[med-svn] [fastaq] 01/01: start using autopkgtest

[Sascha Steinbiss]

This is an automated email from the git hooks/post-receive script.

sascha-guest pushed a commit to branch master
in repository fastaq.

commit f076ce611132c4bf58925d1930f4226faa14512d
Author: Sascha Steinbiss <sascha at steinbiss.name>
Date:   Sun Nov 29 12:13:22 2015 +0000

    start using autopkgtest
---
 debian/control           |  1 +
 debian/tests/control     |  2 ++
 debian/tests/python-test |  5 +++++
 debian/tests/run         | 13 +++++++++++++
 4 files changed, 21 insertions(+)

diff --git a/debian/control b/debian/control
index 6d36542..7e56ad2 100644
--- a/debian/control
+++ b/debian/control
@@ -5,6 +5,7 @@ Uploaders: Andreas Tille <tille at debian.org>,
            Sascha Steinbiss <sascha at steinbiss.name>
 Section: science
 Priority: optional
+Testsuite: autopkgtest
 Build-Depends: debhelper (>= 9),
                python3,
                python3-setuptools,
diff --git a/debian/tests/control b/debian/tests/control
new file mode 100755
index 0000000..04101e3
--- /dev/null
+++ b/debian/tests/control
@@ -0,0 +1,2 @@
+Tests: run python-test
+Depends: @, python3, samtools
diff --git a/debian/tests/python-test b/debian/tests/python-test
new file mode 100755
index 0000000..7655530
--- /dev/null
+++ b/debian/tests/python-test
@@ -0,0 +1,5 @@
+#!/usr/bin/env python3
+# autopkgtest check: Check whether pyfastaq module is importable
+# Author: Sascha Steinbiss <sascha at steinbiss.name>
+
+import pyfastaq
\ No newline at end of file
diff --git a/debian/tests/run b/debian/tests/run
new file mode 100755
index 0000000..fd26630
--- /dev/null
+++ b/debian/tests/run
@@ -0,0 +1,13 @@
+#!/bin/sh
+# autopkgtest check: Check if fastaq tool can be executed
+# Author: Sascha Steinbiss <sascha at steinbiss.name>
+
+WORKDIR=$(mktemp -d)
+trap "rm -rf $WORKDIR" 0 INT QUIT ABRT PIPE TERM
+cd $WORKDIR
+cat <<EOF > infile.fasta
+>test
+CAGTCGATGCGAGCCGGCTACGA
+EOF
+
+fastaq reverse_complement infile.fasta -
\ No newline at end of file

-- 
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/fastaq.git