[med-svn] [python-pysam] 01/01: Imported Upstream version 0.7.5
Andreas Tille
tille at debian.org
Tue Feb 11 17:52:14 UTC 2014
This is an automated email from the git hooks/post-receive script.
tille pushed a commit to branch upstream
in repository python-pysam.
commit 3932a10bd953d5eff2578e9d64d8a6a76182ea02
Author: Andreas Tille <tille at debian.org>
Date: Tue Feb 11 18:46:38 2014 +0100
Imported Upstream version 0.7.5
---
debian/changelog | 37 -
debian/compat | 1 -
debian/control | 45 -
debian/copyright | 107 --
debian/patches/do_not_use_distribute_setup.patch | 17 -
debian/patches/fix_cleanup_tests.patch | 19 -
debian/patches/offline-tests.patch | 1824 ----------------------
debian/patches/series | 3 -
debian/python-pysam-tests.README.Debian | 11 -
debian/python-pysam-tests.install | 1 -
debian/python-pysam-tests.postinst | 20 -
debian/python-pysam-tests.prerm | 22 -
debian/python-pysam.install | 1 -
debian/rules | 55 -
debian/source/format | 1 -
debian/tests/control | 3 -
debian/tests/run-unit-test | 4 -
debian/watch | 4 -
18 files changed, 2175 deletions(-)
diff --git a/debian/changelog b/debian/changelog
deleted file mode 100644
index f42b387..0000000
--- a/debian/changelog
+++ /dev/null
@@ -1,37 +0,0 @@
-pysam (0.7.5-1) UNRELEASED; urgency=low
-
- * New upstream release.
-
- -- Andreas Tille <tille at debian.org> Fri, 07 Feb 2014 18:29:40 +0100
-
-pysam (0.7-1) UNRELEASED; urgency=low
-
- * New upstream release.
-
- -- Dominique Belhachemi <domibel at debian.org> Mon, 03 Dec 2012 16:29:09 -0500
-
-pysam (0.6-1) UNRELEASED; urgency=low
-
- * New upstream release.
-
- -- Dominique Belhachemi <domibel at debian.org> Fri, 16 Dec 2011 16:22:30 -0500
-
-pysam (0.5-1) UNRELEASED; urgency=low
-
- * New upstream release.
-
- -- Charles Plessy <plessy at debian.org> Wed, 08 Jun 2011 19:43:52 +0900
-
-pysam (0.4.1-1) UNRELEASED; urgency=low
-
- * New upstream release.
- * Issue 54 fixed upstream; removed patch system.
- * Build-depend on python-setuptools.
-
- -- Charles Plessy <plessy at debian.org> Mon, 14 Feb 2011 18:54:36 +0900
-
-pysam (0.3.1-1) UNRELEASED; urgency=low
-
- * Draft package
-
- -- Charles Plessy <plessy at debian.org> Thu, 13 Jan 2011 19:32:07 +0900
diff --git a/debian/compat b/debian/compat
deleted file mode 100644
index ec63514..0000000
--- a/debian/compat
+++ /dev/null
@@ -1 +0,0 @@
-9
diff --git a/debian/control b/debian/control
deleted file mode 100644
index c6143b6..0000000
--- a/debian/control
+++ /dev/null
@@ -1,45 +0,0 @@
-Source: pysam
-Maintainer: Debian Med Packaging Team <debian-med-packaging at lists.alioth.debian.org>
-Uploaders: Charles Plessy <plessy at debian.org>,
- Andreas Tille <tille at debian.org>
-Section: python
-XS-Testsuite: autopkgtest
-Priority: optional
-Build-Depends: debhelper (>= 9),
- python-all-dev,
- python-setuptools,
- cython,
- zlib1g-dev,
- samtools
-Standards-Version: 3.9.5
-Vcs-Browser: http://anonscm.debian.org/gitweb/?p=debian-med/pysam.git
-Vcs-Git: git://anonscm.debian.org/debian-med/pysam.git
-Homepage: http://code.google.com/p/pysam/
-X-Python-Version: >= 2.6
-
-Package: python-pysam
-Architecture: any
-Depends: ${shlibs:Depends},
- ${misc:Depends},
- ${python:Depends},
- python-pyrex
-Description: interface for the SAM/BAM sequence alignment and mapping format
- Pysam is a Python module for reading and manipulating Samfiles. It's a
- lightweight wrapper of the samtools C-API.
-
-Package: python-pysam-tests
-Architecture: all
-Priority: extra
-Enhances: python-pysam
-Depends: ${shlibs:Depends},
- ${misc:Depends},
- ${python:Depends},
- python,
- python-pysam,
- python-pyrex
-Description: interface for the SAM/BAM sequence alignment and mapping format (test data)
- Pysam is a Python module for reading and manipulating Samfiles. It's a
- lightweight wrapper of the samtools C-API.
- .
- This package contains the data provided by upstream to run the pysam
- test suite.
diff --git a/debian/copyright b/debian/copyright
deleted file mode 100644
index 85b2e3d..0000000
--- a/debian/copyright
+++ /dev/null
@@ -1,107 +0,0 @@
-Format: http://www.debian.org/doc/packaging-manuals/copyright-format/1.0/
-Upstream-Name: pysam
-Upstream-Contact: Heng Li <lh3 at sanger.ac.uk>
-Source: http://pysam.googlecode.com/files/pysam-0.7.tar.gz
-
-Files: *
-Copyright: 2008-2010 Genome Research Ltd.
-License: MIT
-
-Files: samtools/khash.h samtools/kseq.h
-Copyright: 2008-2011 by Attractive Chaos <attractor at live.co.uk>
-License: MIT
-
-Files: samtools/kprobaln.c.pysam.c
-Copyright: 2003-2006, 2008-2010, by Heng Li <lh3lh3 at live.co.uk>
-License: MIT
-
-Files: tabix/tabix.h
-Copyright: 2009 Genome Research Ltd (GRL), 2010 Broad Institute
-License: MIT
-
-Files: samtools/bcftools/bcf.h
-Copyright: 2010 Broad Institute
-License: MIT
-
-Files: samtools/bgzf.c.pysam.c samtools/bgzf.h tabix/bgzf.c.pysam.c tabix/bgzf.h samtools/knetfile.c.pysam.c
-Copyright: 2008 Broad Institute / Massachusetts Institute of Technology
- 2010-2012 Attractive Chaos <attractor at live.co.uk>
-License: MIT
-
-Files: tabix/bgzip.c.pysam.c
-Copyright: 2008 Broad Institute / Massachusetts Institute of Technology
-License: MIT
-
-Files: samtools/kaln.c.pysam.c samtools/kaln.h samtools/kprobaln.h
-Copyright: 2003-2006, 2008, 2009, by Heng Li <lh3lh3 at gmail.com>
-License: MIT
-
-Files: samtools/razf.c.pysam.c samtools/razf.h
-Copyright: 2008 Jue Ruan <ruanjue at gmail.com>, Heng Li <lh3 at sanger.ac.uk>
-License: BSDlike1
- Redistribution and use in source and binary forms, with or without
- modification, are permitted provided that the following conditions
- are met:
- 1. Redistributions of source code must retain the above copyright
- notice, this list of conditions and the following disclaimer.
- 2. Redistributions in binary form must reproduce the above copyright
- notice, this list of conditions and the following disclaimer in the
- documentation and/or other materials provided with the distribution.
- .
- THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND
- ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
- IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
- ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE
- FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL
- DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS
- OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)
- HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT
- LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY
- OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF
- SUCH DAMAGE.
-
-Files: samtools/win32/zconf.h samtools/win32/zlib.h
-Copyright: 1995-2005 Jean-loup Gailly <jloup at gzip.org> and Mark Adler <madler at alumni.caltech.edu>
-License: BSDlike2
- This software is provided 'as-is', without any express or implied
- warranty. In no event will the authors be held liable for any damages
- arising from the use of this software.
- .
- Permission is granted to anyone to use this software for any purpose,
- including commercial applications, and to alter it and redistribute it
- freely, subject to the following restrictions:
- .
- 1. The origin of this software must not be misrepresented; you must not
- claim that you wrote the original software. If you use this software
- in a product, an acknowledgment in the product documentation would be
- appreciated but is not required.
- 2. Altered source versions must be plainly marked as such, and must not be
- misrepresented as being the original software.
- 3. This notice may not be removed or altered from any source distribution.
-Comment: These files are not used and could be stripped from the source
-
-Files: samtools/win32/xcurses.h
-Copyright: 2008 wmcbrine
-License: PublicDomain
- This file is in public domain.
-Comment: These files are not used and could be stripped from the source
-
-License: MIT
- Permission is hereby granted, free of charge, to any person obtaining a copy
- of this software and associated documentation files (the "Software"), to deal
- in the Software without restriction, including without limitation the rights
- to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
- copies of the Software, and to permit persons to whom the Software is
- furnished to do so, subject to the following conditions:
- .
- The above copyright notice and this permission notice shall be included in
- all copies or substantial portions of the Software.
- .
- THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
- IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
- FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
- AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
- LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
- OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
- THE SOFTWARE.
-
diff --git a/debian/patches/do_not_use_distribute_setup.patch b/debian/patches/do_not_use_distribute_setup.patch
deleted file mode 100644
index fd60f92..0000000
--- a/debian/patches/do_not_use_distribute_setup.patch
+++ /dev/null
@@ -1,17 +0,0 @@
-Author: Olivier Sallou <olivier.sallou at irisa.fr>
-Last-Updated: Fri, 07 Feb 2014 18:29:40 +0100
-Description: Prevent downloading distribute_setup
-
---- pysam.orig/setup.py
-+++ pysam/setup.py
-@@ -127,8 +127,8 @@
- # cp samtools/win32/*.h pysam/include/win32
-
-
--from distribute_setup import use_setuptools
--use_setuptools()
-+#from distribute_setup import use_setuptools
-+#use_setuptools()
-
- from setuptools import Extension, setup, find_packages
-
diff --git a/debian/patches/fix_cleanup_tests.patch b/debian/patches/fix_cleanup_tests.patch
deleted file mode 100644
index 178876e..0000000
--- a/debian/patches/fix_cleanup_tests.patch
+++ /dev/null
@@ -1,19 +0,0 @@
-Author: Andreas Tille <tille at debian.org>
-Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100
-Description: Prevent tests makefile from deleting files which
- are contained inside the upstream source
-
---- a/tests/Makefile
-+++ b/tests/Makefile
-@@ -47,6 +47,11 @@ example_bai.bam: ex1.bam
-
-
- clean:
-+ mkdir keep_bam_files
-+ mv ex9_fail.bam ex9_nofail.bam example_btag.bam example_empty_header.bam issue100.bam tag_bug.bam test_unaligned.bam keep_bam_files
- rm -fr *.bam *.bai *.fai *.pileup* \
- *~ calDepth *.dSYM pysam_*.sam \
- ex2.sam ex2.sam.gz ex1.sam
-+ mv keep_bam_files/* .
-+ rmdir keep_bam_files
-+ rm -rf pysam_test_work/
diff --git a/debian/patches/offline-tests.patch b/debian/patches/offline-tests.patch
deleted file mode 100644
index 968b5ba..0000000
--- a/debian/patches/offline-tests.patch
+++ /dev/null
@@ -1,1824 +0,0 @@
-Author: Andreas Tille <tille at debian.org>
-Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100
-Description: Create a copy of the test suite script and remove those
- tests that try to fetch files from network
-
---- /dev/null
-+++ b/tests/pysam_test_offline.py
-@@ -0,0 +1,1816 @@
-+#!/usr/bin/env python
-+'''unit testing code for pysam.
-+
-+Execute in the :file:`tests` directory as it requires the Makefile
-+and data files located there.
