[med-svn] [abyss] 01/08: Imported Upstream version 1.5.2
Andreas Tille
tille at debian.org
Mon Sep 15 14:27:22 UTC 2014
This is an automated email from the git hooks/post-receive script.
tille pushed a commit to branch master
in repository abyss.
commit fcd96a6b6856a4579319a6276784515da37ace6e
Author: Andreas Tille <tille at debian.org>
Date: Mon Sep 15 14:58:25 2014 +0200
Imported Upstream version 1.5.2
---
.gitignore | 18 +
.travis.yml | 8 +
ABYSS/Abyss.cpp | 1 +
ABYSS/Makefile.in | 590 --
AdjList/AdjList.cpp | 25 +-
AdjList/Makefile.am | 1 -
AdjList/Makefile.in | 591 --
Align/Makefile.in | 750 --
Align/align.cc | 2 +-
Align/alignGlobal.h | 52 +-
Align/mergepairs.cc | 10 +-
Assembly/AssemblyAlgorithms.cpp | 39 +-
Assembly/BranchRecord.cpp | 4 +-
Assembly/ISequenceCollection.h | 7 +-
Assembly/Makefile.in | 647 --
Assembly/Options.cpp | 37 +-
Assembly/Options.h | 2 +
Assembly/SequenceCollection.cpp | 73 +-
Assembly/SequenceCollection.h | 1 +
Bloom/Bloom.h | 324 +
Bloom/BloomFilter.h | 100 +
Bloom/BloomFilterWindow.h | 157 +
Bloom/CascadingBloomFilter.h | 120 +
Bloom/CascadingBloomFilterWindow.h | 90 +
Bloom/ConcurrentBloomFilter.h | 96 +
Bloom/Makefile.am | 20 +
Bloom/bloom.cc | 571 ++
COPYRIGHT | 258 +-
ChangeLog | 160 +-
Common/Algorithms.h | 4 -
Common/Alignment.h | 5 +
Common/ConstString.h | 39 +-
Common/Dictionary.h | 7 +-
Common/Hash.h | 27 +
Common/HashFunction.h | 5 +
Common/Histogram.h | 21 +-
Common/Kmer.cpp | 21 +
Common/Kmer.h | 15 +-
Common/KmerIterator.h | 110 +
Common/Makefile.am | 5 +
Common/Makefile.in | 775 --
Common/MemUtils.h | 18 +
Common/SAM.h | 105 +-
Common/StringUtil.h | 67 +
Common/Uncompress.cpp | 1 +
Common/UnorderedMap.h | 1 +
Common/UnorderedSet.h | 21 +
Common/Warnings.h | 6 +
Common/cholesky.hpp | 4 -
Consensus/Consensus.cpp | 2 +-
Consensus/Makefile.in | 589 --
DAssembler/DAssembler.cpp | 2 +-
DAssembler/Makefile.in | 618 --
DataLayer/FastaConcat.h | 89 +
DataLayer/FastaReader.cpp | 33 +-
DataLayer/FastaReader.h | 15 +-
DataLayer/FastaWriter.cpp | 16 +
DataLayer/FastaWriter.h | 6 +
DataLayer/Makefile.am | 1 +
DataLayer/Makefile.in | 706 --
DataLayer/Options.h | 1 +
DataLayer/abyss-tofastq.cc | 2 +-
DataLayer/fac.cc | 5 +-
DistanceEst/DistanceEst.cpp | 55 +-
DistanceEst/Makefile.am | 11 +-
DistanceEst/Makefile.in | 615 --
FMIndex/FMIndex.h | 11 +-
FMIndex/Makefile.in | 630 --
FMIndex/abyss-dawg.cc | 2 +-
FMIndex/count.cc | 4 +-
FMIndex/sais.hxx | 4 +
FilterGraph/FilterGraph.cpp | 69 +-
FilterGraph/Makefile.am | 1 -
FilterGraph/Makefile.in | 593 --
GapFiller/Makefile.am | 17 +
GapFiller/gapfill.cpp | 359 +
GapFiller/gapfill.h | 70 +
Graph/AllPathsSearch.h | 91 +
Graph/Assemble.h | 5 +-
Graph/BidirectionalBFS.h | 158 +
Graph/BidirectionalBFSVisitor.h | 91 +
Graph/BreadthFirstSearch.h | 72 +
Graph/ConstrainedBFSVisitor.h | 158 +
Graph/ConstrainedBidiBFSVisitor.h | 455 ++
Graph/ConstrainedSearch.cpp | 131 -
Graph/ConstrainedSearch.h | 127 +-
Graph/ContigGraphAlgorithms.h | 47 +-
Graph/DefaultColorMap.h | 56 +
Graph/DepthFirstSearch.h | 10 +-
Graph/DotIO.h | 12 +-
Graph/GraphAlgorithms.h | 48 +
Graph/GraphIO.h | 2 +
Graph/HashGraph.h | 485 ++
Graph/Makefile.am | 26 +-
Graph/Makefile.in | 697 --
Graph/Path.h | 47 +
Graph/PopBubbles.h | 1 -
Graph/SAMIO.h | 33 +-
Graph/gc.cc | 2 +-
Graph/todot.cc | 2 +-
KAligner/Aligner.h | 9 +-
KAligner/KAligner.cpp | 4 +-
KAligner/Makefile.am | 7 +-
KAligner/Makefile.in | 620 --
Konnector/DBGBloom.h | 434 ++
Konnector/DBGBloomAlgorithms.h | 201 +
Konnector/Makefile.am | 17 +
Konnector/konnector.cc | 738 ++
Konnector/konnector.h | 341 +
LICENSE | 872 ++-
Layout/Makefile.in | 580 --
Layout/layout.cc | 9 +-
LogKmerCount/CountingBloomFilter.h | 132 +
LogKmerCount/Makefile.am | 16 +
LogKmerCount/logcounter.cc | 164 +
LogKmerCount/plc.h | 68 +
LogKmerCount/plc_strand.h | 80 +
Makefile.am | 16 +-
Makefile.in | 856 ---
Map/Makefile.am | 11 +-
Map/Makefile.in | 669 --
Map/index.cc | 2 +-
Map/map.cc | 188 +-
Map/overlap.cc | 34 +-
MergePaths/Makefile.am | 5 +-
MergePaths/Makefile.in | 676 --
MergePaths/MergeContigs.cpp | 4 +-
MergePaths/MergePaths.cpp | 4 +-
MergePaths/PathConsensus.cpp | 16 +-
Misc/Makefile.am | 2 +-
Misc/Makefile.in | 538 --
Overlap/Makefile.am | 1 -
Overlap/Makefile.in | 591 --
Overlap/Overlap.cpp | 29 +-
Parallel/Makefile.in | 673 --
Parallel/NetworkSequenceCollection.cpp | 5 +-
Parallel/parallelAbyss.cpp | 61 +-
ParseAligns/Makefile.am | 9 +-
ParseAligns/Makefile.in | 629 --
ParseAligns/ParseAligns.cpp | 4 +-
ParseAligns/abyss-fixmate.cc | 53 +-
PathOverlap/Makefile.am | 1 -
PathOverlap/Makefile.in | 591 --
PathOverlap/PathOverlap.cpp | 25 +-
PopBubbles/Makefile.am | 1 -
PopBubbles/Makefile.in | 597 --
PopBubbles/PopBubbles.cpp | 99 +-
README.html | 385 -
README.md | 121 +-
Scaffold/Makefile.am | 12 +-
Scaffold/Makefile.in | 651 --
Scaffold/drawgraph.cc | 3 +-
Scaffold/junction.cc | 8 +-
Scaffold/longseqdist.cpp | 211 +
Scaffold/scaffold.cc | 35 +-
SimpleGraph/Makefile.am | 10 +-
SimpleGraph/Makefile.in | 590 --
SimpleGraph/SimpleGraph.cpp | 7 +-
Unittest/Common/BitUtilTest.cpp | 17 +
Unittest/Common/HistogramTest.cpp | 53 +
Unittest/Common/KmerIteratorTest.cpp | 48 +
Unittest/Common/KmerTest.cpp | 32 +
Unittest/Common/SAM.cc | 64 +
Unittest/Common/Sequence.cc | 13 +
Unittest/Common/StringUtilTest.cpp | 164 +
Unittest/Graph/AllPathsSearchTest.cpp | 190 +
Unittest/Graph/BidirectionalBFSTest.cpp | 185 +
Unittest/Graph/ConstrainedBFSVisitorTest.cpp | 153 +
Unittest/Graph/ConstrainedBidiBFSVisitorTest.cpp | 215 +
Unittest/Graph/HashGraphTest.cpp | 87 +
Unittest/Konnector/BloomFilter.cc | 323 +
Unittest/Konnector/DBGBloomAlgorithmsTest.cpp | 173 +
Unittest/Konnector/DBGBloomTest.cpp | 63 +
Unittest/Konnector/integration-tests.mk | 370 +
Unittest/Konnector/konnectorTest.cpp | 75 +
Unittest/Makefile.am | 109 +
aclocal.m4 | 1149 ---
autogen.sh | 6 +
bin/Makefile.am | 5 +-
bin/Makefile.in | 478 --
bin/abyss-bloom-dist.mk | 187 +
bin/abyss-bwamem | 78 +
bin/abyss-joindist | 2 +-
bin/abyss-pe | 184 +-
bin/abyss-samtoafg | 1 +
bin/abyss-tabtomd | 12 +
compile | 347 -
config.h.in | 285 -
configure | 8868 ----------------------
configure.ac | 80 +-
depcomp | 791 --
dialign/Makefile.in | 559 --
doc/ABYSS.1 | 7 +-
doc/Makefile.am | 2 +-
doc/Makefile.in | 499 --
doc/abyss-pe.1 | 57 +-
doc/abyss-tofastq.1 | 4 +-
doc/flowchart.graffle | 8498 +++++++++++++++++++++
doc/flowchart.pdf | Bin 165274 -> 165267 bytes
doc/flowchart_simplified.graffle | 1806 +++++
doc/flowchart_simplified.pdf | Bin 0 -> 40801 bytes
install-sh | 527 --
kmerprint/Makefile.am | 4 +-
kmerprint/Makefile.in | 543 --
kmerprint/kmerprint.cc | 2 +-
missing | 215 -
206 files changed, 21668 insertions(+), 31870 deletions(-)
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000..5253d26
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,18 @@
+*/Makefile.in
+Makefile.in
+aclocal.m4
+autom4te.cache
+config.h.in
+configure
+depcomp
+install-sh
+missing
+test-driver
+_*
+*.swp
+*.swo
+*.swn
+*~
+tags
+compile
+*.orig
diff --git a/.travis.yml b/.travis.yml
new file mode 100644
index 0000000..3e5e539
--- /dev/null
+++ b/.travis.yml
@@ -0,0 +1,8 @@
+language: cpp
+compiler:
+ - gcc
+ - clang
+before_install:
+ - sudo apt-get update -qq
+ - sudo apt-get install -qq libboost-dev libopenmpi-dev libsparsehash-dev
+script: ./autogen.sh && ./configure --with-mpi=/usr/lib/openmpi && make
diff --git a/ABYSS/Abyss.cpp b/ABYSS/Abyss.cpp
index 510951c..2b68741 100644
--- a/ABYSS/Abyss.cpp
+++ b/ABYSS/Abyss.cpp
@@ -58,6 +58,7 @@ static void assemble(const string& pathIn, const string& pathOut)
bind1st(ptr_fun(AssemblyAlgorithms::loadSequences), &g));
size_t numLoaded = g.size();
cout << "Loaded " << numLoaded << " k-mer\n";
+ g.setDeletedKey();
g.shrink();
if (g.empty()) {
cerr << "error: no usable sequence\n";
diff --git a/ABYSS/Makefile.in b/ABYSS/Makefile.in
deleted file mode 100644
index f15189a..0000000
--- a/ABYSS/Makefile.in
+++ /dev/null
@@ -1,590 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = ABYSS$(EXEEXT)
-subdir = ABYSS
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_ABYSS_OBJECTS = ABYSS-Abyss.$(OBJEXT)
-ABYSS_OBJECTS = $(am_ABYSS_OBJECTS)
-ABYSS_DEPENDENCIES = $(top_builddir)/Assembly/libassembly.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(ABYSS_SOURCES)
-DIST_SOURCES = $(ABYSS_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-ABYSS_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Assembly \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-ABYSS_LDADD = \
- $(top_builddir)/Assembly/libassembly.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-ABYSS_SOURCES = Abyss.cpp
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign ABYSS/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign ABYSS/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-ABYSS$(EXEEXT): $(ABYSS_OBJECTS) $(ABYSS_DEPENDENCIES) $(EXTRA_ABYSS_DEPENDENCIES)
- @rm -f ABYSS$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(ABYSS_OBJECTS) $(ABYSS_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/ABYSS-Abyss.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-ABYSS-Abyss.o: Abyss.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS-Abyss.o -MD -MP -MF $(DEPDIR)/ABYSS-Abyss.Tpo -c -o ABYSS-Abyss.o `test -f 'Abyss.cpp' || echo '$(srcdir)/'`Abyss.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS-Abyss.Tpo $(DEPDIR)/ABYSS-Abyss.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Abyss.cpp' object='ABYSS-Abyss.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS-Abyss.o `test -f 'Abyss.cpp' || echo '$(srcdir)/'`Abyss.cpp
-
-ABYSS-Abyss.obj: Abyss.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS-Abyss.obj -MD -MP -MF $(DEPDIR)/ABYSS-Abyss.Tpo -c -o ABYSS-Abyss.obj `if test -f 'Abyss.cpp'; then $(CYGPATH_W) 'Abyss.cpp'; else $(CYGPATH_W) '$(srcdir)/Abyss.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS-Abyss.Tpo $(DEPDIR)/ABYSS-Abyss.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Abyss.cpp' object='ABYSS-Abyss.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS-Abyss.obj `if test -f 'Abyss.cpp'; then $(CYGPATH_W) 'Abyss.cpp'; else $(CYGPATH_W) '$(srcdir)/Abyss.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/AdjList/AdjList.cpp b/AdjList/AdjList.cpp
index 795c7ab..521d338 100644
--- a/AdjList/AdjList.cpp
+++ b/AdjList/AdjList.cpp
@@ -31,10 +31,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... [FILE]...\n"
+"Usage: " PROGRAM " -k<kmer> [OPTION]... [FILE]...\n"
"Find overlaps of [m,k) bases. Contigs may be read from FILE(s)\n"
"or standard input. Output is written to standard output.\n"
"Overlaps of exactly k-1 bases are found using a hash table.\n"
@@ -47,6 +47,8 @@ static const char USAGE_MESSAGE[] =
" --adj output the results in adj format [default]\n"
" --dot output the results in dot format\n"
" --sam output the results in SAM format\n"
+" --SS expect contigs to be oriented correctly\n"
+" --no-SS no assumption about contig orientation\n"
" -v, --verbose display verbose output\n"
" --help display this help and exit\n"
" --version output version information and exit\n"
@@ -57,6 +59,9 @@ namespace opt {
unsigned k; // used by GraphIO
int format; // used by GraphIO
+ /** Run a strand-specific RNA-Seq assembly. */
+ static int ss;
+
/** The minimum required amount of overlap. */
static unsigned minOverlap = 50;
}
@@ -71,6 +76,8 @@ static const struct option longopts[] = {
{ "adj", no_argument, &opt::format, ADJ },
{ "dot", no_argument, &opt::format, DOT },
{ "sam", no_argument, &opt::format, SAM },
+ { "SS", no_argument, &opt::ss, 1 },
+ { "no-SS", no_argument, &opt::ss, 0 },
{ "verbose", no_argument, NULL, 'v' },
{ "help", no_argument, NULL, OPT_HELP },
{ "version", no_argument, NULL, OPT_VERSION },
@@ -102,6 +109,8 @@ static void addOverlapsSA(Graph& g, const SuffixArray& sa,
pair<It, It> range = sa.equal_range(q);
for (It it = range.first; it != range.second; ++it) {
ContigNode u(it->second);
+ if (opt::ss && u.sense() != v.sense())
+ continue;
if (seen.insert(u).second) {
// Add the longest overlap between two vertices.
unsigned overlap = it->first.size();
@@ -118,7 +127,6 @@ static void addOverlapsSA(Graph& g, const vector<Kmer>& prefixes)
typedef pair<string, ContigNode> Suffix;
typedef vector<Suffix> Suffixes;
Suffixes suffixes;
- SuffixArray sa(opt::minOverlap);
typedef graph_traits<Graph>::vertex_descriptor V;
typedef graph_traits<Graph>::vertex_iterator Vit;
@@ -132,8 +140,12 @@ static void addOverlapsSA(Graph& g, const vector<Kmer>& prefixes)
assert(uci < prefixes.size());
string suffix(reverseComplement(prefixes[uci]).str());
suffixes.push_back(Suffix(suffix, u));
- sa.insert(suffixes.back());
}
+
+ SuffixArray sa(opt::minOverlap);
+ for (Suffixes::const_iterator it = suffixes.begin();
+ it != suffixes.end(); ++it)
+ sa.insert(*it);
sa.construct();
for (Suffixes::const_iterator it = suffixes.begin();
@@ -144,7 +156,8 @@ static void addOverlapsSA(Graph& g, const vector<Kmer>& prefixes)
}
/** An index of suffixes of k-1 bp. */
-typedef unordered_map<Kmer, vector<ContigNode>, hashKmer> SuffixMap;
+typedef unordered_map<Kmer, vector<ContigNode>, hash<Kmer> >
+ SuffixMap;
/** Read contigs. Add contig properties to the graph. Add prefixes to
* the collection and add suffixes to their index.
@@ -261,6 +274,8 @@ int main(int argc, char** argv)
itu = edges.begin(); itu != edges.end(); ++itu) {
V uc = get(vertex_complement, g, *itu);
V vc = get(vertex_complement, g, v);
+ if (opt::ss && uc.sense() != vc.sense())
+ continue;
add_edge(vc, uc, -(int)opt::k + 1, static_cast<DG&>(g));
}
}
diff --git a/AdjList/Makefile.am b/AdjList/Makefile.am
index 7e6e622..e92cb81 100644
--- a/AdjList/Makefile.am
+++ b/AdjList/Makefile.am
@@ -5,7 +5,6 @@ AdjList_CPPFLAGS = -I$(top_srcdir) \
-I$(top_srcdir)/DataLayer
AdjList_LDADD = \
- $(top_builddir)/Graph/libgraph.a \
$(top_builddir)/DataLayer/libdatalayer.a \
$(top_builddir)/Common/libcommon.a
diff --git a/AdjList/Makefile.in b/AdjList/Makefile.in
deleted file mode 100644
index dac3840..0000000
--- a/AdjList/Makefile.in
+++ /dev/null
@@ -1,591 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = AdjList$(EXEEXT)
-subdir = AdjList
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_AdjList_OBJECTS = AdjList-AdjList.$(OBJEXT)
-AdjList_OBJECTS = $(am_AdjList_OBJECTS)
-AdjList_DEPENDENCIES = $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(AdjList_SOURCES)
-DIST_SOURCES = $(AdjList_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-AdjList_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-AdjList_LDADD = \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-AdjList_SOURCES = \
- AdjList.cpp
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign AdjList/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign AdjList/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-AdjList$(EXEEXT): $(AdjList_OBJECTS) $(AdjList_DEPENDENCIES) $(EXTRA_AdjList_DEPENDENCIES)
- @rm -f AdjList$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(AdjList_OBJECTS) $(AdjList_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/AdjList-AdjList.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-AdjList-AdjList.o: AdjList.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AdjList_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT AdjList-AdjList.o -MD -MP -MF $(DEPDIR)/AdjList-AdjList.Tpo -c -o AdjList-AdjList.o `test -f 'AdjList.cpp' || echo '$(srcdir)/'`AdjList.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/AdjList-AdjList.Tpo $(DEPDIR)/AdjList-AdjList.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='AdjList.cpp' object='AdjList-AdjList.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AdjList_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o AdjList-AdjList.o `test -f 'AdjList.cpp' || echo '$(srcdir)/'`AdjList.cpp
-
-AdjList-AdjList.obj: AdjList.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AdjList_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT AdjList-AdjList.obj -MD -MP -MF $(DEPDIR)/AdjList-AdjList.Tpo -c -o AdjList-AdjList.obj `if test -f 'AdjList.cpp'; then $(CYGPATH_W) 'AdjList.cpp'; else $(CYGPATH_W) '$(srcdir)/AdjList.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/AdjList-AdjList.Tpo $(DEPDIR)/AdjList-AdjList.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='AdjList.cpp' object='AdjList-AdjList.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AdjList_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o AdjList-AdjList.obj `if test -f 'AdjList.cpp'; then $(CYGPATH_W) 'AdjList.cpp'; else $(CYGPATH_W) '$(srcdir)/AdjList.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Align/Makefile.in b/Align/Makefile.in
deleted file mode 100644
index 7b8e3cd..0000000
--- a/Align/Makefile.in
+++ /dev/null
@@ -1,750 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = abyss-align$(EXEEXT) abyss-mergepairs$(EXEEXT)
-subdir = Align
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-LIBRARIES = $(noinst_LIBRARIES)
-AR = ar
-ARFLAGS = cru
-AM_V_AR = $(am__v_AR_ at AM_V@)
-am__v_AR_ = $(am__v_AR_ at AM_DEFAULT_V@)
-am__v_AR_0 = @echo " AR " $@;
-am__v_AR_1 =
-libalign_a_AR = $(AR) $(ARFLAGS)
-libalign_a_LIBADD =
-am_libalign_a_OBJECTS = libalign_a-alignGlobal.$(OBJEXT) \
- libalign_a-dialign.$(OBJEXT) \
- libalign_a-dna_diag_prob.$(OBJEXT) \
- libalign_a-smith_waterman.$(OBJEXT)
-libalign_a_OBJECTS = $(am_libalign_a_OBJECTS)
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_abyss_align_OBJECTS = abyss_align-align.$(OBJEXT)
-abyss_align_OBJECTS = $(am_abyss_align_OBJECTS)
-abyss_align_DEPENDENCIES = $(builddir)/libalign.a \
- $(top_builddir)/dialign/libdialign.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-abyss_align_LINK = $(CXXLD) $(abyss_align_CXXFLAGS) $(CXXFLAGS) \
- $(AM_LDFLAGS) $(LDFLAGS) -o $@
-am_abyss_mergepairs_OBJECTS = abyss_mergepairs-mergepairs.$(OBJEXT)
-abyss_mergepairs_OBJECTS = $(am_abyss_mergepairs_OBJECTS)
-abyss_mergepairs_DEPENDENCIES = $(builddir)/libalign.a \
- $(top_builddir)/dialign/libdialign.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-abyss_mergepairs_LINK = $(CXXLD) $(abyss_mergepairs_CXXFLAGS) \
- $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(libalign_a_SOURCES) $(abyss_align_SOURCES) \
- $(abyss_mergepairs_SOURCES)
-DIST_SOURCES = $(libalign_a_SOURCES) $(abyss_align_SOURCES) \
- $(abyss_mergepairs_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-noinst_LIBRARIES = libalign.a
-libalign_a_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
-libalign_a_SOURCES = \
- alignGlobal.cc alignGlobal.h \
- dialign.cpp dialign.h dna_diag_prob.cc \
- smith_waterman.cpp smith_waterman.h Options.h
-
-abyss_align_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-abyss_align_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
-abyss_align_LDADD = $(builddir)/libalign.a \
- $(top_builddir)/dialign/libdialign.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-abyss_align_SOURCES = align.cc
-abyss_mergepairs_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-abyss_mergepairs_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
-abyss_mergepairs_LDADD = $(builddir)/libalign.a \
- $(top_builddir)/dialign/libdialign.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-abyss_mergepairs_SOURCES = mergepairs.cc
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cc .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Align/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Align/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-
-clean-noinstLIBRARIES:
- -test -z "$(noinst_LIBRARIES)" || rm -f $(noinst_LIBRARIES)
-
-libalign.a: $(libalign_a_OBJECTS) $(libalign_a_DEPENDENCIES) $(EXTRA_libalign_a_DEPENDENCIES)
- $(AM_V_at)-rm -f libalign.a
- $(AM_V_AR)$(libalign_a_AR) libalign.a $(libalign_a_OBJECTS) $(libalign_a_LIBADD)
- $(AM_V_at)$(RANLIB) libalign.a
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-abyss-align$(EXEEXT): $(abyss_align_OBJECTS) $(abyss_align_DEPENDENCIES) $(EXTRA_abyss_align_DEPENDENCIES)
- @rm -f abyss-align$(EXEEXT)
- $(AM_V_CXXLD)$(abyss_align_LINK) $(abyss_align_OBJECTS) $(abyss_align_LDADD) $(LIBS)
-
-abyss-mergepairs$(EXEEXT): $(abyss_mergepairs_OBJECTS) $(abyss_mergepairs_DEPENDENCIES) $(EXTRA_abyss_mergepairs_DEPENDENCIES)
- @rm -f abyss-mergepairs$(EXEEXT)
- $(AM_V_CXXLD)$(abyss_mergepairs_LINK) $(abyss_mergepairs_OBJECTS) $(abyss_mergepairs_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_align-align.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_mergepairs-mergepairs.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libalign_a-alignGlobal.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libalign_a-dialign.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libalign_a-dna_diag_prob.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libalign_a-smith_waterman.Po at am__quote@
-
-.cc.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cc.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-libalign_a-alignGlobal.o: alignGlobal.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libalign_a-alignGlobal.o -MD -MP -MF $(DEPDIR)/libalign_a-alignGlobal.Tpo -c -o libalign_a-alignGlobal.o `test -f 'alignGlobal.cc' || echo '$(srcdir)/'`alignGlobal.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libalign_a-alignGlobal.Tpo $(DEPDIR)/libalign_a-alignGlobal.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='alignGlobal.cc' object='libalign_a-alignGlobal.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libalign_a-alignGlobal.o `test -f 'alignGlobal.cc' || echo '$(srcdir)/'`alignGlobal.cc
-
-libalign_a-alignGlobal.obj: alignGlobal.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libalign_a-alignGlobal.obj -MD -MP -MF $(DEPDIR)/libalign_a-alignGlobal.Tpo -c -o libalign_a-alignGlobal.obj `if test -f 'alignGlobal.cc'; then $(CYGPATH_W) 'alignGlobal.cc'; else $(CYGPATH_W) '$(srcdir)/alignGlobal.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libalign_a-alignGlobal.Tpo $(DEPDIR)/libalign_a-alignGlobal.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='alignGlobal.cc' object='libalign_a-alignGlobal.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libalign_a-alignGlobal.obj `if test -f 'alignGlobal.cc'; then $(CYGPATH_W) 'alignGlobal.cc'; else $(CYGPATH_W) '$(srcdir)/alignGlobal.cc'; fi`
-
-libalign_a-dialign.o: dialign.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libalign_a-dialign.o -MD -MP -MF $(DEPDIR)/libalign_a-dialign.Tpo -c -o libalign_a-dialign.o `test -f 'dialign.cpp' || echo '$(srcdir)/'`dialign.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libalign_a-dialign.Tpo $(DEPDIR)/libalign_a-dialign.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='dialign.cpp' object='libalign_a-dialign.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libalign_a-dialign.o `test -f 'dialign.cpp' || echo '$(srcdir)/'`dialign.cpp
-
-libalign_a-dialign.obj: dialign.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libalign_a-dialign.obj -MD -MP -MF $(DEPDIR)/libalign_a-dialign.Tpo -c -o libalign_a-dialign.obj `if test -f 'dialign.cpp'; then $(CYGPATH_W) 'dialign.cpp'; else $(CYGPATH_W) '$(srcdir)/dialign.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libalign_a-dialign.Tpo $(DEPDIR)/libalign_a-dialign.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='dialign.cpp' object='libalign_a-dialign.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libalign_a-dialign.obj `if test -f 'dialign.cpp'; then $(CYGPATH_W) 'dialign.cpp'; else $(CYGPATH_W) '$(srcdir)/dialign.cpp'; fi`
-
-libalign_a-dna_diag_prob.o: dna_diag_prob.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libalign_a-dna_diag_prob.o -MD -MP -MF $(DEPDIR)/libalign_a-dna_diag_prob.Tpo -c -o libalign_a-dna_diag_prob.o `test -f 'dna_diag_prob.cc' || echo '$(srcdir)/'`dna_diag_prob.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libalign_a-dna_diag_prob.Tpo $(DEPDIR)/libalign_a-dna_diag_prob.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='dna_diag_prob.cc' object='libalign_a-dna_diag_prob.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libalign_a-dna_diag_prob.o `test -f 'dna_diag_prob.cc' || echo '$(srcdir)/'`dna_diag_prob.cc
-
-libalign_a-dna_diag_prob.obj: dna_diag_prob.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libalign_a-dna_diag_prob.obj -MD -MP -MF $(DEPDIR)/libalign_a-dna_diag_prob.Tpo -c -o libalign_a-dna_diag_prob.obj `if test -f 'dna_diag_prob.cc'; then $(CYGPATH_W) 'dna_diag_prob.cc'; else $(CYGPATH_W) '$(srcdir)/dna_diag_prob.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libalign_a-dna_diag_prob.Tpo $(DEPDIR)/libalign_a-dna_diag_prob.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='dna_diag_prob.cc' object='libalign_a-dna_diag_prob.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libalign_a-dna_diag_prob.obj `if test -f 'dna_diag_prob.cc'; then $(CYGPATH_W) 'dna_diag_prob.cc'; else $(CYGPATH_W) '$(srcdir)/dna_diag_prob.cc'; fi`
-
-libalign_a-smith_waterman.o: smith_waterman.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libalign_a-smith_waterman.o -MD -MP -MF $(DEPDIR)/libalign_a-smith_waterman.Tpo -c -o libalign_a-smith_waterman.o `test -f 'smith_waterman.cpp' || echo '$(srcdir)/'`smith_waterman.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libalign_a-smith_waterman.Tpo $(DEPDIR)/libalign_a-smith_waterman.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='smith_waterman.cpp' object='libalign_a-smith_waterman.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libalign_a-smith_waterman.o `test -f 'smith_waterman.cpp' || echo '$(srcdir)/'`smith_waterman.cpp
-
-libalign_a-smith_waterman.obj: smith_waterman.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libalign_a-smith_waterman.obj -MD -MP -MF $(DEPDIR)/libalign_a-smith_waterman.Tpo -c -o libalign_a-smith_waterman.obj `if test -f 'smith_waterman.cpp'; then $(CYGPATH_W) 'smith_waterman.cpp'; else $(CYGPATH_W) '$(srcdir)/smith_waterman.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libalign_a-smith_waterman.Tpo $(DEPDIR)/libalign_a-smith_waterman.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='smith_waterman.cpp' object='libalign_a-smith_waterman.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libalign_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libalign_a-smith_waterman.obj `if test -f 'smith_waterman.cpp'; then $(CYGPATH_W) 'smith_waterman.cpp'; else $(CYGPATH_W) '$(srcdir)/smith_waterman.cpp'; fi`
-
-abyss_align-align.o: align.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_align_CPPFLAGS) $(CPPFLAGS) $(abyss_align_CXXFLAGS) $(CXXFLAGS) -MT abyss_align-align.o -MD -MP -MF $(DEPDIR)/abyss_align-align.Tpo -c -o abyss_align-align.o `test -f 'align.cc' || echo '$(srcdir)/'`align.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_align-align.Tpo $(DEPDIR)/abyss_align-align.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='align.cc' object='abyss_align-align.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_align_CPPFLAGS) $(CPPFLAGS) $(abyss_align_CXXFLAGS) $(CXXFLAGS) -c -o abyss_align-align.o `test -f 'align.cc' || echo '$(srcdir)/'`align.cc
-
-abyss_align-align.obj: align.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_align_CPPFLAGS) $(CPPFLAGS) $(abyss_align_CXXFLAGS) $(CXXFLAGS) -MT abyss_align-align.obj -MD -MP -MF $(DEPDIR)/abyss_align-align.Tpo -c -o abyss_align-align.obj `if test -f 'align.cc'; then $(CYGPATH_W) 'align.cc'; else $(CYGPATH_W) '$(srcdir)/align.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_align-align.Tpo $(DEPDIR)/abyss_align-align.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='align.cc' object='abyss_align-align.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_align_CPPFLAGS) $(CPPFLAGS) $(abyss_align_CXXFLAGS) $(CXXFLAGS) -c -o abyss_align-align.obj `if test -f 'align.cc'; then $(CYGPATH_W) 'align.cc'; else $(CYGPATH_W) '$(srcdir)/align.cc'; fi`
-
-abyss_mergepairs-mergepairs.o: mergepairs.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_mergepairs_CPPFLAGS) $(CPPFLAGS) $(abyss_mergepairs_CXXFLAGS) $(CXXFLAGS) -MT abyss_mergepairs-mergepairs.o -MD -MP -MF $(DEPDIR)/abyss_mergepairs-mergepairs.Tpo -c -o abyss_mergepairs-mergepairs.o `test -f 'mergepairs.cc' || echo '$(srcdir)/'`mergepairs.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_mergepairs-mergepairs.Tpo $(DEPDIR)/abyss_mergepairs-mergepairs.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='mergepairs.cc' object='abyss_mergepairs-mergepairs.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_mergepairs_CPPFLAGS) $(CPPFLAGS) $(abyss_mergepairs_CXXFLAGS) $(CXXFLAGS) -c -o abyss_mergepairs-mergepairs.o `test -f 'mergepairs.cc' || echo '$(srcdir)/'`mergepairs.cc
-
-abyss_mergepairs-mergepairs.obj: mergepairs.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_mergepairs_CPPFLAGS) $(CPPFLAGS) $(abyss_mergepairs_CXXFLAGS) $(CXXFLAGS) -MT abyss_mergepairs-mergepairs.obj -MD -MP -MF $(DEPDIR)/abyss_mergepairs-mergepairs.Tpo -c -o abyss_mergepairs-mergepairs.obj `if test -f 'mergepairs.cc'; then $(CYGPATH_W) 'mergepairs.cc'; else $(CYGPATH_W) '$(srcdir)/mergepairs.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_mergepairs-mergepairs.Tpo $(DEPDIR)/abyss_mergepairs-mergepairs.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='mergepairs.cc' object='abyss_mergepairs-mergepairs.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_mergepairs_CPPFLAGS) $(CPPFLAGS) $(abyss_mergepairs_CXXFLAGS) $(CXXFLAGS) -c -o abyss_mergepairs-mergepairs.obj `if test -f 'mergepairs.cc'; then $(CYGPATH_W) 'mergepairs.cc'; else $(CYGPATH_W) '$(srcdir)/mergepairs.cc'; fi`
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(LIBRARIES) $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic clean-noinstLIBRARIES \
- mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic clean-noinstLIBRARIES \
- cscopelist-am ctags ctags-am distclean distclean-compile \
- distclean-generic distclean-tags distdir dvi dvi-am html \
- html-am info info-am install install-am install-binPROGRAMS \
- install-data install-data-am install-dvi install-dvi-am \
- install-exec install-exec-am install-html install-html-am \
- install-info install-info-am install-man install-pdf \
- install-pdf-am install-ps install-ps-am install-strip \
- installcheck installcheck-am installdirs maintainer-clean \
- maintainer-clean-generic mostlyclean mostlyclean-compile \
- mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
- uninstall-am uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Align/align.cc b/Align/align.cc
index faadf81..4c4978b 100644
--- a/Align/align.cc
+++ b/Align/align.cc
@@ -22,7 +22,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... [FASTA]...\n"
diff --git a/Align/alignGlobal.h b/Align/alignGlobal.h
index ef6f259..b348a0c 100644
--- a/Align/alignGlobal.h
+++ b/Align/alignGlobal.h
@@ -3,8 +3,10 @@
#include <cassert>
#include <cctype>
-#include <ostream>
+#include <utility>
+#include <iostream>
#include <string>
+#include <vector>
/** The result of a Needleman-Wunsch alignment. */
struct NWAlignment {
@@ -39,4 +41,52 @@ unsigned alignGlobal(
const std::string& a, const std::string& b,
NWAlignment& align);
+/** Align the specified pair of sequences.
+ * @return the number of matches and size of the consensus
+ */
+static inline std::pair<unsigned, unsigned> alignPair(
+ const std::string& seqa, const std::string& seqb, NWAlignment& align)
+{
+ unsigned matches = alignGlobal(seqa, seqb, align);
+ return std::make_pair(matches, align.size());
+}
+
+/** Align the specified sequences.
+ * @return the number of matches and size of the consensus
+ */
+template <typename Seq>
+static std::pair<unsigned, unsigned> alignMulti(
+ const std::vector<Seq>& seqs, NWAlignment& align)
+{
+ Seq alignment = seqs[0];
+ unsigned matches = 0;
+ for (unsigned j = 0; j < seqs.size() - 1; j++) {
+ matches = std::min(matches, alignGlobal(alignment,
+ seqs[j+1], align));
+ alignment = align.match_align;
+ }
+ return std::make_pair(matches, alignment.size());
+}
+
+/** Align the specified sequences.
+ * @return the number of matches and size of the consensus
+ */
+template <typename Seq>
+static std::pair<unsigned, unsigned> align(
+ const std::vector<Seq>& seqs, NWAlignment& aln)
+{
+ assert(seqs.size() > 1);
+ if (seqs.size() == 2)
+ return alignPair(seqs[0], seqs[1], aln);
+ else
+ return alignMulti(seqs, aln);
+}
+
+template <typename Seq>
+static std::pair<unsigned, unsigned> align(const std::vector<Seq>& seqs)
+{
+ NWAlignment aln;
+ return align(seqs, aln);
+}
+
#endif
diff --git a/Align/mergepairs.cc b/Align/mergepairs.cc
index 52af592..1f104e9 100644
--- a/Align/mergepairs.cc
+++ b/Align/mergepairs.cc
@@ -24,7 +24,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Anthony Raymond.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... READS1 READS2\n"
@@ -72,6 +72,7 @@ static struct {
unsigned total_reads;
unsigned merged_reads;
unsigned unmerged_reads;
+ unsigned unchaste_reads;
unsigned no_alignment;
unsigned too_many_aligns;
unsigned low_matches;
@@ -256,6 +257,8 @@ static void alignFiles(const char* reads1, const char* reads2)
}
}
r2 >> rec2;
+ stats.unchaste_reads = r1.unchaste();
+ stats.total_reads += r1.unchaste();
assert(r1.eof());
assert(r2.eof());
unmerged1.close();
@@ -320,9 +323,10 @@ int main(int argc, char** argv)
alignFiles(reads1, reads2);
- cerr << "Read merging stats: total=" << stats.total_reads
+ cerr << "Pair merging stats: total=" << stats.total_reads
<< " merged=" << stats.merged_reads
- << " unmerged=" << stats.unmerged_reads << '\n'
+ << " unmerged=" << stats.unmerged_reads
+ << " unchaste=" << stats.unchaste_reads << '\n'
<< "no_alignment=" << stats.no_alignment
<< " too_many_aligns=" << stats.too_many_aligns
<< " too_few_matches=" << stats.low_matches
diff --git a/Assembly/AssemblyAlgorithms.cpp b/Assembly/AssemblyAlgorithms.cpp
index bd4bfb2..d50b360 100644
--- a/Assembly/AssemblyAlgorithms.cpp
+++ b/Assembly/AssemblyAlgorithms.cpp
@@ -82,14 +82,18 @@ void loadSequences(ISequenceCollection* seqCollection, string inFile)
}
size_t count = 0, count_good = 0,
- count_small = 0, count_nonACGT = 0;
- FastaReader reader(inFile.c_str(), FastaReader::FOLD_CASE);
+ count_small = 0, count_nonACGT = 0,
+ count_reversed = 0;
+ int fastaFlags = opt::maskCov ? FastaReader::NO_FOLD_CASE :
+ FastaReader::FOLD_CASE;
+ FastaReader reader(inFile.c_str(), fastaFlags);
if (endsWith(inFile, ".jf") || endsWith(inFile, ".jfq")) {
// Load k-mer with coverage data.
count = loadKmer(*seqCollection, reader);
count_good = count;
} else
- for (Sequence seq; reader >> seq;) {
+ for (FastaRecord rec; reader >> rec;) {
+ Sequence seq = rec.seq;
size_t len = seq.length();
if (opt::kmerSize > len) {
count_small++;
@@ -115,11 +119,24 @@ void loadSequences(ISequenceCollection* seqCollection, string inFile)
bool good = seq.find_first_not_of("ACGT0123") == string::npos;
bool discarded = true;
+
+ if (opt::ss && rec.id.size() > 2
+ && rec.id.substr(rec.id.size()-2) == "/1") {
+ seq = reverseComplement(seq);
+ count_reversed++;
+ }
+
for (unsigned i = 0; i < len - opt::kmerSize + 1; i++) {
Sequence kmer(seq, i, opt::kmerSize);
- if (good || kmer.find_first_not_of("ACGT0123")
+ if (good || kmer.find_first_not_of("acgtACGT0123")
== string::npos) {
- seqCollection->add(Kmer(kmer));
+ if (good || kmer.find_first_of("acgt") == string::npos)
+ seqCollection->add(Kmer(kmer));
+ else {
+ transform(kmer.begin(), kmer.end(), kmer.begin(),
+ ::toupper);
+ seqCollection->add(Kmer(kmer), 0);
+ }
discarded = false;
}
}
@@ -139,6 +156,9 @@ void loadSequences(ISequenceCollection* seqCollection, string inFile)
logger(1) << "Read " << count << " reads. ";
seqCollection->printLoad();
+ if (count_reversed > 0)
+ cerr << "`" << inFile << "': "
+ "reversed " << count_reversed << " reads\n";
if (count_small > 0)
cerr << "`" << inFile << "': "
"discarded " << count_small << " reads "
@@ -230,7 +250,7 @@ size_t markAmbiguous(ISequenceCollection* g)
if (++progress % 1000000 == 0)
logger(1) << "Splitting: " << progress << '\n';
- if (it->first.isPalindrome()) {
+ if (!opt::ss && it->first.isPalindrome()) {
countv += 2;
g->mark(it->first);
counte += markNeighbours(g, *it, SENSE);
@@ -238,7 +258,7 @@ size_t markAmbiguous(ISequenceCollection* g)
for (extDirection sense = SENSE;
sense <= ANTISENSE; ++sense) {
if (it->second.getExtension(sense).isAmbiguous()
- || it->first.isPalindrome(sense)) {
+ || (!opt::ss && it->first.isPalindrome(sense))) {
countv++;
g->mark(it->first, sense);
counte += markNeighbours(g, *it, sense);
@@ -737,7 +757,7 @@ bool processLinearExtensionForBranch(BranchRecord& branch,
unsigned maxLength, bool addKmer)
{
/** Stop contig assembly at palindromes. */
- const bool stopAtPalindromes = maxLength == UINT_MAX;
+ const bool stopAtPalindromes = !opt::ss && maxLength == UINT_MAX;
extDirection dir = branch.getDirection();
if (branch.isTooLong(maxLength)) {
@@ -901,7 +921,8 @@ size_t assemble(SequenceCollectionHash* seqCollection,
currSeq, extRec, multiplicity, UINT_MAX);
}
- if (currBranch.isCanonical()) {
+ if ((opt::ss && currBranch.getDirection() == SENSE)
+ || (!opt::ss && currBranch.isCanonical())) {
size_t removed = assembleContig(seqCollection,
fileWriter, currBranch, contigID++);
assembledKmer += currBranch.size();
diff --git a/Assembly/BranchRecord.cpp b/Assembly/BranchRecord.cpp
index 4a7ff4f..1074a1a 100644
--- a/Assembly/BranchRecord.cpp
+++ b/Assembly/BranchRecord.cpp
@@ -10,10 +10,10 @@ int BranchRecord::calculateBranchMultiplicity() const
for (BranchData::const_iterator it = m_data.begin();
it != m_data.end(); ++it) {
int m = it->second.getMultiplicity();
- assert(m > 0);
+ assert(m >= 0);
total += m;
}
- assert(total > 0);
+ assert(total >= 0);
return total;
}
diff --git a/Assembly/ISequenceCollection.h b/Assembly/ISequenceCollection.h
index c40f845..d015203 100644
--- a/Assembly/ISequenceCollection.h
+++ b/Assembly/ISequenceCollection.h
@@ -7,11 +7,12 @@
#if HAVE_GOOGLE_SPARSE_HASH_MAP
# include <google/sparse_hash_map>
-typedef google::sparse_hash_map<Kmer, KmerData,
- hashKmer> SequenceDataHash;
+typedef google::sparse_hash_map<Kmer, KmerData, hash<Kmer> >
+ SequenceDataHash;
#else
# include "UnorderedMap.h"
-typedef unordered_map<Kmer, KmerData, hashKmer> SequenceDataHash;
+typedef unordered_map<Kmer, KmerData, hash<Kmer> >
+ SequenceDataHash;
#endif
/** The interface of a map of Kmer to KmerData. */
diff --git a/Assembly/Makefile.in b/Assembly/Makefile.in
deleted file mode 100644
index 99f0533..0000000
--- a/Assembly/Makefile.in
+++ /dev/null
@@ -1,647 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-subdir = Assembly
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-LIBRARIES = $(noinst_LIBRARIES)
-AR = ar
-ARFLAGS = cru
-AM_V_AR = $(am__v_AR_ at AM_V@)
-am__v_AR_ = $(am__v_AR_ at AM_DEFAULT_V@)
-am__v_AR_0 = @echo " AR " $@;
-am__v_AR_1 =
-libassembly_a_AR = $(AR) $(ARFLAGS)
-libassembly_a_LIBADD =
-am_libassembly_a_OBJECTS = libassembly_a-AssemblyAlgorithms.$(OBJEXT) \
- libassembly_a-BranchGroup.$(OBJEXT) \
- libassembly_a-BranchRecord.$(OBJEXT) \
- libassembly_a-DotWriter.$(OBJEXT) \
- libassembly_a-Options.$(OBJEXT) \
- libassembly_a-SequenceCollection.$(OBJEXT)
-libassembly_a_OBJECTS = $(am_libassembly_a_OBJECTS)
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(libassembly_a_SOURCES)
-DIST_SOURCES = $(libassembly_a_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-noinst_LIBRARIES = libassembly.a
-libassembly_a_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-libassembly_a_SOURCES = \
- AssemblyAlgorithms.cpp AssemblyAlgorithms.h \
- BranchGroup.cpp BranchGroup.h \
- BranchRecord.cpp BranchRecord.h \
- DotWriter.cpp DotWriter.h \
- ISequenceCollection.h \
- KmerData.h \
- Options.cpp Options.h \
- SequenceCollection.cpp SequenceCollection.h
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Assembly/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Assembly/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-
-clean-noinstLIBRARIES:
- -test -z "$(noinst_LIBRARIES)" || rm -f $(noinst_LIBRARIES)
-
-libassembly.a: $(libassembly_a_OBJECTS) $(libassembly_a_DEPENDENCIES) $(EXTRA_libassembly_a_DEPENDENCIES)
- $(AM_V_at)-rm -f libassembly.a
- $(AM_V_AR)$(libassembly_a_AR) libassembly.a $(libassembly_a_OBJECTS) $(libassembly_a_LIBADD)
- $(AM_V_at)$(RANLIB) libassembly.a
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libassembly_a-AssemblyAlgorithms.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libassembly_a-BranchGroup.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libassembly_a-BranchRecord.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libassembly_a-DotWriter.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libassembly_a-Options.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libassembly_a-SequenceCollection.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-libassembly_a-AssemblyAlgorithms.o: AssemblyAlgorithms.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-AssemblyAlgorithms.o -MD -MP -MF $(DEPDIR)/libassembly_a-AssemblyAlgorithms.Tpo -c -o libassembly_a-AssemblyAlgorithms.o `test -f 'AssemblyAlgorithms.cpp' || echo '$(srcdir)/'`AssemblyAlgorithms.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-AssemblyAlgorithms.Tpo $(DEPDIR)/libassembly_a-AssemblyAlgorithms.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='AssemblyAlgorithms.cpp' object='libassembly_a-AssemblyAlgorithms.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-AssemblyAlgorithms.o `test -f 'AssemblyAlgorithms.cpp' || echo '$(srcdir)/'`AssemblyAlgorithms.cpp
-
-libassembly_a-AssemblyAlgorithms.obj: AssemblyAlgorithms.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-AssemblyAlgorithms.obj -MD -MP -MF $(DEPDIR)/libassembly_a-AssemblyAlgorithms.Tpo -c -o libassembly_a-AssemblyAlgorithms.obj `if test -f 'AssemblyAlgorithms.cpp'; then $(CYGPATH_W) 'AssemblyAlgorithms.cpp'; else $(CYGPATH_W) '$(srcdir)/AssemblyAlgorithms.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-AssemblyAlgorithms.Tpo $(DEPDIR)/libassembly_a-AssemblyAlgorithms.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='AssemblyAlgorithms.cpp' object='libassembly_a-AssemblyAlgorithms.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-AssemblyAlgorithms.obj `if test -f 'AssemblyAlgorithms.cpp'; then $(CYGPATH_W) 'AssemblyAlgorithms.cpp'; else $(CYGPATH_W) '$(srcdir)/AssemblyAlgorithms.cpp'; fi`
-
-libassembly_a-BranchGroup.o: BranchGroup.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-BranchGroup.o -MD -MP -MF $(DEPDIR)/libassembly_a-BranchGroup.Tpo -c -o libassembly_a-BranchGroup.o `test -f 'BranchGroup.cpp' || echo '$(srcdir)/'`BranchGroup.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-BranchGroup.Tpo $(DEPDIR)/libassembly_a-BranchGroup.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='BranchGroup.cpp' object='libassembly_a-BranchGroup.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-BranchGroup.o `test -f 'BranchGroup.cpp' || echo '$(srcdir)/'`BranchGroup.cpp
-
-libassembly_a-BranchGroup.obj: BranchGroup.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-BranchGroup.obj -MD -MP -MF $(DEPDIR)/libassembly_a-BranchGroup.Tpo -c -o libassembly_a-BranchGroup.obj `if test -f 'BranchGroup.cpp'; then $(CYGPATH_W) 'BranchGroup.cpp'; else $(CYGPATH_W) '$(srcdir)/BranchGroup.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-BranchGroup.Tpo $(DEPDIR)/libassembly_a-BranchGroup.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='BranchGroup.cpp' object='libassembly_a-BranchGroup.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-BranchGroup.obj `if test -f 'BranchGroup.cpp'; then $(CYGPATH_W) 'BranchGroup.cpp'; else $(CYGPATH_W) '$(srcdir)/BranchGroup.cpp'; fi`
-
-libassembly_a-BranchRecord.o: BranchRecord.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-BranchRecord.o -MD -MP -MF $(DEPDIR)/libassembly_a-BranchRecord.Tpo -c -o libassembly_a-BranchRecord.o `test -f 'BranchRecord.cpp' || echo '$(srcdir)/'`BranchRecord.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-BranchRecord.Tpo $(DEPDIR)/libassembly_a-BranchRecord.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='BranchRecord.cpp' object='libassembly_a-BranchRecord.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-BranchRecord.o `test -f 'BranchRecord.cpp' || echo '$(srcdir)/'`BranchRecord.cpp
-
-libassembly_a-BranchRecord.obj: BranchRecord.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-BranchRecord.obj -MD -MP -MF $(DEPDIR)/libassembly_a-BranchRecord.Tpo -c -o libassembly_a-BranchRecord.obj `if test -f 'BranchRecord.cpp'; then $(CYGPATH_W) 'BranchRecord.cpp'; else $(CYGPATH_W) '$(srcdir)/BranchRecord.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-BranchRecord.Tpo $(DEPDIR)/libassembly_a-BranchRecord.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='BranchRecord.cpp' object='libassembly_a-BranchRecord.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-BranchRecord.obj `if test -f 'BranchRecord.cpp'; then $(CYGPATH_W) 'BranchRecord.cpp'; else $(CYGPATH_W) '$(srcdir)/BranchRecord.cpp'; fi`
-
-libassembly_a-DotWriter.o: DotWriter.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-DotWriter.o -MD -MP -MF $(DEPDIR)/libassembly_a-DotWriter.Tpo -c -o libassembly_a-DotWriter.o `test -f 'DotWriter.cpp' || echo '$(srcdir)/'`DotWriter.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-DotWriter.Tpo $(DEPDIR)/libassembly_a-DotWriter.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='DotWriter.cpp' object='libassembly_a-DotWriter.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-DotWriter.o `test -f 'DotWriter.cpp' || echo '$(srcdir)/'`DotWriter.cpp
-
-libassembly_a-DotWriter.obj: DotWriter.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-DotWriter.obj -MD -MP -MF $(DEPDIR)/libassembly_a-DotWriter.Tpo -c -o libassembly_a-DotWriter.obj `if test -f 'DotWriter.cpp'; then $(CYGPATH_W) 'DotWriter.cpp'; else $(CYGPATH_W) '$(srcdir)/DotWriter.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-DotWriter.Tpo $(DEPDIR)/libassembly_a-DotWriter.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='DotWriter.cpp' object='libassembly_a-DotWriter.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-DotWriter.obj `if test -f 'DotWriter.cpp'; then $(CYGPATH_W) 'DotWriter.cpp'; else $(CYGPATH_W) '$(srcdir)/DotWriter.cpp'; fi`
-
-libassembly_a-Options.o: Options.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-Options.o -MD -MP -MF $(DEPDIR)/libassembly_a-Options.Tpo -c -o libassembly_a-Options.o `test -f 'Options.cpp' || echo '$(srcdir)/'`Options.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-Options.Tpo $(DEPDIR)/libassembly_a-Options.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Options.cpp' object='libassembly_a-Options.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-Options.o `test -f 'Options.cpp' || echo '$(srcdir)/'`Options.cpp
-
-libassembly_a-Options.obj: Options.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-Options.obj -MD -MP -MF $(DEPDIR)/libassembly_a-Options.Tpo -c -o libassembly_a-Options.obj `if test -f 'Options.cpp'; then $(CYGPATH_W) 'Options.cpp'; else $(CYGPATH_W) '$(srcdir)/Options.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-Options.Tpo $(DEPDIR)/libassembly_a-Options.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Options.cpp' object='libassembly_a-Options.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-Options.obj `if test -f 'Options.cpp'; then $(CYGPATH_W) 'Options.cpp'; else $(CYGPATH_W) '$(srcdir)/Options.cpp'; fi`
-
-libassembly_a-SequenceCollection.o: SequenceCollection.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-SequenceCollection.o -MD -MP -MF $(DEPDIR)/libassembly_a-SequenceCollection.Tpo -c -o libassembly_a-SequenceCollection.o `test -f 'SequenceCollection.cpp' || echo '$(srcdir)/'`SequenceCollection.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-SequenceCollection.Tpo $(DEPDIR)/libassembly_a-SequenceCollection.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='SequenceCollection.cpp' object='libassembly_a-SequenceCollection.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-SequenceCollection.o `test -f 'SequenceCollection.cpp' || echo '$(srcdir)/'`SequenceCollection.cpp
-
-libassembly_a-SequenceCollection.obj: SequenceCollection.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libassembly_a-SequenceCollection.obj -MD -MP -MF $(DEPDIR)/libassembly_a-SequenceCollection.Tpo -c -o libassembly_a-SequenceCollection.obj `if test -f 'SequenceCollection.cpp'; then $(CYGPATH_W) 'SequenceCollection.cpp'; else $(CYGPATH_W) '$(srcdir)/SequenceCollection.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libassembly_a-SequenceCollection.Tpo $(DEPDIR)/libassembly_a-SequenceCollection.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='SequenceCollection.cpp' object='libassembly_a-SequenceCollection.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libassembly_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libassembly_a-SequenceCollection.obj `if test -f 'SequenceCollection.cpp'; then $(CYGPATH_W) 'SequenceCollection.cpp'; else $(CYGPATH_W) '$(srcdir)/SequenceCollection.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(LIBRARIES)
-installdirs:
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-generic clean-noinstLIBRARIES mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am:
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am:
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean clean-generic \
- clean-noinstLIBRARIES cscopelist-am ctags ctags-am distclean \
- distclean-compile distclean-generic distclean-tags distdir dvi \
- dvi-am html html-am info info-am install install-am \
- install-data install-data-am install-dvi install-dvi-am \
- install-exec install-exec-am install-html install-html-am \
- install-info install-info-am install-man install-pdf \
- install-pdf-am install-ps install-ps-am install-strip \
- installcheck installcheck-am installdirs maintainer-clean \
- maintainer-clean-generic mostlyclean mostlyclean-compile \
- mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
- uninstall-am
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Assembly/Options.cpp b/Assembly/Options.cpp
index 184e3be..8cbb455 100644
--- a/Assembly/Options.cpp
+++ b/Assembly/Options.cpp
@@ -20,12 +20,12 @@ namespace opt {
static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
-"Written by Jared Simpson and Shaun Jackman.\n"
+"Written by Jared Simpson, Shaun Jackman and Anthony Raymond.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... FILE...\n"
+"Usage: " PROGRAM " -k<kmer> -o<output.fa> [OPTION]... FILE...\n"
"Assemble the input files, FILE, which may be in FASTA, FASTQ,\n"
"qseq, export, SAM or BAM format and compressed with gz, bz2 or xz.\n"
"\n"
@@ -39,10 +39,13 @@ static const char USAGE_MESSAGE[] =
" reads\n"
" -q, --trim-quality=N trim bases from the ends of reads whose\n"
" quality is less than the threshold\n"
+" -Q, --mask-quality=N mask all low quality bases as `N'\n"
" --standard-quality zero quality is `!' (33)\n"
" default for FASTQ and SAM files\n"
" --illumina-quality zero quality is `@' (64)\n"
" default for qseq and export files\n"
+" --SS assemble in strand-specific mode\n"
+" --no-SS do not assemble in strand-specific mode\n"
" -o, --out=FILE write the contigs to FILE\n"
" -k, --kmer=N k-mer size\n"
" -t, --trim-length=N maximum length of dangling edges to trim\n"
@@ -56,12 +59,17 @@ static const char USAGE_MESSAGE[] =
" with coverage less than this threshold on\n"
" either strand\n"
" --coverage-hist=FILE write the k-mer coverage histogram to FILE\n"
-" -g, --graph=FILE generate a graph in dot format\n"
+" -m, --mask-cov do not include kmers containing masked bases in\n"
+" coverage calculations [experimental]\n"
" -s, --snp=FILE record popped bubbles in FILE\n"
" -v, --verbose display verbose output\n"
" --help display this help and exit\n"
" --version output version information and exit\n"
"\n"
+" ABYSS Options: (won't work with ABYSS-P)\n"
+"\n"
+" -g, --graph=FILE generate a graph in dot format\n"
+"\n"
"Report bugs to <" PACKAGE_BUGREPORT ">.\n";
/** k-mer length */
@@ -88,6 +96,15 @@ float coverage = -1;
/** Pop bubbles shorter than N bp. */
int bubbleLen = -1;
+/** Whether to run a strand-specific assembly. */
+int ss = 0;
+
+/**
+ * do not include kmers containing masked bases in
+ * coverage calculations (experimental)
+ */
+bool maskCov = false;
+
/** coverage histogram path */
string coverageHistPath;
@@ -108,7 +125,7 @@ string snpPath;
/** input FASTA files */
vector<string> inFiles;
-static const char shortopts[] = "b:c:e:E:g:k:o:q:s:t:v";
+static const char shortopts[] = "b:c:e:E:g:k:mo:Q:q:s:t:v";
enum { OPT_HELP = 1, OPT_VERSION, COVERAGE_HIST };
@@ -123,6 +140,8 @@ static const struct option longopts[] = {
{ "trim-quality", required_argument, NULL, 'q' },
{ "standard-quality", no_argument, &opt::qualityOffset, 33 },
{ "illumina-quality", no_argument, &opt::qualityOffset, 64 },
+ { "SS", no_argument, &opt::ss, 1 },
+ { "no-SS", no_argument, &opt::ss, 0 },
{ "coverage", required_argument, NULL, 'c' },
{ "coverage-hist", required_argument, NULL, COVERAGE_HIST },
{ "bubble-length", required_argument, NULL, 'b' },
@@ -130,6 +149,7 @@ static const struct option longopts[] = {
{ "erode", required_argument, NULL, 'e' },
{ "erode-strand", required_argument, NULL, 'E' },
{ "no-erode", no_argument, (int*)&erode, 0 },
+ { "mask-cov", no_argument, NULL, 'm' },
{ "graph", required_argument, NULL, 'g' },
{ "snp", required_argument, NULL, 's' },
{ "verbose", no_argument, NULL, 'v' },
@@ -184,6 +204,9 @@ void parse(int argc, char* const* argv)
case COVERAGE_HIST:
getline(arg, coverageHistPath);
break;
+ case 'm':
+ maskCov = true;
+ break;
case 'o':
getline(arg, contigsPath);
break;
@@ -202,6 +225,9 @@ void parse(int argc, char* const* argv)
case 'q':
arg >> opt::qualityThreshold;
break;
+ case 'Q':
+ arg >> opt::internalQThreshold;
+ break;
case 's':
getline(arg, snpPath);
break;
@@ -240,6 +266,7 @@ void parse(int argc, char* const* argv)
}
assert(opt::qualityThreshold <= 40);
+ assert(opt::internalQThreshold <= 40);
if (opt::rank <= 0
&& opt::coverage >= 0 && opt::erode == (unsigned)-1)
diff --git a/Assembly/Options.h b/Assembly/Options.h
index 3e25b4d..db40a1b 100644
--- a/Assembly/Options.h
+++ b/Assembly/Options.h
@@ -14,6 +14,8 @@ namespace opt {
extern unsigned trimLen;
extern float coverage;
extern unsigned bubbleLen;
+ extern unsigned ss;
+ extern bool maskCov;
extern std::string coverageHistPath;
extern std::string contigsPath;
extern std::string contigsTempPath;
diff --git a/Assembly/SequenceCollection.cpp b/Assembly/SequenceCollection.cpp
index b092c7c..7c2311f 100644
--- a/Assembly/SequenceCollection.cpp
+++ b/Assembly/SequenceCollection.cpp
@@ -2,6 +2,7 @@
#include "SequenceCollection.h"
#include "Log.h"
#include "Common/Options.h"
+#include "Assembly/Options.h"
#include "MemoryUtil.h"
#include "StringUtil.h" // for toSI
#include "Timer.h"
@@ -35,24 +36,45 @@ SequenceCollectionHash::SequenceCollectionHash()
#endif
}
+/** sparse_hash_set requires that set_deleted_key()
+ * is called before calling erase(). This key cannot
+ * be an existing kmer in m_data. This function sets
+ * the deleted key and should be called after all
+ * data has been loaded.
+ */
+void SequenceCollectionHash::setDeletedKey()
+{
+#if HAVE_GOOGLE_SPARSE_HASH_MAP
+ for (SequenceDataHash::iterator it = m_data.begin();
+ it != m_data.end(); it++) {
+ Kmer rc(reverseComplement(it->first));
+ bool isrc;
+ SequenceDataHash::iterator search = find(rc, isrc);
+ // If this is false, we should have a palindrome or we're
+ // doing a SS assembly.
+ if (isrc || search == m_data.end()) {
+ m_data.set_deleted_key(rc);
+ return;
+ }
+ }
+ logger(1) << "error: unable to set deleted key.\n";
+ exit(EXIT_FAILURE);
+#else
+ return;
+#endif
+}
+
/** Add the specified k-mer to this collection. */
void SequenceCollectionHash::add(const Kmer& seq, unsigned coverage)
{
bool rc;
SequenceCollectionHash::iterator it = find(seq, rc);
if (it == m_data.end()) {
-#if HAVE_GOOGLE_SPARSE_HASH_MAP
- if (m_data.empty()) {
- /* sparse_hash_set requires that set_deleted_key()
- * is called before calling erase(). */
- Kmer rc(reverseComplement(seq));
- assert(rc != seq);
- m_data.set_deleted_key(rc);
- }
-#endif
m_data.insert(make_pair(seq, KmerData(SENSE, coverage)));
- } else
+ } else if (coverage > 0) {
+ assert(!rc || !opt::ss);
it->second.addMultiplicity(rc ? ANTISENSE : SENSE, coverage);
+ }
}
/** Clean up by erasing sequences flagged as deleted.
@@ -89,11 +111,16 @@ bool SequenceCollectionHash::setBaseExtension(
SequenceCollectionHash::iterator it = find(kmer, rc);
if (it == m_data.end())
return false;
- bool palindrome = kmer.isPalindrome();
- if (!rc || palindrome)
+ if (opt::ss) {
+ assert(!rc);
it->second.setBaseExtension(dir, base);
- if (rc || palindrome)
- it->second.setBaseExtension(!dir, complementBaseCode(base));
+ } else {
+ bool palindrome = kmer.isPalindrome();
+ if (!rc || palindrome)
+ it->second.setBaseExtension(dir, base);
+ if (rc || palindrome)
+ it->second.setBaseExtension(!dir, complementBaseCode(base));
+ }
return true;
}
@@ -104,11 +131,16 @@ void SequenceCollectionHash::removeExtension(const Kmer& kmer,
bool rc;
SequenceCollectionHash::iterator it = find(kmer, rc);
assert(it != m_data.end());
- bool palindrome = kmer.isPalindrome();
- if (!rc || palindrome)
+ if (opt::ss) {
+ assert(!rc);
it->second.removeExtension(dir, ext);
- if (rc || palindrome)
- it->second.removeExtension(!dir, ~ext);
+ } else {
+ bool palindrome = kmer.isPalindrome();
+ if (!rc || palindrome)
+ it->second.removeExtension(dir, ext);
+ if (rc || palindrome)
+ it->second.removeExtension(!dir, ~ext);
+ }
notify(*it);
}
@@ -144,7 +176,7 @@ SequenceCollectionHash::iterator SequenceCollectionHash::find(
const Kmer& key, bool& rc)
{
SequenceCollectionHash::iterator it = find(key);
- if (it != m_data.end()) {
+ if (opt::ss || it != m_data.end()) {
rc = false;
return it;
} else {
@@ -160,7 +192,7 @@ SequenceCollectionHash::const_iterator SequenceCollectionHash::find(
const Kmer& key, bool& rc) const
{
SequenceCollectionHash::const_iterator it = find(key);
- if (it != m_data.end()) {
+ if (opt::ss || it != m_data.end()) {
rc = false;
return it;
} else {
@@ -190,6 +222,7 @@ bool SequenceCollectionHash::getSeqData(const Kmer& key,
{
bool rc;
SequenceCollectionHash::const_iterator it = find(key, rc);
+ assert(!rc || !opt::ss);
if (it == m_data.end())
return false;
const KmerData data = it->second;
diff --git a/Assembly/SequenceCollection.h b/Assembly/SequenceCollection.h
index 3373c6b..d83d20e 100644
--- a/Assembly/SequenceCollection.h
+++ b/Assembly/SequenceCollection.h
@@ -101,6 +101,7 @@ class SequenceCollectionHash : public ISequenceCollection
void store(const char* path);
bool isAdjacencyLoaded() const { return m_adjacencyLoaded; }
void setColourSpace(bool flag);
+ void setDeletedKey();
private:
iterator find(const Kmer& key) { return m_data.find(key); }
diff --git a/Bloom/Bloom.h b/Bloom/Bloom.h
new file mode 100644
index 0000000..4fd018b
--- /dev/null
+++ b/Bloom/Bloom.h
@@ -0,0 +1,324 @@
+/*
+ * Bloom.h
+ *
+ * This class was created when we removed the virtual class
+ * BloomFilterBase.
+ *
+ * It contains a mix of components from BloomFilterBase as well as
+ * additional functions and properties shared between Bloom Filter
+ * classes.
+ *
+ * Contains useful algorithms for bloom filter calculations
+ *
+ * Created on: May 28, 2014
+ * Author: cjustin
+ */
+
+#ifndef BLOOM_H_
+#define BLOOM_H_
+
+#include "Common/Kmer.h"
+#include "Common/HashFunction.h"
+#include "Common/Uncompress.h"
+#include "Common/IOUtil.h"
+#include "DataLayer/FastaReader.h"
+#include <iostream>
+
+#if _OPENMP
+# include <omp.h>
+#endif
+
+namespace Bloom {
+
+ typedef Kmer key_type;
+
+ /** Header section of serialized bloom filters. */
+ struct FileHeader {
+ unsigned bloomVersion;
+ unsigned k;
+ size_t fullBloomSize;
+ size_t startBitPos;
+ size_t endBitPos;
+ };
+
+ /**
+ * Number of seqs to read in during each iteration of an
+ * OpenMP bloom filter loading task
+ */
+ static const unsigned LOAD_CHUNK_SIZE = 1000;
+ /** Print a progress message after loading this many seqs */
+ static const unsigned LOAD_PROGRESS_STEP = 100000;
+ /** file format version number */
+ static const unsigned BLOOM_VERSION = 2;
+ /** I/O buffer size when reading/writing bloom filter files */
+ static const unsigned long IO_BUFFER_SIZE = 32*1024;
+
+ /**
+ * How to treat existing bits in the bloom filter when
+ * reading in new data.
+ */
+ enum LoadType {
+ LOAD_OVERWRITE,
+ LOAD_UNION,
+ LOAD_INTERSECT
+ };
+
+ /** Return the hash value of this object. */
+ inline static size_t hash(const key_type& key)
+ {
+ if (key.isCanonical())
+ return hashmem(&key, sizeof key);
+
+ key_type copy(key);
+ copy.reverseComplement();
+ return hashmem(©, sizeof copy);
+ }
+
+ /** Return the hash value of this object given seed. */
+ inline static size_t hash(const key_type& key, size_t seed)
+ {
+ if (key.isCanonical())
+ return hashmem(&key, sizeof key, seed);
+
+ key_type copy(key);
+ copy.reverseComplement();
+ return hashmem(©, sizeof copy, seed);
+ }
+
+ template <typename BF>
+ inline static void loadSeq(BF& bloomFilter, unsigned k, const std::string& seq);
+
+ /** Load a sequence file into a bloom filter */
+ template <typename BF>
+ inline static void loadFile(BF& bloomFilter, unsigned k, const std::string& path,
+ bool verbose = false)
+ {
+ assert(!path.empty());
+ if (verbose)
+ std::cerr << "Reading `" << path << "'...\n";
+ FastaReader in(path.c_str(), FastaReader::FOLD_CASE);
+ uint64_t count = 0;
+ const size_t CHUNK_SIZE = 1000;
+#pragma omp parallel
+ for (std::string seq[CHUNK_SIZE];;) {
+ bool good = true;
+ size_t i = 0;
+#pragma omp critical(in)
+ for (; good && i < CHUNK_SIZE; i++)
+ good = in >> seq[i];
+ if (!good)
+ i--;
+ if (i == 0)
+ break;
+ for (size_t j = 0; j < i; j++) {
+ loadSeq(bloomFilter, k, seq[j]);
+ if (verbose)
+#pragma omp critical(cerr)
+ {
+ count++;
+ if (count % LOAD_PROGRESS_STEP == 0)
+ std::cerr << "Loaded " << count << " reads into bloom filter\n";
+ }
+ }
+ }
+ assert(in.eof());
+ if (verbose) {
+ std::cerr << "Loaded " << count << " reads from `"
+ << path << "` into bloom filter\n";
+ }
+ }
+
+ /** Load a sequence (string) into a bloom filter */
+ template <typename BF>
+ inline static void loadSeq(BF& bloomFilter, unsigned k, const std::string& seq)
+ {
+ if (seq.size() < k)
+ return;
+ for (size_t i = 0; i < seq.size() - k + 1; ++i) {
+ std::string kmer = seq.substr(i, k);
+ size_t pos = kmer.find_last_not_of("ACGTacgt");
+ if (pos == std::string::npos) {
+ bloomFilter.insert(Kmer(kmer));
+ } else
+ i += pos;
+ }
+ }
+
+ /** Write a bloom filter to a stream */
+ template <typename BF>
+ static void write(const BF& bloomFilter, size_t fullBloomSize,
+ size_t startBitPos, size_t endBitPos, std::ostream& out)
+ {
+
+ // file header
+
+ out << BLOOM_VERSION << '\n';
+ assert(out);
+ out << Kmer::length() << '\n';
+ assert(out);
+ out << fullBloomSize
+ << '\t' << startBitPos
+ << '\t' << endBitPos
+ << '\n';
+ assert(out);
+
+ // bloom filter bits
+
+ size_t bits = endBitPos - startBitPos + 1;
+ size_t bytes = (bits + 7) / 8;
+ char buf[IO_BUFFER_SIZE];
+ for (size_t i = 0, j = 0; i < bytes;) {
+ size_t writeSize = std::min(IO_BUFFER_SIZE, bytes - i);
+ for (size_t k = 0; k < writeSize; k++) {
+ buf[k] = 0;
+ for (unsigned l = 0; l < 8; l++, j++) {
+ buf[k] <<= 1;
+ if (j < bits && bloomFilter[j]) {
+ buf[k] |= 1;
+ }
+ }
+ }
+ out.write(buf, writeSize);
+ assert(out);
+ i += writeSize;
+ }
+ }
+
+ /** Write a bloom filter to a stream */
+ template <typename BF>
+ static void write(const BF& bloomFilter, std::ostream& out)
+ {
+ Bloom::write(bloomFilter, bloomFilter.size(), 0,
+ bloomFilter.size() - 1, out);
+ }
+
+ FileHeader readHeader(std::istream& in)
+ {
+ FileHeader header;
+
+ // read bloom filter file format version
+
+ in >> header.bloomVersion >> expect("\n");
+ assert(in);
+ if (header.bloomVersion != BLOOM_VERSION) {
+ std::cerr << "error: bloom filter version (`"
+ << header.bloomVersion << "'), does not match version required "
+ "by this program (`" << BLOOM_VERSION << "').\n";
+ exit(EXIT_FAILURE);
+ }
+
+ // read bloom filter k value
+
+ in >> header.k >> expect("\n");
+ assert(in);
+ if (header.k != Kmer::length()) {
+ std::cerr << "error: this program must be run with the same kmer "
+ "size as the bloom filter being loaded (k="
+ << header.k << ").\n";
+ exit(EXIT_FAILURE);
+ }
+
+ // read bloom filter dimensions
+
+ in >> header.fullBloomSize
+ >> expect("\t") >> header.startBitPos
+ >> expect("\t") >> header.endBitPos
+ >> expect("\n");
+
+ assert(in);
+ assert(header.startBitPos < header.fullBloomSize);
+ assert(header.endBitPos < header.fullBloomSize);
+ assert(header.startBitPos <= header.endBitPos);
+
+ return header;
+ }
+
+ /** Read the bloom filter bit array from a stream */
+ template <typename BF>
+ static void readData(BF& bloomFilter, const Bloom::FileHeader& header,
+ std::istream& in, LoadType loadType = LOAD_OVERWRITE,
+ unsigned shrinkFactor = 1)
+ {
+
+ // shrink factor allows building a smaller
+ // bloom filter from a larger one
+
+ size_t size = header.fullBloomSize;
+
+ if (size % shrinkFactor != 0) {
+ std::cerr << "error: the number of bits in the original bloom "
+ "filter must be evenly divisible by the shrink factor (`"
+ << shrinkFactor << "')\n";
+ exit(EXIT_FAILURE);
+ }
+
+ size /= shrinkFactor;
+
+ if((loadType == LOAD_UNION || loadType == LOAD_INTERSECT)
+ && size != bloomFilter.size()) {
+ std::cerr << "error: can't union/intersect two bloom filters "
+ "with different sizes.\n";
+ exit(EXIT_FAILURE);
+ } else {
+ bloomFilter.resize(size);
+ }
+
+ // read bit vector
+
+ if (loadType == LOAD_OVERWRITE)
+ bloomFilter.reset();
+
+ size_t offset = header.startBitPos;
+ size_t bits = header.endBitPos - header.startBitPos + 1;
+ size_t bytes = (bits + 7) / 8;
+
+ char buf[IO_BUFFER_SIZE];
+ for (size_t i = 0, j = offset; i < bytes; ) {
+ size_t readSize = std::min(IO_BUFFER_SIZE, bytes - i);
+ in.read(buf, readSize);
+ assert(in);
+ for (size_t k = 0; k < readSize; k++) {
+ for (unsigned l = 0; l < 8 && j < offset + bits; l++, j++) {
+ bool bit = buf[k] & (1 << (7 - l));
+ size_t index = j % size;
+ switch (loadType)
+ {
+ case LOAD_OVERWRITE:
+ case LOAD_UNION:
+ bloomFilter[index] |= bit;
+ break;
+ case LOAD_INTERSECT:
+ bloomFilter[index] &= bit;
+ break;
+ }
+ }
+ }
+ i += readSize;
+ }
+
+ }
+
+ /** Read a bloom filter from a stream */
+ template <typename BF>
+ static void read(BF& bloomFilter, std::istream& in,
+ LoadType loadType = LOAD_OVERWRITE,
+ unsigned shrinkFactor = 1)
+ {
+ FileHeader header = readHeader(in);
+ readData(bloomFilter, header, in, loadType, shrinkFactor);
+ }
+
+ //TODO: Bloom filter calculation methods
+ //static double calcApproxFPR(size_t numBucket, size_t numEntr,
+ // unsigned numHash) const;
+ //static double calcRedunancyFPR(size_t numBucket, size_t numEntr,
+ // unsigned numHash) const;
+ //static size_t calcOptimalSize(size_t numEle, double fpr) const;
+ //static size_t calcOptimalSize(size_t numEle, double fpr,
+ // unsigned numHash) const;
+ //static unsigned calcOptimalNumHash(double fpr);
+ //static unsigned calcOptimalNumHash(size_t numBucket, size_t numEle);
+
+};
+
+#endif /* BLOOM_H_ */
diff --git a/Bloom/BloomFilter.h b/Bloom/BloomFilter.h
new file mode 100644
index 0000000..42b8a07
--- /dev/null
+++ b/Bloom/BloomFilter.h
@@ -0,0 +1,100 @@
+/**
+ * A Bloom filter
+ * Copyright 2013 Shaun Jackman
+ */
+#ifndef BLOOMFILTER_H
+#define BLOOMFILTER_H 1
+
+#include "Bloom/Bloom.h"
+#include "Common/Kmer.h"
+#include "Common/IOUtil.h"
+#include <algorithm>
+#include <vector>
+#include <iostream>
+#include <boost/dynamic_bitset.hpp>
+
+/** A Bloom filter. */
+class BloomFilter
+{
+ public:
+
+ /** Constructor. */
+ BloomFilter() { }
+
+ /** Constructor. */
+ BloomFilter(size_t n) : m_array(n) { }
+
+ /** Return the size of the bit array. */
+ size_t size() const { return m_array.size(); }
+
+ /** Return the population count, i.e. the number of set bits. */
+ size_t popcount() const
+ {
+ return m_array.count();
+ }
+
+ /** Return the estimated false positive rate */
+ double FPR() const
+ {
+ return (double)popcount() / size();
+ }
+
+ /** Return whether the specified bit is set. */
+ bool operator[](size_t i) const
+ {
+ assert(i < m_array.size());
+ return m_array[i];
+ }
+
+ /** Return whether the object is present in this set. */
+ bool operator[](const Bloom::key_type& key) const
+ {
+ return m_array[Bloom::hash(key) % m_array.size()];
+ }
+
+ /** Add the object with the specified index to this set. */
+ void insert(size_t index)
+ {
+ assert(index < m_array.size());
+ m_array[index] = true;
+ }
+
+ /** Add the object to this set. */
+ void insert(const Bloom::key_type& key)
+ {
+ m_array[Bloom::hash(key) % m_array.size()] = true;
+ }
+
+ /** Operator for reading a bloom filter from a stream. */
+ friend std::istream& operator>>(std::istream& in, BloomFilter& o)
+ {
+ o.read(in, Bloom::LOAD_OVERWRITE);
+ return in;
+ }
+
+ /** Operator for writing the bloom filter to a stream. */
+ friend std::ostream& operator<<(std::ostream& out, const BloomFilter& o)
+ {
+ o.write(out);
+ return out;
+ }
+
+ /** Read a bloom filter from a stream. */
+ void read(std::istream& in, Bloom::LoadType loadType = Bloom::LOAD_OVERWRITE,
+ unsigned shrinkFactor = 1)
+ {
+ Bloom::read(m_array, in, loadType, shrinkFactor);
+ }
+
+ /** Write a bloom filter to a stream. */
+ void write(std::ostream& out) const
+ {
+ Bloom::write(m_array, out);
+ }
+
+ protected:
+
+ boost::dynamic_bitset<> m_array;
+};
+
+#endif
diff --git a/Bloom/BloomFilterWindow.h b/Bloom/BloomFilterWindow.h
new file mode 100644
index 0000000..723be88
--- /dev/null
+++ b/Bloom/BloomFilterWindow.h
@@ -0,0 +1,157 @@
+#ifndef BLOOMFILTERWINDOW_H
+#define BLOOMFILTERWINDOW_H 1
+
+#include "Bloom.h"
+#include "BloomFilter.h"
+#include "Common/HashFunction.h"
+#include "Common/Kmer.h"
+#include "Common/IOUtil.h"
+#include <algorithm>
+#include <vector>
+#include <iostream>
+
+/**
+ * A bloom filter that represents a window
+ * within a larger bloom filter.
+ */
+class BloomFilterWindow : public BloomFilter
+{
+public:
+
+ /** Constructor. */
+ BloomFilterWindow() : BloomFilter() { };
+
+ /** Constructor.
+ *
+ * @param fullBloomSize size in bits of the containing bloom filter
+ * @param startBitPos index of first bit in the window
+ * @param endBitPos index of last bit in the window
+ */
+ BloomFilterWindow(size_t fullBloomSize, size_t startBitPos, size_t endBitPos) :
+ BloomFilter(endBitPos - startBitPos + 1),
+ m_fullBloomSize(fullBloomSize),
+ m_startBitPos(startBitPos),
+ m_endBitPos(endBitPos)
+ {
+ assert(startBitPos < fullBloomSize);
+ assert(endBitPos < fullBloomSize);
+ assert(startBitPos <= endBitPos);
+ }
+
+ /**
+ * Get the full size (in bits) of the bloom filter that
+ * this window is a part of.
+ */
+ size_t fullBloomSize()
+ {
+ return m_fullBloomSize;
+ }
+
+ /** Get the start bit position for the window. */
+ size_t startBitPos()
+ {
+ return m_startBitPos;
+ }
+
+ /** Get the end bit position for the window. */
+ size_t endBitPos()
+ {
+ return m_endBitPos;
+ }
+
+ /** Return the size of the bit array. */
+ size_t size() const
+ {
+ return BloomFilter::size();
+ }
+
+ /** Return the number of elements with count >= MAX_COUNT. */
+ size_t popcount() const
+ {
+ return BloomFilter::popcount();
+ }
+
+ /** Return the estimated false positive rate */
+ double FPR() const
+ {
+ return BloomFilter::FPR();
+ }
+
+ /** Return whether the specified bit is set. */
+ bool operator[](size_t i) const
+ {
+ if (i >= m_startBitPos && i <= m_endBitPos)
+ return BloomFilter::operator[](i - m_startBitPos);
+ return false;
+ }
+
+ /** Return whether the object is present in this set. */
+ bool operator[](const Bloom::key_type& key) const
+ {
+ return (*this)[Bloom::hash(key) % m_fullBloomSize];
+ }
+
+ /** Add the object with the specified index to this set. */
+ void insert(size_t i)
+ {
+ if (i >= m_startBitPos && i <= m_endBitPos)
+ BloomFilter::insert(i - m_startBitPos);
+ }
+
+ /** Add the object to this set. */
+ void insert(const Bloom::key_type& key)
+ {
+ insert(Bloom::hash(key) % m_fullBloomSize);
+ }
+
+ /** Operator for reading a bloom filter from a stream. */
+ friend std::istream& operator>>(std::istream& in, BloomFilterWindow& o)
+ {
+ o.read(in, Bloom::LOAD_OVERWRITE);
+ return in;
+ }
+
+ /** Operator for writing the bloom filter to a stream. */
+ friend std::ostream& operator<<(std::ostream& out, const BloomFilterWindow& o)
+ {
+ o.write(out);
+ return out;
+ }
+
+ /** Read a bloom filter window from a stream. */
+ void read(std::istream& in,
+ Bloom::LoadType loadType = Bloom::LOAD_OVERWRITE,
+ unsigned shrinkFactor = 1)
+ {
+ Bloom::FileHeader header = Bloom::readHeader(in);
+
+ m_fullBloomSize = header.fullBloomSize;
+ m_startBitPos = header.startBitPos;
+ m_endBitPos = header.endBitPos;
+
+ // alter the dimensions that we pass into Bloom::readData
+ // so that we load the data into a bit array that is
+ // exactly the size of the window (not the full size of the
+ // containing bloom filter)
+
+ header.fullBloomSize = header.endBitPos - header.startBitPos + 1;
+ header.startBitPos = 0;
+ header.endBitPos = header.fullBloomSize - 1;
+
+ Bloom::readData(m_array, header, in, loadType, shrinkFactor);
+ }
+
+ /** Write a bloom filter window to a stream. */
+ void write(std::ostream& out) const
+ {
+ Bloom::write(m_array, m_fullBloomSize, m_startBitPos,
+ m_endBitPos, out);
+ }
+
+private:
+
+ size_t m_fullBloomSize;
+ size_t m_startBitPos, m_endBitPos;
+};
+
+#endif
diff --git a/Bloom/CascadingBloomFilter.h b/Bloom/CascadingBloomFilter.h
new file mode 100644
index 0000000..4b3569c
--- /dev/null
+++ b/Bloom/CascadingBloomFilter.h
@@ -0,0 +1,120 @@
+/**
+ * A cascading Bloom filter
+ * Copyright 2013 Shaun Jackman
+ */
+#ifndef CascadingBLOOMFILTER_H
+#define CascadingBLOOMFILTER_H 1
+
+#include "Bloom/Bloom.h"
+#include "BloomFilter.h"
+#include <vector>
+
+/** A Cascading Bloom filter. */
+class CascadingBloomFilter
+{
+ public:
+
+ /** The maximum count of an element in this multiset. */
+ static const unsigned MAX_COUNT = 2;
+
+ /** Constructor */
+ CascadingBloomFilter() {}
+
+ /** Constructor */
+ CascadingBloomFilter(size_t n)
+ {
+ for (unsigned i = 0; i < MAX_COUNT; i++)
+ m_data.push_back(new BloomFilter(n));
+ }
+
+ /** Destructor */
+ ~CascadingBloomFilter()
+ {
+ typedef std::vector<BloomFilter*>::iterator Iterator;
+ for (Iterator i = m_data.begin(); i != m_data.end(); i++) {
+ assert(*i != NULL);
+ delete *i;
+ }
+ }
+
+ /** Return the size of the bit array. */
+ size_t size() const
+ {
+ assert(m_data.back() != NULL);
+ return m_data.back()->size();
+ }
+
+ /** Return the number of elements with count >= MAX_COUNT. */
+ size_t popcount() const
+ {
+ assert(m_data.back() != NULL);
+ return m_data.back()->popcount();
+ }
+
+ /** Return the estimated false positive rate */
+ double FPR() const
+ {
+ return (double)popcount() / size();
+ }
+
+ /** Return whether the element with this index has count >=
+ * MAX_COUNT.
+ */
+ bool operator[](size_t i) const
+ {
+ assert(m_data.back() != NULL);
+ return (*m_data.back())[i];
+ }
+
+ /** Return whether this element has count >= MAX_COUNT. */
+ bool operator[](const Bloom::key_type& key) const
+ {
+ assert(m_data.back() != NULL);
+ return (*m_data.back())[Bloom::hash(key) % m_data.back()->size()];
+ }
+
+ /** Add the object with the specified index to this multiset. */
+ void insert(size_t index)
+ {
+ for (unsigned i = 0; i < MAX_COUNT; ++i) {
+ assert(m_data.at(i) != NULL);
+ if (!(*m_data[i])[index]) {
+ m_data[i]->insert(index);
+ break;
+ }
+ }
+ }
+
+ /** Add the object to this Cascading multiset. */
+ void insert(const Bloom::key_type& key)
+ {
+ assert(m_data.back() != NULL);
+ insert(Bloom::hash(key) % m_data.back()->size());
+ }
+
+ /** Get the Bloom filter for a given level */
+ BloomFilter& getBloomFilter(unsigned level)
+ {
+ assert(m_data.at(level) != NULL);
+ return *m_data.at(level);
+ }
+
+ void write(std::ostream& out) const
+ {
+ assert(m_data.back() != NULL);
+ out << *m_data.back();
+ }
+
+ /** Operator for writing the bloom filter to a stream */
+ friend std::ostream& operator<<(std::ostream& out, const CascadingBloomFilter& o)
+ {
+ o.write(out);
+ return out;
+ }
+
+ private:
+ std::vector<BloomFilter*> m_data;
+
+};
+
+#endif
diff --git a/Bloom/CascadingBloomFilterWindow.h b/Bloom/CascadingBloomFilterWindow.h
new file mode 100644
index 0000000..19bd9e7
--- /dev/null
+++ b/Bloom/CascadingBloomFilterWindow.h
@@ -0,0 +1,90 @@
+#ifndef COUNTINGBLOOMFILTERWINDOW_H
+#define COUNTINGBLOOMFILTERWINDOW_H 1
+
+#include "Bloom.h"
+#include "BloomFilter.h"
+#include "CascadingBloomFilter.h"
+#include <vector>
+
+class CascadingBloomFilterWindow : private CascadingBloomFilter
+{
+ public:
+
+ /** Constructor.
+ *
+ * @param fullBloomSize size in bits of the containing counting bloom filter
+ * @param startBitPos index of first bit in the window
+ * @param endBitPos index of last bit in the window
+ */
+ CascadingBloomFilterWindow(size_t fullBloomSize, size_t startBitPos, size_t endBitPos)
+ : m_fullBloomSize(fullBloomSize)
+ {
+ for (unsigned i = 0; i < MAX_COUNT; i++)
+ m_data.push_back(new BloomFilterWindow(fullBloomSize, startBitPos, endBitPos));
+ }
+
+ /** Return the size of the bit array. */
+ size_t size() const
+ {
+ assert(m_data.back() != NULL);
+ return m_data.back()->size();
+ }
+
+ /** Return the number of elements with count >= MAX_COUNT. */
+ size_t popcount() const
+ {
+ assert(m_data.back() != NULL);
+ return m_data.back()->popcount();
+ }
+
+ /** Return the estimated false positive rate */
+ double FPR() const
+ {
+ return (double)popcount() / size();
+ }
+
+ /** Add the object with the specified index to this multiset. */
+ void insert(size_t index)
+ {
+ for (unsigned i = 0; i < MAX_COUNT; ++i) {
+ assert(m_data.at(i) != NULL);
+ if (!(*m_data[i])[index]) {
+ m_data[i]->insert(index);
+ break;
+ }
+ }
+ }
+
+ /** Add the object to this counting multiset. */
+ void insert(const Bloom::key_type& key)
+ {
+ assert(m_data.back() != NULL);
+ insert(Bloom::hash(key) % m_fullBloomSize);
+ }
+
+ void write(std::ostream& out) const
+ {
+ assert(m_data.back() != NULL);
+ out << *m_data.back();
+ }
+
+ /** Operator for writing the bloom filter to a stream */
+ friend std::ostream& operator<<(std::ostream& out, const CascadingBloomFilterWindow& o)
+ {
+ o.write(out);
+ return out;
+ }
+
+ /** Get the Bloom filter for a given level */
+ BloomFilterWindow& getBloomFilter(unsigned level)
+ {
+ assert(m_data.at(level) != NULL);
+ return *m_data.at(level);
+ }
+
+ private:
+ size_t m_fullBloomSize;
+ std::vector<BloomFilterWindow*> m_data;
+};
+
+#endif
diff --git a/Bloom/ConcurrentBloomFilter.h b/Bloom/ConcurrentBloomFilter.h
new file mode 100644
index 0000000..3dcc68f
--- /dev/null
+++ b/Bloom/ConcurrentBloomFilter.h
@@ -0,0 +1,96 @@
+#ifndef CONCURRENTBLOOMFILTER_H
+#define CONCURRENTBLOOMFILTER
+
+#ifndef _OPENMP
+# error ConcurrentBloomFilter class requires a compiler that supports OpenMP
+#endif
+
+#include "config.h"
+#include <vector>
+#include <omp.h>
+
+/**
+ * A wrapper class that makes a Bloom filter
+ * thread-safe.
+ */
+template <class BloomFilterType>
+class ConcurrentBloomFilter
+{
+
+public:
+
+ /** Constructor */
+ ConcurrentBloomFilter(BloomFilterType& bloom, size_t numLocks) :
+ m_bloom(bloom), m_locks(numLocks)
+ {
+ m_windowSize = bloom.size() / numLocks;
+ // round down to the nearest byte boundary,
+ // because bytes that span locks will
+ // cause concurrency issues
+ m_windowSize -= m_windowSize % 8;
+ assert(numLocks < bloom.size());
+ for (size_t i = 0; i < m_locks.size(); i++)
+ omp_init_lock(&(m_locks.at(i)));
+ }
+
+ /** Destructor */
+ ~ConcurrentBloomFilter()
+ {
+ for (size_t i = 0; i < m_locks.size(); i++)
+ omp_destroy_lock(&(m_locks.at(i)));
+ }
+
+ /** Return whether the specified bit is set. */
+ bool operator[](size_t i) const
+ {
+ assert(i < m_bloom.size());
+ bool bit;
+ getLock(i);
+ bit = m_bloom[i];
+ releaseLock(i);
+ return bit;
+ }
+
+ /** Return whether the object is present in this set. */
+ bool operator[](const Bloom::key_type& key) const
+ {
+ return *this[Bloom::hash(key) % m_bloom.size()];
+ }
+
+ /** Add the object with the specified index to this set. */
+ void insert(size_t index)
+ {
+ assert(index < m_bloom.size());
+ getLock(index);
+ m_bloom.insert(index);
+ releaseLock(index);
+ }
+
+ /** Add the object to this set. */
+ void insert(const Bloom::key_type& key)
+ {
+ insert(Bloom::hash(key) % m_bloom.size());
+ }
+
+private:
+
+ void getLock(size_t bitIndex)
+ {
+ assert(bitIndex < m_bloom.size());
+ size_t lockIndex = std::min(bitIndex / m_windowSize, m_locks.size() - 1);
+ omp_set_lock(&(m_locks.at(lockIndex)));
+ }
+
+ void releaseLock(size_t bitIndex)
+ {
+ assert(bitIndex < m_bloom.size());
+ size_t lockIndex = std::min(bitIndex / m_windowSize, m_locks.size() - 1);
+ omp_unset_lock(&(m_locks.at(lockIndex)));
+ }
+
+ BloomFilterType& m_bloom;
+ std::vector<omp_lock_t> m_locks;
+ size_t m_windowSize;
+};
+
+#endif
diff --git a/Bloom/Makefile.am b/Bloom/Makefile.am
new file mode 100644
index 0000000..d16bcec
--- /dev/null
+++ b/Bloom/Makefile.am
@@ -0,0 +1,20 @@
+bin_PROGRAMS = abyss-bloom
+
+abyss_bloom_CPPFLAGS = -I$(top_srcdir) \
+ -I$(top_srcdir)/Common \
+ -I$(top_srcdir)/DataLayer
+
+abyss_bloom_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
+
+abyss_bloom_LDADD = \
+ $(top_builddir)/DataLayer/libdatalayer.a \
+ $(top_builddir)/Align/libalign.a \
+ $(top_builddir)/Common/libcommon.a
+
+abyss_bloom_SOURCES = bloom.cc \
+ Bloom.h \
+ BloomFilter.h \
+ BloomFilterWindow.h \
+ ConcurrentBloomFilter.h \
+ CascadingBloomFilter.h \
+ CascadingBloomFilterWindow.h
diff --git a/Bloom/bloom.cc b/Bloom/bloom.cc
new file mode 100644
index 0000000..29c050d
--- /dev/null
+++ b/Bloom/bloom.cc
@@ -0,0 +1,571 @@
+/**
+ * Build and manipulate bloom filter files.
+ */
+
+#include "config.h"
+#include "Common/Options.h"
+#include "Common/Kmer.h"
+#include "DataLayer/Options.h"
+#include "Common/StringUtil.h"
+#include "Bloom/Bloom.h"
+#include "Bloom/BloomFilter.h"
+#include "Bloom/CascadingBloomFilter.h"
+#include "Bloom/BloomFilterWindow.h"
+#include "Bloom/CascadingBloomFilterWindow.h"
+
+#include <cstdlib>
+#include <getopt.h>
+#include <iostream>
+#include <fstream>
+#include <sstream>
+
+#if _OPENMP
+# include <omp.h>
+# include "Bloom/ConcurrentBloomFilter.h"
+#endif
+
+using namespace std;
+
+#define PROGRAM "abyss-bloom"
+
+static const char VERSION_MESSAGE[] =
+PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
+"Written by Shaun Jackman, Hamid Mohamadi, Anthony Raymond and\n"
+"Ben Vandervalk.\n"
+"\n"
+"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+
+static const char USAGE_MESSAGE[] =
+"Usage 1: " PROGRAM " build [GLOBAL_OPTS] [COMMAND_OPTS] <OUTPUT_BLOOM_FILE> <READS_FILE_1> [READS_FILE_2]...\n"
+"Usage 2: " PROGRAM " union [GLOBAL_OPTS] [COMMAND_OPTS] <OUTPUT_BLOOM_FILE> <BLOOM_FILE_1> <BLOOM_FILE_2> [BLOOM_FILE_3]...\n"
+"Usage 3: " PROGRAM " intersect [GLOBAL_OPTS] [COMMAND_OPTS] <OUTPUT_BLOOM_FILE> <BLOOM_FILE_1> <BLOOM_FILE_2> [BLOOM_FILE_3]...\n"
+"Usage 4: " PROGRAM " info [GLOBAL_OPTS] [COMMAND_OPTS] <BLOOM_FILE>\n"
+"Build and manipulate bloom filter files.\n"
+"\n"
+" Global options:\n"
+"\n"
+" -k, --kmer=N the size of a k-mer [required]\n"
+" -v, --verbose display verbose output\n"
+" --help display this help and exit\n"
+" --version output version information and exit\n"
+"\n"
+" Options for `" PROGRAM " build':\n"
+"\n"
+" -b, --bloom-size=N size of bloom filter [500M]\n"
+" -j, --threads=N use N parallel threads [1]\n"
+" -l, --levels=N build a cascading bloom filter with N levels\n"
+" and output the last level\n"
+" -L, --init-level='N=FILE' initialize level N of cascading bloom filter\n"
+" from FILE\n"
+" --chastity discard unchaste reads [default]\n"
+" --no-chastity do not discard unchaste reads\n"
+" --trim-masked trim masked bases from the ends of reads\n"
+" --no-trim-masked do not trim masked bases from the ends\n"
+" of reads [default]\n"
+" -n, --num-locks=N number of write locks on bloom filter\n"
+" -q, --trim-quality=N trim bases from the ends of reads whose\n"
+" quality is less than the threshold\n"
+" --standard-quality zero quality is `!' (33)\n"
+" default for FASTQ and SAM files\n"
+" --illumina-quality zero quality is `@' (64)\n"
+" default for qseq and export files\n"
+" -w, --window M/N build a bloom filter for subwindow M of N\n"
+"\n"
+" Options for `" PROGRAM " union': (none)\n"
+" Options for `" PROGRAM " intersect': (none)\n"
+" Options for `" PROGRAM " info': (none)\n"
+"\n"
+"Report bugs to <" PACKAGE_BUGREPORT ">.\n";
+
+namespace opt {
+ /** The size of the bloom filter in bytes. */
+ size_t bloomSize = 500 * 1024 * 1024;
+
+ /** The number of parallel threads. */
+ unsigned threads = 1;
+
+ /** The size of a k-mer. */
+ unsigned k;
+
+ /** Number of levels for cascading bloom filter. */
+ unsigned levels = 1;
+
+ /**
+ * Files used to initialize levels of cascading
+ * bloom filter (-L option).
+ */
+ vector< vector<string> > levelInitPaths;
+
+ /**
+ * Num of locked windows to use, when invoking with
+ * the -j option.
+ */
+ size_t numLocks = 1000;
+
+ /** Index of bloom filter window.
+ ("M" for -w option) */
+ unsigned windowIndex = 0;
+
+ /** Number of windows in complete bloom filter.
+ ("N" for -w option) */
+ unsigned windows = 0;
+}
+
+static const char shortopts[] = "b:j:k:l:L:n:q:vw:";
+
+enum { OPT_HELP = 1, OPT_VERSION };
+
+static const struct option longopts[] = {
+ { "bloom-size", required_argument, NULL, 'b' },
+ { "threads", required_argument, NULL, 'j' },
+ { "kmer", required_argument, NULL, 'k' },
+ { "levels", required_argument, NULL, 'l' },
+ { "init-level", required_argument, NULL, 'L' },
+ { "chastity", no_argument, &opt::chastityFilter, 1 },
+ { "no-chastity", no_argument, &opt::chastityFilter, 0 },
+ { "trim-masked", no_argument, &opt::trimMasked, 1 },
+ { "no-trim-masked", no_argument, &opt::trimMasked, 0 },
+ { "num-locks", required_argument, NULL, 'n' },
+ { "trim-quality", required_argument, NULL, 'q' },
+ { "standard-quality", no_argument, &opt::qualityOffset, 33 },
+ { "illumina-quality", no_argument, &opt::qualityOffset, 64 },
+ { "verbose", no_argument, NULL, 'v' },
+ { "help", no_argument, NULL, OPT_HELP },
+ { "version", no_argument, NULL, OPT_VERSION },
+ { "window", required_argument, NULL, 'w' },
+ { NULL, 0, NULL, 0 }
+};
+
+void dieWithUsageError()
+{
+ cerr << "Try `" << PROGRAM
+ << " --help' for more information.\n";
+ exit(EXIT_FAILURE);
+}
+
+void parseGlobalOpts(int argc, char** argv)
+{
+ bool done = false;
+ int optindPrev = optind;
+
+ for (int c; (c = getopt_long(argc, argv,
+ shortopts, longopts, NULL)) != -1;) {
+
+ istringstream arg(optarg != NULL ? optarg : "");
+ switch (c) {
+ case '?':
+ dieWithUsageError();
+ case 'k':
+ arg >> opt::k; break;
+ case 'v':
+ opt::verbose++; break;
+ case OPT_HELP:
+ cout << USAGE_MESSAGE;
+ exit(EXIT_SUCCESS);
+ case OPT_VERSION:
+ cerr << VERSION_MESSAGE;
+ exit(EXIT_SUCCESS);
+ default:
+ // end of global opts
+ optind = optindPrev;
+ done = true;
+ break;
+ }
+
+ if (done)
+ break;
+
+ if (optarg != NULL && (!arg.eof() || arg.fail())) {
+ cerr << PROGRAM ": invalid option: `-"
+ << (char)c << optarg << "'\n";
+ exit(EXIT_FAILURE);
+ }
+
+ optindPrev = optind;
+ }
+
+ if (opt::k == 0) {
+ cerr << PROGRAM ": missing mandatory option `-k'\n";
+ dieWithUsageError();
+ }
+
+ Kmer::setLength(opt::k);
+}
+
+static inline istream* openInputStream(const string& path)
+{
+ if (path == "-")
+ return &cin;
+ return new ifstream(path.c_str());
+}
+
+static inline ostream* openOutputStream(const string& path)
+{
+ if (path == "-")
+ return &cout;
+ return new ofstream(path.c_str());
+}
+
+static inline void closeInputStream(istream* in, const string& path)
+{
+ if (path == "-")
+ return;
+ ifstream* ifs = static_cast<ifstream*>(in);
+ ifs->close();
+ delete ifs;
+}
+
+static inline void closeOutputStream(ostream* out, const string& path)
+{
+ if (path == "-")
+ return;
+ ofstream* ofs = static_cast<ofstream*>(out);
+ ofs->close();
+ delete ofs;
+}
+
+template <typename CBF>
+void initBloomFilterLevels(CBF& bf)
+{
+ assert(opt::levels >= 2);
+ assert(opt::levelInitPaths.size() <= opt::levels);
+
+ for (unsigned i = 0; i < opt::levelInitPaths.size(); i++) {
+ vector<string>& paths = opt::levelInitPaths.at(i);
+ for (unsigned j = 0; j < paths.size(); j++) {
+ string path = paths.at(j);
+ cerr << "Loading `" << path << "' into level "
+ << i + 1 << " of cascading bloom filter...\n";
+ istream* in = openInputStream(path);
+ assert(*in);
+ Bloom::LoadType loadType = (j > 0) ?
+ Bloom::LOAD_UNION : Bloom::LOAD_OVERWRITE;
+ bf.getBloomFilter(i).read(*in, loadType);
+ assert(*in);
+ closeInputStream(in, path);
+ }
+ }
+}
+
+template <typename BF>
+void loadFilters(BF& bf, int argc, char** argv)
+{
+ for (int i = optind; i < argc; i++)
+ Bloom::loadFile(bf, opt::k, argv[i], opt::verbose);
+
+ if (opt::verbose)
+ cerr << "Successfully loaded bloom filter.\n";
+}
+
+template <typename BF>
+void writeBloom(BF& bf, string& outputPath)
+{
+ if (opt::verbose) {
+ cerr << "Writing bloom filter to `"
+ << outputPath << "'...\n";
+ }
+
+ ostream* out = openOutputStream(outputPath);
+
+ assert_good(*out, outputPath);
+ *out << bf;
+ out->flush();
+ assert_good(*out, outputPath);
+
+ closeOutputStream(out, outputPath);
+}
+
+template <typename BF>
+void printBloomStats(ostream& os, const BF& bloom)
+{
+ os << "Bloom size (bits): " << bloom.size() << "\n"
+ << "Bloom popcount (bits): " << bloom.popcount() << "\n"
+ << "Bloom filter FPR: " << setprecision(3)
+ << 100 * bloom.FPR() << "%\n";
+}
+
+template <typename BF>
+void printCascadingBloomStats(ostream& os, BF& bloom)
+{
+ for (unsigned i = 0; i < opt::levels; i++) {
+ os << "Stats for Bloom filter level " << i+1 << ":\n"
+ << "\tBloom size (bits): "
+ << bloom.getBloomFilter(i).size() << "\n"
+ << "\tBloom popcount (bits): "
+ << bloom.getBloomFilter(i).popcount() << "\n"
+ << "\tBloom filter FPR: " << setprecision(3)
+ << 100 * bloom.getBloomFilter(i).FPR() << "%\n";
+ }
+}
+
+int build(int argc, char** argv)
+{
+ parseGlobalOpts(argc, argv);
+
+ for (int c; (c = getopt_long(argc, argv,
+ shortopts, longopts, NULL)) != -1;) {
+ istringstream arg(optarg != NULL ? optarg : "");
+ switch (c) {
+ case '?':
+ dieWithUsageError();
+ case 'b':
+ opt::bloomSize = SIToBytes(arg); break;
+ case 'j':
+ arg >> opt::threads; break;
+ case 'l':
+ arg >> opt::levels; break;
+ case 'L':
+ {
+ unsigned level;
+ arg >> level >> expect("=");
+ if (arg.fail() || arg.eof())
+ break;
+ string path;
+ arg >> path;
+ if (arg.fail())
+ break;
+ if (level > opt::levelInitPaths.size())
+ opt::levelInitPaths.resize(level);
+ opt::levelInitPaths[level-1].push_back(path);
+ break;
+ }
+ case 'n':
+ arg >> opt::numLocks; break;
+ case 'q':
+ arg >> opt::qualityThreshold; break;
+ case 'w':
+ arg >> opt::windowIndex;
+ arg >> expect("/");
+ arg >> opt::windows;
+ break;
+ }
+ if (optarg != NULL && (!arg.eof() || arg.fail())) {
+ cerr << PROGRAM ": invalid option: `-"
+ << (char)c << optarg << "'\n";
+ exit(EXIT_FAILURE);
+ }
+ }
+
+ if (opt::levels > 2)
+ {
+ cerr << PROGRAM ": -l > 2 is not currently supported\n";
+ dieWithUsageError();
+ }
+
+ if (!opt::levelInitPaths.empty() && opt::levels < 2)
+ {
+ cerr << PROGRAM ": -L can only be used with cascading bloom "
+ "filters (-l >= 2)\n";
+ dieWithUsageError();
+ }
+
+ if (opt::levelInitPaths.size() > opt::levels) {
+ cerr << PROGRAM ": level arg to -L is greater than number"
+ " of bloom filter levels (-l)\n";
+ dieWithUsageError();
+ }
+
+#if _OPENMP
+ if (opt::threads > 0)
+ omp_set_num_threads(opt::threads);
+#endif
+
+ // bloom filter size in bits
+ size_t bits = opt::bloomSize * 8;
+
+ if (bits % opt::levels != 0) {
+ cerr << PROGRAM ": bloom filter size (-b) must be evenly divisible "
+ << "by number of bloom filter levels (-l)\n";
+ dieWithUsageError();
+ }
+
+ if (opt::windows != 0 && bits / opt::levels % opt::windows != 0) {
+ cerr << PROGRAM ": (b / l) % w == 0 must be true, where "
+ << "b is bloom filter size (-b), "
+ << "l is number of levels (-l), and "
+ << "w is number of windows (-w)\n";
+ dieWithUsageError();
+ }
+
+ if (argc - optind < 2) {
+ cerr << PROGRAM ": missing arguments\n";
+ dieWithUsageError();
+ }
+
+ // if we are building a cascading bloom filter, reduce
+ // the size of each level so that the overall bloom filter
+ // fits within the memory limit (specified by -b)
+ bits /= opt::levels;
+
+ string outputPath(argv[optind]);
+ optind++;
+ if (opt::windows == 0) {
+
+ if (opt::levels == 1) {
+ BloomFilter bloom(bits);
+#ifdef _OPENMP
+ ConcurrentBloomFilter<BloomFilter>
+ cbf(bloom, opt::numLocks);
+ loadFilters(cbf, argc, argv);
+#else
+ loadFilters(bloom, argc, argv);
+#endif
+ printBloomStats(cerr, bloom);
+ writeBloom(bloom, outputPath);
+ }
+ else {
+ CascadingBloomFilter cascadingBloom(bits);
+ initBloomFilterLevels(cascadingBloom);
+#ifdef _OPENMP
+ ConcurrentBloomFilter<CascadingBloomFilter>
+ cbf(cascadingBloom, opt::numLocks);
+ loadFilters(cbf, argc, argv);
+#else
+ loadFilters(cascadingBloom, argc, argv);
+#endif
+ printCascadingBloomStats(cerr, cascadingBloom);
+ writeBloom(cascadingBloom, outputPath);
+ }
+
+ } else {
+
+ size_t bitsPerWindow = bits / opt::windows;
+ size_t startBitPos = (opt::windowIndex - 1) * bitsPerWindow;
+ size_t endBitPos;
+
+ if (opt::windowIndex < opt::windows)
+ endBitPos = opt::windowIndex * bitsPerWindow - 1;
+ else
+ endBitPos = bits - 1;
+
+ if (opt::levels == 1) {
+ BloomFilterWindow bloom(bits, startBitPos, endBitPos);
+ loadFilters(bloom, argc, argv);
+ printBloomStats(cerr, bloom);
+ writeBloom(bloom, outputPath);
+ }
+ else {
+ CascadingBloomFilterWindow cascadingBloom(bits, startBitPos, endBitPos);
+ initBloomFilterLevels(cascadingBloom);
+ loadFilters(cascadingBloom, argc, argv);
+ printCascadingBloomStats(cerr, cascadingBloom);
+ writeBloom(cascadingBloom, outputPath);
+ }
+ }
+
+ return 0;
+}
+
+int combine(int argc, char** argv, Bloom::LoadType loadType)
+{
+ parseGlobalOpts(argc, argv);
+
+ if (argc - optind < 3) {
+ cerr << PROGRAM ": missing arguments\n";
+ dieWithUsageError();
+ }
+
+ string outputPath(argv[optind]);
+ optind++;
+
+ BloomFilter bloom;
+
+ for (int i = optind; i < argc; i++) {
+ string path(argv[i]);
+ if (opt::verbose)
+ std::cerr << "Loading bloom filter from `"
+ << path << "'...\n";
+ istream* in = openInputStream(path);
+ assert_good(*in, path);
+ Bloom::LoadType loadOp = (i > optind) ?
+ loadType : Bloom::LOAD_OVERWRITE;
+ bloom.read(*in, loadOp);
+ assert_good(*in, path);
+ closeInputStream(in, path);
+ }
+
+ if (opt::verbose) {
+ cerr << "Successfully loaded bloom filter.\n";
+ printBloomStats(cerr, bloom);
+ switch(loadType) {
+ case Bloom::LOAD_UNION:
+ std::cerr << "Writing union of bloom filters to `"
+ << outputPath << "'...\n";
+ break;
+ case Bloom::LOAD_INTERSECT:
+ std::cerr << "Writing intersection of bloom filters to `"
+ << outputPath << "'...\n";
+ break;
+ default:
+ std::cerr << "error: expected LOAD_UNION or LOAD_INTERSECT\n";
+ assert(false);
+ break;
+ }
+ }
+
+ ostream* out = openOutputStream(outputPath);
+
+ assert_good(*out, outputPath);
+ *out << bloom;
+ out->flush();
+ assert_good(*out, outputPath);
+
+ closeOutputStream(out, outputPath);
+
+ return 0;
+}
+
+int info(int argc, char** argv)
+{
+ parseGlobalOpts(argc, argv);
+
+ if (argc - optind < 1) {
+ cerr << PROGRAM ": missing arguments\n";
+ dieWithUsageError();
+ }
+
+ BloomFilter bloom;
+ string path = argv[optind];
+
+ if (opt::verbose)
+ std::cerr << "Loading bloom filter from `"
+ << path << "'...\n";
+
+ istream* in = openInputStream(path);
+ assert_good(*in, path);
+ *in >> bloom;
+
+ printBloomStats(cerr, bloom);
+
+ closeInputStream(in, path);
+
+ return 0;
+}
+
+int main(int argc, char** argv)
+{
+ if (argc < 2)
+ dieWithUsageError();
+
+ string command(argv[1]);
+ optind++;
+
+ if (command == "--help" || command == "-h") {
+ cout << USAGE_MESSAGE;
+ return EXIT_SUCCESS;
+ }
+ else if (command == "build") {
+ return build(argc, argv);
+ }
+ else if (command == "union") {
+ return combine(argc, argv, Bloom::LOAD_UNION);
+ }
+ else if (command == "intersect") {
+ return combine(argc, argv, Bloom::LOAD_INTERSECT);
+ }
+ else if (command == "info") {
+ return info(argc, argv);
+ }
+
+ dieWithUsageError();
+}
diff --git a/COPYRIGHT b/COPYRIGHT
index 3d56d24..0c4d7a2 100644
--- a/COPYRIGHT
+++ b/COPYRIGHT
@@ -1,246 +1,34 @@
Format: http://www.debian.org/doc/packaging-manuals/copyright-format/1.0/
Upstream-Name: ABySS
Upstream-Contact: Shaun Jackman <sjackman at gmail.com>
-Source: http://www.bcgsc.ca/platform/bioinfo/software/abyss
+Source: https://github.com/bcgsc/abyss
-License: BCCA-Academic
- Debian may redistribute this software package.
- .
- BC CANCER AGENCY SOFTWARE LICENSE AGREEMENT (ACADEMIC USE)
- CAREFULLY READ THE FOLLOWING TERMS AND CONDITIONS. This License
- Agreement (the "Agreement") is a legal contract between you, your
- employer, educational institution or organization (collectively, "You")
- and the British Columbia Cancer Agency ("BCCA") with respect to the
- license of the software, including all associated documentation
- (collectively, the "Product").
- .
- BCCA is willing to license the Product to You only if You accept the
- terms and conditions of this Agreement. By clicking on the "I ACCEPT"
- button, or by copying, downloading, accessing or otherwise using the
- Product, You automatically agree to be bound by the terms of this
- Agreement. IF YOU DO NOT WISH TO BE BOUND BY THE TERMS OF THIS
- AGREEMENT, DO NOT COPY, DOWNLOAD, ACCESS OR OTHERWISE USE THE
- PRODUCT.
- .
- 1. AUTHORITY: In the event that You are an educational institution or
- organization, Your representative who is clicking the "I ACCEPT"
- button, or otherwise copying, downloading, accessing or using the
- Product hereby, in their personal capacity, represents and warrants
- that they possess the legal authority to enter into this Agreement
- on Your behalf and to bind You to the terms of this Agreement.
- .
- 2. LICENSE TO USE: BCCA hereby grants to You a personal, non-exclusive,
- non-transferable, limited license to use the Product solely for
- internal, non-commercial use for non-profit research or educational
- purposes only on the terms and conditions contained in this Agreement.
- The Product may be installed at a single site at Your premises only. A
- copy of the Product installed on a single common machine or cluster of
- machines may be shared for internal use by Qualified Users only. In
- order to be a "Qualified User", an individual must be a student,
- researcher, professor, instructor or staff member of a non-profit
- educational institution or organization who uses the Product solely for
- non-profit research or educational purposes.
- .
- 3. RESTRICTIONS: You acknowledge and agree that You shall not, and
- shall not authorize any third party to:
- (a) make copies of the Product, except as provided in Section 2 and
- except for a single backup copy, and any such copy together with the
- original must be kept in Your possession or control;
- (b) modify, adapt, decompile, disassemble, translate into another
- computer language, create derivative works of, or otherwise reverse
- engineer the Product, or disclose any trade secrets relating to the
- Product, except as permitted in Section 5;
- (c) license, sublicense, distribute, sell, lease, transfer, assign,
- trade, rent or publish the Product or any part thereof and/or copies
- thereof, to any third party;
- (d) use the Product to process any data other than Your own;
- (e) use the Product or any part thereof for any commercial or
- for-profit purpose or any other purpose other than as permitted in
- Section 2; or
- (f) use, without its express permission, the name of BCCA.
- .
- 4. INTELLECTUAL PROPERTY RIGHTS: Subject to Section 5 below, all
- patents, copyrights, trade secrets, service marks, trademarks and
- other proprietary rights in or related to the Product and any
- improvements, modifications and enhancements thereof are and will
- remain the exclusive property of BCCA or its licensors. You agree
- that You will not, either during or after the termination of this
- Agreement, contest or challenge the title to or the intellectual
- property rights of BCCA or its licensors in the Product or any
- portion thereof.
- .
- 5. OWNERSHIP OF IMPROVEMENTS: In the event that the Product, in the
- form provided to You, includes source code (the "Source Code"),
- You are entitled to make improvements, modifications and
- enhancements to the Source Code (collectively, "Improvements")
- which Improvements are to be used by You for non-profit research
- and educational purposes only and You shall be the owner of those
- Improvements that You directly make and of all intellectual
- property rights to such Improvements, subject to the foregoing
- limits on Your use and distribution of such Improvements. You
- hereby grant to BCCA a perpetual, non-exclusive, worldwide,
- fully-paid, irrevocable license to use such Improvements for any
- purposes whatsoever, and to sublicense such Improvements including
- the right for third parties to sublicense the same, in perpetuity
- to the extent such rights are not limited in duration under
- applicable law, without identifying or seeking Your
- consent. Notwithstanding the foregoing, You acknowledge that BCCA
- and its licensors will retain or own all rights in and to any
- pre-existing code or other technology, content and data that may be
- incorporated in the Improvements. For greater certainty, this
- Section applies solely to the Source Code and shall not give You
- any rights with respect to the object code or any other portion or
- format of the Product which use, for greater certainty, is limited
- as set forth in this Agreement including as set out in Section 3(b)
- above. You acknowledge and agree that you will provide copies of
- Improvements to BCCA in such format as reasonably requested by BCCA
- at any time upon the request of BCCA.
- .
- 6. CONFIDENTIALITY: You acknowledge that the Product is and
- incorporates confidential and proprietary information developed,
- acquired by or licensed to BCCA. You will take all reasonable
- precautions necessary to safeguard the confidentiality of the
- Product, and will not disclose any information about the Product to
- any other person without BCCA's prior written consent. You will
- not allow the removal or defacement of any confidential or
- proprietary notice placed on the Product. You acknowledge that any
- breach of this Section 6 will cause irreparable harm to BCCA and
- its licensors.
+License: GPL-NC-3+
+ You may use, redistribute and modify this software for non-commercial
+ purposes under the terms of the GNU General Public License as
+ published by the Free Software Foundation, either version 3 of the
+ License, or (at your option) any later version.
.
- 7. NO WARRANTIES: THIS PRODUCT IS PROVIDED TO YOU BY BCCA IN ORDER TO
- ALLOW YOU TO OBTAIN ACCESS TO LEADING ACADEMIC RESEARCH. THE PRODUCT
- IS PROVIDED TO YOU ON AN "AS IS" BASIS WITHOUT WARRANTY OF ANY
- KIND. NO WARRANTY, REPRESENTATION OR CONDITION EITHER EXPRESS OR
- IMPLIED, INCLUDING WITHOUT LIMITATION, ANY IMPLIED WARRANTY OR
- CONDITION OF MERCHANTABILITY, NON-INFRINGEMENT, PERFORMANCE,
- DURABILITY OR FITNESS FOR A PARTICULAR PURPOSE OR USE SHALL
- APPLY. BCCA DOES NOT WARRANT THAT THE PRODUCT WILL OPERATE ON A
- CONTINUOUS OR TROUBLE FREE BASIS.
+ To license ABySS for commercial purposes, please contact
+ Patrick Rebstein <prebstein at bccancer.bc.ca>
.
- 8. LIMITATION OF LIABILITY: TO THE MAXIMUM EXTENT PERMITTED BY
- APPLICABLE LAW, IN NO EVENT SHALL THE AGGREGATE LIABILITY OF BCCA TO
- YOU EXCEED THE AMOUNT YOU HAVE PAID TO ACQUIRE THE PRODUCT ("MAXIMUM
- AMOUNT") AND WHERE YOU HAVE NOT PAID ANY AMOUNT FOR THE PRODUCT THEN
- THE MAXIMUM AMOUNT SHALL BE DEEMED TO BE CDN$100.00. IN NO EVENT SHALL
- BCCA BE LIABLE FOR ANY INDIRECT, INCIDENTAL, CONSEQUENTIAL, OR SPECIAL
- DAMAGES, INCLUDING WITHOUT LIMITATION ANY DAMAGES FOR LOST PROFITS OR
- SAVINGS, REGARDLESS OF WHETHER THEY HAVE BEEN ADVISED OF THE
- POSSIBILITY OF SUCH DAMAGE. EXCEPT TO THE EXTENT THAT THE LAWS OF A
- COMPETENT JURISDICTION REQUIRE LIABILITIES BEYOND AND DESPITE THESE
- LIMITATIONS, EXCLUSIONS AND DISCLAIMERS, THESE LIMITATIONS, EXCLUSIONS
- AND DISCLAIMERS SHALL APPLY WHETHER AN ACTION, CLAIM OR DEMAND ARISES
- FROM A BREACH OF WARRANTY OR CONDITION, BREACH OF CONTRACT,
- NEGLIGENCE, STRICT LIABILITY OR ANY OTHER KIND OF CIVIL OR STATUTORY
- LIABILITY CONNECTED WITH OR ARISING FROM THIS AGREEMENT. YOU AGREE
- THAT THE FOREGOING DISCLAIMER OF WARRANTIES AND LIMITATION OF
- LIABILITY ARE FAIR IN LIGHT OF THE NATURE OF THE RIGHTS GRANTED HEREIN
- AND THE AMOUNT OF FEES PAID BY YOU IN RESPECT OF THE PRODUCT.
- .
- 9. INDEMNITY: You will indemnify, defend and hold harmless BCCA, its
- board of directors, staff and agents from and against any and all
- liability, loss, damage, action, claim or expense (including
- attorney's fees and costs at trial and appellate levels) in
- connection with any claim, suit, action, demand or judgement
- (collectively, "Claim") arising out of, connected with, resulting
- from, or sustained as a result of Your use of the Product or the
- downloading of the Product, including without limitation, any Claim
- relating to infringement of BCCA's intellectual property rights or
- the intellectual property rights of any third party.
- .
- 10. SUPPORT AND MAINTENANCE: You acknowledge and agree that, unless
- and to the extent expressly agreed by BCCA in a separate written
- document, the Product is provided to You without any support or
- maintenance from BCCA and, for greater certainty, BCCA shall have
- no obligation to issue any update or upgrade to any Product.
- .
- 11. TERM: This Agreement is effective until terminated. You may
- terminate this Agreement at any time by ceasing use of the Product
- and destroying or deleting any copies of the Product. This
- Agreement will terminate immediately without notice from BCCA if
- You fail to comply with any provision of this Agreement. BCCA may
- terminate this Agreement at any time upon notice to you where BCCA
- determines, in its sole discretion, that any continued use of the
- Product could infringe the rights of any third parties. Upon
- termination of this Agreement, and in any event upon BCCA
- delivering You notice of termination, You shall immediately purge
- all Products from Your computer system(s), return to BCCA all
- copies of the Product that are in Your possession or control, and
- cease any further development of any Improvements. On any
- termination of this Agreement Sections 1, 4, 6, 7, 8, 9, 13 and 14
- shall survive such termination.
- .
- 12. GOVERNMENT END USERS: Where any of the Product is used, duplicated
- or disclosed by or to the United States government or a government
- contractor or sub contractor, it is provided with RESTRICTED
- RIGHTS as defined in Title 48 CFR 52.227-19 and is subject to the
- following: Title 48 CFR 2.101, 52.227-19, 227.7201 through
- 227.7202-4, FAR 52.227-14, and FAR 52.227-19(c)(1-2) and (6/87),
- and where applicable, the customary software license, as described
- in Title 48 CFR 227-7202 with respect to commercial software and
- commercial software documentation including DFAR 252.227-7013,
- DFAR 252,227-7014, DFAR 252.227-7015 and DFAR 252.7018, all as
- applicable.
+ This program is distributed in the hope that it will be useful,
+ but WITHOUT ANY WARRANTY; without even the implied warranty of
+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+ GNU General Public License for more details.
.
- 13. USE OF THE DOWNLOAD SERVICE: You acknowledge and agree that you
- will be responsible for all costs, charges and taxes (where
- applicable) arising out of Your use of the Product and the
- downloading of the Product. You acknowledge that You are
- responsible for supplying any hardware or software necessary to
- use the Product pursuant to this Agreement.
+ You should have received a copy of the GNU General Public License
+ along with this software. If not, see <http://www.gnu.org/licenses/>.
.
- 14. GENERAL PROVISIONS:
- (a) This Agreement will be governed by the laws of the Province of
- British Columbia, and the laws of Canada applicable therein, excluding
- any rules of private international law that lead to the application of
- the laws of any other jurisdiction. The United Nations Convention on
- Contracts for the International Sale of Goods (1980) does not apply to
- this Agreement. The courts of the Province of British Columbia shall
- have non-exclusive jurisdiction to hear any matter arising in
- connection with this Agreement.
- (b) USE OF THE PRODUCT IS PROHIBITED IN ANY JURISDICTION WHICH DOES
- NOT GIVE EFFECT TO THE TERMS OF THIS AGREEMENT.
- (c) You agree that no joint venture, partnership, employment,
- consulting or agency relationship exists between You and BCCA as a
- result of this Agreement or Your use of the Product.
- (d) You hereby consent to Your contact information and any other
- personally identifiable information that You provide to us being
- disclosed to and maintained and used by us and our business partners
- for the purposes of (i) managing and developing our respective
- businesses and operations; (ii) marketing products and services to You
- and your staff; and (iii) developing new and enhancing existing
- products. You further agree that we may provide this information to
- other persons as required to satisfy any legal requirements and to any
- person that acquires some or all of the assets of BCCA. Where any of
- the personally identifiable information that You provide to us is in
- respect of individuals other than Yourself (such as Your staff) then
- You represent and warrant to use that You have obtained all necessary
- consents and authorizations from such individuals in order to comply
- with this provision. Please see the BCCA website for further
- information regarding personally identifiable information.
- (e) This Agreement is the entire Agreement between You and BCCA
- relating to this subject matter. You will not contest the validity of
- this Agreement merely because it is in electronic form. No
- modification of this Agreement will be binding, unless in writing and
- accepted by an authorized representative of each party.
- (f) The provisions of this Agreement are severable in that if any
- provision in the Agreement is determined to be invalid or
- unenforceable under any controlling body of law, that will not affect
- the validity or enforceability of the remaining provisions of the
- Agreement.
- (g) You agree to print out or download a copy of this Agreement and
- retain it for Your records.
- (h) You consent to the use of the English language in this Agreement.
- (i) You may not assign this Agreement or any of Your rights or
- obligations hereunder without BCCA's prior written consent. BCCA, at
- its sole discretion may assign this Agreement without notice to You.
+ Debian may redistribute this software package.
Files: *
-Copyright: Copyright 2013 Genome Sciences Centre
-License: BCCA-Academic
+Copyright: Copyright 2014 Canada's Michael Smith Genome Sciences Centre
+License: GPL-NC-3+
Files: Common/* DataLayer/* DistanceEst/* FMIndex/* Map/* ParseAligns/*
-Copyright: Copyright 2013 Genome Sciences Centre
-License: BCCA-Academic or GPL-3+
+Copyright: Copyright 2014 Canada's Michael Smith Genome Sciences Centre
+License: GPL-3+
Files: Common/cholesky.hpp
Copyright: Copyright 2005 Gunter Winkler, Konstantin Kutzkow
@@ -252,7 +40,7 @@ License: Expat
Files: Layout/*
Copyright: Copyright 2012 Shaun Jackman
-License: BCCA-Academic or GPL-3+
+License: GPL-3+
Files: dialign/*
Copyright: Copyright 2008 Amarendran R. Subramanian
@@ -352,10 +140,8 @@ License: GPL-3+
PURPOSE. See the GNU General Public License for more
details.
.
- You should have received a copy of the GNU General Public
- License along with this package; if not, write to the Free
- Software Foundation, Inc., 51 Franklin St, Fifth Floor,
- Boston, MA 02110-1301 USA
+ You should have received a copy of the GNU General Public License
+ along with this software. If not, see <http://www.gnu.org/licenses/>.
.
On Debian systems, the full text of the GNU General Public
License version 3 can be found in the file
diff --git a/ChangeLog b/ChangeLog
index 7a602bc..589c8a4 100644
--- a/ChangeLog
+++ b/ChangeLog
@@ -1,10 +1,166 @@
+2014-07-09 Anthony Raymond <traymond at bcgsc.ca>
+
+ * Release version 1.5.2
+ * First official release of Konnector and abyss-bloom.
+ * More GCC 4.8+ fixes! Modified Boost install instructions.
+ * Fixed rare bug when parsing output of BWA.
+
+ ABYSS:
+ * New option, --mask-cov, use kmers with lowercased bases, but
+ don't count them towards multiplicity.
+
+ abyss-bloom:
+ * Construct reusable Bloom filter files for use with Konnector.
+ * Perform boolean operations on two or more bloom filters.
+ Currently supports union and intersection operations.
+
+ abyss-fixmate:
+ * Check for boost 1.43+ when using `unordered_map::quick_erase`.
+ * New option, --all, to report all alignments.
+ * Set mate unmapped flag for mateless reads.
+
+ abyss-longseqdist:
+ * Fixed `error: invalid CIGAR` when reading BWA output.
+
+ configure:
+ * Include mpi and boost libraries as system libraries. Silences
+ warnings (treated as errors) when compiling with GCC 4.8+.
+
+ konnector:
+ * Merge read pairs into a single sequence (pseudoread) by
+ building a Bloom filter de Bruijn graph and searching for paths
+ between the paired end reads. Input reads may be
+ FASTA/FASTQ/SAM/BAM. The input files must be sorted by read name
+ and may not contain orphan reads.
+
+2014-05-07 Anthony Raymond <traymond at bcgsc.ca>
+
+ * Release version 1.5.1
+ * Fix an issue with strand-specific RNA-Seq assembly when running
+ `abyss-filtergraph --assemble --SS`.
+ * Portability fixes for Fujitsu C Compiler (FCC).
+
+ abyss-filtergraph:
+ * Assemble contigs in forward orientation with `--assemble --SS`
+
+ abyss-pe:
+ * Fix some cases where abyss-pe uses incorrect executables
+
+ ABYSS-P:
+ * Portability fix with FCC
+
+2014-05-01 Anthony Raymond <traymond at bcgsc.ca>
+
+ * Release version 1.5.0
+ * Assemble strand-specific RNA-Seq libraries into strand-specific
+ contigs.
+ * New parameters, Q and xtip. Improves assembly in high-coverage
+ regions by removing recurrent read errors.
+ * Portability fixes for Fujitsu C Compiler.
+
+ abyss-pe:
+ * New parameter, `Q`, to mask low quality bases to N.
+ * New parameter, `xtip=1`, to remove 2-in 0-out tips.
+ * New parameter, `ss=1`, to perform strand-specific assembly
+ using ssRNA-Seq libraries.
+ * New command, `scaftigs`. Breaks scaffold sequences at 'N's and
+ produce a scaftigs.fa file.
+ * Include long-scaffs.fa in FAC statistics if `long` parameter
+ used.
+
+ abyss-fixmate:
+ * Performance improvement for GCC-4.6 and older.
+
+ DistanceEst:
+ * Report an estimation of duplicate fragments from read pairs
+ mapping to different contigs.
+
+ abyss-fixmate:
+ * Report number of fragments removed as noise and outliers.
+
+ ABYSS/ABYSS-P:
+ * New option, --SS, to support strand-specific assembly.
+
+ abyss-layout:
+ * New option, --SS, to support strand-specific assembly.
+
+ abyss-map:
+ * New option, --SS, to support strand-specific assembly.
+
+ abyss-overlap:
+ * New option, --SS, to support strand-specific assembly.
+
+ abyss-PathOverlap:
+ * New option, --SS, to support strand-specific assembly.
+
+ abyss-scaffold:
+ * New option, --SS, to support strand-specific assembly.
+ * Don't prune xtips when scaffolding.
+
+ AdjList:
+ * New option, --SS, to support strand-specific assembly.
+
+ Overlap:
+ * New option, --SS, to support strand-specific assembly.
+
+ PopBubbles:
+ * New option, --SS, to support strand-specific assembly.
+
+2013-11-20 Anthony Raymond <traymond at bcgsc.ca>
+
+ * Release version 1.3.7
+ * Use long sequences to rescaffold scaffolds. May be run by
+ adding libraries to the `long’ parameter. When Scaffolding
+ with RNA-Seq contigs from a Trans-ABySS assembly, the genic
+ contiguity is greatly improved.
+ * Added support gcc 4.8+, and Mac OS X 10.9 Mavericks with clang.
+ * Licensed as GPL for non-commercial purposes.
+
+ abyss-fac:
+ * Added e-size to contiguity statistics as described in the GAGE
+ paper.
+
+ abyss-filtergraph:
+ * Bug fix. `--assemble’ will not fail an assertion.
+ * New option, --max-length, used to remove contigs over the
+ specified threshold.
+ * Trim 2-in 0-out tips when removing tips.
+
+ abyss-map:
+ * Bug fix. Correctly set mapq=0 for reads that multi map.
+
+ abyss-longseqdist:
+ * New program. Generate distance estimates between all contigs a
+ single read maps to.
+
+ abyss-mergepairs:
+ * Report number of reads chastity filtered.
+
+ abyss-overlap:
+ * Bug fix. Handle ambiguity codes.
+
+ abyss-pe:
+ * Support BWA-MEM with assembly. Run using parameter
+ `aligner=bwamem’.
+ * Added another scaffolding stage using long sequences. May be
+ run by adding libraries to the `long’ parameter.
+
+ ABYSS-P:
+ * Bug fix. Do not use awk to merge fasta files.
+
+ abyss-samtobreak:
+ * Building bug fix. Check that ghc modules are installed.
+
+ UnitTest:
+ * The Google C++ testing framework has been added to ABySS.
+
2013-07-15 Anthony Raymond <traymond at bcgsc.ca>
* Release version 1.3.6
* Improved documentation for GitHub devs.
* ABYSS-P performance improvement.
* Various portability and bug fixes.
-
+
abyss-mergepairs:
* Fix program name.
@@ -47,7 +203,7 @@
abyss-pe:
* Attempt to fill scaffold gap with consensus of all paths between
- contigs.
+ contigs.
AdjList:
* Increase the default value of m from 30 to 50.
diff --git a/Common/Algorithms.h b/Common/Algorithms.h
index 9b2a87e..e432238 100644
--- a/Common/Algorithms.h
+++ b/Common/Algorithms.h
@@ -18,9 +18,6 @@ Function for_each_if(It first, It last, Function f, Pred p)
return f;
}
-#if __GXX_EXPERIMENTAL_CXX0X__
-using std::copy_if;
-#else
/** Copies each element in the range [first, last) into the range
* starting at result for which the predicate p is true. */
template<class InputIt, class OutputIt, class Pred>
@@ -35,7 +32,6 @@ OutputIt copy_if(InputIt first, InputIt last, OutputIt result,
}
return result;
}
-#endif
/** Sorts the elements in the range [first,last) ordered by the value
* returned by the unary function op, which is called once for each
diff --git a/Common/Alignment.h b/Common/Alignment.h
index 1e809e1..9307346 100644
--- a/Common/Alignment.h
+++ b/Common/Alignment.h
@@ -73,6 +73,11 @@ static int calculateReverseReadStart(int read_start_pos,
return read_length - qend;
}
+bool operator<(const Alignment& a1) const
+{
+ return read_start_pos < a1.read_start_pos;
+}
+
friend std::istream& operator >>(std::istream& in, Alignment& a)
{
return in >> a.contig
diff --git a/Common/ConstString.h b/Common/ConstString.h
index 6e0bf66..ec5ff5a 100644
--- a/Common/ConstString.h
+++ b/Common/ConstString.h
@@ -1,6 +1,8 @@
#ifndef CONSTSTRING_H
#define CONSTSTRING_H 1
+#include "Common/Hash.h"
+#include "Common/HashFunction.h"
#include <cassert>
#include <cstring>
#include <ostream>
@@ -101,44 +103,13 @@ namespace std {
}
}
-#include "HashFunction.h"
-
-/** Return the hash of the null-terminated string s. */
-static inline size_t hash(const char* s)
-{
- return hashmem(s, strlen(s));
-}
-
-namespace std {
- template <typename T> struct hash;
- template <> struct hash<cstring> {
- size_t operator()(const cstring& s) const
- {
- return ::hash(s);
- }
- };
-} // namespace std
-
-namespace std {
- namespace tr1 {
- template <typename T> struct hash;
- template <> struct hash<cstring> {
- size_t operator()(const cstring& s) const
- {
- return ::hash(s);
- }
- };
- } // namespace tr1
-} // namespace std
-
-namespace __gnu_cxx {
- template <typename T> struct hash;
+NAMESPACE_STD_HASH_BEGIN
template <> struct hash<cstring> {
size_t operator()(const cstring& s) const
{
- return ::hash(s);
+ return hashmem(s.c_str(), strlen(s.c_str()));
}
};
-} // namespace __gnu_cxx
+NAMESPACE_STD_HASH_END
#endif
diff --git a/Common/Dictionary.h b/Common/Dictionary.h
index f055dfc..88f227a 100644
--- a/Common/Dictionary.h
+++ b/Common/Dictionary.h
@@ -19,7 +19,8 @@ class Dictionary
typedef cstring name_reference;
typedef std::vector<const_string> Vector;
- typedef unordered_map<name_reference, index_type> Map;
+ typedef unordered_map<name_reference, index_type,
+ hash<name_reference> > Map;
Dictionary() : m_locked(false) { }
@@ -33,7 +34,7 @@ class Dictionary
if (!inserted.second) {
std::cerr << "error: duplicate ID: `"
<< name << "'\n";
- exit(EXIT_FAILURE);
+ abort();
}
return inserted.first->second;
}
@@ -62,7 +63,7 @@ class Dictionary
if (it == m_map.end()) {
std::cerr << "error: unexpected ID: `"
<< name << "'\n";
- exit(EXIT_FAILURE);
+ abort();
}
return it->second;
}
diff --git a/Common/Hash.h b/Common/Hash.h
new file mode 100644
index 0000000..5b5388e
--- /dev/null
+++ b/Common/Hash.h
@@ -0,0 +1,27 @@
+#ifndef HASH_H_
+#define HASH_H_ 1
+
+#include "config.h"
+
+#if HAVE_STD_HASH
+#ifdef __FUJITSU
+# include <string>
+#else
+# include <functional>
+#endif
+using std::hash;
+# define NAMESPACE_STD_HASH_BEGIN namespace std {
+# define NAMESPACE_STD_HASH_END }
+#elif HAVE_STD_TR1_HASH
+# include <tr1/functional>
+using std::tr1::hash;
+# define NAMESPACE_STD_HASH_BEGIN namespace std { namespace tr1 {
+# define NAMESPACE_STD_HASH_END } }
+#else
+# include <boost/functional/hash.hpp>
+using boost::hash;
+# define NAMESPACE_STD_HASH_BEGIN namespace boost {
+# define NAMESPACE_STD_HASH_END }
+#endif
+
+#endif
diff --git a/Common/HashFunction.h b/Common/HashFunction.h
index dae96fc..c81f853 100644
--- a/Common/HashFunction.h
+++ b/Common/HashFunction.h
@@ -10,4 +10,9 @@ static inline uint64_t hashmem(const void *p, size_t n)
return CityHash64(static_cast<const char*>(p), n);
}
+static inline uint64_t hashmem(const void *p, size_t n, size_t seed)
+{
+ return CityHash64WithSeed(static_cast<const char*>(p), n, seed);
+}
+
#endif
diff --git a/Common/Histogram.h b/Common/Histogram.h
index 2a8e5e8..b466fb5 100644
--- a/Common/Histogram.h
+++ b/Common/Histogram.h
@@ -169,6 +169,19 @@ class Histogram
return argMin((accumulator)ceil(p * sum()));
}
+ /** Return the expected value */
+ double expectedValue() const
+ {
+ double value = 0;
+ accumulator acc = sum();
+ for (Map::const_iterator it = m_map.begin();
+ it != m_map.end(); it++) {
+ value += (double)it->first * it->first
+ * it->second / acc;
+ }
+ return value;
+ }
+
/** Return the N50. */
T n50() const { return weightedPercentile(0.5); }
@@ -209,7 +222,8 @@ class Histogram
{
for (Map::iterator it = m_map.begin(); it != m_map.end();) {
if (m_map.count(it->first - 1) == 0
- && m_map.count(it->first + 1) == 0)
+ && m_map.count(it->first + 1) == 0
+ && m_map.size() > 1)
m_map.erase(it++);
else
++it;
@@ -319,8 +333,10 @@ static inline std::ostream& printContiguityStats(
<< "N80" << sep
<< "N50" << sep
<< "N20" << sep
+ << "E-size" << sep
<< "max" << sep
- << "sum\n";
+ << "sum" << sep
+ << "name" << '\n';
}
unsigned n50 = h.n50();
out << toEng(h0.size()) << sep
@@ -341,6 +357,7 @@ static inline std::ostream& printContiguityStats(
<< toEng(h.weightedPercentile(1 - 0.8)) << sep
<< toEng(n50) << sep
<< toEng(h.weightedPercentile(1 - 0.2)) << sep
+ << toEng((unsigned)h.expectedValue()) << sep
<< toEng(h.maximum()) << sep
<< toEng(sum);
}
diff --git a/Common/Kmer.cpp b/Common/Kmer.cpp
index c86efa4..7466b78 100644
--- a/Common/Kmer.cpp
+++ b/Common/Kmer.cpp
@@ -291,6 +291,27 @@ void Kmer::reverseComplement()
m_seq[i] = swapBases[(uint8_t)m_seq[i]];
}
+bool Kmer::isCanonical() const
+{
+ for (unsigned i = 0, j = s_length - 1;
+ i < s_length / 2 + s_length % 2; i++, j--) {
+ uint8_t base = getBaseCode(m_seq,
+ seqIndexToByteNumber(i), seqIndexToBaseIndex(i));
+ uint8_t rcBase = 0x3 & ~getBaseCode(m_seq,
+ seqIndexToByteNumber(j), seqIndexToBaseIndex(j));
+ if (base == rcBase)
+ continue;
+ return rcBase > base;
+ }
+ return true;
+}
+
+void Kmer::canonicalize()
+{
+ if (!isCanonical())
+ reverseComplement();
+}
+
void Kmer::setLastBase(extDirection dir, uint8_t base)
{
set(dir == SENSE ? s_length - 1 : 0, base);
diff --git a/Common/Kmer.h b/Common/Kmer.h
index 6dcedba..a1a6a25 100644
--- a/Common/Kmer.h
+++ b/Common/Kmer.h
@@ -4,6 +4,7 @@
#include "config.h"
#include "Sense.h"
#include "Sequence.h"
+#include "Common/Hash.h"
#include <cassert>
#include <cstring> // for memcpy
#include <stdint.h>
@@ -51,6 +52,8 @@ class Kmer
}
void reverseComplement();
+ bool isCanonical() const;
+ void canonicalize();
bool isPalindrome() const;
bool isPalindrome(extDirection dir) const;
@@ -122,9 +125,13 @@ static inline Kmer reverseComplement(const Kmer& seq)
return rc;
}
-struct hashKmer
-{
- size_t operator()(const Kmer& o) const { return o.getHashCode(); }
-};
+NAMESPACE_STD_HASH_BEGIN
+ template <> struct hash<Kmer> {
+ size_t operator()(const Kmer& kmer) const
+ {
+ return kmer.getHashCode();
+ }
+ };
+NAMESPACE_STD_HASH_END
#endif
diff --git a/Common/KmerIterator.h b/Common/KmerIterator.h
new file mode 100644
index 0000000..7f1489c
--- /dev/null
+++ b/Common/KmerIterator.h
@@ -0,0 +1,110 @@
+#ifndef KMER_ITERATOR_H_
+#define KMER_ITERATOR_H_
+
+#include "Common/Sequence.h"
+#include "Common/Kmer.h"
+#include <limits>
+#include <iterator>
+#include <string>
+
+struct KmerIterator
+: public std::iterator<std::input_iterator_tag, Kmer>
+{
+ void next()
+ {
+ for(; m_pos + m_k < m_seq.size() + 1; m_pos++) {
+ //TODO(daattali) substr() and find_first_not_of() might be
+ // slow and could be improved for better performance
+ std::string kmerStr = m_seq.substr(m_pos, m_k);
+
+ if (m_pos_invalid >= m_pos + m_k) {
+ // no invalid characters in current kmer, move along
+ } else {
+ size_t pos = m_seq.find_first_not_of("AGCTagct", m_pos);
+ if (pos == std::string::npos) {
+ m_pos_invalid = std::numeric_limits<std::size_t>::max();
+ } else if (pos >= m_pos + m_k) {
+ m_pos_invalid = pos;
+ } else {
+ pos = kmerStr.find_last_not_of("AGCTagct");
+ m_pos += pos;
+ continue;
+ }
+ }
+
+ m_kmer = Kmer(kmerStr);
+ if (m_rc)
+ m_kmer.reverseComplement();
+ return;
+ }
+ m_pos = std::numeric_limits<std::size_t>::max();
+ }
+
+public:
+
+ KmerIterator() :
+ m_seq(),
+ m_pos(std::numeric_limits<std::size_t>::max()),
+ m_pos_invalid(0),
+ m_kmer() { }
+
+ KmerIterator(const Sequence& seq, unsigned k, bool rc = false)
+ : m_seq(seq), m_k(k), m_rc(rc), m_pos(0), m_pos_invalid(0), m_kmer()
+ {
+ next();
+ }
+
+ const Kmer& operator*() const
+ {
+ assert(m_pos + m_k < m_seq.size() + 1);
+ return m_kmer;
+ }
+
+ bool operator==(const KmerIterator& it) const
+ {
+ return m_pos == it.m_pos;
+ }
+
+ bool operator!=(const KmerIterator& it) const
+ {
+ return !(*this == it);
+ }
+
+ KmerIterator& operator++()
+ {
+ assert(m_pos + m_k < m_seq.size() + 1);
+ m_pos++;
+ next();
+ return *this;
+ }
+
+ KmerIterator operator++(int)
+ {
+ KmerIterator it = *this;
+ ++*this;
+ return it;
+ }
+
+ size_t pos() {
+ return m_pos;
+ }
+
+ static const KmerIterator& end()
+ {
+ return KmerIterator::m_end;
+ }
+
+private:
+
+ const Sequence m_seq;
+ unsigned m_k;
+ bool m_rc;
+ size_t m_pos;
+ size_t m_pos_invalid;
+ Kmer m_kmer;
+ static const KmerIterator m_end;
+};
+
+const KmerIterator KmerIterator::m_end = KmerIterator();
+
+#endif
diff --git a/Common/Makefile.am b/Common/Makefile.am
index 08e409d..c4ea89e 100644
--- a/Common/Makefile.am
+++ b/Common/Makefile.am
@@ -15,6 +15,7 @@ libcommon_a_SOURCES = \
Estimate.h \
Fcontrol.cpp Fcontrol.h \
Functional.h \
+ Hash.h \
HashFunction.h \
Histogram.cpp Histogram.h \
IOUtil.h \
@@ -34,5 +35,9 @@ libcommon_a_SOURCES = \
Timer.cpp Timer.h \
Uncompress.cpp Uncompress.h \
UnorderedMap.h \
+ UnorderedSet.h \
+ Warnings.h \
cholesky.hpp \
+ KmerIterator.h \
+ MemUtils.h \
city.cc city.h
diff --git a/Common/Makefile.in b/Common/Makefile.in
deleted file mode 100644
index d8aa9e9..0000000
--- a/Common/Makefile.in
+++ /dev/null
@@ -1,775 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-subdir = Common
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-LIBRARIES = $(noinst_LIBRARIES)
-AR = ar
-ARFLAGS = cru
-AM_V_AR = $(am__v_AR_ at AM_V@)
-am__v_AR_ = $(am__v_AR_ at AM_DEFAULT_V@)
-am__v_AR_0 = @echo " AR " $@;
-am__v_AR_1 =
-libcommon_a_AR = $(AR) $(ARFLAGS)
-libcommon_a_LIBADD =
-am_libcommon_a_OBJECTS = libcommon_a-ContigID.$(OBJEXT) \
- libcommon_a-Fcontrol.$(OBJEXT) libcommon_a-Histogram.$(OBJEXT) \
- libcommon_a-Kmer.$(OBJEXT) libcommon_a-Log.$(OBJEXT) \
- libcommon_a-Options.$(OBJEXT) libcommon_a-SeqExt.$(OBJEXT) \
- libcommon_a-Sequence.$(OBJEXT) \
- libcommon_a-SignalHandler.$(OBJEXT) \
- libcommon_a-Timer.$(OBJEXT) libcommon_a-Uncompress.$(OBJEXT) \
- libcommon_a-city.$(OBJEXT)
-libcommon_a_OBJECTS = $(am_libcommon_a_OBJECTS)
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(libcommon_a_SOURCES)
-DIST_SOURCES = $(libcommon_a_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-noinst_LIBRARIES = libcommon.a
-libcommon_a_CPPFLAGS = -I$(top_srcdir)
-libcommon_a_SOURCES = \
- Algorithms.h \
- Alignment.h \
- BitUtil.h \
- ConstString.h \
- ContigID.h ContigID.cpp \
- ContigNode.h \
- ContigPath.h \
- ContigProperties.h \
- Dictionary.h \
- Estimate.h \
- Fcontrol.cpp Fcontrol.h \
- Functional.h \
- HashFunction.h \
- Histogram.cpp Histogram.h \
- IOUtil.h \
- Iterator.h \
- Kmer.cpp Kmer.h \
- Log.cpp Log.h \
- MemoryUtil.h \
- Options.cpp Options.h \
- PMF.h \
- SAM.h \
- Sense.h \
- SeqExt.cpp SeqExt.h \
- Sequence.cpp Sequence.h \
- SignalHandler.cpp SignalHandler.h \
- StringUtil.h \
- SuffixArray.h \
- Timer.cpp Timer.h \
- Uncompress.cpp Uncompress.h \
- UnorderedMap.h \
- cholesky.hpp \
- city.cc city.h
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cc .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Common/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Common/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-
-clean-noinstLIBRARIES:
- -test -z "$(noinst_LIBRARIES)" || rm -f $(noinst_LIBRARIES)
-
-libcommon.a: $(libcommon_a_OBJECTS) $(libcommon_a_DEPENDENCIES) $(EXTRA_libcommon_a_DEPENDENCIES)
- $(AM_V_at)-rm -f libcommon.a
- $(AM_V_AR)$(libcommon_a_AR) libcommon.a $(libcommon_a_OBJECTS) $(libcommon_a_LIBADD)
- $(AM_V_at)$(RANLIB) libcommon.a
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-ContigID.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-Fcontrol.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-Histogram.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-Kmer.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-Log.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-Options.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-SeqExt.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-Sequence.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-SignalHandler.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-Timer.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-Uncompress.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libcommon_a-city.Po at am__quote@
-
-.cc.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cc.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-libcommon_a-ContigID.o: ContigID.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-ContigID.o -MD -MP -MF $(DEPDIR)/libcommon_a-ContigID.Tpo -c -o libcommon_a-ContigID.o `test -f 'ContigID.cpp' || echo '$(srcdir)/'`ContigID.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-ContigID.Tpo $(DEPDIR)/libcommon_a-ContigID.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='ContigID.cpp' object='libcommon_a-ContigID.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-ContigID.o `test -f 'ContigID.cpp' || echo '$(srcdir)/'`ContigID.cpp
-
-libcommon_a-ContigID.obj: ContigID.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-ContigID.obj -MD -MP -MF $(DEPDIR)/libcommon_a-ContigID.Tpo -c -o libcommon_a-ContigID.obj `if test -f 'ContigID.cpp'; then $(CYGPATH_W) 'ContigID.cpp'; else $(CYGPATH_W) '$(srcdir)/ContigID.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-ContigID.Tpo $(DEPDIR)/libcommon_a-ContigID.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='ContigID.cpp' object='libcommon_a-ContigID.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-ContigID.obj `if test -f 'ContigID.cpp'; then $(CYGPATH_W) 'ContigID.cpp'; else $(CYGPATH_W) '$(srcdir)/ContigID.cpp'; fi`
-
-libcommon_a-Fcontrol.o: Fcontrol.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Fcontrol.o -MD -MP -MF $(DEPDIR)/libcommon_a-Fcontrol.Tpo -c -o libcommon_a-Fcontrol.o `test -f 'Fcontrol.cpp' || echo '$(srcdir)/'`Fcontrol.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Fcontrol.Tpo $(DEPDIR)/libcommon_a-Fcontrol.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Fcontrol.cpp' object='libcommon_a-Fcontrol.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Fcontrol.o `test -f 'Fcontrol.cpp' || echo '$(srcdir)/'`Fcontrol.cpp
-
-libcommon_a-Fcontrol.obj: Fcontrol.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Fcontrol.obj -MD -MP -MF $(DEPDIR)/libcommon_a-Fcontrol.Tpo -c -o libcommon_a-Fcontrol.obj `if test -f 'Fcontrol.cpp'; then $(CYGPATH_W) 'Fcontrol.cpp'; else $(CYGPATH_W) '$(srcdir)/Fcontrol.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Fcontrol.Tpo $(DEPDIR)/libcommon_a-Fcontrol.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Fcontrol.cpp' object='libcommon_a-Fcontrol.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Fcontrol.obj `if test -f 'Fcontrol.cpp'; then $(CYGPATH_W) 'Fcontrol.cpp'; else $(CYGPATH_W) '$(srcdir)/Fcontrol.cpp'; fi`
-
-libcommon_a-Histogram.o: Histogram.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Histogram.o -MD -MP -MF $(DEPDIR)/libcommon_a-Histogram.Tpo -c -o libcommon_a-Histogram.o `test -f 'Histogram.cpp' || echo '$(srcdir)/'`Histogram.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Histogram.Tpo $(DEPDIR)/libcommon_a-Histogram.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Histogram.cpp' object='libcommon_a-Histogram.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Histogram.o `test -f 'Histogram.cpp' || echo '$(srcdir)/'`Histogram.cpp
-
-libcommon_a-Histogram.obj: Histogram.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Histogram.obj -MD -MP -MF $(DEPDIR)/libcommon_a-Histogram.Tpo -c -o libcommon_a-Histogram.obj `if test -f 'Histogram.cpp'; then $(CYGPATH_W) 'Histogram.cpp'; else $(CYGPATH_W) '$(srcdir)/Histogram.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Histogram.Tpo $(DEPDIR)/libcommon_a-Histogram.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Histogram.cpp' object='libcommon_a-Histogram.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Histogram.obj `if test -f 'Histogram.cpp'; then $(CYGPATH_W) 'Histogram.cpp'; else $(CYGPATH_W) '$(srcdir)/Histogram.cpp'; fi`
-
-libcommon_a-Kmer.o: Kmer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Kmer.o -MD -MP -MF $(DEPDIR)/libcommon_a-Kmer.Tpo -c -o libcommon_a-Kmer.o `test -f 'Kmer.cpp' || echo '$(srcdir)/'`Kmer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Kmer.Tpo $(DEPDIR)/libcommon_a-Kmer.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Kmer.cpp' object='libcommon_a-Kmer.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Kmer.o `test -f 'Kmer.cpp' || echo '$(srcdir)/'`Kmer.cpp
-
-libcommon_a-Kmer.obj: Kmer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Kmer.obj -MD -MP -MF $(DEPDIR)/libcommon_a-Kmer.Tpo -c -o libcommon_a-Kmer.obj `if test -f 'Kmer.cpp'; then $(CYGPATH_W) 'Kmer.cpp'; else $(CYGPATH_W) '$(srcdir)/Kmer.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Kmer.Tpo $(DEPDIR)/libcommon_a-Kmer.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Kmer.cpp' object='libcommon_a-Kmer.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Kmer.obj `if test -f 'Kmer.cpp'; then $(CYGPATH_W) 'Kmer.cpp'; else $(CYGPATH_W) '$(srcdir)/Kmer.cpp'; fi`
-
-libcommon_a-Log.o: Log.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Log.o -MD -MP -MF $(DEPDIR)/libcommon_a-Log.Tpo -c -o libcommon_a-Log.o `test -f 'Log.cpp' || echo '$(srcdir)/'`Log.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Log.Tpo $(DEPDIR)/libcommon_a-Log.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Log.cpp' object='libcommon_a-Log.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Log.o `test -f 'Log.cpp' || echo '$(srcdir)/'`Log.cpp
-
-libcommon_a-Log.obj: Log.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Log.obj -MD -MP -MF $(DEPDIR)/libcommon_a-Log.Tpo -c -o libcommon_a-Log.obj `if test -f 'Log.cpp'; then $(CYGPATH_W) 'Log.cpp'; else $(CYGPATH_W) '$(srcdir)/Log.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Log.Tpo $(DEPDIR)/libcommon_a-Log.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Log.cpp' object='libcommon_a-Log.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Log.obj `if test -f 'Log.cpp'; then $(CYGPATH_W) 'Log.cpp'; else $(CYGPATH_W) '$(srcdir)/Log.cpp'; fi`
-
-libcommon_a-Options.o: Options.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Options.o -MD -MP -MF $(DEPDIR)/libcommon_a-Options.Tpo -c -o libcommon_a-Options.o `test -f 'Options.cpp' || echo '$(srcdir)/'`Options.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Options.Tpo $(DEPDIR)/libcommon_a-Options.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Options.cpp' object='libcommon_a-Options.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Options.o `test -f 'Options.cpp' || echo '$(srcdir)/'`Options.cpp
-
-libcommon_a-Options.obj: Options.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Options.obj -MD -MP -MF $(DEPDIR)/libcommon_a-Options.Tpo -c -o libcommon_a-Options.obj `if test -f 'Options.cpp'; then $(CYGPATH_W) 'Options.cpp'; else $(CYGPATH_W) '$(srcdir)/Options.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Options.Tpo $(DEPDIR)/libcommon_a-Options.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Options.cpp' object='libcommon_a-Options.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Options.obj `if test -f 'Options.cpp'; then $(CYGPATH_W) 'Options.cpp'; else $(CYGPATH_W) '$(srcdir)/Options.cpp'; fi`
-
-libcommon_a-SeqExt.o: SeqExt.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-SeqExt.o -MD -MP -MF $(DEPDIR)/libcommon_a-SeqExt.Tpo -c -o libcommon_a-SeqExt.o `test -f 'SeqExt.cpp' || echo '$(srcdir)/'`SeqExt.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-SeqExt.Tpo $(DEPDIR)/libcommon_a-SeqExt.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='SeqExt.cpp' object='libcommon_a-SeqExt.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-SeqExt.o `test -f 'SeqExt.cpp' || echo '$(srcdir)/'`SeqExt.cpp
-
-libcommon_a-SeqExt.obj: SeqExt.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-SeqExt.obj -MD -MP -MF $(DEPDIR)/libcommon_a-SeqExt.Tpo -c -o libcommon_a-SeqExt.obj `if test -f 'SeqExt.cpp'; then $(CYGPATH_W) 'SeqExt.cpp'; else $(CYGPATH_W) '$(srcdir)/SeqExt.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-SeqExt.Tpo $(DEPDIR)/libcommon_a-SeqExt.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='SeqExt.cpp' object='libcommon_a-SeqExt.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-SeqExt.obj `if test -f 'SeqExt.cpp'; then $(CYGPATH_W) 'SeqExt.cpp'; else $(CYGPATH_W) '$(srcdir)/SeqExt.cpp'; fi`
-
-libcommon_a-Sequence.o: Sequence.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Sequence.o -MD -MP -MF $(DEPDIR)/libcommon_a-Sequence.Tpo -c -o libcommon_a-Sequence.o `test -f 'Sequence.cpp' || echo '$(srcdir)/'`Sequence.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Sequence.Tpo $(DEPDIR)/libcommon_a-Sequence.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Sequence.cpp' object='libcommon_a-Sequence.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Sequence.o `test -f 'Sequence.cpp' || echo '$(srcdir)/'`Sequence.cpp
-
-libcommon_a-Sequence.obj: Sequence.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Sequence.obj -MD -MP -MF $(DEPDIR)/libcommon_a-Sequence.Tpo -c -o libcommon_a-Sequence.obj `if test -f 'Sequence.cpp'; then $(CYGPATH_W) 'Sequence.cpp'; else $(CYGPATH_W) '$(srcdir)/Sequence.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Sequence.Tpo $(DEPDIR)/libcommon_a-Sequence.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Sequence.cpp' object='libcommon_a-Sequence.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Sequence.obj `if test -f 'Sequence.cpp'; then $(CYGPATH_W) 'Sequence.cpp'; else $(CYGPATH_W) '$(srcdir)/Sequence.cpp'; fi`
-
-libcommon_a-SignalHandler.o: SignalHandler.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-SignalHandler.o -MD -MP -MF $(DEPDIR)/libcommon_a-SignalHandler.Tpo -c -o libcommon_a-SignalHandler.o `test -f 'SignalHandler.cpp' || echo '$(srcdir)/'`SignalHandler.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-SignalHandler.Tpo $(DEPDIR)/libcommon_a-SignalHandler.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='SignalHandler.cpp' object='libcommon_a-SignalHandler.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-SignalHandler.o `test -f 'SignalHandler.cpp' || echo '$(srcdir)/'`SignalHandler.cpp
-
-libcommon_a-SignalHandler.obj: SignalHandler.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-SignalHandler.obj -MD -MP -MF $(DEPDIR)/libcommon_a-SignalHandler.Tpo -c -o libcommon_a-SignalHandler.obj `if test -f 'SignalHandler.cpp'; then $(CYGPATH_W) 'SignalHandler.cpp'; else $(CYGPATH_W) '$(srcdir)/SignalHandler.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-SignalHandler.Tpo $(DEPDIR)/libcommon_a-SignalHandler.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='SignalHandler.cpp' object='libcommon_a-SignalHandler.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-SignalHandler.obj `if test -f 'SignalHandler.cpp'; then $(CYGPATH_W) 'SignalHandler.cpp'; else $(CYGPATH_W) '$(srcdir)/SignalHandler.cpp'; fi`
-
-libcommon_a-Timer.o: Timer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Timer.o -MD -MP -MF $(DEPDIR)/libcommon_a-Timer.Tpo -c -o libcommon_a-Timer.o `test -f 'Timer.cpp' || echo '$(srcdir)/'`Timer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Timer.Tpo $(DEPDIR)/libcommon_a-Timer.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Timer.cpp' object='libcommon_a-Timer.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Timer.o `test -f 'Timer.cpp' || echo '$(srcdir)/'`Timer.cpp
-
-libcommon_a-Timer.obj: Timer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Timer.obj -MD -MP -MF $(DEPDIR)/libcommon_a-Timer.Tpo -c -o libcommon_a-Timer.obj `if test -f 'Timer.cpp'; then $(CYGPATH_W) 'Timer.cpp'; else $(CYGPATH_W) '$(srcdir)/Timer.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Timer.Tpo $(DEPDIR)/libcommon_a-Timer.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Timer.cpp' object='libcommon_a-Timer.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Timer.obj `if test -f 'Timer.cpp'; then $(CYGPATH_W) 'Timer.cpp'; else $(CYGPATH_W) '$(srcdir)/Timer.cpp'; fi`
-
-libcommon_a-Uncompress.o: Uncompress.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Uncompress.o -MD -MP -MF $(DEPDIR)/libcommon_a-Uncompress.Tpo -c -o libcommon_a-Uncompress.o `test -f 'Uncompress.cpp' || echo '$(srcdir)/'`Uncompress.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Uncompress.Tpo $(DEPDIR)/libcommon_a-Uncompress.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Uncompress.cpp' object='libcommon_a-Uncompress.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Uncompress.o `test -f 'Uncompress.cpp' || echo '$(srcdir)/'`Uncompress.cpp
-
-libcommon_a-Uncompress.obj: Uncompress.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-Uncompress.obj -MD -MP -MF $(DEPDIR)/libcommon_a-Uncompress.Tpo -c -o libcommon_a-Uncompress.obj `if test -f 'Uncompress.cpp'; then $(CYGPATH_W) 'Uncompress.cpp'; else $(CYGPATH_W) '$(srcdir)/Uncompress.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-Uncompress.Tpo $(DEPDIR)/libcommon_a-Uncompress.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Uncompress.cpp' object='libcommon_a-Uncompress.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-Uncompress.obj `if test -f 'Uncompress.cpp'; then $(CYGPATH_W) 'Uncompress.cpp'; else $(CYGPATH_W) '$(srcdir)/Uncompress.cpp'; fi`
-
-libcommon_a-city.o: city.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-city.o -MD -MP -MF $(DEPDIR)/libcommon_a-city.Tpo -c -o libcommon_a-city.o `test -f 'city.cc' || echo '$(srcdir)/'`city.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-city.Tpo $(DEPDIR)/libcommon_a-city.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='city.cc' object='libcommon_a-city.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-city.o `test -f 'city.cc' || echo '$(srcdir)/'`city.cc
-
-libcommon_a-city.obj: city.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libcommon_a-city.obj -MD -MP -MF $(DEPDIR)/libcommon_a-city.Tpo -c -o libcommon_a-city.obj `if test -f 'city.cc'; then $(CYGPATH_W) 'city.cc'; else $(CYGPATH_W) '$(srcdir)/city.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libcommon_a-city.Tpo $(DEPDIR)/libcommon_a-city.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='city.cc' object='libcommon_a-city.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libcommon_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libcommon_a-city.obj `if test -f 'city.cc'; then $(CYGPATH_W) 'city.cc'; else $(CYGPATH_W) '$(srcdir)/city.cc'; fi`
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(LIBRARIES)
-installdirs:
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-generic clean-noinstLIBRARIES mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am:
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am:
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean clean-generic \
- clean-noinstLIBRARIES cscopelist-am ctags ctags-am distclean \
- distclean-compile distclean-generic distclean-tags distdir dvi \
- dvi-am html html-am info info-am install install-am \
- install-data install-data-am install-dvi install-dvi-am \
- install-exec install-exec-am install-html install-html-am \
- install-info install-info-am install-man install-pdf \
- install-pdf-am install-ps install-ps-am install-strip \
- installcheck installcheck-am installdirs maintainer-clean \
- maintainer-clean-generic mostlyclean mostlyclean-compile \
- mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
- uninstall-am
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Common/MemUtils.h b/Common/MemUtils.h
new file mode 100644
index 0000000..a2505d0
--- /dev/null
+++ b/Common/MemUtils.h
@@ -0,0 +1,18 @@
+#ifndef MEMUTILS_H
+#define MEMUTILS_H
+
+#include "Common/UnorderedMap.h"
+
+template <class UnorderedMap>
+static inline size_t
+approxMemSize(const UnorderedMap& map)
+{
+ typedef typename UnorderedMap::value_type Entry;
+ size_t filled_bucket_bytes = map.size() *
+ (sizeof(Entry) + 3 * sizeof(Entry *));
+ size_t empty_bucket_bytes = (1.0 - map.load_factor()) *
+ map.bucket_count() * sizeof(Entry *);
+ return filled_bucket_bytes + empty_bucket_bytes;
+}
+
+#endif
diff --git a/Common/SAM.h b/Common/SAM.h
index 835ec3e..4286a79 100644
--- a/Common/SAM.h
+++ b/Common/SAM.h
@@ -2,7 +2,9 @@
#define SAM_H 1
#include "config.h" // for SAM_SEQ_QUAL
+#include "IOUtil.h"
#include "Alignment.h"
+#include "ContigID.h" // for g_contigNames
#include <algorithm> // for swap
#include <cstdlib> // for exit
#include <iostream>
@@ -51,7 +53,11 @@ struct SAMAlignment {
FDUP = 1024,
};
- SAMAlignment() { }
+ SAMAlignment() :
+ rname("*"),
+ pos(-1),
+ flag(FUNMAP),
+ mapq(0) { }
/** Consturct a single-end alignment. */
SAMAlignment(const Alignment& a) :
@@ -157,45 +163,35 @@ struct SAMAlignment {
std::istringstream in(cigar);
unsigned len;
char type;
- in >> len >> type;
- assert(in.good());
unsigned clip0 = 0;
- switch (type) {
- case 'H': case 'S':
- clip0 = len;
- in >> len >> type;
- assert(in.good());
- if (type != 'M') {
+ a.align_length = 0;
+ unsigned qlen = 0;
+ unsigned clip1 = 0;
+ while (in >> len >> type) {
+ switch (type) {
+ case 'I': case 'X': case '=':
+ qlen += len;
+ clip1 += len;
+ case 'D': case 'N': case 'P':
+ if (a.align_length == 0) {
// Ignore a malformatted CIGAR string whose first
// non-clipping operation is not M.
std::cerr << "warning: malformatted CIGAR: "
<< cigar << std::endl;
- in >> len >> type;
- assert(in.good());
}
- assert(type == 'M');
- a.align_length = len;
break;
- case 'M':
- a.align_length = len;
- break;
- default:
- std::cerr << "error: invalid CIGAR: `"
- << cigar << "'\n";
- exit(EXIT_FAILURE);
- }
-
- unsigned qlen = clip0 + a.align_length;
- unsigned clip1 = 0;
- while (in >> len >> type) {
- switch (type) {
+ case 'M':
+ if ((unsigned)a.align_length < len) {
+ clip0 += a.align_length + clip1;
+ a.align_length = len;
+ qlen += len;
+ clip1 = 0;
+ break;
+ }
case 'H': case 'S':
- case 'I': case 'M': case 'X': case '=':
qlen += len;
clip1 += len;
break;
- case 'D': case 'N': case 'P':
- break;
default:
std::cerr << "error: invalid CIGAR: `"
<< cigar << "'\n";
@@ -204,7 +200,11 @@ struct SAMAlignment {
}
a.read_start_pos = isRC ? clip1 : clip0;
a.read_length = qlen;
- assert(in.eof());
+ if (!in.eof()){
+ std::cerr << "error: invalid CIGAR: `"
+ << cigar << "'\n";
+ exit(EXIT_FAILURE);
+ }
return a;
}
@@ -228,19 +228,20 @@ struct SAMRecord : SAMAlignment {
#if SAM_SEQ_QUAL
std::string seq;
std::string qual;
+ std::string tags;
#endif
- SAMRecord() { }
-
/** Consturct a single-end alignment. */
- explicit SAMRecord(const SAMAlignment& a,
+ explicit SAMRecord(const SAMAlignment& a = SAMAlignment(),
const std::string& qname = "*",
#if SAM_SEQ_QUAL
const std::string& seq = "*",
- const std::string& qual = "*"
+ const std::string& qual = "*",
+ const std::string& tags = ""
#else
const std::string& /*seq*/ = "*",
- const std::string& /*qual*/ = "*"
+ const std::string& /*qual*/ = "*",
+ const std::string& /*tags*/ = ""
#endif
) :
SAMAlignment(a),
@@ -251,7 +252,8 @@ struct SAMRecord : SAMAlignment {
#if SAM_SEQ_QUAL
,
seq(seq),
- qual(qual)
+ qual(qual),
+ tags(tags)
#endif
{
}
@@ -292,6 +294,8 @@ struct SAMRecord : SAMAlignment {
}
}
+ void noMate() { flag &= ~FPAIRED; }
+
/**
* Return the position of the first base of the mate query on the
* target extrapolated from the start of the alignment.
