[med-svn] r16959 - in trunk/packages/genometools/trunk/debian: . patches
Sascha Steinbiss
sascha-guest at moszumanska.debian.org
Mon May 19 22:10:19 UTC 2014
Author: sascha-guest
Date: 2014-05-19 22:10:19 +0000 (Mon, 19 May 2014)
New Revision: 16959
Added:
trunk/packages/genometools/trunk/debian/patches/arm64-no-m64
trunk/packages/genometools/trunk/debian/patches/fix-unsigned-char
Modified:
trunk/packages/genometools/trunk/debian/changelog
trunk/packages/genometools/trunk/debian/control
trunk/packages/genometools/trunk/debian/patches/series
trunk/packages/genometools/trunk/debian/patches/split-manuals
Log:
fix building on some exotic archs, incorporate patches from Ubuntu
Modified: trunk/packages/genometools/trunk/debian/changelog
===================================================================
--- trunk/packages/genometools/trunk/debian/changelog 2014-05-19 11:10:35 UTC (rev 16958)
+++ trunk/packages/genometools/trunk/debian/changelog 2014-05-19 22:10:19 UTC (rev 16959)
@@ -1,3 +1,13 @@
+genometools (1.5.2-3) unstable; urgency=low
+
+ * Address building issues on s390x, powerpc and armhf
+ * Don't use -m64 for arm64 (thanks to Logan Rosen)
+ Closes: #748708
+ * Build-depend on docbook-xsl to fix FTBFS while offline (thanks to Logan Rosen)
+ Closes: #748709
+
+ -- Sascha Steinbiss <steinbiss at zbh.uni-hamburg.de> Mon, 19 May 2014 23:06:34 +0000
+
genometools (1.5.2-2) unstable; urgency=low
* Split manuals into separate documents to avoid strange LaTeX build issues.
Modified: trunk/packages/genometools/trunk/debian/control
===================================================================
--- trunk/packages/genometools/trunk/debian/control 2014-05-19 11:10:35 UTC (rev 16958)
+++ trunk/packages/genometools/trunk/debian/control 2014-05-19 22:10:19 UTC (rev 16959)
@@ -27,7 +27,8 @@
asciidoc,
libxml2-utils,
xsltproc,
- ruby
+ ruby,
+ docbook-xsl
Standards-Version: 3.9.5
Vcs-Browser: http://anonscm.debian.org/viewvc/debian-med/trunk/packages/genometools/trunk/
Vcs-Svn: svn://anonscm.debian.org/debian-med/trunk/packages/genometools/trunk/
Added: trunk/packages/genometools/trunk/debian/patches/arm64-no-m64
===================================================================
--- trunk/packages/genometools/trunk/debian/patches/arm64-no-m64 (rev 0)
+++ trunk/packages/genometools/trunk/debian/patches/arm64-no-m64 2014-05-19 22:10:19 UTC (rev 16959)
@@ -0,0 +1,11 @@
+--- a/Makefile
++++ b/Makefile
+@@ -308,7 +308,7 @@
+ endif
+
+ ifeq ($(m64),yes)
+- ifeq (,$(filter $(MACHINE),ia64 alpha mips64 mips64el))
++ ifeq (,$(filter $(MACHINE),ia64 alpha mips64 mips64el aarch64))
+ GT_CFLAGS += -m64
+ GT_LDFLAGS += -m64
+ SQLITE_CFLAGS += -m64
Added: trunk/packages/genometools/trunk/debian/patches/fix-unsigned-char
===================================================================
--- trunk/packages/genometools/trunk/debian/patches/fix-unsigned-char (rev 0)
+++ trunk/packages/genometools/trunk/debian/patches/fix-unsigned-char 2014-05-19 22:10:19 UTC (rev 16959)
@@ -0,0 +1,115 @@
+--- a/src/core/safearith.c
++++ b/src/core/safearith.c
+@@ -182,8 +182,10 @@
+ gt_error_check(err);
+
+ {
++ /* This is not always true, e.g. on PPC and ARM!
