[med-svn] [pbgenomicconsensus] 01/05: Imported Upstream version 1.0.0
Afif Elghraoui
afif-guest at moszumanska.debian.org
Tue Sep 15 08:49:44 UTC 2015
This is an automated email from the git hooks/post-receive script.
afif-guest pushed a commit to branch master
in repository pbgenomicconsensus.
commit 0fa5eb64173c0b2e5973a9f0c93e32d2c36a518a
Author: Afif Elghraoui <afif at ghraoui.name>
Date: Mon Sep 14 18:58:27 2015 -0700
Imported Upstream version 1.0.0
---
.gitignore | 13 +
CHANGELOG | 42 +
GenomicConsensus/ResultCollector.py | 171 +
GenomicConsensus/Worker.py | 129 +
GenomicConsensus/__init__.py | 33 +
GenomicConsensus/consensus.py | 150 +
GenomicConsensus/io/VariantsGffWriter.py | 96 +
GenomicConsensus/io/__init__.py | 35 +
GenomicConsensus/io/utils.py | 57 +
GenomicConsensus/main.py | 371 +
GenomicConsensus/options.py | 404 +
GenomicConsensus/plurality/__init__.py | 32 +
GenomicConsensus/plurality/plurality.py | 438 +
GenomicConsensus/quiver/__init__.py | 35 +
GenomicConsensus/quiver/diploid.py | 224 +
GenomicConsensus/quiver/evidence.py | 173 +
GenomicConsensus/quiver/model.py | 428 +
GenomicConsensus/quiver/quiver.py | 282 +
.../2013-03/GenomicConsensus/QuiverParameters.ini | 128 +
.../2013-05/GenomicConsensus/QuiverParameters.ini | 151 +
.../2013-09/GenomicConsensus/QuiverParameters.ini | 174 +
.../2014-03/GenomicConsensus/QuiverParameters.ini | 174 +
.../2014-09/GenomicConsensus/QuiverParameters.ini | 198 +
GenomicConsensus/quiver/utils.py | 407 +
GenomicConsensus/reference.py | 261 +
GenomicConsensus/utils.py | 174 +
GenomicConsensus/variants.py | 123 +
GenomicConsensus/windows.py | 190 +
LICENSES | 32 +
Makefile | 62 +
README.md | 36 +
bin/gffToBed.py | 141 +
bin/gffToVcf.py | 136 +
bin/makePbi.py | 115 +
bin/plurality | 2 +
bin/quiver | 2 +
bin/summarizeConsensus.py | 99 +
bin/variantCaller.py | 5 +
doc/HowToQuiver.rst | 178 +
doc/Makefile | 153 +
doc/QuiverFAQ.rst | 376 +
doc/VariantCallerFunctionalSpecification.rst | 211 +
doc/VariantCallerKnownIssues.rst | 11 +
doc/VariantsGffSpecification.rst | 173 +
doc/conf.py | 248 +
doc/index.rst | 18 +
doc/internal/1_3_3_Enhancements.rst | 73 +
doc/internal/VariantCallerValidation.rst | 162 +
setup.py | 36 +
tests/cram/extra/convert-to-bed.t | 22 +
tests/cram/extra/convert-to-vcf.t | 26 +
tests/cram/extra/coverage-bed.t | 29 +
tests/cram/extra/plurality-compressed.t | 55 +
tests/cram/extra/plurality-fluidigm.t | 19 +
tests/cram/extra/reference-mismatch.t | 27 +
tests/cram/internal/alignment_summary.t | 36 +
tests/cram/internal/plurality-diploid-lambda.t | 50 +
tests/cram/internal/plurality-lambda.t | 9 +
tests/cram/internal/quiver-compatibility.t | 43 +
tests/cram/internal/quiver-diploid-lambda.t | 35 +
tests/cram/internal/quiver-ecoli.t | 51 +
tests/cram/internal/quiver-eichler-bac.t | 53 +
tests/cram/internal/quiver-fluidigm-amplicons.t | 6 +
tests/cram/internal/quiver-lambda.t | 32 +
tests/cram/internal/quiver-mruber.t | 69 +
tests/cram/internal/quiver-staph.t | 32 +
tests/cram/internal/quiver-stumpy-read.t.off | 27 +
.../internal/quiver-tinyLambda-coverage-islands.t | 223 +
tests/cram/makePbi.t.off | 284 +
tests/cram/plurality-hcv.t | 55 +
tests/cram/plurality-pbcore-lambda.t | 17 +
tests/cram/quiver-hcv.t | 66 +
tests/cram/quiver-noqvs-test.t | 51 +
tests/cram/version.t | 8 +
tests/data/converters/variants.gff.gz | Bin 0 -> 715 bytes
tests/data/fluidigm_amplicons/040500.cmp.h5 | Bin 0 -> 23086728 bytes
.../Fluidigm_human_amplicons.fasta | 250 +
.../Fluidigm_human_amplicons.fasta.fai | 48 +
.../data/fluidigm_amplicons/alignment_summary.gff | 10716 +++++++++++++++++++
tests/data/hcv/3primeEnd.fa | 7 +
tests/data/hcv/5primeEnd.fa | 4 +
tests/data/hcv/5primeEnd.fa.fai | 1 +
tests/data/hcv/HCV_Ref_For_187140.fasta | 12 +
tests/data/hcv/HCV_Ref_For_187140.fasta.fai | 2 +
tests/data/hcv/aligned_reads.cmp.h5 | Bin 0 -> 1480245 bytes
tests/data/yarm/9_ecoli_mutated_10.gff | 200 +
tests/data/yarm/9_ecoli_mutated_2.gff | 200 +
tests/data/yarm/9_ecoli_mutated_4.gff | 200 +
tests/data/yarm/9_ecoli_mutated_6.gff | 200 +
tests/data/yarm/9_ecoli_mutated_8.gff | 200 +
tests/data/yarm/strain.pkl | Bin 0 -> 4966 bytes
tests/unit/AlignmentHitStubs.py | 352 +
tests/unit/test_consensus.py | 22 +
tests/unit/test_coverage_intervals.py | 109 +
tests/unit/test_dinucleotide_repeats.py | 10 +
tests/unit/test_diploid.py | 34 +
tests/unit/test_plurality.py | 88 +
tests/unit/test_quiver.py | 45 +
tests/unit/test_quiver_params.py | 101 +
tests/unit/test_rare.py.off | 73 +
100 files changed, 21561 insertions(+)
diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000..ff26355
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,13 @@
+*~
+*.pyc
+*.pyo
+.project
+.pydevproject
+.idea
+*.egg-info
+doc/_build
+build/
+dist/
+TAGS
+evidence_dump/
+nosetests.xml
diff --git a/CHANGELOG b/CHANGELOG
new file mode 100644
index 0000000..8ee9baa
--- /dev/null
+++ b/CHANGELOG
@@ -0,0 +1,42 @@
+Version 1.0.0
+ * Working support for BAM files adhering to our BAM spec (version 3.0b6)
+
+Version 0.9.2 (bugfix release, issued with SMRTanalysis 2.3.0p2)
+ * Fix bug where output contained truncated contig names
+
+Version 0.9.1 (released with SMRTanalysis 2.3.0p1)
+ * Preliminary support for BAM file in quiver
+
+Version 0.9.0 (released with SMRTanalysis 2.3)
+ * Support for P6-C4 chemistry
+ * Rate of MLE convergences failures reduced drastically
+ * quiver will now abort if it is provided data lacking the full
+ complement of QV tracks (except the MergeQV, which is allowed to
+ be absent, as is the case in data from old basecaller versions)
+ * Use the new chemistry information decoding spec---expects barcode
+ information in the cmp.h5 but will fall back to the old
+ "SequencingChemistry" tag if the barcodes are absent.
+
+Version 0.8.0 (released with SMRTanalysis 2.2)
+ * Improved consensus calling at edges of contigs and amplicons
+ * Fixes to reduce algorithmic convergence failures
+ * Improved support for chemistry mixtures
+ * Faster analysis of P5-C3 chemistry
+ * Improved robustness using P5-C3 chemistry
+ * Faster startup time for large references
+
+Version 0.7.0 (released with SMRTanalysis 2.1)
+ * Support for diploid variant calling in plurality and quiver algorithms
+ * Auto-windowing to skip coverage deserts, drastically improving user experience
+ for amplicon workflows.
+ * Command line support for operating on a chosen barcode
+ * Fix bug in dinucleotide repeat refinement
+ * Modification to variants.gff schema to support diploid variant reporting
+ * Fix for memory leak affecting jobs with many reference contigs
+ (large assemblies, for example)
+ * Improved support for P5-C3 chemistry
+ * Improved support for P4-C2 chemistry (was included in 2.0.1 release)
+
+Version 0.6.0 (released with SMRTanalysis 2.0)
+ * Improved Quiver accuracy, reducing errors in dinucleotide repeat regions
+ * Improved, extensible support for existing and forthcoming sequencing chemistries
diff --git a/GenomicConsensus/ResultCollector.py b/GenomicConsensus/ResultCollector.py
new file mode 100644
index 0000000..e6d18e9
--- /dev/null
+++ b/GenomicConsensus/ResultCollector.py
@@ -0,0 +1,171 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander, Jim Drake
+
+import cProfile, logging, os.path, sys
+from multiprocessing import Process
+from threading import Thread
+from collections import OrderedDict, defaultdict
+from .options import options
+from GenomicConsensus import reference, consensus, utils, windows
+from .io.VariantsGffWriter import VariantsGffWriter
+from pbcore.io import FastaWriter, FastqWriter
+
+class ResultCollector(object):
+ """
+ Gathers results and writes to a file.
+ """
+ def __init__(self, resultsQueue, algorithmConfig):
+ self._resultsQueue = resultsQueue
+ self._algorithmConfig = algorithmConfig
+
+ def _run(self):
+ self.onStart()
+
+ sentinelsReceived = 0
+ while sentinelsReceived < options.numWorkers:
+ result = self._resultsQueue.get()
+ if result is None:
+ sentinelsReceived += 1
+ else:
+ self.onResult(result)
+
+ self.onFinish()
+
+ def run(self):
+ if options.doProfiling:
+ cProfile.runctx("self._run()",
+ globals=globals(),
+ locals=locals(),
+ filename=os.path.join(options.temporaryDirectory,
+ "profile-%s.out" % (self.name)))
+ else:
+ self._run()
+
+
+ # ==================================
+ # Overridable interface begins here.
+ #
+
+ def onStart(self):
+ self.referenceBasesProcessedById = OrderedDict()
+ for refId in reference.byId:
+ self.referenceBasesProcessedById[refId] = 0
+ self.variantsByRefId = defaultdict(list)
+ self.consensusChunksByRefId = defaultdict(list)
+
+ # open file writers
+ self.fastaWriter = self.fastqWriter = self.gffWriter = None
+ if options.fastaOutputFilename:
+ self.fastaWriter = FastaWriter(options.fastaOutputFilename)
+ if options.fastqOutputFilename:
+ self.fastqWriter = FastqWriter(options.fastqOutputFilename)
+ if options.gffOutputFilename:
+ self.gffWriter = VariantsGffWriter(options.gffOutputFilename,
+ vars(options),
+ reference.byId.values())
+
+ def onResult(self, result):
+ window, cssAndVariants = result
+ css, variants = cssAndVariants
+ self._recordNewResults(window, css, variants)
+ self._flushContigIfCompleted(window)
+
+ def onFinish(self):
+ logging.info("Analysis completed.")
+ if self.fastaWriter: self.fastaWriter.close()
+ if self.fastqWriter: self.fastqWriter.close()
+ if self.gffWriter: self.gffWriter.close()
+ logging.info("Output files completed.")
+
+ def _recordNewResults(self, window, css, variants):
+ refId, refStart, refEnd = window
+ self.consensusChunksByRefId[refId].append(css)
+ self.variantsByRefId[refId] += variants
+ self.referenceBasesProcessedById[refId] += (refEnd - refStart)
+
+ def _flushContigIfCompleted(self, window):
+ refId, _, _ = window
+ refEntry = reference.byId[refId]
+ refName = refEntry.fullName
+ basesProcessed = self.referenceBasesProcessedById[refId]
+ requiredBases = reference.numReferenceBases(refId, options.referenceWindows)
+ if basesProcessed == requiredBases:
+ # This contig is done, so we can dump to file and delete
+ # the data structures.
+ if self.gffWriter:
+ self.gffWriter.writeVariants(sorted(self.variantsByRefId[refId]))
+ del self.variantsByRefId[refId]
+
+ #
+ # If the user asked to analyze a window or a set of
+ # windows, we output a FAST[AQ] contig per analyzed
+ # window. Otherwise we output a fasta contig per
+ # reference contig.
+ #
+ # We try to be intelligent about naming the output
+ # contigs, to include window information where applicable.
+ #
+ for span in reference.enumerateSpans(refId, options.referenceWindows):
+ _, s, e = span
+ if (s == 0) and (e == refEntry.length):
+ spanName = refName
+ else:
+ spanName = refName + ":%d-%d" % (s, e)
+ cssName = consensus.consensusContigName(spanName,
+ options.algorithm)
+ # Gather just the chunks pertaining to this span
+ chunksThisSpan = [ chunk for chunk in self.consensusChunksByRefId[refId]
+ if windows.windowsIntersect(chunk.refWindow, span) ]
+ css = consensus.join(chunksThisSpan)
+
+ if self.fastaWriter:
+ self.fastaWriter.writeRecord(cssName,
+ css.sequence)
+ if self.fastqWriter:
+ self.fastqWriter.writeRecord(cssName,
+ css.sequence,
+ css.confidence)
+
+ del self.consensusChunksByRefId[refId]
+
+class ResultCollectorProcess(ResultCollector, Process):
+ def __init__(self, *args):
+ Process.__init__(self)
+ self.daemon = True
+ super(ResultCollectorProcess,self).__init__(*args)
+
+class ResultCollectorThread(ResultCollector, Thread):
+ def __init__(self, *args):
+ Thread.__init__(self)
+ self.daemon = True
+ self.exitcode = 0
+ super(ResultCollectorThread,self).__init__(*args)
diff --git a/GenomicConsensus/Worker.py b/GenomicConsensus/Worker.py
new file mode 100644
index 0000000..0006caa
--- /dev/null
+++ b/GenomicConsensus/Worker.py
@@ -0,0 +1,129 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander, Jim Drake
+
+import cProfile, logging, os.path
+from multiprocessing import Process
+from threading import Thread
+from .options import options
+from .reference import windowToString
+from .io.utils import loadCmpH5, loadBam
+
+class Worker(object):
+ """
+ Base class for compute worker that read reference coordinates
+ from the task queue, perform variant calling, then push results
+ back to another queue, to be written to a GFF file by a collector.
+
+ All tasks that are O(genome length * coverage depth) should be
+ distributed to compute workers, leaving the collector
+ worker only O(genome length) work to do.
+ """
+ def __init__(self, workQueue, resultsQueue, algorithmConfig):
+ self._workQueue = workQueue
+ self._resultsQueue = resultsQueue
+ self._algorithmConfig = algorithmConfig
+
+ def _run(self):
+ if options.usingBam:
+ self._inCmpH5 = loadBam(options.inputFilename, options.referenceFilename)
+ else:
+ self._inCmpH5 = loadCmpH5(options.inputFilename, options.referenceFilename,
+ disableChunkCache=options.disableHdf5ChunkCache)
+ self.onStart()
+
+ while True:
+ datum = self._workQueue.get()
+ if datum is None:
+ # Sentinel indicating end of input. Place a sentinel
+ # on the results queue and end this worker process.
+ self._resultsQueue.put(None)
+ break
+ else:
+ if datum.hasCoverage:
+ msg = "%s received work unit, coords=%s"
+ else:
+ msg = "%s received work unit, coords=%s (inadequate coverage)"
+ logging.debug(msg % (self.name, windowToString(datum.window)))
+
+ result = self.onChunk(datum)
+ self._resultsQueue.put(result)
+
+ self.onFinish()
+
+
+ def run(self):
+ if options.doDebugging:
+ import ipdb
+ with ipdb.launch_ipdb_on_exception():
+ self._run()
+
+ elif options.doProfiling:
+ cProfile.runctx("self._run()",
+ globals=globals(),
+ locals=locals(),
+ filename=os.path.join(options.temporaryDirectory,
+ "profile-%s.out" % (self.name)))
+ else:
+ self._run()
+
+ #==
+ # Begin overridable interface
+ #==
+
+ def onStart(self):
+ pass
+
+ def onChunk(self, workChunk):
+ """
+ This function is the heart of the matter.
+
+ workChunk -> result
+ """
+ pass
+
+ def onFinish(self):
+ pass
+
+class WorkerProcess(Worker, Process):
+ """Worker that executes as a process."""
+ def __init__(self, *args):
+ Process.__init__(self)
+ super(WorkerProcess,self).__init__(*args)
+ self.daemon = True
+
+class WorkerThread(Worker, Thread):
+ """Worker that executes as a thread (for debugging purposes only)."""
+ def __init__(self, *args):
+ Thread.__init__(self)
+ super(WorkerThread,self).__init__(*args)
+ self.daemon = True
+ self.exitcode = 0
diff --git a/GenomicConsensus/__init__.py b/GenomicConsensus/__init__.py
new file mode 100644
index 0000000..92a44d5
--- /dev/null
+++ b/GenomicConsensus/__init__.py
@@ -0,0 +1,33 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+__VERSION__ = "1.0.0"
diff --git a/GenomicConsensus/consensus.py b/GenomicConsensus/consensus.py
new file mode 100644
index 0000000..2699dca
--- /dev/null
+++ b/GenomicConsensus/consensus.py
@@ -0,0 +1,150 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+import numpy as np
+
+__all__ = [ "Consensus",
+ "QuiverConsensus",
+ "totalLength",
+ "areContiguous",
+ "join" ]
+
+class Consensus(object):
+ """
+ A multiple sequence consensus corresponding to a
+ (reference/scaffold) coordinate region
+ """
+ def __init__(self, refWindow, sequence, confidence):
+ assert (len(sequence) ==
+ len(confidence))
+ self.refWindow = refWindow
+ self.sequence = sequence
+ self.confidence = confidence
+
+ def __cmp__(self, other):
+ return cmp(self.refWindow, other.refWindow)
+
+ #
+ # Functions for calling the consensus for regions of inadequate
+ # coverage
+ #
+
+ @classmethod
+ def nAsConsensus(cls, refWin, referenceSequence):
+ length = len(referenceSequence)
+ seq = np.empty(length, dtype="S1")
+ seq.fill("N")
+ conf = np.zeros(length, dtype=np.uint)
+ return cls(refWin, seq.tostring(), conf)
+
+ @classmethod
+ def referenceAsConsensus(cls, refWin, referenceSequence):
+ conf = np.zeros(len(referenceSequence), dtype=np.uint)
+ return cls(refWin, referenceSequence, conf)
+
+ @classmethod
+ def lowercaseReferenceAsConsensus(cls, refWin, referenceSequence):
+ conf = np.zeros(len(referenceSequence), dtype=np.uint)
+ return cls(refWin, referenceSequence.lower(), conf)
+
+ @classmethod
+ def noCallConsensus(cls, noCallStyle, refWin, refSequence):
+ d = { "nocall" : cls.nAsConsensus,
+ "reference" : cls.referenceAsConsensus,
+ "lowercasereference" : cls.lowercaseReferenceAsConsensus}
+ factory = d[noCallStyle]
+ return factory(refWin, refSequence)
+
+
+class QuiverConsensus(Consensus):
+ """
+ A QuiverConsensus object carries an additional field, `mms`, which
+ is the ConsensusCore MultiReadMutationScorer object, which can be
+ used to perform some post-hoc analyses (diploid, sample mixture, etc)
+ """
+ def __init__(self, refWindow, sequence, confidence, mms=None):
+ super(QuiverConsensus, self).__init__(refWindow, sequence, confidence)
+ self.mms = mms
+
+
+def totalLength(consensi):
+ """
+ Total length of reference/scaffold coordinate windows
+ """
+ return sum(cssChunk.refWindow[2] - cssChunk.refWindow[1]
+ for cssChunk in consensi)
+
+def areContiguous(refWindows):
+ """
+ Predicate that determines whether the reference/scaffold windows
+ are contiguous.
+ """
+ lastEnd = None
+ lastId = None
+ for refWin in refWindows:
+ id, start, end = refWin
+ if ((lastId is not None and id != lastId) or
+ (lastEnd is not None and start != lastEnd)):
+ return False
+ lastEnd = end
+ lastId = id
+ return True
+
+def join(consensi):
+ """
+ [Consensus] -> Consensus
+
+ String together all the consensus objects into a single consensus.
+ Will raise a ValueError if the reference windows are not
+ contiguous.
+ """
+ assert len(consensi) >= 1
+ sortedConsensi = sorted(consensi)
+ if not areContiguous([cssChunk.refWindow for cssChunk in sortedConsensi]):
+ raise ValueError, "Consensus chunks must be contiguous"
+
+ joinedRefWindow = (sortedConsensi[0].refWindow[0],
+ sortedConsensi[0].refWindow[1],
+ sortedConsensi[-1].refWindow[2])
+ joinedSeq = "".join([cssChunk.sequence for cssChunk in sortedConsensi])
+ joinedConfidence = np.concatenate([cssChunk.confidence for cssChunk in sortedConsensi])
+
+ return Consensus(joinedRefWindow,
+ joinedSeq,
+ joinedConfidence)
+
+
+#
+# Naming convention for consensus contigs
+#
+def consensusContigName(referenceName, algorithmName):
+ return "%s|%s" % (referenceName, algorithmName)
diff --git a/GenomicConsensus/io/VariantsGffWriter.py b/GenomicConsensus/io/VariantsGffWriter.py
new file mode 100644
index 0000000..1193ac1
--- /dev/null
+++ b/GenomicConsensus/io/VariantsGffWriter.py
@@ -0,0 +1,96 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+import time
+from pbcore.io import GffWriter, Gff3Record
+from GenomicConsensus import __VERSION__, reference
+
+
+def gffVariantSeq(var):
+ if var.isHeterozygous:
+ return "%s/%s" % (var.readSeq1 or ".",
+ var.readSeq2 or ".")
+ else:
+ return var.readSeq1 or "."
+
+def gffVariantFrequency(var):
+ if var.frequency1==None:
+ return None
+ elif var.isHeterozygous:
+ return "%d/%d" % (var.frequency1, var.frequency2)
+ else:
+ return str(var.frequency1)
+
+def toGffRecord(var):
+ varType = var.variantType
+ gffType = varType.lower()
+ gffStart = (var.refStart + 1) if (var.refSeq != "") else var.refStart
+ gffEnd = var.refEnd if (var.refSeq != "") else var.refStart
+ gffFreq = gffVariantFrequency(var)
+
+ record = Gff3Record(reference.idToFullName(var.refId), gffStart, gffEnd, gffType)
+ record.reference = var.refSeq or "."
+ record.variantSeq = gffVariantSeq(var)
+ if gffFreq:
+ record.frequency = gffFreq
+ record.coverage = var.coverage
+ record.confidence = var.confidence
+ if var.annotations:
+ for (k, v) in var.annotations:
+ record.put(k, v)
+ return record
+
+class VariantsGffWriter(object):
+
+ ONTOLOGY_URL = \
+ "http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12"
+
+ def __init__(self, f, optionsDict, referenceEntries):
+ self._gffWriter = GffWriter(f)
+ self._gffWriter.writeHeader("##pacbio-variant-version 2.1")
+ self._gffWriter.writeHeader("##date %s" % time.ctime())
+ self._gffWriter.writeHeader("##feature-ontology %s" % self.ONTOLOGY_URL)
+ self._gffWriter.writeHeader("##source GenomicConsensus %s" % __VERSION__)
+ self._gffWriter.writeHeader("##source-commandline %s" % optionsDict["shellCommand"])
+ self._gffWriter.writeHeader("##source-alignment-file %s" % optionsDict["inputFilename"])
+ self._gffWriter.writeHeader("##source-reference-file %s" % optionsDict["referenceFilename"])
+ # Reference groups.
+ for entry in referenceEntries:
+ self._gffWriter.writeHeader("##sequence-region %s 1 %d" \
+ % (entry.name, entry.length))
+
+ def writeVariants(self, variants):
+ for var in variants:
+ self._gffWriter.writeRecord(toGffRecord(var))
+
+ def close(self):
+ self._gffWriter.close()
diff --git a/GenomicConsensus/io/__init__.py b/GenomicConsensus/io/__init__.py
new file mode 100644
index 0000000..19ab20b
--- /dev/null
+++ b/GenomicConsensus/io/__init__.py
@@ -0,0 +1,35 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+from __future__ import absolute_import
+from .VariantsGffWriter import VariantsGffWriter
+from .utils import *
diff --git a/GenomicConsensus/io/utils.py b/GenomicConsensus/io/utils.py
new file mode 100644
index 0000000..10b5d85
--- /dev/null
+++ b/GenomicConsensus/io/utils.py
@@ -0,0 +1,57 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+__all__ = ["loadCmpH5", "loadBam"]
+
+import h5py, os.path
+from pbcore.io import CmpH5Reader, BamReader
+
+
+def loadCmpH5(filename, referenceFname, disableChunkCache=False):
+ """
+ Get a CmpH5Reader object, disabling the chunk cache if requested.
+ """
+ filename = os.path.abspath(os.path.expanduser(filename))
+ if not disableChunkCache:
+ file = h5py.File(filename, "r")
+ else:
+ propfaid = h5py.h5p.create(h5py.h5p.FILE_ACCESS)
+ propfaid.set_cache(0, 0, 0, 0)
+ fid = h5py.h5f.open(filename,
+ flags=h5py.h5f.ACC_RDONLY,
+ fapl=propfaid)
+ file = h5py.File(fid)
+ return CmpH5Reader(file)
+
+def loadBam(filename, referenceFname):
+ filename = os.path.abspath(os.path.expanduser(filename))
+ return BamReader(filename, referenceFname)
diff --git a/GenomicConsensus/main.py b/GenomicConsensus/main.py
new file mode 100644
index 0000000..8e2432f
--- /dev/null
+++ b/GenomicConsensus/main.py
@@ -0,0 +1,371 @@
+#!/usr/bin/env python
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+from __future__ import absolute_import
+
+import argparse, atexit, cProfile, gc, glob, h5py, logging, multiprocessing
+import os, pstats, random, shutil, tempfile, time, threading, Queue, traceback
+
+from pbcore.io import CmpH5Reader, BamReader
+from GenomicConsensus import reference
+from GenomicConsensus.options import (options,
+ parseOptions,
+ resolveOptions,
+ consensusCoreVersion)
+from GenomicConsensus.utils import (IncompatibleDataException,
+ datasetCountExceedsThreshold,
+ die)
+
+from GenomicConsensus.quiver import quiver
+from GenomicConsensus.plurality import plurality
+
+class ToolRunner(object):
+ """
+ The main driver class for the GenomicConsensus tool.
+ """
+ def __init__(self):
+ self._inCmpH5 = None
+ self._resultsQueue = None
+ self._workQueue = None
+ self._slaves = None
+ self._algorithm = None
+ self._algorithmConfiguration = None
+ self._aborting = False
+
+ def _setupLogging(self):
+ if options.quiet:
+ logLevel = logging.ERROR
+ elif options.verbosity >= 2:
+ logLevel = logging.DEBUG
+ elif options.verbosity == 1:
+ logLevel = logging.INFO
+ else:
+ logLevel = logging.WARNING
+ logFormat = '[%(levelname)s] %(message)s'
+ logging.basicConfig(level=logLevel, format=logFormat)
+
+ def _makeTemporaryDirectory(self):
+ """
+ Make a temp dir where we can stash things if necessary.
+ """
+ options.temporaryDirectory = tempfile.mkdtemp(prefix="GenomicConsensus-", dir="/tmp")
+ logging.info("Created temporary directory %s" % (options.temporaryDirectory,) )
+
+ def _algorithmByName(self, name):
+ if name=="plurality":
+ algo = plurality
+ elif name=="quiver":
+ algo = quiver
+ else:
+ die("Failure: unrecognized algorithm %s" % name)
+ isOK, msg = algo.availability
+ if not isOK:
+ die("Failure: %s" % msg)
+ return algo
+
+ def _launchSlaves(self):
+ """
+ Launch a group of worker processes (self._slaves), the queue
+ (self._workQueue) that will be used to send them chunks of
+ work, and the queue that will be used to receive back the
+ results (self._resultsQueue).
+
+ Additionally, launch the result collector process.
+ """
+ availableCpus = multiprocessing.cpu_count()
+ logging.info("Available CPUs: %d" % (availableCpus,))
+ logging.info("Requested workers: %d" % (options.numWorkers,))
+ logging.info("Parallel Mode: %s" % ("Threaded" if options.threaded else "Process",))
+ if (options.numWorkers > availableCpus):
+ logging.warn("More workers requested (%d) than CPUs available (%d);"
+ " may result in suboptimal performance."
+ % (options.numWorkers, availableCpus))
+ self._initQueues()
+
+ WorkerType, ResultCollectorType = self._algorithm.slaveFactories(options.threaded)
+ self._slaves = []
+ for i in xrange(options.numWorkers):
+ p = WorkerType(self._workQueue, self._resultsQueue, self._algorithmConfiguration)
+ self._slaves.append(p)
+ p.start()
+ logging.info("Launched compute slaves.")
+
+ rcp = ResultCollectorType(self._resultsQueue, self._algorithmConfiguration)
+ rcp.start()
+ self._slaves.append(rcp)
+ logging.info("Launched collector slave.")
+
+ def _initQueues(self):
+ if options.threaded:
+ self._workQueue = Queue.Queue(options.queueSize)
+ self._resultsQueue = Queue.Queue(options.queueSize)
+ else:
+ self._workQueue = multiprocessing.Queue(options.queueSize)
+ self._resultsQueue = multiprocessing.Queue(options.queueSize)
+
+ def _readCmpH5Input(self):
+ """
+ Read the CmpH5 input file into a CmpH5 object and
+ store it as self._inCmpH5.
+ """
+ fname = options.inputFilename
+ if options.usingBam:
+ self._inCmpH5 = BamReader(fname, options.referenceFilename)
+ else:
+ logging.debug("Before open on main process, # hdf5 objects open: %d" % h5py.h5f.get_obj_count())
+ self._inCmpH5 = CmpH5Reader(fname)
+
+ def _loadReference(self, cmpH5):
+ logging.info("Loading reference")
+ err = reference.loadFromFile(options.referenceFilename, cmpH5)
+ if err:
+ die("Error loading reference")
+ # Grok the referenceWindow spec, if any.
+ if options.referenceWindowsAsString is None:
+ options.referenceWindows = ()
+ elif options.skipUnrecognizedContigs:
+ # This is a workaround for smrtpipe scatter/gather.
+ options.referenceWindows = []
+ for s in options.referenceWindowsAsString.split(","):
+ try:
+ win = reference.stringToWindow(s)
+ options.referenceWindows.append(win)
+ except:
+ pass
+ else:
+ options.referenceWindows = map(reference.stringToWindow,
+ options.referenceWindowsAsString.split(","))
+
+ def _checkFileCompatibility(self, cmpH5):
+ if not cmpH5.isSorted:
+ die("Input CmpH5 file must be sorted.")
+ if cmpH5.isEmpty:
+ die("Input CmpH5 file must be nonempty.")
+
+ def _shouldDisableChunkCache(self, cmpH5):
+ if isinstance(cmpH5, CmpH5Reader):
+ threshold = options.autoDisableHdf5ChunkCache
+ return datasetCountExceedsThreshold(cmpH5, threshold)
+ else:
+ return False
+
+ def _configureAlgorithm(self, options, cmpH5):
+ assert self._algorithm != None
+ try:
+ self._algorithmConfiguration = self._algorithm.configure(options, cmpH5)
+ except IncompatibleDataException as e:
+ die("Failure: %s" % e.message)
+
+ def _mainLoop(self):
+ # Split up reference genome into chunks and farm out the
+ # a chunk as a unit of work.
+ logging.debug("Starting main loop.")
+ ids = reference.enumerateIds(options.referenceWindows)
+ for _id in ids:
+ if options.fancyChunking:
+ chunks = reference.fancyEnumerateChunks(self._inCmpH5,
+ _id,
+ options.referenceChunkSize,
+ options.minCoverage,
+ options.minMapQV,
+ options.referenceWindows)
+ else:
+ chunks = reference.enumerateChunks(_id,
+ options.referenceChunkSize,
+ options.referenceWindows)
+ for chunk in chunks:
+ if self._aborting: return
+ self._workQueue.put(chunk)
+
+ # Write sentinels ("end-of-work-stream")
+ for i in xrange(options.numWorkers):
+ self._workQueue.put(None)
+
+ def _printProfiles(self):
+ for profile in glob.glob(os.path.join(options.temporaryDirectory, "*")):
+ pstats.Stats(profile).sort_stats("time").print_stats(20)
+
+ def _cleanup(self):
+ if options.doProfiling:
+ logging.info("Removing %s" % options.temporaryDirectory)
+ shutil.rmtree(options.temporaryDirectory, ignore_errors=True)
+
+ def _setupEvidenceDumpDirectory(self, directoryName):
+ if os.path.exists(directoryName):
+ shutil.rmtree(directoryName)
+ os.makedirs(directoryName)
+
+ @property
+ def aborting(self):
+ return self._aborting
+
+ def abortWork(self, why):
+ """
+ Performs a shutdown of all the slave processes. Called by the
+ monitoring thread when a child process exits with a non-zero,
+ or when a keyboard interrupt (Ctrl-C) is given. Not called
+ during normal shutdown.
+ """
+ logging.error(why)
+ self._aborting = True
+ self._resultsQueue.close()
+ self._workQueue.close()
+
+ @property
+ def slaves(self):
+ return self._slaves
+
+ def main(self):
+
+ # This looks scary but it's not. Python uses reference
+ # counting and has a secondary, optional garbage collector for
+ # collecting garbage cycles. Unfortunately when a cyclic GC
+ # happens when a thread is calling cPickle.dumps, the
+ # interpreter crashes sometimes. See Bug 19704. Since we
+ # don't leak garbage cycles, disabling the cyclic GC is
+ # essentially harmless.
+ gc.disable()
+
+ parseOptions()
+ self._algorithm = self._algorithmByName(options.algorithm)
+ self._setupLogging()
+ random.seed(42)
+
+ logging.info("h5py version: %s" % h5py.version.version)
+ logging.info("hdf5 version: %s" % h5py.version.hdf5_version)
+ logging.info("ConsensusCore version: %s" %
+ (consensusCoreVersion() or "ConsensusCore unavailable"))
+ logging.info("Starting.")
+
+ atexit.register(self._cleanup)
+ if options.doProfiling:
+ self._makeTemporaryDirectory()
+
+ if options.usingBam:
+ logging.warn("'fancyChunking' not yet available for BAM, disabling")
+ options.fancyChunking = False
+
+ # Peek at the bam file to build tables
+ with BamReader(options.inputFilename) as peekCmpH5:
+ logging.info("Peeking at BAM file %s" % options.inputFilename)
+ logging.info("Input BAM data: numAlnHits=%d" % len(peekCmpH5))
+ resolveOptions(peekCmpH5)
+ self._loadReference(peekCmpH5)
+ self._checkFileCompatibility(peekCmpH5)
+ self._configureAlgorithm(options, peekCmpH5)
+ else:
+ # We need to peek at the cmp.h5 file to build the The
+ # refGroupId<->refGroupFullName mapping, and to determine
+ # whether the selected algorithm parameters (Quiver) are
+ # compatible with the data. But we then have to close the
+ # file, and let the "real" open happen after the fork.
+ with CmpH5Reader(options.inputFilename) as peekCmpH5:
+ logging.info("Peeking at CmpH5 file %s" % options.inputFilename)
+ logging.info("Input CmpH5 data: numAlnHits=%d" % len(peekCmpH5))
+ resolveOptions(peekCmpH5)
+ self._loadReference(peekCmpH5)
+ self._checkFileCompatibility(peekCmpH5)
+ self._configureAlgorithm(options, peekCmpH5)
+ options.disableHdf5ChunkCache = self._shouldDisableChunkCache(peekCmpH5)
+ if options.disableHdf5ChunkCache:
+ logging.info("Will disable HDF5 chunk cache (large number of datasets)")
+ logging.debug("After peek, # hdf5 objects open: %d" % h5py.h5f.get_obj_count())
+
+ if options.dumpEvidence:
+ self._setupEvidenceDumpDirectory(options.evidenceDirectory)
+
+ self._launchSlaves()
+ self._readCmpH5Input()
+
+ monitoringThread = threading.Thread(target=monitorSlaves, args=(self,))
+ monitoringThread.start()
+
+ try:
+ if options.doProfiling:
+ cProfile.runctx("self._mainLoop()",
+ globals=globals(),
+ locals=locals(),
+ filename=os.path.join(options.temporaryDirectory,
+ "profile-main.out"))
+
+ elif options.doDebugging:
+ if not options.threaded:
+ die("Debugging only works with -T (threaded) mode")
+ logging.info("PID: %d", os.getpid())
+ import ipdb
+ with ipdb.launch_ipdb_on_exception():
+ self._mainLoop()
+
+ else:
+ self._mainLoop()
+ except:
+ why = traceback.format_exc()
+ self.abortWork(why)
+
+ monitoringThread.join()
+
+ if self._aborting:
+ logging.error("Aborting")
+ return -1
+ else:
+ logging.info("Finished.")
+
+ if options.doProfiling:
+ self._printProfiles()
+
+ # close h5 file.
+ self._inCmpH5.close()
+ return 0
+
+def monitorSlaves(driver):
+ """
+ Promptly aborts if a child is found to have exited with a nonzero
+ exit code received; otherwise returns when all processes exit cleanly (0).
+
+ This approach is portable--catching SIGCHLD doesn't work on
+ Windows.
+ """
+ while not driver.aborting:
+ all_exited = all(not p.is_alive() for p in driver.slaves)
+ nonzero_exits = [p.exitcode for p in driver.slaves if p.exitcode]
+ if nonzero_exits:
+ exitcode = nonzero_exits[0]
+ driver.abortWork("Child process exited with exitcode=%d. Aborting." % exitcode)
+ return exitcode
+ elif all_exited:
+ return 0
+ time.sleep(1)
+
+def main():
+ tr = ToolRunner()
+ return tr.main()
diff --git a/GenomicConsensus/options.py b/GenomicConsensus/options.py
new file mode 100644
index 0000000..7e71607
--- /dev/null
+++ b/GenomicConsensus/options.py
@@ -0,0 +1,404 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+#
+# This module makes the options globally available to all processes.
+#
+# Presently it relies on the fact that multiprocessing on Linux/Unix uses fork(),
+# so the child processes inherit state from the main process. If we ever wanted
+# to port to Windows, we could support this module using the Manager protocol in
+# in multiprocessing.
+#
+# Usage:
+# In the main process, before forking:
+# > from options import parseOptions, options
+# > parseOptions()
+# ...
+# then in any subprocess you can say
+# > from options import options
+# and get the loaded options dictionary.
+#
+from __future__ import absolute_import
+import argparse, h5py, os, os.path, sys
+from .utils import fileFormat
+from . import __VERSION__
+
+options = argparse.Namespace()
+
+def consensusCoreVersion():
+ try:
+ import ConsensusCore
+ return ConsensusCore.Version.VersionString()
+ except:
+ return None
+
+def parseOptions():
+ """
+ Parse the options and perform some due diligence on them
+ """
+ desc = "Compute genomic consensus and call variants relative to the reference."
+ parser = argparse.ArgumentParser(description=desc, add_help=False)
+
+ def canonicalizedFilePath(path):
+ return os.path.abspath(os.path.expanduser(path))
+
+ def checkInputFile(path):
+ if not os.path.isfile(path):
+ parser.error("Input file %s not found." % (path,))
+
+ def checkOutputFile(path):
+ try:
+ f = open(path, "a")
+ f.close()
+ except:
+ parser.error("Output file %s cannot be written." % (path,))
+
+
+ basics = parser.add_argument_group("Basic required options")
+ basics.add_argument(
+ "inputFilename",
+ type=canonicalizedFilePath,
+ help="The input cmp.h5 file")
+ basics.add_argument(
+ "--referenceFilename", "--reference", "-r",
+ action="store",
+ dest="referenceFilename",
+ type=canonicalizedFilePath,
+ required=True,
+ help="The filename of the reference FASTA file")
+ basics.add_argument(
+ "-o", "--outputFilename",
+ dest="outputFilenames",
+ required=True,
+ type=str,
+ action="append",
+ default=[],
+ help="The output filename(s), as a comma-separated list." + \
+ "Valid output formats are .fa/.fasta, .fq/.fastq, .gff")
+
+ parallelism = parser.add_argument_group("Parallelism")
+ parallelism.add_argument(
+ "-j", "--numWorkers",
+ dest="numWorkers",
+ type=int,
+ default=1,
+ help="The number of worker processes to be used")
+
+ filtering = parser.add_argument_group("Output filtering")
+ filtering.add_argument(
+ "--minConfidence", "-q",
+ action="store",
+ dest="minConfidence",
+ type=int,
+ default=40,
+ help="The minimum confidence for a variant call to be output to variants.gff")
+ filtering.add_argument(
+ "--minCoverage", "-x",
+ action="store",
+ dest="minCoverage",
+ default=5,
+ type=int,
+ help="The minimum site coverage that must be achieved for variant calls and " + \
+ "consensus to be calculated for a site.")
+ filtering.add_argument(
+ "--noEvidenceConsensusCall",
+ action="store",
+ choices=["nocall", "reference", "lowercasereference"],
+ default="lowercasereference",
+ help="The consensus base that will be output for sites with no effective coverage.")
+
+
+ readSelection = parser.add_argument_group("Read selection/filtering")
+ readSelection.add_argument(
+ "--coverage", "-X",
+ action="store",
+ dest="coverage",
+ type=int,
+ default=100,
+ help="A designation of the maximum coverage level to be used for analysis." + \
+ " Exact interpretation is algorithm-specific.")
+ readSelection.add_argument(
+ "--minMapQV", "-m",
+ action="store",
+ dest="minMapQV",
+ type=float,
+ default=10,
+ help="The minimum MapQV for reads that will be used for analysis.")
+ # Since the reference isn't loaded at options processing time, we
+ # can't grok the referenceWindow specified until later. We store
+ # it as a string (referenceWindowsAsString) and it will later be
+ # interpreted and stored as a proper window tuple (referenceWindow)
+ readSelection.add_argument(
+ "--referenceWindow", "--referenceWindows", "-w",
+ action="store",
+ dest="referenceWindowsAsString",
+ type=str,
+ help="The window (or multiple comma-delimited windows) of the reference to " + \
+ "be processed, in the format refGroup:refStart-refEnd " + \
+ "(default: entire reference).",
+ default=None)
+
+ def slurpWindowFile(fname):
+ return ",".join(map(str.strip, open(fname).readlines()))
+
+ readSelection.add_argument(
+ "--referenceWindowsFile", "-W",
+ action="store",
+ dest="referenceWindowsAsString",
+ type=slurpWindowFile,
+ help="A file containing reference window designations, one per line",
+ default=None)
+ readSelection.add_argument(
+ "--barcode",
+ type=str,
+ dest="_barcode",
+ help="Only process reads with the given barcode name.")
+ def parseReadStratum(s):
+ rs = map(int, s.split("/"))
+ assert len(rs) == 2
+ assert rs[0] < rs[1]
+ return rs
+ readSelection.add_argument(
+ "--readStratum",
+ help="A string of the form 'n/N', where n, and N are integers, 0 <= n < N, designating" \
+ " that the reads are to be deterministically split into N strata of roughly even" \
+ " size, and stratum n is to be used for variant and consensus calling. This is" \
+ " mostly useful for Quiver development.",
+ dest="readStratum",
+ default=None,
+ type=parseReadStratum)
+
+
+ algorithm = parser.add_argument_group("Algorithm and parameter settings")
+ algorithm.add_argument(
+ "--algorithm",
+ action="store",
+ dest="algorithm",
+ type=str,
+ default="quiver")
+ algorithm.add_argument(
+ "--parametersFile", "-P",
+ dest="parametersFile",
+ type=str,
+ default=None,
+ help="Parameter set filename (QuiverParameters.ini), or directory D " + \
+ "such that either D/*/GenomicConsensus/QuiverParameters.ini, " + \
+ "or D/GenomicConsensus/QuiverParameters.ini, is found. In the " + \
+ "former case, the lexically largest path is chosen.")
+ algorithm.add_argument(
+ "--parametersSpec", "-p",
+ action="store",
+ dest="parametersSpec",
+ type=str,
+ default="auto",
+ help="Name of parameter set (chemistry.model) to select from the " + \
+ "parameters file, or just the name of the chemistry, in which " + \
+ "case the best available model is chosen. Default is 'auto', " + \
+ "which selects the best parameter set from the cmp.h5")
+
+ debugging = parser.add_argument_group("Verbosity and debugging/profiling")
+ debugging.add_argument("--help", "-h",
+ action="help")
+ class PrintVersionAction(argparse.Action):
+ def __call__(self, parser, namespace, values, option_string=None):
+ print " GenomicConsensus version: %s" % __VERSION__
+ print " ConsensusCore version: %s" % \
+ (consensusCoreVersion() or "ConsensusCore unavailable")
+ print " h5py version: %s" % h5py.version.version
+ print " hdf5 version: %s" % h5py.version.hdf5_version
+ sys.exit(0)
+ debugging.add_argument("--version",
+ nargs=0,
+ action=PrintVersionAction)
+ debugging.add_argument(
+ "--verbose", "-v",
+ dest="verbosity",
+ action="count",
+ help="Set the verbosity level.")
+ debugging.add_argument(
+ "--quiet",
+ dest="quiet",
+ action="store_true",
+ help="Turn off all logging, including warnings")
+ debugging.add_argument(
+ "--debug",
+ action="store_true",
+ dest="doDebugging",
+ default=False,
+ help="Enable Python-level debugging (using pdb).")
+ debugging.add_argument(
+ "--profile",
+ action="store_true",
+ dest="doProfiling",
+ default=False,
+ help="Enable Python-level profiling (using cProfile).")
+ debugging.add_argument(
+ "--dumpEvidence", "-d",
+ dest="dumpEvidence",
+ nargs="?",
+ default=None,
+ const="variants",
+ choices=["variants", "all"])
+ debugging.add_argument(
+ "--evidenceDirectory",
+ default="evidence_dump")
+ debugging.add_argument(
+ "--annotateGFF",
+ action="store_true",
+ help="Augment GFF variant records with additional information")
+
+ advanced = parser.add_argument_group("Advanced configuration options")
+ advanced.add_argument(
+ "--diploid",
+ action="store_true",
+ help="Enable detection of heterozygous variants (experimental)")
+ advanced.add_argument(
+ "--queueSize", "-Q",
+ action="store",
+ dest="queueSize",
+ type=int,
+ default=200)
+ advanced.add_argument(
+ "--threaded", "-T",
+ action="store_true",
+ dest="threaded",
+ default=False,
+ help="Run threads instead of processes (for debugging purposes only)")
+ advanced.add_argument(
+ "--referenceChunkSize", "-C",
+ action="store",
+ dest="referenceChunkSize",
+ type=int,
+ default=500)
+ advanced.add_argument(
+ "--fancyChunking",
+ default=True,
+ action="store_true",
+ help="Adaptive reference chunking designed to handle coverage cutouts better")
+ advanced.add_argument(
+ "--simpleChunking",
+ dest="fancyChunking",
+ action="store_false",
+ help="Disable adaptive reference chunking")
+ advanced.add_argument(
+ "--referenceChunkOverlap",
+ action="store",
+ dest="referenceChunkOverlap",
+ type=int,
+ default=5)
+ advanced.add_argument(
+ "--autoDisableHdf5ChunkCache",
+ action="store",
+ type=int,
+ default=500,
+ help="Disable the HDF5 chunk cache when the number of datasets in the cmp.h5 " + \
+ "exceeds the given threshold")
+ advanced.add_argument(
+ "--aligner", "-a",
+ action="store",
+ choices=["affine", "simple"],
+ default="affine",
+ help="The pairwise alignment algorithm that will be used to produce variant calls" \
+ " from the consensus (Quiver only).")
+ advanced.add_argument(
+ "--refineDinucleotideRepeats",
+ dest="refineDinucleotideRepeats",
+ action="store_true",
+ help="Require quiver maximum likelihood search to try one less/more repeat copy in" \
+ " dinucleotide repeats, which seem to be the most frequent cause of suboptimal" \
+ " convergence (getting trapped in local optimum) (Quiver only)")
+ advanced.add_argument(
+ "--noRefineDinucleotideRepeats",
+ dest="refineDinucleotideRepeats",
+ action="store_false",
+ help="Disable dinucleotide refinement")
+ advanced.set_defaults(refineDinucleotideRepeats=True)
+ advanced.add_argument(
+ "--fast",
+ dest="fastMode",
+ action="store_true",
+ help="Cut some corners to run faster. Unsupported!")
+ advanced.add_argument(
+ "--skipUnrecognizedContigs",
+ action="store_true",
+ help="Do not abort when told to process a reference window (via -w/--referenceWindow[s]) " \
+ "that has no aligned coverage. Outputs emptyish files if there are no remaining " \
+ "non-degenerate windows. Only intended for use by smrtpipe scatter/gather.")
+
+ parser.parse_args(namespace=options)
+
+ options.gffOutputFilename = None
+ options.fastaOutputFilename = None
+ options.fastqOutputFilename = None
+ options.csvOutputFilename = None
+
+
+ for outputFilename in options.outputFilenames:
+ fmt = fileFormat(outputFilename)
+ if fmt == "GFF": options.gffOutputFilename = outputFilename
+ elif fmt == "FASTA": options.fastaOutputFilename = outputFilename
+ elif fmt == "FASTQ": options.fastqOutputFilename = outputFilename
+ elif fmt == "CSV": options.csvOutputFilename = outputFilename
+
+ if options.inputFilename.endswith(".bam"):
+ options.usingBam, options.usingCmpH5 = True, False
+ else:
+ options.usingBam, options.usingCmpH5 = False, True
+
+ for path in (options.inputFilename, options.referenceFilename):
+ if path != None:
+ checkInputFile(path)
+
+ for path in options.outputFilenames:
+ if path != None:
+ checkOutputFile(path)
+
+ options.shellCommand = " ".join(sys.argv)
+
+
+def resolveOptions(cmpH5):
+ """
+ Some of the options are provided as strings by the user, but need
+ to be translated into internal identifiers. These options are
+ encoded as options._optionName; here we lookup the ID and store it
+ as options.optionName.
+
+ This is essentially just an order-of-initialization issue.
+ """
+ if options._barcode != None:
+ if not cmpH5.isBarcoded:
+ raise Exception("cmp.h5 file is not barcoded!")
+ if options._barcode not in cmpH5.barcode:
+ raise Exception("Barcode with given name not present in cmp.h5 file!")
+ options.barcode = cmpH5.barcode[options._barcode]
+ else:
+ options.barcode = None
diff --git a/GenomicConsensus/plurality/__init__.py b/GenomicConsensus/plurality/__init__.py
new file mode 100644
index 0000000..effd567
--- /dev/null
+++ b/GenomicConsensus/plurality/__init__.py
@@ -0,0 +1,32 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
diff --git a/GenomicConsensus/plurality/plurality.py b/GenomicConsensus/plurality/plurality.py
new file mode 100644
index 0000000..f275315
--- /dev/null
+++ b/GenomicConsensus/plurality/plurality.py
@@ -0,0 +1,438 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+from __future__ import absolute_import
+
+import math, logging, numpy as np, random
+from itertools import izip
+from collections import Counter
+from ..utils import *
+from .. import reference
+from ..options import options
+from ..Worker import WorkerProcess, WorkerThread
+from ..ResultCollector import ResultCollectorProcess, ResultCollectorThread
+from ..consensus import *
+from ..variants import *
+
+
+#
+# --------------- Configuration ----------------------
+#
+
+class PluralityConfig(object):
+ """
+ Plurality configuration options
+ """
+ def __init__(self,
+ minMapQV=10,
+ minCoverage=3,
+ minConfidence=40,
+ diploid=False,
+ noEvidenceConsensus="nocall"):
+ self.minMapQV = minMapQV
+ self.minCoverage = minCoverage
+ self.minConfidence = minConfidence
+ self.noEvidenceConsensus = noEvidenceConsensus
+ self.diploid = diploid
+ self.realignHomopolymers = False # not available yet
+
+
+#
+# ----------- The actual algorithm code -------------
+#
+
+def pluralityConsensusAndVariants(refWindow, referenceSequenceInWindow, alns,
+ pluralityConfig):
+ """
+ Compute (Consensus, [Variant]) for this window, using the given
+ `alns`, by applying a straightforward column-oriented consensus
+ calling algorithm.
+
+ If the consensus cannot be called for a base, "N" will be placed
+ in the consensus sequence for that position.
+
+ If `realignHomopolymers` is True, alignment gaps will be shuffled
+ in homopolymer regions in an attempt to maximize variant detection
+ sensitivity (not yet implemented, and may never be).
+ """
+ _, refStart, refEnd = refWindow
+ windowSize = refEnd - refStart
+ assert len(referenceSequenceInWindow) == windowSize
+
+ #
+ # Build up these arrays in reference coordinates.
+ #
+ consensusSequence_ = []
+ consensusFrequency_ = []
+ consensusConfidence_ = []
+ effectiveCoverage_ = []
+ alternateAllele_ = [] # DIPLOID ONLY
+ alternateFrequency_ = [] # "
+ heterozygousConfidence_ = [] # "
+
+ noCallCss = Consensus.noCallConsensus(pluralityConfig.noEvidenceConsensus,
+ refWindow, referenceSequenceInWindow)
+
+ baseCallsMatrix = tabulateBaseCalls(refWindow, alns)
+
+ for j in xrange(0, windowSize):
+ counter = Counter(baseCallsMatrix[:, j])
+ if "" in counter: counter.pop("")
+
+ siteEffectiveCoverage = sum(counter.itervalues())
+ if ((siteEffectiveCoverage == 0) or
+ (siteEffectiveCoverage < pluralityConfig.minCoverage)):
+ siteConsensusFrequency = siteEffectiveCoverage
+ siteConsensusSequence = noCallCss.sequence[j]
+ top2 = None
+ else:
+ # Not for production code:
+ top2 = counter.most_common(2)
+ siteConsensusSequence, siteConsensusFrequency = top2[0]
+
+ # Replace explicit gaps with empty string
+ if siteConsensusSequence == "-":
+ siteConsensusSequence = ""
+
+ consensusSequence_.append(siteConsensusSequence)
+ consensusFrequency_.append(siteConsensusFrequency)
+ effectiveCoverage_.append(siteEffectiveCoverage)
+
+ if pluralityConfig.diploid:
+ if top2 and len(top2) > 1:
+ siteAlternateAllele, siteAlternateFrequency = top2[1]
+ else:
+ siteAlternateAllele = "N"
+ siteAlternateFrequency = 0
+ if siteAlternateAllele == "-":
+ siteAlternateAllele = ""
+ alternateAllele_.append(siteAlternateAllele)
+ alternateFrequency_.append(siteAlternateFrequency)
+ else:
+ siteAlternateAllele = "N"
+ siteAlternateFrequency = 0
+
+ siteConsensusConfidence, siteHeterozygousConfidence = \
+ posteriorConfidences(siteEffectiveCoverage,
+ siteConsensusFrequency,
+ siteAlternateFrequency,
+ diploid=pluralityConfig.diploid)
+ consensusConfidence_.append(siteConsensusConfidence)
+ if pluralityConfig.diploid:
+ heterozygousConfidence_.append(siteHeterozygousConfidence)
+
+ #
+ # Derive variants from reference-coordinates consensus
+ #
+ variants = _computeVariants(pluralityConfig,
+ refWindow,
+ referenceSequenceInWindow,
+ effectiveCoverage_,
+ consensusSequence_,
+ consensusFrequency_,
+ consensusConfidence_,
+ alternateAllele_,
+ alternateFrequency_,
+ heterozygousConfidence_)
+ #
+ # Now we need to put everything in consensus coordinates
+ #
+ consensusLens = map(len, consensusSequence_)
+ consensusSequence = "".join(consensusSequence_)
+ consensusConfidence = np.repeat(consensusConfidence_, consensusLens)
+ css = Consensus(refWindow, consensusSequence, consensusConfidence)
+ return (css, variants)
+
+
+def varsFromRefAndRead(refId, refPos, refBase, readSeq, **kwargs):
+ """
+ Compute the haploid/heterozygous Variant[s] corresponding to a
+ readSeq aligned against refSeq.
+
+ Two variant scenario:
+ REF: G
+ READ: AC
+ => insertion(A), substitution(G->C)
+
+ Required: refBase != readSeq
+ Returned: List of Variant objects (length one or two)
+ """
+ assert refBase != readSeq
+ vars = []
+ readBefore, readAt = readSeq[:-1], readSeq[-1:]
+ if readBefore:
+ # Insertion
+ vars.append(Variant(refId, refPos, refPos, "", readBefore, **kwargs))
+ if readAt != refBase:
+ vars.append(Variant(refId, refPos, refPos+1, refBase, readAt, **kwargs))
+ return vars
+
+def varsFromRefAndReads(refId, refPos, refBase,
+ readSeq1, readSeq2, **kwargs):
+ """
+ Heterozygous extension of the above
+ """
+ assert (refBase != readSeq1) or (refBase != readSeq2)
+ vars = []
+ readBefore1, readAt1 = readSeq1[:-1], readSeq1[-1:]
+ readBefore2, readAt2 = readSeq2[:-1], readSeq2[-1:]
+ if readBefore1 or readBefore2:
+ vars.append(Variant(refId, refPos, refPos, "",
+ readBefore1, readBefore2, **kwargs))
+ if readAt1 != refBase or readAt2 != refBase:
+ vars.append(Variant(refId, refPos, refPos+1, refBase,
+ readAt1, readAt2, **kwargs))
+ return vars
+
+
+def _isMixedLengthVariant(v):
+ return (v.isHeterozygous and
+ len(v.readSeq1) != len(v.readSeq2))
+
+def _isSameLengthVariant(v):
+ return not _isMixedLengthVariant(v)
+
+def _computeVariants(config,
+ refWindow,
+ refSequenceInWindow,
+ coverageArray,
+ consensusArray,
+ consensusFrequencyArray,
+ consensusConfidenceArray,
+ alternateAlleleArray=None,
+ alternateAlleleFrequency=None,
+ heterozygousConfidence=None):
+
+ refId, refStart, refEnd = refWindow
+ windowSize = refEnd - refStart
+ assert len(refSequenceInWindow) == windowSize
+ assert len(consensusArray) == windowSize
+ if config.diploid:
+ assert len(alternateAlleleArray) == windowSize
+ assert len(alternateAlleleFrequency) == windowSize
+
+ vars = []
+ for j in xrange(windowSize):
+ refPos = j + refStart
+ refBase = refSequenceInWindow[j]
+ cov = coverageArray[j]
+ cssBases = consensusArray[j]
+ conf = consensusConfidenceArray[j]
+ cssFreq = consensusFrequencyArray[j]
+ if config.diploid:
+ altBases = alternateAlleleArray[j]
+ altFreq = alternateAlleleFrequency[j]
+ hetConf = heterozygousConfidence[j]
+ else:
+ altBases = "N"
+ altFreq = 0
+
+ if cov < config.minCoverage: continue
+
+ if (config.diploid and hetConf > conf):
+ #
+ # Diploid variant[s]?
+ #
+ if (hetConf >= config.minConfidence) and (refBase != "N"):
+ vs = varsFromRefAndReads(refId, refPos, refBase,
+ cssBases, altBases,
+ confidence=hetConf, coverage=cov,
+ frequency1=cssFreq, frequency2=altFreq)
+ vars = vars + vs
+
+ else:
+ #
+ # Haploid variant[s]?
+ #
+ if (conf >= config.minConfidence) and \
+ (refBase != cssBases) and \
+ (refBase != "N") and \
+ (cssBases != "N") and \
+ (cssBases == "" or cssBases.isupper()):
+
+ vs = varsFromRefAndRead(refId, refPos, refBase, cssBases,
+ confidence=conf, coverage=cov,
+ frequency1=cssFreq)
+ vars = vars + vs
+
+ if config.diploid:
+ vars = filter(_isSameLengthVariant, vars)
+ return sorted(vars)
+
+def tabulateBaseCalls(refWindow, alns, realignHomopolymers=False):
+ """
+ Go through the reads and build up the structured baseCallsMatrix
+ table, which tabulates the read bases occurring at each reference
+ coordinate in each read. This code is somewhat tricky, read carefully.
+ """
+ _, refStart, refEnd = refWindow
+ windowSize = refEnd - refStart
+
+ baseCallsMatrix = np.zeros(shape=(len(alns), windowSize), dtype="S8")
+
+ for i, aln in enumerate(alns):
+ aln = aln.clippedTo(refStart, refEnd)
+ alnRef = aln.reference(orientation="genomic")
+ alnRead = aln.read(orientation="genomic")
+ if realignHomopolymers:
+ alnRef, alnRead = normalizeHomopolymerGaps(alnRef, alnRead)
+
+ # Idea: scan through the ref, read; for each non-gap character
+ # in ref, record all non-gap characters seen in read since
+ # last ref gap.
+ readBases = []
+ accum = []
+ for (refBase, readBase) in izip(alnRef, alnRead):
+ if readBase != "-":
+ readBases.append(readBase)
+ if refBase != "-":
+ basesForRefPos = "".join(readBases) if readBases else "-"
+ accum.append(basesForRefPos)
+ readBases = []
+ s, e = (aln.referenceStart - refStart,
+ aln.referenceEnd - refStart)
+ baseCallsMatrix[i, s:e] = accum
+ return baseCallsMatrix
+
+#
+# ------ HACKISH POSTERIOR PROBABILITY CALCULATION ----------
+#
+
+EPS = 0.05
+LOGEPS = np.log(EPS)
+LOG_O_M_EPS = np.log(1-EPS)
+LOG_O_M_EPS_2 = np.log((1-EPS)/2)
+
+def posteriorConfidences(depth, cssFreq, altFreq, diploid=False, cap=40):
+ """
+ Return crude approximations to the posterior probabilities of the
+ genotypes s_1 and s_1/s_2, where s_1 and s_2 are the observed
+ consensus and alternate allele. The assumption here is that the
+ probability of the genotype being anything other that s_1, s_2, or
+ s_1/s_2 is vanishingly small. Not really a very good assumption,
+ but plurality is not our real algorithm anyway.
+ """
+ cssFreq = cssFreq+1
+ altFreq = altFreq+1
+ depth = depth + 2
+ cssLL_ = cssFreq*LOG_O_M_EPS + (depth-cssFreq)*LOGEPS
+ altLL_ = altFreq*LOG_O_M_EPS + (depth-altFreq)*LOGEPS
+ cssL_ = np.exp(cssLL_)
+ altL_ = np.exp(altLL_)
+ if diploid:
+ hetLL_ = (cssFreq+altFreq)*LOG_O_M_EPS_2 + (depth-cssFreq-altFreq)*LOGEPS
+ hetL_ = np.exp(hetLL_)
+ total = cssL_ + altL_ + hetL_
+ hetProb = hetL_/total
+ hetConf = -10*np.log10(1.-hetProb) if (hetProb < 1) else cap
+ else:
+ total = cssL_ + altL_
+ hetConf = 0
+ cssProb = cssL_/total
+ cssConf = -10*np.log10(1.-cssProb) if (cssProb < 1) else cap
+ return int(min(cap, cssConf)), int(min(cap, hetConf))
+
+#
+# -------------- Plurality Worker class --------------------
+#
+
+class PluralityWorker(object):
+
+ @property
+ def pluralityConfig(self):
+ return self._algorithmConfig
+
+ def onStart(self):
+ random.seed(42)
+
+ def onChunk(self, workChunk):
+ referenceWindow = workChunk.window
+ refSeqInWindow = reference.sequenceInWindow(referenceWindow)
+ logging.info("Plurality operating on %s" %
+ reference.windowToString(referenceWindow))
+
+ if not workChunk.hasCoverage:
+ noCallCss = Consensus.noCallConsensus(options.noEvidenceConsensusCall,
+ referenceWindow, refSeqInWindow)
+ return (referenceWindow, (noCallCss, []))
+
+ alnHits = readsInWindow(self._inCmpH5, referenceWindow,
+ depthLimit=options.coverage,
+ minMapQV=options.minMapQV,
+ strategy="longest",
+ stratum=options.readStratum,
+ barcode=options.barcode)
+ return (referenceWindow,
+ pluralityConsensusAndVariants(referenceWindow, refSeqInWindow,
+ alnHits, self.pluralityConfig))
+
+# define both process and thread-based plurality callers
+class PluralityWorkerProcess(PluralityWorker, WorkerProcess): pass
+class PluralityWorkerThread(PluralityWorker, WorkerThread): pass
+
+#
+# --------------------- Plugin API --------------------------------
+#
+
+# Pluggable module API for algorithms:
+# - Algorithm lives in a package
+# - Package must never fail to import, even if some of
+# its dependencies are not installed.
+# - Package must provide a main module exposing these top level
+# variables/methods:
+# - name = str
+# - availability = (bool, str)
+# - configure -> options -> cmph5 -> algorithm specific config object;
+# (can raise IncompatibleDataException)
+# - slaveFactories -> bool -> (class, class)
+
+__all__ = [ "name",
+ "availability",
+ "configure",
+ "slaveFactories" ]
+
+name = "Plurality"
+availability = (True, "OK")
+
+def slaveFactories(threaded):
+ if threaded:
+ return (PluralityWorkerThread, ResultCollectorThread)
+ else:
+ return (PluralityWorkerProcess, ResultCollectorProcess)
+
+def configure(options, cmpH5):
+ pluralityConfig = PluralityConfig(minMapQV=options.minMapQV,
+ minCoverage=options.minCoverage,
+ minConfidence=options.minConfidence,
+ diploid=options.diploid,
+ noEvidenceConsensus=options.noEvidenceConsensusCall)
+ return pluralityConfig
diff --git a/GenomicConsensus/quiver/__init__.py b/GenomicConsensus/quiver/__init__.py
new file mode 100644
index 0000000..d5c4da6
--- /dev/null
+++ b/GenomicConsensus/quiver/__init__.py
@@ -0,0 +1,35 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+import utils
+import model
+import evidence
diff --git a/GenomicConsensus/quiver/diploid.py b/GenomicConsensus/quiver/diploid.py
new file mode 100644
index 0000000..8370441
--- /dev/null
+++ b/GenomicConsensus/quiver/diploid.py
@@ -0,0 +1,224 @@
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+from GenomicConsensus.quiver.utils import allSingleBaseMutations
+from GenomicConsensus.variants import Variant
+
+import numpy as np
+import ConsensusCore as cc
+
+# IUPAC reference:
+# http://www.bioinformatics.org/sms/iupac.html
+
+_packIupac = { ("A", "G") : "R" ,
+ ("G", "A") : "R" ,
+ ("C", "T") : "Y" ,
+ ("T", "C") : "Y" ,
+ ("G", "C") : "S" ,
+ ("C", "G") : "S" ,
+ ("A", "T") : "W" ,
+ ("T", "A") : "W" ,
+ ("G", "T") : "K" ,
+ ("T", "G") : "K" ,
+ ("A", "C") : "M" ,
+ ("C", "A") : "M" }
+
+_unpackIupac = { "R" : ("A", "G") ,
+ "Y" : ("C", "T") ,
+ "S" : ("G", "C") ,
+ "W" : ("A", "T") ,
+ "K" : ("G", "T") ,
+ "M" : ("A", "C") }
+
+def packIUPAC(bases):
+ return _packIupac[bases]
+
+def unpackIUPAC(iupacCode):
+ return _unpackIupac[iupacCode]
+
+def isHeterozygote(base):
+ return (base in _unpackIupac)
+
+def packMuts(cssBase, mut1, mut2):
+ # Turn two muts (with same Start, End, LengthDiff) into a single mutation to
+ # IUPAC. The no-op mutation is coded as None.
+ #
+ # Example1: (_, Subs A, Subs T) -> Subs W
+ # Example2: (_, Ins A, Ins T) -> Ins W
+ # Example3: (A, None, Subs T) -> Subs W
+ #
+ nonNullMut = mut1 or mut2
+ start = nonNullMut.Start()
+ end = nonNullMut.End()
+ mutType = nonNullMut.Type()
+ newBases1 = mut1.NewBases() if mut1 else cssBase
+ newBases2 = mut2.NewBases() if mut2 else cssBase
+ newBasesPacked = packIUPAC((newBases1, newBases2))
+ return cc.Mutation(mutType, start, end, newBasesPacked)
+
+
+def scoresForPosition(mms, pos):
+ muts = allSingleBaseMutations(mms.Template(), positions=[pos])
+ noMutScore = [0] * mms.NumReads()
+ mutScores_ = [ mms.Scores(mut)
+ for mut in muts ]
+ mutScores = np.column_stack([noMutScore] + mutScores_).astype(np.float32)
+ return mutScores
+
+
+def variantsFromConsensus(refWindow, refSequenceInWindow, cssSequenceInWindow,
+ cssQvInWindow=None, siteCoverage=None, aligner="affine",
+ mms=None):
+ """
+ Compare the consensus and the reference in this window, returning
+ a list of variants.
+
+ Uses the mms to identify heterozygous variants.
+ """
+ assert (cssQvInWindow is None) == (siteCoverage is None) # Both or none
+
+ refId, refStart, refEnd = refWindow
+
+ if mms is not None:
+ #
+ # Hunting diploid variants:
+ # 1. find confident heterozygous sites;
+ # 2. build a "diploid consensus" using IUPAC encoding
+ # for het sites; mark cssQv accordingly
+ # 3. align diploid consensus to reference
+ # 4. extract and decorate variants
+ #
+ assert mms.Template() == cssSequenceInWindow
+ iupacMutations = [] # List of (Mutation, confidence)
+ for pos in xrange(0, mms.TemplateLength()):
+ ds = cc.IsSiteHeterozygous(scoresForPosition(mms, pos), 40)
+ if ds:
+ muts = [None] + list(allSingleBaseMutations(cssSequenceInWindow, positions=[pos]))
+ mut0 = muts[ds.Allele0]
+ mut1 = muts[ds.Allele1]
+ cssBase = cssSequenceInWindow[pos]
+ packedMut = packMuts(cssBase, mut0, mut1)
+ iupacMutations.append((packedMut, 40))
+
+ # Create diploidCss by applying mutations, meanwhile updating the
+ # confidence vector accordingly.
+ diploidCss = cc.ApplyMutations([pair[0] for pair in iupacMutations],
+ cssSequenceInWindow)
+
+ diploidQv = list(cssQvInWindow) if cssQvInWindow is not None else None
+
+ runningLengthDiff = 0
+ for (mut, conf) in iupacMutations:
+ start = mut.Start() + runningLengthDiff
+ end = mut.End() + runningLengthDiff
+ diploidQv[start:end] = [conf]
+ assert len(diploidCss) == len(diploidQv)
+
+ cssSequenceInWindow = diploidCss
+ cssQvInWindow = diploidQv
+
+ vars = variantsFromAlignment(refWindow,
+ refSequenceInWindow, cssSequenceInWindow,
+ cssQvInWindow, siteCoverage)
+ return vars
+
+
+def variantsFromAlignment(refWindow, refSeq, cssSeq,
+ cssQV=None, refCoverage=None):
+ """
+ Extract the variants implied by a pairwise alignment of cssSeq to
+ refSeq reference. If cssQV, refCoverage are provided, they will
+ be used to decorate the variants with those attributes.
+
+ Arguments:
+ - cssQV: QV array, same length as css
+ - refCoverage: coverage array, sample length as reference window
+
+ This is trickier than in the haploid case. We have to break out
+ diploid variants as single bases, in order to avoid implying
+ phase.
+ """
+ variants = []
+ refId, refStart, refEnd = refWindow
+
+ aln = cc.AlignAffineIupac(refSeq, cssSeq);
+ alnTarget = aln.Target()
+ alnQuery = aln.Query()
+
+ assert (cssQV is None) == (refCoverage is None) # Both or none
+ assert len(refSeq) == refEnd - refStart
+ assert cssQV is None or len(cssSeq) == len(cssQV)
+ assert refCoverage is None or len(refSeq) == len(refCoverage)
+
+ transcript = [ X if (Q != "N" and T != "N") else "N"
+ for (X, T, Q) in zip(aln.Transcript(),
+ alnTarget,
+ alnQuery) ]
+ variants = []
+ runStart = -1
+ runStartRefPos = None
+ runX = None
+ refPos = refStart
+ for pos, (X, T, Q) in enumerate(zip(transcript,
+ alnTarget,
+ alnQuery)):
+ if X != runX or isHeterozygote(Q):
+ if runStart >= 0 and runX not in "MN":
+ # Package up the run and dump a variant
+ ref = alnTarget[runStart:pos].replace("-", "")
+ read = alnQuery [runStart:pos].replace("-", "")
+ if isHeterozygote(read):
+ allele1, allele2 = unpackIUPAC(read)
+ var = Variant(refId, runStartRefPos, refPos, ref, allele1, allele2)
+ else:
+ var = Variant(refId, runStartRefPos, refPos, ref, read)
+ variants.append(var)
+ runStart = pos
+ runStartRefPos = refPos
+ runX = X
+ if T != "-": refPos += 1
+
+
+ # This might be better handled within the loop above, just keeping
+ # track of Qpos, Tpos
+ if cssQV is not None:
+ cssPosition = cc.TargetToQueryPositions(aln)
+ for v in variants:
+ # HACK ALERT: we are not really handling the confidence or
+ # coverage for variants at last position of the window
+ # correctly here.
+ refPos_ = min(v.refStart-refStart, len(refCoverage)-1)
+ cssPos_ = min(cssPosition[v.refStart-refStart], len(cssQV)-1)
+
+ if refCoverage is not None: v.coverage = refCoverage[refPos_]
+ if cssQV is not None: v.confidence = cssQV[cssPos_]
+
+ return variants
diff --git a/GenomicConsensus/quiver/evidence.py b/GenomicConsensus/quiver/evidence.py
new file mode 100644
index 0000000..f0c615b
--- /dev/null
+++ b/GenomicConsensus/quiver/evidence.py
@@ -0,0 +1,173 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+__all__ = [ "dumpEvidence",
+ "QuiverEvidence" ]
+
+import h5py, logging, os.path, numpy as np
+from collections import namedtuple
+from itertools import groupby
+from bisect import bisect_left, bisect_right
+from pbcore.io import FastaReader, FastaWriter
+from .utils import scoreMatrix
+from .. import reference
+
+def dumpEvidence(evidenceDumpBaseDirectory,
+ refWindow, refSequence, alns,
+ quiverConsensus):
+ # Format of evidence dump:
+ # evidence_dump/
+ # ref000001/
+ # 0-1005/
+ # reference.fa
+ # reads.fa
+ # consensus.fa
+ # quiver-scores.h5
+ # 995-2005/
+ # ...
+ join = os.path.join
+ refId, refStart, refEnd = refWindow
+ refName = reference.idToName(refId)
+ windowDirectory = join(evidenceDumpBaseDirectory,
+ refName,
+ "%d-%d" % (refStart, refEnd))
+ logging.info("Dumping evidence to %s" % (windowDirectory,))
+
+ if os.path.exists(windowDirectory):
+ raise Exception, "Evidence dump does not expect directory %s to exist." % windowDirectory
+ os.makedirs(windowDirectory)
+ refFasta = FastaWriter(join(windowDirectory, "reference.fa"))
+ readsFasta = FastaWriter(join(windowDirectory, "reads.fa"))
+ consensusFasta = FastaWriter(join(windowDirectory, "consensus.fa"))
+
+ windowName = refName + (":%d-%d" % (refStart, refEnd))
+ refFasta.writeRecord(windowName, refSequence)
+ refFasta.close()
+
+ consensusFasta.writeRecord(windowName + "|quiver", quiverConsensus.sequence)
+ consensusFasta.close()
+
+ rowNames, columnNames, baselineScores, scores = scoreMatrix(quiverConsensus.mms)
+ quiverScoreFile = h5py.File(join(windowDirectory, "quiver-scores.h5"))
+ quiverScoreFile.create_dataset("Scores", data=scores)
+ vlen_str = h5py.special_dtype(vlen=str)
+ quiverScoreFile.create_dataset("RowNames", data=rowNames, dtype=vlen_str)
+ quiverScoreFile.create_dataset("ColumnNames", data=columnNames, dtype=vlen_str)
+ quiverScoreFile.create_dataset("BaselineScores", data=baselineScores)
+ quiverScoreFile.close()
+ for aln in alns:
+ readsFasta.writeRecord(str(aln.rowNumber),
+ aln.read(orientation="genomic", aligned=False))
+ readsFasta.close()
+
+
+class QuiverEvidence(object):
+ """
+ An experimental reader class for quiver evidence dumps produced by
+ quiver --dumpEvidence
+ """
+
+ Mutation = namedtuple("Mutation", ("Position", "Type", "FromBase", "ToBase"))
+
+ @staticmethod
+ def _parseMutName(mutName):
+ fields = mutName.split(" ")
+ pos = int(fields[0])
+ type, fromBase, _, toBase = fields[1:]
+ return QuiverEvidence.Mutation(pos, type, fromBase, toBase)
+
+ def __init__(self, path, refStart, consensus, rowNames, colNames, baselineScores, scores):
+ self.path = path
+ self.refStart = refStart
+ self.consensus = consensus
+ self.rowNames = rowNames
+ self.colNames = colNames
+ self.baselineScores = baselineScores
+ self.scores = scores
+ self.muts = map(QuiverEvidence._parseMutName, self.colNames)
+
+ @property
+ def positions(self):
+ return [ mut.Position for mut in self.muts ]
+
+ @property
+ def uniquePositions(self):
+ return sorted(list(set(self.positions)))
+
+ @property
+ def totalScores(self):
+ return self.baselineScores[:, np.newaxis] + self.scores
+
+ @staticmethod
+ def load(path):
+ if path.endswith("/"): path = path[:-1]
+
+ refWin_ = path.split("/")[-1].split("-")
+ refStart = int(refWin_[0])
+
+ with FastaReader(path + "/consensus.fa") as fr:
+ consensus = next(iter(fr)).sequence
+
+ with h5py.File(path + "/quiver-scores.h5", "r") as f:
+ scores = f["Scores"].value
+ baselineScores = f["BaselineScores"].value
+ colNames = f["ColumnNames"].value
+ rowNames = f["RowNames"].value
+ return QuiverEvidence(path, refStart, consensus,
+ rowNames, colNames,
+ baselineScores, scores)
+
+ def forPosition(self, pos):
+ posStart = bisect_left(self.positions, pos)
+ posEnd = bisect_right(self.positions, pos)
+ return QuiverEvidence(self.path,
+ self.refStart,
+ self.consensus,
+ self.rowNames,
+ self.colNames[posStart:posEnd],
+ self.baselineScores,
+ self.scores[:, posStart:posEnd])
+
+
+ def justSubstitutions(self):
+ colMask = np.array(map(lambda s: ("Sub" in s), self.colNames))
+ return QuiverEvidence(self.path,
+ self.refStart,
+ self.consensus,
+ self.rowNames,
+ self.colNames[colMask],
+ self.baselineScores,
+ self.scores[:, colMask])
+
+ def rowNumbers(self):
+ with FastaReader(self.path + "/reads.fa") as fr:
+ return [ int(ctg.name) for ctg in fr ]
diff --git a/GenomicConsensus/quiver/model.py b/GenomicConsensus/quiver/model.py
new file mode 100644
index 0000000..7eedfdd
--- /dev/null
+++ b/GenomicConsensus/quiver/model.py
@@ -0,0 +1,428 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+import numpy as np, ConfigParser, collections, logging
+from glob import glob
+from os.path import join
+from pkg_resources import resource_filename, Requirement
+
+from GenomicConsensus.utils import die
+from GenomicConsensus.quiver.utils import asFloatFeature, fst, snd
+from pbcore.chemistry import ChemistryLookupError
+from pbcore.io import CmpH5Alignment
+import ConsensusCore as cc
+
+__all__ = [ "ParameterSet",
+ "AllQVsModel",
+ "NoMergeQVModel",
+ "NoQVsModel",
+ "InDelQVsModel",
+ "AllQVsMergingByChannelModel",
+ "NoQVsMergingByChannelModel",
+ "QuiverConfig",
+ "allQVsLoaded",
+ "loadParameterSet",
+ "loadQuiverConfig" ]
+
+_basicParameterNames = \
+ [ "Match" ,
+ "Mismatch" , "MismatchS",
+ "Branch" , "BranchS",
+ "DeletionN" ,
+ "DeletionWithTag" , "DeletionWithTagS",
+ "Nce" , "NceS",
+ "Merge" , "MergeS" ]
+
+_mergeByChannelParameterNames = \
+ [ "Match" ,
+ "Mismatch" , "MismatchS",
+ "Branch" , "BranchS",
+ "DeletionN" ,
+ "DeletionWithTag" , "DeletionWithTagS",
+ "Nce" , "NceS",
+ "Merge_A" , "Merge_C",
+ "Merge_G" , "Merge_T",
+ "MergeS_A" , "MergeS_C",
+ "MergeS_G" , "MergeS_T" ]
+
+ALL_FEATURES = [ "InsertionQV" ,
+ "SubstitutionQV" ,
+ "DeletionQV" ,
+ "DeletionTag" ,
+ "MergeQV" ]
+
+
+#
+# Model classes
+#
+
+class Model(object):
+
+ requiredFeatures = set([])
+ parameterNames = []
+
+ @classmethod
+ def isCompatibleWithCmpH5(cls, cmpH5):
+ return all(cmpH5.hasPulseFeature(feature) for feature in cls.requiredFeatures)
+
+ @classmethod
+ def extractFeatures(cls, aln):
+ """
+ Extract the data in a cmp.h5 alignment record into a
+ ConsensusCore-friendly `QvSequenceFeatures` object. Will
+ extract only the features relevant to this Model, zero-filling
+ the other features arrays.
+ """
+ if isinstance(aln, CmpH5Alignment):
+ #
+ # For cmp.h5 input, we have to use the AlnArray to see where the
+ # gaps are (see bug 20752), in order to support old files.
+ #
+ alnRead = np.fromstring(aln.read(), dtype=np.int8)
+ gapMask = alnRead == ord("-")
+ _args = [ alnRead[~gapMask].tostring() ]
+ for feature in ALL_FEATURES:
+ if feature in cls.requiredFeatures:
+ _args.append(asFloatFeature(aln.pulseFeature(feature)[~gapMask]))
+ else:
+ _args.append(cc.FloatFeature(int(aln.readLength)))
+ return cc.QvSequenceFeatures(*_args)
+
+ else:
+ _args = [ aln.read(aligned=False, orientation="native") ]
+ for feature in ALL_FEATURES:
+ if feature in cls.requiredFeatures:
+ _args.append(asFloatFeature(aln.pulseFeature(feature, aligned=False)))
+ else:
+ _args.append(cc.FloatFeature(int(aln.readLength)))
+ return cc.QvSequenceFeatures(*_args)
+
+
+
+ @classmethod
+ def extractMappedRead(cls, aln, windowStart):
+ """
+ Given a clipped alignment, convert its coordinates into template
+ space (starts with 0), bundle it up with its features as a
+ MappedRead.
+ """
+ assert aln.referenceSpan > 0
+ name = str(aln.rowNumber)
+ chemistry = chemOrUnknown(aln)
+ read = cc.Read(cls.extractFeatures(aln), name, chemistry)
+ return cc.MappedRead(read,
+ int(aln.isReverseStrand),
+ int(aln.referenceStart - windowStart),
+ int(aln.referenceEnd - windowStart))
+
+class AllQVsModel(Model):
+ name = "AllQVsModel"
+ rank = 3
+ requiredFeatures = { "InsertionQV", "SubstitutionQV",
+ "DeletionQV" , "DeletionTag" , "MergeQV" }
+ parameterNames = _basicParameterNames
+
+class NoMergeQVModel(Model):
+ name = "NoMergeQVModel"
+ rank = 2
+ requiredFeatures = { "InsertionQV", "SubstitutionQV",
+ "DeletionQV" , "DeletionTag" }
+ parameterNames = _basicParameterNames
+
+class NoQVsModel(Model):
+ name = "NoQVsModel"
+ rank = 1
+ requiredFeatures = set([])
+ parameterNames = _basicParameterNames
+
+class AllQVsMergingByChannelModel(Model):
+ name = "AllQVsMergingByChannelModel"
+ rank = 4
+ requiredFeatures = AllQVsModel.requiredFeatures
+ parameterNames = _mergeByChannelParameterNames
+
+class NoQVsMergingByChannelModel(Model):
+ name = "NoQVsMergingByChannelModel"
+ rank = -1
+ requiredFeatures = set([])
+ parameterNames = _mergeByChannelParameterNames
+
+class InDelQVsModel(Model):
+ name = "InDelQVsModel"
+ rank = -1
+ requiredFeatures = { "InsertionQV", "DeletionQV", "DeletionTag" }
+ parameterNames = _mergeByChannelParameterNames
+
+
+#
+# Code for accessing the ConsensusCore quiver parameter sets
+# from the .ini config file.
+#
+
+class ParameterSet(object):
+ def __init__(self, name, model, chemistry, ccQuiverConfig):
+ self.name = name
+ self.chemistry = chemistry
+ self.model = model
+ self.ccQuiverConfig = ccQuiverConfig
+
+def _getResourcesDirectory():
+ return resource_filename(Requirement.parse("GenomicConsensus"),
+ "GenomicConsensus/quiver/resources")
+
+def chemOrUnknown(aln):
+ """
+ Chemistry if it's loaded, otherwise "unknown"
+ (If chemistry wasn't loaded, user must have manually selected parameter set)
+ """
+ try:
+ chemistry = aln.sequencingChemistry
+ except ChemistryLookupError:
+ chemistry = "unknown"
+ return chemistry
+
+def _isChemistryMixSupported(allChems):
+ return len(allChems) == 1 or set(allChems).issubset(set(["C2", "P4-C2", "P5-C3", "P6-C4"]))
+
+def _findParametersFile(filenameOrDirectory=None):
+ if filenameOrDirectory is None:
+ filenameOrDirectory = _getResourcesDirectory()
+
+ # Given a full path to an .ini file, return the path
+ if filenameOrDirectory.endswith(".ini"):
+ return filenameOrDirectory
+
+ # Given a path to a bundle (the directory with a date as its
+ # name), return the path to the .ini file within
+ foundInThisBundle = glob(join(filenameOrDirectory,
+ "GenomicConsensus/QuiverParameters.ini"))
+ if foundInThisBundle:
+ return foundInThisBundle[0]
+
+ # Given a directory containing bundles, return the path to the
+ # .ini file within the lexically largest bundle subdirectory
+ foundInBundlesBelow = glob(join(filenameOrDirectory,
+ "*/GenomicConsensus/QuiverParameters.ini"))
+ if foundInBundlesBelow:
+ return sorted(foundInBundlesBelow)[-1]
+
+ raise ValueError("Unable to find parameter set file (QuiverParameters.ini)")
+
+def _buildParameterSet(parameterSetName, nameValuePairs):
+ chem, modelName = parameterSetName.split(".")[:2]
+ if modelName == "AllQVsModel": model = AllQVsModel
+ elif modelName == "NoMergeQVModel": model = NoMergeQVModel
+ elif modelName == "NoQVsModel": model = NoQVsModel
+ elif modelName == "AllQVsMergingByChannelModel": model = AllQVsMergingByChannelModel
+ elif modelName == "NoQVsMergingByChannelModel": model = NoQVsMergingByChannelModel
+ else:
+ logging.error("Found parameter set for unrecognized model: %s" % modelName)
+ return None
+
+ if map(fst, nameValuePairs) != model.parameterNames:
+ die("Malformed parameter set file")
+
+ qvModelParams = cc.QvModelParams(chem, modelName,
+ *[ float(snd(pair)) for pair in nameValuePairs ])
+
+ #
+ # Dirty hack for --diploid support, diploid model is scaled
+ # differently. Needs further work.
+ #
+ if parameterSetName == "unknown.NoQVsModel":
+ bandingOptions = cc.BandingOptions(4, 24)
+ fastScoreThreshold = -50
+ else:
+ bandingOptions = cc.BandingOptions(4, 6)
+ fastScoreThreshold = -12.5
+
+ quiverConfig = cc.QuiverConfig(qvModelParams,
+ cc.ALL_MOVES,
+ bandingOptions,
+ fastScoreThreshold)
+ return ParameterSet(parameterSetName, model, chem, quiverConfig)
+
+def _loadParameterSets(iniFilename):
+ # returns dict: name -> ParameterSet
+ cp = ConfigParser.ConfigParser()
+ cp.optionxform=str
+ cp.read([iniFilename])
+ sections = cp.sections()
+ parameterSets = {}
+ for sectionName in sections:
+ parameterSet = _buildParameterSet(sectionName, cp.items(sectionName))
+ if parameterSet:
+ parameterSets[sectionName] = parameterSet
+ return parameterSets
+
+def _bestParameterSet(parameterSets, chemistry, qvsAvailable):
+ fallbackParameterSets = \
+ [ paramSet for paramSet in parameterSets.itervalues()
+ if paramSet.chemistry == "unknown"
+ if paramSet.model.requiredFeatures.issubset(qvsAvailable) ]
+ perChemistryParameterSets = \
+ [ paramSet for paramSet in parameterSets.itervalues()
+ if paramSet.chemistry == chemistry
+ if paramSet.model.requiredFeatures.issubset(qvsAvailable) ]
+ # Find the best one, under the assumption that a chemistry-trained
+ # parameter set is always better than the "unknown" chemistry set.