@@ -328,6 +332,8 @@ struct SAMRecord : SAMAlignment {
>> o.cigar >> o.mrnm >> o.mpos >> o.isize;
#if SAM_SEQ_QUAL
in >> o.seq >> o.qual;
+ if (in.peek() != '\n')
+ in >> o.tags;
#endif
in.ignore(std::numeric_limits<std::streamsize>::max(), '\n');
if (!in)
@@ -365,4 +371,31 @@ static inline void fixMate(SAMRecord& a0, SAMRecord& a1)
a1.fixMate(a0);
}
+/** Read contig lengths from SAM headers. */
+static inline void readContigLengths(std::istream& in, std::vector<unsigned>& lengths)
+{
+ assert(in);
+ assert(lengths.empty());
+ assert(g_contigNames.empty());
+ for (std::string line; in.peek() == '@' && getline(in, line);) {
+ std::istringstream ss(line);
+ std::string type;
+ ss >> type;
+ if (type != "@SQ")
+ continue;
+
+ std::string s;
+ unsigned len;
+ ss >> expect(" SN:") >> s >> expect(" LN:") >> len;
+ assert(ss);
+
+ put(g_contigNames, lengths.size(), s);
+ lengths.push_back(len);
+ }
+ if (lengths.empty()) {
+ std::cerr << "error: no @SQ records in the SAM header\n";
+ exit(EXIT_FAILURE);
+ }
+}
+
#endif
diff --git a/Common/StringUtil.h b/Common/StringUtil.h
index 1e4d78b..03e2a07 100644
--- a/Common/StringUtil.h
+++ b/Common/StringUtil.h
@@ -5,6 +5,7 @@
#include <iomanip>
#include <sstream>
#include <string>
+#include <cmath>
/** Return the last character of s and remove it. */
static inline char chop(std::string& s)
@@ -87,4 +88,70 @@ bool endsWith(const std::string& s, const std::string& suffix)
suffix.begin());
}
+static inline
+bool isReadNamePair(const std::string& name1, const std::string& name2)
+{
+ assert(!name1.empty() && !name2.empty());
+
+ if (name1 == name2)
+ return true;
+
+ if (endsWith(name1,"/1") && endsWith(name2,"/2")) {
+ int len1 = name1.length();
+ int len2 = name2.length();
+ assert(len1 > 2 && len2 > 2);
+ return name1.compare(0, len1-2, name2, 0, len2-2) == 0;
+ }
+
+ return false;
+}
+
+static inline size_t SIToBytes(std::istringstream& iss)
+{
+ double size;
+ std::string units;
+
+ iss >> size;
+ if (iss.fail()) {
+ // not prefixed by a number
+ return 0;
+ }
+
+ iss >> units;
+ if (iss.fail() && iss.eof()) {
+ // no units given; clear fail flag
+ // and assume bytes
+ iss.clear(std::ios::eofbit);
+ return (size_t)ceil(size);
+ }
+
+ if (units.size() > 1) {
+ // unrecognized multichar suffix
+ iss.setstate(std::ios::failbit);
+ return 0;
+ }
+
+ switch(tolower(units[0])) {
+ case 'k':
+ size *= (size_t)1<<10; break;
+ case 'm':
+ size *= (size_t)1<<20; break;
+ case 'g':
+ size *= (size_t)1<<30; break;
+ case 't':
+ size *= (size_t)1<<40; break;
+ default:
+ iss.setstate(std::ios::failbit);
+ return 0;
+ }
+
+ return (size_t)ceil(size);
+}
+
+static inline size_t SIToBytes(const std::string& str)
+{
+ std::istringstream iss(str);
+ return SIToBytes(iss);
+}
+
#endif
diff --git a/Common/Uncompress.cpp b/Common/Uncompress.cpp
index 476d1fb..c1de69e 100644
--- a/Common/Uncompress.cpp
+++ b/Common/Uncompress.cpp
@@ -51,6 +51,7 @@ static const char* zcatExec(const string& path)
endsWith(path, ".jfq") ? "jellyfish qdump" :
endsWith(path, ".sra") ? "fastq-dump -Z --split-spot" :
endsWith(path, ".url") ? "wget -O- -i" :
+ endsWith(path, ".fqz") ? "fqz_comp -d" :
NULL;
}
diff --git a/Common/UnorderedMap.h b/Common/UnorderedMap.h
index 22bb58c..6df26a1 100644
--- a/Common/UnorderedMap.h
+++ b/Common/UnorderedMap.h
@@ -2,6 +2,7 @@
#define UNORDEREDMAP_H 1
#include "config.h"
+#include "Common/Hash.h"
#if HAVE_UNORDERED_MAP
# include <unordered_map>
diff --git a/Common/UnorderedSet.h b/Common/UnorderedSet.h
new file mode 100644
index 0000000..58d1da6
--- /dev/null
+++ b/Common/UnorderedSet.h
@@ -0,0 +1,21 @@
+#ifndef UNORDEREDSET_H
+#define UNORDEREDSET_H 1
+
+#include "config.h"
+#include "Common/Hash.h"
+
+#if HAVE_UNORDERED_SET
+# include <unordered_set>
+using std::unordered_set;
+using std::unordered_multiset;
+#elif HAVE_TR1_UNORDERED_SET
+# include <tr1/unordered_set>
+using std::tr1::unordered_set;
+using std::tr1::unordered_multiset;
+#else
+# include <boost/unordered_set.hpp>
+using boost::unordered_set;
+using boost::unordered_multiset;
+#endif
+
+#endif
diff --git a/Common/Warnings.h b/Common/Warnings.h
new file mode 100644
index 0000000..9dffe51
--- /dev/null
+++ b/Common/Warnings.h
@@ -0,0 +1,6 @@
+#ifndef WARNINGS_H_
+#define WARNINGS_H_
+
+#define SUPPRESS_UNUSED_WARNING(a) (void)a
+
+#endif
diff --git a/Common/cholesky.hpp b/Common/cholesky.hpp
index c7c0c6d..0d72bbe 100644
--- a/Common/cholesky.hpp
+++ b/Common/cholesky.hpp
@@ -53,8 +53,6 @@ size_t cholesky_decompose(const MATRIX& A, TRIA& L)
{
using namespace ublas;
- typedef typename MATRIX::value_type T;
-
assert( A.size1() == A.size2() );
assert( A.size1() == L.size1() );
assert( A.size2() == L.size2() );
@@ -95,8 +93,6 @@ size_t cholesky_decompose(MATRIX& A)
{
using namespace ublas;
- typedef typename MATRIX::value_type T;
-
const MATRIX& A_c(A);
const size_t n = A.size1();
diff --git a/Consensus/Consensus.cpp b/Consensus/Consensus.cpp
index 669c2fa..2d32078 100644
--- a/Consensus/Consensus.cpp
+++ b/Consensus/Consensus.cpp
@@ -22,7 +22,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Tony Raymond and Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... CONTIG\n"
diff --git a/Consensus/Makefile.in b/Consensus/Makefile.in
deleted file mode 100644
index f15027b..0000000
--- a/Consensus/Makefile.in
+++ /dev/null
@@ -1,589 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = Consensus$(EXEEXT)
-subdir = Consensus
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_Consensus_OBJECTS = Consensus-Consensus.$(OBJEXT)
-Consensus_OBJECTS = $(am_Consensus_OBJECTS)
-Consensus_DEPENDENCIES = $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(Consensus_SOURCES)
-DIST_SOURCES = $(Consensus_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-Consensus_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-Consensus_LDADD = \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-Consensus_SOURCES = \
- Consensus.cpp
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Consensus/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Consensus/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-Consensus$(EXEEXT): $(Consensus_OBJECTS) $(Consensus_DEPENDENCIES) $(EXTRA_Consensus_DEPENDENCIES)
- @rm -f Consensus$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(Consensus_OBJECTS) $(Consensus_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/Consensus-Consensus.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-Consensus-Consensus.o: Consensus.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(Consensus_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT Consensus-Consensus.o -MD -MP -MF $(DEPDIR)/Consensus-Consensus.Tpo -c -o Consensus-Consensus.o `test -f 'Consensus.cpp' || echo '$(srcdir)/'`Consensus.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/Consensus-Consensus.Tpo $(DEPDIR)/Consensus-Consensus.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Consensus.cpp' object='Consensus-Consensus.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(Consensus_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o Consensus-Consensus.o `test -f 'Consensus.cpp' || echo '$(srcdir)/'`Consensus.cpp
-
-Consensus-Consensus.obj: Consensus.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(Consensus_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT Consensus-Consensus.obj -MD -MP -MF $(DEPDIR)/Consensus-Consensus.Tpo -c -o Consensus-Consensus.obj `if test -f 'Consensus.cpp'; then $(CYGPATH_W) 'Consensus.cpp'; else $(CYGPATH_W) '$(srcdir)/Consensus.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/Consensus-Consensus.Tpo $(DEPDIR)/Consensus-Consensus.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Consensus.cpp' object='Consensus-Consensus.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(Consensus_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o Consensus-Consensus.obj `if test -f 'Consensus.cpp'; then $(CYGPATH_W) 'Consensus.cpp'; else $(CYGPATH_W) '$(srcdir)/Consensus.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/DAssembler/DAssembler.cpp b/DAssembler/DAssembler.cpp
index c4e6aa4..e189198 100644
--- a/DAssembler/DAssembler.cpp
+++ b/DAssembler/DAssembler.cpp
@@ -22,7 +22,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Rod Docking.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
namespace opt {
static unsigned max_overlap = 10;
diff --git a/DAssembler/Makefile.in b/DAssembler/Makefile.in
deleted file mode 100644
index f510a3d..0000000
--- a/DAssembler/Makefile.in
+++ /dev/null
@@ -1,618 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = DAssembler$(EXEEXT)
-subdir = DAssembler
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_DAssembler_OBJECTS = DAssembler-DAssembler.$(OBJEXT) \
- DAssembler-RotatedRead.$(OBJEXT)
-DAssembler_OBJECTS = $(am_DAssembler_OBJECTS)
-DAssembler_DEPENDENCIES = $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(DAssembler_SOURCES)
-DIST_SOURCES = $(DAssembler_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-DAssembler_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-DAssembler_LDADD = \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-DAssembler_SOURCES = DAssembler.cpp \
- RotatedRead.cpp RotatedRead.h \
- Rotation.h
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign DAssembler/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign DAssembler/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-DAssembler$(EXEEXT): $(DAssembler_OBJECTS) $(DAssembler_DEPENDENCIES) $(EXTRA_DAssembler_DEPENDENCIES)
- @rm -f DAssembler$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(DAssembler_OBJECTS) $(DAssembler_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/DAssembler-DAssembler.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/DAssembler-RotatedRead.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-DAssembler-DAssembler.o: DAssembler.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DAssembler_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT DAssembler-DAssembler.o -MD -MP -MF $(DEPDIR)/DAssembler-DAssembler.Tpo -c -o DAssembler-DAssembler.o `test -f 'DAssembler.cpp' || echo '$(srcdir)/'`DAssembler.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/DAssembler-DAssembler.Tpo $(DEPDIR)/DAssembler-DAssembler.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='DAssembler.cpp' object='DAssembler-DAssembler.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DAssembler_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o DAssembler-DAssembler.o `test -f 'DAssembler.cpp' || echo '$(srcdir)/'`DAssembler.cpp
-
-DAssembler-DAssembler.obj: DAssembler.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DAssembler_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT DAssembler-DAssembler.obj -MD -MP -MF $(DEPDIR)/DAssembler-DAssembler.Tpo -c -o DAssembler-DAssembler.obj `if test -f 'DAssembler.cpp'; then $(CYGPATH_W) 'DAssembler.cpp'; else $(CYGPATH_W) '$(srcdir)/DAssembler.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/DAssembler-DAssembler.Tpo $(DEPDIR)/DAssembler-DAssembler.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='DAssembler.cpp' object='DAssembler-DAssembler.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DAssembler_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o DAssembler-DAssembler.obj `if test -f 'DAssembler.cpp'; then $(CYGPATH_W) 'DAssembler.cpp'; else $(CYGPATH_W) '$(srcdir)/DAssembler.cpp'; fi`
-
-DAssembler-RotatedRead.o: RotatedRead.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DAssembler_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT DAssembler-RotatedRead.o -MD -MP -MF $(DEPDIR)/DAssembler-RotatedRead.Tpo -c -o DAssembler-RotatedRead.o `test -f 'RotatedRead.cpp' || echo '$(srcdir)/'`RotatedRead.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/DAssembler-RotatedRead.Tpo $(DEPDIR)/DAssembler-RotatedRead.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='RotatedRead.cpp' object='DAssembler-RotatedRead.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DAssembler_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o DAssembler-RotatedRead.o `test -f 'RotatedRead.cpp' || echo '$(srcdir)/'`RotatedRead.cpp
-
-DAssembler-RotatedRead.obj: RotatedRead.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DAssembler_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT DAssembler-RotatedRead.obj -MD -MP -MF $(DEPDIR)/DAssembler-RotatedRead.Tpo -c -o DAssembler-RotatedRead.obj `if test -f 'RotatedRead.cpp'; then $(CYGPATH_W) 'RotatedRead.cpp'; else $(CYGPATH_W) '$(srcdir)/RotatedRead.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/DAssembler-RotatedRead.Tpo $(DEPDIR)/DAssembler-RotatedRead.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='RotatedRead.cpp' object='DAssembler-RotatedRead.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DAssembler_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o DAssembler-RotatedRead.obj `if test -f 'RotatedRead.cpp'; then $(CYGPATH_W) 'RotatedRead.cpp'; else $(CYGPATH_W) '$(srcdir)/RotatedRead.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/DataLayer/FastaConcat.h b/DataLayer/FastaConcat.h
new file mode 100644
index 0000000..2b9bd63
--- /dev/null
+++ b/DataLayer/FastaConcat.h
@@ -0,0 +1,89 @@
+#ifndef FASTACONCAT_H
+#define FASTACONCAT_H 1
+
+#include "FastaReader.h"
+#include <cassert>
+#include <vector>
+#include <iostream>
+
+class FastaConcat
+{
+
+ public:
+
+ FastaConcat(char** first, char** last, int flags)
+ : m_fail(false), m_flags(flags), m_fileIndex(0),
+ m_reader(NULL)
+ {
+ assert(first != last);
+ for (char** p = first; p != last; p++)
+ m_filenames.push_back(*p);
+ m_reader = new FastaReader(
+ m_filenames.at(m_fileIndex).c_str(), flags);
+ }
+
+ ~FastaConcat()
+ {
+ if(m_reader != NULL)
+ delete m_reader;
+ }
+
+ bool eof() const
+ {
+ return m_fileIndex == m_filenames.size();
+ }
+
+ /** Return true if all of the streams are still good. */
+ operator void*() const
+ {
+ return m_fail ? NULL : const_cast<FastaConcat*>(this);
+ }
+
+ template <typename Record>
+ friend FastaConcat& operator>>(
+ FastaConcat& in, Record& o)
+ {
+ in.m_fail = false;
+ for (; in.m_fileIndex < in.m_filenames.size(); in.m_fileIndex++) {
+ assert(in.m_reader != NULL);
+ *in.m_reader >> o;
+ if (!in.m_reader->fail()) {
+ return in;
+ } else if (in.m_reader->fail() && !in.m_reader->eof()) {
+ in.m_fail = true;
+ return in;
+ } else {
+ delete in.m_reader;
+ in.m_reader = NULL;
+ if (in.m_fileIndex < in.m_filenames.size() - 1) {
+ in.m_reader = new FastaReader(
+ in.m_filenames.at(in.m_fileIndex + 1).c_str(),
+ in.m_flags);
+ }
+ }
+ }
+ // set fail when attempting to read at eof
+ // (like normal iostreams)
+ in.m_fail = true;
+ return in;
+ }
+
+ private:
+
+ /** Emulates failbit of iostream */
+ bool m_fail;
+
+ /** FastaReader flags */
+ int m_flags;
+
+ /** Index of current file */
+ unsigned m_fileIndex;
+
+ /** FastaReader for current file */
+ FastaReader* m_reader;
+
+ /** List of filenames to read */
+ std::vector<std::string> m_filenames;
+};
+
+#endif
diff --git a/DataLayer/FastaReader.cpp b/DataLayer/FastaReader.cpp
index 655be43..a0626bb 100644
--- a/DataLayer/FastaReader.cpp
+++ b/DataLayer/FastaReader.cpp
@@ -25,6 +25,9 @@ namespace opt {
/** quality offset, usually 33 or 64 */
int qualityOffset;
+
+ /** minimum quality for internal bases */
+ int internalQThreshold;
}
/** Output an error message. */
@@ -142,14 +145,15 @@ next_record:
string header;
getline(header);
istringstream headerStream(header);
- headerStream >> recordType >> id >> ws;
- std::getline(headerStream, comment);
// Ignore SAM headers.
- if (id.length() == 2 && isupper(id[0]) && isupper(id[1])
- && comment.length() > 2 && comment[2] == ':')
+ if (header[0] == '@' && isalpha(header[1])
+ && isalpha(header[2]) && header[3] == '\t')
goto next_record;
+ headerStream >> recordType >> id >> ws;
+ std::getline(headerStream, comment);
+
// Casava FASTQ format
if (comment.size() > 3
&& comment[1] == ':' && comment[3] == ':') {
@@ -340,16 +344,15 @@ next_record:
q.erase(m_maxLength);
}
+ static const char ASCII[] =
+ " !\"#$%&'()*+,-./0123456789:;<=>?"
+ "@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_"
+ "`abcdefghijklmnopqrstuvwxyz{|}~";
if (opt::qualityThreshold > 0 && !q.empty()) {
assert(s.length() == q.length());
- static const char ASCII[] =
- " !\"#$%&'()*+,-./0123456789:;<=>?"
- "@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_"
- "`abcdefghijklmnopqrstuvwxyz{|}~";
assert(qualityOffset > (unsigned)ASCII[0]);
const char* goodQual = ASCII + (qualityOffset - ASCII[0])
+ opt::qualityThreshold;
-
size_t trimFront = q.find_first_of(goodQual);
size_t trimBack = q.find_last_of(goodQual) + 1;
if (trimFront >= trimBack) {
@@ -364,6 +367,18 @@ next_record:
}
}
+ if (opt::internalQThreshold > 0 && !q.empty()) {
+ assert(s.length() == q.length());
+ assert(qualityOffset > (unsigned)ASCII[0]);
+ const char* internalGoodQual = ASCII
+ + (qualityOffset - ASCII[0])
+ + opt::internalQThreshold;
+ size_t i = 0;
+ while ((i = q.find_first_not_of(internalGoodQual, i))
+ != string::npos)
+ s[i++] = 'N';
+ }
+
assert(qualityOffset >= 33);
if (flagConvertQual() && qualityOffset != 33) {
// Convert to standard quality (ASCII 33).
diff --git a/DataLayer/FastaReader.h b/DataLayer/FastaReader.h
index e097267..c0cafeb 100644
--- a/DataLayer/FastaReader.h
+++ b/DataLayer/FastaReader.h
@@ -45,8 +45,11 @@ class FastaReader {
/** Return whether this stream is at end-of-file. */
bool eof() const { return m_in.eof(); };
+ /** Return true if failbit or badbit of stream is set. */
+ bool fail() const { return m_in.fail(); };
+
/** Return whether this stream is good. */
- operator void*() const { return m_in; }
+ operator const void*() const { return m_in ? this : NULL; }
/** Return the next character of this stream. */
int peek() { return m_in.peek(); }
@@ -133,6 +136,16 @@ struct FastaRecord
const Sequence& seq)
: id(id), comment(comment), anchor(0), seq(seq) { }
+ operator Sequence() const { return seq; }
+
+ FastaRecord& operator=(const std::string& s)
+ {
+ seq = s;
+ return *this;
+ }
+
+ size_t size() const { return seq.size(); }
+
friend FastaReader& operator >>(FastaReader& in, FastaRecord& o)
{
std::string q;
diff --git a/DataLayer/FastaWriter.cpp b/DataLayer/FastaWriter.cpp
index 6082c59..8aaa362 100644
--- a/DataLayer/FastaWriter.cpp
+++ b/DataLayer/FastaWriter.cpp
@@ -55,3 +55,19 @@ void FastaWriter::WriteSequence(const Sequence& seq, unsigned id,
if (n < 0)
die(m_path);
}
+
+void FastaWriter::WriteSequence(const Sequence& seq, unsigned long long id, const std::string& comment)
+{
+ assert(m_fileHandle != NULL);
+ int n = fprintf(m_fileHandle, ">%llu %s\n%s\n", id, comment.c_str(), seq.c_str());
+ if (n < 0)
+ die(m_path);
+}
+
+void FastaWriter::WriteSequence(const Sequence& seq, const std::string& id, const std::string& comment)
+{
+ assert(m_fileHandle != NULL);
+ int n = fprintf(m_fileHandle, ">%s %s\n%s\n", id.c_str(), comment.c_str(), seq.c_str());
+ if (n < 0)
+ die(m_path);
+}
diff --git a/DataLayer/FastaWriter.h b/DataLayer/FastaWriter.h
index 139e659..6dc68fe 100644
--- a/DataLayer/FastaWriter.h
+++ b/DataLayer/FastaWriter.h
@@ -24,6 +24,12 @@ class FastaWriter {
WriteSequence(seq, id, multiplicity, "");
}
+ void WriteSequence(const Sequence& seq, unsigned long long id,
+ const std::string& comment);
+
+ void WriteSequence(const Sequence& seq, const std::string& id,
+ const std::string& comment);
+
private:
const char *m_path;
FILE* m_fileHandle;
diff --git a/DataLayer/Makefile.am b/DataLayer/Makefile.am
index 7ff7ead..3106695 100644
--- a/DataLayer/Makefile.am
+++ b/DataLayer/Makefile.am
@@ -25,4 +25,5 @@ libdatalayer_a_SOURCES = \
FastaInterleave.h \
FastaReader.cpp FastaReader.h \
FastaWriter.cpp FastaWriter.h \
+ FastaConcat.h \
Options.h
diff --git a/DataLayer/Makefile.in b/DataLayer/Makefile.in
deleted file mode 100644
index dd61834..0000000
--- a/DataLayer/Makefile.in
+++ /dev/null
@@ -1,706 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = abyss-fac$(EXEEXT) abyss-tofastq$(EXEEXT)
-subdir = DataLayer
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-LIBRARIES = $(noinst_LIBRARIES)
-AR = ar
-ARFLAGS = cru
-AM_V_AR = $(am__v_AR_ at AM_V@)
-am__v_AR_ = $(am__v_AR_ at AM_DEFAULT_V@)
-am__v_AR_0 = @echo " AR " $@;
-am__v_AR_1 =
-libdatalayer_a_AR = $(AR) $(ARFLAGS)
-libdatalayer_a_LIBADD =
-am_libdatalayer_a_OBJECTS = libdatalayer_a-FastaReader.$(OBJEXT) \
- libdatalayer_a-FastaWriter.$(OBJEXT)
-libdatalayer_a_OBJECTS = $(am_libdatalayer_a_OBJECTS)
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_abyss_fac_OBJECTS = abyss_fac-fac.$(OBJEXT)
-abyss_fac_OBJECTS = $(am_abyss_fac_OBJECTS)
-abyss_fac_DEPENDENCIES = libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-am_abyss_tofastq_OBJECTS = abyss_tofastq-abyss-tofastq.$(OBJEXT)
-abyss_tofastq_OBJECTS = $(am_abyss_tofastq_OBJECTS)
-abyss_tofastq_DEPENDENCIES = libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(libdatalayer_a_SOURCES) $(abyss_fac_SOURCES) \
- $(abyss_tofastq_SOURCES)
-DIST_SOURCES = $(libdatalayer_a_SOURCES) $(abyss_fac_SOURCES) \
- $(abyss_tofastq_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-noinst_LIBRARIES = libdatalayer.a
-abyss_fac_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common
-
-abyss_fac_LDADD = libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-abyss_fac_SOURCES = fac.cc
-abyss_tofastq_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common
-
-abyss_tofastq_LDADD = libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-abyss_tofastq_SOURCES = abyss-tofastq.cc
-libdatalayer_a_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common
-
-libdatalayer_a_SOURCES = \
- FastaIndex.h \
- FastaInterleave.h \
- FastaReader.cpp FastaReader.h \
- FastaWriter.cpp FastaWriter.h \
- Options.h
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cc .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign DataLayer/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign DataLayer/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-
-clean-noinstLIBRARIES:
- -test -z "$(noinst_LIBRARIES)" || rm -f $(noinst_LIBRARIES)
-
-libdatalayer.a: $(libdatalayer_a_OBJECTS) $(libdatalayer_a_DEPENDENCIES) $(EXTRA_libdatalayer_a_DEPENDENCIES)
- $(AM_V_at)-rm -f libdatalayer.a
- $(AM_V_AR)$(libdatalayer_a_AR) libdatalayer.a $(libdatalayer_a_OBJECTS) $(libdatalayer_a_LIBADD)
- $(AM_V_at)$(RANLIB) libdatalayer.a
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-abyss-fac$(EXEEXT): $(abyss_fac_OBJECTS) $(abyss_fac_DEPENDENCIES) $(EXTRA_abyss_fac_DEPENDENCIES)
- @rm -f abyss-fac$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(abyss_fac_OBJECTS) $(abyss_fac_LDADD) $(LIBS)
-
-abyss-tofastq$(EXEEXT): $(abyss_tofastq_OBJECTS) $(abyss_tofastq_DEPENDENCIES) $(EXTRA_abyss_tofastq_DEPENDENCIES)
- @rm -f abyss-tofastq$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(abyss_tofastq_OBJECTS) $(abyss_tofastq_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_fac-fac.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_tofastq-abyss-tofastq.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libdatalayer_a-FastaReader.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libdatalayer_a-FastaWriter.Po at am__quote@
-
-.cc.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cc.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-libdatalayer_a-FastaReader.o: FastaReader.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libdatalayer_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libdatalayer_a-FastaReader.o -MD -MP -MF $(DEPDIR)/libdatalayer_a-FastaReader.Tpo -c -o libdatalayer_a-FastaReader.o `test -f 'FastaReader.cpp' || echo '$(srcdir)/'`FastaReader.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libdatalayer_a-FastaReader.Tpo $(DEPDIR)/libdatalayer_a-FastaReader.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='FastaReader.cpp' object='libdatalayer_a-FastaReader.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libdatalayer_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libdatalayer_a-FastaReader.o `test -f 'FastaReader.cpp' || echo '$(srcdir)/'`FastaReader.cpp
-
-libdatalayer_a-FastaReader.obj: FastaReader.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libdatalayer_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libdatalayer_a-FastaReader.obj -MD -MP -MF $(DEPDIR)/libdatalayer_a-FastaReader.Tpo -c -o libdatalayer_a-FastaReader.obj `if test -f 'FastaReader.cpp'; then $(CYGPATH_W) 'FastaReader.cpp'; else $(CYGPATH_W) '$(srcdir)/FastaReader.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libdatalayer_a-FastaReader.Tpo $(DEPDIR)/libdatalayer_a-FastaReader.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='FastaReader.cpp' object='libdatalayer_a-FastaReader.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libdatalayer_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libdatalayer_a-FastaReader.obj `if test -f 'FastaReader.cpp'; then $(CYGPATH_W) 'FastaReader.cpp'; else $(CYGPATH_W) '$(srcdir)/FastaReader.cpp'; fi`
-
-libdatalayer_a-FastaWriter.o: FastaWriter.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libdatalayer_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libdatalayer_a-FastaWriter.o -MD -MP -MF $(DEPDIR)/libdatalayer_a-FastaWriter.Tpo -c -o libdatalayer_a-FastaWriter.o `test -f 'FastaWriter.cpp' || echo '$(srcdir)/'`FastaWriter.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libdatalayer_a-FastaWriter.Tpo $(DEPDIR)/libdatalayer_a-FastaWriter.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='FastaWriter.cpp' object='libdatalayer_a-FastaWriter.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libdatalayer_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libdatalayer_a-FastaWriter.o `test -f 'FastaWriter.cpp' || echo '$(srcdir)/'`FastaWriter.cpp
-
-libdatalayer_a-FastaWriter.obj: FastaWriter.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libdatalayer_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libdatalayer_a-FastaWriter.obj -MD -MP -MF $(DEPDIR)/libdatalayer_a-FastaWriter.Tpo -c -o libdatalayer_a-FastaWriter.obj `if test -f 'FastaWriter.cpp'; then $(CYGPATH_W) 'FastaWriter.cpp'; else $(CYGPATH_W) '$(srcdir)/FastaWriter.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libdatalayer_a-FastaWriter.Tpo $(DEPDIR)/libdatalayer_a-FastaWriter.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='FastaWriter.cpp' object='libdatalayer_a-FastaWriter.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libdatalayer_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libdatalayer_a-FastaWriter.obj `if test -f 'FastaWriter.cpp'; then $(CYGPATH_W) 'FastaWriter.cpp'; else $(CYGPATH_W) '$(srcdir)/FastaWriter.cpp'; fi`
-
-abyss_fac-fac.o: fac.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_fac_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_fac-fac.o -MD -MP -MF $(DEPDIR)/abyss_fac-fac.Tpo -c -o abyss_fac-fac.o `test -f 'fac.cc' || echo '$(srcdir)/'`fac.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_fac-fac.Tpo $(DEPDIR)/abyss_fac-fac.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='fac.cc' object='abyss_fac-fac.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_fac_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_fac-fac.o `test -f 'fac.cc' || echo '$(srcdir)/'`fac.cc
-
-abyss_fac-fac.obj: fac.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_fac_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_fac-fac.obj -MD -MP -MF $(DEPDIR)/abyss_fac-fac.Tpo -c -o abyss_fac-fac.obj `if test -f 'fac.cc'; then $(CYGPATH_W) 'fac.cc'; else $(CYGPATH_W) '$(srcdir)/fac.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_fac-fac.Tpo $(DEPDIR)/abyss_fac-fac.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='fac.cc' object='abyss_fac-fac.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_fac_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_fac-fac.obj `if test -f 'fac.cc'; then $(CYGPATH_W) 'fac.cc'; else $(CYGPATH_W) '$(srcdir)/fac.cc'; fi`
-
-abyss_tofastq-abyss-tofastq.o: abyss-tofastq.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_tofastq_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_tofastq-abyss-tofastq.o -MD -MP -MF $(DEPDIR)/abyss_tofastq-abyss-tofastq.Tpo -c -o abyss_tofastq-abyss-tofastq.o `test -f 'abyss-tofastq.cc' || echo '$(srcdir)/'`abyss-tofastq.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_tofastq-abyss-tofastq.Tpo $(DEPDIR)/abyss_tofastq-abyss-tofastq.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='abyss-tofastq.cc' object='abyss_tofastq-abyss-tofastq.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_tofastq_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_tofastq-abyss-tofastq.o `test -f 'abyss-tofastq.cc' || echo '$(srcdir)/'`abyss-tofastq.cc
-
-abyss_tofastq-abyss-tofastq.obj: abyss-tofastq.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_tofastq_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_tofastq-abyss-tofastq.obj -MD -MP -MF $(DEPDIR)/abyss_tofastq-abyss-tofastq.Tpo -c -o abyss_tofastq-abyss-tofastq.obj `if test -f 'abyss-tofastq.cc'; then $(CYGPATH_W) 'abyss-tofastq.cc'; else $(CYGPATH_W) '$(srcdir)/abyss-tofastq.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_tofastq-abyss-tofastq.Tpo $(DEPDIR)/abyss_tofastq-abyss-tofastq.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='abyss-tofastq.cc' object='abyss_tofastq-abyss-tofastq.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_tofastq_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_tofastq-abyss-tofastq.obj `if test -f 'abyss-tofastq.cc'; then $(CYGPATH_W) 'abyss-tofastq.cc'; else $(CYGPATH_W) '$(srcdir)/abyss-tofastq.cc'; fi`
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(LIBRARIES) $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic clean-noinstLIBRARIES \
- mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic clean-noinstLIBRARIES \
- cscopelist-am ctags ctags-am distclean distclean-compile \
- distclean-generic distclean-tags distdir dvi dvi-am html \
- html-am info info-am install install-am install-binPROGRAMS \
- install-data install-data-am install-dvi install-dvi-am \
- install-exec install-exec-am install-html install-html-am \
- install-info install-info-am install-man install-pdf \
- install-pdf-am install-ps install-ps-am install-strip \
- installcheck installcheck-am installdirs maintainer-clean \
- maintainer-clean-generic mostlyclean mostlyclean-compile \
- mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
- uninstall-am uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/DataLayer/Options.h b/DataLayer/Options.h
index 625fc07..77fc95b 100644
--- a/DataLayer/Options.h
+++ b/DataLayer/Options.h
@@ -6,6 +6,7 @@ namespace opt {
extern int trimMasked;
extern int qualityOffset;
extern int qualityThreshold;
+ extern int internalQThreshold;
}
#endif
diff --git a/DataLayer/abyss-tofastq.cc b/DataLayer/abyss-tofastq.cc
index 547afd8..1b88232 100644
--- a/DataLayer/abyss-tofastq.cc
+++ b/DataLayer/abyss-tofastq.cc
@@ -22,7 +22,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... [FILE]...\n"
diff --git a/DataLayer/fac.cc b/DataLayer/fac.cc
index 44f897b..4d26c0b 100644
--- a/DataLayer/fac.cc
+++ b/DataLayer/fac.cc
@@ -21,7 +21,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... [FILE]...\n"
@@ -116,6 +116,7 @@ static void printContiguityStatistics(const char* path)
<< "N80" << sep
<< "N50" << sep
<< "N20" << sep
+ << "E-size" << sep
<< "max" << sep
<< "sum" << sep
<< "name" << sep << '\n';
@@ -132,6 +133,7 @@ static void printContiguityStatistics(const char* path)
<< "N80" << sep
<< "N50" << sep
<< "N20" << sep
+ << "E-size" << sep
<< "max" << sep
<< "sum" << sep
<< "name" << '\n';
@@ -147,6 +149,7 @@ static void printContiguityStatistics(const char* path)
<< "------" << sep
<< "------" << sep
<< "------" << sep
+ << "------" << sep
<< "------" << '\n';
}
diff --git a/DistanceEst/DistanceEst.cpp b/DistanceEst/DistanceEst.cpp
index 1603b6b..f366d5a 100644
--- a/DistanceEst/DistanceEst.cpp
+++ b/DistanceEst/DistanceEst.cpp
@@ -32,10 +32,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Jared Simpson and Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... HIST [PAIR]\n"
+"Usage: " PROGRAM " -k<kmer> -s<seed-length> -n<npairs> [OPTION]... HIST [PAIR]\n"
"Estimate distances between contigs using paired-end alignments.\n"
"\n"
" Arguments:\n"
@@ -157,6 +157,13 @@ static int estimateDistanceUsingMean(
/** Global variable to track a recommended minAlign parameter */
unsigned g_recMA;
+static struct {
+ /* Fragment stats are considered only for fragments aligning
+ * to different contigs, and where the contig is >=opt::seedLen. */
+ unsigned total_frags;
+ unsigned dup_frags;
+} stats;
+
/** Estimate the distance between two contigs.
* @param numPairs [out] the number of pairs that agree with the
* expected distribution
@@ -185,10 +192,15 @@ static int estimateDistance(unsigned len0, unsigned len1,
}
// Remove duplicate fragments.
+ unsigned orig = fragments.size();
sort(fragments.begin(), fragments.end());
fragments.erase(unique(fragments.begin(), fragments.end()),
fragments.end());
numPairs = fragments.size();
+ assert((int)orig - (int)numPairs >= 0);
+ stats.total_frags += orig;
+ stats.dup_frags += orig - numPairs;
+
if (numPairs < opt::npairs)
return INT_MIN;
@@ -318,33 +330,6 @@ static Histogram loadHist(const string& path)
return hist;
}
-/** Read contig lengths from SAM headers. */
-static void readContigLengths(istream& in, vector<unsigned>& lengths)
-{
- assert(in);
- assert(lengths.empty());
- assert(g_contigNames.empty());
- for (string line; in.peek() == '@' && getline(in, line);) {
- istringstream ss(line);
- string type;
- ss >> type;
- if (type != "@SQ")
- continue;
-
- string s;
- unsigned len;
- ss >> expect(" SN:") >> s >> expect(" LN:") >> len;
- assert(ss);
-
- put(g_contigNames, lengths.size(), s);
- lengths.push_back(len);
- }
- if (lengths.empty()) {
- cerr << PROGRAM ": error: no @SQ records in the SAM header\n";
- exit(EXIT_FAILURE);
- }
-}
-
/** Copy records from [it, last) to out and stop before alignments to
* the next target sequence.
* @param[in,out] it an input iterator
@@ -561,6 +546,18 @@ int main(int argc, char** argv)
break;
writeEstimates(out, records, contigLens, pmf);
}
+
+ if (opt::verbose > 0) {
+ float prop_dups = (float)100 * stats.dup_frags / stats.total_frags;
+ cerr << "Duplicate rate of spanning fragments: "
+ << stats.dup_frags << "/"
+ << stats.total_frags << " ("
+ << setprecision(3) << prop_dups << "%)\n";
+ if (prop_dups > 0.5)
+ cerr << PROGRAM << ": warning: duplicate rate of fragments "
+ "spanning more than one contig is high.\n";
+ }
+
if (opt::verbose > 0 && g_recMA != opt::minAlign)
cerr << PROGRAM << ": warning: MLE will be more accurate if "
"l is decreased to " << g_recMA << ".\n";
diff --git a/DistanceEst/Makefile.am b/DistanceEst/Makefile.am
index f192324..d8edde0 100644
--- a/DistanceEst/Makefile.am
+++ b/DistanceEst/Makefile.am
@@ -1,4 +1,4 @@
-bin_PROGRAMS = DistanceEst
+bin_PROGRAMS = DistanceEst DistanceEst-ssq
DistanceEst_CPPFLAGS = -I$(top_srcdir) \
-I$(top_srcdir)/Common
@@ -9,3 +9,12 @@ DistanceEst_LDADD = \
$(top_builddir)/Common/libcommon.a
DistanceEst_SOURCES = DistanceEst.cpp MLE.cpp MLE.h
+
+DistanceEst_ssq_CPPFLAGS = $(DistanceEst_CPPFLAGS) \
+ -D SAM_SEQ_QUAL=1
+
+DistanceEst_ssq_CXXFLAGS = $(DistanceEst_CXXFLAGS)
+
+DistanceEst_ssq_LDADD = $(DistanceEst_LDADD)
+
+DistanceEst_ssq_SOURCES = $(DistanceEst_SOURCES)
diff --git a/DistanceEst/Makefile.in b/DistanceEst/Makefile.in
deleted file mode 100644
index bf4b7d4..0000000
--- a/DistanceEst/Makefile.in
+++ /dev/null
@@ -1,615 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = DistanceEst$(EXEEXT)
-subdir = DistanceEst
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_DistanceEst_OBJECTS = DistanceEst-DistanceEst.$(OBJEXT) \
- DistanceEst-MLE.$(OBJEXT)
-DistanceEst_OBJECTS = $(am_DistanceEst_OBJECTS)
-DistanceEst_DEPENDENCIES = $(top_builddir)/Common/libcommon.a
-DistanceEst_LINK = $(CXXLD) $(DistanceEst_CXXFLAGS) $(CXXFLAGS) \
- $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(DistanceEst_SOURCES)
-DIST_SOURCES = $(DistanceEst_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-DistanceEst_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common
-
-DistanceEst_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
-DistanceEst_LDADD = \
- $(top_builddir)/Common/libcommon.a
-
-DistanceEst_SOURCES = DistanceEst.cpp MLE.cpp MLE.h
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign DistanceEst/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign DistanceEst/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-DistanceEst$(EXEEXT): $(DistanceEst_OBJECTS) $(DistanceEst_DEPENDENCIES) $(EXTRA_DistanceEst_DEPENDENCIES)
- @rm -f DistanceEst$(EXEEXT)
- $(AM_V_CXXLD)$(DistanceEst_LINK) $(DistanceEst_OBJECTS) $(DistanceEst_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/DistanceEst-DistanceEst.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/DistanceEst-MLE.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-DistanceEst-DistanceEst.o: DistanceEst.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DistanceEst_CPPFLAGS) $(CPPFLAGS) $(DistanceEst_CXXFLAGS) $(CXXFLAGS) -MT DistanceEst-DistanceEst.o -MD -MP -MF $(DEPDIR)/DistanceEst-DistanceEst.Tpo -c -o DistanceEst-DistanceEst.o `test -f 'DistanceEst.cpp' || echo '$(srcdir)/'`DistanceEst.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/DistanceEst-DistanceEst.Tpo $(DEPDIR)/DistanceEst-DistanceEst.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='DistanceEst.cpp' object='DistanceEst-DistanceEst.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DistanceEst_CPPFLAGS) $(CPPFLAGS) $(DistanceEst_CXXFLAGS) $(CXXFLAGS) -c -o DistanceEst-DistanceEst.o `test -f 'DistanceEst.cpp' || echo '$(srcdir)/'`DistanceEst.cpp
-
-DistanceEst-DistanceEst.obj: DistanceEst.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DistanceEst_CPPFLAGS) $(CPPFLAGS) $(DistanceEst_CXXFLAGS) $(CXXFLAGS) -MT DistanceEst-DistanceEst.obj -MD -MP -MF $(DEPDIR)/DistanceEst-DistanceEst.Tpo -c -o DistanceEst-DistanceEst.obj `if test -f 'DistanceEst.cpp'; then $(CYGPATH_W) 'DistanceEst.cpp'; else $(CYGPATH_W) '$(srcdir)/DistanceEst.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/DistanceEst-DistanceEst.Tpo $(DEPDIR)/DistanceEst-DistanceEst.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='DistanceEst.cpp' object='DistanceEst-DistanceEst.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DistanceEst_CPPFLAGS) $(CPPFLAGS) $(DistanceEst_CXXFLAGS) $(CXXFLAGS) -c -o DistanceEst-DistanceEst.obj `if test -f 'DistanceEst.cpp'; then $(CYGPATH_W) 'DistanceEst.cpp'; else $(CYGPATH_W) '$(srcdir)/DistanceEst.cpp'; fi`
-
-DistanceEst-MLE.o: MLE.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DistanceEst_CPPFLAGS) $(CPPFLAGS) $(DistanceEst_CXXFLAGS) $(CXXFLAGS) -MT DistanceEst-MLE.o -MD -MP -MF $(DEPDIR)/DistanceEst-MLE.Tpo -c -o DistanceEst-MLE.o `test -f 'MLE.cpp' || echo '$(srcdir)/'`MLE.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/DistanceEst-MLE.Tpo $(DEPDIR)/DistanceEst-MLE.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='MLE.cpp' object='DistanceEst-MLE.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DistanceEst_CPPFLAGS) $(CPPFLAGS) $(DistanceEst_CXXFLAGS) $(CXXFLAGS) -c -o DistanceEst-MLE.o `test -f 'MLE.cpp' || echo '$(srcdir)/'`MLE.cpp
-
-DistanceEst-MLE.obj: MLE.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DistanceEst_CPPFLAGS) $(CPPFLAGS) $(DistanceEst_CXXFLAGS) $(CXXFLAGS) -MT DistanceEst-MLE.obj -MD -MP -MF $(DEPDIR)/DistanceEst-MLE.Tpo -c -o DistanceEst-MLE.obj `if test -f 'MLE.cpp'; then $(CYGPATH_W) 'MLE.cpp'; else $(CYGPATH_W) '$(srcdir)/MLE.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/DistanceEst-MLE.Tpo $(DEPDIR)/DistanceEst-MLE.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='MLE.cpp' object='DistanceEst-MLE.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(DistanceEst_CPPFLAGS) $(CPPFLAGS) $(DistanceEst_CXXFLAGS) $(CXXFLAGS) -c -o DistanceEst-MLE.obj `if test -f 'MLE.cpp'; then $(CYGPATH_W) 'MLE.cpp'; else $(CYGPATH_W) '$(srcdir)/MLE.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/FMIndex/FMIndex.h b/FMIndex/FMIndex.h
index 2334c76..53eaa0a 100644
--- a/FMIndex/FMIndex.h
+++ b/FMIndex/FMIndex.h
@@ -57,10 +57,13 @@ struct SAInterval
/** A match of a substring of a query sequence to an FM index. */
struct Match : public SAInterval
{
- unsigned qstart, qend;
+ unsigned qstart, qend, num;
- Match(size_type l, size_type u, unsigned qstart, unsigned qend)
- : SAInterval(l, u), qstart(qstart), qend(qend) { }
+ Match() : SAInterval(0, 0), qstart(0), qend(0), num(0) { }
+
+ Match(size_type l, size_type u, unsigned qstart, unsigned qend,
+ unsigned num = 1)
+ : SAInterval(l, u), qstart(qstart), qend(qend), num(num) { }
unsigned qspan() const
{
@@ -437,6 +440,8 @@ Match findSubstring(It first, It last, unsigned k) const
Match interval = findSuffix(first, it, memoIt++);
if (interval.qspan() > best.qspan())
best = interval;
+ else if (interval.qspan() == best.qspan())
+ best.num++;
}
return best;
}
diff --git a/FMIndex/Makefile.in b/FMIndex/Makefile.in
deleted file mode 100644
index f190387..0000000
--- a/FMIndex/Makefile.in
+++ /dev/null
@@ -1,630 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-noinst_PROGRAMS = abyss-count$(EXEEXT) abyss-dawg$(EXEEXT)
-subdir = FMIndex
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-LIBRARIES = $(noinst_LIBRARIES)
-AR = ar
-ARFLAGS = cru
-AM_V_AR = $(am__v_AR_ at AM_V@)
-am__v_AR_ = $(am__v_AR_ at AM_DEFAULT_V@)
-am__v_AR_0 = @echo " AR " $@;
-am__v_AR_1 =
-libfmindex_a_AR = $(AR) $(ARFLAGS)
-libfmindex_a_LIBADD =
-am_libfmindex_a_OBJECTS = libfmindex_a-bit_array.$(OBJEXT)
-libfmindex_a_OBJECTS = $(am_libfmindex_a_OBJECTS)
-PROGRAMS = $(noinst_PROGRAMS)
-am_abyss_count_OBJECTS = abyss_count-count.$(OBJEXT)
-abyss_count_OBJECTS = $(am_abyss_count_OBJECTS)
-abyss_count_DEPENDENCIES = libfmindex.a \
- $(top_builddir)/Common/libcommon.a
-am_abyss_dawg_OBJECTS = abyss_dawg-abyss-dawg.$(OBJEXT)
-abyss_dawg_OBJECTS = $(am_abyss_dawg_OBJECTS)
-abyss_dawg_DEPENDENCIES = libfmindex.a \
- $(top_builddir)/Common/libcommon.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(libfmindex_a_SOURCES) $(abyss_count_SOURCES) \
- $(abyss_dawg_SOURCES)
-DIST_SOURCES = $(libfmindex_a_SOURCES) $(abyss_count_SOURCES) \
- $(abyss_dawg_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-noinst_LIBRARIES = libfmindex.a
-libfmindex_a_CPPFLAGS = -I$(top_srcdir)/Common
-libfmindex_a_SOURCES = \
- BitArrays.h \
- bit_array.cc bit_array.h \
- DAWG.h \
- FMIndex.h \
- sais.hxx
-
-abyss_dawg_SOURCES = abyss-dawg.cc
-abyss_dawg_LDADD = libfmindex.a \
- $(top_builddir)/Common/libcommon.a
-
-abyss_dawg_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common
-
-abyss_count_SOURCES = count.cc
-abyss_count_LDADD = libfmindex.a \
- $(top_builddir)/Common/libcommon.a
-
-abyss_count_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cc .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign FMIndex/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign FMIndex/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-
-clean-noinstLIBRARIES:
- -test -z "$(noinst_LIBRARIES)" || rm -f $(noinst_LIBRARIES)
-
-libfmindex.a: $(libfmindex_a_OBJECTS) $(libfmindex_a_DEPENDENCIES) $(EXTRA_libfmindex_a_DEPENDENCIES)
- $(AM_V_at)-rm -f libfmindex.a
- $(AM_V_AR)$(libfmindex_a_AR) libfmindex.a $(libfmindex_a_OBJECTS) $(libfmindex_a_LIBADD)
- $(AM_V_at)$(RANLIB) libfmindex.a
-
-clean-noinstPROGRAMS:
- -test -z "$(noinst_PROGRAMS)" || rm -f $(noinst_PROGRAMS)
-
-abyss-count$(EXEEXT): $(abyss_count_OBJECTS) $(abyss_count_DEPENDENCIES) $(EXTRA_abyss_count_DEPENDENCIES)
- @rm -f abyss-count$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(abyss_count_OBJECTS) $(abyss_count_LDADD) $(LIBS)
-
-abyss-dawg$(EXEEXT): $(abyss_dawg_OBJECTS) $(abyss_dawg_DEPENDENCIES) $(EXTRA_abyss_dawg_DEPENDENCIES)
- @rm -f abyss-dawg$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(abyss_dawg_OBJECTS) $(abyss_dawg_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_count-count.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_dawg-abyss-dawg.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libfmindex_a-bit_array.Po at am__quote@
-
-.cc.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cc.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-libfmindex_a-bit_array.o: bit_array.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libfmindex_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libfmindex_a-bit_array.o -MD -MP -MF $(DEPDIR)/libfmindex_a-bit_array.Tpo -c -o libfmindex_a-bit_array.o `test -f 'bit_array.cc' || echo '$(srcdir)/'`bit_array.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libfmindex_a-bit_array.Tpo $(DEPDIR)/libfmindex_a-bit_array.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='bit_array.cc' object='libfmindex_a-bit_array.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libfmindex_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libfmindex_a-bit_array.o `test -f 'bit_array.cc' || echo '$(srcdir)/'`bit_array.cc
-
-libfmindex_a-bit_array.obj: bit_array.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libfmindex_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libfmindex_a-bit_array.obj -MD -MP -MF $(DEPDIR)/libfmindex_a-bit_array.Tpo -c -o libfmindex_a-bit_array.obj `if test -f 'bit_array.cc'; then $(CYGPATH_W) 'bit_array.cc'; else $(CYGPATH_W) '$(srcdir)/bit_array.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libfmindex_a-bit_array.Tpo $(DEPDIR)/libfmindex_a-bit_array.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='bit_array.cc' object='libfmindex_a-bit_array.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libfmindex_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libfmindex_a-bit_array.obj `if test -f 'bit_array.cc'; then $(CYGPATH_W) 'bit_array.cc'; else $(CYGPATH_W) '$(srcdir)/bit_array.cc'; fi`
-
-abyss_count-count.o: count.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_count_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_count-count.o -MD -MP -MF $(DEPDIR)/abyss_count-count.Tpo -c -o abyss_count-count.o `test -f 'count.cc' || echo '$(srcdir)/'`count.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_count-count.Tpo $(DEPDIR)/abyss_count-count.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='count.cc' object='abyss_count-count.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_count_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_count-count.o `test -f 'count.cc' || echo '$(srcdir)/'`count.cc
-
-abyss_count-count.obj: count.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_count_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_count-count.obj -MD -MP -MF $(DEPDIR)/abyss_count-count.Tpo -c -o abyss_count-count.obj `if test -f 'count.cc'; then $(CYGPATH_W) 'count.cc'; else $(CYGPATH_W) '$(srcdir)/count.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_count-count.Tpo $(DEPDIR)/abyss_count-count.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='count.cc' object='abyss_count-count.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_count_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_count-count.obj `if test -f 'count.cc'; then $(CYGPATH_W) 'count.cc'; else $(CYGPATH_W) '$(srcdir)/count.cc'; fi`
-
-abyss_dawg-abyss-dawg.o: abyss-dawg.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_dawg_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_dawg-abyss-dawg.o -MD -MP -MF $(DEPDIR)/abyss_dawg-abyss-dawg.Tpo -c -o abyss_dawg-abyss-dawg.o `test -f 'abyss-dawg.cc' || echo '$(srcdir)/'`abyss-dawg.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_dawg-abyss-dawg.Tpo $(DEPDIR)/abyss_dawg-abyss-dawg.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='abyss-dawg.cc' object='abyss_dawg-abyss-dawg.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_dawg_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_dawg-abyss-dawg.o `test -f 'abyss-dawg.cc' || echo '$(srcdir)/'`abyss-dawg.cc
-
-abyss_dawg-abyss-dawg.obj: abyss-dawg.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_dawg_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_dawg-abyss-dawg.obj -MD -MP -MF $(DEPDIR)/abyss_dawg-abyss-dawg.Tpo -c -o abyss_dawg-abyss-dawg.obj `if test -f 'abyss-dawg.cc'; then $(CYGPATH_W) 'abyss-dawg.cc'; else $(CYGPATH_W) '$(srcdir)/abyss-dawg.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_dawg-abyss-dawg.Tpo $(DEPDIR)/abyss_dawg-abyss-dawg.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='abyss-dawg.cc' object='abyss_dawg-abyss-dawg.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_dawg_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_dawg-abyss-dawg.obj `if test -f 'abyss-dawg.cc'; then $(CYGPATH_W) 'abyss-dawg.cc'; else $(CYGPATH_W) '$(srcdir)/abyss-dawg.cc'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(LIBRARIES) $(PROGRAMS)
-installdirs:
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-generic clean-noinstLIBRARIES clean-noinstPROGRAMS \
- mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am:
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am:
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean clean-generic \
- clean-noinstLIBRARIES clean-noinstPROGRAMS cscopelist-am ctags \
- ctags-am distclean distclean-compile distclean-generic \
- distclean-tags distdir dvi dvi-am html html-am info info-am \
- install install-am install-data install-data-am install-dvi \
- install-dvi-am install-exec install-exec-am install-html \
- install-html-am install-info install-info-am install-man \
- install-pdf install-pdf-am install-ps install-ps-am \
- install-strip installcheck installcheck-am installdirs \
- maintainer-clean maintainer-clean-generic mostlyclean \
- mostlyclean-compile mostlyclean-generic pdf pdf-am ps ps-am \
- tags tags-am uninstall uninstall-am
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/FMIndex/abyss-dawg.cc b/FMIndex/abyss-dawg.cc
index 451475f..da5ec8b 100644
--- a/FMIndex/abyss-dawg.cc
+++ b/FMIndex/abyss-dawg.cc
@@ -24,7 +24,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... [FASTA]\n"
diff --git a/FMIndex/count.cc b/FMIndex/count.cc
index bc79ad5..5ad49b4 100644
--- a/FMIndex/count.cc
+++ b/FMIndex/count.cc
@@ -22,10 +22,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... [FASTA]\n"
+"Usage: " PROGRAM " -k<kmer> [OPTION]... [FASTA]\n"
"Count k-mer of the specified file.\n"
"The index file TARGET.fm will be used if present.\n"
"\n"
diff --git a/FMIndex/sais.hxx b/FMIndex/sais.hxx
index 7daea1d..a472363 100644
--- a/FMIndex/sais.hxx
+++ b/FMIndex/sais.hxx
@@ -551,6 +551,8 @@ template<typename string_type, typename sarray_type, typename index_type>
int
saisxx(string_type T, sarray_type SA, index_type n, index_type k = 256) {
typedef typename std::iterator_traits<sarray_type>::value_type savalue_type;
+ savalue_type unused;
+ (void)unused;
assert((std::numeric_limits<index_type>::min)() < 0);
assert((std::numeric_limits<savalue_type>::min)() < 0);
assert((std::numeric_limits<savalue_type>::max)() == (std::numeric_limits<index_type>::max)());
@@ -574,6 +576,8 @@ index_type
saisxx_bwt(string_type T, string_type U, sarray_type A, index_type n, index_type k = 256) {
typedef typename std::iterator_traits<sarray_type>::value_type savalue_type;
typedef typename std::iterator_traits<string_type>::value_type char_type;
+ savalue_type unused;
+ (void)unused;
index_type i, pidx;
assert((std::numeric_limits<index_type>::min)() < 0);
assert((std::numeric_limits<savalue_type>::min)() < 0);
diff --git a/FilterGraph/FilterGraph.cpp b/FilterGraph/FilterGraph.cpp
index 93dcfbe..2067894 100644
--- a/FilterGraph/FilterGraph.cpp
+++ b/FilterGraph/FilterGraph.cpp
@@ -40,10 +40,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Tony Raymond.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... ADJ\n"
+"Usage: " PROGRAM " -k<kmer> [OPTION]... ADJ\n"
"Remove short contigs that do not contribute any relevant\n"
"information to the assembly.\n"
"\n"
@@ -54,9 +54,12 @@ static const char USAGE_MESSAGE[] =
" Options:\n"
"\n"
" -k, --kmer=N k-mer size\n"
+" --SS expect contigs to be oriented correctly\n"
+" --no-SS no assumption about contig orientation\n"
" -T, --island=N remove islands shorter than N [0]\n"
" -t, --tip=N remove tips shorter than N [0]\n"
" -l, --length=N remove contigs shorter than N [0]\n"
+" -L, --max-length=N remove contigs longer than N [0]\n"
" --shim remove filler contigs that only contribute\n"
" to adjacency [default]\n"
" --no-shim disable filler contigs removal\n"
@@ -80,6 +83,9 @@ static const char USAGE_MESSAGE[] =
namespace opt {
unsigned k; // used by ContigProperties
+ /** Run a strand-specific RNA-Seq assembly. */
+ static int ss;
+
/** Remove island contigs less than this length. */
static unsigned minIslandLen = 0;
@@ -89,6 +95,9 @@ namespace opt {
/** Remove all contigs less than this length. */
static unsigned minLen = 0;
+ /** Remove all contigs more than this length. */
+ static unsigned maxLen = 0;
+
/** Remove short contigs that don't contribute any sequence. */
static int shim = 1;
@@ -111,7 +120,7 @@ namespace opt {
int format = ADJ; // used by ContigProperties
}
-static const char shortopts[] = "g:i:r:k:l:m:t:T:v";
+static const char shortopts[] = "g:i:r:k:l:L:m:t:T:v";
enum { OPT_HELP = 1, OPT_VERSION };
@@ -124,10 +133,13 @@ static const struct option longopts[] = {
{ "graph", required_argument, NULL, 'g' },
{ "ignore", required_argument, NULL, 'i' },
{ "remove", required_argument, NULL, 'r' },
+ { "SS", no_argument, &opt::ss, 1 },
+ { "no-SS", no_argument, &opt::ss, 0 },
{ "kmer", required_argument, NULL, 'k' },
{ "island", required_argument, NULL, 'T' },
{ "tip", required_argument, NULL, 't' },
{ "length", required_argument, NULL, 'l' },
+ { "max-length", required_argument, NULL, 'L' },
{ "shim", no_argument, &opt::shim, 1 },
{ "no-shim", no_argument, &opt::shim, 0 },
{ "assemble", no_argument, &opt::assemble, 1 },
@@ -297,8 +309,6 @@ static void removeContigs(Graph& g, vector<vertex_descriptor>& sc)
{
typedef graph_traits<Graph> GTraits;
typedef GTraits::vertex_descriptor V;
- typedef GTraits::out_edge_iterator OEit;
- typedef GTraits::in_edge_iterator IEit;
vector<vertex_descriptor> out;
out.reserve(sc.size());
@@ -353,7 +363,7 @@ static void findShortContigs(const Graph& g, const vector<bool>& seen,
typedef GTraits::vertex_iterator Vit;
Vit first, second;
tie(first, second) = vertices(g);
- copy_if(first, second, back_inserter(sc),
+ ::copy_if(first, second, back_inserter(sc),
!bind(Marked(g, seen), _1) && bind(removable, &g, _1));
}
@@ -394,6 +404,21 @@ struct ShorterThanX : unary_function<vertex_descriptor, bool> {
}
};
+struct LongerThanX : unary_function<vertex_descriptor, bool> {
+ const Graph& g;
+ const vector<bool>& seen;
+ size_t x;
+
+ LongerThanX(const Graph& g, const vector<bool>& seen, size_t x)
+ : g(g), seen(seen), x(x) { }
+
+ bool operator()(vertex_descriptor y) const
+ {
+ return g[y].length > x && !get(vertex_removed, g, y)
+ && !seen[get(vertex_contig_index, g, y)];
+ }
+};
+
static void removeShims(Graph& g, const vector<bool>& seen)
{
if (opt::verbose > 0)
@@ -419,7 +444,8 @@ static void removeShims(Graph& g, const vector<bool>& seen)
}
}
-static void removeShortContigs(Graph& g, const vector<bool>& seen)
+template <typename pred>
+static void removeContigs_if(Graph& g, pred p)
{
typedef graph_traits<Graph> GTraits;
typedef GTraits::vertex_iterator Vit;
@@ -427,8 +453,7 @@ static void removeShortContigs(Graph& g, const vector<bool>& seen)
Vit first, second;
tie(first, second) = vertices(g);
vector<V> sc;
- copy_if(first, second, back_inserter(sc),
- ShorterThanX(g, seen, opt::minLen));
+ ::copy_if(first, second, back_inserter(sc), p);
remove_vertex_if(g, sc.begin(), sc.end(), True<V>());
transform(sc.begin(), sc.end(), back_inserter(g_removed),
mem_fun_ref(&ContigNode::contigIndex));
@@ -458,6 +483,9 @@ int main(int argc, char** argv)
case 'l':
arg >> opt::minLen;
break;
+ case 'L':
+ arg >> opt::maxLen;
+ break;
case 'm':
arg >> opt::minOverlap;
break;
@@ -581,9 +609,13 @@ int main(int argc, char** argv)
// Remove tips.
if (opt::minTipLen > 0) {
- size_t s = g_removed.size();
- pruneTips_if(g, back_inserter(g_removed),
- ShorterThanX(g, seen, opt::minTipLen));
+ size_t s, prev;
+ s = g_removed.size();
+ do {
+ prev = g_removed.size();
+ pruneTips_if(g, back_inserter(g_removed),
+ ShorterThanX(g, seen, opt::minTipLen));
+ } while (prev < g_removed.size());
if (opt::verbose)
cerr << "Removed " << g_removed.size() - s
<< " tips.\n";
@@ -591,7 +623,11 @@ int main(int argc, char** argv)
// Remove short contigs.
if (opt::minLen > 0)
- removeShortContigs(g, seen);
+ removeContigs_if(g, ShorterThanX(g, seen, opt::minLen));
+
+ // Remove long contigs.
+ if (opt::maxLen > 0)
+ removeContigs_if(g, LongerThanX(g, seen, opt::maxLen));
if (opt::verbose > 0) {
cerr << "Graph stats after:\n";
@@ -610,7 +646,11 @@ int main(int argc, char** argv)
size_t numContigs = num_vertices(g) / 2;
typedef vector<ContigPath> ContigPaths;
ContigPaths paths;
- assemble(g, back_inserter(paths));
+ if (opt::ss)
+ assemble_stranded(g, back_inserter(paths));
+ else
+ assemble(g, back_inserter(paths));
+ g_contigNames.unlock();
for (ContigPaths::const_iterator it = paths.begin();
it != paths.end(); ++it) {
ContigNode u(numContigs + it - paths.begin(), false);
@@ -618,6 +658,7 @@ int main(int argc, char** argv)
put(vertex_name, g, u, name);
cout << name << '\t' << *it << '\n';
}
+ g_contigNames.lock();
}
// Output the updated adjacency graph.
diff --git a/FilterGraph/Makefile.am b/FilterGraph/Makefile.am
index 1f43927..61fdb13 100644
--- a/FilterGraph/Makefile.am
+++ b/FilterGraph/Makefile.am
@@ -7,7 +7,6 @@ abyss_filtergraph_CPPFLAGS = -I$(top_srcdir) \
abyss_filtergraph_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
abyss_filtergraph_LDADD = \
- $(top_builddir)/Graph/libgraph.a \
$(top_builddir)/DataLayer/libdatalayer.a \
$(top_builddir)/Common/libcommon.a
diff --git a/FilterGraph/Makefile.in b/FilterGraph/Makefile.in
deleted file mode 100644
index 5663710..0000000
--- a/FilterGraph/Makefile.in
+++ /dev/null
@@ -1,593 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = abyss-filtergraph$(EXEEXT)
-subdir = FilterGraph
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_abyss_filtergraph_OBJECTS = \
- abyss_filtergraph-FilterGraph.$(OBJEXT)
-abyss_filtergraph_OBJECTS = $(am_abyss_filtergraph_OBJECTS)
-abyss_filtergraph_DEPENDENCIES = $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-abyss_filtergraph_LINK = $(CXXLD) $(abyss_filtergraph_CXXFLAGS) \
- $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(abyss_filtergraph_SOURCES)
-DIST_SOURCES = $(abyss_filtergraph_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-abyss_filtergraph_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-abyss_filtergraph_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
-abyss_filtergraph_LDADD = \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-abyss_filtergraph_SOURCES = FilterGraph.cpp
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign FilterGraph/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign FilterGraph/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-abyss-filtergraph$(EXEEXT): $(abyss_filtergraph_OBJECTS) $(abyss_filtergraph_DEPENDENCIES) $(EXTRA_abyss_filtergraph_DEPENDENCIES)
- @rm -f abyss-filtergraph$(EXEEXT)
- $(AM_V_CXXLD)$(abyss_filtergraph_LINK) $(abyss_filtergraph_OBJECTS) $(abyss_filtergraph_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_filtergraph-FilterGraph.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-abyss_filtergraph-FilterGraph.o: FilterGraph.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_filtergraph_CPPFLAGS) $(CPPFLAGS) $(abyss_filtergraph_CXXFLAGS) $(CXXFLAGS) -MT abyss_filtergraph-FilterGraph.o -MD -MP -MF $(DEPDIR)/abyss_filtergraph-FilterGraph.Tpo -c -o abyss_filtergraph-FilterGraph.o `test -f 'FilterGraph.cpp' || echo '$(srcdir)/'`FilterGraph.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_filtergraph-FilterGraph.Tpo $(DEPDIR)/abyss_filtergraph-FilterGraph.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='FilterGraph.cpp' object='abyss_filtergraph-FilterGraph.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_filtergraph_CPPFLAGS) $(CPPFLAGS) $(abyss_filtergraph_CXXFLAGS) $(CXXFLAGS) -c -o abyss_filtergraph-FilterGraph.o `test -f 'FilterGraph.cpp' || echo '$(srcdir)/'`FilterGraph.cpp
-
-abyss_filtergraph-FilterGraph.obj: FilterGraph.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_filtergraph_CPPFLAGS) $(CPPFLAGS) $(abyss_filtergraph_CXXFLAGS) $(CXXFLAGS) -MT abyss_filtergraph-FilterGraph.obj -MD -MP -MF $(DEPDIR)/abyss_filtergraph-FilterGraph.Tpo -c -o abyss_filtergraph-FilterGraph.obj `if test -f 'FilterGraph.cpp'; then $(CYGPATH_W) 'FilterGraph.cpp'; else $(CYGPATH_W) '$(srcdir)/FilterGraph.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_filtergraph-FilterGraph.Tpo $(DEPDIR)/abyss_filtergraph-FilterGraph.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='FilterGraph.cpp' object='abyss_filtergraph-FilterGraph.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_filtergraph_CPPFLAGS) $(CPPFLAGS) $(abyss_filtergraph_CXXFLAGS) $(CXXFLAGS) -c -o abyss_filtergraph-FilterGraph.obj `if test -f 'FilterGraph.cpp'; then $(CYGPATH_W) 'FilterGraph.cpp'; else $(CYGPATH_W) '$(srcdir)/FilterGraph.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/GapFiller/Makefile.am b/GapFiller/Makefile.am
new file mode 100644
index 0000000..a896dd4
--- /dev/null
+++ b/GapFiller/Makefile.am
@@ -0,0 +1,17 @@
+bin_PROGRAMS = abyss-gapfill
+
+abyss_gapfill_CPPFLAGS = -I$(top_srcdir) \
+ -I$(top_srcdir)/Common \
+ -I$(top_srcdir)/DataLayer \
+ -I$(top_srcdir)/Align \
+ -D SAM_SEQ_QUAL=1
+
+abyss_gapfill_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
+
+abyss_gapfill_LDADD = \
+ $(top_builddir)/Align/libalign.a \
+ $(top_builddir)/dialign/libdialign.a \
+ $(top_builddir)/DataLayer/libdatalayer.a \
+ $(top_builddir)/Common/libcommon.a
+
+abyss_gapfill_SOURCES = gapfill.cpp gapfill.h
diff --git a/GapFiller/gapfill.cpp b/GapFiller/gapfill.cpp
new file mode 100644
index 0000000..51162ce
--- /dev/null
+++ b/GapFiller/gapfill.cpp
@@ -0,0 +1,359 @@
+#include "alignGlobal.h"
+#include "SAM.h"
+#include "DataLayer/Options.h"
+#include "smith_waterman.h"
+#include "Align/Options.h"
+#include "Uncompress.h"
+#include "FastaReader.h"
+#include "gapfill.h"
+
+#include "config.h"
+#include <cstdlib>
+#include <getopt.h>
+#include <iomanip>
+#include <iostream>
+#include <sstream>
+#include <string>
+#include <map>
+#include <vector>
+#include <boost/tuple/tuple.hpp>
+
+
+using namespace std;
+using namespace boost;
+
+#define PROGRAM "abyss-gapfill"
+
+static const char VERSION_MESSAGE[] =
+PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
+"Written by Anthony Raymond.\n"
+"\n"
+"Copyright 2014 Canada's Michael Smith Genome Science Centre\n";
+
+static const char USAGE_MESSAGE[] =
+"Usage: " PROGRAM " [OPTION]... CONTIGS ALIGNS\n"
+"Attempts to fill gaps in CONTIGS with spanning sequences\n"
+"from ALIGNS.\n"
+"\n"
+" -l, --min-align=N the minimal alignment size [1]\n"
+" -v, --verbose display verbose output\n"
+" --help display this help and exit\n"
+" --version output version information and exit\n"
+"\n"
+"Report bugs to <" PACKAGE_BUGREPORT ">.\n";
+
+namespace opt {
+ static float identity = 0.9;
+ static unsigned min_size = 500;
+
+ static int verbose;
+}
+
+static const char shortopts[] = "l:v";
+
+enum { OPT_HELP = 1, OPT_VERSION };
+
+static const struct option longopts[] = {
+ { "min-align", required_argument, NULL, 'l' },
+ { "verbose", no_argument, NULL, 'v' },
+ { "help", no_argument, NULL, OPT_HELP },
+ { "version", no_argument, NULL, OPT_VERSION },
+ { NULL, 0, NULL, 0 }
+};
+
+
+typedef map<string, Scaffold> Scaffolds;
+typedef multimap<string, SAMRecord> Alignments;
+
+static struct {
+ unsigned long long seqs;
+ unsigned long long scaffolds;
+ unsigned long long aligns;
+ unsigned long long split_same;
+ unsigned long long gaps;
+ unsigned long long gaps_filled;
+ unsigned long long n_removed;
+ unsigned long long bases_added;
+} stats;
+
+static void readScaffolds(const char* path, Scaffolds& scaffs)
+{
+ FastaReader in(path, FastaReader::NO_FOLD_CASE);
+ FastaRecord rec;
+ if (opt::verbose)
+ cerr << "Loading scaffolds from `" << path << "'...\n";
+
+ while (in >> rec) {
+ if (++stats.seqs % 10000000 == 0 && opt::verbose)
+ cerr << "Loaded " << stats.scaffolds << " scaffolds "
+ << "out of " << stats.seqs << " sequences.\n";
+
+ // Store only long scaffolded sequences
+ if (rec.seq.size() >= opt::min_size) {
+ assert(scaffs.find(rec.id) == scaffs.end());
+ Scaffold scaff(rec);
+ if (scaff.hasGaps()) {
+ stats.scaffolds++;
+ stats.gaps += scaff.numGaps();
+ scaffs.insert(make_pair(rec.id, scaff));
+ }
+ }
+ }
+}
+
+static void readAlignments(const char* path, Alignments& aligns,
+ Scaffolds& scaffs)
+{
+ ifstream in(path);
+ SAMRecord rec;
+ if (opt::verbose)
+ cerr << "Loading alignments from `" << path << "'...\n";
+
+ // Parse out the headers.
+ while (in.peek() == '@') {
+ string tmp;
+ getline(in, tmp);
+ assert(in);
+ }
+
+ while (in >> rec) {
+ if (++stats.aligns % 10000000 == 0 && opt::verbose)
+ cerr << "Loaded " << stats.split_same << " alignments "
+ << "out of " << stats.aligns << ".\n";
+
+ // If aligns to either side of gap store in aligns.
+ if (rec.tags.size() >= 2
+ && rec.tags[0] == 'X'
+ && rec.tags[1] == 'A'
+ && rec.tags.find(rec.rname, 5) != string::npos
+ && scaffs.count(rec.rname) > 0
+ && scaffs.find(rec.rname)->second.isNearGaps(rec)) {
+ stats.split_same++;
+ aligns.insert(make_pair(rec.rname, rec));
+ }
+ assert(in);
+ }
+ assert(in.eof());
+}
+
+static void filterGapAlignments(vector<overlap_align>& overlaps)
+{
+ if (overlaps.empty()) {
+ //stats.no_alignment++;
+ return;
+ }
+
+ vector<overlap_align>::iterator it;
+ for (it = overlaps.begin(); it != overlaps.end(); it++ ) {
+ overlap_align o = *it;
+ if (o.overlap_match < opt::min_matches)
+ overlaps.erase(it--);
+ }
+ if (overlaps.empty()) {
+ //stats.low_matches++;
+ return;
+ }
+
+ for (it = overlaps.begin(); it != overlaps.end(); it++ ) {
+ overlap_align o = *it;
+ if (o.pid() < opt::identity)
+ overlaps.erase(it--);
+ }
+}
+
+static void alignReadToGapFlanks(string seg1,
+ string seg2, string read, vector<string>& seqs)
+{
+ //overlap align end of first segment to start of read
+ vector<overlap_align> overlaps1;
+ {
+ string a(seg1), b(read);
+ if (seg1.size() > opt::max_overlap)
+ a = seg1.substr(seg1.size() - opt::max_overlap);
+ if (read.size() > opt::max_overlap)
+ b = read.substr(0, opt::max_overlap);
+ alignOverlap(a, b, 0, overlaps1,
+ true, opt::verbose > 2);
+ }
+
+ filterGapAlignments(overlaps1);
+
+ //overlap align start of second segment to end of read
+ vector<overlap_align> overlaps2;
+ {
+ string a(read), b(seg2);
+ if (read.size() > opt::max_overlap)
+ a = read.substr(read.size() - opt::max_overlap);
+ if (seg2.size() > opt::max_overlap)
+ b = seg2.substr(0, opt::max_overlap);
+ alignOverlap(a, b, 0, overlaps2,
+ true, opt::verbose > 2);
+ }
+
+ filterGapAlignments(overlaps2);
+
+ //if both alignments have sufficient identity, return overlaps
+ if (overlaps1.size() == 1 && overlaps2.size() == 1) {
+ unsigned start = overlaps1[0].overlap_str.size();
+ int length = read.size() - overlaps2[0].overlap_str.size() - start;
+ if (length <= 0) //TODO: Handle overlapping scaffolds properly!!!
+ return;
+ seqs.push_back(read.substr(start, length));
+ }
+}
+
+static void alignReadsToGapFlanks(Scaffold& scaff,
+ const Alignments& aligns)
+{
+ string cid = scaff.rec.id;
+ Alignments::const_iterator start, end;
+ tie(start, end) = aligns.equal_range(cid);
+ if (opt::verbose > 1)
+ cerr << "examining contig " << cid << ", which has "
+ << distance(start, end) << " alignments and "
+ << scaff.numSegs() << " segments...\n";
+
+ vector< vector<string> > gap_seqs(scaff.gaps.size());
+
+ //identify the set of gaps that this alignment could span
+ for (unsigned i = 0; i < scaff.gaps.size(); i++) {
+ vector<string>& seqs = gap_seqs[i];
+ for ( ; start != end; start++) {
+ Scaffold::Gap& gap = scaff.gaps[i];
+ if (!Scaffold::isNearGap(gap, start->second))
+ continue;
+ string read_seq = start->second.seq;
+
+ int seg1_start = max(0, (int)(gap.first - opt::max_overlap));
+ assert(seg1_start >= 0);
+ string seg1 = scaff.rec.seq.substr(seg1_start,
+ gap.first - seg1_start);
+
+ int seg2_end = min(scaff.rec.seq.size(),
+ gap.second + opt::max_overlap);
+ assert((unsigned)seg2_end <= scaff.rec.seq.size());
+ string seg2 = scaff.rec.seq.substr(gap.second,
+ seg2_end - gap.second);
+
+ alignReadToGapFlanks(seg1, seg2, read_seq,
+ seqs);
+ }
+ }
+
+ for (int i = gap_seqs.size() - 1; i >= 0; i--) {
+ vector<string>& seqs = gap_seqs[i];
+ if (seqs.size() == 0)
+ continue;
+ string alignment;
+ unsigned matches;
+ switch (seqs.size()) {
+ case 1:
+ alignment = seqs[0];
+ break;
+ default:
+ NWAlignment align;
+ alignment = seqs[0];
+ for (unsigned j = 0; j < seqs.size() - 1; j++) {
+ matches = max(matches, alignGlobal(alignment,
+ seqs[j+1], align));
+ alignment = align.match_align;
+ }
+ break;
+ //if using dialign:
+ // Sequence consensus = dialign(*it, alignment, matches);
+ }
+ if (alignment != "") {
+ pair<unsigned, unsigned> result =
+ scaff.fillGap(i,alignment);
+ stats.n_removed += result.first;
+ stats.bases_added += result.second;
+ stats.gaps_filled++;
+ }
+ }
+}
+
+static void fillGaps(Scaffolds& scaffs, const Alignments& aligns)
+{
+ //foreach scaffold
+ for (Scaffolds::iterator sit = scaffs.begin();
+ sit != scaffs.end(); sit++) {
+ alignReadsToGapFlanks(sit->second, aligns);
+ }
+}
+
+static void printFixedContigs(const Scaffolds& scaffs,
+ const char* path, ostream& out)
+{
+ FastaReader in(path, FastaReader::NO_FOLD_CASE);
+ FastaRecord rec;
+ cerr << "Fixing scaffolds from `" << path << "'...\n";
+
+ while (in >> rec) {
+ Scaffolds::const_iterator it = scaffs.find(rec.id);
+ if (it == scaffs.end())
+ out << rec;
+ else
+ out << it->second;
+ }
+}
+
+int main(int argc, char* const* argv)
+{
+ bool die = false;
+ for (int c; (c = getopt_long(argc, argv,
+ shortopts, longopts, NULL)) != -1;) {
+ istringstream arg(optarg != NULL ? optarg : "");
+ switch (c) {
+ case '?': die = true; break;
+ case 'v': opt::verbose++; break;
+ case OPT_HELP:
+ cout << USAGE_MESSAGE;
+ exit(EXIT_SUCCESS);
+ case OPT_VERSION:
+ cout << VERSION_MESSAGE;
+ exit(EXIT_SUCCESS);
+ }
+ if (optarg != NULL && !arg.eof()) {
+ cerr << PROGRAM ": invalid option: `-"
+ << (char)c << optarg << "'\n";
+ exit(EXIT_FAILURE);
+ }
+ }
+
+ if (argc - optind != 2) {
+ cerr << PROGRAM ": incorrect number of arguments\n";
+ die = true;
+ }
+
+ if (die) {
+ cerr << "Try `" << PROGRAM
+ << " --help' for more information.\n";
+ exit(EXIT_FAILURE);
+ }
+
+ Scaffolds scaffs;
+ readScaffolds(argv[argc-2], scaffs);
+ if (opt::verbose)
+ cerr << "Loaded " << stats.scaffolds << " scaffolds "
+ << "out of " << stats.seqs << " sequences.\n";
+
+ Alignments aligns;
+ readAlignments(argv[argc-1], aligns, scaffs);
+ if (opt::verbose)
+ cerr << "aligns: " << stats.aligns << "\tsplit: "
+ << stats.split_same << '\n';
+
+ fillGaps(scaffs, aligns);
+
+ if (opt::verbose)
+ cerr << "Contigs: " << stats.seqs
+ << "\nScaffolds: " << stats.scaffolds
+ << "\nGaps: " << stats.gaps
+ << "\nGaps filled: " << stats.gaps_filled
+ << "\nN's removed: " << stats.n_removed
+ << "\nBases added: " << stats.bases_added << '\n';
+
+ printFixedContigs(scaffs, argv[argc-2], cout);
+
+ return 0;
+}
diff --git a/GapFiller/gapfill.h b/GapFiller/gapfill.h
new file mode 100644
index 0000000..c7484b2
--- /dev/null
+++ b/GapFiller/gapfill.h
@@ -0,0 +1,70 @@
+#ifndef GAPFILL_H
+#define GAPFILL_H 1
+
+#include "FastaReader.h"
+
+namespace opt {
+ static unsigned min_matches = 50;
+ static unsigned max_overlap = 500;
+}
+
+struct Scaffold {
+ typedef pair<size_t, size_t> Gap;
+ typedef vector<Gap> Gaps;
+
+ FastaRecord rec;
+ Gaps gaps;
+
+ Scaffold(FastaRecord rec) : rec(rec)
+ {
+ splitScaffold();
+ }
+
+ void splitScaffold()
+ {
+ size_t j = 0;
+ for (size_t i = rec.seq.find_first_of('N'); i != string::npos;
+ i = rec.seq.find_first_of('N', j)) {
+ j = rec.seq.find_first_not_of('N', i);
+ gaps.push_back(Gap(i, j));
+ }
+ }
+
+ bool hasGaps() const { return gaps.size() > 0; }
+
+ unsigned numGaps() const { return gaps.size(); }
+
+ unsigned numSegs() const { return numGaps() + 1; }
+
+ static bool isNearGap(const Scaffold::Gap& gap, const SAMRecord& align)
+ {
+ int align_start = align.pos;
+ int gap_start = gap.first;
+ return align_start <= gap_start && align_start >= (int)(gap_start -
+ opt::max_overlap + opt::min_matches);
+ }
+
+ bool isNearGaps(const SAMRecord& align) const
+ {
+ for (Gaps::const_iterator it = gaps.begin();
+ it != gaps.end(); it++)
+ if (isNearGap(*it, align))
+ return true;
+ return false;
+ }
+
+ pair<unsigned, unsigned> fillGap(unsigned i, string& seq)
+ {
+ assert(i < gaps.size());
+ Gap& g = gaps[i];
+ rec.seq.replace(g.first, g.second - g.first, seq);
+ return make_pair(g.second - g.first, seq.size());
+ }
+
+ friend ostream& operator<<(ostream& out, const Scaffold& scaff)
+ {
+ return out << scaff.rec;
+ }
+
+};
+#endif
diff --git a/Graph/AllPathsSearch.h b/Graph/AllPathsSearch.h
new file mode 100644
index 0000000..af736f7
--- /dev/null
+++ b/Graph/AllPathsSearch.h
@@ -0,0 +1,91 @@
+#ifndef ALLPATHS_SEARCH_H_
+#define ALLPATHS_SEARCH_H_
+
+#include "Common/Warnings.h"
+#include "Common/UnorderedSet.h"
+#include "Graph/Path.h"
+#include <boost/tuple/tuple.hpp> // for boost::tie
+#include <boost/graph/graph_traits.hpp>
+#include <boost/graph/graph_concepts.hpp>
+
+template <class IncidenceGraph>
+PathSearchResult allPathsSearch(
+ const IncidenceGraph& g,
+ typename boost::graph_traits<IncidenceGraph>::vertex_descriptor start,
+ typename boost::graph_traits<IncidenceGraph>::vertex_descriptor goal,
+ std::vector< Path<typename boost::graph_traits<IncidenceGraph>::vertex_descriptor> >& pathsFound)
+{
+ return allPathsSearch(g, start, goal, NO_LIMIT, NO_LIMIT, NO_LIMIT, pathsFound);
+}
+
+template <class IncidenceGraph>
+PathSearchResult allPathsSearch(
+ const IncidenceGraph& g,
+ typename boost::graph_traits<IncidenceGraph>::vertex_descriptor start,
+ typename boost::graph_traits<IncidenceGraph>::vertex_descriptor goal,
+ unsigned maxPaths,
+ unsigned minDepth,
+ unsigned maxDepth,
+ std::vector< Path<typename boost::graph_traits<IncidenceGraph>::vertex_descriptor> >& pathsFound)
+{
+ BOOST_CONCEPT_ASSERT((boost::IncidenceGraphConcept<IncidenceGraph>));
+ typedef typename boost::graph_traits<IncidenceGraph>::vertex_descriptor V;
+ typedef typename boost::graph_traits<IncidenceGraph>::out_edge_iterator EdgeIter;
+ typedef typename std::pair<EdgeIter,EdgeIter> EdgeIterPair;
+
+ unordered_set<V, hash<V> > visited;
+ Path<V> path;
+ std::vector<EdgeIterPair> eiStack;
+ unordered_set<V> cycleVertices;
+
+ path.push_back(start);
+ visited.insert(start);
+ eiStack.push_back(out_edges(start, g));
+
+ while(!path.empty()) {
+
+ if (path.back() == goal &&
+ (minDepth == NO_LIMIT || (path.size() - 1) >= minDepth)) {
+ if (maxPaths != NO_LIMIT && pathsFound.size() >= maxPaths)
+ return TOO_MANY_PATHS;
+ if (!cycleVertices.empty())
+ return PATH_CONTAINS_CYCLE;
+ pathsFound.push_back(path);
+ }
+
+ // find next unvisited node and append to path
+ while(!path.empty()) {
+ if ((maxDepth != NO_LIMIT && (path.size() - 1) >= maxDepth) ||
+ eiStack.back().first == eiStack.back().second)
+ {
+ visited.erase(path.back());
+ cycleVertices.erase(path.back());
+ path.pop_back();
+ eiStack.pop_back();
+ assert(path.empty() == eiStack.empty());
+ if (!path.empty())
+ eiStack.back().first++;
+
+ } else {
+ V v = target(*(eiStack.back().first), g);
+ if (visited.find(v) != visited.end()) {
+ cycleVertices.insert(v);
+ eiStack.back().first++;
+ } else {
+ path.push_back(v);
+ eiStack.push_back(out_edges(v, g));
+ visited.insert(v);
+ break;
+ }
+ } // if ei != ei_end
+ } // while !path.empty()
+
+ } // while !path.empty()
+
+ if (pathsFound.empty())
+ return NO_PATH;
+ else
+ return FOUND_PATH;
+}
+
+#endif
diff --git a/Graph/Assemble.h b/Graph/Assemble.h
index 323e524..3e192f4 100644
--- a/Graph/Assemble.h
+++ b/Graph/Assemble.h
@@ -56,12 +56,13 @@ class AssembleVisitor : public boost::default_dfs_visitor
/** Assemble unambiguous paths. Write the paths to out. */
template<typename Graph, typename OutIt>
-void assembleDFS(const Graph& g, OutIt out)
+void assembleDFS(const Graph& g, OutIt out, bool ss = false)
{
+ (void)ss;
typedef boost::vector_property_map<
boost::default_color_type, ContigIndexMap> ColorMap;
depthFirstSearch(g, AssembleVisitor<OutIt>(out),
- ColorMap(num_vertices(g) / 2));
+ ColorMap(num_vertices(g) / 2), ss);
}
#endif
diff --git a/Graph/BidirectionalBFS.h b/Graph/BidirectionalBFS.h
new file mode 100644
index 0000000..a84700e
--- /dev/null
+++ b/Graph/BidirectionalBFS.h
@@ -0,0 +1,158 @@
+#ifndef BIDIRECTIONALBFS_H
+#define BIDIRECTIONALBFS_H 1
+
+#include "Graph/DefaultColorMap.h"
+#include "Graph/BidirectionalBFSVisitor.h"
+#include "Graph/Path.h"
+#include <vector>
+#include <boost/graph/breadth_first_search.hpp>
+
+using boost::function_requires;
+using boost::graph_traits;
+using boost::property_traits;
+using boost::color_traits;
+
+template <class BidirectionalGraph, class Buffer, class ColorMap>
+inline BFSVisitorResult
+bidirectionalBFS_visit_edge(
+ const BidirectionalGraph& g,
+ typename boost::graph_traits<BidirectionalGraph>::edge_descriptor e,
+ Buffer& Q,
+ BidirectionalBFSVisitor<BidirectionalGraph>& vis,
+ ColorMap& color1,
+ ColorMap& color2,
+ Direction dir)
+{
+ function_requires< boost::BidirectionalGraphConcept<BidirectionalGraph> >();
+ typedef graph_traits<BidirectionalGraph> GTraits;
+ typedef typename GTraits::vertex_descriptor Vertex;
+ function_requires< boost::ReadWritePropertyMapConcept<ColorMap, Vertex> >();
+ typedef typename property_traits<ColorMap>::value_type ColorValue;
+ typedef color_traits<ColorValue> Color;
+
+ ColorMap& color = (dir == FORWARD) ? color1 : color2;
+ ColorMap& other_color = (dir == FORWARD) ? color2 : color1;
+
+ Vertex v = (dir == FORWARD) ? target(e, g) : source(e, g);
+ vis.examine_edge(e, g, dir);
+
+ ColorValue v_color = get(color, v);
+ ColorValue other_v_color = get(other_color, v);
+
+ BFSVisitorResult result;
+
+ if (other_v_color != Color::white()) {
+ // We have encountered a common edge, i.e. an
+ // edge where one vertex has been visited by
+ // the forward traversal and the other has
+ // been visited by the reverse traversal.
+ // Each common edge is once by the forward
+ // traversal and once by the reverse traversal.
+ BFSVisitorResult result;
+ result = vis.common_edge(e, g, dir);
+ if (result == SKIP_ELEMENT || result == ABORT_SEARCH)
+ return result;
+ }
+ else if (v_color == Color::white()) {
+ result = vis.discover_vertex(v, g, dir, Q.size());
+ if (result == SKIP_ELEMENT || result == ABORT_SEARCH)
+ return result;
+ result = vis.tree_edge(e, g, dir);
+ if (result == SKIP_ELEMENT || result == ABORT_SEARCH)
+ return result;
+ put(color, v, Color::gray());
+ Q.push(v);
+ }
+ else {
+ result = vis.non_tree_edge(e, g, dir);
+ if (result == SKIP_ELEMENT || result == ABORT_SEARCH)
+ return result;
+ if (v_color == Color::gray())
+ vis.gray_target(e, g, dir);
+ else
+ vis.black_target(e, g, dir);
+ }
+
+ return SUCCESS;
+}
+
+template <class BidirectionalGraph, class Buffer, class ColorMap>
+void bidirectionalBFS(
+ const BidirectionalGraph& g,
+ typename boost::graph_traits<BidirectionalGraph>::vertex_descriptor s1,
+ typename boost::graph_traits<BidirectionalGraph>::vertex_descriptor s2,
+ Buffer& Q1,
+ Buffer& Q2,
+ BidirectionalBFSVisitor<BidirectionalGraph>& vis,
+ ColorMap& color1,
+ ColorMap& color2)
+{
+ function_requires< boost::BidirectionalGraphConcept<BidirectionalGraph> >();
+ typedef graph_traits<BidirectionalGraph> GTraits;
+ typedef typename GTraits::vertex_descriptor Vertex;
+ function_requires< boost::ReadWritePropertyMapConcept<ColorMap, Vertex> >();
+ typedef typename property_traits<ColorMap>::value_type ColorValue;
+ typedef color_traits<ColorValue> Color;
+
+ typename GTraits::out_edge_iterator oei, oei_end;
+ typename GTraits::in_edge_iterator iei, iei_end;
+
+ put(color1, s1, Color::gray());
+ put(color2, s2, Color::gray());
+ vis.discover_vertex(s1, g, FORWARD, Q1.size());
+ vis.discover_vertex(s2, g, REVERSE, Q2.size());
+ Q1.push(s1);
+ Q2.push(s2);
+
+ Direction dir = FORWARD;
+ while (!Q1.empty() || !Q2.empty()) {
+
+ Buffer& Q = (dir == FORWARD) ? Q1 : Q2;
+ ColorMap& color = (dir == FORWARD) ? color1 : color2;
+
+ Vertex u = Q.top(); Q.pop();
+ vis.examine_vertex(u, g, dir);
+
+ if (dir == FORWARD) {
+ for (boost::tie(oei, oei_end) = out_edges(u, g); oei != oei_end; ++oei) {
+ if (bidirectionalBFS_visit_edge(g, *oei, Q, vis,
+ color1, color2, dir) == ABORT_SEARCH) {
+ return;
+ }
+ }
+ } else {
+ for (boost::tie(iei, iei_end) = in_edges(u, g); iei != iei_end; ++iei) {
+ if (bidirectionalBFS_visit_edge(g, *iei, Q, vis,
+ color1, color2, dir) == ABORT_SEARCH) {
+ return;
+ }
+ }
+ }
+
+ put(color, u, Color::black());
+ vis.finish_vertex(u, g, dir);
+
+ if (dir == REVERSE && !Q1.empty())
+ dir = FORWARD;
+ else if (dir == FORWARD && !Q2.empty())
+ dir = REVERSE;
+
+ } // while(!Q1.empty() || !Q2.empty())
+
+} // bidirectionalBFS
+
+template <class BidirectionalGraph>
+void bidirectionalBFS(const BidirectionalGraph& g,
+ typename graph_traits<BidirectionalGraph>::vertex_descriptor start,
+ typename graph_traits<BidirectionalGraph>::vertex_descriptor goal,
+ BidirectionalBFSVisitor<BidirectionalGraph>& visitor)
+{
+ typedef typename graph_traits<BidirectionalGraph>::vertex_descriptor V;
+ DefaultColorMap<BidirectionalGraph> colorMap1;
+ DefaultColorMap<BidirectionalGraph> colorMap2;
+ boost::queue<V> q1;
+ boost::queue<V> q2;
+ bidirectionalBFS(g, start, goal, q1, q2, visitor, colorMap1, colorMap2);
+}
+
+#endif
diff --git a/Graph/BidirectionalBFSVisitor.h b/Graph/BidirectionalBFSVisitor.h
new file mode 100644
index 0000000..0e02549
--- /dev/null
+++ b/Graph/BidirectionalBFSVisitor.h
@@ -0,0 +1,91 @@
+#ifndef BIDIRECTION_BFS_VISITOR_H
+#define BIDIRECTION_BFS_VISITOR_H 1
+
+#include "Graph/Path.h"
+#include "Common/Warnings.h"
+
+enum BFSVisitorResult { SUCCESS, ABORT_SEARCH, SKIP_ELEMENT };
+
+template <class Graph>
+class BidirectionalBFSVisitor {
+
+public:
+
+ typedef typename boost::graph_traits<Graph>::vertex_descriptor Vertex;
+ typedef typename boost::graph_traits<Graph>::edge_descriptor Edge;
+
+ BidirectionalBFSVisitor() { }
+ virtual ~BidirectionalBFSVisitor() { }
+
+ virtual BFSVisitorResult discover_vertex(const Vertex& u, const Graph& g, Direction dir, unsigned numFrontierNodes)
+ {
+ SUPPRESS_UNUSED_WARNING(u);
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(dir);
+ SUPPRESS_UNUSED_WARNING(numFrontierNodes);
+ return SUCCESS;
+ }
+
+ virtual void examine_vertex(const Vertex& u, const Graph& g, Direction dir)
+ {
+ SUPPRESS_UNUSED_WARNING(u);
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(dir);
+ }
+
+ virtual void finish_vertex(const Vertex& u, const Graph& g, Direction dir)
+ {
+ SUPPRESS_UNUSED_WARNING(u);
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(dir);
+ }
+
+ virtual void examine_edge(const Edge& e, const Graph& g, Direction dir)
+ {
+ SUPPRESS_UNUSED_WARNING(e);
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(dir);
+ }
+
+ virtual BFSVisitorResult common_edge(const Edge& e, const Graph& g, Direction dir)
+ {
+ SUPPRESS_UNUSED_WARNING(e);
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(dir);
+ return SUCCESS;
+ }
+
+ virtual BFSVisitorResult tree_edge(const Edge& e, const Graph& g, Direction dir)
+ {
+ SUPPRESS_UNUSED_WARNING(e);
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(dir);
+ return SUCCESS;
+ }
+
+ virtual BFSVisitorResult non_tree_edge(const Edge& e, const Graph& g, Direction dir)
+ {
+ SUPPRESS_UNUSED_WARNING(e);
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(dir);
+ return SUCCESS;
+ }
+
+ virtual void gray_target(const Edge& e, const Graph& g, Direction dir)
+ {
+ SUPPRESS_UNUSED_WARNING(e);
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(dir);
+ }
+
+ virtual void black_target(const Edge& e, const Graph& g, Direction dir)
+ {
+ SUPPRESS_UNUSED_WARNING(e);
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(dir);
+ }
+
+};
+
+#endif
+
diff --git a/Graph/BreadthFirstSearch.h b/Graph/BreadthFirstSearch.h
new file mode 100644
index 0000000..a36a567
--- /dev/null
+++ b/Graph/BreadthFirstSearch.h
@@ -0,0 +1,72 @@
+#ifndef DEPTHFIRSTSEARCH_H
+#define DEPTHFIRSTSEARCH_H 1
+
+#include "Graph/DefaultColorMap.h"
+#include <vector>
+#include <boost/graph/breadth_first_search.hpp>
+
+using boost::function_requires;
+using boost::graph_traits;
+using boost::property_traits;
+using boost::color_traits;
+
+// Note: This is an exact copy of the boost-provided breadth_first_search,
+// except that the visitor and color map arguments are passed by reference.
+
+template <class IncidenceGraph, class Buffer, class BFSVisitor,
+ class ColorMap>
+ void breadthFirstSearch
+ (const IncidenceGraph& g,
+ typename boost::graph_traits<IncidenceGraph>::vertex_descriptor s,
+ Buffer& Q, BFSVisitor& vis, ColorMap& color)
+ {
+ function_requires< boost::IncidenceGraphConcept<IncidenceGraph> >();
+ typedef graph_traits<IncidenceGraph> GTraits;
+ typedef typename GTraits::vertex_descriptor Vertex;
+ function_requires< boost::BFSVisitorConcept<BFSVisitor, IncidenceGraph> >();
+ function_requires< boost::ReadWritePropertyMapConcept<ColorMap, Vertex> >();
+ typedef typename property_traits<ColorMap>::value_type ColorValue;
+ typedef color_traits<ColorValue> Color;
+ typename GTraits::out_edge_iterator ei, ei_end;
+
+ put(color, s, Color::gray()); vis.discover_vertex(s, g);
+ Q.push(s);
+ while (! Q.empty()) {
+ Vertex u = Q.top(); Q.pop(); vis.examine_vertex(u, g);
+ for (boost::tie(ei, ei_end) = out_edges(u, g); ei != ei_end; ++ei) {
+ Vertex v = target(*ei, g); vis.examine_edge(*ei, g);
+ ColorValue v_color = get(color, v);
+ if (v_color == Color::white()) { vis.tree_edge(*ei, g);
+ put(color, v, Color::gray()); vis.discover_vertex(v, g);
+ Q.push(v);
+ } else { vis.non_tree_edge(*ei, g);
+ if (v_color == Color::gray()) vis.gray_target(*ei, g);
+ else vis.black_target(*ei, g);
+ }
+ } // end for
+ put(color, u, Color::black()); vis.finish_vertex(u, g);
+ } // end while
+ } // breadth_first_visit
+
+template <class IncidenceGraph>
+void breadthFirstSearch(const IncidenceGraph& g,
+ typename graph_traits<IncidenceGraph>::vertex_descriptor root)
+{
+ typedef typename graph_traits<IncidenceGraph>::vertex_descriptor V;
+ DefaultColorMap<IncidenceGraph> colorMap;
+ typename boost::default_bfs_visitor visitor;
+ boost::queue<V> q;
+ breadthFirstSearch(g, root, q, visitor, colorMap);
+}
+
+template <class IncidenceGraph, class BFSVisitor, class ColorMap>
+void breadthFirstSearch(const IncidenceGraph& g,
+ typename graph_traits<IncidenceGraph>::vertex_descriptor root,
+ BFSVisitor& visitor, ColorMap& colorMap)
+{
+ typedef typename graph_traits<IncidenceGraph>::vertex_descriptor V;
+ boost::queue<V> q;
+ breadthFirstSearch(g, root, q, visitor, colorMap);
+}
+
+#endif
diff --git a/Graph/ConstrainedBFSVisitor.h b/Graph/ConstrainedBFSVisitor.h
new file mode 100644
index 0000000..b3a7871
--- /dev/null
+++ b/Graph/ConstrainedBFSVisitor.h
@@ -0,0 +1,158 @@
+#ifndef CONSTRAINED_BFS_VISITOR_H
+#define CONSTRAINED_BFS_VISITOR_H
+
+#include "Common/UnorderedMap.h"
+#include "Common/IOUtil.h"
+#include "Graph/DefaultColorMap.h"
+#include "Graph/Path.h"
+#include "Graph/HashGraph.h"
+#include "Graph/AllPathsSearch.h"
+#include <boost/graph/graph_traits.hpp>
+#include <boost/graph/breadth_first_search.hpp>
+#include <iostream>
+#include <sstream>
+#include <vector>
+#include <algorithm>
+
+template <typename G>
+class ConstrainedBFSVisitor : public boost::default_bfs_visitor
+{
+public:
+
+ typedef typename boost::graph_traits<G>::vertex_descriptor V;
+ typedef typename boost::graph_traits<G>::edge_descriptor E;
+ typedef unsigned short depth_t;
+
+private:
+
+ typedef std::vector<V> Predecessors;
+ typedef unordered_map<V, unsigned, hash<V> > OutDegreeMap;
+ typedef unordered_map<V, depth_t, hash<V> > DepthMap;
+
+ HashGraph<V> m_traversalGraph;
+ OutDegreeMap m_outDegree;
+ DepthMap m_depthMap;
+ V m_start;
+ V m_goal;
+ depth_t m_minDepth;
+ depth_t m_maxDepth;
+ unsigned m_maxBranches;
+ DefaultColorMap<G>& m_colorMap;
+ bool m_bFoundGoal;
+ depth_t m_maxDepthVisited;
+ unsigned m_branches;
+ bool m_tooManyBranches;
+
+public:
+
+ ConstrainedBFSVisitor(
+ const V& start,
+ const V& goal,
+ depth_t minDepth,
+ depth_t maxDepth,
+ unsigned maxBranches,
+ DefaultColorMap<G>& colorMap) :
+ m_start(start),
+ m_goal(goal),
+ m_minDepth(minDepth),
+ m_maxDepth(maxDepth),
+ m_maxBranches(maxBranches),
+ m_colorMap(colorMap),
+ m_bFoundGoal(false),
+ m_maxDepthVisited(0),
+ m_branches(1),
+ m_tooManyBranches(false) {}
+
+#if 0
+ // for debugging
+ void examine_vertex(const V& v, const G& g)
+ {
+ std::cout << "visiting vertex: " << v << "\n";
+ }
+#endif
+
+ void examine_edge(const E& e, const G& g)
+ {
+
+ V u = source(e, g);
+ V v = target(e, g);
+
+#if 0
+ // for debugging
+ std::cout << "visiting edge: (" << u << ", " << v << ")\n";
+#endif
+
+ if (m_tooManyBranches) {
+ put(m_colorMap, v, boost::black_color);
+ return;
+ }
+
+ if (v == m_goal)
+ m_bFoundGoal = true;
+
+ // record history of traversal, so that we can trace
+ // backwards from goal to start in pathsToGoal()
+
+ add_edge(v, u, m_traversalGraph);
+
+ // track depth of nodes and go no deeper than m_maxDepth
+
+ if (get(m_colorMap, v) == boost::white_color) // tree edge
+ m_depthMap[v] = m_depthMap[u] + 1;
+
+ if (m_depthMap[v] >= m_maxDepth)
+ put(m_colorMap, v, boost::black_color);
+
+ if (m_depthMap[v] > m_maxDepthVisited)
+ m_maxDepthVisited = m_depthMap[v];
+
+ // track number of branches and abort if we exceed m_maxBranches
+
+ if (m_maxBranches != NO_LIMIT && ++m_outDegree[u] > 1)
+ m_branches++;
+
+ if (m_maxBranches != NO_LIMIT && m_branches > m_maxBranches) {
+ m_tooManyBranches = true;
+ put(m_colorMap, v, boost::black_color);
+ }
+
+ }
+
+ PathSearchResult uniquePathToGoal(Path<V>& uniquePath)
+ {
+ std::vector< Path<V> > pathsFound;
+ PathSearchResult result = pathsToGoal(pathsFound, 1);
+ if (result == FOUND_PATH) {
+ assert(pathsFound.size() == 1);
+ uniquePath = pathsFound[0];
+ }
+ return result;
+ }
+
+ PathSearchResult pathsToGoal(std::vector< Path<V> >& pathsFound, unsigned maxPaths)
+ {
+ if (m_tooManyBranches)
+ return TOO_MANY_BRANCHES;
+ else if (!m_bFoundGoal)
+ return NO_PATH;
+
+ PathSearchResult result = allPathsSearch(m_traversalGraph,
+ m_goal, m_start, maxPaths, m_minDepth, m_maxDepth, pathsFound);
+
+ if (result == FOUND_PATH) {
+ for (unsigned i = 0; i < pathsFound.size(); i++)
+ reverse(pathsFound[i].begin(), pathsFound[i].end());
+ }
+
+ return result;
+ }
+
+ depth_t getMaxDepthVisited()
+ {
+ return m_maxDepthVisited;
+ }
+
+};
+
+
+#endif /* CONSTRAINED_BFS_VISITOR_H */
diff --git a/Graph/ConstrainedBidiBFSVisitor.h b/Graph/ConstrainedBidiBFSVisitor.h
new file mode 100644
index 0000000..2e030a0
--- /dev/null
+++ b/Graph/ConstrainedBidiBFSVisitor.h
@@ -0,0 +1,455 @@
+#ifndef CONSTRAINED_BIDI_BFS_VISITOR_H
+#define CONSTRAINED_BIDI_BFS_VISITOR_H
+
+#include "Common/UnorderedMap.h"
+#include "Common/UnorderedSet.h"
+#include "Common/IOUtil.h"
+#include "Graph/Path.h"
+#include "Graph/HashGraph.h"
+#include "Graph/BidirectionalBFSVisitor.h"
+#include "Graph/AllPathsSearch.h"
+#include "Common/MemUtils.h"
+#include <boost/graph/graph_traits.hpp>
+#include <iostream>
+#include <sstream>
+#include <vector>
+#include <algorithm>
+
+template <typename G>
+class ConstrainedBidiBFSVisitor : public BidirectionalBFSVisitor<G>
+{
+
+protected:
+
+ typedef typename boost::graph_traits<G>::vertex_descriptor V;
+ typedef typename boost::graph_traits<G>::edge_descriptor E;
+ typedef unsigned short depth_t;
+ typedef std::vector< Path<V> > PathList;
+ typedef unordered_map<V, depth_t, hash<V> > DepthMap;
+
+ struct EdgeHash {
+ const G& m_g;
+ EdgeHash(const G& g) : m_g(g) { }
+ std::size_t operator()(const E& e) const {
+ V u = source(e, m_g);
+ V v = target(e, m_g);
+ return hash<V>()(u) ^ hash<V>()(v);
+ }
+ };
+
+ typedef unordered_set<E, EdgeHash> EdgeSet;
+
+ const G& m_graph;
+ V m_start;
+ V m_goal;
+
+ /** maximum number of paths to discover before aborting search */
+ unsigned m_maxPaths;
+
+ /** records history of forward/reverse traversals */
+ HashGraph<V> m_traversalGraph[2];
+
+ /** records depth of vertices during forward/reverse traversal */
+ DepthMap m_depthMap[2];
+
+ /** depth limits for forward/reverse traversal */
+ depth_t m_maxDepth[2];
+
+ /** max depth for forward/reverse traversal */
+ depth_t m_maxDepthVisited[2];
+
+ depth_t m_minPathLength;
+ depth_t m_maxPathLength;
+
+ /** maximum number of frontier nodes allowed at any given
+ * time during forward/reverse traversal */
+ unsigned m_maxBranches;
+
+ /** memory limit for graph search */
+ size_t m_memLimit;
+ /** controls frequency of memory limit checks */
+ size_t m_memCheckCounter;
+ /** true if we have exceeded the memory limit */
+ bool m_exceededMemLimit;
+
+ /** the max number of frontier nodes we had at any time
+ * during forward/reverse traversal (up to a limit
+ * of m_maxBranches) */
+ unsigned m_peakActiveBranches;
+
+ bool m_tooManyBranches;
+ bool m_tooManyPaths;
+
+ unsigned long long m_numNodesVisited;
+
+ /** edges that connect the forward and reverse traversals */
+ EdgeSet m_commonEdges;
+
+ PathList m_pathsFound;
+
+public:
+
+ ConstrainedBidiBFSVisitor(
+ const G& graph,
+ const V& start,
+ const V& goal,
+ unsigned maxPaths,
+ depth_t minPathLength,
+ depth_t maxPathLength,
+ unsigned maxBranches,
+ size_t memLimit
+ ) :
+ m_graph(graph),
+ m_start(start),
+ m_goal(goal),
+ m_maxPaths(maxPaths),
+ m_minPathLength(minPathLength),
+ m_maxPathLength(maxPathLength),
+ m_maxBranches(maxBranches),
+ m_memLimit(memLimit),
+ m_memCheckCounter(0),
+ m_exceededMemLimit(false),
+ m_peakActiveBranches(0),
+ m_tooManyBranches(false),
+ m_tooManyPaths(false),
+ m_numNodesVisited(0),
+ m_commonEdges(m_maxPaths, EdgeHash(m_graph))
+ {
+
+ depth_t maxDepth = maxPathLength - 1;
+ m_maxDepth[FORWARD] = maxDepth / 2 + maxDepth % 2;
+ m_maxDepth[REVERSE] = maxDepth / 2;
+
+ m_maxDepthVisited[FORWARD] = 0;
+ m_maxDepthVisited[REVERSE] = 0;
+
+ // special case
+ if (start == goal && 1 >= m_minPathLength) {
+ Path<V> path;
+ path.push_back(start);
+ m_pathsFound.push_back(path);
+ }
+ }
+
+#if 0
+ // for debugging
+ void examine_vertex(const V& v, const G& g, Direction dir)
+ {
+ SUPPRESS_UNUSED_WARNING(g);
+ std::cout << "visiting vertex: " << v << " from dir: " << dir << "\n";
+ }
+
+ void examine_edge(const E& e, const G& g, Direction dir)
+ {
+ SUPPRESS_UNUSED_WARNING(g);
+ V u = source(e, g);
+ V v = target(e, g);
+ std::cout << "visiting edge: (" << u << "," << v
+ << ") from dir: " << dir << "\n";
+ }
+#endif
+
+ BFSVisitorResult discover_vertex(const V& v, const G& g,
+ Direction dir, unsigned numActiveBranches)
+ {
+ SUPPRESS_UNUSED_WARNING(v);
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(dir);
+
+ if (m_maxBranches != NO_LIMIT &&
+ numActiveBranches >= m_maxBranches) {
+ m_tooManyBranches = true;
+ return ABORT_SEARCH;
+ }
+
+ m_numNodesVisited++;
+
+ // include new branch started by vertex v
+ numActiveBranches++;
+ if (numActiveBranches > m_peakActiveBranches)
+ m_peakActiveBranches = numActiveBranches;
+
+ return SUCCESS;
+ }
+
+ BFSVisitorResult tree_edge(const E& e, const G& g, Direction dir)
+ {
+ if (!updateTargetDepth(e, g, dir))
+ return SKIP_ELEMENT;
+
+ return recordEdgeTraversal(e, g, dir);
+ }
+
+ BFSVisitorResult non_tree_edge(const E& e, const G& g, Direction dir)
+ {
+ return recordEdgeTraversal(e, g, dir);
+ }
+
+ BFSVisitorResult common_edge(const E& e, const G& g, Direction dir)
+ {
+ V u = source(e, g);
+ V v = target(e, g);
+
+ const V& parent = (dir == FORWARD) ? u : v;
+
+ if (m_depthMap[dir][parent] >= m_maxDepth[dir])
+ return SKIP_ELEMENT;
+
+ return recordCommonEdge(e);
+ }
+
+ PathSearchResult uniquePathToGoal(Path<V>& path)
+ {
+ std::vector< Path<V> > paths;
+ PathSearchResult result = pathsToGoal(paths);
+ if (paths.size() > 1) {
+ return TOO_MANY_PATHS;
+ } else if (result == FOUND_PATH && paths.size() == 1) {
+ path = paths[0];
+ return FOUND_PATH;
+ }
+ return result;
+ }
+
+ PathSearchResult pathsToGoal(PathList& pathsFound)
+ {
+ if (m_tooManyPaths)
+ return TOO_MANY_PATHS;
+ else if (m_tooManyBranches)
+ return TOO_MANY_BRANCHES;
+ else if (m_exceededMemLimit)
+ return EXCEEDED_MEM_LIMIT;
+
+ PathSearchResult result = buildPaths();
+
+ if (result == FOUND_PATH)
+ pathsFound = m_pathsFound;
+
+ return result;
+ }
+
+ depth_t getMaxDepthVisited(Direction dir)
+ {
+ return m_maxDepthVisited[dir];
+ }
+
+ unsigned getMaxActiveBranches()
+ {
+ return m_peakActiveBranches;
+ }
+
+ unsigned long long getNumNodesVisited()
+ {
+ return m_numNodesVisited;
+ }
+
+ size_t approxMemUsage()
+ {
+ return
+ m_traversalGraph[FORWARD].approxMemSize() +
+ m_traversalGraph[REVERSE].approxMemSize() +
+ approxMemSize(m_depthMap[FORWARD]) +
+ approxMemSize(m_depthMap[REVERSE]);
+ }
+
+ void getTraversalGraph(HashGraph<V>& traversalGraph)
+ {
+ typedef typename HashGraph<V>::vertex_iterator vertex_iterator;
+ typedef typename HashGraph<V>::adjacency_iterator adjacency_iterator;
+
+ Direction dir[] = { FORWARD, REVERSE };
+ for (unsigned i = 0; i < 2; i++) {
+ HashGraph<V>& g = m_traversalGraph[dir[i]];
+ vertex_iterator vi, vi_end;
+ boost::tie(vi, vi_end) = vertices(g);
+ for(; vi != vi_end; vi++) {
+ adjacency_iterator ai, ai_end;
+ boost::tie(ai, ai_end) = adjacent_vertices(*vi, g);
+ for(; ai != ai_end; ai++) {
+ add_edge(*ai, *vi, traversalGraph);
+ }
+ }
+ }
+ }
+
+protected:
+
+ BFSVisitorResult recordCommonEdge(const E& e)
+ {
+ m_commonEdges.insert(e);
+ if (m_maxPaths != NO_LIMIT &&
+ m_commonEdges.size() > m_maxPaths) {
+ m_tooManyPaths = true;
+ return ABORT_SEARCH;
+ }
+
+ /**
+ * Tricky point:
+ *
+ * Recording the common edges in the both the
+ * forward and reverse traversal histories
+ * is necessary for edge cases where forward
+ * or reverse traversals are limited to
+ * a depth of zero. (In other words,
+ * the traversal graph has zero edges
+ * and exactly one vertex which is either
+ * the start or the goal vertex.)
+ *
+ * I cannot find a way to add a vertex
+ * with a specific vertex_descriptor
+ * to a graph using the Boost graph API.
+ * The only way seems to be creating an edge
+ * that has the given vertex_descriptor
+ * as the source or target.
+ */
+
+ BFSVisitorResult result = recordEdgeTraversal(e, m_graph, FORWARD);
+ if (result != SUCCESS)
+ return result;
+
+ return recordEdgeTraversal(e, m_graph, REVERSE);
+ }
+
+ BFSVisitorResult checkMemLimit()
+ {
+ const size_t MEM_COUNTER_ROLLOVER = 1 / 0.001;
+ m_memCheckCounter++;
+ if (m_memCheckCounter >= MEM_COUNTER_ROLLOVER) {
+ m_memCheckCounter = 0;
+ if (approxMemUsage() > m_memLimit) {
+ m_exceededMemLimit = true;
+ return ABORT_SEARCH;
+ }
+ }
+ return SUCCESS;
+ }
+
+ /**
+ * Record history of edge traversal, so that we can retrace
+ * paths from a common edge to start/goal.
+ */
+ BFSVisitorResult recordEdgeTraversal(const E& e, const G& g, Direction dir)
+ {
+ BFSVisitorResult result = checkMemLimit();
+ if (result != SUCCESS)
+ return result;
+
+ V u = source(e, g);
+ V v = target(e, g);
+
+ if (dir == FORWARD)
+ add_edge(v, u, m_traversalGraph[FORWARD]);
+ else
+ add_edge(u, v, m_traversalGraph[REVERSE]);
+
+ return result;
+ }
+
+ /**
+ * Record the depth of a newly visited vertex.
+ * @return true if the vertex is visitable is less than the max
+ * depth limit false otherwise.
+ */
+ bool updateTargetDepth(const E& e, const G& g, Direction dir)
+ {
+ const V& parent = (dir == FORWARD) ? source(e, g) : target(e, g);
+ const V& child = (dir == FORWARD) ? target(e, g) : source(e, g);
+
+ depth_t parentDepth = m_depthMap[dir][parent];
+ if (parentDepth == m_maxDepth[dir])
+ return false;
+
+ depth_t childDepth = parentDepth + 1;
+ m_depthMap[dir][child] = childDepth;
+
+ if (childDepth > m_maxDepthVisited[dir])
+ m_maxDepthVisited[dir] = childDepth;
+
+ return true;
+ }
+
+ PathSearchResult buildPaths()
+ {
+ PathSearchResult overallResult = NO_PATH;
+
+ // m_pathsFound will already contain one sol'n
+ // in the special case where start_kmer == goal_kmer
+ if (!m_pathsFound.empty())
+ overallResult = FOUND_PATH;
+
+ typename EdgeSet::const_iterator i = m_commonEdges.begin();
+ for (; i != m_commonEdges.end(); i++) {
+ PathSearchResult result = buildPaths(*i);
+ if (result == FOUND_PATH) {
+ overallResult = FOUND_PATH;
+ }
+ else if (result != FOUND_PATH && result != NO_PATH) {
+ // we have encountered a failure case
+ // (e.g. TOO_MANY_PATHS)
+ overallResult = result;
+ break;
+ }
+ }
+ return overallResult;
+ }
+
+ PathSearchResult buildPaths(const E& common_edge)
+ {
+ V u = source(common_edge, m_graph);
+ V v = target(common_edge, m_graph);
+
+ // find paths from common edge to start vertex (forward traversal)
+
+ unsigned maxPathsToStart = m_maxPaths - m_pathsFound.size();
+
+ PathList pathsToStart;
+ PathSearchResult result = allPathsSearch(
+ m_traversalGraph[FORWARD], u, m_start, maxPathsToStart,
+ 0, m_maxDepth[FORWARD], pathsToStart);
+
+ if (result == FOUND_PATH) {
+
+ // find paths from common edge to goal vertex (reverse traversal)
+
+ unsigned maxPathsToGoal =
+ (m_maxPaths - m_pathsFound.size()) / pathsToStart.size();
+
+ PathList pathsToGoal;
+ result = allPathsSearch(m_traversalGraph[REVERSE], v, m_goal,
+ maxPathsToGoal, 0, m_maxDepth[REVERSE], pathsToGoal);
+
+ if (result == FOUND_PATH)
+ result = buildPaths(pathsToStart, pathsToGoal);
+
+ } // result == FOUND_PATH (common edge => start)
+
+ if (result == TOO_MANY_PATHS)
+ m_tooManyPaths = true;
+
+ return result;
+ }
+
+ PathSearchResult buildPaths(const PathList& pathsToStart, const PathList& pathsToGoal)
+ {
+ bool addedPath = false;
+ typename PathList::const_iterator pathToStart = pathsToStart.begin();
+ for (; pathToStart != pathsToStart.end(); pathToStart++) {
+ typename PathList::const_iterator pathToGoal = pathsToGoal.begin();
+ for(; pathToGoal != pathsToGoal.end(); pathToGoal++) {
+ if (pathToStart->size() + pathToGoal->size() < m_minPathLength ||
+ pathToStart->size() + pathToGoal->size() > m_maxPathLength)
+ continue;
+ m_pathsFound.push_back(*pathToStart);
+ Path<V>& mergedPath = m_pathsFound.back();
+ reverse(mergedPath.begin(), mergedPath.end());
+ m_pathsFound.back().insert(mergedPath.end(),
+ pathToGoal->begin(), pathToGoal->end());
+ addedPath = true;
+ }
+ }
+ return (addedPath ? FOUND_PATH : NO_PATH);
+ }
+
+};
+
+#endif /* CONSTRAINED_BFS_VISITOR_H */
diff --git a/Graph/ConstrainedSearch.cpp b/Graph/ConstrainedSearch.cpp
deleted file mode 100644
index 6f4691e..0000000
--- a/Graph/ConstrainedSearch.cpp
+++ /dev/null
@@ -1,131 +0,0 @@
-#include "ConstrainedSearch.h"
-#include "ContigGraph.h"
-#include "DirectedGraph.h"
-#include "Graph/Properties.h"
-#include <algorithm>
-#include <climits> // for INT_MIN
-#include <utility>
-
-using namespace std;
-
-namespace opt {
- /** Abort the search after visiting maxCost vertices. */
- unsigned maxCost = 100000;
-}
-
-/** Compare the distance of two constraints. */
-static inline bool compareDistance(
- const Constraint& a, const Constraint& b)
-{
- return a.second < b.second;
-}
-
-/** Compare the ID of a constraint. */
-static inline bool compareID(const Constraint& constraint,
- const ContigNode& key)
-{
- return constraint.first < key;
-}
-
-/** Find a constraint by ID. */
-static inline Constraints::iterator findConstraint(
- Constraints& constraints,
- const ContigNode& key)
-{
- Constraints::iterator it = lower_bound(
- constraints.begin(), constraints.end(),
- key, compareID);
- return it != constraints.end()
- && it->first == key ? it : constraints.end();
-}
-
-typedef graph_traits<Graph>::vertex_descriptor vertex_descriptor;
-typedef graph_traits<Graph>::out_edge_iterator out_edge_iterator;
-
-/** Find paths through the graph that satisfy the constraints.
- * @return false if the search exited early
- */
-bool constrainedSearch(const Graph& g,
- vertex_descriptor u,
- Constraints& constraints,
- Constraints::const_iterator nextConstraint,
- unsigned satisfied,
- ContigPath& path, ContigPaths& solutions,
- int distance, unsigned& visitedCount)
-{
- assert(satisfied < constraints.size());
- static const int SATISFIED = INT_MAX;
- if (!path.empty()) {
- vertex_descriptor v = path.back();
- Constraints::iterator it = findConstraint(constraints, v);
- if (it != constraints.end() && it->second != SATISFIED) {
- if (distance > it->second)
- return true; // This constraint cannot be met.
-
- if (++satisfied == constraints.size()) {
- // All the constraints have been satisfied.
- solutions.push_back(path);
- return solutions.size() <= opt::maxPaths;
- }
- // This constraint has been satisfied.
- int constraint = it->second;
- it->second = SATISFIED;
- if (!constrainedSearch(g, u, constraints,
- nextConstraint, satisfied, path, solutions,
- distance, visitedCount))
- return false;
- it->second = constraint;
- return true;
- }
-
- if (++visitedCount >= opt::maxCost)
- return false; // Too complex.
-
- // Check that the next constraint has not been violated.
- while (distance > nextConstraint->second
- && findConstraint(constraints,
- nextConstraint->first)->second == SATISFIED)
- ++nextConstraint; // This constraint is satisfied.
- if (distance > nextConstraint->second)
- return true; // This constraint cannot be met.
-
- distance += g[v].length;
- u = v;
- }
-
- path.push_back(vertex_descriptor());
- pair<out_edge_iterator, out_edge_iterator> adj = g.out_edges(u);
- for (out_edge_iterator it = adj.first; it != adj.second; ++it) {
- path.back() = target(*it, g);
- if (!constrainedSearch(g, u, constraints,
- nextConstraint, satisfied, path, solutions,
- distance + g[*it].distance, visitedCount))
- return false;
- }
- assert(!path.empty());
- path.pop_back();
- return true;
-}
-
-/** Find paths through the graph that satisfy the constraints.
- * @return false if the search exited early
- */
-bool constrainedSearch(const Graph& g, vertex_descriptor v,
- Constraints& constraints, ContigPaths& paths,
- unsigned& cost)
-{
- if (constraints.empty())
- return false;
-
- // Sort the constraints by ID.
- sort(constraints.begin(), constraints.end());
-
- // Sort the constraints by distance.
- Constraints queue(constraints);
- sort(queue.begin(), queue.end(), compareDistance);
-
- ContigPath path;
- constrainedSearch(g, v, constraints, queue.begin(), 0,
- path, paths, 0, cost);
- return cost >= opt::maxCost ? false : !paths.empty();
-}
diff --git a/Graph/ConstrainedSearch.h b/Graph/ConstrainedSearch.h
index 1553830..04bd5da 100644
--- a/Graph/ConstrainedSearch.h
+++ b/Graph/ConstrainedSearch.h
@@ -5,26 +5,143 @@
#include "ContigPath.h"
#include "ContigProperties.h"
#include "DirectedGraph.h"
+#include "Graph/Properties.h"
+#include <algorithm>
+#include <climits> // for INT_MIN
#include <cassert>
#include <istream>
#include <utility>
#include <vector>
namespace opt {
- extern unsigned maxCost;
+ unsigned maxCost = 100000;
/** Abort the search after visiting maxPaths solutions. */
- static const unsigned maxPaths = 200;
+ const unsigned maxPaths = 200;
}
-typedef ContigGraph<DirectedGraph<ContigProperties, Distance> > Graph;
typedef std::pair<ContigNode, int> Constraint;
typedef std::vector<Constraint> Constraints;
typedef std::vector<ContigPath> ContigPaths;
+/** Compare the distance of two constraints. */
+static inline bool compareDistance(
+ const Constraint& a, const Constraint& b)
+{
+ return a.second < b.second;
+}
+
+/** Compare the ID of a constraint. */
+static inline bool compareID(const Constraint& constraint,
+ const ContigNode& key)
+{
+ return constraint.first < key;
+}
+
+/** Find a constraint by ID. */
+static inline Constraints::iterator findConstraint(
+ Constraints& constraints,
+ const ContigNode& key)
+{
+ Constraints::iterator it = lower_bound(
+ constraints.begin(), constraints.end(),
+ key, compareID);
+ return it != constraints.end()
+ && it->first == key ? it : constraints.end();
+}
+
+/** Find paths through the graph that satisfy the constraints.
+ * @return false if the search exited early
+ */
+template <typename Graph, typename vertex_descriptor>
bool constrainedSearch(const Graph& g,
- graph_traits<Graph>::vertex_descriptor origin,
+ vertex_descriptor u,
Constraints& constraints,
- ContigPaths& superPaths, unsigned& compCost);
+ Constraints::const_iterator nextConstraint,
+ unsigned satisfied,
+ ContigPath& path, ContigPaths& solutions,
+ int distance, unsigned& visitedCount)
+{
+ typedef typename graph_traits<Graph>::out_edge_iterator out_edge_iterator;
+
+ assert(satisfied < constraints.size());
+ static const int SATISFIED = INT_MAX;
+ if (!path.empty()) {
+ vertex_descriptor v = path.back();
+ Constraints::iterator it = findConstraint(constraints, v);
+ if (it != constraints.end() && it->second != SATISFIED) {
+ if (distance > it->second)
+ return true; // This constraint cannot be met.
+
+ if (++satisfied == constraints.size()) {
+ // All the constraints have been satisfied.
+ solutions.push_back(path);
+ return solutions.size() <= opt::maxPaths;
+ }
+ // This constraint has been satisfied.
+ int constraint = it->second;
+ it->second = SATISFIED;
+ if (!constrainedSearch(g, u, constraints,
+ nextConstraint, satisfied, path, solutions,
+ distance, visitedCount))
+ return false;
+ it->second = constraint;
+ return true;
+ }
+
+ if (++visitedCount >= opt::maxCost)
+ return false; // Too complex.
+
+ // Check that the next constraint has not been violated.
+ while (distance > nextConstraint->second
+ && findConstraint(constraints,
+ nextConstraint->first)->second == SATISFIED)
+ ++nextConstraint; // This constraint is satisfied.
+ if (distance > nextConstraint->second)
+ return true; // This constraint cannot be met.
+
+ distance += g[v].length;
+ u = v;
+ }
+
+ path.push_back(vertex_descriptor());
+ std::pair<out_edge_iterator, out_edge_iterator> adj = g.out_edges(u);
+ for (out_edge_iterator it = adj.first; it != adj.second; ++it) {
+ path.back() = target(*it, g);
+ if (!constrainedSearch(g, u, constraints,
+ nextConstraint, satisfied, path, solutions,
+ distance + g[*it].distance, visitedCount))
+ return false;
+ }
+ assert(!path.empty());
+ path.pop_back();
+ return true;
+}
+
+/** Find paths through the graph that satisfy the constraints.
+ * @return false if the search exited early
+ */
+template <typename Graph, typename vertex_descriptor>
+bool constrainedSearch(const Graph& g,
+ vertex_descriptor v,
+ Constraints& constraints, ContigPaths& paths,
+ unsigned& cost)
+{
+ if (constraints.empty())
+ return false;
+
+ // Sort the constraints by ID.
+ sort(constraints.begin(), constraints.end());
+
+ // Sort the constraints by distance.
+ Constraints queue(constraints);
+ sort(queue.begin(), queue.end(), compareDistance);
+
+ ContigPath path;
+ constrainedSearch(g, v, constraints, queue.begin(), 0,
+ path, paths, 0, cost);
+ return cost >= opt::maxCost ? false : !paths.empty();
+}
+
#endif
diff --git a/Graph/ContigGraphAlgorithms.h b/Graph/ContigGraphAlgorithms.h
index 0eac936..7ac4332 100644
--- a/Graph/ContigGraphAlgorithms.h
+++ b/Graph/ContigGraphAlgorithms.h
@@ -199,7 +199,6 @@ merge(Graph& g, It first, It last)
template<typename Graph, typename OutIt, typename Predicate>
OutIt assemble_if(Graph& g, OutIt out, Predicate pred0)
{
- typedef typename Graph::vertex_descriptor vertex_descriptor;
typedef typename Graph::vertex_iterator vertex_iterator;
// pred(e) = !isPalindrome(e) && pred0(e)
binary_compose<std::logical_and<bool>,
@@ -232,9 +231,33 @@ OutIt assemble(Graph& g, OutIt out)
return assemble_if(g, out, True<edge_descriptor>());
}
+/** Return true if the edge e is +ve sense. */
+template<typename Graph>
+struct IsPositive : std::unary_function<
+ typename graph_traits<Graph>::edge_descriptor, bool>
+{
+ IsPositive(const Graph& g) : m_g(g) { }
+ bool operator()(
+ typename graph_traits<Graph>::edge_descriptor e) const
+ {
+ return !get(vertex_sense, m_g, source(e, m_g))
+ && !get(vertex_sense, m_g, target(e, m_g));
+ }
+ private:
+ const Graph& m_g;
+};
+
+/** Assemble unambiguous paths in forward orientation only.
+ * Write the paths to out. */
+template<typename Graph, typename OutIt>
+OutIt assemble_stranded(Graph& g, OutIt out)
+{
+ return assemble_if(g, out, IsPositive<Graph>(g));
+}
+
/** Remove tips.
* For an edge (u,v), remove the vertex v if deg+(u) > 1,
- * deg-(v) = 1 and deg+(v) = 0, and p(v) is true.
+ * deg+(v) = 0, and p(v) is true.
* Stores all removed vertices in result.
*/
template <typename Graph, typename OutputIt, typename Pred>
@@ -255,7 +278,7 @@ OutputIt pruneTips_if(Graph& g, OutputIt result, Pred p)
for (Vit vit = vrange.first; vit != vrange.second; ++vit) {
V v = *vit;
//assert(v != u);
- if (in_degree(v, g) == 1 && out_degree(v, g) == 0 && p(v))
+ if (out_degree(v, g) == 0 && p(v))
tips.push_back(v);
}
}
@@ -268,6 +291,21 @@ OutputIt pruneTips_if(Graph& g, OutputIt result, Pred p)
return result;
}
+/** Return true if the vertex is a normal 1-in 0-out tip. */
+template<typename Graph>
+struct IsTip : std::unary_function<
+ typename graph_traits<Graph>::vertex_descriptor, bool>
+{
+ IsTip(const Graph& g) : m_g(g) { }
+ bool operator()(
+ typename graph_traits<Graph>::vertex_descriptor v) const
+ {
+ return in_degree(v, m_g) == 1;
+ }
+ private:
+ const Graph& m_g;
+};
+
/** Remove tips.
* For an edge (u,v), remove the vertex v if deg+(u) > 1
* and deg-(v) = 1 and deg+(v) = 0.
@@ -276,8 +314,7 @@ OutputIt pruneTips_if(Graph& g, OutputIt result, Pred p)
template <typename Graph, typename OutputIt>
OutputIt pruneTips(Graph& g, OutputIt result)
{
- typedef typename graph_traits<Graph>::vertex_descriptor V;
- return pruneTips_if(g, result, True<V>());
+ return pruneTips_if(g, result, IsTip<Graph>(g));
}
/** Remove islands.
diff --git a/Graph/DefaultColorMap.h b/Graph/DefaultColorMap.h
new file mode 100644
index 0000000..fdec833
--- /dev/null
+++ b/Graph/DefaultColorMap.h
@@ -0,0 +1,56 @@
+#ifndef DEFAULTCOLORMAP_H
+#define DEFAULTCOLORMAP_H
+
+#include "UnorderedMap.h"
+#include <boost/graph/graph_traits.hpp>
+#include <boost/graph/properties.hpp>
+
+template <typename G>
+class DefaultColorMap
+{
+public:
+
+ typedef typename boost::graph_traits<G>::vertex_descriptor key_type;
+ typedef typename boost::graph_traits<G>::vertex_descriptor& reference;
+ typedef boost::default_color_type value_type;
+ typedef boost::read_write_property_map_tag category;
+
+ typedef unordered_map<key_type, value_type, hash<key_type> >
+ map_type;
+ map_type map;
+};
+
+namespace boost {
+template <typename G>
+struct property_traits< DefaultColorMap<G> > {
+ typedef typename DefaultColorMap<G>::key_type key_type;
+ typedef typename DefaultColorMap<G>::reference reference;
+ typedef typename DefaultColorMap<G>::value_type value_type;
+ typedef typename DefaultColorMap<G>::category category;
+};
+}
+
+template <typename G>
+typename DefaultColorMap<G>::value_type
+get(const DefaultColorMap<G>& colorMap, typename DefaultColorMap<G>::key_type key)
+{
+ typedef typename DefaultColorMap<G>::map_type::const_iterator It;
+
+ It i = colorMap.map.find(key);
+
+ if (i != colorMap.map.end())
+ return i->second;
+
+ return boost::white_color;
+}
+
+template <typename G>
+void
+put(DefaultColorMap<G>& colorMap,
+ typename DefaultColorMap<G>::key_type key,
+ typename DefaultColorMap<G>::value_type value)
+{
+ colorMap.map[key] = value;
+}
+
+#endif
diff --git a/Graph/DepthFirstSearch.h b/Graph/DepthFirstSearch.h
index 11757f5..37f49cc 100644
--- a/Graph/DepthFirstSearch.h
+++ b/Graph/DepthFirstSearch.h
@@ -11,7 +11,7 @@ using boost::graph_traits;
* deg-(u) = 0 and then visiting any remaining vertices.
*/
template <class Graph, class Visitor, class ColorMap>
-void depthFirstSearch(const Graph& g, Visitor vis, ColorMap color)
+void depthFirstSearch(const Graph& g, Visitor vis, ColorMap color, bool ss = false)
{
using boost::color_traits;
using boost::property_traits;
@@ -39,6 +39,10 @@ void depthFirstSearch(const Graph& g, Visitor vis, ColorMap color)
boost::detail::depth_first_visit_impl(g, u, vis, color,
boost::detail::nontruth2());
}
+ if (ss) {
+ ++uit;
+ assert(uit != ulast);
+ }
}
// Visit vertices where discontiguous-(u).
@@ -49,6 +53,10 @@ void depthFirstSearch(const Graph& g, Visitor vis, ColorMap color)
boost::detail::depth_first_visit_impl(g, u, vis, color,
boost::detail::nontruth2());
}
+ if (ss) {
+ ++uit;
+ assert(uit != ulast);
+ }
}
// Visit the remaining vertices.
diff --git a/Graph/DotIO.h b/Graph/DotIO.h
index 0e08639..1c8449e 100644
--- a/Graph/DotIO.h
+++ b/Graph/DotIO.h
@@ -33,8 +33,6 @@ void write_edges(std::ostream& out, const Graph& g,
typename graph_traits<Graph>::vertex_descriptor u,
const EdgeProp*)
{
- typedef typename graph_traits<Graph>::vertex_descriptor
- vertex_descriptor;
typedef typename graph_traits<Graph>::out_edge_iterator
out_edge_iterator;
typedef typename edge_property<Graph>::type edge_property_type;
@@ -76,13 +74,21 @@ void write_edges(std::ostream& out, const Graph& g,
template <typename Graph>
std::ostream& write_dot(std::ostream& out, const Graph& g)
{
+ return write_dot(out, g, "adj");
+}
+
+/** Output a GraphViz dot graph. */
+template <typename Graph>
+std::ostream& write_dot(std::ostream& out, const Graph& g,
+ const std::string& graphName)
+{
typedef typename graph_traits<Graph>::vertex_iterator
vertex_iterator;
typedef typename vertex_property<Graph>::type
vertex_property_type;
typedef typename edge_property<Graph>::type edge_property_type;
- out << "digraph adj {\n";
+ out << "digraph " << graphName << " {\n";
// Graph properties
if (opt::k > 0)
diff --git a/Graph/GraphAlgorithms.h b/Graph/GraphAlgorithms.h
index 8b745c5..8f5f722 100644
--- a/Graph/GraphAlgorithms.h
+++ b/Graph/GraphAlgorithms.h
@@ -1,9 +1,12 @@
#ifndef GRAPHALGORITHMS_H
#define GRAPHALGORITHMS_H 1
+#include "Graph/Properties.h"
+#include "ConstrainedSearch.h"
#include <boost/graph/graph_traits.hpp>
#include <cassert>
#include <vector>
+#include <boost/tuple/tuple.hpp>
using boost::graph_traits;
@@ -102,4 +105,49 @@ unsigned remove_transitive_edges(Graph& g)
return transitive.size();
}
+/**
+ * Find transitive edges when more than one intermediate vertex exists
+ * between u and w.
+ */
+template <typename Graph, typename OutIt>
+void find_complex_transitive_edges(Graph& g, OutIt out)
+{
+ typedef graph_traits<Graph> GTraits;
+ typedef typename GTraits::vertex_descriptor vertex_descriptor;
+ typedef typename GTraits::edge_iterator edge_iterator;
+
+ //ConstrainedSearch<Graph> anyPath(100000, 2, false);
+ edge_iterator efirst, elast;
+ for (boost::tie(efirst, elast) = edges(g); efirst != elast;
+ efirst++) {
+ vertex_descriptor u = source(*efirst, g);
+
+ Constraint c = std::make_pair(target(*efirst, g), 100000);
+ Constraints cs;
+ cs.push_back(c);
+ ContigPaths cp;
+
+ unsigned numVisited = 0;
+ constrainedSearch(g, u, cs, cp, numVisited);
+ if (cp.size() > 1)
+ *out++ = *efirst;
+ }
+}
+
+/**
+ * Remove transitive edges from the specified graph.
+ * Find and remove the subset of edges (u,w) in E for which there
+ * exists a vertex path v such that the edges (u,v) and (v,w) exist in E.
