[med-svn] [augustus] 01/12: New upstream version 3.2.3+dfsg
Sascha Steinbiss
satta at debian.org
Sun Dec 11 11:07:22 UTC 2016
This is an automated email from the git hooks/post-receive script.
satta pushed a commit to branch master
in repository augustus.
commit 591ea5cd736480d64401e5e12708fe8a86e2ee94
Author: Sascha Steinbiss <satta at debian.org>
Date: Sat Dec 10 09:03:12 2016 +0000
New upstream version 3.2.3+dfsg
---
HISTORY.TXT | 7 +
Makefile | 2 +-
README-cgp.txt | 2 +-
README.TXT | 11 +-
auxprogs/bam2wig/Makefile | 12 +-
auxprogs/bam2wig/bam2wig.c | 2 +-
auxprogs/homGeneMapping/README.TXT | 23 +-
auxprogs/homGeneMapping/include/gene.hh | 54 +-
auxprogs/homGeneMapping/include/genome.hh | 57 +-
auxprogs/homGeneMapping/include/projectio.hh | 14 +-
.../homGeneMapping/include}/sqliteDB.hh | 6 -
auxprogs/homGeneMapping/src/Makefile | 19 +-
auxprogs/homGeneMapping/src/gene.cc | 197 +-
auxprogs/homGeneMapping/src/genome.cc | 645 +-
auxprogs/homGeneMapping/src/main.cc | 94 +-
auxprogs/homGeneMapping/src/sqliteDB.cc | 115 +
auxprogs/joingenes/jg_ios.cpp | 1108 +-
auxprogs/joingenes/jg_ios.h | 4 +-
auxprogs/joingenes/jg_transcript.cpp | 3018 +--
auxprogs/joingenes/jg_transcript.h | 942 +-
auxprogs/joingenes/joingenes.cpp | 682 +-
common.mk | 8 +-
config/cgp/log_reg_parameters_primates.cfg | 25 +
config/extrinsic/cgp.extrinsic.cfg | 74 -
config/extrinsic/extrinsic-cgp.cfg | 119 +
.../coyote_tobacco/coyote_tobacco_exon_probs.pbl | 6591 ++++++
.../coyote_tobacco/coyote_tobacco_igenic_probs.pbl | 2420 +++
.../coyote_tobacco/coyote_tobacco_intron_probs.pbl | 7191 +++++++
.../coyote_tobacco_metapars.cfg} | 8 +-
.../coyote_tobacco/coyote_tobacco_metapars.utr.cfg | 30 +
.../coyote_tobacco_parameters.cfg} | 99 +-
.../coyote_tobacco_trans_shadow_partial_utr.pbl | 529 +
.../coyote_tobacco/coyote_tobacco_utr_probs.pbl | 4037 ++++
.../coyote_tobacco_weightmatrix.txt} | 0
.../japaneselamprey/japaneselamprey_exon_probs.pbl | 20253 +++++++++++++++++++
.../japaneselamprey_igenic_probs.pbl | 9680 +++++++++
.../japaneselamprey_intron_probs.pbl | 13746 +++++++++++++
.../japaneselamprey_metapars.cfg} | 8 +-
.../japaneselamprey_metapars.utr.cfg | 30 +
.../japaneselamprey_parameters.cfg} | 81 +-
.../japaneselamprey_weightmatrix.txt} | 0
config/species/schistosoma2/README.TXT | 7 +
.../sealamprey_exon_probs.pbl} | 0
.../sealamprey_igenic_probs.pbl} | 0
.../sealamprey_intron_probs.pbl} | 0
.../sealamprey_metapars.cfg} | 0
.../sealamprey_parameters.cfg} | 22 +-
.../sealamprey_weightmatrix.txt} | 0
docs/espoca/README | 52 +
docs/espoca/example.fa | 25 +
docs/espoca/tree.nwk | 1 +
include/codonMSA.hh | 40 +
include/contTimeMC.hh | 11 +-
include/geneMSA.hh | 8 +-
include/igenicmodel.hh | 4 +-
include/orthoexon.hh | 14 +-
include/properties.hh | 3 +-
include/sqliteDB.hh | 7 +-
include/types.hh | 5 +-
mansrc/aln2wig.1 | 47 +
mansrc/aln2wig.1.adoc | 29 +
mansrc/augustus.1 | 180 +
mansrc/augustus.1.adoc | 85 +
mansrc/bam2hints.1 | 120 +
mansrc/bam2hints.1.adoc | 75 +
mansrc/checkTargetSortedness.1 | 35 +
mansrc/checkTargetSortedness.1.adoc | 23 +
mansrc/consensusFinder.1 | 77 +
mansrc/consensusFinder.1.adoc | 47 +
mansrc/curve2hints.1 | 77 +
mansrc/curve2hints.1.adoc | 47 +
mansrc/etraining.1 | 41 +
mansrc/etraining.1.adoc | 28 +
mansrc/fastBlockSearch.1 | 85 +
mansrc/fastBlockSearch.1.adoc | 45 +
mansrc/filterBam.1 | 165 +
mansrc/filterBam.1.adoc | 87 +
mansrc/homGeneMapping.1 | 151 +
mansrc/homGeneMapping.1.adoc | 81 +
mansrc/joingenes.1 | 199 +
mansrc/joingenes.1.adoc | 83 +
mansrc/make.doc | 2 +
mansrc/prepareAlign.1 | 51 +
mansrc/prepareAlign.1.adoc | 31 +
scripts/gtf2bed.pl | 259 +
scripts/gtf2gff.pl | 36 +-
scripts/hal2maf_split.pl | 19 +-
scripts/join_mult_hints.pl | 2 +-
scripts/selectLongestORFs.pl | 20 -
scripts/splitMfasta.pl | 2 +-
scripts/transMap2hints.pl | 136 +-
src/Makefile | 15 +-
src/augustus.cc | 6 +-
src/codonMSA.cc | 146 +
src/compgenepred.cc | 14 +-
src/contTimeMC.cc | 371 +-
src/cxxflags | 2 +-
src/espoca.cc | 174 +
src/gene.cc | 3 +-
src/geneMSA.cc | 187 +-
src/getSeq | Bin 0 -> 33872520 bytes
src/igenicmodel.cc | 14 +-
src/load2sqlitedb | Bin 0 -> 2534880 bytes
src/load2sqlitedb.cc | 79 +-
src/orthoexon.cc | 43 +-
src/orthograph.cc | 16 +
src/parser/parse.cc | 7 +-
src/phylotree.cc | 40 +-
src/properties.cc | 61 +-
src/{properties.cc => properties.cc.backup} | 23 +-
src/{properties.cc => properties.cc.orig} | 25 +-
src/randseqaccess.cc | 16 +-
src/remove_PATH_MAX.patch | 71 +
src/scanner/lex.cc | 301 +-
src/scanner/lexer | 3 +-
src/scanner/scannerbase.h | 16 +-
src/sqliteDB.cc | 24 +-
src/types.cc | 19 +-
118 files changed, 72263 insertions(+), 3920 deletions(-)
diff --git a/HISTORY.TXT b/HISTORY.TXT
index 622e417..42b3b74 100644
--- a/HISTORY.TXT
+++ b/HISTORY.TXT
@@ -1,3 +1,10 @@
+List of changes from version 3.2.2 to 3.2.3 (until December 6th, 2016)
+ - bugfixes in joingenes, load2sqlitedb, transMap2hints.pl
+ - added script gtf2bed.pl
+ - CGP parameters for clade of 8 primates (cgp/log_reg_parameters_primates.cfg)
+ - added option --clean to load2sqlitedb
+ - now filter out truncated coding genes with CDS length <= 3
+ - Sascha Steinbiss: remove dependency on PATH_MAX
List of changes from version 3.2.1 to 3.2.2 (until March 30th, 2016)
- added extrinsic.M.RM.PB.cfg for PacBio CCS hints with GMAP
(see http://bioinf.uni-greifswald.de/bioinf/wiki/pmwiki.php?n=Augustus.PacBioGMAP )
diff --git a/Makefile b/Makefile
index c8e19f9..a2fba39 100644
--- a/Makefile
+++ b/Makefile
@@ -23,6 +23,7 @@ install:
ln -sf $(INSTALLDIR)/bin/fastBlockSearch /usr/local/bin/fastBlockSearch
ln -sf $(INSTALLDIR)/bin/load2db /usr/local/bin/load2db
ln -sf $(INSTALLDIR)/bin/getSeq /usr/local/bin/getSeq
+ ln -sf $(INSTALLDIR)/bin/espoca /usr/local/bin/espoca
# for internal purposes:
release:
@@ -38,7 +39,6 @@ release:
cd src/parser; rm Makefile; cd -
tar -czf ../augustus-$(AUGVERSION).tar.gz .
-
# remove -static from src/Makefile for MAC users
# remove -g -gdb from CXXFLAGS
# make COMPGENEPRED = true and SQLITE = true and MYSQL = true a comment
diff --git a/README-cgp.txt b/README-cgp.txt
index 4e68267..a316ddc 100644
--- a/README-cgp.txt
+++ b/README-cgp.txt
@@ -48,7 +48,7 @@ The following programs need be installed in cgp mode:
a) install all dependencies
- GSL: download source code from http://www.gnu.org/software/gsl/ and follow the installation instructions
+ GSL: use package manager or install from source from http://www.gnu.org/software/gsl/
Boost: install via package manager, on UBUNTU/Debian linux:
> sudo apt-get install libboost-all-dev
g++ install via package manager:
diff --git a/README.TXT b/README.TXT
index 1be2a13..057d612 100644
--- a/README.TXT
+++ b/README.TXT
@@ -10,7 +10,7 @@
% Fon: +49 3834 864642 %
% mario.stanke at uni-greifswald.de %
% %
-% Date: March 30th, 2016 %
+% Date: December 6th, 2016 %
% %
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
@@ -107,7 +107,7 @@ Aspergillus fumigatus, Aspergillus nidulans, Aspergillus oryzae, Aspergillus ter
, Phanerochaete chrysosporium, Pichia stipitis, Rhizopus oryzae, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Ustilago maydis
, Yarrowia lipolytica.
-The training for lamprey (Petromyzon marinus) was performed by Falk Hildebrand and Shigehiro Kuraku, based on the
+The training for 'sealamprey' (Petromyzon marinus) was performed by Falk Hildebrand and Shigehiro Kuraku, based on the
genome assembly (PMAR3.0) provided by the Genome Sequencing Center at Washington University School of Medicine (WUGSC)
in St. Louis. The training is described in: "Molecular Evolution in the Lamprey Genomes and Its Relevance to the Timing of Whole Genome Duplications"
T. Manousaki, H. Qiu, M. Noro, F. Hildebrand, A. Meyer and S. Kuraku in 'Jawless Fishes of the World, Volume 1', Cambridge Scholars Publishing
@@ -115,6 +115,7 @@ http://www.cambridgescholars.com/jawless-fishes-of-the-world
The training for elephant shark (Callorhinchus milii) was performed by Tereza Manousaki and Shigehiro Kuraku, based on the genome assembly
(made up of 1.4x whole genome shotgun reads) available at http://esharkgenome.imcb.a-star.edu.sg/resources.html.
+The training for 'japaneselamprey' (Lethenteron japonicum or Lethenteron camtschaticum) was performed by Shigehiro Kuraku.
The training for Pneumocystis jirovecii was performed by Marco Pagni, Philippe Hauser et al as described in Hauser PM, Burdet FX, Cissé OH,
Keller L, Taffé P, Sanglard D, Pagni M., Comparative Genomics Suggests that the Fungal Pathogen Pneumocystis Is an Obligate Parasite
@@ -133,7 +134,7 @@ Parameters for Apis dorsata were contributed by Francisco Camara Ferreira.
1. unpack
->tar -xzf augustus-3.2.2.tar.gz
+>tar -xzf augustus-3.2.3.tar.gz
The tar-archive contains one directory 'augustus-3.1' with the following sub-directories:
bin
@@ -162,10 +163,10 @@ If comparative (multi-species, CGP) AUGUSTUS is enabled via uncommenting
SQLITE = true or MYSQL = true
in common.mk then the following additional dependencies are required:
- - GNU scientific library (for eigen decompositions of matrices, sudo apt-get install libgsl0-dev)
+ - GNU scientific library (for eigen decompositions of matrices, sudo apt-get install libgsl-dev)
- libsqlite3-dev or mysql++ (sudo apt-get install libmysql++-dev or sudo apt-get install libsqlite3-dev)
- Boost C++ Library: sudo apt-get install libboost-graph-dev (at least version 1.45 from Nov. 2010)
- - sudo apt-get install liblpsolve55-dev
+ - integer linear program solver lpsolve: sudo apt-get install libsuitesparse-dev liblpsolve55-dev
Compiling bam2hints and filterBam requires:
diff --git a/auxprogs/bam2wig/Makefile b/auxprogs/bam2wig/Makefile
index 0377504..d8ab945 100644
--- a/auxprogs/bam2wig/Makefile
+++ b/auxprogs/bam2wig/Makefile
@@ -7,24 +7,24 @@
#
PROGRAM = bam2wig
-SOURCES = $(PROGRAM) bam_index.o
+SOURCES = $(PROGRAM)
OBJECTS = $(SOURCES:.c=.o)
TOOLDIR=/home/mario/tools
SAMTOOLS=$(TOOLDIR)/samtools/
HTSLIB=$(TOOLDIR)/htslib/
-BCFTOOLS=$(TOOLDIR)/bcftools/
+BCFTOOLS=$(TOOLDIR)/bcftools-1.2/
TABIX=$(TOOLDIR)/tabix/
INCLUDES=-I$(SAMTOOLS) -I. -I$(HTSLIB) -I$(BCFTOOLS) -I$(TABIX)
VPATH=$(SAMTOOLS)
LIBS=$(SAMTOOLS)/libbam.a $(HTSLIB)/libhts.a -lcurses -lm -lz -lpthread
-CFLAGS= -g -Wall -O2 $(INCLUDES)
+CFLAGS=-Wall -O2 $(INCLUDES)
CC=gcc
-$(PROGRAM) : bam2wig.o bam_index.o
+$(PROGRAM) : bam2wig.o
$(CC) $(CFLAGS) $^ -o $@ $(LIBS)
-bam2wig.o : bam2wig.c
+bam2wig.o : bam2wig.c
$(CC) $(CFLAGS) -c $^ -o $@ $(INCLUDES)
-clean:
+clean:
rm -f $(OBJECTS) bam2wig.o
diff --git a/auxprogs/bam2wig/bam2wig.c b/auxprogs/bam2wig/bam2wig.c
index 95b9055..cc50561 100644
--- a/auxprogs/bam2wig/bam2wig.c
+++ b/auxprogs/bam2wig/bam2wig.c
@@ -15,7 +15,7 @@
#include <string.h>
#include <stdio.h>
#include <unistd.h>
-#include "sam.h"
+#include "sam.h"
#include "bam.h"
// Auxiliary data structure
diff --git a/auxprogs/homGeneMapping/README.TXT b/auxprogs/homGeneMapping/README.TXT
index 96a4e42..6b4d5d6 100644
--- a/auxprogs/homGeneMapping/README.TXT
+++ b/auxprogs/homGeneMapping/README.TXT
@@ -15,13 +15,32 @@ alignment of the genomes and prints a summary for each gene, e.g.
INSTALLATION
=====================
-### Requirements
+### Requirements ###
* gcc 4.6 or newer
* HAL Tools (available at https://github.com/glennhickey/hal)
-
From within the src directory, type "make"
+### Optional Requirements """
+* Boost graph library for option --printHomologs that clusters
+ transcripts into groups of homologs
+
+* SQLite library for option --dbaccess that enables the retrieval hints from a database:
+ Install the package libsqlite3-dev with your package manager or
+ download the SQLite source code from http://www.sqlite.org/download.html/
+ (tested with SQLite 3.8.5 ) and install as follows:
+
+ > tar zxvf sqlite-autoconf-3080500.tar.gz
+ > cd sqlite-autoconf-3080500
+ > ./configure
+ > sudo make
+ > sudo make install
+
+ If you encounter an "SQLite header and source version mismatch" error, try
+
+ > ./configure --disable-dynamic-extensions --enable-static --disable-shared
+
+ Turn on the flag SQLITE in src/Makefile and recompile
USAGE
diff --git a/auxprogs/homGeneMapping/include/gene.hh b/auxprogs/homGeneMapping/include/gene.hh
index 67519ae..957c42e 100644
--- a/auxprogs/homGeneMapping/include/gene.hh
+++ b/auxprogs/homGeneMapping/include/gene.hh
@@ -12,18 +12,19 @@
#include <string>
#include <list>
+#include <vector>
// Forward declarations
class GeneFeature;
class Gene;
#define NUM_STRAND_TYPES 2
-#define NUM_FEATURE_TYPES 2
+#define NUM_FEATURE_TYPES 6
enum Strand{unknown=-1,plusstrand,minusstrand};
extern std::string strandIdentifiers[NUM_STRAND_TYPES];
-enum FeatureType{CDS=0, intron};
+enum FeatureType{unkown=-1, CDS, intron, exon, UTR, start, stop};
extern std::string featureTypeIdentifiers[NUM_FEATURE_TYPES];
/*
@@ -45,7 +46,6 @@ public:
strand(_strand),
frame(_frame),
score(_score),
- extrinsic(""),
mult(0),
gene(NULL)
{}
@@ -60,24 +60,29 @@ public:
Gene* getGene();
long int getStart() const {return start;}
int getLen() const {return len;}
+ void setLen(int l) {len = l;}
long int getEnd() const {return (start+len-1);}
int getFrame() const {return frame;}
std::string writeFrame() const;
double getScore() const {return score;}
- void setEvidence(std::string e){ if(extrinsic.empty()){extrinsic=e;}}
- void setMult(int m){mult=m;}
- std::string getEvidence() const {return extrinsic;}
+ void setEvidence(std::string e);
+ void setMult(int m){mult+=m;}
+ void setStart(long int s) {start=s;}
+ std::string getEvidence() const;
int getMult() const {return mult;}
FeatureType getFeatureType() const {return type;}
int lenMod3() const {return ((len) % 3);}
+ bool hasEvidence(std::string e) const;
bool hasEvidence() const {return !extrinsic.empty();}
- bool isExon() const {return (type == CDS);}
+ bool isExon() const {return (type == exon);}
+ bool isCDS() const {return (type == CDS);}
bool isIntron() const {return (type == intron);}
+ bool isUTR() const {return (type == UTR);}
+ bool isMapped() const {return (type == exon || type == CDS || type == intron);}
+ bool isType(FeatureType t) const {return (type == t);}
bool isPartofGene() const {return gene;} // if false, gene feature purely represent extrinsic evidence
bool sameStrand(Strand other);
bool sameFrame(int other);
-
- std::list< std::pair<int,GeneFeature*> >getHomologs() const {return homologs;}
void appendHomolog(GeneFeature *gf, int idx) {homologs.push_back(std::pair<int,GeneFeature*>(idx, gf));}
private:
@@ -89,7 +94,7 @@ private:
// not part of a Gene
int frame; // -1 if gene feature has no frame
double score;
- std::string extrinsic; // source of extrinsic info, e.g. 'M' (manual) or 'E' (EST).
+ std::vector< std::string > extrinsic; // list of sources of extrinsic info, e.g. 'M' (manual) or 'E' (EST).
// empty, if gene feature is not supported by extrinsic evidence,
int mult;
Gene *gene; // pointer to the gene the feature belongs to
@@ -101,9 +106,12 @@ private:
* means that gene feature has 4 homologs:
* 2 in genome 0 (gf1 and gf2), 1 in genome 2 (gf3) and 1 in genome 3 (gf4)
*/
+public:
std::list<std::pair<int,GeneFeature*> >homologs;
};
+bool compareGFs(GeneFeature *a, GeneFeature *b);
+
/*
* class Gene:
* a gene is basically a list of gene features
@@ -131,19 +139,24 @@ public:
std::string getTxID() const {return txID;}
int getSeqID() const {return seqID;}
std::string getSource() const {return source;}
- std::list<GeneFeature*> getFeatureList() const {return features;}
int numGFs() const {return features.size();}
- void setTLstart(long int s) {tlStart = s;}
- void setTLend(long int e) {tlEnd = e;}
+ int numGFs(FeatureType t) const;
+ bool hasFeatures() const {return !features.empty();}
+ void sortGFs() {features.sort(compareGFs);}
+ void includeStopInCDS();
+ void setTLstart(long int s){tlStart=s;}
+ void setTLend(long int e){tlEnd=e;}
long int getTLstart() const {return tlStart;}
long int getTLend() const {return tlEnd;}
- long int getStart() const; // gene start
- long int getEnd() const; // gene end
- bool hasFeatures() const {return !features.empty();}
-
- std::list< std::pair<int,Gene*> >getHomologs() const {return homologs;}
+ GeneFeature* getFirstGF(FeatureType t);
+ GeneFeature* getLastGF(FeatureType t);
+ long int getTXstart() {return getFirstGF(exon)->getStart();}
+ long int getTXend() {return getLastGF(exon)->getEnd();}
+ void insertExons();
+ void insertMissingGFs();
void appendHomolog(Gene *g, int idx) {homologs.push_back(std::pair<int,Gene*>(idx, g));}
+
private:
std::string geneID;
std::string txID;
@@ -152,8 +165,7 @@ private:
std::string source;
long int tlStart; // translation start
long int tlEnd; // translation end
- std::list<GeneFeature*> features;
-
+public:
/*
* homologous genes:
* two genes are homologous if all their gene features are
@@ -163,9 +175,11 @@ private:
* means that gene feature has 3 homologs in genome 0,2 and 3, respectively.
*/
std::list<std::pair<int,Gene*> >homologs;
+ std::list<GeneFeature*> features;
};
Strand getStrand(std::string token);
int getFrame(std::string token);
+FeatureType getType(std::string token);
#endif // _GENE_HH
diff --git a/auxprogs/homGeneMapping/include/genome.hh b/auxprogs/homGeneMapping/include/genome.hh
index 3ea6db9..11a9ccb 100644
--- a/auxprogs/homGeneMapping/include/genome.hh
+++ b/auxprogs/homGeneMapping/include/genome.hh
@@ -1,4 +1,4 @@
- /**********************************************************************
+/**********************************************************************
* file: genome.hh
* licence: Artistic Licence, see file LICENCE.TXT or
* http://www.opensource.org/licenses/artistic-license.php
@@ -16,6 +16,10 @@
//project includes
#include "gene.hh"
+#ifdef SQLITE
+#include "sqliteDB.hh"
+#endif
+
#ifdef BOOST
#include <boost/graph/adjacency_list.hpp>
#include <boost/graph/connected_components.hpp>
@@ -31,6 +35,7 @@ typedef boost::adjacency_list <boost::setS, boost::vecS, boost::undirectedS, Ver
// Forward declarations
class GeneFeature;
struct GeneInfo;
+struct GeneInfoCollection;
/*
* class Genome:
@@ -54,15 +59,20 @@ public:
int getIdx() const {return idx;}
std::string getName(){return name;}
-
// read and write functions
+ void parse(std::string genefile, std::string hintsfile, std::string dbfile);
void parseGTF(std::string gtffilename); // reads a gene file in gtf format
void parseExtrinsicGFF(std::string gfffilename); // reads a hints file in gff format
- void printGFF(std::string outdir, std::vector<Genome> &genomes); // output a gene in gtf format with
+ void insertHint(std::string seqname, long int start, long int end, Strand strand, std::string esource, int mult, int frame, std::string f_type);
+#ifdef SQLITE
+ void getDbHints(SQLiteDB &db);
+#endif
+ //void printGFF(std::string outdir, std::vector<Genome> &genomes, bool detailed=false); // output a gene in gtf format with
void printBed();
void readBed(Genome &other);
- void writeGeneFeature(GeneFeature *gf, std::ofstream &of) const;
+ void writeGeneFeature(GeneFeature *gf, std::ofstream &of, bool unmapped=false) const;
void writeGene(Gene *g, std::ofstream &of) const;
+ void writeTxLine(Gene *g, std::ofstream &of) const;
void writeTLStart(Gene *g, std::ofstream &of) const;
void writeTLEnd(Gene *g, std::ofstream &of) const;
@@ -70,14 +80,17 @@ public:
void liftOverTo(Genome& other, std::string halfile, std::string halLiftover_exec, std::string halParam);
// mapping of homologous gene features
- void mapGeneFeatures(std::vector<Genome> &genomes);
- void printDetailed(GeneFeature *g, std::ofstream &of) const;
+ void write_hgm_gff(std::vector<Genome> &genomes, std::string outdir, bool detailed=false, bool unmapped=false);
+ void mapGeneFeatures(std::vector<Genome> &genomes, std::string outdir, bool detailed=false, bool unmapped=false);
+ void print_hgm_info(GeneFeature *g, std::ofstream &of) const;
+ void print_hgm_unaligned(GeneFeature *g, std::ofstream &of) const;
// hash functions
void insertPos(int seqID, long int pos); // insert start/end positions of gene features in mappedPos
std::vector< std::list< uint_fast64_t > > findMappedPos(int seqID, long int pos);
void insertSeqInt(GeneFeature* gf); // insert gene features into gfHash
void insertSeqInt(GeneFeature* gf, int seqID); // insert hints into gfHash
+ void insertSeqInts(Gene *g); // inserts all gene features of g into gfHash and mappedPos
std::list<GeneFeature*> findSeqInt(uint_fast64_t key, int seqID, Strand strand); // retrieve gene features from gfHash
// static functions
@@ -134,18 +147,44 @@ void printHomGeneList(std::string outfile, std::vector<Genome> &genomes);
struct GeneInfo{
public:
- GeneInfo(Gene *_gene, int _numMatchingEs, int _numMatchingIs, bool _frameshift) :
+ GeneInfo(Gene *_gene, int _numMatchingCs, int _numMatchingIs, int _numMatchingEs, bool _frameshift) :
gene(_gene),
- numMatchingEs(_numMatchingEs),
+ numMatchingCs(_numMatchingCs),
numMatchingIs(_numMatchingIs),
+ numMatchingEs(_numMatchingEs),
frameshift(_frameshift)
{}
~GeneInfo(){}
Gene *gene;
- int numMatchingEs;
+ int numMatchingCs;
int numMatchingIs;
+ int numMatchingEs;
bool frameshift;
};
+struct GeneInfoCollection{
+
+ public:
+ GeneInfoCollection(int no_genomes){
+ ginfo.resize(no_genomes);
+ mappedStatsC.resize(no_genomes);
+ mappedStatsI.resize(no_genomes);
+ mappedStatsE.resize(no_genomes);
+ extrinStatsC.resize(no_genomes+1);
+ extrinStatsI.resize(no_genomes+1);
+ extrinStatsE.resize(no_genomes+1);
+ }
+ ~GeneInfoCollection(){}
+ void createCollection(GeneFeature *g);
+ void printDetailedStats(Gene *g, std::ofstream &of);
+ std::vector<std::map<std::string,GeneInfo> > ginfo;
+ std::vector<int> mappedStatsC; // number of CDS with exact homologs in at least k other genomes
+ std::vector<int> mappedStatsI; // number of Intr ...
+ std::vector<int> mappedStatsE; // number of Exons ...
+ std::vector<int> extrinStatsC; // number of CDS supported by evidence in at least k other genomes
+ std::vector<int> extrinStatsI; // number of Intr ...
+ std::vector<int> extrinStatsE; // number of Exons ...
+};
+
#endif // _GENOME_HH
diff --git a/auxprogs/homGeneMapping/include/projectio.hh b/auxprogs/homGeneMapping/include/projectio.hh
old mode 100755
new mode 100644
index bf24ad1..fb2f54c
--- a/auxprogs/homGeneMapping/include/projectio.hh
+++ b/auxprogs/homGeneMapping/include/projectio.hh
@@ -154,13 +154,15 @@ inline void writePictograph(std::vector<int> v, std::ofstream &of){
/*
* print a pictograph from the sum of values of two vectors
*/
-inline void writePictograph(std::vector<int> u, std::vector<int> v, std::ofstream &of){
+inline void writePictograph(std::vector<int> u, std::vector<int> v, std::vector<int> w, std::ofstream &of){
u = reverse_accumulate(u);
v = reverse_accumulate(v);
+ w = reverse_accumulate(w);
int sumV = v.front();
int sumU = u.front();
- std::vector<int> w = sum(u,v);
+ int sumW = w.front();
+ std::vector<int> x = sum(v,w);
of.setf(std::ios::showpoint|std::ios::fixed, std::ios::floatfield);
@@ -169,8 +171,9 @@ inline void writePictograph(std::vector<int> u, std::vector<int> v, std::ofstrea
for(int i=0; i<v.size(); i++){
double percV = (sumV>0)? (((double)v[i]*100)/sumV) : 0.0;
double percU = (sumU>0)? (((double)u[i]*100)/sumU) : 0.0;
- double percW = ((sumV+sumU)>0)? (((double)w[i]*100)/(sumU+sumV)) : 0.0;
- double numStars = ((sumV+sumU)>0)? ((w[i]*25)/(sumV+sumU)) : 0.0;
+ double percW = (sumW>0)? (((double)w[i]*100)/sumW) : 0.0;
+ double percX = ((sumV+sumW)>0)? (((double)x[i]*100)/(sumV+sumW)) : 0.0;
+ double numStars = ((sumV+sumW)>0)? ((x[i]*25)/(sumV+sumW)) : 0.0;
of << "#";
of.width(4); of << i;
@@ -180,7 +183,8 @@ inline void writePictograph(std::vector<int> u, std::vector<int> v, std::ofstrea
of.width(6); of << percV << "%";
of.width(10); of << w[i];
of.width(6); of << percW << "% ";
-
+ of.width(10); of << x[i];
+ of.width(6); of << percX << "% ";
of << std::string(numStars, '*') << std::endl; // pictograph
}
}
diff --git a/include/sqliteDB.hh b/auxprogs/homGeneMapping/include/sqliteDB.hh
similarity index 92%
copy from include/sqliteDB.hh
copy to auxprogs/homGeneMapping/include/sqliteDB.hh
index a220ad7..c165bb8 100644
--- a/include/sqliteDB.hh
+++ b/auxprogs/homGeneMapping/include/sqliteDB.hh
@@ -43,12 +43,6 @@ public:
// create tables
bool tableExists(string table_name);
- void createTableGenomes();
- void createTableSpeciesnames();
- void createTableSeqnames();
- void createTableHints();
- void createTableFeatureTypes();
- int getSpeciesID(string species);
void beginTransaction();
void endTransaction();
diff --git a/auxprogs/homGeneMapping/src/Makefile b/auxprogs/homGeneMapping/src/Makefile
index 717f4d1..40a2376 100644
--- a/auxprogs/homGeneMapping/src/Makefile
+++ b/auxprogs/homGeneMapping/src/Makefile
@@ -3,6 +3,10 @@
#
# BOOST = true
+# set this flag to enable
+# database access for retrieval of hints
+# SQLITE = true
+
CC = g++
# Notes: - "-Wno-sign-compare" eliminates a high number of warnings (see footnote below). Please adopt
@@ -11,7 +15,7 @@ CC = g++
CFLAGS := -Wall -Wno-sign-compare -ansi -pedantic -std=c++0x -pthread -O2 ${CFLAGS} # -DDEBUG -g -ggdb -pg
INCLS = -I../include
-
+LIBS =
OBJS = gene.o genome.o
ifdef BOOST
@@ -19,6 +23,13 @@ ifdef BOOST
INCLS += # add the boost include path here, if boost ist not installed system-wide
endif
+ifdef SQLITE
+INCLS += # add the sqlite include path here, if sqlite is not installed system-wide
+LIBS += -lsqlite3 # add the sqlite library path here, if sqlite is not install system-wide
+OBJS += sqliteDB.o
+CFLAGS += -DSQLITE
+endif
+
all: homGeneMapping
.SUFFIXES:
@@ -28,7 +39,7 @@ all: homGeneMapping
$(CC) -c $(CFLAGS) $(CXXFLAGS) $(CPPFLAGS) $(LDFLAGS) -o $@ $< $(INCLS)
homGeneMapping: main.cc $(OBJS)
- $(CC) $(CFLAGS) $(CPPFLAGS) -o $@ $^ $(INCLS)
+ $(CC) $(CFLAGS) $(CPPFLAGS) -o $@ $^ $(INCLS) $(LIBS)
cp homGeneMapping ../../../bin/homGeneMapping
clean:
@@ -49,3 +60,7 @@ genome.o : \
../include/bitmasking.hh \
../include/gene.hh \
genome.cc
+
+sqliteDB.o: \
+ ../include/sqliteDB.hh \
+ sqliteDB.cc
diff --git a/auxprogs/homGeneMapping/src/gene.cc b/auxprogs/homGeneMapping/src/gene.cc
index 3919b10..4f38150 100644
--- a/auxprogs/homGeneMapping/src/gene.cc
+++ b/auxprogs/homGeneMapping/src/gene.cc
@@ -1,4 +1,3 @@
-
/**********************************************************************
* file: gene.cc
* licence: Artistic Licence, see file LICENCE.TXT or
@@ -21,7 +20,7 @@ string strandIdentifiers[NUM_STRAND_TYPES]=
{"+", "-"};
string featureTypeIdentifiers[NUM_FEATURE_TYPES]=
- {"CDS", "intron"};
+ {"CDS", "intron","exon", "UTR", "start_codon", "stop_codon"};
string GeneFeature::getGeneID() const {
return gene->getGeneID();
@@ -67,6 +66,24 @@ bool GeneFeature::sameFrame(int other){
return false;
}
+void GeneFeature::setEvidence(string e){
+ if(!hasEvidence(e))
+ extrinsic.push_back(e);
+}
+string GeneFeature::getEvidence() const {
+ string e = "";
+ for (int i = 0; i<extrinsic.size(); i++)
+ (e.empty())? e=extrinsic[i] : e = e + ":" + extrinsic[i];
+ return e;
+}
+bool GeneFeature::hasEvidence(string e) const {
+ for(int i = 0; i < extrinsic.size(); i++){
+ if(extrinsic[i] == e)
+ return true;
+ }
+ return false;
+}
+
Strand getStrand(string token){
Strand strand = unknown;
if(token == "+")
@@ -87,23 +104,169 @@ int getFrame(string token){
return frame;
}
-long int Gene::getStart() const {
-
- long int geneStart = -1;
- if(strand == plusstrand)
- geneStart = (tlStart >= 0)? tlStart : features.front()->getStart();
- else
- geneStart = (tlEnd >=0) ? tlEnd-2 : features.front()->getStart();
- return geneStart;
+FeatureType getType(std::string token){
+ if(token == "CDS")
+ return CDS;
+ if(token == "intron")
+ return intron;
+ if(token == "exon")
+ return exon;
+ if(token == "start_codon")
+ return start;
+ if(token == "stop_codon")
+ return stop;
+ if(token.find("UTR") != string::npos)
+ return UTR;
+ return unkown;
}
-long int Gene::getEnd() const {
+int Gene::numGFs(FeatureType t) const {
+ int num=0;
+ for(std::list<GeneFeature*>::const_iterator it=features.begin(); it!=features.end(); it++){
+ if((*it)->isType(t))
+ num++;
+ }
+ return num;
+}
+GeneFeature* Gene::getFirstGF(FeatureType t){
+ for(std::list<GeneFeature*>::iterator it=features.begin(); it!=features.end(); it++){
+ if((*it)->isType(t))
+ return *it;
+ }
+ return NULL;
+}
- long int geneEnd = -1;
- if(strand == plusstrand)
- geneEnd = (tlEnd >= 0)? tlEnd : features.back()->getEnd();
- else
- geneEnd = (tlStart >=0) ? tlStart+2 : features.back()->getEnd();
- return geneEnd;
+GeneFeature* Gene::getLastGF(FeatureType t){
+ for(std::list<GeneFeature*>::reverse_iterator it=features.rbegin(); it!=features.rend(); it++){
+ if((*it)->isType(t))
+ return *it;
+ }
+ return NULL;
+}
+
+void Gene::includeStopInCDS(){
+ sortGFs();
+ if(tlEnd >= 0){
+ if(strand == plusstrand){
+ GeneFeature *last = getLastGF(CDS);
+ if(last){
+ long int cdsEnd = last->getEnd();
+ if(cdsEnd == tlEnd+2){ // stop already included
+ }
+ else if( cdsEnd == tlEnd-1){ // include stop
+ last->setLen(last->getLen()+3);
+ }
+ else if( cdsEnd < tlEnd-1){ // stop codon is a separate CDS exon
+ FeatureType type = CDS;
+ GeneFeature *exon = new GeneFeature(type, tlEnd,tlEnd+2,strand,0);
+ appendFeature(exon);
+ exon->setGene(this);
+ }
+ }
+ }
+ else if(strand == minusstrand){
+ GeneFeature *first = getFirstGF(CDS);
+ if(first){
+ long int cdsStart = first->getStart();
+ if(cdsStart == tlEnd){ // stop already included
+
+ }
+ else if( cdsStart == tlEnd+3){ // include stop
+ first->setStart(cdsStart-3);
+ first->setLen(first->getLen()+3);
+ }
+ else if( cdsStart > tlEnd+3){ // stop codon is a separate CDS exon
+ FeatureType type = CDS;
+ GeneFeature *exon = new GeneFeature(type, tlEnd,tlEnd+2,strand,0);
+ appendFeature(exon);
+ exon->setGene(this);
+ }
+ }
+ }
+ }
+}
+void Gene::insertExons(){
+
+ sortGFs();
+ GeneFeature* pred_exon = NULL;
+ for(list<GeneFeature*>::iterator it=features.begin(); it!=features.end();it++){
+ if (!(*it)->isCDS() && !(*it)->isUTR())
+ continue;
+ if(pred_exon && pred_exon->getEnd() + 1 == (*it)->getStart()){
+ pred_exon->setLen((*it)->getEnd()-pred_exon->getStart()+1);
+ }
+ else{
+ FeatureType type = exon;
+ GeneFeature *exon = new GeneFeature(type, (*it)->getStart(),(*it)->getEnd(),strand);
+
+ appendFeature(exon);
+ exon->setGene(this);
+
+ pred_exon = exon;
+ }
+ }
+}
+
+void Gene::insertMissingGFs(){
+
+ int numIntr = numGFs(intron);
+ int numEx = numGFs(exon);
+
+ // insert exons if missing
+ if(numEx == 0)
+ insertExons();
+
+ // delete UTR GeneFeatures - not needed anymore
+ for(list<GeneFeature*>::iterator it=features.begin(); it!=features.end();){
+ if ((*it)->isUTR()){
+ delete *it;
+ it = features.erase(it);
+ }
+ else {
+ ++it;
+ }
+ }
+ sortGFs();
+ numEx = numGFs(exon);
+ // insert introns if missing
+ if(numIntr == 0 && numEx > 1){
+ GeneFeature *pred_exon = NULL;
+ for(list<GeneFeature*>::iterator it=features.begin(); it!=features.end();it++){
+ if (!(*it)->isExon())
+ continue;
+ GeneFeature *exon = (*it);
+ if(pred_exon){
+ FeatureType type = intron;
+ GeneFeature *intron = new GeneFeature(type, pred_exon->getEnd(),exon->getStart(),strand);
+ appendFeature(intron);
+ intron->setGene(this);
+ }
+ pred_exon = exon;
+ }
+ }
+ // insert start_codon
+ if(getTLstart() >= 0){
+ FeatureType type = start;
+ GeneFeature *start = new GeneFeature(type, getTLstart(), getTLstart()+2, strand);
+ appendFeature(start);
+ start->setGene(this);
+ }
+ // insert stop_codon
+ if( getTLend() >= 0){
+ FeatureType type = stop;
+ GeneFeature *stop = new GeneFeature(type, getTLend(), getTLend()+2, strand);
+ appendFeature(stop);
+ stop->setGene(this);
+ }
+ sortGFs();
+}
+
+
+bool compareGFs(GeneFeature *a, GeneFeature *b){
+ if( a->getStart() != b->getStart() )
+ return ( a->getStart() < b->getStart() );
+ if ( a->getLen() != b->getLen() )
+ return ( a->getLen() >= b->getLen() );
+ return a->getFeatureType() <= b->getFeatureType();
}
diff --git a/auxprogs/homGeneMapping/src/genome.cc b/auxprogs/homGeneMapping/src/genome.cc
index 91f78fc..4cb4db5 100644
--- a/auxprogs/homGeneMapping/src/genome.cc
+++ b/auxprogs/homGeneMapping/src/genome.cc
@@ -33,6 +33,19 @@ void Genome::destroyHintList(){
delete *it;
}
+void Genome::parse(string genefile, string hintsfile, string dbfile){
+ parseGTF(genefile);
+ if(!hintsfile.empty()) // read hints file if specified
+ parseExtrinsicGFF(hintsfile);
+#ifdef SQLITE
+ if(!dbfile.empty()){
+ SQLiteDB db = SQLiteDB(dbfile.c_str());
+ getDbHints(db);
+ }
+#endif
+ printBed(); // print sequence coordinates, that need to be mapped to the other genomes, to file
+}
+
void Genome::parseExtrinsicGFF(string gfffilename){
ifstream ifstrm(gfffilename.c_str());
if (ifstrm.is_open()){
@@ -47,21 +60,19 @@ void Genome::parseExtrinsicGFF(string gfffilename){
vector<string> tokens = splitString(line);
if(tokens.size() != 9)
throw ProjectError("wrong number of columns.\n");
-
- map<string,int>::iterator it = seqnames.find(tokens[0]);
- if(it == seqnames.end()) // no gene on that sequence
- continue;
- int seqid = it->second;
+
+ string seqname = tokens[0];
long int start = atol(tokens[3].c_str());
long int end = atol(tokens[4].c_str());
Strand strand = getStrand(tokens[6]);
-
+ int frame = getFrame(tokens[7]);
+
/*
* find source of extrinsic info, specified in gff as: source=X or src=X
*/
const char *spos;
string esource;
- int mult = 0;
+ int mult = 1;
spos = strstr(tokens[8].c_str(), "source=");
if (spos)
@@ -85,35 +96,11 @@ void Genome::parseExtrinsicGFF(string gfffilename){
spos += 5;
if (spos)
mult = atoi(spos);
- /*
- * find all gene features that are supported
- * by that hint and update their extrinsic source
- */
- if(tokens[2] == "CDS" || tokens[2] == "intron"){
- int frame = getFrame(tokens[7]);
- FeatureType type = (tokens[2] == "CDS")? CDS : intron;
- if(type == intron){
- start--;
- end++;
- }
- SeqIntKey seqInt(start, end-start+1, type);
- list<GeneFeature*> le = findSeqInt(seqInt.getKey(), seqid, strand);
- bool isGF = false;
- for(list<GeneFeature*>::iterator it=le.begin(); it!=le.end(); it++){
- if((*it)->sameFrame(frame)){
- (*it)->setEvidence(esource); // update extrinsic source
- (*it)->setMult(mult);
- isGF = true;
- }
- }
- if(!isGF){
- GeneFeature *gf = new GeneFeature(type, start, end, strand, frame);
- gf->setEvidence(esource);
- gf->setMult(mult);
- insertSeqInt(gf, seqid);
- hints.push_back(gf);
- }
- }
+
+ string type = tokens[2];
+ if(type == "CDS" || type == "intron" || type == "exon") // currently only CDS , exon and intron hints
+ insertHint(seqname,start,end,strand,esource,mult,frame,type);
+
}
} catch( ProjectError& err ){
cerr << "Error in " << gfffilename << " in line " << line_no << endl;
@@ -130,8 +117,6 @@ void Genome::parseGTF(string gtffilename){
int line_no = 0;
try{
Gene *gene = NULL;
- GeneFeature *pred_exon = NULL;
-
while (ifstrm) {
string line;
getline(ifstrm, line);
@@ -146,7 +131,9 @@ void Genome::parseGTF(string gtffilename){
string attribute = tokens[8];
stringstream ss(attribute);
string geneid, transid, token;
- if(tokens[2] != "start_codon" && tokens[2] != "stop_codon" && tokens[2] != "CDS") // skip all features not in {CDS,start_codon,stop_codon}
+
+ FeatureType type = getType(tokens[2]);
+ if(type == unkown) // skip all features not in {CDS,start_codon,stop_codon,exon,UTR,intron}
continue;
while(ss >> token){
if( token.compare("gene_id") == 0 ){
@@ -179,51 +166,43 @@ void Genome::parseGTF(string gtffilename){
seqid = seqnames.insert(make_pair(tokens[0], seqnames.size()));
if(seqid.second)
seqIDs.insert(make_pair(seqid.first->second, seqid.first->first));
-
+
Strand strand = getStrand(tokens[6]);
- if(gene && gene->hasFeatures())
+ if(gene && gene->hasFeatures()){
+ gene->includeStopInCDS();
+ gene->insertMissingGFs();
genes.push_back(gene);
+ insertSeqInts(gene);
+ }
gene= new Gene(geneid,transid, seqid.first->second, strand, tokens[1]);
- pred_exon = NULL;
}
- if(tokens[2] == "start_codon"){
+ if(type == start){
gene->setTLstart(atol(tokens[3].c_str()));
}
- if(tokens[2] == "stop_codon"){
- gene->setTLend(atol(tokens[4].c_str()));
+ if(type == stop){
+ gene->setTLend(atol(tokens[3].c_str()));
}
- if(tokens[2] == "CDS"){ // add exon to gene
- FeatureType type = CDS;
+ if(type == CDS || type == UTR || type == exon || type == intron){ // add exon to gene
long int start = atol(tokens[3].c_str());
long int end = atol(tokens[4].c_str());
+ if(type == intron){
+ start-=1;
+ end+=1;
+ }
double score = atof(tokens[5].c_str());
Strand strand = getStrand(tokens[6]);
int frame = getFrame(tokens[7]);
- GeneFeature *exon = new GeneFeature(type, start,end,strand,frame,score);
- exon->setGene(gene);
-
- // add exon into gfHash
- insertSeqInt(exon);
-
- // add exon start/end into mappedPos
- insertPos(exon->getSeqID(),start);
- insertPos(exon->getSeqID(),end);
-
- // create an intron if a predecessor exon exists
- if(pred_exon){
- FeatureType type = intron;
- GeneFeature *intron = new GeneFeature(type, pred_exon->getEnd(),exon->getStart(),strand, -1, 0.0);
- gene->appendFeature(intron);
- intron->setGene(gene);
- // add to gfHash
- insertSeqInt(intron);
- }
- gene->appendFeature(exon);
- pred_exon = exon;
+ GeneFeature *gf = new GeneFeature(type, start,end,strand,frame,score);
+ gene->appendFeature(gf);
+ gf->setGene(gene);
}
}
- if(gene && gene->hasFeatures())
+ if(gene && gene->hasFeatures()){
+ gene->includeStopInCDS();
+ gene->insertMissingGFs();
genes.push_back(gene);
+ insertSeqInts(gene);
+ }
} catch( ProjectError& err ){
cerr << "Error in " << gtffilename << " in line " << line_no << endl;
throw err;
@@ -234,7 +213,7 @@ void Genome::parseGTF(string gtffilename){
}
-void Genome::writeGeneFeature(GeneFeature *gf, ofstream &of) const {
+void Genome::writeGeneFeature(GeneFeature *gf, ofstream &of, bool unmapped) const {
of << getSeqName(gf->getSeqID()) << "\t";
of << gf->getSource() << "\t";
of << featureTypeIdentifiers[gf->getFeatureType()] << "\t";
@@ -250,7 +229,18 @@ void Genome::writeGeneFeature(GeneFeature *gf, ofstream &of) const {
of << strandIdentifiers[gf->getStrand()] << "\t";
of << gf->writeFrame() << "\t";
of << "transcript_id \"" << gf->getTxID() << "\"; ";
- of << "gene_id \"" << gf->getGeneID() << "\";" << endl;
+ of << "gene_id \"" << gf->getGeneID() << "\"; " ;
+ if(!gf->isType(stop) && !gf->isType(start)){
+ of << "hgm_info \"";
+ print_hgm_info(gf,of);
+ of << "\"; ";
+ if(unmapped){
+ of << "hgm_mapped \"";
+ print_hgm_unaligned(gf,of);
+ of << "\"; ";
+ }
+ }
+ of << endl;
}
void Genome::setTmpDir(string tmpdir){
@@ -326,7 +316,7 @@ void Genome::liftOverTo(Genome &other, string halfile, string halLiftover_exec,
string Genome::getSeqName(int seqID) const {
- map<int,string>::const_iterator it = seqIDs.find(seqID);
+ map<int,string>::const_iterator it = seqIDs.find(seqID);
if(it == seqIDs.end())
throw ProjectError("internal error: unknown sequence ID seqID=" + itoa(seqID) + " in genome " + name + "\n");
return it->second;
@@ -335,13 +325,21 @@ string Genome::getSeqName(int seqID) const {
int Genome::getSeqID(string seqname) const{
- map<string, int>::const_iterator it = seqnames.find(seqname);
+ map<string, int>::const_iterator it = seqnames.find(seqname);
if(it == seqnames.end())
return -1;
return it->second;
}
+void Genome::write_hgm_gff(vector<Genome> &genomes, string outdir, bool details, bool unmapped){
+ for(int j = 0; j < genomes.size(); j++){
+ if(idx != j)
+ readBed(genomes[j]); // reading in bed files with mapped coordinates
+ }
+ mapGeneFeatures(genomes, outdir, details, unmapped);
+}
+
/*
* mapping of homologous gene features
* retrieves for each gene feature gf the mapped start and end positions in each genome j, and
@@ -349,19 +347,33 @@ int Genome::getSeqID(string seqname) const{
* If an assembled seq interval is part of a gene in genome j,
* it is appended to the list of homologs of gf
*/
-void Genome::mapGeneFeatures(vector<Genome> &genomes){
+void Genome::mapGeneFeatures(vector<Genome> &genomes, string outdir, bool detailed, bool unmapped){
+ string filename = outdir + name + ".gtf";
+ ofstream of;
+
+ of.open(filename.c_str());
+
+ // print header
+ for(int i=0; i < genomes.size(); i++){
+ of << "# " << genomes[i].getIdx() << "\t" << genomes[i].getName() << endl;
+ }
+ of << "###" << endl;
for(list<Gene*>::iterator git = genes.begin(); git != genes.end(); git++){
- list<GeneFeature*> features = (*git)->getFeatureList();
+ list<GeneFeature*> features = (*git)->features;
if(features.empty())
continue;
- GeneFeature* first = features.front();
- vector< list< uint_fast64_t > > mappedStarts = findMappedPos(first->getSeqID(), first->getStart());
-
+ writeTxLine(*git,of);
+ GeneInfoCollection gfc(no_genomes);
for(list<GeneFeature*>::iterator gfit = features.begin(); gfit != features.end(); gfit++){
- // get mapped end positions
+ if(!(*gfit)->isMapped()){
+ writeGeneFeature(*gfit,of);
+ continue;
+ }
+ // get mapped start and end positions
+ vector< list< uint_fast64_t > > mappedStarts = findMappedPos((*gfit)->getSeqID(), (*gfit)->getStart());
vector< list< uint_fast64_t > > mappedEnds = findMappedPos((*gfit)->getSeqID(), (*gfit)->getEnd());
for(int j = 0; j < genomes.size(); j++){
@@ -369,13 +381,15 @@ void Genome::mapGeneFeatures(vector<Genome> &genomes){
if (other_name == this->name)
continue;
- if(mappedStarts[j].empty() || mappedEnds[j].empty()) // at least one boundary is not mappable to genome j
+ if(mappedStarts[j].empty() || mappedEnds[j].empty()){ // at least one boundary is not mappable to genome j
+ (*gfit)->appendHomolog(NULL,j);
continue;
+ }
/*
* loop over all combinations of mapped start and end positions and
* assemble start position s and an end position e to a seq interval, if they are
* on the same sequence. If s > e
- * - reverse seq interval
+ * - reverse seq interval
* - set strand to the reverse strand of gene feature gf
*/
for(std::list<uint_fast64_t>::iterator msit =mappedStarts[j].begin(); msit != mappedStarts[j].end(); msit++){
@@ -399,18 +413,24 @@ void Genome::mapGeneFeatures(vector<Genome> &genomes){
SeqIntKey seqInt(start,end-start+1, (*gfit)->getFeatureType());
list<GeneFeature*> mapped_features = genomes[j].findSeqInt(seqInt.getKey(), s.getSeqID(), strand);
for(list<GeneFeature*>::iterator mapped_gfit = mapped_features.begin(); mapped_gfit !=mapped_features.end();mapped_gfit++){
- if((*gfit)->isIntron()) // append Introns
+ if((*gfit)->isIntron() || (*gfit)->isExon()) // append Introns and Exons
(*gfit)->appendHomolog(*mapped_gfit,j);
else if((*gfit)->sameFrame((*mapped_gfit)->getFrame()) && ((*gfit)->lenMod3() == (*mapped_gfit)->lenMod3())) // append CDS, if they are in the same frame
- (*gfit)->appendHomolog(*mapped_gfit,j);
+ (*gfit)->appendHomolog(*mapped_gfit,j);
}
}
}
}
}
- mappedStarts = mappedEnds;
+ writeGeneFeature(*gfit, of, unmapped);
+ gfc.createCollection(*gfit);
+ (*gfit)->homologs.clear();
}
+ if(detailed)
+ gfc.printDetailedStats(*git, of);
}
+ mappedPos.clear();
+ of.close();
}
void Genome::insertPos(int seqID, long int pos){
@@ -476,6 +496,22 @@ void Genome::insertSeqInt(GeneFeature* gf){ // insert exons/introns into gfHash
}
}
+void Genome::insertSeqInts(Gene *g){
+
+ for(list<GeneFeature*>::const_iterator it = g->features.begin(); it != g->features.end(); it++){
+ if(!(*it)->isMapped())
+ continue;
+ // add to gfHash
+ insertSeqInt(*it);
+
+ // add exon start/end into mappedPos
+ if(!(*it)->isIntron()){
+ insertPos((*it)->getSeqID(),(*it)->getStart());
+ insertPos((*it)->getSeqID(),(*it)->getEnd());
+ }
+ }
+}
+
void Genome::insertSeqInt(GeneFeature* gf, int seqID){ // insert exons/introns into gfHash
SeqIntKey seqInt(gf->getStart(), gf->getLen(), gf->getFeatureType());
@@ -491,228 +527,181 @@ void Genome::insertSeqInt(GeneFeature* gf, int seqID){ // insert exons/introns i
list<GeneFeature*> l;
l.push_back(gf);
ret.first->second.insert(pair<uint_fast64_t,list<GeneFeature*> >(seqInt.getKey(), l));
- } else { // append exon/intron to existing list
+ } else { // append exon/intron to existing list
it->second.push_back(gf);
}
}
-void Genome::printGFF(string outdir, vector<Genome> &genomes){
- string filename = outdir + name + ".gtf";
- ofstream of;
-
- of.open(filename.c_str());
-
- // print header
- for(int i=0; i < genomes.size(); i++){
- of << "# " << genomes[i].getIdx() << "\t" << genomes[i].getName() << endl;
- }
- of << "###" << endl;
-
- // summary stats (over all genes)
- vector<int> total_mappedStatsG(no_genomes); // number of transcripts with exact homologs in at least k other genomes
- vector<int> total_mappedStatsE(no_genomes); // number of CDS with exact homologs in at least k other genomes
- vector<int> total_mappedStatsI(no_genomes); // number of Intr ...
