[med-svn] [python-screed] 01/06: Imported Upstream version 0.8
Michael Crusoe
misterc-guest at moszumanska.debian.org
Thu May 28 03:23:03 UTC 2015
This is an automated email from the git hooks/post-receive script.
misterc-guest pushed a commit to branch master
in repository python-screed.
commit 458072d1bf15e153517a87ad64a7305b8a0facd0
Author: Michael R. Crusoe <mcrusoe at msu.edu>
Date: Wed May 27 21:27:50 2015 -0400
Imported Upstream version 0.8
---
.gitattributes | 1 +
.gitignore | 12 +
.travis.yml | 6 -
CODE_OF_CONDUCT.rst | 35 +
ChangeLog | 61 +
Doxyfile.in | 2303 ++++++++++++++++++++++++++++++
MANIFEST.in | 4 +
Makefile | 117 ++
README.md | 2 +-
TODO | 2 +
benchmarks/fqGen.py | 10 +-
benchmarks/fqToFaConvert.py | 8 +-
benchmarks/mysql/mysqlCreateTimeit.py | 2 +-
benchmarks/pgres/pgresCreateTimeit.py | 2 +-
benchmarks/screedCreateTimeit.py | 2 +-
bigtests/__init__.py | 30 +-
doc/CODE_OF_CONDUCT.txt | 1 +
doc/COPYRIGHT.txt | 2 -
doc/LICENSE.txt | 6 +-
doc/_static/labibi.css | 54 +
doc/_static/labibi.js | 29 +
doc/conf.py | 33 +-
doc/dev/CODE_OF_CONDUCT.rst | 1 +
doc/dev/coding-guidelines-and-review.txt | 66 +
doc/dev/index.txt | 20 +
doc/dev/release-checklist.txt | 142 ++
doc/index.txt | 9 +-
doc/{ => release-notes}/RELEASE-0.5.txt | 4 +
doc/release-notes/RELEASE-0.8.md | 64 +
doc/release-notes/index.txt | 11 +
doc/schema.txt | 5 -
doc/screed.html | 14 +-
doc/screed.txt | 45 +-
doc/user/known-issues.txt | 26 +
get_version.py | 16 +
jenkins-build.sh | 26 +
screed/__init__.py | 68 +-
screed/_version.py | 191 +++
screed/conversion.py | 28 +-
screed/createscreed.py | 12 +-
screed/dna.py | 7 +-
screed/dump_to_fasta.py | 5 +-
screed/dump_to_fastq.py | 5 +-
screed/fadbm.py | 3 +-
screed/fasta.py | 9 +-
screed/fastq.py | 25 +-
screed/fqdbm.py | 2 +-
screed/hava.py | 2 +-
screed/openscreed.py | 98 +-
screed/pygr_api.py | 33 +-
screed/screedRecord.py | 33 +-
screed/seqparse.py | 8 +-
screed/tests/havaGen.py | 17 +-
screed/tests/test.fa.zip | Bin 0 -> 4237 bytes
screed/tests/test.fastq.bz2 | Bin 0 -> 3730 bytes
screed/tests/test_convert.py | 7 +-
screed/tests/test_dictionary.py | 13 +-
screed/tests/test_dna.py | 28 +
screed/tests/test_fasta.py | 44 +-
screed/tests/test_fasta_recover.py | 5 +-
screed/tests/test_fastq.py | 35 +-
screed/tests/test_fastq_recover.py | 2 +
screed/tests/test_hava_methods.py | 35 +-
screed/tests/test_nodb.py | 6 +-
screed/tests/test_open.py | 26 +-
screed/tests/test_pygr_api.py | 39 +-
screed/tests/test_shell.py | 8 +-
screed/tests/test_streaming.py | 85 ++
setup.py | 22 +-
versioneer.py | 913 ++++++++++++
70 files changed, 4685 insertions(+), 300 deletions(-)
diff --git a/.gitattributes b/.gitattributes
new file mode 100644
index 0000000..a7ddc27
--- /dev/null
+++ b/.gitattributes
@@ -0,0 +1 @@
+screed/_version.py export-subst
diff --git a/.gitignore b/.gitignore
index 25fb013..4fbdb99 100644
--- a/.gitignore
+++ b/.gitignore
@@ -8,3 +8,15 @@ screed.egg-info
dist
screed/tests/fa_to_fq
screed/tests/fq_to_fa
+Doxyfile
+.coverage
+coverage.xml
+diff-cover.html
+doc/doxygen/
+env/
+htmlcov/
+nosetests.xml
+pylint_report.txt
+.*.swp
+MANIFEST
+doc/_build/*
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 2899e55..0000000
--- a/.travis.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-language: python
-python:
- - "2.7"
- - "2.6"
-install: python setup.py install
-script: python -m screed.tests.__main__
diff --git a/CODE_OF_CONDUCT.rst b/CODE_OF_CONDUCT.rst
new file mode 100644
index 0000000..df7fe91
--- /dev/null
+++ b/CODE_OF_CONDUCT.rst
@@ -0,0 +1,35 @@
+Contributor Code of Conduct
+===========================
+
+As contributors and maintainers of this project, we pledge to respect
+all people who contribute through reporting issues, posting feature
+requests, updating documentation, submitting pull requests or patches,
+and other activities.
+
+We are committed to making participation in this project a
+harassment-free experience for everyone, regardless of level of
+experience, gender, gender identity and expression, sexual orientation,
+disability, personal appearance, body size, race, age, or religion.
+
+Examples of unacceptable behavior by participants include the use of
+sexual language or imagery, derogatory comments or personal attacks,
+trolling, public or private harassment, insults, or other unprofessional
+conduct.
+
+Project maintainers have the right and responsibility to remove, edit,
+or reject comments, commits, code, wiki edits, issues, and other
+contributions that are not aligned to this Code of Conduct. Project
+maintainers or contributors who do not follow the Code of Conduct may be
+removed from the project team.
+
+Instances of abusive, harassing, or otherwise unacceptable behavior may
+be reported by emailing `khmer-project at idyll.org
+<mailto:khmer-project at idyll.org>`__ which only goes to C. Titus Brown and
+Michael R. Crusoe. To report an issue involving either of them please email
+`Judi Brown Clarke, Ph.D. <mailto:jbc at egr.msu.edu>`__ the Diversity Director
+at the BEACON Center for the Study of Evolution in Action, an NSF Center for
+Science and Technology.
+
+This Code of Conduct is adapted from the `Contributor
+Covenant <http://contributor-covenant.org>`__, version 1.0.0, available at
+http://contributor-covenant.org/version/1/0/0/
diff --git a/ChangeLog b/ChangeLog
new file mode 100644
index 0000000..4575486
--- /dev/null
+++ b/ChangeLog
@@ -0,0 +1,61 @@
+2015-04-04 Jacob Fenton <bocajnotnef at gmail.com>
+
+ * doc/dev/release{.txt,-checklist.txt}: renamed/restored release.txt to
+ release-checklist.txt
+
+2015-03-06 Kevin Murray <spam at kdmurray.id.au>
+
+ * screed/screedRecord.py: Fix a typo in a try: except: block.
+ s/AttributError/AttributeError/
+
+2015-02-23 Gabriel Pratt <gpratt at ucsd.edu>
+
+ * Fixed Issue 705 len(read) != len(read.sequence)
+
+2015-02-23 Michael R. Crusoe <mcrusoe at msu.edu>
+
+ * Doxyfile.in: make documentation generation reproducible; removed
+ timestamp
+
+2015-02-23 Michael R. Crusoe <mcrusoe at msu.edu>
+
+ * doc/dev/release.txt: Fix formatting
+ * MANIFEST.in: include the MANIFEST.in template, the license and other
+ files
+ * versioneer.py,screed/{__init__,_version}.py: upgrade versioneer to 0.13
+
+2015-02-23 Michael R. Crusoe <mcrusoe at msu.edu>
+
+ * setup.py: work around versioneer bug:
+ https://github.com/warner/python-versioneer/issues/52
+
+2014-12-07 Michael R. Crusoe <mcrusoe at msu.edu>
+
+ * Initial jenkins-build.sh
+
+2014-12-03 Jacob Fenton <bocajnotnef at gmail.com>
+
+ * ChangeLog: updated to include major revisions since 0.7.1
+ * CODE_OF_CONDUCT: copied in code of conduct from khmer project
+ * docs/dev/{CODE_OF_CONDUCT, coding-guidelines-and-review, index,
+ releases}.txt, docs/index.txt: added screed dev docs
+ * setup.py, .gitattributes, __init__.py, _version.py, versioneer.py:
+ installed versioneer version naming system
+ * MANIFEST.in: now includes versioneer files and empty testing file
+
+2014-11-02 Michael R. Crusoe <mcrusoe at msu.edu>
+
+ * Doxyfile, Makefile: added Doxygen support, coverage & pylint make targets
+
+2014-10-27 Ben Taylor <taylo886 at msu.edu>
+
+ * benchmarks/fqGen.py, benchmarks/fqToFaConvert.py,
+ benchmarks/mysql/mysqlCreateTimeit.py, benchmarks/screedCreateTimeit.py,
+ benchmarks/pgres/pgresCreateTimeit.py, gibtests/__init__.py,
+ doc/screed.html, doc/screed.txt, screed/conversion.py, screed/fastq.py,
+ screed/tests/test_fastq.py: Changed all uses of "accuracy" to "quality"
+ * screed/tests/test_dna.py: Added basic test coverage for screed/dna.py
+
+2014-05-16 Michael R. Crusoe <mcrusoe at msu.edu>
+
+ * screed/openscreed.py: added sniffing of compression types, including zip
diff --git a/Doxyfile.in b/Doxyfile.in
new file mode 100644
index 0000000..e477e5b
--- /dev/null
+++ b/Doxyfile.in
@@ -0,0 +1,2303 @@
+# Doxyfile 1.8.6
+
+# This file describes the settings to be used by the documentation system
+# doxygen (www.doxygen.org) for a project.
+#
+# All text after a double hash (##) is considered a comment and is placed in
+# front of the TAG it is preceding.
+#
+# All text after a single hash (#) is considered a comment and will be ignored.
+# The format is:
+# TAG = value [value, ...]
+# For lists, items can also be appended using:
+# TAG += value [value, ...]
+# Values that contain spaces should be placed between quotes (\" \").
+
+#---------------------------------------------------------------------------
+# Project related configuration options
+#---------------------------------------------------------------------------
+
+# This tag specifies the encoding used for all characters in the config file
+# that follow. The default is UTF-8 which is also the encoding used for all text
+# before the first occurrence of this tag. Doxygen uses libiconv (or the iconv
+# built into libc) for the transcoding. See http://www.gnu.org/software/libiconv
+# for the list of possible encodings.
+# The default value is: UTF-8.
+
+DOXYFILE_ENCODING = UTF-8
+
+# The PROJECT_NAME tag is a single word (or a sequence of words surrounded by
+# double-quotes, unless you are using Doxywizard) that should identify the
+# project for which the documentation is generated. This name is used in the
+# title of most generated pages and in a few other places.
+# The default value is: My Project.
+
+PROJECT_NAME = "screed"
+
+# The PROJECT_NUMBER tag can be used to enter a project or revision number. This
+# could be handy for archiving the generated documentation or if some version
+# control system is used.
+
+PROJECT_NUMBER = ${VERSION}
+
+# Using the PROJECT_BRIEF tag one can provide an optional one line description
+# for a project that appears at the top of each page and should give viewer a
+# quick idea about the purpose of the project. Keep the description short.
+
+PROJECT_BRIEF =
+
+# With the PROJECT_LOGO tag one can specify an logo or icon that is included in
+# the documentation. The maximum height of the logo should not exceed 55 pixels
+# and the maximum width should not exceed 200 pixels. Doxygen will copy the logo
+# to the output directory.
+
+PROJECT_LOGO =
+
+# The OUTPUT_DIRECTORY tag is used to specify the (relative or absolute) path
+# into which the generated documentation will be written. If a relative path is
+# entered, it will be relative to the location where doxygen was started. If
+# left blank the current directory will be used.
+
+OUTPUT_DIRECTORY = doc/doxygen
+
+# If the CREATE_SUBDIRS tag is set to YES, then doxygen will create 4096 sub-
+# directories (in 2 levels) under the output directory of each output format and
+# will distribute the generated files over these directories. Enabling this
+# option can be useful when feeding doxygen a huge amount of source files, where
+# putting all generated files in the same directory would otherwise causes
+# performance problems for the file system.
+# The default value is: NO.
+
+CREATE_SUBDIRS = NO
+
+# The OUTPUT_LANGUAGE tag is used to specify the language in which all
+# documentation generated by doxygen is written. Doxygen will use this
+# information to generate all constant output in the proper language.
+# Possible values are: Afrikaans, Arabic, Armenian, Brazilian, Catalan, Chinese,
+# Chinese-Traditional, Croatian, Czech, Danish, Dutch, English (United States),
+# Esperanto, Farsi (Persian), Finnish, French, German, Greek, Hungarian,
+# Indonesian, Italian, Japanese, Japanese-en (Japanese with English messages),
+# Korean, Korean-en (Korean with English messages), Latvian, Lithuanian,
+# Macedonian, Norwegian, Persian (Farsi), Polish, Portuguese, Romanian, Russian,
+# Serbian, Serbian-Cyrillic, Slovak, Slovene, Spanish, Swedish, Turkish,
+# Ukrainian and Vietnamese.
+# The default value is: English.
+
+OUTPUT_LANGUAGE = English
+
+# If the BRIEF_MEMBER_DESC tag is set to YES doxygen will include brief member
+# descriptions after the members that are listed in the file and class
+# documentation (similar to Javadoc). Set to NO to disable this.
+# The default value is: YES.
+
+BRIEF_MEMBER_DESC = YES
+
+# If the REPEAT_BRIEF tag is set to YES doxygen will prepend the brief
+# description of a member or function before the detailed description
+#
+# Note: If both HIDE_UNDOC_MEMBERS and BRIEF_MEMBER_DESC are set to NO, the
+# brief descriptions will be completely suppressed.
+# The default value is: YES.
+
+REPEAT_BRIEF = YES
+
+# This tag implements a quasi-intelligent brief description abbreviator that is
+# used to form the text in various listings. Each string in this list, if found
+# as the leading text of the brief description, will be stripped from the text
+# and the result, after processing the whole list, is used as the annotated
+# text. Otherwise, the brief description is used as-is. If left blank, the
+# following values are used ($name is automatically replaced with the name of
+# the entity):The $name class, The $name widget, The $name file, is, provides,
+# specifies, contains, represents, a, an and the.
+
+ABBREVIATE_BRIEF =
+
+# If the ALWAYS_DETAILED_SEC and REPEAT_BRIEF tags are both set to YES then
+# doxygen will generate a detailed section even if there is only a brief
+# description.
+# The default value is: NO.
+
+ALWAYS_DETAILED_SEC = NO
+
+# If the INLINE_INHERITED_MEMB tag is set to YES, doxygen will show all
+# inherited members of a class in the documentation of that class as if those
+# members were ordinary class members. Constructors, destructors and assignment
+# operators of the base classes will not be shown.
+# The default value is: NO.
+
+INLINE_INHERITED_MEMB = NO
+
+# If the FULL_PATH_NAMES tag is set to YES doxygen will prepend the full path
+# before files name in the file list and in the header files. If set to NO the
+# shortest path that makes the file name unique will be used
+# The default value is: YES.
+
+FULL_PATH_NAMES = YES
+
+# The STRIP_FROM_PATH tag can be used to strip a user-defined part of the path.
+# Stripping is only done if one of the specified strings matches the left-hand
+# part of the path. The tag can be used to show relative paths in the file list.
+# If left blank the directory from which doxygen is run is used as the path to
+# strip.
+#
+# Note that you can specify absolute paths here, but also relative paths, which
+# will be relative from the directory where doxygen is started.
+# This tag requires that the tag FULL_PATH_NAMES is set to YES.
+
+STRIP_FROM_PATH =
+
+# The STRIP_FROM_INC_PATH tag can be used to strip a user-defined part of the
+# path mentioned in the documentation of a class, which tells the reader which
+# header file to include in order to use a class. If left blank only the name of
+# the header file containing the class definition is used. Otherwise one should
+# specify the list of include paths that are normally passed to the compiler
+# using the -I flag.
+
+STRIP_FROM_INC_PATH =
+
+# If the SHORT_NAMES tag is set to YES, doxygen will generate much shorter (but
+# less readable) file names. This can be useful is your file systems doesn't
+# support long names like on DOS, Mac, or CD-ROM.
+# The default value is: NO.
+
+SHORT_NAMES = NO
+
+# If the JAVADOC_AUTOBRIEF tag is set to YES then doxygen will interpret the
+# first line (until the first dot) of a Javadoc-style comment as the brief
+# description. If set to NO, the Javadoc-style will behave just like regular Qt-
+# style comments (thus requiring an explicit @brief command for a brief
+# description.)
+# The default value is: NO.
+
+JAVADOC_AUTOBRIEF = NO
+
+# If the QT_AUTOBRIEF tag is set to YES then doxygen will interpret the first
+# line (until the first dot) of a Qt-style comment as the brief description. If
+# set to NO, the Qt-style will behave just like regular Qt-style comments (thus
+# requiring an explicit \brief command for a brief description.)
+# The default value is: NO.
+
+QT_AUTOBRIEF = NO
+
+# The MULTILINE_CPP_IS_BRIEF tag can be set to YES to make doxygen treat a
+# multi-line C++ special comment block (i.e. a block of //! or /// comments) as
+# a brief description. This used to be the default behavior. The new default is
+# to treat a multi-line C++ comment block as a detailed description. Set this
+# tag to YES if you prefer the old behavior instead.
+#
+# Note that setting this tag to YES also means that rational rose comments are
+# not recognized any more.
+# The default value is: NO.
+
+MULTILINE_CPP_IS_BRIEF = NO
+
+# If the INHERIT_DOCS tag is set to YES then an undocumented member inherits the
+# documentation from any documented member that it re-implements.
+# The default value is: YES.
+
+INHERIT_DOCS = YES
+
+# If the SEPARATE_MEMBER_PAGES tag is set to YES, then doxygen will produce a
+# new page for each member. If set to NO, the documentation of a member will be
+# part of the file/class/namespace that contains it.
+# The default value is: NO.
+
+SEPARATE_MEMBER_PAGES = NO
+
+# The TAB_SIZE tag can be used to set the number of spaces in a tab. Doxygen
+# uses this value to replace tabs by spaces in code fragments.
+# Minimum value: 1, maximum value: 16, default value: 4.
+
+TAB_SIZE = 4
+
+# This tag can be used to specify a number of aliases that act as commands in
+# the documentation. An alias has the form:
+# name=value
+# For example adding
+# "sideeffect=@par Side Effects:\n"
+# will allow you to put the command \sideeffect (or @sideeffect) in the
+# documentation, which will result in a user-defined paragraph with heading
+# "Side Effects:". You can put \n's in the value part of an alias to insert
+# newlines.
+
+ALIASES =
+
+# This tag can be used to specify a number of word-keyword mappings (TCL only).
+# A mapping has the form "name=value". For example adding "class=itcl::class"
+# will allow you to use the command class in the itcl::class meaning.
+
+TCL_SUBST =
+
+# Set the OPTIMIZE_OUTPUT_FOR_C tag to YES if your project consists of C sources
+# only. Doxygen will then generate output that is more tailored for C. For
+# instance, some of the names that are used will be different. The list of all
+# members will be omitted, etc.
+# The default value is: NO.
+
+OPTIMIZE_OUTPUT_FOR_C = NO
+
+# Set the OPTIMIZE_OUTPUT_JAVA tag to YES if your project consists of Java or
+# Python sources only. Doxygen will then generate output that is more tailored
+# for that language. For instance, namespaces will be presented as packages,
+# qualified scopes will look different, etc.
+# The default value is: NO.
+
+OPTIMIZE_OUTPUT_JAVA = NO
+
+# Set the OPTIMIZE_FOR_FORTRAN tag to YES if your project consists of Fortran
+# sources. Doxygen will then generate output that is tailored for Fortran.
+# The default value is: NO.
+
+OPTIMIZE_FOR_FORTRAN = NO
+
+# Set the OPTIMIZE_OUTPUT_VHDL tag to YES if your project consists of VHDL
+# sources. Doxygen will then generate output that is tailored for VHDL.
+# The default value is: NO.
+
+OPTIMIZE_OUTPUT_VHDL = NO
+
+# Doxygen selects the parser to use depending on the extension of the files it
+# parses. With this tag you can assign which parser to use for a given
+# extension. Doxygen has a built-in mapping, but you can override or extend it
+# using this tag. The format is ext=language, where ext is a file extension, and
+# language is one of the parsers supported by doxygen: IDL, Java, Javascript,
+# C#, C, C++, D, PHP, Objective-C, Python, Fortran, VHDL. For instance to make
+# doxygen treat .inc files as Fortran files (default is PHP), and .f files as C
+# (default is Fortran), use: inc=Fortran f=C.
+#
+# Note For files without extension you can use no_extension as a placeholder.
+#
+# Note that for custom extensions you also need to set FILE_PATTERNS otherwise
+# the files are not read by doxygen.
+
+EXTENSION_MAPPING =
+
+# If the MARKDOWN_SUPPORT tag is enabled then doxygen pre-processes all comments
+# according to the Markdown format, which allows for more readable
+# documentation. See http://daringfireball.net/projects/markdown/ for details.
+# The output of markdown processing is further processed by doxygen, so you can
+# mix doxygen, HTML, and XML commands with Markdown formatting. Disable only in
+# case of backward compatibilities issues.
+# The default value is: YES.
+
+MARKDOWN_SUPPORT = YES
+
+# When enabled doxygen tries to link words that correspond to documented
+# classes, or namespaces to their corresponding documentation. Such a link can
+# be prevented in individual cases by by putting a % sign in front of the word
+# or globally by setting AUTOLINK_SUPPORT to NO.
+# The default value is: YES.
+
+AUTOLINK_SUPPORT = YES
+
+# If you use STL classes (i.e. std::string, std::vector, etc.) but do not want
+# to include (a tag file for) the STL sources as input, then you should set this
+# tag to YES in order to let doxygen match functions declarations and
+# definitions whose arguments contain STL classes (e.g. func(std::string);
+# versus func(std::string) {}). This also make the inheritance and collaboration
+# diagrams that involve STL classes more complete and accurate.
+# The default value is: NO.
+
+BUILTIN_STL_SUPPORT = NO
+
+# If you use Microsoft's C++/CLI language, you should set this option to YES to
+# enable parsing support.
+# The default value is: NO.
+
+CPP_CLI_SUPPORT = NO
+
+# Set the SIP_SUPPORT tag to YES if your project consists of sip (see:
+# http://www.riverbankcomputing.co.uk/software/sip/intro) sources only. Doxygen
+# will parse them like normal C++ but will assume all classes use public instead
+# of private inheritance when no explicit protection keyword is present.
+# The default value is: NO.
+
+SIP_SUPPORT = NO
+
+# For Microsoft's IDL there are propget and propput attributes to indicate
+# getter and setter methods for a property. Setting this option to YES will make
+# doxygen to replace the get and set methods by a property in the documentation.
+# This will only work if the methods are indeed getting or setting a simple
+# type. If this is not the case, or you want to show the methods anyway, you
+# should set this option to NO.
+# The default value is: YES.
+
+IDL_PROPERTY_SUPPORT = YES
+
+# If member grouping is used in the documentation and the DISTRIBUTE_GROUP_DOC
+# tag is set to YES, then doxygen will reuse the documentation of the first
+# member in the group (if any) for the other members of the group. By default
+# all members of a group must be documented explicitly.
+# The default value is: NO.
+
+DISTRIBUTE_GROUP_DOC = NO
+
+# Set the SUBGROUPING tag to YES to allow class member groups of the same type
+# (for instance a group of public functions) to be put as a subgroup of that
+# type (e.g. under the Public Functions section). Set it to NO to prevent
+# subgrouping. Alternatively, this can be done per class using the
+# \nosubgrouping command.
+# The default value is: YES.
+
+SUBGROUPING = YES
+
+# When the INLINE_GROUPED_CLASSES tag is set to YES, classes, structs and unions
+# are shown inside the group in which they are included (e.g. using \ingroup)
+# instead of on a separate page (for HTML and Man pages) or section (for LaTeX
+# and RTF).
+#
+# Note that this feature does not work in combination with
+# SEPARATE_MEMBER_PAGES.
+# The default value is: NO.
+
+INLINE_GROUPED_CLASSES = NO
+
+# When the INLINE_SIMPLE_STRUCTS tag is set to YES, structs, classes, and unions
+# with only public data fields or simple typedef fields will be shown inline in
+# the documentation of the scope in which they are defined (i.e. file,
+# namespace, or group documentation), provided this scope is documented. If set
+# to NO, structs, classes, and unions are shown on a separate page (for HTML and
+# Man pages) or section (for LaTeX and RTF).
+# The default value is: NO.
+
+INLINE_SIMPLE_STRUCTS = NO
+
+# When TYPEDEF_HIDES_STRUCT tag is enabled, a typedef of a struct, union, or
+# enum is documented as struct, union, or enum with the name of the typedef. So
+# typedef struct TypeS {} TypeT, will appear in the documentation as a struct
+# with name TypeT. When disabled the typedef will appear as a member of a file,
+# namespace, or class. And the struct will be named TypeS. This can typically be
+# useful for C code in case the coding convention dictates that all compound
+# types are typedef'ed and only the typedef is referenced, never the tag name.
+# The default value is: NO.
+
+TYPEDEF_HIDES_STRUCT = NO
+
+# The size of the symbol lookup cache can be set using LOOKUP_CACHE_SIZE. This
+# cache is used to resolve symbols given their name and scope. Since this can be
+# an expensive process and often the same symbol appears multiple times in the
+# code, doxygen keeps a cache of pre-resolved symbols. If the cache is too small
+# doxygen will become slower. If the cache is too large, memory is wasted. The
+# cache size is given by this formula: 2^(16+LOOKUP_CACHE_SIZE). The valid range
+# is 0..9, the default is 0, corresponding to a cache size of 2^16=65536
+# symbols. At the end of a run doxygen will report the cache usage and suggest
+# the optimal cache size from a speed point of view.
+# Minimum value: 0, maximum value: 9, default value: 0.
+
+LOOKUP_CACHE_SIZE = 0
+
+#---------------------------------------------------------------------------
+# Build related configuration options
+#---------------------------------------------------------------------------
+
+# If the EXTRACT_ALL tag is set to YES doxygen will assume all entities in
+# documentation are documented, even if no documentation was available. Private
+# class members and static file members will be hidden unless the
+# EXTRACT_PRIVATE respectively EXTRACT_STATIC tags are set to YES.
+# Note: This will also disable the warnings about undocumented members that are
+# normally produced when WARNINGS is set to YES.
+# The default value is: NO.
+
+EXTRACT_ALL = YES
+
+# If the EXTRACT_PRIVATE tag is set to YES all private members of a class will
+# be included in the documentation.
+# The default value is: NO.
+
+EXTRACT_PRIVATE = YES
+
+# If the EXTRACT_PACKAGE tag is set to YES all members with package or internal
+# scope will be included in the documentation.
+# The default value is: NO.
+
+EXTRACT_PACKAGE = YES
+
+# If the EXTRACT_STATIC tag is set to YES all static members of a file will be
+# included in the documentation.
+# The default value is: NO.
+
+EXTRACT_STATIC = YES
+
+# If the EXTRACT_LOCAL_CLASSES tag is set to YES classes (and structs) defined
+# locally in source files will be included in the documentation. If set to NO
+# only classes defined in header files are included. Does not have any effect
+# for Java sources.
+# The default value is: YES.
+
+EXTRACT_LOCAL_CLASSES = YES
+
+# This flag is only useful for Objective-C code. When set to YES local methods,
+# which are defined in the implementation section but not in the interface are
+# included in the documentation. If set to NO only methods in the interface are
+# included.
+# The default value is: NO.
+
+EXTRACT_LOCAL_METHODS = NO
+
+# If this flag is set to YES, the members of anonymous namespaces will be
+# extracted and appear in the documentation as a namespace called
+# 'anonymous_namespace{file}', where file will be replaced with the base name of
+# the file that contains the anonymous namespace. By default anonymous namespace
+# are hidden.
+# The default value is: NO.
+
+EXTRACT_ANON_NSPACES = YES
+
+# If the HIDE_UNDOC_MEMBERS tag is set to YES, doxygen will hide all
+# undocumented members inside documented classes or files. If set to NO these
+# members will be included in the various overviews, but no documentation
+# section is generated. This option has no effect if EXTRACT_ALL is enabled.
+# The default value is: NO.
+
+HIDE_UNDOC_MEMBERS = NO
+
+# If the HIDE_UNDOC_CLASSES tag is set to YES, doxygen will hide all
+# undocumented classes that are normally visible in the class hierarchy. If set
+# to NO these classes will be included in the various overviews. This option has
+# no effect if EXTRACT_ALL is enabled.
+# The default value is: NO.
+
+HIDE_UNDOC_CLASSES = NO
+
+# If the HIDE_FRIEND_COMPOUNDS tag is set to YES, doxygen will hide all friend
+# (class|struct|union) declarations. If set to NO these declarations will be
+# included in the documentation.
+# The default value is: NO.
+
+HIDE_FRIEND_COMPOUNDS = NO
+
+# If the HIDE_IN_BODY_DOCS tag is set to YES, doxygen will hide any
+# documentation blocks found inside the body of a function. If set to NO these
+# blocks will be appended to the function's detailed documentation block.
+# The default value is: NO.
+
+HIDE_IN_BODY_DOCS = NO
+
+# The INTERNAL_DOCS tag determines if documentation that is typed after a
+# \internal command is included. If the tag is set to NO then the documentation
+# will be excluded. Set it to YES to include the internal documentation.
+# The default value is: NO.
+
+INTERNAL_DOCS = NO
+
+# If the CASE_SENSE_NAMES tag is set to NO then doxygen will only generate file
+# names in lower-case letters. If set to YES upper-case letters are also
+# allowed. This is useful if you have classes or files whose names only differ
+# in case and if your file system supports case sensitive file names. Windows
+# and Mac users are advised to set this option to NO.
+# The default value is: system dependent.
+
+CASE_SENSE_NAMES = NO
+
+# If the HIDE_SCOPE_NAMES tag is set to NO then doxygen will show members with
+# their full class and namespace scopes in the documentation. If set to YES the
+# scope will be hidden.
+# The default value is: NO.
+
+HIDE_SCOPE_NAMES = NO
+
+# If the SHOW_INCLUDE_FILES tag is set to YES then doxygen will put a list of
+# the files that are included by a file in the documentation of that file.
+# The default value is: YES.
+
+SHOW_INCLUDE_FILES = YES
+
+# If the SHOW_GROUPED_MEMB_INC tag is set to YES then Doxygen will add for each
+# grouped member an include statement to the documentation, telling the reader
+# which file to include in order to use the member.
+# The default value is: NO.
+
+SHOW_GROUPED_MEMB_INC = NO
+
+# If the FORCE_LOCAL_INCLUDES tag is set to YES then doxygen will list include
+# files with double quotes in the documentation rather than with sharp brackets.
+# The default value is: NO.
+
+FORCE_LOCAL_INCLUDES = NO
+
+# If the INLINE_INFO tag is set to YES then a tag [inline] is inserted in the
+# documentation for inline members.
+# The default value is: YES.
+
+INLINE_INFO = YES
+
+# If the SORT_MEMBER_DOCS tag is set to YES then doxygen will sort the
+# (detailed) documentation of file and class members alphabetically by member
+# name. If set to NO the members will appear in declaration order.
+# The default value is: YES.
