[med-svn] r14730 - in trunk/packages/mira/trunk/debian: . patches

Tue Sep 17 17:32:22 UTC 2013

Author: alteholz
Date: 2013-09-17 17:32:22 +0000 (Tue, 17 Sep 2013)
New Revision: 14730

Added:
   trunk/packages/mira/trunk/debian/patches/make.patch
   trunk/packages/mira/trunk/debian/patches/spelling.patch
Modified:
   trunk/packages/mira/trunk/debian/changelog
   trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides
   trunk/packages/mira/trunk/debian/patches/series
Log:
progress for rc1

Modified: trunk/packages/mira/trunk/debian/changelog
===================================================================

--- trunk/packages/mira/trunk/debian/changelog	2013-09-17 15:20:29 UTC (rev 14729)
+++ trunk/packages/mira/trunk/debian/changelog	2013-09-17 17:32:22 UTC (rev 14730)
@@ -1,3 +1,10 @@
+mira (4.0~rc1-1) UNRELEASED; urgency=low
+
+  * TODO wait for rc2 and boost transition!
+  * New upstream version 
+
+ -- Thorsten Alteholz <debian at alteholz.de>  Tue, 17 Sep 2013 18:00:00 +0200
+
 mira (3.9.18-1) unstable; urgency=low
 
   * New upstream version (most patches applied by upstream)

Modified: trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides
===================================================================
--- trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides	2013-09-17 15:20:29 UTC (rev 14729)
+++ trunk/packages/mira/trunk/debian/mira-assembler.lintian-overrides	2013-09-17 17:32:22 UTC (rev 14730)
@@ -1,4 +1,2 @@
 # according to www.dict.cc transfering is American English spelling
 mira-assembler: spelling-error-in-binary usr/bin/mira Transfering Transferring
-mira-assembler: spelling-error-in-binary usr/bin/convert_project Transfering Transferring
-

Added: trunk/packages/mira/trunk/debian/patches/make.patch
===================================================================
--- trunk/packages/mira/trunk/debian/patches/make.patch	                        (rev 0)
+++ trunk/packages/mira/trunk/debian/patches/make.patch	2013-09-17 17:32:22 UTC (rev 14730)
@@ -0,0 +1,26 @@
+Index: mira-4.0rc1/src/progs/Makefile.am
+===================================================================
+--- mira-4.0rc1.orig/src/progs/Makefile.am	2013-08-17 16:11:50.000000000 +0200
++++ mira-4.0rc1/src/progs/Makefile.am	2013-09-17 14:41:44.000000000 +0200
+@@ -49,7 +49,7 @@
+ 	rm -f miramem$(EXEEXT) && \
+ 	$(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \
+ 	rm -f mirabait$(EXEEXT) && \
+-	$(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\
++	$(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \
+ 	rm -f miraconvert$(EXEEXT) && \
+ 	$(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT)
+ 
+Index: mira-4.0rc1/src/progs/Makefile.in
+===================================================================
+--- mira-4.0rc1.orig/src/progs/Makefile.in	2013-08-17 16:13:05.000000000 +0200
++++ mira-4.0rc1/src/progs/Makefile.in	2013-09-17 15:06:06.000000000 +0200
+@@ -609,7 +609,7 @@
+ 	rm -f miramem$(EXEEXT) && \
+ 	$(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \
+ 	rm -f mirabait$(EXEEXT) && \
+-	$(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\
++	$(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \
+ 	rm -f miraconvert$(EXEEXT) && \
+ 	$(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT)
+ 

Modified: trunk/packages/mira/trunk/debian/patches/series
===================================================================
--- trunk/packages/mira/trunk/debian/patches/series	2013-09-17 15:20:29 UTC (rev 14729)
+++ trunk/packages/mira/trunk/debian/patches/series	2013-09-17 17:32:22 UTC (rev 14730)
@@ -1 +1,3 @@
-boost-minimal.patch
+#boost-minimal.patch
+make.patch
+spelling.patch

Added: trunk/packages/mira/trunk/debian/patches/spelling.patch
===================================================================
--- trunk/packages/mira/trunk/debian/patches/spelling.patch	                        (rev 0)
+++ trunk/packages/mira/trunk/debian/patches/spelling.patch	2013-09-17 17:32:22 UTC (rev 14730)
@@ -0,0 +1,26 @@
+Index: mira-4.0rc1/src/io/gap4_ft_so_map.xxd
+===================================================================
+--- mira-4.0rc1.orig/src/io/gap4_ft_so_map.xxd	2013-08-17 16:11:50.000000000 +0200
++++ mira-4.0rc1/src/io/gap4_ft_so_map.xxd	2013-09-17 15:43:44.000000000 +0200
+@@ -37,7 +37,7 @@
+ Fcon	conflict	sequence_conflict	SO:0001085	independent determinations of the "same" sequence differ at this site or region; Or /compare=[accession-number.sequence-version]	Different sources report differing sequences. [EBIBS:GAR, UniProt:curation_manual]
+ Fenh	enhancer	enhancer	SO:0000165	a cis-acting sequence that increases the utilization of (some)  eukaryotic promoters, and can function in either orientation and in any location (upstream or downstream) relative to the promoter;	A cis-acting sequence that increases the utilization of (some) eukaryotic promoters, and can function in either orientation and in any location (upstream or downstream) relative to the promoter.
+ Fexn	exon	exon	SO:0000147	region of genome that codes for portion of spliced mRNA,  rRNA and tRNA; may contain 5'UTR, all CDSs and 3' UTR; 	A region of the genome that codes for portion of spliced messenger RNA (SO:0000234); may contain 5'-untranslated region (SO:0000204), all open reading frames (SO:0000236) and 3'-untranslated region (SO:0000205).
+-Fgap	gap	gap	SO:0000730	gap in the sequence	A gap in the sequence of known length. THe unkown bases are filled in with N's.
++Fgap	gap	gap	SO:0000730	gap in the sequence	A gap in the sequence of known length. THe unknown bases are filled in with N's.
+ Fgen	gene	gene	SO:0000704	region of biological interest identified as a gene  and for which a name has been assigned;	A locatable region of genomic sequence, corresponding to a unit of inheritance, which is associated with regulatory regions, transcribed regions and/or other functional sequence regions
+ FiDN	iDNA	iDNA	SO:0000723	intervening DNA; DNA which is eliminated through any of several kinds of recombination;	Genomic sequence removed from the genome, as a normal event, by a process of recombination. 
+ Fint	intron	intron	SO:0000188	a segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it;	A segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it.
+Index: mira-4.0rc1/src/mira/adaptorsforclip.454.xxd
+===================================================================
+--- mira-4.0rc1.orig/src/mira/adaptorsforclip.454.xxd	2013-08-17 16:11:50.000000000 +0200
++++ mira-4.0rc1/src/mira/adaptorsforclip.454.xxd	2013-09-17 15:44:15.000000000 +0200
+@@ -9,7 +9,7 @@
+ # sequences must be included extra in this file (see "rev_*"
+ # down below
+ #
+->unkown_lookslike_adaptorB
++>unknown_lookslike_adaptorB
+ ACTCGTATAGTGACACGCAACAGGGGATAGACAAGGCACACAGGGGATA
+ >unknown_from_cDNA_project_titanium450bp
+ TTCGCAGTGAGTGACAGGCCACTGAGACTGCCAAGGCACACGAGGGGATAGG