- vector<int> total_extrinStatsE(no_genomes+1); // number of CDS supported by evidence in at least k other genomes
- vector<int> total_extrinStatsI(no_genomes+1); // number of Intr ...
-
+void GeneInfoCollection::createCollection(GeneFeature *g){
- for(list<Gene*>::iterator git = genes.begin(); git != genes.end(); git++){
- list<GeneFeature*> features = (*git)->getFeatureList();
-
- of << "# start transcript " << (*git)->getTxID() << endl;
-
- writeGene((*git), of);
-
- vector<map<string,GeneInfo> > ginfo(no_genomes);
- pair<map<string,GeneInfo>::iterator, bool> ret;
-
- // stats for a single gene
- vector<int> mappedStatsE(no_genomes); // number of CDS with exact homologs in at least k other genomes
- vector<int> mappedStatsI(no_genomes); // number of Intr ...
- vector<int> extrinStatsE(no_genomes+1); // number of CDS supported by evidence in at least k other genomes
- vector<int> extrinStatsI(no_genomes+1); // number of Intr ...
-
- of << "#\n# gene feature level:\n#" << endl;
- for(list<GeneFeature*>::iterator gfit = features.begin(); gfit != features.end(); gfit++){
-
- printDetailed(*gfit, of);
-
- bool hasEvidence = false;
- bool hasMatch = false;
- int numMatches = 0;
- int numEvidence = 0;
- if((*gfit)->hasEvidence())
- numEvidence++;
-
- list<pair<int,GeneFeature*> >homologs = (*gfit)->getHomologs();
-
- int pred_idx = 0;
+ pair<map<string,GeneInfo>::iterator, bool> ret;
- for(list<pair<int,GeneFeature*> >::iterator hit = homologs.begin(); hit != homologs.end(); hit++){
-
- int idx = hit->first;
- GeneFeature* h = hit->second;
-
- if(pred_idx < idx && hasMatch){ // new genome
- numMatches++;
- hasMatch = false; // reset flags
- }
- if(pred_idx < idx && hasEvidence){
- numEvidence++;
- hasEvidence = false;
- }
-
- if(h->hasEvidence()){
- hasEvidence = true;
- }
- if(h->isPartofGene()){
- hasMatch = true;
- GeneInfo gi(h->getGene(),h->isExon(),h->isIntron(),false);
- ret = ginfo[idx].insert(pair<string,GeneInfo>(h->getTxID(),gi));
- if(!ret.second){ // transid already in map, only update
- if(h->isExon())
- ret.first->second.numMatchingEs++;
- else if(h->isIntron())
- ret.first->second.numMatchingIs++;
- }
- }
- pred_idx = idx;
- }
- if(hasMatch)
- numMatches++;
- if(hasEvidence)
- numEvidence++;
+ bool hasEvidence = false;
+ bool hasMatch = false;
+ int numMatches = 0;
+ int numEvidence = 0;
+ if(g->hasEvidence())
+ numEvidence++;
+
+ list<pair<int,GeneFeature*> >homologs = g->homologs;
+
+ int pred_idx = 0;
- if((*gfit)->isExon()){
- total_mappedStatsE[numMatches]++;
- total_extrinStatsE[numEvidence]++;
- mappedStatsE[numMatches]++;
- extrinStatsE[numEvidence]++;
+ for(list<pair<int,GeneFeature*> >::iterator hit = homologs.begin(); hit != homologs.end(); hit++){
- }
- else{
- total_mappedStatsI[numMatches]++;
- total_extrinStatsI[numEvidence]++;
- mappedStatsI[numMatches]++;
- extrinStatsI[numEvidence]++;
- }
-
+ if(!hit->second)
+ continue;
+
+ int idx = hit->first;
+ GeneFeature* h = hit->second;
+
+ if(pred_idx < idx && hasMatch){ // new genome
+ numMatches++;
+ hasMatch = false; // reset flags
+ }
+ if(pred_idx < idx && hasEvidence){
+ numEvidence++;
+ hasEvidence = false;
}
- of << "#" << endl;
- of << "# number/% of features with exact homologs in at least k other genomes:" << endl;
- of << "#" << endl;
- of << "#---------------------------------------------------------------------------------" << endl;
- of << "# k CDS Intr Both" << endl;
- of << "#---------------------------------------------------------------------------------" << endl;
- of << "#" << endl;
- writePictograph(mappedStatsE,mappedStatsI,of);
- of << "#" << endl;
- of << "# number/% of features supported by extrinsic evidence in at least k genomes :" << endl;
- of << "#" << endl;
- of << "#---------------------------------------------------------------------------------" << endl;
- of << "# k CDS Intr Both" << endl;
- of << "#---------------------------------------------------------------------------------" << endl;
- of << "#" << endl;
- writePictograph(extrinStatsE,extrinStatsI,of);
- of << "#\n# transcript level:\n#" << endl;
- int numHomologs = 0;
-
- for(int i=0; i < ginfo.size(); i++){
-
- bool hasHomolog = false;
- for(map<string,GeneInfo>::iterator giit = ginfo[i].begin(); giit != ginfo[i].end(); giit++){
-
- int numE = 1 + (giit->second.gene->numGFs()/2);
- int numI = (giit->second.gene->numGFs()/2);
-
- of << "#";
- of << setw(4) << right << i << " ";
- of << "gene_id="<< setw(30) << left << giit->second.gene->getGeneID();
- of << "tx_id="<< setw(30) << left << giit->first;
- of << setw(3) << right << giit->second.numMatchingEs;
- of << "/"<< numE << " CDS";
- of <<setw(3) << right << giit->second.numMatchingIs;
- of <<"/"<< numI << " Intr" << endl;
- if(numE == giit->second.numMatchingEs && numI == giit->second.numMatchingIs && (numE+numI) == (*git)->numGFs()){
- hasHomolog = true;
- (*git)->appendHomolog(giit->second.gene,i);
- }
+ if(h->hasEvidence()){
+ hasEvidence = true;
+ }
+ if(h->isPartofGene()){
+ hasMatch = true;
+ GeneInfo gi(h->getGene(),h->isCDS(),h->isIntron(),h->isExon(),false);
+ ret = ginfo[idx].insert(pair<string,GeneInfo>(h->getTxID(),gi));
+ if(!ret.second){ // transid already in map, only update
+ if(h->isCDS())
+ ret.first->second.numMatchingCs++;
+ else if(h->isIntron())
+ ret.first->second.numMatchingIs++;
+ else if(h->isExon())
+ ret.first->second.numMatchingEs++;
}
- if(hasHomolog)
- numHomologs++;
}
- total_mappedStatsG[numHomologs]++;
-
- of << "#" << endl;
- of << "# transcript has an exact homolog in " << numHomologs << " other genomes." <<endl;
+ pred_idx = idx;
+ }
+ if(hasMatch)
+ numMatches++;
+ if(hasEvidence)
+ numEvidence++;
+
+ if(g->isCDS()){
+ mappedStatsC[numMatches]++;
+ extrinStatsC[numEvidence]++;
+
+ }
+ else if(g->isExon()){
+ mappedStatsE[numMatches]++;
+ extrinStatsE[numEvidence]++;
+ }
+ else{
+ mappedStatsI[numMatches]++;
+ extrinStatsI[numEvidence]++;
+ }
+}
- of << "#\n# end transcript " << (*git)->getTxID() << endl;
- of << "###" << endl;
+void GeneInfoCollection::printDetailedStats(Gene *g, std::ofstream &of){
- }
- // print cumulative statistics
- of << "# summary statistic over all genes" << endl;
- of << "#" << endl;
- of << "# gene feature level:" << endl;
+ of << "#\n# gene feature level:\n#" << endl;
of << "#" << endl;
of << "# number/% of features with exact homologs in at least k other genomes:" << endl;
of << "#" << endl;
- of << "#---------------------------------------------------------------------------------" << endl;
- of << "# k CDS Intr Both" << endl;
- of << "#---------------------------------------------------------------------------------" << endl;
+ of << "#---------------------------------------------------------------------------------------------------" << endl;
+ of << "# k CDS Intr Exon Intr+Exon" << endl;
+ of << "#---------------------------------------------------------------------------------------------------" << endl;
of << "#" << endl;
- writePictograph(total_mappedStatsE,total_mappedStatsI,of);
+ writePictograph(mappedStatsC,mappedStatsI,mappedStatsE,of);
of << "#" << endl;
of << "# number/% of features supported by extrinsic evidence in at least k genomes :" << endl;
of << "#" << endl;
- of << "#---------------------------------------------------------------------------------" << endl;
- of << "# k CDS Intr Both" << endl;
- of << "#---------------------------------------------------------------------------------" << endl;
- of << "#" << endl;
- writePictograph(total_extrinStatsE,total_extrinStatsI,of);
+ of << "#---------------------------------------------------------------------------------------------------" << endl;
+ of << "# k CDS Intr Exon Intr+Exon" << endl;
+ of << "#---------------------------------------------------------------------------------------------------" << endl;
of << "#" << endl;
- of << "# transcript level:" << endl;
- of << "#" << endl;
- of << "# number/% of transcripts with exact homologs in at least k other genomes:" << endl;
+ writePictograph(extrinStatsC,extrinStatsI,extrinStatsE,of);
+ of << "#\n# transcript level:\n#" << endl;
+
+ int numHomologs = 0;
+
+ for(int i=0; i < ginfo.size(); i++){
+
+ bool hasHomolog = false;
+ for(map<string,GeneInfo>::iterator giit = ginfo[i].begin(); giit != ginfo[i].end(); giit++){
+
+ int numC = giit->second.gene->numGFs(CDS);
+ int numI = giit->second.gene->numGFs(intron);
+ int numE = giit->second.gene->numGFs(exon);
+
+ of << "#";
+ of << setw(4) << right << i << " ";
+ of << "gene_id="<< setw(30) << left << giit->second.gene->getGeneID();
+ of << "tx_id="<< setw(30) << left << giit->first;
+ of << setw(3) << right << giit->second.numMatchingCs;
+ of << "/"<< numC << " CDS";
+ of <<setw(3) << right << giit->second.numMatchingIs;
+ of <<"/"<< numI << " Intr";
+ of <<setw(3) << right << giit->second.numMatchingEs;
+ of <<"/"<< numE << " exon" << endl;
+ if(numE == giit->second.numMatchingEs && numE == g->numGFs(exon)){
+ hasHomolog = true;
+ //(*git)->appendHomolog(giit->second.gene,i);
+ }
+ if(giit->second.numMatchingEs >=1){ // TODO: make this more reasonable, e.g. half of splice sites coincide
+ g->appendHomolog(giit->second.gene,i);
+ }
+ }
+ if(hasHomolog)
+ numHomologs++;
+ }
of << "#" << endl;
- of << "#-----------------------------------------------" << endl;
- of << "# k tx" << endl;
- of << "#-----------------------------------------------" << endl;
- writePictograph(total_mappedStatsG,of);
- of.close();
+ of << "# transcript has an exact homolog in " << numHomologs << " other genomes.\n#" <<endl;
}
-void Genome::printDetailed(GeneFeature *g, std::ofstream &of) const{
+void Genome::print_hgm_unaligned(GeneFeature *g, std::ofstream &of) const{
- list<pair<int,GeneFeature*> >homologs = g->getHomologs();
+ bool isFirst = true;
+ for(list<pair<int,GeneFeature*> >::iterator hit = g->homologs.begin(); hit != g->homologs.end(); hit++){
+ if(!hit->second){
+ if(isFirst){
+ of << hit->first;
+ isFirst = false;
+ }
+ else{
+ of <<","<< hit->first;
+ }
+ }
+ }
+}
+
+void Genome::print_hgm_info(GeneFeature *g, std::ofstream &of) const{
+
+ list<pair<int,GeneFeature*> >homologs = g->homologs;
int pred_idx = 0;
bool hasMatch = false;
string evidence = "";
int mult = 0;
string onlyHint = "*";
-
- of << "# ";
- if(g->isExon())
- of << "CDS ";
- else
- of << "Intr ";
+ // own evidence
+ of << this->idx;
if(g->hasEvidence())
- of << g->getEvidence() << "-" << g->getMult() <<" (";
- else
- of <<" (";
+ of << g->getEvidence() << "-" << g->getMult();
+
for(list<pair<int,GeneFeature*> >::iterator hit = homologs.begin(); hit != homologs.end(); hit++){
+ if(!hit->second)
+ continue;
+
int idx = hit->first;
GeneFeature* h = hit->second;
if(pred_idx < idx && hasMatch){ // next genome
- of << pred_idx;
+ of <<","<< pred_idx;
if(!evidence.empty())
of << evidence << onlyHint << "-" << mult;
- of << " ";
hasMatch = false; // reset all flags
evidence = "";
mult = 0;
@@ -729,72 +718,28 @@ void Genome::printDetailed(GeneFeature *g, std::ofstream &of) const{
pred_idx = idx;
}
if(hasMatch){
- of << pred_idx;
+ of <<","<< pred_idx;
if(!evidence.empty())
of << evidence << onlyHint << "-" << mult;
- of << " ";
}
- of << ")" << endl;
-
}
-void Genome::writeGene(Gene *g, std::ofstream &of) const{
+void Genome::writeTxLine(Gene *g, std::ofstream &of) const {
- // gene line
- /*of << getSeqName(g->getSeqID()) << "\t";
- of << g->getSource() << "\tgene\t";
- of << g->getStart() << "\t";
- of << g->getEnd() << "\t.\t";
- of << strandIdentifiers[g->getStrand()] << "\t.\t";
- of << g->getGeneID() << endl;
- */
- // transcript line
of << getSeqName(g->getSeqID()) << "\t";
of << g->getSource() << "\ttranscript\t";
- of << g->getStart() << "\t";
- of << g->getEnd() << "\t.\t";
+ of << g->getTXstart() << "\t";
+ of << g->getTXend() << "\t.\t";
of << strandIdentifiers[g->getStrand()] << "\t.\t";
of << g->getTxID() << endl;
-
- if(g->getStrand() == plusstrand)
- writeTLStart(g, of);
- else
- writeTLEnd(g,of);
+}
- // print exons and introns
- list<GeneFeature*> features = g->getFeatureList();
- for(list<GeneFeature*>::iterator gfit = features.begin(); gfit != features.end(); gfit++){
+void Genome::writeGene(Gene *g, std::ofstream &of) const{
+ // print gene features
+ for(list<GeneFeature*>::iterator gfit = g->features.begin(); gfit != g->features.end(); gfit++)
writeGeneFeature(*gfit, of);
- }
- if(g->getStrand() == plusstrand)
- writeTLEnd(g, of);
- else
- writeTLStart(g,of);
}
-void Genome::writeTLStart(Gene *g, std::ofstream &of) const{
- if(g->getTLstart() >= 0){
- of << getSeqName(g->getSeqID()) << "\t";
- of << g->getSource() << "\tstart_codon\t";
- of << g->getTLstart() << "\t";
- of << g->getTLstart()+2 << "\t.\t";
- of << strandIdentifiers[g->getStrand()] << "\t.\t";
- of << "transcript_id \"" << g->getTxID() << "\"; ";
- of << "gene_id \"" << g->getGeneID() << "\";" << endl;
- }
-
-}
-void Genome::writeTLEnd(Gene *g, std::ofstream &of) const{
- if( g->getTLend() >= 0){
- of << getSeqName(g->getSeqID()) << "\t";
- of << g->getSource() << "\tstop_codon\t";
- of << g->getTLend()-2 << "\t";
- of << g->getTLend() << "\t.\t";
- of << strandIdentifiers[g->getStrand()] << "\t.\t";
- of << "transcript_id \"" << g->getTxID() << "\"; ";
- of << "gene_id \"" << g->getGeneID() << "\";" << endl;
- }
-}
#ifdef BOOST
void printHomGeneList(string outfile, vector<Genome> &genomes){
@@ -816,7 +761,7 @@ void printHomGeneList(string outfile, vector<Genome> &genomes){
for(int i = 0; i < genomes.size(); i++){
for(list<Gene*>::iterator git = genomes[i].genes.begin(); git != genomes[i].genes.end(); git++){
- list<pair<int,Gene*> >homologs = (*git)->getHomologs();
+ list<pair<int,Gene*> >homologs = (*git)->homologs;
string u_name = itoa(i) + "," + (*git)->getTxID();
txit = txs.insert(make_pair(u_name, txs.size()));
@@ -853,3 +798,69 @@ void printHomGeneList(string outfile, vector<Genome> &genomes){
}
}
#endif
+
+void Genome::insertHint(string seqname, long int start, long int end, Strand strand, string esource, int mult, int frame, string f_type){
+
+ // insert new sequences both into the seqname AND seqID Hash
+ pair<map<string,int>::iterator,bool> seqid;
+ seqid = seqnames.insert(make_pair(seqname, seqnames.size()));
+ if(seqid.second)
+ seqIDs.insert(make_pair(seqid.first->second, seqid.first->first));
+
+ FeatureType type = getType(f_type);
+ if(type == intron){
+ start--;
+ end++;
+ }
+
+ SeqIntKey seqInt(start, end-start+1, type);
+ list<GeneFeature*> le = findSeqInt(seqInt.getKey(), seqid.first->second, strand);
+ bool isGF = false;
+ for(list<GeneFeature*>::iterator it=le.begin(); it!=le.end(); it++){
+ if((*it)->sameFrame(frame)){
+ (*it)->setEvidence(esource); // update extrinsic source
+ (*it)->setMult(mult);
+ isGF = true;
+ }
+ }
+ if(!isGF){ // add new gene feature
+ GeneFeature *gf = new GeneFeature(type, start, end, strand, frame);
+ gf->setEvidence(esource);
+ gf->setMult(mult);
+ insertSeqInt(gf, seqid.first->second);
+ hints.push_back(gf);
+ }
+}
+
+
+#ifdef SQLITE
+void Genome::getDbHints(SQLiteDB &db){
+
+ try{
+ Statement stmt(&db);
+
+ stmt.prepare("SELECT seqname,start,end,typename,strand,frame,mult,esource FROM featuretypes JOIN \
+ (SELECT seqname,start,end,type,strand,frame,mult,esource FROM hints NATURAL JOIN \
+ (SELECT * FROM speciesnames NATURAL JOIN seqnames WHERE speciesname=$1)) ON typeid=type WHERE typename=\"CDS\" OR typename=\"exon\" OR typename=\"intron\";");
+
+ stmt.bindText(1,name.c_str());
+
+ while(stmt.nextResult()){
+ // create new Feature
+ string seqname = stmt.textColumn(0);
+ long int start=stmt.intColumn(1)+1; // make coordinates 1-based (DB coordinates are 0-based)
+ long int end=stmt.intColumn(2)+1;
+ Strand strand = getStrand(stmt.textColumn(4));
+ string esource = stmt.textColumn(7);
+ int mult = stmt.intColumn(6);
+ string type = stmt.textColumn(3);
+ int frame = stmt.intColumn(5);
+ insertHint(seqname,start,end,strand,esource,mult,frame,type);
+ }
+ }catch(const char* err) {
+ cerr << err << endl;
+ throw ProjectError("failed retrieving hints from DB for " + name + "." + "\n");
+ }
+}
+#endif
+
diff --git a/auxprogs/homGeneMapping/src/main.cc b/auxprogs/homGeneMapping/src/main.cc
index beac255..f50f753 100644
--- a/auxprogs/homGeneMapping/src/main.cc
+++ b/auxprogs/homGeneMapping/src/main.cc
@@ -25,6 +25,7 @@ using namespace std;
void printUsage();
+void syncThreads(vector<thread> &th);
map<string, pair<string,string> > getFileNames(string listfile);
/*
@@ -43,6 +44,9 @@ int main( int argc, char* argv[] ){
string halLiftover_exec = "";
string homGeneFile = "";
size_t maxCpus=1;
+ string dbfile;
+ bool print_details = false;
+ bool print_unaligned = false;
static struct option long_options[] = {
{"gtfs", 1, 0,'g'},
@@ -53,12 +57,15 @@ int main( int argc, char* argv[] ){
{"halLiftover_exec_dir",1, 0, 'e'},
{"cpus",1, 0, 'n'},
{"noDupes",0,0,'d'},
+ {"details",0,0,'i'},
+ {"unmapped",0,0,'u'},
{"printHomologs",1,0,'m'},
+ {"dbaccess", 1, 0, 'c'},
{"help",0,0,'h'},
{0,0,0,0}
};
int option_index = 0;
- while ((c = getopt_long(argc, argv, "g:s:a:t:o:e:n:dm:h", long_options, &option_index)) != -1) {
+ while ((c = getopt_long(argc, argv, "g:s:a:t:o:e:n:dium:c:h", long_options, &option_index)) != -1) {
switch(c)
{
case 'g':
@@ -85,8 +92,17 @@ int main( int argc, char* argv[] ){
case 'd':
halParam+="--noDupes ";
break;
+ case 'i':
+ print_details=true;
+ break;
+ case 'u':
+ print_unaligned=true;
+ break;
case 'm':
homGeneFile = optarg;
+ break;
+ case 'c':
+ dbfile = optarg;
break;
case 'h':
help=1;
@@ -122,13 +138,21 @@ int main( int argc, char* argv[] ){
printUsage();
exit(1);
}
-
+ if (!dbfile.empty()){
+#ifndef SQLITE
+ throw ProjectError("The option --dbaccess requires the SQLite library.\n"
+ "Please install the SQLite library, e.g. using the APT package manager\n\n"
+ "sudo apt-get install libsqlite3-dev\n\n"
+ "Then edit the Makefile by setting the flag SQLITE = true and recompile homGeneMapping.\n");
+#endif
+ }
if(maxCpus < 1){
maxCpus = 1;
cerr << "number of cpus must be at least 1. Proceeding with --cpus=1" << endl;
}
// check if the boost library is installed (only required for option --printHomologs)
if(!homGeneFile.empty()){
+ print_details = true;
#ifndef BOOST
throw ProjectError("The option --printHomologs requires the boost C++ library.\n"
"Please install the boost library, e.g. using the APT package manager\n\n"
@@ -151,18 +175,27 @@ int main( int argc, char* argv[] ){
*/
map<string, pair<string, string> > filenames = getFileNames (gtfs);
Genome::setNumGenomes(filenames.size());
-
+
vector<Genome> genomes;
+ vector<thread> th;
+
+ // initialize genomes
for(map<string, pair<string, string> >::iterator it = filenames.begin(); it != filenames.end(); it++){
Genome genome(it->first, genomes.size());
- genome.parseGTF(it->second.first);
- if(!it->second.second.empty()) // read hints file if specified
- genome.parseExtrinsicGFF(it->second.second);
genome.setTmpDir(tmpdir);
- genome.printBed(); // print sequence coordinates, that need to be mapped to the other genomes, to file
genomes.push_back(genome);
}
-
+ // parse input files
+ for(int g = 0; g < genomes.size(); g++){
+ if(th.size() == maxCpus) // wait for all running threads to finish
+ syncThreads(th);
+ map<string, pair<string, string> >::iterator it = filenames.find(genomes[g].getName());
+ if (it != filenames.end())
+ th.push_back(thread(&Genome::parse, &genomes[g], it->second.first,it->second.second, dbfile));
+ }
+ // synchronize threads
+ syncThreads(th);
+
/*
* haLiftover from each genome to each other genome (quadratic to the number of genomes)
* TODO:
@@ -171,27 +204,19 @@ int main( int argc, char* argv[] ){
*/
cout << "halLiftover starts. Processing" << endl;
if(maxCpus > 1){ // in parallel
- vector<thread> th;
for(int i = 0; i < genomes.size(); i++){
cout << genomes[i].getName() << endl;
for(int j = 0; j < genomes.size(); j++){
if(i != j){
- if(th.size() == maxCpus){ // wait for all running threads to finish
- // synchronize threads
- for(int i = 0; i < th.size(); i++){
- th[i].join();
- }
- th.clear();
- }
+ if(th.size() == maxCpus) // wait for all running threads to finish
+ syncThreads(th);
// halLiftover
th.push_back(thread(&Genome::liftOverTo, &genomes[i], ref(genomes[j]), halfile, halLiftover_exec, halParam));
}
}
}
// synchronize threads
- for(int i = 0; i < th.size(); i++){
- th[i].join();
- }
+ syncThreads(th);
}
else{ // sequentially
for(int i = 0; i < genomes.size(); i++){
@@ -205,16 +230,13 @@ int main( int argc, char* argv[] ){
}
}
for(int i = 0; i < genomes.size(); i++){
- for(int j = 0; j < genomes.size(); j++){
- if(i != j){
- genomes[i].readBed(genomes[j]); // reading in bed files with mapped coordinates
- }
- }
- // identify homologous gene features (exons/introns)
- genomes[i].mapGeneFeatures(genomes);
- // print extended gene files with homology information
- genomes[i].printGFF(outdir,genomes);
+ if(th.size() == maxCpus) // wait for all running threads to finish
+ syncThreads(th);
+ th.push_back(thread(&Genome::write_hgm_gff, &genomes[i], ref(genomes), outdir, print_details, print_unaligned));
}
+ // synchronize threads
+ syncThreads(th);
+
// print a list with homologous transcript IDs, e.g.
// # 0 dana
// # 1 dere
@@ -265,8 +287,11 @@ OPTIONS:\n\
--help print this usage info\n\
--cpus=N N is the number of CPUs to use (default: 1)\n\
--noDupes do not map between duplications in hal graph. (default: off)\n\
+--details print detailed output (default: off)\n\
--halLiftover_exec_dir=DIR Directory that contains the executable halLiftover\n\
If not specified it must be in $PATH environment variable.\n\
+--unmapped print a GTF attribute with a list of all genomes, that are not aligned to the\n\
+ corresponding gene feature, e.g. hgm_unmapped \"1,4,5\"; (default; off)\n\
--tmpdir=DIR a temporary file directory that stores lifted over files. (default 'tmp/' in current directory)\n\
--outdir=DIR file direcory that stores output gene files. (default: current directory)\n\
--printHomologs=FILE prints disjunct sets of homologous transcripts to FILE, e.g.\n\
@@ -282,6 +307,11 @@ OPTIONS:\n\
Two transcripts are in the same set, if all their exons/introns are homologs and their are\n\
no additional exons/introns.\n\
This option requires the Boost C++ Library\n\
+--dbaccess=db retrieve hints from an SQLite database. In order to set up a database and populate it with hints\n\
+ a separate tool 'load2sqlitedb' is provided. For more information, see the documentation in\n\
+ README-cgp.txt (section 8a+b) in the Augustus package. If both a database and hint files in 'gtffilenames.tbl'\n\
+ are specified, hints are retrieved from both sources.\n\
+ This option requires the SQLite3 library\n\
\n\
example:\n\
homGeneMapping --noDupes --halLiftover_exec_dir=~/tools/progressiveCactus/submodules/hal/bin --gtfs=gtffilenames.tbl --halfile=msca.hal\n\
@@ -324,3 +354,11 @@ map<string,pair<string,string> > getFileNames (string listfile){
throw ProjectError("Could not open input file " + listfile + ".\n");
return filenames;
}
+
+
+// synchronize threads
+void syncThreads(vector<thread> &th){
+ for(int i = 0; i < th.size(); i++)
+ th[i].join();
+ th.clear();
+}
diff --git a/auxprogs/homGeneMapping/src/sqliteDB.cc b/auxprogs/homGeneMapping/src/sqliteDB.cc
new file mode 100644
index 0000000..8ffebb7
--- /dev/null
+++ b/auxprogs/homGeneMapping/src/sqliteDB.cc
@@ -0,0 +1,115 @@
+/**********************************************************************
+ * file: sqliteDB.cc
+ * licence: Artistic Licence, see file LICENCE.TXT or
+ * http://www.opensource.org/licenses/artistic-license.php
+ * descr.: wrapper class around the SQLite interface
+ * authors: Stefanie Koenig
+ *
+ * date | author | changes
+ * --------|---------------|------------------------------------------
+ * 25.06.14|Stefanie Koenig| creation of the file
+ **********************************************************************/
+
+
+#include "sqliteDB.hh"
+
+#include <iostream>
+#include <stdlib.h>
+#include <string.h>
+
+void SQLiteDB::open(OpenMode mode){
+
+ int flag = SQLITE_OPEN_READONLY | SQLITE_OPEN_NOMUTEX;
+ if(mode == rw)
+ flag = SQLITE_OPEN_READWRITE | SQLITE_OPEN_NOMUTEX;
+ else if(mode == crw)
+ flag = SQLITE_OPEN_READWRITE | SQLITE_OPEN_CREATE | SQLITE_OPEN_NOMUTEX;
+
+ if(sqlite3_open_v2(dbfile, &database, flag, NULL) != SQLITE_OK){
+ cerr << "Could not open database "<< dbfile << endl;
+ cerr << error() << endl;
+ exit(1);
+ }
+}
+
+void SQLiteDB::exec(const char *sql){
+
+ Statement statement(this);
+ statement.prepare(sql);
+ statement.step();
+}
+
+void SQLiteDB::beginTransaction(){
+ exec("BEGIN TRANSACTION");
+}
+
+void SQLiteDB::endTransaction(){
+ exec("END TRANSACTION");
+}
+
+void SQLiteDB::close(){
+ sqlite3_close(database);
+}
+
+bool SQLiteDB::tableExists(string table_name){
+
+ Statement stmt(this);
+ stmt.prepare("SELECT count(*) FROM sqlite_master WHERE type='table' AND name=?1;");
+ stmt.bindText(1,table_name.c_str());
+ if(stmt.nextResult()){
+ if (stmt.boolColumn(0)){
+ return true;
+ }
+ }
+ return false;
+}
+
+
+void Statement::prepare(const char *sql){
+
+ if (sqlite3_prepare_v2(database, sql, -1, &stmt, 0) != SQLITE_OK){
+ throw error();
+ }
+}
+
+void Statement::step(){
+
+ if (sqlite3_step(stmt) != SQLITE_DONE){
+ throw error();
+ }
+}
+
+void Statement::bindInt(int idx, int x){
+
+ if(sqlite3_bind_int(stmt, idx, x) != SQLITE_OK){
+ throw error();
+ }
+}
+
+void Statement::bindInt64(int idx, uint64_t x){
+
+ if(sqlite3_bind_int64(stmt, idx, x) != SQLITE_OK){
+ throw error();
+ }
+}
+
+void Statement::bindDouble(int idx, double d){
+
+ if(sqlite3_bind_double(stmt, idx, d) != SQLITE_OK){
+ throw error();
+ }
+}
+
+void Statement::bindText(int idx, const char* text){
+
+ if(sqlite3_bind_text(stmt, idx, text, strlen(text), NULL) != SQLITE_OK){
+ throw error();
+ }
+}
+
+bool Statement::nextResult(){
+ int msg = sqlite3_step(stmt);
+ if( msg != SQLITE_DONE && msg != SQLITE_ROW )
+ throw error();
+ return (msg == SQLITE_ROW);
+}
diff --git a/auxprogs/joingenes/jg_ios.cpp b/auxprogs/joingenes/jg_ios.cpp
index de1289c..8fb0710 100644
--- a/auxprogs/joingenes/jg_ios.cpp
+++ b/auxprogs/joingenes/jg_ios.cpp
@@ -3,444 +3,474 @@
using namespace std;
-void load_error(string const &error)
+void loadError(string const &error)
{
- cerr << "Load error: " << error << endl;
- cerr << "The file is not in a correct gff or gtf format." << endl;
- exit( EXIT_FAILURE );
+ cerr << "Load error: " << error << endl;
+ cerr << "The file is not in a correct gff or gtf format." << endl;
+ exit( EXIT_FAILURE );
}
void load_warning(string const &warning)
{
- cerr << "Load warning: " << warning << endl;
- cerr << "This warning may affect the result." << endl;
+ cerr << "Load warning: " << warning << endl;
+ cerr << "This warning may affect the result." << endl;
+}
+
+map<string,int> getFileNames (string fofn){
+ map<string,int> filenames;
+ ifstream ifstrm(fofn.c_str());
+ if (ifstrm.is_open()){
+ char buf[256];
+ while(ifstrm.getline(buf,255)){
+ stringstream stm(buf);
+ string genefile;
+ int priority;
+ if(stm >> genefile){
+ if (stm >> priority)
+ filenames[genefile] = priority;
+ else
+ filenames[genefile] = 1;
+ }
+ else
+ loadError(fofn + " has wrong format in line\n" + buf + "\nCorrect format:\n\n"
+ "path/to/gtf/of/genome_1 priority_of_genome_1\n"
+ "path/to/gtf/of/genome_2 priority_of_genome_2\n...\n"
+ "path/to/gtf/of/genome_N priority_of_genome_N\n\n"
+ "the last column is optional.\n");
+ }
+ ifstrm.close();
+ }
+ else
+ loadError("Could not open input file " + fofn + ".\n");
+ return filenames;
}
void load(unordered_map<string,Gene*> &geneMap, string &filename, int &priority, unordered_map<string,bool> &taxaMap, Properties &properties)
{
- // loads gtf file in a special data structure
- // mainly there is a list where all transcripts are saved; later this programm work on pointers to this list elements
- // every transcript gets a pointer to his gene in the gene hash map and backwards
- // this function will not distinguish between first column notation "chr1" and "1" or another
- // this function doesnt tests whether there are transcripts with equal name; transcripts with equal name in a row will be read as one transcript; a divided transcript may be read as different transcripts
- // if their is a notation for prediction ranges BEFORE a transcript in the form "#Xprediction on sequence rangeX:NYNYZ" it will save this for the transcript where "X" can be every char exept ":", "Y" have to be a char out of " ", "-", "(", ")", "b", "p", and "Z" can be every char and the number of X,Y and Z is arbitrary at every position and "N" are the prediction range integers with the lower one first
- ifstream infile(filename.c_str());
-
- if(!infile){load_error("Die Datei "+filename+" exisitiert nicht");}
- char buff[1024];
- char copybuff[1024];
- char *temp;
- char *temp_inside;
- pair<int,int> pred_range;
- unordered_map<string,Transcript*> thisFileTranscriptMap;
- unordered_map<string,Gene*> thisFileGeneMap;
-
- unordered_map<string,bool> taxaMapTemp;
- infile.getline(buff, 1024);
- list<string> unknownFeatures;
- while (infile){
- string lineStr = buff;
- // if line dont starts with '#'
- if (buff[0]!='#'){
- //if ((strstr(buff, "gene_id")!=NULL) && (strstr(buff, "transcript_id")!=NULL)){
- Exon exon;
- Transcript* transcript = new Transcript;
- transcript->inputFile = filename;
- (*transcript).priority = priority;
- strncpy(copybuff, buff, 1014);
- if (strstr(buff, "\t")==NULL) {
- load_error("Line not tab separated in file "+filename+":\nProblemLine: "+lineStr);
- }
- temp = strtok(buff, "\t");
- if (temp){
- exon.chr = temp;
- }else
- load_error("Can not read sequence name in file "+filename+":\nProblemLine: "+lineStr);
- temp = strtok(NULL, "\t");
- if (temp)
- (*transcript).source = temp;
- else
- load_error("Can not read second column in file "+filename+":\nProblemLine: "+lineStr);
- temp = strtok(NULL, "\t");
- if (temp)
- exon.feature = temp;
- else
- load_error("Can not read feature in file "+filename+":\nProblemLine: "+lineStr);
- if (exon.feature != "CDS" && exon.feature != "start_codon" && exon.feature != "stop_codon" && exon.feature != "exon" && exon.feature != "UTR" && exon.feature != "3'-UTR" && exon.feature != "5'-UTR" && exon.feature != "tss" && exon.feature != "tts" && exon.feature != "intron"){
- if (exon.feature != "gene" && exon.feature != "transcript"){
- list<string>::iterator fit = find(unknownFeatures.begin(),unknownFeatures.end(),exon.feature);
- if (fit == unknownFeatures.end()){
- unknownFeatures.push_back(exon.feature);
- }
- }
- infile.getline(buff, 1024);
- continue;
- }
- temp = strtok(NULL, "\t");
- if (temp)
- exon.from = atoi(temp);
- else
- load_error("Can not read start position in file "+filename+":\nProblemLine: "+lineStr);
- temp = strtok(NULL, "\t");
- if (temp)
- exon.to = atoi(temp);
- else
- load_error("Can not read end position in file "+filename+":\nProblemLine: "+lineStr);
- temp = strtok(NULL, "\t");
- if (temp)
- exon.score = atof(temp);
- else
- load_error("Can not read score in file "+filename+":\nProblemLine: "+lineStr);
- temp = strtok(NULL, "\t");
- if (!temp)
- load_error("Can not read strand in file "+filename+":\nProblemLine: "+lineStr);
- if (strcmp(temp, "+") == 0)
- (*transcript).strand = '+';
- else if (strcmp(temp, "-") == 0)
- (*transcript).strand = '-';
- else {
- (*transcript).strand = '.';
- load_error("The strand of this transcript is unknown in file "+filename+":\nProblemLine: "+lineStr);
- }
- temp = strtok(NULL, "\t");
- if (!temp)
- load_error("Can not read frame.");
- if (strcmp(temp, "0") == 0)
- exon.frame = 0;
- else if (strcmp(temp, "1") == 0)
- exon.frame = 1;
- else if (strcmp(temp, "2") == 0)
- exon.frame = 2;
- else
- exon.frame = -1;
- temp = strtok(NULL, "\t");
- if (temp){
- char attribute[300];
- strncpy(attribute, temp, 300);
- string gene_id;
- string transcript_id;
- temp_inside = strtok(attribute, "\"");
- Gene* gene = new Gene;
-
- // get the gene_id and transcript_id of the gtf format... If there is non, create a new one.
- while (/*temp_inside && */(gene_id.empty() || transcript_id.empty())){
- if (((strstr(temp, "gene_id")==NULL) && (strstr(temp, "transcript_id")==NULL)) || !temp_inside){
- gene_id = nextFreeGeneID(properties, &thisFileGeneMap);
- (*gene).g_id = gene_id;
- transcript_id = nextFreeTxID(gene, properties, &thisFileTranscriptMap);
- transcript->originalId = "none";
- }
- if (strstr(temp_inside, "transcript_id")!=NULL){
- temp_inside = strtok(NULL, "\"");
- if (temp_inside){
- transcript_id = temp_inside;
- transcript->originalId = temp_inside;
- }else{
- load_error("Missing id behind the flag transcript_id in file "+filename+":\nProblemLine: "+lineStr);
- }
- }
- if (strstr(temp_inside, "gene_id")!=NULL){
- temp_inside = strtok(NULL, "\"");
- if (temp_inside){
- gene_id = temp_inside;
- }else{
- load_error("Missing id behind the flag gene_id in file "+filename+" at "+exon.chr+" from "+to_string((long long int) exon.from)+" to "+to_string((long long int) exon.to)+".");
- }
- }
- temp_inside = strtok(NULL, "\"");
- }
-
- if (thisFileTranscriptMap.find(transcript_id) == thisFileTranscriptMap.end()){
- (*transcript).t_id = transcript_id;
- thisFileTranscriptMap[transcript_id] = transcript;
- }else if ((*transcript).strand != thisFileTranscriptMap[transcript_id]->strand){
- load_warning("Transcript "+thisFileTranscriptMap[transcript_id]->t_id+" on different strands.");
- }
-
-
-
-
- if (pred_range.first && pred_range.second){
- exon.predRange = pred_range;
- }
-
-
- if (exon.feature == "start_codon"){
- if (thisFileTranscriptMap[transcript_id]->tl_complete.first)
- thisFileTranscriptMap[transcript_id]->separated_codon.first = true;
- if (thisFileTranscriptMap[transcript_id]->strand == '+'){
- if (!thisFileTranscriptMap[transcript_id]->tl_complete.first || (thisFileTranscriptMap[transcript_id]->tl_complete.first && thisFileTranscriptMap[transcript_id]->tis > exon.from))
- thisFileTranscriptMap[transcript_id]->tis = exon.from;
- }
- if (thisFileTranscriptMap[transcript_id]->strand == '-'){
- if (!thisFileTranscriptMap[transcript_id]->tl_complete.first || (thisFileTranscriptMap[transcript_id]->tl_complete.first && thisFileTranscriptMap[transcript_id]->tis < exon.to))
- thisFileTranscriptMap[transcript_id]->tis = exon.to;
- }
- thisFileTranscriptMap[transcript_id]->tl_complete.first = true;
- }else if (exon.feature == "stop_codon"){
- if (thisFileTranscriptMap[transcript_id]->tl_complete.second){
- thisFileTranscriptMap[transcript_id]->separated_codon.second = true;}
- if (thisFileTranscriptMap[transcript_id]->strand == '+'){
- if (!thisFileTranscriptMap[transcript_id]->tl_complete.second || (thisFileTranscriptMap[transcript_id]->tl_complete.second && thisFileTranscriptMap[transcript_id]->tes < exon.to)){
- //thisFileTranscriptMap[transcript_id]->tes = exon.to;
- }
- }
- if (thisFileTranscriptMap[transcript_id]->strand == '-'){
- if (!thisFileTranscriptMap[transcript_id]->tl_complete.second || (thisFileTranscriptMap[transcript_id]->tl_complete.second && thisFileTranscriptMap[transcript_id]->tes > exon.from)){
- //thisFileTranscriptMap[transcript_id]->tes = exon.from;
- }
- }
- thisFileTranscriptMap[transcript_id]->tl_complete.second = true;
- thisFileTranscriptMap[transcript_id]->stop_list.push_back(exon); // TESTLARS
- }else if (exon.feature == "tss"){
- if (exon.from != exon.to){load_error("\"tss\" can only take place on one position.");}
- thisFileTranscriptMap[transcript_id]->tss = exon.from;
- thisFileTranscriptMap[transcript_id]->tx_complete.first = true;
- }else if (exon.feature == "tts"){
- if (exon.from != exon.to){load_error("\"tts\" can only take place on one position.");}
- thisFileTranscriptMap[transcript_id]->tts = exon.to;
- thisFileTranscriptMap[transcript_id]->tx_complete.second = true;
- }else if (exon.feature == "intron"){
- thisFileTranscriptMap[transcript_id]->intron_list.push_front(exon);
- }else{
- thisFileTranscriptMap[transcript_id]->exon_list.push_front(exon);
- }
- if (pred_range.first && pred_range.second){
- thisFileTranscriptMap[transcript_id]->pred_range = pred_range;
- }
-
- (*gene).g_id = gene_id;
- if (thisFileGeneMap.count(gene_id) == 0){
- thisFileGeneMap[gene_id] = gene;
- }
-
- thisFileTranscriptMap[transcript_id]->parent = thisFileGeneMap[gene_id];
- }else
- load_error("Can not read last column.");
- //}else{} // cerr << "A line without gene_id and/or transcript_id." << endl;
- }else { // if line starts with '#'
- strncpy(copybuff, buff, 1014);
- if (strstr(buff, "sequence range")!=NULL) {
- int cnt=count(lineStr.begin(),lineStr.end(),':');
- temp = strtok(buff, ":");
- for (int i=1; i<cnt; i++){ temp = strtok(NULL, ":"); }
- temp = strtok(NULL, ":- ()bp");
- pred_range.first = atoi(temp);
- temp = strtok(NULL, ":- ()bp");
- pred_range.second = atoi(temp);
- if ((pred_range.second - pred_range.first) <= 0){
- load_warning("There is a non positiv prediction range in file "+filename+":\nProblemLine: "+lineStr);
- }
- } // at this position other optional options could be read from gff-#-lines with else if
+ // loads gtf file in a special data structure
+ // mainly there is a list where all transcripts are saved; later this programm work on pointers to this list elements
+ // every transcript gets a pointer to his gene in the gene hash map and backwards
+ // this function will not distinguish between first column notation "chr1" and "1" or another
+ // this function doesnt tests whether there are transcripts with equal name; transcripts with equal name in a row will be read as one transcript; a divided transcript may be read as different transcripts
+ // if their is a notation for prediction ranges BEFORE a transcript in the form "#Xprediction on sequence rangeX:NYNYZ" it will save this for the transcript where "X" can be every char exept ":", "Y" have to be a char out of " ", "-", "(", ")", "b", "p", and "Z" can be every char and the number of X,Y and Z is arbitrary at every position and "N" are the prediction range integers with the lower one first
+ ifstream infile(filename.c_str());
+
+ if(!infile){loadError("Could not open file "+filename+".\n");}
+ char buff[1024];
+ char copybuff[1024];
+ char *temp;
+ char *temp_inside;
+ pair<int,int> pred_range;
+ unordered_map<string,Transcript*> thisFileTranscriptMap;
+ unordered_map<string,Gene*> thisFileGeneMap;
+
+ unordered_map<string,bool> taxaMapTemp;
+ infile.getline(buff, 1024);
+ list<string> unknownFeatures;
+ while (infile){
+ string lineStr = buff;
+ // if line dont starts with '#'
+ if (buff[0]!='#'){
+ //if ((strstr(buff, "gene_id")!=NULL) && (strstr(buff, "transcript_id")!=NULL)){
+ Exon exon;
+ Transcript* transcript = new Transcript;
+ transcript->inputFile = filename;
+ (*transcript).priority = priority;
+ strncpy(copybuff, buff, 1014);
+ if (strstr(buff, "\t")==NULL) {
+ loadError("Line not tab separated in file "+filename+":\nProblemLine: "+lineStr);
+ }
+ temp = strtok(buff, "\t");
+ if (temp){
+ exon.chr = temp;
+ }else
+ loadError("Can not read sequence name in file "+filename+":\nProblemLine: "+lineStr);
+ temp = strtok(NULL, "\t");
+ if (temp)
+ (*transcript).source = temp;
+ else
+ loadError("Can not read second column in file "+filename+":\nProblemLine: "+lineStr);
+ temp = strtok(NULL, "\t");
+ if (temp)
+ exon.feature = temp;
+ else
+ loadError("Can not read feature in file "+filename+":\nProblemLine: "+lineStr);
+ if (exon.feature != "CDS" && exon.feature != "start_codon" && exon.feature != "stop_codon" && exon.feature != "exon" && exon.feature != "UTR" && exon.feature != "3'-UTR" && exon.feature != "5'-UTR" && exon.feature != "tss" && exon.feature != "tts" && exon.feature != "intron"){
+ if (exon.feature != "gene" && exon.feature != "transcript"){
+ list<string>::iterator fit = find(unknownFeatures.begin(),unknownFeatures.end(),exon.feature);
+ if (fit == unknownFeatures.end()){
+ unknownFeatures.push_back(exon.feature);
+ }
}
infile.getline(buff, 1024);
- }
- for(auto pointer = thisFileGeneMap.begin(); pointer != thisFileGeneMap.end(); pointer++)
- {
- if ((*properties.geneMap).find( pointer->second->g_id ) != (*properties.geneMap).end()){
- pointer->second->g_id = nextFreeGeneID(properties, &thisFileGeneMap);
- (*properties.geneMap)[pointer->second->g_id] = (*pointer).second;
- // maybe fill thisFileGeneMap with new gene, but is not necessary
+ continue;
+ }
+ temp = strtok(NULL, "\t");
+ if (temp)
+ exon.from = atoi(temp);
+ else
+ loadError("Can not read start position in file "+filename+":\nProblemLine: "+lineStr);
+ temp = strtok(NULL, "\t");
+ if (temp)
+ exon.to = atoi(temp);
+ else
+ loadError("Can not read end position in file "+filename+":\nProblemLine: "+lineStr);
+ temp = strtok(NULL, "\t");
+ if (temp)
+ exon.score = atof(temp);
+ else
+ loadError("Can not read score in file "+filename+":\nProblemLine: "+lineStr);
+ temp = strtok(NULL, "\t");
+ if (!temp)
+ loadError("Can not read strand in file "+filename+":\nProblemLine: "+lineStr);
+ if (strcmp(temp, "+") == 0)
+ (*transcript).strand = '+';
+ else if (strcmp(temp, "-") == 0)
+ (*transcript).strand = '-';
+ else {
+ (*transcript).strand = '.';
+ loadError("The strand of this transcript is unknown in file "+filename+":\nProblemLine: "+lineStr);
+ }
+ temp = strtok(NULL, "\t");
+ if (!temp)
+ loadError("Can not read frame.");
+ if (strcmp(temp, "0") == 0)
+ exon.frame = 0;
+ else if (strcmp(temp, "1") == 0)
+ exon.frame = 1;
+ else if (strcmp(temp, "2") == 0)
+ exon.frame = 2;
+ else
+ exon.frame = -1;
+ temp = strtok(NULL, "\t");
+ if (temp){
+ char attribute[300];
+ strncpy(attribute, temp, 300);
+ string gene_id;
+ string transcript_id;
+ temp_inside = strtok(attribute, "\"");
+ Gene* gene = new Gene;
+
+ // get the gene_id and transcript_id of the gtf format... If there is non, create a new one.