+
+SORT_MEMBER_DOCS = YES
+
+# If the SORT_BRIEF_DOCS tag is set to YES then doxygen will sort the brief
+# descriptions of file, namespace and class members alphabetically by member
+# name. If set to NO the members will appear in declaration order. Note that
+# this will also influence the order of the classes in the class list.
+# The default value is: NO.
+
+SORT_BRIEF_DOCS = NO
+
+# If the SORT_MEMBERS_CTORS_1ST tag is set to YES then doxygen will sort the
+# (brief and detailed) documentation of class members so that constructors and
+# destructors are listed first. If set to NO the constructors will appear in the
+# respective orders defined by SORT_BRIEF_DOCS and SORT_MEMBER_DOCS.
+# Note: If SORT_BRIEF_DOCS is set to NO this option is ignored for sorting brief
+# member documentation.
+# Note: If SORT_MEMBER_DOCS is set to NO this option is ignored for sorting
+# detailed member documentation.
+# The default value is: NO.
+
+SORT_MEMBERS_CTORS_1ST = NO
+
+# If the SORT_GROUP_NAMES tag is set to YES then doxygen will sort the hierarchy
+# of group names into alphabetical order. If set to NO the group names will
+# appear in their defined order.
+# The default value is: NO.
+
+SORT_GROUP_NAMES = NO
+
+# If the SORT_BY_SCOPE_NAME tag is set to YES, the class list will be sorted by
+# fully-qualified names, including namespaces. If set to NO, the class list will
+# be sorted only by class name, not including the namespace part.
+# Note: This option is not very useful if HIDE_SCOPE_NAMES is set to YES.
+# Note: This option applies only to the class list, not to the alphabetical
+# list.
+# The default value is: NO.
+
+SORT_BY_SCOPE_NAME = NO
+
+# If the STRICT_PROTO_MATCHING option is enabled and doxygen fails to do proper
+# type resolution of all parameters of a function it will reject a match between
+# the prototype and the implementation of a member function even if there is
+# only one candidate or it is obvious which candidate to choose by doing a
+# simple string match. By disabling STRICT_PROTO_MATCHING doxygen will still
+# accept a match between prototype and implementation in such cases.
+# The default value is: NO.
+
+STRICT_PROTO_MATCHING = NO
+
+# The GENERATE_TODOLIST tag can be used to enable ( YES) or disable ( NO) the
+# todo list. This list is created by putting \todo commands in the
+# documentation.
+# The default value is: YES.
+
+GENERATE_TODOLIST = YES
+
+# The GENERATE_TESTLIST tag can be used to enable ( YES) or disable ( NO) the
+# test list. This list is created by putting \test commands in the
+# documentation.
+# The default value is: YES.
+
+GENERATE_TESTLIST = YES
+
+# The GENERATE_BUGLIST tag can be used to enable ( YES) or disable ( NO) the bug
+# list. This list is created by putting \bug commands in the documentation.
+# The default value is: YES.
+
+GENERATE_BUGLIST = YES
+
+# The GENERATE_DEPRECATEDLIST tag can be used to enable ( YES) or disable ( NO)
+# the deprecated list. This list is created by putting \deprecated commands in
+# the documentation.
+# The default value is: YES.
+
+GENERATE_DEPRECATEDLIST= YES
+
+# The ENABLED_SECTIONS tag can be used to enable conditional documentation
+# sections, marked by \if <section_label> ... \endif and \cond <section_label>
+# ... \endcond blocks.
+
+ENABLED_SECTIONS =
+
+# The MAX_INITIALIZER_LINES tag determines the maximum number of lines that the
+# initial value of a variable or macro / define can have for it to appear in the
+# documentation. If the initializer consists of more lines than specified here
+# it will be hidden. Use a value of 0 to hide initializers completely. The
+# appearance of the value of individual variables and macros / defines can be
+# controlled using \showinitializer or \hideinitializer command in the
+# documentation regardless of this setting.
+# Minimum value: 0, maximum value: 10000, default value: 30.
+
+MAX_INITIALIZER_LINES = 30
+
+# Set the SHOW_USED_FILES tag to NO to disable the list of files generated at
+# the bottom of the documentation of classes and structs. If set to YES the list
+# will mention the files that were used to generate the documentation.
+# The default value is: YES.
+
+SHOW_USED_FILES = YES
+
+# Set the SHOW_FILES tag to NO to disable the generation of the Files page. This
+# will remove the Files entry from the Quick Index and from the Folder Tree View
+# (if specified).
+# The default value is: YES.
+
+SHOW_FILES = YES
+
+# Set the SHOW_NAMESPACES tag to NO to disable the generation of the Namespaces
+# page. This will remove the Namespaces entry from the Quick Index and from the
+# Folder Tree View (if specified).
+# The default value is: YES.
+
+SHOW_NAMESPACES = YES
+
+# The FILE_VERSION_FILTER tag can be used to specify a program or script that
+# doxygen should invoke to get the current version for each file (typically from
+# the version control system). Doxygen will invoke the program by executing (via
+# popen()) the command command input-file, where command is the value of the
+# FILE_VERSION_FILTER tag, and input-file is the name of an input file provided
+# by doxygen. Whatever the program writes to standard output is used as the file
+# version. For an example see the documentation.
+
+FILE_VERSION_FILTER =
+
+# The LAYOUT_FILE tag can be used to specify a layout file which will be parsed
+# by doxygen. The layout file controls the global structure of the generated
+# output files in an output format independent way. To create the layout file
+# that represents doxygen's defaults, run doxygen with the -l option. You can
+# optionally specify a file name after the option, if omitted DoxygenLayout.xml
+# will be used as the name of the layout file.
+#
+# Note that if you run doxygen from a directory containing a file called
+# DoxygenLayout.xml, doxygen will parse it automatically even if the LAYOUT_FILE
+# tag is left empty.
+
+LAYOUT_FILE =
+
+# The CITE_BIB_FILES tag can be used to specify one or more bib files containing
+# the reference definitions. This must be a list of .bib files. The .bib
+# extension is automatically appended if omitted. This requires the bibtex tool
+# to be installed. See also http://en.wikipedia.org/wiki/BibTeX for more info.
+# For LaTeX the style of the bibliography can be controlled using
+# LATEX_BIB_STYLE. To use this feature you need bibtex and perl available in the
+# search path. Do not use file names with spaces, bibtex cannot handle them. See
+# also \cite for info how to create references.
+
+CITE_BIB_FILES =
+
+#---------------------------------------------------------------------------
+# Configuration options related to warning and progress messages
+#---------------------------------------------------------------------------
+
+# The QUIET tag can be used to turn on/off the messages that are generated to
+# standard output by doxygen. If QUIET is set to YES this implies that the
+# messages are off.
+# The default value is: NO.
+
+QUIET = NO
+
+# The WARNINGS tag can be used to turn on/off the warning messages that are
+# generated to standard error ( stderr) by doxygen. If WARNINGS is set to YES
+# this implies that the warnings are on.
+#
+# Tip: Turn warnings on while writing the documentation.
+# The default value is: YES.
+
+WARNINGS = YES
+
+# If the WARN_IF_UNDOCUMENTED tag is set to YES, then doxygen will generate
+# warnings for undocumented members. If EXTRACT_ALL is set to YES then this flag
+# will automatically be disabled.
+# The default value is: YES.
+
+WARN_IF_UNDOCUMENTED = YES
+
+# If the WARN_IF_DOC_ERROR tag is set to YES, doxygen will generate warnings for
+# potential errors in the documentation, such as not documenting some parameters
+# in a documented function, or documenting parameters that don't exist or using
+# markup commands wrongly.
+# The default value is: YES.
+
+WARN_IF_DOC_ERROR = YES
+
+# This WARN_NO_PARAMDOC option can be enabled to get warnings for functions that
+# are documented, but have no documentation for their parameters or return
+# value. If set to NO doxygen will only warn about wrong or incomplete parameter
+# documentation, but not about the absence of documentation.
+# The default value is: NO.
+
+WARN_NO_PARAMDOC = NO
+
+# The WARN_FORMAT tag determines the format of the warning messages that doxygen
+# can produce. The string should contain the $file, $line, and $text tags, which
+# will be replaced by the file and line number from which the warning originated
+# and the warning text. Optionally the format may contain $version, which will
+# be replaced by the version of the file (if it could be obtained via
+# FILE_VERSION_FILTER)
+# The default value is: $file:$line: $text.
+
+WARN_FORMAT = "$file:$line: $text"
+
+# The WARN_LOGFILE tag can be used to specify a file to which warning and error
+# messages should be written. If left blank the output is written to standard
+# error (stderr).
+
+WARN_LOGFILE =
+
+#---------------------------------------------------------------------------
+# Configuration options related to the input files
+#---------------------------------------------------------------------------
+
+# The INPUT tag is used to specify the files and/or directories that contain
+# documented source files. You may enter file names like myfile.cpp or
+# directories like /usr/src/myproject. Separate the files or directories with
+# spaces.
+# Note: If this tag is empty the current directory is searched.
+
+INPUT = screed
+
+# This tag can be used to specify the character encoding of the source files
+# that doxygen parses. Internally doxygen uses the UTF-8 encoding. Doxygen uses
+# libiconv (or the iconv built into libc) for the transcoding. See the libiconv
+# documentation (see: http://www.gnu.org/software/libiconv) for the list of
+# possible encodings.
+# The default value is: UTF-8.
+
+INPUT_ENCODING = UTF-8
+
+# If the value of the INPUT tag contains directories, you can use the
+# FILE_PATTERNS tag to specify one or more wildcard patterns (like *.cpp and
+# *.h) to filter out the source-files in the directories. If left blank the
+# following patterns are tested:*.c, *.cc, *.cxx, *.cpp, *.c++, *.java, *.ii,
+# *.ixx, *.ipp, *.i++, *.inl, *.idl, *.ddl, *.odl, *.h, *.hh, *.hxx, *.hpp,
+# *.h++, *.cs, *.d, *.php, *.php4, *.php5, *.phtml, *.inc, *.m, *.markdown,
+# *.md, *.mm, *.dox, *.py, *.f90, *.f, *.for, *.tcl, *.vhd, *.vhdl, *.ucf,
+# *.qsf, *.as and *.js.
+
+FILE_PATTERNS = *.py
+
+# The RECURSIVE tag can be used to specify whether or not subdirectories should
+# be searched for input files as well.
+# The default value is: NO.
+
+RECURSIVE = NO
+
+# The EXCLUDE tag can be used to specify files and/or directories that should be
+# excluded from the INPUT source files. This way you can easily exclude a
+# subdirectory from a directory tree whose root is specified with the INPUT tag.
+#
+# Note that relative paths are relative to the directory from which doxygen is
+# run.
+
+EXCLUDE = screed/tests
+
+# The EXCLUDE_SYMLINKS tag can be used to select whether or not files or
+# directories that are symbolic links (a Unix file system feature) are excluded
+# from the input.
+# The default value is: NO.
+
+EXCLUDE_SYMLINKS = NO
+
+# If the value of the INPUT tag contains directories, you can use the
+# EXCLUDE_PATTERNS tag to specify one or more wildcard patterns to exclude
+# certain files from those directories.
+#
+# Note that the wildcards are matched against the file with absolute path, so to
+# exclude all test directories for example use the pattern */test/*
+
+EXCLUDE_PATTERNS =
+
+# The EXCLUDE_SYMBOLS tag can be used to specify one or more symbol names
+# (namespaces, classes, functions, etc.) that should be excluded from the
+# output. The symbol name can be a fully qualified name, a word, or if the
+# wildcard * is used, a substring. Examples: ANamespace, AClass,
+# AClass::ANamespace, ANamespace::*Test
+#
+# Note that the wildcards are matched against the file with absolute path, so to
+# exclude all test directories use the pattern */test/*
+
+EXCLUDE_SYMBOLS =
+
+# The EXAMPLE_PATH tag can be used to specify one or more files or directories
+# that contain example code fragments that are included (see the \include
+# command).
+
+EXAMPLE_PATH =
+
+# If the value of the EXAMPLE_PATH tag contains directories, you can use the
+# EXAMPLE_PATTERNS tag to specify one or more wildcard pattern (like *.cpp and
+# *.h) to filter out the source-files in the directories. If left blank all
+# files are included.
+
+EXAMPLE_PATTERNS =
+
+# If the EXAMPLE_RECURSIVE tag is set to YES then subdirectories will be
+# searched for input files to be used with the \include or \dontinclude commands
+# irrespective of the value of the RECURSIVE tag.
+# The default value is: NO.
+
+EXAMPLE_RECURSIVE = NO
+
+# The IMAGE_PATH tag can be used to specify one or more files or directories
+# that contain images that are to be included in the documentation (see the
+# \image command).
+
+IMAGE_PATH =
+
+# The INPUT_FILTER tag can be used to specify a program that doxygen should
+# invoke to filter for each input file. Doxygen will invoke the filter program
+# by executing (via popen()) the command:
+#
+# <filter> <input-file>
+#
+# where <filter> is the value of the INPUT_FILTER tag, and <input-file> is the
+# name of an input file. Doxygen will then use the output that the filter
+# program writes to standard output. If FILTER_PATTERNS is specified, this tag
+# will be ignored.
+#
+# Note that the filter must not add or remove lines; it is applied before the
+# code is scanned, but not when the output code is generated. If lines are added
+# or removed, the anchors will not be placed correctly.
+
+INPUT_FILTER =
+
+# The FILTER_PATTERNS tag can be used to specify filters on a per file pattern
+# basis. Doxygen will compare the file name with each pattern and apply the
+# filter if there is a match. The filters are a list of the form: pattern=filter
+# (like *.cpp=my_cpp_filter). See INPUT_FILTER for further information on how
+# filters are used. If the FILTER_PATTERNS tag is empty or if none of the
+# patterns match the file name, INPUT_FILTER is applied.
+
+FILTER_PATTERNS =
+
+# If the FILTER_SOURCE_FILES tag is set to YES, the input filter (if set using
+# INPUT_FILTER ) will also be used to filter the input files that are used for
+# producing the source files to browse (i.e. when SOURCE_BROWSER is set to YES).
+# The default value is: NO.
+
+FILTER_SOURCE_FILES = NO
+
+# The FILTER_SOURCE_PATTERNS tag can be used to specify source filters per file
+# pattern. A pattern will override the setting for FILTER_PATTERN (if any) and
+# it is also possible to disable source filtering for a specific pattern using
+# *.ext= (so without naming a filter).
+# This tag requires that the tag FILTER_SOURCE_FILES is set to YES.
+
+FILTER_SOURCE_PATTERNS =
+
+# If the USE_MDFILE_AS_MAINPAGE tag refers to the name of a markdown file that
+# is part of the input, its contents will be placed on the main page
+# (index.html). This can be useful if you have a project on for instance GitHub
+# and want to reuse the introduction page also for the doxygen output.
+
+USE_MDFILE_AS_MAINPAGE =
+
+#---------------------------------------------------------------------------
+# Configuration options related to source browsing
+#---------------------------------------------------------------------------
+
+# If the SOURCE_BROWSER tag is set to YES then a list of source files will be
+# generated. Documented entities will be cross-referenced with these sources.
+#
+# Note: To get rid of all source code in the generated output, make sure that
+# also VERBATIM_HEADERS is set to NO.
+# The default value is: NO.
+
+SOURCE_BROWSER = YES
+
+# Setting the INLINE_SOURCES tag to YES will include the body of functions,
+# classes and enums directly into the documentation.
+# The default value is: NO.
+
+INLINE_SOURCES = NO
+
+# Setting the STRIP_CODE_COMMENTS tag to YES will instruct doxygen to hide any
+# special comment blocks from generated source code fragments. Normal C, C++ and
+# Fortran comments will always remain visible.
+# The default value is: YES.
+
+STRIP_CODE_COMMENTS = YES
+
+# If the REFERENCED_BY_RELATION tag is set to YES then for each documented
+# function all documented functions referencing it will be listed.
+# The default value is: NO.
+
+REFERENCED_BY_RELATION = YES
+
+# If the REFERENCES_RELATION tag is set to YES then for each documented function
+# all documented entities called/used by that function will be listed.
+# The default value is: NO.
+
+REFERENCES_RELATION = YES
+
+# If the REFERENCES_LINK_SOURCE tag is set to YES and SOURCE_BROWSER tag is set
+# to YES, then the hyperlinks from functions in REFERENCES_RELATION and
+# REFERENCED_BY_RELATION lists will link to the source code. Otherwise they will
+# link to the documentation.
+# The default value is: YES.
+
+REFERENCES_LINK_SOURCE = YES
+
+# If SOURCE_TOOLTIPS is enabled (the default) then hovering a hyperlink in the
+# source code will show a tooltip with additional information such as prototype,
+# brief description and links to the definition and documentation. Since this
+# will make the HTML file larger and loading of large files a bit slower, you
+# can opt to disable this feature.
+# The default value is: YES.
+# This tag requires that the tag SOURCE_BROWSER is set to YES.
+
+SOURCE_TOOLTIPS = YES
+
+# If the USE_HTAGS tag is set to YES then the references to source code will
+# point to the HTML generated by the htags(1) tool instead of doxygen built-in
+# source browser. The htags tool is part of GNU's global source tagging system
+# (see http://www.gnu.org/software/global/global.html). You will need version
+# 4.8.6 or higher.
+#
+# To use it do the following:
+# - Install the latest version of global
+# - Enable SOURCE_BROWSER and USE_HTAGS in the config file
+# - Make sure the INPUT points to the root of the source tree
+# - Run doxygen as normal
+#
+# Doxygen will invoke htags (and that will in turn invoke gtags), so these
+# tools must be available from the command line (i.e. in the search path).
+#
+# The result: instead of the source browser generated by doxygen, the links to
+# source code will now point to the output of htags.
+# The default value is: NO.
+# This tag requires that the tag SOURCE_BROWSER is set to YES.
+
+USE_HTAGS = NO
+
+# If the VERBATIM_HEADERS tag is set the YES then doxygen will generate a
+# verbatim copy of the header file for each class for which an include is
+# specified. Set to NO to disable this.
+# See also: Section \class.
+# The default value is: YES.
+
+VERBATIM_HEADERS = YES
+
+#---------------------------------------------------------------------------
+# Configuration options related to the alphabetical class index
+#---------------------------------------------------------------------------
+
+# If the ALPHABETICAL_INDEX tag is set to YES, an alphabetical index of all
+# compounds will be generated. Enable this if the project contains a lot of
+# classes, structs, unions or interfaces.
+# The default value is: YES.
+
+ALPHABETICAL_INDEX = YES
+
+# The COLS_IN_ALPHA_INDEX tag can be used to specify the number of columns in
+# which the alphabetical index list will be split.
+# Minimum value: 1, maximum value: 20, default value: 5.
+# This tag requires that the tag ALPHABETICAL_INDEX is set to YES.
+
+COLS_IN_ALPHA_INDEX = 5
+
+# In case all classes in a project start with a common prefix, all classes will
+# be put under the same header in the alphabetical index. The IGNORE_PREFIX tag
+# can be used to specify a prefix (or a list of prefixes) that should be ignored
+# while generating the index headers.
+# This tag requires that the tag ALPHABETICAL_INDEX is set to YES.
+
+IGNORE_PREFIX =
+
+#---------------------------------------------------------------------------
+# Configuration options related to the HTML output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_HTML tag is set to YES doxygen will generate HTML output
+# The default value is: YES.
+
+GENERATE_HTML = YES
+
+# The HTML_OUTPUT tag is used to specify where the HTML docs will be put. If a
+# relative path is entered the value of OUTPUT_DIRECTORY will be put in front of
+# it.
+# The default directory is: html.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_OUTPUT = html
+
+# The HTML_FILE_EXTENSION tag can be used to specify the file extension for each
+# generated HTML page (for example: .htm, .php, .asp).
+# The default value is: .html.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_FILE_EXTENSION = .html
+
+# The HTML_HEADER tag can be used to specify a user-defined HTML header file for
+# each generated HTML page. If the tag is left blank doxygen will generate a
+# standard header.
+#
+# To get valid HTML the header file that includes any scripts and style sheets
+# that doxygen needs, which is dependent on the configuration options used (e.g.
+# the setting GENERATE_TREEVIEW). It is highly recommended to start with a
+# default header using
+# doxygen -w html new_header.html new_footer.html new_stylesheet.css
+# YourConfigFile
+# and then modify the file new_header.html. See also section "Doxygen usage"
+# for information on how to generate the default header that doxygen normally
+# uses.
+# Note: The header is subject to change so you typically have to regenerate the
+# default header when upgrading to a newer version of doxygen. For a description
+# of the possible markers and block names see the documentation.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_HEADER =
+
+# The HTML_FOOTER tag can be used to specify a user-defined HTML footer for each
+# generated HTML page. If the tag is left blank doxygen will generate a standard
+# footer. See HTML_HEADER for more information on how to generate a default
+# footer and what special commands can be used inside the footer. See also
+# section "Doxygen usage" for information on how to generate the default footer
+# that doxygen normally uses.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_FOOTER =
+
+# The HTML_STYLESHEET tag can be used to specify a user-defined cascading style
+# sheet that is used by each HTML page. It can be used to fine-tune the look of
+# the HTML output. If left blank doxygen will generate a default style sheet.
+# See also section "Doxygen usage" for information on how to generate the style
+# sheet that doxygen normally uses.
+# Note: It is recommended to use HTML_EXTRA_STYLESHEET instead of this tag, as
+# it is more robust and this tag (HTML_STYLESHEET) will in the future become
+# obsolete.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_STYLESHEET =
+
+# The HTML_EXTRA_STYLESHEET tag can be used to specify an additional user-
+# defined cascading style sheet that is included after the standard style sheets
+# created by doxygen. Using this option one can overrule certain style aspects.
+# This is preferred over using HTML_STYLESHEET since it does not replace the
+# standard style sheet and is therefor more robust against future updates.
+# Doxygen will copy the style sheet file to the output directory. For an example
+# see the documentation.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_EXTRA_STYLESHEET =
+
+# The HTML_EXTRA_FILES tag can be used to specify one or more extra images or
+# other source files which should be copied to the HTML output directory. Note
+# that these files will be copied to the base HTML output directory. Use the
+# $relpath^ marker in the HTML_HEADER and/or HTML_FOOTER files to load these
+# files. In the HTML_STYLESHEET file, use the file name only. Also note that the
+# files will be copied as-is; there are no commands or markers available.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_EXTRA_FILES =
+
+# The HTML_COLORSTYLE_HUE tag controls the color of the HTML output. Doxygen
+# will adjust the colors in the stylesheet and background images according to
+# this color. Hue is specified as an angle on a colorwheel, see
+# http://en.wikipedia.org/wiki/Hue for more information. For instance the value
+# 0 represents red, 60 is yellow, 120 is green, 180 is cyan, 240 is blue, 300
+# purple, and 360 is red again.
+# Minimum value: 0, maximum value: 359, default value: 220.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_COLORSTYLE_HUE = 220
+
+# The HTML_COLORSTYLE_SAT tag controls the purity (or saturation) of the colors
+# in the HTML output. For a value of 0 the output will use grayscales only. A
+# value of 255 will produce the most vivid colors.
+# Minimum value: 0, maximum value: 255, default value: 100.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_COLORSTYLE_SAT = 100
+
+# The HTML_COLORSTYLE_GAMMA tag controls the gamma correction applied to the
+# luminance component of the colors in the HTML output. Values below 100
+# gradually make the output lighter, whereas values above 100 make the output
+# darker. The value divided by 100 is the actual gamma applied, so 80 represents
+# a gamma of 0.8, The value 220 represents a gamma of 2.2, and 100 does not
+# change the gamma.
+# Minimum value: 40, maximum value: 240, default value: 80.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_COLORSTYLE_GAMMA = 80
+
+# If the HTML_TIMESTAMP tag is set to YES then the footer of each generated HTML
+# page will contain the date and time when the page was generated. Setting this
+# to NO can help when comparing the output of multiple runs.
+# The default value is: YES.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_TIMESTAMP = NO
+
+# If the HTML_DYNAMIC_SECTIONS tag is set to YES then the generated HTML
+# documentation will contain sections that can be hidden and shown after the
+# page has loaded.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_DYNAMIC_SECTIONS = NO
+
+# With HTML_INDEX_NUM_ENTRIES one can control the preferred number of entries
+# shown in the various tree structured indices initially; the user can expand
+# and collapse entries dynamically later on. Doxygen will expand the tree to
+# such a level that at most the specified number of entries are visible (unless
+# a fully collapsed tree already exceeds this amount). So setting the number of
+# entries 1 will produce a full collapsed tree by default. 0 is a special value
+# representing an infinite number of entries and will result in a full expanded
+# tree by default.
+# Minimum value: 0, maximum value: 9999, default value: 100.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+HTML_INDEX_NUM_ENTRIES = 100
+
+# If the GENERATE_DOCSET tag is set to YES, additional index files will be
+# generated that can be used as input for Apple's Xcode 3 integrated development
+# environment (see: http://developer.apple.com/tools/xcode/), introduced with
+# OSX 10.5 (Leopard). To create a documentation set, doxygen will generate a
+# Makefile in the HTML output directory. Running make will produce the docset in
+# that directory and running make install will install the docset in
+# ~/Library/Developer/Shared/Documentation/DocSets so that Xcode will find it at
+# startup. See http://developer.apple.com/tools/creatingdocsetswithdoxygen.html
+# for more information.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+GENERATE_DOCSET = NO
+
+# This tag determines the name of the docset feed. A documentation feed provides
+# an umbrella under which multiple documentation sets from a single provider
+# (such as a company or product suite) can be grouped.
+# The default value is: Doxygen generated docs.
+# This tag requires that the tag GENERATE_DOCSET is set to YES.
+
+DOCSET_FEEDNAME = "Doxygen generated docs"
+
+# This tag specifies a string that should uniquely identify the documentation
+# set bundle. This should be a reverse domain-name style string, e.g.
+# com.mycompany.MyDocSet. Doxygen will append .docset to the name.
+# The default value is: org.doxygen.Project.
+# This tag requires that the tag GENERATE_DOCSET is set to YES.
+
+DOCSET_BUNDLE_ID = org.doxygen.Project
+
+# The DOCSET_PUBLISHER_ID tag specifies a string that should uniquely identify
+# the documentation publisher. This should be a reverse domain-name style
+# string, e.g. com.mycompany.MyDocSet.documentation.
+# The default value is: org.doxygen.Publisher.
+# This tag requires that the tag GENERATE_DOCSET is set to YES.
+
+DOCSET_PUBLISHER_ID = org.doxygen.Publisher
+
+# The DOCSET_PUBLISHER_NAME tag identifies the documentation publisher.
+# The default value is: Publisher.
+# This tag requires that the tag GENERATE_DOCSET is set to YES.
+
+DOCSET_PUBLISHER_NAME = Publisher
+
+# If the GENERATE_HTMLHELP tag is set to YES then doxygen generates three
+# additional HTML index files: index.hhp, index.hhc, and index.hhk. The
+# index.hhp is a project file that can be read by Microsoft's HTML Help Workshop
+# (see: http://www.microsoft.com/en-us/download/details.aspx?id=21138) on
+# Windows.
+#
+# The HTML Help Workshop contains a compiler that can convert all HTML output
+# generated by doxygen into a single compiled HTML file (.chm). Compiled HTML
+# files are now used as the Windows 98 help format, and will replace the old
+# Windows help format (.hlp) on all Windows platforms in the future. Compressed
+# HTML files also contain an index, a table of contents, and you can search for
+# words in the documentation. The HTML workshop also contains a viewer for
+# compressed HTML files.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+GENERATE_HTMLHELP = NO
+
+# The CHM_FILE tag can be used to specify the file name of the resulting .chm
+# file. You can add a path in front of the file if the result should not be
+# written to the html output directory.
+# This tag requires that the tag GENERATE_HTMLHELP is set to YES.
+
+CHM_FILE =
+
+# The HHC_LOCATION tag can be used to specify the location (absolute path
+# including file name) of the HTML help compiler ( hhc.exe). If non-empty
+# doxygen will try to run the HTML help compiler on the generated index.hhp.
+# The file has to be specified with full path.
+# This tag requires that the tag GENERATE_HTMLHELP is set to YES.
+
+HHC_LOCATION =
+
+# The GENERATE_CHI flag controls if a separate .chi index file is generated (
+# YES) or that it should be included in the master .chm file ( NO).
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTMLHELP is set to YES.
+
+GENERATE_CHI = NO
+
+# The CHM_INDEX_ENCODING is used to encode HtmlHelp index ( hhk), content ( hhc)
+# and project file content.
+# This tag requires that the tag GENERATE_HTMLHELP is set to YES.
+
+CHM_INDEX_ENCODING =
+
+# The BINARY_TOC flag controls whether a binary table of contents is generated (
+# YES) or a normal table of contents ( NO) in the .chm file.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTMLHELP is set to YES.
+
+BINARY_TOC = NO
+
+# The TOC_EXPAND flag can be set to YES to add extra items for group members to
+# the table of contents of the HTML help documentation and to the tree view.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTMLHELP is set to YES.
+
+TOC_EXPAND = NO
+
+# If the GENERATE_QHP tag is set to YES and both QHP_NAMESPACE and
+# QHP_VIRTUAL_FOLDER are set, an additional index file will be generated that
+# can be used as input for Qt's qhelpgenerator to generate a Qt Compressed Help
+# (.qch) of the generated HTML documentation.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+GENERATE_QHP = NO
+
+# If the QHG_LOCATION tag is specified, the QCH_FILE tag can be used to specify
+# the file name of the resulting .qch file. The path specified is relative to
+# the HTML output folder.
+# This tag requires that the tag GENERATE_QHP is set to YES.
+
+QCH_FILE =
+
+# The QHP_NAMESPACE tag specifies the namespace to use when generating Qt Help
+# Project output. For more information please see Qt Help Project / Namespace
+# (see: http://qt-project.org/doc/qt-4.8/qthelpproject.html#namespace).
+# The default value is: org.doxygen.Project.
+# This tag requires that the tag GENERATE_QHP is set to YES.
+
+QHP_NAMESPACE = org.doxygen.Project
+
+# The QHP_VIRTUAL_FOLDER tag specifies the namespace to use when generating Qt
+# Help Project output. For more information please see Qt Help Project / Virtual
+# Folders (see: http://qt-project.org/doc/qt-4.8/qthelpproject.html#virtual-
+# folders).
+# The default value is: doc.
+# This tag requires that the tag GENERATE_QHP is set to YES.
+
+QHP_VIRTUAL_FOLDER = doc
+
+# If the QHP_CUST_FILTER_NAME tag is set, it specifies the name of a custom
+# filter to add. For more information please see Qt Help Project / Custom
+# Filters (see: http://qt-project.org/doc/qt-4.8/qthelpproject.html#custom-
+# filters).
+# This tag requires that the tag GENERATE_QHP is set to YES.
+
+QHP_CUST_FILTER_NAME =
+
+# The QHP_CUST_FILTER_ATTRS tag specifies the list of the attributes of the
+# custom filter to add. For more information please see Qt Help Project / Custom
+# Filters (see: http://qt-project.org/doc/qt-4.8/qthelpproject.html#custom-
+# filters).
+# This tag requires that the tag GENERATE_QHP is set to YES.
+
+QHP_CUST_FILTER_ATTRS =
+
+# The QHP_SECT_FILTER_ATTRS tag specifies the list of the attributes this
+# project's filter section matches. Qt Help Project / Filter Attributes (see:
+# http://qt-project.org/doc/qt-4.8/qthelpproject.html#filter-attributes).
+# This tag requires that the tag GENERATE_QHP is set to YES.
+
+QHP_SECT_FILTER_ATTRS =
+
+# The QHG_LOCATION tag can be used to specify the location of Qt's
+# qhelpgenerator. If non-empty doxygen will try to run qhelpgenerator on the
+# generated .qhp file.