+ if perChemistryParameterSets:
+ return max(perChemistryParameterSets, key=lambda ps: ps.model.rank)
+ elif fallbackParameterSets:
+ return max(fallbackParameterSets, key=lambda ps: ps.model.rank)
+ else:
+ raise Exception("Quiver: No applicable parameter set found!")
+
+
+#
+# QuiverConfig: the kitchen sink class of quiver options
+#
+
+class QuiverConfig(object):
+ """
+ Quiver configuration options
+ """
+ def __init__(self,
+ parameterSets,
+ minMapQV=10,
+ minPoaCoverage=3,
+ maxPoaCoverage=11,
+ mutationSeparation=10,
+ mutationNeighborhood=20,
+ maxIterations=40,
+ refineDinucleotideRepeats=True,
+ noEvidenceConsensus="nocall",
+ computeConfidence=True,
+ readStumpinessThreshold=0.1):
+
+ self.minMapQV = minMapQV
+ self.minPoaCoverage = minPoaCoverage
+ self.maxPoaCoverage = maxPoaCoverage
+ self.mutationSeparation = mutationSeparation
+ self.mutationNeighborhood = mutationNeighborhood
+ self.maxIterations = maxIterations
+ self.refineDinucleotideRepeats = refineDinucleotideRepeats
+ self.noEvidenceConsensus = noEvidenceConsensus
+ self.computeConfidence = computeConfidence
+ self.readStumpinessThreshold = readStumpinessThreshold
+ self.parameterSets = parameterSets
+ qct = cc.QuiverConfigTable()
+ for (chem, pset) in self.parameterSets.items():
+ if chem == "*":
+ qct.InsertDefault(pset.ccQuiverConfig)
+ else:
+ qct.InsertAs(chem, pset.ccQuiverConfig)
+ self.ccQuiverConfigTbl = qct
+
+ @staticmethod
+ def _defaultQuiverParameters():
+ return loadQuiverConfig("unknown.NoQVsModel")
+
+ def extractMappedRead(self, aln, windowStart):
+ pset = self.parameterSets.get(chemOrUnknown(aln)) or \
+ self.parameterSets.get("*")
+ model = pset.model
+ return model.extractMappedRead(aln, windowStart)
+
+#
+# Convenience functions
+#
+
+def allQVsLoaded(cmpH5):
+ """
+ Does this cmp.h5 file have the complete set of QV features?
+ """
+ return AllQVsModel.isCompatibleWithCmpH5(cmpH5)
+
+def enoughQVsLoaded(cmpH5):
+ """
+ If lacking QVs other than possibly the Merge QV, we should abort.
+ This is the check.
+ """
+ return NoMergeQVModel.isCompatibleWithCmpH5(cmpH5)
+
+
+def loadParameterSets(parametersFile=None, spec=None, cmpH5=None):
+ """
+ spec is either:
+ - chemName.modelName (complete spec),
+ - chemName
+ - None
+ If the spec is incomplete, cmpH5 is required to determine the best
+ available option.
+
+ Returned value is a dict of completeSpec -> QuiverConfig
+ """
+ if spec is None:
+ chemistryName, modelName = None, None
+ elif "." in spec:
+ chemistryName, modelName = spec.split(".")
+ else:
+ chemistryName, modelName = spec, None
+ assert cmpH5 or (chemistryName and modelName)
+
+ parametersFile = _findParametersFile(parametersFile)
+ logging.info("Using Quiver parameters file %s" % parametersFile)
+ sets = _loadParameterSets(parametersFile)
+
+ if chemistryName and modelName:
+ try:
+ p = sets[spec]
+ params = { "*" : p }
+ except:
+ die("Quiver: no available parameter set named %s" % \
+ spec)
+ elif chemistryName:
+ qvsAvailable = cmpH5.pulseFeaturesAvailable()
+ p = _bestParameterSet(sets, chemistryName, qvsAvailable)
+ if p.chemistry != chemistryName:
+ die("Quiver: no parameter set available compatible with this " + \
+ "cmp.h5 for chemistry \"%s\" " % chemistryName)
+ params = { "*" : p }
+ else:
+ chemistryNames = list(set(cmpH5.sequencingChemistry)) # uniquify
+ if "unknown" in chemistryNames:
+ die("\"unknown\" chemistry in alignment file: either an unsupported chemistry " +
+ "has been used, the alignment file has been improperly constructed, or " +
+ "this version of SMRTanalysis is too old to recognize a new chemistry.")
+ if not _isChemistryMixSupported(chemistryNames):
+ die("Unsupported chemistry mix, cannot proceed.")
+ qvsAvailable = cmpH5.pulseFeaturesAvailable()
+ bestParams = [ _bestParameterSet(sets, chemistryName, qvsAvailable)
+ for chemistryName in chemistryNames ]
+ params = dict(zip(chemistryNames, bestParams))
+
+ return params
+
+def loadQuiverConfig(spec=None, cmpH5=None, parametersFile=None, **quiverConfigOpts):
+ params = loadParameterSets(parametersFile, spec, cmpH5)
+ return QuiverConfig(parameterSets=params, **quiverConfigOpts)
diff --git a/GenomicConsensus/quiver/quiver.py b/GenomicConsensus/quiver/quiver.py
new file mode 100644
index 0000000..6e2f674
--- /dev/null
+++ b/GenomicConsensus/quiver/quiver.py
@@ -0,0 +1,282 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+import logging
+import ConsensusCore as cc, numpy as np
+
+from .. import reference
+from ..options import options
+from ..Worker import WorkerProcess, WorkerThread
+from ..ResultCollector import ResultCollectorProcess, ResultCollectorThread
+
+from GenomicConsensus.consensus import Consensus, QuiverConsensus, join
+from GenomicConsensus.windows import kSpannedIntervals, holes, subWindow
+from GenomicConsensus.variants import filterVariants, annotateVariants
+from GenomicConsensus.quiver.evidence import dumpEvidence
+from GenomicConsensus.quiver import diploid
+
+import GenomicConsensus.quiver.model as M
+import GenomicConsensus.quiver.utils as U
+
+def consensusAndVariantsForWindow(cmpH5, refWindow, referenceContig,
+ depthLimit, quiverConfig):
+ """
+ High-level routine for calling the consensus for a
+ window of the genome given a cmp.h5.
+
+ Identifies the coverage contours of the window in order to
+ identify subintervals where a good consensus can be called.
+ Creates the desired "no evidence consensus" where there is
+ inadequate coverage.
+ """
+ winId, winStart, winEnd = refWindow
+ logging.info("Quiver operating on %s" %
+ reference.windowToString(refWindow))
+
+ if options.fancyChunking:
+ # 1) identify the intervals with adequate coverage for quiver
+ # consensus; restrict to intervals of length > 10
+ alnHits = U.readsInWindow(cmpH5, refWindow,
+ minMapQV=quiverConfig.minMapQV,
+ strategy="longest",
+ stratum=options.readStratum,
+ barcode=options.barcode)
+ starts = np.fromiter((hit.tStart for hit in alnHits), np.int)
+ ends = np.fromiter((hit.tEnd for hit in alnHits), np.int)
+ intervals = kSpannedIntervals(refWindow, quiverConfig.minPoaCoverage,
+ starts, ends, minLength=10)
+ coverageGaps = holes(refWindow, intervals)
+ allIntervals = sorted(intervals + coverageGaps)
+ if len(allIntervals) > 1:
+ logging.info("Usable coverage in %s: %r" %
+ (reference.windowToString(refWindow), intervals))
+
+ else:
+ allIntervals = [ (winStart, winEnd) ]
+
+ # 2) pull out the reads we will use for each interval
+ # 3) call consensusForAlignments on the interval
+ subConsensi = []
+ variants = []
+
+ for interval in allIntervals:
+ intStart, intEnd = interval
+ intRefSeq = referenceContig[intStart:intEnd]
+ subWin = subWindow(refWindow, interval)
+
+ windowRefSeq = referenceContig[intStart:intEnd]
+ alns = U.readsInWindow(cmpH5, subWin,
+ depthLimit=depthLimit,
+ minMapQV=quiverConfig.minMapQV,
+ strategy="longest",
+ stratum=options.readStratum,
+ barcode=options.barcode)
+ clippedAlns_ = [ aln.clippedTo(*interval) for aln in alns ]
+ clippedAlns = U.filterAlns(subWin, clippedAlns_, quiverConfig)
+
+ if len([ a for a in clippedAlns
+ if a.spansReferenceRange(*interval) ]) >= quiverConfig.minPoaCoverage:
+
+ logging.debug("%s: Reads being used: %s" %
+ (reference.windowToString(subWin),
+ " ".join([str(hit.rowNumber) for hit in alns])))
+
+ css = U.consensusForAlignments(subWin,
+ intRefSeq,
+ clippedAlns,
+ quiverConfig)
+
+ siteCoverage = U.coverageInWindow(subWin, alns)
+
+ if options.diploid:
+ variants_ = diploid.variantsFromConsensus(subWin, windowRefSeq,
+ css.sequence, css.confidence, siteCoverage,
+ options.aligner,
+ css.mms)
+ else:
+ variants_ = U.variantsFromConsensus(subWin, windowRefSeq,
+ css.sequence, css.confidence, siteCoverage,
+ options.aligner,
+ mms=None)
+
+ filteredVars = filterVariants(options.minCoverage,
+ options.minConfidence,
+ variants_)
+ # Annotate?
+ if options.annotateGFF:
+ annotateVariants(filteredVars, clippedAlns)
+
+ variants += filteredVars
+
+ # Dump?
+ shouldDumpEvidence = \
+ ((options.dumpEvidence == "all") or
+ (options.dumpEvidence == "variants") and (len(variants) > 0))
+ if shouldDumpEvidence:
+ dumpEvidence(options.evidenceDirectory,
+ subWin, windowRefSeq,
+ clippedAlns, css)
+ else:
+ css = QuiverConsensus.noCallConsensus(quiverConfig.noEvidenceConsensus,
+ subWin, intRefSeq)
+ subConsensi.append(css)
+
+ # 4) glue the subwindow consensus objects together to form the
+ # full window consensus
+ css = join(subConsensi)
+
+ # 5) Return
+ return css, variants
+
+
+class QuiverWorker(object):
+
+ @property
+ def quiverConfig(self):
+ return self._algorithmConfig
+
+ def onChunk(self, workChunk):
+ referenceWindow = workChunk.window
+ refId, refStart, refEnd = referenceWindow
+
+ refSeqInWindow = reference.sequenceInWindow(referenceWindow)
+
+ # Quick cutout for no-coverage case
+ if not workChunk.hasCoverage:
+ noCallCss = QuiverConsensus.noCallConsensus(self.quiverConfig.noEvidenceConsensus,
+ referenceWindow, refSeqInWindow)
+ return (referenceWindow, (noCallCss, []))
+
+ # General case
+ eWindow = reference.enlargedReferenceWindow(referenceWindow,
+ options.referenceChunkOverlap)
+ _, eStart, eEnd = eWindow
+
+ # We call consensus on the enlarged window and then map back
+ # to the reference and clip the consensus at the implied
+ # bounds. This seems to be more reliable thank cutting the
+ # consensus bluntly
+ refContig = reference.byId[refId].sequence
+ refSequenceInEnlargedWindow = refContig[eStart:eEnd]
+
+ #
+ # Get the consensus for the enlarged window.
+ #
+ css_, variants_ = \
+ consensusAndVariantsForWindow(self._inCmpH5, eWindow,
+ refContig, options.coverage, self.quiverConfig)
+
+ #
+ # Restrict the consensus and variants to the reference window.
+ #
+ ga = cc.Align(refSequenceInEnlargedWindow, css_.sequence)
+ targetPositions = cc.TargetToQueryPositions(ga)
+ cssStart = targetPositions[refStart-eStart]
+ cssEnd = targetPositions[refEnd-eStart]
+
+ cssSequence = css_.sequence[cssStart:cssEnd]
+ cssQv = css_.confidence[cssStart:cssEnd]
+ variants = [ v for v in variants_
+ if refStart <= v.refStart < refEnd ]
+
+ consensusObj = Consensus(referenceWindow,
+ cssSequence,
+ cssQv)
+
+ return (referenceWindow, (consensusObj, variants))
+
+
+
+#
+# Slave process/thread classes
+#
+class QuiverWorkerProcess(QuiverWorker, WorkerProcess): pass
+class QuiverWorkerThread(QuiverWorker, WorkerThread): pass
+
+
+#
+# Plugin API
+#
+__all__ = [ "name",
+ "availability",
+ "configure",
+ "slaveFactories" ]
+
+name = "Quiver"
+availability = (True, "OK")
+
+def configure(options, cmpH5):
+ if options.verbosity > 1:
+ cc.Logging.EnableDiagnosticLogging()
+
+ if cmpH5.readType != "standard":
+ raise U.IncompatibleDataException(
+ "The Quiver algorithm requires a cmp.h5 file containing standard (non-CCS) reads." )
+
+ if options.parametersSpec == "auto":
+ if options.diploid:
+ logging.info("Diploid analysis--resorting to unknown.NoQVsModel until other " +
+ "parameter sets can be recalibrated.")
+ params = M.loadParameterSets(options.parametersFile, spec="unknown.NoQVsModel")
+ else:
+ params = M.loadParameterSets(options.parametersFile, cmpH5=cmpH5)
+ qvMsg = "This .cmp.h5 file lacks some of the QV data tracks that are required " + \
+ "for optimal performance of the Quiver algorithm. For optimal results" + \
+ " use the ResequencingQVs workflow in SMRTPortal with bas.h5 files " + \
+ "from an instrument using software version 1.3.1 or later, or the " + \
+ "--forQuiver option to pbalign."
+ if not M.enoughQVsLoaded(cmpH5):
+ raise U.IncompatibleDataException(qvMsg)
+ elif not M.allQVsLoaded(cmpH5):
+ logging.warn(qvMsg)
+ else:
+ params = M.loadParameterSets(options.parametersFile,
+ spec=options.parametersSpec,
+ cmpH5=cmpH5)
+ if not all(ps.model.isCompatibleWithCmpH5(cmpH5) for ps in params.values()):
+ raise U.IncompatibleDataException(
+ "Selected Quiver parameter set is incompatible with this cmp.h5 file " +
+ "due to missing data tracks.")
+
+ logging.info("Using Quiver parameter set(s): %s" % (", ".join(ps.name for ps in params.values())))
+ return M.QuiverConfig(minMapQV=options.minMapQV,
+ noEvidenceConsensus=options.noEvidenceConsensusCall,
+ refineDinucleotideRepeats=(not options.fastMode) and options.refineDinucleotideRepeats,
+ computeConfidence=(not options.fastMode),
+ parameterSets=params)
+
+def slaveFactories(threaded):
+ # By default we use slave processes. The tuple ordering is important.
+ if threaded:
+ return (QuiverWorkerThread, ResultCollectorThread)
+ else:
+ return (QuiverWorkerProcess, ResultCollectorProcess)
diff --git a/GenomicConsensus/quiver/resources/2013-03/GenomicConsensus/QuiverParameters.ini b/GenomicConsensus/quiver/resources/2013-03/GenomicConsensus/QuiverParameters.ini
new file mode 100644
index 0000000..ef29ef0
--- /dev/null
+++ b/GenomicConsensus/quiver/resources/2013-03/GenomicConsensus/QuiverParameters.ini
@@ -0,0 +1,128 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+#
+# Parameters for Quiver for different modeling and chemistry /
+# upstream analysis conditions.
+#
+# Author: David Alexander
+# Date: 2/12/2013
+#
+
+#
+# C2 chemistry
+#
+[C2.AllQVsModel]
+Match = 0.2627555
+Mismatch = -1.09688872
+MismatchS = -0.01637988
+Branch = -0.60275947
+BranchS = -0.02682689
+DeletionN = -1.00012494
+DeletionWithTag = 0.06000148
+DeletionWithTagS = -0.02579358
+Nce = -0.15864559
+NceS = -0.04403654
+Merge = -1.02398814
+MergeS = -0.12135255
+
+[C2.NoMergeQVModel]
+Match = -0.032017275750000004
+Mismatch = -0.9773427825000001
+MismatchS = -0.01119015225
+Branch = -0.630141005
+BranchS = -0.0347192135
+DeletionN = -0.7697154425
+DeletionWithTag = -0.0003786080875
+DeletionWithTagS = -0.02546157775
+Nce = -0.21589032625
+NceS = -0.04661514775
+Merge = -1.0336790425
+MergeS = 0.0
+
+[C2.NoQVsModel]
+Match = 0.0
+Mismatch = -1.21730327606
+MismatchS = 0.0
+Branch = -0.371355384588
+BranchS = 0.0
+DeletionN = -0.250208973885
+DeletionWithTag = 0.0
+DeletionWithTagS = 0.0
+Nce = -0.250370770693
+NceS = 0.0
+Merge = -0.371355384588
+MergeS = 0.0
+
+#
+# These are the models used when the chemistry is not recognized. For
+# now, we fall back to the C2 parameters.
+#
+[unknown.AllQVsModel]
+Match = 0.2627555
+Mismatch = -1.09688872
+MismatchS = -0.01637988
+Branch = -0.60275947
+BranchS = -0.02682689
+DeletionN = -1.00012494
+DeletionWithTag = 0.06000148
+DeletionWithTagS = -0.02579358
+Nce = -0.15864559
+NceS = -0.04403654
+Merge = -1.02398814
+MergeS = -0.12135255
+
+[unknown.NoMergeQVModel]
+Match = -0.032017275750000004
+Mismatch = -0.9773427825000001
+MismatchS = -0.01119015225
+Branch = -0.630141005
+BranchS = -0.0347192135
+DeletionN = -0.7697154425
+DeletionWithTag = -0.0003786080875
+DeletionWithTagS = -0.02546157775
+Nce = -0.21589032625
+NceS = -0.04661514775
+Merge = -1.0336790425
+MergeS = 0.0
+
+[unknown.NoQVsModel]
+Match = 0.0
+Mismatch = -1.21730327606
+MismatchS = 0.0
+Branch = -0.371355384588
+BranchS = 0.0
+DeletionN = -0.250208973885
+DeletionWithTag = 0.0
+DeletionWithTagS = 0.0
+Nce = -0.250370770693
+NceS = 0.0
+Merge = -0.371355384588
+MergeS = 0.0
diff --git a/GenomicConsensus/quiver/resources/2013-05/GenomicConsensus/QuiverParameters.ini b/GenomicConsensus/quiver/resources/2013-05/GenomicConsensus/QuiverParameters.ini
new file mode 100644
index 0000000..42115e5
--- /dev/null
+++ b/GenomicConsensus/quiver/resources/2013-05/GenomicConsensus/QuiverParameters.ini
@@ -0,0 +1,151 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+#
+# Parameters for Quiver for different modeling and chemistry /
+# upstream analysis conditions.
+#
+# Author: David Alexander
+# Date: 2/12/2013
+#
+
+#
+# C2 chemistry
+#
+[C2.AllQVsModel]
+Match = 0.2627555
+Mismatch = -1.09688872
+MismatchS = -0.01637988
+Branch = -0.60275947
+BranchS = -0.02682689
+DeletionN = -1.00012494
+DeletionWithTag = 0.06000148
+DeletionWithTagS = -0.02579358
+Nce = -0.15864559
+NceS = -0.04403654
+Merge = -1.02398814
+MergeS = -0.12135255
+
+[C2.NoMergeQVModel]
+Match = -0.032017275750000004
+Mismatch = -0.9773427825000001
+MismatchS = -0.01119015225
+Branch = -0.630141005
+BranchS = -0.0347192135
+DeletionN = -0.7697154425
+DeletionWithTag = -0.0003786080875
+DeletionWithTagS = -0.02546157775
+Nce = -0.21589032625
+NceS = -0.04661514775
+Merge = -1.0336790425
+MergeS = 0.0
+
+[C2.NoQVsModel]
+Match = 0.0
+Mismatch = -1.21730327606
+MismatchS = 0.0
+Branch = -0.371355384588
+BranchS = 0.0
+DeletionN = -0.250208973885
+DeletionWithTag = 0.0
+DeletionWithTagS = 0.0
+Nce = -0.250370770693
+NceS = 0.0
+Merge = -0.371355384588
+MergeS = 0.0
+
+#
+# P4-C2 chemistry
+#
+[P4-C2.AllQVsMergingByChannelModel]
+Match = 0.266887694127
+Mismatch = -1.54460829977
+MismatchS = -0.0316527466982
+Branch = -0.578688017857
+BranchS = -0.0481504371325
+DeletionN = -1.30511780446
+DeletionWithTag = 0.023543148334
+DeletionWithTagS = -0.044525216376
+Nce = -0.11981002833
+NceS = -0.094850201311
+Merge_A = -0.719390215369
+Merge_C = 0.0637508742437
+Merge_G = 0.244651896573
+Merge_T = -0.627109496237
+MergeS_A = -0.0168917301257
+MergeS_C = -0.0769984152015
+MergeS_G = -0.0862808988248
+MergeS_T = -0.137076261104
+
+#
+# These are the models used when the chemistry is not recognized. For
+# now, we fall back to the C2 parameters.
+#
+[unknown.AllQVsModel]
+Match = 0.2627555
+Mismatch = -1.09688872
+MismatchS = -0.01637988
+Branch = -0.60275947
+BranchS = -0.02682689
+DeletionN = -1.00012494
+DeletionWithTag = 0.06000148
+DeletionWithTagS = -0.02579358
+Nce = -0.15864559
+NceS = -0.04403654
+Merge = -1.02398814
+MergeS = -0.12135255
+
+[unknown.NoMergeQVModel]
+Match = -0.032017275750000004
+Mismatch = -0.9773427825000001
+MismatchS = -0.01119015225
+Branch = -0.630141005
+BranchS = -0.0347192135
+DeletionN = -0.7697154425
+DeletionWithTag = -0.0003786080875
+DeletionWithTagS = -0.02546157775
+Nce = -0.21589032625
+NceS = -0.04661514775
+Merge = -1.0336790425
+MergeS = 0.0
+
+[unknown.NoQVsModel]
+Match = 0.0
+Mismatch = -4.6
+MismatchS = 0.0
+Branch = -2.4
+BranchS = 0.0
+DeletionN = -3.25
+DeletionWithTag = 0.0
+DeletionWithTagS = 0.0
+Nce = -2.45
+NceS = 0.0
+Merge = -3.2
+MergeS = 0.0
diff --git a/GenomicConsensus/quiver/resources/2013-09/GenomicConsensus/QuiverParameters.ini b/GenomicConsensus/quiver/resources/2013-09/GenomicConsensus/QuiverParameters.ini
new file mode 100644
index 0000000..a54c596
--- /dev/null
+++ b/GenomicConsensus/quiver/resources/2013-09/GenomicConsensus/QuiverParameters.ini
@@ -0,0 +1,174 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+#
+# Parameters for Quiver for different modeling and chemistry /
+# upstream analysis conditions.
+#
+# Author: David Alexander
+# Date: 2/12/2013
+#
+
+#
+# C2 chemistry
+#
+[C2.AllQVsModel]
+Match = 0.2627555
+Mismatch = -1.09688872
+MismatchS = -0.01637988
+Branch = -0.60275947
+BranchS = -0.02682689
+DeletionN = -1.00012494
+DeletionWithTag = 0.06000148
+DeletionWithTagS = -0.02579358
+Nce = -0.15864559
+NceS = -0.04403654
+Merge = -1.02398814
+MergeS = -0.12135255
+
+[C2.NoMergeQVModel]
+Match = -0.032017275750000004
+Mismatch = -0.9773427825000001
+MismatchS = -0.01119015225
+Branch = -0.630141005
+BranchS = -0.0347192135
+DeletionN = -0.7697154425
+DeletionWithTag = -0.0003786080875
+DeletionWithTagS = -0.02546157775
+Nce = -0.21589032625
+NceS = -0.04661514775
+Merge = -1.0336790425
+MergeS = 0.0
+
+[C2.NoQVsModel]
+Match = 0.0
+Mismatch = -1.21730327606
+MismatchS = 0.0
+Branch = -0.371355384588
+BranchS = 0.0
+DeletionN = -0.250208973885
+DeletionWithTag = 0.0
+DeletionWithTagS = 0.0
+Nce = -0.250370770693
+NceS = 0.0
+Merge = -0.371355384588
+MergeS = 0.0
+
+#
+# P4-C2 chemistry
+#
+[P4-C2.AllQVsMergingByChannelModel]
+Match = 0.266887694127
+Mismatch = -1.54460829977
+MismatchS = -0.0316527466982
+Branch = -0.578688017857
+BranchS = -0.0481504371325
+DeletionN = -1.30511780446
+DeletionWithTag = 0.023543148334
+DeletionWithTagS = -0.044525216376
+Nce = -0.11981002833
+NceS = -0.094850201311
+Merge_A = -0.719390215369
+Merge_C = 0.0637508742437
+Merge_G = 0.244651896573
+Merge_T = -0.627109496237
+MergeS_A = -0.0168917301257
+MergeS_C = -0.0769984152015
+MergeS_G = -0.0862808988248
+MergeS_T = -0.137076261104
+
+#
+# P5-C3 chemistry
+#
+[P5-C3.AllQVsMergingByChannelModel]
+Match = 0.622352656797
+Mismatch = -0.562488732923
+MismatchS = -0.00841054902241
+Branch = -0.43638090639
+BranchS = -0.0561792950471
+DeletionN = -1.26498969947
+DeletionWithTag = 0.0821496590925
+DeletionWithTagS = -0.0264743524097
+Nce = -0.00141566220304
+NceS = -0.0658611326794
+Merge_A = 1.63279281062
+Merge_C = 1.31706088385
+Merge_G = 1.30632789651
+Merge_T = -0.253111709614
+MergeS_A = -0.245574925502
+MergeS_C = -0.112808623474
+MergeS_G = -0.107257049139
+MergeS_T = -0.0194831966664
+
+#
+# These are the models used when the chemistry is not recognized. For
+# now, we fall back to the C2 parameters.
+#
+[unknown.AllQVsModel]
+Match = 0.2627555
+Mismatch = -1.09688872
+MismatchS = -0.01637988
+Branch = -0.60275947
+BranchS = -0.02682689
+DeletionN = -1.00012494
+DeletionWithTag = 0.06000148
+DeletionWithTagS = -0.02579358
+Nce = -0.15864559
+NceS = -0.04403654
+Merge = -1.02398814
+MergeS = -0.12135255
+
+[unknown.NoMergeQVModel]
+Match = -0.032017275750000004
+Mismatch = -0.9773427825000001
+MismatchS = -0.01119015225
+Branch = -0.630141005
+BranchS = -0.0347192135
+DeletionN = -0.7697154425
+DeletionWithTag = -0.0003786080875
+DeletionWithTagS = -0.02546157775
+Nce = -0.21589032625
+NceS = -0.04661514775
+Merge = -1.0336790425
+MergeS = 0.0
+
+[unknown.NoQVsModel]
+Match = 0.0
+Mismatch = -4.6
+MismatchS = 0.0
+Branch = -2.4
+BranchS = 0.0
+DeletionN = -3.25
+DeletionWithTag = 0.0
+DeletionWithTagS = 0.0
+Nce = -2.45
+NceS = 0.0
+Merge = -3.2
+MergeS = 0.0
diff --git a/GenomicConsensus/quiver/resources/2014-03/GenomicConsensus/QuiverParameters.ini b/GenomicConsensus/quiver/resources/2014-03/GenomicConsensus/QuiverParameters.ini
new file mode 100644
index 0000000..e5b57f9
--- /dev/null
+++ b/GenomicConsensus/quiver/resources/2014-03/GenomicConsensus/QuiverParameters.ini
@@ -0,0 +1,174 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+#
+# Parameters for Quiver for different modeling and chemistry /
+# upstream analysis conditions.
+#
+# Author: David Alexander
+# Date: 2/12/2013
+#
+
+#
+# C2 chemistry
+#
+[C2.AllQVsModel]
+Match = 0.2627555
+Mismatch = -1.09688872
+MismatchS = -0.01637988
+Branch = -0.60275947
+BranchS = -0.02682689
+DeletionN = -1.00012494
+DeletionWithTag = 0.06000148
+DeletionWithTagS = -0.02579358
+Nce = -0.15864559
+NceS = -0.04403654
+Merge = -1.02398814
+MergeS = -0.12135255
+
+[C2.NoMergeQVModel]
+Match = -0.032017275750000004
+Mismatch = -0.9773427825000001
+MismatchS = -0.01119015225
+Branch = -0.630141005
+BranchS = -0.0347192135
+DeletionN = -0.7697154425
+DeletionWithTag = -0.0003786080875
+DeletionWithTagS = -0.02546157775
+Nce = -0.21589032625
+NceS = -0.04661514775
+Merge = -1.0336790425
+MergeS = 0.0
+
+[C2.NoQVsModel]
+Match = 0.0
+Mismatch = -1.21730327606
+MismatchS = 0.0
+Branch = -0.371355384588
+BranchS = 0.0
+DeletionN = -0.250208973885
+DeletionWithTag = 0.0
+DeletionWithTagS = 0.0
+Nce = -0.250370770693
+NceS = 0.0
+Merge = -0.371355384588
+MergeS = 0.0
+
+#
+# P4-C2 chemistry
+#
+[P4-C2.AllQVsMergingByChannelModel]
+Match = 0.266887694127
+Mismatch = -1.54460829977
+MismatchS = -0.0316527466982
+Branch = -0.578688017857
+BranchS = -0.0481504371325
+DeletionN = -1.30511780446
+DeletionWithTag = 0.023543148334
+DeletionWithTagS = -0.044525216376
+Nce = -0.11981002833
+NceS = -0.094850201311
+Merge_A = -0.719390215369
+Merge_C = 0.0637508742437
+Merge_G = 0.244651896573
+Merge_T = -0.627109496237
+MergeS_A = -0.0168917301257
+MergeS_C = -0.0769984152015
+MergeS_G = -0.0862808988248
+MergeS_T = -0.137076261104
+
+#
+# P5-C3 chemistry
+#
+[P5-C3.AllQVsMergingByChannelModel]
+Match = 0.184656435394
+Mismatch = -0.380508126527
+MismatchS = -0.0519773778309
+Branch = -0.0178687456208
+BranchS = -0.0865415022309
+DeletionN = -0.928673177809
+DeletionWithTag = -0.255381037375
+DeletionWithTagS = 0.0173271990056
+Nce = 0.303359662376
+NceS = -0.0980869366241
+Merge_A = -0.0402618414395
+Merge_C = 0.445432915183
+Merge_G = 0.256569746054
+Merge_T = 0.353800996389
+MergeS_A = -0.118145654186
+MergeS_C = -0.0471922787923
+MergeS_G = -0.032653869882
+MergeS_T = -0.0596571606945
+
+#
+# These are the models used when the chemistry is not recognized. For
+# now, we fall back to the C2 parameters.
+#
+[unknown.AllQVsModel]
+Match = 0.2627555
+Mismatch = -1.09688872
+MismatchS = -0.01637988
+Branch = -0.60275947
+BranchS = -0.02682689
+DeletionN = -1.00012494
+DeletionWithTag = 0.06000148
+DeletionWithTagS = -0.02579358
+Nce = -0.15864559
+NceS = -0.04403654
+Merge = -1.02398814
+MergeS = -0.12135255
+
+[unknown.NoMergeQVModel]
+Match = -0.032017275750000004
+Mismatch = -0.9773427825000001
+MismatchS = -0.01119015225
+Branch = -0.630141005
+BranchS = -0.0347192135
+DeletionN = -0.7697154425
+DeletionWithTag = -0.0003786080875
+DeletionWithTagS = -0.02546157775
+Nce = -0.21589032625
+NceS = -0.04661514775
+Merge = -1.0336790425
+MergeS = 0.0
+
+[unknown.NoQVsModel]
+Match = 0.0
+Mismatch = -4.6
+MismatchS = 0.0
+Branch = -2.4
+BranchS = 0.0
+DeletionN = -3.25
+DeletionWithTag = 0.0
+DeletionWithTagS = 0.0
+Nce = -2.45
+NceS = 0.0
+Merge = -3.2
+MergeS = 0.0
diff --git a/GenomicConsensus/quiver/resources/2014-09/GenomicConsensus/QuiverParameters.ini b/GenomicConsensus/quiver/resources/2014-09/GenomicConsensus/QuiverParameters.ini
new file mode 100644
index 0000000..7b60086
--- /dev/null
+++ b/GenomicConsensus/quiver/resources/2014-09/GenomicConsensus/QuiverParameters.ini
@@ -0,0 +1,198 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+#
+# Parameters for Quiver for different modeling and chemistry /
+# upstream analysis conditions.
+#
+# Author: David Alexander
+# Date: 9/18/2014
+#
+
+#
+# C2 chemistry
+#
+[C2.AllQVsModel]
+Match = 0.2627555
+Mismatch = -1.09688872
+MismatchS = -0.01637988
+Branch = -0.60275947
+BranchS = -0.02682689
+DeletionN = -1.00012494
+DeletionWithTag = 0.06000148
+DeletionWithTagS = -0.02579358
+Nce = -0.15864559
+NceS = -0.04403654
+Merge = -1.02398814
+MergeS = -0.12135255
+
+[C2.NoMergeQVModel]
+Match = -0.032017275750000004
+Mismatch = -0.9773427825000001
+MismatchS = -0.01119015225
+Branch = -0.630141005
+BranchS = -0.0347192135
+DeletionN = -0.7697154425
+DeletionWithTag = -0.0003786080875
+DeletionWithTagS = -0.02546157775
+Nce = -0.21589032625
+NceS = -0.04661514775
+Merge = -1.0336790425
+MergeS = 0.0
+
+[C2.NoQVsModel]
+Match = 0.0
+Mismatch = -1.21730327606
+MismatchS = 0.0
+Branch = -0.371355384588
+BranchS = 0.0
+DeletionN = -0.250208973885
+DeletionWithTag = 0.0
+DeletionWithTagS = 0.0
+Nce = -0.250370770693
+NceS = 0.0
+Merge = -0.371355384588
+MergeS = 0.0
+
+#
+# P4-C2 chemistry
+#
+[P4-C2.AllQVsMergingByChannelModel]
+Match = 0.266887694127
+Mismatch = -1.54460829977
+MismatchS = -0.0316527466982
+Branch = -0.578688017857
+BranchS = -0.0481504371325
+DeletionN = -1.30511780446
+DeletionWithTag = 0.023543148334
+DeletionWithTagS = -0.044525216376
+Nce = -0.11981002833
+NceS = -0.094850201311
+Merge_A = -0.719390215369
+Merge_C = 0.0637508742437
+Merge_G = 0.244651896573
+Merge_T = -0.627109496237
+MergeS_A = -0.0168917301257
+MergeS_C = -0.0769984152015
+MergeS_G = -0.0862808988248
+MergeS_T = -0.137076261104
+
+#
+# P5-C3 chemistry
+#
+[P5-C3.AllQVsMergingByChannelModel]
+Match = 0.184656435394
+Mismatch = -0.380508126527
+MismatchS = -0.0519773778309
+Branch = -0.0178687456208
+BranchS = -0.0865415022309
+DeletionN = -0.928673177809
+DeletionWithTag = -0.255381037375
+DeletionWithTagS = 0.0173271990056
+Nce = 0.303359662376
+NceS = -0.0980869366241
+Merge_A = -0.0402618414395
+Merge_C = 0.445432915183
+Merge_G = 0.256569746054
+Merge_T = 0.353800996389
+MergeS_A = -0.118145654186
+MergeS_C = -0.0471922787923
+MergeS_G = -0.032653869882
+MergeS_T = -0.0596571606945
+
+#
+# P6-C4 chemistry
+#
+[P6-C4.AllQVsMergingByChannelModel]
+Match = 0.262756
+Mismatch = -1.71623
+MismatchS = -0.00961684
+Branch = -0.400811
+BranchS = -0.0577744
+DeletionN = -1.39515
+DeletionWithTag = -0.232547
+DeletionWithTagS = -0.0235445
+Nce = -0.237657
+NceS = -0.0459215
+Merge_A = -1.13237
+Merge_C = 1.08894
+Merge_G = 0.570111
+Merge_T = -0.570049
+MergeS_A = -4.03641e-05
+MergeS_C = -0.107432
+MergeS_G = -0.0801512
+MergeS_T = -0.058112
+
+
+#
+# These are the models used when the chemistry is not recognized. For
+# now, we fall back to the C2 parameters.
+#
+[unknown.AllQVsModel]
+Match = 0.2627555
+Mismatch = -1.09688872
+MismatchS = -0.01637988
+Branch = -0.60275947
+BranchS = -0.02682689
+DeletionN = -1.00012494
+DeletionWithTag = 0.06000148
+DeletionWithTagS = -0.02579358
+Nce = -0.15864559
+NceS = -0.04403654
+Merge = -1.02398814
+MergeS = -0.12135255
+
+[unknown.NoMergeQVModel]
+Match = -0.032017275750000004
+Mismatch = -0.9773427825000001
+MismatchS = -0.01119015225
+Branch = -0.630141005
+BranchS = -0.0347192135
+DeletionN = -0.7697154425
+DeletionWithTag = -0.0003786080875
+DeletionWithTagS = -0.02546157775
+Nce = -0.21589032625
+NceS = -0.04661514775
+Merge = -1.0336790425
+MergeS = 0.0
+
+[unknown.NoQVsModel]
+Match = 0.0
+Mismatch = -4.6
+MismatchS = 0.0
+Branch = -2.4
+BranchS = 0.0
+DeletionN = -3.25
+DeletionWithTag = 0.0
+DeletionWithTagS = 0.0
+Nce = -2.45
+NceS = 0.0
+Merge = -3.2
+MergeS = 0.0
diff --git a/GenomicConsensus/quiver/utils.py b/GenomicConsensus/quiver/utils.py
new file mode 100644
index 0000000..8dcff0f
--- /dev/null
+++ b/GenomicConsensus/quiver/utils.py
@@ -0,0 +1,407 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+import numpy as np, itertools, logging, re
+from collections import Counter
+
+from GenomicConsensus.variants import *
+from GenomicConsensus.utils import *
+from GenomicConsensus.consensus import QuiverConsensus
+from pbcore.io.rangeQueries import projectIntoRange
+import ConsensusCore as cc
+
+def uniqueSingleBaseMutations(templateSequence, positions=None):
+ """
+ Return an iterator over all single-base mutations of a
+ templateSequence that result in unique mutated sequences.
+ """
+ allBases = "ACGT"
+ positions = positions or xrange(0, len(templateSequence))
+ for tplStart in positions:
+ tplBase = templateSequence[tplStart]
+ prevTplBase = templateSequence[tplStart-1] if (tplStart > 0) else None
+ # snvs
+ for subsBase in allBases:
+ if subsBase != tplBase:
+ yield cc.Mutation(cc.SUBSTITUTION, tplStart, subsBase)
+ # Insertions---only allowing insertions that are not cognate
+ # with the previous base.
+ for insBase in allBases:
+ if insBase != prevTplBase:
+ yield cc.Mutation(cc.INSERTION, tplStart, insBase)
+ # Deletion--only allowed if refBase does not match previous tpl base
+ if tplBase != prevTplBase:
+ yield cc.Mutation(cc.DELETION, tplStart, "-")
+
+def allSingleBaseMutations(templateSequence, positions=None):
+ """
+ Same as ``uniqueSingleBaseMutations``, but no filtering as to
+ whether the mutated sequences are unique.
+ """
+ allBases = "ACGT"
+ positions = positions or xrange(0, len(templateSequence))
+ for tplStart in positions:
+ tplBase = templateSequence[tplStart]
+ # snvs
+ for subsBase in allBases:
+ if subsBase != tplBase:
+ yield cc.Mutation(cc.SUBSTITUTION, tplStart, subsBase)
+ # Insertions
+ for insBase in allBases:
+ yield cc.Mutation(cc.INSERTION, tplStart, insBase)
+ # Deletion
+ yield cc.Mutation(cc.DELETION, tplStart, "-")
+
+def nearbyMutations(mutations, tpl, neighborhoodSize):
+ """
+ Return mutations nearby the previously-tried mutations
+ """
+ mutationPositions = map(cc.Mutation.Start, mutations)
+ nearbyPositions = set()
+ for mp in mutationPositions:
+ nearbyPositions.update(range(max(0, mp - neighborhoodSize),
+ min(len(tpl), mp + neighborhoodSize)))
+ return uniqueSingleBaseMutations(tpl, sorted(nearbyPositions))
+
+def asFloatFeature(arr):
+ return cc.FloatFeature(np.array(arr, dtype=np.float32))
+
+def bestSubset(mutationsAndScores, separation):
+ """
+ Given a list of (mutation, score) tuples, this utility method
+ greedily chooses the highest scoring well-separated elements. We
+ use this to avoid applying adjacent high scoring mutations, which
+ are the rule, not the exception. We only apply the best scoring one
+ in each neighborhood, and then revisit the neighborhoods after
+ applying the mutations.
+ """
+ input = mutationsAndScores[:]
+ output = []
+
+ while input:
+ best = max(input, key=snd)
+ output.append(best)
+ nStart = best[0].Start() - separation
+ nEnd = best[0].Start() + separation
+ for t in input[:]:
+ if nStart <= t[0].Start() <= nEnd:
+ input.remove(t)
+
+ return output
+
+def refineConsensus(mms, quiverConfig):
+ """
+ Given a MultiReadMutationScorer, identify and apply favorable
+ template mutations. Return (consensus, didConverge) :: (str, bool)
+ """
+ isConverged = cc.RefineConsensus(mms)
+ return mms.Template(), isConverged
+
+def _buildDinucleotideRepeatPattern(minRepeatCount):
+ allDinucs = [ a + b for a in "ACGT" for b in "ACGT" if a != b ]
+ pattern = "(" + "|".join(["(?:%s){%d,}" % (dinuc, minRepeatCount)
+ for dinuc in allDinucs]) + ")"
+ return pattern
+
+dinucleotideRepeatPattern = _buildDinucleotideRepeatPattern(3)
+
+def findDinucleotideRepeats(s):
+ """
+ string -> list( (start_position, end_position), length-2 string )
+
+ List is sorted, and [start_position, end_position) intervals are
+ disjoint
+ """
+ repeatsFound = [ (m.span(), s[m.start():m.start()+2])
+ for m in re.finditer(dinucleotideRepeatPattern, s) ]
+ return sorted(repeatsFound)
+
+
+def refineDinucleotideRepeats(mms):
+ """
+ We have observed a couple instances where we call the consensus to
+ be off the truth by +/- 1 dinucleotide repeat---we are getting
+ trapped in an inferor local optimum, like so:
+
+ likelihood
+ truth ATATATAT 100
+ quiver AT--ATAT 90
+ quiver+A ATA-ATAT 85
+ quiver+T AT-TATAT 85
+
+ To resolve this issue, we need to explore the likelihood change
+ for wobbling on every dinucleotide repeat in the window.
+ """
+ return cc.RefineDinucleotideRepeats(mms)
+
+def consensusConfidence(mms, positions=None):
+ """
+ Returns an array of QV values reflecting the consensus confidence
+ at each position specified. If the `positions` argument is
+ omitted, confidence values are returned for all positions in the
+ consensus (mms.Template()).
+ """
+ return np.array(cc.ConsensusQVs(mms), dtype=np.uint8)
+
+def variantsFromAlignment(a, refWindow):
+ """
+ Extract the variants implied by a pairwise alignment to the
+ reference.
+ """
+ variants = []
+ refId, refStart, _ = refWindow
+ refPos = refStart
+ tbl = zip(a.Transcript(),
+ a.Target(),
+ a.Query())
+
+ # We don't call variants where either the reference or css is 'N'
+ grouper = lambda row: "N" if (row[1]=="N" or row[2]=="N") else row[0]
+ runs = itertools.groupby(tbl, grouper)
+
+ for code, run in runs:
+ assert code in "RIDMN"
+ run = list(run)
+ ref = "".join(map(snd, run))
+ refLen = len(ref) - Counter(ref)["-"]
+ read = "".join(map(third, run))
+
+ if code == "M" or code == "N":
+ pass
+ elif code == "R":
+ assert len(read)==len(ref)
+ variants.append(Variant(refId, refPos, refPos+len(read), ref, read))
+ elif code == "I":
+ variants.append(Variant(refId, refPos, refPos, "", read))
+ elif code == "D":
+ variants.append(Variant(refId, refPos, refPos + len(ref), ref, ""))
+
+ refPos += refLen
+
+ return variants
+
+def referenceSpanWithinWindow(referenceWindow, aln):
+ """
+ Helper function for sorting reads by their reference span
+ after restriction to a window.
+ """
+ _, winStart, winEnd = referenceWindow
+ return min(winEnd, aln.referenceEnd) - \
+ max(winStart, aln.referenceStart)
+
+def lifted(queryPositions, mappedRead):
+ """
+ Lift a mappedRead into a new coordinate system by using the
+ position translation table `queryPositions`
+ """
+ newStart = queryPositions[mappedRead.TemplateStart]
+ newEnd = queryPositions[mappedRead.TemplateEnd]
+ copy = cc.MappedRead(mappedRead)
+ copy.TemplateStart = newStart
+ copy.TemplateEnd = newEnd
+ return copy
+
+
+_typeMap = { cc.INSERTION : "Ins",
+ cc.DELETION : "Del",
+ cc.SUBSTITUTION : "Sub" }
+
+def _shortMutationDescription(mut, tpl):
+ """
+ More compact and uniform mutation description strings
+ Examples:
+
+ 201 Ins . > G
+ 201 Sub C > T
+ 201 Del C > .
+ """
+ _type = _typeMap[mut.Type()]
+ _pos = mut.Start()
+ _oldBase = "." if mut.Type() == cc.INSERTION \
+ else tpl[_pos]
+ _newBase = "." if mut.Type() == cc.DELETION \
+ else mut.NewBases()
+ return "%d %s %s > %s" % (_pos, _type, _oldBase, _newBase)
+
+def scoreMatrix(mms):
+ """
+ Returns (rowNames, columnNames, S)
+
+ where:
+ - S is a matrix where S_{ij} represents the score delta
+ of mutation j against read i
+ - rowNames[i] is an identifier name for the the read i---presently
+ we use the the row number within the cmp.h5, encoded as a string
+ - columnNames[j] is an identifier for mutation j, encoding the
+ position, type, and base change
+ """
+ css = mms.Template()
+ allMutations = sorted(allSingleBaseMutations(css))
+ shape = (mms.NumReads(), len(allMutations))
+ scoreMatrix = np.zeros(shape)
+ for j, mut in enumerate(allMutations):
+ mutScores = mms.Scores(mut)
+ scoreMatrix[:, j] = mutScores
+ baselineScores = np.array(mms.BaselineScores())
+ rowNames = [ mms.Read(i).Name
+ for i in xrange(mms.NumReads()) ]
+ columnNames = [ _shortMutationDescription(mut, css)
+ for mut in allMutations ]
+ return (rowNames, columnNames, baselineScores, scoreMatrix)
+
+
+def variantsFromConsensus(refWindow, refSequenceInWindow, cssSequenceInWindow,
+ cssQvInWindow=None, siteCoverage=None, aligner="affine",
+ mms=None):
+ """
+ Compare the consensus and the reference in this window, returning
+ a list of variants.
+ """
+ refId, refStart, refEnd = refWindow
+
+ if aligner == "affine":
+ align = cc.AlignAffine
+ else:
+ align = cc.Align
+
+ ga = align(refSequenceInWindow, cssSequenceInWindow)
+ cssPosition = cc.TargetToQueryPositions(ga)
+
+ vars = variantsFromAlignment(ga, refWindow)
+ for v in vars:
+ # HACK ALERT: we are not really handling the confidence or
+ # coverage for variants at last position of the window
+ # correctly here.
+ refPos_ = min(v.refStart-refStart, len(siteCoverage)-1)
+ cssPos_ = min(cssPosition[v.refStart-refStart], len(cssQvInWindow)-1)
+
+ # make sure the arrays are non-empty before indexing into them
+ if siteCoverage is not None and np.size(siteCoverage) > 0:
+ v.coverage = siteCoverage[refPos_]
+
+ if cssQvInWindow is not None and np.size(cssQvInWindow) > 0:
+ v.confidence = cssQvInWindow[cssPos_]
+
+ return vars
+
+def filterAlns(refWindow, alns, quiverConfig):
+ """
+ Given alns (already clipped to the window bounds), filter out any
+ that are incompatible with Quiver.
+
+ By and large we avoid doing any filtering to avoid potential
+ reference bias in variant calling.
+
+ However at the moment the POA (and potentially other components)
+ breaks when there is a read of zero length. So we throw away
+ reads that are "stumpy", where the aligner has inserted a large
+ gap, such that while the alignment technically spans the window,
+ it may not have any read content therein:
+
+ Ref ATGATCCAGTTACTCCGATAAA
+ Read ATG---------------TA-A
+ Win. [ )
+ """
+ return [ a for a in alns
+ if a.readLength >= (quiverConfig.readStumpinessThreshold * a.referenceSpan) ]
+
+
+def consensusForAlignments(refWindow, refSequence, alns, quiverConfig):
+ """
+ Call consensus on this interval---without subdividing the interval
+ further.
+
+ Testable!
+
+ Clipping has already been done!
+ """
+ _, refStart, refEnd = refWindow
+
+ # Compute the POA consensus, which is our initial guess, and
+ # should typically be > 99.5% accurate
+ fwdSequences = [ a.read(orientation="genomic", aligned=False)
+ for a in alns
+ if a.spansReferenceRange(refStart, refEnd) ]
+ assert len(fwdSequences) >= quiverConfig.minPoaCoverage
+
+ try:
+ p = cc.PoaConsensus.FindConsensus(fwdSequences[:quiverConfig.maxPoaCoverage])
+ except:
+ logging.info("%s: POA could not be generated" % (refWindow,))
+ return QuiverConsensus.noCallConsensus(quiverConfig.noEvidenceConsensus,
+ refWindow, refSequence)
+ ga = cc.Align(refSequence, p.Sequence)
+ numPoaVariants = ga.Errors()
+ poaCss = p.Sequence
+
+ # Extract reads into ConsensusCore-compatible objects, and map them into the
+ # coordinates relative to the POA consensus
+ mappedReads = [ quiverConfig.extractMappedRead(aln, refStart) for aln in alns ]
+ queryPositions = cc.TargetToQueryPositions(ga)
+ mappedReads = [ lifted(queryPositions, mr) for mr in mappedReads ]
+
+ # Load the mapped reads into the mutation scorer, and iterate
+ # until convergence.
+ configTbl = quiverConfig.ccQuiverConfigTbl
+ mms = cc.SparseSseQvMultiReadMutationScorer(configTbl, poaCss)
+ for mr in mappedReads:
+ mms.AddRead(mr)
+
+ # Iterate until covergence
+ _, quiverConverged = refineConsensus(mms, quiverConfig)
+ if quiverConverged:
+ if quiverConfig.refineDinucleotideRepeats:
+ refineDinucleotideRepeats(mms)
+ quiverCss = mms.Template()
+ if quiverConfig.computeConfidence:
+ confidence = consensusConfidence(mms)
+ else:
+ confidence = np.zeros(shape=len(quiverCss), dtype=int)
+ return QuiverConsensus(refWindow,
+ quiverCss,
+ confidence,
+ mms)
+ else:
+ logging.info("%s: Quiver did not converge to MLE" % (refWindow,))
+ return QuiverConsensus.noCallConsensus(quiverConfig.noEvidenceConsensus,
+ refWindow, refSequence)
+
+
+def coverageInWindow(refWin, hits):
+ winId, winStart, winEnd = refWin
+ a = np.array([(hit.referenceStart, hit.referenceEnd)
+ for hit in hits
+ if hit.referenceId == winId])
+ tStart = a[:,0]
+ tEnd = a[:,1]
+ cov = projectIntoRange(tStart, tEnd, winStart, winEnd)
+ return cov
diff --git a/GenomicConsensus/reference.py b/GenomicConsensus/reference.py
new file mode 100644
index 0000000..38e3e74
--- /dev/null
+++ b/GenomicConsensus/reference.py
@@ -0,0 +1,261 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+from __future__ import absolute_import
+
+import logging, re, numpy as np
+from collections import OrderedDict
+from pbcore.io import FastaTable, splitFastaHeader
+
+from .windows import holes, kCoveredIntervals, enumerateIntervals
+from .utils import die, nub
+
+class WorkChunk(object):
+ """
+ A chunk of the reference
+ """
+ def __init__(self, window, hasCoverage):
+ self.window = window
+ self.hasCoverage = hasCoverage
+
+class UppercasingMmappedFastaSequence(object):
+ def __init__(self, mmappedFastaSequence):
+ self.other = mmappedFastaSequence
+
+ def __getitem__(self, spec):
+ snip = self.other.__getitem__(spec)
+ return snip.upper()
+
+class ReferenceContig(object):
+ """
+ A contig from a reference (i.e. FASTA) file.
+ """
+ def __init__(self, id, name, fullName, sequence, length):
+ self.id = id # CmpH5-local id
+ self.name = name # Prefix of FASTA heder
+ self.fullName = fullName
+ self.sequence = UppercasingMmappedFastaSequence(sequence)
+ self.length = length
+
+byName = OrderedDict() # Fasta header (string e.g. "chr1") -> FastaRecord
+byId = OrderedDict() # CmpH5 local id (integer) -> FastaRecord
+byPacBioName = OrderedDict() # pacbio name ("ref000001") -> FastaRecord
+
+def idToName(_id):
+ return byId[_id].name
+
+def idToFullName(_id):
+ return byId[_id].fullName
+
+# Interpret a string key (one of name, or id (as string))
+# and find the associated id. Only to be used in interpretation of
+# command-line input!
+def anyKeyToId(stringKey):
+ assert isLoaded()
+ if stringKey in byName:
+ return byName[stringKey].id
+ elif stringKey in byPacBioName:
+ return byPacBioName[stringKey].id
+ elif stringKey.isdigit():
+ refId = int(stringKey)
+ return byId[refId].id
+ else:
+ raise Exception, "Unknown reference name: %s" % stringKey
+
+def sequenceInWindow(window):
+ refId, refStart, refEnd = window
+ return byId[refId].sequence[refStart:refEnd]
+
+filename = None
+
+def isLoaded():
+ return filename != None
+
+def loadFromFile(filename_, cmpH5):
+ """
+ Reads reference from FASTA file, loading
+ lookup tables that can be used any time later.
+ """
+ # Contigs in FASTA may disagree with those in cmp.h5 ref info
+ # table, for instance if the FASTA has been edited. Here's how we
+ # handle things:
+ #
+ # |fastaContigs \ cmpContigs| > 0 : OK, extra FASTA contigs just ignored
+ # |cmpContigs \ fastaContigs| > 0 : Not necessarily OK---a warning should be
+ # issued. We then proceed to operate on
+ # the contigs that are in both.
+ # |cmpContigs ^ fastaContigs| == 0 : Nothing to work with. This is an error.
+ #
+ # While we formerly used MD5s to vouch for the identity of a
+ # contig, we now use the name. This is an inferior approach but
+ # is necessary, in using the FastaTable.
+
+ # Load contigs
+ assert not isLoaded()
+ try:
+ f = FastaTable(filename_)
+ except IOError as e:
+ die(e)
+
+ cmpContigNames = set(splitFastaHeader(x)[0] for x in cmpH5.referenceInfoTable.FullName)
+
+ for fastaRecord in f:
+ refName = fastaRecord.id
+ if refName in cmpContigNames:
+ cmpH5RefEntry = cmpH5.referenceInfo(refName)
+ refId = cmpH5RefEntry.ID
+ pacBioName = cmpH5RefEntry.Name
+ refFullName = cmpH5RefEntry.FullName
+ sequence = UppercasingMmappedFastaSequence(fastaRecord.sequence)
+ length = len(fastaRecord.sequence)
+ contig = ReferenceContig(refId, refName, refFullName, sequence, length)
+ byId[refId] = contig
+ byName[refName] = contig
+ byPacBioName[pacBioName] = contig
+ loadedFastaContigNames = set(byName.keys())
+ logging.info("Loaded %d of %d reference groups from %s " %
+ (len(byId), len(loadedFastaContigNames), filename_))
+
+ if len(byId) == 0:
+ die("No reference groups in the FASTA file were aligned against. " \
+ "Did you select the wrong reference FASTA file?")
+ elif (cmpContigNames - loadedFastaContigNames):
+ logging.warn(
+ "Some reference contigs aligned against are not found in " \
+ "the reference FASTA. Will process only those contigs " \
+ "supported by the reference FASTA.")
+
+ global filename
+ filename = filename_
+ assert isLoaded()
+
+def stringToWindow(s):
+ assert isLoaded()
+ if s is None:
+ return None
+ m = re.match("(.*):(.*)-(.*)", s)
+ if m:
+ refId = anyKeyToId(m.group(1))
+ refStart = int(m.group(2))
+ refEnd = min(int(m.group(3)), byId[refId].length)
+ else:
+ refId = anyKeyToId(s)
+ refStart = 0
+ refEnd = byId[refId].length
+ return (refId, refStart, refEnd)
+
+def windowToString(referenceWindow):
+ assert isLoaded()
+ refId, refStart, refEnd = referenceWindow
+ return "%s:%d-%d" % (idToName(refId),
+ refStart,
+ refEnd)
+
+def enumerateSpans(refId, referenceWindows=()):
+ """
+ Enumerate the contiguous spans along this reference contig that
+ are to be analyzed.
+ """
+ assert isLoaded()
+ referenceEntry = byId[refId]
+ referenceEntrySpan = (refId, 0, referenceEntry.length)
+
+ for refWin in (referenceWindows or [referenceEntrySpan]):
+ refWinId, start, end = refWin
+ if refWinId == refId:
+ yield (refId, start, end)
+
+def enumerateChunks(refId, referenceStride, referenceWindows=()):
+ """
+ Enumerate all work chunks on this reference contig (restricted to
+ the windows, if provided).
+ """
+ for span in enumerateSpans(refId, referenceWindows):
+ for (s, e) in enumerateIntervals(span[1:], referenceStride):
+ yield WorkChunk((refId, s, e), True)
+
+def fancyEnumerateChunks(cmpH5, refId, referenceStride,
+ minCoverage, minMapQV, referenceWindows=()):
+ """
+ Enumerate chunks, creating chunks with hasCoverage=False for
+ coverage cutouts.
+ """
+ startRow = cmpH5.referenceInfo(refId).StartRow
+ endRow = cmpH5.referenceInfo(refId).EndRow
+ goodMapQVs = (cmpH5.MapQV[startRow:endRow] >= minMapQV)
+ tStart = cmpH5.tStart[startRow:endRow][goodMapQVs].view(np.int32)
+ tEnd = cmpH5.tEnd [startRow:endRow][goodMapQVs].view(np.int32)
+
+ for span in enumerateSpans(refId, referenceWindows):
+ _, spanStart, spanEnd = span
+ coveredIntervals = kCoveredIntervals(minCoverage, tStart, tEnd, spanStart, spanEnd)
+ unCoveredIntervals = holes(span, coveredIntervals)
+
+ for (s, e) in sorted(list(coveredIntervals) + unCoveredIntervals):
+ win = (refId, s, e)
+ if (s, e) in coveredIntervals:
+ for chunk in enumerateChunks(refId, referenceStride, [(refId, s, e)]):
+ yield chunk
+ else:
+ yield WorkChunk(win, False)
+
+
+def numReferenceBases(refId, referenceWindows=()):
+ """
+ Termination is determined to be when the result collector has
+ built consensus corresponding to the exact number of reference
+ bases in the window under consideration.
+ """
+ return sum((end - start)
+ for (_, start, end) in enumerateSpans(refId, referenceWindows))
+
+
+def enumerateIds(referenceWindows=()):
+ """
+ Enumerate all refIds (subject to the referenceWindows restriction,
+ if provided).
+ """
+ assert isLoaded()
+ if referenceWindows == ():
+ for refId in byId:
+ yield refId
+ else:
+ for refId in nub(refId for (refId, _, _) in referenceWindows):
+ yield refId
+
+def enlargedReferenceWindow(refWin, overlap):
+ assert isLoaded()
+ refId, refStart, refEnd = refWin
+ contigLength = byId[refId].length
+ return (refId,
+ max(0, refStart - overlap),
+ min(refEnd + overlap, contigLength))
diff --git a/GenomicConsensus/utils.py b/GenomicConsensus/utils.py
new file mode 100644
index 0000000..0597dbd
--- /dev/null
+++ b/GenomicConsensus/utils.py
@@ -0,0 +1,174 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+from __future__ import absolute_import
+import math, numpy as np, os.path, sys, itertools
+
+def die(msg):
+ print msg
+ sys.exit(-1)
+
+class CommonEqualityMixin(object):
+ def __eq__(self, other):
+ return (isinstance(other, self.__class__)
+ and self.__dict__ == other.__dict__)
+
+ def __ne__(self, other):
+ return not self.__eq__(other)
+
+
+# An exception for incompatible cmp.h5 files
+class IncompatibleDataException(Exception):
+ pass
+
+# We truncate QVs at 93 because the FASTQ format downstream can only
+# support QVs in the range [0, 93] without lossage.
+
+def error_probability_to_qv(error_probability, cap=93):
+ """
+ Convert an error probability to a phred-scaled QV.
+ """
+ if error_probability==0:
+ return cap
+ else:
+ return min(cap, int(round(-10*math.log10(error_probability))))
+
+
+_complement = { "A" : "T",
+ "C" : "G",
+ "G" : "C",
+ "T" : "A",
+ "-" : "-" }
+
+def complement(s):
+ cStr = "".join(_complement[c] for c in s)
+ if type(s) == str:
+ return cStr
+ else:
+ return np.fromstring(cStr, "S1")
+
+def reverseComplement(s):
+ return complement(s)[::-1]
+
+def fileFormat(filename):
+ if filename.endswith(".gz"):
+ ext = os.path.splitext(filename[:-3])[1]
+ else:
+ ext = os.path.splitext(filename)[1]
+ ext = ext.lower()
+ if ext in [".fa", ".fasta"]: return "FASTA"
+ elif ext in [".fq", ".fastq"]: return "FASTQ"
+ elif ext in [".gff" ]: return "GFF"
+ elif ext in [".csv" ]: return "CSV"
+ else: raise Exception, "Unrecognized file format"
+
+def rowNumberIsInReadStratum(readStratum, rowNumber):
+ n, N = readStratum
+ return (rowNumber % N) == n
+
+def readsInWindow(cmpH5, window, depthLimit=None,
+ minMapQV=0, strategy="fileorder",
+ stratum=None, barcode=None):
+ """
+ Return up to `depthLimit` reads (as row numbers integers) where
+ the mapped reference intersects the window. If depthLimit is None,
+ return all the reads meeting the criteria.
+
+ `strategy` can be:
+ - "longest" --- get the reads with the longest length in the window
+ - "spanning" --- get only the reads spanning the window
+ - "fileorder" --- get the reads in file order
+ """
+ assert strategy in {"longest", "spanning", "fileorder"}
+
+ if stratum is not None:
+ raise ValueError, "stratum needs to be reimplemented"
+
+ def depthCap(iter):
+ if depthLimit is not None:
+ return list(itertools.islice(iter, 0, depthLimit))
+ else:
+ return list(iter)
+
+ def lengthInWindow(hit):
+ return min(hit.tEnd, winEnd) - max(hit.tStart, winStart)
+
+ winId, winStart, winEnd = window
+ if barcode == None:
+ alnHits = ( hit
+ for hit in cmpH5.readsInRange(winId, winStart, winEnd)
+ if hit.MapQV >= minMapQV )
+ else:
+ alnHits = ( hit
+ for hit in cmpH5.readsInRange(winId, winStart, winEnd)
+ if ((hit.MapQV >= minMapQV) and
+ (hit.barcode == barcode)) )
+
+ if strategy == "fileorder":
+ return depthCap(alnHits)
+ elif strategy == "spanning":
+ winLen = winEnd - winStart
+ return depthCap( hit for hit in alnHits
+ if lengthInWindow(hit) == winLen )
+ elif strategy == "longest":
+ # Well, this defeats the iterable/laziness, performs poorly if
+ # deep coverage. sorted is stable.
+ return depthCap(sorted(alnHits, key=lengthInWindow, reverse=True))
+
+
+def datasetCountExceedsThreshold(cmpH5, threshold):
+ """
+ Does the file contain more than `threshold` datasets? This
+ impacts whether or not we should disable the chunk cache.
+ """
+ total = 0
+ for i in np.unique(cmpH5.AlnGroupID):
+ total += len(cmpH5._alignmentGroup(i))
+ if total > threshold:
+ return True
+ return False
+
+#
+# Some lisp functions we want
+#
+fst = lambda t: t[0]
+snd = lambda t: t[1]
+third = lambda t: t[2]
+
+def nub(it):
+ """
+ Unique entries in an iterable, preserving order
+ """
+ seen = set()
+ for x in it:
+ if x not in seen: yield(x)
+ seen.add(x)
diff --git a/GenomicConsensus/variants.py b/GenomicConsensus/variants.py
new file mode 100644
index 0000000..06e2af6
--- /dev/null
+++ b/GenomicConsensus/variants.py
@@ -0,0 +1,123 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# Author: David Alexander
+
+from __future__ import absolute_import
+from .utils import CommonEqualityMixin
+
+__all__ = [ "Variant" ]
+
+class Variant(CommonEqualityMixin):
+ """
+ Variant objects represent homozygous/haploid OR heterozygous
+ variants corresponding to a fixed window of a reference genome
+
+ Internally we use Python-style half-open intervals zero-based
+ [start, end) to delineate reference ranges. An insertion has
+ start==end, a SNP has start+1==end, etc.
+
+ GFF files use 1-based indexing and open intervals [start, end).
+ In a GFF both insertions and SNPs have start==end, which doesn't
+ make too much sense to me, but so be it.
+
+ VCF files use 1-based indexing as well, but do not record the
+ "end"
+ """
+ def __init__(self, refId, refStart, refEnd, refSeq, readSeq1,
+ readSeq2=None, confidence=None, coverage=None,
+ frequency1=None, frequency2=None, annotations=None):
+ self.refId = refId
+ self.refStart = refStart
+ self.refEnd = refEnd
+ self.refSeq = refSeq
+ self.readSeq1 = readSeq1
+ self.readSeq2 = readSeq2
+ self.confidence = confidence
+ self.coverage = coverage
+ self.frequency1 = frequency1
+ self.frequency2 = frequency2
+ self.annotations = annotations
+
+ @property
+ def isHeterozygous(self):
+ return (self.readSeq2 != None)
+
+ @property
+ def variantType(self):
+ lr = len(self.refSeq)
+ l1 = len(self.readSeq1)
+ l2 = len(self.readSeq2) if self.readSeq2 else None
+ if lr == 0:
+ return "Insertion"
+ elif l1==0 or l2==0:
+ return "Deletion"
+ elif (l1==lr) and (l2==None or l2==lr):
+ return "Substitution"
+ else:
+ return "Variant"
+
+ def __str__(self):
+ refSeq_ = self.refSeq or "."
+ if self.isHeterozygous:
+ readAlleles = "%s/%s" % (self.readSeq1 or ".",
+ self.readSeq2 or ".")
+ else:
+ readAlleles = "%s" % (self.readSeq1 or ".")
+ return "%s@%s:%d-%d %s -> %s" % \
+ (self.variantType,
+ self.refId,
+ self.refStart,
+ self.refEnd,
+ refSeq_,
+ readAlleles)
+
+ def __repr__(self):
+ return str(self)
+
+ def __lt__(self, other):
+ return ((self.refId, self.refStart, self.refEnd, self.readSeq1) <
+ (other.refId, other.refStart, other.refEnd, other.readSeq1))
+
+ def annotate(self, key, value):
+ if self.annotations == None:
+ self.annotations = []
+ self.annotations.append((key, value))
+
+
+def filterVariants(minCoverage, minConfidence, variants):
+ return [ v for v in variants
+ if ((v.coverage >= minCoverage) and
+ (v.confidence >= minConfidence)) ]
+
+def annotateVariants(variants, alns):
+ # Operates in place
+ for v in variants:
+ v.annotate("rows", ",".join(str(a.rowNumber) for a in alns))
diff --git a/GenomicConsensus/windows.py b/GenomicConsensus/windows.py
new file mode 100644
index 0000000..e56d50f
--- /dev/null
+++ b/GenomicConsensus/windows.py
@@ -0,0 +1,190 @@
+#################################################################################
+# Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+#
+# All rights reserved.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are met:
+# * Redistributions of source code must retain the above copyright
+# notice, this list of conditions and the following disclaimer.
+# * Redistributions in binary form must reproduce the above copyright
+# notice, this list of conditions and the following disclaimer in the
+# documentation and/or other materials provided with the distribution.
+# * Neither the name of Pacific Biosciences nor the names of its
+# contributors may be used to endorse or promote products derived from
+# this software without specific prior written permission.
+#
+# NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY
+# THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC BIOSCIENCES AND ITS
+# CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A
+# PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR
+# ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
+# EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
+# PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+# BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER
+# IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
+# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
+# POSSIBILITY OF SUCH DAMAGE.
+#################################################################################
+
+# windows.py: logic for windows/intervals of the genome
+#
+# NOTE that by convention:
+# (start, end) is an /interval/
+# (refId, start, end) is a /window/.
+# All windows/intervals use 0-based indexing and are half-open
+# (includes start, not end)
+#
+# Author: David Alexander
+
+import numpy as np, math
+from pbcore.io.rangeQueries import projectIntoRange
+from ConsensusCore import CoveredIntervals
+
+def intervalToPair(v):
+ return (v.Begin, v.End)
+
+def kCoveredIntervals(k, tStart, tEnd, winStart, winEnd):
+ return map(intervalToPair, CoveredIntervals(k, tStart, tEnd, int(winStart), int(winEnd-winStart)))
+
+def kSpannedIntervals(refWindow, k, start, end, minLength=0):
+ """
+ Find intervals in the window that are k-spanned by the reads.
+
+ Given:
+ `refWindow`: the window under consideration
+ `k`: the number of reads that must span intervals to be returned
+ `start`, `end`: numpy arrays of start and end coordinates for reads,
+ where the extent of each read is [start, end). Must be ordered
+ so that `start` is sorted in ascending order.
+
+ Find a maximal set of maximal disjoint intervals within
+ refWindow such that each interval is spanned by at least k reads.
+ Intervals are returned in sorted order, as a list of (start, end)
+ tuples.
+
+ Note that this is a greedy search procedure and may not always
+ return the optimal solution, in some sense. However it will
+ always return the optimal solutions in the most common cases.
+ """
+ assert k >= 1
+ winId, winStart_, winEnd_ = refWindow
+
+ # Truncate to bounds implied by refWindow
+ start = np.clip(start, winStart_, winEnd_)
+ end = np.clip(end, winStart_, winEnd_)
+
+ # Translate the start, end to coordinate system where
+ # refWindow.start is 0.
+ start = start - winStart_
+ end = end - winStart_
+ winStart = 0
+ winEnd = winEnd_ - winStart_
+
+ positions = np.arange(winEnd - winStart, dtype=int)
+ coverage = projectIntoRange(start, end,
+ winStart, winEnd)
+ x = -1
+ y = 0
+ intervalsFound = []
+
+ while y < winEnd:
+ # Step 1: let x be the first pos >= y that is k-covered
+ eligible = np.flatnonzero((positions >= y) & (coverage >= k))
+ if len(eligible) > 0:
+ x = eligible[0]
+ else:
+ break
+
+ # Step 2: extend the window [x, y) until [x, y) is no longer
+ # k-spanned. Do this by setting y to the k-th largest `end`
+ # among reads covering x
+ eligible = end[(start <= x)]
+ eligible.sort()
+ if len(eligible) >= k:
+ y = eligible[-k]
+ else:
+ break
+
+ intervalsFound.append((x, y))
+
+ # Translate intervals back
+ return [ (s + winStart_,
+ e + winStart_)
+ for (s, e) in intervalsFound
+ if e - s >= minLength ]
+
+def abut(intervals):
+ """
+ Abut adjacent intervals. Useful for debugging...
+ """
+ output = []
+ lastS = None
+ lastE = None
+ for (s, e) in intervals:
+ if s == lastE:
+ lastS, lastE = lastS, e
+ else:
+ if lastS is not None:
+ output.append((lastS, lastE))
+ lastS, lastE = s, e
+ output.append((lastS, lastE))
+ return output
+
+def holes(refWindow, intervals):
+ """
+ Given a window and a set of disjoint subintervals, return the
+ "holes", which are the intervals of the refWindow not covered by
+ the given subintervals.
+ """
+ winId, winStart, winEnd = refWindow
+ output = []
+ intervals = sorted(intervals)
+ lastE = winStart
+ for (s, e) in intervals:
+ if s > lastE:
+ output.append((lastE, s))
+ lastE = e
+ if lastE < winEnd:
+ output.append((lastE, winEnd))
+ return output
+
+def intersection(int1, int2):
+ s1, e1 = int1
+ s2, e2 = int2
+ si, ei = max(s1, s2), min(e1, e2)
+ if si < ei:
+ return (si, ei)
+ else:
+ return None
+
+def windowsIntersect(w1, w2):
+ i1, s1, e1 = w1
+ i2, s2, e2 = w2
+ return (i1 == i2) and (e1 > s2) and (e2 > s1)
+
+def subWindow(refWindow, subinterval):
+ winId, winStart, winEnd = refWindow
+ intS, intE = subinterval
+ assert intS >= winStart
+ assert intE <= winEnd
+ return winId, intS, intE
+
+def enumerateIntervals(bounds, stride):
+ """
+ Enumerate windows of size "stride", attempting to align window
+ boundaries on multiple of stride.
+ """
+ def alignDown(chunk, x):
+ return (x/chunk)*chunk
+ def alignUp(chunk, x):
+ return int(math.ceil(float(x)/chunk)*chunk)
+
+ start, end = bounds
+ roundStart = alignDown(stride, start)
+ roundEnd = alignUp (stride, end)
+
+ for s in xrange(roundStart, roundEnd, stride):
+ roundWin = (s, s + stride)
+ yield intersection(bounds, roundWin)
diff --git a/LICENSES b/LICENSES
new file mode 100644
index 0000000..ccdee9e
--- /dev/null
+++ b/LICENSES
@@ -0,0 +1,32 @@
+Copyright (c) 2011-2013, Pacific Biosciences of California, Inc.
+
+All rights reserved.
+
+Redistribution and use in source and binary forms, with or without
+modification, are permitted provided that the following conditions are
+met:
+
+* Redistributions of source code must retain the above copyright
+ notice, this list of conditions and the following disclaimer.
+
+* Redistributions in binary form must reproduce the above copyright
+ notice, this list of conditions and the following disclaimer in the
+ documentation and/or other materials provided with the distribution.
+
+* Neither the name of Pacific Biosciences nor the names of its
+ contributors may be used to endorse or promote products derived from
+ this software without specific prior written permission.
+
+NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE
+GRANTED BY THIS LICENSE. THIS SOFTWARE IS PROVIDED BY PACIFIC
+BIOSCIENCES AND ITS CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED
+WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF
+MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE
+DISCLAIMED. IN NO EVENT SHALL PACIFIC BIOSCIENCES OR ITS CONTRIBUTORS
+BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
+CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
+SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR
+BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
+WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE
+OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN
+IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
diff --git a/Makefile b/Makefile
new file mode 100644
index 0000000..0033c53
--- /dev/null
+++ b/Makefile
@@ -0,0 +1,62 @@
+SHELL = /bin/bash -e
+INTERNAL_UTILS_PATH = /mnt/secondary/Share/Quiver/Tools
+
+bdist:
+ python setup.py build --executable="/usr/bin/env python"
+ python setup.py bdist --formats=egg
+
+install:
+ python setup.py install
+
+develop:
+ python setup.py develop
+
+tests:
+ # Unit tests
+ nosetests --with-xunit tests/unit
+ # End-to-end tests
+ PATH=`pwd`:$(PATH) cram tests/cram/*.t
+
+extra-tests:
+ # Tests that need to be run by Jenkins but are slowing
+ # down the development cycle, so aren't run by "tests"
+ # target.
+ PATH=`pwd`:$(PATH) cram tests/cram/extra/*.t
+
+internal-tests:
+ # Long running tests that depend on files located on PacBio internal NFS
+ # servers, including some utilities (exonerate suite, MuMMer)
+ (. /mnt/software/Modules/current/init/bash && \
+ module add mummer/3.23 && \
+ module add exonerate/2.0.0 && \
+ module add blasr/2.3.0 && \
+ module add gfftools/dalexander && \
+ cram tests/cram/internal/*.t)
+
+doc:
+ cd doc; make html
+
+clean:
+ -rm -rf dist/ build/ *.egg-info
+ -rm -rf doc/_build
+ -rm -f nosetests.xml
+ -find . -name "*.pyc" | xargs rm -f
+
+tags:
+ find GenomicConsensus -name "*.py" | xargs etags
+
+pip-install:
+ @which pip > /dev/null
+ @pip freeze|grep 'GenomicConsensus=='>/dev/null \
+ && pip uninstall -y GenomicConsensus \
+ || true
+ @pip install --no-index \
+ --install-option="--install-scripts=$(PREFIX)/bin" \
+ ./
+
+# Aliases
+docs: doc
+check: tests
+test: tests
+
+.PHONY: check test tests doc docs clean tags
diff --git a/README.md b/README.md
new file mode 100644
index 0000000..5fddad9
--- /dev/null
+++ b/README.md
@@ -0,0 +1,36 @@
+GenomicConsensus (quiver)
+-------------------------
+
+The ``GenomicConsensus`` package provides the ``quiver`` tool, PacBio's flagship consensus
+and variant caller. The backend logic is provided by the
+``ConsensusCore`` library, which you must install first.
+
+
+Installing
+----------
+Make sure you have set up and activated your virtualenv, and
+installed ``pbcore`` and ``ConsensusCore`` (which cannot be
+installed automatically by pip or setuptools). Then:
+
+```sh
+% python setup.py install
+````
+
+Running
+-------
+Basic usage is as follows:
+
+```sh
+% quiver aligned_reads.cmp.h5 -r reference.fasta -o variants.gff -o consensus.fasta -o consensus.fastq
+```
+
+in this example we perform haploid consensus and variant calling on the mapped reads in the ``aligned_reads.cmp.h5`` which was aligned to ``reference.fasta``. The ``reference.fasta`` is only used for designating variant calls, not for computing the consensus. The consensus quality score for every position can be found in the output FASTQ file.
+
+
+Documentation
+-------------
+
+- [More detailed installation instructions](https://github.com/PacificBiosciences/GenomicConsensus/blob/master/doc/HowToQuiver.rst)
+- [Quiver FAQ](https://github.com/PacificBiosciences/GenomicConsensus/blob/master/doc/QuiverFAQ.rst)
+- [variants.gff spec](https://github.com/PacificBiosciences/GenomicConsensus/blob/master/doc/VariantsGffSpecification.rst)
+- [CHANGELOG](https://github.com/PacificBiosciences/GenomicConsensus/blob/master/CHANGELOG)
diff --git a/bin/gffToBed.py b/bin/gffToBed.py
new file mode 100755
index 0000000..b4112fe
--- /dev/null
+++ b/bin/gffToBed.py
@@ -0,0 +1,141 @@
+#!/usr/bin/env python
+import sys
+import os
+import time
+import traceback
+from optparse import OptionParser
+from pbcore.io import GffReader, WriterBase
+
+#
+# (Ported from pbpy)
+#
+
+class BedRecord:
+ """Models a record in a BED file format"""
+ def __init__(self):
+ self.chrom=''
+ self.chromStart = 0
+ self.chromEnd = 0
+ self.name = ''
+ self.score = -1.00
+ self.strand = '+'
+
+ def __str__(self):
+ return '%s\t%d\t%d\t%s\t%.3f\t%s' % \
+ (self.chrom, self.chromStart, self.chromEnd, self.name, \
+ self.score, self.strand)
+
+class CoverageBedRecord(BedRecord):
+ @staticmethod
+ def fromAlignmentSummaryGffRecord(gff):
+ bed = CoverageBedRecord()
+ bed.chrom = gff.seqid
+ bed.chromStart = gff.start - 1
+ bed.chromEnd = gff.end
+ bed.name = 'meanCov'
+ bed.score = float(gff.cov2.split(',')[0])
+ bed.strand = gff.strand
+ return bed
+
+class VariantsBedRecord(BedRecord):
+ @staticmethod
+ def fromVariantGffRecord(gff):
+ bed = VariantsBedRecord()
+ bed.chrom = gff.seqid
+ bed.chromStart = gff.start - 1
+ bed.score = float(gff.confidence)
+ bed.strand = gff.strand
+
+ feature = gff.type
+ #GFF3 coordinates are 1-based and inclusive
+ #BED coordinates are 0-based and exclusive
+ if feature == 'insertion':
+ bed.chromEnd = bed.chromStart + 1
+ bed.name = '%d_%dins%s' % (bed.chromStart + 1,
+ bed.chromEnd + 1,
+ gff.variantSeq)
+ elif feature == 'deletion':
+ featureLen = len(gff.reference)
+ bed.chromEnd = bed.chromStart + featureLen
+ if featureLen == 1:
+ bed.name = "%ddel" % (bed.chromStart + 1)
+ else:
+ bed.name = '%d_%ddel' % (bed.chromStart + 1, bed.chromEnd)
+ elif feature == 'substitution':
+ bed.chromEnd = bed.chromStart + 1
+ bed.name = '%d%s>%s' % (bed.chromStart + 1,
+ gff.reference,
+ gff.variantSeq)
+ else:
+ print >> sys.stderr, 'Unsupported feature %s found in GFF3 file.' % feature
+
+ return bed
+
+class BedWriter(WriterBase):
+ """Outputs BED annotation track file"""
+ def __init__(self, outfile):
+ self._outfile = outfile
+
+ def close(self):
+ self._outfile.close()
+
+ def flush(self):
+ self._outfile.flush()
+
+ def writeHeader(self, name, description, useScore):
+ print >> self._outfile, 'track name=%s description="%s" useScore=%d' \
+ % (name, description, useScore)
+
+ def writeRecord(self, record):
+ print >> self._outfile, str(record)
+
+class GffToBed:
+ """
+ Utility for converting GFF3 to BED format. Currently supports
+ regional coverage or variant .bed output.
+ """
+ def __init__(self, argv):
+ self.__parseOptions(argv)
+
+ def __parseOptions(self, argv):
+ usage = 'Usage: %prog [--help] [options] purpose[coverage|variants] input.gff > output.bed'
+ parser = OptionParser(usage=usage, description=GffToBed.__doc__)
+
+ parser.add_option('--name', type="string",
+ help="track name to display in header")
+ parser.add_option('--description', type="string",
+ help="track description to display in header")
+ parser.add_option('--useScore', type="int", default=0,
+ help="whether or not to use score for feature display")
+
+ self.options, self.args=parser.parse_args(argv)
+ if len(self.args)!=3:
+ parser.error('Expected 2 argument')
+
+ self.purpose = self.args[1]
+
+ if self.purpose not in [ "variants", "coverage" ]:
+ print >> sys.stderr, \
+ "Purpose %s not supported. Must be one of: [variants|coverage]" % (self.purpose)
+ sys.exit(-1)
+
+ self.gffFile = self.args[2]
+
+ def run(self):
+ with GffReader(self.gffFile) as reader, \
+ BedWriter(sys.stdout) as writer:
+
+ writer.writeHeader(self.options.name,
+ self.options.description,
+ self.options.useScore)
+ for gff in reader:
+ if self.purpose == 'coverage':
+ bedRecord = CoverageBedRecord.fromAlignmentSummaryGffRecord(gff)
+ else:
+ bedRecord = VariantsBedRecord.fromVariantGffRecord(gff)
+ writer.writeRecord(bedRecord)
+
+
+if __name__ == '__main__':
+ app = GffToBed(sys.argv)
+ sys.exit(app.run())
diff --git a/bin/gffToVcf.py b/bin/gffToVcf.py
new file mode 100755
index 0000000..faefc6b
--- /dev/null
+++ b/bin/gffToVcf.py
@@ -0,0 +1,136 @@
+#!/usr/bin/env python
+import sys
+import os
+import time
+import traceback
+from optparse import OptionParser
+from pbcore.io import GffReader, WriterBase
+
+#
+# (Ported from pbpy)
+#
+
+class VcfRecord:
+ """Models a record in a VCF3.3 file."""
+ def __init__(self):
+ self.chrom = ''
+ self.pos = 1
+ self.id = '.'
+ self.ref = ''
+ self.alt = ''
+ self.qual = -1.00
+ self.filter = '0'
+ self.info = {}
+
+ @staticmethod
+ def fromVariantGffRecord(gff):
+ vcf = VcfRecord()
+ vcf.chrom = gff.seqid
+ vcf.id = '.'
+
+ ref = gff.reference
+ if ref is None:
+ vcf.ref = "N"
+ else:
+ vcf.ref = ref
+ vcf.qual = float(gff.confidence)
+ vcf.put('NS', 1)
+ vcf.put('DP', gff.coverage)
+
+ feature = gff.type
+ vcf.pos = gff.start
+ if feature == 'insertion':
+ vcf.alt = 'I%s' % gff.variantSeq.upper()
+ elif feature == 'deletion':
+ vcf.alt = 'D%s' % len(gff.reference)
+ elif feature == 'substitution':
+ vcf.alt = gff.variantSeq.upper()
+ else:
+ print >> sys.stderr, 'Unsupported feature %s found in GFF3 file.' % feature
+
+ return vcf
+
+ def put(self, key, value):
+ self.info[key] = value
+
+ @staticmethod
+ def getHeader():
+ return 'CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO'
+
+ def _getInfoString(self):
+ return ';'.join(['%s=%s' % (k,v) \
+ for k,v in self.info.iteritems()])
+
+ def __str__(self):
+ return '%s\t%d\t%s\t%s\t%s\t%.2f\t%s\t%s' % \
+ (self.chrom, self.pos, self.id, self.ref, \
+ self.alt, self.qual, self.filter, self._getInfoString())
+
+class VcfWriter(WriterBase):
+ """Outputs VCF (1000 Genomes Variant Call Format) 3.3 files"""
+ def __init__(self, outfile):
+ self._outfile = outfile
+ self._start()
+
+ def close(self):
+ self._outfile.close()
+
+ def flush(self):
+ self._outfile.flush()
+
+ def _start(self):
+ self.writeMetaData('fileformat', 'VCFv3.3')
+
+ def writeHeader(self):
+ print >> self._outfile, '#%s' % VcfRecord.getHeader()
+
+ def writeMetaData(self, key, value):
+ print >> self._outfile, '##%s=%s' % (key, value)
+
+ def writeRecord( self, record ):
+ print >> self._outfile, str(record)
+
+class GffToVcf(object):
+ """Utility for converting variant GFF3 files to 1000 Genomes VCF"""
+ def __init__(self, argv):
+ self.__parseOptions(argv)
+
+ def __parseOptions(self, argv):
+ usage = 'Usage: %prog [--help] [options] variants.gff > variants.vcf'
+ parser = OptionParser(usage=usage, description=GffToVcf.__doc__)
+ parser.add_option('--globalReference', type="string",
+ help="Name of global reference to put in Meta field")
+ parser.set_defaults(globalReference=None)
+
+ self.options, self.args=parser.parse_args(argv)
+ if len(self.args)!=2:
+ parser.error('Expected 1 argument')
+
+ self.gffFile = self.args[1]
+
+ def _writeMetaData(self, writer):
+ currentTime = time.localtime()
+ cmdLine = os.path.basename(sys.argv[0]) + ' ' + ' '.join(sys.argv[1:])
+
+ writer.writeMetaData('fileDate', '%d%d%d' % \
+ (currentTime[0], currentTime[1], currentTime[2]))
+ writer.writeMetaData('source', cmdLine)
+ if self.options.globalReference is not None:
+ writer.writeMetaData('reference', self.options.globalReference)
+ writer.writeMetaData('INFO', 'NS,1,Integer,"Number of Samples with Data"')
+ writer.writeMetaData('INFO', 'DP,1,Integer,"Total Depth of Coverage"')
+
+ writer.writeHeader()
+
+ def run(self):
+ with GffReader(self.gffFile) as reader, \
+ VcfWriter(sys.stdout) as writer:
+ self._writeMetaData(writer)
+ for gff in reader:
+ vcf = VcfRecord.fromVariantGffRecord(gff)
+ writer.writeRecord(vcf)
+
+
+if __name__ == '__main__':
+ app = GffToVcf(sys.argv)
+ sys.exit(app.run())
diff --git a/bin/makePbi.py b/bin/makePbi.py
new file mode 100755
index 0000000..ac57182
--- /dev/null
+++ b/bin/makePbi.py
@@ -0,0 +1,115 @@
+#!/usr/bin/env python
+
+import argparse
+import h5py
+import pysam
+import numpy as np
+from collections import Counter, OrderedDict
+
+from pbcore.io import BamReader, BamAlignment
+
+# Call: makePbi.py bamfile referenceFasta
+# Warning: this is a very inefficient reference implementation.