+ while (/*temp_inside && */(gene_id.empty() || transcript_id.empty())){
+ if (((strstr(temp, "gene_id")==NULL) && (strstr(temp, "transcript_id")==NULL)) || !temp_inside){
+ gene_id = nextFreeGeneID(properties, &thisFileGeneMap);
+ (*gene).g_id = gene_id;
+ transcript_id = nextFreeTxID(gene, properties, &thisFileTranscriptMap);
+ transcript->originalId = "none";
+ }
+ if (strstr(temp_inside, "transcript_id")!=NULL){
+ temp_inside = strtok(NULL, "\"");
+ if (temp_inside){
+ transcript_id = temp_inside;
+ transcript->originalId = temp_inside;
+ }else{
+ loadError("Missing id behind the flag transcript_id in file "+filename+":\nProblemLine: "+lineStr);
+ }
+ }
+ if (strstr(temp_inside, "gene_id")!=NULL){
+ temp_inside = strtok(NULL, "\"");
+ if (temp_inside){
+ gene_id = temp_inside;
+ }else{
+ loadError("Missing id behind the flag gene_id in file "+filename+" at "+exon.chr+" from "+to_string((long long int) exon.from)+" to "+to_string((long long int) exon.to)+".");
+ }
+ }
+ temp_inside = strtok(NULL, "\"");
+ }
+
+ if (thisFileTranscriptMap.find(transcript_id) == thisFileTranscriptMap.end()){
+ (*transcript).t_id = transcript_id;
+ thisFileTranscriptMap[transcript_id] = transcript;
+ }else if ((*transcript).strand != thisFileTranscriptMap[transcript_id]->strand){
+ load_warning("Transcript "+thisFileTranscriptMap[transcript_id]->t_id+" on different strands.");
+ }
+
+
+
+
+ if (pred_range.first && pred_range.second){
+ exon.predRange = pred_range;
+ }
+
+
+ if (exon.feature == "start_codon"){
+ if (thisFileTranscriptMap[transcript_id]->tl_complete.first)
+ thisFileTranscriptMap[transcript_id]->separated_codon.first = true;
+ if (thisFileTranscriptMap[transcript_id]->strand == '+'){
+ if (!thisFileTranscriptMap[transcript_id]->tl_complete.first || (thisFileTranscriptMap[transcript_id]->tl_complete.first && thisFileTranscriptMap[transcript_id]->tis > exon.from))
+ thisFileTranscriptMap[transcript_id]->tis = exon.from;
+ }
+ if (thisFileTranscriptMap[transcript_id]->strand == '-'){
+ if (!thisFileTranscriptMap[transcript_id]->tl_complete.first || (thisFileTranscriptMap[transcript_id]->tl_complete.first && thisFileTranscriptMap[transcript_id]->tis < exon.to))
+ thisFileTranscriptMap[transcript_id]->tis = exon.to;
+ }
+ thisFileTranscriptMap[transcript_id]->tl_complete.first = true;
+ }else if (exon.feature == "stop_codon"){
+ if (thisFileTranscriptMap[transcript_id]->tl_complete.second){
+ thisFileTranscriptMap[transcript_id]->separated_codon.second = true;}
+ if (thisFileTranscriptMap[transcript_id]->strand == '+'){
+ if (!thisFileTranscriptMap[transcript_id]->tl_complete.second || (thisFileTranscriptMap[transcript_id]->tl_complete.second && thisFileTranscriptMap[transcript_id]->tes < exon.to)){
+ //thisFileTranscriptMap[transcript_id]->tes = exon.to;
+ }
+ }
+ if (thisFileTranscriptMap[transcript_id]->strand == '-'){
+ if (!thisFileTranscriptMap[transcript_id]->tl_complete.second || (thisFileTranscriptMap[transcript_id]->tl_complete.second && thisFileTranscriptMap[transcript_id]->tes > exon.from)){
+ //thisFileTranscriptMap[transcript_id]->tes = exon.from;
+ }
+ }
+ thisFileTranscriptMap[transcript_id]->tl_complete.second = true;
+ thisFileTranscriptMap[transcript_id]->stop_list.push_back(exon); // TESTLARS
+ }else if (exon.feature == "tss"){
+ if (exon.from != exon.to){loadError("\"tss\" can only take place on one position.");}
+ thisFileTranscriptMap[transcript_id]->tss = exon.from;
+ thisFileTranscriptMap[transcript_id]->tx_complete.first = true;
+ }else if (exon.feature == "tts"){
+ if (exon.from != exon.to){loadError("\"tts\" can only take place on one position.");}
+ thisFileTranscriptMap[transcript_id]->tts = exon.to;
+ thisFileTranscriptMap[transcript_id]->tx_complete.second = true;
+ }else if (exon.feature == "intron"){
+ thisFileTranscriptMap[transcript_id]->intron_list.push_front(exon);
}else{
- (*properties.geneMap)[pointer->second->g_id] = (*pointer).second;
+ thisFileTranscriptMap[transcript_id]->exon_list.push_front(exon);
+ }
+ if (pred_range.first && pred_range.second){
+ thisFileTranscriptMap[transcript_id]->pred_range = pred_range;
}
+
+ (*gene).g_id = gene_id;
+ if (thisFileGeneMap.count(gene_id) == 0){
+ thisFileGeneMap[gene_id] = gene;
+ }
+
+ thisFileTranscriptMap[transcript_id]->parent = thisFileGeneMap[gene_id];
+ }else
+ loadError("Can not read last column.");
+ //}else{} // cerr << "A line without gene_id and/or transcript_id." << endl;
+ }else { // if line starts with '#'
+ strncpy(copybuff, buff, 1014);
+ if (strstr(buff, "sequence range")!=NULL) {
+ int cnt=count(lineStr.begin(),lineStr.end(),':');
+ temp = strtok(buff, ":");
+ for (int i=1; i<cnt; i++){ temp = strtok(NULL, ":"); }
+ temp = strtok(NULL, ":- ()bp");
+ pred_range.first = atoi(temp);
+ temp = strtok(NULL, ":- ()bp");
+ pred_range.second = atoi(temp);
+ if ((pred_range.second - pred_range.first) <= 0){
+ load_warning("There is a non positiv prediction range in file "+filename+":\nProblemLine: "+lineStr);
+ }
+ } // at this position other optional options could be read from gff-#-lines with else if
+ }
+ infile.getline(buff, 1024);
+ }
+ for(auto pointer = thisFileGeneMap.begin(); pointer != thisFileGeneMap.end(); pointer++)
+ {
+ if ((*properties.geneMap).find( pointer->second->g_id ) != (*properties.geneMap).end()){
+ pointer->second->g_id = nextFreeGeneID(properties, &thisFileGeneMap);
+ (*properties.geneMap)[pointer->second->g_id] = (*pointer).second;
+ // maybe fill thisFileGeneMap with new gene, but is not necessary
+ }else{
+ (*properties.geneMap)[pointer->second->g_id] = (*pointer).second;
+ }
}
- for(auto pointer = thisFileTranscriptMap.begin(); pointer != thisFileTranscriptMap.end(); pointer++)
+ for(auto pointer = thisFileTranscriptMap.begin(); pointer != thisFileTranscriptMap.end(); pointer++)
{
- /*if (thisFileGeneMap.find(pointer->second->parent->g_id) == thisFileGeneMap.end()){
- load_error("Something went wrong in the load function, because one transcript is part of an unknown gene.");
+ /*if (thisFileGeneMap.find(pointer->second->parent->g_id) == thisFileGeneMap.end()){
+ loadError("Something went wrong in the load function, because one transcript is part of an unknown gene.");
}*/
- (*properties.geneMap)[pointer->second->parent->g_id]->children.push_front(pointer->second);
- if ((*properties.transcriptMap).find(pointer->second->t_id) != (*properties.transcriptMap).end()){
- pointer->second->t_id = nextFreeTxID(pointer->second->parent, properties, &thisFileTranscriptMap);
- (*properties.transcriptMap)[pointer->second->t_id] = pointer->second;
- }else{
- (*properties.transcriptMap)[pointer->second->t_id] = pointer->second;
- }
+ (*properties.geneMap)[pointer->second->parent->g_id]->children.push_front(pointer->second);
+ if ((*properties.transcriptMap).find(pointer->second->t_id) != (*properties.transcriptMap).end()){
+ pointer->second->t_id = nextFreeTxID(pointer->second->parent, properties, &thisFileTranscriptMap);
+ (*properties.transcriptMap)[pointer->second->t_id] = pointer->second;
+ }else{
+ (*properties.transcriptMap)[pointer->second->t_id] = pointer->second;
+ }
}
- if (!unknownFeatures.empty()){
- for (list<string>::iterator it = unknownFeatures.begin(); it != unknownFeatures.end(); it++){
- load_warning("Did not expect feature \"" + *it + "\". Known features are \"CDS\", \"UTR\", \"3'-UTR\", \"5'-UTR\", \"exon\", \"intron\", \"gene\", \"transcript\", \"tss\", \"tts\", \"start_codon\" and \"stop_codon\". This feature is going to be ignored.");
- }
+ if (!unknownFeatures.empty()){
+ for (list<string>::iterator it = unknownFeatures.begin(); it != unknownFeatures.end(); it++){
+ load_warning("Did not expect feature \"" + *it + "\". Known features are \"CDS\", \"UTR\", \"3'-UTR\", \"5'-UTR\", \"exon\", \"intron\", \"gene\", \"transcript\", \"tss\", \"tts\", \"start_codon\" and \"stop_codon\". This feature is going to be ignored.");
}
- taxaMap.insert(taxaMapTemp.begin(),taxaMapTemp.end());
+ }
+ taxaMap.insert(taxaMapTemp.begin(),taxaMapTemp.end());
+ infile.close();
}
/*bool taxonInList(list<Transcript*> List, string Taxon){
- for(list<Transcript*>::iterator it = List.begin(); it != List.end(); it++){
- if ((*it)->t_id == Taxon){
- return true;
- }
- }
- return false;
-}
+ for(list<Transcript*>::iterator it = List.begin(); it != List.end(); it++){
+ if ((*it)->t_id == Taxon){
+ return true;
+ }
+ }
+ return false;
+ }
-void mergeTranscripts(Properties &properties, Transcript* acc, Transcript* don){
- if (acc->parent->g_id != don->parent->g_id){
- load_error("Only Transcripts from same gene can be merged.");
- }
- if (acc->t_id != don->t_id){
- load_error("Something went wrong in the mergeTranscript function, because only transcripts with same name should be merged.");
- }
- if (acc->strand != don->strand){
- load_error("Transcripts on different strands are not mergeable.");
- }
- if (acc->priority != don->priority){
- load_error("Transcripts with different priorities are not mergeable.");
- }
- if (){}
+ void mergeTranscripts(Properties &properties, Transcript* acc, Transcript* don){
+ if (acc->parent->g_id != don->parent->g_id){
+ loadError("Only Transcripts from same gene can be merged.");
+ }
+ if (acc->t_id != don->t_id){
+ loadError("Something went wrong in the mergeTranscript function, because only transcripts with same name should be merged.");
+ }
+ if (acc->strand != don->strand){
+ loadError("Transcripts on different strands are not mergeable.");
+ }
+ if (acc->priority != don->priority){
+ loadError("Transcripts with different priorities are not mergeable.");
+ }
+ if (){}
-// int tis;
-// int tes;
-// pair<bool,bool> tx_complete;
-// pair<bool,bool> tl_complete;
+ // int tis;
+ // int tes;
+ // pair<bool,bool> tx_complete;
+ // pair<bool,bool> tl_complete;
-// merge exon list:
-// list<Exon> exon_list;
-}
+ // merge exon list:
+ // list<Exon> exon_list;
+ }
-void mergeGenes(Properties &properties, Gene* acc, Gene* don){
- if (acc->g_id != don->g_id){
- load_error("Something went wrong in the mergeGenes function, because only genes with same name should be joined.");
- }
- if (acc->nrOfTx < don->nrOfTx){
- acc->nrOfTx = don->nrOfTx;
- }
- for(list<Transcript*>::iterator it = don->children.begin(); it != don->children.end(); it++){
- if (taxonInList(acc->children, (*it)->t_id)){
- mergeTranscripts();f
- }else{
- if ((*properties.transcriptMap).find((*it)->t_id) == (*properties.transcriptMap).end()){
- acc->children.push_front(*it);
+ void mergeGenes(Properties &properties, Gene* acc, Gene* don){
+ if (acc->g_id != don->g_id){
+ loadError("Something went wrong in the mergeGenes function, because only genes with same name should be joined.");
+ }
+ if (acc->nrOfTx < don->nrOfTx){
+ acc->nrOfTx = don->nrOfTx;
+ }
+ for(list<Transcript*>::iterator it = don->children.begin(); it != don->children.end(); it++){
+ if (taxonInList(acc->children, (*it)->t_id)){
+ mergeTranscripts();f
+ }else{
+ if ((*properties.transcriptMap).find((*it)->t_id) == (*properties.transcriptMap).end()){
+ acc->children.push_front(*it);
- }else{
- load_error("Something went wrong in the load function, because one transcript is part of two different gene. (maybe enable option newTaxa)");
- }
+ }else{
+ loadError("Something went wrong in the load function, because one transcript is part of two different gene. (maybe enable option newTaxa)");
+ }
- }
- }
-}*/
+ }
+ }
+ }*/
void renameTaxa(list<Transcript*> &overlap, Properties &properties){
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- if ((*it)->parent->nrOfPrintedTx == 0){
- properties.nrOfPrintedGenes++;
- (*it)->parent->g_id = "jg" + to_string((long long int) properties.nrOfPrintedGenes);
- }
- (*it)->parent->nrOfPrintedTx++;
- (*it)->t_id = (*it)->parent->g_id + ".t" + to_string((long long int) (*it)->parent->nrOfPrintedTx);
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ if ((*it)->parent->nrOfPrintedTx == 0){
+ properties.nrOfPrintedGenes++;
+ (*it)->parent->g_id = "jg" + to_string((long long int) properties.nrOfPrintedGenes);
}
+ (*it)->parent->nrOfPrintedTx++;
+ (*it)->t_id = (*it)->parent->g_id + ".t" + to_string((long long int) (*it)->parent->nrOfPrintedTx);
+ }
}
void saveOverlap(list<Transcript*> &overlap, string outFileName, Properties &properties)
{
- renameTaxa(overlap, properties);
- // outputs overlap at the end of an existing file in gff format
- // every first and last outfile-line is adjusted and might be change back (to comments above)
- if (overlap.size() == 0) {return;}
- fstream outfile;
- outfile.open(outFileName, ios::out | ios::app);
- outfile << "# overlap start --------------------------------------------------------------------------------" << endl;
- outfile << "# this overlap has " << overlap.size() << " different transcripts" << endl;
- // write by transcripts:
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
-
- if (find(properties.supprList.begin(),properties.supprList.end(),(*it)->priority) != properties.supprList.end()){
- outfile << "# " << (*it)->t_id << " is suppressed." << endl;
- continue;
- }
- outfile << "# This transcript "<< (*it)->t_id << " is derived from " << (*it)->originalId << " from the input file " << (*it)->inputFile << endl;
- outfile << "# It is supported by " << (*it)->supporter.size() << " other predicted genes" << endl;
- outfile << "# the core of this joined transcript has priority " << (*it)->priority << endl;
- if (!(*it)->joinpartner.first.empty())
- outfile << "# transcrpit has been joined at 5'-side with " << (*it)->joinpartner.first << endl;
- if (!(*it)->joinpartner.second.empty())
- outfile << "# transcrpit has been joined at 3'-side with " << (*it)->joinpartner.second << endl;
-
- /*if (!(*it)->parent->printed){
- outfile << (*it)->exon_list.front().chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << "gene" << "\t";
- int minStart = (*it)->getTxStart();
- int maxStop = (*it)->getTxEnd();
- for (list<Transcript*>::iterator it_inside = (*it)->parent->children.begin(); it_inside != (*it)->parent->children.end(); it_inside++){
- if (minStart > (*it_inside)->getTxStart()){minStart=(*it_inside)->getTxStart();}
- if (maxStop < (*it_inside)->getTxEnd()){maxStop=(*it_inside)->getTxEnd();}
- }
- outfile << minStart << "\t";
- outfile << maxStop << "\t";
- outfile << '.' << "\t";
- outfile << (*it)->strand << "\t";
- outfile << "." << "\t";
- outfile << (*it)->parent->g_id << endl;
- (*it)->parent->printed = true;
- }*/
+ renameTaxa(overlap, properties);
+ // outputs overlap at the end of an existing file in gff format
+ // every first and last outfile-line is adjusted and might be change back (to comments above)
+ if (overlap.size() == 0) {return;}
+ fstream outfile;
+ outfile.open(outFileName, ios::out | ios::app);
+ outfile << "# overlap start --------------------------------------------------------------------------------" << endl;
+ outfile << "# this overlap has " << overlap.size() << " different transcripts" << endl;
+ // write by transcripts:
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- if (!(*it)->exon_list.empty()){
- outfile << (*it)->exon_list.front().chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << "transcript" << "\t";
- outfile << (*it)->getTxStart() << "\t";
- outfile << (*it)->getTxEnd() << "\t";
- outfile << '.' << "\t";
- outfile << (*it)->strand << "\t";
- outfile << "." << "\t";
- outfile << (*it)->t_id << endl;
- }
+ if (find(properties.supprList.begin(),properties.supprList.end(),(*it)->priority) != properties.supprList.end()){
+ outfile << "# " << (*it)->t_id << " is suppressed." << endl;
+ continue;
+ }
+ outfile << "# This transcript "<< (*it)->t_id << " is derived from " << (*it)->originalId << " from the input file " << (*it)->inputFile << endl;
+ outfile << "# It is supported by " << (*it)->supporter.size() << " other predicted genes" << endl;
+ outfile << "# the core of this joined transcript has priority " << (*it)->priority << endl;
+ if (!(*it)->joinpartner.first.empty())
+ outfile << "# transcrpit has been joined at 5'-side with " << (*it)->joinpartner.first << endl;
+ if (!(*it)->joinpartner.second.empty())
+ outfile << "# transcrpit has been joined at 3'-side with " << (*it)->joinpartner.second << endl;
+
+ /*if (!(*it)->parent->printed){
+ outfile << (*it)->exon_list.front().chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << "gene" << "\t";
+ int minStart = (*it)->getTxStart();
+ int maxStop = (*it)->getTxEnd();
+ for (list<Transcript*>::iterator it_inside = (*it)->parent->children.begin(); it_inside != (*it)->parent->children.end(); it_inside++){
+ if (minStart > (*it_inside)->getTxStart()){minStart=(*it_inside)->getTxStart();}
+ if (maxStop < (*it_inside)->getTxEnd()){maxStop=(*it_inside)->getTxEnd();}
+ }
+ outfile << minStart << "\t";
+ outfile << maxStop << "\t";
+ outfile << '.' << "\t";
+ outfile << (*it)->strand << "\t";
+ outfile << "." << "\t";
+ outfile << (*it)->parent->g_id << endl;
+ (*it)->parent->printed = true;
+ }*/
+
+ if (!(*it)->exon_list.empty()){
+ outfile << (*it)->exon_list.front().chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << "transcript" << "\t";
+ outfile << (*it)->getTxStart() << "\t";
+ outfile << (*it)->getTxEnd() << "\t";
+ outfile << '.' << "\t";
+ outfile << (*it)->strand << "\t";
+ outfile << "." << "\t";
+ outfile << (*it)->t_id << endl;
+ }
- if ((*it)->strand == '+' && (*it)->tss!=-1){
- outfile << (*it)->exon_list.front().chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << "tss" << "\t";
- outfile << (*it)->tss << "\t";
- outfile << (*it)->tss << "\t";
- outfile << '.' << "\t";
- outfile << (*it)->strand << "\t";
- outfile << "." << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
- if ((*it)->strand == '-' && (*it)->tts!=-1){
- outfile << (*it)->exon_list.front().chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << "tts" << "\t";
- outfile << (*it)->tts << "\t";
- outfile << (*it)->tts << "\t";
- outfile << '.' << "\t";
- outfile << (*it)->strand << "\t";
- outfile << "." << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
- for (list<Exon>::iterator it_inside = (*it)->exon_list.begin(); it_inside != (*it)->exon_list.end(); it_inside++){
- if ((*it_inside).feature == "CDS"){break;}
- outfile << (*it_inside).chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << (*it_inside).feature << "\t";
- outfile << (*it_inside).from << "\t";
- outfile << (*it_inside).to << "\t";
- outfile << (*it_inside).score << "\t";
- outfile << (*it)->strand << "\t";
- if ((*it_inside).frame != -1)
- outfile << (*it_inside).frame << "\t";
- else
- outfile << "." << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
- if ((*it)->strand == '+' && (*it)->tl_complete.first){
- outfile << (*it)->exon_list.front().chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << "start_codon" << "\t";
- outfile << (*it)->tis << "\t";
- outfile << ((*it)->tis+2) << "\t";
- outfile << '.' << "\t";
- outfile << (*it)->strand << "\t";
- outfile << '0' << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ if ((*it)->strand == '+' && (*it)->tss!=-1){
+ outfile << (*it)->exon_list.front().chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << "tss" << "\t";
+ outfile << (*it)->tss << "\t";
+ outfile << (*it)->tss << "\t";
+ outfile << '.' << "\t";
+ outfile << (*it)->strand << "\t";
+ outfile << "." << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ }
+ if ((*it)->strand == '-' && (*it)->tts!=-1){
+ outfile << (*it)->exon_list.front().chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << "tts" << "\t";
+ outfile << (*it)->tts << "\t";
+ outfile << (*it)->tts << "\t";
+ outfile << '.' << "\t";
+ outfile << (*it)->strand << "\t";
+ outfile << "." << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ }
+ for (list<Exon>::iterator it_inside = (*it)->exon_list.begin(); it_inside != (*it)->exon_list.end(); it_inside++){
+ if ((*it_inside).feature == "CDS"){break;}
+ outfile << (*it_inside).chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << (*it_inside).feature << "\t";
+ outfile << (*it_inside).from << "\t";
+ outfile << (*it_inside).to << "\t";
+ outfile << (*it_inside).score << "\t";
+ outfile << (*it)->strand << "\t";
+ if ((*it_inside).frame != -1)
+ outfile << (*it_inside).frame << "\t";
+ else
+ outfile << "." << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ }
+ if ((*it)->strand == '+' && (*it)->tl_complete.first){
+ outfile << (*it)->exon_list.front().chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << "start_codon" << "\t";
+ outfile << (*it)->tis << "\t";
+ outfile << ((*it)->tis+2) << "\t";
+ outfile << '.' << "\t";
+ outfile << (*it)->strand << "\t";
+ outfile << '0' << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
- else if ((*it)->strand == '-' && (*it)->tl_complete.second){
- /* outfile << (*it)->exon_list.front().chr << "\t";
+ }
+ else if ((*it)->strand == '-' && (*it)->tl_complete.second){
+ /* outfile << (*it)->exon_list.front().chr << "\t";
outfile << (*it)->source << "\t";
outfile << "stop_codon" << "\t";
outfile << (*it)->tes << "\t";
@@ -449,156 +479,156 @@ void saveOverlap(list<Transcript*> &overlap, string outFileName, Properties &pro
outfile << (*it)->strand << "\t";
outfile << '0' << "\t";
outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
-*/
-
- for (list<Exon>::iterator it_inside = (*it)->stop_list.begin(); it_inside != (*it)->stop_list.end(); it_inside++){
- if ((*it_inside).feature != "stop_codon"){continue;}
- outfile << (*it_inside).chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << (*it_inside).feature << "\t";
- outfile << (*it_inside).from << "\t";
- outfile << (*it_inside).to << "\t";
- outfile << '.' << "\t";
- outfile << (*it)->strand << "\t";
- if ((*it_inside).frame != -1)
- outfile << (*it_inside).frame << "\t";
- else
- outfile << "." << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
- }
+ */
+
+ for (list<Exon>::iterator it_inside = (*it)->stop_list.begin(); it_inside != (*it)->stop_list.end(); it_inside++){
+ if ((*it_inside).feature != "stop_codon"){continue;}
+ outfile << (*it_inside).chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << (*it_inside).feature << "\t";
+ outfile << (*it_inside).from << "\t";
+ outfile << (*it_inside).to << "\t";
+ outfile << '.' << "\t";
+ outfile << (*it)->strand << "\t";
+ if ((*it_inside).frame != -1)
+ outfile << (*it_inside).frame << "\t";
+ else
+ outfile << "." << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ }
+ }
- if ((*it)->intron_list.size() > 0 && !properties.join){
- (*it)->intron_list.sort();
- for (list<Exon>::iterator it_inside = (*it)->intron_list.begin(); it_inside != (*it)->intron_list.end(); it_inside++){
- outfile << (*it_inside).chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << (*it_inside).feature << "\t";
- outfile << (*it_inside).from << "\t";
- outfile << (*it_inside).to << "\t";
- outfile << (*it_inside).score << "\t";
- outfile << (*it)->strand << "\t";
- if ((*it_inside).frame != -1)
- outfile << (*it_inside).frame << "\t";
- else
- outfile << "." << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
- }
+ if ((*it)->intron_list.size() > 0 && !properties.join){
+ (*it)->intron_list.sort();
+ for (list<Exon>::iterator it_inside = (*it)->intron_list.begin(); it_inside != (*it)->intron_list.end(); it_inside++){
+ outfile << (*it_inside).chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << (*it_inside).feature << "\t";
+ outfile << (*it_inside).from << "\t";
+ outfile << (*it_inside).to << "\t";
+ outfile << (*it_inside).score << "\t";
+ outfile << (*it)->strand << "\t";
+ if ((*it_inside).frame != -1)
+ outfile << (*it_inside).frame << "\t";
+ else
+ outfile << "." << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ }
+ }
- for (list<Exon>::iterator it_inside = (*it)->exon_list.begin(); it_inside != (*it)->exon_list.end(); it_inside++){
- if ((*it_inside).feature != "CDS"){continue;}
- outfile << (*it_inside).chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << (*it_inside).feature << "\t";
- outfile << (*it_inside).from << "\t";
- outfile << (*it_inside).to << "\t";
- outfile << (*it_inside).score << "\t";
- outfile << (*it)->strand << "\t";
- if ((*it_inside).frame != -1)
- outfile << (*it_inside).frame << "\t";
- else
- outfile << "." << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ for (list<Exon>::iterator it_inside = (*it)->exon_list.begin(); it_inside != (*it)->exon_list.end(); it_inside++){
+ if ((*it_inside).feature != "CDS"){continue;}
+ outfile << (*it_inside).chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << (*it_inside).feature << "\t";
+ outfile << (*it_inside).from << "\t";
+ outfile << (*it_inside).to << "\t";
+ outfile << (*it_inside).score << "\t";
+ outfile << (*it)->strand << "\t";
+ if ((*it_inside).frame != -1)
+ outfile << (*it_inside).frame << "\t";
+ else
+ outfile << "." << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
- if ((*it)->strand == '-' && (*it)->tl_complete.first){
- outfile << (*it)->exon_list.back().chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << "start_codon" << "\t";
- outfile << ((*it)->tis-2) << "\t";
- outfile << (*it)->tis << "\t";
- outfile << '.' << "\t";
- outfile << (*it)->strand << "\t";
- outfile << '0' << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
- else if ((*it)->strand == '+' && (*it)->tl_complete.second){
-/* outfile << (*it)->exon_list.back().chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << "stop_codon" << "\t";
- outfile << ((*it)->tes-2) << "\t";
- outfile << (*it)->tes << "\t";
- outfile << '.' << "\t";
- outfile << (*it)->strand << "\t";
- outfile << '0' << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
-*/
- for (list<Exon>::iterator it_inside = (*it)->stop_list.begin(); it_inside != (*it)->stop_list.end(); it_inside++){
- if ((*it_inside).feature != "stop_codon"){continue;}
- outfile << (*it_inside).chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << (*it_inside).feature << "\t";
- outfile << (*it_inside).from << "\t";
- outfile << (*it_inside).to << "\t";
- outfile << '.' << "\t";
- outfile << (*it)->strand << "\t";
- if ((*it_inside).frame != -1)
- outfile << (*it_inside).frame << "\t";
- else
- outfile << "." << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
- }
- bool backUTR = false;
- for (list<Exon>::iterator it_inside = (*it)->exon_list.begin(); it_inside != (*it)->exon_list.end(); it_inside++){
- if ((*it_inside).feature != "CDS" && !backUTR){continue;}
- if ((*it_inside).feature == "CDS"){backUTR = true; continue;}
- outfile << (*it_inside).chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << (*it_inside).feature << "\t";
- outfile << (*it_inside).from << "\t";
- outfile << (*it_inside).to << "\t";
- outfile << (*it_inside).score << "\t";
- outfile << (*it)->strand << "\t";
- if ((*it_inside).frame != -1)
- outfile << (*it_inside).frame << "\t";
- else
- outfile << "." << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
- if ((*it)->strand == '+' && (*it)->tts!=-1){
- outfile << (*it)->exon_list.front().chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << "tts" << "\t";
- outfile << (*it)->tts << "\t";
- outfile << (*it)->tts << "\t";
- outfile << '.' << "\t";
- outfile << (*it)->strand << "\t";
- outfile << "." << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
- if ((*it)->strand == '-' && (*it)->tss!=-1){
- outfile << (*it)->exon_list.front().chr << "\t";
- outfile << (*it)->source << "\t";
- outfile << "tss" << "\t";
- outfile << (*it)->tss << "\t";
- outfile << (*it)->tss << "\t";
- outfile << '.' << "\t";
- outfile << (*it)->strand << "\t";
- outfile << "." << "\t";
- outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
- }
}
- outfile.close();
+ if ((*it)->strand == '-' && (*it)->tl_complete.first){
+ outfile << (*it)->exon_list.back().chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << "start_codon" << "\t";
+ outfile << ((*it)->tis-2) << "\t";
+ outfile << (*it)->tis << "\t";
+ outfile << '.' << "\t";
+ outfile << (*it)->strand << "\t";
+ outfile << '0' << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ }
+ else if ((*it)->strand == '+' && (*it)->tl_complete.second){
+ /* outfile << (*it)->exon_list.back().chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << "stop_codon" << "\t";
+ outfile << ((*it)->tes-2) << "\t";
+ outfile << (*it)->tes << "\t";
+ outfile << '.' << "\t";
+ outfile << (*it)->strand << "\t";
+ outfile << '0' << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ */
+ for (list<Exon>::iterator it_inside = (*it)->stop_list.begin(); it_inside != (*it)->stop_list.end(); it_inside++){
+ if ((*it_inside).feature != "stop_codon"){continue;}
+ outfile << (*it_inside).chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << (*it_inside).feature << "\t";
+ outfile << (*it_inside).from << "\t";
+ outfile << (*it_inside).to << "\t";
+ outfile << '.' << "\t";
+ outfile << (*it)->strand << "\t";
+ if ((*it_inside).frame != -1)
+ outfile << (*it_inside).frame << "\t";
+ else
+ outfile << "." << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ }
+ }
+ bool backUTR = false;
+ for (list<Exon>::iterator it_inside = (*it)->exon_list.begin(); it_inside != (*it)->exon_list.end(); it_inside++){
+ if ((*it_inside).feature != "CDS" && !backUTR){continue;}
+ if ((*it_inside).feature == "CDS"){backUTR = true; continue;}
+ outfile << (*it_inside).chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << (*it_inside).feature << "\t";
+ outfile << (*it_inside).from << "\t";
+ outfile << (*it_inside).to << "\t";
+ outfile << (*it_inside).score << "\t";
+ outfile << (*it)->strand << "\t";
+ if ((*it_inside).frame != -1)
+ outfile << (*it_inside).frame << "\t";
+ else
+ outfile << "." << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ }
+ if ((*it)->strand == '+' && (*it)->tts!=-1){
+ outfile << (*it)->exon_list.front().chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << "tts" << "\t";
+ outfile << (*it)->tts << "\t";
+ outfile << (*it)->tts << "\t";
+ outfile << '.' << "\t";
+ outfile << (*it)->strand << "\t";
+ outfile << "." << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ }
+ if ((*it)->strand == '-' && (*it)->tss!=-1){
+ outfile << (*it)->exon_list.front().chr << "\t";
+ outfile << (*it)->source << "\t";
+ outfile << "tss" << "\t";
+ outfile << (*it)->tss << "\t";
+ outfile << (*it)->tss << "\t";
+ outfile << '.' << "\t";
+ outfile << (*it)->strand << "\t";
+ outfile << "." << "\t";
+ outfile << "transcript_id \"" << (*it)->t_id << "\"; gene_id \"" << (*it)->parent->g_id << "\";" << endl;
+ }
+ }
+ outfile.close();
}
string nextFreeGeneID(Properties &properties, unordered_map<string,Gene*>* addGeneMap){
- string geneID;
- while (geneID == "" || (*properties.geneMap).find(geneID) != (*properties.geneMap).end() || (addGeneMap != NULL && (*addGeneMap).find(geneID) != (*addGeneMap).end())){
- geneID = "g" + to_string((long long int) properties.unknownCount);
- properties.unknownCount++;
- }
- return geneID;
+ string geneID;
+ while (geneID == "" || (*properties.geneMap).find(geneID) != (*properties.geneMap).end() || (addGeneMap != NULL && (*addGeneMap).find(geneID) != (*addGeneMap).end())){
+ geneID = "g" + to_string((long long int) properties.unknownCount);
+ properties.unknownCount++;
+ }
+ return geneID;
}
string nextFreeTxID(Gene* gene, Properties &properties, unordered_map<string,Transcript*>* addTranscriptMap){
- string txID;
- while (txID == "" || (*properties.transcriptMap).find(txID) != (*properties.transcriptMap).end() || (addTranscriptMap != NULL && (*addTranscriptMap).find(txID) != (*addTranscriptMap).end())){
- txID = gene->g_id + ".t" + to_string((long long int) gene->nrOfTx);
- gene->nrOfTx++;
- }
- return txID;
+ string txID;
+ while (txID == "" || (*properties.transcriptMap).find(txID) != (*properties.transcriptMap).end() || (addTranscriptMap != NULL && (*addTranscriptMap).find(txID) != (*addTranscriptMap).end())){
+ txID = gene->g_id + ".t" + to_string((long long int) gene->nrOfTx);
+ gene->nrOfTx++;
+ }
+ return txID;
}
diff --git a/auxprogs/joingenes/jg_ios.h b/auxprogs/joingenes/jg_ios.h
index 18e7385..cfffee7 100644
--- a/auxprogs/joingenes/jg_ios.h
+++ b/auxprogs/joingenes/jg_ios.h
@@ -6,10 +6,12 @@
#include <list>
#include <unordered_map>
#include <algorithm>
-#include <unordered_map>
+#include <map>
+#include <sstream>
using namespace std;
+map<string,int> getFileNames (string fofn);
void load(unordered_map<string,Gene*> &geneMap, string &filename, int &priority, unordered_map<string,bool> &taxaMap, Properties &properties);
void saveOverlap(list<Transcript*> &overlap, string outFileName, Properties &properties);
void saveNew(list<Transcript*> &overlap, string outFileName, Properties &properties);
diff --git a/auxprogs/joingenes/jg_transcript.cpp b/auxprogs/joingenes/jg_transcript.cpp
index 3274ff9..57428f4 100644
--- a/auxprogs/joingenes/jg_transcript.cpp
+++ b/auxprogs/joingenes/jg_transcript.cpp
@@ -7,1756 +7,1760 @@ int count1 = 0; // only for semantic tests
int value = 0; // only for semantic tests
bool compareGenomePositions(Transcript const* lhs, Transcript const* rhs){
- if (min(lhs->tis,lhs->tes) != min(rhs->tis,rhs->tes))
- return (min(lhs->tis,lhs->tes) < min(rhs->tis,rhs->tes));
- else
- return (max(lhs->tis,lhs->tes) < max(rhs->tis,rhs->tes));
+ if (min(lhs->tis,lhs->tes) != min(rhs->tis,rhs->tes))
+ return (min(lhs->tis,lhs->tes) < min(rhs->tis,rhs->tes));
+ else
+ return (max(lhs->tis,lhs->tes) < max(rhs->tis,rhs->tes));
}
void divideInOverlapsAndConquer(list<Transcript*> &transcript_list, Properties &properties){
- // divide a transcript list in clusters of overlapping transcripts (transitive closure) and work on each cluster separately
- transcript_list.sort(compareGenomePositions);
- list<Transcript*> overlap;
- /* string filename2 = "/home/lars/lars/test_data/eval_test.txt";
- fstream outfile2;
- outfile2.open(filename2, ios::out);
- outfile2.close();*/
-
- int max_base = max(transcript_list.front()->tis,transcript_list.front()->tes);
- for (list<Transcript*>::iterator it = transcript_list.begin(); it != transcript_list.end(); it++){
- if (min((*it)->tis,(*it)->tes) < max_base){
- overlap.push_back(*it);
- if (max_base < max((*it)->tis,(*it)->tes)){
- max_base = max((*it)->tis,(*it)->tes);
- }
- }else{
- //eval_gtf(overlap, errordistance);
- if (!properties.onlyCompare){
- workAtOverlap(overlap, properties);
- saveOverlap(overlap, properties.outFileName, properties);
- }else{
- compareAndSplit(overlap, properties);
- }
- overlap.clear();
- max_base = max((*it)->tis,(*it)->tes);
- overlap.push_front(*it);
- }
- }
- if (!properties.onlyCompare){
+ // divide a transcript list in clusters of overlapping transcripts (transitive closure) and work on each cluster separately
+ transcript_list.sort(compareGenomePositions);
+ list<Transcript*> overlap;
+ /* string filename2 = "/home/lars/lars/test_data/eval_test.txt";
+ fstream outfile2;
+ outfile2.open(filename2, ios::out);
+ outfile2.close();
+ */
+
+ int max_base = max(transcript_list.front()->tis,transcript_list.front()->tes);
+ for (list<Transcript*>::iterator it = transcript_list.begin(); it != transcript_list.end(); it++){
+ if ( min((*it)->tis,(*it)->tes) < max_base || ( min((*it)->tis,(*it)->tes) < max_base + 5000 && (((*it)->strand=='+' && !(*it)->tl_complete.first) || ((*it)->strand=='-' && !(*it)->tl_complete.second) ) && overlap.size() < 300 ) ){
+ overlap.push_back(*it);
+ if (max_base < max((*it)->tis,(*it)->tes)){
+ max_base = max((*it)->tis,(*it)->tes);
+ }
+ }else{
+ //eval_gtf(overlap, errordistance);
+ if (!properties.onlyCompare){
workAtOverlap(overlap, properties);
saveOverlap(overlap, properties.outFileName, properties);
- }else{
+ }else{
compareAndSplit(overlap, properties);
- }
- overlap.clear();
+ }
+ overlap.clear();
+ max_base = max((*it)->tis,(*it)->tes);
+ overlap.push_front(*it);
+ }
+ }
+ if (!properties.onlyCompare){
+ workAtOverlap(overlap, properties);
+ saveOverlap(overlap, properties.outFileName, properties);
+ }else{
+ compareAndSplit(overlap, properties);
+ }
+ overlap.clear();
}
void workAtOverlap(list<Transcript*> &overlap, Properties &properties)
{
- if (overlap.size() > 300){
- cerr << "WARNING: the size of the actual overlap is very big (" << overlap.size() << "). This may lead to a long computation time." << endl;
- }
-
- // calls methods for joining transcripts with the target that most of transcripts are complete (have start and stop codon) and delete duplicates and other unwanted transcripts from the overlap
- // search doubling and delete the ones with the lowest priority/score
-
- search_n_destroy_doublings(overlap, properties, true);
- if (properties.join && properties.genemodel != "bacterium"){
- joinCall(overlap, properties);
- }
-
- // searchs and destroys transcripts, which are fully in other transcripts
- if (properties.genemodel != "bacterium")
- search_n_destroy_parts(overlap, properties);
-
- //........................
- if (properties.selecting){
- selection(overlap, properties);
- }
+ if (overlap.size() > 200){
+ cerr << "WARNING: the size of the actual overlap is very big (" << overlap.size() << "). This may lead to a long computation time." << endl;
+ }
+ // calls methods for joining transcripts with the target that most of transcripts are complete (have start and stop codon) and delete duplicates and other unwanted transcripts from the overlap
+ // search doubling and delete the ones with the lowest priority/score
+
+ search_n_destroy_doublings(overlap, properties, true);
+ if (properties.join && properties.genemodel != "bacterium"){
+ joinCall(overlap, properties);
+ }
+ // searchs and destroys transcripts, which are fully in other transcripts
+ if (properties.genemodel != "bacterium")
+ search_n_destroy_parts(overlap, properties);
+ //........................
+ if (properties.selecting){
+ selection(overlap, properties);
+ }
}
void joinCall(list<Transcript*> &overlap, Properties &properties){
- // if there are transcripts with and without start/stop codon, they can be joined here, if they fit together; the old transcript remain for the moment
- // test if some exon is to close to prediction range boundary
- tooCloseToBoundary(overlap, properties);
- // join stop codons
- join(overlap, '3', properties);
+ // if there are transcripts with and without start/stop codon, they can be joined here, if they fit together; the old transcript remain for the moment
+ // test if some exon is to close to prediction range boundary
+ tooCloseToBoundary(overlap, properties);
+ // join stop codons
- search_n_destroy_doublings(overlap, properties, false);
+ join(overlap, '3', properties);
- join(overlap, '5', properties);
+ search_n_destroy_doublings(overlap, properties, false);
- search_n_destroy_doublings(overlap, properties, false);
+ join(overlap, '5', properties);
+
+ search_n_destroy_doublings(overlap, properties, false);
}
void compareAndSplit(list<Transcript*> &overlap, Properties &properties){
- list<Transcript*> priorityTx1;
- list<Transcript*> priorityTx2;
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- if ((*it)->priority == *properties.priorities.begin())
- priorityTx1.push_back(*it);
- else
- priorityTx2.push_back(*it);
- }
-
- list<Transcript*> equal;
- list<Transcript*> alternatives1;
- list<Transcript*> alternatives2;
- list<Transcript*> unequal1;
- list<Transcript*> unequal2;
-
- for (list<Transcript*>::iterator it = priorityTx1.begin(); it != priorityTx1.end(); it++){
- list<Transcript*>::iterator it_temp = it;
- it_temp++;
- for (list<Transcript*>::iterator it_inside = priorityTx2.begin(); it_inside != priorityTx2.end(); it_inside++){
- pair<bool,bool> who_is_part = is_part_of(*it, *it_inside);
- if (who_is_part.first && who_is_part.second){
- (*it)->compareValue = EQUAL;
- (*it_inside)->compareValue = EQUAL;
- }else if ((properties.genemodel == "bacterium" && (*it)->tes && (*it_inside)->tes && (*it)->tes == (*it_inside)->tes) || (properties.genemodel != "bacterium" && alternativeVariants((*it), (*it_inside))) || (overlappingCdsWithAnything((*it), (*it_inside)) && (*it)->strand == (*it_inside)->strand && (*it)->hasExonInSameReadingFrame((*it_inside)) ) ){
- if ((*it)->compareValue != 2){
- if ((*it)->compareValue == 0){
- (*it)->alternatives.clear();
- }
- (*it)->alternatives.push_back(*it_inside);
- (*it)->compareValue = ALTERNATIVE;
- }
- if ((*it_inside)->compareValue != 2){
- if ((*it_inside)->compareValue == 0){
- (*it_inside)->alternatives.clear();
- }
- (*it_inside)->alternatives.push_back(*it);
- (*it_inside)->compareValue = ALTERNATIVE;
- }
- }else{
- if ((*it)->compareValue != 2 && (*it)->compareValue != 1)
- (*it)->compareValue = UNEQUAL;
- if ((*it_inside)->compareValue != 2 && (*it_inside)->compareValue != 1)
- (*it_inside)->compareValue = UNEQUAL;
- }
+ list<Transcript*> priorityTx1;
+ list<Transcript*> priorityTx2;
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ if ((*it)->priority == *properties.priorities.begin())
+ priorityTx1.push_back(*it);
+ else
+ priorityTx2.push_back(*it);
+ }
+
+ list<Transcript*> equal;
+ list<Transcript*> alternatives1;
+ list<Transcript*> alternatives2;
+ list<Transcript*> unequal1;
+ list<Transcript*> unequal2;
+
+ for (list<Transcript*>::iterator it = priorityTx1.begin(); it != priorityTx1.end(); it++){
+ list<Transcript*>::iterator it_temp = it;
+ it_temp++;
+ for (list<Transcript*>::iterator it_inside = priorityTx2.begin(); it_inside != priorityTx2.end(); it_inside++){
+ pair<bool,bool> who_is_part = is_part_of(*it, *it_inside);
+ if (who_is_part.first && who_is_part.second){
+ (*it)->compareValue = EQUAL;
+ (*it_inside)->compareValue = EQUAL;
+ }else if ((properties.genemodel == "bacterium" && (*it)->tes && (*it_inside)->tes && (*it)->tes == (*it_inside)->tes) || (properties.genemodel != "bacterium" && alternativeVariants((*it), (*it_inside))) || (overlappingCdsWithAnything((*it), (*it_inside)) && (*it)->strand == (*it_inside)->strand && (*it)->hasExonInSameReadingFrame((*it_inside)) ) ){
+ if ((*it)->compareValue != 2){
+ if ((*it)->compareValue == 0){
+ (*it)->alternatives.clear();
+ }
+ (*it)->alternatives.push_back(*it_inside);
+ (*it)->compareValue = ALTERNATIVE;
}
- if ((*it)->compareValue == 2)
- equal.push_back(*it);
- if ((*it)->compareValue == 1)
- alternatives1.push_back(*it);
- if ((*it)->compareValue == 0)
- unequal1.push_back(*it);
- }
- for (list<Transcript*>::iterator it = priorityTx2.begin(); it != priorityTx2.end(); it++){
- if ((*it)->compareValue == 1)
- alternatives2.push_back(*it);
- if ((*it)->compareValue == 0)
- unequal2.push_back(*it);
- }
- string filenameEqual = "cEqual.gtf", filenameStop1 = "cAlternative1.gtf", filenameStop2 = "cAlternative2.gtf", filenameUne1 = "cUnequal1.gtf", filenameUne2 = "cUnequal2.gtf";
- saveOverlap(equal, filenameEqual, properties);
- saveOverlap(alternatives1, filenameStop1, properties);
- saveOverlap(alternatives2, filenameStop2, properties);
- saveOverlap(unequal1, filenameUne1, properties);
- saveOverlap(unequal2, filenameUne2, properties);
-
- saveNew(alternatives1, "cLizzy1.gtf", properties);
+ if ((*it_inside)->compareValue != 2){
+ if ((*it_inside)->compareValue == 0){
+ (*it_inside)->alternatives.clear();
+ }
+ (*it_inside)->alternatives.push_back(*it);
+ (*it_inside)->compareValue = ALTERNATIVE;
+ }
+ }else{
+ if ((*it)->compareValue != 2 && (*it)->compareValue != 1)
+ (*it)->compareValue = UNEQUAL;
+ if ((*it_inside)->compareValue != 2 && (*it_inside)->compareValue != 1)
+ (*it_inside)->compareValue = UNEQUAL;
+ }
+ }
+ if ((*it)->compareValue == 2)
+ equal.push_back(*it);
+ if ((*it)->compareValue == 1)
+ alternatives1.push_back(*it);
+ if ((*it)->compareValue == 0)
+ unequal1.push_back(*it);
+ }
+ for (list<Transcript*>::iterator it = priorityTx2.begin(); it != priorityTx2.end(); it++){
+ if ((*it)->compareValue == 1)
+ alternatives2.push_back(*it);
+ if ((*it)->compareValue == 0)
+ unequal2.push_back(*it);
+ }
+ string filenameEqual = "cEqual.gtf", filenameStop1 = "cAlternative1.gtf", filenameStop2 = "cAlternative2.gtf", filenameUne1 = "cUnequal1.gtf", filenameUne2 = "cUnequal2.gtf";
+ saveOverlap(equal, filenameEqual, properties);
+ saveOverlap(alternatives1, filenameStop1, properties);
+ saveOverlap(alternatives2, filenameStop2, properties);
+ saveOverlap(unequal1, filenameUne1, properties);
+ saveOverlap(unequal2, filenameUne2, properties);
+
+ saveNew(alternatives1, "cExtra1.gtf", properties);
}
double simpleProkScore(Transcript const* tx){
- // calculates a score for comparision; completeness shouldn't be used
- if (tx->exon_list.size() != 1)
- return 0;
- else
- return tx->exon_list.front().score;
+ // calculates a score for comparision; completeness shouldn't be used
+ if (tx->exon_list.size() != 1)
+ return 0;
+ else
+ return tx->exon_list.front().score;
}
bool areSimilar(Transcript const* t1, Transcript const* t2){
- // is true, if transcripts are similar
- if (t1->strand != t2->strand){
- return false;
- }
- pair<unsigned int,unsigned int> overHangNumber = make_pair(0, 0);
- unsigned int equalExonNumber = 0;
- pair<int,int> whoHangOver = make_pair(0, 0);
- pair<float,float> overHangScore = make_pair(0, 0);
- list<Exon>::const_iterator it1 = t1->exon_list.begin();
- list<Exon>::const_iterator it2 = t2->exon_list.begin();
-
- //int lowestEqualExonBase;
- //int highestEqualExonBase;
- //bool lowestEqualExonFound = false;
- while (it1 != t1->exon_list.end() || it2 != t2->exon_list.end()){
- if (it1 != t1->exon_list.end() && it2 != t2->exon_list.end()){
- if ((*it1).from == (*it2).from){
- if ((*it1).to == (*it2).to){
- //if (!lowestEqualExonFound){lowestEqualExonFound = true; lowestEqualExonBase = (*it1).from;}
- //highestEqualExonBase = (*it1).to;
- equalExonNumber++; it1++; it2++;
- }else if ((*it1).to < (*it2).to){it1++;}else{it2++;}
- }else if ((*it1).from < (*it2).from){
- if(it2 == t2->exon_list.begin()){whoHangOver.first = 1;}
- if ((*it1).to < (*it2).from){
- if(it2 == t2->exon_list.begin()){overHangNumber.first++; overHangScore.first += (*it1).score;}
- it1++;
- }else{
- if ((*it1).to == (*it2).to){it1++; it2++;}else if ((*it1).to < (*it2).to){it1++;}else{it2++;}
- }
- }else{
- if(it1 == t1->exon_list.begin()){whoHangOver.first = 2;}
- if ((*it1).from > (*it2).to){
- if(it1 == t1->exon_list.begin()){overHangNumber.first++; overHangScore.first += (*it2).score;}
- it2++;
- }else{
- if ((*it1).to == (*it2).to){it1++; it2++;}else if ((*it1).to < (*it2).to){it1++;}else{it2++;}
- }
- }
- }else if (it1 == t1->exon_list.end()){
- whoHangOver.second = 2;
- list<Exon>::const_iterator itemp = it1; itemp--;
- if ((*itemp).to < (*it2).from){overHangNumber.second++; overHangScore.second += (*it2).score;}
- it2++;
- }else{
- whoHangOver.second = 1;
- list<Exon>::const_iterator itemp = it2; itemp--;
- if ((*itemp).to < (*it1).from){overHangNumber.second++; overHangScore.second += (*it1).score;}
- it1++;
- }
+ // is true, if transcripts are similar
+ if (t1->strand != t2->strand){
+ return false;
+ }
+ pair<unsigned int,unsigned int> overHangNumber = make_pair(0, 0);
+ unsigned int equalExonNumber = 0;
+ pair<int,int> whoHangOver = make_pair(0, 0);
+ pair<float,float> overHangScore = make_pair(0, 0);
+ list<Exon>::const_iterator it1 = t1->exon_list.begin();
+ list<Exon>::const_iterator it2 = t2->exon_list.begin();
+
+ //int lowestEqualExonBase;
+ //int highestEqualExonBase;
+ //bool lowestEqualExonFound = false;
+ while (it1 != t1->exon_list.end() || it2 != t2->exon_list.end()){
+ if (it1 != t1->exon_list.end() && it2 != t2->exon_list.end()){
+ if ((*it1).from == (*it2).from){
+ if ((*it1).to == (*it2).to){
+ //if (!lowestEqualExonFound){lowestEqualExonFound = true; lowestEqualExonBase = (*it1).from;}
+ //highestEqualExonBase = (*it1).to;
+ equalExonNumber++; it1++; it2++;
+ }else if ((*it1).to < (*it2).to){it1++;}else{it2++;}
+ }else if ((*it1).from < (*it2).from){
+ if(it2 == t2->exon_list.begin()){whoHangOver.first = 1;}
+ if ((*it1).to < (*it2).from){
+ if(it2 == t2->exon_list.begin()){overHangNumber.first++; overHangScore.first += (*it1).score;}
+ it1++;
+ }else{
+ if ((*it1).to == (*it2).to){it1++; it2++;}else if ((*it1).to < (*it2).to){it1++;}else{it2++;}
+ }
+ }else{
+ if(it1 == t1->exon_list.begin()){whoHangOver.first = 2;}
+ if ((*it1).from > (*it2).to){
+ if(it1 == t1->exon_list.begin()){overHangNumber.first++; overHangScore.first += (*it2).score;}
+ it2++;
+ }else{
+ if ((*it1).to == (*it2).to){it1++; it2++;}else if ((*it1).to < (*it2).to){it1++;}else{it2++;}