+# This tag requires that the tag GENERATE_QHP is set to YES.
+
+QHG_LOCATION =
+
+# If the GENERATE_ECLIPSEHELP tag is set to YES, additional index files will be
+# generated, together with the HTML files, they form an Eclipse help plugin. To
+# install this plugin and make it available under the help contents menu in
+# Eclipse, the contents of the directory containing the HTML and XML files needs
+# to be copied into the plugins directory of eclipse. The name of the directory
+# within the plugins directory should be the same as the ECLIPSE_DOC_ID value.
+# After copying Eclipse needs to be restarted before the help appears.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+GENERATE_ECLIPSEHELP = NO
+
+# A unique identifier for the Eclipse help plugin. When installing the plugin
+# the directory name containing the HTML and XML files should also have this
+# name. Each documentation set should have its own identifier.
+# The default value is: org.doxygen.Project.
+# This tag requires that the tag GENERATE_ECLIPSEHELP is set to YES.
+
+ECLIPSE_DOC_ID = org.doxygen.Project
+
+# If you want full control over the layout of the generated HTML pages it might
+# be necessary to disable the index and replace it with your own. The
+# DISABLE_INDEX tag can be used to turn on/off the condensed index (tabs) at top
+# of each HTML page. A value of NO enables the index and the value YES disables
+# it. Since the tabs in the index contain the same information as the navigation
+# tree, you can set this option to YES if you also set GENERATE_TREEVIEW to YES.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+DISABLE_INDEX = NO
+
+# The GENERATE_TREEVIEW tag is used to specify whether a tree-like index
+# structure should be generated to display hierarchical information. If the tag
+# value is set to YES, a side panel will be generated containing a tree-like
+# index structure (just like the one that is generated for HTML Help). For this
+# to work a browser that supports JavaScript, DHTML, CSS and frames is required
+# (i.e. any modern browser). Windows users are probably better off using the
+# HTML help feature. Via custom stylesheets (see HTML_EXTRA_STYLESHEET) one can
+# further fine-tune the look of the index. As an example, the default style
+# sheet generated by doxygen has an example that shows how to put an image at
+# the root of the tree instead of the PROJECT_NAME. Since the tree basically has
+# the same information as the tab index, you could consider setting
+# DISABLE_INDEX to YES when enabling this option.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+GENERATE_TREEVIEW = YES
+
+# The ENUM_VALUES_PER_LINE tag can be used to set the number of enum values that
+# doxygen will group on one line in the generated HTML documentation.
+#
+# Note that a value of 0 will completely suppress the enum values from appearing
+# in the overview section.
+# Minimum value: 0, maximum value: 20, default value: 4.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+ENUM_VALUES_PER_LINE = 4
+
+# If the treeview is enabled (see GENERATE_TREEVIEW) then this tag can be used
+# to set the initial width (in pixels) of the frame in which the tree is shown.
+# Minimum value: 0, maximum value: 1500, default value: 250.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+TREEVIEW_WIDTH = 250
+
+# When the EXT_LINKS_IN_WINDOW option is set to YES doxygen will open links to
+# external symbols imported via tag files in a separate window.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+EXT_LINKS_IN_WINDOW = NO
+
+# Use this tag to change the font size of LaTeX formulas included as images in
+# the HTML documentation. When you change the font size after a successful
+# doxygen run you need to manually remove any form_*.png images from the HTML
+# output directory to force them to be regenerated.
+# Minimum value: 8, maximum value: 50, default value: 10.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+FORMULA_FONTSIZE = 10
+
+# Use the FORMULA_TRANPARENT tag to determine whether or not the images
+# generated for formulas are transparent PNGs. Transparent PNGs are not
+# supported properly for IE 6.0, but are supported on all modern browsers.
+#
+# Note that when changing this option you need to delete any form_*.png files in
+# the HTML output directory before the changes have effect.
+# The default value is: YES.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+FORMULA_TRANSPARENT = YES
+
+# Enable the USE_MATHJAX option to render LaTeX formulas using MathJax (see
+# http://www.mathjax.org) which uses client side Javascript for the rendering
+# instead of using prerendered bitmaps. Use this if you do not have LaTeX
+# installed or if you want to formulas look prettier in the HTML output. When
+# enabled you may also need to install MathJax separately and configure the path
+# to it using the MATHJAX_RELPATH option.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+USE_MATHJAX = NO
+
+# When MathJax is enabled you can set the default output format to be used for
+# the MathJax output. See the MathJax site (see:
+# http://docs.mathjax.org/en/latest/output.html) for more details.
+# Possible values are: HTML-CSS (which is slower, but has the best
+# compatibility), NativeMML (i.e. MathML) and SVG.
+# The default value is: HTML-CSS.
+# This tag requires that the tag USE_MATHJAX is set to YES.
+
+MATHJAX_FORMAT = HTML-CSS
+
+# When MathJax is enabled you need to specify the location relative to the HTML
+# output directory using the MATHJAX_RELPATH option. The destination directory
+# should contain the MathJax.js script. For instance, if the mathjax directory
+# is located at the same level as the HTML output directory, then
+# MATHJAX_RELPATH should be ../mathjax. The default value points to the MathJax
+# Content Delivery Network so you can quickly see the result without installing
+# MathJax. However, it is strongly recommended to install a local copy of
+# MathJax from http://www.mathjax.org before deployment.
+# The default value is: http://cdn.mathjax.org/mathjax/latest.
+# This tag requires that the tag USE_MATHJAX is set to YES.
+
+MATHJAX_RELPATH = http://cdn.mathjax.org/mathjax/latest
+
+# The MATHJAX_EXTENSIONS tag can be used to specify one or more MathJax
+# extension names that should be enabled during MathJax rendering. For example
+# MATHJAX_EXTENSIONS = TeX/AMSmath TeX/AMSsymbols
+# This tag requires that the tag USE_MATHJAX is set to YES.
+
+MATHJAX_EXTENSIONS =
+
+# The MATHJAX_CODEFILE tag can be used to specify a file with javascript pieces
+# of code that will be used on startup of the MathJax code. See the MathJax site
+# (see: http://docs.mathjax.org/en/latest/output.html) for more details. For an
+# example see the documentation.
+# This tag requires that the tag USE_MATHJAX is set to YES.
+
+MATHJAX_CODEFILE =
+
+# When the SEARCHENGINE tag is enabled doxygen will generate a search box for
+# the HTML output. The underlying search engine uses javascript and DHTML and
+# should work on any modern browser. Note that when using HTML help
+# (GENERATE_HTMLHELP), Qt help (GENERATE_QHP), or docsets (GENERATE_DOCSET)
+# there is already a search function so this one should typically be disabled.
+# For large projects the javascript based search engine can be slow, then
+# enabling SERVER_BASED_SEARCH may provide a better solution. It is possible to
+# search using the keyboard; to jump to the search box use <access key> + S
+# (what the <access key> is depends on the OS and browser, but it is typically
+# <CTRL>, <ALT>/<option>, or both). Inside the search box use the <cursor down
+# key> to jump into the search results window, the results can be navigated
+# using the <cursor keys>. Press <Enter> to select an item or <escape> to cancel
+# the search. The filter options can be selected when the cursor is inside the
+# search box by pressing <Shift>+<cursor down>. Also here use the <cursor keys>
+# to select a filter and <Enter> or <escape> to activate or cancel the filter
+# option.
+# The default value is: YES.
+# This tag requires that the tag GENERATE_HTML is set to YES.
+
+SEARCHENGINE = YES
+
+# When the SERVER_BASED_SEARCH tag is enabled the search engine will be
+# implemented using a web server instead of a web client using Javascript. There
+# are two flavours of web server based searching depending on the
+# EXTERNAL_SEARCH setting. When disabled, doxygen will generate a PHP script for
+# searching and an index file used by the script. When EXTERNAL_SEARCH is
+# enabled the indexing and searching needs to be provided by external tools. See
+# the section "External Indexing and Searching" for details.
+# The default value is: NO.
+# This tag requires that the tag SEARCHENGINE is set to YES.
+
+SERVER_BASED_SEARCH = NO
+
+# When EXTERNAL_SEARCH tag is enabled doxygen will no longer generate the PHP
+# script for searching. Instead the search results are written to an XML file
+# which needs to be processed by an external indexer. Doxygen will invoke an
+# external search engine pointed to by the SEARCHENGINE_URL option to obtain the
+# search results.
+#
+# Doxygen ships with an example indexer ( doxyindexer) and search engine
+# (doxysearch.cgi) which are based on the open source search engine library
+# Xapian (see: http://xapian.org/).
+#
+# See the section "External Indexing and Searching" for details.
+# The default value is: NO.
+# This tag requires that the tag SEARCHENGINE is set to YES.
+
+EXTERNAL_SEARCH = NO
+
+# The SEARCHENGINE_URL should point to a search engine hosted by a web server
+# which will return the search results when EXTERNAL_SEARCH is enabled.
+#
+# Doxygen ships with an example indexer ( doxyindexer) and search engine
+# (doxysearch.cgi) which are based on the open source search engine library
+# Xapian (see: http://xapian.org/). See the section "External Indexing and
+# Searching" for details.
+# This tag requires that the tag SEARCHENGINE is set to YES.
+
+SEARCHENGINE_URL =
+
+# When SERVER_BASED_SEARCH and EXTERNAL_SEARCH are both enabled the unindexed
+# search data is written to a file for indexing by an external tool. With the
+# SEARCHDATA_FILE tag the name of this file can be specified.
+# The default file is: searchdata.xml.
+# This tag requires that the tag SEARCHENGINE is set to YES.
+
+SEARCHDATA_FILE = searchdata.xml
+
+# When SERVER_BASED_SEARCH and EXTERNAL_SEARCH are both enabled the
+# EXTERNAL_SEARCH_ID tag can be used as an identifier for the project. This is
+# useful in combination with EXTRA_SEARCH_MAPPINGS to search through multiple
+# projects and redirect the results back to the right project.
+# This tag requires that the tag SEARCHENGINE is set to YES.
+
+EXTERNAL_SEARCH_ID =
+
+# The EXTRA_SEARCH_MAPPINGS tag can be used to enable searching through doxygen
+# projects other than the one defined by this configuration file, but that are
+# all added to the same external search index. Each project needs to have a
+# unique id set via EXTERNAL_SEARCH_ID. The search mapping then maps the id of
+# to a relative location where the documentation can be found. The format is:
+# EXTRA_SEARCH_MAPPINGS = tagname1=loc1 tagname2=loc2 ...
+# This tag requires that the tag SEARCHENGINE is set to YES.
+
+EXTRA_SEARCH_MAPPINGS =
+
+#---------------------------------------------------------------------------
+# Configuration options related to the LaTeX output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_LATEX tag is set to YES doxygen will generate LaTeX output.
+# The default value is: YES.
+
+GENERATE_LATEX = YES
+
+# The LATEX_OUTPUT tag is used to specify where the LaTeX docs will be put. If a
+# relative path is entered the value of OUTPUT_DIRECTORY will be put in front of
+# it.
+# The default directory is: latex.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+LATEX_OUTPUT = latex
+
+# The LATEX_CMD_NAME tag can be used to specify the LaTeX command name to be
+# invoked.
+#
+# Note that when enabling USE_PDFLATEX this option is only used for generating
+# bitmaps for formulas in the HTML output, but not in the Makefile that is
+# written to the output directory.
+# The default file is: latex.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+LATEX_CMD_NAME = latex
+
+# The MAKEINDEX_CMD_NAME tag can be used to specify the command name to generate
+# index for LaTeX.
+# The default file is: makeindex.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+MAKEINDEX_CMD_NAME = makeindex
+
+# If the COMPACT_LATEX tag is set to YES doxygen generates more compact LaTeX
+# documents. This may be useful for small projects and may help to save some
+# trees in general.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+COMPACT_LATEX = NO
+
+# The PAPER_TYPE tag can be used to set the paper type that is used by the
+# printer.
+# Possible values are: a4 (210 x 297 mm), letter (8.5 x 11 inches), legal (8.5 x
+# 14 inches) and executive (7.25 x 10.5 inches).
+# The default value is: a4.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+PAPER_TYPE = a4
+
+# The EXTRA_PACKAGES tag can be used to specify one or more LaTeX package names
+# that should be included in the LaTeX output. To get the times font for
+# instance you can specify
+# EXTRA_PACKAGES=times
+# If left blank no extra packages will be included.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+EXTRA_PACKAGES =
+
+# The LATEX_HEADER tag can be used to specify a personal LaTeX header for the
+# generated LaTeX document. The header should contain everything until the first
+# chapter. If it is left blank doxygen will generate a standard header. See
+# section "Doxygen usage" for information on how to let doxygen write the
+# default header to a separate file.
+#
+# Note: Only use a user-defined header if you know what you are doing! The
+# following commands have a special meaning inside the header: $title,
+# $datetime, $date, $doxygenversion, $projectname, $projectnumber. Doxygen will
+# replace them by respectively the title of the page, the current date and time,
+# only the current date, the version number of doxygen, the project name (see
+# PROJECT_NAME), or the project number (see PROJECT_NUMBER).
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+LATEX_HEADER =
+
+# The LATEX_FOOTER tag can be used to specify a personal LaTeX footer for the
+# generated LaTeX document. The footer should contain everything after the last
+# chapter. If it is left blank doxygen will generate a standard footer.
+#
+# Note: Only use a user-defined footer if you know what you are doing!
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+LATEX_FOOTER =
+
+# The LATEX_EXTRA_FILES tag can be used to specify one or more extra images or
+# other source files which should be copied to the LATEX_OUTPUT output
+# directory. Note that the files will be copied as-is; there are no commands or
+# markers available.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+LATEX_EXTRA_FILES =
+
+# If the PDF_HYPERLINKS tag is set to YES, the LaTeX that is generated is
+# prepared for conversion to PDF (using ps2pdf or pdflatex). The PDF file will
+# contain links (just like the HTML output) instead of page references. This
+# makes the output suitable for online browsing using a PDF viewer.
+# The default value is: YES.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+PDF_HYPERLINKS = YES
+
+# If the LATEX_PDFLATEX tag is set to YES, doxygen will use pdflatex to generate
+# the PDF file directly from the LaTeX files. Set this option to YES to get a
+# higher quality PDF documentation.
+# The default value is: YES.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+USE_PDFLATEX = YES
+
+# If the LATEX_BATCHMODE tag is set to YES, doxygen will add the \batchmode
+# command to the generated LaTeX files. This will instruct LaTeX to keep running
+# if errors occur, instead of asking the user for help. This option is also used
+# when generating formulas in HTML.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+LATEX_BATCHMODE = NO
+
+# If the LATEX_HIDE_INDICES tag is set to YES then doxygen will not include the
+# index chapters (such as File Index, Compound Index, etc.) in the output.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+LATEX_HIDE_INDICES = NO
+
+# If the LATEX_SOURCE_CODE tag is set to YES then doxygen will include source
+# code with syntax highlighting in the LaTeX output.
+#
+# Note that which sources are shown also depends on other settings such as
+# SOURCE_BROWSER.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+LATEX_SOURCE_CODE = NO
+
+# The LATEX_BIB_STYLE tag can be used to specify the style to use for the
+# bibliography, e.g. plainnat, or ieeetr. See
+# http://en.wikipedia.org/wiki/BibTeX and \cite for more info.
+# The default value is: plain.
+# This tag requires that the tag GENERATE_LATEX is set to YES.
+
+LATEX_BIB_STYLE = plain
+
+#---------------------------------------------------------------------------
+# Configuration options related to the RTF output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_RTF tag is set to YES doxygen will generate RTF output. The
+# RTF output is optimized for Word 97 and may not look too pretty with other RTF
+# readers/editors.
+# The default value is: NO.
+
+GENERATE_RTF = NO
+
+# The RTF_OUTPUT tag is used to specify where the RTF docs will be put. If a
+# relative path is entered the value of OUTPUT_DIRECTORY will be put in front of
+# it.
+# The default directory is: rtf.
+# This tag requires that the tag GENERATE_RTF is set to YES.
+
+RTF_OUTPUT = rtf
+
+# If the COMPACT_RTF tag is set to YES doxygen generates more compact RTF
+# documents. This may be useful for small projects and may help to save some
+# trees in general.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_RTF is set to YES.
+
+COMPACT_RTF = NO
+
+# If the RTF_HYPERLINKS tag is set to YES, the RTF that is generated will
+# contain hyperlink fields. The RTF file will contain links (just like the HTML
+# output) instead of page references. This makes the output suitable for online
+# browsing using Word or some other Word compatible readers that support those
+# fields.
+#
+# Note: WordPad (write) and others do not support links.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_RTF is set to YES.
+
+RTF_HYPERLINKS = NO
+
+# Load stylesheet definitions from file. Syntax is similar to doxygen's config
+# file, i.e. a series of assignments. You only have to provide replacements,
+# missing definitions are set to their default value.
+#
+# See also section "Doxygen usage" for information on how to generate the
+# default style sheet that doxygen normally uses.
+# This tag requires that the tag GENERATE_RTF is set to YES.
+
+RTF_STYLESHEET_FILE =
+
+# Set optional variables used in the generation of an RTF document. Syntax is
+# similar to doxygen's config file. A template extensions file can be generated
+# using doxygen -e rtf extensionFile.
+# This tag requires that the tag GENERATE_RTF is set to YES.
+
+RTF_EXTENSIONS_FILE =
+
+#---------------------------------------------------------------------------
+# Configuration options related to the man page output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_MAN tag is set to YES doxygen will generate man pages for
+# classes and files.
+# The default value is: NO.
+
+GENERATE_MAN = YES
+
+# The MAN_OUTPUT tag is used to specify where the man pages will be put. If a
+# relative path is entered the value of OUTPUT_DIRECTORY will be put in front of
+# it. A directory man3 will be created inside the directory specified by
+# MAN_OUTPUT.
+# The default directory is: man.
+# This tag requires that the tag GENERATE_MAN is set to YES.
+
+MAN_OUTPUT = man
+
+# The MAN_EXTENSION tag determines the extension that is added to the generated
+# man pages. In case the manual section does not start with a number, the number
+# 3 is prepended. The dot (.) at the beginning of the MAN_EXTENSION tag is
+# optional.
+# The default value is: .3.
+# This tag requires that the tag GENERATE_MAN is set to YES.
+
+MAN_EXTENSION = .3
+
+# If the MAN_LINKS tag is set to YES and doxygen generates man output, then it
+# will generate one additional man file for each entity documented in the real
+# man page(s). These additional files only source the real man page, but without
+# them the man command would be unable to find the correct page.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_MAN is set to YES.
+
+MAN_LINKS = NO
+
+#---------------------------------------------------------------------------
+# Configuration options related to the XML output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_XML tag is set to YES doxygen will generate an XML file that
+# captures the structure of the code including all documentation.
+# The default value is: NO.
+
+GENERATE_XML = NO
+
+# The XML_OUTPUT tag is used to specify where the XML pages will be put. If a
+# relative path is entered the value of OUTPUT_DIRECTORY will be put in front of
+# it.
+# The default directory is: xml.
+# This tag requires that the tag GENERATE_XML is set to YES.
+
+XML_OUTPUT = xml
+
+# The XML_SCHEMA tag can be used to specify a XML schema, which can be used by a
+# validating XML parser to check the syntax of the XML files.
+# This tag requires that the tag GENERATE_XML is set to YES.
+
+XML_SCHEMA =
+
+# The XML_DTD tag can be used to specify a XML DTD, which can be used by a
+# validating XML parser to check the syntax of the XML files.
+# This tag requires that the tag GENERATE_XML is set to YES.
+
+XML_DTD =
+
+# If the XML_PROGRAMLISTING tag is set to YES doxygen will dump the program
+# listings (including syntax highlighting and cross-referencing information) to
+# the XML output. Note that enabling this will significantly increase the size
+# of the XML output.
+# The default value is: YES.
+# This tag requires that the tag GENERATE_XML is set to YES.
+
+XML_PROGRAMLISTING = YES
+
+#---------------------------------------------------------------------------
+# Configuration options related to the DOCBOOK output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_DOCBOOK tag is set to YES doxygen will generate Docbook files
+# that can be used to generate PDF.
+# The default value is: NO.
+
+GENERATE_DOCBOOK = NO
+
+# The DOCBOOK_OUTPUT tag is used to specify where the Docbook pages will be put.
+# If a relative path is entered the value of OUTPUT_DIRECTORY will be put in
+# front of it.
+# The default directory is: docbook.
+# This tag requires that the tag GENERATE_DOCBOOK is set to YES.
+
+DOCBOOK_OUTPUT = docbook
+
+#---------------------------------------------------------------------------
+# Configuration options for the AutoGen Definitions output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_AUTOGEN_DEF tag is set to YES doxygen will generate an AutoGen
+# Definitions (see http://autogen.sf.net) file that captures the structure of
+# the code including all documentation. Note that this feature is still
+# experimental and incomplete at the moment.
+# The default value is: NO.
+
+GENERATE_AUTOGEN_DEF = NO
+
+#---------------------------------------------------------------------------
+# Configuration options related to the Perl module output
+#---------------------------------------------------------------------------
+
+# If the GENERATE_PERLMOD tag is set to YES doxygen will generate a Perl module
+# file that captures the structure of the code including all documentation.
+#
+# Note that this feature is still experimental and incomplete at the moment.
+# The default value is: NO.
+
+GENERATE_PERLMOD = NO
+
+# If the PERLMOD_LATEX tag is set to YES doxygen will generate the necessary
+# Makefile rules, Perl scripts and LaTeX code to be able to generate PDF and DVI
+# output from the Perl module output.
+# The default value is: NO.
+# This tag requires that the tag GENERATE_PERLMOD is set to YES.
+
+PERLMOD_LATEX = NO
+
+# If the PERLMOD_PRETTY tag is set to YES the Perl module output will be nicely
+# formatted so it can be parsed by a human reader. This is useful if you want to
+# understand what is going on. On the other hand, if this tag is set to NO the
+# size of the Perl module output will be much smaller and Perl will parse it
+# just the same.
+# The default value is: YES.
+# This tag requires that the tag GENERATE_PERLMOD is set to YES.
+
+PERLMOD_PRETTY = YES
+
+# The names of the make variables in the generated doxyrules.make file are
+# prefixed with the string contained in PERLMOD_MAKEVAR_PREFIX. This is useful
+# so different doxyrules.make files included by the same Makefile don't
+# overwrite each other's variables.
+# This tag requires that the tag GENERATE_PERLMOD is set to YES.
+
+PERLMOD_MAKEVAR_PREFIX =
+
+#---------------------------------------------------------------------------
+# Configuration options related to the preprocessor
+#---------------------------------------------------------------------------
+
+# If the ENABLE_PREPROCESSING tag is set to YES doxygen will evaluate all
+# C-preprocessor directives found in the sources and include files.
+# The default value is: YES.
+
+ENABLE_PREPROCESSING = YES
+
+# If the MACRO_EXPANSION tag is set to YES doxygen will expand all macro names
+# in the source code. If set to NO only conditional compilation will be
+# performed. Macro expansion can be done in a controlled way by setting
+# EXPAND_ONLY_PREDEF to YES.
+# The default value is: NO.
+# This tag requires that the tag ENABLE_PREPROCESSING is set to YES.
+
+MACRO_EXPANSION = NO
+
+# If the EXPAND_ONLY_PREDEF and MACRO_EXPANSION tags are both set to YES then
+# the macro expansion is limited to the macros specified with the PREDEFINED and
+# EXPAND_AS_DEFINED tags.
+# The default value is: NO.
+# This tag requires that the tag ENABLE_PREPROCESSING is set to YES.
+
+EXPAND_ONLY_PREDEF = NO
+
+# If the SEARCH_INCLUDES tag is set to YES the includes files in the
+# INCLUDE_PATH will be searched if a #include is found.
+# The default value is: YES.
+# This tag requires that the tag ENABLE_PREPROCESSING is set to YES.
+
+SEARCH_INCLUDES = YES
+
+# The INCLUDE_PATH tag can be used to specify one or more directories that
+# contain include files that are not input files but should be processed by the
+# preprocessor.
+# This tag requires that the tag SEARCH_INCLUDES is set to YES.
+
+INCLUDE_PATH =
+
+# You can use the INCLUDE_FILE_PATTERNS tag to specify one or more wildcard
+# patterns (like *.h and *.hpp) to filter out the header-files in the
+# directories. If left blank, the patterns specified with FILE_PATTERNS will be
+# used.
+# This tag requires that the tag ENABLE_PREPROCESSING is set to YES.
+
+INCLUDE_FILE_PATTERNS =
+
+# The PREDEFINED tag can be used to specify one or more macro names that are
+# defined before the preprocessor is started (similar to the -D option of e.g.
+# gcc). The argument of the tag is a list of macros of the form: name or
+# name=definition (no spaces). If the definition and the "=" are omitted, "=1"
+# is assumed. To prevent a macro definition from being undefined via #undef or
+# recursively expanded use the := operator instead of the = operator.
+# This tag requires that the tag ENABLE_PREPROCESSING is set to YES.
+
+PREDEFINED =
+
+# If the MACRO_EXPANSION and EXPAND_ONLY_PREDEF tags are set to YES then this
+# tag can be used to specify a list of macro names that should be expanded. The
+# macro definition that is found in the sources will be used. Use the PREDEFINED
+# tag if you want to use a different macro definition that overrules the
+# definition found in the source code.
+# This tag requires that the tag ENABLE_PREPROCESSING is set to YES.
+
+EXPAND_AS_DEFINED =
+
+# If the SKIP_FUNCTION_MACROS tag is set to YES then doxygen's preprocessor will
+# remove all refrences to function-like macros that are alone on a line, have an
+# all uppercase name, and do not end with a semicolon. Such function macros are
+# typically used for boiler-plate code, and will confuse the parser if not
+# removed.
+# The default value is: YES.
+# This tag requires that the tag ENABLE_PREPROCESSING is set to YES.
+
+SKIP_FUNCTION_MACROS = YES
+
+#---------------------------------------------------------------------------
+# Configuration options related to external references
+#---------------------------------------------------------------------------
+
+# The TAGFILES tag can be used to specify one or more tag files. For each tag
+# file the location of the external documentation should be added. The format of
+# a tag file without this location is as follows:
+# TAGFILES = file1 file2 ...
+# Adding location for the tag files is done as follows:
+# TAGFILES = file1=loc1 "file2 = loc2" ...
+# where loc1 and loc2 can be relative or absolute paths or URLs. See the
+# section "Linking to external documentation" for more information about the use
+# of tag files.
+# Note: Each tag file must have an unique name (where the name does NOT include
+# the path). If a tag file is not located in the directory in which doxygen is
+# run, you must also specify the path to the tagfile here.
+
+TAGFILES =
+
+# When a file name is specified after GENERATE_TAGFILE, doxygen will create a
+# tag file that is based on the input files it reads. See section "Linking to
+# external documentation" for more information about the usage of tag files.
+
+GENERATE_TAGFILE =
+
+# If the ALLEXTERNALS tag is set to YES all external class will be listed in the
+# class index. If set to NO only the inherited external classes will be listed.
+# The default value is: NO.
+
+ALLEXTERNALS = NO
+
+# If the EXTERNAL_GROUPS tag is set to YES all external groups will be listed in
+# the modules index. If set to NO, only the current project's groups will be
+# listed.
+# The default value is: YES.
+
+EXTERNAL_GROUPS = YES
+
+# If the EXTERNAL_PAGES tag is set to YES all external pages will be listed in
+# the related pages index. If set to NO, only the current project's pages will
+# be listed.
+# The default value is: YES.
+
+EXTERNAL_PAGES = YES
+
+# The PERL_PATH should be the absolute path and name of the perl script
+# interpreter (i.e. the result of 'which perl').
+# The default file (with absolute path) is: /usr/bin/perl.
+
+PERL_PATH = /usr/bin/perl
+
+#---------------------------------------------------------------------------
+# Configuration options related to the dot tool
+#---------------------------------------------------------------------------
+
+# If the CLASS_DIAGRAMS tag is set to YES doxygen will generate a class diagram
+# (in HTML and LaTeX) for classes with base or super classes. Setting the tag to
+# NO turns the diagrams off. Note that this option also works with HAVE_DOT
+# disabled, but it is recommended to install and use dot, since it yields more
+# powerful graphs.
+# The default value is: YES.
+
+CLASS_DIAGRAMS = YES
+
+# You can define message sequence charts within doxygen comments using the \msc
+# command. Doxygen will then run the mscgen tool (see:
+# http://www.mcternan.me.uk/mscgen/)) to produce the chart and insert it in the
+# documentation. The MSCGEN_PATH tag allows you to specify the directory where
+# the mscgen tool resides. If left empty the tool is assumed to be found in the
+# default search path.
+
+MSCGEN_PATH =
+
+# You can include diagrams made with dia in doxygen documentation. Doxygen will
+# then run dia to produce the diagram and insert it in the documentation. The
+# DIA_PATH tag allows you to specify the directory where the dia binary resides.
+# If left empty dia is assumed to be found in the default search path.
+
+DIA_PATH =
+
+# If set to YES, the inheritance and collaboration graphs will hide inheritance
+# and usage relations if the target is undocumented or is not a class.
+# The default value is: YES.
+
+HIDE_UNDOC_RELATIONS = YES
+
+# If you set the HAVE_DOT tag to YES then doxygen will assume the dot tool is
+# available from the path. This tool is part of Graphviz (see:
+# http://www.graphviz.org/), a graph visualization toolkit from AT&T and Lucent
+# Bell Labs. The other options in this section have no effect if this option is
+# set to NO
+# The default value is: NO.
+
+HAVE_DOT = YES
+
+# The DOT_NUM_THREADS specifies the number of dot invocations doxygen is allowed
+# to run in parallel. When set to 0 doxygen will base this on the number of
+# processors available in the system. You can set it explicitly to a value
+# larger than 0 to get control over the balance between CPU load and processing
+# speed.
+# Minimum value: 0, maximum value: 32, default value: 0.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DOT_NUM_THREADS = 0
+
+# When you want a differently looking font n the dot files that doxygen
+# generates you can specify the font name using DOT_FONTNAME. You need to make
+# sure dot is able to find the font, which can be done by putting it in a
+# standard location or by setting the DOTFONTPATH environment variable or by
+# setting DOT_FONTPATH to the directory containing the font.
+# The default value is: Helvetica.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DOT_FONTNAME = Helvetica
+
+# The DOT_FONTSIZE tag can be used to set the size (in points) of the font of
+# dot graphs.
+# Minimum value: 4, maximum value: 24, default value: 10.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DOT_FONTSIZE = 10
+
+# By default doxygen will tell dot to use the default font as specified with
+# DOT_FONTNAME. If you specify a different font using DOT_FONTNAME you can set
+# the path where dot can find it using this tag.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DOT_FONTPATH =
+
+# If the CLASS_GRAPH tag is set to YES then doxygen will generate a graph for
+# each documented class showing the direct and indirect inheritance relations.
+# Setting this tag to YES will force the CLASS_DIAGRAMS tag to NO.
+# The default value is: YES.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+CLASS_GRAPH = YES
+
+# If the COLLABORATION_GRAPH tag is set to YES then doxygen will generate a
+# graph for each documented class showing the direct and indirect implementation
+# dependencies (inheritance, containment, and class references variables) of the
+# class with other documented classes.
+# The default value is: YES.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+COLLABORATION_GRAPH = YES
+
+# If the GROUP_GRAPHS tag is set to YES then doxygen will generate a graph for
+# groups, showing the direct groups dependencies.
+# The default value is: YES.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+GROUP_GRAPHS = YES
+
+# If the UML_LOOK tag is set to YES doxygen will generate inheritance and
+# collaboration diagrams in a style similar to the OMG's Unified Modeling
+# Language.