+
+PBI_VERSION = "3.0"
+
+PBI_COLUMNS_AND_TYPES = [ ("tId" , np.int32),
+ ("tStart" , np.int32),
+ ("tEnd" , np.int32),
+ ("qId" , np.int32),
+ ("qStart" , np.int32),
+ ("qEnd" , np.int32),
+ ("aStart" , np.int32),
+ ("aEnd" , np.int32),
+ ("holeNumber" , np.int32),
+ ("isReverseStrand" , np.int8),
+ ("nM" , np.int32),
+ ("nMM" , np.int32),
+ ("mapQV" , np.uint8),
+ ("virtualFileOffset" , np.uint64) ]
+
+def main():
+ parser = argparse.ArgumentParser(description="Build PacBio BAM index for a bam")
+ parser.add_argument("bamFile", type=argparse.FileType("r"))
+ parser.add_argument("--referenceFasta", type=argparse.FileType("r"))
+ parser.add_argument("--lite", action="store_true")
+
+ args = parser.parse_args()
+
+ bamFname = args.bamFile.name
+ if args.referenceFasta:
+ refFname = args.referenceFasta.name
+ else:
+ refFname = None
+
+ pbi = h5py.File(bamFname + ".pbi", "w")
+ p = pysam.Samfile(bamFname, check_sq=False)
+ B = BamReader(bamFname, refFname)
+
+ lsts = dict((columnName, [])
+ for (columnName, dtype_) in PBI_COLUMNS_AND_TYPES)
+ p.reset()
+ while True:
+ offset = p.tell()
+ try:
+ rawAln = next(p)
+ except StopIteration:
+ break
+
+ aln = BamAlignment(B, rawAln)
+
+ if aln.isMapped:
+ lsts["tId" ].append(aln.tId)
+ lsts["tStart" ].append(aln.tStart)
+ lsts["tEnd" ].append(aln.tEnd)
+ lsts["qId" ].append(aln.qId)
+ lsts["qStart" ].append(aln.qStart)
+ lsts["qEnd" ].append(aln.qEnd)
+ lsts["aStart" ].append(aln.aStart)
+ lsts["aEnd" ].append(aln.aEnd)
+ lsts["holeNumber" ].append(aln.HoleNumber)
+ lsts["isReverseStrand" ].append(aln.isReverseStrand)
+ lsts["mapQV" ].append(aln.MapQV)
+ lsts["virtualFileOffset" ].append(offset)
+ if not args.lite:
+ transcript = aln.transcript()
+ moveCounts = Counter(transcript)
+ lsts["nM" ].append(moveCounts["M"])
+ lsts["nMM" ].append(moveCounts["R"])
+
+ else:
+ # Unmapped
+ lsts["tId" ].append(-1)
+ lsts["tStart" ].append(-1)
+ lsts["tEnd" ].append(-1)
+ lsts["qId" ].append(aln.qId)
+ lsts["qStart" ].append(aln.qStart)
+ lsts["qEnd" ].append(aln.qEnd)
+ lsts["aStart" ].append(-1)
+ lsts["aEnd" ].append(-1)
+ lsts["holeNumber" ].append(aln.HoleNumber)
+ lsts["isReverseStrand" ].append(-1)
+ lsts["mapQV" ].append(-1)
+ lsts["virtualFileOffset" ].append(offset)
+ lsts["nM" ].append(-1)
+ lsts["nMM" ].append(-1)
+
+
+ # Lists to arrays
+ dsets = {}
+ for (name, dtype) in PBI_COLUMNS_AND_TYPES:
+ dsets[name] = np.fromiter(lsts[name], dtype)
+ del lsts[name]
+
+ # Write to file, gzipped
+ grp = pbi.create_group("PacBioBamIndex")
+ grp.attrs["Version"] = np.string_(PBI_VERSION)
+ columnsGrp = grp.create_group("Columns")
+ for (name, ds) in dsets.iteritems():
+ columnsGrp.create_dataset(name, data=ds, chunks=True, compression="gzip")
+ pbi.close()
+
+
+
+if __name__ == '__main__':
+ main()
diff --git a/bin/plurality b/bin/plurality
new file mode 100755
index 0000000..e0e5d1b
--- /dev/null
+++ b/bin/plurality
@@ -0,0 +1,2 @@
+#!/bin/sh
+variantCaller.py --algorithm=plurality $*
diff --git a/bin/quiver b/bin/quiver
new file mode 100755
index 0000000..16a98a2
--- /dev/null
+++ b/bin/quiver
@@ -0,0 +1,2 @@
+#!/bin/sh
+variantCaller.py --algorithm=quiver $*
diff --git a/bin/summarizeConsensus.py b/bin/summarizeConsensus.py
new file mode 100755
index 0000000..c0340bf
--- /dev/null
+++ b/bin/summarizeConsensus.py
@@ -0,0 +1,99 @@
+#!/usr/bin/env python
+
+import argparse, gzip, numpy as np, sys
+from collections import namedtuple
+
+from pbcore.io import GffReader, GffWriter, Gff3Record
+from GenomicConsensus.utils import error_probability_to_qv
+from GenomicConsensus import __VERSION__
+
+#
+# Note: GFF-style coordinates
+#
+Region = namedtuple("Region", ("seqid", "start", "end"))
+
+def main():
+ headers = [
+ ("source", "GenomicConsensus %s" % __VERSION__),
+ ("pacbio-alignment-summary-version", "0.6"),
+ ("source-commandline", " ".join(sys.argv)),
+ ]
+
+ desc = "Augment the alignment_summary.gff file with consensus and variants information."
+ parser = argparse.ArgumentParser(description=desc)
+ parser.add_argument("--variantsGff",
+ type=str,
+ help="Input variants.gff or variants.gff.gz filename",
+ required=True)
+ parser.add_argument("--output",
+ "-o",
+ type=str,
+ help="Output alignment_summary.gff filename")
+ parser.add_argument("inputAlignmentSummaryGff",
+ type=str,
+ help="Input alignment_summary.gff filename")
+
+ options = parser.parse_args()
+
+ inputVariantsGff = GffReader(options.variantsGff)
+ inputAlignmentSummaryGff = GffReader(options.inputAlignmentSummaryGff)
+
+ summaries = {}
+ for gffRecord in inputAlignmentSummaryGff:
+ region = Region(gffRecord.seqid, gffRecord.start, gffRecord.end)
+ summaries[region] = { "ins" : 0,
+ "del" : 0,
+ "sub" : 0,
+ "cQv" : (0, 0, 0)
+ }
+ inputAlignmentSummaryGff.close()
+
+ counterNames = { "insertion" : "ins",
+ "deletion" : "del",
+ "substitution" : "sub" }
+ for variantGffRecord in inputVariantsGff:
+ for region in summaries:
+ summary = summaries[region]
+ if (region.seqid == variantGffRecord.seqid and
+ region.start <= variantGffRecord.start <= region.end):
+ counterName = counterNames[variantGffRecord.type]
+ variantLength = max(len(variantGffRecord.reference),
+ len(variantGffRecord.variantSeq))
+ summary[counterName] += variantLength
+ # TODO: base consensusQV on effective coverage
+ summary["cQv"] = (20, 20, 20)
+
+ inputAlignmentSummaryGff = open(options.inputAlignmentSummaryGff)
+ outputAlignmentSummaryGff = open(options.output, "w")
+
+ inHeader = True
+
+ for line in inputAlignmentSummaryGff:
+ line = line.rstrip()
+
+ # Pass any metadata line straight through
+ if line[0] == "#":
+ print >>outputAlignmentSummaryGff, line.strip()
+ continue
+
+ if inHeader:
+ # We are at the end of the header -- write the tool-specific headers
+ for k, v in headers:
+ print >>outputAlignmentSummaryGff, ("##%s %s" % (k, v))
+ inHeader = False
+
+ # Parse the line
+ rec = Gff3Record.fromString(line)
+
+ if rec.type == "region":
+ summary = summaries[(rec.seqid, rec.start, rec.end)]
+ if "cQv" in summary:
+ cQvTuple = summary["cQv"]
+ line += ";%s=%s" % ("cQv", ",".join(str(int(f)) for f in cQvTuple))
+ for counterName in counterNames.values():
+ if counterName in summary:
+ line += ";%s=%d" % (counterName, summary[counterName])
+ print >>outputAlignmentSummaryGff, line
+
+if __name__ == "__main__":
+ main()
diff --git a/bin/variantCaller.py b/bin/variantCaller.py
new file mode 100755
index 0000000..8cd8cf0
--- /dev/null
+++ b/bin/variantCaller.py
@@ -0,0 +1,5 @@
+#!/usr/bin/env python
+import sys
+from GenomicConsensus.main import main
+if __name__ == '__main__':
+ sys.exit(main())
diff --git a/doc/HowToQuiver.rst b/doc/HowToQuiver.rst
new file mode 100644
index 0000000..3ab76d7
--- /dev/null
+++ b/doc/HowToQuiver.rst
@@ -0,0 +1,178 @@
+
+How to install and use Quiver
+=============================
+
+Quiver is bundled in SMRTanalysis version 1.4 and later. The easiest
+way to get Quiver is to install the most recent version of SMRTanalysis.
+
+If you want to install Quiver as a standalone package from the latest
+bleeding-edge code, follow the instructions below.
+
+*Note: please install this software on an isolated machine that does
+not have SMRTanalysis installed. Older versions of SMRTanalysis
+pollute the ``PYTHONPATH``, which has the undesirable effect of
+overriding ``virtualenv``-installed modules.*
+
+Background
+----------
+**Quiver** is an algorithm for calling highly accurate consensus from
+multiple PacBio reads, using a pair-HMM exploiting both the basecalls
+and QV metrics to infer the true underlying DNA sequence.
+
+Quiver is available through the ``quiver`` script from the
+``GenomicConsensus`` package. To use Quiver, the following PacBio
+software is required.
+
+- ``GenomicConsensus``, containing ``quiver``
+- ``ConsensusCore``, a C++ library containing the core computational
+ routines for Quiver
+- ``pbcore``, a package providing access to PacBio data files
+
+
+Required libraries and tools
+----------------------------
+To install the PacBio software, the following are required:
+
+- Boost >= 1.4.7 (standard C++ libraries)
+- SWIG >= 2.0.7 (library wrapper generator)
+- Python 2.7.3
+- virtualenv (builds isolated Python environments)
+
+If you are within PacBio, these requirements are already installed
+within the cluster environment.
+
+Otherwise, you will need to install them yourself. The automatic
+installation script requires that the ``swig`` executable is in your
+UNIX ``$PATH`` and that your boost installation can be found under
+``/usr/include`` or ``/usr/local``.
+
+
+Data file requirements
+----------------------
+
+To make the most accurate consensus calls possible, Quiver makes use
+of a battery of quality value metrics calculated by the basecaller.
+If you are using a SMRTportal installation verision 1.4 or later, then
+SMRTportal will load all the information Quiver needs, so you
+can skip the rest of this section.
+
+In SMRTportal versions 1.3.3 and prior, by default only a subset of
+these quality values are included in the ``.cmp.h5`` files produced by
+SMRTanalysis. To get a ``.cmp.h5`` with all the QVs loaded, you will
+need to use the ``RS_Mapping_QVs`` protocol to create a ``cmp.h5``
+file for Quiver.
+
+If you are using an older version than SMRTportal/SMRTanalysis 1.3.3,
+please upgrade.
+
+
+Automatic installation instructions
+-----------------------------------
+If your system meets the installation requirements, you can perform an
+automatic installation of the PacBio software for Quiver by
+executing::
+
+ $ curl -L http://git.io/JR7TnQ | bash
+
+
+Manual installation instructions
+--------------------------------
+If your SWIG or BOOST installations are in non-standard locations or
+you encounter a problem with the automatic installation script, you
+can follow these steps to install Quiver manually.
+
+
+
+Step 1: Set up your Python environment
+``````````````````````````````````````
+I recommend using a Python *virtualenv* to isolate your sandbox.
+
+To set up a new virtualenv, do ::
+
+ $ cd; virtualenv -p python2.7 --no-site-packages VE-QUIVER
+
+and activate the virtualenv using ::
+
+ $ source ~/VE-QUIVER/bin/activate
+
+There are some additional Python libraries required (NumPy and h5py),
+which can be installed via ::
+
+ $ pip install numpy==1.6.1
+ $ pip install h5py==2.0.1
+
+
+Step 2: Install PacBio libraries
+````````````````````````````````
+To install the PacBio software, execute ::
+
+ $ pip install git+https://github.com/PacificBiosciences/pbcore
+ $ git clone https://github.com/PacificBiosciences/ConsensusCore
+ $ cd ConsensusCore; python setup.py install --swig=$SWIG --boost=$BOOST
+ $ pip install git+https://github.com/PacificBiosciences/GenomicConsensus
+
+where you replace ``$SWIG`` with the path to your ``swig`` executable
+and ``$BOOST`` with the path to your boost install (the top level
+directory). (Note that if SWIG is in your ``$PATH`` and boost is in
+``/usr/local`` or ``/usr/include/``, you do not need to specify these
+flags on the command line---``setup.py`` will find them).
+
+
+Step 3: Run Quiver
+``````````````````
+Those who wish to call consensus on a resequencing job can simply use
+the ``quiver`` script that has been installed in your
+virtualenv (from `GenomicConsensus`).
+
+For example, ::
+
+ $ quiver -j8 aligned_reads.cmp.h5 \
+ > -r path/to/lambda.fasta \
+ > -o variants.gff -o consensus.fasta
+
+will use 8 CPUs to run Quiver on ``aligned_reads.cmp.h5``, outputting
+the consensus sequence and variants.
+
+Note that if you have not used the `RS_Mapping_QVs` protocol to
+generate the cmp.h5 file---or if the source bas.h5 file was generated
+by pre-1.3.1 instrument software---the cmp.h5 will not contain the
+full battery of QV metrics required for optimal Quiver accuracy. The
+command will still work, but it will give a warning that its accuracy
+will be suboptimal.
+
+
+Step 4: Highly-accurate assembly consensus
+``````````````````````````````````````````
+Quiver enables consensus accuracies on genome assemblies at accuracies
+approaching or even exceeding Q60 (one error per million bases). If
+you use the HGAP assembly protocol in SMRTportal 2.0 or later, Quiver
+runs automatically as the final "assembly polishing" step.
+
+If you want to use Quiver to *manually* polish an assembly, you need to:
+
+- upload your draft assembly to SMRTportal as a new reference,
+- run the Resequencing protocol to call the consensus of your PacBio
+ reads as oriented by the draft assembly. The variants output will
+ show the "corrections" made by Quiver, while the consensus
+ FASTA/FASTQ output contain the sequence and quality of the polished
+ assembly.
+
+
+Known issues
+------------
+There is a bug in the `multiprocessing` module in Python 2.7.2 and
+lower that causes the interpreter to crash during shutdown. Use
+Python 2.7.3 or newer.
+
+
+Resources
+---------
+Here is an `FAQ document`_ to address common issues.
+
+For a technical summary of some of the details of how Quiver works, I
+recommend reading the supplementary material of our 2013 *Nature
+Methods* `HGAP paper`_
+
+
+.. _`FAQ document`: https://github.com/PacificBiosciences/GenomicConsensus/blob/master/doc/QuiverFAQ.rst
+.. _`HGAP paper`:
diff --git a/doc/Makefile b/doc/Makefile
new file mode 100644
index 0000000..80feb09
--- /dev/null
+++ b/doc/Makefile
@@ -0,0 +1,153 @@
+# Makefile for Sphinx documentation
+#
+
+# You can set these variables from the command line.
+SPHINXOPTS =
+SPHINXBUILD = sphinx-build
+PAPER =
+BUILDDIR = _build
+
+# Internal variables.
+PAPEROPT_a4 = -D latex_paper_size=a4
+PAPEROPT_letter = -D latex_paper_size=letter
+ALLSPHINXOPTS = -d $(BUILDDIR)/doctrees $(PAPEROPT_$(PAPER)) $(SPHINXOPTS) .
+# the i18n builder cannot share the environment and doctrees with the others
+I18NSPHINXOPTS = $(PAPEROPT_$(PAPER)) $(SPHINXOPTS) .
+
+.PHONY: help clean html dirhtml singlehtml pickle json htmlhelp qthelp devhelp epub latex latexpdf text man changes linkcheck doctest gettext
+
+help:
+ @echo "Please use \`make <target>' where <target> is one of"
+ @echo " html to make standalone HTML files"
+ @echo " dirhtml to make HTML files named index.html in directories"
+ @echo " singlehtml to make a single large HTML file"
+ @echo " pickle to make pickle files"
+ @echo " json to make JSON files"
+ @echo " htmlhelp to make HTML files and a HTML help project"
+ @echo " qthelp to make HTML files and a qthelp project"
+ @echo " devhelp to make HTML files and a Devhelp project"
+ @echo " epub to make an epub"
+ @echo " latex to make LaTeX files, you can set PAPER=a4 or PAPER=letter"
+ @echo " latexpdf to make LaTeX files and run them through pdflatex"
+ @echo " text to make text files"
+ @echo " man to make manual pages"
+ @echo " texinfo to make Texinfo files"
+ @echo " info to make Texinfo files and run them through makeinfo"
+ @echo " gettext to make PO message catalogs"
+ @echo " changes to make an overview of all changed/added/deprecated items"
+ @echo " linkcheck to check all external links for integrity"
+ @echo " doctest to run all doctests embedded in the documentation (if enabled)"
+
+clean:
+ -rm -rf $(BUILDDIR)/*
+
+html:
+ $(SPHINXBUILD) -b html $(ALLSPHINXOPTS) $(BUILDDIR)/html
+ @echo
+ @echo "Build finished. The HTML pages are in $(BUILDDIR)/html."
+
+dirhtml:
+ $(SPHINXBUILD) -b dirhtml $(ALLSPHINXOPTS) $(BUILDDIR)/dirhtml
+ @echo
+ @echo "Build finished. The HTML pages are in $(BUILDDIR)/dirhtml."
+
+singlehtml:
+ $(SPHINXBUILD) -b singlehtml $(ALLSPHINXOPTS) $(BUILDDIR)/singlehtml
+ @echo
+ @echo "Build finished. The HTML page is in $(BUILDDIR)/singlehtml."
+
+pickle:
+ $(SPHINXBUILD) -b pickle $(ALLSPHINXOPTS) $(BUILDDIR)/pickle
+ @echo
+ @echo "Build finished; now you can process the pickle files."
+
+json:
+ $(SPHINXBUILD) -b json $(ALLSPHINXOPTS) $(BUILDDIR)/json
+ @echo
+ @echo "Build finished; now you can process the JSON files."
+
+htmlhelp:
+ $(SPHINXBUILD) -b htmlhelp $(ALLSPHINXOPTS) $(BUILDDIR)/htmlhelp
+ @echo
+ @echo "Build finished; now you can run HTML Help Workshop with the" \
+ ".hhp project file in $(BUILDDIR)/htmlhelp."
+
+qthelp:
+ $(SPHINXBUILD) -b qthelp $(ALLSPHINXOPTS) $(BUILDDIR)/qthelp
+ @echo
+ @echo "Build finished; now you can run "qcollectiongenerator" with the" \
+ ".qhcp project file in $(BUILDDIR)/qthelp, like this:"
+ @echo "# qcollectiongenerator $(BUILDDIR)/qthelp/GenomicConsensus.qhcp"
+ @echo "To view the help file:"
+ @echo "# assistant -collectionFile $(BUILDDIR)/qthelp/GenomicConsensus.qhc"
+
+devhelp:
+ $(SPHINXBUILD) -b devhelp $(ALLSPHINXOPTS) $(BUILDDIR)/devhelp
+ @echo
+ @echo "Build finished."
+ @echo "To view the help file:"
+ @echo "# mkdir -p $$HOME/.local/share/devhelp/GenomicConsensus"
+ @echo "# ln -s $(BUILDDIR)/devhelp $$HOME/.local/share/devhelp/GenomicConsensus"
+ @echo "# devhelp"
+
+epub:
+ $(SPHINXBUILD) -b epub $(ALLSPHINXOPTS) $(BUILDDIR)/epub
+ @echo
+ @echo "Build finished. The epub file is in $(BUILDDIR)/epub."
+
+latex:
+ $(SPHINXBUILD) -b latex $(ALLSPHINXOPTS) $(BUILDDIR)/latex
+ @echo
+ @echo "Build finished; the LaTeX files are in $(BUILDDIR)/latex."
+ @echo "Run \`make' in that directory to run these through (pdf)latex" \
+ "(use \`make latexpdf' here to do that automatically)."
+
+latexpdf:
+ $(SPHINXBUILD) -b latex $(ALLSPHINXOPTS) $(BUILDDIR)/latex
+ @echo "Running LaTeX files through pdflatex..."
+ $(MAKE) -C $(BUILDDIR)/latex all-pdf
+ @echo "pdflatex finished; the PDF files are in $(BUILDDIR)/latex."
+
+text:
+ $(SPHINXBUILD) -b text $(ALLSPHINXOPTS) $(BUILDDIR)/text
+ @echo
+ @echo "Build finished. The text files are in $(BUILDDIR)/text."
+
+man:
+ $(SPHINXBUILD) -b man $(ALLSPHINXOPTS) $(BUILDDIR)/man
+ @echo
+ @echo "Build finished. The manual pages are in $(BUILDDIR)/man."
+
+texinfo:
+ $(SPHINXBUILD) -b texinfo $(ALLSPHINXOPTS) $(BUILDDIR)/texinfo
+ @echo
+ @echo "Build finished. The Texinfo files are in $(BUILDDIR)/texinfo."
+ @echo "Run \`make' in that directory to run these through makeinfo" \
+ "(use \`make info' here to do that automatically)."
+
+info:
+ $(SPHINXBUILD) -b texinfo $(ALLSPHINXOPTS) $(BUILDDIR)/texinfo
+ @echo "Running Texinfo files through makeinfo..."
+ make -C $(BUILDDIR)/texinfo info
+ @echo "makeinfo finished; the Info files are in $(BUILDDIR)/texinfo."
+
+gettext:
+ $(SPHINXBUILD) -b gettext $(I18NSPHINXOPTS) $(BUILDDIR)/locale
+ @echo
+ @echo "Build finished. The message catalogs are in $(BUILDDIR)/locale."
+
+changes:
+ $(SPHINXBUILD) -b changes $(ALLSPHINXOPTS) $(BUILDDIR)/changes
+ @echo
+ @echo "The overview file is in $(BUILDDIR)/changes."
+
+linkcheck:
+ $(SPHINXBUILD) -b linkcheck $(ALLSPHINXOPTS) $(BUILDDIR)/linkcheck
+ @echo
+ @echo "Link check complete; look for any errors in the above output " \
+ "or in $(BUILDDIR)/linkcheck/output.txt."
+
+doctest:
+ $(SPHINXBUILD) -b doctest $(ALLSPHINXOPTS) $(BUILDDIR)/doctest
+ @echo "Testing of doctests in the sources finished, look at the " \
+ "results in $(BUILDDIR)/doctest/output.txt."
diff --git a/doc/QuiverFAQ.rst b/doc/QuiverFAQ.rst
new file mode 100644
index 0000000..706551e
--- /dev/null
+++ b/doc/QuiverFAQ.rst
@@ -0,0 +1,376 @@
+Quiver FAQ
+==========
+
+What are EviCons? GenomicConsensus? Quiver? Plurality?
+------------------------------------------------------------
+**GenomicConsensus** is the current PacBio consensus and variant calling suite. It contains a main program, ``variantCaller.py``,
+which provides two consensus / variant calling algorithms: **Plurality** and **Quiver**. These algorithms can be run by calling ``variantCaller.py --algorithm=[quiver|plurality]`` or by going through the convenience wrapper scripes ``quiver`` and ``plurality``.
+
+**EviCons** was the previous generation PacBio variant caller (removed in software release v1.3.1).
+
+A separate package called **ConsensusCore** is a C++ library where all the computation behind Quiver is done (and is transparent to the user after installation).
+
+
+What is Plurality?
+------------------
+**Plurality** is a very simple variant calling algorithm: it stacks up the
+aligned reads (alignment as produced by BLASR, or alternate mapping
+tool), and for each column under a reference base, calls the most
+abundant (i.e., the plurality) read base (or bases, or deletion) as
+the consensus at that reference position.
+
+
+Why is Plurality a weak algorithm?
+----------------------------------
+Plurality does not perform any local realignment. This means it is
+heavily biased by the alignment produced by the mapper (BLASR,
+typically). It also means that it is insensitive at detecting indels.
+Consider this example::
+
+ Reference AAAA
+ ----
+ Aligned A-AA
+ reads AA-A
+ -AAA
+ ----
+ Plurality AAAA
+ consensus
+
+Note here that every read has a deletion and the correct consensus
+call would be "AAA", but due to the mapper's freedom in gap-placement
+at the single-read level, the plurality sequence is "AAAA"---so the
+deletion is missed. Local realignment, which plurality does not do,
+but which could be considered as implicit in the Quiver algorithm,
+essentially pushes the gaps here to the same column, thus identifying
+the deletion. While plurality could be adjusted to use a simple "gap
+normalizing" realignment, in practice noncognate extras (spurious
+non-homopolymer base calls) in the midst of homopolymer runs pose
+challenges.
+
+What is Quiver?
+---------------
+**Quiver** is a more sophisticated algorithm that finds the maximum
+likelihood template sequence given PacBio reads of the template.
+PacBio reads are modeled using a conditional random field approach that
+prescribes a probability to a read given a template sequence. In
+addition to the base sequence of each read, Quiver uses several
+additional *QV* covariates that the basecaller provides. Using these
+covariates provides additional information about each read, allowing
+more accurate consensus calls.
+
+Quiver does not use the alignment provided by the mapper (BLASR,
+typically), except for determining how to group reads together at a
+macro level. It implicitly performs its own realignment, so it is
+highly sensitive to all variant types, including indels---for example,
+it resolves the example above with ease.
+
+The name **Quiver** reflects a consensus-calling algorithm that is
+`QV-aware`.
+
+How do I run Quiver?
+--------------------
+
+For general instructions on installing and running, see the
+HowToQuiver_ document.
+
+
+
+What does Quiver put in its output files?
+-----------------------------------------
+There are three output files from Quiver:
+
+- A consensus *FASTA* file containing the consensus sequence
+- A consensus *FASTQ* file containing the consensus sequence with quality annotations
+- A variants *GFF* file containing a filtered, annotated list of variants identified
+
+It is important to note that the variants included in the output
+variants GFF file are *filtered* by coverage and quality, so not all
+variants that are apparent in comparing the reference to the consensus
+FASTA output will correspond to variants in the output variants GFF
+file.
+
+To enable all output files, the following can be run (for example):
+
+ % quiver -j16 aligned_reads.cmp.h5 -r ref.fa \
+ -o consensus.fa \
+ -o consensus.fq \
+ -o variants.gff
+
+
+The extension is used to determine the output file format.
+
+
+What does it mean that Quiver's consensus is *de novo*?
+-------------------------------------------------------
+Quiver's consensus is *de novo* in the sense that the reference and the reference
+alignment are not used to inform the consensus output. Only the reads
+factor into the determination of the consensus.
+
+The only time the reference sequence is used to make consensus calls -
+when the ``--noEvidenceConsensusCall`` flag is set to ``reference`` or
+``lowercasereference`` (the default)- is when there is no effective
+coverage in a genomic window, so Quiver has no evidence for computing
+consensus. One can set ``--noEvidenceConsensusCall=nocall`` to
+avoid using the reference even in zero coverage regions.
+
+
+What is Quiver's accuracy?
+--------------------------
+Quiver's expected accuracy is a function of coverage and chemistry.
+The C2 chemistry (no longer available), P6-C4 and P4-C2 chemistries
+provide the most accuracy. Nominal consensus accuracy levels are as
+follows:
+
++----------+-------------------------------+
+|Coverage |Expected consensus accuracy |
+| +------------------+------------+
+| | C2, P4-C2, P6-C4 | P5-C3 |
++==========+==================+============+
+|10x | > Q30 | > Q30 |
++----------+------------------+------------+
+|20x | > Q40 | > Q40 |
++----------+------------------+------------+
+|40x | > Q50 | > Q45 |
++----------+------------------+------------+
+|60-80x | ~ Q60 | > Q55 |
++----------+------------------+------------+
+
+The "Q" values referred to are Phred-scaled
+quality values:
+
+.. math::
+ q = -10 \log_{10} p_{error}
+
+for instance, Q50 corresponds to a p_error of 0.00001---an accuracy
+of 99.999%. These accuracy expectations are based on routine
+validations performed on multiple bacterial genomes before each
+chemistry release.
+
+What are the residual errors after applying Quiver?
+---------------------------------------------------
+
+If there are errors remaining applying Quiver, they will almost
+invariably be homopolymer run-length errors (insertions or deletions).
+
+
+
+Does Quiver need to know what sequencing chemistry was used?
+----------------------------------------------------------
+
+At present, the Quiver model is trained per-chemistry, so it is very
+important that Quiver knows the sequencing chemistries used.
+
+If SMRT Analysis software was used to build the `cmp.h5` file, the
+`cmp.h5` will be loaded with information about the sequencing
+chemistry used for each SMRT Cell, and Quiver will automatically
+identify the right parameters to use.
+
+If custom software was used to build the `cmp.h5`, or an
+override of Quiver's autodetection is desired, then the
+chemistry or model must be explicity entered. For example::
+
+ % quiver -p P4-C2 ...
+ % quiver -p P4-C2.AllQVsMergingByChannelModel ...
+
+
+
+Can a mix of chemistries be used in a cmp.h5 file for Quiver?
+-----------------------------------------------------------
+
+Yes! Quiver automatically sees the chemistry *per-SMRT Cell*, so it
+can figure out the right parameters for each read and model them
+appropriately.
+
+Chemistry mixtures of P6-C4, P4-C2, P5-C3, and C2 are supported. If
+other chemistries are mixed in a `cmp.h5`, Quiver will give undefined
+results. However, Quiver can still be used on any `cmp.h5` file
+containing sequencing reads from a single chemistry.
+
+
+What are the QVs that Quiver uses?
+------------------------------------
+Quiver uses additional QV tracks provided by the basecaller.
+These QVs may be looked at as little breadcrumbs that are left behind by
+the basecaller to help identify positions where it was likely that
+errors of a given type occurred. Formally, the QVs for a given read are
+vectors of the same length as the number of bases called; the QVs
+used are as follows:
+
+ - DeletionQV
+ - InsertionQV
+ - MergeQV
+ - SubstitutionQV
+ - DeletionTag
+
+To find out if your cmp.h5 file is loaded with these QV tracks, run the command
+::
+
+ % h5ls -rv aligned_reads.cmp.h5
+
+and look for the QV track names in the output. If your cmp.h5 file is
+lacking some of these tracks, Quiver will still run, though it will
+issue a warning that its performance will be suboptimal.
+
+
+Why is Quiver making errors in some region?
+-------------------------------------------
+The most likely cause for *true* errors made by Quiver is that the
+coverage in the region was low. If there is 5x coverage over a
+1000-base region, then 10 errors in that region can be expected.
+
+It is important to understand that the effective coverage available to
+Quiver is not the full coverage apparent in plots---Quiver and
+Plurality both filter out ambiguously mapped reads by default. The
+remaining coverage after filtering is called the /effective coverage/.
+See the next section for discussion of `MapQV`.
+
+If you have verified that there is high effective coverage in the region
+in question, it is highly possible---given the high accuracy Quiver
+can achieve---that the apparent errors actually
+reflect true sequence variants. Inspect the FASTQ output file to
+ensure that the region was called at high confidence; if an erroneous
+sequence variant is being called at high confidence, please report a
+bug to us.
+
+
+What does Quiver do for genomic regions with no effective coverage?
+-------------------------------------------------------------------
+For regions with no effective coverage, no variants are outputted, and
+the FASTQ confidence is 0.
+
+The output in the FASTA and FASTQ consensus sequence tracks is
+dependent on the setting of the ``--noEvidenceConsensusCall`` flag.
+Assuming the reference in the window is "ACGT", the options are:
+
++---------------------------------------------+---------+
+|``--noEvidenceConsensusCall=...`` |Consensus|
+| |output |
++=============================================+=========+
+|``nocall`` (default in 1.4) |NNNN |
++---------------------------------------------+---------+
+|``reference`` |ACGT |
++---------------------------------------------+---------+
+|``lowercasereference`` (new post 1.4, and the| |
+|default) |acgt |
++---------------------------------------------+---------+
+
+
+
+
+What is `MapQV` and why is it important?
+----------------------------------------
+`MapQV` is a single scalar Phred-scaled QV per aligned read that
+reflects the mapper's degree of certainty that the read aligned to
+*this* part of the reference and not some other. Unambigously mapped
+reads will have a high `MapQV` (typically 255), while a read that was
+equally likely to have come from two parts of the reference would have
+a `MapQV` of 3.
+
+`MapQV` is pretty important when you want highly accurate variant
+calls. Quiver and Plurality both filter out aligned reads with a
+MapQV below 20 (by default), so as not to call a variant using data of
+uncertain genomic origin.
+
+This can be problematic if using Quiver to get a consensus
+sequence. If the genome of interest contains long (relative to the library
+insert size) highly-similar repeats, the effective coverage (after
+`MapQV` filtering) may be reduced in the repeat regions---this is termed
+these `MapQV` dropouts. If the coverage is sufficiently reduced in
+these regions, Quiver will not call consensus in these regions---see
+`What does Quiver do for genomic regions with no effective coverage?`_.
+
+If you want to use ambiguously mapped reads in computing a consensus
+for a denovo assembly, the `MapQV` filter can be turned off entirely.
+In this case, the consensus for each instance of a genomic repeat will
+be calculated using reads that may actually be from other instances of
+the repeat, so the exact trustworthiness of the consensus in that
+region may be suspect. The next section describes how to disable the
+`MapQV` filter.
+
+
+How can the `MapQV` filter be turned off and when should it be?
+--------------------------------------------------------------
+The `MapQV` filter can be disabled using the flag
+``--mapQvThreshold=0`` (shorthand: ``-m=0``). If running a
+Quiver job via SMRT Portal, this can be done by unchecking the "Use
+only unambiguously mapped reads" option. Consider this in
+de novo assembly projects, but it is not recommended for variant
+calling applications.
+
+
+How can variant calls made by Quiver be inspected or validated?
+--------------------------------------------------------------
+When in doubt, it is easiest to inspect the region in a tool like
+SMRT View, which enables you to view the reads aligned to the region.
+Deletions and substitutions should be fairly easy to spot; to view
+insertions, right-click on the reference base and select "View
+Insertions Before...".
+
+
+What are the filtering parameters that Quiver uses?
+---------------------------------------------------
+
+Quiver limits read coverage, filters reads by `MapQV`, and filters
+variants by quality and coverage.
+
+- The overall read coverage used to call consensus in every window is
+ 100x by default, but can be changed using ``-X=value``.
+- The `MapQV` filter, by default, removes reads with MapQV < 20. This
+ is configured using ``--mapQvThreshold=value`` / ``-m=value``
+- Variants are only called if the read coverage of the site exceeds
+ 5x, by default---this is configurable using ``-x=value``.
+ Further, they will not be called if the confidence (Phred-scaled)
+ does not exceed 40---configurable using ``-q=value``.
+
+
+What happens when the sample is a mixture, or diploid?
+-----------------------------------------------------
+At present, Quiver assumes a haploid sample, and the behavior of
+*Quiver* on sample mixtures or diploid/polyploid samples is
+*undefined*. The program will not crash, but the output results are
+not guaranteed to accord with any one of the haplotypes in the sample,
+as opposed to a potential patchwork.
+
+
+Why would I want to *iterate* the mapping+Quiver process?
+---------------------------------------------------------
+Some customers using Quiver for polishing highly repetitive genomes
+have found that if they take the consensus FASTA output of Quiver, use
+it as a new reference, and then perform mapping and Quiver again to
+get a new consensus, they get improved results from the second round
+of Quiver.
+
+This can be explained by noting that the output of the first round of
+Quiver is more accurate than the initial draft consensus output by the
+assembler, so the second round's mapping to the Quiver consensus can
+be more sensitive in mapping reads from repetitive regions. This can
+then result in improved consensus in those repetitive regions, because
+the reads have been assigned more correctly to their true genomic
+loci. However there is also a possibility that the potential shifting
+of reads around from one rounds' mapping to the next might alter
+borderline (low confidence) consensus calls even away from repetitive
+regions.
+
+We recommend the (mapping+Quiver) iteration for customers polishing
+repetitive genomes, and it could also prove useful for resequencing
+applications. However we caution that this is very much an
+*exploratory* procedure and we make no guarantees about its
+performance. In particular, borderline consensus calls can change
+when the procedure is iterated, and the procedure is *not* guaranteed
+to be convergent.
+
+
+Is iterating the (mapping+Quiver) process a convergent procedure?
+-----------------------------------------------------------------
+We have seen many examples where (mapping+Quiver), repeated many
+times, is evidently *not* a convergent procedure. For example, a
+variant call may be present in iteration n, absent in n+1, and then
+present again in n+2. It is possible for subtle changes in mapping to
+change the set of reads examined upon inspecting a genomic window, and
+therefore result in a different consensus sequence there. We expect
+this to be the case primarily for "borderline" (low confidence) base
+calls.
+
+
+
+.. _HowToQuiver: https://github.com/PacificBiosciences/GenomicConsensus/blob/master/doc/HowToQuiver.rst
diff --git a/doc/VariantCallerFunctionalSpecification.rst b/doc/VariantCallerFunctionalSpecification.rst
new file mode 100644
index 0000000..d983b2e
--- /dev/null
+++ b/doc/VariantCallerFunctionalSpecification.rst
@@ -0,0 +1,211 @@
+
+
+Variant Caller Functional Specification
+=======================================
+
+Version 2.2
+
+
+Introduction
+------------
+
+This document describes the interface, input/output, and performance
+characteristics of ``variantCaller.py``, a variant calling tool
+provided by the ``GenomicConsensus`` package.
+
+
+Software Overview
+-----------------
+
+The ``GenomicConsensus`` package provides a command-line tool,
+``variantCaller.py``, which provides several variant-calling algorithms for
+PacBio sequencing data. ``variantCaller.py`` replaces ``EviCons`` and
+``SmrtBayes``, the previous (haploid, diploid---respectively) variant callers
+at PacBio.
+
+
+
+Functional Requirements
+-----------------------
+
+Command-line interface
+``````````````````````
+
+``variantCaller.py`` is invoked from the command line. For example, a simple
+invocation is::
+
+ variantCaller.py -j8 --algorithm=quiver \
+ -r lambdaNEB.fa \
+ -o variants.gff \
+ aligned_reads.cmp.h5
+
+which requests that variant calling proceed,
+- using 8 worker processes,
+- employing the **quiver** algorithm,
+- taking input from the file ``aligned_reads.cmp.h5``,
+- using the FASTA file ``lambdaNEB.fa`` as the reference,
+- and writing output to ``variants.gff``.
+
+A particularly useful option is ``--referenceWindow/-w``: this option
+allows the user to direct the tool to perform variant calling
+exclusively on a *window* of the reference genome, where the
+
+
+Invoking
+
+::
+
+ variantCaller.py --help
+
+will provide a help message explaining all available options; they will be
+documented here shortly.
+
+
+
+Input and output
+````````````````
+``variantCaller.py`` requires two input files:
+
+- A file of reference-aligned reads in PacBio's standard cmp.h5 format;
+- A FASTA file that has been processed by ReferenceUploader.
+
+The tool's output is formatted in the GFF format, as described in (how
+to link to other file?). External tools can be used to convert the
+GFF file to a VCF or BED file---two other standard interchange formats
+for variant calling.
+
+.. note::
+
+ **Input cmp.h5 file requirements**
+
+ ``variantCaller.py`` requires its input cmp.h5 file to be
+ be sorted. An unsorted file can be sorting using the tool
+ ``cmpH5Sort.py``.
+
+ The *quiver* algorithm in ``variantCaller.py`` requires its
+ input cmp.h5 file to have the following *pulse features*:
+ - ``InsQV``,
+ - ``SubsQV``,
+ - ``DelQV``,
+ - ``DelTag``,
+ - ``MergeQV``.
+
+ The *plurality* algorithm can be run on cmp.h5 files that lack
+ these features.
+
+The input file is the main argument to ``variantCaller.py``, while the output
+file is provided as an argument to the ``-o`` flag. For example,
+
+::
+
+ variantCaller.py aligned_reads.cmp.h5 -r lambda.fa -o variants.gff
+
+will read input from ``aligned_reads.cmp.h5``, using the reference
+``lambda.fa``, and send output to the file ``variants.gff``. The
+extension of the filename provided to the ``-o`` flag is meaningful,
+as it determines the output file format. The file formats presently
+supported, by extension, are
+
+``.gff``
+ GFFv3 format
+
+``.txt``
+ a simplified human readable format used primarily by the developers
+
+If the ``-o`` flag is not provided, the default behavior is to output to a
+``variants.gff`` in the current directory.
+
+
+.. note::
+
+ ``variantCaller.py`` does **not** modify its input cmp.h5 file
+ in any way. This is in contrast to previous variant callers in
+ use at PacBio, which would write a *consensus* dataset to the input
+ cmp.h5 file.
+
+
+Available algorithms
+````````````````````
+
+At this time there are two algorithms available for variant calling:
+**plurality** and **quiver**.
+
+**Plurality** is a simple and very fast procedure that merely tallies the most
+frequent read base or bases found in alignment with each reference base, and
+reports deviations from the reference as potential variants.
+
+**Quiver** is a more complex procedure based on algorithms originally
+developed for CCS. Quiver leverages the quality values (QVs) provided by
+upstream processing tools, which provide insight into whether
+insertions/deletions/substitutions were deemed likely at a given read
+position. Use of **quiver** requires the ``ConsensusCore`` library as well as
+trained parameter set, which will be loaded from a standard location (TBD).
+Quiver can be thought of as a QV-aware local-realignment procedure.
+
+Both algorithms are expected to converge to *zero* errors (miscalled variants)
+as coverage increases; however **quiver** should converge much faster (i.e.,
+fewer errors at low coverage), and should provide greater variant detection
+power at a given error level.
+
+
+Software interfaces
+```````````````````
+The ``GenomicConsensus`` module has two essential dependencies:
+
+1. **pbcore**, the PacBio Python bioinformatics library
+2. **ConsensusCore**, a C++ library with SWIG bindings that provides access to
+ the same algorithms used in circular consensus sequencing.
+
+Both of these modules are easily installed using their ``setup.py`` scripts,
+which is the canonical means of installing Python packages.
+
+
+Confidence values
+-----------------
+
+Both *quiver* and *plurality* make a confidence metric available for
+every position of the consensus sequence. The confidence should be
+interpreted as a phred-transformed posterior probability that the
+consensus call is incorrect; i.e.
+
+.. math::
+
+ QV = -10 \log_{10}(p_{err})
+
+``variantCaller.py`` clips reported QV values at 93---larger values
+cannot be encoded in a standard FASTQ file.
+
+
+
+Chemistry specificity
+---------------------
+
+The Quiver algorithm parameters are trained per-chemistry.
+SMRTanalysis software loads metadata into the `cmp.h5` to indicate the
+chemistry used per movie. Quiver sees this table and automatically
+chooses the appropriate parameter set to use. This selection can be
+overriden by a command line flag.
+
+When multiple chemistries are represented in the reads in a
+`cmp.h5`, Quiver will model each read appropriately using the
+parameter set for its chemistry, thus yielding optimal results.
+
+
+Performance Requirements
+------------------------
+
+``variantCaller.py`` performs variant calling in parallel using multiple
+processes. Work splitting and inter-process communication are handled using
+the Python ``multiprocessing`` module. Work can be split among an arbitrary
+number of processes (using the ``-j`` command-line flag), but for best
+performance one should use no more worker processes than there are CPUs in the
+host computer.
+
+The running time of the *plurality* algorithm should not exceed the
+runtime of the BLASR process that produced the cmp.h5. The running
+time of the *quiver* algorithm should not exceed 4x the runtime of
+BLASR.
+
+The amount of core memory (RAM) used among all the python processes launched
+by a ``variantCaller.py`` run should not exceed the size of the uncompressed
+input ``.cmp.h5`` file.
diff --git a/doc/VariantCallerKnownIssues.rst b/doc/VariantCallerKnownIssues.rst
new file mode 100644
index 0000000..83e39c8
--- /dev/null
+++ b/doc/VariantCallerKnownIssues.rst
@@ -0,0 +1,11 @@
+
+Known Issues
+============
+
+Python 2.6 multiprocessing is susceptible to a bug where exceptions
+are occasionally thrown at shutdown because the daemon processes are
+allowed to continue executing while the interpreter is shutting down.
+(See: http://bugs.python.org/issue4106, http://bugs.python.org/issue9207)
+The bug is fixed in 2.7 but not in 2.6. I haven't been able to find a
+workaround.
+
diff --git a/doc/VariantsGffSpecification.rst b/doc/VariantsGffSpecification.rst
new file mode 100644
index 0000000..bd76d2b
--- /dev/null
+++ b/doc/VariantsGffSpecification.rst
@@ -0,0 +1,173 @@
+
+``variants.gff`` File Format (Version 2.1)
+============================================
+
+As of this version, ``variants.gff`` is our primary variant call file
+format. The ``variants.gff`` file is based on the `GFFv3 standard`_.
+The GFFv3 standard describes a tab-delimited plain-text file
+meta-format for describing genomic "features." Each gff file consists
+of some initial "header" lines supplying metadata, and then a number
+of "feature" lines providing information about each identified
+variant.
+
+The GFF Coordinate System
+-------------------------
+
+All coordinates in GFF files are 1-based, and all intervals ``start,
+end`` are understood as including both endpoints.
+
+Headers
+-------
+
+The ``variants.gff`` file begins with a block of metadata headers,
+which looks like the following:
+
+::
+
+ ##gff-version 3
+ ##pacbio-variant-version 2.1
+ ##date Tue Feb 28 17:44:18 2012
+ ##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
+ ##source GenomicConsensus v0.1.0
+ ##source-commandline callVariants.py --algorithm=plurality aligned_reads.cmp.h5 -r spinach.fasta -o variants.gff
+ ##source-alignment-file /home/popeye/data/aligned_reads.cmp.h5
+ ##source-reference-file /home/popeye/data/spinach.fasta
+ ##sequence-region EGFR_Exon_23 1 189
+ ##sequence-header EGFR_Exon_24 1 200
+
+The ``source`` and ``source-commandline`` describe the name and
+version of the software generating the file.
+``pacbio-variant-version`` reflects the specification version that the
+file contents should adhere to.
+
+ The ``sequence-region`` headers describe the names and extents of
+the reference groups (i.e. reference contigs) that will be refered to
+in the file. The names are the same as the full FASTA header.
+
+``source-alignment-file`` and ``source-reference-file`` record
+absolute paths to the primary input files.
+
+
+Feature lines
+-------------
+
+After the headers, each line in the file describes a genomic
+*feature*; in this file, all the features are potential variants
+flagged by the variant caller. The general format of a variant line
+is a 9-column (tab-delimited) record, where the first 8 columns
+correspond to fixed, predefined entities in the GFF standard, while
+the 9th column is a flexible semicolon-delimited list of mappings
+``key=value``.
+
+The 8 predefined columns are as follows:
+
++------+-------+--------------------------------+------------------+
+|Column|Name |Description |Example |
+|Number| | | |
++------+-------+--------------------------------+------------------+
+|1 |seqId |The full FASTA header for the |``lambda_NEB3011``|
+| | |reference contig. | |
+| | | | |
++------+-------+--------------------------------+------------------+
+|2 |source |(unused; always populated with |``.`` |
+| | |``.``) | |
++------+-------+--------------------------------+------------------+
+|3 |type |the type of variant. One of |``substitution`` |
+| | |``insertion``, ``deletion``, or | |
+| | |``substitution``. | |
+| | | | |
++------+-------+--------------------------------+------------------+
+|4 |start |1-based start coordinate for the|200 |
+| | |variant. | |
++------+-------+--------------------------------+------------------+
+|5 |end |1-based end coordinate for the |215 |
+| | |variant. start<=end always | |
+| | |obtains, regardless of strand. | |
++------+-------+--------------------------------+------------------+
+|6 |score |unused; populated with ``.`` |``.`` |
++------+-------+--------------------------------+------------------+
+|7 |strand |unused; populated with ``.`` |``.`` |
+| | | | |
++------+-------+--------------------------------+------------------+
+|8 |phase |unused; populated with ``.`` |``.`` |
++------+-------+--------------------------------+------------------+
+
+
+The attributes in the 9th (final) column are as follows:
+
++--------------+----------------------------+-----------------+
+|Key |Description |Example |
+| | |value |
++--------------+----------------------------+-----------------+
+|``coverage`` |the read coverage of the |``42`` |
+| |variant site (not the | |
+| |variant itself) | |
++--------------+----------------------------+-----------------+
+|``confidence``|the phred-scaled probability|``37`` |
+| |that the variant is real, | |
+| |rounded to the nearest | |
+| |integer and truncated at 93 | |
++--------------+----------------------------+-----------------+
+|``reference`` |the reference base or bases |``T``, ``.`` |
+| |for the variant site. May | |
+| |be ``.`` to represent a | |
+| |zero-length substring (for | |
+| |insertion events) | |
++--------------+----------------------------+-----------------+
+|``variantSeq``|the read base or bases |``T`` |
+| |corresponding to the | (haploid); |
+| |variant. ``.`` encodes a |``T/C``, ``T/.`` |
+| |zer-length string, as for a | (heterozygous) |
+| |deletion. | |
++--------------+----------------------------+-----------------+
+|``frequency`` |the read coverage of the |``13`` |
+| |variant itself; for | (haploid) |
+| |heterozygous variants, the | |
+| |frequency of both observed |``15/12`` |
+| |alleles. This is an | (heterozygous) |
+| |optional field. | |
++--------------+----------------------------+-----------------+
+
+
+The attributes may be present in any order.
+
+The four types of variant we support are as follows. *(Recall that the
+field separator is a tab, not a space.)*
+
+1. Insertion. Examples::
+
+ ref00001 . insertion 8 8 . . . reference=.;variantSeq=G;confidence=22;coverage=18;frequency=10
+ ref00001 . insertion 19 19 . . . reference=.;variantSeq=G/.;confidence=22;coverage=18;frequency=7/5
+
+ For insertions, start==end, and the insertion event is understood as
+ taking place *following* the reference position `start`.
+
+2. Deletion. Examples::
+
+ ref00001 . deletion 348 349 . . . reference=G;variantSeq=.;confidence=39;coverage=25;frequency=20
+ ref00001 . deletion 441 443 . . . reference=GG;variantSeq=GG/.;confidence=39;coverage=25;frequency=8/8
+
+3. Substitution. Examples::
+
+ ref000001 . substitution 100 102 . . . reference=GGG;variantSeq=CCC;confidence=50;coverage=20;frequency=16
+ ref000001 . substitution 200 201 . . . reference=G;variantSeq=G/C;confidence=50;coverage=20;frequency=10/6
+
+
+
+Compression
+-----------
+
+The gff metaformat is verbose, so for practical purposes we will gzip
+encode ``variants.gff`` files as ``variants.gff.gz``. Consumers of
+the variant file should be able to read it in either form.
+
+
+Other file formats
+------------------
+
+The VCF and BED standards describe variant-call specific file formats.
+We can currently translate `variants.gff` files to these formats, but
+they are not the primary output of the variant callers.
+
+
+.. _GFFv3 standard: http://www.sequenceontology.org/gff3.shtml
diff --git a/doc/conf.py b/doc/conf.py
new file mode 100755
index 0000000..fe74544
--- /dev/null
+++ b/doc/conf.py
@@ -0,0 +1,248 @@
+# -*- coding: utf-8 -*-
+#
+# GenomicConsensus documentation build configuration file, created by
+# sphinx-quickstart on Sat Jan 28 18:28:19 2012.
+#
+# This file is execfile()d with the current directory set to its containing dir.
+#
+# Note that not all possible configuration values are present in this
+# autogenerated file.
+#
+# All configuration values have a default; values that are commented out
+# serve to show the default.
+
+import sys, os
+from os.path import dirname, join
+
+globals = {}
+execfile("../GenomicConsensus/__init__.py", globals)
+__VERSION__ = globals["__VERSION__"]
+
+
+# If extensions (or modules to document with autodoc) are in another directory,
+# add these directories to sys.path here. If the directory is relative to the
+# documentation root, use os.path.abspath to make it absolute, like shown here.
+#sys.path.insert(0, os.path.abspath('.'))
+
+# -- General configuration -----------------------------------------------------
+
+# If your documentation needs a minimal Sphinx version, state it here.
+#needs_sphinx = '1.0'
+
+# Add any Sphinx extension module names here, as strings. They can be extensions
+# coming with Sphinx (named 'sphinx.ext.*') or your custom ones.
+extensions = ['sphinx.ext.autodoc', 'sphinx.ext.intersphinx', 'sphinx.ext.todo', 'sphinx.ext.coverage', 'sphinx.ext.viewcode', 'sphinx.ext.mathjax']
+
+# Add any paths that contain templates here, relative to this directory.
+templates_path = ['_templates']
+
+# The suffix of source filenames.
+source_suffix = '.rst'
+
+# The encoding of source files.
+#source_encoding = 'utf-8-sig'
+
+# The master toctree document.
+master_doc = 'index'
+
+# General information about the project.
+project = u'GenomicConsensus'
+copyright = u'2012-2013, Pacific Biosciences'
+
+# The version info for the project you're documenting, acts as replacement for
+# |version| and |release|, also used in various other places throughout the
+# built documents.
+#
+# The short X.Y version.
+version = __VERSION__
+# The full version, including alpha/beta/rc tags.
+release = __VERSION__
+
+# The language for content autogenerated by Sphinx. Refer to documentation
+# for a list of supported languages.
+#language = None
+
+# There are two options for replacing |today|: either, you set today to some
+# non-false value, then it is used:
+#today = ''
+# Else, today_fmt is used as the format for a strftime call.
+#today_fmt = '%B %d, %Y'
+
+# List of patterns, relative to source directory, that match files and
+# directories to ignore when looking for source files.
+exclude_patterns = ['_build']
+
+# The reST default role (used for this markup: `text`) to use for all documents.
+#default_role = None
+
+# If true, '()' will be appended to :func: etc. cross-reference text.
+#add_function_parentheses = True
+
+# If true, the current module name will be prepended to all description
+# unit titles (such as .. function::).
+#add_module_names = True
+
+# If true, sectionauthor and moduleauthor directives will be shown in the
+# output. They are ignored by default.
+#show_authors = False
+
+# The name of the Pygments (syntax highlighting) style to use.
+pygments_style = 'sphinx'
+
+# A list of ignored prefixes for module index sorting.
+#modindex_common_prefix = []
+
+
+# -- Options for HTML output ---------------------------------------------------
+
+# The theme to use for HTML and HTML Help pages. See the documentation for
+# a list of builtin themes.
+html_theme = 'default'
+
+# Theme options are theme-specific and customize the look and feel of a theme
+# further. For a list of options available for each theme, see the
+# documentation.
+#html_theme_options = {}
+
+# Add any paths that contain custom themes here, relative to this directory.
+#html_theme_path = []
+
+# The name for this set of Sphinx documents. If None, it defaults to
+# "<project> v<release> documentation".
+#html_title = None
+
+# A shorter title for the navigation bar. Default is the same as html_title.
+#html_short_title = None
+
+# The name of an image file (relative to this directory) to place at the top
+# of the sidebar.
+#html_logo = None
+
+# The name of an image file (within the static path) to use as favicon of the
+# docs. This file should be a Windows icon file (.ico) being 16x16 or 32x32
+# pixels large.
+#html_favicon = None
+
+# Add any paths that contain custom static files (such as style sheets) here,
+# relative to this directory. They are copied after the builtin static files,
+# so a file named "default.css" will overwrite the builtin "default.css".
+html_static_path = ['_static']
+
+# If not '', a 'Last updated on:' timestamp is inserted at every page bottom,
+# using the given strftime format.
+#html_last_updated_fmt = '%b %d, %Y'
+
+# If true, SmartyPants will be used to convert quotes and dashes to
+# typographically correct entities.
+#html_use_smartypants = True
+
+# Custom sidebar templates, maps document names to template names.
+#html_sidebars = {}
+
+# Additional templates that should be rendered to pages, maps page names to
+# template names.
+#html_additional_pages = {}
+
+# If false, no module index is generated.
+#html_domain_indices = True
+
+# If false, no index is generated.
+#html_use_index = True
+
+# If true, the index is split into individual pages for each letter.
+#html_split_index = False
+
+# If true, links to the reST sources are added to the pages.
+#html_show_sourcelink = True
+
+# If true, "Created using Sphinx" is shown in the HTML footer. Default is True.
+#html_show_sphinx = True
+
+# If true, "(C) Copyright ..." is shown in the HTML footer. Default is True.
+#html_show_copyright = True
+
+# If true, an OpenSearch description file will be output, and all pages will
+# contain a <link> tag referring to it. The value of this option must be the
+# base URL from which the finished HTML is served.
+#html_use_opensearch = ''
+
+# This is the file name suffix for HTML files (e.g. ".xhtml").
+#html_file_suffix = None
+
+# Output file base name for HTML help builder.
+htmlhelp_basename = 'GenomicConsensusdoc'
+
+
+# -- Options for LaTeX output --------------------------------------------------
+
+latex_elements = {
+# The paper size ('letterpaper' or 'a4paper').
+#'papersize': 'letterpaper',
+
+# The font size ('10pt', '11pt' or '12pt').
+#'pointsize': '10pt',
+
+# Additional stuff for the LaTeX preamble.
+#'preamble': '',
+}
+
+# Grouping the document tree into LaTeX files. List of tuples
+# (source start file, target name, title, author, documentclass [howto/manual]).
+latex_documents = [
+ ('index', 'GenomicConsensus.tex', u'GenomicConsensus Documentation',
+ u'David Alexander', 'manual'),
+]
+
+# The name of an image file (relative to this directory) to place at the top of
+# the title page.
+#latex_logo = None
+
+# For "manual" documents, if this is true, then toplevel headings are parts,
+# not chapters.
+#latex_use_parts = False
+
+# If true, show page references after internal links.
+#latex_show_pagerefs = False
+
+# If true, show URL addresses after external links.
+#latex_show_urls = False
+
+# Documents to append as an appendix to all manuals.
+#latex_appendices = []
+
+# If false, no module index is generated.
+#latex_domain_indices = True
+
+
+# -- Options for manual page output --------------------------------------------
+
+# One entry per manual page. List of tuples
+# (source start file, name, description, authors, manual section).
+man_pages = [
+ ('index', 'genomicconsensus', u'GenomicConsensus Documentation',
+ [u'David Alexander'], 1)
+]
+
+# If true, show URL addresses after external links.
+#man_show_urls = False
+
+
+# -- Options for Texinfo output ------------------------------------------------
+
+# Grouping the document tree into Texinfo files. List of tuples
+# (source start file, target name, title, author,
+# dir menu entry, description, category)
+texinfo_documents = [
+ ('index', 'GenomicConsensus', u'GenomicConsensus Documentation',
+ u'David Alexander', 'GenomicConsensus', 'One line description of project.',
+ 'Miscellaneous'),
+]
+
+# Documents to append as an appendix to all manuals.
+#texinfo_appendices = []
+
+# If false, no module index is generated.
+#texinfo_domain_indices = True
+
+# How to display URL addresses: 'footnote', 'no', or 'inline'.
+#texinfo_show_urls = 'footnote'
diff --git a/doc/index.rst b/doc/index.rst
new file mode 100644
index 0000000..786560e
--- /dev/null
+++ b/doc/index.rst
@@ -0,0 +1,18 @@
+.. GenomicConsensus documentation master file, created by
+ sphinx-quickstart on Sat Jan 28 18:28:19 2012.
+ You can adapt this file completely to your liking, but it should at least
+ contain the root `toctree` directive.
+
+GenomicConsensus
+================
+
+Contents:
+
+.. toctree::
+ :maxdepth: 2
+
+ VariantCallerFunctionalSpecification
+ VariantsGffSpecification
+ VariantCallerKnownIssues
+ HowToQuiver
+ QuiverFAQ
diff --git a/doc/internal/1_3_3_Enhancements.rst b/doc/internal/1_3_3_Enhancements.rst
new file mode 100644
index 0000000..5d88e84
--- /dev/null
+++ b/doc/internal/1_3_3_Enhancements.rst
@@ -0,0 +1,73 @@
+1.3.3 Enhancements
+==================
+
+Bug 20100
+---------
+**Genomic Consensus to support rare variant calling**
+
+Adds the ability to to call rare variants. Rare variants are defined here as
+mutations detected at a 1% < frequency < 50%. There is an initial minimum
+coverage requirement set at 500x. The information provided by this feature
+will be limited to deviations from the reference.
+
+This will limited to SNPs only. Indels will be ignored.
+
+Codon-aware filtering could easily be applied to the output as a post-processing
+step. It could also be used *in situ* as an additional filtering mechanism to
+reduce potentially noisy output. We can start with the post-processing option
+(easy) then evolve towards being codon aware as necessary.
+
+This functionality will be optional.
+
+*Inputs*:
+
+ A column-oriented set of short (~1 - 3 bases) sequence calls and their
+ corresponding frequencies.
+
+*Outputs*:
+
+ A GFF-style record per rare variant call. See VariantsGffSpecification for
+ standard format. This feature will augment the standard record with a new
+ key/value pair indicating frequency. Example: freq=0.10. There may be more
+ than one variant per reference position.
+
+ Please note that no consensus file(s) will be generated for rare variants,
+ though enough information is provided to build one in a separate
+ tools/module.
+
+Bug 20628
+---------
+**Add support for detecting and reporting correlated mutations**
+
+Provides support for determing whether or not sets of mutations are co-located.
+This only includes SNPs, not indels. Correlations may only be established
+using overrlapping reads, i.e., gaps not supportable. Correlations will have
+some confidence metric associated with them (TBD). This functionality may also
+be combined with rare variant calling output.
+
+The guiding use-case for this feature is the BCR-ABL project, which targeted an
+863 bp region of the human genome (11,000x coverage). `BCR-ABL Project Details`_.
+
+This functionality will be optional.
+
+*Inputs*:
+
+ CCS-based variant calls at each position including read information: ID,
+ start, stop. 'start' and 'stop' are in (+) strand genomic coordinates.
+
+*Outputs*:
+
+ A table (possibly) of correlated mutations that could look like:
+
+ ===== ======= ===== ===================
+ Freq # Reads Conf Mutations
+ ===== ======= ===== ===================
+ 40.4% 4,321 40 123a, 140c
+ 30.3% 3,210 30 50t, 350a
+ 20.2% 2,500 20 1400g, 1500c, 1550t
+ ===== ======= ===== ===================
+
+ We may also choose to include an output of read IDs associated with reported
+ sets of co-located mutations. Formats TBD.
+
+.. _BCR-ABL Project Details: http://web/~mbrown/workspace2011Q4/bcrAblASHRuns/
diff --git a/doc/internal/VariantCallerValidation.rst b/doc/internal/VariantCallerValidation.rst
new file mode 100644
index 0000000..f47d0b1
--- /dev/null
+++ b/doc/internal/VariantCallerValidation.rst
@@ -0,0 +1,162 @@
+Variant Caller Validation Specification
+=======================================
+
+Created: 2012/02/20
+Author: jdrake
+
+Synopsis
+--------
+There are several algorithms implemented for detecting SNPs in the data using alignments
+against a known reference. These include Evicons (PacBio), GATK (Broad) and, most recently,
+GenomicConsensus (PacBio). The first was built back in the days of 70% accurate reads
+and is quickly becoming deprecated, though currently used only as our haploid caller (though it
+does have diploid calling functionality). The second is part of a comprehensive tool kit
+that provides better diploid calling and is currently used as such in the secondary pipeline.
+The third is the most recent incarnation and the heir apparent going forward.
+
+There are no metrics built to measure, for example, the sensitivy and specificity of these
+algorithms, and thus are difficult to evaluate against eachother. Ostensibly, since we're
+closer to the data, we should be able to better tune an algorithm to maximize true +/-
+variant calls. This exercise will create datasets to generate ROC curves and potentially
+other user metrics to properly evaluate algorithms.
+
+Workflow
+--------
+A dataset will be generated using a set of mutated reference genomes to align real reads
+against. Each mutated reference will have a list of 'ground-truth' mutations associated
+with them. The alignments will then be processed by each of the candidate variant caller
+algorithms and their results evaluated against the ground truth for true +/-.
+
+1. Generate mutated reference(s)
+2. Align reads to each mutated reference
+3. Run variant callers using alignments
+4. Evaluate calls vs ground truth
+5. Generate metrics
+6. Repeat steps 3 - 5 as necessary
+
+*NOTE*: The mutated references could be generated on the fly using the mutation information,
+thus, obviating the need to save all the mutated references.
+
+The automation of the workflow should eventually be packaged and deployed into the Millhouse
+framework. Initially, it can configured to run from the command line on the secondary cluster
+and the smrtpipe infrastructure.
+
+Mutation Sets
+-------------
+Starting with lambda (well represented amongst currently available runs), generate a set, M, of
+mutated lambda references with n randomly generated point mutations within each m mutated genome.
+Each point mutation p will be one of P = {Substitution(s), Insertion(i), Deletion(d)}. Locations will
+be associated with each mutation as a 1-based offset using the wild-type genome (w) coordinates.
+
+Offsets are stored in 0-based coordinates, but displayed and manipulated using a 1-based coordinate
+system because that's what GFF, SAM and Tablet uses.
+
+Mutation sets will be stored in a file per reference mutated. The file will be used as input to
+mutate genomes on the fly just prior to alignment as well as input to the validation procedure.
+GFF files could be generated from them fairly easily if, though probably not, necessary. Multiple
+versions of this file could co-exist for the same reference.
+
+The format of the mutations file is extremely simple and compact making it suitable for source
+control. For simplicity, we'll use the python pickle protocol vers 2.
+
+mutation = {
+ offs, # offset in the wild-type genome (1-based)
+ typ, # type of mutation
+ wild, # base(s), wild-type strain
+ mut # base(s), the mutated strain
+}
+
+Comparison
+~~~~~~~~~~
+
+Alignments play a big role in this. Homopolymer regions are treated slightly differently when
+QV's are involved. Without them, affine gaps are used which push gaps to the left, e.g.,
+
+GAATGAAGCCG
+GAATG-AGCCG
+
+These degenerate cases will be handled by collapsing the homopolymer aligment gaps to the left before
+comparing. See BLASR subsection for more detail.
+
+Some alignments against a substitution generate this type of call (some field removed for brevity):
+deletion 10201 length=1;confidence=22;coverage=16;reference=G
+insertion 10201 length=1;variantSeq=T;confidence=23;coverage=16
+
+This happens when the substitution forms a homopolymer. These will be collapsed and labelled substitutions
+during comparisons.
+
+Does it use CCS reads by default, QV values? The production version does not use CCS reads but does use
+QV values.
+
+
+Data Sets
+---------
+Key things to pay attention to in datasets:
+- coverage level
+- quality
+- location of mutation (e.g., homopolymer)
+- nature of mutation (e.g., insertion followed by deletion)
+
+Start with a positive control using an unmutated reference. Zero mutations should be found.
+
+Metrics
+-------
+Confusion matrix
+ROC Curves (using quality scores)
+QQ Plot
+
+Notes
+-----
+http://www.sequenceontology.org/gff3.shtml
+http://smrtwiki/wiki/SMRTpipe
+http://web/~mhsieh/dag/index.html
+
+Evicons
+~~~~~~~
+Top level module src: //depot/software/assembly/pbpy/pbpy/smrtpipe/modules
+Evicons smrtpipe modules: P_Consensus, P_ConsensusAlgorithm
+ wraps runChunkConnectPost.py (same dir) which ...
+ wraps eviConsWrapper.py (../../../bin/) which ...
+ wraps jConnectPost[.sh] (../../../../seymour/dist2/analysis/bin/) which ...
+ wraps a call an evicons jar file
+*Un*-wrapping this may be more cumbersome than generating the appropriate inputs to the module.
+
+GATK
+~~~~
+P_GATKVC
+
+Uses the UnifiedGenotyper, TableRecalibration, CountCovariates components
+
+Uses BAM inputs, generated after alignment (blasr)
+//depot/software/bioinformatics/tools/pbsamtools
+
+BLASR
+~~~~~
+Running blasr to get a cmp.h5 file (super basic, with crappy alignments)::
+
+> compareSequences.py --algorithm=blasr --h5fn=aligned.cmp.h5 input.fofn refdir
+
+More productiony way::
+
+> compareSequences.py --info --useGuidedAlign --algorithm=blasr --nproc=6 --noXML --h5mode=w \
+ --h5fn=control.cmp.h5 --minAccuracy=0.75 --minLength=50 -x -minMatch 12 -x -bestn 1 -x -minPctIdentity 70.0 \
+ --regionTable=/mnt/secondary/Smrtanalysis/opt/smrtanalysis/common/jobs/037/037285/data/filtered_regions.chunk001of002.fofn \
+ input.fofn /mnt/secondary/Smrtanalysis/opt/smrtanalysis/common/references/lambda
+
+
+`refdir` is a directory containing a set of information related to a reference sequence.
+The key files appear to be <reference>.fa and reference.info.xml. It can work with just
+a fasta file, but will produce a cmp.h5 that breaks evicons (reference length is 0). There
+is a utility to generate these ref dirs:
+
+/mnt/secondary/Smrtpipe/builds/Assembly_Mainline_Nightly_LastSuccessfulBuild/analysis/bin/referenceUploader
+
+
+Validation tests could be source controlled under the siv tree, given they're likely to
+transition into that group eventually (//depot/software/assembly/siv-test/...)
+
+Using what we've already got:
+//depot/software/assembly/siv-test/module-test/bin/
+- mutateRef.py (?)
+- evalVariantCalls.py (?)
+
diff --git a/setup.py b/setup.py
new file mode 100755
index 0000000..8c0341c
--- /dev/null
+++ b/setup.py
@@ -0,0 +1,36 @@
+from setuptools import setup, find_packages
+from os.path import join, dirname
+
+# Load __VERSION__ from the GenomicConsensus package that is under
+# this directory---do NOT import GenomicConsensus, as importing
+# GenomicConsensus may fail if it has not actually been installed yet.
+globals = {}
+execfile("GenomicConsensus/__init__.py", globals)
+__VERSION__ = globals["__VERSION__"]
+
+
+setup(
+ name = 'GenomicConsensus',
+ version=__VERSION__,
+ author='Pacific Biosciences',
+ author_email='devnet at pacificbiosciences.com',
+ license=open('LICENSES').read(),
+ scripts = ['bin/variantCaller.py',
+ 'bin/summarizeConsensus.py',
+ 'bin/gffToVcf.py',
+ 'bin/gffToBed.py',
+ 'bin/makePbi.py',
+ 'bin/plurality',
+ 'bin/quiver'],
+ packages = find_packages(),
+ package_data={'GenomicConsensus.quiver': ['resources/*/GenomicConsensus/*.ini']},
+ include_package_data=True,
+ zip_safe = False,
+ install_requires=[
+ 'pbcore >= 0.9.2',
+ 'numpy >= 1.6.0',
+ 'h5py >= 2.0.1',
+ 'ConsensusCore >= 0.9.1',
+ 'pysam == 0.8.1'
+ ]
+ )
diff --git a/tests/cram/extra/convert-to-bed.t b/tests/cram/extra/convert-to-bed.t
new file mode 100644
index 0000000..c128030
--- /dev/null
+++ b/tests/cram/extra/convert-to-bed.t
@@ -0,0 +1,22 @@
+
+Test conversion variants GFF -> BED.
+
+ $ export DATA=$TESTDIR/../../data
+ $ export INPUT=$DATA/converters/variants.gff.gz
+
+ $ gffToBed.py --name=variants \
+ > --description="PacBio variant calls" \
+ > variants $INPUT
+ track name=variants description="PacBio variant calls" useScore=0
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t701414\t701415\t701415del\t46.000\t. (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t970969\t970970\t970970del\t48.000\t. (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1065967\t1065968\t1065968del\t49.000\t. (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1081287\t1081288\t1081288del\t40.000\t. (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1315974\t1315975\t1315975del\t41.000\t. (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1342769\t1342770\t1342770_1342771insA\t49.000\t. (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1439018\t1439019\t1439019del\t49.000\t. (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1456849\t1456850\t1456850del\t48.000\t. (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1623534\t1623535\t1623535del\t47.000\t. (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1998594\t1998595\t1998595del\t47.000\t. (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t2002375\t2002376\t2002376del\t48.000\t. (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t2179434\t2179435\t2179435del\t48.000\t. (esc)
diff --git a/tests/cram/extra/convert-to-vcf.t b/tests/cram/extra/convert-to-vcf.t
new file mode 100644
index 0000000..b85eb4c
--- /dev/null
+++ b/tests/cram/extra/convert-to-vcf.t
@@ -0,0 +1,26 @@
+
+Test conversion GFF -> VCF
+
+ $ export DATA=$TESTDIR/../../data
+ $ export INPUT=$DATA/converters/variants.gff.gz
+
+ $ gffToVcf.py --globalReference=Staphylococcus_aureus_USA300_TCH1516 $INPUT
+ ##fileformat=VCFv3.3
+ ##fileDate=* (glob)
+ ##source=* (glob)
+ ##reference=Staphylococcus_aureus_USA300_TCH1516
+ ##INFO=NS,1,Integer,"Number of Samples with Data"
+ ##INFO=DP,1,Integer,"Total Depth of Coverage"
+ #CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t701415\t.\tG\tD1\t46.00\t0\tNS=1;DP=97 (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t970970\t.\tG\tD1\t48.00\t0\tNS=1;DP=97 (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1065968\t.\tG\tD1\t49.00\t0\tNS=1;DP=87 (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1081288\t.\tG\tD1\t40.00\t0\tNS=1;DP=81 (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1315975\t.\tC\tD1\t41.00\t0\tNS=1;DP=100 (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1342770\t.\t.\tIA\t49.00\t0\tNS=1;DP=27 (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1439019\t.\tC\tD1\t49.00\t0\tNS=1;DP=88 (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1456850\t.\tC\tD1\t48.00\t0\tNS=1;DP=84 (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1623535\t.\tC\tD1\t47.00\t0\tNS=1;DP=99 (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t1998595\t.\tG\tD1\t47.00\t0\tNS=1;DP=75 (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t2002376\t.\tC\tD1\t48.00\t0\tNS=1;DP=73 (esc)
+ gi|160367075|gb|CP000730.1| Staphylococcus aureus subsp. aureus USA300_TCH1516, complete genome\t2179435\t.\tC\tD1\t48.00\t0\tNS=1;DP=52 (esc)
diff --git a/tests/cram/extra/coverage-bed.t b/tests/cram/extra/coverage-bed.t
new file mode 100644
index 0000000..fab4c61
--- /dev/null
+++ b/tests/cram/extra/coverage-bed.t
@@ -0,0 +1,29 @@
+Test conversion of alignment summary GFF to coverage BED.
+
+ $ export DATA=$TESTDIR/../../data
+ $ export INPUT=$DATA/fluidigm_amplicons/alignment_summary.gff
+
+ $ gffToBed.py --name=coverage \
+ > --description="PacBio coverage" \
+ > coverage $INPUT > coverage.bed
+ $ head -20 coverage.bed
+ track name=coverage description="PacBio coverage" useScore=0
+ ref000001\t0\t1\tmeanCov\t27.000\t+ (esc)
+ ref000001\t1\t2\tmeanCov\t27.000\t+ (esc)
+ ref000001\t2\t3\tmeanCov\t27.000\t+ (esc)
+ ref000001\t3\t4\tmeanCov\t27.000\t+ (esc)
+ ref000001\t4\t5\tmeanCov\t27.000\t+ (esc)
+ ref000001\t5\t6\tmeanCov\t27.000\t+ (esc)
+ ref000001\t6\t7\tmeanCov\t27.000\t+ (esc)
+ ref000001\t7\t8\tmeanCov\t27.000\t+ (esc)
+ ref000001\t8\t9\tmeanCov\t27.000\t+ (esc)
+ ref000001\t9\t10\tmeanCov\t27.000\t+ (esc)
+ ref000001\t10\t11\tmeanCov\t27.000\t+ (esc)
+ ref000001\t11\t12\tmeanCov\t27.000\t+ (esc)
+ ref000001\t12\t13\tmeanCov\t27.000\t+ (esc)
+ ref000001\t13\t14\tmeanCov\t27.000\t+ (esc)
+ ref000001\t14\t15\tmeanCov\t27.000\t+ (esc)
+ ref000001\t15\t16\tmeanCov\t27.000\t+ (esc)
+ ref000001\t16\t17\tmeanCov\t27.000\t+ (esc)
+ ref000001\t17\t18\tmeanCov\t27.000\t+ (esc)
+ ref000001\t18\t19\tmeanCov\t27.000\t+ (esc)
diff --git a/tests/cram/extra/plurality-compressed.t b/tests/cram/extra/plurality-compressed.t
new file mode 100644
index 0000000..79af7ac
--- /dev/null
+++ b/tests/cram/extra/plurality-compressed.t
@@ -0,0 +1,55 @@
+Run plurality on the small example file, and make sure the compressed
+output files are created correctly.
+
+ $ export DATA=$TESTDIR/../../data
+ $ export INPUT=$DATA/hcv/aligned_reads.cmp.h5
+ $ export REFERENCE=$DATA/hcv/HCV_Ref_For_187140.fasta
+ $ variantCaller.py --algorithm=plurality -q 10 -r $REFERENCE -o variants.gff.gz -o consensus.fq.gz $INPUT
+
+I like to show the head of the output files inline here so that glaringly obvious changes will
+pop right out, but I verify that the files are exactly correct by looking at the md5 sums.
+
+First, the variants.gff:
+
+ $ gunzip variants.gff.gz
+ $ cat variants.gff
+ ##gff-version 3
+ ##pacbio-variant-version 2.1
+ ##date * (glob)
+ ##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
+ ##source GenomicConsensus * (glob)
+ ##source-commandline * (glob)
+ ##source-alignment-file * (glob)
+ ##source-reference-file * (glob)
+ ##sequence-region 5primeEnd 1 156
+ ##sequence-region 3primeEnd 1 386
+
+
+Examine consensus output. This is identical to the reference
+
+ $ gunzip consensus.fq.gz
+ $ fold -60 consensus.fq
+ @5primeEnd|plurality
+ GGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCGTGGATAAACCCGC
+ TCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCG
+ CGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTG
+ +
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ @3primeEnd|plurality
+ TACCTGGTCATAGCCTCCGTGAAGGCTCTCAGGCTCGCTGCATCCTCCGGGACTCCCTGA
+ CTTTCACAGATAACGACTAAGTCGTCGCCACACACGAGCATGGTGCAGTCCTGGAGCCCA
+ GCGGCTCGACAGGCTGCTTTGGCCTTGATGTAGCAGGTGAGGGTGTTACCACAGCTGGTC
+ GTCAGTACGCCGCTCGCGCGGCACCTGCGATAGCCGCAGTTTTCCCCCCTTGAATTAGTA
+ AGAGGGCCCCCGACATAGAGCCTCTCGGTGAGGGACTTGATGGCCACGCGGGCTTGGGGG
+ TCCAGGTCACAACATTGGTAAATTGCCTCCTCTGTACGGATATCGCTCTCAGTGACTGTG
+ GAGTCAAAGCAGCGGGTATCATACGA
+ +
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIII
diff --git a/tests/cram/extra/plurality-fluidigm.t b/tests/cram/extra/plurality-fluidigm.t
new file mode 100644
index 0000000..4437160
--- /dev/null
+++ b/tests/cram/extra/plurality-fluidigm.t
@@ -0,0 +1,19 @@
+
+Some tests of a "fluidigm amplicons" dataset
+
+ $ export DATA=$TESTDIR/../../data
+ $ export INPUT=$DATA/fluidigm_amplicons/040500.cmp.h5
+ $ export REFERENCE=$DATA/fluidigm_amplicons/Fluidigm_human_amplicons.fasta
+
+Set the QV threshold to 10.
+
+ $ variantCaller.py --algorithm=plurality -r $REFERENCE -q 10 -o variants.gff -o consensus.csv -o consensus.fastq $INPUT
+
+There are two true SNVs (and one diploid SNV that we miss right now).
+
+ $ grep insertion variants.gff | wc | awk '{print $1}'
+ 0
+ $ grep deletion variants.gff | wc | awk '{print $1}'
+ 0
+ $ grep substitution variants.gff
+ EGFR_Exon_23\t.\tsubstitution\t48\t48\t.\t.\t.\treference=T;variantSeq=C;frequency=97;coverage=100;confidence=40 (esc)
diff --git a/tests/cram/extra/reference-mismatch.t b/tests/cram/extra/reference-mismatch.t
new file mode 100644
index 0000000..b3f9d6a
--- /dev/null
+++ b/tests/cram/extra/reference-mismatch.t
@@ -0,0 +1,27 @@
+
+Test a few scenarios where the reference FASTA disagrees slightly from
+the contigs aligned against in the cmp.h5, and make sure things behave
+sanely.
+
+ $ export DATA=$TESTDIR/../../data
+ $ export INPUT=$DATA/hcv/aligned_reads.cmp.h5
+ $ export WRONG_REFERENCE=$DATA/fluidigm_amplicons/Fluidigm_human_amplicons.fasta
+ $ export REFERENCE_SUBSET=$DATA/hcv/5primeEnd.fa
+ $ export REFERENCE_NO_FAI=$DATA/hcv/3primeEnd.fa
+
+No .fai file:
+
+ $ quiver -p unknown $INPUT -r $REFERENCE_NO_FAI -o variants.gff -o consensus.fastq
+ Companion FASTA index (.fai) file not found or malformatted! Use 'samtools faidx' to generate FASTA index.
+ [255]
+
+Wrong reference:
+
+ $ quiver -p unknown $INPUT -r $WRONG_REFERENCE -o variants.gff -o consensus.fastq
+ No reference groups in the FASTA file were aligned against. Did you select the wrong reference FASTA file?
+ [255]
+
+Reference containing a subset of the reference that was aligned to:
+
+ $ quiver -p unknown $INPUT -r $REFERENCE_SUBSET -o variants.gff -o consensus.fastq
+ [WARNING] Some reference contigs aligned against are not found in the reference FASTA. Will process only those contigs supported by the reference FASTA.
diff --git a/tests/cram/internal/alignment_summary.t b/tests/cram/internal/alignment_summary.t
new file mode 100644
index 0000000..336f2f7
--- /dev/null
+++ b/tests/cram/internal/alignment_summary.t
@@ -0,0 +1,36 @@
+
+Test the (augmentation) of the alignment_summary.gff file by summarizeConsensus.py
+
+ $ export DATA=/mnt/secondary/Share/Quiver/TestData/tinyLambda/
+ $ export PATH=$TESTDIR/..:$PATH
+ $ export VARIANTSGFF=$DATA/variants.gff.gz
+ $ export ALIGNMENTSUMMARYGFF=$DATA/alignment_summary.gff
+ $ summarizeConsensus.py \
+ > --variantsGff $VARIANTSGFF \
+ > $ALIGNMENTSUMMARYGFF \
+ > -o alignment_summary.out.gff
+
+ $ head -20 alignment_summary.out.gff
+ ##gff-version 3
+ ##date Thu, 03-Feb-2011 14:54:12
+ ##source PACBIO_AlignmentSummary 1.0
+ ##source ConsensusStats v0.1
+ ##source-commandline summarizeCoverage.py --reference /mnt/secondary/Smrtanalysis/opt/smrtanalysis/common/references/lambda --numRegions=500 /mnt/secondary/Smrtanalysis/opt/smrtanalysis/common/jobs/016/016789/data/aligned_reads.cmp.h5
+ ##source-commandline mono ConsensusStats.exe /mnt/secondary/Smrtanalysis/opt/smrtanalysis/common/jobs/016/016789/data/variants.gff /mnt/secondary/Smrtanalysis/opt/smrtanalysis/common/jobs/016/016789/data/aligned_reads.cmp.h5
+ ##sequence-region lambda_NEB3011 1 48502
+ ##source GenomicConsensus * (glob)
+ ##pacbio-alignment-summary-version 0.6
+ ##source-commandline * (glob)
+ lambda_NEB3011\t.\tregion\t1\t100\t0.00\t+\t.\tcov2=150.440,26.772;gaps=0,0;cov=51,160,171;cQv=20,20,20;del=0;ins=19;sub=0 (esc)
+ lambda_NEB3011\t.\tregion\t101\t200\t0.00\t+\t.\tcov2=168.700,1.780;gaps=0,0;cov=166,168,173;cQv=20,20,20;del=0;ins=16;sub=0 (esc)
+ lambda_NEB3011\t.\tregion\t201\t300\t0.00\t+\t.\tcov2=167.860,1.732;gaps=0,0;cov=165,168,171;cQv=20,20,20;del=1;ins=17;sub=1 (esc)
+ lambda_NEB3011\t.\tregion\t301\t400\t0.00\t+\t.\tcov2=177.690,2.587;gaps=0,0;cov=168,179,181;cQv=20,20,20;del=2;ins=8;sub=0 (esc)
+ lambda_NEB3011\t.\tregion\t401\t500\t0.00\t+\t.\tcov2=179.730,1.248;gaps=0,0;cov=177,180,182;cQv=20,20,20;del=0;ins=0;sub=0 (esc)
+ lambda_NEB3011\t.\tregion\t501\t600\t0.00\t+\t.\tcov2=186.670,4.907;gaps=0,0;cov=177,188,195;cQv=20,20,20;del=0;ins=0;sub=0 (esc)
+ lambda_NEB3011\t.\tregion\t601\t700\t0.00\t+\t.\tcov2=200.160,4.051;gaps=0,0;cov=192,200,206;cQv=20,20,20;del=0;ins=0;sub=0 (esc)
+ lambda_NEB3011\t.\tregion\t701\t800\t0.00\t+\t.\tcov2=213.630,7.634;gaps=0,0;cov=200,215,226;cQv=20,20,20;del=0;ins=0;sub=0 (esc)
+ lambda_NEB3011\t.\tregion\t801\t900\t0.00\t+\t.\tcov2=244.290,12.954;gaps=0,0;cov=224,243,262;cQv=20,20,20;del=0;ins=0;sub=0 (esc)
+ lambda_NEB3011\t.\tregion\t901\t1000\t0.00\t+\t.\tcov2=267.070,3.724;gaps=0,0;cov=259,266,274;cQv=20,20,20;del=0;ins=0;sub=0 (esc)
+
+ $ grep -v '\#.*' alignment_summary.out.gff | md5sum
+ 08f89b262b159671cdcdd8bdc8331461 -
diff --git a/tests/cram/internal/plurality-diploid-lambda.t b/tests/cram/internal/plurality-diploid-lambda.t
new file mode 100644
index 0000000..f1d594b
--- /dev/null
+++ b/tests/cram/internal/plurality-diploid-lambda.t
@@ -0,0 +1,50 @@
+
+Reads are from a simulated diploid lambda, where there is a SNP at
+each position 250 + 500k, and the SNP is a substitution "ACGT" ->
+"CGTA". How well do we pick up these SNPs?
+
+ $ alias untabify="sed 's/\t/ /g'"
+ $ export INPUT=/mnt/secondary/Share/Quiver/TestData/lambdaDiploid/aln.cmp.h5
+ $ export REFERENCE=/mnt/secondary/Share/Quiver/TestData/lambdaDiploid/lambda.fasta
+ $ export EXPECTED_VARIANTS=/mnt/secondary/Share/Quiver/TestData/lambdaDiploid/v-expected.gff
+
+Run haploid analysis, make sure we don't make too many miscalls!
+
+ $ plurality $INPUT -r $REFERENCE \
+ > -o variants-haploid.gff -o css-haploid.fa
+
+Now run under diploid mode
+
+ $ plurality --diploid $INPUT -r $REFERENCE \
+ > -o variants.gff -o css.fasta
+
+Consensus outputs should be identical, because detection of diploid
+variants doesn't change the cconsensus calls.
+
+ $ diff css.fasta css-haploid.fa
+
+Take a look at the variants...
+
+ $ grep -v "#" variants.gff | head -3 | untabify
+ lambda_NEB3011 . substitution 250 250 . . . reference=A;variantSeq=C/A;frequency=45/43;coverage=100;confidence=40
+ lambda_NEB3011 . substitution 750 750 . . . reference=T;variantSeq=T/A;frequency=60/27;coverage=100;confidence=40
+ lambda_NEB3011 . substitution 1250 1250 . . . reference=G;variantSeq=G/T;frequency=56/21;coverage=100;confidence=40
+
+
+Use gffsubtract.pl to compare variants to expected. Note that the
+gffsubtract tool just looks at the coordinates, not the actual content
+of the event, so it's not going to see if we called G/C as G/T, for
+example. Would be good to either write a better tool or make an easy
+way to do this in Python.
+
+
+False negatives:
+
+ $ gffsubtract.pl $EXPECTED_VARIANTS variants.gff | grep -v '#' | untabify
+ lambda_NEB3011 . substitution 1750 1750 . . . reference=A;variantSeq=A/C;
+ lambda_NEB3011 . substitution 22750 22750 . . . reference=T;variantSeq=T/A;
+
+
+False positives:
+
+ $ gffsubtract.pl variants.gff $EXPECTED_VARIANTS | grep -v '#' | untabify
diff --git a/tests/cram/internal/plurality-lambda.t b/tests/cram/internal/plurality-lambda.t
new file mode 100644
index 0000000..9c7118c
--- /dev/null
+++ b/tests/cram/internal/plurality-lambda.t
@@ -0,0 +1,9 @@
+ $ export INPUT=/mnt/secondary/Share/Quiver/TestData/lambda/job_038537.cmp.h5
+ $ export REFERENCE=/mnt/secondary/Share/Quiver/TestData/lambda/lambda.fasta
+ $ plurality -j${JOBS-8} --noEvidenceConsensusCall=nocall $INPUT -r $REFERENCE \
+ > -o variants.gff -o css.fasta.gz -o css.fq.gz
+ $ grep -v "##" variants.gff
+ [1]
+
+ $ gunzip css.fasta.gz
+ $ fastadiff -c FALSE css.fasta $REFERENCE
diff --git a/tests/cram/internal/quiver-compatibility.t b/tests/cram/internal/quiver-compatibility.t
new file mode 100644
index 0000000..81db985
--- /dev/null
+++ b/tests/cram/internal/quiver-compatibility.t
@@ -0,0 +1,43 @@
+
+Quiver should abort if the cmp.h5 is not suitable. Let's make sure it does the right thing.
