ec547
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 26 21:37:04 2011 -0400
Added option -version to Ray.
commit 58e1a6d336cb137e749a24b5f48cf96800faad57
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 26 21:36:29 2011 -0400
Modified the behavior of Ray when fusions are generated.
commit 26ee55488603a2acf01ff7e4137b68c55733ef3b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 26 21:33:06 2011 -0400
Updated the path to Ray in system tests.
commit c920e1e6ce19c14daf7ba6f5ec5a2ca785eb7f47
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 26 18:03:55 2011 -0400
Fixed a compilation warning.
commit db6b8d3e981f3719ccf6bc31f2dee5227a21e183
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 19:00:33 2011 -0400
reset() must be called in the constructor.
commit d946b2990dbd0d022e9552dee48177301f89cc3e
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 19:00:22 2011 -0400
Fixed compilation warning.
commit 8200a280ff0e686be08eec68a865f66f4d054ac9
Merge: 78af599 7dea079
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 17:53:58 2011 -0400
Merge branch 'master' of github.com:sebhtml/ray
commit 78af599fec1593d28bd2b674395dacf9111a8755
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 17:22:19 2011 -0400
Adding new files in Documentation/.
commit c6fb5d0bd50e735f81490e1aca44009dd1d8d1a7
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 17:05:03 2011 -0400
Added INSTALL.txt.
commit 151028b002c4ca9d979f0b706104fb33ca1af75d
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 17:04:34 2011 -0400
Migrated some code only utilised by the scaffolder.
commit 345d267fe4991e0cb46d59a8c703584832e4e8ed
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 16:44:59 2011 -0400
Added \author tag to all classes.
commit 952e1a2aa1e726917ba487314dceedadd7c80957
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 16:33:04 2011 -0400
Updated Documentation files.
commit 068ce0e8a3bf853db900ef0565d299e1a485c06d
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 16:12:51 2011 -0400
Added VirtualProcessor initialization.
commit 8a2be4aaf93c696fbe5e3325b21c475a1c544f7e
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 16:02:27 2011 -0400
Removed MyForest and its iterator minion.
commit 4eebe61ef5724a1eb7d521c9471357db5e77b5ef
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 15:54:09 2011 -0400
Introducing the VirtualProcessor class.
commit 4897465189a4ce8477acf590f1036598c39fd153
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 15:53:38 2011 -0400
Fixed compilation warnings for 32-bit systems.
commit 91799e1d3e1b65b009c4cdae7f1df5284d49f4b4
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 15:41:40 2011 -0400
Fixed an argument name.
commit 10391288da0b551a0f8f416ffece47231b922178
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 15:39:39 2011 -0400
Added documentation for the network latency.
commit f11cb161523991dbb7ffdba8b007b288de81bf04
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 15:39:14 2011 -0400
Added documentation for the virtual processor.
commit 8152dbb741a784c09fa0291f5de26b4f27f65c93
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 15:39:00 2011 -0400
Added documentation for the virtual communicator.
commit 7e04a0a909cc9c644936d35f106069cd6ea31dec
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Thu Aug 25 15:25:46 2011 -0400
Fixed compilation warnings.
commit 7dea079e6ca225a07e945bdea65bce9b0a350c32
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 25 08:00:40 2011 -0400
Added a function to create directories.
commit 70c8e928dc8bc136f4e64d85acaf14c377b93187
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Wed Aug 24 20:50:07 2011 -0400
Changed where is written the binary Ray.
commit b14a5b770d1c3acf86327544c1cecb067de9295d
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Wed Aug 24 20:37:45 2011 -0400
Removed the manual target from the Makefile.
commit a5ff5c4be1e11522b84e080f329124abde675fca
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Wed Aug 24 20:36:43 2011 -0400
Added a Documentation directory.
commit 6b6fd7c40cd05cde4ddd9a1c74ff0b34eccbf29d
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Wed Aug 24 20:30:30 2011 -0400
Removed logo from source.
commit fa809fa7cd098ea791e5b62211a09f1ac4123065
Author: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
Date: Wed Aug 24 20:30:09 2011 -0400
Testing symbolic links.
commit 6a290cee1d2fa490dc03819a927f9a478c549ff7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 24 20:22:35 2011 -0400
Added additional debugging information.
commit b6aa616ae664c05033abaf5fa6c140cbeb3f1045
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 24 08:33:30 2011 -0400
Restored original state.
commit 7f8708f9f8e0641f0fbd1b7fc63fe0ca59262fa7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 24 08:33:13 2011 -0400
Added an explicit flush.
commit 1a11ee5acf4c511e6762efaafe8bf5e22e7b4ec7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 24 07:12:55 2011 -0400
Added checkpoint Sequences.
commit ffef055d3826d5a13a2139f9a5d6354bf2479d2e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 24 07:12:39 2011 -0400
Updated the ouput of -help option.
commit 89ed32bad2f6de1cd31d65776300e53ac089f582
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 24 07:11:53 2011 -0400
Added option -debug-fusions.
commit 5e093886c5f477ad798846d930c3bc43279d1b73
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 23 16:07:08 2011 -0400
Updated the MANUAL.
commit 797baefd407049d3a724a8964e99e4256354ec15
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 23 15:28:41 2011 -0400
Added -read-write-checkpoints in the changes.
commit d15a0caab2979c1b95e9937882fe9b667ba320b0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 23 15:28:22 2011 -0400
Added gmane link in the README
commit 98dbbd4435105445ead722d74ea7a4c7f0a6469b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 23 15:17:25 2011 -0400
Removed unused scripts.
commit 003473033cbce29785523ad8ce76843f4bc9ebcd
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 22 08:48:48 2011 -0400
Skip a seed if within it during flow 1 and a vertex is already processed.
commit 37aa1ff25d1cf5a07557721693b4fff5e44b1cd6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 22 07:42:39 2011 -0400
Limiting seeds to probably unique vertices.
commit 03cb71f1c011debe3e1e68352639a80bd37baae0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 20 23:20:58 2011 -0400
Don't write a checkpoint if it was just read.
commit dcf3eb68ae854096e9d8351a90a463fb36194a7d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 20 23:20:15 2011 -0400
Added a file describing checkpoints.
commit ee971f53b1488e5f2fb63dd87a50707299ddb4e2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 20 23:19:51 2011 -0400
Read checkpoint before writing it.
commit aec738a90e70b14298ddc1e779f620e0c0e07131
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 20 23:18:49 2011 -0400
Changed 1 hash function because it was a copy.
commit 6c4fac96b8a0e45b428a2cc1fc5242ca41d500f3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 20 18:50:58 2011 -0400
Fixed a hanging problem.
commit 0094fbacd831b3fe44e2b71c80fefb16ca15f9ce
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 20 14:32:54 2011 -0400
Added checkpoint Extensions.
commit 5dd54700ab9fc6815b672ace3904db452e086242
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 20 10:40:10 2011 -0400
Added checkpoint Partition.
commit ddf21253a810e52cab48cee02d94a19d98d48ba0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 19 14:10:40 2011 -0400
Fixed a bug when no sequence files are provided.
commit 5a7b56e85ad01e5ddb2d5504fc7e4e20eea0f28b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 19 14:10:05 2011 -0400
Improved checkpointing message.
commit a6596ea20aa3eb8fd73e526a55796aa7392f6b27
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 19 14:09:41 2011 -0400
Added option -test-network-only to only to test the network and return.
commit a72d0ec2d80dec135fe197d3cc19ab1363eb6346
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 19 14:07:30 2011 -0400
Improved checkpointing messages.
commit 6d29d438ad9bc9c94579453ac0cc32aa423b5777
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 19 14:06:43 2011 -0400
Fixed a messaging bug occuring very rarely.
commit e2a2bb6719a347b4a499283690491429ba3b67cf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 19 10:57:03 2011 -0400
Added a MANUAL file.
commit 218546f8b4dec399faaa65157e740f0dd8ff07c4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 23:00:52 2011 -0400
Checkpoint files are now written in a binary format.
commit f63590acfd8f129f94c56d2476e8a2a0470547cf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 22:21:00 2011 -0400
Checkpoints are now operational.
commit adf722268c218e6b52458588609b14f4e6885b78
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 21:33:52 2011 -0400
-read-checkpoints works with checkpoints <CoverageDistribution>, <GenomeGraph> and <Seeds>.
commit 890ba118a5ebeed9663d960efae717486208c0f0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 20:00:21 2011 -0400
Option -write-checkpoints writes all checkpoints.
commit 4822527505c6212012beeb34f2e6a1edff241c61
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 17:44:16 2011 -0400
Added options -read-checkpoints and -write-checkpoints, this is still in development.
commit 23f721826bffc3d0eee8136158871e380abbb96e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 15:24:54 2011 -0400
Preparing code for a change.
commit 60d1ebe8e44a22c416ac6f87c3de4bf9c1b72734
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 13:58:46 2011 -0400
Reduced the number of messages with tag RAY_MPI_TAG_REQUEST_VERTEX_COVERAGE in SeedExtender.cpp
commit c510d9694bb148d9a3bc329d5adb4ab74ef89986
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 13:36:02 2011 -0400
Added tag counts for option -run-profiler.
commit 63beff405ad792e5dc28c4b59a3d832847da8131
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 13:07:34 2011 -0400
Fixed a display problem.
commit 1e3490f497ce74f66d716e8fdf6733cef0606da5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 13:05:11 2011 -0400
Modified the order of the steps performed when merging identical paths.
commit 5fc8c1347f7192a60ad0581496dda7ed2e5d9a37
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 10:57:43 2011 -0400
Changed the prototype of VirtualCommunicator::getMessageResponseElements.
commit 237339a926c29c2d85df5282b6484d22dc132b78
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 18 09:28:15 2011 -0400
Only send a RAY_MPI_TAG_ASK_IS_ASSEMBLED message if starting on a seed on flow 1.
commit 6fa20a901b2384b18f522b6091b1d778814583e6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 16 14:49:50 2011 -0400
Don't fetch read markers when not needed, use less memory to know is a vertex was assembled.
commit 7c2a0840356ee1b8cfdd506d315ef39eebe324d2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 16 11:13:49 2011 -0400
Added skipping events.
commit d4e5a25cb6f4c390d7ef10f34ef375b45cda401d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 15 18:53:18 2011 -0400
Fixed N50 when there is only 1 scaffold.
commit c17c1fdc7ae7a8018fd74c873b89f4d557eb514e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 15 16:19:04 2011 -0400
RayCommands file is written correctly now.
commit 3ece690db5161e6be61c6c4d3cb4a8b2307db277
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Aug 14 21:40:27 2011 -0400
Ray merger will merge more things now.
commit b6e342c79a90bb403c4d00601a1a727a53d2221b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Aug 14 21:39:55 2011 -0400
Fixed a segmentation fault that occurs in rare cases.
commit 6208303a3c67fe7a488b863e8c2c4c3e233cca67
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Aug 14 21:35:47 2011 -0400
Fixed a bug in the scaffolder, now more vertices should be investigated.
commit eb13301270dc5bb775ebee520031f91e90909da6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Aug 14 18:41:02 2011 -0400
Changed the precision of things that go together.
commit 0f78f4edc5b9bc53861df1fb94ed51cdf6d58ebb
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Aug 14 18:40:38 2011 -0400
Fixed which arguments are picked up by opcodes -p and -i.
commit dd5c7962a3e5ee69d9d6c8c177e7f0ed2f05e331
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 13 19:05:34 2011 -0400
Input opcodes are now shuffled before being utilised.
commit dbba521e9fb1f9bceb46bf59c346c61b5aeeb230
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Thu Aug 11 22:46:11 2011 -0400
Added some documentation files.
commit 40d1d8a90cdfcfcf20deb7415399bd0b29ccfd73
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Thu Aug 11 22:46:02 2011 -0400
Fixed a bug.
commit 44d2bc88f97674410782d33df6fb148bbb158566
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 10 20:21:50 2011 -0400
Extension of seeds if done endlessly until growth stops.
commit ac01c27c419ee92251ded5150b941cb22ea91dac
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 10 12:56:06 2011 -0400
Modified NovaEngine to pass a new unit test (as well as the old unit tests).
commit f23b52dec11f769ecd074c6c5e408093bdea8c6d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 10 10:52:01 2011 -0400
Changed the default number of persistent requests.
commit fe05cee625edae7a8c68b5d9b6b57b766fa7c451
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 8 16:48:46 2011 -0400
Added list of working C++ compilers.
commit 6a1854a3c0508d4bc6f0ed4bde43bcf1a8ac2621
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 8 16:44:34 2011 -0400
The paired read simulator is now a separate project, see https://github.com/sebhtml/paired-read-simulator
commit 6ccac7ad5a583793b5a87905c271ecf4dea16ce5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 8 10:04:41 2011 -0400
Flag invalid choices before doing the actual selection.
commit 82f6107a7071b139e30d7ae174a062fc796e7527
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 8 10:04:15 2011 -0400
Fixed a compilation Warning.
commit 5a99139f2662119d97b921ede7a532ae18152675
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Aug 6 18:36:34 2011 -0400
Fixed a integer overflow.
commit c63ba4af027fa99d50be3c6eb84102aeaf4d9c9a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 5 11:46:01 2011 -0400
Fixed a compilation warning with gcc.
commit 0d1aab0d168fbdee01a55b8d3e680b832db151df
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Aug 5 11:30:41 2011 -0400
Fixed a compilation warning with Intel compiler.
commit f84d308cbfe613a744417ccf1193def5623b3642
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 4 23:08:07 2011 -0400
ExtensionElement objects now contains reads in 2-bit format.
commit ec0f6d1f7f1573bdfa0e0a3d7fc3b245c4c4583c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 4 21:45:15 2011 -0400
Fixed a memory problem in the computation of optimal read markers.
commit 5a7c941d1cc70cc0003ba74cd21d5f1d916057c2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 4 20:44:33 2011 -0400
Implemented a Bloom filter to reduce the memory usage. This is ridiculously good and
the false positive rate has no effect whatsoever on Ray thanks to the KmerAcademy.
Some of the k-mers occuring once make their way in the KmerAcademy thus by-passing the
BloomFilter, but they are very few and they are just avoided like plague.
commit 27f24d535a45967ae16eeea6b095b2357f237e09
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 4 11:57:57 2011 -0400
Added a few things in the README.
commit a1233c0213c61a1301d0eb4153d5676a74ec6be3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 4 11:56:30 2011 -0400
Fixed a recently introduced regression in heuristics (should not choose an invalid choice).
commit ed67f2597331b144fa82b90c308844950120902a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Aug 4 11:48:24 2011 -0400
Updates in the README.
commit 83f0e0a1f823fcb0d1b0a4c295c949d83ab3a2f0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 3 16:04:07 2011 -0400
Fixed the maximum length of input reads to 65535.
commit 8354455661531deed44eb02128fb15885b4dbcb8
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Wed Aug 3 13:39:46 2011 -0400
Fixed a compilation errors due to the algorithm library.
commit e6c66af9d0387bdca1be744efd978b982adc1d6c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 3 11:30:59 2011 -0400
Added N50, median, average and largest contig and scaffold lengths in PREFIX.OutputNumbers.txt
commit 1aac7a6a08e228ed979a6b9c969f7daf816f0692
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Aug 3 10:42:34 2011 -0400
Removed the coverage threshold from the algorithm that finds seeds in the distributed graph.
Suggested by David Eccles(gringer) from Max-Planck-Gesellschaft, München.
commit a6244b09bbb4e2a72fc14f4182cc65ff4a6348b0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 2 15:33:32 2011 -0400
Modified the selection engine to that the new unit tests also pass.
commit 081170763630912d18d995f0a4f8b5902f13ab47
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 2 14:30:49 2011 -0400
Removed email of contributor.
commit 91f32510f83b13697dc37f45e8ef25999cfbf12c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 2 14:30:03 2011 -0400
Added David Eccles in the README
commit c9aa3729d85795194794a99d35740d0d9e9c6d39
Author: David Eccles (gringer) <david.eccles at mpi-muenster.mpg.de>
Date: Tue Aug 2 17:20:38 2011 +0200
fixing a segfault when no contigs are found
Signed-off-by: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
commit 798f26244dbbeb7be28c614eccd73483124b881c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Aug 2 13:35:07 2011 -0400
Added debugging option -show-distance-summary.
commit 34d1af25636d839d8b6ef376c29aa120fd916bf8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Aug 1 13:50:33 2011 -0400
New development option: -show-distance-summary.
commit 8ffee2bece692cfc5a69e7ed5c57e7890313b792
Merge: 29ab020 454d5ee
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Sat Jul 30 20:03:36 2011 -0400
Merge branch 'master' of github.com:sebhtml/ray
commit 29ab0207f4cb51d68ff8207d30158b5494ed540c
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Sat Jul 30 20:00:40 2011 -0400
Fixed a bug in the incremental resizing algorithm of MyHashTable.
commit 454d5eefd13276a1579d0c47cf67f5d0354e7636
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jul 30 14:36:59 2011 -0400
Added a test for open addressing.
commit bacc0c70776c596192127de0228d625cdff75300
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Sat Jul 30 01:01:07 2011 -0400
Fixed comments and assertions for new correct code.
commit d48fa3347427ce58dda00a4706e361fcef5460c7
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Sat Jul 30 00:48:38 2011 -0400
Fixed an implementation bug for double hashing.
commit bffce621e177c09c93fb8d302cc47e1945f44a43
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 28 16:33:13 2011 -0400
Merging of similar paths has been modified.
commit 3b83d6c0b81e477a8ad9e8768d08f88517f7f8d0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 27 18:36:08 2011 -0400
Added read placement freezing.
commit dac7de58e93e7473435027ea31c920a0e14a4f84
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 27 12:46:10 2011 -0400
Modified the extension algorithm to avoid collapsing of repeated k-mers that are near each other in the genome.
commit c66713367578d903f27d62358d58f430b5c9b4dc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 26 16:11:31 2011 -0400
Added a unit test and fixed NovaEngine to handle it.
commit 7a3443cf4af35263c80c10aab8d20d2d6c0b81de
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 26 14:52:46 2011 -0400
Improved the manual.
commit d84236002fac7fdb90d1e35f8a8b17ed8e17575a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 26 14:25:51 2011 -0400
Added a section on how to launch Ray in the manual.
commit 9c449be541b9178ba1adaf348b6236ad7ef2cca7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 25 23:47:41 2011 -0400
Fixed a compilation warning.
commit 182fe2c9de809cb51421358026b20934a84f2559
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 25 19:05:00 2011 -0400
Added some unit tests for the Ray NovaEngine (for mate-pair reads). Seems to work quite well so far.
commit a5e631bef196687a46eb88d31bb60eb891812449
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 25 19:04:24 2011 -0400
New option: -write-seeds which is useful for debugging the code.
commit 190263610f8505afe976553c72410b309c72bf74
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 24 07:56:35 2011 -0400
Only use NovaEngine when paired information is available.
commit 91359b051cc12d68bda13d6cb46489ec0005ae7c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 22 15:17:57 2011 -0400
Added options -use-NovaEngine and -show-NovaEngine for debugging purposes.
commit 8bc58aa853ebe2da3544eb2c1af40b487ccabafa
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 22 13:44:25 2011 -0400
Fixed compilation errors with HAVE_LIBZ=y and HAVE_LIBBZ2=y
commit af7557e31426a2cd86a1ab4018271682397febf2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 22 12:00:13 2011 -0400
New output files: PREFIX.SequencePartition.txt and PREFIX.NumberOfSequences.
Improved the content shown with -help.
commit 9598fda30edecaf419ff48e1b271a4c0bf471a34
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 21:41:28 2011 -0400
Now using the NovaEngine.
commit ddeca62a224c8971aedd071ab978487947820d33
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 21:31:05 2011 -0400
Fixed a bug in the NovaEngine.
commit 13e5e7651dec982575f80257b1a62fd96520ff8a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 19:49:21 2011 -0400
Removed by default the reporting of libraries in stdout.
commit 5e5edae264daef28a4ed01f0132cd8c3c9a36d72
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 17:57:13 2011 -0400
Option use:NovaEngine enables experimental NovaEngine.
commit 73c61bde7389be95c0d1ba7816ac2b9d8122fc97
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 17:54:36 2011 -0400
Fixed a bug in the recently introduced peer-to-peer parallel Partitioner.
commit 0bbd8d31159bbe131f848a25f6b01a6abd7ebc7f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 15:32:17 2011 -0400
Removed options in 2 system tests.
commit 1c53c6ec3fe5f2e1257646e2c6cc25c386d369ea
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 15:08:06 2011 -0400
Added comments at random places.
commit 3696be0ea0d8b27f3f54a279e1d4254528cd1cbb
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 14:47:28 2011 -0400
Added 2 scripts for code editing.
commit 1c135af29d2caf6a8b60a232716a95652e573441
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 14:31:37 2011 -0400
Disabling by default the experimental NovaEngine. Results so far are promising !
commit e1efa6e8dc032a6dfd759f3baa8ceb6f8a3f1663
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 14:31:32 2011 -0400
Fixed a compilation warning.
commit 3fe9fab9c3faf9af8ad5ff21f0ab69cdb869f126
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 14:28:24 2011 -0400
Removed roughly half of the messages with the MPI tag RAY_MPI_TAG_KMER_ACADEMY_DATA.
commit 4b3639fb7b643c8d1280a24c2580851c84eda0cb
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 12:26:29 2011 -0400
Added a unit test and modified CoverageDistribution.cpp to handle low-coverage datasets.
commit c9e8a5e5b827cf9d7a12b7b71f7b9b73423ac48b
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Thu Jul 21 11:52:50 2011 -0400
Added a TODO item.
commit b76e9dde17fb06b5a8541f0d3c6338f5e0e70c95
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 10:58:16 2011 -0400
* Added information on unknown nucleotides in the instruction manual.
Suggested by Walter Eckalbar from Arizona State University.
commit 9847b9e130aa212fe07b26f195d25c71e1fe2afd
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 10:38:03 2011 -0400
Added a TODO item.
commit 20ad18fc5fed4dca9b5fb5e84ae273b030838c96
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 09:45:28 2011 -0400
Added an abstraction layer for the operating system.
commit 970660341b69b90f6e70ed59e11ab9f5a8ac243b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 08:22:08 2011 -0400
Improved the README for system tests.
commit 437284549e9c86325476ddcc929aae1a46f64e5a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 08:12:42 2011 -0400
Only show nova choices if -show-extension-choice is provided.
commit 67a87edd53428b8f1062fe6510c35e6d946b252e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 08:11:17 2011 -0400
Improved the document about patching.
commit 231dbc9877bea5c7f17f013b8858d263d07990cf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 07:32:52 2011 -0400
Added a file describing how to submit a patch.
commit 88b13a0d4495b0a94751f3d1803e35683519fcee
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 07:21:04 2011 -0400
Unit tests are now files named test_<test_name>.sh
Instructions on how to add a unit test are in unit-tests/README
commit 43200b54f9e19c6938bff2cbb9836e8898ec8ce9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 07:21:00 2011 -0400
Fixed a typo.
commit efda9d92a59d51468f650979bbf644537e2eb6b8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 21 07:07:16 2011 -0400
Moved Kmer routines in the class Kmer.
commit 207a1930312e8c69c3c8ade5f0abc76b3a86a2aa
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 20 21:57:46 2011 -0400
Added an entry in the changelog.
commit 19b3905abfa2213ac934d9ddcf31956f41b50504
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 20 21:01:40 2011 -0400
Added a symbolic link.
commit f7addb41b59aaecbf946abb70b6d0a5b3af539c4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 20 20:57:23 2011 -0400
Added 35 unit tests.
commit e704aa19483b46191616df701e2aaa353262715c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 20 20:56:17 2011 -0400
Simplified the algorithm that finds peak and added 35 unit tests to test it (for various datasets).
commit 1a8b0e008264bebc3a567e862ea0ec4aa95d8f3a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 20 14:02:21 2011 -0400
Improved the NovaEngine according to unit tests.
commit 412052b26f2ccec90bc2f3c8eb032e38bb335e11
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 20 14:02:02 2011 -0400
Improved the unit tests for the NovaEngine.
commit 862e6dd08af92973a66ebff276f8750093f5423e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 20 14:01:37 2011 -0400
Removed some messages.
commit 1bd4d5ab059fa33598a9bfe99b06d434a3d6da8f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 19 19:37:45 2011 -0400
Removed assertion.
commit 4471c3744aeee9d037faac6b6cd94e81031e2c55
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 19 13:56:03 2011 -0400
Improved the NovaEngine, but not using it yet. It needs more testing.
commit 668ad2f89ee64e8c0e8a930c9197efe8046f3954
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 19 09:52:49 2011 -0400
Added a unit test for the NovaEngine.
commit 9c8b02dbd1d1e4f9f785fab4200c00d608397587
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 19 00:11:16 2011 -0400
New experimental heuristics: The Ray NovaEngine.
commit 1ef868dda82840ec444041cdd2cb6632bdf0c950
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 18 21:55:12 2011 -0400
Created an heuristics module and moved related bits in it.
commit cd8c1af92340405ec4a63dd64f438ad27d6c16f4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 18 21:43:12 2011 -0400
Improved the peak finder when there is no deviation.
commit 8549758915992f3867d8a9bffe9da006ccd10ca7
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Mon Jul 18 12:31:17 2011 -0400
File partitioning is now performed in parallel.
commit 9825ecf0f53201a7f519ac8b4ec01edc22f077f0
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Mon Jul 18 12:07:26 2011 -0400
Implemented parallel file partitioning.
commit 15ea481aec567b2f1f7af808cc9a54db063512b9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 18 07:16:57 2011 -0400
Fixed a compilation error.
commit a2470f21640e1c91c68807b9c1adad4d7519b8b7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 17 21:03:08 2011 -0400
Moved the configuration of the virtual communicator in Machine.cpp
commit 810187dc515cc929eca227c72c1a28885161c4f8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 17 20:09:40 2011 -0400
Corrected a code comment.
commit 982ff04d2ce181b842a7345e13a9ff68e8e85d75
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 17 19:51:42 2011 -0400
Updated the coding style.
commit f7d9087d2b576fd9436c664d9e0a87ef6b0f10d6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 17 19:49:25 2011 -0400
Added a coding style file.
commit 3f15314e17f1307999ca253ff1e18bd5abeb7d83
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 17 14:21:26 2011 -0400
Don't compute or update peaks for libraries with manually-provided information.
commit d38617321a3155d044d7d18ebcb0b96712c0f5c5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 17 14:20:30 2011 -0400
When the extension is finished, show library peak usage.
commit 952dfb80e5e3f6e9c93d9759c29499d4040d7ce2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 17 14:00:28 2011 -0400
Don't print the tree.
commit 5a49add9a93f56f918c243162e2e5d6e004879c3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 17 13:49:46 2011 -0400
Changed to 64 slots.
commit 8c15d793cec8c3f1f0b376ca9ed23b6481849521
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 17 12:38:13 2011 -0400
Corrected the peak finder.
commit fdc1bde4ac6c4bfe188912022cabdabf8fd5d780
Merge: 2b5f716 4a4b739
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 17 10:32:35 2011 -0400
Merge branch 'master' of git at github.com:sebhtml/ray
commit 2b5f7165ebb83d5df863f1d8bb1d59b38c78cac3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jul 16 20:59:04 2011 -0400
Changed the behavior for repeats.
commit 4a4b7394ba8518c1a3286c22fb4bedfd0734bb4c
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Sat Jul 16 16:59:28 2011 -0400
Don't set NSLOTS if already defined.
commit 0d6565e0e7e5d863ae9bad121857137bf57bf4ef
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 15 23:50:51 2011 -0400
Fixed a system test.
commit 857c2072e1fe5d069266d088400702b79e90f39b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 15 20:10:28 2011 -0400
Fixed some compilation warning with gcc 4.1.2.
commit d652a1ccbf044b144ecae2101ac83a44ce23ad2a
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Fri Jul 15 20:03:34 2011 -0400
Now Ray uses the maximum peak of a paired library to compute the expiry position of a read.
commit 065df3a4b0f54c897fc6bf731c14ed332ed4dc75
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Fri Jul 15 16:00:04 2011 -0400
Choosing the good peak for a paired library if a mate is already available.
commit bd324ea98e2a8307dd1c295083237b09e10c2da6
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Fri Jul 15 15:23:13 2011 -0400
Now selecting the correct peak to choose the next vertex.
commit 7a72aac43c95c60ae8ad8925ed218bfa06a04d6b
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Fri Jul 15 14:38:14 2011 -0400
Ray can find more than one peak in any paired library.
- Some work needs to be done in SeedExtender.cpp.
commit 7d92f0697b835dea8fa6748f2f51509b05321e4a
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Fri Jul 15 11:10:24 2011 -0400
Ported the prototype for finding peaks from Python to C++.
commit 4bb20bac3ba5c3013824b3836bf1f90ece0d93a0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 15 09:13:32 2011 -0400
Added an entry in the change log for 1.6.2.
commit 5fab076c9b14bffe6cb2cce13e8ad7257ad9c7c8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 15 00:28:03 2011 -0400
Now working on v1.6.2
commit 630d7620c9472b4235cc1d02134125ec6ed5d128
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 14 23:42:34 2011 -0400
Fixed the command in a system test.
commit 4838ccaa33b8cc6f2308d10f6d31c25fd68b93ab
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Thu Jul 14 15:18:58 2011 -0400
Library caller prototype works well on all 3 Assemblathon 2 datasets without worrying about persky adaptors, thanks to Optimal Read Markers (TM).
commit 753046d1af054a740e499d0ea93d605a2745b110
Merge: 20f6df7 eab5862
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Thu Jul 14 13:40:17 2011 -0400
Merge branch 'master' of github.com:sebhtml/ray
commit 20f6df74da5c792cffd446755795931cfd1e9953
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Thu Jul 14 13:37:15 2011 -0400
Added a working prototype in Python for calling library peaks.
commit eab5862978ef5ec22f27bc06705337a7f6624d81
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 14 12:18:09 2011 -0400
Moved this script because it interferes with system tests.
commit bf1a2a75ac8b3b8d7640b1ab825d66342cd76da3
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Thu Jul 14 12:07:17 2011 -0400
Changed a constant in a R script that controls the boundaries.
commit f217fe0c1e5e019cf0df611d74073917f766327e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 14 10:39:07 2011 -0400
Added log10 scale to library distribution plots.
commit 9eabbb7cb7b5ffff2d0888d802878ddb63248cf9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 14 10:34:01 2011 -0400
Now using png instead of pdf.
commit 29486fb7df00f7d9f43d1e097a53202c91a53ce0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 14 10:14:08 2011 -0400
Using png instead of pdf.
commit c3ec6f9617c85338ccc7d55f6a9e03cc51abecf1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 14 09:20:48 2011 -0400
Ray v1.6.1 is code named 'sunray'.
commit 39a7f6a344434638a516413a4173f459bf8e2d94
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 14 09:14:00 2011 -0400
Added the symbolic link for data-for-system-tests.
commit 34effb40c16021a677a877eaeaf86a818857387d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 14 08:59:42 2011 -0400
Updated the change log, version 1.6.1 should be released today.
commit 6b7a7de20d1483bd7db10187f7d87470e655c2a0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 13 23:01:31 2011 -0400
Corrected the number of pairs.
commit 852ae1e911ef0866ed2303c00a3be345097fb699
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 13 21:28:43 2011 -0400
Moved symbolic links.
commit 08b2827de34945851cc7a8c12ffc7a58bae4c6ef
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 13 20:07:46 2011 -0400
Fixed an R script for the plotting boundaries.
commit 477d43b3dac0f50884b926eb8c6889baef40a958
Author: Sébastien Boisvert <Sebastien.Boisvert at oicr.on.ca>
Date: Wed Jul 13 15:31:20 2011 -0400
Pacific Biosciences long reads now load correctly into Ray systems.
commit d8f35e3e7ed024e8b491168175e2206e0f2dc200
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 13 10:52:08 2011 -0400
Fixed the range.
commit 89c6dce0775e8d761770932a9ae9e69ea33b12d5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 13 10:31:53 2011 -0400
Updated R scripts.
commit f64bb91d9b98301d59dd9886fe06091573220f15
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 12 11:14:58 2011 -0400
Updated version to 1.6.1-rc3
commit fe117c067e12f7bc0079043cc094ec3768d4a8c8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 11 22:42:04 2011 -0400
Renamed MiSeq system test.
commit cc0d4111667865621c6cc9d13822de365f1437ba
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 11 22:27:31 2011 -0400
Added a system test for the Illumina MiSeq.
commit 27c25bc5a13dcbe25b073491f5b5d01e2fc08851
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jul 11 11:41:50 2011 -0400
Added host name in network test message.
commit c061c36732424da1819a5083c590044c7e0587ec
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 10 18:56:46 2011 -0400
Fixed a compilation warning.
commit c3c7e015882a5f96909144d4246b67bd290b7146
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 10 15:38:21 2011 -0400
deallocation is faster, so the overall process is faster.
commit e271ee8dc6fc0bb4bd1042f9d9ae01d431f0b70e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 10 15:37:51 2011 -0400
Using cout instead of printf to print uint64_t values.
commit 5aa25261c907006aec7417de951dc2b824c9d886
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 10 15:37:10 2011 -0400
Added a message indicating that network testing is to be done.
commit b132cd3f5810d448501ee7df9d29a165966bb2a1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 10 15:36:42 2011 -0400
Removed calls to defragment() outside of DefragmentationGroup.
commit 414b48ef757c97f4c5e03df5caf78530666439da
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 10 15:35:12 2011 -0400
Added -O3 when running the profiler.
commit 090bec2758c99fa0ce2d49031cd67ce14f81ee14
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 8 17:59:33 2011 -0400
New thing to do.
commit 106cbaa810aed3f8e49ac3689eee56ce7a76ce81
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 8 13:14:00 2011 -0400
Fixed the computation of the destination for the network test.
commit 8659ddc59007e6881d352f5a97424fe7476be283
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 8 13:13:39 2011 -0400
Fixed a problem that caused contigs within scaffolds to be 2 times shorter when MAXKMERLENGTH=2.
commit da22f356c09a2034f76a14992ceb7bee2da5daba
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 8 13:12:54 2011 -0400
Removed a displayed message.
commit f075d078a97aad8d8e8572ce982b176806c0e7af
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 8 13:12:30 2011 -0400
Fixed a display problem.
commit 2d68462ba336ab1c378b3454fb7c560edf6fdc38
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 8 13:11:30 2011 -0400
By default, don't pack structures in memory (FORCE_PACKING=n).
commit 1c44855e63f49fd11a253dc07549fabb0f2cd719
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 7 17:23:02 2011 -0400
Added a new output file called PREFIX.NetworkTest.txt which contains average latency including software overhead.
commit f83e63208f3485624e09596f616f6869310c14d0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 7 15:15:38 2011 -0400
Fixed a display bug.
commit 64bba3b093558991ce63a0c5e21b0027e1e7062f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 7 08:56:17 2011 -0400
Corrected 2 dead symbolic links.
commit 0e11f624c6a80c999597e610fccf2c533acfe97f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 7 00:04:30 2011 -0400
Fixed 2 segmentation fault bugs in this newly crafted memory allocator.
commit 239b256df6c44c9a5dfd17a1bd5ab9f06002ce98
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 7 00:03:34 2011 -0400
Changed maximum execution time.
commit 6aae5b709bc2d3094b1c19a77048064ed12ae01c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 7 00:03:11 2011 -0400
Added time complexity.
commit a1c3914abec1f6d3cec5a05bca268c5ad4129e0a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 7 00:02:21 2011 -0400
Documented insert().
commit 73e5b6bcb46634d691c1eb40ed1cc88801754fdc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 7 00:01:52 2011 -0400
Added a to-do task, I think there is memory fragmentation during the selection of optimal read markers.
commit 48dcea9e5314f91109ed12ea18a6923336cafe21
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 7 00:01:06 2011 -0400
Documented the main loop of Ray.
commit 190ec24efc36f80fdb8643a73b924c339e1c556b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 7 00:00:39 2011 -0400
Added a task to do.
commit b6dab3868891389231c3b3f3e0bf149480955930
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jul 7 00:00:09 2011 -0400
Added a to-do task.
commit cacf7333e2254b9c54e741cb5a4dfdf3d57ca559
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 6 18:26:38 2011 -0400
Fixed main-sge.sh.
commit 2fa490bf34a41e7b830ae0d39f8f03f2a37725bc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 6 17:39:06 2011 -0400
Fixed a bug (KmerAcademy::insert) that effectively doubled the memory usage of the k-mer academy.
commit bd62be8a3cc9884f39605c20f28c59f2f05522ea
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 6 16:13:24 2011 -0400
The allocation process is now a little bit faster -- only defragmenting when there are enough gaps.
commit c5723f816aa3b305229a6650506ba97feca722f7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 6 16:12:17 2011 -0400
Fixed a compilation warning.
commit 58c6ddd4f7e8a667110850fd65d64da41e4195d9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 6 16:11:57 2011 -0400
Added DefragmentationLane class.
commit b7c2804cbb46096d0265728a569beb6a58dcf05f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jul 6 13:28:39 2011 -0400
defragment() now is O(65536).
commit f6d47aa47cd96d658d069dab3e79a8fb5524020f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 22:44:05 2011 -0400
Fixed a bug that I introduced in ChunkAllocatorWithDefragmentation
commit dd88eddb443227cbe0b71c5c2c53aa4d0e21961d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 17:46:57 2011 -0400
Working on the speed.
commit 9de9cdf7cb0f2af9ba7427518151adb51948935d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 17:08:57 2011 -0400
Changed the rules for allocation, now more real-time.
commit 043fc3df8d2a2653d07daa70ad1331ebaae6aa46
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 16:47:06 2011 -0400
Fixed compilation warnings.
commit 45b66f0c53d8cf2c366c44798a795336446ec8ac
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 16:42:17 2011 -0400
Cleaned scripts for Sun Grid Engine
commit 71889a77e5f13dced46e1b2c7183ee31200f44b3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 16:03:52 2011 -0400
Added m_firstGapStart to speed up the lookup.
commit 204ec6b71443af4fb541885a922c3ad178c68399
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 12:14:41 2011 -0400
Changed the default number of buckets for MyHashTable and changed parameters for incremental resizing.
commit f820cfa16f46e2f185b1d35e0c54f3d59a035738
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 10:43:39 2011 -0400
When all message-passing interface ranks are done computing k-mers (or vertices), the incremental resizing is completed if necessary.
commit fd01c9cbb2a4e0716368601fc1598f10699d31bf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 10:42:31 2011 -0400
Implemented incremental resizing to allow low latency.
commit 08921df61e062a76ec62f1a541f6e5a95f6d41e7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 10:41:36 2011 -0400
Added a method to obtain the allocated size for a SmartPointer.
commit 8099ac4bfc0440fa25aa54d160e540529f26e731
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 10:40:38 2011 -0400
Added a method to obtain the allocated size for a SmallSmartPointer.