+ }
+ }
+ }else if (it1 == t1->exon_list.end()){
+ whoHangOver.second = 2;
+ list<Exon>::const_iterator itemp = it1; itemp--;
+ if ((*itemp).to < (*it2).from){overHangNumber.second++; overHangScore.second += (*it2).score;}
+ it2++;
+ }else{
+ whoHangOver.second = 1;
+ list<Exon>::const_iterator itemp = it2; itemp--;
+ if ((*itemp).to < (*it1).from){overHangNumber.second++; overHangScore.second += (*it1).score;}
+ it1++;
}
+ }
- /*if (lowestEqualExonFound){
- float scoreSum = 0;
- int countLoopRuns = 0;
- for (list<Exon>::const_iterator it = t1->exon_list.begin(); (it != t1->exon_list.end() && (*it).from != lowestEqualExonBase); it++){
- scoreSum += (*it1).score;
- countLoopRuns++;
- }
- if (countLoopRuns > 0){
- cout << scoreSum/countLoopRuns << endl;
- }
-
- scoreSum = 0;
- countLoopRuns = 0;
- for (list<Exon>::const_iterator it = t2->exon_list.begin(); (it != t2->exon_list.end() && (*it).from != lowestEqualExonBase); it++){
- scoreSum += (*it1).score;
- countLoopRuns++;
- }
- if (countLoopRuns > 0){
- cout << scoreSum/countLoopRuns << endl;
- }
-
- scoreSum = 0;
- countLoopRuns = 0;
- bool behindHighestExon = false;
- for (list<Exon>::const_iterator it = t1->exon_list.begin(); it != t1->exon_list.end(); it++){
- if (behindHighestExon){
- scoreSum += (*it).score;
- countLoopRuns++;
- }
- if ((*it).to == highestEqualExonBase){behindHighestExon = true;}
- }
- if (countLoopRuns > 0){
- cout << scoreSum/countLoopRuns << endl;
- }
-
- scoreSum = 0;
- countLoopRuns = 0;
- behindHighestExon = false;
- for (list<Exon>::const_iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
- if (behindHighestExon){
- scoreSum += (*it).score;
- countLoopRuns++;
- }
- if ((*it).to == highestEqualExonBase){behindHighestExon = true;}
- }
- if (countLoopRuns > 0){
- cout << scoreSum/countLoopRuns << endl;
- }
- }*/
-
- float equalBorder = 0.5; // maybe as option
- float overHangScoreBorder = 0.5; // maybe as option
- // maybe also as option: [border = score1 - score2]; maybe output this score to use it later
- overHangScore.first /= overHangNumber.first;
- overHangScore.second /= overHangNumber.second;
- if ((whoHangOver.first == 0 && overHangNumber.first != 0) || (whoHangOver.second == 0 && overHangNumber.second != 0)){cerr << "Something went wrong in areSimilar at Pos. 1" << endl;}
- float overlapExonNumberT1 = t1->exon_list.size();
- // float overlapExonNumberT2 = t2->exon_list.size();
- if (whoHangOver.first == 1){overlapExonNumberT1 -= overHangNumber.first;}//else if (whoHangOver.first == 2){overlapExonNumberT2 -= overHangNumber.first;}
- if (whoHangOver.second == 1){overlapExonNumberT1 -= overHangNumber.second;}//else if (whoHangOver.second == 2){overlapExonNumberT2 -= overHangNumber.second;}
-
- float overlapEqualRatioT1 = (float) (equalExonNumber / overlapExonNumberT1);
- // float overlapEqualRatioT2 = (float) (equalExonNumber / overlapExonNumberT2);
-
- float centerScoreT1 = 0;
- float centerScoreT2 = 0;
- unsigned int centerNumberT1 = t1->exon_list.size();
- unsigned int centerNumberT2 = t2->exon_list.size();
- for (list<Exon>::const_iterator it1 = t1->exon_list.begin(); it1 != t1->exon_list.end(); it1++){centerScoreT1 += (*it1).score;}
- for (list<Exon>::const_iterator it2 = t2->exon_list.begin(); it2 != t2->exon_list.end(); it2++){centerScoreT2 += (*it2).score;}
+ /*if (lowestEqualExonFound){
+ float scoreSum = 0;
+ int countLoopRuns = 0;
+ for (list<Exon>::const_iterator it = t1->exon_list.begin(); (it != t1->exon_list.end() && (*it).from != lowestEqualExonBase); it++){
+ scoreSum += (*it1).score;
+ countLoopRuns++;
+ }
+ if (countLoopRuns > 0){
+ cout << scoreSum/countLoopRuns << endl;
+ }
+
+ scoreSum = 0;
+ countLoopRuns = 0;
+ for (list<Exon>::const_iterator it = t2->exon_list.begin(); (it != t2->exon_list.end() && (*it).from != lowestEqualExonBase); it++){
+ scoreSum += (*it1).score;
+ countLoopRuns++;
+ }
+ if (countLoopRuns > 0){
+ cout << scoreSum/countLoopRuns << endl;
+ }
+
+ scoreSum = 0;
+ countLoopRuns = 0;
+ bool behindHighestExon = false;
+ for (list<Exon>::const_iterator it = t1->exon_list.begin(); it != t1->exon_list.end(); it++){
+ if (behindHighestExon){
+ scoreSum += (*it).score;
+ countLoopRuns++;
+ }
+ if ((*it).to == highestEqualExonBase){behindHighestExon = true;}
+ }
+ if (countLoopRuns > 0){
+ cout << scoreSum/countLoopRuns << endl;
+ }
+
+ scoreSum = 0;
+ countLoopRuns = 0;
+ behindHighestExon = false;
+ for (list<Exon>::const_iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
+ if (behindHighestExon){
+ scoreSum += (*it).score;
+ countLoopRuns++;
+ }
+ if ((*it).to == highestEqualExonBase){behindHighestExon = true;}
+ }
+ if (countLoopRuns > 0){
+ cout << scoreSum/countLoopRuns << endl;
+ }
+ }*/
+
+ float equalBorder = 0.5; // maybe as option
+ float overHangScoreBorder = 0.5; // maybe as option
+ // maybe also as option: [border = score1 - score2]; maybe output this score to use it later
+ overHangScore.first /= overHangNumber.first;
+ overHangScore.second /= overHangNumber.second;
+ if ((whoHangOver.first == 0 && overHangNumber.first != 0) || (whoHangOver.second == 0 && overHangNumber.second != 0)){cerr << "Something went wrong in areSimilar at Pos. 1" << endl;}
+ float overlapExonNumberT1 = t1->exon_list.size();
+ // float overlapExonNumberT2 = t2->exon_list.size();
+ if (whoHangOver.first == 1){overlapExonNumberT1 -= overHangNumber.first;}//else if (whoHangOver.first == 2){overlapExonNumberT2 -= overHangNumber.first;}
+ if (whoHangOver.second == 1){overlapExonNumberT1 -= overHangNumber.second;}//else if (whoHangOver.second == 2){overlapExonNumberT2 -= overHangNumber.second;}
+
+ float overlapEqualRatioT1 = (float) (equalExonNumber / overlapExonNumberT1);
+ // float overlapEqualRatioT2 = (float) (equalExonNumber / overlapExonNumberT2);
+
+ float centerScoreT1 = 0;
+ float centerScoreT2 = 0;
+ unsigned int centerNumberT1 = t1->exon_list.size();
+ unsigned int centerNumberT2 = t2->exon_list.size();
+ for (list<Exon>::const_iterator it1 = t1->exon_list.begin(); it1 != t1->exon_list.end(); it1++){centerScoreT1 += (*it1).score;}
+ for (list<Exon>::const_iterator it2 = t2->exon_list.begin(); it2 != t2->exon_list.end(); it2++){centerScoreT2 += (*it2).score;}
+ if (whoHangOver.first == 1){
+ centerScoreT1 -= overHangScore.first;
+ centerNumberT1 -= overHangNumber.first;
+ }else if (whoHangOver.first == 2){
+ centerScoreT2 -= overHangScore.first;
+ centerNumberT2 -= overHangNumber.first;
+ }
+ if (whoHangOver.second == 1){
+ centerScoreT1 -= overHangScore.second;
+ centerNumberT1 -= overHangNumber.second;
+ }else if (whoHangOver.second == 2){
+ centerScoreT2 -= overHangScore.second;
+ centerNumberT2 -= overHangNumber.second;
+ }
+
+
+ if (overlapEqualRatioT1 < equalBorder){
+ if (centerScoreT2/centerNumberT2 < 0.8 || centerScoreT2/centerNumberT2 < 2*(centerScoreT1/centerNumberT1)){
+ return false;
+ }
+ }
+
+ if ((overHangScore.first > overHangScoreBorder) && (overHangNumber.first > 2 || overHangNumber.first > centerNumberT1)){
if (whoHangOver.first == 1){
- centerScoreT1 -= overHangScore.first;
- centerNumberT1 -= overHangNumber.first;
- }else if (whoHangOver.first == 2){
- centerScoreT2 -= overHangScore.first;
- centerNumberT2 -= overHangNumber.first;
+ return false;
}
+ }
+ if ((overHangScore.second > overHangScoreBorder) && (overHangNumber.second > 2 || overHangNumber.second > centerNumberT1)){
if (whoHangOver.second == 1){
- centerScoreT1 -= overHangScore.second;
- centerNumberT1 -= overHangNumber.second;
- }else if (whoHangOver.second == 2){
- centerScoreT2 -= overHangScore.second;
- centerNumberT2 -= overHangNumber.second;
+ return false;
}
-
-
- if (overlapEqualRatioT1 < equalBorder){
- if (centerScoreT2/centerNumberT2 < 0.8 || centerScoreT2/centerNumberT2 < 2*(centerScoreT1/centerNumberT1)){
- return false;
- }
- }
-
- if ((overHangScore.first > overHangScoreBorder) && (overHangNumber.first > 2 || overHangNumber.first > centerNumberT1)){
- if (whoHangOver.first == 1){
- return false;
- }
- }
- if ((overHangScore.second > overHangScoreBorder) && (overHangNumber.second > 2 || overHangNumber.second > centerNumberT1)){
- if (whoHangOver.second == 1){
- return false;
- }
- }
- return true;
+ }
+ return true;
}
Transcript* createCopyOf(Transcript* tx, Properties &properties, list<Transcript*> &overlap){
- Transcript* txNew = new Transcript;
- (*txNew) = *tx;
-
-// either
- //txNew->parent->children.push_back(txNew);
-// or
- Gene* geneNew = new Gene;
- geneNew->children.push_back(txNew);
- unordered_map<string,Gene*>* empty = NULL;
- geneNew->g_id = nextFreeGeneID(properties, empty);
- (*properties.geneMap)[geneNew->g_id] = geneNew;
- txNew->parent = geneNew;
-// either end
-
- txNew->t_id = nextFreeTxID(txNew->parent, properties, NULL);
- (*properties.transcriptMap)[txNew->t_id] = txNew;
- overlap.push_back(txNew);
- return txNew;
+ Transcript* txNew = new Transcript;
+ (*txNew) = *tx;
+
+ // either
+ //txNew->parent->children.push_back(txNew);
+ // or
+ Gene* geneNew = new Gene;
+ geneNew->children.push_back(txNew);
+ unordered_map<string,Gene*>* empty = NULL;
+ geneNew->g_id = nextFreeGeneID(properties, empty);
+ (*properties.geneMap)[geneNew->g_id] = geneNew;
+ txNew->parent = geneNew;
+ // either end
+
+ txNew->t_id = nextFreeTxID(txNew->parent, properties, NULL);
+ (*properties.transcriptMap)[txNew->t_id] = txNew;
+ overlap.push_back(txNew);
+ return txNew;
}
void deleteGene(Gene* gene, Properties &properties){
- if (gene->children.size() > 0){cerr << "SEMANTIC ERROR: It is not allowed to delete a gene without deleting transcripts before." << endl; exit( EXIT_FAILURE );}
- (*properties.geneMap).erase(gene->g_id);
- delete gene;
+ if (gene->children.size() > 0){cerr << "SEMANTIC ERROR: It is not allowed to delete a gene without deleting transcripts before." << endl; exit( EXIT_FAILURE );}
+ (*properties.geneMap).erase(gene->g_id);
+ delete gene;
}
void deleteTx(Transcript* tx, Properties &properties){
- (*properties.transcriptMap).erase(tx->t_id);
- for (list<Transcript*>::iterator it = tx->parent->children.begin(); it != tx->parent->children.end(); it++){
- if ((*it) == tx){
- it = tx->parent->children.erase(it);
- it--;
- if (tx->parent->children.empty()){
- deleteGene(tx->parent, properties);
- }
- }
+ (*properties.transcriptMap).erase(tx->t_id);
+ for (list<Transcript*>::iterator it = tx->parent->children.begin(); it != tx->parent->children.end(); it++){
+ if ((*it) == tx){
+ it = tx->parent->children.erase(it);
+ it--;
+ if (tx->parent->children.empty()){
+ deleteGene(tx->parent, properties);
+ }
}
- delete tx; // problem with pointer to these transcript in "isCopyOf" and "joinpartner" and others in that kind
+ }
+ delete tx; // problem with pointer to these transcript in "isCopyOf" and "joinpartner" and others in that kind
}
void tooCloseToBoundary(list<Transcript*> &overlap, Properties &properties){
- // if an errordistance is set, solve problem cases
- if (properties.errordistance < 0){
- return;
+ // if an errordistance is set, solve problem cases
+ if (properties.errordistance < 0){
+ return;
+ }
+ // find out, if there are indirect boundary problems
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ list<Transcript*>::iterator itInside = it;
+ itInside++;
+ while (itInside != overlap.end()){
+ if (overlappingCdsWithAnything((*it), (*itInside)) /*&& (*it)->strand == (*itInside)->strand*/){
+ // does *it transcend the predictionBoundary of *itInside in tail direction
+ (*it)->indirectBoundaryProblem(*itInside);
+ (*itInside)->indirectBoundaryProblem(*it);
+ }
+ itInside++;
}
- // find out, if there are indirect boundary problems
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- list<Transcript*>::iterator itInside = it;
- itInside++;
- while (itInside != overlap.end()){
- if (overlappingCdsWithAnything((*it), (*itInside)) /*&& (*it)->strand == (*itInside)->strand*/){
- // does *it transcend the predictionBoundary of *itInside in tail direction
- (*it)->indirectBoundaryProblem(*itInside);
- (*itInside)->indirectBoundaryProblem(*it);
- }
- itInside++;
- }
+ }
+
+ // create new transcripts without the problem exons at front and/or back, if there is a boundary problem (direct or indirect)
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ unsigned int countCDS = 0;
+ for (list<Exon>::iterator ite = (*it)->exon_list.begin(); ite != (*it)->exon_list.end(); ite++){
+ if ((*ite).feature == "CDS"){
+ countCDS++;
+ }
+ if (countCDS >= 2){break;}
}
- // create new transcripts without the problem exons at front and/or back, if there is a boundary problem (direct or indirect)
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- unsigned int countCDS = 0;
- for (list<Exon>::iterator ite = (*it)->exon_list.begin(); ite != (*it)->exon_list.end(); ite++){
- if ((*ite).feature == "CDS"){
- countCDS++;
- }
- if (countCDS >= 2){break;}
- }
+ if ((*it)->boundaryProblem.first >= 2 && (*it)->boundaryProblem.second < 2){
+ // erase the transcript, if it has problem boundary exons only
+ if ((*it)->exon_list.size() == 1 || ((*it)->exon_list.front().feature == "CDS" && countCDS <= 1)){
+ deleteTx(*it, properties);
+ it = overlap.erase(it);
+ it--;
+ continue;
+ }
+ // create txNew
+ Transcript* txNew = createCopyOf(*it, properties, overlap);
- if ((*it)->boundaryProblem.first >= 2 && (*it)->boundaryProblem.second < 2){
- // erase the transcript, if it has problem boundary exons only
- if ((*it)->exon_list.size() == 1 || ((*it)->exon_list.front().feature == "CDS" && countCDS <= 1)){
- deleteTx(*it, properties);
- it = overlap.erase(it);
- it--;
- continue;
- }
- // create txNew
- Transcript* txNew = createCopyOf(*it, properties, overlap);
-
- string tempFeatureFront = txNew->exon_list.front().feature;
-
- // delete problem exon
- txNew->exon_list.pop_front();
-
- // change some values of new transcripts for adaption
- if (tempFeatureFront == "CDS"){
- if (txNew->strand == '+'){
- txNew->tl_complete.first = false;
- txNew->tis = txNew->exon_list.front().from;
- }else{
- txNew->tl_complete.second = false;
- txNew->stop_list.clear();
- txNew->tes = txNew->exon_list.front().from;
- }
- }else{
- if (txNew->strand == '+'){
- txNew->tx_complete.first = false;
- txNew->tss = -1;
- }else{
- txNew->tx_complete.second = false;
- txNew->tts = -1;
- }
- }
- txNew->boundaryProblem.first = FREED;
-
- }else if ((*it)->boundaryProblem.first < 2 && (*it)->boundaryProblem.second >= 2){
- // erase the transcript, if it has problem boundary exons only
- if ((*it)->exon_list.size() == 1 || ((*it)->exon_list.back().feature == "CDS" && countCDS <= 1)){
- deleteTx(*it, properties);
- it = overlap.erase(it);
- it--;
- continue;
- }
- // create txNew
- Transcript* txNew = createCopyOf(*it, properties, overlap);
-
- string tempFeatureBack = txNew->exon_list.back().feature;
-
- // delete problem exon
- txNew->exon_list.pop_back();
-
- // change some values of new transcripts for adaption
- if (tempFeatureBack == "CDS"){
- if (txNew->strand == '-'){
- txNew->tl_complete.first = false;
- txNew->tis = txNew->exon_list.back().to;
- }else{
- txNew->tl_complete.second = false;
- txNew->stop_list.clear();
- txNew->tes = txNew->exon_list.back().to;
- }
- }else{
- if (txNew->strand == '-'){
- txNew->tx_complete.first = false;
- txNew->tss = -1;
- }else{
- txNew->tx_complete.second = false;
- txNew->tts = -1;
- }
- }
- txNew->boundaryProblem.second = FREED;
-
- }else if ((*it)->boundaryProblem.first >= 2 && (*it)->boundaryProblem.second >= 2){
- // erase the transcript, if it has problem boundary exons only
- if ((*it)->exon_list.size() <= 2 || ((*it)->exon_list.front().feature == "CDS" && countCDS <= 1) || ((*it)->exon_list.back().feature == "CDS" && countCDS <= 1) || ((*it)->exon_list.front().feature == "CDS" && (*it)->exon_list.back().feature == "CDS" && countCDS <= 2)){
- deleteTx(*it, properties);
- it = overlap.erase(it);
- it--;
- continue;
- }
- Transcript* txNew = createCopyOf(*it, properties, overlap);
-
- string tempFeatureFront = txNew->exon_list.front().feature;
-
- // delete problem exon
- txNew->exon_list.pop_front();
-
- // change some values of new transcripts for adaption
- if (tempFeatureFront == "CDS"){
- if (txNew->strand == '+'){
- txNew->tl_complete.first = false;
- txNew->tis = txNew->exon_list.front().from;
- }else{
- txNew->tl_complete.second = false;
- txNew->stop_list.clear();
- txNew->tes = txNew->exon_list.front().from;
- }
- }else{
- if (txNew->strand == '+'){
- txNew->tx_complete.first = false;
- txNew->tss = -1;
- }else{
- txNew->tx_complete.second = false;
- txNew->tts = -1;
- }
- }
+ string tempFeatureFront = txNew->exon_list.front().feature;
- txNew->boundaryProblem.first = FREED;
+ // delete problem exon
+ txNew->exon_list.pop_front();
- string tempFeatureBack = txNew->exon_list.back().feature;
+ // change some values of new transcripts for adaption
+ if (tempFeatureFront == "CDS"){
+ if (txNew->strand == '+'){
+ txNew->tl_complete.first = false;
+ txNew->tis = txNew->exon_list.front().from;
+ }else{
+ txNew->tl_complete.second = false;
+ txNew->stop_list.clear();
+ txNew->tes = txNew->exon_list.front().from;
+ }
+ }else{
+ if (txNew->strand == '+'){
+ txNew->tx_complete.first = false;
+ txNew->tss = -1;
+ }else{
+ txNew->tx_complete.second = false;
+ txNew->tts = -1;
+ }
+ }
+ txNew->boundaryProblem.first = FREED;
+
+ }else if ((*it)->boundaryProblem.first < 2 && (*it)->boundaryProblem.second >= 2){
+ // erase the transcript, if it has problem boundary exons only
+ if ((*it)->exon_list.size() == 1 || ((*it)->exon_list.back().feature == "CDS" && countCDS <= 1)){
+ deleteTx(*it, properties);
+ it = overlap.erase(it);
+ it--;
+ continue;
+ }
+ // create txNew
+ Transcript* txNew = createCopyOf(*it, properties, overlap);
- // delete problem exon
- txNew->exon_list.pop_back();
+ string tempFeatureBack = txNew->exon_list.back().feature;
- // change some values of new transcripts for adaption
- if (tempFeatureBack == "CDS"){
- if (txNew->strand == '-'){
- txNew->tl_complete.first = false;
- txNew->tis = txNew->exon_list.back().to;
- }else{
- txNew->tl_complete.second = false;
- txNew->stop_list.clear();
- txNew->tes = txNew->exon_list.back().to;
- }
- }else{
- if (txNew->strand == '-'){
- txNew->tx_complete.first = false;
- txNew->tss = -1;
- }else{
- txNew->tx_complete.second = false;
- txNew->tts = -1;
- }
- }
+ // delete problem exon
+ txNew->exon_list.pop_back();
- txNew->boundaryProblem.first = FREED;
+ // change some values of new transcripts for adaption
+ if (tempFeatureBack == "CDS"){
+ if (txNew->strand == '-'){
+ txNew->tl_complete.first = false;
+ txNew->tis = txNew->exon_list.back().to;
+ }else{
+ txNew->tl_complete.second = false;
+ txNew->stop_list.clear();
+ txNew->tes = txNew->exon_list.back().to;
}
- }
-}
+ }else{
+ if (txNew->strand == '-'){
+ txNew->tx_complete.first = false;
+ txNew->tss = -1;
+ }else{
+ txNew->tx_complete.second = false;
+ txNew->tts = -1;
+ }
+ }
+ txNew->boundaryProblem.second = FREED;
+
+ }else if ((*it)->boundaryProblem.first >= 2 && (*it)->boundaryProblem.second >= 2){
+ // erase the transcript, if it has problem boundary exons only
+ if ((*it)->exon_list.size() <= 2 || ((*it)->exon_list.front().feature == "CDS" && countCDS <= 1) || ((*it)->exon_list.back().feature == "CDS" && countCDS <= 1) || ((*it)->exon_list.front().feature == "CDS" && (*it)->exon_list.back().feature == "CDS" && countCDS <= 2)){
+ deleteTx(*it, properties);
+ it = overlap.erase(it);
+ it--;
+ continue;
+ }
+ Transcript* txNew = createCopyOf(*it, properties, overlap);
-void search_n_destroy_doublings(list<Transcript*> &overlap, Properties &properties, bool abInitio){
- // delete all transcripts that are completly part of another transcript (in particular all exons are also in the other transcript and vice versa); the one with the lesser priority will be deleted
- if (overlap.size() > 1){
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- list<Transcript*>::iterator it_temp = it;
- it_temp++;
- for (list<Transcript*>::iterator itInside = it_temp; itInside != overlap.end(); itInside++){
- if (overlap.size() <= 1){return;}
- pair<bool,bool> who_is_part = is_part_of(*it, *itInside); // <a is in b; b is in a>; if both are true, they are identical
- if (who_is_part.first == true){
- if (who_is_part.second == true){
- if (abInitio){ // fill the supporter list only while the first run of this method
- (*it)->supporter.push_front((*itInside)->originalId);
- (*itInside)->supporter.push_front((*it)->originalId);
- }
-
- if (compare_quality((*it), *itInside)){
- deleteTx((*itInside), properties);
- itInside = overlap.erase(itInside);
- itInside--;
-
- }else{
- deleteTx((*it), properties);
- it = overlap.erase(it);
- itInside = it;
- }
- }else{
- if (abInitio){
- (*itInside)->supporter.push_front((*it)->originalId);
- }
- //it = overlap.erase(it); // deleting throws information away
- //itInside = it;
- }
- }else{
- if (who_is_part.second == true){
- if (abInitio){
- (*it)->supporter.push_front((*itInside)->originalId);
- }
- //itInside = overlap.erase(itInside); // deleting throws information away
- //itInside--;
- }
- }
- }
+ string tempFeatureFront = txNew->exon_list.front().feature;
+
+ // delete problem exon
+ txNew->exon_list.pop_front();
+
+ // change some values of new transcripts for adaption
+ if (tempFeatureFront == "CDS"){
+ if (txNew->strand == '+'){
+ txNew->tl_complete.first = false;
+ txNew->tis = txNew->exon_list.front().from;
+ }else{
+ txNew->tl_complete.second = false;
+ txNew->stop_list.clear();
+ txNew->tes = txNew->exon_list.front().from;
}
- }
-}
+ }else{
+ if (txNew->strand == '+'){
+ txNew->tx_complete.first = false;
+ txNew->tss = -1;
+ }else{
+ txNew->tx_complete.second = false;
+ txNew->tts = -1;
+ }
+ }
-void search_n_destroy_parts(list<Transcript*> &overlap, Properties &properties){
- // delete all transcripts that are part of another transcript
- if (overlap.size() > 1){
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- list<Transcript*>::iterator it_temp = it;
- it_temp++;
- for (list<Transcript*>::iterator itInside = it_temp; itInside != overlap.end(); itInside++){
- if (overlap.size() <= 1){return;}
- pair<bool,bool> who_is_part = is_part_of(*it, *itInside);
-
- if (who_is_part.first == true){
- if (who_is_part.second == true){
- }else{
- deleteTx((*it), properties);
- it = overlap.erase(it);
- itInside = it;
- }
- }else{
- if (who_is_part.second == true){
- deleteTx((*itInside), properties);
- itInside = overlap.erase(itInside);
- itInside--;
- }
- }
- }
+ txNew->boundaryProblem.first = FREED;
+
+ string tempFeatureBack = txNew->exon_list.back().feature;
+
+ // delete problem exon
+ txNew->exon_list.pop_back();
+
+ // change some values of new transcripts for adaption
+ if (tempFeatureBack == "CDS"){
+ if (txNew->strand == '-'){
+ txNew->tl_complete.first = false;
+ txNew->tis = txNew->exon_list.back().to;
+ }else{
+ txNew->tl_complete.second = false;
+ txNew->stop_list.clear();
+ txNew->tes = txNew->exon_list.back().to;
+ }
+ }else{
+ if (txNew->strand == '-'){
+ txNew->tx_complete.first = false;
+ txNew->tss = -1;
+ }else{
+ txNew->tx_complete.second = false;
+ txNew->tts = -1;
}
+ }
+
+ txNew->boundaryProblem.first = FREED;
}
+ }
}
-void join(list<Transcript*> &overlap, char side, Properties &properties){
- // devides an overlap in a list of start/stop codon donors and in an other list of start/stop codon acceptors and joins every pair (one of each list) if they are combinable
- // list<Transcript*> new_overlap_part;
- list<Transcript*> donor;
- list<Transcript*> acceptor;
-
+void search_n_destroy_doublings(list<Transcript*> &overlap, Properties &properties, bool abInitio){
+ // delete all transcripts that are completly part of another transcript (in particular all exons are also in the other transcript and vice versa); the one with the lesser priority will be deleted
+ if (overlap.size() > 1){
for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- if ((*it)->isNotFrameCorrect){continue;}
- if (side == '3'){
- if ((*it)->tl_complete.second){
- donor.push_front(*it);
- }else{
- acceptor.push_front(*it);
+ list<Transcript*>::iterator it_temp = it;
+ it_temp++;
+ for (list<Transcript*>::iterator itInside = it_temp; itInside != overlap.end(); itInside++){
+ if (overlap.size() <= 1){return;}
+ pair<bool,bool> who_is_part = is_part_of(*it, *itInside); // <a is in b; b is in a>; if both are true, they are identical
+ if (who_is_part.first == true){
+ if (who_is_part.second == true){
+ if (abInitio){ // fill the supporter list only while the first run of this method
+ (*it)->supporter.push_front((*itInside)->originalId);
+ (*itInside)->supporter.push_front((*it)->originalId);
}
- }else if (side == '5'){
- if ((*it)->tl_complete.first){
- donor.push_front(*it);
+
+ if (compare_quality((*it), *itInside)){
+ deleteTx((*itInside), properties);
+ itInside = overlap.erase(itInside);
+ itInside--;
+
}else{
- acceptor.push_front(*it);
+ deleteTx((*it), properties);
+ it = overlap.erase(it);
+ itInside = it;
}
- }
- }
-
- for (list<Transcript*>::iterator it = acceptor.begin(); it != acceptor.end(); it++){
- for (list<Transcript*>::iterator it_donor = donor.begin(); it_donor != donor.end(); it_donor++){
- if ((*it)->strand == (*it_donor)->strand){
- bool frontSide = ((*it)->strand == '+' && side == '5') || ((*it)->strand == '-' && side == '3'); // closer to the first base on the dna strand (NOT the start codon position!)
- int fittingCase = isCombinable(*it, *it_donor, frontSide, properties);
- if (fittingCase){
- Transcript* txNew = createCopyOf((*it), properties, overlap);
- joining(*it_donor, (*it)->strand, txNew, fittingCase, properties);
- }
+ }else{
+ if (abInitio){
+ (*itInside)->supporter.push_front((*it)->originalId);
}
+ //it = overlap.erase(it); // deleting throws information away
+ //itInside = it;
+ }
+ }else{
+ if (who_is_part.second == true){
+ if (abInitio){
+ (*it)->supporter.push_front((*itInside)->originalId);
+ }
+ //itInside = overlap.erase(itInside); // deleting throws information away
+ //itInside--;
+ }
}
+ }
}
+ }
+}
- // UTR joining:
- list<Transcript*> donorUTR;
- list<Transcript*> acceptorUTR;
+void search_n_destroy_parts(list<Transcript*> &overlap, Properties &properties){
+ // delete all transcripts that are part of another transcript
+ if (overlap.size() > 1){
for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- if (side == '3'){
- if ((*it)->tx_complete.second){
- donorUTR.push_front(*it);
- }else if ((*it)->tl_complete.second){
- acceptorUTR.push_front(*it);
- }
- }else if (side == '5'){
- if ((*it)->tx_complete.first){
- donorUTR.push_front(*it);
- }else if ((*it)->tl_complete.first){
- acceptorUTR.push_front(*it);
- }
+ list<Transcript*>::iterator it_temp = it;
+ it_temp++;
+ for (list<Transcript*>::iterator itInside = it_temp; itInside != overlap.end(); itInside++){
+ if (overlap.size() <= 1){return;}
+ pair<bool,bool> who_is_part = is_part_of(*it, *itInside);
+
+ if (who_is_part.first == true){
+ if (who_is_part.second == true){
+ }else{
+ deleteTx((*it), properties);
+ it = overlap.erase(it);
+ itInside = it;
+ }
+ }else{
+ if (who_is_part.second == true){
+ deleteTx((*itInside), properties);
+ itInside = overlap.erase(itInside);
+ itInside--;
+ }
}
+ }
+ }
+ }
+}
+void join(list<Transcript*> &overlap, char side, Properties &properties){
+ // devides an overlap in a list of start/stop codon donors and in an other list of start/stop codon acceptors and joins every pair (one of each list) if they are combinable
+ // list<Transcript*> new_overlap_part;
+
+ list<Transcript*> donor;
+ list<Transcript*> acceptor;
+
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ if ((*it)->isNotFrameCorrect){continue;}
+ if (side == '3'){
+ if ((*it)->tl_complete.second){
+ donor.push_front(*it);
+ }else{
+ acceptor.push_front(*it);
+ }
+ }else if (side == '5'){
+ if ((*it)->tl_complete.first){
+ donor.push_front(*it);
+ }else{
+ acceptor.push_front(*it);
+ }
}
+ }
- for (list<Transcript*>::iterator it = acceptorUTR.begin(); it != acceptorUTR.end(); it++){
- for (list<Transcript*>::iterator it_donor = donorUTR.begin(); it_donor != donorUTR.end(); it_donor++){
- if ((*it)->strand == (*it_donor)->strand){
- bool frontSide = ((*it)->strand == '+' && side == '5') || ((*it)->strand == '-' && side == '3');
- int fittingCase = 0;
- if (frontSide){
- if (((*it)->strand == '+' && (*it)->tis == (*it_donor)->tis) || ((*it)->strand == '-' && (*it)->tes == (*it_donor)->tes)){
-
- Transcript temp = *(*it);
- Transcript tempD = *(*it_donor);
- bool eraseExon = false;
- for (list<Exon>::iterator iti = temp.exon_list.begin(); iti != temp.exon_list.end(); iti++){
- if ((*iti).feature == "CDS"){
- eraseExon = true;
- }
- if (eraseExon){
- temp.exon_list.erase(iti);
- iti--;
- }
- }
- eraseExon = false;
- for (list<Exon>::iterator iti = tempD.exon_list.begin(); iti != tempD.exon_list.end(); iti++){
- if ((*iti).feature == "CDS"){
- eraseExon = true;
- }
- if (eraseExon){
- tempD.exon_list.erase(iti);
- iti--;
- }
- }
- if ((*it)->strand == '+'){
- temp.tes = (*it_donor)->tes;
- }else{
- temp.tis = (*it_donor)->tis;
- }
- pair<bool,bool> partBool;
- if (temp.exon_list.size() > 0){
- partBool = is_part_of(&temp, &tempD);
- }else{
- partBool.first = true;
- partBool.second = true;
- }
- if (partBool.first){
- fittingCase = 4;
- }
- }
- }else{
- if (((*it)->strand == '-' && (*it)->tis == (*it_donor)->tis) || ((*it)->strand == '+' && (*it)->tes == (*it_donor)->tes)){
-
- Transcript temp = *(*it);
- Transcript tempD = *(*it_donor);
- string lastFeature = "";
- for (list<Exon>::iterator iti = temp.exon_list.begin(); iti != temp.exon_list.end(); iti++){
- if (lastFeature == "CDS" && (*iti).feature != "CDS"){
- break;
- }
- lastFeature = (*iti).feature;
- temp.exon_list.erase(iti);
- iti--;
- }
- lastFeature = "";
- for (list<Exon>::iterator iti = tempD.exon_list.begin(); iti != tempD.exon_list.end(); iti++){
- if (lastFeature == "CDS" && (*iti).feature != "CDS"){
- break;
- }
- lastFeature = (*iti).feature;
- tempD.exon_list.erase(iti);
- iti--;
- }
- if ((*it)->strand == '+'){
- temp.tis = (*it_donor)->tis;
- }else{
- temp.tes = (*it_donor)->tes;
- }
- pair<bool,bool> partBool;
- if (temp.exon_list.size() > 0){
- partBool = is_part_of(&temp, &tempD);
- }else{
- partBool.first = true;
- partBool.second = true;
- }
-
- if (partBool.first){
- fittingCase = 2;
- }
- }
- }
- if (fittingCase){
- Transcript* txNew = createCopyOf((*it), properties, overlap);
- joining(*it_donor, (*it)->strand, txNew, fittingCase, properties);
- }
- }
+ for (list<Transcript*>::iterator it = acceptor.begin(); it != acceptor.end(); it++){
+ for (list<Transcript*>::iterator it_donor = donor.begin(); it_donor != donor.end(); it_donor++){
+ if ((*it)->strand == (*it_donor)->strand){
+ bool frontSide = ((*it)->strand == '+' && side == '5') || ((*it)->strand == '-' && side == '3'); // closer to the first base on the dna strand (NOT the start codon position!)
+ int fittingCase = isCombinable(*it, *it_donor, frontSide, properties);
+ if (fittingCase){
+ Transcript* txNew = createCopyOf((*it), properties, overlap);
+ joining(*it_donor, (*it)->strand, txNew, fittingCase, properties);
}
+ }
}
-}
-
-void joining(Transcript* t2, char strand, Transcript* txNew, int fittingCase, Properties &properties){
-
- // joins transcripts in one direction so that every suitable exon will be transferred and returns a new "joined" transcript without deleting the old ones
+ }
- int lastPositionInOriginal = txNew->exon_list.back().to;
- int firstPositionInOriginal = txNew->exon_list.front().from;
- string lastPosfeature = txNew->exon_list.back().feature;
- string firstPosfeature = txNew->exon_list.front().feature;
+ search_n_destroy_doublings(overlap, properties, false);
- int nrOfJoinedCDS = 0;
- int nrOfCoreCDS = 0;
- bool inside = false;
- for (list<Exon>::iterator it = txNew->exon_list.begin(); it != txNew->exon_list.end(); it++){
- if (!inside && txNew->outerCds.first && txNew->outerCds.first->from == (*it).from && txNew->outerCds.first->to == (*it).to && txNew->outerCds.first->frame == (*it).frame){
- inside = true;
- }
- if (inside){
- nrOfCoreCDS++;
- if (txNew->outerCds.second->from == (*it).from && txNew->outerCds.second->to == (*it).to && txNew->outerCds.second->frame == (*it).frame){break;}
- }
+ // UTR joining:
+ list<Transcript*> donorUTR;
+ list<Transcript*> acceptorUTR;
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ if (side == '3'){
+ if ((*it)->tx_complete.second){
+ donorUTR.push_front(*it);
+ }else if ((*it)->tl_complete.second){
+ acceptorUTR.push_front(*it);
+ }
+ }else if (side == '5'){
+ if ((*it)->tx_complete.first){
+ donorUTR.push_front(*it);
+ }else if ((*it)->tl_complete.first){
+ acceptorUTR.push_front(*it);
+ }
}
-
- bool are_at_add_part;
- list<Exon> temp_exon_list;
- temp_exon_list.clear();
- switch (fittingCase){
- case 0:
- cerr << "WARNING: shouldn't happen (in joining())!" << endl;
- break;
- case 1:
- if (strand == '+'){
- if (txNew->stop_list.empty()){txNew->stop_list = t2->stop_list;}else{cerr << "WARNING: existing stop list should be replaced (in joining())!1" << endl;}
- txNew->tts = t2->tts;
- txNew->tx_complete.second = t2->tx_complete.second;
- txNew->tes = t2->tes;
- txNew->tl_complete.second = t2->tl_complete.second;
- txNew->joinpartner.second = t2->originalId;
- }else{
- txNew->tss = t2->tss;
- txNew->tx_complete.first = t2->tx_complete.first;
- txNew->tis = t2->tis;
- txNew->tl_complete.first = t2->tl_complete.first;
- txNew->joinpartner.first = t2->originalId;
- }
- are_at_add_part = false;
- for (list<Exon>::iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
- if (are_at_add_part){
- txNew->exon_list.push_back(*it);
- if ((*it).feature == "CDS"){nrOfJoinedCDS++;}
+ }
+
+ for (list<Transcript*>::iterator it = acceptorUTR.begin(); it != acceptorUTR.end(); it++){
+ for (list<Transcript*>::iterator it_donor = donorUTR.begin(); it_donor != donorUTR.end(); it_donor++){
+ if ((*it)->strand == (*it_donor)->strand){
+ bool frontSide = ((*it)->strand == '+' && side == '5') || ((*it)->strand == '-' && side == '3');
+ int fittingCase = 0;
+ if (frontSide){
+ if (((*it)->strand == '+' && (*it)->tis == (*it_donor)->tis) || ((*it)->strand == '-' && (*it)->tes == (*it_donor)->tes)){
+
+ Transcript temp = *(*it);
+ Transcript tempD = *(*it_donor);
+ bool eraseExon = false;
+ for (list<Exon>::iterator iti = temp.exon_list.begin(); iti != temp.exon_list.end(); iti++){
+ if ((*iti).feature == "CDS"){
+ eraseExon = true;
+ }
+ if (eraseExon){
+ temp.exon_list.erase(iti);
+ iti--;
+ }
}
- if (lastPositionInOriginal >= (*it).from && lastPositionInOriginal <= (*it).to){
-// txNew->exon_list.back().to = (*it).to;
-// txNew->exon_list.back().score = (*it).score;
-// txNew->exon_list.back().rangeToBoundary = (*it).rangeToBoundary;
- if (strand == '-'){txNew->exon_list.back().frame = (*it).frame;}
- are_at_add_part = true;
+ eraseExon = false;
+ for (list<Exon>::iterator iti = tempD.exon_list.begin(); iti != tempD.exon_list.end(); iti++){
+ if ((*iti).feature == "CDS"){
+ eraseExon = true;
+ }
+ if (eraseExon){
+ tempD.exon_list.erase(iti);
+ iti--;
+ }
}
- }
- txNew->updateExonSpecificValues(t2, fittingCase);
- break;
- case 2:
- if (strand == '+'){
- if (txNew->stop_list.empty()){txNew->stop_list = t2->stop_list;}else{/*cerr << "WARNING: existing stop list should be replaced (in joining())!2" << endl;*/}
- txNew->tts = t2->tts;
- txNew->tx_complete.second = t2->tx_complete.second;
- txNew->tes = t2->tes;
- txNew->tl_complete.second = t2->tl_complete.second;
- txNew->joinpartner.second = t2->originalId;
- }else{
- txNew->tss = t2->tss;
- txNew->tx_complete.first = t2->tx_complete.first;
- txNew->tis = t2->tis;
- txNew->tl_complete.first = t2->tl_complete.first;
- txNew->joinpartner.first = t2->originalId;
- }
- are_at_add_part = false;
- for (list<Exon>::iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
- if (lastPositionInOriginal <= ((*it).from - (int) properties.minimumIntronLength) || ( (*it).feature != "CDS" && lastPosfeature == "CDS" && lastPositionInOriginal <= ((*it).from - 1) )){
- are_at_add_part = true;
+ if ((*it)->strand == '+'){
+ temp.tes = (*it_donor)->tes;
+ }else{
+ temp.tis = (*it_donor)->tis;
}
- if (are_at_add_part){
- txNew->exon_list.push_back(*it);
- if ((*it).feature == "CDS"){nrOfJoinedCDS++;}
+ pair<bool,bool> partBool;
+ if (temp.exon_list.size() > 0){
+ partBool = is_part_of(&temp, &tempD);
+ }else{
+ partBool.first = true;
+ partBool.second = true;
}
- }
- txNew->updateExonSpecificValues(t2, fittingCase);
- break;
- case 3:
- if (strand == '+'){
- txNew->tss = t2->tss;
- txNew->tx_complete.first = t2->tx_complete.first;
- txNew->tis = t2->tis;
- txNew->tl_complete.first = t2->tl_complete.first;
- txNew->joinpartner.first = t2->originalId;
+ if (partBool.first){
+ fittingCase = 4;
+ }
+ }
}else{
- if (txNew->stop_list.empty()){txNew->stop_list = t2->stop_list;}else{cerr << "WARNING: existing stop list should be replaced (in joining())!3" << endl;}
- txNew->tts = t2->tts;
- txNew->tx_complete.second = t2->tx_complete.second;
- txNew->tes = t2->tes;
- txNew->tl_complete.second = t2->tl_complete.second;
- txNew->joinpartner.second = t2->originalId;
- }
- for (list<Exon>::iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
- if (firstPositionInOriginal >= (*it).from && firstPositionInOriginal <= (*it).to){
-// txNew->exon_list.front().from = (*it).from;
-// txNew->exon_list.front().score = (*it).score;
-// txNew->exon_list.front().rangeToBoundary = (*it).rangeToBoundary;
- if (strand == '+'){txNew->exon_list.front().frame = (*it).frame;}
- txNew->exon_list.merge(temp_exon_list);
+ if (((*it)->strand == '-' && (*it)->tis == (*it_donor)->tis) || ((*it)->strand == '+' && (*it)->tes == (*it_donor)->tes)){
+
+ Transcript temp = *(*it);
+ Transcript tempD = *(*it_donor);
+ string lastFeature = "";
+ for (list<Exon>::iterator iti = temp.exon_list.begin(); iti != temp.exon_list.end(); iti++){
+ if (lastFeature == "CDS" && (*iti).feature != "CDS"){
break;
+ }
+ lastFeature = (*iti).feature;
+ temp.exon_list.erase(iti);
+ iti--;
}
- temp_exon_list.push_back(*it);
- if ((*it).feature == "CDS"){nrOfJoinedCDS++;}
- }
- txNew->updateExonSpecificValues(t2, fittingCase);
- break;
- case 4:
- if (strand == '+'){
- txNew->tss = t2->tss;
- txNew->tx_complete.first = t2->tx_complete.first;
- txNew->tis = t2->tis;
- txNew->tl_complete.first = t2->tl_complete.first;
- txNew->joinpartner.first = t2->originalId;
- }else{
- if (txNew->stop_list.empty()){txNew->stop_list = t2->stop_list;}else{/*cerr << "WARNING: existing stop list should be replaced (in joining())!4" << endl;*/}
- txNew->tts = t2->tts;
- txNew->tx_complete.second = t2->tx_complete.second;
- txNew->tes = t2->tes;
- txNew->tl_complete.second = t2->tl_complete.second;
- txNew->joinpartner.second = t2->originalId;
- }
- for (list<Exon>::iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
- if ((!((*it).feature != "CDS" && firstPosfeature == "CDS") && firstPositionInOriginal < ((*it).to + (int) properties.minimumIntronLength)) || ( (*it).feature != "CDS" && firstPosfeature == "CDS" && firstPositionInOriginal < ((*it).to + 1) )){
- txNew->exon_list.merge(temp_exon_list);
+ lastFeature = "";
+ for (list<Exon>::iterator iti = tempD.exon_list.begin(); iti != tempD.exon_list.end(); iti++){
+ if (lastFeature == "CDS" && (*iti).feature != "CDS"){
break;
+ }
+ lastFeature = (*iti).feature;
+ tempD.exon_list.erase(iti);
+ iti--;
+ }
+ if ((*it)->strand == '+'){
+ temp.tis = (*it_donor)->tis;
+ }else{
+ temp.tes = (*it_donor)->tes;
}
- temp_exon_list.push_back(*it);
- if ((*it).feature == "CDS"){nrOfJoinedCDS++;}
+ pair<bool,bool> partBool;
+ if (temp.exon_list.size() > 0){
+ partBool = is_part_of(&temp, &tempD);
+ }else{
+ partBool.first = true;
+ partBool.second = true;
+ }
+
+ if (partBool.first){
+ fittingCase = 2;
+ }
+ }
+ }
+ if (fittingCase){
+ Transcript* txNew = createCopyOf((*it), properties, overlap);
+ joining(*it_donor, (*it)->strand, txNew, fittingCase, properties);
}
- txNew->updateExonSpecificValues(t2, fittingCase);
+ }
+ }
+ }
+}
+
+void joining(Transcript* t2, char strand, Transcript* txNew, int fittingCase, Properties &properties){
+
+ // joins transcripts in one direction so that every suitable exon will be transferred and returns a new "joined" transcript without deleting the old ones
+
+ int lastPositionInOriginal = txNew->exon_list.back().to;
+ int firstPositionInOriginal = txNew->exon_list.front().from;
+ string lastPosfeature = txNew->exon_list.back().feature;
+ string firstPosfeature = txNew->exon_list.front().feature;
+
+ int nrOfJoinedCDS = 0;
+ int nrOfCoreCDS = 0;
+ bool inside = false;
+ for (list<Exon>::iterator it = txNew->exon_list.begin(); it != txNew->exon_list.end(); it++){
+ if (!inside && txNew->outerCds.first && txNew->outerCds.first->from == (*it).from && txNew->outerCds.first->to == (*it).to && txNew->outerCds.first->frame == (*it).frame){
+ inside = true;
+ }
+ if (inside){
+ nrOfCoreCDS++;
+ if (txNew->outerCds.second->from == (*it).from && txNew->outerCds.second->to == (*it).to && txNew->outerCds.second->frame == (*it).frame){break;}
+ }
+ }
+
+ bool are_at_add_part;
+ list<Exon> temp_exon_list;
+ temp_exon_list.clear();
+ switch (fittingCase){
+ case 0:
+ cerr << "WARNING: shouldn't happen (in joining())!" << endl;
+ break;
+ case 1:
+ if (strand == '+'){
+ if (txNew->stop_list.empty()){txNew->stop_list = t2->stop_list;}else{cerr << "WARNING: existing stop list should be replaced (in joining())!1" << endl;}
+ txNew->tts = t2->tts;
+ txNew->tx_complete.second = t2->tx_complete.second;
+ txNew->tes = t2->tes;
+ txNew->tl_complete.second = t2->tl_complete.second;
+ txNew->joinpartner.second = t2->originalId;
+ }else{
+ txNew->tss = t2->tss;
+ txNew->tx_complete.first = t2->tx_complete.first;
+ txNew->tis = t2->tis;
+ txNew->tl_complete.first = t2->tl_complete.first;
+ txNew->joinpartner.first = t2->originalId;
+ }
+ are_at_add_part = false;
+ for (list<Exon>::iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
+ if (are_at_add_part){
+ txNew->exon_list.push_back(*it);
+ if ((*it).feature == "CDS"){nrOfJoinedCDS++;}
+ }
+ if (lastPositionInOriginal >= (*it).from && lastPositionInOriginal <= (*it).to){
+ // txNew->exon_list.back().to = (*it).to;
+ // txNew->exon_list.back().score = (*it).score;
+ // txNew->exon_list.back().rangeToBoundary = (*it).rangeToBoundary;
+ if (strand == '-'){txNew->exon_list.back().frame = (*it).frame;}
+ are_at_add_part = true;
+ }
+ }
+ txNew->updateExonSpecificValues(t2, fittingCase);
+ break;
+ case 2:
+ if (strand == '+'){
+ if (txNew->stop_list.empty()){txNew->stop_list = t2->stop_list;}else{/*cerr << "WARNING: existing stop list should be replaced (in joining())!2" << endl;*/}
+ txNew->tts = t2->tts;
+ txNew->tx_complete.second = t2->tx_complete.second;
+ txNew->tes = t2->tes;
+ txNew->tl_complete.second = t2->tl_complete.second;
+ txNew->joinpartner.second = t2->originalId;
+ }else{
+ txNew->tss = t2->tss;
+ txNew->tx_complete.first = t2->tx_complete.first;
+ txNew->tis = t2->tis;
+ txNew->tl_complete.first = t2->tl_complete.first;
+ txNew->joinpartner.first = t2->originalId;
+ }
+ are_at_add_part = false;
+ for (list<Exon>::iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
+ if (lastPositionInOriginal <= ((*it).from - (int) properties.minimumIntronLength) || ( (*it).feature != "CDS" && lastPosfeature == "CDS" && lastPositionInOriginal <= ((*it).from - 1) )){
+ are_at_add_part = true;
+ }
+ if (are_at_add_part){
+ txNew->exon_list.push_back(*it);
+ if ((*it).feature == "CDS"){nrOfJoinedCDS++;}
+ }
+ }
+ txNew->updateExonSpecificValues(t2, fittingCase);
+ break;
+ case 3:
+ if (strand == '+'){
+ txNew->tss = t2->tss;
+ txNew->tx_complete.first = t2->tx_complete.first;
+ txNew->tis = t2->tis;
+ txNew->tl_complete.first = t2->tl_complete.first;
+ txNew->joinpartner.first = t2->originalId;
+ }else{
+ if (txNew->stop_list.empty()){txNew->stop_list = t2->stop_list;}else{cerr << "WARNING: existing stop list should be replaced (in joining())!3" << endl;}
+ txNew->tts = t2->tts;
+ txNew->tx_complete.second = t2->tx_complete.second;
+ txNew->tes = t2->tes;
+ txNew->tl_complete.second = t2->tl_complete.second;
+ txNew->joinpartner.second = t2->originalId;
+ }
+ for (list<Exon>::iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
+ if (firstPositionInOriginal >= (*it).from && firstPositionInOriginal <= (*it).to){
+ // txNew->exon_list.front().from = (*it).from;
+ // txNew->exon_list.front().score = (*it).score;
+ // txNew->exon_list.front().rangeToBoundary = (*it).rangeToBoundary;
+ if (strand == '+'){txNew->exon_list.front().frame = (*it).frame;}
break;
- default:
- cerr << "WARNING: unexpected case (in joining())!" << endl;
+ }
+ temp_exon_list.push_back(*it);
+ if ((*it).feature == "CDS"){nrOfJoinedCDS++;}
}
+ txNew->exon_list.merge(temp_exon_list);
- if (nrOfJoinedCDS > nrOfCoreCDS){
- txNew->priority = t2->priority;
+ txNew->updateExonSpecificValues(t2, fittingCase);
+ break;
+ case 4:
+ if (strand == '+'){
+ txNew->tss = t2->tss;
+ txNew->tx_complete.first = t2->tx_complete.first;
+ txNew->tis = t2->tis;
+ txNew->tl_complete.first = t2->tl_complete.first;
+ txNew->joinpartner.first = t2->originalId;
+ }else{
+ if (txNew->stop_list.empty()){txNew->stop_list = t2->stop_list;}else{/*cerr << "WARNING: existing stop list should be replaced (in joining())!4" << endl;*/}
+ txNew->tts = t2->tts;
+ txNew->tx_complete.second = t2->tx_complete.second;
+ txNew->tes = t2->tes;
+ txNew->tl_complete.second = t2->tl_complete.second;
+ txNew->joinpartner.second = t2->originalId;
+ }
+ for (list<Exon>::iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
+ if ((!((*it).feature != "CDS" && firstPosfeature == "CDS") && firstPositionInOriginal < ((*it).to + (int) properties.minimumIntronLength)) || ( (*it).feature != "CDS" && firstPosfeature == "CDS" && firstPositionInOriginal < ((*it).to + 1) ) ){
+ break;
+ }
+ temp_exon_list.push_back(*it);
+ if ((*it).feature == "CDS"){nrOfJoinedCDS++;}
}
+ txNew->exon_list.merge(temp_exon_list);
+
+ txNew->updateExonSpecificValues(t2, fittingCase);
+ break;
+ default:
+ cerr << "WARNING: unexpected case (in joining())!" << endl;
+ }
+
+ if (nrOfJoinedCDS > nrOfCoreCDS){
+ txNew->priority = t2->priority;
+ }
}
int is_combinable(Transcript const* t1, Transcript const* t2, char strand, char side, Properties &properties){
- // is true, if the first exon which is minimal the minimumIntronLength away from the last exon of the other transcript in the appropriate direction
- // && the exons at these positions are frame-compatible
- // && the transcripts are overlapping // maybe we can improve something here, that combinable non-overlaping transcripts gets true (but be carefull)
-
- if ((max( (*t1).tis,(*t1).tes) < min((*t2).tis,(*t2).tes)) || (min((*t1).tis,(*t1).tes) > max((*t2).tis,(*t2).tes))){
- return 0;
- }
- if ((strand == '+' && side == '3') || (strand == '-' && side == '5')){
- for (list<Exon>::const_iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
- if (((*t1).exon_list.back().to >= (*it).from) && ((*t1).exon_list.back().to <= (*it).to)){
- if ((*t1).exon_list.back().frame == -1 && (*it).frame == -1){return 1;}
- else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
- if ((strand == '+') && ((3 - (((*t1).exon_list.back().to - (*t1).exon_list.back().from) - (*t1).exon_list.back().frame) % 3) % 3) == ((3 - (((*t1).exon_list.back().to - (*it).from) - (*it).frame) % 3) % 3) ){
- return 1;
- }else if ((strand == '-') && (*t1).exon_list.back().frame == ((3 - (((*it).to - (*t1).exon_list.back().to) - (*it).frame) % 3) % 3) ){
- return 1;
- }else{
- return 0;
- }
- }else{
- if ((*t1).exon_list.back().to <= ((*it).from - (int) properties.minimumIntronLength)){
- if ((strand == '+') && ((*it).frame == (3 - ( ((*t1).exon_list.back().to - (*t1).exon_list.back().from + 1) - (*t1).exon_list.back().frame) % 3) % 3)){
- return 2;
- }else if ((strand == '-') && ((*t1).exon_list.back().frame == (3 - ( ((*it).to - (*it).from + 1) - (*it).frame) % 3) % 3)){
- return 2;
- }else{
- return 0;
- }
- }
- }
+ // is true, if the first exon which is minimal the minimumIntronLength away from the last exon of the other transcript in the appropriate direction
+ // && the exons at these positions are frame-compatible
+ // && the transcripts are overlapping // maybe we can improve something here, that combinable non-overlaping transcripts gets true (but be carefull)