+
+First make sure we abort once we recognize the tiny fluidigm file is CCS data.
+
+ $ export DATA=$TESTDIR/../../data
+ $ export INPUT=$DATA/fluidigm_amplicons/040500.cmp.h5
+ $ export REFERENCE=$DATA/fluidigm_amplicons/Fluidigm_human_amplicons.fasta
+ $ quiver -r $REFERENCE -o variants.gff $INPUT 2>1
+ Failure: The Quiver algorithm requires a cmp.h5 file containing standard (non-CCS) reads.
+ [255]
+
+
+Tiny lambda file. Make sure it recognizes this cmp.h5 has an imcomplete set of QVs.
+
+ $ export INPUT=/mnt/secondary/Share/Quiver/TestData/tinyLambda/aligned_reads_1.cmp.h5
+ $ export REFERENCE=/mnt/secondary/Share/Quiver/TestData/tinyLambda/lambdaNEB.fa
+ $ quiver -p C2.AllQVsModel -r $REFERENCE -o variants.gff $INPUT
+ Failure: Selected Quiver parameter set is incompatible with this cmp.h5 file due to missing data tracks.
+ [255]
+
+
+It should handle the request of a parameter set by complete name:
+
+ $ quiver -v -p C2.NoQVsModel -r $REFERENCE -o variants.gff $INPUT 2>&1 | grep "Using Quiver parameter set"
+ [INFO] Using Quiver parameter set(s): C2.NoQVsModel
+
+... or by chemistry name:
+
+ $ quiver -v -p C2 -r $REFERENCE -o variants.gff $INPUT 2>&1 | grep "Using Quiver parameter set"
+ [INFO] Using Quiver parameter set(s): C2.NoQVsModel
+
+
+... and should fail informatively when we ask for an unrecognized
+parameter set or chemistry:
+
+ $ quiver -p SuperChem.Model -r $REFERENCE -o variants.gff $INPUT
+ Quiver: no available parameter set named SuperChem.Model
+ [255]
+
+ $ quiver -p SuperChem -r $REFERENCE -o variants.gff $INPUT
+ Quiver: no parameter set available compatible with this cmp.h5 for chemistry "SuperChem"
+ [255]
diff --git a/tests/cram/internal/quiver-diploid-lambda.t b/tests/cram/internal/quiver-diploid-lambda.t
new file mode 100644
index 0000000..9e2c0bd
--- /dev/null
+++ b/tests/cram/internal/quiver-diploid-lambda.t
@@ -0,0 +1,35 @@
+
+Reads are from a simulated diploid lambda, where there is a SNP at
+each position 250 + 500k, and the SNP is a substitution "ACGT" ->
+"CGTA". How well do we pick up these SNPs?
+
+ $ alias untabify="sed 's/\t/ /g'"
+ $ export INPUT=/mnt/secondary/Share/Quiver/TestData/lambdaDiploid/aln.cmp.h5
+ $ export REFERENCE=/mnt/secondary/Share/Quiver/TestData/lambdaDiploid/lambda.fasta
+ $ export EXPECTED_VARIANTS=/mnt/secondary/Share/Quiver/TestData/lambdaDiploid/v-expected.gff
+
+ $ quiver -p unknown.NoQVsModel --diploid $INPUT -r $REFERENCE \
+ > -o variants.gff -o css.fasta
+
+Take a look at the variants
+
+ $ grep -v "#" variants.gff | head -3 | untabify
+ lambda_NEB3011 . substitution 250 250 . . . reference=A;variantSeq=A/C;coverage=100;confidence=40
+ lambda_NEB3011 . substitution 750 750 . . . reference=T;variantSeq=A/T;coverage=100;confidence=40
+ lambda_NEB3011 . substitution 1250 1250 . . . reference=G;variantSeq=G/T;coverage=100;confidence=40
+
+Use gffsubtract.pl to compare variants to expected. Note that the
+gffsubtract tool just looks at the coordinates, not the actual content
+of the event, so it's not going to see if we called G/C as G/T, for
+example. Would be good to either write a better tool or make an easy
+way to do this in Python.
+
+
+False negatives:
+
+ $ gffsubtract.pl $EXPECTED_VARIANTS variants.gff | grep -v '#' | untabify
+
+
+False positives:
+
+ $ gffsubtract.pl variants.gff $EXPECTED_VARIANTS | grep -v '#' | untabify
diff --git a/tests/cram/internal/quiver-ecoli.t b/tests/cram/internal/quiver-ecoli.t
new file mode 100644
index 0000000..91fcd71
--- /dev/null
+++ b/tests/cram/internal/quiver-ecoli.t
@@ -0,0 +1,51 @@
+
+Run quiver on a large-insert C2 E. coli job.
+
+ $ export INPUT=/mnt/secondary/Share/Quiver/TestData/ecoli/job_059531.cmp.h5
+ $ export REFERENCE=/mnt/secondary/Share/Quiver/TestData/ecoli/ecoliK12_pbi_March2013.fasta
+
+For some reason, this old cmp.h5 file lacks proper chemistry
+information. Quiver should reject it.
+
+ $ quiver -j${JOBS-8} $INPUT -r $REFERENCE -o variants.gff -o css.fasta
+ "unknown" chemistry in alignment file: either an unsupported chemistry has been used, the alignment file has been improperly constructed, or this version of SMRTanalysis is too old to recognize a new chemistry.
+ [255]
+
+
+Well, we know it was a C2 job, so let's force the issue
+
+ $ quiver -p C2 -j${JOBS-8} $INPUT -r $REFERENCE -o variants.gff -o css.fasta
+
+Inspect the variants list. A few mutations seem to have crept in
+since I built the new reference.
+
+ $ sed 's/\t/ /g' variants.gff
+ ##gff-version 3
+ ##pacbio-variant-version 2.1
+ ##date * (glob)
+ ##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
+ ##source GenomicConsensus * (glob)
+ ##source-commandline * (glob)
+ ##source-alignment-file * (glob)
+ ##source-reference-file * (glob)
+ ##sequence-region ecoliK12_pbi_March2013 1 4642522
+ ecoliK12_pbi_March2013 . deletion 85 85 . . . reference=G;variantSeq=.;coverage=53;confidence=48
+ ecoliK12_pbi_March2013 . deletion 219 219 . . . reference=A;variantSeq=.;coverage=58;confidence=47
+ ecoliK12_pbi_March2013 . insertion 1536 1536 . . . reference=.;variantSeq=C;coverage=91;confidence=50
+
+No no-call windows.
+
+ $ fastacomposition css.fasta
+ css.fasta A 1141540 C 1177642 G 1180362 T 1142977
+
+MuMMer analysis. No structural diffs
+
+ $ nucmer -mum $REFERENCE css.fasta 2>/dev/null
+ $ show-diff -H out.delta
+
+SNPs same as variants
+
+ $ show-snps -C -H out.delta | sed 's/\s\+/ /g'
+ 85 G . 84 | 85 84 | 1 1 ecoliK12_pbi_March2013 ecoliK12_pbi_March2013|quiver
+ 220 A . 218 | 135 218 | 1 1 ecoliK12_pbi_March2013 ecoliK12_pbi_March2013|quiver
+ 1536 . C 1535 | 1316 1535 | 1 1 ecoliK12_pbi_March2013 ecoliK12_pbi_March2013|quiver
diff --git a/tests/cram/internal/quiver-eichler-bac.t b/tests/cram/internal/quiver-eichler-bac.t
new file mode 100644
index 0000000..17a0a4d
--- /dev/null
+++ b/tests/cram/internal/quiver-eichler-bac.t
@@ -0,0 +1,53 @@
+
+ $ export INPUT=/mnt/secondary/Share/Quiver/TestData/eichler/053727.cmp.h5
+ $ export SANGER_REFERENCE=/mnt/secondary/Share/Quiver/TestData/eichler/CH17-157L1.finished.fa
+ $ export ASSEMBLY_REFERENCE=/mnt/secondary/Share/Quiver/TestData/eichler/CH17_157L1_quiver_fasta.fasta
+
+The QVs warning gets printed to stderr N times ... ignore it for now.
+
+ $ quiver -p C2 --noEvidenceConsensusCall=nocall \
+ > -j${JOBS-8} $INPUT -r $ASSEMBLY_REFERENCE -o variants.gff -o css.fasta 2>/dev/null
+
+Variant scores are currently miscalibrated (need to fix the
+NoMergeQVModel; bug 22255). Note that these variants listed below are
+reckoned compared to the assembly reference, so they are not really
+variants so much as errors in the assembly. Variants assessed using
+MuMMer at the end are compared to the Sanger reference.
+
+ $ sed 's/\t/ /g' variants.gff | grep -v '#'
+ CH17-157L1 . deletion 141 142 . . . reference=AC;variantSeq=.;coverage=100;confidence=47
+ CH17-157L1 . deletion 797 797 . . . reference=G;variantSeq=.;coverage=100;confidence=48
+ CH17-157L1 . deletion 805 805 . . . reference=T;variantSeq=.;coverage=100;confidence=47
+ CH17-157L1 . deletion 26174 26175 . . . reference=AC;variantSeq=.;coverage=100;confidence=48
+ CH17-157L1 . deletion 93356 93357 . . . reference=CG;variantSeq=.;coverage=100;confidence=49
+ CH17-157L1 . insertion 230679 230679 . . . reference=.;variantSeq=A;coverage=100;confidence=49
+ CH17-157L1 . insertion 230681 230681 . . . reference=.;variantSeq=CA;coverage=100;confidence=48
+ CH17-157L1 . insertion 230684 230684 . . . reference=.;variantSeq=C;coverage=100;confidence=48
+
+
+ $ fastacomposition css.fasta
+ css.fasta A 65735 C 51391 G 50341 N 28 T 63420
+
+Use the MuMMer suite to look at the differences from the reference.
+
+ $ nucmer -mum $SANGER_REFERENCE css.fasta 2>/dev/null
+
+First: no structural differences.
+
+ $ show-diff -H -q out.delta | sed 's/\t/ /g'
+ CH17-157L1|quiver BRK 1 30 30
+ CH17-157L1|quiver BRK 230896 230915 20
+
+Next, the SNPs.
+
+ $ show-snps -H -C -x10 out.delta
+ 24558 . A 24583 | 24552 24558 | AAAAAAAAAA.AGCCTGGATG AAAAAAAAAAAAGCCTGGATG | 1 1 CH17-157L1\tCH17-157L1|quiver (esc)
+ 51215 C . 51239 | 1765 51215 | GGCCCGCCCCCCGGGCAGCCA GGCCCGCCCC.CGGGCAGCCA | 1 1 CH17-157L1\tCH17-157L1|quiver (esc)
+ 52980 . A 53005 | 1765 52980 | AAAAAAAAAA.ACAACAAACA AAAAAAAAAAAACAACAAACA | 1 1 CH17-157L1\tCH17-157L1|quiver (esc)
+ 64634 C . 64658 | 11654 64634 | GACCCCCCCCCCACCGGTCAG GACCCCCCCC.CACCGGTCAG | 1 1 CH17-157L1\tCH17-157L1|quiver (esc)
+ 85478 . T 85503 | 8834 85478 | TTTTTTTTTT.TACTAACCAG TTTTTTTTTTTTACTAACCAG | 1 1 CH17-157L1\tCH17-157L1|quiver (esc)
+ 94312 . T 94338 | 8834 94312 | TTTTTTTTTT.TAGACAGAGT TTTTTTTTTTTTAGACAGAGT | 1 1 CH17-157L1\tCH17-157L1|quiver (esc)
+ 106985 . T 107012 | 0 106985 | TTTTTTTTTT.TCCTGAGCAG TTTTTTTTTTTTTCCTGAGCA | 1 1 CH17-157L1\tCH17-157L1|quiver (esc)
+ 106985 . T 107013 | 0 106985 | TTTTTTTTTT.TCCTGAGCAG TTTTTTTTTTTTCCTGAGCAG | 1 1 CH17-157L1\tCH17-157L1|quiver (esc)
+ 182920 . A 182949 | 564 47946 | AAAAAAAAAA.ATGTGGTCTC AAAAAAAAAAAATGTGGTCTC | 1 1 CH17-157L1\tCH17-157L1|quiver (esc)
+ 183484 . A 183514 | 564 47382 | AAAAAAAAAA.ATAGATGAAC AAAAAAAAAAAATAGATGAAC | 1 1 CH17-157L1\tCH17-157L1|quiver (esc)
diff --git a/tests/cram/internal/quiver-fluidigm-amplicons.t b/tests/cram/internal/quiver-fluidigm-amplicons.t
new file mode 100644
index 0000000..53c84d1
--- /dev/null
+++ b/tests/cram/internal/quiver-fluidigm-amplicons.t
@@ -0,0 +1,6 @@
+
+ $ export INPUT=/mnt/secondary/Share/Quiver/TestData/fluidigmAmplicons/aligned_reads.cmp.h5
+ $ export REFERENCE=/mnt/secondary/Share/Quiver/TestData/fluidigmAmplicons/MET_EGFR_Full_Genes.fasta
+ $ quiver --noEvidenceConsensusCall=nocall -j${JOBS-8} $INPUT -r $REFERENCE \
+ > -o variants.gff -o css.fasta
+ [WARNING] This .cmp.h5 file lacks some of the QV data tracks that are required for optimal performance of the Quiver algorithm. For optimal results use the ResequencingQVs workflow in SMRTPortal with bas.h5 files from an instrument using software version 1.3.1 or later, or the --forQuiver option to pbalign.
diff --git a/tests/cram/internal/quiver-lambda.t b/tests/cram/internal/quiver-lambda.t
new file mode 100644
index 0000000..921f75b
--- /dev/null
+++ b/tests/cram/internal/quiver-lambda.t
@@ -0,0 +1,32 @@
+Small lambda phage job, should be no errors.
+
+ $ export CMPH5=/mnt/secondary/Share/Quiver/TestData/lambda.P4-C2/082796.cmp.h5
+ $ export BAM=/mnt/secondary/Share/Quiver/TestData/lambda.P4-C2/082796.bam
+ $ export REFERENCE=/mnt/secondary/Share/Quiver/TestData/lambda.P4-C2/lambdaNEB.fa
+
+First try the cmp.h5:
+
+ $ mkdir CmpH5; cd CmpH5
+ $ quiver -j${JOBS-8} --noEvidenceConsensusCall=nocall $CMPH5 -r $REFERENCE \
+ > -o variants.gff -o css.fasta.gz -o css.fq.gz
+
+ $ grep -v "##" variants.gff
+ [1]
+
+ $ gunzip css.fasta.gz
+ $ fastadiff -c FALSE css.fasta $REFERENCE
+
+ $ cd ..
+
+#Now run on the BAM:
+#
+# $ mkdir BAM; cd BAM
+# $ quiver -j${JOBS-8} --noEvidenceConsensusCall=nocall $BAM -r $REFERENCE \
+# > -o variants.gff -o css.fasta.gz -o css.fq.gz
+# [WARNING] 'fancyChunking' not yet available for BAM, disabling
+#
+# $ grep -v "##" variants.gff
+# [1]
+#
+# $ gunzip css.fasta.gz
+# $ fastadiff -c FALSE css.fasta $REFERENCE
diff --git a/tests/cram/internal/quiver-mruber.t b/tests/cram/internal/quiver-mruber.t
new file mode 100644
index 0000000..8a14e6c
--- /dev/null
+++ b/tests/cram/internal/quiver-mruber.t
@@ -0,0 +1,69 @@
+
+ $ export INPUT=/mnt/secondary/Share/Quiver/TestData/mruber/aligned_reads.cmp.h5
+ $ export REFERENCE=/mnt/secondary/Share/Quiver/TestData/mruber/Mruber_DSM_1279.fasta
+ $ quiver -p C2 -j${JOBS-8} $INPUT -r $REFERENCE -o variants.gff -o css.fasta
+
+Inspect the variant calls.
+
+ $ grep -v "#" variants.gff | sed 's/\t/ /g'
+ M.ruber . substitution 357364 357364 . . . reference=C;variantSeq=T;coverage=100;confidence=47
+ M.ruber . insertion 640716 640716 . . . reference=.;variantSeq=C;coverage=100;confidence=49
+ M.ruber . insertion 1320669 1320669 . . . reference=.;variantSeq=C;coverage=100;confidence=49
+ M.ruber . deletion 1878514 1878953 . . . reference=AGGGCGTACTTCTTTTCGGGTGCAGATGCGTAGGCATCGTAGTTGAACAGGGTTTTGACCGCCATTGAGCACTCCTTTTACGGTTCCACAATGAGTTTGCTGATCATGTTGGCGTGGCCGATGCCGCAGTATTCGTTGCAGATGATGGGATACTCACCGGGTTTGCTGAAGGTGTAGCTGACCTTGGCAATTTCCCCCGGTATCACCTGTACGTTGATGTTGGTGTTGTGTACGTGGAAGCTGTGCTGCACATCGGGTGAGGTGATATAGAAGGTTACCTTCCTGCCCACCTTGAACCGCATCTCCGCTGGCAGGTAGCCAAAGGCAAAGGCCTGCACATAGGCCACGTACTCGTTGCCGACCTGCTCAACCCGTGGGTTGGCAAAGTCTCCCTCGGTGCGCACCTTGGTGGCGTCGATGCGGCCTGCCCCCACCGGGT [...]
+ M.ruber . insertion 1987969 1987969 . . . reference=.;variantSeq=G;coverage=100;confidence=49
+ M.ruber . insertion 2010700 2010700 . . . reference=.;variantSeq=T;coverage=100;confidence=48
+ M.ruber . insertion 2070035 2070035 . . . reference=.;variantSeq=A;coverage=100;confidence=49
+ M.ruber . insertion 2827713 2827713 . . . reference=.;variantSeq=T;coverage=100;confidence=49
+ M.ruber . deletion 2841287 2841301 . . . reference=AAGCACGCCGAGGGA;variantSeq=.;coverage=100;confidence=49
+
+
+The variant calls have all been Sanger validated!
+
+ | | Confirmed | Confirmed |
+ | Variant call | by eye? | by Sanger? |
+ |------------------+-----------+------------|
+ | 357364 C>T | YES | YES |
+ | 640716 InsC | YES | YES |
+ | 1320669 InsC | YES | YES |
+ | 1878514 Del440bp | YES | YES |
+ | 1987969 InsG | YES | YES |
+ | 2010700 InsT | YES | YES |
+ | 2070035 InsA | YES | YES |
+ | 2827713 InsT | YES | YES |
+ | 2841287 Del15bp | YES | YES |
+
+
+Look at the consensus output.
+
+First, there are no no-calls, which is nice.
+
+ $ fastacomposition css.fasta
+ css.fasta A 566308 C 979601 G 983450 T 567651
+
+There are two gaps corresponding to the structural deletions:
+
+ $ nucmer -mum $REFERENCE css.fasta 2>/dev/null
+ $ show-diff -H out.delta | sed 's/\t/ /g'
+ M.ruber GAP 1878514 1878953 440 0 440
+ M.ruber GAP 2851299 2831302 -19996 -19981 -15
+
+... and there are some SNPS. Five of them are at the coverage desert
+before the large deletion, seven are accounted for in the
+variants.gff, and the remaining ones are low-confidence miscalls.
+
+ $ show-snps -H -C out.delta
+ 233298 C . 233297 | 124066 233297 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 357364 C T 357363 | 124066 357363 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 640719 . C 640719 | 283355 640719 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 1320671 . C 1320672 | 299698 1320671 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 1620369 C . 1620369 | 252295 1476642 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 1872664 G . 1872663 | 5836 1224348 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 1878500 . C 1878500 | 0 1218511 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 1878500 . C 1878501 | 0 1218510 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 1878500 . C 1878502 | 0 1218509 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 1878500 . A 1878503 | 0 1218508 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 1878500 . G 1878504 | 0 1218507 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 1987973 . G 1987538 | 22731 1109473 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 2010704 . T 2010270 | 22731 1086741 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 2070035 . A 2069602 | 59331 1027409 | 1 1 M.ruber\tM.ruber|quiver (esc)
+ 2827716 . T 2827284 | 13583 269727 | 1 1 M.ruber\tM.ruber|quiver (esc)
diff --git a/tests/cram/internal/quiver-staph.t b/tests/cram/internal/quiver-staph.t
new file mode 100644
index 0000000..deeaaaf
--- /dev/null
+++ b/tests/cram/internal/quiver-staph.t
@@ -0,0 +1,32 @@
+This input data is taken from the output of the mapping job in Pysiv:
+pysiv_jobs/jobs/BAMMapping/saureus_p6c4
+
+ $ export BAM=/mnt/secondary/Share/Quiver/TestData/staph/aligned_reads.bam
+ $ export REFERENCE=/mnt/secondary/Share/Quiver/TestData/staph/S_aureus_USA300_TCH1516.fasta
+
+ $ quiver -j${JOBS-8} $BAM -r $REFERENCE -o variants.gff -o css.fasta -o css.fastq
+ [WARNING] 'fancyChunking' not yet available for BAM, disabling
+
+Inspect the variant calls. The first variant call might be an error
+(follow up on this) but the latter is an error in the reference, it
+seems.
+
+ $ grep -v "#" variants.gff | sed 's/\t/ /g'
+ Staphylococcus_aureus_subsp_aureus_USA300_TCH1516 . deletion 1592553 1592553 . . . reference=T;variantSeq=.;coverage=100;confidence=50
+ Staphylococcus_aureus_subsp_aureus_USA300_TCH1516 . deletion 2179435 2179435 . . . reference=C;variantSeq=.;coverage=100;confidence=49
+
+One window is nocalled. Follow up on this.
+
+ $ fastacomposition css.fasta
+ css.fasta A 960146 C 470678 G 470218 T 971370 a 176 c 74 g 91 t 159
+
+No gaps.
+
+ $ nucmer -mum $REFERENCE css.fasta 2>/dev/null
+ $ show-diff -H out.delta | sed 's/\t/ /g'
+
+SNPs in consensus the same as called.
+
+ $ show-snps -H -C out.delta
+ 1040006 A . 1040005 | 552550 1040005 | 1 1 Staphylococcus_aureus_subsp_aureus_USA300_TCH1516\tStaphylococcus_aureus_subsp_aureus_USA300_TCH1516|quiver (esc)
+ 1592556 T . 1592554 | 552550 1280359 | 1 1 Staphylococcus_aureus_subsp_aureus_USA300_TCH1516\tStaphylococcus_aureus_subsp_aureus_USA300_TCH1516|quiver (esc)
diff --git a/tests/cram/internal/quiver-stumpy-read.t.off b/tests/cram/internal/quiver-stumpy-read.t.off
new file mode 100644
index 0000000..3e7efd6
--- /dev/null
+++ b/tests/cram/internal/quiver-stumpy-read.t.off
@@ -0,0 +1,27 @@
+
+We occasionally come across a "stumpy" read, where there is a large
+gap in the read, due to a single molecule event that is as-yet not
+well understood. At the moment if these guys aren't identified and
+filtered out the POA and probably the rest of Quiver will crash and
+burn. This is a simple test to make sure we get it right. The file
+contains coverage restricted to a small ~10KB window containing the
+stumpy read.
+
+ $ export INPUT=/mnt/secondary/Share/Quiver/TestData/stumpyReadInEcoli/out.cmp.h5
+ $ export REFERENCE=/mnt/secondary/Share/Quiver/TestData/stumpyReadInEcoli/ecoli_mutated.fasta
+ $ quiver --noEvidenceConsensusCall=nocall -j${JOBS-8} $INPUT -r $REFERENCE \
+ > -o variants.gff -o css.fasta
+
+Now compare back to the reference. Coverage island results in
+consensus sequence only in the window [2734568,2745424] (GFF
+convention).
+
+ $ nucmer -mum $REFERENCE css.fasta 2>/dev/null
+ $ show-coords -H out.delta
+ 2734568 2745424 | 2734568 2745424 | 10857 10857 | 99.96 | ecoliK12_mutated\tecoliK12_mutated|quiver (esc)
+
+No confident variants. The 4 SNPs in the alignment are at the
+fringes, where there is low coverage.
+
+ $ grep -v "#" variants.gff
+ [1]
diff --git a/tests/cram/internal/quiver-tinyLambda-coverage-islands.t b/tests/cram/internal/quiver-tinyLambda-coverage-islands.t
new file mode 100644
index 0000000..97c34a0
--- /dev/null
+++ b/tests/cram/internal/quiver-tinyLambda-coverage-islands.t
@@ -0,0 +1,223 @@
+Here's a test of the new amplicons support in Quiver. Previously
+Quiver would not see coverage spanning its fixed 500bp windows, and
+would no-call the entire genome. Now the windows extents are
+determined adaptively based on where the coverage actually is.
+
+ $ export INPUT=/mnt/secondary/Share/Quiver/TestData/tinyLambda/aligned_reads_1.cmp.h5
+ $ export REFERENCE=/mnt/secondary/Share/Quiver/TestData/tinyLambda/lambdaNEB.fa
+
+ $ quiver -p unknown --quiet -j${JOBS-8} --noEvidenceConsensusCall=nocall \
+ > $INPUT -r $REFERENCE \
+ > -o variants.gff -o css.fa -o css.fq
+
+
+These variant calls actually look reasonable given the reads, but the
+confidences are too high. Fix this.
+
+ $ grep -v '#' variants.gff
+ lambda_NEB3011\t.\tinsertion\t24781\t24781\t.\t.\t.\treference=.;variantSeq=T;coverage=6;confidence=57 (esc)
+ lambda_NEB3011\t.\tdeletion\t24878\t24878\t.\t.\t.\treference=A;variantSeq=.;coverage=16;confidence=43 (esc)
+ lambda_NEB3011\t.\tinsertion\t30882\t30882\t.\t.\t.\treference=.;variantSeq=C;coverage=5;confidence=44 (esc)
+
+ $ fastacomposition css.fa
+ css.fa A 282 C 266 G 305 N 47361 T 281
+
+ $ nucmer -mum $REFERENCE css.fa 2>/dev/null
+
+ $ show-aligns out.delta lambda_NEB3011 'lambda_NEB3011|quiver'
+ * (glob)
+
+ ============================================================
+ -- Alignments between lambda_NEB3011 and lambda_NEB3011|quiver
+
+ -- BEGIN alignment [ +1 6531 - 6718 | +1 6531 - 6718 ]
+
+
+ 6531 ctgccgtgcttaagggcaaatacaccatgaccggtgaagccttcgatcc
+ 6531 ctgccgtgcttaagggcaaatacaccatgaccggtgaagccttcgatcc
+
+
+ 6580 ggttgaggtggatatgggccgcagtgaggagaataacatcacgcagtcc
+ 6580 ggttgaggtggatatgggccgcagtgaggagaataacatcacgcagtcc
+
+
+ 6629 ggcggcacggagtggagcaagcgtgacaagtccacgtatgacccgaccg
+ 6629 ggcggcacggagtggagcaagcgtgacaagtccacgtatgacccgaccg
+
+
+ 6678 acgatatcgaagcctacgcgctgaacgccagcggtgtggtg
+ 6678 acgatatcgaagcctacgcgctgaacgccagcggtgtggtg
+
+
+
+ -- END alignment [ +1 6531 - 6718 | +1 6531 - 6718 ]
+ -- BEGIN alignment [ +1 7266 - 7562 | +1 7266 - 7561 ]
+
+
+ 7266 cctgacggggacgaaagaagaactggcgctccgtgtggcagagctgaaa
+ 7266 cctgacggggacgaaagaagaactggcgctccgtgtggcagagctgaaa
+
+
+ 7315 gaggagcttgatgacacggatgaaactgccggtcaggacacccctctca
+ 7315 gaggagcttgatgacacggatgaaactgccggtcaggacacccctctca
+
+
+ 7364 gccgggaaaatgtgctgaccggacatgaaaatgaggtgggatcagcgca
+ 7364 gccgggaaaatgtgctgaccggacatgaaaatga.gtgggatcagcgca
+ ^
+
+ 7413 gccggataccgtgattctggatacgtctgaactggtcacggtcgtggca
+ 7412 gccggataccgtgattctggatacgtctgaactggtcacggtcgtggca
+
+
+ 7462 ctggtgaagctgcatactgatgcacttcacgccacgcgggatgaacctg
+ 7461 ctggtgaagctgcatactgatgcacttcacgccacgcgggatgaacctg
+
+
+ 7511 tggcatttgtgctgccgggaacggcgtttcgtgtctctgccggtgtggc
+ 7510 tggcatttgtgctgccgggaacggcgtttcgtgtctctgccggtgtggc
+
+
+ 7560 agc
+ 7559 agc
+
+
+
+ -- END alignment [ +1 7266 - 7562 | +1 7266 - 7561 ]
+ -- BEGIN alignment [ +1 24760 - 25167 | +1 24759 - 25166 ]
+
+
+ 24760 tgaaatgatgaagagctctgtgtt.tgtcttcctgcctccagttcgccg
+ 24759 tgaaatgatgaagagctctgtgttttgtcttcctgcctccagttcgccg
+ ^
+
+ 24808 ggcattcaacataaaaactgatagcacccggagttccggaaacgaaatt
+ 24808 ggcattcaacataaaaactgatagcacccggagttccggaaacgaaatt
+
+
+ 24857 tgcatatacccattgctcacgaaaaaaaatgtccttgtcgatataggga
+ 24857 tgcatatacccattgctcacgaaaaaa.atgtccttgtcgatataggga
+ ^
+
+ 24906 tgaatcgcttggtgtacctcatctactgcgaaaacttgacctttctctc
+ 24905 tgaatcgcttggtgtacctcatctactgcgaaaacttgacctttctctc
+
+
+ 24955 ccatattgcagtcgcggcacgatggaactaaattaataggcatcaccga
+ 24954 ccatattgcagtcgcggcacgatggaactaaattaataggcatcaccga
+
+
+ 25004 aaattcaggataatgtgcaataggaagaaaatgatctatattttttgtc
+ 25003 aaattcaggataatgtgcaataggaagaaaatgatctatattttttgtc
+
+
+ 25053 tgtcctatatcaccacaaaatggacatttttcacctgatgaaacaagca
+ 25052 tgtcctatatcaccacaaaatggacatttttcacctgatgaaacaagca
+
+
+ 25102 tgtcatcgtaatatgttctagcgggtttgtttttatctcggagattatt
+ 25101 tgtcatcgtaatatgttctagcgggtttgtttttatctcggagattatt
+
+
+ 25151 ttcataaagcttttcta
+ 25150 ttcataaagcttttcta
+
+
+
+ -- END alignment [ +1 24760 - 25167 | +1 24759 - 25166 ]
+ -- BEGIN alignment [ +1 30837 - 30950 | +1 30835 - 30945 ]
+
+
+ 30837 ttttatccggaaactgctgtctggctttttttgatttcagaattag.cc
+ 30835 ttttatccggaaactgctgtctggcttttt.tgatttcagaa.tagccc
+ ^ ^ ^
+
+ 30885 tgacgggcaatgctgcgaagggcgttttcctgctgaggtgtcattgaac
+ 30882 tgacgcg.gatgctgcgaagggcgttttcctgctgagg.gtcattgaac
+ ^ ^^ ^
+
+ 30934 aagtcccatgtcggcaa
+ 30929 aagtcccatgtcggcaa
+
+
+
+ -- END alignment [ +1 30837 - 30950 | +1 30835 - 30945 ]
+ -- BEGIN alignment [ +1 43908 - 44037 | +1 43902 - 44030 ]
+
+
+ 43908 aatttcattcgccaaaaagcccgatgatgagcgactcaccacgggccac
+ 43902 aatttcattcgccaaaaagc.cgatgatgagcgactcaccacgggccac
+ ^
+
+ 43957 ggcttctgactctctttccggtactgatgtgatggctgctatggggatg
+ 43950 ggcttctgactctctttccggtactgatgtgatggctgctatggggatg
+
+
+ 44006 gcgcaatcacaagccggattcggtatggctgc
+ 43999 gcgcaatcacaagccggattcggtatggctgc
+
+
+
+ -- END alignment [ +1 43908 - 44037 | +1 43902 - 44030 ]
+
+ ============================================================
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff --git a/tests/cram/makePbi.t.off b/tests/cram/makePbi.t.off
new file mode 100644
index 0000000..d2e613a
--- /dev/null
+++ b/tests/cram/makePbi.t.off
@@ -0,0 +1,284 @@
+
+Run makePbi.py on the lil' BAM in pbcore, make sure output is as
+expected. We have to copy it and the bam.bai locally because we can't
+write to the pbcore directory.
+
+ $ export REMOTE_BAM=`python -c "import pbcore.data as D; print D.getBamAndCmpH5()[0]"`
+ $ cp $REMOTE_BAM .
+ $ cp ${REMOTE_BAM}.bai .
+ $ export BAM=`echo *.bam`
+ $ export REF=`python -c "import pbcore.data as D; print D.getLambdaFasta()"`
+
+ $ makePbi.py $BAM $REF
+
+ $ h5dump *.bam.pbi
+ HDF5 "bam_mapping.bam.pbi" {
+ GROUP "/" {
+ GROUP "PacBioBamIndex" {
+ ATTRIBUTE "Version" {
+ DATATYPE H5T_STRING {
+ STRSIZE 3;
+ STRPAD H5T_STR_NULLPAD;
+ CSET H5T_CSET_ASCII;
+ CTYPE H5T_C_S1;
+ }
+ DATASPACE SCALAR
+ DATA {
+ (0): "0.1"
+ }
+ }
+ GROUP "Columns" {
+ DATASET "HoleNumber" {
+ DATATYPE H5T_STD_U32LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 49050, 32328, 32328, 6469, 6469, 30983, 13473, 13473, 19915,
+ (9): 30983, 19915, 7247, 7247, 38025, 13473, 36363, 36363, 31174,
+ (18): 31174, 38025, 50257, 50257, 14743, 14743, 39571, 39571,
+ (26): 39571, 32901, 24494, 24494, 24962, 14743, 14743, 42165,
+ (34): 35858, 35858, 42827, 35858, 42827, 32861, 32861, 32861,
+ (42): 32861, 32861, 32861, 12736, 12736, 38754, 32861, 32861,
+ (50): 45203, 2771, 7670, 2771, 36628, 45203, 49194, 49194, 47698,
+ (59): 47698, 47698, 44356, 19837, 50621, 50621, 20211, 20211,
+ (67): 32560, 32560, 32560, 7957, 7957, 26262, 52206, 6251, 6251,
+ (76): 6251, 6251, 6251, 6251, 6251, 6251, 6251, 6251, 54396,
+ (85): 16996, 16996, 46835, 46835, 49521, 46835, 16996, 1650,
+ (93): 1650, 37134, 37134, 37134, 37134, 37134, 37134, 37134,
+ (101): 37134, 37134, 37134, 37134, 37134, 37134, 37134, 51534,
+ (109): 29843, 23454, 23454, 19360, 15641, 49050
+ }
+ }
+ DATASET "MapQV" {
+ DATATYPE H5T_STD_U8LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254,
+ (12): 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254,
+ (24): 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254,
+ (36): 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254,
+ (48): 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254,
+ (60): 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254,
+ (72): 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254,
+ (84): 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254,
+ (96): 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254, 254,
+ (108): 254, 254, 254, 254, 254, 254, 254
+ }
+ }
+ DATASET "ReadGroupID" {
+ DATATYPE H5T_STD_U32LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (5): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (10): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (15): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (20): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (25): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (30): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (35): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (40): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (45): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (50): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (55): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (60): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (65): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (70): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (75): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (80): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (85): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (90): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (95): 3771511568, 3771511568, 3771511568, 3771511568, 3771511568,
+ (100): 3771511568, 3771511568, 3771511568, 3771511568,
+ (104): 3771511568, 3771511568, 3771511568, 3771511568,
+ (108): 3771511568, 3771511568, 3771511568, 3771511568,
+ (112): 3771511568, 3771511568, 3771511568
+ }
+ }
+ DATASET "isReverseStrand" {
+ DATATYPE H5T_STD_U8LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 0, 1, 0, 0, 1, 1, 1, 0, 1, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0,
+ (20): 1, 0, 1, 0, 1, 0, 1, 0, 0, 1, 1, 1, 0, 0, 0, 1, 0, 0, 1, 0,
+ (40): 0, 1, 1, 1, 0, 0, 1, 1, 1, 0, 1, 1, 0, 0, 0, 1, 0, 1, 0, 1,
+ (60): 0, 0, 0, 0, 1, 0, 1, 0, 1, 0, 0, 1, 0, 1, 1, 0, 0, 1, 1, 1,
+ (80): 0, 0, 0, 1, 0, 0, 1, 0, 1, 0, 0, 1, 0, 1, 0, 0, 0, 0, 1, 1,
+ (100): 1, 1, 1, 0, 1, 0, 1, 0, 1, 0, 1, 0, 0, 0, 0
+ }
+ }
+ DATASET "nDel" {
+ DATATYPE H5T_STD_U32LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 11, 15, 12, 7, 11, 51, 38, 37, 29, 11, 13, 21, 20, 37, 5,
+ (15): 11, 9, 9, 16, 12, 15, 10, 41, 46, 13, 36, 26, 30, 11, 8,
+ (30): 12, 14, 13, 20, 36, 39, 32, 7, 30, 19, 14, 15, 8, 14, 10,
+ (45): 14, 0, 19, 6, 11, 4, 14, 24, 5, 9, 6, 19, 8, 5, 13, 5, 3,
+ (62): 1, 26, 16, 4, 3, 0, 26, 12, 1, 3, 16, 12, 6, 11, 9, 12, 5,
+ (79): 18, 13, 8, 10, 7, 21, 19, 12, 5, 15, 2, 4, 1, 25, 4, 10, 9,
+ (96): 16, 13, 8, 11, 10, 10, 7, 10, 7, 6, 8, 5, 2, 20, 10, 6, 3,
+ (113): 3, 13
+ }
+ }
+ DATASET "nIns" {
+ DATATYPE H5T_STD_U32LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 16, 37, 4, 9, 9, 46, 80, 56, 17, 10, 15, 16, 6, 63, 5, 5, 9,
+ (17): 6, 35, 46, 12, 13, 66, 67, 14, 72, 50, 9, 17, 9, 14, 25,
+ (32): 18, 21, 8, 23, 32, 11, 44, 26, 47, 35, 25, 40, 40, 26, 5,
+ (47): 19, 18, 25, 19, 22, 8, 2, 10, 28, 32, 33, 8, 10, 0, 19, 5,
+ (63): 17, 6, 3, 1, 2, 67, 27, 0, 2, 25, 11, 26, 25, 30, 32, 35,
+ (79): 23, 27, 21, 27, 6, 28, 25, 12, 7, 31, 16, 10, 1, 44, 15,
+ (94): 26, 27, 13, 14, 16, 8, 19, 17, 17, 17, 15, 28, 26, 14, 10,
+ (109): 41, 25, 16, 16, 11, 29
+ }
+ }
+ DATASET "nM" {
+ DATATYPE H5T_STD_U32LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 460, 699, 337, 151, 216, 1385, 1578, 1313, 580, 341, 359,
+ (11): 448, 233, 1574, 185, 281, 236, 181, 990, 419, 378, 341,
+ (22): 1405, 1398, 430, 1345, 1272, 399, 323, 173, 380, 582, 383,
+ (33): 636, 512, 954, 1019, 217, 937, 737, 738, 741, 748, 739,
+ (44): 741, 614, 74, 803, 454, 403, 325, 514, 269, 131, 210, 492,
+ (56): 755, 661, 222, 633, 146, 411, 71, 594, 258, 115, 62, 67,
+ (68): 1412, 656, 53, 56, 516, 366, 596, 591, 589, 586, 594, 582,
+ (80): 585, 593, 451, 130, 692, 535, 402, 129, 601, 113, 217, 88,
+ (92): 1046, 219, 432, 427, 425, 427, 432, 430, 431, 427, 425,
+ (103): 429, 427, 429, 428, 288, 189, 701, 281, 424, 354, 96, 569
+ }
+ }
+ DATASET "nMM" {
+ DATATYPE H5T_STD_U32LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 0, 3, 2, 0, 0, 7, 3, 3, 2, 1, 1, 8, 0, 2, 2, 1, 1, 0, 4, 3,
+ (20): 4, 3, 3, 4, 0, 3, 3, 0, 1, 0, 4, 1, 0, 3, 0, 1, 2, 0, 1, 0,
+ (40): 3, 0, 0, 2, 0, 2, 0, 4, 1, 2, 0, 2, 1, 0, 0, 0, 4, 2, 1, 1,
+ (60): 0, 0, 0, 4, 0, 1, 1, 0, 3, 0, 0, 0, 1, 0, 1, 0, 1, 2, 1, 2,
+ (80): 2, 0, 0, 1, 5, 1, 0, 0, 0, 1, 1, 0, 6, 1, 0, 0, 0, 0, 1, 0,
+ (100): 0, 0, 1, 0, 1, 1, 0, 1, 0, 5, 1, 1, 1, 3, 2
+ }
+ }
+ DATASET "rEnd" {
+ DATATYPE H5T_STD_U32LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 1129, 1134, 344, 10394, 10185, 8906, 7235, 8657, 1040, 7418,
+ (10): 382, 7820, 7290, 7894, 5505, 1194, 853, 1262, 1029, 6211,
+ (20): 7351, 6903, 4055, 5571, 445, 1918, 3290, 11588, 570, 185,
+ (30): 407, 6227, 2531, 661, 1822, 1259, 1053, 228, 2107, 2064,
+ (40): 3718, 1255, 2884, 4549, 5389, 763, 79, 827, 5908, 431, 357,
+ (51): 9480, 5699, 8874, 1925, 888, 798, 1541, 10609, 10332, 9628,
+ (61): 4803, 5653, 3208, 3516, 9443, 9552, 2356, 2213, 684, 9734,
+ (71): 9619, 546, 380, 3818, 1808, 4484, 1145, 2488, 5139, 3146,
+ (81): 5805, 479, 5993, 733, 11857, 11253, 4868, 4684, 134, 4005,
+ (91): 11992, 3296, 2155, 1318, 3325, 5293, 6271, 1816, 3812,
+ (100): 4805, 5785, 6766, 4306, 2823, 2330, 808, 308, 200, 756,
+ (110): 2211, 2705, 371, 3562, 653
+ }
+ }
+ DATASET "rStart" {
+ DATATYPE H5T_STD_U32LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 653, 395, 1, 10234, 9960, 7468, 5574, 7285, 441, 7066, 7,
+ (11): 7348, 7051, 6255, 5313, 907, 607, 1075, 0, 5743, 6957,
+ (21): 6546, 2581, 4102, 1, 498, 1965, 11180, 229, 3, 9, 5619,
+ (32): 2130, 1, 1302, 281, 0, 0, 1125, 1301, 2930, 479, 2111,
+ (43): 3768, 4608, 121, 0, 1, 5435, 1, 13, 8942, 5421, 8741, 1705,
+ (55): 368, 7, 845, 10378, 9688, 9482, 4373, 5577, 2593, 3252,
+ (65): 9324, 9488, 2287, 731, 1, 9681, 9561, 4, 3, 3195, 1192,
+ (76): 3864, 525, 1858, 4532, 2532, 5191, 1, 5856, 8, 11296,
+ (86): 10839, 4732, 4052, 4, 3777, 11903, 2200, 1920, 860, 2871,
+ (96): 4855, 5830, 1367, 3374, 4355, 5341, 6323, 3860, 2380, 1872,
+ (106): 354, 5, 1, 9, 1904, 2264, 0, 3452, 53
+ }
+ }
+ DATASET "tEnd" {
+ DATATYPE H5T_STD_U32LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 471, 1019, 1026, 2326, 2397, 5015, 6125, 5860, 5203, 5011,
+ (10): 5215, 5380, 5388, 7039, 6134, 6550, 6557, 6676, 7496, 7039,
+ (20): 7338, 7352, 9902, 9903, 8962, 9909, 9909, 9160, 9316, 9162,
+ (30): 9631, 9900, 9903, 10847, 10830, 11277, 12062, 11286, 12083,
+ (39): 14130, 14129, 14130, 14130, 14131, 14130, 14039, 13483,
+ (47): 14494, 14130, 14130, 14480, 16490, 16359, 16477, 18449,
+ (55): 18989, 20659, 20659, 21954, 22375, 22386, 25815, 25627,
+ (63): 28077, 28077, 28300, 28300, 28865, 30239, 30238, 29805,
+ (71): 29823, 32290, 33539, 33947, 33947, 33944, 33945, 33945,
+ (79): 33947, 33946, 33947, 33947, 33945, 34651, 34524, 34384,
+ (87): 34170, 34653, 34455, 34653, 34524, 41729, 40876, 41668,
+ (95): 41662, 41667, 41666, 41667, 41667, 41667, 41663, 41659,
+ (103): 41667, 41663, 41667, 41667, 41667, 42245, 43431, 43707,
+ (111): 43852, 46021, 47300, 48502
+ }
+ }
+ DATASET "tId" {
+ DATATYPE H5T_STD_U32LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
+ (20): 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
+ (40): 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
+ (60): 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
+ (80): 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
+ (100): 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0
+ }
+ }
+ DATASET "tStart" {
+ DATATYPE H5T_STD_U32LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 0, 302, 675, 2168, 2170, 3572, 4506, 4507, 4592, 4658, 4842,
+ (11): 4903, 5135, 5426, 5942, 6257, 6311, 6486, 6486, 6605, 6941,
+ (21): 6998, 8453, 8455, 8519, 8525, 8608, 8731, 8981, 8981, 9235,
+ (31): 9303, 9507, 10188, 10282, 10283, 11009, 11062, 11115,
+ (39): 13374, 13374, 13374, 13374, 13376, 13379, 13409, 13409,
+ (47): 13668, 13669, 13714, 14151, 15960, 16065, 16341, 18230,
+ (55): 18491, 19881, 19988, 21726, 21728, 22235, 25401, 25555,
+ (63): 27453, 27803, 28180, 28234, 28798, 28798, 29570, 29751,
+ (71): 29764, 31757, 33161, 33344, 33345, 33345, 33345, 33345,
+ (79): 33345, 33346, 33346, 33486, 33807, 33933, 33969, 33970,
+ (87): 34036, 34037, 34339, 34431, 34435, 40652, 40652, 41226,
+ (95): 41226, 41226, 41226, 41226, 41226, 41226, 41226, 41226,
+ (103): 41228, 41228, 41231, 41231, 41373, 42054, 42705, 43415,
+ (111): 43421, 45663, 47198, 47918
+ }
+ }
+ DATASET "virtualFileOffset" {
+ DATATYPE H5T_STD_U64LE
+ DATASPACE SIMPLE { ( 115 ) / ( 115 ) }
+ DATA {
+ (0): 37289984, 37297464, 37302901, 37305464, 37306835, 37308840,
+ (6): 37319177, 37331170, 37340990, 37345579, 37348282, 37351180,
+ (12): 1400766464, 1400768474, 1400780090, 1400781672, 1400783950,
+ (17): 1400785921, 1400787532, 1400794809, 1400798441, 1400801586,
+ (22): 1400804273, 1400814861, 1400825478, 2693922816, 2693933061,
+ (27): 2693942476, 2693945620, 2693948306, 2693949849, 2693953028,
+ (32): 2693957573, 2693960750, 2693965565, 2693969455, 2693976553,
+ (37): 2693984256, 4005036032, 4005043189, 4005048711, 4005054536,
+ (42): 4005060173, 4005065686, 4005071343, 4005077071, 4005081765,
+ (47): 4005082502, 4005088435, 4005091906, 5185470464, 5185476664,
+ (52): 5185480882, 5185483212, 5185484548, 5185486594, 5185492867,
+ (57): 5185498641, 5185503674, 5185505475, 5185510163, 5185511365,
+ (62): 5185514585, 5185516413, 5185520969, 5185523099, 5185524146,
+ (67): 5185524807, 6259802112, 6259812658, 6259817624, 6259818185,
+ (72): 6259818965, 6259822993, 6259825854, 6259830337, 6259834829,
+ (77): 6259839381, 6259843935, 6259848543, 6259852994, 6259857544,
+ (82): 6259861981, 6259865591, 7562395648, 7562401014, 7562405209,
+ (87): 7562408308, 7562409500, 7562414175, 7562415337, 7562417257,
+ (92): 7562418063, 7562425937, 7562427821, 7562431267, 7562434728,
+ (97): 7562438021, 7562441318, 7562444627, 7562447840, 7562451195,
+ (102): 7562454497, 8838053888, 8838057225, 8838060537,
+ (106): 8838064023, 8838067483, 8838069828, 8838071554,
+ (110): 8838077140, 8838079550, 8838082848, 8838085829, 8838086898
+ }
+ }
+ }
+ }
+ }
+ }
diff --git a/tests/cram/plurality-hcv.t b/tests/cram/plurality-hcv.t
new file mode 100644
index 0000000..d674274
--- /dev/null
+++ b/tests/cram/plurality-hcv.t
@@ -0,0 +1,55 @@
+
+Run plurality on the small example file, and make sure the GFF and
+CSV output is correct.
+
+
+ $ export DATA=$TESTDIR/../data
+ $ export INPUT=$DATA/hcv/aligned_reads.cmp.h5
+ $ export REFERENCE=$DATA/hcv/HCV_Ref_For_187140.fasta
+ $ variantCaller.py --algorithm=plurality -q 10 -r $REFERENCE -o variants.gff -o consensus.fq $INPUT
+
+I like to show the head of the output files inline here so that glaringly obvious changes will
+pop right out, but I verify that the files are exactly correct by looking at the md5 sums.
+
+First, the variants.gff:
+
+ $ cat variants.gff
+ ##gff-version 3
+ ##pacbio-variant-version 2.1
+ ##date * (glob)
+ ##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
+ ##source GenomicConsensus * (glob)
+ ##source-commandline * (glob)
+ ##source-alignment-file * (glob)
+ ##source-reference-file * (glob)
+ ##sequence-region 5primeEnd 1 156
+ ##sequence-region 3primeEnd 1 386
+
+
+Examine consensus output. This is identical to the reference
+
+ $ fold -60 consensus.fq
+ @5primeEnd|plurality
+ GGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCGTGGATAAACCCGC
+ TCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCG
+ CGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTG
+ +
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ @3primeEnd|plurality
+ TACCTGGTCATAGCCTCCGTGAAGGCTCTCAGGCTCGCTGCATCCTCCGGGACTCCCTGA
+ CTTTCACAGATAACGACTAAGTCGTCGCCACACACGAGCATGGTGCAGTCCTGGAGCCCA
+ GCGGCTCGACAGGCTGCTTTGGCCTTGATGTAGCAGGTGAGGGTGTTACCACAGCTGGTC
+ GTCAGTACGCCGCTCGCGCGGCACCTGCGATAGCCGCAGTTTTCCCCCCTTGAATTAGTA
+ AGAGGGCCCCCGACATAGAGCCTCTCGGTGAGGGACTTGATGGCCACGCGGGCTTGGGGG
+ TCCAGGTCACAACATTGGTAAATTGCCTCCTCTGTACGGATATCGCTCTCAGTGACTGTG
+ GAGTCAAAGCAGCGGGTATCATACGA
+ +
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+ IIIIIIIIIIIIIIIIIIIIIIIIII
diff --git a/tests/cram/plurality-pbcore-lambda.t b/tests/cram/plurality-pbcore-lambda.t
new file mode 100644
index 0000000..b0e4593
--- /dev/null
+++ b/tests/cram/plurality-pbcore-lambda.t
@@ -0,0 +1,17 @@
+
+Run plurality on the lambda file in pbcore.
+
+ $ export CMPH5=`python -c "from pbcore import data as D; print D.getBamAndCmpH5()[1]"`
+# $ export BAM=`python -c "from pbcore import data as D; print D.getBamAndCmpH5()[0]"`
+ $ export REF=`python -c "from pbcore import data as D; print D.getLambdaFasta()"`
+
+ $ plurality $CMPH5 -r $REF -o css-cmph5.fa -o v-cmph5.gff
+ $ cat v-cmph5.gff | grep -v "#" | sed 's/ / /g'
+ lambda_NEB3011 . deletion 4945 4945 . . . reference=C;variantSeq=.;frequency=4;coverage=7;confidence=40
+
+# $ plurality $BAM -r $REF -o css-bam.fa -o v-bam.gff
+# [WARNING] 'fancyChunking' not yet available for BAM, disabling
+# $ cat v-bam.gff | grep -v "#" | sed 's/ / /g'
+# lambda_NEB3011 . deletion 4945 4945 . . . reference=C;variantSeq=.;frequency=4;coverage=7;confidence=40
+
+# $ diff css-cmph5.fa css-bam.fa
diff --git a/tests/cram/quiver-hcv.t b/tests/cram/quiver-hcv.t
new file mode 100644
index 0000000..7232429
--- /dev/null
+++ b/tests/cram/quiver-hcv.t
@@ -0,0 +1,66 @@
+
+Bite-sized Quiver test using the HCV dataset
+
+ $ export DATA=$TESTDIR/../data
+ $ export INPUT=$DATA/hcv/aligned_reads.cmp.h5
+ $ export REFERENCE=$DATA/hcv/HCV_Ref_For_187140.fasta
+
+Quiver actually makes one error here, which is kind of disappointing,
+but this data is from a really ancient instrument-software version, so
+I'm not all that surprised.
+
+ $ quiver -p unknown -x0 -q0 $INPUT -r $REFERENCE -o v.gff -o css.fa -o css.fq
+
+ $ cat v.gff
+ ##gff-version 3
+ ##pacbio-variant-version 2.1
+ ##date * (glob)
+ ##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
+ ##source GenomicConsensus * (glob)
+ ##source-commandline * (glob)
+ ##source-alignment-file * (glob)
+ ##source-reference-file * (glob)
+ ##sequence-region 5primeEnd 1 156
+ ##sequence-region 3primeEnd 1 386
+ 3primeEnd\t.\tdeletion\t296\t296\t.\t.\t.\treference=G;variantSeq=.;coverage=92;confidence=4 (esc)
+
+
+ $ cat css.fa
+ >5primeEnd|quiver
+ GGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCGTGGATAAACCCGC
+ TCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCG
+ CGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTG
+ >3primeEnd|quiver
+ TACCTGGTCATAGCCTCCGTGAAGGCTCTCAGGCTCGCTGCATCCTCCGGGACTCCCTGA
+ CTTTCACAGATAACGACTAAGTCGTCGCCACACACGAGCATGGTGCAGTCCTGGAGCCCA
+ GCGGCTCGACAGGCTGCTTTGGCCTTGATGTAGCAGGTGAGGGTGTTACCACAGCTGGTC
+ GTCAGTACGCCGCTCGCGCGGCACCTGCGATAGCCGCAGTTTTCCCCCCTTGAATTAGTA
+ AGAGGGCCCCCGACATAGAGCCTCTCGGTGAGGGACTTGATGGCCACGCGGGCTTGGGGT
+ CCAGGTCACAACATTGGTAAATTGCCTCCTCTGTACGGATATCGCTCTCAGTGACTGTGG
+ AGTCAAAGCAGCGGGTATCATACGA
+
+ $ fold -60 css.fq
+ @5primeEnd|quiver
+ GGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCGTGGATAAACCCGC
+ TCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCG
+ CGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTG
+ +
+ "RPRQSQRPQQPQPQPQQOQQQPQQQQQQRPRQQPPQRQPQRRRRQPPQRQPPQQPPQQQ
+ QQPRPQPRQPQPQQQRRPRQQQPQPRQQRRQPRPPPQQQPQRQQQPQPPQQQQQPQQQRQ
+ PQQRQPRPRPRQQQRQQQQQPRQQQPQQRRQQQRRQ
+ @3primeEnd|quiver
+ TACCTGGTCATAGCCTCCGTGAAGGCTCTCAGGCTCGCTGCATCCTCCGGGACTCCCTGA
+ CTTTCACAGATAACGACTAAGTCGTCGCCACACACGAGCATGGTGCAGTCCTGGAGCCCA
+ GCGGCTCGACAGGCTGCTTTGGCCTTGATGTAGCAGGTGAGGGTGTTACCACAGCTGGTC
+ GTCAGTACGCCGCTCGCGCGGCACCTGCGATAGCCGCAGTTTTCCCCCCTTGAATTAGTA
+ AGAGGGCCCCCGACATAGAGCCTCTCGGTGAGGGACTTGATGGCCACGCGGGCTTGGGGT
+ CCAGGTCACAACATTGGTAAATTGCCTCCTCTGTACGGATATCGCTCTCAGTGACTGTGG
+ AGTCAAAGCAGCGGGTATCATACGA
+ +
+ "QQRQQQPQPQPQPRQQRPQPPRPQQQQRQPQRQQQQQPQQQQQRQRQRQQPQQPRRPQP
+ QPQQQQQPQQQPSQQQPQQQPRQQPQQQRQPQQQQQQPQPQQQQQQRQPPRPRRQRRRQQ
+ QQPRPQQRRQQRRQQQQPQRQRPQPRQQPQQPPQRQRQQRPRQPPQQQQQQPPQRQQQQQ
+ QPQQQQRPQRRQPQQQPQQPPPQPQPQQQPQQQQQPQQQQQQR5QPQQQRQPPQPRPQQQ
+ QRQRSRJQQSPQQPPPPQPQPQQQPQQRQQPRQRQQQQQQRPQQQQPQQQRQPRQ%RQQQ
+ PQPQRQQQRPQQQQRPQRQRQPQQQQQPRPQQQQRPPQQQPQQQQOQQQPQQQPQPQRRR
+ PPQPPPRPQPRQQQPPQQPQPRQQQ
diff --git a/tests/cram/quiver-noqvs-test.t b/tests/cram/quiver-noqvs-test.t
new file mode 100644
index 0000000..0601dbc
--- /dev/null
+++ b/tests/cram/quiver-noqvs-test.t
@@ -0,0 +1,51 @@
+
+Identical to "small-quiver-test.t" but using the NoQVs model.
+
+ $ export DATA=$TESTDIR/../data
+ $ export INPUT=$DATA/hcv/aligned_reads.cmp.h5
+ $ export REFERENCE=$DATA/hcv/HCV_Ref_For_187140.fasta
+
+Quiver actually makes one error here, which is kind of disappointing,
+but this data is from a really ancient instrument-software version, so
+I'm not all that surprised.
+
+ $ quiver -pC2.NoQVsModel -x0 -q0 $INPUT -r $REFERENCE -o v.gff -o css.fa -o css.fq
+
+ $ cat v.gff
+ ##gff-version 3
+ ##pacbio-variant-version 2.1
+ ##date * (glob)
+ ##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
+ ##source GenomicConsensus * (glob)
+ ##source-commandline * (glob)
+ ##source-alignment-file * (glob)
+ ##source-reference-file * (glob)
+ ##sequence-region 5primeEnd 1 156
+ ##sequence-region 3primeEnd 1 386
+ 3primeEnd\t.\tdeletion\t296\t296\t.\t.\t.\treference=G;variantSeq=.;coverage=92;confidence=4 (esc)
+ 3primeEnd\t.\tdeletion\t369\t369\t.\t.\t.\treference=G;variantSeq=.;coverage=83;confidence=6 (esc)
+
+
+ $ cat css.fa
+ >5primeEnd|quiver
+ GGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCGTGGATAAACCCGC
+ TCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCG
+ CGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTG
+ >3primeEnd|quiver
+ TACCTGGTCATAGCCTCCGTGAAGGCTCTCAGGCTCGCTGCATCCTCCGGGACTCCCTGA
+ CTTTCACAGATAACGACTAAGTCGTCGCCACACACGAGCATGGTGCAGTCCTGGAGCCCA
+ GCGGCTCGACAGGCTGCTTTGGCCTTGATGTAGCAGGTGAGGGTGTTACCACAGCTGGTC
+ GTCAGTACGCCGCTCGCGCGGCACCTGCGATAGCCGCAGTTTTCCCCCCTTGAATTAGTA
+ AGAGGGCCCCCGACATAGAGCCTCTCGGTGAGGGACTTGATGGCCACGCGGGCTTGGGGT
+ CCAGGTCACAACATTGGTAAATTGCCTCCTCTGTACGGATATCGCTCTCAGTGACTGTGG
+ AGTCAAACAGCGGGTATCATACGA
+
+ $ cat css.fq
+ @5primeEnd|quiver
+ GGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCGTGGATAAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTG
+ +
+ "POPOPOPOOOOOOOOOPLPKPOPOOPOOPOOOOKPOPPOLPOPPOOOOPOOOPPOPPOOOOOPOOOPOOPOOOOPPFPPOOOO5PPPPOOOPOOOOOOOOOOPOOOOOOOOOPOPPOOOOOOPPOPOPOPOOOPOOOOOOPOOOOOOPPOOOOPO
+ @3primeEnd|quiver
+ TACCTGGTCATAGCCTCCGTGAAGGCTCTCAGGCTCGCTGCATCCTCCGGGACTCCCTGACTTTCACAGATAACGACTAAGTCGTCGCCACACACGAGCATGGTGCAGTCCTGGAGCCCAGCGGCTCGACAGGCTGCTTTGGCCTTGATGTAGCAGGTGAGGGTGTTACCACAGCTGGTCGTCAGTACGCCGCTCGCGCGGCACCTGCGATAGCCGCAGTTTTCCCCCCTTGAATTAGTAAGAGGGCCCCCGACATAGAGCCTCTCGGTGAGGGACTTGATGGCCACGCGGGCTTGGGGTCCAGGTCACAACATTGGTAAATTGCCTCCTCTGTACGGATATCGCTCTCAGTGACTGTGGAGTCAAACAGCGGGTATCATACGA
+ +
+ "8<=A:@NNOOOOOPOKPOOOOPFPOIOOOOKPOOOOOOOOOOKPOFP>PPOOO5PPOOOOJPPOOOOOOONPOOOOOOPOOOOOOOOPOOOOOOOOOOOONPOOOOOONPOOPOO>PPOOOKPOOOOOOOOPOOOOOPPNPNPOPOONOOOOOOOPOOOJPPOOOPOOPOOOOOOOPOOOOOOOOOOOOPOOOOOOOOOPOOOPOOOOOOOONPOOOOEPPP(PPPPPOPOOPOPOOOOPOOOPP0PPPPOOOOOOOOOOPOOOOOPOOOLPPOOOPOOONPOPOOOONPPOOP%PPPOKPOOPOOOOOPOOOPOPOOPPOPOOPONPOOOOOOOOPOOOOOOOOOOOOOOOOOOOOMPOOOO*PP'OOOGPPO??OOOOKF@
diff --git a/tests/cram/version.t b/tests/cram/version.t
new file mode 100644
index 0000000..5d58c75
--- /dev/null
+++ b/tests/cram/version.t
@@ -0,0 +1,8 @@
+This actually failed once because of a missing import, so we might as
+well test it.