commit 1bcd6c680038d3b410013a4dc612fe352c11fe97
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jul 5 10:39:37 2011 -0400
Edited an error message to make it more explicit.
commit e8c1cc040a4b554b4fdc9368ebb8ba03a2030045
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 3 23:19:33 2011 -0400
Renamed the Sun Grid Engine runner script for system tests and added the script for testing on a symmetric multiprocessing processing machine.
commit 705b52ac42ac2e8ebfb2c02e991c024a80c9b288
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 3 23:15:44 2011 -0400
Modified defragment to be coherent with the low-granularity of Ray.
commit 0413e88a16aa316e13dd73ae5487a8a54c617af0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 3 22:38:49 2011 -0400
Added defragment calls when a core is waiting, testing it.
commit 45528ab6f558a309ec0bb7a332867f57e14f15cb
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 3 22:38:18 2011 -0400
Fixed a bug in deallocate and added defragment method.
commit 9d73ac336c833fbd51635fda1e7be1b45f2bb040
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 3 16:32:15 2011 -0400
Removed some output in print().
commit 36c989dd9e596116411e63ad26f4478d9ad36b70
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 3 16:31:41 2011 -0400
Restored the correct number of cores
commit 29b0321cc380267b58da10aa61a3aa652c82f9d8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 3 09:20:52 2011 -0400
Fixed a buffer overflow in getKmerAtPosition, reported by David Eccles (gringer).
commit 0d0809fb37c689732153de8d01e71b766d2ae797
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jul 3 09:14:21 2011 -0400
Added documentation for getIngoingEdges and getOutgoingEdges
commit 22ab5c81661bf2fb976d9c76028394f6daa8ebc3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jul 2 22:50:22 2011 -0400
Removed memmove.
commit 85089442124b54f4cabe2df7892c17890227d64f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jul 2 22:20:26 2011 -0400
Unstable version of an allocator with real-time defragmentation.
commit c01b61762178e4f48c05017a5ccaa6c90b60aacb
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jul 2 22:19:53 2011 -0400
Fixed a bug that reported 0 sequence reads for the first file while otherwise handling everything correctly.
commit 998e05c544159e9467f1dffd45c6e74510f410ce
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jul 2 22:18:58 2011 -0400
Changed the default number of processors for system tests to 30
commit 880fa6a273ba5ca40205a89b35befec1d3e1b8c9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jul 2 22:18:27 2011 -0400
Allocating a number of elements, not a number of bytes & fixed a bug for a SmartPointer after deallocate
commit d165fa6c03bcb79139e7d991e370a7d7b0031238
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 1 23:25:19 2011 -0400
Implemented SmartPointer objects to allow defragmentation of memory.
commit f9f4c350bc3afcc863e24d844b3bacdeba3853fa
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 1 19:30:56 2011 -0400
New output file: PREFIX.MessagePassingInterface.txt contains the number of sent messages for each type.
commit c6725c29f75376a4a5c38828756dd2b0b9bee96d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 1 17:08:25 2011 -0400
A system test can be run outside of a compute grid (cloud) using run-test.sh.
commit 150b0925988c46f438fba11c18acbc1b60e9031f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 1 17:07:53 2011 -0400
Removed examples directory -- system tests now replace them.
commit 46890f092331066dba6efcc96918d352cbc5ba5a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 1 16:23:47 2011 -0400
System tests can now be done with Sun Grid Engine. Entry point is system-tests/main.sh
commit 180e1da98b97d7ee9f8652fbedbc047abeeac89b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 1 14:22:37 2011 -0400
Fixed a segmentation fault when one rank has no seeds.
commit edf17af6ca7aa63db6d7ed0c1858c85c845f1823
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jul 1 12:45:06 2011 -0400
Continued work for the system tests. Mostly script editing.
commit 27ff1dbe6204c740dd836e7efdc7a4a3698d4134
Merge: 56273c9 2b71038
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 30 21:27:47 2011 -0400
Merge branch 'master' of git at github.com:sebhtml/ray
commit 56273c9563ec1e8c5194962d216351bb4a8358e6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 30 21:27:23 2011 -0400
printStatistics should be called on the k-mer academy, not on the grid table.
commit 2b71038cc0387b21a424a0fd335f081d04a26d02
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 30 10:56:51 2011 -0400
Created a framework to launch systems tests in parallel on a compute grid
commit bb8ad87fef7f3c74a5e54d8440338fc75fa8f076
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 30 10:19:03 2011 -0400
Updated unit tests.
commit 326132a4f100956f9a3ed37b5ce0189abe9df060
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 30 10:06:03 2011 -0400
Renamed a directory
commit 404ad4cd7b4dc1f54d61e81fdb0e1673d4ef609c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 30 10:01:42 2011 -0400
Investigating possible memory fragmentation -- added printing of debug information.
commit db0f359f7612424d5dd009cab7c8d66c11b0e722
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 29 09:07:28 2011 -0400
Fixed an infinite loop when a file contains no sequences at all.
commit 86ba0044d323507f59d86dd58c386e4687ae769d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 28 17:18:08 2011 -0400
Now, only the MessagesHandler is aware of the message-passing stack (mpi.h and MPI_*). The other folks use the inbox and the outbox to communicate -- or the virtual communicator if they are intelligent.
commit 0d13d7f78d21a473296e2a3440d788cab242cf7b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 28 17:16:20 2011 -0400
Fixed a boundary issue with the second hashing function
commit 5930ddecb40db5cfd0e3d54587d5c147d23457bc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 28 16:18:20 2011 -0400
Fixed compilation errors for unit tests.
commit df93e457b903e5f00ac63414045d8a69a0dcc067
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 28 16:13:36 2011 -0400
Removed a useless prototype.
commit 5a57c214def6c6af6b919ad2affc277950fc4743
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 28 16:13:10 2011 -0400
Fixed a compilation error for MAXKMERLENGTH>32
commit cbd3b3dc14f1a4186b2e4b9f1bfe26deaaa5c7a8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 28 15:45:10 2011 -0400
Changes: MyHashTable now automatically grows and uses double hashing for open addressing.
commit b9e90882030f164fdb623ff63096d00c537caacc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 28 07:51:49 2011 -0400
In MyHashTable, the bitmap is now static instead of dynamically allocated. Furthermore, a group of buckets now contains 64 buckets instead of 48.
commit eb60e401d35cec78cc99a04477de91a2afa34099
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 27 23:23:21 2011 -0400
Added some documentation in the source code of Ray.
commit 8c1ddd3acc6202cfaccae19a0bab7c0a671a86a5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 27 23:22:42 2011 -0400
Added statistics for the new hash table.
commit 3d0c5c35a24e473ac8c44082f794c79197146395
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 27 23:21:27 2011 -0400
Removed data type attribute in Message because it is always 64-bit integers anyway.
commit 6f504e37f6ec4b82891cdb9beb1604f0730bfc92
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 27 23:19:41 2011 -0400
Improved the performance of MyHashTable (running time)
commit 6777ffb4e758f1f955fda490f42867f96be84710
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 27 23:19:01 2011 -0400
Increased the maximum number of reads per message-passing interface rank in Ray
commit 34d0fe732f6efce7a2b33f9482fbad4eed0528da
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 27 22:00:41 2011 -0400
Implemented a sparse hash map (following the description of Google sparse hash; see structures/MyHashTable.h)
commit b431b88df3f16708ca7b10745ca2a9216959327d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 27 18:45:48 2011 -0400
Now using MyHashTable for GridTable
commit 55dccf58ecadc2395081cbfbdd9892182dd90ced
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 27 17:07:20 2011 -0400
The hash tables are now implemented using open addressing with quadratic probing.
commit 3f2c879f2c91a5f0d85d7e9465fe79facce80dda
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 27 14:53:45 2011 -0400
The hashing functions now only take an object, the reverse-complement logic is outside.
commit 52a0328e6d95067e3fee07d7866e9b14ade1a5f2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jun 26 18:52:07 2011 -0400
Fixed a bug in KmerAcademy
commit a757aa6ae227c5fb4a01895ca337497ed22b6569
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jun 26 02:03:28 2011 -0400
Cleaned the code by removing MemoryConsumptionReducer (~ -1000 SLOC).
commit 33c15ec53ae98bfdfb0845a84606b50bf197b09b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jun 26 01:16:49 2011 -0400
New outputted file: PREFIX.degreeDistribution.txt contains the distribution of degrees in the graph.
commit 945370aa9c58547e71a866b7941794071e0a2711
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jun 26 00:16:20 2011 -0400
Reinstated code for -write-kmers
commit 67dcba9cc5e9d37397e2db3272f5f9c1fcd92772
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 25 22:34:00 2011 -0400
VirtualCommunicator statistics are now reported for BufferedData
commit 6de41634a928349ef8e1736670dce638d668270f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 25 21:58:45 2011 -0400
Edges pointing to non-existing vertices are now purged
commit 6d23cc362453c38e2cad082a22172c091ac352fb
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 25 12:59:07 2011 -0400
Removed segmentation fault
commit 3554b8d164076cd7d2799e2534a9fd1033b207ee
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 25 12:18:14 2011 -0400
Added parenthesis for clarity
commit bda9226e6e447fa48a656445d8b6f82e36facd23
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 25 11:23:45 2011 -0400
Fixed a free problem in SeedExtender.cpp when no seeds are available.
commit 1def1374fb98c37df6abec0809448e72e00d8cc7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 24 22:45:24 2011 -0400
Added DynamicVector to reduce memory fragmentation
commit f6fd08ba6030e9565adcc3ccbde478b4f3f97735
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 24 17:26:17 2011 -0400
* Reduced the memory usage during the building of the graph.
commit 30d7a77ed83d7d2ae5497be2039910ee96eb747a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 24 14:36:26 2011 -0400
Merged VertexData with Vertex and merged VertexTable with GridTable
commit 70802aea156506b1c59ac2fb1d69ca6453544083
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 24 14:08:35 2011 -0400
The memory usage for optimal read markers is now reported with -show-memory-usage
commit d0a6c2d2e0a75d4366c080f91140e6d225c13ed3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 24 13:35:07 2011 -0400
Memory for low-coverage k-mers (the KmerAcademy) is freed after graph construction.
commit 25ec404ce4c1ab56af0e47ffd2f04789cd825d0b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 24 11:41:29 2011 -0400
KmerAcademy is a place where all k-mer must transit before making it to the GridTable. Those observed only once remain in the KmerAcademy. This academy is then destroyed.
commit 02c1d593a29a0072f1753ae9753e8dbbe979381c
Merge: 7872de9 d220aaf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 24 09:41:21 2011 -0400
Merge branch 'master' of git at github.com:sebhtml/ray
commit 7872de9ce65f13abc80bceb5aa129555662c1a29
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 24 09:41:05 2011 -0400
A read can actually be empty after trimming.
commit d220aaf8ba31615c058a8bbe4d4119ca799c8f44
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 24 00:10:09 2011 -0400
filter-qseq.c is working properly now.
commit f526d10a5b45e2ad24d76ae848a8d785e9efe85b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 23 23:43:07 2011 -0400
Created a program to filter qseq files.
commit f33a60c770ce638ce99df4240d5f1cde97eb9a5b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 23 18:28:18 2011 -0400
New C script.
commit 2d5d180742d34910e8687bd65f150f5e107dbc21
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 23 18:13:16 2011 -0400
Corrected script.
commit 12f94cfa6666fcbd11c5edf9590acb751bd00b0a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 23 13:54:56 2011 -0400
Fixed a bug in a script that generate Ray commands
commit 2a58deead0aeed8a9c3b98b0c079422ccd340987
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 23 13:18:17 2011 -0400
* New options: -minimumCoverage, -peakCoverage, -repeatCoverage -- provides coverage values automatically.
commit 9cfac4bd6fe33f2e0ee58b08540e06a0d3e77be7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 23 12:40:03 2011 -0400
Fixed smoothing bug in CoverageDistribution.
commit 8644d2d91826861534d1c924d5f2b8689de9132c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 23 11:25:41 2011 -0400
Fixed: Sending RAY_MPI_TAG_GET_CONTIG_CHUNK messages fails
commit a0eb036eb8be344a2503b54c7b1f3dc27c0220fc
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 22 14:59:31 2011 -0400
-write-kmers don't write k-mers with coverage of 1
commit f9ba49265f58c812f8e3d6e455f73009e63a43b7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 22 12:34:34 2011 -0400
An additional round of smoothing is now the default.
commit 6fdc94b3448ddbf26bc6b99ab14a12325e7d4076
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 22 11:29:48 2011 -0400
Added DEBUG=n as default in the Makefile.
commit 43408f762d6a22116fc6ba096d0b01d76d00903a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 22 11:26:46 2011 -0400
Edited unit tests to consider changes to the code base.
commit b94dd2c84e5b7c2d37832e32b059229c75418398
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 22 10:38:30 2011 -0400
Documented color-space mode.
commit b4c64be54c238c7b11f2ca020fb590bf20b1a837
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 22 10:10:44 2011 -0400
Corrected a typo in the eagerness explanation.
commit d8bebd5320c41995c988835b54e80a552c4aeb6c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 22 10:07:38 2011 -0400
Added a small comment to document call_RAY_MPI_TAG_ASK_VERTEX_PATHS.
commit 5d6032d2183974a8b4ebc7837ea2a8a33aa2d8e8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 22 01:00:04 2011 -0400
* Ray can generate an assembly in color space (the resulting assembly is in color space).
commit cb8ccd5552a76a4cbf05be67833205f94aef53d5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 21 20:13:20 2011 -0400
* Added an assembler panic when no k-mers are found in reads.
commit c2348fba2326ffde4bd219da61ee0418869a38c2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 21 17:25:17 2011 -0400
* New experimental option: -color-space for .csfasta files (unstable)
commit 78c904a1dcc86f85e95e8a3049dbc6e50c5031e1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 21 15:13:21 2011 -0400
Adding experimental support for color-space reads.
commit e9e9989d1d52e019830bbd22da0380f34cac8ab2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 21 13:58:16 2011 -0400
New Ray option: -write-kmers write k-mers, coverage values and arcs to PREFIX.kmers.txt
Actually, this file *contains* the k-mer graph in ASCII.
This file contains k-mers, coverage values and arcs (ingoing and outgoing edges).
Format:
k-mer sequence;coverage value; first nucleotide of parents; last nucleotide of children
Example:
ATCG;10;T G;C A
ATCG has a coverage value of 10
Ingoing arcs: TATC -> ATCG and GATC -> ATCG
Outgoing arcs: ATCG -> TCGC and ATCG -> TCGA
Example of content:
GAAAATATTATTTCTATAATT;31;A;G
CCAAAGACACAAAAACAGCCA;33;;
TGGCTGTTTTTGTGTCTTTGG;33;A;A
CTTCCATGCAGATTTTGTTTC;35;;C
GAAACAAAATCTGCATGGAAG;35;G;G
AAATAATCTAATGTAAACTGT;33;G;T C
commit a2c9149e05067e340e608794b2f6777285ce3999
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 20 20:22:18 2011 -0400
Added some comments in the code.
commit 5842f3c12acc1ae1ecbae500ca4cad0e87ebb744
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 20 15:51:42 2011 -0400
Fixed a compilation error for BzReader.
commit a73382b2c64d7deac2431ad70f133ac0557b7a15
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 20 14:25:12 2011 -0400
To use 454 mate-pairs in an SFF file, you must extract them
and provide Ray with the 2 resulting fastq files.
commit f752919805a4efa3ae5aa92dbc56d25305702c9e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 20 12:27:09 2011 -0400
Modified the code that writes scaffolds in FASTA format.
Instead of sending an MPI message to an MPI rank to tell it to open
the FASTA file and to append to it its contig, the MASTER rank is the only
one that actually write bits to the file. Other MPI ranks are just asked
for their important bits.
I initially thought that writting scaffold sequences was slow because
of the numerous fprintf (one for each nucleotide), but it seems that
it is not the case. I believe it was slow because of the overhead of
all the fopen/fprintf/fclose that were generated on numerous MPI ranks on the
same very file which is available through a net filesystem or Lustre.
I guess this will fix the problem.
commit a2fc0e88746dc6da41c66688bfa90c6f0ae305c8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 20 10:58:00 2011 -0400
Modified the code to reduce the number of calls to fopen.
commit 869f40426b8e8c39e9f15ffcb6218f9450b69b84
Merge: df4c197 ce080de
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jun 19 17:18:07 2011 -0400
Merge branch 'master' of git at github.com:sebhtml/ray
commit df4c19761cca65370058974e618bea858b4d1945
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jun 19 17:17:35 2011 -0400
* Added a progression indicator for scaffolding.
* Writting scaffold sequences is now faster.
commit 0c8f6a296472de371950b44e53f275b6e4b59a24
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jun 19 17:15:55 2011 -0400
Added balance for the profiler.
commit 6bd94588ec4ea8c6714e6c9742fa741057bac6d8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jun 19 11:17:31 2011 -0400
Optimised run()
commit ce080de7d8c2ba9071c0c7c7ce9db216d09110c6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 18 21:08:38 2011 -0400
Added (some) code documentation.
seb
commit 9eb15a7bb50308cf6751a68dcf7e33d4e4cfc617
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 18 17:29:05 2011 -0400
Now Ray writes observations for libraries in a file.
commit 5f39f0b8681e6e5e5133d0e9d735848f79b14f26
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 18 15:28:58 2011 -0400
* Fixed a communication problem for k>32.
commit cfd8bc951a7c51e5c6bcbe1011df79ac07dc9aa8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 18 15:06:56 2011 -0400
Moved the allocator in its own file.
commit c8ec3c60c2bd8c8c6d272ddfa58d8ac7990613fa
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 18 11:41:17 2011 -0400
Changed MAXKMERLENGTH=128 for MAXKMERLENGTH=64 in examples.
commit ec9673f33eb0fe1a102ce2ee4dc5e7dc044e4dce
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 18 11:40:10 2011 -0400
Changed MAXKMERLENGTH=128 for MAXKMERLENGTH=64 in examples.
commit 11c120cb8612a2a25a5d56d005788488bffd673d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 18 11:36:17 2011 -0400
Fixed a bug for the seed length distribution written to a file.
commit ef7728724b2064d8c59c97f5ed8747b2ac47742e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 18 11:35:27 2011 -0400
Fixed a bug for the seed length distribution written to a file.
commit 9b38e4e3520b3db0eb82160db66cc0e7716a382f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 17 20:13:01 2011 -0400
Added a unit test for uniformity of vertices on ranks.
commit 60d73547639993c4d721e68aec30dce29ec97abe
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 17 19:24:00 2011 -0400
Added a unit test for uniformity.
commit e1309521f7c2e8116632f0b0ac0254901bcee5e3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 17 18:55:43 2011 -0400
* Fixed the showMemoryUsage function.
* Fixed uniform distribution of k-mers for k > 32
commit 8665d6da71de5234b57a37fccf30466c8bb11c0b
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 16 12:08:12 2011 -0400
Changed ifdef linux for ifdef __linux__
commit e48b7fd2eb4851f60e1195d16300e87176a3b634
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 16 12:07:57 2011 -0400
Added an indicator for completion.
commit e81af379d4476c2dd13de8a209c661b06f418cf5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 16 09:16:49 2011 -0400
Added option -show-memory-allocations
commit 2910a92d1ce0bc984a2cc40245d45cdc1a05c6db
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 15 16:11:52 2011 -0400
Added the processor name for debugging purposes.
commit 6590dd0220788a6a374587b53353347efd88f81c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 15 14:54:14 2011 -0400
* Added a smoothing routine for the detection of points in the coverage
distribution. Thanks to pmiguel on SEQanswers for providing raw data points.
http://seqanswers.com/forums/showthread.php?p=43979#post43979
commit 5d135455ef413b1cdf3783b534f96bddc3149053
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 15 11:31:08 2011 -0400
Updated change log.
commit 2b7536fd261682576e12731380624c62c08859c3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 15 11:29:26 2011 -0400
Presumably fixed a compilation error on Apple Snow Leopard.
Thanks to Anthony Underwood for reporting the bug.
commit ee015727bb6d0e14ddb3cd02132a7fc1cebfa29a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 19:26:36 2011 -0400
Updated the changelog.
commit b689eb91eb94e939c4ef010fa113cd77aa0e2cdf
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 17:30:14 2011 -0400
Changed method name.
commit 44a27a100f1aae77c9ad9cea11041d97b6d53298
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 16:32:06 2011 -0400
Fixed the tiling (TLE) entries in the AMOS file when forwardOffset or reverseOffset are not 0.
commit 2de854a705a3683f6c24fea75e5c7778b4ab9fc8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 16:31:19 2011 -0400
By default, Ray now displays the options available if parameters are provided or if -help is provided.
commit e2bc426e8eafbcc7e15ae9803d4b3bf4e3d29509
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 16:29:29 2011 -0400
Added documentation of the amos option.
commit 5c2922aa3a0d2df56c6c4e974523d49d026b2658
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 15:01:38 2011 -0400
Fixed a compilation warning for printf with uint64_t.
commit 238aad8059cb34585c5100ca53c13b18ce6693b4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 13:20:14 2011 -0400
Added some options in the manual.
commit 27f416b3ad32d00f005573a648031319b8b36b07
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 12:23:51 2011 -0400
Ray works on Microsoft Windows and can be compiled with Microsoft Visual Studio 10.0.
commit 024435d43ed0f11d96a1442116562aec1907ce91
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 10:48:37 2011 -0400
Finally fixed all compilation errors.
commit 2fdf8f0382afa6e9df3f6d988d6df8f412e597ca
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 10:43:31 2011 -0400
Message also needs stdexcept because it includes mpi.h which I believe check __cplusplus
commit 14b8371911fb928b18765704679949e40bb4543e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 10:36:10 2011 -0400
Added ray_windows.h to LibraryWorker
commit d4d2848702bdefe2ebaf4613cc6a0241e154b57f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 10:30:49 2011 -0400
- Fixed namespace collision with Message and stdexcept.
commit 188804c11646369c844ec02326a73a2d6fa5f339
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 10:14:14 2011 -0400
Fixed a compilation error involving stdexcept.
commit 1885703b85f47b4698d9c2fcf9e70ad7ebf7580d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 10:10:40 2011 -0400
- Moved the simulator outside the tree.
- Fixed some compilation errors in Microsoft Visual Studio.
commit 45919fc764e361bb51af1b51784442ff76a61ea5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 10:04:10 2011 -0400
Fixed some other compilation errors on Microsoft Windows.
commit f000edbd7553273efbf9227dce6df23819f1601c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 09:38:36 2011 -0400
Removed inttypes.h as versions prior to Microsoft Visual Studio 10.0 do not support it I believe.
commit d8225b1eed6de6c592245ea67c07614d09faf5f1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 09:23:59 2011 -0400
Moved tests.
commit 6ab6f1a034d23f7a2d3d10df399fa63e33a6fd91
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 13 09:11:29 2011 -0400
Fixed some compilation errors under Microsoft Visual Studio 10.0.
commit 52645e3d5b57a2fa9b0b33f5acf693b585cff434
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jun 12 21:39:05 2011 -0400
Define MAXKMERLENGTH if it is not defined.
commit 9f6602dce41a8af6a53a3754e2da2cf195aa8f85
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jun 12 20:56:20 2011 -0400
Updated the README.
commit fe9c1963ca6d0e5e07eb2c0275a9b639e2495db3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sun Jun 12 17:25:22 2011 -0400
Optimised some code again.
commit 8344ac2ee7fcca8697b437bab13d8d891c1d536f
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 11 21:48:57 2011 -0400
Fixed compilation error with -pedantic and -Wextra.
commit 6562651da90a773799983dc1b2b2b49adf74dc81
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Sat Jun 11 18:24:14 2011 -0400
Added 2 options to the Makefile: GPROF and OPTIMIZE
Optimize some code.
commit cb4fba730c1435b31eac6c127dc2edbb1f0214bd
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 23:09:34 2011 -0400
Updated documentation.
commit b11495fdd20cf8f63a0ecf324de5ba35f9d18833
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 23:02:11 2011 -0400
Added documentation for large k-mers.
commit a1fe88d4b6ec06ffc2725b28b46ea8893c0adb55
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 22:26:28 2011 -0400
Readded the minimum number of scaffolding links because
it reduces the number of scaffolds for a yet unknown reason.
Was initially added in b01c5fb6945b975f90fd76419f926a84d05de561 (Sun May 29 15:21:08 2011 +0000)
Was removed in 8a3a1679d5c14e2670ee68b93516232294687cd9 (Mon Jun 6 19:40:55 2011 -0400)
commit 080cfeda59ffeb7c5384a0d7b92ad1d9eae80c5e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 22:01:12 2011 -0400
Added compilation options for build-compression.
commit 630a28c241a3db4b19718e78da37ecf90cf2f120
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 21:58:41 2011 -0400
Fixed integration tests for compressed datasets.
commit 32cf0f2a72e665bb9a8d005dbab3d424c33f89ff
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 20:15:27 2011 -0400
Documented exit codes in constants.h
commit 6fc1c142416b44b0ff6166c89636dd3ae201a19a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 20:12:11 2011 -0400
Cleaned the source code -- removed commented code.
commit becf4a04f2e603609f6aa60dbc53182e5730b6a3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 18:59:39 2011 -0400
Moved the exit which was at the wrong place.
commit 8f1c58bcb632e02cf691193d9c9822f474bc54a7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 17:52:17 2011 -0400
Removed dependencies of install.
commit d37785365f034e7e5873873f73a7c7bbb60ceec4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 17:24:17 2011 -0400
* Fixed compilation errors for Microsoft Visual C++ (xiosbase and stdexcept)
Bug reported by Hannes Pouseele (applied-maths.com>)
commit a63460a7a287258818eb12ff8455866953529e8d
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 17:12:17 2011 -0400
Updated change log.
commit dd0849780e76f85ff1fd794c1fc5705a10106bd8
Author: sebhtml <seb at boisvert.info>
Date: Fri Jun 10 17:08:17 2011 -0400
Fixed the an access violation on Windows.
Bug reported by Hannes Pouseele (applied-maths.com).
commit 72ad91cf5d1bb48fa3bb074a6df769bd6c1a762f
Author: sebhtml <seb at boisvert.info>
Date: Fri Jun 10 16:45:04 2011 -0400
Added exit code EXIT_NOMOREMEMORY=42 as suggested by
Hannes Pouseele (applied-maths.com).
commit 074372077160f7a5f6475956f63a8040b1a0c244
Author: sebhtml <seb at boisvert.info>
Date: Fri Jun 10 16:07:11 2011 -0400
Really *fixed* installation
commit fa5df3bbdd5ceed8af9b47afd287501fbb904d75
Author: sebhtml <seb at boisvert.info>
Date: Fri Jun 10 16:05:30 2011 -0400
Fixed the Makefile.
commit 9b6851a84f35672a94586c442a0fc1184a3495ee
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 15:58:47 2011 -0400
The makefile can now install Ray somewhere (PREFIX)
commit b879ac23e4b3aff73a5235ea4296a310916f88fe
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 14:05:21 2011 -0400
Fixed CoverageDistribution for Assemblathon-2/Snake
Now maximums are required to have at least two previous positive derivatives.
File= tests/Snake-Assemblathon-2-2011-06-09.CoverageDistribution?.txt
MinCoverage?= 22
PeakCoverage?= 88
RepeatCoverage?= 135
commit f9220290d5268b63dbcb29483f69ab3830a9f1b5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 13:53:59 2011 -0400
Fixed an integer overflow.
The overflow occured in the dataset Assemblathon-2/Fish
k-mer length= 31
File= tests/Fish-2011-06-09-Ray-1.6.0-devel.CoverageDistribution.txt
MinCoverage= 25
PeakCoverage= 91
RepeatCoverage= 164
Percentage of vertices with coverage 1: 87.1866%
DistributionFile: Fish-2011-06-09-Ray-1.6.0-devel.CoverageDistribution.txt
commit c5dfe6f28a689c431c574a7e4ec90691a2e7d7f2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 13:43:21 2011 -0400
Integration test for k-mer length=63 works.
commit a94286c18662e6a89c2a0836836fced8eadd4cb3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Fri Jun 10 13:12:43 2011 -0400
Ray works with MAXKMERLENGTH=64 and k-mer length=21, which means that those k-mers are
communicated correctly even if the second uint64_t is *useless*.
Now, with MAXKMERLENGTH=64 and k-mer length=60, everything works up to the extension of seeds.
The rest should be easy as the main things that needed modifications were
related to k-mer handling.
commit 3012ee5c972c3288d6a77527f78ad1f9af0e3162
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 22:52:42 2011 -0400
Removed the old logo.
commit 397cbd3fc3185a851c1002a42a16aa5bf44e3cde
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 22:50:30 2011 -0400
- Added the paper in the abstract of the manual.
- Remove old build in makeBuilds.sh
commit 2175e7ab66048290e35bf2a0af8833a294bb4f72
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 22:45:24 2011 -0400
Updated the README.
Fixed the Makefile.
commit bd00914227146d1bffd78746cc5db82671aae164
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 22:42:09 2011 -0400
Updated the manual.
commit f2c5ce37a4931b2e09662ac35a380a560f6748a2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 21:57:05 2011 -0400
Updated the README.
commit e53ffeb3b6b12effff86e6cde75b7d610847ff47
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 21:53:51 2011 -0400
Fixed the README.
commit fa7cccb2a5969ba177d1922f512f72f15da440a0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 21:52:34 2011 -0400
Added doxygen information in the README.md
commit b2faea82bd6b797124d486ed221c3a2deed0ec03
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 21:42:19 2011 -0400
Unified the README, now in markdown format.
commit d0d8fab8ca7ef859f9c31d70b0bfaf8a58561597
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 21:36:41 2011 -0400
Updated scripts to use git and not subversion.
commit c71db6d13a2d38615995c2ebfef5843d8e233a71
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 21:35:54 2011 -0400
Added debugging code.
commit 6df039e737193ccf445f997a3b9c3ee8cea8253c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 21:34:03 2011 -0400
Commented debug-friendly code.
commit f1ae7680073de13c669bba383d60666e1b707e72
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 21:32:30 2011 -0400
Unit tests for edges with large k-mers now pass.
test_Ingoing_large
TCAAAAATTTCTTTCAAAGTAATCTCATAAGCCGCTGGA -> CAAAAATTTCTTTCAAAGTAATCTCATAAGCTGCTGGAT
TCAAAAATTTCTTTCAAAGTAATCTCATAAGCCGCTGGA
CAAAAATTTCTTTCAAAGTAATCTCATAAGCTGCTGGAT
WordSize: 39
Expected:
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90
T C A A A A A T T T C T T T C A A A G T A A T C T C A T A A G C T G C T G G A
01 10 00 00 00 00 00 01 01 01 10 01 01 01 10 00 00 00 11 01 00 00 01 10 01 10 00 01 00 00 11 10 01 11 10 01 11 11 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
Actual:
11 10 00 00 00 00 00 01 01 01 10 01 01 01 10 00 00 00 11 01 00 00 01 10 01 10 00 01 00 00 11 10 10 11 10 01 11 11 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
should be the same--> **
commit d0e7aca542016041f93775ec864abc810cc37d03
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 21:32:04 2011 -0400
Added 2 unit tests for ingoing and outgoing edges with larger k-mers.
commit eb0d5af5ba26c8fcbbaa6d7c8972348af13203d7
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 21:31:44 2011 -0400
Updated the ChangeLog
commit 45dc0a9cd0d672a09c4c1a5e0c41a98126e51329
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 20:37:41 2011 -0400
- Ray now estimates the genome length and writes it to RayOutput.CoverageDistributionAnalysis.txt.
commit 7c05f0520eacbef858b0d8390955313af684bde2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 20:36:30 2011 -0400
Only push the warning on MASTER.
commit c8742d428029e909c4aec74c75efa46941e25650
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 20:35:39 2011 -0400
Added a script to generate different builds for integration tests.
commit 931c8a3ee6136b2b1209198b018abc3791cc3c14
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 20:20:20 2011 -0400
Added a new integration test.
commit 545d514d9de54ad3f8e8c8b0d867192ab0419017
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 19:45:35 2011 -0400
Edited this file to change the hard-coded maximum k-mer length.
commit 4300f0f3c45ea8d4900fc47d406b041c102a6cd3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 19:38:03 2011 -0400
Added a warning when the provided k-mer length is higher than KMERMAXLENGTH (k-mer maximum length).
commit 0cf16e2f0090684269ad0516c93e05dd2856b0da
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 19:37:38 2011 -0400
Updated the RELEASE PROCEDURE.
commit 1d8b677c7ac6819b3bff58f8dea5d1ec3f1ab5b4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 19:37:10 2011 -0400
Removed the Instruction manual from the git repository.
commit 6371ddec13f414bf585a983769ca0c19542b7516
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 19:32:41 2011 -0400
Added the option to compile VirtualNextGenSequencer.
commit 4df6d69aa9c37cd6a9fab052ab3e48f1d1489a61
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 19:00:41 2011 -0400
Fixed element counts for call_RAY_MPI_TAG_REQUEST_VERTEX_READS
commit 15826e290f184a9b2ab950601d5cd8825bc250e5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 19:00:00 2011 -0400
The SFF Loader now takes all the sequences, even those that do not match
the key sequence.
commit b51185e9e172ccb137960ecf3f236cf0a2848410
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 17:13:53 2011 -0400
Ray assembles genomes with MAXKMERLENGTH=64 !
yay !
commit 46808d205810918d794cb42fa531ad398f20b3fa
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 15:36:20 2011 -0400
Fixed a bug in the VirtualCommunicator.
The threshold is the maximum number of messages to be pushed.
The current number of pushed messages *is* the number of workers that pushed a
message to a given destination -- not the total number of 8-byte elements pushed.
commit 6245da5d3e5b427d454b32de741ed3b7c649c7f8
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 14:02:14 2011 -0400
Moved all calls to MPI functions in MessagesHandler.
The remaining bits that need mpi.h are mostly for MPI datatypes.
Since I always use MPI_UNSIGNED_LONG_LONG, I will presumably remove it everywhere.
commit ab415405dfb223083652517e8e5cd81095144c22
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 13:43:08 2011 -0400
Moved code in subdirectories -- fixed include paths.
commit 521da23e61cb926e67bf1ac34dbeb37db2ac8c15
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 13:21:43 2011 -0400
Moved some code in directory assembler.
commit deeec5d9ed8264910ea2aa17b1e7d6766ae6e165
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 12:57:12 2011 -0400
- Updated the README
- The Makefile is now devoid of ifeq but remains conditional.
It is easier to read that way.
- The Makefile is fully operational -- it can *install* Ray somewhere too !
The syntax is based on the makefiles of the linux kernel tree.
- Next version will likely be 1.6.0 as MAXKMERLENGTH is a huge feature with *huge* changes
to the code base
commit db6c6f868b79366b37c8ca6b743abd59944e4f9e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 00:05:43 2011 -0400
Bug fixed.
Nothing reported = all unit tests passed
Test Suite: test_getedges.sh
====
====
Test Suite: test_limit_kmer.sh
====
====
Test Suite: unit_tests.sh
====
====
commit aa00ec5f876340071747b71d5e9952713a2e30a2
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 00:01:59 2011 -0400
Found another bug in getOutgoingEdges.
This bug is triggered when MAXKMERLENGTH>32.
For example:
====
Test Suite: test_limit_kmer.sh
====
MAXKMERLENGTH: 50
WordSize: 21
Expected
GACTTGATTAGACAAGAAGTT -> ACTTGATTAGACAAGAAGTTG
Actual:
GACTTGATTAGACAAGAAGTT -> ACTTGATTAGACAAGAAGTTA*
It seems that the template is not updated correctly with the last letter that should be appended.
commit 6dc21007853d97217f95904a16da2419ac4fe6e1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 9 00:01:35 2011 -0400
Added a cool text about P2P technology in Ray.
commit 9eddbeb5c1e89c3132824de0433446b9fced6a5c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 8 23:43:17 2011 -0400
Fixed the bug, all unit tests pass now.
"While the string representation may be correct, the hashing value will change if the
underlying bits are not cleared when required."
commit fbb9fef984e26d9134511cefb796a8c646bcddd1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 8 23:23:00 2011 -0400
I catched the renegade with my handy test suite -- I will now fix it.
a.out: tests/test_kmer.cpp:48: void test_Ingoing(): Assertion `actual==aKmer' failed.
Expected:
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
G A C T T G A T T A G A C A A G A A G T T
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
11 00 10 01 01 11 00 01 01 00 11 00 10 00 00 11 00 00 11 01 01 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
Actual:
G A C T T G A T T A G A C A A G A A G T T
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42
11 00 10 01 01 11 00 01 01 00 11 00 10 00 00 11 00 00 11 01 01 11 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00
These folks should be 0s----> **
Otherwise, while the string representation, the hashing value may change...
commit dfd36291d18af53118670af1e97c85909e43f325
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 8 23:20:57 2011 -0400
Added ghostly code to track and kill those pesky bug related to larger k-mers.
It seems that getIngoingEdges() does not clear bits that should be cleared.
commit d204801971fab6fe2f9f5ea154d7dca12fefc2ef
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 8 23:19:47 2011 -0400
Added a description for MAXKMERLENGTH
commit 4adced0b8dc52200491b12346d5b271468bdd7f3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 8 22:13:03 2011 -0400
Fixed the length of the array that is allocated.
commit c8bb75d0e9bf25891cffbbf55aeb89c7e0e4c8e0
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 8 22:08:43 2011 -0400
Updated the README.
commit a3a584c31b414ee1211c11ecb40ac734059bf131
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 8 22:06:52 2011 -0400
Updated release procedure.
commit 8a113246fbf848fa8a50fd82f0cf430d6dd0ee1e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 8 21:39:18 2011 -0400
I added a section for compilation options in the Makefile.
These options take yes/no values.
commit 8358496febf36374021255ca7b99561ad212cfb3
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 8 21:35:47 2011 -0400
BzReader.cpp and FastqGzLoader.cpp should not be aware of the value of HAVE_LIBZ and HAVE_LIBBZ2.