++ cf. http://www.network-theory.co.uk/docs/gccintro/gccintro_71.html
+ gt_ensure(__MIN(char) == -128);
+- gt_ensure(__MAX(char) == 127);
++ gt_ensure(__MAX(char) == 127); */
+ gt_ensure(__MIN(unsigned char) == 0);
+ gt_ensure(__MAX(unsigned char) == 255);
+
+--- a/src/core/tokenizer.c
++++ b/src/core/tokenizer.c
+@@ -45,7 +45,9 @@
+
+ GtStr* gt_tokenizer_get_token(GtTokenizer *t)
+ {
+- char c = EOF;
++ char c;
++ bool has_eof = true;
++ int rval = 0;
+ gt_assert(t);
+
+ /* if we have no current token, get it if possible */
+@@ -53,32 +55,44 @@
+ if (t->skip_comment_lines && gt_io_line_start(t->io)) {
+ for (;;) {
+ gt_assert(gt_io_line_start(t->io));
+- if ((gt_io_get_char(t->io, &c) != -1)) {
+- if (c == '#') {
++ if ((gt_io_get_char(t->io, (char*) &c) != -1)) {
++ if ((char) c == '#') {
+ /* skip line */
+ while ((gt_io_get_char(t->io, &c) != -1) && c != '\n');
+- c = EOF;
++ has_eof = true;
+ }
+ else {
+ gt_io_unget_char(t->io, c);
++ has_eof = false;
+ break;
+ }
+ }
+- else
++ else {
++ c = EOF;
+ break;
++ }
+ }
+- }
+- while ((gt_io_get_char(t->io, &c) != -1) && c == ' '); /* skip blanks */
++ } /* skip blanks */
++ while (((rval = gt_io_get_char(t->io, &c)) != -1) && c == ' ');
++ if (rval == -1)
++ has_eof = true;
++ else
++ has_eof = false;
+ do {
+- if (c != EOF) {
++ if (!has_eof) {
+ if (!t->token)
+ t->token = gt_str_new();
+ if (c == '\n')
+ break;
+ gt_str_append_char(t->token, c);
+ }
+- } while ((gt_io_get_char(t->io, &c) != -1) && c != ' ' && c != '\n');
+- if (c == '\n' && c != EOF) {
++ } while (((rval = gt_io_get_char(t->io, &c)) != -1)
++ && c != ' ' && c != '\n');
++ if (rval == -1)
++ has_eof = true;
++ else
++ has_eof = false;
++ if (c == '\n' && !has_eof) {
+ gt_assert(t->token);
+ gt_str_append_char(t->token, c);
+ }
+--- a/src/core/tokenizer.h
++++ b/src/core/tokenizer.h
+@@ -33,7 +33,7 @@
+ bool gt_tokenizer_has_token(GtTokenizer*);
+ bool gt_tokenizer_line_start(const GtTokenizer*);
+ void gt_tokenizer_next_token(GtTokenizer*); /* go to the next token */
+-GtUword gt_tokenizer_get_line_number(const GtTokenizer*);
++GtUword gt_tokenizer_get_line_number(const GtTokenizer*);
+ const char* gt_tokenizer_get_filename(const GtTokenizer*);
+ int gt_tokenizer_unit_test(GtError*);
+ void gt_tokenizer_delete(GtTokenizer*);
+--- a/src/core/trans_table.c
++++ b/src/core/trans_table.c
+@@ -21,7 +21,7 @@
+ #include "core/ma.h"
+ #include "core/trans_table.h"
+
+-#define GT_AMINOACIDFAIL -1
++#define GT_AMINOACIDFAIL ((char) 0)
+
+ /* The integer which a T is encoded to. */
+ #define GT_T_CODE 0
+--- a/src/extended/gff3_escaping.c
++++ b/src/extended/gff3_escaping.c
+@@ -64,7 +64,8 @@
+ unsigned char d;
+ gt_assert(str && out);
+ if (!(GtIsHexChar[(int) *(str+1)] & 2)
+- || !(GtIsHexChar[(int) *(str+2)] & 1)) {
++ || !(GtIsHexChar[(int) *(str+2)] & 1)
++ || !strncmp(str, "%7F", 3 * (sizeof (char)))) {
+ return -1;
+ }
+ d = (GtHexToDec[(int) *(str+1)] << 4) | (GtHexToDec[(int) *(str+2)]);
Modified: trunk/packages/genometools/trunk/debian/patches/series
===================================================================
--- trunk/packages/genometools/trunk/debian/patches/series 2014-05-19 11:10:35 UTC (rev 16958)
+++ trunk/packages/genometools/trunk/debian/patches/series 2014-05-19 22:10:19 UTC (rev 16959)
@@ -1,3 +1,4 @@
+fix-unsigned-char
add-libtre
adding_soname
libbam-fix
@@ -8,3 +9,4 @@
no-xmllint
spelling
split-manuals
+arm64-no-m64
Modified: trunk/packages/genometools/trunk/debian/patches/split-manuals
===================================================================
--- trunk/packages/genometools/trunk/debian/patches/split-manuals 2014-05-19 11:10:35 UTC (rev 16958)
+++ trunk/packages/genometools/trunk/debian/patches/split-manuals 2014-05-19 22:10:19 UTC (rev 16959)
@@ -1,5 +1,3 @@
-Description: Split manuals into separate documents to avoid strange LaTeX build issues.