+
+ $ variantCaller.py --version
+ GenomicConsensus version: * (glob)
+ ConsensusCore version: * (glob)
+ h5py version: * (glob)
+ hdf5 version: * (glob)
diff --git a/tests/data/converters/variants.gff.gz b/tests/data/converters/variants.gff.gz
new file mode 100755
index 0000000..4fd74a5
Binary files /dev/null and b/tests/data/converters/variants.gff.gz differ
diff --git a/tests/data/fluidigm_amplicons/040500.cmp.h5 b/tests/data/fluidigm_amplicons/040500.cmp.h5
new file mode 100644
index 0000000..f80a079
Binary files /dev/null and b/tests/data/fluidigm_amplicons/040500.cmp.h5 differ
diff --git a/tests/data/fluidigm_amplicons/Fluidigm_human_amplicons.fasta b/tests/data/fluidigm_amplicons/Fluidigm_human_amplicons.fasta
new file mode 100644
index 0000000..a4464a5
--- /dev/null
+++ b/tests/data/fluidigm_amplicons/Fluidigm_human_amplicons.fasta
@@ -0,0 +1,250 @@
+>EGFR_Exon_2
+TTTCTTCCAGTTTGCCAAGGCACGAGTAACAAGCTCACGCAGTTGGGCACTTTTGAAGAT
+CATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTGGTCCTTGGGAATTTGGAA
+ATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAGGTTGGTGACTTTGATTTT
+CCT
+>EGFR_Exon_3
+TTCTTAGACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCG
+AATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGC
+CTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAG
+AAATTTACAGGGTGAGAGGCTGG
+>EGFR_Exon_4
+AGCTGGAAAGAGTGCTCACCGCAGTTCCATTCTCCCGCAGAAATCCTGCATGGCGCCGTG
+CGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCCAGTGGCGGGACATAGTC
+AGCAGTGACTTTCTCAGCAACATGTCGATGGACTTCCAGAACCACCTGGGCAGCTGTAAG
+TGTCGCATACACACTATCTCTGCCTCCAGCTCCTA
+>EGFR_Exon_5
+GCGTCATCAGTTTCTCATCATTTCACTGAGATATGCATCTATTACTTTTACATTTCAGGC
+CAAAAGTGTGATCCAAGCTGTCCCAATGGGAGCTGCTGGGGTGCAGGAGAGGAGAACTGC
+CAGAAACGTAAGTCAGTGAACAGCCTCAGACCCATGT
+>EGFR_Exon_6
+CCCTGGGAAATGATCCTACCCTCACTCTTCAGCTCACAGGGAACCTTTGCTCTTTTTCAG
+TGACCAAAATCATCTGTGCCCAGCAGTGCTCCGGGCGCTGCCGTGGCAAGTCCCCCAGTG
+ACTGCTGCCACAACCAGTGTGCTGCAGGCTGCACAGGCCCCCGGGAGAGCGACTGCCTGG
+TAAGA
+>EGFR_Exon_7
+CCAGCGTGTCCTCTCTCCTCCATAGGTCTGCCGCAAATTCCGAGACGAAGCCACGTGCAA
+GGACACCTGCCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAACCC
+CGAGGGCAAATACAGCTTTGGTGCCACCTGCGTGAAGAAGTGTCCCCGTGAGTCCTCCTC
+TGTGGGCCCTCTAACTGGTCAGGCATCCTTGTC
+>EGFR_Exon_8
+CAAAGGAGGATGGAGCCTTTCCATCACCCCTCAAGAGGACCTGGACCGCCTGTGTGAGGC
+CCGAGCACCTGGTGCCACCGTCATCACCTTCCTTTCATGCTCTCTTCCCCAGGTAATTAT
+GTGGTGACAGATCACGGCTCGTGCGTCCGAGCCTGTGGGGCCGACAGCTATGAGATGGAG
+GAAGACGGCGTCCGCAAGTGTAAGAAGTGCGAAGGGCCTTGCCGCAAAGGTAGGAAGCCC
+GCCGGTGTGCGGACGAGGCTTGTTCTCGGCTGCTGAGGCTGGGCTCTCATGCCACCTCCA
+AAGGAACACATC
+>EGFR_Exon_9
+TCCAACAAATGTGAACGGAATACACGTCTCTCTTATCTCTGCAGTGTGTAACGGAATAGG
+TATTGGTGAATTTAAAGACTCACTCTCCATAAATGCTACGAATATTAAACACTTCAAAAA
+CTGCACCTCCATCAGTGGCGATCTCCACATCCTGCCGGTGGCATTTAGGGGGTGAGTCAC
+AGGTTCAGTTGCTTG
+>EGFR_Exon_10
+GATCAATAATCACCCTGTTGTTTGTTTCAGTGACTCCTTCACACATACTCCTCCTCTGGA
+TCCACAGGAACTGGATATTCTGAAAACCGTAAAGGAAATCACAGGTTTGAGCTGAATTAT
+CACATGAATATAAATGGGAAATCAGTGTTTTAGAGAGAGAACTTTTCGACATATTTCCTG
+TTCCCTTGGAA
+>EGFR_Exon_11
+TCCTACGTGGTGTGTGTCTGAAGTCTTTCATCTGCCTTACAGGGTTTTTGCTGATTCAGG
+CTTGGCCTGAAAACAGGACGGACCTCCATGCCTTTGAGAACCTAGAAATCATACGCGGCA
+GGACCAAGCAACAGTAAGTTGACCACAGCCAAAGC
+>EGFR_Exon_12
+CCACATGATTTTTCTTCTCTCCAATGTAGTGGTCAGTTTTCTCTTGCAGTCGTCAGCCTG
+AACATAACATCCTTGGGATTACGCTCCCTCAAGGAGATAAGTGATGGAGATGTGATAATT
+TCAGGAAACAAAAATTTGTGCTATGCAAATACAATAAACTGGAAAAAACTGTTTGGGACC
+TCCGGTCAGAAAACCAAAATTATAAGCAACAGAGGTGAAAACAGCTGCAGTAAGTCACCG
+>EGFR_Exon_13
+GCTCTGTCACTGACTGCTGTGACCCACTCTGTCTCCGCAGAGGCCACAGGCCAGGTCTGC
+CATGCCTTGTGCTCCCCCGAGGGCTGCTGGGGCCCGGAGCCCAGGGACTGCGTCTCTTGC
+CGGAATGTCAGCCGAGGCAGGGAATGCGTGGACAAGTGCAACCTTCTGGAGGGGTAGGAG
+GTTATTTCTTTAATCCCCTTGCGTTGATCAAAAATAAGGCTCCAGGTTGTTGTTATAGC
+>EGFR_Exon_14
+GCTGACGGGTTTCCTCTTCCTCCTCTCAGTGAGCCAAGGGAGTTTGTGGAGAACTCTGAG
+TGCATACAGTGCCACCCAGAGTGCCTGCCTCAGGCCATGAACATCACCTGCACAGGACGG
+GTAAGAGCCCCTTGCTGCTATCCACGTC
+>EGFR_Exon_15
+GCATGAACATTTTTCTCCACCTTGGTGCAGGGACCAGACAACTGTATCCAGTGTGCCCAC
+TACATTGACGGCCCCCACTGCGTCAAGACCTGCCCGGCAGGAGTCATGGGAGAAAACAAC
+ACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGC
+ACCTACGGGTGAGTGGAAAGTGAAGGAGAACAGAA
+>EGFR_Exon_16
+TTTCTCTTTCACTTCCTACAGATGCACTGGGCCAGGTCTTGAAGGCTGTCCAACGAATGG
+GTAAGTGTTCACAGCTCTGTGTCACATGGACCTCGTCAAGAATGACCACACTGCTGTGG
+>EGFR_Exon_17
+TGGAATCTGTCAGCAACCTCACCCTTCCTTGTTCCTCCACCTCATTCCAGGCCTAAGATC
+CCGTCCATCGCCACTGGGATGGTGGGGGCCCTCCTCTTGCTGCTGGTGGTGGCCCTGGGG
+ATCGGCCTCTTCATGCGAAGGCGCCACATCGTTCGGAAGCGCACGCTGCGGAGGCTGCTG
+CAGGAGAGGGAGGTGAGTGCCAGTCCTGGG
+>EGFR_Exon_18
+GCTGAGGTGACCCTTGTCTCTGTGTTCTTGTCCCCCCCAGCTTGTGGAGCCTCTTACACC
+CAGTGGAGAAGCTCCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAA
+GATCAAAGTGCTGGGCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCCTGGCACA
+GGCCTCTGGGCTGGGCCGCAGGGCCTCTCATGGTCTGGTGGG
+>EGFR_Exon_19
+TCACAATTGCCAGTTAACGTCTTCCTTCTCTCTCTGTCATAGGGACTCTGGATCCCAGAA
+GGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAA
+GCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGG
+>EGFR_Exon_20
+CCACACTGACGTGCCTCTCCCTCCCTCCAGGAAGCCTACGTGATGGCCAGCGTGGACAAC
+CCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAG
+CTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTCC
+CAGTACCTGCTCAACTGGTGTGTGCAGATCGCAAAGGTAATCAGGGAAGGGAGATACGG
+>EGFR_Exon_21
+CCTCACAGCAGGGTCTTCTCTGTTTCAGGGCATGAACTACTTGGAGGACCGTCGCTTGGT
+GCACCGCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCAC
+AGATTTTGGGCTGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGG
+CAAAGTAAGGAGGTGGCTTTAGGTCAG
+>EGFR_Exon_22
+CACTGCCTCATCTCTCACCATCCCAAGGTGCCTATCAAGTGGATGGCATTGGAATCAATT
+TTACACAGAATCTATACCCACCAGAGTGATGTCTGGAGCTACGGTGAGTCATAATCCTGA
+TGCTAATGAGTTTGTACTGAGGCCAAGCTGG
+>EGFR_Exon_23
+CATGATCCCACTGCCTTCTTTTCTTGCTTCATCCTCTCAGGGGTGACTGTTTGGGAGTTG
+ATGACCTTTGGATCCAAGCCATATGACGGAATCCCTGCCAGCGAGATCTCCTCCATCCTG
+GAGAAAGGAGAACGCCTCCCTCAGCCACCCATATGTACCATCGATGTCTACATGATCATG
+GTCAAGTGTGAGTGACTGGTGGGTCTGTCCACACT
+>EGFR_Exon_24
+TTCCAGTGTTCTAATTGCACTGTTTTTTCTCATTCCTTCCCCAGGCTGGATGATAGACGC
+AGATAGTCGCCCAAAGTTCCGTGAGTTGATCATCGAATTCTCCAAAATGGCCCGAGACCC
+CCAGCGCTACCTTGTCATTCAGGTACAAATTGCAGTCTGTGCTTCCATTGGGAAGAGTCC
+CTC
+>EGFR_Exon_25
+CTAATAGCCTCAAAATCTCTGCACCAGGGGGATGAAAGAATGCATTTGCCAAGTCCTACA
+GACTCCAACTTCTACCGTGCCCTGATGGATGAAGAAGACATGGACGACGTGGTGGATGCC
+GACGAGTACCTCATCCCACAGCAGGGCTTCTTCAGCAGCCCCTCCACGTCACGGACTCCC
+CTCCTGAGCTCTCTGGTATGAAATCTCTGTCTCTCTCTCTCTCTCAAGCTGTGTCTACTC
+ATTTGAACAAA
+>EGFR_Exon_26
+CATTCCATGGGCAACTTCTCTGTTTCTTTTTCAGAGTGCAACCAGCAACAATTCCACCGT
+GGCTTGCATTGATAGAAATGGGGTATGTATGAACACCTTATAAGCCAGAA
+>EGFR_Exon_27
+CCTTCCCTCATTTCCTCCTGCAGCTGCAAAGCTGTCCCATCAAGGAAGACAGCTTCTTGC
+AGCGATACAGCTCAGACCCCACAGGCGCCTTGACTGAGGACAGCATAGACGACACCTTCC
+TCCCAGTGCCTGGTGAGTGGCTTGTCTGGA
+>EGFR_Exon_28.1
+CCTCTGATTTCTTTCCACTTTCAGAATACATAAACCAGTCCGTTCCCAAAAGGCCCGCTG
+GCTCTGTGCAGAATCCTGTCTATCACAATCAGCCTCTGAACCCCGCGCCCAGCAGAGACC
+CACACTACCAGGACCCCCACAGCACTGCAGTGGGCAACCCCGAGTATCTCAACACTGTCC
+AGCCCACCTGTGTCAACAGCACATTCGACAGCCCTGCCCACTGGGCCCAGAAAGGCAGCC
+ACCAAATTAG
+>EGFR_Exon_28.2
+TGTCAACAGCACATTCGACAGCCCTGCCCACTGGGCCCAGAAAGGCAGCCACCAAATTAG
+CCTGGACAACCCTGACTACCAGCAGGACTTCTTTCCCAAGGAAGCCAAGCCAAATGGCAT
+CTTTAAGGGCTCCACAGCTGAAAATGCAGAATACCTAAGGGTCGCGCCACAAAGCAGTGA
+ATTTATTGGAGCATGACCACGGAGGATAGTATGAGCCCTAAAAATCCAGACTCTTTCGAT
+ACCCAGGACC
+>MET_Exon_1.1
+CTCTCGCCTTGAACCTGTTTTGGCAGATAAACCTCTCATAATGAAGGCCCCCGCTGTGCT
+TGCACCTGGCATCCTCGTGCTCCTGTTTACCTTGGTGCAGAGGAGCAATGGGGAGTGTAA
+AGAGGCACTAGCAAAGTCCGAGATGAATGTGAATATGAAGTATCAGCTTCCCAACTTCAC
+CGCGGAAACACCCATCCAGAATGTCATTCTACATGAGCATCACATTTTCCTTGGTGCCAC
+TAACTACATTTATGTTTTAAATGAGGAAGACCTTCAGAAGGTTGCTGAGTACAAGACTGG
+GCCTGTGCTG
+>MET_Exon_1.2
+TTCCTTGGTGCCACTAACTACATTTATGTTTTAAATGAGGAAGACCTTCAGAAGGTTGCT
+GAGTACAAGACTGGGCCTGTGCTGGAACACCCAGATTGTTTCCCATGTCAGGACTGCAGC
+AGCAAAGCCAATTTATCAGGAGGTGTTTGGAAAGATAACATCAACATGGCTCTAGTTGTC
+GACACCTACTATGATGATCAACTCATTAGCTGTGGCAGCGTCAACAGAGGGACCTGCCAG
+CGACATGTCTTTCCCCACAATCATACTGCTGACATACAGTCGGAGGTTCACTGCATATTC
+TCCC
+>MET_Exon_2
+TGGATTCACATTAACTCTATGACCATATTTTATTCCAGACACTTCTGAGAAATTCATCAG
+GCTGTGAAGCGCGCCGTGATGAATATCGAACAGAGTTTACCACAGCTTTGCAGCGCGTTG
+ACTTATTCATGGGTCAATTCAGCGAAGTCCTCTTAACATCTATATCCACCTTCATTAAAG
+GAGACCTCACCATAGCTAATCTTGGGACATCAGAGGGTCGCTTCATGCAGGTAAGTGCTT
+TCTGAGAGTAGCTGTGTCTGTTCTATCTGGTATTGTGCAA
+>MET_Exon_3
+TGAGCTTGTTGGAATAAGGATGTTATAACTTTTTTGCTGTTTAGGTTGTGGTTTCTCGAT
+CAGGACCATCAACCCCTCATGTGAATTTTCTCCTGGACTCCCATCCAGTGTCTCCAGAAG
+TGATTGTGGAGCATACATTAAACCAAAATGGCTACACACTGGTTATCACTGGGAAGAAGG
+TAAGCTGTTCCCACAGGGAATTTCCATAGACG
+>MET_Exon_4
+GAAGCTCTTTCCACCCCTTCTCTTCACAGATCACGAAGATCCCATTGAATGGCTTGGGCT
+GCAGACATTTCCAGTCCTGCAGTCAATGCCTCTCTGCCCCACCCTTTGTTCAGTGTGGCT
+GGTGCCACGACAAATGTGTGCGATCGGAGGAATGCCTGAGCGGGACATGGACTCAACAGA
+TCTGTCTGCCTGCAATCTACAAGGTAGGAATCTCTAACAGCTGGCA
+>MET_Exon_5
+TGTCCTTGTAGGTTTTCCCAAATAGTGCACCCCTTGAAGGAGGGACAAGGCTGACCATAT
+GTGGCTGGGACTTTGGATTTCGGAGGAATAATAAATTTGATTTAAAGAAAACTAGAGTTC
+TCCTTGGAAATGAGAGCTGCACCTTGACTTTAAGTGAGAGCACGATGAATACGTAAGGAT
+CTTAAAATGCTTTGCTGGGG
+>MET_Exon_6
+GAAAATTCCTTGGATTTGTCATGTATTAAACTTTGGGTTTTTTTTCCAGATTGAAATGCA
+CAGTTGGTCCTGCCATGAATAAGCATTTCAATATGTCCATAATTATTTCAAATGGCCACG
+GGACAACACAATACAGTACATTCTCCTATGTGGTAAGGAAGATTCTATCCTATCATG
+>MET_Exon_7
+GTTTTGTTTTTATCTCCCCTCCAGGATCCTGTAATAACAAGTATTTCGCCGAAATACGGT
+CCTATGGCTGGTGGCACTTTACTTACTTTAACTGGAAATTACCTAAACAGTGGGAATTCT
+AGACACATTTCAATTGGTGGAAAAACATGTACTTTAAAAAGGTGTTGTAAATTTATTTTT
+TGTTGCATCTGTCAATTTGAA
+>MET_Exon_8
+GGAACCATTGAGTTATATCCTTTTGATTTGTGGATATAATTCTAAAATATGTGTATCTCT
+AATAGCTAAAATTCACTTCCTTAATTTTTTTTGTTCAGTGTGTCAAACAGTATTCTTGAA
+TGTTATACCCCAGCCCAAACCATTTCAACTGAGTTTGCTGTTAAATTGAAAATTGACTTA
+GCCAACCGAGAGACAAGCATCTTCAGTTACCGTGAAGATCCCATTGTCTATGAAATTCAT
+CCAACCAAATCTTTTATTAGGTAAGTAGAAGCTTCTGATGGGTATAAGAAAACAA
+>MET_Exon_9
+TTGGTGGAAAGAACCTCTCAACATTGTCAGTTTTCTATTTTGCTTTGCCAGTGGTGGGAG
+CACAATAACAGGTGTTGGGAAAAACCTGAATTCAGTTAGTGTCCCGAGAATGGTCATAAA
+TGTGCATGAAGCAGGAAGGAACTTTACAGTGGTAAGTCCTTTGAGCAATGGTTCTACTCA
+GAGCTCTGCATCTTTGCCTCTAACCATGTGGCTTTCATGGTACCTG
+>MET_Exon_10
+TGTTGCCAAGCTGTATTCTGTTTACAGTGGATAATTGTGTCTTTCTCTAGGCATGTCAAC
+ATCGCTCTAATTCAGAGATAATCTGTTGTACCACTCCTTCCCTGCAACAGCTGAATCTGC
+AACTCCCCCTGAAAACCAAAGCCTTTTTCATGTTAGATGGGATCCTTTCCAAATACTTTG
+ATCTCATTTATGTACATAATCCTGTGTTTAAGCCTTTTGAAAAGCCAGTGATGATCTCAA
+TGGGCAATGAAAATGTACTGGAAATTAAGGTAAGAAATGCTTTAAACACTGTCTTAAATC
+ATCAGCTCAAA
+>MET_Exon_12
+GGACCCAAAGTGCTACAACCTGTGTAGTACAAATATCTATCATGGCTAAATGCTGACTTT
+TCTTTATTTGTCATTTTTAGTGGAAGCAAGCAATTTCTTCAACCGTCCTTGGAAAAGTAA
+TAGTTCAACCAGATCAGAATTTCACAGGATTGATTGCTGGTGTTGTCTCAATATCAACAG
+CACTGTTATTACTACTTGGGTTTTTCCTGTGGCTGAAAAAGAGAAAGCAAATTAAAGGTG
+CATTTTTGTTACTGTTCATTTTTAGAAGTTACCTTAAGAACACAGTCATTACAGTTTAAG
+ATTGTCGTCGATTCTTG
+>MET_Exon_13
+GCCCATGATAGCCGTCTTTAACAAGCTCTTTCTTTCTCTCTGTTTTAAGATCTGGGCAGT
+GAATTAGTTCGCTACGATGCAAGAGTACACACTCCTCATTTGGATAGGCTTGTAAGTGCC
+CGAAGTGTAAGCCCAACTACAGAAATGGTTTCAAATGAATCTGTAGACTACCGAGCTACT
+TTTCCAGAAGGTATATTTCAGTTTATTGTTCTGAGAAATACCTATACATATACCTCAGTG
+GGTTGTGACATTGTTG
+>MET_Exon_14
+CCTTCATCTTACAGATCAGTTTCCTAATTCATCTCAGAACGGTTCATGCCGACAAGTGCA
+GTATCCTCTGACAGACATGTCCCCCATCCTAACTAGTGGGGACTCTGATATATCCAGTCC
+ATTACTGCAAAATACTGTCCACATTGACCTCAGTGCTCTAAATCCAGAGCTGGTCCAGGC
+AGTGCAGCATGTAGTGATTGGGCCCAGTAGCCTGATTGTGCATTTCAATGAAGTCATAGG
+AAGAGGTAAGTATTTCCACTCAGCTTTTTGTTAAATACGATTTTCCAGTAAGC
+>MET_Exon_15
+ACGCAGTGCTAACCAAGTTCTTTCTTTTGCACAGGGCATTTTGGTTGTGTATATCATGGG
+ACTTTGTTGGACAATGATGGCAAGAAAATTCACTGTGCTGTGAAATCCTTGAACAGTAAG
+TGGCATTTTATTTAACCATGGAGTATACTTTTGTGGTTTGCAACCTAATAAATAGCTTAT
+AATAAAACGTTGATTTACACTTTCCCCTTGTGGA
+>MET_Exon_16
+TGTCTCCACCACTGGATTTCTCAGGAATCACTGACATAGGAGAAGTTTCCCAATTTCTGA
+CCGAGGGAATCATCATGAAAGATTTTAGTCATCCCAATGTCCTCTCGCTCCTGGGAATCT
+GCCTGCGAAGTGAAGGGTCTCCGCTGGTGGTCCTACCATACATGAAACATGGAGATCTTC
+GAAATTTCATTCGAAATGAGACTCATGTAAGTTGACTGCCAAGCTTACTAACTGGCAAAC
+TAGCTGTAAGCC
+>MET_Exon_17
+TGCTTTTCTAACTCTCTTTGACTGCAGAATCCAACTGTAAAAGATCTTATTGGCTTTGGT
+CTTCAAGTAGCCAAAGGCATGAAATATCTTGCAAGCAAAAAGTTTGTCCACAGAGACTTG
+GCTGCAAGAAACTGTATGTAAGTATCAGAATCTCTGTGCCACAATCCAAATTAAGTGACA
+AGGAGGA
+>MET_Exon_18
+TTCTATTTCAGCCACGGGTAATAATTTTTGTCCTTTCTGTAGGCTGGATGAAAAATTCAC
+AGTCAAGGTTGCTGATTTTGGTCTTGCCAGAGACATGTATGATAAAGAATACTATAGTGT
+ACACAACAAAACAGGTGCAAAGCTGCCAGTGAAGTGGATGGCTTTGGAAAGTCTGCAAAC
+TCAAAAGTTTACCACCAAGTCAGATGTGGTAATGTATTGGTTATCTCTGAGTTTCTCCTC
+T
+>MET_Exon_19
+CTCACCTCATCTGTCCTGTTTCTTGTTTTACTAGTGGTCCTTTGGCGTGCTCCTCTGGGA
+GCTGATGACAAGAGGAGCCCCACCTTATCCTGACGTAAACACCTTTGATATAACTGTTTA
+CTTGTTGCAAGGGAGAAGACTCCTACAACCCGAATACTGCCCAGACCCCTTGTAAGTAGT
+CTTTCTGTACCTCTTACGTTCTTTACTTTTACAGAAATGCC
+>MET_Exon_20
+CCTGCCTTCAAAGGGTCTCTTACAGCATGTCTTTCTTTTTGGAACAGATATGAAGTAATG
+CTAAAATGCTGGCACCCTAAAGCCGAAATGCGCCCATCCTTTTCTGAACTGGTGTCCCGG
+ATATCAGCGATCTTCTCTACTTTCATTGGGGAGCACTATGTCCATGTGAACGCTACTTAT
+GTGAACGTAAAATGTGTCGCTCCGTATCCTTCTCTGTTGTCATCAGAAGATAACGCTGAT
+GATGAGGTGGACACACGACCAGCCTCCTTCTGGGAGACATCATAGTGCTAGTACTATGTC
+AAAGCAACAGTCCACAC
diff --git a/tests/data/fluidigm_amplicons/Fluidigm_human_amplicons.fasta.fai b/tests/data/fluidigm_amplicons/Fluidigm_human_amplicons.fasta.fai
new file mode 100644
index 0000000..4a19449
--- /dev/null
+++ b/tests/data/fluidigm_amplicons/Fluidigm_human_amplicons.fasta.fai
@@ -0,0 +1,48 @@
+EGFR_Exon_2 183 13 60 61
+EGFR_Exon_3 203 213 60 61
+EGFR_Exon_4 215 433 60 61
+EGFR_Exon_5 157 665 60 61
+EGFR_Exon_6 185 838 60 61
+EGFR_Exon_7 213 1040 60 61
+EGFR_Exon_8 312 1270 60 61
+EGFR_Exon_9 195 1601 60 61
+EGFR_Exon_10 191 1814 60 61
+EGFR_Exon_11 155 2023 60 61
+EGFR_Exon_12 240 2195 60 61
+EGFR_Exon_13 239 2453 60 61
+EGFR_Exon_14 148 2710 60 61
+EGFR_Exon_15 215 2875 60 61
+EGFR_Exon_16 119 3108 60 61
+EGFR_Exon_17 210 3243 60 61
+EGFR_Exon_18 222 3471 60 61
+EGFR_Exon_19 165 3711 60 61
+EGFR_Exon_20 239 3893 60 61
+EGFR_Exon_21 207 4150 60 61
+EGFR_Exon_22 151 4375 60 61
+EGFR_Exon_23 215 4543 60 61
+EGFR_Exon_24 183 4776 60 61
+EGFR_Exon_25 251 4977 60 61
+EGFR_Exon_26 110 5247 60 61
+EGFR_Exon_27 150 5373 60 61
+EGFR_Exon_28.1 250 5542 60 61
+EGFR_Exon_28.2 250 5813 60 61
+MET_Exon_1.1 310 6082 60 61
+MET_Exon_1.2 304 6412 60 61
+MET_Exon_2 280 6734 60 61
+MET_Exon_3 212 7031 60 61
+MET_Exon_4 226 7259 60 61
+MET_Exon_5 200 7501 60 61
+MET_Exon_6 177 7717 60 61
+MET_Exon_7 201 7909 60 61
+MET_Exon_8 295 8126 60 61
+MET_Exon_9 226 8438 60 61
+MET_Exon_10 311 8681 60 61
+MET_Exon_12 317 9011 60 61
+MET_Exon_13 256 9347 60 61
+MET_Exon_14 293 9621 60 61
+MET_Exon_15 214 9932 60 61
+MET_Exon_16 252 10163 60 61
+MET_Exon_17 187 10433 60 61
+MET_Exon_18 241 10637 60 61
+MET_Exon_19 221 10896 60 61
+MET_Exon_20 317 11134 60 61
diff --git a/tests/data/fluidigm_amplicons/alignment_summary.gff b/tests/data/fluidigm_amplicons/alignment_summary.gff
new file mode 100644
index 0000000..dd09f63
--- /dev/null
+++ b/tests/data/fluidigm_amplicons/alignment_summary.gff
@@ -0,0 +1,10716 @@
+##gff-version 3
+##date 2012-03-17T02:29:16
+##source PACBIO_AlignmentSummary 1.0
+##source-commandline summarizeCoverage.py --reference /opt/smrtanalysis/common/references/fluidigm_amplicons --numRegions=500 /opt/smrtanalysis/common/jobs/016/016447/data/aligned_reads.cmp.h5
+##sequence-header ref000001 EGFR_Exon_2
+##sequence-header ref000002 EGFR_Exon_3
+##sequence-header ref000003 EGFR_Exon_4
+##sequence-header ref000004 EGFR_Exon_5
+##sequence-header ref000005 EGFR_Exon_6
+##sequence-header ref000006 EGFR_Exon_7
+##sequence-header ref000007 EGFR_Exon_8
+##sequence-header ref000008 EGFR_Exon_9
+##sequence-header ref000009 EGFR_Exon_10
+##sequence-header ref000010 EGFR_Exon_11
+##sequence-header ref000011 EGFR_Exon_12
+##sequence-header ref000012 EGFR_Exon_13
+##sequence-header ref000013 EGFR_Exon_14
+##sequence-header ref000014 EGFR_Exon_15
+##sequence-header ref000015 EGFR_Exon_16
+##sequence-header ref000016 EGFR_Exon_17
+##sequence-header ref000017 EGFR_Exon_18
+##sequence-header ref000018 EGFR_Exon_19
+##sequence-header ref000019 EGFR_Exon_20
+##sequence-header ref000020 EGFR_Exon_21
+##sequence-header ref000021 EGFR_Exon_22
+##sequence-header ref000022 EGFR_Exon_23
+##sequence-header ref000023 EGFR_Exon_24
+##sequence-header ref000024 EGFR_Exon_25
+##sequence-header ref000025 EGFR_Exon_26
+##sequence-header ref000026 EGFR_Exon_27
+##sequence-header ref000027 EGFR_Exon_28.1
+##sequence-header ref000028 EGFR_Exon_28.2
+##sequence-header ref000029 MET_Exon_1.1
+##sequence-header ref000030 MET_Exon_1.2
+##sequence-header ref000031 MET_Exon_2
+##sequence-header ref000032 MET_Exon_3
+##sequence-header ref000033 MET_Exon_4
+##sequence-header ref000034 MET_Exon_5
+##sequence-header ref000035 MET_Exon_6
+##sequence-header ref000036 MET_Exon_7
+##sequence-header ref000037 MET_Exon_8
+##sequence-header ref000038 MET_Exon_9
+##sequence-header ref000039 MET_Exon_10
+##sequence-header ref000040 MET_Exon_12
+##sequence-header ref000041 MET_Exon_13
+##sequence-header ref000042 MET_Exon_14
+##sequence-header ref000043 MET_Exon_15
+##sequence-header ref000044 MET_Exon_16
+##sequence-header ref000045 MET_Exon_17
+##sequence-header ref000046 MET_Exon_18
+##sequence-header ref000047 MET_Exon_19
+##sequence-header ref000048 MET_Exon_20
+##sequence-region ref000001 1 183
+##sequence-region ref000002 1 203
+##sequence-region ref000003 1 215
+##sequence-region ref000004 1 157
+##sequence-region ref000005 1 185
+##sequence-region ref000006 1 213
+##sequence-region ref000007 1 312
+##sequence-region ref000008 1 195
+##sequence-region ref000009 1 191
+##sequence-region ref000010 1 155
+##sequence-region ref000011 1 240
+##sequence-region ref000012 1 239
+##sequence-region ref000013 1 148
+##sequence-region ref000014 1 215
+##sequence-region ref000015 1 119
+##sequence-region ref000016 1 210
+##sequence-region ref000017 1 222
+##sequence-region ref000018 1 165
+##sequence-region ref000019 1 239
+##sequence-region ref000020 1 207
+##sequence-region ref000021 1 151
+##sequence-region ref000022 1 215
+##sequence-region ref000023 1 183
+##sequence-region ref000024 1 251
+##sequence-region ref000025 1 110
+##sequence-region ref000026 1 150
+##sequence-region ref000027 1 250
+##sequence-region ref000028 1 250
+##sequence-region ref000029 1 310
+##sequence-region ref000030 1 304
+##sequence-region ref000031 1 280
+##sequence-region ref000032 1 212
+##sequence-region ref000033 1 226
+##sequence-region ref000034 1 200
+##sequence-region ref000035 1 177
+##sequence-region ref000036 1 201
+##sequence-region ref000037 1 295
+##sequence-region ref000038 1 226
+##sequence-region ref000039 1 311
+##sequence-region ref000040 1 317
+##sequence-region ref000041 1 256
+##sequence-region ref000042 1 293
+##sequence-region ref000043 1 214
+##sequence-region ref000044 1 252
+##sequence-region ref000045 1 187
+##sequence-region ref000046 1 241
+##sequence-region ref000047 1 221
+##sequence-region ref000048 1 317
+##source GenomicConsensus 0.1.0
+##pacbio-alignment-summary-version 0.4
+##source-commandline /opt/smrtanalysis/analysis/bin/summarizeConsensus.py --variantsGff /opt/smrtanalysis/common/jobs/016/016447/data/variants.gff --consensusFastq /opt/smrtanalysis/common/jobs/016/016447/data/consensus.fastq.gz /opt/smrtanalysis/common/jobs/016/016447/data/alignment_summary.gff --output /tmp/tmpdUeLh1.gff
+ref000001 . region 1 1 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 2 2 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 3 3 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 4 4 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 5 5 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 6 6 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 7 7 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 8 8 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 9 9 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 10 10 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 11 11 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 12 12 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 13 13 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 14 14 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 15 15 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 16 16 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 17 17 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 18 18 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 19 19 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 20 20 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 21 21 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 22 22 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 23 23 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 24 24 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 25 25 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 26 26 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 27 27 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 28 28 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 29 29 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 30 30 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 31 31 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 32 32 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 33 33 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 34 34 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 35 35 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 36 36 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 37 37 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 38 38 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000001 . region 39 39 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 40 40 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 41 41 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 42 42 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 43 43 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 44 44 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 45 45 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 46 46 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 47 47 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 48 48 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 49 49 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 50 50 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 51 51 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 52 52 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 53 53 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000001 . region 54 54 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 55 55 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 56 56 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 57 57 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 58 58 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 59 59 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 60 60 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 61 61 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 62 62 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 63 63 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 64 64 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 65 65 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 66 66 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 67 67 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 68 68 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 69 69 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000001 . region 70 70 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 71 71 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 72 72 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 73 73 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 74 74 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 75 75 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 76 76 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 77 77 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 78 78 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 79 79 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 80 80 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 81 81 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 82 82 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 83 83 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 84 84 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 85 85 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 86 86 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 87 87 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 88 88 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 89 89 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 90 90 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 91 91 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 92 92 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 93 93 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 94 94 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 95 95 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 96 96 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 97 97 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 98 98 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 99 99 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 100 100 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 101 101 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 102 102 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 103 103 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 104 104 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 105 105 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 106 106 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 107 107 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 108 108 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 109 109 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 110 110 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 111 111 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 112 112 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 113 113 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 114 114 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 115 115 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 116 116 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 117 117 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 118 118 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 119 119 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 120 120 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 121 121 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 122 122 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 123 123 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 124 124 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 125 125 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 126 126 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 127 127 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 128 128 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 129 129 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 130 130 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 131 131 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 132 132 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 133 133 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 134 134 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 135 135 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 136 136 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 137 137 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 138 138 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000001 . region 139 139 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 140 140 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 141 141 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 142 142 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 143 143 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 144 144 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 145 145 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 146 146 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 147 147 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 148 148 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 149 149 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 150 150 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 151 151 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 152 152 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 153 153 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 154 154 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 155 155 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 156 156 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 157 157 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 158 158 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 159 159 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 160 160 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 161 161 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 162 162 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 163 163 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 164 164 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 165 165 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 166 166 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 167 167 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 168 168 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 169 169 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 170 170 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 171 171 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 172 172 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 173 173 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 174 174 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 175 175 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 176 176 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 177 177 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 178 178 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 179 179 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 180 180 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 181 181 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 182 182 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000001 . region 183 183 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000002 . region 1 1 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000002 . region 2 2 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000002 . region 3 3 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000002 . region 4 4 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000002 . region 5 5 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 6 6 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 7 7 0.00 + . cov2=115.000,0.000;gaps=0,0;cov=115,115,115;cQv=93,93,93;
+ref000002 . region 8 8 0.00 + . cov2=116.000,0.000;gaps=0,0;cov=116,116,116;cQv=93,93,93;
+ref000002 . region 9 9 0.00 + . cov2=116.000,0.000;gaps=0,0;cov=116,116,116;cQv=93,93,93;
+ref000002 . region 10 10 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 11 11 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 12 12 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 13 13 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 14 14 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 15 15 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 16 16 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 17 17 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 18 18 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 19 19 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 20 20 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 21 21 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 22 22 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 23 23 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 24 24 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 25 25 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 26 26 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 27 27 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 28 28 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 29 29 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 30 30 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 31 31 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 32 32 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 33 33 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 34 34 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 35 35 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 36 36 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 37 37 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 38 38 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 39 39 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 40 40 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 41 41 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 42 42 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 43 43 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 44 44 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 45 45 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 46 46 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 47 47 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 48 48 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 49 49 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 50 50 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 51 51 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 52 52 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 53 53 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 54 54 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 55 55 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 56 56 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 57 57 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 58 58 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 59 59 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000002 . region 60 60 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 61 61 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 62 62 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 63 63 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 64 64 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 65 65 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 66 66 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 67 67 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 68 68 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 69 69 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 70 70 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 71 71 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 72 72 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 73 73 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 74 74 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 75 75 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 76 76 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 77 77 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 78 78 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 79 79 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 80 80 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 81 81 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 82 82 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 83 83 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 84 84 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 85 85 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 86 86 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 87 87 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 88 88 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 89 89 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 90 90 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 91 91 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 92 92 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 93 93 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 94 94 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 95 95 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 96 96 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 97 97 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 98 98 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 99 99 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 100 100 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 101 101 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 102 102 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 103 103 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 104 104 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 105 105 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 106 106 0.00 + . cov2=119.000,0.000;gaps=0,0;cov=119,119,119;cQv=93,93,93;
+ref000002 . region 107 107 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 108 108 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 109 109 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 110 110 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 111 111 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 112 112 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 113 113 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 114 114 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 115 115 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 116 116 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 117 117 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 118 118 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 119 119 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 120 120 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 121 121 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 122 122 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 123 123 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 124 124 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 125 125 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 126 126 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 127 127 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 128 128 0.00 + . cov2=118.000,0.000;gaps=0,0;cov=118,118,118;cQv=93,93,93;
+ref000002 . region 129 129 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 130 130 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 131 131 0.00 + . cov2=117.000,0.000;gaps=0,0;cov=117,117,117;cQv=93,93,93;
+ref000002 . region 132 132 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 133 133 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 134 134 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 135 135 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 136 136 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 137 137 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 138 138 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 139 139 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 140 140 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 141 141 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 142 142 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 143 143 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 144 144 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 145 145 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 146 146 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 147 147 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 148 148 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 149 149 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000002 . region 150 150 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 151 151 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 152 152 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 153 153 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 154 154 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 155 155 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 156 156 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 157 157 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 158 158 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 159 159 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 160 160 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 161 161 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 162 162 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 163 163 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 164 164 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 165 165 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 166 166 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 167 167 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 168 168 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 169 169 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 170 170 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 171 171 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 172 172 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 173 173 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 174 174 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 175 175 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 176 176 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 177 177 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 178 178 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 179 179 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 180 180 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 181 181 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 182 182 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 183 183 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 184 184 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 185 185 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 186 186 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 187 187 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 188 188 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 189 189 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 190 190 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 191 191 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 192 192 0.00 + . cov2=113.000,0.000;gaps=0,0;cov=113,113,113;cQv=93,93,93;
+ref000002 . region 193 193 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000002 . region 194 194 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000002 . region 195 195 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000002 . region 196 196 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000002 . region 197 197 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000002 . region 198 198 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000002 . region 199 199 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000002 . region 200 200 0.00 + . cov2=110.000,0.000;gaps=0,0;cov=110,110,110;cQv=93,93,93;
+ref000002 . region 201 201 0.00 + . cov2=110.000,0.000;gaps=0,0;cov=110,110,110;cQv=93,93,93;
+ref000002 . region 202 202 0.00 + . cov2=110.000,0.000;gaps=0,0;cov=110,110,110;cQv=93,93,93;
+ref000002 . region 203 203 0.00 + . cov2=109.000,0.000;gaps=0,0;cov=109,109,109;cQv=93,93,93;
+ref000003 . region 1 1 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 2 2 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 3 3 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 4 4 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 5 5 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 6 6 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 7 7 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 8 8 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 9 9 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 10 10 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 11 11 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 12 12 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 13 13 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 14 14 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 15 15 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 16 16 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 17 17 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 18 18 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 19 19 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 20 20 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 21 21 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 22 22 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 23 23 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 24 24 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 25 25 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 26 26 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 27 27 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 28 28 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 29 29 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 30 30 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 31 31 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 32 32 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 33 33 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 34 34 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 35 35 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 36 36 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 37 37 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 38 38 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 39 39 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 40 40 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 41 41 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 42 42 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 43 43 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 44 44 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 45 45 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 46 46 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 47 47 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 48 48 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 49 49 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 50 50 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 51 51 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 52 52 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 53 53 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 54 54 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 55 55 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 56 56 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 57 57 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 58 58 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 59 59 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 60 60 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 61 61 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 62 62 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 63 63 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 64 64 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 65 65 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 66 66 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 67 67 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 68 68 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 69 69 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000003 . region 70 70 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 71 71 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 72 72 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 73 73 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 74 74 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 75 75 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 76 76 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 77 77 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 78 78 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 79 79 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 80 80 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 81 81 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 82 82 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 83 83 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 84 84 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 85 85 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 86 86 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 87 87 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 88 88 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 89 89 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 90 90 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 91 91 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 92 92 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 93 93 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 94 94 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 95 95 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 96 96 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 97 97 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 98 98 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 99 99 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 100 100 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 101 101 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 102 102 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 103 103 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 104 104 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 105 105 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 106 106 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 107 107 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 108 108 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 109 109 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 110 110 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 111 111 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 112 112 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 113 113 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 114 114 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 115 115 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 116 116 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 117 117 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 118 118 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 119 119 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 120 120 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 121 121 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 122 122 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 123 123 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 124 124 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 125 125 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 126 126 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 127 127 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 128 128 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 129 129 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 130 130 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 131 131 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 132 132 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 133 133 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 134 134 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 135 135 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 136 136 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 137 137 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 138 138 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 139 139 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 140 140 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 141 141 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000003 . region 142 142 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 143 143 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 144 144 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 145 145 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 146 146 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 147 147 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 148 148 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 149 149 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 150 150 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 151 151 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 152 152 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 153 153 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 154 154 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 155 155 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 156 156 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 157 157 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 158 158 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 159 159 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 160 160 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 161 161 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 162 162 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 163 163 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 164 164 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 165 165 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 166 166 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 167 167 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 168 168 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 169 169 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 170 170 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 171 171 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 172 172 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 173 173 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 174 174 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 175 175 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 176 176 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 177 177 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 178 178 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 179 179 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 180 180 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 181 181 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 182 182 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 183 183 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 184 184 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 185 185 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 186 186 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000003 . region 187 187 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 188 188 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 189 189 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 190 190 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 191 191 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 192 192 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 193 193 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 194 194 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000003 . region 195 195 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 196 196 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 197 197 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 198 198 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 199 199 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 200 200 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 201 201 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 202 202 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 203 203 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 204 204 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 205 205 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 206 206 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 207 207 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 208 208 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 209 209 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 210 210 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000003 . region 211 211 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000003 . region 212 212 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000003 . region 213 213 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000003 . region 214 214 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000003 . region 215 215 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000004 . region 1 1 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000004 . region 2 2 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000004 . region 3 3 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000004 . region 4 4 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000004 . region 5 5 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000004 . region 6 6 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000004 . region 7 7 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000004 . region 8 8 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000004 . region 9 9 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000004 . region 10 10 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000004 . region 11 11 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 12 12 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 13 13 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 14 14 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 15 15 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 16 16 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 17 17 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 18 18 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 19 19 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 20 20 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 21 21 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 22 22 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 23 23 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 24 24 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 25 25 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 26 26 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 27 27 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 28 28 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 29 29 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 30 30 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 31 31 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 32 32 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 33 33 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 34 34 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 35 35 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 36 36 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 37 37 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 38 38 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 39 39 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 40 40 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 41 41 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 42 42 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 43 43 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 44 44 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 45 45 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 46 46 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 47 47 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 48 48 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 49 49 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 50 50 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 51 51 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 52 52 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 53 53 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 54 54 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 55 55 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 56 56 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 57 57 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 58 58 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 59 59 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 60 60 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 61 61 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 62 62 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 63 63 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 64 64 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 65 65 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 66 66 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 67 67 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 68 68 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 69 69 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 70 70 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 71 71 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 72 72 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 73 73 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 74 74 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 75 75 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 76 76 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 77 77 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 78 78 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 79 79 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 80 80 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 81 81 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 82 82 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 83 83 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 84 84 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 85 85 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 86 86 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 87 87 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 88 88 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 89 89 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000004 . region 90 90 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 91 91 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 92 92 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 93 93 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 94 94 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 95 95 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 96 96 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 97 97 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 98 98 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 99 99 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 100 100 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 101 101 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 102 102 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 103 103 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 104 104 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 105 105 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 106 106 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 107 107 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 108 108 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 109 109 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 110 110 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 111 111 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 112 112 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 113 113 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 114 114 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 115 115 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 116 116 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 117 117 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 118 118 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 119 119 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 120 120 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 121 121 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 122 122 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 123 123 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 124 124 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 125 125 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 126 126 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 127 127 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 128 128 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 129 129 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 130 130 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 131 131 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 132 132 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 133 133 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 134 134 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 135 135 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 136 136 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 137 137 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 138 138 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 139 139 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 140 140 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 141 141 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 142 142 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 143 143 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 144 144 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 145 145 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 146 146 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 147 147 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 148 148 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 149 149 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 150 150 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 151 151 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 152 152 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 153 153 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 154 154 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 155 155 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 156 156 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000004 . region 157 157 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000005 . region 1 1 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000005 . region 2 2 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000005 . region 3 3 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000005 . region 4 4 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000005 . region 5 5 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000005 . region 6 6 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000005 . region 7 7 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000005 . region 8 8 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000005 . region 9 9 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000005 . region 10 10 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000005 . region 11 11 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000005 . region 12 12 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 13 13 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 14 14 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 15 15 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 16 16 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 17 17 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 18 18 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 19 19 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 20 20 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 21 21 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 22 22 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 23 23 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 24 24 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 25 25 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 26 26 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 27 27 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 28 28 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 29 29 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 30 30 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 31 31 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 32 32 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000005 . region 33 33 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 34 34 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 35 35 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 36 36 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 37 37 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 38 38 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 39 39 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 40 40 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 41 41 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 42 42 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 43 43 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 44 44 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 45 45 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 46 46 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 47 47 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 48 48 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 49 49 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 50 50 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 51 51 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 52 52 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 53 53 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 54 54 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 55 55 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 56 56 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 57 57 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 58 58 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 59 59 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 60 60 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 61 61 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 62 62 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 63 63 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 64 64 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 65 65 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 66 66 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 67 67 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 68 68 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 69 69 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 70 70 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 71 71 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 72 72 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 73 73 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 74 74 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 75 75 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 76 76 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 77 77 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 78 78 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 79 79 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 80 80 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 81 81 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 82 82 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 83 83 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 84 84 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 85 85 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 86 86 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 87 87 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 88 88 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 89 89 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 90 90 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 91 91 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 92 92 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 93 93 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 94 94 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 95 95 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 96 96 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 97 97 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 98 98 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 99 99 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 100 100 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 101 101 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 102 102 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 103 103 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 104 104 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 105 105 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 106 106 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 107 107 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 108 108 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 109 109 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 110 110 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 111 111 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 112 112 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 113 113 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 114 114 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 115 115 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 116 116 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 117 117 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 118 118 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 119 119 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 120 120 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 121 121 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 122 122 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 123 123 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 124 124 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 125 125 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 126 126 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 127 127 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 128 128 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 129 129 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 130 130 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 131 131 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 132 132 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 133 133 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 134 134 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 135 135 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 136 136 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 137 137 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 138 138 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 139 139 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 140 140 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 141 141 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 142 142 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 143 143 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 144 144 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 145 145 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 146 146 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 147 147 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 148 148 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 149 149 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 150 150 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 151 151 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 152 152 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 153 153 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 154 154 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 155 155 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 156 156 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 157 157 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 158 158 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 159 159 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 160 160 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 161 161 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 162 162 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 163 163 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 164 164 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 165 165 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 166 166 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 167 167 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 168 168 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 169 169 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 170 170 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 171 171 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 172 172 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 173 173 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 174 174 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 175 175 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000005 . region 176 176 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000005 . region 177 177 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000005 . region 178 178 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000005 . region 179 179 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000005 . region 180 180 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000005 . region 181 181 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000005 . region 182 182 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000005 . region 183 183 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000005 . region 184 184 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000005 . region 185 185 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000006 . region 1 1 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000006 . region 2 2 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000006 . region 3 3 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000006 . region 4 4 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 5 5 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 6 6 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 7 7 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 8 8 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 9 9 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 10 10 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 11 11 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 12 12 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 13 13 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 14 14 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 15 15 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 16 16 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 17 17 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 18 18 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 19 19 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 20 20 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 21 21 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 22 22 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 23 23 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 24 24 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 25 25 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 26 26 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 27 27 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 28 28 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 29 29 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 30 30 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 31 31 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 32 32 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 33 33 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 34 34 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 35 35 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 36 36 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 37 37 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 38 38 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 39 39 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 40 40 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 41 41 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 42 42 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 43 43 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 44 44 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 45 45 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 46 46 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 47 47 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 48 48 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 49 49 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 50 50 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 51 51 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 52 52 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 53 53 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 54 54 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 55 55 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 56 56 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 57 57 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 58 58 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 59 59 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 60 60 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 61 61 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 62 62 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 63 63 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 64 64 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 65 65 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 66 66 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 67 67 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 68 68 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 69 69 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 70 70 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 71 71 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 72 72 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 73 73 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 74 74 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 75 75 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 76 76 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 77 77 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 78 78 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 79 79 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 80 80 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 81 81 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000006 . region 82 82 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 83 83 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 84 84 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 85 85 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 86 86 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 87 87 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 88 88 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 89 89 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 90 90 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 91 91 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 92 92 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 93 93 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 94 94 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 95 95 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 96 96 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 97 97 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 98 98 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 99 99 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 100 100 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 101 101 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 102 102 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 103 103 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 104 104 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 105 105 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 106 106 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 107 107 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 108 108 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 109 109 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 110 110 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 111 111 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 112 112 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 113 113 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 114 114 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 115 115 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 116 116 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 117 117 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 118 118 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 119 119 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 120 120 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 121 121 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 122 122 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 123 123 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 124 124 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 125 125 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 126 126 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 127 127 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 128 128 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 129 129 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 130 130 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 131 131 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 132 132 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 133 133 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 134 134 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 135 135 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 136 136 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 137 137 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 138 138 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 139 139 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 140 140 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 141 141 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 142 142 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 143 143 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 144 144 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 145 145 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 146 146 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 147 147 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 148 148 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 149 149 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 150 150 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 151 151 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 152 152 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 153 153 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 154 154 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 155 155 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 156 156 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 157 157 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 158 158 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 159 159 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 160 160 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 161 161 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 162 162 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 163 163 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 164 164 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 165 165 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 166 166 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 167 167 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 168 168 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 169 169 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 170 170 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 171 171 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 172 172 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 173 173 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 174 174 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 175 175 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 176 176 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 177 177 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 178 178 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 179 179 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 180 180 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 181 181 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 182 182 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 183 183 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 184 184 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 185 185 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 186 186 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 187 187 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 188 188 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 189 189 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 190 190 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 191 191 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 192 192 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 193 193 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 194 194 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 195 195 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 196 196 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 197 197 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 198 198 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 199 199 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 200 200 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 201 201 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 202 202 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 203 203 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 204 204 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 205 205 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000006 . region 206 206 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 207 207 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 208 208 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 209 209 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000006 . region 210 210 0.00 + . cov2=65.000,0.000;gaps=0,0;cov=65,65,65;cQv=93,93,93;
+ref000006 . region 211 211 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000006 . region 212 212 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000006 . region 213 213 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000007 . region 1 1 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000007 . region 2 2 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000007 . region 3 3 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000007 . region 4 4 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000007 . region 5 5 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000007 . region 6 6 0.00 + . cov2=33.000,0.000;gaps=0,0;cov=33,33,33;cQv=93,93,93;
+ref000007 . region 7 7 0.00 + . cov2=33.000,0.000;gaps=0,0;cov=33,33,33;cQv=93,93,93;
+ref000007 . region 8 8 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 9 9 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 10 10 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 11 11 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 12 12 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 13 13 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 14 14 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 15 15 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 16 16 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 17 17 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 18 18 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 19 19 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 20 20 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 21 21 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 22 22 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 23 23 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 24 24 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 25 25 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 26 26 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 27 27 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 28 28 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 29 29 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 30 30 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 31 31 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 32 32 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 33 33 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 34 34 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 35 35 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 36 36 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 37 37 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 38 38 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 39 39 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 40 40 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 41 41 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 42 42 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 43 43 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 44 44 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 45 45 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 46 46 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 47 47 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 48 48 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 49 49 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 50 50 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 51 51 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 52 52 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 53 53 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 54 54 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 55 55 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 56 56 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 57 57 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 58 58 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 59 59 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 60 60 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 61 61 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 62 62 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 63 63 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 64 64 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 65 65 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000007 . region 66 66 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000007 . region 67 67 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000007 . region 68 68 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 69 69 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 70 70 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 71 71 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 72 72 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 73 73 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 74 74 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 75 75 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 76 76 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 77 77 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 78 78 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 79 79 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 80 80 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 81 81 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 82 82 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 83 83 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 84 84 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 85 85 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 86 86 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 87 87 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 88 88 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 89 89 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 90 90 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 91 91 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 92 92 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 93 93 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 94 94 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 95 95 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 96 96 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 97 97 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 98 98 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 99 99 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 100 100 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 101 101 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 102 102 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 103 103 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 104 104 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 105 105 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 106 106 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 107 107 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 108 108 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 109 109 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 110 110 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 111 111 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 112 112 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 113 113 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 114 114 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 115 115 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 116 116 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 117 117 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 118 118 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 119 119 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 120 120 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 121 121 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 122 122 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 123 123 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 124 124 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 125 125 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 126 126 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 127 127 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 128 128 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 129 129 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 130 130 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 131 131 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 132 132 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 133 133 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 134 134 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 135 135 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 136 136 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 137 137 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 138 138 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 139 139 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 140 140 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 141 141 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 142 142 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 143 143 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 144 144 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 145 145 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 146 146 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 147 147 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 148 148 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 149 149 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 150 150 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 151 151 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 152 152 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 153 153 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 154 154 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 155 155 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 156 156 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 157 157 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 158 158 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 159 159 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 160 160 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 161 161 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 162 162 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 163 163 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 164 164 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 165 165 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 166 166 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 167 167 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 168 168 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 169 169 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 170 170 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 171 171 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 172 172 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 173 173 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 174 174 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 175 175 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 176 176 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 177 177 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 178 178 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 179 179 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 180 180 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 181 181 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 182 182 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 183 183 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 184 184 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 185 185 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 186 186 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 187 187 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 188 188 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 189 189 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 190 190 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 191 191 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 192 192 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000007 . region 193 193 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000007 . region 194 194 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000007 . region 195 195 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000007 . region 196 196 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000007 . region 197 197 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000007 . region 198 198 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000007 . region 199 199 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000007 . region 200 200 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 201 201 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 202 202 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 203 203 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 204 204 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 205 205 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 206 206 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 207 207 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 208 208 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 209 209 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 210 210 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 211 211 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 212 212 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 213 213 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 214 214 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 215 215 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 216 216 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 217 217 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 218 218 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 219 219 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 220 220 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 221 221 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 222 222 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 223 223 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 224 224 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 225 225 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 226 226 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 227 227 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 228 228 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 229 229 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 230 230 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 231 231 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 232 232 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 233 233 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 234 234 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 235 235 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 236 236 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 237 237 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 238 238 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 239 239 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=68,68,68;
+ref000007 . region 240 240 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 241 241 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 242 242 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 243 243 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 244 244 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 245 245 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 246 246 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 247 247 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 248 248 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 249 249 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 250 250 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 251 251 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 252 252 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 253 253 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 254 254 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 255 255 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 256 256 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 257 257 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 258 258 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 259 259 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 260 260 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 261 261 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 262 262 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 263 263 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 264 264 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 265 265 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 266 266 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 267 267 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 268 268 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 269 269 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 270 270 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 271 271 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 272 272 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 273 273 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 274 274 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 275 275 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 276 276 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 277 277 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 278 278 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 279 279 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 280 280 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 281 281 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 282 282 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 283 283 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 284 284 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 285 285 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 286 286 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 287 287 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 288 288 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 289 289 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 290 290 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 291 291 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 292 292 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 293 293 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 294 294 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 295 295 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 296 296 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 297 297 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 298 298 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 299 299 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 300 300 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000007 . region 301 301 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 302 302 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 303 303 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 304 304 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 305 305 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 306 306 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 307 307 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 308 308 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 309 309 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 310 310 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 311 311 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000007 . region 312 312 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000008 . region 1 1 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000008 . region 2 2 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000008 . region 3 3 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000008 . region 4 4 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000008 . region 5 5 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 6 6 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 7 7 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 8 8 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 9 9 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 10 10 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 11 11 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 12 12 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 13 13 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 14 14 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 15 15 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 16 16 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 17 17 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 18 18 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 19 19 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 20 20 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 21 21 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 22 22 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 23 23 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 24 24 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 25 25 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 26 26 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 27 27 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 28 28 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 29 29 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 30 30 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 31 31 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 32 32 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 33 33 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 34 34 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 35 35 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 36 36 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 37 37 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 38 38 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 39 39 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 40 40 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 41 41 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 42 42 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 43 43 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 44 44 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 45 45 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 46 46 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 47 47 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 48 48 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 49 49 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 50 50 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 51 51 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 52 52 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 53 53 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 54 54 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 55 55 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 56 56 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 57 57 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 58 58 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 59 59 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 60 60 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 61 61 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 62 62 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 63 63 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 64 64 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 65 65 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 66 66 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 67 67 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 68 68 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 69 69 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 70 70 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 71 71 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 72 72 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 73 73 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 74 74 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 75 75 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 76 76 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 77 77 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 78 78 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 79 79 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 80 80 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 81 81 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 82 82 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000008 . region 83 83 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000008 . region 84 84 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000008 . region 85 85 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000008 . region 86 86 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000008 . region 87 87 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000008 . region 88 88 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000008 . region 89 89 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000008 . region 90 90 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000008 . region 91 91 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 92 92 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 93 93 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 94 94 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 95 95 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 96 96 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 97 97 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 98 98 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 99 99 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 100 100 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 101 101 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 102 102 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 103 103 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 104 104 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 105 105 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 106 106 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 107 107 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 108 108 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 109 109 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 110 110 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 111 111 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 112 112 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 113 113 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 114 114 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 115 115 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 116 116 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 117 117 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 118 118 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 119 119 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 120 120 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 121 121 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 122 122 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 123 123 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 124 124 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 125 125 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 126 126 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 127 127 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 128 128 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 129 129 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 130 130 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 131 131 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 132 132 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 133 133 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 134 134 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 135 135 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 136 136 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 137 137 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 138 138 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 139 139 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000008 . region 140 140 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000008 . region 141 141 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000008 . region 142 142 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000008 . region 143 143 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000008 . region 144 144 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 145 145 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 146 146 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 147 147 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 148 148 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 149 149 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 150 150 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 151 151 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 152 152 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 153 153 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 154 154 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 155 155 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 156 156 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 157 157 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 158 158 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 159 159 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 160 160 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 161 161 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 162 162 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 163 163 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 164 164 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 165 165 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 166 166 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 167 167 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 168 168 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 169 169 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 170 170 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 171 171 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 172 172 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 173 173 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 174 174 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 175 175 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 176 176 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 177 177 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 178 178 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 179 179 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 180 180 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 181 181 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 182 182 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 183 183 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 184 184 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 185 185 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 186 186 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 187 187 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 188 188 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 189 189 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 190 190 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 191 191 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 192 192 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 193 193 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000008 . region 194 194 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000008 . region 195 195 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000009 . region 1 1 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 2 2 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 3 3 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 4 4 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 5 5 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=68,68,68;
+ref000009 . region 6 6 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 7 7 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 8 8 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 9 9 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 10 10 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 11 11 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 12 12 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 13 13 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 14 14 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=75,75,75;
+ref000009 . region 15 15 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 16 16 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 17 17 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 18 18 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 19 19 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=75,75,75;
+ref000009 . region 20 20 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 21 21 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 22 22 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 23 23 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 24 24 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 25 25 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 26 26 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=75,75,75;
+ref000009 . region 27 27 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 28 28 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 29 29 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 30 30 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 31 31 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 32 32 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 33 33 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 34 34 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 35 35 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 36 36 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 37 37 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 38 38 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 39 39 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 40 40 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 41 41 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 42 42 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 43 43 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 44 44 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 45 45 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 46 46 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 47 47 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 48 48 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 49 49 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 50 50 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 51 51 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 52 52 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 53 53 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 54 54 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 55 55 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 56 56 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 57 57 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 58 58 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=75,75,75;
+ref000009 . region 59 59 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 60 60 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 61 61 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 62 62 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 63 63 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 64 64 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 65 65 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 66 66 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 67 67 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 68 68 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 69 69 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 70 70 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 71 71 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 72 72 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 73 73 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 74 74 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 75 75 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 76 76 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 77 77 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 78 78 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 79 79 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 80 80 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 81 81 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 82 82 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 83 83 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 84 84 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 85 85 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=60,60,60;
+ref000009 . region 86 86 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 87 87 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 88 88 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 89 89 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 90 90 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 91 91 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 92 92 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 93 93 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 94 94 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=75,75,75;
+ref000009 . region 95 95 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 96 96 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=75,75,75;
+ref000009 . region 97 97 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=75,75,75;
+ref000009 . region 98 98 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 99 99 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 100 100 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 101 101 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 102 102 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 103 103 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 104 104 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 105 105 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 106 106 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 107 107 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=75,75,75;
+ref000009 . region 108 108 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 109 109 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 110 110 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 111 111 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 112 112 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 113 113 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 114 114 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 115 115 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 116 116 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=75,75,75;
+ref000009 . region 117 117 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 118 118 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 119 119 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 120 120 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 121 121 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 122 122 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 123 123 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 124 124 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 125 125 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 126 126 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 127 127 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 128 128 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 129 129 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 130 130 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 131 131 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 132 132 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 133 133 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 134 134 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 135 135 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 136 136 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 137 137 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=75,75,75;
+ref000009 . region 138 138 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 139 139 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 140 140 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 141 141 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 142 142 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 143 143 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 144 144 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 145 145 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 146 146 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 147 147 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 148 148 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 149 149 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=79,79,79;
+ref000009 . region 150 150 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=79,79,79;
+ref000009 . region 151 151 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 152 152 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 153 153 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 154 154 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 155 155 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 156 156 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 157 157 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 158 158 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 159 159 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000009 . region 160 160 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000009 . region 161 161 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=82,82,82;
+ref000009 . region 162 162 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=82,82,82;
+ref000009 . region 163 163 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 164 164 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=82,82,82;
+ref000009 . region 165 165 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 166 166 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=72,72,72;
+ref000009 . region 167 167 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=82,82,82;
+ref000009 . region 168 168 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=82,82,82;
+ref000009 . region 169 169 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=82,82,82;
+ref000009 . region 170 170 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=82,82,82;
+ref000009 . region 171 171 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 172 172 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 173 173 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000009 . region 174 174 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=68,68,68;
+ref000009 . region 175 175 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000009 . region 176 176 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000009 . region 177 177 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000009 . region 178 178 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000009 . region 179 179 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000009 . region 180 180 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000009 . region 181 181 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000009 . region 182 182 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000009 . region 183 183 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000009 . region 184 184 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=45,45,45;
+ref000009 . region 185 185 0.00 + . cov2=10.000,0.000;gaps=0,0;cov=10,10,10;cQv=75,75,75;
+ref000009 . region 186 186 0.00 + . cov2=10.000,0.000;gaps=0,0;cov=10,10,10;cQv=75,75,75;
+ref000009 . region 187 187 0.00 + . cov2=10.000,0.000;gaps=0,0;cov=10,10,10;cQv=75,75,75;
+ref000009 . region 188 188 0.00 + . cov2=10.000,0.000;gaps=0,0;cov=10,10,10;cQv=75,75,75;
+ref000009 . region 189 189 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=53,53,53;
+ref000009 . region 190 190 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=53,53,53;
+ref000009 . region 191 191 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000010 . region 1 1 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000010 . region 2 2 0.00 + . cov2=98.000,0.000;gaps=0,0;cov=98,98,98;cQv=93,93,93;
+ref000010 . region 3 3 0.00 + . cov2=109.000,0.000;gaps=0,0;cov=109,109,109;cQv=93,93,93;
+ref000010 . region 4 4 0.00 + . cov2=110.000,0.000;gaps=0,0;cov=110,110,110;cQv=93,93,93;
+ref000010 . region 5 5 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 6 6 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 7 7 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 8 8 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 9 9 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 10 10 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 11 11 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 12 12 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 13 13 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 14 14 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 15 15 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 16 16 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 17 17 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 18 18 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 19 19 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 20 20 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 21 21 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 22 22 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 23 23 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 24 24 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 25 25 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 26 26 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 27 27 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 28 28 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 29 29 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 30 30 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 31 31 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 32 32 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 33 33 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 34 34 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 35 35 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 36 36 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 37 37 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 38 38 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 39 39 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 40 40 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 41 41 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 42 42 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 43 43 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 44 44 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 45 45 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 46 46 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 47 47 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 48 48 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 49 49 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 50 50 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 51 51 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 52 52 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 53 53 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 54 54 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 55 55 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 56 56 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 57 57 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 58 58 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 59 59 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 60 60 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 61 61 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 62 62 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000010 . region 63 63 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 64 64 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 65 65 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 66 66 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 67 67 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 68 68 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 69 69 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 70 70 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 71 71 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 72 72 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 73 73 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 74 74 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 75 75 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 76 76 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 77 77 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 78 78 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 79 79 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 80 80 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 81 81 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 82 82 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 83 83 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 84 84 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 85 85 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 86 86 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 87 87 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 88 88 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 89 89 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 90 90 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 91 91 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 92 92 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 93 93 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 94 94 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 95 95 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 96 96 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 97 97 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 98 98 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 99 99 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 100 100 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 101 101 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 102 102 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 103 103 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 104 104 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 105 105 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 106 106 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 107 107 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 108 108 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 109 109 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 110 110 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 111 111 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 112 112 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 113 113 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 114 114 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 115 115 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 116 116 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 117 117 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 118 118 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 119 119 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 120 120 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 121 121 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 122 122 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 123 123 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 124 124 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 125 125 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 126 126 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 127 127 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 128 128 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 129 129 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 130 130 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 131 131 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 132 132 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 133 133 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 134 134 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 135 135 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 136 136 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 137 137 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 138 138 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 139 139 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 140 140 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 141 141 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 142 142 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 143 143 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 144 144 0.00 + . cov2=111.000,0.000;gaps=0,0;cov=111,111,111;cQv=93,93,93;
+ref000010 . region 145 145 0.00 + . cov2=110.000,0.000;gaps=0,0;cov=110,110,110;cQv=93,93,93;
+ref000010 . region 146 146 0.00 + . cov2=110.000,0.000;gaps=0,0;cov=110,110,110;cQv=93,93,93;
+ref000010 . region 147 147 0.00 + . cov2=109.000,0.000;gaps=0,0;cov=109,109,109;cQv=93,93,93;
+ref000010 . region 148 148 0.00 + . cov2=109.000,0.000;gaps=0,0;cov=109,109,109;cQv=93,93,93;
+ref000010 . region 149 149 0.00 + . cov2=109.000,0.000;gaps=0,0;cov=109,109,109;cQv=93,93,93;
+ref000010 . region 150 150 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000010 . region 151 151 0.00 + . cov2=104.000,0.000;gaps=0,0;cov=104,104,104;cQv=93,93,93;
+ref000010 . region 152 152 0.00 + . cov2=104.000,0.000;gaps=0,0;cov=104,104,104;cQv=93,93,93;
+ref000010 . region 153 153 0.00 + . cov2=88.000,0.000;gaps=0,0;cov=88,88,88;cQv=93,93,93;
+ref000010 . region 154 154 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000010 . region 155 155 0.00 + . cov2=86.000,0.000;gaps=0,0;cov=86,86,86;cQv=93,93,93;
+ref000011 . region 1 1 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 2 2 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 3 3 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 4 4 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 5 5 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 6 6 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 7 7 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 8 8 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 9 9 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 10 10 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 11 11 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 12 12 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 13 13 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 14 14 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 15 15 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 16 16 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 17 17 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 18 18 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 19 19 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 20 20 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 21 21 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 22 22 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 23 23 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 24 24 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 25 25 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 26 26 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 27 27 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 28 28 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 29 29 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 30 30 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 31 31 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 32 32 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 33 33 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 34 34 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 35 35 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 36 36 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 37 37 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 38 38 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 39 39 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 40 40 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 41 41 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 42 42 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 43 43 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 44 44 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 45 45 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 46 46 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 47 47 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 48 48 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 49 49 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 50 50 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 51 51 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 52 52 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000011 . region 53 53 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 54 54 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 55 55 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 56 56 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 57 57 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 58 58 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 59 59 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 60 60 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 61 61 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 62 62 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 63 63 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 64 64 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 65 65 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 66 66 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 67 67 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 68 68 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 69 69 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 70 70 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 71 71 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 72 72 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 73 73 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 74 74 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 75 75 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=90,90,90;
+ref000011 . region 76 76 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=45,45,45;
+ref000011 . region 77 77 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=90,90,90;
+ref000011 . region 78 78 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 79 79 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 80 80 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 81 81 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 82 82 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 83 83 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 84 84 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 85 85 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 86 86 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 87 87 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=60,60,60;
+ref000011 . region 88 88 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 89 89 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 90 90 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 91 91 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 92 92 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 93 93 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 94 94 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 95 95 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 96 96 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 97 97 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 98 98 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 99 99 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 100 100 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 101 101 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 102 102 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 103 103 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 104 104 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 105 105 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 106 106 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 107 107 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=83,83,83;
+ref000011 . region 108 108 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 109 109 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 110 110 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 111 111 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 112 112 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 113 113 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 114 114 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 115 115 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 116 116 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 117 117 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 118 118 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 119 119 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 120 120 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 121 121 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 122 122 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 123 123 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 124 124 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 125 125 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 126 126 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 127 127 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 128 128 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 129 129 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 130 130 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=83,83,83;
+ref000011 . region 131 131 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=83,83,83;
+ref000011 . region 132 132 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 133 133 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 134 134 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 135 135 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 136 136 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 137 137 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 138 138 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 139 139 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 140 140 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 141 141 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 142 142 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 143 143 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 144 144 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 145 145 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 146 146 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 147 147 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 148 148 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 149 149 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 150 150 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 151 151 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 152 152 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 153 153 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 154 154 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 155 155 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 156 156 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 157 157 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=90,90,90;
+ref000011 . region 158 158 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 159 159 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 160 160 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 161 161 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=90,90,90;
+ref000011 . region 162 162 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 163 163 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 164 164 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=53,53,53;
+ref000011 . region 165 165 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 166 166 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 167 167 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 168 168 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 169 169 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 170 170 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 171 171 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 172 172 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 173 173 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=45,45,45;
+ref000011 . region 174 174 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 175 175 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 176 176 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 177 177 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 178 178 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 179 179 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=75,75,75;
+ref000011 . region 180 180 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=90,90,90;
+ref000011 . region 181 181 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 182 182 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 183 183 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=60,60,60;
+ref000011 . region 184 184 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 185 185 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=90,90,90;
+ref000011 . region 186 186 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 187 187 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 188 188 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 189 189 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 190 190 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=90,90,90;
+ref000011 . region 191 191 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=75,75,75;
+ref000011 . region 192 192 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 193 193 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 194 194 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 195 195 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 196 196 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 197 197 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=90,90,90;
+ref000011 . region 198 198 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 199 199 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 200 200 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 201 201 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 202 202 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 203 203 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 204 204 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 205 205 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 206 206 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 207 207 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000011 . region 208 208 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 209 209 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 210 210 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 211 211 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 212 212 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 213 213 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 214 214 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 215 215 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 216 216 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 217 217 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 218 218 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 219 219 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 220 220 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 221 221 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 222 222 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 223 223 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 224 224 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 225 225 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 226 226 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 227 227 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 228 228 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 229 229 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 230 230 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 231 231 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 232 232 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 233 233 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 234 234 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 235 235 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 236 236 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 237 237 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 238 238 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000011 . region 239 239 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000011 . region 240 240 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000012 . region 1 1 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000012 . region 2 2 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000012 . region 3 3 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000012 . region 4 4 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000012 . region 5 5 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000012 . region 6 6 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000012 . region 7 7 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000012 . region 8 8 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000012 . region 9 9 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000012 . region 10 10 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000012 . region 11 11 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000012 . region 12 12 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000012 . region 13 13 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000012 . region 14 14 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000012 . region 15 15 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000012 . region 16 16 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000012 . region 17 17 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000012 . region 18 18 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000012 . region 19 19 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000012 . region 20 20 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000012 . region 21 21 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000012 . region 22 22 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000012 . region 23 23 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000012 . region 24 24 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 25 25 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 26 26 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 27 27 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 28 28 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 29 29 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 30 30 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 31 31 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 32 32 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 33 33 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 34 34 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 35 35 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 36 36 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 37 37 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 38 38 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 39 39 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 40 40 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 41 41 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 42 42 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 43 43 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 44 44 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 45 45 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 46 46 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 47 47 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 48 48 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 49 49 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 50 50 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 51 51 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 52 52 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 53 53 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 54 54 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 55 55 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 56 56 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 57 57 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 58 58 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 59 59 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 60 60 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 61 61 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 62 62 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 63 63 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 64 64 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 65 65 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 66 66 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 67 67 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 68 68 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 69 69 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 70 70 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 71 71 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 72 72 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 73 73 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 74 74 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 75 75 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 76 76 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 77 77 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 78 78 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 79 79 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 80 80 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 81 81 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 82 82 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 83 83 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 84 84 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000012 . region 85 85 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 86 86 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 87 87 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 88 88 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 89 89 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 90 90 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 91 91 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 92 92 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 93 93 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 94 94 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 95 95 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 96 96 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 97 97 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 98 98 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 99 99 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 100 100 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 101 101 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 102 102 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 103 103 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 104 104 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 105 105 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 106 106 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 107 107 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 108 108 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 109 109 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 110 110 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 111 111 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 112 112 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 113 113 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 114 114 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 115 115 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 116 116 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 117 117 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 118 118 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 119 119 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 120 120 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 121 121 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 122 122 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 123 123 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 124 124 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 125 125 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 126 126 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 127 127 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 128 128 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 129 129 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 130 130 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 131 131 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 132 132 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 133 133 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 134 134 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 135 135 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 136 136 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 137 137 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 138 138 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 139 139 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 140 140 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 141 141 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 142 142 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 143 143 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 144 144 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 145 145 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 146 146 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 147 147 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 148 148 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 149 149 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 150 150 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 151 151 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 152 152 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 153 153 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 154 154 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 155 155 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 156 156 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 157 157 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 158 158 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 159 159 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 160 160 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 161 161 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 162 162 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 163 163 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 164 164 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 165 165 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 166 166 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 167 167 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 168 168 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 169 169 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 170 170 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 171 171 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 172 172 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 173 173 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 174 174 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 175 175 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 176 176 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 177 177 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 178 178 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 179 179 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 180 180 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 181 181 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 182 182 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 183 183 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 184 184 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 185 185 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 186 186 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 187 187 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 188 188 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 189 189 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 190 190 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 191 191 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 192 192 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 193 193 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 194 194 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 195 195 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 196 196 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 197 197 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 198 198 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 199 199 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 200 200 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 201 201 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 202 202 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 203 203 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 204 204 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 205 205 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 206 206 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 207 207 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 208 208 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 209 209 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 210 210 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 211 211 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 212 212 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 213 213 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 214 214 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 215 215 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 216 216 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 217 217 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 218 218 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 219 219 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 220 220 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 221 221 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 222 222 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 223 223 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 224 224 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 225 225 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 226 226 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 227 227 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 228 228 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 229 229 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 230 230 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 231 231 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 232 232 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 233 233 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 234 234 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000012 . region 235 235 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000012 . region 236 236 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000012 . region 237 237 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000012 . region 238 238 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000012 . region 239 239 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000013 . region 1 1 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000013 . region 2 2 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 3 3 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 4 4 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 5 5 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 6 6 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 7 7 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 8 8 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 9 9 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 10 10 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 11 11 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 12 12 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 13 13 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 14 14 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 15 15 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 16 16 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 17 17 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 18 18 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 19 19 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 20 20 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 21 21 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 22 22 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 23 23 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 24 24 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 25 25 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 26 26 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 27 27 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 28 28 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 29 29 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 30 30 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 31 31 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 32 32 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 33 33 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 34 34 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 35 35 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 36 36 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 37 37 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 38 38 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 39 39 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 40 40 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 41 41 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 42 42 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 43 43 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 44 44 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 45 45 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 46 46 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 47 47 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 48 48 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 49 49 0.00 + . cov2=98.000,0.000;gaps=0,0;cov=98,98,98;cQv=93,93,93;
+ref000013 . region 50 50 0.00 + . cov2=98.000,0.000;gaps=0,0;cov=98,98,98;cQv=93,93,93;
+ref000013 . region 51 51 0.00 + . cov2=98.000,0.000;gaps=0,0;cov=98,98,98;cQv=93,93,93;
+ref000013 . region 52 52 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 53 53 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 54 54 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 55 55 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 56 56 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 57 57 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 58 58 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 59 59 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 60 60 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 61 61 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 62 62 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 63 63 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 64 64 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 65 65 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 66 66 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 67 67 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 68 68 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 69 69 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 70 70 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000013 . region 71 71 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000013 . region 72 72 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000013 . region 73 73 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000013 . region 74 74 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 75 75 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 76 76 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 77 77 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 78 78 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 79 79 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 80 80 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 81 81 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 82 82 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 83 83 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 84 84 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 85 85 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 86 86 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 87 87 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 88 88 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 89 89 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 90 90 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 91 91 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 92 92 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 93 93 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 94 94 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 95 95 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 96 96 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 97 97 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 98 98 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 99 99 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 100 100 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 101 101 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 102 102 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 103 103 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 104 104 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 105 105 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 106 106 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 107 107 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 108 108 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 109 109 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 110 110 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 111 111 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 112 112 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 113 113 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 114 114 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 115 115 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 116 116 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 117 117 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 118 118 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 119 119 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 120 120 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 121 121 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 122 122 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 123 123 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 124 124 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 125 125 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 126 126 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 127 127 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 128 128 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 129 129 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 130 130 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 131 131 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 132 132 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 133 133 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 134 134 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 135 135 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 136 136 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 137 137 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 138 138 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 139 139 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 140 140 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 141 141 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 142 142 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000013 . region 143 143 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000013 . region 144 144 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000013 . region 145 145 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000013 . region 146 146 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000013 . region 147 147 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000013 . region 148 148 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000014 . region 1 1 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 2 2 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 3 3 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 4 4 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 5 5 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 6 6 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 7 7 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 8 8 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 9 9 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 10 10 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 11 11 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 12 12 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 13 13 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 14 14 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 15 15 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 16 16 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 17 17 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 18 18 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 19 19 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 20 20 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 21 21 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 22 22 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 23 23 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 24 24 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000014 . region 25 25 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 26 26 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 27 27 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 28 28 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 29 29 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 30 30 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 31 31 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=90,90,90;
+ref000014 . region 32 32 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 33 33 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 34 34 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 35 35 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 36 36 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 37 37 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 38 38 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 39 39 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 40 40 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 41 41 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 42 42 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 43 43 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 44 44 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 45 45 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 46 46 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 47 47 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 48 48 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 49 49 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 50 50 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 51 51 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 52 52 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 53 53 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 54 54 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 55 55 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000014 . region 56 56 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 57 57 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 58 58 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 59 59 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 60 60 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 61 61 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 62 62 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 63 63 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 64 64 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 65 65 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 66 66 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 67 67 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 68 68 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 69 69 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 70 70 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 71 71 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 72 72 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 73 73 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 74 74 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 75 75 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 76 76 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 77 77 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 78 78 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 79 79 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 80 80 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 81 81 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 82 82 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 83 83 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 84 84 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 85 85 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 86 86 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 87 87 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 88 88 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 89 89 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 90 90 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 91 91 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 92 92 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 93 93 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 94 94 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000014 . region 95 95 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 96 96 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 97 97 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 98 98 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 99 99 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 100 100 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 101 101 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 102 102 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 103 103 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 104 104 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 105 105 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 106 106 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 107 107 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 108 108 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 109 109 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 110 110 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 111 111 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 112 112 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 113 113 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 114 114 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 115 115 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 116 116 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 117 117 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 118 118 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 119 119 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 120 120 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 121 121 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 122 122 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 123 123 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 124 124 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 125 125 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 126 126 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 127 127 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 128 128 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 129 129 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 130 130 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 131 131 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 132 132 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000014 . region 133 133 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000014 . region 134 134 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000014 . region 135 135 0.00 + . cov2=29.000,0.000;gaps=0,0;cov=29,29,29;cQv=93,93,93;
+ref000014 . region 136 136 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 137 137 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 138 138 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 139 139 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 140 140 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 141 141 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 142 142 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 143 143 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 144 144 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 145 145 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 146 146 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 147 147 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 148 148 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 149 149 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 150 150 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 151 151 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 152 152 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 153 153 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 154 154 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 155 155 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 156 156 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 157 157 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 158 158 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 159 159 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 160 160 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 161 161 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 162 162 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 163 163 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 164 164 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 165 165 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 166 166 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 167 167 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 168 168 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 169 169 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 170 170 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 171 171 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 172 172 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 173 173 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 174 174 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 175 175 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 176 176 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 177 177 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 178 178 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 179 179 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 180 180 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 181 181 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 182 182 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 183 183 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 184 184 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 185 185 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 186 186 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 187 187 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 188 188 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=90,90,90;
+ref000014 . region 189 189 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 190 190 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 191 191 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 192 192 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 193 193 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 194 194 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 195 195 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 196 196 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 197 197 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 198 198 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 199 199 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 200 200 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 201 201 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 202 202 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 203 203 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 204 204 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 205 205 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 206 206 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 207 207 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 208 208 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 209 209 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 210 210 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 211 211 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 212 212 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 213 213 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 214 214 0.00 + . cov2=24.000,0.000;gaps=0,0;cov=24,24,24;cQv=93,93,93;