These files are just not compiled and linked if support for compression is not activated.
commit 554b58f40e26e73ee92d20b82b02f6f74d8b1331
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 8 21:35:01 2011 -0400
Fixed a compilation error when -DASSERT is not provided.
commit 62b82b6de554cf48ac5fba6d3fede3bcd4e8a3b5
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Wed Jun 8 21:34:24 2011 -0400
Fixed a small bug for k-mers longer than 32.
commit 9f35bdb9ff839ab00176ffdd71b57a0696fa537a
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Tue Jun 7 06:18:37 2011 -0400
Changed HAVE_ZLIB to HAVE_LIBZ
commit 8a3a1679d5c14e2670ee68b93516232294687cd9
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 6 19:40:55 2011 -0400
removed the minimum number of links in Scaffolder.cpp
commit 137a64c9fc393c9532f0caec5cbfd9207bda3bc4
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 6 19:31:13 2011 -0400
Fixed a bug in the TLE entries int he AMOS files.
commit 9adf87914d8063914e07e8d8cea16285a84ab4a1
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 6 18:16:53 2011 -0400
Now using ReadFetcher.cpp in Amos.cpp to obtain the read markers for a Kmer.cpp
commit 2bb8a070b73f8e4726e7ce07402855918508610e
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 6 17:15:00 2011 -0400
Moved the AMOS routines in Amos.cpp
commit 37aee552df80859c9d338fdc62118027125bee9c
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 6 15:51:25 2011 -0400
output contigs >= 100 bp, not paths >= 100 vertices
commit 24a6faef20263b5ffe1fdd0e548c4e73c377c062
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Mon Jun 6 15:46:56 2011 -0400
added a better warning for bad 454 prefix
commit 4abc27c9f50cfc7f8f50418db6222753c51ec09c
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 18:59:40 2011 -0400
Fixed integration test.
commit 055011f97cd961e3c4677be5cbb144f49cba5d85
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 18:41:14 2011 -0400
Adding the Makefile which is now located in the code directory.
Adding as well a unit test.
commit 63a3c45ac30b5a5b879bb9ac9dd9b8549a8fb4ec
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 18:39:16 2011 -0400
Fixed k-mer routines so that unit tests are now OK.
commit 97e80a8a0475721fad37d211ababaaca35d05371
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 16:49:12 2011 -0400
Moved files again.
commit ae5e76399f6a34a6b4c7ef7bd7341b57a99333dd
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 15:27:17 2011 -0400
Fixed the Makefile.
commit ca6b3856483f4259d50f5984efa1f4db4f87ba4d
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 15:25:33 2011 -0400
adapted files to use new paths
commit 5813765af84bc939649298ed1b3b7f4d42fdc4bb
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 15:24:21 2011 -0400
adapted files to use new paths
commit 8241204f5cd751b2db3bef225a1f0f29f60f88e0
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 15:23:59 2011 -0400
moved files
commit 7f412d4eef9e4f91d05ef9607168fb787945803e
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 14:09:26 2011 -0400
The distribution of vertices works with k=31
commit 7e66e210041e13cb4a30ddff97431f9fc57c9f36
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 12:29:52 2011 -0400
Added code/Kmer.o to the Makefile.
commit 07547b7563ccb15022e6561e89038b81fe83271d
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 12:28:49 2011 -0400
Changed uint64_t to Kmer in the code.
Now I need to change places where K-mers are communicated.
commit c3f83221b1b7b0a2edc959537a345b548de3560e
Author: sebhtml <seb at boisvert.info>
Date: Sun Jun 5 12:24:01 2011 -0400
Added a new class to represent k-mers.
commit 7c088fe5370440c4f3125dfd2a89f5f6444be189
Author: sebhtml <seb at boisvert.info>
Date: Thu Jun 2 12:58:21 2011 -0400
Updated the README file.
commit 6e91c4bca534e20b2fba282e3aab91c137785a3e
Merge: e351408 2324b19
Author: sebhtml <seb at boisvert.info>
Date: Thu Jun 2 12:08:32 2011 -0400
Merge branch 'master' of git at github.com:sebhtml/ray
commit e3514087409901a31b8f880f394e0c2121c32692
Author: boiseb01 <boiseb01 at ls30.genome.ulaval.ca>
Date: Thu Jun 2 11:57:20 2011 -0400
Don't erase fasta files in regressions
commit 2324b193ff87393810c0b71baa64f13e22770619
Author: boiseb01 <boiseb01 at ls30.genome.ulaval.ca>
Date: Thu Jun 2 11:57:20 2011 -0400
Don't erase fasta files in regressions
commit d531d46658cc6a14431e52476b0e6688122c54b6
Author: Sébastien Boisvert <sebastien.boisvert.3 at ulaval.ca>
Date: Thu Jun 2 01:46:02 2011 -0400
Removed the old Makefile.in
commit da759ff5a56a05ec53c8d991780da03aa6c64610
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 31 14:38:52 2011 +0000
New variable in the Makefile
commit 6099e0213521ccf4dfc063c0608f08e424d338b1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 31 14:08:48 2011 +0000
Preparing 1.4.1
commit 0b43c5735c4f2b2907cc203dd7b14124e3086632
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 31 13:58:28 2011 +0000
Removed NEWS
commit f7eb1db47ccc013226756204e4513a18d42e4eeb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 31 13:47:28 2011 +0000
* Fixed a compilation problem in Scaffolder.cpp. Thanks to
Volker Winkelmann (University of Cologne).
* Changed CC to MPICXX and added lines to compile Ray with Intel's MPI
implementation. Thanks to Volker Winkelmann (University of Cologne).
commit 477da3de1bd29306d2ec6ef0bc3bb13146230c82
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon May 30 17:32:35 2011 +0000
don't print raw link
commit 5aaf55f9b1200caa0a72ba48e648549628ba52e2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon May 30 17:27:04 2011 +0000
Changed the procedure
commit 42ffed6e7973f37ab6c226a4b525deb892bfa932
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon May 30 17:25:33 2011 +0000
300-strept.sh.Ray & 80 & 64 & 1968145 & 24601 & 48138 & 194158 & 0.9669 & 1 & 0 & 1 & 0 \\
coli-mpich2-interleaved.sh.Ray & 77 & 66 & 4595185 & 59677 & 133448 & 285886 & 0.9885 & 3 & 0 & 2 & 4 \\
coli-mpich2.sh.Ray & 77 & 66 & 4595185 & 59677 & 133448 & 285886 & 0.9885 & 3 & 0 & 2 & 4 \\
L1-L3.sh.Ray & 44 & 6 & 4628560 & 105194 & 173963 & 371980 & 0.9976 & 1 & 0 & 1 & 0 \\
pseudomonas-interleaved-bz2.sh.Ray & 85 & 68 & 6234019 & 73341 & 169959 & 573806 & 0.9931 & 1 & 0 & 1 & 0 \\
pseudomonas-p-bz2-gz.sh.Ray & 91 & 89 & 6211400 & 68257 & 169607 & 428076 & 0.9911 & 0 & 0 & 1 & 0 \\
pseudomonas-p-mpich2.sh.Ray & 89 & 86 & 6136792 & 68952 & 178718 & 428076 & 0.9791 & 0 & 0 & 1 & 0 \\
pseudomonas-s-mpich2.sh.Ray & 234 & 234 & 6183052 & 26423 & 58012 & 181131 & 0.9863 & 0 & 0 & 0 & 0 \\
strept-mpich2-200.sh.Ray & 89 & 87 & 1990758 & 22368 & 39956 & 127946 & 0.9764 & 0 & 0 & 0 & 0 \\
strept-mpich2-amos.sh.Ray & 89 & 88 & 1989642 & 22355 & 39956 & 127946 & 0.9761 & 0 & 0 & 0 & 0 \\
strept-mpich2-bz2.sh.Ray & 88 & 86 & 1973698 & 22428 & 42549 & 127946 & 0.9685 & 0 & 0 & 0 & 0 \\
strept-mpich2-interleaved-bz2.sh.Ray & 87 & 86 & 1950440 & 22418 & 42549 & 127946 & 0.9571 & 0 & 0 & 0 & 0 \\
strept-mpich2-interleaved.sh.Ray & 89 & 88 & 1989681 & 22355 & 39956 & 127946 & 0.9761 & 0 & 0 & 0 & 0 \\
strept-mpich2.sh.Ray & 88 & 87 & 1959900 & 22271 & 42549 & 127946 & 0.9617 & 0 & 0 & 0 & 0 \\
strept-mpich2-simulated-errors-longer.sh.Ray & 49 & 13 & 2003700 & 40891 & 68931 & 298833 & 0.9840 & 0 & 0 & 1 & 0 \\
strept-mpich2-simulated-errors.sh.Ray & 97 & 82 & 1975592 & 20366 & 37410 & 101741 & 0.9695 & 1 & 0 & 1 & 0 \\
commit 1fc71db6863a111dd9fcaa8f5f9a2615bf21c02c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon May 30 14:23:08 2011 +0000
Added a strict rule to constraint scaffolding.
commit 2aabeca933e9d6200f43eb4f6a6a13fa6b3cc1b9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon May 30 13:52:42 2011 +0000
Changed the minimum overlap.
commit 8943f44c456bd81114101f70a30b2265bef6368e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon May 30 02:46:48 2011 +0000
[1,0]<stdout>:Check for coli-mpich2.sh.*
[1,0]<stdout>:
[1,0]<stdout>:
% & numberOfContigs &scaffolds & bases & meanSize & n50 & max & coverage & misassembledContigs & misassembledScaffolds & mismatches & indels
coli-mpich2.sh.Ray & 78 & 67 & 4597448 & 58941 & 133448 & 285886 & 0.9885 & 3 & 0 & 2 & 4 \\
commit 446d1b99f170227384bb17515bdcf34a07c817d7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun May 29 23:19:09 2011 +0000
Changed merger behavior.
commit 2d1f6efeb747ae63b33075e6d359ebdadb7afe26
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun May 29 15:23:52 2011 +0000
Removed useless scripts.
commit b01c5fb6945b975f90fd76419f926a84d05de561
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun May 29 15:21:08 2011 +0000
Added a minimum number of links for scaffolding.
commit c7894753188d5daa957fada5d70bbd191cd87c61
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat May 28 13:51:16 2011 +0000
Fixed the script...
commit c9b58ed6a37710d53bf1443d537ac1e7e3934dcf
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 18:55:13 2011 +0000
Corrected the code that check scaffolds.
commit f2a2c221d61be99bf6f861a6106a80ea2c5ab847
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 18:40:41 2011 +0000
Sending new version
commit bcda25693f4b504045ef8990bc403839d4aa9974
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 17:11:11 2011 +0000
updated manual
commit 8ea69a5d8499eeaae2c33c755d95de0f2a2a81a9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 15:53:57 2011 +0000
moving web site
commit 55d9f319fed7aa08fd2503438a43c8e671017ef4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 15:52:58 2011 +0000
new files.
commit c254d8db2dd57d39741b95c146bfaf1c1da584cf
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 15:52:14 2011 +0000
Nouveau site web
commit 867c1b0cc3049557e1fda0a38f8d646ed882a9be
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 14:27:15 2011 +0000
adding website.
commit 9e6190e57527ae9950b97b0a0a7e99d4a846b7e4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 14:24:06 2011 +0000
Changed changes.
commit 06fe8351315effa830a63da3754c2c8074909bdb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 14:22:42 2011 +0000
Updated changes.
commit 11a1da7e229be0e7caf135d76ce976640ad4f54d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 14:19:38 2011 +0000
Fixed a bug in the scaffolder.
commit 5a9740cd6dbcb00d0a963f0f6f02aaded494e7ee
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 14:09:44 2011 +0000
Renamed the script to ValidateGenomeAssembly.sh
commit 8d4c4a4b21970f3d59ebefafe256366042d2affd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 27 14:07:03 2011 +0000
New script to validate scaffolds.
commit 1f919c9a085afc4c097171d61c37b6d2502e7e32
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 26 23:53:01 2011 +0000
Changed the way the coverage values are computed.
commit 2e4e854a12aac363d28432120e61987a45611f9c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 26 20:09:39 2011 +0000
Ajout d'un script dans Ray pour calculer des statistiques.
commit b5ea5e0cadb270f76b443f0bed00c66bdd6aa203
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed May 25 21:19:51 2011 +0000
Unabling bubbler
commit e88cd5f0c35c7f1ba03002d7e389f43b9601f002
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed May 25 19:54:07 2011 +0000
Added these lines at the end:
- show number all contigs
- show number of contigs >= 500
- show number of all scaffolds
- show number of scaffolds >= 500
commit 221d964c10f9f7b9a953fa02ba551fa193899fef
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 24 21:38:00 2011 +0000
Mmodification to a script.
commit 945671a2ee618847f6b684c7dd1ffc5fceb80957
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 24 20:52:19 2011 +0000
New target
commit 2087b14e22c815024639e29c09ba5a6468c1a6cb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon May 23 21:33:43 2011 +0000
Sending new code.
commit 9c99019d0a5ffe3e0c25014752b006ca50d5ae70
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon May 23 20:58:31 2011 +0000
Scaffolder is finished.
commit 038647108fc2868ef5410a9684471ec73e6aafdb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun May 22 14:56:51 2011 +0000
Scaffolder runs on E coli too.
commit 5b6f0faed58536b8817173b706292c70f3bd875e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun May 22 04:23:40 2011 +0000
The scaffolder is operational.
commit 0247c7a9caaf642a125b16e70254d8b00d463270
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun May 22 03:22:48 2011 +0000
Scaffolder is almost finished.
commit 161a7a0dbcb39c06eeb4de6e1721ad215ccf3b78
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat May 21 23:30:48 2011 +0000
The code generates mega-links.
commit d0b78f56ae0e0083e37bdf0d9a8d6729303c701d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat May 21 22:44:58 2011 +0000
Links are now gathered.
commit d9aa2ed5a324abe72c2093722dbf6042ecea58ca
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 20 21:04:44 2011 +0000
Updating manual;
commit e8126c405165ccab43a5f87d5727fd8708e207c0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 20 20:25:06 2011 +0000
Link generator is online.
commit 5e9ad8fe928922ba6c470787c6a34ed18e18deb3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 20 18:44:16 2011 +0000
Added some changes for the operating system.
commit 936a7c27a4241a4edc118d82c12765bfcaf6090b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 20 17:49:15 2011 +0000
4 types out of 8 are done.
commit 5c80f92dc8edb28a3cf6b859fe6315352b6bc9ec
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 20 15:47:54 2011 +0000
Example of scaffold links:
[1,18]<stdout>:Path1: 3000018
[1,18]<stdout>: Length: 55445
[1,18]<stdout>: Position: 55431
[1,18]<stdout>: Coverage: 43
[1,18]<stdout>: PathStrand: F
[1,18]<stdout>: ReadStrand: F
[1,18]<stdout>: ReadLength: 50
[1,18]<stdout>: PositionInRead: 0
[1,18]<stdout>:Path2: 20
[1,18]<stdout>: Length: 42705
[1,18]<stdout>: Position: 42636
[1,18]<stdout>: Coverage: 63
[1,18]<stdout>: PathStrand: F
[1,18]<stdout>: ReadStrand: F
[1,18]<stdout>: ReadLength: 50
[1,18]<stdout>: PositionInRead: 0
commit a877b6922e5eb190069241a209227e38d29cb9a8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 19 23:39:08 2011 +0000
The scaffolder is starting to be pretty good.
commit 484c07e7b13bc709ed323f7c0858b29c15e9d25a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 19 21:15:57 2011 +0000
Great leap forward for my scaffolder.
almost done.
commit 1ca29ee061a27ab1893172ac31c1ee1de956752b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 19 17:06:33 2011 +0000
The slave and master modes are printed
The MPI ranks are also printed.
commit e332d6a598dc7ca3033700ba286cde89b8768f8f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 19 16:38:42 2011 +0000
The Scaffolder now uses the Virtual Communicator.
commit d90a364c37aff8ce221170bbd3d6ab08cd4444e2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 19 15:48:27 2011 +0000
There is now only one instance of the Virtual Communicator.
Sébastien
commit bfd743001479f0bf6bee87d7bfbb0c7edea3e306
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 19 14:26:18 2011 +0000
small change
commit 71d1171e1d0a579344583a32f9b1e1999f119d10
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 19 14:06:50 2011 +0000
Sending code to ls28
commit 387898b1faafe8bbdca4bb867f7c37c55542996a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 19 00:45:32 2011 +0000
Pseudocode for the scaffolder link generation
commit ba671a9526a819fd77f6c0ea5c142b1cebf0919c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed May 18 20:11:46 2011 +0000
Working on the scaffolder now.
commit a7edd4cfa64d1d5de996ff76fe86345cc8f1b588
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed May 18 00:28:45 2011 +0000
#235
scaffolder makes it debug.
* Slave modes, master modes and MPI tags are generated with macros for method
commit e1ec2ed53e495b4980e3add020287c3d6521ab84
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 17 17:35:34 2011 +0000
New algorithm for seeds.
commit 82b206e18570393e7a39654079586e2b46355613
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 17 16:13:07 2011 +0000
Removed the printing of addLibraryData
commit 2b4ffa9bbf927ac1f9c9414ccb6188731aebf38d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 17 16:11:24 2011 +0000
* Ray now writes the statistics for seed lengths to a file.
commit 09a81b2142a47a7c554573213965ebd3a640cae3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 17 03:18:10 2011 +0000
possibly fixed a bug regarding ticket #290: manual and automatic detection don't work when mixed...
commit 66e06b3d87d223fbd78b0896cf14aa96182a8e66
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue May 17 02:38:03 2011 +0000
Sending new version of peak finder.
commit 6b18678dc81ac25e91e9e491292886d6b30060d6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 13 17:26:31 2011 +0000
Sending code fix.
commit cee4732f6d055d8e7b8d9e6f7bab6a2bfa28290d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 13 16:40:20 2011 +0000
Fixed a bug: out of range.
commit 2c49c79295baa925888b30920f6a61deae18d2c8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 13 16:13:54 2011 +0000
Ray now writes a file with coverage statistics and a file with library numbers.
commit f0bfc23a67bd1720a95b0b631eb94d20308f2b68
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 13 15:29:54 2011 +0000
Add/Change #268 (consider dnGASP coverage)
New algo utilises derivatives.
commit fb65a182a08220c981c71b3bd3a567702b092621
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 13 03:31:37 2011 +0000
Diff
commit e95a717f8cafcaa2e7573e2af615ccec8a0e2e32
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 13 03:15:23 2011 +0000
New algorithm to find peak.
commit 9bb7288e29292f40cfc47fb30e7b9f42a9603223
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 20:08:09 2011 +0000
adding profiling scripts.
commit c933825b1ce56be4aa66d9e7a3137b0950bdcd87
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 19:36:00 2011 +0000
Add/Change #267 (add a flag to show the ending context)
commit 35ae1d80841b2f878d48ea6e81466b4732643e28
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 19:25:40 2011 +0000
Add/Change #265 (add a switch to turn on bubble debug mode)
commit d0977c4c7d645b45287de60f356ed321f934ae1f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 19:03:32 2011 +0000
Add/Change #264 (add a switch to turn on seed debug mode)
commit 1bad3d8df0881699ad1fabfe540c80ae5f15db33
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 18:59:10 2011 +0000
Add/Change #266 (add a switch to turn one memory usage reporting)
commit 1ebbb12392207123967135cebae373ff5687cf65
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 18:15:11 2011 +0000
Add/Change #263 (add a switch to turn on profiler)
done
commit 1eb7d29c735f6a73dbb59f8211188275a0274e40
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 18:07:49 2011 +0000
New license file
commit 288d9d0a7c2b630b800094b5f2cd168419dad3e1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 18:07:12 2011 +0000
removed files
commit b72354199693a64b2fb4ca088887f76e7f7455ff
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 18:05:49 2011 +0000
Sending code with new makefile
commit 4a14ba1f5366eb2f49d03a48c0efc2894159cf94
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 18:00:41 2011 +0000
sending new code.
commit 7b4a5da6bbf0fcf8cec136090e1682f1365f5c41
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 17:57:27 2011 +0000
Removing the configure script.
commit 5baad61b436b91b15c849618856392dba2976165
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 17:47:16 2011 +0000
working on switches for
seed debug mode #264
profile mode #263
bubble debug mode #265
commit a56f3e8a6fafbb895f93f354009adf21b559d073
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 12 14:27:08 2011 +0000
Fixed bubbles code
- both paths can have any coverage.
commit 1bc21bdd1f412f5ff521bff588bd663583fe2451
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat May 7 02:40:54 2011 +0000
Add/Change #262 (some vertices don't have a coverage value in the depth first search)
commit 022308cf737bae1cdb0aab9dc2bf0c5552a1ac89
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri May 6 19:50:14 2011 +0000
Fixed a bug in which some vertices would not have coverage values.
commit ca90c1bd449d892194be34a0006ffa4a0b94bcd7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu May 5 18:53:40 2011 +0000
Add/Change #261 (design new way to compute seeds)
commit de82d0acdbf66c2eae3b6f4a3a8d914d8cbefb1d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 30 14:26:25 2011 +0000
Ticket #259 (new enhancement)
halve the seeds
--ncement) This line, and those below, will be ignored--
M code/SeedingData.cpp
M code/SeedExtender.h
M code/SeedExtender.cpp
commit cca6a358bc3265a1af7eac6a54387f44b438deb6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 30 01:28:20 2011 +0000
Sending some work in progress.
commit 9abe774aa462bb91bd8ab1ae08a78e3fb3a0cafd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 27 19:16:53 2011 +0000
added a real-time timer
commit c92fe1b866f233392d103c6b7bf44e6c035e7cce
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 26 15:53:26 2011 +0000
Changed the seed coverage.
see #253
commit 8fb5ae58653c51e50a431553bbe6493599ab794c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 21 20:11:21 2011 +0000
ajout d'un fichier.
commit 5ffabfd9e2440b57f42d8e5da95b326698ef2582
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 21 20:06:12 2011 +0000
The seed coverage is now set to the minimum coverage
commit ad276f5b458f85576bf5fcfa2e3af36200cf4a42
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 20 21:31:14 2011 +0000
Adding debug messaging for profiling purposes.
commit adeba67b6539de7f0f3522f7008edd53390a7d31
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 14 20:45:26 2011 +0000
Sending new manual
commit c5a0627bcbca3b3816e2e0629f18eae7b980cf3e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 13 19:48:36 2011 +0000
Ready to launch a computation on the colosse.
commit 7fa80143ea7cb2eba9485f611e5f5088912941d5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 13 16:27:04 2011 +0000
Updating manual
commit 2565c097d302a54aebae73273efd8b0c730ad56c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 13 16:15:54 2011 +0000
added that mpic++ must be in the path.
commit e95af63ac05cd573cae5bc8caf1f2efcdaf55b63
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 13 16:07:05 2011 +0000
playing with grid tables.
commit 05254d60be6a1430a4bd0a905df2ba60d41b3fcb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 12 17:54:31 2011 +0000
added a marker in the output.
commit 26ef69ba19b94503e22207e0db8b7cc52b910ed8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 11 17:28:37 2011 +0000
Add/Change #238 (Remove the limitation on the maximum number of libraries.)
Sébastien
commit f2b37670a16fe6792c6d81b4ec3ac59ee70f4a90
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 11 15:35:09 2011 +0000
Corrected the error message for the simulator.
commit 3738ba513f0cb3f0a4b35459323c5effa442d71f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 22 13:38:50 2011 +0000
removed large files
commit 4da7a01c6d818fe94ed9e95a737b3040720c64de
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 22 13:28:08 2011 +0000
Added string.h for memcpy
added iostream for cout.
commit 4c1e75ceccf9f330a717bdca7d66a56d89b4c8ab
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 22 13:25:53 2011 +0000
Corrected a compilation error.
commit 8799acbe50ce8953629629798b1865deda40dc13
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 22 13:21:42 2011 +0000
Recompiled the manual.
commit 0d4fbba4531d9b7fa730e1ba3babffdb9cead308
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 21 23:03:28 2011 +0000
updated the manual
commit 18e5058f041a35ecdab3d6a3eef5fab945c52440
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 21 22:47:41 2011 +0000
* Changed 'Completion of assembly' to 'Total'
* Added percentage of flushed messages.
commit 628a29a01d999f298517cbd18df9c4dabfb514aa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 21 20:47:48 2011 +0000
ajout du logo
commit b01cee22fe9e7bfcf79ccf9faa186a6d75ab73a9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 21 17:24:38 2011 +0000
Version for unit tests.
commit 9ca54362c3f95580666c0ad487c37794b3bd7e04
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 20 18:39:38 2011 +0000
Activated HUNTBUG Mode
commit d2384af630ec82a6a0418a08704fb2f406be5430
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 20 18:39:04 2011 +0000
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
L1-L3.sh.Ray & 42 & 4628137 & 110193 & 161412 & 371980 & 0.9974 & 0 & 6 & 0 \\
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 73 & 4598691 & 62995 & 133448 & 285886 & 0.9889 & 2 & 2 & 4 \\
commit 53f2cd6544205ec192b82998781ca5513fd5d8ad
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 20 17:25:39 2011 +0000
Sending stuff.
commit ecf95b47a0fa1f976261257ca9730d76192257c4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 18 22:42:42 2011 +0000
Envoyer nouvelle version
commit 0364b1de86337d42adceef7fab55a6f1a7f2c407
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 18 19:38:56 2011 +0000
Fixed probably the infinite loop.
commit ec159c50dbd22fe05bf65d281c400121cf4316e6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 18 14:52:12 2011 +0000
Sending stuff.
A
* Now a mate is not added if the distance is not OK in the first place
Before, it was added and later removed because of the distance..
commit f9874f400e6a36bc1b4b96e87fca459f00fb3d10
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 18 04:30:04 2011 +0000
Added debug messages for IDs:
667867000413 and 3070752000416
commit 5f243d084ebd85c4d75e6bf49647e25efd045ec3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 17 11:23:36 2011 +0000
Catching infinite loop.
commit 2909e014c7f153795ab9d77f32470a7b3691e7eb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 17 11:19:51 2011 +0000
stop the infinite loop
commit bbba51075fbfd45809d1b75fce3c7b8ece0fd3c4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 17 11:17:08 2011 +0000
Dded code.
commit e31d5f3eb3e5334fd48c581d97b4ae2185a0c64d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 16 21:00:32 2011 +0000
Fixed a bug regarding timer : 15000 days is impossible.
commit 225a41f30bda6afb84f80029617933b92cb25b79
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 16 17:48:08 2011 +0000
Updated makefile
commit 405516a2da4cdf95d8aac43c9a86562f849db9e2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 16 17:03:14 2011 +0000
Call the constructor of timer
commit be38065204f9288570756ea0913c13fc3e9ec33c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 16 02:51:55 2011 +0000
Updated the manual
commit 5fbc17360d708d32c448d3a6b1fa33a0493621a1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 16 02:15:00 2011 +0000
Fixed a bug.
assertion made no sense.
commit ec12534365e4f84c020bd27ddfed854256b9ba5c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 16 01:46:31 2011 +0000
Added timers.
commit 7c0d8317b934671c3928fe816164cbc75da292d0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 15 01:23:26 2011 +0000
added debug outputs and stuff.
commit f61f3bd26037014b90cc9baf90a4a47b9f259ed8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 14 22:24:10 2011 +0000
envoi de trucs.
commit f99c80573e3851e204e255d3e95ea30d7b52271b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 14 12:51:18 2011 +0000
#228 (finishing fusions exaust memory)
Beginning of computation: 3 seconds
Distribution of sequence reads: 1 minutes, 21 seconds
Distribution of vertices & edges: 14 minutes, 34 seconds
Calculation of coverage distribution: 4 seconds
Indexing of sequence reads: 16 minutes, 23 seconds
Computation of seeds: 11 minutes, 3 seconds
Computation of library sizes: 3 minutes, 37 seconds
Extension of seeds: 2 hours, 4 minutes, 19 seconds
Computation of fusions: 2 hours, 27 minutes, 43 seconds
Collection of fusions: 8 seconds
Completion of the assembly: 5 hours, 19 minutes, 15 seconds
Rank 0 is appending its fusions
Rank 0 appended 2806 elements
Rank 0: VmData= 1837632 KiB
Rank 1 is appending its fusions
Rank 1 appended 2768 elements
Rank 1: VmData= 1836052 KiB
Rank 2 is appending its fusions
Rank 2 appended 2786 elements
Rank 2: VmData= 1821968 KiB
Rank 3 is appending its fusions
Rank 3 appended 2701 elements
Rank 3: VmData= 1822700 KiB
Rank 4 is appending its fusions
Rank 4 appended 2692 elements
Rank 4: VmData= 1843320 KiB
Rank 5 is appending its fusions
Rank 5 appended 2759 elements
Rank 5: VmData= 1830784 KiB
Rank 6 is appending its fusions
Rank 6 appended 2641 elements
Rank 6: VmData= 1812868 KiB
Rank 7 is appending its fusions
Rank 7 appended 2770 elements
Rank 7: VmData= 1828424 KiB
Rank 8 is appending its fusions
Rank 8 appended 2869 elements
Rank 8: VmData= 1845748 KiB
Rank 9 is appending its fusions
Rank 9 appended 2873 elements
Rank 9: VmData= 1839756 KiB
Rank 10 is appending its fusions
Rank 10 appended 2938 elements
Rank 10: VmData= 1862944 KiB
Rank 11 is appending its fusions
Rank 11 appended 2983 elements
Rank 11: VmData= 1868592 KiB
Rank 12 is appending its fusions
Rank 12 appended 2854 elements
Rank 12: VmData= 1846156 KiB
Rank 13 is appending its fusions
Rank 13 appended 2839 elements
Rank 13: VmData= 1858916 KiB
Rank 14 is appending its fusions
Rank 14 appended 2930 elements
Rank 14: VmData= 1853580 KiB
Rank 15 is appending its fusions
Rank 15 appended 2944 elements
Rank 15: VmData= 1847292 KiB
Rank 16 is appending its fusions
Rank 16 appended 2792 elements
Rank 16: VmData= 1844588 KiB
Rank 17 is appending its fusions
Rank 17 appended 2873 elements
Rank 17: VmData= 1845200 KiB
Rank 18 is appending its fusions
Rank 18 appended 2890 elements
Rank 18: VmData= 1849056 KiB
Rank 19 is appending its fusions
Rank 19 appended 2874 elements
Rank 19: VmData= 1843352 KiB
Rank 20 is appending its fusions
Rank 20 appended 2816 elements
Rank 20: VmData= 1852544 KiB
Rank 21 is appending its fusions
Rank 21 appended 2881 elements
Rank 21: VmData= 1856508 KiB
Rank 22 is appending its fusions
Rank 22 appended 2927 elements
Rank 22: VmData= 1857268 KiB
Rank 23 is appending its fusions
Rank 23 appended 2841 elements
Rank 23: VmData= 1856796 KiB
Rank 24 is appending its fusions
Rank 24 appended 2924 elements
Rank 24: VmData= 1863820 KiB
Rank 25 is appending its fusions
Rank 25 appended 2848 elements
Rank 25: VmData= 1845736 KiB
Rank 26 is appending its fusions
Rank 26 appended 2877 elements
Rank 26: VmData= 1843440 KiB
Rank 27 is appending its fusions
Rank 27 appended 2900 elements
Rank 27: VmData= 1846052 KiB
Rank 28 is appending its fusions
Rank 28 appended 2895 elements
Rank 28: VmData= 1848756 KiB
Rank 29 is appending its fusions
Rank 29 appended 2989 elements
Rank 29: VmData= 1855048 KiB
Rank 30 is appending its fusions
Rank 30 appended 2921 elements
Rank 30: VmData= 1860988 KiB
Rank 31 is appending its fusions
Rank 31 appended 2881 elements
Rank 31: VmData= 1863296 KiB
gg
commit d5c9839b5bac537397413f711636c5af6fb3cada
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 13 02:57:46 2011 +0000
Sending stuff back to ls30
commit ddab59cc284334eca1c0382c546fd8f00c893623
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 12 04:16:33 2011 +0000
Fixed the makefile
commit d5f0735c7ca4118ae0eb3422bf1d89a1a9017601
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 12 04:11:27 2011 +0000
#224 (fetch reads by storing a list of 'mates to meet')
commit 9783db07b65c0a0cbd278a3ce6c38473b06a2981
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 11 17:03:51 2011 +0000
sending stuff.
new makefile
commit 2e96227f840c9b40b557708e3626d4366d2f19ee
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 11 16:32:42 2011 +0000
Adding the vertex messenger
commit f60a54c85d7428fab662feaf5a0037409f872056
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 10 23:45:15 2011 +0000
#224 (fetch reads by storing a list of 'mates to meet')
commit ef8a5328234802e3a74e684ebaef7791431ff543
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 9 18:05:29 2011 +0000
commit b7680d63f85ca1680a307861e066d0e2b0cde9d3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 9 16:38:04 2011 +0000
Removed the on-disk allocator.
commit e1ffc85e4dc11a2ffed1fe2178a16fce620c1928
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 8 23:37:43 2011 +0000
private now
commit 4cf6755c60bfa4217a1dacf68248faa2774d209b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 8 21:28:33 2011 +0000
Optimised the on-disk allocator.
#221 (caching takes too much memory)
commit 2402a0b1ef96f3f26fa65aa987239d1fedb3746c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 8 18:28:48 2011 +0000
Implemented an on-disk allocator.
#221 (caching takes too much memory)
commit 4ecdf7be9e86f0ea832e3083337875faf480fdb3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 8 06:04:45 2011 +0000
Added a disk allocator.
commit 8da1706cffaccd2568a6d003f12f6e082fe24846
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 7 03:53:04 2011 +0000
Updated version number.
<
commit 246d1d800ac3913b87d325ca9991d20f7487ea10
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 7 03:49:10 2011 +0000
[1,0]<stdout>: Beginning of computation: 1 seconds
[1,0]<stdout>: Distribution of sequence reads: 59 seconds
[1,0]<stdout>: Distribution of vertices & edges: 20 minutes, 58 seconds
[1,0]<stdout>: Calculation of coverage distribution: 8 seconds
[1,0]<stdout>: Indexing of sequence reads: 27 minutes, 11 seconds
[1,0]<stdout>: Computation of seeds: 19 minutes, 37 seconds
[1,0]<stdout>: Computation of library sizes: 5 minutes, 43 seconds
[1,0]<stdout>: Extension of seeds: 2 hours, 4 minutes, 33 seconds
[1,0]<stdout>: Computation of fusions: 2 hours, 4 minutes, 51 seconds
[1,0]<stdout>: Collection of fusions: 10 seconds
[1,0]<stdout>: Completion of the assembly: 5 hours, 24 minutes, 11 seconds
commit b766103503b61bb3a2aa799e242493ab5b7e2afa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 6 21:36:38 2011 +0000
Potentially fixed a bug.
commit d577930059ce6e7dbb69420723a6108fd6fd74fd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 6 17:49:22 2011 +0000
#217 (* Reads list for a repeated vertex is cached during the extension.)
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 89 & 1973378 & 22172 & 39956 & 128050 & 0.9664 & 0 & 0 & 0 \\
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 75 & 4597931 & 61305 & 133448 & 285886 & 0.9888 & 2 & 2 & 4 \\
commit f59b45a5e3df272515b11e60a62a859a95ecffb7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 6 17:11:29 2011 +0000
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 89 & 1974326 & 22183 & 39956 & 128050 & 0.9668 & 0 & 0 & 0 \\
commit 50d9b033eff500c25aeebf8680c42236aace3ba6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 6 16:21:04 2011 +0000
#219 (It hangs at Fusions)
commit 78e3501ec22a9ca2baa09c5e7fa475888911393c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 4 19:59:23 2011 +0000
removed useless file.
commit 03385ff944a094b8cdbb7b39f4e0b51389a910f6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 4 19:55:59 2011 +0000
* Reads marked on repeated vertices are cached during the extension.
commit 4bdd9b959ff1eca76dbe47e482b5c81dec103041
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 4 18:45:40 2011 +0000
merged "RAY_MPI_TAG_GET_COVERAGE_AND_MARK" with "RAY_MPI_TAG_REQUEST_READS",
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
300-strept.sh.Ray & 79 & 2007040 & 25405 & 48138 & 139185 & 0.9819 & 0 & 0 & 0 \\
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 89 & 1983998 & 22292 & 39956 & 128050 & 0.9720 & 0 & 0 & 0 \\
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 73 & 4597899 & 62984 & 133448 & 285886 & 0.9888 & 2 & 2 & 4 \\
commit 0cbb1e7eebdafdac33d612a916f49df56b16c709
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 4 17:04:22 2011 +0000
merged RAY_MPI_TAG_REQUEST_VERTEX_OUTGOING_EDGES and RAY_MPI_TAG_GET_COVERAGE_AND_MARK,
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
300-strept.sh.Ray & 77 & 2010512 & 26110 & 45529 & 139140 & 0.9865 & 0 & 1 & 0 \\
commit 9f1634caf3e8d695d7fc3448ddf1a57c7511a878
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 4 16:54:53 2011 +0000
RAY_MPI_TAG_SAVE_WAVE_PROGRESSION is grouped with RAY_MPI_TAG_REQUEST_VERTEX_COVERAGE (done)
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
300-strept.sh.Ray & 78 & 2012891 & 25806 & 45529 & 139140 & 0.9865 & 0 & 1 & 0 \\
commit c4bced46f8cfae4212f3364b23d9c6966a678024
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 3 18:45:46 2011 +0000
Polished the code a little and added two files for read fetching.
-seb
commit dfa173070828d2da75cc3269d663f49cd21601af
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 3 17:25:28 2011 +0000
* A read is not added in the active set if it is marked on a repeated vertex
and its mate was not encountered yet.
commit b93a460216ad85c6c303f8a18cd3c39f77779368
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 1 22:29:03 2011 +0000
commit 59e32807e86147e701ad7955014321e1e03553e1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 1 05:15:26 2011 +0000
#214 (THere are length-4 sequences with reusing memory)
#213 (in the extension, use expiry position for reads too. and remove the inner loop when there is only one choice.)