+ * @return the number of transitive edges removed from g
+ */
+template <typename Graph>
+unsigned remove_complex_transitive_edges(Graph& g)
+{
+ typedef typename graph_traits<Graph>::edge_descriptor
+ edge_descriptor;
+ std::vector<edge_descriptor> transitive;
+ find_complex_transitive_edges(g, back_inserter(transitive));
+ remove_edges(g, transitive.begin(), transitive.end());
+ return transitive.size();
+}
#endif
diff --git a/Graph/GraphIO.h b/Graph/GraphIO.h
index 6f33c95..fa6c441 100644
--- a/Graph/GraphIO.h
+++ b/Graph/GraphIO.h
@@ -48,6 +48,8 @@ std::istream& read_graph(std::istream& in, ContigGraph<Graph>& g,
in >> std::ws;
assert(in);
switch (in.peek()) {
+ case '@': // @SQ: SAM format
+ return read_sam_header(in, g);
case 'd': // digraph: GraphViz dot format
return read_dot<Graph>(in, g, betterEP);
case 'H': // HT: ASQG format
diff --git a/Graph/HashGraph.h b/Graph/HashGraph.h
new file mode 100644
index 0000000..4ba791a
--- /dev/null
+++ b/Graph/HashGraph.h
@@ -0,0 +1,485 @@
+#ifndef HASH_GRAPH_H
+#define HASH_GRAPH_H
+
+#include "Common/UnorderedMap.h"
+#include "Common/UnorderedSet.h"
+#include "Common/Warnings.h"
+#include "Graph/Properties.h"
+#include <boost/graph/graph_traits.hpp>
+#include <vector>
+#include <cassert>
+#include <sstream>
+
+#define DEFAULT_VERTEX_COLOR "gray"
+
+template <class VertexType>
+class HashGraph
+{
+public:
+
+ typedef HashGraph<VertexType> Graph;
+ typedef boost::graph_traits<Graph> GraphTraits;
+ typedef typename GraphTraits::vertex_descriptor vertex_descriptor;
+ typedef typename GraphTraits::vertex_property_type vertex_property_type;
+ typedef typename GraphTraits::edge_descriptor edge_descriptor;
+ typedef typename GraphTraits::edge_property_type edge_property_type;
+ typedef typename GraphTraits::out_edge_iterator out_edge_iterator;
+ typedef typename GraphTraits::adjacency_iterator adjacency_iterator;
+ typedef typename GraphTraits::degree_size_type degree_size_type;
+ typedef typename GraphTraits::vertex_iterator vertex_iterator;
+ typedef typename GraphTraits::vertices_size_type vertices_size_type;
+
+ typedef typename GraphTraits::VertexList VertexList;
+ typedef typename GraphTraits::VertexListIterator VertexListIterator;
+ typedef typename GraphTraits::EdgeList EdgeList;
+
+protected:
+
+ typedef unordered_map<vertex_descriptor, VertexList,
+ hash<vertex_descriptor> > VertexMap;
+ typedef std::pair<vertex_descriptor, VertexList> VertexMapEntry;
+ typedef unordered_map<vertex_descriptor, std::string> VertexColorMap;
+
+ VertexMap m_vertices;
+ VertexColorMap m_vertexColor;
+ size_t m_numEdges;
+
+public:
+
+ typedef typename VertexMap::const_iterator VertexMapIterator;
+
+ HashGraph() : m_numEdges(0) {}
+
+ size_t approxMemSize()
+ {
+ size_t pointer_size = sizeof(void *);
+ size_t entry_bytes = m_numEdges * sizeof(vertex_descriptor);
+ size_t filled_bucket_bytes = m_vertices.size() *
+ (sizeof(typename VertexMap::value_type) +
+ 3 * pointer_size);
+ size_t empty_bucket_bytes = (1.0 - m_vertices.load_factor()) *
+ m_vertices.bucket_count() * pointer_size;
+ return entry_bytes + filled_bucket_bytes + empty_bucket_bytes;
+ }
+
+ void set_vertex_color(const vertex_descriptor& v, const std::string& color)
+ {
+ m_vertexColor[v] = color;
+ }
+
+ std::string get_vertex_color(const vertex_descriptor& v) const
+ {
+ typename VertexColorMap::const_iterator i = m_vertexColor.find(v);
+ if (i == m_vertexColor.end())
+ return DEFAULT_VERTEX_COLOR;
+ return i->second;
+ }
+
+ std::pair<VertexMapIterator, VertexMapIterator>
+ get_vertex_map_entries() const
+ {
+ return std::pair<VertexMapIterator, VertexMapIterator>
+ (m_vertices.begin(), m_vertices.end());
+ }
+
+ vertices_size_type num_vertices() const
+ {
+ return m_vertices.size();
+ }
+
+ std::pair<VertexListIterator, VertexListIterator>
+ get_successors(const vertex_descriptor& v) const
+ {
+ typename VertexMap::const_iterator i = m_vertices.find(v);
+ assert(i != m_vertices.end());
+ VertexListIterator begin = i->second.begin();
+ VertexListIterator end = i->second.end();
+ return std::pair<VertexListIterator, VertexListIterator>
+ (begin, end);
+ }
+
+ degree_size_type
+ out_degree(const vertex_descriptor& v) const
+ {
+ typename VertexMap::const_iterator i = m_vertices.find(v);
+ if (i == m_vertices.end())
+ return 0;
+ return i->second.size();
+ }
+
+ typename VertexMap::iterator
+ init_vertex(const vertex_descriptor &v)
+ {
+ bool inserted;
+ VertexList successors;
+ successors.reserve(1);
+ VertexMapEntry entry(v, successors);
+ typename VertexMap::iterator i;
+ boost::tie(i, inserted) = m_vertices.insert(entry);
+ assert(inserted);
+ return i;
+ }
+
+ std::pair<edge_descriptor, bool>
+ add_edge(const vertex_descriptor& u, const vertex_descriptor& v)
+ {
+ bool edgeInserted = false;
+ typename VertexMap::iterator i = m_vertices.find(u);
+ if (i == m_vertices.end())
+ i = init_vertex(u);
+ VertexList& successors = i->second;
+ if (std::find(successors.begin(), successors.end(), v) == successors.end()) {
+ successors.push_back(v);
+ m_numEdges++;
+ edgeInserted = true;
+ }
+ i = m_vertices.find(v);
+ if (i == m_vertices.end())
+ init_vertex(v);
+ return std::pair<edge_descriptor, bool>
+ (edge_descriptor(u, v), edgeInserted);
+ }
+};
+
+namespace boost {
+
+template <class VertexType>
+struct graph_traits< HashGraph<VertexType> > {
+
+ // Graph
+ typedef VertexType vertex_descriptor;
+ typedef std::pair<vertex_descriptor, vertex_descriptor> edge_descriptor;
+ typedef boost::directed_tag directed_category;
+ typedef boost::allow_parallel_edge_tag edge_parallel_category;
+ struct traversal_category
+ : boost::incidence_graph_tag,
+ boost::adjacency_graph_tag,
+ boost::vertex_list_graph_tag,
+ boost::edge_list_graph_tag { };
+
+ // BidirectionalGraph
+ typedef void in_edge_iterator;
+
+ // VertexListGraph
+ typedef std::vector<vertex_descriptor> VertexList;
+ typedef typename
+ std::vector<vertex_descriptor>::const_iterator
+ VertexListIterator;
+ typedef unsigned vertices_size_type;
+
+ // EdgeListGraph
+ typedef void edges_size_type;
+
+ // PropertyGraph
+ typedef std::string vertex_bundled;
+ typedef std::string vertex_property_type;
+ typedef no_property edge_bundled;
+ typedef no_property edge_property_type;
+
+ // IncidenceGraph
+ typedef std::vector<edge_descriptor> EdgeList;
+ typedef unsigned degree_size_type;
+
+ class vertex_iterator
+ : public std::iterator<std::input_iterator_tag,
+ const vertex_descriptor>
+ {
+ protected:
+
+ void init(bool end)
+ {
+ boost::tie(m_it, m_end) = m_g->get_vertex_map_entries();
+ if (end)
+ m_it = m_end;
+ }
+
+ public:
+
+ vertex_iterator() {}
+
+ vertex_iterator(const HashGraph<VertexType>& g, bool end) : m_g(&g)
+ {
+ init(end);
+ }
+
+ vertex_descriptor operator *() const
+ {
+ return m_it->first;
+ }
+
+ bool operator ==(const vertex_iterator& it) const
+ {
+ return m_it == it.m_it;
+ }
+
+ bool operator !=(const vertex_iterator& it) const
+ {
+ return m_it != it.m_it;
+ }
+
+ vertex_iterator& operator ++()
+ {
+ ++m_it;
+ return *this;
+ }
+
+ vertex_iterator operator++(int)
+ {
+ vertex_iterator it = *this;
+ ++*this;
+ return it;
+ }
+
+ private:
+
+ const HashGraph<VertexType>* m_g;
+ typename HashGraph<VertexType>::VertexMapIterator m_it, m_end;
+
+ };
+
+ struct adjacency_iterator
+ : public std::iterator<std::input_iterator_tag, vertex_descriptor>
+ {
+ protected:
+
+ void init(bool end)
+ {
+ boost::tie(m_successor, m_successor_end) = m_g->get_successors(m_v);
+ if (end)
+ m_successor = m_successor_end;
+ }
+
+ public:
+
+ adjacency_iterator() { }
+
+ adjacency_iterator(const HashGraph<VertexType>& g, vertex_descriptor v, bool end)
+ : m_g(&g), m_v(v)
+ {
+ init(end);
+ }
+
+ vertex_descriptor operator*() const
+ {
+ return *m_successor;
+ }
+
+ bool operator==(const adjacency_iterator& it) const
+ {
+ return m_successor == it.m_successor;
+ }
+
+ bool operator!=(const adjacency_iterator& it) const
+ {
+ return !(*this == it);
+ }
+
+ adjacency_iterator& operator++()
+ {
+ m_successor++;
+ return *this;
+ }
+
+ adjacency_iterator operator++(int)
+ {
+ adjacency_iterator it = *this;
+ ++*this;
+ return it;
+ }
+
+ private:
+
+ const HashGraph<VertexType>* m_g;
+ vertex_descriptor m_v;
+ VertexListIterator m_successor;
+ VertexListIterator m_successor_end;
+ };
+
+ struct out_edge_iterator
+ : public std::iterator<std::input_iterator_tag, edge_descriptor>
+ {
+
+ protected:
+
+ void init(bool end)
+ {
+ boost::tie(m_successor, m_successor_end) = m_g->get_successors(m_v);
+ if (end)
+ m_successor = m_successor_end;
+ }
+
+ public:
+
+ out_edge_iterator() { }
+
+ out_edge_iterator(const HashGraph<VertexType>& g, vertex_descriptor v)
+ : m_g(&g), m_v(v)
+ {
+ init(false);
+ }
+
+ out_edge_iterator(const HashGraph<VertexType>& g, vertex_descriptor v, bool end)
+ : m_g(&g), m_v(v)
+ {
+ init(end);
+ }
+
+ edge_descriptor operator*() const
+ {
+ return edge_descriptor(m_v, *m_successor);
+ }
+
+ bool operator==(const out_edge_iterator& it) const
+ {
+ return m_successor == it.m_successor;
+ }
+
+ bool operator!=(const out_edge_iterator& it) const
+ {
+ return !(*this == it);
+ }
+
+ out_edge_iterator& operator++()
+ {
+ m_successor++;
+ return *this;
+ }
+
+ out_edge_iterator operator++(int)
+ {
+ out_edge_iterator it = *this;
+ ++*this;
+ return it;
+ }
+
+ private:
+
+ const HashGraph<VertexType>* m_g;
+ vertex_descriptor m_v;
+ VertexListIterator m_successor;
+ VertexListIterator m_successor_end;
+
+ }; // out_edge_iterator
+
+}; // graph_traits
+
+}
+
+// IncidenceGraph
+
+template <class VertexType>
+std::pair<
+ typename HashGraph<VertexType>::out_edge_iterator,
+ typename HashGraph<VertexType>::out_edge_iterator>
+out_edges(
+ typename HashGraph<VertexType>::vertex_descriptor v,
+ const HashGraph<VertexType>& g)
+{
+ typedef typename HashGraph<VertexType>::out_edge_iterator out_edge_iterator;
+ return std::pair<out_edge_iterator, out_edge_iterator>
+ (out_edge_iterator(g, v), out_edge_iterator(g, v, true));
+}
+
+template <class VertexType>
+typename HashGraph<VertexType>::degree_size_type
+out_degree(
+ typename HashGraph<VertexType>::vertex_descriptor v,
+ const HashGraph<VertexType>& g)
+{
+ return g.out_degree(v);
+}
+
+// AdjacencyGraph
+
+template <class VertexType>
+std::pair<
+ typename HashGraph<VertexType>::adjacency_iterator,
+ typename HashGraph<VertexType>::adjacency_iterator>
+adjacent_vertices(
+ typename HashGraph<VertexType>::vertex_descriptor v,
+ const HashGraph<VertexType>& g)
+{
+ typedef typename HashGraph<VertexType>::adjacency_iterator adjacency_iterator;
+ return std::pair<adjacency_iterator, adjacency_iterator>
+ (adjacency_iterator(g, v, false), adjacency_iterator(g, v, true));
+}
+
+// VertexListGraph
+
+template <class VertexType>
+std::pair<
+ typename HashGraph<VertexType>::vertex_iterator,
+ typename HashGraph<VertexType>::vertex_iterator>
+vertices(const HashGraph<VertexType>& g)
+{
+ typedef typename HashGraph<VertexType>::vertex_iterator vertex_iterator;
+ return std::pair<vertex_iterator, vertex_iterator>
+ (vertex_iterator(g, false), vertex_iterator(g, true));
+}
+
+template <class VertexType>
+typename HashGraph<VertexType>::vertices_size_type
+num_vertices(const HashGraph<VertexType>& g)
+{
+ return g.num_vertices();
+}
+
+// MutableGraph
+
+template <class VertexType>
+std::pair<typename HashGraph<VertexType>::edge_descriptor, bool>
+add_edge(
+ typename HashGraph<VertexType>::vertex_descriptor u,
+ typename HashGraph<VertexType>::vertex_descriptor v,
+ HashGraph<VertexType>& g)
+{
+ return g.add_edge(u, v);
+}
+
+// PropertyGraph
+// (dummy functions so that HashGraph
+// works with DotIO.h routines)
+
+template <class VertexType>
+bool get(vertex_removed_t, const HashGraph<VertexType>& g,
+ typename HashGraph<VertexType>::vertex_descriptor v)
+{
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(v);
+ return false;
+}
+
+template <class VertexType>
+void put(vertex_removed_t tag, HashGraph<VertexType>& g,
+ typename HashGraph<VertexType>::vertex_descriptor v,
+ bool flag)
+{
+ SUPPRESS_UNUSED_WARNING(tag);
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(v);
+ SUPPRESS_UNUSED_WARNING(flag);
+ return;
+}
+
+template <class VertexType>
+typename HashGraph<VertexType>::vertex_descriptor
+get(vertex_name_t, const HashGraph<VertexType>& g,
+ typename HashGraph<VertexType>::vertex_descriptor v)
+{
+ SUPPRESS_UNUSED_WARNING(g);
+ return v;
+}
+
+template <class VertexType>
+std::string
+get(vertex_bundle_t, const HashGraph<VertexType>& g,
+ typename HashGraph<VertexType>::vertex_descriptor v)
+{
+ const std::string& color = g.get_vertex_color(v);
+ std::ostringstream ss;
+ ss << "color=" << color;
+ assert(ss);
+ return ss.str();
+}
+
+#endif
diff --git a/Graph/Makefile.am b/Graph/Makefile.am
index f46756d..e92ea5c 100644
--- a/Graph/Makefile.am
+++ b/Graph/Makefile.am
@@ -1,15 +1,25 @@
-noinst_LIBRARIES = libgraph.a
bin_PROGRAMS = abyss-gc abyss-todot
-libgraph_a_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
+abyss_todot_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
+abyss_todot_LDFLAGS = -L.
+abyss_todot_LDADD = \
+ $(top_builddir)/Common/libcommon.a
+abyss_todot_SOURCES = todot.cc
-libgraph_a_SOURCES = \
+EXTRA_DIST = \
AdjIO.h \
+ AllPathsSearch.h \
AsqgIO.h \
Assemble.h \
- ConstrainedSearch.cpp ConstrainedSearch.h \
+ BidirectionalBFS.h \
+ BidirectionalBFSVisitor.h \
+ BreadthFirstSearch.h \
+ ConstrainedBFSVisitor.h \
+ ConstrainedBidiBFSVisitor.h \
+ ConstrainedSearch.h \
ContigGraph.h \
ContigGraphAlgorithms.h \
+ DefaultColorMap.h \
DepthFirstSearch.h \
DirectedGraph.h \
DistIO.h \
@@ -18,17 +28,13 @@ libgraph_a_SOURCES = \
GraphAlgorithms.h \
GraphIO.h \
GraphUtil.h \
+ HashGraph.h \
Options.h \
+ Path.h \
PopBubbles.h \
Properties.h \
SAMIO.h
-abyss_todot_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
-abyss_todot_LDFLAGS = -L.
-abyss_todot_LDADD = libgraph.a \
- $(top_builddir)/Common/libcommon.a
-abyss_todot_SOURCES = todot.cc
-
abyss_gc_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
abyss_gc_LDADD = $(top_builddir)/Common/libcommon.a
abyss_gc_SOURCES = gc.cc
diff --git a/Graph/Makefile.in b/Graph/Makefile.in
deleted file mode 100644
index 34c5517..0000000
--- a/Graph/Makefile.in
+++ /dev/null
@@ -1,697 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = abyss-gc$(EXEEXT) abyss-todot$(EXEEXT)
-subdir = Graph
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-LIBRARIES = $(noinst_LIBRARIES)
-AR = ar
-ARFLAGS = cru
-AM_V_AR = $(am__v_AR_ at AM_V@)
-am__v_AR_ = $(am__v_AR_ at AM_DEFAULT_V@)
-am__v_AR_0 = @echo " AR " $@;
-am__v_AR_1 =
-libgraph_a_AR = $(AR) $(ARFLAGS)
-libgraph_a_LIBADD =
-am_libgraph_a_OBJECTS = libgraph_a-ConstrainedSearch.$(OBJEXT)
-libgraph_a_OBJECTS = $(am_libgraph_a_OBJECTS)
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_abyss_gc_OBJECTS = abyss_gc-gc.$(OBJEXT)
-abyss_gc_OBJECTS = $(am_abyss_gc_OBJECTS)
-abyss_gc_DEPENDENCIES = $(top_builddir)/Common/libcommon.a
-am_abyss_todot_OBJECTS = abyss_todot-todot.$(OBJEXT)
-abyss_todot_OBJECTS = $(am_abyss_todot_OBJECTS)
-abyss_todot_DEPENDENCIES = libgraph.a \
- $(top_builddir)/Common/libcommon.a
-abyss_todot_LINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) \
- $(abyss_todot_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(libgraph_a_SOURCES) $(abyss_gc_SOURCES) \
- $(abyss_todot_SOURCES)
-DIST_SOURCES = $(libgraph_a_SOURCES) $(abyss_gc_SOURCES) \
- $(abyss_todot_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-noinst_LIBRARIES = libgraph.a
-libgraph_a_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
-libgraph_a_SOURCES = \
- AdjIO.h \
- AsqgIO.h \
- Assemble.h \
- ConstrainedSearch.cpp ConstrainedSearch.h \
- ContigGraph.h \
- ContigGraphAlgorithms.h \
- DepthFirstSearch.h \
- DirectedGraph.h \
- DistIO.h \
- DotIO.h \
- FastaIO.h \
- GraphAlgorithms.h \
- GraphIO.h \
- GraphUtil.h \
- Options.h \
- PopBubbles.h \
- Properties.h \
- SAMIO.h
-
-abyss_todot_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
-abyss_todot_LDFLAGS = -L.
-abyss_todot_LDADD = libgraph.a \
- $(top_builddir)/Common/libcommon.a
-
-abyss_todot_SOURCES = todot.cc
-abyss_gc_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
-abyss_gc_LDADD = $(top_builddir)/Common/libcommon.a
-abyss_gc_SOURCES = gc.cc
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cc .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Graph/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Graph/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-
-clean-noinstLIBRARIES:
- -test -z "$(noinst_LIBRARIES)" || rm -f $(noinst_LIBRARIES)
-
-libgraph.a: $(libgraph_a_OBJECTS) $(libgraph_a_DEPENDENCIES) $(EXTRA_libgraph_a_DEPENDENCIES)
- $(AM_V_at)-rm -f libgraph.a
- $(AM_V_AR)$(libgraph_a_AR) libgraph.a $(libgraph_a_OBJECTS) $(libgraph_a_LIBADD)
- $(AM_V_at)$(RANLIB) libgraph.a
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-abyss-gc$(EXEEXT): $(abyss_gc_OBJECTS) $(abyss_gc_DEPENDENCIES) $(EXTRA_abyss_gc_DEPENDENCIES)
- @rm -f abyss-gc$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(abyss_gc_OBJECTS) $(abyss_gc_LDADD) $(LIBS)
-
-abyss-todot$(EXEEXT): $(abyss_todot_OBJECTS) $(abyss_todot_DEPENDENCIES) $(EXTRA_abyss_todot_DEPENDENCIES)
- @rm -f abyss-todot$(EXEEXT)
- $(AM_V_CXXLD)$(abyss_todot_LINK) $(abyss_todot_OBJECTS) $(abyss_todot_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_gc-gc.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_todot-todot.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/libgraph_a-ConstrainedSearch.Po at am__quote@
-
-.cc.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cc.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-libgraph_a-ConstrainedSearch.o: ConstrainedSearch.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libgraph_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libgraph_a-ConstrainedSearch.o -MD -MP -MF $(DEPDIR)/libgraph_a-ConstrainedSearch.Tpo -c -o libgraph_a-ConstrainedSearch.o `test -f 'ConstrainedSearch.cpp' || echo '$(srcdir)/'`ConstrainedSearch.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libgraph_a-ConstrainedSearch.Tpo $(DEPDIR)/libgraph_a-ConstrainedSearch.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='ConstrainedSearch.cpp' object='libgraph_a-ConstrainedSearch.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libgraph_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libgraph_a-ConstrainedSearch.o `test -f 'ConstrainedSearch.cpp' || echo '$(srcdir)/'`ConstrainedSearch.cpp
-
-libgraph_a-ConstrainedSearch.obj: ConstrainedSearch.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libgraph_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT libgraph_a-ConstrainedSearch.obj -MD -MP -MF $(DEPDIR)/libgraph_a-ConstrainedSearch.Tpo -c -o libgraph_a-ConstrainedSearch.obj `if test -f 'ConstrainedSearch.cpp'; then $(CYGPATH_W) 'ConstrainedSearch.cpp'; else $(CYGPATH_W) '$(srcdir)/ConstrainedSearch.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/libgraph_a-ConstrainedSearch.Tpo $(DEPDIR)/libgraph_a-ConstrainedSearch.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='ConstrainedSearch.cpp' object='libgraph_a-ConstrainedSearch.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(libgraph_a_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o libgraph_a-ConstrainedSearch.obj `if test -f 'ConstrainedSearch.cpp'; then $(CYGPATH_W) 'ConstrainedSearch.cpp'; else $(CYGPATH_W) '$(srcdir)/ConstrainedSearch.cpp'; fi`
-
-abyss_gc-gc.o: gc.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_gc_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_gc-gc.o -MD -MP -MF $(DEPDIR)/abyss_gc-gc.Tpo -c -o abyss_gc-gc.o `test -f 'gc.cc' || echo '$(srcdir)/'`gc.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_gc-gc.Tpo $(DEPDIR)/abyss_gc-gc.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='gc.cc' object='abyss_gc-gc.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_gc_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_gc-gc.o `test -f 'gc.cc' || echo '$(srcdir)/'`gc.cc
-
-abyss_gc-gc.obj: gc.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_gc_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_gc-gc.obj -MD -MP -MF $(DEPDIR)/abyss_gc-gc.Tpo -c -o abyss_gc-gc.obj `if test -f 'gc.cc'; then $(CYGPATH_W) 'gc.cc'; else $(CYGPATH_W) '$(srcdir)/gc.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_gc-gc.Tpo $(DEPDIR)/abyss_gc-gc.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='gc.cc' object='abyss_gc-gc.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_gc_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_gc-gc.obj `if test -f 'gc.cc'; then $(CYGPATH_W) 'gc.cc'; else $(CYGPATH_W) '$(srcdir)/gc.cc'; fi`
-
-abyss_todot-todot.o: todot.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_todot_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_todot-todot.o -MD -MP -MF $(DEPDIR)/abyss_todot-todot.Tpo -c -o abyss_todot-todot.o `test -f 'todot.cc' || echo '$(srcdir)/'`todot.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_todot-todot.Tpo $(DEPDIR)/abyss_todot-todot.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='todot.cc' object='abyss_todot-todot.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_todot_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_todot-todot.o `test -f 'todot.cc' || echo '$(srcdir)/'`todot.cc
-
-abyss_todot-todot.obj: todot.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_todot_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_todot-todot.obj -MD -MP -MF $(DEPDIR)/abyss_todot-todot.Tpo -c -o abyss_todot-todot.obj `if test -f 'todot.cc'; then $(CYGPATH_W) 'todot.cc'; else $(CYGPATH_W) '$(srcdir)/todot.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_todot-todot.Tpo $(DEPDIR)/abyss_todot-todot.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='todot.cc' object='abyss_todot-todot.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_todot_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_todot-todot.obj `if test -f 'todot.cc'; then $(CYGPATH_W) 'todot.cc'; else $(CYGPATH_W) '$(srcdir)/todot.cc'; fi`
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(LIBRARIES) $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic clean-noinstLIBRARIES \
- mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic clean-noinstLIBRARIES \
- cscopelist-am ctags ctags-am distclean distclean-compile \
- distclean-generic distclean-tags distdir dvi dvi-am html \
- html-am info info-am install install-am install-binPROGRAMS \
- install-data install-data-am install-dvi install-dvi-am \
- install-exec install-exec-am install-html install-html-am \
- install-info install-info-am install-man install-pdf \
- install-pdf-am install-ps install-ps-am install-strip \
- installcheck installcheck-am installdirs maintainer-clean \
- maintainer-clean-generic mostlyclean mostlyclean-compile \
- mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
- uninstall-am uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Graph/Path.h b/Graph/Path.h
new file mode 100644
index 0000000..9962b42
--- /dev/null
+++ b/Graph/Path.h
@@ -0,0 +1,47 @@
+#ifndef PATH_H_
+#define PATH_H_
+
+#include <vector>
+#include <string>
+#include <sstream>
+#include <climits>
+
+enum PathSearchResult {
+ FOUND_PATH = 0,
+ TOO_MANY_PATHS,
+ TOO_MANY_BRANCHES,
+ PATH_CONTAINS_CYCLE,
+ EXCEEDED_MEM_LIMIT,
+ NO_PATH
+};
+
+const char* PathSearchResultLabel[] = {
+ "FOUND_PATH",
+ "TOO_MANY_PATHS",
+ "TOO_MANY_BRANCHES",
+ "PATH_CONTAINS_CYCLE",
+ "EXCEEDED_MEM_LIMIT",
+ "NO_PATH"
+};
+
+enum Direction { FORWARD = 0, REVERSE };
+
+const unsigned NO_LIMIT = UINT_MAX;
+
+template <class Vertex> class Path : public std::vector<Vertex>
+{
+public:
+
+ std::string str() {
+ std::stringstream s;
+ typename std::vector<Vertex>::iterator i = this->begin();
+ for (; i != this->end(); i++) {
+ if (i != this->begin())
+ s << ",";
+ s << *i;
+ }
+ return s.str();
+ }
+};
+
+#endif
diff --git a/Graph/PopBubbles.h b/Graph/PopBubbles.h
index 8eea310..91ff1fd 100644
--- a/Graph/PopBubbles.h
+++ b/Graph/PopBubbles.h
@@ -161,7 +161,6 @@ template <typename Graph>
void scaffoldBubble(Graph& g, const Bubble& bubble)
{
typedef graph_traits<Graph> GTraits;
- typedef typename GTraits::adjacency_iterator Ait;
typedef typename GTraits::vertex_descriptor V;
assert(bubble.size() > 2);
diff --git a/Graph/SAMIO.h b/Graph/SAMIO.h
index b2da70c..abfd5ee 100644
--- a/Graph/SAMIO.h
+++ b/Graph/SAMIO.h
@@ -1,8 +1,9 @@
#ifndef SAMIO_H
#define SAMIO_H 1
-#include "ContigNode.h"
#include "Graph/Properties.h"
+#include <istream>
+#include <sstream>
#include <boost/graph/graph_traits.hpp>
#include <ostream>
@@ -23,8 +24,6 @@ std::ostream& write_sam(std::ostream& out, const Graph& g,
vertex_property_type;
typedef typename graph_traits<Graph>::edge_iterator
edge_iterator;
- typedef typename edge_property<Graph>::type
- edge_property_type;
out << "@HD\tVN:1.0\n"
"@PG\tID:" << program << "\tVN:" VERSION "\t"
@@ -69,4 +68,32 @@ std::ostream& write_sam(std::ostream& out, const Graph& g,
return out;
}
+template <typename Graph>
+std::istream& read_sam_header(std::istream& in, Graph& g)
+{
+ typedef typename graph_traits<Graph>::vertex_descriptor V;
+ typedef typename vertex_property<Graph>::type VP;
+ assert(in);
+ for (std::string line; in.peek() == '@' && getline(in, line);) {
+ std::istringstream ss(line);
+ std::string type;
+ ss >> type;
+ if (type != "@SQ")
+ continue;
+
+ std::string s;
+ VP vp;
+ ss >> expect(" SN:") >> s >> expect(" LN:") >> vp;
+ assert(ss);
+
+ V u = add_vertex(vp, g);
+ put(vertex_name, g, u, s);
+ }
+ if (g.num_vertices() == 0) {
+ std::cerr << "error: no @SQ records in the SAM header\n";
+ exit(EXIT_FAILURE);
+ }
+ return in;
+}
+
#endif
diff --git a/Graph/gc.cc b/Graph/gc.cc
index dfa755b..5dee00e 100644
--- a/Graph/gc.cc
+++ b/Graph/gc.cc
@@ -19,7 +19,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [FILE]...\n"
diff --git a/Graph/todot.cc b/Graph/todot.cc
index c6fe767..6ac2b46 100644
--- a/Graph/todot.cc
+++ b/Graph/todot.cc
@@ -24,7 +24,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [FILE]...\n"
diff --git a/KAligner/Aligner.h b/KAligner/Aligner.h
index f05d869..947b8f6 100644
--- a/KAligner/Aligner.h
+++ b/KAligner/Aligner.h
@@ -54,15 +54,16 @@ struct Position
}
};
-typedef unordered_multimap<Kmer, Position, hashKmer>
+typedef unordered_multimap<Kmer, Position, hash<Kmer> >
SeqPosHashMultiMap;
#if HAVE_GOOGLE_SPARSE_HASH_MAP
# include <google/sparse_hash_map>
-typedef google::sparse_hash_map<Kmer, Position,
- hashKmer> SeqPosHashUniqueMap;
+typedef google::sparse_hash_map<Kmer, Position, hash<Kmer> >
+ SeqPosHashUniqueMap;
#else
-typedef unordered_map<Kmer, Position, hashKmer> SeqPosHashUniqueMap;
+typedef unordered_map<Kmer, Position, hash<Kmer> >
+ SeqPosHashUniqueMap;
#endif
diff --git a/KAligner/KAligner.cpp b/KAligner/KAligner.cpp
index 548fafb..bdbc7db 100644
--- a/KAligner/KAligner.cpp
+++ b/KAligner/KAligner.cpp
@@ -34,10 +34,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Jared Simpson and Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... QUERY... TARGET\n"
+"Usage: " PROGRAM " -k<kmer> [OPTION]... QUERY... TARGET\n"
"Align the sequences of the files QUERY to those of TARGET.\n"
"All perfect matches of at least k bases will be found.\n"
"\n"
diff --git a/KAligner/Makefile.am b/KAligner/Makefile.am
index 0cf2996..0725ec1 100644
--- a/KAligner/Makefile.am
+++ b/KAligner/Makefile.am
@@ -1,14 +1,13 @@
bin_PROGRAMS = KAligner
-KAligner_CPPFLAGS = -pthread -I$(top_srcdir) \
+KAligner_CPPFLAGS = -I$(top_srcdir) \
-I$(top_srcdir)/Common \
-I$(top_srcdir)/DataLayer
KAligner_LDADD = \
$(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-KAligner_LDFLAGS = -pthread
+ $(top_builddir)/Common/libcommon.a \
+ -lpthread
KAligner_SOURCES = KAligner.cpp Aligner.cpp Aligner.h Options.h \
Pipe.h PipeMux.h Semaphore.h
diff --git a/KAligner/Makefile.in b/KAligner/Makefile.in
deleted file mode 100644
index 42bcb6b..0000000
--- a/KAligner/Makefile.in
+++ /dev/null
@@ -1,620 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = KAligner$(EXEEXT)
-subdir = KAligner
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_KAligner_OBJECTS = KAligner-KAligner.$(OBJEXT) \
- KAligner-Aligner.$(OBJEXT)
-KAligner_OBJECTS = $(am_KAligner_OBJECTS)
-KAligner_DEPENDENCIES = $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-KAligner_LINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) \
- $(KAligner_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(KAligner_SOURCES)
-DIST_SOURCES = $(KAligner_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-KAligner_CPPFLAGS = -pthread -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-KAligner_LDADD = \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-KAligner_LDFLAGS = -pthread
-KAligner_SOURCES = KAligner.cpp Aligner.cpp Aligner.h Options.h \
- Pipe.h PipeMux.h Semaphore.h
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign KAligner/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign KAligner/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-KAligner$(EXEEXT): $(KAligner_OBJECTS) $(KAligner_DEPENDENCIES) $(EXTRA_KAligner_DEPENDENCIES)
- @rm -f KAligner$(EXEEXT)
- $(AM_V_CXXLD)$(KAligner_LINK) $(KAligner_OBJECTS) $(KAligner_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/KAligner-Aligner.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/KAligner-KAligner.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-KAligner-KAligner.o: KAligner.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(KAligner_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT KAligner-KAligner.o -MD -MP -MF $(DEPDIR)/KAligner-KAligner.Tpo -c -o KAligner-KAligner.o `test -f 'KAligner.cpp' || echo '$(srcdir)/'`KAligner.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/KAligner-KAligner.Tpo $(DEPDIR)/KAligner-KAligner.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='KAligner.cpp' object='KAligner-KAligner.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(KAligner_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o KAligner-KAligner.o `test -f 'KAligner.cpp' || echo '$(srcdir)/'`KAligner.cpp
-
-KAligner-KAligner.obj: KAligner.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(KAligner_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT KAligner-KAligner.obj -MD -MP -MF $(DEPDIR)/KAligner-KAligner.Tpo -c -o KAligner-KAligner.obj `if test -f 'KAligner.cpp'; then $(CYGPATH_W) 'KAligner.cpp'; else $(CYGPATH_W) '$(srcdir)/KAligner.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/KAligner-KAligner.Tpo $(DEPDIR)/KAligner-KAligner.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='KAligner.cpp' object='KAligner-KAligner.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(KAligner_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o KAligner-KAligner.obj `if test -f 'KAligner.cpp'; then $(CYGPATH_W) 'KAligner.cpp'; else $(CYGPATH_W) '$(srcdir)/KAligner.cpp'; fi`
-
-KAligner-Aligner.o: Aligner.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(KAligner_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT KAligner-Aligner.o -MD -MP -MF $(DEPDIR)/KAligner-Aligner.Tpo -c -o KAligner-Aligner.o `test -f 'Aligner.cpp' || echo '$(srcdir)/'`Aligner.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/KAligner-Aligner.Tpo $(DEPDIR)/KAligner-Aligner.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Aligner.cpp' object='KAligner-Aligner.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(KAligner_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o KAligner-Aligner.o `test -f 'Aligner.cpp' || echo '$(srcdir)/'`Aligner.cpp
-
-KAligner-Aligner.obj: Aligner.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(KAligner_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT KAligner-Aligner.obj -MD -MP -MF $(DEPDIR)/KAligner-Aligner.Tpo -c -o KAligner-Aligner.obj `if test -f 'Aligner.cpp'; then $(CYGPATH_W) 'Aligner.cpp'; else $(CYGPATH_W) '$(srcdir)/Aligner.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/KAligner-Aligner.Tpo $(DEPDIR)/KAligner-Aligner.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Aligner.cpp' object='KAligner-Aligner.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(KAligner_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o KAligner-Aligner.obj `if test -f 'Aligner.cpp'; then $(CYGPATH_W) 'Aligner.cpp'; else $(CYGPATH_W) '$(srcdir)/Aligner.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Konnector/DBGBloom.h b/Konnector/DBGBloom.h
new file mode 100644
index 0000000..c42737b
--- /dev/null
+++ b/Konnector/DBGBloom.h
@@ -0,0 +1,434 @@
+/**
+ * de Bruijn Graph data structure using a Bloom filter
+ * Copyright 2013 Shaun Jackman
+ */
+
+#ifndef DBGBLOOM_H
+#define DBGBLOOM_H 1
+
+#include "Common/IOUtil.h"
+#include "Common/Kmer.h"
+#include "Common/SeqExt.h" // for NUM_BASES
+#include "Graph/Properties.h"
+#include "Common/Uncompress.h"
+#include "DataLayer/FastaReader.h"
+
+#include <algorithm>
+#include <cassert>
+#include <cstdlib> // for abort
+#include <fstream>
+#include <string>
+
+using boost::graph_traits;
+
+template <typename BF>
+class DBGBloom: public BF {
+ public:
+ /** The bundled vertex properties. */
+ typedef no_property vertex_bundled;
+ typedef no_property vertex_property_type;
+
+ /** The bundled edge properties. */
+ typedef no_property edge_bundled;
+ typedef no_property edge_property_type;
+
+ /** The bloom filter */
+ const BF& m_bloom;
+
+ DBGBloom(const BF& bloom) : m_bloom(bloom), m_depthThresh(0) { }
+
+ DBGBloom(const BF& bloom, unsigned depthThresh) :
+ m_bloom(bloom), m_depthThresh(depthThresh) { }
+
+ const unsigned m_depthThresh;
+
+ private:
+ /** Copy constructor. */
+ DBGBloom(const DBGBloom<BF>&);
+
+}; // class DBGBloom
+
+/** PropertyGraph vertex_index */
+template <typename Graph>
+struct DBGBloomIndexMap
+ : boost::put_get_helper<size_t, Graph >
+{
+ typedef Kmer key_type;
+ typedef size_t value_type;
+ typedef value_type reference;
+ typedef boost::readable_property_map_tag category;
+
+ const Graph& m_g;
+
+ DBGBloomIndexMap(const Graph& g) : m_g(g) { }
+
+ reference operator[](const key_type& u) const
+ {
+ return m_g.m_bloom.hash(u) % m_g.m_bloom.size();
+ }
+};
+
+// Graph
+
+namespace boost {
+
+/** Graph traits */
+template <typename BF>
+struct graph_traits< DBGBloom<BF> > {
+ // Graph
+ typedef Kmer vertex_descriptor;
+ typedef boost::directed_tag directed_category;
+ struct traversal_category
+ : boost::adjacency_graph_tag,
+ boost::bidirectional_graph_tag,
+ boost::vertex_list_graph_tag
+ { };
+ typedef boost::disallow_parallel_edge_tag edge_parallel_category;
+
+ static vertex_descriptor null_vertex() { return Kmer(); }
+
+ // IncidenceGraph
+ typedef std::pair<vertex_descriptor, vertex_descriptor>
+ edge_descriptor;
+ typedef unsigned degree_size_type;
+
+ // VertexListGraph
+ typedef size_t vertices_size_type;
+ typedef void vertex_iterator;
+
+ // EdgeListGraph
+ typedef size_t edges_size_type;
+ typedef void edge_iterator;
+
+// AdjacencyGraph
+
+/** Iterate through the adjacent vertices of a vertex. */
+struct adjacency_iterator
+ : public std::iterator<std::input_iterator_tag, vertex_descriptor>
+{
+ /** Skip to the next edge that is present. */
+ void next()
+ {
+ for (; m_i < NUM_BASES; ++m_i) {
+ m_v.setLastBase(SENSE, m_i);
+ if (vertex_exists(m_v, m_g))
+ break;
+ }
+ }
+
+ public:
+ adjacency_iterator(const DBGBloom<BF>& g) : m_g(g), m_i(NUM_BASES) { }
+
+ adjacency_iterator(const DBGBloom<BF>& g, vertex_descriptor u)
+ : m_g(g), m_v(u), m_i(0)
+ {
+ m_v.shift(SENSE);
+ next();
+ }
+
+ const vertex_descriptor& operator*() const
+ {
+ assert(m_i < NUM_BASES);
+ return m_v;
+ }
+
+ bool operator==(const adjacency_iterator& it) const
+ {
+ return m_i == it.m_i;
+ }
+
+ bool operator!=(const adjacency_iterator& it) const
+ {
+ return !(*this == it);
+ }
+
+ adjacency_iterator& operator++()
+ {
+ assert(m_i < NUM_BASES);
+ ++m_i;
+ next();
+ return *this;
+ }
+
+ private:
+ const DBGBloom<BF>& m_g;
+ vertex_descriptor m_v;
+ short unsigned m_i;
+}; // adjacency_iterator
+
+/** IncidenceGraph */
+struct out_edge_iterator
+ : public std::iterator<std::input_iterator_tag, edge_descriptor>
+{
+ /** Skip to the next edge that is present. */
+ void next()
+ {
+ for (; m_i < NUM_BASES; ++m_i) {
+ m_v.setLastBase(SENSE, m_i);
+ if (vertex_exists(m_v, *m_g))
+ break;
+ }
+ }
+
+ public:
+ out_edge_iterator() { }
+
+ out_edge_iterator(const DBGBloom<BF>& g) : m_g(&g), m_i(NUM_BASES) { }
+
+ out_edge_iterator(const DBGBloom<BF>& g, vertex_descriptor u)
+ : m_g(&g), m_u(u), m_v(u), m_i(0)
+ {
+ m_v.shift(SENSE);
+ next();
+ }
+
+ edge_descriptor operator*() const
+ {
+ assert(m_i < NUM_BASES);
+ return edge_descriptor(m_u, m_v);
+ }
+
+ bool operator==(const out_edge_iterator& it) const
+ {
+ return m_i == it.m_i;
+ }
+
+ bool operator!=(const out_edge_iterator& it) const
+ {
+ return !(*this == it);
+ }
+
+ out_edge_iterator& operator++()
+ {
+ assert(m_i < NUM_BASES);
+ ++m_i;
+ next();
+ return *this;
+ }
+
+ out_edge_iterator operator++(int)
+ {
+ out_edge_iterator it = *this;
+ ++*this;
+ return it;
+ }
+
+ private:
+ const DBGBloom<BF>* m_g;
+ vertex_descriptor m_u;
+ vertex_descriptor m_v;
+ unsigned m_i;
+}; // out_edge_iterator
+
+/** BidirectionalGraph */
+struct in_edge_iterator
+ : public std::iterator<std::input_iterator_tag, edge_descriptor>
+{
+ /** Skip to the next edge that is present. */
+ void next()
+ {
+ for (; m_i < NUM_BASES; ++m_i) {
+ m_v.setLastBase(ANTISENSE, m_i);
+ if (vertex_exists(m_v, *m_g))
+ break;
+ }
+ }
+
+ public:
+ in_edge_iterator() { }
+
+ in_edge_iterator(const DBGBloom<BF>& g) : m_g(&g), m_i(NUM_BASES) { }
+
+ in_edge_iterator(const DBGBloom<BF>& g, vertex_descriptor u)
+ : m_g(&g), m_u(u), m_v(u), m_i(0)
+ {
+ m_v.shift(ANTISENSE);
+ next();
+ }
+
+ edge_descriptor operator*() const
+ {
+ assert(m_i < NUM_BASES);
+ return edge_descriptor(m_v, m_u);
+ }
+
+ bool operator==(const in_edge_iterator& it) const
+ {
+ return m_i == it.m_i;
+ }
+
+ bool operator!=(const in_edge_iterator& it) const
+ {
+ return !(*this == it);
+ }
+
+ in_edge_iterator& operator++()
+ {
+ assert(m_i < NUM_BASES);
+ ++m_i;
+ next();
+ return *this;
+ }
+
+ in_edge_iterator operator++(int)
+ {
+ in_edge_iterator it = *this;
+ ++*this;
+ return it;
+ }
+
+ private:
+ const DBGBloom<BF>* m_g;
+ vertex_descriptor m_u;
+ vertex_descriptor m_v;
+ unsigned m_i;
+}; // in_edge_iterator
+
+}; // graph_traits<DBGBloom>
+
+} // namespace boost
+
+// Subgraph
+
+/** Return whether this vertex exists in the subgraph. */
+template <typename Graph>
+static inline bool
+vertex_exists(typename graph_traits<Graph>::vertex_descriptor u, const Graph& g)
+{
+ return g.m_bloom[u] > g.m_depthThresh;
+}
+
+template <typename Graph>
+static inline
+std::pair<typename graph_traits<Graph>::adjacency_iterator,
+ typename graph_traits<Graph>::adjacency_iterator>
+adjacent_vertices(
+ typename graph_traits<Graph>::vertex_descriptor u, const Graph& g)
+{
+ typedef typename graph_traits<Graph>::adjacency_iterator adjacency_iterator;
+ return std::make_pair(adjacency_iterator(g, u), adjacency_iterator(g));
+}
+
+// IncidenceGraph
+template <typename Graph>
+static inline
+typename graph_traits<Graph>::degree_size_type
+out_degree(
+ typename graph_traits<Graph>::vertex_descriptor u,
+ const Graph& g)
+{
+ typedef typename graph_traits<Graph>::adjacency_iterator Ait;
+ std::pair<Ait, Ait> adj = adjacent_vertices(u, g);
+ return std::distance(adj.first, adj.second);
+}
+
+template <typename Graph>
+static inline typename
+std::pair<typename graph_traits<Graph>::out_edge_iterator,
+ typename graph_traits<Graph>::out_edge_iterator>
+out_edges(
+ typename graph_traits<Graph>::vertex_descriptor u,
+ const Graph& g)
+{
+ typedef typename graph_traits<Graph>::out_edge_iterator Oit;
+ return std::make_pair(Oit(g, u), Oit(g));
+}
+
+// BidirectionalGraph
+template <typename Graph>
+static inline
+typename graph_traits<Graph>::degree_size_type
+in_degree(typename graph_traits<Graph>::vertex_descriptor u,
+ const Graph& g)
+{
+ return out_degree(reverseComplement(u), g);
+}
+
+template <typename Graph>
+static inline
+std::pair<typename graph_traits<Graph>::in_edge_iterator,
+ typename graph_traits<Graph>::in_edge_iterator>
+in_edges(
+ typename graph_traits<Graph>::vertex_descriptor u,
+ const Graph& g)
+{
+ typedef typename graph_traits<Graph>::in_edge_iterator Iit;
+ return std::make_pair(Iit(g, u), Iit(g));
+}
+
+// VertexListGraph
+template <typename Graph>
+static inline
+typename graph_traits<Graph>::vertices_size_type
+num_vertices(const Graph& g)
+{
+ return g.m_bloom.popcount();
+}
+
+// PropertyGraph vertex_index
+template<typename Graph>
+static inline
+DBGBloomIndexMap<Graph>
+get(vertex_index_t, const Graph& g)
+{
+ return DBGBloomIndexMap<Graph>(g);
+}
+
+template <typename Graph>
+static inline
+typename graph_traits<Graph>::vertices_size_type
+get(vertex_index_t tag, const Graph& g,
+ typename graph_traits<Graph>::vertex_descriptor u)
+{
+ return get(get(tag, g), u);
+}
+
+// PropertyGraph
+
+/** Return the reverse complement of the specified k-mer. */
+template <typename Graph>
+static inline
+typename graph_traits<Graph>::vertex_descriptor
+get(vertex_complement_t, const Graph&,
+ typename graph_traits<Graph>::vertex_descriptor u)
+{
+ return reverseComplement(u);
+}
+
+/** Return the name of the specified vertex. */
+template <typename Graph>
+static inline
+Kmer get(vertex_name_t, const Graph&,
+ typename graph_traits<Graph>::vertex_descriptor u)
+{
+ return u;
+}
+
+template <typename Graph>
+static inline
+bool
+get(vertex_removed_t, const Graph&,
+ typename graph_traits<Graph>::vertex_descriptor)
+{
+ return false;
+}
+
+template <typename Graph>
+static inline
+no_property
+get(vertex_bundle_t, const Graph&,
+ typename graph_traits<Graph>::edge_descriptor)
+{
+ return no_property();
+}
+
+template <typename Graph>
+static inline
+no_property
+get(edge_bundle_t, const Graph&,
+ typename graph_traits<Graph>::edge_descriptor)
+{
+ return no_property();
+}
+
+#endif
diff --git a/Konnector/DBGBloomAlgorithms.h b/Konnector/DBGBloomAlgorithms.h
new file mode 100644
index 0000000..863e3e1
--- /dev/null
+++ b/Konnector/DBGBloomAlgorithms.h
@@ -0,0 +1,201 @@
+/**
+ * Algorithms for a de Bruijn Graph using a Bloom filter
+ * Copyright 2014 Canada's Michael Smith Genome Science Centre
+ */
+#ifndef DBGBLOOMALGORITHMS_H
+#define DBGBLOOMALGORITHMS_H 1
+
+#include "Common/Kmer.h"
+#include "Common/KmerIterator.h"
+#include "Common/Warnings.h"
+#include "DBGBloom.h"
+#include "Common/StringUtil.h"
+#include "Common/Sequence.h"
+#include "DataLayer/FastaReader.h"
+#include "Graph/Path.h"
+#include <climits>
+#include <algorithm> // for std::max
+#define NO_MATCH UINT_MAX
+
+static inline Sequence pathToSeq(Path<Kmer> path)
+{
+ Sequence seq;
+ assert(path.size() > 0);
+ seq.append(path[0].str());
+ for (unsigned i = 1; i < path.size(); i++)
+ seq.append(1, path[i].getLastBaseChar());
+ return seq;
+}
+
+template<typename Graph>
+static inline unsigned getStartKmerPos(unsigned k, const FastaRecord& read,
+ const Graph& g, bool rc = false, bool longSearch = false)
+{
+ if (read.seq.size() < k)
+ return NO_MATCH;
+
+ // build a vector indicating whether each kmer is a match
+ // Note: the vector intentionally has an extra false element at
+ // the end, for the second loop below.
+
+ const std::string& seq = read.seq;
+ std::vector<bool> match(seq.length() - k + 2, false);
+ bool foundMatch = false;
+ for (unsigned i = 0; i < seq.length() - k + 1; i++) {
+ std::string kmerStr = seq.substr(i, k);
+ size_t pos = kmerStr.find_first_not_of("AGCTagct");
+ if (pos != std::string::npos) {
+ i += pos;
+ continue;
+ }
+ Kmer kmer(kmerStr);
+ if (rc)
+ kmer.reverseComplement();
+ if (vertex_exists(kmer, g)) {
+ foundMatch = true;
+ match[i] = true;
+ }
+ }
+ if (!foundMatch)
+ return NO_MATCH;
+
+ // find the longest string of matches
+
+ unsigned maxMatchLength = 0;
+ unsigned maxMatchPos = 0;
+ unsigned matchLength = 0;
+ unsigned matchPos = 0;
+ bool matchPosSet = false;
+ for (unsigned i = 0; i < match.size(); i++) {
+ if (match[i]) {
+ if (!matchPosSet) {
+ matchPos = i;
+ matchPosSet = true;
+ }
+ matchLength++;
+ } else {
+ // Note: match has an extra false element at the end,
+ // so this else block will get executed at least once.
+ if ((longSearch && matchLength > maxMatchLength)
+ || (!longSearch && matchLength >= maxMatchLength))
+ {
+ maxMatchPos = matchPos;
+ maxMatchLength = matchLength;
+ }
+ matchLength = 0;
+ matchPosSet = false;
+ }
+ }
+ assert(maxMatchLength > 0);
+
+ if (longSearch)
+ return maxMatchPos;
+ else
+ return maxMatchPos + maxMatchLength - 1;
+}
+
+struct BaseChangeScore {
+
+ size_t m_pos;
+ char m_base;
+ unsigned m_score;
+
+public:
+
+ BaseChangeScore() :
+ m_pos(0), m_base('N'), m_score(0){}
+
+ BaseChangeScore(size_t pos, char base, unsigned score) :
+ m_pos(pos), m_base(base), m_score(score){}
+
+};
+
+template<typename Graph>
+static inline bool correctSingleBaseError(const Graph& g, unsigned k,
+ FastaRecord& read, size_t& correctedPos, bool rc = false)
+{
+ if (read.seq.length() < k)
+ return false;
+
+ SUPPRESS_UNUSED_WARNING(correctedPos);
+
+ const std::string bases = "AGCT";
+ const size_t minScore = 3;
+ std::vector<BaseChangeScore> scores;
+
+ for (size_t i = 0; i < read.seq.length(); i++) {
+
+ size_t overlapStart = std::max((int) (i - k + 1), 0);
+ size_t overlapEnd = std::min(i + k - 1, read.seq.length() - 1);
+ assert(overlapStart < overlapEnd);
+ Sequence overlapStr = read.seq.substr(overlapStart,
+ overlapEnd - overlapStart + 1);
+ size_t changePos = i - overlapStart;
+
+ for (size_t j = 0; j < bases.size(); j++) {
+ if (read.seq[i] == bases[j])
+ continue;
+ overlapStr[changePos] = bases[j];
+ size_t score = 0;
+ for (KmerIterator it(overlapStr, k, rc); it != KmerIterator::end();
+ it++)
+ {
+ if (vertex_exists(*it, g))
+ score++;
+ }
+ if (score > minScore)
+ scores.push_back(BaseChangeScore(i, bases[j], score));
+ }
+
+ }
+
+ if (scores.size() == 0)
+ return false;
+
+ BaseChangeScore bestScore;
+ bool bestScoreSet = false;
+ for (size_t i = 0; i < scores.size(); i++) {
+ if (!bestScoreSet || scores[i].m_score > bestScore.m_score) {
+ bestScore = scores[i];
+ bestScoreSet = true;
+ }
+ }
+
+ correctedPos = bestScore.m_pos;
+ read.seq[correctedPos] = bestScore.m_base;
+
+ return true;
+}
+
+/** Uppercase only bases that are present in original reads.
+ * @return number of mis-matching bases. */
+static inline unsigned maskNew(const FastaRecord& read1,
+ const FastaRecord& read2, FastaRecord& merged, int mask = 0)
+{
+ Sequence r1 = read1.seq, r2 = reverseComplement(read2.seq);
+ if (mask) {
+ transform(r1.begin(), r1.end(), r1.begin(), ::tolower);
+ transform(r2.begin(), r2.end(), r2.begin(), ::tolower);
+ transform(merged.seq.begin(), merged.seq.end(), merged.seq.begin(),
+ ::tolower);
+ }
+ unsigned mismatches = 0;
+ for (unsigned i = 0; i < r1.size(); i++) {
+ assert(i < merged.seq.size());
+ if (r1[i] == merged.seq[i])
+ merged.seq[i] = toupper(r1[i]);
+ else
+ mismatches++;
+ }
+ for (unsigned i = 0; i < r2.size(); i++) {
+ assert(r2.size() <= merged.seq.size());
+ unsigned merged_loc = i + merged.seq.size() - r2.size();
+ if (r2[i] == merged.seq[merged_loc])
+ merged.seq[merged_loc] = toupper(r2[i]);
+ else
+ mismatches++;
+ }
+ return mismatches;
+}
+
+#endif
diff --git a/Konnector/Makefile.am b/Konnector/Makefile.am
new file mode 100644
index 0000000..86c3ef4
--- /dev/null
+++ b/Konnector/Makefile.am
@@ -0,0 +1,17 @@
+bin_PROGRAMS = konnector
+
+konnector_CPPFLAGS = -I$(top_srcdir) \
+ -I$(top_srcdir)/Common \
+ -I$(top_srcdir)/DataLayer
+
+konnector_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
+
+konnector_LDADD = \
+ $(top_builddir)/DataLayer/libdatalayer.a \
+ $(top_builddir)/Align/libalign.a \
+ $(top_builddir)/Common/libcommon.a
+
+konnector_SOURCES = konnector.cc \
+ DBGBloom.h \
+ DBGBloomAlgorithms.h \
+ konnector.h
diff --git a/Konnector/konnector.cc b/Konnector/konnector.cc
new file mode 100644
index 0000000..e09eb14
--- /dev/null
+++ b/Konnector/konnector.cc
@@ -0,0 +1,738 @@
+/**
+ * Connect pairs using a Bloom filter de Bruijn graph
+ * Copyright 2013 Shaun Jackman
+ */
+
+#include "config.h"
+
+#include "konnector.h"
+#include "Bloom/CascadingBloomFilter.h"
+#include "DBGBloom.h"
+#include "DBGBloomAlgorithms.h"
+
+#include "Align/alignGlobal.h"
+#include "Common/IOUtil.h"
+#include "Common/Options.h"
+#include "Common/StringUtil.h"
+#include "DataLayer/FastaConcat.h"
+#include "DataLayer/FastaInterleave.h"
+#include "DataLayer/Options.h"
+#include "Graph/DotIO.h"
+#include "Graph/Options.h"
+#include "Graph/GraphUtil.h"
+
+#include <cassert>
+#include <getopt.h>
+#include <iostream>
+#include <cstring>
+
+#if _OPENMP
+# include <omp.h>
+# include "Bloom/ConcurrentBloomFilter.h"
+#endif
+
+#undef USESEQAN
+
+#if USESEQAN
+#include <seqan/align.h>
+#include <seqan/sequence.h>
+#include <seqan/align_split.h>
+#endif
+
+using namespace std;
+#if USESEQAN
+using namespace seqan;
+#endif
+
+#define PROGRAM "konnector"
+
+static const char VERSION_MESSAGE[] =
+PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
+"Written by Shaun Jackman, Hamid Mohamadi, Anthony Raymond, \n"
+"Ben Vandervalk and Justin Chu.\n"
+"\n"
+"Copyright 2014 Canada's Michael Smith Genome Science Centre\n";
+
+static const char USAGE_MESSAGE[] =
+"Usage: " PROGRAM " -k <kmer_size> -o <output_prefix> [options]... <reads1> [reads2]...\n"
+"Connect the pairs READS1 and READS2 and close the gap using\n"
+"a Bloom filter de Bruijn graph.\n"
+"\n"
+" Options:\n"
+"\n"
+" -j, --threads=N use N parallel threads [1]\n"
+" -k, --kmer=N the size of a k-mer\n"
+" -b, --bloom-size=N size of bloom filter [500M]\n"
+" -B, --max-branches=N max branches in de Bruijn graph traversal;\n"
+" use 'nolimit' for no limit [350]\n"
+" -d, --dot-file=FILE write graph traversals to a DOT file\n"
+" -e, --fix-errors find and fix single-base errors when reads\n"
+" have no kmers in bloom filter [disabled]\n"
+" -f, --min-frag=N min fragment size in base pairs [0]\n"
+" -F, --max-frag=N max fragment size in base pairs [1000]\n"
+" -i, --input-bloom=FILE load bloom filter from FILE\n"
+" -I, --interleaved input reads files are interleaved\n"
+" --mask mask new and changed bases as lower case\n"
+" --no-mask do not mask bases [default]\n"
+" --chastity discard unchaste reads [default]\n"
+" --no-chastity do not discard unchaste reads\n"
+" --trim-masked trim masked bases from the ends of reads\n"
+" --no-trim-masked do not trim masked bases from the ends\n"
+" of reads [default]\n"
+" -l, --long-search start path search as close as possible\n"
+" to the beginnings of reads. Takes more time\n"
+" but improves results when bloom filter false\n"
+" positive rate is high [disabled]\n"
+" -m, --read-mismatches=N max mismatches between paths and reads; use\n"
+" 'nolimit' for no limit [nolimit]\n"
+" -M, --max-mismatches=N max mismatches between all alternate paths;\n"
+" use 'nolimit' for no limit [2]\n"
+" -n --no-limits disable all limits; equivalent to\n"
+" '-B nolimit -m nolimit -M nolimit -P nolimit'\n"
+" -o, --output-prefix=FILE prefix of output FASTA files [required]\n"
+" -P, --max-paths=N merge at most N alternate paths; use 'nolimit'\n"
+" for no limit [2]\n"
+" -q, --trim-quality=N trim bases from the ends of reads whose\n"
+" quality is less than the threshold\n"
+" --standard-quality zero quality is `!' (33)\n"
+" default for FASTQ and SAM files\n"
+" --illumina-quality zero quality is `@' (64)\n"
+" default for qseq and export files\n"
+" -r, --read-name=STR only process reads with names that contain STR\n"
+" -s, --search-mem=N mem limit for graph searches; multiply by the\n"
+" number of threads (-j) to get the total mem used\n"
+" for graph traversal [500M]\n"
+" -t, --trace-file=FILE write graph search stats to FILE\n"
+" -v, --verbose display verbose output\n"
+" --help display this help and exit\n"
+" --version output version information and exit\n"
+"\n"
+"Report bugs to <" PACKAGE_BUGREPORT ">.\n";
+
+const unsigned g_progressStep = 1000;
+
+namespace opt {
+
+ /** The number of parallel threads. */
+ static unsigned threads = 1;
+
+ /** The size of the bloom filter in bytes. */
+ size_t bloomSize = 500 * 1024 * 1024;
+
+ /** Input read files are interleaved? */
+ bool interleaved = false;
+
+ /**
+ * Choose start/goal kmers for path search as close as
+ * possible to beginning (5' end) of reads. Improves
+ * results when bloom filter FPR is high.
+ */
+ bool longSearch = false;
+
+ /** Max active branches during de Bruijn graph traversal */
+ unsigned maxBranches = 350;
+
+ /** multi-graph DOT file containing graph traversals */
+ static string dotPath;
+
+ /**
+ * Find and fix single base errors when a read has no
+ * kmers in the bloom filter.
+ */
+ bool fixErrors = false;
+
+ /** The size of a k-mer. */
+ unsigned k;
+
+ /** The minimum fragment size */
+ unsigned minFrag = 0;
+
+ /** The maximum fragment size */
+ unsigned maxFrag = 1000;
+
+ /** Bloom filter input file */
+ static string inputBloomPath;
+
+ /** Max paths between read 1 and read 2 */
+ unsigned maxPaths = 2;
+
+ /** Prefix for output files */
+ static string outputPrefix;
+
+ /** Max mismatches allowed when building consensus seqs */
+ unsigned maxMismatches = 2;
+
+ /** Only process reads that contain this substring. */
+ static string readName;
+
+ /** Max mem used per thread during graph traversal */
+ static size_t searchMem = 500 * 1024 * 1024;
+
+ /** Output file for graph search stats */
+ static string tracefilePath;
+
+ /** Mask bases not in reads */
+ static int mask = 0;
+
+ /** Max mismatches between consensus and original reads */
+ static unsigned maxReadMismatches = NO_LIMIT;
+
+}
+
+/** Counters */
+static struct {
+ size_t noStartOrGoalKmer;
+ size_t noPath;
+ size_t uniquePath;
+ size_t multiplePaths;
+ size_t tooManyPaths;
+ size_t tooManyBranches;
+ size_t tooManyMismatches;
+ size_t tooManyReadMismatches;
+ size_t containsCycle;
+ size_t exceededMemLimit;
+ size_t traversalMemExceeded;
+ size_t readPairsProcessed;
+ size_t readPairsMerged;
+ size_t skipped;
+} g_count;
+
+static const char shortopts[] = "b:B:d:ef:F:i:Ij:k:lm:M:no:P:q:r:s:t:v";
+
+enum { OPT_HELP = 1, OPT_VERSION };
+
+static const struct option longopts[] = {
+ { "bloom-size", required_argument, NULL, 'b' },
+ { "max-branches", required_argument, NULL, 'B' },
+ { "dot-file", required_argument, NULL, 'd' },
+ { "fix-errors", no_argument, NULL, 'e' },
+ { "min-frag", required_argument, NULL, 'f' },
+ { "max-frag", required_argument, NULL, 'F' },
+ { "input-bloom", required_argument, NULL, 'i' },
+ { "interleaved", no_argument, NULL, 'I' },
+ { "long-search", no_argument, NULL, 'l' },
+ { "threads", required_argument, NULL, 'j' },
+ { "kmer", required_argument, NULL, 'k' },
+ { "chastity", no_argument, &opt::chastityFilter, 1 },
+ { "no-chastity", no_argument, &opt::chastityFilter, 0 },
+ { "mask", no_argument, &opt::mask, 1 },
+ { "no-mask", no_argument, &opt::mask, 0 },
+ { "no-limits", no_argument, NULL, 'n' },
+ { "trim-masked", no_argument, &opt::trimMasked, 1 },
+ { "no-trim-masked", no_argument, &opt::trimMasked, 0 },
+ { "output-prefix", required_argument, NULL, 'o' },
+ { "read-mismatches", required_argument, NULL, 'm' },
+ { "max-mismatches", required_argument, NULL, 'M' },
+ { "max-paths", required_argument, NULL, 'P' },
+ { "trim-quality", required_argument, NULL, 'q' },
+ { "standard-quality", no_argument, &opt::qualityOffset, 33 },
+ { "illumina-quality", no_argument, &opt::qualityOffset, 64 },
+ { "read-name", required_argument, NULL, 'r' },
+ { "search-mem", required_argument, NULL, 's' },
+ { "trace-file", required_argument, NULL, 't' },
+ { "verbose", no_argument, NULL, 'v' },
+ { "help", no_argument, NULL, OPT_HELP },
+ { "version", no_argument, NULL, OPT_VERSION },
+ { NULL, 0, NULL, 0 }
+};
+
+#if USESEQAN
+const string r1 =
+"AGAATCAACCAACCGTTCAATGATATAATCAAGAGCGATATTGTAATCTTTGTTTCT";
+const string r2 =
+"CGACGTCCACCAATTCGTCCCTGTGCACGAGCAGTTTCCAGTCCAGCTTTTGTTCGT";
+const string ins =
+"AGAATCAACCAACCGTTCAATGATATAATCAAGAGCGATATTGTAATCTTTGTTTCTGTCACCCGGCCCCCACGACTCAAGGATTAGACCATAAACACCATCCTCTTCACCTATCGAACACTCAGCTTTCAGTTCAATTCCATTATTATCAAAAACATGCATAATATTAATCTTTAATCAATTTTTCACGACAATACTACTTTTATTGATAAAATTGCAACAAGTTGCTGTTGTTTTACTTTCTTTTGTACACAAAGTGTCTTTAACTTTATTTATCCCCTGCAGGAAACCTCTTATACAAAGTTGACACACCAACATCATAGATAATCGCCACCTTCTGGCGAGGAGTTCCTGCTGCAATTAATCGTCCAGCTTGTGCCCATTGTTCTGGTGTAAGTTTGGGACGACGTCCACCAATTCGTCCCTGTGCACGAGCAGTTTCCAGTCCAGCTTTTGTTCGT";
+
+static void seqanTests()
+{
+ typedef String<Dna> DS;
+ typedef Align<DS> Alignment;
+
+ //DS seq1 = "TTGT";
+ //DS seq2 = "TTAGT";
+ DS ref = ins;
+ DS seq1 = r1;
+ DS seq2 = r2;
+
+ Alignment align1;
+ resize(rows(align1), 2);
+ assignSource(row(align1, 0), ref);
+ assignSource(row(align1, 1), seq1);
+ Alignment align2;
+ resize(rows(align2), 2);
+ assignSource(row(align2, 0), ref);
+ assignSource(row(align2, 1), seq2);
+
+ Score<int> scoring(2, -2, -50, -100);
+
+ cout << splitAlignment(align1, align2, scoring) << endl;
+ cout << align1 << endl;
+ cout << align2 << endl;
+
+ cout << localAlignment(align1, scoring) << endl;
+ cout << align1 << endl;
+
+ cout << localAlignment(align2, scoring) << endl;
+ cout << align2 << endl;
+}
+#endif
+
+/** Connect a read pair. */
+template <typename Graph>
+static void connectPair(const Graph& g,
+ const FastqRecord& read1,
+ const FastqRecord& read2,
+ const ConnectPairsParams& params,
+ ofstream& mergedStream,
+ ofstream& read1Stream,
+ ofstream& read2Stream,
+ ofstream& traceStream)
+{
+ bool skip = false;
+
+ if (!opt::readName.empty() &&
+ read1.id.find(opt::readName) == string::npos) {
+#pragma omp atomic
+ ++g_count.skipped;
+ skip = true;
+ }
+
+ if (!skip) {
+
+ ConnectPairsResult result =
+ connectPairs(opt::k, read1, read2, g, params);
+
+ vector<FastaRecord>& paths = result.mergedSeqs;
+
+ if (!opt::tracefilePath.empty())
+#pragma omp critical(tracefile)
+ {
+ traceStream << result;
+ assert_good(traceStream, opt::tracefilePath);
+ }
+
+ switch (result.pathResult) {
+
+ case NO_PATH:
+ assert(paths.empty());
+ if (result.foundStartKmer && result.foundGoalKmer)
+#pragma omp atomic
+ ++g_count.noPath;
+ else {
+#pragma omp atomic
+ ++g_count.noStartOrGoalKmer;
+ }
+ break;
+
+ case FOUND_PATH:
+ assert(!paths.empty());
+ if (result.pathMismatches > params.maxPathMismatches ||
+ result.readMismatches > params.maxReadMismatches) {
+ if (result.pathMismatches > params.maxPathMismatches)
+#pragma omp atomic
+ ++g_count.tooManyMismatches;
+ else
+ ++g_count.tooManyReadMismatches;
+#pragma omp critical(read1Stream)
+ read1Stream << read1;
+#pragma omp critical(read2Stream)
+ read2Stream << read2;
+ }
+ else if (paths.size() > 1) {
+#pragma omp atomic
+ ++g_count.multiplePaths;
+#pragma omp critical(mergedStream)
+ mergedStream << result.consensusSeq;
+ }
+ else {
+#pragma omp atomic
+ ++g_count.uniquePath;
+#pragma omp critical(mergedStream)
+ mergedStream << paths.front();
+ }
+ break;
+
+ case TOO_MANY_PATHS:
+#pragma omp atomic
+ ++g_count.tooManyPaths;
+ break;
+
+ case TOO_MANY_BRANCHES:
+#pragma omp atomic
+ ++g_count.tooManyBranches;
+ break;
+
+ case PATH_CONTAINS_CYCLE:
+#pragma omp atomic
+ ++g_count.containsCycle;
+ break;
+
+ case EXCEEDED_MEM_LIMIT:
+#pragma omp atomic
+ ++g_count.exceededMemLimit;
+ break;
+ }
+
+ if (result.pathResult != FOUND_PATH) {
+#pragma omp critical(read1Stream)
+ read1Stream << read1;
+#pragma omp critical(read2Stream)
+ read2Stream << read2;
+ }
+ }
+
+#pragma omp critical(cerr)
+ {
+ g_count.readPairsProcessed++;
+ if (opt::verbose >= 2)
+ {
+ if(g_count.readPairsProcessed % g_progressStep == 0) {
+ cerr << "Merged " << g_count.uniquePath + g_count.multiplePaths << " of "
+ << g_count.readPairsProcessed << " read pairs "
+ << "(no start/goal kmer: " << g_count.noStartOrGoalKmer << ", "
+ << "no path: " << g_count.noPath << ", "
+ << "too many paths: " << g_count.tooManyPaths << ", "
+ << "too many branches: " << g_count.tooManyBranches << ", "
+ << "too many path/path mismatches: " << g_count.tooManyMismatches << ", "
+ << "too many path/read mismatches: " << g_count.tooManyReadMismatches << ", "
+ << "contains cycle: " << g_count.containsCycle << ", "
+ << "exceeded mem limit: " << g_count.exceededMemLimit << ", "
+ << "skipped: " << g_count.skipped
+ << ")\n";
+ }
+ }
+ }
+}
+
+/** Connect read pairs. */
+template <typename Graph, typename FastaStream>
+static void connectPairs(const Graph& g,
+ FastaStream& in,
+ const ConnectPairsParams& params,
+ ofstream& mergedStream,
+ ofstream& read1Stream,
+ ofstream& read2Stream,
+ ofstream& traceStream)
+{
+#pragma omp parallel
+ for (FastqRecord a, b;;) {
+ bool good;
+#pragma omp critical(in)
+ good = in >> a >> b;
+ if (good)
+ connectPair(g, a, b, params, mergedStream, read1Stream,
+ read2Stream, traceStream);
+ else
+ break;
+ }
+}
+
+/**
+ * Set the value for a commandline option, using "nolimit"
+ * to represent NO_LIMIT.
+ */
+static inline void setMaxOption(unsigned& arg, istream& in)
+{
+ string str;
+ getline(in, str);
+ if (in.good() && str == "nolimit") {
+ arg = NO_LIMIT;
+ } else {
+ istringstream ss(str);
+ ss >> arg;
+ // copy state bits (fail, bad, eof) to
+ // original stream
+ in.clear(ss.rdstate());
+ }
+}
+
+/**
+ * Connect pairs using a Bloom filter de Bruijn graph
+ */
+int main(int argc, char** argv)
+{
+ bool die = false;
+
+ for (int c; (c = getopt_long(argc, argv,
+ shortopts, longopts, NULL)) != -1;) {
+ istringstream arg(optarg != NULL ? optarg : "");
+ switch (c) {
+ case '?':
+ die = true; break;
+ case 'b':
+ opt::bloomSize = SIToBytes(arg); break;
+ case 'B':
+ setMaxOption(opt::maxBranches, arg); break;
+ case 'd':
+ arg >> opt::dotPath; break;
+ case 'e':
+ opt::fixErrors = true; break;
+ case 'f':
+ arg >> opt::minFrag; break;
+ case 'F':
+ arg >> opt::maxFrag; break;
+ case 'i':
+ arg >> opt::inputBloomPath; break;
+ case 'I':
+ opt::interleaved = true; break;
+ case 'j':
+ arg >> opt::threads; break;
+ case 'k':
+ arg >> opt::k; break;
+ case 'l':
+ opt::longSearch = true; break;
+ case 'm':
+ setMaxOption(opt::maxReadMismatches, arg); break;
+ case 'n':
+ opt::maxBranches = NO_LIMIT;
+ opt::maxReadMismatches = NO_LIMIT;
+ opt::maxMismatches = NO_LIMIT;
+ opt::maxPaths = NO_LIMIT;
+ break;
+ case 'M':
+ setMaxOption(opt::maxMismatches, arg); break;
+ case 'o':
+ arg >> opt::outputPrefix; break;
+ case 'P':
+ setMaxOption(opt::maxPaths, arg); break;
+ case 'q':
+ arg >> opt::qualityThreshold; break;
+ case 'r':
+ arg >> opt::readName; break;
+ case 's':
+ opt::searchMem = SIToBytes(arg); break;
+ case 't':
+ arg >> opt::tracefilePath; break;
+ case 'v':
+ opt::verbose++; break;
+ case OPT_HELP:
+ cout << USAGE_MESSAGE;
+ exit(EXIT_SUCCESS);
+ case OPT_VERSION:
+ cout << VERSION_MESSAGE;
+ exit(EXIT_SUCCESS);
+ }
+ if (optarg != NULL && (!arg.eof() || arg.fail())) {
+ cerr << PROGRAM ": invalid option: `-"
+ << (char)c << optarg << "'\n";
+ exit(EXIT_FAILURE);
+ }
+ }
+
+ if (opt::k == 0) {
+ cerr << PROGRAM ": missing mandatory option `-k'\n";
+ die = true;
+ }
+
+ if (opt::outputPrefix.empty()) {
+ cerr << PROGRAM ": missing mandatory option `-o'\n";
+ die = true;
+ }
+
+ if (argc - optind < 1) {
+ cerr << PROGRAM ": missing input file arguments\n";
+ die = true;
+ }
+
+ if (die) {
+ cerr << "Try `" << PROGRAM
+ << " --help' for more information.\n";
+ exit(EXIT_FAILURE);
+ }
+
+#if _OPENMP
+ if (opt::threads > 0)
+ omp_set_num_threads(opt::threads);
+#endif
+
+ Kmer::setLength(opt::k);
+
+#if USESEQAN
+ seqanTests();
+#endif
+
+ assert(opt::bloomSize > 0);
+
+ BloomFilter bloom;
+
+ if (!opt::inputBloomPath.empty()) {
+
+ if (opt::verbose)
+ std::cerr << "Loading bloom filter from `"
+ << opt::inputBloomPath << "'...\n";
+
+ const char* inputPath = opt::inputBloomPath.c_str();
+ ifstream inputBloom(inputPath, ios_base::in | ios_base::binary);
+ assert_good(inputBloom, inputPath);
+ inputBloom >> bloom;
+ assert_good(inputBloom, inputPath);
+ inputBloom.close();
+
+ } else {
+
+ // Specify bloom filter size in bits. Divide by two
+ // because counting bloom filter requires twice as
+ // much space.
+ size_t bits = opt::bloomSize * 8 / 2;
+ CascadingBloomFilter tempBloom(bits);
+#ifdef _OPENMP
+ ConcurrentBloomFilter<CascadingBloomFilter> cbf(tempBloom, 1000);
+ for (int i = optind; i < argc; i++)
+ Bloom::loadFile(cbf, opt::k, string(argv[i]), opt::verbose);
+#else
+ for (int i = optind; i < argc; i++)
+ Bloom::loadFile(tempBloom, opt::k, string(argv[i]), opt::verbose);
+#endif
+ bloom = tempBloom.getBloomFilter(tempBloom.MAX_COUNT-1);
+ }
+
+ if (opt::verbose)
+ cerr << "Bloom filter FPR: " << setprecision(3)
+ << 100 * bloom.FPR() << "%\n";
+
+ ofstream dotStream;
+ if (!opt::dotPath.empty()) {
+ if (opt::verbose)
+ cerr << "Writing graph traversals to "
+ "dot file `" << opt::dotPath << "'\n";
+ dotStream.open(opt::dotPath.c_str());
+ assert_good(dotStream, opt::dotPath);
+ }
+
+ ofstream traceStream;
+ if (!opt::tracefilePath.empty()) {
+ if (opt::verbose)
+ cerr << "Writing graph search stats to `"
+ << opt::tracefilePath << "'\n";
+ traceStream.open(opt::tracefilePath.c_str());
+ assert(traceStream.is_open());
+ ConnectPairsResult::printHeaders(traceStream);
+ assert_good(traceStream, opt::tracefilePath);
+ }
+
+ DBGBloom<BloomFilter> g(bloom);
+
+ string mergedOutputPath(opt::outputPrefix);
+ mergedOutputPath.append("_merged.fa");
+ ofstream mergedStream(mergedOutputPath.c_str());
+ assert_good(mergedStream, mergedOutputPath);
+
+ string read1OutputPath(opt::outputPrefix);
+ read1OutputPath.append("_reads_1.fq");
+ ofstream read1Stream(read1OutputPath.c_str());
+ assert_good(read1Stream, read1OutputPath);
+
+ string read2OutputPath(opt::outputPrefix);
+ read2OutputPath.append("_reads_2.fq");
+ ofstream read2Stream(read2OutputPath.c_str());
+ assert_good(read2Stream, read2OutputPath);
+
+ if (opt::verbose > 0)
+ cerr << "Connecting read pairs\n";
+
+ ConnectPairsParams params;
+
+ params.minMergedSeqLen = opt::minFrag;
+ params.maxMergedSeqLen = opt::maxFrag;
+ params.maxPaths = opt::maxPaths;
+ params.maxBranches = opt::maxBranches;
+ params.maxPathMismatches = opt::maxMismatches;
+ params.maxReadMismatches = opt::maxReadMismatches;
+ params.fixErrors = opt::fixErrors;
+ params.longSearch = opt::longSearch;
+ params.maskBases = opt::mask;
+ params.memLimit = opt::searchMem;
+ params.dotPath = opt::dotPath;
+ params.dotStream = opt::dotPath.empty() ? NULL : &dotStream;
+
+ if (opt::interleaved) {
+ FastaConcat in(argv + optind, argv + argc,
+ FastaReader::FOLD_CASE);
+ connectPairs(g, in, params, mergedStream, read1Stream,
+ read2Stream, traceStream);
+ assert(in.eof());
+ } else {
+ FastaInterleave in(argv + optind, argv + argc,
+ FastaReader::FOLD_CASE);
+ connectPairs(g, in, params, mergedStream, read1Stream,
+ read2Stream, traceStream);
+ assert(in.eof());
+ }
+
+ if (opt::verbose > 0) {
+ cerr <<
+ "Processed " << g_count.readPairsProcessed << " read pairs\n"
+ "Merged (Unique path + Multiple paths): "
+ << g_count.uniquePath + g_count.multiplePaths
+ << " (" << setprecision(3) << (float)100
+ * (g_count.uniquePath + g_count.multiplePaths) /
+ g_count.readPairsProcessed
+ << "%)\n"
+ "No start/goal kmer: " << g_count.noStartOrGoalKmer
+ << " (" << setprecision(3) << (float)100
+ * g_count.noStartOrGoalKmer / g_count.readPairsProcessed
+ << "%)\n"
+ "No path: " << g_count.noPath
+ << " (" << setprecision(3) << (float)100
+ * g_count.noPath / g_count.readPairsProcessed
+ << "%)\n"
+ "Unique path: " << g_count.uniquePath
+ << " (" << setprecision(3) << (float)100
+ * g_count.uniquePath / g_count.readPairsProcessed
+ << "%)\n"
+ "Multiple paths: " << g_count.multiplePaths
+ << " (" << setprecision(3) << (float)100
+ * g_count.multiplePaths / g_count.readPairsProcessed
+ << "%)\n"
+ "Too many paths: " << g_count.tooManyPaths
+ << " (" << setprecision(3) << (float)100
+ * g_count.tooManyPaths / g_count.readPairsProcessed
+ << "%)\n"
+ "Too many branches: " << g_count.tooManyBranches
+ << " (" << setprecision(3) << (float)100
+ * g_count.tooManyBranches / g_count.readPairsProcessed
+ << "%)\n"
+ "Too many path/path mismatches: " << g_count.tooManyMismatches
+ << " (" << setprecision(3) << (float)100
+ * g_count.tooManyMismatches / g_count.readPairsProcessed
+ << "%)\n"
+ "Too many path/read mismatches: " << g_count.tooManyReadMismatches
+ << " (" << setprecision(3) << (float)100
+ * g_count.tooManyReadMismatches / g_count.readPairsProcessed
+ << "%)\n"
+ "Contains cycle: " << g_count.containsCycle
+ << " (" << setprecision(3) << (float)100
+ * g_count.containsCycle / g_count.readPairsProcessed
+ << "%)\n"
+ "Exceeded mem limit: " << g_count.exceededMemLimit
+ << " (" << setprecision(3) << (float)100
+ * g_count.exceededMemLimit / g_count.readPairsProcessed
+ << "%)\n"
+ "Skipped: " << g_count.skipped
+ << " (" << setprecision(3) << (float)100
+ * g_count.skipped / g_count.readPairsProcessed
+ << "%)\n"
+ "Bloom filter FPR: " << setprecision(3) << 100 * bloom.FPR()
+ << "%\n";
+ }
+
+ assert_good(mergedStream, mergedOutputPath.c_str());
+ mergedStream.close();
+ assert_good(read1Stream, read1OutputPath.c_str());
+ read1Stream.close();
+ assert_good(read2Stream, read2OutputPath.c_str());
+ read2Stream.close();
+
+ if (!opt::dotPath.empty()) {
+ assert_good(dotStream, opt::dotPath);
+ dotStream.close();
+ }
+
+ if (!opt::tracefilePath.empty()) {
+ assert_good(traceStream, opt::tracefilePath);
+ traceStream.close();
+ }
+
+ return 0;
+}
diff --git a/Konnector/konnector.h b/Konnector/konnector.h
new file mode 100644
index 0000000..7517a63
--- /dev/null
+++ b/Konnector/konnector.h
@@ -0,0 +1,341 @@
+#ifndef CONNECTPAIRS_H
+#define CONNECTPAIRS_H
+
+#include "DBGBloomAlgorithms.h"
+#include "Bloom/CascadingBloomFilter.h"
+#include "DataLayer/FastaInterleave.h"
+#include "Graph/BidirectionalBFS.h"
+#include "Graph/ConstrainedBidiBFSVisitor.h"
+#include "Align/alignGlobal.h"
+#include "Graph/DefaultColorMap.h"
+#include "Graph/DotIO.h"
+#include <algorithm>
+#include <boost/tuple/tuple.hpp>
+#include <limits>
+#include <fstream>
+
+#if _OPENMP
+# include <omp.h>
+#endif
+
+struct ConnectPairsResult
+{
+ std::string readNamePrefix;
+ PathSearchResult pathResult;
+ std::vector<FastaRecord> mergedSeqs;
+ FastaRecord consensusSeq;
+ bool foundStartKmer;
+ bool foundGoalKmer;
+ unsigned startKmerPos;
+ unsigned goalKmerPos;
+ unsigned long long numNodesVisited;
+ unsigned maxActiveBranches;
+ unsigned maxDepthVisitedForward;
+ unsigned maxDepthVisitedReverse;
+ unsigned pathMismatches;
+ unsigned readMismatches;
+ size_t memUsage;
+
+ ConnectPairsResult() :
+ pathResult(NO_PATH),
+ foundStartKmer(false),
+ foundGoalKmer(false),
+ startKmerPos(NO_MATCH),
+ goalKmerPos(NO_MATCH),
+ numNodesVisited(0),
+ maxActiveBranches(0),
+ maxDepthVisitedForward(0),
+ maxDepthVisitedReverse(0),
+ pathMismatches(0),
+ readMismatches(0),
+ memUsage(0)
+ {}
+
+ static std::ostream& printHeaders(std::ostream& out)
+ {
+ out << "read_id" << "\t"
+ << "search_result" << "\t"
+ << "num_paths" << "\t"
+ << "path_lengths" << "\t"
+ << "start_kmer_pos" << "\t"
+ << "end_kmer_pos" << "\t"
+ << "nodes_visited" << "\t"
+ << "max_breadth" << "\t"
+ << "max_depth_forward" << "\t"
+ << "max_depth_reverse" << "\t"
+ << "path_mismatches" << "\t"
+ << "read_mismatches" << "\t"
+ << "mem_usage" << "\n";
+ return out;
+ }
+
+ friend std::ostream& operator <<(std::ostream& out,
+ const ConnectPairsResult& o)
+ {
+ out << o.readNamePrefix << "\t"
+ << PathSearchResultLabel[o.pathResult] << "\t"
+ << o.mergedSeqs.size() << "\t";
+ if (o.mergedSeqs.size() == 0) {
+ out << "NA" << "\t";
+ } else {
+ for (unsigned i = 0; i < o.mergedSeqs.size(); i++) {
+ out << o.mergedSeqs[i].seq.size();
+ if (i < o.mergedSeqs.size() - 1)
+ out << ",";
+ }
+ out << "\t";
+ }
+ out << o.startKmerPos << "\t"
+ << o.goalKmerPos << "\t"
+ << o.numNodesVisited << "\t"
+ << o.maxActiveBranches << "\t"
+ << o.maxDepthVisitedForward << "\t"
+ << o.maxDepthVisitedReverse << "\t"
+ << o.pathMismatches << "\t"
+ << o.readMismatches << "\t"
+ << o.memUsage << "\n";
+
+ return out;
+ }
+};
+
+struct ConnectPairsParams {
+
+ unsigned minMergedSeqLen;
+ unsigned maxMergedSeqLen;
+ unsigned maxPaths;
+ unsigned maxBranches;
+ unsigned maxPathMismatches;
+ unsigned maxReadMismatches;
+ bool fixErrors;
+ bool longSearch;
+ bool maskBases;
+ size_t memLimit;
+ std::string dotPath;
+ std::ofstream* dotStream;
+
+ ConnectPairsParams() :
+ minMergedSeqLen(0),
+ maxMergedSeqLen(1000),
+ maxPaths(NO_LIMIT),
+ maxBranches(NO_LIMIT),
+ maxPathMismatches(NO_LIMIT),
+ maxReadMismatches(NO_LIMIT),
+ fixErrors(false),
+ longSearch(false),
+ maskBases(false),
+ memLimit(std::numeric_limits<std::size_t>::max()),
+ dotStream(NULL)
+ {}
+
+};
+
+static inline void colorPath(HashGraph<Kmer>& graph, unsigned k,
+ const Sequence& seq, const std::string& color,
+ bool addEdges = true)
+{
+ KmerIterator it(seq, k);
+ if (it != it.end()) {
+ graph.set_vertex_color(*it, color);
+ Kmer prev = *it;
+ ++it;
+ for(; it != it.end(); prev=*it, ++it) {
+ if (addEdges)
+ add_edge(prev, *it, graph);
+ graph.set_vertex_color(*it, color);
+ }
+ }
+}
+
+/** Write a color-coded traversal graph to a DOT file. */
+static inline void writeDot(
+ HashGraph<Kmer>& traversalGraph,
+ unsigned k,
+ const FastaRecord& read1,
+ const FastaRecord& read2,
+ const ConnectPairsParams& params,
+ const ConnectPairsResult& result)
+{
+ const std::string pathColor("darkgreen");
+ const std::string solutionColor("green");
+ const std::string read1Color("blue");
+ const std::string read2Color("red");
+
+ // color kmers for the paths / consensus
+
+ const std::vector<FastaRecord>& paths = result.mergedSeqs;
+
+ if (paths.size() == 1) {
+ colorPath(traversalGraph, k, paths.front(), solutionColor);
+ } else if (paths.size() > 1) {
+ for (unsigned i = 0; i < paths.size(); i++)
+ colorPath(traversalGraph, k, paths.at(i), pathColor);
+ colorPath(traversalGraph, k, result.consensusSeq, solutionColor);
+ }
+
+ // color the reads
+
+ colorPath(traversalGraph, k, read1.seq, read1Color);
+ colorPath(traversalGraph, k, reverseComplement(read2.seq),
+ read2Color);
+
+ // write out the dot file
+
+ // GraphViz utils don't like colons in graph names
+ std::string graphName = result.readNamePrefix;
+ std::replace(graphName.begin(), graphName.end(), ':', '_');
+
+ write_dot(*params.dotStream, traversalGraph, graphName);
+ assert_good(*params.dotStream, params.dotPath);
+};
+
+template <typename Graph>
+static inline ConnectPairsResult connectPairs(
+ unsigned k,
+ const FastaRecord& read1,
+ const FastaRecord& read2,
+ const Graph& g,
+ const ConnectPairsParams& params)
+{
+ ConnectPairsResult result;
+
+ if (!isReadNamePair(read1.id, read2.id)) {
+#pragma omp critical(cerr)
+ std::cerr << "error: name mismatch between paired end reads.\n"
+ << "Read 1: " << read1.id << "\n"
+ << "Read 2: " << read2.id << "\n";
+ exit(EXIT_FAILURE);
+ }
+
+ if (read1.seq.length() < k || read2.seq.length() < k) {
+ result.pathResult = NO_PATH;
+ return result;
+ }
+
+ unsigned startKmerPos = getStartKmerPos(k, read1, g,
+ false, params.longSearch);
+
+ unsigned goalKmerPos = getStartKmerPos(k, read2, g,
+ true, params.longSearch);
+
+ const FastaRecord* pRead1 = &read1;
+ const FastaRecord* pRead2 = &read2;
+ FastaRecord correctedRead1;
+ FastaRecord correctedRead2;
+ size_t unused;
+
+ if (startKmerPos == NO_MATCH && params.fixErrors) {
+ correctedRead1 = read1;
+ if (correctSingleBaseError(g, k, correctedRead1, unused)) {
+ startKmerPos = getStartKmerPos(k, correctedRead1, g,
+ false, params.longSearch);
+ assert(startKmerPos != NO_MATCH);
+ pRead1 = &correctedRead1;
+ }
+ }
+
+ if (goalKmerPos == NO_MATCH && params.fixErrors) {
+ correctedRead2 = read2;
+ if (correctSingleBaseError(g, k, correctedRead2, unused)) {
+ goalKmerPos = getStartKmerPos(k, correctedRead2, g,
+ true, params.longSearch);
+ assert(goalKmerPos != NO_MATCH);
+ pRead2 = &correctedRead2;
+ }
+ }
+
+ if (startKmerPos == NO_MATCH || goalKmerPos == NO_MATCH) {
+ result.pathResult = NO_PATH;
+ return result;
+ } else {
+ result.startKmerPos = startKmerPos;
+ result.foundStartKmer = true;
+ result.goalKmerPos = goalKmerPos;
+ result.foundGoalKmer = true;
+ }
+
+ Kmer startKmer(pRead1->seq.substr(startKmerPos, k));
+ Kmer goalKmer(pRead2->seq.substr(goalKmerPos, k));
+ goalKmer.reverseComplement();
+
+ unsigned maxPathLen = params.maxMergedSeqLen - k + 1 - startKmerPos - goalKmerPos;
+ assert(maxPathLen <= params.maxMergedSeqLen - k + 1);
+
+ unsigned minPathLen = (unsigned)std::max((int)0,
+ (int)(params.minMergedSeqLen - k + 1 - startKmerPos - goalKmerPos));
+ // do not allow merged seqs that are shorter than the reads
+ minPathLen = std::max(minPathLen, (unsigned)std::max(
+ pRead1->seq.length() - k + 1 - startKmerPos,
+ pRead2->seq.length() - k + 1 - goalKmerPos));
+
+ ConstrainedBidiBFSVisitor<Graph> visitor(g, startKmer, goalKmer,
+ params.maxPaths, minPathLen, maxPathLen, params.maxBranches,
+ params.memLimit);
+ bidirectionalBFS(g, startKmer, goalKmer, visitor);
+
+ std::vector< Path<Kmer> > paths;
+ result.readNamePrefix = pRead1->id.substr(0, pRead1->id.find_last_of("/"));
+ result.pathResult = visitor.pathsToGoal(paths);
+ result.numNodesVisited = visitor.getNumNodesVisited();
+ result.maxActiveBranches = visitor.getMaxActiveBranches();
+ result.maxDepthVisitedForward = visitor.getMaxDepthVisited(FORWARD);
+ result.maxDepthVisitedReverse = visitor.getMaxDepthVisited(REVERSE);
+ result.memUsage = visitor.approxMemUsage();
+
+ // write traversal graph to dot file (-d option)
+
+ if (result.pathResult == FOUND_PATH) {
+
+ // build sequences for connecting paths
+
+ std::string seqPrefix = pRead1->seq.substr(0, startKmerPos);
+ std::string seqSuffix = reverseComplement(pRead2->seq.substr(0, goalKmerPos));
+ for (unsigned i = 0; i < paths.size(); i++) {
+ FastaRecord mergedSeq;
+ std::stringstream index;
+ index << i;
+ assert(index);
+ mergedSeq.id = result.readNamePrefix + "_" + index.str();
+ mergedSeq.seq = seqPrefix + pathToSeq(paths[i]) + seqSuffix;
+ result.mergedSeqs.push_back(mergedSeq);
+ }
+
+ // calc consensus seq and mismatch stats
+
+ if (paths.size() == 1) {
+
+ result.readMismatches =
+ maskNew(read1, read2, result.mergedSeqs.front(), params.maskBases);
+
+ } else {
+
+ NWAlignment aln;
+ unsigned matches, size;
+ boost::tie(matches, size) = align(result.mergedSeqs, aln);
+ assert(size >= matches);
+ result.pathMismatches = size - matches;
+
+ result.consensusSeq.id = result.readNamePrefix;
+ result.consensusSeq.seq = aln.match_align;
+ result.readMismatches =
+ maskNew(read1, read2, result.consensusSeq, params.maskBases);
+
+ }
+
+ }
+
+ if (!params.dotPath.empty()) {
+ HashGraph<Kmer> traversalGraph;
+ visitor.getTraversalGraph(traversalGraph);
+ writeDot(traversalGraph, k, read1, read2, params, result);
+ }
+
+#if 0
+# pragma omp critical(cerr)
+ std::cerr << result;
+#endif
+
+ return result;
+}
+
+#endif
diff --git a/LICENSE b/LICENSE
index cb557ef..f13b0d6 100644
--- a/LICENSE
+++ b/LICENSE
@@ -1,230 +1,644 @@
ABySS
-Copyright 2013 Genome Sciences Centre
-
-BC CANCER AGENCY SOFTWARE LICENSE AGREEMENT (ACADEMIC USE)
-CAREFULLY READ THE FOLLOWING TERMS AND CONDITIONS. This License
-Agreement (the "Agreement") is a legal contract between you, your
-employer, educational institution or organization (collectively, "You")
-and the British Columbia Cancer Agency ("BCCA") with respect to the
-license of the software, including all associated documentation
-(collectively, the "Product").
-
-BCCA is willing to license the Product to You only if You accept the
-terms and conditions of this Agreement. By clicking on the "I ACCEPT"
-button, or by copying, downloading, accessing or otherwise using the
-Product, You automatically agree to be bound by the terms of this
-Agreement. IF YOU DO NOT WISH TO BE BOUND BY THE TERMS OF THIS
-AGREEMENT, DO NOT COPY, DOWNLOAD, ACCESS OR OTHERWISE USE THE
-PRODUCT.
-
-1. AUTHORITY: In the event that You are an educational institution or
-organization, Your representative who is clicking the "I ACCEPT"
-button, or otherwise copying, downloading, accessing or using the
-Product hereby, in their personal capacity, represents and warrants
-that they possess the legal authority to enter into this Agreement
-on Your behalf and to bind You to the terms of this Agreement.
-
-2. LICENSE TO USE: BCCA hereby grants to You a personal, non-exclusive,
-non-transferable, limited license to use the Product solely for
-internal, non-commercial use for non-profit research or educational
-purposes only on the terms and conditions contained in this Agreement.
-The Product may be installed at a single site at Your premises only. A
-copy of the Product installed on a single common machine or cluster of
-machines may be shared for internal use by Qualified Users only. In
-order to be a "Qualified User", an individual must be a student,
-researcher, professor, instructor or staff member of a non-profit
-educational institution or organization who uses the Product solely for
-non-profit research or educational purposes.
-
-3. RESTRICTIONS: You acknowledge and agree that You shall not, and
-shall not authorize any third party to:
-(a) make copies of the Product, except as provided in Section 2 and
-except for a single backup copy, and any such copy together with the
-original must be kept in Your possession or control;
-(b) modify, adapt, decompile, disassemble, translate into another
-computer language, create derivative works of, or otherwise reverse
-engineer the Product, or disclose any trade secrets relating to the
-Product, except as permitted in Section 5;
-(c) license, sublicense, distribute, sell, lease, transfer, assign,
-trade, rent or publish the Product or any part thereof and/or copies
-thereof, to any third party;
-(d) use the Product to process any data other than Your own;
-(e) use the Product or any part thereof for any commercial or
-for-profit purpose or any other purpose other than as permitted in
-Section 2; or
-(f) use, without its express permission, the name of BCCA.
-
-4. INTELLECTUAL PROPERTY RIGHTS: Subject to Section 5 below, all
-patents, copyrights, trade secrets, service marks, trademarks and
-other proprietary rights in or related to the Product and any
-improvements, modifications and enhancements thereof are and will
-remain the exclusive property of BCCA or its licensors. You agree
-that You will not, either during or after the termination of this
-Agreement, contest or challenge the title to or the intellectual
-property rights of BCCA or its licensors in the Product or any
-portion thereof.
-
-5. OWNERSHIP OF IMPROVEMENTS: In the event that the Product, in the
-form provided to You, includes source code (the "Source Code"),
-You are entitled to make improvements, modifications and
-enhancements to the Source Code (collectively, "Improvements")
-which Improvements are to be used by You for non-profit research
-and educational purposes only and You shall be the owner of those
-Improvements that You directly make and of all intellectual
-property rights to such Improvements, subject to the foregoing
-limits on Your use and distribution of such Improvements. You
-hereby grant to BCCA a perpetual, non-exclusive, worldwide,
-fully-paid, irrevocable license to use such Improvements for any
-purposes whatsoever, and to sublicense such Improvements including
-the right for third parties to sublicense the same, in perpetuity
-to the extent such rights are not limited in duration under
-applicable law, without identifying or seeking Your
-consent. Notwithstanding the foregoing, You acknowledge that BCCA
-and its licensors will retain or own all rights in and to any
-pre-existing code or other technology, content and data that may be
-incorporated in the Improvements. For greater certainty, this
-Section applies solely to the Source Code and shall not give You
-any rights with respect to the object code or any other portion or
-format of the Product which use, for greater certainty, is limited
-as set forth in this Agreement including as set out in Section 3(b)
-above. You acknowledge and agree that you will provide copies of
-Improvements to BCCA in such format as reasonably requested by BCCA
-at any time upon the request of BCCA.
-
-6. CONFIDENTIALITY: You acknowledge that the Product is and
-incorporates confidential and proprietary information developed,
-acquired by or licensed to BCCA. You will take all reasonable
-precautions necessary to safeguard the confidentiality of the
-Product, and will not disclose any information about the Product to
-any other person without BCCA's prior written consent. You will
-not allow the removal or defacement of any confidential or
-proprietary notice placed on the Product. You acknowledge that any
-breach of this Section 6 will cause irreparable harm to BCCA and
-its licensors.
-
-7. NO WARRANTIES: THIS PRODUCT IS PROVIDED TO YOU BY BCCA IN ORDER TO
-ALLOW YOU TO OBTAIN ACCESS TO LEADING ACADEMIC RESEARCH. THE PRODUCT
-IS PROVIDED TO YOU ON AN "AS IS" BASIS WITHOUT WARRANTY OF ANY
-KIND. NO WARRANTY, REPRESENTATION OR CONDITION EITHER EXPRESS OR
-IMPLIED, INCLUDING WITHOUT LIMITATION, ANY IMPLIED WARRANTY OR
-CONDITION OF MERCHANTABILITY, NON-INFRINGEMENT, PERFORMANCE,
-DURABILITY OR FITNESS FOR A PARTICULAR PURPOSE OR USE SHALL
-APPLY. BCCA DOES NOT WARRANT THAT THE PRODUCT WILL OPERATE ON A
-CONTINUOUS OR TROUBLE FREE BASIS.
-
-8. LIMITATION OF LIABILITY: TO THE MAXIMUM EXTENT PERMITTED BY
-APPLICABLE LAW, IN NO EVENT SHALL THE AGGREGATE LIABILITY OF BCCA TO
-YOU EXCEED THE AMOUNT YOU HAVE PAID TO ACQUIRE THE PRODUCT ("MAXIMUM
-AMOUNT") AND WHERE YOU HAVE NOT PAID ANY AMOUNT FOR THE PRODUCT THEN
-THE MAXIMUM AMOUNT SHALL BE DEEMED TO BE CDN$100.00. IN NO EVENT SHALL
-BCCA BE LIABLE FOR ANY INDIRECT, INCIDENTAL, CONSEQUENTIAL, OR SPECIAL
-DAMAGES, INCLUDING WITHOUT LIMITATION ANY DAMAGES FOR LOST PROFITS OR
-SAVINGS, REGARDLESS OF WHETHER THEY HAVE BEEN ADVISED OF THE
-POSSIBILITY OF SUCH DAMAGE. EXCEPT TO THE EXTENT THAT THE LAWS OF A
-COMPETENT JURISDICTION REQUIRE LIABILITIES BEYOND AND DESPITE THESE
-LIMITATIONS, EXCLUSIONS AND DISCLAIMERS, THESE LIMITATIONS, EXCLUSIONS
-AND DISCLAIMERS SHALL APPLY WHETHER AN ACTION, CLAIM OR DEMAND ARISES
-FROM A BREACH OF WARRANTY OR CONDITION, BREACH OF CONTRACT,
-NEGLIGENCE, STRICT LIABILITY OR ANY OTHER KIND OF CIVIL OR STATUTORY
-LIABILITY CONNECTED WITH OR ARISING FROM THIS AGREEMENT. YOU AGREE
-THAT THE FOREGOING DISCLAIMER OF WARRANTIES AND LIMITATION OF
-LIABILITY ARE FAIR IN LIGHT OF THE NATURE OF THE RIGHTS GRANTED HEREIN
-AND THE AMOUNT OF FEES PAID BY YOU IN RESPECT OF THE PRODUCT.
-
-9. INDEMNITY: You will indemnify, defend and hold harmless BCCA, its
-board of directors, staff and agents from and against any and all
-liability, loss, damage, action, claim or expense (including
-attorney's fees and costs at trial and appellate levels) in
-connection with any claim, suit, action, demand or judgement
-(collectively, "Claim") arising out of, connected with, resulting
-from, or sustained as a result of Your use of the Product or the
-downloading of the Product, including without limitation, any Claim
-relating to infringement of BCCA's intellectual property rights or
-the intellectual property rights of any third party.
-
-10. SUPPORT AND MAINTENANCE: You acknowledge and agree that, unless
-and to the extent expressly agreed by BCCA in a separate written
-document, the Product is provided to You without any support or
-maintenance from BCCA and, for greater certainty, BCCA shall have
-no obligation to issue any update or upgrade to any Product.
-
-11. TERM: This Agreement is effective until terminated. You may
-terminate this Agreement at any time by ceasing use of the Product
-and destroying or deleting any copies of the Product. This
-Agreement will terminate immediately without notice from BCCA if
-You fail to comply with any provision of this Agreement. BCCA may
-terminate this Agreement at any time upon notice to you where BCCA
-determines, in its sole discretion, that any continued use of the
-Product could infringe the rights of any third parties. Upon
-termination of this Agreement, and in any event upon BCCA
-delivering You notice of termination, You shall immediately purge
-all Products from Your computer system(s), return to BCCA all
-copies of the Product that are in Your possession or control, and
-cease any further development of any Improvements. On any
-termination of this Agreement Sections 1, 4, 6, 7, 8, 9, 13 and 14
-shall survive such termination.
-
-12. GOVERNMENT END USERS: Where any of the Product is used, duplicated
-or disclosed by or to the United States government or a government
-contractor or sub contractor, it is provided with RESTRICTED
-RIGHTS as defined in Title 48 CFR 52.227-19 and is subject to the
-following: Title 48 CFR 2.101, 52.227-19, 227.7201 through
-227.7202-4, FAR 52.227-14, and FAR 52.227-19(c)(1-2) and (6/87),
-and where applicable, the customary software license, as described
-in Title 48 CFR 227-7202 with respect to commercial software and
-commercial software documentation including DFAR 252.227-7013,
-DFAR 252,227-7014, DFAR 252.227-7015 and DFAR 252.7018, all as
-applicable.
-
-13. USE OF THE DOWNLOAD SERVICE: You acknowledge and agree that you
-will be responsible for all costs, charges and taxes (where
-applicable) arising out of Your use of the Product and the
-downloading of the Product. You acknowledge that You are
-responsible for supplying any hardware or software necessary to
-use the Product pursuant to this Agreement.
-
-14. GENERAL PROVISIONS:
-(a) This Agreement will be governed by the laws of the Province of
-British Columbia, and the laws of Canada applicable therein, excluding
-any rules of private international law that lead to the application of
-the laws of any other jurisdiction. The United Nations Convention on
-Contracts for the International Sale of Goods (1980) does not apply to
-this Agreement. The courts of the Province of British Columbia shall
-have non-exclusive jurisdiction to hear any matter arising in
-connection with this Agreement.
-(b) USE OF THE PRODUCT IS PROHIBITED IN ANY JURISDICTION WHICH DOES
-NOT GIVE EFFECT TO THE TERMS OF THIS AGREEMENT.
-(c) You agree that no joint venture, partnership, employment,
-consulting or agency relationship exists between You and BCCA as a
-result of this Agreement or Your use of the Product.
-(d) You hereby consent to Your contact information and any other
-personally identifiable information that You provide to us being
-disclosed to and maintained and used by us and our business partners
-for the purposes of (i) managing and developing our respective
-businesses and operations; (ii) marketing products and services to You
-and your staff; and (iii) developing new and enhancing existing
-products. You further agree that we may provide this information to
-other persons as required to satisfy any legal requirements and to any
-person that acquires some or all of the assets of BCCA. Where any of
-the personally identifiable information that You provide to us is in
-respect of individuals other than Yourself (such as Your staff) then
-You represent and warrant to use that You have obtained all necessary
-consents and authorizations from such individuals in order to comply
-with this provision. Please see the BCCA website for further
-information regarding personally identifiable information.
-(e) This Agreement is the entire Agreement between You and BCCA
-relating to this subject matter. You will not contest the validity of
-this Agreement merely because it is in electronic form. No
-modification of this Agreement will be binding, unless in writing and
-accepted by an authorized representative of each party.
-(f) The provisions of this Agreement are severable in that if any
-provision in the Agreement is determined to be invalid or
-unenforceable under any controlling body of law, that will not affect
-the validity or enforceability of the remaining provisions of the
-Agreement.
-(g) You agree to print out or download a copy of this Agreement and
-retain it for Your records.
-(h) You consent to the use of the English language in this Agreement.
-(i) You may not assign this Agreement or any of Your rights or
-obligations hereunder without BCCA's prior written consent. BCCA, at
-its sole discretion may assign this Agreement without notice to You.
+Copyright 2014 Canada's Michael Smith Genome Sciences Centre
+
+You may use, redistribute and modify this software for non-commercial
+purposes under the terms of the GNU General Public License as
+published by the Free Software Foundation, either version 3 of the
+License, or (at your option) any later version.
+
+To license ABySS for commercial purposes, please contact
+Patrick Rebstein <prebstein at bccancer.bc.ca>
+
+This program is distributed in the hope that it will be useful,
+but WITHOUT ANY WARRANTY; without even the implied warranty of
+MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+GNU General Public License for more details.
+
+The complete text of the GNU General Public License version 3 follows
+and is also available from the Free Software Foundation web site:
+http://www.gnu.org/licenses/
+
+See the file `COPYRIGHT` for details of the copyright and license of
+each individual file included with this software.
+
+ GNU GENERAL PUBLIC LICENSE
+ Version 3, 29 June 2007
+
+ Copyright (C) 2007 Free Software Foundation, Inc. <http://fsf.org/>
+ Everyone is permitted to copy and distribute verbatim copies
+ of this license document, but changing it is not allowed.
+
+ Preamble
+
+ The GNU General Public License is a free, copyleft license for
+software and other kinds of works.
+
+ The licenses for most software and other practical works are designed
+to take away your freedom to share and change the works. By contrast,
+the GNU General Public License is intended to guarantee your freedom to
+share and change all versions of a program--to make sure it remains free
+software for all its users. We, the Free Software Foundation, use the
+GNU General Public License for most of our software; it applies also to
+any other work released this way by its authors. You can apply it to
+your programs, too.
+
+ When we speak of free software, we are referring to freedom, not
+price. Our General Public Licenses are designed to make sure that you
+have the freedom to distribute copies of free software (and charge for
+them if you wish), that you receive source code or can get it if you
+want it, that you can change the software or use pieces of it in new
+free programs, and that you know you can do these things.
+
+ To protect your rights, we need to prevent others from denying you
+these rights or asking you to surrender the rights. Therefore, you have
+certain responsibilities if you distribute copies of the software, or if
+you modify it: responsibilities to respect the freedom of others.
+
+ For example, if you distribute copies of such a program, whether
+gratis or for a fee, you must pass on to the recipients the same
+freedoms that you received. You must make sure that they, too, receive
+or can get the source code. And you must show them these terms so they
+know their rights.
+
+ Developers that use the GNU GPL protect your rights with two steps:
+(1) assert copyright on the software, and (2) offer you this License
+giving you legal permission to copy, distribute and/or modify it.
+
+ For the developers' and authors' protection, the GPL clearly explains
+that there is no warranty for this free software. For both users' and
+authors' sake, the GPL requires that modified versions be marked as
+changed, so that their problems will not be attributed erroneously to
+authors of previous versions.
+
+ Some devices are designed to deny users access to install or run
+modified versions of the software inside them, although the manufacturer
+can do so. This is fundamentally incompatible with the aim of
+protecting users' freedom to change the software. The systematic
+pattern of such abuse occurs in the area of products for individuals to
+use, which is precisely where it is most unacceptable. Therefore, we
+have designed this version of the GPL to prohibit the practice for those
+products. If such problems arise substantially in other domains, we
+stand ready to extend this provision to those domains in future versions
+of the GPL, as needed to protect the freedom of users.
+
+ Finally, every program is threatened constantly by software patents.
+States should not allow patents to restrict development and use of
+software on general-purpose computers, but in those that do, we wish to
+avoid the special danger that patents applied to a free program could
+make it effectively proprietary. To prevent this, the GPL assures that
+patents cannot be used to render the program non-free.
+
+ The precise terms and conditions for copying, distribution and
+modification follow.
+
+ TERMS AND CONDITIONS
+
+ 0. Definitions.
+
+ "This License" refers to version 3 of the GNU General Public License.
+
+ "Copyright" also means copyright-like laws that apply to other kinds of
+works, such as semiconductor masks.
+
+ "The Program" refers to any copyrightable work licensed under this
+License. Each licensee is addressed as "you". "Licensees" and
+"recipients" may be individuals or organizations.
+
+ To "modify" a work means to copy from or adapt all or part of the work
+in a fashion requiring copyright permission, other than the making of an
+exact copy. The resulting work is called a "modified version" of the
+earlier work or a work "based on" the earlier work.
+
+ A "covered work" means either the unmodified Program or a work based
+on the Program.
+
+ To "propagate" a work means to do anything with it that, without
+permission, would make you directly or secondarily liable for
+infringement under applicable copyright law, except executing it on a
+computer or modifying a private copy. Propagation includes copying,
+distribution (with or without modification), making available to the
+public, and in some countries other activities as well.
+
+ To "convey" a work means any kind of propagation that enables other
+parties to make or receive copies. Mere interaction with a user through
+a computer network, with no transfer of a copy, is not conveying.
+
+ An interactive user interface displays "Appropriate Legal Notices"
+to the extent that it includes a convenient and prominently visible
+feature that (1) displays an appropriate copyright notice, and (2)
+tells the user that there is no warranty for the work (except to the
+extent that warranties are provided), that licensees may convey the
+work under this License, and how to view a copy of this License. If
+the interface presents a list of user commands or options, such as a
+menu, a prominent item in the list meets this criterion.
+
+ 1. Source Code.
+
+ The "source code" for a work means the preferred form of the work
+for making modifications to it. "Object code" means any non-source
+form of a work.
+
+ A "Standard Interface" means an interface that either is an official
+standard defined by a recognized standards body, or, in the case of
+interfaces specified for a particular programming language, one that
+is widely used among developers working in that language.
+
+ The "System Libraries" of an executable work include anything, other
+than the work as a whole, that (a) is included in the normal form of
+packaging a Major Component, but which is not part of that Major
+Component, and (b) serves only to enable use of the work with that
+Major Component, or to implement a Standard Interface for which an
+implementation is available to the public in source code form. A
+"Major Component", in this context, means a major essential component
+(kernel, window system, and so on) of the specific operating system
+(if any) on which the executable work runs, or a compiler used to
+produce the work, or an object code interpreter used to run it.
+
+ The "Corresponding Source" for a work in object code form means all
+the source code needed to generate, install, and (for an executable
+work) run the object code and to modify the work, including scripts to
+control those activities. However, it does not include the work's
+System Libraries, or general-purpose tools or generally available free
+programs which are used unmodified in performing those activities but
+which are not part of the work. For example, Corresponding Source
+includes interface definition files associated with source files for
+the work, and the source code for shared libraries and dynamically
+linked subprograms that the work is specifically designed to require,
+such as by intimate data communication or control flow between those
+subprograms and other parts of the work.
+
+ The Corresponding Source need not include anything that users
+can regenerate automatically from other parts of the Corresponding
+Source.
+
+ The Corresponding Source for a work in source code form is that
+same work.
+
+ 2. Basic Permissions.
+
+ All rights granted under this License are granted for the term of
+copyright on the Program, and are irrevocable provided the stated
+conditions are met. This License explicitly affirms your unlimited
+permission to run the unmodified Program. The output from running a
+covered work is covered by this License only if the output, given its
+content, constitutes a covered work. This License acknowledges your
+rights of fair use or other equivalent, as provided by copyright law.
+
+ You may make, run and propagate covered works that you do not
+convey, without conditions so long as your license otherwise remains
+in force. You may convey covered works to others for the sole purpose
+of having them make modifications exclusively for you, or provide you
+with facilities for running those works, provided that you comply with
+the terms of this License in conveying all material for which you do
+not control copyright. Those thus making or running the covered works
+for you must do so exclusively on your behalf, under your direction
+and control, on terms that prohibit them from making any copies of
+your copyrighted material outside their relationship with you.
+
+ Conveying under any other circumstances is permitted solely under
+the conditions stated below. Sublicensing is not allowed; section 10
+makes it unnecessary.
+
+ 3. Protecting Users' Legal Rights From Anti-Circumvention Law.
+
+ No covered work shall be deemed part of an effective technological
+measure under any applicable law fulfilling obligations under article
+11 of the WIPO copyright treaty adopted on 20 December 1996, or
+similar laws prohibiting or restricting circumvention of such
+measures.
+
+ When you convey a covered work, you waive any legal power to forbid
+circumvention of technological measures to the extent such circumvention
+is effected by exercising rights under this License with respect to
+the covered work, and you disclaim any intention to limit operation or
+modification of the work as a means of enforcing, against the work's
+users, your or third parties' legal rights to forbid circumvention of
+technological measures.
+
+ 4. Conveying Verbatim Copies.
+
+ You may convey verbatim copies of the Program's source code as you
+receive it, in any medium, provided that you conspicuously and
+appropriately publish on each copy an appropriate copyright notice;
+keep intact all notices stating that this License and any
+non-permissive terms added in accord with section 7 apply to the code;
+keep intact all notices of the absence of any warranty; and give all
+recipients a copy of this License along with the Program.
+
+ You may charge any price or no price for each copy that you convey,
+and you may offer support or warranty protection for a fee.
+
+ 5. Conveying Modified Source Versions.
+
+ You may convey a work based on the Program, or the modifications to
+produce it from the Program, in the form of source code under the
+terms of section 4, provided that you also meet all of these conditions:
+
+ a) The work must carry prominent notices stating that you modified
+ it, and giving a relevant date.
+
+ b) The work must carry prominent notices stating that it is
+ released under this License and any conditions added under section
+ 7. This requirement modifies the requirement in section 4 to
+ "keep intact all notices".
+
+ c) You must license the entire work, as a whole, under this
+ License to anyone who comes into possession of a copy. This
+ License will therefore apply, along with any applicable section 7
+ additional terms, to the whole of the work, and all its parts,
+ regardless of how they are packaged. This License gives no
+ permission to license the work in any other way, but it does not
+ invalidate such permission if you have separately received it.
+
+ d) If the work has interactive user interfaces, each must display
+ Appropriate Legal Notices; however, if the Program has interactive
+ interfaces that do not display Appropriate Legal Notices, your
+ work need not make them do so.
+
+ A compilation of a covered work with other separate and independent
+works, which are not by their nature extensions of the covered work,
+and which are not combined with it such as to form a larger program,
+in or on a volume of a storage or distribution medium, is called an
+"aggregate" if the compilation and its resulting copyright are not
+used to limit the access or legal rights of the compilation's users
+beyond what the individual works permit. Inclusion of a covered work
+in an aggregate does not cause this License to apply to the other
+parts of the aggregate.
+
+ 6. Conveying Non-Source Forms.
+
+ You may convey a covered work in object code form under the terms
+of sections 4 and 5, provided that you also convey the
+machine-readable Corresponding Source under the terms of this License,
+in one of these ways:
+
+ a) Convey the object code in, or embodied in, a physical product
+ (including a physical distribution medium), accompanied by the
+ Corresponding Source fixed on a durable physical medium
+ customarily used for software interchange.
+
+ b) Convey the object code in, or embodied in, a physical product
+ (including a physical distribution medium), accompanied by a
+ written offer, valid for at least three years and valid for as
+ long as you offer spare parts or customer support for that product
+ model, to give anyone who possesses the object code either (1) a
+ copy of the Corresponding Source for all the software in the
+ product that is covered by this License, on a durable physical
+ medium customarily used for software interchange, for a price no
+ more than your reasonable cost of physically performing this
+ conveying of source, or (2) access to copy the
+ Corresponding Source from a network server at no charge.
+
+ c) Convey individual copies of the object code with a copy of the
+ written offer to provide the Corresponding Source. This
+ alternative is allowed only occasionally and noncommercially, and
+ only if you received the object code with such an offer, in accord
+ with subsection 6b.
+
+ d) Convey the object code by offering access from a designated
+ place (gratis or for a charge), and offer equivalent access to the
+ Corresponding Source in the same way through the same place at no
+ further charge. You need not require recipients to copy the
+ Corresponding Source along with the object code. If the place to
+ copy the object code is a network server, the Corresponding Source
+ may be on a different server (operated by you or a third party)
+ that supports equivalent copying facilities, provided you maintain
+ clear directions next to the object code saying where to find the
+ Corresponding Source. Regardless of what server hosts the
+ Corresponding Source, you remain obligated to ensure that it is
+ available for as long as needed to satisfy these requirements.
+
+ e) Convey the object code using peer-to-peer transmission, provided
+ you inform other peers where the object code and Corresponding
+ Source of the work are being offered to the general public at no
+ charge under subsection 6d.
+
+ A separable portion of the object code, whose source code is excluded
+from the Corresponding Source as a System Library, need not be
+included in conveying the object code work.
+
+ A "User Product" is either (1) a "consumer product", which means any
+tangible personal property which is normally used for personal, family,
+or household purposes, or (2) anything designed or sold for incorporation
+into a dwelling. In determining whether a product is a consumer product,
+doubtful cases shall be resolved in favor of coverage. For a particular
+product received by a particular user, "normally used" refers to a
+typical or common use of that class of product, regardless of the status
+of the particular user or of the way in which the particular user
+actually uses, or expects or is expected to use, the product. A product
+is a consumer product regardless of whether the product has substantial
+commercial, industrial or non-consumer uses, unless such uses represent
+the only significant mode of use of the product.
+
+ "Installation Information" for a User Product means any methods,
+procedures, authorization keys, or other information required to install
+and execute modified versions of a covered work in that User Product from
+a modified version of its Corresponding Source. The information must
+suffice to ensure that the continued functioning of the modified object
+code is in no case prevented or interfered with solely because
+modification has been made.
+
+ If you convey an object code work under this section in, or with, or
+specifically for use in, a User Product, and the conveying occurs as
+part of a transaction in which the right of possession and use of the
+User Product is transferred to the recipient in perpetuity or for a
+fixed term (regardless of how the transaction is characterized), the
+Corresponding Source conveyed under this section must be accompanied
+by the Installation Information. But this requirement does not apply
+if neither you nor any third party retains the ability to install
+modified object code on the User Product (for example, the work has
+been installed in ROM).
+
+ The requirement to provide Installation Information does not include a
+requirement to continue to provide support service, warranty, or updates
+for a work that has been modified or installed by the recipient, or for
+the User Product in which it has been modified or installed. Access to a
+network may be denied when the modification itself materially and
+adversely affects the operation of the network or violates the rules and
+protocols for communication across the network.
+
+ Corresponding Source conveyed, and Installation Information provided,
+in accord with this section must be in a format that is publicly
+documented (and with an implementation available to the public in
+source code form), and must require no special password or key for
+unpacking, reading or copying.
+
+ 7. Additional Terms.
+
+ "Additional permissions" are terms that supplement the terms of this
+License by making exceptions from one or more of its conditions.
+Additional permissions that are applicable to the entire Program shall
+be treated as though they were included in this License, to the extent
+that they are valid under applicable law. If additional permissions
+apply only to part of the Program, that part may be used separately
+under those permissions, but the entire Program remains governed by
+this License without regard to the additional permissions.
+
+ When you convey a copy of a covered work, you may at your option
+remove any additional permissions from that copy, or from any part of
+it. (Additional permissions may be written to require their own
+removal in certain cases when you modify the work.) You may place
+additional permissions on material, added by you to a covered work,
+for which you have or can give appropriate copyright permission.
+
+ Notwithstanding any other provision of this License, for material you
+add to a covered work, you may (if authorized by the copyright holders of
+that material) supplement the terms of this License with terms:
+
+ a) Disclaiming warranty or limiting liability differently from the
+ terms of sections 15 and 16 of this License; or
+
+ b) Requiring preservation of specified reasonable legal notices or
+ author attributions in that material or in the Appropriate Legal
+ Notices displayed by works containing it; or
+
+ c) Prohibiting misrepresentation of the origin of that material, or
+ requiring that modified versions of such material be marked in
+ reasonable ways as different from the original version; or
+
+ d) Limiting the use for publicity purposes of names of licensors or
+ authors of the material; or
+
+ e) Declining to grant rights under trademark law for use of some
+ trade names, trademarks, or service marks; or
+
+ f) Requiring indemnification of licensors and authors of that
+ material by anyone who conveys the material (or modified versions of
+ it) with contractual assumptions of liability to the recipient, for
+ any liability that these contractual assumptions directly impose on
+ those licensors and authors.
+
+ All other non-permissive additional terms are considered "further
+restrictions" within the meaning of section 10. If the Program as you
+received it, or any part of it, contains a notice stating that it is
+governed by this License along with a term that is a further
+restriction, you may remove that term. If a license document contains
+a further restriction but permits relicensing or conveying under this
+License, you may add to a covered work material governed by the terms
+of that license document, provided that the further restriction does
+not survive such relicensing or conveying.
+
+ If you add terms to a covered work in accord with this section, you
+must place, in the relevant source files, a statement of the
+additional terms that apply to those files, or a notice indicating
+where to find the applicable terms.
+
+ Additional terms, permissive or non-permissive, may be stated in the
+form of a separately written license, or stated as exceptions;
+the above requirements apply either way.
+
+ 8. Termination.
+
+ You may not propagate or modify a covered work except as expressly
+provided under this License. Any attempt otherwise to propagate or
+modify it is void, and will automatically terminate your rights under
+this License (including any patent licenses granted under the third
+paragraph of section 11).
+
+ However, if you cease all violation of this License, then your
+license from a particular copyright holder is reinstated (a)
+provisionally, unless and until the copyright holder explicitly and
+finally terminates your license, and (b) permanently, if the copyright
+holder fails to notify you of the violation by some reasonable means
+prior to 60 days after the cessation.
+
+ Moreover, your license from a particular copyright holder is
+reinstated permanently if the copyright holder notifies you of the
+violation by some reasonable means, this is the first time you have
+received notice of violation of this License (for any work) from that
+copyright holder, and you cure the violation prior to 30 days after
+your receipt of the notice.
+
+ Termination of your rights under this section does not terminate the
+licenses of parties who have received copies or rights from you under
+this License. If your rights have been terminated and not permanently
+reinstated, you do not qualify to receive new licenses for the same
+material under section 10.
+
+ 9. Acceptance Not Required for Having Copies.
+
+ You are not required to accept this License in order to receive or
+run a copy of the Program. Ancillary propagation of a covered work
+occurring solely as a consequence of using peer-to-peer transmission
+to receive a copy likewise does not require acceptance. However,
+nothing other than this License grants you permission to propagate or
+modify any covered work. These actions infringe copyright if you do
+not accept this License. Therefore, by modifying or propagating a
+covered work, you indicate your acceptance of this License to do so.
+
+ 10. Automatic Licensing of Downstream Recipients.
+
+ Each time you convey a covered work, the recipient automatically
+receives a license from the original licensors, to run, modify and
+propagate that work, subject to this License. You are not responsible
+for enforcing compliance by third parties with this License.
+
+ An "entity transaction" is a transaction transferring control of an
+organization, or substantially all assets of one, or subdividing an
+organization, or merging organizations. If propagation of a covered
+work results from an entity transaction, each party to that
+transaction who receives a copy of the work also receives whatever
+licenses to the work the party's predecessor in interest had or could
+give under the previous paragraph, plus a right to possession of the
+Corresponding Source of the work from the predecessor in interest, if
+the predecessor has it or can get it with reasonable efforts.
+
+ You may not impose any further restrictions on the exercise of the
+rights granted or affirmed under this License. For example, you may
+not impose a license fee, royalty, or other charge for exercise of
+rights granted under this License, and you may not initiate litigation
+(including a cross-claim or counterclaim in a lawsuit) alleging that
+any patent claim is infringed by making, using, selling, offering for
+sale, or importing the Program or any portion of it.
+
+ 11. Patents.
+
+ A "contributor" is a copyright holder who authorizes use under this
+License of the Program or a work on which the Program is based. The
+work thus licensed is called the contributor's "contributor version".
+
+ A contributor's "essential patent claims" are all patent claims
+owned or controlled by the contributor, whether already acquired or
+hereafter acquired, that would be infringed by some manner, permitted
+by this License, of making, using, or selling its contributor version,
+but do not include claims that would be infringed only as a
+consequence of further modification of the contributor version. For
+purposes of this definition, "control" includes the right to grant
+patent sublicenses in a manner consistent with the requirements of
+this License.
+
+ Each contributor grants you a non-exclusive, worldwide, royalty-free
+patent license under the contributor's essential patent claims, to
+make, use, sell, offer for sale, import and otherwise run, modify and
+propagate the contents of its contributor version.
+
+ In the following three paragraphs, a "patent license" is any express
+agreement or commitment, however denominated, not to enforce a patent
+(such as an express permission to practice a patent or covenant not to
+sue for patent infringement). To "grant" such a patent license to a
+party means to make such an agreement or commitment not to enforce a
+patent against the party.
+
+ If you convey a covered work, knowingly relying on a patent license,
+and the Corresponding Source of the work is not available for anyone
+to copy, free of charge and under the terms of this License, through a
+publicly available network server or other readily accessible means,
+then you must either (1) cause the Corresponding Source to be so
+available, or (2) arrange to deprive yourself of the benefit of the
+patent license for this particular work, or (3) arrange, in a manner
+consistent with the requirements of this License, to extend the patent
+license to downstream recipients. "Knowingly relying" means you have
+actual knowledge that, but for the patent license, your conveying the
+covered work in a country, or your recipient's use of the covered work
+in a country, would infringe one or more identifiable patents in that
+country that you have reason to believe are valid.
+
+ If, pursuant to or in connection with a single transaction or
+arrangement, you convey, or propagate by procuring conveyance of, a
+covered work, and grant a patent license to some of the parties
+receiving the covered work authorizing them to use, propagate, modify
+or convey a specific copy of the covered work, then the patent license
+you grant is automatically extended to all recipients of the covered
+work and works based on it.
+
+ A patent license is "discriminatory" if it does not include within
+the scope of its coverage, prohibits the exercise of, or is
+conditioned on the non-exercise of one or more of the rights that are
+specifically granted under this License. You may not convey a covered
+work if you are a party to an arrangement with a third party that is
+in the business of distributing software, under which you make payment
+to the third party based on the extent of your activity of conveying
+the work, and under which the third party grants, to any of the
+parties who would receive the covered work from you, a discriminatory
+patent license (a) in connection with copies of the covered work
+conveyed by you (or copies made from those copies), or (b) primarily
+for and in connection with specific products or compilations that
+contain the covered work, unless you entered into that arrangement,
+or that patent license was granted, prior to 28 March 2007.
+
+ Nothing in this License shall be construed as excluding or limiting
+any implied license or other defenses to infringement that may
+otherwise be available to you under applicable patent law.
+
+ 12. No Surrender of Others' Freedom.
+
+ If conditions are imposed on you (whether by court order, agreement or
+otherwise) that contradict the conditions of this License, they do not
+excuse you from the conditions of this License. If you cannot convey a
+covered work so as to satisfy simultaneously your obligations under this
+License and any other pertinent obligations, then as a consequence you may
+not convey it at all. For example, if you agree to terms that obligate you
+to collect a royalty for further conveying from those to whom you convey
+the Program, the only way you could satisfy both those terms and this
+License would be to refrain entirely from conveying the Program.
+
+ 13. Use with the GNU Affero General Public License.
+
+ Notwithstanding any other provision of this License, you have
+permission to link or combine any covered work with a work licensed
+under version 3 of the GNU Affero General Public License into a single
+combined work, and to convey the resulting work. The terms of this
+License will continue to apply to the part which is the covered work,
+but the special requirements of the GNU Affero General Public License,
+section 13, concerning interaction through a network will apply to the
+combination as such.
+
+ 14. Revised Versions of this License.
+
+ The Free Software Foundation may publish revised and/or new versions of
+the GNU General Public License from time to time. Such new versions will
+be similar in spirit to the present version, but may differ in detail to
+address new problems or concerns.
+
+ Each version is given a distinguishing version number. If the
+Program specifies that a certain numbered version of the GNU General
+Public License "or any later version" applies to it, you have the
+option of following the terms and conditions either of that numbered
+version or of any later version published by the Free Software
+Foundation. If the Program does not specify a version number of the
+GNU General Public License, you may choose any version ever published
+by the Free Software Foundation.
+
+ If the Program specifies that a proxy can decide which future
+versions of the GNU General Public License can be used, that proxy's
+public statement of acceptance of a version permanently authorizes you
+to choose that version for the Program.
+
+ Later license versions may give you additional or different
+permissions. However, no additional obligations are imposed on any
+author or copyright holder as a result of your choosing to follow a
+later version.
+
+ 15. Disclaimer of Warranty.
+
+ THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
+APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
+HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY
+OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,
+THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
+PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM
+IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF
+ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
+
+ 16. Limitation of Liability.
+
+ IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS
+THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY
+GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE
+USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF
+DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
+PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),
+EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF
+SUCH DAMAGES.
+
+ 17. Interpretation of Sections 15 and 16.
+
+ If the disclaimer of warranty and limitation of liability provided
+above cannot be given local legal effect according to their terms,
+reviewing courts shall apply local law that most closely approximates
+an absolute waiver of all civil liability in connection with the
+Program, unless a warranty or assumption of liability accompanies a
+copy of the Program in return for a fee.
+
+ END OF TERMS AND CONDITIONS
diff --git a/Layout/Makefile.in b/Layout/Makefile.in
deleted file mode 100644
index 4504628..0000000
--- a/Layout/Makefile.in
+++ /dev/null
@@ -1,580 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = abyss-layout$(EXEEXT)
-subdir = Layout
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_abyss_layout_OBJECTS = abyss_layout-layout.$(OBJEXT)
-abyss_layout_OBJECTS = $(am_abyss_layout_OBJECTS)
-abyss_layout_DEPENDENCIES = $(top_builddir)/Common/libcommon.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(abyss_layout_SOURCES)
-DIST_SOURCES = $(abyss_layout_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-abyss_layout_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
-abyss_layout_LDADD = $(top_builddir)/Common/libcommon.a
-abyss_layout_SOURCES = layout.cc
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cc .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Layout/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Layout/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-abyss-layout$(EXEEXT): $(abyss_layout_OBJECTS) $(abyss_layout_DEPENDENCIES) $(EXTRA_abyss_layout_DEPENDENCIES)
- @rm -f abyss-layout$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(abyss_layout_OBJECTS) $(abyss_layout_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_layout-layout.Po at am__quote@
-
-.cc.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cc.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-abyss_layout-layout.o: layout.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_layout_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_layout-layout.o -MD -MP -MF $(DEPDIR)/abyss_layout-layout.Tpo -c -o abyss_layout-layout.o `test -f 'layout.cc' || echo '$(srcdir)/'`layout.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_layout-layout.Tpo $(DEPDIR)/abyss_layout-layout.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='layout.cc' object='abyss_layout-layout.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_layout_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_layout-layout.o `test -f 'layout.cc' || echo '$(srcdir)/'`layout.cc
-
-abyss_layout-layout.obj: layout.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_layout_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_layout-layout.obj -MD -MP -MF $(DEPDIR)/abyss_layout-layout.Tpo -c -o abyss_layout-layout.obj `if test -f 'layout.cc'; then $(CYGPATH_W) 'layout.cc'; else $(CYGPATH_W) '$(srcdir)/layout.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_layout-layout.Tpo $(DEPDIR)/abyss_layout-layout.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='layout.cc' object='abyss_layout-layout.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_layout_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_layout-layout.obj `if test -f 'layout.cc'; then $(CYGPATH_W) 'layout.cc'; else $(CYGPATH_W) '$(srcdir)/layout.cc'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Layout/layout.cc b/Layout/layout.cc
index 9e498be..43a5121 100644
--- a/Layout/layout.cc
+++ b/Layout/layout.cc
@@ -47,6 +47,8 @@ static const char USAGE_MESSAGE[] =
" -g, --graph=FILE write the graph to FILE\n"
" --tred remove transitive edges\n"
" --no-tred do not remove transitive edges [default]\n"
+" --SS expect contigs to be oriented correctly\n"
+" --no-SS no assumption about contig orientation [default]\n"
" -v, --verbose display verbose output\n"
" --help display this help and exit\n"
" --version output version information and exit\n"
@@ -71,6 +73,9 @@ namespace opt {
/** Remove transitive edges. */
static int tred;
+ /** Run a strand-specific RNA-Seq assembly. */
+ static int ss;
+
/** Verbose output. */
int verbose; // used by PopBubbles
@@ -90,6 +95,8 @@ static const struct option longopts[] = {
{ "min-length", required_argument, NULL, 's' },
{ "tred", no_argument, &opt::tred, true },
{ "no-tred", no_argument, &opt::tred, false },
+ { "SS", no_argument, &opt::ss, 1 },
+ { "no-SS", no_argument, &opt::ss, 0 },
{ "verbose", no_argument, NULL, 'v' },
{ "help", no_argument, NULL, OPT_HELP },
{ "version", no_argument, NULL, OPT_VERSION },
@@ -267,7 +274,7 @@ int main(int argc, char** argv)
// Assemble the paths.
ContigPaths paths;
- assembleDFS(g, back_inserter(paths));
+ assembleDFS(g, back_inserter(paths), opt::ss);
sort(paths.begin(), paths.end());
if (opt::verbose > 0) {
unsigned n = 0;
diff --git a/LogKmerCount/CountingBloomFilter.h b/LogKmerCount/CountingBloomFilter.h
new file mode 100644
index 0000000..ee09ae0
--- /dev/null
+++ b/LogKmerCount/CountingBloomFilter.h
@@ -0,0 +1,132 @@
+/**
+ * A counting Bloom filter
+ * Copyright 2014 bcgsc
+ */
+#ifndef COUNTINGBLOOMFILTER_H
+#define COUNTINGBLOOMFILTER_H 1
+
+#include "Bloom/Bloom.h"
+#include <vector>
+#include <math.h>
+#include <cassert>
+
+/** A counting Bloom filter. */
+template<typename NumericType>
+class CountingBloomFilter {
+public:
+
+ /** Constructor */
+ CountingBloomFilter(unsigned hashnum = 1) :
+ m_data(0), hashNum(hashnum), uniqueEntries(0), replicateEntries(0)
+ {
+ }
+
+ /** Constructor */
+ CountingBloomFilter(size_t n, unsigned hashnum = 1) :
+ m_data(n), hashNum(hashnum), uniqueEntries(0), replicateEntries(0)
+ {
+ }
+
+ /** Destructor */
+ virtual ~CountingBloomFilter() {}
+
+ /** Return the size (in discrete elements) of the bit array. */
+ size_t size() const
+ {
+ return m_data.size();
+ }
+
+ /** Return the number of elements with count >= MAX_COUNT. */
+ size_t popcount() const
+ {
+ return uniqueEntries;
+ }
+
+ /** Return the estimated false positive rate */
+ double FPR() const
+ {
+ return pow(1.0 - pow(1.0 - 1.0 / double(m_data.size()),
+ double(uniqueEntries) * hashNum), double(hashNum));
+ }
+
+ /** Return the count of the single element (debugging purposes)
+ */
+ NumericType operator[](size_t i) const
+ {
+ return m_data[i];
+ }
+
+ /** Return the count of this element. */
+ NumericType operator[](const Bloom::key_type& key) const
+ {
+ NumericType currentMin = m_data[Bloom::hash(key, 0) % m_data.size()];
+ for (unsigned int i = 1; i < hashNum; ++i) {
+ NumericType min = m_data[Bloom::hash(key, i) % m_data.size()];
+ if (min < currentMin) {
+ currentMin = min;
+ }
+ if (0 == currentMin) {
+ break;
+ }
+ }
+ return currentMin;
+ }
+
+ /** Add the object with the specified index (debugging purposes). */
+ void insert(size_t index)
+ {
+ ++m_data[index];
+ }
+
+ /** Add the object to this counting multiset.
+ * If all values are the same update all
+ * If some values are larger only update smallest counts*/
+ void insert(const Bloom::key_type& key)
+ {
+ //check for which elements to update
+ NumericType minEle = (*this)[key];
+
+ //update only those elements
+ for (unsigned int i = 1; i < hashNum; ++i) {
+ size_t hashVal = Bloom::hash(key, i) % m_data.size();
+ NumericType val = m_data[hashVal];
+ if (minEle == val) {
+ insert(hashVal);
+ }
+ }
+ if (minEle)
+ ++uniqueEntries;
+ else
+ ++replicateEntries;
+ }
+
+ void write(std::ostream& out) const
+ {
+ assert(!m_data.empty());
+ out.write(reinterpret_cast<const char *>(&m_data), sizeof(NumericType));
+ }
+
+ //TODO: need to implement tracking of directionality
+ void loadSeq(unsigned k, const std::string& seq)
+ {
+ if (seq.size() < k)
+ return;
+ for (size_t i = 0; i < seq.size() - k + 1; ++i) {
+ std::string kmer = seq.substr(i, k);
+ size_t pos = kmer.find_last_not_of("ACGTacgt");
+ if (pos == std::string::npos) {
+ insert(Kmer(kmer));
+ } else
+ i += pos;
+ }
+ }
+
+protected:
+ std::vector<NumericType> m_data;
+ unsigned hashNum;
+ size_t uniqueEntries;
+ size_t replicateEntries;
+
+};
+
+#endif
diff --git a/LogKmerCount/Makefile.am b/LogKmerCount/Makefile.am
new file mode 100644
index 0000000..1e60179
--- /dev/null
+++ b/LogKmerCount/Makefile.am
@@ -0,0 +1,16 @@
+bin_PROGRAMS = logcounter
+
+logcounter_CPPFLAGS = -I$(top_srcdir) \
+ -I$(top_srcdir)/Common \
+ -I$(top_srcdir)/DataLayer
+
+logcounter_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
+
+logcounter_LDADD = \
+ $(top_builddir)/DataLayer/libdatalayer.a \
+ $(top_builddir)/Align/libalign.a \
+ $(top_builddir)/Common/libcommon.a
+
+logcounter_SOURCES = logcounter.cc \
+ CountingBloomFilter.h \
+ plc.h
diff --git a/LogKmerCount/logcounter.cc b/LogKmerCount/logcounter.cc
new file mode 100644
index 0000000..15331eb
--- /dev/null
+++ b/LogKmerCount/logcounter.cc
@@ -0,0 +1,164 @@
+/**
+ * logarithmic k-mer count based on a Bloom filter
+ * Copyright 2014 BCGSC
+ */
+
+#include "config.h"
+#include "plc.h"
+#include "CountingBloomFilter.h"
+
+#include "Common/IOUtil.h"
+#include "Common/Options.h"
+#include "Common/StringUtil.h"
+#include "DataLayer/Options.h"
+
+#include <cassert>
+#include <getopt.h>
+#include <iostream>
+#include <cstring>
+#if _OPENMP
+# include <omp.h>
+#endif
+
+using namespace std;
+
+#define PROGRAM "logcounter"
+
+static const char VERSION_MESSAGE[] =
+PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
+"Written by ?.\n"
+"\n"
+"Copyright 2014 Canada's Michael Smith Genome Science Centre\n";
+
+static const char USAGE_MESSAGE[] =
+"Usage: " PROGRAM " [OPTION]... [READS]...\n"
+" -j, --threads=N use N parallel threads [1]\n"
+" -k, --kmer=N the size of a k-mer\n"
+" -s, --seed=N the seed value used\n"
+" -b, --bloom-size=N size of bloom filter [500M]\n"
+" --chastity discard unchaste reads [default]\n"
+" --no-chastity do not discard unchaste reads\n"
+" --trim-masked trim masked bases from the ends of reads\n"
+" --no-trim-masked do not trim masked bases from the ends\n"
+" of reads [default]\n"
+" -q, --trim-quality=N trim bases from the ends of reads whose\n"
+" quality is less than the threshold\n"
+" --standard-quality zero quality is `!' (33)\n"
+" default for FASTQ and SAM files\n"
+" --illumina-quality zero quality is `@' (64)\n"
+" default for qseq and export files\n"
+" -v, --verbose display verbose output\n"
+" --help display this help and exit\n"
+" --version output version information and exit\n"
+"\n"
+"Report bugs to <" PACKAGE_BUGREPORT ">.\n";
+
+namespace opt {
+ /** The number of parallel threads. */
+ static unsigned threads = 1;
+
+ /** The size of the bloom filter in bytes. */
+ size_t bloomSize = 500 * 1024 * 1024;
+
+ /** The size of a k-mer. */
+ unsigned k;
+
+ /** The seed value to use for random number gen **/
+ unsigned s;
+
+// /** Prefix for output files */
+// static string outputPrefix;
+}
+
+///** Counters */
+//static struct {
+//} g_count;
+
+static const char shortopts[] = "j:k:s:q:v";
+
+enum { OPT_HELP = 1, OPT_VERSION };
+
+static const struct option longopts[] = {
+ { "bloom-size", required_argument, NULL, 'b' },
+ { "threads", required_argument, NULL, 'j' },
+ { "kmer", required_argument, NULL, 'k' },
+ { "seed", required_argument, NULL, 's' },
+ { "chastity", no_argument, &opt::chastityFilter, 1 },
+ { "no-chastity", no_argument, &opt::chastityFilter, 0 },
+ { "trim-masked", no_argument, &opt::trimMasked, 1 },
+ { "no-trim-masked", no_argument, &opt::trimMasked, 0 },
+ { "trim-quality", required_argument, NULL, 'q' },
+ { "standard-quality", no_argument, &opt::qualityOffset, 33 },
+ { "illumina-quality", no_argument, &opt::qualityOffset, 64 },
+ { "verbose", no_argument, NULL, 'v' },
+ { "help", no_argument, NULL, OPT_HELP },
+ { "version", no_argument, NULL, OPT_VERSION },
+ { NULL, 0, NULL, 0 }
+};
+
+int main(int argc, char** argv)
+{
+ bool die = false;
+
+ for (int c; (c = getopt_long(argc, argv,
+ shortopts, longopts, NULL)) != -1;) {
+ istringstream arg(optarg != NULL ? optarg : "");
+ switch (c) {
+ case '?':
+ die = true; break;
+ case 'b':
+ opt::bloomSize = SIToBytes(arg); break;
+ case 'j':
+ arg >> opt::threads; break;
+ case 'k':
+ arg >> opt::k; break;
+ case 's':
+ arg >> opt::s; break;
+ case 'q':
+ arg >> opt::qualityThreshold; break;
+ case 'v':
+ opt::verbose++; break;
+ case OPT_HELP:
+ cerr << USAGE_MESSAGE;
+ exit(EXIT_SUCCESS);
+ case OPT_VERSION:
+ cerr << VERSION_MESSAGE;
+ exit(EXIT_SUCCESS);
+ }
+ if (optarg != NULL && (!arg.eof() || arg.fail())) {
+ cerr << PROGRAM ": invalid option: `-"
+ << (char)c << optarg << "'\n";
+ exit(EXIT_FAILURE);
+ }
+ }
+
+ if (opt::k == 0) {
+ cerr << PROGRAM ": missing mandatory option `-k'\n";
+ die = true;
+ }
+
+ if (die) {
+ cerr << "Try `" << PROGRAM
+ << " --help' for more information.\n";
+ exit(EXIT_FAILURE);
+ }
+
+#if _OPENMP
+ if (opt::threads > 0)
+ omp_set_num_threads(opt::threads);
+#endif
+
+ //set seed
+ srand (opt::s);
+
+ Kmer::setLength(opt::k);
+
+ assert(opt::bloomSize > 0);
+
+ //size determined by
+ CountingBloomFilter<plc> bloom(opt::bloomSize, 1);
+ for (int i = optind; i < argc; i++)
+ Bloom::loadFile(bloom, opt::k, string(argv[i]), opt::verbose);
+
+ return 0;
+}
diff --git a/LogKmerCount/plc.h b/LogKmerCount/plc.h
new file mode 100644
index 0000000..07fe2c1
--- /dev/null
+++ b/LogKmerCount/plc.h
@@ -0,0 +1,68 @@
+/**
+ * A minifloat like datatype for probablistic log counts (PLC) of elements
+ * Unsigned generic implementation
+ * Mantissa = 3 bits
+ * Exponent = 5 bits
+ * Copyright 2014 bcgsc
+ */
+#include <stdint.h>
+#include <stdlib.h>
+#include <math.h>
+#include <iostream>
+
+using namespace std;
+
+static const unsigned mantissa = 3;
+static const uint8_t mantiMask = 0xFF >> (8 - mantissa);
+static const uint8_t addMask = 0x80 >> (7 - mantissa);
+
+class plc {
+public:
+ plc()
+ {
+ m_val = 0;
+ }
+
+ void operator++()
+ {
+ //from 0-1
+ if (m_val <= mantiMask) {
+ ++m_val;
+ } else {
+ //this shifts the first bit off and creates the value
+ //need to get the correct transition probability
+ size_t shiftVal = 1 << ((m_val >> mantissa) - 1);
+ if (rand() % shiftVal == 0) {
+ ++m_val;
+ }
+ }
+ }
+
+ bool operator==(plc val)
+ {
+ return val.rawValue() == m_val;
+ }
+
+ operator bool()
+ {
+ return m_val;
+ }
+
+ float toFloat()
+ {
+ if (m_val <= mantiMask)
+ return float(m_val);
+ return ldexp((m_val & mantiMask) | addMask, (m_val >> mantissa) - 1);
+ }
+
+ /*
+ * return raw value of byte use to store value
+ */
+ uint8_t rawValue()
+ {
+ return m_val;
+ }
+
+private:
+ uint8_t m_val;
+};
diff --git a/LogKmerCount/plc_strand.h b/LogKmerCount/plc_strand.h
new file mode 100644
index 0000000..defe57b
--- /dev/null
+++ b/LogKmerCount/plc_strand.h
@@ -0,0 +1,80 @@
+/**
+ * A minifloat like datatype for probablistic log counts (PLC) of elements
+ * Contains unique functionalities for minimizing collision
+ * Mantissa = 3 bits
+ * Exponent = 4 bits
+ * ControlBit = 1 bits
+ * Copyright 2014 bcgsc
+ */
+
+static const uint8_t numericBitMask = 0x7F;
+static const unsigned mantissa = 3;
+static const uint8_t mantiMask = 0xFF >> (8 - mantissa);
+static const uint8_t addMask = 0x80 >> (7 - mantissa);
+
+class plc {
+public:
+ plc()
+ {
+ m_val = 0;
+ }
+
+ void operator++()
+ {
+ //extract numeric section of plc
+ uint8_t maskedVal = m_val & numericBitMask;
+
+ //check if at max value
+ if (maskedVal == numericBitMask) {
+ return;
+ }
+
+ if (maskedVal <= mantissa) {
+ ++m_val;
+ } else {
+ //this shifts the first bit off and creates the value
+ //need to get the correct transition probability
+ unsigned shiftVal = 1 << ((maskedVal >> mantissa) - 1);
+ if (rand() % shiftVal == 0) {
+ ++maskedVal;
+ }
+ }
+ }
+
+ bool operator==(plc val)
+ {
+ return val.rawValue() & numericBitMask == m_val & numericBitMask;
+ }
+
+ operator bool()
+ {
+ return m_val & numericBitMask;
+ }
+
+ float toFloat()
+ {
+ //extract numeric section of plc
+ uint8_t maskedVal = m_val & numericBitMask;
+
+ if (maskedVal <= mantissa)
+ return float(maskedVal);
+ return ldexp((maskedVal & mantiMask) | addMask,
+ (maskedVal >> mantissa) - 1);
+ }
+
+ /*
+ * return raw value of byte use to store value
+ */
+ uint8_t rawValue()
+ {
+ return m_val;
+ }
+
+ void setStrandBit()
+ {
+ m_val &= 0x80;
+ }
+
+private:
+ uint8_t m_val;
+};
diff --git a/Makefile.am b/Makefile.am
index 14d63a8..47800ee 100644
--- a/Makefile.am
+++ b/Makefile.am
@@ -2,6 +2,15 @@ if HAVE_LIBMPI
Parallel=Parallel
endif
+if HAVE_GTEST
+Unittest=Unittest
+else
+check:
+ @echo "error: To use 'make check' command, please setup"; \
+ echo " gtest header&library as shown on the Wiki"; \
+ false
+endif
+
dist_doc_DATA = ChangeLog COPYRIGHT LICENSE \
README.css README.html README.md
@@ -19,11 +28,14 @@ SUBDIRS = \
Align \
ABYSS $(Parallel) \
AdjList \
+ Bloom \
+ Konnector \
Consensus \
DAssembler \
DistanceEst \
KAligner \
Layout \
+ LogKmerCount \
Map \
MergePaths \
Misc \
@@ -34,7 +46,9 @@ SUBDIRS = \
Scaffold \
SimpleGraph \
kmerprint \
- FilterGraph
+ FilterGraph \
+ GapFiller \
+ $(Unittest)
%.html: %.md
-multimarkdown $< >$@
diff --git a/Makefile.in b/Makefile.in
deleted file mode 100644
index 1bd58f7..0000000
--- a/Makefile.in
+++ /dev/null
@@ -1,856 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-subdir = .