-+'''
-+
-+import pysam
-+import unittest
-+import os, re, sys
-+import itertools
-+import collections
-+import subprocess
-+import shutil
-+import logging
-+
-+IS_PYTHON3 = sys.version_info[0] >= 3
-+
-+if IS_PYTHON3:
-+ from itertools import zip_longest
-+else:
-+ from itertools import izip as zip_longest
-+
-+
-+SAMTOOLS="samtools"
-+WORKDIR="pysam_test_work"
-+
-+def checkBinaryEqual( filename1, filename2 ):
-+ '''return true if the two files are binary equal.'''
-+ if os.path.getsize( filename1 ) != os.path.getsize( filename2 ):
-+ return False
-+
-+ infile1 = open(filename1, "rb")
-+ infile2 = open(filename2, "rb")
-+
-+ def chariter( infile ):
-+ while 1:
-+ c = infile.read(1)
-+ if c == b"": break
-+ yield c
-+
-+ found = False
-+ for c1,c2 in zip_longest( chariter( infile1), chariter( infile2) ):
-+ if c1 != c2: break
-+ else:
-+ found = True
-+
-+ infile1.close()
-+ infile2.close()
-+ return found
-+
-+def runSamtools( cmd ):
-+ '''run a samtools command'''
-+
-+ try:
-+ retcode = subprocess.call(cmd, shell=True,
-+ stderr = subprocess.PIPE)
-+ if retcode < 0:
-+ print("Child was terminated by signal", -retcode)
-+ except OSError as e:
-+ print("Execution failed:", e)
-+
-+def getSamtoolsVersion():
-+ '''return samtools version'''
-+
-+ with subprocess.Popen(SAMTOOLS, shell=True, stderr=subprocess.PIPE).stderr as pipe:
-+ lines = b"".join(pipe.readlines())
-+
-+ if IS_PYTHON3:
-+ lines = lines.decode('ascii')
-+ return re.search( "Version:\s+(\S+)", lines).groups()[0]
-+
-+class BinaryTest(unittest.TestCase):
-+ '''test samtools command line commands and compare
-+ against pysam commands.
-+
-+ Tests fail, if the output is not binary identical.
-+ '''
-+
-+ first_time = True
-+
-+ # a dictionary of commands to test
-+ # first entry: (samtools output file, samtools command)
-+ # second entry: (pysam output file, (pysam function, pysam options) )
-+ commands = \
-+ {
-+ "view" :
-+ (
-+ ("ex1.view", "view ex1.bam > ex1.view"),
-+ ("pysam_ex1.view", (pysam.view, "ex1.bam" ) ),
-+ ),
-+ "view2" :
-+ (
-+ ("ex1.view", "view -bT ex1.fa -o ex1.view2 ex1.sam"),
-+ # note that -o ex1.view2 throws exception.
-+ ("pysam_ex1.view", (pysam.view, "-bT ex1.fa -oex1.view2 ex1.sam" ) ),
-+ ),
-+ "sort" :
-+ (
-+ ( "ex1.sort.bam", "sort ex1.bam ex1.sort" ),
-+ ( "pysam_ex1.sort.bam", (pysam.sort, "ex1.bam pysam_ex1.sort" ) ),
-+ ),
-+ "mpileup" :
-+ (
-+ ("ex1.pileup", "mpileup ex1.bam > ex1.pileup" ),
-+ ("pysam_ex1.mpileup", (pysam.mpileup, "ex1.bam" ) ),
-+ ),
-+ "depth" :
-+ (
-+ ("ex1.depth", "depth ex1.bam > ex1.depth" ),
-+ ("pysam_ex1.depth", (pysam.depth, "ex1.bam" ) ),
-+ ),
-+ "faidx" :
-+ (
-+ ("ex1.fa.fai", "faidx ex1.fa"),
-+ ("pysam_ex1.fa.fai", (pysam.faidx, "ex1.fa") ),
-+ ),
-+ "index":
-+ (
-+ ("ex1.bam.bai", "index ex1.bam" ),
-+ ("pysam_ex1.bam.bai", (pysam.index, "pysam_ex1.bam" ) ),
-+ ),
-+ "idxstats" :
-+ (
-+ ("ex1.idxstats", "idxstats ex1.bam > ex1.idxstats" ),
-+ ("pysam_ex1.idxstats", (pysam.idxstats, "pysam_ex1.bam" ) ),
-+ ),
-+ "fixmate" :
-+ (
-+ ("ex1.fixmate", "fixmate ex1.bam ex1.fixmate" ),
-+ ("pysam_ex1.fixmate", (pysam.fixmate, "pysam_ex1.bam pysam_ex1.fixmate") ),
-+ ),
-+ "flagstat" :
-+ (
-+ ("ex1.flagstat", "flagstat ex1.bam > ex1.flagstat" ),
-+ ("pysam_ex1.flagstat", (pysam.flagstat, "pysam_ex1.bam") ),
-+ ),
-+ "calmd" :
-+ (
-+ ("ex1.calmd", "calmd ex1.bam ex1.fa > ex1.calmd" ),
-+ ("pysam_ex1.calmd", (pysam.calmd, "pysam_ex1.bam ex1.fa") ),
-+ ),
-+ "merge" :
-+ (
-+ ("ex1.merge", "merge -f ex1.merge ex1.bam ex1.bam" ),
-+ # -f option does not work - following command will cause the subsequent
-+ # command to fail
-+ ("pysam_ex1.merge", (pysam.merge, "pysam_ex1.merge pysam_ex1.bam pysam_ex1.bam") ),
-+ ),
-+ "rmdup" :
-+ (
-+ ("ex1.rmdup", "rmdup ex1.bam ex1.rmdup" ),
-+ ("pysam_ex1.rmdup", (pysam.rmdup, "pysam_ex1.bam pysam_ex1.rmdup" )),
-+ ),
-+ "reheader" :
-+ (
-+ ( "ex1.reheader", "reheader ex1.bam ex1.bam > ex1.reheader"),
-+ ( "pysam_ex1.reheader", (pysam.reheader, "ex1.bam ex1.bam" ) ),
-+ ),
-+ "cat":
-+ (
-+ ( "ex1.cat", "cat ex1.bam ex1.bam > ex1.cat"),
-+ ( "pysam_ex1.cat", (pysam.cat, "ex1.bam ex1.bam" ) ),
-+ ),
-+ "targetcut":
-+ (
-+ ("ex1.targetcut", "targetcut ex1.bam > ex1.targetcut" ),
-+ ("pysam_ex1.targetcut", (pysam.targetcut, "pysam_ex1.bam") ),
-+ ),
-+ "phase":
-+ (
-+ ("ex1.phase", "phase ex1.bam > ex1.phase" ),
-+ ("pysam_ex1.phase", (pysam.phase, "pysam_ex1.bam") ),
-+ ),
-+ "import" :
-+ (
-+ ("ex1.bam", "import ex1.fa.fai ex1.sam.gz ex1.bam" ),
-+ ("pysam_ex1.bam", (pysam.samimport, "ex1.fa.fai ex1.sam.gz pysam_ex1.bam") ),
-+ ),
-+ "bam2fq":
-+ (
-+ ("ex1.bam2fq", "bam2fq ex1.bam > ex1.bam2fq" ),
-+ ("pysam_ex1.bam2fq", (pysam.bam2fq, "pysam_ex1.bam") ),
-+ ),
-+ "pad2unpad":
-+ (
-+ ("ex2.unpad", "pad2unpad -T ex1.fa ex2.bam > ex2.unpad" ),
-+ ("pysam_ex2.unpad", (pysam.pad2unpad, "-T ex1.fa ex2.bam") ),
-+ ),
-+ "bamshuf":
-+ (
-+ ("ex1.bamshuf.bam", "bamshuf ex1.bam ex1.bamshuf" ),
-+ ("pysam_ex1.bamshuf.bam", (pysam.bamshuf, "ex1.bam pysam_ex1.bamshuf") ),
-+ ),
-+ "bedcov":
-+ (
-+ ("ex1.bedcov", "bedcov ex1.bed ex1.bam > ex1.bedcov" ),
-+ ("pysam_ex1.bedcov", (pysam.bedcov, "ex1.bed ex1.bam") ),
-+ ),
-+ }
-+
-+ # some tests depend on others. The order specifies in which order
-+ # the samtools commands are executed.
-+ # The first three (faidx, import, index) need to be in that order,
-+ # the rest is arbitrary.
-+ order = ('faidx', 'import', 'index',
-+ # 'pileup1', 'pileup2', deprecated
-+ # 'glfview', deprecated
-+ 'view', 'view2',
-+ 'sort',
-+ 'mpileup',
-+ 'depth',
-+ 'idxstats',
-+ 'fixmate',
-+ 'flagstat',
-+ ## 'calmd',
-+ 'merge',
-+ 'rmdup',
-+ 'reheader',
-+ 'cat',
-+ 'bedcov',
-+ 'targetcut',
-+ 'phase',
-+ 'bamshuf',
-+ 'bam2fq',
-+ 'pad2unpad',
-+ )
-+
-+ def setUp( self ):
-+ '''setup tests.
-+
-+ For setup, all commands will be run before the first test is
-+ executed. Individual tests will then just compare the output
-+ files.
-+ '''
-+ if BinaryTest.first_time:
-+
-+ # remove previous files
-+ if os.path.exists( WORKDIR ):
-+ shutil.rmtree( WORKDIR )
-+ pass
-+
-+ # copy the source files to WORKDIR
-+ os.makedirs( WORKDIR )
-+
-+ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "pysam_ex1.fa" ) )
-+ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "ex1.fa" ) )
-+ shutil.copy( "ex1.sam.gz", os.path.join( WORKDIR, "ex1.sam.gz" ) )
-+ shutil.copy( "ex1.sam", os.path.join( WORKDIR, "ex1.sam" ) )
-+ shutil.copy( "ex2.bam", os.path.join( WORKDIR, "ex2.bam" ) )
-+
-+ # cd to workdir
-+ savedir = os.getcwd()
-+ os.chdir( WORKDIR )
-+
-+ for label in self.order:
-+ # print ("command=", label)
-+ command = self.commands[label]
-+ # build samtools command and target and run
-+ samtools_target, samtools_command = command[0]
-+ runSamtools( " ".join( (SAMTOOLS, samtools_command )))
-+
-+ # get pysam command and run
-+ try:
-+ pysam_target, pysam_command = command[1]
-+ except ValueError as msg:
-+ raise ValueError( "error while setting up %s=%s: %s" %\
-+ (label, command, msg) )
-+
-+ pysam_method, pysam_options = pysam_command
-+ try:
-+ output = pysam_method( *pysam_options.split(" "), raw=True)
-+ except pysam.SamtoolsError as msg:
-+ raise pysam.SamtoolsError( "error while executing %s: options=%s: msg=%s" %\
-+ (label, pysam_options, msg) )
-+
-+
-+ if ">" in samtools_command:
-+ with open( pysam_target, "wb" ) as outfile:
-+ if type(output) == list:
-+ if IS_PYTHON3:
-+ for line in output:
-+ outfile.write( line.encode('ascii') )
-+ else:
-+ for line in output: outfile.write( line )
-+ else:
-+ outfile.write(output)
-+
-+ os.chdir( savedir )
-+ BinaryTest.first_time = False
-+
-+ samtools_version = getSamtoolsVersion()
-+
-+
-+ def _r( s ):
-+ # patch - remove any of the alpha/beta suffixes, i.e., 0.1.12a -> 0.1.12
-+ if s.count('-') > 0: s = s[0:s.find('-')]
-+ return re.sub( "[^0-9.]", "", s )
-+
-+ if _r(samtools_version) != _r( pysam.__samtools_version__):
-+ raise ValueError("versions of pysam/samtools and samtools differ: %s != %s" % \
-+ (pysam.__samtools_version__,
-+ samtools_version ))
-+
-+ def checkCommand( self, command ):
-+ if command:
-+ samtools_target, pysam_target = self.commands[command][0][0], self.commands[command][1][0]
-+ samtools_target = os.path.join( WORKDIR, samtools_target )
-+ pysam_target = os.path.join( WORKDIR, pysam_target )
-+ self.assertTrue( checkBinaryEqual( samtools_target, pysam_target ),
-+ "%s failed: files %s and %s are not the same" % (command, samtools_target, pysam_target) )
-+
-+ def testImport( self ):
-+ self.checkCommand( "import" )
-+
-+ def testIndex( self ):
-+ self.checkCommand( "index" )
-+
-+ def testSort( self ):
-+ self.checkCommand( "sort" )
-+
-+ def testMpileup( self ):
-+ self.checkCommand( "mpileup" )
-+
-+ def testDepth( self ):
-+ self.checkCommand( "depth" )
-+
-+ def testIdxstats( self ):
-+ self.checkCommand( "idxstats" )
-+
-+ def testFixmate( self ):
-+ self.checkCommand( "fixmate" )
-+
-+ def testFlagstat( self ):
-+ self.checkCommand( "flagstat" )
-+
-+ def testMerge( self ):
-+ self.checkCommand( "merge" )
-+
-+ def testRmdup( self ):
-+ self.checkCommand( "rmdup" )
-+
-+ def testReheader( self ):
-+ self.checkCommand( "reheader" )
-+
-+ def testCat( self ):
-+ self.checkCommand( "cat" )
-+
-+ def testTargetcut( self ):
-+ self.checkCommand( "targetcut" )
-+
-+ def testPhase( self ):
-+ self.checkCommand( "phase" )
-+
-+ def testBam2fq( self ):
-+ self.checkCommand( "bam2fq" )
-+
-+ def testBedcov( self ):
-+ self.checkCommand( "bedcov" )
-+
-+ def testBamshuf( self ):
-+ self.checkCommand( "bamshuf" )
-+
-+ def testPad2Unpad( self ):
-+ self.checkCommand( "pad2unpad" )
-+
-+ # def testPileup1( self ):
-+ # self.checkCommand( "pileup1" )
-+
-+ # def testPileup2( self ):
-+ # self.checkCommand( "pileup2" )
-+
-+ # deprecated
-+ # def testGLFView( self ):
-+ # self.checkCommand( "glfview" )
-+
-+ def testView( self ):
-+ self.checkCommand( "view" )
-+
-+ def testEmptyIndex( self ):
-+ self.assertRaises( IOError, pysam.index, "exdoesntexist.bam" )
-+
-+ def __del__(self):
-+ if os.path.exists( WORKDIR ):
-+ pass
-+ # shutil.rmtree( WORKDIR )
-+
-+class IOTest(unittest.TestCase):
-+ '''check if reading samfile and writing a samfile are consistent.'''