-Author: Sascha Steinbiss <steinbiss at zbh.uni-hamburg.de>
--- a/doc/manuals/matstat.tex
+++ b/doc/manuals/matstat.tex
@@ -1,2 +1,160 @@
@@ -38,18 +36,18 @@
+
+The program \Program is called as follows:
+\par
-+\noindent\Program [\textit{options}] \Showoption{query} \Showoptionarg{files} [\textit{options}]
++\noindent\Program [\textit{options}] \Showoption{query} \Showoptionarg{files} [\textit{options}]
+\par
-+\Showoptionarg{files} is a white space separated list of at least one
++\Showoptionarg{files} is a white space separated list of at least one
+filename. Any sequence occurring in any file specified in \Showoptionarg{files}
+is called \textit{unit} in the following.
+In addition to the mandatory option \Showoption{query}, the program
+must be called with either option \Showoption{pck} or \Showoption{esa}
-+which specify to use a packed index or an enhanced suffix array for
++which specify to use a packed index or an enhanced suffix array for
+a given set of subject sequences.
+
-+\Program computes the \textit{matching statistics} for each unit. That is,
-+for each position \(i\) in
++\Program computes the \textit{matching statistics} for each unit. That is,
++for each position \(i\) in
+each unit, say \(s\) of length \(n\), \(\MS{i}=(l,j)\) is computed. Here
+\(l\) is the largest integer such that \(\Substring{s}{i}{i+l-1}\) matches
+a substring represented by the index and \(j\) is a start position of the
@@ -77,20 +75,20 @@
+
+\Option{query}{$\Showoptionarg{files}$}{
+Specify a white space separated list of query files containing the units.
-+At least one query file must be given. The files may be in
++At least one query file must be given. The files may be in
+gzipped format, in which case they have to end with the suffix \texttt{.gz}.
+}
+
-+\Option{min}{$\ell$}{
++\Option{min}{$\ell$}{
+Specify the minimum value $\ell$ for the length of the matching statistics.
-+That is, for each unit \(s\) and each position \(i\) in \(s\), the program
-+reports all values \(i\) and \(\MS{i}\) if the
++That is, for each unit \(s\) and each position \(i\) in \(s\), the program
++reports all values \(i\) and \(\MS{i}\) if the
+length of \(\MS{i}\) is at least \(\ell\).
+}
+
+\Option{max}{$\ell$}{
+Specify the maximum length $\ell$ for the length of the matching statistics.
-+That is, for each unit \(s\) and each positions \(i\) in \(s\), the program
++That is, for each unit \(s\) and each positions \(i\) in \(s\), the program
+reports the values \(i\) and \(\MS{i}\) if the length of \(\MS{i}\)
+is at most \(\ell\).
+}
@@ -100,7 +98,7 @@
+$\Showoptionkey{subjectpos}$,
+$\Showoptionkey{querypos}$, and
+$\Showoptionkey{sequence}$ must be used.
-+Using the keyword $\Showoptionkey{subjectpos}$ shows the
++Using the keyword $\Showoptionkey{subjectpos}$ shows the
+subject position of the matching statistics.
+Using the keyword $\Showoptionkey{querypos}$ shows the query position.