+
+ if ((max( (*t1).tis,(*t1).tes) < min((*t2).tis,(*t2).tes)) || (min((*t1).tis,(*t1).tes) > max((*t2).tis,(*t2).tes))){
+ return 0;
+ }
+ if ((strand == '+' && side == '3') || (strand == '-' && side == '5')){
+ for (list<Exon>::const_iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
+ if (((*t1).exon_list.back().to >= (*it).from) && ((*t1).exon_list.back().to <= (*it).to)){
+ if ((*t1).exon_list.back().frame == -1 && (*it).frame == -1){return 1;}
+ else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
+ if ((strand == '+') && ((3 - (((*t1).exon_list.back().to - (*t1).exon_list.back().from) - (*t1).exon_list.back().frame) % 3) % 3) == ((3 - (((*t1).exon_list.back().to - (*it).from) - (*it).frame) % 3) % 3) ){
+ return 1;
+ }else if ((strand == '-') && (*t1).exon_list.back().frame == ((3 - (((*it).to - (*t1).exon_list.back().to) - (*it).frame) % 3) % 3) ){
+ return 1;
+ }else{
+ return 0;
}
- }else if ((strand == '+' && side == '5') || (strand == '-' && side == '3')){
- for (list<Exon>::const_iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
- if (((*t1).exon_list.front().from >= (*it).from) && ((*t1).exon_list.front().from <= (*it).to)){
- if ((*t1).exon_list.front().frame == -1 && (*it).frame == -1){return 3;}
- else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
- if ( (strand == '-') && ((3 - (((*t1).exon_list.front().to - (*t1).exon_list.front().from) - (*t1).exon_list.front().frame) % 3) % 3) == ((3 - (((*it).to - (*t1).exon_list.front().from) - (*it).frame) % 3) % 3) ){
- return 3;
- }else if ( (strand == '+') && (*t1).exon_list.front().frame == ((3 - (((*t1).exon_list.front().from - (*it).from) - (*it).frame) % 3) % 3) ){
- return 3;
- }else{
- return 0;
- }
- }else{
- if ((*t1).exon_list.front().from < ((*it).to + (int) properties.minimumIntronLength)){
- if (it != t2->exon_list.begin()){
- it--;
- }else{
- return 0;
- }
- if ((strand == '-') && ((*it).frame == (3 - ( ((*t1).exon_list.front().to - (*t1).exon_list.front().from + 1) - (*t1).exon_list.front().frame) % 3) % 3)){
- return 4;
- }else if ((strand == '+') && ((*t1).exon_list.front().frame == (3 - ( ((*it).to - (*it).from + 1) - (*it).frame) % 3) % 3)){
- return 4;
- }else{
- return 0;
- }
- }
- }
+ }else{
+ if ((*t1).exon_list.back().to <= ((*it).from - (int) properties.minimumIntronLength)){
+ if ((strand == '+') && ((*it).frame == (3 - ( ((*t1).exon_list.back().to - (*t1).exon_list.back().from + 1) - (*t1).exon_list.back().frame) % 3) % 3)){
+ return 2;
+ }else if ((strand == '-') && ((*t1).exon_list.back().frame == (3 - ( ((*it).to - (*it).from + 1) - (*it).frame) % 3) % 3)){
+ return 2;
+ }else{
+ return 0;
+ }
}
- }else{ // no '+' or '-' strand
- return 0; // here we have an unexpected case and so we dont wanna combine
+ }
}
- return 0;
+ }else if ((strand == '+' && side == '5') || (strand == '-' && side == '3')){
+ for (list<Exon>::const_iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
+ if (((*t1).exon_list.front().from >= (*it).from) && ((*t1).exon_list.front().from <= (*it).to)){
+ if ((*t1).exon_list.front().frame == -1 && (*it).frame == -1){return 3;}
+ else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
+ if ( (strand == '-') && ((3 - (((*t1).exon_list.front().to - (*t1).exon_list.front().from) - (*t1).exon_list.front().frame) % 3) % 3) == ((3 - (((*it).to - (*t1).exon_list.front().from) - (*it).frame) % 3) % 3) ){
+ return 3;
+ }else if ( (strand == '+') && (*t1).exon_list.front().frame == ((3 - (((*t1).exon_list.front().from - (*it).from) - (*it).frame) % 3) % 3) ){
+ return 3;
+ }else{
+ return 0;
+ }
+ }else{
+ if ((*t1).exon_list.front().from < ((*it).to + (int) properties.minimumIntronLength)){
+ if (it != t2->exon_list.begin()){
+ it--;
+ }else{
+ return 0;
+ }
+ if ((strand == '-') && ((*it).frame == (3 - ( ((*t1).exon_list.front().to - (*t1).exon_list.front().from + 1) - (*t1).exon_list.front().frame) % 3) % 3)){
+ return 4;
+ }else if ((strand == '+') && ((*t1).exon_list.front().frame == (3 - ( ((*it).to - (*it).from + 1) - (*it).frame) % 3) % 3)){
+ return 4;
+ }else{
+ return 0;
+ }
+ }
+ }
+ }
+ }else{ // no '+' or '-' strand
+ return 0; // here we have an unexpected case and so we dont wanna combine
+ }
+ return 0;
}
pair<bool,bool> is_part_of(Transcript const* t1, Transcript const* t2){
- // is true,false or false,true if one transcript contains the other completely
- // is true,true if the transcripts are equal in exons // this case could completly replace compare_transcripts
- int UTRtoleranceWindow = 10;
- bool t1_is_part = true;
- bool t2_is_part = true;
- if (t1->strand != t2->strand){
- t1_is_part = false;
- t2_is_part = false;
- }
-
- if (t1->exon_list.size() > t2->exon_list.size()){
+ // is true,false or false,true if one transcript contains the other completely
+ // is true,true if the transcripts are equal in exons // this case could completly replace compare_transcripts
+ int UTRtoleranceWindow = 10;
+ bool t1_is_part = true;
+ bool t2_is_part = true;
+ if (t1->strand != t2->strand){
+ t1_is_part = false;
+ t2_is_part = false;
+ }
+
+ if (t1->exon_list.size() > t2->exon_list.size()){
+ t1_is_part = false;
+ }
+ if (t1->exon_list.size() < t2->exon_list.size()){
+ t2_is_part = false;
+ }
+ if (t1->tl_complete.first && t2->tl_complete.first && t1->tis != t2->tis){
+ t1_is_part = false;
+ t2_is_part = false;
+ }
+ if (t1->tl_complete.second && t2->tl_complete.second && t1->tes != t2->tes){
+ t1_is_part = false;
+ t2_is_part = false;
+ }
+ list<Exon>::const_iterator it1 = t1->exon_list.begin();
+ list<Exon>::const_iterator it2 = t2->exon_list.begin();
+ while (t1_is_part == true || t2_is_part == true){
+ if ((*it1).from == (*it2).from){
+ if((*it1).to == (*it2).to && (*it1).frame == (*it2).frame){ // same start and same stop of exon
+ it1++;
+ it2++;
+ }
+ else{ // same start but diffrent stop of exon
+ if ((*it1).feature != "CDS" && (*it2).feature != "CDS" && (*it1).to <= (*it2).to+UTRtoleranceWindow && (*it1).to >= (*it2).to-UTRtoleranceWindow){
+ it1++;
+ it2++;
+ }else{
+ t1_is_part = false;
+ t2_is_part = false;
+ break;
+ }
+ }
+ }else if ((*it1).to == (*it2).to){ // different start but same stop of exon
+ if ((*it1).feature != "CDS" && (*it2).feature != "CDS" && (*it1).from <= (*it2).from+UTRtoleranceWindow && (*it1).from >= (*it2).from-UTRtoleranceWindow){
+ it1++;
+ it2++;
+ }else{
t1_is_part = false;
- }
- if (t1->exon_list.size() < t2->exon_list.size()){
t2_is_part = false;
- }
- if (t1->tl_complete.first && t2->tl_complete.first && t1->tis != t2->tis){
- t1_is_part = false;
+ break;
+ }
+ }else if ((*it1).from > (*it2).from){ // different start and different stop of exon AND exon1 is behind exon2
+ if ((*it1).feature != "CDS" && (*it2).feature != "CDS" && (*it1).from <= (*it2).from+UTRtoleranceWindow && (*it1).from >= (*it2).from-UTRtoleranceWindow && (*it1).to <= (*it2).to+UTRtoleranceWindow && (*it1).to >= (*it2).to-UTRtoleranceWindow){
+ it1++;
+ }else{
t2_is_part = false;
- }
- if (t1->tl_complete.second && t2->tl_complete.second && t1->tes != t2->tes){
+ }
+ it2++;
+ }else{ // different start and different stop of exon AND exon1 is in front of exon2
+ if ((*it1).feature != "CDS" && (*it2).feature != "CDS" && (*it1).from <= (*it2).from+UTRtoleranceWindow && (*it1).from >= (*it2).from-UTRtoleranceWindow && (*it1).to <= (*it2).to+UTRtoleranceWindow && (*it1).to >= (*it2).to-UTRtoleranceWindow){
+ it2++;
+ }else{
t1_is_part = false;
- t2_is_part = false;
+ }
+ it1++;
}
- list<Exon>::const_iterator it1 = t1->exon_list.begin();
- list<Exon>::const_iterator it2 = t2->exon_list.begin();
- while (t1_is_part == true || t2_is_part == true){
- if ((*it1).from == (*it2).from){
- if((*it1).to == (*it2).to && (*it1).frame == (*it2).frame){ // same start and same stop of exon
- it1++;
- it2++;
- }
- else{ // same start but diffrent stop of exon
- if ((*it1).feature != "CDS" && (*it2).feature != "CDS" && (*it1).to <= (*it2).to+UTRtoleranceWindow && (*it1).to >= (*it2).to-UTRtoleranceWindow){
- it1++;
- it2++;
- }else{
- t1_is_part = false;
- t2_is_part = false;
- break;
- }
- }
- }else if ((*it1).to == (*it2).to){ // different start but same stop of exon
- if ((*it1).feature != "CDS" && (*it2).feature != "CDS" && (*it1).from <= (*it2).from+UTRtoleranceWindow && (*it1).from >= (*it2).from-UTRtoleranceWindow){
- it1++;
- it2++;
- }else{
- t1_is_part = false;
- t2_is_part = false;
- break;
- }
- }else if ((*it1).from > (*it2).from){ // different start and different stop of exon AND exon1 is behind exon2
- if ((*it1).feature != "CDS" && (*it2).feature != "CDS" && (*it1).from <= (*it2).from+UTRtoleranceWindow && (*it1).from >= (*it2).from-UTRtoleranceWindow && (*it1).to <= (*it2).to+UTRtoleranceWindow && (*it1).to >= (*it2).to-UTRtoleranceWindow){
- it1++;
- }else{
- t2_is_part = false;
- }
- it2++;
- }else{ // different start and different stop of exon AND exon1 is in front of exon2
- if ((*it1).feature != "CDS" && (*it2).feature != "CDS" && (*it1).from <= (*it2).from+UTRtoleranceWindow && (*it1).from >= (*it2).from-UTRtoleranceWindow && (*it1).to <= (*it2).to+UTRtoleranceWindow && (*it1).to >= (*it2).to-UTRtoleranceWindow){
- it2++;
- }else{
- t1_is_part = false;
- }
- it1++;
- }
- if (!t1_is_part && !t2_is_part){break;} // both transcripts are not part of the other one
- if (it1 == t1->exon_list.end() && it2 == t2->exon_list.end()){ // no more exon in both exon lists
- break;
- }else{
- if (it1 == t1->exon_list.end() && !(it2 == t2->exon_list.end())){ // no more exon in exon1 list
- t2_is_part = false;
- break;
- }
- if (it2 == t2->exon_list.end() && !(it1 == t1->exon_list.end())){ // no more exon in exon2 list
- t1_is_part = false;
- break;
- }
- }
+ if (!t1_is_part && !t2_is_part){break;} // both transcripts are not part of the other one
+ if (it1 == t1->exon_list.end() && it2 == t2->exon_list.end()){ // no more exon in both exon lists
+ break;
+ }else{
+ if (it1 == t1->exon_list.end() && !(it2 == t2->exon_list.end())){ // no more exon in exon1 list
+ t2_is_part = false;
+ break;
+ }
+ if (it2 == t2->exon_list.end() && !(it1 == t1->exon_list.end())){ // no more exon in exon2 list
+ t1_is_part = false;
+ break;
+ }
}
- return make_pair(t1_is_part, t2_is_part);
+ }
+ return make_pair(t1_is_part, t2_is_part);
}
bool compare_priority(Transcript const* lhs, Transcript const* rhs){
- // returns true, if the priority of the first element is higher; used to sort transcripts by priority
- return ( lhs->priority > rhs->priority );
+ // returns true, if the priority of the first element is higher; used to sort transcripts by priority
+ return ( lhs->priority > rhs->priority );
}
bool check_frame_annotation(Transcript const &transcript){
- // returns true, if the frame annotation of the transcript is correct
- list<Exon>::const_iterator it2;
- if (transcript.strand == '+'){
- for (list<Exon>::const_iterator it1 = transcript.exon_list.begin(); it1 != transcript.exon_list.end(); it1++){
- it2 = it1;
- it2++;
- if (it2 == transcript.exon_list.end())
- break;
- if ((*it1).frame != -1 && (*it2).frame != -1){
- if ((*it2).frame != (3 - ( ((*it1).to - (*it1).from + 1) - (*it1).frame) % 3) % 3){
- return false;
- }
- }
- }
- }else if (transcript.strand == '-'){
- for (list<Exon>::const_iterator it1 = transcript.exon_list.end(); it1 != transcript.exon_list.begin(); it1--){
- if (it1 == transcript.exon_list.end()){
- it1--;
- if (it1 == transcript.exon_list.begin())
- break;
- }
- it2 = it1;
- it2--;
- if (it2 == transcript.exon_list.begin())
- break;
- if ((*it1).frame != -1 && (*it2).frame != -1){
- if ((*it2).frame != (3 - ( ((*it1).to - (*it1).from + 1) - (*it1).frame) % 3) % 3){
- return false;
- }else
- if (it2 == transcript.exon_list.begin())
- break;
- }
+ // returns true, if the frame annotation of the transcript is correct
+ list<Exon>::const_iterator it2;
+ if (transcript.strand == '+'){
+ for (list<Exon>::const_iterator it1 = transcript.exon_list.begin(); it1 != transcript.exon_list.end(); it1++){
+ it2 = it1;
+ it2++;
+ if (it2 == transcript.exon_list.end())
+ break;
+ if ((*it1).frame != -1 && (*it2).frame != -1){
+ if ((*it2).frame != (3 - ( ((*it1).to - (*it1).from + 1) - (*it1).frame) % 3) % 3){
+ return false;
}
+ }
}
- return true;
+ }else if (transcript.strand == '-'){
+ for (list<Exon>::const_iterator it1 = transcript.exon_list.end(); it1 != transcript.exon_list.begin(); it1--){
+ if (it1 == transcript.exon_list.end()){
+ it1--;
+ if (it1 == transcript.exon_list.begin())
+ break;
+ }
+ it2 = it1;
+ it2--;
+ if (it2 == transcript.exon_list.begin())
+ break;
+ if ((*it1).frame != -1 && (*it2).frame != -1){
+ if ((*it2).frame != (3 - ( ((*it1).to - (*it1).from + 1) - (*it1).frame) % 3) % 3){
+ return false;
+ }else
+ if (it2 == transcript.exon_list.begin())
+ break;
+ }
+ }
+ }
+ return true;
}
void eval_gtf(list<Transcript*> &overlap, Properties &properties){
- string filename = "/home/lars/lars/test_data/eval_test.txt";
- fstream outfile;
- outfile.open(filename, ios::out | ios::app);
-
- list<Transcript*> annotation;
- list<Transcript*> prediction;
- list<Transcript*> single;
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- if ((*it)->priority == 3){
- annotation.push_back(*it);
- }
- search_n_destroy_doublings(annotation, properties, false);
- if ((*it)->pred_range.first && (*it)->pred_range.second){
- prediction.push_back(*it);
- }
- search_n_destroy_doublings(prediction, properties, false);
- if ((*it)->priority == 1){
- single.push_back(*it);
+ string filename = "/home/lars/lars/test_data/eval_test.txt";
+ fstream outfile;
+ outfile.open(filename, ios::out | ios::app);
+
+ list<Transcript*> annotation;
+ list<Transcript*> prediction;
+ list<Transcript*> single;
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ if ((*it)->priority == 3){
+ annotation.push_back(*it);
+ }
+ search_n_destroy_doublings(annotation, properties, false);
+ if ((*it)->pred_range.first && (*it)->pred_range.second){
+ prediction.push_back(*it);
+ }
+ search_n_destroy_doublings(prediction, properties, false);
+ if ((*it)->priority == 1){
+ single.push_back(*it);
+ }
+ }
+ if (annotation.empty()){
+ for (list<Transcript*>::iterator itp = prediction.begin(); itp != prediction.end(); itp++){
+ for (list<Exon>::iterator itpe = (*itp)->exon_list.begin(); itpe != (*itp)->exon_list.end(); itpe++){
+ (*itpe).tooFew = 0;
+ (*itpe).tooMany = (*itpe).to - (*itpe).from + 1;
+
+ (*itpe).penalty = (*itpe).tooFew + (*itpe).tooMany;
+ (*itpe).distance = min((*itpe).from - (*itp)->pred_range.first, (*itp)->pred_range.second - (*itpe).to);
+ list<Exon>::iterator itpe_temp = itpe;
+ itpe_temp++;
+ if (!(itpe == (*itp)->exon_list.begin()) && !(itpe_temp == (*itp)->exon_list.end())){
+ // outfile << (*itpe).distance << "\t" << (*itpe).penalty << endl;
+ }else{
+ outfile << (*itpe).distance << "\t" << (*itpe).penalty << endl;
}
+ }
}
- if (annotation.empty()){
- for (list<Transcript*>::iterator itp = prediction.begin(); itp != prediction.end(); itp++){
- for (list<Exon>::iterator itpe = (*itp)->exon_list.begin(); itpe != (*itp)->exon_list.end(); itpe++){
- (*itpe).tooFew = 0;
- (*itpe).tooMany = (*itpe).to - (*itpe).from + 1;
+ for (list<Transcript*>::iterator its = single.begin(); its != single.end(); its++){
+ for (list<Exon>::iterator itpe = (*its)->exon_list.begin(); itpe != (*its)->exon_list.end(); itpe++){
+ (*itpe).tooFew = 0;
+ (*itpe).tooMany = (*itpe).to - (*itpe).from + 1;
- (*itpe).penalty = (*itpe).tooFew + (*itpe).tooMany;
- (*itpe).distance = min((*itpe).from - (*itp)->pred_range.first, (*itp)->pred_range.second - (*itpe).to);
- list<Exon>::iterator itpe_temp = itpe;
- itpe_temp++;
- if (!(itpe == (*itp)->exon_list.begin()) && !(itpe_temp == (*itp)->exon_list.end())){
- // outfile << (*itpe).distance << "\t" << (*itpe).penalty << endl;
- }else{
- outfile << (*itpe).distance << "\t" << (*itpe).penalty << endl;
- }
- }
- }
- for (list<Transcript*>::iterator its = single.begin(); its != single.end(); its++){
- for (list<Exon>::iterator itpe = (*its)->exon_list.begin(); itpe != (*its)->exon_list.end(); itpe++){
+ (*itpe).penalty = (*itpe).tooFew + (*itpe).tooMany;
+ count1++;
+ value += (*itpe).penalty;
+ }
+ }
+ }else{
+ for (list<Transcript*>::iterator itp = prediction.begin(); itp != prediction.end(); itp++){
+ for (list<Exon>::iterator itpe = (*itp)->exon_list.begin(); itpe != (*itp)->exon_list.end(); itpe++){
+ int min_pen = -1;
+ for (list<Transcript*>::iterator ita = annotation.begin(); ita != annotation.end(); ita++){
+ for (list<Exon>::iterator itae = (*ita)->exon_list.begin(); itae != (*ita)->exon_list.end(); itae++){
+ if ((*itpe).to >= (*itae).from && (*itpe).from <= (*itae).to && (*itp)->strand == (*ita)->strand && strandeq(*itpe,*itae,(*itp)->strand)){
+ int more = 0;
+ int lesser = 0;
+ if ((*itpe).to > (*itae).to){
+ more += (*itpe).to - (*itae).to;
+ }else if ((*itpe).to < (*itae).to){
+ lesser += (*itae).to - (*itpe).to;
+ }
+ if ((*itpe).from > (*itae).from){
+ lesser += (*itpe).from - (*itae).from;
+ }else if ((*itpe).from < (*itae).from){
+ more += (*itae).from - (*itpe).from;
+ }
+ if (min_pen == -1 || min_pen > more + lesser){
+ (*itpe).tooFew = lesser;
+ (*itpe).tooMany = more;
+ min_pen = (*itpe).tooFew + (*itpe).tooMany;
+ //min_pen = (*itpe).tooFew;
+ }
+ }else{
+ if (min_pen == -1 || min_pen > (*itpe).to - (*itpe).from + 1){
(*itpe).tooFew = 0;
(*itpe).tooMany = (*itpe).to - (*itpe).from + 1;
-
- (*itpe).penalty = (*itpe).tooFew + (*itpe).tooMany;
- count1++;
- value += (*itpe).penalty;
+ min_pen = (*itpe).tooFew + (*itpe).tooMany;
+ //min_pen = (*itpe).tooFew;
+ }
}
+ }
}
- }else{
- for (list<Transcript*>::iterator itp = prediction.begin(); itp != prediction.end(); itp++){
- for (list<Exon>::iterator itpe = (*itp)->exon_list.begin(); itpe != (*itp)->exon_list.end(); itpe++){
- int min_pen = -1;
- for (list<Transcript*>::iterator ita = annotation.begin(); ita != annotation.end(); ita++){
- for (list<Exon>::iterator itae = (*ita)->exon_list.begin(); itae != (*ita)->exon_list.end(); itae++){
- if ((*itpe).to >= (*itae).from && (*itpe).from <= (*itae).to && (*itp)->strand == (*ita)->strand && strandeq(*itpe,*itae,(*itp)->strand)){
- int more = 0;
- int lesser = 0;
- if ((*itpe).to > (*itae).to){
- more += (*itpe).to - (*itae).to;
- }else if ((*itpe).to < (*itae).to){
- lesser += (*itae).to - (*itpe).to;
- }
- if ((*itpe).from > (*itae).from){
- lesser += (*itpe).from - (*itae).from;
- }else if ((*itpe).from < (*itae).from){
- more += (*itae).from - (*itpe).from;
- }
- if (min_pen == -1 || min_pen > more + lesser){
- (*itpe).tooFew = lesser;
- (*itpe).tooMany = more;
- min_pen = (*itpe).tooFew + (*itpe).tooMany;
- //min_pen = (*itpe).tooFew;
- }
- }else{
- if (min_pen == -1 || min_pen > (*itpe).to - (*itpe).from + 1){
- (*itpe).tooFew = 0;
- (*itpe).tooMany = (*itpe).to - (*itpe).from + 1;
- min_pen = (*itpe).tooFew + (*itpe).tooMany;
- //min_pen = (*itpe).tooFew;
- }
- }
- }
- }
- (*itpe).penalty = min_pen;
- (*itpe).distance = min((*itpe).from - (*itp)->pred_range.first, (*itp)->pred_range.second - (*itpe).to);
-
- list<Exon>::iterator itpe_temp = itpe;
- itpe_temp++;
- if (!(itpe == (*itp)->exon_list.begin()) && !(itpe_temp == (*itp)->exon_list.end())){
- // outfile << (*itpe).distance << "\t" << (*itpe).penalty << endl;
- }else{
- outfile << (*itpe).distance << "\t" << (*itpe).penalty << endl;
- }
- }
+ (*itpe).penalty = min_pen;
+ (*itpe).distance = min((*itpe).from - (*itp)->pred_range.first, (*itp)->pred_range.second - (*itpe).to);
+
+ list<Exon>::iterator itpe_temp = itpe;
+ itpe_temp++;
+ if (!(itpe == (*itp)->exon_list.begin()) && !(itpe_temp == (*itp)->exon_list.end())){
+ // outfile << (*itpe).distance << "\t" << (*itpe).penalty << endl;
+ }else{
+ outfile << (*itpe).distance << "\t" << (*itpe).penalty << endl;
}
- for (list<Transcript*>::iterator its = single.begin(); its != single.end(); its++){
- for (list<Exon>::iterator itpe = (*its)->exon_list.begin(); itpe != (*its)->exon_list.end(); itpe++){
- int min_pen = -1;
- for (list<Transcript*>::iterator ita = annotation.begin(); ita != annotation.end(); ita++){
- for (list<Exon>::iterator itae = (*ita)->exon_list.begin(); itae != (*ita)->exon_list.end(); itae++){
- if ((*itpe).to >= (*itae).from && (*itpe).from <= (*itae).to && (*its)->strand == (*ita)->strand && strandeq(*itpe,*itae,(*its)->strand)){
- int more = 0;
- int lesser = 0;
- if ((*itpe).to > (*itae).to){
- more += (*itpe).to - (*itae).to;
- }else if ((*itpe).to < (*itae).to){
- lesser += (*itae).to - (*itpe).to;
- }
- if ((*itpe).from > (*itae).from){
- lesser += (*itpe).from - (*itae).from;
- }else if ((*itpe).from < (*itae).from){
- more += (*itae).from - (*itpe).from;
- }
- if (min_pen == -1 || min_pen > more + lesser){
- (*itpe).tooFew = lesser;
- (*itpe).tooMany = more;
- min_pen = (*itpe).tooFew + (*itpe).tooMany;
- //min_pen = (*itpe).tooFew;
- }
- }else{
- if (min_pen == -1 || min_pen > (*itpe).to - (*itpe).from + 1){
- (*itpe).tooFew = 0;
- (*itpe).tooMany = (*itpe).to - (*itpe).from + 1;
- min_pen = (*itpe).tooFew + (*itpe).tooMany;
- //min_pen = (*itpe).tooFew;
- }
- }
- }
- }
- (*itpe).penalty = min_pen;
- count1++;
- value += (*itpe).penalty;
+ }
+ }
+ for (list<Transcript*>::iterator its = single.begin(); its != single.end(); its++){
+ for (list<Exon>::iterator itpe = (*its)->exon_list.begin(); itpe != (*its)->exon_list.end(); itpe++){
+ int min_pen = -1;
+ for (list<Transcript*>::iterator ita = annotation.begin(); ita != annotation.end(); ita++){
+ for (list<Exon>::iterator itae = (*ita)->exon_list.begin(); itae != (*ita)->exon_list.end(); itae++){
+ if ((*itpe).to >= (*itae).from && (*itpe).from <= (*itae).to && (*its)->strand == (*ita)->strand && strandeq(*itpe,*itae,(*its)->strand)){
+ int more = 0;
+ int lesser = 0;
+ if ((*itpe).to > (*itae).to){
+ more += (*itpe).to - (*itae).to;
+ }else if ((*itpe).to < (*itae).to){
+ lesser += (*itae).to - (*itpe).to;
+ }
+ if ((*itpe).from > (*itae).from){
+ lesser += (*itpe).from - (*itae).from;
+ }else if ((*itpe).from < (*itae).from){
+ more += (*itae).from - (*itpe).from;
+ }
+ if (min_pen == -1 || min_pen > more + lesser){
+ (*itpe).tooFew = lesser;
+ (*itpe).tooMany = more;
+ min_pen = (*itpe).tooFew + (*itpe).tooMany;
+ //min_pen = (*itpe).tooFew;
+ }
+ }else{
+ if (min_pen == -1 || min_pen > (*itpe).to - (*itpe).from + 1){
+ (*itpe).tooFew = 0;
+ (*itpe).tooMany = (*itpe).to - (*itpe).from + 1;
+ min_pen = (*itpe).tooFew + (*itpe).tooMany;
+ //min_pen = (*itpe).tooFew;
+ }
}
+ }
}
+ (*itpe).penalty = min_pen;
+ count1++;
+ value += (*itpe).penalty;
+ }
}
- outfile.close();
+ }
+ outfile.close();
}
bool strandeq(Exon ex1, Exon ex2, char strand){
- if (strand == '+'){
- if (ex1.frame == -1 && ex2.frame == -1){return true;}
- if (ex1.from >= ex2.from)
- if (((ex1.from - ex2.from) + ex1.frame) % 3 == ex2.frame){return true;}else{return false;}
- else
- if (((ex2.from - ex1.from) + ex2.frame) % 3 == ex1.frame){return true;}else{return false;}
- }else{
- if (ex1.frame == -1 && ex2.frame == -1){return true;}
- if (ex1.to >= ex2.to)
- if (((ex1.to - ex2.to) + ex2.frame) % 3 == ex1.frame){return true;}else{return false;}
- else
- if (((ex2.to - ex1.to) + ex1.frame) % 3 == ex2.frame){return true;}else{return false;}
- }
- return false;
+ if (strand == '+'){
+ if (ex1.frame == -1 && ex2.frame == -1){return true;}
+ if (ex1.from >= ex2.from)
+ if (((ex1.from - ex2.from) + ex1.frame) % 3 == ex2.frame){return true;}else{return false;}
+ else
+ if (((ex2.from - ex1.from) + ex2.frame) % 3 == ex1.frame){return true;}else{return false;}
+ }else{
+ if (ex1.frame == -1 && ex2.frame == -1){return true;}
+ if (ex1.to >= ex2.to)
+ if (((ex1.to - ex2.to) + ex2.frame) % 3 == ex1.frame){return true;}else{return false;}
+ else
+ if (((ex2.to - ex1.to) + ex1.frame) % 3 == ex2.frame){return true;}else{return false;}
+ }
+ return false;
}
void output_exon_list(Transcript const* tx){
- // just for semantic tests
- cout << ">> Exon_list of " << tx->t_id << ": " << endl;
- cout << "Original ID: " << tx->originalId << " from " << tx->inputFile << endl;
- cout << "Priority: " << tx->priority << endl;
- cout << tx->exon_list.size() << " elements, complete start: " << tx->tl_complete.first << ", complete stop: " << tx->tl_complete.second << endl;
- cout << "start codon of: ";
- if (!tx->joinpartner.first.empty()){cout << tx->joinpartner.first;}else{cout << "noone";}
- cout << ", stop codon of: ";
- if (!tx->joinpartner.second.empty()){cout << tx->joinpartner.second;}else{cout << "noone";}
- cout << endl;
- if (tx->pred_range.first && tx->pred_range.second){
- cout << "Pred_range: " << tx->pred_range.first << "\t" << tx->pred_range.second << endl;
- cout << "Pred_range EXON: " << tx->exon_list.front().predRange.first << "\t" << tx->exon_list.back().predRange.second << endl;
- cout << "Minimum distance from pred_range borders: " << min(tx->exon_list.front().from - tx->pred_range.first, tx->pred_range.second - tx->exon_list.back().to) << endl;
- cout << "Boundary problem: " << tx->boundaryProblem.first << " " << tx->boundaryProblem.second << endl;
- }
- double x = 0.0;
- for (list<Exon>::const_iterator it = tx->exon_list.begin(); it != tx->exon_list.end(); it++){
- cout << (*it).chr << "\tTESTOUTPUT\t" << (*it).feature << "\t" << (*it).from << "\t" << (*it).to << "\t" << (*it).score << "\t" << tx->strand << "\t" << (*it).frame << "\ttranscript_id \"" << tx->t_id << "\"; gene_id \"" << tx->parent->g_id << "\";" << endl;
- x += (*it).score;
- }
- x /= tx->exon_list.size();
- cout << "Mean score: " << x << endl;
- cout << "Exon_list end----------------------------------------------------------------" << endl;
+ // just for semantic tests
+ cout << ">> Exon_list of " << tx->t_id << ": " << endl;
+ cout << "Original ID: " << tx->originalId << " from " << tx->inputFile << endl;
+ cout << "Priority: " << tx->priority << endl;
+ cout << tx->exon_list.size() << " elements, complete start: " << tx->tl_complete.first << ", complete stop: " << tx->tl_complete.second << endl;
+ cout << "start codon of: ";
+ if (!tx->joinpartner.first.empty()){cout << tx->joinpartner.first;}else{cout << "noone";}
+ cout << ", stop codon of: ";
+ if (!tx->joinpartner.second.empty()){cout << tx->joinpartner.second;}else{cout << "noone";}
+ cout << endl;
+ if (tx->pred_range.first && tx->pred_range.second){
+ cout << "Pred_range: " << tx->pred_range.first << "\t" << tx->pred_range.second << endl;
+ cout << "Pred_range EXON: " << tx->exon_list.front().predRange.first << "\t" << tx->exon_list.back().predRange.second << endl;
+ cout << "Minimum distance from pred_range borders: " << min(tx->exon_list.front().from - tx->pred_range.first, tx->pred_range.second - tx->exon_list.back().to) << endl;
+ cout << "Boundary problem: " << tx->boundaryProblem.first << " " << tx->boundaryProblem.second << endl;
+ }
+ double x = 0.0;
+ for (list<Exon>::const_iterator it = tx->exon_list.begin(); it != tx->exon_list.end(); it++){
+ cout << (*it).chr << "\tTESTOUTPUT\t" << (*it).feature << "\t" << (*it).from << "\t" << (*it).to << "\t" << (*it).score << "\t" << tx->strand << "\t" << (*it).frame << "\ttranscript_id \"" << tx->t_id << "\"; gene_id \"" << tx->parent->g_id << "\";" << endl;
+ x += (*it).score;
+ }
+ x /= tx->exon_list.size();
+ cout << "Mean score: " << x << endl;
+ cout << "Exon_list end----------------------------------------------------------------" << endl;
}
void calculatePredictionScore(Transcript* tx){
- float cumScoreCDS = 0;
- float countCDS = 0;
- float cumScoreUTR = 0;
- float countUTR = 0;
- float cumScoreIntron = 0;
- float countIntron = 0;
-
- int maxIntronSize = 0;
+ float cumScoreCDS = 0;
+ float countCDS = 0;
+ float cumScoreUTR = 0;
+ float countUTR = 0;
+ float cumScoreIntron = 0;
+ float countIntron = 0;
- for (list<Exon>::const_iterator iex = tx->exon_list.begin(); iex != tx->exon_list.end(); iex++){
+ int maxIntronSize = 0;
-
- list<Exon>::const_iterator iexNext = iex;
- iexNext++;
- if (iexNext != tx->exon_list.end()){
- int intronSize = (*iexNext).from - (*iex).to - 1;
- if (maxIntronSize < intronSize){maxIntronSize = intronSize;}
- if (intronSize > 0){
- countIntron++;
- }
- }
+ for (list<Exon>::const_iterator iex = tx->exon_list.begin(); iex != tx->exon_list.end(); iex++){
- if (iex->feature == "CDS"){
- cumScoreCDS += iex->score;
- countCDS++;
- if (iex->score < 0 && iex->score > 1){
- cerr << "WARNING: A value of column 6 is above 1 (100%) or below 0 (0%)." << endl;
- }
- }else if (iex->feature == "UTR"){
- cumScoreUTR += iex->score;
- countUTR++;
- if (iex->score < 0 && iex->score > 1){
- cerr << "WARNING: A value of column 6 is above 1 (100%) or below 0 (0%)." << endl;
- }
- }
+ list<Exon>::const_iterator iexNext = iex;
+ iexNext++;
+ if (iexNext != tx->exon_list.end()){
+ int intronSize = (*iexNext).from - (*iex).to - 1;
+ if (maxIntronSize < intronSize){maxIntronSize = intronSize;}
+ if (intronSize > 0){
+ countIntron++;
+ }
}
- for (list<Exon>::const_iterator iin = tx->intron_list.begin(); iin != tx->intron_list.end(); iin++){
- cumScoreIntron += iin->score;
- //countIntron++;
- if (iin->score < 0 && iin->score > 1){
- cerr << "WARNING: A value of column 6 is above 1 (100%) or below 0 (0%)." << endl;
- }
- }
- if (countCDS == 0){
- cumScoreCDS = 0;
- }else{
- cumScoreCDS /= countCDS;
- }
- if (countUTR == 0){
- cumScoreUTR = 0;
- }else{
- cumScoreUTR /= countUTR;
- }
- if (countIntron == 0){
- cumScoreIntron = 0;
- }else{
- cumScoreIntron /= countIntron;
+ if (iex->feature == "CDS"){
+ cumScoreCDS += iex->score;
+ countCDS++;
+ if (iex->score < 0 && iex->score > 1){
+ cerr << "WARNING: A value of column 6 is above 1 (100%) or below 0 (0%)." << endl;
+ }
+ }else if (iex->feature == "UTR"){
+ cumScoreUTR += iex->score;
+ countUTR++;
+ if (iex->score < 0 && iex->score > 1){
+ cerr << "WARNING: A value of column 6 is above 1 (100%) or below 0 (0%)." << endl;
+ }
}
-
- tx->predictionScore = (4*cumScoreCDS + 4*cumScoreIntron + cumScoreUTR)/9;
+ }
+
+ for (list<Exon>::const_iterator iin = tx->intron_list.begin(); iin != tx->intron_list.end(); iin++){
+ cumScoreIntron += iin->score;
+ //countIntron++;
+ if (iin->score < 0 && iin->score > 1){
+ cerr << "WARNING: A value of column 6 is above 1 (100%) or below 0 (0%)." << endl;
+ }
+ }
+
+ if (countCDS == 0){
+ cumScoreCDS = 0;
+ }else{
+ cumScoreCDS /= countCDS;
+ }
+ if (countUTR == 0){
+ cumScoreUTR = 0;
+ }else{
+ cumScoreUTR /= countUTR;
+ }
+ if (countIntron == 0){
+ cumScoreIntron = 0;
+ }else{
+ cumScoreIntron /= countIntron;
+ }
+
+ tx->predictionScore = (4*cumScoreCDS + 4*cumScoreIntron + cumScoreUTR)/9;
}
bool compare_quality(Transcript const* lhs, Transcript const* rhs){
- // completeness
- if ((lhs->tl_complete.first && lhs->tl_complete.second) && !(rhs->tl_complete.first && rhs->tl_complete.second)){
- return true;
- }
- if (!(lhs->tl_complete.first && lhs->tl_complete.second) && (rhs->tl_complete.first && rhs->tl_complete.second)){
- return false;
- }
+ // completeness
+ if ((lhs->tl_complete.first && lhs->tl_complete.second) && !(rhs->tl_complete.first && rhs->tl_complete.second)){
+ return true;
+ }
+ if (!(lhs->tl_complete.first && lhs->tl_complete.second) && (rhs->tl_complete.first && rhs->tl_complete.second)){
+ return false;
+ }
- if ((lhs->tl_complete.first || lhs->tl_complete.second) && !(rhs->tl_complete.first || rhs->tl_complete.second)){
- return true;
- }
- if (!(lhs->tl_complete.first || lhs->tl_complete.second) && (rhs->tl_complete.first || rhs->tl_complete.second)){
- return false;
- }
+ if ((lhs->tl_complete.first || lhs->tl_complete.second) && !(rhs->tl_complete.first || rhs->tl_complete.second)){
+ return true;
+ }
+ if (!(lhs->tl_complete.first || lhs->tl_complete.second) && (rhs->tl_complete.first || rhs->tl_complete.second)){
+ return false;
+ }
- // closeness to prediction range border
- if ((lhs->boundaryProblem.first <= 1 && lhs->boundaryProblem.second <= 1) && !(rhs->boundaryProblem.first <= 1 && rhs->boundaryProblem.second <= 1)){
- return true;
- }
- if (!(lhs->boundaryProblem.first <= 1 && lhs->boundaryProblem.second <= 1) && (rhs->boundaryProblem.first <= 1 && rhs->boundaryProblem.second <= 1)){
- return false;
- }
+ // closeness to prediction range border
+ if ((lhs->boundaryProblem.first <= 1 && lhs->boundaryProblem.second <= 1) && !(rhs->boundaryProblem.first <= 1 && rhs->boundaryProblem.second <= 1)){
+ return true;
+ }
+ if (!(lhs->boundaryProblem.first <= 1 && lhs->boundaryProblem.second <= 1) && (rhs->boundaryProblem.first <= 1 && rhs->boundaryProblem.second <= 1)){
+ return false;
+ }
- // priority
- if (lhs->priority > rhs->priority){
- return true;
- }
- if (lhs->priority < rhs->priority){
- return false;
- }
+ // priority
+ if (lhs->priority > rhs->priority){
+ return true;
+ }
+ if (lhs->priority < rhs->priority){
+ return false;
+ }
- // prediction score
- if (lhs->predictionScore >= rhs->predictionScore){
- return true;
- }else{
- return false;
- }
+ // prediction score
+ if (lhs->predictionScore >= rhs->predictionScore){
+ return true;
+ }else{
+ return false;
+ }
}
bool shareAlternativeVariant(Gene* g1, Gene* g2){
- for (list<Transcript*>::iterator it = g1->children.begin(); it != g1->children.end(); it++){
- for (list<Transcript*>::iterator itInside = g2->children.begin(); itInside != g2->children.end(); itInside++){
- if (alternativeVariants((*it), (*itInside))){
- return true;
- }
- }
+ for (list<Transcript*>::iterator it = g1->children.begin(); it != g1->children.end(); it++){
+ for (list<Transcript*>::iterator itInside = g2->children.begin(); itInside != g2->children.end(); itInside++){
+ if (alternativeVariants((*it), (*itInside))){
+ return true;
+ }
}
- return false;
+ }
+ return false;
}
bool alternativeVariants(Transcript* t1, Transcript* t2){
- if (overlappingCdsWithAnything(t1, t2) && t1->strand == t2->strand && (t1->hasCommonExon(t2) || (t1->hasCommonTlStart(t2) || t1->hasCommonTlStop(t2) ))){
- return true;
- }
- return false;
+ if (overlappingCdsWithAnything(t1, t2) && t1->strand == t2->strand && (t1->hasCommonExon(t2) || (t1->hasCommonTlStart(t2) || t1->hasCommonTlStop(t2) ))){
+ return true;
+ }
+ return false;
}
void solveIndirectProblems(list<Transcript*> &overlap, Properties &properties){
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- list<Transcript*>::iterator itInside = it;
- itInside++;
- while (itInside != overlap.end()){
- if ((*it)->parent == (*itInside)->parent){
-
- bool b1 = (*it)->indirectBoundaryProblem(*itInside);
- bool b2 = (*itInside)->indirectBoundaryProblem(*it);
-
- if ( b1 && !b2 ){
- // DELETE *it
- deleteTx(*it, properties);
- it = overlap.erase(it);
- it--;
- }
- if ( b2 && !b1 ){
- deleteTx(*itInside, properties);
- itInside = overlap.erase(itInside);
- itInside--;
- }
- }
- itInside++;
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ list<Transcript*>::iterator itInside = it;
+ itInside++;
+ while (itInside != overlap.end()){
+ if ((*it)->parent == (*itInside)->parent){
+
+ bool b1 = (*it)->indirectBoundaryProblem(*itInside);
+ bool b2 = (*itInside)->indirectBoundaryProblem(*it);
+
+ if ( b1 && !b2 ){
+ // DELETE *it
+ deleteTx(*it, properties);
+ it = overlap.erase(it);
+ it--;
+ }
+ if ( b2 && !b1 ){
+ deleteTx(*itInside, properties);
+ itInside = overlap.erase(itInside);
+ itInside--;
}
+ }
+ itInside++;
}
+ }
}
void txCoexBact(list<Transcript*> &overlap, Properties &properties){
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- list<Transcript*>::iterator itInside = it;
- itInside++;
- while (itInside != overlap.end()){
- if (!((*it), (*itInside)) || (*it)->strand != (*itInside)->strand || ((*it)->parent == (*itInside)->parent && (*it)->originalId != (*itInside)->originalId) || (*it)->tes != (*itInside)->tes){
- (*it)->consistent.push_back((*itInside)->t_id);
- (*itInside)->consistent.push_back((*it)->t_id);
- }
- itInside++;
- }
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ list<Transcript*>::iterator itInside = it;
+ itInside++;
+ while (itInside != overlap.end()){
+ if (!((*it), (*itInside)) || (*it)->strand != (*itInside)->strand || ((*it)->parent == (*itInside)->parent && (*it)->originalId != (*itInside)->originalId) || (*it)->tes != (*itInside)->tes){
+ (*it)->consistent.push_back((*itInside)->t_id);
+ (*itInside)->consistent.push_back((*it)->t_id);
+ }
+ itInside++;
}
+ }
-// a transcript shouldn't be 100% in another transcript if it's score is very small:
-/* if((*it)->strand == (*itInside)->strand && (*it)->getCdsFront()->from > (*itInside)->getCdsFront()->from && (*it)->getCdsBack()->to < (*itInside)->getCdsBack()->to){
- if ((*it)->getCdsFront()->score < 0.1){
- it = overlap.erase(it);
- it--;
- break;
- }
+ // a transcript shouldn't be 100% in another transcript if it's score is very small:
+ /* if((*it)->strand == (*itInside)->strand && (*it)->getCdsFront()->from > (*itInside)->getCdsFront()->from && (*it)->getCdsBack()->to < (*itInside)->getCdsBack()->to){
+ if ((*it)->getCdsFront()->score < 0.1){
+ it = overlap.erase(it);
+ it--;
+ break;
+ }
}else if((*it)->strand == (*itInside)->strand && (*it)->getCdsFront()->from < (*itInside)->getCdsFront()->from && (*it)->getCdsBack()->to > (*itInside)->getCdsBack()->to){
- if ((*itInside)->getCdsFront()->score < 0.1){
- itInside = overlap.erase(itInside);
- continue;
- }
+ if ((*itInside)->getCdsFront()->score < 0.1){
+ itInside = overlap.erase(itInside);
+ continue;
+ }
}*/
}
void txCoexEuka(list<Transcript*> &overlap, Properties &properties){
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- list<Transcript*>::iterator itInside = it;
- itInside++;
- while (itInside != overlap.end()){
- if (!overlappingCdsWithAnything((*it), (*itInside)) || (*it)->strand != (*itInside)->strand || ((*it)->parent == (*itInside)->parent && (*it)->originalId != (*itInside)->originalId)){
- (*it)->consistent.push_back((*itInside)->t_id);
- (*itInside)->consistent.push_back((*it)->t_id);
- }
- itInside++;
- }
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ list<Transcript*>::iterator itInside = it;
+ itInside++;
+ while (itInside != overlap.end()){
+ if (!overlappingCdsWithAnything((*it), (*itInside)) || (*it)->strand != (*itInside)->strand || ((*it)->parent == (*itInside)->parent && (*it)->originalId != (*itInside)->originalId)){
+ (*it)->consistent.push_back((*itInside)->t_id);
+ (*itInside)->consistent.push_back((*it)->t_id);
+ }
+ itInside++;
}
+ }
}
void selection(list<Transcript*> &overlap, Properties &properties){
- search_n_destroy_doublings(overlap, properties, false);
+ search_n_destroy_doublings(overlap, properties, false);
- // delete transcripts that belong to input files with priorities that should be suppressed
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- if (find(properties.supprList.begin(),properties.supprList.end(),(*it)->priority) != properties.supprList.end()){
- deleteTx(*it, properties);
- it = overlap.erase(it);
- it--;
- continue;
- }
- // calculate score to compare the quality of transcripts
- calculatePredictionScore(*it);
+ // delete transcripts that belong to input files with priorities that should be suppressed
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ if (find(properties.supprList.begin(),properties.supprList.end(),(*it)->priority) != properties.supprList.end()){
+ deleteTx(*it, properties);
+ it = overlap.erase(it);
+ it--;
+ continue;
}
+ // calculate score to compare the quality of transcripts
+ calculatePredictionScore(*it);
+ }
- overlap.sort(compare_quality);
+ overlap.sort(compare_quality);
- // figure out, which genes are present in this overlap (#genes <= #transcripts)
- list<Gene*> genes;
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- if (find(genes.begin(),genes.end(),(*it)->parent) == genes.end()){
- genes.push_back((*it)->parent);
- }
+ // figure out, which genes are present in this overlap (#genes <= #transcripts)
+ list<Gene*> genes;
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ if (find(genes.begin(),genes.end(),(*it)->parent) == genes.end()){
+ genes.push_back((*it)->parent);
}
+ }
- // delete uncomplete transcripts from gene, if there is a complete one
- for (list<Gene*>::iterator it = genes.begin(); it != genes.end(); it++){
- bool completeExists = false;
- for (list<Transcript*>::iterator tit = (*it)->children.begin(); tit != (*it)->children.end(); tit++){
- if ((*tit)->tl_complete.first && (*tit)->tl_complete.second){
- completeExists = true;
- break;
- }
- }
- if (completeExists){
- for (list<Transcript*>::iterator tit = (*it)->children.begin(); tit != (*it)->children.end(); tit++){
- if ( !( (*tit)->tl_complete.first && (*tit)->tl_complete.second ) ){
- for (list<Transcript*>::iterator oit = overlap.begin(); oit != overlap.end(); oit++){
- if (*tit == *oit){
- oit = overlap.erase(oit);
- oit--;
- }
- }
- deleteTx(*tit, properties);
- tit--;
- }
+ // delete uncomplete transcripts from gene, if there is a complete one
+ for (list<Gene*>::iterator it = genes.begin(); it != genes.end(); it++){
+ bool completeExists = false;
+ for (list<Transcript*>::iterator tit = (*it)->children.begin(); tit != (*it)->children.end(); tit++){
+ if ((*tit)->tl_complete.first && (*tit)->tl_complete.second){
+ completeExists = true;
+ break;
+ }
+ }
+ if (completeExists){
+ for (list<Transcript*>::iterator tit = (*it)->children.begin(); tit != (*it)->children.end(); tit++){
+ if ( !( (*tit)->tl_complete.first && (*tit)->tl_complete.second ) ){
+ for (list<Transcript*>::iterator oit = overlap.begin(); oit != overlap.end(); oit++){
+ if (*tit == *oit){
+ oit = overlap.erase(oit);
+ oit--;
}
+ }
+ deleteTx(*tit, properties);
+ tit--;
}
+ }
}
+ }
- // if flag alternatives is on, try to combine transcripts to one gene, if they look like alternative spliced variants
- if (properties.alternatives && genes.size() >= 2 && properties.genemodel != "bacterium"){
-
- for (list<Gene*>::iterator it = genes.begin(); it != genes.end(); it++){
-
- list<Gene*>::iterator itInside = it;
- itInside++;
+ // if flag alternatives is on, try to combine transcripts to one gene, if they look like alternative spliced variants
+ if (properties.alternatives && genes.size() >= 2 && properties.genemodel != "bacterium"){
- while (itInside != genes.end()){
-
- if (shareAlternativeVariant((*it), (*itInside))){
+ for (list<Gene*>::iterator it = genes.begin(); it != genes.end(); it++){
- // Transfer all transcripts of itInside to it and delete itInside
- for (list<Transcript*>::iterator tit = (*it)->children.begin(); tit != (*it)->children.end(); tit++){
- (*tit)->parent = (*itInside);
- (*itInside)->children.push_back(*tit);
- (*itInside)->nrOfTx += (*it)->nrOfTx;
- (*itInside)->nrOfPrintedTx += (*it)->nrOfPrintedTx;
- tit = (*it)->children.erase(tit);
- tit--;
- }
- deleteGene((*it), properties);
- it = genes.erase(it);
- it--;
- break;
- }
- itInside++;
- }
- }
- // sort children
- for (list<Gene*>::iterator it = genes.begin(); it != genes.end(); it++){
- (*it)->children.sort(compare_quality);
+ list<Gene*>::iterator itInside = it;
+ itInside++;
+
+ while (itInside != genes.end()){
+
+ if (shareAlternativeVariant((*it), (*itInside))){
+
+ // Transfer all transcripts of itInside to it and delete itInside
+ for (list<Transcript*>::iterator tit = (*it)->children.begin(); tit != (*it)->children.end(); tit++){
+ (*tit)->parent = (*itInside);
+ (*itInside)->children.push_back(*tit);
+ (*itInside)->nrOfTx += (*it)->nrOfTx;
+ (*itInside)->nrOfPrintedTx += (*it)->nrOfPrintedTx;
+ tit = (*it)->children.erase(tit);
+ tit--;
+ }
+ deleteGene((*it), properties);
+ it = genes.erase(it);
+ it--;
+ break;
}
+ itInside++;
+ }
}
+ // sort children
+ for (list<Gene*>::iterator it = genes.begin(); it != genes.end(); it++){
+ (*it)->children.sort(compare_quality);
+ }
+ }
- // look for indirect boundary problems
- solveIndirectProblems(overlap, properties);
+ // look for indirect boundary problems
+ solveIndirectProblems(overlap, properties);
- // find out, which transcripts can coexist in a gene structure ("consistent")
- if (properties.genemodel == "bacterium"){
- txCoexBact(overlap, properties);
- }else{
- txCoexEuka(overlap, properties);
- }
+ // find out, which transcripts can coexist in a gene structure ("consistent")
+ if (properties.genemodel == "bacterium"){
+ txCoexBact(overlap, properties);
+ }else{
+ txCoexEuka(overlap, properties);
+ }
- overlap.sort(compare_quality);
- overlap = calcGeneStructur(overlap, properties);
+ overlap.sort(compare_quality);
+ overlap = calcGeneStructur(overlap, properties);
}
list<Transcript*> calcGeneStructur(list<Transcript*> overlap, Properties &properties){
- list<Transcript*> newOvlp;
- list<string> openTx;
-
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- openTx.push_back((*it)->t_id);
- }
-
- for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
- if ((find(openTx.begin(), openTx.end(), (*it)->t_id) != openTx.end())){
- newOvlp.push_back(*it);
- for (list<string>::iterator iti = openTx.begin(); iti != openTx.end(); iti++){
- if ((find((*it)->consistent.begin(), (*it)->consistent.end(), (*iti)) == (*it)->consistent.end())){
- openTx.erase(iti);
- iti--;
- }
- }
+ list<Transcript*> newOvlp;
+ list<string> openTx;
+
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ openTx.push_back((*it)->t_id);
+ }
+
+ for (list<Transcript*>::iterator it = overlap.begin(); it != overlap.end(); it++){
+ if ((find(openTx.begin(), openTx.end(), (*it)->t_id) != openTx.end())){
+ newOvlp.push_back(*it);
+ for (list<string>::iterator iti = openTx.begin(); iti != openTx.end(); iti++){
+ if ((find((*it)->consistent.begin(), (*it)->consistent.end(), (*iti)) == (*it)->consistent.end())){
+ openTx.erase(iti);
+ iti--;
}
+ }
}
- return newOvlp;
+ }
+ return newOvlp;
}
bool overlapping(Transcript* t1, Transcript* t2){
- int t1TxFirst = t1->getTxStart();
- int t1TxLast = t1->getTxEnd();
+ int t1TxFirst = t1->getTxStart();
+ int t1TxLast = t1->getTxEnd();
- int t2TxFirst = t2->getTxStart();
- int t2TxLast = t2->getTxEnd();
+ int t2TxFirst = t2->getTxStart();
+ int t2TxLast = t2->getTxEnd();
- return !((t1TxLast < t2TxFirst) || (t1TxFirst > t2TxLast));
+ return !((t1TxLast < t2TxFirst) || (t1TxFirst > t2TxLast));
}
bool overlappingCdsWithAnything(Transcript* t1, Transcript * t2){
- int t1TlFirst = min(t1->tis,t1->tes);
- int t1TlLast = max(t1->tis,t1->tes);
- int t1TxFirst = t1->getTxStart();
- int t1TxLast = t1->getTxEnd();
+ int t1TlFirst = min(t1->tis,t1->tes);
+ int t1TlLast = max(t1->tis,t1->tes);
+ int t1TxFirst = t1->getTxStart();
+ int t1TxLast = t1->getTxEnd();
- int t2TlFirst = min(t2->tis,t2->tes);
- int t2TlLast = max(t2->tis,t2->tes);
- int t2TxFirst = t2->getTxStart();
- int t2TxLast = t2->getTxEnd();
+ int t2TlFirst = min(t2->tis,t2->tes);
+ int t2TlLast = max(t2->tis,t2->tes);
+ int t2TxFirst = t2->getTxStart();
+ int t2TxLast = t2->getTxEnd();
- return !((t1TlLast < t2TxFirst) || (t1TlFirst > t2TxLast)) || !((t1TxLast < t2TlFirst) || (t1TxFirst > t2TlLast));
+ return !((t1TlLast < t2TxFirst) || (t1TlFirst > t2TxLast)) || !((t1TxLast < t2TlFirst) || (t1TxFirst > t2TlLast));
}
bool overlappingCdsWithCds(Transcript* t1, Transcript* t2){
- return (((t2->tis - t1->tis) * (t2->tis - t1->tes)) < 0) || (((t2->tes - t1->tis) * (t2->tes - t1->tes)) < 0);
+ return (((t2->tis - t1->tis) * (t2->tis - t1->tes)) < 0) || (((t2->tes - t1->tis) * (t2->tes - t1->tes)) < 0);
}
bool overlappingCdsOnlyWithUtr(Transcript* t1, Transcript* t2){
- return overlappingCdsWithAnything(t1,t2) && !overlappingCdsWithCds(t1, t2);
+ return overlappingCdsWithAnything(t1,t2) && !overlappingCdsWithCds(t1, t2);
}
bool overlappingUtrOnly(Transcript* t1, Transcript* t2){
- return overlapping(t1, t2) && !overlappingCdsWithAnything(t1, t2);
+ return overlapping(t1, t2) && !overlappingCdsWithAnything(t1, t2);
}
int isCombinable(Transcript* t1, Transcript* t2, bool frontSide, Properties &properties){
-// return 0 if t1 and t2 are not combinable (joinable), otherwise return the joining case
- // if not overlapping, they are not combinable
- if (!overlapping(t1, t2)){ return 0; }
-
- // backSide ("+" && "3'" and "-" && "5'")
- if (!frontSide){
- if ( ( (*t1).tes < (*t2).tis && (*t1).strand == '+' ) || ( (*t1).tes > (*t2).tis && (*t1).strand == '-' ) ){ return 0; }
- // for every exon in t2
- for (list<Exon>::const_iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
- if ((*it).feature != "CDS"){continue;}
- // return 1: if t1.back() ends in an exon of t2 such that they are combinable; return 2 if t1.back() does not end ...