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 79 & 4601391 & 58245 & 126519 & 269119 & 0.9895 & 3 & 6 & 4 \\
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 92 & 2007185 & 21817 & 36757 & 128935 & 0.9830 & 0 & 0 & 0 \\
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
300-strept.sh.Ray & 80 & 2008191 & 25102 & 42620 & 139140 & 0.9810 & 0 & 0 & 0 \\
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
L1-L3.sh.Ray & 41 & 4629914 & 112924 & 177402 & 409463 & 0.9976 & 0 & 0 & 0 \\
commit 3d032786590fecb264ef00b17f595e1b66463f98
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 28 21:06:44 2011 +0000
Added entry in changelog.
commit a1d588be9f18b4af2c548c7f5ad00bd44d5d6120
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 28 21:05:44 2011 +0000
implemented this:
#206 (Hide vertices with coverage 1 before doChoice)
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 76 & 4596184 & 60476 & 118630 & 210413 & 0.9886 & 2 & 7 & 4 \\
commit 164e38cb5f93f80836eda66bb0d142249a5e279a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 28 15:11:07 2011 +0000
Not reproducible
#203 (all observations in Library.cpp are 'F' + 'R')
[1,4]<stdout>:d=275 lId=21721000023 rId=90686000008 pLeft=76 pRight=301 lStrand=R rStrand=F leftStrandPos=0 rightStrandPos=0 RightLength=50
[1,14]<stdout>:d=313 lId=137664000002 rId=68699000017 pLeft=42 pRight=305 lStrand=F rStrand=R leftStrandPos=0 rightStrandPos=0 RightLength=50
[1,14]<stdout>:d=313 lId=137664000002 rId=68699000017 pLeft=42 pRight=305 lStrand=F rStrand=R leftStrandPos=0 rightStrandPos=0 RightLength=50
[1,14]<stdout>:d=277 lId=8605000020 rId=77570000005 pLeft=46 pRight=273 lStrand=R rStrand=F leftStrandPos=0 righ^Crand=R rStrand=F leftStrandPos=0 rightStrandPos=0 RightLength=50
[1,9]<stdout>:d=275 lId=82122000003 rId=13157000018 pLeft=49 pRight=274 lStrand=R rStrand=F leftStrandPos=0 rightStrandPos=0 RightLength=50
[1,9]<stdout>:d=290 lId=66665000009 rId=135631000023 pLeft=25 pRight=265 lStrand=F rStrand=R leftStrandPos=0 rightStrandPos=0 RightLength=50
[1,9]<stdout>:d=290 lId=66665000009 rId=135631000023 pLeft=25 pRight=265 lStrand=F rStrand=R leftStrandPos=0 rightStrandPos=0 RightLength=50
[1,9]<stdout>:d=300 lId=133427000009 rId=64462000024 pLeft=24 pRight=274 lStrand=R rStrand=F leftStrandPos=0 rightStrandPos=0 RightLength=50
[1,9]<stdout>:d=300 lId=133427000009 rId=64462000024 pLeft=24 pRight=274 lStrand=R rStrand=F leftStrandPos=0 rightStrandPos=0 RightLength=50
[1,25]<stdout>:d=259 lId=56384000011 rId=125350000025 pLeft=27 pRight=236 lStrand=R rStrand=F leftStrandPos=0 rightStrandPos=0 RightLength=50
[1,25]<stdout>:d=259 lId=56384000011 rId=125350000025 pLeft=27 pRight=236 lStrand=R rStrand=F leftStrandPos=0 rightStrandPos=0 RightLength=50
[1,17]<stdout>:d=300 lId=28147000025 rId=97112000010 pLeft=12 pRight=262 lStrand=R rStrand=F leftStrandPos=0 rightStrandPos=0 RightLength=50
commit 1a26404604565a62d93c580f4c7e5135dbe77462
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 28 15:03:31 2011 +0000
Ticket done: #204 (add VirtualCommunicator in Library.cpp too)
* fixed memory usage for this step.
commit 95681f00f0f334062d49fe91ecb18dd76d0effc0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 28 00:48:25 2011 +0000
#204 (add VirtualCommunicator in Library.cpp too)
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 82 & 2014394 & 24565 & 45817 & 143847 & 0.9859 & 0 & 0 & 0 \\
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
300-strept.sh.Ray & 78 & 2001635 & 25661 & 45529 & 128021 & 0.9808 & 0 & 1 & 0 \\
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 78 & 4601509 & 58993 & 118457 & 210407 & 0.9896 & 2 & 7 & 4 \\
[1,0]<stdout>:Library # 0 (Automatic) -> average length: 215 and standard variation: 10
[1,0]<stdout>:Library # 1 (Automatic) -> average length: 487 and standard variation: 19
[1,0]<stdout>:Library # 0 (Automatic) -> average length: 216 and standard variation: 11
[1,0]<stdout>:Library # 1 (Automatic) -> average length: 489 and standard variation: 20
commit 0cb6df55f4dbe374fd685fbeede794325fa4546e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 27 22:03:22 2011 +0000
NJow I only need to change the number of workers.,
commit f3e2c61bec709aadcdebfdefc30f9935b725a920
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 27 18:13:04 2011 +0000
Library now uses virtual communications.
#204 (add VirtualCommunicator in Library.cpp too)
commit 5e1d191f2fcbf28b6d0a84789f3295377def88ab
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 26 22:52:36 2011 +0000
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
300-strept.sh.Ray & 78 & 2001927 & 25665 & 45529 & 128021 & 0.9807 & 0 & 1 & 0 \\
commit c14c4ef44c0dd1a18d1830a300a4e560a8ed805e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 26 02:31:31 2011 +0000
#204 (add VirtualCommunicator in Library.cpp too)
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 82 & 2009598 & 24507 & 45817 & 143847 & 0.9859 & 0 & 0 & 0 \\
commit 97a37cd7d807b5a1a66b2f70827d4ed70edb9deb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 23 16:14:37 2011 +0000
Updated change log
commit 3d40491d3d47826715ad32e798f706d9ee5e09ee
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 23 16:00:06 2011 +0000
Sending stuff.
commit 827f006ae06d23f1c26de05e2c9e7a3bc2ae58f7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 23 15:21:24 2011 +0000
Updated scripts; manual and CHangelog
commit 8d36962e9fbb8189ef381c155960888f006b2703
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 22 22:33:33 2011 +0000
Fixed stuff.
commit a6b21304784bec86189e94d6bf9db1ff8a87ce8c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 22 04:53:35 2011 +0000
commit 9dea8bb06f98ed3b3559040dc58606fdde974ee1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 21 02:23:54 2011 +0000
Added some verbosity
commit e680bdbf2d9dc08445b58e080aab97dd13220c07
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 21 02:19:20 2011 +0000
Updated makefile.
commit 1b2a04af8bb7da2511ce7ca23c3a7626ba7324a8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 20 16:22:07 2011 +0000
Ok ready for paper submission.
commit ab4c43f9347235cbef8585a67451bbacd196a080
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 20 06:56:22 2011 +0000
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 79 & 4600771 & 58237 & 126779 & 269428 & 0.9895 & 2 & 7 & 4 \\
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 80 & 2025101 & 25313 & 47929 & 178519 & 0.9864 & 0 & 0 & 0 \\
commit 1ef40452ca32f6f7530fdec371d3a597057fc801
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 20 03:13:42 2011 +0000
The place where to index a read is carefully choosed now.
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 85 & 2020909 & 23775 & 42873 & 143743 & 0.9864 & 0 & 0 & 0 \\
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 78 & 4592465 & 58877 & 126779 & 269428 & 0.9884 & 2 & 8 & 4 \\
commit cd022234a9f8ef832f3f60950b7a8de3fc3ab12e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 20 01:30:51 2011 +0000
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 82 & 4593587 & 56019 & 113679 & 269370 & 0.9884 & 2 & 6 & 6 \\
commit 97d07119128e936b369c359d291132c1a3c6aa9f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 19 22:29:12 2011 +0000
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 93 & 4589864 & 49353 & 101161 & 210313 & 0.9876 & 3 & 11 & 4 \\
commit 006dee4d2e8c571a9bc0793f39b13ca4b726249a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 19 18:25:53 2011 +0000
Work is under way to index reads on the good vertex.
commit a7e47fb4a8df4df4c55bd8e8368238e9d39e9e92
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 19 15:56:18 2011 +0000
The maximumum allowed coverage is now 65535.
commit 6eef22515d00875a6d05a9c5e5ef93f5fadaebfb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 19 04:12:58 2011 +0000
adding a simulator that uses boost
commit 2472f4a7ee945f2366df08df04388c92d5ef828d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 18 18:38:26 2011 +0000
L1
^[# % & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
L1 & 125 & 4505611 & 36044 & 75241 & 327317 & 0.9697 & 1 & 26 & 0 \\
Strept
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 88 & 1989158 & 22604 & 42483 & 127947 & 0.9762 & 0 & 0 & 0 \\
SRA001125
-bash.Ray & 71 & 4593938 & 64703 & 133379 & 312174 & 0.9886 & 2 & 11 & 4 \\
2: one repeat collapse (-100) and the other is 400 nucleotides that are linked but should not be
-seb
commit 879d95b9b2a13f046b33edd0798c3b29d9e8c62b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 16 23:51:29 2011 +0000
Now ready for another run on the human genome.
commit 4456427439fb39f8252b25f48f80ecb9cfbbb43b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 16 20:15:20 2011 +0000
commit 936ae8f2f47399254a85696a638e9b380dba18a1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 15 21:15:48 2011 +0000
Fixed:
Add/Change #198 (MessageProcessor::call_RAY_MPI_TAG_GET_PATH_LENGTH(Message*): Assertion `m_fusionData->m_FUSION_identifier_map.count(id)>0')
Add/Change #197 (Memory usage for vertices)
Add/Change #168 (common_functions.cpp:503: warning: format ‘%lu’ expects type ‘long unsigned int’, but argument 3 has type ‘uint64_t’)
Add/Change #181 (Memory usage for Ray)
new
coli-mpich2.sh.Ray & 77 & 4594365 & 59667 & 126519 & 269064 & 0.9886 & 3 & 12 & 4 \\
strept-mpich2-simulated-errors-longer.sh.Ray & 76 & 1896115 & 24948 & 39101 & 111237 & 0.9303 & 0 & 22 & 0 \\ NOT OK
ray.sh.Ray & 60 & 4592951 & 76549 & 118331 & 409463 & 0.9897 & 1 & 5 & 0 \\ OK
strept-mpich2-simulated-errors.sh.Ray & 150 & 1988139 & 13254 & 24093 & 77992 & 0.9742 & 0 & 9 & 0 \\ OK
strept-mpich2.sh.Ray & 95 & 1999524 & 21047 & 36692 & 127935 & 0.9832 & 0 & 0 & 0 \\
old
coli-mpich2.sh.Ray & 80 & 4593723 & 57421 & 126519 & 269064 & 0.9884 & 3 & 15 & 8 \\
strept-mpich2-simulated-errors-longer.sh.Ray & 81 & 1972604 & 24353 & 38881 & 88304 & 0.9656 & 1 & 27 & 0 \\
ray.sh.Ray & 62 & 4552263 & 73423 & 121858 & 371980 & 0.9812 & 0 & 0 & 0 \\
strept-mpich2-simulated-errors.sh.Ray & 152 & 1992851 & 13110 & 24093 & 77992 & 0.9769 & 0 & 11 & 0 \\
strept-mpich2.sh.Ray & 96 & 2010469 & 20942 & 39940 & 143743 & 0.9878 & 0 & 0 & 0 \\
commit 723a4ea0a3588107fd4419c479dad0c831e31023
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 14 20:30:40 2011 +0000
Grouped messages in finishing fusions.
commit 8f69264106460baf22283d4efbc8fc9ed41558c5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 13 05:02:32 2011 +0000
Added current vertex in output.
commit b75fd9e440f0ae04f6d9aa662534f28f0d293158
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 12 19:13:09 2011 +0000
Changements dans le code.
commit 6b3ec5f2011364dc7ff2a36e230331e6c954bcf8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 11 20:16:04 2011 +0000
Sending patch.
commit 447dc437c0358e9f772311fe932b35d32a18e520
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 9 05:23:02 2011 +0000
Added the option to pack things up.
commit 964a433f03e2710a8b7372dbeece194ddbaed3a9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 8 22:32:01 2011 +0000
Fixed makefile.alternate
commit bbd0960a0be3a21c6faefb251e1c824663144bc6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 8 22:27:45 2011 +0000
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 79 & 4592032 & 58126 & 126519 & 269064 & 0.9882 & 3 & 19 & 6 \\
commit 499d5538e88e45f4235d550744ef3267b6c6ca51
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 8 18:38:00 2011 +0000
* Force the packing of structures and classes if using gcc
* The memory for sequence reads is reused in the extension of seeds.
* Any vertex is stored along its reverse complement.
* The Vertex class was stripped to reduce the memory usage.
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 79 & 4592032 & 58126 & 126519 & 269064 & 0.9882 & 3 & 17 & 6 \\
commit f733b4c21b7db01a4c1792c4568ef50efa44d71b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 8 03:11:46 2011 +0000
Missing coverage.
commit 0663f59da4bd4ec46f311d44a3361eb6edb23000
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 6 20:29:48 2011 +0000
Fixed compilation error.
commit 598b0b7dc5fadea6182ff2be26cf168026d19347
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 6 20:25:37 2011 +0000
Reduced memory fragmentation in the extension of seeds.
commit 2a40f57f83aeec4dabdc1d535e61fcafa8bce812
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Feb 6 05:07:27 2011 +0000
Added a grid allocator.
commit 5c1d14027db9a1fba994413ef1c1edb2a603aefc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 5 18:52:56 2011 +0000
Version 1.2.3
commit 37578ce8e432033c9aac8e40bd8fe9072d38953d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 5 18:49:14 2011 +0000
Updated scripts.
commit b7076baa403bde3858be5ca474565eb45bfbb4ba
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 5 17:21:05 2011 +0000
Senidng changes.
commit eeb4c3d18b3d647c840e6343feea311e9891eb46
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Feb 5 04:06:28 2011 +0000
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 79 & 4572091 & 57874 & 126238 & 268486 & 0.9851 & 2 & 8 & 4 \\
commit dc4774ea53a02d61ba8ea532324ee651d8c48f2d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 4 23:42:00 2011 +0000
Fixed a bug.
commit 36f76b950d07127912c2ab37d4b9de9aa09acaeb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 4 23:01:02 2011 +0000
Sending stuff.
commit 6cc99cc80571c61418de738f201fefa339eb6102
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 4 22:49:55 2011 +0000
commit 3b8f74f3acab7e218c6e0526714778a580f1a986
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 4 22:14:14 2011 +0000
added a manual
commit ea48dd17580b2c4c0bbfceef3fb486f38ce6e530
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 4 21:34:45 2011 +0000
Adding file numbers.
commit fbfb8ef31d4404d35e810794adca8884555c01ff
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 4 20:31:08 2011 +0000
Fixed the assembly errors.
commit be1dbf296d94420f9e7e79503f41e15584f238b1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 3 15:42:01 2011 +0000
Add/Change #195 (remove the inner loop for doChoice)
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 83 & 4616837 & 55624 & 126519 & 252372 & 0.9897 & 3 & 30 & 8 \\
commit 86f1445c7ef547969cccc87bebae9af77d2cb125
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 2 23:59:27 2011 +0000
commit f87e4fafd35f0883900df29c02903b90a35b0069
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 2 03:15:26 2011 +0000
Removed some leaks.
commit 93e5c776c1039583ef37fc1cb8dec06cf865012f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 1 16:15:05 2011 +0000
Add/Change #153 (Reducer increases memory usage ?? (probably STL, it sucks so much LOL))
commit 503c42a90e0327063286c91ff1d875d42e596444
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 31 23:13:15 2011 +0000
Completion of the assembly: 8 minutes, 17 seconds
Rank 23: VmData= 114676 KiB
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 83 & 4615237 & 55605 & 126519 & 252371 & 0.9895 & 3 & 41 & 10 \\
:
commit 03d6dcc6a26a9e8e916b1176097a6788a87e780f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 31 03:17:20 2011 +0000
Sending stuff.
commit f6719f2df9fd3d151af402d572b0ce90fd07a774
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 31 02:53:20 2011 +0000
With SRA001125
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 82 & 4617353 & 56309 & 118119 & 222661 & 0.9898 & 3 & 26 & 4 \\
29
19934 20564 | 9339 8709 | 631 631 | 100.00 | 4639675 9339 | 0.01 6.76 | gi|49175990|ref|NC_000913.2| 29
257900 266608 | 8709 1 | 8709 8709 | 100.00 | 4639675 9339 | 0.19 93.25 | gi|49175990|ref|NC_000913.2| 29
2767308 2767917 | 1 610 | 610 610 | 88.09 | 4639675 9339 | 0.01 6.53 | gi|49175990|ref|NC_000913.2| 29
2768475 2769563 | 604 1691 | 1089 1088 | 86.62 | 4639675 9339 | 0.02 11.65 | gi|49175990|ref|NC_000913.2| 29
2774492 2775701 | 2731 3942 | 1210 1212 | 84.41 | 4639675 9339 | 0.03 12.98 | gi|49175990|ref|NC_000913.2| 29
3581450 3582080 | 8709 9339 | 631 631 | 100.00 | 4639675 9339 | 0.01 6.76 | gi|49175990|ref|NC_000913.2| 29
52
247507 257907 | 10907 507 | 10401 10401 | 100.00 | 4639675 10907 | 0.22 95.36 | gi|49175990|ref|NC_000913.2| 52
3581713 3582218 | 1 506 | 506 506 | 100.00 | 4639675 10907 | 0.01 4.64 | gi|49175990|ref|NC_000913.2| 52
100
1286017 1298721 | 1 12705 | 12705 12705 | 100.00 | 4639675 13333 | 0.27 95.29 | gi|49175990|ref|NC_000913.2| 100
1394063 1394695 | 12701 13333 | 633 633 | 100.00 | 4639675 13333 | 0.01 4.75 | gi|49175990|ref|NC_000913.2| 100
with 4 libraries
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 65 & 4625792 & 71166 & 121756 & 371980 & 0.9965 & 0 & 0 & 0 \\
strept
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 96 & 2006564 & 20901 & 37555 & 127935 & 0.9841 & 0 & 0 & 0 \\
Add/Change #172 (on using large distances to extend seeds)
commit 4df1153c0ff812a8f23ea69018df78911fbc4be0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 30 20:21:31 2011 +0000
4 libraries
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 63 & 4615670 & 73264 & 138099 & 371980 & 0.9944 & 0 & 0 & 0 \\
coli SRA001125
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 104 & 4882339 & 46945 & 81363 & 222661 & 0.9884 & 3 & 9 & 4 \\
62
247507 257907 | 10907 507 | 10401 10401 | 100.00 | 4639675 10907 | 0.22 95.36 | gi|49175990|ref|NC_000913.2| 62
3581713 3582218 | 1 506 | 506 506 | 100.00 | 4639675 10907 | 0.01 4.64 | gi|49175990|ref|NC_000913.2| 62
26
19934 20564 | 9339 8709 | 631 631 | 100.00 | 4639675 9339 | 0.01 6.76 | gi|49175990|ref|NC_000913.2| 26
257900 266608 | 8709 1 | 8709 8709 | 100.00 | 4639675 9339 | 0.19 93.25 | gi|49175990|ref|NC_000913.2| 26
2767308 2767917 | 1 610 | 610 610 | 88.09 | 4639675 9339 | 0.01 6.53 | gi|49175990|ref|NC_000913.2| 26
2768475 2769563 | 604 1691 | 1089 1088 | 86.62 | 4639675 9339 | 0.02 11.65 | gi|49175990|ref|NC_000913.2| 26
2774492 2775701 | 2731 3942 | 1210 1212 | 84.41 | 4639675 9339 | 0.03 12.98 | gi|49175990|ref|NC_000913.2| 26
3581450 3582080 | 8709 9339 | 631 631 | 100.00 | 4639675 9339 | 0.01 6.76 | gi|49175990|ref|NC_000913.2| 26
121
1286017 1298721 | 1 12705 | 12705 12705 | 100.00 | 4639675 13333 | 0.27 95.29 | gi|49175990|ref|NC_000913.2| 121
1394063 1394695 | 12701 13333 | 633 633 | 100.00 | 4639675 13333 | 0.01 4.75 | gi|49175990|ref|NC_000913.2| 121
Cool Cool
commit e3d7749bde8ff74a4c9405f02734aa7e3a38f296
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 30 01:38:58 2011 +0000
M trunk/scripts/mummer-validate.rb
M trunk/code/FusionData.h
M trunk/code/Chooser.cpp
M trunk/code/Machine.cpp
M trunk/code/OpenAssemblerChooser.cpp
M trunk/code/FusionData.cpp
M trunk/code/OpenAssemblerChooser.h
M trunk/code/ExtensionData.cpp
M trunk/code/MessageProcessor.cpp
M trunk/code/MyForest.cpp
M trunk/code/ExtensionData.h
M trunk/code/SplayTree.h
M|49175990|ref|NC_000913.2| 65
126025 129764 | 58983 62722 | 3740 3740 | 99.68 | 4639675 | 0.08 5.96 | gi|49175990|ref|NC_000913.2| 65
What is thy bidding, my master? grep 62702 2011-01-29-1454
[1,24]<stdout>:Ray says: extension-4000024 (44821 vertices) and extension-4000016 (57243 vertices) make a fusion, result: 62702 vertices.
[1,16]<stdout>:Ray says: extension-5000016 (57243 vertices) and extension-5000024 (44821 vertices) make a fusion, result: 62702 vertices.
---------------------------------------------------------------->
<---------------------------- 62702 ---------------------------->
--------------------------------------->
<---------------44821------------------><----------17881-------->
-------------------------------------------------->
<-- 5459 ----><-------------------------- 57243 ---------------->
* 59137 misassembly
position 53678
no
>contig-8000024 62722 nucleotides
---------------------------------------------------------------->
<---------------------------- 62702 ---------------------------->
-------------------------------------------------->
<-------------------------- 57243 ----------------><-- 5459 ---->
--------------------------------------->
<----------17881--------><---------------44821------------------>
* 59137 misassembly
position 53678
[1,16]<stdout>:CurrentVertex=GTCGCCTTCTACGGTGATCAG @3632
[1,16]<stdout>:Coverage=255
[1,16]<stdout>: # ReadsInRange: 97
[1,16]<stdout>:2 choices
[1,16]<stdout>:
[1,16]<stdout>:Choice #1
[1,16]<stdout>:Vertex: TCGCCTTCTACGGTGATCAGT
[1,16]<stdout>:Coverage=172
[1,16]<stdout>:New letter: T
[1,16]<stdout>:Single-end reads: (4)
[1,16]<stdout>:1 1 1 1
[1,16]<stdout>:Paired-end reads: (2)
[1,16]<stdout>:1027 1036
[1,16]<stdout>:
[1,16]<stdout>:Choice #2
[1,16]<stdout>:Vertex: TCGCCTTCTACGGTGATCAGC
[1,16]<stdout>:Coverage=255
[1,16]<stdout>:New letter: C
[1,16]<stdout>:Single-end reads: (98)
[1,16]<stdout>:8 7 5 9 9 7 6 9 9 4 1 7 9 5 4 9 5 9 1 8 7 7 5 6 6 3 5 6 9 4 4 8 4 1 6 5 7 4 3 9 4 6 5 9 6 9 4 7 6 5 8 5 4 5 4 4 7 5 9 1 6 8 6 5 5 1 6 6 7 5 4 5 4 8 4 1 9 4 7 6 5 2 9 6 1 2 6 6 5 1 8 4 9 8 8 7 1 8
[1,16]<stdout>:Paired-end reads: (26)
[1,16]<stdout>:195 1069 950 914 1081 3627 182 939 978 192 977 199 1026 209 1063 3625 978 902 1038 3579 941 3651 983 1082 187 210
[1,16]<stdout>:
[1,16]<stdout>:Selection: 2
no one should win !!
[1,0]<stdout>:Library # 0 (Automatic) -> average length: 199 and standard variation: 20
[1,0]<stdout>:Library # 1 (Automatic) -> average length: 998 and standard variation: 99
[1,0]<stdout>:Library # 2 (Automatic) -> average length: 3975 and standard variation: 399
[1,0]<stdout>:Library # 3 (Automatic) -> average length: 9861 and standard variation: 1002
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 72 & 4563779 & 63385 & 102906 & 311520 & 0.9829 & 0 & 0 & 1 \\
trunk/code/SeedExtender.cpp
commit 08a53545e5adc4b653c920900eeb2614ee2716f1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 28 03:45:27 2011 +0000
200, 1000, 10000
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 72 & 4626848 & 64261 & 108460 & 311520 & 0.9959 & 0 & 0 & 0 \\
SRA001125
[1,17]<stdout>:Rank 17: VmData= 97224 KiB
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 117 & 4641642 & 39672 & 80392 & 244416 & 0.9890 & 0 & 6 & 4 \\
commit 16c7ab9e62757b6974ebe176207e105e1d0acfe5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 27 16:58:17 2011 +0000
Fixed a bug with caching.
commit c095d46fbcbec71eb485c05b43e1c8dc43b081bc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 27 16:04:05 2011 +0000
Add/Change #193
MessageProcessor::call_RAY_MPI_TAG_GET_PATH_LENGTH(Message*): Assertion `m_fusionData->m_FUSION_identifier_map.count(id)>0' failed
commit 28b69d7911ce4346bb5c8f10ceef1e316761b262
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 27 05:35:00 2011 +0000
kmerAtPosition is no longer among the slowest functions
Flat profile:
Each sample counts as 0.01 seconds.
% cumulative self self total
time seconds seconds calls s/call s/call name
9.55 2.05 2.05 11270868 0.00 0.00 MyForest::find(unsigned long)
9.51 4.09 2.04 4087061 0.00 0.00 MyForest::insert(unsigned long)
4.94 5.15 1.06 96301663 0.00 0.00 MessagesHandler::receiveMessages(StaticVector*, RingAllocator*, int)
4.61 6.14 0.99 1 0.99 20.42 Machine::run()
4.24 7.05 0.91 9080187 0.00 0.00 SeedingData::computeSeeds()
3.29 7.76 0.71 96301663 0.00 0.00 Machine::sendMessages()
2.94 8.39 0.63 11939874 0.00 0.00 SeedExtender::doChoice(RingAllocator*, int*, StaticVector*, unsigned long*, ChooserData*, BubbleData*, int, DepthFirstSearchData*, int, ExtensionData*, int, int, OpenAssemblerChooser*, Chooser*, bool*, std::vector<std::vector<unsigned long, std::allocator<unsigned long> >, std::allocator<std::vector<unsigned long, std::allocator<unsigned long> > > >*, bool*, bool*, bool*, int, int*, bool*, std::vector<unsigned long, std::allocator<unsigned long> >*)
2.89 9.01 0.62 6135175 0.00 0.00 idToWord(unsigned long, int)
2.19 9.48 0.47 14615045 0.00 0.00 vertexRank(unsigned long, int)
1.86 9.88 0.40 7684564 0.00 0.00 RingAllocator::allocate(int)
1.82 10.27 0.39 96301663 0.00 0.00 MessagesHandler::sendMessages(StaticVector*, int)
1.82 10.66 0.39 11294673 0.00 0.00 kmerAtPosition(char*, int, int, char, bool)
1.82 11.05 0.39 5644008 0.00 0.00 complementVertex_normal(unsigned long, int)
1.72 11.42 0.37 3509577 0.00 0.00 SeedWorker::do_1_1_test()
commit 1024b5b2b749f3eb91e2a9cc52b671be9423c686
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 27 05:15:12 2011 +0000
Flat profile:
Each sample counts as 0.01 seconds.
% cumulative self self total
time seconds seconds calls s/call s/call name
9.38 2.36 2.36 11673565 0.00 0.00 MyForest::find(unsigned long)
7.99 4.37 2.01 4058067 0.00 0.00 MyForest::insert(unsigned long)
5.92 5.86 1.49 10343180 0.00 0.00 kmerAtPosition(char const*, int, int, char, bool)
5.25 7.18 1.32 1 1.32 24.75 Machine::run()
4.41 8.29 1.11 149385073 0.00 0.00 MessagesHandler::receiveMessages(StaticVector*, RingAllocator*, int)
4.29 9.37 1.08 11041433 0.00 0.00 SeedExtender::doChoice(RingAllocator*, int*, StaticVector*, unsigned long*, ChooserData*, BubbleData*, int, DepthFirstSearchData*, int, ExtensionData*, int, int, OpenAssemblerChooser*, Chooser*, bool*, std::vector<std::vector<unsigned long, std::allocator<unsigned long> >, std::allocator<std::vector<unsigned long, std::allocator<unsigned long> > > >*, bool*, bool*, bool*, int, int*, bool*, std::vector<unsigned long, std::allocator<unsigned long> >*)
3.42 10.23 0.86 8587307 0.00 0.00 SeedingData::computeSeeds()
3.06 11.00 0.77 149385073 0.00 0.00 MessagesHandler::sendMessages(StaticVector*, int)
3.02 11.76 0.76 6107011 0.00 0.00 idToWord(unsigned long, int)
2.72 12.45 0.69 149385073 0.00 0.00 Machine::sendMessages()
2.31 13.03 0.58 1087284 0.00 0.00 Read::trim(char*, char const*)
Add/Change #191 (don't use getSeq in ExtensionData)
commit fb8efa083b83588c30ffee4ed09026357b868440
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 27 05:00:44 2011 +0000
AFlat profile:
Each sample counts as 0.01 seconds.
% cumulative self self total
time seconds seconds calls s/call s/call name
9.19 2.31 2.31 11278398 0.00 0.00 MyForest::find(unsigned long)
8.15 4.36 2.05 MyForest::insert(unsigned long)
5.45 5.73 1.37 8778386 0.00 0.00 Read::getSeq(char*) const
4.57 6.88 1.15 1 1.15 22.62 Machine::run()
4.49 8.01 1.13 8241538 0.00 0.00 kmerAtPosition(char const*, int, int, char, bool)
4.06 9.03 1.02 114447066 0.00 0.00 MessagesHandler::receiveMessages(StaticVector*, RingAllocator*, int)
3.94 10.02 0.99 8600637 0.00 0.00 SeedingData::computeSeeds()
3.12 10.81 0.79 114447066 0.00 0.00 Machine::sendMessages()
Add/Change #192 (cache calls to getSeq in VerticesExtractor.cpp)
commit 398488631bc40d8d4f034c3df83c676394244353
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 26 14:23:51 2011 +0000
Sending fix.
commit 98c20549b358dfb435f647ea669ab838b8666e70
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 25 23:53:02 2011 +0000
Updated the INSTALL script.
commit e685cf4285a9a788e36b850f0576ebe38b6f8bad
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 25 23:51:43 2011 +0000
Adding missing pieces.
commit f490ca7020355aa6699ac135009f3f0af03f0d69
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 25 23:46:35 2011 +0000
Add/Change #186 (adapt the AMOS writer to the parallel writting of contigs.)
commit 4d1c21aba680f09612581ec6934decb1e83a8519
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 25 21:44:48 2011 +0000
Add/Change #185 (Rank 0 must not gather fusions. Instead, each rank must write them to disk.)
commit 5defdc3282fcdccffa04eeb5e1bbfd1fa9bf44b5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 25 05:06:57 2011 +0000
Updated the change log
commit a8c4f68ac5e98f3946ce59c7659f46b4861c0e33
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 25 05:00:57 2011 +0000
Add/Change #184 (MessageProcessor::call_RAY_MPI_TAG_GET_PATH_LENGTH(Message*): Assertion `m_fusionData->m_FUSION_identifier_map.count(id)>0' failed.)
commit e01060789bd5355b0ea0f96b0af0fa396d6b07a2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 25 04:56:01 2011 +0000
Virtualization of communicators works like a charm.
What is thy bidding, my master? grep virtual log
Rank 19: 148466 virtual messages for 8317918 pushed messages
Rank 16: 142832 virtual messages for 8272674 pushed messages
Rank 5: 140445 virtual messages for 8334045 pushed messages
Rank 7: 160927 virtual messages for 8308481 pushed messages
Rank 29: 160804 virtual messages for 8389943 pushed messages
Rank 4: 155630 virtual messages for 8398524 pushed messages
Rank 27: 168845 virtual messages for 8344830 pushed messages
Rank 22: 157846 virtual messages for 8413726 pushed messages
Rank 28: 155166 virtual messages for 8419380 pushed messages
Rank 11: 165350 virtual messages for 8440100 pushed messages
Rank 20: 153263 virtual messages for 8304962 pushed messages
Rank 23: 150940 virtual messages for 8323605 pushed messages
Rank 0: 144253 virtual messages for 8325632 pushed messages
Rank 15: 147506 virtual messages for 8342492 pushed messages
Rank 17: 146663 virtual messages for 8338486 pushed messages
Rank 21: 143454 virtual messages for 8321440 pushed messages
Rank 10: 155236 virtual messages for 8331825 pushed messages
Rank 2: 155678 virtual messages for 8341462 pushed messages
Rank 12: 162159 virtual messages for 8408314 pushed messages
Rank 9: 139690 virtual messages for 8280352 pushed messages
Rank 1: 167812 virtual messages for 8457174 pushed messages
Rank 24: 144914 virtual messages for 8280450 pushed messages
Rank 8: 144659 virtual messages for 8340652 pushed messages
Rank 3: 135758 virtual messages for 8302206 pushed messages
Rank 25: 159072 virtual messages for 8351507 pushed messages
Rank 18: 161236 virtual messages for 8468711 pushed messages
Rank 6: 169108 virtual messages for 8449037 pushed messages
Rank 26: 140321 virtual messages for 8321623 pushed messages
Rank 14: 144899 virtual messages for 8330405 pushed messages
Rank 13: 156654 virtual messages for 8411725 pushed messages
For SRA001125 with Ray 1.2.2, the elapsed time was
Beginning of computation: 0 seconds
Distribution of sequence reads: 48 seconds
Distribution of vertices & edges: 2 minutes, 49 seconds
Calculation of coverage distribution: 1 seconds
Indexing of sequence reads: 10 seconds
Computation of seeds: 2 minutes, 14 seconds
Computation of library sizes: 51 seconds
Extension of seeds: 4 minutes, 34 seconds
Computation of fusions: 26 seconds
Collection of fusions: 1 seconds
Completion of the assembly: 11 minutes, 54 seconds
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
& 122 & 4579618 & 37537 & 75272 & 174465 & 0.9813 & 0 & 2 & 4 \\
For the same dataset with Ray 1.2.3-dev, the time is
Beginning of computation: 2 seconds
Distribution of sequence reads: 50 seconds
Distribution of vertices & edges: 3 minutes, 21 seconds
Calculation of coverage distribution: 1 seconds
Indexing of sequence reads: 10 seconds
Computation of seeds: 1 minutes, 27 seconds
Computation of library sizes: 1 minutes, 7 seconds
Extension of seeds: 2 minutes, 42 seconds
Computation of fusions: 30 seconds
Collection of fusions: 0 seconds
Completion of the assembly: 10 minutes, 10 seconds
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 119 & 4650322 & 39078 & 80392 & 175494 & 0.9892 & 0 & 5 & 4 \\
Sébastien Boisvert
commit b460c1da67c4d8bb3f51afcafbf71206b522b2ba
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 24 15:58:17 2011 +0000
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 116 & 4551108 & 39233 & 80392 & 176272 & 0.9694 & 0 & 5 & 4 \\
Beginning of computation: 2 seconds
Distribution of sequence reads: 48 seconds
Distribution of vertices & edges: 3 minutes, 0 seconds
Calculation of coverage distribution: 0 seconds
Indexing of sequence reads: 10 seconds
Computation of seeds: 1 minutes, 36 seconds
Computation of library sizes: 1 minutes, 2 seconds
Extension of seeds: 2 minutes, 52 seconds
Computation of fusions: 31 seconds
Collection of fusions: 0 seconds
Completion of the assembly: 10 minutes, 1 seconds
I am sure I can get the computation of seeds below 1 min.
commit 6fd03dbfa7bb066450804173dd4d4e5affa531fc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 24 02:21:16 2011 +0000
works on Strept. but not on E. coli.
commit 335840dc08b4d3f0601b5dd99bc8152037502e8f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 22 18:38:24 2011 +0000
Add/Change #171 (group messages in SeedingData to make it faster)
http://genome.ulaval.ca/trac/ticket/171
What is done:
workers are implemented, the framework is in place.
What don't work yet:
- the number of alive workers got to be maximum m_size or else there is an infinite loop, but no hang
- the communicator only process one message at a time (will be removed when point aforementionned is fixed.)
- What I think:
- processInbox don't get its messages
- messages are lost and/or overwritten.
takes 1 min 17 sec with m_size workers and readiness enabled.