-+
-+ def checkEcho( self, input_filename,
-+ reference_filename,
-+ output_filename,
-+ input_mode, output_mode, use_template = True ):
-+ '''iterate through *input_filename* writing to *output_filename* and
-+ comparing the output to *reference_filename*.
-+
-+ The files are opened according to the *input_mode* and *output_mode*.
-+
-+ If *use_template* is set, the header is copied from infile using the
-+ template mechanism, otherwise target names and lengths are passed
-+ explicitely.
-+
-+ '''
-+
-+ infile = pysam.Samfile( input_filename, input_mode )
-+ if use_template:
-+ outfile = pysam.Samfile( output_filename, output_mode, template = infile )
-+ else:
-+ outfile = pysam.Samfile( output_filename, output_mode,
-+ referencenames = infile.references,
-+ referencelengths = infile.lengths,
-+ add_sq_text = False )
-+
-+ iter = infile.fetch()
-+
-+ for x in iter: outfile.write( x )
-+ infile.close()
-+ outfile.close()
-+
-+ self.assertTrue( checkBinaryEqual( reference_filename, output_filename),
-+ "files %s and %s are not the same" % (reference_filename, output_filename) )
-+
-+
-+ def testReadWriteBam( self ):
-+
-+ input_filename = "ex1.bam"
-+ output_filename = "pysam_ex1.bam"
-+ reference_filename = "ex1.bam"
-+
-+ self.checkEcho( input_filename, reference_filename, output_filename,
-+ "rb", "wb" )
-+
-+ def testReadWriteBamWithTargetNames( self ):
-+
-+ input_filename = "ex1.bam"
-+ output_filename = "pysam_ex1.bam"
-+ reference_filename = "ex1.bam"
-+
-+ self.checkEcho( input_filename, reference_filename, output_filename,
-+ "rb", "wb", use_template = False )
-+
-+ def testReadWriteSamWithHeader( self ):
-+
-+ input_filename = "ex2.sam"
-+ output_filename = "pysam_ex2.sam"
-+ reference_filename = "ex2.sam"
-+
-+ self.checkEcho( input_filename, reference_filename, output_filename,
-+ "r", "wh" )
-+
-+ def testReadWriteSamWithoutHeader( self ):
-+
-+ input_filename = "ex2.sam"
-+ output_filename = "pysam_ex2.sam"
-+ reference_filename = "ex1.sam"
-+
-+ self.checkEcho( input_filename, reference_filename, output_filename,
-+ "r", "w" )
-+
-+ def testReadSamWithoutTargetNames( self ):
-+ '''see issue 104.'''
-+ input_filename = "example_unmapped_reads_no_sq.sam"
-+
-+ # raise exception in default mode
-+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
-+
-+ # raise exception if no SQ files
-+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
-+ check_header = True)
-+
-+ infile = pysam.Samfile( input_filename, check_header = False, check_sq = False )
-+ result = list(infile.fetch())
-+
-+ def testReadBamWithoutTargetNames( self ):
-+ '''see issue 104.'''
-+ input_filename = "example_unmapped_reads_no_sq.bam"
-+
-+ # raise exception in default mode
-+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
-+
-+ # raise exception if no SQ files
-+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
-+ check_header = True)
-+
-+
-+ infile = pysam.Samfile( input_filename, check_header = False, check_sq = False )
-+ result = list(infile.fetch( until_eof = True))
-+
-+ def testReadSamWithoutHeader( self ):
-+ input_filename = "ex1.sam"
-+ output_filename = "pysam_ex1.sam"
-+ reference_filename = "ex1.sam"
-+
-+ # reading from a samfile without header is not implemented.
-+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
-+
-+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
-+ check_header = False )
-+
-+ def testReadUnformattedFile( self ):
-+ '''test reading from a file that is not bam/sam formatted'''
-+ input_filename = "example.vcf40"
-+
-+ # bam - file raise error
-+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "rb" )
-+
-+ # sam - file error, but can't fetch
-+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
-+
-+ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
-+ check_header = False)
-+
-+ def testBAMWithoutAlignedReads( self ):
-+ '''see issue 117'''
-+ input_filename = "test_unaligned.bam"
-+ samfile = pysam.Samfile( input_filename, "rb", check_sq = False )
-+ samfile.fetch( until_eof = True )
-+
-+ def testBAMWithShortBAI( self ):
-+ '''see issue 116'''
-+ input_filename = "example_bai.bam"
-+ samfile = pysam.Samfile( input_filename, "rb", check_sq = False )
-+ samfile.fetch( 'chr2' )
-+
-+ def testFetchFromClosedFile( self ):
-+
-+ samfile = pysam.Samfile( "ex1.bam", "rb" )
-+ samfile.close()
-+ self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120)
-+
-+ def testClosedFile( self ):
-+ '''test that access to a closed samfile raises ValueError.'''
-+
-+ samfile = pysam.Samfile( "ex1.bam", "rb" )
-+ samfile.close()
-+ self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120)
-+ self.assertRaises( ValueError, samfile.pileup, 'chr1', 100, 120)
-+ self.assertRaises( ValueError, samfile.getrname, 0 )
-+ self.assertRaises( ValueError, samfile.tell )
-+ self.assertRaises( ValueError, samfile.seek, 0 )
-+ self.assertRaises( ValueError, getattr, samfile, "nreferences" )
-+ self.assertRaises( ValueError, getattr, samfile, "references" )
-+ self.assertRaises( ValueError, getattr, samfile, "lengths" )
-+ self.assertRaises( ValueError, getattr, samfile, "text" )
-+ self.assertRaises( ValueError, getattr, samfile, "header" )
-+
-+ # write on closed file
-+ self.assertEqual( 0, samfile.write(None) )
-+
-+ def testAutoDetection( self ):
-+ '''test if autodetection works.'''
-+
-+ samfile = pysam.Samfile( "ex3.sam" )
-+ self.assertRaises( ValueError, samfile.fetch, 'chr1' )
-+ samfile.close()
-+
-+ samfile = pysam.Samfile( "ex3.bam" )
-+ samfile.fetch('chr1')
-+ samfile.close()
-+
-+ def testReadingFromSamFileWithoutHeader( self ):
-+ '''read from samfile without header.
-+ '''
-+ samfile = pysam.Samfile( "ex7.sam", check_header = False, check_sq = False )
-+ self.assertRaises( NotImplementedError, samfile.__iter__ )
-+
-+ def testReadingFromFileWithoutIndex( self ):
-+ '''read from bam file without index.'''
-+
-+ assert not os.path.exists( "ex2.bam.bai" )
-+ samfile = pysam.Samfile( "ex2.bam", "rb" )
-+ self.assertRaises( ValueError, samfile.fetch )
-+ self.assertEqual( len(list( samfile.fetch(until_eof = True) )), 3270 )
-+
-+ def testReadingUniversalFileMode( self ):
-+ '''read from samfile without header.
-+ '''
-+
-+ input_filename = "ex2.sam"
-+ output_filename = "pysam_ex2.sam"
-+ reference_filename = "ex1.sam"
-+
-+ self.checkEcho( input_filename, reference_filename, output_filename,
-+ "rU", "w" )
-+
-+class TestFloatTagBug( unittest.TestCase ):
-+ '''see issue 71'''
-+
-+ def testFloatTagBug( self ):
-+ '''a float tag before another exposed a parsing bug in bam_aux_get.
-+
-+ Fixed in 0.1.19
-+ '''
-+ samfile = pysam.Samfile("tag_bug.bam")
-+ read = next(samfile.fetch(until_eof=True))
-+ self.assertTrue( ('XC',1) in read.tags )
-+ self.assertEqual(read.opt('XC'), 1)
-+
-+class TestLargeFieldBug( unittest.TestCase ):
-+ '''see issue 100'''
-+
-+ def testLargeFileBug( self ):
-+ '''when creating a read with a large entry in the tag field
-+ causes an errror:
-+ NotImplementedError: tags field too large
-+ '''
-+ samfile = pysam.Samfile("issue100.bam")
-+ read = next(samfile.fetch(until_eof=True))
-+ new_read = pysam.AlignedRead()
-+ new_read.tags = read.tags
-+ self.assertEqual( new_read.tags, read.tags )
-+
-+class TestTagParsing( unittest.TestCase ):
-+ '''tests checking the accuracy of tag setting and retrieval.'''