- if (((*t1).exon_list.back().to >= (*it).from) && ((*t1).exon_list.back().to <= (*it).to)){
- if ((*t1).exon_list.back().frame == -1 && (*it).frame == -1){return 1;}
- else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
- if ((t1->strand == '+') && ((3 - (((*t1).exon_list.back().to - (*t1).exon_list.back().from) - (*t1).exon_list.back().frame) % 3) % 3) == ((3 - (((*t1).exon_list.back().to - (*it).from) - (*it).frame) % 3) % 3) ){
- return 1;
- }else if ((t1->strand == '-') && (*t1).exon_list.back().frame == ((3 - (((*it).to - (*t1).exon_list.back().to) - (*it).frame) % 3) % 3) ){
- return 1;
- }else{
- return 0;
- }
- }else{
- if ((*t1).exon_list.back().to <= ((*it).from - (int) properties.minimumIntronLength)){
- if ((*t1).exon_list.back().frame == -1 && (*it).frame == -1){return 2;}
- else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
- if ((t1->strand == '+') && ((*it).frame == (3 - ( ((*t1).exon_list.back().to - (*t1).exon_list.back().from + 1) - (*t1).exon_list.back().frame) % 3) % 3)){
- return 2;
- }else if ((t1->strand == '-') && ((*t1).exon_list.back().frame == (3 - ( ((*it).to - (*it).from + 1) - (*it).frame) % 3) % 3)){
- return 2;
- }else{
- return 0;
- }
- }
- }
+ // return 0 if t1 and t2 are not combinable (joinable), otherwise return the joining case
+ // if not overlapping, they are not combinable
+ if ( !overlapping(t1, t2) ){
+ if ( ( (*t1).strand=='+' && frontSide && !(*t2).tl_complete.second && (*t1).tis-(*t2).tes<=5000 ) || ( (*t1).strand=='-' && !frontSide && !(*t2).tl_complete.second && (*t2).tes-(*t1).tis<=5000 ) || ( (*t1).strand=='-' && frontSide && !(*t2).tl_complete.first && (*t1).tes-(*t2).tis<=5000 ) || ( (*t1).strand=='+' && !frontSide && !(*t2).tl_complete.first && (*t2).tis-(*t1).tes<=5000 ) ){ }else{ return 0; }
+ }
+ // backSide ("+" && "3'" and "-" && "5'")
+ if (!frontSide){
+ if ( ( (*t1).tes < (*t2).tis && (*t1).strand == '+' ) || ( (*t1).tes > (*t2).tis && (*t1).strand == '-' ) ){ return 0; } // maybe better more restrictive: tis<tis OR tis>tis, DEPENDS
+ // for every exon in t2
+ for (list<Exon>::const_iterator it = t2->exon_list.begin(); it != t2->exon_list.end(); it++){
+ if ((*it).feature != "CDS"){continue;}
+ // return 1: if t1.back() ends in an exon of t2 such that they are combinable; return 2 if t1.back() does not end ...
+ if (((*t1).exon_list.back().to >= (*it).from) && ((*t1).exon_list.back().to <= (*it).to)){
+ if ((*t1).exon_list.back().frame == -1 && (*it).frame == -1){return 1;}
+ else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
+ if ((t1->strand == '+') && ((3 - (((*t1).exon_list.back().to - (*t1).exon_list.back().from) - (*t1).exon_list.back().frame) % 3) % 3) == ((3 - (((*t1).exon_list.back().to - (*it).from) - (*it).frame) % 3) % 3) ){
+ return 1;
+ }else if ((t1->strand == '-') && (*t1).exon_list.back().frame == ((3 - (((*it).to - (*t1).exon_list.back().to) - (*it).frame) % 3) % 3) ){
+ return 1;
+ }else{
+ return 0;
}
- }else{ // frontSide
- if ( ((*t1).tis > (*t2).tes && (*t1).strand == '+') || ((*t1).tis < (*t2).tes && (*t1).strand == '-') ){ return 0; }
- for (list<Exon>::reverse_iterator it = t2->exon_list.rbegin(); it != t2->exon_list.rend(); it++){
- if ((*it).feature != "CDS"){continue;}
- // return 3: if t1.front() ends in an exon of t2 such that they are combinable; return 4 if t1.front() does not end ...
-
- if (((*t1).exon_list.front().from >= (*it).from) && ((*t1).exon_list.front().from <= (*it).to)){
- if ((*t1).exon_list.front().frame == -1 && (*it).frame == -1){return 3;}
- else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
- if ( (t1->strand == '-') && ((3 - (((*t1).exon_list.front().to - (*t1).exon_list.front().from) - (*t1).exon_list.front().frame) % 3) % 3) == ((3 - (((*it).to - (*t1).exon_list.front().from) - (*it).frame) % 3) % 3) ){
- return 3;
- }else if ( (t1->strand == '+') && (*t1).exon_list.front().frame == ((3 - (((*t1).exon_list.front().from - (*it).from) - (*it).frame) % 3) % 3) ){
- return 3;
- }else{
- return 0;
- }
- }else{
- if ((*t1).exon_list.front().from >= ((*it).to + (int) properties.minimumIntronLength)){
- if ((*t1).exon_list.front().frame == -1 && (*it).frame == -1){return 4;}
- else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
-/* if (it != t2->exon_list.begin()){
- it--;
- }else{
- return 0;
- }*/
- if ((t1->strand == '-') && ((*it).frame == (3 - ( ((*t1).exon_list.front().to - (*t1).exon_list.front().from + 1) - (*t1).exon_list.front().frame) % 3) % 3)){
- return 4;
- }else if ((t1->strand == '+') && ((*t1).exon_list.front().frame == (3 - ( ((*it).to - (*it).from + 1) - (*it).frame) % 3) % 3)){
- return 4;
- }else{
- return 0;
- }
- }
- }
+ }else{
+ if ((*t1).exon_list.back().to <= ((*it).from - (int) properties.minimumIntronLength)){
+ if ((*t1).exon_list.back().frame == -1 && (*it).frame == -1){return 2;}
+ else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
+ if ((t1->strand == '+') && ((*it).frame == (3 - ( ((*t1).exon_list.back().to - (*t1).exon_list.back().from + 1) - (*t1).exon_list.back().frame) % 3) % 3)){
+ return 2;
+ }else if ((t1->strand == '-') && ((*t1).exon_list.back().frame == (3 - ( ((*it).to - (*it).from + 1) - (*it).frame) % 3) % 3)){
+ return 2;
+ }else{
+ return 0;
+ }
}
+ }
}
- return 0;
+ }else{ // frontSide
+ if ( ((*t1).tis > (*t2).tes && (*t1).strand == '+') || ((*t1).tis < (*t2).tes && (*t1).strand == '-') ){ return 0; } // maybe better more restrictive: tis<tis OR tis>tis, DEPENDS
+ for (list<Exon>::reverse_iterator it = t2->exon_list.rbegin(); it != t2->exon_list.rend(); it++){
+ if ((*it).feature != "CDS"){continue;}
+ // return 3: if t1.front() ends in an exon of t2 such that they are combinable; return 4 if t1.front() does not end ...
+
+ if (((*t1).exon_list.front().from >= (*it).from) && ((*t1).exon_list.front().from <= (*it).to)){
+ if ((*t1).exon_list.front().frame == -1 && (*it).frame == -1){return 3;}
+ else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
+ if ( (t1->strand == '-') && ((3 - (((*t1).exon_list.front().to - (*t1).exon_list.front().from) - (*t1).exon_list.front().frame) % 3) % 3) == ((3 - (((*it).to - (*t1).exon_list.front().from) - (*it).frame) % 3) % 3) ){
+ return 3;
+ }else if ( (t1->strand == '+') && (*t1).exon_list.front().frame == ((3 - (((*t1).exon_list.front().from - (*it).from) - (*it).frame) % 3) % 3) ){
+ return 3;
+ }else{
+ return 0;
+ }
+ }else{
+ if ((*t1).exon_list.front().from >= ((*it).to + (int) properties.minimumIntronLength)){
+ if ((*t1).exon_list.front().frame == -1 && (*it).frame == -1){return 4;}
+ else if (((*t1).exon_list.back().frame != -1 && (*it).frame == -1) || ((*t1).exon_list.back().frame == -1 && (*it).frame != -1)){return 0;}
+ /* if (it != t2->exon_list.begin()){
+ it--;
+ }else{
+ return 0;
+ }*/
+ if ((t1->strand == '-') && ((*it).frame == (3 - ( ((*t1).exon_list.front().to - (*t1).exon_list.front().from + 1) - (*t1).exon_list.front().frame) % 3) % 3)){
+ return 4;
+ }else if ((t1->strand == '+') && ((*t1).exon_list.front().frame == (3 - ( ((*it).to - (*it).from + 1) - (*it).frame) % 3) % 3)){
+ return 4;
+ }else{
+ return 0;
+ }
+ }
+ }
+ }
+ }
+ return 0;
}
void testInputAlternatives(Properties &properties){
- for (auto pointer = (*properties.geneMap).begin(); pointer != (*properties.geneMap).end(); pointer++){
- if (pointer->second->children.size() <= 1){continue;}
- for (list<Transcript*>::iterator it = pointer->second->children.begin(); it != pointer->second->children.end(); it++){
- bool x = false;
- if (!(*it)->tl_complete.first || !(*it)->tl_complete.second){continue;}
-
- for (list<Transcript*>::iterator itI = pointer->second->children.begin(); itI != pointer->second->children.end(); itI++){
- if (!(*itI)->tl_complete.first || !(*itI)->tl_complete.second){continue;}
- if ((*it)->t_id == (*itI)->t_id){continue;}
- if (alternativeVariants((*it), (*itI))){
- x = true;
- }
- }
- if (!x){
- cerr << "The transkript " << (*it)->originalId << " from file " << (*it)->inputFile << " is not an alternative variant in its gene in the definition of this program!" << endl;
- }
+ for (auto pointer = (*properties.geneMap).begin(); pointer != (*properties.geneMap).end(); pointer++){
+ if (pointer->second->children.size() <= 1){continue;}
+ for (list<Transcript*>::iterator it = pointer->second->children.begin(); it != pointer->second->children.end(); it++){
+ bool x = false;
+ if (!(*it)->tl_complete.first || !(*it)->tl_complete.second){continue;}
+
+ for (list<Transcript*>::iterator itI = pointer->second->children.begin(); itI != pointer->second->children.end(); itI++){
+ if (!(*itI)->tl_complete.first || !(*itI)->tl_complete.second){continue;}
+ if ((*it)->t_id == (*itI)->t_id){continue;}
+ if (alternativeVariants((*it), (*itI))){
+ x = true;
}
+ }
+ if (!x){
+ cerr << "The transkript " << (*it)->originalId << " from file " << (*it)->inputFile << " is not an alternative variant in its gene in the definition of this program!" << endl;
+ }
}
+ }
}
void displayWarning(string const &warning, Properties &properties, string warningString){
- int unsigned n = 2;
- properties.warningCount[warningString]++;
- if (properties.warningCount[warningString] <= n){
- cerr << "WARNING: " << warning << endl;
- if (properties.warningCount[warningString] == n){
- cerr << "(This problem occurred already " << n << " times and will not be printed further)..." << endl;
- }
- }
+ int unsigned n = 2;
+ properties.warningCount[warningString]++;
+ if (properties.warningCount[warningString] <= n){
+ cerr << "WARNING: " << warning << endl;
+ if (properties.warningCount[warningString] == n){
+ cerr << "(This problem occurred already " << n << " times and will not be printed further)..." << endl;
+ }
+ }
}
void warningSummary(string const &warning, string const &warning2, Properties &properties, string warningString){
- if (properties.warningCount[warningString] == 0){return;}
- if (warning.empty()){
- cerr << "The " << warningString << " problem occurred " << properties.warningCount[warningString] << " times." << endl;
- }else{
- cerr << warning << properties.warningCount[warningString] << warning2 << endl;
- }
+ if (properties.warningCount[warningString] == 0){return;}
+ if (warning.empty()){
+ cerr << "The " << warningString << " problem occurred " << properties.warningCount[warningString] << " times." << endl;
+ }else{
+ cerr << warning << properties.warningCount[warningString] << warning2 << endl;
+ }
}
diff --git a/auxprogs/joingenes/jg_transcript.h b/auxprogs/joingenes/jg_transcript.h
index a665374..1c2dac7 100644
--- a/auxprogs/joingenes/jg_transcript.h
+++ b/auxprogs/joingenes/jg_transcript.h
@@ -17,8 +17,8 @@ class Transcript;
#define NUM_TYPES 4
enum boundaryStatusType{TYPE_UNKNOWN = -1, // predRange-boundaryStatusType
- NO_PROB=0, FREED=1, INDIRECT_PROBLEM=2, TOO_CLOSE=3 // INDIRECT_PROBLEM means that it is not too close, but there is an other transcript, which transcend its boundary
- // FREED means that the problem exon was erased
+ NO_PROB=0, FREED=1, INDIRECT_PROBLEM=2, TOO_CLOSE=3 // INDIRECT_PROBLEM means that it is not too close, but there is an other transcript, which transcend its boundary
+ // FREED means that the problem exon was erased
};
enum compareType{UNEQUAL=0, ALTERNATIVE=1, EQUAL=2
@@ -28,536 +28,536 @@ bool overlappingCdsWithAnything(Transcript* t1, Transcript* t2);
struct Properties{
public:
- int errordistance;
- string genemodel;
- bool onlyCompare;
- list<string> filenames;
- list<int> priorities;
- list<int> supprList;
- string outFileName;
- bool join;
- bool selecting;
- int nrOfPrintedGenes;
- unsigned int unknownCount;
- unordered_map<string,Gene*>* geneMap;
- unordered_map<string,Transcript*>* transcriptMap;
- unsigned int minimumIntronLength;
- bool alternatives;
- bool stopincoding;
- unordered_map<string,unsigned int> warningCount;
+ int errordistance;
+ string genemodel;
+ bool onlyCompare;
+ list<string> filenames;
+ list<int> priorities;
+ list<int> supprList;
+ string outFileName;
+ bool join;
+ bool selecting;
+ int nrOfPrintedGenes;
+ unsigned int unknownCount;
+ unordered_map<string,Gene*>* geneMap;
+ unordered_map<string,Transcript*>* transcriptMap;
+ unsigned int minimumIntronLength;
+ bool alternatives;
+ bool stopincoding;
+ unordered_map<string,unsigned int> warningCount;
};
class Exon{
public:
- string chr;
- int from, to;
- string feature;
- float score;
- int frame;
- int rangeToBoundary;
- boundaryStatusType boundaryProblem;
-
- int tooMany;
- int tooFew;
- int penalty;
- int distance;
- pair<int,int> predRange;
- bool isUtr () { return (frame == -1); }
- bool operator<(Exon const& rhs) const {
- if (from != rhs.from)
- return (from < rhs.from);
- else
- return (to < rhs.to);
- }
+ string chr;
+ int from, to;
+ string feature;
+ float score;
+ int frame;
+ int rangeToBoundary;
+ boundaryStatusType boundaryProblem;
+
+ int tooMany;
+ int tooFew;
+ int penalty;
+ int distance;
+ pair<int,int> predRange;
+ bool isUtr () { return (frame == -1); }
+ bool operator<(Exon const& rhs) const {
+ if (from != rhs.from)
+ return (from < rhs.from);
+ else
+ return (to < rhs.to);
+ }
};
void output_exon_list(Transcript const* tx); // only for semantic tests
class Gene{
public:
- Gene(string geneID=""){
- this->nrOfTx = 1;
- this->nrOfPrintedTx = 0;
- this->g_id = geneID;
- this->printed = false;
- }
- string g_id;
- list<Transcript*> children;
- int nrOfTx;
- int nrOfPrintedTx;
- bool printed;
+ Gene(string geneID=""){
+ this->nrOfTx = 1;
+ this->nrOfPrintedTx = 0;
+ this->g_id = geneID;
+ this->printed = false;
+ }
+ string g_id;
+ list<Transcript*> children;
+ int nrOfTx;
+ int nrOfPrintedTx;
+ bool printed;
};
class Transcript{
public:
- Transcript(string txID = "", Gene* gene=NULL){
- this->parent = gene;
- this->t_id = txID;
- this->tx_complete.first = false;
- this->tx_complete.second = false;
- this->tl_complete.first = false;
- this->tl_complete.second = false;
- this->isNotFrameCorrect = false;
- this->tss = -1;
- this->tts = -1;
- }
-
- list<string> supporter; // at the moment these list only consist the pointer to transcripts, who are totaly equal to this transcript (doesnt matter whether their creation is related)
- list<Exon> exon_list; // saves every feature (cds, utr, exon [cds+utr]
- list<Exon> intron_list;
- list<Exon> stop_list;
- Gene* parent;
- string source;
- string t_id;
- char strand;
- int tis; // position of first base in translation sequence (translation initation site)
- int tes; // position of last base in translation sequence (translation end site)
- int tss;
- int tts;
- int priority;
- pair<int,int> pred_range; // prediction range borders: <low,high> sequence position
- pair<bool,bool> tx_complete; // transcript end complete at <lower,higher> base number
- pair<bool,bool> tl_complete; // translation end complete at <start,stop> codon
- pair<bool,bool> separated_codon; // separated <start,stop> codon
-
- pair<string,string> joinpartner; // pointer to transcript that was used to complete the <start,stop> codon side
- pair<string,string> utr_joinpartner; // pointer to transcript that was used to fulfill the <downstream-UTR,upstream-UTR> codon side
- bool must_be_deleted; // a transcript with this flag must be deleted
- pair<Exon*,Exon*> outerCds; // CDS with the <lowest,highest> sequence position
- int qualityScore;
- float predictionScore;
- list<string> consistent;
- bool isNotFrameCorrect;
- string originalId;
- string inputFile;
- list<Transcript*> alternatives;
-
- pair<boundaryStatusType,boundaryStatusType> boundaryProblem;
-
- double penalty;
-
- compareType compareValue;
-
-/* boundaryStatusType startBoundaryType(){
+ Transcript(string txID = "", Gene* gene=NULL){
+ this->parent = gene;
+ this->t_id = txID;
+ this->tx_complete.first = false;
+ this->tx_complete.second = false;
+ this->tl_complete.first = false;
+ this->tl_complete.second = false;
+ this->isNotFrameCorrect = false;
+ this->tss = -1;
+ this->tts = -1;
+ }
+
+ list<string> supporter; // at the moment these list only consist the pointer to transcripts, who are totaly equal to this transcript (doesnt matter whether their creation is related)
+ list<Exon> exon_list; // saves every feature (cds, utr, exon [cds+utr]
+ list<Exon> intron_list;
+ list<Exon> stop_list;
+ Gene* parent;
+ string source;
+ string t_id;
+ char strand;
+ int tis; // position of first base in translation sequence (translation initation site)
+ int tes; // position of last base in translation sequence (translation end site)
+ int tss;
+ int tts;
+ int priority;
+ pair<int,int> pred_range; // prediction range borders: <low,high> sequence position
+ pair<bool,bool> tx_complete; // transcript end complete at <lower,higher> base number
+ pair<bool,bool> tl_complete; // translation end complete at <start,stop> codon
+ pair<bool,bool> separated_codon; // separated <start,stop> codon
+
+ pair<string,string> joinpartner; // pointer to transcript that was used to complete the <start,stop> codon side
+ pair<string,string> utr_joinpartner; // pointer to transcript that was used to fulfill the <downstream-UTR,upstream-UTR> codon side
+ bool must_be_deleted; // a transcript with this flag must be deleted
+ pair<Exon*,Exon*> outerCds; // CDS with the <lowest,highest> sequence position
+ int qualityScore;
+ float predictionScore;
+ list<string> consistent;
+ bool isNotFrameCorrect;
+ string originalId;
+ string inputFile;
+ list<Transcript*> alternatives;
+
+ pair<boundaryStatusType,boundaryStatusType> boundaryProblem;
+
+ double penalty;
+
+ compareType compareValue;
+
+ /* boundaryStatusType startBoundaryType(){
if (strand == '+'){
- return exon_list.front().boundaryProblem;
+ return exon_list.front().boundaryProblem;
}else{
- return exon_list.back().boundaryProblem;
+ return exon_list.back().boundaryProblem;
+ }
}
- }
- boundaryStatusType stopBoundaryType(){
+ boundaryStatusType stopBoundaryType(){
if (strand == '+'){
- return exon_list.back().boundaryProblem;
+ return exon_list.back().boundaryProblem;
}else{
- return exon_list.front().boundaryProblem;
+ return exon_list.front().boundaryProblem;
}
- }
-*/
- bool hasCommonExon(Transcript* tx){
- list<Exon>::const_iterator it1 = exon_list.begin();
- list<Exon>::const_iterator it2 = tx->exon_list.begin();
-
- while (it1 != exon_list.end() && it2 != tx->exon_list.end()){
- if ((*it1).from == (*it2).from){
- if((*it1).to == (*it2).to){
- if ((*it1).frame == (*it2).frame){
- return true;
- }else{
- it1++; it2++;
- }
- }else if ((*it1).to < (*it2).to){
- it1++;
- }else{
- it2++;
- }
- }else if ((*it1).from > (*it2).from){
- it2++;
- }else{
- it1++;
- }
}
- return false;
+ */
+ bool hasCommonExon(Transcript* tx){
+ list<Exon>::const_iterator it1 = exon_list.begin();
+ list<Exon>::const_iterator it2 = tx->exon_list.begin();
+
+ while (it1 != exon_list.end() && it2 != tx->exon_list.end()){
+ if ((*it1).from == (*it2).from){
+ if((*it1).to == (*it2).to){
+ if ((*it1).frame == (*it2).frame){
+ return true;
+ }else{
+ it1++; it2++;
+ }
+ }else if ((*it1).to < (*it2).to){
+ it1++;
+ }else{
+ it2++;
+ }
+ }else if ((*it1).from > (*it2).from){
+ it2++;
+ }else{
+ it1++;
+ }
}
-
- bool hasExonInSameReadingFrame(Transcript* tx){
- list<Exon>::const_iterator it1 = exon_list.begin();
- list<Exon>::const_iterator it2 = tx->exon_list.begin();
- if (strand != tx->strand){ return false; }
- while (it1 != exon_list.end() && it2 != tx->exon_list.end()){
- if ( !((*it1).to <= (*it2).from) && !((*it1).from >= (*it2).to) ){
- if (strand=='+'){
- if ( ((*it1).frame + (*it1).from) % 3 == ((*it2).frame + (*it2).from) % 3 ){
- return true;
- }
- }else{
- if ( ((*it1).frame + (*it1).to) % 3 == ((*it2).frame + (*it2).to) % 3 ){
- return true;
- }
- }
+ return false;
+ }
+
+ bool hasExonInSameReadingFrame(Transcript* tx){
+ list<Exon>::const_iterator it1 = exon_list.begin();
+ list<Exon>::const_iterator it2 = tx->exon_list.begin();
+ if (strand != tx->strand){ return false; }
+ while (it1 != exon_list.end() && it2 != tx->exon_list.end()){
+ if ( !((*it1).to <= (*it2).from) && !((*it1).from >= (*it2).to) ){
+ if (strand=='+'){
+ if ( ((*it1).frame + (*it1).from) % 3 == ((*it2).frame + (*it2).from) % 3 ){
+ return true;
}
- if ((*it1).to <= (*it2).to){
- it1++;
- }else{
- it2++;
+ }else{
+ if ( ((*it1).frame + (*it1).to) % 3 == ((*it2).frame + (*it2).to) % 3 ){
+ return true;
}
}
- return false;
+ }
+ if ((*it1).to <= (*it2).to){
+ it1++;
+ }else{
+ it2++;
+ }
}
-
-
- bool hasCommonTlStart(Transcript* tx){
- if (!this->tl_complete.first || !tx->tl_complete.first){return false;}
- if (tis == tx->tis && strand == tx->strand){return true;}else{return false;}
+ return false;
+ }
+
+
+ bool hasCommonTlStart(Transcript* tx){
+ if (!this->tl_complete.first || !tx->tl_complete.first){return false;}
+ if (tis == tx->tis && strand == tx->strand){return true;}else{return false;}
+ }
+
+ bool hasCommonTlStop(Transcript* tx){
+ if (!this->tl_complete.second || !tx->tl_complete.second){return false;}
+ if (tes == tx->tes && strand == tx->strand){return true;}{return false;}
+ }
+
+ string getChr(){
+ return exon_list.front().chr;
+ }
+
+ int getTxStart(){
+ return exon_list.front().from;
+ }
+ int getTxEnd(){
+ return exon_list.back().to;
+ }
+
+ Exon* getCdsFront(){
+ for (list<Exon>::iterator it = exon_list.begin(); it != exon_list.end(); it++){
+ if ((*it).feature == "CDS"){
+ return &(*it); // (*it).from
+ }
}
-
- bool hasCommonTlStop(Transcript* tx){
- if (!this->tl_complete.second || !tx->tl_complete.second){return false;}
- if (tes == tx->tes && strand == tx->strand){return true;}{return false;}
+ return NULL;
+ }
+
+ Exon* getCdsBack(){
+ for (list<Exon>::reverse_iterator it = exon_list.rbegin(); it != exon_list.rend(); it++){
+ if ((*it).feature == "CDS"){
+ return &(*it); // (*it).to
+ }
}
+ return NULL;
+ }
- string getChr(){
- return exon_list.front().chr;
- }
+ void initiate(Properties &properties){
+ exon_list.sort(); // essential for the other steps, so it should be the first one
+ stop_list.sort();
- int getTxStart(){
- return exon_list.front().from;
- }
- int getTxEnd(){
- return exon_list.back().to;
- }
+ outerCds.first = getCdsFront();
+ outerCds.second = getCdsBack();
- Exon* getCdsFront(){
- for (list<Exon>::iterator it = exon_list.begin(); it != exon_list.end(); it++){
- if ((*it).feature == "CDS"){
- return &(*it); // (*it).from
- }
- }
- return NULL;
- }
+ exontoutr();
- Exon* getCdsBack(){
- for (list<Exon>::reverse_iterator it = exon_list.rbegin(); it != exon_list.rend(); it++){
- if ((*it).feature == "CDS"){
- return &(*it); // (*it).to
- }
- }
- return NULL;
+ if (strand == '+'){
+ tis = (outerCds.first)->from;
+ tes = (outerCds.second)->to;
+ }else{
+ tis = (outerCds.second)->to;
+ tes = (outerCds.first)->from;
+ }
+ if (properties.stopincoding){
+ tes_to_cds(); // needs utr structure!
}
- void initiate(Properties &properties){
- exon_list.sort(); // essential for the other steps, so it should be the first one
- stop_list.sort();
-
- outerCds.first = getCdsFront();
- outerCds.second = getCdsBack();
+ calcDistToBoundary(properties);
+ }
- exontoutr();
+ void calcDistToBoundary(Properties &properties){
- if (strand == '+'){
- tis = (outerCds.first)->from;
- tes = (outerCds.second)->to;
- }else{
- tis = (outerCds.second)->to;
- tes = (outerCds.first)->from;
- }
- if (properties.stopincoding){
- tes_to_cds(); // needs utr structure!
- }
-
- calcDistToBoundary(properties);
+ for (list<Exon>::iterator it = exon_list.begin(); it != exon_list.end(); it++){
+ (*it).rangeToBoundary = -1;
}
- void calcDistToBoundary(Properties &properties){
-
- for (list<Exon>::iterator it = exon_list.begin(); it != exon_list.end(); it++){
- (*it).rangeToBoundary = -1;
- }
+ if (pred_range.second){
+ int boundaryDist = pred_range.second - getTxEnd();
+ if (boundaryDist > properties.errordistance){
+ boundaryProblem.second = NO_PROB;
- if (pred_range.second){
- int boundaryDist = pred_range.second - getTxEnd();
- if (boundaryDist > properties.errordistance){
- boundaryProblem.second = NO_PROB;
-
- }else{
- boundaryProblem.second = TOO_CLOSE;
+ }else{
+ boundaryProblem.second = TOO_CLOSE;
+ }
+ }
+ if (pred_range.first){
+ int boundaryDist = getTxStart() - pred_range.first;
+ if (boundaryDist > properties.errordistance){
+ boundaryProblem.first = NO_PROB;
+ }else{
+ boundaryProblem.first = TOO_CLOSE;
+ }
+ }
+ }
+
+ void tes_to_cds(){
+ /*int cdsfront;
+ if (outerCds.first)
+ cdsfront = (outerCds.first)->from;
+ else
+ cdsfront = -1;
+ int cdsback;
+ if (outerCds.second)
+ cdsback = (outerCds.second)->to;
+ else
+ cdsback = -1;*/
+ bool done = false;
+ //if (t_id == "g10104.t1"){cout << "HIER" << endl; sleep(1);}
+ if (strand == '+'){
+ if (tl_complete.second){
+ if (tes != stop_list.back().to){
+ for (list<Exon>::iterator it = exon_list.begin(); it != exon_list.end(); it++){
+ if (((*it).feature == "UTR" || (*it).feature == "3'-UTR" || (*it).feature == "5'-UTR") && tes < (*it).from){
+ done = true;
+ if ((*it).from == tes + 1){
+ int temp = (*it).to - (*it).from + 1;
+ if (temp > 3){
+ (*it).from += 3;
+ it--;
+ (*it).to += 3;
+ }else if (temp == 3){
+ it = exon_list.erase(it);
+ it--;
+ (*it).to += 3;
+ }else{
+ it = exon_list.erase(it);
+ it--;
+ (*it).to += temp;
+ it++;
+ if ((*it).to - (*it).from + 1 > 3 - temp){
+ Exon new_cds = (*it);
+ new_cds.from = (*it).from;
+ new_cds.to = (*it).from + (3 - (temp + 1));
+ new_cds.feature = "CDS";
+ new_cds.frame = (new_cds.to - new_cds.from + 1) % 3;
+ (*it).from += 3 - temp;
+ exon_list.insert(it, new_cds);
+ }else if ((*it).to - (*it).from + 1 == 3 - temp){
+ (*it).feature = "CDS";
+ (*it).frame = 0;
+ }else{
+ cerr << "Fatal error: An exon with start/stop codon part is not even 3 bases long." << endl;
+ exit( EXIT_FAILURE );
+ }
+ }
+ }else{
+ Exon new_cds = (*it);
+ new_cds.from = (*it).from;
+ new_cds.to = (*it).from + 2;
+ new_cds.feature = "CDS";
+ new_cds.frame = 0;
+ (*it).from += 3;
+ exon_list.insert(it, new_cds);
+ }
+ break;
}
- }
- if (pred_range.first){
- int boundaryDist = getTxStart() - pred_range.first;
- if (boundaryDist > properties.errordistance){
- boundaryProblem.first = NO_PROB;
+ }
+ if (!done){
+ if (tes == stop_list.back().to - 3){
+ (outerCds.second)->to += 3;
}else{
- boundaryProblem.first = TOO_CLOSE;
+ Exon new_cds = *(outerCds.second);
+ new_cds.from = stop_list.back().to - 2;
+ new_cds.to = stop_list.back().to;
+ new_cds.feature = "CDS";
+ new_cds.frame = 0;
+ exon_list.push_back(new_cds);
}
+ }
+ tes = stop_list.back().to;
}
- }
-
- void tes_to_cds(){
- /*int cdsfront;
- if (outerCds.first)
- cdsfront = (outerCds.first)->from;
- else
- cdsfront = -1;
- int cdsback;
- if (outerCds.second)
- cdsback = (outerCds.second)->to;
- else
- cdsback = -1;*/
- bool done = false;
-//if (t_id == "g10104.t1"){cout << "HIER" << endl; sleep(1);}
- if (strand == '+'){
- if (tl_complete.second){
- if (tes != stop_list.back().to){
- for (list<Exon>::iterator it = exon_list.begin(); it != exon_list.end(); it++){
- if (((*it).feature == "UTR" || (*it).feature == "3'-UTR" || (*it).feature == "5'-UTR") && tes < (*it).from){
- done = true;
- if ((*it).from == tes + 1){
- int temp = (*it).to - (*it).from + 1;
- if (temp > 3){
- (*it).from += 3;
- it--;
- (*it).to += 3;
- }else if (temp == 3){
- it = exon_list.erase(it);
- it--;
- (*it).to += 3;
- }else{
- it = exon_list.erase(it);
- it--;
- (*it).to += temp;
- it++;
- if ((*it).to - (*it).from + 1 > 3 - temp){
- Exon new_cds = (*it);
- new_cds.from = (*it).from;
- new_cds.to = (*it).from + (3 - (temp + 1));
- new_cds.feature = "CDS";
- new_cds.frame = (new_cds.to - new_cds.from + 1) % 3;
- (*it).from += 3 - temp;
- exon_list.insert(it, new_cds);
- }else if ((*it).to - (*it).from + 1 == 3 - temp){
- (*it).feature = "CDS";
- (*it).frame = 0;
- }else{
- cerr << "Fatal error: An exon with start/stop codon part is not even 3 bases long." << endl;
- exit( EXIT_FAILURE );
- }
- }
- }else{
- Exon new_cds = (*it);
- new_cds.from = (*it).from;
- new_cds.to = (*it).from + 2;
- new_cds.feature = "CDS";
- new_cds.frame = 0;
- (*it).from += 3;
- exon_list.insert(it, new_cds);
- }
- break;
- }
- }
- if (!done){
- if (tes == stop_list.back().to - 3){
- (outerCds.second)->to += 3;
- }else{
- Exon new_cds = *(outerCds.second);
- new_cds.from = stop_list.back().to - 2;
- new_cds.to = stop_list.back().to;
- new_cds.feature = "CDS";
- new_cds.frame = 0;
- exon_list.push_back(new_cds);
- }
+ }/*else{
+ tes = cdsback;
+ }
+ if (!tl_complete.first){
+ tis = cdsfront;
+ }*/
+ }else{ // strand == "-"
+ if (tl_complete.second){ // stop codon exists
+ //if (t_id == "g10104.t1"){cout << "HIER2" << endl; sleep(1);}
+ if (tes != stop_list.front().from){ // stop codon is not in cds
+ //if (t_id == "g10104.t1"){cout << "HIER4" << endl; sleep(1);}
+ for (list<Exon>::iterator it = exon_list.begin(); it != exon_list.end(); it++){
+ if ((*it).feature == "CDS" && tes == (*it).from){
+ if (it == exon_list.end()){
+ cerr << "Fatal error: No exon for an existing codon." << endl;
+ exit( EXIT_FAILURE );
+ }
+ //it--;
+ if (it != exon_list.begin() && ((*(it--)).feature == "UTR" || (*it).feature == "3'-UTR" || (*it).feature == "5'-UTR")){
+ done = true;
+ if ((*it).to == tes - 1){
+ int temp = (*it).to - (*it).from + 1;
+ if (temp > 3){
+ (*it).to -= 3;
+ it++;
+ (*it).from -= 3;
+ }else if (temp == 3){
+ it = exon_list.erase(it);
+ (*it).from -= 3;
+ }else{
+ it = exon_list.erase(it);
+ (*it).from -= temp;
+ it--;
+ if ((*it).to - (*it).from + 1 > 3 - temp){
+ Exon new_cds = (*it);
+ new_cds.to = (*it).to;
+ new_cds.from = (*it).to - (3 - (temp + 1));
+ new_cds.feature = "CDS";
+ new_cds.frame = (new_cds.to - new_cds.from + 1) % 3;
+ (*it).to -= 3 - temp;
+ it++;
+ exon_list.insert(it, new_cds);
+ }else if ((*it).to - (*it).from + 1 == 3 - temp){
+ (*it).feature = "CDS";
+ (*it).frame = 0;
+ }else{
+ cerr << "Fatal error: An exon with start/stop codon part is not even 3 bases long." << endl;
+ exit( EXIT_FAILURE );
}
- tes = stop_list.back().to;
+ }
+ }else{
+ Exon new_cds = (*it);
+ new_cds.to = (*it).to;
+ new_cds.from = (*it).to - 2;
+ new_cds.feature = "CDS";
+ new_cds.frame = 0;
+ (*it).from -= 3;
+ it++;
+ exon_list.insert(it, new_cds);
}
- }/*else{
- tes = cdsback;
+ }
+ break;
}
- if (!tl_complete.first){
- tis = cdsfront;
- }*/
- }else{ // strand == "-"
- if (tl_complete.second){ // stop codon exists
-//if (t_id == "g10104.t1"){cout << "HIER2" << endl; sleep(1);}
- if (tes != stop_list.front().from){ // stop codon is not in cds
-//if (t_id == "g10104.t1"){cout << "HIER4" << endl; sleep(1);}
- for (list<Exon>::iterator it = exon_list.begin(); it != exon_list.end(); it++){
- if ((*it).feature == "CDS" && tes == (*it).from){
- if (it == exon_list.end()){
- cerr << "Fatal error: No exon for an existing codon." << endl;
- exit( EXIT_FAILURE );
- }
- //it--;
- if (it != exon_list.begin() && ((*(it--)).feature == "UTR" || (*it).feature == "3'-UTR" || (*it).feature == "5'-UTR")){
- done = true;
- if ((*it).to == tes - 1){
- int temp = (*it).to - (*it).from + 1;
- if (temp > 3){
- (*it).to -= 3;
- it++;
- (*it).from -= 3;
- }else if (temp == 3){
- it = exon_list.erase(it);
- (*it).from -= 3;
- }else{
- it = exon_list.erase(it);
- (*it).from -= temp;
- it--;
- if ((*it).to - (*it).from + 1 > 3 - temp){
- Exon new_cds = (*it);
- new_cds.to = (*it).to;
- new_cds.from = (*it).to - (3 - (temp + 1));
- new_cds.feature = "CDS";
- new_cds.frame = (new_cds.to - new_cds.from + 1) % 3;
- (*it).to -= 3 - temp;
- it++;
- exon_list.insert(it, new_cds);
- }else if ((*it).to - (*it).from + 1 == 3 - temp){
- (*it).feature = "CDS";
- (*it).frame = 0;
- }else{
- cerr << "Fatal error: An exon with start/stop codon part is not even 3 bases long." << endl;
- exit( EXIT_FAILURE );
- }
- }
- }else{
- Exon new_cds = (*it);
- new_cds.to = (*it).to;
- new_cds.from = (*it).to - 2;
- new_cds.feature = "CDS";
- new_cds.frame = 0;
- (*it).from -= 3;
- it++;
- exon_list.insert(it, new_cds);
- }
- }
- break;
- }
- }
- if (!done){
- if (tes == stop_list.front().from + 3){
- (outerCds.first)->from -= 3;
- }else{
- Exon new_cds = *(outerCds.first);
- new_cds.from = stop_list.front().from;
- new_cds.to = stop_list.front().from + 2;
- new_cds.feature = "CDS";
- new_cds.frame = 0;
- exon_list.push_front(new_cds);
- }
- }
-//if (t_id == "g10104.t1"){cout << "HIER3" << endl; sleep(1);}
- tes = stop_list.front().from;
- }
- }/*else{
- tes = cdsfront;
+ }
+ if (!done){
+ if (tes == stop_list.front().from + 3){
+ (outerCds.first)->from -= 3;
+ }else{
+ Exon new_cds = *(outerCds.first);
+ new_cds.from = stop_list.front().from;
+ new_cds.to = stop_list.front().from + 2;
+ new_cds.feature = "CDS";
+ new_cds.frame = 0;
+ exon_list.push_front(new_cds);
}
- if (!tl_complete.first){
- tis = cdsback;
- }*/
+ }
+ //if (t_id == "g10104.t1"){cout << "HIER3" << endl; sleep(1);}
+ tes = stop_list.front().from;
}
+ }/*else{
+ tes = cdsfront;
+ }
+ if (!tl_complete.first){
+ tis = cdsback;
+ }*/
}
-
- void exontoutr(){
- list<Exon>::iterator it_prev;
- list<Exon>::iterator it_next;
- for (list<Exon>::iterator it = exon_list.begin(); it != exon_list.end(); it++){
- if ((*it).feature == "exon"){
- if (it != exon_list.begin()){
- it_prev = it;
- it_prev--;
- if ((*it_prev).feature == "CDS"){
- if ((*it_prev).to >= (*it).from){
- if ((*it_prev).from == (*it).from && (*it_prev).to == (*it).to){
- it = exon_list.erase(it);
- it--;
- continue;
- }else if ((*it_prev).from == (*it).from){
- (*it).from = (*it_prev).to + 1;
- (*it).feature = "UTR";
- continue;
- }else{cerr << "unexpected case in exontoutr() nr 1 with: " << originalId << " from " << inputFile << " because there is an exon from " << (*it).from << " to " << (*it).to << " and a CDS from " << (*it_prev).from << " to " << (*it_prev).to << endl;}
- }
- }
- }
- it_next = it;
- it_next++;
- if (it_next != exon_list.end()){
- if ((*it_next).feature == "CDS"){
- if ((*it).to >= (*it_next).from){
- if ((*it_next).from == (*it).from && (*it_next).to == (*it).to){
- it = exon_list.erase(it);
- it--;
- continue;
- }else if ((*it_next).to == (*it).to){
- (*it).to = (*it_next).from - 1;
- (*it).feature = "UTR";
- continue;
- }else if ((*it).to > (*it_next).to){
- (*it).feature = "UTR";
- Exon new_utr = (*it);
- new_utr.from = (*it_next).to + 1;
- (*it).to = (*it_next).from - 1;
- it_next++;
- exon_list.insert(it_next, new_utr);
- continue;
- }else{cerr << "unexpected case in exontoutr() nr 2" << originalId << " from " << inputFile << " because there is an exon from " << (*it).from << " to " << (*it).to << " and a CDS from " << (*it_next).from << " to " << (*it_next).to << endl;}
- }
- }
- }
+ }
+
+ void exontoutr(){
+ list<Exon>::iterator it_prev;
+ list<Exon>::iterator it_next;
+ for (list<Exon>::iterator it = exon_list.begin(); it != exon_list.end(); it++){
+ if ((*it).feature == "exon"){
+ if (it != exon_list.begin()){
+ it_prev = it;
+ it_prev--;
+ if ((*it_prev).feature == "CDS"){
+ if ((*it_prev).to >= (*it).from){
+ if ((*it_prev).from == (*it).from && (*it_prev).to == (*it).to){
+ it = exon_list.erase(it);
+ it--;
+ continue;
+ }else if ((*it_prev).from == (*it).from){
+ (*it).from = (*it_prev).to + 1;
(*it).feature = "UTR";
+ continue;
+ }else{cerr << "unexpected case in exontoutr() nr 1 with: " << originalId << " from " << inputFile << " because there is an exon from " << (*it).from << " to " << (*it).to << " and a CDS from " << (*it_prev).from << " to " << (*it_prev).to << endl;}
}
+ }
}
- }
- bool operator<(Transcript const& rhs) const {
- if (min(tis,tes) != min(rhs.tis,rhs.tes))
- return (min(tis,tes) < min(rhs.tis,rhs.tes));
- else
- return (max(tis,tes) < max(rhs.tis,rhs.tes));
- }
-
- bool indirectBoundaryProblem(Transcript* tx){
- if (overlappingCdsWithAnything(this, tx) && this->strand == tx->strand){
- bool problem = false;
- // does "this" transcend the predictionBoundary of tx in tail direction
- if (this->pred_range.second && tx->getTxEnd() > this->pred_range.second){
- if (!(this->boundaryProblem.second > 2)){ this->boundaryProblem.second = INDIRECT_PROBLEM; }
- problem = true;
- }
-
- // does "this" transcend the predictionBoundary of tx in front direction
- if (this->pred_range.first && tx->getTxStart() < this->pred_range.first){
- if (!(this->boundaryProblem.first > 2)){ this->boundaryProblem.first = INDIRECT_PROBLEM; }
- problem = true;
+ it_next = it;
+ it_next++;
+ if (it_next != exon_list.end()){
+ if ((*it_next).feature == "CDS"){
+ if ((*it).to >= (*it_next).from){
+ if ((*it_next).from == (*it).from && (*it_next).to == (*it).to){
+ it = exon_list.erase(it);
+ it--;
+ continue;
+ }else if ((*it_next).to == (*it).to){
+ (*it).to = (*it_next).from - 1;
+ (*it).feature = "UTR";
+ continue;
+ }else if ((*it).to > (*it_next).to){
+ (*it).feature = "UTR";
+ Exon new_utr = (*it);
+ new_utr.from = (*it_next).to + 1;
+ (*it).to = (*it_next).from - 1;
+ it_next++;
+ exon_list.insert(it_next, new_utr);
+ continue;
+ }else{cerr << "unexpected case in exontoutr() nr 2" << originalId << " from " << inputFile << " because there is an exon from " << (*it).from << " to " << (*it).to << " and a CDS from " << (*it_next).from << " to " << (*it_next).to << endl;}
}
- return problem;
+ }
}
- return false;
+ (*it).feature = "UTR";
+ }
}
-
- void updateExonSpecificValues(Transcript* t2, int fittingCase){
- if (fittingCase <= 2){
- this->boundaryProblem.second = t2->boundaryProblem.second;
- this->pred_range.second = t2->pred_range.second;
- }else{
- this->boundaryProblem.first = t2->boundaryProblem.first;
- this->pred_range.first = t2->pred_range.first;
- }
+ }
+ bool operator<(Transcript const& rhs) const {
+ if (min(tis,tes) != min(rhs.tis,rhs.tes))
+ return (min(tis,tes) < min(rhs.tis,rhs.tes));
+ else
+ return (max(tis,tes) < max(rhs.tis,rhs.tes));
+ }
+
+ bool indirectBoundaryProblem(Transcript* tx){
+ if (overlappingCdsWithAnything(this, tx) && this->strand == tx->strand){
+ bool problem = false;
+ // does "this" transcend the predictionBoundary of tx in tail direction
+ if (this->pred_range.second && tx->getTxEnd() > this->pred_range.second){
+ if (!(this->boundaryProblem.second > 2)){ this->boundaryProblem.second = INDIRECT_PROBLEM; }
+ problem = true;
+ }
+
+ // does "this" transcend the predictionBoundary of tx in front direction
+ if (this->pred_range.first && tx->getTxStart() < this->pred_range.first){
+ if (!(this->boundaryProblem.first > 2)){ this->boundaryProblem.first = INDIRECT_PROBLEM; }
+ problem = true;
+ }
+ return problem;
}
+ return false;
+ }
+
+ void updateExonSpecificValues(Transcript* t2, int fittingCase){
+ if (fittingCase <= 2){
+ this->boundaryProblem.second = t2->boundaryProblem.second;
+ this->pred_range.second = t2->pred_range.second;
+ }else{
+ this->boundaryProblem.first = t2->boundaryProblem.first;
+ this->pred_range.first = t2->pred_range.first;
+ }
+ }
};
class Point{
public:
- double i_x;
- double i_y;
- int x;
- int y;
-
- bool operator<(Point const& rhs) const {
- if (y != rhs.y)
- return (y > rhs.y);
- else
- return (x < rhs.x);
- }
+ double i_x;
+ double i_y;
+ int x;
+ int y;
+
+ bool operator<(Point const& rhs) const {
+ if (y != rhs.y)
+ return (y > rhs.y);
+ else
+ return (x < rhs.x);
+ }
};
void divideInOverlapsAndConquer(list<Transcript*> &transcript_list, Properties &properties);
diff --git a/auxprogs/joingenes/joingenes.cpp b/auxprogs/joingenes/joingenes.cpp
index 4b95c8b..a389df2 100644
--- a/auxprogs/joingenes/joingenes.cpp
+++ b/auxprogs/joingenes/joingenes.cpp
@@ -2,7 +2,8 @@
#include <string> // strings
#include <fstream> // input/output on hard drive
#include <list> // list
-#include <unordered_map> // hash
+#include <map> // hash
+#include <unordered_map> // unordered hash
#include <unistd.h> // for getopt()
#include <getopt.h> // for getopt() with long option
@@ -12,387 +13,400 @@
using namespace std;
static const struct option longOpts[] = {
- { "genesets", required_argument, NULL, 'g' },
- { "priorities", required_argument, NULL, 'p' },
- { "output", required_argument, NULL, 'o' },
- { "errordistance", required_argument, NULL, 'e' },
- { "genemodel", required_argument, NULL, 'm'},
- { "onlycompare", no_argument, NULL, 'c'},
- { "suppress", required_argument, NULL, 's' },
- { "nojoin", no_argument, NULL, 'j' },
- { "noselection", no_argument, NULL, 'l' },
- { "alternatives", no_argument, NULL, 'a' },
- { "stopincoding", no_argument, NULL, 'i' },
- { "help", no_argument, NULL, 'h' },
- { NULL, no_argument, NULL, 0 }
+ { "genesets", required_argument, NULL, 'g' },
+ { "priorities", required_argument, NULL, 'p' },
+ { "inputfile", required_argument, NULL, 'f' },
+ { "output", required_argument, NULL, 'o' },
+ { "errordistance", required_argument, NULL, 'e' },
+ { "genemodel", required_argument, NULL, 'm'},
+ { "onlycompare", no_argument, NULL, 'c'},
+ { "suppress", required_argument, NULL, 's' },
+ { "nojoin", no_argument, NULL, 'j' },
+ { "noselection", no_argument, NULL, 'l' },
+ { "alternatives", no_argument, NULL, 'a' },
+ { "stopincoding", no_argument, NULL, 'i' },
+ { "help", no_argument, NULL, 'h' },
+ { NULL, no_argument, NULL, 0 }
};
void display_help(void)
{
- cout << "joingenes - merge several gene sets into one, including the combination of transcripts to new ones not present in input" << endl;
- cout << "This program works in several steps:" << endl;
- cout << " 1. divide the set of all transcripts into smaller sets, in which all transcripts are on the same sequence and are overlapping at least with one other transcript in this set (set is called \"overlap\")" << endl;
- cout << " 2. delete all duplications of transcripts and save the variant with the highest \"score\"" << endl;
- cout << " 3. if sequence ranges are set for some transcripts, the program detects, whether the distance to that range is dangerously close" << endl;
- cout << " 4. join:" << endl;
- cout << " 4.1. if there is a transcript dangerously close to one/both end(s) of a sequence range, the program creates a copy without the corresponding terminal exon" << endl;