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/configure $(am__configure_deps) \
- $(srcdir)/config.h.in $(dist_doc_DATA) ChangeLog compile \
- depcomp install-sh missing
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-am__CONFIG_DISTCLEAN_FILES = config.status config.cache config.log \
- configure.lineno config.status.lineno
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-SOURCES =
-DIST_SOURCES =
-RECURSIVE_TARGETS = all-recursive check-recursive cscopelist-recursive \
- ctags-recursive dvi-recursive html-recursive info-recursive \
- install-data-recursive install-dvi-recursive \
- install-exec-recursive install-html-recursive \
- install-info-recursive install-pdf-recursive \
- install-ps-recursive install-recursive installcheck-recursive \
- installdirs-recursive pdf-recursive ps-recursive \
- tags-recursive uninstall-recursive
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`;
-am__vpath_adj = case $$p in \
- $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \
- *) f=$$p;; \
- esac;
-am__strip_dir = f=`echo $$p | sed -e 's|^.*/||'`;
-am__install_max = 40
-am__nobase_strip_setup = \
- srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*|]/\\\\&/g'`
-am__nobase_strip = \
- for p in $$list; do echo "$$p"; done | sed -e "s|$$srcdirstrip/||"
-am__nobase_list = $(am__nobase_strip_setup); \
- for p in $$list; do echo "$$p $$p"; done | \
- sed "s| $$srcdirstrip/| |;"' / .*\//!s/ .*/ ./; s,\( .*\)/[^/]*$$,\1,' | \
- $(AWK) 'BEGIN { files["."] = "" } { files[$$2] = files[$$2] " " $$1; \
- if (++n[$$2] == $(am__install_max)) \
- { print $$2, files[$$2]; n[$$2] = 0; files[$$2] = "" } } \
- END { for (dir in files) print dir, files[dir] }'
-am__base_list = \
- sed '$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;s/\n/ /g' | \
- sed '$$!N;$$!N;$$!N;$$!N;s/\n/ /g'
-am__uninstall_files_from_dir = { \
- test -z "$$files" \
- || { test ! -d "$$dir" && test ! -f "$$dir" && test ! -r "$$dir"; } \
- || { echo " ( cd '$$dir' && rm -f" $$files ")"; \
- $(am__cd) "$$dir" && rm -f $$files; }; \
- }
-am__installdirs = "$(DESTDIR)$(docdir)"
-DATA = $(dist_doc_DATA)
-RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive \
- distclean-recursive maintainer-clean-recursive
-am__recursive_targets = \
- $(RECURSIVE_TARGETS) \
- $(RECURSIVE_CLEAN_TARGETS) \
- $(am__extra_recursive_targets)
-AM_RECURSIVE_TARGETS = $(am__recursive_targets:-recursive=) TAGS CTAGS \
- cscope distdir dist dist-all distcheck
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) \
- $(LISP)config.h.in
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-CSCOPE = cscope
-DIST_SUBDIRS = bin doc Assembly Common DataLayer FMIndex Graph dialign \
- Align ABYSS Parallel AdjList Consensus DAssembler DistanceEst \
- KAligner Layout Map MergePaths Misc Overlap ParseAligns \
- PathOverlap PopBubbles Scaffold SimpleGraph kmerprint \
- FilterGraph
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-distdir = $(PACKAGE)-$(VERSION)
-top_distdir = $(distdir)
-am__remove_distdir = \
- if test -d "$(distdir)"; then \
- find "$(distdir)" -type d ! -perm -200 -exec chmod u+w {} ';' \
- && rm -rf "$(distdir)" \
- || { sleep 5 && rm -rf "$(distdir)"; }; \
- else :; fi
-am__post_remove_distdir = $(am__remove_distdir)
-am__relativize = \
- dir0=`pwd`; \
- sed_first='s,^\([^/]*\)/.*$$,\1,'; \
- sed_rest='s,^[^/]*/*,,'; \
- sed_last='s,^.*/\([^/]*\)$$,\1,'; \
- sed_butlast='s,/*[^/]*$$,,'; \
- while test -n "$$dir1"; do \
- first=`echo "$$dir1" | sed -e "$$sed_first"`; \
- if test "$$first" != "."; then \
- if test "$$first" = ".."; then \
- dir2=`echo "$$dir0" | sed -e "$$sed_last"`/"$$dir2"; \
- dir0=`echo "$$dir0" | sed -e "$$sed_butlast"`; \
- else \
- first2=`echo "$$dir2" | sed -e "$$sed_first"`; \
- if test "$$first2" = "$$first"; then \
- dir2=`echo "$$dir2" | sed -e "$$sed_rest"`; \
- else \
- dir2="../$$dir2"; \
- fi; \
- dir0="$$dir0"/"$$first"; \
- fi; \
- fi; \
- dir1=`echo "$$dir1" | sed -e "$$sed_rest"`; \
- done; \
- reldir="$$dir2"
-DIST_ARCHIVES = $(distdir).tar.gz
-GZIP_ENV = --best
-DIST_TARGETS = dist-gzip
-distuninstallcheck_listfiles = find . -type f -print
-am__distuninstallcheck_listfiles = $(distuninstallcheck_listfiles) \
- | sed 's|^\./|$(prefix)/|' | grep -v '$(infodir)/dir$$'
-distcleancheck_listfiles = find . -type f -print
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
- at HAVE_LIBMPI_TRUE@Parallel = Parallel
-dist_doc_DATA = ChangeLog COPYRIGHT LICENSE \
- README.css README.html README.md
-
-EXTRA_DIST = doxygen.conf
-SUBDIRS = \
- bin \
- doc \
- Assembly \
- Common \
- DataLayer \
- FMIndex \
- Graph \
- dialign \
- Align \
- ABYSS $(Parallel) \
- AdjList \
- Consensus \
- DAssembler \
- DistanceEst \
- KAligner \
- Layout \
- Map \
- MergePaths \
- Misc \
- Overlap \
- ParseAligns \
- PathOverlap \
- PopBubbles \
- Scaffold \
- SimpleGraph \
- kmerprint \
- FilterGraph
-
-all: config.h
- $(MAKE) $(AM_MAKEFLAGS) all-recursive
-
-.SUFFIXES:
-am--refresh: Makefile
- @:
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- echo ' cd $(srcdir) && $(AUTOMAKE) --foreign'; \
- $(am__cd) $(srcdir) && $(AUTOMAKE) --foreign \
- && exit 0; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- echo ' $(SHELL) ./config.status'; \
- $(SHELL) ./config.status;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- $(SHELL) ./config.status --recheck
-
-$(top_srcdir)/configure: $(am__configure_deps)
- $(am__cd) $(srcdir) && $(AUTOCONF)
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- $(am__cd) $(srcdir) && $(ACLOCAL) $(ACLOCAL_AMFLAGS)
-$(am__aclocal_m4_deps):
-
-config.h: stamp-h1
- @test -f $@ || rm -f stamp-h1
- @test -f $@ || $(MAKE) $(AM_MAKEFLAGS) stamp-h1
-
-stamp-h1: $(srcdir)/config.h.in $(top_builddir)/config.status
- @rm -f stamp-h1
- cd $(top_builddir) && $(SHELL) ./config.status config.h
-$(srcdir)/config.h.in: $(am__configure_deps)
- ($(am__cd) $(top_srcdir) && $(AUTOHEADER))
- rm -f stamp-h1
- touch $@
-
-distclean-hdr:
- -rm -f config.h stamp-h1
-install-dist_docDATA: $(dist_doc_DATA)
- @$(NORMAL_INSTALL)
- @list='$(dist_doc_DATA)'; test -n "$(docdir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(docdir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(docdir)" || exit 1; \
- fi; \
- for p in $$list; do \
- if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
- echo "$$d$$p"; \
- done | $(am__base_list) | \
- while read files; do \
- echo " $(INSTALL_DATA) $$files '$(DESTDIR)$(docdir)'"; \
- $(INSTALL_DATA) $$files "$(DESTDIR)$(docdir)" || exit $$?; \
- done
-
-uninstall-dist_docDATA:
- @$(NORMAL_UNINSTALL)
- @list='$(dist_doc_DATA)'; test -n "$(docdir)" || list=; \
- files=`for p in $$list; do echo $$p; done | sed -e 's|^.*/||'`; \
- dir='$(DESTDIR)$(docdir)'; $(am__uninstall_files_from_dir)
-
-# This directory's subdirectories are mostly independent; you can cd
-# into them and run 'make' without going through this Makefile.
-# To change the values of 'make' variables: instead of editing Makefiles,
-# (1) if the variable is set in 'config.status', edit 'config.status'
-# (which will cause the Makefiles to be regenerated when you run 'make');
-# (2) otherwise, pass the desired values on the 'make' command line.
-$(am__recursive_targets):
- @fail=; \
- if $(am__make_keepgoing); then \
- failcom='fail=yes'; \
- else \
- failcom='exit 1'; \
- fi; \
- dot_seen=no; \
- target=`echo $@ | sed s/-recursive//`; \
- case "$@" in \
- distclean-* | maintainer-clean-*) list='$(DIST_SUBDIRS)' ;; \
- *) list='$(SUBDIRS)' ;; \
- esac; \
- for subdir in $$list; do \
- echo "Making $$target in $$subdir"; \
- if test "$$subdir" = "."; then \
- dot_seen=yes; \
- local_target="$$target-am"; \
- else \
- local_target="$$target"; \
- fi; \
- ($(am__cd) $$subdir && $(MAKE) $(AM_MAKEFLAGS) $$local_target) \
- || eval $$failcom; \
- done; \
- if test "$$dot_seen" = "no"; then \
- $(MAKE) $(AM_MAKEFLAGS) "$$target-am" || exit 1; \
- fi; test -z "$$fail"
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-recursive
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- if ($(ETAGS) --etags-include --version) >/dev/null 2>&1; then \
- include_option=--etags-include; \
- empty_fix=.; \
- else \
- include_option=--include; \
- empty_fix=; \
- fi; \
- list='$(SUBDIRS)'; for subdir in $$list; do \
- if test "$$subdir" = .; then :; else \
- test ! -f $$subdir/TAGS || \
- set "$$@" "$$include_option=$$here/$$subdir/TAGS"; \
- fi; \
- done; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-recursive
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscope: cscope.files
- test ! -s cscope.files \
- || $(CSCOPE) -b -q $(AM_CSCOPEFLAGS) $(CSCOPEFLAGS) -i cscope.files $(CSCOPE_ARGS)
-clean-cscope:
- -rm -f cscope.files
-cscope.files: clean-cscope cscopelist
-cscopelist: cscopelist-recursive
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
- -rm -f cscope.out cscope.in.out cscope.po.out cscope.files
-
-distdir: $(DISTFILES)
- $(am__remove_distdir)
- test -d "$(distdir)" || mkdir "$(distdir)"
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
- @list='$(DIST_SUBDIRS)'; for subdir in $$list; do \
- if test "$$subdir" = .; then :; else \
- $(am__make_dryrun) \
- || test -d "$(distdir)/$$subdir" \
- || $(MKDIR_P) "$(distdir)/$$subdir" \
- || exit 1; \
- dir1=$$subdir; dir2="$(distdir)/$$subdir"; \
- $(am__relativize); \
- new_distdir=$$reldir; \
- dir1=$$subdir; dir2="$(top_distdir)"; \
- $(am__relativize); \
- new_top_distdir=$$reldir; \
- echo " (cd $$subdir && $(MAKE) $(AM_MAKEFLAGS) top_distdir="$$new_top_distdir" distdir="$$new_distdir" \\"; \
- echo " am__remove_distdir=: am__skip_length_check=: am__skip_mode_fix=: distdir)"; \
- ($(am__cd) $$subdir && \
- $(MAKE) $(AM_MAKEFLAGS) \
- top_distdir="$$new_top_distdir" \
- distdir="$$new_distdir" \
- am__remove_distdir=: \
- am__skip_length_check=: \
- am__skip_mode_fix=: \
- distdir) \
- || exit 1; \
- fi; \
- done
- -test -n "$(am__skip_mode_fix)" \
- || find "$(distdir)" -type d ! -perm -755 \
- -exec chmod u+rwx,go+rx {} \; -o \
- ! -type d ! -perm -444 -links 1 -exec chmod a+r {} \; -o \
- ! -type d ! -perm -400 -exec chmod a+r {} \; -o \
- ! -type d ! -perm -444 -exec $(install_sh) -c -m a+r {} {} \; \
- || chmod -R a+r "$(distdir)"
-dist-gzip: distdir
- tardir=$(distdir) && $(am__tar) | GZIP=$(GZIP_ENV) gzip -c >$(distdir).tar.gz
- $(am__post_remove_distdir)
-
-dist-bzip2: distdir
- tardir=$(distdir) && $(am__tar) | BZIP2=$${BZIP2--9} bzip2 -c >$(distdir).tar.bz2
- $(am__post_remove_distdir)
-
-dist-lzip: distdir
- tardir=$(distdir) && $(am__tar) | lzip -c $${LZIP_OPT--9} >$(distdir).tar.lz
- $(am__post_remove_distdir)
-
-dist-xz: distdir
- tardir=$(distdir) && $(am__tar) | XZ_OPT=$${XZ_OPT--e} xz -c >$(distdir).tar.xz
- $(am__post_remove_distdir)
-
-dist-tarZ: distdir
- @echo WARNING: "Support for shar distribution archives is" \
- "deprecated." >&2
- @echo WARNING: "It will be removed altogether in Automake 2.0" >&2
- tardir=$(distdir) && $(am__tar) | compress -c >$(distdir).tar.Z
- $(am__post_remove_distdir)
-
-dist-shar: distdir
- @echo WARNING: "Support for distribution archives compressed with" \
- "legacy program 'compress' is deprecated." >&2
- @echo WARNING: "It will be removed altogether in Automake 2.0" >&2
- shar $(distdir) | GZIP=$(GZIP_ENV) gzip -c >$(distdir).shar.gz
- $(am__post_remove_distdir)
-
-dist-zip: distdir
- -rm -f $(distdir).zip
- zip -rq $(distdir).zip $(distdir)
- $(am__post_remove_distdir)
-
-dist dist-all:
- $(MAKE) $(AM_MAKEFLAGS) $(DIST_TARGETS) am__post_remove_distdir='@:'
- $(am__post_remove_distdir)
-
-# This target untars the dist file and tries a VPATH configuration. Then
-# it guarantees that the distribution is self-contained by making another
-# tarfile.
-distcheck: dist
- case '$(DIST_ARCHIVES)' in \
- *.tar.gz*) \
- GZIP=$(GZIP_ENV) gzip -dc $(distdir).tar.gz | $(am__untar) ;;\
- *.tar.bz2*) \
- bzip2 -dc $(distdir).tar.bz2 | $(am__untar) ;;\
- *.tar.lz*) \
- lzip -dc $(distdir).tar.lz | $(am__untar) ;;\
- *.tar.xz*) \
- xz -dc $(distdir).tar.xz | $(am__untar) ;;\
- *.tar.Z*) \
- uncompress -c $(distdir).tar.Z | $(am__untar) ;;\
- *.shar.gz*) \
- GZIP=$(GZIP_ENV) gzip -dc $(distdir).shar.gz | unshar ;;\
- *.zip*) \
- unzip $(distdir).zip ;;\
- esac
- chmod -R a-w $(distdir)
- chmod u+w $(distdir)
- mkdir $(distdir)/_build $(distdir)/_inst
- chmod a-w $(distdir)
- test -d $(distdir)/_build || exit 0; \
- dc_install_base=`$(am__cd) $(distdir)/_inst && pwd | sed -e 's,^[^:\\/]:[\\/],/,'` \
- && dc_destdir="$${TMPDIR-/tmp}/am-dc-$$$$/" \
- && am__cwd=`pwd` \
- && $(am__cd) $(distdir)/_build \
- && ../configure --srcdir=.. --prefix="$$dc_install_base" \
- $(AM_DISTCHECK_CONFIGURE_FLAGS) \
- $(DISTCHECK_CONFIGURE_FLAGS) \
- && $(MAKE) $(AM_MAKEFLAGS) \
- && $(MAKE) $(AM_MAKEFLAGS) dvi \
- && $(MAKE) $(AM_MAKEFLAGS) check \
- && $(MAKE) $(AM_MAKEFLAGS) install \
- && $(MAKE) $(AM_MAKEFLAGS) installcheck \
- && $(MAKE) $(AM_MAKEFLAGS) uninstall \
- && $(MAKE) $(AM_MAKEFLAGS) distuninstallcheck_dir="$$dc_install_base" \
- distuninstallcheck \
- && chmod -R a-w "$$dc_install_base" \
- && ({ \
- (cd ../.. && umask 077 && mkdir "$$dc_destdir") \
- && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" install \
- && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" uninstall \
- && $(MAKE) $(AM_MAKEFLAGS) DESTDIR="$$dc_destdir" \
- distuninstallcheck_dir="$$dc_destdir" distuninstallcheck; \
- } || { rm -rf "$$dc_destdir"; exit 1; }) \
- && rm -rf "$$dc_destdir" \
- && $(MAKE) $(AM_MAKEFLAGS) dist \
- && rm -rf $(DIST_ARCHIVES) \
- && $(MAKE) $(AM_MAKEFLAGS) distcleancheck \
- && cd "$$am__cwd" \
- || exit 1
- $(am__post_remove_distdir)
- @(echo "$(distdir) archives ready for distribution: "; \
- list='$(DIST_ARCHIVES)'; for i in $$list; do echo $$i; done) | \
- sed -e 1h -e 1s/./=/g -e 1p -e 1x -e '$$p' -e '$$x'
-distuninstallcheck:
- @test -n '$(distuninstallcheck_dir)' || { \
- echo 'ERROR: trying to run $@ with an empty' \
- '$$(distuninstallcheck_dir)' >&2; \
- exit 1; \
- }; \
- $(am__cd) '$(distuninstallcheck_dir)' || { \
- echo 'ERROR: cannot chdir into $(distuninstallcheck_dir)' >&2; \
- exit 1; \
- }; \
- test `$(am__distuninstallcheck_listfiles) | wc -l` -eq 0 \
- || { echo "ERROR: files left after uninstall:" ; \
- if test -n "$(DESTDIR)"; then \
- echo " (check DESTDIR support)"; \
- fi ; \
- $(distuninstallcheck_listfiles) ; \
- exit 1; } >&2
-distcleancheck: distclean
- @if test '$(srcdir)' = . ; then \
- echo "ERROR: distcleancheck can only run from a VPATH build" ; \
- exit 1 ; \
- fi
- @test `$(distcleancheck_listfiles) | wc -l` -eq 0 \
- || { echo "ERROR: files left in build directory after distclean:" ; \
- $(distcleancheck_listfiles) ; \
- exit 1; } >&2
-check-am: all-am
-check: check-recursive
-all-am: Makefile $(DATA) config.h
-installdirs: installdirs-recursive
-installdirs-am:
- for dir in "$(DESTDIR)$(docdir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-recursive
-install-exec: install-exec-recursive
-install-data: install-data-recursive
-uninstall: uninstall-recursive
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-recursive
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-recursive
-
-clean-am: clean-generic mostlyclean-am
-
-distclean: distclean-recursive
- -rm -f $(am__CONFIG_DISTCLEAN_FILES)
- -rm -f Makefile
-distclean-am: clean-am distclean-generic distclean-hdr distclean-tags
-
-dvi: dvi-recursive
-
-dvi-am:
-
-html: html-recursive
-
-html-am:
-
-info: info-recursive
-
-info-am:
-
-install-data-am: install-dist_docDATA
-
-install-dvi: install-dvi-recursive
-
-install-dvi-am:
-
-install-exec-am:
-
-install-html: install-html-recursive
-
-install-html-am:
-
-install-info: install-info-recursive
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-recursive
-
-install-pdf-am:
-
-install-ps: install-ps-recursive
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-recursive
- -rm -f $(am__CONFIG_DISTCLEAN_FILES)
- -rm -rf $(top_srcdir)/autom4te.cache
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-recursive
-
-mostlyclean-am: mostlyclean-generic
-
-pdf: pdf-recursive
-
-pdf-am:
-
-ps: ps-recursive
-
-ps-am:
-
-uninstall-am: uninstall-dist_docDATA
-
-.MAKE: $(am__recursive_targets) all install-am install-strip
-
-.PHONY: $(am__recursive_targets) CTAGS GTAGS TAGS all all-am \
- am--refresh check check-am clean clean-cscope clean-generic \
- cscope cscopelist-am ctags ctags-am dist dist-all dist-bzip2 \
- dist-gzip dist-lzip dist-shar dist-tarZ dist-xz dist-zip \
- distcheck distclean distclean-generic distclean-hdr \
- distclean-tags distcleancheck distdir distuninstallcheck dvi \
- dvi-am html html-am info info-am install install-am \
- install-data install-data-am install-dist_docDATA install-dvi \
- install-dvi-am install-exec install-exec-am install-html \
- install-html-am install-info install-info-am install-man \
- install-pdf install-pdf-am install-ps install-ps-am \
- install-strip installcheck installcheck-am installdirs \
- installdirs-am maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-generic pdf pdf-am ps ps-am tags \
- tags-am uninstall uninstall-am uninstall-dist_docDATA
-
-
-%.html: %.md
- -multimarkdown $< >$@
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Map/Makefile.am b/Map/Makefile.am
index 86497c7..1fedfaf 100644
--- a/Map/Makefile.am
+++ b/Map/Makefile.am
@@ -1,4 +1,4 @@
-bin_PROGRAMS = abyss-index abyss-map abyss-overlap
+bin_PROGRAMS = abyss-index abyss-map abyss-map-ssq abyss-overlap
abyss_index_CPPFLAGS = -I$(top_srcdir) \
-I$(top_srcdir)/Common \
@@ -26,6 +26,15 @@ abyss_map_LDADD = \
abyss_map_SOURCES = map.cc
+abyss_map_ssq_CPPFLAGS = $(abyss_map_CPPFLAGS) \
+ -D SAM_SEQ_QUAL=1
+
+abyss_map_ssq_CXXFLAGS = $(abyss_map_CXXFLAGS)
+
+abyss_map_ssq_LDADD = $(abyss_map_LDADD)
+
+abyss_map_ssq_SOURCES = $(abyss_map_SOURCES)
+
abyss_overlap_CPPFLAGS = -I$(top_srcdir) \
-I$(top_srcdir)/Common \
-I$(top_srcdir)/DataLayer \
diff --git a/Map/Makefile.in b/Map/Makefile.in
deleted file mode 100644
index 1f7ec91..0000000
--- a/Map/Makefile.in
+++ /dev/null
@@ -1,669 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = abyss-index$(EXEEXT) abyss-map$(EXEEXT) \
- abyss-overlap$(EXEEXT)
-subdir = Map
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_abyss_index_OBJECTS = abyss_index-index.$(OBJEXT)
-abyss_index_OBJECTS = $(am_abyss_index_OBJECTS)
-abyss_index_DEPENDENCIES = $(top_builddir)/FMIndex/libfmindex.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-am_abyss_map_OBJECTS = abyss_map-map.$(OBJEXT)
-abyss_map_OBJECTS = $(am_abyss_map_OBJECTS)
-abyss_map_DEPENDENCIES = $(top_builddir)/FMIndex/libfmindex.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-abyss_map_LINK = $(CXXLD) $(abyss_map_CXXFLAGS) $(CXXFLAGS) \
- $(AM_LDFLAGS) $(LDFLAGS) -o $@
-am_abyss_overlap_OBJECTS = abyss_overlap-overlap.$(OBJEXT)
-abyss_overlap_OBJECTS = $(am_abyss_overlap_OBJECTS)
-abyss_overlap_DEPENDENCIES = $(top_builddir)/FMIndex/libfmindex.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-abyss_overlap_LINK = $(CXXLD) $(abyss_overlap_CXXFLAGS) $(CXXFLAGS) \
- $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(abyss_index_SOURCES) $(abyss_map_SOURCES) \
- $(abyss_overlap_SOURCES)
-DIST_SOURCES = $(abyss_index_SOURCES) $(abyss_map_SOURCES) \
- $(abyss_overlap_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-abyss_index_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer \
- -I$(top_srcdir)/FMIndex
-
-abyss_index_LDADD = \
- $(top_builddir)/FMIndex/libfmindex.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-abyss_index_SOURCES = index.cc
-abyss_map_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer \
- -I$(top_srcdir)/FMIndex
-
-abyss_map_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
-abyss_map_LDADD = \
- $(top_builddir)/FMIndex/libfmindex.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-abyss_map_SOURCES = map.cc
-abyss_overlap_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer \
- -I$(top_srcdir)/FMIndex
-
-abyss_overlap_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
-abyss_overlap_LDADD = \
- $(top_builddir)/FMIndex/libfmindex.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-abyss_overlap_SOURCES = overlap.cc
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cc .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Map/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Map/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-abyss-index$(EXEEXT): $(abyss_index_OBJECTS) $(abyss_index_DEPENDENCIES) $(EXTRA_abyss_index_DEPENDENCIES)
- @rm -f abyss-index$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(abyss_index_OBJECTS) $(abyss_index_LDADD) $(LIBS)
-
-abyss-map$(EXEEXT): $(abyss_map_OBJECTS) $(abyss_map_DEPENDENCIES) $(EXTRA_abyss_map_DEPENDENCIES)
- @rm -f abyss-map$(EXEEXT)
- $(AM_V_CXXLD)$(abyss_map_LINK) $(abyss_map_OBJECTS) $(abyss_map_LDADD) $(LIBS)
-
-abyss-overlap$(EXEEXT): $(abyss_overlap_OBJECTS) $(abyss_overlap_DEPENDENCIES) $(EXTRA_abyss_overlap_DEPENDENCIES)
- @rm -f abyss-overlap$(EXEEXT)
- $(AM_V_CXXLD)$(abyss_overlap_LINK) $(abyss_overlap_OBJECTS) $(abyss_overlap_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_index-index.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_map-map.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_overlap-overlap.Po at am__quote@
-
-.cc.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cc.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-abyss_index-index.o: index.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_index_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_index-index.o -MD -MP -MF $(DEPDIR)/abyss_index-index.Tpo -c -o abyss_index-index.o `test -f 'index.cc' || echo '$(srcdir)/'`index.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_index-index.Tpo $(DEPDIR)/abyss_index-index.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='index.cc' object='abyss_index-index.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_index_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_index-index.o `test -f 'index.cc' || echo '$(srcdir)/'`index.cc
-
-abyss_index-index.obj: index.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_index_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_index-index.obj -MD -MP -MF $(DEPDIR)/abyss_index-index.Tpo -c -o abyss_index-index.obj `if test -f 'index.cc'; then $(CYGPATH_W) 'index.cc'; else $(CYGPATH_W) '$(srcdir)/index.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_index-index.Tpo $(DEPDIR)/abyss_index-index.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='index.cc' object='abyss_index-index.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_index_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_index-index.obj `if test -f 'index.cc'; then $(CYGPATH_W) 'index.cc'; else $(CYGPATH_W) '$(srcdir)/index.cc'; fi`
-
-abyss_map-map.o: map.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_map_CPPFLAGS) $(CPPFLAGS) $(abyss_map_CXXFLAGS) $(CXXFLAGS) -MT abyss_map-map.o -MD -MP -MF $(DEPDIR)/abyss_map-map.Tpo -c -o abyss_map-map.o `test -f 'map.cc' || echo '$(srcdir)/'`map.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_map-map.Tpo $(DEPDIR)/abyss_map-map.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='map.cc' object='abyss_map-map.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_map_CPPFLAGS) $(CPPFLAGS) $(abyss_map_CXXFLAGS) $(CXXFLAGS) -c -o abyss_map-map.o `test -f 'map.cc' || echo '$(srcdir)/'`map.cc
-
-abyss_map-map.obj: map.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_map_CPPFLAGS) $(CPPFLAGS) $(abyss_map_CXXFLAGS) $(CXXFLAGS) -MT abyss_map-map.obj -MD -MP -MF $(DEPDIR)/abyss_map-map.Tpo -c -o abyss_map-map.obj `if test -f 'map.cc'; then $(CYGPATH_W) 'map.cc'; else $(CYGPATH_W) '$(srcdir)/map.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_map-map.Tpo $(DEPDIR)/abyss_map-map.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='map.cc' object='abyss_map-map.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_map_CPPFLAGS) $(CPPFLAGS) $(abyss_map_CXXFLAGS) $(CXXFLAGS) -c -o abyss_map-map.obj `if test -f 'map.cc'; then $(CYGPATH_W) 'map.cc'; else $(CYGPATH_W) '$(srcdir)/map.cc'; fi`
-
-abyss_overlap-overlap.o: overlap.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_overlap_CPPFLAGS) $(CPPFLAGS) $(abyss_overlap_CXXFLAGS) $(CXXFLAGS) -MT abyss_overlap-overlap.o -MD -MP -MF $(DEPDIR)/abyss_overlap-overlap.Tpo -c -o abyss_overlap-overlap.o `test -f 'overlap.cc' || echo '$(srcdir)/'`overlap.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_overlap-overlap.Tpo $(DEPDIR)/abyss_overlap-overlap.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='overlap.cc' object='abyss_overlap-overlap.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_overlap_CPPFLAGS) $(CPPFLAGS) $(abyss_overlap_CXXFLAGS) $(CXXFLAGS) -c -o abyss_overlap-overlap.o `test -f 'overlap.cc' || echo '$(srcdir)/'`overlap.cc
-
-abyss_overlap-overlap.obj: overlap.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_overlap_CPPFLAGS) $(CPPFLAGS) $(abyss_overlap_CXXFLAGS) $(CXXFLAGS) -MT abyss_overlap-overlap.obj -MD -MP -MF $(DEPDIR)/abyss_overlap-overlap.Tpo -c -o abyss_overlap-overlap.obj `if test -f 'overlap.cc'; then $(CYGPATH_W) 'overlap.cc'; else $(CYGPATH_W) '$(srcdir)/overlap.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_overlap-overlap.Tpo $(DEPDIR)/abyss_overlap-overlap.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='overlap.cc' object='abyss_overlap-overlap.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_overlap_CPPFLAGS) $(CPPFLAGS) $(abyss_overlap_CXXFLAGS) $(CXXFLAGS) -c -o abyss_overlap-overlap.obj `if test -f 'overlap.cc'; then $(CYGPATH_W) 'overlap.cc'; else $(CYGPATH_W) '$(srcdir)/overlap.cc'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Map/index.cc b/Map/index.cc
index 33dfbd8..beac34a 100644
--- a/Map/index.cc
+++ b/Map/index.cc
@@ -23,7 +23,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... FILE\n"
diff --git a/Map/map.cc b/Map/map.cc
index 183405f..5cc13d1 100644
--- a/Map/map.cc
+++ b/Map/map.cc
@@ -9,6 +9,8 @@
#include "SAM.h"
#include "StringUtil.h"
#include "Uncompress.h"
+#include <boost/algorithm/string/join.hpp>
+#include <boost/tuple/tuple.hpp>
#include <algorithm>
#include <cassert>
#include <cctype> // for toupper
@@ -25,6 +27,8 @@
#endif
using namespace std;
+using namespace boost;
+using namespace boost::algorithm;
#define PROGRAM "abyss-map"
@@ -32,7 +36,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... QUERY... TARGET\n"
@@ -49,6 +53,11 @@ static const char USAGE_MESSAGE[] =
" --order print alignments in the same order as\n"
" read from QUERY\n"
" --no-order print alignments ASAP [default]\n"
+" --multi Align unaligned segments of primary\n"
+" alignment\n"
+" --no-multi don't Align unaligned segments [default]\n"
+" --SS expect contigs to be oriented correctly\n"
+" --no-SS no assumption about contig orientation\n"
" --chastity discard unchaste reads\n"
" --no-chastity do not discard unchaste reads [default]\n"
" -v, --verbose display verbose output\n"
@@ -67,9 +76,16 @@ namespace opt {
/** The number of parallel threads. */
static unsigned threads = 1;
+ /** Run a strand-specific RNA-Seq alignments. */
+ static int ss;
+
/** Identify duplicate and subsumed sequences. */
static bool dup = false;
+ /** Align unaligned segments of primary alignment. */
+ static int multi;
+
+ /** Ensure output order matches input order. */
static int order;
/** Verbose output. */
@@ -87,6 +103,10 @@ static const struct option longopts[] = {
{ "threads", required_argument, NULL, 'j' },
{ "order", no_argument, &opt::order, 1 },
{ "no-order", no_argument, &opt::order, 0 },
+ { "multi", no_argument, &opt::multi, 1 },
+ { "no-multi", no_argument, &opt::multi, 0 },
+ { "SS", no_argument, &opt::ss, 1 },
+ { "no-SS", no_argument, &opt::ss, 0 },
{ "verbose", no_argument, NULL, 'v' },
{ "chastity", no_argument, &opt::chastityFilter, 1 },
{ "no-chastity", no_argument, &opt::chastityFilter, 0 },
@@ -100,10 +120,46 @@ static struct {
unsigned unique;
unsigned multimapped;
unsigned unmapped;
+ unsigned suboptimal;
+ unsigned subunmapped;
} g_count;
typedef FMIndex::Match Match;
+#if SAM_SEQ_QUAL
+static string toXA(const FastaIndex& faIndex,
+ const FMIndex& fmIndex, const Match& m, bool rc,
+ unsigned qlength, unsigned seq_start)
+{
+ if (m.size() == 0)
+ return "";
+ FastaIndex::SeqPos seqPos = faIndex[fmIndex[m.l]];
+ string rname = seqPos.get<0>().id;
+ int pos = seqPos.get<1>() + 1;
+
+ // Set the mapq to the alignment score.
+ assert(m.qstart < m.qend);
+ unsigned matches = m.qend - m.qstart;
+
+ unsigned qstart = seq_start + m.qstart;
+ unsigned qend = m.qend + seq_start;
+ unsigned short flag = rc ? SAMAlignment::FREVERSE : 0;
+
+ ostringstream ss;
+ if (qstart > 0)
+ ss << qstart << 'S';
+ ss << matches << 'M';
+ if (qend < qlength)
+ ss << qlength - qend << 'S';
+ string cigar = ss.str();
+
+ stringstream xa_tag;
+ xa_tag << rname << ',' << pos << ',' << cigar << ",0," << flag;
+
+ return xa_tag.str();
+}
+#endif
+
/** Return a SAM record of the specified match. */
static SAMRecord toSAM(const FastaIndex& faIndex,
const FMIndex& fmIndex, const Match& m, bool rc,
@@ -126,7 +182,8 @@ static SAMRecord toSAM(const FastaIndex& faIndex,
// Set the mapq to the alignment score.
assert(m.qstart < m.qend);
unsigned matches = m.qend - m.qstart;
- a.mapq = m.size() > 1 ? 0 : min(matches, 255U);
+ assert (m.num != 0);
+ a.mapq = m.size() > 1 || m.num > 1 ? 0 : min(matches, 254U);
ostringstream ss;
if (m.qstart > 0)
@@ -186,8 +243,12 @@ static void printDuplicates(const Match& m, const Match& rcm,
const FastqRecord& rec)
{
size_t myLen = m.qspan();
- size_t maxLen = max(getMaxLen(m, faIndex, fmIndex),
- getMaxLen(rcm, faIndex, fmIndex));
+ size_t maxLen;
+ if (opt::ss)
+ maxLen = getMaxLen(m, faIndex, fmIndex);
+ else
+ maxLen = max(getMaxLen(m, faIndex, fmIndex),
+ getMaxLen(rcm, faIndex, fmIndex));
if (myLen < maxLen) {
#pragma omp atomic
g_count.multimapped++;
@@ -199,8 +260,12 @@ static void printDuplicates(const Match& m, const Match& rcm,
return;
}
size_t myPos = getMyPos(m, faIndex, fmIndex, rec.id);
- size_t minPos = min(getMinPos(m, maxLen, faIndex, fmIndex),
- getMinPos(rcm, maxLen, faIndex, fmIndex));
+ size_t minPos;
+ if (opt::ss)
+ minPos = getMinPos(m, maxLen, faIndex, fmIndex);
+ else
+ minPos = min(getMinPos(m, maxLen, faIndex, fmIndex),
+ getMinPos(rcm, maxLen, faIndex, fmIndex));
if (myPos > minPos) {
#pragma omp atomic
g_count.multimapped++;
@@ -215,6 +280,21 @@ static void printDuplicates(const Match& m, const Match& rcm,
return;
}
+pair<Match, Match> findMatch(const FMIndex& fmIndex, const string& seq)
+{
+ Match m = fmIndex.find(seq,
+ opt::dup ? seq.length() : opt::k);
+
+ string rcqseq = reverseComplement(seq);
+ Match rcm;
+ if (opt::ss)
+ rcm = fmIndex.find(rcqseq,
+ opt::dup ? rcqseq.length() : opt::k);
+ else
+ rcm = fmIndex.find(rcqseq,
+ opt::dup ? rcqseq.length() : m.qspan());
+ return make_pair(m, rcm);
+}
static queue<string> g_pq;
@@ -228,21 +308,68 @@ static void find(const FastaIndex& faIndex, const FMIndex& fmIndex,
exit(EXIT_FAILURE);
}
- Match m = fmIndex.find(rec.seq,
- opt::dup ? rec.seq.length() : opt::k);
-
- string rcqseq = reverseComplement(rec.seq);
- Match rcm = fmIndex.find(rcqseq,
- opt::dup ? rcqseq.length() : m.qspan());
+ Match m, rcm;
+ tie(m, rcm) = findMatch(fmIndex, rec.seq);
if (opt::dup) {
printDuplicates(m, rcm, faIndex, fmIndex, rec);
return;
}
- bool rc = rcm.qspan() > m.qspan();
+ bool rc;
+ if (opt::ss) {
+ rc = rec.id.size() > 2
+ && rec.id.substr(rec.id.size()-2) == "/1";
+ bool prc = rcm.qspan() > m.qspan();
+ if (prc != rc && ((rc && rcm.size() > 0)
+ || (!rc && m.size() > 0)))
+#pragma omp atomic
+ g_count.suboptimal++;
+ if (prc != rc && ((rc && rcm.size() == 0 && m.size() > 0)
+ || (!rc && m.size() == 0 && rcm.size() > 0)))
+#pragma omp atomic
+ g_count.subunmapped++;
+ } else {
+ rc = rcm.qspan() > m.qspan();
+
+ // if both matches are the same length, sum up the number of times
+ // each were seen.
+ if (rcm.qspan() == m.qspan())
+ rc ? rcm.num += m.num : m.num += rcm.num;
+ }
+
+ vector<string> alts;
+ Match mm = rc ? rcm : m;
+ string mseq = rc ? reverseComplement(rec.seq) : rec.seq;
- SAMRecord sam = toSAM(faIndex, fmIndex, rc ? rcm : m, rc,
+#if SAM_SEQ_QUAL
+ if (opt::multi) {
+ if (mm.qstart > 0) {
+ string seq = mseq.substr(0, mm.qstart);
+ Match m1, rcm1;
+ tie(m1, rcm1) = findMatch(fmIndex, seq);
+ bool rc1 = rcm1.qspan() > m1.qspan();
+ string xa = toXA(faIndex, fmIndex, rc1 ? rcm1 : m1,
+ rc ^ rc1, mseq.size(), 0);
+ if (xa != "")
+ alts.push_back(xa);
+ }
+
+ if (mm.qend < mseq.size()) {
+ string seq =
+ mseq.substr(mm.qend, mseq.length() - mm.qend);
+ Match m2, rcm2;
+ tie(m2, rcm2) = findMatch(fmIndex, seq);
+ bool rc2 = rcm2.qspan() > m2.qspan();
+ string xa = toXA(faIndex, fmIndex, rc2 ? rcm2 : m2,
+ rc ^ rc2, mseq.size(), mm.qend);
+ if (xa != "")
+ alts.push_back(xa);
+ }
+ }
+#endif
+
+ SAMRecord sam = toSAM(faIndex, fmIndex, mm, rc,
rec.seq.size());
if (rec.id[0] == '@') {
cerr << PROGRAM ": error: "
@@ -253,18 +380,12 @@ static void find(const FastaIndex& faIndex, const FMIndex& fmIndex,
sam.qname = rec.id;
#if SAM_SEQ_QUAL
- sam.seq = rc ? rcqseq : rec.seq;
+ sam.seq = mseq;
sam.qual = rec.qual.empty() ? "*" : rec.qual;
if (rc)
reverse(sam.qual.begin(), sam.qual.end());
#endif
- if (m.qstart == rec.seq.size() - rcm.qend
- && m.qspan() == rcm.qspan()) {
- // This matching sequence maps to both strands.
- sam.mapq = 0;
- }
-
bool print = opt::order == 0;
do {
#pragma omp critical(cout)
@@ -276,7 +397,12 @@ static void find(const FastaIndex& faIndex, const FMIndex& fmIndex,
g_pq.pop();
}
if (print) {
- cout << sam << '\n';
+ cout << sam;
+#if SAM_SEQ_QUAL
+ if (alts.size() > 0)
+ cout << "\tXA:Z:" << join(alts, ";");
+#endif
+ cout << '\n';
assert_good(cout, "stdout");
}
}
@@ -412,6 +538,17 @@ int main(int argc, char** argv)
}
}
+#ifndef SAM_SEQ_QUAL
+# define SAM_SEQ_QUAL 0
+#endif
+
+ if (opt::multi && !SAM_SEQ_QUAL) {
+ cerr << PROGRAM ": multiple alignments not supported with "
+ "this install. Recompile ABySS with `./configure "
+ "--enable-samseqqual'.\n";
+ die = true;
+ }
+
if (argc - optind < 2) {
cerr << PROGRAM ": missing arguments\n";
die = true;
@@ -512,6 +649,13 @@ int main(int argc, char** argv)
<< "Mapped " << unique << " of " << total
<< " reads uniquely (" << (float)100 * unique / total
<< "%)\n";
+ if (opt::ss)
+ cerr << "Mapped " << g_count.suboptimal
+ << " (" << (float)100 * g_count.suboptimal / total << "%)"
+ << " reads to the opposite strand of the optimal mapping.\n"
+ << "Made " << g_count.subunmapped << " ("
+ << (float)100 * g_count.subunmapped / total << "%)"
+ << " unmapped suboptimal decisions.\n";
}
cout.flush();
diff --git a/Map/overlap.cc b/Map/overlap.cc
index 02a63a2..e6ee16e 100644
--- a/Map/overlap.cc
+++ b/Map/overlap.cc
@@ -44,7 +44,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... FILE\n"
@@ -63,6 +63,8 @@ static const char USAGE_MESSAGE[] =
" --adj output the results in adj format\n"
" --dot output the results in dot format [default]\n"
" --sam output the results in SAM format\n"
+" --SS expect contigs to be oriented correctly\n"
+" --no-SS no assumption about contig orientation\n"
" -v, --verbose display verbose output\n"
" --help display this help and exit\n"
" --version output version information and exit\n"
@@ -79,6 +81,9 @@ namespace opt {
/** Sample the suffix array. */
static unsigned sampleSA;
+ /** Run a strand-specific overlaping algorithm. */
+ static int ss;
+
/** Remove transitive edges. */
static int tred = true;
@@ -105,6 +110,8 @@ static const struct option longopts[] = {
{ "min", required_argument, NULL, 'm' },
{ "sample", required_argument, NULL, 's' },
{ "threads", required_argument, NULL, 'j' },
+ { "SS", no_argument, &opt::ss, 1 },
+ { "no-SS", no_argument, &opt::ss, 0 },
{ "tred", no_argument, &opt::tred, true },
{ "no-tred", no_argument, &opt::tred, false },
{ "verbose", no_argument, NULL, 'v' },
@@ -135,7 +142,7 @@ static void addSuffixOverlaps(Graph &g,
const FAIRecord& tseq = seqPos.get<0>();
size_t tstart = seqPos.get<1>();
size_t tend = tstart + fmi.qspan();
- assert(tend < tseq.size);
+ assert(tend < tseq.size || tstart > 0);
(void)tend;
if (tstart > 0) {
// This match is due to an ambiguity code in the target sequence.
@@ -182,7 +189,7 @@ static void addPrefixOverlaps(Graph &g,
const FAIRecord& tseq = seqPos.get<0>();
size_t tstart = seqPos.get<1>();
size_t tend = tstart + fmi.qspan();
- assert(tstart > 0);
+ assert(tstart > 0 || tend < tseq.size);
if (tend < tseq.size) {
// This match is due to an ambiguity code in the target sequence.
continue;
@@ -215,12 +222,12 @@ static void findOverlapsSuffix(Graph &g,
? seq.size() - opt::maxOverlap + 1 : 1;
string suffix(seq, pos);
typedef vector<Match> Matches;
- vector<Match> matches;
+ Matches matches;
fmIndex.findOverlapSuffix(suffix, back_inserter(matches),
opt::minOverlap);
for (Matches::reverse_iterator it = matches.rbegin();
- it != matches.rend(); ++it)
+ !(it == matches.rend()); ++it)
addSuffixOverlaps(g, faIndex, fmIndex, u, *it);
}
@@ -233,12 +240,12 @@ static void findOverlapsPrefix(Graph &g,
string prefix(seq, 0,
min((size_t)opt::maxOverlap, seq.size()) - 1);
typedef vector<Match> Matches;
- vector<Match> matches;
+ Matches matches;
fmIndex.findOverlapPrefix(prefix, back_inserter(matches),
opt::minOverlap);
for (Matches::reverse_iterator it = matches.rbegin();
- it != matches.rend(); ++it)
+ !(it == matches.rend()); ++it)
addPrefixOverlaps(g, faIndex, fmIndex, v, *it);
}
@@ -251,11 +258,13 @@ static void findOverlaps(Graph& g,
V uc = get(vertex_complement, g, u);
// Add edges u+ -> v+ and v- -> u-
findOverlapsSuffix(g, faIndex, fmIndex, u, rec.seq);
- string rcseq = reverseComplement(rec.seq);
- // Add edges u- -> v+
- findOverlapsSuffix(g, faIndex, fmIndex, uc, rcseq);
- // Add edges v+ -> u-
- findOverlapsPrefix(g, faIndex, fmIndex, uc, rcseq);
+ if (!opt::ss) {
+ string rcseq = reverseComplement(rec.seq);
+ // Add edges u- -> v+
+ findOverlapsSuffix(g, faIndex, fmIndex, uc, rcseq);
+ // Add edges v+ -> u-
+ findOverlapsPrefix(g, faIndex, fmIndex, uc, rcseq);
+ }
}
/** Map the sequences of the specified file. */
@@ -301,7 +310,6 @@ static void buildFMIndex(FMIndex& fm, const char* path)
/** Read contigs and add vertices to the graph. */
static void addVertices(const string& path, Graph& g)
{
- typedef vertex_property<Graph>::type VP;
if (opt::verbose > 0)
cerr << "Reading `" << path << "'...\n";
ifstream in(path.c_str());
diff --git a/MergePaths/Makefile.am b/MergePaths/Makefile.am
index 764f2e7..bf07dd7 100644
--- a/MergePaths/Makefile.am
+++ b/MergePaths/Makefile.am
@@ -8,8 +8,7 @@ MergePaths_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
MergePaths_LDADD = \
$(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a \
- $(top_builddir)/Graph/libgraph.a
+ $(top_builddir)/Common/libcommon.a
MergePaths_SOURCES = \
MergePaths.cpp
@@ -21,7 +20,6 @@ MergeContigs_CPPFLAGS = -I$(top_srcdir) \
MergeContigs_LDADD = \
$(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Graph/libgraph.a \
$(top_builddir)/Align/libalign.a \
$(top_builddir)/Common/libcommon.a
@@ -35,7 +33,6 @@ PathConsensus_CPPFLAGS = -I$(top_srcdir) \
PathConsensus_LDADD = \
$(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Graph/libgraph.a \
$(top_builddir)/Align/libalign.a \
$(top_builddir)/Common/libcommon.a \
$(top_builddir)/dialign/libdialign.a
diff --git a/MergePaths/Makefile.in b/MergePaths/Makefile.in
deleted file mode 100644
index 4b85d98..0000000
--- a/MergePaths/Makefile.in
+++ /dev/null
@@ -1,676 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = MergePaths$(EXEEXT) MergeContigs$(EXEEXT) \
- PathConsensus$(EXEEXT)
-subdir = MergePaths
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_MergeContigs_OBJECTS = MergeContigs-MergeContigs.$(OBJEXT)
-MergeContigs_OBJECTS = $(am_MergeContigs_OBJECTS)
-MergeContigs_DEPENDENCIES = $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/Align/libalign.a \
- $(top_builddir)/Common/libcommon.a
-am_MergePaths_OBJECTS = MergePaths-MergePaths.$(OBJEXT)
-MergePaths_OBJECTS = $(am_MergePaths_OBJECTS)
-MergePaths_DEPENDENCIES = $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a \
- $(top_builddir)/Graph/libgraph.a
-MergePaths_LINK = $(CXXLD) $(MergePaths_CXXFLAGS) $(CXXFLAGS) \
- $(AM_LDFLAGS) $(LDFLAGS) -o $@
-am_PathConsensus_OBJECTS = PathConsensus-PathConsensus.$(OBJEXT)
-PathConsensus_OBJECTS = $(am_PathConsensus_OBJECTS)
-PathConsensus_DEPENDENCIES = $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/Align/libalign.a \
- $(top_builddir)/Common/libcommon.a \
- $(top_builddir)/dialign/libdialign.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(MergeContigs_SOURCES) $(MergePaths_SOURCES) \
- $(PathConsensus_SOURCES)
-DIST_SOURCES = $(MergeContigs_SOURCES) $(MergePaths_SOURCES) \
- $(PathConsensus_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-MergePaths_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-MergePaths_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
-MergePaths_LDADD = \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a \
- $(top_builddir)/Graph/libgraph.a
-
-MergePaths_SOURCES = \
- MergePaths.cpp
-
-MergeContigs_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Align \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-MergeContigs_LDADD = \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/Align/libalign.a \
- $(top_builddir)/Common/libcommon.a
-
-MergeContigs_SOURCES = MergeContigs.cpp
-PathConsensus_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Align \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer \
- -I$(top_srcdir)/SimpleGraph
-
-PathConsensus_LDADD = \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/Align/libalign.a \
- $(top_builddir)/Common/libcommon.a \
- $(top_builddir)/dialign/libdialign.a
-
-PathConsensus_SOURCES = \
- PathConsensus.cpp
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign MergePaths/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign MergePaths/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-MergeContigs$(EXEEXT): $(MergeContigs_OBJECTS) $(MergeContigs_DEPENDENCIES) $(EXTRA_MergeContigs_DEPENDENCIES)
- @rm -f MergeContigs$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(MergeContigs_OBJECTS) $(MergeContigs_LDADD) $(LIBS)
-
-MergePaths$(EXEEXT): $(MergePaths_OBJECTS) $(MergePaths_DEPENDENCIES) $(EXTRA_MergePaths_DEPENDENCIES)
- @rm -f MergePaths$(EXEEXT)
- $(AM_V_CXXLD)$(MergePaths_LINK) $(MergePaths_OBJECTS) $(MergePaths_LDADD) $(LIBS)
-
-PathConsensus$(EXEEXT): $(PathConsensus_OBJECTS) $(PathConsensus_DEPENDENCIES) $(EXTRA_PathConsensus_DEPENDENCIES)
- @rm -f PathConsensus$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(PathConsensus_OBJECTS) $(PathConsensus_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/MergeContigs-MergeContigs.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/MergePaths-MergePaths.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/PathConsensus-PathConsensus.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-MergeContigs-MergeContigs.o: MergeContigs.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(MergeContigs_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT MergeContigs-MergeContigs.o -MD -MP -MF $(DEPDIR)/MergeContigs-MergeContigs.Tpo -c -o MergeContigs-MergeContigs.o `test -f 'MergeContigs.cpp' || echo '$(srcdir)/'`MergeContigs.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/MergeContigs-MergeContigs.Tpo $(DEPDIR)/MergeContigs-MergeContigs.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='MergeContigs.cpp' object='MergeContigs-MergeContigs.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(MergeContigs_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o MergeContigs-MergeContigs.o `test -f 'MergeContigs.cpp' || echo '$(srcdir)/'`MergeContigs.cpp
-
-MergeContigs-MergeContigs.obj: MergeContigs.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(MergeContigs_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT MergeContigs-MergeContigs.obj -MD -MP -MF $(DEPDIR)/MergeContigs-MergeContigs.Tpo -c -o MergeContigs-MergeContigs.obj `if test -f 'MergeContigs.cpp'; then $(CYGPATH_W) 'MergeContigs.cpp'; else $(CYGPATH_W) '$(srcdir)/MergeContigs.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/MergeContigs-MergeContigs.Tpo $(DEPDIR)/MergeContigs-MergeContigs.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='MergeContigs.cpp' object='MergeContigs-MergeContigs.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(MergeContigs_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o MergeContigs-MergeContigs.obj `if test -f 'MergeContigs.cpp'; then $(CYGPATH_W) 'MergeContigs.cpp'; else $(CYGPATH_W) '$(srcdir)/MergeContigs.cpp'; fi`
-
-MergePaths-MergePaths.o: MergePaths.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(MergePaths_CPPFLAGS) $(CPPFLAGS) $(MergePaths_CXXFLAGS) $(CXXFLAGS) -MT MergePaths-MergePaths.o -MD -MP -MF $(DEPDIR)/MergePaths-MergePaths.Tpo -c -o MergePaths-MergePaths.o `test -f 'MergePaths.cpp' || echo '$(srcdir)/'`MergePaths.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/MergePaths-MergePaths.Tpo $(DEPDIR)/MergePaths-MergePaths.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='MergePaths.cpp' object='MergePaths-MergePaths.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(MergePaths_CPPFLAGS) $(CPPFLAGS) $(MergePaths_CXXFLAGS) $(CXXFLAGS) -c -o MergePaths-MergePaths.o `test -f 'MergePaths.cpp' || echo '$(srcdir)/'`MergePaths.cpp
-
-MergePaths-MergePaths.obj: MergePaths.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(MergePaths_CPPFLAGS) $(CPPFLAGS) $(MergePaths_CXXFLAGS) $(CXXFLAGS) -MT MergePaths-MergePaths.obj -MD -MP -MF $(DEPDIR)/MergePaths-MergePaths.Tpo -c -o MergePaths-MergePaths.obj `if test -f 'MergePaths.cpp'; then $(CYGPATH_W) 'MergePaths.cpp'; else $(CYGPATH_W) '$(srcdir)/MergePaths.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/MergePaths-MergePaths.Tpo $(DEPDIR)/MergePaths-MergePaths.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='MergePaths.cpp' object='MergePaths-MergePaths.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(MergePaths_CPPFLAGS) $(CPPFLAGS) $(MergePaths_CXXFLAGS) $(CXXFLAGS) -c -o MergePaths-MergePaths.obj `if test -f 'MergePaths.cpp'; then $(CYGPATH_W) 'MergePaths.cpp'; else $(CYGPATH_W) '$(srcdir)/MergePaths.cpp'; fi`
-
-PathConsensus-PathConsensus.o: PathConsensus.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PathConsensus_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT PathConsensus-PathConsensus.o -MD -MP -MF $(DEPDIR)/PathConsensus-PathConsensus.Tpo -c -o PathConsensus-PathConsensus.o `test -f 'PathConsensus.cpp' || echo '$(srcdir)/'`PathConsensus.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/PathConsensus-PathConsensus.Tpo $(DEPDIR)/PathConsensus-PathConsensus.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='PathConsensus.cpp' object='PathConsensus-PathConsensus.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PathConsensus_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o PathConsensus-PathConsensus.o `test -f 'PathConsensus.cpp' || echo '$(srcdir)/'`PathConsensus.cpp
-
-PathConsensus-PathConsensus.obj: PathConsensus.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PathConsensus_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT PathConsensus-PathConsensus.obj -MD -MP -MF $(DEPDIR)/PathConsensus-PathConsensus.Tpo -c -o PathConsensus-PathConsensus.obj `if test -f 'PathConsensus.cpp'; then $(CYGPATH_W) 'PathConsensus.cpp'; else $(CYGPATH_W) '$(srcdir)/PathConsensus.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/PathConsensus-PathConsensus.Tpo $(DEPDIR)/PathConsensus-PathConsensus.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='PathConsensus.cpp' object='PathConsensus-PathConsensus.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PathConsensus_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o PathConsensus-PathConsensus.obj `if test -f 'PathConsensus.cpp'; then $(CYGPATH_W) 'PathConsensus.cpp'; else $(CYGPATH_W) '$(srcdir)/PathConsensus.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/MergePaths/MergeContigs.cpp b/MergePaths/MergeContigs.cpp
index 5f1e3e0..fe3612c 100644
--- a/MergePaths/MergeContigs.cpp
+++ b/MergePaths/MergeContigs.cpp
@@ -38,10 +38,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... FASTA [OVERLAP] PATH\n"
+"Usage: " PROGRAM " -k<kmer> -o<out.fa> [OPTION]... FASTA [OVERLAP] PATH\n"
"Merge paths of contigs to create larger contigs.\n"
"\n"
" Arguments:\n"
diff --git a/MergePaths/MergePaths.cpp b/MergePaths/MergePaths.cpp
index 09d12ab..9e3e939 100644
--- a/MergePaths/MergePaths.cpp
+++ b/MergePaths/MergePaths.cpp
@@ -42,10 +42,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Jared Simpson and Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... LEN PATH\n"
+"Usage: " PROGRAM " -k<kmer> [OPTION]... LEN PATH\n"
"Merge sequences of contigs IDs.\n"
"\n"
" Arguments:\n"
diff --git a/MergePaths/PathConsensus.cpp b/MergePaths/PathConsensus.cpp
index dd2d9c2..09a90b1 100644
--- a/MergePaths/PathConsensus.cpp
+++ b/MergePaths/PathConsensus.cpp
@@ -28,6 +28,7 @@
#include <vector>
using namespace std;
+using boost::tie;
#define PROGRAM "PathConsensus"
@@ -35,10 +36,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman and Rong She.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... FASTA ADJ PATH\n"
+"Usage: " PROGRAM " -k<kmer> -s<consensus.fa> -o<out.path> [OPTION]... FASTA ADJ PATH\n"
"Align sequences of ambiguous paths and output a consensus\n"
"sequence.\n"
"\n"
@@ -145,6 +146,7 @@ struct AmbPathConstraint {
}
};
+typedef ContigGraph<DirectedGraph<ContigProperties, Distance> > Graph;
typedef ContigPath Path;
typedef vector<Path> ContigPaths;
typedef map<AmbPathConstraint, ContigPath> AmbPath2Contig;
@@ -188,8 +190,6 @@ static int getDistance(const Graph& g,
static ContigPaths readPaths(const string& inPath,
vector<string>& ids, vector<bool>& isAmb)
{
- typedef graph_traits<Graph>::vertex_descriptor V;
-
assert(ids.empty());
assert(isAmb.empty());
assert(g_ambpath_contig.empty());
@@ -600,9 +600,11 @@ static ContigPath alignMulti(const Graph& g,
return ContigPath();
}
- string alignment;
- unsigned matches;
- Sequence consensus = dialign(amb_seqs, alignment, matches);
+ unsigned matches, consensusSize;
+ NWAlignment alignment;
+ tie(matches, consensusSize) = align(amb_seqs, alignment);
+ string consensus = alignment.consensus();
+
if (opt::verbose > 2)
cerr << alignment << consensus << '\n';
float identity = (float)matches / consensus.size();
diff --git a/Misc/Makefile.am b/Misc/Makefile.am
index cb7230a..78a35c5 100644
--- a/Misc/Makefile.am
+++ b/Misc/Makefile.am
@@ -1,4 +1,4 @@
-if HAVE_GHC
+if HAVE_GHC_MMAP
bin_PROGRAMS = abyss-samtobreak
endif
diff --git a/Misc/Makefile.in b/Misc/Makefile.in
deleted file mode 100644
index 575213c..0000000
--- a/Misc/Makefile.in
+++ /dev/null
@@ -1,538 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
- at HAVE_GHC_TRUE@bin_PROGRAMS = abyss-samtobreak$(EXEEXT)
-subdir = Misc
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_abyss_samtobreak_OBJECTS =
-abyss_samtobreak_OBJECTS = $(am_abyss_samtobreak_OBJECTS)
-abyss_samtobreak_LDADD = $(LDADD)
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(abyss_samtobreak_SOURCES)
-DIST_SOURCES = $(abyss_samtobreak_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-abyss_samtobreak_SOURCES = samtobreak.hs
-CLEANFILES = *.hi
-GHC_FLAGS = -O2
-all: all-am
-
-.SUFFIXES:
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Misc/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Misc/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
- -test -z "$(CLEANFILES)" || rm -f $(CLEANFILES)
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-abyss-samtobreak$(EXEEXT): $(abyss_samtobreak_SOURCES)
- $(GHC) --make $(GHC_FLAGS) -hidir $(dir $@) -odir $(dir $@) -o $@ $^
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Overlap/Makefile.am b/Overlap/Makefile.am
index 3d6fd5f..f657fbd 100644
--- a/Overlap/Makefile.am
+++ b/Overlap/Makefile.am
@@ -5,7 +5,6 @@ Overlap_CPPFLAGS = -I$(top_srcdir) \
-I$(top_srcdir)/DataLayer
Overlap_LDADD = \
- $(top_builddir)/Graph/libgraph.a \
$(top_builddir)/DataLayer/libdatalayer.a \
$(top_builddir)/Common/libcommon.a
diff --git a/Overlap/Makefile.in b/Overlap/Makefile.in
deleted file mode 100644
index b807ba5..0000000
--- a/Overlap/Makefile.in
+++ /dev/null
@@ -1,591 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = Overlap$(EXEEXT)
-subdir = Overlap
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_Overlap_OBJECTS = Overlap-Overlap.$(OBJEXT)
-Overlap_OBJECTS = $(am_Overlap_OBJECTS)
-Overlap_DEPENDENCIES = $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(Overlap_SOURCES)
-DIST_SOURCES = $(Overlap_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-Overlap_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-Overlap_LDADD = \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Common/libcommon.a
-
-Overlap_SOURCES = \
- Overlap.cpp
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Overlap/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Overlap/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-Overlap$(EXEEXT): $(Overlap_OBJECTS) $(Overlap_DEPENDENCIES) $(EXTRA_Overlap_DEPENDENCIES)
- @rm -f Overlap$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(Overlap_OBJECTS) $(Overlap_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/Overlap-Overlap.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-Overlap-Overlap.o: Overlap.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(Overlap_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT Overlap-Overlap.o -MD -MP -MF $(DEPDIR)/Overlap-Overlap.Tpo -c -o Overlap-Overlap.o `test -f 'Overlap.cpp' || echo '$(srcdir)/'`Overlap.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/Overlap-Overlap.Tpo $(DEPDIR)/Overlap-Overlap.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Overlap.cpp' object='Overlap-Overlap.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(Overlap_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o Overlap-Overlap.o `test -f 'Overlap.cpp' || echo '$(srcdir)/'`Overlap.cpp
-
-Overlap-Overlap.obj: Overlap.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(Overlap_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT Overlap-Overlap.obj -MD -MP -MF $(DEPDIR)/Overlap-Overlap.Tpo -c -o Overlap-Overlap.obj `if test -f 'Overlap.cpp'; then $(CYGPATH_W) 'Overlap.cpp'; else $(CYGPATH_W) '$(srcdir)/Overlap.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/Overlap-Overlap.Tpo $(DEPDIR)/Overlap-Overlap.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Overlap.cpp' object='Overlap-Overlap.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(Overlap_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o Overlap-Overlap.obj `if test -f 'Overlap.cpp'; then $(CYGPATH_W) 'Overlap.cpp'; else $(CYGPATH_W) '$(srcdir)/Overlap.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Overlap/Overlap.cpp b/Overlap/Overlap.cpp
index d4f1303..75f75b5 100644
--- a/Overlap/Overlap.cpp
+++ b/Overlap/Overlap.cpp
@@ -32,10 +32,6 @@
using namespace std;
using namespace boost::lambda;
-#if !__GXX_EXPERIMENTAL_CXX0X__
-using boost::cref;
-using boost::ref;
-#endif
#define PROGRAM "Overlap"
@@ -43,10 +39,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... CONTIGS ADJ DIST\n"
+"Usage: " PROGRAM " -k<kmer> -o<out.fa> [OPTION]... CONTIGS ADJ DIST\n"
"Find overlaps between blunt contigs that have negative distance\n"
"estimates. Add edges to the overlap graph.\n"
"\n"
@@ -60,6 +56,8 @@ static const char USAGE_MESSAGE[] =
" --mask-repeat join contigs at a simple repeat and mask\n"
" the repeat sequence [default]\n"
" --no-merge-repeat don't join contigs at a repeat\n"
+" --SS expect contigs to be oriented correctly\n"
+" --no-SS no assumption about contig orientation [default]\n"
" -g, --graph=FILE write the contig adjacency graph to FILE\n"
" -o, --out=FILE write result to FILE\n"
" -v, --verbose display verbose output\n"
@@ -74,6 +72,9 @@ namespace opt {
static int mask = 1;
static int scaffold = 1;
+ /** Run a strand-specific RNA-Seq assembly. */
+ static int ss;
+
/** The acceptable error of a distance estimate. */
unsigned distanceError = 6;
@@ -98,6 +99,8 @@ static const struct option longopts[] = {
{ "no-scaffold", no_argument, &opt::scaffold, 0 },
{ "mask-repeat", no_argument, &opt::mask, 1 },
{ "no-merge-repeat", no_argument, &opt::mask, 0 },
+ { "SS", no_argument, &opt::ss, 1 },
+ { "no-SS", no_argument, &opt::ss, 0 },
{ "out", required_argument, NULL, 'o' },
{ "verbose", no_argument, NULL, 'v' },
{ "help", no_argument, NULL, OPT_HELP },
@@ -436,7 +439,8 @@ int main(int argc, char** argv)
printGraphStats(cout, scaffoldGraph);
remove_edge_if(
!bind(checkEdgeForOverlap,
- cref(graph), ref(scaffoldGraph), _1),
+ boost::cref(graph), boost::ref(scaffoldGraph),
+ _1),
static_cast<OverlapGraph::base_type&>(scaffoldGraph));
} else {
// dist graph format
@@ -537,8 +541,13 @@ int main(int argc, char** argv)
// This edge is not scaffolded.
} else if (contiguous_out(scaffoldGraph, t)) {
assert(*adjacent_vertices(t, scaffoldGraph).first == h);
+ ContigNode t1 = t, h1 = h;
+ if (opt::ss && t.sense() && h.sense()) {
+ t1 = h ^ true;
+ h1 = t ^ true;
+ }
FastaRecord contig = createGapContig(graph,
- t, h, overlap);
+ t1, h1, overlap);
out << contig;
assert(out.good());
@@ -546,8 +555,8 @@ int main(int argc, char** argv)
vertex_descriptor v = add_vertex(
ContigProperties(contig.seq.length(), 0), graph);
put(vertex_name, graph, v, contig.id);
- add_edge(t, v, graph);
- add_edge(v, h, graph);
+ add_edge(t1, v, graph);
+ add_edge(v, h1, graph);
} else
stats.ambiguous++;
}
diff --git a/Parallel/Makefile.in b/Parallel/Makefile.in
deleted file mode 100644
index 0fc127f..0000000
--- a/Parallel/Makefile.in
+++ /dev/null
@@ -1,673 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = ABYSS-P$(EXEEXT)
-subdir = Parallel
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_ABYSS_P_OBJECTS = ABYSS_P-parallelAbyss.$(OBJEXT) \
- ABYSS_P-CommLayer.$(OBJEXT) \
- ABYSS_P-NetworkSequenceCollection.$(OBJEXT) \
- ABYSS_P-MessageBuffer.$(OBJEXT) ABYSS_P-Messages.$(OBJEXT)
-ABYSS_P_OBJECTS = $(am_ABYSS_P_OBJECTS)
-am__DEPENDENCIES_1 =
-ABYSS_P_DEPENDENCIES = $(top_builddir)/Assembly/libassembly.a \
- $(top_builddir)/Common/libcommon.a \
- $(top_builddir)/DataLayer/libdatalayer.a $(am__DEPENDENCIES_1)
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(ABYSS_P_SOURCES)
-DIST_SOURCES = $(ABYSS_P_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-ABYSS_P_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Assembly \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-ABYSS_P_LDADD = \
- $(top_builddir)/Assembly/libassembly.a \
- $(top_builddir)/Common/libcommon.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(MPI_LIBS)
-
-ABYSS_P_SOURCES = \
- parallelAbyss.cpp \
- CommLayer.cpp CommLayer.h \
- NetworkSequenceCollection.cpp NetworkSequenceCollection.h \
- MessageBuffer.cpp MessageBuffer.h \
- Messages.cpp Messages.h
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Parallel/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Parallel/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-ABYSS-P$(EXEEXT): $(ABYSS_P_OBJECTS) $(ABYSS_P_DEPENDENCIES) $(EXTRA_ABYSS_P_DEPENDENCIES)
- @rm -f ABYSS-P$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(ABYSS_P_OBJECTS) $(ABYSS_P_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/ABYSS_P-CommLayer.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/ABYSS_P-MessageBuffer.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/ABYSS_P-Messages.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/ABYSS_P-NetworkSequenceCollection.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/ABYSS_P-parallelAbyss.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-ABYSS_P-parallelAbyss.o: parallelAbyss.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS_P-parallelAbyss.o -MD -MP -MF $(DEPDIR)/ABYSS_P-parallelAbyss.Tpo -c -o ABYSS_P-parallelAbyss.o `test -f 'parallelAbyss.cpp' || echo '$(srcdir)/'`parallelAbyss.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS_P-parallelAbyss.Tpo $(DEPDIR)/ABYSS_P-parallelAbyss.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='parallelAbyss.cpp' object='ABYSS_P-parallelAbyss.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS_P-parallelAbyss.o `test -f 'parallelAbyss.cpp' || echo '$(srcdir)/'`parallelAbyss.cpp
-
-ABYSS_P-parallelAbyss.obj: parallelAbyss.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS_P-parallelAbyss.obj -MD -MP -MF $(DEPDIR)/ABYSS_P-parallelAbyss.Tpo -c -o ABYSS_P-parallelAbyss.obj `if test -f 'parallelAbyss.cpp'; then $(CYGPATH_W) 'parallelAbyss.cpp'; else $(CYGPATH_W) '$(srcdir)/parallelAbyss.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS_P-parallelAbyss.Tpo $(DEPDIR)/ABYSS_P-parallelAbyss.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='parallelAbyss.cpp' object='ABYSS_P-parallelAbyss.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS_P-parallelAbyss.obj `if test -f 'parallelAbyss.cpp'; then $(CYGPATH_W) 'parallelAbyss.cpp'; else $(CYGPATH_W) '$(srcdir)/parallelAbyss.cpp'; fi`
-
-ABYSS_P-CommLayer.o: CommLayer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS_P-CommLayer.o -MD -MP -MF $(DEPDIR)/ABYSS_P-CommLayer.Tpo -c -o ABYSS_P-CommLayer.o `test -f 'CommLayer.cpp' || echo '$(srcdir)/'`CommLayer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS_P-CommLayer.Tpo $(DEPDIR)/ABYSS_P-CommLayer.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='CommLayer.cpp' object='ABYSS_P-CommLayer.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS_P-CommLayer.o `test -f 'CommLayer.cpp' || echo '$(srcdir)/'`CommLayer.cpp
-
-ABYSS_P-CommLayer.obj: CommLayer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS_P-CommLayer.obj -MD -MP -MF $(DEPDIR)/ABYSS_P-CommLayer.Tpo -c -o ABYSS_P-CommLayer.obj `if test -f 'CommLayer.cpp'; then $(CYGPATH_W) 'CommLayer.cpp'; else $(CYGPATH_W) '$(srcdir)/CommLayer.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS_P-CommLayer.Tpo $(DEPDIR)/ABYSS_P-CommLayer.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='CommLayer.cpp' object='ABYSS_P-CommLayer.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS_P-CommLayer.obj `if test -f 'CommLayer.cpp'; then $(CYGPATH_W) 'CommLayer.cpp'; else $(CYGPATH_W) '$(srcdir)/CommLayer.cpp'; fi`
-
-ABYSS_P-NetworkSequenceCollection.o: NetworkSequenceCollection.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS_P-NetworkSequenceCollection.o -MD -MP -MF $(DEPDIR)/ABYSS_P-NetworkSequenceCollection.Tpo -c -o ABYSS_P-NetworkSequenceCollection.o `test -f 'NetworkSequenceCollection.cpp' || echo '$(srcdir)/'`NetworkSequenceCollection.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS_P-NetworkSequenceCollection.Tpo $(DEPDIR)/ABYSS_P-NetworkSequenceCollection.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='NetworkSequenceCollection.cpp' object='ABYSS_P-NetworkSequenceCollection.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS_P-NetworkSequenceCollection.o `test -f 'NetworkSequenceCollection.cpp' || echo '$(srcdir)/'`NetworkSequenceCollection.cpp
-
-ABYSS_P-NetworkSequenceCollection.obj: NetworkSequenceCollection.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS_P-NetworkSequenceCollection.obj -MD -MP -MF $(DEPDIR)/ABYSS_P-NetworkSequenceCollection.Tpo -c -o ABYSS_P-NetworkSequenceCollection.obj `if test -f 'NetworkSequenceCollection.cpp'; then $(CYGPATH_W) 'NetworkSequenceCollection.cpp'; else $(CYGPATH_W) '$(srcdir)/NetworkSequenceCollection.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS_P-NetworkSequenceCollection.Tpo $(DEPDIR)/ABYSS_P-NetworkSequenceCollection.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='NetworkSequenceCollection.cpp' object='ABYSS_P-NetworkSequenceCollection.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS_P-NetworkSequenceCollection.obj `if test -f 'NetworkSequenceCollection.cpp'; then $(CYGPATH_W) 'NetworkSequenceCollection.cpp'; else $(CYGPATH_W) '$(srcdir)/NetworkSequenceCollection.cpp'; fi`
-
-ABYSS_P-MessageBuffer.o: MessageBuffer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS_P-MessageBuffer.o -MD -MP -MF $(DEPDIR)/ABYSS_P-MessageBuffer.Tpo -c -o ABYSS_P-MessageBuffer.o `test -f 'MessageBuffer.cpp' || echo '$(srcdir)/'`MessageBuffer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS_P-MessageBuffer.Tpo $(DEPDIR)/ABYSS_P-MessageBuffer.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='MessageBuffer.cpp' object='ABYSS_P-MessageBuffer.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS_P-MessageBuffer.o `test -f 'MessageBuffer.cpp' || echo '$(srcdir)/'`MessageBuffer.cpp
-
-ABYSS_P-MessageBuffer.obj: MessageBuffer.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS_P-MessageBuffer.obj -MD -MP -MF $(DEPDIR)/ABYSS_P-MessageBuffer.Tpo -c -o ABYSS_P-MessageBuffer.obj `if test -f 'MessageBuffer.cpp'; then $(CYGPATH_W) 'MessageBuffer.cpp'; else $(CYGPATH_W) '$(srcdir)/MessageBuffer.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS_P-MessageBuffer.Tpo $(DEPDIR)/ABYSS_P-MessageBuffer.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='MessageBuffer.cpp' object='ABYSS_P-MessageBuffer.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS_P-MessageBuffer.obj `if test -f 'MessageBuffer.cpp'; then $(CYGPATH_W) 'MessageBuffer.cpp'; else $(CYGPATH_W) '$(srcdir)/MessageBuffer.cpp'; fi`
-
-ABYSS_P-Messages.o: Messages.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS_P-Messages.o -MD -MP -MF $(DEPDIR)/ABYSS_P-Messages.Tpo -c -o ABYSS_P-Messages.o `test -f 'Messages.cpp' || echo '$(srcdir)/'`Messages.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS_P-Messages.Tpo $(DEPDIR)/ABYSS_P-Messages.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Messages.cpp' object='ABYSS_P-Messages.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS_P-Messages.o `test -f 'Messages.cpp' || echo '$(srcdir)/'`Messages.cpp
-
-ABYSS_P-Messages.obj: Messages.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ABYSS_P-Messages.obj -MD -MP -MF $(DEPDIR)/ABYSS_P-Messages.Tpo -c -o ABYSS_P-Messages.obj `if test -f 'Messages.cpp'; then $(CYGPATH_W) 'Messages.cpp'; else $(CYGPATH_W) '$(srcdir)/Messages.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ABYSS_P-Messages.Tpo $(DEPDIR)/ABYSS_P-Messages.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='Messages.cpp' object='ABYSS_P-Messages.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ABYSS_P_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ABYSS_P-Messages.obj `if test -f 'Messages.cpp'; then $(CYGPATH_W) 'Messages.cpp'; else $(CYGPATH_W) '$(srcdir)/Messages.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Parallel/NetworkSequenceCollection.cpp b/Parallel/NetworkSequenceCollection.cpp
index e4a39c3..c673958 100644
--- a/Parallel/NetworkSequenceCollection.cpp
+++ b/Parallel/NetworkSequenceCollection.cpp
@@ -79,6 +79,7 @@ void NetworkSequenceCollection::run()
logger(0) << "Loaded " << m_data.size()
<< " k-mer.\n";
assert(!m_data.empty());
+ m_data.setDeletedKey();
m_data.shrink();
m_comm.reduce(m_data.size());
@@ -437,6 +438,7 @@ void NetworkSequenceCollection::runControl()
logger(0) << "Loaded " << m_data.size()
<< " k-mer.\n";
assert(!m_data.empty() || opt::numProc >= DEDICATE_CONTROL_AT);
+ m_data.setDeletedKey();
m_data.shrink();
size_t numLoaded = m_comm.reduce(m_data.size());
cout << "Loaded " << numLoaded << " k-mer. "
@@ -1196,7 +1198,8 @@ processBranchesAssembly(ISequenceCollection* seqCollection,
assert(branch.getState() == BS_NOEXT
|| branch.getState() == BS_AMBI_SAME
|| branch.getState() == BS_AMBI_OPP);
- if (branch.isCanonical()) {
+ if ((opt::ss && branch.getDirection() == SENSE)
+ || (!opt::ss && branch.isCanonical())) {
assembledContigs++;
assembledKmer += branch.size();
assembleContig(seqCollection, fileWriter, branch,
diff --git a/Parallel/parallelAbyss.cpp b/Parallel/parallelAbyss.cpp
index dbdaced..b000bc9 100644
--- a/Parallel/parallelAbyss.cpp
+++ b/Parallel/parallelAbyss.cpp
@@ -3,6 +3,7 @@
#include "NetworkSequenceCollection.h"
#include "Assembly/Options.h"
#include "Common/Options.h"
+#include "DataLayer/FastaReader.h"
#include "Timer.h"
#include "Uncompress.h"
#include <cerrno>
@@ -18,38 +19,39 @@
using namespace std;
-/** Execute a shell command and check its return status. */
-static void systemx(const string& command)
-{
- if (opt::verbose > 0)
- cout << command << endl;
- int ret = system(command.c_str());
- if (ret == 0)
- return;
- cerr << "error: command failed: `" << command << "'\n";
- if (ret == -1)
- cerr << "system() failed: " << strerror(errno) << endl;
- exit(ret == -1 ? EXIT_FAILURE : ret);
-}
+static const char* FASTA_SUFFIX = ".fa";
-/** Concatenate files using the specified command and remove them. */
-static void concatenateFiles(const string& dest,
- const string& prefix, const string& suffix,
- const string& command = "cat")
+static void mergeFastaFiles(const string& outputPath, const string& inputPathPrefix, bool generateNewIds = false)
{
- cout << "Concatenating to " << dest << endl;
- ostringstream s;
- s << command;
- for (int i = 0; i < opt::numProc; i++)
- s << ' ' << prefix << i << suffix;
- s << " >'" << dest << '\'';
- systemx(s.str());
+ cout << "Concatenating fasta files to " << outputPath << endl;
+
+ // write merged FASTA file
+
+ FastaWriter writer(outputPath.c_str());
+ uint64_t seqid = 0;
+ for(int i = 0; i < opt::numProc; i++) {
+ ostringstream filename;
+ filename << inputPathPrefix << i << FASTA_SUFFIX;
+ assert(filename.good());
+ string str(filename.str());
+ FastaReader reader(str.c_str(), FastaReader::NO_FOLD_CASE);
+ for (FastaRecord rec; reader >> rec;) {
+ if (generateNewIds)
+ writer.WriteSequence(rec.seq, seqid++, rec.comment);
+ else
+ writer.WriteSequence(rec.seq, rec.id, rec.comment);
+ }
+ assert(reader.eof());
+ }
+
+ // remove temp FASTA files
bool die = false;
for (int i = 0; i < opt::numProc; i++) {
- s.str("");
- s << prefix << i << suffix;
- const char* path = s.str().c_str();
+ ostringstream s;
+ s << inputPathPrefix << i << FASTA_SUFFIX;
+ string str(s.str());
+ const char* path = str.c_str();
if (unlink(path) == -1) {
cerr << "error: removing `" << path << "': "
<< strerror(errno) << endl;
@@ -97,10 +99,9 @@ int main(int argc, char** argv)
MPI_Finalize();
if (opt::rank == 0) {
- concatenateFiles(opt::contigsPath, "contigs-", ".fa",
- "awk '/^>/ { $1=\">\" i++ } { print }'");
+ mergeFastaFiles(opt::contigsPath, "contigs-", true);
if (!opt::snpPath.empty())
- concatenateFiles(opt::snpPath, "snp-", ".fa");
+ mergeFastaFiles(opt::snpPath, "snp-");
cout << "Done." << endl;
}
diff --git a/ParseAligns/Makefile.am b/ParseAligns/Makefile.am
index dfb7ca2..c574c86 100644
--- a/ParseAligns/Makefile.am
+++ b/ParseAligns/Makefile.am
@@ -1,4 +1,4 @@
-bin_PROGRAMS = abyss-fixmate ParseAligns
+bin_PROGRAMS = abyss-fixmate abyss-fixmate-ssq ParseAligns
abyss_fixmate_CPPFLAGS= -I$(top_srcdir) \
-I$(top_srcdir)/Common
@@ -8,6 +8,13 @@ abyss_fixmate_LDADD= \
abyss_fixmate_SOURCES=abyss-fixmate.cc
+abyss_fixmate_ssq_CPPFLAGS = $(abyss_fixmate_CPPFLAGS) \
+ -D SAM_SEQ_QUAL=1
+
+abyss_fixmate_ssq_LDADD = $(abyss_fixmate_LDADD)
+
+abyss_fixmate_ssq_SOURCES = $(abyss_fixmate_SOURCES)
+
ParseAligns_CPPFLAGS = -I$(top_srcdir) \
-I$(top_srcdir)/Common
diff --git a/ParseAligns/Makefile.in b/ParseAligns/Makefile.in
deleted file mode 100644
index 1f80d62..0000000
--- a/ParseAligns/Makefile.in
+++ /dev/null
@@ -1,629 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = abyss-fixmate$(EXEEXT) ParseAligns$(EXEEXT)
-subdir = ParseAligns
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_ParseAligns_OBJECTS = ParseAligns-ParseAligns.$(OBJEXT)
-ParseAligns_OBJECTS = $(am_ParseAligns_OBJECTS)
-ParseAligns_DEPENDENCIES = $(top_builddir)/Common/libcommon.a
-am_abyss_fixmate_OBJECTS = abyss_fixmate-abyss-fixmate.$(OBJEXT)
-abyss_fixmate_OBJECTS = $(am_abyss_fixmate_OBJECTS)
-abyss_fixmate_DEPENDENCIES = $(top_builddir)/Common/libcommon.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(ParseAligns_SOURCES) $(abyss_fixmate_SOURCES)
-DIST_SOURCES = $(ParseAligns_SOURCES) $(abyss_fixmate_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-abyss_fixmate_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common
-
-abyss_fixmate_LDADD = \
- $(top_builddir)/Common/libcommon.a
-
-abyss_fixmate_SOURCES = abyss-fixmate.cc
-ParseAligns_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common
-
-ParseAligns_LDADD = \
- $(top_builddir)/Common/libcommon.a
-
-ParseAligns_SOURCES = \
- ParseAligns.cpp
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cc .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign ParseAligns/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign ParseAligns/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-ParseAligns$(EXEEXT): $(ParseAligns_OBJECTS) $(ParseAligns_DEPENDENCIES) $(EXTRA_ParseAligns_DEPENDENCIES)
- @rm -f ParseAligns$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(ParseAligns_OBJECTS) $(ParseAligns_LDADD) $(LIBS)
-
-abyss-fixmate$(EXEEXT): $(abyss_fixmate_OBJECTS) $(abyss_fixmate_DEPENDENCIES) $(EXTRA_abyss_fixmate_DEPENDENCIES)
- @rm -f abyss-fixmate$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(abyss_fixmate_OBJECTS) $(abyss_fixmate_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/ParseAligns-ParseAligns.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_fixmate-abyss-fixmate.Po at am__quote@
-
-.cc.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cc.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-ParseAligns-ParseAligns.o: ParseAligns.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ParseAligns_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ParseAligns-ParseAligns.o -MD -MP -MF $(DEPDIR)/ParseAligns-ParseAligns.Tpo -c -o ParseAligns-ParseAligns.o `test -f 'ParseAligns.cpp' || echo '$(srcdir)/'`ParseAligns.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ParseAligns-ParseAligns.Tpo $(DEPDIR)/ParseAligns-ParseAligns.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='ParseAligns.cpp' object='ParseAligns-ParseAligns.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ParseAligns_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ParseAligns-ParseAligns.o `test -f 'ParseAligns.cpp' || echo '$(srcdir)/'`ParseAligns.cpp
-
-ParseAligns-ParseAligns.obj: ParseAligns.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ParseAligns_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT ParseAligns-ParseAligns.obj -MD -MP -MF $(DEPDIR)/ParseAligns-ParseAligns.Tpo -c -o ParseAligns-ParseAligns.obj `if test -f 'ParseAligns.cpp'; then $(CYGPATH_W) 'ParseAligns.cpp'; else $(CYGPATH_W) '$(srcdir)/ParseAligns.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/ParseAligns-ParseAligns.Tpo $(DEPDIR)/ParseAligns-ParseAligns.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='ParseAligns.cpp' object='ParseAligns-ParseAligns.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(ParseAligns_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o ParseAligns-ParseAligns.obj `if test -f 'ParseAligns.cpp'; then $(CYGPATH_W) 'ParseAligns.cpp'; else $(CYGPATH_W) '$(srcdir)/ParseAligns.cpp'; fi`
-
-abyss_fixmate-abyss-fixmate.o: abyss-fixmate.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_fixmate_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_fixmate-abyss-fixmate.o -MD -MP -MF $(DEPDIR)/abyss_fixmate-abyss-fixmate.Tpo -c -o abyss_fixmate-abyss-fixmate.o `test -f 'abyss-fixmate.cc' || echo '$(srcdir)/'`abyss-fixmate.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_fixmate-abyss-fixmate.Tpo $(DEPDIR)/abyss_fixmate-abyss-fixmate.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='abyss-fixmate.cc' object='abyss_fixmate-abyss-fixmate.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_fixmate_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_fixmate-abyss-fixmate.o `test -f 'abyss-fixmate.cc' || echo '$(srcdir)/'`abyss-fixmate.cc
-
-abyss_fixmate-abyss-fixmate.obj: abyss-fixmate.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_fixmate_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_fixmate-abyss-fixmate.obj -MD -MP -MF $(DEPDIR)/abyss_fixmate-abyss-fixmate.Tpo -c -o abyss_fixmate-abyss-fixmate.obj `if test -f 'abyss-fixmate.cc'; then $(CYGPATH_W) 'abyss-fixmate.cc'; else $(CYGPATH_W) '$(srcdir)/abyss-fixmate.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_fixmate-abyss-fixmate.Tpo $(DEPDIR)/abyss_fixmate-abyss-fixmate.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='abyss-fixmate.cc' object='abyss_fixmate-abyss-fixmate.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_fixmate_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_fixmate-abyss-fixmate.obj `if test -f 'abyss-fixmate.cc'; then $(CYGPATH_W) 'abyss-fixmate.cc'; else $(CYGPATH_W) '$(srcdir)/abyss-fixmate.cc'; fi`
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/ParseAligns/ParseAligns.cpp b/ParseAligns/ParseAligns.cpp
index 3d4c446..75672f0 100644
--- a/ParseAligns/ParseAligns.cpp
+++ b/ParseAligns/ParseAligns.cpp
@@ -30,10 +30,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Jared Simpson and Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... [FILE]...\n"
+"Usage: " PROGRAM " -k<kmer> [OPTION]... [FILE]...\n"
"Write pairs that map to the same contig to the file SAME.\n"
"Write pairs that map to different contigs to standard output.\n"
"Alignments may be read from FILE(s) or standard input.\n"
diff --git a/ParseAligns/abyss-fixmate.cc b/ParseAligns/abyss-fixmate.cc
index 52112c7..1183a28 100644
--- a/ParseAligns/abyss-fixmate.cc
+++ b/ParseAligns/abyss-fixmate.cc
@@ -17,6 +17,7 @@
#include <iterator>
#include <sstream>
#include <string>
+#include <boost/unordered_map.hpp>
using namespace std;
@@ -26,7 +27,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... [FILE]...\n"
@@ -38,6 +39,9 @@ static const char USAGE_MESSAGE[] =
"\n"
" --no-qname set the qname to * [default]\n"
" --qname do not alter the qname\n"
+" --all print all alignments\n"
+" --diff print alignments that align to different\n"
+" contigs [default]\n"
" -l, --min-align=N the minimal alignment size [1]\n"
" -s, --same=SAME write properly-paired reads to this file\n"
" -h, --hist=FILE write the fragment size histogram to FILE\n"
@@ -54,6 +58,7 @@ namespace opt {
static string covPath;
static int qname;
static int verbose;
+ static int print_all;
}
static const char shortopts[] = "h:c:l:s:v";
@@ -63,6 +68,8 @@ enum { OPT_HELP = 1, OPT_VERSION };
static const struct option longopts[] = {
{ "qname", no_argument, &opt::qname, 1 },
{ "no-qname", no_argument, &opt::qname, 0 },
+ { "all", no_argument, &opt::print_all, 1 },
+ { "diff", no_argument, &opt::print_all, 0 },
{ "min-align", required_argument, NULL, 'l' },
{ "hist", required_argument, NULL, 'h' },
{ "cov", required_argument, NULL, 'c' },
@@ -123,7 +130,7 @@ static void handlePair(SAMRecord& a0, SAMRecord& a1)
stats.numDifferent++;
// Set the mapping quality of both reads to their minimum.
a0.mapq = a1.mapq = min(a0.mapq, a1.mapq);
- if (!opt::histPath.empty())
+ if (!opt::print_all)
cout << a0 << '\n' << a1 << '\n';
} else if (a0.isReverse() == a1.isReverse()) {
// Same target, FF orientation.
@@ -141,16 +148,16 @@ static void handlePair(SAMRecord& a0, SAMRecord& a1)
}
}
- if (opt::histPath.empty()) {
+ if (opt::print_all) {
cout << a0 << '\n' << a1 << '\n';
assert(cout.good());
}
}
#if SAM_SEQ_QUAL
-typedef unordered_map<string, SAMRecord> Alignments;
+typedef boost::unordered_map<string, SAMRecord> Alignments;
#else
-typedef unordered_map<string, SAMAlignment> Alignments;
+typedef boost::unordered_map<string, SAMAlignment> Alignments;
#endif
static void printProgress(const Alignments& map)
@@ -184,7 +191,14 @@ static void handleAlignment(SAMRecord& sam, Alignments& map)
SAMRecord a0(it.first->second, it.first->first);
#endif
handlePair(a0, sam);
+
+#include <boost/version.hpp>
+#if BOOST_VERSION >= 104300
+ // erase() is slow on older compilers so we use quick_erase()
+ map.quick_erase(it.first);
+#else
map.erase(it.first);
+#endif
}
stats.alignments++;
printProgress(map);
@@ -282,15 +296,23 @@ static string percent(size_t x, size_t n)
return ss.str();
}
-/** Print statistics of the specified histogram. */
-static void printHistogramStats(const Histogram& h)
+/** Print statistics of the specified histogram. h not passed by
+ * reference because we want to make a copy
+ **/
+static void printHistogramStats(Histogram h)
{
+ unsigned n_orig = h.size();
+ h.eraseNegative();
+ h.removeNoise();
+ h.removeOutliers();
+ h = h.trimFraction(0.0001);
cerr << "Stats mean: " << setprecision(4) << h.mean() << " "
"median: " << setprecision(4) << h.median() << " "
"sd: " << setprecision(4) << h.sd() << " "
"n: " << h.size() << " "
"min: " << h.minimum() << " "
- "max: " << h.maximum() << '\n'
+ "max: " << h.maximum() << " "
+ "ignored: " << n_orig - h.size() << '\n'
<< h.barplot() << endl;
}
@@ -347,7 +369,7 @@ int main(int argc, char* const* argv)
cerr << "Read " << stats.alignments << " alignments" << endl;
// Print the unpaired alignments.
- if (opt::histPath.empty()) {
+ if (opt::print_all) {
for (Alignments::iterator it = alignments.begin();
it != alignments.end(); it++) {
#if SAM_SEQ_QUAL
@@ -355,6 +377,7 @@ int main(int argc, char* const* argv)
#else
SAMRecord a0(it->second, it->first);
#endif
+ a0.noMate();
cout << a0 << '\n';
assert(cout.good());
}
@@ -399,22 +422,14 @@ int main(int argc, char* const* argv)
// Print the statistics of the forward-reverse distribution.
if ((float)numFR / numTotal > 0.001) {
- Histogram h = g_histogram;
- h.eraseNegative();
- h.removeNoise();
- h.removeOutliers();
cerr << "FR ";
- printHistogramStats(h.trimFraction(0.0001));
+ printHistogramStats(g_histogram);
}
// Print the statistics of the reverse-forward distribution.
if ((float)numRF / numTotal > 0.001) {
- Histogram h = g_histogram.negate();
- h.eraseNegative();
- h.removeNoise();
- h.removeOutliers();
cerr << "RF ";
- printHistogramStats(h.trimFraction(0.0001));
+ printHistogramStats(g_histogram.negate());
}
}
diff --git a/PathOverlap/Makefile.am b/PathOverlap/Makefile.am
index 13f4bc8..4e517d8 100644
--- a/PathOverlap/Makefile.am
+++ b/PathOverlap/Makefile.am
@@ -6,7 +6,6 @@ PathOverlap_CPPFLAGS = -I$(top_srcdir) \
PathOverlap_LDADD = \
$(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Graph/libgraph.a \
$(top_builddir)/Common/libcommon.a
PathOverlap_SOURCES = \
diff --git a/PathOverlap/Makefile.in b/PathOverlap/Makefile.in
deleted file mode 100644
index b2d93eb..0000000
--- a/PathOverlap/Makefile.in
+++ /dev/null
@@ -1,591 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = PathOverlap$(EXEEXT)
-subdir = PathOverlap
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_PathOverlap_OBJECTS = PathOverlap-PathOverlap.$(OBJEXT)
-PathOverlap_OBJECTS = $(am_PathOverlap_OBJECTS)
-PathOverlap_DEPENDENCIES = $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/Common/libcommon.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(PathOverlap_SOURCES)
-DIST_SOURCES = $(PathOverlap_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-PathOverlap_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-PathOverlap_LDADD = \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/Common/libcommon.a
-
-PathOverlap_SOURCES = \
- PathOverlap.cpp
-
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign PathOverlap/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign PathOverlap/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-PathOverlap$(EXEEXT): $(PathOverlap_OBJECTS) $(PathOverlap_DEPENDENCIES) $(EXTRA_PathOverlap_DEPENDENCIES)
- @rm -f PathOverlap$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(PathOverlap_OBJECTS) $(PathOverlap_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/PathOverlap-PathOverlap.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-PathOverlap-PathOverlap.o: PathOverlap.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PathOverlap_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT PathOverlap-PathOverlap.o -MD -MP -MF $(DEPDIR)/PathOverlap-PathOverlap.Tpo -c -o PathOverlap-PathOverlap.o `test -f 'PathOverlap.cpp' || echo '$(srcdir)/'`PathOverlap.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/PathOverlap-PathOverlap.Tpo $(DEPDIR)/PathOverlap-PathOverlap.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='PathOverlap.cpp' object='PathOverlap-PathOverlap.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PathOverlap_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o PathOverlap-PathOverlap.o `test -f 'PathOverlap.cpp' || echo '$(srcdir)/'`PathOverlap.cpp
-
-PathOverlap-PathOverlap.obj: PathOverlap.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PathOverlap_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT PathOverlap-PathOverlap.obj -MD -MP -MF $(DEPDIR)/PathOverlap-PathOverlap.Tpo -c -o PathOverlap-PathOverlap.obj `if test -f 'PathOverlap.cpp'; then $(CYGPATH_W) 'PathOverlap.cpp'; else $(CYGPATH_W) '$(srcdir)/PathOverlap.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/PathOverlap-PathOverlap.Tpo $(DEPDIR)/PathOverlap-PathOverlap.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='PathOverlap.cpp' object='PathOverlap-PathOverlap.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PathOverlap_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o PathOverlap-PathOverlap.obj `if test -f 'PathOverlap.cpp'; then $(CYGPATH_W) 'PathOverlap.cpp'; else $(CYGPATH_W) '$(srcdir)/PathOverlap.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/PathOverlap/PathOverlap.cpp b/PathOverlap/PathOverlap.cpp
index 25d5ab2..b312b02 100644
--- a/PathOverlap/PathOverlap.cpp
+++ b/PathOverlap/PathOverlap.cpp
@@ -32,10 +32,10 @@ static const char *VERSION_MESSAGE =
PROGRAM " (ABySS) " VERSION "\n"
"Written by Shaun Jackman and Tony Raymond.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char *USAGE_MESSAGE =
-"Usage: " PROGRAM " [OPTION]... ADJ PATH\n"
+"Usage: " PROGRAM " -k<kmer> [OPTION]... ADJ PATH\n"
"Find paths that overlap. Either output the graph of overlapping\n"
"paths, assemble overlapping paths into larger paths, or trim the\n"
"overlapping paths.\n"
@@ -56,6 +56,8 @@ static const char *USAGE_MESSAGE =
" --adj output the graph in adj format [default]\n"
" --dot output the graph in dot format\n"
" --sam output the graph in SAM format\n"
+" --SS expect contigs to be oriented correctly\n"
+" --no-SS no assumption about contig orientation [default]\n"
" -v, --verbose display verbose output\n"
" --help display this help and exit\n"
" --version output version information and exit\n"
@@ -74,6 +76,9 @@ namespace opt {
/** Output the IDs of contigs in overlaps to this file. */
static string repeatContigs;
+ /** Run a strand-specific RNA-Seq assembly. */
+ static int ss;
+
/** Mode of operation. */
enum {
/** Find overlapping paths, do not assemble. */
@@ -101,6 +106,8 @@ static const struct option longopts[] = {
{ "adj", no_argument, &opt::format, ADJ, },
{ "dot", no_argument, &opt::format, DOT, },
{ "sam", no_argument, &opt::format, SAM, },
+ { "SS", no_argument, &opt::ss, 1 },
+ { "no-SS", no_argument, &opt::ss, 0 },
{ "repeats", required_argument, NULL, 'r' },
{ "verbose", no_argument, NULL, 'v' },
{ "help", no_argument, NULL, OPT_HELP },
@@ -472,15 +479,21 @@ static ContigPath mergePaths(const Paths& paths,
/** Return true if the edge e is a path overlap. */
struct IsPathOverlap : unary_function<edge_descriptor, bool> {
- IsPathOverlap(const Graph& g, const OverlapMap& pmap)
- : m_g(g), m_pmap(pmap) { }
+ IsPathOverlap(const Graph& g, const OverlapMap& pmap,
+ const IsPositive<Graph>& pred)
+ : m_g(g), m_pmap(pmap), m_isPositive(pred) { }
bool operator()(edge_descriptor e) const
{
- return getOverlap(m_pmap, source(e, m_g), target(e, m_g));
+ bool stranded = true;
+ if (opt::ss)
+ stranded = m_isPositive(e);
+ return stranded &&
+ getOverlap(m_pmap, source(e, m_g), target(e, m_g));
}
private:
const Graph& m_g;
const OverlapMap& m_pmap;
+ const IsPositive<Graph>& m_isPositive;
};
/** Assemble overlapping paths. */
@@ -507,7 +520,7 @@ static void assembleOverlappingPaths(Graph& g,
// Assemble unambiguously overlapping paths.
Paths merges;
assemble_if(g, back_inserter(merges),
- IsPathOverlap(g, overlapMap));
+ IsPathOverlap(g, overlapMap, IsPositive<Graph>(g)));
// Merge overlapping paths.
g_contigNames.unlock();
diff --git a/PopBubbles/Makefile.am b/PopBubbles/Makefile.am
index aaed14b..a2efa96 100644
--- a/PopBubbles/Makefile.am
+++ b/PopBubbles/Makefile.am
@@ -8,7 +8,6 @@ PopBubbles_CPPFLAGS = -I$(top_srcdir) \
PopBubbles_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
PopBubbles_LDADD = \
- $(top_builddir)/Graph/libgraph.a \
$(top_builddir)/DataLayer/libdatalayer.a \
$(top_builddir)/Align/libalign.a \
$(top_builddir)/Common/libcommon.a \
diff --git a/PopBubbles/Makefile.in b/PopBubbles/Makefile.in
deleted file mode 100644
index 2e3a1ed..0000000
--- a/PopBubbles/Makefile.in
+++ /dev/null
@@ -1,597 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = PopBubbles$(EXEEXT)
-subdir = PopBubbles
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_PopBubbles_OBJECTS = PopBubbles-PopBubbles.$(OBJEXT)
-PopBubbles_OBJECTS = $(am_PopBubbles_OBJECTS)
-PopBubbles_DEPENDENCIES = $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Align/libalign.a \
- $(top_builddir)/Common/libcommon.a \
- $(top_builddir)/dialign/libdialign.a
-PopBubbles_LINK = $(CXXLD) $(PopBubbles_CXXFLAGS) $(CXXFLAGS) \
- $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(PopBubbles_SOURCES)
-DIST_SOURCES = $(PopBubbles_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-PopBubbles_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Align \
- -I$(top_srcdir)/Common \
- -I$(top_srcdir)/DataLayer
-
-PopBubbles_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
-PopBubbles_LDADD = \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/DataLayer/libdatalayer.a \
- $(top_builddir)/Align/libalign.a \
- $(top_builddir)/Common/libcommon.a \
- $(top_builddir)/dialign/libdialign.a
-
-PopBubbles_SOURCES = PopBubbles.cpp
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign PopBubbles/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign PopBubbles/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-PopBubbles$(EXEEXT): $(PopBubbles_OBJECTS) $(PopBubbles_DEPENDENCIES) $(EXTRA_PopBubbles_DEPENDENCIES)
- @rm -f PopBubbles$(EXEEXT)
- $(AM_V_CXXLD)$(PopBubbles_LINK) $(PopBubbles_OBJECTS) $(PopBubbles_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/PopBubbles-PopBubbles.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-PopBubbles-PopBubbles.o: PopBubbles.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PopBubbles_CPPFLAGS) $(CPPFLAGS) $(PopBubbles_CXXFLAGS) $(CXXFLAGS) -MT PopBubbles-PopBubbles.o -MD -MP -MF $(DEPDIR)/PopBubbles-PopBubbles.Tpo -c -o PopBubbles-PopBubbles.o `test -f 'PopBubbles.cpp' || echo '$(srcdir)/'`PopBubbles.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/PopBubbles-PopBubbles.Tpo $(DEPDIR)/PopBubbles-PopBubbles.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='PopBubbles.cpp' object='PopBubbles-PopBubbles.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PopBubbles_CPPFLAGS) $(CPPFLAGS) $(PopBubbles_CXXFLAGS) $(CXXFLAGS) -c -o PopBubbles-PopBubbles.o `test -f 'PopBubbles.cpp' || echo '$(srcdir)/'`PopBubbles.cpp
-
-PopBubbles-PopBubbles.obj: PopBubbles.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PopBubbles_CPPFLAGS) $(CPPFLAGS) $(PopBubbles_CXXFLAGS) $(CXXFLAGS) -MT PopBubbles-PopBubbles.obj -MD -MP -MF $(DEPDIR)/PopBubbles-PopBubbles.Tpo -c -o PopBubbles-PopBubbles.obj `if test -f 'PopBubbles.cpp'; then $(CYGPATH_W) 'PopBubbles.cpp'; else $(CYGPATH_W) '$(srcdir)/PopBubbles.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/PopBubbles-PopBubbles.Tpo $(DEPDIR)/PopBubbles-PopBubbles.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='PopBubbles.cpp' object='PopBubbles-PopBubbles.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(PopBubbles_CPPFLAGS) $(CPPFLAGS) $(PopBubbles_CXXFLAGS) $(CXXFLAGS) -c -o PopBubbles-PopBubbles.obj `if test -f 'PopBubbles.cpp'; then $(CYGPATH_W) 'PopBubbles.cpp'; else $(CYGPATH_W) '$(srcdir)/PopBubbles.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/PopBubbles/PopBubbles.cpp b/PopBubbles/PopBubbles.cpp
index 269dcd1..08f4765 100644
--- a/PopBubbles/PopBubbles.cpp
+++ b/PopBubbles/PopBubbles.cpp
@@ -3,7 +3,6 @@
* Written by Shaun Jackman <sjackman at bcgsc.ca>.
*/
-#include "dialign.h"
#include "config.h"
#include "Common/Options.h"
#include "ConstString.h"
@@ -43,9 +42,6 @@
using namespace std;
using namespace boost::lambda;
using boost::tie;
-#if !__GXX_EXPERIMENTAL_CXX0X__
-using boost::cref;
-#endif
#define PROGRAM "PopBubbles"
@@ -53,10 +49,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... FASTA ADJ\n"
+"Usage: " PROGRAM " -k<kmer> [OPTION]... FASTA ADJ\n"
"Identify and pop simple bubbles.\n"
"\n"
" Arguments:\n"
@@ -76,6 +72,8 @@ static const char USAGE_MESSAGE[] =
" --scaffold scaffold over bubbles that have\n"
" insufficient identity\n"
" --no-scaffold disable scaffolding [default]\n"
+" --SS expect contigs to be oriented correctly\n"
+" --no-SS no assumption about contig orientation [default]\n"
" -g, --graph=FILE write the contig adjacency graph to FILE\n"
" --dot output bubbles in dot format\n"
" -j, --threads=N use N parallel threads [1]\n"
@@ -111,14 +109,14 @@ namespace opt {
int format; // used by ContigProperties
+ /** Run a strand-specific RNA-Seq assembly. */
+ static int ss;
+
/** Number of threads. */
static int threads = 1;
- static int dialign_debug;
- static string dialign_score;
- static string dialign_prob;
}
-static const char shortopts[] = "a:b:c:g:j:k:p:vD:M:P:";
+static const char shortopts[] = "a:b:c:g:j:k:p:v";
enum { OPT_HELP = 1, OPT_VERSION };
@@ -132,13 +130,12 @@ static const struct option longopts[] = {
{ "identity", required_argument, NULL, 'p' },
{ "scaffold", no_argument, &opt::scaffold, 1},
{ "no-scaffold", no_argument, &opt::scaffold, 0},
+ { "SS", no_argument, &opt::ss, 1 },
+ { "no-SS", no_argument, &opt::ss, 0 },
{ "threads", required_argument, NULL, 'j' },
{ "verbose", no_argument, NULL, 'v' },
{ "help", no_argument, NULL, OPT_HELP },
{ "version", no_argument, NULL, OPT_VERSION },
- { "dialign-d", required_argument, NULL, 'D' },
- { "dialign-m", required_argument, NULL, 'M' },
- { "dialign-p", required_argument, NULL, 'P' },
{ NULL, 0, NULL, 0 }
};
@@ -225,51 +222,6 @@ static unsigned getLength(const Graph* g, vertex_descriptor v)
return (*g)[v].length;
}
-/** Align the specified pair of sequences.
- * @return the number of matches and size of the consensus
- */
-static pair<unsigned, unsigned> alignPair(
- const string& seqa, const string& seqb)
-{
- NWAlignment alignment;
- unsigned matches = alignGlobal(seqa, seqb, alignment);
- if (opt::verbose > 2)
-#pragma omp critical(cerr)
- cerr << alignment;
- return make_pair(matches, alignment.size());
-}
-
-/** Align the specified sequences.
- * @return the number of matches and size of the consensus
- */
-static pair<unsigned, unsigned> alignMulti(const vector<string>& seqs)
-{
- string alignment = seqs[0];
- unsigned matches = 0;
- NWAlignment align;
- for (unsigned j = 0; j < seqs.size() - 1; j++) {
- matches = min(matches, alignGlobal(alignment,
- seqs[j+1], align));
- alignment = align.match_align;
- }
- if (opt::verbose > 2)
-#pragma omp critical(cerr)
- cerr << align;
- return make_pair(matches, alignment.size());
-}
-
-/** Align the specified sequences.
- * @return the number of matches and size of the consensus
- */
-static pair<unsigned, unsigned> align(const vector<string>& seqs)
-{
- assert(seqs.size() > 1);
- if (seqs.size() == 2)
- return alignPair(seqs[0], seqs[1]);
- else
- return alignMulti(seqs);
-}
-
/** Align the sequences of [first,last).
* @param t the vertex to the left of the bubble
* @param v the vertex to the right of the bubble
@@ -283,15 +235,15 @@ static float getAlignmentIdentity(const Graph& g,
unsigned nbranches = distance(first, last);
vector<int> inDists(nbranches);
transform(first, last, inDists.begin(),
- bind(getDistance, cref(g), t, _1));
+ bind(getDistance, boost::cref(g), t, _1));
vector<int> outDists(nbranches);
transform(first, last, outDists.begin(),
- bind(getDistance, cref(g), _1, v));
+ bind(getDistance, boost::cref(g), _1, v));
vector<int> insertLens(nbranches);
transform(first, last, insertLens.begin(),
- bind(getDistance, cref(g), t, _1)
+ bind(getDistance, boost::cref(g), t, _1)
+ bind(getLength, &g, _1)
- + bind(getDistance, cref(g), _1, v));
+ + bind(getDistance, boost::cref(g), _1, v));
int max_in_overlap = -(*min_element(inDists.begin(),
inDists.end()));
@@ -474,7 +426,6 @@ static int longestPath(const Graph& g, const Bubble& topo)
*/
static void scaffoldBubble(Graph& g, const Bubble& bubble)
{
- typedef graph_traits<Graph>::adjacency_iterator Ait;
typedef graph_traits<Graph>::vertex_descriptor V;
assert(opt::scaffold);
assert(bubble.size() > 2);
@@ -582,9 +533,6 @@ int main(int argc, char** argv)
case 'g': arg >> opt::graphPath; break;
case 'j': arg >> opt::threads; break;
case 'k': arg >> opt::k; break;
- case 'D': arg >> opt::dialign_debug; break;
- case 'M': arg >> opt::dialign_score; break;
- case 'P': arg >> opt::dialign_prob; break;
case 'p': arg >> opt::identity; break;
case 'v': opt::verbose++; break;
case OPT_HELP:
@@ -622,13 +570,6 @@ int main(int argc, char** argv)
exit(EXIT_FAILURE);
}
- init_parameters();
- set_parameters_dna();
- para->DEBUG = opt::dialign_debug;
- para->SCR_MATRIX_FILE_NAME = (char*)opt::dialign_score.c_str();
- para->DIAG_PROB_FILE_NAME = (char*)opt::dialign_prob.c_str();
- initDialign();
-
const char* contigsPath(argv[optind++]);
string adjPath(argv[optind++]);
@@ -685,8 +626,6 @@ int main(int argc, char** argv)
it != g_popped.end(); ++it)
cout << get(g_contigNames, *it) << '\n';
}
- free_prob_dist(pdist);
- free(para);
if (opt::verbose > 0)
cerr << "Bubbles: " << (g_count.bubbles + 1) / 2
@@ -710,7 +649,10 @@ int main(int argc, char** argv)
size_t numContigs = num_vertices(g) / 2;
if (opt::scaffold) {
Graph gorig = g;
- assemble(g, back_inserter(paths));
+ if (opt::ss)
+ assemble_stranded(g, back_inserter(paths));
+ else
+ assemble(g, back_inserter(paths));
for (ContigPaths::const_iterator it = paths.begin();
it != paths.end(); ++it) {
ContigNode u(numContigs + it - paths.begin(), false);
@@ -720,7 +662,10 @@ int main(int argc, char** argv)
<< addDistance(gorig, *it) << '\n';
}
} else {
- assemble(g, back_inserter(paths));
+ if (opt::ss)
+ assemble_stranded(g, back_inserter(paths));
+ else
+ assemble(g, back_inserter(paths));
for (ContigPaths::const_iterator it = paths.begin();
it != paths.end(); ++it) {
ContigNode u(numContigs + it - paths.begin(), false);
diff --git a/README.html b/README.html
deleted file mode 100644
index 1eb37b0..0000000
--- a/README.html
+++ /dev/null
@@ -1,385 +0,0 @@
-<!DOCTYPE html>
-<html>
-<head>
- <meta charset="utf-8"/>
- <title>ABySS README</title>
- <meta name="author" content="Shaun Jackman, Anthony Raymond"/>
- <meta name="affiliation" content="Canada's Michael Smith Genome Science Centre"/>
- <link type="text/css" rel="stylesheet" href="README.css"/>
-</head>
-<body>
-
-<h1 id="abyss">ABySS</h1>
-
-<p>ABySS is a <em>de novo</em> sequence assembler intended for short paired-end
-reads and large genomes.</p>
-
-<h1 id="contents">Contents</h1>
-
-<ul>
-<li><a href="#quickstart">Quick Start</a>
-
-<ul>
-<li><a href="#installabyssondebianorubuntu">Install ABySS on Debian or Ubuntu</a></li>
-<li><a href="#installabyssonmacosx">Install ABySS on Mac OS X</a></li>
-</ul></li>
-<li><a href="#dependencies">Dependencies</a></li>
-<li><a href="#compilingabyssfromsource">Compiling ABySS from source</a></li>
-<li><a href="#assemblingapaired-endlibrary">Assembling a paired-end library</a></li>
-<li><a href="#assemblingmultiplelibraries">Assembling multiple libraries</a></li>
-<li><a href="#scaffolding">Scaffolding</a></li>
-<li><a href="#optimizingtheparameterk">Optimizing the parameter k</a></li>
-<li><a href="#parallelprocessing">Parallel processing</a></li>
-<li><a href="#runningabyssonacluster">Running ABySS on a cluster</a></li>
-<li><a href="#assemblyparameters">Assembly Parameters</a></li>
-<li><a href="#abyssprograms">ABySS programs</a></li>
-<li><a href="#mailinglist">Mailing List</a></li>
-<li><a href="#authors">Authors</a></li>
-</ul>
-
-<h1 id="quickstart">Quick Start</h1>
-
-<h2 id="installabyssondebianorubuntu">Install ABySS on Debian or Ubuntu</h2>
-
-<p>Run the command</p>
-
-<pre><code>sudo apt-get install abyss
-</code></pre>
-
-<p>or download and install the
-<a href="http://www.bcgsc.ca/platform/bioinfo/software/abyss">Debian package</a>.</p>
-
-<h2 id="installabyssonmacosx">Install ABySS on Mac OS X</h2>
-
-<p>Download and install the
-<a href="http://www.bcgsc.ca/platform/bioinfo/software/abyss">Mac OS X app</a>.</p>
-
-<h2 id="assembleasmallsyntheticdataset">Assemble a small synthetic data set</h2>
-
-<pre><code>wget http://www.bcgsc.ca/platform/bioinfo/software/abyss/releases/1.3.4/test-data.tar.gz
-tar xzvf test-data.tar.gz
-abyss-pe k=25 name=test \
- in='test-data/reads1.fastq test-data/reads2.fastq'
-</code></pre>
-
-<h2 id="calculateassemblycontiguitystatistics">Calculate assembly contiguity statistics</h2>
-
-<pre><code>abyss-fac test-unitigs.fa
-</code></pre>
-
-<h1 id="dependencies">Dependencies</h1>
-
-<p>ABySS requires the following libraries:</p>
-
-<ul>
-<li><a href="http://www.boost.org">Boost</a></li>
-<li><a href="http://code.google.com/p/sparsehash">sparsehash</a></li>
-<li><a href="http://www.open-mpi.org">Open MPI</a></li>
-</ul>
-
-<p>ABySS requires a C++ compiler that supports
-<a href="http://www.openmp.org">OpenMP</a> such as <a href="http://gcc.gnu.org">GCC</a>.</p>
-
-<p>ABySS will receive an error when compiling with Boost 1.51.0 or 1.52.0
-since they contain a bug. Later versions of Boost compile without error.</p>
-
-<h1 id="compilingabyssfromgithub">Compiling ABySS from GitHub</h1>
-
-<p>When installing ABySS from GitHub source the following tools are
-required:</p>
-
-<ul>
-<li><a href="http://www.gnu.org/software/autoconf">Autoconf</a></li>
-<li><a href="http://www.gnu.org/software/automake">Automake</a></li>
-</ul>
-
-<p>To generate the configure script and make files:</p>
-
-<pre><code>./autogen.sh
-</code></pre>
-
-<p>See “Compiling ABySS from source” for further steps.</p>
-
-<h1 id="compilingabyssfromsource">Compiling ABySS from source</h1>
-
-<p>To compile and install ABySS in <code>/usr/local</code>:</p>
-
-<pre><code>./configure
-make
-sudo make install
-</code></pre>
-
-<p>To install ABySS in a specified directory:</p>
-
-<pre><code>./configure --prefix=/opt/abyss
-make
-sudo make install
-</code></pre>
-
-<p>ABySS uses OpenMP for parallelization, which requires a modern
-compiler such as GCC 4.2 or greater. If you have an older compiler, it
-is best to upgrade your compiler if possible. If you have multiple
-versions of GCC installed, you can specify a different compiler:</p>
-
-<pre><code>./configure CC=gcc-4.6 CXX=g++-4.6
-</code></pre>
-
-<p>ABySS requires the Boost C++ libraries. Many systems come with Boost
-installed. If yours does not, you can download
-<a href="http://www.boost.org/users/download">Boost</a>.
-It is not necessary to compile Boost before installing it. The Boost
-header file directory should be found at <code>/usr/include/boost</code>, in the
-ABySS source directory, or its location specified to <code>configure</code>:</p>
-
-<pre><code>./configure --with-boost=/usr/local/include
-</code></pre>
-
-<p>If you wish to build the parallel assembler with MPI support,
-MPI should be found in <code>/usr/include</code> and <code>/usr/lib</code> or its location
-specified to <code>configure</code>:</p>
-
-<pre><code>./configure --with-mpi=/usr/lib/openmpi
-</code></pre>
-
-<p>ABySS should be built using the sparsehash library to reduce memory
-usage, although it will build without. sparsehash should be found in
-<code>/usr/include</code> or its location specified to <code>configure</code>:</p>
-
-<pre><code>./configure CPPFLAGS=-I/usr/local/include
-</code></pre>
-
-<p>The default maximum k-mer size is 64 and may be decreased to reduce
-memory usage or increased at compile time:</p>
-
-<pre><code>./configure --enable-maxk=96
-</code></pre>
-
-<p>If you encounter compiler warnings, you may ignore them like so:</p>
-
-<pre><code>make AM_CXXFLAGS=-Wall
-</code></pre>
-
-<p>To run ABySS, its executables should be found in your <code>PATH</code>. If you
-installed ABySS in <code>/opt/abyss</code>, add <code>/opt/abyss/bin</code> to your <code>PATH</code>:</p>
-
-<pre><code>PATH=/opt/abyss/bin:$PATH
-</code></pre>
-
-<h1 id="assemblingapaired-endlibrary">Assembling a paired-end library</h1>
-
-<p>To assemble paired reads in two files named <code>reads1.fa</code> and
-<code>reads2.fa</code> into contigs in a file named <code>ecoli-contigs.fa</code>, run the
-command:</p>
-
-<pre><code>abyss-pe name=ecoli k=64 in='reads1.fa reads2.fa'
-</code></pre>
-
-<p>The parameter <code>in</code> specifies the input files to read, which may be in
-FASTA, FASTQ, qseq, export, SRA, SAM or BAM format and compressed with
-gz, bz2 or xz and may be tarred. The assembled contigs will be stored
-in <code>${name}-contigs.fa</code>.</p>
-
-<p>A pair of reads must be named with the suffixes <code>/1</code> and <code>/2</code> to
-identify the first and second read, or the reads may be named
-identically. The paired reads may be in separate files or interleaved
-in a single file.</p>
-
-<p>Reads without mates should be placed in a file specified by the
-parameter <code>se</code> (single-end). Reads without mates in the paired-end
-files will slow down the paired-end assembler considerably during the
-<code>abyss-fixmate</code> stage.</p>
-
-<h1 id="assemblingmultiplelibraries">Assembling multiple libraries</h1>
-
-<p>The distribution of fragment sizes of each library is calculated
-empirically by aligning paired reads to the contigs produced by the
-single-end assembler, and the distribution is stored in a file with
-the extension <code>.hist</code>, such as <code>ecoli-3.hist</code>. The N50 of the
-single-end assembly must be well over the fragment-size to obtain an
-accurate empirical distribution.</p>
-
-<p>Here’s an example scenario of assembling a data set with two different
-fragment libraries and single-end reads:</p>
-
-<ul>
-<li>Library <code>pe200</code> has reads in two files,
- <code>pe200_1.fa</code> and <code>pe200_2.fa</code>.</li>
-<li>Library <code>pe500</code> has reads in two files,
- <code>pe500_1.fa</code> and <code>pe500_2.fa</code>.</li>
-<li>Single-end reads are stored in two files, <code>se1.fa</code> and <code>se2.fa</code>.</li>
-</ul>
-
-<p>The command line to assemble this example data set is:</p>
-
-<pre><code>abyss-pe k=64 name=ecoli lib='pe200 pe500' \
- pe200='pe200_1.fa pe200_2.fa' pe500='pe500_1.fa pe500_2.fa' \
- se='se1.fa se2.fa'
-</code></pre>
-
-<p>The empirical distribution of fragment sizes will be stored in two
-files named <code>pe200-3.hist</code> and <code>pe500-3.hist</code>. These files may be
-plotted to check that the empirical distribution agrees with the
-expected distribution. The assembled contigs will be stored in
-<code>${name}-contigs.fa</code>.</p>
-
-<h1 id="scaffolding">Scaffolding</h1>
-
-<p>Long-distance mate-pair libraries may be used to scaffold an assembly.
-Specify the names of the mate-pair libraries using the parameter <code>mp</code>.
-The scaffolds will be stored in the file <code>${name}-scaffolds.fa</code>.
-Here’s an example of assembling a data set with two paired-end
-libraries and two mate-pair libraries:</p>
-
-<pre><code>abyss-pe k=64 name=ecoli lib='pe1 pe2' mp='mp1 mp2' \
- pe1='pe1_1.fa pe1_2.fa' pe2='pe2_1.fa pe2_2.fa' \
- mp1='mp1_1.fa mp1_2.fa' mp2='mp2_1.fa mp2_2.fa'
-</code></pre>
-
-<p>The mate-pair libraries are used only for scaffolding and do not
-contribute towards the consensus sequence.</p>
-
-<h1 id="optimizingtheparameterk">Optimizing the parameter k</h1>
-
-<p>To find the optimal value of <code>k</code>, run multiple assemblies and inspect
-the assembly contiguity statistics. The following shell snippet will
-assemble for every value of <code>k</code> from 20 to 40.</p>
-
-<pre><code>export k
-for k in {20..40}; do
- mkdir k$k
- abyss-pe -C k$k name=ecoli in=../reads.fa
-done
-abyss-fac k*/ecoli-contigs.fa
-</code></pre>
-
-<p>The default maximum value for <code>k</code> is 64. This limit may be changed at
-compile time using the <code>--enable-maxk</code> option of configure. It may be
-decreased to 32 to decrease memory usage or increased to 96.</p>
-
-<h1 id="parallelprocessing">Parallel processing</h1>
-
-<p>The <code>np</code> option of <code>abyss-pe</code> specifies the number of processes to
-use for the parallel MPI job. Without any MPI configuration, this will
-allow you to use multiple cores on a single machine. To use multiple
-machines for assembly, you must create a <code>hostfile</code> for <code>mpirun</code>,
-which is described in the <code>mpirun</code> man page.</p>
-
-<p><em>Do not</em> run <code>mpirun -np 8 abyss-pe</code>. To run ABySS with 8 threads, use
-<code>abyss-pe np=8</code>. The <code>abyss-pe</code> driver script will start the MPI
-process, like so: <code>mpirun -np 8 ABYSS-P</code>.</p>
-
-<p>The paired-end assembly stage is multithreaded, but must run on a
-single machine. The number of threads to use may be specified with the
-parameter <code>j</code>. The default value for <code>j</code> is the value of <code>np</code>.</p>
-
-<h1 id="runningabyssonacluster">Running ABySS on a cluster</h1>
-
-<p>ABySS integrates well with cluster job schedulers, such as:</p>
-
-<ul>
-<li>SGE (Sun Grid Engine)</li>
-<li>Portable Batch System (PBS)</li>
-<li>Load Sharing Facility (LSF)</li>
-<li>IBM LoadLeveler</li>
-</ul>
-
-<p>For example, to submit an array of jobs to assemble every odd value of
-<code>k</code> between 51 and 63 using 64 processes for each job:</p>
-
-<pre><code>mkdir k{51..63}
-qsub -N ecoli -pe openmpi 64 -t 51-63:2 \
- <<<'abyss-pe -C k$SGE_TASK_ID in=/data/reads.fa'
-</code></pre>
-
-<h1 id="assemblyparameters">Assembly Parameters</h1>
-
-<p>Parameters of the driver script, <code>abyss-pe</code></p>
-
-<ul>
-<li><code>a</code>: maximum number of branches of a bubble [<code>2</code>]</li>
-<li><code>b</code>: maximum length of a bubble (bp) [<code>10000</code>]</li>
-<li><code>c</code>: minimum mean k-mer coverage of a unitig [<code>sqrt(median)</code>]</li>
-<li><code>d</code>: allowable error of a distance estimate (bp) [<code>6</code>]</li>
-<li><code>e</code>: minimum erosion k-mer coverage [<code>sqrt(median)</code>]</li>
-<li><code>E</code>: minimum erosion k-mer coverage per strand [<code>1</code>]</li>
-<li><code>j</code>: number of threads [<code>2</code>]</li>
-<li><code>k</code>: size of k-mer (bp)</li>
-<li><code>l</code>: minimum alignment length of a read (bp) [<code>k</code>]</li>
-<li><code>m</code>: minimum overlap of two unitigs (bp) [<code>30</code>]</li>
-<li><code>n</code>: minimum number of pairs required for building contigs [<code>10</code>]</li>
-<li><code>N</code>: minimum number of pairs required for building scaffolds [<code>n</code>]</li>
-<li><code>p</code>: minimum sequence identity of a bubble [<code>0.9</code>]</li>
-<li><code>q</code>: minimum base quality [<code>3</code>]</li>
-<li><code>s</code>: minimum unitig size required for building contigs (bp) [<code>200</code>]</li>
-<li><code>S</code>: minimum contig size required for building scaffolds (bp) [<code>s</code>]</li>
-<li><code>t</code>: minimum tip size (bp) [<code>2k</code>]</li>
-<li><code>v</code>: use <code>v=-v</code> to enable verbose logging [<code>disabled</code>]</li>
-</ul>
-
-<p>Please see the
-<a href="http://manpages.ubuntu.com/abyss-pe.1.html">abyss-pe</a>
-manual page for more information on assembly parameters.</p>
-
-<h1 id="abyssprograms">ABySS programs</h1>
-
-<p><code>abyss-pe</code> is a driver script implemented as a Makefile. Any option of
-<code>make</code> may be used with <code>abyss-pe</code>. Particularly useful options are:</p>
-
-<ul>
-<li><code>-C dir</code>, <code>--directory=dir</code><br/>
- Change to the directory <code>dir</code> and store the results there.</li>
-<li><code>-n</code>, <code>--dry-run</code><br/>
- Print the commands that would be executed, but do not execute
- them.</li>
-</ul>
-
-<p><code>abyss-pe</code> uses the following programs, which must be found in your
-<code>PATH</code>:</p>
-
-<ul>
-<li><code>ABYSS</code>: de Bruijn graph assembler</li>
-<li><code>ABYSS-P</code>: parallel (MPI) de Bruijn graph assembler</li>
-<li><code>AdjList</code>: find overlapping sequences</li>
-<li><code>DistanceEst</code>: estimate the distance between sequences</li>
-<li><code>MergeContigs</code>: merge sequences</li>
-<li><code>MergePaths</code>: merge overlapping paths</li>
-<li><code>Overlap</code>: find overlapping sequences using paired-end reads</li>
-<li><code>PathConsensus</code>: find a consensus sequence of ambiguous paths</li>
-<li><code>PathOverlap</code>: find overlapping paths</li>
-<li><code>PopBubbles</code>: remove bubbles from the sequence overlap graph</li>
-<li><code>SimpleGraph</code>: find paths through the overlap graph</li>
-<li><code>abyss-fac</code>: calculate assembly contiguity statistics</li>
-<li><code>abyss-filtergraph</code>: remove shim contigs from the overlap graph</li>
-<li><code>abyss-fixmate</code>: fill the paired-end fields of SAM alignments</li>
-<li><code>abyss-map</code>: map reads to a reference sequence</li>
-<li><code>abyss-scaffold</code>: scaffold contigs using distance estimates</li>
-<li><code>abyss-todot</code>: convert graph formats and merge graphs</li>
-</ul>
-
-<p>For a flowchart showing the relationship between these programs,
-see doc/flowchart.pdf.</p>
-
-<h1 id="mailinglist">Mailing List</h1>
-
-<p>Subscribe to the
-[ABySS mailing list]
-(http://groups.google.com/group/abyss-users),
-<a href="mailto:abyss-users@googlegroups.com">abyss-users@googlegroups.com</a>.</p>
-
-<p>For questions related to transcriptome assembly, contact the
-[Trans-ABySS mailing list]
-(http://groups.google.com/group/trans-abyss),
-<a href="mailto:trans-abyss@googlegroups.com">trans-abyss@googlegroups.com</a>.</p>
-
-<h1 id="authors">Authors</h1>
-
-<p>This document is written by Shaun Jackman.</p>
-
-<p>ABySS is written by Shaun Jackman, Tony Raymond and Jared Simpson.</p>
-
-<p>Copyright 2012 Canada’s Michael Smith Genome Science Centre</p>
-
-<p><a href="http://githalytics.com/sjackman/abyss"><img src="https://cruel-carlota.pagodabox.com/af4811df3b40b7d096f6085db2969f0e" alt="githalytics.com" title="githalytics.com" /></a></p>
-
-</body>
-</html>
diff --git a/README.md b/README.md
index b9d6655..66ca8b2 100644
--- a/README.md
+++ b/README.md
@@ -1,6 +1,6 @@
Title: ABySS README
Author: Shaun Jackman, Anthony Raymond
-Affiliation: Canada's Michael Smith Genome Science Centre
+Affiliation: Canada's Michael Smith Genome Sciences Centre
CSS: README.css
ABySS
@@ -12,21 +12,24 @@ reads and large genomes.
Contents
========
-* [Quick Start]
- * [Install ABySS on Debian or Ubuntu]
- * [Install ABySS on Mac OS X]
-* [Dependencies]
-* [Compiling ABySS from source]
-* [Assembling a paired-end library]
-* [Assembling multiple libraries]
-* [Scaffolding]
-* [Optimizing the parameter k]
-* [Parallel processing]
-* [Running ABySS on a cluster]
-* [Assembly Parameters]
-* [ABySS programs]
-* [Mailing List]
-* [Authors]
+* [Quick Start](#quick-start)
+ * [Install ABySS on Debian or Ubuntu](#install-abyss-on-debian-or-ubuntu)
+ * [Install ABySS on Mac OS X](#install-abyss-on-mac-os-x)
+* [Dependencies](#dependencies)
+* [Compiling ABySS from source](#compiling-abyss-from-source)
+* [Assembling a paired-end library](#assembling-a-paired-end-library)
+* [Assembling multiple libraries](#assembling-multiple-libraries)
+* [Scaffolding](#scaffolding)
+* [Rescaffolding with long sequences](#rescaffolding-with-long-sequences)
+* [Assembling a strand-specific RNA-Seq library](#assembling-a-strand-specific-rna-seq-library)
+* [Optimizing the parameter k](#optimizing-the-parameter-k)
+* [Parallel processing](#parallel-processing)
+* [Running ABySS on a cluster](#running-abyss-on-a-cluster)
+* [Assembly Parameters](#assembly-parameters)
+* [ABySS programs](#abyss-programs)
+* [Publications](#publications)
+* [Mailing List](#mailing-list)
+* [Authors](#authors)
Quick Start
===========
@@ -42,8 +45,9 @@ or download and install the
## Install ABySS on Mac OS X
-Download and install the
-[Mac OS X app](http://www.bcgsc.ca/platform/bioinfo/software/abyss).
+Install [Homebrew](http://brew.sh/), and run the command
+
+ brew install abyss
## Assemble a small synthetic data set
@@ -130,7 +134,8 @@ usage, although it will build without. sparsehash should be found in
./configure CPPFLAGS=-I/usr/local/include
The default maximum k-mer size is 64 and may be decreased to reduce
-memory usage or increased at compile time:
+memory usage or increased at compile time. This value must be a
+multiple of 32 (i.e. 32, 64, 96, 128, etc):
./configure --enable-maxk=96
@@ -214,6 +219,38 @@ libraries and two mate-pair libraries:
The mate-pair libraries are used only for scaffolding and do not
contribute towards the consensus sequence.
+Rescaffolding with long sequences
+=================================
+
+Long sequences such as RNA-Seq contigs can be used to rescaffold an
+assembly. Sequences are aligned using BWA-MEM to the assembled
+scaffolds. Additional scaffolds are then formed between scaffolds that
+can be linked unambiguously when considering all BWA-MEM alignments.
+
+Similar to scaffolding, the names of the datasets can be specified with
+the `long` parameter. These scaffolds will be stored in the file
+`${name}-trans-scaffs.fa`. The following is an example of an assembly with PET, MPET and an RNA-Seq assembly:
+
+ abyss-pe k=64 name=ecoli lib='pe1 pe2' mp='mp1 mp2' long=long1 \
+ pe1='pe1_1.fa pe1_2.fa' pe2='pe2_1.fa pe2_2.fa' \
+ mp1='mp1_1.fa mp1_2.fa' mp2='mp2_1.fa mp2_2.fa' \
+ long1=long1.fa
+
+Assembling a strand-specific RNA-Seq library
+============================================
+
+Strand-specific RNA-Seq libraries can be assembled such that the
+resulting unitigs, conitgs and scaffolds are oriented correctly with
+respect to the original transcripts that were sequenced. In order to
+run ABySS in strand-specific mode, the `SS` parameter must be used as
+in the following example:
+
+ abyss-pe name=SS-RNA k=64 in='reads1.fa reads2.fa' SS=--SS
+
+The expected orientation for the read sequences with respect to the
+original RNA is RF. i.e. the first read in a read pair is always in
+reverse orientation.
+
Optimizing the parameter k
==========================
@@ -288,12 +325,18 @@ Parameters of the driver script, `abyss-pe`
* `s`: minimum unitig size required for building contigs (bp) [`200`]
* `S`: minimum contig size required for building scaffolds (bp) [`s`]
* `t`: minimum tip size (bp) [`2k`]
- * `v`: use `v=-v` to enable verbose logging [`disabled`]
+ * `v`: use `v=-v` for verbose logging, `v=-vv` for extra verbose [`disabled`]
Please see the
[abyss-pe](http://manpages.ubuntu.com/abyss-pe.1.html)
manual page for more information on assembly parameters.
+Possibly, `abyss-pe` parameters can have same names as existing environment variables'. The parameters then cannot be used until the environment variables are unset. To detect such occasions, run the command:
+
+ abyss-pe env [options]
+
+Above command will report all `abyss-pe` parameters that are set from various origins. However it will not operate ABySS programs.
+
ABySS programs
==============
@@ -330,6 +373,30 @@ ABySS programs
For a flowchart showing the relationship between these programs,
see doc/flowchart.pdf.
+Publications
+============
+
+## [ABySS](http://genome.cshlp.org/content/19/6/1117)
+
+Simpson, Jared T., Kim Wong, Shaun D. Jackman, Jacqueline E. Schein,
+Steven JM Jones, and İnanç Birol.
+**ABySS: a parallel assembler for short read sequence data**.
+*Genome research* 19, no. 6 (2009): 1117-1123.
+
+## [Trans-ABySS](http://www.nature.com/nmeth/journal/v7/n11/abs/nmeth.1517.html)
+
+Robertson, Gordon, Jacqueline Schein, Readman Chiu, Richard Corbett,
+Matthew Field, Shaun D. Jackman, Karen Mungall et al.
+**De novo assembly and analysis of RNA-seq data**.
+*Nature methods* 7, no. 11 (2010): 909-912.
+
+## [ABySS-Explorer](http://ieeexplore.ieee.org/xpls/abs_all.jsp?arnumber=5290690)
+
+Nielsen, Cydney B., Shaun D. Jackman, Inanc Birol, and Steven JM Jones.
+**ABySS-Explorer: visualizing genome sequence assemblies**.
+*IEEE Transactions on Visualization and Computer Graphics*
+15, no. 6 (2009): 881-888.
+
Mailing List
============
@@ -338,6 +405,9 @@ Subscribe to the
(http://groups.google.com/group/abyss-users),
<abyss-users at googlegroups.com>.
+Post questions to the community on
+[](http://www.biostars.org/show/tag/abyss/).
+
For questions related to transcriptome assembly, contact the
[Trans-ABySS mailing list]
(http://groups.google.com/group/trans-abyss),
@@ -346,10 +416,15 @@ For questions related to transcriptome assembly, contact the
Authors
=======
-This document is written by Shaun Jackman.
+- **[Shaun Jackman](http://sjackman.ca)**
+ — [GitHub/sjackman](https://github.com/sjackman)
+ — [@sjackman](https://twitter.com/sjackman)
+- **Tony Raymond** — [GitHub/traymond](https://github.com/traymond)
+- **Ben Vandervalk** — [GitHub/benvvalk ](https://github.com/benvvalk)
+- **Jared Simpson** — [GitHub/jts](https://github.com/jts)
-ABySS is written by Shaun Jackman, Tony Raymond and Jared Simpson.
+Supervised by [**Dr. İnanç Birol**](http://www.bcgsc.ca/faculty/inanc-birol).
-Copyright 2012 Canada's Michael Smith Genome Science Centre
+Copyright 2014 Canada's Michael Smith Genome Sciences Centre
[](http://githalytics.com/sjackman/abyss)
diff --git a/Scaffold/Makefile.am b/Scaffold/Makefile.am
index b6ca98d..04a908a 100644
--- a/Scaffold/Makefile.am
+++ b/Scaffold/Makefile.am
@@ -1,4 +1,4 @@
-bin_PROGRAMS = abyss-scaffold abyss-junction
+bin_PROGRAMS = abyss-scaffold abyss-junction abyss-longseqdist
noinst_PROGRAMS = abyss-drawgraph
abyss_scaffold_CPPFLAGS = -I$(top_srcdir) \
@@ -11,6 +11,16 @@ abyss_scaffold_LDADD = \
abyss_scaffold_SOURCES = scaffold.cc
+abyss_longseqdist_CPPFLAGS = -I$(top_srcdir) \
+ -I$(top_srcdir)/Common
+
+abyss_longseqdist_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
+
+abyss_longseqdist_LDADD = \
+ $(top_builddir)/Common/libcommon.a
+
+abyss_longseqdist_SOURCES = longseqdist.cpp
+
abyss_junction_CPPFLAGS = -I$(top_srcdir) \
-I$(top_srcdir)/Common
diff --git a/Scaffold/Makefile.in b/Scaffold/Makefile.in
deleted file mode 100644
index 39eab1a..0000000
--- a/Scaffold/Makefile.in
+++ /dev/null
@@ -1,651 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = abyss-scaffold$(EXEEXT) abyss-junction$(EXEEXT)
-noinst_PROGRAMS = abyss-drawgraph$(EXEEXT)
-subdir = Scaffold
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS) $(noinst_PROGRAMS)
-am_abyss_drawgraph_OBJECTS = abyss_drawgraph-drawgraph.$(OBJEXT)
-abyss_drawgraph_OBJECTS = $(am_abyss_drawgraph_OBJECTS)
-abyss_drawgraph_DEPENDENCIES = $(top_builddir)/Common/libcommon.a
-am_abyss_junction_OBJECTS = abyss_junction-junction.$(OBJEXT)
-abyss_junction_OBJECTS = $(am_abyss_junction_OBJECTS)
-abyss_junction_DEPENDENCIES = $(top_builddir)/Common/libcommon.a
-abyss_junction_LINK = $(CXXLD) $(abyss_junction_CXXFLAGS) $(CXXFLAGS) \
- $(AM_LDFLAGS) $(LDFLAGS) -o $@
-am_abyss_scaffold_OBJECTS = abyss_scaffold-scaffold.$(OBJEXT)
-abyss_scaffold_OBJECTS = $(am_abyss_scaffold_OBJECTS)
-abyss_scaffold_DEPENDENCIES = $(top_builddir)/Common/libcommon.a
-abyss_scaffold_LINK = $(CXXLD) $(abyss_scaffold_CXXFLAGS) $(CXXFLAGS) \
- $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(abyss_drawgraph_SOURCES) $(abyss_junction_SOURCES) \
- $(abyss_scaffold_SOURCES)
-DIST_SOURCES = $(abyss_drawgraph_SOURCES) $(abyss_junction_SOURCES) \
- $(abyss_scaffold_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-abyss_scaffold_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common
-
-abyss_scaffold_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
-abyss_scaffold_LDADD = \
- $(top_builddir)/Common/libcommon.a
-
-abyss_scaffold_SOURCES = scaffold.cc
-abyss_junction_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Common
-
-abyss_junction_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
-abyss_junction_LDADD = \
- $(top_builddir)/Common/libcommon.a
-
-abyss_junction_SOURCES = junction.cc
-abyss_drawgraph_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
-abyss_drawgraph_LDADD = $(top_builddir)/Common/libcommon.a
-abyss_drawgraph_SOURCES = drawgraph.cc
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cc .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign Scaffold/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign Scaffold/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-clean-noinstPROGRAMS:
- -test -z "$(noinst_PROGRAMS)" || rm -f $(noinst_PROGRAMS)
-
-abyss-drawgraph$(EXEEXT): $(abyss_drawgraph_OBJECTS) $(abyss_drawgraph_DEPENDENCIES) $(EXTRA_abyss_drawgraph_DEPENDENCIES)
- @rm -f abyss-drawgraph$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(abyss_drawgraph_OBJECTS) $(abyss_drawgraph_LDADD) $(LIBS)
-
-abyss-junction$(EXEEXT): $(abyss_junction_OBJECTS) $(abyss_junction_DEPENDENCIES) $(EXTRA_abyss_junction_DEPENDENCIES)
- @rm -f abyss-junction$(EXEEXT)
- $(AM_V_CXXLD)$(abyss_junction_LINK) $(abyss_junction_OBJECTS) $(abyss_junction_LDADD) $(LIBS)
-
-abyss-scaffold$(EXEEXT): $(abyss_scaffold_OBJECTS) $(abyss_scaffold_DEPENDENCIES) $(EXTRA_abyss_scaffold_DEPENDENCIES)
- @rm -f abyss-scaffold$(EXEEXT)
- $(AM_V_CXXLD)$(abyss_scaffold_LINK) $(abyss_scaffold_OBJECTS) $(abyss_scaffold_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_drawgraph-drawgraph.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_junction-junction.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/abyss_scaffold-scaffold.Po at am__quote@
-
-.cc.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cc.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-abyss_drawgraph-drawgraph.o: drawgraph.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_drawgraph_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_drawgraph-drawgraph.o -MD -MP -MF $(DEPDIR)/abyss_drawgraph-drawgraph.Tpo -c -o abyss_drawgraph-drawgraph.o `test -f 'drawgraph.cc' || echo '$(srcdir)/'`drawgraph.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_drawgraph-drawgraph.Tpo $(DEPDIR)/abyss_drawgraph-drawgraph.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='drawgraph.cc' object='abyss_drawgraph-drawgraph.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_drawgraph_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_drawgraph-drawgraph.o `test -f 'drawgraph.cc' || echo '$(srcdir)/'`drawgraph.cc
-
-abyss_drawgraph-drawgraph.obj: drawgraph.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_drawgraph_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT abyss_drawgraph-drawgraph.obj -MD -MP -MF $(DEPDIR)/abyss_drawgraph-drawgraph.Tpo -c -o abyss_drawgraph-drawgraph.obj `if test -f 'drawgraph.cc'; then $(CYGPATH_W) 'drawgraph.cc'; else $(CYGPATH_W) '$(srcdir)/drawgraph.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_drawgraph-drawgraph.Tpo $(DEPDIR)/abyss_drawgraph-drawgraph.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='drawgraph.cc' object='abyss_drawgraph-drawgraph.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_drawgraph_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o abyss_drawgraph-drawgraph.obj `if test -f 'drawgraph.cc'; then $(CYGPATH_W) 'drawgraph.cc'; else $(CYGPATH_W) '$(srcdir)/drawgraph.cc'; fi`
-
-abyss_junction-junction.o: junction.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_junction_CPPFLAGS) $(CPPFLAGS) $(abyss_junction_CXXFLAGS) $(CXXFLAGS) -MT abyss_junction-junction.o -MD -MP -MF $(DEPDIR)/abyss_junction-junction.Tpo -c -o abyss_junction-junction.o `test -f 'junction.cc' || echo '$(srcdir)/'`junction.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_junction-junction.Tpo $(DEPDIR)/abyss_junction-junction.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='junction.cc' object='abyss_junction-junction.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_junction_CPPFLAGS) $(CPPFLAGS) $(abyss_junction_CXXFLAGS) $(CXXFLAGS) -c -o abyss_junction-junction.o `test -f 'junction.cc' || echo '$(srcdir)/'`junction.cc
-
-abyss_junction-junction.obj: junction.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_junction_CPPFLAGS) $(CPPFLAGS) $(abyss_junction_CXXFLAGS) $(CXXFLAGS) -MT abyss_junction-junction.obj -MD -MP -MF $(DEPDIR)/abyss_junction-junction.Tpo -c -o abyss_junction-junction.obj `if test -f 'junction.cc'; then $(CYGPATH_W) 'junction.cc'; else $(CYGPATH_W) '$(srcdir)/junction.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_junction-junction.Tpo $(DEPDIR)/abyss_junction-junction.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='junction.cc' object='abyss_junction-junction.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_junction_CPPFLAGS) $(CPPFLAGS) $(abyss_junction_CXXFLAGS) $(CXXFLAGS) -c -o abyss_junction-junction.obj `if test -f 'junction.cc'; then $(CYGPATH_W) 'junction.cc'; else $(CYGPATH_W) '$(srcdir)/junction.cc'; fi`
-
-abyss_scaffold-scaffold.o: scaffold.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_scaffold_CPPFLAGS) $(CPPFLAGS) $(abyss_scaffold_CXXFLAGS) $(CXXFLAGS) -MT abyss_scaffold-scaffold.o -MD -MP -MF $(DEPDIR)/abyss_scaffold-scaffold.Tpo -c -o abyss_scaffold-scaffold.o `test -f 'scaffold.cc' || echo '$(srcdir)/'`scaffold.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_scaffold-scaffold.Tpo $(DEPDIR)/abyss_scaffold-scaffold.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='scaffold.cc' object='abyss_scaffold-scaffold.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_scaffold_CPPFLAGS) $(CPPFLAGS) $(abyss_scaffold_CXXFLAGS) $(CXXFLAGS) -c -o abyss_scaffold-scaffold.o `test -f 'scaffold.cc' || echo '$(srcdir)/'`scaffold.cc
-
-abyss_scaffold-scaffold.obj: scaffold.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_scaffold_CPPFLAGS) $(CPPFLAGS) $(abyss_scaffold_CXXFLAGS) $(CXXFLAGS) -MT abyss_scaffold-scaffold.obj -MD -MP -MF $(DEPDIR)/abyss_scaffold-scaffold.Tpo -c -o abyss_scaffold-scaffold.obj `if test -f 'scaffold.cc'; then $(CYGPATH_W) 'scaffold.cc'; else $(CYGPATH_W) '$(srcdir)/scaffold.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/abyss_scaffold-scaffold.Tpo $(DEPDIR)/abyss_scaffold-scaffold.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='scaffold.cc' object='abyss_scaffold-scaffold.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(abyss_scaffold_CPPFLAGS) $(CPPFLAGS) $(abyss_scaffold_CXXFLAGS) $(CXXFLAGS) -c -o abyss_scaffold-scaffold.obj `if test -f 'scaffold.cc'; then $(CYGPATH_W) 'scaffold.cc'; else $(CYGPATH_W) '$(srcdir)/scaffold.cc'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic clean-noinstPROGRAMS \
- mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic clean-noinstPROGRAMS \
- cscopelist-am ctags ctags-am distclean distclean-compile \
- distclean-generic distclean-tags distdir dvi dvi-am html \
- html-am info info-am install install-am install-binPROGRAMS \
- install-data install-data-am install-dvi install-dvi-am \
- install-exec install-exec-am install-html install-html-am \
- install-info install-info-am install-man install-pdf \
- install-pdf-am install-ps install-ps-am install-strip \
- installcheck installcheck-am installdirs maintainer-clean \
- maintainer-clean-generic mostlyclean mostlyclean-compile \
- mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
- uninstall-am uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/Scaffold/drawgraph.cc b/Scaffold/drawgraph.cc
index 32a18e9..d034e5f 100644
--- a/Scaffold/drawgraph.cc
+++ b/Scaffold/drawgraph.cc
@@ -35,7 +35,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... FASTA|OVERLAP DIST...\n"
@@ -169,7 +169,6 @@ int main(int argc, char** argv)
typedef graph_traits<Graph>::edge_iterator Eit;
typedef graph_traits<Graph>::vertex_descriptor V;
typedef graph_traits<Graph>::vertex_iterator Vit;
- typedef edge_bundle_type<Graph>::type EP;
Graph g;
if (optind < argc) {
diff --git a/Scaffold/junction.cc b/Scaffold/junction.cc
index d26ef88..2ccaed0 100644
--- a/Scaffold/junction.cc
+++ b/Scaffold/junction.cc
@@ -24,10 +24,6 @@
using namespace std;
using namespace boost::lambda;
using boost::tie;
-#if !__GXX_EXPERIMENTAL_CXX0X__
-using boost::cref;
-using boost::ref;
-#endif
#define PROGRAM "abyss-junction"
@@ -35,7 +31,7 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
"Usage: " PROGRAM " [OPTION]... OVERLAP [SCAFFOLD]...\n"
@@ -192,7 +188,7 @@ int main(int argc, char** argv)
ScaffoldGraph scaffoldG(overlapG.num_vertices() / 2);
if (optind < argc) {
for_each(argv + optind, argv + argc,
- bind(readGraph, _1, ref(scaffoldG)));
+ bind(readGraph, _1, boost::ref(scaffoldG)));
// Add any missing complementary edges.
size_t numAdded = addComplementaryEdges(scaffoldG);
if (opt::verbose > 0)
diff --git a/Scaffold/longseqdist.cpp b/Scaffold/longseqdist.cpp
new file mode 100644
index 0000000..d1d379c
--- /dev/null
+++ b/Scaffold/longseqdist.cpp
@@ -0,0 +1,211 @@
+#include "config.h"
+#include "IOUtil.h"
+#include "ContigNode.h"
+#include "Uncompress.h"
+#include "Graph/ContigGraph.h"
+#include "Graph/ContigGraphAlgorithms.h"
+#include "Graph/DirectedGraph.h"
+#include "Graph/GraphAlgorithms.h"
+#include "Graph/GraphIO.h"
+#include "Graph/GraphUtil.h"
+#include "ContigProperties.h"
+#include "SAM.h"
+#include <iostream>
+#include <sstream>
+#include <string>
+#include <getopt.h>
+#include <boost/tuple/tuple.hpp>
+
+using namespace std;
+using namespace boost;
+
+#define PROGRAM "abyss-longseqdist"
+
+static const char VERSION_MESSAGE[] =
+PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
+"Written by Anthony Raymond.\n"
+"\n"
+"Copyright 2014 Canada's Michael Smith Genome Science Centre\n";
+
+static const char USAGE_MESSAGE[] =
+"Usage: " PROGRAM " -k<kmer> [OPTION]... SAM >DIST\n"
+"Generate distance estimates between all contigs a single\n"
+"read maps to.\n"
+"\n"
+" Arguments:\n"
+"\n"
+" SAM BWA-MEM alignments of long sequences to the assembly\n"
+" DIST estimates of the distance between contigs\n"
+"\n"
+" Options:\n"
+"\n"
+" -k, --kmer=N length of a k-mer\n"
+" --min-gap=N minimum scaffold gap length to output [200]\n"
+" -v, --verbose display verbose output\n"
+" --help display this help and exit\n"
+" --version output version information and exit\n"
+"\n"
+"Report bugs to <" PACKAGE_BUGREPORT ">.\n";
+
+namespace opt {
+ unsigned k; // used by ContigProperties
+
+ /** Minimum scaffold gap length to output. */
+ static int minGap = 200;
+
+ /** Verbose output. */
+ int verbose; // used by PopBubbles
+
+ /** Output format */
+ int format = DOT; // used by DistanceEst
+}
+
+static const char shortopts[] = "k:n:o:v";
+
+enum { OPT_HELP = 1, OPT_VERSION, OPT_MIN_GAP };
+
+static const struct option longopts[] = {
+ { "kmer", required_argument, NULL, 'k' },
+ { "min-gap", required_argument, NULL, OPT_MIN_GAP },
+ { "verbose", no_argument, NULL, 'v' },
+ { "help", no_argument, NULL, OPT_HELP },
+ { "version", no_argument, NULL, OPT_VERSION },
+ { NULL, 0, NULL, 0 }
+};
+
+/** A distance estimate graph. */
+typedef DirectedGraph<Length, DistanceEst> DG;
+typedef ContigGraph<DG> Graph;
+
+static void processQuery(vector<Alignment>& recs, Graph& g)
+{
+ typedef graph_traits<Graph>::vertex_descriptor V;
+ typedef graph_traits<Graph>::edge_descriptor E;
+ typedef edge_property<Graph>::type EP;
+ if (recs.size() <= 1)
+ return;
+
+ sort(recs.begin(), recs.end());
+ for (vector<Alignment>::const_iterator itx = recs.begin();
+ itx != recs.end(); itx++) {
+ for (vector<Alignment>::const_iterator ity = itx + 1;
+ ity != recs.end(); ity++) {
+ // if aligned to the same contig, don't draw self edge
+ if (itx->contig == ity->contig)
+ continue;
+
+ // if y is subsumed in x don't draw edge
+ unsigned xqend = itx->read_start_pos + itx->align_length;
+ unsigned yqend = ity->read_start_pos + ity->align_length;
+ if (xqend >= yqend)
+ continue;
+
+ V u = find_vertex(itx->contig, itx->isRC, g);
+ V v = find_vertex(ity->contig, ity->isRC, g);
+ E e;
+ EP ep(opt::minGap, 1, opt::minGap);
+ bool found;
+ tie(e, found) = edge(u, v, g);
+ if (found) {
+ EP& ep = g[e];
+ ep.numPairs++;
+ } else
+ add_edge(u, v, ep, g);
+ }
+ }
+}
+
+static void readAlignments(istream& in, Graph& g)
+{
+ SAMRecord rec, prev;
+ vector<Alignment> recs;
+ int i = 0;
+ while (prev.isUnmapped() || prev.mapq == 0)
+ in >> prev;
+ recs.push_back(prev);
+ while (in >> rec) {
+ if (rec.isUnmapped() || rec.mapq == 0)
+ continue;
+ if (opt::verbose > 0 && ++i % 100000 == 0)
+ cerr << "Processed " << i << " good alignments...\n";
+ if (rec.qname != prev.qname) {
+ processQuery(recs, g);
+ recs.clear();
+ prev = rec;
+ recs.push_back(prev);
+ } else
+ recs.push_back(rec);
+ }
+ if (opt::verbose > 0)
+ cerr << "Processed " << i << " good alignments.\n";
+ processQuery(recs, g);
+}
+
+int main(int argc, char** argv)
+{
+ bool die = false;
+ for (int c; (c = getopt_long(argc, argv,
+ shortopts, longopts, NULL)) != -1;) {
+ istringstream arg(optarg != NULL ? optarg : "");
+ switch (c) {
+ case '?':
+ die = true;
+ break;
+ case 'k':
+ arg >> opt::k;
+ break;
+ case 'v':
+ opt::verbose++;
+ break;
+ case OPT_MIN_GAP:
+ arg >> opt::minGap;
+ break;
+ case OPT_HELP:
+ cout << USAGE_MESSAGE;
+ exit(EXIT_SUCCESS);
+ case OPT_VERSION:
+ cout << VERSION_MESSAGE;
+ exit(EXIT_SUCCESS);
+ }
+ if (optarg != NULL && !arg.eof()) {
+ cerr << PROGRAM ": invalid option: `-"
+ << (char)c << optarg << "'\n";
+ exit(EXIT_FAILURE);
+ }
+ }
+
+ if (opt::k <= 0) {
+ cerr << PROGRAM ": missing -k,--kmer option\n";
+ die = true;
+ }
+
+ if (argc - optind != 1) {
+ cerr << PROGRAM ": incorrect number of arguments\n";
+ die = true;
+ }
+
+ if (die) {
+ cerr << "Try `" << PROGRAM
+ << " --help' for more information.\n";
+ exit(EXIT_FAILURE);
+ }
+
+ if (opt::verbose > 0)
+ cerr << "Reading graph file '" << argv[optind] << "`...\n";
+ Graph g;
+ ifstream in(argv[optind]);
+ in >> g;
+ g_contigNames.lock();
+ if (opt::verbose > 0)
+ cerr << "Finished reading graph.\n";
+ if (in.eof()) {
+ cerr << PROGRAM ": there are no alignments\n";
+ exit(EXIT_FAILURE);
+ }
+
+ if (opt::verbose > 0)
+ cerr << "Processing alignments from '" << argv[optind] << "`...\n";
+ readAlignments(in, g);
+ write_dot(cout, g);
+ return 0;
+}
diff --git a/Scaffold/scaffold.cc b/Scaffold/scaffold.cc
index bd61e20..1ad0736 100644
--- a/Scaffold/scaffold.cc
+++ b/Scaffold/scaffold.cc
@@ -37,10 +37,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... FASTA|OVERLAP DIST...\n"
+"Usage: " PROGRAM " -k<kmer> [OPTION]... FASTA|OVERLAP DIST...\n"
"Scaffold contigs using the distance estimate graph.\n"
"\n"
" Arguments:\n"
@@ -57,6 +57,10 @@ static const char USAGE_MESSAGE[] =
" that maximizes the scaffold N50.\n"
" -k, --kmer=N length of a k-mer\n"
" --min-gap=N minimum scaffold gap length to output [50]\n"
+" --complex remove complex transitive edges\n"
+" --no-complex don't remove complex transitive edges [default]\n"
+" --SS expect contigs to be oriented correctly\n"
+" --no-SS no assumption about contig orientation [default]\n"
" -o, --out=FILE write the paths to FILE\n"
" -g, --graph=FILE write the graph to FILE\n"
" -v, --verbose display verbose output\n"
@@ -84,16 +88,22 @@ namespace opt {
/** Write the graph to this file. */
static string graphPath;
+ /** Run a strand-specific RNA-Seq assembly. */
+ static int ss;
+
/** Verbose output. */
int verbose; // used by PopBubbles
/** Output format */
int format = DOT; // used by DistanceEst
+
+ /** Remove complex transitive edges */
+ static int comp_trans;
}
static const char shortopts[] = "g:k:n:o:s:v";
-enum { OPT_HELP = 1, OPT_VERSION, OPT_MIN_GAP };
+enum { OPT_HELP = 1, OPT_VERSION, OPT_MIN_GAP, OPT_COMP };
static const struct option longopts[] = {
{ "graph", no_argument, NULL, 'g' },
@@ -102,6 +112,10 @@ static const struct option longopts[] = {
{ "npairs", required_argument, NULL, 'n' },
{ "out", required_argument, NULL, 'o' },
{ "seed-length", required_argument, NULL, 's' },
+ { "complex", no_argument, &opt::comp_trans, 1 },
+ { "no-complex", no_argument, &opt::comp_trans, 0 },
+ { "SS", no_argument, &opt::ss, 1 },
+ { "no-SS", no_argument, &opt::ss, 0 },
{ "verbose", no_argument, NULL, 'v' },
{ "help", no_argument, NULL, OPT_HELP },
{ "version", no_argument, NULL, OPT_VERSION },
@@ -142,8 +156,6 @@ struct PoorSupport {
static void filterGraph(Graph& g, unsigned minContigLength)
{
typedef graph_traits<Graph> GTraits;
- typedef GTraits::edge_descriptor E;
- typedef GTraits::edge_iterator Eit;
typedef GTraits::vertex_descriptor V;
typedef GTraits::vertex_iterator Vit;
@@ -258,8 +270,6 @@ static void resolveForks(Graph& g, const Graph& g0)
*/
static void pruneTips(Graph& g)
{
- typedef graph_traits<Graph>::vertex_descriptor V;
-
/** Identify the tips. */
size_t n = 0;
pruneTips(g, CountingOutputIterator(n));
@@ -565,7 +575,12 @@ unsigned scaffold(const Graph& g0, unsigned minContigLength,
removeRepeats(g);
// Remove transitive edges.