+ref000014 . region 215 215 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000015 . region 1 1 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000015 . region 2 2 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000015 . region 3 3 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 4 4 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 5 5 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 6 6 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 7 7 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 8 8 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 9 9 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 10 10 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 11 11 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 12 12 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 13 13 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 14 14 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 15 15 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 16 16 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 17 17 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 18 18 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 19 19 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 20 20 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 21 21 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 22 22 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 23 23 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 24 24 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 25 25 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 26 26 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 27 27 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 28 28 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 29 29 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 30 30 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 31 31 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 32 32 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 33 33 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 34 34 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 35 35 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 36 36 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 37 37 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 38 38 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 39 39 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 40 40 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 41 41 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 42 42 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 43 43 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 44 44 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 45 45 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 46 46 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 47 47 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 48 48 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 49 49 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 50 50 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 51 51 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 52 52 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 53 53 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 54 54 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 55 55 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 56 56 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 57 57 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 58 58 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 59 59 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 60 60 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 61 61 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 62 62 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 63 63 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 64 64 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 65 65 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 66 66 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 67 67 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 68 68 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 69 69 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 70 70 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 71 71 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 72 72 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 73 73 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 74 74 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 75 75 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 76 76 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 77 77 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 78 78 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 79 79 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 80 80 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 81 81 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 82 82 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 83 83 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 84 84 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 85 85 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 86 86 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 87 87 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 88 88 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 89 89 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 90 90 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 91 91 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 92 92 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 93 93 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 94 94 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 95 95 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 96 96 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 97 97 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 98 98 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 99 99 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 100 100 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 101 101 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 102 102 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 103 103 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 104 104 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 105 105 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 106 106 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 107 107 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 108 108 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 109 109 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 110 110 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 111 111 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 112 112 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 113 113 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 114 114 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000015 . region 115 115 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000015 . region 116 116 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000015 . region 117 117 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000015 . region 118 118 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000015 . region 119 119 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000016 . region 1 1 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000016 . region 2 2 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000016 . region 3 3 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000016 . region 4 4 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000016 . region 5 5 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000016 . region 6 6 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000016 . region 7 7 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 8 8 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 9 9 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 10 10 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 11 11 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 12 12 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 13 13 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 14 14 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 15 15 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 16 16 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 17 17 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 18 18 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 19 19 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 20 20 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 21 21 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 22 22 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 23 23 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 24 24 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 25 25 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 26 26 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 27 27 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000016 . region 28 28 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 29 29 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 30 30 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 31 31 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 32 32 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 33 33 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 34 34 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 35 35 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 36 36 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 37 37 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 38 38 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 39 39 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 40 40 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 41 41 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 42 42 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 43 43 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 44 44 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 45 45 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 46 46 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 47 47 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 48 48 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 49 49 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 50 50 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 51 51 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000016 . region 52 52 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 53 53 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 54 54 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 55 55 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 56 56 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 57 57 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 58 58 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 59 59 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 60 60 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 61 61 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 62 62 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 63 63 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 64 64 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 65 65 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 66 66 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 67 67 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 68 68 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 69 69 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 70 70 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 71 71 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 72 72 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 73 73 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 74 74 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 75 75 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 76 76 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 77 77 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 78 78 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 79 79 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 80 80 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 81 81 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 82 82 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 83 83 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 84 84 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 85 85 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 86 86 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 87 87 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 88 88 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 89 89 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 90 90 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 91 91 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 92 92 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 93 93 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 94 94 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 95 95 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 96 96 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 97 97 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 98 98 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 99 99 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 100 100 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 101 101 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 102 102 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 103 103 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 104 104 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 105 105 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 106 106 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 107 107 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 108 108 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 109 109 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 110 110 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 111 111 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 112 112 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 113 113 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 114 114 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 115 115 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 116 116 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 117 117 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 118 118 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 119 119 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 120 120 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 121 121 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 122 122 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 123 123 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 124 124 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 125 125 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 126 126 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 127 127 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 128 128 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 129 129 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 130 130 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 131 131 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 132 132 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 133 133 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 134 134 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 135 135 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 136 136 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 137 137 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 138 138 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 139 139 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 140 140 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 141 141 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 142 142 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 143 143 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 144 144 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 145 145 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 146 146 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 147 147 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 148 148 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 149 149 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 150 150 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 151 151 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 152 152 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 153 153 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 154 154 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 155 155 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 156 156 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 157 157 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 158 158 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 159 159 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000016 . region 160 160 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 161 161 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 162 162 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 163 163 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 164 164 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 165 165 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 166 166 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 167 167 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 168 168 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 169 169 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 170 170 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 171 171 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 172 172 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 173 173 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 174 174 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 175 175 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 176 176 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 177 177 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 178 178 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 179 179 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 180 180 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 181 181 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 182 182 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 183 183 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 184 184 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 185 185 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 186 186 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 187 187 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 188 188 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 189 189 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 190 190 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 191 191 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 192 192 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 193 193 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 194 194 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 195 195 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 196 196 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 197 197 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 198 198 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 199 199 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 200 200 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 201 201 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 202 202 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 203 203 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 204 204 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 205 205 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000016 . region 206 206 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000016 . region 207 207 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000016 . region 208 208 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000016 . region 209 209 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000016 . region 210 210 0.00 + . cov2=26.000,0.000;gaps=0,0;cov=26,26,26;cQv=93,93,93;
+ref000017 . region 1 1 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 2 2 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 3 3 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 4 4 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 5 5 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 6 6 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 7 7 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 8 8 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 9 9 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 10 10 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 11 11 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 12 12 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 13 13 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 14 14 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 15 15 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 16 16 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 17 17 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 18 18 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 19 19 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 20 20 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 21 21 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 22 22 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 23 23 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 24 24 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 25 25 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 26 26 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 27 27 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 28 28 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 29 29 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 30 30 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 31 31 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 32 32 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 33 33 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 34 34 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 35 35 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 36 36 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 37 37 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 38 38 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 39 39 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 40 40 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 41 41 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 42 42 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 43 43 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 44 44 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 45 45 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 46 46 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 47 47 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 48 48 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 49 49 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 50 50 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 51 51 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 52 52 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 53 53 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 54 54 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 55 55 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 56 56 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 57 57 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 58 58 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 59 59 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 60 60 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 61 61 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 62 62 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 63 63 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000017 . region 64 64 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 65 65 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 66 66 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 67 67 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 68 68 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 69 69 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 70 70 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 71 71 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 72 72 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 73 73 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 74 74 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 75 75 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000017 . region 76 76 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 77 77 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 78 78 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 79 79 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 80 80 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000017 . region 81 81 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 82 82 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 83 83 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 84 84 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 85 85 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 86 86 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 87 87 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 88 88 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 89 89 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 90 90 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 91 91 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 92 92 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 93 93 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 94 94 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 95 95 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 96 96 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 97 97 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 98 98 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 99 99 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 100 100 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000017 . region 101 101 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 102 102 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 103 103 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 104 104 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 105 105 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 106 106 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 107 107 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 108 108 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 109 109 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 110 110 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 111 111 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 112 112 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 113 113 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000017 . region 114 114 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000017 . region 115 115 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000017 . region 116 116 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000017 . region 117 117 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000017 . region 118 118 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000017 . region 119 119 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000017 . region 120 120 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000017 . region 121 121 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000017 . region 122 122 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000017 . region 123 123 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000017 . region 124 124 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000017 . region 125 125 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000017 . region 126 126 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000017 . region 127 127 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000017 . region 128 128 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 129 129 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 130 130 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 131 131 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 132 132 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 133 133 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 134 134 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 135 135 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 136 136 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 137 137 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 138 138 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 139 139 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 140 140 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 141 141 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 142 142 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 143 143 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 144 144 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 145 145 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 146 146 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 147 147 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 148 148 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 149 149 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 150 150 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 151 151 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 152 152 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 153 153 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 154 154 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 155 155 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 156 156 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 157 157 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 158 158 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 159 159 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 160 160 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 161 161 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 162 162 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 163 163 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 164 164 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 165 165 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 166 166 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 167 167 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 168 168 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 169 169 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 170 170 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 171 171 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 172 172 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 173 173 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 174 174 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 175 175 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 176 176 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 177 177 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 178 178 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000017 . region 179 179 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 180 180 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 181 181 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 182 182 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 183 183 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 184 184 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 185 185 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 186 186 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 187 187 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 188 188 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 189 189 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 190 190 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 191 191 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 192 192 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 193 193 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 194 194 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000017 . region 195 195 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 196 196 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 197 197 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 198 198 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 199 199 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 200 200 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 201 201 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 202 202 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 203 203 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 204 204 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 205 205 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 206 206 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 207 207 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 208 208 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 209 209 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 210 210 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 211 211 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 212 212 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 213 213 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 214 214 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 215 215 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 216 216 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 217 217 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000017 . region 218 218 0.00 + . cov2=65.000,0.000;gaps=0,0;cov=65,65,65;cQv=93,93,93;
+ref000017 . region 219 219 0.00 + . cov2=65.000,0.000;gaps=0,0;cov=65,65,65;cQv=93,93,93;
+ref000017 . region 220 220 0.00 + . cov2=65.000,0.000;gaps=0,0;cov=65,65,65;cQv=93,93,93;
+ref000017 . region 221 221 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000017 . region 222 222 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000018 . region 1 1 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000018 . region 2 2 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000018 . region 3 3 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000018 . region 4 4 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000018 . region 5 5 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000018 . region 6 6 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000018 . region 7 7 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000018 . region 8 8 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 9 9 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 10 10 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 11 11 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 12 12 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 13 13 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 14 14 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 15 15 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 16 16 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 17 17 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 18 18 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 19 19 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 20 20 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 21 21 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 22 22 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 23 23 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 24 24 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 25 25 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 26 26 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 27 27 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 28 28 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 29 29 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 30 30 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 31 31 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 32 32 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 33 33 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 34 34 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 35 35 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 36 36 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 37 37 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 38 38 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 39 39 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 40 40 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 41 41 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 42 42 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 43 43 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 44 44 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 45 45 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 46 46 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 47 47 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 48 48 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 49 49 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 50 50 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 51 51 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 52 52 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 53 53 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 54 54 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 55 55 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 56 56 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 57 57 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 58 58 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 59 59 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 60 60 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 61 61 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 62 62 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 63 63 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 64 64 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 65 65 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 66 66 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 67 67 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 68 68 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 69 69 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 70 70 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 71 71 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 72 72 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 73 73 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 74 74 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 75 75 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 76 76 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 77 77 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 78 78 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 79 79 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 80 80 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 81 81 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 82 82 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 83 83 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 84 84 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 85 85 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 86 86 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 87 87 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 88 88 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 89 89 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 90 90 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 91 91 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 92 92 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 93 93 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 94 94 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 95 95 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 96 96 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 97 97 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 98 98 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 99 99 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 100 100 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 101 101 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 102 102 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 103 103 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 104 104 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 105 105 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 106 106 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 107 107 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 108 108 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 109 109 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 110 110 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 111 111 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 112 112 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 113 113 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 114 114 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 115 115 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 116 116 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 117 117 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 118 118 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 119 119 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 120 120 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 121 121 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 122 122 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 123 123 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 124 124 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 125 125 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 126 126 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 127 127 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 128 128 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 129 129 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 130 130 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 131 131 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 132 132 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 133 133 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 134 134 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 135 135 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 136 136 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 137 137 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 138 138 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 139 139 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 140 140 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 141 141 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 142 142 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 143 143 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 144 144 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 145 145 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 146 146 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 147 147 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 148 148 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 149 149 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 150 150 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 151 151 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000018 . region 152 152 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 153 153 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 154 154 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 155 155 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 156 156 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 157 157 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 158 158 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000018 . region 159 159 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 160 160 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 161 161 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000018 . region 162 162 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000018 . region 163 163 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000018 . region 164 164 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000018 . region 165 165 0.00 + . cov2=89.000,0.000;gaps=0,0;cov=89,89,89;cQv=93,93,93;
+ref000019 . region 1 1 0.00 + . cov2=89.000,0.000;gaps=0,0;cov=89,89,89;cQv=93,93,93;
+ref000019 . region 2 2 0.00 + . cov2=103.000,0.000;gaps=0,0;cov=103,103,103;cQv=93,93,93;
+ref000019 . region 3 3 0.00 + . cov2=103.000,0.000;gaps=0,0;cov=103,103,103;cQv=93,93,93;
+ref000019 . region 4 4 0.00 + . cov2=104.000,0.000;gaps=0,0;cov=104,104,104;cQv=93,93,93;
+ref000019 . region 5 5 0.00 + . cov2=104.000,0.000;gaps=0,0;cov=104,104,104;cQv=93,93,93;
+ref000019 . region 6 6 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 7 7 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 8 8 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 9 9 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 10 10 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 11 11 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 12 12 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 13 13 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 14 14 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 15 15 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 16 16 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 17 17 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 18 18 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 19 19 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 20 20 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 21 21 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 22 22 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 23 23 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 24 24 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 25 25 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 26 26 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 27 27 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 28 28 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 29 29 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 30 30 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 31 31 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 32 32 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 33 33 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 34 34 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 35 35 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 36 36 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 37 37 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 38 38 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 39 39 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 40 40 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 41 41 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 42 42 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 43 43 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 44 44 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 45 45 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 46 46 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 47 47 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 48 48 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 49 49 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 50 50 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 51 51 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 52 52 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 53 53 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 54 54 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 55 55 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 56 56 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 57 57 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 58 58 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 59 59 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 60 60 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 61 61 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 62 62 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 63 63 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 64 64 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 65 65 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 66 66 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 67 67 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 68 68 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 69 69 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 70 70 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 71 71 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 72 72 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 73 73 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 74 74 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 75 75 0.00 + . cov2=109.000,0.000;gaps=0,0;cov=109,109,109;cQv=93,93,93;
+ref000019 . region 76 76 0.00 + . cov2=109.000,0.000;gaps=0,0;cov=109,109,109;cQv=93,93,93;
+ref000019 . region 77 77 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 78 78 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 79 79 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 80 80 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 81 81 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 82 82 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 83 83 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 84 84 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 85 85 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 86 86 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 87 87 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 88 88 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 89 89 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 90 90 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 91 91 0.00 + . cov2=108.000,0.000;gaps=0,0;cov=108,108,108;cQv=93,93,93;
+ref000019 . region 92 92 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 93 93 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 94 94 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 95 95 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 96 96 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 97 97 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 98 98 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 99 99 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 100 100 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 101 101 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 102 102 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 103 103 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 104 104 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 105 105 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 106 106 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 107 107 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 108 108 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 109 109 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 110 110 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 111 111 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 112 112 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 113 113 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 114 114 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 115 115 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 116 116 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 117 117 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 118 118 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 119 119 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 120 120 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 121 121 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 122 122 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 123 123 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 124 124 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 125 125 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 126 126 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 127 127 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 128 128 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 129 129 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 130 130 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 131 131 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 132 132 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 133 133 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 134 134 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 135 135 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 136 136 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 137 137 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 138 138 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 139 139 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 140 140 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 141 141 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 142 142 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 143 143 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 144 144 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 145 145 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 146 146 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 147 147 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 148 148 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 149 149 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 150 150 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 151 151 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 152 152 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 153 153 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 154 154 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 155 155 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 156 156 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 157 157 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 158 158 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 159 159 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 160 160 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 161 161 0.00 + . cov2=106.000,0.000;gaps=0,0;cov=106,106,106;cQv=93,93,93;
+ref000019 . region 162 162 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 163 163 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 164 164 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 165 165 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 166 166 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 167 167 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 168 168 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 169 169 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 170 170 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 171 171 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 172 172 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 173 173 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 174 174 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 175 175 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 176 176 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 177 177 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 178 178 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 179 179 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 180 180 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 181 181 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 182 182 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 183 183 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 184 184 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 185 185 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 186 186 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 187 187 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 188 188 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 189 189 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 190 190 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 191 191 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 192 192 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 193 193 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 194 194 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 195 195 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 196 196 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 197 197 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 198 198 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 199 199 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 200 200 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 201 201 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 202 202 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 203 203 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 204 204 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 205 205 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 206 206 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 207 207 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 208 208 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 209 209 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 210 210 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 211 211 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 212 212 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 213 213 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 214 214 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 215 215 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 216 216 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 217 217 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 218 218 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 219 219 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 220 220 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 221 221 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 222 222 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 223 223 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 224 224 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 225 225 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 226 226 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 227 227 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 228 228 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 229 229 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 230 230 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 231 231 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 232 232 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 233 233 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 234 234 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 235 235 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 236 236 0.00 + . cov2=107.000,0.000;gaps=0,0;cov=107,107,107;cQv=93,93,93;
+ref000019 . region 237 237 0.00 + . cov2=104.000,0.000;gaps=0,0;cov=104,104,104;cQv=93,93,93;
+ref000019 . region 238 238 0.00 + . cov2=104.000,0.000;gaps=0,0;cov=104,104,104;cQv=93,93,93;
+ref000019 . region 239 239 0.00 + . cov2=102.000,0.000;gaps=0,0;cov=102,102,102;cQv=93,93,93;
+ref000020 . region 1 1 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 2 2 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 3 3 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 4 4 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 5 5 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 6 6 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000020 . region 7 7 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000020 . region 8 8 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000020 . region 9 9 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000020 . region 10 10 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000020 . region 11 11 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 12 12 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 13 13 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 14 14 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 15 15 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 16 16 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 17 17 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 18 18 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 19 19 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 20 20 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 21 21 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 22 22 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 23 23 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 24 24 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 25 25 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 26 26 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 27 27 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 28 28 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 29 29 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 30 30 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 31 31 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 32 32 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 33 33 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 34 34 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 35 35 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 36 36 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 37 37 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 38 38 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 39 39 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 40 40 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 41 41 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 42 42 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 43 43 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 44 44 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 45 45 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 46 46 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 47 47 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 48 48 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 49 49 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 50 50 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 51 51 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 52 52 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 53 53 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 54 54 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 55 55 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 56 56 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 57 57 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 58 58 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 59 59 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 60 60 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 61 61 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 62 62 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 63 63 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 64 64 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 65 65 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 66 66 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 67 67 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 68 68 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 69 69 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 70 70 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 71 71 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 72 72 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 73 73 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 74 74 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 75 75 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 76 76 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 77 77 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 78 78 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 79 79 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 80 80 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 81 81 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 82 82 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 83 83 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 84 84 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 85 85 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 86 86 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 87 87 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 88 88 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 89 89 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 90 90 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 91 91 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 92 92 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 93 93 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 94 94 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 95 95 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 96 96 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 97 97 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 98 98 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 99 99 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 100 100 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 101 101 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 102 102 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 103 103 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 104 104 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 105 105 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 106 106 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 107 107 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 108 108 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 109 109 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 110 110 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 111 111 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 112 112 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 113 113 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 114 114 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 115 115 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 116 116 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 117 117 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 118 118 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 119 119 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 120 120 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 121 121 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 122 122 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 123 123 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 124 124 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 125 125 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 126 126 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 127 127 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 128 128 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 129 129 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000020 . region 130 130 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000020 . region 131 131 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000020 . region 132 132 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 133 133 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 134 134 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 135 135 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 136 136 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 137 137 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 138 138 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 139 139 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 140 140 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 141 141 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 142 142 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 143 143 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 144 144 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000020 . region 145 145 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 146 146 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 147 147 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 148 148 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 149 149 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 150 150 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 151 151 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 152 152 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 153 153 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 154 154 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 155 155 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 156 156 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 157 157 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 158 158 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 159 159 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 160 160 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 161 161 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 162 162 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 163 163 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 164 164 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 165 165 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 166 166 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 167 167 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 168 168 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 169 169 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 170 170 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 171 171 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 172 172 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 173 173 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 174 174 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 175 175 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 176 176 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 177 177 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 178 178 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 179 179 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 180 180 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 181 181 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 182 182 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 183 183 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 184 184 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 185 185 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000020 . region 186 186 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000020 . region 187 187 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000020 . region 188 188 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000020 . region 189 189 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000020 . region 190 190 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000020 . region 191 191 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000020 . region 192 192 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000020 . region 193 193 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000020 . region 194 194 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000020 . region 195 195 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000020 . region 196 196 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000020 . region 197 197 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000020 . region 198 198 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000020 . region 199 199 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000020 . region 200 200 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000020 . region 201 201 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000020 . region 202 202 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000020 . region 203 203 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000020 . region 204 204 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000020 . region 205 205 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000020 . region 206 206 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000020 . region 207 207 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000021 . region 1 1 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000021 . region 2 2 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000021 . region 3 3 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000021 . region 4 4 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000021 . region 5 5 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 6 6 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 7 7 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 8 8 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 9 9 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 10 10 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 11 11 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 12 12 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 13 13 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 14 14 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 15 15 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 16 16 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 17 17 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 18 18 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 19 19 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 20 20 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 21 21 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 22 22 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 23 23 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 24 24 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 25 25 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 26 26 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 27 27 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 28 28 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 29 29 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 30 30 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 31 31 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 32 32 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 33 33 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 34 34 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 35 35 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 36 36 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 37 37 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 38 38 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 39 39 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 40 40 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 41 41 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 42 42 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 43 43 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 44 44 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 45 45 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 46 46 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 47 47 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 48 48 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 49 49 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 50 50 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 51 51 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 52 52 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 53 53 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 54 54 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 55 55 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 56 56 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 57 57 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 58 58 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 59 59 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 60 60 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 61 61 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 62 62 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 63 63 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 64 64 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 65 65 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 66 66 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 67 67 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 68 68 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 69 69 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 70 70 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 71 71 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 72 72 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 73 73 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 74 74 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 75 75 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 76 76 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 77 77 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 78 78 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 79 79 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 80 80 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 81 81 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 82 82 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 83 83 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 84 84 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 85 85 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 86 86 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 87 87 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 88 88 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 89 89 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 90 90 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 91 91 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 92 92 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 93 93 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 94 94 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 95 95 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 96 96 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 97 97 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 98 98 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 99 99 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 100 100 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 101 101 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 102 102 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 103 103 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 104 104 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 105 105 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 106 106 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 107 107 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 108 108 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 109 109 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 110 110 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 111 111 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 112 112 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 113 113 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 114 114 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 115 115 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 116 116 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 117 117 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 118 118 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 119 119 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 120 120 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 121 121 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 122 122 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 123 123 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 124 124 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 125 125 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 126 126 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 127 127 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 128 128 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 129 129 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 130 130 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 131 131 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 132 132 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 133 133 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 134 134 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 135 135 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 136 136 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 137 137 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 138 138 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 139 139 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000021 . region 140 140 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 141 141 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 142 142 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 143 143 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000021 . region 144 144 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000021 . region 145 145 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000021 . region 146 146 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000021 . region 147 147 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000021 . region 148 148 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000021 . region 149 149 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000021 . region 150 150 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000021 . region 151 151 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000022 . region 1 1 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000022 . region 2 2 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000022 . region 3 3 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000022 . region 4 4 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 5 5 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 6 6 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 7 7 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 8 8 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 9 9 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 10 10 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 11 11 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 12 12 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 13 13 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 14 14 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 15 15 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 16 16 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 17 17 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 18 18 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 19 19 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 20 20 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 21 21 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 22 22 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 23 23 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 24 24 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 25 25 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 26 26 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 27 27 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 28 28 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 29 29 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 30 30 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 31 31 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 32 32 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 33 33 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 34 34 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 35 35 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 36 36 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 37 37 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 38 38 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 39 39 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 40 40 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 41 41 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 42 42 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 43 43 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 44 44 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 45 45 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000022 . region 46 46 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 47 47 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 48 48 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 49 49 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 50 50 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 51 51 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 52 52 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 53 53 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 54 54 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 55 55 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 56 56 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 57 57 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 58 58 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 59 59 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 60 60 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 61 61 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 62 62 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 63 63 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 64 64 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 65 65 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 66 66 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 67 67 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 68 68 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 69 69 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 70 70 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 71 71 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 72 72 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 73 73 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 74 74 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 75 75 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 76 76 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 77 77 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 78 78 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 79 79 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 80 80 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 81 81 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 82 82 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 83 83 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 84 84 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 85 85 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 86 86 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 87 87 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 88 88 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 89 89 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 90 90 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 91 91 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 92 92 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 93 93 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 94 94 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 95 95 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 96 96 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 97 97 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 98 98 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 99 99 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 100 100 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 101 101 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 102 102 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 103 103 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 104 104 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 105 105 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 106 106 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 107 107 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 108 108 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 109 109 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 110 110 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 111 111 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 112 112 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 113 113 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 114 114 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 115 115 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 116 116 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 117 117 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 118 118 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 119 119 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 120 120 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 121 121 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 122 122 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 123 123 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 124 124 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 125 125 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 126 126 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 127 127 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 128 128 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 129 129 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 130 130 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 131 131 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 132 132 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 133 133 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 134 134 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 135 135 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 136 136 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 137 137 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 138 138 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 139 139 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 140 140 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 141 141 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 142 142 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 143 143 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 144 144 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 145 145 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 146 146 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 147 147 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 148 148 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 149 149 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 150 150 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 151 151 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 152 152 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 153 153 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 154 154 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 155 155 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 156 156 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 157 157 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 158 158 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 159 159 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 160 160 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 161 161 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 162 162 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 163 163 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 164 164 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 165 165 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000022 . region 166 166 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 167 167 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 168 168 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 169 169 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 170 170 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 171 171 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 172 172 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 173 173 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 174 174 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 175 175 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 176 176 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 177 177 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 178 178 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 179 179 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 180 180 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 181 181 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 182 182 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 183 183 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 184 184 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 185 185 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 186 186 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 187 187 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 188 188 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 189 189 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 190 190 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 191 191 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 192 192 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 193 193 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 194 194 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 195 195 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 196 196 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000022 . region 197 197 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000022 . region 198 198 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000022 . region 199 199 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000022 . region 200 200 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000022 . region 201 201 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000022 . region 202 202 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000022 . region 203 203 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000022 . region 204 204 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000022 . region 205 205 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000022 . region 206 206 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000022 . region 207 207 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000022 . region 208 208 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000022 . region 209 209 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000022 . region 210 210 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000022 . region 211 211 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000022 . region 212 212 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000022 . region 213 213 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000022 . region 214 214 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000022 . region 215 215 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000023 . region 1 1 0.00 + . cov2=47.000,0.000;gaps=0,0;cov=47,47,47;cQv=93,93,93;
+ref000023 . region 2 2 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000023 . region 3 3 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000023 . region 4 4 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000023 . region 5 5 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000023 . region 6 6 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000023 . region 7 7 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000023 . region 8 8 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000023 . region 9 9 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000023 . region 10 10 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000023 . region 11 11 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000023 . region 12 12 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 13 13 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 14 14 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 15 15 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 16 16 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 17 17 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 18 18 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 19 19 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 20 20 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 21 21 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 22 22 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 23 23 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 24 24 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 25 25 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 26 26 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 27 27 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 28 28 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 29 29 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 30 30 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 31 31 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 32 32 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 33 33 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 34 34 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 35 35 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 36 36 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 37 37 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 38 38 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 39 39 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 40 40 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 41 41 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 42 42 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 43 43 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 44 44 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 45 45 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 46 46 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 47 47 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 48 48 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 49 49 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 50 50 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 51 51 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 52 52 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 53 53 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 54 54 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 55 55 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 56 56 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 57 57 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 58 58 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 59 59 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 60 60 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 61 61 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 62 62 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 63 63 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 64 64 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 65 65 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 66 66 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 67 67 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 68 68 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 69 69 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 70 70 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 71 71 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 72 72 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 73 73 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 74 74 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 75 75 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 76 76 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 77 77 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 78 78 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 79 79 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 80 80 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 81 81 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 82 82 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 83 83 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 84 84 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 85 85 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000023 . region 86 86 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 87 87 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 88 88 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 89 89 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 90 90 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 91 91 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 92 92 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 93 93 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 94 94 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 95 95 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 96 96 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 97 97 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 98 98 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 99 99 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 100 100 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 101 101 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 102 102 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 103 103 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 104 104 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 105 105 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 106 106 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 107 107 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 108 108 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 109 109 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 110 110 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 111 111 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 112 112 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 113 113 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 114 114 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 115 115 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 116 116 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 117 117 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 118 118 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 119 119 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 120 120 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 121 121 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 122 122 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 123 123 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 124 124 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 125 125 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 126 126 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 127 127 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 128 128 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 129 129 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 130 130 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 131 131 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 132 132 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 133 133 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 134 134 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 135 135 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 136 136 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 137 137 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 138 138 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 139 139 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 140 140 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 141 141 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 142 142 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 143 143 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 144 144 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 145 145 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 146 146 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 147 147 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 148 148 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 149 149 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 150 150 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 151 151 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 152 152 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 153 153 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 154 154 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 155 155 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 156 156 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 157 157 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 158 158 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 159 159 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 160 160 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 161 161 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 162 162 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 163 163 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 164 164 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 165 165 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 166 166 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 167 167 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 168 168 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 169 169 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 170 170 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 171 171 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 172 172 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 173 173 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 174 174 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 175 175 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 176 176 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 177 177 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 178 178 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000023 . region 179 179 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000023 . region 180 180 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000023 . region 181 181 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000023 . region 182 182 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000023 . region 183 183 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000024 . region 1 1 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000024 . region 2 2 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000024 . region 3 3 0.00 + . cov2=28.000,0.000;gaps=0,0;cov=28,28,28;cQv=93,93,93;
+ref000024 . region 4 4 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000024 . region 5 5 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000024 . region 6 6 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000024 . region 7 7 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000024 . region 8 8 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000024 . region 9 9 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000024 . region 10 10 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 11 11 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 12 12 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 13 13 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 14 14 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 15 15 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 16 16 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 17 17 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 18 18 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 19 19 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 20 20 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 21 21 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 22 22 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 23 23 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 24 24 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 25 25 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 26 26 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 27 27 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 28 28 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 29 29 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 30 30 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 31 31 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=83,83,83;
+ref000024 . region 32 32 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 33 33 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 34 34 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 35 35 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 36 36 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 37 37 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 38 38 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 39 39 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 40 40 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 41 41 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 42 42 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 43 43 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 44 44 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 45 45 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 46 46 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 47 47 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 48 48 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 49 49 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 50 50 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 51 51 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 52 52 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 53 53 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 54 54 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 55 55 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 56 56 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 57 57 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 58 58 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 59 59 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 60 60 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 61 61 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 62 62 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 63 63 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 64 64 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 65 65 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 66 66 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 67 67 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 68 68 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 69 69 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 70 70 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 71 71 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 72 72 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 73 73 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 74 74 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 75 75 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 76 76 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 77 77 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 78 78 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 79 79 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 80 80 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 81 81 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 82 82 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 83 83 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 84 84 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 85 85 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 86 86 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 87 87 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 88 88 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 89 89 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 90 90 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 91 91 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 92 92 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 93 93 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 94 94 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 95 95 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 96 96 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 97 97 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 98 98 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 99 99 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 100 100 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 101 101 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 102 102 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 103 103 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 104 104 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 105 105 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 106 106 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 107 107 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 108 108 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 109 109 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 110 110 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 111 111 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 112 112 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 113 113 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 114 114 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 115 115 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 116 116 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 117 117 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 118 118 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 119 119 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 120 120 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 121 121 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 122 122 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 123 123 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 124 124 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 125 125 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 126 126 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 127 127 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 128 128 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 129 129 0.00 + . cov2=31.000,0.000;gaps=0,0;cov=31,31,31;cQv=93,93,93;
+ref000024 . region 130 130 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000024 . region 131 131 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000024 . region 132 132 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000024 . region 133 133 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000024 . region 134 134 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000024 . region 135 135 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 136 136 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 137 137 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=83,83,83;
+ref000024 . region 138 138 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 139 139 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 140 140 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 141 141 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 142 142 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 143 143 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 144 144 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 145 145 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 146 146 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=53,53,53;
+ref000024 . region 147 147 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 148 148 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 149 149 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 150 150 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 151 151 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 152 152 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 153 153 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 154 154 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 155 155 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 156 156 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 157 157 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 158 158 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 159 159 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 160 160 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=68,68,68;
+ref000024 . region 161 161 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=38,38,38;
+ref000024 . region 162 162 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=83,83,83;
+ref000024 . region 163 163 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 164 164 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 165 165 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 166 166 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 167 167 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 168 168 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 169 169 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 170 170 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 171 171 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 172 172 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 173 173 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 174 174 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 175 175 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 176 176 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 177 177 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 178 178 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 179 179 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=83,83,83;
+ref000024 . region 180 180 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=45,45,45;
+ref000024 . region 181 181 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 182 182 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 183 183 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 184 184 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 185 185 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 186 186 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 187 187 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 188 188 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 189 189 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 190 190 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 191 191 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 192 192 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 193 193 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 194 194 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 195 195 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 196 196 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 197 197 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 198 198 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 199 199 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 200 200 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 201 201 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 202 202 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 203 203 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 204 204 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 205 205 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 206 206 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 207 207 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 208 208 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 209 209 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 210 210 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 211 211 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 212 212 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 213 213 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 214 214 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 215 215 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 216 216 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 217 217 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 218 218 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 219 219 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 220 220 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 221 221 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000024 . region 222 222 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 223 223 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 224 224 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 225 225 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 226 226 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 227 227 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 228 228 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 229 229 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 230 230 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 231 231 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 232 232 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 233 233 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 234 234 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 235 235 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 236 236 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 237 237 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 238 238 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 239 239 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 240 240 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 241 241 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 242 242 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 243 243 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 244 244 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 245 245 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 246 246 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 247 247 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000024 . region 248 248 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000024 . region 249 249 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000024 . region 250 250 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000024 . region 251 251 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000025 . region 1 1 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 2 2 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 3 3 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 4 4 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 5 5 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 6 6 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 7 7 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 8 8 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 9 9 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=38,38,38;
+ref000025 . region 10 10 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 11 11 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 12 12 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 13 13 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 14 14 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 15 15 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 16 16 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 17 17 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 18 18 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 19 19 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 20 20 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 21 21 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 22 22 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 23 23 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 24 24 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 25 25 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 26 26 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 27 27 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 28 28 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 29 29 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=23,23,23;
+ref000025 . region 30 30 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=38,38,38;
+ref000025 . region 31 31 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 32 32 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 33 33 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 34 34 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 35 35 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 36 36 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 37 37 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 38 38 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 39 39 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 40 40 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 41 41 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 42 42 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 43 43 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 44 44 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 45 45 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 46 46 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 47 47 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 48 48 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 49 49 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 50 50 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 51 51 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 52 52 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 53 53 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 54 54 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=8,8,8;
+ref000025 . region 55 55 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 56 56 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 57 57 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 58 58 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 59 59 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 60 60 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 61 61 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 62 62 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 63 63 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 64 64 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 65 65 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 66 66 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 67 67 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 68 68 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 69 69 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=38,38,38;
+ref000025 . region 70 70 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 71 71 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 72 72 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 73 73 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 74 74 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 75 75 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 76 76 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 77 77 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 78 78 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 79 79 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 80 80 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 81 81 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 82 82 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=38,38,38;
+ref000025 . region 83 83 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=38,38,38;
+ref000025 . region 84 84 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 85 85 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 86 86 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 87 87 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 88 88 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 89 89 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 90 90 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 91 91 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 92 92 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=52,52,52;
+ref000025 . region 93 93 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 94 94 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 95 95 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 96 96 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 97 97 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 98 98 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 99 99 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 100 100 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 101 101 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 102 102 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 103 103 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 104 104 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 105 105 0.00 + . cov2=9.000,0.000;gaps=0,0;cov=9,9,9;cQv=68,68,68;
+ref000025 . region 106 106 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000025 . region 107 107 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000025 . region 108 108 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000025 . region 109 109 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000025 . region 110 110 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=53,53,53;
+ref000026 . region 1 1 0.00 + . cov2=24609.000,0.000;gaps=0,0;cov=24609,24609,24609;cQv=93,93,93;
+ref000026 . region 2 2 0.00 + . cov2=27113.000,0.000;gaps=0,0;cov=27113,27113,27113;cQv=93,93,93;
+ref000026 . region 3 3 0.00 + . cov2=27178.000,0.000;gaps=0,0;cov=27178,27178,27178;cQv=93,93,93;
+ref000026 . region 4 4 0.00 + . cov2=28098.000,0.000;gaps=0,0;cov=28098,28098,28098;cQv=93,93,93;
+ref000026 . region 5 5 0.00 + . cov2=28217.000,0.000;gaps=0,0;cov=28217,28217,28217;cQv=93,93,93;
+ref000026 . region 6 6 0.00 + . cov2=28712.000,0.000;gaps=0,0;cov=28712,28712,28712;cQv=93,93,93;
+ref000026 . region 7 7 0.00 + . cov2=28773.000,0.000;gaps=0,0;cov=28773,28773,28773;cQv=93,93,93;
+ref000026 . region 8 8 0.00 + . cov2=28796.000,0.000;gaps=0,0;cov=28796,28796,28796;cQv=93,93,93;
+ref000026 . region 9 9 0.00 + . cov2=28814.000,0.000;gaps=0,0;cov=28814,28814,28814;cQv=93,93,93;
+ref000026 . region 10 10 0.00 + . cov2=28831.000,0.000;gaps=0,0;cov=28831,28831,28831;cQv=93,93,93;
+ref000026 . region 11 11 0.00 + . cov2=28876.000,0.000;gaps=0,0;cov=28876,28876,28876;cQv=93,93,93;
+ref000026 . region 12 12 0.00 + . cov2=28888.000,0.000;gaps=0,0;cov=28888,28888,28888;cQv=93,93,93;
+ref000026 . region 13 13 0.00 + . cov2=28891.000,0.000;gaps=0,0;cov=28891,28891,28891;cQv=93,93,93;
+ref000026 . region 14 14 0.00 + . cov2=28894.000,0.000;gaps=0,0;cov=28894,28894,28894;cQv=93,93,93;
+ref000026 . region 15 15 0.00 + . cov2=28907.000,0.000;gaps=0,0;cov=28907,28907,28907;cQv=93,93,93;
+ref000026 . region 16 16 0.00 + . cov2=28909.000,0.000;gaps=0,0;cov=28909,28909,28909;cQv=93,93,93;
+ref000026 . region 17 17 0.00 + . cov2=28911.000,0.000;gaps=0,0;cov=28911,28911,28911;cQv=93,93,93;
+ref000026 . region 18 18 0.00 + . cov2=28914.000,0.000;gaps=0,0;cov=28914,28914,28914;cQv=93,93,93;
+ref000026 . region 19 19 0.00 + . cov2=28914.000,0.000;gaps=0,0;cov=28914,28914,28914;cQv=93,93,93;
+ref000026 . region 20 20 0.00 + . cov2=28916.000,0.000;gaps=0,0;cov=28916,28916,28916;cQv=93,93,93;
+ref000026 . region 21 21 0.00 + . cov2=28919.000,0.000;gaps=0,0;cov=28919,28919,28919;cQv=93,93,93;
+ref000026 . region 22 22 0.00 + . cov2=28920.000,0.000;gaps=0,0;cov=28920,28920,28920;cQv=93,93,93;
+ref000026 . region 23 23 0.00 + . cov2=28921.000,0.000;gaps=0,0;cov=28921,28921,28921;cQv=93,93,93;
+ref000026 . region 24 24 0.00 + . cov2=28923.000,0.000;gaps=0,0;cov=28923,28923,28923;cQv=93,93,93;
+ref000026 . region 25 25 0.00 + . cov2=28923.000,0.000;gaps=0,0;cov=28923,28923,28923;cQv=93,93,93;
+ref000026 . region 26 26 0.00 + . cov2=28923.000,0.000;gaps=0,0;cov=28923,28923,28923;cQv=93,93,93;
+ref000026 . region 27 27 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 28 28 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 29 29 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 30 30 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 31 31 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 32 32 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 33 33 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 34 34 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 35 35 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 36 36 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 37 37 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 38 38 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 39 39 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 40 40 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 41 41 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 42 42 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 43 43 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 44 44 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 45 45 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 46 46 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 47 47 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 48 48 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 49 49 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 50 50 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 51 51 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 52 52 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 53 53 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 54 54 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 55 55 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 56 56 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 57 57 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 58 58 0.00 + . cov2=28927.000,0.000;gaps=0,0;cov=28927,28927,28927;cQv=93,93,93;
+ref000026 . region 59 59 0.00 + . cov2=28927.000,0.000;gaps=0,0;cov=28927,28927,28927;cQv=93,93,93;
+ref000026 . region 60 60 0.00 + . cov2=28927.000,0.000;gaps=0,0;cov=28927,28927,28927;cQv=93,93,93;
+ref000026 . region 61 61 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 62 62 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 63 63 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 64 64 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 65 65 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 66 66 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 67 67 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 68 68 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 69 69 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 70 70 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 71 71 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 72 72 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 73 73 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 74 74 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 75 75 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 76 76 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 77 77 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 78 78 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 79 79 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 80 80 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 81 81 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 82 82 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 83 83 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 84 84 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 85 85 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 86 86 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 87 87 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 88 88 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 89 89 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 90 90 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 91 91 0.00 + . cov2=28929.000,0.000;gaps=0,0;cov=28929,28929,28929;cQv=93,93,93;
+ref000026 . region 92 92 0.00 + . cov2=28929.000,0.000;gaps=0,0;cov=28929,28929,28929;cQv=93,93,93;
+ref000026 . region 93 93 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 94 94 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 95 95 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 96 96 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 97 97 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 98 98 0.00 + . cov2=28928.000,0.000;gaps=0,0;cov=28928,28928,28928;cQv=93,93,93;
+ref000026 . region 99 99 0.00 + . cov2=28927.000,0.000;gaps=0,0;cov=28927,28927,28927;cQv=93,93,93;
+ref000026 . region 100 100 0.00 + . cov2=28927.000,0.000;gaps=0,0;cov=28927,28927,28927;cQv=93,93,93;
+ref000026 . region 101 101 0.00 + . cov2=28927.000,0.000;gaps=0,0;cov=28927,28927,28927;cQv=93,93,93;
+ref000026 . region 102 102 0.00 + . cov2=28927.000,0.000;gaps=0,0;cov=28927,28927,28927;cQv=93,93,93;
+ref000026 . region 103 103 0.00 + . cov2=28927.000,0.000;gaps=0,0;cov=28927,28927,28927;cQv=93,93,93;
+ref000026 . region 104 104 0.00 + . cov2=28927.000,0.000;gaps=0,0;cov=28927,28927,28927;cQv=93,93,93;
+ref000026 . region 105 105 0.00 + . cov2=28927.000,0.000;gaps=0,0;cov=28927,28927,28927;cQv=93,93,93;
+ref000026 . region 106 106 0.00 + . cov2=28927.000,0.000;gaps=0,0;cov=28927,28927,28927;cQv=93,93,93;
+ref000026 . region 107 107 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 108 108 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 109 109 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 110 110 0.00 + . cov2=28926.000,0.000;gaps=0,0;cov=28926,28926,28926;cQv=93,93,93;
+ref000026 . region 111 111 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 112 112 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 113 113 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 114 114 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 115 115 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 116 116 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 117 117 0.00 + . cov2=28925.000,0.000;gaps=0,0;cov=28925,28925,28925;cQv=93,93,93;
+ref000026 . region 118 118 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 119 119 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 120 120 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 121 121 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 122 122 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 123 123 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 124 124 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 125 125 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 126 126 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 127 127 0.00 + . cov2=28924.000,0.000;gaps=0,0;cov=28924,28924,28924;cQv=93,93,93;
+ref000026 . region 128 128 0.00 + . cov2=28923.000,0.000;gaps=0,0;cov=28923,28923,28923;cQv=93,93,93;
+ref000026 . region 129 129 0.00 + . cov2=28923.000,0.000;gaps=0,0;cov=28923,28923,28923;cQv=93,93,93;
+ref000026 . region 130 130 0.00 + . cov2=28921.000,0.000;gaps=0,0;cov=28921,28921,28921;cQv=93,93,93;
+ref000026 . region 131 131 0.00 + . cov2=28920.000,0.000;gaps=0,0;cov=28920,28920,28920;cQv=93,93,93;
+ref000026 . region 132 132 0.00 + . cov2=28920.000,0.000;gaps=0,0;cov=28920,28920,28920;cQv=93,93,93;
+ref000026 . region 133 133 0.00 + . cov2=28919.000,0.000;gaps=0,0;cov=28919,28919,28919;cQv=93,93,93;
+ref000026 . region 134 134 0.00 + . cov2=28918.000,0.000;gaps=0,0;cov=28918,28918,28918;cQv=93,93,93;
+ref000026 . region 135 135 0.00 + . cov2=28917.000,0.000;gaps=0,0;cov=28917,28917,28917;cQv=93,93,93;
+ref000026 . region 136 136 0.00 + . cov2=28917.000,0.000;gaps=0,0;cov=28917,28917,28917;cQv=93,93,93;
+ref000026 . region 137 137 0.00 + . cov2=28916.000,0.000;gaps=0,0;cov=28916,28916,28916;cQv=93,93,93;
+ref000026 . region 138 138 0.00 + . cov2=28911.000,0.000;gaps=0,0;cov=28911,28911,28911;cQv=93,93,93;
+ref000026 . region 139 139 0.00 + . cov2=28911.000,0.000;gaps=0,0;cov=28911,28911,28911;cQv=93,93,93;
+ref000026 . region 140 140 0.00 + . cov2=28892.000,0.000;gaps=0,0;cov=28892,28892,28892;cQv=93,93,93;
+ref000026 . region 141 141 0.00 + . cov2=28849.000,0.000;gaps=0,0;cov=28849,28849,28849;cQv=93,93,93;
+ref000026 . region 142 142 0.00 + . cov2=28827.000,0.000;gaps=0,0;cov=28827,28827,28827;cQv=93,93,93;
+ref000026 . region 143 143 0.00 + . cov2=28803.000,0.000;gaps=0,0;cov=28803,28803,28803;cQv=93,93,93;
+ref000026 . region 144 144 0.00 + . cov2=28762.000,0.000;gaps=0,0;cov=28762,28762,28762;cQv=93,93,93;
+ref000026 . region 145 145 0.00 + . cov2=28723.000,0.000;gaps=0,0;cov=28723,28723,28723;cQv=93,93,93;
+ref000026 . region 146 146 0.00 + . cov2=28681.000,0.000;gaps=0,0;cov=28681,28681,28681;cQv=93,93,93;
+ref000026 . region 147 147 0.00 + . cov2=28493.000,0.000;gaps=0,0;cov=28493,28493,28493;cQv=93,93,93;
+ref000026 . region 148 148 0.00 + . cov2=28449.000,0.000;gaps=0,0;cov=28449,28449,28449;cQv=93,93,93;
+ref000026 . region 149 149 0.00 + . cov2=26491.000,0.000;gaps=0,0;cov=26491,26491,26491;cQv=93,93,93;
+ref000026 . region 150 150 0.00 + . cov2=24699.000,0.000;gaps=0,0;cov=24699,24699,24699;cQv=93,93,93;
+ref000027 . region 1 1 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000027 . region 2 2 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 3 3 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 4 4 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 5 5 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 6 6 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 7 7 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 8 8 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 9 9 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 10 10 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 11 11 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 12 12 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 13 13 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 14 14 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 15 15 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 16 16 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 17 17 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 18 18 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 19 19 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 20 20 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 21 21 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 22 22 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 23 23 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 24 24 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 25 25 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 26 26 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 27 27 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 28 28 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 29 29 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 30 30 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 31 31 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 32 32 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 33 33 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 34 34 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 35 35 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 36 36 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 37 37 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 38 38 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 39 39 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 40 40 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 41 41 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 42 42 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 43 43 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 44 44 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 45 45 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 46 46 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 47 47 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 48 48 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 49 49 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 50 50 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 51 51 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 52 52 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 53 53 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 54 54 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 55 55 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 56 56 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 57 57 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 58 58 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 59 59 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 60 60 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 61 61 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 62 62 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 63 63 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 64 64 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 65 65 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 66 66 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 67 67 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 68 68 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 69 69 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 70 70 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 71 71 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 72 72 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 73 73 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 74 74 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 75 75 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 76 76 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 77 77 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 78 78 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 79 79 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 80 80 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 81 81 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000027 . region 82 82 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 83 83 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 84 84 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 85 85 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 86 86 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 87 87 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 88 88 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 89 89 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 90 90 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 91 91 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 92 92 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 93 93 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 94 94 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 95 95 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 96 96 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000027 . region 97 97 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000027 . region 98 98 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000027 . region 99 99 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000027 . region 100 100 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000027 . region 101 101 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000027 . region 102 102 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000027 . region 103 103 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000027 . region 104 104 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 105 105 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 106 106 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 107 107 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 108 108 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 109 109 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 110 110 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 111 111 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 112 112 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 113 113 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 114 114 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 115 115 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 116 116 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 117 117 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 118 118 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 119 119 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 120 120 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 121 121 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 122 122 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 123 123 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000027 . region 124 124 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 125 125 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 126 126 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 127 127 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 128 128 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 129 129 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 130 130 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 131 131 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 132 132 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 133 133 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 134 134 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 135 135 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 136 136 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 137 137 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 138 138 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 139 139 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 140 140 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 141 141 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 142 142 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 143 143 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 144 144 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 145 145 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 146 146 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 147 147 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 148 148 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 149 149 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 150 150 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 151 151 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 152 152 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 153 153 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 154 154 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 155 155 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 156 156 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 157 157 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 158 158 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 159 159 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 160 160 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 161 161 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=83,83,83;
+ref000027 . region 162 162 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 163 163 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 164 164 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 165 165 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 166 166 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 167 167 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 168 168 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 169 169 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 170 170 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 171 171 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 172 172 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 173 173 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 174 174 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000027 . region 175 175 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000027 . region 176 176 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000027 . region 177 177 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000027 . region 178 178 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 179 179 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 180 180 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 181 181 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 182 182 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 183 183 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 184 184 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 185 185 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 186 186 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 187 187 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 188 188 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 189 189 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 190 190 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 191 191 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 192 192 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 193 193 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 194 194 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 195 195 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 196 196 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 197 197 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 198 198 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 199 199 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 200 200 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 201 201 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 202 202 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 203 203 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 204 204 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 205 205 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 206 206 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 207 207 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 208 208 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 209 209 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 210 210 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 211 211 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 212 212 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 213 213 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 214 214 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 215 215 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 216 216 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 217 217 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 218 218 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 219 219 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 220 220 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 221 221 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 222 222 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 223 223 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 224 224 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000027 . region 225 225 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000027 . region 226 226 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000027 . region 227 227 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 228 228 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 229 229 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 230 230 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 231 231 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 232 232 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 233 233 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 234 234 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 235 235 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 236 236 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 237 237 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 238 238 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 239 239 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 240 240 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 241 241 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 242 242 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 243 243 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 244 244 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 245 245 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 246 246 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 247 247 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000027 . region 248 248 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000027 . region 249 249 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000027 . region 250 250 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000028 . region 1 1 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 2 2 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 3 3 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 4 4 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 5 5 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 6 6 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 7 7 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 8 8 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 9 9 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 10 10 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 11 11 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 12 12 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 13 13 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 14 14 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 15 15 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 16 16 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 17 17 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 18 18 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 19 19 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 20 20 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 21 21 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 22 22 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 23 23 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 24 24 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 25 25 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 26 26 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 27 27 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 28 28 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 29 29 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 30 30 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 31 31 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 32 32 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 33 33 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 34 34 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 35 35 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 36 36 0.00 + . cov2=46.000,0.000;gaps=0,0;cov=46,46,46;cQv=93,93,93;
+ref000028 . region 37 37 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 38 38 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 39 39 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 40 40 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 41 41 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 42 42 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 43 43 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 44 44 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 45 45 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 46 46 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 47 47 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 48 48 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 49 49 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 50 50 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 51 51 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 52 52 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 53 53 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 54 54 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 55 55 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 56 56 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 57 57 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 58 58 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 59 59 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 60 60 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 61 61 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000028 . region 62 62 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000028 . region 63 63 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000028 . region 64 64 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000028 . region 65 65 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 66 66 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 67 67 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 68 68 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 69 69 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 70 70 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 71 71 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 72 72 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 73 73 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 74 74 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 75 75 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 76 76 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 77 77 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 78 78 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 79 79 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 80 80 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 81 81 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 82 82 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 83 83 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 84 84 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 85 85 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 86 86 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 87 87 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 88 88 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 89 89 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 90 90 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 91 91 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000028 . region 92 92 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 93 93 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 94 94 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 95 95 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 96 96 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 97 97 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 98 98 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 99 99 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 100 100 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 101 101 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 102 102 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 103 103 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 104 104 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 105 105 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 106 106 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 107 107 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 108 108 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 109 109 0.00 + . cov2=53.000,0.000;gaps=0,0;cov=53,53,53;cQv=93,93,93;
+ref000028 . region 110 110 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000028 . region 111 111 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000028 . region 112 112 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 113 113 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 114 114 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 115 115 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 116 116 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 117 117 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 118 118 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 119 119 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 120 120 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 121 121 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 122 122 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 123 123 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 124 124 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 125 125 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 126 126 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 127 127 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 128 128 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 129 129 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 130 130 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 131 131 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 132 132 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 133 133 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 134 134 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 135 135 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 136 136 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 137 137 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000028 . region 138 138 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 139 139 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 140 140 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 141 141 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 142 142 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 143 143 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 144 144 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 145 145 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 146 146 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 147 147 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 148 148 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 149 149 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 150 150 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 151 151 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 152 152 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 153 153 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 154 154 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 155 155 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 156 156 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 157 157 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 158 158 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 159 159 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 160 160 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 161 161 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 162 162 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 163 163 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 164 164 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 165 165 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 166 166 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 167 167 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 168 168 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 169 169 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 170 170 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 171 171 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 172 172 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 173 173 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 174 174 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 175 175 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 176 176 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 177 177 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 178 178 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 179 179 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 180 180 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 181 181 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 182 182 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 183 183 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 184 184 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 185 185 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 186 186 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 187 187 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 188 188 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 189 189 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 190 190 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 191 191 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 192 192 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 193 193 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 194 194 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 195 195 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 196 196 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 197 197 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 198 198 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 199 199 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 200 200 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 201 201 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 202 202 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 203 203 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 204 204 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 205 205 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 206 206 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 207 207 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 208 208 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 209 209 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 210 210 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 211 211 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 212 212 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 213 213 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 214 214 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 215 215 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 216 216 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 217 217 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 218 218 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 219 219 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 220 220 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 221 221 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 222 222 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 223 223 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 224 224 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 225 225 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 226 226 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 227 227 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 228 228 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 229 229 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 230 230 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 231 231 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 232 232 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 233 233 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 234 234 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 235 235 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 236 236 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 237 237 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 238 238 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 239 239 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 240 240 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 241 241 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 242 242 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 243 243 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000028 . region 244 244 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000028 . region 245 245 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000028 . region 246 246 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000028 . region 247 247 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000028 . region 248 248 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000028 . region 249 249 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000028 . region 250 250 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000029 . region 1 1 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000029 . region 2 2 0.00 + . cov2=32.000,0.000;gaps=0,0;cov=32,32,32;cQv=93,93,93;
+ref000029 . region 3 3 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000029 . region 4 4 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000029 . region 5 5 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 6 6 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 7 7 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 8 8 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 9 9 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 10 10 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 11 11 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 12 12 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 13 13 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 14 14 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 15 15 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 16 16 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 17 17 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 18 18 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 19 19 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 20 20 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 21 21 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 22 22 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 23 23 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 24 24 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 25 25 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 26 26 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 27 27 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 28 28 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 29 29 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 30 30 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 31 31 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 32 32 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 33 33 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 34 34 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 35 35 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 36 36 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 37 37 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 38 38 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 39 39 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 40 40 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 41 41 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 42 42 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 43 43 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 44 44 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 45 45 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 46 46 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 47 47 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 48 48 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 49 49 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 50 50 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 51 51 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 52 52 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 53 53 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 54 54 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 55 55 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 56 56 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 57 57 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 58 58 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 59 59 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 60 60 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 61 61 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 62 62 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 63 63 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 64 64 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 65 65 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 66 66 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 67 67 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 68 68 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 69 69 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000029 . region 70 70 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 71 71 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 72 72 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 73 73 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 74 74 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 75 75 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 76 76 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 77 77 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 78 78 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 79 79 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 80 80 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 81 81 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 82 82 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 83 83 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 84 84 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 85 85 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 86 86 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 87 87 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 88 88 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 89 89 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 90 90 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 91 91 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 92 92 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 93 93 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 94 94 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 95 95 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 96 96 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 97 97 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 98 98 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 99 99 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 100 100 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 101 101 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 102 102 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 103 103 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 104 104 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 105 105 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 106 106 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 107 107 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 108 108 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 109 109 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 110 110 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 111 111 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 112 112 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 113 113 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 114 114 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 115 115 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 116 116 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 117 117 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 118 118 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 119 119 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 120 120 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 121 121 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 122 122 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 123 123 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 124 124 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 125 125 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 126 126 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 127 127 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 128 128 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 129 129 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 130 130 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 131 131 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 132 132 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 133 133 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 134 134 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 135 135 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 136 136 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 137 137 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 138 138 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 139 139 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 140 140 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 141 141 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 142 142 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 143 143 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 144 144 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 145 145 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 146 146 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 147 147 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 148 148 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 149 149 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 150 150 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 151 151 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 152 152 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 153 153 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 154 154 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 155 155 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 156 156 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 157 157 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 158 158 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 159 159 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 160 160 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 161 161 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 162 162 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 163 163 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 164 164 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 165 165 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 166 166 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 167 167 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 168 168 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 169 169 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 170 170 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 171 171 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 172 172 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 173 173 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 174 174 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 175 175 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 176 176 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 177 177 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 178 178 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 179 179 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 180 180 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 181 181 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 182 182 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 183 183 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 184 184 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 185 185 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 186 186 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 187 187 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 188 188 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 189 189 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 190 190 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 191 191 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 192 192 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 193 193 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 194 194 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 195 195 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 196 196 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 197 197 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 198 198 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 199 199 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 200 200 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 201 201 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 202 202 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 203 203 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 204 204 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 205 205 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 206 206 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 207 207 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 208 208 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 209 209 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 210 210 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 211 211 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 212 212 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 213 213 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 214 214 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 215 215 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 216 216 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 217 217 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 218 218 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 219 219 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 220 220 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 221 221 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 222 222 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 223 223 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 224 224 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 225 225 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 226 226 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 227 227 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 228 228 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 229 229 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 230 230 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 231 231 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 232 232 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 233 233 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 234 234 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 235 235 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 236 236 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 237 237 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 238 238 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 239 239 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 240 240 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 241 241 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 242 242 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000029 . region 243 243 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 244 244 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 245 245 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 246 246 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 247 247 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 248 248 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 249 249 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 250 250 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 251 251 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 252 252 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 253 253 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 254 254 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 255 255 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 256 256 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 257 257 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 258 258 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 259 259 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 260 260 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 261 261 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 262 262 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 263 263 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 264 264 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 265 265 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000029 . region 266 266 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 267 267 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 268 268 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 269 269 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 270 270 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 271 271 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000029 . region 272 272 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 273 273 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 274 274 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 275 275 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 276 276 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 277 277 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 278 278 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 279 279 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 280 280 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 281 281 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 282 282 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 283 283 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 284 284 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 285 285 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 286 286 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 287 287 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 288 288 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 289 289 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 290 290 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 291 291 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 292 292 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 293 293 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 294 294 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 295 295 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 296 296 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 297 297 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 298 298 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 299 299 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 300 300 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 301 301 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 302 302 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 303 303 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 304 304 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 305 305 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 306 306 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 307 307 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 308 308 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000029 . region 309 309 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000029 . region 310 310 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000030 . region 1 1 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 2 2 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 3 3 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 4 4 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 5 5 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 6 6 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 7 7 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=3,3,3;
+ref000030 . region 8 8 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 9 9 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 10 10 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 11 11 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 12 12 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 13 13 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 14 14 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 15 15 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 16 16 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 17 17 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000030 . region 18 18 0.00 + . cov2=10.000,0.000;gaps=0,0;cov=10,10,10;cQv=75,75,75;
+ref000030 . region 19 19 0.00 + . cov2=10.000,0.000;gaps=0,0;cov=10,10,10;cQv=75,75,75;
+ref000030 . region 20 20 0.00 + . cov2=10.000,0.000;gaps=0,0;cov=10,10,10;cQv=60,60,60;
+ref000030 . region 21 21 0.00 + . cov2=11.000,0.000;gaps=0,0;cov=11,11,11;cQv=67,67,67;
+ref000030 . region 22 22 0.00 + . cov2=11.000,0.000;gaps=0,0;cov=11,11,11;cQv=8,8,8;
+ref000030 . region 23 23 0.00 + . cov2=11.000,0.000;gaps=0,0;cov=11,11,11;cQv=23,23,23;
+ref000030 . region 24 24 0.00 + . cov2=11.000,0.000;gaps=0,0;cov=11,11,11;cQv=44,44,44;
+ref000030 . region 25 25 0.00 + . cov2=11.000,0.000;gaps=0,0;cov=11,11,11;cQv=44,44,44;
+ref000030 . region 26 26 0.00 + . cov2=11.000,0.000;gaps=0,0;cov=11,11,11;cQv=30,30,30;
+ref000030 . region 27 27 0.00 + . cov2=11.000,0.000;gaps=0,0;cov=11,11,11;cQv=83,83,83;
+ref000030 . region 28 28 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 29 29 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 30 30 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 31 31 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 32 32 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 33 33 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 34 34 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=60,60,60;
+ref000030 . region 35 35 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=60,60,60;
+ref000030 . region 36 36 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 37 37 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 38 38 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 39 39 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 40 40 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 41 41 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 42 42 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 43 43 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 44 44 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 45 45 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=60,60,60;
+ref000030 . region 46 46 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 47 47 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=60,60,60;
+ref000030 . region 48 48 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=60,60,60;
+ref000030 . region 49 49 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 50 50 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 51 51 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 52 52 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 53 53 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 54 54 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 55 55 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 56 56 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=64,64,64;
+ref000030 . region 57 57 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 58 58 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 59 59 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 60 60 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 61 61 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 62 62 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 63 63 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 64 64 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 65 65 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 66 66 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 67 67 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 68 68 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 69 69 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 70 70 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 71 71 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 72 72 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000030 . region 73 73 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=45,45,45;
+ref000030 . region 74 74 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=60,60,60;
+ref000030 . region 75 75 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000030 . region 76 76 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=45,45,45;
+ref000030 . region 77 77 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000030 . region 78 78 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000030 . region 79 79 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000030 . region 80 80 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000030 . region 81 81 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000030 . region 82 82 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000030 . region 83 83 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=75,75,75;
+ref000030 . region 84 84 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000030 . region 85 85 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000030 . region 86 86 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000030 . region 87 87 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000030 . region 88 88 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000030 . region 89 89 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000030 . region 90 90 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000030 . region 91 91 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000030 . region 92 92 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=8,8,8;
+ref000030 . region 93 93 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 94 94 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 95 95 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 96 96 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 97 97 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 98 98 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 99 99 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 100 100 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 101 101 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 102 102 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 103 103 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 104 104 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 105 105 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 106 106 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 107 107 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 108 108 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 109 109 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 110 110 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 111 111 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 112 112 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 113 113 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 114 114 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 115 115 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 116 116 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 117 117 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 118 118 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 119 119 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 120 120 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 121 121 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 122 122 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 123 123 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 124 124 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 125 125 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 126 126 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 127 127 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 128 128 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 129 129 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 130 130 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 131 131 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 132 132 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 133 133 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 134 134 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 135 135 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 136 136 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 137 137 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 138 138 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 139 139 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 140 140 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 141 141 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 142 142 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 143 143 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 144 144 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 145 145 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 146 146 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 147 147 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 148 148 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 149 149 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 150 150 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 151 151 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 152 152 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 153 153 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 154 154 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 155 155 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 156 156 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 157 157 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 158 158 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 159 159 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 160 160 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 161 161 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 162 162 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 163 163 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 164 164 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 165 165 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 166 166 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 167 167 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 168 168 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 169 169 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 170 170 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 171 171 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 172 172 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 173 173 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 174 174 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 175 175 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 176 176 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 177 177 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 178 178 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 179 179 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 180 180 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 181 181 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 182 182 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 183 183 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 184 184 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 185 185 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 186 186 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 187 187 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 188 188 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 189 189 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 190 190 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 191 191 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 192 192 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 193 193 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 194 194 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 195 195 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 196 196 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 197 197 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 198 198 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 199 199 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 200 200 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 201 201 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 202 202 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 203 203 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 204 204 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 205 205 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 206 206 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 207 207 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 208 208 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 209 209 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 210 210 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 211 211 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 212 212 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 213 213 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 214 214 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 215 215 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 216 216 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 217 217 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 218 218 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 219 219 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 220 220 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 221 221 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 222 222 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000030 . region 223 223 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000030 . region 224 224 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000030 . region 225 225 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 226 226 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 227 227 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 228 228 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 229 229 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 230 230 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 231 231 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 232 232 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 233 233 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000030 . region 234 234 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000030 . region 235 235 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000030 . region 236 236 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000030 . region 237 237 0.00 + . cov2=51.000,0.000;gaps=0,0;cov=51,51,51;cQv=93,93,93;
