[med-svn] r15810 - in trunk/packages/mira/trunk/debian: . patches
Andreas Tille
tille at moszumanska.debian.org
Sat Jan 18 13:31:45 UTC 2014
Author: tille
Date: 2014-01-18 13:31:45 +0000 (Sat, 18 Jan 2014)
New Revision: 15810
Removed:
trunk/packages/mira/trunk/debian/patches/make.patch
trunk/packages/mira/trunk/debian/patches/spelling.patch
Modified:
trunk/packages/mira/trunk/debian/changelog
trunk/packages/mira/trunk/debian/control
trunk/packages/mira/trunk/debian/patches/series
Log:
Adapted to upstream 4.0rc5 (patches are applied upstream)
Modified: trunk/packages/mira/trunk/debian/changelog
===================================================================
--- trunk/packages/mira/trunk/debian/changelog 2014-01-18 13:22:39 UTC (rev 15809)
+++ trunk/packages/mira/trunk/debian/changelog 2014-01-18 13:31:45 UTC (rev 15810)
@@ -1,10 +1,14 @@
-mira (4.0~rc1-1) UNRELEASED; urgency=low
+mira (4.0~rc5-1) UNRELEASED; urgency=low
- * TODO wait for rc2 and boost transition!
+ [ Thorsten Alteholz ]
* New upstream version
- -- Thorsten Alteholz <debian at alteholz.de> Tue, 17 Sep 2013 18:00:00 +0200
+ [ Andreas Tille ]
+ * cme fix dpkg-control
+ * debian/patches/{make.patch,spelling.patch}: applied upstream (thus removed)
+ -- Andreas Tille <tille at debian.org> Sat, 18 Jan 2014 13:51:35 +0100
+
mira (3.9.18-1) unstable; urgency=low
* New upstream version (most patches applied by upstream)
Modified: trunk/packages/mira/trunk/debian/control
===================================================================
--- trunk/packages/mira/trunk/debian/control 2014-01-18 13:22:39 UTC (rev 15809)
+++ trunk/packages/mira/trunk/debian/control 2014-01-18 13:31:45 UTC (rev 15810)
@@ -20,7 +20,7 @@
flex,
vim-common,
zlib1g-dev
-Standards-Version: 3.9.4
+Standards-Version: 3.9.5
Vcs-Browser: http://anonscm.debian.org/viewvc/debian-med/trunk/packages/mira/trunk/
Vcs-Svn: svn://anonscm.debian.org/debian-med/trunk/packages/mira/trunk/
Homepage: http://chevreux.org/projects_mira.html
@@ -92,4 +92,3 @@
repeats.
.
This package contains an HTML book introducing to mira.
-
Deleted: trunk/packages/mira/trunk/debian/patches/make.patch
===================================================================
--- trunk/packages/mira/trunk/debian/patches/make.patch 2014-01-18 13:22:39 UTC (rev 15809)
+++ trunk/packages/mira/trunk/debian/patches/make.patch 2014-01-18 13:31:45 UTC (rev 15810)
@@ -1,26 +0,0 @@
-Index: mira-4.0rc1/src/progs/Makefile.am
-===================================================================
---- mira-4.0rc1.orig/src/progs/Makefile.am 2013-08-17 16:11:50.000000000 +0200
-+++ mira-4.0rc1/src/progs/Makefile.am 2013-09-17 14:41:44.000000000 +0200
-@@ -49,7 +49,7 @@
- rm -f miramem$(EXEEXT) && \
- $(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \
- rm -f mirabait$(EXEEXT) && \
-- $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\
-+ $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \
- rm -f miraconvert$(EXEEXT) && \
- $(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT)
-
-Index: mira-4.0rc1/src/progs/Makefile.in
-===================================================================
---- mira-4.0rc1.orig/src/progs/Makefile.in 2013-08-17 16:13:05.000000000 +0200
-+++ mira-4.0rc1/src/progs/Makefile.in 2013-09-17 15:06:06.000000000 +0200
-@@ -609,7 +609,7 @@
- rm -f miramem$(EXEEXT) && \
- $(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \
- rm -f mirabait$(EXEEXT) && \
-- $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\
-+ $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \
- rm -f miraconvert$(EXEEXT) && \
- $(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT)