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept.sh.Ray & 97 & 2012374 & 20746 & 36693 & 127908 & 0.9864 & 0 & 0 & 0 \\
commit bf5f5e9fbf9a6e7896a8b6fee3c8272600337622
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 21 04:59:01 2011 +0000
Some work
commit b55a1470cd365725ee109d476e3c111a04f4aaf7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 20 22:26:41 2011 +0000
Some updates on virtual stuff.
commit 2f82deecd27cf4c9504d7d944e8e12a6dea15c2f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 20 18:02:57 2011 +0000
Some work on an event-driven thing.
commit 47fd2eeb6fe075b6c0a87490534c1c672de969ea
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 20 15:16:53 2011 +0000
Add/Change #188 (add Doxygen file)
commit 679089532dff4ada089201aa0a731d2e84c29530
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 20 14:29:59 2011 +0000
Add/Change #171 (group messages in SeedingData to make it faster)
Almost done.
commit 1c548eb3a3ed8bb47a16b41d0137ba64145d7f57
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 19 17:37:33 2011 +0000
Added VirtualCommunicator
for this ticket mainly:
Add/Change #171 (group messages in SeedingData to make it faster)
commit 549850b3e31a14226e44fd74ecaaee4c14707dea
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 19 15:15:28 2011 +0000
added some outputs.
commit 44643b75fb8e2a821f25b8142a4afd3fe93c2d0c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 19 14:46:42 2011 +0000
Fixed compilation errors.
commit 6185a825d386aaa4560eb08421fea1b658bb5a42
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 19 14:33:43 2011 +0000
Forgot this file.
commit e7157b91d85376bbaf0d0dd2bd4831562b08e149
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 19 14:31:16 2011 +0000
ggAChanges
Add/Change #181 (Memory usage for Ray)
Improved memory usage for extensions and fusions
monsieur Sébastien Boisvert
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2-interleaved.sh.Ray & 117 & 4650988 & 39752 & 80392 & 176272 & 0.9893 & 0 & 5 & 4 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2-reducer.sh.Ray & 114 & 4614665 & 40479 & 83433 & 176272 & 0.9894 & 0 & 4 & 4 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 117 & 4650988 & 39752 & 80392 & 176272 & 0.9893 & 0 & 5 & 4 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-interleaved-bz2.sh.Ray & 100 & 6232245 & 62322 & 149525 & 475363 & 0.9926 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-p-bz2-gz.sh.Ray & 105 & 6221737 & 59254 & 148009 & 475347 & 0.9917 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-p-mpich2.sh.Ray & 105 & 6221737 & 59254 & 148009 & 475347 & 0.9917 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-s-mpich2.sh.Ray & 248 & 6175778 & 24902 & 54457 & 312927 & 0.9839 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
reducer.sh.Ray & 200 & 1970015 & 9850 & 15096 & 59466 & 0.9660 & 0 & 14 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
run-remover.sh.Ray & 111 & 4613754 & 41565 & 83433 & 176273 & 0.9893 & 0 & 4 & 4 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 117 & 4649732 & 39741 & 80392 & 176272 & 0.9892 & 0 & 5 & 4 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-200.sh.Ray & 99 & 2012491 & 20328 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-amos.sh.Ray & 99 & 2012361 & 20326 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-bz2.sh.Ray & 99 & 2012623 & 20329 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-interleaved-bz2.sh.Ray & 99 & 2012753 & 20330 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-interleaved.sh.Ray & 99 & 2012753 & 20330 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 99 & 2012623 & 20329 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-simulated-errors-reducer.sh.Ray & 214 & 1965304 & 9183 & 14319 & 53041 & 0.9630 & 0 & 15 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-simulated-errors.sh.Ray & 229 & 1968827 & 8597 & 12734 & 53041 & 0.9616 & 0 & 16 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept.sh.Ray & 99 & 2012623 & 20329 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
commit 381536211448e1e3d92a29e1d542165e7b4ffe52
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 18 01:33:04 2011 +0000
Now reporting the memory usage for sequences and vertices.
commit 58a4a8a52c557134ec77af0979bcc1a17183e0e9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 18 00:39:36 2011 +0000
Disabled SHOW_CHOICE.
commit 32ef6d79dcdca53ecf3726c5c743e0ca53535afa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 17 21:22:04 2011 +0000
Fusions.
commit c744d06843cc4083633011909f31dca36b5f4076
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 17 21:21:17 2011 +0000
Add/Change #177 (in FusionData::finishFusions(), only fetch paths for -1 up to -1-minimumOverlap)
commit e4024fcdedac649168905b4c3d8aee45cc7a28d3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 17 21:11:32 2011 +0000
Add/Change #178 (move scripts in
MPICH2
and remove MPICH2 + test with configure script)
commit 1ea15370616180fb3ef1636e1d1547404e45a8c1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 17 20:51:29 2011 +0000
== UPDATE ChangeLog ==
1. Add/Change #172 (on using large distances to extend seeds)
2. Add/Change #176 (Remove the hack that uses coverage and see if it still works.)
3. Changed mean-1*standardDeviation;mean+1*standardDeviation to mean-3*standardDeviation;mean+3*standardDeviation
4. There are further verifications now to check if the paths to merge really overlap.
5. Add/Change #172 (on using large distances to extend seeds)
Result on E. coli:
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 86 & 4637796 & 53927 & 94923 & 311521 & 0.9950 & 0 & 0 & 0 \\
Regressions:
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2-interleaved.sh.Ray & 117 & 4621300 & 39498 & 81231 & 176272 & 0.9890 & 0 & 4 & 4 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2-reducer.sh.Ray & 117 & 4619407 & 39482 & 81231 & 176272 & 0.9890 & 0 & 4 & 4 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 118 & 4621804 & 39167 & 81231 & 176272 & 0.9890 & 0 & 4 & 4 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-interleaved-bz2.sh.Ray & 104 & 6244567 & 60043 & 149525 & 475363 & 0.9926 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-p-bz2-gz.sh.Ray & 109 & 6234624 & 57198 & 128529 & 475347 & 0.9917 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-p-mpich2.sh.Ray & 109 & 6162432 & 56536 & 128529 & 475347 & 0.9804 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-s-mpich2.sh.Ray & 251 & 6182231 & 24630 & 54457 & 312927 & 0.9839 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-200.sh.Ray & 102 & 2021154 & 19815 & 35057 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-amos.sh.Ray & 102 & 2021024 & 19813 & 35057 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-bz2.sh.Ray & 102 & 2021024 & 19813 & 35057 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-interleaved-bz2.sh.Ray & 102 & 2021154 & 19815 & 35057 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-interleaved.sh.Ray & 102 & 2020892 & 19812 & 35057 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 102 & 2021024 & 19813 & 35057 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-simulated-errors-reducer.sh.Ray & 209 & 2006767 & 9601 & 15544 & 50523 & 0.9700 & 0 & 2 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-simulated-errors.sh.Ray & 212 & 2014342 & 9501 & 15265 & 50523 & 0.9700 & 0 & 2 & 0 \\
Sébastien Boisvert
commit 2e8126d89e3a4d1c3b66e8f9d4b06dea639a6ef7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 15 22:16:59 2011 +0000
Changes
1. Add/Change #74 (try to use obth version of pairs)
2. Changed the RepeatThreshold to 3*peak instead of 255
3. Changed the paired-end algorithm: see Chooser.cpp
4. Removed RepeatThreshold Watchdog
5. maxCoverage is not actually used, good thing it works
Regressions:
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2-interleaved.sh.Ray & 114 & 4632157 & 40632 & 81231 & 244604 & 0.9891 & 0 & 4 & 4 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2-reducer.sh.Ray & 113 & 4616726 & 40855 & 81231 & 244604 & 0.9891 & 0 & 4 & 4 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
coli-mpich2.sh.Ray & 114 & 4630901 & 40621 & 81231 & 244604 & 0.9890 & 0 & 4 & 4 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-interleaved-bz2.sh.Ray & 99 & 6232085 & 62950 & 152388 & 475363 & 0.9926 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-p-bz2-gz.sh.Ray & 102 & 5955004 & 58382 & 148009 & 475347 & 0.9494 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-p-mpich2.sh.Ray & 104 & 6221584 & 59822 & 148009 & 475347 & 0.9917 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
pseudomonas-s-mpich2.sh.Ray & 245 & 6176871 & 25211 & 56586 & 312927 & 0.9841 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-200.sh.Ray & 99 & 2011394 & 20317 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-amos.sh.Ray & 99 & 2011394 & 20317 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-bz2.sh.Ray & 99 & 2011394 & 20317 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-interleaved-bz2.sh.Ray & 99 & 2011132 & 20314 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-interleaved.sh.Ray & 99 & 2011132 & 20314 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2.sh.Ray & 99 & 2011524 & 20318 & 35346 & 127908 & 0.9865 & 0 & 0 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-simulated-errors-reducer.sh.Ray & 140 & 2000944 & 14292 & 22881 & 81842 & 0.9802 & 0 & 2 & 0 \\
--
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
strept-mpich2-simulated-errors.sh.Ray & 139 & 1978653 & 14234 & 23834 & 81842 & 0.9693 & 0 & 1 & 0 \\
(End of Regressions)
14 Jan. 2011
Sébastien Boisvert
commit 3c05b0194fb29c5f951302c1b36710409fb44ded
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 13 17:43:27 2011 +0000
Removed simulators.
commit 11a6cf250c84e2f100f44d41a2b8fe7c7f2f43ee
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 12 02:45:09 2011 +0000
Sending sequences.
commit c0887c1597b04f600554f04d94826bd783a57d21
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 12 02:28:55 2011 +0000
Added memory usage dump too.
commit 8f548d1b914c65e3df2efe55b6e04f4596e8a137
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 12 02:18:51 2011 +0000
Added a script to dump commands.
commit 22d0af80ea91d1a2500ccdb57480c18a0fffb0e7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 12 01:34:28 2011 +0000
Add/Change #167 (hangs without parameters or with -s or -p with insuficient operands)
commit 0c2103e95ee8411859928be9b3e1f0cb5fcb29c8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 12 01:33:51 2011 +0000
Add/Change #167 (hangs without parameters or with -s or -p with insuficient operands)
commit ae2d90f2c3628984a529de2d7d818b3ea410c6ff
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 11 22:20:13 2011 +0000
Updating regressions script.
commit b70b4dcee869fdbf5860690e8a472c996931b3f2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 11 14:37:14 2011 +0000
Cleaned the code.
commit 3df81b5ef2b9bc9ec115ce1c3523d8069303b78b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 11 14:24:40 2011 +0000
Fixed a critical bug: I had removed a line that should not.
commit 0ad71d8d69a7cc25de428913c01e27eb50d86293
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 11 06:25:29 2011 +0000
Fixed a bug for maximum number of sequences.
Rank 0 wrote strept-mpich2.fasta (contiguous sequences in FASTA format)
Rank 0 wrote strept-mpich2.ReceivedMessages.txt (MPI communication matrix)
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 98 & 2014191 & 20552 & 36692 & 127906 & 0.9874 & 0 & 0 & 0 \\
commit cccb9b706354d3fbbe854a236831014325df7f38
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 11 04:46:05 2011 +0000
SImulators are not compiled now.
commit 272090bdbb445c1890deaab0612b089e8a8c35e1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 11 04:43:19 2011 +0000
Reads are now encoded in 2-bits.
commit 9ce9de319d90ab7c279b844a2c2799c0288d7c3b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 11 03:29:20 2011 +0000
Fixed a bug in Library.cpp
-seb
commit 75e15753f2d9be29718222f872e7fed454a6145b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 11 03:12:35 2011 +0000
Removed pending request
added a few scripts.
Add/Change #145 (add a test for amos format)
commit f07179b46597e45b3c166f6c4e020978f7c60ad7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 11 00:31:07 2011 +0000
Add/Change #157 (parallel read for input files)
commit 513202d39b570dee846e91684f44b5fc56b10ec9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 10 04:56:09 2011 +0000
Restored message size.
commit 901d1562cce5c4b3f7f91c97383423cf00b4199e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 10 04:36:43 2011 +0000
Fixed a bug.
commit 277916efe612db4fb037e00ddcf5f29411b8e779
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 10 04:07:08 2011 +0000
Debug messages
commit bc53e34a20e7e6847da4037f3fd99ce29d5b1faf
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 10 00:26:20 2011 +0000
I did some work on the internal buffers.
commit 1b01cc3bfed6ab82e26d647e9908e2ef62f7ccf4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 9 01:11:39 2011 +0000
Fixed error in compilation.
commit 3eef730e15c91e184d883f8592fa4a20fd53cba7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 9 01:05:49 2011 +0000
Fixed a compilation warning.
commit bcf5ad01647a4c377b71846bf4f5073a6ded53ae
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 8 23:50:30 2011 +0000
Add/Change #149 (Group communication (2 instead of 4) for INDEX PAIRED)
commit 4b464af888d385ce0706efa6283b617d420c3810
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 8 23:25:58 2011 +0000
Add/Change #150 (change RAY_MASTER_RAY_SLAVE_ for RAY_MASTER_)
commit bbf951af36726d1e503cf72861c1ce341d317839
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 8 23:01:33 2011 +0000
Problem:
Add/Change #144 (Memory reducer in HEAD is too intense)
http://genome.ulaval.ca/trac/ticket/144#comment:45
Fixed the problem by requiring that the maximum coverage for a removed vertex be below or equal
to 3.
SB
commit d91600d2cf091f8e36bcf0d017803c437417f1a4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Jan 8 03:56:21 2011 +0000
Add/Change #151 (Reproduce and fix the bug wherein the number of sent messages overflow the ring buffer.)
Fixed the bug, it was due to a ring buffer overflow.
SB
commit ac34695a92a2b618ab6ab57843d5092e197b88b7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 6 17:20:51 2011 +0000
sending diffs.
commit 7cf5fe1a45286f90969da272b9429935b41a2e53
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 4 17:21:49 2011 +0000
Fixed:
Add/Change #144 (Memory reducer in HEAD is too intense)
commit de5b4a89de88970a7dcc229000a463ce38c3fd05
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 4 08:22:36 2011 +0000
Sending data to root
commit 8af56a11b7807917315bb84bb961321af3a075f5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 4 08:17:31 2011 +0000
Updated reducer to 10 M
commit f3615fa1f85da064a03f43f89c619d5e28cdac9f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 4 04:54:35 2011 +0000
The memory reducer is now run at the end of vertices distribution too.
commit 54ecc8f7d28a60a42659e925f66456dbcb31bb09
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 3 21:13:01 2011 +0000
Now the paired information is packed.
commit 676495a021e7bebd81176bf507e970b041e57a73
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 3 18:53:17 2011 +0000
Updated the ChangeLog.
commit 73514e27a7cb6ba181c4f610367392406d651765
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 3 18:49:11 2011 +0000
Removed useless print
commit e00dd4a21fbdb1ed638edbe087fb4d66d89ddc13
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 3 18:43:20 2011 +0000
Fixed:
Add/Change #143 (Ray: RingAllocator.cpp:54: void* RingAllocator::allocate(int): Assertion `a<=m_max' failed.)
Reason:
Mispelled constant.
commit a6baf52722e4c8b087ff306ebdfd533b145b78b2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 3 18:13:56 2011 +0000
Fixed this:
Add/Change #142 (Ray: MessageProcessor.cpp:1195: void MessageProcessor::call_RAY_MPI_TAG_ASK_VERTEX_PATHS_SIZE(Message*): Assertion `node!=__null' failed. [ls30:16297] *** Process received signal ***)
commit 64f352eb2a6de237257127dbebe25f3b93368a6f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 3 06:27:52 2011 +0000
Working on
Add/Change #142 (Ray: MessageProcessor.cpp:1195: void MessageProcessor::call_RAY_MPI_TAG_ASK_VERTEX_PATHS_SIZE(Message*): Assertion `node!=__null' failed. [ls30:16297] *** Process received signal ***)
Released versions are not affected by this.
commit d926a8ce946c55a3d695777e60050331f9b054f0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 3 06:14:59 2011 +0000
Sending chunk allocator, removed realloc in ArrayOfReads.
commit e2c5b477d8fe7af24becfb20335f9d31077bfdb7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 31 17:53:04 2010 +0000
Fixed a compilation warning.
commit e1891ad986bb8e8c45ca7d34e3cfe0fb0a3c7cdb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 31 17:22:02 2010 +0000
Add/Change #140 (Fatal error in PMPI_Isend: Invalid rank, error stack:)
commit d6fb84a9f86702fd323031f77269b79a9d6f353a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 31 05:53:44 2010 +0000
Fixed the limit for vertices
commit d2b6bc18f0c234db5d64fe5e26a77448248eb82d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 31 04:34:14 2010 +0000
The number of sent messages is below or equal to the number of MPI ranks.
commit 5de13105445ffb83efce278981a10394ae667894
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 31 01:05:45 2010 +0000
Add/Change #135 (implement <flushRemainingBuffers>)
commit 59e8fa54d3658f28938d9d258360358762007b6c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 20:49:00 2010 +0000
Added assertions to track down the bug http://genome.ulaval.ca/trac/ticket/140
commit 3742ee1f9419068de024543e91742595d5553b17
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 17:23:20 2010 +0000
Sending new Makefile.
commit be7536dafde9db2cac8a6bc0fdc35c8689eaba71
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 15:28:52 2010 +0000
Updated the changelog.
commit 20a8332aa947e925cbbc1690fefd499f8b4ca876
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 15:23:03 2010 +0000
Updated RELEASE procedure.
commit 54754a8c911b526a670796f782a6b1005af017f2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 15:04:22 2010 +0000
Updated the change log.
commit e98bf84cc031af2e42156de39572915d70558d08
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 06:22:30 2010 +0000
Modified change log.
commit b6e887a719faa1fb9cfe7989f06455a01c591144
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 06:15:12 2010 +0000
Changed the threshold + swapped a cout for a printf.
-seb
commit b7ab9170f08f94414f421cd21af37e9975c2fce2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 06:07:38 2010 +0000
Fixed -r option.
commit 8fd2ff6f25ab45c360a07e24ec1abb97a73f88b2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 05:57:33 2010 +0000
Adding scripts + modified errors simulator.
commit 691b23698818ba7bb01ebba669d3a7bc678720ce
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 05:49:45 2010 +0000
Fixed a compilation warning.
commit 5e6eb374dbe27a177d64f62bf317393ad8f62d23
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 05:46:21 2010 +0000
Some changes
commit 4eeda30f1ad6fc15f40caf5ae9c3bb42a63419a3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 05:00:29 2010 +0000
Fixed
Add/Change #137 (Fatal error in Ray)
commit d391428bb6df5ea0d0ab16393f73d2f9d91d4a1d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 02:32:07 2010 +0000
Left to do:
bubble + find the remaining 1-coverage vertices.
commit 60fb6ce798e67e85778c804ff1038e2a2243841a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 30 00:39:25 2010 +0000
On SRA001125:
Ray & 132 & 4561068 & 34553 & 80761 & 244014 & 0.9819 & 0 & 11 & 5 \\
Rank 13: VmData= 375160 KiB (from /proc)
Rank 15: VmData= 382824 KiB (from /proc)
Rank 20: VmData= 414652 KiB (from /proc)
Rank 19: VmData= 376244 KiB (from /proc)
Rank 21: VmData= 396168 KiB (from /proc)
Rank 7: VmData= 350184 KiB (from /proc)
Rank 1: VmData= 343832 KiB (from /proc)
Rank 12: VmData= 455968 KiB (from /proc)
Rank 17: VmData= 344624 KiB (from /proc)
Rank 0: VmData= 370272 KiB (from /proc)
Rank 14: VmData= 408780 KiB (from /proc)
Rank 16: VmData= 368248 KiB (from /proc)
Rank 5: VmData= 386056 KiB (from /proc)
Rank 22: VmData= 411120 KiB (from /proc)
Rank 9: VmData= 406304 KiB (from /proc)
Rank 2: VmData= 356536 KiB (from /proc)
Rank 11: VmData= 339104 KiB (from /proc)
Rank 3: VmData= 415416 KiB (from /proc)
Rank 6: VmData= 362596 KiB (from /proc)
Rank 23: VmData= 357900 KiB (from /proc)
Rank 18: VmData= 391104 KiB (from /proc)
Rank 8: VmData= 359964 KiB (from /proc)
Rank 10: VmData= 367664 KiB (from /proc)
Rank 4: VmData= 407644 KiB (from /proc)
1 15492730
2 331894
3 61582
4 25006
5 13110
6 8364
7 5528
8 4102
9 3114
10 2316
11 1962
12 1620
13 1318
14 1068
15 1136
16 758
commit 5ec06a6c3299b17d24c4595c90bacb5644632cc5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 29 22:18:05 2010 +0000
Seems to work well.
commit 63edbdf784161a1d89f4199250f8ef5ab5bb8614
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 29 20:58:39 2010 +0000
Code is operational.
commit 5859e1dbfef5400108753e098e3e5bc8974b302f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 29 05:24:18 2010 +0000
Doing a test.
commit 249a06b5dc026b0ede21a6208b56414f300f2f14
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 29 05:03:03 2010 +0000
With memory reducer:
Ray & 128 & 4571454 & 35714 & 80761 & 244232 & 0.9817 & 0 & 5 & 5 \\
without:
Ray_THEONE & 126 & 4590162 & 36429 & 72499 & 174569 & 0.9815 & 0 & 2 & 4 \\
Observation:
the assembly is better.
commit d92c124f0cbdfa2ceb9e41caaa2e0d530fa2960c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 29 03:06:57 2010 +0000
the assertion was wrong.
commit 456ff33e61d065a8a63ebede74b74b400dedcc1a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 29 03:00:47 2010 +0000
Possibly fixed a bug.
commit ad9ac17b97b7e7485c081e85302461b540d377c6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 28 23:06:13 2010 +0000
Only one message in the inbox.
commit 3d5e24f12f235df4a4b8a7fbb88e02fde62efdd0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 28 22:59:36 2010 +0000
Sending data
commit 12d052bdd60bf195ceb30550db66826a366d6229
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 28 21:41:09 2010 +0000
Memory usage reduction is working a little.
commit d07d8bab2e7914baf9bbecde0b104f9a4b1a1655
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 28 04:01:06 2010 +0000
Sending some changes.
commit 8cfe23204a2ec2ce14d2bc4cdc8339e58517bcb9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 28 03:23:48 2010 +0000
Add/Change #134 (seg fault in trunk while implementing memory usage reduction)
commit 6f0e46b158ff066e8a89ec3c47da46c4850ac269
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 28 02:27:23 2010 +0000
The bug is that here exists a seed with no reverse-complement seed.
seb
commit bdb49507646e1480a295da7926800c437e27dd01
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 24 15:50:39 2010 +0000
Sending changes.
commit 24877fe2f04d2ba73eafd43cf6c4915ad30fca66
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 24 14:50:33 2010 +0000
Fixed the bug.
commit df6ea476ec61070805256b682c0ef0eac94964d8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 23 19:58:50 2010 +0000
Envoi du code
commit bd55057952831489897117479758f0c0ab0768d5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 23 16:46:03 2010 +0000
Sending code.
commit 557e4d3b3cf7518af9ccf7359a7af940cd52172f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 23 16:29:34 2010 +0000
Deleted EdgesExtractor
commit b87584163835d300448cc2091b381ae4946d542f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 23 05:32:12 2010 +0000
Sending stuff.
commit cc8e738a4f8e0b97b5600f32bb1c32c6f3755c3b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 23 05:00:46 2010 +0000
Good job.
commit 87b9cd0ca195d798d22b9f19d88670ee2432f2af
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 23 02:54:36 2010 +0000
sending stuff.
commit b8c67c233ba58d78bd15ee5f71893a61574acee5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 22 19:26:44 2010 +0000
From: Sébastien Boisvert <Sebastien.Boisvert.3 at ulaval.ca>
To: jacques.corbeil <jacques.corbeil at crchul.ulaval.ca>
Cc: francois.laviolette <francois.laviolette at ift.ulaval.ca>, Mario Marchand <Mario.Marchand at ift.ulaval.ca>, Arnaud Droit <arnaud.droit at crchuq.ulaval.ca>, Elenie Godzaridis <elenie.godzaridis.1 at ulaval.ca>
Subject: Algorithme de réduction de l'utilisation de la mémoire pour Ray: avancements
Date: 10-12-22 02:04:16 PM
Bonjour,
Un génome peut être vu comme une séquence de {A,T,C,G}. La longueur d'un génome va de quelques millions à quelques milliards.
Les technologies de séquençages produisent des millions de sous-séquences du génome, appelées lectures d'ADN, et l'assemblage de novo est la reconstruction de la séquence du génome à partir des lectures d'ADN.
Une approche au problème est de commencer par construire un dictionnaire qui contient la redondance -- c'est-à-dire le nombre d'observations -- de tous les mots de longueur k dans les lectures d'ADN.
En l'absence d'erreurs de séquençage, le nombre d'entrées dans un tel dictionnaire est borné supérieurement par la longueur du génome puisque, dans le pire cas, il y aura un mot unique de longueur k à chaque position dans le génome.
Cependant, étant donné que les lectures d'ADN contiennent des erreurs de substitutions, il y a beaucoup d'entrées dans le dictionnaire qui sont des mots de longueur k qui ne sont pas dans la séquence du génome et qui ont une redondance très basse.
Une distribution de la redondance des sommets, lorsqu'il y a des erreurs de séquençage, a beaucoup d'entrées pour la valeur de redondance de 1. Voici un exemple.
1 12312058 <<<<<<<<<<<<<<<<
2 282936
3 10440
4 8418
5 20272
6 44712
7 87004
8 146010
9 219106
10 294768
11 361856
12 407242
13 423804
14 408558
15 366930
16 309014
17 245306
18 185152
19 132402
20 89088
21 57636
22 36712
23 22926
24 13594
25 8656
26 5742
27 4054
28 3154
...
Dans le contexte de l'assemblage de novo, les entrées dans le dictionnaires -- qui sont des mots de longueurs k -- sont les sommets d'un sous-graphe dirigé appelé graphe de Bruijn.
Le sous-graphe de Bruijn est beaucoup utilisé comme structure de base dans les algorithmes d'assemblage de novo.
Dans ce sous-graphe, une arête lie deux sommets si et seulement s'il existe au moins une lecture d'ADN qui contient ces deux sommets de manière consécutive (un à la suite de l'autre).
Une arête est donc un mot de longueur k+1 puisque deux mots consécutifs de longueur k chevauchent sur k-1 nucléotides.
Pour une taille de sommet k, une erreur dans une lecture d'ADN cause dans le sous-graphe de Bruijn:
Dans les illustrations, '...' est le reste du sous-graphe, '---->' est une arête, et '*' est un sommet.
1. un cul-de-sac lorsque l'erreur est dans les k premiers nucléotides de la lecture d'ADN mais pas dans les k derniers nucléotides;
Illustration:
*---->*---->*---->*---->....
raison: le premier mot de la lecture d'ADN n'est pas connecté au sous-graphe.
2. un cul-de-sac lorsque l'erreur est dans les k derniers nucléotides de la lecture d'ADN mais pas dans les k premiers nucléotides;
Illustration:
...---->*---->*---->*
raison: le dernier mot provenant de la lecture d'ADN n'est pas connecté au sous-graphe.
3. un bulle lorsque l'erreur est après les k premiers nucléotides de la lecture d'ADN et avant les k derniers nucléotides;
Illustration:
....--->*---->*---->*---->*-----*---->....
\---->*---->*---->*---/
raison: le premier mot et le dernier mot de la lecture d'ADN sont connectés au sous-graphe et un chemin alternatif existe. Ce chemin représente le bon chemin sans erreurs.
4. une composante contenant au plus 2*k-1 non-connectée sommets au reste du sous-graphe lorsque l'erreur est dans les k premiers nucléotides de la lecture d'ADN et dans les k derniers nucléotides;
Illustration:
*---->*---->*---->*
raison: le premier mot et le dernier mot de la lecture d'ADN ne sont sont connectés au sous-graphe.
Les cas 3 et 4 nécessitent que l'erreur ne soit pas à la fin ni au début de la lecture d'ADN.
Le cas 4 nécessite que la lecture soit de longueur au plus 2*k-1.
Avec des données Illumina, les cas 1 et 2 arrivent le plus souvent et les cas 3 et 4 à peu près jamais parce que les erreurs sont à la fin.
Aucun algorithme d'assemblage (Velvet, ABySS, EULER, SOAP, Ray) enlève préventivement les erreurs pendant la construction du graphe, ce qui mène à un besoin en mémoire ridiculement élevé.
Ray est un algorithme d'assemblage de novo parallèle utilisant le standard MPI (Message Passing Interface) développé par moi-même, François & Jacques.
Suite à la discussion du 20 décembre 2010 avec Jacques sur un algorithme de réduction de la mémoire, j'ai fait des tests et implémenter un algorithme dans Ray -- j'ai presque terminé.
Mes tests préalables indiquent que ça va être vraiment bon.
J'attaque seulement les sommets avec 1, 2 ou 3 de redondance.
Extrait de l'exécution:
Rank 0 is reducing memory usage [560001/604786]
Rank 7 is reducing memory usage [560001/603808]
Rank 1 is reducing memory usage [560001/603755]
Rank 13 is reducing memory usage [560001/603538]
Rank 6 is reducing memory usage [600001/604003]
Rank 6 is reducing memory usage [604003/604003] (completed)
Rank 6 is reducing memory usage [604003/604003] (completed)
Rank 6 removed 530878 vertices to reduce memory consumption preemptively (0.8789)
Rank 4 is reducing memory usage [600001/604318]
Rank 3 is reducing memory usage [560001/602417]
Rank 11 is reducing memory usage [560001/604230]
Rank 4 is reducing memory usage [604318/604318] (completed)
Rank 4 is reducing memory usage [604318/604318] (completed)
Rank 4 removed 530118 vertices to reduce memory consumption preemptively (0.8772)
-seb.
Joyeux Noël et bonne année.
--
Sébastien Boisvert, B.Sc. Biotechnologie
Étudiant au doctorat en physiologie-endocrinologie (débuté en janvier
2010)
Récipiendaire d'une bourse de doctorat Frederick Banting & Charles Best
des Instituts de recherche en santé du Canada (débutée en septembre
2010)
Adepte des logiciels libres
Infectiologie et immunologie
Centre de Recherche du CHUQ
2705, boulevard Laurier, R-5711
Québec (Québec), Canada, G1V 4G2
Téléphone : +1 418-525-4444, poste 46342
Télécopieur : +1 418-654-2761
Courriel : sebastien.boisvert.3 at ulaval.ca
Site web: http://boisvert.info
commit 36ba008d15bcd1edae8f20a027306fd98d193160
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 22 04:38:43 2010 +0000
Almost done.
that is all for today.
commit ba0be6e2c24829cf6adb36d9ffca7d0a864cf9dc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 22 01:33:02 2010 +0000
sending code
commit 986ed8ce43337b10904b9a85c842fa0116181a33
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 21 21:10:07 2010 +0000
Almost done.
commit e239cb7068a36d04d1630bf0f751c53b44818c5b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 21 19:16:06 2010 +0000
Add/Change #123 (Implémenter l'algorithme de Jacques: poussin v. pouzin)
working prototype.
commit 9e1698a88d1e8f8bc1d9ea8409861e4139799b38
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 21 15:32:23 2010 +0000
Au revoir !
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 128 & 2003745 & 15654 & 28294 & 89893 & 0.9829 & 0 & 1 & 0 \\
[boiseb01 at ls30 Open-MPI]$ bash strept-error-ompi.sh |tee log
commit 647ba67df85fd413afe1dd7b3e23d87fdae5c05f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 21 03:36:17 2010 +0000
Fixed bugs
related to #123
Completion of the assembly: 3 minutes, 59 seconds
Rank 0 wrote strept-ompi.CoverageDistribution.txt
Rank 0 wrote strept-ompi.Library0.txt
Rank 0 wrote strept-ompi.fasta
Rank 0 wrote strept-ompi.ReceivedMessages.txt
Au revoir !
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 128 & 2005257 & 15666 & 28294 & 89893 & 0.9836 & 0 & 1 & 0 \\
[boiseb01 at ls30 Open-MPI]$ bash strept-error-ompi.sh |tee log
commit 217fc8acaef6c78ec8cc52082d3bd8e5b66c5152
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 21 03:09:04 2010 +0000
Add/Change #132 (add code for not adding an edge if any vertex of the pair does not exist)
Completion of the assembly: 2 minutes, 20 seconds
Rank 0 wrote strept-mpich2.CoverageDistribution.txt
Rank 0 wrote strept-mpich2.Library0.txt
Rank 0 wrote strept-mpich2.fasta
Rank 0 wrote strept-mpich2.ReceivedMessages.txt
Au revoir !
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 98 & 2013973 & 20550 & 36326 & 127906 & 0.9875 & 0 & 0 & 0 \\
commit 440f4f281e3fa60c5b23fad889f698df216ad87a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 21 00:22:45 2010 +0000
Add/Change #132 (add code for not adding an edge if any vertex of the pair does not exist)
commit a05b2172a5b9f60452bec305a765f0b1f6acac83
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Dec 20 23:52:28 2010 +0000
Add/Change #131 (add code not to index a read on a vertex that is not in the graph)
commit ae7e3fe66babee6df9c2ecd9c7827bf55ee2d5e8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Dec 20 23:50:29 2010 +0000
Add/Change #130 (change m_mode for slave_mode)
commit b140751b19a6e9a44cb5b4dffa1d455963db6386
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Dec 20 23:47:36 2010 +0000
Add/Change #128 (change MASTER_MODE_ for RAY_MASTER_MODE_)
commit a9d32cb610a3831fcd9f107784b0d57c46243f3b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Dec 20 23:42:36 2010 +0000
Add/Change #127 (change TAG_ for RAY_MPI_TAG_)
commit faae3bbcd972b8669ae848f4b5ead0b952e7bdfc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Dec 20 23:38:25 2010 +0000
Add/Change #126 (change MODE_ variables for RAY_SLAVE_MODE_)
commit fa95808e7aee454571d619e61ded891fb0f5b267
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Dec 20 21:46:11 2010 +0000
Add/Change #123 (Implémenter l'algorithme de Jacques: poussin v. pouzin)
commit 51e5cbe3e335bf0d3dbb283ce3431dff95e6f471
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Dec 20 16:37:00 2010 +0000
Added an iterator over forests.
commit be0edd8f6330e0574fb6625e7144bf91079f1fcb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Dec 20 16:05:12 2010 +0000
added code for removing node in splay trees.
commit faa04378292ce4a7cb4a514bc4d33916f1be6a77
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Dec 18 06:22:33 2010 +0000
Sending patch to detect the source of the bug.
commit 0a06d9f909aa790a304698e51b297467f081026c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 17 19:52:36 2010 +0000
Changed VERTEX_TYPE to uint64_t
Changed MPI_UNSIGNED_LONG_LONG to MPI_UINT64_T
-seb.
Got the idea while reading the MPI 2.2 book.
commit 98c3556d5fba6f9d03b91041f04b4155f0f27948
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 16 00:32:20 2010 +0000
changed the crypto-function
commit 1c87514d4a119e7046cac01dadc4b0b458ea2150
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 15 22:30:56 2010 +0000
Added a crypto file
Completion of the assembly: 2 minutes, 6 seconds
Rank 0 wrote strept-mpich2.CoverageDistribution.txt
Rank 0 wrote strept-mpich2.Library0.txt
Rank 0 wrote strept-mpich2.fasta
Rank 0 wrote strept-mpich2.ReceivedMessages.txt
Au revoir !
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 99 & 2014179 & 20345 & 36482 & 127906 & 0.9874 & 0 & 0 & 0 \\
Corrected the forest size: 16384.
commit e8960b4d502ffd5e8e50f0edd7ed8caeeae51430
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 15 13:51:04 2010 +0000
Updated CHangeLog
commit ae678fa25ffa60a08e24eebf5adec1695b6cb01a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 15 13:50:18 2010 +0000
Corrected the bug in libraries.
commit 9e84c404f592d8bf4d765221164f41f7dc81c27c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 14 22:00:20 2010 +0000
Envois des changements:
* indicateurs pour les fichiers.
commit 48c62eccb98ea01b20a637b5d1eb941b7c27bf5f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Dec 14 18:54:41 2010 +0000
Sending dummy changes.
commit 0acf115e8d0f0e40c001133b5906b4e2b057ede2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Dec 12 18:04:47 2010 +0000
Sending debug messages.
commit 09d013720831f43fd27da1cf9171b98c91957860
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Dec 11 22:26:59 2010 +0000
Fixed compilation warnings.
commit b474b7d9321f3912d4e3b436e788db708e673013
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Dec 11 19:41:56 2010 +0000
Updated change log.
commit ae0d7c3758c955e9a89818d092feb9f7ce41fe81
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Dec 11 18:31:37 2010 +0000
Removed CHI-Square tests.
commit bb81a2c175fb7f46fc9dcc800dbe306c70900b20
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Dec 11 18:27:44 2010 +0000
Fixed some problems for polymorphic genomes.
commit ed7d0ae7b87bf4df8b09d5050c49143961d68ce4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Dec 11 16:59:20 2010 +0000
Removed the number of k-mers in the output.
commit de58b6c206384aaec2c3412de606783605e31afa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Dec 11 16:42:49 2010 +0000
Add/Change #66 (support polymorphic genomes (which data to use, simulated data?))
commit 8890cea4fcc0c389608013ea0ee65278049c09df
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Dec 11 05:54:01 2010 +0000
Almost done with this.
commit f084c86211fb8a82a1889e5087039cd7c9e435be
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 10 23:25:02 2010 +0000
SOme code for A
Add/Change #66 (support polymorphic genomes (which data to use, simulated data?))
commit 7de9c30cbebaedb1011f2610c835568a138ab746
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 10 16:55:12 2010 +0000
sending change.
commit 2d1c71158b2a4812f7437cd2b000d6e22966d841
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 9 19:15:47 2010 +0000
Now it is faster !!!
LOL
Rank 0: 100 contigs/2014545 nucleotides
//////////////////////---------------------------\\\\\\\\\\\\\\\\\\\\\\
Rank 0 reports the elapsed time, Thu Dec 9 13:54:53 2010
Step: Collection of fusions
Elapsed time: 0 seconds
Since beginning: 1 minutes, 34 seconds
\\\\\\\\\\\\\\\\\\\\\\---------------------------//////////////////////
Elapsed time for each step, Thu Dec 9 13:54:53 2010
Beginning of computation: 1 seconds
Distribution of sequence reads: 6 seconds
Distribution of vertices: 12 seconds
Calculation of coverage distribution: 0 seconds
Distribution of edges: 17 seconds
Indexing of sequence reads: 1 seconds
Computation of seeds: 14 seconds
Computation of library sizes: 5 seconds
Extension of seeds: 27 seconds
Computation of fusions: 11 seconds
Collection of fusions: 0 seconds
Completion of the assembly: 1 minutes, 34 seconds <-----------------------------
Rank 0 wrote strept-mpich2.CoverageDistribution.txt
Rank 0 wrote strept-mpich2.Library0.txt
Rank 0 wrote strept-mpich2.fasta
Rank 0 wrote strept-mpich2.ReceivedMessages.txt
Au revoir !
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 98 & 2014101 & 20552 & 36692 & 127906 & 0.9874 & 0 & 0 & 0 \\
commit e890093ed19054924f4adb8d258ecebacf3c54b1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 9 00:44:07 2010 +0000
Fixed http://genome.ulaval.ca/trac/ticket/113#comment:1
#113
SplayTreeIterator?<VERTEX_TYPE,Vertex> consumes too much memory, make it less hungry.
commit b48f8aa1934a939435a3f57613c82ad2fe5e6e10
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 9 00:21:32 2010 +0000
Sending code for ls30
commit dee7371bc170cd37d07a437271d89b6dade1156b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 3 11:49:13 2010 +0000
Sending updates for scripts.
commit aaa9a10872e228ff95cd5d410106ca8a13d92405
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 3 05:10:49 2010 +0000
Sending scripts.
commit e537fb0907c88c11d470ddcaf5523a6b9f7345e2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 3 03:22:19 2010 +0000
Fixed a bug in the print-latex.sh script.
commit bfa824487523a2a08996ed79bea04938fe258663
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Dec 3 00:22:50 2010 +0000
Add/Change #56 (puts seeding routines in SeedingData)
commit a21dfee3ac1c82ff4e6b0b07e8908e6e27a3c251
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 2 22:28:53 2010 +0000
Sending information.
commit 089c49bd9a167421cd833147e43ba985d4929a82
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 2 22:14:19 2010 +0000
Updated changelog.
commit 360fbebb03da87f1ca70b68ac61bf13bc1e0d583
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 2 22:13:45 2010 +0000
Add/Change #55 (add a file for finishFusions( and makeFusions)
commit 024c1234663026b6b59919ce5114e7bdaf3cdf5d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 2 16:11:53 2010 +0000
Add/Change #69 (add installation of scripts with 'make install')
commit 2c550969476e21761dc2f3e85c5857b1555b2f3c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 2 15:04:38 2010 +0000
Now the mismatches are calculated by mummer too.