- cout << " 4.2. if there is a transcript with start or stop codon in a set and a second one without this codon and they are \"joinable\", than this step joines the corresponesponding terminal exons" << endl;
- cout << " 5. selection: selects the \"best\" gene structure out of all possible \"maximum\" gene structures" << endl;
- cout << " - \"maximum\" gene structure is a set of transcripts from an overlap so that there is no other transcript in the overlap, which can be added to the set without producing a \"contradiction\"" << endl;
- cout << " - a gene structure is \"better\" than another one, if it has the transcript with the highest \"score\", which is not present in the other gene structure" << endl;
- cout << endl;
- cout << " Options:" << endl;
- cout << " Necessary:" << endl;
- cout << "\t--genesets=file1,file2,...\t-g file1,file2,...\twhere \"file1,file2,...,filen\" have to be data files with genesets in GTF format." << endl;
- cout << "\t--output=ofile\t\t\t-o ofile\t\twhere \"ofile\" is the name for an output file (GTF)." << endl;
- cout << " Optional:" << endl;
- cout << " Parameters:" << endl;
- cout << "\t--priorities=pr1,pr2,...\t-p pr1,pr2,...\t\twhere \"pr1,pr2,...,prn\" have to be positiv integers (different from 0)." << endl;
- cout << "\t\t\t\t\t\t\t\tHave to be as many as filenames are added." << endl;
- cout << "\t\t\t\t\t\t\t\tBigger numbers means a higher priority." << endl;
- cout << "\t\t\t\t\t\t\t\tIf no priorities are added, the program will set all priorties to 1." << endl;
- cout << "\t\t\t\t\t\t\t\tThis option is only useful, if there is more than one geneset." << endl;
- cout << "\t\t\t\t\t\t\t\tIf there is a conflict between two transcripts, so that they can not be picked in the same genestructure, joingenes decides for the one with the highest priority." << endl;
- cout << "\t--errordistance=x\t\t-e x\t\t\twhere \"x\" is a non-negative integer" << endl;
- cout << "\t\t\t\t\t\t\t\tIf a prediction is <=x bases next to a prediction range border, the program supposes, that there could be a mistake." << endl;
- cout << "\t\t\t\t\t\t\t\tDefault is 1000." << endl;
- cout << "\t\t\t\t\t\t\t\tTo disable the function, set errordistance to a negative number (e.g. -1)." << endl;
- cout << "\t--genemodel=x\t\t\t-m x\t\t\twhere \"x\" is a genemodel from the set {eukaryote, bacterium}." << endl;
- cout << "\t\t\t\t\t\t\t\tDefault is eukaryotic." << endl;
- cout << "\t--alternatives\t\t\t-a\t\t\tis a flag" << endl;
- cout << "\t\t\t\t\t\t\t\tIf this flag is set, the program joines different genes, if the transcripts of the genes are alternative variants." << endl;
- cout << endl;
- cout << " Format changes of input/output:" << endl;
- cout << "\t--suppress=pr1,pr2,..\t\t-s pr1,pr2,...\t\twhere \"pr1,pr2,...,prm\" have to be positiv integers (different from 0)." << endl;
- cout << "\t\t\t\t\t\t\t\tDefault is none." << endl;
- cout << "\t\t\t\t\t\t\t\tif the core of a joined/non-joined transcript has one of these priorities it will not occur in the output file." << endl;
- cout << "\t--stopincoding\t\t\t-i\t\t\tis a flag" << endl;
- cout << "\t\t\t\t\t\t\t\tIf this flag is set, the program joines the stop_codons to the CDS." << endl;
- cout << endl;
- cout << " Enable/Disable program parts:" << endl;
- cout << "\t--nojoin\t\t\t-j\t\t\tis a flag (to disable joining)." << endl;
- cout << "\t\t\t\t\t\t\t\tIf this flag is set, the program will not join/merge/shuffle;" << endl;
- cout << "\t\t\t\t\t\t\t\tit will only decide between the unchanged input transcipts and output them." << endl;
- cout << "\t--noselection\t\t\t-l\t\t\tis a flag (to disable selection)." << endl;
- cout << "\t\t\t\t\t\t\t\tIf this flag is set, the program will NOT select at the end between \"contradictory\" transcripts." << endl;
- cout << "\t\t\t\t\t\t\t\t\"contradictory\" is self defined with respect to known biological terms." << endl;
- cout << "\t\t\t\t\t\t\t\tThe selection works with a self defined scoring function." << endl;
- cout << endl;
- cout << " Secondary program functions:" << endl;
- cout << "\t--onlycompare\t\t\t-c\t\t\tis a flag." << endl;
- cout << "\t\t\t\t\t\t\t\tIf this flag is set, it disables the normal function of the program and" << endl;
- cout << "\t\t\t\t\t\t\t\tactivates a compare and separate mode to separate equal transcripts from non equal ones." << endl;
- cout << endl;
- cout << " This help:" << endl;
- cout << "\t--help \t\t\t\t-h\t\t\tprints the help documentation." << endl;
- cout << endl;
- exit( EXIT_FAILURE );
+ cout << "joingenes - merge several gene sets into one, including the combination of transcripts to new ones not present in input" << endl;
+ cout << "This program works in several steps:" << endl;
+ cout << " 1. divide the set of all transcripts into smaller sets, in which all transcripts are on the same sequence and are overlapping at least with one other transcript in this set (set is called \"overlap\")" << endl;
+ cout << " 2. delete all duplications of transcripts and save the variant with the highest \"score\"" << endl;
+ cout << " 3. if sequence ranges are set for some transcripts, the program detects, whether the distance to that range is dangerously close" << endl;
+ cout << " 4. join:" << endl;
+ cout << " 4.1. if there is a transcript dangerously close to one/both end(s) of a sequence range, the program creates a copy without the corresponding terminal exon" << endl;
+ cout << " 4.2. if there is a transcript with start or stop codon in a set and a second one without this codon and they are \"joinable\", than this step joines the corresponesponding terminal exons" << endl;
+ cout << " 5. selection: selects the \"best\" gene structure out of all possible \"maximum\" gene structures" << endl;
+ cout << " - \"maximum\" gene structure is a set of transcripts from an overlap so that there is no other transcript in the overlap, which can be added to the set without producing a \"contradiction\"" << endl;
+ cout << " - a gene structure is \"better\" than another one, if it has the transcript with the highest \"score\", which is not present in the other gene structure" << endl;
+ cout << endl;
+ cout << " Options:" << endl;
+ cout << " Necessary:" << endl;
+ cout << "\t--genesets=file1,file2,...\t-g file1,file2,...\twhere \"file1,file2,...,filen\" have to be data files with genesets in GTF format." << endl;
+ cout << "\t--output=ofile\t\t\t-o ofile\t\twhere \"ofile\" is the name for an output file (GTF)." << endl;
+ cout << " Optional:" << endl;
+ cout << " Parameters:" << endl;
+ cout << "\t--priorities=pr1,pr2,...\t-p pr1,pr2,...\t\twhere \"pr1,pr2,...,prn\" have to be positiv integers (different from 0)." << endl;
+ cout << "\t--inputfile=file\t\t-f file\t\twhere \"file\" is the path of a file containing paths to GTF files and corresponding priorities in a tab-separated list (2 columns). Use this option instead of -g and -p" << endl;
+ cout << "\t\t\t\t\t\t\t\tHave to be as many as filenames are added." << endl;
+ cout << "\t\t\t\t\t\t\t\tBigger numbers means a higher priority." << endl;
+ cout << "\t\t\t\t\t\t\t\tIf no priorities are added, the program will set all priorties to 1." << endl;
+ cout << "\t\t\t\t\t\t\t\tThis option is only useful, if there is more than one geneset." << endl;
+ cout << "\t\t\t\t\t\t\t\tIf there is a conflict between two transcripts, so that they can not be picked in the same genestructure, joingenes decides for the one with the highest priority." << endl;
+ cout << "\t--errordistance=x\t\t-e x\t\t\twhere \"x\" is a non-negative integer" << endl;
+ cout << "\t\t\t\t\t\t\t\tIf a prediction is <=x bases next to a prediction range border, the program supposes, that there could be a mistake." << endl;
+ cout << "\t\t\t\t\t\t\t\tDefault is 1000." << endl;
+ cout << "\t\t\t\t\t\t\t\tTo disable the function, set errordistance to a negative number (e.g. -1)." << endl;
+ cout << "\t--genemodel=x\t\t\t-m x\t\t\twhere \"x\" is a genemodel from the set {eukaryote, bacterium}." << endl;
+ cout << "\t\t\t\t\t\t\t\tDefault is eukaryotic." << endl;
+ cout << "\t--alternatives\t\t\t-a\t\t\tis a flag" << endl;
+ cout << "\t\t\t\t\t\t\t\tIf this flag is set, the program joines different genes, if the transcripts of the genes are alternative variants." << endl;
+ cout << endl;
+ cout << " Format changes of input/output:" << endl;
+ cout << "\t--suppress=pr1,pr2,..\t\t-s pr1,pr2,...\t\twhere \"pr1,pr2,...,prm\" have to be positiv integers (different from 0)." << endl;
+ cout << "\t\t\t\t\t\t\t\tDefault is none." << endl;
+ cout << "\t\t\t\t\t\t\t\tif the core of a joined/non-joined transcript has one of these priorities it will not occur in the output file." << endl;
+ cout << "\t--stopincoding\t\t\t-i\t\t\tis a flag" << endl;
+ cout << "\t\t\t\t\t\t\t\tIf this flag is set, the program joines the stop_codons to the CDS." << endl;
+ cout << endl;
+ cout << " Enable/Disable program parts:" << endl;
+ cout << "\t--nojoin\t\t\t-j\t\t\tis a flag (to disable joining)." << endl;
+ cout << "\t\t\t\t\t\t\t\tIf this flag is set, the program will not join/merge/shuffle;" << endl;
+ cout << "\t\t\t\t\t\t\t\tit will only decide between the unchanged input transcipts and output them." << endl;
+ cout << "\t--noselection\t\t\t-l\t\t\tis a flag (to disable selection)." << endl;
+ cout << "\t\t\t\t\t\t\t\tIf this flag is set, the program will NOT select at the end between \"contradictory\" transcripts." << endl;
+ cout << "\t\t\t\t\t\t\t\t\"contradictory\" is self defined with respect to known biological terms." << endl;
+ cout << "\t\t\t\t\t\t\t\tThe selection works with a self defined scoring function." << endl;
+ cout << endl;
+ cout << " Secondary program functions:" << endl;
+ cout << "\t--onlycompare\t\t\t-c\t\t\tis a flag." << endl;
+ cout << "\t\t\t\t\t\t\t\tIf this flag is set, it disables the normal function of the program and" << endl;
+ cout << "\t\t\t\t\t\t\t\tactivates a compare and separate mode to separate equal transcripts from non equal ones." << endl;
+ cout << endl;
+ cout << " This help:" << endl;
+ cout << "\t--help \t\t\t\t-h\t\t\tprints the help documentation." << endl;
+ cout << endl;
+ exit( EXIT_FAILURE );
}
void display_error(string const &error)
{
- cerr << "Usage error: " << error << endl;
- display_help();
- exit( EXIT_FAILURE );
+ cerr << "Usage error: " << error << endl;
+ display_help();
+ exit( EXIT_FAILURE );
}
list<string> get_filenames(char* filename_string){
- list<string> filenames;
- char *temp_inside;
- string str_temp = filename_string;
- unsigned int n_comma = count(str_temp.begin(), str_temp.end(), ',');
- if (n_comma){
- temp_inside = strtok(filename_string, ",");
- filenames.push_back(temp_inside);
- for (unsigned int j = 1; j <= n_comma; j++){
- temp_inside = strtok(NULL, ",");
- filenames.push_back(temp_inside);
- }
- }else{
- filenames.push_back(filename_string);
+ list<string> filenames;
+ char *temp_inside;
+ string str_temp = filename_string;
+ unsigned int n_comma = count(str_temp.begin(), str_temp.end(), ',');
+ if (n_comma){
+ temp_inside = strtok(filename_string, ",");
+ filenames.push_back(temp_inside);
+ for (unsigned int j = 1; j <= n_comma; j++){
+ temp_inside = strtok(NULL, ",");
+ filenames.push_back(temp_inside);
}
- return filenames;
+ }else{
+ filenames.push_back(filename_string);
+ }
+ return filenames;
}
list<int> get_priorities(char* priority_string){
- list<int> priorities;
- char *temp_inside;
- string str_temp = priority_string;
- unsigned int n_comma = count(str_temp.begin(), str_temp.end(), ',');
- if (n_comma){
- temp_inside = strtok(priority_string, ",");
- priorities.push_back(atoi(temp_inside));
- for (unsigned int j = 1; j <= n_comma; j++){
- temp_inside = strtok(NULL, ",");
- priorities.push_back(atoi(temp_inside));
- }
- }else{
- priorities.push_back(atoi(priority_string));
+ list<int> priorities;
+ char *temp_inside;
+ string str_temp = priority_string;
+ unsigned int n_comma = count(str_temp.begin(), str_temp.end(), ',');
+ if (n_comma){
+ temp_inside = strtok(priority_string, ",");
+ priorities.push_back(atoi(temp_inside));
+ for (unsigned int j = 1; j <= n_comma; j++){
+ temp_inside = strtok(NULL, ",");
+ priorities.push_back(atoi(temp_inside));
}
- return priorities;
+ }else{
+ priorities.push_back(atoi(priority_string));
+ }
+ return priorities;
}
list<int> getSuppressionList(char* suppString){
- list<int> supprList;
- char *temp_inside;
- string str_temp = suppString;
- unsigned int n_comma = count(str_temp.begin(), str_temp.end(), ',');
- if (n_comma){
- temp_inside = strtok(suppString, ",");
- supprList.push_back(atoi(temp_inside));
- for (unsigned int j = 1; j <= n_comma; j++){
- temp_inside = strtok(NULL, ",");
- supprList.push_back(atoi(temp_inside));
- }
- }else{
- supprList.push_back(atoi(suppString));
+ list<int> supprList;
+ char *temp_inside;
+ string str_temp = suppString;
+ unsigned int n_comma = count(str_temp.begin(), str_temp.end(), ',');
+ if (n_comma){
+ temp_inside = strtok(suppString, ",");
+ supprList.push_back(atoi(temp_inside));
+ for (unsigned int j = 1; j <= n_comma; j++){
+ temp_inside = strtok(NULL, ",");
+ supprList.push_back(atoi(temp_inside));
}
- return supprList;
+ }else{
+ supprList.push_back(atoi(suppString));
+ }
+ return supprList;
}
void check_cds_stop_combination(Transcript* tx, pair<string,string> &stopVariants, Properties &properties){
- if (tx->strand == '+'){
- if ((tx->tl_complete.second && tx->stop_list.empty()) || (!tx->tl_complete.second && !tx->stop_list.empty())){display_error("Semantic Error: stop-complete but no stop_codon.");}
- if (!tx->stop_list.empty()){
- if (tx->tes == tx->stop_list.back().to){
- stopVariants.first = tx->t_id;
- }else{
- stopVariants.second = tx->t_id;
- }
- }
- }else{
- if ((tx->tl_complete.second && tx->stop_list.empty()) || (!tx->tl_complete.second && !tx->stop_list.empty())){display_error("Semantic Error: stop-complete but no stop_codon.");}
- if (!tx->stop_list.empty()){
- if (tx->tes == tx->stop_list.front().from){
- stopVariants.first = tx->t_id;
- }else{
- stopVariants.second = tx->t_id;
- }
- }
+ if (tx->strand == '+'){
+ if ((tx->tl_complete.second && tx->stop_list.empty()) || (!tx->tl_complete.second && !tx->stop_list.empty())){display_error("Semantic Error: stop-complete but no stop_codon.");}
+ if (!tx->stop_list.empty()){
+ if (tx->tes == tx->stop_list.back().to){
+ stopVariants.first = tx->t_id;
+ }else{
+ stopVariants.second = tx->t_id;
+ }
}
-
- if (!stopVariants.first.empty() && !stopVariants.second.empty()){
- display_error("E.g. the stop_codon of "+(*properties.transcriptMap)[stopVariants.first]->originalId+" from "+(*properties.transcriptMap)[stopVariants.first]->inputFile+" is inside of the CDS and the stop_codon of "+(*properties.transcriptMap)[stopVariants.second]->originalId+" from "+(*properties.transcriptMap)[stopVariants.second]->inputFile+" is outside of the CDS. You have to make it equally!");
+ }else{
+ if ((tx->tl_complete.second && tx->stop_list.empty()) || (!tx->tl_complete.second && !tx->stop_list.empty())){display_error("Semantic Error: stop-complete but no stop_codon.");}
+ if (!tx->stop_list.empty()){
+ if (tx->tes == tx->stop_list.front().from){
+ stopVariants.first = tx->t_id;
+ }else{
+ stopVariants.second = tx->t_id;
+ }
}
+ }
+
+ if (!stopVariants.first.empty() && !stopVariants.second.empty()){
+ display_error("E.g. the stop_codon of "+(*properties.transcriptMap)[stopVariants.first]->originalId+" from "+(*properties.transcriptMap)[stopVariants.first]->inputFile+" is inside of the CDS and the stop_codon of "+(*properties.transcriptMap)[stopVariants.second]->originalId+" from "+(*properties.transcriptMap)[stopVariants.second]->inputFile+" is outside of the CDS. You have to make it equally!");
+ }
}
int main(int argc, char* argv[])
{
- int opt = 0;
- static const char *optString = "g:p:o:e:m:s:jlaich?";
- list<string> filenames;
- list<int> priorities;
- list<int> supprList;
- string filename_out;
- int longIndex;
- Properties properties;
- properties.errordistance = 1000;
- properties.genemodel = "eukaryote";
- properties.onlyCompare = false;
- properties.join = true;
- properties.selecting = true;
- properties.alternatives = false;
- properties.nrOfPrintedGenes = 0;
- properties.unknownCount = 1;
- properties.minimumIntronLength = 20; // hard coded (not optional at the moment)
- properties.stopincoding = false;
-
- opt = getopt_long(argc, argv, optString, longOpts, &longIndex);
- while (opt != -1) {
- switch (opt) {
- case 'g':
- filenames = get_filenames(optarg);
- break;
-
- case 'p':
- priorities = get_priorities(optarg);
- break;
-
- case 'o':
- properties.outFileName = optarg;
- break;
-
- case 'e':
- if (strstr(optarg, "rror") !=NULL){display_error("You have to write two \"-\" before the optionname \"errordistance\".");}
- properties.errordistance = atoi(optarg);
- break;
-
- case 'm':
- if (strstr(optarg, "bacterium") == NULL){display_error("You used a wrong parameter for genemodel (allowed are \"bacterium\").");}
- properties.genemodel = optarg;
- break;
-
- case 'c':
- properties.onlyCompare = true;
- break;
-
- case 's':
- supprList = getSuppressionList(optarg);
- break;
-
- case 'j':
- properties.join = false;
- break;
-
- case 'l':
- properties.selecting = false;
- break;
-
- case 'a':
- properties.alternatives = true;
- break;
-
- case 'i':
- properties.stopincoding = true;
- break;
-
- case 'h':
- display_help();
- break;
-
- case '0': // long option without short form
- break;
-
- case '?':
- display_error("You entered an invalid option.");
- break;
-
- default:
- break;
- }
- opt = getopt_long(argc, argv, optString, longOpts, &longIndex);
+ int opt = 0;
+ static const char *optString = "g:p:f:o:e:m:s:jlaich?";
+ list<string> filenames;
+ list<int> priorities;
+ list<int> supprList;
+ string filename_out;
+ int longIndex;
+ Properties properties;
+ properties.errordistance = 1000;
+ properties.genemodel = "eukaryote";
+ properties.onlyCompare = false;
+ properties.join = true;
+ properties.selecting = true;
+ properties.alternatives = false;
+ properties.nrOfPrintedGenes = 0;
+ properties.unknownCount = 1;
+ properties.minimumIntronLength = 20; // hard coded (not optional at the moment)
+ properties.stopincoding = false;
+ map<string,int> input;
+
+ opt = getopt_long(argc, argv, optString, longOpts, &longIndex);
+ while (opt != -1) {
+ switch (opt) {
+ case 'g':
+ filenames = get_filenames(optarg);
+ break;
+
+ case 'p':
+ priorities = get_priorities(optarg);
+ break;
+
+ case 'f':
+ input = getFileNames(optarg);
+ for(map<string,int>::iterator itF = input.begin(); itF != input.end(); itF++) {
+ filenames.push_back(itF->first);
+ priorities.push_back(itF->second);
+ }
+ break;
+
+ case 'o':
+ properties.outFileName = optarg;
+ break;
+
+ case 'e':
+ if (strstr(optarg, "rror") !=NULL){display_error("You have to write two \"-\" before the optionname \"errordistance\".");}
+ properties.errordistance = atoi(optarg);
+ break;
+
+ case 'm':
+ if (strstr(optarg, "bacterium") == NULL){display_error("You used a wrong parameter for genemodel (allowed are \"bacterium\").");}
+ properties.genemodel = optarg;
+ break;
+
+ case 'c':
+ properties.onlyCompare = true;
+ break;
+
+ case 's':
+ supprList = getSuppressionList(optarg);
+ break;
+
+ case 'j':
+ properties.join = false;
+ break;
+
+ case 'l':
+ properties.selecting = false;
+ break;
+
+ case 'a':
+ properties.alternatives = true;
+ break;
+
+ case 'i':
+ properties.stopincoding = true;
+ break;
+
+ case 'h':
+ display_help();
+ break;
+
+ case '0': // long option without short form
+ break;
+
+ case '?':
+ display_error("You entered an invalid option.");
+ break;
+
+ default:
+ break;
}
- if (filenames.size() == 0){
- display_error("Missing input filenames.");
+ opt = getopt_long(argc, argv, optString, longOpts, &longIndex);
+ }
+
+ if (filenames.size() == 0){
+ display_error("Missing input filenames.");
+ }
+ if (properties.outFileName == "" && !properties.onlyCompare){
+ display_error("Missing output filename.");
+ }
+ if (priorities.size() == 0){
+ if (filenames.size()>1){
+ cout << "All priorities set to 1 (default)." << endl;
}
- if (properties.outFileName == ""){
- display_error("Missing output filename.");
+ for (list<string>::iterator it_f = filenames.begin(); it_f != filenames.end(); it_f++){
+ priorities.push_back(1);
}
- if (priorities.size() == 0){
- if (filenames.size()>1){
- cout << "All priorities set to 1 (default)." << endl;
- }
- for (list<string>::iterator it_f = filenames.begin(); it_f != filenames.end(); it_f++){
- priorities.push_back(1);
- }
- }else{
- for (list<int>::iterator it_p = priorities.begin(); it_p != priorities.end(); it_p++){
- if ((*it_p) == 0){
- display_error("It is forbidden that a priority is equal to 0.");
- }
- }
+ }else{
+ for (list<int>::iterator it_p = priorities.begin(); it_p != priorities.end(); it_p++){
+ if ((*it_p) == 0){
+ display_error("It is forbidden that a priority is equal to 0.");
+ }
}
-
- properties.filenames = filenames;
- properties.priorities = priorities;
- properties.supprList = supprList;
- properties.minimumIntronLength = 20;
-
- if (properties.onlyCompare == true && (properties.priorities.size() != 2 || properties.priorities.begin() == properties.priorities.end())){
- display_error("CompareMode is only working with exact 2 priorities, which have to be different.");
+ }
+
+ properties.filenames = filenames;
+ properties.priorities = priorities;
+ properties.supprList = supprList;
+ properties.minimumIntronLength = 20;
+
+ if (properties.onlyCompare == true && (properties.priorities.size() != 2 || properties.priorities.begin() == properties.priorities.end())){
+ display_error("CompareMode is only working with exact 2 priorities, which have to be different.");
+ }
+
+ unordered_map<string,Gene*> geneMap;
+ properties.geneMap = &geneMap;
+ unordered_map<string,Transcript*> transcriptMap;
+ properties.transcriptMap = &transcriptMap;
+
+ if (priorities.size() == filenames.size()){
+ unordered_map<string,bool> taxaMap;
+ list<int>::iterator it_p = priorities.begin();
+ for (list<string>::iterator it_f = filenames.begin(); it_f != filenames.end(); it_f++){
+ load(geneMap, (*it_f) ,(*it_p), taxaMap, properties);
+ cout << "# After loading " << (*it_f) << " (Priority " << (*it_p) << ") there are " << (*properties.transcriptMap).size() << " transcripts in transcript list." << endl;
+ it_p++;
}
- unordered_map<string,Gene*> geneMap;
- properties.geneMap = &geneMap;
- unordered_map<string,Transcript*> transcriptMap;
- properties.transcriptMap = &transcriptMap;
-
- if (priorities.size() == filenames.size()){
- unordered_map<string,bool> taxaMap;
- list<int>::iterator it_p = priorities.begin();
- for (list<string>::iterator it_f = filenames.begin(); it_f != filenames.end(); it_f++){
- load(geneMap, (*it_f) ,(*it_p), taxaMap, properties);
- cout << "# After loading " << (*it_f) << " (Priority " << (*it_p) << ") there are " << (*properties.transcriptMap).size() << " transcripts in transcript list." << endl;
- it_p++;
- }
-
- for (auto pointer = (*properties.transcriptMap).begin(); pointer != (*properties.transcriptMap).end(); pointer++){
- bool hasCDS = false;
- for (list<Exon>::iterator it = pointer->second->exon_list.begin(); it != pointer->second->exon_list.end(); it++){
- if ((*it).feature == "CDS"){
- hasCDS = true;
- break;
- }
- }
- if (!hasCDS){
- cerr << (*properties.transcriptMap)[pointer->second->t_id]->originalId << " from file " << (*properties.transcriptMap)[pointer->second->t_id]->inputFile << " has no CDS and will be deleted." << endl;
- deleteTx(pointer->second, properties);
- continue;
- }
- if ((*(pointer->second)).exon_list.size() == 0){
- deleteTx(pointer->second, properties);
- }else{
- (*(pointer->second)).initiate(properties);
- }
+ for (auto pointer = (*properties.transcriptMap).begin(); pointer != (*properties.transcriptMap).end(); ){
+ bool hasCDS = false;
+ for (list<Exon>::iterator it = pointer->second->exon_list.begin(); it != pointer->second->exon_list.end(); it++){
+ if ((*it).feature == "CDS"){
+ hasCDS = true;
+ break;
}
- }else{
- display_error("Number of input files and priorities is not equal.");
+ }
+ if (!hasCDS){
+ Transcript* tx=pointer->second;
+ cerr << (*properties.transcriptMap)[pointer->second->t_id]->originalId << " from file " << (*properties.transcriptMap)[pointer->second->t_id]->inputFile << " has no CDS and will be deleted." << endl;
+ pointer++;
+ deleteTx(tx, properties);
+ continue;
+ }
+ if ((*(pointer->second)).exon_list.size() == 0){
+ deleteTx(pointer->second, properties);
+ }else{
+ (*(pointer->second)).initiate(properties);
+ }
+ pointer++;
}
-
- pair<string,string> stopVariants; // <stop_codon is in CDS, stop_codon is not in CDS>
-
- for (auto pointer = (*properties.transcriptMap).begin(); pointer != (*properties.transcriptMap).end(); pointer++){
- check_cds_stop_combination(pointer->second, stopVariants, properties);
- if (!check_frame_annotation(*pointer->second)){
- pointer->second->isNotFrameCorrect = true;
- displayWarning((*properties.transcriptMap)[pointer->second->t_id]->originalId+" from file "+(*properties.transcriptMap)[pointer->second->t_id]->inputFile+" has wrong frame annotation and will be ignored in joining step.", properties, "frame");
- //display_error("Frames are not correct.");
- }
+ }else{
+ display_error("Number of input files and priorities is not equal.");
+ }
+ pair<string,string> stopVariants; // <stop_codon is in CDS, stop_codon is not in CDS>
+
+ for (auto pointer = (*properties.transcriptMap).begin(); pointer != (*properties.transcriptMap).end(); pointer++){
+ check_cds_stop_combination(pointer->second, stopVariants, properties);
+ if (!check_frame_annotation(*pointer->second)){
+ pointer->second->isNotFrameCorrect = true;
+ displayWarning((*properties.transcriptMap)[pointer->second->t_id]->originalId+" from file "+(*properties.transcriptMap)[pointer->second->t_id]->inputFile+" has wrong frame annotation and will be ignored in joining step.", properties, "frame");
+ //display_error("Frames are not correct.");
}
- warningSummary("There are ", " transcripts with wrong frame in the input files.", properties, "frame");
+ }
+ warningSummary("There are ", " transcripts with wrong frame in the input files.", properties, "frame");
- // tests, if the alternatives definition in the input is more strict than the one in this program or not
-// testInputAlternatives(properties);
+ // tests, if the alternatives definition in the input is more strict than the one in this program or not
+ // testInputAlternatives(properties);
- // take a look at length of introns
-/* list<int> intronLengths;
- for (auto pointer = (*properties.transcriptMap).begin(); pointer != (*properties.transcriptMap).end(); pointer++){
+ // take a look at length of introns
+ /* list<int> intronLengths;
+ for (auto pointer = (*properties.transcriptMap).begin(); pointer != (*properties.transcriptMap).end(); pointer++){
for (list<Exon>::iterator it1 = pointer->second->exon_list.begin(); it1 != pointer->second->exon_list.end(); it1++){
- list<Exon>::iterator it2 = it1;
- it2++;
- if (it2 != pointer->second->exon_list.end()){
- int intronLength = (*it2).from - (*it1).to - 1;
- intronLengths.push_back(intronLength);
-if (intronLength == 89114){cout << pointer->first << " " << intronLength << endl;}
- }
+ list<Exon>::iterator it2 = it1;
+ it2++;
+ if (it2 != pointer->second->exon_list.end()){
+ int intronLength = (*it2).from - (*it1).to - 1;
+ intronLengths.push_back(intronLength);
+ if (intronLength == 89114){cout << pointer->first << " " << intronLength << endl;}
}
- }
- intronLengths.sort();
- for (list<int>::iterator it = intronLengths.begin(); it != intronLengths.end(); it++){
+ }
+ }
+ intronLengths.sort();
+ for (list<int>::iterator it = intronLengths.begin(); it != intronLengths.end(); it++){
cout << (*it) << endl;
- }*/
+ }*/
- // splits the transcript list by the scaffold of the transcript
- unordered_map<string,list<Transcript*>> splitted_transcript_list;
- for (auto pointer = (*properties.transcriptMap).begin(); pointer != (*properties.transcriptMap).end(); pointer++){
- splitted_transcript_list[(*pointer->second).getChr()].push_back(pointer->second);
- }
+ // splits the transcript list by the scaffold of the transcript
+ unordered_map<string,list<Transcript*>> splitted_transcript_list;
+ for (auto pointer = (*properties.transcriptMap).begin(); pointer != (*properties.transcriptMap).end(); pointer++){
+ splitted_transcript_list[(*pointer->second).getChr()].push_back(pointer->second);
+ }
+ if(!properties.onlyCompare){
fstream outfile;
outfile.open(properties.outFileName, ios::out); // delete content of file filename
outfile.close();
+ }else{
+ string filenameEqual = "cEqual.gtf", filenameStop1 = "cAlternative1.gtf", filenameStop2 = "cAlternative2.gtf", filenameUne1 = "cUnequal1.gtf", filenameUne2 = "cUnequal2.gtf";
+ fstream outfile;
+ outfile.open(filenameEqual, ios::out);
+ outfile.close();
+ outfile.open(filenameStop1, ios::out);
+ outfile.close();
+ outfile.open(filenameStop2, ios::out);
+ outfile.close();
+ outfile.open(filenameUne1, ios::out);
+ outfile.close();
+ outfile.open(filenameUne2, ios::out);
+ outfile.close();
+ outfile.open("cExtra1.gtf", ios::out);
+ outfile.close();
+ }
- if (properties.onlyCompare){
- string filenameEqual = "cEqual.gtf", filenameStop1 = "cAlternative1.gtf", filenameStop2 = "cAlternative2.gtf", filenameUne1 = "cUnequal1.gtf", filenameUne2 = "cUnequal2.gtf";
- fstream outfile;
- outfile.open(filenameEqual, ios::out);
- outfile.close();
- outfile.open(filenameStop1, ios::out);
- outfile.close();
- outfile.open(filenameStop2, ios::out);
- outfile.close();
- outfile.open(filenameUne1, ios::out);
- outfile.close();
- outfile.open(filenameUne2, ios::out);
- outfile.close();
-
- outfile.open("cLizzy1.gtf", ios::out);
- outfile.close();
- }
-
- for(auto it = splitted_transcript_list.begin(); it != splitted_transcript_list.end(); it++){
- divideInOverlapsAndConquer(it->second, properties);
- }
- return 0;
+ for(auto it = splitted_transcript_list.begin(); it != splitted_transcript_list.end(); it++){
+ divideInOverlapsAndConquer(it->second, properties);
+ }
+ return 0;
}
diff --git a/common.mk b/common.mk
index 2f4b507..59a238f 100644
--- a/common.mk
+++ b/common.mk
@@ -1,17 +1,17 @@
# Definitions common to all Makefiles
# This file is included from other Makefiles in the augustus project.
-AUGVERSION = 3.2.2
+AUGVERSION = 3.2.3
# make this a comment if you get compilation errors about the boost iostreams library
# cannot install this library and do not need to input gzipped input genome files
-ZIPINPUT = true
+#ZIPINPUT = true
# uncomment this line to enable comparative gene finding (requires compiler which supports C++11 standard)
-# COMPGENEPRED = true
+#COMPGENEPRED = true
# uncomment this line when you need MySQL access to sequences (most users don't)
#MYSQL = true
# uncomment this line to enable access to SQLite databases that store
# file offsets of sequence data in flat files and hints
-# SQLITE = true
+#SQLITE = true
diff --git a/config/cgp/log_reg_parameters_primates.cfg b/config/cgp/log_reg_parameters_primates.cfg
new file mode 100644
index 0000000..f732f46
--- /dev/null
+++ b/config/cgp/log_reg_parameters_primates.cfg
@@ -0,0 +1,25 @@
+# scores from logistic regression
+
+/CompPred/ec_thold 1.585627
+/CompPred/ic_thold 1.585627
+
+# exon scores
+
+/CompPred/exon_score0 -0.99579 # intercept
+/CompPred/exon_score1 -4.15386 # for not having omega
+/CompPred/exon_score4 5.97133 # posterior probability
+/CompPred/exon_score12 -3.62007 # for not beeing sampled
+
+# ortho exon scores
+
+/CompPred/exon_score6 -3.04547 # posterior mean omega (0 if no omega was calculated)
+/CompPred/exon_score8 -6.26088 # conservation
+/CompPred/exon_score10 4.65264 # diversity
+/CompPred/exon_score15 5.52477 # number of species involved in this ortho exon divided by clade size
+
+# intron scores
+
+/CompPred/intron_score0 -3.468171 # intercept
+/CompPred/intron_score1 6.410487 # posterior probability
+/CompPred/intron_score2 2.429658 # average base probability
+/CompPred/intron_score3 -0.353082 # log length
diff --git a/config/extrinsic/cgp.extrinsic.cfg b/config/extrinsic/cgp.extrinsic.cfg
deleted file mode 100644
index 1ce9535..0000000
--- a/config/extrinsic/cgp.extrinsic.cfg
+++ /dev/null
@@ -1,74 +0,0 @@
-# extrinsic information configuration file for AUGUSTUS in cgp (comparative gene prediction) mode
-#
-# include with --extrinsicCfgFile=filename
-# date: 13.06.2014
-# Stefanie Koenig
-
-
-# Source of extrinsic information:
-# M manual anchor (required)
-# P protein database hit
-# E EST/cDNA database hit
-# C combined est/protein database hit
-# D Dialign
-# R retroposed genes
-# T transMapped refSeqs
-# W wiggle track coverage info from RNA-Seq
-
-[SOURCES]
-M RM
-
-#
-# individual_liability: Only unsatisfiable hints are disregarded. By default this flag is not set
-# and the whole hint group is disregarded when one hint in it is unsatisfiable.
-# 1group1gene: Try to predict a single gene that covers all hints of a given group. This is relevant for
-# hint groups with gaps, e.g. when two ESTs, say 5' and 3', from the same clone align nearby.
-#
-[SOURCE-PARAMETERS]
-T individual_liability
-
-# feature bonus malus gradelevelcolumns
-# r+/r-
-#
-# the gradelevel colums have the following format for each source
-# sourcecharacter numscoreclasses boundary ... boundary gradequot ... gradequot
-#
-
-[GENERAL]
- start 1 1 M 1 1e+100 RM 1 1
- stop 1 1 M 1 1e+100 RM 1 1
- tss 1 1 M 1 1e+100 RM 1 1
- tts 1 1 M 1 1e+100 RM 1 1
- ass 1 1 M 1 1e+100 RM 1 1
- dss 1 1 M 1 1e+100 RM 1 1
- exonpart 1 1 M 1 1e+100 RM 1 1
- exon 1 1 M 1 1e+100 RM 1 1
- intronpart 1 1 M 1 1e+100 RM 1 1
- intron 1 1 M 1 1e+100 RM 1 1
- CDSpart 1 1 M 1 1e+100 RM 1 1
- CDS 1 1 M 1 1e+100 RM 1 1
- UTRpart 1 1 M 1 1e+100 RM 1 1
- UTR 1 1 M 1 1e+100 RM 1 1
- irpart 1 1 M 1 1e+100 RM 1 1
-nonexonpart 1 1 M 1 1e+100 RM 1 1.15
- genicpart 1 1 M 1 1e+100 RM 1 1
-
-[GROUP]
-all
-
-#
-# Explanation:
-#
-# In comparative gene prediction, hints can be integrated for multiple species.
-# In order to have different extrinsic config settings for different species,
-# multiple [GENERAL] tables are specified. Each table is followed by a [GROUP] section,
-# a single line, in which a subset of the species is listed, for which the table is valid.
-# Use the same species identifiers as in the MSA and in the phylogenetic tree.
-# If a species is not assigned to any of the tables, all hints for that species are
-# ignored. To assign all species to a single table, the key 'all' can be used instead of itemizing
-# every single species identifier. Use the key 'other' to specify a table for all species, not
-# listed in any previous table.
-# Note that the source RM must be specified in case that the softmasking option is turned on.
-# Also note that all tables have the same dimension, i.e. each table must contain all sources
-# listed in the section [SOURCES], even sources for which no hints exist for any of species
-# in group.
diff --git a/config/extrinsic/extrinsic-cgp.cfg b/config/extrinsic/extrinsic-cgp.cfg
new file mode 100644
index 0000000..ad4ea42
--- /dev/null
+++ b/config/extrinsic/extrinsic-cgp.cfg
@@ -0,0 +1,119 @@
+# extrinsic information configuration file for AUGUSTUS
+#
+# protein hints
+# include with --extrinsicCfgFile=filename
+# date: 16.10.2007
+# Mario Stanke (mstanke at gwdg.de)
+
+
+# source of extrinsic information:
+# M manual anchor (required)
+# P protein database hit
+# E EST/cDNA database hit
+# C combined est/protein database hit
+# D Dialign
+# R retroposed genes
+# T transMapped refSeqs
+# W wiggle track coverage info from RNA-Seq
+
+[SOURCES]
+M RM E W
+
+#
+# individual_liability: Only unsatisfiable hints are disregarded. By default this flag is not set
+# and the whole hint group is disregarded when one hint in it is unsatisfiable.
+# 1group1gene: Try to predict a single gene that covers all hints of a given group. This is relevant for
+# hint groups with gaps, e.g. when two ESTs, say 5' and 3', from the same clone align nearby.
+#
+[SOURCE-PARAMETERS]
+
+
+# feature bonus malus gradelevelcolumns
+# r+/r-
+#
+# the gradelevel colums have the following format for each source
+# sourcecharacter numscoreclasses boundary ... boundary gradequot ... gradequot
+#
+
+[GENERAL]
+ start 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ stop 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ tss 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ tts 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ ass 1 1 0.1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ dss 1 1 0.1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ exonpart 1 .992 .985 M 1 1e+100 RM 1 1 E 1 1 W 1 1.02
+ exon 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ intronpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ intron 1 .34 M 1 1e+100 RM 1 1 E 1 1e4 W 1 1
+ CDSpart 1 1 .985 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ CDS 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ UTRpart 1 1 .985 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ UTR 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ irpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+nonexonpart 1 1 M 1 1e+100 RM 1 1.15 E 1 1 W 1 1
+ genicpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+
+[GROUP] # replace 'none' by the names of genomes with src=W and src=E hints in the database
+none
+
+[GENERAL]
+ start 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ stop 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ tss 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ tts 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ ass 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ dss 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ exonpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ exon 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ intronpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ intron 1 .1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ CDSpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ CDS 1 .1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ UTRpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ UTR 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ irpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+nonexonpart 1 1 M 1 1e+100 RM 1 1.15 E 1 1 W 1 1
+ genicpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+
+[GROUP] # replace 'none' by the names of genomes with src=M hints in the database
+none
+
+[GENERAL]
+ start 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ stop 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ tss 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ tts 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ ass 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ dss 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ exonpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ exon 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ intronpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ intron 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ CDSpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ CDS 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ UTRpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ UTR 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+ irpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+nonexonpart 1 1 M 1 1e+100 RM 1 1.15 E 1 1 W 1 1
+ genicpart 1 1 M 1 1e+100 RM 1 1 E 1 1 W 1 1
+
+[GROUP]
+other
+
+#
+# Explanation:
+#
+# In comparative gene prediction, hints can be integrated for multiple species.
+# In order to have different extrinsic config settings for different species,
+# multiple [GENERAL] tables are specified. Each table is followed by a [GROUP] section,
+# a single line, in which a subset of the species is listed, for which the table is valid.
+# Use the same species identifiers as in the MSA and in the phylogenetic tree.
+# If a species is not assigned to any of the tables, all hints for that species are
+# ignored. To assign all species to a single table, the key 'all' can be used instead of itemizing
+# every single species identifier. Use the key 'other' to specify a table for all species, not
+# listed in any previous table. When the key 'none' is specified the table is skipped.
+# Note that the source RM must be specified in case that the softmasking option is turned on.
+# Also note that all tables have the same dimension, i.e. each table must contain all sources
+# listed in the section [SOURCES], even sources for which no hints exist for any of species
+# in group.
diff --git a/config/species/coyote_tobacco/coyote_tobacco_exon_probs.pbl b/config/species/coyote_tobacco/coyote_tobacco_exon_probs.pbl
new file mode 100644
index 0000000..0bc1c75
--- /dev/null
+++ b/config/species/coyote_tobacco/coyote_tobacco_exon_probs.pbl
@@ -0,0 +1,6591 @@
+#exon model parameters
+# begin of content independent part
+
+# Length distributions
+[LENGTH]
+# maximal individually stored length probability =
+2000
+# slope of smoothing bandwidth =
+0.4625
+# smoothing minwindowcount =
+8
+# length single initial internal terminal
+# total number of exons of above types
+ 342 1023 3778 1021
+# number of exons exceeding length d
+ 25 12 6 5
+# 1000 P(len=k), k=0,1,..., 2000
+0 0 0.475 0.0147 0.41
+1 0 0.509 0.0162 0.441
+2 0 0.544 0.0179 0.471
+3 0 0.579 0.02 0.501
+4 0 0.614 0.0226 0.53
+5 0 0.649 0.0258 0.558
+6 0 0.685 0.0298 0.585
+7 0 0.72 0.0347 0.611
+8 0 0.756 0.0409 0.636
+9 0 0.792 0.0485 0.66
+10 0 0.828 0.0578 0.682
+11 0 0.865 0.0692 0.703
+12 0 0.902 0.083 0.724
+13 0 0.941 0.0996 0.743
+14 0 0.981 0.119 0.761
+15 0 1.02 0.143 0.778
+16 0 1.07 0.17 0.795
+17 0 1.11 0.202 0.811
+18 0 1.16 0.238 0.827
+19 0 1.21 0.28 0.842
+20 0 1.26 0.328 0.857
+21 0 1.31 0.381 0.872
+22 0 1.36 0.441 0.886
+23 0 1.42 0.507 0.901
+24 0 1.48 0.58 0.915
+25 0 1.54 0.658 0.928
+26 0 1.6 0.743 0.941