+# The default value is: NO.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+UML_LOOK = NO
+
+# If the UML_LOOK tag is enabled, the fields and methods are shown inside the
+# class node. If there are many fields or methods and many nodes the graph may
+# become too big to be useful. The UML_LIMIT_NUM_FIELDS threshold limits the
+# number of items for each type to make the size more manageable. Set this to 0
+# for no limit. Note that the threshold may be exceeded by 50% before the limit
+# is enforced. So when you set the threshold to 10, up to 15 fields may appear,
+# but if the number exceeds 15, the total amount of fields shown is limited to
+# 10.
+# Minimum value: 0, maximum value: 100, default value: 10.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+UML_LIMIT_NUM_FIELDS = 10
+
+# If the TEMPLATE_RELATIONS tag is set to YES then the inheritance and
+# collaboration graphs will show the relations between templates and their
+# instances.
+# The default value is: NO.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+TEMPLATE_RELATIONS = NO
+
+# If the INCLUDE_GRAPH, ENABLE_PREPROCESSING and SEARCH_INCLUDES tags are set to
+# YES then doxygen will generate a graph for each documented file showing the
+# direct and indirect include dependencies of the file with other documented
+# files.
+# The default value is: YES.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+INCLUDE_GRAPH = YES
+
+# If the INCLUDED_BY_GRAPH, ENABLE_PREPROCESSING and SEARCH_INCLUDES tags are
+# set to YES then doxygen will generate a graph for each documented file showing
+# the direct and indirect include dependencies of the file with other documented
+# files.
+# The default value is: YES.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+INCLUDED_BY_GRAPH = YES
+
+# If the CALL_GRAPH tag is set to YES then doxygen will generate a call
+# dependency graph for every global function or class method.
+#
+# Note that enabling this option will significantly increase the time of a run.
+# So in most cases it will be better to enable call graphs for selected
+# functions only using the \callgraph command.
+# The default value is: NO.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+CALL_GRAPH = YES
+
+# If the CALLER_GRAPH tag is set to YES then doxygen will generate a caller
+# dependency graph for every global function or class method.
+#
+# Note that enabling this option will significantly increase the time of a run.
+# So in most cases it will be better to enable caller graphs for selected
+# functions only using the \callergraph command.
+# The default value is: NO.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+CALLER_GRAPH = YES
+
+# If the GRAPHICAL_HIERARCHY tag is set to YES then doxygen will graphical
+# hierarchy of all classes instead of a textual one.
+# The default value is: YES.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+GRAPHICAL_HIERARCHY = YES
+
+# If the DIRECTORY_GRAPH tag is set to YES then doxygen will show the
+# dependencies a directory has on other directories in a graphical way. The
+# dependency relations are determined by the #include relations between the
+# files in the directories.
+# The default value is: YES.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DIRECTORY_GRAPH = YES
+
+# The DOT_IMAGE_FORMAT tag can be used to set the image format of the images
+# generated by dot.
+# Note: If you choose svg you need to set HTML_FILE_EXTENSION to xhtml in order
+# to make the SVG files visible in IE 9+ (other browsers do not have this
+# requirement).
+# Possible values are: png, jpg, gif and svg.
+# The default value is: png.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DOT_IMAGE_FORMAT = png
+
+# If DOT_IMAGE_FORMAT is set to svg, then this option can be set to YES to
+# enable generation of interactive SVG images that allow zooming and panning.
+#
+# Note that this requires a modern browser other than Internet Explorer. Tested
+# and working are Firefox, Chrome, Safari, and Opera.
+# Note: For IE 9+ you need to set HTML_FILE_EXTENSION to xhtml in order to make
+# the SVG files visible. Older versions of IE do not have SVG support.
+# The default value is: NO.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+INTERACTIVE_SVG = YES
+
+# The DOT_PATH tag can be used to specify the path where the dot tool can be
+# found. If left blank, it is assumed the dot tool can be found in the path.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DOT_PATH =
+
+# The DOTFILE_DIRS tag can be used to specify one or more directories that
+# contain dot files that are included in the documentation (see the \dotfile
+# command).
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DOTFILE_DIRS =
+
+# The MSCFILE_DIRS tag can be used to specify one or more directories that
+# contain msc files that are included in the documentation (see the \mscfile
+# command).
+
+MSCFILE_DIRS =
+
+# The DIAFILE_DIRS tag can be used to specify one or more directories that
+# contain dia files that are included in the documentation (see the \diafile
+# command).
+
+DIAFILE_DIRS =
+
+# The DOT_GRAPH_MAX_NODES tag can be used to set the maximum number of nodes
+# that will be shown in the graph. If the number of nodes in a graph becomes
+# larger than this value, doxygen will truncate the graph, which is visualized
+# by representing a node as a red box. Note that doxygen if the number of direct
+# children of the root node in a graph is already larger than
+# DOT_GRAPH_MAX_NODES then the graph will not be shown at all. Also note that
+# the size of a graph can be further restricted by MAX_DOT_GRAPH_DEPTH.
+# Minimum value: 0, maximum value: 10000, default value: 50.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DOT_GRAPH_MAX_NODES = 100
+
+# The MAX_DOT_GRAPH_DEPTH tag can be used to set the maximum depth of the graphs
+# generated by dot. A depth value of 3 means that only nodes reachable from the
+# root by following a path via at most 3 edges will be shown. Nodes that lay
+# further from the root node will be omitted. Note that setting this option to 1
+# or 2 may greatly reduce the computation time needed for large code bases. Also
+# note that the size of a graph can be further restricted by
+# DOT_GRAPH_MAX_NODES. Using a depth of 0 means no depth restriction.
+# Minimum value: 0, maximum value: 1000, default value: 0.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+MAX_DOT_GRAPH_DEPTH = 0
+
+# Set the DOT_TRANSPARENT tag to YES to generate images with a transparent
+# background. This is disabled by default, because dot on Windows does not seem
+# to support this out of the box.
+#
+# Warning: Depending on the platform used, enabling this option may lead to
+# badly anti-aliased labels on the edges of a graph (i.e. they become hard to
+# read).
+# The default value is: NO.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DOT_TRANSPARENT = NO
+
+# Set the DOT_MULTI_TARGETS tag to YES allow dot to generate multiple output
+# files in one run (i.e. multiple -o and -T options on the command line). This
+# makes dot run faster, but since only newer versions of dot (>1.8.10) support
+# this, this feature is disabled by default.
+# The default value is: NO.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DOT_MULTI_TARGETS = YES
+
+# If the GENERATE_LEGEND tag is set to YES doxygen will generate a legend page
+# explaining the meaning of the various boxes and arrows in the dot generated
+# graphs.
+# The default value is: YES.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+GENERATE_LEGEND = YES
+
+# If the DOT_CLEANUP tag is set to YES doxygen will remove the intermediate dot
+# files that are used to generate the various graphs.
+# The default value is: YES.
+# This tag requires that the tag HAVE_DOT is set to YES.
+
+DOT_CLEANUP = NO
diff --git a/MANIFEST.in b/MANIFEST.in
new file mode 100644
index 0000000..77721a1
--- /dev/null
+++ b/MANIFEST.in
@@ -0,0 +1,4 @@
+include ChangeLog Makefile README.md
+include versioneer.py MANIFEST.in Doxyfile.in
+include TODO doc/LICENSE.txt
+include screed/_version.py screed/tests/empty.fa
diff --git a/Makefile b/Makefile
new file mode 100644
index 0000000..c3294c1
--- /dev/null
+++ b/Makefile
@@ -0,0 +1,117 @@
+# make pep8 to check for basic Python code compliance
+# make autopep8 to fix most pep8 errors
+# make pylint to check Python code for enhanced compliance including naming
+# and documentation
+# make coverage-report to check coverage of the python scripts by the tests
+
+PYSOURCES=$(wildcard screed/*.py)
+TESTSOURCES=$(wildcard screed/tests/*.py)
+SOURCES=$(PYSOURCES) setup.py
+DEVPKGS=pep8==1.5.7 diff_cover autopep8 pylint coverage nose sphinx
+
+VERSION=$(shell git describe --tags --dirty | sed s/v//)
+all:
+ ./setup.py build
+
+install-dependencies:
+ pip2 install --user --upgrade $(DEVPKGS) || pip2 install --upgrade \
+ $(DEVPKGS) || pip install --user --upgrade $(DEVPKGS) || pip \
+ install --upgrade $(DEVPKGS)
+
+install: FORCE
+ ./setup.py build install
+
+develop: FORCE
+ ./setup.py develop
+
+dist: dist/screed-$(VERSION).tar.gz
+
+dist/screed-$(VERSION).tar.gz: $(SOURCES)
+ ./setup.py sdist
+
+clean: FORCE
+ ./setup.py clean --all || true
+ rm coverage-debug || true
+ rm -Rf .coverage || true
+ rm -Rf doc/_build || true
+
+pep8: $(PYSOURCES) $(TESTSOURCES)
+ pep8 --exclude=_version.py setup.py screed/ || true
+
+pep8_report.txt: $(PYSOURCES) $(TESTSOURCES)
+ pep8 --exclude=_version.py setup.py screed/ > pep8_report.txt || true
+
+diff_pep8_report: pep8_report.txt
+ diff-quality --violations=pep8 pep8_report.txt
+
+autopep8: $(PYSOURCES) $(TESTSOURCS)
+ autopep8 --recursive --in-place --exclude _version.py --ignore E309 \
+ setup.py screed
+
+# A command to automatically run autopep8 on appropriate files
+format: autopep8
+ # Do nothing
+
+pylint: FORCE
+ pylint --msg-template="{path}:{line}: [{msg_id}({symbol}), {obj}] {msg}" \
+ setup.py screed || true
+
+pylint_report.txt: ${PYSOURCES} $(TESTSOURCES)
+ pylint --msg-template="{path}:{line}: [{msg_id}({symbol}), {obj}] {msg}" \
+ setup.py screed > pylint_report.txt || true
+
+diff_pylint_report: pylint_report.txt
+ diff-quality --violations=pylint pylint_report.txt
+
+.coverage: $(PYSOURCES) $(TESTSOURCES)
+ ./setup.py nosetests --with-coverage --cover-package screed \
+ --attr '!known_failing' 2>&1 > .coverage.out
+
+coverage.xml: .coverage
+ coverage xml --omit 'screed/tests/*'
+
+coverage.html: htmlcov/index.html
+
+htmlcov/index.html: .coverage
+ coverage html --omit 'screed/tests/*'
+ @echo Test coverage is now in htmlcov/index.html
+
+coverage-report: .coverage
+ coverage report --omit 'screed/tests/*'
+
+diff-cover: coverage.xml
+ diff-cover coverage.xml
+
+diff-cover.html: coverage.xml
+ diff-cover coverage.xml --html-report diff-cover.html
+
+nosetests.xml: FORCE
+ ./setup.py nosetests --with-xunit --attr '!known_failing'
+
+doxygen: doc/doxygen/html/index.html
+
+doc: build/sphinx/html/index.html
+
+build/sphinx/html/index.html: $(SOURCES) $(wildcard doc/*.txt) doc/conf.py all
+ ./setup.py build_sphinx --fresh-env
+ @echo ''
+ @echo '--> docs in build/sphinx/html <--'
+ @echo ''
+
+doc/doxygen/html/index.html: ${CPPSOURCES} ${PYSOURCES}
+ mkdir -p doc/doxygen
+ sed "s/\$${VERSION}/`python get_version.py`/" Doxyfile.in > \
+ Doxyfile
+ doxygen
+
+test: FORCE
+ ./setup.py nosetests --attr '!known_failing'
+
+sloccount.sc: ${PYSOURCES} Makefile
+ sloccount --duplicates --wide --details screed setup.py Makefile \
+ > sloccount.sc
+
+sloccount:
+ sloccount screed setup.py Makefile
+
+FORCE:
diff --git a/README.md b/README.md
index 96d874f..9d43a21 100644
--- a/README.md
+++ b/README.md
@@ -8,4 +8,4 @@ See http://readthedocs.org/docs/screed/en/latest/ for docs.
Issues are tracked at https://github.com/ged-lab/khmer/issues.
-[](http://162.209.84.54:8080/job/screed-master/)
+[](http://ci.ged.msu.edu/job/screed/)
diff --git a/TODO b/TODO
index 9df8096..65de8cc 100644
--- a/TODO
+++ b/TODO
@@ -12,3 +12,5 @@ db -> text
PEP-8 noncompliance, e.g. screedDB should be ScreedDB, although
I kind of agree that screedDB is prettier.
+accuracy => quality
+get pairs via a standard api, with/without enforcement
diff --git a/benchmarks/fqGen.py b/benchmarks/fqGen.py
index b2c8463..e327a6a 100755
--- a/benchmarks/fqGen.py
+++ b/benchmarks/fqGen.py
@@ -19,11 +19,11 @@ class collectionOFiles(object):
self.fileHandles[filename]= (fh, self.totalSize/divisor, 0)
- def writeRecord(self, name, sequence, accuracy):
+ def writeRecord(self, name, sequence, quality):
toRemove = []
for filename in self.fileHandles:
file, limit, count = self.fileHandles[filename]
- file.write("%s\n%s\n+\n%s\n" % (name, sequence, accuracy))
+ file.write("%s\n%s\n+\n%s\n" % (name, sequence, quality))
count += 1
if count >= limit:
file.close()
@@ -50,7 +50,7 @@ def genSeq(length):
def genAcc(length):
"""
- Generates an accuracy with length characters
+ Generates a quality with length characters
"""
choices = ['A','1','7','3','.',';','*','<']
result = []
@@ -64,8 +64,8 @@ def createFastqFiles(filename, size, divisions):
while(not cof.finished()):
name = "@HWI-EAS_4_PE-F%d" % counter
sequence = genSeq(seqLength)
- accuracy = genAcc(seqLength)
- cof.writeRecord(name, sequence, accuracy)
+ quality = genAcc(seqLength)
+ cof.writeRecord(name, sequence, quality)
counter += 1
return
diff --git a/benchmarks/fqToFaConvert.py b/benchmarks/fqToFaConvert.py
index a9c79d1..0983514 100755
--- a/benchmarks/fqToFaConvert.py
+++ b/benchmarks/fqToFaConvert.py
@@ -33,7 +33,7 @@ class fastaModel(object):
def convertFastqToFasta(inputFilename, outputFilename):
"""
Converts the given fastq file (inputFilename) to an equilivalent fasta file
- (outputFilename). The fastq's accuracy information is converted to a fasta's
+ (outputFilename). The fastq's quality information is converted to a fasta's
'description' field. Sequence and name fields are left alone
"""
@@ -45,9 +45,9 @@ def convertFastqToFasta(inputFilename, outputFilename):
for line in inputFile:
if line.startswith("@"): # Line is a name
model.writeName(line[1:])
- elif line.startswith('+'): # Next line is the accuracy
- accuracy = inputFile.next()
- model.writeDescription(accuracy)
+ elif line.startswith('+'): # Next line is the quality
+ quality = inputFile.next()
+ model.writeDescription(quality)
else: # Line is the sequence
model.writeSequence(line)
diff --git a/benchmarks/mysql/mysqlCreateTimeit.py b/benchmarks/mysql/mysqlCreateTimeit.py
index 830d458..2508cc1 100755
--- a/benchmarks/mysql/mysqlCreateTimeit.py
+++ b/benchmarks/mysql/mysqlCreateTimeit.py
@@ -24,7 +24,7 @@ libdir = os.path.abspath(os.path.join(thisdir, '..', '..', 'screed'))
sys.path.insert(0, libdir)
from fastq import fqiter
create.droptables()
-FASTQFIELDTYPES = ('name', 'annotations', 'sequence', 'accuracy')
+FASTQFIELDTYPES = ('name', 'annotations', 'sequence', 'quality')
theFile = open('%s', 'rb')
iterfunc = fqiter(theFile)
""" % filename
diff --git a/benchmarks/pgres/pgresCreateTimeit.py b/benchmarks/pgres/pgresCreateTimeit.py
index 37e1963..b702b51 100755
--- a/benchmarks/pgres/pgresCreateTimeit.py
+++ b/benchmarks/pgres/pgresCreateTimeit.py
@@ -24,7 +24,7 @@ libdir = os.path.abspath(os.path.join(thisdir, '..', '..', 'screed'))
sys.path.insert(0, libdir)
from fastq import fqiter
create.droptables()
-FASTQFIELDTYPES = ('name', 'annotations', 'sequence', 'accuracy')
+FASTQFIELDTYPES = ('name', 'annotations', 'sequence', 'quality')
theFile = open('%s', 'rb')
iterfunc = fqiter(theFile)
""" % filename
diff --git a/benchmarks/screedCreateTimeit.py b/benchmarks/screedCreateTimeit.py
index 8329003..933ef23 100755
--- a/benchmarks/screedCreateTimeit.py
+++ b/benchmarks/screedCreateTimeit.py
@@ -23,7 +23,7 @@ libdir = os.path.abspath(os.path.join(thisdir, '..', 'screed'))
sys.path.insert(0, libdir)
import createscreed
import fastq
-FASTQFIELDTYPES = ('name', 'annotations', 'sequence', 'accuracy')
+FASTQFIELDTYPES = ('name', 'annotations', 'sequence', 'quality')
filename = '%s'
theFile = open(filename, 'rb')
iterfunc = fastq.fastq_iter(theFile)
diff --git a/bigtests/__init__.py b/bigtests/__init__.py
index 08e1d22..23c0523 100755
--- a/bigtests/__init__.py
+++ b/bigtests/__init__.py
@@ -169,35 +169,35 @@ class Test_s22_fastq:
testcases['HWI-EAS_4_PE-FC20GCB:2:1:492:573/2'] = {
'id': 0,
'annotations': '',
- 'accuracy': 'AA7AAA3+AAAAAA.AAA.;7;AA;;;;*;<1;<<<',
+ 'quality': 'AA7AAA3+AAAAAA.AAA.;7;AA;;;;*;<1;<<<',
'name' : 'HWI-EAS_4_PE-FC20GCB:2:1:492:573/2',
'sequence': 'ACAGCAAAATTGTGATTGAGGATGAAGAACTGCTGT'}
testcases['HWI-EAS_4_PE-FC20GCB:2:162:131:826/2'] = {
'id': 1895228,
'annotations': '',
- 'accuracy': 'AAAAAAAAAAAAAAAAAAAAAA+ at 6=7A<05<*15:',
+ 'quality': 'AAAAAAAAAAAAAAAAAAAAAA+ at 6=7A<05<*15:',
'name': 'HWI-EAS_4_PE-FC20GCB:2:162:131:826/2',
'sequence': 'ATGAATACAAACAATGCGGCAGTCATAATGCCCCTC'}
testcases['HWI-EAS_4_PE-FC20GCB:2:330:88:628/2'] = {
'id': 3790455,
'annotations': '',
- 'accuracy' : 'AA;AA??A5A;;+AA?AAAA;AA;9AA.AA?????9',
+ 'quality' : 'AA;AA??A5A;;+AA?AAAA;AA;9AA.AA?????9',
'name': 'HWI-EAS_4_PE-FC20GCB:2:330:88:628/2',
'sequence': 'AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAA'}
testcases['HWI-EAS_4_PE-FC20GCB:2:4:707:391/2'] = {
'id': 29999,
'annotations': '',
- 'accuracy': 'AAAAAAAAAA@<)A*AAA6A::<@AA<>A>-8?>4<',
+ 'quality': 'AAAAAAAAAA@<)A*AAA6A::<@AA<>A>-8?>4<',
'name': 'HWI-EAS_4_PE-FC20GCB:2:4:707:391/2',
'sequence': 'ATTAATCTCCAGTTTCTGGCAAACATTCAGGCCATT'}
testcases['HWI-EAS_4_PE-FC20GCB:2:36:158:208/2'] = {
'id': 342842,
'annotations': '',
- 'accuracy': 'AA5?AAAAA?AAAA5?AAA5A???5A>AAA4?;.;;',
+ 'quality': 'AA5?AAAAA?AAAA5?AAA5A???5A>AAA4?;.;;',
'name': 'HWI-EAS_4_PE-FC20GCB:2:36:158:208/2',
'sequence': 'TTTCCCTACAGAAGTGTCTGTACCGGTAATAAAGAA'}
@@ -308,35 +308,35 @@ class Test_s31_fastq:
testcases['HWI-EAS_4_PE-FC20GCB:3:1:71:840/1'] = {
'id': 0,
'annotations': '',
- 'accuracy': 'CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC',
+ 'quality': 'CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC',
'name' : 'HWI-EAS_4_PE-FC20GCB:3:1:71:840/1',
'sequence': 'AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA'}
testcases['HWI-EAS_4_PE-FC20GCB:3:330:957:433/1'] = {
'id': 4439695,
'annotations': '',
- 'accuracy': 'AAAAAAAAAAA<A?<AA<AAAAA?AAA?<:*??&::',
+ 'quality': 'AAAAAAAAAAA<A?<AA<AAAAA?AAA?<:*??&::',
'name': 'HWI-EAS_4_PE-FC20GCB:3:330:957:433/1',
'sequence': 'CTTTGTGGAGAAGAGGGCGTGGGCAAGGCACTGATA'}
testcases['HWI-EAS_4_PE-FC20GCB:3:166:443:410/1'] = {
'id': 2219847,
'annotations': '',
- 'accuracy' : 'AAAAAAAAAAAAAAAAAAAAAAAA6<@AA959???%',
+ 'quality' : 'AAAAAAAAAAAAAAAAAAAAAAAA6<@AA959???%',
'name': 'HWI-EAS_4_PE-FC20GCB:3:166:443:410/1',
'sequence': 'TGGCATTCGCACACATCATGATGGTGCTGACCGTAA'}
testcases['HWI-EAS_4_PE-FC20GCB:3:1:803:878/1'] = {
'id': 2999,
'annotations': '',
- 'accuracy': '?6AAA6A<A6AA<<AA?A&A066/6:/&?&1191+0',
+ 'quality': '?6AAA6A<A6AA<<AA?A&A066/6:/&?&1191+0',
'name': 'HWI-EAS_4_PE-FC20GCB:3:1:803:878/1',
'sequence': 'AAGATGCTGTAGTGGCCGCATGTGTAATAGGCTTTA'}
testcases['HWI-EAS_4_PE-FC20GCB:3:245:54:506/1'] = {
'id': 3329772,
'annotations': '',
- 'accuracy': "AAAAAAAAAAAAAAAA>A+AAA+ at AA+A>A%8*?'%",
+ 'quality': "AAAAAAAAAAAAAAAA>A+AAA+ at AA+A>A%8*?'%",
'name': 'HWI-EAS_4_PE-FC20GCB:3:245:54:506/1',
'sequence': 'CTTCGTTGCTGTTTATCAGTAACTTTTTCTGGCTAG'}
@@ -448,35 +448,35 @@ class Test_s42_fastq:
testcases['HWI-EAS_4_PE-FC20GCB:4:1:257:604/2'] = {
'id': 0,
'annotations': '',
- 'accuracy': 'AAAAAAAA:4>>AAA:44>>->-&4;8+8826;66.',
+ 'quality': 'AAAAAAAA:4>>AAA:44>>->-&4;8+8826;66.',
'name' : 'HWI-EAS_4_PE-FC20GCB:4:1:257:604/2',
'sequence': 'TGTGGATAGTCGCCCGTGATGGCGTCGAAGTTCCGG'}
testcases['HWI-EAS_4_PE-FC20GCB:4:330:96:902/2'] = {
'id': 4148632,
'annotations': '',
- 'accuracy': 'AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA??????',
+ 'quality': 'AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA??????',
'name': 'HWI-EAS_4_PE-FC20GCB:4:330:96:902/2',
'sequence': 'CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC'}
testcases['HWI-EAS_4_PE-FC20GCB:4:166:158:532/2'] = {
'id': 2074316,
'annotations': '',
- 'accuracy' : 'AAAAAAA?A?AAAAAAA?A>A?A?AAAAAA?.<?-?',
+ 'quality' : 'AAAAAAA?A?AAAAAAA?A>A?A?AAAAAA?.<?-?',
'name': 'HWI-EAS_4_PE-FC20GCB:4:166:158:532/2',
'sequence': 'ATCGCCAATGCCCAGGCCTGGTTCTCTTTAACCTAT'}
testcases['HWI-EAS_4_PE-FC20GCB:4:1:332:634/2'] = {
'id': 3000,
'annotations': '',
- 'accuracy': '?A?AAAAAAAAA8>AAAAAA*AA?A?AA.?)<9)9?',
+ 'quality': '?A?AAAAAAAAA8>AAAAAA*AA?A?AA.?)<9)9?',
'name': 'HWI-EAS_4_PE-FC20GCB:4:1:332:634/2',
'sequence': 'ACCGTGCCAGATCAGAACCTAGTGGCGATTCCAATT'}
testcases['HWI-EAS_4_PE-FC20GCB:4:242:843:13/2'] = {
'id': 3111474,
'annotations': '',
- 'accuracy': "ABAAACA?CAAA??%A;2A;/5/&:?-*1-'11%71",
+ 'quality': "ABAAACA?CAAA??%A;2A;/5/&:?-*1-'11%71",
'name': 'HWI-EAS_4_PE-FC20GCB:4:242:843:13/2',
'sequence': 'GTTTCTATATTCTGGCGTTAGTCGTCGCCGATAATT'}
diff --git a/doc/CODE_OF_CONDUCT.txt b/doc/CODE_OF_CONDUCT.txt
new file mode 120000
index 0000000..74bfe5d
--- /dev/null
+++ b/doc/CODE_OF_CONDUCT.txt
@@ -0,0 +1 @@
+../CODE_OF_CONDUCT.rst
\ No newline at end of file
diff --git a/doc/COPYRIGHT.txt b/doc/COPYRIGHT.txt
deleted file mode 100644
index 329971b..0000000
--- a/doc/COPYRIGHT.txt
+++ /dev/null
@@ -1,2 +0,0 @@
-screed is Copyright 2008-2010 Michigan State University
-screed is licensed under the BSD license
diff --git a/doc/LICENSE.txt b/doc/LICENSE.txt
index 9bc1947..2660056 100644
--- a/doc/LICENSE.txt
+++ b/doc/LICENSE.txt
@@ -1,4 +1,8 @@
-Copyright (c) 2008-2010, Michigan State University
+=======
+License
+=======
+
+Copyright (c) 2008-2015, Michigan State University
All rights reserved.
Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met:
diff --git a/doc/_static/labibi.css b/doc/_static/labibi.css
new file mode 100644
index 0000000..4d13b58
--- /dev/null
+++ b/doc/_static/labibi.css
@@ -0,0 +1,54 @@
+ at import url('default.css');
+
+/* Styles for floating Edit on GitHub box */
+#editor-trap {
+ margin: 1em;
+ padding: 1em;
+ border: 1px solid black;
+ box-shadow: 0 0 3px black;
+ width: 200px;
+
+ background: #fefabc;
+ position: fixed;
+ bottom: 1em;
+ left: 1em;
+ font-size: 60%;
+ text-align: left;
+ z-index: 2;
+
+ -moz-transform: rotate(-4deg);
+ -webkit-transform: rotate(-4deg);
+ -o-transform: rotate(-4deg);
+ -ms-transform: rotate(-4deg);
+ transform: rotate(-4deg);
+ box-shadow: 0px 4px 6px #333;
+ -moz-box-shadow: 0px 4px 6px #333;
+ -webkit-box-shadow: 0px 4px 6px #333;
+
+
+ cursor: pointer;
+}
+
+#editor-trap h3 {
+ margin: 0 0 0.5em 0;
+ padding: 0;
+ background: transparent;
+}
+
+#editor-trap ol {
+ margin: 0;
+ padding: 0 0 0 2em;
+}
+
+/* Hide trick */
+
+#editor-trap.toggled > * {
+ display: none;
+}
+
+
+#editor-trap.toggled > h3 {
+ display: block;
+}
+
+
diff --git a/doc/_static/labibi.js b/doc/_static/labibi.js
new file mode 100644
index 0000000..8ebc91c
--- /dev/null
+++ b/doc/_static/labibi.js
@@ -0,0 +1,29 @@
+// Store editor pop-up help state in localStorage
+// so it does not re-pop-up itself between page loads.
+// Do not even to pretend to support IE gracefully.
+(function($) {
+
+ $(document).ready(function() {
+ var box = $("#editor-trap");
+ var klass = "toggled";
+ var storageKey = "toggled";
+
+ function toggle() {
+ box.toggleClass(klass);
+ // Store the toggle status in local storage as "has value string" or null
+ window.localStorage.setItem(storageKey, box.hasClass(klass) ? "toggled" : "not-toggled");
+ }
+
+ box.click(toggle);
+
+ // Check the persistent state of the editor pop-up
+ // Note that localStorage does not necessarily support boolean values (ugh!)
+ // http://stackoverflow.com/questions/3263161/cannot-set-boolean-values-in-localstorage
+ var v = window.localStorage.getItem(storageKey);
+ if(v == "toggled" || !v) {
+ box.addClass(klass);
+ }
+
+ });
+
+})(jQuery);
diff --git a/doc/conf.py b/doc/conf.py
index 66a8290..196ec6d 100644
--- a/doc/conf.py
+++ b/doc/conf.py
@@ -41,16 +41,33 @@ master_doc = 'index'
# General information about the project.
project = u'screed'
-copyright = u'2012, Alex Nolley and Titus Brown'
+copyright = u'2012-2015, Michigan State University'
# The version info for the project you're documenting, acts as replacement for
# |version| and |release|, also used in various other places throughout the
# built documents.
#
-# The short X.Y version.
-version = '0.7'
+
# The full version, including alpha/beta/rc tags.
-release = '0.7.1'
+
+sys.path.insert(0, '.')
+sys.path.insert(0, '../') # to get the versioneer module
+
+import imp
+fp, pathname, description = imp.find_module('versioneer')
+versioneer = imp.load_module('versioneer', fp, pathname, description)
+del imp
+
+versioneer.VCS = 'git'
+versioneer.versionfile_source = '../screed/_version.py'
+versioneer.versionfile_build = '../screed/_version.py'
+versioneer.tag_prefix = 'v' # tags are like v1.2.0
+versioneer.parentdir_prefix = '..'
+
+release = versioneer.get_version()
+
+# The short X.Y version.
+version = '.'.join(release.split('.')[:2])
# The language for content autogenerated by Sphinx. Refer to documentation
# for a list of supported languages.
@@ -121,6 +138,7 @@ html_theme = 'default'
# relative to this directory. They are copied after the builtin static files,
# so a file named "default.css" will overwrite the builtin "default.css".
html_static_path = ['_static']
+html_style = 'labibi.css'
# If not '', a 'Last updated on:' timestamp is inserted at every page bottom,
# using the given strftime format.
@@ -167,6 +185,13 @@ html_static_path = ['_static']
htmlhelp_basename = 'screeddoc'
+html_context = {
+ "google_analytics_id" : 'UA-51731094-1',
+ "disqus_shortname" : 'screed-docs',
+ # "github_base_account" : 'ged-lab',
+ "github_project" : 'screed',
+}
+
# -- Options for LaTeX output --------------------------------------------------
latex_elements = {
diff --git a/doc/dev/CODE_OF_CONDUCT.rst b/doc/dev/CODE_OF_CONDUCT.rst
new file mode 120000
index 0000000..b52bf14
--- /dev/null
+++ b/doc/dev/CODE_OF_CONDUCT.rst
@@ -0,0 +1 @@
+../../CODE_OF_CONDUCT.rst
\ No newline at end of file
diff --git a/doc/dev/coding-guidelines-and-review.txt b/doc/dev/coding-guidelines-and-review.txt
new file mode 100644
index 0000000..2da7992
--- /dev/null
+++ b/doc/dev/coding-guidelines-and-review.txt
@@ -0,0 +1,66 @@
+.. vim: set filetype=rst
+
+Coding guidelines and code review checklist
+===========================================
+
+This document is for anyone who want to contribute code to the screed
+project, and describes our coding standards and code review checklist.