- unsigned numTransitive = remove_transitive_edges(g);
+ unsigned numTransitive;
+ if (opt::comp_trans)
+ numTransitive = remove_complex_transitive_edges(g);
+ else
+ numTransitive = remove_transitive_edges(g);
+
if (opt::verbose > 0) {
cerr << "Removed " << numTransitive << " transitive edges.\n";
printGraphStats(cerr, g);
@@ -595,7 +610,7 @@ unsigned scaffold(const Graph& g0, unsigned minContigLength,
// Assemble the paths.
ContigPaths paths;
- assembleDFS(g, back_inserter(paths));
+ assembleDFS(g, back_inserter(paths), opt::ss);
sort(paths.begin(), paths.end());
if (opt::verbose > 0) {
unsigned n = 0;
@@ -731,7 +746,7 @@ int main(int argc, char** argv)
remove_edge_if(InvalidEdge(g), static_cast<DG&>(g));
unsigned numRemoved = numBefore - num_edges(g);
if (numRemoved > 0)
- cerr << "waning: Removed "
+ cerr << "warning: Removed "
<< numRemoved << " invalid edges.\n";
if (opt::minContigLengthEnd == 0) {
diff --git a/SimpleGraph/Makefile.am b/SimpleGraph/Makefile.am
index 52ea487..e58574e 100644
--- a/SimpleGraph/Makefile.am
+++ b/SimpleGraph/Makefile.am
@@ -1,14 +1,12 @@
bin_PROGRAMS = SimpleGraph
-SimpleGraph_CPPFLAGS = -pthread -I$(top_srcdir) \
+SimpleGraph_CPPFLAGS = -I$(top_srcdir) \
-I$(top_srcdir)/Common
-SimpleGraph_CXXFLAGS = -Wno-strict-aliasing
+SimpleGraph_CXXFLAGS = $(AM_CXXFLAGS) -Wno-strict-aliasing
SimpleGraph_LDADD = \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/Common/libcommon.a
-
-SimpleGraph_LDFLAGS = -pthread
+ $(top_builddir)/Common/libcommon.a \
+ -lpthread
SimpleGraph_SOURCES = SimpleGraph.cpp
diff --git a/SimpleGraph/Makefile.in b/SimpleGraph/Makefile.in
deleted file mode 100644
index 9569104..0000000
--- a/SimpleGraph/Makefile.in
+++ /dev/null
@@ -1,590 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-bin_PROGRAMS = SimpleGraph$(EXEEXT)
-subdir = SimpleGraph
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__installdirs = "$(DESTDIR)$(bindir)"
-PROGRAMS = $(bin_PROGRAMS)
-am_SimpleGraph_OBJECTS = SimpleGraph-SimpleGraph.$(OBJEXT)
-SimpleGraph_OBJECTS = $(am_SimpleGraph_OBJECTS)
-SimpleGraph_DEPENDENCIES = $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/Common/libcommon.a
-SimpleGraph_LINK = $(CXXLD) $(SimpleGraph_CXXFLAGS) $(CXXFLAGS) \
- $(SimpleGraph_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(SimpleGraph_SOURCES)
-DIST_SOURCES = $(SimpleGraph_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-SimpleGraph_CPPFLAGS = -pthread -I$(top_srcdir) \
- -I$(top_srcdir)/Common
-
-SimpleGraph_CXXFLAGS = -Wno-strict-aliasing
-SimpleGraph_LDADD = \
- $(top_builddir)/Graph/libgraph.a \
- $(top_builddir)/Common/libcommon.a
-
-SimpleGraph_LDFLAGS = -pthread
-SimpleGraph_SOURCES = SimpleGraph.cpp
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cpp .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign SimpleGraph/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign SimpleGraph/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-binPROGRAMS: $(bin_PROGRAMS)
- @$(NORMAL_INSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do echo "$$p $$p"; done | \
- sed 's/$(EXEEXT)$$//' | \
- while read p p1; do if test -f $$p \
- ; then echo "$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n;h' \
- -e 's|.*|.|' \
- -e 'p;x;s,.*/,,;s/$(EXEEXT)$$//;$(transform);s/$$/$(EXEEXT)/' | \
- sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1 } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) files[d] = files[d] " " $$1; \
- else { print "f", $$3 "/" $$4, $$1; } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_PROGRAM_ENV) $(INSTALL_PROGRAM) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-binPROGRAMS:
- @$(NORMAL_UNINSTALL)
- @list='$(bin_PROGRAMS)'; test -n "$(bindir)" || list=; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 'h;s,^.*/,,;s/$(EXEEXT)$$//;$(transform)' \
- -e 's/$$/$(EXEEXT)/' \
- `; \
- test -n "$$list" || exit 0; \
- echo " ( cd '$(DESTDIR)$(bindir)' && rm -f" $$files ")"; \
- cd "$(DESTDIR)$(bindir)" && rm -f $$files
-
-clean-binPROGRAMS:
- -test -z "$(bin_PROGRAMS)" || rm -f $(bin_PROGRAMS)
-
-SimpleGraph$(EXEEXT): $(SimpleGraph_OBJECTS) $(SimpleGraph_DEPENDENCIES) $(EXTRA_SimpleGraph_DEPENDENCIES)
- @rm -f SimpleGraph$(EXEEXT)
- $(AM_V_CXXLD)$(SimpleGraph_LINK) $(SimpleGraph_OBJECTS) $(SimpleGraph_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/SimpleGraph-SimpleGraph.Po at am__quote@
-
-.cpp.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cpp.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-SimpleGraph-SimpleGraph.o: SimpleGraph.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(SimpleGraph_CPPFLAGS) $(CPPFLAGS) $(SimpleGraph_CXXFLAGS) $(CXXFLAGS) -MT SimpleGraph-SimpleGraph.o -MD -MP -MF $(DEPDIR)/SimpleGraph-SimpleGraph.Tpo -c -o SimpleGraph-SimpleGraph.o `test -f 'SimpleGraph.cpp' || echo '$(srcdir)/'`SimpleGraph.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/SimpleGraph-SimpleGraph.Tpo $(DEPDIR)/SimpleGraph-SimpleGraph.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='SimpleGraph.cpp' object='SimpleGraph-SimpleGraph.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(SimpleGraph_CPPFLAGS) $(CPPFLAGS) $(SimpleGraph_CXXFLAGS) $(CXXFLAGS) -c -o SimpleGraph-SimpleGraph.o `test -f 'SimpleGraph.cpp' || echo '$(srcdir)/'`SimpleGraph.cpp
-
-SimpleGraph-SimpleGraph.obj: SimpleGraph.cpp
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(SimpleGraph_CPPFLAGS) $(CPPFLAGS) $(SimpleGraph_CXXFLAGS) $(CXXFLAGS) -MT SimpleGraph-SimpleGraph.obj -MD -MP -MF $(DEPDIR)/SimpleGraph-SimpleGraph.Tpo -c -o SimpleGraph-SimpleGraph.obj `if test -f 'SimpleGraph.cpp'; then $(CYGPATH_W) 'SimpleGraph.cpp'; else $(CYGPATH_W) '$(srcdir)/SimpleGraph.cpp'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/SimpleGraph-SimpleGraph.Tpo $(DEPDIR)/SimpleGraph-SimpleGraph.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='SimpleGraph.cpp' object='SimpleGraph-SimpleGraph.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(SimpleGraph_CPPFLAGS) $(CPPFLAGS) $(SimpleGraph_CXXFLAGS) $(CXXFLAGS) -c -o SimpleGraph-SimpleGraph.obj `if test -f 'SimpleGraph.cpp'; then $(CYGPATH_W) 'SimpleGraph.cpp'; else $(CYGPATH_W) '$(srcdir)/SimpleGraph.cpp'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-binPROGRAMS clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-binPROGRAMS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-binPROGRAMS
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean \
- clean-binPROGRAMS clean-generic cscopelist-am ctags ctags-am \
- distclean distclean-compile distclean-generic distclean-tags \
- distdir dvi dvi-am html html-am info info-am install \
- install-am install-binPROGRAMS install-data install-data-am \
- install-dvi install-dvi-am install-exec install-exec-am \
- install-html install-html-am install-info install-info-am \
- install-man install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-compile mostlyclean-generic pdf pdf-am \
- ps ps-am tags tags-am uninstall uninstall-am \
- uninstall-binPROGRAMS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/SimpleGraph/SimpleGraph.cpp b/SimpleGraph/SimpleGraph.cpp
index e8a5118..2554485 100644
--- a/SimpleGraph/SimpleGraph.cpp
+++ b/SimpleGraph/SimpleGraph.cpp
@@ -30,10 +30,10 @@ static const char VERSION_MESSAGE[] =
PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Written by Jared Simpson and Shaun Jackman.\n"
"\n"
-"Copyright 2013 Canada's Michael Smith Genome Science Centre\n";
+"Copyright 2014 Canada's Michael Smith Genome Sciences Centre\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... ADJ DIST\n"
+"Usage: " PROGRAM " -k<kmer> -o<out.path> [OPTION]... ADJ DIST\n"
"Find paths through contigs using distance estimates.\n"
"\n"
" Arguments:\n"
@@ -94,6 +94,7 @@ static const struct option longopts[] = {
{ NULL, 0, NULL, 0 }
};
+typedef ContigGraph<DirectedGraph<ContigProperties, Distance> > Graph;
static void generatePathsThroughEstimates(const Graph& g,
const string& estPath);
@@ -258,7 +259,7 @@ struct ComparePathLength
unsigned lenA = calculatePathLength(m_g, m_origin, a);
unsigned lenB = calculatePathLength(m_g, m_origin, b);
return lenA < lenB
- || lenA == lenB && a.size() < b.size();
+ || (lenA == lenB && a.size() < b.size());
}
private:
const Graph& m_g;
diff --git a/Unittest/Common/BitUtilTest.cpp b/Unittest/Common/BitUtilTest.cpp
new file mode 100644
index 0000000..311d16e
--- /dev/null
+++ b/Unittest/Common/BitUtilTest.cpp
@@ -0,0 +1,17 @@
+#include "Common/BitUtil.h"
+#include "gtest/gtest.h"
+
+/** Test limits */
+TEST(popcountTest, boundaries)
+{
+ EXPECT_EQ(64ULL, popcount(0xffffffffffffffffULL));
+ EXPECT_EQ(0ULL, popcount(0ULL));
+}
+
+/** Test some random values */
+TEST(popcountTest, random_values)
+{
+ EXPECT_EQ(45ULL, popcount(0x992E54FFFFFFFBA1ULL));
+ EXPECT_EQ(45ULL, popcount(0x814BC5FFFFFFF7FULL));
+ EXPECT_EQ(46ULL, popcount(0x815BC5FFFFFFF7FULL));
+}
diff --git a/Unittest/Common/HistogramTest.cpp b/Unittest/Common/HistogramTest.cpp
new file mode 100644
index 0000000..7db37e3
--- /dev/null
+++ b/Unittest/Common/HistogramTest.cpp
@@ -0,0 +1,53 @@
+#include "Common/Histogram.h"
+#include "gtest/gtest.h"
+
+
+// test Histogram.empty()
+TEST(emptyTest, base_cases)
+{
+ Histogram hi;
+ EXPECT_TRUE(hi.empty());
+ hi.insert(2);
+ EXPECT_FALSE(hi.empty());
+ hi.insert(4);
+ EXPECT_FALSE(hi.empty());
+}
+
+// test Histogram.count()
+TEST(countTest, non_negative_cases)
+{
+ Histogram hi;
+ hi.insert(2);
+ hi.insert(4);
+ EXPECT_EQ(hi.size(), (unsigned)2);
+ hi.insert(6);
+ hi.insert(8);
+ hi.insert(10, 5);
+ EXPECT_EQ(hi.size(), (unsigned)9);
+ EXPECT_EQ(hi.count(INT_MIN, INT_MAX), (unsigned)9);
+ EXPECT_EQ(hi.count(8, 10), (unsigned)6);
+ hi.insert(12);
+ EXPECT_EQ(hi.size(), (unsigned)10);
+ EXPECT_EQ(hi.count(INT_MIN, INT_MAX), (unsigned)10);
+}
+
+// test Histogram.sum()
+TEST(sumTest, trivial_cases)
+{
+ Histogram hello;
+ EXPECT_EQ(hello.sum(), (unsigned)0);
+}
+
+// test Histogram.removeNoise()
+TEST(removeNoise, one_entry)
+{
+ Histogram hi;
+ hi.insert(10, 5);
+ EXPECT_EQ(hi.size(), 5u);
+ hi.removeNoise();
+ EXPECT_EQ(hi.size(), 5u);
+ hi.insert(20, 10);
+ EXPECT_EQ(hi.size(), 15u);
+ hi.removeNoise();
+ EXPECT_EQ(hi.size(), 10u);
+}
diff --git a/Unittest/Common/KmerIteratorTest.cpp b/Unittest/Common/KmerIteratorTest.cpp
new file mode 100644
index 0000000..1e0b382
--- /dev/null
+++ b/Unittest/Common/KmerIteratorTest.cpp
@@ -0,0 +1,48 @@
+#include "Common/KmerIterator.h"
+#include <gtest/gtest.h>
+
+TEST(KmerIteratorTest, NoIllegalChars)
+{
+ unsigned k = 3;
+ Kmer::setLength(k);
+ KmerIterator i("AGCTA", k);
+
+ ASSERT_EQ(Kmer("AGC"), *i);
+ i++;
+ ASSERT_EQ(Kmer("GCT"), *i);
+ i++;
+ ASSERT_EQ(Kmer("CTA"), *i);
+ i++;
+ ASSERT_EQ(KmerIterator::end(), i);
+}
+
+TEST(KmerIteratorTest, IllegalChars)
+{
+ unsigned k = 3;
+ Kmer::setLength(k);
+ KmerIterator i("AGCTNTAG", k);
+
+ ASSERT_EQ(Kmer("AGC"), *i);
+ i++;
+ ASSERT_EQ(Kmer("GCT"), *i);
+ i++;
+ ASSERT_EQ(Kmer("TAG"), *i);
+ i++;
+ ASSERT_EQ(KmerIterator::end(), i);
+}
+
+TEST(KmerIteratorTest, SeqLengthOneLessThanK)
+{
+ unsigned k = 3;
+ Kmer::setLength(k);
+ KmerIterator i("AG", k);
+ ASSERT_EQ(KmerIterator::end(), i);
+}
+
+TEST(KmerIteratorTest, SeqLengthMuchLessThanK)
+{
+ unsigned k = 10;
+ Kmer::setLength(k);
+ KmerIterator i("AG", k);
+ ASSERT_EQ(KmerIterator::end(), i);
+}
diff --git a/Unittest/Common/KmerTest.cpp b/Unittest/Common/KmerTest.cpp
new file mode 100644
index 0000000..b88abea
--- /dev/null
+++ b/Unittest/Common/KmerTest.cpp
@@ -0,0 +1,32 @@
+#include "Common/Kmer.h"
+#include <gtest/gtest.h>
+#include <iostream>
+
+TEST(Kmer, canonicalize)
+{
+ Kmer::setLength(4);
+ Kmer canonical("ATGC");
+ Kmer nonCanonical("GCAT");
+ Kmer palindrome("ACGT");
+
+ Kmer kmer = canonical;
+ kmer.canonicalize();
+ EXPECT_EQ(canonical, kmer);
+
+ kmer = nonCanonical;
+ kmer.canonicalize();
+ EXPECT_EQ(canonical, kmer);
+
+ kmer = palindrome;
+ kmer.canonicalize();
+ EXPECT_EQ(palindrome, kmer);
+
+ Kmer::setLength(5);
+ Kmer oddLength("GCTCG");
+ Kmer oddLengthCanonical("CGAGC");
+
+ kmer = oddLength;
+ kmer.canonicalize();
+ EXPECT_EQ(oddLengthCanonical, kmer);
+}
+
diff --git a/Unittest/Common/SAM.cc b/Unittest/Common/SAM.cc
new file mode 100644
index 0000000..a14a6e4
--- /dev/null
+++ b/Unittest/Common/SAM.cc
@@ -0,0 +1,64 @@
+#include "Common/SAM.h"
+#include <gtest/gtest.h>
+
+/** Verify SAM records are stored and used correctly */
+
+using namespace std;
+
+/** @Return whether two Alignments are equivalent. */
+bool operator==(const Alignment& a, const Alignment& b)
+{
+ return a.read_start_pos == b.read_start_pos &&
+ a.align_length == b.align_length &&
+ a.read_length == b.read_length;
+}
+
+
+// Test SAM::parseCigar()
+TEST(parseCigar, check_alignment)
+{
+ Alignment a;
+ a.align_length = 40;
+ a.read_start_pos = 0;
+ a.read_length = 40;
+ EXPECT_EQ(a, SAMAlignment::parseCigar("40M", false));
+
+ a.align_length = 40;
+ a.read_start_pos = 20;
+ a.read_length = 60;
+ EXPECT_EQ(a, SAMAlignment::parseCigar("20S40M", false));
+
+ a.align_length = 40;
+ a.read_start_pos = 0;
+ a.read_length = 60;
+ EXPECT_EQ(a, SAMAlignment::parseCigar("40M20S", false));
+ EXPECT_EQ(a, SAMAlignment::parseCigar("20S40M", true));
+
+ a.align_length = 40;
+ a.read_start_pos = 20;
+ a.read_length = 70;
+ EXPECT_EQ(a, SAMAlignment::parseCigar("20S40M10S", false));
+ EXPECT_EQ(a, SAMAlignment::parseCigar("10S40M20S", true));
+
+ a.align_length = 40;
+ a.read_start_pos = 20;
+ a.read_length = 70;
+ EXPECT_EQ(a, SAMAlignment::parseCigar("20I40M10S", false));
+
+ a.align_length = 40;
+ a.read_start_pos = 30;
+ a.read_length = 80;
+ EXPECT_EQ(a, SAMAlignment::parseCigar("20M10I40M10S", false));
+
+ a.align_length = 40;
+ a.read_start_pos = 0;
+ a.read_length = 80;
+ EXPECT_EQ(a, SAMAlignment::parseCigar("40M10I20M10S", false));
+}
+
+// Check that we error when an invalid CIGAR is given.
+TEST(parseCigarDeath, invalid_cigar)
+{
+ EXPECT_DEATH(SAMAlignment::parseCigar("20SS", false), "error: invalid CIGAR: `20SS'");
+ EXPECT_DEATH(SAMAlignment::parseCigar("20m", false), "error: invalid CIGAR: `20m'");
+}
diff --git a/Unittest/Common/Sequence.cc b/Unittest/Common/Sequence.cc
new file mode 100644
index 0000000..e481e1c
--- /dev/null
+++ b/Unittest/Common/Sequence.cc
@@ -0,0 +1,13 @@
+#include "Common/Sequence.h"
+
+#include <gtest/gtest.h>
+
+using namespace std;
+
+TEST(reverseComplement, base)
+{
+ string s = "AGATGTGCTGCCGCCTTGGACAGCGTTACCTCTAATAACAGTCCCTATGA";
+ string rc = "TCATAGGGACTGTTATTAGAGGTAACGCTGTCCAAGGCGGCAGCACATCT";
+ EXPECT_EQ(reverseComplement(s), rc);
+ EXPECT_EQ(reverseComplement(reverseComplement(s)), s);
+}
diff --git a/Unittest/Common/StringUtilTest.cpp b/Unittest/Common/StringUtilTest.cpp
new file mode 100644
index 0000000..4ac4152
--- /dev/null
+++ b/Unittest/Common/StringUtilTest.cpp
@@ -0,0 +1,164 @@
+#include "Common/StringUtil.h"
+#include "gtest/gtest.h"
+using namespace std;
+
+TEST(chop_test, base_case_2)
+{
+ string myString = "me";
+ EXPECT_EQ((unsigned)2, myString.length());
+ EXPECT_EQ('e', chop(myString));
+ EXPECT_EQ((unsigned)1, myString.length());
+}
+
+TEST(chop_test, trivial_gt_length2)
+{
+ string myString = "something";
+ EXPECT_EQ((unsigned)9, myString.length());
+ EXPECT_EQ('g', chop(myString));
+ EXPECT_EQ((unsigned)8, myString.length());
+ EXPECT_EQ('n', chop(myString));
+ EXPECT_EQ((unsigned)7, myString.length());
+}
+
+TEST(chomp_test, base_cases)
+{
+ // test .length=1
+ string myString = "a";
+ EXPECT_TRUE(1 == myString.length());
+ EXPECT_FALSE(chomp(myString));
+ string anotherString = "\n";
+ EXPECT_TRUE(1 == anotherString.length());
+ EXPECT_TRUE(chomp(anotherString));
+
+ // test .length=2
+ string greatString = "ab";
+ EXPECT_FALSE(chomp(greatString));
+ EXPECT_EQ((unsigned)2, greatString.length());
+
+ string badString = "a\n";
+ EXPECT_TRUE(chomp(badString));
+ EXPECT_EQ((unsigned)1, badString.length());
+}
+
+TEST(toSI_test, all_the_cases)
+{
+ // negative and zero values
+ EXPECT_EQ ("-0.000123 ", toSI(-0.0001234));
+ EXPECT_EQ("1e-13 ", toSI(0.0000000000001));
+ EXPECT_EQ("-1.2e-13 ", toSI(-0.00000000000012));
+ EXPECT_EQ("-1.23e-13 ", toSI(-0.000000000000123456));
+ EXPECT_EQ("0 ", toSI(0));
+ EXPECT_EQ("-0 ", toSI(-0.000));
+
+ //trivially all posible values
+ EXPECT_EQ("1.23 k", toSI(1234));
+ EXPECT_EQ("123 M", toSI(123440111));
+ EXPECT_EQ("23.4 M", toSI(23440111));
+ EXPECT_EQ("1.23 G", toSI(1234123123));
+ EXPECT_EQ("123 G", toSI(123440111222));
+ EXPECT_EQ("23.4 G", toSI(23440222111));
+}
+
+template <typename T>
+class MultiTypes{
+ public:
+ T myVar;
+ void type_int() { ::testing::StaticAssertTypeEq<int, T>(); }
+ void type_double() { ::testing::StaticAssertTypeEq<double, T>(); }
+ void type_string() { ::testing::StaticAssertTypeEq<string, T>(); }
+};
+
+TEST(toEng_test, integer_cases)
+{
+ EXPECT_EQ("1234", toEng(1234));
+
+ MultiTypes<int> temp;
+ temp.type_int();
+ temp.myVar = 1234;
+ EXPECT_EQ(temp.myVar, 1234);
+ EXPECT_EQ("1234", toEng(temp.myVar));
+ temp.myVar = 12345678;
+
+ EXPECT_EQ("12.35e6", toEng(temp.myVar));
+ temp.myVar = 123456789;
+ EXPECT_EQ ("123.5e6" , toEng(temp.myVar));
+}
+
+TEST(toEng_test, double_cases)
+{
+ MultiTypes<double> temp;
+ temp.type_double();
+
+ temp.myVar = 123.456;
+ EXPECT_EQ (temp.myVar, 123.456);
+ EXPECT_EQ ("123.5", toEng(temp.myVar));
+ temp.myVar = 123456789.9;
+ EXPECT_EQ ("123.5e6", toEng(temp.myVar));
+}
+
+TEST(toEng_test, string_cases)
+{
+ MultiTypes<string> temp;
+ temp.type_string();
+ temp.myVar = "123.456";
+}
+
+TEST (startsWith_test, trivial_cases)
+{
+ EXPECT_TRUE (startsWith("hello", "hell"));
+ EXPECT_TRUE (startsWith("hello", "h"));
+ EXPECT_FALSE (startsWith("hello", "hello"));
+ EXPECT_TRUE (startsWith("hello", ""));
+ EXPECT_FALSE (startsWith ("whatever", "who"));
+}
+
+TEST(endsWith_test, any_cases)
+{
+ // suffix should not be the string itself
+ EXPECT_FALSE(endsWith("hello", "hello"));
+ EXPECT_FALSE(endsWith("", ""));
+ EXPECT_TRUE(endsWith("hello", ""));
+
+ // EXPECT_FALSE(endsWith("hello", NULL));
+ // NULL is not valid
+ EXPECT_TRUE(endsWith("hello", "ello"));
+ EXPECT_TRUE(endsWith("hello", "o"));
+ EXPECT_FALSE(endsWith("hell", "hello"));
+ EXPECT_FALSE(endsWith("hell", "heaven"));
+}
+
+TEST(SIToBytes_test, unit_conversions)
+{
+ EXPECT_EQ(1024u, SIToBytes("1024"));
+ EXPECT_EQ(1024u, SIToBytes("1k"));
+ EXPECT_EQ(1536u, SIToBytes("1.5k"));
+ EXPECT_EQ(1048576u, SIToBytes("1M"));
+ EXPECT_EQ(1073741824u, SIToBytes("1G"));
+ EXPECT_EQ(1099511627776u, SIToBytes("1T"));
+}
+
+TEST(SIToBytes_test, error_handling)
+{
+ unsigned long long bytes;
+
+ // non-number
+
+ istringstream nonNumber("not-a-number");
+ bytes = SIToBytes(nonNumber);
+ EXPECT_EQ(0u, bytes);
+ EXPECT_TRUE(nonNumber.fail());
+
+ // unrecognized suffix
+
+ istringstream illegalUnits("1024y");
+ bytes = SIToBytes(nonNumber);
+ EXPECT_EQ(0u, bytes);
+ EXPECT_TRUE(nonNumber.fail());
+
+ // valid string should set eof
+
+ istringstream valid("500M");
+ bytes = SIToBytes(valid);
+ EXPECT_EQ(524288000u, bytes);
+ EXPECT_TRUE(valid.eof());
+}
diff --git a/Unittest/Graph/AllPathsSearchTest.cpp b/Unittest/Graph/AllPathsSearchTest.cpp
new file mode 100644
index 0000000..a7f337b
--- /dev/null
+++ b/Unittest/Graph/AllPathsSearchTest.cpp
@@ -0,0 +1,190 @@
+#include "Graph/Path.h"
+#include "Graph/AllPathsSearch.h"
+#include "Common/UnorderedMap.h"
+#include "Common/Warnings.h"
+#include <boost/graph/adjacency_list.hpp>
+#include <gtest/gtest.h>
+#include <set>
+
+using namespace std;
+
+typedef boost::adjacency_list<boost::vecS, boost::vecS,
+ boost::bidirectionalS> Graph;
+
+// note: vertex_descriptor for adjacency_list<> is int
+typedef boost::graph_traits<Graph>::vertex_descriptor Vertex;
+// note: edge_descriptor for adjacency_list<> is int
+typedef boost::graph_traits<Graph>::edge_descriptor Edge;
+
+namespace {
+
+class AllPathsSearchTest : public ::testing::Test {
+
+protected:
+
+ Graph disconnectedGraph;
+ Graph simpleAcyclicGraph;
+ Graph simpleCyclicGraph;
+ Graph multiPathGraph;
+
+ AllPathsSearchTest() {
+
+ add_edge(0, 1, disconnectedGraph);
+ add_vertex(disconnectedGraph);
+
+ add_edge(0, 1, simpleAcyclicGraph);
+ add_edge(0, 2, simpleAcyclicGraph);
+ add_edge(2, 3, simpleAcyclicGraph);
+
+ add_edge(0, 1, simpleCyclicGraph);
+ add_edge(0, 4, simpleCyclicGraph);
+ add_edge(1, 2, simpleCyclicGraph);
+ add_edge(2, 1, simpleCyclicGraph);
+ add_edge(1, 3, simpleCyclicGraph);
+
+ add_edge(0, 1, multiPathGraph);
+ add_edge(1, 2, multiPathGraph);
+ add_edge(1, 3, multiPathGraph);
+ add_edge(2, 3, multiPathGraph);
+ add_edge(3, 4, multiPathGraph);
+ add_edge(3, 5, multiPathGraph);
+ add_edge(4, 5, multiPathGraph);
+ add_edge(5, 6, multiPathGraph);
+
+ }
+
+};
+
+TEST_F(AllPathsSearchTest, UnreachableGoal)
+{
+ vector< Path<Vertex> > paths;
+ PathSearchResult result = allPathsSearch(disconnectedGraph, 0, 2, paths);
+
+ EXPECT_EQ(NO_PATH, result);
+ EXPECT_TRUE(paths.empty());
+}
+
+TEST_F(AllPathsSearchTest, StartNodeEqualsGoal)
+{
+ vector< Path<Vertex> > paths;
+ PathSearchResult result = allPathsSearch(simpleAcyclicGraph, 0, 0, paths);
+
+ EXPECT_EQ(FOUND_PATH, result);
+ ASSERT_EQ(1u, paths.size());
+ ASSERT_EQ("0", paths[0].str());
+}
+
+TEST_F(AllPathsSearchTest, SinglePath)
+{
+ vector< Path<Vertex> > paths;
+ PathSearchResult result = allPathsSearch(simpleAcyclicGraph, 0, 3, 1, 2, 2, paths);
+
+ EXPECT_EQ(FOUND_PATH, result);
+ ASSERT_EQ(1u, paths.size());
+ ASSERT_EQ("0,2,3", paths[0].str());
+}
+
+TEST_F(AllPathsSearchTest, MultiPathGraph)
+{
+ vector< Path<Vertex> > paths;
+ PathSearchResult result = allPathsSearch(multiPathGraph, 0, 6, 4, 4, 6, paths);
+
+ set<string> expectedPaths;
+ expectedPaths.insert("0,1,3,5,6");
+ expectedPaths.insert("0,1,2,3,5,6");
+ expectedPaths.insert("0,1,3,4,5,6");
+ expectedPaths.insert("0,1,2,3,4,5,6");
+
+ EXPECT_EQ(FOUND_PATH, result);
+ ASSERT_EQ(4u, paths.size());
+
+ // check that each path is one of the expected ones
+ for (unsigned i = 0; i < 4; i++)
+ ASSERT_TRUE(expectedPaths.find(paths[i].str()) != expectedPaths.end());
+
+ // check that each path is unique
+ for (unsigned i = 0; i < 3; i++)
+ ASSERT_TRUE(paths[i].str() != paths[i+1].str());
+}
+
+TEST_F(AllPathsSearchTest, RespectsMaxPathsLimit)
+{
+ vector< Path<Vertex> > paths;
+ PathSearchResult result = allPathsSearch(multiPathGraph, 0, 6, 3, NO_LIMIT, NO_LIMIT, paths);
+ EXPECT_EQ(TOO_MANY_PATHS, result);
+}
+
+TEST_F(AllPathsSearchTest, RespectsMaxDepthLimit)
+{
+ vector< Path<Vertex> > paths;
+ PathSearchResult result = allPathsSearch(multiPathGraph, 0, 6, 4, 4, 5, paths);
+
+ // We expect the fourth path ("0,1,2,3,4,5,6")
+ // to be excluded by the max depth limit. Note that
+ // the depth of the start node is 0, and so a
+ // path of length 7 reaches depth 6.
+
+ set<string> expectedPaths;
+ expectedPaths.insert("0,1,3,5,6");
+ expectedPaths.insert("0,1,2,3,5,6");
+ expectedPaths.insert("0,1,3,4,5,6");
+
+ EXPECT_EQ(FOUND_PATH, result);
+ ASSERT_EQ(3u, paths.size());
+
+ // check that each path is one of the expected ones
+ for (unsigned i = 0; i < 3; i++)
+ ASSERT_TRUE(expectedPaths.find(paths[i].str()) != expectedPaths.end());
+
+ // check that each path is unique
+ for (unsigned i = 0; i < 2; i++)
+ ASSERT_TRUE(paths[i].str() != paths[i+1].str());
+}
+
+TEST_F(AllPathsSearchTest, RespectsMinDepthLimit)
+{
+ vector< Path<Vertex> > paths;
+ PathSearchResult result = allPathsSearch(multiPathGraph, 0, 6, 4, 5, 6, paths);
+
+ // We expect the shortest path ("0,1,3,4,6")
+ // to be excluded by the min depth limit. Note that
+ // the depth of the start node is 0, and so a
+ // path of length 5 reaches depth 4.
+
+ set<string> expectedPaths;
+ expectedPaths.insert("0,1,2,3,5,6");
+ expectedPaths.insert("0,1,3,4,5,6");
+ expectedPaths.insert("0,1,2,3,4,5,6");
+
+ EXPECT_EQ(FOUND_PATH, result);
+ ASSERT_EQ(3u, paths.size());
+
+ // check that each path is one of the expected ones
+ for (unsigned i = 0; i < 3; i++)
+ ASSERT_TRUE(expectedPaths.find(paths[i].str()) != expectedPaths.end());
+
+ // check that each path is unique
+ for (unsigned i = 0; i < 2; i++)
+ ASSERT_TRUE(paths[i].str() != paths[i+1].str());
+}
+
+TEST_F(AllPathsSearchTest, PathContainsCycle)
+{
+ vector< Path<Vertex> > paths;
+ PathSearchResult result = allPathsSearch(simpleCyclicGraph, 0, 3,
+ NO_LIMIT, 0, NO_LIMIT, paths);
+ EXPECT_EQ(PATH_CONTAINS_CYCLE, result);
+}
+
+TEST_F(AllPathsSearchTest, IgnoreCycleNotOnPath)
+{
+ vector< Path<Vertex> > paths;
+ PathSearchResult result = allPathsSearch(simpleCyclicGraph, 0, 4,
+ NO_LIMIT, 0, NO_LIMIT, paths);
+
+ EXPECT_EQ(FOUND_PATH, result);
+ ASSERT_EQ(1u, paths.size());
+ ASSERT_EQ("0,4", paths.front().str());
+}
+
+}
diff --git a/Unittest/Graph/BidirectionalBFSTest.cpp b/Unittest/Graph/BidirectionalBFSTest.cpp
new file mode 100644
index 0000000..1717d9f
--- /dev/null
+++ b/Unittest/Graph/BidirectionalBFSTest.cpp
@@ -0,0 +1,185 @@
+#include "Graph/Path.h"
+#include "Graph/BidirectionalBFS.h"
+#include "Graph/BidirectionalBFSVisitor.h"
+#include "Common/UnorderedMap.h"
+#include "Common/Warnings.h"
+#include <boost/graph/adjacency_list.hpp>
+#include <gtest/gtest.h>
+
+using namespace std;
+
+static const bool DEBUG = false;
+
+typedef boost::adjacency_list<boost::vecS, boost::vecS,
+ boost::bidirectionalS> Graph;
+
+// note: vertex_descriptor for adjacency_list<> is int
+typedef boost::graph_traits<Graph>::vertex_descriptor Vertex;
+// note: edge_descriptor for adjacency_list<> is int
+typedef boost::graph_traits<Graph>::edge_descriptor Edge;
+
+class TestVisitor : public BidirectionalBFSVisitor<Graph>
+{
+public:
+
+ typedef unordered_map<Vertex, Direction> DirMap;
+ typedef unordered_map<Vertex, int> RankMap;
+ typedef vector<Edge> EdgeList;
+
+ DirMap dirMap;
+ RankMap rankMap;
+ EdgeList commonEdges;
+ int rank;
+
+ TestVisitor() : rank(0) { }
+
+ BFSVisitorResult discover_vertex(const Vertex& u, const Graph& g, Direction dir,
+ unsigned numFrontierNodes)
+ {
+ if (DEBUG)
+ cerr << dir << ": discover_vertex " << u << "\n";
+
+ SUPPRESS_UNUSED_WARNING(g);
+ SUPPRESS_UNUSED_WARNING(numFrontierNodes);
+ return SUCCESS;
+ }
+
+ void examine_vertex(const Vertex& u, const Graph& g, Direction dir)
+ {
+ if (DEBUG)
+ cerr << dir << ": examine_vertex " << u << "\n";
+
+ SUPPRESS_UNUSED_WARNING(g);
+ dirMap[u] = dir;
+ rankMap[u] = rank++;
+ }
+
+ void examine_edge(const Edge& e, const Graph& g, Direction dir)
+ {
+ if (DEBUG)
+ cerr << dir << ": examine_edge " << e << "\n";
+
+ SUPPRESS_UNUSED_WARNING(g);
+ }
+
+ BFSVisitorResult tree_edge(const Edge& e, const Graph& g, Direction dir)
+ {
+ if (DEBUG)
+ cerr << dir << ": tree_edge " << e << "\n";
+
+ SUPPRESS_UNUSED_WARNING(g);
+ return SUCCESS;
+ }
+
+ BFSVisitorResult common_edge(const Edge& e, const Graph& g, Direction dir)
+ {
+ if (DEBUG)
+ cerr << dir << ": common_edge " << e << "\n";
+
+ SUPPRESS_UNUSED_WARNING(g);
+ commonEdges.push_back(e);
+ return SUCCESS;
+ }
+
+ BFSVisitorResult non_tree_edge(const Edge& e, const Graph& g, Direction dir)
+ {
+ if (DEBUG)
+ cerr << dir << ": non_tree_edge " << e << "\n";
+
+ SUPPRESS_UNUSED_WARNING(g);
+ commonEdges.push_back(e);
+ return SUCCESS;
+ }
+
+ void gray_target(const Edge& e, const Graph& g, Direction dir)
+ {
+ if (DEBUG)
+ cerr << dir << ": gray_target " << e << "\n";
+
+ SUPPRESS_UNUSED_WARNING(g);
+ }
+
+ void black_target(const Edge& e, const Graph& g, Direction dir)
+ {
+ if (DEBUG)
+ cerr << dir << ": black_target " << e << "\n";
+
+ SUPPRESS_UNUSED_WARNING(g);
+ }
+
+};
+
+namespace {
+
+class BidirectionalBFSTest : public ::testing::Test {
+
+protected:
+
+ Graph linearGraph;
+ Graph branchingGraph;
+
+ BidirectionalBFSTest() {
+
+ add_edge(0, 1, linearGraph);
+ add_edge(1, 2, linearGraph);
+ add_edge(2, 3, linearGraph);
+
+ add_edge(0, 1, branchingGraph);
+ add_edge(0, 2, branchingGraph);
+ add_edge(1, 3, branchingGraph);
+ add_edge(3, 4, branchingGraph);
+ add_edge(4, 6, branchingGraph);
+ add_edge(5, 6, branchingGraph);
+
+ }
+
+};
+
+TEST_F(BidirectionalBFSTest, AlternatesDirection)
+{
+ TestVisitor visitor;
+ bidirectionalBFS(linearGraph, 0, 3, visitor);
+
+ TestVisitor::DirMap& dir = visitor.dirMap;
+
+ ASSERT_EQ(dir[0], FORWARD);
+ ASSERT_EQ(dir[3], REVERSE);
+ ASSERT_EQ(dir[1], FORWARD);
+ ASSERT_EQ(dir[2], REVERSE);
+}
+
+TEST_F(BidirectionalBFSTest, FollowsBreadthFirstOrder)
+{
+ TestVisitor visitor;
+ bidirectionalBFS(branchingGraph, 0, 6, visitor);
+
+ TestVisitor::RankMap& rank = visitor.rankMap;
+
+ ASSERT_TRUE(rank[1] > rank[0]);
+ ASSERT_TRUE(rank[2] > rank[0]);
+ ASSERT_TRUE(rank[3] > rank[1]);
+ ASSERT_TRUE(rank[3] > rank[2]);
+ ASSERT_TRUE(rank[3] > rank[4]);
+ ASSERT_TRUE(rank[3] > rank[5]);
+ ASSERT_TRUE(rank[4] > rank[6]);
+ ASSERT_TRUE(rank[5] > rank[6]);
+}
+
+TEST_F(BidirectionalBFSTest, IdentifiesCommonEdge)
+{
+ TestVisitor visitor;
+ bidirectionalBFS(linearGraph, 0, 3, visitor);
+
+ TestVisitor::EdgeList& commonEdges = visitor.commonEdges;
+
+ // Note: Each common edge is visited twice. It is
+ // visited once by the forward traversal and once
+ // by the reverse traversal.
+
+ ASSERT_TRUE(commonEdges.size() == 2);
+ ASSERT_TRUE(commonEdges[0] == commonEdges[1]);
+ ASSERT_TRUE(source(commonEdges[0], linearGraph) == 1u);
+ ASSERT_TRUE(target(commonEdges[0], linearGraph) == 2u);
+}
+
+}
diff --git a/Unittest/Graph/ConstrainedBFSVisitorTest.cpp b/Unittest/Graph/ConstrainedBFSVisitorTest.cpp
new file mode 100644
index 0000000..bb3ad27
--- /dev/null
+++ b/Unittest/Graph/ConstrainedBFSVisitorTest.cpp
@@ -0,0 +1,153 @@
+#include "Graph/Path.h"
+#include "Graph/BreadthFirstSearch.h"
+#include "Graph/ConstrainedBFSVisitor.h"
+#include "Graph/DefaultColorMap.h"
+#include <boost/graph/adjacency_list.hpp>
+#include <boost/property_map/property_map.hpp>
+#include <gtest/gtest.h>
+
+using namespace std;
+using namespace boost;
+
+typedef adjacency_list<> Graph;
+typedef graph_traits<Graph>::vertex_descriptor V;
+typedef std::vector< Path<V> > PathList;
+
+namespace {
+
+class ConstrainedBFSVisitorTest : public ::testing::Test {
+
+protected:
+
+ Graph simpleAcyclicGraph;
+ Graph simpleCyclicGraph;
+
+ ConstrainedBFSVisitorTest() {
+
+ add_edge(0, 1, simpleAcyclicGraph);
+ add_edge(0, 2, simpleAcyclicGraph);
+ add_edge(2, 3, simpleAcyclicGraph);
+
+ add_edge(0, 1, simpleCyclicGraph);
+ add_edge(1, 3, simpleCyclicGraph);
+ add_edge(0, 2, simpleCyclicGraph);
+ add_edge(2, 3, simpleCyclicGraph);
+
+ }
+};
+
+TEST_F(ConstrainedBFSVisitorTest, IdentifyUniquePath)
+{
+ int start = 0;
+ int goal = 3;
+ int minDepth = 0;
+ int maxDepth = 2;
+ int maxBranches = 3;
+
+ DefaultColorMap<Graph> colorMap;
+ ConstrainedBFSVisitor<Graph> visitor(start, goal, minDepth, maxDepth, maxBranches, colorMap);
+ breadthFirstSearch(simpleAcyclicGraph, start, visitor, colorMap);
+
+ Path<V> uniquePath;
+ PathSearchResult result = visitor.uniquePathToGoal(uniquePath);
+
+ ASSERT_EQ(result, FOUND_PATH);
+ ASSERT_EQ(uniquePath.str(), "0,2,3");
+}
+
+TEST_F(ConstrainedBFSVisitorTest, RespectMaxDepthLimit)
+{
+ int start = 0;
+ int goal = 3;
+ int minDepth = 0;
+ int maxDepth = 1;
+ int maxBranches = 3;
+
+ DefaultColorMap<Graph> colorMap;
+ ConstrainedBFSVisitor<Graph> visitor(start, goal, minDepth, maxDepth, maxBranches, colorMap);
+ breadthFirstSearch(simpleAcyclicGraph, start, visitor, colorMap);
+
+ Path<V> uniquePath;
+
+ EXPECT_EQ(visitor.getMaxDepthVisited(), 1);
+ EXPECT_EQ(visitor.uniquePathToGoal(uniquePath), NO_PATH);
+}
+
+TEST_F(ConstrainedBFSVisitorTest, RespectMinDepthLimit)
+{
+ int start = 0;
+ int goal = 3;
+ int minDepth = 3;
+ int maxDepth = 10;
+ int maxBranches = 3;
+
+ DefaultColorMap<Graph> colorMap;
+ ConstrainedBFSVisitor<Graph> visitor(start, goal, minDepth, maxDepth, maxBranches, colorMap);
+ breadthFirstSearch(simpleAcyclicGraph, start, visitor, colorMap);
+
+ Path<V> uniquePath;
+
+ EXPECT_EQ(visitor.uniquePathToGoal(uniquePath), NO_PATH);
+}
+
+TEST_F(ConstrainedBFSVisitorTest, IdentifyMultiplePaths)
+{
+ int start = 0;
+ int goal = 3;
+ int minDepth = 0;
+ int maxDepth = 3;
+ int maxBranches = 3;
+
+ DefaultColorMap<Graph> colorMap;
+ ConstrainedBFSVisitor<Graph> visitor(start, goal, minDepth, maxDepth, maxBranches, colorMap);
+ breadthFirstSearch(simpleCyclicGraph, start, visitor, colorMap);
+
+ Path<V> uniquePath;
+
+ EXPECT_EQ(visitor.uniquePathToGoal(uniquePath), TOO_MANY_PATHS);
+}
+
+TEST_F(ConstrainedBFSVisitorTest, ReturnMultiplePaths)
+{
+ int start = 0;
+ int goal = 3;
+ int minDepth = 0;
+ int maxDepth = 3;
+ int maxBranches = 3;
+
+ DefaultColorMap<Graph> colorMap;
+ ConstrainedBFSVisitor<Graph> visitor(start, goal, minDepth, maxDepth, maxBranches, colorMap);
+ breadthFirstSearch(simpleCyclicGraph, start, visitor, colorMap);
+
+ PathList paths;
+ PathSearchResult result = visitor.pathsToGoal(paths, 2);
+
+ EXPECT_EQ(result, FOUND_PATH);
+ ASSERT_EQ(paths.size(), 2u);
+
+ string path1 = paths[0].str();
+ string path2 = paths[1].str();
+
+ EXPECT_TRUE(path1 != path2);
+ ASSERT_TRUE(path1 == "0,1,3" || path1 == "0,2,3");
+ ASSERT_TRUE(path2 == "0,1,3" || path2 == "0,2,3");
+}
+
+TEST_F(ConstrainedBFSVisitorTest, RespectBranchLimit)
+{
+ int start = 0;
+ int goal = 3;
+ int minDepth = 0;
+ int maxDepth = 3;
+ int maxBranches = 1;
+
+ DefaultColorMap<Graph> colorMap;
+ ConstrainedBFSVisitor<Graph> visitor(start, goal, minDepth, maxDepth, maxBranches, colorMap);
+ breadthFirstSearch(simpleAcyclicGraph, start, visitor, colorMap);
+
+ Path<V> uniquePath;
+
+ EXPECT_EQ(visitor.uniquePathToGoal(uniquePath), TOO_MANY_BRANCHES);
+}
+
+}
diff --git a/Unittest/Graph/ConstrainedBidiBFSVisitorTest.cpp b/Unittest/Graph/ConstrainedBidiBFSVisitorTest.cpp
new file mode 100644
index 0000000..bd00bd6
--- /dev/null
+++ b/Unittest/Graph/ConstrainedBidiBFSVisitorTest.cpp
@@ -0,0 +1,215 @@
+#include "Common/Warnings.h"
+#include "Graph/Path.h"
+#include "Graph/ConstrainedBidiBFSVisitor.h"
+#include "Graph/BidirectionalBFS.h"
+#include <boost/graph/adjacency_list.hpp>
+#include <boost/property_map/property_map.hpp>
+#include <limits>
+#include <gtest/gtest.h>
+
+using namespace std;
+using namespace boost;
+
+typedef adjacency_list<boost::vecS, boost::vecS, boost::bidirectionalS> Graph;
+typedef graph_traits<Graph>::vertex_descriptor V;
+typedef graph_traits<Graph>::edge_descriptor e;
+typedef std::vector< Path<V> > PathList;
+
+static const size_t NO_MEM_LIMIT = std::numeric_limits<std::size_t>::max();
+
+namespace {
+
+class ConstrainedBidiBFSVisitorTest : public ::testing::Test {
+
+protected:
+
+ Graph simpleAcyclicGraph;
+ Graph simpleCyclicGraph;
+ Graph cyclicGraph;
+
+ ConstrainedBidiBFSVisitorTest() {
+
+ add_edge(0, 1, simpleAcyclicGraph);
+ add_edge(0, 2, simpleAcyclicGraph);
+ add_edge(2, 3, simpleAcyclicGraph);
+
+ add_edge(0, 1, simpleCyclicGraph);
+ add_edge(1, 3, simpleCyclicGraph);
+ add_edge(0, 2, simpleCyclicGraph);
+ add_edge(2, 3, simpleCyclicGraph);
+
+ add_edge(0, 1, cyclicGraph);
+ add_edge(1, 2, cyclicGraph);
+ add_edge(1, 3, cyclicGraph);
+ add_edge(2, 3, cyclicGraph);
+ add_edge(3, 4, cyclicGraph);
+ add_edge(3, 5, cyclicGraph);
+ add_edge(4, 5, cyclicGraph);
+ add_edge(5, 6, cyclicGraph);
+
+ }
+};
+
+TEST_F(ConstrainedBidiBFSVisitorTest, IdentifyUniquePath)
+{
+ ConstrainedBidiBFSVisitor<Graph>
+ visitor(simpleAcyclicGraph, 0, 3, 1, 1, 3, 2, NO_MEM_LIMIT);
+ bidirectionalBFS(simpleAcyclicGraph, 0, 3, visitor);
+
+ Path<V> uniquePath;
+ PathSearchResult result = visitor.uniquePathToGoal(uniquePath);
+
+ ASSERT_EQ(FOUND_PATH, result);
+ ASSERT_EQ("0,2,3", uniquePath.str());
+}
+
+TEST_F(ConstrainedBidiBFSVisitorTest, StartEqualsGoal)
+{
+ ConstrainedBidiBFSVisitor<Graph>
+ visitor(simpleAcyclicGraph, 0, 0, 1, 1, 1, 2, NO_MEM_LIMIT);
+ bidirectionalBFS(simpleAcyclicGraph, 0, 0, visitor);
+
+ Path<V> uniquePath;
+ PathSearchResult result = visitor.uniquePathToGoal(uniquePath);
+
+ ASSERT_EQ(FOUND_PATH, result);
+ ASSERT_EQ("0", uniquePath.str());
+}
+
+TEST_F(ConstrainedBidiBFSVisitorTest, SingleEdgeToGoal)
+{
+ ConstrainedBidiBFSVisitor<Graph>
+ visitor(simpleAcyclicGraph, 0, 1, 1, 1, 2, 2, NO_MEM_LIMIT);
+ bidirectionalBFS(simpleAcyclicGraph, 0, 1, visitor);
+
+ Path<V> uniquePath;
+ PathSearchResult result = visitor.uniquePathToGoal(uniquePath);
+
+ ASSERT_EQ(FOUND_PATH, result);
+ ASSERT_EQ("0,1", uniquePath.str());
+}
+
+TEST_F(ConstrainedBidiBFSVisitorTest, RespectMaxPathLength)
+{
+ ConstrainedBidiBFSVisitor<Graph>
+ visitor(cyclicGraph, 0, 6, 4, 5, 6, 2, NO_MEM_LIMIT);
+ bidirectionalBFS(cyclicGraph, 0, 6, visitor);
+
+ vector< Path<V> > paths;
+ PathSearchResult result = visitor.pathsToGoal(paths);
+
+ // We expect the fourth path ("0,1,2,3,4,5,6")
+ // to be excluded by the max path length limit (6).
+
+ set<string> expectedPaths;
+ expectedPaths.insert("0,1,3,5,6");
+ expectedPaths.insert("0,1,2,3,5,6");
+ expectedPaths.insert("0,1,3,4,5,6");
+
+ EXPECT_EQ(FOUND_PATH, result);
+ ASSERT_EQ(3u, paths.size());
+
+ // check that each path is one of the expected ones
+ for (unsigned i = 0; i < 3; i++)
+ ASSERT_TRUE(expectedPaths.find(paths[i].str()) != expectedPaths.end());
+
+ // check that each path is unique
+ for (unsigned i = 0; i < 2; i++)
+ ASSERT_TRUE(paths[i].str() != paths[i+1].str());
+}
+
+TEST_F(ConstrainedBidiBFSVisitorTest, RespectMinPathLength)
+{
+ ConstrainedBidiBFSVisitor<Graph>
+ visitor(cyclicGraph, 0, 6, 4, 6, 7, 2, NO_MEM_LIMIT);
+ bidirectionalBFS(cyclicGraph, 0, 6, visitor);
+
+ vector< Path<V> > paths;
+ PathSearchResult result = visitor.pathsToGoal(paths);
+
+ // We expect the first path ("0,1,3,5,6")
+ // to be excluded by the min path length limit (6).
+
+ set<string> expectedPaths;
+ expectedPaths.insert("0,1,2,3,5,6");
+ expectedPaths.insert("0,1,3,4,5,6");
+ expectedPaths.insert("0,1,2,3,4,5,6");
+
+ EXPECT_EQ(FOUND_PATH, result);
+ ASSERT_EQ(3u, paths.size());
+
+ // check that each path is one of the expected ones
+ for (unsigned i = 0; i < 3; i++)
+ ASSERT_TRUE(expectedPaths.find(paths[i].str()) != expectedPaths.end());
+
+ // check that each path is unique
+ for (unsigned i = 0; i < 2; i++)
+ ASSERT_TRUE(paths[i].str() != paths[i+1].str());
+}
+
+TEST_F(ConstrainedBidiBFSVisitorTest, RespectMaxPathsLimit)
+{
+ ConstrainedBidiBFSVisitor<Graph>
+ visitor(simpleCyclicGraph, 0, 3, 1, 1, 3, 2, NO_MEM_LIMIT);
+ bidirectionalBFS(simpleCyclicGraph, 0, 3, visitor);
+
+ Path<V> uniquePath;
+ EXPECT_EQ(visitor.uniquePathToGoal(uniquePath), TOO_MANY_PATHS);
+}
+
+TEST_F(ConstrainedBidiBFSVisitorTest, ReturnMultiplePaths)
+{
+ ConstrainedBidiBFSVisitor<Graph>
+ visitor(simpleCyclicGraph, 0, 3, 2, 1, 3, 2, NO_MEM_LIMIT);
+ bidirectionalBFS(simpleCyclicGraph, 0, 3, visitor);
+
+ PathList paths;
+ PathSearchResult result = visitor.pathsToGoal(paths);
+
+ EXPECT_EQ(FOUND_PATH, result);
+ ASSERT_EQ(2u, paths.size());
+
+ string path1 = paths[0].str();
+ string path2 = paths[1].str();
+
+ EXPECT_TRUE(path1 != path2);
+ ASSERT_TRUE(path1 == "0,1,3" || path1 == "0,2,3");
+ ASSERT_TRUE(path2 == "0,1,3" || path2 == "0,2,3");
+}
+
+TEST_F(ConstrainedBidiBFSVisitorTest, RespectMaxBranches)
+{
+ ConstrainedBidiBFSVisitor<Graph>
+ visitor(simpleCyclicGraph, 0, 3, 2, 1, 3, 1, NO_MEM_LIMIT);
+ bidirectionalBFS(simpleCyclicGraph, 0, 3, visitor);
+
+ PathList paths;
+ PathSearchResult result = visitor.pathsToGoal(paths);
+
+ EXPECT_EQ(TOO_MANY_BRANCHES, result);
+ EXPECT_EQ(0u, paths.size());
+ // expect early exit from traversal
+ EXPECT_EQ(3u, visitor.getNumNodesVisited());
+}
+
+TEST_F(ConstrainedBidiBFSVisitorTest, NoLimitForBranches)
+{
+ ConstrainedBidiBFSVisitor<Graph>
+ visitor(simpleCyclicGraph, 0, 3, 2, 1, 3, NO_LIMIT, NO_MEM_LIMIT);
+ bidirectionalBFS(simpleCyclicGraph, 0, 3, visitor);
+
+ PathList paths;
+ PathSearchResult result = visitor.pathsToGoal(paths);
+
+ EXPECT_EQ(FOUND_PATH, result);
+ ASSERT_EQ(2u, paths.size());
+
+ string path1 = paths[0].str();
+ string path2 = paths[1].str();
+
+ EXPECT_TRUE(path1 != path2);
+ ASSERT_TRUE(path1 == "0,1,3" || path1 == "0,2,3");
+ ASSERT_TRUE(path2 == "0,1,3" || path2 == "0,2,3");
+}
+
+}
diff --git a/Unittest/Graph/HashGraphTest.cpp b/Unittest/Graph/HashGraphTest.cpp
new file mode 100644
index 0000000..b1a641f
--- /dev/null
+++ b/Unittest/Graph/HashGraphTest.cpp
@@ -0,0 +1,87 @@
+#include "Graph/HashGraph.h"
+#include <string>
+#include <gtest/gtest.h>
+
+using namespace std;
+
+namespace {
+
+class HashGraphTest : public ::testing::Test {
+
+protected:
+
+ typedef HashGraph<string> Graph;
+ typedef boost::graph_traits<Graph>::edge_descriptor edge_descriptor;
+ typedef boost::graph_traits<Graph>::out_edge_iterator out_edge_iterator;
+ typedef boost::graph_traits<Graph>::in_edge_iterator in_edge_iterator;
+ typedef boost::graph_traits<Graph>::vertex_descriptor vertex_descriptor;
+ typedef boost::graph_traits<Graph>::vertex_iterator vertex_iterator;
+
+ Graph simpleCyclicGraph;
+
+ string a;
+ string b;
+ string c;
+ string d;
+
+ unordered_set<string> vertexSet;
+
+ HashGraphTest() : a("a"), b("b"), c("c"), d("d") {
+
+ add_edge(a, b, simpleCyclicGraph);
+ add_edge(a, c, simpleCyclicGraph);
+ add_edge(b, d, simpleCyclicGraph);
+ add_edge(c, d, simpleCyclicGraph);
+
+ vertexSet.insert(a);
+ vertexSet.insert(b);
+ vertexSet.insert(c);
+ vertexSet.insert(d);
+
+ }
+};
+
+TEST_F(HashGraphTest, out_edge_iterator)
+{
+ edge_descriptor expectedEdge1(a, b);
+ edge_descriptor expectedEdge2(a, c);
+
+ out_edge_iterator ei, ei_end;
+ boost::tie(ei, ei_end) = out_edges(a, simpleCyclicGraph);
+
+ ASSERT_TRUE(ei != ei_end);
+ edge_descriptor edge1 = *ei;
+ EXPECT_TRUE(edge1 == expectedEdge1 || edge1 == expectedEdge2);
+
+ ei++;
+ ASSERT_TRUE(ei != ei_end);
+ edge_descriptor edge2 = *ei;
+ EXPECT_TRUE(edge2 != edge1);
+ EXPECT_TRUE(edge2 == expectedEdge1 || edge2 == expectedEdge2);
+
+ ei++;
+ EXPECT_TRUE(ei == ei_end);
+}
+
+TEST_F(HashGraphTest, vertex_iterator)
+{
+ vertex_iterator vi, vi_begin, vi_end;
+ boost::tie(vi_begin, vi_end) = vertices(simpleCyclicGraph);
+ ASSERT_TRUE(vi_begin != vi_end);
+
+ unsigned count = 0;
+ vertex_descriptor v;
+ vi = vi_begin;
+ for(; vi != vi_end; vi++, count++) {
+ // check that current vertex is different from
+ // previous vertex
+ if (vi != vi_begin)
+ EXPECT_TRUE(*vi != v);
+ vertex_descriptor v = *vi;
+ EXPECT_TRUE(vertexSet.find(v) != vertexSet.end());
+ }
+
+ EXPECT_EQ(4U, count);
+}
+
+}
diff --git a/Unittest/Konnector/BloomFilter.cc b/Unittest/Konnector/BloomFilter.cc
new file mode 100644
index 0000000..d326946
--- /dev/null
+++ b/Unittest/Konnector/BloomFilter.cc
@@ -0,0 +1,323 @@
+#include "Bloom/Bloom.h"
+#include "Bloom/BloomFilter.h"
+#include "Bloom/CascadingBloomFilter.h"
+#include "Bloom/BloomFilterWindow.h"
+#include "Bloom/CascadingBloomFilterWindow.h"
+
+#include <gtest/gtest.h>
+#include <string>
+
+using namespace std;
+
+TEST(BloomFilter, base)
+{
+ BloomFilter x(100);
+ EXPECT_EQ(x.size(), 100U);
+
+ Kmer::setLength(16);
+ Kmer a("AGATGTGCTGCCGCCT");
+ Kmer b("TGGACAGCGTTACCTC");
+ Kmer c("TAATAACAGTCCCTAT");
+ Kmer d("GATCGTGGCGGGCGAT");
+
+ x.insert(a);
+ EXPECT_EQ(x.popcount(), 1U);
+ EXPECT_TRUE(x[a]);
+ x.insert(b);
+ EXPECT_EQ(x.popcount(), 2U);
+ EXPECT_TRUE(x[b]);
+ EXPECT_TRUE(x[Bloom::hash(b) % x.size()]);
+ x.insert(Bloom::hash(c) % x.size());
+ EXPECT_EQ(x.popcount(), 3U);
+ EXPECT_TRUE(x[c]);
+ EXPECT_TRUE(x[Bloom::hash(c) % x.size()]);
+
+ EXPECT_FALSE(x[d]);
+}
+
+TEST(BloomFilter, serialization)
+{
+ BloomFilter origBloom(20);
+ EXPECT_EQ(origBloom.size(), 20U);
+
+ Kmer::setLength(16);
+ Kmer a("AGATGTGCTGCCGCCT");
+ Kmer b("TGGACAGCGTTACCTC");
+ Kmer c("TAATAACAGTCCCTAT");
+
+ origBloom.insert(a);
+ origBloom.insert(b);
+ origBloom.insert(c);
+
+ EXPECT_TRUE(origBloom[a]);
+ EXPECT_TRUE(origBloom[b]);
+ EXPECT_TRUE(origBloom[c]);
+
+ size_t origSize = origBloom.size();
+ size_t origPopcount = origBloom.popcount();
+
+ stringstream ss;
+ ss << origBloom;
+ ASSERT_TRUE(ss.good());
+
+ BloomFilter copyBloom;
+ ss >> copyBloom;
+ ASSERT_TRUE(ss.good());
+
+ EXPECT_EQ(origSize, copyBloom.size());
+ EXPECT_EQ(origPopcount, copyBloom.popcount());
+
+ EXPECT_TRUE(copyBloom[a]);
+ EXPECT_TRUE(copyBloom[b]);
+ EXPECT_TRUE(copyBloom[c]);
+}
+
+TEST(BloomFilter, union_)
+{
+ size_t bits = 100;
+ BloomFilter bloom1(bits);
+ BloomFilter bloom2(bits);
+
+ Kmer a("AGATGTGCTGCCGCCT");
+ Kmer b("TGGACAGCGTTACCTC");
+
+ bloom1.insert(a);
+ bloom2.insert(b);
+
+ EXPECT_TRUE(bloom1[a]);
+ EXPECT_FALSE(bloom1[b]);
+ EXPECT_FALSE(bloom2[a]);
+ EXPECT_TRUE(bloom2[b]);
+
+ BloomFilter unionBloom;
+
+ stringstream ss;
+ ss << bloom1;
+ ASSERT_TRUE(ss.good());
+ ss << bloom2;
+ ASSERT_TRUE(ss.good());
+
+ ss >> unionBloom;
+ ASSERT_TRUE(ss.good());
+ unionBloom.read(ss, Bloom::LOAD_UNION);
+ ASSERT_TRUE(ss.good());
+
+ EXPECT_EQ(unionBloom.size(), bits);
+ EXPECT_TRUE(unionBloom[a]);
+ EXPECT_TRUE(unionBloom[b]);
+}
+
+TEST(BloomFilter, intersect)
+{
+ size_t bits = 100;
+ BloomFilter bloom1(bits);
+ BloomFilter bloom2(bits);
+
+ Kmer a("AGATGTGCTGCCGCCT");
+ Kmer b("TGGACAGCGTTACCTC");
+ Kmer c("AGCTAGCTAGCTAGCT");
+
+ bloom1.insert(a);
+ bloom2.insert(b);
+
+ bloom1.insert(c);
+ bloom2.insert(c);
+
+ EXPECT_TRUE(bloom1[a]);
+ EXPECT_TRUE(bloom1[c]);
+ EXPECT_FALSE(bloom1[b]);
+ EXPECT_FALSE(bloom2[a]);
+ EXPECT_TRUE(bloom2[b]);
+ EXPECT_TRUE(bloom2[c]);
+
+ BloomFilter intersectBloom;
+
+ stringstream ss;
+ ss << bloom1;
+ ASSERT_TRUE(ss.good());
+ ss << bloom2;
+ ASSERT_TRUE(ss.good());
+
+ ss >> intersectBloom;
+ ASSERT_TRUE(ss.good());
+ intersectBloom.read(ss, Bloom::LOAD_INTERSECT);
+ ASSERT_TRUE(ss.good());
+
+ EXPECT_EQ(intersectBloom.size(), bits);
+ EXPECT_FALSE(intersectBloom[a]);
+ EXPECT_FALSE(intersectBloom[b]);
+ EXPECT_TRUE(intersectBloom[c]);
+}
+
+TEST(CascadingBloomFilter, base)
+{
+ CascadingBloomFilter x(100);
+ EXPECT_EQ(x.size(), 100U);
+
+ Kmer::setLength(16);
+ Kmer a("AGATGTGCTGCCGCCT");
+ Kmer b("TGGACAGCGTTACCTC");
+ Kmer c("TAATAACAGTCCCTAT");
+ Kmer d("GATCGTGGCGGGCGAT");
+
+ x.insert(a);
+ EXPECT_EQ(x.popcount(), 0U);
+ EXPECT_FALSE(x[a]);
+ x.insert(a);
+ EXPECT_EQ(x.popcount(), 1U);
+ EXPECT_TRUE(x[a]);
+ x.insert(b);
+ EXPECT_EQ(x.popcount(), 1U);
+ EXPECT_FALSE(x[b]);
+ x.insert(c);
+ EXPECT_EQ(x.popcount(), 1U);
+ EXPECT_FALSE(x[c]);
+ x.insert(b);
+ EXPECT_EQ(x.popcount(), 2U);
+ EXPECT_TRUE(x[b]);
+ EXPECT_TRUE(x[Bloom::hash(b) % x.size()]);
+ x.insert(Bloom::hash(c) % x.size());
+ EXPECT_EQ(x.popcount(), 3U);
+ EXPECT_TRUE(x[c]);
+
+ EXPECT_FALSE(x[d]);
+}
+
+TEST(BloomFilter, shrink)
+{
+ BloomFilter big(10);
+ BloomFilter small;
+
+ big.insert(1);
+ big.insert(8);
+
+ EXPECT_EQ(2U, big.popcount());
+ EXPECT_TRUE(big[1]);
+ EXPECT_TRUE(big[8]);
+
+ stringstream ss;
+ ss << big;
+ ASSERT_TRUE(ss.good());
+ small.read(ss, Bloom::LOAD_OVERWRITE, 2);
+ ASSERT_TRUE(ss.good());
+
+ EXPECT_EQ(5U, small.size());
+ EXPECT_EQ(2U, small.popcount());
+ EXPECT_TRUE(small[1]);
+ EXPECT_TRUE(small[3]);
+}
+
+TEST(BloomFilter, windowSerialization)
+{
+ size_t bits = 100;
+ size_t pos = 80;
+
+ BloomFilterWindow window(bits, bits/2, bits-1);
+
+ window.insert(pos);
+ EXPECT_TRUE(window[pos]);
+
+ stringstream ss;
+ ss << window;
+ ASSERT_TRUE(ss.good());
+
+ BloomFilterWindow windowCopy;
+ ss >> windowCopy;
+ ASSERT_TRUE(ss.good());
+ EXPECT_TRUE(windowCopy[pos]);
+ EXPECT_EQ(window.fullBloomSize(), windowCopy.fullBloomSize());
+ EXPECT_EQ(window.startBitPos(), windowCopy.startBitPos());
+ EXPECT_EQ(window.endBitPos(), windowCopy.endBitPos());
+}
+
+TEST(BloomFilter, windowUnion)
+{
+ size_t bits = 100;
+ size_t pos1 = 25;
+ size_t pos2 = 80;
+
+ BloomFilter bloom(bits);
+
+ // set a bit in both halves of bloom filter
+ // bit array
+ bloom.insert(pos1);
+ bloom.insert(pos2);
+
+ EXPECT_TRUE(bloom[pos1]);
+ EXPECT_TRUE(bloom[pos2]);
+ EXPECT_EQ(2U, bloom.popcount());
+
+ BloomFilterWindow window1(bits, 0, bits/2 - 1);
+ window1.insert(pos1);
+ EXPECT_TRUE(window1[pos1]);
+
+ BloomFilterWindow window2(bits, bits/2, bits - 1);
+ window2.insert(pos2);
+ EXPECT_TRUE(window2[pos2]);
+
+ stringstream ss;
+ ss << window1;
+ ASSERT_TRUE(ss.good());
+ ss << window2;
+ ASSERT_TRUE(ss.good());
+
+ BloomFilter unionBloom;
+ ss >> unionBloom;
+ ASSERT_TRUE(ss.good());
+ unionBloom.read(ss, Bloom::LOAD_UNION);
+ ASSERT_TRUE(ss.good());
+
+ EXPECT_EQ(2U, unionBloom.popcount());
+ EXPECT_TRUE(unionBloom[pos1]);
+ EXPECT_TRUE(unionBloom[pos2]);
+}
+
+TEST(CascadingBloomFilter, window)
+{
+ size_t bits = 100;
+ size_t pos1 = 25;
+ size_t pos2 = 80;
+ size_t pos3 = 50;
+
+ CascadingBloomFilter CascadingBloom(bits);
+
+ // set a bit in both halves of the second level
+ // bloom filter
+ CascadingBloom.insert(pos1);
+ CascadingBloom.insert(pos1);
+ CascadingBloom.insert(pos2);
+ CascadingBloom.insert(pos2);
+ CascadingBloom.insert(pos3);
+
+ EXPECT_TRUE(CascadingBloom[pos1]);
+ EXPECT_TRUE(CascadingBloom[pos2]);
+ EXPECT_EQ(2U, CascadingBloom.getBloomFilter(1).popcount());
+
+ CascadingBloomFilterWindow window1(bits, 0, bits/2 - 1);
+ window1.insert(pos1);
+ window1.insert(pos1);
+
+ CascadingBloomFilterWindow window2(bits, bits/2, bits - 1);
+ window2.insert(pos2);
+ window2.insert(pos2);
+
+ window2.insert(pos3);
+ window1.insert(pos3);
+
+ stringstream ss;
+ ss << window1;
+ ASSERT_TRUE(ss.good());
+ ss << window2;
+ ASSERT_TRUE(ss.good());
+
+ BloomFilter unionBloom;
+ ss >> unionBloom;
+ ASSERT_TRUE(ss.good());
+ unionBloom.read(ss, Bloom::LOAD_UNION);
+ ASSERT_TRUE(ss.good());
+
+ EXPECT_EQ(2U, unionBloom.popcount());
+ EXPECT_TRUE(unionBloom[pos1]);
+ EXPECT_TRUE(unionBloom[pos2]);
+ EXPECT_FALSE(unionBloom[pos3]);
+}
diff --git a/Unittest/Konnector/DBGBloomAlgorithmsTest.cpp b/Unittest/Konnector/DBGBloomAlgorithmsTest.cpp
new file mode 100644
index 0000000..7646977
--- /dev/null
+++ b/Unittest/Konnector/DBGBloomAlgorithmsTest.cpp
@@ -0,0 +1,173 @@
+#include "Konnector/DBGBloomAlgorithms.h"
+#include "Bloom/Bloom.h"
+#include "Bloom/CascadingBloomFilter.h"
+#include "Common/Sequence.h"
+#include <gtest/gtest.h>
+#include <string>
+
+using namespace std;
+
+/**
+ * Test fixture for the getStartKmerPos function.
+ *
+ * getStartKmerPos chooses the kmer at the
+ * beginning of the longest series kmer matches with
+ * within the read. In the case where there are
+ * two equal-length series of matches,
+ * getStartKmerPos choose the kmer position closest
+ * to the beginning (5' end) of the read.
+ */
+class GetStartKmerPosTest : public testing::Test {
+
+protected:
+
+ FastaRecord testRead;
+ static const int k = 2;
+ // set this large to avoid false positives
+ static const int bloomFilterSize = 1000000;
+
+ GetStartKmerPosTest() {
+ Kmer::setLength(k);
+ testRead.seq = "TACAGTG";
+ }
+
+};
+
+TEST_F(GetStartKmerPosTest, FullReadMatch)
+{
+ BloomFilter bloom(bloomFilterSize);
+ Bloom::loadSeq(bloom, k, testRead.seq);
+ DBGBloom<BloomFilter> g(bloom);
+
+ EXPECT_EQ(0U, getStartKmerPos(k, testRead, g, false, true));
+ // true indicates revese complement (second read)
+ EXPECT_EQ(0U, getStartKmerPos(k, testRead, g, true, true));
+}
+
+TEST_F(GetStartKmerPosTest, FullReadMismatch)
+{
+ BloomFilter bloom(bloomFilterSize);
+ // Leave the bloom filter empty to generate a mismatch
+ // for every kmer in the read.
+ DBGBloom<BloomFilter> g(bloom);
+ EXPECT_EQ(NO_MATCH, getStartKmerPos(k, testRead, g, false, true));
+}
+
+TEST_F(GetStartKmerPosTest, SelectLongestMatchRegion)
+{
+ const string& seq = testRead.seq;
+ BloomFilter bloom(bloomFilterSize);
+ DBGBloom<BloomFilter> g(bloom);
+
+ // This loop creates kmer match vector 101101
+ for (unsigned i = 0; i < seq.length() - k + 1; i++) {
+ // non-matching kmers
+ if (i == 1 || i == 4)
+ continue;
+ Bloom::loadSeq(bloom, k, seq.substr(i,k));
+ }
+
+ EXPECT_EQ(2U, getStartKmerPos(k, testRead, g, false, true));
+ // true indicates revese complement (second read)
+ EXPECT_EQ(getStartKmerPos(k, testRead, g),
+ getStartKmerPos(k, testRead, g, true));
+}
+
+TEST_F(GetStartKmerPosTest, EqualLengthMatchRegions)
+{
+ const string& seq = testRead.seq;
+ BloomFilter bloom(bloomFilterSize);
+ DBGBloom<BloomFilter> g(bloom);
+
+ // This loop creates kmer match vector 011011
+ for (unsigned i = 0; i < seq.length() - k + 1; i++) {
+ // non-matching kmers
+ if (i == 0 || i == 3)
+ continue;
+ Bloom::loadSeq(bloom, k, seq.substr(i,k));
+ }
+
+ EXPECT_EQ(1U, getStartKmerPos(k, testRead, g, false, true));
+ // true indicates revese complement (second read)
+ EXPECT_EQ(1U, getStartKmerPos(k, testRead, g, true, true));
+}
+
+class CorrectSingleBaseErrorTest : public testing::Test {
+
+protected:
+
+ FastaRecord correctRead;
+ FastaRecord singleErrorRead;
+ string simulatedFalsePositive;
+ static const int k = 6;
+ static const size_t errorPos1 = 4;
+ // set this large to avoid false positives
+ static const int bloomFilterSize = 1000000;
+
+ CorrectSingleBaseErrorTest() {
+ Kmer::setLength(k);
+ correctRead.seq = "TACAGTGCC";
+ singleErrorRead.seq = correctRead.seq;
+ singleErrorRead.seq[errorPos1] = 'C';
+ simulatedFalsePositive = "TGCAGT";
+ }
+
+};
+
+
+TEST_F(CorrectSingleBaseErrorTest, SingleError)
+{
+ BloomFilter bloom(bloomFilterSize);
+ Bloom::loadSeq(bloom, k, correctRead.seq);
+ DBGBloom<BloomFilter> g(bloom);
+
+ size_t correctedPos = numeric_limits<size_t>::max();
+ FastaRecord read = singleErrorRead;
+ bool success = correctSingleBaseError(g, k, read, correctedPos);
+
+ ASSERT_TRUE(success);
+ EXPECT_EQ(read.seq, read.seq);
+ EXPECT_TRUE(correctedPos == errorPos1);
+}
+
+TEST_F(CorrectSingleBaseErrorTest, ReverseComplement)
+{
+ BloomFilter bloom(bloomFilterSize);
+ Bloom::loadSeq(bloom, k, correctRead.seq);
+ DBGBloom<BloomFilter> g(bloom);
+
+ size_t correctedPos = numeric_limits<size_t>::max();
+ FastaRecord read = singleErrorRead;
+ bool success = correctSingleBaseError(g, k, read, correctedPos, true);
+
+ ASSERT_TRUE(success);
+ EXPECT_EQ(read.seq, read.seq);
+ EXPECT_TRUE(correctedPos == errorPos1);
+}
+
+TEST_F(CorrectSingleBaseErrorTest, NoError)
+{
+ BloomFilter bloom(bloomFilterSize);
+ Bloom::loadSeq(bloom, k, singleErrorRead.seq);
+ DBGBloom<BloomFilter> g(bloom);
+
+ size_t correctedPos = numeric_limits<size_t>::max();
+ FastaRecord read = singleErrorRead;
+ bool success = correctSingleBaseError(g, k, read, correctedPos);
+ ASSERT_FALSE(success);
+}
+
+TEST_F(CorrectSingleBaseErrorTest, SkipFalsePositive)
+{
+ BloomFilter bloom(bloomFilterSize);
+ Bloom::loadSeq(bloom, k, correctRead.seq);
+ Bloom::loadSeq(bloom, k, simulatedFalsePositive);
+ DBGBloom<BloomFilter> g(bloom);
+
+ size_t correctedPos = numeric_limits<size_t>::max();
+ FastaRecord read = singleErrorRead;
+ bool success = correctSingleBaseError(g, k, read, correctedPos);
+ ASSERT_TRUE(success);
+ EXPECT_EQ(read.seq, read.seq);
+ EXPECT_TRUE(correctedPos == errorPos1);
+}
diff --git a/Unittest/Konnector/DBGBloomTest.cpp b/Unittest/Konnector/DBGBloomTest.cpp
new file mode 100644
index 0000000..e746902
--- /dev/null
+++ b/Unittest/Konnector/DBGBloomTest.cpp
@@ -0,0 +1,63 @@
+#include "Konnector/DBGBloom.h"
+#include "Bloom/CascadingBloomFilter.h"
+#include "Bloom/BloomFilter.h"
+
+#include <gtest/gtest.h>
+#include <string>
+
+TEST(DBGBloom, BloomFilterPolymorphism)
+{
+ unsigned bits = 100000;
+
+ Kmer::setLength(3);
+
+ Kmer kmer1("GAC");
+ Kmer kmer2("ACC");
+ Kmer kmer3("CCA");
+
+ CascadingBloomFilter countingBloom(bits);
+
+ countingBloom.insert(kmer1);
+ countingBloom.insert(kmer1);
+ countingBloom.insert(kmer2);
+ countingBloom.insert(kmer2);
+ countingBloom.insert(kmer3);
+ countingBloom.insert(kmer3);
+
+ DBGBloom<CascadingBloomFilter> graph(countingBloom);
+
+ // test that expected edges exist
+
+ boost::graph_traits< DBGBloom<CascadingBloomFilter> >::out_edge_iterator ei, ei_end;
+
+ boost::tie(ei, ei_end) = out_edges(kmer1, graph);
+ ASSERT_TRUE(ei != ei_end);
+ EXPECT_TRUE(target(*ei, graph) == kmer2);
+ ei++;
+ EXPECT_TRUE(ei == ei_end);
+
+ boost::tie(ei, ei_end) = out_edges(kmer2, graph);
+ ASSERT_TRUE(ei != ei_end);
+ EXPECT_TRUE(target(*ei, graph) == kmer3);
+ ei++;
+ EXPECT_TRUE(ei == ei_end);
+
+ boost::graph_traits< DBGBloom<BloomFilter> >::out_edge_iterator ei2, ei_end2;
+
+ DBGBloom<BloomFilter> graph2(countingBloom.getBloomFilter(1));
+
+ // test that the same edges exist in non-counting
+ // bloom filter
+
+ boost::tie(ei2, ei_end2) = out_edges(kmer1, graph2);
+ ASSERT_TRUE(ei2 != ei_end2);
+ EXPECT_TRUE(target(*ei2, graph2) == kmer2);
+ ei2++;
+ EXPECT_TRUE(ei2 == ei_end2);
+
+ boost::tie(ei2, ei_end2) = out_edges(kmer2, graph2);
+ ASSERT_TRUE(ei2 != ei_end2);
+ EXPECT_TRUE(target(*ei2, graph2) == kmer3);
+ ei2++;
+ EXPECT_TRUE(ei2 == ei_end2);
+}
diff --git a/Unittest/Konnector/integration-tests.mk b/Unittest/Konnector/integration-tests.mk
new file mode 100755
index 0000000..0b4dfb2
--- /dev/null
+++ b/Unittest/Konnector/integration-tests.mk
@@ -0,0 +1,370 @@
+#!/usr/bin/make -Rrf
+
+# Test konnector
+
+SHELL=/bin/bash -o pipefail
+
+#------------------------------------------------------------
+# testing params
+#------------------------------------------------------------
+
+# threads (leave as 1 for consistent results)
+j?=1
+# counting bloom filter size
+# For the parallel_load_* tests, this number
+# must be in bytes (no "M" or "G" suffix) and divisible by 2.
+b?=100000000
+# kmer size
+k?=20
+# number of synthetic read pairs
+# For the parallel_load_* tests, this number must be
+# divisible by 3.
+N?=6000
+# error rate of synthetic reads
+e?=0.005
+# path to konnector binary
+konnector?=konnector
+# path to abyss-bloom binary
+bloom?=abyss-bloom
+# path to abyss-bloom-dist.mk makefile
+bloom_dist=abyss-bloom-dist.mk
+# temp dir for test outputs
+tmpdir=tmp
+# shared options to konnector
+k_opts=-j$j -v -v -k$k
+# user options to konnector
+K_OPTS?=
+
+#------------------------------------------------------------
+# global vars
+#------------------------------------------------------------
+
+b_div_2:=$(shell echo $b / 2 | bc)
+
+#------------------------------------------------------------
+# phony targets
+#------------------------------------------------------------
+
+tests=run_test \
+ save_and_load_test \
+ union_test \
+ interleaved_files_test \
+ window_single_test \
+ window_test \
+ parallel_load_2_files_test \
+ parallel_load_3_files_test \
+ abyss_bloom_dist_1_file_test \
+ abyss_bloom_dist_2_files_test \
+ abyss_bloom_dist_3_files_test \
+ abyss_bloom_illegal_chars_test
+
+.PHONY: all $(tests)
+.DELETE_ON_ERROR:
+.SECONDARY:
+
+#------------------------------------------------------------
+# top level rules
+#------------------------------------------------------------
+
+.PHONY: all clean tmpdir
+
+all: $(tests)
+
+clean:
+ rm -f $(tmpdir)/*
+ rmdir $(tmpdir) || true
+
+#------------------------------------------------------------
+# common rules
+#------------------------------------------------------------
+
+$(tmpdir):
+ mkdir -p $(tmpdir)
+
+$(tmpdir)/test_reference.fa: | $(tmpdir)
+ curl -L https://raw.githubusercontent.com/dzerbino/velvet/master/data/test_reference.fa \
+ |abyss-tofastq --fasta >$@
+
+$(tmpdir)/e%_1.fq $(tmpdir)/e%_2.fq: $(tmpdir)/test_reference.fa
+ wgsim -S 0 -e $* -N $N -r 0 -R 0 $< $(tmpdir)/e$*_1.fq $(tmpdir)/e$*_2.fq
+
+$(tmpdir)/e%_merged.fa $(tmpdir)/e%_reads_1.fq $(tmpdir)/e%_reads_2.fq: $(tmpdir)/e%_1.fq $(tmpdir)/e%_2.fq
+ /usr/bin/time -v $(konnector) $(k_opts) -b$b -o $(tmpdir)/e$* $(K_OPTS) $^
+
+$(tmpdir)/e%_l2.bloom: $(tmpdir) $(tmpdir)/e%_1.fq $(tmpdir)/e%_2.fq
+ $(bloom) build -v -k$k -l2 -b$b $@ $(filter-out $<, $^)
+
+$(tmpdir)/e%_interleaved.fq: $(tmpdir)/e%_1.fq $(tmpdir)/e%_2.fq
+ paste -d'\n' <(cat $(tmpdir)/e$e_1.fq | paste - - - -) \
+ <(cat $(tmpdir)/e$e_2.fq | paste - - - -) | \
+ tr '\t' '\n' > $(tmpdir)/e$e_interleaved.fq
+
+FASTQ_CHUNKS:=3
+FASTQ_CHUNK_SIZE:=$(shell echo '$N * 2 * 4 / $(FASTQ_CHUNKS)' | bc)
+
+$(tmpdir)/e%_reads_1of3.fq \
+ $(tmpdir)/e%_reads_2of3.fq \
+ $(tmpdir)/e%_reads_3of3.fq: $(tmpdir)/e%_interleaved.fq
+ awk '{ print > "$(tmpdir)/e$e_reads_" \
+ int((NR-1)/$(FASTQ_CHUNK_SIZE))+1 \
+ "of"$(FASTQ_CHUNKS)".fq"}' $<
+
+#------------------------------------------------------------
+# run_test
+#------------------------------------------------------------
+
+run_test: $(tmpdir) $(tmpdir)/e$e_merged.fa
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# save_and_load_test
+#------------------------------------------------------------
+
+save_and_load_test: $(tmpdir)/e$e_l2.bloom \
+ $(tmpdir)/e$e_merged.fa \
+ $(tmpdir)/e$e_reads_1.fq \
+ $(tmpdir)/e$e_reads_2.fq
+ /usr/bin/time -v $(konnector) $(k_opts) -o $(tmpdir)/e$e_loaded \
+ -i $(tmpdir)/e$e_l2.bloom $(K_OPTS) $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ diff $(tmpdir)/e$e_merged.fa $(tmpdir)/e$e_loaded_merged.fa
+ diff $(tmpdir)/e$e_reads_1.fq $(tmpdir)/e$e_loaded_reads_1.fq
+ diff $(tmpdir)/e$e_reads_2.fq $(tmpdir)/e$e_loaded_reads_2.fq
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# interleaved_files_test
+#------------------------------------------------------------
+
+HALF_FASTQ_LINES:=$(shell echo '$N * 2 * 4 / 2' | bc)
+
+interleaved_files_test: $(tmpdir)/e$e_l2.bloom \
+ $(tmpdir)/e$e_merged.fa \
+ $(tmpdir)/e$e_interleaved_a.fq \
+ $(tmpdir)/e$e_interleaved_b.fq
+ /usr/bin/time -v $(konnector) $(k_opts) -I -b$b \
+ -i $(tmpdir)/e$e_l2.bloom -o $(tmpdir)/e$e_interleaved \
+ $(K_OPTS) \
+ $(tmpdir)/e$e_interleaved_a.fq \
+ $(tmpdir)/e$e_interleaved_b.fq
+ diff $(tmpdir)/e$e_merged.fa $(tmpdir)/e$e_interleaved_merged.fa
+ diff $(tmpdir)/e$e_reads_1.fq $(tmpdir)/e$e_interleaved_reads_1.fq
+ diff $(tmpdir)/e$e_reads_2.fq $(tmpdir)/e$e_interleaved_reads_2.fq
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+$(tmpdir)/e%_interleaved_a.fq $(tmpdir)/e%_interleaved_b.fq: \
+ $(tmpdir)/e%_interleaved.fq
+ head -n $(HALF_FASTQ_LINES) $< > $(tmpdir)/e$*_interleaved_a.fq
+ tail -n $(HALF_FASTQ_LINES) $< > $(tmpdir)/e$*_interleaved_b.fq
+
+#------------------------------------------------------------
+# union_test
+#------------------------------------------------------------
+
+union_test: $(tmpdir) $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ $(bloom) build -v -k$k -b$b $(tmpdir)/e$e.bloom $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ $(bloom) build -v -k$k -b$b $(tmpdir)/e$e_1.bloom $(tmpdir)/e$e_1.fq
+ $(bloom) build -v -k$k -b$b $(tmpdir)/e$e_2.bloom $(tmpdir)/e$e_2.fq
+ $(bloom) union -v -k$k $(tmpdir)/e$e_union.bloom $(tmpdir)/e$e_1.bloom $(tmpdir)/e$e_2.bloom
+ cmp $(tmpdir)/e$e.bloom $(tmpdir)/e$e_union.bloom
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# intersect_test
+#------------------------------------------------------------
+
+intersect_test: $(tmpdir) $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ $(bloom) build -v -k$k -b$b $(tmpdir)/e$e.bloom $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ $(bloom) build -v -k$k -b$b $(tmpdir)/e$e_1.bloom $(tmpdir)/e$e_1.fq
+ $(bloom) intersect -v -k$k $(tmpdir)/e$e_intersect.bloom \
+ $(tmpdir)/e$e.bloom $(tmpdir)/e$e_1.bloom
+ cmp $(tmpdir)/e$e_intersect.bloom $(tmpdir)/e$e_1.bloom
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# window_single_test
+#------------------------------------------------------------
+
+window_single_test: $(tmpdir)/e$e.bloom $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ $(bloom) build -v -k$k -w1/2 -b$b $(tmpdir)/e$e_window1.bloom \
+ $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ $(bloom) build -v -k$k -w2/2 -b$b $(tmpdir)/e$e_window2.bloom \
+ $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ $(bloom) union -v -k$k $(tmpdir)/e$e_l2_concat.bloom \
+ $(tmpdir)/e$e_window1.bloom $(tmpdir)/e$e_window2.bloom
+ cmp $(tmpdir)/e$e.bloom $(tmpdir)/e$e_l2_concat.bloom
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# window_test
+#------------------------------------------------------------
+
+window_test: $(tmpdir)/e$e_l2.bloom $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ $(bloom) build -v -k$k -l2 -w1/2 -b$b $(tmpdir)/e$e_l2_window1.bloom \
+ $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ $(bloom) build -v -k$k -l2 -w2/2 -b$b $(tmpdir)/e$e_l2_window2.bloom \
+ $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ $(bloom) union -v -k$k $(tmpdir)/e$e_l2_concat.bloom \
+ $(tmpdir)/e$e_l2_window1.bloom $(tmpdir)/e$e_l2_window2.bloom
+ cmp $(tmpdir)/e$e_l2.bloom $(tmpdir)/e$e_l2_concat.bloom
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# parallel_load_2_files_test
+#------------------------------------------------------------
+
+parallel_load_2_files_test: $(tmpdir)/e$e_l2.bloom \
+ $(tmpdir)/e$e_1.fq \
+ $(tmpdir)/e$e_2.fq
+ echo 'b_div_2: $(b_div_2)'
+ $(bloom) build -v -k$k -b$(b_div_2) $(tmpdir)/e$e_l1_read1.bloom \
+ $(tmpdir)/e$e_1.fq
+ $(bloom) build -v -k$k -b$(b_div_2) $(tmpdir)/e$e_l1_read2.bloom \
+ $(tmpdir)/e$e_2.fq
+ $(bloom) build -v -k$k -b$b -l2 -L 1=$(tmpdir)/e$e_l1_read2.bloom \
+ $(tmpdir)/e$e_l2_read1.bloom $(tmpdir)/e$e_1.fq
+ $(bloom) build -v -k$k -b$b -l2 -L 1=$(tmpdir)/e$e_l1_read1.bloom \
+ $(tmpdir)/e$e_l2_read2.bloom $(tmpdir)/e$e_2.fq
+ $(bloom) union -v -k$k $(tmpdir)/e$e_l2_union.bloom \
+ $(tmpdir)/e$e_l2_read1.bloom \
+ $(tmpdir)/e$e_l2_read2.bloom
+ cmp $(tmpdir)/e$e_l2.bloom $(tmpdir)/e$e_l2_union.bloom
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# parallel_load_3_files_test
+#------------------------------------------------------------
+
+parallel_load_3_files_test: $(tmpdir)/e$e_l2.bloom \
+ $(tmpdir)/e$e_reads_1of3.fq \
+ $(tmpdir)/e$e_reads_2of3.fq \
+ $(tmpdir)/e$e_reads_3of3.fq
+ $(bloom) build -v -k$k -b$(b_div_2) $(tmpdir)/e$e_l1_1of3.bloom \
+ $(tmpdir)/e$e_reads_1of3.fq
+ $(bloom) build -v -k$k -b$(b_div_2) $(tmpdir)/e$e_l1_2of3.bloom \
+ $(tmpdir)/e$e_reads_2of3.fq
+ $(bloom) build -v -k$k -b$(b_div_2) $(tmpdir)/e$e_l1_3of3.bloom \
+ $(tmpdir)/e$e_reads_3of3.fq
+ $(bloom) build -v -k$k -b$b -l2 \
+ -L 1=$(tmpdir)/e$e_l1_2of3.bloom \
+ -L 1=$(tmpdir)/e$e_l1_3of3.bloom \
+ $(tmpdir)/e$e_l2_1of3.bloom $(tmpdir)/e$e_reads_1of3.fq
+ $(bloom) build -v -k$k -b$b -l2 \
+ -L 1=$(tmpdir)/e$e_l1_1of3.bloom \
+ -L 1=$(tmpdir)/e$e_l1_3of3.bloom \
+ $(tmpdir)/e$e_l2_2of3.bloom $(tmpdir)/e$e_reads_2of3.fq
+ $(bloom) build -v -k$k -b$b -l2 \
+ -L 1=$(tmpdir)/e$e_l1_1of3.bloom \
+ -L 1=$(tmpdir)/e$e_l1_2of3.bloom \
+ $(tmpdir)/e$e_l2_3of3.bloom $(tmpdir)/e$e_reads_3of3.fq
+ $(bloom) union -v -k$k $(tmpdir)/e$e_l2_union.bloom \
+ $(tmpdir)/e$e_l2_1of3.bloom \
+ $(tmpdir)/e$e_l2_2of3.bloom \
+ $(tmpdir)/e$e_l2_3of3.bloom
+ cmp $(tmpdir)/e$e_l2.bloom $(tmpdir)/e$e_l2_union.bloom
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# abyss_bloom_dist_1_file_test
+#------------------------------------------------------------
+
+abyss_bloom_dist_1_file_test: $(tmpdir)/e$e_l2.bloom \
+ $(tmpdir)/e$e_1.fq \
+ $(tmpdir)/e$e_2.fq
+ cat $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq > $(tmpdir)/e$e_1cat2.fq
+ $(bloom_dist) -C $(tmpdir) name=dist-1-file k=$k b=$(b_div_2) w=2 \
+ files='e$e_1cat2.fq'
+ cmp $(tmpdir)/e$e_l2.bloom <(gunzip -c $(tmpdir)/dist-1-file.bloom.gz)
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# abyss_bloom_dist_2_files_test
+#------------------------------------------------------------
+
+abyss_bloom_dist_2_files_test: $(tmpdir)/e$e_l2.bloom \
+ $(tmpdir)/e$e_1.fq \
+ $(tmpdir)/e$e_2.fq
+ $(bloom_dist) -C $(tmpdir) name=dist-2-files k=$k b=$(b_div_2) w=2 \
+ files='e$e_1.fq e$e_2.fq'
+ cmp $(tmpdir)/e$e_l2.bloom <(gunzip -c $(tmpdir)/dist-2-files.bloom.gz)
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# abyss_bloom_dist_3_files_test
+#------------------------------------------------------------
+
+abyss_bloom_dist_3_files_test: $(tmpdir)/e$e_l2.bloom \
+ $(tmpdir)/e$e_reads_1of3.fq \
+ $(tmpdir)/e$e_reads_2of3.fq \
+ $(tmpdir)/e$e_reads_3of3.fq
+ $(bloom_dist) -C $(tmpdir) name=dist-3-files k=$k b=$(b_div_2) w=2 \
+ files='e$e_reads_1of3.fq e$e_reads_2of3.fq e$e_reads_3of3.fq'
+ cmp $(tmpdir)/e$e_l2.bloom <(gunzip -c $(tmpdir)/dist-3-files.bloom.gz)
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# abyss_bloom_illegal_chars_test
+#------------------------------------------------------------
+
+abyss_bloom_illegal_chars_test:
+ $(bloom) build -v -k3 -b1M $(tmpdir)/illegal_char_test.bloom <(echo -e ">test\nAGCTagctAGCTnqrsAGCTNQRS")
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# abyss_bloom_multithreaded_test
+#------------------------------------------------------------
+
+abyss_bloom_multithreaded_test: $(tmpdir) $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq \
+ $(tmpdir)/e$e_l2.bloom
+ $(bloom) build -v -k$k -j10 -l2 -b$b $(tmpdir)/e$e_l2_multithreaded.bloom \
+ $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ cmp $(tmpdir)/e$e_l2.bloom $(tmpdir)/e$e_l2_multithreaded.bloom
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
+
+#------------------------------------------------------------
+# konnector_multithreaded_test
+#------------------------------------------------------------
+
+konnector_multithreaded_test: $(tmpdir)/e$e_1.fq $(tmpdir)/e$e_2.fq
+ /usr/bin/time -v $(konnector) $(cp_opts) -o $(tmpdir)/e$e_singlethreaded \
+ $(CP_OPTS) -j1 $^
+ cat $(tmpdir)/e$e_singlethreaded_merged.fa | \
+ paste - - | sort | tr '\t' '\n' \
+ > $(tmpdir)/e$e_singlethreaded_merged.sorted.fa
+ /usr/bin/time -v $(konnector) $(cp_opts) -o $(tmpdir)/e$e_multithreaded \
+ $(CP_OPTS) -j10 $^
+ cat $(tmpdir)/e$e_multithreaded_merged.fa | \
+ paste - - | sort | tr '\t' '\n' \
+ > $(tmpdir)/e$e_multithreaded_merged.sorted.fa
+ diff $(tmpdir)/e$e_singlethreaded_merged.sorted.fa \
+ $(tmpdir)/e$e_multithreaded_merged.sorted.fa
+ @echo '------------------'
+ @echo '$@: PASSED'
+ @echo '------------------'
diff --git a/Unittest/Konnector/konnectorTest.cpp b/Unittest/Konnector/konnectorTest.cpp
new file mode 100644
index 0000000..df9b865
--- /dev/null
+++ b/Unittest/Konnector/konnectorTest.cpp
@@ -0,0 +1,75 @@
+#include "Konnector/konnector.h"
+#include <iostream>
+
+#include <gtest/gtest.h>
+
+using namespace std;
+
+// workaround: opt::k must be defined because
+// it is used by write_dot(..)
+namespace opt { unsigned k = 0; }
+
+TEST(maskNew, read1)
+{
+ FastqRecord r1("1", "", "ACGTACGT", "BBBBBBBB");
+ FastqRecord r2;
+ FastaRecord read("2", "", "ACGTACGT");
+
+ int mask = 1;
+ EXPECT_TRUE(maskNew(r1, r2, read, mask) == 0u);
+ EXPECT_TRUE(read.seq == "ACGTACGT");
+
+ read = FastaRecord("2", "", "ACGTACGTA");
+ EXPECT_TRUE(maskNew(r1, r2, read, mask) == 0u);
+ cout << read.seq << endl;
+ EXPECT_TRUE(read.seq == "ACGTACGTa");
+}
+
+TEST(maskNew, mask)
+{
+ FastqRecord r1("1", "", "ACGTA", "BBBBB");
+ FastqRecord r2;
+ FastaRecord read("2", "", "ACGTACGT");
+
+ int mask = 0;
+ EXPECT_TRUE(maskNew(r1, r2, read, mask) == 0u);
+ EXPECT_TRUE(read.seq == "ACGTACGT");
+}
+
+TEST(ConnectPairsTest, MergeOverlappingPair)
+{
+ // Merged seq: GATG
+ // Read 1: GAT =>
+ // Read 2: TAC <=
+
+ const int k = 2;
+ Kmer::setLength(k);
+ const int readLength = 3;
+ string mergedSeq = "GATG";
+
+ FastaRecord read1, read2;
+ read1.id = "read/1";
+ read1.seq = mergedSeq.substr(0,readLength);
+ read2.id = "read/2";
+ read2.seq = reverseComplement(mergedSeq.substr(1,readLength));
+
+ BloomFilter bloom(1000);
+ DBGBloom<BloomFilter> g(bloom);
+
+ Bloom::loadSeq(bloom, k, read1.seq);
+ Bloom::loadSeq(bloom, k, read2.seq);
+
+ vector<FastaRecord> mergedSeqs;
+
+ ConnectPairsParams params;
+ params.maxPaths = 1;
+ params.minMergedSeqLen = 0;
+ params.maxMergedSeqLen = 4;
+
+ ConnectPairsResult result = connectPairs(k, read1, read2, g, params);
+
+ EXPECT_EQ(FOUND_PATH, result.pathResult);
+ ASSERT_EQ(1u, result.mergedSeqs.size());
+ EXPECT_EQ("GATG", result.mergedSeqs[0].seq);
+
+}
diff --git a/Unittest/Makefile.am b/Unittest/Makefile.am
new file mode 100644
index 0000000..6726b5e
--- /dev/null
+++ b/Unittest/Makefile.am
@@ -0,0 +1,109 @@
+UNIT_TESTS = common_stringutil
+check_PROGRAMS = common_stringutil
+common_stringutil_SOURCES = Common/StringUtilTest.cpp
+common_stringutil_CPPFLAGS = -I$(top_srcdir)
+common_stringutil_LDADD = $(GTEST_LIBS)
+
+UNIT_TESTS += common_histogram
+check_PROGRAMS += common_histogram
+common_histogram_SOURCES = Common/HistogramTest.cpp
+common_histogram_CPPFLAGS = -I$(top_srcdir)
+common_histogram_LDADD = $(GTEST_LIBS)
+
+UNIT_TESTS += common_bitutil
+check_PROGRAMS += common_bitutil
+common_bitutil_SOURCES = Common/BitUtilTest.cpp
+common_bitutil_CPPFLAGS = -I$(top_srcdir)
+common_bitutil_LDADD = $(GTEST_LIBS)
+
+UNIT_TESTS += common_kmer
+check_PROGRAMS += common_kmer
+common_kmer_SOURCES = Common/KmerTest.cpp
+common_kmer_CPPFLAGS = -I$(top_srcdir)
+common_kmer_LDADD = $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+UNIT_TESTS += common_sequence
+check_PROGRAMS += common_sequence
+common_sequence_SOURCES = Common/Sequence.cc
+common_sequence_CPPFLAGS = -I$(top_srcdir)
+common_sequence_LDADD = $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+UNIT_TESTS += common_KmerIterator
+check_PROGRAMS += common_KmerIterator
+common_KmerIterator_SOURCES = Common/KmerIteratorTest.cpp
+common_KmerIterator_CPPFLAGS = -I$(top_srcdir)
+common_KmerIterator_LDADD = $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+UNIT_TESTS += common_sam
+check_PROGRAMS += common_sam
+common_sam_SOURCES = Common/SAM.cc
+common_sam_CPPFLAGS = -I$(top_srcdir)
+common_sam_LDADD = $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+UNIT_TESTS += BloomFilter
+check_PROGRAMS += BloomFilter
+BloomFilter_SOURCES = Konnector/BloomFilter.cc
+BloomFilter_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
+BloomFilter_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
+BloomFilter_LDADD = $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+UNIT_TESTS += Konnector_DBGBloom
+check_PROGRAMS += Konnector_DBGBloom
+Konnector_DBGBloom_SOURCES = Konnector/DBGBloomTest.cpp
+Konnector_DBGBloom_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
+Konnector_DBGBloom_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
+Konnector_DBGBloom_LDADD = $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+UNIT_TESTS += Konnector_DBGBloomAlgorithms
+check_PROGRAMS += Konnector_DBGBloomAlgorithms
+Konnector_DBGBloomAlgorithms_SOURCES = Konnector/DBGBloomAlgorithmsTest.cpp
+Konnector_DBGBloomAlgorithms_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
+Konnector_DBGBloomAlgorithms_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
+Konnector_DBGBloomAlgorithms_LDADD = \
+ $(top_builddir)/Common/libcommon.a \
+ $(GTEST_LIBS)
+
+UNIT_TESTS += graph_ConstrainedBFSVisitor
+check_PROGRAMS += graph_ConstrainedBFSVisitor
+graph_ConstrainedBFSVisitor_SOURCES = Graph/ConstrainedBFSVisitorTest.cpp
+graph_ConstrainedBFSVisitor_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
+graph_ConstrainedBFSVisitor_LDADD = $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+UNIT_TESTS += graph_BidirectionalBFS
+check_PROGRAMS += graph_BidirectionalBFS
+graph_BidirectionalBFS_SOURCES = Graph/BidirectionalBFSTest.cpp
+graph_BidirectionalBFS_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
+graph_BidirectionalBFS_LDADD = $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+UNIT_TESTS += graph_AllPathsSearch
+check_PROGRAMS += graph_AllPathsSearch
+graph_AllPathsSearch_SOURCES = Graph/AllPathsSearchTest.cpp
+graph_AllPathsSearch_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
+graph_AllPathsSearch_LDADD = $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+UNIT_TESTS += graph_HashGraph
+check_PROGRAMS += graph_HashGraph
+graph_HashGraph_SOURCES = Graph/HashGraphTest.cpp
+graph_HashGraph_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
+graph_HashGraph_LDADD = $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+UNIT_TESTS += graph_ConstrainedBidiBFSVisitor
+check_PROGRAMS += graph_ConstrainedBidiBFSVisitor
+graph_ConstrainedBidiBFSVisitor_SOURCES = \
+ Graph/ConstrainedBidiBFSVisitorTest.cpp
+graph_ConstrainedBidiBFSVisitor_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
+graph_ConstrainedBidiBFSVisitor_LDADD = $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+UNIT_TESTS += Konnector_konnector
+check_PROGRAMS += Konnector_konnector
+Konnector_konnector_SOURCES = \
+ Konnector/konnectorTest.cpp
+Konnector_konnector_CPPFLAGS = -I$(top_srcdir) -I$(top_srcdir)/Common
+Konnector_konnector_CXXFLAGS = $(AM_CXXFLAGS) $(OPENMP_CXXFLAGS)
+Konnector_konnector_LDADD = \
+ $(top_builddir)/Align/libalign.a \
+ $(top_builddir)/Common/libcommon.a $(GTEST_LIBS)
+
+##Tests for log kmer counting / Counting bloom filter
+
+TESTS = $(UNIT_TESTS)
diff --git a/aclocal.m4 b/aclocal.m4
deleted file mode 100644
index 83c8b4f..0000000
--- a/aclocal.m4
+++ /dev/null
@@ -1,1149 +0,0 @@
-# generated automatically by aclocal 1.14 -*- Autoconf -*-
-
-# Copyright (C) 1996-2013 Free Software Foundation, Inc.
-
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
-m4_ifndef([AC_CONFIG_MACRO_DIRS], [m4_defun([_AM_CONFIG_MACRO_DIRS], [])m4_defun([AC_CONFIG_MACRO_DIRS], [_AM_CONFIG_MACRO_DIRS($@)])])
-m4_ifndef([AC_AUTOCONF_VERSION],
- [m4_copy([m4_PACKAGE_VERSION], [AC_AUTOCONF_VERSION])])dnl
-m4_if(m4_defn([AC_AUTOCONF_VERSION]), [2.69],,
-[m4_warning([this file was generated for autoconf 2.69.
-You have another version of autoconf. It may work, but is not guaranteed to.
-If you have problems, you may need to regenerate the build system entirely.
-To do so, use the procedure documented by the package, typically 'autoreconf'.])])
-
-# Copyright (C) 2002-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# AM_AUTOMAKE_VERSION(VERSION)
-# ----------------------------
-# Automake X.Y traces this macro to ensure aclocal.m4 has been
-# generated from the m4 files accompanying Automake X.Y.
-# (This private macro should not be called outside this file.)
-AC_DEFUN([AM_AUTOMAKE_VERSION],
-[am__api_version='1.14'
-dnl Some users find AM_AUTOMAKE_VERSION and mistake it for a way to
-dnl require some minimum version. Point them to the right macro.
-m4_if([$1], [1.14], [],
- [AC_FATAL([Do not call $0, use AM_INIT_AUTOMAKE([$1]).])])dnl
-])
-
-# _AM_AUTOCONF_VERSION(VERSION)
-# -----------------------------
-# aclocal traces this macro to find the Autoconf version.
-# This is a private macro too. Using m4_define simplifies
-# the logic in aclocal, which can simply ignore this definition.
-m4_define([_AM_AUTOCONF_VERSION], [])
-
-# AM_SET_CURRENT_AUTOMAKE_VERSION
-# -------------------------------
-# Call AM_AUTOMAKE_VERSION and AM_AUTOMAKE_VERSION so they can be traced.
-# This function is AC_REQUIREd by AM_INIT_AUTOMAKE.
-AC_DEFUN([AM_SET_CURRENT_AUTOMAKE_VERSION],
-[AM_AUTOMAKE_VERSION([1.14])dnl
-m4_ifndef([AC_AUTOCONF_VERSION],
- [m4_copy([m4_PACKAGE_VERSION], [AC_AUTOCONF_VERSION])])dnl
-_AM_AUTOCONF_VERSION(m4_defn([AC_AUTOCONF_VERSION]))])
-
-# AM_AUX_DIR_EXPAND -*- Autoconf -*-
-
-# Copyright (C) 2001-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# For projects using AC_CONFIG_AUX_DIR([foo]), Autoconf sets
-# $ac_aux_dir to '$srcdir/foo'. In other projects, it is set to
-# '$srcdir', '$srcdir/..', or '$srcdir/../..'.
-#
-# Of course, Automake must honor this variable whenever it calls a
-# tool from the auxiliary directory. The problem is that $srcdir (and
-# therefore $ac_aux_dir as well) can be either absolute or relative,
-# depending on how configure is run. This is pretty annoying, since
-# it makes $ac_aux_dir quite unusable in subdirectories: in the top
-# source directory, any form will work fine, but in subdirectories a
-# relative path needs to be adjusted first.
-#
-# $ac_aux_dir/missing
-# fails when called from a subdirectory if $ac_aux_dir is relative
-# $top_srcdir/$ac_aux_dir/missing
-# fails if $ac_aux_dir is absolute,
-# fails when called from a subdirectory in a VPATH build with
-# a relative $ac_aux_dir
-#
-# The reason of the latter failure is that $top_srcdir and $ac_aux_dir
-# are both prefixed by $srcdir. In an in-source build this is usually
-# harmless because $srcdir is '.', but things will broke when you
-# start a VPATH build or use an absolute $srcdir.
-#
-# So we could use something similar to $top_srcdir/$ac_aux_dir/missing,
-# iff we strip the leading $srcdir from $ac_aux_dir. That would be:
-# am_aux_dir='\$(top_srcdir)/'`expr "$ac_aux_dir" : "$srcdir//*\(.*\)"`
-# and then we would define $MISSING as
-# MISSING="\${SHELL} $am_aux_dir/missing"
-# This will work as long as MISSING is not called from configure, because
-# unfortunately $(top_srcdir) has no meaning in configure.
-# However there are other variables, like CC, which are often used in
-# configure, and could therefore not use this "fixed" $ac_aux_dir.
-#
-# Another solution, used here, is to always expand $ac_aux_dir to an
-# absolute PATH. The drawback is that using absolute paths prevent a
-# configured tree to be moved without reconfiguration.
-
-AC_DEFUN([AM_AUX_DIR_EXPAND],
-[dnl Rely on autoconf to set up CDPATH properly.
-AC_PREREQ([2.50])dnl
-# expand $ac_aux_dir to an absolute path
-am_aux_dir=`cd $ac_aux_dir && pwd`
-])
-
-# AM_CONDITIONAL -*- Autoconf -*-
-
-# Copyright (C) 1997-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# AM_CONDITIONAL(NAME, SHELL-CONDITION)
-# -------------------------------------
-# Define a conditional.
-AC_DEFUN([AM_CONDITIONAL],
-[AC_PREREQ([2.52])dnl
- m4_if([$1], [TRUE], [AC_FATAL([$0: invalid condition: $1])],
- [$1], [FALSE], [AC_FATAL([$0: invalid condition: $1])])dnl
-AC_SUBST([$1_TRUE])dnl
-AC_SUBST([$1_FALSE])dnl
-_AM_SUBST_NOTMAKE([$1_TRUE])dnl
-_AM_SUBST_NOTMAKE([$1_FALSE])dnl
-m4_define([_AM_COND_VALUE_$1], [$2])dnl
-if $2; then
- $1_TRUE=
- $1_FALSE='#'
-else
- $1_TRUE='#'
- $1_FALSE=
-fi
-AC_CONFIG_COMMANDS_PRE(
-[if test -z "${$1_TRUE}" && test -z "${$1_FALSE}"; then
- AC_MSG_ERROR([[conditional "$1" was never defined.
-Usually this means the macro was only invoked conditionally.]])
-fi])])
-
-# Copyright (C) 1999-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-
-# There are a few dirty hacks below to avoid letting 'AC_PROG_CC' be
-# written in clear, in which case automake, when reading aclocal.m4,
-# will think it sees a *use*, and therefore will trigger all it's
-# C support machinery. Also note that it means that autoscan, seeing
-# CC etc. in the Makefile, will ask for an AC_PROG_CC use...
-
-
-# _AM_DEPENDENCIES(NAME)
-# ----------------------
-# See how the compiler implements dependency checking.
-# NAME is "CC", "CXX", "OBJC", "OBJCXX", "UPC", or "GJC".
-# We try a few techniques and use that to set a single cache variable.
-#
-# We don't AC_REQUIRE the corresponding AC_PROG_CC since the latter was
-# modified to invoke _AM_DEPENDENCIES(CC); we would have a circular
-# dependency, and given that the user is not expected to run this macro,
-# just rely on AC_PROG_CC.
-AC_DEFUN([_AM_DEPENDENCIES],
-[AC_REQUIRE([AM_SET_DEPDIR])dnl
-AC_REQUIRE([AM_OUTPUT_DEPENDENCY_COMMANDS])dnl
-AC_REQUIRE([AM_MAKE_INCLUDE])dnl
-AC_REQUIRE([AM_DEP_TRACK])dnl
-
-m4_if([$1], [CC], [depcc="$CC" am_compiler_list=],
- [$1], [CXX], [depcc="$CXX" am_compiler_list=],
- [$1], [OBJC], [depcc="$OBJC" am_compiler_list='gcc3 gcc'],
- [$1], [OBJCXX], [depcc="$OBJCXX" am_compiler_list='gcc3 gcc'],
- [$1], [UPC], [depcc="$UPC" am_compiler_list=],
- [$1], [GCJ], [depcc="$GCJ" am_compiler_list='gcc3 gcc'],
- [depcc="$$1" am_compiler_list=])
-
-AC_CACHE_CHECK([dependency style of $depcc],
- [am_cv_$1_dependencies_compiler_type],
-[if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
- # We make a subdir and do the tests there. Otherwise we can end up
- # making bogus files that we don't know about and never remove. For
- # instance it was reported that on HP-UX the gcc test will end up
- # making a dummy file named 'D' -- because '-MD' means "put the output
- # in D".
- rm -rf conftest.dir
- mkdir conftest.dir
- # Copy depcomp to subdir because otherwise we won't find it if we're
- # using a relative directory.
- cp "$am_depcomp" conftest.dir
- cd conftest.dir
- # We will build objects and dependencies in a subdirectory because
- # it helps to detect inapplicable dependency modes. For instance
- # both Tru64's cc and ICC support -MD to output dependencies as a
- # side effect of compilation, but ICC will put the dependencies in
- # the current directory while Tru64 will put them in the object
- # directory.
- mkdir sub
-
- am_cv_$1_dependencies_compiler_type=none
- if test "$am_compiler_list" = ""; then
- am_compiler_list=`sed -n ['s/^#*\([a-zA-Z0-9]*\))$/\1/p'] < ./depcomp`
- fi
- am__universal=false
- m4_case([$1], [CC],
- [case " $depcc " in #(
- *\ -arch\ *\ -arch\ *) am__universal=true ;;
- esac],
- [CXX],
- [case " $depcc " in #(
- *\ -arch\ *\ -arch\ *) am__universal=true ;;
- esac])
-
- for depmode in $am_compiler_list; do
- # Setup a source with many dependencies, because some compilers
- # like to wrap large dependency lists on column 80 (with \), and
- # we should not choose a depcomp mode which is confused by this.
- #
- # We need to recreate these files for each test, as the compiler may
- # overwrite some of them when testing with obscure command lines.
- # This happens at least with the AIX C compiler.
- : > sub/conftest.c
- for i in 1 2 3 4 5 6; do
- echo '#include "conftst'$i'.h"' >> sub/conftest.c
- # Using ": > sub/conftst$i.h" creates only sub/conftst1.h with
- # Solaris 10 /bin/sh.
- echo '/* dummy */' > sub/conftst$i.h
- done
- echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
-
- # We check with '-c' and '-o' for the sake of the "dashmstdout"
- # mode. It turns out that the SunPro C++ compiler does not properly
- # handle '-M -o', and we need to detect this. Also, some Intel
- # versions had trouble with output in subdirs.
- am__obj=sub/conftest.${OBJEXT-o}
- am__minus_obj="-o $am__obj"
- case $depmode in
- gcc)
- # This depmode causes a compiler race in universal mode.
- test "$am__universal" = false || continue
- ;;
- nosideeffect)
- # After this tag, mechanisms are not by side-effect, so they'll
- # only be used when explicitly requested.
- if test "x$enable_dependency_tracking" = xyes; then
- continue
- else
- break
- fi
- ;;
- msvc7 | msvc7msys | msvisualcpp | msvcmsys)
- # This compiler won't grok '-c -o', but also, the minuso test has
- # not run yet. These depmodes are late enough in the game, and
- # so weak that their functioning should not be impacted.
- am__obj=conftest.${OBJEXT-o}
- am__minus_obj=
- ;;
- none) break ;;
- esac
- if depmode=$depmode \
- source=sub/conftest.c object=$am__obj \
- depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
- $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
- >/dev/null 2>conftest.err &&
- grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
- grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
- grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
- ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
- # icc doesn't choke on unknown options, it will just issue warnings
- # or remarks (even with -Werror). So we grep stderr for any message
- # that says an option was ignored or not supported.
- # When given -MP, icc 7.0 and 7.1 complain thusly:
- # icc: Command line warning: ignoring option '-M'; no argument required
- # The diagnosis changed in icc 8.0:
- # icc: Command line remark: option '-MP' not supported
- if (grep 'ignoring option' conftest.err ||
- grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
- am_cv_$1_dependencies_compiler_type=$depmode
- break
- fi
- fi
- done
-
- cd ..
- rm -rf conftest.dir
-else
- am_cv_$1_dependencies_compiler_type=none
-fi
-])
-AC_SUBST([$1DEPMODE], [depmode=$am_cv_$1_dependencies_compiler_type])
-AM_CONDITIONAL([am__fastdep$1], [
- test "x$enable_dependency_tracking" != xno \
- && test "$am_cv_$1_dependencies_compiler_type" = gcc3])
-])
-
-
-# AM_SET_DEPDIR
-# -------------
-# Choose a directory name for dependency files.
-# This macro is AC_REQUIREd in _AM_DEPENDENCIES.
-AC_DEFUN([AM_SET_DEPDIR],
-[AC_REQUIRE([AM_SET_LEADING_DOT])dnl
-AC_SUBST([DEPDIR], ["${am__leading_dot}deps"])dnl
-])
-
-
-# AM_DEP_TRACK
-# ------------
-AC_DEFUN([AM_DEP_TRACK],
-[AC_ARG_ENABLE([dependency-tracking], [dnl
-AS_HELP_STRING(
- [--enable-dependency-tracking],
- [do not reject slow dependency extractors])
-AS_HELP_STRING(
- [--disable-dependency-tracking],
- [speeds up one-time build])])
-if test "x$enable_dependency_tracking" != xno; then
- am_depcomp="$ac_aux_dir/depcomp"
- AMDEPBACKSLASH='\'
- am__nodep='_no'
-fi
-AM_CONDITIONAL([AMDEP], [test "x$enable_dependency_tracking" != xno])
-AC_SUBST([AMDEPBACKSLASH])dnl
-_AM_SUBST_NOTMAKE([AMDEPBACKSLASH])dnl
-AC_SUBST([am__nodep])dnl
-_AM_SUBST_NOTMAKE([am__nodep])dnl
-])
-
-# Generate code to set up dependency tracking. -*- Autoconf -*-
-
-# Copyright (C) 1999-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-
-# _AM_OUTPUT_DEPENDENCY_COMMANDS
-# ------------------------------
-AC_DEFUN([_AM_OUTPUT_DEPENDENCY_COMMANDS],
-[{
- # Older Autoconf quotes --file arguments for eval, but not when files
- # are listed without --file. Let's play safe and only enable the eval
- # if we detect the quoting.
- case $CONFIG_FILES in
- *\'*) eval set x "$CONFIG_FILES" ;;
- *) set x $CONFIG_FILES ;;
- esac
- shift
- for mf
- do
- # Strip MF so we end up with the name of the file.
- mf=`echo "$mf" | sed -e 's/:.*$//'`
- # Check whether this is an Automake generated Makefile or not.
- # We used to match only the files named 'Makefile.in', but
- # some people rename them; so instead we look at the file content.
- # Grep'ing the first line is not enough: some people post-process
- # each Makefile.in and add a new line on top of each file to say so.
- # Grep'ing the whole file is not good either: AIX grep has a line
- # limit of 2048, but all sed's we know have understand at least 4000.
- if sed -n 's,^#.*generated by automake.*,X,p' "$mf" | grep X >/dev/null 2>&1; then
- dirpart=`AS_DIRNAME("$mf")`
- else
- continue
- fi
- # Extract the definition of DEPDIR, am__include, and am__quote
- # from the Makefile without running 'make'.
- DEPDIR=`sed -n 's/^DEPDIR = //p' < "$mf"`
- test -z "$DEPDIR" && continue
- am__include=`sed -n 's/^am__include = //p' < "$mf"`
- test -z "$am__include" && continue
- am__quote=`sed -n 's/^am__quote = //p' < "$mf"`
- # Find all dependency output files, they are included files with
- # $(DEPDIR) in their names. We invoke sed twice because it is the
- # simplest approach to changing $(DEPDIR) to its actual value in the
- # expansion.
- for file in `sed -n "
- s/^$am__include $am__quote\(.*(DEPDIR).*\)$am__quote"'$/\1/p' <"$mf" | \
- sed -e 's/\$(DEPDIR)/'"$DEPDIR"'/g'`; do
- # Make sure the directory exists.
- test -f "$dirpart/$file" && continue
- fdir=`AS_DIRNAME(["$file"])`
- AS_MKDIR_P([$dirpart/$fdir])
- # echo "creating $dirpart/$file"
- echo '# dummy' > "$dirpart/$file"
- done
- done
-}
-])# _AM_OUTPUT_DEPENDENCY_COMMANDS
-
-
-# AM_OUTPUT_DEPENDENCY_COMMANDS
-# -----------------------------
-# This macro should only be invoked once -- use via AC_REQUIRE.
-#
-# This code is only required when automatic dependency tracking
-# is enabled. FIXME. This creates each '.P' file that we will
-# need in order to bootstrap the dependency handling code.
-AC_DEFUN([AM_OUTPUT_DEPENDENCY_COMMANDS],
-[AC_CONFIG_COMMANDS([depfiles],
- [test x"$AMDEP_TRUE" != x"" || _AM_OUTPUT_DEPENDENCY_COMMANDS],
- [AMDEP_TRUE="$AMDEP_TRUE" ac_aux_dir="$ac_aux_dir"])
-])
-
-# Do all the work for Automake. -*- Autoconf -*-
-
-# Copyright (C) 1996-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This macro actually does too much. Some checks are only needed if
-# your package does certain things. But this isn't really a big deal.
-
-dnl Redefine AC_PROG_CC to automatically invoke _AM_PROG_CC_C_O.
-m4_define([AC_PROG_CC],
-m4_defn([AC_PROG_CC])
-[_AM_PROG_CC_C_O
-])
-
-# AM_INIT_AUTOMAKE(PACKAGE, VERSION, [NO-DEFINE])
-# AM_INIT_AUTOMAKE([OPTIONS])
-# -----------------------------------------------
-# The call with PACKAGE and VERSION arguments is the old style
-# call (pre autoconf-2.50), which is being phased out. PACKAGE
-# and VERSION should now be passed to AC_INIT and removed from
-# the call to AM_INIT_AUTOMAKE.
-# We support both call styles for the transition. After
-# the next Automake release, Autoconf can make the AC_INIT
-# arguments mandatory, and then we can depend on a new Autoconf
-# release and drop the old call support.
-AC_DEFUN([AM_INIT_AUTOMAKE],
-[AC_PREREQ([2.65])dnl
-dnl Autoconf wants to disallow AM_ names. We explicitly allow
-dnl the ones we care about.
-m4_pattern_allow([^AM_[A-Z]+FLAGS$])dnl
-AC_REQUIRE([AM_SET_CURRENT_AUTOMAKE_VERSION])dnl
-AC_REQUIRE([AC_PROG_INSTALL])dnl
-if test "`cd $srcdir && pwd`" != "`pwd`"; then
- # Use -I$(srcdir) only when $(srcdir) != ., so that make's output
- # is not polluted with repeated "-I."
- AC_SUBST([am__isrc], [' -I$(srcdir)'])_AM_SUBST_NOTMAKE([am__isrc])dnl
- # test to see if srcdir already configured
- if test -f $srcdir/config.status; then
- AC_MSG_ERROR([source directory already configured; run "make distclean" there first])
- fi
-fi
-
-# test whether we have cygpath
-if test -z "$CYGPATH_W"; then
- if (cygpath --version) >/dev/null 2>/dev/null; then
- CYGPATH_W='cygpath -w'
- else
- CYGPATH_W=echo
- fi
-fi
-AC_SUBST([CYGPATH_W])
-
-# Define the identity of the package.
-dnl Distinguish between old-style and new-style calls.
-m4_ifval([$2],
-[AC_DIAGNOSE([obsolete],
- [$0: two- and three-arguments forms are deprecated.])
-m4_ifval([$3], [_AM_SET_OPTION([no-define])])dnl
- AC_SUBST([PACKAGE], [$1])dnl
- AC_SUBST([VERSION], [$2])],
-[_AM_SET_OPTIONS([$1])dnl
-dnl Diagnose old-style AC_INIT with new-style AM_AUTOMAKE_INIT.
-m4_if(
- m4_ifdef([AC_PACKAGE_NAME], [ok]):m4_ifdef([AC_PACKAGE_VERSION], [ok]),
- [ok:ok],,
- [m4_fatal([AC_INIT should be called with package and version arguments])])dnl
- AC_SUBST([PACKAGE], ['AC_PACKAGE_TARNAME'])dnl
- AC_SUBST([VERSION], ['AC_PACKAGE_VERSION'])])dnl
-
-_AM_IF_OPTION([no-define],,
-[AC_DEFINE_UNQUOTED([PACKAGE], ["$PACKAGE"], [Name of package])
- AC_DEFINE_UNQUOTED([VERSION], ["$VERSION"], [Version number of package])])dnl
-
-# Some tools Automake needs.
-AC_REQUIRE([AM_SANITY_CHECK])dnl
-AC_REQUIRE([AC_ARG_PROGRAM])dnl
-AM_MISSING_PROG([ACLOCAL], [aclocal-${am__api_version}])
-AM_MISSING_PROG([AUTOCONF], [autoconf])
-AM_MISSING_PROG([AUTOMAKE], [automake-${am__api_version}])
-AM_MISSING_PROG([AUTOHEADER], [autoheader])
-AM_MISSING_PROG([MAKEINFO], [makeinfo])
-AC_REQUIRE([AM_PROG_INSTALL_SH])dnl
-AC_REQUIRE([AM_PROG_INSTALL_STRIP])dnl
-AC_REQUIRE([AC_PROG_MKDIR_P])dnl
-# For better backward compatibility. To be removed once Automake 1.9.x
-# dies out for good. For more background, see:
-# <http://lists.gnu.org/archive/html/automake/2012-07/msg00001.html>
-# <http://lists.gnu.org/archive/html/automake/2012-07/msg00014.html>
-AC_SUBST([mkdir_p], ['$(MKDIR_P)'])
-# We need awk for the "check" target. The system "awk" is bad on
-# some platforms.
-AC_REQUIRE([AC_PROG_AWK])dnl
-AC_REQUIRE([AC_PROG_MAKE_SET])dnl
-AC_REQUIRE([AM_SET_LEADING_DOT])dnl
-_AM_IF_OPTION([tar-ustar], [_AM_PROG_TAR([ustar])],
- [_AM_IF_OPTION([tar-pax], [_AM_PROG_TAR([pax])],
- [_AM_PROG_TAR([v7])])])
-_AM_IF_OPTION([no-dependencies],,
-[AC_PROVIDE_IFELSE([AC_PROG_CC],
- [_AM_DEPENDENCIES([CC])],
- [m4_define([AC_PROG_CC],
- m4_defn([AC_PROG_CC])[_AM_DEPENDENCIES([CC])])])dnl
-AC_PROVIDE_IFELSE([AC_PROG_CXX],
- [_AM_DEPENDENCIES([CXX])],
- [m4_define([AC_PROG_CXX],
- m4_defn([AC_PROG_CXX])[_AM_DEPENDENCIES([CXX])])])dnl
-AC_PROVIDE_IFELSE([AC_PROG_OBJC],
- [_AM_DEPENDENCIES([OBJC])],
- [m4_define([AC_PROG_OBJC],
- m4_defn([AC_PROG_OBJC])[_AM_DEPENDENCIES([OBJC])])])dnl
-AC_PROVIDE_IFELSE([AC_PROG_OBJCXX],
- [_AM_DEPENDENCIES([OBJCXX])],
- [m4_define([AC_PROG_OBJCXX],
- m4_defn([AC_PROG_OBJCXX])[_AM_DEPENDENCIES([OBJCXX])])])dnl
-])
-AC_REQUIRE([AM_SILENT_RULES])dnl
-dnl The testsuite driver may need to know about EXEEXT, so add the
-dnl 'am__EXEEXT' conditional if _AM_COMPILER_EXEEXT was seen. This
-dnl macro is hooked onto _AC_COMPILER_EXEEXT early, see below.
-AC_CONFIG_COMMANDS_PRE(dnl
-[m4_provide_if([_AM_COMPILER_EXEEXT],
- [AM_CONDITIONAL([am__EXEEXT], [test -n "$EXEEXT"])])])dnl
-
-# POSIX will say in a future version that running "rm -f" with no argument
-# is OK; and we want to be able to make that assumption in our Makefile
-# recipes. So use an aggressive probe to check that the usage we want is
-# actually supported "in the wild" to an acceptable degree.
-# See automake bug#10828.
-# To make any issue more visible, cause the running configure to be aborted
-# by default if the 'rm' program in use doesn't match our expectations; the
-# user can still override this though.
-if rm -f && rm -fr && rm -rf; then : OK; else
- cat >&2 <<'END'
-Oops!
-
-Your 'rm' program seems unable to run without file operands specified
-on the command line, even when the '-f' option is present. This is contrary
-to the behaviour of most rm programs out there, and not conforming with
-the upcoming POSIX standard: <http://austingroupbugs.net/view.php?id=542>
-
-Please tell bug-automake at gnu.org about your system, including the value
-of your $PATH and any error possibly output before this message. This
-can help us improve future automake versions.
-
-END
- if test x"$ACCEPT_INFERIOR_RM_PROGRAM" = x"yes"; then
- echo 'Configuration will proceed anyway, since you have set the' >&2
- echo 'ACCEPT_INFERIOR_RM_PROGRAM variable to "yes"' >&2
- echo >&2
- else
- cat >&2 <<'END'
-Aborting the configuration process, to ensure you take notice of the issue.
-
-You can download and install GNU coreutils to get an 'rm' implementation
-that behaves properly: <http://www.gnu.org/software/coreutils/>.
-
-If you want to complete the configuration process using your problematic
-'rm' anyway, export the environment variable ACCEPT_INFERIOR_RM_PROGRAM
-to "yes", and re-run configure.
-
-END
- AC_MSG_ERROR([Your 'rm' program is bad, sorry.])
- fi
-fi])
-
-dnl Hook into '_AC_COMPILER_EXEEXT' early to learn its expansion. Do not
-dnl add the conditional right here, as _AC_COMPILER_EXEEXT may be further
-dnl mangled by Autoconf and run in a shell conditional statement.
-m4_define([_AC_COMPILER_EXEEXT],
-m4_defn([_AC_COMPILER_EXEEXT])[m4_provide([_AM_COMPILER_EXEEXT])])
-
-# When config.status generates a header, we must update the stamp-h file.
-# This file resides in the same directory as the config header
-# that is generated. The stamp files are numbered to have different names.
-
-# Autoconf calls _AC_AM_CONFIG_HEADER_HOOK (when defined) in the
-# loop where config.status creates the headers, so we can generate
-# our stamp files there.
-AC_DEFUN([_AC_AM_CONFIG_HEADER_HOOK],
-[# Compute $1's index in $config_headers.
-_am_arg=$1
-_am_stamp_count=1
-for _am_header in $config_headers :; do
- case $_am_header in
- $_am_arg | $_am_arg:* )
- break ;;
- * )
- _am_stamp_count=`expr $_am_stamp_count + 1` ;;
- esac
-done
-echo "timestamp for $_am_arg" >`AS_DIRNAME(["$_am_arg"])`/stamp-h[]$_am_stamp_count])
-
-# Copyright (C) 2001-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# AM_PROG_INSTALL_SH
-# ------------------
-# Define $install_sh.
-AC_DEFUN([AM_PROG_INSTALL_SH],
-[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
-if test x"${install_sh}" != xset; then
- case $am_aux_dir in
- *\ * | *\ *)
- install_sh="\${SHELL} '$am_aux_dir/install-sh'" ;;
- *)
- install_sh="\${SHELL} $am_aux_dir/install-sh"
- esac
-fi
-AC_SUBST([install_sh])])
-
-# Copyright (C) 2003-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# Check whether the underlying file-system supports filenames
-# with a leading dot. For instance MS-DOS doesn't.
-AC_DEFUN([AM_SET_LEADING_DOT],
-[rm -rf .tst 2>/dev/null
-mkdir .tst 2>/dev/null
-if test -d .tst; then
- am__leading_dot=.
-else
- am__leading_dot=_
-fi
-rmdir .tst 2>/dev/null
-AC_SUBST([am__leading_dot])])
-
-# Check to see how 'make' treats includes. -*- Autoconf -*-
-
-# Copyright (C) 2001-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# AM_MAKE_INCLUDE()
-# -----------------
-# Check to see how make treats includes.
-AC_DEFUN([AM_MAKE_INCLUDE],
-[am_make=${MAKE-make}
-cat > confinc << 'END'
-am__doit:
- @echo this is the am__doit target
-.PHONY: am__doit
-END
-# If we don't find an include directive, just comment out the code.
-AC_MSG_CHECKING([for style of include used by $am_make])
-am__include="#"
-am__quote=
-_am_result=none
-# First try GNU make style include.
-echo "include confinc" > confmf
-# Ignore all kinds of additional output from 'make'.
-case `$am_make -s -f confmf 2> /dev/null` in #(
-*the\ am__doit\ target*)
- am__include=include
- am__quote=
- _am_result=GNU
- ;;
-esac
-# Now try BSD make style include.
-if test "$am__include" = "#"; then
- echo '.include "confinc"' > confmf
- case `$am_make -s -f confmf 2> /dev/null` in #(
- *the\ am__doit\ target*)
- am__include=.include
- am__quote="\""
- _am_result=BSD
- ;;
- esac
-fi
-AC_SUBST([am__include])
-AC_SUBST([am__quote])
-AC_MSG_RESULT([$_am_result])
-rm -f confinc confmf
-])
-
-# Fake the existence of programs that GNU maintainers use. -*- Autoconf -*-
-
-# Copyright (C) 1997-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# AM_MISSING_PROG(NAME, PROGRAM)
-# ------------------------------
-AC_DEFUN([AM_MISSING_PROG],
-[AC_REQUIRE([AM_MISSING_HAS_RUN])
-$1=${$1-"${am_missing_run}$2"}
-AC_SUBST($1)])
-
-# AM_MISSING_HAS_RUN
-# ------------------
-# Define MISSING if not defined so far and test if it is modern enough.
-# If it is, set am_missing_run to use it, otherwise, to nothing.
-AC_DEFUN([AM_MISSING_HAS_RUN],
-[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
-AC_REQUIRE_AUX_FILE([missing])dnl
-if test x"${MISSING+set}" != xset; then
- case $am_aux_dir in
- *\ * | *\ *)
- MISSING="\${SHELL} \"$am_aux_dir/missing\"" ;;
- *)
- MISSING="\${SHELL} $am_aux_dir/missing" ;;
- esac
-fi
-# Use eval to expand $SHELL
-if eval "$MISSING --is-lightweight"; then
- am_missing_run="$MISSING "
-else
- am_missing_run=
- AC_MSG_WARN(['missing' script is too old or missing])
-fi
-])
-
-# Helper functions for option handling. -*- Autoconf -*-
-
-# Copyright (C) 2001-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# _AM_MANGLE_OPTION(NAME)
-# -----------------------
-AC_DEFUN([_AM_MANGLE_OPTION],
-[[_AM_OPTION_]m4_bpatsubst($1, [[^a-zA-Z0-9_]], [_])])
-
-# _AM_SET_OPTION(NAME)
-# --------------------
-# Set option NAME. Presently that only means defining a flag for this option.
-AC_DEFUN([_AM_SET_OPTION],
-[m4_define(_AM_MANGLE_OPTION([$1]), [1])])
-
-# _AM_SET_OPTIONS(OPTIONS)
-# ------------------------
-# OPTIONS is a space-separated list of Automake options.
-AC_DEFUN([_AM_SET_OPTIONS],
-[m4_foreach_w([_AM_Option], [$1], [_AM_SET_OPTION(_AM_Option)])])
-
-# _AM_IF_OPTION(OPTION, IF-SET, [IF-NOT-SET])
-# -------------------------------------------
-# Execute IF-SET if OPTION is set, IF-NOT-SET otherwise.
-AC_DEFUN([_AM_IF_OPTION],
-[m4_ifset(_AM_MANGLE_OPTION([$1]), [$2], [$3])])
-
-# Copyright (C) 1999-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# _AM_PROG_CC_C_O
-# ---------------
-# Like AC_PROG_CC_C_O, but changed for automake. We rewrite AC_PROG_CC
-# to automatically call this.
-AC_DEFUN([_AM_PROG_CC_C_O],
-[AC_REQUIRE([AM_AUX_DIR_EXPAND])dnl
-AC_REQUIRE_AUX_FILE([compile])dnl
-AC_LANG_PUSH([C])dnl
-AC_CACHE_CHECK(
- [whether $CC understands -c and -o together],
- [am_cv_prog_cc_c_o],
- [AC_LANG_CONFTEST([AC_LANG_PROGRAM([])])
- # Make sure it works both with $CC and with simple cc.
- # Following AC_PROG_CC_C_O, we do the test twice because some
- # compilers refuse to overwrite an existing .o file with -o,
- # though they will create one.
- am_cv_prog_cc_c_o=yes
- for am_i in 1 2; do
- if AM_RUN_LOG([$CC -c conftest.$ac_ext -o conftest2.$ac_objext]) \
- && test -f conftest2.$ac_objext; then
- : OK
- else
- am_cv_prog_cc_c_o=no
- break
- fi
- done
- rm -f core conftest*
- unset am_i])
-if test "$am_cv_prog_cc_c_o" != yes; then
- # Losing compiler, so override with the script.
- # FIXME: It is wrong to rewrite CC.
- # But if we don't then we get into trouble of one sort or another.
- # A longer-term fix would be to have automake use am__CC in this case,
- # and then we could set am__CC="\$(top_srcdir)/compile \$(CC)"
- CC="$am_aux_dir/compile $CC"
-fi
-AC_LANG_POP([C])])
-
-# For backward compatibility.
-AC_DEFUN_ONCE([AM_PROG_CC_C_O], [AC_REQUIRE([AC_PROG_CC])])
-
-# Copyright (C) 2001-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# AM_RUN_LOG(COMMAND)
-# -------------------
-# Run COMMAND, save the exit status in ac_status, and log it.
-# (This has been adapted from Autoconf's _AC_RUN_LOG macro.)
-AC_DEFUN([AM_RUN_LOG],
-[{ echo "$as_me:$LINENO: $1" >&AS_MESSAGE_LOG_FD
- ($1) >&AS_MESSAGE_LOG_FD 2>&AS_MESSAGE_LOG_FD
- ac_status=$?
- echo "$as_me:$LINENO: \$? = $ac_status" >&AS_MESSAGE_LOG_FD
- (exit $ac_status); }])
-
-# Check to make sure that the build environment is sane. -*- Autoconf -*-
-
-# Copyright (C) 1996-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# AM_SANITY_CHECK
-# ---------------
-AC_DEFUN([AM_SANITY_CHECK],
-[AC_MSG_CHECKING([whether build environment is sane])
-# Reject unsafe characters in $srcdir or the absolute working directory
-# name. Accept space and tab only in the latter.
-am_lf='
-'
-case `pwd` in
- *[[\\\"\#\$\&\'\`$am_lf]]*)
- AC_MSG_ERROR([unsafe absolute working directory name]);;
-esac
-case $srcdir in
- *[[\\\"\#\$\&\'\`$am_lf\ \ ]]*)
- AC_MSG_ERROR([unsafe srcdir value: '$srcdir']);;
-esac
-
-# Do 'set' in a subshell so we don't clobber the current shell's
-# arguments. Must try -L first in case configure is actually a
-# symlink; some systems play weird games with the mod time of symlinks
-# (eg FreeBSD returns the mod time of the symlink's containing
-# directory).
-if (
- am_has_slept=no
- for am_try in 1 2; do
- echo "timestamp, slept: $am_has_slept" > conftest.file
- set X `ls -Lt "$srcdir/configure" conftest.file 2> /dev/null`
- if test "$[*]" = "X"; then
- # -L didn't work.
- set X `ls -t "$srcdir/configure" conftest.file`
- fi
- if test "$[*]" != "X $srcdir/configure conftest.file" \
- && test "$[*]" != "X conftest.file $srcdir/configure"; then
-
- # If neither matched, then we have a broken ls. This can happen
- # if, for instance, CONFIG_SHELL is bash and it inherits a
- # broken ls alias from the environment. This has actually
- # happened. Such a system could not be considered "sane".
- AC_MSG_ERROR([ls -t appears to fail. Make sure there is not a broken
- alias in your environment])
- fi
- if test "$[2]" = conftest.file || test $am_try -eq 2; then
- break
- fi
- # Just in case.
- sleep 1
- am_has_slept=yes
- done
- test "$[2]" = conftest.file
- )
-then
- # Ok.
- :
-else
- AC_MSG_ERROR([newly created file is older than distributed files!
-Check your system clock])
-fi
-AC_MSG_RESULT([yes])
-# If we didn't sleep, we still need to ensure time stamps of config.status and
-# generated files are strictly newer.
-am_sleep_pid=
-if grep 'slept: no' conftest.file >/dev/null 2>&1; then
- ( sleep 1 ) &
- am_sleep_pid=$!
-fi
-AC_CONFIG_COMMANDS_PRE(
- [AC_MSG_CHECKING([that generated files are newer than configure])
- if test -n "$am_sleep_pid"; then
- # Hide warnings about reused PIDs.
- wait $am_sleep_pid 2>/dev/null
- fi
- AC_MSG_RESULT([done])])
-rm -f conftest.file
-])
-
-# Copyright (C) 2009-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# AM_SILENT_RULES([DEFAULT])
-# --------------------------
-# Enable less verbose build rules; with the default set to DEFAULT
-# ("yes" being less verbose, "no" or empty being verbose).
-AC_DEFUN([AM_SILENT_RULES],
-[AC_ARG_ENABLE([silent-rules], [dnl
-AS_HELP_STRING(
- [--enable-silent-rules],
- [less verbose build output (undo: "make V=1")])
-AS_HELP_STRING(
- [--disable-silent-rules],
- [verbose build output (undo: "make V=0")])dnl
-])
-case $enable_silent_rules in @%:@ (((
- yes) AM_DEFAULT_VERBOSITY=0;;
- no) AM_DEFAULT_VERBOSITY=1;;
- *) AM_DEFAULT_VERBOSITY=m4_if([$1], [yes], [0], [1]);;
-esac
-dnl
-dnl A few 'make' implementations (e.g., NonStop OS and NextStep)
-dnl do not support nested variable expansions.
-dnl See automake bug#9928 and bug#10237.
-am_make=${MAKE-make}
-AC_CACHE_CHECK([whether $am_make supports nested variables],
- [am_cv_make_support_nested_variables],
- [if AS_ECHO([['TRUE=$(BAR$(V))
-BAR0=false
-BAR1=true
-V=1
-am__doit:
- @$(TRUE)
-.PHONY: am__doit']]) | $am_make -f - >/dev/null 2>&1; then
- am_cv_make_support_nested_variables=yes
-else
- am_cv_make_support_nested_variables=no
-fi])
-if test $am_cv_make_support_nested_variables = yes; then
- dnl Using '$V' instead of '$(V)' breaks IRIX make.
- AM_V='$(V)'
- AM_DEFAULT_V='$(AM_DEFAULT_VERBOSITY)'
-else
- AM_V=$AM_DEFAULT_VERBOSITY
- AM_DEFAULT_V=$AM_DEFAULT_VERBOSITY
-fi
-AC_SUBST([AM_V])dnl
-AM_SUBST_NOTMAKE([AM_V])dnl
-AC_SUBST([AM_DEFAULT_V])dnl
-AM_SUBST_NOTMAKE([AM_DEFAULT_V])dnl
-AC_SUBST([AM_DEFAULT_VERBOSITY])dnl
-AM_BACKSLASH='\'
-AC_SUBST([AM_BACKSLASH])dnl
-_AM_SUBST_NOTMAKE([AM_BACKSLASH])dnl
-])
-
-# Copyright (C) 2001-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# AM_PROG_INSTALL_STRIP
-# ---------------------
-# One issue with vendor 'install' (even GNU) is that you can't
-# specify the program used to strip binaries. This is especially
-# annoying in cross-compiling environments, where the build's strip
-# is unlikely to handle the host's binaries.
-# Fortunately install-sh will honor a STRIPPROG variable, so we
-# always use install-sh in "make install-strip", and initialize
-# STRIPPROG with the value of the STRIP variable (set by the user).
-AC_DEFUN([AM_PROG_INSTALL_STRIP],
-[AC_REQUIRE([AM_PROG_INSTALL_SH])dnl
-# Installed binaries are usually stripped using 'strip' when the user
-# run "make install-strip". However 'strip' might not be the right
-# tool to use in cross-compilation environments, therefore Automake
-# will honor the 'STRIP' environment variable to overrule this program.
-dnl Don't test for $cross_compiling = yes, because it might be 'maybe'.
-if test "$cross_compiling" != no; then
- AC_CHECK_TOOL([STRIP], [strip], :)
-fi
-INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s"
-AC_SUBST([INSTALL_STRIP_PROGRAM])])
-
-# Copyright (C) 2006-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# _AM_SUBST_NOTMAKE(VARIABLE)
-# ---------------------------
-# Prevent Automake from outputting VARIABLE = @VARIABLE@ in Makefile.in.
-# This macro is traced by Automake.
-AC_DEFUN([_AM_SUBST_NOTMAKE])
-
-# AM_SUBST_NOTMAKE(VARIABLE)
-# --------------------------
-# Public sister of _AM_SUBST_NOTMAKE.
-AC_DEFUN([AM_SUBST_NOTMAKE], [_AM_SUBST_NOTMAKE($@)])
-
-# Check how to create a tarball. -*- Autoconf -*-
-
-# Copyright (C) 2004-2013 Free Software Foundation, Inc.
-#
-# This file is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# _AM_PROG_TAR(FORMAT)
-# --------------------
-# Check how to create a tarball in format FORMAT.
-# FORMAT should be one of 'v7', 'ustar', or 'pax'.
-#
-# Substitute a variable $(am__tar) that is a command
-# writing to stdout a FORMAT-tarball containing the directory
-# $tardir.
-# tardir=directory && $(am__tar) > result.tar
-#
-# Substitute a variable $(am__untar) that extract such
-# a tarball read from stdin.
-# $(am__untar) < result.tar
-#
-AC_DEFUN([_AM_PROG_TAR],
-[# Always define AMTAR for backward compatibility. Yes, it's still used
-# in the wild :-( We should find a proper way to deprecate it ...
-AC_SUBST([AMTAR], ['$${TAR-tar}'])
-
-# We'll loop over all known methods to create a tar archive until one works.
-_am_tools='gnutar m4_if([$1], [ustar], [plaintar]) pax cpio none'
-
-m4_if([$1], [v7],
- [am__tar='$${TAR-tar} chof - "$$tardir"' am__untar='$${TAR-tar} xf -'],
-
- [m4_case([$1],
- [ustar],
- [# The POSIX 1988 'ustar' format is defined with fixed-size fields.
- # There is notably a 21 bits limit for the UID and the GID. In fact,
- # the 'pax' utility can hang on bigger UID/GID (see automake bug#8343
- # and bug#13588).
- am_max_uid=2097151 # 2^21 - 1
- am_max_gid=$am_max_uid
- # The $UID and $GID variables are not portable, so we need to resort
- # to the POSIX-mandated id(1) utility. Errors in the 'id' calls
- # below are definitely unexpected, so allow the users to see them
- # (that is, avoid stderr redirection).
- am_uid=`id -u || echo unknown`
- am_gid=`id -g || echo unknown`
- AC_MSG_CHECKING([whether UID '$am_uid' is supported by ustar format])
- if test $am_uid -le $am_max_uid; then
- AC_MSG_RESULT([yes])
- else
- AC_MSG_RESULT([no])
- _am_tools=none
- fi
- AC_MSG_CHECKING([whether GID '$am_gid' is supported by ustar format])
- if test $am_gid -le $am_max_gid; then
- AC_MSG_RESULT([yes])
- else
- AC_MSG_RESULT([no])
- _am_tools=none
- fi],
-
- [pax],
- [],
-
- [m4_fatal([Unknown tar format])])
-
- AC_MSG_CHECKING([how to create a $1 tar archive])
-
- # Go ahead even if we have the value already cached. We do so because we
- # need to set the values for the 'am__tar' and 'am__untar' variables.
- _am_tools=${am_cv_prog_tar_$1-$_am_tools}
-
- for _am_tool in $_am_tools; do
- case $_am_tool in
- gnutar)
- for _am_tar in tar gnutar gtar; do
- AM_RUN_LOG([$_am_tar --version]) && break
- done
- am__tar="$_am_tar --format=m4_if([$1], [pax], [posix], [$1]) -chf - "'"$$tardir"'
- am__tar_="$_am_tar --format=m4_if([$1], [pax], [posix], [$1]) -chf - "'"$tardir"'
- am__untar="$_am_tar -xf -"
- ;;
- plaintar)
- # Must skip GNU tar: if it does not support --format= it doesn't create
- # ustar tarball either.
- (tar --version) >/dev/null 2>&1 && continue
- am__tar='tar chf - "$$tardir"'
- am__tar_='tar chf - "$tardir"'
- am__untar='tar xf -'
- ;;
- pax)
- am__tar='pax -L -x $1 -w "$$tardir"'
- am__tar_='pax -L -x $1 -w "$tardir"'
- am__untar='pax -r'
- ;;
- cpio)
- am__tar='find "$$tardir" -print | cpio -o -H $1 -L'
- am__tar_='find "$tardir" -print | cpio -o -H $1 -L'
- am__untar='cpio -i -H $1 -d'
- ;;
- none)
- am__tar=false
- am__tar_=false
- am__untar=false
- ;;
- esac
-
- # If the value was cached, stop now. We just wanted to have am__tar
- # and am__untar set.
- test -n "${am_cv_prog_tar_$1}" && break
-
- # tar/untar a dummy directory, and stop if the command works.
- rm -rf conftest.dir
- mkdir conftest.dir
- echo GrepMe > conftest.dir/file
- AM_RUN_LOG([tardir=conftest.dir && eval $am__tar_ >conftest.tar])
- rm -rf conftest.dir
- if test -s conftest.tar; then
- AM_RUN_LOG([$am__untar <conftest.tar])
- AM_RUN_LOG([cat conftest.dir/file])
- grep GrepMe conftest.dir/file >/dev/null 2>&1 && break
- fi
- done
- rm -rf conftest.dir
-
- AC_CACHE_VAL([am_cv_prog_tar_$1], [am_cv_prog_tar_$1=$_am_tool])
- AC_MSG_RESULT([$am_cv_prog_tar_$1])])
-
-AC_SUBST([am__tar])
-AC_SUBST([am__untar])
-]) # _AM_PROG_TAR
-
diff --git a/autogen.sh b/autogen.sh
new file mode 100755
index 0000000..905085d
--- /dev/null
+++ b/autogen.sh
@@ -0,0 +1,6 @@
+#!/bin/sh
+set -ex
+aclocal
+autoconf
+autoheader
+automake -a
diff --git a/bin/Makefile.am b/bin/Makefile.am
index 658decd..3909976 100644
--- a/bin/Makefile.am
+++ b/bin/Makefile.am
@@ -3,10 +3,13 @@ dist_bin_SCRIPTS = \
abyss-bowtie2 \
abyss-bwa \
abyss-bwasw \
+ abyss-bwamem \
abyss-fatoagp \
abyss-kaligner \
abyss-pe \
- abyss-samtoafg
+ abyss-samtoafg \
+ abyss-tabtomd \
+ abyss-bloom-dist.mk
dist_noinst_SCRIPTS = \
abyss-adjtodot.pl \
abyss-cstont \
diff --git a/bin/Makefile.in b/bin/Makefile.in
deleted file mode 100644
index 1a1795f..0000000
--- a/bin/Makefile.in
+++ /dev/null
@@ -1,478 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-subdir = bin
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(dist_bin_SCRIPTS) $(dist_noinst_SCRIPTS)
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`;
-am__vpath_adj = case $$p in \
- $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \
- *) f=$$p;; \
- esac;
-am__strip_dir = f=`echo $$p | sed -e 's|^.*/||'`;
-am__install_max = 40
-am__nobase_strip_setup = \
- srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*|]/\\\\&/g'`
-am__nobase_strip = \
- for p in $$list; do echo "$$p"; done | sed -e "s|$$srcdirstrip/||"
-am__nobase_list = $(am__nobase_strip_setup); \
- for p in $$list; do echo "$$p $$p"; done | \
- sed "s| $$srcdirstrip/| |;"' / .*\//!s/ .*/ ./; s,\( .*\)/[^/]*$$,\1,' | \
- $(AWK) 'BEGIN { files["."] = "" } { files[$$2] = files[$$2] " " $$1; \
- if (++n[$$2] == $(am__install_max)) \
- { print $$2, files[$$2]; n[$$2] = 0; files[$$2] = "" } } \
- END { for (dir in files) print dir, files[dir] }'
-am__base_list = \
- sed '$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;s/\n/ /g' | \
- sed '$$!N;$$!N;$$!N;$$!N;s/\n/ /g'
-am__uninstall_files_from_dir = { \
- test -z "$$files" \
- || { test ! -d "$$dir" && test ! -f "$$dir" && test ! -r "$$dir"; } \
- || { echo " ( cd '$$dir' && rm -f" $$files ")"; \
- $(am__cd) "$$dir" && rm -f $$files; }; \
- }
-am__installdirs = "$(DESTDIR)$(bindir)"
-SCRIPTS = $(dist_bin_SCRIPTS) $(dist_noinst_SCRIPTS)
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-SOURCES =
-DIST_SOURCES =
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-dist_bin_SCRIPTS = \
- abyss-bowtie \
- abyss-bowtie2 \
- abyss-bwa \
- abyss-bwasw \
- abyss-fatoagp \
- abyss-kaligner \
- abyss-pe \
- abyss-samtoafg
-
-dist_noinst_SCRIPTS = \
- abyss-adjtodot.pl \
- abyss-cstont \
- abyss-fac.pl \
- abyss-joindist
-
-all: all-am
-
-.SUFFIXES:
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign bin/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign bin/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-dist_binSCRIPTS: $(dist_bin_SCRIPTS)
- @$(NORMAL_INSTALL)
- @list='$(dist_bin_SCRIPTS)'; test -n "$(bindir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(bindir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(bindir)" || exit 1; \
- fi; \
- for p in $$list; do \
- if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
- if test -f "$$d$$p"; then echo "$$d$$p"; echo "$$p"; else :; fi; \
- done | \
- sed -e 'p;s,.*/,,;n' \
- -e 'h;s|.*|.|' \
- -e 'p;x;s,.*/,,;$(transform)' | sed 'N;N;N;s,\n, ,g' | \
- $(AWK) 'BEGIN { files["."] = ""; dirs["."] = 1; } \
- { d=$$3; if (dirs[d] != 1) { print "d", d; dirs[d] = 1 } \
- if ($$2 == $$4) { files[d] = files[d] " " $$1; \
- if (++n[d] == $(am__install_max)) { \
- print "f", d, files[d]; n[d] = 0; files[d] = "" } } \
- else { print "f", d "/" $$4, $$1 } } \
- END { for (d in files) print "f", d, files[d] }' | \
- while read type dir files; do \
- if test "$$dir" = .; then dir=; else dir=/$$dir; fi; \
- test -z "$$files" || { \
- echo " $(INSTALL_SCRIPT) $$files '$(DESTDIR)$(bindir)$$dir'"; \
- $(INSTALL_SCRIPT) $$files "$(DESTDIR)$(bindir)$$dir" || exit $$?; \
- } \
- ; done
-
-uninstall-dist_binSCRIPTS:
- @$(NORMAL_UNINSTALL)
- @list='$(dist_bin_SCRIPTS)'; test -n "$(bindir)" || exit 0; \
- files=`for p in $$list; do echo "$$p"; done | \
- sed -e 's,.*/,,;$(transform)'`; \
- dir='$(DESTDIR)$(bindir)'; $(am__uninstall_files_from_dir)
-tags TAGS:
-
-ctags CTAGS:
-
-cscope cscopelist:
-
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(SCRIPTS)
-installdirs:
- for dir in "$(DESTDIR)$(bindir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -f Makefile
-distclean-am: clean-am distclean-generic
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am: install-dist_binSCRIPTS
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-dist_binSCRIPTS
-
-.MAKE: install-am install-strip
-
-.PHONY: all all-am check check-am clean clean-generic cscopelist-am \
- ctags-am distclean distclean-generic distdir dvi dvi-am html \
- html-am info info-am install install-am install-data \
- install-data-am install-dist_binSCRIPTS install-dvi \
- install-dvi-am install-exec install-exec-am install-html \
- install-html-am install-info install-info-am install-man \
- install-pdf install-pdf-am install-ps install-ps-am \
- install-strip installcheck installcheck-am installdirs \
- maintainer-clean maintainer-clean-generic mostlyclean \
- mostlyclean-generic pdf pdf-am ps ps-am tags-am uninstall \
- uninstall-am uninstall-dist_binSCRIPTS
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/bin/abyss-bloom-dist.mk b/bin/abyss-bloom-dist.mk
new file mode 100755
index 0000000..f0f60a1
--- /dev/null
+++ b/bin/abyss-bloom-dist.mk
@@ -0,0 +1,187 @@
+#!/usr/bin/make -rRf
+
+# Setting the SHELL variable does not work under SGE's qmake utility,
+# so we must do this instead.