+Using the keyword $\Showoptionkey{sequence}$ shows the sequence content
@@ -125,7 +123,7 @@
+\section{Examples}
+
+Suppose that in some directory, say \texttt{homo-sapiens}, we have 25 gzipped
-+fasta files containing all 24 human chromomsomes plus one file with
++fasta files containing all 24 human chromomsomes plus one file with
+mitrochondrial sequences. These may have been downloaded from
+\url{ftp://ftp.ensembl.org/pub/current_fasta/homo_sapiens_47_36i/dna}.
+
@@ -136,7 +134,7 @@
+ -indexname human-all -db homo-sapiens/*.gz
+\end{Output}
+
-+The program runs for almost two hours and delivers
++The program runs for almost two hours and delivers
+an index \texttt{human-all} consisting of three files:
+
+\begin{Output}
@@ -149,7 +147,7 @@
+This is used in the following call to the program \Program:
+
+\begin{Output}
-+gt matstat -output subjectpos querypos sequence -min 20 -max 30
++gt matstat -output subjectpos querypos sequence -min 20 -max 30
+ -query queryfile.fna -pck human-all
+unit 0 (Mus musculus, chr 1, complete sequence)
+22 20 390765125 actgtatctcaaaatataaa
@@ -168,12 +166,12 @@
--- a/doc/manuals/uniquesub.tex
+++ b/doc/manuals/uniquesub.tex
@@ -8,38 +8,15 @@
-
+
\usepackage{verbatim}
\usepackage{ifthen}
-\usepackage{comment}
\usepackage{optionman}
-
+
-\ifthenelse{\isundefined{\BuildMatstat}}{%
-\includecomment{AboutUniquesub}
-\excludecomment{AboutMatstat}
@@ -187,7 +185,7 @@
-}
-
\newcommand{\Substring}[3]{#1[#2..#3]}
-
+
-\begin{AboutUniquesub}
\newcommand{\Program}[0]{\texttt{uniquesub}\xspace}
\newcommand{\Mup}[1]{\mathit{mup(s,#1)}}
@@ -203,96 +201,44 @@
- matching statistics\\
- a manual}
-\end{AboutMatstat}
-
+
\author{\begin{tabular}{c}
\textit{Stefan Kurtz}\\
-@@ -54,47 +31,35 @@
-
- The program \Program is called as follows:
- \par
--\noindent\Program [\textit{options}] \Showoption{query} \Showoptionarg{files} [\textit{options}]
-+\noindent\Program [\textit{options}] \Showoption{query} \Showoptionarg{files} [\textit{options}]
- \par
--\Showoptionarg{files} is a white space separated list of at least one
-+\Showoptionarg{files} is a white space separated list of at least one
- filename. Any sequence occurring in any file specified in \Showoptionarg{files}
- is called \textit{unit} in the following.
- In addition to the mandatory option \Showoption{query}, the program
- must be called with either option \Showoption{pck} or \Showoption{esa}
--which specify to use a packed index or an enhanced suffix array for
-+which specify to use a packed index or an enhanced suffix array for
+@@ -64,7 +41,6 @@
+ which specify to use a packed index or an enhanced suffix array for
a given set of subject sequences.
-
+
-\begin{AboutUniquesub}
\Program computes for all positions \(i\) in each unit, say \(s\) of length
--\(n\), the length \(\Mup{i}\) of the minimum unique prefix
-+\(n\), the length \(\Mup{i}\) of the minimum unique prefix
+ \(n\), the length \(\Mup{i}\) of the minimum unique prefix
at position \(i\), if it exists. Uniqueness always refers to all substrings
--represented by the index. \(\Mup{i}\) is defined by the following two
-+represented by the index. \(\Mup{i}\) is defined by the following two
- statements:
- \begin{itemize}
- \item
- If \(\Substring{s}{i}{n-1}\) is not unique in the index, then \(\Mup{i}=\bot\).
- That is, it is undefined.
- \item
--If \(\Substring{s}{i}{n-1}\) is unique in the index, then \(\Mup{i}=m\), where
--\(m\) is the smallest value such that \(i+m-1\leq n-1\) and
-+If \(\Substring{s}{i}{n-1}\) is unique in the index, then \(\Mup{i}=m\), where
-+\(m\) is the smallest value such that \(i+m-1\leq n-1\) and
- \(\Substring{s}{i}{i+m-1}\) occurs exactly once as a substring in the index.