-+
-+ def makeRead( self ):
-+ a = pysam.AlignedRead()
-+ a.qname = "read_12345"
-+ a.tid = 0
-+ a.seq="ACGT" * 3
-+ a.flag = 0
-+ a.rname = 0
-+ a.pos = 1
-+ a.mapq = 20
-+ a.cigar = ( (0,10), (2,1), (0,25) )
-+ a.mrnm = 0
-+ a.mpos=200
-+ a.isize = 0
-+ a.qual ="1234" * 3
-+ # todo: create tags
-+ return a
-+
-+ def testNegativeIntegers( self ):
-+ x = -2
-+ aligned_read = self.makeRead()
-+ aligned_read.tags = [("XD", int(x) ) ]
-+ # print (aligned_read.tags)
-+
-+ def testNegativeIntegers2( self ):
-+ x = -2
-+ r = self.makeRead()
-+ r.tags = [("XD", int(x) ) ]
-+ outfile = pysam.Samfile( "test.bam",
-+ "wb",
-+ referencenames = ("chr1",),
-+ referencelengths = (1000,) )
-+ outfile.write (r )
-+ outfile.close()
-+
-+ def testCigarString( self ):
-+ r = self.makeRead()
-+ self.assertEqual( r.cigarstring, "10M1D25M" )
-+ r.cigarstring = "20M10D20M"
-+ self.assertEqual( r.cigar, [(0,20), (2,10), (0,20)])
-+
-+ def testLongTags( self ):
-+ '''see issue 115'''
-+
-+ r = self.makeRead()
-+ rg = 'HS2000-899_199.L3'
-+ tags = [('XC', 85), ('XT', 'M'), ('NM', 5), ('SM', 29), ('AM', 29), ('XM', 1), ('XO', 1), ('XG', 4), ('MD', '37^ACCC29T18'), ('XA','5,+11707,36M1I48M,2;21,-48119779,46M1I38M,2;hs37d5,-10060835,40M1D45M,3;5,+11508,36M1I48M,3;hs37d5,+6743812,36M1I48M,3;19,-59118894,46M1I38M,3;4,-191044002,6M1I78M,3;')]
-+
-+ r.tags = tags
-+ r.tags += [("RG",rg)] * 100
-+ tags += [("RG",rg)] * 100
-+
-+ self.assertEqual( tags, r.tags )
-+
-+class TestIteratorRow(unittest.TestCase):
-+
-+ def setUp(self):
-+ self.samfile=pysam.Samfile( "ex1.bam","rb" )
-+
-+ def checkRange( self, rnge ):
-+ '''compare results from iterator with those from samtools.'''
-+ ps = list(self.samfile.fetch(region=rnge))
-+ sa = list(pysam.view( "ex1.bam", rnge, raw = True) )
-+ self.assertEqual( len(ps), len(sa), "unequal number of results for range %s: %i != %i" % (rnge, len(ps), len(sa) ))
-+ # check if the same reads are returned and in the same order
-+ for line, (a, b) in enumerate( list(zip( ps, sa )) ):
-+ d = b.split("\t")
-+ self.assertEqual( a.qname, d[0], "line %i: read id mismatch: %s != %s" % (line, a.rname, d[0]) )
-+ self.assertEqual( a.pos, int(d[3])-1, "line %i: read position mismatch: %s != %s, \n%s\n%s\n" % \
-+ (line, a.pos, int(d[3])-1,
-+ str(a), str(d) ) )
-+ if sys.version_info[0] < 3:
-+ qual = d[10]
-+ else:
-+ qual = d[10].encode('ascii')
-+ self.assertEqual( a.qual, qual, "line %i: quality mismatch: %s != %s, \n%s\n%s\n" % \
-+ (line, a.qual, qual,
-+ str(a), str(d) ) )
-+
-+ def testIteratePerContig(self):
-+ '''check random access per contig'''
-+ for contig in self.samfile.references:
-+ self.checkRange( contig )
-+
-+ def testIterateRanges(self):
-+ '''check random access per range'''
-+ for contig, length in zip(self.samfile.references, self.samfile.lengths):
-+ for start in range( 1, length, 90):
-+ self.checkRange( "%s:%i-%i" % (contig, start, start + 90) ) # this includes empty ranges
-+
-+ def tearDown(self):
-+ self.samfile.close()
-+
-+
-+class TestIteratorRowAll(unittest.TestCase):
-+
-+ def setUp(self):
-+ self.samfile=pysam.Samfile( "ex1.bam","rb" )
-+
-+ def testIterate(self):
-+ '''compare results from iterator with those from samtools.'''
-+ ps = list(self.samfile.fetch())
-+ sa = list(pysam.view( "ex1.bam", raw = True) )
-+ self.assertEqual( len(ps), len(sa), "unequal number of results: %i != %i" % (len(ps), len(sa) ))
-+ # check if the same reads are returned
-+ for line, pair in enumerate( list(zip( ps, sa )) ):
-+ data = pair[1].split("\t")
-+ self.assertEqual( pair[0].qname, data[0], "read id mismatch in line %i: %s != %s" % (line, pair[0].rname, data[0]) )
-+
-+ def tearDown(self):
-+ self.samfile.close()
-+
-+class TestIteratorColumn(unittest.TestCase):
-+ '''test iterator column against contents of ex4.bam.'''
-+
-+ # note that samfile contains 1-based coordinates
-+ # 1D means deletion with respect to reference sequence
-+ #
-+ mCoverages = { 'chr1' : [ 0 ] * 20 + [1] * 36 + [0] * (100 - 20 -35 ),
-+ 'chr2' : [ 0 ] * 20 + [1] * 35 + [0] * (100 - 20 -35 ),
-+ }
-+
-+ def setUp(self):
-+ self.samfile=pysam.Samfile( "ex4.bam","rb" )
-+
-+ def checkRange( self, contig, start = None, end = None, truncate = False ):
-+ '''compare results from iterator with those from samtools.'''
-+ # check if the same reads are returned and in the same order
-+ for column in self.samfile.pileup(contig, start, end, truncate = truncate):
-+ if truncate:
-+ self.assertGreaterEqual( column.pos, start )
-+ self.assertLess( column.pos, end )
-+ thiscov = len(column.pileups)
-+ refcov = self.mCoverages[self.samfile.getrname(column.tid)][column.pos]
-+ self.assertEqual( thiscov, refcov, "wrong coverage at pos %s:%i %i should be %i" % (self.samfile.getrname(column.tid), column.pos, thiscov, refcov))
-+
-+ def testIterateAll(self):
-+ '''check random access per contig'''
-+ self.checkRange( None )
-+
-+ def testIteratePerContig(self):
-+ '''check random access per contig'''
-+ for contig in self.samfile.references:
-+ self.checkRange( contig )
-+
-+ def testIterateRanges(self):
-+ '''check random access per range'''
-+ for contig, length in zip(self.samfile.references, self.samfile.lengths):
-+ for start in range( 1, length, 90):
-+ self.checkRange( contig, start, start + 90 ) # this includes empty ranges
-+
-+ def testInverse( self ):
-+ '''test the inverse, is point-wise pileup accurate.'''
-+ for contig, refseq in list(self.mCoverages.items()):
-+ refcolumns = sum(refseq)
-+ for pos, refcov in enumerate( refseq ):
-+ columns = list(self.samfile.pileup( contig, pos, pos+1) )
-+ if refcov == 0:
-+ # if no read, no coverage
-+ self.assertEqual( len(columns), refcov, "wrong number of pileup columns returned for position %s:%i, %i should be %i" %(contig,pos,len(columns), refcov) )
-+ elif refcov == 1:
-+ # one read, all columns of the read are returned
-+ self.assertEqual( len(columns), refcolumns, "pileup incomplete at position %i: got %i, expected %i " %\
-+ (pos, len(columns), refcolumns))
-+
-+ def testIterateTruncate( self ):
-+ '''check random access per range'''
-+ for contig, length in zip(self.samfile.references, self.samfile.lengths):
-+ for start in range( 1, length, 90):
-+ self.checkRange( contig, start, start + 90, truncate = True ) # this includes empty ranges
-+
-+ def tearDown(self):
-+ self.samfile.close()
-+
-+class TestIteratorColumn2(unittest.TestCase):
-+ '''test iterator column against contents of ex1.bam.'''
-+
-+ def setUp(self):
-+ self.samfile=pysam.Samfile( "ex1.bam","rb" )
-+
-+ def testStart( self ):
-+ #print self.samfile.fetch().next().pos
-+ #print self.samfile.pileup().next().pos
-+ pass
-+
-+ def testTruncate( self ):
-+ '''see issue 107.'''
-+ # note that ranges in regions start from 1
-+ p = self.samfile.pileup(region='chr1:170:172', truncate=True)
-+ columns = [ x.pos for x in p ]
-+ self.assertEqual( len(columns), 3)
-+ self.assertEqual( columns, [169,170,171] )
-+
-+ p = self.samfile.pileup( 'chr1', 169, 172, truncate=True)
-+ columns = [ x.pos for x in p ]
-+
-+ self.assertEqual( len(columns), 3)
-+ self.assertEqual( columns, [169,170,171] )
-+
-+class TestAlignedReadFromBam(unittest.TestCase):
-+
-+ def setUp(self):
-+ self.samfile=pysam.Samfile( "ex3.bam","rb" )
-+ self.reads=list(self.samfile.fetch())
-+
-+ def testARqname(self):
-+ self.assertEqual( self.reads[0].qname, "read_28833_29006_6945", "read name mismatch in read 1: %s != %s" % (self.reads[0].qname, "read_28833_29006_6945") )
-+ self.assertEqual( self.reads[1].qname, "read_28701_28881_323b", "read name mismatch in read 2: %s != %s" % (self.reads[1].qname, "read_28701_28881_323b") )
-+
-+ def testARflag(self):
-+ self.assertEqual( self.reads[0].flag, 99, "flag mismatch in read 1: %s != %s" % (self.reads[0].flag, 99) )
-+ self.assertEqual( self.reads[1].flag, 147, "flag mismatch in read 2: %s != %s" % (self.reads[1].flag, 147) )
-+
-+ def testARrname(self):
-+ self.assertEqual( self.reads[0].rname, 0, "chromosome/target id mismatch in read 1: %s != %s" % (self.reads[0].rname, 0) )
-+ self.assertEqual( self.reads[1].rname, 1, "chromosome/target id mismatch in read 2: %s != %s" % (self.reads[1].rname, 1) )
-+
-+ def testARpos(self):
-+ self.assertEqual( self.reads[0].pos, 33-1, "mapping position mismatch in read 1: %s != %s" % (self.reads[0].pos, 33-1) )
-+ self.assertEqual( self.reads[1].pos, 88-1, "mapping position mismatch in read 2: %s != %s" % (self.reads[1].pos, 88-1) )
-+
-+ def testARmapq(self):
-+ self.assertEqual( self.reads[0].mapq, 20, "mapping quality mismatch in read 1: %s != %s" % (self.reads[0].mapq, 20) )
-+ self.assertEqual( self.reads[1].mapq, 30, "mapping quality mismatch in read 2: %s != %s" % (self.reads[1].mapq, 30) )
-+
-+ def testARcigar(self):
-+ self.assertEqual( self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)], "read name length mismatch in read 1: %s != %s" % (self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)]) )
-+ self.assertEqual( self.reads[1].cigar, [(0, 35)], "read name length mismatch in read 2: %s != %s" % (self.reads[1].cigar, [(0, 35)]) )
-+
-+ def testARcigarstring(self):
-+ self.assertEqual( self.reads[0].cigarstring, '10M1D25M' )
-+ self.assertEqual( self.reads[1].cigarstring, '35M' )
-+
-+ def testARmrnm(self):
-+ self.assertEqual( self.reads[0].mrnm, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].mrnm, 0) )
-+ self.assertEqual( self.reads[1].mrnm, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].mrnm, 1) )
-+ self.assertEqual( self.reads[0].rnext, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].rnext, 0) )
-+ self.assertEqual( self.reads[1].rnext, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].rnext, 1) )
-+
-+ def testARmpos(self):
-+ self.assertEqual( self.reads[0].mpos, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].mpos, 200-1) )
-+ self.assertEqual( self.reads[1].mpos, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].mpos, 500-1) )
-+ self.assertEqual( self.reads[0].pnext, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].pnext, 200-1) )
-+ self.assertEqual( self.reads[1].pnext, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].pnext, 500-1) )
-+
-+ def testARisize(self):
-+ self.assertEqual( self.reads[0].isize, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].isize, 167) )
-+ self.assertEqual( self.reads[1].isize, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].isize, 412) )
-+ self.assertEqual( self.reads[0].tlen, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].tlen, 167) )
-+ self.assertEqual( self.reads[1].tlen, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].tlen, 412) )
-+
-+ def testARseq(self):
-+ self.assertEqual( self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 1: %s != %s" % (self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