+BEGIN_SHELL=/bin/bash -o pipefail -c '
+END_SHELL='
+
+#------------------------------------------------------------
+# optional params
+#------------------------------------------------------------
+
+# Number of levels in counting bloom filter.
+# Note: Changing this value will currently break the script.
+l:=2
+
+#------------------------------------------------------------
+# global vars
+#------------------------------------------------------------
+
+PROGRAM_NAME=abyss-bloom-dist.mk
+
+# convert bloom filter size from kilobytes/megs/gigs to bytes
+override b:=$(shell echo '$b' | \
+ sed 's/k/*1024/I' | \
+ sed 's/m/*1024^2/I' | \
+ sed 's/g/*1024^3/I' | \
+ bc)
+
+# strip leading or trailing whitespace from files list
+override files:=$(strip $(files))
+
+# compute mem limits (in gigabytes) for SGE_RREQ lines below
+b_gb:=$(shell echo '$b / 1024^3' | bc -l)
+l1_mem_gb:=$(shell echo '$(b_gb) / $w + 1.05' | bc -l | xargs printf '%.1f')
+l2_mem_gb:=$(shell echo '2 * $(l1_mem_gb)' | bc -l)
+union_mem_gb:=$(shell echo '$(b_gb) + 2.05' | bc -l | xargs printf '%.1f')
+
+# a single space character
+space:=$(noop) $(noop)
+b_times_l:=$(shell echo '$b * $l' | bc)
+b_mod_w:=$(shell echo '$b % $w' | bc)
+windows:=$(shell seq 1 $w)
+l1_bloom_files:=\
+ $(foreach window,$(windows),\
+ $(foreach file,$(files),\
+ $(name)_l1_w$(window)_$(notdir $(file)).bloom.gz))
+l2_bloom_files:=\
+ $(foreach window,$(windows),\
+ $(foreach file,$(files),\
+ $(name)_l2_w$(window)_$(notdir $(file)).bloom.gz))
+
+#------------------------------------------------------------
+# functions
+#------------------------------------------------------------
+
+# arg 1: filename of the form $(name)_l<level>_w<window>_<readfile>.bloom
+# output: list of filename parts, split by '_'
+splitBloomFilename=$(subst _, ,$(subst .bloom.gz,,$1))
+
+# arg 1: filename of the form $(name)_l<level>_w<window>_<readfile>.bloom
+# output: <window>
+getWindow=$(subst w,,$(word 3,$(call splitBloomFilename,$1)))
+
+# arg 1: filename of the form $(name)_l<level>_w<window>_<readfile>.bloom
+# output: <readfile>
+getReadFilename=$(subst $(space),_,$(wordlist 4,999,$(call splitBloomFilename,$1)))
+getReadFilePath=$(filter %$(call getReadFilename,$1),$(files))
+
+# arg 1: filename of the form $(name)_l1_w<window>_<readfile>.bloom
+# output: list of bloom filter files for level 1, window <window>, excluding
+# input (arg 1).
+getSiblingBloomFiles=$(filter-out $1,$(filter $(name)_l1_w$(call getWindow,$1)_%.bloom.gz,$(l1_bloom_files)))
+
+#------------------------------------------------------------
+# special rules
+#------------------------------------------------------------
+
+.PHONY: args_check build
+# don't automatically delete intermediate bloom files, because they can
+# take a long time to build!
+.SECONDARY: $(l1_bloom_files) $(l2_bloom_files)
+default: build
+
+#------------------------------------------------------------
+# parameter checking rule
+#------------------------------------------------------------
+
+args_check:
+ifndef name
+ $(error $(PROGRAM_NAME): missing required parameter 'name')
+endif
+ifeq (_,$(findstring _,$(name)))
+ $(error $(PROGRAM_NAME): sorry, 'name' parameter ('$(name)') must not contain underscores)
+endif
+ifndef k
+ $(error $(PROGRAM_NAME): missing required parameter 'k')
+endif
+ifndef b
+ $(error $(PROGRAM_NAME): missing required parameter 'b')
+endif
+ifndef w
+ $(error $(PROGRAM_NAME): missing required parameter 'w')
+endif
+ifndef files
+ $(error $(PROGRAM_NAME): missing required parameter 'files')
+endif
+ifneq ($(b_mod_w), 0)
+ $(error $(PROGRAM_NAME): `b' ($b) must be divisible by `w' ($w))
+endif
+
+#------------------------------------------------------------
+# main rules
+#------------------------------------------------------------
+
+build: args_check $(name).bloom.gz
+
+# level 1 bloom filter files
+
+$(name)_l1_%.bloom.gz: $(files)
+ SGE_RREQ="-N $(name)_l1 -l mem_token=$(l1_mem_gb)G,mem_free=$(l1_mem_gb)G,h_vmem=$(l1_mem_gb)G" \
+ $(BEGIN_SHELL) \
+ abyss-bloom build -v -k$k $(build_opts) -b$b -w$(call getWindow,$@)/$w \
+ - $(call getReadFilePath,$@) | gzip -c > $@.incomplete && \
+ mv $@.incomplete $@ \
+ $(END_SHELL)
+
+# level 2 bloom filter files
+
+ifeq (1,$(words $(files)))
+$(name)_l2_%.bloom.gz: $(l1_bloom_files)
+ SGE_RREQ="-N $(name)_l2 -l mem_token=$(l2_mem_gb)G,mem_free=$(l2_mem_gb)G,h_vmem=$(l2_mem_gb)G" \
+ $(BEGIN_SHELL) \
+ abyss-bloom build -v -k$k $(build_opts) -b$(b_times_l) -l2 \
+ -w$(call getWindow,$@)/$w \
+ - $(call getReadFilePath,$@) | \
+ gzip -c > $@.incomplete && \
+ mv $@.incomplete $@ \
+ $(END_SHELL)
+else
+$(name)_l2_%.bloom.gz: $(l1_bloom_files)
+ SGE_RREQ="-N $(name)_l2 -l mem_token=$(l2_mem_gb)G,mem_free=$(l2_mem_gb)G,h_vmem=$(l2_mem_gb)G" \
+ $(BEGIN_SHELL) \
+ $(if $(word 2,$(files)), zcat $(call getSiblingBloomFiles,$(subst l2,l1,$@)) |,) \
+ abyss-bloom build -v -k$k $(build_opts) -b$(b_times_l) -l2 \
+ -w$(call getWindow,$@)/$w \
+ $(foreach i,$(wordlist 2,999,$(files)),-L1=-) \
+ - $(call getReadFilePath,$@) | \
+ gzip -c > $@.incomplete && \
+ mv $@.incomplete $@ \
+ $(END_SHELL)
+endif
+
+# final output file
+
+ifeq (1,$(words $(l2_bloom_files)))
+$(name).bloom.gz: $(l2_bloom_files)
+ cp $< $@
+else
+$(name).bloom.gz: $(l2_bloom_files)
+ SGE_RREQ="-N $(name)_union -l mem_token=$(union_mem_gb)G,mem_free=$(union_mem_gb)G,h_vmem=$(union_mem_gb)G" \
+ $(BEGIN_SHELL) \
+ zcat $(l2_bloom_files) | \
+ abyss-bloom union -v -k$k - \
+ $(foreach i,$(l2_bloom_files),-) | \
+ gzip -c > $@.incomplete && \
+ mv $@.incomplete $@ \
+ $(END_SHELL)
+endif
+
+#------------------------------------------------------------
+# debugging rules
+#------------------------------------------------------------
+
+debug:
+ @echo 'b=$b'
+ @echo 'b_times_l=$(b_times_l)'
+ @echo 'b_mod_w=$(b_mod_w)'
+ @echo 'b_gb=$(b_gb)'
+ @echo 'l1_mem_gb=$(l1_mem_gb)'
+ @echo 'l2_mem_gb=$(l2_mem_gb)'
+ @echo 'union_mem_gb=$(union_mem_gb)'
+ @echo 'l1_bloom_files="$(l1_bloom_files)"'
+ @echo 'l2_bloom_files="$(l2_bloom_files)"'
+ @echo '$$(call getWindow, $(word 1,$(l1_bloom_files))): $(call getWindow,$(word 1,$(l1_bloom_files)))'
+ @echo '$$(call getReadFilename, $(word 1,$(l1_bloom_files))): $(call getReadFilename,$(word 1,$(l1_bloom_files)))'
+ @echo '$$(call getReadFilePath, $(word 1,$(l1_bloom_files))): $(call getReadFilePath,$(word 1,$(l1_bloom_files)))'
+ @echo '$$(call getSiblingBloomFiles, $(word 1,$(l1_bloom_files))): $(call getSiblingBloomFiles,$(word 1,$(l1_bloom_files)))'
diff --git a/bin/abyss-bwamem b/bin/abyss-bwamem
new file mode 100755
index 0000000..11c1f22
--- /dev/null
+++ b/bin/abyss-bwamem
@@ -0,0 +1,78 @@
+#!/bin/bash
+set -eu
+
+case $1 in
+ --help)
+ cat <<EOF
+Usage: abyss-bwamem [OPTION]... QUERY... TARGET
+Align the sequences of the files QUERY to those of the file
+TARGET using bwa.
+EOF
+ exit
+ ;;
+ --version)
+ cat <<EOF
+abyss-bwamem (ABySS)
+Written by Shaun Jackman.
+EOF
+ bwa 2>&1 |head -n4
+ exit
+ ;;
+esac
+
+# Parse the command line.
+bwamem='bwa mem'
+bwa_index='bwa index'
+while getopts :j:l:v opt; do
+ case $opt in
+ j) bwamem="$bwamem -t$OPTARG";;
+ l) bwamem="$bwamem -k$OPTARG";;
+ v) ;;
+ \?) echo >&2 "abyss-bwamem: invalid option: $OPTARG"; exit 1;;
+ esac
+done
+shift $((OPTIND-1))
+
+query=("$@")
+target=${query[${#query[@]}-1]}
+unset query[${#query[@]}-1]
+index=$target.bwt
+
+# Build the index.
+if [ ! -r $index ]; then
+ echo >&2 "Building the index $index..."
+ echo >&2 $bwa_index $target $target
+ $bwa_index $target $target 1>&2
+elif [ $index -ot $target ]; then
+ echo >&2 "The index $index is stale. Rebuilding the index..."
+ echo >&2 $bwa_index $target $target
+ $bwa_index $target $target 1>&2
+else
+ echo >&2 "The index $index is up to date."
+fi
+
+# Map the reads.
+echo >&2 $bwamem $target "${query[@]}"
+#exec $bwamem $target "${query[@]}" | abyss-tofastq -i "${query[@]}"
+
+
+
+exec abyss-tofastq "${query[@]}" \
+ |$bwamem $target - \
+ |awk '
+BEGIN {
+ OFS = "\t"
+}
+/^@/ { print; next }
+$1 == x { next }
+{ x = $1 }
+sub("/1$", "", $1) > 0 {
+ $2 = or($2, 0x41)
+ print; next
+}
+sub("/[23]$", "", $1) > 0 {
+ $2 = or($2, 0x81)
+ print; next
+}
+{ print }
+'
diff --git a/bin/abyss-joindist b/bin/abyss-joindist
index afbdfb4..ddb03be 100755
--- a/bin/abyss-joindist
+++ b/bin/abyss-joindist
@@ -66,7 +66,7 @@ Written by Shaun Jackman.
=head1 REPORTING BUGS
-Report bugs to <abyss at bcgsc.ca>.
+Report bugs to <abyss-users at googlegroups.com>.
=head1 COPYRIGHT
diff --git a/bin/abyss-pe b/bin/abyss-pe
index 73339ba..0fb384c 100755
--- a/bin/abyss-pe
+++ b/bin/abyss-pe
@@ -1,6 +1,7 @@
#!/usr/bin/make -rRf
# Run the ABySS assembler.
-# Written by Shaun Jackman <sjackman at bcgsc.ca>.
+# Written by Shaun Jackman <sjackman at bcgsc.ca> and
+# Anthony Raymond <traymond at bcgsc.ca>.
# Set pipefail to require that all commands of a pipe must succeed.
SHELL=/bin/bash -o pipefail
@@ -84,12 +85,14 @@ mpirun=mpirun
endif
# Determine the path to the ABySS executables
-path?=$(shell if ! which ABYSS >/dev/null 2>/dev/null; then \
- dirname $(MAKEFILE_LIST); fi)
+path?=$(shell dirname `which $(MAKEFILE_LIST)`)
ifdef path
PATH:=$(path):$(PATH)
endif
+# Programs
+MARKDOWN=multimarkdown
+
ifdef lib
map=$(foreach a,$(2),$(call $(1),$(a)))
deref=$($1)
@@ -130,7 +133,13 @@ ifdef b
abyssopt += -b$b
pbopt += -b$b
endif
-abyssopt += $v --coverage-hist=coverage.hist -s $*-bubbles.fa
+ifdef Q
+abyssopt += -Q$Q
+endif
+ifdef ss
+SS=--SS
+endif
+abyssopt += $v $(SS) --coverage-hist=coverage.hist -s $*-bubbles.fa
# Number of threads
ifdef PE_HOSTFILE
@@ -147,24 +156,44 @@ endif
# AdjList parameters
m?=50
+# filtergraph parameters
+ifdef xtip
+fgopt := -t$(shell echo $k*2 |bc)
+endif
+
# PopBubbles parameters
p?=0.9
pbopt += -p$p
+ifdef a
+pbopt += -a$a
+endif
+
+# Keep sequence and quality strings of read alignments
+ifdef ssq
+ssq_t :=-ssq
+endif
# Aligner parameters
-aligner?=map
+aligner?=map$(ssq_t)
+ifeq ($(SS),--SS)
+ ifneq ($(aligner),map$(ssq_t))
+ $(warning warning: setting aligner to abyss-map$(ssq_t) since other aligners do not support ss=1)
+ override aligner=map$(ssq_t)
+ endif
+endif
align?=abyss-$(aligner)
-mapopt=$v -j$j -l$($*_l) $(ALIGNER_OPTIONS) $(MAP_OPTIONS)
+mapopt=$v -j$j -l$($*_l) $(SS) $(ALIGNER_OPTIONS) $(MAP_OPTIONS)
# fixmate parameters
ifeq ($(align),abyss-kaligner)
fixmate?=ParseAligns
else
-fixmate?=abyss-fixmate
+fixmate?=abyss-fixmate$(ssq_t)
endif
fmopt=$v -l$($*_l) $(FIXMATE_OPTIONS)
# DistanceEst parameters
+DistanceEst?=DistanceEst$(ssq_t)
l?=$k
s?=200
n?=10
@@ -195,7 +224,7 @@ bwaswopt=-t$j
BWASW_OPTIONS='-b9 -q16 -r1 -w500'
# Remove environment variables
-unexport in se $(lib) $(pe) $(mp)
+unexport in se $(lib) $(pe) $(mp) $(long)
# Check the mandatory parameters
@@ -234,12 +263,13 @@ Report bugs to <abyss-users at bcgsc.ca>.\n'
version:
@printf '\
-abyss-pe (ABySS) 1.3.6\n\
-Written by Shaun Jackman.\n\
+abyss-pe (ABySS) 1.5.2\n\
+Written by Shaun Jackman and Anthony Raymond.\n\
\n\
Copyright 2012 Canada'\''s Michael Smith Genome Science Centre\n'
versions: version
+ @echo PATH=$(PATH)
@ABYSS --version; echo
@-ABYSS-P --version; echo
@AdjList --version; echo
@@ -269,6 +299,9 @@ default: contigs contigs-dot
endif
ifneq ($(mp),)
default: scaffolds scaffolds-dot
+ifneq ($(long),)
+default: long-scaffs long-scaffs-dot
+endif
endif
default: stats
@@ -297,6 +330,12 @@ scaffolds: $(name)-scaffolds.fa
scaffolds-dot: $(name)-scaffolds.dot
+scaftigs: $(name)-scaftigs.fa $(name)-scaftigs.agp
+
+long-scaffs: $(name)-long-scaffs.fa
+
+long-scaffs-dot: $(name)-long-scaffs.dot
+
all: default bam stats
clean:
@@ -306,6 +345,7 @@ clean:
unitigs unitigs-dot \
pe-index pe-sam pe-bam contigs contigs-dot \
mp-index mp-sam mp-bam scaffolds scaffolds-dot \
+ scaftigs long-scaffs long-scaffs-dot \
all clean help version versions
.DELETE_ON_ERROR:
.SECONDARY:
@@ -333,17 +373,17 @@ endif
# Find overlapping contigs
%-1.adj: %-1.fa
- AdjList $v -k$k -m$m $< >$@
+ AdjList $(SS) $v -k$k -m$m $< >$@
# Remove shim contigs
%-2.adj: %-1.adj
- abyss-filtergraph $v -k$k -g $@ $^ >$*-1.path
+ abyss-filtergraph $v $(fgopt) $(FILTERGRAPH_OPTIONS) -k$k -g $@ $^ >$*-1.path
# Pop bubbles
%-2.path %-3.adj: %-1.fa %-2.adj
- PopBubbles $v -j$j -k$k $(pbopt) $(POPBUBBLES_OPTIONS) -g $*-3.adj $^ >$*-2.path
+ PopBubbles $v -j$j -k$k $(SS) $(pbopt) $(POPBUBBLES_OPTIONS) -g $*-3.adj $^ >$*-2.path
%-3.fa: %-1.fa %-2.adj %-2.path
MergeContigs $v -k$k -o $@ $^
@@ -375,17 +415,17 @@ endif
%-3.dist: %-3.sam.gz %-3.hist
gunzip -c $< \
- |DistanceEst $(deopt) -o $@ $*-3.hist
+ |$(DistanceEst) $(deopt) -o $@ $*-3.hist
%-3.dist: %-3.bam %-3.hist
samtools view -h $< \
- |DistanceEst $(deopt) -o $@ $*-3.hist
+ |$(DistanceEst) $(deopt) -o $@ $*-3.hist
%-3.dist: $(name)-3.fa
$(align) $(mapopt) $(strip $($*)) $< \
|$(fixmate) $(fmopt) -h $*-3.hist \
|sort -snk3 -k4 \
- |DistanceEst $(deopt) -o $@ $*-3.hist
+ |$(DistanceEst) $(deopt) -o $@ $*-3.hist
dist=$(addsuffix -3.dist, $(pe))
@@ -400,7 +440,7 @@ endif
# Find overlaps between contigs
%-4.fa %-4.adj: %-3.fa %-3.adj %-3.dist
- Overlap $v $(OVERLAP_OPTIONS) -k$k -g $*-4.adj -o $*-4.fa $^
+ Overlap $v $(SS) $(OVERLAP_OPTIONS) -k$k -g $*-4.adj -o $*-4.fa $^
# Assemble contigs
@@ -411,7 +451,7 @@ endif
MergePaths $v $(MERGEPATHS_OPTIONS) -j$j -k$k -o $@ $^
%-4.path3: %-4.adj %-4.path2
- PathOverlap --assemble $v -k$k $^ >$@
+ PathOverlap --assemble $(SS) $v -k$k $^ >$@
ifndef cs
@@ -464,29 +504,29 @@ endif
%-6.dist.dot: %-6.sam.gz %-6.hist
gunzip -c $< \
- |DistanceEst --dot $(deopt) -o $@ $*-6.hist
+ |$(DistanceEst) --dot $(deopt) -o $@ $*-6.hist
%-6.dist.dot: %-6.bam %-6.hist
samtools view -h $< \
- |DistanceEst --dot $(deopt) -o $@ $*-6.hist
+ |$(DistanceEst) --dot $(deopt) -o $@ $*-6.hist
%-6.dist.dot: $(name)-6.fa
$(align) $(mapopt) $(strip $($*)) $< \
|$(fixmate) $(fmopt) -h $*-6.hist \
|sort -snk3 -k4 \
- |DistanceEst --dot $(deopt) -o $@ $*-6.hist
+ |$(DistanceEst) --dot $(deopt) -o $@ $*-6.hist
# Scaffold
%-6.path: $(name)-6.dot $(addsuffix -6.dist.dot, $(mp))
- abyss-scaffold $v -k$k -s$S -n$N -g $@.dot $(SCAFFOLD_OPTIONS) $^ >$@
+ abyss-scaffold $v $(SS) -k$k -s$S -n$N -g $@.dot $(SCAFFOLD_OPTIONS) $^ >$@
%-7.path %-7.adj %-7.fa: %-6.fa %-6.dot %-6.path
PathConsensus $v -k$k $(pcopt) -s $*-7.fa -g $*-7.adj -o $*-7.path $^
%-8.fa: %-6.fa %-7.fa %-7.adj %-7.path
cat $(wordlist 1, 2, $^) \
- |MergeContigs $v -k$k -o $*-8.fa - $(wordlist 3, 4, $^)
+ |MergeContigs $v -k$k -o $@ - $(wordlist 3, 4, $^)
%-8.dot: %-7.adj %-7.path
PathOverlap --overlap $v --dot -k$k $^ >$@
@@ -497,6 +537,46 @@ endif
%-scaffolds.dot: %-8.dot
ln -sf $< $@
+# Scaftig
+
+%-scaftigs.fa: %-scaffolds-agp.fa
+ ln -sf $< $@
+
+%-scaftigs.agp: %-scaffolds.agp
+ ln -sf $< $@
+
+# Transcriptome assisted scaffolding
+
+%.fa.bwt: %.fa
+ bwa index $<
+
+%-8.sam.gz: $(name)-8.fa.bwt
+ bwa mem -a -t$j -S -P -k$l $(name)-8.fa $(strip $($*)) \
+ |gzip >$@
+
+%-8.dist.dot: %-8.sam.gz
+ abyss-longseqdist -k$k $(LONGSEQDIST_OPTIONS) $< \
+ |grep -v "l=" >$@
+
+%-8.path: $(name)-8.dot $(addsuffix -8.dist.dot, $(long))
+ abyss-scaffold $v $(SS) -k$k -s$S -n1 -g $@.dot $(SCAFFOLD_OPTIONS) $^ >$@
+
+%-9.path %-9.adj %-9.fa: %-8.fa %-8.dot %-8.path
+ PathConsensus $v -k$k $(pcopt) -s $*-9.fa -g $*-9.adj -o $*-9.path $^
+
+%-10.fa: %-8.fa %-9.fa %-9.adj %-9.path
+ cat $(wordlist 1, 2, $^) \
+ |MergeContigs $v -k$k -o $@ - $(wordlist 3, 4, $^)
+
+%-10.dot: %-9.adj %-9.path
+ PathOverlap --overlap $v --dot -k$k $^ >$@
+
+%-long-scaffs.fa: %-10.fa
+ ln -sf $< $@
+
+%-long-scaffs.dot: %-10.dot
+ ln -sf $< $@
+
# Create the final BAM file
ifneq ($(mp),)
@@ -522,9 +602,6 @@ $(name)-contigs.bam $(name)-scaffolds.bam: %.bam: %.fa
# Align the variants to the assembly
-%.fa.bwt: %.fa
- bwa index $<
-
%-variants.bam: %.fa.bwt
bwa bwasw -t$j $*.fa <(cat $(name)-bubbles.fa $(name)-indel.fa) \
|samtools view -Su - |samtools sort -o - - >$@
@@ -537,18 +614,36 @@ $(name)-contigs.bam $(name)-scaffolds.bam: %.bam: %.fa
# Calculate assembly contiguity statistics
-stats: $(name)-stats
+stats: $(name)-stats.tab $(name)-stats $(name)-stats.csv $(name)-stats.md
+ifneq ($(shell which $(MARKDOWN) 2>/dev/null),)
+stats: $(name)-stats.html
+endif
+
+%-stats: %-stats.tab
+ ln -sf $< $@
-$(name)-stats: %-stats: %-unitigs.fa
+$(name)-stats.tab: %-stats.tab: %-unitigs.fa
ifneq ($(in),)
-$(name)-stats: %-stats: %-contigs.fa
+$(name)-stats.tab: %-stats.tab: %-contigs.fa
endif
ifneq ($(mp),)
-$(name)-stats: %-stats: %-scaffolds.fa
+$(name)-stats.tab: %-stats.tab: %-scaffolds.fa
endif
-$(name)-stats:
+ifneq ($(long),)
+$(name)-stats.tab: %-stats.tab: %-long-scaffs.fa
+endif
+$(name)-stats.tab:
abyss-fac $(FAC_OPTIONS) $^ |tee $@
+%.csv: %.tab
+ tr '\t' , <$< >$@
+
+%.md: %.tab
+ abyss-tabtomd $< >$@
+
+%.html: %.md
+ $(MARKDOWN) $< >$@
+
# Create an AGP file and FASTA file of scaftigs from scaffolds
%.agp %-agp.fa: %.fa
@@ -563,3 +658,30 @@ $(name)-stats:
%.break: %.sam.gz
abyss-samtobreak $(SAMTOBREAK_OPTIONS) $< >$@
+
+# Report ABySS configuration variable(s) and value(s) currently set.
+
+override varList := a b c d e E j k l m n N p q s S t v cs pi \
+ np pe lib mp se SS hostname xtip \
+ ssq ssq_ti libs path name in mpirun \
+ aligner long ref fixmate DistanceEst \
+ map deref abyssopt fgopt pbopt \
+ align mapopt fmopt deopt \
+ pcopt sgopt bwaswopt \
+ ABYSS_OPTIONS FILTERGRAPH_OPTIONS POPBUBBLES_OPTIONS \
+ OVERLAP_OPTIONS SIMPLEGRAPH_OPTIONS MERGEPATHS_OPTIONS \
+ SCAFFOLD_OPTIONS ALIGNER_OPTIONS MAP_OPTIONS FAC_OPTIONS \
+ FIXMATE_OPTIONS BWASW_OPTIONS FATOAGP_OPTIONS SAMTOBREAK_OPTIONS \
+ MARKDOWN
+
+.PHONY: env
+env:
+ @echo -e "\
+ List of ABySS configuration variables currently set:\n\n\
+ [environment], if variable was inherited from the environment.\n\
+ [command line], if variable was defined on the command line.\n\
+ [file], if variable was defined in (this) makefile.\n\
+ [override], if variable was defined with an override directive in (this) makefile.\n"
+
+ @$(foreach var,$(varList),\
+ echo -e $(var)" = "$($(var))"\t["$(origin $(var))"]" | grep -v "undefined";)
diff --git a/bin/abyss-samtoafg b/bin/abyss-samtoafg
index ce588bb..48f972f 100755
--- a/bin/abyss-samtoafg
+++ b/bin/abyss-samtoafg
@@ -105,6 +105,7 @@ while (<>) {
die unless defined $qqual;
$tstart--; # convert to zero-based coordinate
+ next if $flag & 0x100; # secondary alignment
$qid .= "/1" if $flag & 0x40; #FREAD1
$qid .= "/2" if $flag & 0x80; #FREAD2
diff --git a/bin/abyss-tabtomd b/bin/abyss-tabtomd
new file mode 100755
index 0000000..7605c07
--- /dev/null
+++ b/bin/abyss-tabtomd
@@ -0,0 +1,12 @@
+#!/bin/sh
+set -eu
+exec awk '
+BEGIN { FS = "\t"; OFS = "\t|" }
+{ $1 = $1; print }
+NR == 1 {
+ printf "%s", "---"
+ for (i = 1; i < NF; ++i)
+ printf "%s", OFS "---"
+ print ""
+}
+' "$@" |column -ts"$(printf '\t')"
diff --git a/compile b/compile
deleted file mode 100755
index 531136b..0000000
--- a/compile
+++ /dev/null
@@ -1,347 +0,0 @@
-#! /bin/sh
-# Wrapper for compilers which do not understand '-c -o'.
-
-scriptversion=2012-10-14.11; # UTC
-
-# Copyright (C) 1999-2013 Free Software Foundation, Inc.
-# Written by Tom Tromey <tromey at cygnus.com>.
-#
-# This program is free software; you can redistribute it and/or modify
-# it under the terms of the GNU General Public License as published by
-# the Free Software Foundation; either version 2, or (at your option)
-# any later version.
-#
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY; without even the implied warranty of
-# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
-# GNU General Public License for more details.
-#
-# You should have received a copy of the GNU General Public License
-# along with this program. If not, see <http://www.gnu.org/licenses/>.
-
-# As a special exception to the GNU General Public License, if you
-# distribute this file as part of a program that contains a
-# configuration script generated by Autoconf, you may include it under
-# the same distribution terms that you use for the rest of that program.
-
-# This file is maintained in Automake, please report
-# bugs to <bug-automake at gnu.org> or send patches to
-# <automake-patches at gnu.org>.
-
-nl='
-'
-
-# We need space, tab and new line, in precisely that order. Quoting is
-# there to prevent tools from complaining about whitespace usage.
-IFS=" "" $nl"
-
-file_conv=
-
-# func_file_conv build_file lazy
-# Convert a $build file to $host form and store it in $file
-# Currently only supports Windows hosts. If the determined conversion
-# type is listed in (the comma separated) LAZY, no conversion will
-# take place.
-func_file_conv ()
-{
- file=$1
- case $file in
- / | /[!/]*) # absolute file, and not a UNC file
- if test -z "$file_conv"; then
- # lazily determine how to convert abs files
- case `uname -s` in
- MINGW*)
- file_conv=mingw
- ;;
- CYGWIN*)
- file_conv=cygwin
- ;;
- *)
- file_conv=wine
- ;;
- esac
- fi
- case $file_conv/,$2, in
- *,$file_conv,*)
- ;;
- mingw/*)
- file=`cmd //C echo "$file " | sed -e 's/"\(.*\) " *$/\1/'`
- ;;
- cygwin/*)
- file=`cygpath -m "$file" || echo "$file"`
- ;;
- wine/*)
- file=`winepath -w "$file" || echo "$file"`
- ;;
- esac
- ;;
- esac
-}
-
-# func_cl_dashL linkdir
-# Make cl look for libraries in LINKDIR
-func_cl_dashL ()
-{
- func_file_conv "$1"
- if test -z "$lib_path"; then
- lib_path=$file
- else
- lib_path="$lib_path;$file"
- fi
- linker_opts="$linker_opts -LIBPATH:$file"
-}
-
-# func_cl_dashl library
-# Do a library search-path lookup for cl
-func_cl_dashl ()
-{
- lib=$1
- found=no
- save_IFS=$IFS
- IFS=';'
- for dir in $lib_path $LIB
- do
- IFS=$save_IFS
- if $shared && test -f "$dir/$lib.dll.lib"; then
- found=yes
- lib=$dir/$lib.dll.lib
- break
- fi
- if test -f "$dir/$lib.lib"; then
- found=yes
- lib=$dir/$lib.lib
- break
- fi
- if test -f "$dir/lib$lib.a"; then
- found=yes
- lib=$dir/lib$lib.a
- break
- fi
- done
- IFS=$save_IFS
-
- if test "$found" != yes; then
- lib=$lib.lib
- fi
-}
-
-# func_cl_wrapper cl arg...
-# Adjust compile command to suit cl
-func_cl_wrapper ()
-{
- # Assume a capable shell
- lib_path=
- shared=:
- linker_opts=
- for arg
- do
- if test -n "$eat"; then
- eat=
- else
- case $1 in
- -o)
- # configure might choose to run compile as 'compile cc -o foo foo.c'.
- eat=1
- case $2 in
- *.o | *.[oO][bB][jJ])
- func_file_conv "$2"
- set x "$@" -Fo"$file"
- shift
- ;;
- *)
- func_file_conv "$2"
- set x "$@" -Fe"$file"
- shift
- ;;
- esac
- ;;
- -I)
- eat=1
- func_file_conv "$2" mingw
- set x "$@" -I"$file"
- shift
- ;;
- -I*)
- func_file_conv "${1#-I}" mingw
- set x "$@" -I"$file"
- shift
- ;;
- -l)
- eat=1
- func_cl_dashl "$2"
- set x "$@" "$lib"
- shift
- ;;
- -l*)
- func_cl_dashl "${1#-l}"
- set x "$@" "$lib"
- shift
- ;;
- -L)
- eat=1
- func_cl_dashL "$2"
- ;;
- -L*)
- func_cl_dashL "${1#-L}"
- ;;
- -static)
- shared=false
- ;;
- -Wl,*)
- arg=${1#-Wl,}
- save_ifs="$IFS"; IFS=','
- for flag in $arg; do
- IFS="$save_ifs"
- linker_opts="$linker_opts $flag"
- done
- IFS="$save_ifs"
- ;;
- -Xlinker)
- eat=1
- linker_opts="$linker_opts $2"
- ;;
- -*)
- set x "$@" "$1"
- shift
- ;;
- *.cc | *.CC | *.cxx | *.CXX | *.[cC]++)
- func_file_conv "$1"
- set x "$@" -Tp"$file"
- shift
- ;;
- *.c | *.cpp | *.CPP | *.lib | *.LIB | *.Lib | *.OBJ | *.obj | *.[oO])
- func_file_conv "$1" mingw
- set x "$@" "$file"
- shift
- ;;
- *)
- set x "$@" "$1"
- shift
- ;;
- esac
- fi
- shift
- done
- if test -n "$linker_opts"; then
- linker_opts="-link$linker_opts"
- fi
- exec "$@" $linker_opts
- exit 1
-}
-
-eat=
-
-case $1 in
- '')
- echo "$0: No command. Try '$0 --help' for more information." 1>&2
- exit 1;
- ;;
- -h | --h*)
- cat <<\EOF
-Usage: compile [--help] [--version] PROGRAM [ARGS]
-
-Wrapper for compilers which do not understand '-c -o'.
-Remove '-o dest.o' from ARGS, run PROGRAM with the remaining
-arguments, and rename the output as expected.
-
-If you are trying to build a whole package this is not the
-right script to run: please start by reading the file 'INSTALL'.
-
-Report bugs to <bug-automake at gnu.org>.
-EOF
- exit $?
- ;;
- -v | --v*)
- echo "compile $scriptversion"
- exit $?
- ;;
- cl | *[/\\]cl | cl.exe | *[/\\]cl.exe )
- func_cl_wrapper "$@" # Doesn't return...
- ;;
-esac
-
-ofile=
-cfile=
-
-for arg
-do
- if test -n "$eat"; then
- eat=
- else
- case $1 in
- -o)
- # configure might choose to run compile as 'compile cc -o foo foo.c'.
- # So we strip '-o arg' only if arg is an object.
- eat=1
- case $2 in
- *.o | *.obj)
- ofile=$2
- ;;
- *)
- set x "$@" -o "$2"
- shift
- ;;
- esac
- ;;
- *.c)
- cfile=$1
- set x "$@" "$1"
- shift
- ;;
- *)
- set x "$@" "$1"
- shift
- ;;
- esac
- fi
- shift
-done
-
-if test -z "$ofile" || test -z "$cfile"; then
- # If no '-o' option was seen then we might have been invoked from a
- # pattern rule where we don't need one. That is ok -- this is a
- # normal compilation that the losing compiler can handle. If no
- # '.c' file was seen then we are probably linking. That is also
- # ok.
- exec "$@"
-fi
-
-# Name of file we expect compiler to create.
-cofile=`echo "$cfile" | sed 's|^.*[\\/]||; s|^[a-zA-Z]:||; s/\.c$/.o/'`
-
-# Create the lock directory.
-# Note: use '[/\\:.-]' here to ensure that we don't use the same name
-# that we are using for the .o file. Also, base the name on the expected
-# object file name, since that is what matters with a parallel build.
-lockdir=`echo "$cofile" | sed -e 's|[/\\:.-]|_|g'`.d
-while true; do
- if mkdir "$lockdir" >/dev/null 2>&1; then
- break
- fi
- sleep 1
-done
-# FIXME: race condition here if user kills between mkdir and trap.
-trap "rmdir '$lockdir'; exit 1" 1 2 15
-
-# Run the compile.
-"$@"
-ret=$?
-
-if test -f "$cofile"; then
- test "$cofile" = "$ofile" || mv "$cofile" "$ofile"
-elif test -f "${cofile}bj"; then
- test "${cofile}bj" = "$ofile" || mv "${cofile}bj" "$ofile"
-fi
-
-rmdir "$lockdir"
-exit $ret
-
-# Local Variables:
-# mode: shell-script
-# sh-indentation: 2
-# eval: (add-hook 'write-file-hooks 'time-stamp)
-# time-stamp-start: "scriptversion="
-# time-stamp-format: "%:y-%02m-%02d.%02H"
-# time-stamp-time-zone: "UTC"
-# time-stamp-end: "; # UTC"
-# End:
diff --git a/config.h.in b/config.h.in
deleted file mode 100644
index 809f1f0..0000000
--- a/config.h.in
+++ /dev/null
@@ -1,285 +0,0 @@
-/* config.h.in. Generated from configure.ac by autoheader. */
-
-/* Define if building universal (internal helper macro) */
-#undef AC_APPLE_UNIVERSAL_BUILD
-
-/* Width of bits of the FM-index in bits */
-#undef FMBITS
-
-/* Define to 1 if you have the <boost/property_map/property_map.hpp> header
- file. */
-#undef HAVE_BOOST_PROPERTY_MAP_PROPERTY_MAP_HPP
-
-/* Define to 1 if you have the <dlfcn.h> header file. */
-#undef HAVE_DLFCN_H
-
-/* Define to 1 if you don't have `vprintf' but do have `_doprnt.' */
-#undef HAVE_DOPRNT
-
-/* Define to 1 if you have the `dup2' function. */
-#undef HAVE_DUP2
-
-/* Define to 1 if you have the <fcntl.h> header file. */
-#undef HAVE_FCNTL_H
-
-/* Define to 1 if you have the <float.h> header file. */
-#undef HAVE_FLOAT_H
-
-/* Define to 1 if you have the `fork' function. */
-#undef HAVE_FORK
-
-/* Define to 1 if you have the `gethostname' function. */
-#undef HAVE_GETHOSTNAME
-
-/* Define to 1 if you have the `getopt_long' function. */
-#undef HAVE_GETOPT_LONG
-
-/* Define to 1 if you have the `getpagesize' function. */
-#undef HAVE_GETPAGESIZE
-
-/* Define to 1 if you have the <google/sparse_hash_map> header file. */
-#undef HAVE_GOOGLE_SPARSE_HASH_MAP
-
-/* Define to 1 if you have the <inttypes.h> header file. */
-#undef HAVE_INTTYPES_H
-
-/* Define to 1 if you have the `dl' library (-ldl). */
-#undef HAVE_LIBDL
-
-/* Define to 1 if you have the `lam' library (-llam). */
-#undef HAVE_LIBLAM
-
-/* Define to 1 if you have the `lammpi++' library (-llammpi++). */
-#undef HAVE_LIBLAMMPI__
-
-/* Define to 1 if you have the `m' library (-lm). */
-#undef HAVE_LIBM
-
-/* Define to 1 if you have the `mpi' library (-lmpi). */
-#undef HAVE_LIBMPI
-
-/* Define to 1 if you have the `mpich' library (-lmpich). */
-#undef HAVE_LIBMPICH
-
-/* Define to 1 if you have the `mpl' library (-lmpl). */
-#undef HAVE_LIBMPL
-
-/* Define to 1 if you have the `pthread' library (-lpthread). */
-#undef HAVE_LIBPTHREAD
-
-/* Define to 1 if you have the <limits.h> header file. */
-#undef HAVE_LIMITS_H
-
-/* Define to 1 if your system has a GNU libc compatible `malloc' function, and
- to 0 otherwise. */
-#undef HAVE_MALLOC
-
-/* Define to 1 if you have the <memory.h> header file. */
-#undef HAVE_MEMORY_H
-
-/* Define to 1 if you have the `memset' function. */
-#undef HAVE_MEMSET
-
-/* Define to 1 if you have the <mpi.h> header file. */
-#undef HAVE_MPI_H
-
-/* Define to 0 if you do not have popcnt. */
-#undef HAVE_POPCNT
-
-/* Define to 1 if you have the `pow' function. */
-#undef HAVE_POW
-
-/* Define to 1 if the system has the type `ptrdiff_t'. */
-#undef HAVE_PTRDIFF_T
-
-/* Define to 1 if your system has a GNU libc compatible `realloc' function,
- and to 0 otherwise. */
-#undef HAVE_REALLOC
-
-/* Define to 1 if you have the `sqrt' function. */
-#undef HAVE_SQRT
-
-/* Define to 1 if stdbool.h conforms to C99. */
-#undef HAVE_STDBOOL_H
-
-/* Define to 1 if you have the <stddef.h> header file. */
-#undef HAVE_STDDEF_H
-
-/* Define to 1 if you have the <stdint.h> header file. */
-#undef HAVE_STDINT_H
-
-/* Define to 1 if you have the <stdlib.h> header file. */
-#undef HAVE_STDLIB_H
-
-/* Define to 1 if you have the `strdup' function. */
-#undef HAVE_STRDUP
-
-/* Define to 1 if you have the `strerror' function. */
-#undef HAVE_STRERROR
-
-/* Define to 1 if you have the <strings.h> header file. */
-#undef HAVE_STRINGS_H
-
-/* Define to 1 if you have the <string.h> header file. */
-#undef HAVE_STRING_H
-
-/* Define to 1 if you have the `strtoul' function. */
-#undef HAVE_STRTOUL
-
-/* Define to 1 if you have the <sys/param.h> header file. */
-#undef HAVE_SYS_PARAM_H
-
-/* Define to 1 if you have the <sys/stat.h> header file. */
-#undef HAVE_SYS_STAT_H
-
-/* Define to 1 if you have the <sys/types.h> header file. */
-#undef HAVE_SYS_TYPES_H
-
-/* Define to 1 if you have the <tr1/unordered_map> header file. */
-#undef HAVE_TR1_UNORDERED_MAP
-
-/* Define to 1 if you have the <unistd.h> header file. */
-#undef HAVE_UNISTD_H
-
-/* Define to 1 if you have the <unordered_map> header file. */
-#undef HAVE_UNORDERED_MAP
-
-/* Define to 1 if you have the `vfork' function. */
-#undef HAVE_VFORK
-
-/* Define to 1 if you have the <vfork.h> header file. */
-#undef HAVE_VFORK_H
-
-/* Define to 1 if you have the `vprintf' function. */
-#undef HAVE_VPRINTF
-
-/* Define to 1 if `fork' works. */
-#undef HAVE_WORKING_FORK
-
-/* Define to 1 if `vfork' works. */
-#undef HAVE_WORKING_VFORK
-
-/* Define to 1 if the system has the type `_Bool'. */
-#undef HAVE__BOOL
-
-/* Define if the system does not provide HOST_NAME_MAX */
-#undef HOST_NAME_MAX
-
-/* maximum k-mer length */
-#undef MAX_KMER
-
-/* Define to disable MPICH C++ bindings */
-#undef MPICH_SKIP_MPICXX
-
-/* Define to disable OpenMPI C++ bindings */
-#undef OMPI_SKIP_MPICXX
-
-/* Name of package */
-#undef PACKAGE
-
-/* Define to the address where bug reports for this package should be sent. */
-#undef PACKAGE_BUGREPORT
-
-/* Define to the full name of this package. */
-#undef PACKAGE_NAME
-
-/* Define to the full name and version of this package. */
-#undef PACKAGE_STRING
-
-/* Define to the one symbol short name of this package. */
-#undef PACKAGE_TARNAME
-
-/* Define to the home page for this package. */
-#undef PACKAGE_URL
-
-/* Define to the version of this package. */
-#undef PACKAGE_VERSION
-
-/* Define to use SAM sequence and quality fields */
-#undef SAM_SEQ_QUAL
-
-/* Define to 1 if you have the ANSI C header files. */
-#undef STDC_HEADERS
-
-/* Version number of package */
-#undef VERSION
-
-/* Define WORDS_BIGENDIAN to 1 if your processor stores words with the most
- significant byte first (like Motorola and SPARC, unlike Intel). */
-#if defined AC_APPLE_UNIVERSAL_BUILD
-# if defined __BIG_ENDIAN__
-# define WORDS_BIGENDIAN 1
-# endif
-#else
-# ifndef WORDS_BIGENDIAN
-# undef WORDS_BIGENDIAN
-# endif
-#endif
-
-/* Define for Solaris 2.5.1 so the uint32_t typedef from <sys/synch.h>,
- <pthread.h>, or <semaphore.h> is not used. If the typedef were allowed, the
- #define below would cause a syntax error. */
-#undef _UINT32_T
-
-/* Define for Solaris 2.5.1 so the uint64_t typedef from <sys/synch.h>,
- <pthread.h>, or <semaphore.h> is not used. If the typedef were allowed, the
- #define below would cause a syntax error. */
-#undef _UINT64_T
-
-/* Define for Solaris 2.5.1 so the uint8_t typedef from <sys/synch.h>,
- <pthread.h>, or <semaphore.h> is not used. If the typedef were allowed, the
- #define below would cause a syntax error. */
-#undef _UINT8_T
-
-/* Define if the system does not provide ceilf */
-#undef ceilf
-
-/* Define to empty if `const' does not conform to ANSI C. */
-#undef const
-
-/* Define to `__inline__' or `__inline' if that's what the C compiler
- calls it, or to nothing if 'inline' is not supported under any name. */
-#ifndef __cplusplus
-#undef inline
-#endif
-
-/* Define to the type of a signed integer type of width exactly 64 bits if
- such a type exists and the standard includes do not define it. */
-#undef int64_t
-
-/* Define to rpl_malloc if the replacement function should be used. */
-#undef malloc
-
-/* Define to `int' if <sys/types.h> does not define. */
-#undef mode_t
-
-/* Define to `int' if <sys/types.h> does not define. */
-#undef pid_t
-
-/* Define to rpl_realloc if the replacement function should be used. */
-#undef realloc
-
-/* Define to `unsigned int' if <sys/types.h> does not define. */
-#undef size_t
-
-/* Define to `int' if <sys/types.h> does not define. */
-#undef ssize_t
-
-/* Define to the type of an unsigned integer type of width exactly 16 bits if
- such a type exists and the standard includes do not define it. */
-#undef uint16_t
-
-/* Define to the type of an unsigned integer type of width exactly 32 bits if
- such a type exists and the standard includes do not define it. */
-#undef uint32_t
-
-/* Define to the type of an unsigned integer type of width exactly 64 bits if
- such a type exists and the standard includes do not define it. */
-#undef uint64_t
-
-/* Define to the type of an unsigned integer type of width exactly 8 bits if
- such a type exists and the standard includes do not define it. */
-#undef uint8_t
-
-/* Define as `fork' if `vfork' does not work. */
-#undef vfork
diff --git a/configure b/configure
deleted file mode 100755
index ff3d00c..0000000
--- a/configure
+++ /dev/null
@@ -1,8868 +0,0 @@
-#! /bin/sh
-# Guess values for system-dependent variables and create Makefiles.
-# Generated by GNU Autoconf 2.69 for ABySS 1.3.6.
-#
-# Report bugs to <abyss-users at bcgsc.ca>.
-#
-#
-# Copyright (C) 1992-1996, 1998-2012 Free Software Foundation, Inc.
-#
-#
-# This configure script is free software; the Free Software Foundation
-# gives unlimited permission to copy, distribute and modify it.
-## -------------------- ##
-## M4sh Initialization. ##
-## -------------------- ##
-
-# Be more Bourne compatible
-DUALCASE=1; export DUALCASE # for MKS sh
-if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then :
- emulate sh
- NULLCMD=:
- # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
- # is contrary to our usage. Disable this feature.
- alias -g '${1+"$@"}'='"$@"'
- setopt NO_GLOB_SUBST
-else
- case `(set -o) 2>/dev/null` in #(
- *posix*) :
- set -o posix ;; #(
- *) :
- ;;
-esac
-fi
-
-
-as_nl='
-'
-export as_nl
-# Printing a long string crashes Solaris 7 /usr/bin/printf.
-as_echo='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
-as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo
-as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo$as_echo
-# Prefer a ksh shell builtin over an external printf program on Solaris,
-# but without wasting forks for bash or zsh.
-if test -z "$BASH_VERSION$ZSH_VERSION" \
- && (test "X`print -r -- $as_echo`" = "X$as_echo") 2>/dev/null; then
- as_echo='print -r --'
- as_echo_n='print -rn --'
-elif (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then
- as_echo='printf %s\n'
- as_echo_n='printf %s'
-else
- if test "X`(/usr/ucb/echo -n -n $as_echo) 2>/dev/null`" = "X-n $as_echo"; then
- as_echo_body='eval /usr/ucb/echo -n "$1$as_nl"'
- as_echo_n='/usr/ucb/echo -n'
- else
- as_echo_body='eval expr "X$1" : "X\\(.*\\)"'
- as_echo_n_body='eval
- arg=$1;
- case $arg in #(
- *"$as_nl"*)
- expr "X$arg" : "X\\(.*\\)$as_nl";
- arg=`expr "X$arg" : ".*$as_nl\\(.*\\)"`;;
- esac;
- expr "X$arg" : "X\\(.*\\)" | tr -d "$as_nl"
- '
- export as_echo_n_body
- as_echo_n='sh -c $as_echo_n_body as_echo'
- fi
- export as_echo_body
- as_echo='sh -c $as_echo_body as_echo'
-fi
-
-# The user is always right.
-if test "${PATH_SEPARATOR+set}" != set; then
- PATH_SEPARATOR=:
- (PATH='/bin;/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 && {
- (PATH='/bin:/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 ||
- PATH_SEPARATOR=';'
- }
-fi
-
-
-# IFS
-# We need space, tab and new line, in precisely that order. Quoting is
-# there to prevent editors from complaining about space-tab.
-# (If _AS_PATH_WALK were called with IFS unset, it would disable word
-# splitting by setting IFS to empty value.)
-IFS=" "" $as_nl"
-
-# Find who we are. Look in the path if we contain no directory separator.
-as_myself=
-case $0 in #((
- *[\\/]* ) as_myself=$0 ;;
- *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
- done
-IFS=$as_save_IFS
-
- ;;
-esac
-# We did not find ourselves, most probably we were run as `sh COMMAND'
-# in which case we are not to be found in the path.
-if test "x$as_myself" = x; then
- as_myself=$0
-fi
-if test ! -f "$as_myself"; then
- $as_echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2
- exit 1
-fi
-
-# Unset variables that we do not need and which cause bugs (e.g. in
-# pre-3.0 UWIN ksh). But do not cause bugs in bash 2.01; the "|| exit 1"
-# suppresses any "Segmentation fault" message there. '((' could
-# trigger a bug in pdksh 5.2.14.
-for as_var in BASH_ENV ENV MAIL MAILPATH
-do eval test x\${$as_var+set} = xset \
- && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || :
-done
-PS1='$ '
-PS2='> '
-PS4='+ '
-
-# NLS nuisances.
-LC_ALL=C
-export LC_ALL
-LANGUAGE=C
-export LANGUAGE
-
-# CDPATH.
-(unset CDPATH) >/dev/null 2>&1 && unset CDPATH
-
-# Use a proper internal environment variable to ensure we don't fall
- # into an infinite loop, continuously re-executing ourselves.
- if test x"${_as_can_reexec}" != xno && test "x$CONFIG_SHELL" != x; then
- _as_can_reexec=no; export _as_can_reexec;
- # We cannot yet assume a decent shell, so we have to provide a
-# neutralization value for shells without unset; and this also
-# works around shells that cannot unset nonexistent variables.
-# Preserve -v and -x to the replacement shell.
-BASH_ENV=/dev/null
-ENV=/dev/null
-(unset BASH_ENV) >/dev/null 2>&1 && unset BASH_ENV ENV
-case $- in # ((((
- *v*x* | *x*v* ) as_opts=-vx ;;
- *v* ) as_opts=-v ;;
- *x* ) as_opts=-x ;;
- * ) as_opts= ;;
-esac
-exec $CONFIG_SHELL $as_opts "$as_myself" ${1+"$@"}
-# Admittedly, this is quite paranoid, since all the known shells bail
-# out after a failed `exec'.
-$as_echo "$0: could not re-execute with $CONFIG_SHELL" >&2
-as_fn_exit 255
- fi
- # We don't want this to propagate to other subprocesses.
- { _as_can_reexec=; unset _as_can_reexec;}
-if test "x$CONFIG_SHELL" = x; then
- as_bourne_compatible="if test -n \"\${ZSH_VERSION+set}\" && (emulate sh) >/dev/null 2>&1; then :
- emulate sh
- NULLCMD=:
- # Pre-4.2 versions of Zsh do word splitting on \${1+\"\$@\"}, which
- # is contrary to our usage. Disable this feature.
- alias -g '\${1+\"\$@\"}'='\"\$@\"'
- setopt NO_GLOB_SUBST
-else
- case \`(set -o) 2>/dev/null\` in #(
- *posix*) :
- set -o posix ;; #(
- *) :
- ;;
-esac
-fi
-"
- as_required="as_fn_return () { (exit \$1); }
-as_fn_success () { as_fn_return 0; }
-as_fn_failure () { as_fn_return 1; }
-as_fn_ret_success () { return 0; }
-as_fn_ret_failure () { return 1; }
-
-exitcode=0
-as_fn_success || { exitcode=1; echo as_fn_success failed.; }
-as_fn_failure && { exitcode=1; echo as_fn_failure succeeded.; }
-as_fn_ret_success || { exitcode=1; echo as_fn_ret_success failed.; }
-as_fn_ret_failure && { exitcode=1; echo as_fn_ret_failure succeeded.; }
-if ( set x; as_fn_ret_success y && test x = \"\$1\" ); then :
-
-else
- exitcode=1; echo positional parameters were not saved.
-fi
-test x\$exitcode = x0 || exit 1
-test -x / || exit 1"
- as_suggested=" as_lineno_1=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_1a=\$LINENO
- as_lineno_2=";as_suggested=$as_suggested$LINENO;as_suggested=$as_suggested" as_lineno_2a=\$LINENO
- eval 'test \"x\$as_lineno_1'\$as_run'\" != \"x\$as_lineno_2'\$as_run'\" &&
- test \"x\`expr \$as_lineno_1'\$as_run' + 1\`\" = \"x\$as_lineno_2'\$as_run'\"' || exit 1
-test \$(( 1 + 1 )) = 2 || exit 1"
- if (eval "$as_required") 2>/dev/null; then :
- as_have_required=yes
-else
- as_have_required=no
-fi
- if test x$as_have_required = xyes && (eval "$as_suggested") 2>/dev/null; then :
-
-else
- as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-as_found=false
-for as_dir in /bin$PATH_SEPARATOR/usr/bin$PATH_SEPARATOR$PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- as_found=:
- case $as_dir in #(
- /*)
- for as_base in sh bash ksh sh5; do
- # Try only shells that exist, to save several forks.
- as_shell=$as_dir/$as_base
- if { test -f "$as_shell" || test -f "$as_shell.exe"; } &&
- { $as_echo "$as_bourne_compatible""$as_required" | as_run=a "$as_shell"; } 2>/dev/null; then :
- CONFIG_SHELL=$as_shell as_have_required=yes
- if { $as_echo "$as_bourne_compatible""$as_suggested" | as_run=a "$as_shell"; } 2>/dev/null; then :
- break 2
-fi
-fi
- done;;
- esac
- as_found=false
-done
-$as_found || { if { test -f "$SHELL" || test -f "$SHELL.exe"; } &&
- { $as_echo "$as_bourne_compatible""$as_required" | as_run=a "$SHELL"; } 2>/dev/null; then :
- CONFIG_SHELL=$SHELL as_have_required=yes
-fi; }
-IFS=$as_save_IFS
-
-
- if test "x$CONFIG_SHELL" != x; then :
- export CONFIG_SHELL
- # We cannot yet assume a decent shell, so we have to provide a
-# neutralization value for shells without unset; and this also
-# works around shells that cannot unset nonexistent variables.
-# Preserve -v and -x to the replacement shell.
-BASH_ENV=/dev/null
-ENV=/dev/null
-(unset BASH_ENV) >/dev/null 2>&1 && unset BASH_ENV ENV
-case $- in # ((((
- *v*x* | *x*v* ) as_opts=-vx ;;
- *v* ) as_opts=-v ;;
- *x* ) as_opts=-x ;;
- * ) as_opts= ;;
-esac
-exec $CONFIG_SHELL $as_opts "$as_myself" ${1+"$@"}
-# Admittedly, this is quite paranoid, since all the known shells bail
-# out after a failed `exec'.
-$as_echo "$0: could not re-execute with $CONFIG_SHELL" >&2
-exit 255
-fi
-
- if test x$as_have_required = xno; then :
- $as_echo "$0: This script requires a shell more modern than all"
- $as_echo "$0: the shells that I found on your system."
- if test x${ZSH_VERSION+set} = xset ; then
- $as_echo "$0: In particular, zsh $ZSH_VERSION has bugs and should"
- $as_echo "$0: be upgraded to zsh 4.3.4 or later."
- else
- $as_echo "$0: Please tell bug-autoconf at gnu.org and
-$0: abyss-users at bcgsc.ca about your system, including any
-$0: error possibly output before this message. Then install
-$0: a modern shell, or manually run the script under such a
-$0: shell if you do have one."
- fi
- exit 1
-fi
-fi
-fi
-SHELL=${CONFIG_SHELL-/bin/sh}
-export SHELL
-# Unset more variables known to interfere with behavior of common tools.
-CLICOLOR_FORCE= GREP_OPTIONS=
-unset CLICOLOR_FORCE GREP_OPTIONS
-
-## --------------------- ##
-## M4sh Shell Functions. ##
-## --------------------- ##
-# as_fn_unset VAR
-# ---------------
-# Portably unset VAR.
-as_fn_unset ()
-{
- { eval $1=; unset $1;}
-}
-as_unset=as_fn_unset
-
-# as_fn_set_status STATUS
-# -----------------------
-# Set $? to STATUS, without forking.
-as_fn_set_status ()
-{
- return $1
-} # as_fn_set_status
-
-# as_fn_exit STATUS
-# -----------------
-# Exit the shell with STATUS, even in a "trap 0" or "set -e" context.
-as_fn_exit ()
-{
- set +e
- as_fn_set_status $1
- exit $1
-} # as_fn_exit
-
-# as_fn_mkdir_p
-# -------------
-# Create "$as_dir" as a directory, including parents if necessary.
-as_fn_mkdir_p ()
-{
-
- case $as_dir in #(
- -*) as_dir=./$as_dir;;
- esac
- test -d "$as_dir" || eval $as_mkdir_p || {
- as_dirs=
- while :; do
- case $as_dir in #(
- *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
- *) as_qdir=$as_dir;;
- esac
- as_dirs="'$as_qdir' $as_dirs"
- as_dir=`$as_dirname -- "$as_dir" ||
-$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
- X"$as_dir" : 'X\(//\)[^/]' \| \
- X"$as_dir" : 'X\(//\)$' \| \
- X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$as_dir" |
- sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
- s//\1/
- q
- }
- /^X\(\/\/\)[^/].*/{
- s//\1/
- q
- }
- /^X\(\/\/\)$/{
- s//\1/
- q
- }
- /^X\(\/\).*/{
- s//\1/
- q
- }
- s/.*/./; q'`
- test -d "$as_dir" && break
- done
- test -z "$as_dirs" || eval "mkdir $as_dirs"
- } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir"
-
-
-} # as_fn_mkdir_p
-
-# as_fn_executable_p FILE
-# -----------------------
-# Test if FILE is an executable regular file.
-as_fn_executable_p ()
-{
- test -f "$1" && test -x "$1"
-} # as_fn_executable_p
-# as_fn_append VAR VALUE
-# ----------------------
-# Append the text in VALUE to the end of the definition contained in VAR. Take
-# advantage of any shell optimizations that allow amortized linear growth over
-# repeated appends, instead of the typical quadratic growth present in naive
-# implementations.
-if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null; then :
- eval 'as_fn_append ()
- {
- eval $1+=\$2
- }'
-else
- as_fn_append ()
- {
- eval $1=\$$1\$2
- }
-fi # as_fn_append
-
-# as_fn_arith ARG...
-# ------------------
-# Perform arithmetic evaluation on the ARGs, and store the result in the
-# global $as_val. Take advantage of shells that can avoid forks. The arguments
-# must be portable across $(()) and expr.
-if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null; then :
- eval 'as_fn_arith ()
- {
- as_val=$(( $* ))
- }'
-else
- as_fn_arith ()
- {
- as_val=`expr "$@" || test $? -eq 1`
- }
-fi # as_fn_arith
-
-
-# as_fn_error STATUS ERROR [LINENO LOG_FD]
-# ----------------------------------------
-# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are
-# provided, also output the error to LOG_FD, referencing LINENO. Then exit the
-# script with STATUS, using 1 if that was 0.
-as_fn_error ()
-{
- as_status=$1; test $as_status -eq 0 && as_status=1
- if test "$4"; then
- as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- $as_echo "$as_me:${as_lineno-$LINENO}: error: $2" >&$4
- fi
- $as_echo "$as_me: error: $2" >&2
- as_fn_exit $as_status
-} # as_fn_error
-
-if expr a : '\(a\)' >/dev/null 2>&1 &&
- test "X`expr 00001 : '.*\(...\)'`" = X001; then
- as_expr=expr
-else
- as_expr=false
-fi
-
-if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then
- as_basename=basename
-else
- as_basename=false
-fi
-
-if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
- as_dirname=dirname
-else
- as_dirname=false
-fi
-
-as_me=`$as_basename -- "$0" ||
-$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
- X"$0" : 'X\(//\)$' \| \
- X"$0" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X/"$0" |
- sed '/^.*\/\([^/][^/]*\)\/*$/{
- s//\1/
- q
- }
- /^X\/\(\/\/\)$/{
- s//\1/
- q
- }
- /^X\/\(\/\).*/{
- s//\1/
- q
- }
- s/.*/./; q'`
-
-# Avoid depending upon Character Ranges.
-as_cr_letters='abcdefghijklmnopqrstuvwxyz'
-as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
-as_cr_Letters=$as_cr_letters$as_cr_LETTERS
-as_cr_digits='0123456789'
-as_cr_alnum=$as_cr_Letters$as_cr_digits
-
-
- as_lineno_1=$LINENO as_lineno_1a=$LINENO
- as_lineno_2=$LINENO as_lineno_2a=$LINENO
- eval 'test "x$as_lineno_1'$as_run'" != "x$as_lineno_2'$as_run'" &&
- test "x`expr $as_lineno_1'$as_run' + 1`" = "x$as_lineno_2'$as_run'"' || {
- # Blame Lee E. McMahon (1931-1989) for sed's syntax. :-)
- sed -n '
- p
- /[$]LINENO/=
- ' <$as_myself |
- sed '
- s/[$]LINENO.*/&-/
- t lineno
- b
- :lineno
- N
- :loop
- s/[$]LINENO\([^'$as_cr_alnum'_].*\n\)\(.*\)/\2\1\2/
- t loop
- s/-\n.*//
- ' >$as_me.lineno &&
- chmod +x "$as_me.lineno" ||
- { $as_echo "$as_me: error: cannot create $as_me.lineno; rerun with a POSIX shell" >&2; as_fn_exit 1; }
-
- # If we had to re-execute with $CONFIG_SHELL, we're ensured to have
- # already done that, so ensure we don't try to do so again and fall
- # in an infinite loop. This has already happened in practice.
- _as_can_reexec=no; export _as_can_reexec
- # Don't try to exec as it changes $[0], causing all sort of problems
- # (the dirname of $[0] is not the place where we might find the
- # original and so on. Autoconf is especially sensitive to this).
- . "./$as_me.lineno"
- # Exit status is that of the last command.
- exit
-}
-
-ECHO_C= ECHO_N= ECHO_T=
-case `echo -n x` in #(((((
--n*)
- case `echo 'xy\c'` in
- *c*) ECHO_T=' ';; # ECHO_T is single tab character.
- xy) ECHO_C='\c';;
- *) echo `echo ksh88 bug on AIX 6.1` > /dev/null
- ECHO_T=' ';;
- esac;;
-*)
- ECHO_N='-n';;
-esac
-
-rm -f conf$$ conf$$.exe conf$$.file
-if test -d conf$$.dir; then
- rm -f conf$$.dir/conf$$.file
-else
- rm -f conf$$.dir
- mkdir conf$$.dir 2>/dev/null
-fi
-if (echo >conf$$.file) 2>/dev/null; then
- if ln -s conf$$.file conf$$ 2>/dev/null; then
- as_ln_s='ln -s'
- # ... but there are two gotchas:
- # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail.
- # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable.
- # In both cases, we have to default to `cp -pR'.
- ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe ||
- as_ln_s='cp -pR'
- elif ln conf$$.file conf$$ 2>/dev/null; then
- as_ln_s=ln
- else
- as_ln_s='cp -pR'
- fi
-else
- as_ln_s='cp -pR'
-fi
-rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file
-rmdir conf$$.dir 2>/dev/null
-
-if mkdir -p . 2>/dev/null; then
- as_mkdir_p='mkdir -p "$as_dir"'
-else
- test -d ./-p && rmdir ./-p
- as_mkdir_p=false
-fi
-
-as_test_x='test -x'
-as_executable_p=as_fn_executable_p
-
-# Sed expression to map a string onto a valid CPP name.
-as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'"
-
-# Sed expression to map a string onto a valid variable name.
-as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'"
-
-
-test -n "$DJDIR" || exec 7<&0 </dev/null
-exec 6>&1
-
-# Name of the host.
-# hostname on some systems (SVR3.2, old GNU/Linux) returns a bogus exit status,
-# so uname gets run too.
-ac_hostname=`(hostname || uname -n) 2>/dev/null | sed 1q`
-
-#
-# Initializations.
-#
-ac_default_prefix=/usr/local
-ac_clean_files=
-ac_config_libobj_dir=.
-LIBOBJS=
-cross_compiling=no
-subdirs=
-MFLAGS=
-MAKEFLAGS=
-
-# Identity of this package.
-PACKAGE_NAME='ABySS'
-PACKAGE_TARNAME='abyss'
-PACKAGE_VERSION='1.3.6'
-PACKAGE_STRING='ABySS 1.3.6'
-PACKAGE_BUGREPORT='abyss-users at bcgsc.ca'
-PACKAGE_URL='http://www.bcgsc.ca/platform/bioinfo/software/abyss'
-
-ac_unique_file="ABYSS/Abyss.cpp"
-# Factoring default headers for most tests.
-ac_includes_default="\
-#include <stdio.h>
-#ifdef HAVE_SYS_TYPES_H
-# include <sys/types.h>
-#endif
-#ifdef HAVE_SYS_STAT_H
-# include <sys/stat.h>
-#endif
-#ifdef STDC_HEADERS
-# include <stdlib.h>
-# include <stddef.h>
-#else
-# ifdef HAVE_STDLIB_H
-# include <stdlib.h>
-# endif
-#endif
-#ifdef HAVE_STRING_H
-# if !defined STDC_HEADERS && defined HAVE_MEMORY_H
-# include <memory.h>
-# endif
-# include <string.h>
-#endif
-#ifdef HAVE_STRINGS_H
-# include <strings.h>
-#endif
-#ifdef HAVE_INTTYPES_H
-# include <inttypes.h>
-#endif
-#ifdef HAVE_STDINT_H
-# include <stdint.h>
-#endif
-#ifdef HAVE_UNISTD_H
-# include <unistd.h>
-#endif"
-
-ac_subst_vars='am__EXEEXT_FALSE
-am__EXEEXT_TRUE
-LTLIBOBJS
-AM_CXXFLAGS
-OPENMP_CXXFLAGS
-CXXCPP
-MPI_LIBS
-HAVE_LIBMPI_FALSE
-HAVE_LIBMPI_TRUE
-LIBOBJS
-EGREP
-GREP
-HAVE_GHC_FALSE
-HAVE_GHC_TRUE
-GHC
-RANLIB
-am__fastdepCXX_FALSE
-am__fastdepCXX_TRUE
-CXXDEPMODE
-ac_ct_CXX
-CXXFLAGS
-CXX
-CPP
-am__fastdepCC_FALSE
-am__fastdepCC_TRUE
-CCDEPMODE
-am__nodep
-AMDEPBACKSLASH
-AMDEP_FALSE
-AMDEP_TRUE
-am__quote
-am__include
-DEPDIR
-OBJEXT
-EXEEXT
-ac_ct_CC
-CPPFLAGS
-LDFLAGS
-CFLAGS
-CC
-AM_BACKSLASH
-AM_DEFAULT_VERBOSITY
-AM_DEFAULT_V
-AM_V
-am__untar
-am__tar
-AMTAR
-am__leading_dot
-SET_MAKE
-AWK
-mkdir_p
-MKDIR_P
-INSTALL_STRIP_PROGRAM
-STRIP
-install_sh
-MAKEINFO
-AUTOHEADER
-AUTOMAKE
-AUTOCONF
-ACLOCAL
-VERSION
-PACKAGE
-CYGPATH_W
-am__isrc
-INSTALL_DATA
-INSTALL_SCRIPT
-INSTALL_PROGRAM
-target_alias
-host_alias
-build_alias
-LIBS
-ECHO_T
-ECHO_N
-ECHO_C
-DEFS
-mandir
-localedir
-libdir
-psdir
-pdfdir
-dvidir
-htmldir
-infodir
-docdir
-oldincludedir
-includedir
-localstatedir
-sharedstatedir
-sysconfdir
-datadir
-datarootdir
-libexecdir
-sbindir
-bindir
-program_transform_name
-prefix
-exec_prefix
-PACKAGE_URL
-PACKAGE_BUGREPORT
-PACKAGE_STRING
-PACKAGE_VERSION
-PACKAGE_TARNAME
-PACKAGE_NAME
-PATH_SEPARATOR
-SHELL'
-ac_subst_files=''
-ac_user_opts='
-enable_option_checking
-enable_silent_rules
-enable_dependency_tracking
-with_boost
-with_mpi
-enable_mpich
-enable_lammpi
-enable_fm
-enable_maxk
-enable_samseqqual
-enable_openmp
-'
- ac_precious_vars='build_alias
-host_alias
-target_alias
-CC
-CFLAGS
-LDFLAGS
-LIBS
-CPPFLAGS
-CPP
-CXX
-CXXFLAGS
-CCC
-CXXCPP'
-
-
-# Initialize some variables set by options.
-ac_init_help=
-ac_init_version=false
-ac_unrecognized_opts=
-ac_unrecognized_sep=
-# The variables have the same names as the options, with
-# dashes changed to underlines.
-cache_file=/dev/null
-exec_prefix=NONE
-no_create=
-no_recursion=
-prefix=NONE
-program_prefix=NONE
-program_suffix=NONE
-program_transform_name=s,x,x,
-silent=
-site=
-srcdir=
-verbose=
-x_includes=NONE
-x_libraries=NONE
-
-# Installation directory options.
-# These are left unexpanded so users can "make install exec_prefix=/foo"
-# and all the variables that are supposed to be based on exec_prefix
-# by default will actually change.
-# Use braces instead of parens because sh, perl, etc. also accept them.
-# (The list follows the same order as the GNU Coding Standards.)
-bindir='${exec_prefix}/bin'
-sbindir='${exec_prefix}/sbin'
-libexecdir='${exec_prefix}/libexec'
-datarootdir='${prefix}/share'
-datadir='${datarootdir}'
-sysconfdir='${prefix}/etc'
-sharedstatedir='${prefix}/com'
-localstatedir='${prefix}/var'
-includedir='${prefix}/include'
-oldincludedir='/usr/include'
-docdir='${datarootdir}/doc/${PACKAGE_TARNAME}'
-infodir='${datarootdir}/info'
-htmldir='${docdir}'
-dvidir='${docdir}'
-pdfdir='${docdir}'
-psdir='${docdir}'
-libdir='${exec_prefix}/lib'
-localedir='${datarootdir}/locale'
-mandir='${datarootdir}/man'
-
-ac_prev=
-ac_dashdash=
-for ac_option
-do
- # If the previous option needs an argument, assign it.
- if test -n "$ac_prev"; then
- eval $ac_prev=\$ac_option
- ac_prev=
- continue
- fi
-
- case $ac_option in
- *=?*) ac_optarg=`expr "X$ac_option" : '[^=]*=\(.*\)'` ;;
- *=) ac_optarg= ;;
- *) ac_optarg=yes ;;
- esac
-
- # Accept the important Cygnus configure options, so we can diagnose typos.
-
- case $ac_dashdash$ac_option in
- --)
- ac_dashdash=yes ;;
-
- -bindir | --bindir | --bindi | --bind | --bin | --bi)
- ac_prev=bindir ;;
- -bindir=* | --bindir=* | --bindi=* | --bind=* | --bin=* | --bi=*)
- bindir=$ac_optarg ;;
-
- -build | --build | --buil | --bui | --bu)
- ac_prev=build_alias ;;
- -build=* | --build=* | --buil=* | --bui=* | --bu=*)
- build_alias=$ac_optarg ;;
-
- -cache-file | --cache-file | --cache-fil | --cache-fi \
- | --cache-f | --cache- | --cache | --cach | --cac | --ca | --c)
- ac_prev=cache_file ;;
- -cache-file=* | --cache-file=* | --cache-fil=* | --cache-fi=* \
- | --cache-f=* | --cache-=* | --cache=* | --cach=* | --cac=* | --ca=* | --c=*)
- cache_file=$ac_optarg ;;
-
- --config-cache | -C)
- cache_file=config.cache ;;
-
- -datadir | --datadir | --datadi | --datad)
- ac_prev=datadir ;;
- -datadir=* | --datadir=* | --datadi=* | --datad=*)
- datadir=$ac_optarg ;;
-
- -datarootdir | --datarootdir | --datarootdi | --datarootd | --dataroot \
- | --dataroo | --dataro | --datar)
- ac_prev=datarootdir ;;
- -datarootdir=* | --datarootdir=* | --datarootdi=* | --datarootd=* \
- | --dataroot=* | --dataroo=* | --dataro=* | --datar=*)
- datarootdir=$ac_optarg ;;
-
- -disable-* | --disable-*)
- ac_useropt=`expr "x$ac_option" : 'x-*disable-\(.*\)'`
- # Reject names that are not valid shell variable names.
- expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
- as_fn_error $? "invalid feature name: $ac_useropt"
- ac_useropt_orig=$ac_useropt
- ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
- case $ac_user_opts in
- *"
-"enable_$ac_useropt"
-"*) ;;
- *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--disable-$ac_useropt_orig"
- ac_unrecognized_sep=', ';;
- esac
- eval enable_$ac_useropt=no ;;
-
- -docdir | --docdir | --docdi | --doc | --do)
- ac_prev=docdir ;;
- -docdir=* | --docdir=* | --docdi=* | --doc=* | --do=*)
- docdir=$ac_optarg ;;
-
- -dvidir | --dvidir | --dvidi | --dvid | --dvi | --dv)
- ac_prev=dvidir ;;
- -dvidir=* | --dvidir=* | --dvidi=* | --dvid=* | --dvi=* | --dv=*)
- dvidir=$ac_optarg ;;
-
- -enable-* | --enable-*)
- ac_useropt=`expr "x$ac_option" : 'x-*enable-\([^=]*\)'`
- # Reject names that are not valid shell variable names.
- expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
- as_fn_error $? "invalid feature name: $ac_useropt"
- ac_useropt_orig=$ac_useropt
- ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
- case $ac_user_opts in
- *"
-"enable_$ac_useropt"
-"*) ;;
- *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--enable-$ac_useropt_orig"
- ac_unrecognized_sep=', ';;
- esac
- eval enable_$ac_useropt=\$ac_optarg ;;
-
- -exec-prefix | --exec_prefix | --exec-prefix | --exec-prefi \
- | --exec-pref | --exec-pre | --exec-pr | --exec-p | --exec- \
- | --exec | --exe | --ex)
- ac_prev=exec_prefix ;;
- -exec-prefix=* | --exec_prefix=* | --exec-prefix=* | --exec-prefi=* \
- | --exec-pref=* | --exec-pre=* | --exec-pr=* | --exec-p=* | --exec-=* \
- | --exec=* | --exe=* | --ex=*)
- exec_prefix=$ac_optarg ;;
-
- -gas | --gas | --ga | --g)
- # Obsolete; use --with-gas.
- with_gas=yes ;;
-
- -help | --help | --hel | --he | -h)
- ac_init_help=long ;;
- -help=r* | --help=r* | --hel=r* | --he=r* | -hr*)
- ac_init_help=recursive ;;
- -help=s* | --help=s* | --hel=s* | --he=s* | -hs*)
- ac_init_help=short ;;
-
- -host | --host | --hos | --ho)
- ac_prev=host_alias ;;
- -host=* | --host=* | --hos=* | --ho=*)
- host_alias=$ac_optarg ;;
-
- -htmldir | --htmldir | --htmldi | --htmld | --html | --htm | --ht)
- ac_prev=htmldir ;;
- -htmldir=* | --htmldir=* | --htmldi=* | --htmld=* | --html=* | --htm=* \
- | --ht=*)
- htmldir=$ac_optarg ;;
-
- -includedir | --includedir | --includedi | --included | --include \
- | --includ | --inclu | --incl | --inc)
- ac_prev=includedir ;;
- -includedir=* | --includedir=* | --includedi=* | --included=* | --include=* \
- | --includ=* | --inclu=* | --incl=* | --inc=*)
- includedir=$ac_optarg ;;
-
- -infodir | --infodir | --infodi | --infod | --info | --inf)
- ac_prev=infodir ;;
- -infodir=* | --infodir=* | --infodi=* | --infod=* | --info=* | --inf=*)
- infodir=$ac_optarg ;;
-
- -libdir | --libdir | --libdi | --libd)
- ac_prev=libdir ;;
- -libdir=* | --libdir=* | --libdi=* | --libd=*)
- libdir=$ac_optarg ;;
-
- -libexecdir | --libexecdir | --libexecdi | --libexecd | --libexec \
- | --libexe | --libex | --libe)
- ac_prev=libexecdir ;;
- -libexecdir=* | --libexecdir=* | --libexecdi=* | --libexecd=* | --libexec=* \
- | --libexe=* | --libex=* | --libe=*)
- libexecdir=$ac_optarg ;;
-
- -localedir | --localedir | --localedi | --localed | --locale)
- ac_prev=localedir ;;
- -localedir=* | --localedir=* | --localedi=* | --localed=* | --locale=*)
- localedir=$ac_optarg ;;
-
- -localstatedir | --localstatedir | --localstatedi | --localstated \
- | --localstate | --localstat | --localsta | --localst | --locals)
- ac_prev=localstatedir ;;
- -localstatedir=* | --localstatedir=* | --localstatedi=* | --localstated=* \
- | --localstate=* | --localstat=* | --localsta=* | --localst=* | --locals=*)
- localstatedir=$ac_optarg ;;
-
- -mandir | --mandir | --mandi | --mand | --man | --ma | --m)
- ac_prev=mandir ;;
- -mandir=* | --mandir=* | --mandi=* | --mand=* | --man=* | --ma=* | --m=*)
- mandir=$ac_optarg ;;
-
- -nfp | --nfp | --nf)
- # Obsolete; use --without-fp.
- with_fp=no ;;
-
- -no-create | --no-create | --no-creat | --no-crea | --no-cre \
- | --no-cr | --no-c | -n)
- no_create=yes ;;
-
- -no-recursion | --no-recursion | --no-recursio | --no-recursi \
- | --no-recurs | --no-recur | --no-recu | --no-rec | --no-re | --no-r)
- no_recursion=yes ;;
-
- -oldincludedir | --oldincludedir | --oldincludedi | --oldincluded \
- | --oldinclude | --oldinclud | --oldinclu | --oldincl | --oldinc \
- | --oldin | --oldi | --old | --ol | --o)
- ac_prev=oldincludedir ;;
- -oldincludedir=* | --oldincludedir=* | --oldincludedi=* | --oldincluded=* \
- | --oldinclude=* | --oldinclud=* | --oldinclu=* | --oldincl=* | --oldinc=* \
- | --oldin=* | --oldi=* | --old=* | --ol=* | --o=*)
- oldincludedir=$ac_optarg ;;
-
- -prefix | --prefix | --prefi | --pref | --pre | --pr | --p)
- ac_prev=prefix ;;
- -prefix=* | --prefix=* | --prefi=* | --pref=* | --pre=* | --pr=* | --p=*)
- prefix=$ac_optarg ;;
-
- -program-prefix | --program-prefix | --program-prefi | --program-pref \
- | --program-pre | --program-pr | --program-p)
- ac_prev=program_prefix ;;
- -program-prefix=* | --program-prefix=* | --program-prefi=* \
- | --program-pref=* | --program-pre=* | --program-pr=* | --program-p=*)
- program_prefix=$ac_optarg ;;
-
- -program-suffix | --program-suffix | --program-suffi | --program-suff \
- | --program-suf | --program-su | --program-s)
- ac_prev=program_suffix ;;
- -program-suffix=* | --program-suffix=* | --program-suffi=* \
- | --program-suff=* | --program-suf=* | --program-su=* | --program-s=*)
- program_suffix=$ac_optarg ;;
-
- -program-transform-name | --program-transform-name \
- | --program-transform-nam | --program-transform-na \
- | --program-transform-n | --program-transform- \
- | --program-transform | --program-transfor \
- | --program-transfo | --program-transf \
- | --program-trans | --program-tran \
- | --progr-tra | --program-tr | --program-t)
- ac_prev=program_transform_name ;;
- -program-transform-name=* | --program-transform-name=* \
- | --program-transform-nam=* | --program-transform-na=* \
- | --program-transform-n=* | --program-transform-=* \
- | --program-transform=* | --program-transfor=* \
- | --program-transfo=* | --program-transf=* \
- | --program-trans=* | --program-tran=* \
- | --progr-tra=* | --program-tr=* | --program-t=*)
- program_transform_name=$ac_optarg ;;
-
- -pdfdir | --pdfdir | --pdfdi | --pdfd | --pdf | --pd)
- ac_prev=pdfdir ;;
- -pdfdir=* | --pdfdir=* | --pdfdi=* | --pdfd=* | --pdf=* | --pd=*)
- pdfdir=$ac_optarg ;;
-
- -psdir | --psdir | --psdi | --psd | --ps)
- ac_prev=psdir ;;
- -psdir=* | --psdir=* | --psdi=* | --psd=* | --ps=*)
- psdir=$ac_optarg ;;
-
- -q | -quiet | --quiet | --quie | --qui | --qu | --q \
- | -silent | --silent | --silen | --sile | --sil)
- silent=yes ;;
-
- -sbindir | --sbindir | --sbindi | --sbind | --sbin | --sbi | --sb)
- ac_prev=sbindir ;;
- -sbindir=* | --sbindir=* | --sbindi=* | --sbind=* | --sbin=* \
- | --sbi=* | --sb=*)
- sbindir=$ac_optarg ;;
-
- -sharedstatedir | --sharedstatedir | --sharedstatedi \
- | --sharedstated | --sharedstate | --sharedstat | --sharedsta \
- | --sharedst | --shareds | --shared | --share | --shar \
- | --sha | --sh)
- ac_prev=sharedstatedir ;;
- -sharedstatedir=* | --sharedstatedir=* | --sharedstatedi=* \
- | --sharedstated=* | --sharedstate=* | --sharedstat=* | --sharedsta=* \
- | --sharedst=* | --shareds=* | --shared=* | --share=* | --shar=* \
- | --sha=* | --sh=*)
- sharedstatedir=$ac_optarg ;;
-
- -site | --site | --sit)
- ac_prev=site ;;
- -site=* | --site=* | --sit=*)
- site=$ac_optarg ;;
-
- -srcdir | --srcdir | --srcdi | --srcd | --src | --sr)
- ac_prev=srcdir ;;
- -srcdir=* | --srcdir=* | --srcdi=* | --srcd=* | --src=* | --sr=*)
- srcdir=$ac_optarg ;;
-
- -sysconfdir | --sysconfdir | --sysconfdi | --sysconfd | --sysconf \
- | --syscon | --sysco | --sysc | --sys | --sy)
- ac_prev=sysconfdir ;;
- -sysconfdir=* | --sysconfdir=* | --sysconfdi=* | --sysconfd=* | --sysconf=* \
- | --syscon=* | --sysco=* | --sysc=* | --sys=* | --sy=*)
- sysconfdir=$ac_optarg ;;
-
- -target | --target | --targe | --targ | --tar | --ta | --t)
- ac_prev=target_alias ;;
- -target=* | --target=* | --targe=* | --targ=* | --tar=* | --ta=* | --t=*)
- target_alias=$ac_optarg ;;
-
- -v | -verbose | --verbose | --verbos | --verbo | --verb)
- verbose=yes ;;
-
- -version | --version | --versio | --versi | --vers | -V)
- ac_init_version=: ;;
-
- -with-* | --with-*)
- ac_useropt=`expr "x$ac_option" : 'x-*with-\([^=]*\)'`
- # Reject names that are not valid shell variable names.
- expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
- as_fn_error $? "invalid package name: $ac_useropt"
- ac_useropt_orig=$ac_useropt
- ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
- case $ac_user_opts in
- *"
-"with_$ac_useropt"
-"*) ;;
- *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--with-$ac_useropt_orig"
- ac_unrecognized_sep=', ';;
- esac
- eval with_$ac_useropt=\$ac_optarg ;;
-
- -without-* | --without-*)
- ac_useropt=`expr "x$ac_option" : 'x-*without-\(.*\)'`
- # Reject names that are not valid shell variable names.
- expr "x$ac_useropt" : ".*[^-+._$as_cr_alnum]" >/dev/null &&
- as_fn_error $? "invalid package name: $ac_useropt"
- ac_useropt_orig=$ac_useropt
- ac_useropt=`$as_echo "$ac_useropt" | sed 's/[-+.]/_/g'`
- case $ac_user_opts in
- *"
-"with_$ac_useropt"
-"*) ;;
- *) ac_unrecognized_opts="$ac_unrecognized_opts$ac_unrecognized_sep--without-$ac_useropt_orig"
- ac_unrecognized_sep=', ';;
- esac
- eval with_$ac_useropt=no ;;
-
- --x)
- # Obsolete; use --with-x.
- with_x=yes ;;
-
- -x-includes | --x-includes | --x-include | --x-includ | --x-inclu \
- | --x-incl | --x-inc | --x-in | --x-i)
- ac_prev=x_includes ;;
- -x-includes=* | --x-includes=* | --x-include=* | --x-includ=* | --x-inclu=* \
- | --x-incl=* | --x-inc=* | --x-in=* | --x-i=*)
- x_includes=$ac_optarg ;;
-
- -x-libraries | --x-libraries | --x-librarie | --x-librari \
- | --x-librar | --x-libra | --x-libr | --x-lib | --x-li | --x-l)
- ac_prev=x_libraries ;;
- -x-libraries=* | --x-libraries=* | --x-librarie=* | --x-librari=* \
- | --x-librar=* | --x-libra=* | --x-libr=* | --x-lib=* | --x-li=* | --x-l=*)
- x_libraries=$ac_optarg ;;
-
- -*) as_fn_error $? "unrecognized option: \`$ac_option'
-Try \`$0 --help' for more information"
- ;;
-
- *=*)
- ac_envvar=`expr "x$ac_option" : 'x\([^=]*\)='`
- # Reject names that are not valid shell variable names.
- case $ac_envvar in #(
- '' | [0-9]* | *[!_$as_cr_alnum]* )
- as_fn_error $? "invalid variable name: \`$ac_envvar'" ;;
- esac
- eval $ac_envvar=\$ac_optarg
- export $ac_envvar ;;
-
- *)
- # FIXME: should be removed in autoconf 3.0.
- $as_echo "$as_me: WARNING: you should use --build, --host, --target" >&2
- expr "x$ac_option" : ".*[^-._$as_cr_alnum]" >/dev/null &&
- $as_echo "$as_me: WARNING: invalid host type: $ac_option" >&2
- : "${build_alias=$ac_option} ${host_alias=$ac_option} ${target_alias=$ac_option}"
- ;;
-
- esac
-done
-
-if test -n "$ac_prev"; then
- ac_option=--`echo $ac_prev | sed 's/_/-/g'`
- as_fn_error $? "missing argument to $ac_option"
-fi
-
-if test -n "$ac_unrecognized_opts"; then
- case $enable_option_checking in
- no) ;;
- fatal) as_fn_error $? "unrecognized options: $ac_unrecognized_opts" ;;
- *) $as_echo "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2 ;;
- esac
-fi
-
-# Check all directory arguments for consistency.
-for ac_var in exec_prefix prefix bindir sbindir libexecdir datarootdir \
- datadir sysconfdir sharedstatedir localstatedir includedir \
- oldincludedir docdir infodir htmldir dvidir pdfdir psdir \
- libdir localedir mandir
-do
- eval ac_val=\$$ac_var
- # Remove trailing slashes.
- case $ac_val in
- */ )
- ac_val=`expr "X$ac_val" : 'X\(.*[^/]\)' \| "X$ac_val" : 'X\(.*\)'`
- eval $ac_var=\$ac_val;;
- esac
- # Be sure to have absolute directory names.
- case $ac_val in
- [\\/$]* | ?:[\\/]* ) continue;;
- NONE | '' ) case $ac_var in *prefix ) continue;; esac;;
- esac
- as_fn_error $? "expected an absolute directory name for --$ac_var: $ac_val"
-done
-
-# There might be people who depend on the old broken behavior: `$host'
-# used to hold the argument of --host etc.
-# FIXME: To remove some day.
-build=$build_alias
-host=$host_alias
-target=$target_alias
-
-# FIXME: To remove some day.
-if test "x$host_alias" != x; then
- if test "x$build_alias" = x; then
- cross_compiling=maybe
- elif test "x$build_alias" != "x$host_alias"; then
- cross_compiling=yes
- fi
-fi
-
-ac_tool_prefix=
-test -n "$host_alias" && ac_tool_prefix=$host_alias-
-
-test "$silent" = yes && exec 6>/dev/null
-
-
-ac_pwd=`pwd` && test -n "$ac_pwd" &&
-ac_ls_di=`ls -di .` &&
-ac_pwd_ls_di=`cd "$ac_pwd" && ls -di .` ||
- as_fn_error $? "working directory cannot be determined"
-test "X$ac_ls_di" = "X$ac_pwd_ls_di" ||
- as_fn_error $? "pwd does not report name of working directory"
-
-
-# Find the source files, if location was not specified.
-if test -z "$srcdir"; then
- ac_srcdir_defaulted=yes
- # Try the directory containing this script, then the parent directory.
- ac_confdir=`$as_dirname -- "$as_myself" ||
-$as_expr X"$as_myself" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
- X"$as_myself" : 'X\(//\)[^/]' \| \
- X"$as_myself" : 'X\(//\)$' \| \
- X"$as_myself" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$as_myself" |
- sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
- s//\1/
- q
- }
- /^X\(\/\/\)[^/].*/{
- s//\1/
- q
- }
- /^X\(\/\/\)$/{
- s//\1/
- q
- }
- /^X\(\/\).*/{
- s//\1/
- q
- }
- s/.*/./; q'`
- srcdir=$ac_confdir
- if test ! -r "$srcdir/$ac_unique_file"; then
- srcdir=..
- fi
-else
- ac_srcdir_defaulted=no
-fi
-if test ! -r "$srcdir/$ac_unique_file"; then
- test "$ac_srcdir_defaulted" = yes && srcdir="$ac_confdir or .."
- as_fn_error $? "cannot find sources ($ac_unique_file) in $srcdir"
-fi
-ac_msg="sources are in $srcdir, but \`cd $srcdir' does not work"
-ac_abs_confdir=`(
- cd "$srcdir" && test -r "./$ac_unique_file" || as_fn_error $? "$ac_msg"
- pwd)`
-# When building in place, set srcdir=.
-if test "$ac_abs_confdir" = "$ac_pwd"; then
- srcdir=.
-fi
-# Remove unnecessary trailing slashes from srcdir.
-# Double slashes in file names in object file debugging info
-# mess up M-x gdb in Emacs.
-case $srcdir in
-*/) srcdir=`expr "X$srcdir" : 'X\(.*[^/]\)' \| "X$srcdir" : 'X\(.*\)'`;;
-esac
-for ac_var in $ac_precious_vars; do
- eval ac_env_${ac_var}_set=\${${ac_var}+set}
- eval ac_env_${ac_var}_value=\$${ac_var}
- eval ac_cv_env_${ac_var}_set=\${${ac_var}+set}
- eval ac_cv_env_${ac_var}_value=\$${ac_var}
-done
-
-#
-# Report the --help message.
-#
-if test "$ac_init_help" = "long"; then
- # Omit some internal or obsolete options to make the list less imposing.
- # This message is too long to be a string in the A/UX 3.1 sh.
- cat <<_ACEOF
-\`configure' configures ABySS 1.3.6 to adapt to many kinds of systems.
-
-Usage: $0 [OPTION]... [VAR=VALUE]...
-
-To assign environment variables (e.g., CC, CFLAGS...), specify them as
-VAR=VALUE. See below for descriptions of some of the useful variables.
-
-Defaults for the options are specified in brackets.
-
-Configuration:
- -h, --help display this help and exit
- --help=short display options specific to this package
- --help=recursive display the short help of all the included packages
- -V, --version display version information and exit
- -q, --quiet, --silent do not print \`checking ...' messages
- --cache-file=FILE cache test results in FILE [disabled]
- -C, --config-cache alias for \`--cache-file=config.cache'
- -n, --no-create do not create output files
- --srcdir=DIR find the sources in DIR [configure dir or \`..']
-
-Installation directories:
- --prefix=PREFIX install architecture-independent files in PREFIX
- [$ac_default_prefix]
- --exec-prefix=EPREFIX install architecture-dependent files in EPREFIX
- [PREFIX]
-
-By default, \`make install' will install all the files in
-\`$ac_default_prefix/bin', \`$ac_default_prefix/lib' etc. You can specify
-an installation prefix other than \`$ac_default_prefix' using \`--prefix',
-for instance \`--prefix=\$HOME'.
-
-For better control, use the options below.
-
-Fine tuning of the installation directories:
- --bindir=DIR user executables [EPREFIX/bin]
- --sbindir=DIR system admin executables [EPREFIX/sbin]
- --libexecdir=DIR program executables [EPREFIX/libexec]
- --sysconfdir=DIR read-only single-machine data [PREFIX/etc]
- --sharedstatedir=DIR modifiable architecture-independent data [PREFIX/com]
- --localstatedir=DIR modifiable single-machine data [PREFIX/var]
- --libdir=DIR object code libraries [EPREFIX/lib]
- --includedir=DIR C header files [PREFIX/include]
- --oldincludedir=DIR C header files for non-gcc [/usr/include]
- --datarootdir=DIR read-only arch.-independent data root [PREFIX/share]
- --datadir=DIR read-only architecture-independent data [DATAROOTDIR]
- --infodir=DIR info documentation [DATAROOTDIR/info]
- --localedir=DIR locale-dependent data [DATAROOTDIR/locale]
- --mandir=DIR man documentation [DATAROOTDIR/man]
- --docdir=DIR documentation root [DATAROOTDIR/doc/abyss]
- --htmldir=DIR html documentation [DOCDIR]
- --dvidir=DIR dvi documentation [DOCDIR]
- --pdfdir=DIR pdf documentation [DOCDIR]
- --psdir=DIR ps documentation [DOCDIR]
-_ACEOF
-
- cat <<\_ACEOF
-
-Program names:
- --program-prefix=PREFIX prepend PREFIX to installed program names
- --program-suffix=SUFFIX append SUFFIX to installed program names
- --program-transform-name=PROGRAM run sed PROGRAM on installed program names
-_ACEOF
-fi
-
-if test -n "$ac_init_help"; then
- case $ac_init_help in
- short | recursive ) echo "Configuration of ABySS 1.3.6:";;
- esac
- cat <<\_ACEOF
-
-Optional Features:
- --disable-option-checking ignore unrecognized --enable/--with options
- --disable-FEATURE do not include FEATURE (same as --enable-FEATURE=no)
- --enable-FEATURE[=ARG] include FEATURE [ARG=yes]
- --enable-silent-rules less verbose build output (undo: "make V=1")
- --disable-silent-rules verbose build output (undo: "make V=0")
- --enable-dependency-tracking
- do not reject slow dependency extractors
- --disable-dependency-tracking
- speeds up one-time build
- --enable-mpich use MPICH (default is to use Open MPI)
- --enable-lammpi use LAM/MPI (default is to use Open MPI)
- --enable-fm specify the width of the FM-index in bits (default
- is 64-bit)
- --enable-maxk=N set the maximum k-mer length (default is 64)
- --enable-samseqqual enable SAM sequence and quality fields
- --disable-openmp do not use OpenMP
-
-Optional Packages:
- --with-PACKAGE[=ARG] use PACKAGE [ARG=yes]
- --without-PACKAGE do not use PACKAGE (same as --with-PACKAGE=no)
- --with-boost=PATH specify directory for the boost header files
- --with-mpi=PATH specify prefix directory for the installed MPI
- parallel computing library
-
-Some influential environment variables:
- CC C compiler command
- CFLAGS C compiler flags
- LDFLAGS linker flags, e.g. -L<lib dir> if you have libraries in a
- nonstandard directory <lib dir>
- LIBS libraries to pass to the linker, e.g. -l<library>
- CPPFLAGS (Objective) C/C++ preprocessor flags, e.g. -I<include dir> if
- you have headers in a nonstandard directory <include dir>
- CPP C preprocessor
- CXX C++ compiler command
- CXXFLAGS C++ compiler flags
- CXXCPP C++ preprocessor
-
-Use these variables to override the choices made by `configure' or to help
-it to find libraries and programs with nonstandard names/locations.
-
-Report bugs to <abyss-users at bcgsc.ca>.
-ABySS home page: <http://www.bcgsc.ca/platform/bioinfo/software/abyss>.
-_ACEOF
-ac_status=$?
-fi
-
-if test "$ac_init_help" = "recursive"; then
- # If there are subdirs, report their specific --help.
- for ac_dir in : $ac_subdirs_all; do test "x$ac_dir" = x: && continue
- test -d "$ac_dir" ||
- { cd "$srcdir" && ac_pwd=`pwd` && srcdir=. && test -d "$ac_dir"; } ||
- continue
- ac_builddir=.
-
-case "$ac_dir" in
-.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;;
-*)
- ac_dir_suffix=/`$as_echo "$ac_dir" | sed 's|^\.[\\/]||'`
- # A ".." for each directory in $ac_dir_suffix.
- ac_top_builddir_sub=`$as_echo "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'`
- case $ac_top_builddir_sub in
- "") ac_top_builddir_sub=. ac_top_build_prefix= ;;
- *) ac_top_build_prefix=$ac_top_builddir_sub/ ;;
- esac ;;
-esac
-ac_abs_top_builddir=$ac_pwd
-ac_abs_builddir=$ac_pwd$ac_dir_suffix
-# for backward compatibility:
-ac_top_builddir=$ac_top_build_prefix
-
-case $srcdir in
- .) # We are building in place.
- ac_srcdir=.
- ac_top_srcdir=$ac_top_builddir_sub
- ac_abs_top_srcdir=$ac_pwd ;;
- [\\/]* | ?:[\\/]* ) # Absolute name.
- ac_srcdir=$srcdir$ac_dir_suffix;
- ac_top_srcdir=$srcdir
- ac_abs_top_srcdir=$srcdir ;;
- *) # Relative name.
- ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix
- ac_top_srcdir=$ac_top_build_prefix$srcdir
- ac_abs_top_srcdir=$ac_pwd/$srcdir ;;
-esac
-ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix
-
- cd "$ac_dir" || { ac_status=$?; continue; }
- # Check for guested configure.
- if test -f "$ac_srcdir/configure.gnu"; then
- echo &&
- $SHELL "$ac_srcdir/configure.gnu" --help=recursive
- elif test -f "$ac_srcdir/configure"; then
- echo &&
- $SHELL "$ac_srcdir/configure" --help=recursive
- else
- $as_echo "$as_me: WARNING: no configuration information is in $ac_dir" >&2
- fi || ac_status=$?
- cd "$ac_pwd" || { ac_status=$?; break; }
- done
-fi
-
-test -n "$ac_init_help" && exit $ac_status
-if $ac_init_version; then
- cat <<\_ACEOF
-ABySS configure 1.3.6
-generated by GNU Autoconf 2.69
-
-Copyright (C) 2012 Free Software Foundation, Inc.
-This configure script is free software; the Free Software Foundation
-gives unlimited permission to copy, distribute and modify it.
-_ACEOF
- exit
-fi
-
-## ------------------------ ##
-## Autoconf initialization. ##
-## ------------------------ ##
-
-# ac_fn_c_try_compile LINENO
-# --------------------------
-# Try to compile conftest.$ac_ext, and return whether this succeeded.
-ac_fn_c_try_compile ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- rm -f conftest.$ac_objext
- if { { ac_try="$ac_compile"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_compile") 2>conftest.err
- ac_status=$?
- if test -s conftest.err; then
- grep -v '^ *+' conftest.err >conftest.er1
- cat conftest.er1 >&5
- mv -f conftest.er1 conftest.err
- fi
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; } && {
- test -z "$ac_c_werror_flag" ||
- test ! -s conftest.err
- } && test -s conftest.$ac_objext; then :
- ac_retval=0
-else
- $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
- ac_retval=1
-fi
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
- as_fn_set_status $ac_retval
-
-} # ac_fn_c_try_compile
-
-# ac_fn_c_try_cpp LINENO
-# ----------------------
-# Try to preprocess conftest.$ac_ext, and return whether this succeeded.
-ac_fn_c_try_cpp ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- if { { ac_try="$ac_cpp conftest.$ac_ext"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_cpp conftest.$ac_ext") 2>conftest.err
- ac_status=$?
- if test -s conftest.err; then
- grep -v '^ *+' conftest.err >conftest.er1
- cat conftest.er1 >&5
- mv -f conftest.er1 conftest.err
- fi
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; } > conftest.i && {
- test -z "$ac_c_preproc_warn_flag$ac_c_werror_flag" ||
- test ! -s conftest.err
- }; then :
- ac_retval=0
-else
- $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
- ac_retval=1
-fi
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
- as_fn_set_status $ac_retval
-
-} # ac_fn_c_try_cpp
-
-# ac_fn_cxx_try_compile LINENO
-# ----------------------------
-# Try to compile conftest.$ac_ext, and return whether this succeeded.
-ac_fn_cxx_try_compile ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- rm -f conftest.$ac_objext
- if { { ac_try="$ac_compile"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_compile") 2>conftest.err
- ac_status=$?
- if test -s conftest.err; then
- grep -v '^ *+' conftest.err >conftest.er1
- cat conftest.er1 >&5
- mv -f conftest.er1 conftest.err
- fi
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; } && {
- test -z "$ac_cxx_werror_flag" ||
- test ! -s conftest.err
- } && test -s conftest.$ac_objext; then :
- ac_retval=0
-else
- $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
- ac_retval=1
-fi
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
- as_fn_set_status $ac_retval
-
-} # ac_fn_cxx_try_compile
-
-# ac_fn_c_check_header_mongrel LINENO HEADER VAR INCLUDES
-# -------------------------------------------------------
-# Tests whether HEADER exists, giving a warning if it cannot be compiled using
-# the include files in INCLUDES and setting the cache variable VAR
-# accordingly.
-ac_fn_c_check_header_mongrel ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- if eval \${$3+:} false; then :
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
-$as_echo_n "checking for $2... " >&6; }
-if eval \${$3+:} false; then :
- $as_echo_n "(cached) " >&6
-fi
-eval ac_res=\$$3
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
-else
- # Is the header compilable?
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking $2 usability" >&5
-$as_echo_n "checking $2 usability... " >&6; }
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$4
-#include <$2>
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- ac_header_compiler=yes
-else
- ac_header_compiler=no
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_header_compiler" >&5
-$as_echo "$ac_header_compiler" >&6; }
-
-# Is the header present?
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking $2 presence" >&5
-$as_echo_n "checking $2 presence... " >&6; }
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <$2>
-_ACEOF
-if ac_fn_c_try_cpp "$LINENO"; then :
- ac_header_preproc=yes
-else
- ac_header_preproc=no
-fi
-rm -f conftest.err conftest.i conftest.$ac_ext
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_header_preproc" >&5
-$as_echo "$ac_header_preproc" >&6; }
-
-# So? What about this header?
-case $ac_header_compiler:$ac_header_preproc:$ac_c_preproc_warn_flag in #((
- yes:no: )
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: accepted by the compiler, rejected by the preprocessor!" >&5
-$as_echo "$as_me: WARNING: $2: accepted by the compiler, rejected by the preprocessor!" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: proceeding with the compiler's result" >&5
-$as_echo "$as_me: WARNING: $2: proceeding with the compiler's result" >&2;}
- ;;
- no:yes:* )
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: present but cannot be compiled" >&5
-$as_echo "$as_me: WARNING: $2: present but cannot be compiled" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: check for missing prerequisite headers?" >&5
-$as_echo "$as_me: WARNING: $2: check for missing prerequisite headers?" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: see the Autoconf documentation" >&5
-$as_echo "$as_me: WARNING: $2: see the Autoconf documentation" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: section \"Present But Cannot Be Compiled\"" >&5
-$as_echo "$as_me: WARNING: $2: section \"Present But Cannot Be Compiled\"" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: proceeding with the compiler's result" >&5
-$as_echo "$as_me: WARNING: $2: proceeding with the compiler's result" >&2;}
-( $as_echo "## ----------------------------------- ##
-## Report this to abyss-users at bcgsc.ca ##
-## ----------------------------------- ##"
- ) | sed "s/^/$as_me: WARNING: /" >&2
- ;;
-esac
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
-$as_echo_n "checking for $2... " >&6; }
-if eval \${$3+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- eval "$3=\$ac_header_compiler"
-fi
-eval ac_res=\$$3
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
-fi
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
-
-} # ac_fn_c_check_header_mongrel
-
-# ac_fn_c_try_run LINENO
-# ----------------------
-# Try to link conftest.$ac_ext, and return whether this succeeded. Assumes
-# that executables *can* be run.
-ac_fn_c_try_run ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- if { { ac_try="$ac_link"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_link") 2>&5
- ac_status=$?
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; } && { ac_try='./conftest$ac_exeext'
- { { case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_try") 2>&5
- ac_status=$?
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; }; }; then :
- ac_retval=0
-else
- $as_echo "$as_me: program exited with status $ac_status" >&5
- $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
- ac_retval=$ac_status
-fi
- rm -rf conftest.dSYM conftest_ipa8_conftest.oo
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
- as_fn_set_status $ac_retval
-
-} # ac_fn_c_try_run
-
-# ac_fn_c_check_header_compile LINENO HEADER VAR INCLUDES
-# -------------------------------------------------------
-# Tests whether HEADER exists and can be compiled using the include files in
-# INCLUDES, setting the cache variable VAR accordingly.
-ac_fn_c_check_header_compile ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
-$as_echo_n "checking for $2... " >&6; }
-if eval \${$3+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$4
-#include <$2>
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- eval "$3=yes"
-else
- eval "$3=no"
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-eval ac_res=\$$3
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
-
-} # ac_fn_c_check_header_compile
-
-# ac_fn_c_check_type LINENO TYPE VAR INCLUDES
-# -------------------------------------------
-# Tests whether TYPE exists after having included INCLUDES, setting cache
-# variable VAR accordingly.
-ac_fn_c_check_type ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
-$as_echo_n "checking for $2... " >&6; }
-if eval \${$3+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- eval "$3=no"
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$4
-int
-main ()
-{
-if (sizeof ($2))
- return 0;
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$4
-int
-main ()
-{
-if (sizeof (($2)))
- return 0;
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
-
-else
- eval "$3=yes"
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-eval ac_res=\$$3
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
-
-} # ac_fn_c_check_type
-
-# ac_fn_c_find_intX_t LINENO BITS VAR
-# -----------------------------------
-# Finds a signed integer type with width BITS, setting cache variable VAR
-# accordingly.
-ac_fn_c_find_intX_t ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for int$2_t" >&5
-$as_echo_n "checking for int$2_t... " >&6; }
-if eval \${$3+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- eval "$3=no"
- # Order is important - never check a type that is potentially smaller
- # than half of the expected target width.
- for ac_type in int$2_t 'int' 'long int' \
- 'long long int' 'short int' 'signed char'; do
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$ac_includes_default
- enum { N = $2 / 2 - 1 };
-int
-main ()
-{
-static int test_array [1 - 2 * !(0 < ($ac_type) ((((($ac_type) 1 << N) << N) - 1) * 2 + 1))];
-test_array [0] = 0;
-return test_array [0];
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$ac_includes_default
- enum { N = $2 / 2 - 1 };
-int
-main ()
-{
-static int test_array [1 - 2 * !(($ac_type) ((((($ac_type) 1 << N) << N) - 1) * 2 + 1)
- < ($ac_type) ((((($ac_type) 1 << N) << N) - 1) * 2 + 2))];
-test_array [0] = 0;
-return test_array [0];
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
-
-else
- case $ac_type in #(
- int$2_t) :
- eval "$3=yes" ;; #(
- *) :
- eval "$3=\$ac_type" ;;
-esac
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
- if eval test \"x\$"$3"\" = x"no"; then :
-
-else
- break
-fi
- done
-fi
-eval ac_res=\$$3
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
-
-} # ac_fn_c_find_intX_t
-
-# ac_fn_c_find_uintX_t LINENO BITS VAR
-# ------------------------------------
-# Finds an unsigned integer type with width BITS, setting cache variable VAR
-# accordingly.
-ac_fn_c_find_uintX_t ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for uint$2_t" >&5
-$as_echo_n "checking for uint$2_t... " >&6; }
-if eval \${$3+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- eval "$3=no"
- # Order is important - never check a type that is potentially smaller
- # than half of the expected target width.
- for ac_type in uint$2_t 'unsigned int' 'unsigned long int' \
- 'unsigned long long int' 'unsigned short int' 'unsigned char'; do
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$ac_includes_default
-int
-main ()
-{
-static int test_array [1 - 2 * !((($ac_type) -1 >> ($2 / 2 - 1)) >> ($2 / 2 - 1) == 3)];
-test_array [0] = 0;
-return test_array [0];
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- case $ac_type in #(
- uint$2_t) :
- eval "$3=yes" ;; #(
- *) :
- eval "$3=\$ac_type" ;;
-esac
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
- if eval test \"x\$"$3"\" = x"no"; then :
-
-else
- break
-fi
- done
-fi
-eval ac_res=\$$3
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
-
-} # ac_fn_c_find_uintX_t
-
-# ac_fn_c_try_link LINENO
-# -----------------------
-# Try to link conftest.$ac_ext, and return whether this succeeded.
-ac_fn_c_try_link ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- rm -f conftest.$ac_objext conftest$ac_exeext
- if { { ac_try="$ac_link"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_link") 2>conftest.err
- ac_status=$?
- if test -s conftest.err; then
- grep -v '^ *+' conftest.err >conftest.er1
- cat conftest.er1 >&5
- mv -f conftest.er1 conftest.err
- fi
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; } && {
- test -z "$ac_c_werror_flag" ||
- test ! -s conftest.err
- } && test -s conftest$ac_exeext && {
- test "$cross_compiling" = yes ||
- test -x conftest$ac_exeext
- }; then :
- ac_retval=0
-else
- $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
- ac_retval=1
-fi
- # Delete the IPA/IPO (Inter Procedural Analysis/Optimization) information
- # created by the PGI compiler (conftest_ipa8_conftest.oo), as it would
- # interfere with the next link command; also delete a directory that is
- # left behind by Apple's compiler. We do this before executing the actions.
- rm -rf conftest.dSYM conftest_ipa8_conftest.oo
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
- as_fn_set_status $ac_retval
-
-} # ac_fn_c_try_link
-
-# ac_fn_c_check_func LINENO FUNC VAR
-# ----------------------------------
-# Tests whether FUNC exists, setting the cache variable VAR accordingly
-ac_fn_c_check_func ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
-$as_echo_n "checking for $2... " >&6; }
-if eval \${$3+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-/* Define $2 to an innocuous variant, in case <limits.h> declares $2.
- For example, HP-UX 11i <limits.h> declares gettimeofday. */
-#define $2 innocuous_$2
-
-/* System header to define __stub macros and hopefully few prototypes,
- which can conflict with char $2 (); below.
- Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
- <limits.h> exists even on freestanding compilers. */
-
-#ifdef __STDC__
-# include <limits.h>
-#else
-# include <assert.h>
-#endif
-
-#undef $2
-
-/* Override any GCC internal prototype to avoid an error.
- Use char because int might match the return type of a GCC
- builtin and then its argument prototype would still apply. */
-#ifdef __cplusplus
-extern "C"
-#endif
-char $2 ();
-/* The GNU C library defines this for functions which it implements
- to always fail with ENOSYS. Some functions are actually named
- something starting with __ and the normal name is an alias. */
-#if defined __stub_$2 || defined __stub___$2
-choke me
-#endif
-
-int
-main ()
-{
-return $2 ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_link "$LINENO"; then :
- eval "$3=yes"
-else
- eval "$3=no"
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-fi
-eval ac_res=\$$3
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
-
-} # ac_fn_c_check_func
-
-# ac_fn_c_check_decl LINENO SYMBOL VAR INCLUDES
-# ---------------------------------------------
-# Tests whether SYMBOL is declared in INCLUDES, setting cache variable VAR
-# accordingly.
-ac_fn_c_check_decl ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- as_decl_name=`echo $2|sed 's/ *(.*//'`
- as_decl_use=`echo $2|sed -e 's/(/((/' -e 's/)/) 0&/' -e 's/,/) 0& (/g'`
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $as_decl_name is declared" >&5
-$as_echo_n "checking whether $as_decl_name is declared... " >&6; }
-if eval \${$3+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$4
-int
-main ()
-{
-#ifndef $as_decl_name
-#ifdef __cplusplus
- (void) $as_decl_use;
-#else
- (void) $as_decl_name;
-#endif
-#endif
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- eval "$3=yes"
-else
- eval "$3=no"
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-eval ac_res=\$$3
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
-
-} # ac_fn_c_check_decl
-
-# ac_fn_cxx_try_link LINENO
-# -------------------------
-# Try to link conftest.$ac_ext, and return whether this succeeded.
-ac_fn_cxx_try_link ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- rm -f conftest.$ac_objext conftest$ac_exeext
- if { { ac_try="$ac_link"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_link") 2>conftest.err
- ac_status=$?
- if test -s conftest.err; then
- grep -v '^ *+' conftest.err >conftest.er1
- cat conftest.er1 >&5
- mv -f conftest.er1 conftest.err
- fi
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; } && {
- test -z "$ac_cxx_werror_flag" ||
- test ! -s conftest.err
- } && test -s conftest$ac_exeext && {
- test "$cross_compiling" = yes ||
- test -x conftest$ac_exeext
- }; then :
- ac_retval=0
-else
- $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
- ac_retval=1
-fi
- # Delete the IPA/IPO (Inter Procedural Analysis/Optimization) information
- # created by the PGI compiler (conftest_ipa8_conftest.oo), as it would
- # interfere with the next link command; also delete a directory that is
- # left behind by Apple's compiler. We do this before executing the actions.
- rm -rf conftest.dSYM conftest_ipa8_conftest.oo
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
- as_fn_set_status $ac_retval
-
-} # ac_fn_cxx_try_link
-
-# ac_fn_cxx_try_cpp LINENO
-# ------------------------
-# Try to preprocess conftest.$ac_ext, and return whether this succeeded.
-ac_fn_cxx_try_cpp ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- if { { ac_try="$ac_cpp conftest.$ac_ext"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_cpp conftest.$ac_ext") 2>conftest.err
- ac_status=$?
- if test -s conftest.err; then
- grep -v '^ *+' conftest.err >conftest.er1
- cat conftest.er1 >&5
- mv -f conftest.er1 conftest.err
- fi
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; } > conftest.i && {
- test -z "$ac_cxx_preproc_warn_flag$ac_cxx_werror_flag" ||
- test ! -s conftest.err
- }; then :
- ac_retval=0
-else
- $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
- ac_retval=1
-fi
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
- as_fn_set_status $ac_retval
-
-} # ac_fn_cxx_try_cpp
-
-# ac_fn_cxx_check_header_mongrel LINENO HEADER VAR INCLUDES
-# ---------------------------------------------------------
-# Tests whether HEADER exists, giving a warning if it cannot be compiled using
-# the include files in INCLUDES and setting the cache variable VAR
-# accordingly.
-ac_fn_cxx_check_header_mongrel ()
-{
- as_lineno=${as_lineno-"$1"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- if eval \${$3+:} false; then :
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
-$as_echo_n "checking for $2... " >&6; }
-if eval \${$3+:} false; then :
- $as_echo_n "(cached) " >&6
-fi
-eval ac_res=\$$3
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
-else
- # Is the header compilable?
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking $2 usability" >&5
-$as_echo_n "checking $2 usability... " >&6; }
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$4
-#include <$2>
-_ACEOF
-if ac_fn_cxx_try_compile "$LINENO"; then :
- ac_header_compiler=yes
-else
- ac_header_compiler=no
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_header_compiler" >&5
-$as_echo "$ac_header_compiler" >&6; }
-
-# Is the header present?
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking $2 presence" >&5
-$as_echo_n "checking $2 presence... " >&6; }
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <$2>
-_ACEOF
-if ac_fn_cxx_try_cpp "$LINENO"; then :
- ac_header_preproc=yes
-else
- ac_header_preproc=no
-fi
-rm -f conftest.err conftest.i conftest.$ac_ext
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_header_preproc" >&5
-$as_echo "$ac_header_preproc" >&6; }
-
-# So? What about this header?
-case $ac_header_compiler:$ac_header_preproc:$ac_cxx_preproc_warn_flag in #((
- yes:no: )
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: accepted by the compiler, rejected by the preprocessor!" >&5
-$as_echo "$as_me: WARNING: $2: accepted by the compiler, rejected by the preprocessor!" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: proceeding with the compiler's result" >&5
-$as_echo "$as_me: WARNING: $2: proceeding with the compiler's result" >&2;}
- ;;
- no:yes:* )
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: present but cannot be compiled" >&5
-$as_echo "$as_me: WARNING: $2: present but cannot be compiled" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: check for missing prerequisite headers?" >&5
-$as_echo "$as_me: WARNING: $2: check for missing prerequisite headers?" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: see the Autoconf documentation" >&5
-$as_echo "$as_me: WARNING: $2: see the Autoconf documentation" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: section \"Present But Cannot Be Compiled\"" >&5
-$as_echo "$as_me: WARNING: $2: section \"Present But Cannot Be Compiled\"" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $2: proceeding with the compiler's result" >&5
-$as_echo "$as_me: WARNING: $2: proceeding with the compiler's result" >&2;}
-( $as_echo "## ----------------------------------- ##
-## Report this to abyss-users at bcgsc.ca ##
-## ----------------------------------- ##"
- ) | sed "s/^/$as_me: WARNING: /" >&2
- ;;
-esac
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $2" >&5
-$as_echo_n "checking for $2... " >&6; }
-if eval \${$3+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- eval "$3=\$ac_header_compiler"
-fi
-eval ac_res=\$$3
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_res" >&5
-$as_echo "$ac_res" >&6; }
-fi
- eval $as_lineno_stack; ${as_lineno_stack:+:} unset as_lineno
-
-} # ac_fn_cxx_check_header_mongrel
-cat >config.log <<_ACEOF
-This file contains any messages produced by compilers while
-running configure, to aid debugging if configure makes a mistake.
-
-It was created by ABySS $as_me 1.3.6, which was
-generated by GNU Autoconf 2.69. Invocation command line was
-
- $ $0 $@
-
-_ACEOF
-exec 5>>config.log
-{
-cat <<_ASUNAME
-## --------- ##
-## Platform. ##
-## --------- ##
-
-hostname = `(hostname || uname -n) 2>/dev/null | sed 1q`
-uname -m = `(uname -m) 2>/dev/null || echo unknown`
-uname -r = `(uname -r) 2>/dev/null || echo unknown`
-uname -s = `(uname -s) 2>/dev/null || echo unknown`
-uname -v = `(uname -v) 2>/dev/null || echo unknown`
-
-/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null || echo unknown`
-/bin/uname -X = `(/bin/uname -X) 2>/dev/null || echo unknown`
-
-/bin/arch = `(/bin/arch) 2>/dev/null || echo unknown`
-/usr/bin/arch -k = `(/usr/bin/arch -k) 2>/dev/null || echo unknown`
-/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null || echo unknown`
-/usr/bin/hostinfo = `(/usr/bin/hostinfo) 2>/dev/null || echo unknown`
-/bin/machine = `(/bin/machine) 2>/dev/null || echo unknown`
-/usr/bin/oslevel = `(/usr/bin/oslevel) 2>/dev/null || echo unknown`
-/bin/universe = `(/bin/universe) 2>/dev/null || echo unknown`
-
-_ASUNAME
-
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- $as_echo "PATH: $as_dir"
- done
-IFS=$as_save_IFS
-
-} >&5
-
-cat >&5 <<_ACEOF
-
-
-## ----------- ##
-## Core tests. ##
-## ----------- ##
-
-_ACEOF
-
-
-# Keep a trace of the command line.
-# Strip out --no-create and --no-recursion so they do not pile up.
-# Strip out --silent because we don't want to record it for future runs.
-# Also quote any args containing shell meta-characters.
-# Make two passes to allow for proper duplicate-argument suppression.
-ac_configure_args=
-ac_configure_args0=
-ac_configure_args1=
-ac_must_keep_next=false
-for ac_pass in 1 2
-do
- for ac_arg
- do
- case $ac_arg in
- -no-create | --no-c* | -n | -no-recursion | --no-r*) continue ;;
- -q | -quiet | --quiet | --quie | --qui | --qu | --q \
- | -silent | --silent | --silen | --sile | --sil)
- continue ;;
- *\'*)
- ac_arg=`$as_echo "$ac_arg" | sed "s/'/'\\\\\\\\''/g"` ;;
- esac
- case $ac_pass in
- 1) as_fn_append ac_configure_args0 " '$ac_arg'" ;;
- 2)
- as_fn_append ac_configure_args1 " '$ac_arg'"
- if test $ac_must_keep_next = true; then
- ac_must_keep_next=false # Got value, back to normal.
- else
- case $ac_arg in
- *=* | --config-cache | -C | -disable-* | --disable-* \
- | -enable-* | --enable-* | -gas | --g* | -nfp | --nf* \
- | -q | -quiet | --q* | -silent | --sil* | -v | -verb* \
- | -with-* | --with-* | -without-* | --without-* | --x)
- case "$ac_configure_args0 " in
- "$ac_configure_args1"*" '$ac_arg' "* ) continue ;;
- esac
- ;;
- -* ) ac_must_keep_next=true ;;
- esac
- fi
- as_fn_append ac_configure_args " '$ac_arg'"
- ;;
- esac
- done
-done
-{ ac_configure_args0=; unset ac_configure_args0;}
-{ ac_configure_args1=; unset ac_configure_args1;}
-
-# When interrupted or exit'd, cleanup temporary files, and complete
-# config.log. We remove comments because anyway the quotes in there
-# would cause problems or look ugly.
-# WARNING: Use '\'' to represent an apostrophe within the trap.
-# WARNING: Do not start the trap code with a newline, due to a FreeBSD 4.0 bug.
-trap 'exit_status=$?
- # Save into config.log some information that might help in debugging.
- {
- echo
-
- $as_echo "## ---------------- ##
-## Cache variables. ##
-## ---------------- ##"
- echo
- # The following way of writing the cache mishandles newlines in values,
-(
- for ac_var in `(set) 2>&1 | sed -n '\''s/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'\''`; do
- eval ac_val=\$$ac_var
- case $ac_val in #(
- *${as_nl}*)
- case $ac_var in #(
- *_cv_*) { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5
-$as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
- esac
- case $ac_var in #(
- _ | IFS | as_nl) ;; #(
- BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #(
- *) { eval $ac_var=; unset $ac_var;} ;;
- esac ;;
- esac
- done
- (set) 2>&1 |
- case $as_nl`(ac_space='\'' '\''; set) 2>&1` in #(
- *${as_nl}ac_space=\ *)
- sed -n \
- "s/'\''/'\''\\\\'\'''\''/g;
- s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\''\\2'\''/p"
- ;; #(
- *)
- sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p"
- ;;
- esac |
- sort
-)
- echo
-
- $as_echo "## ----------------- ##
-## Output variables. ##
-## ----------------- ##"
- echo
- for ac_var in $ac_subst_vars
- do
- eval ac_val=\$$ac_var
- case $ac_val in
- *\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
- esac
- $as_echo "$ac_var='\''$ac_val'\''"
- done | sort
- echo
-
- if test -n "$ac_subst_files"; then
- $as_echo "## ------------------- ##
-## File substitutions. ##
-## ------------------- ##"
- echo
- for ac_var in $ac_subst_files
- do
- eval ac_val=\$$ac_var
- case $ac_val in
- *\'\''*) ac_val=`$as_echo "$ac_val" | sed "s/'\''/'\''\\\\\\\\'\'''\''/g"`;;
- esac
- $as_echo "$ac_var='\''$ac_val'\''"
- done | sort
- echo
- fi
-
- if test -s confdefs.h; then
- $as_echo "## ----------- ##
-## confdefs.h. ##
-## ----------- ##"
- echo
- cat confdefs.h
- echo
- fi
- test "$ac_signal" != 0 &&
- $as_echo "$as_me: caught signal $ac_signal"
- $as_echo "$as_me: exit $exit_status"
- } >&5
- rm -f core *.core core.conftest.* &&
- rm -f -r conftest* confdefs* conf$$* $ac_clean_files &&
- exit $exit_status
-' 0
-for ac_signal in 1 2 13 15; do
- trap 'ac_signal='$ac_signal'; as_fn_exit 1' $ac_signal
-done
-ac_signal=0
-
-# confdefs.h avoids OS command line length limits that DEFS can exceed.
-rm -f -r conftest* confdefs.h
-
-$as_echo "/* confdefs.h */" > confdefs.h
-
-# Predefined preprocessor variables.
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_NAME "$PACKAGE_NAME"
-_ACEOF
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_TARNAME "$PACKAGE_TARNAME"
-_ACEOF
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_VERSION "$PACKAGE_VERSION"
-_ACEOF
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_STRING "$PACKAGE_STRING"
-_ACEOF
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_BUGREPORT "$PACKAGE_BUGREPORT"
-_ACEOF
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE_URL "$PACKAGE_URL"
-_ACEOF
-
-
-# Let the site file select an alternate cache file if it wants to.
-# Prefer an explicitly selected file to automatically selected ones.
-ac_site_file1=NONE
-ac_site_file2=NONE
-if test -n "$CONFIG_SITE"; then
- # We do not want a PATH search for config.site.
- case $CONFIG_SITE in #((
- -*) ac_site_file1=./$CONFIG_SITE;;
- */*) ac_site_file1=$CONFIG_SITE;;
- *) ac_site_file1=./$CONFIG_SITE;;
- esac
-elif test "x$prefix" != xNONE; then
- ac_site_file1=$prefix/share/config.site
- ac_site_file2=$prefix/etc/config.site
-else
- ac_site_file1=$ac_default_prefix/share/config.site
- ac_site_file2=$ac_default_prefix/etc/config.site
-fi
-for ac_site_file in "$ac_site_file1" "$ac_site_file2"
-do
- test "x$ac_site_file" = xNONE && continue
- if test /dev/null != "$ac_site_file" && test -r "$ac_site_file"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: loading site script $ac_site_file" >&5
-$as_echo "$as_me: loading site script $ac_site_file" >&6;}
- sed 's/^/| /' "$ac_site_file" >&5
- . "$ac_site_file" \
- || { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error $? "failed to load site script $ac_site_file
-See \`config.log' for more details" "$LINENO" 5; }
- fi
-done
-
-if test -r "$cache_file"; then
- # Some versions of bash will fail to source /dev/null (special files
- # actually), so we avoid doing that. DJGPP emulates it as a regular file.
- if test /dev/null != "$cache_file" && test -f "$cache_file"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: loading cache $cache_file" >&5
-$as_echo "$as_me: loading cache $cache_file" >&6;}
- case $cache_file in
- [\\/]* | ?:[\\/]* ) . "$cache_file";;
- *) . "./$cache_file";;
- esac
- fi
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: creating cache $cache_file" >&5
-$as_echo "$as_me: creating cache $cache_file" >&6;}
- >$cache_file
-fi
-
-# Check that the precious variables saved in the cache have kept the same
-# value.
-ac_cache_corrupted=false
-for ac_var in $ac_precious_vars; do
- eval ac_old_set=\$ac_cv_env_${ac_var}_set
- eval ac_new_set=\$ac_env_${ac_var}_set
- eval ac_old_val=\$ac_cv_env_${ac_var}_value
- eval ac_new_val=\$ac_env_${ac_var}_value
- case $ac_old_set,$ac_new_set in
- set,)
- { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&5
-$as_echo "$as_me: error: \`$ac_var' was set to \`$ac_old_val' in the previous run" >&2;}
- ac_cache_corrupted=: ;;
- ,set)
- { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' was not set in the previous run" >&5
-$as_echo "$as_me: error: \`$ac_var' was not set in the previous run" >&2;}
- ac_cache_corrupted=: ;;
- ,);;
- *)
- if test "x$ac_old_val" != "x$ac_new_val"; then
- # differences in whitespace do not lead to failure.
- ac_old_val_w=`echo x $ac_old_val`
- ac_new_val_w=`echo x $ac_new_val`
- if test "$ac_old_val_w" != "$ac_new_val_w"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: error: \`$ac_var' has changed since the previous run:" >&5
-$as_echo "$as_me: error: \`$ac_var' has changed since the previous run:" >&2;}
- ac_cache_corrupted=:
- else
- { $as_echo "$as_me:${as_lineno-$LINENO}: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&5
-$as_echo "$as_me: warning: ignoring whitespace changes in \`$ac_var' since the previous run:" >&2;}
- eval $ac_var=\$ac_old_val
- fi
- { $as_echo "$as_me:${as_lineno-$LINENO}: former value: \`$ac_old_val'" >&5
-$as_echo "$as_me: former value: \`$ac_old_val'" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: current value: \`$ac_new_val'" >&5
-$as_echo "$as_me: current value: \`$ac_new_val'" >&2;}
- fi;;
- esac
- # Pass precious variables to config.status.
- if test "$ac_new_set" = set; then
- case $ac_new_val in
- *\'*) ac_arg=$ac_var=`$as_echo "$ac_new_val" | sed "s/'/'\\\\\\\\''/g"` ;;
- *) ac_arg=$ac_var=$ac_new_val ;;
- esac
- case " $ac_configure_args " in
- *" '$ac_arg' "*) ;; # Avoid dups. Use of quotes ensures accuracy.
- *) as_fn_append ac_configure_args " '$ac_arg'" ;;
- esac
- fi
-done
-if $ac_cache_corrupted; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
- { $as_echo "$as_me:${as_lineno-$LINENO}: error: changes in the environment can compromise the build" >&5
-$as_echo "$as_me: error: changes in the environment can compromise the build" >&2;}
- as_fn_error $? "run \`make distclean' and/or \`rm $cache_file' and start over" "$LINENO" 5
-fi
-## -------------------- ##
-## Main body of script. ##
-## -------------------- ##
-
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-
-
-am__api_version='1.14'
-
-ac_aux_dir=
-for ac_dir in "$srcdir" "$srcdir/.." "$srcdir/../.."; do
- if test -f "$ac_dir/install-sh"; then
- ac_aux_dir=$ac_dir
- ac_install_sh="$ac_aux_dir/install-sh -c"
- break
- elif test -f "$ac_dir/install.sh"; then
- ac_aux_dir=$ac_dir
- ac_install_sh="$ac_aux_dir/install.sh -c"
- break
- elif test -f "$ac_dir/shtool"; then
- ac_aux_dir=$ac_dir
- ac_install_sh="$ac_aux_dir/shtool install -c"
- break
- fi
-done
-if test -z "$ac_aux_dir"; then
- as_fn_error $? "cannot find install-sh, install.sh, or shtool in \"$srcdir\" \"$srcdir/..\" \"$srcdir/../..\"" "$LINENO" 5
-fi
-
-# These three variables are undocumented and unsupported,
-# and are intended to be withdrawn in a future Autoconf release.
-# They can cause serious problems if a builder's source tree is in a directory
-# whose full name contains unusual characters.
-ac_config_guess="$SHELL $ac_aux_dir/config.guess" # Please don't use this var.
-ac_config_sub="$SHELL $ac_aux_dir/config.sub" # Please don't use this var.
-ac_configure="$SHELL $ac_aux_dir/configure" # Please don't use this var.
-
-
-# Find a good install program. We prefer a C program (faster),
-# so one script is as good as another. But avoid the broken or
-# incompatible versions:
-# SysV /etc/install, /usr/sbin/install
-# SunOS /usr/etc/install
-# IRIX /sbin/install
-# AIX /bin/install
-# AmigaOS /C/install, which installs bootblocks on floppy discs
-# AIX 4 /usr/bin/installbsd, which doesn't work without a -g flag
-# AFS /usr/afsws/bin/install, which mishandles nonexistent args
-# SVR4 /usr/ucb/install, which tries to use the nonexistent group "staff"
-# OS/2's system install, which has a completely different semantic
-# ./install, which can be erroneously created by make from ./install.sh.
-# Reject install programs that cannot install multiple files.
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for a BSD-compatible install" >&5
-$as_echo_n "checking for a BSD-compatible install... " >&6; }
-if test -z "$INSTALL"; then
-if ${ac_cv_path_install+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- # Account for people who put trailing slashes in PATH elements.
-case $as_dir/ in #((
- ./ | .// | /[cC]/* | \
- /etc/* | /usr/sbin/* | /usr/etc/* | /sbin/* | /usr/afsws/bin/* | \
- ?:[\\/]os2[\\/]install[\\/]* | ?:[\\/]OS2[\\/]INSTALL[\\/]* | \
- /usr/ucb/* ) ;;
- *)
- # OSF1 and SCO ODT 3.0 have their own names for install.
- # Don't use installbsd from OSF since it installs stuff as root
- # by default.
- for ac_prog in ginstall scoinst install; do
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_prog$ac_exec_ext"; then
- if test $ac_prog = install &&
- grep dspmsg "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
- # AIX install. It has an incompatible calling convention.
- :
- elif test $ac_prog = install &&
- grep pwplus "$as_dir/$ac_prog$ac_exec_ext" >/dev/null 2>&1; then
- # program-specific install script used by HP pwplus--don't use.
- :
- else
- rm -rf conftest.one conftest.two conftest.dir
- echo one > conftest.one
- echo two > conftest.two
- mkdir conftest.dir
- if "$as_dir/$ac_prog$ac_exec_ext" -c conftest.one conftest.two "`pwd`/conftest.dir" &&
- test -s conftest.one && test -s conftest.two &&
- test -s conftest.dir/conftest.one &&
- test -s conftest.dir/conftest.two
- then
- ac_cv_path_install="$as_dir/$ac_prog$ac_exec_ext -c"
- break 3
- fi
- fi
- fi
- done
- done
- ;;
-esac
-
- done
-IFS=$as_save_IFS
-
-rm -rf conftest.one conftest.two conftest.dir
-
-fi
- if test "${ac_cv_path_install+set}" = set; then
- INSTALL=$ac_cv_path_install
- else
- # As a last resort, use the slow shell script. Don't cache a
- # value for INSTALL within a source directory, because that will
- # break other packages using the cache if that directory is
- # removed, or if the value is a relative name.
- INSTALL=$ac_install_sh
- fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $INSTALL" >&5
-$as_echo "$INSTALL" >&6; }
-
-# Use test -z because SunOS4 sh mishandles braces in ${var-val}.
-# It thinks the first close brace ends the variable substitution.
-test -z "$INSTALL_PROGRAM" && INSTALL_PROGRAM='${INSTALL}'
-
-test -z "$INSTALL_SCRIPT" && INSTALL_SCRIPT='${INSTALL}'
-
-test -z "$INSTALL_DATA" && INSTALL_DATA='${INSTALL} -m 644'
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether build environment is sane" >&5
-$as_echo_n "checking whether build environment is sane... " >&6; }
-# Reject unsafe characters in $srcdir or the absolute working directory
-# name. Accept space and tab only in the latter.
-am_lf='
-'
-case `pwd` in
- *[\\\"\#\$\&\'\`$am_lf]*)
- as_fn_error $? "unsafe absolute working directory name" "$LINENO" 5;;
-esac
-case $srcdir in
- *[\\\"\#\$\&\'\`$am_lf\ \ ]*)
- as_fn_error $? "unsafe srcdir value: '$srcdir'" "$LINENO" 5;;
-esac
-
-# Do 'set' in a subshell so we don't clobber the current shell's
-# arguments. Must try -L first in case configure is actually a
-# symlink; some systems play weird games with the mod time of symlinks
-# (eg FreeBSD returns the mod time of the symlink's containing
-# directory).
-if (
- am_has_slept=no
- for am_try in 1 2; do
- echo "timestamp, slept: $am_has_slept" > conftest.file
- set X `ls -Lt "$srcdir/configure" conftest.file 2> /dev/null`
- if test "$*" = "X"; then
- # -L didn't work.
- set X `ls -t "$srcdir/configure" conftest.file`
- fi
- if test "$*" != "X $srcdir/configure conftest.file" \
- && test "$*" != "X conftest.file $srcdir/configure"; then
-
- # If neither matched, then we have a broken ls. This can happen
- # if, for instance, CONFIG_SHELL is bash and it inherits a
- # broken ls alias from the environment. This has actually
- # happened. Such a system could not be considered "sane".
- as_fn_error $? "ls -t appears to fail. Make sure there is not a broken
- alias in your environment" "$LINENO" 5
- fi
- if test "$2" = conftest.file || test $am_try -eq 2; then
- break
- fi
- # Just in case.
- sleep 1
- am_has_slept=yes
- done
- test "$2" = conftest.file
- )
-then
- # Ok.
- :
-else
- as_fn_error $? "newly created file is older than distributed files!
-Check your system clock" "$LINENO" 5
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
-$as_echo "yes" >&6; }
-# If we didn't sleep, we still need to ensure time stamps of config.status and
-# generated files are strictly newer.
-am_sleep_pid=
-if grep 'slept: no' conftest.file >/dev/null 2>&1; then
- ( sleep 1 ) &
- am_sleep_pid=$!
-fi
-
-rm -f conftest.file
-
-test "$program_prefix" != NONE &&
- program_transform_name="s&^&$program_prefix&;$program_transform_name"
-# Use a double $ so make ignores it.
-test "$program_suffix" != NONE &&
- program_transform_name="s&\$&$program_suffix&;$program_transform_name"
-# Double any \ or $.
-# By default was `s,x,x', remove it if useless.
-ac_script='s/[\\$]/&&/g;s/;s,x,x,$//'
-program_transform_name=`$as_echo "$program_transform_name" | sed "$ac_script"`
-
-# expand $ac_aux_dir to an absolute path
-am_aux_dir=`cd $ac_aux_dir && pwd`
-
-if test x"${MISSING+set}" != xset; then
- case $am_aux_dir in
- *\ * | *\ *)
- MISSING="\${SHELL} \"$am_aux_dir/missing\"" ;;
- *)
- MISSING="\${SHELL} $am_aux_dir/missing" ;;
- esac
-fi
-# Use eval to expand $SHELL
-if eval "$MISSING --is-lightweight"; then
- am_missing_run="$MISSING "
-else
- am_missing_run=
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: 'missing' script is too old or missing" >&5
-$as_echo "$as_me: WARNING: 'missing' script is too old or missing" >&2;}
-fi
-
-if test x"${install_sh}" != xset; then
- case $am_aux_dir in
- *\ * | *\ *)
- install_sh="\${SHELL} '$am_aux_dir/install-sh'" ;;
- *)
- install_sh="\${SHELL} $am_aux_dir/install-sh"
- esac
-fi
-
-# Installed binaries are usually stripped using 'strip' when the user
-# run "make install-strip". However 'strip' might not be the right
-# tool to use in cross-compilation environments, therefore Automake
-# will honor the 'STRIP' environment variable to overrule this program.
-if test "$cross_compiling" != no; then
- if test -n "$ac_tool_prefix"; then
- # Extract the first word of "${ac_tool_prefix}strip", so it can be a program name with args.
-set dummy ${ac_tool_prefix}strip; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_STRIP+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$STRIP"; then
- ac_cv_prog_STRIP="$STRIP" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_STRIP="${ac_tool_prefix}strip"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-STRIP=$ac_cv_prog_STRIP
-if test -n "$STRIP"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $STRIP" >&5
-$as_echo "$STRIP" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-fi
-if test -z "$ac_cv_prog_STRIP"; then
- ac_ct_STRIP=$STRIP
- # Extract the first word of "strip", so it can be a program name with args.
-set dummy strip; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_ac_ct_STRIP+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$ac_ct_STRIP"; then
- ac_cv_prog_ac_ct_STRIP="$ac_ct_STRIP" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_ac_ct_STRIP="strip"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-ac_ct_STRIP=$ac_cv_prog_ac_ct_STRIP
-if test -n "$ac_ct_STRIP"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_STRIP" >&5
-$as_echo "$ac_ct_STRIP" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
- if test "x$ac_ct_STRIP" = x; then
- STRIP=":"
- else
- case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
- STRIP=$ac_ct_STRIP
- fi
-else
- STRIP="$ac_cv_prog_STRIP"
-fi
-
-fi
-INSTALL_STRIP_PROGRAM="\$(install_sh) -c -s"
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for a thread-safe mkdir -p" >&5
-$as_echo_n "checking for a thread-safe mkdir -p... " >&6; }
-if test -z "$MKDIR_P"; then
- if ${ac_cv_path_mkdir+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH$PATH_SEPARATOR/opt/sfw/bin
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_prog in mkdir gmkdir; do
- for ac_exec_ext in '' $ac_executable_extensions; do
- as_fn_executable_p "$as_dir/$ac_prog$ac_exec_ext" || continue
- case `"$as_dir/$ac_prog$ac_exec_ext" --version 2>&1` in #(
- 'mkdir (GNU coreutils) '* | \
- 'mkdir (coreutils) '* | \
- 'mkdir (fileutils) '4.1*)
- ac_cv_path_mkdir=$as_dir/$ac_prog$ac_exec_ext
- break 3;;
- esac
- done
- done
- done
-IFS=$as_save_IFS
-
-fi
-
- test -d ./--version && rmdir ./--version
- if test "${ac_cv_path_mkdir+set}" = set; then
- MKDIR_P="$ac_cv_path_mkdir -p"
- else
- # As a last resort, use the slow shell script. Don't cache a
- # value for MKDIR_P within a source directory, because that will
- # break other packages using the cache if that directory is
- # removed, or if the value is a relative name.
- MKDIR_P="$ac_install_sh -d"
- fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $MKDIR_P" >&5
-$as_echo "$MKDIR_P" >&6; }
-
-for ac_prog in gawk mawk nawk awk
-do
- # Extract the first word of "$ac_prog", so it can be a program name with args.
-set dummy $ac_prog; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_AWK+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$AWK"; then
- ac_cv_prog_AWK="$AWK" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_AWK="$ac_prog"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-AWK=$ac_cv_prog_AWK
-if test -n "$AWK"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $AWK" >&5
-$as_echo "$AWK" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
- test -n "$AWK" && break
-done
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether ${MAKE-make} sets \$(MAKE)" >&5
-$as_echo_n "checking whether ${MAKE-make} sets \$(MAKE)... " >&6; }
-set x ${MAKE-make}
-ac_make=`$as_echo "$2" | sed 's/+/p/g; s/[^a-zA-Z0-9_]/_/g'`
-if eval \${ac_cv_prog_make_${ac_make}_set+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat >conftest.make <<\_ACEOF
-SHELL = /bin/sh
-all:
- @echo '@@@%%%=$(MAKE)=@@@%%%'
-_ACEOF
-# GNU make sometimes prints "make[1]: Entering ...", which would confuse us.
-case `${MAKE-make} -f conftest.make 2>/dev/null` in
- *@@@%%%=?*=@@@%%%*)
- eval ac_cv_prog_make_${ac_make}_set=yes;;
- *)
- eval ac_cv_prog_make_${ac_make}_set=no;;
-esac
-rm -f conftest.make
-fi
-if eval test \$ac_cv_prog_make_${ac_make}_set = yes; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
-$as_echo "yes" >&6; }
- SET_MAKE=
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
- SET_MAKE="MAKE=${MAKE-make}"
-fi
-
-rm -rf .tst 2>/dev/null
-mkdir .tst 2>/dev/null
-if test -d .tst; then
- am__leading_dot=.
-else
- am__leading_dot=_
-fi
-rmdir .tst 2>/dev/null
-
-# Check whether --enable-silent-rules was given.
-if test "${enable_silent_rules+set}" = set; then :
- enableval=$enable_silent_rules;
-fi
-
-case $enable_silent_rules in # (((
- yes) AM_DEFAULT_VERBOSITY=0;;
- no) AM_DEFAULT_VERBOSITY=1;;
- *) AM_DEFAULT_VERBOSITY=1;;
-esac
-am_make=${MAKE-make}
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $am_make supports nested variables" >&5
-$as_echo_n "checking whether $am_make supports nested variables... " >&6; }
-if ${am_cv_make_support_nested_variables+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if $as_echo 'TRUE=$(BAR$(V))
-BAR0=false
-BAR1=true
-V=1
-am__doit:
- @$(TRUE)
-.PHONY: am__doit' | $am_make -f - >/dev/null 2>&1; then
- am_cv_make_support_nested_variables=yes
-else
- am_cv_make_support_nested_variables=no
-fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_make_support_nested_variables" >&5
-$as_echo "$am_cv_make_support_nested_variables" >&6; }
-if test $am_cv_make_support_nested_variables = yes; then
- AM_V='$(V)'
- AM_DEFAULT_V='$(AM_DEFAULT_VERBOSITY)'
-else
- AM_V=$AM_DEFAULT_VERBOSITY
- AM_DEFAULT_V=$AM_DEFAULT_VERBOSITY
-fi
-AM_BACKSLASH='\'
-
-if test "`cd $srcdir && pwd`" != "`pwd`"; then
- # Use -I$(srcdir) only when $(srcdir) != ., so that make's output
- # is not polluted with repeated "-I."
- am__isrc=' -I$(srcdir)'
- # test to see if srcdir already configured
- if test -f $srcdir/config.status; then
- as_fn_error $? "source directory already configured; run \"make distclean\" there first" "$LINENO" 5
- fi
-fi
-
-# test whether we have cygpath
-if test -z "$CYGPATH_W"; then
- if (cygpath --version) >/dev/null 2>/dev/null; then
- CYGPATH_W='cygpath -w'
- else
- CYGPATH_W=echo
- fi
-fi
-
-
-# Define the identity of the package.
- PACKAGE='abyss'
- VERSION='1.3.6'
-
-
-cat >>confdefs.h <<_ACEOF
-#define PACKAGE "$PACKAGE"
-_ACEOF
-
-
-cat >>confdefs.h <<_ACEOF
-#define VERSION "$VERSION"
-_ACEOF
-
-# Some tools Automake needs.
-
-ACLOCAL=${ACLOCAL-"${am_missing_run}aclocal-${am__api_version}"}
-
-
-AUTOCONF=${AUTOCONF-"${am_missing_run}autoconf"}
-
-
-AUTOMAKE=${AUTOMAKE-"${am_missing_run}automake-${am__api_version}"}
-
-
-AUTOHEADER=${AUTOHEADER-"${am_missing_run}autoheader"}
-
-
-MAKEINFO=${MAKEINFO-"${am_missing_run}makeinfo"}
-
-# For better backward compatibility. To be removed once Automake 1.9.x
-# dies out for good. For more background, see:
-# <http://lists.gnu.org/archive/html/automake/2012-07/msg00001.html>
-# <http://lists.gnu.org/archive/html/automake/2012-07/msg00014.html>
-mkdir_p='$(MKDIR_P)'
-
-# We need awk for the "check" target. The system "awk" is bad on
-# some platforms.
-# Always define AMTAR for backward compatibility. Yes, it's still used
-# in the wild :-( We should find a proper way to deprecate it ...
-AMTAR='$${TAR-tar}'
-
-
-# We'll loop over all known methods to create a tar archive until one works.
-_am_tools='gnutar pax cpio none'
-
-am__tar='$${TAR-tar} chof - "$$tardir"' am__untar='$${TAR-tar} xf -'
-
-
-
-
-
-
-# POSIX will say in a future version that running "rm -f" with no argument
-# is OK; and we want to be able to make that assumption in our Makefile
-# recipes. So use an aggressive probe to check that the usage we want is
-# actually supported "in the wild" to an acceptable degree.
-# See automake bug#10828.
-# To make any issue more visible, cause the running configure to be aborted
-# by default if the 'rm' program in use doesn't match our expectations; the
-# user can still override this though.
-if rm -f && rm -fr && rm -rf; then : OK; else
- cat >&2 <<'END'
-Oops!
-
-Your 'rm' program seems unable to run without file operands specified
-on the command line, even when the '-f' option is present. This is contrary
-to the behaviour of most rm programs out there, and not conforming with
-the upcoming POSIX standard: <http://austingroupbugs.net/view.php?id=542>
-
-Please tell bug-automake at gnu.org about your system, including the value
-of your $PATH and any error possibly output before this message. This
-can help us improve future automake versions.
-
-END
- if test x"$ACCEPT_INFERIOR_RM_PROGRAM" = x"yes"; then
- echo 'Configuration will proceed anyway, since you have set the' >&2
- echo 'ACCEPT_INFERIOR_RM_PROGRAM variable to "yes"' >&2
- echo >&2
- else
- cat >&2 <<'END'
-Aborting the configuration process, to ensure you take notice of the issue.
-
-You can download and install GNU coreutils to get an 'rm' implementation
-that behaves properly: <http://www.gnu.org/software/coreutils/>.
-
-If you want to complete the configuration process using your problematic
-'rm' anyway, export the environment variable ACCEPT_INFERIOR_RM_PROGRAM
-to "yes", and re-run configure.
-
-END
- as_fn_error $? "Your 'rm' program is bad, sorry." "$LINENO" 5
- fi
-fi
-
-ac_config_headers="$ac_config_headers config.h"
-
-
-# Checks for programs.
-for ac_prog in gawk mawk nawk awk
-do
- # Extract the first word of "$ac_prog", so it can be a program name with args.
-set dummy $ac_prog; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_AWK+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$AWK"; then
- ac_cv_prog_AWK="$AWK" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_AWK="$ac_prog"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-AWK=$ac_cv_prog_AWK
-if test -n "$AWK"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $AWK" >&5
-$as_echo "$AWK" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
- test -n "$AWK" && break
-done
-
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-if test -n "$ac_tool_prefix"; then
- # Extract the first word of "${ac_tool_prefix}gcc", so it can be a program name with args.
-set dummy ${ac_tool_prefix}gcc; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_CC+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$CC"; then
- ac_cv_prog_CC="$CC" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_CC="${ac_tool_prefix}gcc"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-CC=$ac_cv_prog_CC
-if test -n "$CC"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
-$as_echo "$CC" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-fi
-if test -z "$ac_cv_prog_CC"; then
- ac_ct_CC=$CC
- # Extract the first word of "gcc", so it can be a program name with args.
-set dummy gcc; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_ac_ct_CC+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$ac_ct_CC"; then
- ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_ac_ct_CC="gcc"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-ac_ct_CC=$ac_cv_prog_ac_ct_CC
-if test -n "$ac_ct_CC"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CC" >&5
-$as_echo "$ac_ct_CC" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
- if test "x$ac_ct_CC" = x; then
- CC=""
- else
- case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
- CC=$ac_ct_CC
- fi
-else
- CC="$ac_cv_prog_CC"
-fi
-
-if test -z "$CC"; then
- if test -n "$ac_tool_prefix"; then
- # Extract the first word of "${ac_tool_prefix}cc", so it can be a program name with args.
-set dummy ${ac_tool_prefix}cc; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_CC+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$CC"; then
- ac_cv_prog_CC="$CC" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_CC="${ac_tool_prefix}cc"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-CC=$ac_cv_prog_CC
-if test -n "$CC"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
-$as_echo "$CC" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
- fi
-fi
-if test -z "$CC"; then
- # Extract the first word of "cc", so it can be a program name with args.
-set dummy cc; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_CC+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$CC"; then
- ac_cv_prog_CC="$CC" # Let the user override the test.
-else
- ac_prog_rejected=no
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- if test "$as_dir/$ac_word$ac_exec_ext" = "/usr/ucb/cc"; then
- ac_prog_rejected=yes
- continue
- fi
- ac_cv_prog_CC="cc"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-if test $ac_prog_rejected = yes; then
- # We found a bogon in the path, so make sure we never use it.
- set dummy $ac_cv_prog_CC
- shift
- if test $# != 0; then
- # We chose a different compiler from the bogus one.
- # However, it has the same basename, so the bogon will be chosen
- # first if we set CC to just the basename; use the full file name.
- shift
- ac_cv_prog_CC="$as_dir/$ac_word${1+' '}$@"
- fi
-fi
-fi
-fi
-CC=$ac_cv_prog_CC
-if test -n "$CC"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
-$as_echo "$CC" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-fi
-if test -z "$CC"; then
- if test -n "$ac_tool_prefix"; then
- for ac_prog in cl.exe
- do
- # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
-set dummy $ac_tool_prefix$ac_prog; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_CC+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$CC"; then
- ac_cv_prog_CC="$CC" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_CC="$ac_tool_prefix$ac_prog"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-CC=$ac_cv_prog_CC
-if test -n "$CC"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CC" >&5
-$as_echo "$CC" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
- test -n "$CC" && break
- done
-fi
-if test -z "$CC"; then
- ac_ct_CC=$CC
- for ac_prog in cl.exe
-do
- # Extract the first word of "$ac_prog", so it can be a program name with args.