- \end{itemize}
--Note that it is possible that for all \(i\in[0,n-1]\) we have
--\(\Mup{i}=\bot\), which means that unit \(s\) does not contain any unique
-+Note that it is possible that for all \(i\in[0,n-1]\) we have
-+\(\Mup{i}=\bot\), which means that unit \(s\) does not contain any unique
+@@ -84,17 +60,6 @@
substring. In this case, the program reports nothing for the corresponding
unit. The program was developed for designing whole genome tiling arrays.
The corresponding publication is \cite{GRAE:NIE:KUR:HUY:BIR:STU:FLI:2007}.
-\end{AboutUniquesub}
-
-\begin{AboutMatstat}
--\Program computes the \textit{matching statistics} for each unit. That is,
--for each position \(i\) in
+-\Program computes the \textit{matching statistics} for each unit. That is,
+-for each position \(i\) in
-each unit, say \(s\) of length \(n\), \(\MS{i}=(l,j)\) is computed. Here
-\(l\) is the largest integer such that \(\Substring{s}{i}{i+l-1}\) matches
-a substring represented by the index and \(j\) is a start position of the
-matching substring in the index. We say that \(l\) is the length of \(\MS{i}\)
-and \(j\) is the subject position of \(\MS{i}\).
-\end{AboutMatstat}
-
+
The following options are available in \Program:
-
-@@ -117,58 +82,29 @@
-
- \Option{query}{$\Showoptionarg{files}$}{
- Specify a white space separated list of query files containing the units.
--At least one query file must be given. The files may be in
-+At least one query file must be given. The files may be in
+
+@@ -121,7 +86,6 @@
gzipped format, in which case they have to end with the suffix \texttt{.gz}.
}
-
+
-\begin{AboutUniquesub}
\Option{min}{$\ell$}{
Specify the minimum length $\ell$ of the minimum unique prefixes.
--That is, for each unit \(s\) and each positions \(i\) in \(s\), the program
--reports the values \(i\) and \(\Mup{i}\) whenever \(\Mup{i}\geq\ell\).
-+That is, for each unit \(s\) and each positions \(i\) in \(s\), the program
-+reports the values \(i\) and \(\Mup{i}\) whenever \(\Mup{i}\geq\ell\).
- }
-
- \Option{max}{$\ell$}{
- Specify the maximum length $\ell$ of the minimum unique prefixes.
--That is, for each unit \(s\) and each positions \(i\) in \(s\), the program
-+That is, for each unit \(s\) and each positions \(i\) in \(s\), the program
- reports the values \(i\) and \(\Mup{i}\) whenever \(\Mup{i}\leq\ell\).
- }
-
- \Option{output}{(\Showoptionkey{querypos}$\mid$\Showoptionkey{sequence})}{
- Specify what to output. At least one of the two keys words
--$\Showoptionkey{querypos}$ and $\Showoptionkey{sequence}$ must be used.
-+$\Showoptionkey{querypos}$ and $\Showoptionkey{sequence}$ must be used.
- Using the keyword $\Showoptionkey{querypos}$ shows the query position.
+ That is, for each unit \(s\) and each positions \(i\) in \(s\), the program
+@@ -141,34 +105,6 @@
Using the keyword $\Showoptionkey{sequence}$ shows the sequence content
of the match.
}
@@ -301,14 +247,14 @@
-\begin{AboutMatstat}
-\Option{min}{$\ell$}{
-Specify the minimum value $\ell$ for the length of the matching statistics.
--That is, for each unit \(s\) and each position \(i\) in \(s\), the program
--reports all values \(i\) and \(\MS{i}\) if the
+-That is, for each unit \(s\) and each position \(i\) in \(s\), the program
+-reports all values \(i\) and \(\MS{i}\) if the
-length of \(\MS{i}\) is at least \(\ell\).
-}
-
-\Option{max}{$\ell$}{
-Specify the maximum length $\ell$ for the length of the matching statistics.