-
Modified: trunk/packages/mira/trunk/debian/patches/series
===================================================================
--- trunk/packages/mira/trunk/debian/patches/series 2014-01-18 13:22:39 UTC (rev 15809)
+++ trunk/packages/mira/trunk/debian/patches/series 2014-01-18 13:31:45 UTC (rev 15810)
@@ -1,3 +1 @@
#boost-minimal.patch
-make.patch
-spelling.patch
Deleted: trunk/packages/mira/trunk/debian/patches/spelling.patch
===================================================================
--- trunk/packages/mira/trunk/debian/patches/spelling.patch 2014-01-18 13:22:39 UTC (rev 15809)
+++ trunk/packages/mira/trunk/debian/patches/spelling.patch 2014-01-18 13:31:45 UTC (rev 15810)
@@ -1,26 +0,0 @@
-Index: mira-4.0rc1/src/io/gap4_ft_so_map.xxd
-===================================================================
---- mira-4.0rc1.orig/src/io/gap4_ft_so_map.xxd 2013-08-17 16:11:50.000000000 +0200
-+++ mira-4.0rc1/src/io/gap4_ft_so_map.xxd 2013-09-17 15:43:44.000000000 +0200
-@@ -37,7 +37,7 @@
- Fcon conflict sequence_conflict SO:0001085 independent determinations of the "same" sequence differ at this site or region; Or /compare=[accession-number.sequence-version] Different sources report differing sequences. [EBIBS:GAR, UniProt:curation_manual]
- Fenh enhancer enhancer SO:0000165 a cis-acting sequence that increases the utilization of (some) eukaryotic promoters, and can function in either orientation and in any location (upstream or downstream) relative to the promoter; A cis-acting sequence that increases the utilization of (some) eukaryotic promoters, and can function in either orientation and in any location (upstream or downstream) relative to the promoter.
- Fexn exon exon SO:0000147 region of genome that codes for portion of spliced mRNA, rRNA and tRNA; may contain 5'UTR, all CDSs and 3' UTR; A region of the genome that codes for portion of spliced messenger RNA (SO:0000234); may contain 5'-untranslated region (SO:0000204), all open reading frames (SO:0000236) and 3'-untranslated region (SO:0000205).
--Fgap gap gap SO:0000730 gap in the sequence A gap in the sequence of known length. THe unkown bases are filled in with N's.
-+Fgap gap gap SO:0000730 gap in the sequence A gap in the sequence of known length. THe unknown bases are filled in with N's.
- Fgen gene gene SO:0000704 region of biological interest identified as a gene and for which a name has been assigned; A locatable region of genomic sequence, corresponding to a unit of inheritance, which is associated with regulatory regions, transcribed regions and/or other functional sequence regions
- FiDN iDNA iDNA SO:0000723 intervening DNA; DNA which is eliminated through any of several kinds of recombination; Genomic sequence removed from the genome, as a normal event, by a process of recombination.
- Fint intron intron SO:0000188 a segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it; A segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it.
-Index: mira-4.0rc1/src/mira/adaptorsforclip.454.xxd
-===================================================================
---- mira-4.0rc1.orig/src/mira/adaptorsforclip.454.xxd 2013-08-17 16:11:50.000000000 +0200
-+++ mira-4.0rc1/src/mira/adaptorsforclip.454.xxd 2013-09-17 15:44:15.000000000 +0200
-@@ -9,7 +9,7 @@
- # sequences must be included extra in this file (see "rev_*"
- # down below
- #
-->unkown_lookslike_adaptorB
-+>unknown_lookslike_adaptorB
- ACTCGTATAGTGACACGCAACAGGGGATAGACAAGGCACACAGGGGATA
- >unknown_from_cDNA_project_titanium450bp
- TTCGCAGTGAGTGACAGGCCACTGAGACTGCCAAGGCACACGAGGGGATAGG
More information about the debian-med-commit
mailing list