+
+----
+
+Coding standards
+----------------
+
+All plain-text files should have line widths of 80 characters or less unless
+that is not supported for the particular file format.
+
+Vim user can set the indentation with::
+
+ set expandtab
+ set shiftwidth=4
+ set softtabstop=4
+
+We are a pure Python project and `PEP 8 <http://www.python.org/dev/peps/pep-0008/>`__ is our
+standard. The ```pep8``` and ```autopep8``` Makefile targets are helpful.
+
+Code and documentation must have its spelling checked. Vim users can
+run::
+
+ :setlocal spell spelllang=en_us
+
+Use `]s` and `[s` to navigate between misspellings and `z=` to suggest a
+correctly spelled word. `zg` will add a word as a good word.
+
+GNU `aspell` can also be used to check the spelling in a single file::
+
+ aspell check --mode $filename
+
+Code Review
+-----------
+
+Please read `11 Best Practices for Peer Code Review
+<http://smartbear.com/SmartBear/media/pdfs/WP-CC-11-Best-Practices-of-Peer-Code-Review.pdf>`__.
+
+See also `Code reviews: the lab meeting for code
+<http://fperez.org/py4science/code_reviews.html>`__ and
+`the PyCogent coding guidelines
+<http://pycogent.org/coding_guidelines.html>`__.
+
+Checklist
+---------
+
+Copy and paste the following into a pull request comment when it is
+ready for review::
+
+ - [ ] Is it mergable?
+ - [ ] Did it pass the tests?
+ - [ ] If it introduces new functionality, is it tested?
+ - [ ] Is it well formatted? Look at `make pep8`, `make diff_pylint_report`,
+ and `make doc` output. Use `make format` and manual fixing as needed.
+ - [ ] Is it documented in the ChangeLog?
+ - [ ] Was a spellchecker run on the source code and documentation after
+ changes were made?
+
+**Note** that after you submit the comment you can check and uncheck
+the individual boxes on the formatted comment; no need to put x or y
+in the middle.
diff --git a/doc/dev/index.txt b/doc/dev/index.txt
new file mode 100644
index 0000000..98ddcca
--- /dev/null
+++ b/doc/dev/index.txt
@@ -0,0 +1,20 @@
+.. vim set filetype=rst
+
+The screed developer documentation
+==================================
+
+This section of the documentation is for people who are contributing
+(or would like to contribute to) the screed project codebase, either by
+contributing code or by helping improve the documentation.
+
+Please note that this project is released with a :doc:`../CODE_OF_CONDUCT`.
+By participating in the development of this project you agree to abide by its
+terms.
+
+Contents:
+
+.. toctree::
+ :maxdepth: 1
+
+ coding-guidelines-and-review
+ release-checklist
diff --git a/doc/dev/release-checklist.txt b/doc/dev/release-checklist.txt
new file mode 100644
index 0000000..479dbea
--- /dev/null
+++ b/doc/dev/release-checklist.txt
@@ -0,0 +1,142 @@
+.. vim: set filetype=rst
+
+=====================
+Release Documentation
+=====================
+
+
+Introduction
+============
+
+This is the release documentation for releasing a new version of screed. This
+document is meant for screed release managers. Michael R. Crusoe and C. Titus
+Brown have released screed in the past. Jake Fenton is the first to release
+screed using this checklist.
+
+Getting Started
+===============
+
+#. Start with a clean checkout::
+
+ cd `mktemp -d`
+ git clone git at github.com:ged-lab/screed.git
+ cd screed
+
+#. Install/update versioneer::
+
+ pip install versioneer
+ versioneer-installer
+
+ If there is a new version of versioneer::
+
+ git diff
+ ./setup.py versioneer
+ git commit -p -m "new version of versioneer.py"
+ # or abandon the changes
+ git checkout -- versioneer.py screed/_version.py screed/__init.py \
+ MANIFEST.in
+
+#. Review the git logs since the previous release and that ChangeLog reflects
+ the major changes::
+
+ git log --minimal --patch \
+ `git describe --tags --always --abbrev=0`..HEAD
+
+#. Review the issue list for any existing bugs that won't be fixed in the
+ release and ensure they're documented in ``doc/known-issues.txt``
+
+#. Verify that the build is clean: http://ci.ged.msu.edu/job/screed/
+
+#. Set the new version number and release candidate::
+
+ new_version=1.1
+ rc=rc3
+
+ Tag the release candidate with the new version prefixed by the letter 'v'::
+
+ git tag v${new_version}-${rc}
+ git push --tags git at github.com:ged-lab/screed.git
+
+#. Test the release candidate::
+
+ cd ..
+ virtualenv testenv1
+ virtualenv testenv2
+ virtualenv testenv3
+ virtualenv testenv4
+
+ # first we test the tag
+ cd testenv1
+ source bin/activate
+ pip install nose
+ git clone --depth 1 --branch v${new_version}-${rc} \
+ https://github.com/ged-lab/screed.git
+ cd screed
+ make install
+ nosetests screed --attr '!known_failing'
+ make test
+ python -c 'import screed; print screed.__version__' # double-check
+ version number
+
+
+ # Test via pip
+ cd ../../testenv2
+ source bin/activate
+ pip install nose
+ pip install -e
+ git+https://github.com/ged-lab/screed.git@v${new_version}-${rc}#egg=screed
+ cd src/screed
+ make dist
+ make install
+ nosetests screed --attr '!known_failing'
+ python -c 'import screed; print screed.__version__'
+ cp dist/screed*tar.gz ../../../testenv3
+
+ # test if the dist made in testenv2 is complete enough to build another
+ # functional dist
+
+ cd ../../../testenv3
+ source bin/activate
+ pip install nose
+ pip install screed*tar.gz
+ nosetests screed --attr '!known_failing'
+ python -c 'import screed; print screed.__version__'
+ tar xzf screed*tar.gz
+ cd screed*
+ make dist
+ make test
+
+#. Publish the new release on the testing PyPI server. You will need to
+ change your PyPI credentials as documented here:
+ https://wiki.python.org/moin/TestPyPI. You may need to re-register::
+
+ python setup.py register --repository test
+
+ Now, upload the new release::
+
+ python setup.py sdist upload -r test
+
+ Test the PyPI release in a new virtualenv::
+
+ cd ../../testenv4
+ source bin/activate
+ pip install -U setuptools
+ pip install nose
+ pip install -i https://testpypi.python.org/pypi --pre --no-clean screed
+ nosetests screed --attr '!known_failing'
+ python -c 'import screed; print screed.__version__'
+ cd build/screed
+ ./setup.py nosetests --attr '!known_failing'
+
+#. Do any final testing (acceptance tests, etc.) Note that the acceptance tests
+ for screed are to run the khmer automated tests with the new version of
+ screed installed and then to run the khmer acceptance tests.
+
+#. Make sure any release notes are merged into doc/release-notes/.
+
+Notes on this document
+======================
+This is the procedure for cutting a new release of screed. It has been adapted
+from the release documentation for the khmer project, found at
+http://khmer.readthedocs.org/en/v1.1/release.html.
+
diff --git a/doc/index.txt b/doc/index.txt
index bd3ad32..ae92ca9 100644
--- a/doc/index.txt
+++ b/doc/index.txt
@@ -18,7 +18,14 @@ Contents:
screed
example
-
+
+ dev/index
+ release-notes/index
+ user/known-issues.txt
+
+ CODE_OF_CONDUCT
+ LICENSE
+
Indices and tables
==================
diff --git a/doc/RELEASE-0.5.txt b/doc/release-notes/RELEASE-0.5.txt
similarity index 95%
rename from doc/RELEASE-0.5.txt
rename to doc/release-notes/RELEASE-0.5.txt
index 8d17e06..2a1f5ac 100644
--- a/doc/RELEASE-0.5.txt
+++ b/doc/release-notes/RELEASE-0.5.txt
@@ -1,3 +1,7 @@
+============
+Release v0.5
+============
+
We are proud to announce the release of screed v0.5. screed is a database engine
capable of storing and retriving short-read sequence data. screed is designed
to be fast and adaptable to different sequence file formats. This marks the
diff --git a/doc/release-notes/RELEASE-0.8.md b/doc/release-notes/RELEASE-0.8.md
new file mode 100644
index 0000000..d4170fa
--- /dev/null
+++ b/doc/release-notes/RELEASE-0.8.md
@@ -0,0 +1,64 @@
+
+# Release v0.8
+
+We are pleased to announce the release of Screed v0.8. Screed is a database
+engine capable of storing and retrieving short-read sequence data and is
+designed to be fast and adaptable to different sequence file formats.
+
+This version of Screed contains developer documentation for contributing to the
+Screed project and a code of conduct for interacting with other contributors
+and project maintainers. Documentation is available at
+http://screed.readthedocs.org/en/v0.8/
+
+## New items of note:
+
+This release successfully installs and passes its unit tests on
+Ubuntu 14.04 and the latest release of Mac OS X 10 "Yosemite". It
+also passes the khmer acceptance tests as per the [eelpond testing
+protocol.](https://github.com/ged-lab/literate-resting/blob/master/kp/README.txt)
+
+This release of screed has renamed the 'accuracy' attribute of read records to
+'quality;' this API change will need to be adopted by all users wanting to
+upgrade to this version. Unlike the khmer project, Screed is not currently
+under semantic versioning. It will be with the 1.0 release.
+
+ - Screed now has automatic compression detection via magic bit sniffing
+ for gzip and bzip2 compressed files (from @mr-c in ged-lab/khmer#432)
+ - Screed now supports streaming of uncompressed FASTA and FASTQ formatted
+ nucleotide sequence data. bzip2 compressed FASTA and FASTQ formatted
+ nucleotide sequence data can also be streamed but not gzip compressed
+ FASTA and FASTQ formatted nucleotide sequence data. (from @mr-c, see
+ ged-lab/khmer#633)
+ - Screed now has a Changelog, developer documentation and a code of conduct
+ (from @ctb, @mr-c, @bocajnotnef in ged-lab/khmer#625)
+ - Versions are now autogenerated using git tags via Versioneer (from
+ @bocajnotnef in cadceb5)
+ - Documentation is now autogenerated using Doxygen (from @mr-c in d8ed05b)
+
+## Notable bugs fixed/issues closed:
+ - A khmer script was not accepting reads on the stdin ged-lab/khmer#633
+ by @mr-c
+ - screed returning the wrong version and breaking dev installs
+ ged-lab/khmer#803 by @mr-c
+
+
+## Known Issues
+
+These are all pre-existing
+
+ - Screed records cannot be sliced requiring un-Pythonic techniques to achieve
+ the same behavior. This will be included in a future release. This is being
+ tracked in ged-lab/khmer#768
+ - Screed self-tests do not use a temporary directory which causes
+ tests run from package-based installs to fail. This is being tracked in
+ ged-lab/khmer#748
+ - Screed does not support gzip file streaming. This is an issue with Python
+ 2.x and will likely *not* be fixed in future releases. This is being tracked
+ in ged-lab/khmer#700
+ - Screed is overly tolerant of spaces in fast{a,q} which is against spec. This
+ is being tracked in ged-lab/khmer#108
+
+## Contributors
+
+ at bocajnotnef @mr-c @brtaylor92 @wrightmhw @kdmurray91 @luizirber @ctb
+
diff --git a/doc/release-notes/index.txt b/doc/release-notes/index.txt
new file mode 100644
index 0000000..bcf699c
--- /dev/null
+++ b/doc/release-notes/index.txt
@@ -0,0 +1,11 @@
+.. vim set filetype=rst
+
+Release notes for past versions of screed
+=========================================
+
+Contents:
+
+.. toctree::
+ :maxdepth: 1
+
+ RELEASE-0.5
diff --git a/doc/schema.txt b/doc/schema.txt
deleted file mode 100644
index e0529f0..0000000
--- a/doc/schema.txt
+++ /dev/null
@@ -1,5 +0,0 @@
-[ADMINISTRATION TABLE]
-FIELDNAME TEXT | FIELDTYPE TEXT
-
-[DICTIONARY TABLE]
-ID INTEGER PRIMARY KEY | KEY FOR NAME QUERY TEXT | OTHER FIELDS...
diff --git a/doc/screed.html b/doc/screed.html
index caf69e0..12439d1 100644
--- a/doc/screed.html
+++ b/doc/screed.html
@@ -410,7 +410,7 @@ don't modify a dictionary are supported:</p>
>>> fqdb.keys()
</pre>
<p>Each record in the database contains 'fields' such as name and sequence
-information. If the database was derived from a FASTQ file, accuracy and
+information. If the database was derived from a FASTQ file, quality and
optional annotation strings are included. Conversely, FASTA-derived
databases have a description field.</p>
<p>To retrieve the names of records in the database:</p>
@@ -664,9 +664,9 @@ how many sequence lines a record may contain.</p>
FASTQ formats require the first line to be repeated after the '+'
character, but since this adds no new information to the record,
read_fastq_sequences() will ignore this if it is included.</p>
-<p>The accuracy line(s) is last. Like the sequence line(s) this may
+<p>The quality line(s) is last. Like the sequence line(s) this may
be line wrapped. read_fastq_sequences() will raise an exception if the
-accuracy and sequence strings are of unequal length. screed performs
+quality and sequence strings are of unequal length. screed performs
no checking for valid quality scores.</p>
</div>
<div class="section" id="fasta">
@@ -704,14 +704,14 @@ attribute is also dumped pretty much directly, but is line wrapped to 80
characters if it is longer.</p>
<p>Any description line in the FASTA database is stored as a FASTQ annotation
string with no other interpretation done.</p>
-<p>Finally, as there is no accuracy or quality score in a FASTA file, a default
-one is generated. The generation of the accuracy follows the Sanger FASTQ
+<p>Finally, as there is no quality or quality score in a FASTA file, a default
+one is generated. The generation of the quality follows the Sanger FASTQ
conventions. The score is 1 (ASCII: '"') meaning a probability of about 75%
that the read is incorrect (1 in 4 chance). This PHRED quality score is
calculated from the Sanger format: Q = -10log(p) where p is the probability
of an incorrect read. Obviously this is a very rough way of providing a
quality score and it is only intended to fill in the requirements of a FASTQ
-file. Any application needing a true measurement of the accuracy should
+file. Any application needing a true measurement of the quality should
not rely on this automatic conversion.</p>
</div>
<div class="section" id="fastq-to-fasta">
@@ -731,7 +731,7 @@ $ python -m screed.ToFasta <path to fastq db> <converted fasta file>
<p>As above, the name and sequence attributes are directly dumped from the FASTQ
database to the FASTA file with the sequence line wrapping to 80 characters.</p>
<p>If it exists, the FASTQ annotation tag is stored as the FASTA description tag.
-As there is no equivalent in FASTA, the FASTQ accuracy score is ignored.</p>
+As there is no equivalent in FASTA, the FASTQ quality score is ignored.</p>
<!-- Local Variables:
mode: rst
mode: outline-minor
diff --git a/doc/screed.txt b/doc/screed.txt
index 223201d..c897bff 100755
--- a/doc/screed.txt
+++ b/doc/screed.txt
@@ -79,18 +79,14 @@ syntax is similar::
Creating a database from a script
---------------------------------
-To create a screed db from a FASTQ file at the shell::
+If the screed module is in your PYTHONPATH, you can create a screed db from
+a FASTQ file at the shell::
- $ ./fqdbm screed/tests/test.fastq
+ $ python -m screed.fqdbm <fastq file>
Similarly, to create a screed db from a fasta file::
- $ ./fadbm screed/tests/test.fa
-
-Alternately, if the screed module is in your PATH::
-
$ python -m screed.fadbm <fasta file>
- $ python -m screed.fqdbm <fastq file>
where <fast* file> is the path to a sequence file.
@@ -130,7 +126,7 @@ that don't modify a dictionary are supported::
Each record in the database contains 'fields' such as name and
sequence information. If the database was derived from a FASTQ file,
-accuracy and optional annotation strings are included. Conversely,
+quality and optional annotation strings are included. Conversely,
FASTA-derived databases have a description field.
To retrieve the names of records in the database::
@@ -409,9 +405,9 @@ FASTQ formats require the first line to be repeated after the '+'
character, but since this adds no new information to the record,
read_fastq_sequences() will ignore this if it is included.
-The accuracy line(s) is last. Like the sequence line(s) this may
+The quality line(s) is last. Like the sequence line(s) this may
be line wrapped. read_fastq_sequences() will raise an exception if the
-accuracy and sequence strings are of unequal length. screed performs
+quality and sequence strings are of unequal length. screed performs
no checking for valid quality scores.
FASTA
@@ -442,15 +438,10 @@ FASTA to FASTQ
The function used for this process is called 'ToFastq' and is located
in the screed module. It takes the path to a screed database as the
first argument and a path to the desired FASTQ file as the second
-argument. There is also a shell interface called ToFastq.py::
-
- $ ./ToFastq.py <path to fasta db> <converted fastq file>
+argument. There is also a shell interface if the screed module is in
+your PYTHONPATH::
-or::
-
- $ python -m screed.ToFastq <path to fasta db> <converted fastq file>
-
-if the screed module is in your PATH.
+ $ python -m screed.dump_to_fastq <path to fasta db> <converted fastq file>
The FASTA name attribute is directly dumped from the file. The
sequence attribute is also dumped pretty much directly, but is line
@@ -459,15 +450,15 @@ wrapped to 80 characters if it is longer.
Any description line in the FASTA database is stored as a FASTQ annotation
string with no other interpretation done.
-Finally, as there is no accuracy or quality score in a FASTA file, a
-default one is generated. The generation of the accuracy follows the
+Finally, as there is no quality or quality score in a FASTA file, a
+default one is generated. The generation of the quality follows the
Sanger FASTQ conventions. The score is 1 (ASCII: '"') meaning a
probability of about 75% that the read is incorrect (1 in 4
chance). This PHRED quality score is calculated from the Sanger
format: Q = -10log(p) where p is the probability of an incorrect
read. Obviously this is a very rough way of providing a quality score
and it is only intended to fill in the requirements of a FASTQ
-file. Any application needing a true measurement of the accuracy
+file. Any application needing a true measurement of the quality
should not rely on this automatic conversion.
FASTQ to FASTA
@@ -477,22 +468,16 @@ The function used for this process is called 'toFasta' and is located
in the screed module. It takes the path to a screed database as the
first argument and a path to the desired FASTA file as the second
argument. Like the ToFastq function before, there is a shell interface
-to ToFasta::
-
- $ ./ToFasta.py <path to fastq db> <converted fasta file>
-
-or::
-
- $ python -m screed.ToFasta <path to fastq db> <converted fasta file>
+to ToFasta if the screed module is in your PYTHONPATH::
-if the screed module is in your PATH.
+ $ python -m screed.dump_to_fasta <path to fastq db> <converted fasta file>
As above, the name and sequence attributes are directly dumped from
the FASTQ database to the FASTA file with the sequence line wrapping
to 80 characters.
If it exists, the FASTQ annotation tag is stored as the FASTA description tag.
-As there is no equivalent in FASTA, the FASTQ accuracy score is ignored.
+As there is no equivalent in FASTA, the FASTQ quality score is ignored.
..
Local Variables:
diff --git a/doc/user/known-issues.txt b/doc/user/known-issues.txt
new file mode 100644
index 0000000..3fc90e5
--- /dev/null
+++ b/doc/user/known-issues.txt
@@ -0,0 +1,26 @@
+.. vim: set filetype=rst
+
+============
+Known Issues
+============
+
+This document details the known issues in the current release of screed. All
+issues for screed are tracked at https://github.com/ged-lab/khmer/labels/screed
+
+List of known issues
+====================
+
+Screed does not support gzip file streaming. This is an issue
+with Python 2.x and will likely *not* be fixed in future
+releases. https://github.com/ged-lab/khmer/issues/700
+
+Screed is overly tolerant of spaces in fast{q,a} which is against
+spec. https://github.com/ged-lab/khmer/issues/108
+
+Screed records cannot be sliced requiring un-Pythonic techniques
+to achieve the same behavior This will be included in a future
+release. https://github.com/ged-lab/khmer/issues/768
+
+Screed self-tests do not use a temporary directory which causes tests run
+from package-based installs to fail https://github.com/ged-lab/khmer/issues/748
+
diff --git a/get_version.py b/get_version.py
new file mode 100755
index 0000000..d9ad6d9
--- /dev/null
+++ b/get_version.py
@@ -0,0 +1,16 @@
+#!/usr/bin/env python
+""" Extracts the version of screed """
+
+import sys
+import pkg_resources
+
+try:
+ print pkg_resources.get_distribution( # pylint: disable=E1103
+ 'screed').version
+except pkg_resources.DistributionNotFound:
+ print 'To build the screed library, the distribution information'
+ print 'has to be available. Either install the package into your'
+ print 'development environment or run "setup.py develop" to setup the'
+ print 'metadata. A virtualenv is recommended!'
+ sys.exit(1)
+del pkg_resources
diff --git a/jenkins-build.sh b/jenkins-build.sh
new file mode 100755
index 0000000..9b0a6cf
--- /dev/null
+++ b/jenkins-build.sh
@@ -0,0 +1,26 @@
+#!/bin/bash
+
+if type python2> /dev/null 2>&1
+then
+ PYTHON_EXECUTABLE=$(which python2)
+else
+ PYTHON_EXECUTABLE=$(which python)
+fi
+virtualenv -p ${PYTHON_EXECUTABLE} .env
+
+. .env/bin/activate
+make install-dependencies > install_dependencies.out
+make develop
+make coverage.xml
+make nosetests.xml
+if type doxygen >/dev/null 2>&1
+then
+ make doxygen 2>&1 > doxygen.out
+fi
+make pylint_report.txt
+make pep8_report.txt
+if type sloccount >/dev/null 2>&1
+then
+ make sloccount.sc
+fi
+
diff --git a/screed/__init__.py b/screed/__init__.py
index 2c4c151..2758da4 100755
--- a/screed/__init__.py
+++ b/screed/__init__.py
@@ -1,33 +1,35 @@
-# Copyright (c) 2008-2010, Michigan State University
-
-"""
-screed is a database tool useful for retrieving arbitrary kinds of sequence
-data through a on-disk database that emulates a read-only Python dictionary.
-
-For opening a screed database, the 'ScreedDB' class is used. This class
-accepts a string file path to a pre-created screed database. Read-only
-dictionary methods are implemented here.
-
-For creating a screed database, the 'create_db' function is used. This
-function accepts an iterator as an argument which will yield records
-from its respective sequence file. create_db will sequentially pull
-records from the iterator, writing them to disk in a screed database
-until the iterator is done.
-
-Automatic ways for parsing FASTA and FASTQ files are accessed through
-the read_fast*_sequences functions. These parse the given sequence
-file into a screed database.
-
-Conversion between sequence file types is provided in the ToFastq and
-ToFasta functions
-"""
-from openscreed import ScreedDB, open_writer
-from openscreed import open_reader as open
-from conversion import ToFastq
-from conversion import ToFasta
-from createscreed import create_db
-from seqparse import read_fastq_sequences
-from seqparse import read_fasta_sequences
-from dna import rc
-
-__version__ = '0.7'
+# Copyright (c) 2008-2010, Michigan State University
+
+"""
+screed is a database tool useful for retrieving arbitrary kinds of sequence
+data through a on-disk database that emulates a read-only Python dictionary.
+
+For opening a screed database, the 'ScreedDB' class is used. This class
+accepts a string file path to a pre-created screed database. Read-only
+dictionary methods are implemented here.
+
+For creating a screed database, the 'create_db' function is used. This
+function accepts an iterator as an argument which will yield records
+from its respective sequence file. create_db will sequentially pull
+records from the iterator, writing them to disk in a screed database
+until the iterator is done.
+
+Automatic ways for parsing FASTA and FASTQ files are accessed through
+the read_fast*_sequences functions. These parse the given sequence
+file into a screed database.
+
+Conversion between sequence file types is provided in the ToFastq and
+ToFasta functions
+"""
+from openscreed import ScreedDB, open_writer
+from openscreed import open_reader as open
+from conversion import ToFastq
+from conversion import ToFasta
+from createscreed import create_db
+from seqparse import read_fastq_sequences
+from seqparse import read_fasta_sequences
+from dna import rc
+
+from _version import get_versions
+__version__ = get_versions()['version']
+del get_versions
diff --git a/screed/_version.py b/screed/_version.py
new file mode 100644
index 0000000..9005698
--- /dev/null
+++ b/screed/_version.py
@@ -0,0 +1,191 @@
+
+# This file helps to compute a version number in source trees obtained from
+# git-archive tarball (such as those provided by githubs download-from-tag
+# feature). Distribution tarballs (built by setup.py sdist) and build
+# directories (produced by setup.py build) will contain a much shorter file
+# that just contains the computed version number.
+
+# This file is released into the public domain. Generated by
+# versioneer-0.13 (https://github.com/warner/python-versioneer)
+
+# these strings will be replaced by git during git-archive
+git_refnames = " (tag: v0.8)"
+git_full = "ff9083881f1a3ef507d4149acadf06266154f79a"
+
+# these strings are filled in when 'setup.py versioneer' creates _version.py
+tag_prefix = "v"
+parentdir_prefix = "."
+versionfile_source = "screed/_version.py"
+
+import errno
+import os
+import re
+import subprocess
+import sys
+
+
+def run_command(commands, args, cwd=None, verbose=False, hide_stderr=False):
+ assert isinstance(commands, list)
+ p = None
+ for c in commands:
+ try:
+ # remember shell=False, so use git.cmd on windows, not just git
+ p = subprocess.Popen([c] + args, cwd=cwd, stdout=subprocess.PIPE,
+ stderr=(subprocess.PIPE if hide_stderr
+ else None))
+ break
+ except EnvironmentError:
+ e = sys.exc_info()[1]
+ if e.errno == errno.ENOENT:
+ continue
+ if verbose:
+ print("unable to run %s" % args[0])
+ print(e)
+ return None
+ else:
+ if verbose:
+ print("unable to find command, tried %s" % (commands,))
+ return None
+ stdout = p.communicate()[0].strip()
+ if sys.version >= '3':
+ stdout = stdout.decode()
+ if p.returncode != 0:
+ if verbose:
+ print("unable to run %s (error)" % args[0])
+ return None
+ return stdout
+
+
+def versions_from_parentdir(parentdir_prefix, root, verbose=False):
+ # Source tarballs conventionally unpack into a directory that includes
+ # both the project name and a version string.
+ dirname = os.path.basename(root)
+ if not dirname.startswith(parentdir_prefix):
+ if verbose:
+ print("guessing rootdir is '%s', but '%s' doesn't start with "
+ "prefix '%s'" % (root, dirname, parentdir_prefix))
+ return None
+ return {"version": dirname[len(parentdir_prefix):], "full": ""}
+
+
+def git_get_keywords(versionfile_abs):
+ # the code embedded in _version.py can just fetch the value of these
+ # keywords. When used from setup.py, we don't want to import _version.py,
+ # so we do it with a regexp instead. This function is not used from
+ # _version.py.
+ keywords = {}
+ try:
+ f = open(versionfile_abs, "r")
+ for line in f.readlines():
+ if line.strip().startswith("git_refnames ="):
+ mo = re.search(r'=\s*"(.*)"', line)
+ if mo:
+ keywords["refnames"] = mo.group(1)
+ if line.strip().startswith("git_full ="):
+ mo = re.search(r'=\s*"(.*)"', line)
+ if mo:
+ keywords["full"] = mo.group(1)
+ f.close()
+ except EnvironmentError:
+ pass
+ return keywords
+
+
+def git_versions_from_keywords(keywords, tag_prefix, verbose=False):
+ if not keywords:
+ return {} # keyword-finding function failed to find keywords
+ refnames = keywords["refnames"].strip()
+ if refnames.startswith("$Format"):
+ if verbose:
+ print("keywords are unexpanded, not using")
+ return {} # unexpanded, so not in an unpacked git-archive tarball
+ refs = set([r.strip() for r in refnames.strip("()").split(",")])
+ # starting in git-1.8.3, tags are listed as "tag: foo-1.0" instead of
+ # just "foo-1.0". If we see a "tag: " prefix, prefer those.
+ TAG = "tag: "
+ tags = set([r[len(TAG):] for r in refs if r.startswith(TAG)])
+ if not tags:
+ # Either we're using git < 1.8.3, or there really are no tags. We use
+ # a heuristic: assume all version tags have a digit. The old git %d
+ # expansion behaves like git log --decorate=short and strips out the
+ # refs/heads/ and refs/tags/ prefixes that would let us distinguish
+ # between branches and tags. By ignoring refnames without digits, we
+ # filter out many common branch names like "release" and
+ # "stabilization", as well as "HEAD" and "master".
+ tags = set([r for r in refs if re.search(r'\d', r)])
+ if verbose:
+ print("discarding '%s', no digits" % ",".join(refs-tags))
+ if verbose:
+ print("likely tags: %s" % ",".join(sorted(tags)))
+ for ref in sorted(tags):
+ # sorting will prefer e.g. "2.0" over "2.0rc1"
+ if ref.startswith(tag_prefix):
+ r = ref[len(tag_prefix):]
+ if verbose:
+ print("picking %s" % r)
+ return {"version": r,
+ "full": keywords["full"].strip()}
+ # no suitable tags, so we use the full revision id
+ if verbose:
+ print("no suitable tags, using full revision id")
+ return {"version": keywords["full"].strip(),
+ "full": keywords["full"].strip()}
+
+
+def git_versions_from_vcs(tag_prefix, root, verbose=False):
+ # this runs 'git' from the root of the source tree. This only gets called
+ # if the git-archive 'subst' keywords were *not* expanded, and
+ # _version.py hasn't already been rewritten with a short version string,
+ # meaning we're inside a checked out source tree.
+
+ if not os.path.exists(os.path.join(root, ".git")):
+ if verbose:
+ print("no .git in %s" % root)
+ return {}
+
+ GITS = ["git"]
+ if sys.platform == "win32":
+ GITS = ["git.cmd", "git.exe"]
+ stdout = run_command(GITS, ["describe", "--tags", "--dirty", "--always"],
+ cwd=root)
+ if stdout is None:
+ return {}
+ if not stdout.startswith(tag_prefix):
+ if verbose:
+ fmt = "tag '%s' doesn't start with prefix '%s'"
+ print(fmt % (stdout, tag_prefix))
+ return {}
+ tag = stdout[len(tag_prefix):]
+ stdout = run_command(GITS, ["rev-parse", "HEAD"], cwd=root)
+ if stdout is None:
+ return {}
+ full = stdout.strip()
+ if tag.endswith("-dirty"):
+ full += "-dirty"
+ return {"version": tag, "full": full}
+
+
+def get_versions(default={"version": "unknown", "full": ""}, verbose=False):
+ # I am in _version.py, which lives at ROOT/VERSIONFILE_SOURCE. If we have
+ # __file__, we can work backwards from there to the root. Some
+ # py2exe/bbfreeze/non-CPython implementations don't do __file__, in which
+ # case we can only use expanded keywords.
+
+ keywords = {"refnames": git_refnames, "full": git_full}
+ ver = git_versions_from_keywords(keywords, tag_prefix, verbose)
+ if ver:
+ return ver
+
+ try:
+ root = os.path.realpath(__file__)
+ # versionfile_source is the relative path from the top of the source
+ # tree (where the .git directory might live) to this file. Invert
+ # this to find the root from __file__.