--That is, for each unit \(s\) and each positions \(i\) in \(s\), the program
+-That is, for each unit \(s\) and each positions \(i\) in \(s\), the program
-reports the values \(i\) and \(\MS{i}\) if the length of \(\MS{i}\)
-is at most \(\ell\).
-}
@@ -318,62 +264,23 @@
-$\Showoptionkey{subjectpos}$,
-$\Showoptionkey{querypos}$, and
-$\Showoptionkey{sequence}$ must be used.
--Using the keyword $\Showoptionkey{subjectpos}$ shows the
+-Using the keyword $\Showoptionkey{subjectpos}$ shows the
-subject position of the matching statistics.
-Using the keyword $\Showoptionkey{querypos}$ shows the query position.
-Using the keyword $\Showoptionkey{sequence}$ shows the sequence content
-}
-\end{AboutMatstat}
-
+
\Helpoption
-
-@@ -189,7 +125,7 @@
- \section{Examples}
-
- Suppose that in some directory, say \texttt{homo-sapiens}, we have 25 gzipped
--fasta files containing all 24 human chromomsomes plus one file with
-+fasta files containing all 24 human chromomsomes plus one file with
- mitrochondrial sequences. These may have been downloaded from
- \url{ftp://ftp.ensembl.org/pub/current_fasta/homo_sapiens_47_36i/dna}.
-
-@@ -200,7 +136,7 @@
- -indexname human-all -db homo-sapiens/*.gz
- \end{Output}
-
--The program runs for almost two hours and delivers
-+The program runs for almost two hours and delivers
- an index \texttt{human-all} consisting of three files:
-
- \begin{Output}
-@@ -212,9 +148,8 @@
-
+
+@@ -212,7 +148,6 @@
+
This is used in the following call to the program \Program:
-
+
-\begin{AboutUniquesub}
\begin{Output}
--gt uniquesub -output querypos -min 20 -max 30 -query queryfile.fna
-+gt uniquesub -output querypos -min 20 -max 30 -query queryfile.fna
+ gt uniquesub -output querypos -min 20 -max 30 -query queryfile.fna
-pck human-all
- unit 0 (Mus musculus, chr 1, complete sequence)
- 1007 20
-@@ -227,7 +162,7 @@
-
- For all units \(s\) in the multiple \Fasta file \texttt{queryfile.fna},
- a line is shown, reporting the number of the unit and the original fasta
--header. Also, all for positions \(i\) in \(s\) satisfying
-+header. Also, all for positions \(i\) in \(s\) satisfying
- \(20\leq \Mup{i}\leq 30\), \(i\) and \(\Mup{i}\) is reported.
-
- The first column is the relative position in the unit sequence (counting
-@@ -238,7 +173,7 @@
- \Showoption{output}:
-
- \begin{Output}
--gt uniquesub -output querypos sequence -min 20 -max 30
-+gt uniquesub -output querypos sequence -min 20 -max 30
- -query queryfile.fna -pck human-all
- unit 0 (Mus musculus, chr 1, complete sequence)
- 1007 20 ctgacagtttttttttttta
@@ -248,27 +183,7 @@
1013 21 gttttttttttttactttata
...
@@ -382,7 +289,7 @@
-
-\begin{AboutMatstat}
-\begin{Output}
--gt matstat -output subjectpos querypos sequence -min 20 -max 30
+-gt matstat -output subjectpos querypos sequence -min 20 -max 30
- -query queryfile.fna -pck human-all
-unit 0 (Mus musculus, chr 1, complete sequence)
-22 20 390765125 actgtatctcaaaatataaa
@@ -397,14 +304,14 @@
-the corresponding length value. The third column shows position of the
-matching sequence in the index, and the fourth shows the sequence content.
-\end{AboutMatstat}
-
+
-\begin{AboutUniquesub}
%\bibliographystyle{plain}
%\bibliography{defines,kurtz}
\begin{thebibliography}{1}
@@ -280,5 +195,4 @@
\newblock {\em {Bioinformatics}}, {23 ISMB/ECCB 2007}:{i195--i204}, 2007.
-
+
\end{thebibliography}
-\end{AboutUniquesub}
\end{document}
More information about the debian-med-commit
mailing list