Add/Change #106 (use MUMmer for print-latex.sh)
commit 204498908f788a558a2788f18372b90d615905b9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Dec 2 03:25:05 2010 +0000
Removed text.
commit 23b1f6066e58fd32b2f097718f0af43099dd5cb9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 23:31:29 2010 +0000
I think the problem is fixed.
commit f3bdd23be827b703bf9602fc4a04289a430bae99
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 22:15:19 2010 +0000
I need to fix the code on SRA001125.
commit d2d0db01680697cade4f74e0a617d174d76770a4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 22:14:44 2010 +0000
Sending code,
need to fix the code on SRA001125.
commit a48229ee762dfe8dd16d1b098017e31bb5d729e8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 21:44:09 2010 +0000
Fixed a printing problem.
commit 61177289343d120cfe8c4701e66241210b9231c5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 21:40:07 2010 +0000
Add/Change #50 (Use only a int to represent a library in PairedRead)
commit 79741dc3f073fc43f3ec89935f6397d0fc52ad96
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 19:22:46 2010 +0000
Add/Change #57 (merge all instances of BufferedData)
commit 5aa9fd1b1291c3d23f49ddec81508b13ed597c7d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 16:23:17 2010 +0000
Sending documentation.
commit d73df8f2e6ce05a57175b818a73bc5ac678163e4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 15:29:11 2010 +0000
Changed batch size to 1 000 000
commit 8110c1ee8faad485a33a2402a65a501042456407
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 14:31:02 2010 +0000
Sending stuff.
commit b4200fda94d682bed447c450e840833b99c1ce75
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 14:06:59 2010 +0000
added foreign directive.
commit bc0aa59d3d6a25ca170e62f3e65a8c6024e8b5ee
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 13:56:34 2010 +0000
Fixed a bug in loaders:
must eat 4 lines for fastq and 2 to fasta.
commit fa4a64c61a06e92f4a64bc1ae337a28090c09268
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 04:26:10 2010 +0000
Adding config.h.in
commit 32eb237ced3a548dadfb0260180b66dc6b1695ad
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 04:23:02 2010 +0000
Sending configure that works.
commit 3f659818c46f8f13dce8c8db08111bef812e608b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 04:18:41 2010 +0000
Sending configure.
commit 8d5998fbee3b6debc2937ac346116b5fb1bf5c56
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 03:53:58 2010 +0000
Changed the ring size.
commit 137d6ee7ec78d9ea5c48af8ddeb4705b5fb90b62
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 03:19:33 2010 +0000
Sending old configure.ac.
commit 463a87897cb17bc6ba1253b13d96aaa732805ee0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 03:08:24 2010 +0000
Sending new configure script.
commit fc4f2cf1f48d2ec74926573d70b029e0314979bf
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 03:00:03 2010 +0000
Add/Change #79 (Load only 10000 sequence at one instant,)
commit 57591a913907100ab711985a919e60bf0c8c49f9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Dec 1 00:02:23 2010 +0000
Add/Change #79 (Load only 10000 sequence at one instant,)
commit ab1550328d609eaba25a953ff48a92fa23686208
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 30 23:55:36 2010 +0000
Add/Change #79 (Load only 10000 sequence at one instant,)
commit 34920aa4960c244085fb0ce48c6e73838978c265
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 30 23:45:58 2010 +0000
Add/Change #79 (Load only 10000 sequence at one instant,)
commit e3616d5951c5b6abb50a40e7d03dc9d0be2c7d57
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 30 21:23:57 2010 +0000
Add/Change #84 (use printf to make output beautiful with MPICH2)
commit 4c77775d5b130fdc8b7c94c4fdd2ee3bc5dd672f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 30 17:38:44 2010 +0000
Added a script.
commit 77d17cc22ccf17b339cd585c4ad09b3e8199d317
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 30 04:00:00 2010 +0000
Add/Change #93 (remove half seeds, but not before the approximation)
commit cb4d4be5fe025b7d2ddc7e1e22f9e8876db63a43
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 30 03:20:54 2010 +0000
Add/Change #50 (Use only a int to represent a library in PairedRead)
commit 7d573b2534575a5b285d33f0413935b670819e62
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 29 20:13:33 2010 +0000
Removed couts
commit 30681dd9025ae29d9a4e06c01d1850cff876be8b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 29 19:48:01 2010 +0000
Add/Change #96 (Problem with reproducibility of paired distance approximation,)
commit d34fda798fbcf3d30990747a573ff13fe1e0d829
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 29 18:21:58 2010 +0000
Working on several tickets, but this commit is to allow code to be in scratch.
commit 477024771b65e9f782fef1e4cfc9064142d97b28
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 29 13:42:22 2010 +0000
Sending code, almost done fixing #91
commit f5871eff76f124f217e5062ec54a7635eb104378
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 29 07:04:38 2010 +0000
Add/Change #91 (too many contigs for SRA001125)
commit 0f8e4b505d25229e9db55710a4e7a67cb568224c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 29 04:41:24 2010 +0000
Sending code.
commit 8aec860d4a280c2546364dab444d44f9561af4fa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 28 21:30:19 2010 +0000
Updated finishFusions.
commit de48bf36afdccdfdcb0d4ce5c05bbb3b139dc344
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 28 17:29:33 2010 +0000
Sending optimization for finishing fusions and
for seed extension.
Add/Change #52 (Ray crashes on fusion)
commit 1a00f53c0f215b935a55e122bd7400ae9d182879
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 23:46:55 2010 +0000
Sending changes.
commit 5e641f3125ba9de7e43a9ddaef199e0581f573c6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 23:45:45 2010 +0000
Corrected the makefile.
commit cb539bdaf5282198737a21534c8dde2756175e59
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 23:26:17 2010 +0000
Add/Change #89 (misassembly poped back)
commit c7ceaf5f14e46564d8e81336907d842ddd34aa4c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 22:06:20 2010 +0000
Now the Loader frees its memory.
commit 5f6850dcb978ee2ef068d171a4ed828251445530
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 17:23:31 2010 +0000
Add/Change #88 (code a special arrays for myReads)
commit 470d3d268772d6d625d7c249089b6842dac43714
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 06:45:53 2010 +0000
new files.
commit f74df5f85e917b8b7488e7ac7f6a73d057065c13
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 05:14:58 2010 +0000
Fixed an coding error.
commit 538a9dd8bf063dcb1118ce84bbda6f3159024660
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 05:12:14 2010 +0000
changed cout for printf.
commit 788f69495985c3dc955e7a3a0a2cc78910ff8a4c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 04:29:13 2010 +0000
Fixed configure script.
commit 5ca83afe7a08714a5e536a2adb85593c62f77096
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 01:03:51 2010 +0000
Corrected ifdef.
commit f19864df76a96ccfd516571124cf09a7631c1b93
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 01:00:17 2010 +0000
Fixed a bug
commit 415677193e89449284c8136b0adff687a640c190
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 27 00:56:47 2010 +0000
Add/Change #79 (Load only 10000 sequence at one instant,)
commit f722122da50e854c9830692d76cd1a752ff640d3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 23:53:21 2010 +0000
Add/Change #84 (use printf to make output beautiful with MPICH2)
commit 2954a739b71244a213983b09d834641bb2bfef12
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 23:22:02 2010 +0000
Au revoir !
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 99 & 2014074 & 20344 & 36482 & 127906 & 0.9873 & 0 & 1 & 0 \\
Add/Change #86 (kill half the seeds)
commit 7de6eb822d485d82544f4ec638a1d672d88394c3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 22:10:11 2010 +0000
aclocal is correct.
commit 70a22875ca309a4eb0c138a48801e4dc06a36e08
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 22:06:34 2010 +0000
sending old version of script.
commit d10f8b5b9ee1e7bea532ef96b2ba0c284d498dc4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 21:54:51 2010 +0000
removed comparison scripts.
commit 7a810f2b610c474a01d18b7552cfbf6246103150
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 21:52:43 2010 +0000
changelog changed.
commit ea77dd9a02bf6242e1055875a102df49426fd6a7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 21:51:19 2010 +0000
Add/Change #82 (Alert the user if the extension is unknown.)
commit b3070006e97809d7bff115fc87d052295c80f3ac
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 21:48:05 2010 +0000
Add/Change #76 (add thanks to René in AUTHORS + Add colosse folks too+ add René for SPARC)
commit 05219f442d97265094c195e0cd12a10c435a53fc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 21:46:13 2010 +0000
Worked a little on the early-stopping.
commit 58ef84ff140ac80f1acb89691dfff8f77ac4e632
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 21:25:59 2010 +0000
Implemented Early-stopping.
commit 6d359cb1af0e5a1ef2ad844f119763f91806944a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 12:58:54 2010 +0000
Removed simple test.
commit 890669a9bd46d9c56eff3ea422c53fe11fdf7360
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 12:54:56 2010 +0000
Updated the CHangeLog
commit b1221ba780264ccbbf85cca3969efd89faf5e1d2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 12:46:13 2010 +0000
sending a file.
commit 0193c1e8715e1c8a3cf21b2f5cd2b857cb3f3931
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 26 05:26:25 2010 +0000
Add/Change #67 (add an early-stop technology (To speed up the process.))
work in progress.
commit 8188e570c34f83e1edb9411ff94586007f752def
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 21:31:18 2010 +0000
Corrected the file.
commit df1273d1bdb8a6f47fb5a856eef795d3915731ae
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 21:28:26 2010 +0000
Add/Change #78 (test with PowerPC)
commit e97ef846e167b46a658a7415315d075c8e143981
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 20:35:45 2010 +0000
Add/Change #75 (fix compilation warning on SPARC)
commit 1ba78e274d8b575a1fc1910ae66dfec0e5d10576
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 13:17:24 2010 +0000
Final commit before release.
commit 78fa60c7746a172e86936df82d6d753303bf52b3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 06:14:10 2010 +0000
Added architectures.
commit 836e99ca1400b21ae0beb9c643d6828f3818a22e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 05:52:20 2010 +0000
sending x86 as a tested architecture
commit 120c1b7e216701269fe379d6e63993180b0662ae
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 05:42:47 2010 +0000
Adding simple test
commit 9296cc6513830d6844d7dd33f876ec10a6a04eb3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 05:41:46 2010 +0000
sending tested architectures
commit 37090b7adc5fbd0d66ab11ab8849d6138b5c40fd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 05:13:50 2010 +0000
fixed a compilation warning on Sparc V9
commit b3c4c4fda9897e383a4a29e5c04ac2891749d6ba
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 04:15:51 2010 +0000
Renamed test.
commit 9d1348b558d5bb433ad1bb65d4e767faa360fd63
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 03:45:32 2010 +0000
Corrected a major flaw.
commit 33dc0932b9494c634d1dfb0937a4ca68426257f3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 03:26:36 2010 +0000
Add/Change #73 (coli-mpich2-interleaved-bz2.sh has many contigs, but coli-mpich2-interleaved.sh is OK)
commit c54dcd81c4b348325752eab2a54244b8805e02b7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 02:04:59 2010 +0000
Corrected the comments.
commit 7d1b8004ca571a1f04278f9af29b9c8bc7a52f3c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 01:52:40 2010 +0000
commit 0d0a0eb6261206f4a61103a54a477bd39eb6b75a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 01:49:42 2010 +0000
Updated the ChangeLog.
commit 4ed135499cf49c2aa9c7077d0e00e4b23cdf2e53
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 25 01:45:05 2010 +0000
merged the branch.
#62 is done.
commit de2dba49768eade112adbe12c5f2026ec62a2403
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 23:38:16 2010 +0000
Problem apparently fixed:
1.
[boiseb01 at ls30 MPICH2]$ tail coli-mpich2-interleaved.sh-1750-1-1
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 131 & 4587939 & 35022 & 70851 & 174289 & 0.9812 & 0 & 5 & 4 \\
======== END^^ >>>
K THX BYE
...
Wed Nov 24 18:02:08 EST 2010
2.
[boiseb01 at ls30 MPICH2]$ tail strept-mpich2-interleaved.sh-today
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 97 & 2014101 & 20763 & 36692 & 127906 & 0.9875 & 0 & 1 & 0 \\
======== END^^ >>>
K THX BYE
...
Wed Nov 24 17:31:32 EST 2010
3.
[boiseb01 at ls30 MPICH2]$ tail pseudomonas-p.sh-1740-2
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 103 & 6221912 & 60406 & 149323 & 475346 & 0.9917 & 0 & 0 & 0 \\
======== END^^ >>>
K THX BYE
...
Wed Nov 24 17:41:31 EST 2010
commit d5837935588c2b0c212c7aaa115aadb375931da4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 21:48:27 2010 +0000
Modified the regression runner.
commit 70a217b629660cd65b7d09ac42e8f17645783853
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 21:37:19 2010 +0000
adding regression.
commit ce5c0a64726aefb8812577baa2af1baf36e9d034
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 20:24:47 2010 +0000
Now it is fixed (?)
commit b6f7b433b8b086fc374b90b8913ea6b48ba40348
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 19:06:59 2010 +0000
Fixed (at least I think I did) the evil bug.
commit 424c10323e2798bfbc541db4f604739ece1fc87f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 16:27:54 2010 +0000
Sending patch for Library.cpp
commit 20c369c2a038498665b256c0e324a38ca3ec42c3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 14:36:22 2010 +0000
Sending diff: changed 4096 for maxToProcess.
commit 8c0124a2c02a0b6a5667c1e6183cb9ae55265bb9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 14:33:31 2010 +0000
Updating regressions scripts.
commit 375b8d2045098cb7d3e7d0dcd1fe1185cd12f55c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 14:18:29 2010 +0000
Sending regression.
commit 4cfbd637108006ab71c61f0fc3235a035b1f2f19
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 06:40:57 2010 +0000
Sending new release procedure.
commit d8a51bb5a08e3b29d2fe826e2942f96a1a20e8da
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 06:31:30 2010 +0000
Modified scripts.
commit a03535cfed557ad4a8acad3526e1a786f58026d0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 06:21:06 2010 +0000
sending changes
commit c05190e539905eb883a7f4ea4e532d02282d8374
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 06:13:01 2010 +0000
Changed the change log
commit a26aa733580b15ac9be06d23ea547b357561392d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 06:05:33 2010 +0000
Corrected the release data in the ChangeLog.
commit 4a6e3c8acb1b804da51bc8820e2cdf69d2fc9bb4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 06:02:55 2010 +0000
Almost ready for release.
commit 6acefa9ca325e7b0942ff87ae973244e1b444ba0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 05:50:28 2010 +0000
added regression script.
A
Add/Change #583 (AUtomate tests with stuff in examples.)
commit 73d59aa3bf99d2ea0d0c90c24755a490349f40b7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 05:47:40 2010 +0000
Removed a field.
commit aa2af94faccb1f9b19077776fb920ec30d093b76
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 05:25:27 2010 +0000
Changed the maximum size of messages to 4000, as suggested by Open-MPI folks.
commit 6eae6fade89c9a062003cfdaaa4c6962deb3a529
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 04:09:15 2010 +0000
Add/Change #598 (pseudomonas-p.sh has 1 error with HEAD, but 0 with r3846)
commit 38c1905b548a498ee25e7b8fd5ca1ca184ca1194
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 04:08:11 2010 +0000
Add/Change #598 (pseudomonas-p.sh has 1 error with HEAD, but 0 with r3846)
commit 3e14f70679357d94fb98a248d4e933f3cab4456f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 02:03:19 2010 +0000
«Fixed a compile error.
commit 011b6ca103046e53609e3adcd17a4aad945aecea
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 01:59:38 2010 +0000
Only update paired read is they need it.
commit 9316380990e1ca376cc7340d710fdf9f226958b1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 24 01:18:40 2010 +0000
Fixed
Add/Change #596 (The library0 distribution is not the same for -i and -p)
commit c26be4d84685528c9c0ae8c9ac7f316d93f700f0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 15:42:39 2010 +0000
added a file for paired pseudomonas.
commit d98c6179375fabe5b3717480f108b87b4978c221
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 15:41:10 2010 +0000
Removed writting of temporary sequences.
commit cbcaec05eb9f59315b3ab52fe66c3f1e76d94a83
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 15:39:14 2010 +0000
Moved an output string.
commit ebed25633ae8db490236e038f28f89186390eb7e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 15:13:30 2010 +0000
Modified scripts.
commit ceb25d44bbc65b84b1047712c2708498073d2847
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 15:09:40 2010 +0000
added the logo.
commit edf9140d45d0e89a282c1250a2e0d9e844b4d081
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 15:01:42 2010 +0000
Add/Change #591 (optimize finishFusions (currently O(N^2) LOL)
commit 508d59df24282f2ee31786a34364c95add5823a8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 14:11:36 2010 +0000
MOved a line in the output.
commit 9d5164b29d047d483bebcc88ad816aaa0d93246c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 06:30:42 2010 +0000
modified a script.
commit 76f29967ac8696bf8f31d911d36b5fddf1dced87
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 06:01:40 2010 +0000
Add/Change #585 (Write the distribution of the libraries too)
commit 9720e4b6b318692a168ecb2ae8b2f3e6a529454b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 05:32:39 2010 +0000
Moved scripts.
commit 24a6b60300fb7977153dbe50524c1d8784216b2a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 05:31:31 2010 +0000
adding a script.
commit 05f75eabd0baba4cd8bd08b3e6d4e5bd56b7dca9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 05:25:29 2010 +0000
ggA Add/Change #585 (Write the distribution of the libraries too)
commit f9f5a35bdcfbade2fbf10d0c4bf580645fcdaf53
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 05:14:14 2010 +0000
Add/Change #589 (enum for slave modes)
commit 81b36ca80a8b448443d381bbf651b27801f2f230
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 05:11:51 2010 +0000
Add/Change #588 (ENUM FOR master modes)
commit 53d994308dcb325a1c714dd8520d0907d46f8c98
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 05:09:31 2010 +0000
Add/Change #590 (enumc for mpi tags)
commit dc2e638c2fd562e41aa143db357aa51cc6e49ef4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 05:05:30 2010 +0000
Add/Change #584 (Index both read of the pair for paired information)
Add/Change #580 (run Ray on Pseudomonas interleaved.)
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 97 & 2010887 & 20730 & 36482 & 127906 & 0.9862 & 0 & 0 & 0 \\
commit 6022b63c40b0b5da758b2d26e655bf6943e7d69c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 23 04:49:50 2010 +0000
Add/Change #581 (run Ray on Pseudomonas -p)
Au revoir !
% & numberOfContigs & bases & meanSize & n50 & max & coverage & misassembled & mismatches & indels
Ray & 101 & 6221989 & 61603 & 149323 & 475346 & 0.9918 & 0 & 44 & 0 \\
[boiseb01 at ls30 MPICH2]$ cat pseudomonas-p-mpich2.sh
/software/mpich2-1.3/bin/mpirun -np 31 ~/Ray/trunk/code/Ray \
-p ~/nuccore/Pseud,200b,2x50b,50X_1.fasta ~/nuccore/Pseud,200b,2x50b,50X_2.fasta \
-o pseudo |& tee pseudomonas-p.log
~/Ray/trunk/scripts/print-latex.sh \
~/nuccore/Pseudomonas-aeruginosa-PAO1,-complete-genome.fasta pseudo.fasta Ray | tee -a pseudomonas-p.log
commit 0df5cd68bd331afa582af964e4cc8161688e74b6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 21:55:46 2010 +0000
Modified scripts.
commit 2998dcd8ed6a8c20419bd5faf892aebd365ce324
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 21:31:41 2010 +0000
Updated scripts.
commit 697f2785f15af4c09d3567c717b6a709f6bf6e2c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 21:30:04 2010 +0000
Changed the method name in Parameters for the prefix setting.
-SEB
commit 16ea4960eb57ec37660ccc72da222abd69d2d3a5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 21:26:08 2010 +0000
Removed a useless output.
commit b3969e6c0497dc1a695ef7cb9186fb59af3d1e35
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 21:25:16 2010 +0000
Add/Change #582 (output a message matrix)
commit 29b95c10362ccf7f321647b3439f68ca8d1ccbbb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 21:20:46 2010 +0000
Add/Change #582 (output a message matrix)
commit a4cbaaf3e107416213b971d6f43ec0d676502bdc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 21:14:07 2010 +0000
Add/Change #582 (output a message matrix)
commit 7dda7eb1c31921a8c3b520c2efa22b2b0eeb5cd2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 20:25:43 2010 +0000
Add/Change #582 (output a message matrix)
Working on this ticket.
commit 8d67f890b7a2604e45b3bb8b9b333a9467e93cbd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 20:24:50 2010 +0000
No trimming when the sequence does not come from a file.
commit c18d5c5211c96e16cadf99ccff9338350e6a7756
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 19:50:36 2010 +0000
Add/Change #582 (output a message matrix)
commit 10565f68c6dc5600d98df81432d0008771f4e979
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 18:50:02 2010 +0000
Sending changes
commit 68c0d109cbfd9b0113b8ae57108ec43279fee75c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 18:18:23 2010 +0000
Add/Change #581 (run Ray on Pseudomonas -p)
commit ac8ecbfe346f18c04f9421abc8506ac2145339b9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 17:37:59 2010 +0000
added a file for the sun grid engine.
commit 2a8d153fd56bdf60df6155760796ea9356017adc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 17:36:24 2010 +0000
Moved scripts in directories.
commit 19b5109a1186a8ebb1fc5e96a2a61a4e070f0f44
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 17:31:09 2010 +0000
Added two directories: one for each implementations.
commit 58bfc8f60794692be3ddbe2494e15eaa979bc32b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 16:04:01 2010 +0000
Updated the citation
-Sébastien
commit 8cbb3a592f6e9e68a0008d04433b6a63a076af7d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 16:01:59 2010 +0000
ADded the full path for the reference.
Add/Change #581 (run Ray on Pseudomonas -p)
commit 05abd83ead11e960e0003e790d7c6a88d085be3e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 15:57:48 2010 +0000
Added a script for pseudomonas -p
commit 860692574f088011d1104ac9d424cd91b8677a42
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 13:58:27 2010 +0000
Add/Change #581 (run Ray on Pseudomonas -p)
commit 66035d172c7f308c559f09b58bc390946a1e7ce7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 13:57:24 2010 +0000
ggA Add/Change #581 (run Ray on Pseudomonas -p)
commit 795efa9d2c729233c0732f3e9a7240dc3c2050e9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 03:54:45 2010 +0000
Added sequences in output.
commit bb8082e3d2a31316f0b3e6b06f04a82752516e53
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 02:40:03 2010 +0000
Add/Change #575 (run Ray with -i on ls30 with MPICH2 & SRA001125)
commit 0813c6c6a87ceda35c7416e59528dc9ef6b4a933
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 02:32:01 2010 +0000
Sending scripts.
Add/Change #575 (run Ray with -i on ls30 with MPICH2 & SRA001125)
commit 868f33422c454a036778cfeea4dfe9328074f0f1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 02:29:39 2010 +0000
Corrected scripts.
commit 8e7c96035d678dc6f989d919102df31bcb9b0ada
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 02:22:07 2010 +0000
Small fix.
commit 47ee904b7561489ed9e4e6718fc4c662d2a6ab27
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 02:20:23 2010 +0000
Add/Change #575 (run Ray with -i on ls30 with MPICH2 & SRA001125)
commit 74fd75ac7d4095672148df277424565c945ff03f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 02:14:08 2010 +0000
Adding a script.
Add/Change #575 (run Ray with -i on ls30 with MPICH2 & SRA001125)
commit 991c576d089333ee06e86a02d93e92afe375272e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 02:06:20 2010 +0000
Adding a script.
Add/Change #575 (run Ray with -i on ls30 with MPICH2 & SRA001125)
Ray
commit 194424826d8d9ed7a1ff1e0f344418be4d681d1f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 02:02:42 2010 +0000
Sending correction.
Ray & 97 & 2011240 & 20734 & 36482 & 127906 & 0.9864 & 0 & 0 & 0 \\
commit 1c03bbb3547bffb8992883a065f0805ac861a776
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 00:31:36 2010 +0000
Au revoir message moved.
commit 668f30fb01e318e5d8d4fb17861bea7970322c67
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 00:25:41 2010 +0000
Added busy-waiting for distance updating.
commit e671285968856bb90abbbe1b2e848ff0165e68cd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 22 00:03:20 2010 +0000
Changed the place where showStats is called.
commit cc8cfe26d5b5ebf9d9121c1a21090b5579b5461b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 23:34:56 2010 +0000
Sending stuff.
commit 65a45a4f4c53b87d7e77eb4fa387336aa4ae2158
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 23:03:22 2010 +0000
Sending DESIGNs.
commit bcdc6ea438ffec6cc5b1c55e9e569bcb07a839b2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 22:34:27 2010 +0000
Sending change of license name
commit 6773d6eae3941611853bf5f89d7d2167190f6d3e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 22:05:17 2010 +0000
Renamed ChangeLog.
commit 3949538090b320d98464b05a344b8bf56ddffab4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 22:05:05 2010 +0000
Sending changes.
commit f003cf495854f7494c6d82e7e0f1fbb60ee7d282
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 21:22:16 2010 +0000
Adding a file.
commit 2eff623e129ce3a57e981a340939b50d678eaca7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 21:18:34 2010 +0000
Changed stuff.
commit 61136266d60fa8ffce2595d62098ed8244478f55
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 20:57:02 2010 +0000
Changed the period.
commit 2804231008079e225d350fded44b88e26706b913
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 20:45:29 2010 +0000
added +1
commit dd5020982f6e205512579de6e2c168c117fc4ad1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 20:41:02 2010 +0000
Added printing of updating distances.
commit 792437c09bb3658429a178d6d359f74523c3219c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 20:32:29 2010 +0000
Printing the number of messages received.
commit 97add5c2679fbfdb50a4971971a4d2b010119fa0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 20:23:44 2010 +0000
Changed slightly the output.
commit 320655cda829528035e2d03687562a151043940b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 20:21:42 2010 +0000
Added printing of MPI implementation.
commit cc13ab614526120e2193cc2ff963128426bd0484
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 20:09:02 2010 +0000
Sending packages.
commit fb3876be08cd045d627c913f25d68d477330e3a1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 20:06:14 2010 +0000
Updated the configure script.
commit 89bf2fdc5c89bf801c31ba328a37bd0e3cbecae2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 20:02:55 2010 +0000
Sending test
commit d8ed11c7991968af58acc3962fa518adf0598c30
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 19:54:27 2010 +0000
ggA Add/Change #578 (add installation of scripts with 'make install')
See INSTALL
commit 070f729810316c6d745e497938a2c78d9612d161
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 19:37:14 2010 +0000
Renaming file.
commit 3e21f36e8bce88b86b281c286a1e6b8f03802072
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 19:36:07 2010 +0000
Sending a file.
commit ed0b2ead3130a1ab3ebdf6daa3718ecdd6025e27
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 19:21:48 2010 +0000
Added some files for distribution.
commit 5600f1c5c1bca5420a41a0532c6ef0b699cee896
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 19:10:44 2010 +0000
COrrected a bug for library distribution (size updates)
commit 2916e34eee8ab6a38849a807d1454797e8781c73
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 18:03:36 2010 +0000
Sending new scripts.
commit 3d0dfa1f6c1cd4a381bcaf5f0669cdaf76b54604
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 17:33:30 2010 +0000
Add/Change #576 (support bz Files (fastq and fasta))
commit 1b1095773f7b54eebb37d5e8c5b67822a4a856c1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 17:32:38 2010 +0000
Add/Change #576 (support bz Files (fastq and fasta))
commit 9f0f43ac789d125beafea3033481ff3a2f132af8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 06:41:59 2010 +0000
Sending a BzReader.
commit 43e9188306952a98a52b45308e6b60218b1490b2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 05:46:44 2010 +0000
Added two example scripts.
commit 39b5792d4b4c2577f4bc2f302e35e4ebf496a02b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 05:37:41 2010 +0000
Adding diff.
Send extension is now more verbose.
commit 34ee5b7a457f164d81c5a5e1ba0c1fb910ab4852
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 05:24:48 2010 +0000
Changed two periods.
commit 33c3ea158c846eab21bc586a0961207e7ecd8d18
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 05:13:14 2010 +0000
Fixed another bug.
commit 08d6c8db9516983ba2e62bba344c1c03ab167024
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 05:08:47 2010 +0000
Fixed the bug:
it was because of the terminating character \0 + empty sequences...
commit 3f4a7599f1b9a941b14c2ca316fe77503b9eca30
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 01:10:47 2010 +0000
Management of invalid files.
commit 4b4bc41278add233567672ae0977be4bdd8864b7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 00:46:42 2010 +0000
Corrected the TimePrinter so it can print a message every hour.
(from the very beginning..)
-S.
commit 2638ff55191e95c05ef1e6d39b193095f27c5d5e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 21 00:36:04 2010 +0000
Finally fixed the bug.
commit af3794ea102fc9a1e81b7dc13ce16308a5928428
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 22:01:29 2010 +0000
There is a residual bug.
This line, and those below, will be ignored--
M code/RingAllocator.cpp
M code/TimePrinter.cpp
M code/Machine.cpp
M code/Read.cpp
M code/BufferedData.cpp
M code/Vertex.cpp
M code/Parameters.cpp
M code/Library.cpp
M code/RepeatedVertexWatchdog.cpp
M code/Machine.h
M code/BufferedData.h
M code/SequencesIndexer.cpp
M code/VerticesExtractor.cpp
M code/SequencesLoader.cpp
M code/MessageProcessor.cpp
M code/MyAllocator.cpp
M code/MessagesHandler.cpp
M code/StaticVector.cpp
M code/SeedExtender.cpp
M code/SequencesLoader.h
commit 2df3a8dcd4720639e3db7f2cdc0b05993882591d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 17:27:39 2010 +0000
Now busy-waiting when flushing paired information.
commit 4a0115de8fa646df3cb5a876d0cf411e9def3c95
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 16:33:20 2010 +0000
Add/Change #572 (test on ls30 with MPICH2)
commit 9643693dfc249f08c6ba7b3814c6882c5d483ca9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 16:12:48 2010 +0000
Add/Change #572 (test on ls30 with MPICH2)
commit ad66346f5bcebd6f748c1f6190002084f733dcc8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 15:55:05 2010 +0000
More beautiful output in stdout.
commit 4d799a968e8040b727a09625eeb0711b4016d9df
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 15:15:30 2010 +0000
Add/Change #571 (send paired information after sending sequences)
commit eda5834c18cb25c2494536d9fb3d4934dff9ef6d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 06:48:27 2010 +0000
Fixed the bug.
the bug was that flushing of sequences was not done correctly...
commit f0b94b46b66c54588c42e5ae9e2b1f8afb267274
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 05:17:59 2010 +0000
Add/Change #570 (flush a destination instead of looping them all)
commit a543a7fb08c761b7e999829626892c5bcb37aec9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 04:39:58 2010 +0000
Add/Change #569 (glue sequences together in the distribution of them.)
commit d797e8a8f60f5e8722c2fcabfb72612625fd2f58
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 03:17:30 2010 +0000
Changed the period for seeding from 30000 to 100000
-s.
commit 5adae4a99e4de9c3ad45bed6298c3fd658f4dee7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 02:52:36 2010 +0000
Now, the verticesExtractor and the EdgeExtractors wait for a reply before continuing.
This ensures that the communication (communicator) is not sacked by one MPI rank alone.
-SEB
commit 313f6f377b0572ddd2933e66275153de19bd64d3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 01:46:54 2010 +0000
Sending stuff.
commit fb7c41999a735e4c9907dfbb2837777c15591f6b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 00:54:24 2010 +0000
Sending diff.
commit 07b5464620d0eb245822bde9afeb1497ba5e8e38
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 20 00:05:14 2010 +0000
Changed the intervals.
commit b85a33ec436cbd4037f859403ec194ec32a2a932
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 19 23:59:23 2010 +0000
Add/Change #568 (Dont' load files when indexing reads...)
commit a4cc31d307b2e343c9d69144809fdeaff342cc44
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 19 22:29:47 2010 +0000
Sending code.
commit e30f3feac7a3efd07717b47df302b16cf0d4fce6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 19 16:03:07 2010 +0000
Moved a script
commit ee04ed4036b0454ac9713ccdc7ef550c12d32b1c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 19 05:51:52 2010 +0000
New code is ready.
commit f2946ceeb3b168b05a8b4dc5cb3fb49b882374b5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 19 05:35:31 2010 +0000
Add/Change #497 (add a file for detectDistances and updateDistances)
commit aa87b6f9fdc93bd09ac04caa7686e48d6a5b2d6a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 19 04:58:50 2010 +0000
Working on Add/Change #497 (add a file for detectDistances and updateDistances)
commit 0ce16f81aee63b5943fd341d51d827d2a142ad8c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 19 03:06:17 2010 +0000
* Removed messages replies for send_sequence
* ADded a special tag for adding a sequence with a regulator
* removed busy-waiting for distribution of fusions
* Removed message replies for fusion distribution.
commit d34bf699ce65be08fc6d52487b81ceb29942bbef
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 18 23:01:00 2010 +0000
Add/Change #558 (make Ray compliant with MPI 2.2, regardless of implementation)
commit 5833f77696bd4df4298b16740b916e1ef65790c7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 18 16:27:21 2010 +0000
Small changes.
commit ffd5ffb1428a41cd7cc111b0f8c83f4597c02add
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 18 16:22:26 2010 +0000
Added regulation for RingAllocator .
commit 81080a2f2974ed11e6feccf8447ab79bdb196a55
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 18 15:45:26 2010 +0000
Implemented a RingAllocator for inbox and outbox allocations.
commit 7a9929ec4b0c96ed55c5a486e7a6e52b5e73e76d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 18 15:24:48 2010 +0000
Replaced vector<Message> for inbox * outbox with a StaticAllocator.
commit 49c639d6c05f7b56ca100b843475d1a4788a9123
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 18 03:50:00 2010 +0000
Envoyer un patch de code.
commit 496fcac532461071b94d01d25301f39084483c30
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 18 03:43:23 2010 +0000
C'est tout pour aujourd'hui.
commit 6783c80bb9c3a82a0cb6a0315d8e0937451075c4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 18 02:36:37 2010 +0000
Add/Change #559 (for message allocation of outgoing messages, I must implement a custom allocator)
commit 49fd29c9ceec9bb9abdaf5b2e2d138ba13b3f3db
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 18 02:30:26 2010 +0000
Add/Change #559 (for message allocation of outgoing messages, I must implement a custom allocator)
commit fa8f495d3bf84c3cab100e8e57b94873720f215b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 22:20:17 2010 +0000
Add/Change #559 (for message allocation of outgoing messages, I must implement a custom allocator)
commit 79849da0918aaba6838dee928a946701979b8caf
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 17:20:26 2010 +0000
Add/Change #558 (make Ray compliant with MPI 2.2, regardless of implementation)
commit ae535ca57d2d5a431c2010f5bbe98bf0fa86b501
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 15:35:58 2010 +0000
sending
commit ab976c1069be163f43210d63140192c7139dd6b2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 13:54:36 2010 +0000
Small changes.
commit 0ef12d582c448f4da5264197853fbd37d88c3f3a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 13:52:03 2010 +0000
Now it works with MPICH2 and OpenMPI
commit f1981a4adf66ba5fa8f57d79387411f5856199fa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 13:20:14 2010 +0000
Sending Makefile.in
commit fd5a4a4fd8ae97c47c9ee99f698f11d620ce384f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 13:19:40 2010 +0000
adding two classes
commit 7b577540c321833d4dc6e4e09b641e7dd5a8ae91
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 12:21:19 2010 +0000
fixed compilation errors with MPICH2
commit 063e0e9cfeeaa0336aea958ee800943d31dd98da
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 02:56:02 2010 +0000
Fixed a bug.
commit 209a97552a7dfb7bc172efb6d9e092c1cd4b4099
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 02:54:27 2010 +0000
Corrected visual flaws.
commit 9506623dcb305ec5b9aba4aaead05271eb02fb61
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 00:29:41 2010 +0000
Maybe this will fix the problem.
commit 6f42d1a080db890d73673bfafc562338f842d6da
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 17 00:16:12 2010 +0000
Sending a preliminary diff.
commit 55482482b97480583d88bbef977240e7fde8bbd6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 16 19:00:37 2010 +0000
Sending code back to the home so I can work on another place.
commit 29e3f4a3f19c89ee3e2ffb94e6108ba65de4ed0b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 16 02:22:23 2010 +0000
envoi des données
commit a55df4d93ecd652411e6cadf3cfb4751a18ea477
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 16 01:45:10 2010 +0000
Sending diffs.
commit 268d8b3f279731705ef053123e73def03a6a60f4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 23:07:35 2010 +0000
Add/Change #549 (in updateDistances, left sequences don't get their sequence updated.)
commit 479ca37a79ab46ecf870c2ddef6ceff63cf7f806
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 20:08:11 2010 +0000
Maybe fixed:
Add/Change #550 (Seriously trashed Ecoli assembly, need to fix that soon.)
commit 8015ad44795c4a2236d7d6b6e59c677f235dbf51
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 18:35:44 2010 +0000
Sending a small change
commit 6f9a94da9c26fe1e2b2342adad78bbaaae17abe2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 16:56:02 2010 +0000
Add/Change #165 ("-i" / "LoadInterleavedPairedEndReads")
commit 9f2942e99d0689b15687d61ffb7e5ccb622cbc9b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 16:23:04 2010 +0000
Add/Change #546 (use an array of method pointers for MASTER_MODE & SLAVE_MODE)
commit 254e0772ff20ea4eef943b42978e69771dd57228
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 16:08:42 2010 +0000
ticket done
Add/Change #545 (create MASTER_MODE and SLAVE_MODE in Machine::processData)
commit b9294acb874ed0f27ac6769e958ba9edc1f787d7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 15:51:08 2010 +0000
m_master_mode is completed.
Add/Change #545 (create MASTER_MODE and SLAVE_MODE in Machine::processData)
commit e9a2415b546041869c542f3bf7ef524335f8c064
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 14:40:12 2010 +0000
Checkpoint, almost done with ticket 545
commit 9855d8c2201db94353fa48ff3412883a9cf8a824
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 05:37:10 2010 +0000
Almost done.
commit 95a8aa0f40bc0406ffc0fcbf5c89cbd2c76fb4a0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 05:11:40 2010 +0000
Checkpoint
commit 4e3d4019138e40e7d0809798ad31e9177cedf20a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 04:41:34 2010 +0000
sending data
commit bc1fb791bfd8c9c431ddf30fbd3def9c4c0132e6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 04:10:35 2010 +0000
Add/Change #545 (create MASTER_MODE and SLAVE_MODE in Machine::processData)
commit b6eecdda461d5c00780e22bf022d4673e5642974
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 02:50:55 2010 +0000
Add/Change #539 (optimize the big if/else if/else if in MessageProcessor.cpp, using an array of pointers probably)
commit d39a7fd2d6735936f0bb71fa06fe4be193c77113
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 01:29:00 2010 +0000
Add/Change #539 (optimize the big if/else if/else if in MessageProcessor.cpp, using an array of pointers probably)
commit aa77c81ac82e36e9b87477e2f5647f99aa352298
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 00:22:06 2010 +0000
updated the makefile
commit 78e6263376914906b49ac9e97fc3823d900ae792
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 15 00:21:28 2010 +0000
Changed the CXXFLAGS to -g
commit c57f2da110f673e0a998a9407ceed59c4bcccaf2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 14 15:57:59 2010 +0000
some work
commit 84a876a3c0cdd54b1600a1e9d367f63f4e8ce1a4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 14 06:49:48 2010 +0000
Started to work on this.
commit 04bde8a1c5dc8504d289b1c496975335f4d1ae7d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Nov 12 19:50:53 2010 +0000
Started to implement the function arrays
commit 6ede5cd06b897aeaac404152973578a6d2b84654
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 11 07:34:59 2010 +0000
sending stuff.
commit ae6422ef7b1c2f430724b65965fa328f5fdae6a0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 11 07:11:18 2010 +0000
Fixed another pesky bug.
commit 013a514424ba8ac16c5d5acb16dc6f7a06397186
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 11 06:59:51 2010 +0000
added a comment
commit 91b183374a342db79c01f241fe87911b1ac2d7cc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 11 06:47:43 2010 +0000
Optimized messages.
commit de178e772ae05c52d1c1f5beb2ccd8de2cb6e1ec
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 11 06:25:58 2010 +0000
Corrected an error, bug
commit f35ea778d331a58cb484070cbab9402f6af9b568
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 11 05:48:12 2010 +0000
Fixed an infinite loop
commit 1155596f8f869ff6902fa10785ef5990cfe83d7b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 10 23:41:28 2010 +0000
Add/Change #540 (use sentinel to remove two messages coupled with TAG_REQUEST_READS)
commit 3cb78d4d5d76530276fd5654d7f20566c092ee60
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 10 23:19:27 2010 +0000
Add/Change #538 (in Ray, if message is more than 4096 for TAG_REQUEST_READS, send it in chunks)
commit c0060ef044669f47f320a0adf52ac3df593b5f9f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 10 22:59:08 2010 +0000
Add/Change #537 (do an assertion with message size under 4096 in MPI_Send-utilizing function)
commit 14949e985e6718fdcc0798437ab247e67f641e67
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 10 05:04:16 2010 +0000
Debuggng messages.
commit c0dd371b43bea227e20ca0a33c12aacef1e31631
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 10 03:32:08 2010 +0000
ASending diff.
commit 964306d49c9f14a822c651e8f7af5d9626b7fe52
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Nov 10 00:59:25 2010 +0000
Add/Change #529 (why is there no message near 'Rank 0: fusion is done.')
commit 7d508b1b510aa21084ee412d8936ec51c14001f0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 9 18:07:29 2010 +0000
Add/Change #23 (add an early-stop technology (To speed up the process.))
commit 84637ddc04d5a666daff60cb387776c4bb67e337
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 9 17:36:13 2010 +0000
sending diffs.
commit 518a065607d821500acc3e53ed38e67366f10249
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 9 16:15:59 2010 +0000
Removed the regulator.
commit f362e4e49eaa971ede46d0a153b01306d54b7b68
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 9 13:20:47 2010 +0000
Changed it to 15 us.
commit 6845e283c3b0ffe0975cee8a0e6c818eabbc9ec7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 9 01:51:27 2010 +0000
the tribe is regulated with a scale of 5 micro-seconds
Add/Change #528 (regulate messages in the tribe)
only in the extension step.
commit da8853ad507c988cb334e3111a727ecab8f1d5b1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 8 20:00:22 2010 +0000
sending new files
commit 6b5b7c6919a2896d4a75157f2f9ace9342557718
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 8 19:56:33 2010 +0000
Sending code with modifications for regulation.
commit 0f6936106da55134a6731518e40e1bcf67c810a7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 8 18:59:36 2010 +0000
Removed memcpy for sending messages to self.