+ for i in range(len(versionfile_source.split('/'))):
+ root = os.path.dirname(root)
+ except NameError:
+ return default
+
+ return (git_versions_from_vcs(tag_prefix, root, verbose)
+ or versions_from_parentdir(parentdir_prefix, root, verbose)
+ or default)
diff --git a/screed/conversion.py b/screed/conversion.py
index 9e497ff..adfe1a0 100644
--- a/screed/conversion.py
+++ b/screed/conversion.py
@@ -3,7 +3,8 @@
from openscreed import ScreedDB
_MAXLINELEN = 80
-_null_accuracy = '\"' # ASCII 34, e.g 75% chance of incorrect read
+_null_quality = '\"' # ASCII 34, e.g 75% chance of incorrect read
+
def GetComments(value):
"""
@@ -17,6 +18,7 @@ def GetComments(value):
else:
return ''
+
def linewrap(longString):
"""
Given a long string of characters, inserts newline characters
@@ -25,21 +27,23 @@ def linewrap(longString):
res = []
begin = 0
while begin < len(longString):
- res.append(longString[begin:begin+_MAXLINELEN])
+ res.append(longString[begin:begin + _MAXLINELEN])
begin += _MAXLINELEN
return '\n'.join(res)
-def GenerateAccuracy(value):
+
+def GenerateQuality(value):
"""
- Returns accuracy from value if it exists. Otherwise, makes
- a null accuracy. Accuracy is line wrapped to _MAXLINELEN
+ Returns quality from value if it exists. Otherwise, makes
+ a null quality. Quality is line wrapped to _MAXLINELEN
either way
"""
- if 'accuracy' in value:
- return linewrap(value['accuracy'])
+ if 'quality' in value:
+ return linewrap(value['quality'])
+
+ return linewrap(_null_quality * len(str(value['sequence'])))
- return linewrap(_null_accuracy * len(str(value['sequence'])))
def ToFastq(dbFile, outputFile):
"""
@@ -52,11 +56,13 @@ def ToFastq(dbFile, outputFile):
for value in db.itervalues():
outFile.write('@%s %s\n%s\n+\n%s\n' % (value['name'],
GetComments(value),
- linewrap(str(value['sequence'])),
- GenerateAccuracy(value)))
+ linewrap(
+ str(value['sequence'])),
+ GenerateQuality(value)))
db.close()
outFile.close()
+
def ToFasta(dbFile, outputFile):
"""
Opens the screed database file and attempts to dump it
@@ -68,6 +74,6 @@ def ToFasta(dbFile, outputFile):
for value in db.itervalues():
outFile.write('>%s %s\n%s\n' % (value['name'], GetComments(value),
linewrap(str(value['sequence']))))
-
+
db.close()
outFile.close()
diff --git a/screed/createscreed.py b/screed/createscreed.py
index a15245c..5e01334 100644
--- a/screed/createscreed.py
+++ b/screed/createscreed.py
@@ -3,6 +3,7 @@ import os
import sqlite3
import itertools
+
def create_db(filepath, fields, rcrditer):
"""
Creates a screed database in the given filepath. Fields is a tuple
@@ -13,7 +14,7 @@ def create_db(filepath, fields, rcrditer):
if not filepath.endswith(DBConstants.fileExtension):
filepath += DBConstants.fileExtension
- if os.path.exists(filepath): # Remove existing files
+ if os.path.exists(filepath): # Remove existing files
os.unlink(filepath)
con = sqlite3.connect(filepath)
@@ -24,7 +25,7 @@ def create_db(filepath, fields, rcrditer):
cur.execute("PRAGMA locking_mode=EXCLUSIVE")
# Create the admin table
- cur.execute('CREATE TABLE %s (%s INTEGER PRIMARY KEY, '\
+ cur.execute('CREATE TABLE %s (%s INTEGER PRIMARY KEY, '
'%s TEXT, %s TEXT)' % (DBConstants._SCREEDADMIN,
DBConstants._PRIMARY_KEY,
DBConstants._FIELDNAME,
@@ -57,16 +58,17 @@ def create_db(filepath, fields, rcrditer):
(DBConstants._DICT_TABLE, fieldsub, qmarks)
# Pull data from the iterator and store in database
# Commiting in batches seems faster than a single call to executemany
- data = (tuple(record[fieldname] for fieldname, role in fields) \
+ data = (tuple(record[fieldname] for fieldname, role in fields)
for record in rcrditer)
while True:
batch = list(itertools.islice(data, 10000))
- if not batch: break
+ if not batch:
+ break
cur.executemany(query, batch)
con.commit()
# Attribute to index
- queryby = fields[0][0] # Defaults to the first field
+ queryby = fields[0][0] # Defaults to the first field
for fieldname, role in fields:
if role == DBConstants._INDEXED_TEXT_KEY:
queryby = fieldname
diff --git a/screed/dna.py b/screed/dna.py
index 229cc89..1052b8f 100644
--- a/screed/dna.py
+++ b/screed/dna.py
@@ -1,7 +1,9 @@
-import string, array
+import string
+import array
legal_dna = "ACGTN"
+
def is_DNA(seq):
"""
Returns 1 if it contains only legal values for a DNA sequence.
@@ -14,6 +16,7 @@ def is_DNA(seq):
return 1
+
def reverse_complement(s):
"""
Build reverse complement of 's'.
@@ -30,6 +33,7 @@ rc = reverse_complement # alias 'rc' to 'reverse_complement'
__complementTranslation = string.maketrans('ACTG', 'TGAC')
+
def complement(s):
"""
Return complement of 's'.
@@ -37,6 +41,7 @@ def complement(s):
c = string.translate(s, __complementTranslation)
return c
+
def reverse(s):
"""
Return reverse of 's'.
diff --git a/screed/dump_to_fasta.py b/screed/dump_to_fasta.py
index 130399d..586d982 100644
--- a/screed/dump_to_fasta.py
+++ b/screed/dump_to_fasta.py
@@ -3,7 +3,8 @@
# Copyright (c) 2008-2010, Michigan State University
from screed import ToFasta
-import sys, os
+import sys
+import os
# Shell interface to the ToFasta screed conversion function
if __name__ == '__main__':
@@ -19,5 +20,5 @@ if __name__ == '__main__':
exit(1)
if os.path.isfile(outputFile):
os.unlink(outputFile)
-
+
ToFasta(dbFile, outputFile)
diff --git a/screed/dump_to_fastq.py b/screed/dump_to_fastq.py
index be86015..f5a4ef9 100644
--- a/screed/dump_to_fastq.py
+++ b/screed/dump_to_fastq.py
@@ -3,7 +3,8 @@
# Copyright (c) 2008-2010, Michigan State University
from screed import ToFastq
-import sys, os
+import sys
+import os
# Shell interface to the ToFastq screed conversion function
if __name__ == '__main__':
@@ -19,5 +20,5 @@ if __name__ == '__main__':
exit(1)
if os.path.isfile(outputFile):
os.unlink(outputFile)
-
+
ToFastq(dbFile, outputFile)
diff --git a/screed/fadbm.py b/screed/fadbm.py
index 81a5c1b..111b9d8 100755
--- a/screed/fadbm.py
+++ b/screed/fadbm.py
@@ -15,6 +15,5 @@ if __name__ == "__main__":
filename = sys.argv[1]
read_fasta_sequences(filename)
-
- print "Database saved in %s%s" % (sys.argv[1], DBConstants.fileExtension)
+ print "Database saved in %s%s" % (sys.argv[1], DBConstants.fileExtension)
diff --git a/screed/fasta.py b/screed/fasta.py
index fa44502..df50769 100644
--- a/screed/fasta.py
+++ b/screed/fasta.py
@@ -5,6 +5,7 @@ FieldTypes = (('name', DBConstants._INDEXED_TEXT_KEY),
('description', DBConstants._STANDARD_TEXT),
('sequence', DBConstants._SLICEABLE_TEXT))
+
def fasta_iter(handle, parse_description=True, line=None):
"""
Iterator over the given FASTA file handle, returning records. handle
@@ -12,7 +13,7 @@ def fasta_iter(handle, parse_description=True, line=None):
"""
if line is None:
line = handle.readline()
-
+
while line:
data = _screed_record_dict()
@@ -20,10 +21,10 @@ def fasta_iter(handle, parse_description=True, line=None):
if not line.startswith('>'):
raise IOError("Bad FASTA format: no '>' at beginning of line")
- if parse_description: # Try to grab the name and optional description
+ if parse_description: # Try to grab the name and optional description
try:
data['name'], data['description'] = line[1:].split(' ', 1)
- except ValueError: # No optional description
+ except ValueError: # No optional description
data['name'] = line[1:]
data['description'] = ''
else:
@@ -43,7 +44,9 @@ def fasta_iter(handle, parse_description=True, line=None):
data['sequence'] = ''.join(sequenceList)
yield data
+
class FASTA_Writer(_Writer):
+
def write(self, record):
s = ">%s %s\n%s\n" % (record.name, record.description,
record.sequence,)
diff --git a/screed/fastq.py b/screed/fastq.py
index 7d37bbf..b3e4361 100644
--- a/screed/fastq.py
+++ b/screed/fastq.py
@@ -3,7 +3,8 @@ from screedRecord import _screed_record_dict, _Writer
FieldTypes = (('name', DBConstants._INDEXED_TEXT_KEY),
('annotations', DBConstants._STANDARD_TEXT),
('sequence', DBConstants._STANDARD_TEXT),
- ('accuracy', DBConstants._STANDARD_TEXT))
+ ('quality', DBConstants._STANDARD_TEXT))
+
def fastq_iter(handle, line=None, parse_description=True):
"""
@@ -15,15 +16,15 @@ def fastq_iter(handle, line=None, parse_description=True):
line = line.strip()
while line:
data = _screed_record_dict()
-
+
if not line.startswith('@'):
raise IOError("Bad FASTQ format: no '@' at beginning of line")
# Try to grab the name and (optional) annotations
if parse_description:
try:
- data['name'], data['annotations'] = line[1:].split(' ',1)
- except ValueError: # No optional annotations
+ data['name'], data['annotations'] = line[1:].split(' ', 1)
+ except ValueError: # No optional annotations
data['name'] = line[1:]
data['annotations'] = ''
pass
@@ -40,25 +41,27 @@ def fastq_iter(handle, line=None, parse_description=True):
data['sequence'] = ''.join(sequence)
- # Extract the accuracy lines
- accuracy = []
+ # Extract the quality lines
+ quality = []
line = handle.readline().strip()
seqlen = len(data['sequence'])
aclen = 0
while not line == '' and aclen < seqlen:
- accuracy.append(line)
+ quality.append(line)
aclen += len(line)
line = handle.readline().strip()
- data['accuracy'] = ''.join(accuracy)
- if len(data['sequence']) != len(data['accuracy']):
- raise IOError('sequence and accuracy strings must be '\
+ data['quality'] = ''.join(quality)
+ if len(data['sequence']) != len(data['quality']):
+ raise IOError('sequence and quality strings must be '
'of equal length')
yield data
+
class FASTQ_Writer(_Writer):
+
def write(self, record):
s = "@%s %s\n%s\n+\n%s\n" % (record.name, record.description,
- record.sequence, record.accuracy)
+ record.sequence, record.quality)
self.fp.write(s)
diff --git a/screed/fqdbm.py b/screed/fqdbm.py
index 4559622..81b3581 100755
--- a/screed/fqdbm.py
+++ b/screed/fqdbm.py
@@ -10,7 +10,7 @@ import DBConstants
if __name__ == "__main__":
# Make sure the user entered the command line arguments correctly
if len(sys.argv) != 2:
- sys.stderr.write("ERROR: USAGE IS: %s <dbfilename>\n" % sys.argv[0]);
+ sys.stderr.write("ERROR: USAGE IS: %s <dbfilename>\n" % sys.argv[0])
exit(1)
filename = sys.argv[1]
diff --git a/screed/hava.py b/screed/hava.py
index fa6332c..18fc820 100644
--- a/screed/hava.py
+++ b/screed/hava.py
@@ -22,6 +22,6 @@ def hava_iter(handle):
data['fakours'] = handle.readline().strip()
data['selimizicka'] = handle.readline().strip()
data['marshoon'] = handle.readline().strip()
-
+
line = handle.readline().strip()
yield data
diff --git a/screed/openscreed.py b/screed/openscreed.py
index 25581b6..0e3b64c 100644
--- a/screed/openscreed.py
+++ b/screed/openscreed.py
@@ -1,64 +1,89 @@
import os
import types
import UserDict
-import types
import sqlite3
import gzip
-import bz2
+import bz2file
+import StringIO
+import io
+import sys
import DBConstants
import screedRecord
from fastq import fastq_iter, FASTQ_Writer
from fasta import fasta_iter, FASTA_Writer
+
def get_writer_class(read_iter):
if read_iter.__name__ == 'fasta_iter':
return FASTA_Writer
elif read_iter.__name__ == 'fastq_iter':
return FASTQ_Writer
+
def open_writer(inp_filename, outp_filename):
- read_iter = open_reader(inp_filename)
+ read_iter = open_reader(inp_filename)
klass = get_writer_class(read_iter)
return klass(outp_filename)
+
def open_reader(filename, *args, **kwargs):
"""
Make a best-effort guess as to how to open/parse the given sequence file.
Deals with .gz, FASTA, and FASTQ records.
"""
- if filename.endswith('.gz'):
- fp = gzip.open(filename)
- elif filename.endswith('.bz2'):
- fp = bz2.BZ2File(filename)
+ magic_dict = {
+ "\x1f\x8b\x08": "gz",
+ "\x42\x5a\x68": "bz2",
+ # "\x50\x4b\x03\x04": "zip"
+ } # Inspired by http://stackoverflow.com/a/13044946/1585509
+ bufferedfile = io.open(file=filename, mode='rb', buffering=8192)
+ num_bytes_to_peek = max(len(x) for x in magic_dict)
+ file_start = bufferedfile.peek(num_bytes_to_peek)
+ compression = None
+ for magic, ftype in magic_dict.items():
+ if file_start.startswith(magic):
+ compression = ftype
+ break
+ if compression is 'bz2':
+ sequencefile = bz2file.BZ2File(filename=bufferedfile)
+ peek = sequencefile.peek(1)
+ elif compression is 'gz':
+ if not bufferedfile.seekable():
+ raise ValueError("gziped data not streamable, pipe through zcat \
+ first")
+ peek = gzip.GzipFile(filename=filename).read(1)
+ sequencefile = gzip.GzipFile(filename=filename)
else:
- fp = file(filename)
-
- line = fp.readline()
-
- if not line:
- return []
+ peek = bufferedfile.peek(1)
+ sequencefile = bufferedfile
iter_fn = None
- if line.startswith('>'):
- iter_fn = fasta_iter
- elif line.startswith('@'):
- iter_fn = fastq_iter
+ try:
+ if peek[0] == '>':
+ iter_fn = fasta_iter
+ elif peek[0] == '@':
+ iter_fn = fastq_iter
+ except IndexError as err:
+ return [] # empty file
if iter_fn is None:
- raise Exception("unknown file format for '%s'" % filename)
+ raise ValueError("unknown file format for '%s'" % filename)
- fp.seek(0)
- return iter_fn(fp, *args, **kwargs)
+ return iter_fn(sequencefile, *args, **kwargs)
+_open = open
open = open_reader
+
class ScreedDB(object, UserDict.DictMixin):
+
"""
Core on-disk dictionary interface for reading screed databases. Accepts a
path string to a screed database
"""
+
def __init__(self, filepath):
self._filepath = filepath
self._db = None
@@ -67,7 +92,7 @@ class ScreedDB(object, UserDict.DictMixin):
if not os.path.exists(self._filepath):
raise ValueError('No such file: %s' % self._filepath)
-
+
self._db = sqlite3.connect(self._filepath)
cursor = self._db.cursor()
@@ -88,17 +113,17 @@ class ScreedDB(object, UserDict.DictMixin):
self._db.close()
raise TypeError("Database %s is not a proper screed database"
% self._filepath)
-
+
nothing = res.fetchone()
- if type(nothing) != types.NoneType:
+ if not isinstance(nothing, type(None)):
self._db.close()
raise TypeError("Database %s has too many tables." % filename)
-
+
# Store the fields of the admin table in a tuple
query = "SELECT %s, %s FROM %s" % \
- (DBConstants._FIELDNAME,
- DBConstants._ROLENAME,
- DBConstants._SCREEDADMIN)
+ (DBConstants._FIELDNAME,
+ DBConstants._ROLENAME,
+ DBConstants._SCREEDADMIN)
res = cursor.execute(query)
self.fields = tuple([(str(field), role) for field, role in res])
@@ -135,12 +160,12 @@ class ScreedDB(object, UserDict.DictMixin):
Retrieves from database the record with the key 'key'
"""
cursor = self._db.cursor()
- key = str(key) # So lazy retrieval objectes are evaluated
+ key = str(key) # So lazy retrieval objectes are evaluated
query = 'SELECT %s FROM %s WHERE %s=?' % (self._queryBy,
DBConstants._DICT_TABLE,
self._queryBy)
res = cursor.execute(query, (key,))
- if type(res.fetchone()) == types.NoneType:
+ if isinstance(res.fetchone(), type(None)):
raise KeyError("Key %s not found" % key)
return screedRecord._buildRecord(self.fields, self._db,
key,
@@ -164,17 +189,17 @@ class ScreedDB(object, UserDict.DictMixin):
Retrieves record from database at the given index
"""
cursor = self._db.cursor()
- index = int(index) + 1 # Hack to make indexing start at 0
+ index = int(index) + 1 # Hack to make indexing start at 0
query = 'SELECT %s FROM %s WHERE %s=?' % (DBConstants._PRIMARY_KEY,
DBConstants._DICT_TABLE,
DBConstants._PRIMARY_KEY)
res = cursor.execute(query, (index,))
- if type(res.fetchone()) == types.NoneType:
+ if isinstance(res.fetchone(), type(None)):
raise KeyError("Index %d not found" % index)
return screedRecord._buildRecord(self.fields, self._db,
index,
DBConstants._PRIMARY_KEY)
-
+
def __len__(self):
"""
Returns the number of records in the database
@@ -193,12 +218,12 @@ class ScreedDB(object, UserDict.DictMixin):
"""
return "<%s, '%s'>" % (self.__class__.__name__,
self._filepath)
-
+
def itervalues(self):
"""
Iterator over records in the database
"""
- for index in xrange(1, self.__len__()+1):
+ for index in xrange(1, self.__len__() + 1):
yield screedRecord._buildRecord(self.fields, self._db,
index,
DBConstants._PRIMARY_KEY)
@@ -208,7 +233,8 @@ class ScreedDB(object, UserDict.DictMixin):
Iterator over keys in the database
"""
cursor = self._db.cursor()
- query = 'SELECT %s FROM %s ORDER BY id' % (self._queryBy, DBConstants._DICT_TABLE)
+ query = 'SELECT %s FROM %s ORDER BY id' % (
+ self._queryBy, DBConstants._DICT_TABLE)
for key, in cursor.execute(query):
yield key
@@ -238,7 +264,7 @@ class ScreedDB(object, UserDict.DictMixin):
cursor = self._db.cursor()
query = 'SELECT %s FROM %s WHERE %s = ?' % \
(self._queryBy, DBConstants._DICT_TABLE, self._queryBy)
- if cursor.execute(query, (key,)).fetchone() == None:
+ if cursor.execute(query, (key,)).fetchone() is None:
return False
return True
diff --git a/screed/pygr_api.py b/screed/pygr_api.py
index 81f3545..1fc675d 100644
--- a/screed/pygr_api.py
+++ b/screed/pygr_api.py
@@ -36,9 +36,11 @@ from pygr.sequence import SequenceBase
from pygr.seqdb import SequenceDB
from pygr.sequtil import DNA_SEQTYPE
-###
+#
+
class ScreedSequence(SequenceBase):
+
"""Sequence implementation based on screed; stores screed record info.
Attributes:
@@ -49,16 +51,19 @@ class ScreedSequence(SequenceBase):
- 'seq' is the sequence.
"""
+
def __init__(self, db, id):
self.id = id
SequenceBase.__init__(self)
info = db.seqInfoDict[id]
-
+
self.record = info.record
self.name = info.record.name
self.seq = info.record.sequence
+
class ScreedSequenceDB(SequenceDB):
+
"""SequenceDB implementation based on screed; retrieve seqs by name."""
itemClass = ScreedSequence
@@ -76,16 +81,18 @@ class ScreedSequenceDB(SequenceDB):
# override inherited __reduce__/__getstate__/__setstate__ from SequenceDB.
def __reduce__(self):
return (ScreedSequenceDB, (self.filepath,))
-
+
+
class ScreedSequenceDB_ByIndex(SequenceDB):
+
"""SequenceDB implementation based on screed; retrieve seqs by index."""
itemClass = ScreedSequence
-
+
def __init__(self, filepath):
self.filepath = filepath
self.seqInfoDict = _ScreedSeqInfoDict_ByIndex(filepath)
SequenceDB.__init__(self)
-
+
def _set_seqtype(self):
self._seqtype = DNA_SEQTYPE
@@ -95,16 +102,22 @@ class ScreedSequenceDB_ByIndex(SequenceDB):
# override inherited __reduce__/__getstate__/__setstate__ from SequenceDB.
def __reduce__(self):
return (ScreedSequenceDB_ByIndex, (self.filepath,))
-
+
+
class _ScreedSequenceInfo(object):
+
"""Objects to put in seqInfoDict values, for holding screed record info."""
+
def __init__(self, id, record):
self.id = id
self.record = record
self.length = len(record.sequence)
+
class _ScreedSeqInfoDict_ByName(object, UserDict.DictMixin):
+
"""seqInfoDict implementation that uses names to retrieve records."""
+
def __init__(self, filepath):
self.sdb = ScreedDB(filepath)
@@ -126,15 +139,17 @@ class _ScreedSeqInfoDict_ByName(object, UserDict.DictMixin):
def iteritems(self):
for v in self.itervalues():
yield v.record.name, v
-
+
class _ScreedSeqInfoDict_ByIndex(object, UserDict.DictMixin):
+
"""seqInfoDict implementation that uses indices to retrieve records."""
+
def __init__(self, filepath):
self.sdb = ScreedDB(filepath)
def __getitem__(self, k):
- n = int(k)
+ n = int(k)
v = self.sdb.loadRecordByIndex(n)
return _ScreedSequenceInfo(k, v)
@@ -148,7 +163,7 @@ class _ScreedSeqInfoDict_ByIndex(object, UserDict.DictMixin):
yield i
i += 1
-###
+#
if __name__ == '__main__':
import sys
diff --git a/screed/screedRecord.py b/screed/screedRecord.py
index e1d5434..a811b6f 100644
--- a/screed/screedRecord.py
+++ b/screed/screedRecord.py
@@ -4,32 +4,41 @@ import DBConstants
import gzip
import bz2
+
class _screed_record_dict(UserDict.DictMixin):
+
"""
Simple dict-like record interface with bag behavior.
"""
+
def __init__(self, *args, **kwargs):
self.d = dict(*args, **kwargs)
-
+
def __getitem__(self, name):
return self.d[name]
def __setitem__(self, name, value):
self.d[name] = value
-
+
def __getattr__(self, name):
try:
return self.d[name]
except KeyError:
- raise AttributeError, name
+ raise AttributeError(name)
+
+ def __len__(self):
+ return len(self.sequence)
def keys(self):
return self.d.keys()
+
class _screed_attr(object):
+
"""
Sliceable database object that supports lazy retrieval
"""
+
def __init__(self, dbObj, attrName, rowName, queryBy):
"""
Initializes database object with specific record retrieval
@@ -49,14 +58,14 @@ class _screed_attr(object):
Slicing interface. Returns the slice range given.
*.start + 1 to be compatible with sqlite's 1 not 0 scheme
"""
- if type(sliceObj) != types.SliceType:
+ if not isinstance(sliceObj, slice):
raise TypeError('__getitem__ argument must be of slice type')
- if not sliceObj.start <= sliceObj.stop: # String reverse in future?
+ if not sliceObj.start <= sliceObj.stop: # String reverse in future?
raise ValueError('start must be less than stop in slice object')
length = sliceObj.stop - sliceObj.start
-
+
query = 'SELECT substr(%s, %d, %d) FROM %s WHERE %s = ?' \
- % (self._attrName, sliceObj.start+1, length,
+ % (self._attrName, sliceObj.start + 1, length,
DBConstants._DICT_TABLE,
self._queryBy)
cur = self._dbObj.cursor()
@@ -100,7 +109,7 @@ class _screed_attr(object):
"""
Compares attribute to given object in string form
"""
- if type(given) == types.StringType:
+ if isinstance(given, bytes):
return given == self.__str__()
try:
@@ -112,12 +121,12 @@ class _screed_attr(object):
"""
Compares attribute to given object in string form
"""
- if type(given) == types.StringType:
+ if isinstance(given, bytes):
return self.__repr__() != given
try:
return self.__repr__() != str(given)
- except AttributError:
+ except AttributeError:
raise TypeError("Cannot compare to given type: %s" % type(given))
def __str__(self):
@@ -134,6 +143,7 @@ class _screed_attr(object):
raise KeyError("Key %s not found" % self._rowName)
return str(record)
+
def _buildRecord(fieldTuple, dbObj, rowName, queryBy):
"""
Constructs a dict-like object with record attribute names as keys and
@@ -167,7 +177,7 @@ def _buildRecord(fieldTuple, dbObj, rowName, queryBy):
hackedResult = []
for key, value in kvResult:
if key == DBConstants._PRIMARY_KEY:
- hackedResult.append((key, int(value)-1))
+ hackedResult.append((key, int(value) - 1))
else:
hackedResult.append((key, value))
@@ -175,6 +185,7 @@ def _buildRecord(fieldTuple, dbObj, rowName, queryBy):
class _Writer(object):
+
def __init__(self, filename, fp=None):
self.filename = filename
if fp is None:
diff --git a/screed/seqparse.py b/screed/seqparse.py
index e07ffa7..7276ff6 100644
--- a/screed/seqparse.py
+++ b/screed/seqparse.py
@@ -14,12 +14,14 @@ import fasta
import hava
# [AN] these functions look strangely similar
+
+
def read_fastq_sequences(filename):
"""
Function to parse text from the given FASTQ file into a screed database
"""
import openscreed
-
+
# Will raise an exception if the file doesn't exist
iterfunc = openscreed.open(filename)
@@ -28,12 +30,13 @@ def read_fastq_sequences(filename):
return ScreedDB(filename)
+
def read_fasta_sequences(filename):
"""
Function to parse text from the given FASTA file into a screed database
"""
import openscreed
-
+
# Will raise an exception if the file doesn't exist
iterfunc = openscreed.open(filename)
@@ -42,6 +45,7 @@ def read_fasta_sequences(filename):
return ScreedDB(filename)
+
def read_hava_sequences(filename):
"""
Function to parse text from the given HAVA file into a screed database
diff --git a/screed/tests/havaGen.py b/screed/tests/havaGen.py
index 2dda9cd..7b431c1 100755
--- a/screed/tests/havaGen.py
+++ b/screed/tests/havaGen.py
@@ -18,10 +18,13 @@ This is a work of fiction. Names are the product of the author's imagination
and any resemblance to real life is entirely coincidental.
"""
-import sys, os
+import sys
+import os
import random
+
class collectionOFiles(object):
+
def __init__(self, baseName, divisions, totalSize):
self.baseName = baseName
self.divisions = divisions
@@ -34,13 +37,15 @@ class collectionOFiles(object):
divisor = i * 2
if divisor == 0:
divisor = 1
- self.fileHandles[filename]= (fh, self.totalSize/divisor, 0)
+ self.fileHandles[filename] = (fh, self.totalSize / divisor, 0)
- def writeRecord(self, hava, quarzk, muchalo, fakours, selimizicka, marshoon):
+ def writeRecord(self, hava, quarzk, muchalo, fakours, selimizicka,
+ marshoon):
toRemove = []
for filename in self.fileHandles:
file, limit, count = self.fileHandles[filename]
- file.write("%s\n%s\n%s\n%s\n%s\n%s\n" % (hava, quarzk, muchalo, fakours, selimizicka, marshoon))
+ file.write("%s\n%s\n%s\n%s\n%s\n%s\n" %
+ (hava, quarzk, muchalo, fakours, selimizicka, marshoon))
count += 1
if count >= limit:
file.close()
@@ -54,13 +59,15 @@ class collectionOFiles(object):
def finished(self):
return len(self.fileHandles) == 0
+
def genString(length, allowedChars):
res = []
for i in range(0, length):
- char = allowedChars[random.randint(0, len(allowedChars)-1)]
+ char = allowedChars[random.randint(0, len(allowedChars) - 1)]
res.append(char)
return "".join(res)
+
def createHavaFiles(filename, size, divisions):
cof = collectionOFiles(filename, divisions, size)
counter = 0
diff --git a/screed/tests/test.fa.zip b/screed/tests/test.fa.zip
new file mode 100644
index 0000000..6e387b9
Binary files /dev/null and b/screed/tests/test.fa.zip differ
diff --git a/screed/tests/test.fastq.bz2 b/screed/tests/test.fastq.bz2
new file mode 100644
index 0000000..0dedfdc
Binary files /dev/null and b/screed/tests/test.fastq.bz2 differ
diff --git a/screed/tests/test_convert.py b/screed/tests/test_convert.py
index 1e1e6d9..432b3a1 100644
--- a/screed/tests/test_convert.py
+++ b/screed/tests/test_convert.py
@@ -3,12 +3,15 @@ import os
import screed
from screed.DBConstants import fileExtension
+
class Test_fasta_to_fastq(test_fasta.Test_fasta):
+
"""
Tests the ability to convert a fasta db to a fastq file, parse it into
a fastq db, save to a fasta file, parse the fasta file into a fasta
db and then run the fasta suite
"""
+
def setup(self):
thisdir = os.path.dirname(__file__)
self._fqName = os.path.join(thisdir, 'fa_to_fq')
@@ -16,9 +19,9 @@ class Test_fasta_to_fastq(test_fasta.Test_fasta):
self._testfa = os.path.join(thisdir, 'test.fa')
screed.read_fasta_sequences(self._testfa)
- screed.ToFastq(self._testfa, self._fqName) # Fasta db -> fasta text
+ screed.ToFastq(self._testfa, self._fqName) # Fasta db -> fasta text
screed.read_fastq_sequences(self._fqName) # Fastq file -> fastq db
- screed.ToFasta(self._fqName, self._faName) # Fastq db -> fasta text
+ screed.ToFasta(self._fqName, self._faName) # Fastq db -> fasta text
screed.read_fasta_sequences(self._faName) # Fasta file -> fasta db
self.db = screed.ScreedDB(self._faName)
diff --git a/screed/tests/test_dictionary.py b/screed/tests/test_dictionary.py
index 9164423..79b19fe 100644
--- a/screed/tests/test_dictionary.py
+++ b/screed/tests/test_dictionary.py
@@ -2,11 +2,14 @@ import os
import screed
from screed.DBConstants import fileExtension
+
class Test_dict_methods(object):
+
"""
Make sure that screed returns sensible results for standard dictionary
queries.