+ref000030 . region 238 238 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 239 239 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 240 240 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 241 241 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 242 242 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 243 243 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 244 244 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 245 245 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 246 246 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 247 247 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 248 248 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 249 249 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 250 250 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 251 251 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 252 252 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 253 253 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 254 254 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 255 255 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 256 256 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 257 257 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 258 258 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 259 259 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 260 260 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 261 261 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 262 262 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 263 263 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 264 264 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 265 265 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 266 266 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 267 267 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 268 268 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 269 269 0.00 + . cov2=50.000,0.000;gaps=0,0;cov=50,50,50;cQv=93,93,93;
+ref000030 . region 270 270 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 271 271 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 272 272 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 273 273 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 274 274 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 275 275 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 276 276 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 277 277 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 278 278 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 279 279 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 280 280 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 281 281 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 282 282 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 283 283 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 284 284 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 285 285 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 286 286 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 287 287 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 288 288 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 289 289 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 290 290 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 291 291 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 292 292 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 293 293 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 294 294 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 295 295 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 296 296 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 297 297 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 298 298 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 299 299 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 300 300 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 301 301 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000030 . region 302 302 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000030 . region 303 303 0.00 + . cov2=48.000,0.000;gaps=0,0;cov=48,48,48;cQv=93,93,93;
+ref000030 . region 304 304 0.00 + . cov2=47.000,0.000;gaps=0,0;cov=47,47,47;cQv=93,93,93;
+ref000031 . region 1 1 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000031 . region 2 2 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000031 . region 3 3 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 4 4 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 5 5 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 6 6 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 7 7 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 8 8 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 9 9 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 10 10 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 11 11 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 12 12 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 13 13 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 14 14 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 15 15 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 16 16 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 17 17 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 18 18 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 19 19 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 20 20 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 21 21 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 22 22 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 23 23 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 24 24 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 25 25 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 26 26 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 27 27 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 28 28 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 29 29 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 30 30 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 31 31 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 32 32 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 33 33 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 34 34 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 35 35 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 36 36 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 37 37 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 38 38 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 39 39 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 40 40 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 41 41 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 42 42 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 43 43 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 44 44 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 45 45 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 46 46 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 47 47 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 48 48 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 49 49 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 50 50 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 51 51 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 52 52 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 53 53 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 54 54 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 55 55 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 56 56 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 57 57 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 58 58 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 59 59 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 60 60 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 61 61 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 62 62 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 63 63 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 64 64 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 65 65 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 66 66 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 67 67 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 68 68 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 69 69 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 70 70 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 71 71 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 72 72 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 73 73 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 74 74 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 75 75 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 76 76 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 77 77 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 78 78 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 79 79 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 80 80 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 81 81 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 82 82 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 83 83 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 84 84 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 85 85 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 86 86 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 87 87 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 88 88 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 89 89 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 90 90 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 91 91 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 92 92 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 93 93 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 94 94 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 95 95 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 96 96 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 97 97 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 98 98 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 99 99 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 100 100 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 101 101 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 102 102 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 103 103 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 104 104 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 105 105 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 106 106 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 107 107 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 108 108 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 109 109 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 110 110 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 111 111 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 112 112 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 113 113 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 114 114 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 115 115 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 116 116 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000031 . region 117 117 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000031 . region 118 118 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000031 . region 119 119 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000031 . region 120 120 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000031 . region 121 121 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000031 . region 122 122 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000031 . region 123 123 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000031 . region 124 124 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 125 125 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 126 126 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 127 127 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 128 128 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 129 129 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 130 130 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 131 131 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 132 132 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 133 133 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 134 134 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 135 135 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 136 136 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 137 137 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 138 138 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 139 139 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 140 140 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 141 141 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 142 142 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 143 143 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 144 144 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 145 145 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000031 . region 146 146 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 147 147 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 148 148 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 149 149 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000031 . region 150 150 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 151 151 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 152 152 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 153 153 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 154 154 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 155 155 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 156 156 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 157 157 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 158 158 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000031 . region 159 159 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 160 160 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 161 161 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 162 162 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 163 163 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 164 164 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 165 165 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 166 166 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 167 167 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 168 168 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 169 169 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 170 170 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 171 171 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 172 172 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 173 173 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 174 174 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 175 175 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 176 176 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 177 177 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 178 178 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 179 179 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 180 180 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 181 181 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 182 182 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 183 183 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 184 184 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 185 185 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 186 186 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 187 187 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 188 188 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 189 189 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 190 190 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 191 191 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 192 192 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 193 193 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 194 194 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 195 195 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 196 196 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 197 197 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 198 198 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 199 199 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 200 200 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 201 201 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 202 202 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 203 203 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 204 204 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 205 205 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 206 206 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 207 207 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 208 208 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 209 209 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 210 210 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 211 211 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 212 212 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 213 213 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 214 214 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 215 215 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 216 216 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 217 217 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 218 218 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 219 219 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 220 220 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 221 221 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 222 222 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 223 223 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 224 224 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 225 225 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 226 226 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 227 227 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 228 228 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 229 229 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 230 230 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 231 231 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 232 232 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 233 233 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 234 234 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 235 235 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 236 236 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 237 237 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 238 238 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 239 239 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 240 240 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 241 241 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 242 242 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 243 243 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 244 244 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 245 245 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 246 246 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 247 247 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 248 248 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 249 249 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 250 250 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 251 251 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 252 252 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 253 253 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 254 254 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 255 255 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 256 256 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 257 257 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 258 258 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 259 259 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 260 260 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 261 261 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 262 262 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 263 263 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 264 264 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 265 265 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 266 266 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 267 267 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 268 268 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 269 269 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 270 270 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 271 271 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 272 272 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 273 273 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 274 274 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000031 . region 275 275 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000031 . region 276 276 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000031 . region 277 277 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000031 . region 278 278 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000031 . region 279 279 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000031 . region 280 280 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000032 . region 1 1 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 2 2 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 3 3 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 4 4 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 5 5 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 6 6 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 7 7 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 8 8 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 9 9 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 10 10 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 11 11 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 12 12 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 13 13 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 14 14 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 15 15 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 16 16 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 17 17 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 18 18 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 19 19 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 20 20 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 21 21 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 22 22 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 23 23 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 24 24 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 25 25 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 26 26 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 27 27 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 28 28 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 29 29 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 30 30 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 31 31 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 32 32 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 33 33 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 34 34 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 35 35 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 36 36 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 37 37 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 38 38 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 39 39 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 40 40 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 41 41 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 42 42 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 43 43 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 44 44 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 45 45 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 46 46 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 47 47 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 48 48 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 49 49 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 50 50 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 51 51 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 52 52 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 53 53 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 54 54 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 55 55 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 56 56 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 57 57 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 58 58 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 59 59 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 60 60 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 61 61 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 62 62 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 63 63 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 64 64 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 65 65 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 66 66 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 67 67 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 68 68 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 69 69 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 70 70 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 71 71 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 72 72 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 73 73 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 74 74 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 75 75 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 76 76 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 77 77 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 78 78 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 79 79 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 80 80 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 81 81 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 82 82 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 83 83 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 84 84 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 85 85 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 86 86 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 87 87 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 88 88 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 89 89 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 90 90 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 91 91 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 92 92 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 93 93 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 94 94 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 95 95 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 96 96 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 97 97 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 98 98 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 99 99 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 100 100 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 101 101 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 102 102 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 103 103 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 104 104 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 105 105 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 106 106 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 107 107 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 108 108 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 109 109 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 110 110 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 111 111 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 112 112 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 113 113 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 114 114 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 115 115 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 116 116 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 117 117 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 118 118 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 119 119 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 120 120 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 121 121 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 122 122 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 123 123 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 124 124 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 125 125 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 126 126 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 127 127 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 128 128 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 129 129 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 130 130 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 131 131 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000032 . region 132 132 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 133 133 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 134 134 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 135 135 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 136 136 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 137 137 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 138 138 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 139 139 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 140 140 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 141 141 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 142 142 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 143 143 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 144 144 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 145 145 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 146 146 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 147 147 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 148 148 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 149 149 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 150 150 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 151 151 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 152 152 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 153 153 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 154 154 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000032 . region 155 155 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 156 156 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 157 157 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 158 158 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 159 159 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 160 160 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 161 161 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 162 162 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 163 163 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 164 164 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 165 165 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 166 166 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 167 167 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 168 168 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 169 169 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 170 170 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 171 171 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 172 172 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 173 173 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 174 174 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 175 175 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 176 176 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 177 177 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 178 178 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 179 179 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 180 180 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 181 181 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 182 182 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 183 183 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 184 184 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 185 185 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 186 186 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 187 187 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 188 188 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 189 189 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 190 190 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 191 191 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 192 192 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 193 193 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 194 194 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 195 195 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 196 196 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 197 197 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 198 198 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 199 199 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 200 200 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 201 201 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 202 202 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 203 203 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 204 204 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 205 205 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 206 206 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 207 207 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 208 208 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 209 209 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000032 . region 210 210 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000032 . region 211 211 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000032 . region 212 212 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000033 . region 1 1 0.00 + . cov2=81.000,0.000;gaps=0,0;cov=81,81,81;cQv=93,93,93;
+ref000033 . region 2 2 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000033 . region 3 3 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000033 . region 4 4 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000033 . region 5 5 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 6 6 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 7 7 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 8 8 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 9 9 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 10 10 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 11 11 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 12 12 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 13 13 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 14 14 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 15 15 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 16 16 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 17 17 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 18 18 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 19 19 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 20 20 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 21 21 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 22 22 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 23 23 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 24 24 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 25 25 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 26 26 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 27 27 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 28 28 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 29 29 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 30 30 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 31 31 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 32 32 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 33 33 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 34 34 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 35 35 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 36 36 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 37 37 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 38 38 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 39 39 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 40 40 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 41 41 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 42 42 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 43 43 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 44 44 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 45 45 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 46 46 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 47 47 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 48 48 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 49 49 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 50 50 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 51 51 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 52 52 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 53 53 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 54 54 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 55 55 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 56 56 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 57 57 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000033 . region 58 58 0.00 + . cov2=86.000,0.000;gaps=0,0;cov=86,86,86;cQv=93,93,93;
+ref000033 . region 59 59 0.00 + . cov2=86.000,0.000;gaps=0,0;cov=86,86,86;cQv=93,93,93;
+ref000033 . region 60 60 0.00 + . cov2=86.000,0.000;gaps=0,0;cov=86,86,86;cQv=93,93,93;
+ref000033 . region 61 61 0.00 + . cov2=86.000,0.000;gaps=0,0;cov=86,86,86;cQv=93,93,93;
+ref000033 . region 62 62 0.00 + . cov2=86.000,0.000;gaps=0,0;cov=86,86,86;cQv=93,93,93;
+ref000033 . region 63 63 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 64 64 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 65 65 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 66 66 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 67 67 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 68 68 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 69 69 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 70 70 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 71 71 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 72 72 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 73 73 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 74 74 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000033 . region 75 75 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000033 . region 76 76 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000033 . region 77 77 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000033 . region 78 78 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000033 . region 79 79 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000033 . region 80 80 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000033 . region 81 81 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000033 . region 82 82 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000033 . region 83 83 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000033 . region 84 84 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000033 . region 85 85 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000033 . region 86 86 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000033 . region 87 87 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000033 . region 88 88 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000033 . region 89 89 0.00 + . cov2=81.000,0.000;gaps=0,0;cov=81,81,81;cQv=93,93,93;
+ref000033 . region 90 90 0.00 + . cov2=81.000,0.000;gaps=0,0;cov=81,81,81;cQv=93,93,93;
+ref000033 . region 91 91 0.00 + . cov2=81.000,0.000;gaps=0,0;cov=81,81,81;cQv=93,93,93;
+ref000033 . region 92 92 0.00 + . cov2=81.000,0.000;gaps=0,0;cov=81,81,81;cQv=93,93,93;
+ref000033 . region 93 93 0.00 + . cov2=81.000,0.000;gaps=0,0;cov=81,81,81;cQv=93,93,93;
+ref000033 . region 94 94 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 95 95 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 96 96 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 97 97 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 98 98 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 99 99 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 100 100 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 101 101 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 102 102 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 103 103 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 104 104 0.00 + . cov2=81.000,0.000;gaps=0,0;cov=81,81,81;cQv=93,93,93;
+ref000033 . region 105 105 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 106 106 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 107 107 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 108 108 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 109 109 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000033 . region 110 110 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000033 . region 111 111 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000033 . region 112 112 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000033 . region 113 113 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000033 . region 114 114 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000033 . region 115 115 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000033 . region 116 116 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000033 . region 117 117 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000033 . region 118 118 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000033 . region 119 119 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 120 120 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 121 121 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 122 122 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 123 123 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 124 124 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 125 125 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 126 126 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 127 127 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 128 128 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 129 129 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 130 130 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 131 131 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000033 . region 132 132 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000033 . region 133 133 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000033 . region 134 134 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000033 . region 135 135 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000033 . region 136 136 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000033 . region 137 137 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000033 . region 138 138 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000033 . region 139 139 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000033 . region 140 140 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000033 . region 141 141 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000033 . region 142 142 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000033 . region 143 143 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 144 144 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 145 145 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 146 146 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 147 147 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 148 148 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 149 149 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 150 150 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 151 151 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 152 152 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 153 153 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 154 154 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000033 . region 155 155 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 156 156 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 157 157 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 158 158 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 159 159 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 160 160 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 161 161 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 162 162 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 163 163 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 164 164 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 165 165 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 166 166 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000033 . region 167 167 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 168 168 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 169 169 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 170 170 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 171 171 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 172 172 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 173 173 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 174 174 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 175 175 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 176 176 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 177 177 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 178 178 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 179 179 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 180 180 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 181 181 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 182 182 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 183 183 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 184 184 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 185 185 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 186 186 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 187 187 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 188 188 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 189 189 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 190 190 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000033 . region 191 191 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 192 192 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 193 193 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 194 194 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 195 195 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 196 196 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 197 197 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 198 198 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 199 199 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 200 200 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 201 201 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 202 202 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 203 203 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 204 204 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 205 205 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 206 206 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 207 207 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 208 208 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 209 209 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 210 210 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 211 211 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 212 212 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 213 213 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 214 214 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 215 215 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 216 216 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 217 217 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 218 218 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 219 219 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 220 220 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 221 221 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 222 222 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 223 223 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000033 . region 224 224 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000033 . region 225 225 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000033 . region 226 226 0.00 + . cov2=54.000,0.000;gaps=0,0;cov=54,54,54;cQv=93,93,93;
+ref000034 . region 1 1 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000034 . region 2 2 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000034 . region 3 3 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000034 . region 4 4 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000034 . region 5 5 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 6 6 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 7 7 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 8 8 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 9 9 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 10 10 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 11 11 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 12 12 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 13 13 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 14 14 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 15 15 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 16 16 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 17 17 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 18 18 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 19 19 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 20 20 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 21 21 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 22 22 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 23 23 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 24 24 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 25 25 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 26 26 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 27 27 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 28 28 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 29 29 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 30 30 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 31 31 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 32 32 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 33 33 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 34 34 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 35 35 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 36 36 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 37 37 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 38 38 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 39 39 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 40 40 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 41 41 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 42 42 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 43 43 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 44 44 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 45 45 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 46 46 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 47 47 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 48 48 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 49 49 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 50 50 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 51 51 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 52 52 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 53 53 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 54 54 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 55 55 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 56 56 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 57 57 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 58 58 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 59 59 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 60 60 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 61 61 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 62 62 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 63 63 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 64 64 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 65 65 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 66 66 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 67 67 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 68 68 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 69 69 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 70 70 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 71 71 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 72 72 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 73 73 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 74 74 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 75 75 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 76 76 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 77 77 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 78 78 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 79 79 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 80 80 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 81 81 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 82 82 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 83 83 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 84 84 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 85 85 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 86 86 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 87 87 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 88 88 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 89 89 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 90 90 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 91 91 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 92 92 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 93 93 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 94 94 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 95 95 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 96 96 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 97 97 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 98 98 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 99 99 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 100 100 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 101 101 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 102 102 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 103 103 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 104 104 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 105 105 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 106 106 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 107 107 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 108 108 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 109 109 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 110 110 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 111 111 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 112 112 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 113 113 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 114 114 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 115 115 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000034 . region 116 116 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 117 117 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 118 118 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 119 119 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 120 120 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 121 121 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 122 122 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 123 123 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 124 124 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 125 125 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 126 126 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 127 127 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 128 128 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 129 129 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 130 130 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 131 131 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 132 132 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 133 133 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 134 134 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 135 135 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 136 136 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 137 137 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 138 138 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 139 139 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 140 140 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 141 141 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 142 142 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 143 143 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 144 144 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 145 145 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 146 146 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 147 147 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 148 148 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 149 149 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 150 150 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 151 151 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 152 152 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 153 153 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 154 154 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 155 155 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 156 156 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 157 157 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 158 158 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 159 159 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 160 160 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 161 161 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 162 162 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 163 163 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 164 164 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 165 165 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 166 166 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 167 167 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 168 168 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 169 169 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 170 170 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 171 171 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 172 172 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 173 173 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 174 174 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 175 175 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 176 176 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 177 177 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 178 178 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 179 179 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 180 180 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000034 . region 181 181 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 182 182 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 183 183 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 184 184 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 185 185 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 186 186 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 187 187 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 188 188 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 189 189 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 190 190 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 191 191 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 192 192 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 193 193 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 194 194 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 195 195 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 196 196 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 197 197 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 198 198 0.00 + . cov2=37.000,0.000;gaps=0,0;cov=37,37,37;cQv=93,93,93;
+ref000034 . region 199 199 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000034 . region 200 200 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000035 . region 1 1 0.00 + . cov2=3.000,0.000;gaps=0,0;cov=3,3,3;cQv=23,23,23;
+ref000035 . region 2 2 0.00 + . cov2=3.000,0.000;gaps=0,0;cov=3,3,3;cQv=23,23,23;
+ref000035 . region 3 3 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 4 4 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 5 5 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 6 6 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 7 7 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 8 8 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 9 9 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 10 10 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 11 11 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 12 12 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 13 13 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 14 14 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 15 15 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=34,34,34;
+ref000035 . region 16 16 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=34,34,34;
+ref000035 . region 17 17 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 18 18 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 19 19 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 20 20 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 21 21 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 22 22 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 23 23 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 24 24 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 25 25 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 26 26 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 27 27 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 28 28 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 29 29 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 30 30 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 31 31 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 32 32 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 33 33 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=30,30,30;
+ref000035 . region 34 34 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 35 35 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=30,30,30;
+ref000035 . region 36 36 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 37 37 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 38 38 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 39 39 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=30,30,30;
+ref000035 . region 40 40 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 41 41 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 42 42 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 43 43 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 44 44 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=30,30,30;
+ref000035 . region 45 45 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 46 46 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 47 47 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=30,30,30;
+ref000035 . region 48 48 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 49 49 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 50 50 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 51 51 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 52 52 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 53 53 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 54 54 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 55 55 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 56 56 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 57 57 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 58 58 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 59 59 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 60 60 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 61 61 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 62 62 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 63 63 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 64 64 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 65 65 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 66 66 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 67 67 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 68 68 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 69 69 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 70 70 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 71 71 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 72 72 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 73 73 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 74 74 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=30,30,30;
+ref000035 . region 75 75 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 76 76 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 77 77 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 78 78 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=30,30,30;
+ref000035 . region 79 79 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 80 80 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 81 81 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 82 82 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 83 83 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 84 84 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 85 85 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 86 86 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 87 87 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 88 88 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 89 89 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 90 90 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=34,34,34;
+ref000035 . region 91 91 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=30,30,30;
+ref000035 . region 92 92 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 93 93 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 94 94 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 95 95 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 96 96 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 97 97 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 98 98 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 99 99 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 100 100 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 101 101 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 102 102 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 103 103 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 104 104 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 105 105 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 106 106 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 107 107 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 108 108 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 109 109 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 110 110 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 111 111 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=44,44,44;
+ref000035 . region 112 112 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 113 113 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 114 114 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=15,15,15;
+ref000035 . region 115 115 0.00 + . cov2=8.000,0.000;gaps=0,0;cov=8,8,8;cQv=60,60,60;
+ref000035 . region 116 116 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=37,37,37;
+ref000035 . region 117 117 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=53,53,53;
+ref000035 . region 118 118 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=53,53,53;
+ref000035 . region 119 119 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=53,53,53;
+ref000035 . region 120 120 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=22,22,22;
+ref000035 . region 121 121 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=37,37,37;
+ref000035 . region 122 122 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=22,22,22;
+ref000035 . region 123 123 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=53,53,53;
+ref000035 . region 124 124 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=53,53,53;
+ref000035 . region 125 125 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=53,53,53;
+ref000035 . region 126 126 0.00 + . cov2=7.000,0.000;gaps=0,0;cov=7,7,7;cQv=53,53,53;
+ref000035 . region 127 127 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 128 128 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=29,29,29;
+ref000035 . region 129 129 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 130 130 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 131 131 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 132 132 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 133 133 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 134 134 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 135 135 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 136 136 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 137 137 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 138 138 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 139 139 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 140 140 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 141 141 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 142 142 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 143 143 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 144 144 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 145 145 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 146 146 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 147 147 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 148 148 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 149 149 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 150 150 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 151 151 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 152 152 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 153 153 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 154 154 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 155 155 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 156 156 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 157 157 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 158 158 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=29,29,29;
+ref000035 . region 159 159 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=29,29,29;
+ref000035 . region 160 160 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 161 161 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 162 162 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 163 163 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 164 164 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 165 165 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 166 166 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 167 167 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 168 168 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 169 169 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 170 170 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=29,29,29;
+ref000035 . region 171 171 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 172 172 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 173 173 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 174 174 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 175 175 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 176 176 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000035 . region 177 177 0.00 + . cov2=6.000,0.000;gaps=0,0;cov=6,6,6;cQv=45,45,45;
+ref000036 . region 1 1 0.00 + . cov2=10.000,0.000;gaps=0,0;cov=10,10,10;cQv=75,75,75;
+ref000036 . region 2 2 0.00 + . cov2=10.000,0.000;gaps=0,0;cov=10,10,10;cQv=75,75,75;
+ref000036 . region 3 3 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 4 4 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 5 5 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 6 6 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 7 7 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=83,83,83;
+ref000036 . region 8 8 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 9 9 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 10 10 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 11 11 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 12 12 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 13 13 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 14 14 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 15 15 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 16 16 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=83,83,83;
+ref000036 . region 17 17 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 18 18 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 19 19 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 20 20 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 21 21 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 22 22 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 23 23 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 24 24 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 25 25 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 26 26 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 27 27 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 28 28 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 29 29 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 30 30 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 31 31 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 32 32 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 33 33 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 34 34 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 35 35 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 36 36 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 37 37 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 38 38 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 39 39 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 40 40 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 41 41 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 42 42 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 43 43 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 44 44 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 45 45 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 46 46 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 47 47 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 48 48 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 49 49 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 50 50 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 51 51 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 52 52 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 53 53 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 54 54 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 55 55 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 56 56 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 57 57 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 58 58 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 59 59 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 60 60 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 61 61 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 62 62 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 63 63 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 64 64 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 65 65 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 66 66 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 67 67 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 68 68 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 69 69 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 70 70 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 71 71 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 72 72 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 73 73 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 74 74 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 75 75 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 76 76 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 77 77 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 78 78 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 79 79 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 80 80 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 81 81 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 82 82 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 83 83 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 84 84 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 85 85 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 86 86 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 87 87 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 88 88 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 89 89 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 90 90 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 91 91 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 92 92 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 93 93 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 94 94 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 95 95 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 96 96 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 97 97 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 98 98 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 99 99 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 100 100 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 101 101 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 102 102 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 103 103 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 104 104 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 105 105 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 106 106 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 107 107 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 108 108 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 109 109 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 110 110 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 111 111 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 112 112 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 113 113 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=75,75,75;
+ref000036 . region 114 114 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 115 115 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 116 116 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 117 117 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 118 118 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 119 119 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 120 120 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 121 121 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 122 122 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 123 123 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 124 124 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 125 125 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 126 126 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 127 127 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000036 . region 128 128 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 129 129 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 130 130 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 131 131 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 132 132 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 133 133 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 134 134 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 135 135 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=45,45,45;
+ref000036 . region 136 136 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 137 137 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 138 138 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 139 139 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 140 140 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 141 141 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=90,90,90;
+ref000036 . region 142 142 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=90,90,90;
+ref000036 . region 143 143 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 144 144 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 145 145 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 146 146 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 147 147 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 148 148 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 149 149 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 150 150 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 151 151 0.00 + . cov2=20.000,0.000;gaps=0,0;cov=20,20,20;cQv=93,93,93;
+ref000036 . region 152 152 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 153 153 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 154 154 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 155 155 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 156 156 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=75,75,75;
+ref000036 . region 157 157 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=23,23,23;
+ref000036 . region 158 158 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 159 159 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 160 160 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 161 161 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=90,90,90;
+ref000036 . region 162 162 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 163 163 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 164 164 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 165 165 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 166 166 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 167 167 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 168 168 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 169 169 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 170 170 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 171 171 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 172 172 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 173 173 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 174 174 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 175 175 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 176 176 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 177 177 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=15,15,15;
+ref000036 . region 178 178 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 179 179 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 180 180 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=90,90,90;
+ref000036 . region 181 181 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 182 182 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 183 183 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 184 184 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 185 185 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 186 186 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 187 187 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 188 188 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 189 189 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 190 190 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 191 191 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 192 192 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 193 193 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 194 194 0.00 + . cov2=18.000,0.000;gaps=0,0;cov=18,18,18;cQv=93,93,93;
+ref000036 . region 195 195 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000036 . region 196 196 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000036 . region 197 197 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000036 . region 198 198 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000036 . region 199 199 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000036 . region 200 200 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000036 . region 201 201 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000037 . region 1 1 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 2 2 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 3 3 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 4 4 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 5 5 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 6 6 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 7 7 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 8 8 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 9 9 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 10 10 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 11 11 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 12 12 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 13 13 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 14 14 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 15 15 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 16 16 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 17 17 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 18 18 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 19 19 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 20 20 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 21 21 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 22 22 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 23 23 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 24 24 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 25 25 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 26 26 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 27 27 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 28 28 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 29 29 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 30 30 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 31 31 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 32 32 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 33 33 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 34 34 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 35 35 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 36 36 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 37 37 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 38 38 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 39 39 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 40 40 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 41 41 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 42 42 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 43 43 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 44 44 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 45 45 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 46 46 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 47 47 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 48 48 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 49 49 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 50 50 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 51 51 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 52 52 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 53 53 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 54 54 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 55 55 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 56 56 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 57 57 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 58 58 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 59 59 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 60 60 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 61 61 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 62 62 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 63 63 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 64 64 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 65 65 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 66 66 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 67 67 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 68 68 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 69 69 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 70 70 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 71 71 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 72 72 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 73 73 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 74 74 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 75 75 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 76 76 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 77 77 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 78 78 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 79 79 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 80 80 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 81 81 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 82 82 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 83 83 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 84 84 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 85 85 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 86 86 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 87 87 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 88 88 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 89 89 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 90 90 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 91 91 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 92 92 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 93 93 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 94 94 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 95 95 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 96 96 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 97 97 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 98 98 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 99 99 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 100 100 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 101 101 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 102 102 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 103 103 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 104 104 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 105 105 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 106 106 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 107 107 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 108 108 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 109 109 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 110 110 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 111 111 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 112 112 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 113 113 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 114 114 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 115 115 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 116 116 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 117 117 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 118 118 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 119 119 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 120 120 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 121 121 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 122 122 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 123 123 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 124 124 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 125 125 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 126 126 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 127 127 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 128 128 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 129 129 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 130 130 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 131 131 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 132 132 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 133 133 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 134 134 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 135 135 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 136 136 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 137 137 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 138 138 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 139 139 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 140 140 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 141 141 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 142 142 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 143 143 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 144 144 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 145 145 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 146 146 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 147 147 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 148 148 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 149 149 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 150 150 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 151 151 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 152 152 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 153 153 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 154 154 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 155 155 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 156 156 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 157 157 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 158 158 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 159 159 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 160 160 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 161 161 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 162 162 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 163 163 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 164 164 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 165 165 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 166 166 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 167 167 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 168 168 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 169 169 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 170 170 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 171 171 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 172 172 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 173 173 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 174 174 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 175 175 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 176 176 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 177 177 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 178 178 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 179 179 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 180 180 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 181 181 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 182 182 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 183 183 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 184 184 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 185 185 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 186 186 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 187 187 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 188 188 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 189 189 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 190 190 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 191 191 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 192 192 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 193 193 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 194 194 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 195 195 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 196 196 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 197 197 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 198 198 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 199 199 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 200 200 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 201 201 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 202 202 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 203 203 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 204 204 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 205 205 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 206 206 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 207 207 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 208 208 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 209 209 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 210 210 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 211 211 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 212 212 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 213 213 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 214 214 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 215 215 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 216 216 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 217 217 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 218 218 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 219 219 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 220 220 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 221 221 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 222 222 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 223 223 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 224 224 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 225 225 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 226 226 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 227 227 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 228 228 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 229 229 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 230 230 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 231 231 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 232 232 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 233 233 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 234 234 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 235 235 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 236 236 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 237 237 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 238 238 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 239 239 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 240 240 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 241 241 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 242 242 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 243 243 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 244 244 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 245 245 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 246 246 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 247 247 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 248 248 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 249 249 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 250 250 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 251 251 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 252 252 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 253 253 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 254 254 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 255 255 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 256 256 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 257 257 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 258 258 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 259 259 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 260 260 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 261 261 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 262 262 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 263 263 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 264 264 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 265 265 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 266 266 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 267 267 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 268 268 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 269 269 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 270 270 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 271 271 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 272 272 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 273 273 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 274 274 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 275 275 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 276 276 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 277 277 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 278 278 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 279 279 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 280 280 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 281 281 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 282 282 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 283 283 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 284 284 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 285 285 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 286 286 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 287 287 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 288 288 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 289 289 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 290 290 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 291 291 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 292 292 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 293 293 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 294 294 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000037 . region 295 295 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;
+ref000038 . region 1 1 0.00 + . cov2=2.000,0.000;gaps=0,0;cov=2,2,2;cQv=15,15,15;
+ref000038 . region 2 2 0.00 + . cov2=4.000,0.000;gaps=0,0;cov=4,4,4;cQv=30,30,30;
+ref000038 . region 3 3 0.00 + . cov2=4.000,0.000;gaps=0,0;cov=4,4,4;cQv=30,30,30;
+ref000038 . region 4 4 0.00 + . cov2=4.000,0.000;gaps=0,0;cov=4,4,4;cQv=30,30,30;
+ref000038 . region 5 5 0.00 + . cov2=4.000,0.000;gaps=0,0;cov=4,4,4;cQv=30,30,30;
+ref000038 . region 6 6 0.00 + . cov2=4.000,0.000;gaps=0,0;cov=4,4,4;cQv=15,15,15;
+ref000038 . region 7 7 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=22,22,22;
+ref000038 . region 8 8 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=22,22,22;
+ref000038 . region 9 9 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 10 10 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 11 11 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 12 12 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 13 13 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=22,22,22;
+ref000038 . region 14 14 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 15 15 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 16 16 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 17 17 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 18 18 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=22,22,22;
+ref000038 . region 19 19 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 20 20 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 21 21 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 22 22 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 23 23 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 24 24 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 25 25 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 26 26 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 27 27 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 28 28 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 29 29 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=22,22,22;
+ref000038 . region 30 30 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 31 31 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 32 32 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 33 33 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 34 34 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 35 35 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 36 36 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 37 37 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 38 38 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=22,22,22;
+ref000038 . region 39 39 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 40 40 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=22,22,22;
+ref000038 . region 41 41 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=22,22,22;
+ref000038 . region 42 42 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 43 43 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 44 44 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 45 45 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 46 46 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 47 47 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 48 48 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 49 49 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=8,8,8;
+ref000038 . region 50 50 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 51 51 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 52 52 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 53 53 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=8,8,8;
+ref000038 . region 54 54 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 55 55 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 56 56 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000038 . region 57 57 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=8,8,8;
+ref000038 . region 58 58 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=22,22,22;
+ref000038 . region 59 59 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000038 . region 60 60 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000038 . region 61 61 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000038 . region 62 62 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000038 . region 63 63 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000038 . region 64 64 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000038 . region 65 65 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000038 . region 66 66 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000038 . region 67 67 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000038 . region 68 68 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 69 69 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 70 70 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 71 71 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 72 72 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 73 73 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 74 74 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 75 75 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 76 76 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 77 77 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 78 78 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 79 79 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 80 80 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 81 81 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 82 82 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 83 83 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 84 84 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 85 85 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 86 86 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 87 87 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 88 88 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 89 89 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 90 90 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 91 91 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 92 92 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 93 93 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 94 94 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 95 95 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 96 96 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 97 97 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 98 98 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 99 99 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 100 100 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 101 101 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 102 102 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 103 103 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 104 104 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 105 105 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 106 106 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 107 107 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 108 108 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 109 109 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 110 110 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 111 111 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 112 112 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 113 113 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000038 . region 114 114 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 115 115 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 116 116 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 117 117 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 118 118 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 119 119 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 120 120 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 121 121 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 122 122 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 123 123 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 124 124 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 125 125 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 126 126 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 127 127 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 128 128 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 129 129 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 130 130 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 131 131 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 132 132 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 133 133 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 134 134 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 135 135 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 136 136 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 137 137 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 138 138 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 139 139 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 140 140 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 141 141 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 142 142 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 143 143 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 144 144 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 145 145 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 146 146 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 147 147 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 148 148 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 149 149 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 150 150 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 151 151 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 152 152 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 153 153 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 154 154 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 155 155 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 156 156 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 157 157 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 158 158 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 159 159 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 160 160 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 161 161 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 162 162 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 163 163 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 164 164 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 165 165 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 166 166 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 167 167 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 168 168 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 169 169 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 170 170 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 171 171 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 172 172 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 173 173 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 174 174 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 175 175 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 176 176 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 177 177 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 178 178 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 179 179 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 180 180 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 181 181 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 182 182 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 183 183 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 184 184 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 185 185 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 186 186 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 187 187 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 188 188 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 189 189 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 190 190 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 191 191 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 192 192 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 193 193 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 194 194 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 195 195 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 196 196 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 197 197 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 198 198 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 199 199 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 200 200 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 201 201 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 202 202 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 203 203 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 204 204 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 205 205 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 206 206 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 207 207 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 208 208 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 209 209 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 210 210 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000038 . region 211 211 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000038 . region 212 212 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000038 . region 213 213 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000038 . region 214 214 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000038 . region 215 215 0.00 + . cov2=27.000,0.000;gaps=0,0;cov=27,27,27;cQv=93,93,93;
+ref000038 . region 216 216 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000038 . region 217 217 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000038 . region 218 218 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000038 . region 219 219 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000038 . region 220 220 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000038 . region 221 221 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000038 . region 222 222 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000038 . region 223 223 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000038 . region 224 224 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000038 . region 225 225 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000038 . region 226 226 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 1 1 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 2 2 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 3 3 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 4 4 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 5 5 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 6 6 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 7 7 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 8 8 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 9 9 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 10 10 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 11 11 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 12 12 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 13 13 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 14 14 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 15 15 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 16 16 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 17 17 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 18 18 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 19 19 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 20 20 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 21 21 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 22 22 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 23 23 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 24 24 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 25 25 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 26 26 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 27 27 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 28 28 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 29 29 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 30 30 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 31 31 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 32 32 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 33 33 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 34 34 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 35 35 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 36 36 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 37 37 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 38 38 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 39 39 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 40 40 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 41 41 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 42 42 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 43 43 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 44 44 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 45 45 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 46 46 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 47 47 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 48 48 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 49 49 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 50 50 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 51 51 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 52 52 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 53 53 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 54 54 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 55 55 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 56 56 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 57 57 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 58 58 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 59 59 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 60 60 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 61 61 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 62 62 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 63 63 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 64 64 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 65 65 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 66 66 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 67 67 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 68 68 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 69 69 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 70 70 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 71 71 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 72 72 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 73 73 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 74 74 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 75 75 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 76 76 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 77 77 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 78 78 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 79 79 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 80 80 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 81 81 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 82 82 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 83 83 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 84 84 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 85 85 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 86 86 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 87 87 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 88 88 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 89 89 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 90 90 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 91 91 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 92 92 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 93 93 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 94 94 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 95 95 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 96 96 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 97 97 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 98 98 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 99 99 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 100 100 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 101 101 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 102 102 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 103 103 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 104 104 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 105 105 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 106 106 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 107 107 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 108 108 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 109 109 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 110 110 0.00 + . cov2=0.000,0.000;gaps=1,1;cov=0,0,0;cQv=0,0,0;
+ref000039 . region 111 111 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 112 112 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 113 113 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 114 114 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 115 115 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 116 116 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 117 117 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 118 118 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 119 119 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 120 120 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 121 121 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 122 122 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 123 123 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 124 124 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 125 125 0.00 + . cov2=1.000,0.000;gaps=0,0;cov=1,1,1;cQv=8,8,8;
+ref000039 . region 126 126 0.00 + . cov2=5.000,0.000;gaps=0,0;cov=5,5,5;cQv=38,38,38;
+ref000039 . region 127 127 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000039 . region 128 128 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000039 . region 129 129 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000039 . region 130 130 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000039 . region 131 131 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000039 . region 132 132 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 133 133 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 134 134 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=75,75,75;
+ref000039 . region 135 135 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 136 136 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=75,75,75;
+ref000039 . region 137 137 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 138 138 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 139 139 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 140 140 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 141 141 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 142 142 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 143 143 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=90,90,90;
+ref000039 . region 144 144 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=75,75,75;
+ref000039 . region 145 145 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=90,90,90;
+ref000039 . region 146 146 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 147 147 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=90,90,90;
+ref000039 . region 148 148 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=75,75,75;
+ref000039 . region 149 149 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 150 150 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 151 151 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 152 152 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 153 153 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 154 154 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 155 155 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 156 156 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 157 157 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 158 158 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 159 159 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 160 160 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 161 161 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=75,75,75;
+ref000039 . region 162 162 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 163 163 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 164 164 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 165 165 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 166 166 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 167 167 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=60,60,60;
+ref000039 . region 168 168 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 169 169 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 170 170 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 171 171 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 172 172 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=90,90,90;
+ref000039 . region 173 173 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 174 174 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 175 175 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 176 176 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 177 177 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 178 178 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 179 179 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 180 180 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 181 181 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 182 182 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 183 183 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 184 184 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 185 185 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 186 186 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 187 187 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 188 188 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=90,90,90;
+ref000039 . region 189 189 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 190 190 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 191 191 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 192 192 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 193 193 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 194 194 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 195 195 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 196 196 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 197 197 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 198 198 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 199 199 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 200 200 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 201 201 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 202 202 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 203 203 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 204 204 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 205 205 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 206 206 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 207 207 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 208 208 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=90,90,90;
+ref000039 . region 209 209 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 210 210 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 211 211 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 212 212 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 213 213 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 214 214 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=90,90,90;
+ref000039 . region 215 215 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=82,82,82;
+ref000039 . region 216 216 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=82,82,82;
+ref000039 . region 217 217 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 218 218 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=60,60,60;
+ref000039 . region 219 219 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 220 220 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 221 221 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 222 222 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=75,75,75;
+ref000039 . region 223 223 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=75,75,75;
+ref000039 . region 224 224 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 225 225 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=68,68,68;
+ref000039 . region 226 226 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 227 227 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 228 228 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 229 229 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 230 230 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 231 231 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 232 232 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 233 233 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 234 234 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 235 235 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 236 236 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 237 237 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 238 238 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 239 239 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 240 240 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 241 241 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 242 242 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 243 243 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 244 244 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=75,75,75;
+ref000039 . region 245 245 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 246 246 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 247 247 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 248 248 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 249 249 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 250 250 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 251 251 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 252 252 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 253 253 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 254 254 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 255 255 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 256 256 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 257 257 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 258 258 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 259 259 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 260 260 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 261 261 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 262 262 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 263 263 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=75,75,75;
+ref000039 . region 264 264 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 265 265 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 266 266 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 267 267 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 268 268 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 269 269 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 270 270 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 271 271 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 272 272 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 273 273 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 274 274 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 275 275 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 276 276 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 277 277 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 278 278 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 279 279 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 280 280 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 281 281 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 282 282 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 283 283 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 284 284 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 285 285 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 286 286 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 287 287 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 288 288 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 289 289 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 290 290 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 291 291 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 292 292 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 293 293 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 294 294 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 295 295 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 296 296 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 297 297 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 298 298 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 299 299 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 300 300 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 301 301 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 302 302 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 303 303 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=93,93,93;
+ref000039 . region 304 304 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000039 . region 305 305 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000039 . region 306 306 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000039 . region 307 307 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000039 . region 308 308 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000039 . region 309 309 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000039 . region 310 310 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000039 . region 311 311 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000040 . region 1 1 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000040 . region 2 2 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000040 . region 3 3 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000040 . region 4 4 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000040 . region 5 5 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000040 . region 6 6 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000040 . region 7 7 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000040 . region 8 8 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 9 9 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 10 10 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 11 11 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 12 12 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 13 13 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 14 14 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 15 15 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 16 16 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 17 17 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 18 18 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 19 19 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 20 20 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 21 21 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 22 22 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 23 23 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 24 24 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 25 25 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 26 26 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 27 27 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 28 28 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 29 29 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 30 30 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 31 31 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 32 32 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 33 33 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 34 34 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 35 35 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 36 36 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 37 37 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 38 38 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 39 39 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 40 40 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 41 41 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 42 42 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 43 43 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 44 44 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 45 45 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 46 46 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 47 47 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 48 48 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 49 49 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 50 50 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 51 51 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 52 52 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 53 53 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 54 54 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 55 55 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 56 56 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 57 57 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 58 58 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 59 59 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 60 60 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 61 61 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 62 62 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 63 63 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 64 64 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 65 65 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 66 66 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 67 67 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 68 68 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 69 69 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 70 70 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 71 71 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 72 72 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 73 73 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 74 74 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 75 75 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 76 76 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 77 77 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 78 78 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 79 79 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 80 80 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 81 81 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 82 82 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 83 83 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 84 84 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 85 85 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 86 86 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 87 87 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 88 88 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 89 89 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 90 90 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 91 91 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 92 92 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 93 93 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 94 94 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000040 . region 95 95 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000040 . region 96 96 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 97 97 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 98 98 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 99 99 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 100 100 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 101 101 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 102 102 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 103 103 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 104 104 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 105 105 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 106 106 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 107 107 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 108 108 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 109 109 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 110 110 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 111 111 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 112 112 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 113 113 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 114 114 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 115 115 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 116 116 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 117 117 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 118 118 0.00 + . cov2=99.000,0.000;gaps=0,0;cov=99,99,99;cQv=93,93,93;
+ref000040 . region 119 119 0.00 + . cov2=98.000,0.000;gaps=0,0;cov=98,98,98;cQv=93,93,93;
+ref000040 . region 120 120 0.00 + . cov2=98.000,0.000;gaps=0,0;cov=98,98,98;cQv=93,93,93;
+ref000040 . region 121 121 0.00 + . cov2=98.000,0.000;gaps=0,0;cov=98,98,98;cQv=93,93,93;
+ref000040 . region 122 122 0.00 + . cov2=98.000,0.000;gaps=0,0;cov=98,98,98;cQv=93,93,93;
+ref000040 . region 123 123 0.00 + . cov2=98.000,0.000;gaps=0,0;cov=98,98,98;cQv=93,93,93;
+ref000040 . region 124 124 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000040 . region 125 125 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000040 . region 126 126 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000040 . region 127 127 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000040 . region 128 128 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000040 . region 129 129 0.00 + . cov2=97.000,0.000;gaps=0,0;cov=97,97,97;cQv=93,93,93;
+ref000040 . region 130 130 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 131 131 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 132 132 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 133 133 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 134 134 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 135 135 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 136 136 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 137 137 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 138 138 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 139 139 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 140 140 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 141 141 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 142 142 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 143 143 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 144 144 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 145 145 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 146 146 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 147 147 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 148 148 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 149 149 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 150 150 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 151 151 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 152 152 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 153 153 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 154 154 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 155 155 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 156 156 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 157 157 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 158 158 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 159 159 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 160 160 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 161 161 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 162 162 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 163 163 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 164 164 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 165 165 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 166 166 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 167 167 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 168 168 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 169 169 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 170 170 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000040 . region 171 171 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 172 172 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 173 173 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 174 174 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 175 175 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 176 176 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 177 177 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 178 178 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 179 179 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 180 180 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 181 181 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 182 182 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 183 183 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 184 184 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 185 185 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000040 . region 186 186 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 187 187 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 188 188 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 189 189 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 190 190 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 191 191 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 192 192 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 193 193 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 194 194 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 195 195 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 196 196 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 197 197 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 198 198 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 199 199 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 200 200 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 201 201 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 202 202 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 203 203 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 204 204 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 205 205 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 206 206 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 207 207 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 208 208 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 209 209 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 210 210 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 211 211 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 212 212 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 213 213 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 214 214 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000040 . region 215 215 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000040 . region 216 216 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000040 . region 217 217 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000040 . region 218 218 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000040 . region 219 219 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000040 . region 220 220 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000040 . region 221 221 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000040 . region 222 222 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000040 . region 223 223 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000040 . region 224 224 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000040 . region 225 225 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000040 . region 226 226 0.00 + . cov2=92.000,0.000;gaps=0,0;cov=92,92,92;cQv=93,93,93;
+ref000040 . region 227 227 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 228 228 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 229 229 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 230 230 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 231 231 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 232 232 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 233 233 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 234 234 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 235 235 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 236 236 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 237 237 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 238 238 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 239 239 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 240 240 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 241 241 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 242 242 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 243 243 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 244 244 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 245 245 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 246 246 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 247 247 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 248 248 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 249 249 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 250 250 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 251 251 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 252 252 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 253 253 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 254 254 0.00 + . cov2=91.000,0.000;gaps=0,0;cov=91,91,91;cQv=93,93,93;
+ref000040 . region 255 255 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 256 256 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 257 257 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 258 258 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 259 259 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 260 260 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 261 261 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 262 262 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 263 263 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 264 264 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 265 265 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 266 266 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 267 267 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 268 268 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 269 269 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 270 270 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 271 271 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 272 272 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 273 273 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 274 274 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 275 275 0.00 + . cov2=90.000,0.000;gaps=0,0;cov=90,90,90;cQv=93,93,93;
+ref000040 . region 276 276 0.00 + . cov2=89.000,0.000;gaps=0,0;cov=89,89,89;cQv=93,93,93;
+ref000040 . region 277 277 0.00 + . cov2=89.000,0.000;gaps=0,0;cov=89,89,89;cQv=93,93,93;
+ref000040 . region 278 278 0.00 + . cov2=89.000,0.000;gaps=0,0;cov=89,89,89;cQv=93,93,93;
+ref000040 . region 279 279 0.00 + . cov2=89.000,0.000;gaps=0,0;cov=89,89,89;cQv=93,93,93;
+ref000040 . region 280 280 0.00 + . cov2=88.000,0.000;gaps=0,0;cov=88,88,88;cQv=93,93,93;
+ref000040 . region 281 281 0.00 + . cov2=86.000,0.000;gaps=0,0;cov=86,86,86;cQv=93,93,93;
+ref000040 . region 282 282 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000040 . region 283 283 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000040 . region 284 284 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000040 . region 285 285 0.00 + . cov2=85.000,0.000;gaps=0,0;cov=85,85,85;cQv=93,93,93;
+ref000040 . region 286 286 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000040 . region 287 287 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000040 . region 288 288 0.00 + . cov2=83.000,0.000;gaps=0,0;cov=83,83,83;cQv=93,93,93;
+ref000040 . region 289 289 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000040 . region 290 290 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000040 . region 291 291 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000040 . region 292 292 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000040 . region 293 293 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000040 . region 294 294 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000040 . region 295 295 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000040 . region 296 296 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000040 . region 297 297 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000040 . region 298 298 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000040 . region 299 299 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000040 . region 300 300 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000040 . region 301 301 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000040 . region 302 302 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000040 . region 303 303 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000040 . region 304 304 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000040 . region 305 305 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000040 . region 306 306 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000040 . region 307 307 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000040 . region 308 308 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000040 . region 309 309 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000040 . region 310 310 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000040 . region 311 311 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000040 . region 312 312 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000040 . region 313 313 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000040 . region 314 314 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000040 . region 315 315 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000040 . region 316 316 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000040 . region 317 317 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000041 . region 1 1 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000041 . region 2 2 0.00 + . cov2=52.000,0.000;gaps=0,0;cov=52,52,52;cQv=93,93,93;
+ref000041 . region 3 3 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000041 . region 4 4 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000041 . region 5 5 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000041 . region 6 6 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000041 . region 7 7 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000041 . region 8 8 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000041 . region 9 9 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000041 . region 10 10 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000041 . region 11 11 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 12 12 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 13 13 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 14 14 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 15 15 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 16 16 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 17 17 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 18 18 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 19 19 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 20 20 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 21 21 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 22 22 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 23 23 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 24 24 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 25 25 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 26 26 0.00 + . cov2=69.000,0.000;gaps=0,0;cov=69,69,69;cQv=93,93,93;
+ref000041 . region 27 27 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 28 28 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 29 29 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 30 30 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 31 31 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 32 32 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 33 33 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 34 34 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 35 35 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 36 36 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 37 37 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 38 38 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 39 39 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 40 40 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 41 41 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 42 42 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 43 43 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 44 44 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 45 45 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 46 46 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 47 47 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 48 48 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 49 49 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 50 50 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 51 51 0.00 + . cov2=70.000,0.000;gaps=0,0;cov=70,70,70;cQv=93,93,93;
+ref000041 . region 52 52 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000041 . region 53 53 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000041 . region 54 54 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000041 . region 55 55 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000041 . region 56 56 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000041 . region 57 57 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 58 58 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 59 59 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 60 60 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 61 61 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 62 62 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 63 63 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 64 64 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 65 65 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 66 66 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 67 67 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 68 68 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 69 69 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 70 70 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 71 71 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 72 72 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 73 73 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 74 74 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 75 75 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 76 76 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 77 77 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 78 78 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 79 79 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 80 80 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 81 81 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 82 82 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 83 83 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 84 84 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 85 85 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 86 86 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 87 87 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 88 88 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 89 89 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 90 90 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 91 91 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 92 92 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 93 93 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000041 . region 94 94 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 95 95 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 96 96 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 97 97 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 98 98 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 99 99 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 100 100 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 101 101 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 102 102 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 103 103 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 104 104 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 105 105 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 106 106 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 107 107 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 108 108 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 109 109 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 110 110 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 111 111 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 112 112 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 113 113 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 114 114 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 115 115 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 116 116 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 117 117 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 118 118 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 119 119 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 120 120 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 121 121 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 122 122 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 123 123 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 124 124 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 125 125 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 126 126 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 127 127 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 128 128 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 129 129 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 130 130 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 131 131 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 132 132 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 133 133 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 134 134 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 135 135 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 136 136 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 137 137 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 138 138 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 139 139 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 140 140 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 141 141 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 142 142 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 143 143 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 144 144 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 145 145 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 146 146 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 147 147 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 148 148 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 149 149 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 150 150 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 151 151 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 152 152 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 153 153 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 154 154 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 155 155 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 156 156 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 157 157 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 158 158 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 159 159 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 160 160 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 161 161 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 162 162 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 163 163 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 164 164 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 165 165 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 166 166 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 167 167 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 168 168 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 169 169 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 170 170 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 171 171 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 172 172 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 173 173 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 174 174 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 175 175 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 176 176 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 177 177 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 178 178 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 179 179 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 180 180 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 181 181 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 182 182 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 183 183 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 184 184 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 185 185 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 186 186 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 187 187 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 188 188 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 189 189 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 190 190 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 191 191 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 192 192 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 193 193 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 194 194 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 195 195 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 196 196 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 197 197 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 198 198 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 199 199 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 200 200 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 201 201 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 202 202 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 203 203 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 204 204 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 205 205 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 206 206 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 207 207 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 208 208 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 209 209 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 210 210 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 211 211 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 212 212 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 213 213 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 214 214 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 215 215 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 216 216 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 217 217 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 218 218 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 219 219 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 220 220 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 221 221 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 222 222 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 223 223 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 224 224 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 225 225 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 226 226 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 227 227 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 228 228 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 229 229 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 230 230 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 231 231 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 232 232 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 233 233 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 234 234 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 235 235 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 236 236 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 237 237 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 238 238 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 239 239 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 240 240 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 241 241 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 242 242 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 243 243 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 244 244 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 245 245 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 246 246 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 247 247 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 248 248 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 249 249 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 250 250 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 251 251 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 252 252 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 253 253 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 254 254 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000041 . region 255 255 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000041 . region 256 256 0.00 + . cov2=68.000,0.000;gaps=0,0;cov=68,68,68;cQv=93,93,93;
+ref000042 . region 1 1 0.00 + . cov2=136.000,0.000;gaps=0,0;cov=136,136,136;cQv=93,93,93;
+ref000042 . region 2 2 0.00 + . cov2=138.000,0.000;gaps=0,0;cov=138,138,138;cQv=93,93,93;
+ref000042 . region 3 3 0.00 + . cov2=138.000,0.000;gaps=0,0;cov=138,138,138;cQv=93,93,93;
+ref000042 . region 4 4 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 5 5 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 6 6 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 7 7 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 8 8 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 9 9 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 10 10 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 11 11 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 12 12 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 13 13 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 14 14 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 15 15 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 16 16 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 17 17 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 18 18 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 19 19 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 20 20 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 21 21 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 22 22 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 23 23 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 24 24 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 25 25 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 26 26 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 27 27 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 28 28 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 29 29 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 30 30 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 31 31 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 32 32 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 33 33 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 34 34 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 35 35 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 36 36 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 37 37 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 38 38 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 39 39 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 40 40 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 41 41 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 42 42 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 43 43 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 44 44 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 45 45 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 46 46 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 47 47 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 48 48 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 49 49 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 50 50 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 51 51 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 52 52 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 53 53 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 54 54 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 55 55 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 56 56 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 57 57 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 58 58 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 59 59 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 60 60 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 61 61 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 62 62 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 63 63 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 64 64 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 65 65 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 66 66 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 67 67 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 68 68 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 69 69 0.00 + . cov2=145.000,0.000;gaps=0,0;cov=145,145,145;cQv=93,93,93;
+ref000042 . region 70 70 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 71 71 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 72 72 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 73 73 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 74 74 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 75 75 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 76 76 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 77 77 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 78 78 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 79 79 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 80 80 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 81 81 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 82 82 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 83 83 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 84 84 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 85 85 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 86 86 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 87 87 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 88 88 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 89 89 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 90 90 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 91 91 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 92 92 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 93 93 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 94 94 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 95 95 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 96 96 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 97 97 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 98 98 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 99 99 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 100 100 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 101 101 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 102 102 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 103 103 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 104 104 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 105 105 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 106 106 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 107 107 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 108 108 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 109 109 0.00 + . cov2=144.000,0.000;gaps=0,0;cov=144,144,144;cQv=93,93,93;
+ref000042 . region 110 110 0.00 + . cov2=143.000,0.000;gaps=0,0;cov=143,143,143;cQv=93,93,93;
+ref000042 . region 111 111 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 112 112 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 113 113 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 114 114 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 115 115 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 116 116 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 117 117 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 118 118 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 119 119 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 120 120 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 121 121 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 122 122 0.00 + . cov2=142.000,0.000;gaps=0,0;cov=142,142,142;cQv=93,93,93;
+ref000042 . region 123 123 0.00 + . cov2=141.000,0.000;gaps=0,0;cov=141,141,141;cQv=93,93,93;
+ref000042 . region 124 124 0.00 + . cov2=141.000,0.000;gaps=0,0;cov=141,141,141;cQv=93,93,93;
+ref000042 . region 125 125 0.00 + . cov2=141.000,0.000;gaps=0,0;cov=141,141,141;cQv=93,93,93;
+ref000042 . region 126 126 0.00 + . cov2=141.000,0.000;gaps=0,0;cov=141,141,141;cQv=93,93,93;
+ref000042 . region 127 127 0.00 + . cov2=140.000,0.000;gaps=0,0;cov=140,140,140;cQv=93,93,93;
+ref000042 . region 128 128 0.00 + . cov2=140.000,0.000;gaps=0,0;cov=140,140,140;cQv=93,93,93;
+ref000042 . region 129 129 0.00 + . cov2=140.000,0.000;gaps=0,0;cov=140,140,140;cQv=93,93,93;
+ref000042 . region 130 130 0.00 + . cov2=138.000,0.000;gaps=0,0;cov=138,138,138;cQv=93,93,93;
+ref000042 . region 131 131 0.00 + . cov2=138.000,0.000;gaps=0,0;cov=138,138,138;cQv=93,93,93;
+ref000042 . region 132 132 0.00 + . cov2=138.000,0.000;gaps=0,0;cov=138,138,138;cQv=93,93,93;
+ref000042 . region 133 133 0.00 + . cov2=138.000,0.000;gaps=0,0;cov=138,138,138;cQv=93,93,93;
+ref000042 . region 134 134 0.00 + . cov2=137.000,0.000;gaps=0,0;cov=137,137,137;cQv=93,93,93;
+ref000042 . region 135 135 0.00 + . cov2=137.000,0.000;gaps=0,0;cov=137,137,137;cQv=93,93,93;
+ref000042 . region 136 136 0.00 + . cov2=137.000,0.000;gaps=0,0;cov=137,137,137;cQv=93,93,93;
+ref000042 . region 137 137 0.00 + . cov2=137.000,0.000;gaps=0,0;cov=137,137,137;cQv=93,93,93;
+ref000042 . region 138 138 0.00 + . cov2=137.000,0.000;gaps=0,0;cov=137,137,137;cQv=93,93,93;
+ref000042 . region 139 139 0.00 + . cov2=137.000,0.000;gaps=0,0;cov=137,137,137;cQv=93,93,93;
+ref000042 . region 140 140 0.00 + . cov2=137.000,0.000;gaps=0,0;cov=137,137,137;cQv=93,93,93;
+ref000042 . region 141 141 0.00 + . cov2=136.000,0.000;gaps=0,0;cov=136,136,136;cQv=93,93,93;
+ref000042 . region 142 142 0.00 + . cov2=135.000,0.000;gaps=0,0;cov=135,135,135;cQv=93,93,93;
+ref000042 . region 143 143 0.00 + . cov2=133.000,0.000;gaps=0,0;cov=133,133,133;cQv=93,93,93;
+ref000042 . region 144 144 0.00 + . cov2=133.000,0.000;gaps=0,0;cov=133,133,133;cQv=93,93,93;
+ref000042 . region 145 145 0.00 + . cov2=133.000,0.000;gaps=0,0;cov=133,133,133;cQv=93,93,93;
+ref000042 . region 146 146 0.00 + . cov2=132.000,0.000;gaps=0,0;cov=132,132,132;cQv=93,93,93;
+ref000042 . region 147 147 0.00 + . cov2=132.000,0.000;gaps=0,0;cov=132,132,132;cQv=93,93,93;
+ref000042 . region 148 148 0.00 + . cov2=132.000,0.000;gaps=0,0;cov=132,132,132;cQv=93,93,93;
+ref000042 . region 149 149 0.00 + . cov2=132.000,0.000;gaps=0,0;cov=132,132,132;cQv=93,93,93;
+ref000042 . region 150 150 0.00 + . cov2=130.000,0.000;gaps=0,0;cov=130,130,130;cQv=93,93,93;
+ref000042 . region 151 151 0.00 + . cov2=130.000,0.000;gaps=0,0;cov=130,130,130;cQv=93,93,93;
+ref000042 . region 152 152 0.00 + . cov2=130.000,0.000;gaps=0,0;cov=130,130,130;cQv=93,93,93;
+ref000042 . region 153 153 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 154 154 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 155 155 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 156 156 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 157 157 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 158 158 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 159 159 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 160 160 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 161 161 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 162 162 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 163 163 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 164 164 0.00 + . cov2=131.000,0.000;gaps=0,0;cov=131,131,131;cQv=93,93,93;
+ref000042 . region 165 165 0.00 + . cov2=130.000,0.000;gaps=0,0;cov=130,130,130;cQv=93,93,93;
+ref000042 . region 166 166 0.00 + . cov2=130.000,0.000;gaps=0,0;cov=130,130,130;cQv=93,93,93;
+ref000042 . region 167 167 0.00 + . cov2=130.000,0.000;gaps=0,0;cov=130,130,130;cQv=93,93,93;
+ref000042 . region 168 168 0.00 + . cov2=128.000,0.000;gaps=0,0;cov=128,128,128;cQv=93,93,93;
+ref000042 . region 169 169 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 170 170 0.00 + . cov2=128.000,0.000;gaps=0,0;cov=128,128,128;cQv=93,93,93;
+ref000042 . region 171 171 0.00 + . cov2=128.000,0.000;gaps=0,0;cov=128,128,128;cQv=93,93,93;
+ref000042 . region 172 172 0.00 + . cov2=129.000,0.000;gaps=0,0;cov=129,129,129;cQv=93,93,93;
+ref000042 . region 173 173 0.00 + . cov2=129.000,0.000;gaps=0,0;cov=129,129,129;cQv=93,93,93;
+ref000042 . region 174 174 0.00 + . cov2=128.000,0.000;gaps=0,0;cov=128,128,128;cQv=93,93,93;
+ref000042 . region 175 175 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 176 176 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 177 177 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 178 178 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 179 179 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 180 180 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 181 181 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 182 182 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 183 183 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 184 184 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 185 185 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 186 186 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 187 187 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 188 188 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 189 189 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 190 190 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 191 191 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 192 192 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 193 193 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 194 194 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 195 195 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 196 196 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 197 197 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 198 198 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 199 199 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 200 200 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 201 201 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 202 202 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 203 203 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 204 204 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 205 205 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 206 206 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 207 207 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 208 208 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 209 209 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 210 210 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 211 211 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 212 212 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 213 213 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 214 214 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 215 215 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 216 216 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 217 217 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 218 218 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 219 219 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 220 220 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 221 221 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 222 222 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 223 223 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 224 224 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 225 225 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 226 226 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 227 227 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 228 228 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 229 229 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 230 230 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 231 231 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 232 232 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 233 233 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 234 234 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 235 235 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 236 236 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 237 237 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 238 238 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 239 239 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 240 240 0.00 + . cov2=127.000,0.000;gaps=0,0;cov=127,127,127;cQv=93,93,93;
+ref000042 . region 241 241 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 242 242 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 243 243 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 244 244 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 245 245 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 246 246 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 247 247 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 248 248 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 249 249 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 250 250 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 251 251 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 252 252 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 253 253 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 254 254 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 255 255 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 256 256 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 257 257 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 258 258 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 259 259 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 260 260 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 261 261 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 262 262 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 263 263 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 264 264 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 265 265 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 266 266 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 267 267 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 268 268 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 269 269 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 270 270 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 271 271 0.00 + . cov2=126.000,0.000;gaps=0,0;cov=126,126,126;cQv=93,93,93;
+ref000042 . region 272 272 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 273 273 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 274 274 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 275 275 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 276 276 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 277 277 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 278 278 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 279 279 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 280 280 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 281 281 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 282 282 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 283 283 0.00 + . cov2=125.000,0.000;gaps=0,0;cov=125,125,125;cQv=93,93,93;
+ref000042 . region 284 284 0.00 + . cov2=124.000,0.000;gaps=0,0;cov=124,124,124;cQv=93,93,93;
+ref000042 . region 285 285 0.00 + . cov2=123.000,0.000;gaps=0,0;cov=123,123,123;cQv=93,93,93;
+ref000042 . region 286 286 0.00 + . cov2=123.000,0.000;gaps=0,0;cov=123,123,123;cQv=93,93,93;
+ref000042 . region 287 287 0.00 + . cov2=123.000,0.000;gaps=0,0;cov=123,123,123;cQv=93,93,93;
+ref000042 . region 288 288 0.00 + . cov2=123.000,0.000;gaps=0,0;cov=123,123,123;cQv=93,93,93;
+ref000042 . region 289 289 0.00 + . cov2=123.000,0.000;gaps=0,0;cov=123,123,123;cQv=93,93,93;
+ref000042 . region 290 290 0.00 + . cov2=121.000,0.000;gaps=0,0;cov=121,121,121;cQv=93,93,93;
+ref000042 . region 291 291 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000042 . region 292 292 0.00 + . cov2=114.000,0.000;gaps=0,0;cov=114,114,114;cQv=93,93,93;
+ref000042 . region 293 293 0.00 + . cov2=112.000,0.000;gaps=0,0;cov=112,112,112;cQv=93,93,93;
+ref000043 . region 1 1 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 2 2 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 3 3 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 4 4 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 5 5 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 6 6 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 7 7 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 8 8 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 9 9 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 10 10 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 11 11 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 12 12 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 13 13 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 14 14 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 15 15 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 16 16 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 17 17 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 18 18 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 19 19 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 20 20 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 21 21 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 22 22 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 23 23 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 24 24 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 25 25 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 26 26 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 27 27 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 28 28 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 29 29 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 30 30 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 31 31 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 32 32 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 33 33 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 34 34 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 35 35 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 36 36 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 37 37 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 38 38 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 39 39 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 40 40 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 41 41 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 42 42 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 43 43 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 44 44 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 45 45 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 46 46 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 47 47 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 48 48 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 49 49 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 50 50 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 51 51 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 52 52 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 53 53 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 54 54 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 55 55 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 56 56 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 57 57 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 58 58 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 59 59 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 60 60 0.00 + . cov2=64.000,0.000;gaps=0,0;cov=64,64,64;cQv=93,93,93;
+ref000043 . region 61 61 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 62 62 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 63 63 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 64 64 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 65 65 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 66 66 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 67 67 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 68 68 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 69 69 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 70 70 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 71 71 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 72 72 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 73 73 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 74 74 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 75 75 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 76 76 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 77 77 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 78 78 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 79 79 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 80 80 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 81 81 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 82 82 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 83 83 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 84 84 0.00 + . cov2=63.000,0.000;gaps=0,0;cov=63,63,63;cQv=93,93,93;