SB
commit 6b014fc6de17e2bd20998a3faa1f4091403a43cd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 8 03:48:32 2010 +0000
Adding a file.
commit 29944077e9cd5d6433ec118c0d6fd2ad86e6650d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 8 03:47:44 2010 +0000
APossibly a fix for:
Add/Change #140 (put seeding stuff in seeding data)
commit 2a219c2e9f486455952687b1c33e12c2a6a7c43d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 8 00:45:29 2010 +0000
Add/Change #526 (left reads are not linked with the right one... this is a bug.)
commit f75f5388f26e091c31874894d9674182398be8ef
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 8 00:34:14 2010 +0000
Add/Change #525 (add support for .fasta.gz)
commit 59764e16c6c8845df7671b1286f5674308924837
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 23:22:06 2010 +0000
AAdd/Change #512 (add support for .gz files)
commit d249204ded706ff6586231007fe162e565d7fbc0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 23:07:43 2010 +0000
Sending new code.
commit 2601ad13e3af5a28242d19544ec4d1ad5accef4a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 22:59:44 2010 +0000
Sending code.
commit 3f404c0b3f758a1b17bb429fa58a59b58b2359a1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 22:50:29 2010 +0000
sending new file.
commit ffcf86e2b347ede1eb443140051f05042069c121
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 22:49:50 2010 +0000
Adding a new loader.
commit cf5ab61b9bc5059f6da7c221cbfd5876df6f7ea9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 22:34:53 2010 +0000
sending data.
commit ce179bfeffcc0b9ede8465678c05f28615cb176f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 22:17:17 2010 +0000
Sending stuff.
commit 12e4e0fa9946cc9b1dea144be419bc93c852edcf
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 22:13:00 2010 +0000
Adding files.
commit 711866c7cbc35139c32fadb13ca54025c847077f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 21:51:43 2010 +0000
commit 91a43c375aeea1aa3cc07e8a99429cf1851dabc4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 21:49:03 2010 +0000
commit 32508bf3aeeb946fe88e66ecaf22d390083ea045
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 21:46:42 2010 +0000
Removing makefile.
commit 16bebb17254987ec074f035d076a14354ec3340b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 21:46:32 2010 +0000
Sending configure stuff.
commit 274dd4f6e0b233b58ef3af4f68aba8e665fd2bdb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 17:42:38 2010 +0000
Add/Change #521 (Do a test with a paired library of 1000 on E. coli.)
commit 3225bb264c0012604508bc4b37926ff3dd1a78eb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 02:09:11 2010 +0000
Adding another script.
commit 214ec101d8a2caaf8e3404fd48ca4465cfdbcb65
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 01:08:26 2010 +0000
Added a script to prepare for gnuplot
commit edb721f2953364f04b8768bb07fd5ef1c85758eb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Nov 7 01:07:46 2010 +0000
Added gnuplot scripts.
commit cba8313292d67dcbdb96d37550f5347939697e87
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 6 23:58:21 2010 +0000
Version is 0.1.1
commit 7af7db3502c9eac435ff3263a8e49bb72470c705
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 6 23:53:53 2010 +0000
Corrected a bug .
commit e5dc6f3a061741964b33363f87bd065f9c942c2e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 6 23:35:13 2010 +0000
Corrected an output for library computations.
commit c94a148e98c171150f6dc5c826d4fe4446439e20
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Nov 6 21:14:47 2010 +0000
Sending stuff
commit 2064264ed3593717697c1cab308c0e9cafe9205b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 4 04:00:09 2010 +0000
Updated NEWS.
commit 75d8a39578ada07c28293460475d57ee0e0fed84
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 4 02:48:41 2010 +0000
Updated the NEWS.
commit d58f0e4b982db5ad4f171cfb17a14c8d608b2ee9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Nov 4 02:26:04 2010 +0000
Sending news
commit ce63ec7366263fc5099ee7938485cdc07d2fca01
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 2 21:40:41 2010 +0000
Adding a script.
commit 58f2c7be3e73e073619efd6f6753c1ac858a8186
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 2 20:33:09 2010 +0000
Added a script.
commit 7cc71073b829c6dcefb58103ca25ddcebc87eaa2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 2 20:32:02 2010 +0000
Moved scripts.
commit f30e60ea4227be25bc74ed6f693a105632d5e4bb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 2 20:28:40 2010 +0000
Adding a script.
commit 5c735ab1aaa818aac28792092a4beab7492a0377
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 2 19:32:23 2010 +0000
removing stuff.
commit 92cdb1cd70fbcebac481fa4c4bde1551733c9ae0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 2 18:08:14 2010 +0000
Updated scripts.
commit 96f8daa449490ddbac7379084911d41f86c8d0f9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 2 13:02:17 2010 +0000
Added dates in output of elapsed times.
commit 429ee679494e55e0bb25936020f6e94fb77349a0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Nov 2 12:52:10 2010 +0000
Sending small changes
commit 042e0ee9a56bc606cc2a1ebf51d2d5e0cde8c692
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 18:56:02 2010 +0000
corrected TimePrinter
commit b7866b9cc8bca55b118625f096852057c991049f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 17:29:00 2010 +0000
sending modifications.
commit 914df73157f7c162b56600c55ae2503e502b87c6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 17:27:53 2010 +0000
Sending commands.
commit 53aad432f597504c696f9582c78e3a1bf530c76e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 17:26:46 2010 +0000
Added an example
commit c025ae457f79a6b7036e83781c0b8fa7c7960ce4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 16:41:00 2010 +0000
Removing sort, it is useless.
commit 89bf2619d4f68705c6c98be7427eb4658d2e5590
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 16:01:17 2010 +0000
Removed a debug message.
commit 16d4d60a86597f9f99c52ca29e2e027c2cc9ff27
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 15:38:38 2010 +0000
Updated the Makefile.
commit c4200349ca489bf2d0c8c636ddb1fe160bcf2f69
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 15:35:41 2010 +0000
Updated released procedure
commit fd5decc096cf2700d37e7d9044ab9ace0d2718fa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 15:34:15 2010 +0000
Updating README
commit 18de70b1bf89bba4bb35185bb409aa60b5221d9b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 15:33:30 2010 +0000
Updated the Makefile.
commit 0ff38015d8613c875c7dd2c3933ea44df2b3e6af
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 15:29:15 2010 +0000
The Makefile is awesome now.
-SB
commit 0b6009d980688e98bb2f3868f1c629b92d0516f5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 15:26:32 2010 +0000
Removing useless files.
commit 6debbcdb1f0a08d4f014401ccce7e6a2f1e0f3bf
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 15:25:11 2010 +0000
Moved code in code.
SB
commit 7bf4f94cbac0268aad8932d1a8b24f98af8a7e16
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 15:24:29 2010 +0000
Updating Makefile
commit 19ac3649a6447348fa24acfe2c97916ad703fbfb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 15:18:59 2010 +0000
Sending information.
commit 6039dc1e328595a36467ecd6fcd1c159dbb8f807
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 15:06:23 2010 +0000
Add/Change #498 (Do a test by ordering the seeds by the length before processing them.)
-SB
commit 25b0906238d8a257045366072812f26ff65561ca
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 14:36:49 2010 +0000
Updated NEWS
commit b6c8a1b7e7f37afeffe0c25cba5fcf88a520f33d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 14:25:44 2010 +0000
Corrected INSTALL
commit 09f2da81ec00e47f7b74596bf69e2a662b0220a8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 14:24:21 2010 +0000
Using 1.4.3 in examples.
commit 6c9f7bef2a26286f099a90bfb97179e548e8591e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 14:20:28 2010 +0000
Removing a file
commit 9a6baa8959d524cd8e2da20e3129e783e1b91abb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 14:09:21 2010 +0000
Updated options.
commit f73e5e19703793742c4958507a3f45fede8cf181
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 13:49:08 2010 +0000
The AMOS FILE name is now based on -o option.
commit a88c5c2fb3a1eb6741fd290d6f86d6458114c652
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 13:30:52 2010 +0000
Updated files.
commit 59cf4172ef5b78b6368a2650fd8d125261b0b75e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 13:25:59 2010 +0000
Changed readme file name
commit 8996d9b3ed2a1c7d7ddeab0a70ab41b8ef8dc56d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 13:25:32 2010 +0000
Changed LICENSE file
commit 6e7a0a3232790645b433c40317e234323ef75a17
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 13:23:28 2010 +0000
Remove codename
commit 3aef69c1ea7a7a6cb0d21f91b4be6af909fd3246
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 13:01:16 2010 +0000
Corrected a critical flaw
commit 95a4090c9ab0f30a2a36fa69e1bf20447ffcaf38
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 12:51:50 2010 +0000
Changed period to 10 for fusion reporting
commit d7ac69b7d8e4a17b3a77a17958f6a86fc198b4d3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 12:26:52 2010 +0000
Simplified extension of seeds.
-SEB
commit 1e1bac6f72c14170cf4f6ceddd77e305880bb030
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 11:44:38 2010 +0000
Add/Change #495 (group TAG_GET_PAIRED_READ with TAG_REQUEST_READ_SEQUENCE)
-SEB
commit dda38246559f9ad914c3d6b9c87fc7f5578b3ab6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 03:37:11 2010 +0000
Corrected the script.
commit ff5d111509e65675af464e61bef3d95361caf71a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 03:36:33 2010 +0000
Moved script.
commit 5edf82a0b1253f02063b68249cdd11ecc195b56d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 03:35:41 2010 +0000
Corrected the Makefile.
commit 423b283406f54c6a0a9c0418e2c7369234489bef
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 03:34:58 2010 +0000
Updating scripts.
commit c106d54ba76c81a3a8a39ac766cc4381ab402654
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 03:32:25 2010 +0000
Adding examples.
commit 633209a084f37abd620a877b71bdeb66dc273ab7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 03:18:43 2010 +0000
Sending a small change
commit 9d8a51bf528270f44516ed2ea2ea66bc4e74d5e5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 02:58:37 2010 +0000
Corrected keys, changed them to u64
commit b02db8d059889487820f8c8720f2f6d497115b5d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 02:07:49 2010 +0000
Added indicator of temporal advancement
commit 1e36d7dbd9623e7ecb58f84f4381d10b6b6cf47b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Nov 1 00:30:24 2010 +0000
Add/Change #494 (implement a TimePrinter with cool features)
commit b35b22a1e638c160b3e603aae891772adda724e0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 23:59:41 2010 +0000
Add/Change #154 (Use only a int to represent a Read index in ReadAnnotation)
commit a321624fcff3f3feb6e4881138a07550a215d865
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 23:57:39 2010 +0000
Add/Change #153 (Use only a int to represent a Read index in PairedRead)
commit d9ba95e72f5f4831de2361705b390b215096d055
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 23:42:52 2010 +0000
Add/Change #491 (remove messages that use TAG_HAS_PAIRED_READ)
commit 3c7d7ac3eabb2eded2ce26a8e8df530924d57e68
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 21:09:32 2010 +0000
Some fixes.
commit 60206d6a30c018a329bfcfe51452934163d3ff92
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 20:25:24 2010 +0000
Updated the Makefile.
commit 7c59b468d9290f9fa082a2d516c5aa4acea8ca81
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 20:23:36 2010 +0000
Now I am ready to face the trials
-SBE
commit af76b19a74b9c77b8d08324031fc08e6e634be9f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 17:45:49 2010 +0000
Moved wiki file.
commit fc54155a8e2bfa85b9fda5cada3aaf8cdbfabefe
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 17:39:58 2010 +0000
only do the silly DFS
when
there are more than one edge LOL
Ticket #490 (new defect)
SB
commit 16493d94d4f0e43d951eab56542847a809a31677
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 17:23:27 2010 +0000
cache paired end queries in seed extension
Ticket #487 (new enhancement)
Seb
commit 547fc89526042a665a8bf728e7ac6d2a076cdac8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 16:53:01 2010 +0000
the error was in MessageProcessor
genome size is too large for ecoli, check where I incorporated a wrong line
-seb
Ticket #489 (new defect)
commit 80ad2c78b70c2ec669b2299c7e60b3b8beb8f90f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 14:30:19 2010 +0000
SYncing
commit 409b9972cfdbe97f0c97b6b9a14f4f3ea078736b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 04:05:22 2010 +0000
Sending diff.
commit b46bf62d954f95014ad9efc0b4b1568a0521e133
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Oct 31 02:53:15 2010 +0000
Removed a print
commit 1316790047e1c94496ae4f61068a6aa4648decb3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 21:46:29 2010 +0000
COrrected a bug in MPI count
commit dc5fe0bb762710a06589562b5a238112c47edbe9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 21:43:47 2010 +0000
Removed a loop.
SB
commit dd0cf7beafd4f166a23392afb7f3e9a634765fd1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 20:26:53 2010 +0000
Updated the release procedure.
commit 541b7dca19fedf09e83ca339c34d84b18539de62
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 20:18:12 2010 +0000
Added the number of k-mer for a given size.
commit 0fd514e440f6ece5ecb079690ed04a786017ffde
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 20:12:32 2010 +0000
Added exception when out of memory or requested memory exceeds CHUNK SIZE
SB
commit 6df2f4b455a72860eff2681ad7601419f08e5819
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 19:38:28 2010 +0000
#164
removed a lot of communication LOL
SB
commit 7a129a40787173a1b590423d514af89b34cfd009
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 19:21:55 2010 +0000
#164 working on it
commit 46323d6ab1b9905cd29fc58c514a2acefd403bf1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 18:11:23 2010 +0000
Removed some line breaks.
commit 7162e4be79fafd3fcb0837a247261013a9471c73
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 18:10:20 2010 +0000
Adding files.
commit ec2e430cc370a37e68a672752dbf79a4d6b9119d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 18:10:06 2010 +0000
check the code for
extracting
edges
Ticket #486 (new enhancement)
SEB
commit bc1d97d972b36bb9220a70c0c6c22e3fcfdb2c38
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 17:02:48 2010 +0000
[boiseb01 at ls28 trunk]$ svn merge -r 3680:3683 http://genome.ulaval.ca/svn/boisvert/Ray/branches/Ray-0.1.0_vector
--- Fusion de r3681 à r3683 dans '.':
U Machine.cpp
U Machine.h
U MessageProcessor.cpp
U common_functions.h
U MessageProcessor.h
Merging the branch.
commit 6abbc74e78c2733eaabcc812d3097a6262e406a1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 01:00:32 2010 +0000
Write the coverage distribution.
#480
commit 25665004ee14e416bc483d6532abb84cf64cb8c5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Oct 30 00:56:49 2010 +0000
add reference in Ray
#479
commit 1018302e8a6ef657ced8b0af52e945279d702cb2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Oct 29 20:19:23 2010 +0000
make k a tunable parameter
#483
commit 5b5d407263e743af4f18a06aa16795299846b835
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Oct 29 20:00:05 2010 +0000
Verbose mode.
https://24.37.247.169:4443/trac/ticket/167#comment:9
commit 186264b8c759549599c0b87c5ce0b82fafa3152d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Oct 29 16:50:04 2010 +0000
Enabled -v is default.
commit 023c0fb416c12dd4f80423eaae2fd347f5841763
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Oct 19 16:16:13 2010 +0000
# 446
Jordi Camps Itanium probably fixed now.
Aligned allocated parts from MyAllocator onto 8 bytes.
-SB
commit f808fd08a83e685b90e6a68d9d0b1182c483be4a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 30 16:10:59 2010 +0000
Ajout d'un Define.
SB
commit 38e49f2a5fc72e38fabde5ae85b2eac5baf306b4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 24 13:12:32 2010 +0000
Moving wiki.
commit 28732e9f6d206619dcacc031e4b27cd67514b34b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 24 13:12:09 2010 +0000
Updating wiki.txt
SB
commit 94c9e53b9e1e41aef4b3ed7009f18c58120d5f1f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 24 13:09:27 2010 +0000
Sending README
commit b9f601ce7f26047368fa9fe904788c8cf48fa0e4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 24 12:16:33 2010 +0000
Ready for 0.0.7
commit 64faf25baef186e3c79b114a884f836fed6545ad
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 24 11:52:34 2010 +0000
Sending small changes.
commit eefe82d67bb80e7f337eb13291d157ba1f67c24f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 23 20:06:15 2010 +0000
Removed a blank space.
SB
commit b5af9b551edc66d667d81b9d230e854c5e9a7c99
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 23 19:30:46 2010 +0000
Now it seems to be ok.
SB
commit 009389aec806d30ee02a53039bd8e97ed3326285
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 23 19:08:13 2010 +0000
#163 (add an option to for prefix output)
SB
commit 8180ca545c70dd54f701b1f0cf98e0e4a0d3c0fc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 23 17:47:41 2010 +0000
Fixed Makefile.
commit 49c2dc458d8d26263f081d46648184afca7146e6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 23 17:47:19 2010 +0000
#162 (find why Ray crashes on mix21 and mix23)
SB
commit 35a466b31ebb40f0946a088048236eb27f3a4f5f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 23 15:05:40 2010 +0000
Added a script to analyze the quality.
commit e239988806fabe8e79b9e52228cca6ee336f43c6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 23 14:54:30 2010 +0000
Fixed cabog script.
SB
commit dc479865b61cda6b2b10dd234473438f76f918ab
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 23 14:50:38 2010 +0000
This will fix #162 (find why Ray crashes on mix21 and mix23)
SB
commit ab6897d56cffabe61307820f7dabee24d3a08a4d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 23 13:34:08 2010 +0000
Added an option to dump libraries.
SB
commit c36655dc913bab3825e089b4670844692d20d5a3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 22 16:08:30 2010 +0000
Some small changes.
SB
commit 643543cff86b35d9edd4b1621ca048289a6a4aba
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 22 16:05:35 2010 +0000
#156 (Group communications for library distances)
#158 (se map<int,int> for distance storage in Parameters)
#159 (use map<int,int> for distance storage in Machine)
SB
commit 0cd2b539b87a5074d267bcfa6edd9911db265d2c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 22 13:40:36 2010 +0000
Updated scripts.
SB
commit 2c2b889e4e70eb742d63df6a7c2cf721d7d73095
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 22 04:30:07 2010 +0000
#131 (automatic detection of fragment length and standard deviation)
SB
commit c573705c502351a337ed3bd062b280cd212192e9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 22 03:16:29 2010 +0000
Sending code.
SB
commit 10e2eb0914600ec847d4b21a6f8efd1fa8941d83
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 21 20:38:09 2010 +0000
Working on distances,
SB
commit d866f348c0493355b1159ba7e9a7dfb2d97dfd76
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 21 19:04:17 2010 +0000
#131 (automatic detection of fragment length and standard deviation)
SB
commit 975bfaec5c4994a54176489f141b9f054260afd6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 21 15:22:48 2010 +0000
#131 (automatic detection of fragment length and standard deviation)
commit a0b8f4e7f6f42a8edbc7f855017ae0009b5544fc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 21 12:59:07 2010 +0000
some changes.
commit 83e9490c2f553241df015767a9d38920f4530b2d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 20 23:51:18 2010 +0000
Small changes.
SB
commit 718459aa1f9e969637a6168157e9d560c970beda
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 20 20:43:26 2010 +0000
Small fix.
commit 1242f61a7c00e5870dc57be1eeae22bb99d9e42d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 20 20:40:21 2010 +0000
#149 (create an array of splay tree, and hash vertices to place them in)
SB
commit cd01ea981bb4744f743e573dbb3b8dae4e1de94e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 20 19:07:12 2010 +0000
#151 (freeze splay tree after vertice distribution)
SB
commit 3f13272908cf1624a8e2ec4a829fcb8f0b18a8de
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 20 18:43:58 2010 +0000
#150 (pass the allocator to SplayTree when creating them.)
SB
commit 69e6aad337a99c7e9a0f980eba037057ac89b80b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 20 17:54:16 2010 +0000
Some work on Splay
commit 060059f115d33a981844d2b7f17632d4488574ee
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 20 17:41:30 2010 +0000
Changes in scripts.
SB
commit a8dca526ae79faf299b0f2d1d462fbaf92041beb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 19 22:41:01 2010 +0000
pre-release of 0.0.7
commit b778bf86a95445a72ef01eb34abb07037cdd6449
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 19 14:43:54 2010 +0000
sending changes.
commit d1fc2063677873cf90ac1a0aebd45d2f855fb664
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 19 12:41:25 2010 +0000
Removed hard-coded thing.
commit 2a2f353829e52bfacf334ae1f2c69bddcd3c5583
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 16 20:43:40 2010 +0000
Sending modifications.
commit 4b2401a4b89073cf664a966409fd706ec6e42972
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 16 05:06:08 2010 +0000
Fixed compilation errors.
SB
commit d9fb4065e5ad5d2e8390f206227665788c13856f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 15 22:36:11 2010 +0000
#116 (create components to reduce the number of C++ lines in a single file.)
commit 53c644bef693f2d8f8049d4ed9538d6bf39912cd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 15 19:07:01 2010 +0000
#129 (robustness for arguments parsing)
SB
commit 803dc982d44a4353024a024fef599926d88bfd73
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 15 18:52:13 2010 +0000
I am ready to run everything.
SB
commit 678123bfb5bc451972cbd778906612369f6f12f5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 15 17:15:13 2010 +0000
Sending data.
commit 14612d3a0872811025d467f9b8b2c79bd9d7a752
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 15 16:15:01 2010 +0000
Soft watchdog.
commit 31b40ca6f3f2f051dfcc51a80af51d9daee1d7e1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 15 15:36:36 2010 +0000
Introducing watchdogs:
TipWatchdog -- because cutting tips can be a dangereous business!
RepeatedVertexWatchdog -- because repeated vertices can be confusing, better watch out.
Sébastien Boisvert.
commit 6c9913cc621c3bd5e432807666f89f4bca94e837
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 15 15:13:58 2010 +0000
added a watchdog for decision on tips.
SB
commit 220ea3fc1d30b827cb4141dcc31f5b2a4b575176
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 15 13:17:24 2010 +0000
Updated scripts and Makefile.
SB
commit 9e696a0d2ce1e2ee25a9fd6ae1901b9cc7b31858
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 15 13:10:30 2010 +0000
Adding a script.
commit 80f8731e403f62d2dcc1eb2217431182c1878045
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 15 01:51:18 2010 +0000
Updated the Makefile.
SB
commit 18cfaf0029083a3a1823d28411fc913f82969d6c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 21:11:17 2010 +0000
1 is not good, remember?
SB
commit 3b7024bc792921adf47b5e7f534ab33d8e581b40
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 20:08:46 2010 +0000
Single change, but not much.
SB
commit bd1a55049bd4e1cd29637f6d12ea0d9719d973f0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 19:54:12 2010 +0000
Fixed bugs.
SB
commit 7bc06b8eaeca277d12549f989f470a1ab5d52ae1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 18:54:50 2010 +0000
#21 (speed hack: when extending reverse-complement paths, only thread reads at the ~1000 last vertices.)
SB
commit 447205f0b4cbc106f9bcb211c9486cb33e664de6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 18:45:22 2010 +0000
Probably a fix for #132 (fix 0mix14-ray)
SB
commit c93320578716ff26bda073105bfd562acc2cc8c1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 17:41:36 2010 +0000
#116 (create components to reduce the number of C++ lines in a single file.)
SB
commit 957eb67dcf7ec11fbe1d41bed819fcfbd9bf39a9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 16:31:56 2010 +0000
Send script.
commit d4db0adb1db39c0f74616ce6c3ff1237f7bf943b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 16:26:25 2010 +0000
Changed name.
commit a5740cda276c88600e2e1685cfe76463ef0fd369
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 16:20:11 2010 +0000
Corrected a bug.
commit 1233f1ce24379064dcfca23928a808b6ca2855b2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 16:09:19 2010 +0000
#136 (add running time in scripts.)
SB
commit 9ed75711d7ee39d39d3941eb9208bcdbfb5ced16
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 14:06:30 2010 +0000
Working on 0mix14.
SB
commit 257f07a29a1efc44f890be3b57492438b7a30588
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 14 11:50:18 2010 +0000
#135 (change multiplicator depending on coverage.)
SB
commit 81dc819ae16d7c2dba7730f4f6d11d48205e2868
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 13 22:24:14 2010 +0000
Improved speed.
SB
commit aa2df7a49915a2c1173769e5edbe32b1ad1e8712
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 13 12:41:37 2010 +0000
Added MPIOPTS in scripts.
SB
commit 3f577a9b1a08f1edb13d25e1e9c82b14ac0badcf
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 12 19:00:37 2010 +0000
Working on ticket #55.
commit a2b48a3069f6c263c2da699905a2837d2469fec6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 12 18:46:31 2010 +0000
ticket #55.
SB
commit 92698c7342e91bf8890b94d80134f2af908a0475
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 12 14:56:38 2010 +0000
Some work for ticket #55.
SB
commit e3ce0ae2f1e67b0e00d9d3824bc4eae973211684
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 12 13:15:13 2010 +0000
Multiplicators set to 1.3 are good.
commit 7b3d4866552b83439c945cae9505407595416614
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Apr 11 20:07:25 2010 +0000
Corrected typos.
SB
commit 745d1a43a13f0958dfda94f42935420c2a4f31d9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 10 14:07:08 2010 +0000
Updated version to 0.0.7
commit cfc7bd86e54b74790cb701aa3aae5f14780079f2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 10 13:22:36 2010 +0000
removed line
commit 0dd436eeedd8dd9a25937c9de906bd5f87c5bf09
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 10 13:21:54 2010 +0000
added a change log.
SB
commit ef20af6a40d451424c9c1dde1aab545fa6813198
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 10 13:09:54 2010 +0000
Updated Released procedure.
SB
commit ea00dc95a15a50c1adde953f0266887c8058a964
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 10 12:33:31 2010 +0000
Updated release procedure.
commit fe0fbb144e73b455f0abc0102a1dd9fc9c4379da
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 10 12:30:42 2010 +0000
Ok now.
commit 5a774432991bcafcefd5c11c20d424a98106f08f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 10 03:27:52 2010 +0000
Fixed SEGFAULTS
SB
commit bef83c9d9f45f43e575695e57a55ea54706b6a2b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 10 01:27:50 2010 +0000
Restored threshold.
commit a06a5a5195a4afcef5f0b3e0e223b15071e93728
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 10 01:26:31 2010 +0000
Changed alarm.
SB
commit 86801c18f0427df6328ea6900597dafb22357cad
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 10 01:25:38 2010 +0000
Restored the good old coverage detector.
SB
commit f8c15ee3aae4655bc1c4d8811aed3c24bc7a9b36
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 9 19:26:33 2010 +0000
Corrected the Makefile
SB
commit c913080200712a59968b06dda49efd4446ca28eb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 9 19:15:27 2010 +0000
Sending updated scripts.
commit 748d73ac80ec1d78eeecb1f739b778d023d1a833
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 9 18:41:54 2010 +0000
Updated README.txt
commit 6df44e2e5123fb3dcae7bb96fe58a45c94816e62
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 9 18:02:24 2010 +0000
added code for circular genomes.
SB
commit 2b553b2cd41d779a35615557f125d12f2aafca87
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 9 17:24:26 2010 +0000
Added documentation on how to use this script.
SB
commit 83b7078fe18e8ed6522980c144c06cc738e4a438
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 9 17:11:21 2010 +0000
Fixed bugs in the new algorithm for coverage detection.
SB
commit 529beef98ae81547c3f2f7d1b7f96112c72c25f5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 9 16:15:48 2010 +0000
#126 (new coverage detection based on linear algebra)
Sébastien Boisvert
commit f86808349e2d3e9f5a564b7dc25f62cbf41ea943
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 9 15:23:30 2010 +0000
Prototype for #126 (new coverage detection based on linear algebra)
Sébastien Boisvert
commit 810fd5fcc3f1c4f36ad8be59cf60ff7f109088aa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 9 02:32:16 2010 +0000
Optimizer
commit 9a92b9ae4256e7dbef669ff7eb342d2766eebb41
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 9 01:13:03 2010 +0000
adding scripts
commit a97f080caf5905e2e258b42c30b2e0287cf27171
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 9 00:54:38 2010 +0000
Added codes for SOLID.
commit e15e977930f15e69e4bedba749bc29126796ddc2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 21:26:15 2010 +0000
Updated a script.
SB
commit 616818d723454a71f915ab489e1275c88858f48c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 21:23:37 2010 +0000
Corrected scripts.
SB
commit 45ae94717f3a208b009029a170f1ff7210344879
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 21:00:38 2010 +0000
* Fixed basename when the file is in the current directory.
* Trim file name if it's too long for simulations.
Seb at boisvert.info
commit cd9718e11de33333b0cc9e75fcb7711ff2960bf3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 20:42:15 2010 +0000
#48 (Fix compilation errors for Simulation tools.)
SB
commit 6c343b5ec3d444e243545bc92062b8dc460c918e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 18:53:23 2010 +0000
#83 (fix compilation errors for 'make test')
SB
commit 95447d345ce7f93aa1d1a1db4df22ac7acac2624
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 17:31:03 2010 +0000
Changed parameters.
SB
commit e009b28669ccf8ae95a02e881e4fb85ee570450d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 17:29:04 2010 +0000
Fixing Makefile.
SB
commit 9115eb2fe973aa56c95dcbf725778a82ca6bb21c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 16:33:56 2010 +0000
added a repeated-region watchdog.
SB
commit c5cc2af9ced0f4a1cf586e757cd40fa8902b85d9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 16:16:49 2010 +0000
Added a watchdog for repeated vertices.
SB
commit f3ef9fdc7a50bcba3323a3b6d67f6d449ffac7ae
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 15:44:53 2010 +0000
Changes
SB
commit 8eb592f958cbf183eca5dab1137546bb3f782bc6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 15:10:17 2010 +0000
Added the 'Tron' algorithm, which can replace the 'OpenAssembler' algorithm.
SB
commit f87b69df3b8ebe9bae9370c5389a9ddca0143e31
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 13:45:34 2010 +0000
#116 (create components to reduce the number of C++ lines in a single file.)
SB
commit 774885e1644905a5c6fc192bc60fa8697953a39d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 12:09:48 2010 +0000
#123 (-DSHOW_CHOICE removal tricks things)
SB
commit 664c67976ea67fa8876eee0f989bea80734ccb84
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 8 03:31:19 2010 +0000
Investigating ticket #123.
SB
commit c938a1e134fdf568ef70bbb3bf1c4845c26b74c9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 7 20:29:55 2010 +0000
Added a component.
SB
commit 6bfa81491151fc105631754074a5d1f0c8770727
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 7 17:29:06 2010 +0000
Corrected serious bugs.
SB
commit a15d18deb05a6f0359b57ae353fea42d3da8b760
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 7 15:58:54 2010 +0000
Fixed a SEG FAULT brought by -ticket #120.
SB
commit 50a0f891095336db10a1b49bb687bb237f2498e5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 7 15:52:01 2010 +0000
Implemented Ticket #120 (move computation of sums, counts, and maxs in mapping of reads onto arcs.)
SB
commit 57b70d1227bbe43cdf61d9aecc279cc845f5627a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 7 15:13:35 2010 +0000
Added a watchdog on the coverage to assess when a maximum coverage is attained.
(related to #107 (check misassembly on mix14))
Sébastien Boisvert
commit 32808c040bd8080e08158b8e844de7e2a431cf45
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Apr 7 14:40:49 2010 +0000
Ticket #116 (new enhancement)
create components to reduce the number of C++ lines in a single file.
SB
commit cc548aad4536106f09c6c795f7213008d1db6c06
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 6 22:21:45 2010 +0000
ticket #117 done.
SB
commit 26759390781ab5084c2765c91c2976964be19310
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 6 20:04:39 2010 +0000
Added two constants.
SB
commit 19490d6e8c8d5f74a77137722a5ba8f3d3fc7688
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 6 19:35:47 2010 +0000
Created a component VerticesExtractor (ticket #116)
SB
commit caacfd1220fa2de954d09e6e737fb2eeb3558e17
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 6 18:49:21 2010 +0000
Implemented Ticket #115 -- early skipping of 1-coverage vertices in extension
Sébastien Boisvert.
commit 2f965f711018f77ed7ea802d379cd47fd5a7d25e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Apr 6 02:27:14 2010 +0000
Investigate the number of elements.
commit 1f6801798db5c51c9dcc66b129fcff3623327a1d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 5 16:31:35 2010 +0000
Grouping communications for pairing of sequences. (ticket #114)
SB
commit c099aecebb7722d2af215a6b2b16439c7eefc119
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 5 16:14:26 2010 +0000
This patch is for sequence distribution grouping of communications.
SB
commit 4997a61430ff1bc482fccfdef310c4ed136b95f4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 5 12:52:17 2010 +0000
Added a constant.
SB
commit 393cbd1bb77da72c30a91322d8d575e3f61d53a1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 5 04:06:38 2010 +0000
Added a comment.
SB
commit 0d5acf96f86ba3ab2d003f8f8e3644ffe38ef086
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 5 04:05:02 2010 +0000
Started to work on grouping indexing communications.
commit 6562b6ddc73ddee71d81c3ba240b5ad790a1bca6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 5 04:00:12 2010 +0000
Flushing arcs in groups (ticket #114).
SB
commit 0fb2224bf3d3a23def1dd0c187f006f295712c25
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Apr 5 03:27:46 2010 +0000
Implementation for vertices, ticket #114.
SB
commit de4e4c2a784cd5c763c2be04bd43fbbc819ba8ad
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Apr 3 12:55:40 2010 +0000
Corrected scripts.
commit ecd51a1237e20d6088ad7602931836b830b1ad1f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Apr 2 14:19:45 2010 +0000
Corrected scripts.
commit fb15602f16d6619d02a120e4719ffd937169c428
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 1 21:38:49 2010 +0000
Fixed ticket #113.
SB
commit 39b5f0acae6cc15a27a948fd27af2e5a3710996b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 1 20:35:07 2010 +0000
Fixed ticket #103.
SB
commit 2115edd2c970f8e584957fc563e31db03b440c4c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 1 12:57:19 2010 +0000
Skip the first base AND the first color in SOLiD reads.
Thanks to sparks from seqanswers.com
SB
commit 89055179d49c4ef58ab9dd316cc25b7bffabfa0d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Apr 1 00:46:29 2010 +0000
Only open Amos file once.
SB
commit c942964cad98683f71ca78bde4ad80074847773d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 31 19:31:48 2010 +0000
corrected scripts.
SRA001125: the second is 480
commit c49fcfd8eebb5f5d56da5a58e2fa8020ddd11f6a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 31 17:24:53 2010 +0000
Corrected scripts.
commit 0ff8f7c9585b56c48b6596599ea565b9520ba243
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 31 15:27:04 2010 +0000
Corrected scripts.
commit 70d0c1f06104d0d6eccf08d88fbe17f03c14b2ba
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 31 14:24:02 2010 +0000
Corrected scripts.
commit 464a2b75beebc174b2f7d5dec0f97cb1770e0a08
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 31 14:08:49 2010 +0000
Modified scripts.
SB
commit 6307d49f9d8652af2545334bb64cfa9bd7ad9324
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 31 13:33:51 2010 +0000
Adding scripts.
commit a94414d9c604f8194007b137065eb6f755c9ed94
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 31 02:06:33 2010 +0000
adding scripts.
commit 0ceb7bb93f12f6aff64e3d3db5a87d8fadc07d5b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 23:34:42 2010 +0000
Corrected scripts.
commit 4a08a820e6d9fde5f8e69bb54cd565f7a84b7011
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 23:22:35 2010 +0000
Modified script.
commit 9ca65d7c3d6741827bfd2789188b122d5ebac9e1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 23:17:45 2010 +0000
Added additional scripts.
SB
commit e5181fcc71173a866ef12e8e5f5a45b03521ef1f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 21:00:05 2010 +0000
Corrected scripts.
commit 4c63e7c46c3898dae45cdc0b7294fd38808f4a48
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 20:57:11 2010 +0000
adding scripts again.
commit 5a60568e07692d088d6d8e21c1d3bd18357cc1f1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 20:40:31 2010 +0000
Fix to ticket #105.