-+ self.assertEqual( self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "sequence size mismatch in read 2: %s != %s" % (self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") )
-+ self.assertEqual( self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 4: %s != %s" % (self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
-+
-+ def testARqual(self):
-+ self.assertEqual( self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 1: %s != %s" % (self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
-+ self.assertEqual( self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "quality string mismatch in read 2: %s != %s" % (self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") )
-+ self.assertEqual( self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 3: %s != %s" % (self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
-+
-+ def testARquery(self):
-+ self.assertEqual( self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "query mismatch in read 1: %s != %s" % (self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
-+ self.assertEqual( self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "query size mismatch in read 2: %s != %s" % (self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") )
-+ self.assertEqual( self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT", "query mismatch in read 4: %s != %s" % (self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT") )
-+
-+ def testARqqual(self):
-+ self.assertEqual( self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "qquality string mismatch in read 1: %s != %s" % (self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
-+ self.assertEqual( self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "qquality string mismatch in read 2: %s != %s" % (self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") )
-+ self.assertEqual( self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22", "qquality string mismatch in read 3: %s != %s" % (self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22") )
-+
-+ def testPresentOptionalFields(self):
-+ self.assertEqual( self.reads[0].opt('NM'), 1, "optional field mismatch in read 1, NM: %s != %s" % (self.reads[0].opt('NM'), 1) )
-+ self.assertEqual( self.reads[0].opt('RG'), 'L1', "optional field mismatch in read 1, RG: %s != %s" % (self.reads[0].opt('RG'), 'L1') )
-+ self.assertEqual( self.reads[1].opt('RG'), 'L2', "optional field mismatch in read 2, RG: %s != %s" % (self.reads[1].opt('RG'), 'L2') )
-+ self.assertEqual( self.reads[1].opt('MF'), 18, "optional field mismatch in read 2, MF: %s != %s" % (self.reads[1].opt('MF'), 18) )
-+
-+ def testPairedBools(self):
-+ self.assertEqual( self.reads[0].is_paired, True, "is paired mismatch in read 1: %s != %s" % (self.reads[0].is_paired, True) )
-+ self.assertEqual( self.reads[1].is_paired, True, "is paired mismatch in read 2: %s != %s" % (self.reads[1].is_paired, True) )
-+ self.assertEqual( self.reads[0].is_proper_pair, True, "is proper pair mismatch in read 1: %s != %s" % (self.reads[0].is_proper_pair, True) )
-+ self.assertEqual( self.reads[1].is_proper_pair, True, "is proper pair mismatch in read 2: %s != %s" % (self.reads[1].is_proper_pair, True) )
-+
-+ def testTags( self ):
-+ self.assertEqual( self.reads[0].tags,
-+ [('NM', 1), ('RG', 'L1'),
-+ ('PG', 'P1'), ('XT', 'U')] )
-+ self.assertEqual( self.reads[1].tags,
-+ [('MF', 18), ('RG', 'L2'),
-+ ('PG', 'P2'),('XT', 'R') ] )
-+
-+ def testOpt( self ):
-+ self.assertEqual( self.reads[0].opt("XT"), "U" )
-+ self.assertEqual( self.reads[1].opt("XT"), "R" )
-+
-+ def testMissingOpt( self ):
-+ self.assertRaises( KeyError, self.reads[0].opt, "XP" )
-+
-+ def testEmptyOpt( self ):
-+ self.assertRaises( KeyError, self.reads[2].opt, "XT" )
-+
-+ def tearDown(self):
-+ self.samfile.close()
-+
-+class TestAlignedReadFromSam(TestAlignedReadFromBam):
-+
-+ def setUp(self):
-+ self.samfile=pysam.Samfile( "ex3.sam","r" )
-+ self.reads=list(self.samfile.fetch())
-+
-+# needs to be implemented
-+# class TestAlignedReadFromSamWithoutHeader(TestAlignedReadFromBam):
-+#
-+# def setUp(self):
-+# self.samfile=pysam.Samfile( "ex7.sam","r" )
-+# self.reads=list(self.samfile.fetch())
-+
-+class TestHeaderSam(unittest.TestCase):
-+
-+ header = {'SQ': [{'LN': 1575, 'SN': 'chr1'},
-+ {'LN': 1584, 'SN': 'chr2'}],
-+ 'RG': [{'LB': 'SC_1', 'ID': 'L1', 'SM': 'NA12891', 'PU': 'SC_1_10', "CN":"name:with:colon"},
-+ {'LB': 'SC_2', 'ID': 'L2', 'SM': 'NA12891', 'PU': 'SC_2_12', "CN":"name:with:colon"}],
-+ 'PG': [{'ID': 'P1', 'VN': '1.0'}, {'ID': 'P2', 'VN': '1.1'}],
-+ 'HD': {'VN': '1.0'},
-+ 'CO' : [ 'this is a comment', 'this is another comment'],
-+ }
-+
-+ def compareHeaders( self, a, b ):
-+ '''compare two headers a and b.'''
-+ for ak,av in a.items():
-+ self.assertTrue( ak in b, "key '%s' not in '%s' " % (ak,b) )
-+ self.assertEqual( av, b[ak] )
-+
-+ def setUp(self):
-+ self.samfile=pysam.Samfile( "ex3.sam","r" )
-+
-+ def testHeaders(self):
-+ self.compareHeaders( self.header, self.samfile.header )
-+ self.compareHeaders( self.samfile.header, self.header )
-+
-+ def testNameMapping( self ):
-+ for x, y in enumerate( ("chr1", "chr2")):
-+ tid = self.samfile.gettid( y )
-+ ref = self.samfile.getrname( x )
-+ self.assertEqual( tid, x )
-+ self.assertEqual( ref, y )
-+
-+ self.assertEqual( self.samfile.gettid("chr?"), -1 )
-+ self.assertRaises( ValueError, self.samfile.getrname, 2 )
-+
-+ def tearDown(self):
-+ self.samfile.close()
-+
-+class TestHeaderBam(TestHeaderSam):
-+
-+ def setUp(self):
-+ self.samfile=pysam.Samfile( "ex3.bam","rb" )
-+
-+
-+class TestHeader1000Genomes( unittest.TestCase ):
-+
-+ # bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase2b_alignment/data/NA07048/exome_alignment/NA07048.unmapped.ILLUMINA.bwa.CEU.exome.20120522_p2b.bam"
-+ bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase3_EX_or_LC_only_alignment/data/HG00104/alignment/HG00104.chrom11.ILLUMINA.bwa.GBR.low_coverage.20130415.bam"
-+
-+ def testRead( self ):
-+
-+ # Skip fetching files from web when building the package
-+ #f = pysam.Samfile( self.bamfile, "rb" )
-+ #data = f.header.copy()
-+ #self.assertTrue( data )
-+ self.assertTrue( True )
-+
-+class TestUnmappedReads(unittest.TestCase):
-+
-+ def testSAM(self):
-+ samfile=pysam.Samfile( "ex5.sam","r" )
-+ self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 )
-+ samfile.close()
-+
-+ def testBAM(self):
-+ samfile=pysam.Samfile( "ex5.bam","rb" )
-+ self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 )
-+ samfile.close()
-+
-+class TestPileupObjects(unittest.TestCase):
-+
-+ def setUp(self):
-+ self.samfile=pysam.Samfile( "ex1.bam","rb" )
-+
-+ def testPileupColumn(self):
-+ for pcolumn1 in self.samfile.pileup( region="chr1:105" ):
-+ if pcolumn1.pos == 104:
-+ self.assertEqual( pcolumn1.tid, 0, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn1.tid, 0) )
-+ self.assertEqual( pcolumn1.pos, 105-1, "position mismatch in position 1: %s != %s" % (pcolumn1.pos, 105-1) )
-+ self.assertEqual( pcolumn1.n, 2, "# reads mismatch in position 1: %s != %s" % (pcolumn1.n, 2) )
-+ for pcolumn2 in self.samfile.pileup( region="chr2:1480" ):
-+ if pcolumn2.pos == 1479:
-+ self.assertEqual( pcolumn2.tid, 1, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn2.tid, 1) )
-+ self.assertEqual( pcolumn2.pos, 1480-1, "position mismatch in position 1: %s != %s" % (pcolumn2.pos, 1480-1) )
-+ self.assertEqual( pcolumn2.n, 12, "# reads mismatch in position 1: %s != %s" % (pcolumn2.n, 12) )
-+
-+ def testPileupRead(self):
-+ for pcolumn1 in self.samfile.pileup( region="chr1:105" ):
-+ if pcolumn1.pos == 104:
-+ self.assertEqual( len(pcolumn1.pileups), 2, "# reads aligned to column mismatch in position 1: %s != %s" % (len(pcolumn1.pileups), 2) )
-+# self.assertEqual( pcolumn1.pileups[0] # need to test additional properties here
-+
-+ def tearDown(self):
-+ self.samfile.close()
-+
-+ def testIteratorOutOfScope( self ):
-+ '''test if exception is raised if pileup col is accessed after iterator is exhausted.'''
-+
-+ for pileupcol in self.samfile.pileup():
-+ pass
-+
-+ self.assertRaises( ValueError, getattr, pileupcol, "pileups" )
-+
-+class TestContextManager(unittest.TestCase):
-+
-+ def testManager( self ):
-+ with pysam.Samfile('ex1.bam', 'rb') as samfile:
-+ samfile.fetch()
-+ self.assertEqual( samfile._isOpen(), False )
-+
-+class TestExceptions(unittest.TestCase):
-+
-+ def setUp(self):
-+ self.samfile=pysam.Samfile( "ex1.bam","rb" )
-+
-+ def testMissingFile(self):
-+
-+ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "rb" )
-+ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "r" )
-+ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "r" )
-+ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "rb" )
-+
-+ def testBadContig(self):
-+ self.assertRaises( ValueError, self.samfile.fetch, "chr88" )
-+
-+ def testMeaninglessCrap(self):
-+ self.assertRaises( ValueError, self.samfile.fetch, "skljf" )
-+
-+ def testBackwardsOrderNewFormat(self):
-+ self.assertRaises( ValueError, self.samfile.fetch, 'chr1', 100, 10 )
-+
-+ def testBackwardsOrderOldFormat(self):
-+ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:100-10")
-+
-+ def testOutOfRangeNegativeNewFormat(self):
-+ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, -10 )
-+ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, 0 )
-+ self.assertRaises( ValueError, self.samfile.fetch, "chr1", -5, -10 )
-+
-+ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, -10 )
-+ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, 0 )
-+ self.assertRaises( ValueError, self.samfile.count, "chr1", -5, -10 )
-+
-+ def testOutOfRangeNegativeOldFormat(self):
-+ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-10" )
-+ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-0" )
-+ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5--10" )
-+
-+ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-10" )
-+ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-0" )
-+ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5--10" )
-+
-+ def testOutOfRangNewFormat(self):
-+ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999, 99999999999 )
-+ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999, 99999999999 )
-+
-+ def testOutOfRangeLargeNewFormat(self):
-+ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 )
-+ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 )
-+
-+ def testOutOfRangeLargeOldFormat(self):
-+ self.assertRaises( ValueError, self.samfile.fetch, "chr1:99999999999999999-999999999999999999" )
-+ self.assertRaises( ValueError, self.samfile.count, "chr1:99999999999999999-999999999999999999" )
-+
-+ def testZeroToZero(self):
-+ '''see issue 44'''
-+ self.assertEqual( len(list(self.samfile.fetch('chr1', 0, 0))), 0)
-+
-+ def tearDown(self):
-+ self.samfile.close()
-+
-+class TestWrongFormat(unittest.TestCase):
-+ '''test cases for opening files not in bam/sam format.'''