+ref000043 . region 85 85 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 86 86 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 87 87 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 88 88 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 89 89 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 90 90 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 91 91 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 92 92 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 93 93 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 94 94 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 95 95 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 96 96 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 97 97 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 98 98 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 99 99 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 100 100 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 101 101 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 102 102 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 103 103 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 104 104 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 105 105 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 106 106 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 107 107 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 108 108 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 109 109 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 110 110 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 111 111 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 112 112 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 113 113 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 114 114 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 115 115 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 116 116 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 117 117 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 118 118 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 119 119 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 120 120 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 121 121 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 122 122 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 123 123 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 124 124 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 125 125 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 126 126 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 127 127 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 128 128 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 129 129 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 130 130 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 131 131 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 132 132 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 133 133 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 134 134 0.00 + . cov2=62.000,0.000;gaps=0,0;cov=62,62,62;cQv=93,93,93;
+ref000043 . region 135 135 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 136 136 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 137 137 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 138 138 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 139 139 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 140 140 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 141 141 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 142 142 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 143 143 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 144 144 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 145 145 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 146 146 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 147 147 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 148 148 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 149 149 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 150 150 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 151 151 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 152 152 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 153 153 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 154 154 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 155 155 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 156 156 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 157 157 0.00 + . cov2=61.000,0.000;gaps=0,0;cov=61,61,61;cQv=93,93,93;
+ref000043 . region 158 158 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 159 159 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 160 160 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 161 161 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 162 162 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 163 163 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 164 164 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 165 165 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 166 166 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 167 167 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 168 168 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 169 169 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 170 170 0.00 + . cov2=60.000,0.000;gaps=0,0;cov=60,60,60;cQv=93,93,93;
+ref000043 . region 171 171 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000043 . region 172 172 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000043 . region 173 173 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000043 . region 174 174 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000043 . region 175 175 0.00 + . cov2=59.000,0.000;gaps=0,0;cov=59,59,59;cQv=93,93,93;
+ref000043 . region 176 176 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 177 177 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 178 178 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 179 179 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 180 180 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 181 181 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 182 182 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 183 183 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 184 184 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 185 185 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 186 186 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 187 187 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 188 188 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 189 189 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 190 190 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 191 191 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 192 192 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 193 193 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 194 194 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 195 195 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 196 196 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 197 197 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 198 198 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 199 199 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 200 200 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 201 201 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 202 202 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 203 203 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 204 204 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 205 205 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 206 206 0.00 + . cov2=58.000,0.000;gaps=0,0;cov=58,58,58;cQv=93,93,93;
+ref000043 . region 207 207 0.00 + . cov2=57.000,0.000;gaps=0,0;cov=57,57,57;cQv=93,93,93;
+ref000043 . region 208 208 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000043 . region 209 209 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000043 . region 210 210 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000043 . region 211 211 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000043 . region 212 212 0.00 + . cov2=55.000,0.000;gaps=0,0;cov=55,55,55;cQv=93,93,93;
+ref000043 . region 213 213 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000043 . region 214 214 0.00 + . cov2=49.000,0.000;gaps=0,0;cov=49,49,49;cQv=93,93,93;
+ref000044 . region 1 1 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 2 2 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 3 3 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 4 4 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000044 . region 5 5 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000044 . region 6 6 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 7 7 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 8 8 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 9 9 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 10 10 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 11 11 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 12 12 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 13 13 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 14 14 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 15 15 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 16 16 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 17 17 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 18 18 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 19 19 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 20 20 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 21 21 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 22 22 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 23 23 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 24 24 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 25 25 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 26 26 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 27 27 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 28 28 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 29 29 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 30 30 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 31 31 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 32 32 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 33 33 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 34 34 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 35 35 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 36 36 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 37 37 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 38 38 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 39 39 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 40 40 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 41 41 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 42 42 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 43 43 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 44 44 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 45 45 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 46 46 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 47 47 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 48 48 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 49 49 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 50 50 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 51 51 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 52 52 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 53 53 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 54 54 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 55 55 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 56 56 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 57 57 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 58 58 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 59 59 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 60 60 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 61 61 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 62 62 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 63 63 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 64 64 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 65 65 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 66 66 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 67 67 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 68 68 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 69 69 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 70 70 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 71 71 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 72 72 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 73 73 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 74 74 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 75 75 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 76 76 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 77 77 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 78 78 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 79 79 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000044 . region 80 80 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 81 81 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 82 82 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 83 83 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 84 84 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 85 85 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 86 86 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 87 87 0.00 + . cov2=80.000,0.000;gaps=0,0;cov=80,80,80;cQv=93,93,93;
+ref000044 . region 88 88 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000044 . region 89 89 0.00 + . cov2=79.000,0.000;gaps=0,0;cov=79,79,79;cQv=93,93,93;
+ref000044 . region 90 90 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 91 91 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 92 92 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 93 93 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 94 94 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 95 95 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 96 96 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 97 97 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 98 98 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 99 99 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 100 100 0.00 + . cov2=78.000,0.000;gaps=0,0;cov=78,78,78;cQv=93,93,93;
+ref000044 . region 101 101 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 102 102 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 103 103 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 104 104 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 105 105 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 106 106 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 107 107 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 108 108 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 109 109 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 110 110 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 111 111 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 112 112 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 113 113 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 114 114 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 115 115 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 116 116 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 117 117 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 118 118 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 119 119 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 120 120 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 121 121 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 122 122 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 123 123 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 124 124 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 125 125 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 126 126 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 127 127 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 128 128 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 129 129 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 130 130 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 131 131 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 132 132 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 133 133 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 134 134 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 135 135 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 136 136 0.00 + . cov2=77.000,0.000;gaps=0,0;cov=77,77,77;cQv=93,93,93;
+ref000044 . region 137 137 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 138 138 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 139 139 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 140 140 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 141 141 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 142 142 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 143 143 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 144 144 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 145 145 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 146 146 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 147 147 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 148 148 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 149 149 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 150 150 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 151 151 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 152 152 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 153 153 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 154 154 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 155 155 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 156 156 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 157 157 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 158 158 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 159 159 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 160 160 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 161 161 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 162 162 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 163 163 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 164 164 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 165 165 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 166 166 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 167 167 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 168 168 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 169 169 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 170 170 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 171 171 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 172 172 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 173 173 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 174 174 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 175 175 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 176 176 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 177 177 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 178 178 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 179 179 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 180 180 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 181 181 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 182 182 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 183 183 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 184 184 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 185 185 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 186 186 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 187 187 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 188 188 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 189 189 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 190 190 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 191 191 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 192 192 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 193 193 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 194 194 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 195 195 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 196 196 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 197 197 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 198 198 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 199 199 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 200 200 0.00 + . cov2=76.000,0.000;gaps=0,0;cov=76,76,76;cQv=93,93,93;
+ref000044 . region 201 201 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 202 202 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 203 203 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 204 204 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 205 205 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 206 206 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 207 207 0.00 + . cov2=75.000,0.000;gaps=0,0;cov=75,75,75;cQv=93,93,93;
+ref000044 . region 208 208 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000044 . region 209 209 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000044 . region 210 210 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000044 . region 211 211 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000044 . region 212 212 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000044 . region 213 213 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000044 . region 214 214 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000044 . region 215 215 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000044 . region 216 216 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000044 . region 217 217 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000044 . region 218 218 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 219 219 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 220 220 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 221 221 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 222 222 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 223 223 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 224 224 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 225 225 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 226 226 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 227 227 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 228 228 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 229 229 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 230 230 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 231 231 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 232 232 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 233 233 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 234 234 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 235 235 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 236 236 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 237 237 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 238 238 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 239 239 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 240 240 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 241 241 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 242 242 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 243 243 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 244 244 0.00 + . cov2=73.000,0.000;gaps=0,0;cov=73,73,73;cQv=93,93,93;
+ref000044 . region 245 245 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000044 . region 246 246 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000044 . region 247 247 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000044 . region 248 248 0.00 + . cov2=71.000,0.000;gaps=0,0;cov=71,71,71;cQv=93,93,93;
+ref000044 . region 249 249 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000044 . region 250 250 0.00 + . cov2=67.000,0.000;gaps=0,0;cov=67,67,67;cQv=93,93,93;
+ref000044 . region 251 251 0.00 + . cov2=66.000,0.000;gaps=0,0;cov=66,66,66;cQv=93,93,93;
+ref000044 . region 252 252 0.00 + . cov2=56.000,0.000;gaps=0,0;cov=56,56,56;cQv=93,93,93;
+ref000045 . region 1 1 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000045 . region 2 2 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000045 . region 3 3 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000045 . region 4 4 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 5 5 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 6 6 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 7 7 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 8 8 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 9 9 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 10 10 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 11 11 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 12 12 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 13 13 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 14 14 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 15 15 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 16 16 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 17 17 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 18 18 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 19 19 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 20 20 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 21 21 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 22 22 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 23 23 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 24 24 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 25 25 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 26 26 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 27 27 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 28 28 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 29 29 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 30 30 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 31 31 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 32 32 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 33 33 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 34 34 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 35 35 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 36 36 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 37 37 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 38 38 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 39 39 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 40 40 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 41 41 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 42 42 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 43 43 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 44 44 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 45 45 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 46 46 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 47 47 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 48 48 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 49 49 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 50 50 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 51 51 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 52 52 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 53 53 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 54 54 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 55 55 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 56 56 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 57 57 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 58 58 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 59 59 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 60 60 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 61 61 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 62 62 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 63 63 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 64 64 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 65 65 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 66 66 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 67 67 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 68 68 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 69 69 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 70 70 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 71 71 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 72 72 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 73 73 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 74 74 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 75 75 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 76 76 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 77 77 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 78 78 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 79 79 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 80 80 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 81 81 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 82 82 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 83 83 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 84 84 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 85 85 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 86 86 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 87 87 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 88 88 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 89 89 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 90 90 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 91 91 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 92 92 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 93 93 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 94 94 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 95 95 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 96 96 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 97 97 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 98 98 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 99 99 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 100 100 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 101 101 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 102 102 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 103 103 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 104 104 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 105 105 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 106 106 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 107 107 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 108 108 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 109 109 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 110 110 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 111 111 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 112 112 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 113 113 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 114 114 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 115 115 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 116 116 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 117 117 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 118 118 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 119 119 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 120 120 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 121 121 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 122 122 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 123 123 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 124 124 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 125 125 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 126 126 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 127 127 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 128 128 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 129 129 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 130 130 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 131 131 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 132 132 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 133 133 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 134 134 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 135 135 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 136 136 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 137 137 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 138 138 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 139 139 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 140 140 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 141 141 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 142 142 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 143 143 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 144 144 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 145 145 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 146 146 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 147 147 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 148 148 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 149 149 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 150 150 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 151 151 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 152 152 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 153 153 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 154 154 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 155 155 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 156 156 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 157 157 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 158 158 0.00 + . cov2=96.000,0.000;gaps=0,0;cov=96,96,96;cQv=93,93,93;
+ref000045 . region 159 159 0.00 + . cov2=95.000,0.000;gaps=0,0;cov=95,95,95;cQv=93,93,93;
+ref000045 . region 160 160 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000045 . region 161 161 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000045 . region 162 162 0.00 + . cov2=94.000,0.000;gaps=0,0;cov=94,94,94;cQv=93,93,93;
+ref000045 . region 163 163 0.00 + . cov2=93.000,0.000;gaps=0,0;cov=93,93,93;cQv=93,93,93;
+ref000045 . region 164 164 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 165 165 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 166 166 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 167 167 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 168 168 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 169 169 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 170 170 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 171 171 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 172 172 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 173 173 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 174 174 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 175 175 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 176 176 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 177 177 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 178 178 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 179 179 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 180 180 0.00 + . cov2=87.000,0.000;gaps=0,0;cov=87,87,87;cQv=93,93,93;
+ref000045 . region 181 181 0.00 + . cov2=86.000,0.000;gaps=0,0;cov=86,86,86;cQv=93,93,93;
+ref000045 . region 182 182 0.00 + . cov2=86.000,0.000;gaps=0,0;cov=86,86,86;cQv=93,93,93;
+ref000045 . region 183 183 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000045 . region 184 184 0.00 + . cov2=84.000,0.000;gaps=0,0;cov=84,84,84;cQv=93,93,93;
+ref000045 . region 185 185 0.00 + . cov2=82.000,0.000;gaps=0,0;cov=82,82,82;cQv=93,93,93;
+ref000045 . region 186 186 0.00 + . cov2=74.000,0.000;gaps=0,0;cov=74,74,74;cQv=93,93,93;
+ref000045 . region 187 187 0.00 + . cov2=72.000,0.000;gaps=0,0;cov=72,72,72;cQv=93,93,93;
+ref000046 . region 1 1 0.00 + . cov2=199.000,0.000;gaps=0,0;cov=199,199,199;cQv=93,93,93;
+ref000046 . region 2 2 0.00 + . cov2=204.000,0.000;gaps=0,0;cov=204,204,204;cQv=93,93,93;
+ref000046 . region 3 3 0.00 + . cov2=204.000,0.000;gaps=0,0;cov=204,204,204;cQv=93,93,93;
+ref000046 . region 4 4 0.00 + . cov2=204.000,0.000;gaps=0,0;cov=204,204,204;cQv=93,93,93;
+ref000046 . region 5 5 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 6 6 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 7 7 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 8 8 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 9 9 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 10 10 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 11 11 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 12 12 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 13 13 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 14 14 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 15 15 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 16 16 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 17 17 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 18 18 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 19 19 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 20 20 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 21 21 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 22 22 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 23 23 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 24 24 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 25 25 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 26 26 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 27 27 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 28 28 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 29 29 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 30 30 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 31 31 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 32 32 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 33 33 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 34 34 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 35 35 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 36 36 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 37 37 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 38 38 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 39 39 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 40 40 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 41 41 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 42 42 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 43 43 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 44 44 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 45 45 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 46 46 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 47 47 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 48 48 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 49 49 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 50 50 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 51 51 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 52 52 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 53 53 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 54 54 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 55 55 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 56 56 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 57 57 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 58 58 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 59 59 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 60 60 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 61 61 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 62 62 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 63 63 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 64 64 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 65 65 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 66 66 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 67 67 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 68 68 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 69 69 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 70 70 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 71 71 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 72 72 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 73 73 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 74 74 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 75 75 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 76 76 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 77 77 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 78 78 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 79 79 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 80 80 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 81 81 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 82 82 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 83 83 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 84 84 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 85 85 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 86 86 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 87 87 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 88 88 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 89 89 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 90 90 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 91 91 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 92 92 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 93 93 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 94 94 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 95 95 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 96 96 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 97 97 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 98 98 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 99 99 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 100 100 0.00 + . cov2=208.000,0.000;gaps=0,0;cov=208,208,208;cQv=93,93,93;
+ref000046 . region 101 101 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 102 102 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 103 103 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 104 104 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 105 105 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 106 106 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 107 107 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 108 108 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 109 109 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 110 110 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 111 111 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 112 112 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 113 113 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 114 114 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 115 115 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 116 116 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 117 117 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 118 118 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 119 119 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 120 120 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 121 121 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 122 122 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 123 123 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 124 124 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 125 125 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 126 126 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 127 127 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 128 128 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 129 129 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 130 130 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 131 131 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 132 132 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 133 133 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 134 134 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 135 135 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 136 136 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 137 137 0.00 + . cov2=207.000,0.000;gaps=0,0;cov=207,207,207;cQv=93,93,93;
+ref000046 . region 138 138 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 139 139 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 140 140 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 141 141 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 142 142 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 143 143 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 144 144 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 145 145 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 146 146 0.00 + . cov2=206.000,0.000;gaps=0,0;cov=206,206,206;cQv=93,93,93;
+ref000046 . region 147 147 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000046 . region 148 148 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000046 . region 149 149 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000046 . region 150 150 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000046 . region 151 151 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 152 152 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 153 153 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 154 154 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 155 155 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 156 156 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 157 157 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 158 158 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 159 159 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 160 160 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 161 161 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 162 162 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 163 163 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 164 164 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 165 165 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 166 166 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 167 167 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 168 168 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 169 169 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 170 170 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 171 171 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 172 172 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 173 173 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 174 174 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 175 175 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 176 176 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 177 177 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 178 178 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 179 179 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 180 180 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 181 181 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 182 182 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 183 183 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 184 184 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 185 185 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 186 186 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 187 187 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 188 188 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 189 189 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 190 190 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 191 191 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 192 192 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 193 193 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 194 194 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 195 195 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 196 196 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 197 197 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 198 198 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 199 199 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 200 200 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 201 201 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 202 202 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 203 203 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 204 204 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 205 205 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 206 206 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 207 207 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 208 208 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 209 209 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 210 210 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 211 211 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 212 212 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 213 213 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 214 214 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 215 215 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 216 216 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 217 217 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 218 218 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 219 219 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 220 220 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 221 221 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 222 222 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 223 223 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 224 224 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 225 225 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 226 226 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 227 227 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 228 228 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 229 229 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 230 230 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 231 231 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 232 232 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 233 233 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 234 234 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 235 235 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 236 236 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 237 237 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000046 . region 238 238 0.00 + . cov2=36.000,0.000;gaps=0,0;cov=36,36,36;cQv=93,93,93;
+ref000046 . region 239 239 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000046 . region 240 240 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000046 . region 241 241 0.00 + . cov2=35.000,0.000;gaps=0,0;cov=35,35,35;cQv=93,93,93;
+ref000047 . region 1 1 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 2 2 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 3 3 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 4 4 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 5 5 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 6 6 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 7 7 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 8 8 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 9 9 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 10 10 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 11 11 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 12 12 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 13 13 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 14 14 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 15 15 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 16 16 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 17 17 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 18 18 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 19 19 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 20 20 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 21 21 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 22 22 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 23 23 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 24 24 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 25 25 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 26 26 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 27 27 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 28 28 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 29 29 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 30 30 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 31 31 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 32 32 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 33 33 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 34 34 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 35 35 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 36 36 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 37 37 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 38 38 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 39 39 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 40 40 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 41 41 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 42 42 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 43 43 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 44 44 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 45 45 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 46 46 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 47 47 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 48 48 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 49 49 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 50 50 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 51 51 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 52 52 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000047 . region 53 53 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 54 54 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 55 55 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 56 56 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 57 57 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 58 58 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 59 59 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 60 60 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 61 61 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 62 62 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 63 63 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 64 64 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 65 65 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 66 66 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 67 67 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 68 68 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 69 69 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 70 70 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 71 71 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 72 72 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 73 73 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 74 74 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 75 75 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 76 76 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 77 77 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 78 78 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 79 79 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 80 80 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 81 81 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 82 82 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 83 83 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 84 84 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 85 85 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 86 86 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 87 87 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 88 88 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 89 89 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 90 90 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 91 91 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 92 92 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 93 93 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 94 94 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 95 95 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000047 . region 96 96 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 97 97 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 98 98 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 99 99 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 100 100 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 101 101 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 102 102 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 103 103 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 104 104 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 105 105 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 106 106 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 107 107 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 108 108 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 109 109 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 110 110 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 111 111 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 112 112 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000047 . region 113 113 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 114 114 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 115 115 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 116 116 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 117 117 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 118 118 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 119 119 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 120 120 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 121 121 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 122 122 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 123 123 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 124 124 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 125 125 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 126 126 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 127 127 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 128 128 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 129 129 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 130 130 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 131 131 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000047 . region 132 132 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=68,68,68;
+ref000047 . region 133 133 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000047 . region 134 134 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000047 . region 135 135 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000047 . region 136 136 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000047 . region 137 137 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000047 . region 138 138 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000047 . region 139 139 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000047 . region 140 140 0.00 + . cov2=38.000,0.000;gaps=0,0;cov=38,38,38;cQv=93,93,93;
+ref000047 . region 141 141 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000047 . region 142 142 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 143 143 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 144 144 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 145 145 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 146 146 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 147 147 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 148 148 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 149 149 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 150 150 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=68,68,68;
+ref000047 . region 151 151 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 152 152 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 153 153 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 154 154 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 155 155 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 156 156 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 157 157 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 158 158 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 159 159 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 160 160 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 161 161 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 162 162 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 163 163 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 164 164 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 165 165 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 166 166 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=68,68,68;
+ref000047 . region 167 167 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 168 168 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 169 169 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=68,68,68;
+ref000047 . region 170 170 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 171 171 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 172 172 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 173 173 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 174 174 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 175 175 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 176 176 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 177 177 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 178 178 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 179 179 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 180 180 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 181 181 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 182 182 0.00 + . cov2=17.000,0.000;gaps=0,0;cov=17,17,17;cQv=93,93,93;
+ref000047 . region 183 183 0.00 + . cov2=16.000,0.000;gaps=0,0;cov=16,16,16;cQv=90,90,90;
+ref000047 . region 184 184 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000047 . region 185 185 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000047 . region 186 186 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000047 . region 187 187 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000047 . region 188 188 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000047 . region 189 189 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000047 . region 190 190 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=83,83,83;
+ref000047 . region 191 191 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000047 . region 192 192 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000047 . region 193 193 0.00 + . cov2=15.000,0.000;gaps=0,0;cov=15,15,15;cQv=93,93,93;
+ref000047 . region 194 194 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=90,90,90;
+ref000047 . region 195 195 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000047 . region 196 196 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000047 . region 197 197 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000047 . region 198 198 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000047 . region 199 199 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000047 . region 200 200 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000047 . region 201 201 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000047 . region 202 202 0.00 + . cov2=14.000,0.000;gaps=0,0;cov=14,14,14;cQv=93,93,93;
+ref000047 . region 203 203 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=68,68,68;
+ref000047 . region 204 204 0.00 + . cov2=13.000,0.000;gaps=0,0;cov=13,13,13;cQv=93,93,93;
+ref000047 . region 205 205 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 206 206 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 207 207 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 208 208 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000047 . region 209 209 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000047 . region 210 210 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 211 211 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 212 212 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 213 213 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 214 214 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 215 215 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 216 216 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=75,75,75;
+ref000047 . region 217 217 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 218 218 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 219 219 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 220 220 0.00 + . cov2=12.000,0.000;gaps=0,0;cov=12,12,12;cQv=90,90,90;
+ref000047 . region 221 221 0.00 + . cov2=11.000,0.000;gaps=0,0;cov=11,11,11;cQv=83,83,83;
+ref000048 . region 1 1 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000048 . region 2 2 0.00 + . cov2=19.000,0.000;gaps=0,0;cov=19,19,19;cQv=93,93,93;
+ref000048 . region 3 3 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000048 . region 4 4 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000048 . region 5 5 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000048 . region 6 6 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 7 7 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 8 8 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 9 9 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 10 10 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 11 11 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 12 12 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 13 13 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 14 14 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 15 15 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 16 16 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 17 17 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 18 18 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 19 19 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 20 20 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 21 21 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 22 22 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 23 23 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 24 24 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 25 25 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 26 26 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 27 27 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 28 28 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 29 29 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 30 30 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 31 31 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 32 32 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 33 33 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 34 34 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 35 35 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 36 36 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 37 37 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=90,90,90;
+ref000048 . region 38 38 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 39 39 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 40 40 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=90,90,90;
+ref000048 . region 41 41 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 42 42 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 43 43 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 44 44 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 45 45 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 46 46 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 47 47 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 48 48 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 49 49 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 50 50 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 51 51 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 52 52 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 53 53 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 54 54 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 55 55 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 56 56 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 57 57 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 58 58 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 59 59 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 60 60 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 61 61 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 62 62 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 63 63 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 64 64 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 65 65 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 66 66 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 67 67 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 68 68 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 69 69 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 70 70 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 71 71 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 72 72 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 73 73 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 74 74 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 75 75 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 76 76 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 77 77 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 78 78 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 79 79 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 80 80 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 81 81 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 82 82 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 83 83 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 84 84 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 85 85 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 86 86 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 87 87 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 88 88 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=75,75,75;
+ref000048 . region 89 89 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 90 90 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 91 91 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 92 92 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 93 93 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 94 94 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=8,8,8;
+ref000048 . region 95 95 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 96 96 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 97 97 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 98 98 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 99 99 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 100 100 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 101 101 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 102 102 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 103 103 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 104 104 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 105 105 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 106 106 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 107 107 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 108 108 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 109 109 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 110 110 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 111 111 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 112 112 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=75,75,75;
+ref000048 . region 113 113 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 114 114 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 115 115 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 116 116 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 117 117 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=90,90,90;
+ref000048 . region 118 118 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 119 119 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 120 120 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 121 121 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 122 122 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 123 123 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 124 124 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 125 125 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 126 126 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 127 127 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 128 128 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 129 129 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 130 130 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 131 131 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 132 132 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 133 133 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 134 134 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 135 135 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 136 136 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 137 137 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 138 138 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 139 139 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 140 140 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 141 141 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 142 142 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 143 143 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 144 144 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 145 145 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 146 146 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 147 147 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 148 148 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 149 149 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 150 150 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=68,68,68;
+ref000048 . region 151 151 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 152 152 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 153 153 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 154 154 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 155 155 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 156 156 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 157 157 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 158 158 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 159 159 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 160 160 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 161 161 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 162 162 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 163 163 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 164 164 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 165 165 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 166 166 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 167 167 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 168 168 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 169 169 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 170 170 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 171 171 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 172 172 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 173 173 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 174 174 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 175 175 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 176 176 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 177 177 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 178 178 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 179 179 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 180 180 0.00 + . cov2=30.000,0.000;gaps=0,0;cov=30,30,30;cQv=93,93,93;
+ref000048 . region 181 181 0.00 + . cov2=39.000,0.000;gaps=0,0;cov=39,39,39;cQv=93,93,93;
+ref000048 . region 182 182 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000048 . region 183 183 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000048 . region 184 184 0.00 + . cov2=40.000,0.000;gaps=0,0;cov=40,40,40;cQv=93,93,93;
+ref000048 . region 185 185 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 186 186 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 187 187 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 188 188 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 189 189 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 190 190 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 191 191 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 192 192 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 193 193 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 194 194 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 195 195 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 196 196 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 197 197 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 198 198 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 199 199 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 200 200 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 201 201 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 202 202 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 203 203 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 204 204 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 205 205 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 206 206 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 207 207 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 208 208 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 209 209 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 210 210 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 211 211 0.00 + . cov2=41.000,0.000;gaps=0,0;cov=41,41,41;cQv=93,93,93;
+ref000048 . region 212 212 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 213 213 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 214 214 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 215 215 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 216 216 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 217 217 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 218 218 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 219 219 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 220 220 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 221 221 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 222 222 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 223 223 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 224 224 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 225 225 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 226 226 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 227 227 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 228 228 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 229 229 0.00 + . cov2=42.000,0.000;gaps=0,0;cov=42,42,42;cQv=93,93,93;
+ref000048 . region 230 230 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 231 231 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 232 232 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 233 233 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 234 234 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 235 235 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 236 236 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 237 237 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 238 238 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 239 239 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 240 240 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 241 241 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 242 242 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 243 243 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 244 244 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 245 245 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 246 246 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 247 247 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 248 248 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 249 249 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 250 250 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 251 251 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 252 252 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 253 253 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 254 254 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 255 255 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 256 256 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 257 257 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 258 258 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 259 259 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 260 260 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 261 261 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 262 262 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 263 263 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 264 264 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 265 265 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 266 266 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 267 267 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 268 268 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 269 269 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 270 270 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 271 271 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 272 272 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 273 273 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 274 274 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 275 275 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 276 276 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 277 277 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 278 278 0.00 + . cov2=45.000,0.000;gaps=0,0;cov=45,45,45;cQv=93,93,93;
+ref000048 . region 279 279 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000048 . region 280 280 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000048 . region 281 281 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000048 . region 282 282 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000048 . region 283 283 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000048 . region 284 284 0.00 + . cov2=44.000,0.000;gaps=0,0;cov=44,44,44;cQv=93,93,93;
+ref000048 . region 285 285 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000048 . region 286 286 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000048 . region 287 287 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000048 . region 288 288 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000048 . region 289 289 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000048 . region 290 290 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000048 . region 291 291 0.00 + . cov2=43.000,0.000;gaps=0,0;cov=43,43,43;cQv=93,93,93;
+ref000048 . region 292 292 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000048 . region 293 293 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000048 . region 294 294 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000048 . region 295 295 0.00 + . cov2=34.000,0.000;gaps=0,0;cov=34,34,34;cQv=93,93,93;
+ref000048 . region 296 296 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 297 297 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 298 298 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 299 299 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 300 300 0.00 + . cov2=23.000,0.000;gaps=0,0;cov=23,23,23;cQv=93,93,93;
+ref000048 . region 301 301 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 302 302 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 303 303 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 304 304 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 305 305 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 306 306 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 307 307 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 308 308 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 309 309 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 310 310 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 311 311 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 312 312 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 313 313 0.00 + . cov2=22.000,0.000;gaps=0,0;cov=22,22,22;cQv=93,93,93;
+ref000048 . region 314 314 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000048 . region 315 315 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000048 . region 316 316 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
+ref000048 . region 317 317 0.00 + . cov2=21.000,0.000;gaps=0,0;cov=21,21,21;cQv=93,93,93;
diff --git a/tests/data/hcv/3primeEnd.fa b/tests/data/hcv/3primeEnd.fa
new file mode 100644
index 0000000..990ddb7
--- /dev/null
+++ b/tests/data/hcv/3primeEnd.fa
@@ -0,0 +1,7 @@
+>3primeEnd
+TACCTGGTCATAGCCTCCGTGAAGGCTCTCAGGCTCGCTGCATCCTCCGGGACTCCCTGACTTTCACAGA
+TAACGACTAAGTCGTCGCCACACACGAGCATGGTGCAGTCCTGGAGCCCAGCGGCTCGACAGGCTGCTTT
+GGCCTTGATGTAGCAGGTGAGGGTGTTACCACAGCTGGTCGTCAGTACGCCGCTCGCGCGGCACCTGCGA
+TAGCCGCAGTTTTCCCCCCTTGAATTAGTAAGAGGGCCCCCGACATAGAGCCTCTCGGTGAGGGACTTGA
+TGGCCACGCGGGCTTGGGGGTCCAGGTCACAACATTGGTAAATTGCCTCCTCTGTACGGATATCGCTCTC
+AGTGACTGTGGAGTCAAAGCAGCGGGTATCATACGA
diff --git a/tests/data/hcv/5primeEnd.fa b/tests/data/hcv/5primeEnd.fa
new file mode 100644
index 0000000..589a652
--- /dev/null
+++ b/tests/data/hcv/5primeEnd.fa
@@ -0,0 +1,4 @@
+>5primeEnd
+GGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCGTGGATAAACCCGCTCAATGCCTG
+GAGATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTG
+CCTGATAGGGTGCTTG
diff --git a/tests/data/hcv/5primeEnd.fa.fai b/tests/data/hcv/5primeEnd.fa.fai
new file mode 100644
index 0000000..ee93071
--- /dev/null
+++ b/tests/data/hcv/5primeEnd.fa.fai
@@ -0,0 +1 @@
+5primeEnd 156 11 70 71
diff --git a/tests/data/hcv/HCV_Ref_For_187140.fasta b/tests/data/hcv/HCV_Ref_For_187140.fasta
new file mode 100644
index 0000000..17ab6aa
--- /dev/null
+++ b/tests/data/hcv/HCV_Ref_For_187140.fasta
@@ -0,0 +1,12 @@
+>5primeEnd
+GGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCGTGGATAAACCCGC
+TCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCG
+CGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTG
+>3primeEnd
+TACCTGGTCATAGCCTCCGTGAAGGCTCTCAGGCTCGCTGCATCCTCCGGGACTCCCTGA
+CTTTCACAGATAACGACTAAGTCGTCGCCACACACGAGCATGGTGCAGTCCTGGAGCCCA
+GCGGCTCGACAGGCTGCTTTGGCCTTGATGTAGCAGGTGAGGGTGTTACCACAGCTGGTC
+GTCAGTACGCCGCTCGCGCGGCACCTGCGATAGCCGCAGTTTTCCCCCCTTGAATTAGTA
+AGAGGGCCCCCGACATAGAGCCTCTCGGTGAGGGACTTGATGGCCACGCGGGCTTGGGGG
+TCCAGGTCACAACATTGGTAAATTGCCTCCTCTGTACGGATATCGCTCTCAGTGACTGTG
+GAGTCAAAGCAGCGGGTATCATACGA
diff --git a/tests/data/hcv/HCV_Ref_For_187140.fasta.fai b/tests/data/hcv/HCV_Ref_For_187140.fasta.fai
new file mode 100644
index 0000000..e253726
--- /dev/null
+++ b/tests/data/hcv/HCV_Ref_For_187140.fasta.fai
@@ -0,0 +1,2 @@
+5primeEnd 156 11 60 61
+3primeEnd 386 181 60 61
diff --git a/tests/data/hcv/aligned_reads.cmp.h5 b/tests/data/hcv/aligned_reads.cmp.h5
new file mode 100644
index 0000000..742a2c4
Binary files /dev/null and b/tests/data/hcv/aligned_reads.cmp.h5 differ
diff --git a/tests/data/yarm/9_ecoli_mutated_10.gff b/tests/data/yarm/9_ecoli_mutated_10.gff
new file mode 100644
index 0000000..019cea5
--- /dev/null
+++ b/tests/data/yarm/9_ecoli_mutated_10.gff
@@ -0,0 +1,200 @@
+##gff-version 3
+##pacbio-variant-version 1.3.1
+##date Mon Apr 16 14:48:07 2012
+##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
+##source GenomicConsensus v0.1.0
+##source-commandline /mnt/secondary/Smrtpipe/builds/Assembly_C2_Nightly_Archive/build187-107116/analysis/bin/variantCaller.py -j4 --algorithm=plurality -o 9_ecoli_mutated_10.gff -r 9_ecoli_mutated/sequence/9_ecoli_mutated.fasta --coverageSubsampling 1.0 9_ecoli_mutated.cmp.h5
+##sequence-header ref000001 9_ref000001|ecoliK12_mutated
+##sequence-region ref000001 1 4639638
+ref000001 . deletion 47 47 . . . length=1;confidence=15;coverage=16;reference=A
+ref000001 . deletion 150 150 . . . length=1;confidence=38;coverage=19;reference=T
+ref000001 . SNV 249 249 . . . coverage=21;variantSeq=G;confidence=93;reference=T
+ref000001 . SNV 348 348 . . . coverage=23;variantSeq=T;confidence=68;reference=A
+ref000001 . deletion 446 446 . . . length=1;confidence=93;coverage=27;reference=A
+ref000001 . SNV 645 645 . . . coverage=30;variantSeq=A;confidence=38;reference=C
+ref000001 . insertion 742 742 . . . length=1;variantSeq=G;confidence=45;coverage=30
+ref000001 . SNV 840 840 . . . coverage=30;variantSeq=T;confidence=45;reference=C
+ref000001 . deletion 1036 1036 . . . length=1;confidence=93;coverage=30;reference=G
+ref000001 . insertion 1134 1134 . . . length=1;variantSeq=C;confidence=45;coverage=33
+ref000001 . insertion 1231 1231 . . . length=1;variantSeq=C;confidence=15;coverage=37
+ref000001 . insertion 1330 1330 . . . length=1;variantSeq=G;confidence=93;coverage=41
+ref000001 . SNV 1428 1428 . . . coverage=43;variantSeq=A;confidence=93;reference=T
+ref000001 . insertion 1622 1622 . . . length=1;variantSeq=A;confidence=83;coverage=44
+ref000001 . SNV 1721 1721 . . . coverage=48;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 1819 1819 . . . length=1;confidence=30;coverage=48;reference=T
+ref000001 . insertion 2017 2017 . . . length=1;variantSeq=C;confidence=93;coverage=46
+ref000001 . deletion 2115 2115 . . . length=1;confidence=93;coverage=45;reference=A
+ref000001 . deletion 2214 2214 . . . length=1;confidence=93;coverage=48;reference=A
+ref000001 . SNV 2314 2314 . . . coverage=50;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 2412 2412 . . . length=1;confidence=93;coverage=50;reference=T
+ref000001 . deletion 2512 2512 . . . length=1;confidence=93;coverage=51;reference=A
+ref000001 . deletion 2611 2611 . . . length=1;confidence=93;coverage=51;reference=C
+ref000001 . SNV 2710 2710 . . . coverage=51;variantSeq=G;confidence=93;reference=A
+ref000001 . deletion 2809 2809 . . . length=1;confidence=93;coverage=49;reference=A
+ref000001 . insertion 2907 2907 . . . length=1;variantSeq=G;confidence=93;coverage=47
+ref000001 . deletion 3005 3005 . . . length=1;confidence=93;coverage=52;reference=C
+ref000001 . insertion 3103 3103 . . . length=1;variantSeq=C;confidence=93;coverage=54
+ref000001 . insertion 3201 3201 . . . length=1;variantSeq=G;confidence=93;coverage=53
+ref000001 . deletion 3399 3399 . . . length=1;confidence=93;coverage=53;reference=T
+ref000001 . insertion 3497 3497 . . . length=1;variantSeq=T;confidence=93;coverage=54
+ref000001 . insertion 3592 3592 . . . length=1;variantSeq=C;confidence=15;coverage=51
+ref000001 . SNV 3693 3693 . . . coverage=54;variantSeq=T;confidence=60;reference=A
+ref000001 . deletion 3791 3791 . . . length=1;confidence=93;coverage=52;reference=T
+ref000001 . insertion 3890 3890 . . . length=1;variantSeq=G;confidence=93;coverage=54
+ref000001 . deletion 3988 3988 . . . length=1;confidence=93;coverage=56;reference=G
+ref000001 . insertion 4086 4086 . . . length=1;variantSeq=T;confidence=93;coverage=54
+ref000001 . deletion 4185 4185 . . . length=1;confidence=93;coverage=58;reference=G
+ref000001 . insertion 4283 4283 . . . length=1;variantSeq=G;confidence=93;coverage=57
+ref000001 . insertion 4380 4380 . . . length=1;variantSeq=C;confidence=93;coverage=59
+ref000001 . SNV 4479 4479 . . . coverage=57;variantSeq=A;confidence=93;reference=C
+ref000001 . SNV 4577 4577 . . . coverage=53;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 4675 4675 . . . coverage=52;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 4774 4774 . . . length=1;confidence=93;coverage=48;reference=C
+ref000001 . insertion 4873 4873 . . . length=1;variantSeq=G;confidence=45;coverage=52
+ref000001 . SNV 4971 4971 . . . coverage=52;variantSeq=T;confidence=93;reference=C
+ref000001 . insertion 5066 5066 . . . length=1;variantSeq=C;confidence=68;coverage=54
+ref000001 . SNV 5166 5166 . . . coverage=53;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 5265 5265 . . . length=1;confidence=93;coverage=50;reference=T
+ref000001 . deletion 5463 5463 . . . length=1;confidence=93;coverage=48;reference=A
+ref000001 . SNV 5659 5659 . . . coverage=49;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 5757 5757 . . . length=1;confidence=93;coverage=54;reference=A
+ref000001 . SNV 5857 5857 . . . coverage=59;variantSeq=C;confidence=93;reference=T
+ref000001 . SNV 5955 5955 . . . coverage=56;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 6053 6053 . . . coverage=55;variantSeq=T;confidence=93;reference=C
+ref000001 . deletion 6152 6152 . . . length=1;confidence=93;coverage=58;reference=T
+ref000001 . SNV 6250 6250 . . . coverage=57;variantSeq=G;confidence=93;reference=T
+ref000001 . SNV 6349 6349 . . . coverage=58;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 6447 6447 . . . length=1;confidence=93;coverage=56;reference=T
+ref000001 . deletion 6546 6546 . . . length=1;confidence=93;coverage=55;reference=C
+ref000001 . deletion 6646 6646 . . . length=1;confidence=75;coverage=56;reference=T
+ref000001 . deletion 6844 6844 . . . length=1;confidence=93;coverage=54;reference=T
+ref000001 . SNV 6944 6944 . . . coverage=47;variantSeq=C;confidence=93;reference=T
+ref000001 . SNV 7042 7042 . . . coverage=48;variantSeq=A;confidence=93;reference=T
+ref000001 . insertion 7138 7138 . . . length=1;variantSeq=A;confidence=8;coverage=51
+ref000001 . SNV 7337 7337 . . . coverage=55;variantSeq=T;confidence=93;reference=C
+ref000001 . deletion 7533 7533 . . . length=1;confidence=93;coverage=55;reference=G
+ref000001 . insertion 7630 7630 . . . length=1;variantSeq=C;confidence=93;coverage=55
+ref000001 . insertion 7730 7730 . . . length=1;variantSeq=G;confidence=93;coverage=58
+ref000001 . insertion 8023 8023 . . . length=1;variantSeq=T;confidence=93;coverage=54
+ref000001 . insertion 8219 8219 . . . length=1;variantSeq=A;confidence=93;coverage=57
+ref000001 . SNV 8319 8319 . . . coverage=55;variantSeq=C;confidence=93;reference=A
+ref000001 . deletion 8417 8417 . . . length=1;confidence=93;coverage=53;reference=C
+ref000001 . SNV 8517 8517 . . . coverage=54;variantSeq=C;confidence=60;reference=T
+ref000001 . deletion 8714 8714 . . . length=1;confidence=30;coverage=56;reference=G
+ref000001 . insertion 8812 8812 . . . length=1;variantSeq=A;confidence=93;coverage=54
+ref000001 . SNV 9007 9007 . . . coverage=51;variantSeq=G;confidence=93;reference=A
+ref000001 . deletion 9106 9106 . . . length=1;confidence=93;coverage=50;reference=T
+ref000001 . deletion 9302 9302 . . . length=1;confidence=93;coverage=56;reference=T
+ref000001 . SNV 9402 9402 . . . coverage=53;variantSeq=A;confidence=93;reference=T
+ref000001 . deletion 9500 9500 . . . length=1;confidence=93;coverage=51;reference=C
+ref000001 . insertion 9598 9598 . . . length=1;variantSeq=A;confidence=93;coverage=52
+ref000001 . SNV 9697 9697 . . . coverage=50;variantSeq=A;confidence=93;reference=G
+ref000001 . insertion 9794 9794 . . . length=1;variantSeq=C;confidence=93;coverage=49
+ref000001 . insertion 9892 9892 . . . length=1;variantSeq=C;confidence=93;coverage=51
+ref000001 . insertion 9989 9989 . . . length=1;variantSeq=A;confidence=93;coverage=50
+ref000001 . insertion 10086 10086 . . . length=1;variantSeq=G;confidence=93;coverage=48
+ref000001 . SNV 10185 10185 . . . coverage=52;variantSeq=G;confidence=93;reference=A
+ref000001 . SNV 10283 10283 . . . coverage=49;variantSeq=T;confidence=93;reference=C
+ref000001 . SNV 10381 10381 . . . coverage=48;variantSeq=A;confidence=93;reference=T
+ref000001 . SNV 10480 10480 . . . coverage=48;variantSeq=C;confidence=60;reference=T
+ref000001 . SNV 10578 10578 . . . coverage=53;variantSeq=A;confidence=93;reference=T
+ref000001 . SNV 10676 10676 . . . coverage=50;variantSeq=C;confidence=93;reference=G
+ref000001 . deletion 10872 10872 . . . length=1;confidence=93;coverage=48;reference=G
+ref000001 . SNV 10972 10972 . . . coverage=50;variantSeq=C;confidence=45;reference=A
+ref000001 . SNV 11070 11070 . . . coverage=49;variantSeq=G;confidence=60;reference=T
+ref000001 . SNV 11168 11168 . . . coverage=51;variantSeq=C;confidence=93;reference=A
+ref000001 . insertion 11266 11266 . . . length=1;variantSeq=A;confidence=93;coverage=49
+ref000001 . SNV 11364 11364 . . . coverage=47;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 11462 11462 . . . coverage=44;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 11561 11561 . . . length=1;confidence=93;coverage=45;reference=T
+ref000001 . insertion 11562 11562 . . . length=1;variantSeq=G;confidence=3;coverage=45
+ref000001 . insertion 11658 11658 . . . length=1;variantSeq=G;confidence=93;coverage=48
+ref000001 . insertion 11755 11755 . . . length=1;variantSeq=A;confidence=93;coverage=50
+ref000001 . insertion 11952 11952 . . . length=1;variantSeq=T;confidence=93;coverage=49
+ref000001 . insertion 12149 12149 . . . length=1;variantSeq=G;confidence=93;coverage=43
+ref000001 . deletion 12345 12345 . . . length=1;confidence=93;coverage=41;reference=T
+ref000001 . SNV 12444 12444 . . . coverage=42;variantSeq=T;confidence=83;reference=C
+ref000001 . deletion 12542 12542 . . . length=1;confidence=93;coverage=41;reference=A
+ref000001 . insertion 12739 12739 . . . length=1;variantSeq=T;confidence=83;coverage=38
+ref000001 . insertion 12935 12935 . . . length=1;variantSeq=A;confidence=3;coverage=40
+ref000001 . deletion 13130 13130 . . . length=1;confidence=93;coverage=41;reference=G
+ref000001 . SNV 13230 13230 . . . coverage=38;variantSeq=T;confidence=15;reference=G
+ref000001 . deletion 13329 13329 . . . length=1;confidence=15;coverage=39;reference=A
+ref000001 . insertion 13427 13427 . . . length=1;variantSeq=C;confidence=93;coverage=41
+ref000001 . SNV 13622 13622 . . . coverage=39;variantSeq=G;confidence=93;reference=A
+ref000001 . insertion 13720 13720 . . . length=1;variantSeq=G;confidence=93;coverage=37
+ref000001 . insertion 13817 13817 . . . length=1;variantSeq=A;confidence=93;coverage=34
+ref000001 . insertion 13914 13914 . . . length=1;variantSeq=C;confidence=93;coverage=33
+ref000001 . SNV 14013 14013 . . . coverage=31;variantSeq=A;confidence=53;reference=T
+ref000001 . SNV 14111 14111 . . . coverage=29;variantSeq=A;confidence=93;reference=T
+ref000001 . deletion 14209 14209 . . . length=1;confidence=93;coverage=28;reference=T
+ref000001 . SNV 14309 14309 . . . coverage=30;variantSeq=A;confidence=93;reference=G
+ref000001 . insertion 14407 14407 . . . length=1;variantSeq=G;confidence=93;coverage=31
+ref000001 . SNV 14505 14505 . . . coverage=33;variantSeq=G;confidence=93;reference=A
+ref000001 . SNV 14603 14603 . . . coverage=31;variantSeq=C;confidence=93;reference=G
+ref000001 . insertion 14700 14700 . . . length=1;variantSeq=A;confidence=93;coverage=34
+ref000001 . deletion 14799 14799 . . . length=1;confidence=93;coverage=33;reference=G
+ref000001 . deletion 14898 14898 . . . length=1;confidence=53;coverage=32;reference=C
+ref000001 . SNV 14997 14997 . . . coverage=30;variantSeq=C;confidence=93;reference=G
+ref000001 . deletion 15195 15195 . . . length=1;confidence=93;coverage=29;reference=A
+ref000001 . SNV 15394 15394 . . . coverage=31;variantSeq=G;confidence=90;reference=C
+ref000001 . deletion 15492 15492 . . . length=1;confidence=93;coverage=30;reference=G
+ref000001 . insertion 15690 15690 . . . length=1;variantSeq=G;confidence=3;coverage=31
+ref000001 . insertion 15787 15787 . . . length=1;variantSeq=A;confidence=93;coverage=31
+ref000001 . insertion 15885 15885 . . . length=1;variantSeq=C;confidence=15;coverage=32
+ref000001 . insertion 15981 15981 . . . length=1;variantSeq=C;confidence=8;coverage=34
+ref000001 . deletion 16180 16180 . . . length=1;confidence=38;coverage=33;reference=T
+ref000001 . insertion 16278 16278 . . . length=1;variantSeq=T;confidence=93;coverage=32
+ref000001 . insertion 16375 16375 . . . length=1;variantSeq=G;confidence=93;coverage=33
+ref000001 . insertion 16473 16473 . . . length=1;variantSeq=G;confidence=93;coverage=33
+ref000001 . insertion 16570 16570 . . . length=1;variantSeq=C;confidence=93;coverage=33
+ref000001 . deletion 16668 16668 . . . length=1;confidence=93;coverage=38;reference=A
+ref000001 . insertion 16767 16767 . . . length=1;variantSeq=G;confidence=93;coverage=37
+ref000001 . SNV 16865 16865 . . . coverage=37;variantSeq=T;confidence=93;reference=G
+ref000001 . insertion 16963 16963 . . . length=1;variantSeq=C;confidence=60;coverage=36
+ref000001 . insertion 17060 17060 . . . length=1;variantSeq=C;confidence=93;coverage=35
+ref000001 . deletion 17158 17158 . . . length=1;confidence=93;coverage=33;reference=G
+ref000001 . insertion 17354 17354 . . . length=1;variantSeq=T;confidence=93;coverage=31
+ref000001 . SNV 17452 17452 . . . coverage=33;variantSeq=G;confidence=93;reference=A
+ref000001 . insertion 17550 17550 . . . length=1;variantSeq=T;confidence=93;coverage=37
+ref000001 . insertion 17744 17744 . . . length=1;variantSeq=C;confidence=93;coverage=35
+ref000001 . deletion 17941 17941 . . . length=1;confidence=93;coverage=37;reference=C
+ref000001 . SNV 18040 18040 . . . coverage=38;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 18139 18139 . . . coverage=37;variantSeq=A;confidence=53;reference=G
+ref000001 . SNV 18237 18237 . . . coverage=40;variantSeq=T;confidence=93;reference=C
+ref000001 . SNV 18336 18336 . . . coverage=41;variantSeq=C;confidence=93;reference=T
+ref000001 . SNV 18434 18434 . . . coverage=38;variantSeq=T;confidence=93;reference=A
+ref000001 . deletion 18532 18532 . . . length=1;confidence=23;coverage=36;reference=A
+ref000001 . deletion 18632 18632 . . . length=1;confidence=93;coverage=35;reference=T
+ref000001 . insertion 18827 18827 . . . length=1;variantSeq=T;confidence=3;coverage=39
+ref000001 . SNV 18926 18926 . . . coverage=38;variantSeq=T;confidence=93;reference=C
+ref000001 . SNV 19121 19121 . . . coverage=42;variantSeq=T;confidence=93;reference=G
+ref000001 . SNV 19220 19220 . . . coverage=42;variantSeq=A;confidence=93;reference=C
+ref000001 . insertion 19317 19317 . . . length=1;variantSeq=C;confidence=93;coverage=41
+ref000001 . SNV 19416 19416 . . . coverage=40;variantSeq=T;confidence=93;reference=C
+ref000001 . SNV 19514 19514 . . . coverage=36;variantSeq=A;confidence=93;reference=G
+ref000001 . insertion 19611 19611 . . . length=1;variantSeq=G;confidence=90;coverage=38
+ref000001 . deletion 19710 19710 . . . length=1;confidence=93;coverage=39;reference=C
+ref000001 . insertion 19808 19808 . . . length=1;variantSeq=T;confidence=93;coverage=43
+ref000001 . insertion 19905 19905 . . . length=1;variantSeq=C;confidence=93;coverage=48
+ref000001 . SNV 20004 20004 . . . coverage=48;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 20102 20102 . . . length=1;confidence=93;coverage=50;reference=A
+ref000001 . deletion 20201 20201 . . . length=1;confidence=45;coverage=49;reference=A
+ref000001 . insertion 20299 20299 . . . length=1;variantSeq=A;confidence=93;coverage=48
+ref000001 . deletion 20397 20397 . . . length=1;confidence=93;coverage=49;reference=C
+ref000001 . insertion 20497 20497 . . . length=1;variantSeq=G;confidence=15;coverage=43
+ref000001 . deletion 20593 20593 . . . length=1;confidence=60;coverage=40;reference=T
+ref000001 . deletion 20693 20693 . . . length=1;confidence=93;coverage=39;reference=C
+ref000001 . SNV 20793 20793 . . . coverage=39;variantSeq=A;confidence=38;reference=G
+ref000001 . SNV 20891 20891 . . . coverage=39;variantSeq=T;confidence=93;reference=A
+ref000001 . insertion 20988 20988 . . . length=1;variantSeq=A;confidence=93;coverage=38
+ref000001 . insertion 21086 21086 . . . length=1;variantSeq=C;confidence=93;coverage=39
+ref000001 . insertion 21183 21183 . . . length=1;variantSeq=A;confidence=93;coverage=38
+ref000001 . SNV 21381 21381 . . . coverage=44;variantSeq=T;confidence=60;reference=C
+ref000001 . deletion 21578 21578 . . . length=1;confidence=93;coverage=43;reference=G
+ref000001 . SNV 21678 21678 . . . coverage=44;variantSeq=T;confidence=60;reference=G
+ref000001 . insertion 21874 21874 . . . length=1;variantSeq=G;confidence=93;coverage=41
+ref000001 . insertion 21970 21970 . . . length=1;variantSeq=G;confidence=60;coverage=39
+ref000001 . insertion 22067 22067 . . . length=1;variantSeq=C;confidence=93;coverage=38
+ref000001 . insertion 22165 22165 . . . length=1;variantSeq=A;confidence=93;coverage=40
+ref000001 . deletion 22263 22263 . . . length=1;confidence=30;coverage=42;reference=C
diff --git a/tests/data/yarm/9_ecoli_mutated_2.gff b/tests/data/yarm/9_ecoli_mutated_2.gff
new file mode 100644
index 0000000..20ac3c8
--- /dev/null
+++ b/tests/data/yarm/9_ecoli_mutated_2.gff
@@ -0,0 +1,200 @@
+##gff-version 3
+##pacbio-variant-version 1.3.1
+##date Mon Apr 16 14:42:29 2012
+##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
+##source GenomicConsensus v0.1.0
+##source-commandline /mnt/secondary/Smrtpipe/builds/Assembly_C2_Nightly_Archive/build187-107116/analysis/bin/variantCaller.py -j4 --algorithm=plurality -o 9_ecoli_mutated_2.gff -r 9_ecoli_mutated/sequence/9_ecoli_mutated.fasta --coverageSubsampling .2 9_ecoli_mutated.cmp.h5
+##sequence-header ref000001 9_ref000001|ecoliK12_mutated
+##sequence-region ref000001 1 4639638
+ref000001 . deletion 47 47 . . . length=1;confidence=8;coverage=3;reference=A
+ref000001 . insertion 73 73 . . . length=1;variantSeq=C;confidence=2;coverage=3
+ref000001 . insertion 75 75 . . . length=1;variantSeq=T;confidence=2;coverage=3
+ref000001 . SNV 106 106 . . . coverage=3;variantSeq=C;confidence=2;reference=A
+ref000001 . insertion 109 109 . . . length=1;variantSeq=T;confidence=2;coverage=3
+ref000001 . insertion 122 122 . . . length=1;variantSeq=C;confidence=2;coverage=3
+ref000001 . deletion 150 150 . . . length=1;confidence=23;coverage=3;reference=T
+ref000001 . insertion 194 194 . . . length=1;variantSeq=G;confidence=2;coverage=3
+ref000001 . SNV 249 249 . . . coverage=4;variantSeq=G;confidence=15;reference=T
+ref000001 . deletion 318 318 . . . length=1;confidence=8;coverage=5;reference=A
+ref000001 . SNV 348 348 . . . coverage=5;variantSeq=T;confidence=22;reference=A
+ref000001 . deletion 446 446 . . . length=1;confidence=22;coverage=5;reference=A
+ref000001 . deletion 544 544 . . . length=1;confidence=22;coverage=5;reference=C
+ref000001 . deletion 630 630 . . . length=1;confidence=12;coverage=5;reference=A
+ref000001 . deletion 639 639 . . . length=1;confidence=8;coverage=5;reference=A
+ref000001 . SNV 645 645 . . . coverage=5;variantSeq=A;confidence=8;reference=C
+ref000001 . insertion 741 741 . . . length=1;variantSeq=G;confidence=4;coverage=5
+ref000001 . insertion 742 742 . . . length=1;variantSeq=G;confidence=3;coverage=5
+ref000001 . insertion 761 761 . . . length=1;variantSeq=C;confidence=3;coverage=5
+ref000001 . SNV 840 840 . . . coverage=5;variantSeq=T;confidence=22;reference=C
+ref000001 . insertion 938 938 . . . length=1;variantSeq=G;confidence=15;coverage=4
+ref000001 . deletion 952 952 . . . length=1;confidence=6;coverage=4;reference=A
+ref000001 . deletion 1036 1036 . . . length=1;confidence=19;coverage=6;reference=G
+ref000001 . insertion 1047 1047 . . . length=1;variantSeq=G;confidence=3;coverage=7
+ref000001 . insertion 1134 1134 . . . length=1;variantSeq=C;confidence=14;coverage=7
+ref000001 . insertion 1217 1217 . . . length=1;variantSeq=G;confidence=2;coverage=7
+ref000001 . insertion 1231 1231 . . . length=1;variantSeq=C;confidence=14;coverage=7
+ref000001 . insertion 1330 1330 . . . length=1;variantSeq=G;confidence=18;coverage=7
+ref000001 . deletion 1428 1428 . . . length=1;confidence=8;coverage=7;reference=T
+ref000001 . deletion 1614 1614 . . . length=1;confidence=7;coverage=7;reference=A
+ref000001 . deletion 1615 1615 . . . length=1;confidence=7;coverage=7;reference=T
+ref000001 . insertion 1622 1622 . . . length=1;variantSeq=A;confidence=7;coverage=7
+ref000001 . deletion 1660 1660 . . . length=1;confidence=8;coverage=8;reference=G
+ref000001 . SNV 1721 1721 . . . coverage=9;variantSeq=G;confidence=33;reference=C
+ref000001 . deletion 1917 1917 . . . length=1;confidence=15;coverage=9;reference=G
+ref000001 . insertion 2017 2017 . . . length=1;variantSeq=C;confidence=34;coverage=8
+ref000001 . deletion 2115 2115 . . . length=1;confidence=37;coverage=7;reference=A
+ref000001 . deletion 2214 2214 . . . length=1;confidence=60;coverage=8;reference=A
+ref000001 . SNV 2314 2314 . . . coverage=8;variantSeq=G;confidence=25;reference=C
+ref000001 . deletion 2412 2412 . . . length=1;confidence=68;coverage=9;reference=T
+ref000001 . deletion 2512 2512 . . . length=1;confidence=42;coverage=9;reference=A
+ref000001 . deletion 2611 2611 . . . length=1;confidence=60;coverage=8;reference=C
+ref000001 . SNV 2710 2710 . . . coverage=9;variantSeq=G;confidence=3;reference=A
+ref000001 . deletion 2809 2809 . . . length=1;confidence=52;coverage=9;reference=A
+ref000001 . insertion 2907 2907 . . . length=1;variantSeq=G;confidence=42;coverage=9
+ref000001 . deletion 3005 3005 . . . length=1;confidence=42;coverage=9;reference=C
+ref000001 . insertion 3103 3103 . . . length=1;variantSeq=C;confidence=38;coverage=9
+ref000001 . insertion 3201 3201 . . . length=1;variantSeq=G;confidence=52;coverage=9
+ref000001 . deletion 3299 3299 . . . length=1;confidence=15;coverage=8;reference=C
+ref000001 . deletion 3399 3399 . . . length=1;confidence=68;coverage=9;reference=T
+ref000001 . insertion 3497 3497 . . . length=1;variantSeq=T;confidence=57;coverage=11
+ref000001 . insertion 3592 3592 . . . length=1;variantSeq=C;confidence=3;coverage=10
+ref000001 . SNV 3693 3693 . . . coverage=10;variantSeq=T;confidence=3;reference=A
+ref000001 . deletion 3791 3791 . . . length=1;confidence=60;coverage=10;reference=T
+ref000001 . insertion 3890 3890 . . . length=1;variantSeq=G;confidence=57;coverage=11
+ref000001 . deletion 3988 3988 . . . length=1;confidence=53;coverage=11;reference=G
+ref000001 . insertion 4086 4086 . . . length=1;variantSeq=T;confidence=75;coverage=12
+ref000001 . deletion 4185 4185 . . . length=1;confidence=47;coverage=12;reference=G
+ref000001 . insertion 4283 4283 . . . length=1;variantSeq=G;confidence=28;coverage=11
+ref000001 . insertion 4380 4380 . . . length=1;variantSeq=C;confidence=47;coverage=12
+ref000001 . SNV 4479 4479 . . . coverage=12;variantSeq=A;confidence=23;reference=C
+ref000001 . SNV 4577 4577 . . . coverage=10;variantSeq=G;confidence=60;reference=C
+ref000001 . SNV 4675 4675 . . . coverage=8;variantSeq=G;confidence=15;reference=C
+ref000001 . deletion 4774 4774 . . . length=1;confidence=44;coverage=8;reference=C
+ref000001 . insertion 4873 4873 . . . length=1;variantSeq=G;confidence=3;coverage=8
+ref000001 . SNV 4971 4971 . . . coverage=8;variantSeq=T;confidence=34;reference=C
+ref000001 . insertion 5066 5066 . . . length=1;variantSeq=C;confidence=3;coverage=10
+ref000001 . SNV 5166 5166 . . . coverage=9;variantSeq=C;confidence=15;reference=T
+ref000001 . deletion 5265 5265 . . . length=1;confidence=37;coverage=7;reference=T
+ref000001 . deletion 5463 5463 . . . length=1;confidence=22;coverage=8;reference=A
+ref000001 . insertion 5561 5561 . . . length=1;variantSeq=T;confidence=3;coverage=8
+ref000001 . insertion 5562 5562 . . . length=1;variantSeq=T;confidence=8;coverage=8
+ref000001 . SNV 5659 5659 . . . coverage=8;variantSeq=C;confidence=15;reference=T
+ref000001 . deletion 5757 5757 . . . length=1;confidence=60;coverage=8;reference=A
+ref000001 . deletion 5815 5815 . . . length=1;confidence=6;coverage=9;reference=A
+ref000001 . SNV 5857 5857 . . . coverage=8;variantSeq=C;confidence=14;reference=T
+ref000001 . SNV 5955 5955 . . . coverage=9;variantSeq=G;confidence=52;reference=C
+ref000001 . SNV 6053 6053 . . . coverage=8;variantSeq=T;confidence=60;reference=C
+ref000001 . deletion 6152 6152 . . . length=1;confidence=38;coverage=9;reference=T
+ref000001 . insertion 6152 6152 . . . length=1;variantSeq=G;confidence=3;coverage=9
+ref000001 . SNV 6250 6250 . . . coverage=9;variantSeq=G;confidence=21;reference=T
+ref000001 . SNV 6349 6349 . . . coverage=9;variantSeq=C;confidence=52;reference=T
+ref000001 . deletion 6447 6447 . . . length=1;confidence=68;coverage=9;reference=T
+ref000001 . deletion 6546 6546 . . . length=1;confidence=23;coverage=9;reference=C
+ref000001 . deletion 6646 6646 . . . length=1;confidence=30;coverage=11;reference=T
+ref000001 . deletion 6745 6745 . . . length=1;confidence=8;coverage=11;reference=C
+ref000001 . deletion 6746 6746 . . . length=1;confidence=8;coverage=11;reference=C
+ref000001 . deletion 6844 6844 . . . length=1;confidence=83;coverage=11;reference=T
+ref000001 . SNV 6944 6944 . . . coverage=10;variantSeq=C;confidence=22;reference=T
+ref000001 . SNV 7042 7042 . . . coverage=9;variantSeq=A;confidence=52;reference=T
+ref000001 . insertion 7138 7138 . . . length=1;variantSeq=A;confidence=33;coverage=9
+ref000001 . insertion 7299 7299 . . . length=1;variantSeq=C;confidence=8;coverage=10
+ref000001 . SNV 7337 7337 . . . coverage=10;variantSeq=T;confidence=60;reference=C
+ref000001 . deletion 7533 7533 . . . length=1;confidence=67;coverage=11;reference=G
+ref000001 . insertion 7630 7630 . . . length=1;variantSeq=C;confidence=53;coverage=11
+ref000001 . insertion 7730 7730 . . . length=1;variantSeq=G;confidence=19;coverage=11
+ref000001 . insertion 8023 8023 . . . length=1;variantSeq=T;confidence=67;coverage=11
+ref000001 . insertion 8219 8219 . . . length=1;variantSeq=A;confidence=45;coverage=12
+ref000001 . SNV 8319 8319 . . . coverage=13;variantSeq=C;confidence=22;reference=A
+ref000001 . deletion 8417 8417 . . . length=1;confidence=67;coverage=11;reference=C
+ref000001 . SNV 8517 8517 . . . coverage=12;variantSeq=C;confidence=8;reference=T
+ref000001 . deletion 8714 8714 . . . length=1;confidence=30;coverage=11;reference=G
+ref000001 . insertion 8812 8812 . . . length=1;variantSeq=A;confidence=42;coverage=9
+ref000001 . insertion 8909 8909 . . . length=1;variantSeq=T;confidence=18;coverage=7
+ref000001 . SNV 9007 9007 . . . coverage=9;variantSeq=G;confidence=52;reference=A
+ref000001 . deletion 9106 9106 . . . length=1;confidence=44;coverage=8;reference=T
+ref000001 . deletion 9302 9302 . . . length=1;confidence=67;coverage=11;reference=T
+ref000001 . SNV 9402 9402 . . . coverage=10;variantSeq=A;confidence=49;reference=T
+ref000001 . deletion 9500 9500 . . . length=1;confidence=44;coverage=8;reference=C
+ref000001 . insertion 9598 9598 . . . length=1;variantSeq=A;confidence=7;coverage=8
+ref000001 . SNV 9697 9697 . . . coverage=8;variantSeq=A;confidence=34;reference=G
+ref000001 . insertion 9794 9794 . . . length=1;variantSeq=C;confidence=27;coverage=7
+ref000001 . insertion 9892 9892 . . . length=1;variantSeq=C;confidence=16;coverage=8
+ref000001 . insertion 9989 9989 . . . length=1;variantSeq=A;confidence=37;coverage=7
+ref000001 . insertion 10086 10086 . . . length=1;variantSeq=G;confidence=49;coverage=10
+ref000001 . SNV 10185 10185 . . . coverage=12;variantSeq=G;confidence=64;reference=A
+ref000001 . SNV 10283 10283 . . . coverage=10;variantSeq=T;confidence=60;reference=C
+ref000001 . SNV 10381 10381 . . . coverage=10;variantSeq=A;confidence=19;reference=T
+ref000001 . deletion 10480 10480 . . . length=1;confidence=29;coverage=9;reference=T
+ref000001 . SNV 10578 10578 . . . coverage=9;variantSeq=A;confidence=52;reference=T
+ref000001 . SNV 10676 10676 . . . coverage=9;variantSeq=C;confidence=21;reference=G
+ref000001 . SNV 10972 10972 . . . coverage=9;variantSeq=C;confidence=29;reference=A
+ref000001 . deletion 11070 11070 . . . length=1;confidence=12;coverage=9;reference=T
+ref000001 . deletion 11168 11168 . . . length=1;confidence=8;coverage=9;reference=A
+ref000001 . insertion 11266 11266 . . . length=1;variantSeq=A;confidence=42;coverage=9
+ref000001 . SNV 11364 11364 . . . coverage=9;variantSeq=G;confidence=33;reference=C
+ref000001 . SNV 11462 11462 . . . coverage=9;variantSeq=G;confidence=42;reference=C
+ref000001 . deletion 11561 11561 . . . length=1;confidence=52;coverage=9;reference=T
+ref000001 . insertion 11562 11562 . . . length=1;variantSeq=G;confidence=38;coverage=9
+ref000001 . insertion 11658 11658 . . . length=1;variantSeq=G;confidence=40;coverage=10
+ref000001 . insertion 11755 11755 . . . length=1;variantSeq=A;confidence=22;coverage=11
+ref000001 . insertion 11952 11952 . . . length=1;variantSeq=T;confidence=28;coverage=11
+ref000001 . deletion 12048 12048 . . . length=1;confidence=15;coverage=8;reference=A
+ref000001 . insertion 12149 12149 . . . length=1;variantSeq=G;confidence=6;coverage=9
+ref000001 . insertion 12246 12246 . . . length=1;variantSeq=A;confidence=8;coverage=10
+ref000001 . deletion 12345 12345 . . . length=1;confidence=37;coverage=7;reference=T
+ref000001 . SNV 12444 12444 . . . coverage=7;variantSeq=T;confidence=8;reference=C
+ref000001 . deletion 12542 12542 . . . length=1;confidence=53;coverage=7;reference=A
+ref000001 . deletion 12579 12579 . . . length=1;confidence=7;coverage=7;reference=T
+ref000001 . deletion 12641 12641 . . . length=1;confidence=27;coverage=7;reference=A
+ref000001 . insertion 12739 12739 . . . length=1;variantSeq=T;confidence=27;coverage=7
+ref000001 . insertion 12791 12791 . . . length=1;variantSeq=T;confidence=2;coverage=7
+ref000001 . insertion 12836 12836 . . . length=1;variantSeq=C;confidence=3;coverage=7
+ref000001 . insertion 12935 12935 . . . length=1;variantSeq=A;confidence=7;coverage=7
+ref000001 . deletion 13130 13130 . . . length=1;confidence=42;coverage=9;reference=G
+ref000001 . deletion 13230 13230 . . . length=1;confidence=15;coverage=9;reference=G
+ref000001 . deletion 13328 13328 . . . length=1;confidence=22;coverage=10;reference=A
+ref000001 . insertion 13427 13427 . . . length=1;variantSeq=C;confidence=42;coverage=9
+ref000001 . insertion 13437 13437 . . . length=1;variantSeq=T;confidence=13;coverage=9
+ref000001 . insertion 13523 13523 . . . length=1;variantSeq=G;confidence=3;coverage=9
+ref000001 . SNV 13622 13622 . . . coverage=8;variantSeq=G;confidence=44;reference=A
+ref000001 . insertion 13720 13720 . . . length=1;variantSeq=G;confidence=37;coverage=7
+ref000001 . insertion 13817 13817 . . . length=1;variantSeq=A;confidence=53;coverage=7
+ref000001 . insertion 13914 13914 . . . length=1;variantSeq=C;confidence=30;coverage=8
+ref000001 . SNV 14013 14013 . . . coverage=7;variantSeq=A;confidence=14;reference=T
+ref000001 . SNV 14111 14111 . . . coverage=7;variantSeq=A;confidence=53;reference=T
+ref000001 . deletion 14209 14209 . . . length=1;confidence=10;coverage=6;reference=T
+ref000001 . SNV 14309 14309 . . . coverage=6;variantSeq=A;confidence=45;reference=G
+ref000001 . insertion 14407 14407 . . . length=1;variantSeq=G;confidence=14;coverage=7
+ref000001 . SNV 14505 14505 . . . coverage=7;variantSeq=G;confidence=53;reference=A
+ref000001 . SNV 14603 14603 . . . coverage=7;variantSeq=C;confidence=37;reference=G
+ref000001 . insertion 14700 14700 . . . length=1;variantSeq=A;confidence=22;coverage=8
+ref000001 . deletion 14799 14799 . . . length=1;confidence=22;coverage=8;reference=G
+ref000001 . deletion 14898 14898 . . . length=1;confidence=14;coverage=7;reference=C
+ref000001 . SNV 14997 14997 . . . coverage=6;variantSeq=C;confidence=29;reference=G
+ref000001 . insertion 15066 15066 . . . length=1;variantSeq=G;confidence=8;coverage=3
+ref000001 . deletion 15097 15097 . . . length=1;confidence=23;coverage=3;reference=G
+ref000001 . insertion 15111 15111 . . . length=3;variantSeq=GGG;confidence=2;coverage=3
+ref000001 . insertion 15115 15115 . . . length=1;variantSeq=G;confidence=2;coverage=3
+ref000001 . deletion 15172 15172 . . . length=1;confidence=8;coverage=3;reference=G
+ref000001 . insertion 15177 15177 . . . length=1;variantSeq=G;confidence=2;coverage=3
+ref000001 . deletion 15195 15195 . . . length=1;confidence=23;coverage=3;reference=A
+ref000001 . insertion 15246 15246 . . . length=1;variantSeq=G;confidence=2;coverage=3
+ref000001 . insertion 15255 15255 . . . length=1;variantSeq=T;confidence=2;coverage=3
+ref000001 . SNV 15294 15294 . . . coverage=4;variantSeq=T;confidence=1;reference=C
+ref000001 . SNV 15394 15394 . . . coverage=5;variantSeq=G;confidence=12;reference=C
+ref000001 . deletion 15492 15492 . . . length=1;confidence=45;coverage=6;reference=G
+ref000001 . deletion 15591 15591 . . . length=1;confidence=15;coverage=6;reference=C
+ref000001 . insertion 15690 15690 . . . length=1;variantSeq=G;confidence=2;coverage=6
+ref000001 . insertion 15787 15787 . . . length=1;variantSeq=A;confidence=3;coverage=7
+ref000001 . insertion 15981 15981 . . . length=1;variantSeq=C;confidence=3;coverage=9
+ref000001 . insertion 16278 16278 . . . length=1;variantSeq=T;confidence=44;coverage=8
+ref000001 . insertion 16375 16375 . . . length=1;variantSeq=G;confidence=30;coverage=8
+ref000001 . insertion 16473 16473 . . . length=1;variantSeq=G;confidence=7;coverage=8
+ref000001 . insertion 16570 16570 . . . length=1;variantSeq=C;confidence=37;coverage=7
+ref000001 . insertion 16627 16627 . . . length=1;variantSeq=G;confidence=3;coverage=6
+ref000001 . deletion 16668 16668 . . . length=1;confidence=53;coverage=7;reference=A
+ref000001 . insertion 16767 16767 . . . length=1;variantSeq=G;confidence=27;coverage=7
+ref000001 . SNV 16865 16865 . . . coverage=8;variantSeq=T;confidence=44;reference=G
+ref000001 . insertion 16963 16963 . . . length=1;variantSeq=C;confidence=9;coverage=7
+ref000001 . insertion 17060 17060 . . . length=1;variantSeq=C;confidence=7;coverage=7
+ref000001 . deletion 17158 17158 . . . length=1;confidence=53;coverage=7;reference=G
diff --git a/tests/data/yarm/9_ecoli_mutated_4.gff b/tests/data/yarm/9_ecoli_mutated_4.gff
new file mode 100644
index 0000000..c99ef00
--- /dev/null
+++ b/tests/data/yarm/9_ecoli_mutated_4.gff
@@ -0,0 +1,200 @@
+##gff-version 3
+##pacbio-variant-version 1.3.1
+##date Mon Apr 16 14:42:33 2012
+##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
+##source GenomicConsensus v0.1.0
+##source-commandline /mnt/secondary/Smrtpipe/builds/Assembly_C2_Nightly_Archive/build187-107116/analysis/bin/variantCaller.py -j4 --algorithm=plurality -o 9_ecoli_mutated_4.gff -r 9_ecoli_mutated/sequence/9_ecoli_mutated.fasta --coverageSubsampling .4 9_ecoli_mutated.cmp.h5
+##sequence-header ref000001 9_ref000001|ecoliK12_mutated
+##sequence-region ref000001 1 4639638
+ref000001 . deletion 47 47 . . . length=1;confidence=27;coverage=7;reference=A
+ref000001 . deletion 150 150 . . . length=1;confidence=37;coverage=7;reference=T
+ref000001 . SNV 249 249 . . . coverage=8;variantSeq=G;confidence=44;reference=T
+ref000001 . SNV 348 348 . . . coverage=9;variantSeq=T;confidence=52;reference=A
+ref000001 . deletion 446 446 . . . length=1;confidence=57;coverage=11;reference=A
+ref000001 . deletion 544 544 . . . length=1;confidence=8;coverage=11;reference=C
+ref000001 . SNV 645 645 . . . coverage=11;variantSeq=A;confidence=8;reference=C
+ref000001 . insertion 742 742 . . . length=1;variantSeq=G;confidence=14;coverage=11
+ref000001 . deletion 840 840 . . . length=1;confidence=8;coverage=11;reference=C
+ref000001 . insertion 938 938 . . . length=1;variantSeq=G;confidence=3;coverage=11
+ref000001 . deletion 1036 1036 . . . length=1;confidence=52;coverage=12;reference=G
+ref000001 . insertion 1134 1134 . . . length=1;variantSeq=C;confidence=22;coverage=14
+ref000001 . insertion 1231 1231 . . . length=1;variantSeq=C;confidence=45;coverage=17
+ref000001 . insertion 1330 1330 . . . length=1;variantSeq=G;confidence=63;coverage=19
+ref000001 . SNV 1428 1428 . . . coverage=21;variantSeq=A;confidence=93;reference=T
+ref000001 . insertion 1622 1622 . . . length=1;variantSeq=A;confidence=45;coverage=19
+ref000001 . SNV 1721 1721 . . . coverage=19;variantSeq=G;confidence=52;reference=C
+ref000001 . deletion 1819 1819 . . . length=1;confidence=15;coverage=20;reference=T
+ref000001 . insertion 2017 2017 . . . length=1;variantSeq=C;confidence=67;coverage=22
+ref000001 . deletion 2115 2115 . . . length=1;confidence=93;coverage=22;reference=A
+ref000001 . deletion 2214 2214 . . . length=1;confidence=93;coverage=23;reference=A
+ref000001 . SNV 2314 2314 . . . coverage=23;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 2412 2412 . . . length=1;confidence=93;coverage=22;reference=T
+ref000001 . deletion 2512 2512 . . . length=1;confidence=90;coverage=22;reference=A
+ref000001 . deletion 2611 2611 . . . length=1;confidence=93;coverage=22;reference=C
+ref000001 . SNV 2710 2710 . . . coverage=23;variantSeq=G;confidence=75;reference=A
+ref000001 . deletion 2809 2809 . . . length=1;confidence=93;coverage=22;reference=A
+ref000001 . insertion 2907 2907 . . . length=1;variantSeq=G;confidence=93;coverage=20
+ref000001 . deletion 3005 3005 . . . length=1;confidence=93;coverage=18;reference=C
+ref000001 . insertion 3103 3103 . . . length=1;variantSeq=C;confidence=23;coverage=20
+ref000001 . insertion 3201 3201 . . . length=1;variantSeq=G;confidence=93;coverage=19
+ref000001 . deletion 3399 3399 . . . length=1;confidence=93;coverage=18;reference=T
+ref000001 . insertion 3497 3497 . . . length=1;variantSeq=T;confidence=68;coverage=19
+ref000001 . insertion 3592 3592 . . . length=1;variantSeq=C;confidence=3;coverage=18
+ref000001 . SNV 3693 3693 . . . coverage=20;variantSeq=T;confidence=20;reference=A
+ref000001 . deletion 3791 3791 . . . length=1;confidence=93;coverage=20;reference=T
+ref000001 . insertion 3890 3890 . . . length=1;variantSeq=G;confidence=68;coverage=22
+ref000001 . deletion 3988 3988 . . . length=1;confidence=93;coverage=23;reference=G
+ref000001 . insertion 4086 4086 . . . length=1;variantSeq=T;confidence=75;coverage=20
+ref000001 . deletion 4185 4185 . . . length=1;confidence=93;coverage=22;reference=G
+ref000001 . insertion 4283 4283 . . . length=1;variantSeq=G;confidence=93;coverage=22
+ref000001 . insertion 4380 4380 . . . length=1;variantSeq=C;confidence=93;coverage=23
+ref000001 . SNV 4479 4479 . . . coverage=23;variantSeq=A;confidence=38;reference=C
+ref000001 . SNV 4577 4577 . . . coverage=20;variantSeq=G;confidence=88;reference=C
+ref000001 . SNV 4675 4675 . . . coverage=17;variantSeq=G;confidence=45;reference=C
+ref000001 . deletion 4774 4774 . . . length=1;confidence=45;coverage=14;reference=C
+ref000001 . insertion 4873 4873 . . . length=1;variantSeq=G;confidence=38;coverage=16
+ref000001 . SNV 4971 4971 . . . coverage=17;variantSeq=T;confidence=90;reference=C
+ref000001 . insertion 5066 5066 . . . length=1;variantSeq=C;confidence=23;coverage=18
+ref000001 . SNV 5166 5166 . . . coverage=19;variantSeq=C;confidence=45;reference=T
+ref000001 . deletion 5265 5265 . . . length=1;confidence=93;coverage=17;reference=T
+ref000001 . deletion 5364 5364 . . . length=1;confidence=38;coverage=15;reference=G
+ref000001 . deletion 5463 5463 . . . length=1;confidence=30;coverage=15;reference=A
+ref000001 . SNV 5659 5659 . . . coverage=17;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 5757 5757 . . . length=1;confidence=93;coverage=20;reference=A
+ref000001 . SNV 5857 5857 . . . coverage=25;variantSeq=C;confidence=75;reference=T
+ref000001 . SNV 5955 5955 . . . coverage=22;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 6053 6053 . . . coverage=20;variantSeq=T;confidence=60;reference=C
+ref000001 . deletion 6152 6152 . . . length=1;confidence=53;coverage=21;reference=T
+ref000001 . SNV 6250 6250 . . . coverage=21;variantSeq=G;confidence=82;reference=T
+ref000001 . SNV 6349 6349 . . . coverage=21;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 6447 6447 . . . length=1;confidence=93;coverage=19;reference=T
+ref000001 . deletion 6546 6546 . . . length=1;confidence=93;coverage=19;reference=C
+ref000001 . deletion 6646 6646 . . . length=1;confidence=53;coverage=21;reference=T
+ref000001 . deletion 6844 6844 . . . length=1;confidence=93;coverage=22;reference=T
+ref000001 . SNV 6944 6944 . . . coverage=18;variantSeq=C;confidence=38;reference=T
+ref000001 . SNV 7042 7042 . . . coverage=19;variantSeq=A;confidence=93;reference=T
+ref000001 . SNV 7337 7337 . . . coverage=22;variantSeq=T;confidence=93;reference=C
+ref000001 . deletion 7533 7533 . . . length=1;confidence=93;coverage=21;reference=G
+ref000001 . insertion 7630 7630 . . . length=1;variantSeq=C;confidence=88;coverage=20
+ref000001 . insertion 7730 7730 . . . length=1;variantSeq=G;confidence=49;coverage=20
+ref000001 . insertion 8023 8023 . . . length=1;variantSeq=T;confidence=93;coverage=21
+ref000001 . deletion 8119 8119 . . . length=1;confidence=8;coverage=21;reference=A
+ref000001 . insertion 8219 8219 . . . length=1;variantSeq=A;confidence=68;coverage=22
+ref000001 . SNV 8319 8319 . . . coverage=21;variantSeq=C;confidence=86;reference=A
+ref000001 . deletion 8417 8417 . . . length=1;confidence=93;coverage=18;reference=C
+ref000001 . SNV 8517 8517 . . . coverage=19;variantSeq=C;confidence=8;reference=T
+ref000001 . deletion 8614 8614 . . . length=1;confidence=30;coverage=21;reference=A
+ref000001 . deletion 8714 8714 . . . length=1;confidence=15;coverage=22;reference=G
+ref000001 . insertion 8812 8812 . . . length=1;variantSeq=A;confidence=82;coverage=22
+ref000001 . SNV 9007 9007 . . . coverage=20;variantSeq=G;confidence=93;reference=A
+ref000001 . deletion 9106 9106 . . . length=1;confidence=93;coverage=20;reference=T
+ref000001 . deletion 9302 9302 . . . length=1;confidence=93;coverage=22;reference=T
+ref000001 . SNV 9402 9402 . . . coverage=23;variantSeq=A;confidence=42;reference=T
+ref000001 . deletion 9500 9500 . . . length=1;confidence=90;coverage=24;reference=C
+ref000001 . insertion 9598 9598 . . . length=1;variantSeq=A;confidence=60;coverage=24
+ref000001 . SNV 9697 9697 . . . coverage=24;variantSeq=A;confidence=93;reference=G
+ref000001 . insertion 9794 9794 . . . length=1;variantSeq=C;confidence=74;coverage=23
+ref000001 . insertion 9892 9892 . . . length=1;variantSeq=C;confidence=93;coverage=23
+ref000001 . insertion 9989 9989 . . . length=1;variantSeq=A;confidence=67;coverage=22
+ref000001 . insertion 10086 10086 . . . length=1;variantSeq=G;confidence=93;coverage=22
+ref000001 . SNV 10185 10185 . . . coverage=22;variantSeq=G;confidence=93;reference=A
+ref000001 . SNV 10283 10283 . . . coverage=20;variantSeq=T;confidence=90;reference=C
+ref000001 . SNV 10381 10381 . . . coverage=18;variantSeq=A;confidence=81;reference=T
+ref000001 . SNV 10480 10480 . . . coverage=18;variantSeq=C;confidence=75;reference=T
+ref000001 . SNV 10578 10578 . . . coverage=20;variantSeq=A;confidence=86;reference=T
+ref000001 . SNV 10676 10676 . . . coverage=19;variantSeq=C;confidence=83;reference=G
+ref000001 . deletion 10872 10872 . . . length=1;confidence=93;coverage=20;reference=G
+ref000001 . deletion 10972 10972 . . . length=1;confidence=15;coverage=20;reference=A
+ref000001 . SNV 11070 11070 . . . coverage=18;variantSeq=G;confidence=15;reference=T
+ref000001 . SNV 11168 11168 . . . coverage=19;variantSeq=C;confidence=53;reference=A
+ref000001 . insertion 11266 11266 . . . length=1;variantSeq=A;confidence=67;coverage=19
+ref000001 . SNV 11364 11364 . . . coverage=19;variantSeq=G;confidence=60;reference=C
+ref000001 . SNV 11462 11462 . . . coverage=18;variantSeq=G;confidence=45;reference=C
+ref000001 . deletion 11561 11561 . . . length=1;confidence=87;coverage=19;reference=T
+ref000001 . insertion 11562 11562 . . . length=1;variantSeq=G;confidence=3;coverage=19
+ref000001 . insertion 11658 11658 . . . length=1;variantSeq=G;confidence=93;coverage=20
+ref000001 . insertion 11755 11755 . . . length=1;variantSeq=A;confidence=88;coverage=21
+ref000001 . insertion 11952 11952 . . . length=1;variantSeq=T;confidence=93;coverage=19
+ref000001 . deletion 12048 12048 . . . length=1;confidence=15;coverage=16;reference=A
+ref000001 . insertion 12149 12149 . . . length=1;variantSeq=G;confidence=29;coverage=16
+ref000001 . insertion 12246 12246 . . . length=1;variantSeq=A;confidence=8;coverage=16
+ref000001 . deletion 12345 12345 . . . length=1;confidence=93;coverage=17;reference=T
+ref000001 . SNV 12444 12444 . . . coverage=18;variantSeq=T;confidence=30;reference=C
+ref000001 . deletion 12542 12542 . . . length=1;confidence=93;coverage=18;reference=A
+ref000001 . insertion 12739 12739 . . . length=1;variantSeq=T;confidence=30;coverage=15
+ref000001 . deletion 13130 13130 . . . length=1;confidence=93;coverage=19;reference=G
+ref000001 . SNV 13230 13230 . . . coverage=17;variantSeq=T;confidence=30;reference=G
+ref000001 . insertion 13427 13427 . . . length=1;variantSeq=C;confidence=58;coverage=15
+ref000001 . insertion 13524 13524 . . . length=1;variantSeq=G;confidence=8;coverage=12
+ref000001 . SNV 13622 13622 . . . coverage=13;variantSeq=G;confidence=59;reference=A
+ref000001 . insertion 13720 13720 . . . length=1;variantSeq=G;confidence=30;coverage=13
+ref000001 . insertion 13817 13817 . . . length=1;variantSeq=A;confidence=52;coverage=12
+ref000001 . insertion 13914 13914 . . . length=1;variantSeq=C;confidence=63;coverage=13
+ref000001 . SNV 14013 14013 . . . coverage=11;variantSeq=A;confidence=30;reference=T
+ref000001 . SNV 14111 14111 . . . coverage=11;variantSeq=A;confidence=48;reference=T
+ref000001 . deletion 14209 14209 . . . length=1;confidence=75;coverage=10;reference=T
+ref000001 . SNV 14309 14309 . . . coverage=11;variantSeq=A;confidence=67;reference=G
+ref000001 . insertion 14407 14407 . . . length=1;variantSeq=G;confidence=51;coverage=13
+ref000001 . SNV 14505 14505 . . . coverage=14;variantSeq=G;confidence=67;reference=A
+ref000001 . SNV 14603 14603 . . . coverage=12;variantSeq=C;confidence=52;reference=G
+ref000001 . insertion 14700 14700 . . . length=1;variantSeq=A;confidence=14;coverage=13
+ref000001 . deletion 14799 14799 . . . length=1;confidence=45;coverage=13;reference=G
+ref000001 . SNV 14997 14997 . . . coverage=13;variantSeq=C;confidence=63;reference=G
+ref000001 . deletion 15096 15096 . . . length=1;confidence=8;coverage=12;reference=G
+ref000001 . deletion 15195 15195 . . . length=1;confidence=72;coverage=13;reference=A
+ref000001 . SNV 15394 15394 . . . coverage=12;variantSeq=G;confidence=30;reference=C
+ref000001 . deletion 15492 15492 . . . length=1;confidence=75;coverage=10;reference=G
+ref000001 . deletion 15590 15590 . . . length=1;confidence=15;coverage=10;reference=C
+ref000001 . insertion 15690 15690 . . . length=1;variantSeq=G;confidence=15;coverage=10
+ref000001 . insertion 15787 15787 . . . length=1;variantSeq=A;confidence=49;coverage=10
+ref000001 . insertion 15885 15885 . . . length=1;variantSeq=C;confidence=15;coverage=12
+ref000001 . deletion 16080 16080 . . . length=1;confidence=30;coverage=14;reference=G
+ref000001 . deletion 16180 16180 . . . length=1;confidence=23;coverage=14;reference=T
+ref000001 . insertion 16278 16278 . . . length=1;variantSeq=T;confidence=75;coverage=14
+ref000001 . insertion 16375 16375 . . . length=1;variantSeq=G;confidence=70;coverage=14
+ref000001 . insertion 16473 16473 . . . length=1;variantSeq=G;confidence=53;coverage=14
+ref000001 . insertion 16570 16570 . . . length=1;variantSeq=C;confidence=43;coverage=13
+ref000001 . deletion 16668 16668 . . . length=1;confidence=87;coverage=15;reference=A
+ref000001 . insertion 16767 16767 . . . length=1;variantSeq=G;confidence=6;coverage=14
+ref000001 . SNV 16865 16865 . . . coverage=14;variantSeq=T;confidence=49;reference=G
+ref000001 . insertion 16963 16963 . . . length=1;variantSeq=C;confidence=30;coverage=13
+ref000001 . insertion 17060 17060 . . . length=1;variantSeq=C;confidence=59;coverage=13
+ref000001 . deletion 17158 17158 . . . length=1;confidence=64;coverage=12;reference=G
+ref000001 . insertion 17354 17354 . . . length=1;variantSeq=T;confidence=79;coverage=14
+ref000001 . SNV 17452 17452 . . . coverage=15;variantSeq=G;confidence=68;reference=A
+ref000001 . insertion 17550 17550 . . . length=1;variantSeq=T;confidence=93;coverage=18
+ref000001 . insertion 17744 17744 . . . length=1;variantSeq=C;confidence=60;coverage=17
+ref000001 . deletion 17941 17941 . . . length=1;confidence=68;coverage=17;reference=C
+ref000001 . SNV 18040 18040 . . . coverage=18;variantSeq=G;confidence=45;reference=C
+ref000001 . SNV 18139 18139 . . . coverage=15;variantSeq=A;confidence=23;reference=G
+ref000001 . SNV 18237 18237 . . . coverage=17;variantSeq=T;confidence=80;reference=C
+ref000001 . SNV 18336 18336 . . . coverage=18;variantSeq=C;confidence=45;reference=T
+ref000001 . SNV 18434 18434 . . . coverage=17;variantSeq=T;confidence=83;reference=A
+ref000001 . deletion 18532 18532 . . . length=1;confidence=8;coverage=17;reference=A
+ref000001 . deletion 18632 18632 . . . length=1;confidence=90;coverage=17;reference=T
+ref000001 . insertion 18827 18827 . . . length=1;variantSeq=T;confidence=15;coverage=18
+ref000001 . SNV 18926 18926 . . . coverage=18;variantSeq=T;confidence=64;reference=C
+ref000001 . insertion 19023 19023 . . . length=1;variantSeq=A;confidence=8;coverage=15
+ref000001 . SNV 19121 19121 . . . coverage=14;variantSeq=T;confidence=45;reference=G
+ref000001 . SNV 19220 19220 . . . coverage=15;variantSeq=A;confidence=78;reference=C
+ref000001 . insertion 19317 19317 . . . length=1;variantSeq=C;confidence=3;coverage=14
+ref000001 . SNV 19416 19416 . . . coverage=15;variantSeq=T;confidence=66;reference=C
+ref000001 . SNV 19514 19514 . . . coverage=13;variantSeq=A;confidence=59;reference=G
+ref000001 . insertion 19611 19611 . . . length=1;variantSeq=G;confidence=22;coverage=14
+ref000001 . deletion 19710 19710 . . . length=1;confidence=93;coverage=14;reference=C
+ref000001 . insertion 19808 19808 . . . length=1;variantSeq=T;confidence=37;coverage=14
+ref000001 . insertion 19905 19905 . . . length=1;variantSeq=C;confidence=59;coverage=18
+ref000001 . SNV 20004 20004 . . . coverage=22;variantSeq=C;confidence=77;reference=T
+ref000001 . deletion 20102 20102 . . . length=1;confidence=93;coverage=22;reference=A
+ref000001 . deletion 20201 20201 . . . length=1;confidence=8;coverage=20;reference=A
+ref000001 . insertion 20299 20299 . . . length=1;variantSeq=A;confidence=80;coverage=19
+ref000001 . deletion 20397 20397 . . . length=1;confidence=93;coverage=19;reference=C
+ref000001 . insertion 20497 20497 . . . length=1;variantSeq=G;confidence=8;coverage=17
+ref000001 . deletion 20693 20693 . . . length=1;confidence=38;coverage=16;reference=C
+ref000001 . SNV 20793 20793 . . . coverage=16;variantSeq=A;confidence=8;reference=G
+ref000001 . SNV 20891 20891 . . . coverage=16;variantSeq=T;confidence=66;reference=A
+ref000001 . insertion 20988 20988 . . . length=1;variantSeq=A;confidence=66;coverage=16
+ref000001 . insertion 21086 21086 . . . length=1;variantSeq=C;confidence=93;coverage=18
+ref000001 . insertion 21183 21183 . . . length=1;variantSeq=A;confidence=93;coverage=19
+ref000001 . deletion 21278 21278 . . . length=1;confidence=38;coverage=20;reference=T
+ref000001 . SNV 21381 21381 . . . coverage=19;variantSeq=T;confidence=23;reference=C
diff --git a/tests/data/yarm/9_ecoli_mutated_6.gff b/tests/data/yarm/9_ecoli_mutated_6.gff
new file mode 100644
index 0000000..795356c
--- /dev/null
+++ b/tests/data/yarm/9_ecoli_mutated_6.gff
@@ -0,0 +1,200 @@
+##gff-version 3
+##pacbio-variant-version 1.3.1
+##date Mon Apr 16 14:43:56 2012
+##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
+##source GenomicConsensus v0.1.0
+##source-commandline /mnt/secondary/Smrtpipe/builds/Assembly_C2_Nightly_Archive/build187-107116/analysis/bin/variantCaller.py -j4 --algorithm=plurality -o 9_ecoli_mutated_6.gff -r 9_ecoli_mutated/sequence/9_ecoli_mutated.fasta --coverageSubsampling .6 9_ecoli_mutated.cmp.h5
+##sequence-header ref000001 9_ref000001|ecoliK12_mutated
+##sequence-region ref000001 1 4639638
+ref000001 . deletion 47 47 . . . length=1;confidence=29;coverage=10;reference=A
+ref000001 . deletion 150 150 . . . length=1;confidence=8;coverage=11;reference=T
+ref000001 . SNV 249 249 . . . coverage=12;variantSeq=G;confidence=52;reference=T
+ref000001 . SNV 348 348 . . . coverage=13;variantSeq=T;confidence=63;reference=A
+ref000001 . deletion 446 446 . . . length=1;confidence=85;coverage=16;reference=A
+ref000001 . SNV 645 645 . . . coverage=17;variantSeq=A;confidence=3;reference=C
+ref000001 . insertion 742 742 . . . length=1;variantSeq=G;confidence=52;coverage=17
+ref000001 . SNV 840 840 . . . coverage=17;variantSeq=T;confidence=8;reference=C
+ref000001 . deletion 1036 1036 . . . length=1;confidence=93;coverage=19;reference=G
+ref000001 . insertion 1134 1134 . . . length=1;variantSeq=C;confidence=8;coverage=22
+ref000001 . insertion 1231 1231 . . . length=1;variantSeq=C;confidence=15;coverage=23
+ref000001 . insertion 1330 1330 . . . length=1;variantSeq=G;confidence=93;coverage=27
+ref000001 . SNV 1428 1428 . . . coverage=28;variantSeq=A;confidence=30;reference=T
+ref000001 . insertion 1622 1622 . . . length=1;variantSeq=A;confidence=38;coverage=30
+ref000001 . SNV 1721 1721 . . . coverage=31;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 1819 1819 . . . length=1;confidence=15;coverage=31;reference=T
+ref000001 . insertion 2017 2017 . . . length=1;variantSeq=C;confidence=75;coverage=24
+ref000001 . deletion 2115 2115 . . . length=1;confidence=93;coverage=23;reference=A
+ref000001 . deletion 2214 2214 . . . length=1;confidence=93;coverage=26;reference=A
+ref000001 . SNV 2314 2314 . . . coverage=27;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 2412 2412 . . . length=1;confidence=93;coverage=27;reference=T
+ref000001 . deletion 2512 2512 . . . length=1;confidence=93;coverage=29;reference=A
+ref000001 . deletion 2611 2611 . . . length=1;confidence=93;coverage=28;reference=C
+ref000001 . SNV 2710 2710 . . . coverage=29;variantSeq=G;confidence=68;reference=A
+ref000001 . deletion 2809 2809 . . . length=1;confidence=93;coverage=29;reference=A
+ref000001 . insertion 2907 2907 . . . length=1;variantSeq=G;confidence=93;coverage=29
+ref000001 . deletion 3005 3005 . . . length=1;confidence=93;coverage=31;reference=C
+ref000001 . insertion 3103 3103 . . . length=1;variantSeq=C;confidence=53;coverage=32
+ref000001 . insertion 3201 3201 . . . length=1;variantSeq=G;confidence=93;coverage=32
+ref000001 . deletion 3399 3399 . . . length=1;confidence=93;coverage=29;reference=T
+ref000001 . insertion 3497 3497 . . . length=1;variantSeq=T;confidence=93;coverage=32
+ref000001 . insertion 3592 3592 . . . length=1;variantSeq=C;confidence=23;coverage=30
+ref000001 . SNV 3693 3693 . . . coverage=32;variantSeq=T;confidence=30;reference=A
+ref000001 . deletion 3791 3791 . . . length=1;confidence=93;coverage=32;reference=T
+ref000001 . insertion 3890 3890 . . . length=1;variantSeq=G;confidence=93;coverage=34
+ref000001 . deletion 3988 3988 . . . length=1;confidence=93;coverage=36;reference=G
+ref000001 . insertion 4086 4086 . . . length=1;variantSeq=T;confidence=93;coverage=34
+ref000001 . deletion 4185 4185 . . . length=1;confidence=93;coverage=37;reference=G
+ref000001 . insertion 4283 4283 . . . length=1;variantSeq=G;confidence=93;coverage=35
+ref000001 . insertion 4380 4380 . . . length=1;variantSeq=C;confidence=93;coverage=36
+ref000001 . SNV 4479 4479 . . . coverage=35;variantSeq=A;confidence=53;reference=C
+ref000001 . SNV 4577 4577 . . . coverage=32;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 4675 4675 . . . coverage=33;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 4774 4774 . . . length=1;confidence=93;coverage=32;reference=C
+ref000001 . insertion 4873 4873 . . . length=1;variantSeq=G;confidence=60;coverage=32
+ref000001 . SNV 4971 4971 . . . coverage=32;variantSeq=T;confidence=93;reference=C
+ref000001 . SNV 5166 5166 . . . coverage=30;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 5265 5265 . . . length=1;confidence=93;coverage=27;reference=T
+ref000001 . deletion 5463 5463 . . . length=1;confidence=93;coverage=27;reference=A
+ref000001 . SNV 5659 5659 . . . coverage=27;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 5757 5757 . . . length=1;confidence=93;coverage=28;reference=A
+ref000001 . SNV 5857 5857 . . . coverage=31;variantSeq=C;confidence=93;reference=T
+ref000001 . SNV 5955 5955 . . . coverage=31;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 6053 6053 . . . coverage=33;variantSeq=T;confidence=83;reference=C
+ref000001 . deletion 6152 6152 . . . length=1;confidence=93;coverage=35;reference=T
+ref000001 . SNV 6250 6250 . . . coverage=34;variantSeq=G;confidence=93;reference=T
+ref000001 . SNV 6349 6349 . . . coverage=35;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 6447 6447 . . . length=1;confidence=93;coverage=34;reference=T
+ref000001 . deletion 6546 6546 . . . length=1;confidence=93;coverage=34;reference=C
+ref000001 . deletion 6646 6646 . . . length=1;confidence=23;coverage=34;reference=T
+ref000001 . deletion 6745 6745 . . . length=1;confidence=15;coverage=33;reference=C
+ref000001 . deletion 6844 6844 . . . length=1;confidence=93;coverage=32;reference=T
+ref000001 . SNV 6944 6944 . . . coverage=31;variantSeq=C;confidence=90;reference=T
+ref000001 . SNV 7042 7042 . . . coverage=29;variantSeq=A;confidence=93;reference=T
+ref000001 . insertion 7138 7138 . . . length=1;variantSeq=A;confidence=30;coverage=31
+ref000001 . deletion 7238 7238 . . . length=1;confidence=15;coverage=32;reference=G
+ref000001 . SNV 7337 7337 . . . coverage=34;variantSeq=T;confidence=93;reference=C
+ref000001 . deletion 7533 7533 . . . length=1;confidence=93;coverage=36;reference=G
+ref000001 . insertion 7630 7630 . . . length=1;variantSeq=C;confidence=93;coverage=35
+ref000001 . insertion 7730 7730 . . . length=1;variantSeq=G;confidence=93;coverage=37
+ref000001 . insertion 8023 8023 . . . length=1;variantSeq=T;confidence=93;coverage=31
+ref000001 . insertion 8219 8219 . . . length=1;variantSeq=A;confidence=93;coverage=33
+ref000001 . SNV 8319 8319 . . . coverage=32;variantSeq=C;confidence=93;reference=A
+ref000001 . deletion 8417 8417 . . . length=1;confidence=93;coverage=32;reference=C
+ref000001 . SNV 8517 8517 . . . coverage=35;variantSeq=C;confidence=83;reference=T
+ref000001 . deletion 8614 8614 . . . length=1;confidence=8;coverage=36;reference=A
+ref000001 . SNV 8714 8714 . . . coverage=38;variantSeq=C;confidence=8;reference=G
+ref000001 . insertion 8812 8812 . . . length=1;variantSeq=A;confidence=93;coverage=37
+ref000001 . SNV 9007 9007 . . . coverage=32;variantSeq=G;confidence=93;reference=A
+ref000001 . deletion 9106 9106 . . . length=1;confidence=93;coverage=31;reference=T
+ref000001 . deletion 9302 9302 . . . length=1;confidence=93;coverage=33;reference=T
+ref000001 . SNV 9402 9402 . . . coverage=30;variantSeq=A;confidence=93;reference=T
+ref000001 . deletion 9500 9500 . . . length=1;confidence=93;coverage=31;reference=C
+ref000001 . insertion 9598 9598 . . . length=1;variantSeq=A;confidence=93;coverage=30
+ref000001 . SNV 9697 9697 . . . coverage=31;variantSeq=A;confidence=93;reference=G
+ref000001 . insertion 9794 9794 . . . length=1;variantSeq=C;confidence=93;coverage=30
+ref000001 . insertion 9892 9892 . . . length=1;variantSeq=C;confidence=93;coverage=32
+ref000001 . insertion 9989 9989 . . . length=1;variantSeq=A;confidence=93;coverage=31
+ref000001 . insertion 10086 10086 . . . length=1;variantSeq=G;confidence=93;coverage=28
+ref000001 . SNV 10185 10185 . . . coverage=29;variantSeq=G;confidence=93;reference=A
+ref000001 . SNV 10283 10283 . . . coverage=29;variantSeq=T;confidence=93;reference=C
+ref000001 . SNV 10381 10381 . . . coverage=31;variantSeq=A;confidence=45;reference=T
+ref000001 . SNV 10480 10480 . . . coverage=32;variantSeq=C;confidence=30;reference=T
+ref000001 . SNV 10578 10578 . . . coverage=33;variantSeq=A;confidence=93;reference=T
+ref000001 . SNV 10676 10676 . . . coverage=32;variantSeq=C;confidence=93;reference=G
+ref000001 . deletion 10872 10872 . . . length=1;confidence=93;coverage=28;reference=G
+ref000001 . SNV 10972 10972 . . . coverage=31;variantSeq=C;confidence=23;reference=A
+ref000001 . SNV 11070 11070 . . . coverage=32;variantSeq=G;confidence=8;reference=T
+ref000001 . SNV 11168 11168 . . . coverage=33;variantSeq=C;confidence=75;reference=A
+ref000001 . insertion 11266 11266 . . . length=1;variantSeq=A;confidence=90;coverage=33
+ref000001 . SNV 11364 11364 . . . coverage=33;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 11462 11462 . . . coverage=30;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 11561 11561 . . . length=1;confidence=93;coverage=30;reference=T
+ref000001 . insertion 11562 11562 . . . length=1;variantSeq=G;confidence=3;coverage=30
+ref000001 . insertion 11658 11658 . . . length=1;variantSeq=G;confidence=93;coverage=31
+ref000001 . insertion 11755 11755 . . . length=1;variantSeq=A;confidence=83;coverage=30
+ref000001 . deletion 11855 11855 . . . length=1;confidence=30;coverage=30;reference=A
+ref000001 . insertion 11952 11952 . . . length=1;variantSeq=T;confidence=93;coverage=30
+ref000001 . insertion 12149 12149 . . . length=1;variantSeq=G;confidence=87;coverage=29
+ref000001 . deletion 12345 12345 . . . length=1;confidence=93;coverage=27;reference=T
+ref000001 . SNV 12444 12444 . . . coverage=28;variantSeq=T;confidence=53;reference=C
+ref000001 . deletion 12542 12542 . . . length=1;confidence=93;coverage=28;reference=A
+ref000001 . deletion 12641 12641 . . . length=1;confidence=8;coverage=26;reference=A
+ref000001 . insertion 12739 12739 . . . length=1;variantSeq=T;confidence=53;coverage=24
+ref000001 . insertion 12935 12935 . . . length=1;variantSeq=A;confidence=3;coverage=27
+ref000001 . deletion 13130 13130 . . . length=1;confidence=93;coverage=25;reference=G
+ref000001 . SNV 13230 13230 . . . coverage=23;variantSeq=T;confidence=8;reference=G
+ref000001 . deletion 13329 13329 . . . length=1;confidence=23;coverage=23;reference=A
+ref000001 . insertion 13427 13427 . . . length=1;variantSeq=C;confidence=93;coverage=25
+ref000001 . insertion 13524 13524 . . . length=1;variantSeq=G;confidence=23;coverage=23
+ref000001 . SNV 13622 13622 . . . coverage=24;variantSeq=G;confidence=93;reference=A
+ref000001 . insertion 13720 13720 . . . length=1;variantSeq=G;confidence=60;coverage=22
+ref000001 . insertion 13817 13817 . . . length=1;variantSeq=A;confidence=93;coverage=21
+ref000001 . insertion 13914 13914 . . . length=1;variantSeq=C;confidence=60;coverage=19
+ref000001 . SNV 14013 14013 . . . coverage=19;variantSeq=A;confidence=23;reference=T
+ref000001 . SNV 14111 14111 . . . coverage=17;variantSeq=A;confidence=93;reference=T
+ref000001 . deletion 14209 14209 . . . length=1;confidence=90;coverage=17;reference=T
+ref000001 . SNV 14309 14309 . . . coverage=17;variantSeq=A;confidence=93;reference=G
+ref000001 . insertion 14407 14407 . . . length=1;variantSeq=G;confidence=75;coverage=18
+ref000001 . SNV 14505 14505 . . . coverage=19;variantSeq=G;confidence=93;reference=A
+ref000001 . SNV 14603 14603 . . . coverage=16;variantSeq=C;confidence=82;reference=G
+ref000001 . insertion 14700 14700 . . . length=1;variantSeq=A;confidence=37;coverage=18
+ref000001 . deletion 14799 14799 . . . length=1;confidence=53;coverage=18;reference=G
+ref000001 . SNV 14997 14997 . . . coverage=17;variantSeq=C;confidence=72;reference=G
+ref000001 . deletion 15195 15195 . . . length=1;confidence=93;coverage=20;reference=A
+ref000001 . SNV 15394 15394 . . . coverage=19;variantSeq=G;confidence=60;reference=C
+ref000001 . deletion 15492 15492 . . . length=1;confidence=90;coverage=16;reference=G
+ref000001 . insertion 15787 15787 . . . length=1;variantSeq=A;confidence=59;coverage=17
+ref000001 . insertion 15885 15885 . . . length=1;variantSeq=C;confidence=15;coverage=18
+ref000001 . deletion 16180 16180 . . . length=1;confidence=30;coverage=20;reference=T
+ref000001 . insertion 16278 16278 . . . length=1;variantSeq=T;confidence=45;coverage=19
+ref000001 . insertion 16375 16375 . . . length=1;variantSeq=G;confidence=52;coverage=19
+ref000001 . insertion 16473 16473 . . . length=1;variantSeq=G;confidence=91;coverage=19
+ref000001 . insertion 16570 16570 . . . length=1;variantSeq=C;confidence=37;coverage=19
+ref000001 . deletion 16668 16668 . . . length=1;confidence=93;coverage=23;reference=A
+ref000001 . insertion 16767 16767 . . . length=1;variantSeq=G;confidence=75;coverage=23
+ref000001 . SNV 16865 16865 . . . coverage=22;variantSeq=T;confidence=89;reference=G
+ref000001 . insertion 16963 16963 . . . length=1;variantSeq=C;confidence=45;coverage=23
+ref000001 . insertion 17060 17060 . . . length=1;variantSeq=C;confidence=93;coverage=21
+ref000001 . deletion 17158 17158 . . . length=1;confidence=93;coverage=20;reference=G
+ref000001 . insertion 17354 17354 . . . length=1;variantSeq=T;confidence=93;coverage=20
+ref000001 . SNV 17452 17452 . . . coverage=21;variantSeq=G;confidence=93;reference=A
+ref000001 . insertion 17550 17550 . . . length=1;variantSeq=T;confidence=93;coverage=23
+ref000001 . deletion 17648 17648 . . . length=1;confidence=12;coverage=22;reference=C
+ref000001 . insertion 17744 17744 . . . length=1;variantSeq=C;confidence=93;coverage=22
+ref000001 . deletion 17941 17941 . . . length=1;confidence=75;coverage=21;reference=C
+ref000001 . SNV 18040 18040 . . . coverage=24;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 18139 18139 . . . coverage=24;variantSeq=A;confidence=38;reference=G
+ref000001 . SNV 18237 18237 . . . coverage=25;variantSeq=T;confidence=83;reference=C
+ref000001 . SNV 18336 18336 . . . coverage=25;variantSeq=C;confidence=53;reference=T
+ref000001 . SNV 18434 18434 . . . coverage=24;variantSeq=T;confidence=93;reference=A
+ref000001 . deletion 18632 18632 . . . length=1;confidence=93;coverage=22;reference=T
+ref000001 . SNV 18926 18926 . . . coverage=24;variantSeq=T;confidence=82;reference=C
+ref000001 . insertion 19023 19023 . . . length=1;variantSeq=A;confidence=3;coverage=21
+ref000001 . SNV 19121 19121 . . . coverage=26;variantSeq=T;confidence=45;reference=G
+ref000001 . SNV 19220 19220 . . . coverage=27;variantSeq=A;confidence=93;reference=C
+ref000001 . insertion 19317 19317 . . . length=1;variantSeq=C;confidence=53;coverage=26
+ref000001 . SNV 19416 19416 . . . coverage=26;variantSeq=T;confidence=93;reference=C
+ref000001 . SNV 19514 19514 . . . coverage=22;variantSeq=A;confidence=60;reference=G
+ref000001 . insertion 19611 19611 . . . length=1;variantSeq=G;confidence=38;coverage=24
+ref000001 . deletion 19710 19710 . . . length=1;confidence=93;coverage=25;reference=C
+ref000001 . insertion 19808 19808 . . . length=1;variantSeq=T;confidence=93;coverage=25
+ref000001 . insertion 19905 19905 . . . length=1;variantSeq=C;confidence=93;coverage=29
+ref000001 . SNV 20004 20004 . . . coverage=27;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 20102 20102 . . . length=1;confidence=93;coverage=29;reference=A
+ref000001 . SNV 20201 20201 . . . coverage=28;variantSeq=C;confidence=3;reference=A
+ref000001 . insertion 20299 20299 . . . length=1;variantSeq=A;confidence=93;coverage=27
+ref000001 . deletion 20397 20397 . . . length=1;confidence=93;coverage=27;reference=C
+ref000001 . insertion 20497 20497 . . . length=1;variantSeq=G;confidence=3;coverage=25
+ref000001 . deletion 20593 20593 . . . length=1;confidence=60;coverage=23;reference=T
+ref000001 . deletion 20693 20693 . . . length=1;confidence=82;coverage=20;reference=C
+ref000001 . SNV 20793 20793 . . . coverage=20;variantSeq=A;confidence=23;reference=G
+ref000001 . SNV 20891 20891 . . . coverage=21;variantSeq=T;confidence=93;reference=A
+ref000001 . insertion 20988 20988 . . . length=1;variantSeq=A;confidence=82;coverage=21
+ref000001 . insertion 21086 21086 . . . length=1;variantSeq=C;confidence=52;coverage=22
+ref000001 . insertion 21183 21183 . . . length=1;variantSeq=A;confidence=93;coverage=22
+ref000001 . deletion 21278 21278 . . . length=1;confidence=30;coverage=24;reference=T
+ref000001 . deletion 21381 21381 . . . length=1;confidence=8;coverage=23;reference=C
+ref000001 . deletion 21578 21578 . . . length=1;confidence=93;coverage=25;reference=G
+ref000001 . SNV 21678 21678 . . . coverage=27;variantSeq=T;confidence=53;reference=G
+ref000001 . insertion 21874 21874 . . . length=1;variantSeq=G;confidence=83;coverage=26
+ref000001 . insertion 21970 21970 . . . length=1;variantSeq=G;confidence=45;coverage=26
diff --git a/tests/data/yarm/9_ecoli_mutated_8.gff b/tests/data/yarm/9_ecoli_mutated_8.gff
new file mode 100644
index 0000000..2a91319
--- /dev/null
+++ b/tests/data/yarm/9_ecoli_mutated_8.gff
@@ -0,0 +1,200 @@
+##gff-version 3
+##pacbio-variant-version 1.3.1
+##date Mon Apr 16 14:45:54 2012
+##feature-ontology http://song.cvs.sourceforge.net/*checkout*/song/ontology/sofa.obo?revision=1.12
+##source GenomicConsensus v0.1.0
+##source-commandline /mnt/secondary/Smrtpipe/builds/Assembly_C2_Nightly_Archive/build187-107116/analysis/bin/variantCaller.py -j4 --algorithm=plurality -o 9_ecoli_mutated_8.gff -r 9_ecoli_mutated/sequence/9_ecoli_mutated.fasta --coverageSubsampling .8 9_ecoli_mutated.cmp.h5
+##sequence-header ref000001 9_ref000001|ecoliK12_mutated
+##sequence-region ref000001 1 4639638
+ref000001 . deletion 47 47 . . . length=1;confidence=30;coverage=14;reference=A
+ref000001 . deletion 150 150 . . . length=1;confidence=45;coverage=16;reference=T
+ref000001 . SNV 249 249 . . . coverage=18;variantSeq=G;confidence=89;reference=T
+ref000001 . SNV 348 348 . . . coverage=19;variantSeq=T;confidence=67;reference=A
+ref000001 . deletion 446 446 . . . length=1;confidence=93;coverage=22;reference=A
+ref000001 . SNV 645 645 . . . coverage=24;variantSeq=A;confidence=3;reference=C
+ref000001 . insertion 742 742 . . . length=1;variantSeq=G;confidence=45;coverage=24
+ref000001 . SNV 840 840 . . . coverage=24;variantSeq=T;confidence=45;reference=C
+ref000001 . insertion 938 938 . . . length=1;variantSeq=G;confidence=3;coverage=22
+ref000001 . deletion 1036 1036 . . . length=1;confidence=93;coverage=25;reference=G
+ref000001 . insertion 1134 1134 . . . length=1;variantSeq=C;confidence=23;coverage=26
+ref000001 . insertion 1330 1330 . . . length=1;variantSeq=G;confidence=93;coverage=32
+ref000001 . SNV 1428 1428 . . . coverage=34;variantSeq=A;confidence=83;reference=T
+ref000001 . insertion 1622 1622 . . . length=1;variantSeq=A;confidence=53;coverage=35
+ref000001 . SNV 1721 1721 . . . coverage=38;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 1819 1819 . . . length=1;confidence=8;coverage=38;reference=T
+ref000001 . insertion 2017 2017 . . . length=1;variantSeq=C;confidence=93;coverage=35
+ref000001 . deletion 2115 2115 . . . length=1;confidence=93;coverage=35;reference=A
+ref000001 . deletion 2214 2214 . . . length=1;confidence=93;coverage=37;reference=A
+ref000001 . SNV 2314 2314 . . . coverage=39;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 2412 2412 . . . length=1;confidence=93;coverage=39;reference=T
+ref000001 . deletion 2512 2512 . . . length=1;confidence=93;coverage=39;reference=A
+ref000001 . deletion 2611 2611 . . . length=1;confidence=93;coverage=40;reference=C
+ref000001 . SNV 2710 2710 . . . coverage=40;variantSeq=G;confidence=93;reference=A
+ref000001 . deletion 2809 2809 . . . length=1;confidence=93;coverage=38;reference=A
+ref000001 . insertion 2907 2907 . . . length=1;variantSeq=G;confidence=93;coverage=36
+ref000001 . deletion 3005 3005 . . . length=1;confidence=93;coverage=38;reference=C
+ref000001 . insertion 3103 3103 . . . length=1;variantSeq=C;confidence=68;coverage=40
+ref000001 . insertion 3201 3201 . . . length=1;variantSeq=G;confidence=93;coverage=40
+ref000001 . deletion 3399 3399 . . . length=1;confidence=93;coverage=42;reference=T
+ref000001 . insertion 3497 3497 . . . length=1;variantSeq=T;confidence=93;coverage=44
+ref000001 . SNV 3693 3693 . . . coverage=45;variantSeq=T;confidence=60;reference=A
+ref000001 . deletion 3791 3791 . . . length=1;confidence=93;coverage=44;reference=T
+ref000001 . insertion 3890 3890 . . . length=1;variantSeq=G;confidence=93;coverage=46
+ref000001 . deletion 3988 3988 . . . length=1;confidence=93;coverage=47;reference=G
+ref000001 . insertion 4086 4086 . . . length=1;variantSeq=T;confidence=93;coverage=43
+ref000001 . deletion 4185 4185 . . . length=1;confidence=93;coverage=48;reference=G
+ref000001 . insertion 4283 4283 . . . length=1;variantSeq=G;confidence=93;coverage=48
+ref000001 . insertion 4380 4380 . . . length=1;variantSeq=C;confidence=93;coverage=50
+ref000001 . SNV 4479 4479 . . . coverage=48;variantSeq=A;confidence=93;reference=C
+ref000001 . SNV 4577 4577 . . . coverage=44;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 4675 4675 . . . coverage=43;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 4774 4774 . . . length=1;confidence=93;coverage=40;reference=C
+ref000001 . SNV 4971 4971 . . . coverage=41;variantSeq=T;confidence=93;reference=C
+ref000001 . insertion 5066 5066 . . . length=1;variantSeq=C;confidence=60;coverage=44
+ref000001 . SNV 5166 5166 . . . coverage=44;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 5265 5265 . . . length=1;confidence=93;coverage=41;reference=T
+ref000001 . deletion 5463 5463 . . . length=1;confidence=93;coverage=36;reference=A
+ref000001 . SNV 5659 5659 . . . coverage=37;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 5757 5757 . . . length=1;confidence=93;coverage=40;reference=A
+ref000001 . SNV 5857 5857 . . . coverage=43;variantSeq=C;confidence=93;reference=T
+ref000001 . SNV 5955 5955 . . . coverage=42;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 6053 6053 . . . coverage=44;variantSeq=T;confidence=93;reference=C
+ref000001 . deletion 6152 6152 . . . length=1;confidence=93;coverage=46;reference=T
+ref000001 . SNV 6250 6250 . . . coverage=46;variantSeq=G;confidence=93;reference=T
+ref000001 . SNV 6349 6349 . . . coverage=46;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 6447 6447 . . . length=1;confidence=93;coverage=44;reference=T
+ref000001 . deletion 6546 6546 . . . length=1;confidence=93;coverage=42;reference=C
+ref000001 . deletion 6646 6646 . . . length=1;confidence=45;coverage=43;reference=T
+ref000001 . deletion 6844 6844 . . . length=1;confidence=93;coverage=42;reference=T
+ref000001 . SNV 6944 6944 . . . coverage=37;variantSeq=C;confidence=75;reference=T
+ref000001 . SNV 7042 7042 . . . coverage=42;variantSeq=A;confidence=93;reference=T
+ref000001 . insertion 7138 7138 . . . length=1;variantSeq=A;confidence=45;coverage=44
+ref000001 . SNV 7337 7337 . . . coverage=45;variantSeq=T;confidence=93;reference=C
+ref000001 . deletion 7533 7533 . . . length=1;confidence=93;coverage=44;reference=G
+ref000001 . insertion 7630 7630 . . . length=1;variantSeq=C;confidence=93;coverage=44
+ref000001 . deletion 7632 7632 . . . length=1;confidence=15;coverage=44;reference=A
+ref000001 . insertion 7730 7730 . . . length=1;variantSeq=G;confidence=93;coverage=45
+ref000001 . insertion 8023 8023 . . . length=1;variantSeq=T;confidence=93;coverage=40
+ref000001 . insertion 8219 8219 . . . length=1;variantSeq=A;confidence=93;coverage=43
+ref000001 . SNV 8319 8319 . . . coverage=42;variantSeq=C;confidence=93;reference=A
+ref000001 . deletion 8417 8417 . . . length=1;confidence=93;coverage=40;reference=C
+ref000001 . SNV 8517 8517 . . . coverage=42;variantSeq=C;confidence=8;reference=T
+ref000001 . deletion 8714 8714 . . . length=1;confidence=15;coverage=45;reference=G
+ref000001 . insertion 8812 8812 . . . length=1;variantSeq=A;confidence=93;coverage=44
+ref000001 . SNV 9007 9007 . . . coverage=42;variantSeq=G;confidence=93;reference=A
+ref000001 . deletion 9106 9106 . . . length=1;confidence=93;coverage=42;reference=T
+ref000001 . deletion 9302 9302 . . . length=1;confidence=93;coverage=47;reference=T
+ref000001 . SNV 9402 9402 . . . coverage=44;variantSeq=A;confidence=93;reference=T
+ref000001 . deletion 9500 9500 . . . length=1;confidence=93;coverage=40;reference=C
+ref000001 . insertion 9598 9598 . . . length=1;variantSeq=A;confidence=93;coverage=40
+ref000001 . SNV 9697 9697 . . . coverage=38;variantSeq=A;confidence=93;reference=G
+ref000001 . insertion 9794 9794 . . . length=1;variantSeq=C;confidence=93;coverage=37
+ref000001 . insertion 9892 9892 . . . length=1;variantSeq=C;confidence=93;coverage=38
+ref000001 . insertion 9989 9989 . . . length=1;variantSeq=A;confidence=93;coverage=39
+ref000001 . insertion 10086 10086 . . . length=1;variantSeq=G;confidence=93;coverage=41
+ref000001 . SNV 10185 10185 . . . coverage=43;variantSeq=G;confidence=93;reference=A
+ref000001 . SNV 10283 10283 . . . coverage=41;variantSeq=T;confidence=93;reference=C
+ref000001 . SNV 10381 10381 . . . coverage=39;variantSeq=A;confidence=93;reference=T
+ref000001 . SNV 10480 10480 . . . coverage=40;variantSeq=C;confidence=45;reference=T
+ref000001 . SNV 10578 10578 . . . coverage=42;variantSeq=A;confidence=93;reference=T
+ref000001 . SNV 10676 10676 . . . coverage=40;variantSeq=C;confidence=93;reference=G
+ref000001 . deletion 10872 10872 . . . length=1;confidence=93;coverage=39;reference=G
+ref000001 . SNV 10972 10972 . . . coverage=41;variantSeq=C;confidence=15;reference=A
+ref000001 . SNV 11070 11070 . . . coverage=40;variantSeq=G;confidence=52;reference=T
+ref000001 . SNV 11168 11168 . . . coverage=42;variantSeq=C;confidence=93;reference=A
+ref000001 . insertion 11266 11266 . . . length=1;variantSeq=A;confidence=93;coverage=42
+ref000001 . SNV 11364 11364 . . . coverage=42;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 11462 11462 . . . coverage=39;variantSeq=G;confidence=93;reference=C
+ref000001 . deletion 11561 11561 . . . length=1;confidence=93;coverage=39;reference=T
+ref000001 . insertion 11658 11658 . . . length=1;variantSeq=G;confidence=93;coverage=41
+ref000001 . insertion 11755 11755 . . . length=1;variantSeq=A;confidence=93;coverage=42
+ref000001 . insertion 11952 11952 . . . length=1;variantSeq=T;confidence=93;coverage=40
+ref000001 . insertion 12149 12149 . . . length=1;variantSeq=G;confidence=93;coverage=37
+ref000001 . deletion 12345 12345 . . . length=1;confidence=93;coverage=36;reference=T
+ref000001 . SNV 12444 12444 . . . coverage=37;variantSeq=T;confidence=53;reference=C
+ref000001 . deletion 12542 12542 . . . length=1;confidence=93;coverage=37;reference=A
+ref000001 . insertion 12739 12739 . . . length=1;variantSeq=T;confidence=60;coverage=33
+ref000001 . insertion 12935 12935 . . . length=1;variantSeq=A;confidence=3;coverage=35
+ref000001 . deletion 13130 13130 . . . length=1;confidence=93;coverage=33;reference=G
+ref000001 . SNV 13230 13230 . . . coverage=30;variantSeq=T;confidence=3;reference=G
+ref000001 . deletion 13329 13329 . . . length=1;confidence=15;coverage=31;reference=A
+ref000001 . insertion 13427 13427 . . . length=1;variantSeq=C;confidence=93;coverage=31
+ref000001 . SNV 13622 13622 . . . coverage=31;variantSeq=G;confidence=93;reference=A
+ref000001 . insertion 13720 13720 . . . length=1;variantSeq=G;confidence=83;coverage=29
+ref000001 . insertion 13817 13817 . . . length=1;variantSeq=A;confidence=93;coverage=27
+ref000001 . insertion 13914 13914 . . . length=1;variantSeq=C;confidence=93;coverage=27
+ref000001 . SNV 14013 14013 . . . coverage=23;variantSeq=A;confidence=38;reference=T
+ref000001 . SNV 14111 14111 . . . coverage=22;variantSeq=A;confidence=93;reference=T
+ref000001 . deletion 14209 14209 . . . length=1;confidence=93;coverage=21;reference=T
+ref000001 . SNV 14309 14309 . . . coverage=23;variantSeq=A;confidence=93;reference=G
+ref000001 . insertion 14407 14407 . . . length=1;variantSeq=G;confidence=60;coverage=24
+ref000001 . SNV 14505 14505 . . . coverage=26;variantSeq=G;confidence=93;reference=A
+ref000001 . SNV 14603 14603 . . . coverage=24;variantSeq=C;confidence=93;reference=G
+ref000001 . insertion 14700 14700 . . . length=1;variantSeq=A;confidence=83;coverage=27
+ref000001 . deletion 14799 14799 . . . length=1;confidence=93;coverage=26;reference=G
+ref000001 . deletion 14898 14898 . . . length=1;confidence=75;coverage=25;reference=C
+ref000001 . SNV 14997 14997 . . . coverage=23;variantSeq=C;confidence=75;reference=G
+ref000001 . deletion 15097 15097 . . . length=1;confidence=15;coverage=22;reference=G
+ref000001 . deletion 15195 15195 . . . length=1;confidence=93;coverage=23;reference=A
+ref000001 . SNV 15394 15394 . . . coverage=25;variantSeq=G;confidence=67;reference=C
+ref000001 . deletion 15492 15492 . . . length=1;confidence=93;coverage=24;reference=G
+ref000001 . insertion 15787 15787 . . . length=1;variantSeq=A;confidence=86;coverage=25
+ref000001 . insertion 15885 15885 . . . length=1;variantSeq=C;confidence=15;coverage=25
+ref000001 . deletion 16180 16180 . . . length=1;confidence=60;coverage=25;reference=T
+ref000001 . insertion 16278 16278 . . . length=1;variantSeq=T;confidence=68;coverage=24
+ref000001 . insertion 16375 16375 . . . length=1;variantSeq=G;confidence=82;coverage=25
+ref000001 . insertion 16473 16473 . . . length=1;variantSeq=G;confidence=93;coverage=25
+ref000001 . insertion 16570 16570 . . . length=1;variantSeq=C;confidence=90;coverage=25
+ref000001 . deletion 16668 16668 . . . length=1;confidence=93;coverage=29;reference=A
+ref000001 . insertion 16767 16767 . . . length=1;variantSeq=G;confidence=93;coverage=29
+ref000001 . SNV 16865 16865 . . . coverage=30;variantSeq=T;confidence=93;reference=G
+ref000001 . insertion 16963 16963 . . . length=1;variantSeq=C;confidence=45;coverage=30
+ref000001 . insertion 17060 17060 . . . length=1;variantSeq=C;confidence=93;coverage=26
+ref000001 . deletion 17158 17158 . . . length=1;confidence=93;coverage=25;reference=G
+ref000001 . insertion 17354 17354 . . . length=1;variantSeq=T;confidence=93;coverage=22
+ref000001 . SNV 17452 17452 . . . coverage=24;variantSeq=G;confidence=93;reference=A
+ref000001 . insertion 17550 17550 . . . length=1;variantSeq=T;confidence=93;coverage=28
+ref000001 . insertion 17744 17744 . . . length=1;variantSeq=C;confidence=93;coverage=26
+ref000001 . deletion 17941 17941 . . . length=1;confidence=93;coverage=29;reference=C
+ref000001 . SNV 18040 18040 . . . coverage=31;variantSeq=G;confidence=93;reference=C
+ref000001 . SNV 18139 18139 . . . coverage=31;variantSeq=A;confidence=30;reference=G
+ref000001 . SNV 18237 18237 . . . coverage=33;variantSeq=T;confidence=93;reference=C
+ref000001 . SNV 18336 18336 . . . coverage=34;variantSeq=C;confidence=93;reference=T
+ref000001 . SNV 18434 18434 . . . coverage=32;variantSeq=T;confidence=93;reference=A
+ref000001 . deletion 18532 18532 . . . length=1;confidence=15;coverage=30;reference=A
+ref000001 . deletion 18632 18632 . . . length=1;confidence=93;coverage=29;reference=T
+ref000001 . SNV 18926 18926 . . . coverage=31;variantSeq=T;confidence=93;reference=C
+ref000001 . SNV 19121 19121 . . . coverage=35;variantSeq=T;confidence=93;reference=G
+ref000001 . SNV 19220 19220 . . . coverage=35;variantSeq=A;confidence=93;reference=C
+ref000001 . insertion 19317 19317 . . . length=1;variantSeq=C;confidence=93;coverage=34
+ref000001 . SNV 19416 19416 . . . coverage=33;variantSeq=T;confidence=93;reference=C
+ref000001 . SNV 19514 19514 . . . coverage=29;variantSeq=A;confidence=93;reference=G
+ref000001 . insertion 19611 19611 . . . length=1;variantSeq=G;confidence=68;coverage=31
+ref000001 . deletion 19710 19710 . . . length=1;confidence=93;coverage=30;reference=C
+ref000001 . insertion 19808 19808 . . . length=1;variantSeq=T;confidence=93;coverage=35
+ref000001 . insertion 19905 19905 . . . length=1;variantSeq=C;confidence=93;coverage=40
+ref000001 . SNV 20004 20004 . . . coverage=36;variantSeq=C;confidence=93;reference=T
+ref000001 . deletion 20102 20102 . . . length=1;confidence=93;coverage=38;reference=A
+ref000001 . deletion 20201 20201 . . . length=1;confidence=8;coverage=37;reference=A
+ref000001 . insertion 20299 20299 . . . length=1;variantSeq=A;confidence=93;coverage=37
+ref000001 . deletion 20397 20397 . . . length=1;confidence=93;coverage=38;reference=C
+ref000001 . deletion 20593 20593 . . . length=1;confidence=68;coverage=33;reference=T
+ref000001 . deletion 20693 20693 . . . length=1;confidence=93;coverage=32;reference=C
+ref000001 . SNV 20793 20793 . . . coverage=32;variantSeq=A;confidence=30;reference=G
+ref000001 . SNV 20891 20891 . . . coverage=32;variantSeq=T;confidence=93;reference=A
+ref000001 . insertion 20988 20988 . . . length=1;variantSeq=A;confidence=93;coverage=30
+ref000001 . insertion 21086 21086 . . . length=1;variantSeq=C;confidence=93;coverage=31
+ref000001 . insertion 21183 21183 . . . length=1;variantSeq=A;confidence=93;coverage=31
+ref000001 . SNV 21381 21381 . . . coverage=36;variantSeq=T;confidence=53;reference=C
+ref000001 . deletion 21578 21578 . . . length=1;confidence=93;coverage=35;reference=G
+ref000001 . SNV 21678 21678 . . . coverage=36;variantSeq=T;confidence=38;reference=G
+ref000001 . insertion 21874 21874 . . . length=1;variantSeq=G;confidence=90;coverage=34
+ref000001 . insertion 21970 21970 . . . length=1;variantSeq=G;confidence=53;coverage=32
+ref000001 . insertion 22067 22067 . . . length=1;variantSeq=C;confidence=65;coverage=29
+ref000001 . insertion 22165 22165 . . . length=1;variantSeq=A;confidence=93;coverage=30
+ref000001 . deletion 22263 22263 . . . length=1;confidence=53;coverage=32;reference=C
+ref000001 . SNV 22362 22362 . . . coverage=29;variantSeq=A;confidence=93;reference=C
+ref000001 . insertion 22461 22461 . . . length=1;variantSeq=G;confidence=93;coverage=32
+ref000001 . deletion 22558 22558 . . . length=1;confidence=93;coverage=31;reference=C
+ref000001 . SNV 22657 22657 . . . coverage=34;variantSeq=T;confidence=93;reference=A
+ref000001 . insertion 22952 22952 . . . length=1;variantSeq=T;confidence=93;coverage=38
diff --git a/tests/data/yarm/strain.pkl b/tests/data/yarm/strain.pkl
new file mode 100644
index 0000000..2d06848
Binary files /dev/null and b/tests/data/yarm/strain.pkl differ
diff --git a/tests/unit/AlignmentHitStubs.py b/tests/unit/AlignmentHitStubs.py
new file mode 100644
index 0000000..4983c9b
--- /dev/null
+++ b/tests/unit/AlignmentHitStubs.py
@@ -0,0 +1,352 @@
+"""
+This module provides an `AlignmentHitStub` class as well as a group of
+curated stub objects, allowing for decoupled testing.
+"""
+
+import numpy as np
+from GenomicConsensus.utils import complement, reverseComplement
+from GenomicConsensus.variants import *
+
+def ungappedPulseArray(a):
+ dtype = a.dtype
+ if dtype == np.float32:
+ return a[~np.isnan(a)]
+ elif dtype == np.uint8:
+ return a[a != np.uint8(-1)]
+ elif dtype == np.uint16:
+ return a[a != np.uint16(-1)]
+ elif dtype == np.int8:
+ return a[a != ord("-")]
+ else:
+ raise Exception, "Invalid pulse array type"
+
+def _makePulseFeatureAccessor(featureName):
+ def f(self, aligned=True, orientation="native"):
+ return self.pulseFeature(featureName, aligned=aligned, orientation=orientation)
+ return f
+
+class AlignmentHitStub(object):
+
+ def __init__(self, referenceStart, reverseStrand, nativeReference, read, **kwargs):
+ """
+ Initialize stub with data, as if it just came from the
+ instrument (i.e., reference must be provided in
+ reverse-complemented form for reverse-strand reads).
+ """
+ self.reverseStrand = reverseStrand
+ self.forwardStrand = not reverseStrand
+ self.referenceStart = referenceStart
+ self.referenceEnd = referenceStart + sum(b != '-' for b in nativeReference)
+ self._reference = np.fromstring(nativeReference, dtype="S1")
+ self._read = np.fromstring(read, dtype="S1")
+
+ self._pulseFeatures = {}
+ for featureName, feature in kwargs.iteritems():
+ self._pulseFeatures[featureName] = feature
+
+ def read(self, aligned=True, orientation="native"):
+ val = self._read
+ if not aligned:
+ val = val[val != "-"]
+ if orientation == "genomic" and self.reverseStrand:
+ val = reverseComplement(val)
+ return val.tostring()
+
+ def reference(self, aligned=True, orientation="native"):
+ val = self._reference
+ if not aligned:
+ val = val[val != "-"]
+ if orientation == "genomic" and self.reverseStrand:
+ val = reverseComplement(val)
+ return val.tostring()
+
+ def referencePositions(self, orientation="native"):
+ genomicReference = np.fromstring(self.reference(orientation="genomic"), dtype="S1")
+ genomicPositions = \
+ self.referenceStart + \
+ np.append(0, np.cumsum(genomicReference != "-")[:-1])
+ if orientation == "native" and self.reverseStrand:
+ return genomicPositions[::-1]
+ else:
+ return genomicPositions
+
+ def spansReferencePosition(self, refPos):
+ return self.referenceStart <= refPos < self.referenceEnd
+
+ def pulseFeature(self, featureName, aligned=True, orientation="native"):
+ data = self._pulseFeatures[featureName]
+ if orientation == "genomic" and self.reverseStrand:
+ data = data[::-1]
+ if not aligned:
+ data = ungappedPulseArray(data)
+ return data
+
+ def clippedTo(self, refStart, refEnd):
+ # Not really implemented.
+ assert refStart <= self.referenceStart <= self.referenceEnd <= refEnd
+ return self
+
+ IPD = _makePulseFeatureAccessor("IPD")
+ PulseWidth = _makePulseFeatureAccessor("PulseWidth")
+ QualityValue = _makePulseFeatureAccessor("QualityValue")
+ InsertionQV = _makePulseFeatureAccessor("InsertionQV")
+ DeletionQV = _makePulseFeatureAccessor("DeletionQV")
+ DeletionTag = _makePulseFeatureAccessor("DeletionTag")
+ MergeQV = _makePulseFeatureAccessor("MergeQV")
+ SubstitutionQV = _makePulseFeatureAccessor("SubstitutionQV")
+
+ def __repr__(self):
+ return "Stub 0x%x" % id(self)
+
+ def __getattr__(self, key):
+ pass
+
+
+FORWARD, REVERSE = False, True
+
+def _(s):
+ """
+ Decode an ASCII-art representation of
+ a pulse feature.
+
+ Spec: string -> np.array(dtype=float32)
+
+ _(" ") -> [20], error improbable
+ _("*") -> [3], error probable
+ _("-") -> [NaN], for an alignment gap
+ _("A") -> [ord("A")], (works for A,T,G,C,N)
+ """
+ _decoder = { " " : 20,
+ "*" : 0,
+ "-" : np.NaN }
+ for c in "ATGCN":
+ _decoder[c] = ord(c)
+ return np.array([_decoder[c] for c in s], dtype=np.float32)
+
+
+
+
+class ForwardAndReverseReads(object):
+ """
+ 3 fwd, 3 rev; blunt ends.
+
+ FWD READS: ccaaaaccccc ttttggggcc (hit1; has insertion)
+ ccaaaa cccc ttttg-ggcc (hit2; has deletion)
+ ccagaa cccc ttttggggcc (hit3; has substitution)
+ REFERENCE: (fwd) CCAAAA CCCC TTTTGGGGCC
+ (pos) 012345 6789 0123456789
+ (rev) GGTTTT GGGG AAAACCCCGG
+ REV READS: ggtttt gggggaaaaccccgg (hit4 = hit1'; has ins)
+ ggtttt gggg aaaac-ccgg (hit5 = hit2'; has del)
+ ggtctt gggg aaaaccccgg (hit6 = hit3'; has sub)
+
+ Notes:
+
+ - hit4-hit6 sequences are the reverse complements of hit1-hit3;
+ with gaps and insqv/delqv bumps placed where blasr+primary would
+ put them.
+
+ - No plurality variants.
+
+ """
+ referenceWindow = (1, 0, 20)
+ reference = "CCAAAACCCCTTTTGGGGCC"
+ expectedPluralityConsensus = "CCAAAACCCCTTTTGGGGCC"
+ expectedPluralityVariants = []
+
+ hit1 = AlignmentHitStub(0, FORWARD,
+ "CCAAAA-CCCCTTTTGGGGCC",
+ "CCAAAACCCCCTTTTGGGGCC",
+ InsertionQV= _(" * "),
+ SubstitutionQV= _(" "),
+ DeletionQV= _(" "),
+ DeletionTag= _("NNNNNNNNNNNNNNNNNNNNN"),
+ MergeQV= _(" "))
+
+ hit2 = AlignmentHitStub(0, FORWARD,
+ "CCAAAACCCCTTTTGGGGCC",
+ "CCAAAACCCCTTTTG-GGCC",
+ InsertionQV= _(" - "),
+ SubstitutionQV= _(" - "),
+ DeletionQV= _(" -* "),
+ DeletionTag= _("NNNNNNNNNNNNNNN-GNNN"),
+ MergeQV= _(" - "))
+
+ hit3 = AlignmentHitStub(0, FORWARD,
+ "CCAAAACCCCTTTTGGGGCC",
+ "CCAGAACCCCTTTTGGGGCC",
+ InsertionQV= _(" "),
+ SubstitutionQV= _(" * "),
+ DeletionQV= _(" "),
+ DeletionTag= _("NNNNNNNNNNNNNNNNNNNN"),
+ MergeQV= _(" "))
+
+ hit4 = AlignmentHitStub(0, REVERSE,
+ "GGTTTTGGGG-AAAACCCCGG" [::-1],
+ "GGTTTTGGGGGAAAACCCCGG" [::-1],
+ InsertionQV= _(" * ") [::-1],
+ SubstitutionQV= _(" ") [::-1],
+ DeletionQV= _(" ") [::-1],
+ DeletionTag= _("NNNNNNNNNNNNNNNNNNNNN") [::-1],
+ MergeQV= _(" ") [::-1])
+
+ hit5 = AlignmentHitStub(0, REVERSE,
+ "GGTTTTGGGGAAAACCCCGG" [::-1],
+ "GGTTTTGGGGAAAAC-CCGG" [::-1],
+ InsertionQV= _(" - ") [::-1],
+ SubstitutionQV= _(" - ") [::-1],
+ DeletionQV= _(" *- ") [::-1],
+ DeletionTag= _("NNNNNNNNNNNNNNC-NNNN") [::-1],
+ MergeQV= _(" - ") [::-1])
+
+ hit6 = AlignmentHitStub(0, REVERSE,
+ "GGTTTTGGGGAAAACCCCGG" [::-1],
+ "GGTCTTGGGGAAAACCCCGG" [::-1],
+ InsertionQV= _(" ") [::-1],
+ SubstitutionQV= _(" * ") [::-1],
+ DeletionQV= _(" ") [::-1],
+ DeletionTag= _("NNNNNNNNNNNNNNNNNNNN") [::-1],
+ MergeQV= _(" ") [::-1])
+
+ hits = [hit1, hit2, hit3, hit4, hit5, hit6]
+
+
+
+
+class AllForwardStrandReads(object):
+ """
+ 3 forward strand reads with blunt ends.
+ """
+ reference = ForwardAndReverseReads.reference
+ expectedPluralityConsensus = ForwardAndReverseReads.expectedPluralityConsensus
+ referenceWindow = ForwardAndReverseReads.referenceWindow
+ hits = [ForwardAndReverseReads.hit1,
+ ForwardAndReverseReads.hit2,
+ ForwardAndReverseReads.hit3]
+
+class AllReverseStrandReads(object):
+ """
+ 3 reverse strand reads with blunt ends.
+ """
+ reference = ForwardAndReverseReads.reference
+ expectedPluralityConsensus = ForwardAndReverseReads.expectedPluralityConsensus
+ referenceWindow = ForwardAndReverseReads.referenceWindow
+ hits = [ForwardAndReverseReads.hit4,
+ ForwardAndReverseReads.hit5,
+ ForwardAndReverseReads.hit6]
+
+class StaggeredReads(object):
+ """
+ 3 forward strand, 3 reverse strand reads. Staggered starts and
+ ends.
+
+ FWD READS: gaa-t a (hit1)
+ a-ttacag att aca (hit2)
+ gatttaga (hit3)
+ REFERENCE: (fwd) GA TTACAG ATT ACA
+ POS 01 234567 890 123
+ (rev) CT AATGTC TAA TGT
+ REV READS: t aatctctt (hit4)
+ tctctt-attt (hit5)
+ a ttg (hit6)
+ Note:
+ - plurality insertion of A at 8;
+ - plurality substitution C->G at 5;
+ - plurality deletion of T at 9.
+ """
+ referenceWindow = (1, 0, 20)
+ reference = "GATTACAGATTACATTTTTT"
+ expectedPluralityConsensus = "GATTAGAGAATACANNNNNN"
+ expectedPluralityVariants = \
+ [ Variant(1, 5, 6, "C", "G", coverage=4, confidence=38, frequency1=3),
+ Variant(1, 8, 8, "", "A", coverage=4, confidence=38, frequency1=3),
+ Variant(1, 9, 10, "T", "", coverage=3, confidence=25, frequency1=2) ]
+
+ hit1 = AlignmentHitStub(7, FORWARD,
+ "G-ATTA",
+ "GAA-TA",
+ InsertionQV=_(" - "),
+ SubstitutionQV=_(" - "),
+ DeletionQV=_(" - "),
+ DeletionTag=_("NNN-NN"),
+ MergeQV=_(" - "))
+
+ hit2 = AlignmentHitStub(1, FORWARD,
+ "ATTACAGATTACA",
+ "ATTACAGATTACA",
+ InsertionQV=_(" "),
+ SubstitutionQV=_(" "),
+ DeletionQV=_(" "),
+ DeletionTag=_("NNNNNNNNNNNNN"),
+ MergeQV=_(" "))
+
+ hit3 = AlignmentHitStub(0, FORWARD,
+ "GA-TTACA",
+ "GATTTAGA",
+ InsertionQV=_(" * "),
+ SubstitutionQV=_(" "),
+ DeletionQV=_(" "),
+ DeletionTag=_("NNNNNNNN"),
+ MergeQV=_(" "))
+
+ hit4 = AlignmentHitStub(1, REVERSE,
+ "TAATGTC-T"[::-1],
+ "TAATCTCTT"[::-1],
+ InsertionQV=_(" ")[::-1],
+ SubstitutionQV=_(" ")[::-1],
+ DeletionQV=_(" ")[::-1],
+ DeletionTag=_("NNNNNNNNN")[::-1],
+ MergeQV=_(" ")[::-1])
+
+ hit5 = AlignmentHitStub(4, REVERSE,
+ "TGTC-TAA--T"[::-1],
+ "TCTCTT-ATTT"[::-1],
+ InsertionQV=_(" - ")[::-1],
+ SubstitutionQV=_(" - ")[::-1],
+ DeletionQV=_(" - ")[::-1],
+ DeletionTag=_("NNNNNN-NNNN")[::-1],
+ MergeQV=_(" - ")[::-1])
+
+ hit6 = AlignmentHitStub(10, REVERSE,
+ "A-TG"[::-1],
+ "ATTG"[::-1],
+ InsertionQV=_(" ")[::-1],
+ SubstitutionQV=_(" ")[::-1],
+ DeletionQV=_(" ")[::-1],
+ DeletionTag=_("NNNN")[::-1],
+ MergeQV=_(" ")[::-1])
+
+ hits = [hit1, hit2, hit3, hit4, hit5, hit6]
+
+
+class BigReads(object):
+ """
+ Large-ish hits, useful for stress-testing memory consumption.
+ """
+ length = 4000
+ referenceWindow = (1, 0, length)
+ seq = list("ACCT") * 1000
+ np.random.seed(42)
+ np.random.shuffle(seq)
+ seq = "".join(seq)
+ reference = expectedPluralityConsensus = seq
+
+ middlingQV = np.array([7] * length, dtype=np.float32)
+ hit1 = AlignmentHitStub(0, FORWARD, seq, seq,
+ InsertionQV = middlingQV,
+ SubstitutionQV = middlingQV,
+ DeletionQV = middlingQV,
+ DeletionTag = _("N" * length),
+ MergeQV = middlingQV)
+
+ hits = [ hit1 ]
+
+ @classmethod
+ def manyHits(k, n):
+ return [ AlignmentHitStub(0, FORWARD, k.seq, k.seq,
+ InsertionQV = k.middlingQV,
+ SubstitutionQV = k.middlingQV,
+ DeletionQV = k.middlingQV,
+ DeletionTag = _("N" * k.length),
+ MergeQV = k.middlingQV)
+ for i in xrange(n) ]
diff --git a/tests/unit/test_consensus.py b/tests/unit/test_consensus.py
new file mode 100644
index 0000000..a974a91
--- /dev/null
+++ b/tests/unit/test_consensus.py
@@ -0,0 +1,22 @@
+from numpy.testing import assert_array_almost_equal
+from nose.tools import assert_equal
+
+from GenomicConsensus.consensus import *
+
+def test_areContiguous():
+ refWindowsGood = [ (0, 100, 200),
+ (0, 200, 300) ]
+ refWindowsBad1 = [ (0, 100, 200),
+ (0, 201, 300) ]
+ refWindowsBad2 = [ (0, 100, 200),
+ (1, 200, 300) ]
+
+ assert areContiguous(refWindowsGood)
+ assert not areContiguous(refWindowsBad1)
+
+def test_join():
+ chunks = [ Consensus( (0, 100, 110), "GATTACA", range(7) ),
+ Consensus( (0, 110, 120), "CATTACA", range(7,14) ) ]
+ joined = join(chunks)
+ expectedJoined = Consensus( (0, 100, 120), "GATTACACATTACA", range(14))
+ assert_equal(expectedJoined, joined)
diff --git a/tests/unit/test_coverage_intervals.py b/tests/unit/test_coverage_intervals.py
new file mode 100644
index 0000000..fd9eeb7
--- /dev/null
+++ b/tests/unit/test_coverage_intervals.py
@@ -0,0 +1,109 @@
+
+import numpy as np
+from nose.tools import assert_equals
+
+from GenomicConsensus.windows import (kSpannedIntervals,
+ enumerateIntervals,
+ abut, holes)
+
+
+def test_intervals_1():
+ """
+ Intervals all covering the window
+ """
+ refWindow = (0, 100, 1010)
+ start = np.array(np.array([100]*10, dtype=int), dtype=int)
+ end = np.array(np.array([110]*10, dtype=int), dtype=int)
+ assert_equals([(100, 110)],
+ kSpannedIntervals(refWindow, 3, start, end))
+
+def test_intervals_2():
+ """
+ Intervals not touching the window
+ """
+ refWindow = (0, 1, 10)
+ start = np.array([0]*5 + [10]*5, dtype=int)
+ end = np.array([1]*5 + [15]*5, dtype=int)
+ assert_equals([],
+ kSpannedIntervals(refWindow, 3, start, end))
+
+def test_intervals_3():
+ """
+ Intervals covering the middle of the window -- "dromedary"
+ """
+ refWindow = (0, 0, 10)
+ start = np.array([3]*10, dtype=int)
+ end = np.array([7]*10, dtype=int)
+ assert_equals([(3, 7)],
+ kSpannedIntervals(refWindow, 3, start, end))
+
+def test_intervals_4():
+ """
+ Two intervals at the fringes, with a hole in the middle --- "camel"
+ """
+ refWindow = (0, 100, 110)
+ start = np.array([103]*5 + [107]*5, dtype=int)
+ end = np.array([105]*5 + [109]*5, dtype=int)
+ assert_equals([(103,105), (107,109)],
+ kSpannedIntervals(refWindow, 3, start, end))
+
+
+def test_intervals_5():
+ """
+ A case where there is nowhere 3-spanning coverage
+ """
+ refWindow = (0, 0, 10)
+ reads = [ (x, x+1) for x in xrange(0, 10) ]
+ reads.append((0, 10))
+ start, end = map(np.array, zip(*reads))
+ assert_equals([ (x, x+1) for x in xrange(0, 10) ],
+ kSpannedIntervals(refWindow, 2, start, end))
+ assert_equals([],
+ kSpannedIntervals(refWindow, 3, start, end))
+
+
+def test_intervals_underflow():
+ """
+ I found an case that gave the wrong results due to an underflow.
+ Regression test here.
+ """
+ refWindow = (0, 5, 10)
+ tStart = np.arange(10, dtype=np.uint32)
+ tEnd = tStart + 10
+ assert_equals([(5, 10)], kSpannedIntervals(refWindow, 3, tStart, tEnd))
+
+
+def test_abut():
+ """
+ Test abutting adjacent intervals
+ """
+ ints = [(s, s+1) for s in range(10)] + [(s, s+1) for s in range(20,30)]
+ assert_equals([(0, 10), (20, 30)], abut(ints))
+
+
+def test_holes_1():
+ assert_equals([(0, 100)], holes((0, 0, 100), []))
+
+def test_holes_2():
+ assert_equals([], holes((0, 0, 100), [(0, 100)]))
+
+def test_holes_3():
+ """
+ Holes for the dromedary test case
+ """
+ assert_equals([(0,3), (7,10)],
+ holes((0, 0, 10), [(3,7)]))
+
+def test_holes_4():
+ """
+ Holes for the camel test case
+ """
+ assert_equals([(3, 7)],
+ holes((0, 0, 10), [(0,3), (7,10)]))
+
+
+def test_enumerateIntervals():
+ assert_equals(list(enumerateIntervals((55, 75), 100)), [(55, 75)])
+ assert_equals(list(enumerateIntervals((99,100), 100)), [(99,100)])
+ assert_equals(list(enumerateIntervals((99,101), 100)), [(99,100), (100, 101)])
+ assert_equals(list(enumerateIntervals((99,200), 100)), [(99,100), (100, 200)])
diff --git a/tests/unit/test_dinucleotide_repeats.py b/tests/unit/test_dinucleotide_repeats.py
new file mode 100644
index 0000000..2704196
--- /dev/null
+++ b/tests/unit/test_dinucleotide_repeats.py
@@ -0,0 +1,10 @@
+
+from nose.tools import assert_equal as EQ
+from GenomicConsensus.quiver.utils import findDinucleotideRepeats
+
+
+def test_findDinucleotideRepeats():
+ EQ([], findDinucleotideRepeats("GATTACA"))
+ EQ([((1,7), "AT")], findDinucleotideRepeats("GATATATACA"))
+ EQ([((1, 7), "AT"), ((7, 13), "AC")],
+ findDinucleotideRepeats("GATATATACACACA"))
diff --git a/tests/unit/test_diploid.py b/tests/unit/test_diploid.py
new file mode 100644
index 0000000..59ff68c
--- /dev/null
+++ b/tests/unit/test_diploid.py
@@ -0,0 +1,34 @@
+
+from nose.tools import assert_equal as EQ
+from GenomicConsensus.quiver.diploid import variantsFromAlignment
+from GenomicConsensus.variants import Variant
+import ConsensusCore as cc
+
+def test_diploid_variantsFromAlignment():
+ refWin = (0, 10, 17)
+
+ EQ([],
+ variantsFromAlignment(refWin, "GATTACA","GATTACA"))
+
+ EQ([Variant(0, 13, 14, "T", "G")],
+ variantsFromAlignment(refWin, "GATTACA","GATGACA"))
+
+ EQ([Variant(0, 12, 14, "TT", "GG")],
+ variantsFromAlignment(refWin, "GATTACA","GAGGACA"))
+
+ EQ([Variant(0, 12, 13, "T", "G"),
+ Variant(0, 14, 15, "A", "G")],
+ variantsFromAlignment(refWin, "GATTACA","GAGNGCA"))
+
+ EQ([Variant(0, 15, 16, "C", "")],
+ variantsFromAlignment(refWin, "GATTACA","GATTAA"))
+
+ EQ([Variant(0, 12, 12, "", "T")],
+ variantsFromAlignment(refWin, "GATTACA","GATTTACA"))
+
+ EQ([Variant(0, 13, 14, "T", "A", "T")],
+ variantsFromAlignment(refWin, "GATTACA","GATWACA"))
+
+ EQ([Variant(0, 12, 13, "T", "A", "T"),
+ Variant(0, 13, 14, "T", "A", "T")],
+ variantsFromAlignment(refWin, "GATTACA","GAWWACA"))
diff --git a/tests/unit/test_plurality.py b/tests/unit/test_plurality.py
new file mode 100644
index 0000000..e8c2053
--- /dev/null
+++ b/tests/unit/test_plurality.py
@@ -0,0 +1,88 @@
+from numpy.testing import assert_array_almost_equal
+from nose.tools import assert_equal
+import operator, numpy as np
+
+from GenomicConsensus.plurality.plurality import (PluralityConfig,
+ pluralityConsensusAndVariants,
+ _computeVariants)
+from AlignmentHitStubs import *
+
+def test_plurality1():
+ css, variants = pluralityConsensusAndVariants(ForwardAndReverseReads.referenceWindow,
+ ForwardAndReverseReads.reference,
+ ForwardAndReverseReads.hits,
+ PluralityConfig())
+
+ assert_equal(ForwardAndReverseReads.expectedPluralityConsensus,
+ css.sequence)
+
+ assert_equal(ForwardAndReverseReads.expectedPluralityVariants,
+ variants)
+
+
+def test_plurality2():
+ config = PluralityConfig(minConfidence=0, minCoverage=0)
+ css, variants = pluralityConsensusAndVariants(StaggeredReads.referenceWindow,
+ StaggeredReads.reference,
+ StaggeredReads.hits,
+ config)
+ assert_equal(StaggeredReads.expectedPluralityConsensus,
+ css.sequence)
+
+ assert_equal(StaggeredReads.expectedPluralityVariants,
+ variants)
+
+
+def test_computeHaploidVariants():
+ config = PluralityConfig(minConfidence=0,
+ minCoverage=0)
+
+ variants1 = _computeVariants(config,
+ (1, 0, 7),
+ "GATTACA",
+ [4]*7,
+ "GATGACA",
+ [3]*7,
+ [35]*7)
+ assert_equal([ Variant(1, 3, 4, "T", "G",
+ coverage=4, confidence=35, frequency1=3) ],
+ variants1)
+
+ variants2 = _computeVariants(config,
+ (1, 0, 7),
+ "GATTACA",
+ [4]*7,
+ ["G", "A", "", "T", "A", "C", "A"],
+ [3]*7,
+ [35]*7)
+ assert_equal([ Variant(1, 2, 3, "T", "",
+ coverage=4, confidence=35, frequency1=3)],
+ variants2)
+
+ variants3 = _computeVariants(config,
+ (1, 0, 7),
+ "GATTACA",
+ [4]*7,
+ ["G", "A", "TT", "T", "A", "C", "A"],
+ [3]*7,
+ [35]*7)
+ assert_equal([ Variant(1, 2, 2, "", "T",
+ coverage=4, confidence=35, frequency1=3)],
+ variants3)
+
+
+# def test_computeVariantsDiploid():
+# config = PluralityConfig(minConfidence=0,
+# minCoverage=0,
+# diploid=True)
+# variants1 = _computeVariants(config,
+# (1, 0, 7),
+# "GATTACA",
+# [20]*7,
+# "GATTACA",
+# [10]*7,
+# [35]*7,
+# "GATCACA",
+# [10]*7,
+# [35]*7)
+# assert_equal([ Substitution(1, 3, 4, "T", "G", 4, 35, 3) ], variants1)
diff --git a/tests/unit/test_quiver.py b/tests/unit/test_quiver.py
new file mode 100644
index 0000000..9cb3bbf
--- /dev/null
+++ b/tests/unit/test_quiver.py
@@ -0,0 +1,45 @@
+from numpy.testing import assert_array_almost_equal
+from nose.tools import assert_equal
+
+from GenomicConsensus.quiver import utils
+from GenomicConsensus.variants import *
+from ConsensusCore import *
+
+class TestVariantsFromAlignment(object):
+
+ def testVariantsFromAlignment1(self):
+ a = PairwiseAlignment("GATTACA", "GAT-ACA")
+ vs = utils.variantsFromAlignment(a, (1, 1000, 2000))
+ assert_equal([ Variant(1, 1003, 1004, "T", "") ], vs)
+
+ def testVariantsFromAlignment2(self):
+ a = PairwiseAlignment("GA-TTACA", "GATTTACA")
+ vs = utils.variantsFromAlignment(a, (1, 1000, 2000))
+ assert_equal([ Variant(1, 1002, 1002, "", "T") ], vs)
+
+ def testVariantsFromAlignment3(self):
+ a = PairwiseAlignment("GATTACA", "GAGGACA")
+ vs = utils.variantsFromAlignment(a, (1, 1000, 2000))
+ assert_equal([ Variant(1, 1002, 1004, "TT", "GG") ], vs)
+
+ def testNoCallBasesInReference1(self):
+ a = PairwiseAlignment("GATTNGATT", "GAGGATATT")
+ vs = utils.variantsFromAlignment(a, (1, 1000, 2000))
+ assert_equal([ Variant(1, 1002, 1004, "TT", "GG"),
+ Variant(1, 1005, 1006, "G", "T") ], vs)
+
+ def testLongInsertion(self):
+ a = PairwiseAlignment("GA-----TTACA", "GACCCCCTTACA")
+ vs = utils.variantsFromAlignment(a, (1, 1000, 2000))
+ assert_equal([ Variant(1, 1002, 1002, "", "CCCCC") ], vs)
+
+ def testLongDeletion(self):
+ a = PairwiseAlignment("GACCCCCTTACA", "GA-----TTACA")
+ vs = utils.variantsFromAlignment(a, (1, 1000, 2000))
+ assert_equal([ Variant(1, 1002, 1007, "CCCCC", "") ], vs)
+
+ def testTwoSubstitutions(self):
+ a = PairwiseAlignment("GATTACA", "GAGTAGA")
+ vs = utils.variantsFromAlignment(a, (1, 1000, 2000))
+ assert_equal([ Variant(1, 1002, 1003, "T", "G"),
+ Variant(1, 1005, 1006, "C", "G") ], vs)
diff --git a/tests/unit/test_quiver_params.py b/tests/unit/test_quiver_params.py
new file mode 100644
index 0000000..6058d97
--- /dev/null
+++ b/tests/unit/test_quiver_params.py
@@ -0,0 +1,101 @@
+#
+# Test aspects of the loading of quiver parameter sets from .ini files
+#
+
+from nose.tools import assert_equal
+from os.path import dirname as up
+
+import GenomicConsensus.quiver.model as m
+
+class StubParameterSet(object):
+ def __init__(self, name):
+ chem, modelName = name.split(".")[:2]
+ if modelName=="AllQVsModel": model = m.AllQVsModel
+ elif modelName=="NoMergeQVModel": model = m.NoMergeQVModel
+ elif modelName=="NoQVsModel": model = m.NoQVsModel
+ self.name = name
+ self.chemistry = chem
+ self.model = model
+ self.quiverConfig = None
+
+
+class TestBestParameterSet:
+ def setup(self):
+ self.parameterSets = { name : StubParameterSet(name)
+ for name in ["C5.AllQVsModel",
+ "C5.NoMergeQVModel",
+ "C5.NoQVsModel",
+ "C6.NoQVsModel",
+ "unknown.AllQVsModel",
+ "unknown.NoMergeQVModel",
+ "unknown.NoQVsModel"] }
+
+ def test_bestParameterSet_1(self):
+ assert_equal("C5.NoQVsModel",
+ m._bestParameterSet(self.parameterSets, "C5", []).name)
+ assert_equal("C5.NoMergeQVModel",
+ m._bestParameterSet(self.parameterSets, "C5",
+ m.NoMergeQVModel.requiredFeatures).name)
+ assert_equal("C5.AllQVsModel",
+ m._bestParameterSet(self.parameterSets, "C5",
+ m.AllQVsModel.requiredFeatures).name)
+
+ def test_bestParameterSet_2(self):
+ # Try C6, where there is only one trained parameter set
+ assert_equal("C6.NoQVsModel",
+ m._bestParameterSet(self.parameterSets, "C6", []).name)
+ assert_equal("C6.NoQVsModel",
+ m._bestParameterSet(self.parameterSets, "C6",
+ m.NoMergeQVModel.requiredFeatures).name)
+ assert_equal("C6.NoQVsModel",
+ m._bestParameterSet(self.parameterSets, "C6",
+ m.AllQVsModel.requiredFeatures).name)
+
+ def test_bestParameterSet_3(self):
+ # Try the "future" chemistry C7, where we don't have access to
+ # any trained parameter sets yet
+ assert_equal("unknown.NoQVsModel",
+ m._bestParameterSet(self.parameterSets, "C7", []).name)
+ assert_equal("unknown.NoMergeQVModel",
+ m._bestParameterSet(self.parameterSets, "C7",
+ m.NoMergeQVModel.requiredFeatures).name)
+ assert_equal("unknown.AllQVsModel",
+ m._bestParameterSet(self.parameterSets, "C7",
+ m.AllQVsModel.requiredFeatures).name)
+
+
+class TestLoadingBundledParameters:
+
+ def test_loadBundledParameterSet(self):
+ """
+ Make sure that the bundled parameter set in resources/ works.
+ """
+ paramSets = m._loadParameterSets(m._findParametersFile())
+ assert "C2.AllQVsModel" in paramSets
+
+
+ def test_loadParameterSetFromDir1(self):
+ """
+ Try loading from X, where the FS looks like:
+ X/
+ 2013-03/
+ GenomicConsensus/
+ QuiverParameters.ini
+ """
+ quiverParamsIni = m._findParametersFile()
+ X = up(up(up(quiverParamsIni)))
+ paramSets = m._loadParameterSets(m._findParametersFile(X))
+ assert "C2.AllQVsModel" in paramSets
+
+ def test_loadParameterSetFromDir2(self):
+ """
+ Try loading from specified bundle
+ X/
+ 2013-03/ <------------ here
+ GenomicConsensus/
+ QuiverParameters.ini
+ """
+ quiverParamsIni = m._findParametersFile()
+ X = up(up(quiverParamsIni))
+ paramSets = m._loadParameterSets(m._findParametersFile(X))
+ assert "C2.AllQVsModel" in paramSets
diff --git a/tests/unit/test_rare.py.off b/tests/unit/test_rare.py.off
new file mode 100644
index 0000000..0c4165b
--- /dev/null
+++ b/tests/unit/test_rare.py.off
@@ -0,0 +1,73 @@
+import sys
+from collections import defaultdict, OrderedDict
+from nose import with_setup
+from nose.tools import assert_equal, assert_true
+from GenomicConsensus.options import options, parseOptions, importAdditionalDefaultOptions
+from GenomicConsensus.rare import *
+from GenomicConsensus.plurality.plurality import PluralityLocusSummary
+from AlignmentHitStubs import *
+
+class TestRareVariants(object):
+ """Battery of tests for the rare variant algorithm. """
+
+ snpsfreqs = ['T',0.0095, # 19, < 1%
+ 'G',0.025, # 50, lower QV rare variant
+ '-',0.05, # 100, highest QV rare variant
+ 'A',0.9155] # 1831, dominant allele (putative wild-type)
+
+ def setup(self):
+ sys.argv = ['','']
+ parseOptions(relax=True)
+ importAdditionalDefaultOptions(rare.additionalDefaultOptions)
+
+ def test_consensus(self):
+ """[RareAlignmentColumn.consensus] The core rare variant algo. """
+ algCol = RareAlignmentColumn('test',1,'A')
+ sf = TestRareVariants.snpsfreqs
+ for i in xrange(0,8,2):
+ count = int(sf[i+1]*2000)
+ [algCol.addReadSnippet(sf[i]) for x in xrange(0, count)]
+
+ results = algCol.consensus()
+
+ # running just consensus will find any and all variants above 1% and
+ # coverage > 500
+ assert_equal(3, len(results))
+ assert_equal(results[0], PluralityLocusSummary('test',1,2000,'G',84,50))
+ assert_equal(results[1], PluralityLocusSummary('test',1,2000,'-',93,100))
+ assert_equal(results[2], PluralityLocusSummary('test',1,2000,'A',93,1831))
+
+ def gen_hits(self, coverage=2000):
+ ref = "ATGG CTCC GATC TCAG".replace(' ','')
+ hits = []
+ sf = TestRareVariants.snpsfreqs
+ for i in xrange(0,8,2):
+ read = ref[0:9] + sf[i] + ref[10:]
+ count = int(sf[i+1]*coverage)
+ hit = AlignmentHitStub(0, FORWARD, ref, read)
+ [hits.append(hit) for x in xrange(0, count)]
+
+ return hits
+
+ def test_coverage_option(self):
+ """Can we adjust the minimum coverage"""
+ options.variantCoverageThreshold = 110
+ results = RareCaller.rare(('test',0,20), self.gen_hits(coverage=120))
+ assert_equal(3, len(results))
+ expected = [(('test',9),PluralityLocusSummary('test',9,119,'G',15,3)),
+ (('test',9),PluralityLocusSummary('test',9,119,'',37,6)),
+ (('test',9),PluralityLocusSummary('test',9,119,'A',93,109))]
+
+ expected = set(expected)
+
+ for r in results:
+ assert_true(r in expected, "Unexpected result: %s" % str(r))
+
+
+ def test_rare(self):
+ """[RareCaller.rare] The rare variant alignment processing. """
+ results = RareCaller.rare(('test',0,20),self.gen_hits())
+ assert_equal(3, len(results))
+ results.index((('test',9),PluralityLocusSummary('test',9,2000,'G',84,50)))
+ results.index((('test',9),PluralityLocusSummary('test',9,2000,'',93,100)))
+ results.index((('test',9),PluralityLocusSummary('test',9,2000,'A',93,1831)))
--
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/pbgenomicconsensus.git
More information about the debian-med-commit
mailing list