SB
commit 74ddaa98e7846d6f9ac55f551d8f65293cb50f98
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 20:39:31 2010 +0000
Adding scripts.
commit 08e413db480dd1377637fa4db3f01e95ba216990
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 19:50:34 2010 +0000
modified scripts.
commit 268cee4c33fe86d8add4d77c1823e3fa3d9b40ce
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 19:33:13 2010 +0000
adding scripts.
commit f198928ed53833d76b9554da95bc264107e80442
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 19:12:30 2010 +0000
Adding scripts.
commit d32791f95d95167b311a65ddf4a08393008487c3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 18:28:52 2010 +0000
adding scripts.
commit 2ce1251ea5a1b93fd26ec7ebaefd0ef319af85ad
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 18:11:53 2010 +0000
adding scripts.
commit 3c4be41c69ffe8d1b9b15c9f2376fd8d14c371c8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 17:50:39 2010 +0000
adding new scripts.
commit 143587b4b2cad8dc29b531caad5696cfb62e9fcf
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 17:03:29 2010 +0000
added log files.
commit 98f848fe81c6d568c619941c7c3b568dc59e9789
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 16:49:01 2010 +0000
Updated scripts.
commit d3a5bf919ff27e3b99d61e9ea5096440c13f9595
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 16:13:09 2010 +0000
Move things around.
commit 0826d312d0f68283aeca992a8b55ba9ea1547226
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 16:03:34 2010 +0000
removing script.
commit a6d51e58bf48bb3d239acebd2586994f1fc74844
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 16:03:26 2010 +0000
adding scripts.
commit 0d0f406a97ce44b474e1ccee06fd701e9114d9d9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 30 15:37:28 2010 +0000
adding scripts directory.
commit a3d7d83610bcb3330e0f13493ecba24386f4347d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 29 18:38:06 2010 +0000
Updating the script.
commit 76ad45fe46e8a148bc64726bcdfca811a244b14c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 29 14:39:32 2010 +0000
added identifiers. in tests.
SB
commit b4dcdeaeb37cf379c7568138bf1896d1d1d6156f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 29 14:12:29 2010 +0000
Updated the wiki.
SB
commit 91078cf0405c54f098c820fdcc850245eac6fb26
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 29 14:05:58 2010 +0000
Adding scripts.
commit 7f28cc363b886e91bf0f5ebcc13fe84263ba9341
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 28 14:19:33 2010 +0000
Updated scripts.
SB
commit e41f3e5e01d33f62ea023645c1a94a58b4c2d30c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 26 21:44:03 2010 +0000
Changes for today.
commit e035e041f00023455d9e4447dc6c3523c1c5366b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 26 19:44:51 2010 +0000
This might be a fix for #103.
SB
commit b62c18875feeb6d057554938756d0690bf6d323d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 26 19:14:22 2010 +0000
Adding new scripts.
SB
commit 8355702b6241704d6b7989774b9a4c58903c0ac7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 25 21:18:48 2010 +0000
Sending code.
SB
commit 76597c8af040a40b96c735c1abdd5ef1b8b61a97
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 25 19:27:35 2010 +0000
Working on ticket #100.
SB
commit 04b84e919d4935757f0f7c0be62abc9a06e5e566
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 25 18:33:02 2010 +0000
Fixed a bug in amos output.
commit c1c05a5e5e69af98e1610403297ad3ceeb2bff12
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 25 13:57:40 2010 +0000
Working on bubbles.
SB
commit fb898183102bf1b83d9d770c08b5811970f0c0ea
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 25 13:24:10 2010 +0000
Fixed crash when one read is provided. (ticket #99)
SB
commit 58728eaea49f0319b127c99deda8e9450dc4bb1c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 24 20:57:59 2010 +0000
Added a read trimmer to remove letters that are not nucleotides from both ends.
Sébastien Boisvert.
commit 9e84cd2cc4c9fe1392205d7aaa7cb1013c785eeb
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 24 20:33:39 2010 +0000
Corrected a bug for coverage distribution.
SB
commit a4eacf201efe8359fd202f541ff95a2d45dc4afc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 24 20:18:45 2010 +0000
Updated Release Procedure.
SB
commit ab8c96e4f57d49e77aaadadbb4f276d7ecbe6d58
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 24 19:47:53 2010 +0000
Fixed a bug.
SB
commit 2a07e529058d414faf71945f5b438c78eff99992
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 24 18:29:44 2010 +0000
Support for AMOS is finished.
#58
Sébastien Boisvert.
commit 1184431203de048514168dcfdb42afd507352614
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 24 17:48:49 2010 +0000
Unified the documentation.
Sébastien Boisvert.
commit 0b628e12124f7d7cb3f5bbf3c9744264c5a7fddd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 24 16:13:11 2010 +0000
Ticket #94 -- allows on to provide arguments -- is implemented.
Sébastien Boisvert.
commit 2ffd784b01fb342b2568647300795228e3f60fd9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 24 15:09:04 2010 +0000
* added AMOS support (ticket #58)
* added support for arguments (ticket #94)
Sébastien Boisvert.
commit 3087cf79a698651fda200c008fe8f1f3e8150056
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 23 20:54:05 2010 +0000
Started to work on AMOS output (ticket #58)
Sébastien Boisvert
commit 038f0a942366108ccd317c122da748346ea66250
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 23 20:23:11 2010 +0000
Done with ticket #93.
Sébastien Boisvert.
commit 59dffe93092ec14d360492f1dcea6c9e96ba1a82
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 23 20:02:11 2010 +0000
Ticket #92 fixed.
Sébastien Boisvert.
commit c14b61d55cfbbf46f5932a1585ca9df09ec27dc2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 23 19:11:16 2010 +0000
Cleared some things written on-screen.
SB
commit a81fff01093ba27e4859848f40dc84a1bddd8d90
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 23 02:50:10 2010 +0000
Updated wiki.
SB
commit a4d6b7c6aac0acab2979bafba66e25392153c514
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 23 01:57:32 2010 +0000
Updated procedure.
commit 707e4d2ee0ec11f85b5fd2d2e2af38b1f51ea328
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 22 18:49:08 2010 +0000
Close to version 0.0.4
Sébastien Boisvert.
commit eed81bebd65260c30b4c11ac14e6f45297a0f3ee
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 22 18:15:11 2010 +0000
Implemented another thing to avoid misassemblies.
SB
commit bab5ec8db6c913819c47b896525c9e7518f953b9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 22 13:23:06 2010 +0000
Fixed two situations.
SB
commit 9246a3cef3677bcdbcc679ad6462b1cf0c62495b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 22 01:36:44 2010 +0000
I think this fixed the problem.
Sébastien Boisvert.
commit 9c7087da2d9004e04835c01430980d18d19a9735
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 21 13:51:54 2010 +0000
Added another test.
SB
commit 0133f841bcba61b6a22431e92335b68eff5ea1d7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 21 01:54:14 2010 +0000
I misassembled contig now.
SB
commit ecdc65401dd7f703dde9508ff8bf4703e5e9e215
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 21 00:45:40 2010 +0000
Changes.
commit 5ca5efed83a66d14216a210252300d0337ca3e1b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 20 01:31:39 2010 +0000
Fix of the day for ticket #88 (SpPaired @ k=21 fails).
SB
commit efc5420c9eb747b571f0ffb860688ebe71632b99
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 19 15:26:58 2010 +0000
Created a framework for bubble detection.
SB
commit 95d25d3aab5e151c3bbf462a4a8750eb6e5f8f7f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 19 14:59:10 2010 +0000
Avoid bubble detection unless the maximum vertices to visit is not reached.
Sébastien Boisvert
commit 0afc533b5aa49010d0c84a8c7eafca27019ed854
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 19 14:25:30 2010 +0000
Fixed bug #86. (SEG FAULT.)
SB
commit 511f0d2cb236e3d43e4ad8df0c9a5a6b46184aba
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 19 13:34:00 2010 +0000
Possibly fixed a SEGFAULT. (ticket #86)
SB
commit 46f7252fea1425acb046892935558ab000b8c609
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 18 21:14:11 2010 +0000
Sending work.
commit 89b619346bff8b0b117170cd1ec659815ea3f2e3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 18 19:37:49 2010 +0000
Almost done with the bubble detector.
SB
commit ccfa49e15a1f7f27c52458f153500f68144346a0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 18 00:25:00 2010 +0000
The algorithm is working out now.
commit e8b653fcd9c4cd9667daf3957dd493fec0d8042a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 17 19:10:06 2010 +0000
Switching to ls30
commit 4261b4b380ab68594f4195d3f0602cc774989a97
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 17 18:05:31 2010 +0000
Removed alignment of addresses.
SB
commit 80a9e0275428408a6534595b6c2d76ca713533df
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 17 16:10:37 2010 +0000
I think I found a good algorithm for homopolymers.
commit 90225778ad98885563eb6f480528e2ad68c9c671
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 17 13:39:10 2010 +0000
Some work done.
commit 80753d77e44b79203135a7619e56848c875ebec2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 16 20:46:28 2010 +0000
Bubble detection tool is online.
SB
commit 41bfebdaa1b32952f49a04722e7792dc569e27e7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 16 18:03:59 2010 +0000
Fixed a SEGFAULT by reducing the number of members in Machine.
SB
commit 408a35dddbaf4300ac14194221193bd0aa114210
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 16 14:37:50 2010 +0000
Updated RP
SB
commit fbaee42f34c2ef56a74dba082d63a691dbb8eefc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 16 14:31:00 2010 +0000
Implemented BubbleTool. (for tickets #18 and #19)
SB
commit 518669fc726c07dd8eecde3e81495132bf74aa27
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 16 14:17:26 2010 +0000
Added CoverageDistribution.txt and Parameters.txt to outputs.
SB
commit ae0b40689efad1c440c28db5b657816d915cd779
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 16 14:04:02 2010 +0000
Fixed SEGFAULT (ticket #84).
SB
commit 9540e32f16516e92bd2d374fcecc425eb615286e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 16 13:00:22 2010 +0000
Adding mummer validate script.
SB
commit 5965f5542c962152cdafaad725ce4d83eb6a243b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 15 23:33:44 2010 +0000
Some patchwork on tip detection!
commit 333c920b1cd879e2ab075301fd0e93c11447a1f7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 15 18:11:13 2010 +0000
Adjusted the maximum coverage using COVERAGE_TYPE.
SB
commit 8a55e56557ae92e175912946047bfcd450a542ac
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 15 17:55:25 2010 +0000
Implementation of a tip detector.
Tickets: #79, #20.
SB
commit 8e3560ac4a8b0a243e769bf909b5365175a1e0a1
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 15 14:30:49 2010 +0000
Fixed ticket #80. (stop if no peak coverage is observed.)
SB
commit e6ae40291b89a7a180b9310f400f03279df636e7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 13 03:02:23 2010 +0000
Fixed several SEGFAULTS caused by reads shorter than wordSize
SB
commit 34d6ed363bca628fb422cd1842a7362bfad34a5e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 12 21:58:21 2010 +0000
Testing on SOLiD data, but they seem to be rich in errors...
SB
commit a0e2fef1051335e0a45ed12f31e46dd9ae93633d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 12 17:58:06 2010 +0000
Implemented Distant Segments Graph.
SB
commit 274d29aa18d43146cc74efcdbe19f534ce48f892
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 12 03:12:30 2010 +0000
Working hard on color space!
commit 6ebb83f79798711558d0ff150c5f25888153f1e0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 11 22:28:19 2010 +0000
Sending stuff.
commit b9e793b991de601364075ccdc11d21aa340977aa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 11 18:31:07 2010 +0000
Work in progress.
SB
commit 67673cff07d771a9323d57c90e758b0bfbea4499
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 11 14:10:13 2010 +0000
* Fixed typo in documentation
* Added seqanswer thread.
SB
commit 896d981da51c5255204a97f7d4b18b75a37c5bd7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 10 01:37:49 2010 +0000
Removed test.
SB
commit c1c0e45e163ac18117465371d147d6268186fde7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 10 01:29:57 2010 +0000
Fixed #69 (check if maximum cycling is reached.)
SB
commit f4c666aaccfb2d270270cb723a6d73bf98b2244d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 9 21:53:00 2010 +0000
* Added comments
* removed useless files.
SB
commit 9357629e288b220e049f43d5b6a82b4ac6344778
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 9 20:56:21 2010 +0000
Added some comments.
SB
commit 42f0c99c2f9da3b0302a753b55539a20c9e51201
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 9 20:31:44 2010 +0000
Fixed compilation error.
SB
commit c9ecad675c18df78a87872d3cee5454032d7b023
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 9 20:30:25 2010 +0000
Making some comments.
SB
commit 7e0d895dff5bd99cae1abc77268dc2093aae71c2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 9 20:20:48 2010 +0000
Removed a false assert (it can be false, but it is not a problem..)
SB
commit 3953ca3a9441e68086418a444bb17b70b6103a0a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 9 19:55:50 2010 +0000
Making some tests.
Working towards the #66.
Sébastien Boisvert.
commit 3750293f33e44410198e514ac79f4429cbba45f2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 8 22:40:29 2010 +0000
* disabling cycling for now...
SB
commit 8835a341f973f5165c39d5ab5d83252856efeb2e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 8 22:18:25 2010 +0000
Fixed possible infinite loop.
SB
commit 24fdbf2ea029830c8e584bb12cd7e4a35aec68f0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 8 22:15:41 2010 +0000
Updated year in copyright.
SB
commit fdf9f5d1147d0c96ea8d2a6abe1fea04d2eaa498
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 8 19:25:35 2010 +0000
Fixed ticket #53 (Ray produces too much thing for SpPaired)
[boiseb01 at ls30 SpPaired]$ /home/boiseb01/Ray/trunk/AnalyzeAssembly.py /home/boiseb01/nuccore/Streptococcus-pneumoniae-R6.fasta Contigs.fasta
Alignments not perfect:
1 mismatches, length=4939 alignmentLength=4938
Statistics for >=500-nt contigs
TotalBases=2051310
Perfect=104/105
AtLeast99.9%=1/105
AtLeast99.00%=0/105
AtLeast97.00%=0/105
Others=0
MeanLength=19536
commit 7bcbd152a08322b97ddb1a5556dbe30e27bbce64
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 8 19:00:15 2010 +0000
I only have to make them go together now.
SB
commit f174160e3a3cb48f0fc11a48eab578e2bd5fa5c8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Mar 8 01:13:24 2010 +0000
Fixed the duplication of the first contig.
SB
commit fe17fa39371d9e5287234b29239626bfbd3c0b79
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Mar 7 03:36:46 2010 +0000
Work in progress.
commit 8fe4eff0d1ac4d1fc1a01719a303ba3ccf1e6f36
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 6 13:47:41 2010 +0000
Fixed #54: SEGFAULT on SRA001125 unpaired.
Sébastien Boisvert.
commit ab10c1fe51d1d0d4ac3c5f5ec71270db5a3a4cd6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 6 03:06:35 2010 +0000
Added an error message.
SB
commit 638b7c62c782a4df63641fee9f845e007d79df02
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 6 02:50:11 2010 +0000
Cleaned the code.
SB
commit 5bad53f6263dc74d5bf6db4c6ade8a454b7e1a61
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 6 02:24:35 2010 +0000
Corrected the README.
commit aac9dd4154d9f1e68c1f214df375b1a78f712281
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 6 02:24:20 2010 +0000
Corrected the text.
commit b99b0b998a3608c51c241c19dc269c81a2bcbcf5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sat Mar 6 02:19:05 2010 +0000
Implemented ticket #52.
SB
commit 906ff59a32a7c70cb8c0581ba0be09209935801c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 5 23:41:19 2010 +0000
commit e67047e5f60a440f6891bc96185c2b5f413bfc87
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 5 23:34:42 2010 +0000
Updated the text for Seq Answers.com
SB
commit 473b737da222abdfdcc2efc5883672babaa99fae
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 5 17:46:45 2010 +0000
Added URI.
commit e75dd887dfb304a8a00cb3c7f44f1492387e072d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 5 17:45:22 2010 +0000
Added message for SeqAnswers.com
commit 969c4459a898b377ad4ff5ccbdbb12bb7a0b463b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 5 17:11:25 2010 +0000
Small changes in the README.txt
SB
commit c22bf2612ce0618da238fc62b5d7185f2b632d34
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 5 16:46:46 2010 +0000
Updated the README
Sébastien Boisvert.
commit a8b7084d4ffc94aba31ba67218ca21043644aa3d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Mar 5 01:07:57 2010 +0000
Added endl.
SB
commit 7af569158cfbfb9af49a602756dc274fe5ee7886
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 4 21:01:11 2010 +0000
Implemented ticket #16.
* "load paired reads. (test on SpPaired)"
Sébastien Boisvert.
commit fb00fda8cb53396583df6bbed44593d8f3127995
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 4 19:55:21 2010 +0000
Implemented #45: add a compilation flag for writing things in stdout.
The compilation flag is -D SHOW_PROGRESS
Sébastien Boisvert.
commit 92a1ad4b6223dd063d991ac314437444a3409fbe
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 4 17:14:58 2010 +0000
Changed http to https.
commit 01741ae4246af8b31597e9157a65f073c97e48f6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 4 17:13:12 2010 +0000
Updated the README.
commit 133c258c96761f1e18bb5a5aa0281371489f81f2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 4 16:57:21 2010 +0000
Moved the content of the site in README.txt
commit d8d38bdec2fb319848168c2069b2bab0ce22688e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 4 16:27:22 2010 +0000
Added the content of the website.
SB
commit 0b41b50cfd597acab522f6bb0360b9e68edc152f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Mar 4 15:25:41 2010 +0000
Fixed #47
SB
commit fcde760932fe9ae45c02cd920e09a0296aa90754
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 3 21:38:28 2010 +0000
Added segments.
SB
commit b3d7b9a1496f6c3e92fd4fd02f9b119f7d1aa9de
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 3 20:43:41 2010 +0000
Added a script to analyse assemblies.
Sébastien Boisvert.
commit b99454477a8ca61b42050718c45bc57848121243
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 3 19:12:51 2010 +0000
Debugging stuff.
commit 6e2bdc656f51f1a1a22c0729c0b83293ab70cfc0
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Mar 3 14:38:09 2010 +0000
Work in progress.
commit baebe3dca64abae9aa927de2e53367b000d336a8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 2 22:01:49 2010 +0000
Removed cout's
SB
commit eebc8350b950bac2e2ab687495ea941fd7f4609a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 2 21:43:04 2010 +0000
Partial fix for #15 (when complete coverage of a contig invalids it)
* TODO: head-to-tail alignments.
Sébastien Boisvert.
commit 16c00385c8fdfaff00bc1a23c7be9ded52ae2708
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 2 17:54:34 2010 +0000
* Implemented Ticket #22 (new enhancement) -- possibly use a map<,> to hold information on path lengths.
-> this allows a log(N) length extraction instead of the unpopular N.
* Fixing #22 fixes #41 ( Ticket #41 (new defect) -- Contigs are duplicated on ls28)
* This will presumably eases #37 when colosse.clumeq.ca is not crashed...
Sébastien Boisvert.
commit a0b2344b4857a2cce716b2f8954824f0d3e1517c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Mar 2 14:42:18 2010 +0000
Adding progression in fusion steps.
SB
commit a6a798bcfcdad2e055856618fca36b0144a34ead
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 26 19:50:39 2010 +0000
Documented the code for MPI implementations.
Sébastien Boisvert.
commit 715e127218aff9f6310aa551017aeeccea50d00c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 26 19:33:37 2010 +0000
Detection of MPICH2 and Open-MPI is done.
Sébastien Boisvert.
commit f07bebd77d5087acf4be2632077278c37dda48ce
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 26 19:18:22 2010 +0000
Fixed ticket http://genome.ulaval.ca/seb-trac/trac/ticket/30.
Sébastien Boisvert.
commit ead2433e1f38028b2d39106a26bb8350878da3a7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 25 03:26:51 2010 +0000
Use shortcut when sending message to self.
Sébastien Boisvert.
commit 46c7406bd646e8591e0f4f8c3ab6a7851fd93718
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 25 03:03:27 2010 +0000
Fixed the detection of MPICH2.
Sébastien Boisvert.
commit dd9952de119b95ae9414127179d931505be20c83
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 25 02:38:09 2010 +0000
Added a detection of MPICH2
turn on Isend when it is the case.
Sébastien Boisvert.
commit da2a1f7587adee52439af0d401e1f769d0e78a78
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 23 19:16:58 2010 +0000
Removing all Barriers.
commit 2f4ae7eeee8141b3ec388bb770aa7caad1dde75d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 22 18:46:34 2010 +0000
Removed the qsub SGE submission script. It does not belong there.
Sébastien Boisvert.
commit e054b1905886a6dcc1ec497c8d2ec9232affafb2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 22 17:24:06 2010 +0000
Removed TODO.txt
Tracker is now http://ls13:1235/seb-trac
Sébastien Boisvert.
commit 49d540618169110ea063ee5134ff889e1c8c6da7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 22 17:13:20 2010 +0000
Debuging on colosse.
Sébastien Boisvert.
commit 69f159906397ece171e1c8ed7e425b6c36549bea
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 19 22:24:31 2010 +0000
* Removed time.h and sys/time.h from includes.
Sébastien Boisvert.
commit 6f09a8a9be2982ba2df650dad31e9c7625655d7c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 19 22:20:45 2010 +0000
* Remove calls to Get_processor_name in code.
Sébastien Boisvert.
commit 9b28b19115899eddb54f6a60fc00351d46e9e860
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 19 22:15:56 2010 +0000
SRA001125 preliminary results:
Run time on 800 cores: a few minutes.
-rw-r--r-- 1 sboisver12 nne-790-01 5.3M Feb 19 16:43 Contigs.fasta (quite a few things wrong)
-> check what is going on.
Bugs/Features FIXED:
* remove commented c++ code
* commit results for SRA001125 unpaired.
Sébastien Boisvert
commit 4d53ea6527f5e676134f807665a6a77df064a1e6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 19 21:59:54 2010 +0000
* added progress when attaching reads.
Sébastien Boisvert
commit ba789a1b4c0a1937183e1f4173d6279e3df1c467
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 19 21:43:10 2010 +0000
Implemented:
* add progress when distributing reads.
Sébastien Boisvert.
commit 57848356159624fdf113cc6bb9c63b82c50e1149
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 19 21:17:41 2010 +0000
* Removed all MPI_Barrier calls from the program (they are broken with shared memory for
my application anyway, apparently.)
* this fix fixes theses:
* DEFUNC: sample the peak speed when sending message during 5 seconds, and then,
ensures that it never goes beyond that. (OpenMPI's fifos can't handle it anyway...)
* DEFUNC: SRA001125 freezes with 32 cores on ls30. (find the bug, fixed with --mca btl ^sm, but it is rather slow.)
* DEFUNC: the current problem with extension: several MPI processes are extending the
very same region, thus sending messages to the same exact MPI rank. the rank
is then running out of fifos, and the sm btl hangs. LOL
* DEFUNC: do a barrier at a millisecond interval. (each 10 ms)
* DEFUNC: increase overall speed with regular interval between barriers and messages sent ?
* DEFUNC: don'T underestimate maxSpeed -- use a distinct timestamp in each MPI process
* DEFUNC: essayer plusieurs valeurs de périodes pour les barriers.
* DEFUNC: move verification of an invalid file before the calibration
Sébastien Boisvert.
commit 8bb0da401a9615d2467d8f50bf9c2afb6880d351
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 19 17:11:28 2010 +0000
Speed regulator works on Llactis with 8 MPI processes.
Sébastien Boisvert
commit 8ff66c660cb02e591212ad8058fcd039a2991849
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 18 19:55:40 2010 +0000
Testing speed limitation.
Sébastien Boisvert
commit d07b46e737f31b59f40a30b3f6dae672040e498a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 18 17:03:22 2010 +0000
Removing ther Makefile for colosse.
Sébastien Boisvert
commit bc860896673415438c40e40ecded6e37c547f2aa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 17 22:31:15 2010 +0000
The hang is caused by the btl sm.
using --mca btl ^sm solves the problem although it renders the whole process very slow.
Sébastien Boisvert
commit 4da90629ee2b2285dfae0fdc9cbc8c136e37fc71
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 17 18:50:12 2010 +0000
Currently investigating the hang.
Sébastien Boisvert
commit 52051113b8fc5280f609796567c947a09abd54e7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 16 22:39:00 2010 +0000
* Removed the DUMMY message.
Sébastien Boisvert.
commit 8848929889cd4bf29f5351ba28b8b35d4ffb9d2a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 16 22:30:11 2010 +0000
good .
commit 53b92257a46a3de5e605b8bde3e6cce3276a719a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 15 20:14:10 2010 +0000
working on a bug
it has something to do with Iprobe.
commit 049eb183cdd889526bd4c0e389ff91689821728a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 12 21:08:19 2010 +0000
Updated TODO.
SB
commit a421f27ec6c95e2600b574a168c0c6b040e220f7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 12 17:36:11 2010 +0000
The next milestone:
Ray version Ifrit
depends on the implementation of:
* accomodation of paired-end reads.
Sébastien Boisvert seb at boisvert.info
commit 36cb5df5ce009bb18b55559a9c1025aa40130d36
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 12 17:28:24 2010 +0000
Fix in README.
SB.
commit ca2080c097d7c1ed26f996f7be5b5cbf04c4aa61
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 12 17:25:59 2010 +0000
Fixed:
* do a refinement on the merger (on Streptococcus pneumoniae & on E coli.)
(New) Results (with print-latex.sh from OpenAssembler):
Llactis:
% & numberOfContigs & bases & meanSize & n50 & max & coverage & % misassembled & mismatches & indels
Ray & 179 & 2343444 & 13091 & 27406 & 105816 & 0.94 & 0 & 0 & 0 \\
Spneumoniae:
% & numberOfContigs & bases & meanSize & n50 & max & coverage & % misassembled & mismatches & indels
Ray & 264 & 1980464 & 7501 & 11581 & 72167 & 0.96 & 0 & 0 & 0 \\
Ecoli:
% & numberOfContigs & bases & meanSize & n50 & max & coverage & % misassembled & mismatches & indels
Ray & 166 & 4748610 & 28606 & 53827 & 270019 & 0.98 & 0 & 0 & 0 \\
Spneumoniae with errors.:
% & numberOfContigs & bases & meanSize & n50 & max & coverage & % misassembled & mismatches & indels
Ray & 272 & 1991068 & 7320 & 11502 & 72167 & 0.96 & 0 & 2 & 0 \\
Sébastien Boisvert.
commit 09086f405a8ca09a67e875b3b27c8614f114b346
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 12 16:29:07 2010 +0000
Fixed compilation errors.
Sébastien Boisvert.
commit f5ef1adac868002f3ac4244d5c4d015ecbd0796b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 12 15:53:33 2010 +0000
Fixed:
* in includes, only use < and >
Sébastien Boisvert seb at boisvert.info
commit 0856c3f542ee76c4b71fbeb8f48001dcd0a4bce5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 12 15:36:05 2010 +0000
Fixed:
* document 10000, that is the max # of machines.
Sébastien Boisvert
commit 828ad9ee43181685166f4f6877c5fa4ad6f87a46
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 12 15:19:12 2010 +0000
WORKS-FOR-ME:
* add early-stop trick (not implemented, and probably not necessary because extensions start at different places with large genomes.
DONE:
* add path-merging.
SB
commit d37209ca2871c600d594fdc3daac4337f4bcb564
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 11 18:31:32 2010 +0000
The fusion has begun.
SB
commit 52bef9479d8b7d0307a1197133336d2398c38d65
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 11 15:58:11 2010 +0000
* removed the line break before the Minimum Coverage
* The fusion is implemented in the case of 100% overlapping paths on the same strand.
SB
commit 0423285f179936c4edb1bbce20b0c80f841a113e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 10 20:09:14 2010 +0000
Added the direction class.
SB
commit c851a025cc69ace6c1ac749032c3ee4b1dcb8321
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 10 20:06:54 2010 +0000
Removed paired-end Class.
commit 54dffe6cdebbe547ddbed42aa9e6c28bd3e41390
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 10 20:00:15 2010 +0000
Setting the PERIOD for MPI_Barrier back to 100
SB
commit 91df3e7a36d3a76ea60ddc96d1dd4dfeea15ebf7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 10 19:42:32 2010 +0000
Fixed misassembly.
SB
:wq
commit 72443b701f63c3f28ffa07b18d7d03242b4e1941
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 10 18:56:46 2010 +0000
Implemented:
* use single-end reads to resolve repeats.
* extend in parallel.
* try with a barrier=1000 (it works)
* find out why the extension is slow (?). (Now in parallel.)
SB
commit 8620297b5c7a5fd87418214cd6b43eeb3c568635
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 10 18:28:19 2010 +0000
* Restored extension.
SB
commit 5839eae10f58b7d64c8c0c8137443483d3c49e8d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 9 20:47:46 2010 +0000
Directions are copied.
TO DO:
* use them to build contigs.
SB
commit 66d47b6f0a04112ca65ce72b917d5cea68fb7803
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 8 19:51:35 2010 +0000
Updating TODOs
commit cda1aa3e175e6e3f5c3145f5d2f55f593ac431dd
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 5 22:06:36 2010 +0000
Updated TODO.
commit b5921ad6c141cf1b77c35fb1790ca0f2b357ae8e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 5 21:56:18 2010 +0000
Added this feature:
* use both read strands.
* The short reads are used to resolve short repeats.
SB
commit 07e683bf2e8dfb21ef7844fe85c14ce028b22f41
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 5 16:06:05 2010 +0000
FIXED:
* negative coverage on SRA001125? (fixed char -> unsigned char)
SB
commit adc3690e681046cfd3c8e8816dac3a0f16da49c3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 5 15:05:31 2010 +0000
* remove Edge class (it was replaced by ReadAnnotation)
* replace reads positions with (int,int)
SB
commit bcf00c43ae62527489e789544e76d6581ffde302
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Feb 5 13:32:00 2010 +0000
* FIXED: random mismatches plague seeding?
* FIXED: check memory allocation for master... (something to do with vector<Read*> ??)
SB
commit 9e6b70d4fbc0c3de833c35153d696d97f865c14c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 4 15:31:50 2010 +0000
* removed commented code lines in the code.
SB
commit ce94d8fb5a92e6248178b942dc1ad3e9b09b2ef6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 4 15:11:23 2010 +0000
* only keep seeds with at least 100 nucleotides.
SB
commit 739cc91f32ebf6ada0d360091c548cdc41f3509f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Feb 4 15:00:33 2010 +0000
* I added constants for allocator's chunk sizes.
SB
commit eb927f4fa77bb232430f4d955b334319e9eca5ae
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 3 23:08:47 2010 +0000
fixed compilation warnings
SB
commit a501716a58850801f4e6983508f3509492c0305b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 3 20:10:52 2010 +0000
* The extension is now done in both direction.
SB.
commit d50e115ac642d6ef617264ebbf6a68fc2637ef95
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Feb 3 18:11:47 2010 +0000
Fixed:
* extension does not work on test2 yet.
SB
commit 16e60e519544fd8fb166e466f84cd260faeb3b9d
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 2 22:17:29 2010 +0000
commit ae3f25682210aca70f34272ce21ddeccd18152b9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 2 22:17:07 2010 +0000
Summary of today's work:
* Now, a Vertex stores the coverage with a char, the edges with a char, and the assembled with a bool.
* the extension engine works great, but it is not finished yet.
SB.
commit 8ba5de38fd281381eebe4e940adfc6995a41ded5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 2 21:02:58 2010 +0000
The memory usage is lowered, now each vertex is a (uint64_t,char,char,bool)
SB
commit c5e59e80f8e9edd5cf7b9185d0194f2d4ffe774e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 2 16:32:11 2010 +0000
* removed cout's
SB
commit f1785e37d8ccfb7e7dfc5c98579fe6607130f139
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 2 16:23:00 2010 +0000
* fixed compilation warnings.
SB
commit 582eb132e7ca0307c62b7acabf604345eab835a2
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 2 16:10:58 2010 +0000
* Edges are stored as a 'char'.
commit 86f9ac8bbfc1517429846a19cedc71902d2589b6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Feb 2 14:49:56 2010 +0000
* The coverage of a vertex is now stored as a 'char', with a maximum of 255.
SB
commit 638428c07c52f669554d0e0a2c536fff00796e05
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Feb 1 15:10:46 2010 +0000
This behavior is correct:
* test1 should output 6300 letters, byt 6298 are output.
because seeds only contain vertices with 1 ingoing and 1 outgoing edges.
SB
commit 96fd5992c5999ac9cf8bb7294696c4d6719153d8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 29 21:40:45 2010 +0000
Updated TODO .
commit 207a2bae3fd097163e488ee416baad162c84422b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 29 21:39:40 2010 +0000
* Fixed a SEG FAULT when sending large sequences.
S.B. the almighty.
commit bf8a9ea52a59835187058e49f561daea9781d5fa
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 29 21:31:46 2010 +0000
Reduced communication:
* removed suffix in TAG_OUT_EDGE_DATA_WITH_PTR
* removed prefix in TAG_IN_EDGE_DATA_WITH_PTR
S.B. the conqueror.
commit f52fcef13fd891f4f0a972a9dae3fd9ce59d87b7
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 29 21:24:24 2010 +0000
Done: now I have 2*n seeds! yay.
* also check that added vertices are 1-in 1-out (work in progress.)
Sébastien Boisvert
commit b1501c6792c41a4acf9814e7eb98cc7562cf320f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 28 22:14:00 2010 +0000
No message, just commiting stuff.
commit 335c0c32750f05e1094653be82eeb7653bbb2695
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 28 20:23:47 2010 +0000
* show progress for vertex seeding.
SB
commit d74ccd7107cd1be75943884d95331b3a0676253a
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 28 18:19:04 2010 +0000
* Show progress when attaching reads.
SB
commit 2ef537b916af2bd454b89ee3272edb6e8311e0d8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 28 18:02:18 2010 +0000
commit 370f620230c9676e0ca8d5dce77ae8f1b33d4cda
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 28 18:01:33 2010 +0000
* added version in stdout
* tells if the user uses Open MPI.
S.B.
commit 38aa15ffaf5fcd5ae7b4c61ff94da1610d745e41
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 28 17:53:32 2010 +0000
* Ray returns immediatly if given an invalid configuration file.
Sébastien Boisvert
commit 94ed43a6a9198fe59abdd0166ee8bfcc00955c17
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 28 17:04:49 2010 +0000
* Reads get attached now.
Sébastien Boisvert.
commit 0434b5868ff842eecf492f6c678db28142c0867b
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 28 15:17:15 2010 +0000
Seems ok to me:
* problem with memory usage on MASTER
Sébastien Boisvert
commit ce241e49da6b02d2612facdaca378eb48f9e20c8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 28 15:15:11 2010 +0000
* will fix these later or never (they are not that important.):
* for symmetry-> maybe parent checking.
* grep beaut test1.log |awk '{print $8}'|sort -n|uniq -c|less
* check that the number of seeds is 2*n
* compute 2*n seeds (almost done.)
Sébastien Boisvert
commit 3d79571c8063f40395ae999b6a9e092e3d057bf5
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 28 15:08:05 2010 +0000
* Fixed a bug in building seeds.
Sébastien Boisvert
commit 29964c0ef0b7414ec17db844f214856bad79b287
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 28 14:22:07 2010 +0000
* Fixed problem with Finalize and MPI_Barrier.
* The program returns correctly upon completion.
Sébastien Boisvert
commit 3d64dca7db65a0e6446891f45f433a8788f42eef
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 27 22:49:19 2010 +0000
* the seeds are now computed correctly. (need to test stuff in TODO.txt)
* parallel code works, but the MPI_Finalize calls hang because of MPI_Barrier calls waiting to complete.
* MPI_Send works well because small messages are sent eagerly in Open-MPI 1.4.1.
* use can switch back to MPI_Isend by modifying the code.
Sébastien Boisvert.
commit 004848a55a64f205b5ffb4a1dc2186ab1bd1c8c3
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Wed Jan 27 16:01:21 2010 +0000
commit 800b776a78e2fa752914917fb5174dfa4381fdc6
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 26 17:23:04 2010 +0000
commit 107f7de8cc18564fe23e7332dd799451e10f067e
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 26 17:22:58 2010 +0000
commit 639ecd60b249491e3523c7d596aa72461297a887
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 26 16:33:06 2010 +0000
commit 1e3ad1ba3bcb24442b441740b1d42d290fb88c0c
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 26 16:24:44 2010 +0000
commit 3c9cb7ae8bcba1e7c0df4a136cdb90536bf11065
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 26 16:15:27 2010 +0000
commit 72db23dd80245fe0706462eda62e138ff2ce94b4
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Tue Jan 26 16:12:59 2010 +0000
commit 6686b74dbe4d2e6ad6577bd1d978602b5d4b77cc
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 25 22:09:15 2010 +0000
Added command for MPICH2
commit 113f490d6ec3bc839f9fe62c831d663b2492e1ee
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 25 21:57:01 2010 +0000
Sending code
commit bf74402916207312fd9ea6112f4d1d2ecabfdd72
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 25 21:48:54 2010 +0000
Works ok.
commit f8f66ba5cc640145372096475d5b17d64af520ec
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 25 20:20:15 2010 +0000
test1 and test2 ok with coverage calculation
commit 55bcb0f2ed790aef42c84627cefff7acc0fb3e91
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 25 17:44:52 2010 +0000
commit 7938e7a2edaabf8ee0f55eb1b34e30f76e53c015
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 25 17:43:59 2010 +0000
* free message memory
commit cb446f087806140d2a3604ac5bcb8a7d691af981
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Mon Jan 25 16:27:31 2010 +0000
test1, test2, and SRA001125 file 1 load
commit 3b66a4ba29e24901f4e2524dca1a3211d591561f
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Sun Jan 24 05:10:57 2010 +0000
* possibly proceed separatly for direct and reverse for edges.
* Resotre add Edges. (find SEGFAULT .)
commit 02d9a550dc4fc621efe0e4e39133b48fa419ea16
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 22 22:16:30 2010 +0000
* possibly proceed separatly for direct and reverse for edges.
commit 5a19fc32a309bf408199042a3658906d8fda64a8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 22 19:25:26 2010 +0000
* possibly proceed separatly for direct and reverse for edges.
commit 1c17f41a2961b108f4b2b34c36a15b439be8a437
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Fri Jan 22 15:59:31 2010 +0000
MPI_Waitall is better
commit d6b67519cb532e2ad20cfbde29fd9b370ccf5da9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 21 20:30:54 2010 +0000
Changes, test1, test2, and test3 are working properly
commit 93b583bb9a0521d6f773629e5b7e88096958c5db
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 21 16:02:28 2010 +0000
added a message limit
commit 9093c59b42ac9a1869939a9dd560efd202741714
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 21 15:46:14 2010 +0000
Loading a parameter: the directory name
commit 76883b03c5f6280bf324004e3e42724c9cecf9b8
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 21 15:41:36 2010 +0000
Moving stuff around
commit 955666c7e1c830af55b4bfb277b7f034fbe428b9
Author: Sébastien Boisvert <seb at boisvert.info>
Date: Thu Jan 21 15:41:09 2010 +0000
-----------------------------------------------------------------------
--
Packaging of Ray in Debian
More information about the debian-med-commit
mailing list