-+
-+ def testOpenSamAsBam( self ):
-+ self.assertRaises( ValueError, pysam.Samfile, 'ex1.sam', 'rb' )
-+
-+ def testOpenBamAsSam( self ):
-+ # test fails, needs to be implemented.
-+ # sam.fetch() fails on reading, not on opening
-+ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.bam', 'r' )
-+ pass
-+
-+ def testOpenFastaAsSam( self ):
-+ # test fails, needs to be implemented.
-+ # sam.fetch() fails on reading, not on opening
-+ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'r' )
-+ pass
-+
-+ def testOpenFastaAsBam( self ):
-+ self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'rb' )
-+
-+class TestFastaFile(unittest.TestCase):
-+
-+ mSequences = { 'chr1' :
-+ b"CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCCATGGCCCAGCATTAGGGAGCTGTGGACCCTGCAGCCTGGCTGTGGGGGCCGCAGTGGCTGAGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCACAGGGGCTTAACCTCTGGTGACTGCCAGAGCTGCTGGCAAGCTAGAGTCCCATTTGGAGCCCCTCTAAGCCGTTCTATTTGTAATGAAAACTATATTTATGCTATTCAGTTCTAAATATAGAAATTGAAACAGCTGTGTTTAGTGCCTTTGTTCAACCCCCTTGCAACAACCTTGAGAACCCCAGGGAATTTGTCAATGTCAGGGAAGGAGCATTTTGTCAGTTACCAAATGTGTTTATTACCAGAGGGATGGAGGGAAGAGGGACGCTGAAGAACTTTGATGCCCTCTTCTTCCAAAGATGAAACGCGTAACTGCGCTCTCATTCACTCCAG [...]
-+ 'chr2' :
-+ b"TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAAGAAATTACAAAATATAGTTGAAAGCTCTAACAATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCTTATGAATTAACCCAGTCAGACAAAAATAAAGAAAAAAATTTTAAAAATGAACAGAGCTTTCAAGAAGTATGAGATTATGTAAAGTAACTGAACCTATGAGTCACAGGTATTCCTGAGGAAAAAGAAAAAGTGAGAAGTTTGGAAAAACTATTTGAGGAAGTAATTGGGGAAAACCTCTTTAGTCTTGCTAGAGATTTAGACATCTAAATGAAAGAGGCTCAAAGAATGCCAGGAAGATACATTGCAAGACAGACTTCATCAAGATATGTAGTCATCAGACTATCTAAAGTCAACATGAAGGAAAAAAATTCTAAAATCAGCAAGAGAAAAGCATACAGTCATCTAT [...]
-+ }
-+
-+ def setUp(self):
-+ self.file=pysam.Fastafile( "ex1.fa" )
-+
-+ def testFetch(self):
-+ for id, seq in list(self.mSequences.items()):
-+ self.assertEqual( seq, self.file.fetch( id ) )
-+ for x in range( 0, len(seq), 10):
-+ self.assertEqual( seq[x:x+10], self.file.fetch( id, x, x+10) )
-+ # test x:end
-+ self.assertEqual( seq[x:], self.file.fetch( id, x) )
-+ # test 0:x
-+ self.assertEqual( seq[:x], self.file.fetch( id, None, x) )
-+
-+
-+ # unknown sequence returns ""
-+ self.assertEqual( b"", self.file.fetch("chr12") )
-+
-+ def testOutOfRangeAccess( self ):
-+ '''test out of range access.'''
-+ # out of range access returns an empty string
-+ for contig, s in self.mSequences.items():
-+ self.assertEqual( self.file.fetch( contig, len(s), len(s)+1), b"" )
-+
-+ self.assertEqual( self.file.fetch( "chr3", 0 , 100), b"" )
-+
-+ def testFetchErrors( self ):
-+ self.assertRaises( ValueError, self.file.fetch )
-+ self.assertRaises( ValueError, self.file.fetch, "chr1", -1, 10 )
-+ self.assertRaises( ValueError, self.file.fetch, "chr1", 20, 10 )
-+
-+ def testLength( self ):
-+ self.assertEqual( len(self.file), 2 )
-+
-+ def tearDown(self):
-+ self.file.close()
-+
-+class TestAlignedRead(unittest.TestCase):
-+ '''tests to check if aligned read can be constructed
-+ and manipulated.
-+ '''
-+
-+ def checkFieldEqual( self, read1, read2, exclude = []):
-+ '''check if two reads are equal by comparing each field.'''
-+
-+ for x in ("qname", "seq", "flag",
-+ "rname", "pos", "mapq", "cigar",
-+ "mrnm", "mpos", "isize", "qual",
-+ "is_paired", "is_proper_pair",
-+ "is_unmapped", "mate_is_unmapped",
-+ "is_reverse", "mate_is_reverse",
-+ "is_read1", "is_read2",
-+ "is_secondary", "is_qcfail",
-+ "is_duplicate", "bin"):
-+ if x in exclude: continue
-+ self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" %
-+ (x, getattr(read1, x), getattr(read2,x)))
-+
-+ def testEmpty( self ):
-+ a = pysam.AlignedRead()
-+ self.assertEqual( a.qname, None )
-+ self.assertEqual( a.seq, None )
-+ self.assertEqual( a.qual, None )
-+ self.assertEqual( a.flag, 0 )
-+ self.assertEqual( a.rname, 0 )
-+ self.assertEqual( a.mapq, 0 )
-+ self.assertEqual( a.cigar, None )
-+ self.assertEqual( a.tags, [] )
-+ self.assertEqual( a.mrnm, 0 )
-+ self.assertEqual( a.mpos, 0 )
-+ self.assertEqual( a.isize, 0 )
-+
-+ def buildRead( self ):
-+ '''build an example read.'''
-+
-+ a = pysam.AlignedRead()
-+ a.qname = "read_12345"
-+ a.seq="ACGT" * 10
-+ a.flag = 0
-+ a.rname = 0
-+ a.pos = 20
-+ a.mapq = 20
-+ a.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) )
-+ a.mrnm = 0
-+ a.mpos=200
-+ a.isize=167
-+ a.qual="1234" * 10
-+ # todo: create tags
-+ return a
-+
-+ def testUpdate( self ):
-+ '''check if updating fields affects other variable length data
-+ '''
-+ a = self.buildRead()
-+ b = self.buildRead()
-+
-+ # check qname
-+ b.qname = "read_123"
-+ self.checkFieldEqual( a, b, "qname" )
-+ b.qname = "read_12345678"
-+ self.checkFieldEqual( a, b, "qname" )
-+ b.qname = "read_12345"
-+ self.checkFieldEqual( a, b)
-+
-+ # check cigar
-+ b.cigar = ( (0,10), )
-+ self.checkFieldEqual( a, b, "cigar" )
-+ b.cigar = ( (0,10), (2,1), (0,10) )
-+ self.checkFieldEqual( a, b, "cigar" )
-+ b.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) )
-+ self.checkFieldEqual( a, b)
-+
-+ # check seq
-+ b.seq = "ACGT"
-+ self.checkFieldEqual( a, b, ("seq", "qual") )
-+ b.seq = "ACGT" * 3
-+ self.checkFieldEqual( a, b, ("seq", "qual") )
-+ b.seq = "ACGT" * 10
-+ self.checkFieldEqual( a, b, ("qual",))
-+
-+ # reset qual
-+ b = self.buildRead()
-+
-+ # check flags:
-+ for x in (
-+ "is_paired", "is_proper_pair",
-+ "is_unmapped", "mate_is_unmapped",
-+ "is_reverse", "mate_is_reverse",
-+ "is_read1", "is_read2",
-+ "is_secondary", "is_qcfail",
-+ "is_duplicate"):
-+ setattr( b, x, True )
-+ self.assertEqual( getattr(b, x), True )
-+ self.checkFieldEqual( a, b, ("flag", x,) )
-+ setattr( b, x, False )
-+ self.assertEqual( getattr(b, x), False )
-+ self.checkFieldEqual( a, b )
-+
-+ def testLargeRead( self ):
-+ '''build an example read.'''
-+
-+ a = pysam.AlignedRead()
-+ a.qname = "read_12345"
-+ a.seq="ACGT" * 200
-+ a.flag = 0
-+ a.rname = 0
-+ a.pos = 20
-+ a.mapq = 20
-+ a.cigar = ( (0, 4 * 200), )
-+ a.mrnm = 0
-+ a.mpos=200
-+ a.isize=167
-+ a.qual="1234" * 200
-+
-+ return a
-+
-+ def testTagParsing( self ):
-+ '''test for tag parsing
-+
-+ see http://groups.google.com/group/pysam-user-group/browse_thread/thread/67ca204059ea465a
-+ '''
-+ samfile=pysam.Samfile( "ex8.bam","rb" )
-+
-+ for entry in samfile:
-+ before = entry.tags
-+ entry.tags = entry.tags
-+ after = entry.tags
-+ self.assertEqual( after, before )
-+
-+ def testUpdateTlen( self ):
-+ '''check if updating tlen works'''
-+ a = self.buildRead()
-+ oldlen = a.tlen
-+ oldlen *= 2
-+ a.tlen = oldlen
-+ self.assertEqual( a.tlen, oldlen )
-+
-+ def testPositions( self ):
-+ a = self.buildRead()
-+ self.assertEqual( a.positions,
-+ [20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
-+ 31, 32, 33, 34, 35, 36, 37, 38, 39,
-+ 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
-+ 50, 51, 52, 53, 54, 55, 56, 57, 58, 59] )
-+
-+ self.assertEqual( a.aligned_pairs,
-+ [(0, 20), (1, 21), (2, 22), (3, 23), (4, 24),
-+ (5, 25), (6, 26), (7, 27), (8, 28), (9, 29),
-+ (None, 30),
-+ (10, 31), (11, 32), (12, 33), (13, 34), (14, 35),
-+ (15, 36), (16, 37), (17, 38), (18, 39), (19, None),
-+ (20, 40), (21, 41), (22, 42), (23, 43), (24, 44),
-+ (25, 45), (26, 46), (27, 47), (28, 48), (29, 49),
-+ (30, 50), (31, 51), (32, 52), (33, 53), (34, 54),
-+ (35, 55), (36, 56), (37, 57), (38, 58), (39, 59)] )
-+
-+ self.assertEqual( a.positions, [x[1] for x in a.aligned_pairs if x[0] != None and x[1] != None] )
-+ # alen is the length of the aligned read in genome
-+ self.assertEqual( a.alen, a.aligned_pairs[-1][0] + 1 )
-+ # aend points to one beyond last aligned base in ref
-+ self.assertEqual( a.positions[-1], a.aend - 1 )
-+
-+class TestDeNovoConstruction(unittest.TestCase):
-+ '''check BAM/SAM file construction using ex6.sam
-+
-+ (note these are +1 coordinates):
-+
-+ read_28833_29006_6945 99 chr1 33 20 10M1D25M = 200 167 AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG <<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<< NM:i:1 RG:Z:L1
-+ read_28701_28881_323b 147 chr2 88 30 35M = 500 412 ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA <<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<< MF:i:18 RG:Z:L2
-+ '''
-+
-+ header = { 'HD': {'VN': '1.0'},
-+ 'SQ': [{'LN': 1575, 'SN': 'chr1'},
-+ {'LN': 1584, 'SN': 'chr2'}], }
-+
-+ bamfile = "ex6.bam"
-+ samfile = "ex6.sam"
-+
-+ def checkFieldEqual( self, read1, read2, exclude = []):
-+ '''check if two reads are equal by comparing each field.'''