"""
+
def setup(self):
self._testfa = os.path.join(os.path.dirname(__file__), 'test.fa')
screed.read_fasta_sequences(self._testfa)
@@ -31,17 +34,17 @@ class Test_dict_methods(object):
def test_contains(self):
for k in self.db:
- assert self.db.has_key(k)
+ assert k in self.db
+
+ assert db.get('FOO') is None
- assert db.get('FOO') == None
+ assert 'FOO' not in self.db
- assert not self.db.has_key('FOO')
-
def test_contains(self):
for k in self.db:
assert k in self.db
- assert not 'FOO' in self.db
+ assert 'FOO' not in self.db
def test_get(self):
for k in self.db:
diff --git a/screed/tests/test_dna.py b/screed/tests/test_dna.py
new file mode 100644
index 0000000..4ef2958
--- /dev/null
+++ b/screed/tests/test_dna.py
@@ -0,0 +1,28 @@
+import os
+import screed
+from screed.DBConstants import fileExtension
+
+
+class Test_dna(object):
+
+ """Tests the dna module of screed"""
+ def test_is_DNA(args):
+ valid_DNA_str = "ATCCG"
+ invalid_DNA_str = "ATXXG"
+ assert screed.dna.is_DNA(valid_DNA_str)
+ assert not screed.dna.is_DNA(invalid_DNA_str)
+
+ def test_complement(args):
+ dna = "ATCCG"
+ comp = "TAGGC"
+ assert screed.dna.complement(dna) == comp
+
+ def test_reverse(args):
+ dna = "ATCCG"
+ reverse = "GCCTA"
+ assert screed.dna.reverse(dna) == reverse
+
+ def test_reverse_complement(args):
+ dna = "ATCCG"
+ reverse_complement = "CGGAT"
+ assert screed.dna.reverse_complement(dna) == reverse_complement
diff --git a/screed/tests/test_fasta.py b/screed/tests/test_fasta.py
index 8de9e1f..d3bb45d 100644
--- a/screed/tests/test_fasta.py
+++ b/screed/tests/test_fasta.py
@@ -3,18 +3,21 @@ from screed.DBConstants import fileExtension
import os
from cStringIO import StringIO
+
def test_new_record():
# test for a bug where the record dict was not reset after each
# sequence load, leading to all records being identical if you
# kept a handle on the returned dictionary.
-
+
s = StringIO(">1\nACTG\n>2\nACGG\n")
records = list(iter(screed.fasta.fasta_iter(s)))
assert records[0]['name'] == '1'
assert records[1]['name'] == '2'
+
class Test_fasta(object):
+
def setup(self):
self._testfa = os.path.join(os.path.dirname(__file__), 'test.fa')
screed.read_fasta_sequences(self._testfa)
@@ -36,14 +39,19 @@ class Test_fasta(object):
intRcrd = self.db.loadRecordByIndex(record.id)
assert record == intRcrd
+ def test_length(self):
+ read = self.db[self.db.keys()[0]]
+
+ assert len(read) == len(read.sequence)
+
def test_contains_front(self):
first = self.db[self.db.keys()[0]]
assert first.id == 0
assert first.name == 'ENSMICT00000012722'
assert first.description == 'cdna:pseudogene scaffold:micMur1:'\
- 'scaffold_185008:9:424:1 gene:ENSMICG00000012730'
- assert str(first.sequence).startswith('TGCAGAAAATATCAAGAGTCAGC'\
- 'AGAAAAACTATACAAGGGCTGGT'\
+ 'scaffold_185008:9:424:1 gene:ENSMICG00000012730'
+ assert str(first.sequence).startswith('TGCAGAAAATATCAAGAGTCAGC'
+ 'AGAAAAACTATACAAGGGCTGGT'
'ATTTTGATTATTCT')
def test_contains_middle(self):
@@ -51,9 +59,9 @@ class Test_fasta(object):
assert middle.id == 10
assert middle.name == 'ENSMICT00000012078'
assert middle.description == 'cdna:pseudogene scaffold:micMur1'\
- ':scaffold_180699:3:774:-1 gene:ENSMICG00000012085'
- assert str(middle.sequence).startswith('GCGCACTCCCAGTGGCTACCCA'\
- 'CGGCAGGAGGCGGCGGCAGTGA'\
+ ':scaffold_180699:3:774:-1 gene:ENSMICG00000012085'
+ assert str(middle.sequence).startswith('GCGCACTCCCAGTGGCTACCCA'
+ 'CGGCAGGAGGCGGCGGCAGTGA'
'CTGGGCCGGCGGCCCG')
def test_contains_end(self):
@@ -61,18 +69,18 @@ class Test_fasta(object):
assert end.id == 21
assert end.name == 'ENSMICT00000003880'
assert end.description == 'cdna:novel scaffold:micMur1:scaffol'\
- 'd_175819:130:631:1 gene:ENSMICG00000003884'
- assert str(end.sequence).startswith('ATGCTGCCTAAGTTTGACCCCAACG'\
- 'CGATCAAAGTCATGTACCTGAGGTG'\
+ 'd_175819:130:631:1 gene:ENSMICG00000003884'
+ assert str(end.sequence).startswith('ATGCTGCCTAAGTTTGACCCCAACG'
+ 'CGATCAAAGTCATGTACCTGAGGTG'
'CACGGGTGGC')
def test_contains(self):
for k in self.db:
- assert self.db.has_key(k)
+ assert k in self.db
- assert self.db.get('FOO') == None
+ assert self.db.get('FOO') is None
- assert not 'FOO' in self.db
+ assert 'FOO' not in self.db
def test_iterv(self):
entries = []
@@ -87,7 +95,9 @@ class Test_fasta(object):
assert id == self.db[entry.name].id
assert entry == self.db[entry.name]
+
class Test_fasta_whitespace(object):
+
def setup(self):
self._testfa = os.path.join(os.path.dirname(__file__),
'test-whitespace.fa')
@@ -100,13 +110,14 @@ class Test_fasta_whitespace(object):
def teardown(self):
os.unlink(self._testfa + fileExtension)
+
def test_writer():
fp = StringIO()
w = screed.fasta.FASTA_Writer("", fp)
class FakeRecord(object):
pass
-
+
read = FakeRecord()
read.name = 'foo'
read.description = 'bar'
@@ -115,14 +126,15 @@ def test_writer():
w.write(read)
assert fp.getvalue() == '>foo bar\nATCG\n'
-
+
+
def test_writer_2():
fp = StringIO()
w = screed.fasta.FASTA_Writer("", fp)
class FakeRecord(object):
pass
-
+
read = FakeRecord()
read.name = 'foo'
read.description = 'bar'
diff --git a/screed/tests/test_fasta_recover.py b/screed/tests/test_fasta_recover.py
index 27a1f37..b73327a 100644
--- a/screed/tests/test_fasta_recover.py
+++ b/screed/tests/test_fasta_recover.py
@@ -3,9 +3,12 @@ import os
import screed
from screed.DBConstants import fileExtension
+
class test_fa_recover(test_fasta.Test_fasta):
+
def setup(self):
- self._fileName = os.path.join(os.path.dirname(__file__), 'fastaRecovery')
+ self._fileName = os.path.join(
+ os.path.dirname(__file__), 'fastaRecovery')
self._testfa = os.path.join(os.path.dirname(__file__), 'test.fa')
screed.read_fasta_sequences(self._testfa)
screed.ToFasta(self._testfa, self._fileName)
diff --git a/screed/tests/test_fastq.py b/screed/tests/test_fastq.py
index 4298a1b..c95dfa2 100644
--- a/screed/tests/test_fastq.py
+++ b/screed/tests/test_fastq.py
@@ -3,22 +3,24 @@ from screed.DBConstants import fileExtension
import os
from cStringIO import StringIO
+
def test_new_record():
# test for a bug where the record dict was not reset after each
# sequence load, leading to all records being identical if you
# kept a handle on the returned dictionary.
-
+
s = StringIO("@1\nACTG\n+\nAAAA\n at 2\nACGG\n+\nAAAA\n")
records = list(iter(screed.fastq.fastq_iter(s)))
assert records[0]['name'] == '1'
assert records[1]['name'] == '2'
+
def test_parse_description_true():
# test for a bug where the record dict was not reset after each
# sequence load, leading to all records being identical if you
# kept a handle on the returned dictionary.
-
+
s = StringIO("@1 FOO\nACTG\n+\nAAAA\n at 2\nACGG\n+\nAAAA\n")
records = list(iter(screed.fastq.fastq_iter(s, parse_description=True)))
@@ -32,18 +34,21 @@ def test_parse_description_true():
assert records[0]['name'] == '1'
assert records[1]['name'] == '2'
+
def test_parse_description_false():
# test for a bug where the record dict was not reset after each
# sequence load, leading to all records being identical if you
# kept a handle on the returned dictionary.
-
+
s = StringIO("@1 FOO\nACTG\n+\nAAAA\n at 2\nACGG\n+\nAAAA\n")
records = list(iter(screed.fastq.fastq_iter(s, parse_description=False)))
assert records[0]['name'] == '1 FOO'
assert records[1]['name'] == '2'
+
class Test_fastq(object):
+
def setup(self):
self._testfq = os.path.join(os.path.dirname(__file__), 'test.fastq')
screed.read_fastq_sequences(self._testfq)
@@ -70,29 +75,29 @@ class Test_fastq(object):
assert first.id == 0
assert first.name == 'HWI-EAS_4_PE-FC20GCB:2:1:492:573/2'
assert first.sequence == 'ACAGCAAAATTGTGATTGAGGATGAAGAACTGCTGT'
- assert first.accuracy == 'AA7AAA3+AAAAAA.AAA.;7;AA;;;;*;<1;<<<'
+ assert first.quality == 'AA7AAA3+AAAAAA.AAA.;7;AA;;;;*;<1;<<<'
def test_contains_middle(self):
middle = self.db[self.db.keys()[62]]
assert middle.id == 62
assert middle.name == 'HWI-EAS_4_PE-FC20GCB:2:1:245:483/2'
assert middle.sequence == 'TGTCGAGCAAAGCAAAACAGGCGTAAAAATTGCCAT'
- assert middle.accuracy == 'AAAAAAAAAAAAAAAAAAAAA>AAAAAAAA?9>6><'
+ assert middle.quality == 'AAAAAAAAAAAAAAAAAAAAA>AAAAAAAA?9>6><'
def test_contains_end(self):
end = self.db[self.db.keys()[124]]
assert end.id == 124
assert end.name == 'HWI-EAS_4_PE-FC20GCB:2:1:350:588/2'
assert end.sequence == 'GGTACAAAATAGATGCTGGACTCTCCGAATCCTATA'
- assert end.accuracy == ';?5AAAAAAAAAA?A??;?AA;AAA>AAAA?4?844'
+ assert end.quality == ';?5AAAAAAAAAA?A??;?AA;AAA>AAAA?4?844'
def test_contains(self):
for k in self.db:
- assert self.db.has_key(k)
+ assert k in self.db
- assert self.db.get('FOO') == None
+ assert self.db.get('FOO') is None
- assert not 'FOO' in self.db
+ assert 'FOO' not in self.db
def test_iterv(self):
entries = []
@@ -107,35 +112,37 @@ class Test_fastq(object):
assert id == self.db[entry.name].id
assert entry == self.db[entry.name]
+
def test_writer():
fp = StringIO()
w = screed.fastq.FASTQ_Writer("", fp)
class FakeRecord(object):
pass
-
+
read = FakeRecord()
read.name = 'foo'
read.description = 'bar'
read.sequence = 'ATCG'
- read.accuracy = '####'
+ read.quality = '####'
w.write(read)
assert fp.getvalue() == '@foo bar\nATCG\n+\n####\n'
-
+
+
def test_writer_2():
fp = StringIO()
w = screed.fastq.FASTQ_Writer("", fp)
class FakeRecord(object):
pass
-
+
read = FakeRecord()
read.name = 'foo'
read.description = 'bar'
read.sequence = 'ATCG'
- read.accuracy = '####'
+ read.quality = '####'
read_iter = [read]
diff --git a/screed/tests/test_fastq_recover.py b/screed/tests/test_fastq_recover.py
index a3a7b3c..59bd1c9 100644
--- a/screed/tests/test_fastq_recover.py
+++ b/screed/tests/test_fastq_recover.py
@@ -3,7 +3,9 @@ import os
import screed
from screed.DBConstants import fileExtension
+
class test_fq_recover(test_fastq.Test_fastq):
+
def setup(self):
thisdir = os.path.dirname(__file__)
self._fileName = os.path.join(thisdir, 'fastqRecovery')
diff --git a/screed/tests/test_hava_methods.py b/screed/tests/test_hava_methods.py
index 81bccdf..fba7859 100644
--- a/screed/tests/test_hava_methods.py
+++ b/screed/tests/test_hava_methods.py
@@ -5,14 +5,16 @@ import os
testha = os.path.join(os.path.dirname(__file__), 'test.hava')
+
class test_hava(object):
+
def setup(self):
screed.seqparse.read_hava_sequences(testha)
self._db = screed.ScreedDB(testha)
def teardown(self):
b = 7
- #os.unlink(testha + fileExtension)
+ # os.unlink(testha + fileExtension)
def test_contains(self):
assert 'test_006' in self._db
@@ -21,41 +23,40 @@ class test_hava(object):
result = self._db['test_000']
assert result.hava == 'test_000'
assert result.quarzk == 'ACGGTGACGGTCACCGTCGACGGCCCAAGCCCATCGAACG'\
- 'TACCACCCCCACCTATCGTCACGCTGGTGGAGAGCCAATG'
+ 'TACCACCCCCACCTATCGTCACGCTGGTGGAGAGCCAATG'
assert result.muchalo == 'AFPPCLHBCCILGMMOCHKNNDBKCCPNHAMKJOCCDJA'\
- 'OEPNMHFHCBAJOKEMMMBHCPHIOAEPFFCAOJPGIMKGK'
+ 'OEPNMHFHCBAJOKEMMMBHCPHIOAEPFFCAOJPGIMKGK'
assert result.fakours == '218583165871861127719451483455294521865'\
- '68176931571171542294878855181415261425688'
+ '68176931571171542294878855181415261425688'
assert result.selimizicka == 'bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb'\
- 'bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb'
+ 'bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb'
assert result.marshoon == 'C7AF246AC7AAEABE5A557FCBC6FD5F5263BCDE'\
- '4E745BEF1GG7DD1AB511GBC63A4GF1F4E1A154B35D'
+ '4E745BEF1GG7DD1AB511GBC63A4GF1F4E1A154B35D'
def test_middle_key_retrieval(self):
result = self._db['test_0063']
assert result.hava == 'test_0063'
assert result.quarzk == 'CAACACGATCAAGTTTGGTAAGAATTCCGCCTTAAGCTTT'\
- 'CTAGAACGATAGTTGCCCCCAATCTGGTTCGAAATCTCTT'
+ 'CTAGAACGATAGTTGCCCCCAATCTGGTTCGAAATCTCTT'
assert result.muchalo == 'GMDAPLMOOFANDHHMLBPIKGHIAFFFOABFMNNJNIJ'\
- 'ILEEFEPOCAJLNDLIFBPMGKOFJIEFAHNJPIOFAJMLM'
+ 'ILEEFEPOCAJLNDLIFBPMGKOFJIEFAHNJPIOFAJMLM'
assert result.fakours == '392363971393898522756138876485334274384'\
- '39122136418369146118333919885587613673488'
+ '39122136418369146118333919885587613673488'
assert result.selimizicka == 'bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb'\
- 'bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb'
+ 'bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb'
assert result.marshoon == 'FC25E2CFC2BAFA7A2AA4757F3GFFFEE37G7752'\
- 'FCDBAEADBA1AC7374FB5C15552E6E2GG6GFF62C6GE'
+ 'FCDBAEADBA1AC7374FB5C15552E6E2GG6GFF62C6GE'
def test_end_key_retrieval(self):
result = self._db['test_00124']
assert result.hava == 'test_00124'
assert result.quarzk == 'ATCGCAACCGTTTCCCCTATCTGGCAATTGAATCCGCGTC'\
- 'CTAAAACGAAAGCTTATCCCTGGCGAGGCACGCTAGGCCT'
+ 'CTAAAACGAAAGCTTATCCCTGGCGAGGCACGCTAGGCCT'
assert result.muchalo == 'CIHNCECANFNLKGCHNOEHJDHADHPAEMMNKGMMMPD'\
- 'OBMOCKNBCMCPHEBEOINHMBMMGCHEMOIOAPEFPDDJP'
+ 'OBMOCKNBCMCPHEBEOINHMBMMGCHEMOIOAPEFPDDJP'
assert result.fakours == '327364511483537131695325595876269716778'\
- '14946924334424648676283848861393812686731'
+ '14946924334424648676283848861393812686731'
assert result.selimizicka == 'bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb'\
- 'bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb'
+ 'bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb'
assert result.marshoon == '4FE5FDD76CC5DE4DC2F25AA2GFBD7BEG326C6D'\
- '7AB5B71GA67BAFD63AE1A562CDC1C2D157G6EF17CD'
-
+ '7AB5B71GA67BAFD63AE1A562CDC1C2D157G6EF17CD'
diff --git a/screed/tests/test_nodb.py b/screed/tests/test_nodb.py
index 198697e..f4dd523 100644
--- a/screed/tests/test_nodb.py
+++ b/screed/tests/test_nodb.py
@@ -2,6 +2,7 @@ import screed
import os
from screed.DBConstants import fileExtension
+
def test_nodb():
"""
Tests if screed throws an appropriate exception if it is
@@ -9,10 +10,11 @@ def test_nodb():
"""
try:
db = screed.ScreedDB('foo')
- assert 1 == 0 # Previous line should throw an error
+ assert 1 == 0 # Previous line should throw an error
except ValueError:
pass
+
def test_wrongdb():
"""
Tests if screed throws an appropriate exception if it is
@@ -22,7 +24,7 @@ def test_wrongdb():
blah = 'blah_screed'
blah_file = open(blah, 'wb')
blah_file.close()
-
+
db = screed.ScreedDB(blah)
os.unlink(blah)
assert 1 == 0
diff --git a/screed/tests/test_open.py b/screed/tests/test_open.py
index d2c5de9..b9be0be 100644
--- a/screed/tests/test_open.py
+++ b/screed/tests/test_open.py
@@ -1,21 +1,25 @@
import os.path
+import sys
+
+import screed
+import screed.openscreed
-import screed, screed.openscreed
def test_empty_open():
filename = os.path.join(os.path.dirname(__file__), 'empty.fa')
-
assert len(list(iter(screed.open(filename)))) == 0
+
def test_simple_open():
filename = os.path.join(os.path.dirname(__file__), 'test.fa')
-
+
n = -1
for n, record in enumerate(screed.open(filename)):
assert record.name == 'ENSMICT00000012722'
break
assert n == 0, n
+
def test_simple_open_fq():
filename = os.path.join(os.path.dirname(__file__), 'test.fastq')
@@ -25,6 +29,7 @@ def test_simple_open_fq():
break
assert n == 0
+
def test_gz_open():
filename1 = os.path.join(os.path.dirname(__file__), 'test.fa')
filename2 = os.path.join(os.path.dirname(__file__), 'test.fa.gz')
@@ -34,6 +39,7 @@ def test_gz_open():
assert n > 0
+
def test_bz2_open():
filename1 = os.path.join(os.path.dirname(__file__), 'test.fa')
filename2 = os.path.join(os.path.dirname(__file__), 'test.fa.bz2')
@@ -42,7 +48,8 @@ def test_bz2_open():
assert r1.name == r2.name
assert n > 0
-
+
+
def test_gz_open_fastq():
filename1 = os.path.join(os.path.dirname(__file__), 'test.fastq')
filename2 = os.path.join(os.path.dirname(__file__), 'test.fastq.gz')
@@ -52,11 +59,20 @@ def test_gz_open_fastq():
assert n > 0
+
def test_get_writer_class_fasta():
import screed.fasta
-
+
filename = os.path.join(os.path.dirname(__file__), 'test.fa')
read_iter = screed.open(filename)
x = screed.openscreed.get_writer_class(read_iter)
assert x is screed.fasta.FASTA_Writer, x
+
+
+def test_unknown_fileformat():
+
+ try:
+ screed.open(__file__)
+ except ValueError as err:
+ assert "unknown file format" in str(err)
diff --git a/screed/tests/test_pygr_api.py b/screed/tests/test_pygr_api.py
index ba1b1a7..8c46a43 100644
--- a/screed/tests/test_pygr_api.py
+++ b/screed/tests/test_pygr_api.py
@@ -6,7 +6,7 @@ try:
import pygr
except ImportError:
import nose
- raise nose.SkipTest, "pygr is required for these tests"
+ raise nose.SkipTest("pygr is required for these tests")
import screed
from screed.DBConstants import fileExtension
@@ -17,61 +17,69 @@ import os
testfa = os.path.join(os.path.dirname(__file__), 'test.fa')
+
def setup():
screed.read_fasta_sequences(testfa)
+
def teardown():
os.unlink(testfa + fileExtension)
+
def test_name_iterator_methods():
db = ScreedSequenceDB(testfa)
# test the various iterator methods for equal results from db
- a = sorted([ (x, db[x]) for x in db ])
- b = sorted([ i for i in db.iteritems() ])
- c = sorted([ (v.name, v) for v in db.itervalues() ])
+ a = sorted([(x, db[x]) for x in db])
+ b = sorted([i for i in db.iteritems()])
+ c = sorted([(v.name, v) for v in db.itervalues()])
assert a == b
assert a == c
+
def test_index_iterator_methods():
db = ScreedSequenceDB_ByIndex(testfa)
# test the various iterator methods for equal results from db
- m = sorted([ (x, db[x]) for x in db ])
- n = sorted([ i for i in db.iteritems() ])
- o = sorted([ (v.record.id, v) for v in db.itervalues() ])
+ m = sorted([(x, db[x]) for x in db])
+ n = sorted([i for i in db.iteritems()])
+ o = sorted([(v.record.id, v) for v in db.itervalues()])
assert m == n
assert m == o, (m, o)
+
def test_name_index_equality():
db1 = ScreedSequenceDB(testfa)
db2 = ScreedSequenceDB_ByIndex(testfa)
# must use something other than the obj itself for comparison...
- v1 = sorted([ (v.name, v.seq) for v in db1.itervalues() ])
- v2 = sorted([ (v.name, v.seq) for v in db2.itervalues() ])
+ v1 = sorted([(v.name, v.seq) for v in db1.itervalues()])
+ v2 = sorted([(v.name, v.seq) for v in db2.itervalues()])
assert v1 == v2, (v1, v2)
+
def test_seqinfodict_by_name():
db1 = ScreedSequenceDB(testfa)
sd = db1.seqInfoDict
- m = sorted([ y.id for (x, y) in sd.iteritems() ])
- n = sorted([ x.id for x in sd.itervalues() ])
+ m = sorted([y.id for (x, y) in sd.iteritems()])
+ n = sorted([x.id for x in sd.itervalues()])
assert m == n, (m, n)
-
+
+
def test_seqinfodict_by_index():
db1 = ScreedSequenceDB_ByIndex(testfa)
sd = db1.seqInfoDict
- m = sorted([ x for (x, y) in sd.iteritems() ])
- n = sorted([ x for x in sd.iterkeys() ])
+ m = sorted([x for (x, y) in sd.iteritems()])
+ n = sorted([x for x in sd.iterkeys()])
assert m == n, (m, n)
+
def test_pickle_ByName():
db = ScreedSequenceDB(testfa)
ofp = StringIO()
@@ -81,7 +89,8 @@ def test_pickle_ByName():
ifp = StringIO(ofp.getvalue())
db2 = load(ifp)
assert db.filepath == db2.filepath
-
+
+
def test_pickle_ByIndex():
db = ScreedSequenceDB_ByIndex(testfa)
ofp = StringIO()
diff --git a/screed/tests/test_shell.py b/screed/tests/test_shell.py
index a653a73..1c3aa78 100644
--- a/screed/tests/test_shell.py
+++ b/screed/tests/test_shell.py
@@ -5,11 +5,14 @@ import subprocess
import screed
from screed.DBConstants import fileExtension
+
class Test_fa_shell(test_fasta.Test_fasta):
+
"""
Tests the functionality of the script 'fadbm' in creating a
screed database correctly from the shell
"""
+
def setup(self):
thisdir = os.path.dirname(__file__)
self._testfa = os.path.join(thisdir, 'test.fa')
@@ -21,15 +24,18 @@ class Test_fa_shell(test_fasta.Test_fasta):
def teardown(self):
os.unlink(self._testfa + fileExtension)
+
class Test_fq_shell(test_fastq.Test_fastq):
+
"""
Tests the functionality of the script 'fqdbm' in creating a
screed database correctly from the shell
"""
+
def setup(self):
thisdir = os.path.dirname(__file__)
self._testfq = os.path.join(thisdir, 'test.fastq')
-
+
fqdbm = os.path.join(thisdir, '..', 'fqdbm.py')
subprocess.check_call(['python', fqdbm, self._testfq],
stdout=subprocess.PIPE)
diff --git a/screed/tests/test_streaming.py b/screed/tests/test_streaming.py
new file mode 100644
index 0000000..30775b2
--- /dev/null
+++ b/screed/tests/test_streaming.py
@@ -0,0 +1,85 @@
+import test_fasta
+import test_fastq
+import tempfile
+import os
+import sys
+import io
+import threading
+import subprocess
+import screed
+from nose.plugins.attrib import attr
+from screed.DBConstants import fileExtension
+
+
+def streamer_reader(ifilename, exception):
+ try:
+ for read in screed.open(ifilename):
+ pass
+ except Exception as e:
+ exception.append(e)
+
+
+def streamer(ifilename):
+
+ # Get temp filenames, etc.
+ in_dir = tempfile.mkdtemp(prefix="screedtest_")
+ fifo = os.path.join(in_dir, 'fifo')
+
+ # make a fifo to simulate streaming
+ os.mkfifo(fifo)
+
+ exception = []
+ # FIFOs MUST BE OPENED FOR READING BEFORE THEY ARE WRITTEN TO
+ # If this isn't done, they will BLOCK and things will hang.
+ # rvalues will hold the return from the threaded function
+ thread = threading.Thread(target=streamer_reader, args=[fifo, exception])
+ thread.start()
+
+ ifile = io.open(ifilename, 'rb')
+ fifofile = io.open(fifo, 'wb')
+ # read binary to handle compressed files
+ chunk = ifile.read(8192)
+ while len(chunk) > 0:
+ fifofile.write(chunk)
+ chunk = ifile.read(8192)
+
+ fifofile.close()
+
+ thread.join()
+
+ if len(exception) > 0:
+ raise exception[0]
+
+
+def test_stream_fa():
+ streamer(os.path.join(os.path.dirname(__file__), 'test.fa'))
+
+
+def test_stream_fq():
+ streamer(os.path.join(os.path.dirname(__file__), 'test.fastq'))
+
+
+ at attr('known_failing')
+def test_stream_fa_gz():
+ streamer(os.path.join(os.path.dirname(__file__), 'test.fa.gz'))
+
+
+def test_stream_gz_fail():
+ try:
+ streamer(os.path.join(os.path.dirname(__file__), 'test.fastq.gz'))
+ assert 0, "This should not work yet"
+ except ValueError as err:
+ print str(err)
+
+
+ at attr('known_failing')
+def test_stream_fq_gz():
+ streamer(os.path.join(os.path.dirname(__file__), 'test.fastq.gz'))
+
+
+def test_stream_fa_bz2():
+ streamer(os.path.join(os.path.dirname(__file__), 'test.fa.bz2'))
+
+
+def test_stream_fq_bz2():
+ streamer(os.path.join(os.path.dirname(__file__), 'test.fastq.bz2'))
diff --git a/setup.py b/setup.py
old mode 100644
new mode 100755
index 5cef938..6c963df
--- a/setup.py
+++ b/setup.py
@@ -5,14 +5,30 @@ except ImportError:
print '(WARNING: importing distutils, not setuptools!)'
from distutils.core import setup
+import imp
+fp, pathname, description = imp.find_module('versioneer')
+versioneer = imp.load_module('versioneer', fp, pathname, description)
+del imp
+versioneer.VCS = 'git'
+versioneer.versionfile_source = 'screed/_version.py'
+versioneer.versionfile_build = 'screed/_version.py'
+versioneer.tag_prefix = 'v' # i.e. v1.2.0
+versioneer.parentdir_prefix = '.'
+CMDCLASS = versioneer.get_cmdclass()
+
setup(name='screed',
- version='0.7.1',
+ version=versioneer.get_version(),
description='A short read database',
author='Alex Nolley, C. Titus Brown',
author_email='ctb at msu.edu',
url='http://github.com/ged-lab/screed/',
+ include_package_data=True,
packages=['screed', 'screed.tests'],
- package_data={'screed.tests': ['test.*', 'test-whitespace.fa']},
+ package_data={
+ 'screed.tests': ['test.*', 'test-whitespace.fa', 'empty.fa']},
license='BSD',
- test_suite = 'nose.collector'
+ test_suite='nose.collector',
+ extras_require={'tests': ['nose >= 1.0']},
+ cmdclass=versioneer.get_cmdclass(),
+ install_requires=['bz2file']
)
diff --git a/versioneer.py b/versioneer.py
new file mode 100644
index 0000000..d3fe56c
--- /dev/null
+++ b/versioneer.py
@@ -0,0 +1,913 @@
+
+# Version: 0.13
+
+"""
+The Versioneer
+==============
+
+* like a rocketeer, but for versions!
+* https://github.com/warner/python-versioneer
+* Brian Warner
+* License: Public Domain
+* Compatible With: python2.6, 2.7, 3.2, 3.3, 3.4, and pypy
+* [](https://pypi.python.org/pypi/versioneer/)
+* [](https://travis-ci.org/warner/python-versioneer)
+
+This is a tool for managing a recorded version number in distutils-based
+python projects. The goal is to remove the tedious and error-prone "update
+the embedded version string" step from your release process. Making a new
+release should be as easy as recording a new tag in your version-control
+system, and maybe making new tarballs.
+
+
+## Quick Install
+
+* `pip install versioneer` to somewhere to your $PATH
+* run `versioneer-installer` in your source tree: this installs `versioneer.py`
+* follow the instructions below (also in the `versioneer.py` docstring)
+
+## Version Identifiers
+
+Source trees come from a variety of places:
+
+* a version-control system checkout (mostly used by developers)
+* a nightly tarball, produced by build automation
+* a snapshot tarball, produced by a web-based VCS browser, like github's
+ "tarball from tag" feature
+* a release tarball, produced by "setup.py sdist", distributed through PyPI
+
+Within each source tree, the version identifier (either a string or a number,
+this tool is format-agnostic) can come from a variety of places:
+
+* ask the VCS tool itself, e.g. "git describe" (for checkouts), which knows
+ about recent "tags" and an absolute revision-id
+* the name of the directory into which the tarball was unpacked
+* an expanded VCS keyword ($Id$, etc)
+* a `_version.py` created by some earlier build step
+
+For released software, the version identifier is closely related to a VCS
+tag. Some projects use tag names that include more than just the version
+string (e.g. "myproject-1.2" instead of just "1.2"), in which case the tool
+needs to strip the tag prefix to extract the version identifier. For
+unreleased software (between tags), the version identifier should provide
+enough information to help developers recreate the same tree, while also
+giving them an idea of roughly how old the tree is (after version 1.2, before
+version 1.3). Many VCS systems can report a description that captures this,
+for example 'git describe --tags --dirty --always' reports things like
+"0.7-1-g574ab98-dirty" to indicate that the checkout is one revision past the
+0.7 tag, has a unique revision id of "574ab98", and is "dirty" (it has
+uncommitted changes.
+
+The version identifier is used for multiple purposes:
+
+* to allow the module to self-identify its version: `myproject.__version__`
+* to choose a name and prefix for a 'setup.py sdist' tarball
+
+## Theory of Operation
+
+Versioneer works by adding a special `_version.py` file into your source
+tree, where your `__init__.py` can import it. This `_version.py` knows how to
+dynamically ask the VCS tool for version information at import time. However,
+when you use "setup.py build" or "setup.py sdist", `_version.py` in the new
+copy is replaced by a small static file that contains just the generated
+version data.
+
+`_version.py` also contains `$Revision$` markers, and the installation
+process marks `_version.py` to have this marker rewritten with a tag name
+during the "git archive" command. As a result, generated tarballs will
+contain enough information to get the proper version.
+
+
+## Installation
+
+First, decide on values for the following configuration variables:
+
+* `VCS`: the version control system you use. Currently accepts "git".