-set dummy $ac_prog; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_ac_ct_CC+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$ac_ct_CC"; then
- ac_cv_prog_ac_ct_CC="$ac_ct_CC" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_ac_ct_CC="$ac_prog"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-ac_ct_CC=$ac_cv_prog_ac_ct_CC
-if test -n "$ac_ct_CC"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CC" >&5
-$as_echo "$ac_ct_CC" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
- test -n "$ac_ct_CC" && break
-done
-
- if test "x$ac_ct_CC" = x; then
- CC=""
- else
- case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
- CC=$ac_ct_CC
- fi
-fi
-
-fi
-
-
-test -z "$CC" && { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error $? "no acceptable C compiler found in \$PATH
-See \`config.log' for more details" "$LINENO" 5; }
-
-# Provide some information about the compiler.
-$as_echo "$as_me:${as_lineno-$LINENO}: checking for C compiler version" >&5
-set X $ac_compile
-ac_compiler=$2
-for ac_option in --version -v -V -qversion; do
- { { ac_try="$ac_compiler $ac_option >&5"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_compiler $ac_option >&5") 2>conftest.err
- ac_status=$?
- if test -s conftest.err; then
- sed '10a\
-... rest of stderr output deleted ...
- 10q' conftest.err >conftest.er1
- cat conftest.er1 >&5
- fi
- rm -f conftest.er1 conftest.err
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; }
-done
-
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-
- ;
- return 0;
-}
-_ACEOF
-ac_clean_files_save=$ac_clean_files
-ac_clean_files="$ac_clean_files a.out a.out.dSYM a.exe b.out"
-# Try to create an executable without -o first, disregard a.out.
-# It will help us diagnose broken compilers, and finding out an intuition
-# of exeext.
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether the C compiler works" >&5
-$as_echo_n "checking whether the C compiler works... " >&6; }
-ac_link_default=`$as_echo "$ac_link" | sed 's/ -o *conftest[^ ]*//'`
-
-# The possible output files:
-ac_files="a.out conftest.exe conftest a.exe a_out.exe b.out conftest.*"
-
-ac_rmfiles=
-for ac_file in $ac_files
-do
- case $ac_file in
- *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
- * ) ac_rmfiles="$ac_rmfiles $ac_file";;
- esac
-done
-rm -f $ac_rmfiles
-
-if { { ac_try="$ac_link_default"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_link_default") 2>&5
- ac_status=$?
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; }; then :
- # Autoconf-2.13 could set the ac_cv_exeext variable to `no'.
-# So ignore a value of `no', otherwise this would lead to `EXEEXT = no'
-# in a Makefile. We should not override ac_cv_exeext if it was cached,
-# so that the user can short-circuit this test for compilers unknown to
-# Autoconf.
-for ac_file in $ac_files ''
-do
- test -f "$ac_file" || continue
- case $ac_file in
- *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj )
- ;;
- [ab].out )
- # We found the default executable, but exeext='' is most
- # certainly right.
- break;;
- *.* )
- if test "${ac_cv_exeext+set}" = set && test "$ac_cv_exeext" != no;
- then :; else
- ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
- fi
- # We set ac_cv_exeext here because the later test for it is not
- # safe: cross compilers may not add the suffix if given an `-o'
- # argument, so we may need to know it at that point already.
- # Even if this section looks crufty: it has the advantage of
- # actually working.
- break;;
- * )
- break;;
- esac
-done
-test "$ac_cv_exeext" = no && ac_cv_exeext=
-
-else
- ac_file=''
-fi
-if test -z "$ac_file"; then :
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-$as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error 77 "C compiler cannot create executables
-See \`config.log' for more details" "$LINENO" 5; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: yes" >&5
-$as_echo "yes" >&6; }
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for C compiler default output file name" >&5
-$as_echo_n "checking for C compiler default output file name... " >&6; }
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_file" >&5
-$as_echo "$ac_file" >&6; }
-ac_exeext=$ac_cv_exeext
-
-rm -f -r a.out a.out.dSYM a.exe conftest$ac_cv_exeext b.out
-ac_clean_files=$ac_clean_files_save
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for suffix of executables" >&5
-$as_echo_n "checking for suffix of executables... " >&6; }
-if { { ac_try="$ac_link"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_link") 2>&5
- ac_status=$?
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; }; then :
- # If both `conftest.exe' and `conftest' are `present' (well, observable)
-# catch `conftest.exe'. For instance with Cygwin, `ls conftest' will
-# work properly (i.e., refer to `conftest.exe'), while it won't with
-# `rm'.
-for ac_file in conftest.exe conftest conftest.*; do
- test -f "$ac_file" || continue
- case $ac_file in
- *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM | *.o | *.obj ) ;;
- *.* ) ac_cv_exeext=`expr "$ac_file" : '[^.]*\(\..*\)'`
- break;;
- * ) break;;
- esac
-done
-else
- { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error $? "cannot compute suffix of executables: cannot compile and link
-See \`config.log' for more details" "$LINENO" 5; }
-fi
-rm -f conftest conftest$ac_cv_exeext
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_exeext" >&5
-$as_echo "$ac_cv_exeext" >&6; }
-
-rm -f conftest.$ac_ext
-EXEEXT=$ac_cv_exeext
-ac_exeext=$EXEEXT
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <stdio.h>
-int
-main ()
-{
-FILE *f = fopen ("conftest.out", "w");
- return ferror (f) || fclose (f) != 0;
-
- ;
- return 0;
-}
-_ACEOF
-ac_clean_files="$ac_clean_files conftest.out"
-# Check that the compiler produces executables we can run. If not, either
-# the compiler is broken, or we cross compile.
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are cross compiling" >&5
-$as_echo_n "checking whether we are cross compiling... " >&6; }
-if test "$cross_compiling" != yes; then
- { { ac_try="$ac_link"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_link") 2>&5
- ac_status=$?
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; }
- if { ac_try='./conftest$ac_cv_exeext'
- { { case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_try") 2>&5
- ac_status=$?
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; }; }; then
- cross_compiling=no
- else
- if test "$cross_compiling" = maybe; then
- cross_compiling=yes
- else
- { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error $? "cannot run C compiled programs.
-If you meant to cross compile, use \`--host'.
-See \`config.log' for more details" "$LINENO" 5; }
- fi
- fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $cross_compiling" >&5
-$as_echo "$cross_compiling" >&6; }
-
-rm -f conftest.$ac_ext conftest$ac_cv_exeext conftest.out
-ac_clean_files=$ac_clean_files_save
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for suffix of object files" >&5
-$as_echo_n "checking for suffix of object files... " >&6; }
-if ${ac_cv_objext+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-
- ;
- return 0;
-}
-_ACEOF
-rm -f conftest.o conftest.obj
-if { { ac_try="$ac_compile"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_compile") 2>&5
- ac_status=$?
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; }; then :
- for ac_file in conftest.o conftest.obj conftest.*; do
- test -f "$ac_file" || continue;
- case $ac_file in
- *.$ac_ext | *.xcoff | *.tds | *.d | *.pdb | *.xSYM | *.bb | *.bbg | *.map | *.inf | *.dSYM ) ;;
- *) ac_cv_objext=`expr "$ac_file" : '.*\.\(.*\)'`
- break;;
- esac
-done
-else
- $as_echo "$as_me: failed program was:" >&5
-sed 's/^/| /' conftest.$ac_ext >&5
-
-{ { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error $? "cannot compute suffix of object files: cannot compile
-See \`config.log' for more details" "$LINENO" 5; }
-fi
-rm -f conftest.$ac_cv_objext conftest.$ac_ext
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_objext" >&5
-$as_echo "$ac_cv_objext" >&6; }
-OBJEXT=$ac_cv_objext
-ac_objext=$OBJEXT
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are using the GNU C compiler" >&5
-$as_echo_n "checking whether we are using the GNU C compiler... " >&6; }
-if ${ac_cv_c_compiler_gnu+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-#ifndef __GNUC__
- choke me
-#endif
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- ac_compiler_gnu=yes
-else
- ac_compiler_gnu=no
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-ac_cv_c_compiler_gnu=$ac_compiler_gnu
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_c_compiler_gnu" >&5
-$as_echo "$ac_cv_c_compiler_gnu" >&6; }
-if test $ac_compiler_gnu = yes; then
- GCC=yes
-else
- GCC=
-fi
-ac_test_CFLAGS=${CFLAGS+set}
-ac_save_CFLAGS=$CFLAGS
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CC accepts -g" >&5
-$as_echo_n "checking whether $CC accepts -g... " >&6; }
-if ${ac_cv_prog_cc_g+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_save_c_werror_flag=$ac_c_werror_flag
- ac_c_werror_flag=yes
- ac_cv_prog_cc_g=no
- CFLAGS="-g"
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- ac_cv_prog_cc_g=yes
-else
- CFLAGS=""
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
-
-else
- ac_c_werror_flag=$ac_save_c_werror_flag
- CFLAGS="-g"
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- ac_cv_prog_cc_g=yes
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
- ac_c_werror_flag=$ac_save_c_werror_flag
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cc_g" >&5
-$as_echo "$ac_cv_prog_cc_g" >&6; }
-if test "$ac_test_CFLAGS" = set; then
- CFLAGS=$ac_save_CFLAGS
-elif test $ac_cv_prog_cc_g = yes; then
- if test "$GCC" = yes; then
- CFLAGS="-g -O2"
- else
- CFLAGS="-g"
- fi
-else
- if test "$GCC" = yes; then
- CFLAGS="-O2"
- else
- CFLAGS=
- fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $CC option to accept ISO C89" >&5
-$as_echo_n "checking for $CC option to accept ISO C89... " >&6; }
-if ${ac_cv_prog_cc_c89+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_cv_prog_cc_c89=no
-ac_save_CC=$CC
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <stdarg.h>
-#include <stdio.h>
-struct stat;
-/* Most of the following tests are stolen from RCS 5.7's src/conf.sh. */
-struct buf { int x; };
-FILE * (*rcsopen) (struct buf *, struct stat *, int);
-static char *e (p, i)
- char **p;
- int i;
-{
- return p[i];
-}
-static char *f (char * (*g) (char **, int), char **p, ...)
-{
- char *s;
- va_list v;
- va_start (v,p);
- s = g (p, va_arg (v,int));
- va_end (v);
- return s;
-}
-
-/* OSF 4.0 Compaq cc is some sort of almost-ANSI by default. It has
- function prototypes and stuff, but not '\xHH' hex character constants.
- These don't provoke an error unfortunately, instead are silently treated
- as 'x'. The following induces an error, until -std is added to get
- proper ANSI mode. Curiously '\x00'!='x' always comes out true, for an
- array size at least. It's necessary to write '\x00'==0 to get something
- that's true only with -std. */
-int osf4_cc_array ['\x00' == 0 ? 1 : -1];
-
-/* IBM C 6 for AIX is almost-ANSI by default, but it replaces macro parameters
- inside strings and character constants. */
-#define FOO(x) 'x'
-int xlc6_cc_array[FOO(a) == 'x' ? 1 : -1];
-
-int test (int i, double x);
-struct s1 {int (*f) (int a);};
-struct s2 {int (*f) (double a);};
-int pairnames (int, char **, FILE *(*)(struct buf *, struct stat *, int), int, int);
-int argc;
-char **argv;
-int
-main ()
-{
-return f (e, argv, 0) != argv[0] || f (e, argv, 1) != argv[1];
- ;
- return 0;
-}
-_ACEOF
-for ac_arg in '' -qlanglvl=extc89 -qlanglvl=ansi -std \
- -Ae "-Aa -D_HPUX_SOURCE" "-Xc -D__EXTENSIONS__"
-do
- CC="$ac_save_CC $ac_arg"
- if ac_fn_c_try_compile "$LINENO"; then :
- ac_cv_prog_cc_c89=$ac_arg
-fi
-rm -f core conftest.err conftest.$ac_objext
- test "x$ac_cv_prog_cc_c89" != "xno" && break
-done
-rm -f conftest.$ac_ext
-CC=$ac_save_CC
-
-fi
-# AC_CACHE_VAL
-case "x$ac_cv_prog_cc_c89" in
- x)
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: none needed" >&5
-$as_echo "none needed" >&6; } ;;
- xno)
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: unsupported" >&5
-$as_echo "unsupported" >&6; } ;;
- *)
- CC="$CC $ac_cv_prog_cc_c89"
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cc_c89" >&5
-$as_echo "$ac_cv_prog_cc_c89" >&6; } ;;
-esac
-if test "x$ac_cv_prog_cc_c89" != xno; then :
-
-fi
-
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CC understands -c and -o together" >&5
-$as_echo_n "checking whether $CC understands -c and -o together... " >&6; }
-if ${am_cv_prog_cc_c_o+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-
- ;
- return 0;
-}
-_ACEOF
- # Make sure it works both with $CC and with simple cc.
- # Following AC_PROG_CC_C_O, we do the test twice because some
- # compilers refuse to overwrite an existing .o file with -o,
- # though they will create one.
- am_cv_prog_cc_c_o=yes
- for am_i in 1 2; do
- if { echo "$as_me:$LINENO: $CC -c conftest.$ac_ext -o conftest2.$ac_objext" >&5
- ($CC -c conftest.$ac_ext -o conftest2.$ac_objext) >&5 2>&5
- ac_status=$?
- echo "$as_me:$LINENO: \$? = $ac_status" >&5
- (exit $ac_status); } \
- && test -f conftest2.$ac_objext; then
- : OK
- else
- am_cv_prog_cc_c_o=no
- break
- fi
- done
- rm -f core conftest*
- unset am_i
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_prog_cc_c_o" >&5
-$as_echo "$am_cv_prog_cc_c_o" >&6; }
-if test "$am_cv_prog_cc_c_o" != yes; then
- # Losing compiler, so override with the script.
- # FIXME: It is wrong to rewrite CC.
- # But if we don't then we get into trouble of one sort or another.
- # A longer-term fix would be to have automake use am__CC in this case,
- # and then we could set am__CC="\$(top_srcdir)/compile \$(CC)"
- CC="$am_aux_dir/compile $CC"
-fi
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-
-DEPDIR="${am__leading_dot}deps"
-
-ac_config_commands="$ac_config_commands depfiles"
-
-
-am_make=${MAKE-make}
-cat > confinc << 'END'
-am__doit:
- @echo this is the am__doit target
-.PHONY: am__doit
-END
-# If we don't find an include directive, just comment out the code.
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for style of include used by $am_make" >&5
-$as_echo_n "checking for style of include used by $am_make... " >&6; }
-am__include="#"
-am__quote=
-_am_result=none
-# First try GNU make style include.
-echo "include confinc" > confmf
-# Ignore all kinds of additional output from 'make'.
-case `$am_make -s -f confmf 2> /dev/null` in #(
-*the\ am__doit\ target*)
- am__include=include
- am__quote=
- _am_result=GNU
- ;;
-esac
-# Now try BSD make style include.
-if test "$am__include" = "#"; then
- echo '.include "confinc"' > confmf
- case `$am_make -s -f confmf 2> /dev/null` in #(
- *the\ am__doit\ target*)
- am__include=.include
- am__quote="\""
- _am_result=BSD
- ;;
- esac
-fi
-
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $_am_result" >&5
-$as_echo "$_am_result" >&6; }
-rm -f confinc confmf
-
-# Check whether --enable-dependency-tracking was given.
-if test "${enable_dependency_tracking+set}" = set; then :
- enableval=$enable_dependency_tracking;
-fi
-
-if test "x$enable_dependency_tracking" != xno; then
- am_depcomp="$ac_aux_dir/depcomp"
- AMDEPBACKSLASH='\'
- am__nodep='_no'
-fi
- if test "x$enable_dependency_tracking" != xno; then
- AMDEP_TRUE=
- AMDEP_FALSE='#'
-else
- AMDEP_TRUE='#'
- AMDEP_FALSE=
-fi
-
-
-
-depcc="$CC" am_compiler_list=
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking dependency style of $depcc" >&5
-$as_echo_n "checking dependency style of $depcc... " >&6; }
-if ${am_cv_CC_dependencies_compiler_type+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
- # We make a subdir and do the tests there. Otherwise we can end up
- # making bogus files that we don't know about and never remove. For
- # instance it was reported that on HP-UX the gcc test will end up
- # making a dummy file named 'D' -- because '-MD' means "put the output
- # in D".
- rm -rf conftest.dir
- mkdir conftest.dir
- # Copy depcomp to subdir because otherwise we won't find it if we're
- # using a relative directory.
- cp "$am_depcomp" conftest.dir
- cd conftest.dir
- # We will build objects and dependencies in a subdirectory because
- # it helps to detect inapplicable dependency modes. For instance
- # both Tru64's cc and ICC support -MD to output dependencies as a
- # side effect of compilation, but ICC will put the dependencies in
- # the current directory while Tru64 will put them in the object
- # directory.
- mkdir sub
-
- am_cv_CC_dependencies_compiler_type=none
- if test "$am_compiler_list" = ""; then
- am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
- fi
- am__universal=false
- case " $depcc " in #(
- *\ -arch\ *\ -arch\ *) am__universal=true ;;
- esac
-
- for depmode in $am_compiler_list; do
- # Setup a source with many dependencies, because some compilers
- # like to wrap large dependency lists on column 80 (with \), and
- # we should not choose a depcomp mode which is confused by this.
- #
- # We need to recreate these files for each test, as the compiler may
- # overwrite some of them when testing with obscure command lines.
- # This happens at least with the AIX C compiler.
- : > sub/conftest.c
- for i in 1 2 3 4 5 6; do
- echo '#include "conftst'$i'.h"' >> sub/conftest.c
- # Using ": > sub/conftst$i.h" creates only sub/conftst1.h with
- # Solaris 10 /bin/sh.
- echo '/* dummy */' > sub/conftst$i.h
- done
- echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
-
- # We check with '-c' and '-o' for the sake of the "dashmstdout"
- # mode. It turns out that the SunPro C++ compiler does not properly
- # handle '-M -o', and we need to detect this. Also, some Intel
- # versions had trouble with output in subdirs.
- am__obj=sub/conftest.${OBJEXT-o}
- am__minus_obj="-o $am__obj"
- case $depmode in
- gcc)
- # This depmode causes a compiler race in universal mode.
- test "$am__universal" = false || continue
- ;;
- nosideeffect)
- # After this tag, mechanisms are not by side-effect, so they'll
- # only be used when explicitly requested.
- if test "x$enable_dependency_tracking" = xyes; then
- continue
- else
- break
- fi
- ;;
- msvc7 | msvc7msys | msvisualcpp | msvcmsys)
- # This compiler won't grok '-c -o', but also, the minuso test has
- # not run yet. These depmodes are late enough in the game, and
- # so weak that their functioning should not be impacted.
- am__obj=conftest.${OBJEXT-o}
- am__minus_obj=
- ;;
- none) break ;;
- esac
- if depmode=$depmode \
- source=sub/conftest.c object=$am__obj \
- depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
- $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
- >/dev/null 2>conftest.err &&
- grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
- grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
- grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
- ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
- # icc doesn't choke on unknown options, it will just issue warnings
- # or remarks (even with -Werror). So we grep stderr for any message
- # that says an option was ignored or not supported.
- # When given -MP, icc 7.0 and 7.1 complain thusly:
- # icc: Command line warning: ignoring option '-M'; no argument required
- # The diagnosis changed in icc 8.0:
- # icc: Command line remark: option '-MP' not supported
- if (grep 'ignoring option' conftest.err ||
- grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
- am_cv_CC_dependencies_compiler_type=$depmode
- break
- fi
- fi
- done
-
- cd ..
- rm -rf conftest.dir
-else
- am_cv_CC_dependencies_compiler_type=none
-fi
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_CC_dependencies_compiler_type" >&5
-$as_echo "$am_cv_CC_dependencies_compiler_type" >&6; }
-CCDEPMODE=depmode=$am_cv_CC_dependencies_compiler_type
-
- if
- test "x$enable_dependency_tracking" != xno \
- && test "$am_cv_CC_dependencies_compiler_type" = gcc3; then
- am__fastdepCC_TRUE=
- am__fastdepCC_FALSE='#'
-else
- am__fastdepCC_TRUE='#'
- am__fastdepCC_FALSE=
-fi
-
-
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking how to run the C preprocessor" >&5
-$as_echo_n "checking how to run the C preprocessor... " >&6; }
-# On Suns, sometimes $CPP names a directory.
-if test -n "$CPP" && test -d "$CPP"; then
- CPP=
-fi
-if test -z "$CPP"; then
- if ${ac_cv_prog_CPP+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- # Double quotes because CPP needs to be expanded
- for CPP in "$CC -E" "$CC -E -traditional-cpp" "/lib/cpp"
- do
- ac_preproc_ok=false
-for ac_c_preproc_warn_flag in '' yes
-do
- # Use a header file that comes with gcc, so configuring glibc
- # with a fresh cross-compiler works.
- # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
- # <limits.h> exists even on freestanding compilers.
- # On the NeXT, cc -E runs the code through the compiler's parser,
- # not just through cpp. "Syntax error" is here to catch this case.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#ifdef __STDC__
-# include <limits.h>
-#else
-# include <assert.h>
-#endif
- Syntax error
-_ACEOF
-if ac_fn_c_try_cpp "$LINENO"; then :
-
-else
- # Broken: fails on valid input.
-continue
-fi
-rm -f conftest.err conftest.i conftest.$ac_ext
-
- # OK, works on sane cases. Now check whether nonexistent headers
- # can be detected and how.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <ac_nonexistent.h>
-_ACEOF
-if ac_fn_c_try_cpp "$LINENO"; then :
- # Broken: success on invalid input.
-continue
-else
- # Passes both tests.
-ac_preproc_ok=:
-break
-fi
-rm -f conftest.err conftest.i conftest.$ac_ext
-
-done
-# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
-rm -f conftest.i conftest.err conftest.$ac_ext
-if $ac_preproc_ok; then :
- break
-fi
-
- done
- ac_cv_prog_CPP=$CPP
-
-fi
- CPP=$ac_cv_prog_CPP
-else
- ac_cv_prog_CPP=$CPP
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $CPP" >&5
-$as_echo "$CPP" >&6; }
-ac_preproc_ok=false
-for ac_c_preproc_warn_flag in '' yes
-do
- # Use a header file that comes with gcc, so configuring glibc
- # with a fresh cross-compiler works.
- # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
- # <limits.h> exists even on freestanding compilers.
- # On the NeXT, cc -E runs the code through the compiler's parser,
- # not just through cpp. "Syntax error" is here to catch this case.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#ifdef __STDC__
-# include <limits.h>
-#else
-# include <assert.h>
-#endif
- Syntax error
-_ACEOF
-if ac_fn_c_try_cpp "$LINENO"; then :
-
-else
- # Broken: fails on valid input.
-continue
-fi
-rm -f conftest.err conftest.i conftest.$ac_ext
-
- # OK, works on sane cases. Now check whether nonexistent headers
- # can be detected and how.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <ac_nonexistent.h>
-_ACEOF
-if ac_fn_c_try_cpp "$LINENO"; then :
- # Broken: success on invalid input.
-continue
-else
- # Passes both tests.
-ac_preproc_ok=:
-break
-fi
-rm -f conftest.err conftest.i conftest.$ac_ext
-
-done
-# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
-rm -f conftest.i conftest.err conftest.$ac_ext
-if $ac_preproc_ok; then :
-
-else
- { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error $? "C preprocessor \"$CPP\" fails sanity check
-See \`config.log' for more details" "$LINENO" 5; }
-fi
-
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-
-ac_ext=cpp
-ac_cpp='$CXXCPP $CPPFLAGS'
-ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
-if test -z "$CXX"; then
- if test -n "$CCC"; then
- CXX=$CCC
- else
- if test -n "$ac_tool_prefix"; then
- for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
- do
- # Extract the first word of "$ac_tool_prefix$ac_prog", so it can be a program name with args.
-set dummy $ac_tool_prefix$ac_prog; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_CXX+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$CXX"; then
- ac_cv_prog_CXX="$CXX" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_CXX="$ac_tool_prefix$ac_prog"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-CXX=$ac_cv_prog_CXX
-if test -n "$CXX"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $CXX" >&5
-$as_echo "$CXX" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
- test -n "$CXX" && break
- done
-fi
-if test -z "$CXX"; then
- ac_ct_CXX=$CXX
- for ac_prog in g++ c++ gpp aCC CC cxx cc++ cl.exe FCC KCC RCC xlC_r xlC
-do
- # Extract the first word of "$ac_prog", so it can be a program name with args.
-set dummy $ac_prog; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_ac_ct_CXX+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$ac_ct_CXX"; then
- ac_cv_prog_ac_ct_CXX="$ac_ct_CXX" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_ac_ct_CXX="$ac_prog"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-ac_ct_CXX=$ac_cv_prog_ac_ct_CXX
-if test -n "$ac_ct_CXX"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_CXX" >&5
-$as_echo "$ac_ct_CXX" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
- test -n "$ac_ct_CXX" && break
-done
-
- if test "x$ac_ct_CXX" = x; then
- CXX="g++"
- else
- case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
- CXX=$ac_ct_CXX
- fi
-fi
-
- fi
-fi
-# Provide some information about the compiler.
-$as_echo "$as_me:${as_lineno-$LINENO}: checking for C++ compiler version" >&5
-set X $ac_compile
-ac_compiler=$2
-for ac_option in --version -v -V -qversion; do
- { { ac_try="$ac_compiler $ac_option >&5"
-case "(($ac_try" in
- *\"* | *\`* | *\\*) ac_try_echo=\$ac_try;;
- *) ac_try_echo=$ac_try;;
-esac
-eval ac_try_echo="\"\$as_me:${as_lineno-$LINENO}: $ac_try_echo\""
-$as_echo "$ac_try_echo"; } >&5
- (eval "$ac_compiler $ac_option >&5") 2>conftest.err
- ac_status=$?
- if test -s conftest.err; then
- sed '10a\
-... rest of stderr output deleted ...
- 10q' conftest.err >conftest.er1
- cat conftest.er1 >&5
- fi
- rm -f conftest.er1 conftest.err
- $as_echo "$as_me:${as_lineno-$LINENO}: \$? = $ac_status" >&5
- test $ac_status = 0; }
-done
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether we are using the GNU C++ compiler" >&5
-$as_echo_n "checking whether we are using the GNU C++ compiler... " >&6; }
-if ${ac_cv_cxx_compiler_gnu+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-#ifndef __GNUC__
- choke me
-#endif
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_cxx_try_compile "$LINENO"; then :
- ac_compiler_gnu=yes
-else
- ac_compiler_gnu=no
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-ac_cv_cxx_compiler_gnu=$ac_compiler_gnu
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_cxx_compiler_gnu" >&5
-$as_echo "$ac_cv_cxx_compiler_gnu" >&6; }
-if test $ac_compiler_gnu = yes; then
- GXX=yes
-else
- GXX=
-fi
-ac_test_CXXFLAGS=${CXXFLAGS+set}
-ac_save_CXXFLAGS=$CXXFLAGS
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking whether $CXX accepts -g" >&5
-$as_echo_n "checking whether $CXX accepts -g... " >&6; }
-if ${ac_cv_prog_cxx_g+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_save_cxx_werror_flag=$ac_cxx_werror_flag
- ac_cxx_werror_flag=yes
- ac_cv_prog_cxx_g=no
- CXXFLAGS="-g"
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_cxx_try_compile "$LINENO"; then :
- ac_cv_prog_cxx_g=yes
-else
- CXXFLAGS=""
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_cxx_try_compile "$LINENO"; then :
-
-else
- ac_cxx_werror_flag=$ac_save_cxx_werror_flag
- CXXFLAGS="-g"
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_cxx_try_compile "$LINENO"; then :
- ac_cv_prog_cxx_g=yes
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
- ac_cxx_werror_flag=$ac_save_cxx_werror_flag
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cxx_g" >&5
-$as_echo "$ac_cv_prog_cxx_g" >&6; }
-if test "$ac_test_CXXFLAGS" = set; then
- CXXFLAGS=$ac_save_CXXFLAGS
-elif test $ac_cv_prog_cxx_g = yes; then
- if test "$GXX" = yes; then
- CXXFLAGS="-g -O2"
- else
- CXXFLAGS="-g"
- fi
-else
- if test "$GXX" = yes; then
- CXXFLAGS="-O2"
- else
- CXXFLAGS=
- fi
-fi
-ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-
-depcc="$CXX" am_compiler_list=
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking dependency style of $depcc" >&5
-$as_echo_n "checking dependency style of $depcc... " >&6; }
-if ${am_cv_CXX_dependencies_compiler_type+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -z "$AMDEP_TRUE" && test -f "$am_depcomp"; then
- # We make a subdir and do the tests there. Otherwise we can end up
- # making bogus files that we don't know about and never remove. For
- # instance it was reported that on HP-UX the gcc test will end up
- # making a dummy file named 'D' -- because '-MD' means "put the output
- # in D".
- rm -rf conftest.dir
- mkdir conftest.dir
- # Copy depcomp to subdir because otherwise we won't find it if we're
- # using a relative directory.
- cp "$am_depcomp" conftest.dir
- cd conftest.dir
- # We will build objects and dependencies in a subdirectory because
- # it helps to detect inapplicable dependency modes. For instance
- # both Tru64's cc and ICC support -MD to output dependencies as a
- # side effect of compilation, but ICC will put the dependencies in
- # the current directory while Tru64 will put them in the object
- # directory.
- mkdir sub
-
- am_cv_CXX_dependencies_compiler_type=none
- if test "$am_compiler_list" = ""; then
- am_compiler_list=`sed -n 's/^#*\([a-zA-Z0-9]*\))$/\1/p' < ./depcomp`
- fi
- am__universal=false
- case " $depcc " in #(
- *\ -arch\ *\ -arch\ *) am__universal=true ;;
- esac
-
- for depmode in $am_compiler_list; do
- # Setup a source with many dependencies, because some compilers
- # like to wrap large dependency lists on column 80 (with \), and
- # we should not choose a depcomp mode which is confused by this.
- #
- # We need to recreate these files for each test, as the compiler may
- # overwrite some of them when testing with obscure command lines.
- # This happens at least with the AIX C compiler.
- : > sub/conftest.c
- for i in 1 2 3 4 5 6; do
- echo '#include "conftst'$i'.h"' >> sub/conftest.c
- # Using ": > sub/conftst$i.h" creates only sub/conftst1.h with
- # Solaris 10 /bin/sh.
- echo '/* dummy */' > sub/conftst$i.h
- done
- echo "${am__include} ${am__quote}sub/conftest.Po${am__quote}" > confmf
-
- # We check with '-c' and '-o' for the sake of the "dashmstdout"
- # mode. It turns out that the SunPro C++ compiler does not properly
- # handle '-M -o', and we need to detect this. Also, some Intel
- # versions had trouble with output in subdirs.
- am__obj=sub/conftest.${OBJEXT-o}
- am__minus_obj="-o $am__obj"
- case $depmode in
- gcc)
- # This depmode causes a compiler race in universal mode.
- test "$am__universal" = false || continue
- ;;
- nosideeffect)
- # After this tag, mechanisms are not by side-effect, so they'll
- # only be used when explicitly requested.
- if test "x$enable_dependency_tracking" = xyes; then
- continue
- else
- break
- fi
- ;;
- msvc7 | msvc7msys | msvisualcpp | msvcmsys)
- # This compiler won't grok '-c -o', but also, the minuso test has
- # not run yet. These depmodes are late enough in the game, and
- # so weak that their functioning should not be impacted.
- am__obj=conftest.${OBJEXT-o}
- am__minus_obj=
- ;;
- none) break ;;
- esac
- if depmode=$depmode \
- source=sub/conftest.c object=$am__obj \
- depfile=sub/conftest.Po tmpdepfile=sub/conftest.TPo \
- $SHELL ./depcomp $depcc -c $am__minus_obj sub/conftest.c \
- >/dev/null 2>conftest.err &&
- grep sub/conftst1.h sub/conftest.Po > /dev/null 2>&1 &&
- grep sub/conftst6.h sub/conftest.Po > /dev/null 2>&1 &&
- grep $am__obj sub/conftest.Po > /dev/null 2>&1 &&
- ${MAKE-make} -s -f confmf > /dev/null 2>&1; then
- # icc doesn't choke on unknown options, it will just issue warnings
- # or remarks (even with -Werror). So we grep stderr for any message
- # that says an option was ignored or not supported.
- # When given -MP, icc 7.0 and 7.1 complain thusly:
- # icc: Command line warning: ignoring option '-M'; no argument required
- # The diagnosis changed in icc 8.0:
- # icc: Command line remark: option '-MP' not supported
- if (grep 'ignoring option' conftest.err ||
- grep 'not supported' conftest.err) >/dev/null 2>&1; then :; else
- am_cv_CXX_dependencies_compiler_type=$depmode
- break
- fi
- fi
- done
-
- cd ..
- rm -rf conftest.dir
-else
- am_cv_CXX_dependencies_compiler_type=none
-fi
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $am_cv_CXX_dependencies_compiler_type" >&5
-$as_echo "$am_cv_CXX_dependencies_compiler_type" >&6; }
-CXXDEPMODE=depmode=$am_cv_CXX_dependencies_compiler_type
-
- if
- test "x$enable_dependency_tracking" != xno \
- && test "$am_cv_CXX_dependencies_compiler_type" = gcc3; then
- am__fastdepCXX_TRUE=
- am__fastdepCXX_FALSE='#'
-else
- am__fastdepCXX_TRUE='#'
- am__fastdepCXX_FALSE=
-fi
-
-
-
-if test -n "$ac_tool_prefix"; then
- # Extract the first word of "${ac_tool_prefix}ranlib", so it can be a program name with args.
-set dummy ${ac_tool_prefix}ranlib; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_RANLIB+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$RANLIB"; then
- ac_cv_prog_RANLIB="$RANLIB" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_RANLIB="${ac_tool_prefix}ranlib"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-RANLIB=$ac_cv_prog_RANLIB
-if test -n "$RANLIB"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $RANLIB" >&5
-$as_echo "$RANLIB" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-fi
-if test -z "$ac_cv_prog_RANLIB"; then
- ac_ct_RANLIB=$RANLIB
- # Extract the first word of "ranlib", so it can be a program name with args.
-set dummy ranlib; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_ac_ct_RANLIB+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$ac_ct_RANLIB"; then
- ac_cv_prog_ac_ct_RANLIB="$ac_ct_RANLIB" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_ac_ct_RANLIB="ranlib"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-ac_ct_RANLIB=$ac_cv_prog_ac_ct_RANLIB
-if test -n "$ac_ct_RANLIB"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_RANLIB" >&5
-$as_echo "$ac_ct_RANLIB" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
- if test "x$ac_ct_RANLIB" = x; then
- RANLIB=":"
- else
- case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
- RANLIB=$ac_ct_RANLIB
- fi
-else
- RANLIB="$ac_cv_prog_RANLIB"
-fi
-
-if test -n "$ac_tool_prefix"; then
- # Extract the first word of "${ac_tool_prefix}ghc", so it can be a program name with args.
-set dummy ${ac_tool_prefix}ghc; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_GHC+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$GHC"; then
- ac_cv_prog_GHC="$GHC" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_GHC="${ac_tool_prefix}ghc"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-GHC=$ac_cv_prog_GHC
-if test -n "$GHC"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $GHC" >&5
-$as_echo "$GHC" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
-
-fi
-if test -z "$ac_cv_prog_GHC"; then
- ac_ct_GHC=$GHC
- # Extract the first word of "ghc", so it can be a program name with args.
-set dummy ghc; ac_word=$2
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for $ac_word" >&5
-$as_echo_n "checking for $ac_word... " >&6; }
-if ${ac_cv_prog_ac_ct_GHC+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -n "$ac_ct_GHC"; then
- ac_cv_prog_ac_ct_GHC="$ac_ct_GHC" # Let the user override the test.
-else
-as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_exec_ext in '' $ac_executable_extensions; do
- if as_fn_executable_p "$as_dir/$ac_word$ac_exec_ext"; then
- ac_cv_prog_ac_ct_GHC="ghc"
- $as_echo "$as_me:${as_lineno-$LINENO}: found $as_dir/$ac_word$ac_exec_ext" >&5
- break 2
- fi
-done
- done
-IFS=$as_save_IFS
-
-fi
-fi
-ac_ct_GHC=$ac_cv_prog_ac_ct_GHC
-if test -n "$ac_ct_GHC"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_ct_GHC" >&5
-$as_echo "$ac_ct_GHC" >&6; }
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: no" >&5
-$as_echo "no" >&6; }
-fi
-
- if test "x$ac_ct_GHC" = x; then
- GHC=""
- else
- case $cross_compiling:$ac_tool_warned in
-yes:)
-{ $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: using cross tools not prefixed with host triplet" >&5
-$as_echo "$as_me: WARNING: using cross tools not prefixed with host triplet" >&2;}
-ac_tool_warned=yes ;;
-esac
- GHC=$ac_ct_GHC
- fi
-else
- GHC="$ac_cv_prog_GHC"
-fi
-
- if test "$GHC"; then
- HAVE_GHC_TRUE=
- HAVE_GHC_FALSE='#'
-else
- HAVE_GHC_TRUE='#'
- HAVE_GHC_FALSE=
-fi
-
-
-# Checks for header files.
-
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for grep that handles long lines and -e" >&5
-$as_echo_n "checking for grep that handles long lines and -e... " >&6; }
-if ${ac_cv_path_GREP+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test -z "$GREP"; then
- ac_path_GREP_found=false
- # Loop through the user's path and test for each of PROGNAME-LIST
- as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_prog in grep ggrep; do
- for ac_exec_ext in '' $ac_executable_extensions; do
- ac_path_GREP="$as_dir/$ac_prog$ac_exec_ext"
- as_fn_executable_p "$ac_path_GREP" || continue
-# Check for GNU ac_path_GREP and select it if it is found.
- # Check for GNU $ac_path_GREP
-case `"$ac_path_GREP" --version 2>&1` in
-*GNU*)
- ac_cv_path_GREP="$ac_path_GREP" ac_path_GREP_found=:;;
-*)
- ac_count=0
- $as_echo_n 0123456789 >"conftest.in"
- while :
- do
- cat "conftest.in" "conftest.in" >"conftest.tmp"
- mv "conftest.tmp" "conftest.in"
- cp "conftest.in" "conftest.nl"
- $as_echo 'GREP' >> "conftest.nl"
- "$ac_path_GREP" -e 'GREP$' -e '-(cannot match)-' < "conftest.nl" >"conftest.out" 2>/dev/null || break
- diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
- as_fn_arith $ac_count + 1 && ac_count=$as_val
- if test $ac_count -gt ${ac_path_GREP_max-0}; then
- # Best one so far, save it but keep looking for a better one
- ac_cv_path_GREP="$ac_path_GREP"
- ac_path_GREP_max=$ac_count
- fi
- # 10*(2^10) chars as input seems more than enough
- test $ac_count -gt 10 && break
- done
- rm -f conftest.in conftest.tmp conftest.nl conftest.out;;
-esac
-
- $ac_path_GREP_found && break 3
- done
- done
- done
-IFS=$as_save_IFS
- if test -z "$ac_cv_path_GREP"; then
- as_fn_error $? "no acceptable grep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" "$LINENO" 5
- fi
-else
- ac_cv_path_GREP=$GREP
-fi
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_path_GREP" >&5
-$as_echo "$ac_cv_path_GREP" >&6; }
- GREP="$ac_cv_path_GREP"
-
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for egrep" >&5
-$as_echo_n "checking for egrep... " >&6; }
-if ${ac_cv_path_EGREP+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if echo a | $GREP -E '(a|b)' >/dev/null 2>&1
- then ac_cv_path_EGREP="$GREP -E"
- else
- if test -z "$EGREP"; then
- ac_path_EGREP_found=false
- # Loop through the user's path and test for each of PROGNAME-LIST
- as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH$PATH_SEPARATOR/usr/xpg4/bin
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- for ac_prog in egrep; do
- for ac_exec_ext in '' $ac_executable_extensions; do
- ac_path_EGREP="$as_dir/$ac_prog$ac_exec_ext"
- as_fn_executable_p "$ac_path_EGREP" || continue
-# Check for GNU ac_path_EGREP and select it if it is found.
- # Check for GNU $ac_path_EGREP
-case `"$ac_path_EGREP" --version 2>&1` in
-*GNU*)
- ac_cv_path_EGREP="$ac_path_EGREP" ac_path_EGREP_found=:;;
-*)
- ac_count=0
- $as_echo_n 0123456789 >"conftest.in"
- while :
- do
- cat "conftest.in" "conftest.in" >"conftest.tmp"
- mv "conftest.tmp" "conftest.in"
- cp "conftest.in" "conftest.nl"
- $as_echo 'EGREP' >> "conftest.nl"
- "$ac_path_EGREP" 'EGREP$' < "conftest.nl" >"conftest.out" 2>/dev/null || break
- diff "conftest.out" "conftest.nl" >/dev/null 2>&1 || break
- as_fn_arith $ac_count + 1 && ac_count=$as_val
- if test $ac_count -gt ${ac_path_EGREP_max-0}; then
- # Best one so far, save it but keep looking for a better one
- ac_cv_path_EGREP="$ac_path_EGREP"
- ac_path_EGREP_max=$ac_count
- fi
- # 10*(2^10) chars as input seems more than enough
- test $ac_count -gt 10 && break
- done
- rm -f conftest.in conftest.tmp conftest.nl conftest.out;;
-esac
-
- $ac_path_EGREP_found && break 3
- done
- done
- done
-IFS=$as_save_IFS
- if test -z "$ac_cv_path_EGREP"; then
- as_fn_error $? "no acceptable egrep could be found in $PATH$PATH_SEPARATOR/usr/xpg4/bin" "$LINENO" 5
- fi
-else
- ac_cv_path_EGREP=$EGREP
-fi
-
- fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_path_EGREP" >&5
-$as_echo "$ac_cv_path_EGREP" >&6; }
- EGREP="$ac_cv_path_EGREP"
-
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for ANSI C header files" >&5
-$as_echo_n "checking for ANSI C header files... " >&6; }
-if ${ac_cv_header_stdc+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <stdlib.h>
-#include <stdarg.h>
-#include <string.h>
-#include <float.h>
-
-int
-main ()
-{
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- ac_cv_header_stdc=yes
-else
- ac_cv_header_stdc=no
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-
-if test $ac_cv_header_stdc = yes; then
- # SunOS 4.x string.h does not declare mem*, contrary to ANSI.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <string.h>
-
-_ACEOF
-if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
- $EGREP "memchr" >/dev/null 2>&1; then :
-
-else
- ac_cv_header_stdc=no
-fi
-rm -f conftest*
-
-fi
-
-if test $ac_cv_header_stdc = yes; then
- # ISC 2.0.2 stdlib.h does not declare free, contrary to ANSI.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <stdlib.h>
-
-_ACEOF
-if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
- $EGREP "free" >/dev/null 2>&1; then :
-
-else
- ac_cv_header_stdc=no
-fi
-rm -f conftest*
-
-fi
-
-if test $ac_cv_header_stdc = yes; then
- # /bin/cc in Irix-4.0.5 gets non-ANSI ctype macros unless using -ansi.
- if test "$cross_compiling" = yes; then :
- :
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <ctype.h>
-#include <stdlib.h>
-#if ((' ' & 0x0FF) == 0x020)
-# define ISLOWER(c) ('a' <= (c) && (c) <= 'z')
-# define TOUPPER(c) (ISLOWER(c) ? 'A' + ((c) - 'a') : (c))
-#else
-# define ISLOWER(c) \
- (('a' <= (c) && (c) <= 'i') \
- || ('j' <= (c) && (c) <= 'r') \
- || ('s' <= (c) && (c) <= 'z'))
-# define TOUPPER(c) (ISLOWER(c) ? ((c) | 0x40) : (c))
-#endif
-
-#define XOR(e, f) (((e) && !(f)) || (!(e) && (f)))
-int
-main ()
-{
- int i;
- for (i = 0; i < 256; i++)
- if (XOR (islower (i), ISLOWER (i))
- || toupper (i) != TOUPPER (i))
- return 2;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_run "$LINENO"; then :
-
-else
- ac_cv_header_stdc=no
-fi
-rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
- conftest.$ac_objext conftest.beam conftest.$ac_ext
-fi
-
-fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_header_stdc" >&5
-$as_echo "$ac_cv_header_stdc" >&6; }
-if test $ac_cv_header_stdc = yes; then
-
-$as_echo "#define STDC_HEADERS 1" >>confdefs.h
-
-fi
-
-# On IRIX 5.3, sys/types and inttypes.h are conflicting.
-for ac_header in sys/types.h sys/stat.h stdlib.h string.h memory.h strings.h \
- inttypes.h stdint.h unistd.h
-do :
- as_ac_Header=`$as_echo "ac_cv_header_$ac_header" | $as_tr_sh`
-ac_fn_c_check_header_compile "$LINENO" "$ac_header" "$as_ac_Header" "$ac_includes_default
-"
-if eval test \"x\$"$as_ac_Header"\" = x"yes"; then :
- cat >>confdefs.h <<_ACEOF
-#define `$as_echo "HAVE_$ac_header" | $as_tr_cpp` 1
-_ACEOF
-
-fi
-
-done
-
-
-for ac_header in dlfcn.h fcntl.h float.h limits.h \
- stddef.h stdint.h stdlib.h sys/param.h
-do :
- as_ac_Header=`$as_echo "ac_cv_header_$ac_header" | $as_tr_sh`
-ac_fn_c_check_header_mongrel "$LINENO" "$ac_header" "$as_ac_Header" "$ac_includes_default"
-if eval test \"x\$"$as_ac_Header"\" = x"yes"; then :
- cat >>confdefs.h <<_ACEOF
-#define `$as_echo "HAVE_$ac_header" | $as_tr_cpp` 1
-_ACEOF
-
-fi
-
-done
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for stdbool.h that conforms to C99" >&5
-$as_echo_n "checking for stdbool.h that conforms to C99... " >&6; }
-if ${ac_cv_header_stdbool_h+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
- #include <stdbool.h>
- #ifndef bool
- "error: bool is not defined"
- #endif
- #ifndef false
- "error: false is not defined"
- #endif
- #if false
- "error: false is not 0"
- #endif
- #ifndef true
- "error: true is not defined"
- #endif
- #if true != 1
- "error: true is not 1"
- #endif
- #ifndef __bool_true_false_are_defined
- "error: __bool_true_false_are_defined is not defined"
- #endif
-
- struct s { _Bool s: 1; _Bool t; } s;
-
- char a[true == 1 ? 1 : -1];
- char b[false == 0 ? 1 : -1];
- char c[__bool_true_false_are_defined == 1 ? 1 : -1];
- char d[(bool) 0.5 == true ? 1 : -1];
- /* See body of main program for 'e'. */
- char f[(_Bool) 0.0 == false ? 1 : -1];
- char g[true];
- char h[sizeof (_Bool)];
- char i[sizeof s.t];
- enum { j = false, k = true, l = false * true, m = true * 256 };
- /* The following fails for
- HP aC++/ANSI C B3910B A.05.55 [Dec 04 2003]. */
- _Bool n[m];
- char o[sizeof n == m * sizeof n[0] ? 1 : -1];
- char p[-1 - (_Bool) 0 < 0 && -1 - (bool) 0 < 0 ? 1 : -1];
- /* Catch a bug in an HP-UX C compiler. See
- http://gcc.gnu.org/ml/gcc-patches/2003-12/msg02303.html
- http://lists.gnu.org/archive/html/bug-coreutils/2005-11/msg00161.html
- */
- _Bool q = true;
- _Bool *pq = &q;
-
-int
-main ()
-{
-
- bool e = &s;
- *pq |= q;
- *pq |= ! q;
- /* Refer to every declared value, to avoid compiler optimizations. */
- return (!a + !b + !c + !d + !e + !f + !g + !h + !i + !!j + !k + !!l
- + !m + !n + !o + !p + !q + !pq);
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- ac_cv_header_stdbool_h=yes
-else
- ac_cv_header_stdbool_h=no
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_header_stdbool_h" >&5
-$as_echo "$ac_cv_header_stdbool_h" >&6; }
- ac_fn_c_check_type "$LINENO" "_Bool" "ac_cv_type__Bool" "$ac_includes_default"
-if test "x$ac_cv_type__Bool" = xyes; then :
-
-cat >>confdefs.h <<_ACEOF
-#define HAVE__BOOL 1
-_ACEOF
-
-
-fi
-
-
-if test $ac_cv_header_stdbool_h = yes; then
-
-$as_echo "#define HAVE_STDBOOL_H 1" >>confdefs.h
-
-fi
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for ANSI C header files" >&5
-$as_echo_n "checking for ANSI C header files... " >&6; }
-if ${ac_cv_header_stdc+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <stdlib.h>
-#include <stdarg.h>
-#include <string.h>
-#include <float.h>
-
-int
-main ()
-{
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- ac_cv_header_stdc=yes
-else
- ac_cv_header_stdc=no
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-
-if test $ac_cv_header_stdc = yes; then
- # SunOS 4.x string.h does not declare mem*, contrary to ANSI.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <string.h>
-
-_ACEOF
-if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
- $EGREP "memchr" >/dev/null 2>&1; then :
-
-else
- ac_cv_header_stdc=no
-fi
-rm -f conftest*
-
-fi
-
-if test $ac_cv_header_stdc = yes; then
- # ISC 2.0.2 stdlib.h does not declare free, contrary to ANSI.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <stdlib.h>
-
-_ACEOF
-if (eval "$ac_cpp conftest.$ac_ext") 2>&5 |
- $EGREP "free" >/dev/null 2>&1; then :
-
-else
- ac_cv_header_stdc=no
-fi
-rm -f conftest*
-
-fi
-
-if test $ac_cv_header_stdc = yes; then
- # /bin/cc in Irix-4.0.5 gets non-ANSI ctype macros unless using -ansi.
- if test "$cross_compiling" = yes; then :
- :
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <ctype.h>
-#include <stdlib.h>
-#if ((' ' & 0x0FF) == 0x020)
-# define ISLOWER(c) ('a' <= (c) && (c) <= 'z')
-# define TOUPPER(c) (ISLOWER(c) ? 'A' + ((c) - 'a') : (c))
-#else
-# define ISLOWER(c) \
- (('a' <= (c) && (c) <= 'i') \
- || ('j' <= (c) && (c) <= 'r') \
- || ('s' <= (c) && (c) <= 'z'))
-# define TOUPPER(c) (ISLOWER(c) ? ((c) | 0x40) : (c))
-#endif
-
-#define XOR(e, f) (((e) && !(f)) || (!(e) && (f)))
-int
-main ()
-{
- int i;
- for (i = 0; i < 256; i++)
- if (XOR (islower (i), ISLOWER (i))
- || toupper (i) != TOUPPER (i))
- return 2;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_run "$LINENO"; then :
-
-else
- ac_cv_header_stdc=no
-fi
-rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
- conftest.$ac_objext conftest.beam conftest.$ac_ext
-fi
-
-fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_header_stdc" >&5
-$as_echo "$ac_cv_header_stdc" >&6; }
-if test $ac_cv_header_stdc = yes; then
-
-$as_echo "#define STDC_HEADERS 1" >>confdefs.h
-
-fi
-
-
-# Checks for typedefs, structures, and compiler characteristics.
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking whether byte ordering is bigendian" >&5
-$as_echo_n "checking whether byte ordering is bigendian... " >&6; }
-if ${ac_cv_c_bigendian+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_cv_c_bigendian=unknown
- # See if we're dealing with a universal compiler.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#ifndef __APPLE_CC__
- not a universal capable compiler
- #endif
- typedef int dummy;
-
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
-
- # Check for potential -arch flags. It is not universal unless
- # there are at least two -arch flags with different values.
- ac_arch=
- ac_prev=
- for ac_word in $CC $CFLAGS $CPPFLAGS $LDFLAGS; do
- if test -n "$ac_prev"; then
- case $ac_word in
- i?86 | x86_64 | ppc | ppc64)
- if test -z "$ac_arch" || test "$ac_arch" = "$ac_word"; then
- ac_arch=$ac_word
- else
- ac_cv_c_bigendian=universal
- break
- fi
- ;;
- esac
- ac_prev=
- elif test "x$ac_word" = "x-arch"; then
- ac_prev=arch
- fi
- done
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
- if test $ac_cv_c_bigendian = unknown; then
- # See if sys/param.h defines the BYTE_ORDER macro.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <sys/types.h>
- #include <sys/param.h>
-
-int
-main ()
-{
-#if ! (defined BYTE_ORDER && defined BIG_ENDIAN \
- && defined LITTLE_ENDIAN && BYTE_ORDER && BIG_ENDIAN \
- && LITTLE_ENDIAN)
- bogus endian macros
- #endif
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- # It does; now see whether it defined to BIG_ENDIAN or not.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <sys/types.h>
- #include <sys/param.h>
-
-int
-main ()
-{
-#if BYTE_ORDER != BIG_ENDIAN
- not big endian
- #endif
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- ac_cv_c_bigendian=yes
-else
- ac_cv_c_bigendian=no
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
- fi
- if test $ac_cv_c_bigendian = unknown; then
- # See if <limits.h> defines _LITTLE_ENDIAN or _BIG_ENDIAN (e.g., Solaris).
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <limits.h>
-
-int
-main ()
-{
-#if ! (defined _LITTLE_ENDIAN || defined _BIG_ENDIAN)
- bogus endian macros
- #endif
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- # It does; now see whether it defined to _BIG_ENDIAN or not.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <limits.h>
-
-int
-main ()
-{
-#ifndef _BIG_ENDIAN
- not big endian
- #endif
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- ac_cv_c_bigendian=yes
-else
- ac_cv_c_bigendian=no
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
- fi
- if test $ac_cv_c_bigendian = unknown; then
- # Compile a test program.
- if test "$cross_compiling" = yes; then :
- # Try to guess by grepping values from an object file.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-short int ascii_mm[] =
- { 0x4249, 0x4765, 0x6E44, 0x6961, 0x6E53, 0x7953, 0 };
- short int ascii_ii[] =
- { 0x694C, 0x5454, 0x656C, 0x6E45, 0x6944, 0x6E61, 0 };
- int use_ascii (int i) {
- return ascii_mm[i] + ascii_ii[i];
- }
- short int ebcdic_ii[] =
- { 0x89D3, 0xE3E3, 0x8593, 0x95C5, 0x89C4, 0x9581, 0 };
- short int ebcdic_mm[] =
- { 0xC2C9, 0xC785, 0x95C4, 0x8981, 0x95E2, 0xA8E2, 0 };
- int use_ebcdic (int i) {
- return ebcdic_mm[i] + ebcdic_ii[i];
- }
- extern int foo;
-
-int
-main ()
-{
-return use_ascii (foo) == use_ebcdic (foo);
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- if grep BIGenDianSyS conftest.$ac_objext >/dev/null; then
- ac_cv_c_bigendian=yes
- fi
- if grep LiTTleEnDian conftest.$ac_objext >/dev/null ; then
- if test "$ac_cv_c_bigendian" = unknown; then
- ac_cv_c_bigendian=no
- else
- # finding both strings is unlikely to happen, but who knows?
- ac_cv_c_bigendian=unknown
- fi
- fi
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$ac_includes_default
-int
-main ()
-{
-
- /* Are we little or big endian? From Harbison&Steele. */
- union
- {
- long int l;
- char c[sizeof (long int)];
- } u;
- u.l = 1;
- return u.c[sizeof (long int) - 1] == 1;
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_run "$LINENO"; then :
- ac_cv_c_bigendian=no
-else
- ac_cv_c_bigendian=yes
-fi
-rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
- conftest.$ac_objext conftest.beam conftest.$ac_ext
-fi
-
- fi
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_c_bigendian" >&5
-$as_echo "$ac_cv_c_bigendian" >&6; }
- case $ac_cv_c_bigendian in #(
- yes)
- $as_echo "#define WORDS_BIGENDIAN 1" >>confdefs.h
-;; #(
- no)
- ;; #(
- universal)
-
-$as_echo "#define AC_APPLE_UNIVERSAL_BUILD 1" >>confdefs.h
-
- ;; #(
- *)
- as_fn_error $? "unknown endianness
- presetting ac_cv_c_bigendian=no (or yes) will help" "$LINENO" 5 ;;
- esac
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for an ANSI C-conforming const" >&5
-$as_echo_n "checking for an ANSI C-conforming const... " >&6; }
-if ${ac_cv_c_const+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-int
-main ()
-{
-
-#ifndef __cplusplus
- /* Ultrix mips cc rejects this sort of thing. */
- typedef int charset[2];
- const charset cs = { 0, 0 };
- /* SunOS 4.1.1 cc rejects this. */
- char const *const *pcpcc;
- char **ppc;
- /* NEC SVR4.0.2 mips cc rejects this. */
- struct point {int x, y;};
- static struct point const zero = {0,0};
- /* AIX XL C 1.02.0.0 rejects this.
- It does not let you subtract one const X* pointer from another in
- an arm of an if-expression whose if-part is not a constant
- expression */
- const char *g = "string";
- pcpcc = &g + (g ? g-g : 0);
- /* HPUX 7.0 cc rejects these. */
- ++pcpcc;
- ppc = (char**) pcpcc;
- pcpcc = (char const *const *) ppc;
- { /* SCO 3.2v4 cc rejects this sort of thing. */
- char tx;
- char *t = &tx;
- char const *s = 0 ? (char *) 0 : (char const *) 0;
-
- *t++ = 0;
- if (s) return 0;
- }
- { /* Someone thinks the Sun supposedly-ANSI compiler will reject this. */
- int x[] = {25, 17};
- const int *foo = &x[0];
- ++foo;
- }
- { /* Sun SC1.0 ANSI compiler rejects this -- but not the above. */
- typedef const int *iptr;
- iptr p = 0;
- ++p;
- }
- { /* AIX XL C 1.02.0.0 rejects this sort of thing, saying
- "k.c", line 2.27: 1506-025 (S) Operand must be a modifiable lvalue. */
- struct s { int j; const int *ap[3]; } bx;
- struct s *b = &bx; b->j = 5;
- }
- { /* ULTRIX-32 V3.1 (Rev 9) vcc rejects this */
- const int foo = 10;
- if (!foo) return 0;
- }
- return !cs[0] && !zero.x;
-#endif
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- ac_cv_c_const=yes
-else
- ac_cv_c_const=no
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_c_const" >&5
-$as_echo "$ac_cv_c_const" >&6; }
-if test $ac_cv_c_const = no; then
-
-$as_echo "#define const /**/" >>confdefs.h
-
-fi
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for inline" >&5
-$as_echo_n "checking for inline... " >&6; }
-if ${ac_cv_c_inline+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_cv_c_inline=no
-for ac_kw in inline __inline__ __inline; do
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#ifndef __cplusplus
-typedef int foo_t;
-static $ac_kw foo_t static_foo () {return 0; }
-$ac_kw foo_t foo () {return 0; }
-#endif
-
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
- ac_cv_c_inline=$ac_kw
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
- test "$ac_cv_c_inline" != no && break
-done
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_c_inline" >&5
-$as_echo "$ac_cv_c_inline" >&6; }
-
-case $ac_cv_c_inline in
- inline | yes) ;;
- *)
- case $ac_cv_c_inline in
- no) ac_val=;;
- *) ac_val=$ac_cv_c_inline;;
- esac
- cat >>confdefs.h <<_ACEOF
-#ifndef __cplusplus
-#define inline $ac_val
-#endif
-_ACEOF
- ;;
-esac
-
-ac_fn_c_check_type "$LINENO" "ptrdiff_t" "ac_cv_type_ptrdiff_t" "$ac_includes_default"
-if test "x$ac_cv_type_ptrdiff_t" = xyes; then :
-
-cat >>confdefs.h <<_ACEOF
-#define HAVE_PTRDIFF_T 1
-_ACEOF
-
-
-fi
-
-ac_fn_c_check_type "$LINENO" "mode_t" "ac_cv_type_mode_t" "$ac_includes_default"
-if test "x$ac_cv_type_mode_t" = xyes; then :
-
-else
-
-cat >>confdefs.h <<_ACEOF
-#define mode_t int
-_ACEOF
-
-fi
-
-ac_fn_c_check_type "$LINENO" "pid_t" "ac_cv_type_pid_t" "$ac_includes_default"
-if test "x$ac_cv_type_pid_t" = xyes; then :
-
-else
-
-cat >>confdefs.h <<_ACEOF
-#define pid_t int
-_ACEOF
-
-fi
-
-ac_fn_c_check_type "$LINENO" "size_t" "ac_cv_type_size_t" "$ac_includes_default"
-if test "x$ac_cv_type_size_t" = xyes; then :
-
-else
-
-cat >>confdefs.h <<_ACEOF
-#define size_t unsigned int
-_ACEOF
-
-fi
-
-ac_fn_c_check_type "$LINENO" "ssize_t" "ac_cv_type_ssize_t" "$ac_includes_default"
-if test "x$ac_cv_type_ssize_t" = xyes; then :
-
-else
-
-cat >>confdefs.h <<_ACEOF
-#define ssize_t int
-_ACEOF
-
-fi
-
-ac_fn_c_find_intX_t "$LINENO" "64" "ac_cv_c_int64_t"
-case $ac_cv_c_int64_t in #(
- no|yes) ;; #(
- *)
-
-cat >>confdefs.h <<_ACEOF
-#define int64_t $ac_cv_c_int64_t
-_ACEOF
-;;
-esac
-
-ac_fn_c_find_uintX_t "$LINENO" "8" "ac_cv_c_uint8_t"
-case $ac_cv_c_uint8_t in #(
- no|yes) ;; #(
- *)
-
-$as_echo "#define _UINT8_T 1" >>confdefs.h
-
-
-cat >>confdefs.h <<_ACEOF
-#define uint8_t $ac_cv_c_uint8_t
-_ACEOF
-;;
- esac
-
-ac_fn_c_find_uintX_t "$LINENO" "16" "ac_cv_c_uint16_t"
-case $ac_cv_c_uint16_t in #(
- no|yes) ;; #(
- *)
-
-
-cat >>confdefs.h <<_ACEOF
-#define uint16_t $ac_cv_c_uint16_t
-_ACEOF
-;;
- esac
-
-ac_fn_c_find_uintX_t "$LINENO" "32" "ac_cv_c_uint32_t"
-case $ac_cv_c_uint32_t in #(
- no|yes) ;; #(
- *)
-
-$as_echo "#define _UINT32_T 1" >>confdefs.h
-
-
-cat >>confdefs.h <<_ACEOF
-#define uint32_t $ac_cv_c_uint32_t
-_ACEOF
-;;
- esac
-
-ac_fn_c_find_uintX_t "$LINENO" "64" "ac_cv_c_uint64_t"
-case $ac_cv_c_uint64_t in #(
- no|yes) ;; #(
- *)
-
-$as_echo "#define _UINT64_T 1" >>confdefs.h
-
-
-cat >>confdefs.h <<_ACEOF
-#define uint64_t $ac_cv_c_uint64_t
-_ACEOF
-;;
- esac
-
-
-# Checks for library functions.
-for ac_func in dup2 gethostname getopt_long getpagesize \
- memset strdup strerror strtoul
-do :
- as_ac_var=`$as_echo "ac_cv_func_$ac_func" | $as_tr_sh`
-ac_fn_c_check_func "$LINENO" "$ac_func" "$as_ac_var"
-if eval test \"x\$"$as_ac_var"\" = x"yes"; then :
- cat >>confdefs.h <<_ACEOF
-#define `$as_echo "HAVE_$ac_func" | $as_tr_cpp` 1
-_ACEOF
-
-fi
-done
-
-for ac_header in vfork.h
-do :
- ac_fn_c_check_header_mongrel "$LINENO" "vfork.h" "ac_cv_header_vfork_h" "$ac_includes_default"
-if test "x$ac_cv_header_vfork_h" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_VFORK_H 1
-_ACEOF
-
-fi
-
-done
-
-for ac_func in fork vfork
-do :
- as_ac_var=`$as_echo "ac_cv_func_$ac_func" | $as_tr_sh`
-ac_fn_c_check_func "$LINENO" "$ac_func" "$as_ac_var"
-if eval test \"x\$"$as_ac_var"\" = x"yes"; then :
- cat >>confdefs.h <<_ACEOF
-#define `$as_echo "HAVE_$ac_func" | $as_tr_cpp` 1
-_ACEOF
-
-fi
-done
-
-if test "x$ac_cv_func_fork" = xyes; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for working fork" >&5
-$as_echo_n "checking for working fork... " >&6; }
-if ${ac_cv_func_fork_works+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test "$cross_compiling" = yes; then :
- ac_cv_func_fork_works=cross
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$ac_includes_default
-int
-main ()
-{
-
- /* By Ruediger Kuhlmann. */
- return fork () < 0;
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_run "$LINENO"; then :
- ac_cv_func_fork_works=yes
-else
- ac_cv_func_fork_works=no
-fi
-rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
- conftest.$ac_objext conftest.beam conftest.$ac_ext
-fi
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_func_fork_works" >&5
-$as_echo "$ac_cv_func_fork_works" >&6; }
-
-else
- ac_cv_func_fork_works=$ac_cv_func_fork
-fi
-if test "x$ac_cv_func_fork_works" = xcross; then
- case $host in
- *-*-amigaos* | *-*-msdosdjgpp*)
- # Override, as these systems have only a dummy fork() stub
- ac_cv_func_fork_works=no
- ;;
- *)
- ac_cv_func_fork_works=yes
- ;;
- esac
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: result $ac_cv_func_fork_works guessed because of cross compilation" >&5
-$as_echo "$as_me: WARNING: result $ac_cv_func_fork_works guessed because of cross compilation" >&2;}
-fi
-ac_cv_func_vfork_works=$ac_cv_func_vfork
-if test "x$ac_cv_func_vfork" = xyes; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for working vfork" >&5
-$as_echo_n "checking for working vfork... " >&6; }
-if ${ac_cv_func_vfork_works+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test "$cross_compiling" = yes; then :
- ac_cv_func_vfork_works=cross
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-/* Thanks to Paul Eggert for this test. */
-$ac_includes_default
-#include <sys/wait.h>
-#ifdef HAVE_VFORK_H
-# include <vfork.h>
-#endif
-/* On some sparc systems, changes by the child to local and incoming
- argument registers are propagated back to the parent. The compiler
- is told about this with #include <vfork.h>, but some compilers
- (e.g. gcc -O) don't grok <vfork.h>. Test for this by using a
- static variable whose address is put into a register that is
- clobbered by the vfork. */
-static void
-#ifdef __cplusplus
-sparc_address_test (int arg)
-# else
-sparc_address_test (arg) int arg;
-#endif
-{
- static pid_t child;
- if (!child) {
- child = vfork ();
- if (child < 0) {
- perror ("vfork");
- _exit(2);
- }
- if (!child) {
- arg = getpid();
- write(-1, "", 0);
- _exit (arg);
- }
- }
-}
-
-int
-main ()
-{
- pid_t parent = getpid ();
- pid_t child;
-
- sparc_address_test (0);
-
- child = vfork ();
-
- if (child == 0) {
- /* Here is another test for sparc vfork register problems. This
- test uses lots of local variables, at least as many local
- variables as main has allocated so far including compiler
- temporaries. 4 locals are enough for gcc 1.40.3 on a Solaris
- 4.1.3 sparc, but we use 8 to be safe. A buggy compiler should
- reuse the register of parent for one of the local variables,
- since it will think that parent can't possibly be used any more
- in this routine. Assigning to the local variable will thus
- munge parent in the parent process. */
- pid_t
- p = getpid(), p1 = getpid(), p2 = getpid(), p3 = getpid(),
- p4 = getpid(), p5 = getpid(), p6 = getpid(), p7 = getpid();
- /* Convince the compiler that p..p7 are live; otherwise, it might
- use the same hardware register for all 8 local variables. */
- if (p != p1 || p != p2 || p != p3 || p != p4
- || p != p5 || p != p6 || p != p7)
- _exit(1);
-
- /* On some systems (e.g. IRIX 3.3), vfork doesn't separate parent
- from child file descriptors. If the child closes a descriptor
- before it execs or exits, this munges the parent's descriptor
- as well. Test for this by closing stdout in the child. */
- _exit(close(fileno(stdout)) != 0);
- } else {
- int status;
- struct stat st;
-
- while (wait(&status) != child)
- ;
- return (
- /* Was there some problem with vforking? */
- child < 0
-
- /* Did the child fail? (This shouldn't happen.) */
- || status
-
- /* Did the vfork/compiler bug occur? */
- || parent != getpid()
-
- /* Did the file descriptor bug occur? */
- || fstat(fileno(stdout), &st) != 0
- );
- }
-}
-_ACEOF
-if ac_fn_c_try_run "$LINENO"; then :
- ac_cv_func_vfork_works=yes
-else
- ac_cv_func_vfork_works=no
-fi
-rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
- conftest.$ac_objext conftest.beam conftest.$ac_ext
-fi
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_func_vfork_works" >&5
-$as_echo "$ac_cv_func_vfork_works" >&6; }
-
-fi;
-if test "x$ac_cv_func_fork_works" = xcross; then
- ac_cv_func_vfork_works=$ac_cv_func_vfork
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: result $ac_cv_func_vfork_works guessed because of cross compilation" >&5
-$as_echo "$as_me: WARNING: result $ac_cv_func_vfork_works guessed because of cross compilation" >&2;}
-fi
-
-if test "x$ac_cv_func_vfork_works" = xyes; then
-
-$as_echo "#define HAVE_WORKING_VFORK 1" >>confdefs.h
-
-else
-
-$as_echo "#define vfork fork" >>confdefs.h
-
-fi
-if test "x$ac_cv_func_fork_works" = xyes; then
-
-$as_echo "#define HAVE_WORKING_FORK 1" >>confdefs.h
-
-fi
-
-for ac_header in stdlib.h
-do :
- ac_fn_c_check_header_mongrel "$LINENO" "stdlib.h" "ac_cv_header_stdlib_h" "$ac_includes_default"
-if test "x$ac_cv_header_stdlib_h" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_STDLIB_H 1
-_ACEOF
-
-fi
-
-done
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for GNU libc compatible malloc" >&5
-$as_echo_n "checking for GNU libc compatible malloc... " >&6; }
-if ${ac_cv_func_malloc_0_nonnull+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test "$cross_compiling" = yes; then :
- ac_cv_func_malloc_0_nonnull=no
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#if defined STDC_HEADERS || defined HAVE_STDLIB_H
-# include <stdlib.h>
-#else
-char *malloc ();
-#endif
-
-int
-main ()
-{
-return ! malloc (0);
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_run "$LINENO"; then :
- ac_cv_func_malloc_0_nonnull=yes
-else
- ac_cv_func_malloc_0_nonnull=no
-fi
-rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
- conftest.$ac_objext conftest.beam conftest.$ac_ext
-fi
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_func_malloc_0_nonnull" >&5
-$as_echo "$ac_cv_func_malloc_0_nonnull" >&6; }
-if test $ac_cv_func_malloc_0_nonnull = yes; then :
-
-$as_echo "#define HAVE_MALLOC 1" >>confdefs.h
-
-else
- $as_echo "#define HAVE_MALLOC 0" >>confdefs.h
-
- case " $LIBOBJS " in
- *" malloc.$ac_objext "* ) ;;
- *) LIBOBJS="$LIBOBJS malloc.$ac_objext"
- ;;
-esac
-
-
-$as_echo "#define malloc rpl_malloc" >>confdefs.h
-
-fi
-
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for working memcmp" >&5
-$as_echo_n "checking for working memcmp... " >&6; }
-if ${ac_cv_func_memcmp_working+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test "$cross_compiling" = yes; then :
- ac_cv_func_memcmp_working=no
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-$ac_includes_default
-int
-main ()
-{
-
- /* Some versions of memcmp are not 8-bit clean. */
- char c0 = '\100', c1 = '\200', c2 = '\201';
- if (memcmp(&c0, &c2, 1) >= 0 || memcmp(&c1, &c2, 1) >= 0)
- return 1;
-
- /* The Next x86 OpenStep bug shows up only when comparing 16 bytes
- or more and with at least one buffer not starting on a 4-byte boundary.
- William Lewis provided this test program. */
- {
- char foo[21];
- char bar[21];
- int i;
- for (i = 0; i < 4; i++)
- {
- char *a = foo + i;
- char *b = bar + i;
- strcpy (a, "--------01111111");
- strcpy (b, "--------10000000");
- if (memcmp (a, b, 16) >= 0)
- return 1;
- }
- return 0;
- }
-
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_run "$LINENO"; then :
- ac_cv_func_memcmp_working=yes
-else
- ac_cv_func_memcmp_working=no
-fi
-rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
- conftest.$ac_objext conftest.beam conftest.$ac_ext
-fi
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_func_memcmp_working" >&5
-$as_echo "$ac_cv_func_memcmp_working" >&6; }
-test $ac_cv_func_memcmp_working = no && case " $LIBOBJS " in
- *" memcmp.$ac_objext "* ) ;;
- *) LIBOBJS="$LIBOBJS memcmp.$ac_objext"
- ;;
-esac
-
-
-for ac_header in stdlib.h
-do :
- ac_fn_c_check_header_mongrel "$LINENO" "stdlib.h" "ac_cv_header_stdlib_h" "$ac_includes_default"
-if test "x$ac_cv_header_stdlib_h" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_STDLIB_H 1
-_ACEOF
-
-fi
-
-done
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for GNU libc compatible realloc" >&5
-$as_echo_n "checking for GNU libc compatible realloc... " >&6; }
-if ${ac_cv_func_realloc_0_nonnull+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- if test "$cross_compiling" = yes; then :
- ac_cv_func_realloc_0_nonnull=no
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#if defined STDC_HEADERS || defined HAVE_STDLIB_H
-# include <stdlib.h>
-#else
-char *realloc ();
-#endif
-
-int
-main ()
-{
-return ! realloc (0, 0);
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_run "$LINENO"; then :
- ac_cv_func_realloc_0_nonnull=yes
-else
- ac_cv_func_realloc_0_nonnull=no
-fi
-rm -f core *.core core.conftest.* gmon.out bb.out conftest$ac_exeext \
- conftest.$ac_objext conftest.beam conftest.$ac_ext
-fi
-
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_func_realloc_0_nonnull" >&5
-$as_echo "$ac_cv_func_realloc_0_nonnull" >&6; }
-if test $ac_cv_func_realloc_0_nonnull = yes; then :
-
-$as_echo "#define HAVE_REALLOC 1" >>confdefs.h
-
-else
- $as_echo "#define HAVE_REALLOC 0" >>confdefs.h
-
- case " $LIBOBJS " in
- *" realloc.$ac_objext "* ) ;;
- *) LIBOBJS="$LIBOBJS realloc.$ac_objext"
- ;;
-esac
-
-
-$as_echo "#define realloc rpl_realloc" >>confdefs.h
-
-fi
-
-
-if ${ac_cv_func_setvbuf_reversed+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_cv_func_setvbuf_reversed=no
-fi
-
-
-for ac_func in vprintf
-do :
- ac_fn_c_check_func "$LINENO" "vprintf" "ac_cv_func_vprintf"
-if test "x$ac_cv_func_vprintf" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_VPRINTF 1
-_ACEOF
-
-ac_fn_c_check_func "$LINENO" "_doprnt" "ac_cv_func__doprnt"
-if test "x$ac_cv_func__doprnt" = xyes; then :
-
-$as_echo "#define HAVE_DOPRNT 1" >>confdefs.h
-
-fi
-
-fi
-done
-
-
-
-# Checks for library constants.
-ac_fn_c_check_decl "$LINENO" "HOST_NAME_MAX" "ac_cv_have_decl_HOST_NAME_MAX" "#include <limits.h>
-"
-if test "x$ac_cv_have_decl_HOST_NAME_MAX" = xyes; then :
-
-else
-
-$as_echo "#define HOST_NAME_MAX _POSIX_HOST_NAME_MAX" >>confdefs.h
-
-fi
-
-
-# Options to configure.
-# Boost
-
-# Check whether --with-boost was given.
-if test "${with_boost+set}" = set; then :
- withval=$with_boost;
-fi
-
-if test "$with_boost" -a -d "$with_boost"; then
- boost_cppflags="-I$with_boost"
-fi
-# MPI
-
-# Check whether --with-mpi was given.
-if test "${with_mpi+set}" = set; then :
- withval=$with_mpi;
-fi
-
-if test "$with_mpi" -a -d "$with_mpi"; then
- mpi_cppflags="-I$with_mpi/include"
- mpi_ldflags="-L$with_mpi/lib"
-fi
-
-# Check whether --enable-mpich was given.
-if test "${enable_mpich+set}" = set; then :
- enableval=$enable_mpich;
-fi
-
-# Check whether --enable-lammpi was given.
-if test "${enable_lammpi+set}" = set; then :
- enableval=$enable_lammpi;
-fi
-
-
-# Check whether --enable-fm was given.
-if test "${enable_fm+set}" = set; then :
- enableval=$enable_fm;
-else
- enable_fm=64
-fi
-
-
-cat >>confdefs.h <<_ACEOF
-#define FMBITS $enable_fm
-_ACEOF
-
-
-# Check whether --enable-maxk was given.
-if test "${enable_maxk+set}" = set; then :
- enableval=$enable_maxk;
-else
- enable_maxk=64
-fi
-
-
-cat >>confdefs.h <<_ACEOF
-#define MAX_KMER $enable_maxk
-_ACEOF
-
-
-# Check whether --enable-samseqqual was given.
-if test "${enable_samseqqual+set}" = set; then :
- enableval=$enable_samseqqual;
-cat >>confdefs.h <<_ACEOF
-#define SAM_SEQ_QUAL 1
-_ACEOF
-
-fi
-
-
-# Set compiler flags.
-CPPFLAGS="-I$srcdir $boost_cppflags $mpi_cppflags $CPPFLAGS"
-
-LDFLAGS="$mpi_ldflags $LDFLAGS"
-
-
-# Check for the MPI parallel computing library.
-libs="$LIBS"
-
-$as_echo "#define MPICH_SKIP_MPICXX 1" >>confdefs.h
-
-
-$as_echo "#define OMPI_SKIP_MPICXX 1" >>confdefs.h
-
-for ac_header in mpi.h
-do :
- ac_fn_c_check_header_mongrel "$LINENO" "mpi.h" "ac_cv_header_mpi_h" "$ac_includes_default"
-if test "x$ac_cv_header_mpi_h" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_MPI_H 1
-_ACEOF
-
-fi
-
-done
-
-if test "$enable_mpich"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for pthread_create in -lpthread" >&5
-$as_echo_n "checking for pthread_create in -lpthread... " >&6; }
-if ${ac_cv_lib_pthread_pthread_create+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_check_lib_save_LIBS=$LIBS
-LIBS="-lpthread $LIBS"
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-/* Override any GCC internal prototype to avoid an error.
- Use char because int might match the return type of a GCC
- builtin and then its argument prototype would still apply. */
-#ifdef __cplusplus
-extern "C"
-#endif
-char pthread_create ();
-int
-main ()
-{
-return pthread_create ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_link "$LINENO"; then :
- ac_cv_lib_pthread_pthread_create=yes
-else
- ac_cv_lib_pthread_pthread_create=no
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-LIBS=$ac_check_lib_save_LIBS
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_pthread_pthread_create" >&5
-$as_echo "$ac_cv_lib_pthread_pthread_create" >&6; }
-if test "x$ac_cv_lib_pthread_pthread_create" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_LIBPTHREAD 1
-_ACEOF
-
- LIBS="-lpthread $LIBS"
-
-fi
-
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for MPL_env2int in -lmpl" >&5
-$as_echo_n "checking for MPL_env2int in -lmpl... " >&6; }
-if ${ac_cv_lib_mpl_MPL_env2int+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_check_lib_save_LIBS=$LIBS
-LIBS="-lmpl $LIBS"
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-/* Override any GCC internal prototype to avoid an error.
- Use char because int might match the return type of a GCC
- builtin and then its argument prototype would still apply. */
-#ifdef __cplusplus
-extern "C"
-#endif
-char MPL_env2int ();
-int
-main ()
-{
-return MPL_env2int ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_link "$LINENO"; then :
- ac_cv_lib_mpl_MPL_env2int=yes
-else
- ac_cv_lib_mpl_MPL_env2int=no
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-LIBS=$ac_check_lib_save_LIBS
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_mpl_MPL_env2int" >&5
-$as_echo "$ac_cv_lib_mpl_MPL_env2int" >&6; }
-if test "x$ac_cv_lib_mpl_MPL_env2int" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_LIBMPL 1
-_ACEOF
-
- LIBS="-lmpl $LIBS"
-
-fi
-
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for MPI_Init in -lmpich" >&5
-$as_echo_n "checking for MPI_Init in -lmpich... " >&6; }
-if ${ac_cv_lib_mpich_MPI_Init+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_check_lib_save_LIBS=$LIBS
-LIBS="-lmpich $LIBS"
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-/* Override any GCC internal prototype to avoid an error.
- Use char because int might match the return type of a GCC
- builtin and then its argument prototype would still apply. */
-#ifdef __cplusplus
-extern "C"
-#endif
-char MPI_Init ();
-int
-main ()
-{
-return MPI_Init ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_link "$LINENO"; then :
- ac_cv_lib_mpich_MPI_Init=yes
-else
- ac_cv_lib_mpich_MPI_Init=no
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-LIBS=$ac_check_lib_save_LIBS
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_mpich_MPI_Init" >&5
-$as_echo "$ac_cv_lib_mpich_MPI_Init" >&6; }
-if test "x$ac_cv_lib_mpich_MPI_Init" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_LIBMPICH 1
-_ACEOF
-
- LIBS="-lmpich $LIBS"
-
-fi
-
- ac_cv_lib_mpi_MPI_Init=$ac_cv_lib_mpich_MPI_Init
-elif test "$enable_lammpi"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for pthread_create in -lpthread" >&5
-$as_echo_n "checking for pthread_create in -lpthread... " >&6; }
-if ${ac_cv_lib_pthread_pthread_create+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_check_lib_save_LIBS=$LIBS
-LIBS="-lpthread $LIBS"
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-/* Override any GCC internal prototype to avoid an error.
- Use char because int might match the return type of a GCC
- builtin and then its argument prototype would still apply. */
-#ifdef __cplusplus
-extern "C"
-#endif
-char pthread_create ();
-int
-main ()
-{
-return pthread_create ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_link "$LINENO"; then :
- ac_cv_lib_pthread_pthread_create=yes
-else
- ac_cv_lib_pthread_pthread_create=no
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-LIBS=$ac_check_lib_save_LIBS
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_pthread_pthread_create" >&5
-$as_echo "$ac_cv_lib_pthread_pthread_create" >&6; }
-if test "x$ac_cv_lib_pthread_pthread_create" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_LIBPTHREAD 1
-_ACEOF
-
- LIBS="-lpthread $LIBS"
-
-fi
-
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for dlopen in -ldl" >&5
-$as_echo_n "checking for dlopen in -ldl... " >&6; }
-if ${ac_cv_lib_dl_dlopen+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_check_lib_save_LIBS=$LIBS
-LIBS="-ldl $LIBS"
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-/* Override any GCC internal prototype to avoid an error.
- Use char because int might match the return type of a GCC
- builtin and then its argument prototype would still apply. */
-#ifdef __cplusplus
-extern "C"
-#endif
-char dlopen ();
-int
-main ()
-{
-return dlopen ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_link "$LINENO"; then :
- ac_cv_lib_dl_dlopen=yes
-else
- ac_cv_lib_dl_dlopen=no
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-LIBS=$ac_check_lib_save_LIBS
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_dl_dlopen" >&5
-$as_echo "$ac_cv_lib_dl_dlopen" >&6; }
-if test "x$ac_cv_lib_dl_dlopen" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_LIBDL 1
-_ACEOF
-
- LIBS="-ldl $LIBS"
-
-fi
-
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for lam_mutex_lock in -llam" >&5
-$as_echo_n "checking for lam_mutex_lock in -llam... " >&6; }
-if ${ac_cv_lib_lam_lam_mutex_lock+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_check_lib_save_LIBS=$LIBS
-LIBS="-llam $LIBS"
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-/* Override any GCC internal prototype to avoid an error.
- Use char because int might match the return type of a GCC
- builtin and then its argument prototype would still apply. */
-#ifdef __cplusplus
-extern "C"
-#endif
-char lam_mutex_lock ();
-int
-main ()
-{
-return lam_mutex_lock ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_link "$LINENO"; then :
- ac_cv_lib_lam_lam_mutex_lock=yes
-else
- ac_cv_lib_lam_lam_mutex_lock=no
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-LIBS=$ac_check_lib_save_LIBS
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_lam_lam_mutex_lock" >&5
-$as_echo "$ac_cv_lib_lam_lam_mutex_lock" >&6; }
-if test "x$ac_cv_lib_lam_lam_mutex_lock" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_LIBLAM 1
-_ACEOF
-
- LIBS="-llam $LIBS"
-
-fi
-
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for MPI_Init in -lmpi" >&5
-$as_echo_n "checking for MPI_Init in -lmpi... " >&6; }
-if ${ac_cv_lib_mpi_MPI_Init+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_check_lib_save_LIBS=$LIBS
-LIBS="-lmpi $LIBS"
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-/* Override any GCC internal prototype to avoid an error.
- Use char because int might match the return type of a GCC
- builtin and then its argument prototype would still apply. */
-#ifdef __cplusplus
-extern "C"
-#endif
-char MPI_Init ();
-int
-main ()
-{
-return MPI_Init ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_link "$LINENO"; then :
- ac_cv_lib_mpi_MPI_Init=yes
-else
- ac_cv_lib_mpi_MPI_Init=no
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-LIBS=$ac_check_lib_save_LIBS
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_mpi_MPI_Init" >&5
-$as_echo "$ac_cv_lib_mpi_MPI_Init" >&6; }
-if test "x$ac_cv_lib_mpi_MPI_Init" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_LIBMPI 1
-_ACEOF
-
- LIBS="-lmpi $LIBS"
-
-fi
-
- ac_ext=cpp
-ac_cpp='$CXXCPP $CPPFLAGS'
-ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
-
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for main in -llammpi++" >&5
-$as_echo_n "checking for main in -llammpi++... " >&6; }
-if ${ac_cv_lib_lammpipp_main+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_check_lib_save_LIBS=$LIBS
-LIBS="-llammpi++ $LIBS"
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-
-int
-main ()
-{
-return main ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_cxx_try_link "$LINENO"; then :
- ac_cv_lib_lammpipp_main=yes
-else
- ac_cv_lib_lammpipp_main=no
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-LIBS=$ac_check_lib_save_LIBS
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_lammpipp_main" >&5
-$as_echo "$ac_cv_lib_lammpipp_main" >&6; }
-if test "x$ac_cv_lib_lammpipp_main" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_LIBLAMMPI__ 1
-_ACEOF
-
- LIBS="-llammpi++ $LIBS"
-
-fi
-
- ac_ext=c
-ac_cpp='$CPP $CPPFLAGS'
-ac_compile='$CC -c $CFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CC -o conftest$ac_exeext $CFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_c_compiler_gnu
-
-else
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for MPI_Init in -lmpi" >&5
-$as_echo_n "checking for MPI_Init in -lmpi... " >&6; }
-if ${ac_cv_lib_mpi_MPI_Init+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_check_lib_save_LIBS=$LIBS
-LIBS="-lmpi $LIBS"
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-/* Override any GCC internal prototype to avoid an error.
- Use char because int might match the return type of a GCC
- builtin and then its argument prototype would still apply. */
-#ifdef __cplusplus
-extern "C"
-#endif
-char MPI_Init ();
-int
-main ()
-{
-return MPI_Init ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_link "$LINENO"; then :
- ac_cv_lib_mpi_MPI_Init=yes
-else
- ac_cv_lib_mpi_MPI_Init=no
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-LIBS=$ac_check_lib_save_LIBS
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_mpi_MPI_Init" >&5
-$as_echo "$ac_cv_lib_mpi_MPI_Init" >&6; }
-if test "x$ac_cv_lib_mpi_MPI_Init" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_LIBMPI 1
-_ACEOF
-
- LIBS="-lmpi $LIBS"
-
-fi
-
-fi
- if test $ac_cv_header_mpi_h = yes -a $ac_cv_lib_mpi_MPI_Init = yes; then
- HAVE_LIBMPI_TRUE=
- HAVE_LIBMPI_FALSE='#'
-else
- HAVE_LIBMPI_TRUE='#'
- HAVE_LIBMPI_FALSE=
-fi
-
-MPI_LIBS="$LIBS"
-
-
-# Check for the math library.
-LIBS="$libs"
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for sqrt in -lm" >&5
-$as_echo_n "checking for sqrt in -lm... " >&6; }
-if ${ac_cv_lib_m_sqrt+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_check_lib_save_LIBS=$LIBS
-LIBS="-lm $LIBS"
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-/* Override any GCC internal prototype to avoid an error.
- Use char because int might match the return type of a GCC
- builtin and then its argument prototype would still apply. */
-#ifdef __cplusplus
-extern "C"
-#endif
-char sqrt ();
-int
-main ()
-{
-return sqrt ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_link "$LINENO"; then :
- ac_cv_lib_m_sqrt=yes
-else
- ac_cv_lib_m_sqrt=no
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-LIBS=$ac_check_lib_save_LIBS
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_m_sqrt" >&5
-$as_echo "$ac_cv_lib_m_sqrt" >&6; }
-if test "x$ac_cv_lib_m_sqrt" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_LIBM 1
-_ACEOF
-
- LIBS="-lm $LIBS"
-
-fi
-
-for ac_func in pow sqrt
-do :
- as_ac_var=`$as_echo "ac_cv_func_$ac_func" | $as_tr_sh`
-ac_fn_c_check_func "$LINENO" "$ac_func" "$as_ac_var"
-if eval test \"x\$"$as_ac_var"\" = x"yes"; then :
- cat >>confdefs.h <<_ACEOF
-#define `$as_echo "HAVE_$ac_func" | $as_tr_cpp` 1
-_ACEOF
-
-fi
-done
-
-ac_fn_c_check_func "$LINENO" "ceilf" "ac_cv_func_ceilf"
-if test "x$ac_cv_func_ceilf" = xyes; then :
-
-else
-
-$as_echo "#define ceilf ceil" >>confdefs.h
-
-fi
-
-
-# Check for the dynamic linking library.
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking for dlsym in -ldl" >&5
-$as_echo_n "checking for dlsym in -ldl... " >&6; }
-if ${ac_cv_lib_dl_dlsym+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- ac_check_lib_save_LIBS=$LIBS
-LIBS="-ldl $LIBS"
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-/* Override any GCC internal prototype to avoid an error.
- Use char because int might match the return type of a GCC
- builtin and then its argument prototype would still apply. */
-#ifdef __cplusplus
-extern "C"
-#endif
-char dlsym ();
-int
-main ()
-{
-return dlsym ();
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_link "$LINENO"; then :
- ac_cv_lib_dl_dlsym=yes
-else
- ac_cv_lib_dl_dlsym=no
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-LIBS=$ac_check_lib_save_LIBS
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_lib_dl_dlsym" >&5
-$as_echo "$ac_cv_lib_dl_dlsym" >&6; }
-if test "x$ac_cv_lib_dl_dlsym" = xyes; then :
- cat >>confdefs.h <<_ACEOF
-#define HAVE_LIBDL 1
-_ACEOF
-
- LIBS="-ldl $LIBS"
-
-fi
-
-
-# Check for popcnt instruction.
-cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <stdint.h>,
- uint64_t x = 0;
-int
-main ()
-{
-__asm__("popcnt %1,%0" : "=r" (x) : "r" (x));
- ;
- return 0;
-}
-_ACEOF
-if ac_fn_c_try_compile "$LINENO"; then :
-
-$as_echo "#define HAVE_POPCNT 1" >>confdefs.h
-
-else
-
-$as_echo "#define HAVE_POPCNT 0" >>confdefs.h
-
-fi
-rm -f core conftest.err conftest.$ac_objext conftest.$ac_ext
-
-# Check for the hash table implementation.
-ac_ext=cpp
-ac_cpp='$CXXCPP $CPPFLAGS'
-ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
-
-ac_ext=cpp
-ac_cpp='$CXXCPP $CPPFLAGS'
-ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking how to run the C++ preprocessor" >&5
-$as_echo_n "checking how to run the C++ preprocessor... " >&6; }
-if test -z "$CXXCPP"; then
- if ${ac_cv_prog_CXXCPP+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- # Double quotes because CXXCPP needs to be expanded
- for CXXCPP in "$CXX -E" "/lib/cpp"
- do
- ac_preproc_ok=false
-for ac_cxx_preproc_warn_flag in '' yes
-do
- # Use a header file that comes with gcc, so configuring glibc
- # with a fresh cross-compiler works.
- # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
- # <limits.h> exists even on freestanding compilers.
- # On the NeXT, cc -E runs the code through the compiler's parser,
- # not just through cpp. "Syntax error" is here to catch this case.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#ifdef __STDC__
-# include <limits.h>
-#else
-# include <assert.h>
-#endif
- Syntax error
-_ACEOF
-if ac_fn_cxx_try_cpp "$LINENO"; then :
-
-else
- # Broken: fails on valid input.
-continue
-fi
-rm -f conftest.err conftest.i conftest.$ac_ext
-
- # OK, works on sane cases. Now check whether nonexistent headers
- # can be detected and how.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <ac_nonexistent.h>
-_ACEOF
-if ac_fn_cxx_try_cpp "$LINENO"; then :
- # Broken: success on invalid input.
-continue
-else
- # Passes both tests.
-ac_preproc_ok=:
-break
-fi
-rm -f conftest.err conftest.i conftest.$ac_ext
-
-done
-# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
-rm -f conftest.i conftest.err conftest.$ac_ext
-if $ac_preproc_ok; then :
- break
-fi
-
- done
- ac_cv_prog_CXXCPP=$CXXCPP
-
-fi
- CXXCPP=$ac_cv_prog_CXXCPP
-else
- ac_cv_prog_CXXCPP=$CXXCPP
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $CXXCPP" >&5
-$as_echo "$CXXCPP" >&6; }
-ac_preproc_ok=false
-for ac_cxx_preproc_warn_flag in '' yes
-do
- # Use a header file that comes with gcc, so configuring glibc
- # with a fresh cross-compiler works.
- # Prefer <limits.h> to <assert.h> if __STDC__ is defined, since
- # <limits.h> exists even on freestanding compilers.
- # On the NeXT, cc -E runs the code through the compiler's parser,
- # not just through cpp. "Syntax error" is here to catch this case.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#ifdef __STDC__
-# include <limits.h>
-#else
-# include <assert.h>
-#endif
- Syntax error
-_ACEOF
-if ac_fn_cxx_try_cpp "$LINENO"; then :
-
-else
- # Broken: fails on valid input.
-continue
-fi
-rm -f conftest.err conftest.i conftest.$ac_ext
-
- # OK, works on sane cases. Now check whether nonexistent headers
- # can be detected and how.
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-#include <ac_nonexistent.h>
-_ACEOF
-if ac_fn_cxx_try_cpp "$LINENO"; then :
- # Broken: success on invalid input.
-continue
-else
- # Passes both tests.
-ac_preproc_ok=:
-break
-fi
-rm -f conftest.err conftest.i conftest.$ac_ext
-
-done
-# Because of `break', _AC_PREPROC_IFELSE's cleaning code was skipped.
-rm -f conftest.i conftest.err conftest.$ac_ext
-if $ac_preproc_ok; then :
-
-else
- { { $as_echo "$as_me:${as_lineno-$LINENO}: error: in \`$ac_pwd':" >&5
-$as_echo "$as_me: error: in \`$ac_pwd':" >&2;}
-as_fn_error $? "C++ preprocessor \"$CXXCPP\" fails sanity check
-See \`config.log' for more details" "$LINENO" 5; }
-fi
-
-ac_ext=cpp
-ac_cpp='$CXXCPP $CPPFLAGS'
-ac_compile='$CXX -c $CXXFLAGS $CPPFLAGS conftest.$ac_ext >&5'
-ac_link='$CXX -o conftest$ac_exeext $CXXFLAGS $CPPFLAGS $LDFLAGS conftest.$ac_ext $LIBS >&5'
-ac_compiler_gnu=$ac_cv_cxx_compiler_gnu
-
-
-for ac_header in \
- boost/property_map/property_map.hpp \
- google/sparse_hash_map \
- unordered_map tr1/unordered_map \
-
-do :
- as_ac_Header=`$as_echo "ac_cv_header_$ac_header" | $as_tr_sh`
-ac_fn_cxx_check_header_mongrel "$LINENO" "$ac_header" "$as_ac_Header" "$ac_includes_default"
-if eval test \"x\$"$as_ac_Header"\" = x"yes"; then :
- cat >>confdefs.h <<_ACEOF
-#define `$as_echo "HAVE_$ac_header" | $as_tr_cpp` 1
-_ACEOF
-
-fi
-
-done
-
-
-# Check for Boost.
-if test $ac_cv_header_boost_property_map_property_map_hpp != yes; then
- as_fn_error $? "ABySS requires the Boost C++ libraries, which may
- be downloaded from here: http://www.boost.org/users/download/
- It is not necessary to compile Boost before installing it. The
- following commands will download and install Boost for ABySS:
- wget http://downloads.sourceforge.net/project/boost/boost/1.50.0/boost_1_50_0.tar.bz2
- tar jxf boost_1_50_0.tar.bz2
- ln -s boost_1_50_0/boost boost
- " "$LINENO" 5
-fi
-
-# Check for OpenMP.
-
- OPENMP_CXXFLAGS=
- # Check whether --enable-openmp was given.
-if test "${enable_openmp+set}" = set; then :
- enableval=$enable_openmp;
-fi
-
- if test "$enable_openmp" != no; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: checking for $CXX option to support OpenMP" >&5
-$as_echo_n "checking for $CXX option to support OpenMP... " >&6; }
-if ${ac_cv_prog_cxx_openmp+:} false; then :
- $as_echo_n "(cached) " >&6
-else
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-#ifndef _OPENMP
- choke me
-#endif
-#include <omp.h>
-int main () { return omp_get_num_threads (); }
-
-_ACEOF
-if ac_fn_cxx_try_link "$LINENO"; then :
- ac_cv_prog_cxx_openmp='none needed'
-else
- ac_cv_prog_cxx_openmp='unsupported'
- for ac_option in -fopenmp -xopenmp -openmp -mp -omp -qsmp=omp -homp \
- -Popenmp --openmp; do
- ac_save_CXXFLAGS=$CXXFLAGS
- CXXFLAGS="$CXXFLAGS $ac_option"
- cat confdefs.h - <<_ACEOF >conftest.$ac_ext
-/* end confdefs.h. */
-
-#ifndef _OPENMP
- choke me
-#endif
-#include <omp.h>
-int main () { return omp_get_num_threads (); }
-
-_ACEOF
-if ac_fn_cxx_try_link "$LINENO"; then :
- ac_cv_prog_cxx_openmp=$ac_option
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
- CXXFLAGS=$ac_save_CXXFLAGS
- if test "$ac_cv_prog_cxx_openmp" != unsupported; then
- break
- fi
- done
-fi
-rm -f core conftest.err conftest.$ac_objext \
- conftest$ac_exeext conftest.$ac_ext
-fi
-{ $as_echo "$as_me:${as_lineno-$LINENO}: result: $ac_cv_prog_cxx_openmp" >&5
-$as_echo "$ac_cv_prog_cxx_openmp" >&6; }
- case $ac_cv_prog_cxx_openmp in #(
- "none needed" | unsupported)
- ;; #(
- *)
- OPENMP_CXXFLAGS=$ac_cv_prog_cxx_openmp ;;
- esac
- fi
-
-
-if test -z $OPENMP_CXXFLAGS; then
- OPENMP_CXXFLAGS=-Wno-unknown-pragmas
-fi
-
-# Set compiler flags.
-AM_CXXFLAGS='-Wall -Wextra -Werror'
-
-
-ac_config_files="$ac_config_files Makefile ABYSS/Makefile Align/Makefile Assembly/Makefile Common/Makefile DataLayer/Makefile FMIndex/Makefile Graph/Makefile Parallel/Makefile bin/Makefile doc/Makefile dialign/Makefile kmerprint/Makefile AdjList/Makefile DAssembler/Makefile DistanceEst/Makefile Layout/Makefile Map/Makefile Misc/Makefile Overlap/Makefile PopBubbles/Makefile Scaffold/Makefile SimpleGraph/Makefile MergePaths/Makefile KAligner/Makefile ParseAligns/Makefile PathOverlap/Makefi [...]
-
-cat >confcache <<\_ACEOF
-# This file is a shell script that caches the results of configure
-# tests run on this system so they can be shared between configure
-# scripts and configure runs, see configure's option --config-cache.
-# It is not useful on other systems. If it contains results you don't
-# want to keep, you may remove or edit it.
-#
-# config.status only pays attention to the cache file if you give it
-# the --recheck option to rerun configure.
-#
-# `ac_cv_env_foo' variables (set or unset) will be overridden when
-# loading this file, other *unset* `ac_cv_foo' will be assigned the
-# following values.
-
-_ACEOF
-
-# The following way of writing the cache mishandles newlines in values,
-# but we know of no workaround that is simple, portable, and efficient.
-# So, we kill variables containing newlines.
-# Ultrix sh set writes to stderr and can't be redirected directly,
-# and sets the high bit in the cache file unless we assign to the vars.
-(
- for ac_var in `(set) 2>&1 | sed -n 's/^\([a-zA-Z_][a-zA-Z0-9_]*\)=.*/\1/p'`; do
- eval ac_val=\$$ac_var
- case $ac_val in #(
- *${as_nl}*)
- case $ac_var in #(
- *_cv_*) { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: cache variable $ac_var contains a newline" >&5
-$as_echo "$as_me: WARNING: cache variable $ac_var contains a newline" >&2;} ;;
- esac
- case $ac_var in #(
- _ | IFS | as_nl) ;; #(
- BASH_ARGV | BASH_SOURCE) eval $ac_var= ;; #(
- *) { eval $ac_var=; unset $ac_var;} ;;
- esac ;;
- esac
- done
-
- (set) 2>&1 |
- case $as_nl`(ac_space=' '; set) 2>&1` in #(
- *${as_nl}ac_space=\ *)
- # `set' does not quote correctly, so add quotes: double-quote
- # substitution turns \\\\ into \\, and sed turns \\ into \.
- sed -n \
- "s/'/'\\\\''/g;
- s/^\\([_$as_cr_alnum]*_cv_[_$as_cr_alnum]*\\)=\\(.*\\)/\\1='\\2'/p"
- ;; #(
- *)
- # `set' quotes correctly as required by POSIX, so do not add quotes.
- sed -n "/^[_$as_cr_alnum]*_cv_[_$as_cr_alnum]*=/p"
- ;;
- esac |
- sort
-) |
- sed '
- /^ac_cv_env_/b end
- t clear
- :clear
- s/^\([^=]*\)=\(.*[{}].*\)$/test "${\1+set}" = set || &/
- t end
- s/^\([^=]*\)=\(.*\)$/\1=${\1=\2}/
- :end' >>confcache
-if diff "$cache_file" confcache >/dev/null 2>&1; then :; else
- if test -w "$cache_file"; then
- if test "x$cache_file" != "x/dev/null"; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: updating cache $cache_file" >&5
-$as_echo "$as_me: updating cache $cache_file" >&6;}
- if test ! -f "$cache_file" || test -h "$cache_file"; then
- cat confcache >"$cache_file"
- else
- case $cache_file in #(
- */* | ?:*)
- mv -f confcache "$cache_file"$$ &&
- mv -f "$cache_file"$$ "$cache_file" ;; #(
- *)
- mv -f confcache "$cache_file" ;;
- esac
- fi
- fi
- else
- { $as_echo "$as_me:${as_lineno-$LINENO}: not updating unwritable cache $cache_file" >&5
-$as_echo "$as_me: not updating unwritable cache $cache_file" >&6;}
- fi
-fi
-rm -f confcache
-
-test "x$prefix" = xNONE && prefix=$ac_default_prefix
-# Let make expand exec_prefix.
-test "x$exec_prefix" = xNONE && exec_prefix='${prefix}'
-
-DEFS=-DHAVE_CONFIG_H
-
-ac_libobjs=
-ac_ltlibobjs=
-U=
-for ac_i in : $LIBOBJS; do test "x$ac_i" = x: && continue
- # 1. Remove the extension, and $U if already installed.
- ac_script='s/\$U\././;s/\.o$//;s/\.obj$//'
- ac_i=`$as_echo "$ac_i" | sed "$ac_script"`
- # 2. Prepend LIBOBJDIR. When used with automake>=1.10 LIBOBJDIR
- # will be set to the directory where LIBOBJS objects are built.
- as_fn_append ac_libobjs " \${LIBOBJDIR}$ac_i\$U.$ac_objext"
- as_fn_append ac_ltlibobjs " \${LIBOBJDIR}$ac_i"'$U.lo'
-done
-LIBOBJS=$ac_libobjs
-
-LTLIBOBJS=$ac_ltlibobjs
-
-
-{ $as_echo "$as_me:${as_lineno-$LINENO}: checking that generated files are newer than configure" >&5
-$as_echo_n "checking that generated files are newer than configure... " >&6; }
- if test -n "$am_sleep_pid"; then
- # Hide warnings about reused PIDs.
- wait $am_sleep_pid 2>/dev/null
- fi
- { $as_echo "$as_me:${as_lineno-$LINENO}: result: done" >&5
-$as_echo "done" >&6; }
- if test -n "$EXEEXT"; then
- am__EXEEXT_TRUE=
- am__EXEEXT_FALSE='#'
-else
- am__EXEEXT_TRUE='#'
- am__EXEEXT_FALSE=
-fi
-
-if test -z "${AMDEP_TRUE}" && test -z "${AMDEP_FALSE}"; then
- as_fn_error $? "conditional \"AMDEP\" was never defined.
-Usually this means the macro was only invoked conditionally." "$LINENO" 5
-fi
-if test -z "${am__fastdepCC_TRUE}" && test -z "${am__fastdepCC_FALSE}"; then
- as_fn_error $? "conditional \"am__fastdepCC\" was never defined.
-Usually this means the macro was only invoked conditionally." "$LINENO" 5
-fi
-if test -z "${am__fastdepCXX_TRUE}" && test -z "${am__fastdepCXX_FALSE}"; then
- as_fn_error $? "conditional \"am__fastdepCXX\" was never defined.
-Usually this means the macro was only invoked conditionally." "$LINENO" 5
-fi
-if test -z "${HAVE_GHC_TRUE}" && test -z "${HAVE_GHC_FALSE}"; then
- as_fn_error $? "conditional \"HAVE_GHC\" was never defined.
-Usually this means the macro was only invoked conditionally." "$LINENO" 5
-fi
-
-if test -z "${HAVE_LIBMPI_TRUE}" && test -z "${HAVE_LIBMPI_FALSE}"; then
- as_fn_error $? "conditional \"HAVE_LIBMPI\" was never defined.
-Usually this means the macro was only invoked conditionally." "$LINENO" 5
-fi
-
-: "${CONFIG_STATUS=./config.status}"
-ac_write_fail=0
-ac_clean_files_save=$ac_clean_files
-ac_clean_files="$ac_clean_files $CONFIG_STATUS"
-{ $as_echo "$as_me:${as_lineno-$LINENO}: creating $CONFIG_STATUS" >&5
-$as_echo "$as_me: creating $CONFIG_STATUS" >&6;}
-as_write_fail=0
-cat >$CONFIG_STATUS <<_ASEOF || as_write_fail=1
-#! $SHELL
-# Generated by $as_me.
-# Run this file to recreate the current configuration.
-# Compiler output produced by configure, useful for debugging
-# configure, is in config.log if it exists.
-
-debug=false
-ac_cs_recheck=false
-ac_cs_silent=false
-
-SHELL=\${CONFIG_SHELL-$SHELL}
-export SHELL
-_ASEOF
-cat >>$CONFIG_STATUS <<\_ASEOF || as_write_fail=1
-## -------------------- ##
-## M4sh Initialization. ##
-## -------------------- ##
-
-# Be more Bourne compatible
-DUALCASE=1; export DUALCASE # for MKS sh
-if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then :
- emulate sh
- NULLCMD=:
- # Pre-4.2 versions of Zsh do word splitting on ${1+"$@"}, which
- # is contrary to our usage. Disable this feature.
- alias -g '${1+"$@"}'='"$@"'
- setopt NO_GLOB_SUBST
-else
- case `(set -o) 2>/dev/null` in #(
- *posix*) :
- set -o posix ;; #(
- *) :
- ;;
-esac
-fi
-
-
-as_nl='
-'
-export as_nl
-# Printing a long string crashes Solaris 7 /usr/bin/printf.
-as_echo='\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\'
-as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo
-as_echo=$as_echo$as_echo$as_echo$as_echo$as_echo$as_echo
-# Prefer a ksh shell builtin over an external printf program on Solaris,
-# but without wasting forks for bash or zsh.
-if test -z "$BASH_VERSION$ZSH_VERSION" \
- && (test "X`print -r -- $as_echo`" = "X$as_echo") 2>/dev/null; then
- as_echo='print -r --'
- as_echo_n='print -rn --'
-elif (test "X`printf %s $as_echo`" = "X$as_echo") 2>/dev/null; then
- as_echo='printf %s\n'
- as_echo_n='printf %s'
-else
- if test "X`(/usr/ucb/echo -n -n $as_echo) 2>/dev/null`" = "X-n $as_echo"; then
- as_echo_body='eval /usr/ucb/echo -n "$1$as_nl"'
- as_echo_n='/usr/ucb/echo -n'
- else
- as_echo_body='eval expr "X$1" : "X\\(.*\\)"'
- as_echo_n_body='eval
- arg=$1;
- case $arg in #(
- *"$as_nl"*)
- expr "X$arg" : "X\\(.*\\)$as_nl";
- arg=`expr "X$arg" : ".*$as_nl\\(.*\\)"`;;
- esac;
- expr "X$arg" : "X\\(.*\\)" | tr -d "$as_nl"
- '
- export as_echo_n_body
- as_echo_n='sh -c $as_echo_n_body as_echo'
- fi
- export as_echo_body
- as_echo='sh -c $as_echo_body as_echo'
-fi
-
-# The user is always right.
-if test "${PATH_SEPARATOR+set}" != set; then
- PATH_SEPARATOR=:
- (PATH='/bin;/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 && {
- (PATH='/bin:/bin'; FPATH=$PATH; sh -c :) >/dev/null 2>&1 ||
- PATH_SEPARATOR=';'
- }
-fi
-
-
-# IFS
-# We need space, tab and new line, in precisely that order. Quoting is
-# there to prevent editors from complaining about space-tab.
-# (If _AS_PATH_WALK were called with IFS unset, it would disable word
-# splitting by setting IFS to empty value.)
-IFS=" "" $as_nl"
-
-# Find who we are. Look in the path if we contain no directory separator.
-as_myself=
-case $0 in #((
- *[\\/]* ) as_myself=$0 ;;
- *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR
-for as_dir in $PATH
-do
- IFS=$as_save_IFS
- test -z "$as_dir" && as_dir=.
- test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break
- done
-IFS=$as_save_IFS
-
- ;;
-esac
-# We did not find ourselves, most probably we were run as `sh COMMAND'
-# in which case we are not to be found in the path.
-if test "x$as_myself" = x; then
- as_myself=$0
-fi
-if test ! -f "$as_myself"; then
- $as_echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2
- exit 1
-fi
-
-# Unset variables that we do not need and which cause bugs (e.g. in
-# pre-3.0 UWIN ksh). But do not cause bugs in bash 2.01; the "|| exit 1"
-# suppresses any "Segmentation fault" message there. '((' could
-# trigger a bug in pdksh 5.2.14.
-for as_var in BASH_ENV ENV MAIL MAILPATH
-do eval test x\${$as_var+set} = xset \
- && ( (unset $as_var) || exit 1) >/dev/null 2>&1 && unset $as_var || :
-done
-PS1='$ '
-PS2='> '
-PS4='+ '
-
-# NLS nuisances.
-LC_ALL=C
-export LC_ALL
-LANGUAGE=C
-export LANGUAGE
-
-# CDPATH.
-(unset CDPATH) >/dev/null 2>&1 && unset CDPATH
-
-
-# as_fn_error STATUS ERROR [LINENO LOG_FD]
-# ----------------------------------------
-# Output "`basename $0`: error: ERROR" to stderr. If LINENO and LOG_FD are
-# provided, also output the error to LOG_FD, referencing LINENO. Then exit the
-# script with STATUS, using 1 if that was 0.
-as_fn_error ()
-{
- as_status=$1; test $as_status -eq 0 && as_status=1
- if test "$4"; then
- as_lineno=${as_lineno-"$3"} as_lineno_stack=as_lineno_stack=$as_lineno_stack
- $as_echo "$as_me:${as_lineno-$LINENO}: error: $2" >&$4
- fi
- $as_echo "$as_me: error: $2" >&2
- as_fn_exit $as_status
-} # as_fn_error
-
-
-# as_fn_set_status STATUS
-# -----------------------
-# Set $? to STATUS, without forking.
-as_fn_set_status ()
-{
- return $1
-} # as_fn_set_status
-
-# as_fn_exit STATUS
-# -----------------
-# Exit the shell with STATUS, even in a "trap 0" or "set -e" context.
-as_fn_exit ()
-{
- set +e
- as_fn_set_status $1
- exit $1
-} # as_fn_exit
-
-# as_fn_unset VAR
-# ---------------
-# Portably unset VAR.
-as_fn_unset ()
-{
- { eval $1=; unset $1;}
-}
-as_unset=as_fn_unset
-# as_fn_append VAR VALUE
-# ----------------------
-# Append the text in VALUE to the end of the definition contained in VAR. Take
-# advantage of any shell optimizations that allow amortized linear growth over
-# repeated appends, instead of the typical quadratic growth present in naive
-# implementations.
-if (eval "as_var=1; as_var+=2; test x\$as_var = x12") 2>/dev/null; then :
- eval 'as_fn_append ()
- {
- eval $1+=\$2
- }'
-else
- as_fn_append ()
- {
- eval $1=\$$1\$2
- }
-fi # as_fn_append
-
-# as_fn_arith ARG...
-# ------------------
-# Perform arithmetic evaluation on the ARGs, and store the result in the
-# global $as_val. Take advantage of shells that can avoid forks. The arguments
-# must be portable across $(()) and expr.
-if (eval "test \$(( 1 + 1 )) = 2") 2>/dev/null; then :
- eval 'as_fn_arith ()
- {
- as_val=$(( $* ))
- }'
-else
- as_fn_arith ()
- {
- as_val=`expr "$@" || test $? -eq 1`
- }
-fi # as_fn_arith
-
-
-if expr a : '\(a\)' >/dev/null 2>&1 &&
- test "X`expr 00001 : '.*\(...\)'`" = X001; then
- as_expr=expr
-else
- as_expr=false
-fi
-
-if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then
- as_basename=basename
-else
- as_basename=false
-fi
-
-if (as_dir=`dirname -- /` && test "X$as_dir" = X/) >/dev/null 2>&1; then
- as_dirname=dirname
-else
- as_dirname=false
-fi
-
-as_me=`$as_basename -- "$0" ||
-$as_expr X/"$0" : '.*/\([^/][^/]*\)/*$' \| \
- X"$0" : 'X\(//\)$' \| \
- X"$0" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X/"$0" |
- sed '/^.*\/\([^/][^/]*\)\/*$/{
- s//\1/
- q
- }
- /^X\/\(\/\/\)$/{
- s//\1/
- q
- }
- /^X\/\(\/\).*/{
- s//\1/
- q
- }
- s/.*/./; q'`
-
-# Avoid depending upon Character Ranges.
-as_cr_letters='abcdefghijklmnopqrstuvwxyz'
-as_cr_LETTERS='ABCDEFGHIJKLMNOPQRSTUVWXYZ'
-as_cr_Letters=$as_cr_letters$as_cr_LETTERS
-as_cr_digits='0123456789'
-as_cr_alnum=$as_cr_Letters$as_cr_digits
-
-ECHO_C= ECHO_N= ECHO_T=
-case `echo -n x` in #(((((
--n*)
- case `echo 'xy\c'` in
- *c*) ECHO_T=' ';; # ECHO_T is single tab character.
- xy) ECHO_C='\c';;
- *) echo `echo ksh88 bug on AIX 6.1` > /dev/null
- ECHO_T=' ';;
- esac;;
-*)
- ECHO_N='-n';;
-esac
-
-rm -f conf$$ conf$$.exe conf$$.file
-if test -d conf$$.dir; then
- rm -f conf$$.dir/conf$$.file
-else
- rm -f conf$$.dir
- mkdir conf$$.dir 2>/dev/null
-fi
-if (echo >conf$$.file) 2>/dev/null; then
- if ln -s conf$$.file conf$$ 2>/dev/null; then
- as_ln_s='ln -s'
- # ... but there are two gotchas:
- # 1) On MSYS, both `ln -s file dir' and `ln file dir' fail.
- # 2) DJGPP < 2.04 has no symlinks; `ln -s' creates a wrapper executable.
- # In both cases, we have to default to `cp -pR'.
- ln -s conf$$.file conf$$.dir 2>/dev/null && test ! -f conf$$.exe ||
- as_ln_s='cp -pR'
- elif ln conf$$.file conf$$ 2>/dev/null; then
- as_ln_s=ln
- else
- as_ln_s='cp -pR'
- fi
-else
- as_ln_s='cp -pR'
-fi
-rm -f conf$$ conf$$.exe conf$$.dir/conf$$.file conf$$.file
-rmdir conf$$.dir 2>/dev/null
-
-
-# as_fn_mkdir_p
-# -------------
-# Create "$as_dir" as a directory, including parents if necessary.
-as_fn_mkdir_p ()
-{
-
- case $as_dir in #(
- -*) as_dir=./$as_dir;;
- esac
- test -d "$as_dir" || eval $as_mkdir_p || {
- as_dirs=
- while :; do
- case $as_dir in #(
- *\'*) as_qdir=`$as_echo "$as_dir" | sed "s/'/'\\\\\\\\''/g"`;; #'(
- *) as_qdir=$as_dir;;
- esac
- as_dirs="'$as_qdir' $as_dirs"
- as_dir=`$as_dirname -- "$as_dir" ||
-$as_expr X"$as_dir" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
- X"$as_dir" : 'X\(//\)[^/]' \| \
- X"$as_dir" : 'X\(//\)$' \| \
- X"$as_dir" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$as_dir" |
- sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
- s//\1/
- q
- }
- /^X\(\/\/\)[^/].*/{
- s//\1/
- q
- }
- /^X\(\/\/\)$/{
- s//\1/
- q
- }
- /^X\(\/\).*/{
- s//\1/
- q
- }
- s/.*/./; q'`
- test -d "$as_dir" && break
- done
- test -z "$as_dirs" || eval "mkdir $as_dirs"
- } || test -d "$as_dir" || as_fn_error $? "cannot create directory $as_dir"
-
-
-} # as_fn_mkdir_p
-if mkdir -p . 2>/dev/null; then
- as_mkdir_p='mkdir -p "$as_dir"'
-else
- test -d ./-p && rmdir ./-p
- as_mkdir_p=false
-fi
-
-
-# as_fn_executable_p FILE
-# -----------------------
-# Test if FILE is an executable regular file.
-as_fn_executable_p ()
-{
- test -f "$1" && test -x "$1"
-} # as_fn_executable_p
-as_test_x='test -x'
-as_executable_p=as_fn_executable_p
-
-# Sed expression to map a string onto a valid CPP name.
-as_tr_cpp="eval sed 'y%*$as_cr_letters%P$as_cr_LETTERS%;s%[^_$as_cr_alnum]%_%g'"
-
-# Sed expression to map a string onto a valid variable name.
-as_tr_sh="eval sed 'y%*+%pp%;s%[^_$as_cr_alnum]%_%g'"
-
-
-exec 6>&1
-## ----------------------------------- ##
-## Main body of $CONFIG_STATUS script. ##
-## ----------------------------------- ##
-_ASEOF
-test $as_write_fail = 0 && chmod +x $CONFIG_STATUS || ac_write_fail=1
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-# Save the log message, to keep $0 and so on meaningful, and to
-# report actual input values of CONFIG_FILES etc. instead of their
-# values after options handling.
-ac_log="
-This file was extended by ABySS $as_me 1.3.6, which was
-generated by GNU Autoconf 2.69. Invocation command line was
-
- CONFIG_FILES = $CONFIG_FILES
- CONFIG_HEADERS = $CONFIG_HEADERS
- CONFIG_LINKS = $CONFIG_LINKS
- CONFIG_COMMANDS = $CONFIG_COMMANDS
- $ $0 $@
-
-on `(hostname || uname -n) 2>/dev/null | sed 1q`
-"
-
-_ACEOF
-
-case $ac_config_files in *"
-"*) set x $ac_config_files; shift; ac_config_files=$*;;
-esac
-
-case $ac_config_headers in *"
-"*) set x $ac_config_headers; shift; ac_config_headers=$*;;
-esac
-
-
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-# Files that config.status was made for.
-config_files="$ac_config_files"
-config_headers="$ac_config_headers"
-config_commands="$ac_config_commands"
-
-_ACEOF
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-ac_cs_usage="\
-\`$as_me' instantiates files and other configuration actions
-from templates according to the current configuration. Unless the files
-and actions are specified as TAGs, all are instantiated by default.
-
-Usage: $0 [OPTION]... [TAG]...
-
- -h, --help print this help, then exit
- -V, --version print version number and configuration settings, then exit
- --config print configuration, then exit
- -q, --quiet, --silent
- do not print progress messages
- -d, --debug don't remove temporary files
- --recheck update $as_me by reconfiguring in the same conditions
- --file=FILE[:TEMPLATE]
- instantiate the configuration file FILE
- --header=FILE[:TEMPLATE]
- instantiate the configuration header FILE
-
-Configuration files:
-$config_files
-
-Configuration headers:
-$config_headers
-
-Configuration commands:
-$config_commands
-
-Report bugs to <abyss-users at bcgsc.ca>.
-ABySS home page: <http://www.bcgsc.ca/platform/bioinfo/software/abyss>."
-
-_ACEOF
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-ac_cs_config="`$as_echo "$ac_configure_args" | sed 's/^ //; s/[\\""\`\$]/\\\\&/g'`"
-ac_cs_version="\\
-ABySS config.status 1.3.6
-configured by $0, generated by GNU Autoconf 2.69,
- with options \\"\$ac_cs_config\\"
-
-Copyright (C) 2012 Free Software Foundation, Inc.
-This config.status script is free software; the Free Software Foundation
-gives unlimited permission to copy, distribute and modify it."
-
-ac_pwd='$ac_pwd'
-srcdir='$srcdir'
-INSTALL='$INSTALL'
-MKDIR_P='$MKDIR_P'
-AWK='$AWK'
-test -n "\$AWK" || AWK=awk
-_ACEOF
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-# The default lists apply if the user does not specify any file.
-ac_need_defaults=:
-while test $# != 0
-do
- case $1 in
- --*=?*)
- ac_option=`expr "X$1" : 'X\([^=]*\)='`
- ac_optarg=`expr "X$1" : 'X[^=]*=\(.*\)'`
- ac_shift=:
- ;;
- --*=)
- ac_option=`expr "X$1" : 'X\([^=]*\)='`
- ac_optarg=
- ac_shift=:
- ;;
- *)
- ac_option=$1
- ac_optarg=$2
- ac_shift=shift
- ;;
- esac
-
- case $ac_option in
- # Handling of the options.
- -recheck | --recheck | --rechec | --reche | --rech | --rec | --re | --r)
- ac_cs_recheck=: ;;
- --version | --versio | --versi | --vers | --ver | --ve | --v | -V )
- $as_echo "$ac_cs_version"; exit ;;
- --config | --confi | --conf | --con | --co | --c )
- $as_echo "$ac_cs_config"; exit ;;
- --debug | --debu | --deb | --de | --d | -d )
- debug=: ;;
- --file | --fil | --fi | --f )
- $ac_shift
- case $ac_optarg in
- *\'*) ac_optarg=`$as_echo "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"` ;;
- '') as_fn_error $? "missing file argument" ;;
- esac
- as_fn_append CONFIG_FILES " '$ac_optarg'"
- ac_need_defaults=false;;
- --header | --heade | --head | --hea )
- $ac_shift
- case $ac_optarg in
- *\'*) ac_optarg=`$as_echo "$ac_optarg" | sed "s/'/'\\\\\\\\''/g"` ;;
- esac
- as_fn_append CONFIG_HEADERS " '$ac_optarg'"
- ac_need_defaults=false;;
- --he | --h)
- # Conflict between --help and --header
- as_fn_error $? "ambiguous option: \`$1'
-Try \`$0 --help' for more information.";;
- --help | --hel | -h )
- $as_echo "$ac_cs_usage"; exit ;;
- -q | -quiet | --quiet | --quie | --qui | --qu | --q \
- | -silent | --silent | --silen | --sile | --sil | --si | --s)
- ac_cs_silent=: ;;
-
- # This is an error.
- -*) as_fn_error $? "unrecognized option: \`$1'
-Try \`$0 --help' for more information." ;;
-
- *) as_fn_append ac_config_targets " $1"
- ac_need_defaults=false ;;
-
- esac
- shift
-done
-
-ac_configure_extra_args=
-
-if $ac_cs_silent; then
- exec 6>/dev/null
- ac_configure_extra_args="$ac_configure_extra_args --silent"
-fi
-
-_ACEOF
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-if \$ac_cs_recheck; then
- set X $SHELL '$0' $ac_configure_args \$ac_configure_extra_args --no-create --no-recursion
- shift
- \$as_echo "running CONFIG_SHELL=$SHELL \$*" >&6
- CONFIG_SHELL='$SHELL'
- export CONFIG_SHELL
- exec "\$@"
-fi
-
-_ACEOF
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-exec 5>>config.log
-{
- echo
- sed 'h;s/./-/g;s/^.../## /;s/...$/ ##/;p;x;p;x' <<_ASBOX
-## Running $as_me. ##
-_ASBOX
- $as_echo "$ac_log"
-} >&5
-
-_ACEOF
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-#
-# INIT-COMMANDS
-#
-AMDEP_TRUE="$AMDEP_TRUE" ac_aux_dir="$ac_aux_dir"
-
-_ACEOF
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-
-# Handling of arguments.
-for ac_config_target in $ac_config_targets
-do
- case $ac_config_target in
- "config.h") CONFIG_HEADERS="$CONFIG_HEADERS config.h" ;;
- "depfiles") CONFIG_COMMANDS="$CONFIG_COMMANDS depfiles" ;;
- "Makefile") CONFIG_FILES="$CONFIG_FILES Makefile" ;;
- "ABYSS/Makefile") CONFIG_FILES="$CONFIG_FILES ABYSS/Makefile" ;;
- "Align/Makefile") CONFIG_FILES="$CONFIG_FILES Align/Makefile" ;;
- "Assembly/Makefile") CONFIG_FILES="$CONFIG_FILES Assembly/Makefile" ;;
- "Common/Makefile") CONFIG_FILES="$CONFIG_FILES Common/Makefile" ;;
- "DataLayer/Makefile") CONFIG_FILES="$CONFIG_FILES DataLayer/Makefile" ;;
- "FMIndex/Makefile") CONFIG_FILES="$CONFIG_FILES FMIndex/Makefile" ;;
- "Graph/Makefile") CONFIG_FILES="$CONFIG_FILES Graph/Makefile" ;;
- "Parallel/Makefile") CONFIG_FILES="$CONFIG_FILES Parallel/Makefile" ;;
- "bin/Makefile") CONFIG_FILES="$CONFIG_FILES bin/Makefile" ;;
- "doc/Makefile") CONFIG_FILES="$CONFIG_FILES doc/Makefile" ;;
- "dialign/Makefile") CONFIG_FILES="$CONFIG_FILES dialign/Makefile" ;;
- "kmerprint/Makefile") CONFIG_FILES="$CONFIG_FILES kmerprint/Makefile" ;;
- "AdjList/Makefile") CONFIG_FILES="$CONFIG_FILES AdjList/Makefile" ;;
- "DAssembler/Makefile") CONFIG_FILES="$CONFIG_FILES DAssembler/Makefile" ;;
- "DistanceEst/Makefile") CONFIG_FILES="$CONFIG_FILES DistanceEst/Makefile" ;;
- "Layout/Makefile") CONFIG_FILES="$CONFIG_FILES Layout/Makefile" ;;
- "Map/Makefile") CONFIG_FILES="$CONFIG_FILES Map/Makefile" ;;
- "Misc/Makefile") CONFIG_FILES="$CONFIG_FILES Misc/Makefile" ;;
- "Overlap/Makefile") CONFIG_FILES="$CONFIG_FILES Overlap/Makefile" ;;
- "PopBubbles/Makefile") CONFIG_FILES="$CONFIG_FILES PopBubbles/Makefile" ;;
- "Scaffold/Makefile") CONFIG_FILES="$CONFIG_FILES Scaffold/Makefile" ;;
- "SimpleGraph/Makefile") CONFIG_FILES="$CONFIG_FILES SimpleGraph/Makefile" ;;
- "MergePaths/Makefile") CONFIG_FILES="$CONFIG_FILES MergePaths/Makefile" ;;
- "KAligner/Makefile") CONFIG_FILES="$CONFIG_FILES KAligner/Makefile" ;;
- "ParseAligns/Makefile") CONFIG_FILES="$CONFIG_FILES ParseAligns/Makefile" ;;
- "PathOverlap/Makefile") CONFIG_FILES="$CONFIG_FILES PathOverlap/Makefile" ;;
- "Consensus/Makefile") CONFIG_FILES="$CONFIG_FILES Consensus/Makefile" ;;
- "FilterGraph/Makefile") CONFIG_FILES="$CONFIG_FILES FilterGraph/Makefile" ;;
-
- *) as_fn_error $? "invalid argument: \`$ac_config_target'" "$LINENO" 5;;
- esac
-done
-
-
-# If the user did not use the arguments to specify the items to instantiate,
-# then the envvar interface is used. Set only those that are not.
-# We use the long form for the default assignment because of an extremely
-# bizarre bug on SunOS 4.1.3.
-if $ac_need_defaults; then
- test "${CONFIG_FILES+set}" = set || CONFIG_FILES=$config_files
- test "${CONFIG_HEADERS+set}" = set || CONFIG_HEADERS=$config_headers
- test "${CONFIG_COMMANDS+set}" = set || CONFIG_COMMANDS=$config_commands
-fi
-
-# Have a temporary directory for convenience. Make it in the build tree
-# simply because there is no reason against having it here, and in addition,
-# creating and moving files from /tmp can sometimes cause problems.
-# Hook for its removal unless debugging.
-# Note that there is a small window in which the directory will not be cleaned:
-# after its creation but before its name has been assigned to `$tmp'.
-$debug ||
-{
- tmp= ac_tmp=
- trap 'exit_status=$?
- : "${ac_tmp:=$tmp}"
- { test ! -d "$ac_tmp" || rm -fr "$ac_tmp"; } && exit $exit_status
-' 0
- trap 'as_fn_exit 1' 1 2 13 15
-}
-# Create a (secure) tmp directory for tmp files.
-
-{
- tmp=`(umask 077 && mktemp -d "./confXXXXXX") 2>/dev/null` &&
- test -d "$tmp"
-} ||
-{
- tmp=./conf$$-$RANDOM
- (umask 077 && mkdir "$tmp")
-} || as_fn_error $? "cannot create a temporary directory in ." "$LINENO" 5
-ac_tmp=$tmp
-
-# Set up the scripts for CONFIG_FILES section.
-# No need to generate them if there are no CONFIG_FILES.
-# This happens for instance with `./config.status config.h'.
-if test -n "$CONFIG_FILES"; then
-
-
-ac_cr=`echo X | tr X '\015'`
-# On cygwin, bash can eat \r inside `` if the user requested igncr.
-# But we know of no other shell where ac_cr would be empty at this
-# point, so we can use a bashism as a fallback.
-if test "x$ac_cr" = x; then
- eval ac_cr=\$\'\\r\'
-fi
-ac_cs_awk_cr=`$AWK 'BEGIN { print "a\rb" }' </dev/null 2>/dev/null`
-if test "$ac_cs_awk_cr" = "a${ac_cr}b"; then
- ac_cs_awk_cr='\\r'
-else
- ac_cs_awk_cr=$ac_cr
-fi
-
-echo 'BEGIN {' >"$ac_tmp/subs1.awk" &&
-_ACEOF
-
-
-{
- echo "cat >conf$$subs.awk <<_ACEOF" &&
- echo "$ac_subst_vars" | sed 's/.*/&!$&$ac_delim/' &&
- echo "_ACEOF"
-} >conf$$subs.sh ||
- as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
-ac_delim_num=`echo "$ac_subst_vars" | grep -c '^'`
-ac_delim='%!_!# '
-for ac_last_try in false false false false false :; do
- . ./conf$$subs.sh ||
- as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
-
- ac_delim_n=`sed -n "s/.*$ac_delim\$/X/p" conf$$subs.awk | grep -c X`
- if test $ac_delim_n = $ac_delim_num; then
- break
- elif $ac_last_try; then
- as_fn_error $? "could not make $CONFIG_STATUS" "$LINENO" 5
- else
- ac_delim="$ac_delim!$ac_delim _$ac_delim!! "
- fi
-done
-rm -f conf$$subs.sh
-
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-cat >>"\$ac_tmp/subs1.awk" <<\\_ACAWK &&
-_ACEOF
-sed -n '
-h
-s/^/S["/; s/!.*/"]=/
-p
-g
-s/^[^!]*!//
-:repl
-t repl
-s/'"$ac_delim"'$//
-t delim
-:nl
-h
-s/\(.\{148\}\)..*/\1/
-t more1
-s/["\\]/\\&/g; s/^/"/; s/$/\\n"\\/
-p
-n
-b repl
-:more1
-s/["\\]/\\&/g; s/^/"/; s/$/"\\/
-p
-g
-s/.\{148\}//
-t nl
-:delim
-h
-s/\(.\{148\}\)..*/\1/
-t more2
-s/["\\]/\\&/g; s/^/"/; s/$/"/
-p
-b
-:more2
-s/["\\]/\\&/g; s/^/"/; s/$/"\\/
-p
-g
-s/.\{148\}//
-t delim
-' <conf$$subs.awk | sed '
-/^[^""]/{
- N
- s/\n//
-}
-' >>$CONFIG_STATUS || ac_write_fail=1
-rm -f conf$$subs.awk
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-_ACAWK
-cat >>"\$ac_tmp/subs1.awk" <<_ACAWK &&
- for (key in S) S_is_set[key] = 1
- FS = ""
-
-}
-{
- line = $ 0
- nfields = split(line, field, "@")
- substed = 0
- len = length(field[1])
- for (i = 2; i < nfields; i++) {
- key = field[i]
- keylen = length(key)
- if (S_is_set[key]) {
- value = S[key]
- line = substr(line, 1, len) "" value "" substr(line, len + keylen + 3)
- len += length(value) + length(field[++i])
- substed = 1
- } else
- len += 1 + keylen
- }
-
- print line
-}
-
-_ACAWK
-_ACEOF
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-if sed "s/$ac_cr//" < /dev/null > /dev/null 2>&1; then
- sed "s/$ac_cr\$//; s/$ac_cr/$ac_cs_awk_cr/g"
-else
- cat
-fi < "$ac_tmp/subs1.awk" > "$ac_tmp/subs.awk" \
- || as_fn_error $? "could not setup config files machinery" "$LINENO" 5
-_ACEOF
-
-# VPATH may cause trouble with some makes, so we remove sole $(srcdir),
-# ${srcdir} and @srcdir@ entries from VPATH if srcdir is ".", strip leading and
-# trailing colons and then remove the whole line if VPATH becomes empty
-# (actually we leave an empty line to preserve line numbers).
-if test "x$srcdir" = x.; then
- ac_vpsub='/^[ ]*VPATH[ ]*=[ ]*/{
-h
-s///
-s/^/:/
-s/[ ]*$/:/
-s/:\$(srcdir):/:/g
-s/:\${srcdir}:/:/g
-s/:@srcdir@:/:/g
-s/^:*//
-s/:*$//
-x
-s/\(=[ ]*\).*/\1/
-G
-s/\n//
-s/^[^=]*=[ ]*$//
-}'
-fi
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-fi # test -n "$CONFIG_FILES"
-
-# Set up the scripts for CONFIG_HEADERS section.
-# No need to generate them if there are no CONFIG_HEADERS.
-# This happens for instance with `./config.status Makefile'.
-if test -n "$CONFIG_HEADERS"; then
-cat >"$ac_tmp/defines.awk" <<\_ACAWK ||
-BEGIN {
-_ACEOF
-
-# Transform confdefs.h into an awk script `defines.awk', embedded as
-# here-document in config.status, that substitutes the proper values into
-# config.h.in to produce config.h.
-
-# Create a delimiter string that does not exist in confdefs.h, to ease
-# handling of long lines.
-ac_delim='%!_!# '
-for ac_last_try in false false :; do
- ac_tt=`sed -n "/$ac_delim/p" confdefs.h`
- if test -z "$ac_tt"; then
- break
- elif $ac_last_try; then
- as_fn_error $? "could not make $CONFIG_HEADERS" "$LINENO" 5
- else
- ac_delim="$ac_delim!$ac_delim _$ac_delim!! "
- fi
-done
-
-# For the awk script, D is an array of macro values keyed by name,
-# likewise P contains macro parameters if any. Preserve backslash
-# newline sequences.
-
-ac_word_re=[_$as_cr_Letters][_$as_cr_alnum]*
-sed -n '
-s/.\{148\}/&'"$ac_delim"'/g
-t rset
-:rset
-s/^[ ]*#[ ]*define[ ][ ]*/ /
-t def
-d
-:def
-s/\\$//
-t bsnl
-s/["\\]/\\&/g
-s/^ \('"$ac_word_re"'\)\(([^()]*)\)[ ]*\(.*\)/P["\1"]="\2"\
-D["\1"]=" \3"/p
-s/^ \('"$ac_word_re"'\)[ ]*\(.*\)/D["\1"]=" \2"/p
-d
-:bsnl
-s/["\\]/\\&/g
-s/^ \('"$ac_word_re"'\)\(([^()]*)\)[ ]*\(.*\)/P["\1"]="\2"\
-D["\1"]=" \3\\\\\\n"\\/p
-t cont
-s/^ \('"$ac_word_re"'\)[ ]*\(.*\)/D["\1"]=" \2\\\\\\n"\\/p
-t cont
-d
-:cont
-n
-s/.\{148\}/&'"$ac_delim"'/g
-t clear
-:clear
-s/\\$//
-t bsnlc
-s/["\\]/\\&/g; s/^/"/; s/$/"/p
-d
-:bsnlc
-s/["\\]/\\&/g; s/^/"/; s/$/\\\\\\n"\\/p
-b cont
-' <confdefs.h | sed '
-s/'"$ac_delim"'/"\\\
-"/g' >>$CONFIG_STATUS || ac_write_fail=1
-
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
- for (key in D) D_is_set[key] = 1
- FS = ""
-}
-/^[\t ]*#[\t ]*(define|undef)[\t ]+$ac_word_re([\t (]|\$)/ {
- line = \$ 0
- split(line, arg, " ")
- if (arg[1] == "#") {
- defundef = arg[2]
- mac1 = arg[3]
- } else {
- defundef = substr(arg[1], 2)
- mac1 = arg[2]
- }
- split(mac1, mac2, "(") #)
- macro = mac2[1]
- prefix = substr(line, 1, index(line, defundef) - 1)
- if (D_is_set[macro]) {
- # Preserve the white space surrounding the "#".
- print prefix "define", macro P[macro] D[macro]
- next
- } else {
- # Replace #undef with comments. This is necessary, for example,
- # in the case of _POSIX_SOURCE, which is predefined and required
- # on some systems where configure will not decide to define it.
- if (defundef == "undef") {
- print "/*", prefix defundef, macro, "*/"
- next
- }
- }
-}
-{ print }
-_ACAWK
-_ACEOF
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
- as_fn_error $? "could not setup config headers machinery" "$LINENO" 5
-fi # test -n "$CONFIG_HEADERS"
-
-
-eval set X " :F $CONFIG_FILES :H $CONFIG_HEADERS :C $CONFIG_COMMANDS"
-shift
-for ac_tag
-do
- case $ac_tag in
- :[FHLC]) ac_mode=$ac_tag; continue;;
- esac
- case $ac_mode$ac_tag in
- :[FHL]*:*);;
- :L* | :C*:*) as_fn_error $? "invalid tag \`$ac_tag'" "$LINENO" 5;;
- :[FH]-) ac_tag=-:-;;
- :[FH]*) ac_tag=$ac_tag:$ac_tag.in;;
- esac
- ac_save_IFS=$IFS
- IFS=:
- set x $ac_tag
- IFS=$ac_save_IFS
- shift
- ac_file=$1
- shift
-
- case $ac_mode in
- :L) ac_source=$1;;
- :[FH])
- ac_file_inputs=
- for ac_f
- do
- case $ac_f in
- -) ac_f="$ac_tmp/stdin";;
- *) # Look for the file first in the build tree, then in the source tree
- # (if the path is not absolute). The absolute path cannot be DOS-style,
- # because $ac_f cannot contain `:'.
- test -f "$ac_f" ||
- case $ac_f in
- [\\/$]*) false;;
- *) test -f "$srcdir/$ac_f" && ac_f="$srcdir/$ac_f";;
- esac ||
- as_fn_error 1 "cannot find input file: \`$ac_f'" "$LINENO" 5;;
- esac
- case $ac_f in *\'*) ac_f=`$as_echo "$ac_f" | sed "s/'/'\\\\\\\\''/g"`;; esac
- as_fn_append ac_file_inputs " '$ac_f'"
- done
-
- # Let's still pretend it is `configure' which instantiates (i.e., don't
- # use $as_me), people would be surprised to read:
- # /* config.h. Generated by config.status. */
- configure_input='Generated from '`
- $as_echo "$*" | sed 's|^[^:]*/||;s|:[^:]*/|, |g'
- `' by configure.'
- if test x"$ac_file" != x-; then
- configure_input="$ac_file. $configure_input"
- { $as_echo "$as_me:${as_lineno-$LINENO}: creating $ac_file" >&5
-$as_echo "$as_me: creating $ac_file" >&6;}
- fi
- # Neutralize special characters interpreted by sed in replacement strings.
- case $configure_input in #(
- *\&* | *\|* | *\\* )
- ac_sed_conf_input=`$as_echo "$configure_input" |
- sed 's/[\\\\&|]/\\\\&/g'`;; #(
- *) ac_sed_conf_input=$configure_input;;
- esac
-
- case $ac_tag in
- *:-:* | *:-) cat >"$ac_tmp/stdin" \
- || as_fn_error $? "could not create $ac_file" "$LINENO" 5 ;;
- esac
- ;;
- esac
-
- ac_dir=`$as_dirname -- "$ac_file" ||
-$as_expr X"$ac_file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
- X"$ac_file" : 'X\(//\)[^/]' \| \
- X"$ac_file" : 'X\(//\)$' \| \
- X"$ac_file" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$ac_file" |
- sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
- s//\1/
- q
- }
- /^X\(\/\/\)[^/].*/{
- s//\1/
- q
- }
- /^X\(\/\/\)$/{
- s//\1/
- q
- }
- /^X\(\/\).*/{
- s//\1/
- q
- }
- s/.*/./; q'`
- as_dir="$ac_dir"; as_fn_mkdir_p
- ac_builddir=.
-
-case "$ac_dir" in
-.) ac_dir_suffix= ac_top_builddir_sub=. ac_top_build_prefix= ;;
-*)
- ac_dir_suffix=/`$as_echo "$ac_dir" | sed 's|^\.[\\/]||'`
- # A ".." for each directory in $ac_dir_suffix.
- ac_top_builddir_sub=`$as_echo "$ac_dir_suffix" | sed 's|/[^\\/]*|/..|g;s|/||'`
- case $ac_top_builddir_sub in
- "") ac_top_builddir_sub=. ac_top_build_prefix= ;;
- *) ac_top_build_prefix=$ac_top_builddir_sub/ ;;
- esac ;;
-esac
-ac_abs_top_builddir=$ac_pwd
-ac_abs_builddir=$ac_pwd$ac_dir_suffix
-# for backward compatibility:
-ac_top_builddir=$ac_top_build_prefix
-
-case $srcdir in
- .) # We are building in place.
- ac_srcdir=.
- ac_top_srcdir=$ac_top_builddir_sub
- ac_abs_top_srcdir=$ac_pwd ;;
- [\\/]* | ?:[\\/]* ) # Absolute name.
- ac_srcdir=$srcdir$ac_dir_suffix;
- ac_top_srcdir=$srcdir
- ac_abs_top_srcdir=$srcdir ;;
- *) # Relative name.
- ac_srcdir=$ac_top_build_prefix$srcdir$ac_dir_suffix
- ac_top_srcdir=$ac_top_build_prefix$srcdir
- ac_abs_top_srcdir=$ac_pwd/$srcdir ;;
-esac
-ac_abs_srcdir=$ac_abs_top_srcdir$ac_dir_suffix
-
-
- case $ac_mode in
- :F)
- #
- # CONFIG_FILE
- #
-
- case $INSTALL in
- [\\/$]* | ?:[\\/]* ) ac_INSTALL=$INSTALL ;;
- *) ac_INSTALL=$ac_top_build_prefix$INSTALL ;;
- esac
- ac_MKDIR_P=$MKDIR_P
- case $MKDIR_P in
- [\\/$]* | ?:[\\/]* ) ;;
- */*) ac_MKDIR_P=$ac_top_build_prefix$MKDIR_P ;;
- esac
-_ACEOF
-
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-# If the template does not know about datarootdir, expand it.
-# FIXME: This hack should be removed a few years after 2.60.
-ac_datarootdir_hack=; ac_datarootdir_seen=
-ac_sed_dataroot='
-/datarootdir/ {
- p
- q
-}
-/@datadir@/p
-/@docdir@/p
-/@infodir@/p
-/@localedir@/p
-/@mandir@/p'
-case `eval "sed -n \"\$ac_sed_dataroot\" $ac_file_inputs"` in
-*datarootdir*) ac_datarootdir_seen=yes;;
-*@datadir@*|*@docdir@*|*@infodir@*|*@localedir@*|*@mandir@*)
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&5
-$as_echo "$as_me: WARNING: $ac_file_inputs seems to ignore the --datarootdir setting" >&2;}
-_ACEOF
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
- ac_datarootdir_hack='
- s&@datadir@&$datadir&g
- s&@docdir@&$docdir&g
- s&@infodir@&$infodir&g
- s&@localedir@&$localedir&g
- s&@mandir@&$mandir&g
- s&\\\${datarootdir}&$datarootdir&g' ;;
-esac
-_ACEOF
-
-# Neutralize VPATH when `$srcdir' = `.'.
-# Shell code in configure.ac might set extrasub.
-# FIXME: do we really want to maintain this feature?
-cat >>$CONFIG_STATUS <<_ACEOF || ac_write_fail=1
-ac_sed_extra="$ac_vpsub
-$extrasub
-_ACEOF
-cat >>$CONFIG_STATUS <<\_ACEOF || ac_write_fail=1
-:t
-/@[a-zA-Z_][a-zA-Z_0-9]*@/!b
-s|@configure_input@|$ac_sed_conf_input|;t t
-s&@top_builddir@&$ac_top_builddir_sub&;t t
-s&@top_build_prefix@&$ac_top_build_prefix&;t t
-s&@srcdir@&$ac_srcdir&;t t
-s&@abs_srcdir@&$ac_abs_srcdir&;t t
-s&@top_srcdir@&$ac_top_srcdir&;t t
-s&@abs_top_srcdir@&$ac_abs_top_srcdir&;t t
-s&@builddir@&$ac_builddir&;t t
-s&@abs_builddir@&$ac_abs_builddir&;t t
-s&@abs_top_builddir@&$ac_abs_top_builddir&;t t
-s&@INSTALL@&$ac_INSTALL&;t t
-s&@MKDIR_P@&$ac_MKDIR_P&;t t
-$ac_datarootdir_hack
-"
-eval sed \"\$ac_sed_extra\" "$ac_file_inputs" | $AWK -f "$ac_tmp/subs.awk" \
- >$ac_tmp/out || as_fn_error $? "could not create $ac_file" "$LINENO" 5
-
-test -z "$ac_datarootdir_hack$ac_datarootdir_seen" &&
- { ac_out=`sed -n '/\${datarootdir}/p' "$ac_tmp/out"`; test -n "$ac_out"; } &&
- { ac_out=`sed -n '/^[ ]*datarootdir[ ]*:*=/p' \
- "$ac_tmp/out"`; test -z "$ac_out"; } &&
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: $ac_file contains a reference to the variable \`datarootdir'
-which seems to be undefined. Please make sure it is defined" >&5
-$as_echo "$as_me: WARNING: $ac_file contains a reference to the variable \`datarootdir'
-which seems to be undefined. Please make sure it is defined" >&2;}
-
- rm -f "$ac_tmp/stdin"
- case $ac_file in
- -) cat "$ac_tmp/out" && rm -f "$ac_tmp/out";;
- *) rm -f "$ac_file" && mv "$ac_tmp/out" "$ac_file";;
- esac \
- || as_fn_error $? "could not create $ac_file" "$LINENO" 5
- ;;
- :H)
- #
- # CONFIG_HEADER
- #
- if test x"$ac_file" != x-; then
- {
- $as_echo "/* $configure_input */" \
- && eval '$AWK -f "$ac_tmp/defines.awk"' "$ac_file_inputs"
- } >"$ac_tmp/config.h" \
- || as_fn_error $? "could not create $ac_file" "$LINENO" 5
- if diff "$ac_file" "$ac_tmp/config.h" >/dev/null 2>&1; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: $ac_file is unchanged" >&5
-$as_echo "$as_me: $ac_file is unchanged" >&6;}
- else
- rm -f "$ac_file"
- mv "$ac_tmp/config.h" "$ac_file" \
- || as_fn_error $? "could not create $ac_file" "$LINENO" 5
- fi
- else
- $as_echo "/* $configure_input */" \
- && eval '$AWK -f "$ac_tmp/defines.awk"' "$ac_file_inputs" \
- || as_fn_error $? "could not create -" "$LINENO" 5
- fi
-# Compute "$ac_file"'s index in $config_headers.
-_am_arg="$ac_file"
-_am_stamp_count=1
-for _am_header in $config_headers :; do
- case $_am_header in
- $_am_arg | $_am_arg:* )
- break ;;
- * )
- _am_stamp_count=`expr $_am_stamp_count + 1` ;;
- esac
-done
-echo "timestamp for $_am_arg" >`$as_dirname -- "$_am_arg" ||
-$as_expr X"$_am_arg" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
- X"$_am_arg" : 'X\(//\)[^/]' \| \
- X"$_am_arg" : 'X\(//\)$' \| \
- X"$_am_arg" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$_am_arg" |
- sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
- s//\1/
- q
- }
- /^X\(\/\/\)[^/].*/{
- s//\1/
- q
- }
- /^X\(\/\/\)$/{
- s//\1/
- q
- }
- /^X\(\/\).*/{
- s//\1/
- q
- }
- s/.*/./; q'`/stamp-h$_am_stamp_count
- ;;
-
- :C) { $as_echo "$as_me:${as_lineno-$LINENO}: executing $ac_file commands" >&5
-$as_echo "$as_me: executing $ac_file commands" >&6;}
- ;;
- esac
-
-
- case $ac_file$ac_mode in
- "depfiles":C) test x"$AMDEP_TRUE" != x"" || {
- # Older Autoconf quotes --file arguments for eval, but not when files
- # are listed without --file. Let's play safe and only enable the eval
- # if we detect the quoting.
- case $CONFIG_FILES in
- *\'*) eval set x "$CONFIG_FILES" ;;
- *) set x $CONFIG_FILES ;;
- esac
- shift
- for mf
- do
- # Strip MF so we end up with the name of the file.
- mf=`echo "$mf" | sed -e 's/:.*$//'`
- # Check whether this is an Automake generated Makefile or not.
- # We used to match only the files named 'Makefile.in', but
- # some people rename them; so instead we look at the file content.
- # Grep'ing the first line is not enough: some people post-process
- # each Makefile.in and add a new line on top of each file to say so.
- # Grep'ing the whole file is not good either: AIX grep has a line
- # limit of 2048, but all sed's we know have understand at least 4000.
- if sed -n 's,^#.*generated by automake.*,X,p' "$mf" | grep X >/dev/null 2>&1; then
- dirpart=`$as_dirname -- "$mf" ||
-$as_expr X"$mf" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
- X"$mf" : 'X\(//\)[^/]' \| \
- X"$mf" : 'X\(//\)$' \| \
- X"$mf" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$mf" |
- sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
- s//\1/
- q
- }
- /^X\(\/\/\)[^/].*/{
- s//\1/
- q
- }
- /^X\(\/\/\)$/{
- s//\1/
- q
- }
- /^X\(\/\).*/{
- s//\1/
- q
- }
- s/.*/./; q'`
- else
- continue
- fi
- # Extract the definition of DEPDIR, am__include, and am__quote
- # from the Makefile without running 'make'.
- DEPDIR=`sed -n 's/^DEPDIR = //p' < "$mf"`
- test -z "$DEPDIR" && continue
- am__include=`sed -n 's/^am__include = //p' < "$mf"`
- test -z "$am__include" && continue
- am__quote=`sed -n 's/^am__quote = //p' < "$mf"`
- # Find all dependency output files, they are included files with
- # $(DEPDIR) in their names. We invoke sed twice because it is the
- # simplest approach to changing $(DEPDIR) to its actual value in the
- # expansion.
- for file in `sed -n "
- s/^$am__include $am__quote\(.*(DEPDIR).*\)$am__quote"'$/\1/p' <"$mf" | \
- sed -e 's/\$(DEPDIR)/'"$DEPDIR"'/g'`; do
- # Make sure the directory exists.
- test -f "$dirpart/$file" && continue
- fdir=`$as_dirname -- "$file" ||
-$as_expr X"$file" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
- X"$file" : 'X\(//\)[^/]' \| \
- X"$file" : 'X\(//\)$' \| \
- X"$file" : 'X\(/\)' \| . 2>/dev/null ||
-$as_echo X"$file" |
- sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
- s//\1/
- q
- }
- /^X\(\/\/\)[^/].*/{
- s//\1/
- q
- }
- /^X\(\/\/\)$/{
- s//\1/
- q
- }
- /^X\(\/\).*/{
- s//\1/
- q
- }
- s/.*/./; q'`
- as_dir=$dirpart/$fdir; as_fn_mkdir_p
- # echo "creating $dirpart/$file"
- echo '# dummy' > "$dirpart/$file"
- done
- done
-}
- ;;
-
- esac
-done # for ac_tag
-
-
-as_fn_exit 0
-_ACEOF
-ac_clean_files=$ac_clean_files_save
-
-test $ac_write_fail = 0 ||
- as_fn_error $? "write failure creating $CONFIG_STATUS" "$LINENO" 5
-
-
-# configure is writing to config.log, and then calls config.status.
-# config.status does its own redirection, appending to config.log.
-# Unfortunately, on DOS this fails, as config.log is still kept open
-# by configure, so config.status won't be able to write to it; its
-# output is simply discarded. So we exec the FD to /dev/null,
-# effectively closing config.log, so it can be properly (re)opened and
-# appended to by config.status. When coming back to configure, we
-# need to make the FD available again.
-if test "$no_create" != yes; then
- ac_cs_success=:
- ac_config_status_args=
- test "$silent" = yes &&
- ac_config_status_args="$ac_config_status_args --quiet"
- exec 5>/dev/null
- $SHELL $CONFIG_STATUS $ac_config_status_args || ac_cs_success=false
- exec 5>>config.log
- # Use ||, not &&, to avoid exiting from the if with $? = 1, which
- # would make configure fail if this is the last instruction.