-+
-+ for x in ("qname", "seq", "flag",
-+ "rname", "pos", "mapq", "cigar",
-+ "mrnm", "mpos", "isize", "qual",
-+ "bin",
-+ "is_paired", "is_proper_pair",
-+ "is_unmapped", "mate_is_unmapped",
-+ "is_reverse", "mate_is_reverse",
-+ "is_read1", "is_read2",
-+ "is_secondary", "is_qcfail",
-+ "is_duplicate"):
-+ if x in exclude: continue
-+ self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" %
-+ (x, getattr(read1, x), getattr(read2,x)))
-+
-+ def setUp( self ):
-+
-+ a = pysam.AlignedRead()
-+ a.qname = "read_28833_29006_6945"
-+ a.seq="AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG"
-+ a.flag = 99
-+ a.rname = 0
-+ a.pos = 32
-+ a.mapq = 20
-+ a.cigar = ( (0,10), (2,1), (0,25) )
-+ a.mrnm = 0
-+ a.mpos=199
-+ a.isize=167
-+ a.qual="<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<"
-+ a.tags = ( ("NM", 1),
-+ ("RG", "L1") )
-+
-+ b = pysam.AlignedRead()
-+ b.qname = "read_28701_28881_323b"
-+ b.seq="ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA"
-+ b.flag = 147
-+ b.rname = 1
-+ b.pos = 87
-+ b.mapq = 30
-+ b.cigar = ( (0,35), )
-+ b.mrnm = 1
-+ b.mpos=499
-+ b.isize=412
-+ b.qual="<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<"
-+ b.tags = ( ("MF", 18),
-+ ("RG", "L2") )
-+
-+ self.reads = (a,b)
-+
-+ def testSAMWholeFile( self ):
-+
-+ tmpfilename = "tmp_%i.sam" % id(self)
-+
-+ outfile = pysam.Samfile( tmpfilename, "wh", header = self.header )
-+
-+ for x in self.reads: outfile.write( x )
-+ outfile.close()
-+ self.assertTrue( checkBinaryEqual( tmpfilename, self.samfile ),
-+ "mismatch when construction SAM file, see %s %s" % (tmpfilename, self.samfile))
-+
-+ os.unlink( tmpfilename )
-+
-+ def testBAMPerRead( self ):
-+ '''check if individual reads are binary equal.'''
-+ infile = pysam.Samfile( self.bamfile, "rb")
-+
-+ others = list(infile)
-+ for denovo, other in zip( others, self.reads):
-+ self.checkFieldEqual( other, denovo )
-+ self.assertEqual( other.compare( denovo ), 0 )
-+
-+ def testSAMPerRead( self ):
-+ '''check if individual reads are binary equal.'''
-+ infile = pysam.Samfile( self.samfile, "r")
-+
-+ others = list(infile)
-+ for denovo, other in zip( others, self.reads):
-+ self.checkFieldEqual( other, denovo )
-+ self.assertEqual( other.compare( denovo), 0 )
-+
-+ def testBAMWholeFile( self ):
-+
-+ tmpfilename = "tmp_%i.bam" % id(self)
-+
-+ outfile = pysam.Samfile( tmpfilename, "wb", header = self.header )
-+
-+ for x in self.reads: outfile.write( x )
-+ outfile.close()
-+
-+ self.assertTrue( checkBinaryEqual( tmpfilename, self.bamfile ),
-+ "mismatch when construction BAM file, see %s %s" % (tmpfilename, self.bamfile))
-+
-+ os.unlink( tmpfilename )
-+
-+class TestDeNovoConstructionUserTags(TestDeNovoConstruction):
-+ '''test de novo construction with a header that contains lower-case tags.'''
-+
-+ header = { 'HD': {'VN': '1.0'},
-+ 'SQ': [{'LN': 1575, 'SN': 'chr1'},
-+ {'LN': 1584, 'SN': 'chr2'}],
-+ 'x1': {'A': 2, 'B': 5 },
-+ 'x3': {'A': 6, 'B': 5 },
-+ 'x2': {'A': 4, 'B': 5 } }
-+
-+ bamfile = "example_user_header.bam"
-+ samfile = "example_user_header.sam"
-+
-+class TestEmptyHeader( unittest.TestCase ):
-+ '''see issue 84.'''
-+
-+ def testEmptyHeader( self ):
-+
-+ s = pysam.Samfile('example_empty_header.bam')
-+ self.assertEqual( s.header, {'SQ': [{'LN': 1000, 'SN': 'chr1'}]} )
-+
-+class TestBTagSam( unittest.TestCase ):
-+ '''see issue 81.'''
-+
-+ compare = [ [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, [...]
-+ [-100,200,-300,-400],
-+ [-100,12],
-+ [12,15],
-+ [-1.0,5.0,2.5] ]
-+
-+ filename = 'example_btag.sam'
-+
-+ def testRead( self ):
-+
-+ s = pysam.Samfile(self.filename)
-+ for x, read in enumerate(s):
-+ if x == 0:
-+ self.assertEqual( read.tags, [('RG', 'QW85I'), ('PG', 'tmap'), ('MD', '140'), ('NM', 0), ('AS', 140), ('FZ', [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, [...]
-+ )
-+
-+ fz = dict(read.tags)["FZ"]
-+ self.assertEqual( fz, self.compare[x] )
-+ self.assertEqual( read.opt("FZ"), self.compare[x])
-+
-+ def testWrite( self ):
-+
-+ s = pysam.Samfile(self.filename)
-+ for read in s:
-+ before = read.tags
-+ read.tags = read.tags
-+ after = read.tags
-+ self.assertEqual( after, before )
-+
-+class TestBTagBam( TestBTagSam ):
-+ filename = 'example_btag.bam'
-+
-+class TestDoubleFetch(unittest.TestCase):
-+ '''check if two iterators on the same bamfile are independent.'''
-+
-+ def testDoubleFetch( self ):
-+
-+ samfile1 = pysam.Samfile('ex1.bam', 'rb')
-+
-+ for a,b in zip(samfile1.fetch(), samfile1.fetch()):
-+ self.assertEqual( a.compare( b ), 0 )
-+
-+ def testDoubleFetchWithRegion( self ):
-+
-+ samfile1 = pysam.Samfile('ex1.bam', 'rb')
-+ chr, start, stop = 'chr1', 200, 3000000
-+ self.assertTrue(len(list(samfile1.fetch ( chr, start, stop))) > 0) #just making sure the test has something to catch
-+
-+ for a,b in zip(samfile1.fetch( chr, start, stop), samfile1.fetch( chr, start, stop)):
-+ self.assertEqual( a.compare( b ), 0 )
-+
-+ def testDoubleFetchUntilEOF( self ):
-+
-+ samfile1 = pysam.Samfile('ex1.bam', 'rb')
-+
-+ for a,b in zip(samfile1.fetch( until_eof = True),
-+ samfile1.fetch( until_eof = True )):
-+ self.assertEqual( a.compare( b), 0 )
-+
-+class TestRemoteFileFTP(unittest.TestCase):
-+ '''test remote access.
-+
-+ '''
-+
-+ # Need to find an ftp server without password on standard
-+ # port.
-+
-+ url = "ftp://ftp.sanger.ac.uk/pub/rd/humanSequences/CV.bam"
-+ region = "1:1-1000"
-+
-+ def testFTPView( self ):
-+ return
-+ result = pysam.view( self.url, self.region )
-+ self.assertEqual( len(result), 36 )
-+
-+ def testFTPFetch( self ):
-+ return
-+ samfile = pysam.Samfile(self.url, "rb")
-+ result = list(samfile.fetch( region = self.region ))
-+ self.assertEqual( len(result), 36 )
-+
-+class TestLargeOptValues( unittest.TestCase ):
-+
-+ ints = ( 65536, 214748, 2147484, 2147483647 )
-+ floats = ( 65536.0, 214748.0, 2147484.0 )
-+
-+ def check( self, samfile ):
-+
-+ i = samfile.fetch()
-+ for exp in self.ints:
-+ rr = next(i)
-+ obs = rr.opt("ZP")
-+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
-+
-+ for exp in [ -x for x in self.ints ]:
-+ rr = next(i)
-+ obs = rr.opt("ZP")
-+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
-+
-+ for exp in self.floats:
-+ rr = next(i)
-+ obs = rr.opt("ZP")
-+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
-+
-+ for exp in [ -x for x in self.floats ]:
-+ rr = next(i)
-+ obs = rr.opt("ZP")
-+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
-+
-+ def testSAM( self ):
-+ samfile = pysam.Samfile("ex10.sam", "r")
-+ self.check( samfile )
-+
-+ def testBAM( self ):
-+ samfile = pysam.Samfile("ex10.bam", "rb")
-+ self.check( samfile )
-+
-+# class TestSNPCalls( unittest.TestCase ):
-+# '''test pysam SNP calling ability.'''
-+
-+# def checkEqual( self, a, b ):
-+# for x in ("reference_base",
-+# "pos",
-+# "genotype",
-+# "consensus_quality",
-+# "snp_quality",
-+# "mapping_quality",
-+# "coverage" ):
-+# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" %
-+# (x, getattr(a, x), getattr(b,x), str(a), str(b)))
-+
-+# def testAllPositionsViaIterator( self ):
-+# samfile = pysam.Samfile( "ex1.bam", "rb")
-+# fastafile = pysam.Fastafile( "ex1.fa" )
-+# try:
-+# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base != "*"]
-+# except pysam.SamtoolsError:
-+# pass
-+
-+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
-+# calls = list(pysam.IteratorSNPCalls(i))
-+# for x,y in zip( refs, calls ):
-+# self.checkEqual( x, y )
-+
-+# def testPerPositionViaIterator( self ):
-+# # test pileup for each position. This is a slow operation
-+# # so this test is disabled
-+# return
-+# samfile = pysam.Samfile( "ex1.bam", "rb")
-+# fastafile = pysam.Fastafile( "ex1.fa" )
-+# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
-+# if x.reference_base == "*": continue
-+# i = samfile.pileup( x.chromosome, x.pos, x.pos+1,
-+# fastafile = fastafile,
-+# stepper = "samtools" )
-+# z = [ zz for zz in pysam.IteratorSamtools(i) if zz.pos == x.pos ]
-+# self.assertEqual( len(z), 1 )
-+# self.checkEqual( x, z[0] )
-+
-+# def testPerPositionViaCaller( self ):
-+# # test pileup for each position. This is a fast operation
-+# samfile = pysam.Samfile( "ex1.bam", "rb")
-+# fastafile = pysam.Fastafile( "ex1.fa" )
-+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
-+# caller = pysam.SNPCaller( i )
-+
-+# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
-+# if x.reference_base == "*": continue
-+# call = caller.call( x.chromosome, x.pos )
-+# self.checkEqual( x, call )
-+
-+# class TestIndelCalls( unittest.TestCase ):
-+# '''test pysam indel calling.'''