+
+* `versionfile_source`:
+
+ A project-relative pathname into which the generated version strings should
+ be written. This is usually a `_version.py` next to your project's main
+ `__init__.py` file, so it can be imported at runtime. If your project uses
+ `src/myproject/__init__.py`, this should be `src/myproject/_version.py`.
+ This file should be checked in to your VCS as usual: the copy created below
+ by `setup.py versioneer` will include code that parses expanded VCS
+ keywords in generated tarballs. The 'build' and 'sdist' commands will
+ replace it with a copy that has just the calculated version string.
+
+ This must be set even if your project does not have any modules (and will
+ therefore never import `_version.py`), since "setup.py sdist" -based trees
+ still need somewhere to record the pre-calculated version strings. Anywhere
+ in the source tree should do. If there is a `__init__.py` next to your
+ `_version.py`, the `setup.py versioneer` command (described below) will
+ append some `__version__`-setting assignments, if they aren't already
+ present.
+
+* `versionfile_build`:
+
+ Like `versionfile_source`, but relative to the build directory instead of
+ the source directory. These will differ when your setup.py uses
+ 'package_dir='. If you have `package_dir={'myproject': 'src/myproject'}`,
+ then you will probably have `versionfile_build='myproject/_version.py'` and
+ `versionfile_source='src/myproject/_version.py'`.
+
+ If this is set to None, then `setup.py build` will not attempt to rewrite
+ any `_version.py` in the built tree. If your project does not have any
+ libraries (e.g. if it only builds a script), then you should use
+ `versionfile_build = None` and override `distutils.command.build_scripts`
+ to explicitly insert a copy of `versioneer.get_version()` into your
+ generated script.
+
+* `tag_prefix`:
+
+ a string, like 'PROJECTNAME-', which appears at the start of all VCS tags.
+ If your tags look like 'myproject-1.2.0', then you should use
+ tag_prefix='myproject-'. If you use unprefixed tags like '1.2.0', this
+ should be an empty string.
+
+* `parentdir_prefix`:
+
+ a string, frequently the same as tag_prefix, which appears at the start of
+ all unpacked tarball filenames. If your tarball unpacks into
+ 'myproject-1.2.0', this should be 'myproject-'.
+
+This tool provides one script, named `versioneer-installer`. That script does
+one thing: write a copy of `versioneer.py` into the current directory.
+
+To versioneer-enable your project:
+
+* 1: Run `versioneer-installer` to copy `versioneer.py` into the top of your
+ source tree.
+
+* 2: add the following lines to the top of your `setup.py`, with the
+ configuration values you decided earlier:
+
+ import versioneer
+ versioneer.VCS = 'git'
+ versioneer.versionfile_source = 'src/myproject/_version.py'
+ versioneer.versionfile_build = 'myproject/_version.py'
+ versioneer.tag_prefix = '' # tags are like 1.2.0
+ versioneer.parentdir_prefix = 'myproject-' # dirname like 'myproject-1.2.0'
+
+* 3: add the following arguments to the setup() call in your setup.py:
+
+ version=versioneer.get_version(),
+ cmdclass=versioneer.get_cmdclass(),
+
+* 4: now run `setup.py versioneer`, which will create `_version.py`, and will
+ modify your `__init__.py` (if one exists next to `_version.py`) to define
+ `__version__` (by calling a function from `_version.py`). It will also
+ modify your `MANIFEST.in` to include both `versioneer.py` and the generated
+ `_version.py` in sdist tarballs.
+
+* 5: commit these changes to your VCS. To make sure you won't forget,
+ `setup.py versioneer` will mark everything it touched for addition.
+
+## Post-Installation Usage
+
+Once established, all uses of your tree from a VCS checkout should get the
+current version string. All generated tarballs should include an embedded
+version string (so users who unpack them will not need a VCS tool installed).
+
+If you distribute your project through PyPI, then the release process should
+boil down to two steps:
+
+* 1: git tag 1.0
+* 2: python setup.py register sdist upload
+
+If you distribute it through github (i.e. users use github to generate
+tarballs with `git archive`), the process is:
+
+* 1: git tag 1.0
+* 2: git push; git push --tags
+
+Currently, all version strings must be based upon a tag. Versioneer will
+report "unknown" until your tree has at least one tag in its history. This
+restriction will be fixed eventually (see issue #12).
+
+## Version-String Flavors
+
+Code which uses Versioneer can learn about its version string at runtime by
+importing `_version` from your main `__init__.py` file and running the
+`get_versions()` function. From the "outside" (e.g. in `setup.py`), you can
+import the top-level `versioneer.py` and run `get_versions()`.
+
+Both functions return a dictionary with different keys for different flavors
+of the version string:
+
+* `['version']`: condensed tag+distance+shortid+dirty identifier. For git,
+ this uses the output of `git describe --tags --dirty --always` but strips
+ the tag_prefix. For example "0.11-2-g1076c97-dirty" indicates that the tree
+ is like the "1076c97" commit but has uncommitted changes ("-dirty"), and
+ that this commit is two revisions ("-2-") beyond the "0.11" tag. For
+ released software (exactly equal to a known tag), the identifier will only
+ contain the stripped tag, e.g. "0.11".
+
+* `['full']`: detailed revision identifier. For Git, this is the full SHA1
+ commit id, followed by "-dirty" if the tree contains uncommitted changes,
+ e.g. "1076c978a8d3cfc70f408fe5974aa6c092c949ac-dirty".
+
+Some variants are more useful than others. Including `full` in a bug report
+should allow developers to reconstruct the exact code being tested (or
+indicate the presence of local changes that should be shared with the
+developers). `version` is suitable for display in an "about" box or a CLI
+`--version` output: it can be easily compared against release notes and lists
+of bugs fixed in various releases.
+
+In the future, this will also include a
+[PEP-0440](http://legacy.python.org/dev/peps/pep-0440/) -compatible flavor
+(e.g. `1.2.post0.dev123`). This loses a lot of information (and has no room
+for a hash-based revision id), but is safe to use in a `setup.py`
+"`version=`" argument. It also enables tools like *pip* to compare version
+strings and evaluate compatibility constraint declarations.
+
+The `setup.py versioneer` command adds the following text to your
+`__init__.py` to place a basic version in `YOURPROJECT.__version__`:
+
+ from ._version import get_versions
+ __version__ = get_versions()['version']
+ del get_versions
+
+## Updating Versioneer
+
+To upgrade your project to a new release of Versioneer, do the following:
+
+* install the new Versioneer (`pip install -U versioneer` or equivalent)
+* re-run `versioneer-installer` in your source tree to replace your copy of
+ `versioneer.py`
+* edit `setup.py`, if necessary, to include any new configuration settings
+ indicated by the release notes
+* re-run `setup.py versioneer` to replace `SRC/_version.py`
+* commit any changed files
+
+### Upgrading from 0.10 to 0.11
+
+You must add a `versioneer.VCS = "git"` to your `setup.py` before re-running
+`setup.py versioneer`. This will enable the use of additional version-control
+systems (SVN, etc) in the future.
+
+### Upgrading from 0.11 to 0.12
+
+Nothing special.
+
+## Future Directions
+
+This tool is designed to make it easily extended to other version-control
+systems: all VCS-specific components are in separate directories like
+src/git/ . The top-level `versioneer.py` script is assembled from these
+components by running make-versioneer.py . In the future, make-versioneer.py
+will take a VCS name as an argument, and will construct a version of
+`versioneer.py` that is specific to the given VCS. It might also take the
+configuration arguments that are currently provided manually during
+installation by editing setup.py . Alternatively, it might go the other
+direction and include code from all supported VCS systems, reducing the
+number of intermediate scripts.
+
+
+## License
+
+To make Versioneer easier to embed, all its code is hereby released into the
+public domain. The `_version.py` that it creates is also in the public
+domain.
+
+"""
+
+import os, sys, re, subprocess, errno
+from distutils.core import Command
+from distutils.command.sdist import sdist as _sdist
+from distutils.command.build import build as _build
+
+# these configuration settings will be overridden by setup.py after it
+# imports us
+versionfile_source = None
+versionfile_build = None
+tag_prefix = None
+parentdir_prefix = None
+VCS = None
+
+# these dictionaries contain VCS-specific tools
+LONG_VERSION_PY = {}
+
+
+def run_command(commands, args, cwd=None, verbose=False, hide_stderr=False):
+ assert isinstance(commands, list)
+ p = None
+ for c in commands:
+ try:
+ # remember shell=False, so use git.cmd on windows, not just git
+ p = subprocess.Popen([c] + args, cwd=cwd, stdout=subprocess.PIPE,
+ stderr=(subprocess.PIPE if hide_stderr
+ else None))
+ break
+ except EnvironmentError:
+ e = sys.exc_info()[1]
+ if e.errno == errno.ENOENT:
+ continue
+ if verbose:
+ print("unable to run %s" % args[0])
+ print(e)
+ return None
+ else:
+ if verbose:
+ print("unable to find command, tried %s" % (commands,))
+ return None
+ stdout = p.communicate()[0].strip()
+ if sys.version >= '3':
+ stdout = stdout.decode()
+ if p.returncode != 0:
+ if verbose:
+ print("unable to run %s (error)" % args[0])
+ return None
+ return stdout
+
+LONG_VERSION_PY['git'] = '''
+# This file helps to compute a version number in source trees obtained from
+# git-archive tarball (such as those provided by githubs download-from-tag
+# feature). Distribution tarballs (built by setup.py sdist) and build
+# directories (produced by setup.py build) will contain a much shorter file
+# that just contains the computed version number.
+
+# This file is released into the public domain. Generated by
+# versioneer-0.13 (https://github.com/warner/python-versioneer)
+
+# these strings will be replaced by git during git-archive
+git_refnames = "%(DOLLAR)sFormat:%%d%(DOLLAR)s"
+git_full = "%(DOLLAR)sFormat:%%H%(DOLLAR)s"
+
+# these strings are filled in when 'setup.py versioneer' creates _version.py
+tag_prefix = "%(TAG_PREFIX)s"
+parentdir_prefix = "%(PARENTDIR_PREFIX)s"
+versionfile_source = "%(VERSIONFILE_SOURCE)s"
+
+import errno
+import os
+import re
+import subprocess
+import sys
+
+
+def run_command(commands, args, cwd=None, verbose=False, hide_stderr=False):
+ assert isinstance(commands, list)
+ p = None
+ for c in commands:
+ try:
+ # remember shell=False, so use git.cmd on windows, not just git
+ p = subprocess.Popen([c] + args, cwd=cwd, stdout=subprocess.PIPE,
+ stderr=(subprocess.PIPE if hide_stderr
+ else None))
+ break
+ except EnvironmentError:
+ e = sys.exc_info()[1]
+ if e.errno == errno.ENOENT:
+ continue
+ if verbose:
+ print("unable to run %%s" %% args[0])
+ print(e)
+ return None
+ else:
+ if verbose:
+ print("unable to find command, tried %%s" %% (commands,))
+ return None
+ stdout = p.communicate()[0].strip()
+ if sys.version >= '3':
+ stdout = stdout.decode()
+ if p.returncode != 0:
+ if verbose:
+ print("unable to run %%s (error)" %% args[0])
+ return None
+ return stdout
+
+
+def versions_from_parentdir(parentdir_prefix, root, verbose=False):
+ # Source tarballs conventionally unpack into a directory that includes
+ # both the project name and a version string.
+ dirname = os.path.basename(root)
+ if not dirname.startswith(parentdir_prefix):
+ if verbose:
+ print("guessing rootdir is '%%s', but '%%s' doesn't start with "
+ "prefix '%%s'" %% (root, dirname, parentdir_prefix))
+ return None
+ return {"version": dirname[len(parentdir_prefix):], "full": ""}
+
+
+def git_get_keywords(versionfile_abs):
+ # the code embedded in _version.py can just fetch the value of these
+ # keywords. When used from setup.py, we don't want to import _version.py,
+ # so we do it with a regexp instead. This function is not used from
+ # _version.py.
+ keywords = {}
+ try:
+ f = open(versionfile_abs, "r")
+ for line in f.readlines():
+ if line.strip().startswith("git_refnames ="):
+ mo = re.search(r'=\s*"(.*)"', line)
+ if mo:
+ keywords["refnames"] = mo.group(1)
+ if line.strip().startswith("git_full ="):
+ mo = re.search(r'=\s*"(.*)"', line)
+ if mo:
+ keywords["full"] = mo.group(1)
+ f.close()
+ except EnvironmentError:
+ pass
+ return keywords
+
+
+def git_versions_from_keywords(keywords, tag_prefix, verbose=False):
+ if not keywords:
+ return {} # keyword-finding function failed to find keywords
+ refnames = keywords["refnames"].strip()
+ if refnames.startswith("$Format"):
+ if verbose:
+ print("keywords are unexpanded, not using")
+ return {} # unexpanded, so not in an unpacked git-archive tarball
+ refs = set([r.strip() for r in refnames.strip("()").split(",")])
+ # starting in git-1.8.3, tags are listed as "tag: foo-1.0" instead of
+ # just "foo-1.0". If we see a "tag: " prefix, prefer those.
+ TAG = "tag: "
+ tags = set([r[len(TAG):] for r in refs if r.startswith(TAG)])
+ if not tags:
+ # Either we're using git < 1.8.3, or there really are no tags. We use
+ # a heuristic: assume all version tags have a digit. The old git %%d
+ # expansion behaves like git log --decorate=short and strips out the
+ # refs/heads/ and refs/tags/ prefixes that would let us distinguish
+ # between branches and tags. By ignoring refnames without digits, we
+ # filter out many common branch names like "release" and
+ # "stabilization", as well as "HEAD" and "master".
+ tags = set([r for r in refs if re.search(r'\d', r)])
+ if verbose:
+ print("discarding '%%s', no digits" %% ",".join(refs-tags))
+ if verbose:
+ print("likely tags: %%s" %% ",".join(sorted(tags)))
+ for ref in sorted(tags):
+ # sorting will prefer e.g. "2.0" over "2.0rc1"
+ if ref.startswith(tag_prefix):
+ r = ref[len(tag_prefix):]
+ if verbose:
+ print("picking %%s" %% r)
+ return {"version": r,
+ "full": keywords["full"].strip()}
+ # no suitable tags, so we use the full revision id
+ if verbose:
+ print("no suitable tags, using full revision id")
+ return {"version": keywords["full"].strip(),
+ "full": keywords["full"].strip()}
+
+
+def git_versions_from_vcs(tag_prefix, root, verbose=False):
+ # this runs 'git' from the root of the source tree. This only gets called
+ # if the git-archive 'subst' keywords were *not* expanded, and
+ # _version.py hasn't already been rewritten with a short version string,
+ # meaning we're inside a checked out source tree.
+
+ if not os.path.exists(os.path.join(root, ".git")):
+ if verbose:
+ print("no .git in %%s" %% root)
+ return {}
+
+ GITS = ["git"]
+ if sys.platform == "win32":
+ GITS = ["git.cmd", "git.exe"]
+ stdout = run_command(GITS, ["describe", "--tags", "--dirty", "--always"],
+ cwd=root)
+ if stdout is None:
+ return {}
+ if not stdout.startswith(tag_prefix):
+ if verbose:
+ fmt = "tag '%%s' doesn't start with prefix '%%s'"
+ print(fmt %% (stdout, tag_prefix))
+ return {}
+ tag = stdout[len(tag_prefix):]
+ stdout = run_command(GITS, ["rev-parse", "HEAD"], cwd=root)
+ if stdout is None:
+ return {}
+ full = stdout.strip()
+ if tag.endswith("-dirty"):
+ full += "-dirty"
+ return {"version": tag, "full": full}
+
+
+def get_versions(default={"version": "unknown", "full": ""}, verbose=False):
+ # I am in _version.py, which lives at ROOT/VERSIONFILE_SOURCE. If we have
+ # __file__, we can work backwards from there to the root. Some
+ # py2exe/bbfreeze/non-CPython implementations don't do __file__, in which
+ # case we can only use expanded keywords.
+
+ keywords = {"refnames": git_refnames, "full": git_full}
+ ver = git_versions_from_keywords(keywords, tag_prefix, verbose)
+ if ver:
+ return ver
+
+ try:
+ root = os.path.realpath(__file__)
+ # versionfile_source is the relative path from the top of the source
+ # tree (where the .git directory might live) to this file. Invert
+ # this to find the root from __file__.
+ for i in range(len(versionfile_source.split('/'))):
+ root = os.path.dirname(root)
+ except NameError:
+ return default
+
+ return (git_versions_from_vcs(tag_prefix, root, verbose)
+ or versions_from_parentdir(parentdir_prefix, root, verbose)
+ or default)
+'''
+
+
+def git_get_keywords(versionfile_abs):
+ # the code embedded in _version.py can just fetch the value of these
+ # keywords. When used from setup.py, we don't want to import _version.py,
+ # so we do it with a regexp instead. This function is not used from
+ # _version.py.
+ keywords = {}
+ try:
+ f = open(versionfile_abs, "r")
+ for line in f.readlines():
+ if line.strip().startswith("git_refnames ="):
+ mo = re.search(r'=\s*"(.*)"', line)
+ if mo:
+ keywords["refnames"] = mo.group(1)
+ if line.strip().startswith("git_full ="):
+ mo = re.search(r'=\s*"(.*)"', line)
+ if mo:
+ keywords["full"] = mo.group(1)
+ f.close()
+ except EnvironmentError:
+ pass
+ return keywords
+
+
+def git_versions_from_keywords(keywords, tag_prefix, verbose=False):
+ if not keywords:
+ return {} # keyword-finding function failed to find keywords
+ refnames = keywords["refnames"].strip()
+ if refnames.startswith("$Format"):
+ if verbose:
+ print("keywords are unexpanded, not using")
+ return {} # unexpanded, so not in an unpacked git-archive tarball
+ refs = set([r.strip() for r in refnames.strip("()").split(",")])
+ # starting in git-1.8.3, tags are listed as "tag: foo-1.0" instead of
+ # just "foo-1.0". If we see a "tag: " prefix, prefer those.
+ TAG = "tag: "
+ tags = set([r[len(TAG):] for r in refs if r.startswith(TAG)])
+ if not tags:
+ # Either we're using git < 1.8.3, or there really are no tags. We use
+ # a heuristic: assume all version tags have a digit. The old git %d
+ # expansion behaves like git log --decorate=short and strips out the
+ # refs/heads/ and refs/tags/ prefixes that would let us distinguish
+ # between branches and tags. By ignoring refnames without digits, we
+ # filter out many common branch names like "release" and
+ # "stabilization", as well as "HEAD" and "master".
+ tags = set([r for r in refs if re.search(r'\d', r)])
+ if verbose:
+ print("discarding '%s', no digits" % ",".join(refs-tags))
+ if verbose:
+ print("likely tags: %s" % ",".join(sorted(tags)))
+ for ref in sorted(tags):
+ # sorting will prefer e.g. "2.0" over "2.0rc1"
+ if ref.startswith(tag_prefix):
+ r = ref[len(tag_prefix):]
+ if verbose:
+ print("picking %s" % r)
+ return {"version": r,
+ "full": keywords["full"].strip()}
+ # no suitable tags, so we use the full revision id
+ if verbose:
+ print("no suitable tags, using full revision id")
+ return {"version": keywords["full"].strip(),
+ "full": keywords["full"].strip()}
+
+
+def git_versions_from_vcs(tag_prefix, root, verbose=False):
+ # this runs 'git' from the root of the source tree. This only gets called
+ # if the git-archive 'subst' keywords were *not* expanded, and
+ # _version.py hasn't already been rewritten with a short version string,
+ # meaning we're inside a checked out source tree.
+
+ if not os.path.exists(os.path.join(root, ".git")):
+ if verbose:
+ print("no .git in %s" % root)
+ return {}
+
+ GITS = ["git"]
+ if sys.platform == "win32":
+ GITS = ["git.cmd", "git.exe"]
+ stdout = run_command(GITS, ["describe", "--tags", "--dirty", "--always"],
+ cwd=root)
+ if stdout is None:
+ return {}
+ if not stdout.startswith(tag_prefix):
+ if verbose:
+ fmt = "tag '%s' doesn't start with prefix '%s'"
+ print(fmt % (stdout, tag_prefix))
+ return {}
+ tag = stdout[len(tag_prefix):]
+ stdout = run_command(GITS, ["rev-parse", "HEAD"], cwd=root)
+ if stdout is None:
+ return {}
+ full = stdout.strip()
+ if tag.endswith("-dirty"):
+ full += "-dirty"
+ return {"version": tag, "full": full}
+
+
+def do_vcs_install(manifest_in, versionfile_source, ipy):
+ GITS = ["git"]
+ if sys.platform == "win32":
+ GITS = ["git.cmd", "git.exe"]
+ files = [manifest_in, versionfile_source]
+ if ipy:
+ files.append(ipy)
+ try:
+ me = __file__
+ if me.endswith(".pyc") or me.endswith(".pyo"):
+ me = os.path.splitext(me)[0] + ".py"
+ versioneer_file = os.path.relpath(me)
+ except NameError:
+ versioneer_file = "versioneer.py"
+ files.append(versioneer_file)
+ present = False
+ try:
+ f = open(".gitattributes", "r")
+ for line in f.readlines():
+ if line.strip().startswith(versionfile_source):
+ if "export-subst" in line.strip().split()[1:]:
+ present = True
+ f.close()
+ except EnvironmentError:
+ pass
+ if not present:
+ f = open(".gitattributes", "a+")
+ f.write("%s export-subst\n" % versionfile_source)
+ f.close()
+ files.append(".gitattributes")
+ run_command(GITS, ["add", "--"] + files)
+
+def versions_from_parentdir(parentdir_prefix, root, verbose=False):
+ # Source tarballs conventionally unpack into a directory that includes
+ # both the project name and a version string.
+ dirname = os.path.basename(root)
+ if not dirname.startswith(parentdir_prefix):
+ if verbose:
+ print("guessing rootdir is '%s', but '%s' doesn't start with "
+ "prefix '%s'" % (root, dirname, parentdir_prefix))
+ return None
+ return {"version": dirname[len(parentdir_prefix):], "full": ""}
+
+SHORT_VERSION_PY = """
+# This file was generated by 'versioneer.py' (0.13) from
+# revision-control system data, or from the parent directory name of an
+# unpacked source archive. Distribution tarballs contain a pre-generated copy
+# of this file.
+
+version_version = '%(version)s'
+version_full = '%(full)s'
+def get_versions(default={}, verbose=False):
+ return {'version': version_version, 'full': version_full}
+
+"""
+
+DEFAULT = {"version": "unknown", "full": "unknown"}
+
+def versions_from_file(filename):
+ versions = {}
+ try:
+ with open(filename) as f:
+ for line in f.readlines():
+ mo = re.match("version_version = '([^']+)'", line)
+ if mo:
+ versions["version"] = mo.group(1)
+ mo = re.match("version_full = '([^']+)'", line)
+ if mo:
+ versions["full"] = mo.group(1)
+ except EnvironmentError:
+ return {}
+
+ return versions
+
+def write_to_version_file(filename, versions):
+ with open(filename, "w") as f:
+ f.write(SHORT_VERSION_PY % versions)
+
+ print("set %s to '%s'" % (filename, versions["version"]))
+
+
+def get_root():
+ try:
+ return os.path.dirname(os.path.abspath(__file__))
+ except NameError:
+ return os.path.dirname(os.path.abspath(sys.argv[0]))
+
+def vcs_function(vcs, suffix):
+ return getattr(sys.modules[__name__], '%s_%s' % (vcs, suffix), None)
+
+def get_versions(default=DEFAULT, verbose=False):
+ # returns dict with two keys: 'version' and 'full'
+ assert versionfile_source is not None, "please set versioneer.versionfile_source"
+ assert tag_prefix is not None, "please set versioneer.tag_prefix"
+ assert parentdir_prefix is not None, "please set versioneer.parentdir_prefix"
+ assert VCS is not None, "please set versioneer.VCS"
+
+ # I am in versioneer.py, which must live at the top of the source tree,
+ # which we use to compute the root directory. py2exe/bbfreeze/non-CPython
+ # don't have __file__, in which case we fall back to sys.argv[0] (which
+ # ought to be the setup.py script). We prefer __file__ since that's more
+ # robust in cases where setup.py was invoked in some weird way (e.g. pip)
+ root = get_root()
+ versionfile_abs = os.path.join(root, versionfile_source)
+
+ # extract version from first of _version.py, VCS command (e.g. 'git
+ # describe'), parentdir. This is meant to work for developers using a
+ # source checkout, for users of a tarball created by 'setup.py sdist',
+ # and for users of a tarball/zipball created by 'git archive' or github's
+ # download-from-tag feature or the equivalent in other VCSes.
+
+ get_keywords_f = vcs_function(VCS, "get_keywords")
+ versions_from_keywords_f = vcs_function(VCS, "versions_from_keywords")
+ if get_keywords_f and versions_from_keywords_f:
+ vcs_keywords = get_keywords_f(versionfile_abs)
+ ver = versions_from_keywords_f(vcs_keywords, tag_prefix)
+ if ver:
+ if verbose: print("got version from expanded keyword %s" % ver)
+ return ver
+
+ ver = versions_from_file(versionfile_abs)
+ if ver:
+ if verbose: print("got version from file %s %s" % (versionfile_abs,ver))
+ return ver
+
+ versions_from_vcs_f = vcs_function(VCS, "versions_from_vcs")
+ if versions_from_vcs_f:
+ ver = versions_from_vcs_f(tag_prefix, root, verbose)
+ if ver:
+ if verbose: print("got version from VCS %s" % ver)
+ return ver
+
+ ver = versions_from_parentdir(parentdir_prefix, root, verbose)
+ if ver:
+ if verbose: print("got version from parentdir %s" % ver)
+ return ver
+
+ if verbose: print("got version from default %s" % default)
+ return default
+
+def get_version(verbose=False):
+ return get_versions(verbose=verbose)["version"]
+
+class cmd_version(Command):
+ description = "report generated version string"
+ user_options = []
+ boolean_options = []
+ def initialize_options(self):
+ pass
+ def finalize_options(self):
+ pass
+ def run(self):
+ ver = get_version(verbose=True)
+ print("Version is currently: %s" % ver)
+
+
+class cmd_build(_build):
+ def run(self):
+ versions = get_versions(verbose=True)
+ _build.run(self)
+ # now locate _version.py in the new build/ directory and replace it
+ # with an updated value
+ if versionfile_build:
+ target_versionfile = os.path.join(self.build_lib, versionfile_build)
+ print("UPDATING %s" % target_versionfile)
+ os.unlink(target_versionfile)
+ with open(target_versionfile, "w") as f:
+ f.write(SHORT_VERSION_PY % versions)
+
+if 'cx_Freeze' in sys.modules: # cx_freeze enabled?
+ from cx_Freeze.dist import build_exe as _build_exe
+
+ class cmd_build_exe(_build_exe):
+ def run(self):
+ versions = get_versions(verbose=True)
+ target_versionfile = versionfile_source
+ print("UPDATING %s" % target_versionfile)
+ os.unlink(target_versionfile)
+ with open(target_versionfile, "w") as f:
+ f.write(SHORT_VERSION_PY % versions)
+
+ _build_exe.run(self)
+ os.unlink(target_versionfile)
+ with open(versionfile_source, "w") as f:
+ assert VCS is not None, "please set versioneer.VCS"
+ LONG = LONG_VERSION_PY[VCS]
+ f.write(LONG % {"DOLLAR": "$",
+ "TAG_PREFIX": tag_prefix,
+ "PARENTDIR_PREFIX": parentdir_prefix,
+ "VERSIONFILE_SOURCE": versionfile_source,
+ })
+
+class cmd_sdist(_sdist):
+ def run(self):
+ versions = get_versions(verbose=True)
+ self._versioneer_generated_versions = versions
+ # unless we update this, the command will keep using the old version
+ self.distribution.metadata.version = versions["version"]
+ return _sdist.run(self)
+
+ def make_release_tree(self, base_dir, files):
+ _sdist.make_release_tree(self, base_dir, files)
+ # now locate _version.py in the new base_dir directory (remembering
+ # that it may be a hardlink) and replace it with an updated value
+ target_versionfile = os.path.join(base_dir, versionfile_source)
+ print("UPDATING %s" % target_versionfile)
+ os.unlink(target_versionfile)
+ with open(target_versionfile, "w") as f:
+ f.write(SHORT_VERSION_PY % self._versioneer_generated_versions)
+
+INIT_PY_SNIPPET = """
+from ._version import get_versions
+__version__ = get_versions()['version']
+del get_versions
+"""
+
+class cmd_update_files(Command):
+ description = "install/upgrade Versioneer files: __init__.py SRC/_version.py"
+ user_options = []
+ boolean_options = []
+ def initialize_options(self):
+ pass
+ def finalize_options(self):
+ pass
+ def run(self):
+ print(" creating %s" % versionfile_source)
+ with open(versionfile_source, "w") as f:
+ assert VCS is not None, "please set versioneer.VCS"
+ LONG = LONG_VERSION_PY[VCS]
+ f.write(LONG % {"DOLLAR": "$",
+ "TAG_PREFIX": tag_prefix,
+ "PARENTDIR_PREFIX": parentdir_prefix,
+ "VERSIONFILE_SOURCE": versionfile_source,
+ })
+
+ ipy = os.path.join(os.path.dirname(versionfile_source), "__init__.py")
+ if os.path.exists(ipy):
+ try:
+ with open(ipy, "r") as f:
+ old = f.read()
+ except EnvironmentError:
+ old = ""
+ if INIT_PY_SNIPPET not in old:
+ print(" appending to %s" % ipy)
+ with open(ipy, "a") as f:
+ f.write(INIT_PY_SNIPPET)
+ else:
+ print(" %s unmodified" % ipy)
+ else:
+ print(" %s doesn't exist, ok" % ipy)
+ ipy = None
+
+ # Make sure both the top-level "versioneer.py" and versionfile_source
+ # (PKG/_version.py, used by runtime code) are in MANIFEST.in, so
+ # they'll be copied into source distributions. Pip won't be able to
+ # install the package without this.
+ manifest_in = os.path.join(get_root(), "MANIFEST.in")
+ simple_includes = set()
+ try:
+ with open(manifest_in, "r") as f:
+ for line in f:
+ if line.startswith("include "):
+ for include in line.split()[1:]:
+ simple_includes.add(include)
+ except EnvironmentError:
+ pass
+ # That doesn't cover everything MANIFEST.in can do
+ # (http://docs.python.org/2/distutils/sourcedist.html#commands), so
+ # it might give some false negatives. Appending redundant 'include'
+ # lines is safe, though.
+ if "versioneer.py" not in simple_includes:
+ print(" appending 'versioneer.py' to MANIFEST.in")
+ with open(manifest_in, "a") as f:
+ f.write("include versioneer.py\n")
+ else:
+ print(" 'versioneer.py' already in MANIFEST.in")
+ if versionfile_source not in simple_includes:
+ print(" appending versionfile_source ('%s') to MANIFEST.in" %
+ versionfile_source)
+ with open(manifest_in, "a") as f:
+ f.write("include %s\n" % versionfile_source)
+ else:
+ print(" versionfile_source already in MANIFEST.in")
+
+ # Make VCS-specific changes. For git, this means creating/changing
+ # .gitattributes to mark _version.py for export-time keyword
+ # substitution.
+ do_vcs_install(manifest_in, versionfile_source, ipy)
+
+def get_cmdclass():
+ cmds = {'version': cmd_version,
+ 'versioneer': cmd_update_files,
+ 'build': cmd_build,
+ 'sdist': cmd_sdist,
+ }
+ if 'cx_Freeze' in sys.modules: # cx_freeze enabled?
+ cmds['build_exe'] = cmd_build_exe
+ del cmds['build']
+
+ return cmds
--
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/python-screed.git
More information about the debian-med-commit
mailing list