- $ac_cs_success || as_fn_exit 1
-fi
-if test -n "$ac_unrecognized_opts" && test "$enable_option_checking" != no; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: unrecognized options: $ac_unrecognized_opts" >&5
-$as_echo "$as_me: WARNING: unrecognized options: $ac_unrecognized_opts" >&2;}
-fi
-
-
-if test $ac_cv_header_google_sparse_hash_map != yes; then
- { $as_echo "$as_me:${as_lineno-$LINENO}: WARNING: ABySS should be compiled with Google sparsehash to
- reduce memory usage. It may be downloaded here:
- http://code.google.com/p/google-sparsehash" >&5
-$as_echo "$as_me: WARNING: ABySS should be compiled with Google sparsehash to
- reduce memory usage. It may be downloaded here:
- http://code.google.com/p/google-sparsehash" >&2;}
-fi
diff --git a/configure.ac b/configure.ac
index 79e64fe..66b9954 100644
--- a/configure.ac
+++ b/configure.ac
@@ -1,7 +1,7 @@
-AC_PREREQ(2.59)
-AC_INIT(ABySS, 1.3.6, abyss-users at bcgsc.ca, abyss,
+AC_PREREQ(2.62)
+AC_INIT(ABySS, 1.5.2, abyss-users at bcgsc.ca, abyss,
http://www.bcgsc.ca/platform/bioinfo/software/abyss)
-AM_INIT_AUTOMAKE(foreign)
+AM_INIT_AUTOMAKE(1.9.6 foreign subdir-objects)
AC_CONFIG_SRCDIR([ABYSS/Abyss.cpp])
AC_CONFIG_HEADER([config.h])
@@ -13,7 +13,8 @@ AC_PROG_CXX
AC_PROG_INSTALL
AC_PROG_RANLIB
AC_CHECK_TOOL(GHC, ghc)
-AM_CONDITIONAL([HAVE_GHC], [test "$GHC"])
+AC_CHECK_TOOL(GHC_PKG, ghc-pkg)
+AM_CONDITIONAL([HAVE_GHC_MMAP], ["$GHC_PKG" list |grep -q mmap])
# Checks for header files.
AC_CHECK_HEADERS([dlfcn.h fcntl.h float.h limits.h \
@@ -36,6 +37,23 @@ AC_TYPE_UINT16_T
AC_TYPE_UINT32_T
AC_TYPE_UINT64_T
+# Check for std::hash and std::tr1::hash.
+AC_LANG_PUSH([C++])
+AC_CHECK_TYPE([std::hash<int>],
+ AC_DEFINE(HAVE_STD_HASH, [1],
+ [Define if the system provides std::hash]),
+ [], [
+#ifdef __FUJITSU
+#include <string>
+#else
+#include <functional>
+#endif])
+AC_CHECK_TYPE([std::tr1::hash<int>],
+ AC_DEFINE(HAVE_STD_TR1_HASH, [1],
+ [Define if the system provides std::tr1::hash]),
+ [], [#include <tr1/functional>])
+AC_LANG_POP([C++])
+
# Checks for library functions.
AC_CHECK_FUNCS([dup2 gethostname getopt_long getpagesize \
memset strdup strerror strtoul])
@@ -57,17 +75,25 @@ AC_CHECK_DECL(HOST_NAME_MAX, [],
AC_ARG_WITH(boost, AS_HELP_STRING([--with-boost=PATH],
[specify directory for the boost header files]))
if test "$with_boost" -a -d "$with_boost"; then
- boost_cppflags="-I$with_boost"
+ boost_cppflags="-isystem$with_boost"
fi
# MPI
AC_ARG_WITH(mpi, AS_HELP_STRING([--with-mpi=PATH],
[specify prefix directory for the installed MPI parallel
computing library]))
if test "$with_mpi" -a -d "$with_mpi"; then
- mpi_cppflags="-I$with_mpi/include"
+ mpi_cppflags="-isystem$with_mpi/include"
mpi_ldflags="-L$with_mpi/lib"
fi
+# GTest
+AC_ARG_WITH(gtest, AS_HELP_STRING([--with-gtest=PATH],
+ [specify prefix directory for the installed gtest library]))
+if test "$with_gtest" -a -d "$with_gtest"; then
+ gtest_cppflags="-I$with_gtest/include"
+ gtest_ldflags="-L$with_gtest/lib"
+fi
+
AC_ARG_ENABLE(mpich, AS_HELP_STRING([--enable-mpich],
[use MPICH (default is to use Open MPI)]))
AC_ARG_ENABLE(lammpi, AS_HELP_STRING([--enable-lammpi],
@@ -84,16 +110,15 @@ AC_ARG_ENABLE(maxk, AS_HELP_STRING([--enable-maxk=N],
[], [enable_maxk=64])
AC_DEFINE_UNQUOTED(MAX_KMER, [$enable_maxk], [maximum k-mer length])
-AC_ARG_ENABLE(samseqqual,
- AS_HELP_STRING([--enable-samseqqual],
- [enable SAM sequence and quality fields]),
- AC_DEFINE_UNQUOTED(SAM_SEQ_QUAL, 1,
- [Define to use SAM sequence and quality fields]))
+# Find the absolute path to the source.
+my_abs_srcdir=$(cd $srcdir; pwd)
# Set compiler flags.
+boost_ver=1.55.0
+boost_ver_dir=boost_1_55_0
AC_SUBST(CPPFLAGS,
- "-I$srcdir $boost_cppflags $mpi_cppflags $CPPFLAGS")
-AC_SUBST(LDFLAGS, "$mpi_ldflags $LDFLAGS")
+ "-I$my_abs_srcdir $boost_cppflags $mpi_cppflags $gtest_cppflags $CPPFLAGS -isystem$my_abs_srcdir/$boost_ver_dir")
+AC_SUBST(LDFLAGS, "$mpi_ldflags $gtest_ldflags $LDFLAGS")
# Check for the MPI parallel computing library.
libs="$LIBS"
@@ -121,9 +146,9 @@ fi
AM_CONDITIONAL([HAVE_LIBMPI],
[test $ac_cv_header_mpi_h = yes -a $ac_cv_lib_mpi_MPI_Init = yes])
AC_SUBST(MPI_LIBS, "$LIBS")
+LIBS="$libs"
# Check for the math library.
-LIBS="$libs"
AC_CHECK_LIB([m], [sqrt])
AC_CHECK_FUNCS([pow sqrt])
AC_CHECK_FUNC(ceilf, [], AC_DEFINE(ceilf, [ceil],
@@ -143,9 +168,14 @@ AC_COMPILE_IFELSE(
# Check for the hash table implementation.
AC_LANG([C++])
AC_CHECK_HEADERS([ \
+ functional \
+ tr1/functional \
+ boost/functional/hash.hpp \
boost/property_map/property_map.hpp \
google/sparse_hash_map \
unordered_map tr1/unordered_map \
+ unordered_set tr1/unordered_set \
+ boost/unordered_set.hpp \
])
# Check for Boost.
@@ -154,12 +184,21 @@ if test $ac_cv_header_boost_property_map_property_map_hpp != yes; then
be downloaded from here: http://www.boost.org/users/download/
It is not necessary to compile Boost before installing it. The
following commands will download and install Boost for ABySS:
- wget http://downloads.sourceforge.net/project/boost/boost/1.50.0/boost_1_50_0.tar.bz2
- tar jxf boost_1_50_0.tar.bz2
- ln -s boost_1_50_0/boost boost
- ])
+ cd $my_abs_srcdir
+ wget http://downloads.sourceforge.net/project/boost/boost/$boost_ver/$boost_ver_dir.tar.bz2
+ tar jxf $boost_ver_dir.tar.bz2
+ cd -])
fi
+# Check for gtest
+libs="$LIBS"
+AC_CHECK_HEADERS([gtest/gtest.h])
+AC_CHECK_LIB([pthread], [pthread_create])
+AC_CHECK_LIB([gtest_main],[main])
+AM_CONDITIONAL([HAVE_GTEST], [test $ac_cv_header_gtest_gtest_h = yes -a $ac_cv_lib_gtest_main_main = yes])
+AC_SUBST(GTEST_LIBS, "$LIBS")
+LIBS=$libs
+
# Check for OpenMP.
AC_OPENMP
if test -z $OPENMP_CXXFLAGS; then
@@ -184,6 +223,7 @@ AC_CONFIG_FILES([
dialign/Makefile
kmerprint/Makefile
AdjList/Makefile
+ Konnector/Makefile
DAssembler/Makefile
DistanceEst/Makefile
Layout/Makefile
@@ -199,6 +239,10 @@ AC_CONFIG_FILES([
PathOverlap/Makefile
Consensus/Makefile
FilterGraph/Makefile
+ GapFiller/Makefile
+ Unittest/Makefile
+ LogKmerCount/Makefile
+ Bloom/Makefile
])
AC_OUTPUT
diff --git a/depcomp b/depcomp
deleted file mode 100755
index 4ebd5b3..0000000
--- a/depcomp
+++ /dev/null
@@ -1,791 +0,0 @@
-#! /bin/sh
-# depcomp - compile a program generating dependencies as side-effects
-
-scriptversion=2013-05-30.07; # UTC
-
-# Copyright (C) 1999-2013 Free Software Foundation, Inc.
-
-# This program is free software; you can redistribute it and/or modify
-# it under the terms of the GNU General Public License as published by
-# the Free Software Foundation; either version 2, or (at your option)
-# any later version.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY; without even the implied warranty of
-# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
-# GNU General Public License for more details.
-
-# You should have received a copy of the GNU General Public License
-# along with this program. If not, see <http://www.gnu.org/licenses/>.
-
-# As a special exception to the GNU General Public License, if you
-# distribute this file as part of a program that contains a
-# configuration script generated by Autoconf, you may include it under
-# the same distribution terms that you use for the rest of that program.
-
-# Originally written by Alexandre Oliva <oliva at dcc.unicamp.br>.
-
-case $1 in
- '')
- echo "$0: No command. Try '$0 --help' for more information." 1>&2
- exit 1;
- ;;
- -h | --h*)
- cat <<\EOF
-Usage: depcomp [--help] [--version] PROGRAM [ARGS]
-
-Run PROGRAMS ARGS to compile a file, generating dependencies
-as side-effects.
-
-Environment variables:
- depmode Dependency tracking mode.
- source Source file read by 'PROGRAMS ARGS'.
- object Object file output by 'PROGRAMS ARGS'.
- DEPDIR directory where to store dependencies.
- depfile Dependency file to output.
- tmpdepfile Temporary file to use when outputting dependencies.
- libtool Whether libtool is used (yes/no).
-
-Report bugs to <bug-automake at gnu.org>.
-EOF
- exit $?
- ;;
- -v | --v*)
- echo "depcomp $scriptversion"
- exit $?
- ;;
-esac
-
-# Get the directory component of the given path, and save it in the
-# global variables '$dir'. Note that this directory component will
-# be either empty or ending with a '/' character. This is deliberate.
-set_dir_from ()
-{
- case $1 in
- */*) dir=`echo "$1" | sed -e 's|/[^/]*$|/|'`;;
- *) dir=;;
- esac
-}
-
-# Get the suffix-stripped basename of the given path, and save it the
-# global variable '$base'.
-set_base_from ()
-{
- base=`echo "$1" | sed -e 's|^.*/||' -e 's/\.[^.]*$//'`
-}
-
-# If no dependency file was actually created by the compiler invocation,
-# we still have to create a dummy depfile, to avoid errors with the
-# Makefile "include basename.Plo" scheme.
-make_dummy_depfile ()
-{
- echo "#dummy" > "$depfile"
-}
-
-# Factor out some common post-processing of the generated depfile.
-# Requires the auxiliary global variable '$tmpdepfile' to be set.
-aix_post_process_depfile ()
-{
- # If the compiler actually managed to produce a dependency file,
- # post-process it.
- if test -f "$tmpdepfile"; then
- # Each line is of the form 'foo.o: dependency.h'.
- # Do two passes, one to just change these to
- # $object: dependency.h
- # and one to simply output
- # dependency.h:
- # which is needed to avoid the deleted-header problem.
- { sed -e "s,^.*\.[$lower]*:,$object:," < "$tmpdepfile"
- sed -e "s,^.*\.[$lower]*:[$tab ]*,," -e 's,$,:,' < "$tmpdepfile"
- } > "$depfile"
- rm -f "$tmpdepfile"
- else
- make_dummy_depfile
- fi
-}
-
-# A tabulation character.
-tab=' '
-# A newline character.
-nl='
-'
-# Character ranges might be problematic outside the C locale.
-# These definitions help.
-upper=ABCDEFGHIJKLMNOPQRSTUVWXYZ
-lower=abcdefghijklmnopqrstuvwxyz
-digits=0123456789
-alpha=${upper}${lower}
-
-if test -z "$depmode" || test -z "$source" || test -z "$object"; then
- echo "depcomp: Variables source, object and depmode must be set" 1>&2
- exit 1
-fi
-
-# Dependencies for sub/bar.o or sub/bar.obj go into sub/.deps/bar.Po.
-depfile=${depfile-`echo "$object" |
- sed 's|[^\\/]*$|'${DEPDIR-.deps}'/&|;s|\.\([^.]*\)$|.P\1|;s|Pobj$|Po|'`}
-tmpdepfile=${tmpdepfile-`echo "$depfile" | sed 's/\.\([^.]*\)$/.T\1/'`}
-
-rm -f "$tmpdepfile"
-
-# Avoid interferences from the environment.
-gccflag= dashmflag=
-
-# Some modes work just like other modes, but use different flags. We
-# parameterize here, but still list the modes in the big case below,
-# to make depend.m4 easier to write. Note that we *cannot* use a case
-# here, because this file can only contain one case statement.
-if test "$depmode" = hp; then
- # HP compiler uses -M and no extra arg.
- gccflag=-M
- depmode=gcc
-fi
-
-if test "$depmode" = dashXmstdout; then
- # This is just like dashmstdout with a different argument.
- dashmflag=-xM
- depmode=dashmstdout
-fi
-
-cygpath_u="cygpath -u -f -"
-if test "$depmode" = msvcmsys; then
- # This is just like msvisualcpp but w/o cygpath translation.
- # Just convert the backslash-escaped backslashes to single forward
- # slashes to satisfy depend.m4
- cygpath_u='sed s,\\\\,/,g'
- depmode=msvisualcpp
-fi
-
-if test "$depmode" = msvc7msys; then
- # This is just like msvc7 but w/o cygpath translation.
- # Just convert the backslash-escaped backslashes to single forward
- # slashes to satisfy depend.m4
- cygpath_u='sed s,\\\\,/,g'
- depmode=msvc7
-fi
-
-if test "$depmode" = xlc; then
- # IBM C/C++ Compilers xlc/xlC can output gcc-like dependency information.
- gccflag=-qmakedep=gcc,-MF
- depmode=gcc
-fi
-
-case "$depmode" in
-gcc3)
-## gcc 3 implements dependency tracking that does exactly what
-## we want. Yay! Note: for some reason libtool 1.4 doesn't like
-## it if -MD -MP comes after the -MF stuff. Hmm.
-## Unfortunately, FreeBSD c89 acceptance of flags depends upon
-## the command line argument order; so add the flags where they
-## appear in depend2.am. Note that the slowdown incurred here
-## affects only configure: in makefiles, %FASTDEP% shortcuts this.
- for arg
- do
- case $arg in
- -c) set fnord "$@" -MT "$object" -MD -MP -MF "$tmpdepfile" "$arg" ;;
- *) set fnord "$@" "$arg" ;;
- esac
- shift # fnord
- shift # $arg
- done
- "$@"
- stat=$?
- if test $stat -ne 0; then
- rm -f "$tmpdepfile"
- exit $stat
- fi
- mv "$tmpdepfile" "$depfile"
- ;;
-
-gcc)
-## Note that this doesn't just cater to obsosete pre-3.x GCC compilers.
-## but also to in-use compilers like IMB xlc/xlC and the HP C compiler.
-## (see the conditional assignment to $gccflag above).
-## There are various ways to get dependency output from gcc. Here's
-## why we pick this rather obscure method:
-## - Don't want to use -MD because we'd like the dependencies to end
-## up in a subdir. Having to rename by hand is ugly.
-## (We might end up doing this anyway to support other compilers.)
-## - The DEPENDENCIES_OUTPUT environment variable makes gcc act like
-## -MM, not -M (despite what the docs say). Also, it might not be
-## supported by the other compilers which use the 'gcc' depmode.
-## - Using -M directly means running the compiler twice (even worse
-## than renaming).
- if test -z "$gccflag"; then
- gccflag=-MD,
- fi
- "$@" -Wp,"$gccflag$tmpdepfile"
- stat=$?
- if test $stat -ne 0; then
- rm -f "$tmpdepfile"
- exit $stat
- fi
- rm -f "$depfile"
- echo "$object : \\" > "$depfile"
- # The second -e expression handles DOS-style file names with drive
- # letters.
- sed -e 's/^[^:]*: / /' \
- -e 's/^['$alpha']:\/[^:]*: / /' < "$tmpdepfile" >> "$depfile"
-## This next piece of magic avoids the "deleted header file" problem.
-## The problem is that when a header file which appears in a .P file
-## is deleted, the dependency causes make to die (because there is
-## typically no way to rebuild the header). We avoid this by adding
-## dummy dependencies for each header file. Too bad gcc doesn't do
-## this for us directly.
-## Some versions of gcc put a space before the ':'. On the theory
-## that the space means something, we add a space to the output as
-## well. hp depmode also adds that space, but also prefixes the VPATH
-## to the object. Take care to not repeat it in the output.
-## Some versions of the HPUX 10.20 sed can't process this invocation
-## correctly. Breaking it into two sed invocations is a workaround.
- tr ' ' "$nl" < "$tmpdepfile" \
- | sed -e 's/^\\$//' -e '/^$/d' -e "s|.*$object$||" -e '/:$/d' \
- | sed -e 's/$/ :/' >> "$depfile"
- rm -f "$tmpdepfile"
- ;;
-
-hp)
- # This case exists only to let depend.m4 do its work. It works by
- # looking at the text of this script. This case will never be run,
- # since it is checked for above.
- exit 1
- ;;
-
-sgi)
- if test "$libtool" = yes; then
- "$@" "-Wp,-MDupdate,$tmpdepfile"
- else
- "$@" -MDupdate "$tmpdepfile"
- fi
- stat=$?
- if test $stat -ne 0; then
- rm -f "$tmpdepfile"
- exit $stat
- fi
- rm -f "$depfile"
-
- if test -f "$tmpdepfile"; then # yes, the sourcefile depend on other files
- echo "$object : \\" > "$depfile"
- # Clip off the initial element (the dependent). Don't try to be
- # clever and replace this with sed code, as IRIX sed won't handle
- # lines with more than a fixed number of characters (4096 in
- # IRIX 6.2 sed, 8192 in IRIX 6.5). We also remove comment lines;
- # the IRIX cc adds comments like '#:fec' to the end of the
- # dependency line.
- tr ' ' "$nl" < "$tmpdepfile" \
- | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' \
- | tr "$nl" ' ' >> "$depfile"
- echo >> "$depfile"
- # The second pass generates a dummy entry for each header file.
- tr ' ' "$nl" < "$tmpdepfile" \
- | sed -e 's/^.*\.o://' -e 's/#.*$//' -e '/^$/ d' -e 's/$/:/' \
- >> "$depfile"
- else
- make_dummy_depfile
- fi
- rm -f "$tmpdepfile"
- ;;
-
-xlc)
- # This case exists only to let depend.m4 do its work. It works by
- # looking at the text of this script. This case will never be run,
- # since it is checked for above.
- exit 1
- ;;
-
-aix)
- # The C for AIX Compiler uses -M and outputs the dependencies
- # in a .u file. In older versions, this file always lives in the
- # current directory. Also, the AIX compiler puts '$object:' at the
- # start of each line; $object doesn't have directory information.
- # Version 6 uses the directory in both cases.
- set_dir_from "$object"
- set_base_from "$object"
- if test "$libtool" = yes; then
- tmpdepfile1=$dir$base.u
- tmpdepfile2=$base.u
- tmpdepfile3=$dir.libs/$base.u
- "$@" -Wc,-M
- else
- tmpdepfile1=$dir$base.u
- tmpdepfile2=$dir$base.u
- tmpdepfile3=$dir$base.u
- "$@" -M
- fi
- stat=$?
- if test $stat -ne 0; then
- rm -f "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
- exit $stat
- fi
-
- for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
- do
- test -f "$tmpdepfile" && break
- done
- aix_post_process_depfile
- ;;
-
-tcc)
- # tcc (Tiny C Compiler) understand '-MD -MF file' since version 0.9.26
- # FIXME: That version still under development at the moment of writing.
- # Make that this statement remains true also for stable, released
- # versions.
- # It will wrap lines (doesn't matter whether long or short) with a
- # trailing '\', as in:
- #
- # foo.o : \
- # foo.c \
- # foo.h \
- #
- # It will put a trailing '\' even on the last line, and will use leading
- # spaces rather than leading tabs (at least since its commit 0394caf7
- # "Emit spaces for -MD").
- "$@" -MD -MF "$tmpdepfile"
- stat=$?
- if test $stat -ne 0; then
- rm -f "$tmpdepfile"
- exit $stat
- fi
- rm -f "$depfile"
- # Each non-empty line is of the form 'foo.o : \' or ' dep.h \'.
- # We have to change lines of the first kind to '$object: \'.
- sed -e "s|.*:|$object :|" < "$tmpdepfile" > "$depfile"
- # And for each line of the second kind, we have to emit a 'dep.h:'
- # dummy dependency, to avoid the deleted-header problem.
- sed -n -e 's|^ *\(.*\) *\\$|\1:|p' < "$tmpdepfile" >> "$depfile"
- rm -f "$tmpdepfile"
- ;;
-
-## The order of this option in the case statement is important, since the
-## shell code in configure will try each of these formats in the order
-## listed in this file. A plain '-MD' option would be understood by many
-## compilers, so we must ensure this comes after the gcc and icc options.
-pgcc)
- # Portland's C compiler understands '-MD'.
- # Will always output deps to 'file.d' where file is the root name of the
- # source file under compilation, even if file resides in a subdirectory.
- # The object file name does not affect the name of the '.d' file.
- # pgcc 10.2 will output
- # foo.o: sub/foo.c sub/foo.h
- # and will wrap long lines using '\' :
- # foo.o: sub/foo.c ... \
- # sub/foo.h ... \
- # ...
- set_dir_from "$object"
- # Use the source, not the object, to determine the base name, since
- # that's sadly what pgcc will do too.
- set_base_from "$source"
- tmpdepfile=$base.d
-
- # For projects that build the same source file twice into different object
- # files, the pgcc approach of using the *source* file root name can cause
- # problems in parallel builds. Use a locking strategy to avoid stomping on
- # the same $tmpdepfile.
- lockdir=$base.d-lock
- trap "
- echo '$0: caught signal, cleaning up...' >&2
- rmdir '$lockdir'
- exit 1
- " 1 2 13 15
- numtries=100
- i=$numtries
- while test $i -gt 0; do
- # mkdir is a portable test-and-set.
- if mkdir "$lockdir" 2>/dev/null; then
- # This process acquired the lock.
- "$@" -MD
- stat=$?
- # Release the lock.
- rmdir "$lockdir"
- break
- else
- # If the lock is being held by a different process, wait
- # until the winning process is done or we timeout.
- while test -d "$lockdir" && test $i -gt 0; do
- sleep 1
- i=`expr $i - 1`
- done
- fi
- i=`expr $i - 1`
- done
- trap - 1 2 13 15
- if test $i -le 0; then
- echo "$0: failed to acquire lock after $numtries attempts" >&2
- echo "$0: check lockdir '$lockdir'" >&2
- exit 1
- fi
-
- if test $stat -ne 0; then
- rm -f "$tmpdepfile"
- exit $stat
- fi
- rm -f "$depfile"
- # Each line is of the form `foo.o: dependent.h',
- # or `foo.o: dep1.h dep2.h \', or ` dep3.h dep4.h \'.
- # Do two passes, one to just change these to
- # `$object: dependent.h' and one to simply `dependent.h:'.
- sed "s,^[^:]*:,$object :," < "$tmpdepfile" > "$depfile"
- # Some versions of the HPUX 10.20 sed can't process this invocation
- # correctly. Breaking it into two sed invocations is a workaround.
- sed 's,^[^:]*: \(.*\)$,\1,;s/^\\$//;/^$/d;/:$/d' < "$tmpdepfile" \
- | sed -e 's/$/ :/' >> "$depfile"
- rm -f "$tmpdepfile"
- ;;
-
-hp2)
- # The "hp" stanza above does not work with aCC (C++) and HP's ia64
- # compilers, which have integrated preprocessors. The correct option
- # to use with these is +Maked; it writes dependencies to a file named
- # 'foo.d', which lands next to the object file, wherever that
- # happens to be.
- # Much of this is similar to the tru64 case; see comments there.
- set_dir_from "$object"
- set_base_from "$object"
- if test "$libtool" = yes; then
- tmpdepfile1=$dir$base.d
- tmpdepfile2=$dir.libs/$base.d
- "$@" -Wc,+Maked
- else
- tmpdepfile1=$dir$base.d
- tmpdepfile2=$dir$base.d
- "$@" +Maked
- fi
- stat=$?
- if test $stat -ne 0; then
- rm -f "$tmpdepfile1" "$tmpdepfile2"
- exit $stat
- fi
-
- for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2"
- do
- test -f "$tmpdepfile" && break
- done
- if test -f "$tmpdepfile"; then
- sed -e "s,^.*\.[$lower]*:,$object:," "$tmpdepfile" > "$depfile"
- # Add 'dependent.h:' lines.
- sed -ne '2,${
- s/^ *//
- s/ \\*$//
- s/$/:/
- p
- }' "$tmpdepfile" >> "$depfile"
- else
- make_dummy_depfile
- fi
- rm -f "$tmpdepfile" "$tmpdepfile2"
- ;;
-
-tru64)
- # The Tru64 compiler uses -MD to generate dependencies as a side
- # effect. 'cc -MD -o foo.o ...' puts the dependencies into 'foo.o.d'.
- # At least on Alpha/Redhat 6.1, Compaq CCC V6.2-504 seems to put
- # dependencies in 'foo.d' instead, so we check for that too.
- # Subdirectories are respected.
- set_dir_from "$object"
- set_base_from "$object"
-
- if test "$libtool" = yes; then
- # Libtool generates 2 separate objects for the 2 libraries. These
- # two compilations output dependencies in $dir.libs/$base.o.d and
- # in $dir$base.o.d. We have to check for both files, because
- # one of the two compilations can be disabled. We should prefer
- # $dir$base.o.d over $dir.libs/$base.o.d because the latter is
- # automatically cleaned when .libs/ is deleted, while ignoring
- # the former would cause a distcleancheck panic.
- tmpdepfile1=$dir$base.o.d # libtool 1.5
- tmpdepfile2=$dir.libs/$base.o.d # Likewise.
- tmpdepfile3=$dir.libs/$base.d # Compaq CCC V6.2-504
- "$@" -Wc,-MD
- else
- tmpdepfile1=$dir$base.d
- tmpdepfile2=$dir$base.d
- tmpdepfile3=$dir$base.d
- "$@" -MD
- fi
-
- stat=$?
- if test $stat -ne 0; then
- rm -f "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
- exit $stat
- fi
-
- for tmpdepfile in "$tmpdepfile1" "$tmpdepfile2" "$tmpdepfile3"
- do
- test -f "$tmpdepfile" && break
- done
- # Same post-processing that is required for AIX mode.
- aix_post_process_depfile
- ;;
-
-msvc7)
- if test "$libtool" = yes; then
- showIncludes=-Wc,-showIncludes
- else
- showIncludes=-showIncludes
- fi
- "$@" $showIncludes > "$tmpdepfile"
- stat=$?
- grep -v '^Note: including file: ' "$tmpdepfile"
- if test $stat -ne 0; then
- rm -f "$tmpdepfile"
- exit $stat
- fi
- rm -f "$depfile"
- echo "$object : \\" > "$depfile"
- # The first sed program below extracts the file names and escapes
- # backslashes for cygpath. The second sed program outputs the file
- # name when reading, but also accumulates all include files in the
- # hold buffer in order to output them again at the end. This only
- # works with sed implementations that can handle large buffers.
- sed < "$tmpdepfile" -n '
-/^Note: including file: *\(.*\)/ {
- s//\1/
- s/\\/\\\\/g
- p
-}' | $cygpath_u | sort -u | sed -n '
-s/ /\\ /g
-s/\(.*\)/'"$tab"'\1 \\/p
-s/.\(.*\) \\/\1:/
-H
-$ {
- s/.*/'"$tab"'/
- G
- p
-}' >> "$depfile"
- echo >> "$depfile" # make sure the fragment doesn't end with a backslash
- rm -f "$tmpdepfile"
- ;;
-
-msvc7msys)
- # This case exists only to let depend.m4 do its work. It works by
- # looking at the text of this script. This case will never be run,
- # since it is checked for above.
- exit 1
- ;;
-
-#nosideeffect)
- # This comment above is used by automake to tell side-effect
- # dependency tracking mechanisms from slower ones.
-
-dashmstdout)
- # Important note: in order to support this mode, a compiler *must*
- # always write the preprocessed file to stdout, regardless of -o.
- "$@" || exit $?
-
- # Remove the call to Libtool.
- if test "$libtool" = yes; then
- while test "X$1" != 'X--mode=compile'; do
- shift
- done
- shift
- fi
-
- # Remove '-o $object'.
- IFS=" "
- for arg
- do
- case $arg in
- -o)
- shift
- ;;
- $object)
- shift
- ;;
- *)
- set fnord "$@" "$arg"
- shift # fnord
- shift # $arg
- ;;
- esac
- done
-
- test -z "$dashmflag" && dashmflag=-M
- # Require at least two characters before searching for ':'
- # in the target name. This is to cope with DOS-style filenames:
- # a dependency such as 'c:/foo/bar' could be seen as target 'c' otherwise.
- "$@" $dashmflag |
- sed "s|^[$tab ]*[^:$tab ][^:][^:]*:[$tab ]*|$object: |" > "$tmpdepfile"
- rm -f "$depfile"
- cat < "$tmpdepfile" > "$depfile"
- # Some versions of the HPUX 10.20 sed can't process this sed invocation
- # correctly. Breaking it into two sed invocations is a workaround.
- tr ' ' "$nl" < "$tmpdepfile" \
- | sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' \
- | sed -e 's/$/ :/' >> "$depfile"
- rm -f "$tmpdepfile"
- ;;
-
-dashXmstdout)
- # This case only exists to satisfy depend.m4. It is never actually
- # run, as this mode is specially recognized in the preamble.
- exit 1
- ;;
-
-makedepend)
- "$@" || exit $?
- # Remove any Libtool call
- if test "$libtool" = yes; then
- while test "X$1" != 'X--mode=compile'; do
- shift
- done
- shift
- fi
- # X makedepend
- shift
- cleared=no eat=no
- for arg
- do
- case $cleared in
- no)
- set ""; shift
- cleared=yes ;;
- esac
- if test $eat = yes; then
- eat=no
- continue
- fi
- case "$arg" in
- -D*|-I*)
- set fnord "$@" "$arg"; shift ;;
- # Strip any option that makedepend may not understand. Remove
- # the object too, otherwise makedepend will parse it as a source file.
- -arch)
- eat=yes ;;
- -*|$object)
- ;;
- *)
- set fnord "$@" "$arg"; shift ;;
- esac
- done
- obj_suffix=`echo "$object" | sed 's/^.*\././'`
- touch "$tmpdepfile"
- ${MAKEDEPEND-makedepend} -o"$obj_suffix" -f"$tmpdepfile" "$@"
- rm -f "$depfile"
- # makedepend may prepend the VPATH from the source file name to the object.
- # No need to regex-escape $object, excess matching of '.' is harmless.
- sed "s|^.*\($object *:\)|\1|" "$tmpdepfile" > "$depfile"
- # Some versions of the HPUX 10.20 sed can't process the last invocation
- # correctly. Breaking it into two sed invocations is a workaround.
- sed '1,2d' "$tmpdepfile" \
- | tr ' ' "$nl" \
- | sed -e 's/^\\$//' -e '/^$/d' -e '/:$/d' \
- | sed -e 's/$/ :/' >> "$depfile"
- rm -f "$tmpdepfile" "$tmpdepfile".bak
- ;;
-
-cpp)
- # Important note: in order to support this mode, a compiler *must*
- # always write the preprocessed file to stdout.
- "$@" || exit $?
-
- # Remove the call to Libtool.
- if test "$libtool" = yes; then
- while test "X$1" != 'X--mode=compile'; do
- shift
- done
- shift
- fi
-
- # Remove '-o $object'.
- IFS=" "
- for arg
- do
- case $arg in
- -o)
- shift
- ;;
- $object)
- shift
- ;;
- *)
- set fnord "$@" "$arg"
- shift # fnord
- shift # $arg
- ;;
- esac
- done
-
- "$@" -E \
- | sed -n -e '/^# [0-9][0-9]* "\([^"]*\)".*/ s:: \1 \\:p' \
- -e '/^#line [0-9][0-9]* "\([^"]*\)".*/ s:: \1 \\:p' \
- | sed '$ s: \\$::' > "$tmpdepfile"
- rm -f "$depfile"
- echo "$object : \\" > "$depfile"
- cat < "$tmpdepfile" >> "$depfile"
- sed < "$tmpdepfile" '/^$/d;s/^ //;s/ \\$//;s/$/ :/' >> "$depfile"
- rm -f "$tmpdepfile"
- ;;
-
-msvisualcpp)
- # Important note: in order to support this mode, a compiler *must*
- # always write the preprocessed file to stdout.
- "$@" || exit $?
-
- # Remove the call to Libtool.
- if test "$libtool" = yes; then
- while test "X$1" != 'X--mode=compile'; do
- shift
- done
- shift
- fi
-
- IFS=" "
- for arg
- do
- case "$arg" in
- -o)
- shift
- ;;
- $object)
- shift
- ;;
- "-Gm"|"/Gm"|"-Gi"|"/Gi"|"-ZI"|"/ZI")
- set fnord "$@"
- shift
- shift
- ;;
- *)
- set fnord "$@" "$arg"
- shift
- shift
- ;;
- esac
- done
- "$@" -E 2>/dev/null |
- sed -n '/^#line [0-9][0-9]* "\([^"]*\)"/ s::\1:p' | $cygpath_u | sort -u > "$tmpdepfile"
- rm -f "$depfile"
- echo "$object : \\" > "$depfile"
- sed < "$tmpdepfile" -n -e 's% %\\ %g' -e '/^\(.*\)$/ s::'"$tab"'\1 \\:p' >> "$depfile"
- echo "$tab" >> "$depfile"
- sed < "$tmpdepfile" -n -e 's% %\\ %g' -e '/^\(.*\)$/ s::\1\::p' >> "$depfile"
- rm -f "$tmpdepfile"
- ;;
-
-msvcmsys)
- # This case exists only to let depend.m4 do its work. It works by
- # looking at the text of this script. This case will never be run,
- # since it is checked for above.
- exit 1
- ;;
-
-none)
- exec "$@"
- ;;
-
-*)
- echo "Unknown depmode $depmode" 1>&2
- exit 1
- ;;
-esac
-
-exit 0
-
-# Local Variables:
-# mode: shell-script
-# sh-indentation: 2
-# eval: (add-hook 'write-file-hooks 'time-stamp)
-# time-stamp-start: "scriptversion="
-# time-stamp-format: "%:y-%02m-%02d.%02H"
-# time-stamp-time-zone: "UTC"
-# time-stamp-end: "; # UTC"
-# End:
diff --git a/dialign/Makefile.in b/dialign/Makefile.in
deleted file mode 100644
index 7369f7d..0000000
--- a/dialign/Makefile.in
+++ /dev/null
@@ -1,559 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-noinst_PROGRAMS = dialign$(EXEEXT)
-subdir = dialign
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-LIBRARIES = $(noinst_LIBRARIES)
-AR = ar
-ARFLAGS = cru
-AM_V_AR = $(am__v_AR_ at AM_V@)
-am__v_AR_ = $(am__v_AR_ at AM_DEFAULT_V@)
-am__v_AR_0 = @echo " AR " $@;
-am__v_AR_1 =
-libdialign_a_AR = $(AR) $(ARFLAGS)
-libdialign_a_LIBADD =
-am_libdialign_a_OBJECTS = alig.$(OBJEXT) assemble.$(OBJEXT) \
- diag.$(OBJEXT) io.$(OBJEXT) orf.$(OBJEXT) parameters.$(OBJEXT) \
- prob.$(OBJEXT) translate.$(OBJEXT)
-libdialign_a_OBJECTS = $(am_libdialign_a_OBJECTS)
-PROGRAMS = $(noinst_PROGRAMS)
-am_dialign_OBJECTS = museq.$(OBJEXT)
-dialign_OBJECTS = $(am_dialign_OBJECTS)
-dialign_DEPENDENCIES = libdialign.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \
- $(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)
-AM_V_CC = $(am__v_CC_ at AM_V@)
-am__v_CC_ = $(am__v_CC_ at AM_DEFAULT_V@)
-am__v_CC_0 = @echo " CC " $@;
-am__v_CC_1 =
-CCLD = $(CC)
-LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@
-AM_V_CCLD = $(am__v_CCLD_ at AM_V@)
-am__v_CCLD_ = $(am__v_CCLD_ at AM_DEFAULT_V@)
-am__v_CCLD_0 = @echo " CCLD " $@;
-am__v_CCLD_1 =
-SOURCES = $(libdialign_a_SOURCES) $(dialign_SOURCES)
-DIST_SOURCES = $(libdialign_a_SOURCES) $(dialign_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-noinst_LIBRARIES = libdialign.a
-libdialign_a_SOURCES = \
- alig.c \
- assemble.c \
- diag.c \
- io.c io.h \
- orf.c orf.h \
- parameters.c parameters.h \
- prob.c \
- struct.h \
- translate.c translate.h
-
-dialign_SOURCES = museq.c
-dialign_LDADD = libdialign.a
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .c .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign dialign/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign dialign/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-
-clean-noinstLIBRARIES:
- -test -z "$(noinst_LIBRARIES)" || rm -f $(noinst_LIBRARIES)
-
-libdialign.a: $(libdialign_a_OBJECTS) $(libdialign_a_DEPENDENCIES) $(EXTRA_libdialign_a_DEPENDENCIES)
- $(AM_V_at)-rm -f libdialign.a
- $(AM_V_AR)$(libdialign_a_AR) libdialign.a $(libdialign_a_OBJECTS) $(libdialign_a_LIBADD)
- $(AM_V_at)$(RANLIB) libdialign.a
-
-clean-noinstPROGRAMS:
- -test -z "$(noinst_PROGRAMS)" || rm -f $(noinst_PROGRAMS)
-
-dialign$(EXEEXT): $(dialign_OBJECTS) $(dialign_DEPENDENCIES) $(EXTRA_dialign_DEPENDENCIES)
- @rm -f dialign$(EXEEXT)
- $(AM_V_CCLD)$(LINK) $(dialign_OBJECTS) $(dialign_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/alig.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/assemble.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/diag.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/io.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/museq.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/orf.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/parameters.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/prob.Po at am__quote@
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/translate.Po at am__quote@
-
-.c.o:
- at am__fastdepCC_TRUE@ $(AM_V_CC)$(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(COMPILE) -c -o $@ $<
-
-.c.obj:
- at am__fastdepCC_TRUE@ $(AM_V_CC)$(COMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCC_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCC_FALSE@ $(AM_V_CC)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCC_FALSE@ DEPDIR=$(DEPDIR) $(CCDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCC_FALSE@ $(AM_V_CC at am__nodep@)$(COMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(LIBRARIES) $(PROGRAMS)
-installdirs:
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-generic clean-noinstLIBRARIES clean-noinstPROGRAMS \
- mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am:
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am:
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean clean-generic \
- clean-noinstLIBRARIES clean-noinstPROGRAMS cscopelist-am ctags \
- ctags-am distclean distclean-compile distclean-generic \
- distclean-tags distdir dvi dvi-am html html-am info info-am \
- install install-am install-data install-data-am install-dvi \
- install-dvi-am install-exec install-exec-am install-html \
- install-html-am install-info install-info-am install-man \
- install-pdf install-pdf-am install-ps install-ps-am \
- install-strip installcheck installcheck-am installdirs \
- maintainer-clean maintainer-clean-generic mostlyclean \
- mostlyclean-compile mostlyclean-generic pdf pdf-am ps ps-am \
- tags tags-am uninstall uninstall-am
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/doc/ABYSS.1 b/doc/ABYSS.1
index 7a3d970..ce3b3fb 100644
--- a/doc/ABYSS.1
+++ b/doc/ABYSS.1
@@ -1,4 +1,4 @@
-.TH ABYSS "1" "2013-Jul" "ABYSS (ABySS) 1.3.6" "User Commands"
+.TH ABYSS "1" "2014-May" "ABYSS (ABySS) 1.5.2" "User Commands"
.SH NAME
ABYSS \- assemble short reads into contigs
.SH SYNOPSIS
@@ -33,6 +33,9 @@ do not trim masked bases from the ends of reads
trim bases from the ends of reads whose quality is less than the
threshold
.TP
+\fB-Q\fR, \fB--mask-quality\fR=\fITHRESHOLD\fR
+mask all bases in reads whose quality is less than the threshold
+.TP
\fB--standard-quality\fR
zero quality is `!' (33)
.br
@@ -91,4 +94,4 @@ Written by Jared Simpson and Shaun Jackman.
.SH "REPORTING BUGS"
Report bugs to <abyss-users at bcgsc.ca>.
.SH COPYRIGHT
-Copyright 2013 Canada's Michael Smith Genome Science Centre
+Copyright 2014 Canada's Michael Smith Genome Sciences Centre
diff --git a/doc/Makefile.am b/doc/Makefile.am
index add4805..77b6dec 100644
--- a/doc/Makefile.am
+++ b/doc/Makefile.am
@@ -1,2 +1,2 @@
dist_man_MANS = ABYSS.1 abyss-pe.1 abyss-tofastq.1
-dist_doc_DATA = flowchart.pdf
+dist_doc_DATA = flowchart.pdf flowchart_simplified.pdf
diff --git a/doc/Makefile.in b/doc/Makefile.in
deleted file mode 100644
index 79fa43b..0000000
--- a/doc/Makefile.in
+++ /dev/null
@@ -1,499 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-subdir = doc
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(dist_man_MANS) $(dist_doc_DATA)
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-SOURCES =
-DIST_SOURCES =
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed 's|.|.|g'`;
-am__vpath_adj = case $$p in \
- $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \
- *) f=$$p;; \
- esac;
-am__strip_dir = f=`echo $$p | sed -e 's|^.*/||'`;
-am__install_max = 40
-am__nobase_strip_setup = \
- srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*|]/\\\\&/g'`
-am__nobase_strip = \
- for p in $$list; do echo "$$p"; done | sed -e "s|$$srcdirstrip/||"
-am__nobase_list = $(am__nobase_strip_setup); \
- for p in $$list; do echo "$$p $$p"; done | \
- sed "s| $$srcdirstrip/| |;"' / .*\//!s/ .*/ ./; s,\( .*\)/[^/]*$$,\1,' | \
- $(AWK) 'BEGIN { files["."] = "" } { files[$$2] = files[$$2] " " $$1; \
- if (++n[$$2] == $(am__install_max)) \
- { print $$2, files[$$2]; n[$$2] = 0; files[$$2] = "" } } \
- END { for (dir in files) print dir, files[dir] }'
-am__base_list = \
- sed '$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;$$!N;s/\n/ /g' | \
- sed '$$!N;$$!N;$$!N;$$!N;s/\n/ /g'
-am__uninstall_files_from_dir = { \
- test -z "$$files" \
- || { test ! -d "$$dir" && test ! -f "$$dir" && test ! -r "$$dir"; } \
- || { echo " ( cd '$$dir' && rm -f" $$files ")"; \
- $(am__cd) "$$dir" && rm -f $$files; }; \
- }
-man1dir = $(mandir)/man1
-am__installdirs = "$(DESTDIR)$(man1dir)" "$(DESTDIR)$(docdir)"
-NROFF = nroff
-MANS = $(dist_man_MANS)
-DATA = $(dist_doc_DATA)
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-dist_man_MANS = ABYSS.1 abyss-pe.1 abyss-tofastq.1
-dist_doc_DATA = flowchart.pdf
-all: all-am
-
-.SUFFIXES:
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign doc/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign doc/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-install-man1: $(dist_man_MANS)
- @$(NORMAL_INSTALL)
- @list1=''; \
- list2='$(dist_man_MANS)'; \
- test -n "$(man1dir)" \
- && test -n "`echo $$list1$$list2`" \
- || exit 0; \
- echo " $(MKDIR_P) '$(DESTDIR)$(man1dir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(man1dir)" || exit 1; \
- { for i in $$list1; do echo "$$i"; done; \
- if test -n "$$list2"; then \
- for i in $$list2; do echo "$$i"; done \
- | sed -n '/\.1[a-z]*$$/p'; \
- fi; \
- } | while read p; do \
- if test -f $$p; then d=; else d="$(srcdir)/"; fi; \
- echo "$$d$$p"; echo "$$p"; \
- done | \
- sed -e 'n;s,.*/,,;p;h;s,.*\.,,;s,^[^1][0-9a-z]*$$,1,;x' \
- -e 's,\.[0-9a-z]*$$,,;$(transform);G;s,\n,.,' | \
- sed 'N;N;s,\n, ,g' | { \
- list=; while read file base inst; do \
- if test "$$base" = "$$inst"; then list="$$list $$file"; else \
- echo " $(INSTALL_DATA) '$$file' '$(DESTDIR)$(man1dir)/$$inst'"; \
- $(INSTALL_DATA) "$$file" "$(DESTDIR)$(man1dir)/$$inst" || exit $$?; \
- fi; \
- done; \
- for i in $$list; do echo "$$i"; done | $(am__base_list) | \
- while read files; do \
- test -z "$$files" || { \
- echo " $(INSTALL_DATA) $$files '$(DESTDIR)$(man1dir)'"; \
- $(INSTALL_DATA) $$files "$(DESTDIR)$(man1dir)" || exit $$?; }; \
- done; }
-
-uninstall-man1:
- @$(NORMAL_UNINSTALL)
- @list=''; test -n "$(man1dir)" || exit 0; \
- files=`{ for i in $$list; do echo "$$i"; done; \
- l2='$(dist_man_MANS)'; for i in $$l2; do echo "$$i"; done | \
- sed -n '/\.1[a-z]*$$/p'; \
- } | sed -e 's,.*/,,;h;s,.*\.,,;s,^[^1][0-9a-z]*$$,1,;x' \
- -e 's,\.[0-9a-z]*$$,,;$(transform);G;s,\n,.,'`; \
- dir='$(DESTDIR)$(man1dir)'; $(am__uninstall_files_from_dir)
-install-dist_docDATA: $(dist_doc_DATA)
- @$(NORMAL_INSTALL)
- @list='$(dist_doc_DATA)'; test -n "$(docdir)" || list=; \
- if test -n "$$list"; then \
- echo " $(MKDIR_P) '$(DESTDIR)$(docdir)'"; \
- $(MKDIR_P) "$(DESTDIR)$(docdir)" || exit 1; \
- fi; \
- for p in $$list; do \
- if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \
- echo "$$d$$p"; \
- done | $(am__base_list) | \
- while read files; do \
- echo " $(INSTALL_DATA) $$files '$(DESTDIR)$(docdir)'"; \
- $(INSTALL_DATA) $$files "$(DESTDIR)$(docdir)" || exit $$?; \
- done
-
-uninstall-dist_docDATA:
- @$(NORMAL_UNINSTALL)
- @list='$(dist_doc_DATA)'; test -n "$(docdir)" || list=; \
- files=`for p in $$list; do echo $$p; done | sed -e 's|^.*/||'`; \
- dir='$(DESTDIR)$(docdir)'; $(am__uninstall_files_from_dir)
-tags TAGS:
-
-ctags CTAGS:
-
-cscope cscopelist:
-
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(MANS) $(DATA)
-installdirs:
- for dir in "$(DESTDIR)$(man1dir)" "$(DESTDIR)$(docdir)"; do \
- test -z "$$dir" || $(MKDIR_P) "$$dir"; \
- done
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-generic mostlyclean-am
-
-distclean: distclean-am
- -rm -f Makefile
-distclean-am: clean-am distclean-generic
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am: install-dist_docDATA install-man
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am:
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man: install-man1
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am: uninstall-dist_docDATA uninstall-man
-
-uninstall-man: uninstall-man1
-
-.MAKE: install-am install-strip
-
-.PHONY: all all-am check check-am clean clean-generic cscopelist-am \
- ctags-am distclean distclean-generic distdir dvi dvi-am html \
- html-am info info-am install install-am install-data \
- install-data-am install-dist_docDATA install-dvi \
- install-dvi-am install-exec install-exec-am install-html \
- install-html-am install-info install-info-am install-man \
- install-man1 install-pdf install-pdf-am install-ps \
- install-ps-am install-strip installcheck installcheck-am \
- installdirs maintainer-clean maintainer-clean-generic \
- mostlyclean mostlyclean-generic pdf pdf-am ps ps-am tags-am \
- uninstall uninstall-am uninstall-dist_docDATA uninstall-man \
- uninstall-man1
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/doc/abyss-pe.1 b/doc/abyss-pe.1
index fdf6439..42385af 100644
--- a/doc/abyss-pe.1
+++ b/doc/abyss-pe.1
@@ -1,4 +1,4 @@
-.TH abyss-pe "1" "2013-Jul" "abyss-pe (ABySS) 1.3.6" "User Commands"
+.TH abyss-pe "1" "2014-May" "abyss-pe (ABySS) 1.5.2" "User Commands"
.SH NAME
abyss-pe - assemble reads into contigs
.SH SYNOPSIS
@@ -38,6 +38,10 @@ sequence.
list of mate-pair libraries that will be used for scaffolding.
Mate-pair libraries do not contribute toward the consensus sequence.
.TP
+.B long
+list of long sequence libraries that will be used for rescaffolding.
+long sequence libraries do not contribute toward the consensus sequence.
+.TP
.B se
files containing single-end reads
.TP
@@ -81,10 +85,15 @@ minimum number of pairs required for building scaffolds [n]
minimum sequence identity of a bubble [0.9]
.TP
.B q
-minimum base quality [3]
+minimum base quality when trimming [3]
.br
Trim bases from the ends of reads whose quality is less q.
.TP
+.B Q
+minimum base quality [0]
+.br
+Mask all bases of reads whose quality is less than Q as `N'.
+.TP
.B s
minimum unitig size required for building contigs (bp) [200]
.br
@@ -94,6 +103,13 @@ sequence is assembled than the expected genome size, try increasing s.
.B S
minimum contig size required for building scaffolds (bp) [s]
.TP
+.B SS
+SS=--SS to assemble in strand-specific mode
+.br
+Requires that all libraries are strand-specific RNA-Seq libraries.
+Assumes that the first read in a read pair is reveresed WRT the
+transcripts sequenced.
+.TP
.B t
minimum tip size (bp) [2k]
.TP
@@ -129,10 +145,16 @@ Assemble unitigs.
Output the unitig overlap graph.
.TP
.B pe-sam
-Map paired-end reads to the unitigs and output a SAM file.
+Map paired-end reads to the unitigs and output a SAM file. SAM file
+will only contain reads mapping to different contigs, and the read
+ID, sequence and quality strings will be replaced with '*'
+characters.
.TP
.B pe-bam
-Map paired-end reads to the unitigs and output a BAM file.
+Map paired-end reads to the unitigs and output a BAM file. BAM file
+will only contain reads mapping to different contigs, and the read
+ID, sequence and quality strings will be replaced with '*'
+characters.
.TP
.B pe-index
Generate an index of the unitigs used by abyss-map.
@@ -144,10 +166,16 @@ Assemble contigs.
Output the contig overlap graph.
.TP
.B mp-sam
-Map mate-pair reads to the contigs and output a SAM file.
+Map mate-pair reads to the contigs and output a SAM file. SAM file
+will only contain reads mapping to different contigs, and the read
+ID, sequence and quality strings will be replaced with '*'
+characters.
.TP
.B mp-bam
-Map mate-pair reads to the contigs and output a BAM file.
+Map mate-pair reads to the contigs and output a BAM file. BAM file
+will only contain reads mapping to different contigs, and the read
+ID, sequence and quality strings will be replaced with '*'
+characters.
.TP
.B mp-index
Generate an index of the contigs used by abyss-map.
@@ -158,6 +186,15 @@ Assemble scaffolds.
.B scaffolds-dot
Output the scaffold overlap graph.
.TP
+.B scaftigs
+Break scaffolds and generate AGP file.
+.TP
+.B long-scaffs
+Rescaffold using RNA-Seq assembled contigs.
+.TP
+.B long-scaffs-dot
+Output the RNA scaffold overlap graph.
+.TP
.B stats
Display assembly contiguity statistics.
.TP
@@ -210,6 +247,12 @@ similarly for other schedulers.
mp1='mp1_1.fa mp1_2.fa' mp2='mp2_1.fa mp2_2.fa' \\
.br
se='se1.fa se2.fa'
+.SS "Including RNA-Seq assemblies
+ abyss-pe k=64 name=ecoli lib=pe1 mp=mp1 long=long1 \\
+.br
+ pe1='pe1_1.fa pe1_2.fa' mp1='mp1_1.fa mp1_2.fa' \\
+.br
+ long1=long1.fa
.SS MPI
abyss-pe np=8 k=64 name=ecoli in='reads1.fa reads2.fa'
.SS SGE
@@ -223,4 +266,4 @@ Written by Shaun Jackman.
.SH "REPORTING BUGS"
Report bugs to <abyss-users at googlegroups.com>.
.SH COPYRIGHT
-Copyright 2013 Canada's Michael Smith Genome Science Centre
+Copyright 2014 Canada's Michael Smith Genome Sciences Centre
diff --git a/doc/abyss-tofastq.1 b/doc/abyss-tofastq.1
index 71c315a..1d8e9ec 100644
--- a/doc/abyss-tofastq.1
+++ b/doc/abyss-tofastq.1
@@ -1,4 +1,4 @@
-.TH abyss-tofastq "1" "2013-Jul" "ABySS 1.3.6" "User Commands"
+.TH abyss-tofastq "1" "2014-May" "ABySS 1.5.2" "User Commands"
.SH NAME
abyss-tofastq \- convert various file formats to FASTQ format
.br
@@ -18,4 +18,4 @@ Written by Shaun Jackman.
.SH "REPORTING BUGS"
Report bugs to <abyss-users at bcgsc.ca>.
.SH COPYRIGHT
-Copyright 2013 Canada's Michael Smith Genome Science Centre
+Copyright 2014 Canada's Michael Smith Genome Sciences Centre
diff --git a/doc/flowchart.graffle b/doc/flowchart.graffle
new file mode 100644
index 0000000..fa3d897
--- /dev/null
+++ b/doc/flowchart.graffle
@@ -0,0 +1,8498 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd">
+<plist version="1.0">
+<dict>
+ <key>ActiveLayerIndex</key>
+ <integer>0</integer>
+ <key>ApplicationVersion</key>
+ <array>
+ <string>com.omnigroup.OmniGraffle</string>
+ <string>139.18.0.187838</string>
+ </array>
+ <key>AutoAdjust</key>
+ <true/>
+ <key>BackgroundGraphic</key>
+ <dict>
+ <key>Bounds</key>
+ <string>{{0, 0}, {1097.8582763671875, 3342.57470703125}}</string>
+ <key>Class</key>
+ <string>SolidGraphic</string>
+ <key>ID</key>
+ <integer>2</integer>
+ <key>Style</key>
+ <dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>BaseZoom</key>
+ <integer>0</integer>
+ <key>CanvasOrigin</key>
+ <string>{0, 0}</string>
+ <key>ColumnAlign</key>
+ <integer>1</integer>
+ <key>ColumnSpacing</key>
+ <real>36</real>
+ <key>CreationDate</key>
+ <string>2010-09-03 17:10:07 +0000</string>
+ <key>Creator</key>
+ <string>Rod Docking</string>
+ <key>DisplayScale</key>
+ <string>1 0/72 in = 1.0000 in</string>
+ <key>GraphDocumentVersion</key>
+ <integer>8</integer>
+ <key>GraphicsList</key>
+ <array>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>309</integer>
+ </dict>
+ <key>ID</key>
+ <integer>312</integer>
+ <key>Points</key>
+ <array>
+ <string>{861.5, 641.5999755859375}</string>
+ <string>{899, 641.5999755859375}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>310</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>310</integer>
+ <key>Info</key>
+ <integer>4</integer>
+ </dict>
+ <key>ID</key>
+ <integer>311</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 623.59996871948238}</string>
+ <string>{589, 638}</string>
+ <string>{746, 641}</string>
+ <string>{811, 641.5999755859375}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>209</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{811, 623.5999755859375}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>310</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ln}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{899, 632.5999755859375}, {117.75, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>309</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0.501961</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-unitigs.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>305</integer>
+ </dict>
+ <key>ID</key>
+ <integer>308</integer>
+ <key>Points</key>
+ <array>
+ <string>{632.4375, 2588.650146484375}</string>
+ <string>{631.9375, 2625.0004119873047}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>303</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>303</integer>
+ </dict>
+ <key>ID</key>
+ <integer>307</integer>
+ <key>Points</key>
+ <array>
+ <string>{631.6875, 2534.2999649047852}</string>
+ <string>{632.4375, 2570.650146484375}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>285</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>304</integer>
+ </dict>
+ <key>ID</key>
+ <integer>306</integer>
+ <key>Points</key>
+ <array>
+ <string>{631.9375, 2661.0004119873047}</string>
+ <string>{631.59375, 2697.3503723144531}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>305</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{606.6875, 2625.0004119873047}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>305</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ln}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{572.1875, 2697.3503723144531}, {118.8125, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>304</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0.501961</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-scaffolds.dot}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{587.4375, 2570.650146484375}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>303</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-8.dot}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>285</integer>
+ </dict>
+ <key>ID</key>
+ <integer>302</integer>
+ <key>Points</key>
+ <array>
+ <string>{631.93753814697266, 2379.4999351501465}</string>
+ <string>{631.6875, 2498.2999649047852}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>289</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>285</integer>
+ </dict>
+ <key>ID</key>
+ <integer>301</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.9375, 2379.4999675750732}</string>
+ <string>{631.6875, 2498.2999649047852}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>260</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>267</integer>
+ </dict>
+ <key>ID</key>
+ <integer>300</integer>
+ <key>Points</key>
+ <array>
+ <string>{508.1875, 2661}</string>
+ <string>{507.9375, 2697.3499603271484}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>297</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>297</integer>
+ </dict>
+ <key>ID</key>
+ <integer>299</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.9375, 2588.6500396728516}</string>
+ <string>{508.1875, 2625}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>296</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>296</integer>
+ </dict>
+ <key>ID</key>
+ <integer>298</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.9375, 2534.3000801086428}</string>
+ <string>{507.9375, 2570.6500396728516}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>263</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{482.9375, 2625}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>297</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ln}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{462.9375, 2570.6500396728516}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>296</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-8.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>263</integer>
+ </dict>
+ <key>ID</key>
+ <integer>295</integer>
+ <key>Points</key>
+ <array>
+ <string>{631.93753814697266, 2379.4999351501465}</string>
+ <string>{507.9375, 2498.3000801086428}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>289</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>263</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>294</integer>
+ <key>Points</key>
+ <array>
+ <string>{389.9375, 2449.8999671936035}</string>
+ <string>{507.9375, 2498.3000801086428}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>287</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>289</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>293</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.9375, 2327.0999687194826}</string>
+ <string>{631.93753814697266, 2361.4999351501465}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>257</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>288</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>292</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.9375, 2327.0999687194826}</string>
+ <string>{389.93749267578119, 2361.4999675750732}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>257</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>287</integer>
+ </dict>
+ <key>ID</key>
+ <integer>291</integer>
+ <key>Points</key>
+ <array>
+ <string>{389.93749267578119, 2379.4999675750732}</string>
+ <string>{389.9375, 2413.8999671936035}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>288</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>287</integer>
+ </dict>
+ <key>ID</key>
+ <integer>290</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.9375, 1823.3999687194826}</string>
+ <string>{295, 2015.4999687194825}</string>
+ <string>{310, 2337}</string>
+ <string>{389.9375, 2413.8999671936035}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>216</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{586.93753814697266, 2361.4999351501465}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>289</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-7.adj}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{344.93749267578119, 2361.4999675750732}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>288</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-7.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{364.6875, 2413.8999671936035}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>287</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 cat}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{584.4375, 2498.2999649047852}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>285</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 PathOverlap\
+--overlap}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 324.5999641418457}, {117, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>284</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Filter out shim contigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>63</integer>
+ </dict>
+ <key>ID</key>
+ <integer>283</integer>
+ <key>Points</key>
+ <array>
+ <string>{505.1875, 396.59997940063477}</string>
+ <string>{504.6875, 426.79996871948242}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>280</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{460.1875, 378.59997940063477}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>280</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-2.adj}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>278</integer>
+ </dict>
+ <key>ID</key>
+ <integer>279</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.75, 284}</string>
+ <string>{505.1875, 313.59998893737793}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>57</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{460.1875, 313.59998893737793}, {90, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>278</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 FilterGraph}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 2188.0999687194826}, {220.0625, 28}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>Vertical</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>275</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Align</key>
+ <integer>0</integer>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural
+
+\f0\fs24 \cf0 Scaffold contigs using the distance estimate graph}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>271</integer>
+ <key>Info</key>
+ <integer>3</integer>
+ </dict>
+ <key>ID</key>
+ <integer>274</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.47121081998512, 1823.5804524742123}</string>
+ <string>{321.90350000000001, 1895.0199687194824}</string>
+ <string>{279.40350000000001, 1908.0199687194824}</string>
+ <string>{229.9142468622905, 1916.836874470187}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>216</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>149</integer>
+ </dict>
+ <key>ID</key>
+ <integer>273</integer>
+ <key>Points</key>
+ <array>
+ <string>{177.9375, 1917.0999687194826}</string>
+ <string>{154.6875, 1917.0999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>271</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>180</integer>
+ </dict>
+ <key>ID</key>
+ <integer>272</integer>
+ <key>Points</key>
+ <array>
+ <string>{177.9375, 1865.1999687194825}</string>
+ <string>{154.6875, 1865.1999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>269</integer>
+ <key>Info</key>
+ <integer>4</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{177.9375, 1899.0999687194826}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>271</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ln}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>269</integer>
+ </dict>
+ <key>ID</key>
+ <integer>270</integer>
+ <key>Points</key>
+ <array>
+ <string>{375.8125, 1820.8399687194826}</string>
+ <string>{320.9375, 1842.1999687194825}</string>
+ <string>{278.4375, 1855.1999687194825}</string>
+ <string>{228.4375, 1865.1999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>217</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{177.9375, 1847.1999687194825}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>269</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ln}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{453.4375, 2697.3499603271484}, {109, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>267</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0.501961</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-scaffolds.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>263</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>265</integer>
+ <key>Points</key>
+ <array>
+ <string>{373.44343345780555, 1827.206745795535}</string>
+ <string>{261, 2030.2999649047852}</string>
+ <string>{295.9375, 2404.2999649047852}</string>
+ <string>{506.10916667576845, 2497.4894030185069}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>254</integer>
+ <key>Position</key>
+ <real>0.014218973927199841</real>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>263</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>264</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.9375, 2379.4999675750732}</string>
+ <string>{507.9375, 2498.3000801086428}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>260</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{460.6875, 2498.3000801086428}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>263</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 MergeContigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>257</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>262</integer>
+ <key>Points</key>
+ <array>
+ <string>{373.7929382890427, 1826.2928611449695}</string>
+ <string>{304, 1986}</string>
+ <string>{336, 2188.0999687194826}</string>
+ <string>{507.9375, 2291.0999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>254</integer>
+ <key>Position</key>
+ <real>0.012177241034805775</real>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>257</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>261</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.9375, 1823.3999687194826}</string>
+ <string>{330.8125, 1982}</string>
+ <string>{358, 2184}</string>
+ <string>{506.31004202611257, 2289.9374796950851}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>216</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{462.9375, 2361.4999675750732}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>260</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-7.path}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>260</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>259</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.9375, 2327.0999687194826}</string>
+ <string>{507.9375, 2361.4999675750732}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>257</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>257</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>258</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.9375, 2260.6999687194825}</string>
+ <string>{507.9375, 2291.0999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>253</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{454.9375, 2291.0999687194826}, {106, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>257</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 PathConsensus}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>255</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>256</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.74250000000006, 2213.0999687194826}</string>
+ <string>{622.4375, 2242.6999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>245</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{567.9375, 2242.6999687194825}, {109, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>255</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-6.path1.dot}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>242</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>254</integer>
+ <key>Points</key>
+ <array>
+ <string>{375.8125, 1820.8399687194826}</string>
+ <string>{322.9375, 1967.8999687194826}</string>
+ <string>{357.9375, 2118.1999687194825}</string>
+ <string>{508.32221747843306, 2176.3783586011227}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>217</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{462.9375, 2242.6999687194825}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>253</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-6.path1}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>218</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>252</integer>
+ <key>Points</key>
+ <array>
+ <string>{728.0625, 1823.3999687194826}</string>
+ <string>{506.9375, 1866.2999687194824}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>249</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>218</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>251</integer>
+ <key>Points</key>
+ <array>
+ <string>{638.0625, 1823.3999687194826}</string>
+ <string>{506.9375, 1866.2999687194824}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>248</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{637.3125, 1787.3999687194826}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>250</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 mpet_lib}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{683.0625, 1805.3999687194826}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>249</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 mp_2.fq.gz}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{593.0625, 1805.3999687194826}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>248</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 mp_1.fq.gz}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>218</integer>
+ </dict>
+ <key>ID</key>
+ <integer>246</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.9375, 1823.3999687194826}</string>
+ <string>{506.9375, 1866.2999687194824}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>216</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>245</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.74250000000006, 2213.0999687194826}</string>
+ <string>{506.74250000000006, 2242.6999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>242</integer>
+ </dict>
+ <key>ID</key>
+ <integer>244</integer>
+ <key>Points</key>
+ <array>
+ <string>{509.6875, 2151.2999687194824}</string>
+ <string>{510.14874758577207, 2175.1003441453217}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{462.9375, 2177.0999687194826}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>242</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 abyss-scaffold}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>228</integer>
+ </dict>
+ <key>ID</key>
+ <integer>229</integer>
+ <key>Points</key>
+ <array>
+ <string>{509.1875, 2103.6999687194825}</string>
+ <string>{509.1875, 2133.2999687194824}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{464.1875, 2133.2999687194824}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>228</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 lib1-6.dist.dot}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>226</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ <key>ID</key>
+ <integer>227</integer>
+ <key>Points</key>
+ <array>
+ <string>{389.9375, 2015.4999687194825}</string>
+ <string>{509.6875, 2063.0999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>221</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>226</integer>
+ <key>Points</key>
+ <array>
+ <string>{509.6875, 2033.4999687194822}</string>
+ <string>{509.6875, 2063.0999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{462.4375, 2063.0999687194826}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>225</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 DistanceEst --dot}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{481.6875, 1997.4999687194825}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>224</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 sort}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>223</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.9375, 1967.8999687194826}</string>
+ <string>{506.9375, 1997.4999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>221</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>222</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.9375, 1967.8999687194826}</string>
+ <string>{389.9375, 1997.4999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{344.9375, 1997.4999687194825}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>221</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 lib1-6.hist}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>220</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.9375, 1902.2999687194824}</string>
+ <string>{506.9375, 1931.8999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{459.6875, 1931.8999687194826}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>219</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 abyss-fixmate}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{459.6875, 1866.2999687194824}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>218</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 abyss-map}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{330.8125, 1802.8399687194826}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>217</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-6.dot}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{461.9375, 1805.3999687194826}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>216</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-6.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 1756.6999687194825}, {247, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>215</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Merge paths of contigs to create larger contigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 1734.6999687194825}, {197, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>214</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Find paths that overlap, output graph}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>213</integer>
+ <key>Points</key>
+ <array>
+ <string>{375.3125, 1773.2499687194825}</string>
+ <string>{375.3125, 1802.8499687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>210</integer>
+ </dict>
+ <key>ID</key>
+ <integer>212</integer>
+ <key>Points</key>
+ <array>
+ <string>{395.99250000000001, 1639.5999687194826}</string>
+ <string>{375.8125, 1734.6999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>210</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>211</integer>
+ <key>Points</key>
+ <array>
+ <string>{505.4375, 1637.9999687194825}</string>
+ <string>{375.8125, 1734.6999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{328.5625, 1734.6999687194825}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>210</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 PathOverlap\
+--overlap}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>204</integer>
+ </dict>
+ <key>ID</key>
+ <integer>209</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 623.59996871948238}</string>
+ <string>{855, 743.79996871948242}</string>
+ <string>{773.9375, 1525.1999687194825}</string>
+ <string>{624.9375, 1668.1999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>204</integer>
+ </dict>
+ <key>ID</key>
+ <integer>208</integer>
+ <key>Points</key>
+ <array>
+ <string>{635.9375, 1162.0999687194826}</string>
+ <string>{751.9375, 1317.1999687194825}</string>
+ <string>{723.4375, 1588.1999687194825}</string>
+ <string>{624.9375, 1668.1999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>216</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>207</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.24250000000001, 1770.6999687194825}</string>
+ <string>{506.9375, 1805.3999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>201</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>201</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>206</integer>
+ <key>Points</key>
+ <array>
+ <string>{620.9375, 1704.1999687194825}</string>
+ <string>{509.17420075564866, 1734.1817676284295}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>204</integer>
+ </dict>
+ <key>ID</key>
+ <integer>205</integer>
+ <key>Points</key>
+ <array>
+ <string>{624.9375, 1639.5999687129283}</string>
+ <string>{624.9375, 1668.1999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>195</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{599.6875, 1668.1999687194825}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>204</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 cat}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>201</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>203</integer>
+ <key>Points</key>
+ <array>
+ <string>{396.49250000000001, 1639.0999687194826}</string>
+ <string>{507.24250000000001, 1734.6999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>197</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>201</integer>
+ </dict>
+ <key>ID</key>
+ <integer>202</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.24250000000001, 1639.0999687194826}</string>
+ <string>{507.24250000000001, 1734.6999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>193</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{459.99250000000001, 1734.6999687194825}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>201</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 MergeContigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>190</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>200</integer>
+ <key>Points</key>
+ <array>
+ <string>{698.1875, 1353.1999687194825}</string>
+ <string>{657.9375, 1440.1999687194825}</string>
+ <string>{579.4375, 1521.1999687194825}</string>
+ <string>{512.03442547098064, 1554.6117102664928}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>133</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>190</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>199</integer>
+ <key>Points</key>
+ <array>
+ <string>{508.1875, 1513.9999687194825}</string>
+ <string>{510.24250000000001, 1555.4999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>189</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>190</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>198</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.4375, 1163.3999687194826}</string>
+ <string>{606.4375, 1218.1999687194825}</string>
+ <string>{624.9375, 1430.3999687194826}</string>
+ <string>{510.24250000000001, 1555.4999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{351.49250000000001, 1621.0999687194826}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>197</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-5.adj}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>196</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.74250000000006, 1591.4999687194825}</string>
+ <string>{395.99250000000001, 1621.0999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>192</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{579.9375, 1621.0999687194826}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>195</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-5.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>194</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.74250000000006, 1591.4999687194825}</string>
+ <string>{628.49249999999995, 1621.0999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>192</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{462.24250000000001, 1621.0999687194826}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>193</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-5.path}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>192</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.74250000000006, 1591.4999687194825}</string>
+ <string>{506.74250000000006, 1621.0999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{457.24250000000001, 1555.4999687194825}, {106, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>190</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 PathConsensus}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{463.1875, 1495.9999687194825}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>189</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-4.path3}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>188</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.6875, 1466.3999687194826}</string>
+ <string>{507.6875, 1495.9999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>123</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>187</integer>
+ <key>Points</key>
+ <array>
+ <string>{391.9375, 510.99996871948247}</string>
+ <string>{379, 632.5999755859375}</string>
+ <string>{294, 901}</string>
+ <string>{507.62877024092643, 1072.7468280883497}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>74</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>186</integer>
+ <key>Points</key>
+ <array>
+ <string>{501.36750000000006, 510.99996871948247}</string>
+ <string>{448.9375, 522.1999687194824}</string>
+ <string>{392.6875, 531.1999687194824}</string>
+ <string>{327.9375, 539.99996871948247}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>70</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>185</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 510.99996871948247}</string>
+ <string>{505.1875, 539.99996871948247}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>66</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>70</integer>
+ </dict>
+ <key>ID</key>
+ <integer>184</integer>
+ <key>Points</key>
+ <array>
+ <string>{505.1875, 396.59997940063477}</string>
+ <string>{563, 426.79996871948242}</string>
+ <string>{562, 510.99996871948247}</string>
+ <string>{505.1875, 539.99996871948247}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>280</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>63</integer>
+ </dict>
+ <key>ID</key>
+ <integer>183</integer>
+ <key>Points</key>
+ <array>
+ <string>{517.43135067823948, 174.92420095495595}</string>
+ <string>{570, 200.40000000000001}</string>
+ <string>{570.9375, 379.1999687194824}</string>
+ <string>{506.31173042826481, 425.63297447970274}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>35</integer>
+ <key>Position</key>
+ <real>0.03043123334646225</real>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>74</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>182</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.32400650842607, 171.06178148053633}</string>
+ <string>{398, 236.40000000000001}</string>
+ <string>{342.75, 444.29998970031738}</string>
+ <string>{327.9375, 539.99996871948247}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>53</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 1565.5199687194824}, {327, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>181</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Align sequences of ambiguous paths and output a consensus}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{36.9375, 1856.1999687194825}, {117.75, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>180</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0.501961</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-contigs.dot}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>150</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ <key>ID</key>
+ <integer>178</integer>
+ <key>Points</key>
+ <array>
+ <string>{505.1875, 1162.0999687194826}</string>
+ <string>{417, 1220.5999687194826}</string>
+ <string>{432.6875, 1386.1999687194825}</string>
+ <string>{507.6875, 1430.3999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>126</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>133</integer>
+ </dict>
+ <key>ID</key>
+ <integer>174</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 623.59996871948238}</string>
+ <string>{766, 689.1999687194824}</string>
+ <string>{807, 974.1999687194824}</string>
+ <string>{698.1875, 1317.1999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>79</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>133</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>172</integer>
+ <key>Points</key>
+ <array>
+ <string>{636.6875, 1162.0999687194826}</string>
+ <string>{698.1875, 1317.1999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>128</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{672.9375, 1317.1999687194825}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>133</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 cat}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 1441.3999687194826}, {288, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>170</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Find paths that overlap, assembling overlapping paths}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 1328.1999687194825}, {172, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>169</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Merge sequences of contigs IDs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 1206.5999687194826}, {277, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>168</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Find paths through contigs using distance estimates}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 1084.9999687194822}, {192, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>167</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Find overlaps between blunt contigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 974.1999687194824}, {137, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>166</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Merge distance estimates}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 860.99996871948235}, {191, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>165</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Estimate distances between contigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 729.79996871948242}, {174, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>164</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Find pairs of reads in alignments}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 664.1999687194824}, {115, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>163</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Align reads to contigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 550.99996871948247}, {251, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>162</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Merge paths of contigs to create larger contigs.}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 437.79996871948242}, {169, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>161</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Identify and pop simple bubbles}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 210.80199999999999}, {151, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>160</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Find overlaps of [m,k) bases}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{27.9375, 97.004000000000005}, {127, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>159</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Assemble the input files}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{865.125, 240.60300000000001}, {117.75, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>157</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0.501961</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 output file}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{870, 208.80199999999999}, {108, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>156</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 intermediate file}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{879, 177.001}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>155</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 input file}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{898.75, 127.20099999999999}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>154</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 unix tool}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{879, 77.399900000000002}, {90, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>153</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Cap</key>
+ <integer>2</integer>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ABySS tool}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{778.75, 40}, {268, 17}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Font</key>
+ <string>Helvetica-Bold</string>
+ <key>Size</key>
+ <real>14</real>
+ </dict>
+ <key>ID</key>
+ <integer>152</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\b\fs28 \cf0 ABySS paired-end pipeline version 1.5.2}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>150</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.6875, 1400.7999687194824}</string>
+ <string>{507.6875, 1430.3999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{36.9375, 1908.0999687194826}, {117.75, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>149</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0.501961</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-contigs.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{460.9375, 1430.3999687194826}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>147</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 PathOverlap\
+--assemble}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>145</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ <key>ID</key>
+ <integer>146</integer>
+ <key>Points</key>
+ <array>
+ <string>{505.1875, 1162.0999687194826}</string>
+ <string>{432.6875, 1203.1999687194825}</string>
+ <string>{433.9375, 1279.7999687194824}</string>
+ <string>{506.4375, 1317.1999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>126</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>145</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.4375, 1287.5999687194826}</string>
+ <string>{506.4375, 1317.1999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{463.1875, 1382.7999687194824}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>144</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-4.path2}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>143</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.6875, 1353.1999687194825}</string>
+ <string>{507.6875, 1382.7999687194824}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{459.6875, 1317.1999687194825}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>142</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 MergePaths}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{461.9375, 1261.7999687194824}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>141</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-4.path1}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>140</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.4375, 1232.1999687194825}</string>
+ <string>{506.4375, 1261.7999687194824}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>137</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>139</integer>
+ <key>Points</key>
+ <array>
+ <string>{560.9375, 1046.7999687194824}</string>
+ <string>{572.9375, 1109.9999687194825}</string>
+ <string>{556.4375, 1175.1999687194825}</string>
+ <string>{506.9375, 1196.1999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>127</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>137</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>138</integer>
+ <key>Points</key>
+ <array>
+ <string>{505.1875, 1162.0999687194826}</string>
+ <string>{506.9375, 1196.1999687194825}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>126</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{459.6875, 1196.1999687194825}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>137</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 SimpleGraph}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>123</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>130</integer>
+ <key>Points</key>
+ <array>
+ <string>{505.1875, 623.59996871948238}</string>
+ <string>{372.9375, 685.59996871948238}</string>
+ <string>{311.4375, 907.59996871948238}</string>
+ <string>{509.1875, 1073.9999687194822}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>71</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>128</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>129</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.9375, 1109.9999687194825}</string>
+ <string>{636.2039216974481, 1143.9728780056712}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{589.4375, 1144.0999687194826}, {94.5, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>128</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-4.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>123</integer>
+ </dict>
+ <key>ID</key>
+ <integer>127</integer>
+ <key>Points</key>
+ <array>
+ <string>{560.9375, 1046.7999687194824}</string>
+ <string>{510.95785563837956, 1073.0694629539958}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{460.1875, 1144.0999687194826}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>126</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-4.adj}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>126</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>124</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 1109.9999687194825}</string>
+ <string>{505.1875, 1144.0999687194826}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{461.9375, 1073.9999687194822}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>123</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 Overlap}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>121</integer>
+ </dict>
+ <key>ID</key>
+ <integer>122</integer>
+ <key>Points</key>
+ <array>
+ <string>{561.4375, 999.19996871948251}</string>
+ <string>{561.4375, 1028.2999687259262}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{516.4375, 1028.7999687194824}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>121</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-3.dist}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>118</integer>
+ </dict>
+ <key>ID</key>
+ <integer>120</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.4375, 938.1999687194824}</string>
+ <string>{563.6875, 963.1999687194824}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>118</integer>
+ </dict>
+ <key>ID</key>
+ <integer>119</integer>
+ <key>Points</key>
+ <array>
+ <string>{626.6875, 938.1999687194824}</string>
+ <string>{563.6875, 963.1999687194824}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{516.4375, 963.1999687194824}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>118</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 abyss-joindist}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{585.75, 21}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>117</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 lib2}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{347, 21}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>116</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 lib1}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>102</integer>
+ </dict>
+ <key>ID</key>
+ <integer>115</integer>
+ <key>Points</key>
+ <array>
+ <string>{720.75, 48}</string>
+ <string>{772, 163.20099999999999}</string>
+ <string>{689, 481}</string>
+ <string>{625.63485355620992, 651.32548270089467}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>99</integer>
+ <key>Info</key>
+ <integer>3</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>102</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>114</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 623.59996871948238}</string>
+ <string>{622.99547020199293, 652.72193061535768}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>79</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>112</integer>
+ </dict>
+ <key>ID</key>
+ <integer>113</integer>
+ <key>Points</key>
+ <array>
+ <string>{627.1875, 890.59996871948238}</string>
+ <string>{627.1875, 919.69996872592617}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{582.1875, 920.1999687194824}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>112</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 lib2-3.dist}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>110</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ <key>ID</key>
+ <integer>111</integer>
+ <key>Points</key>
+ <array>
+ <string>{738.7405, 802.39996871948244}</string>
+ <string>{627.6875, 849.99996871948235}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>105</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>110</integer>
+ <key>Points</key>
+ <array>
+ <string>{627.6875, 820.39996871948244}</string>
+ <string>{627.6875, 849.99996871948235}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{580.4375, 849.99996871948235}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>109</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 DistanceEst}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{599.6875, 784.39996871948244}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>108</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 sort}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>107</integer>
+ <key>Points</key>
+ <array>
+ <string>{624.9375, 754.79996871948242}</string>
+ <string>{624.9375, 784.39996871948244}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>105</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>106</integer>
+ <key>Points</key>
+ <array>
+ <string>{624.9375, 754.79996871948242}</string>
+ <string>{738.25660037834405, 784.27410710949846}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{693.7405, 784.39996871948244}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>105</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 lib2-3.hist}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>104</integer>
+ <key>Points</key>
+ <array>
+ <string>{624.9375, 689.1999687194824}</string>
+ <string>{624.9375, 718.79996871948242}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{577.6875, 718.79996871948242}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>103</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 abyss-fixmate}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{577.6875, 653.1999687194824}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>102</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 abyss-map}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>10</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>101</integer>
+ <key>Points</key>
+ <array>
+ <string>{675.75, 57}</string>
+ <string>{504.75, 87.1999}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>99</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>10</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>100</integer>
+ <key>Points</key>
+ <array>
+ <string>{585.75, 57}</string>
+ <string>{504.75, 87.1999}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>98</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{630.75, 39}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>99</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 reads_2.fq.gz}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{540.75, 39}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>98</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 reads_1.fq.gz}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>93</integer>
+ </dict>
+ <key>ID</key>
+ <integer>94</integer>
+ <key>Points</key>
+ <array>
+ <string>{506.9375, 890.59996871948238}</string>
+ <string>{506.9375, 919.69996872592617}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{461.9375, 920.1999687194824}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>93</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 lib1-3.dist}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>91</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ <key>ID</key>
+ <integer>31</integer>
+ <key>Points</key>
+ <array>
+ <string>{387.6875, 802.39996871948244}</string>
+ <string>{507.4375, 849.99996871948235}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>85</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>91</integer>
+ <key>Points</key>
+ <array>
+ <string>{507.4375, 820.39996871948244}</string>
+ <string>{507.4375, 849.99996871948235}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{460.1875, 849.99996871948235}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>90</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 DistanceEst}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{479.4375, 784.39996871948244}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>88</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 sort}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>87</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 754.79996871948242}</string>
+ <string>{504.6875, 784.39996871948244}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>85</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>86</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 754.79996871948242}</string>
+ <string>{388.17222815072813, 784.27733664032394}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{342.6875, 784.39996871948244}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>85</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 lib1-3.hist}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>84</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 689.1999687194824}</string>
+ <string>{504.6875, 718.79996871948242}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{457.4375, 718.79996871948242}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>83</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 abyss-fixmate}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>78</integer>
+ </dict>
+ <key>ID</key>
+ <integer>80</integer>
+ <key>Points</key>
+ <array>
+ <string>{482.75, 48}</string>
+ <string>{731.4375, 152.19996871948243}</string>
+ <string>{610.4375, 575.99996871948247}</string>
+ <string>{504.6875, 653.1999687194824}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>51</integer>
+ <key>Info</key>
+ <integer>3</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>79</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 623.59996871948238}</string>
+ <string>{504.6875, 653.1999687194824}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{457.4375, 653.1999687194824}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>78</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 abyss-map}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>76</integer>
+ </dict>
+ <key>ID</key>
+ <integer>77</integer>
+ <key>Points</key>
+ <array>
+ <string>{327.9375, 575.99996871948247}</string>
+ <string>{327.9375, 605.09996872592603}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{282.9375, 605.59996871948238}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>76</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0.501961</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-indel.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{302.6875, 539.99996871948247}, {50.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>74</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.00241076</string>
+ <key>g</key>
+ <string>0.229592</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>3</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 awk}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>70</integer>
+ </dict>
+ <key>ID</key>
+ <integer>35</integer>
+ <key>Points</key>
+ <array>
+ <string>{505.19342901477512, 171.03102104226556}</string>
+ <string>{585.75, 213}</string>
+ <string>{578.4375, 494.59996871948238}</string>
+ <string>{506.8874612237708, 538.94634087567101}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>53</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>71</integer>
+ </dict>
+ <key>ID</key>
+ <integer>72</integer>
+ <key>Points</key>
+ <array>
+ <string>{505.1875, 575.99996871948247}</string>
+ <string>{505.1875, 605.59996871948238}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>70</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{460.1875, 605.59996871948238}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>71</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-3.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{457.9375, 539.99996871948247}, {94.5, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>70</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 MergeContigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>66</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>68</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 462.79996871948242}</string>
+ <string>{504.6875, 492.99996871948247}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>65</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>67</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.6875, 462.79996871948242}</string>
+ <string>{398.9375, 492.99996871948247}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{459.6875, 492.99996871948247}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>66</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-2.path}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{353.9375, 492.99996871948247}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>65</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-3.adj}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>280</integer>
+ </dict>
+ <key>ID</key>
+ <integer>64</integer>
+ <key>Points</key>
+ <array>
+ <string>{505.1875, 349.59998893737793}</string>
+ <string>{505.1875, 378.59997940063477}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>278</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{459.6875, 426.79996871948242}, {90, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>63</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 PopBubbles}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>57</integer>
+ </dict>
+ <key>ID</key>
+ <integer>62</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.75, 236.40000000000001}</string>
+ <string>{504.75, 266}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>56</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>ID</key>
+ <integer>61</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.75, 171.2999999935563}</string>
+ <string>{504.75, 200.40000000000001}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>53</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>54</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>60</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.75, 123.2}</string>
+ <string>{387.75, 152.80000000000001}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>58</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>53</integer>
+ </dict>
+ <key>ID</key>
+ <integer>59</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.75, 123.2}</string>
+ <string>{504.75, 152.80000000000001}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>58</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>55</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>58</integer>
+ <key>Points</key>
+ <array>
+ <string>{504.75, 123.2}</string>
+ <string>{630.75, 152.80000000000001}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{459.75, 266}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>57</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-1.adj}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{459.75, 200.40000000000001}, {90, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>56</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 AdjList}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{576.75, 152.80000000000001}, {108, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>55</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0.501961</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-bubbles.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{342.75, 152.80000000000001}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>54</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0.501961</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 coverage.hist}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{459.75, 152.80000000000001}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>53</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict/>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ecoli-1.fa}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>10</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>52</integer>
+ <key>Points</key>
+ <array>
+ <string>{437.75, 57}</string>
+ <string>{504.75, 87.1999}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>51</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>10</integer>
+ <key>Info</key>
+ <integer>2</integer>
+ </dict>
+ <key>ID</key>
+ <integer>39</integer>
+ <key>Points</key>
+ <array>
+ <string>{347.75, 57}</string>
+ <string>{504.75, 87.1999}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>17</integer>
+ <key>Info</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{392.75, 39}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>51</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 reads_2.fq.gz}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{302.75, 39}, {90, 18}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>17</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 reads_1.fq.gz}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{459.75, 87.1999}, {90, 36}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>10</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{0, 1}</string>
+ <string>{0, -1}</string>
+ <string>{1, 0}</string>
+ <string>{-1, 0}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>Cap</key>
+ <integer>2</integer>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.501961</string>
+ <key>g</key>
+ <string>0</string>
+ <key>r</key>
+ <string>0</string>
+ </dict>
+ <key>GapRatio</key>
+ <real>0.5</real>
+ <key>Width</key>
+ <real>4</real>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\b\fs24 \cf0 ABYSS}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ </array>
+ <key>GridInfo</key>
+ <dict/>
+ <key>GuidesLocked</key>
+ <string>NO</string>
+ <key>GuidesVisible</key>
+ <string>YES</string>
+ <key>HPages</key>
+ <integer>1</integer>
+ <key>ImageCounter</key>
+ <integer>1</integer>
+ <key>KeepToScale</key>
+ <false/>
+ <key>Layers</key>
+ <array>
+ <dict>
+ <key>Lock</key>
+ <string>NO</string>
+ <key>Name</key>
+ <string>Layer 1</string>
+ <key>Print</key>
+ <string>YES</string>
+ <key>View</key>
+ <string>YES</string>
+ </dict>
+ </array>
+ <key>LayoutInfo</key>
+ <dict>
+ <key>Animate</key>
+ <string>NO</string>
+ <key>circoMinDist</key>
+ <real>18</real>
+ <key>circoSeparation</key>
+ <real>0.0</real>
+ <key>layoutEngine</key>
+ <string>dot</string>
+ <key>neatoSeparation</key>
+ <real>0.0</real>
+ <key>twopiSeparation</key>
+ <real>0.0</real>
+ </dict>
+ <key>LinksVisible</key>
+ <string>NO</string>
+ <key>MagnetsVisible</key>
+ <string>NO</string>
+ <key>MasterSheets</key>
+ <array/>
+ <key>ModificationDate</key>
+ <string>2014-05-07 21:55:17 +0000</string>
+ <key>Modifier</key>
+ <string>Tony Raymond</string>
+ <key>NotesVisible</key>
+ <string>NO</string>
+ <key>Orientation</key>
+ <integer>2</integer>
+ <key>OriginVisible</key>
+ <string>NO</string>
+ <key>PageBreaks</key>
+ <string>YES</string>
+ <key>PrintInfo</key>
+ <dict>
+ <key>NSBottomMargin</key>
+ <array>
+ <string>float</string>
+ <string>41</string>
+ </array>
+ <key>NSHorizonalPagination</key>
+ <array>
+ <string>coded</string>
+ <string>BAtzdHJlYW10eXBlZIHoA4QBQISEhAhOU051bWJlcgCEhAdOU1ZhbHVlAISECE5TT2JqZWN0AIWEASqEhAFxlwCG</string>
+ </array>
+ <key>NSLeftMargin</key>
+ <array>
+ <string>float</string>
+ <string>18</string>
+ </array>
+ <key>NSPaperName</key>
+ <array>
+ <string>string</string>
+ <string>E409205B-47EF-41DB-B00B-53E0115DBFAE</string>
+ </array>
+ <key>NSPaperSize</key>
+ <array>
+ <string>size</string>
+ <string>{1133.8582763671875, 3401.57470703125}</string>
+ </array>
+ <key>NSPrintReverseOrientation</key>
+ <array>
+ <string>int</string>
+ <string>0</string>
+ </array>
+ <key>NSRightMargin</key>
+ <array>
+ <string>float</string>
+ <string>18</string>
+ </array>
+ <key>NSTopMargin</key>
+ <array>
+ <string>float</string>
+ <string>18</string>
+ </array>
+ </dict>
+ <key>PrintOnePage</key>
+ <false/>
+ <key>ReadOnly</key>
+ <string>NO</string>
+ <key>RowAlign</key>
+ <integer>1</integer>
+ <key>RowSpacing</key>
+ <real>36</real>
+ <key>SheetTitle</key>
+ <string>Canvas 1</string>
+ <key>SmartAlignmentGuidesActive</key>
+ <string>YES</string>
+ <key>SmartDistanceGuidesActive</key>
+ <string>YES</string>
+ <key>UniqueID</key>
+ <integer>1</integer>
+ <key>UseEntirePage</key>
+ <false/>
+ <key>VPages</key>
+ <integer>1</integer>
+ <key>WindowInfo</key>
+ <dict>
+ <key>CurrentSheet</key>
+ <integer>0</integer>
+ <key>ExpandedCanvases</key>
+ <array>
+ <dict>
+ <key>name</key>
+ <string>Canvas 1</string>
+ </dict>
+ </array>
+ <key>Frame</key>
+ <string>{{337, 419}, {1256, 933}}</string>
+ <key>ListView</key>
+ <true/>
+ <key>OutlineWidth</key>
+ <integer>142</integer>
+ <key>RightSidebar</key>
+ <false/>
+ <key>ShowRuler</key>
+ <true/>
+ <key>Sidebar</key>
+ <true/>
+ <key>SidebarWidth</key>
+ <integer>120</integer>
+ <key>VisibleRegion</key>
+ <string>{{-4, 0}, {1107, 794}}</string>
+ <key>Zoom</key>
+ <real>1</real>
+ <key>ZoomValues</key>
+ <array>
+ <array>
+ <string>Canvas 1</string>
+ <real>1</real>
+ <real>1</real>
+ </array>
+ </array>
+ </dict>
+</dict>
+</plist>
diff --git a/doc/flowchart.pdf b/doc/flowchart.pdf
index a59c16c..e2daaa6 100644
Binary files a/doc/flowchart.pdf and b/doc/flowchart.pdf differ
diff --git a/doc/flowchart_simplified.graffle b/doc/flowchart_simplified.graffle
new file mode 100644
index 0000000..2844f5e
--- /dev/null
+++ b/doc/flowchart_simplified.graffle
@@ -0,0 +1,1806 @@
+<?xml version="1.0" encoding="UTF-8"?>
+<!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd">
+<plist version="1.0">
+<dict>
+ <key>ActiveLayerIndex</key>
+ <integer>0</integer>
+ <key>ApplicationVersion</key>
+ <array>
+ <string>com.omnigroup.OmniGraffle</string>
+ <string>139.18.0.187838</string>
+ </array>
+ <key>AutoAdjust</key>
+ <true/>
+ <key>BackgroundGraphic</key>
+ <dict>
+ <key>Bounds</key>
+ <string>{{0, 0}, {1099, 928}}</string>
+ <key>Class</key>
+ <string>SolidGraphic</string>
+ <key>ID</key>
+ <integer>2</integer>
+ <key>Style</key>
+ <dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>BaseZoom</key>
+ <integer>0</integer>
+ <key>CanvasOrigin</key>
+ <string>{0, 0}</string>
+ <key>CanvasSize</key>
+ <string>{1099, 928}</string>
+ <key>ColumnAlign</key>
+ <integer>1</integer>
+ <key>ColumnSpacing</key>
+ <real>36</real>
+ <key>CreationDate</key>
+ <string>2012-12-05 00:56:47 +0000</string>
+ <key>Creator</key>
+ <string>Tony Raymond</string>
+ <key>DisplayScale</key>
+ <string>1 0/72 in = 1.0000 in</string>
+ <key>FileType</key>
+ <string>flat</string>
+ <key>GraphDocumentVersion</key>
+ <integer>8</integer>
+ <key>GraphicsList</key>
+ <array>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43461</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43597</integer>
+ <key>Points</key>
+ <array>
+ <string>{179.69920329269712, 194.47751115583006}</string>
+ <string>{227.95678889313632, 219.55307955830477}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43460</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{238.47937393188568, 445.99996613762551}, {39, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>43544</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 ABySS}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{325.81455612182708, 445.99998139641457}, {65, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>43543</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Output Files}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{131.56212997436614, 445.99999617836647}, {56, 14}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FitText</key>
+ <string>YES</string>
+ <key>Flow</key>
+ <string>Resize</string>
+ <key>ID</key>
+ <integer>43542</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Pad</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\pardirnatural\qc
+
+\f0\fs24 \cf0 Input Files}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>Wrap</key>
+ <string>NO</string>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{293.35941696167083, 441.99998139641457}, {22.108642578125, 22}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43541</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>1</string>
+ <key>g</key>
+ <string>0.85076</string>
+ <key>r</key>
+ <string>0.722565</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{206.02423477172943, 441.99996613762551}, {22.108642578125, 22}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43540</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.591099</string>
+ <key>g</key>
+ <string>0.787961</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{99.106990814210349, 441.99999617836647}, {22.108642578125, 22}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43539</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.791123</string>
+ <key>g</key>
+ <string>1</string>
+ <key>r</key>
+ <string>0.777435</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43472</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43491</integer>
+ <key>Points</key>
+ <array>
+ <string>{408.87020861788773, 371.97922164079642}</string>
+ <string>{443.87019417847011, 371.9805196971426}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43489</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43489</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43490</integer>
+ <key>Points</key>
+ <array>
+ <string>{300.87023859886983, 371.97785281522317}</string>
+ <string>{335.87020859878953, 371.97785281522317}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43469</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{336.37020860618236, 349.47786795290506}, {72, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43489</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.591099</string>
+ <key>g</key>
+ <string>0.787961</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+MPET Algorithms}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43462</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43488</integer>
+ <key>Points</key>
+ <array>
+ <string>{409.33649444336606, 238.48993113034226}</string>
+ <string>{444.77252131555792, 238.48993113034226}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43486</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43486</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43487</integer>
+ <key>Points</key>
+ <array>
+ <string>{300.90046643683979, 238.48993352202285}</string>
+ <string>{336.33649444580089, 238.48993352202285}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43461</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{336.83649445260335, 215.98992172901012}, {72, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43486</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.591099</string>
+ <key>g</key>
+ <string>0.787961</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+PET Algorithms}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43594</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43591</integer>
+ <key>Points</key>
+ <array>
+ <string>{408.34666043418969, 105.00532664588899}</string>
+ <string>{444.36664927522622, 105.00466117135421}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43593</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43593</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43592</integer>
+ <key>Points</key>
+ <array>
+ <string>{300.12791644743027, 105.0059899548778}</string>
+ <string>{335.34666041392916, 105.0059899548778}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43595</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{335.84666043658603, 82.506000988699725}, {72, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43593</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.591099</string>
+ <key>g</key>
+ <string>0.787961</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+Filter Unitig Graph}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43461</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43478</integer>
+ <key>Points</key>
+ <array>
+ <string>{180.40917205306428, 238.48991831012302}</string>
+ <string>{227.90046643507853, 238.48991831012302}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43477</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{92, 215.98990487358742}, {87.909172058105469, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43477</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.791123</string>
+ <key>g</key>
+ <string>1</string>
+ <key>r</key>
+ <string>0.777435</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+'pe' Libraries}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43461</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43476</integer>
+ <key>Points</key>
+ <array>
+ <string>{444.44106247849021, 127.46617088472254}</string>
+ <string>{300.82605322437695, 216.02773035415149}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43594</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43469</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43475</integer>
+ <key>Points</key>
+ <array>
+ <string>{180.40917205123054, 371.98047036292445}</string>
+ <string>{227.87023859835193, 371.97899281733066}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43474</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{92, 349.48185431154764}, {87.909172058105469, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43474</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.791123</string>
+ <key>g</key>
+ <string>1</string>
+ <key>r</key>
+ <string>0.777435</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+'mp' Libraries}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{444.37019419017543, 349.48187338503396}, {72, 45.000000000000014}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43472</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>1</string>
+ <key>g</key>
+ <string>0.85076</string>
+ <key>r</key>
+ <string>0.722565</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+Scaffolds}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43469</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43471</integer>
+ <key>Points</key>
+ <array>
+ <string>{444.84670056819556, 260.90741868331719}</string>
+ <string>{300.79605932960209, 349.56035223582666}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43462</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{228.370238591477, 349.47785650881326}, {72, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43469</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.591099</string>
+ <key>g</key>
+ <string>0.787961</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+Align Reads to Contigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43595</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43466</integer>
+ <key>Points</key>
+ <array>
+ <string>{179.43947386612567, 149.01533349400736}</string>
+ <string>{227.18480744900279, 124.05656008745486}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43460</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Class</key>
+ <string>LineGraphic</string>
+ <key>Head</key>
+ <dict>
+ <key>ID</key>
+ <integer>43595</integer>
+ </dict>
+ <key>ID</key>
+ <integer>43465</integer>
+ <key>Points</key>
+ <array>
+ <string>{180.40917203904971, 105.00074959034995}</string>
+ <string>{227.12791644382912, 105.00369770906197}</string>
+ </array>
+ <key>Style</key>
+ <dict>
+ <key>stroke</key>
+ <dict>
+ <key>HeadArrow</key>
+ <string>FilledArrow</string>
+ <key>Legacy</key>
+ <true/>
+ <key>LineType</key>
+ <integer>1</integer>
+ <key>TailArrow</key>
+ <string>0</string>
+ </dict>
+ </dict>
+ <key>Tail</key>
+ <dict>
+ <key>ID</key>
+ <integer>43459</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{444.86664927282982, 82.503986828543475}, {72, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43594</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>1</string>
+ <key>g</key>
+ <string>0.85076</string>
+ <key>r</key>
+ <string>0.722565</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+Unitigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{227.62791642477339, 82.506000988699725}, {72, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43595</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.591099</string>
+ <key>g</key>
+ <string>0.787961</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+Pre-Unitig}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{445.27252130632064, 215.98991441033058}, {72, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43462</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>1</string>
+ <key>g</key>
+ <string>0.85076</string>
+ <key>r</key>
+ <string>0.722565</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+Contigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{228.40046643003734, 215.98991441033058}, {72, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43461</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.591099</string>
+ <key>g</key>
+ <string>0.787961</string>
+ <key>r</key>
+ <string>1</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+Align Reads to Unitigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{92, 149.24696778557472}, {87.909172058105469, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43460</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.791123</string>
+ <key>g</key>
+ <string>1</string>
+ <key>r</key>
+ <string>0.777435</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+'lib' Libraries}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{92, 82.497944348074725}, {87.909172058105469, 45}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>FontInfo</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>w</key>
+ <string>0</string>
+ </dict>
+ <key>Font</key>
+ <string>Helvetica</string>
+ <key>NSKern</key>
+ <real>0.0</real>
+ <key>Size</key>
+ <real>12</real>
+ </dict>
+ <key>ID</key>
+ <integer>43459</integer>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Color</key>
+ <dict>
+ <key>b</key>
+ <string>0.791123</string>
+ <key>g</key>
+ <string>1</string>
+ <key>r</key>
+ <string>0.777435</string>
+ </dict>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\qc
+
+\f0\fs24 \cf0 \expnd0\expndtw0\kerning0
+'se' Files}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{212.49812316894531, 193.48792471098125}, {317.00189208984375, 90.004020690917969}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>43496</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{1, 0.5}</string>
+ <string>{1, -0.5}</string>
+ <string>{-1, 0.5}</string>
+ <string>{-1, -0.5}</string>
+ <string>{0.5, 1}</string>
+ <string>{-0.5, 1}</string>
+ <string>{0.5, -1}</string>
+ <string>{-0.5, -1}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Cap</key>
+ <integer>0</integer>
+ <key>CornerRadius</key>
+ <real>5</real>
+ <key>Join</key>
+ <integer>0</integer>
+ <key>Pattern</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Align</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720
+
+\f0\fs20 \cf0 Contigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>TextPlacement</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{212.49811788989803, 326.97584270519633}, {317.00189208984375, 90.004020690917969}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>43495</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{1, 0.5}</string>
+ <string>{1, -0.5}</string>
+ <string>{-1, 0.5}</string>
+ <string>{-1, -0.5}</string>
+ <string>{0.5, 1}</string>
+ <string>{-0.5, 1}</string>
+ <string>{0.5, -1}</string>
+ <string>{-0.5, -1}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Cap</key>
+ <integer>0</integer>
+ <key>CornerRadius</key>
+ <real>5</real>
+ <key>Join</key>
+ <integer>0</integer>
+ <key>Pattern</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Align</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720
+
+\f0\fs20 \cf0 Scaffolds}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>TextPlacement</key>
+ <integer>0</integer>
+ </dict>
+ <dict>
+ <key>Bounds</key>
+ <string>{{210.60791960427923, 60}, {318.89206799795477, 90.004020690917969}}</string>
+ <key>Class</key>
+ <string>ShapedGraphic</string>
+ <key>ID</key>
+ <integer>43596</integer>
+ <key>Magnets</key>
+ <array>
+ <string>{1, 0.5}</string>
+ <string>{1, -0.5}</string>
+ <string>{-1, 0.5}</string>
+ <string>{-1, -0.5}</string>
+ <string>{0.5, 1}</string>
+ <string>{-0.5, 1}</string>
+ <string>{0.5, -1}</string>
+ <string>{-0.5, -1}</string>
+ </array>
+ <key>Shape</key>
+ <string>Rectangle</string>
+ <key>Style</key>
+ <dict>
+ <key>fill</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>shadow</key>
+ <dict>
+ <key>Draws</key>
+ <string>NO</string>
+ </dict>
+ <key>stroke</key>
+ <dict>
+ <key>Cap</key>
+ <integer>0</integer>
+ <key>CornerRadius</key>
+ <real>5</real>
+ <key>Join</key>
+ <integer>0</integer>
+ <key>Pattern</key>
+ <integer>1</integer>
+ </dict>
+ </dict>
+ <key>Text</key>
+ <dict>
+ <key>Align</key>
+ <integer>0</integer>
+ <key>Text</key>
+ <string>{\rtf1\ansi\ansicpg1252\cocoartf1138\cocoasubrtf510
+{\fonttbl\f0\fswiss\fcharset0 Helvetica;}
+{\colortbl;\red255\green255\blue255;}
+\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720
+
+\f0\fs20 \cf0 Unitigs}</string>
+ <key>VerticalPad</key>
+ <integer>0</integer>
+ </dict>
+ <key>TextPlacement</key>
+ <integer>0</integer>
+ </dict>
+ </array>
+ <key>GridInfo</key>
+ <dict>
+ <key>ShowsGrid</key>
+ <string>YES</string>
+ </dict>
+ <key>GuidesLocked</key>
+ <string>NO</string>
+ <key>GuidesVisible</key>
+ <string>YES</string>
+ <key>HPages</key>
+ <integer>2</integer>
+ <key>ImageCounter</key>
+ <integer>8</integer>
+ <key>KeepToScale</key>
+ <false/>
+ <key>Layers</key>
+ <array>
+ <dict>
+ <key>Lock</key>
+ <string>NO</string>
+ <key>Name</key>
+ <string>Layer 1</string>
+ <key>Print</key>
+ <string>YES</string>
+ <key>View</key>
+ <string>YES</string>
+ </dict>
+ </array>
+ <key>LayoutInfo</key>
+ <dict>
+ <key>Animate</key>
+ <string>NO</string>
+ <key>HierarchicalOrientation</key>
+ <integer>0</integer>
+ <key>LineLength</key>
+ <real>0.4643835723400116</real>
+ <key>circoMinDist</key>
+ <real>18</real>
+ <key>circoSeparation</key>
+ <real>0.0</real>
+ <key>layoutEngine</key>
+ <string>dot</string>
+ <key>neatoSeparation</key>
+ <real>0.0</real>
+ <key>twopiSeparation</key>
+ <real>0.0</real>
+ </dict>
+ <key>LinksVisible</key>
+ <string>NO</string>
+ <key>MagnetsVisible</key>
+ <string>NO</string>
+ <key>MasterSheets</key>
+ <array/>
+ <key>ModificationDate</key>
+ <string>2013-09-19 18:08:36 +0000</string>
+ <key>Modifier</key>
+ <string>Tony Raymond</string>
+ <key>NotesVisible</key>
+ <string>NO</string>
+ <key>Orientation</key>
+ <integer>2</integer>
+ <key>OriginVisible</key>
+ <string>NO</string>
+ <key>OutlineStyle</key>
+ <string>Basic</string>
+ <key>PageBreaks</key>
+ <string>NO</string>
+ <key>PrintInfo</key>
+ <dict>
+ <key>NSBottomMargin</key>
+ <array>
+ <string>float</string>
+ <string>41</string>
+ </array>
+ <key>NSHorizonalPagination</key>
+ <array>
+ <string>coded</string>
+ <string>BAtzdHJlYW10eXBlZIHoA4QBQISEhAhOU051bWJlcgCEhAdOU1ZhbHVlAISECE5TT2JqZWN0AIWEASqEhAFxlwCG</string>
+ </array>
+ <key>NSLeftMargin</key>
+ <array>
+ <string>float</string>
+ <string>18</string>
+ </array>
+ <key>NSPaperSize</key>
+ <array>
+ <string>size</string>
+ <string>{612, 792}</string>
+ </array>
+ <key>NSPrintReverseOrientation</key>
+ <array>
+ <string>int</string>
+ <string>0</string>
+ </array>
+ <key>NSRightMargin</key>
+ <array>
+ <string>float</string>
+ <string>18</string>
+ </array>
+ <key>NSTopMargin</key>
+ <array>
+ <string>float</string>
+ <string>18</string>
+ </array>
+ </dict>
+ <key>PrintOnePage</key>
+ <true/>
+ <key>ReadOnly</key>
+ <string>NO</string>
+ <key>RowAlign</key>
+ <integer>1</integer>
+ <key>RowSpacing</key>
+ <real>36</real>
+ <key>SheetTitle</key>
+ <string>Canvas</string>
+ <key>SmartAlignmentGuidesActive</key>
+ <string>YES</string>
+ <key>SmartDistanceGuidesActive</key>
+ <string>YES</string>
+ <key>UniqueID</key>
+ <integer>7</integer>
+ <key>UseEntirePage</key>
+ <false/>
+ <key>VPages</key>
+ <integer>2</integer>
+ <key>WindowInfo</key>
+ <dict>
+ <key>CurrentSheet</key>
+ <integer>0</integer>
+ <key>ExpandedCanvases</key>
+ <array/>
+ <key>Frame</key>
+ <string>{{439, 332}, {1378, 1037}}</string>
+ <key>ListView</key>
+ <false/>
+ <key>OutlineWidth</key>
+ <integer>142</integer>
+ <key>RightSidebar</key>
+ <true/>
+ <key>Sidebar</key>
+ <true/>
+ <key>SidebarWidth</key>
+ <integer>138</integer>
+ <key>VisibleRegion</key>
+ <string>{{1, 1}, {1097, 927}}</string>
+ <key>Zoom</key>
+ <real>1</real>
+ <key>ZoomValues</key>
+ <array>
+ <array>
+ <string>Canvas</string>
+ <real>1</real>
+ <real>1</real>
+ </array>
+ </array>
+ </dict>
+</dict>
+</plist>
diff --git a/doc/flowchart_simplified.pdf b/doc/flowchart_simplified.pdf
new file mode 100644
index 0000000..ec29691
Binary files /dev/null and b/doc/flowchart_simplified.pdf differ
diff --git a/install-sh b/install-sh
deleted file mode 100755
index 377bb86..0000000
--- a/install-sh
+++ /dev/null
@@ -1,527 +0,0 @@
-#!/bin/sh
-# install - install a program, script, or datafile
-
-scriptversion=2011-11-20.07; # UTC
-
-# This originates from X11R5 (mit/util/scripts/install.sh), which was
-# later released in X11R6 (xc/config/util/install.sh) with the
-# following copyright and license.
-#
-# Copyright (C) 1994 X Consortium
-#
-# Permission is hereby granted, free of charge, to any person obtaining a copy
-# of this software and associated documentation files (the "Software"), to
-# deal in the Software without restriction, including without limitation the
-# rights to use, copy, modify, merge, publish, distribute, sublicense, and/or
-# sell copies of the Software, and to permit persons to whom the Software is
-# furnished to do so, subject to the following conditions:
-#
-# The above copyright notice and this permission notice shall be included in
-# all copies or substantial portions of the Software.
-#
-# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
-# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
-# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
-# X CONSORTIUM BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN
-# AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNEC-
-# TION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
-#
-# Except as contained in this notice, the name of the X Consortium shall not
-# be used in advertising or otherwise to promote the sale, use or other deal-
-# ings in this Software without prior written authorization from the X Consor-
-# tium.
-#
-#
-# FSF changes to this file are in the public domain.
-#
-# Calling this script install-sh is preferred over install.sh, to prevent
-# 'make' implicit rules from creating a file called install from it
-# when there is no Makefile.
-#
-# This script is compatible with the BSD install script, but was written
-# from scratch.
-
-nl='
-'
-IFS=" "" $nl"
-
-# set DOITPROG to echo to test this script
-
-# Don't use :- since 4.3BSD and earlier shells don't like it.
-doit=${DOITPROG-}
-if test -z "$doit"; then
- doit_exec=exec
-else
- doit_exec=$doit
-fi
-
-# Put in absolute file names if you don't have them in your path;
-# or use environment vars.
-
-chgrpprog=${CHGRPPROG-chgrp}
-chmodprog=${CHMODPROG-chmod}
-chownprog=${CHOWNPROG-chown}
-cmpprog=${CMPPROG-cmp}
-cpprog=${CPPROG-cp}
-mkdirprog=${MKDIRPROG-mkdir}
-mvprog=${MVPROG-mv}
-rmprog=${RMPROG-rm}
-stripprog=${STRIPPROG-strip}
-
-posix_glob='?'
-initialize_posix_glob='
- test "$posix_glob" != "?" || {
- if (set -f) 2>/dev/null; then
- posix_glob=
- else
- posix_glob=:
- fi
- }
-'
-
-posix_mkdir=
-
-# Desired mode of installed file.
-mode=0755
-
-chgrpcmd=
-chmodcmd=$chmodprog
-chowncmd=
-mvcmd=$mvprog
-rmcmd="$rmprog -f"
-stripcmd=
-
-src=
-dst=
-dir_arg=
-dst_arg=
-
-copy_on_change=false
-no_target_directory=
-
-usage="\
-Usage: $0 [OPTION]... [-T] SRCFILE DSTFILE
- or: $0 [OPTION]... SRCFILES... DIRECTORY
- or: $0 [OPTION]... -t DIRECTORY SRCFILES...
- or: $0 [OPTION]... -d DIRECTORIES...
-
-In the 1st form, copy SRCFILE to DSTFILE.
-In the 2nd and 3rd, copy all SRCFILES to DIRECTORY.
-In the 4th, create DIRECTORIES.
-
-Options:
- --help display this help and exit.
- --version display version info and exit.
-
- -c (ignored)
- -C install only if different (preserve the last data modification time)
- -d create directories instead of installing files.
- -g GROUP $chgrpprog installed files to GROUP.
- -m MODE $chmodprog installed files to MODE.
- -o USER $chownprog installed files to USER.
- -s $stripprog installed files.
- -t DIRECTORY install into DIRECTORY.
- -T report an error if DSTFILE is a directory.
-
-Environment variables override the default commands:
- CHGRPPROG CHMODPROG CHOWNPROG CMPPROG CPPROG MKDIRPROG MVPROG
- RMPROG STRIPPROG
-"
-
-while test $# -ne 0; do
- case $1 in
- -c) ;;
-
- -C) copy_on_change=true;;
-
- -d) dir_arg=true;;
-
- -g) chgrpcmd="$chgrpprog $2"
- shift;;
-
- --help) echo "$usage"; exit $?;;
-
- -m) mode=$2
- case $mode in
- *' '* | *' '* | *'
-'* | *'*'* | *'?'* | *'['*)
- echo "$0: invalid mode: $mode" >&2
- exit 1;;
- esac
- shift;;
-
- -o) chowncmd="$chownprog $2"
- shift;;
-
- -s) stripcmd=$stripprog;;
-
- -t) dst_arg=$2
- # Protect names problematic for 'test' and other utilities.
- case $dst_arg in
- -* | [=\(\)!]) dst_arg=./$dst_arg;;
- esac
- shift;;
-
- -T) no_target_directory=true;;
-
- --version) echo "$0 $scriptversion"; exit $?;;
-
- --) shift
- break;;
-
- -*) echo "$0: invalid option: $1" >&2
- exit 1;;
-
- *) break;;
- esac
- shift
-done
-
-if test $# -ne 0 && test -z "$dir_arg$dst_arg"; then
- # When -d is used, all remaining arguments are directories to create.
- # When -t is used, the destination is already specified.
- # Otherwise, the last argument is the destination. Remove it from $@.
- for arg
- do
- if test -n "$dst_arg"; then
- # $@ is not empty: it contains at least $arg.
- set fnord "$@" "$dst_arg"
- shift # fnord
- fi
- shift # arg
- dst_arg=$arg
- # Protect names problematic for 'test' and other utilities.
- case $dst_arg in
- -* | [=\(\)!]) dst_arg=./$dst_arg;;
- esac
- done
-fi
-
-if test $# -eq 0; then
- if test -z "$dir_arg"; then
- echo "$0: no input file specified." >&2
- exit 1
- fi
- # It's OK to call 'install-sh -d' without argument.
- # This can happen when creating conditional directories.
- exit 0
-fi
-
-if test -z "$dir_arg"; then
- do_exit='(exit $ret); exit $ret'
- trap "ret=129; $do_exit" 1
- trap "ret=130; $do_exit" 2
- trap "ret=141; $do_exit" 13
- trap "ret=143; $do_exit" 15
-
- # Set umask so as not to create temps with too-generous modes.
- # However, 'strip' requires both read and write access to temps.
- case $mode in
- # Optimize common cases.
- *644) cp_umask=133;;
- *755) cp_umask=22;;
-
- *[0-7])
- if test -z "$stripcmd"; then
- u_plus_rw=
- else
- u_plus_rw='% 200'
- fi
- cp_umask=`expr '(' 777 - $mode % 1000 ')' $u_plus_rw`;;
- *)
- if test -z "$stripcmd"; then
- u_plus_rw=
- else
- u_plus_rw=,u+rw
- fi
- cp_umask=$mode$u_plus_rw;;
- esac
-fi
-
-for src
-do
- # Protect names problematic for 'test' and other utilities.
- case $src in
- -* | [=\(\)!]) src=./$src;;
- esac
-
- if test -n "$dir_arg"; then
- dst=$src
- dstdir=$dst
- test -d "$dstdir"
- dstdir_status=$?
- else
-
- # Waiting for this to be detected by the "$cpprog $src $dsttmp" command
- # might cause directories to be created, which would be especially bad
- # if $src (and thus $dsttmp) contains '*'.
- if test ! -f "$src" && test ! -d "$src"; then
- echo "$0: $src does not exist." >&2
- exit 1
- fi
-
- if test -z "$dst_arg"; then
- echo "$0: no destination specified." >&2
- exit 1
- fi
- dst=$dst_arg
-
- # If destination is a directory, append the input filename; won't work
- # if double slashes aren't ignored.
- if test -d "$dst"; then
- if test -n "$no_target_directory"; then
- echo "$0: $dst_arg: Is a directory" >&2
- exit 1
- fi
- dstdir=$dst
- dst=$dstdir/`basename "$src"`
- dstdir_status=0
- else
- # Prefer dirname, but fall back on a substitute if dirname fails.
- dstdir=`
- (dirname "$dst") 2>/dev/null ||
- expr X"$dst" : 'X\(.*[^/]\)//*[^/][^/]*/*$' \| \
- X"$dst" : 'X\(//\)[^/]' \| \
- X"$dst" : 'X\(//\)$' \| \
- X"$dst" : 'X\(/\)' \| . 2>/dev/null ||
- echo X"$dst" |
- sed '/^X\(.*[^/]\)\/\/*[^/][^/]*\/*$/{
- s//\1/
- q
- }
- /^X\(\/\/\)[^/].*/{
- s//\1/
- q
- }
- /^X\(\/\/\)$/{
- s//\1/
- q
- }
- /^X\(\/\).*/{
- s//\1/
- q
- }
- s/.*/./; q'
- `
-
- test -d "$dstdir"
- dstdir_status=$?
- fi
- fi
-
- obsolete_mkdir_used=false
-
- if test $dstdir_status != 0; then
- case $posix_mkdir in
- '')
- # Create intermediate dirs using mode 755 as modified by the umask.
- # This is like FreeBSD 'install' as of 1997-10-28.
- umask=`umask`
- case $stripcmd.$umask in
- # Optimize common cases.
- *[2367][2367]) mkdir_umask=$umask;;
- .*0[02][02] | .[02][02] | .[02]) mkdir_umask=22;;
-
- *[0-7])
- mkdir_umask=`expr $umask + 22 \
- - $umask % 100 % 40 + $umask % 20 \
- - $umask % 10 % 4 + $umask % 2
- `;;
- *) mkdir_umask=$umask,go-w;;
- esac
-
- # With -d, create the new directory with the user-specified mode.
- # Otherwise, rely on $mkdir_umask.
- if test -n "$dir_arg"; then
- mkdir_mode=-m$mode
- else
- mkdir_mode=
- fi
-
- posix_mkdir=false
- case $umask in
- *[123567][0-7][0-7])
- # POSIX mkdir -p sets u+wx bits regardless of umask, which
- # is incompatible with FreeBSD 'install' when (umask & 300) != 0.
- ;;
- *)
- tmpdir=${TMPDIR-/tmp}/ins$RANDOM-$$
- trap 'ret=$?; rmdir "$tmpdir/d" "$tmpdir" 2>/dev/null; exit $ret' 0
-
- if (umask $mkdir_umask &&
- exec $mkdirprog $mkdir_mode -p -- "$tmpdir/d") >/dev/null 2>&1
- then
- if test -z "$dir_arg" || {
- # Check for POSIX incompatibilities with -m.
- # HP-UX 11.23 and IRIX 6.5 mkdir -m -p sets group- or
- # other-writable bit of parent directory when it shouldn't.
- # FreeBSD 6.1 mkdir -m -p sets mode of existing directory.
- ls_ld_tmpdir=`ls -ld "$tmpdir"`
- case $ls_ld_tmpdir in
- d????-?r-*) different_mode=700;;
- d????-?--*) different_mode=755;;
- *) false;;
- esac &&
- $mkdirprog -m$different_mode -p -- "$tmpdir" && {
- ls_ld_tmpdir_1=`ls -ld "$tmpdir"`
- test "$ls_ld_tmpdir" = "$ls_ld_tmpdir_1"
- }
- }
- then posix_mkdir=:
- fi
- rmdir "$tmpdir/d" "$tmpdir"
- else
- # Remove any dirs left behind by ancient mkdir implementations.
- rmdir ./$mkdir_mode ./-p ./-- 2>/dev/null
- fi
- trap '' 0;;
- esac;;
- esac
-
- if
- $posix_mkdir && (
- umask $mkdir_umask &&
- $doit_exec $mkdirprog $mkdir_mode -p -- "$dstdir"
- )
- then :
- else
-
- # The umask is ridiculous, or mkdir does not conform to POSIX,
- # or it failed possibly due to a race condition. Create the
- # directory the slow way, step by step, checking for races as we go.
-
- case $dstdir in
- /*) prefix='/';;
- [-=\(\)!]*) prefix='./';;
- *) prefix='';;
- esac
-
- eval "$initialize_posix_glob"
-
- oIFS=$IFS
- IFS=/
- $posix_glob set -f
- set fnord $dstdir
- shift
- $posix_glob set +f
- IFS=$oIFS
-
- prefixes=
-
- for d
- do
- test X"$d" = X && continue
-
- prefix=$prefix$d
- if test -d "$prefix"; then
- prefixes=
- else
- if $posix_mkdir; then
- (umask=$mkdir_umask &&
- $doit_exec $mkdirprog $mkdir_mode -p -- "$dstdir") && break
- # Don't fail if two instances are running concurrently.
- test -d "$prefix" || exit 1
- else
- case $prefix in
- *\'*) qprefix=`echo "$prefix" | sed "s/'/'\\\\\\\\''/g"`;;
- *) qprefix=$prefix;;
- esac
- prefixes="$prefixes '$qprefix'"
- fi
- fi
- prefix=$prefix/
- done
-
- if test -n "$prefixes"; then
- # Don't fail if two instances are running concurrently.
- (umask $mkdir_umask &&
- eval "\$doit_exec \$mkdirprog $prefixes") ||
- test -d "$dstdir" || exit 1
- obsolete_mkdir_used=true
- fi
- fi
- fi
-
- if test -n "$dir_arg"; then
- { test -z "$chowncmd" || $doit $chowncmd "$dst"; } &&
- { test -z "$chgrpcmd" || $doit $chgrpcmd "$dst"; } &&
- { test "$obsolete_mkdir_used$chowncmd$chgrpcmd" = false ||
- test -z "$chmodcmd" || $doit $chmodcmd $mode "$dst"; } || exit 1
- else
-
- # Make a couple of temp file names in the proper directory.
- dsttmp=$dstdir/_inst.$$_
- rmtmp=$dstdir/_rm.$$_
-
- # Trap to clean up those temp files at exit.
- trap 'ret=$?; rm -f "$dsttmp" "$rmtmp" && exit $ret' 0
-
- # Copy the file name to the temp name.
- (umask $cp_umask && $doit_exec $cpprog "$src" "$dsttmp") &&
-
- # and set any options; do chmod last to preserve setuid bits.
- #
- # If any of these fail, we abort the whole thing. If we want to
- # ignore errors from any of these, just make sure not to ignore
- # errors from the above "$doit $cpprog $src $dsttmp" command.
- #
- { test -z "$chowncmd" || $doit $chowncmd "$dsttmp"; } &&
- { test -z "$chgrpcmd" || $doit $chgrpcmd "$dsttmp"; } &&
- { test -z "$stripcmd" || $doit $stripcmd "$dsttmp"; } &&
- { test -z "$chmodcmd" || $doit $chmodcmd $mode "$dsttmp"; } &&
-
- # If -C, don't bother to copy if it wouldn't change the file.
- if $copy_on_change &&
- old=`LC_ALL=C ls -dlL "$dst" 2>/dev/null` &&
- new=`LC_ALL=C ls -dlL "$dsttmp" 2>/dev/null` &&
-
- eval "$initialize_posix_glob" &&
- $posix_glob set -f &&
- set X $old && old=:$2:$4:$5:$6 &&
- set X $new && new=:$2:$4:$5:$6 &&
- $posix_glob set +f &&
-
- test "$old" = "$new" &&
- $cmpprog "$dst" "$dsttmp" >/dev/null 2>&1
- then
- rm -f "$dsttmp"
- else
- # Rename the file to the real destination.
- $doit $mvcmd -f "$dsttmp" "$dst" 2>/dev/null ||
-
- # The rename failed, perhaps because mv can't rename something else
- # to itself, or perhaps because mv is so ancient that it does not
- # support -f.
- {
- # Now remove or move aside any old file at destination location.
- # We try this two ways since rm can't unlink itself on some
- # systems and the destination file might be busy for other
- # reasons. In this case, the final cleanup might fail but the new
- # file should still install successfully.
- {
- test ! -f "$dst" ||
- $doit $rmcmd -f "$dst" 2>/dev/null ||
- { $doit $mvcmd -f "$dst" "$rmtmp" 2>/dev/null &&
- { $doit $rmcmd -f "$rmtmp" 2>/dev/null; :; }
- } ||
- { echo "$0: cannot unlink or rename $dst" >&2
- (exit 1); exit 1
- }
- } &&
-
- # Now rename the file to the real destination.
- $doit $mvcmd "$dsttmp" "$dst"
- }
- fi || exit 1
-
- trap '' 0
- fi
-done
-
-# Local variables:
-# eval: (add-hook 'write-file-hooks 'time-stamp)
-# time-stamp-start: "scriptversion="
-# time-stamp-format: "%:y-%02m-%02d.%02H"
-# time-stamp-time-zone: "UTC"
-# time-stamp-end: "; # UTC"
-# End:
diff --git a/kmerprint/Makefile.am b/kmerprint/Makefile.am
index 410bf7d..64dba9b 100644
--- a/kmerprint/Makefile.am
+++ b/kmerprint/Makefile.am
@@ -2,10 +2,12 @@ noinst_PROGRAMS = kmerprint
kmerprint_CPPFLAGS = -I$(top_srcdir) \
-I$(top_srcdir)/Assembly \
- -I$(top_srcdir)/Common
+ -I$(top_srcdir)/Common \
+ -I$(top_srcdir)/DataLayer
kmerprint_LDADD = \
$(top_builddir)/Assembly/libassembly.a \
+ $(top_builddir)/DataLayer/libdatalayer.a \
$(top_builddir)/Common/libcommon.a
kmerprint_SOURCES = kmerprint.cc
diff --git a/kmerprint/Makefile.in b/kmerprint/Makefile.in
deleted file mode 100644
index c2b5ccc..0000000
--- a/kmerprint/Makefile.in
+++ /dev/null
@@ -1,543 +0,0 @@
-# Makefile.in generated by automake 1.14 from Makefile.am.
-# @configure_input@
-
-# Copyright (C) 1994-2013 Free Software Foundation, Inc.
-
-# This Makefile.in is free software; the Free Software Foundation
-# gives unlimited permission to copy and/or distribute it,
-# with or without modifications, as long as this notice is preserved.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY, to the extent permitted by law; without
-# even the implied warranty of MERCHANTABILITY or FITNESS FOR A
-# PARTICULAR PURPOSE.
-
- at SET_MAKE@
-
-VPATH = @srcdir@
-am__is_gnu_make = test -n '$(MAKEFILE_LIST)' && test -n '$(MAKELEVEL)'
-am__make_running_with_option = \
- case $${target_option-} in \
- ?) ;; \
- *) echo "am__make_running_with_option: internal error: invalid" \
- "target option '$${target_option-}' specified" >&2; \
- exit 1;; \
- esac; \
- has_opt=no; \
- sane_makeflags=$$MAKEFLAGS; \
- if $(am__is_gnu_make); then \
- sane_makeflags=$$MFLAGS; \
- else \
- case $$MAKEFLAGS in \
- *\\[\ \ ]*) \
- bs=\\; \
- sane_makeflags=`printf '%s\n' "$$MAKEFLAGS" \
- | sed "s/$$bs$$bs[$$bs $$bs ]*//g"`;; \
- esac; \
- fi; \
- skip_next=no; \
- strip_trailopt () \
- { \
- flg=`printf '%s\n' "$$flg" | sed "s/$$1.*$$//"`; \
- }; \
- for flg in $$sane_makeflags; do \
- test $$skip_next = yes && { skip_next=no; continue; }; \
- case $$flg in \
- *=*|--*) continue;; \
- -*I) strip_trailopt 'I'; skip_next=yes;; \
- -*I?*) strip_trailopt 'I';; \
- -*O) strip_trailopt 'O'; skip_next=yes;; \
- -*O?*) strip_trailopt 'O';; \
- -*l) strip_trailopt 'l'; skip_next=yes;; \
- -*l?*) strip_trailopt 'l';; \
- -[dEDm]) skip_next=yes;; \
- -[JT]) skip_next=yes;; \
- esac; \
- case $$flg in \
- *$$target_option*) has_opt=yes; break;; \
- esac; \
- done; \
- test $$has_opt = yes
-am__make_dryrun = (target_option=n; $(am__make_running_with_option))
-am__make_keepgoing = (target_option=k; $(am__make_running_with_option))
-pkgdatadir = $(datadir)/@PACKAGE@
-pkgincludedir = $(includedir)/@PACKAGE@
-pkglibdir = $(libdir)/@PACKAGE@
-pkglibexecdir = $(libexecdir)/@PACKAGE@
-am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd
-install_sh_DATA = $(install_sh) -c -m 644
-install_sh_PROGRAM = $(install_sh) -c
-install_sh_SCRIPT = $(install_sh) -c
-INSTALL_HEADER = $(INSTALL_DATA)
-transform = $(program_transform_name)
-NORMAL_INSTALL = :
-PRE_INSTALL = :
-POST_INSTALL = :
-NORMAL_UNINSTALL = :
-PRE_UNINSTALL = :
-POST_UNINSTALL = :
-noinst_PROGRAMS = kmerprint$(EXEEXT)
-subdir = kmerprint
-DIST_COMMON = $(srcdir)/Makefile.in $(srcdir)/Makefile.am \
- $(top_srcdir)/depcomp
-ACLOCAL_M4 = $(top_srcdir)/aclocal.m4
-am__aclocal_m4_deps = $(top_srcdir)/configure.ac
-am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \
- $(ACLOCAL_M4)
-mkinstalldirs = $(install_sh) -d
-CONFIG_HEADER = $(top_builddir)/config.h
-CONFIG_CLEAN_FILES =
-CONFIG_CLEAN_VPATH_FILES =
-PROGRAMS = $(noinst_PROGRAMS)
-am_kmerprint_OBJECTS = kmerprint-kmerprint.$(OBJEXT)
-kmerprint_OBJECTS = $(am_kmerprint_OBJECTS)
-kmerprint_DEPENDENCIES = $(top_builddir)/Assembly/libassembly.a \
- $(top_builddir)/Common/libcommon.a
-AM_V_P = $(am__v_P_ at AM_V@)
-am__v_P_ = $(am__v_P_ at AM_DEFAULT_V@)
-am__v_P_0 = false
-am__v_P_1 = :
-AM_V_GEN = $(am__v_GEN_ at AM_V@)
-am__v_GEN_ = $(am__v_GEN_ at AM_DEFAULT_V@)
-am__v_GEN_0 = @echo " GEN " $@;
-am__v_GEN_1 =
-AM_V_at = $(am__v_at_ at AM_V@)
-am__v_at_ = $(am__v_at_ at AM_DEFAULT_V@)
-am__v_at_0 = @
-am__v_at_1 =
-DEFAULT_INCLUDES = -I. at am__isrc@ -I$(top_builddir)
-depcomp = $(SHELL) $(top_srcdir)/depcomp
-am__depfiles_maybe = depfiles
-am__mv = mv -f
-AM_V_lt = $(am__v_lt_ at AM_V@)
-am__v_lt_ = $(am__v_lt_ at AM_DEFAULT_V@)
-am__v_lt_0 = --silent
-am__v_lt_1 =
-CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \
- $(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)
-AM_V_CXX = $(am__v_CXX_ at AM_V@)
-am__v_CXX_ = $(am__v_CXX_ at AM_DEFAULT_V@)
-am__v_CXX_0 = @echo " CXX " $@;
-am__v_CXX_1 =
-CXXLD = $(CXX)
-CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \
- -o $@
-AM_V_CXXLD = $(am__v_CXXLD_ at AM_V@)
-am__v_CXXLD_ = $(am__v_CXXLD_ at AM_DEFAULT_V@)
-am__v_CXXLD_0 = @echo " CXXLD " $@;
-am__v_CXXLD_1 =
-SOURCES = $(kmerprint_SOURCES)
-DIST_SOURCES = $(kmerprint_SOURCES)
-am__can_run_installinfo = \
- case $$AM_UPDATE_INFO_DIR in \
- n|no|NO) false;; \
- *) (install-info --version) >/dev/null 2>&1;; \
- esac
-am__tagged_files = $(HEADERS) $(SOURCES) $(TAGS_FILES) $(LISP)
-# Read a list of newline-separated strings from the standard input,
-# and print each of them once, without duplicates. Input order is
-# *not* preserved.
-am__uniquify_input = $(AWK) '\
- BEGIN { nonempty = 0; } \
- { items[$$0] = 1; nonempty = 1; } \
- END { if (nonempty) { for (i in items) print i; }; } \
-'
-# Make sure the list of sources is unique. This is necessary because,
-# e.g., the same source file might be shared among _SOURCES variables
-# for different programs/libraries.
-am__define_uniq_tagged_files = \
- list='$(am__tagged_files)'; \
- unique=`for i in $$list; do \
- if test -f "$$i"; then echo $$i; else echo $(srcdir)/$$i; fi; \
- done | $(am__uniquify_input)`
-ETAGS = etags
-CTAGS = ctags
-DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)
-ACLOCAL = @ACLOCAL@
-AMTAR = @AMTAR@
-AM_CXXFLAGS = @AM_CXXFLAGS@
-AM_DEFAULT_VERBOSITY = @AM_DEFAULT_VERBOSITY@
-AUTOCONF = @AUTOCONF@
-AUTOHEADER = @AUTOHEADER@
-AUTOMAKE = @AUTOMAKE@
-AWK = @AWK@
-CC = @CC@
-CCDEPMODE = @CCDEPMODE@
-CFLAGS = @CFLAGS@
-CPP = @CPP@
-CPPFLAGS = @CPPFLAGS@
-CXX = @CXX@
-CXXCPP = @CXXCPP@
-CXXDEPMODE = @CXXDEPMODE@
-CXXFLAGS = @CXXFLAGS@
-CYGPATH_W = @CYGPATH_W@
-DEFS = @DEFS@
-DEPDIR = @DEPDIR@
-ECHO_C = @ECHO_C@
-ECHO_N = @ECHO_N@
-ECHO_T = @ECHO_T@
-EGREP = @EGREP@
-EXEEXT = @EXEEXT@
-GHC = @GHC@
-GREP = @GREP@
-INSTALL = @INSTALL@
-INSTALL_DATA = @INSTALL_DATA@
-INSTALL_PROGRAM = @INSTALL_PROGRAM@
-INSTALL_SCRIPT = @INSTALL_SCRIPT@
-INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@
-LDFLAGS = @LDFLAGS@
-LIBOBJS = @LIBOBJS@
-LIBS = @LIBS@
-LTLIBOBJS = @LTLIBOBJS@
-MAKEINFO = @MAKEINFO@
-MKDIR_P = @MKDIR_P@
-MPI_LIBS = @MPI_LIBS@
-OBJEXT = @OBJEXT@
-OPENMP_CXXFLAGS = @OPENMP_CXXFLAGS@
-PACKAGE = @PACKAGE@
-PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@
-PACKAGE_NAME = @PACKAGE_NAME@
-PACKAGE_STRING = @PACKAGE_STRING@
-PACKAGE_TARNAME = @PACKAGE_TARNAME@
-PACKAGE_URL = @PACKAGE_URL@
-PACKAGE_VERSION = @PACKAGE_VERSION@
-PATH_SEPARATOR = @PATH_SEPARATOR@
-RANLIB = @RANLIB@
-SET_MAKE = @SET_MAKE@
-SHELL = @SHELL@
-STRIP = @STRIP@
-VERSION = @VERSION@
-abs_builddir = @abs_builddir@
-abs_srcdir = @abs_srcdir@
-abs_top_builddir = @abs_top_builddir@
-abs_top_srcdir = @abs_top_srcdir@
-ac_ct_CC = @ac_ct_CC@
-ac_ct_CXX = @ac_ct_CXX@
-am__include = @am__include@
-am__leading_dot = @am__leading_dot@
-am__quote = @am__quote@
-am__tar = @am__tar@
-am__untar = @am__untar@
-bindir = @bindir@
-build_alias = @build_alias@
-builddir = @builddir@
-datadir = @datadir@
-datarootdir = @datarootdir@
-docdir = @docdir@
-dvidir = @dvidir@
-exec_prefix = @exec_prefix@
-host_alias = @host_alias@
-htmldir = @htmldir@
-includedir = @includedir@
-infodir = @infodir@
-install_sh = @install_sh@
-libdir = @libdir@
-libexecdir = @libexecdir@
-localedir = @localedir@
-localstatedir = @localstatedir@
-mandir = @mandir@
-mkdir_p = @mkdir_p@
-oldincludedir = @oldincludedir@
-pdfdir = @pdfdir@
-prefix = @prefix@
-program_transform_name = @program_transform_name@
-psdir = @psdir@
-sbindir = @sbindir@
-sharedstatedir = @sharedstatedir@
-srcdir = @srcdir@
-sysconfdir = @sysconfdir@
-target_alias = @target_alias@
-top_build_prefix = @top_build_prefix@
-top_builddir = @top_builddir@
-top_srcdir = @top_srcdir@
-kmerprint_CPPFLAGS = -I$(top_srcdir) \
- -I$(top_srcdir)/Assembly \
- -I$(top_srcdir)/Common
-
-kmerprint_LDADD = \
- $(top_builddir)/Assembly/libassembly.a \
- $(top_builddir)/Common/libcommon.a
-
-kmerprint_SOURCES = kmerprint.cc
-all: all-am
-
-.SUFFIXES:
-.SUFFIXES: .cc .o .obj
-$(srcdir)/Makefile.in: $(srcdir)/Makefile.am $(am__configure_deps)
- @for dep in $?; do \
- case '$(am__configure_deps)' in \
- *$$dep*) \
- ( cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh ) \
- && { if test -f $@; then exit 0; else break; fi; }; \
- exit 1;; \
- esac; \
- done; \
- echo ' cd $(top_srcdir) && $(AUTOMAKE) --foreign kmerprint/Makefile'; \
- $(am__cd) $(top_srcdir) && \
- $(AUTOMAKE) --foreign kmerprint/Makefile
-.PRECIOUS: Makefile
-Makefile: $(srcdir)/Makefile.in $(top_builddir)/config.status
- @case '$?' in \
- *config.status*) \
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \
- *) \
- echo ' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)'; \
- cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \
- esac;
-
-$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-
-$(top_srcdir)/configure: $(am__configure_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(ACLOCAL_M4): $(am__aclocal_m4_deps)
- cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh
-$(am__aclocal_m4_deps):
-
-clean-noinstPROGRAMS:
- -test -z "$(noinst_PROGRAMS)" || rm -f $(noinst_PROGRAMS)
-
-kmerprint$(EXEEXT): $(kmerprint_OBJECTS) $(kmerprint_DEPENDENCIES) $(EXTRA_kmerprint_DEPENDENCIES)
- @rm -f kmerprint$(EXEEXT)
- $(AM_V_CXXLD)$(CXXLINK) $(kmerprint_OBJECTS) $(kmerprint_LDADD) $(LIBS)
-
-mostlyclean-compile:
- -rm -f *.$(OBJEXT)
-
-distclean-compile:
- -rm -f *.tab.c
-
- at AMDEP_TRUE@@am__include@ @am__quote at ./$(DEPDIR)/kmerprint-kmerprint.Po at am__quote@
-
-.cc.o:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ $<
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ $<
-
-.cc.obj:
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXXCOMPILE) -MT $@ -MD -MP -MF $(DEPDIR)/$*.Tpo -c -o $@ `$(CYGPATH_W) '$<'`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/$*.Tpo $(DEPDIR)/$*.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='$<' object='$@' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXXCOMPILE) -c -o $@ `$(CYGPATH_W) '$<'`
-
-kmerprint-kmerprint.o: kmerprint.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(kmerprint_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT kmerprint-kmerprint.o -MD -MP -MF $(DEPDIR)/kmerprint-kmerprint.Tpo -c -o kmerprint-kmerprint.o `test -f 'kmerprint.cc' || echo '$(srcdir)/'`kmerprint.cc
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/kmerprint-kmerprint.Tpo $(DEPDIR)/kmerprint-kmerprint.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='kmerprint.cc' object='kmerprint-kmerprint.o' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(kmerprint_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o kmerprint-kmerprint.o `test -f 'kmerprint.cc' || echo '$(srcdir)/'`kmerprint.cc
-
-kmerprint-kmerprint.obj: kmerprint.cc
- at am__fastdepCXX_TRUE@ $(AM_V_CXX)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(kmerprint_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -MT kmerprint-kmerprint.obj -MD -MP -MF $(DEPDIR)/kmerprint-kmerprint.Tpo -c -o kmerprint-kmerprint.obj `if test -f 'kmerprint.cc'; then $(CYGPATH_W) 'kmerprint.cc'; else $(CYGPATH_W) '$(srcdir)/kmerprint.cc'; fi`
- at am__fastdepCXX_TRUE@ $(AM_V_at)$(am__mv) $(DEPDIR)/kmerprint-kmerprint.Tpo $(DEPDIR)/kmerprint-kmerprint.Po
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ $(AM_V_CXX)source='kmerprint.cc' object='kmerprint-kmerprint.obj' libtool=no @AMDEPBACKSLASH@
- at AMDEP_TRUE@@am__fastdepCXX_FALSE@ DEPDIR=$(DEPDIR) $(CXXDEPMODE) $(depcomp) @AMDEPBACKSLASH@
- at am__fastdepCXX_FALSE@ $(AM_V_CXX at am__nodep@)$(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(kmerprint_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS) -c -o kmerprint-kmerprint.obj `if test -f 'kmerprint.cc'; then $(CYGPATH_W) 'kmerprint.cc'; else $(CYGPATH_W) '$(srcdir)/kmerprint.cc'; fi`
-
-ID: $(am__tagged_files)
- $(am__define_uniq_tagged_files); mkid -fID $$unique
-tags: tags-am
-TAGS: tags
-
-tags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- set x; \
- here=`pwd`; \
- $(am__define_uniq_tagged_files); \
- shift; \
- if test -z "$(ETAGS_ARGS)$$*$$unique"; then :; else \
- test -n "$$unique" || unique=$$empty_fix; \
- if test $$# -gt 0; then \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- "$$@" $$unique; \
- else \
- $(ETAGS) $(ETAGSFLAGS) $(AM_ETAGSFLAGS) $(ETAGS_ARGS) \
- $$unique; \
- fi; \
- fi
-ctags: ctags-am
-
-CTAGS: ctags
-ctags-am: $(TAGS_DEPENDENCIES) $(am__tagged_files)
- $(am__define_uniq_tagged_files); \
- test -z "$(CTAGS_ARGS)$$unique" \
- || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \
- $$unique
-
-GTAGS:
- here=`$(am__cd) $(top_builddir) && pwd` \
- && $(am__cd) $(top_srcdir) \
- && gtags -i $(GTAGS_ARGS) "$$here"
-cscopelist: cscopelist-am
-
-cscopelist-am: $(am__tagged_files)
- list='$(am__tagged_files)'; \
- case "$(srcdir)" in \
- [\\/]* | ?:[\\/]*) sdir="$(srcdir)" ;; \
- *) sdir=$(subdir)/$(srcdir) ;; \
- esac; \
- for i in $$list; do \
- if test -f "$$i"; then \
- echo "$(subdir)/$$i"; \
- else \
- echo "$$sdir/$$i"; \
- fi; \
- done >> $(top_builddir)/cscope.files
-
-distclean-tags:
- -rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags
-
-distdir: $(DISTFILES)
- @srcdirstrip=`echo "$(srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- topsrcdirstrip=`echo "$(top_srcdir)" | sed 's/[].[^$$\\*]/\\\\&/g'`; \
- list='$(DISTFILES)'; \
- dist_files=`for file in $$list; do echo $$file; done | \
- sed -e "s|^$$srcdirstrip/||;t" \
- -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \
- case $$dist_files in \
- */*) $(MKDIR_P) `echo "$$dist_files" | \
- sed '/\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,' | \
- sort -u` ;; \
- esac; \
- for file in $$dist_files; do \
- if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \
- if test -d $$d/$$file; then \
- dir=`echo "/$$file" | sed -e 's,/[^/]*$$,,'`; \
- if test -d "$(distdir)/$$file"; then \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \
- cp -fpR $(srcdir)/$$file "$(distdir)$$dir" || exit 1; \
- find "$(distdir)/$$file" -type d ! -perm -700 -exec chmod u+rwx {} \;; \
- fi; \
- cp -fpR $$d/$$file "$(distdir)$$dir" || exit 1; \
- else \
- test -f "$(distdir)/$$file" \
- || cp -p $$d/$$file "$(distdir)/$$file" \
- || exit 1; \
- fi; \
- done
-check-am: all-am
-check: check-am
-all-am: Makefile $(PROGRAMS)
-installdirs:
-install: install-am
-install-exec: install-exec-am
-install-data: install-data-am
-uninstall: uninstall-am
-
-install-am: all-am
- @$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am
-
-installcheck: installcheck-am
-install-strip:
- if test -z '$(STRIP)'; then \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- install; \
- else \
- $(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \
- install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \
- "INSTALL_PROGRAM_ENV=STRIPPROG='$(STRIP)'" install; \
- fi
-mostlyclean-generic:
-
-clean-generic:
-
-distclean-generic:
- -test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)
- -test . = "$(srcdir)" || test -z "$(CONFIG_CLEAN_VPATH_FILES)" || rm -f $(CONFIG_CLEAN_VPATH_FILES)
-
-maintainer-clean-generic:
- @echo "This command is intended for maintainers to use"
- @echo "it deletes files that may require special tools to rebuild."
-clean: clean-am
-
-clean-am: clean-generic clean-noinstPROGRAMS mostlyclean-am
-
-distclean: distclean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-distclean-am: clean-am distclean-compile distclean-generic \
- distclean-tags
-
-dvi: dvi-am
-
-dvi-am:
-
-html: html-am
-
-html-am:
-
-info: info-am
-
-info-am:
-
-install-data-am:
-
-install-dvi: install-dvi-am
-
-install-dvi-am:
-
-install-exec-am:
-
-install-html: install-html-am
-
-install-html-am:
-
-install-info: install-info-am
-
-install-info-am:
-
-install-man:
-
-install-pdf: install-pdf-am
-
-install-pdf-am:
-
-install-ps: install-ps-am
-
-install-ps-am:
-
-installcheck-am:
-
-maintainer-clean: maintainer-clean-am
- -rm -rf ./$(DEPDIR)
- -rm -f Makefile
-maintainer-clean-am: distclean-am maintainer-clean-generic
-
-mostlyclean: mostlyclean-am
-
-mostlyclean-am: mostlyclean-compile mostlyclean-generic
-
-pdf: pdf-am
-
-pdf-am:
-
-ps: ps-am
-
-ps-am:
-
-uninstall-am:
-
-.MAKE: install-am install-strip
-
-.PHONY: CTAGS GTAGS TAGS all all-am check check-am clean clean-generic \
- clean-noinstPROGRAMS cscopelist-am ctags ctags-am distclean \
- distclean-compile distclean-generic distclean-tags distdir dvi \
- dvi-am html html-am info info-am install install-am \
- install-data install-data-am install-dvi install-dvi-am \
- install-exec install-exec-am install-html install-html-am \
- install-info install-info-am install-man install-pdf \
- install-pdf-am install-ps install-ps-am install-strip \
- installcheck installcheck-am installdirs maintainer-clean \
- maintainer-clean-generic mostlyclean mostlyclean-compile \
- mostlyclean-generic pdf pdf-am ps ps-am tags tags-am uninstall \
- uninstall-am
-
-
-# Tell versions [3.59,3.63) of GNU make to not export all variables.
-# Otherwise a system limit (for SysV at least) may be exceeded.
-.NOEXPORT:
diff --git a/kmerprint/kmerprint.cc b/kmerprint/kmerprint.cc
index 243f0b1..657c694 100644
--- a/kmerprint/kmerprint.cc
+++ b/kmerprint/kmerprint.cc
@@ -23,7 +23,7 @@ PROGRAM " (" PACKAGE_NAME ") " VERSION "\n"
"Copyright 2013 Shaun Jackman\n";
static const char USAGE_MESSAGE[] =
-"Usage: " PROGRAM " [OPTION]... GRAPH...\n"
+"Usage: " PROGRAM " -k<kmer> [OPTION]... GRAPH...\n"
"Convert a binary de Bruijn graph to plain text.\n"
"\n"
" Arguments:\n"
diff --git a/missing b/missing
deleted file mode 100755
index cdea514..0000000
--- a/missing
+++ /dev/null
@@ -1,215 +0,0 @@
-#! /bin/sh
-# Common wrapper for a few potentially missing GNU programs.
-
-scriptversion=2012-06-26.16; # UTC
-
-# Copyright (C) 1996-2013 Free Software Foundation, Inc.
-# Originally written by Fran,cois Pinard <pinard at iro.umontreal.ca>, 1996.
-
-# This program is free software; you can redistribute it and/or modify
-# it under the terms of the GNU General Public License as published by
-# the Free Software Foundation; either version 2, or (at your option)
-# any later version.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY; without even the implied warranty of
-# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
-# GNU General Public License for more details.
-
-# You should have received a copy of the GNU General Public License
-# along with this program. If not, see <http://www.gnu.org/licenses/>.
-
-# As a special exception to the GNU General Public License, if you
-# distribute this file as part of a program that contains a
-# configuration script generated by Autoconf, you may include it under
-# the same distribution terms that you use for the rest of that program.
-
-if test $# -eq 0; then
- echo 1>&2 "Try '$0 --help' for more information"
- exit 1
-fi
-
-case $1 in
-
- --is-lightweight)
- # Used by our autoconf macros to check whether the available missing
- # script is modern enough.
- exit 0
- ;;
-
- --run)
- # Back-compat with the calling convention used by older automake.
- shift
- ;;
-
- -h|--h|--he|--hel|--help)
- echo "\
-$0 [OPTION]... PROGRAM [ARGUMENT]...
-
-Run 'PROGRAM [ARGUMENT]...', returning a proper advice when this fails due
-to PROGRAM being missing or too old.
-
-Options:
- -h, --help display this help and exit
- -v, --version output version information and exit
-
-Supported PROGRAM values:
- aclocal autoconf autoheader autom4te automake makeinfo
- bison yacc flex lex help2man
-
-Version suffixes to PROGRAM as well as the prefixes 'gnu-', 'gnu', and
-'g' are ignored when checking the name.
-
-Send bug reports to <bug-automake at gnu.org>."
- exit $?
- ;;
-
- -v|--v|--ve|--ver|--vers|--versi|--versio|--version)
- echo "missing $scriptversion (GNU Automake)"
- exit $?
- ;;
-
- -*)
- echo 1>&2 "$0: unknown '$1' option"
- echo 1>&2 "Try '$0 --help' for more information"
- exit 1
- ;;
-
-esac
-
-# Run the given program, remember its exit status.
-"$@"; st=$?
-
-# If it succeeded, we are done.
-test $st -eq 0 && exit 0
-
-# Also exit now if we it failed (or wasn't found), and '--version' was
-# passed; such an option is passed most likely to detect whether the
-# program is present and works.
-case $2 in --version|--help) exit $st;; esac
-
-# Exit code 63 means version mismatch. This often happens when the user
-# tries to use an ancient version of a tool on a file that requires a
-# minimum version.
-if test $st -eq 63; then
- msg="probably too old"
-elif test $st -eq 127; then
- # Program was missing.
- msg="missing on your system"
-else
- # Program was found and executed, but failed. Give up.
- exit $st
-fi
-
-perl_URL=http://www.perl.org/
-flex_URL=http://flex.sourceforge.net/
-gnu_software_URL=http://www.gnu.org/software
-
-program_details ()
-{
- case $1 in
- aclocal|automake)
- echo "The '$1' program is part of the GNU Automake package:"
- echo "<$gnu_software_URL/automake>"
- echo "It also requires GNU Autoconf, GNU m4 and Perl in order to run:"
- echo "<$gnu_software_URL/autoconf>"
- echo "<$gnu_software_URL/m4/>"
- echo "<$perl_URL>"
- ;;
- autoconf|autom4te|autoheader)
- echo "The '$1' program is part of the GNU Autoconf package:"
- echo "<$gnu_software_URL/autoconf/>"
- echo "It also requires GNU m4 and Perl in order to run:"
- echo "<$gnu_software_URL/m4/>"
- echo "<$perl_URL>"
- ;;
- esac
-}
-
-give_advice ()
-{
- # Normalize program name to check for.
- normalized_program=`echo "$1" | sed '
- s/^gnu-//; t
- s/^gnu//; t
- s/^g//; t'`
-
- printf '%s\n' "'$1' is $msg."
-
- configure_deps="'configure.ac' or m4 files included by 'configure.ac'"
- case $normalized_program in
- autoconf*)
- echo "You should only need it if you modified 'configure.ac',"
- echo "or m4 files included by it."
- program_details 'autoconf'
- ;;
- autoheader*)
- echo "You should only need it if you modified 'acconfig.h' or"
- echo "$configure_deps."
- program_details 'autoheader'
- ;;
- automake*)
- echo "You should only need it if you modified 'Makefile.am' or"
- echo "$configure_deps."
- program_details 'automake'
- ;;
- aclocal*)
- echo "You should only need it if you modified 'acinclude.m4' or"
- echo "$configure_deps."
- program_details 'aclocal'
- ;;
- autom4te*)
- echo "You might have modified some maintainer files that require"
- echo "the 'automa4te' program to be rebuilt."
- program_details 'autom4te'
- ;;
- bison*|yacc*)
- echo "You should only need it if you modified a '.y' file."
- echo "You may want to install the GNU Bison package:"
- echo "<$gnu_software_URL/bison/>"
- ;;
- lex*|flex*)
- echo "You should only need it if you modified a '.l' file."
- echo "You may want to install the Fast Lexical Analyzer package:"
- echo "<$flex_URL>"
- ;;
- help2man*)
- echo "You should only need it if you modified a dependency" \
- "of a man page."
- echo "You may want to install the GNU Help2man package:"
- echo "<$gnu_software_URL/help2man/>"
- ;;
- makeinfo*)
- echo "You should only need it if you modified a '.texi' file, or"
- echo "any other file indirectly affecting the aspect of the manual."
- echo "You might want to install the Texinfo package:"
- echo "<$gnu_software_URL/texinfo/>"
- echo "The spurious makeinfo call might also be the consequence of"
- echo "using a buggy 'make' (AIX, DU, IRIX), in which case you might"
- echo "want to install GNU make:"
- echo "<$gnu_software_URL/make/>"
- ;;
- *)
- echo "You might have modified some files without having the proper"
- echo "tools for further handling them. Check the 'README' file, it"
- echo "often tells you about the needed prerequisites for installing"
- echo "this package. You may also peek at any GNU archive site, in"
- echo "case some other package contains this missing '$1' program."
- ;;
- esac
-}
-
-give_advice "$1" | sed -e '1s/^/WARNING: /' \
- -e '2,$s/^/ /' >&2
-
-# Propagate the correct exit status (expected to be 127 for a program
-# not found, 63 for a program that failed due to version mismatch).
-exit $st
-
-# Local variables:
-# eval: (add-hook 'write-file-hooks 'time-stamp)
-# time-stamp-start: "scriptversion="
-# time-stamp-format: "%:y-%02m-%02d.%02H"
-# time-stamp-time-zone: "UTC"
-# time-stamp-end: "; # UTC"
-# End:
--
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/abyss.git
More information about the debian-med-commit
mailing list