-+
-+# def checkEqual( self, a, b ):
-+
-+# for x in ("pos",
-+# "genotype",
-+# "consensus_quality",
-+# "snp_quality",
-+# "mapping_quality",
-+# "coverage",
-+# "first_allele",
-+# "second_allele",
-+# "reads_first",
-+# "reads_second",
-+# "reads_diff"):
-+# if b.genotype == "*/*" and x == "second_allele":
-+# # ignore test for second allele (positions chr2:439 and chr2:1512)
-+# continue
-+# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" %
-+# (x, getattr(a, x), getattr(b,x), str(a), str(b)))
-+
-+# def testAllPositionsViaIterator( self ):
-+
-+# samfile = pysam.Samfile( "ex1.bam", "rb")
-+# fastafile = pysam.Fastafile( "ex1.fa" )
-+# try:
-+# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base == "*"]
-+# except pysam.SamtoolsError:
-+# pass
-+
-+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
-+# calls = [ x for x in list(pysam.IteratorIndelCalls(i)) if x != None ]
-+# for x,y in zip( refs, calls ):
-+# self.checkEqual( x, y )
-+
-+# def testPerPositionViaCaller( self ):
-+# # test pileup for each position. This is a fast operation
-+# samfile = pysam.Samfile( "ex1.bam", "rb")
-+# fastafile = pysam.Fastafile( "ex1.fa" )
-+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
-+# caller = pysam.IndelCaller( i )
-+
-+# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
-+# if x.reference_base != "*": continue
-+# call = caller.call( x.chromosome, x.pos )
-+# self.checkEqual( x, call )
-+
-+class TestLogging( unittest.TestCase ):
-+ '''test around bug issue 42,
-+
-+ failed in versions < 0.4
-+ '''
-+
-+ def check( self, bamfile, log ):
-+
-+ if log:
-+ logger = logging.getLogger('franklin')
-+ logger.setLevel(logging.INFO)
-+ formatter = logging.Formatter('%(asctime)s %(levelname)s %(message)s')
-+ log_hand = logging.FileHandler('log.txt')
-+ log_hand.setFormatter(formatter)
-+ logger.addHandler(log_hand)
-+
-+ bam = pysam.Samfile(bamfile, 'rb')
-+ cols = bam.pileup()
-+ self.assertTrue( True )
-+
-+ def testFail1( self ):
-+ self.check( "ex9_fail.bam", False )
-+ self.check( "ex9_fail.bam", True )
-+
-+ def testNoFail1( self ):
-+ self.check( "ex9_nofail.bam", False )
-+ self.check( "ex9_nofail.bam", True )
-+
-+ def testNoFail2( self ):
-+ self.check( "ex9_nofail.bam", True )
-+ self.check( "ex9_nofail.bam", True )
-+
-+# TODOS
-+# 1. finish testing all properties within pileup objects
-+# 2. check exceptions and bad input problems (missing files, optional fields that aren't present, etc...)
-+# 3. check: presence of sequence
-+
-+class TestSamfileUtilityFunctions( unittest.TestCase ):
-+
-+ def testCount( self ):
-+
-+ samfile = pysam.Samfile( "ex1.bam", "rb" )
-+
-+ for contig in ("chr1", "chr2" ):
-+ for start in range( 0, 2000, 100 ):
-+ end = start + 1
-+ self.assertEqual( len( list( samfile.fetch( contig, start, end ) ) ),
-+ samfile.count( contig, start, end ) )
-+
-+ # test empty intervals
-+ self.assertEqual( len( list( samfile.fetch( contig, start, start ) ) ),
-+ samfile.count( contig, start, start ) )
-+
-+ # test half empty intervals
-+ self.assertEqual( len( list( samfile.fetch( contig, start ) ) ),
-+ samfile.count( contig, start ) )
-+
-+ def testMate( self ):
-+ '''test mate access.'''
-+
-+ with open( "ex1.sam", "rb" ) as inf:
-+ readnames = [ x.split(b"\t")[0] for x in inf.readlines() ]
-+ if sys.version_info[0] >= 3:
-+ readnames = [ name.decode('ascii') for name in readnames ]
-+
-+ counts = collections.defaultdict( int )
-+ for x in readnames: counts[x] += 1
-+
-+ samfile = pysam.Samfile( "ex1.bam", "rb" )
-+ for read in samfile.fetch():
-+ if not read.is_paired:
-+ self.assertRaises( ValueError, samfile.mate, read )
-+ elif read.mate_is_unmapped:
-+ self.assertRaises( ValueError, samfile.mate, read )
-+ else:
-+ if counts[read.qname] == 1:
-+ self.assertRaises( ValueError, samfile.mate, read )
-+ else:
-+ mate = samfile.mate( read )
-+ self.assertEqual( read.qname, mate.qname )
-+ self.assertEqual( read.is_read1, mate.is_read2 )
-+ self.assertEqual( read.is_read2, mate.is_read1 )
-+ self.assertEqual( read.pos, mate.mpos )
-+ self.assertEqual( read.mpos, mate.pos )
-+
-+ def testIndexStats( self ):
-+ '''test if total number of mapped/unmapped reads is correct.'''
-+
-+ samfile = pysam.Samfile( "ex1.bam", "rb" )
-+ self.assertEqual( samfile.mapped, 3235 )
-+ self.assertEqual( samfile.unmapped, 35 )
-+
-+class TestSamtoolsProxy( unittest.TestCase ):
-+ '''tests for sanity checking access to samtools functions.'''
-+
-+ def testIndex( self ):
-+ self.assertRaises( IOError, pysam.index, "missing_file" )
-+
-+ def testView( self ):
-+ # note that view still echos "open: No such file or directory"
-+ self.assertRaises( pysam.SamtoolsError, pysam.view, "missing_file" )
-+
-+ def testSort( self ):
-+ self.assertRaises( pysam.SamtoolsError, pysam.sort, "missing_file" )
-+
-+class TestSamfileIndex( unittest.TestCase):
-+
-+ def testIndex( self ):
-+ samfile = pysam.Samfile( "ex1.bam", "rb" )
-+ index = pysam.IndexedReads( samfile )
-+ index.build()
-+
-+ reads = collections.defaultdict( int )
-+
-+ for read in samfile: reads[read.qname] += 1
-+
-+ for qname, counts in reads.items():
-+ found = list(index.find( qname ))
-+ self.assertEqual( len(found), counts )
-+ for x in found: self.assertEqual( x.qname, qname )
-+
-+
-+if __name__ == "__main__":
-+ # build data files
-+ print ("building data files")
-+ subprocess.call( "make", shell=True)
-+ print ("starting tests")
-+ unittest.main()
-+ print ("completed tests")
diff --git a/debian/patches/series b/debian/patches/series
deleted file mode 100644
index ebb9930..0000000
--- a/debian/patches/series
+++ /dev/null
@@ -1,3 +0,0 @@
-fix_cleanup_tests.patch
-do_not_use_distribute_setup.patch
-offline-tests.patch
diff --git a/debian/python-pysam-tests.README.Debian b/debian/python-pysam-tests.README.Debian
deleted file mode 100644
index 6ec9300..0000000
--- a/debian/python-pysam-tests.README.Debian
+++ /dev/null
@@ -1,11 +0,0 @@
-Pysam for Debian
-================
-
-To verify whether your python-pysam modules are working correctly
-you can run the test suite manually via
-
- cd /var/lib/pysam/tests
- ./pysam_test.py
-
- -- Andreas Tille <tille at debian.org> Fri, 07 Feb 2014 18:29:40 +0100
-
diff --git a/debian/python-pysam-tests.install b/debian/python-pysam-tests.install
deleted file mode 100644
index 5717f36..0000000
--- a/debian/python-pysam-tests.install
+++ /dev/null
@@ -1 +0,0 @@
-tests var/lib/pysam
diff --git a/debian/python-pysam-tests.postinst b/debian/python-pysam-tests.postinst
deleted file mode 100644
index b9d63dd..0000000
--- a/debian/python-pysam-tests.postinst
+++ /dev/null
@@ -1,20 +0,0 @@
-#!/bin/sh
-
-set -e
-
-case "$1" in
- configure)
- chmod a+w /var/lib/pysam/tests
- chmod a+w /var/lib/pysam/tests/*.[bs]am*
- ;;
-
- abort-upgrade|abort-remove|abort-deconfigure)
- ;;
-
- *)
- echo "postinst called with unknown argument \`$1'" >&2
- exit 1
- ;;
-esac
-
-#DEBHELPER#
diff --git a/debian/python-pysam-tests.prerm b/debian/python-pysam-tests.prerm
deleted file mode 100644
index 6c79f5d..0000000
--- a/debian/python-pysam-tests.prerm
+++ /dev/null
@@ -1,22 +0,0 @@
-#!/bin/sh
-
-set -e
-
-case "$1" in
- purge|remove|upgrade)
- if [ -e /var/lib/pysam/tests/Makefile ] ; then
- cd /var/lib/pysam/tests; make clean; rm -f log.txt
- fi
- ;;
- failed-upgrade|abort-install|abort-upgrade|disappear)
- ;;
-
- *)
- echo "postrm called with unknown argument \`$1'" >&2
- exit 1
- ;;
-esac
-
-#DEBHELPER#
-
-exit 0
diff --git a/debian/python-pysam.install b/debian/python-pysam.install
deleted file mode 100644
index 13f83a7..0000000
--- a/debian/python-pysam.install
+++ /dev/null
@@ -1 +0,0 @@
-/usr/lib/python2.*/*
diff --git a/debian/rules b/debian/rules
deleted file mode 100755
index 8dbc39a..0000000
--- a/debian/rules
+++ /dev/null
@@ -1,55 +0,0 @@
-#!/usr/bin/make -f
-
-# Hint:
-# https://wiki.debian.org/Python/LibraryStyleGuide
-# suggests:
-export PYBUILD_NAME=pysam
-# which probably does not harm but due to the fact that there is
-# some additional binary package a debian/python-pysam.install
-# file is definitely needed.
-
-DEBPKGNAME := python-$(shell dpkg-parsechangelog | awk '/^Source:/ {print $$2}')
-TESTPKG := $(DEBPKGNAME)-tests
-pybuilddir := $(CURDIR)/build/lib.$(shell dpkg-architecture -qDEB_BUILD_ARCH_OS)-$(shell dpkg-architecture -qDEB_BUILD_GNU_CPU)
-
-%:
- dh $@ --with python2
-
-# Cython is recreating some c-files. To enable building twice in a row these
-# will be saved in advance and restored afterwards
-debian/savefiles:
- mkdir -p debian/savefiles
- cp -a `grep -l "Generated by Cython" pysam/*.c` debian/savefiles
-
-override_dh_clean:
- dh_clean
- # restore cython generated files
- if [ -d debian/savefiles ] ; then \
- mv debian/savefiles/* pysam ; \
- rm -rf debian/savefiles ; \
- fi
-
-override_dh_auto_build: debian/savefiles
- dh_auto_build
-
-override_dh_auto_test:
- dh_auto_test
- chmod a+x tests/pysam_test_offline.py
-ifeq (,$(filter nocheck,$(DEB_BUILD_OPTIONS)))
- set -e -x;\
- for pyv in `pyversions -dv` ; do \
- cd tests && env PYTHONPATH=$(pybuilddir)-$${pyv} ./pysam_test_offline.py ; \
- done
-endif
-
-override_dh_install-indep:
- dh_install -p $(TESTPKG)
- cd debian/$(TESTPKG)/var/lib/pysam/tests; \
- make clean; \
- rm -f log.txt ; \
- chmod a+x tabix_test.py
-
-override_dh_auto_clean:
- dh_auto_clean
- cd tests; make clean
- rm -f tests/log.txt
diff --git a/debian/source/format b/debian/source/format
deleted file mode 100644
index 163aaf8..0000000
--- a/debian/source/format
+++ /dev/null
@@ -1 +0,0 @@
-3.0 (quilt)
diff --git a/debian/tests/control b/debian/tests/control
deleted file mode 100644
index 516915b..0000000
--- a/debian/tests/control
+++ /dev/null
@@ -1,3 +0,0 @@
-Tests: run-unit-test
-Depends: @, python-pysam-tests
-Restrictions: allow-stderr
diff --git a/debian/tests/run-unit-test b/debian/tests/run-unit-test
deleted file mode 100644
index ffba74b..0000000
--- a/debian/tests/run-unit-test
+++ /dev/null
@@ -1,4 +0,0 @@
-#!/bin/sh -e
-
-cd /var/lib/pysam/tests
-./pysam_test_offline.py
diff --git a/debian/watch b/debian/watch
deleted file mode 100644
index 1030de6..0000000
--- a/debian/watch
+++ /dev/null
@@ -1,4 +0,0 @@
-version=3
-
-opts=downloadurlmangle=s|//code.google.com|| \
- http://code.google.com/p/pysam/downloads/list //pysam.googlecode.com/files/pysam-(.*).tar.gz
--
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/python-pysam.git
More information about the debian-med-commit
mailing list