+27 0 1.66 0.835 0.954
+28 0 1.72 0.931 0.967
+29 0 1.78 1.03 0.979
+30 0 1.84 1.14 0.99
+31 0 1.9 1.25 1
+32 0 1.96 1.37 1.01
+33 0 2.01 1.49 1.02
+34 0 2.07 1.61 1.03
+35 0 2.12 1.73 1.04
+36 0 2.17 1.86 1.05
+37 0 2.22 1.99 1.06
+38 0 2.27 2.12 1.08
+39 0 2.31 2.25 1.09
+40 0 2.35 2.38 1.1
+41 0 2.38 2.52 1.12
+42 0 2.41 2.65 1.14
+43 0 2.44 2.78 1.16
+44 0 2.46 2.91 1.19
+45 0 2.47 3.04 1.22
+46 0 2.48 3.18 1.25
+47 0 2.48 3.31 1.29
+48 0 2.48 3.44 1.34
+49 0 2.47 3.57 1.39
+50 0 2.46 3.7 1.44
+51 0 2.44 3.83 1.5
+52 0 2.42 3.97 1.56
+53 0 2.41 4.11 1.63
+54 0 2.39 4.25 1.7
+55 0 2.38 4.39 1.78
+56 0 2.37 4.54 1.86
+57 0 2.36 4.7 1.94
+58 0 2.37 4.85 2.02
+59 0 2.38 5.02 2.1
+60 0 2.4 5.18 2.19
+61 0 2.42 5.34 2.27
+62 0 2.46 5.51 2.35
+63 0 2.5 5.67 2.44
+64 0 2.56 5.83 2.52
+65 0 2.61 5.99 2.6
+66 0 2.67 6.14 2.68
+67 0 2.73 6.28 2.75
+68 0 2.79 6.41 2.83
+69 0 2.85 6.53 2.9
+70 0 2.9 6.64 2.97
+71 0 2.95 6.74 3.04
+72 0 2.99 6.83 3.11
+73 0 3.02 6.91 3.17
+74 0 3.04 6.97 3.23
+75 0 3.05 7.03 3.28
+76 0 3.06 7.08 3.33
+77 0 3.05 7.12 3.38
+78 0 3.03 7.15 3.42
+79 0 3.01 7.18 3.45
+80 0 2.98 7.2 3.48
+81 0 2.95 7.22 3.5
+82 0 2.91 7.24 3.52
+83 0 2.87 7.26 3.52
+84 0 2.83 7.28 3.52
+85 0 2.79 7.3 3.51
+86 0 2.76 7.32 3.5
+87 0 2.73 7.34 3.47
+88 0 2.7 7.36 3.44
+89 0 2.67 7.37 3.41
+90 0 2.65 7.37 3.37
+91 0 2.63 7.37 3.33
+92 0 2.62 7.36 3.28
+93 0 2.61 7.34 3.23
+94 0 2.61 7.31 3.18
+95 0 2.6 7.27 3.13
+96 0 2.6 7.22 3.08
+97 0 2.6 7.16 3.03
+98 0 2.6 7.09 2.98
+99 0 2.6 7.01 2.94
+100 0 2.6 6.93 2.89
+101 0 2.6 6.84 2.85
+102 0 2.6 6.75 2.82
+103 0 2.59 6.66 2.78
+104 0 2.59 6.57 2.75
+105 0 2.59 6.48 2.72
+106 0 2.58 6.4 2.69
+107 0 2.58 6.32 2.67
+108 0 2.57 6.24 2.64
+109 0 2.56 6.16 2.62
+110 0 2.55 6.09 2.6
+111 0 2.54 6.03 2.58
+112 0 2.53 5.96 2.57
+113 0 2.52 5.9 2.55
+114 0 2.51 5.84 2.53
+115 0 2.5 5.79 2.52
+116 0 2.49 5.73 2.5
+117 0 2.48 5.67 2.49
+118 0 2.46 5.62 2.48
+119 0 2.45 5.56 2.47
+120 0 2.44 5.5 2.46
+121 0 2.43 5.44 2.45
+122 0 2.42 5.38 2.45
+123 0 2.41 5.32 2.44
+124 0 2.4 5.26 2.44
+125 0 2.39 5.2 2.43
+126 0 2.38 5.13 2.43
+127 0 2.37 5.07 2.43
+128 0 2.36 5 2.43
+129 0 2.35 4.93 2.43
+130 0 2.35 4.86 2.43
+131 0 2.34 4.78 2.44
+132 0 2.33 4.71 2.44
+133 0 2.33 4.64 2.45
+134 0 2.32 4.56 2.45
+135 0 2.31 4.49 2.46
+136 0 2.31 4.42 2.47
+137 0 2.3 4.35 2.47
+138 0 2.29 4.27 2.48
+139 0 2.29 4.2 2.49
+140 0 2.28 4.14 2.5
+141 0 2.28 4.07 2.5
+142 0 2.27 4.01 2.51
+143 0 2.27 3.94 2.52
+144 0 2.26 3.88 2.52
+145 0 2.26 3.82 2.53
+146 0 2.25 3.77 2.54
+147 0 2.25 3.71 2.54
+148 0 2.25 3.66 2.54
+149 0 2.24 3.61 2.55
+150 0 2.24 3.56 2.55
+151 0 2.24 3.52 2.55
+152 0 2.24 3.47 2.55
+153 0 2.24 3.43 2.55
+154 0 2.24 3.38 2.55
+155 0 2.24 3.34 2.54
+156 0 2.24 3.3 2.54
+157 0 2.25 3.26 2.53
+158 0 2.25 3.22 2.53
+159 0 2.26 3.19 2.52
+160 0 2.26 3.15 2.51
+161 0 2.27 3.11 2.5
+162 0 2.27 3.07 2.49
+163 0 2.28 3.04 2.48
+164 0 2.28 3 2.47
+165 0 2.29 2.97 2.46
+166 0 2.3 2.93 2.45
+167 0 2.31 2.9 2.44
+168 0 2.31 2.87 2.43
+169 0 2.32 2.83 2.41
+170 0 2.33 2.8 2.4
+171 0 2.34 2.77 2.38
+172 0 2.34 2.74 2.37
+173 0 2.35 2.71 2.35
+174 0 2.36 2.68 2.34
+175 0 2.36 2.66 2.32
+176 0 2.37 2.63 2.31
+177 0 2.37 2.6 2.29
+178 0 2.38 2.58 2.28
+179 0 2.38 2.56 2.26
+180 0 2.38 2.53 2.25
+181 0 2.39 2.51 2.23
+182 0 2.39 2.49 2.22
+183 0 2.39 2.47 2.2
+184 0 2.39 2.45 2.19
+185 0 2.39 2.43 2.17
+186 0 2.39 2.41 2.16
+187 0 2.39 2.4 2.15
+188 0 2.38 2.38 2.13
+189 0 2.38 2.36 2.12
+190 0 2.37 2.35 2.11
+191 0 2.37 2.33 2.09
+192 0 2.36 2.32 2.08
+193 0 2.35 2.3 2.07
+194 0 2.35 2.29 2.06
+195 0 2.34 2.27 2.05
+196 0 2.33 2.26 2.04
+197 0 2.32 2.25 2.03
+198 0 2.31 2.23 2.02
+199 0 2.29 2.22 2.01
+200 0 2.28 2.21 2
+201 0.055 2.27 2.19 1.99
+202 0.0581 2.26 2.18 1.98
+203 0.0614 2.24 2.16 1.98
+204 0.0648 2.23 2.15 1.97
+205 0.0684 2.21 2.14 1.96
+206 0.0721 2.2 2.12 1.95
+207 0.076 2.18 2.11 1.95
+208 0.0801 2.17 2.09 1.94
+209 0.0844 2.15 2.08 1.94
+210 0.0888 2.13 2.06 1.93
+211 0.0934 2.12 2.05 1.93
+212 0.0983 2.1 2.03 1.92
+213 0.103 2.09 2.02 1.92
+214 0.109 2.07 2 1.92
+215 0.114 2.05 1.98 1.91
+216 0.12 2.04 1.97 1.91
+217 0.126 2.02 1.95 1.91
+218 0.132 2.01 1.93 1.9
+219 0.138 1.99 1.92 1.9
+220 0.145 1.98 1.9 1.9
+221 0.152 1.96 1.88 1.9
+222 0.159 1.95 1.86 1.89
+223 0.166 1.93 1.84 1.89
+224 0.174 1.92 1.82 1.89
+225 0.182 1.91 1.8 1.89
+226 0.19 1.89 1.78 1.88
+227 0.199 1.88 1.77 1.88
+228 0.207 1.87 1.75 1.88
+229 0.216 1.86 1.73 1.88
+230 0.226 1.84 1.71 1.87
+231 0.235 1.83 1.69 1.87
+232 0.245 1.82 1.67 1.87
+233 0.256 1.81 1.65 1.87
+234 0.266 1.8 1.63 1.86
+235 0.277 1.79 1.61 1.86
+236 0.288 1.78 1.59 1.86
+237 0.3 1.77 1.57 1.85
+238 0.312 1.76 1.55 1.85
+239 0.324 1.75 1.53 1.85
+240 0.337 1.74 1.51 1.84
+241 0.349 1.74 1.49 1.84
+242 0.363 1.73 1.47 1.83
+243 0.376 1.72 1.45 1.83
+244 0.39 1.71 1.43 1.82
+245 0.404 1.7 1.41 1.82
+246 0.419 1.7 1.39 1.81
+247 0.434 1.69 1.37 1.81
+248 0.449 1.68 1.35 1.8
+249 0.464 1.67 1.33 1.8
+250 0.48 1.67 1.31 1.79
+251 0.496 1.66 1.3 1.78
+252 0.513 1.65 1.28 1.78
+253 0.53 1.65 1.26 1.77
+254 0.547 1.64 1.24 1.76
+255 0.564 1.63 1.22 1.75
+256 0.582 1.63 1.21 1.75
+257 0.6 1.62 1.19 1.74
+258 0.618 1.61 1.17 1.73
+259 0.637 1.61 1.15 1.72
+260 0.656 1.6 1.14 1.71
+261 0.675 1.6 1.12 1.7
+262 0.695 1.59 1.1 1.69
+263 0.714 1.58 1.09 1.69
+264 0.734 1.58 1.07 1.68
+265 0.755 1.57 1.05 1.67
+266 0.775 1.56 1.04 1.66
+267 0.796 1.55 1.02 1.65
+268 0.817 1.55 1 1.64
+269 0.838 1.54 0.989 1.63
+270 0.859 1.53 0.974 1.62
+271 0.881 1.53 0.959 1.61
+272 0.902 1.52 0.944 1.6
+273 0.924 1.51 0.929 1.59
+274 0.946 1.51 0.915 1.58
+275 0.968 1.5 0.901 1.57
+276 0.99 1.49 0.887 1.56
+277 1.01 1.49 0.873 1.55
+278 1.04 1.48 0.859 1.54
+279 1.06 1.47 0.846 1.53
+280 1.08 1.47 0.833 1.52
+281 1.1 1.46 0.82 1.51
+282 1.13 1.45 0.807 1.5
+283 1.15 1.45 0.795 1.49
+284 1.17 1.44 0.783 1.48
+285 1.19 1.43 0.771 1.47
+286 1.22 1.43 0.759 1.46
+287 1.24 1.42 0.748 1.45
+288 1.26 1.42 0.736 1.44
+289 1.28 1.41 0.725 1.43
+290 1.31 1.4 0.715 1.42
+291 1.33 1.4 0.704 1.41
+292 1.35 1.39 0.694 1.4
+293 1.37 1.39 0.684 1.39
+294 1.39 1.38 0.674 1.39
+295 1.42 1.38 0.664 1.38
+296 1.44 1.37 0.655 1.37
+297 1.46 1.37 0.646 1.36
+298 1.48 1.36 0.637 1.35
+299 1.5 1.36 0.628 1.34
+300 1.52 1.35 0.62 1.34
+301 1.54 1.35 0.612 1.33
+302 1.56 1.35 0.604 1.32
+303 1.58 1.34 0.596 1.31
+304 1.6 1.34 0.588 1.31
+305 1.62 1.34 0.581 1.3
+306 1.64 1.33 0.573 1.29
+307 1.66 1.33 0.566 1.28
+308 1.67 1.33 0.56 1.28
+309 1.69 1.32 0.553 1.27
+310 1.71 1.32 0.547 1.26
+311 1.73 1.32 0.54 1.26
+312 1.74 1.32 0.534 1.25
+313 1.76 1.31 0.528 1.24
+314 1.77 1.31 0.522 1.24
+315 1.79 1.31 0.517 1.23
+316 1.8 1.31 0.511 1.22
+317 1.82 1.3 0.506 1.22
+318 1.83 1.3 0.5 1.21
+319 1.85 1.3 0.495 1.2
+320 1.86 1.3 0.49 1.2
+321 1.87 1.3 0.485 1.19
+322 1.88 1.3 0.48 1.19
+323 1.9 1.3 0.476 1.18
+324 1.91 1.29 0.471 1.18
+325 1.92 1.29 0.466 1.17
+326 1.93 1.29 0.462 1.16
+327 1.94 1.29 0.457 1.16
+328 1.95 1.29 0.453 1.15
+329 1.96 1.29 0.449 1.15
+330 1.96 1.29 0.444 1.14
+331 1.97 1.29 0.44 1.14
+332 1.98 1.28 0.436 1.13
+333 1.99 1.28 0.432 1.13
+334 1.99 1.28 0.428 1.12
+335 2 1.28 0.424 1.12
+336 2.01 1.28 0.42 1.11
+337 2.01 1.28 0.416 1.11
+338 2.01 1.28 0.412 1.1
+339 2.02 1.27 0.408 1.1
+340 2.02 1.27 0.404 1.09
+341 2.03 1.27 0.401 1.09
+342 2.03 1.27 0.397 1.08
+343 2.03 1.27 0.393 1.08
+344 2.03 1.26 0.39 1.07
+345 2.03 1.26 0.386 1.07
+346 2.04 1.26 0.382 1.07
+347 2.04 1.26 0.379 1.06
+348 2.04 1.26 0.375 1.06
+349 2.04 1.25 0.372 1.05
+350 2.04 1.25 0.368 1.05
+351 2.03 1.25 0.365 1.04
+352 2.03 1.25 0.361 1.04
+353 2.03 1.24 0.358 1.04
+354 2.03 1.24 0.355 1.03
+355 2.03 1.24 0.352 1.03
+356 2.02 1.23 0.348 1.02
+357 2.02 1.23 0.345 1.02
+358 2.02 1.23 0.342 1.02
+359 2.02 1.22 0.339 1.01
+360 2.01 1.22 0.336 1.01
+361 2.01 1.21 0.333 1.01
+362 2 1.21 0.33 1
+363 2 1.21 0.327 0.998
+364 1.99 1.2 0.325 0.994
+365 1.99 1.2 0.322 0.991
+366 1.98 1.19 0.319 0.987
+367 1.98 1.19 0.317 0.984
+368 1.97 1.18 0.314 0.98
+369 1.96 1.18 0.312 0.977
+370 1.96 1.18 0.309 0.973
+371 1.95 1.17 0.307 0.97
+372 1.94 1.17 0.304 0.967
+373 1.94 1.16 0.302 0.963
+374 1.93 1.16 0.3 0.96
+375 1.92 1.15 0.298 0.957
+376 1.92 1.14 0.296 0.954
+377 1.91 1.14 0.294 0.951
+378 1.9 1.13 0.292 0.947
+379 1.89 1.13 0.29 0.944
+380 1.89 1.12 0.288 0.941
+381 1.88 1.12 0.286 0.938
+382 1.87 1.11 0.284 0.935
+383 1.86 1.11 0.282 0.932
+384 1.85 1.1 0.281 0.929
+385 1.84 1.09 0.279 0.926
+386 1.84 1.09 0.277 0.923
+387 1.83 1.08 0.276 0.919
+388 1.82 1.08 0.274 0.916
+389 1.81 1.07 0.273 0.913
+390 1.8 1.06 0.271 0.91
+391 1.79 1.06 0.269 0.907
+392 1.78 1.05 0.268 0.904
+393 1.78 1.04 0.267 0.901
+394 1.77 1.04 0.265 0.898
+395 1.76 1.03 0.264 0.895
+396 1.75 1.03 0.262 0.892
+397 1.74 1.02 0.261 0.889
+398 1.73 1.01 0.259 0.886
+399 1.72 1.01 0.258 0.883
+400 1.71 1 0.257 0.88
+401 1.7 0.993 0.255 0.876
+402 1.69 0.987 0.254 0.873
+403 1.69 0.98 0.253 0.87
+404 1.68 0.974 0.251 0.867
+405 1.67 0.968 0.25 0.864
+406 1.66 0.961 0.249 0.861
+407 1.65 0.955 0.247 0.858
+408 1.64 0.948 0.246 0.854
+409 1.63 0.942 0.245 0.851
+410 1.62 0.936 0.243 0.848
+411 1.61 0.93 0.242 0.845
+412 1.61 0.923 0.241 0.841
+413 1.6 0.917 0.239 0.838
+414 1.59 0.911 0.238 0.835
+415 1.58 0.905 0.237 0.831
+416 1.57 0.898 0.235 0.828
+417 1.56 0.892 0.234 0.825
+418 1.55 0.886 0.233 0.821
+419 1.54 0.88 0.231 0.818
+420 1.54 0.874 0.23 0.815
+421 1.53 0.868 0.228 0.811
+422 1.52 0.862 0.227 0.808
+423 1.51 0.856 0.226 0.805
+424 1.5 0.85 0.224 0.801
+425 1.49 0.845 0.223 0.798
+426 1.49 0.839 0.221 0.794
+427 1.48 0.833 0.22 0.791
+428 1.47 0.827 0.218 0.788
+429 1.46 0.822 0.217 0.784
+430 1.45 0.816 0.216 0.781
+431 1.45 0.811 0.214 0.777
+432 1.44 0.805 0.213 0.774
+433 1.43 0.8 0.211 0.77
+434 1.42 0.795 0.21 0.767
+435 1.41 0.789 0.208 0.764
+436 1.41 0.784 0.207 0.76
+437 1.4 0.779 0.205 0.757
+438 1.39 0.774 0.204 0.754
+439 1.38 0.769 0.202 0.75
+440 1.38 0.764 0.201 0.747
+441 1.37 0.759 0.199 0.743
+442 1.36 0.754 0.198 0.74
+443 1.35 0.749 0.196 0.737
+444 1.35 0.744 0.195 0.734
+445 1.34 0.74 0.193 0.73
+446 1.33 0.735 0.192 0.727
+447 1.32 0.73 0.191 0.724
+448 1.32 0.726 0.189 0.72
+449 1.31 0.721 0.188 0.717
+450 1.3 0.717 0.186 0.714
+451 1.3 0.713 0.185 0.711
+452 1.29 0.708 0.183 0.708
+453 1.28 0.704 0.182 0.705
+454 1.27 0.7 0.18 0.702
+455 1.27 0.696 0.179 0.699
+456 1.26 0.692 0.178 0.696
+457 1.25 0.688 0.176 0.692
+458 1.25 0.684 0.175 0.69
+459 1.24 0.68 0.173 0.687
+460 1.24 0.676 0.172 0.684
+461 1.23 0.673 0.171 0.681
+462 1.22 0.669 0.169 0.678
+463 1.22 0.665 0.168 0.675
+464 1.21 0.662 0.166 0.672
+465 1.2 0.658 0.165 0.669
+466 1.2 0.655 0.164 0.667
+467 1.19 0.652 0.162 0.664
+468 1.19 0.648 0.161 0.661
+469 1.18 0.645 0.16 0.659
+470 1.17 0.642 0.159 0.656
+471 1.17 0.639 0.157 0.654
+472 1.16 0.635 0.156 0.651
+473 1.16 0.632 0.155 0.648
+474 1.15 0.629 0.154 0.646
+475 1.15 0.626 0.152 0.643
+476 1.14 0.623 0.151 0.641
+477 1.13 0.621 0.15 0.639
+478 1.13 0.618 0.149 0.636
+479 1.12 0.615 0.148 0.634
+480 1.12 0.612 0.147 0.632
+481 1.11 0.61 0.146 0.629
+482 1.11 0.607 0.144 0.627
+483 1.1 0.604 0.143 0.625
+484 1.1 0.602 0.142 0.623
+485 1.09 0.599 0.141 0.62
+486 1.09 0.597 0.14 0.618
+487 1.08 0.594 0.139 0.616
+488 1.08 0.592 0.138 0.614
+489 1.07 0.589 0.137 0.612
+490 1.07 0.587 0.136 0.61
+491 1.06 0.585 0.135 0.608
+492 1.06 0.583 0.134 0.606
+493 1.05 0.58 0.133 0.604
+494 1.05 0.578 0.133 0.602
+495 1.04 0.576 0.132 0.6
+496 1.04 0.574 0.131 0.598
+497 1.04 0.572 0.13 0.596
+498 1.03 0.57 0.129 0.594
+499 1.03 0.568 0.128 0.593
+500 1.02 0.566 0.127 0.591
+501 1.02 0.564 0.127 0.589
+502 1.01 0.562 0.126 0.587
+503 1.01 0.56 0.125 0.585
+504 1.01 0.558 0.124 0.584
+505 1 0.556 0.124 0.582
+506 0.997 0.554 0.123 0.58
+507 0.993 0.553 0.122 0.578
+508 0.989 0.551 0.122 0.577
+509 0.985 0.549 0.121 0.575
+510 0.981 0.547 0.12 0.573
+511 0.977 0.546 0.12 0.572
+512 0.973 0.544 0.119 0.57
+513 0.97 0.542 0.118 0.568
+514 0.966 0.54 0.118 0.567
+515 0.962 0.539 0.117 0.565
+516 0.958 0.537 0.116 0.563
+517 0.955 0.536 0.116 0.562
+518 0.951 0.534 0.115 0.56
+519 0.947 0.532 0.115 0.559
+520 0.944 0.531 0.114 0.557
+521 0.94 0.529 0.113 0.555
+522 0.937 0.528 0.113 0.554
+523 0.933 0.526 0.112 0.552
+524 0.93 0.525 0.112 0.551
+525 0.926 0.523 0.111 0.549
+526 0.923 0.522 0.111 0.548
+527 0.92 0.52 0.11 0.546
+528 0.916 0.519 0.11 0.544
+529 0.913 0.517 0.109 0.543
+530 0.91 0.516 0.109 0.541
+531 0.907 0.514 0.108 0.54
+532 0.903 0.513 0.108 0.538
+533 0.9 0.511 0.107 0.537
+534 0.897 0.51 0.107 0.535
+535 0.894 0.509 0.106 0.534
+536 0.891 0.507 0.106 0.532
+537 0.888 0.506 0.105 0.531
+538 0.885 0.504 0.105 0.529
+539 0.882 0.503 0.104 0.528
+540 0.879 0.502 0.104 0.526
+541 0.876 0.5 0.103 0.525
+542 0.873 0.499 0.103 0.523
+543 0.87 0.497 0.102 0.522
+544 0.867 0.496 0.102 0.52
+545 0.864 0.495 0.101 0.519
+546 0.861 0.493 0.101 0.517
+547 0.858 0.492 0.1 0.516
+548 0.855 0.491 0.0997 0.514
+549 0.852 0.489 0.0992 0.513
+550 0.85 0.488 0.0987 0.512
+551 0.847 0.486 0.0982 0.51
+552 0.844 0.485 0.0977 0.509
+553 0.841 0.484 0.0972 0.507
+554 0.839 0.482 0.0967 0.506
+555 0.836 0.481 0.0962 0.504
+556 0.833 0.48 0.0957 0.503
+557 0.831 0.478 0.0952 0.501
+558 0.828 0.477 0.0947 0.5
+559 0.825 0.475 0.0942 0.499
+560 0.823 0.474 0.0937 0.497
+561 0.82 0.473 0.0932 0.496
+562 0.817 0.471 0.0927 0.494
+563 0.815 0.47 0.0921 0.493
+564 0.812 0.468 0.0916 0.492
+565 0.81 0.467 0.0911 0.49
+566 0.807 0.466 0.0906 0.489
+567 0.805 0.464 0.0901 0.487
+568 0.802 0.463 0.0896 0.486
+569 0.8 0.461 0.0891 0.485
+570 0.797 0.46 0.0885 0.483
+571 0.795 0.458 0.088 0.482
+572 0.792 0.457 0.0875 0.48
+573 0.79 0.456 0.087 0.479
+574 0.788 0.454 0.0865 0.478
+575 0.785 0.453 0.086 0.476
+576 0.783 0.451 0.0854 0.475
+577 0.78 0.45 0.0849 0.474
+578 0.778 0.448 0.0844 0.472
+579 0.776 0.447 0.0839 0.471
+580 0.773 0.445 0.0834 0.469
+581 0.771 0.444 0.0829 0.468
+582 0.769 0.442 0.0824 0.467
+583 0.767 0.441 0.0818 0.465
+584 0.764 0.439 0.0813 0.464
+585 0.762 0.438 0.0808 0.463
+586 0.76 0.436 0.0803 0.461
+587 0.758 0.435 0.0798 0.46
+588 0.755 0.433 0.0793 0.459
+589 0.753 0.432 0.0788 0.457
+590 0.751 0.43 0.0783 0.456
+591 0.749 0.429 0.0779 0.455
+592 0.747 0.427 0.0774 0.454
+593 0.745 0.426 0.0769 0.452
+594 0.742 0.424 0.0764 0.451
+595 0.74 0.422 0.0759 0.45
+596 0.738 0.421 0.0755 0.448
+597 0.736 0.419 0.075 0.447
+598 0.734 0.418 0.0745 0.446
+599 0.732 0.416 0.0741 0.445
+600 0.73 0.415 0.0736 0.443
+601 0.728 0.413 0.0732 0.442
+602 0.726 0.411 0.0728 0.441
+603 0.724 0.41 0.0723 0.439
+604 0.722 0.408 0.0719 0.438
+605 0.72 0.407 0.0715 0.437
+606 0.718 0.405 0.0711 0.436
+607 0.716 0.403 0.0706 0.434
+608 0.714 0.402 0.0702 0.433
+609 0.712 0.4 0.0698 0.432
+610 0.71 0.398 0.0695 0.431
+611 0.708 0.397 0.0691 0.429
+612 0.706 0.395 0.0687 0.428
+613 0.704 0.394 0.0683 0.427
+614 0.703 0.392 0.0679 0.426
+615 0.701 0.39 0.0676 0.425
+616 0.699 0.389 0.0672 0.423
+617 0.697 0.387 0.0669 0.422
+618 0.695 0.385 0.0666 0.421
+619 0.693 0.384 0.0662 0.42
+620 0.692 0.382 0.0659 0.418
+621 0.69 0.38 0.0656 0.417
+622 0.688 0.379 0.0653 0.416
+623 0.686 0.377 0.065 0.415
+624 0.685 0.375 0.0647 0.414
+625 0.683 0.374 0.0644 0.412
+626 0.681 0.372 0.0641 0.411
+627 0.68 0.37 0.0638 0.41
+628 0.678 0.369 0.0635 0.409
+629 0.676 0.367 0.0633 0.408
+630 0.675 0.365 0.063 0.406
+631 0.673 0.364 0.0628 0.405
+632 0.671 0.362 0.0625 0.404
+633 0.67 0.36 0.0623 0.403
+634 0.668 0.359 0.0621 0.402
+635 0.667 0.357 0.0618 0.4
+636 0.665 0.355 0.0616 0.399
+637 0.663 0.354 0.0614 0.398
+638 0.662 0.352 0.0612 0.397
+639 0.66 0.35 0.061 0.396
+640 0.659 0.349 0.0608 0.394
+641 0.657 0.347 0.0606 0.393
+642 0.656 0.345 0.0605 0.392
+643 0.654 0.344 0.0603 0.391
+644 0.653 0.342 0.0601 0.39
+645 0.651 0.34 0.0599 0.389
+646 0.65 0.339 0.0598 0.387
+647 0.649 0.337 0.0596 0.386
+648 0.647 0.335 0.0595 0.385
+649 0.646 0.334 0.0593 0.384
+650 0.644 0.332 0.0592 0.383
+651 0.643 0.33 0.0591 0.382
+652 0.642 0.329 0.0589 0.381
+653 0.64 0.327 0.0588 0.379
+654 0.639 0.325 0.0587 0.378
+655 0.638 0.324 0.0586 0.377
+656 0.636 0.322 0.0584 0.376
+657 0.635 0.321 0.0583 0.375
+658 0.634 0.319 0.0582 0.374
+659 0.632 0.317 0.0581 0.373
+660 0.631 0.316 0.058 0.371
+661 0.63 0.314 0.0579 0.37
+662 0.629 0.313 0.0578 0.369
+663 0.627 0.311 0.0577 0.368
+664 0.626 0.31 0.0576 0.367
+665 0.625 0.308 0.0575 0.366
+666 0.624 0.306 0.0575 0.365
+667 0.622 0.305 0.0574 0.364
+668 0.621 0.303 0.0573 0.363
+669 0.62 0.302 0.0572 0.362
+670 0.619 0.3 0.0571 0.36
+671 0.618 0.299 0.057 0.359
+672 0.617 0.297 0.057 0.358
+673 0.616 0.296 0.0569 0.357
+674 0.614 0.294 0.0568 0.356
+675 0.613 0.293 0.0567 0.355
+676 0.612 0.291 0.0567 0.354
+677 0.611 0.29 0.0566 0.353
+678 0.61 0.288 0.0565 0.352
+679 0.609 0.287 0.0564 0.351
+680 0.608 0.285 0.0564 0.35
+681 0.607 0.284 0.0563 0.349
+682 0.606 0.282 0.0562 0.348
+683 0.605 0.281 0.0561 0.347
+684 0.604 0.28 0.0561 0.346
+685 0.603 0.278 0.056 0.345
+686 0.602 0.277 0.0559 0.344
+687 0.601 0.275 0.0558 0.343
+688 0.6 0.274 0.0557 0.342
+689 0.599 0.273 0.0557 0.341
+690 0.598 0.271 0.0556 0.34
+691 0.597 0.27 0.0555 0.339
+692 0.596 0.269 0.0554 0.338
+693 0.595 0.267 0.0553 0.337
+694 0.594 0.266 0.0552 0.336
+695 0.593 0.265 0.0552 0.335
+696 0.592 0.263 0.0551 0.334
+697 0.591 0.262 0.055 0.333
+698 0.59 0.261 0.0549 0.332
+699 0.589 0.259 0.0548 0.331
+700 0.589 0.258 0.0547 0.33
+701 0.588 0.257 0.0546 0.329
+702 0.587 0.256 0.0545 0.328
+703 0.586 0.254 0.0544 0.327
+704 0.585 0.253 0.0543 0.326
+705 0.584 0.252 0.0542 0.325
+706 0.583 0.251 0.0541 0.324
+707 0.582 0.249 0.054 0.324
+708 0.582 0.248 0.0539 0.323
+709 0.581 0.247 0.0538 0.322
+710 0.58 0.246 0.0536 0.321
+711 0.579 0.245 0.0535 0.32
+712 0.578 0.244 0.0534 0.319
+713 0.577 0.242 0.0533 0.318
+714 0.577 0.241 0.0532 0.317
+715 0.576 0.24 0.053 0.317
+716 0.575 0.239 0.0529 0.316
+717 0.574 0.238 0.0528 0.315
+718 0.573 0.237 0.0527 0.314
+719 0.573 0.236 0.0525 0.313
+720 0.572 0.235 0.0524 0.312
+721 0.571 0.234 0.0522 0.312
+722 0.57 0.233 0.0521 0.311
+723 0.569 0.232 0.052 0.31
+724 0.569 0.231 0.0518 0.309
+725 0.568 0.23 0.0517 0.308
+726 0.567 0.229 0.0515 0.307
+727 0.566 0.228 0.0514 0.307
+728 0.565 0.227 0.0512 0.306
+729 0.565 0.226 0.0511 0.305
+730 0.564 0.225 0.0509 0.304
+731 0.563 0.224 0.0508 0.304
+732 0.562 0.223 0.0506 0.303
+733 0.562 0.222 0.0504 0.302
+734 0.561 0.221 0.0503 0.301
+735 0.56 0.22 0.0501 0.301
+736 0.559 0.219 0.0499 0.3
+737 0.559 0.218 0.0498 0.299
+738 0.558 0.217 0.0496 0.298
+739 0.557 0.216 0.0494 0.298
+740 0.556 0.215 0.0493 0.297
+741 0.556 0.214 0.0491 0.296
+742 0.555 0.214 0.0489 0.295
+743 0.554 0.213 0.0487 0.295
+744 0.554 0.212 0.0485 0.294
+745 0.553 0.211 0.0484 0.293
+746 0.552 0.21 0.0482 0.293
+747 0.551 0.209 0.048 0.292
+748 0.551 0.209 0.0478 0.291
+749 0.55 0.208 0.0476 0.29
+750 0.549 0.207 0.0475 0.29
+751 0.548 0.206 0.0473 0.289
+752 0.548 0.205 0.0471 0.288
+753 0.547 0.205 0.0469 0.288
+754 0.546 0.204 0.0467 0.287
+755 0.546 0.203 0.0465 0.286
+756 0.545 0.202 0.0463 0.286
+757 0.544 0.202 0.0461 0.285
+758 0.543 0.201 0.046 0.284
+759 0.543 0.2 0.0458 0.284
+760 0.542 0.2 0.0456 0.283
+761 0.541 0.199 0.0454 0.282
+762 0.541 0.198 0.0452 0.282
+763 0.54 0.197 0.045 0.281
+764 0.539 0.197 0.0448 0.28
+765 0.538 0.196 0.0446 0.28
+766 0.538 0.195 0.0444 0.279
+767 0.537 0.195 0.0442 0.278
+768 0.536 0.194 0.044 0.278
+769 0.536 0.193 0.0438 0.277
+770 0.535 0.193 0.0437 0.277
+771 0.534 0.192 0.0435 0.276
+772 0.533 0.191 0.0433 0.275
+773 0.533 0.191 0.0431 0.275
+774 0.532 0.19 0.0429 0.274
+775 0.531 0.19 0.0427 0.273
+776 0.531 0.189 0.0425 0.273
+777 0.53 0.188 0.0423 0.272
+778 0.529 0.188 0.0421 0.271
+779 0.528 0.187 0.0419 0.271
+780 0.528 0.187 0.0418 0.27
+781 0.527 0.186 0.0416 0.27
+782 0.526 0.186 0.0414 0.269
+783 0.526 0.185 0.0412 0.268
+784 0.525 0.184 0.041 0.268
+785 0.524 0.184 0.0408 0.267
+786 0.523 0.183 0.0407 0.267
+787 0.523 0.183 0.0405 0.266
+788 0.522 0.182 0.0403 0.265
+789 0.521 0.182 0.0401 0.265
+790 0.521 0.181 0.0399 0.264
+791 0.52 0.181 0.0398 0.263
+792 0.519 0.18 0.0396 0.263
+793 0.518 0.18 0.0394 0.262
+794 0.518 0.179 0.0392 0.262
+795 0.517 0.179 0.0391 0.261
+796 0.516 0.178 0.0389 0.26
+797 0.516 0.178 0.0387 0.26
+798 0.515 0.177 0.0385 0.259
+799 0.514 0.177 0.0384 0.259
+800 0.513 0.176 0.0382 0.258
+801 0.513 0.176 0.038 0.257
+802 0.512 0.175 0.0379 0.257
+803 0.511 0.175 0.0377 0.256
+804 0.511 0.174 0.0376 0.256
+805 0.51 0.174 0.0374 0.255
+806 0.509 0.173 0.0372 0.254
+807 0.508 0.173 0.0371 0.254
+808 0.508 0.172 0.0369 0.253
+809 0.507 0.172 0.0368 0.253
+810 0.506 0.172 0.0366 0.252
+811 0.505 0.171 0.0365 0.251
+812 0.505 0.171 0.0363 0.251
+813 0.504 0.17 0.0362 0.25
+814 0.503 0.17 0.036 0.249
+815 0.503 0.169 0.0359 0.249
+816 0.502 0.169 0.0357 0.248
+817 0.501 0.169 0.0356 0.248
+818 0.5 0.168 0.0354 0.247
+819 0.5 0.168 0.0353 0.246
+820 0.499 0.167 0.0351 0.246
+821 0.498 0.167 0.035 0.245
+822 0.497 0.167 0.0349 0.245
+823 0.497 0.166 0.0347 0.244
+824 0.496 0.166 0.0346 0.243
+825 0.495 0.165 0.0345 0.243
+826 0.495 0.165 0.0343 0.242
+827 0.494 0.165 0.0342 0.242
+828 0.493 0.164 0.0341 0.241
+829 0.492 0.164 0.0339 0.24
+830 0.492 0.163 0.0338 0.24
+831 0.491 0.163 0.0337 0.239
+832 0.49 0.163 0.0336 0.239
+833 0.489 0.162 0.0334 0.238
+834 0.489 0.162 0.0333 0.237
+835 0.488 0.162 0.0332 0.237
+836 0.487 0.161 0.0331 0.236
+837 0.486 0.161 0.033 0.236
+838 0.486 0.161 0.0328 0.235
+839 0.485 0.16 0.0327 0.234
+840 0.484 0.16 0.0326 0.234
+841 0.483 0.159 0.0325 0.233
+842 0.483 0.159 0.0324 0.233
+843 0.482 0.159 0.0323 0.232
+844 0.481 0.158 0.0322 0.231
+845 0.48 0.158 0.032 0.231
+846 0.48 0.158 0.0319 0.23
+847 0.479 0.157 0.0318 0.23
+848 0.478 0.157 0.0317 0.229
+849 0.478 0.157 0.0316 0.228
+850 0.477 0.156 0.0315 0.228
+851 0.476 0.156 0.0314 0.227
+852 0.475 0.156 0.0313 0.227
+853 0.475 0.155 0.0312 0.226
+854 0.474 0.155 0.0311 0.225
+855 0.473 0.155 0.031 0.225
+856 0.472 0.154 0.0309 0.224
+857 0.472 0.154 0.0308 0.223
+858 0.471 0.154 0.0307 0.223
+859 0.47 0.153 0.0306 0.222
+860 0.469 0.153 0.0305 0.222
+861 0.469 0.153 0.0304 0.221
+862 0.468 0.152 0.0303 0.22
+863 0.467 0.152 0.0302 0.22
+864 0.466 0.152 0.0301 0.219
+865 0.466 0.151 0.03 0.219
+866 0.465 0.151 0.03 0.218
+867 0.464 0.151 0.0299 0.217
+868 0.463 0.151 0.0298 0.217
+869 0.463 0.15 0.0297 0.216
+870 0.462 0.15 0.0296 0.216
+871 0.461 0.15 0.0295 0.215
+872 0.46 0.149 0.0294 0.214
+873 0.46 0.149 0.0293 0.214
+874 0.459 0.149 0.0292 0.213
+875 0.458 0.148 0.0292 0.213
+876 0.457 0.148 0.0291 0.212
+877 0.457 0.148 0.029 0.211
+878 0.456 0.147 0.0289 0.211
+879 0.455 0.147 0.0288 0.21
+880 0.454 0.147 0.0287 0.21
+881 0.454 0.146 0.0286 0.209
+882 0.453 0.146 0.0286 0.208
+883 0.452 0.146 0.0285 0.208
+884 0.451 0.146 0.0284 0.207
+885 0.45 0.145 0.0283 0.207
+886 0.45 0.145 0.0282 0.206
+887 0.449 0.145 0.0281 0.205
+888 0.448 0.144 0.0281 0.205
+889 0.447 0.144 0.028 0.204
+890 0.447 0.144 0.0279 0.204
+891 0.446 0.143 0.0278 0.203
+892 0.445 0.143 0.0277 0.203
+893 0.444 0.143 0.0276 0.202
+894 0.444 0.143 0.0276 0.201
+895 0.443 0.142 0.0275 0.201
+896 0.442 0.142 0.0274 0.2
+897 0.441 0.142 0.0273 0.2
+898 0.441 0.141 0.0272 0.199
+899 0.44 0.141 0.0272 0.198
+900 0.439 0.141 0.0271 0.198
+901 0.438 0.14 0.027 0.197
+902 0.438 0.14 0.0269 0.197
+903 0.437 0.14 0.0268 0.196
+904 0.436 0.139 0.0268 0.195
+905 0.435 0.139 0.0267 0.195
+906 0.435 0.139 0.0266 0.194
+907 0.434 0.138 0.0265 0.194
+908 0.433 0.138 0.0264 0.193
+909 0.432 0.138 0.0264 0.193
+910 0.432 0.138 0.0263 0.192
+911 0.431 0.137 0.0262 0.191
+912 0.43 0.137 0.0261 0.191
+913 0.429 0.137 0.026 0.19
+914 0.428 0.136 0.026 0.19
+915 0.428 0.136 0.0259 0.189
+916 0.427 0.136 0.0258 0.188
+917 0.426 0.135 0.0257 0.188
+918 0.425 0.135 0.0256 0.187
+919 0.425 0.135 0.0256 0.187
+920 0.424 0.134 0.0255 0.186
+921 0.423 0.134 0.0254 0.186
+922 0.422 0.134 0.0253 0.185
+923 0.422 0.133 0.0252 0.184
+924 0.421 0.133 0.0252 0.184
+925 0.42 0.133 0.0251 0.183
+926 0.419 0.132 0.025 0.183
+927 0.419 0.132 0.0249 0.182
+928 0.418 0.132 0.0249 0.182
+929 0.417 0.131 0.0248 0.181
+930 0.416 0.131 0.0247 0.181
+931 0.415 0.131 0.0246 0.18
+932 0.415 0.13 0.0245 0.179
+933 0.414 0.13 0.0245 0.179
+934 0.413 0.13 0.0244 0.178
+935 0.412 0.13 0.0243 0.178
+936 0.412 0.129 0.0242 0.177
+937 0.411 0.129 0.0242 0.177
+938 0.41 0.128 0.0241 0.176
+939 0.409 0.128 0.024 0.176
+940 0.409 0.128 0.0239 0.175
+941 0.408 0.127 0.0238 0.174
+942 0.407 0.127 0.0238 0.174
+943 0.406 0.127 0.0237 0.173
+944 0.405 0.126 0.0236 0.173
+945 0.405 0.126 0.0235 0.172
+946 0.404 0.126 0.0235 0.172
+947 0.403 0.125 0.0234 0.171
+948 0.402 0.125 0.0233 0.171
+949 0.402 0.125 0.0232 0.17
+950 0.401 0.124 0.0232 0.17
+951 0.4 0.124 0.0231 0.169
+952 0.399 0.124 0.023 0.168
+953 0.399 0.123 0.0229 0.168
+954 0.398 0.123 0.0229 0.167
+955 0.397 0.123 0.0228 0.167
+956 0.396 0.122 0.0227 0.166
+957 0.396 0.122 0.0226 0.166
+958 0.395 0.122 0.0226 0.165
+959 0.394 0.121 0.0225 0.165
+960 0.393 0.121 0.0224 0.164
+961 0.392 0.12 0.0223 0.164
+962 0.392 0.12 0.0223 0.163
+963 0.391 0.12 0.0222 0.163
+964 0.39 0.119 0.0221 0.162
+965 0.389 0.119 0.0221 0.162
+966 0.389 0.119 0.022 0.161
+967 0.388 0.118 0.0219 0.161
+968 0.387 0.118 0.0218 0.16
+969 0.386 0.118 0.0218 0.16
+970 0.386 0.117 0.0217 0.159
+971 0.385 0.117 0.0216 0.159
+972 0.384 0.116 0.0216 0.158
+973 0.383 0.116 0.0215 0.158
+974 0.383 0.116 0.0214 0.157
+975 0.382 0.115 0.0214 0.157
+976 0.381 0.115 0.0213 0.156
+977 0.38 0.115 0.0212 0.156
+978 0.38 0.114 0.0212 0.155
+979 0.379 0.114 0.0211 0.155
+980 0.378 0.113 0.021 0.154
+981 0.377 0.113 0.021 0.154
+982 0.377 0.113 0.0209 0.153
+983 0.376 0.112 0.0208 0.153
+984 0.375 0.112 0.0208 0.152
+985 0.374 0.111 0.0207 0.152
+986 0.374 0.111 0.0206 0.152
+987 0.373 0.111 0.0206 0.151
+988 0.372 0.11 0.0205 0.151
+989 0.371 0.11 0.0205 0.15
+990 0.371 0.11 0.0204 0.15
+991 0.37 0.109 0.0203 0.149
+992 0.369 0.109 0.0203 0.149
+993 0.368 0.108 0.0202 0.148
+994 0.368 0.108 0.0202 0.148
+995 0.367 0.108 0.0201 0.147
+996 0.366 0.107 0.02 0.147
+997 0.365 0.107 0.02 0.147
+998 0.365 0.106 0.0199 0.146
+999 0.364 0.106 0.0199 0.146
+1000 0.363 0.106 0.0198 0.145
+1001 0.362 0.105 0.0198 0.145
+1002 0.362 0.105 0.0197 0.144
+1003 0.361 0.105 0.0196 0.144
+1004 0.36 0.104 0.0196 0.144
+1005 0.36 0.104 0.0195 0.143
+1006 0.359 0.103 0.0195 0.143
+1007 0.358 0.103 0.0194 0.142
+1008 0.357 0.103 0.0194 0.142
+1009 0.357 0.102 0.0193 0.142
+1010 0.356 0.102 0.0193 0.141
+1011 0.355 0.101 0.0192 0.141
+1012 0.355 0.101 0.0192 0.14
+1013 0.354 0.101 0.0191 0.14
+1014 0.353 0.1 0.0191 0.14
+1015 0.352 0.0998 0.019 0.139
+1016 0.352 0.0994 0.019 0.139
+1017 0.351 0.0991 0.0189 0.138
+1018 0.35 0.0987 0.0189 0.138
+1019 0.35 0.0983 0.0188 0.138
+1020 0.349 0.0979 0.0188 0.137
+1021 0.348 0.0975 0.0187 0.137
+1022 0.348 0.0971 0.0187 0.136
+1023 0.347 0.0967 0.0186 0.136
+1024 0.346 0.0964 0.0186 0.136
+1025 0.345 0.096 0.0185 0.135
+1026 0.345 0.0956 0.0185 0.135
+1027 0.344 0.0952 0.0185 0.135
+1028 0.343 0.0948 0.0184 0.134
+1029 0.343 0.0944 0.0184 0.134
+1030 0.342 0.0941 0.0183 0.134
+1031 0.341 0.0937 0.0183 0.133
+1032 0.341 0.0933 0.0182 0.133
+1033 0.34 0.0929 0.0182 0.133
+1034 0.339 0.0926 0.0182 0.132
+1035 0.339 0.0922 0.0181 0.132
+1036 0.338 0.0918 0.0181 0.132
+1037 0.337 0.0914 0.018 0.131
+1038 0.337 0.0911 0.018 0.131
+1039 0.336 0.0907 0.018 0.131
+1040 0.335 0.0903 0.0179 0.13
+1041 0.335 0.0899 0.0179 0.13
+1042 0.334 0.0896 0.0179 0.13
+1043 0.334 0.0892 0.0178 0.129
+1044 0.333 0.0888 0.0178 0.129
+1045 0.332 0.0885 0.0177 0.129
+1046 0.332 0.0881 0.0177 0.128
+1047 0.331 0.0877 0.0177 0.128
+1048 0.33 0.0874 0.0176 0.128
+1049 0.33 0.087 0.0176 0.127
+1050 0.329 0.0867 0.0176 0.127
+1051 0.328 0.0863 0.0175 0.127
+1052 0.328 0.086 0.0175 0.127
+1053 0.327 0.0856 0.0175 0.126
+1054 0.327 0.0852 0.0174 0.126
+1055 0.326 0.0849 0.0174 0.126
+1056 0.325 0.0845 0.0174 0.125
+1057 0.325 0.0842 0.0173 0.125
+1058 0.324 0.0839 0.0173 0.125
+1059 0.324 0.0835 0.0173 0.125
+1060 0.323 0.0832 0.0172 0.124
+1061 0.322 0.0828 0.0172 0.124
+1062 0.322 0.0825 0.0172 0.124
+1063 0.321 0.0821 0.0171 0.123
+1064 0.321 0.0818 0.0171 0.123
+1065 0.32 0.0815 0.0171 0.123
+1066 0.32 0.0811 0.017 0.123
+1067 0.319 0.0808 0.017 0.122
+1068 0.318 0.0805 0.017 0.122
+1069 0.318 0.0802 0.0169 0.122
+1070 0.317 0.0798 0.0169 0.122
+1071 0.317 0.0795 0.0169 0.121
+1072 0.316 0.0792 0.0169 0.121
+1073 0.316 0.0789 0.0168 0.121
+1074 0.315 0.0785 0.0168 0.121
+1075 0.314 0.0782 0.0168 0.12
+1076 0.314 0.0779 0.0167 0.12
+1077 0.313 0.0776 0.0167 0.12
+1078 0.313 0.0773 0.0167 0.12
+1079 0.312 0.077 0.0167 0.119
+1080 0.312 0.0767 0.0166 0.119
+1081 0.311 0.0764 0.0166 0.119
+1082 0.311 0.0761 0.0166 0.119
+1083 0.31 0.0758 0.0165 0.118
+1084 0.31 0.0755 0.0165 0.118
+1085 0.309 0.0752 0.0165 0.118
+1086 0.309 0.0749 0.0165 0.118
+1087 0.308 0.0746 0.0164 0.118
+1088 0.308 0.0743 0.0164 0.117
+1089 0.307 0.074 0.0164 0.117
+1090 0.307 0.0737 0.0163 0.117
+1091 0.306 0.0734 0.0163 0.117
+1092 0.306 0.0731 0.0163 0.117
+1093 0.305 0.0729 0.0163 0.116
+1094 0.305 0.0726 0.0162 0.116
+1095 0.304 0.0723 0.0162 0.116
+1096 0.304 0.072 0.0162 0.116
+1097 0.303 0.0718 0.0162 0.115
+1098 0.303 0.0715 0.0161 0.115
+1099 0.302 0.0712 0.0161 0.115
+1100 0.302 0.071 0.0161 0.115
+1101 0.301 0.0707 0.0161 0.115
+1102 0.301 0.0704 0.016 0.114
+1103 0.301 0.0702 0.016 0.114
+1104 0.3 0.0699 0.016 0.114
+1105 0.3 0.0697 0.0159 0.114
+1106 0.299 0.0694 0.0159 0.114
+1107 0.299 0.0692 0.0159 0.113
+1108 0.298 0.0689 0.0159 0.113
+1109 0.298 0.0687 0.0158 0.113
+1110 0.298 0.0684 0.0158 0.113
+1111 0.297 0.0682 0.0158 0.113
+1112 0.297 0.0679 0.0158 0.113
+1113 0.296 0.0677 0.0157 0.112
+1114 0.296 0.0675 0.0157 0.112
+1115 0.295 0.0672 0.0157 0.112
+1116 0.295 0.067 0.0157 0.112
+1117 0.295 0.0668 0.0156 0.112
+1118 0.294 0.0665 0.0156 0.111
+1119 0.294 0.0663 0.0156 0.111
+1120 0.294 0.0661 0.0156 0.111
+1121 0.293 0.0659 0.0155 0.111
+1122 0.293 0.0657 0.0155 0.111
+1123 0.292 0.0654 0.0155 0.111
+1124 0.292 0.0652 0.0155 0.11
+1125 0.292 0.065 0.0154 0.11
+1126 0.291 0.0648 0.0154 0.11
+1127 0.291 0.0646 0.0154 0.11
+1128 0.291 0.0644 0.0154 0.11
+1129 0.29 0.0642 0.0153 0.11
+1130 0.29 0.064 0.0153 0.109
+1131 0.29 0.0638 0.0153 0.109
+1132 0.289 0.0636 0.0152 0.109
+1133 0.289 0.0634 0.0152 0.109
+1134 0.289 0.0632 0.0152 0.109
+1135 0.288 0.063 0.0152 0.108
+1136 0.288 0.0628 0.0151 0.108
+1137 0.288 0.0626 0.0151 0.108
+1138 0.287 0.0624 0.0151 0.108
+1139 0.287 0.0623 0.0151 0.108
+1140 0.287 0.0621 0.015 0.108
+1141 0.286 0.0619 0.015 0.107
+1142 0.286 0.0617 0.015 0.107
+1143 0.286 0.0615 0.015 0.107
+1144 0.285 0.0614 0.0149 0.107
+1145 0.285 0.0612 0.0149 0.107
+1146 0.285 0.061 0.0149 0.107
+1147 0.284 0.0608 0.0149 0.107
+1148 0.284 0.0607 0.0148 0.106
+1149 0.284 0.0605 0.0148 0.106
+1150 0.284 0.0604 0.0148 0.106
+1151 0.283 0.0602 0.0148 0.106
+1152 0.283 0.06 0.0147 0.106
+1153 0.283 0.0599 0.0147 0.106
+1154 0.283 0.0597 0.0147 0.105
+1155 0.282 0.0596 0.0147 0.105
+1156 0.282 0.0594 0.0146 0.105
+1157 0.282 0.0593 0.0146 0.105
+1158 0.281 0.0591 0.0146 0.105
+1159 0.281 0.059 0.0146 0.105
+1160 0.281 0.0588 0.0145 0.104
+1161 0.281 0.0587 0.0145 0.104
+1162 0.28 0.0585 0.0145 0.104
+1163 0.28 0.0584 0.0144 0.104
+1164 0.28 0.0582 0.0144 0.104
+1165 0.28 0.0581 0.0144 0.104
+1166 0.28 0.058 0.0144 0.103
+1167 0.279 0.0578 0.0143 0.103
+1168 0.279 0.0577 0.0143 0.103
+1169 0.279 0.0576 0.0143 0.103
+1170 0.279 0.0574 0.0143 0.103
+1171 0.278 0.0573 0.0142 0.103
+1172 0.278 0.0572 0.0142 0.102
+1173 0.278 0.057 0.0142 0.102
+1174 0.278 0.0569 0.0142 0.102
+1175 0.278 0.0568 0.0141 0.102
+1176 0.277 0.0567 0.0141 0.102
+1177 0.277 0.0566 0.0141 0.102
+1178 0.277 0.0564 0.0141 0.101
+1179 0.277 0.0563 0.014 0.101
+1180 0.277 0.0562 0.014 0.101
+1181 0.276 0.0561 0.014 0.101
+1182 0.276 0.056 0.014 0.101
+1183 0.276 0.0559 0.0139 0.101
+1184 0.276 0.0557 0.0139 0.1
+1185 0.276 0.0556 0.0139 0.1
+1186 0.276 0.0555 0.0139 0.1
+1187 0.275 0.0554 0.0138 0.1
+1188 0.275 0.0553 0.0138 0.0998
+1189 0.275 0.0552 0.0138 0.0997
+1190 0.275 0.0551 0.0137 0.0995
+1191 0.275 0.055 0.0137 0.0993
+1192 0.275 0.0549 0.0137 0.0992
+1193 0.274 0.0548 0.0137 0.099
+1194 0.274 0.0547 0.0136 0.0988
+1195 0.274 0.0546 0.0136 0.0987
+1196 0.274 0.0545 0.0136 0.0985
+1197 0.274 0.0544 0.0136 0.0983
+1198 0.274 0.0543 0.0135 0.0981
+1199 0.274 0.0542 0.0135 0.098
+1200 0.273 0.0541 0.0135 0.0978
+1201 0.273 0.054 0.0135 0.0976
+1202 0.273 0.0539 0.0134 0.0975
+1203 0.273 0.0538 0.0134 0.0973
+1204 0.273 0.0537 0.0134 0.0971
+1205 0.273 0.0536 0.0134 0.097
+1206 0.273 0.0535 0.0133 0.0968
+1207 0.273 0.0535 0.0133 0.0966
+1208 0.272 0.0534 0.0133 0.0964
+1209 0.272 0.0533 0.0133 0.0963
+1210 0.272 0.0532 0.0132 0.0961
+1211 0.272 0.0531 0.0132 0.0959
+1212 0.272 0.053 0.0132 0.0958
+1213 0.272 0.0529 0.0132 0.0956
+1214 0.272 0.0529 0.0131 0.0954
+1215 0.272 0.0528 0.0131 0.0952
+1216 0.272 0.0527 0.0131 0.0951
+1217 0.271 0.0526 0.0131 0.0949
+1218 0.271 0.0525 0.013 0.0947
+1219 0.271 0.0524 0.013 0.0945
+1220 0.271 0.0524 0.013 0.0944
+1221 0.271 0.0523 0.013 0.0942
+1222 0.271 0.0522 0.0129 0.094
+1223 0.271 0.0521 0.0129 0.0938
+1224 0.271 0.0521 0.0129 0.0937
+1225 0.271 0.052 0.0129 0.0935
+1226 0.271 0.0519 0.0128 0.0933
+1227 0.271 0.0518 0.0128 0.0931
+1228 0.27 0.0517 0.0128 0.093
+1229 0.27 0.0517 0.0128 0.0928
+1230 0.27 0.0516 0.0127 0.0926
+1231 0.27 0.0515 0.0127 0.0924
+1232 0.27 0.0515 0.0127 0.0922
+1233 0.27 0.0514 0.0127 0.0921
+1234 0.27 0.0513 0.0126 0.0919
+1235 0.27 0.0512 0.0126 0.0917
+1236 0.27 0.0512 0.0126 0.0915
+1237 0.27 0.0511 0.0126 0.0913
+1238 0.27 0.051 0.0125 0.0912
+1239 0.27 0.0509 0.0125 0.091
+1240 0.27 0.0509 0.0125 0.0908
+1241 0.27 0.0508 0.0125 0.0906
+1242 0.269 0.0507 0.0124 0.0904
+1243 0.269 0.0507 0.0124 0.0903
+1244 0.269 0.0506 0.0124 0.0901
+1245 0.269 0.0505 0.0124 0.0899
+1246 0.269 0.0505 0.0123 0.0897
+1247 0.269 0.0504 0.0123 0.0895
+1248 0.269 0.0503 0.0123 0.0893
+1249 0.269 0.0502 0.0123 0.0892
+1250 0.269 0.0502 0.0123 0.089
+1251 0.269 0.0501 0.0122 0.0888
+1252 0.269 0.05 0.0122 0.0886
+1253 0.269 0.05 0.0122 0.0884
+1254 0.269 0.0499 0.0122 0.0882
+1255 0.269 0.0498 0.0121 0.088
+1256 0.269 0.0498 0.0121 0.0879
+1257 0.269 0.0497 0.0121 0.0877
+1258 0.269 0.0496 0.0121 0.0875
+1259 0.269 0.0496 0.012 0.0873
+1260 0.269 0.0495 0.012 0.0871
+1261 0.269 0.0494 0.012 0.0869
+1262 0.269 0.0494 0.012 0.0867
+1263 0.268 0.0493 0.0119 0.0866
+1264 0.268 0.0492 0.0119 0.0864
+1265 0.268 0.0492 0.0119 0.0862
+1266 0.268 0.0491 0.0119 0.086
+1267 0.268 0.049 0.0118 0.0858
+1268 0.268 0.049 0.0118 0.0856
+1269 0.268 0.0489 0.0118 0.0854
+1270 0.268 0.0488 0.0118 0.0853
+1271 0.268 0.0488 0.0117 0.0851
+1272 0.268 0.0487 0.0117 0.0849
+1273 0.268 0.0486 0.0117 0.0847
+1274 0.268 0.0485 0.0117 0.0845
+1275 0.268 0.0485 0.0117 0.0843
+1276 0.268 0.0484 0.0116 0.0841
+1277 0.268 0.0483 0.0116 0.0839
+1278 0.268 0.0483 0.0116 0.0838
+1279 0.268 0.0482 0.0116 0.0836
+1280 0.268 0.0481 0.0115 0.0834
+1281 0.268 0.0481 0.0115 0.0832
+1282 0.268 0.048 0.0115 0.083
+1283 0.268 0.0479 0.0115 0.0828
+1284 0.268 0.0479 0.0114 0.0826
+1285 0.268 0.0478 0.0114 0.0824
+1286 0.268 0.0477 0.0114 0.0822
+1287 0.268 0.0477 0.0114 0.0821
+1288 0.268 0.0476 0.0113 0.0819
+1289 0.268 0.0475 0.0113 0.0817
+1290 0.268 0.0475 0.0113 0.0815
+1291 0.268 0.0474 0.0113 0.0813
+1292 0.268 0.0473 0.0113 0.0811
+1293 0.268 0.0472 0.0112 0.0809
+1294 0.268 0.0472 0.0112 0.0807
+1295 0.268 0.0471 0.0112 0.0805
+1296 0.268 0.047 0.0112 0.0804
+1297 0.268 0.047 0.0111 0.0802
+1298 0.268 0.0469 0.0111 0.08
+1299 0.267 0.0468 0.0111 0.0798
+1300 0.267 0.0468 0.0111 0.0796
+1301 0.267 0.0467 0.011 0.0794
+1302 0.267 0.0466 0.011 0.0792
+1303 0.267 0.0465 0.011 0.079
+1304 0.267 0.0465 0.011 0.0789
+1305 0.267 0.0464 0.0109 0.0787
+1306 0.267 0.0463 0.0109 0.0785
+1307 0.267 0.0462 0.0109 0.0783
+1308 0.267 0.0462 0.0109 0.0781
+1309 0.267 0.0461 0.0109 0.0779
+1310 0.267 0.046 0.0108 0.0777
+1311 0.267 0.046 0.0108 0.0775
+1312 0.267 0.0459 0.0108 0.0773
+1313 0.267 0.0458 0.0108 0.0772
+1314 0.267 0.0457 0.0107 0.077
+1315 0.267 0.0457 0.0107 0.0768
+1316 0.267 0.0456 0.0107 0.0766
+1317 0.267 0.0455 0.0107 0.0764
+1318 0.267 0.0454 0.0106 0.0762
+1319 0.267 0.0454 0.0106 0.076
+1320 0.267 0.0453 0.0106 0.0758
+1321 0.267 0.0452 0.0106 0.0757
+1322 0.267 0.0451 0.0105 0.0755
+1323 0.267 0.0451 0.0105 0.0753
+1324 0.267 0.045 0.0105 0.0751
+1325 0.267 0.0449 0.0105 0.0749
+1326 0.267 0.0448 0.0105 0.0747
+1327 0.267 0.0448 0.0104 0.0745
+1328 0.267 0.0447 0.0104 0.0743
+1329 0.267 0.0446 0.0104 0.0742
+1330 0.267 0.0445 0.0104 0.074
+1331 0.267 0.0444 0.0103 0.0738
+1332 0.267 0.0444 0.0103 0.0736
+1333 0.267 0.0443 0.0103 0.0734
+1334 0.267 0.0442 0.0103 0.0732
+1335 0.267 0.0441 0.0102 0.073
+1336 0.267 0.044 0.0102 0.0729
+1337 0.267 0.044 0.0102 0.0727
+1338 0.267 0.0439 0.0102 0.0725
+1339 0.267 0.0438 0.0101 0.0723
+1340 0.267 0.0437 0.0101 0.0721
+1341 0.267 0.0436 0.0101 0.0719
+1342 0.267 0.0436 0.0101 0.0718
+1343 0.267 0.0435 0.01 0.0716
+1344 0.267 0.0434 0.01 0.0714
+1345 0.267 0.0433 0.01 0.0712
+1346 0.266 0.0432 0.00997 0.071
+1347 0.266 0.0432 0.00995 0.0708
+1348 0.266 0.0431 0.00992 0.0707
+1349 0.266 0.043 0.0099 0.0705
+1350 0.266 0.0429 0.00988 0.0703
+1351 0.266 0.0428 0.00985 0.0701
+1352 0.266 0.0428 0.00983 0.0699
+1353 0.266 0.0427 0.0098 0.0697
+1354 0.266 0.0426 0.00978 0.0696
+1355 0.266 0.0425 0.00975 0.0694
+1356 0.266 0.0424 0.00973 0.0692
+1357 0.266 0.0423 0.00971 0.069
+1358 0.266 0.0423 0.00968 0.0688
+1359 0.266 0.0422 0.00966 0.0686
+1360 0.266 0.0421 0.00963 0.0685
+1361 0.266 0.042 0.00961 0.0683
+1362 0.266 0.0419 0.00958 0.0681
+1363 0.266 0.0418 0.00956 0.0679
+1364 0.266 0.0417 0.00953 0.0677
+1365 0.266 0.0417 0.00951 0.0676
+1366 0.266 0.0416 0.00949 0.0674
+1367 0.266 0.0415 0.00946 0.0672
+1368 0.266 0.0414 0.00944 0.067
+1369 0.266 0.0413 0.00941 0.0668
+1370 0.266 0.0412 0.00939 0.0667
+1371 0.266 0.0412 0.00936 0.0665
+1372 0.266 0.0411 0.00934 0.0663
+1373 0.266 0.041 0.00931 0.0661
+1374 0.266 0.0409 0.00929 0.0659
+1375 0.265 0.0408 0.00926 0.0658
+1376 0.265 0.0407 0.00924 0.0656
+1377 0.265 0.0406 0.00921 0.0654
+1378 0.265 0.0406 0.00919 0.0652
+1379 0.265 0.0405 0.00916 0.065
+1380 0.265 0.0404 0.00914 0.0649
+1381 0.265 0.0403 0.00912 0.0647
+1382 0.265 0.0402 0.00909 0.0645
+1383 0.265 0.0401 0.00907 0.0643
+1384 0.265 0.04 0.00904 0.0642
+1385 0.265 0.0399 0.00902 0.064
+1386 0.265 0.0399 0.00899 0.0638
+1387 0.265 0.0398 0.00897 0.0636
+1388 0.265 0.0397 0.00894 0.0635
+1389 0.265 0.0396 0.00892 0.0633
+1390 0.265 0.0395 0.00889 0.0631
+1391 0.265 0.0394 0.00887 0.0629
+1392 0.265 0.0393 0.00884 0.0627
+1393 0.265 0.0392 0.00882 0.0626
+1394 0.265 0.0392 0.00879 0.0624
+1395 0.264 0.0391 0.00877 0.0622
+1396 0.264 0.039 0.00874 0.062
+1397 0.264 0.0389 0.00872 0.0619
+1398 0.264 0.0388 0.00869 0.0617
+1399 0.264 0.0387 0.00867 0.0615
+1400 0.264 0.0386 0.00864 0.0613
+1401 0.264 0.0385 0.00862 0.0612
+1402 0.264 0.0385 0.00859 0.061
+1403 0.264 0.0384 0.00857 0.0608
+1404 0.264 0.0383 0.00854 0.0607
+1405 0.264 0.0382 0.00852 0.0605
+1406 0.264 0.0381 0.00849 0.0603
+1407 0.264 0.038 0.00847 0.0601
+1408 0.264 0.0379 0.00844 0.06
+1409 0.264 0.0378 0.00842 0.0598
+1410 0.263 0.0378 0.00839 0.0596
+1411 0.263 0.0377 0.00837 0.0594
+1412 0.263 0.0376 0.00834 0.0593
+1413 0.263 0.0375 0.00832 0.0591
+1414 0.263 0.0374 0.00829 0.0589
+1415 0.263 0.0373 0.00827 0.0588
+1416 0.263 0.0372 0.00824 0.0586
+1417 0.263 0.0371 0.00822 0.0584
+1418 0.263 0.0371 0.00819 0.0582
+1419 0.263 0.037 0.00817 0.0581
+1420 0.263 0.0369 0.00814 0.0579
+1421 0.263 0.0368 0.00812 0.0577
+1422 0.263 0.0367 0.00809 0.0575
+1423 0.262 0.0366 0.00807 0.0574
+1424 0.262 0.0365 0.00804 0.0572
+1425 0.262 0.0364 0.00802 0.057
+1426 0.262 0.0364 0.00799 0.0569
+1427 0.262 0.0363 0.00797 0.0567
+1428 0.262 0.0362 0.00794 0.0565
+1429 0.262 0.0361 0.00792 0.0564
+1430 0.262 0.036 0.00789 0.0562
+1431 0.262 0.0359 0.00787 0.056
+1432 0.262 0.0358 0.00784 0.0558
+1433 0.262 0.0358 0.00782 0.0557
+1434 0.262 0.0357 0.00779 0.0555
+1435 0.261 0.0356 0.00777 0.0553
+1436 0.261 0.0355 0.00775 0.0552
+1437 0.261 0.0354 0.00772 0.055
+1438 0.261 0.0353 0.0077 0.0548
+1439 0.261 0.0352 0.00767 0.0547
+1440 0.261 0.0352 0.00765 0.0545
+1441 0.261 0.0351 0.00762 0.0543
+1442 0.261 0.035 0.0076 0.0542
+1443 0.261 0.0349 0.00757 0.054
+1444 0.261 0.0348 0.00755 0.0538
+1445 0.26 0.0347 0.00752 0.0537
+1446 0.26 0.0347 0.0075 0.0535
+1447 0.26 0.0346 0.00748 0.0533
+1448 0.26 0.0345 0.00745 0.0532
+1449 0.26 0.0344 0.00743 0.053
+1450 0.26 0.0343 0.0074 0.0528
+1451 0.26 0.0342 0.00738 0.0527
+1452 0.26 0.0341 0.00735 0.0525
+1453 0.26 0.0341 0.00733 0.0523
+1454 0.26 0.034 0.00731 0.0522
+1455 0.259 0.0339 0.00728 0.052
+1456 0.259 0.0338 0.00726 0.0518
+1457 0.259 0.0337 0.00723 0.0517
+1458 0.259 0.0337 0.00721 0.0515
+1459 0.259 0.0336 0.00719 0.0513
+1460 0.259 0.0335 0.00716 0.0512
+1461 0.259 0.0334 0.00714 0.051
+1462 0.259 0.0333 0.00711 0.0508
+1463 0.258 0.0332 0.00709 0.0507
+1464 0.258 0.0332 0.00707 0.0505
+1465 0.258 0.0331 0.00704 0.0503
+1466 0.258 0.033 0.00702 0.0502
+1467 0.258 0.0329 0.007 0.05
+1468 0.258 0.0328 0.00697 0.0498
+1469 0.258 0.0328 0.00695 0.0497
+1470 0.258 0.0327 0.00693 0.0495
+1471 0.257 0.0326 0.0069 0.0493
+1472 0.257 0.0325 0.00688 0.0492
+1473 0.257 0.0324 0.00686 0.049
+1474 0.257 0.0324 0.00683 0.0488
+1475 0.257 0.0323 0.00681 0.0487
+1476 0.257 0.0322 0.00679 0.0485
+1477 0.257 0.0321 0.00676 0.0484
+1478 0.257 0.0321 0.00674 0.0482
+1479 0.256 0.032 0.00672 0.048
+1480 0.256 0.0319 0.0067 0.0479
+1481 0.256 0.0318 0.00667 0.0477
+1482 0.256 0.0317 0.00665 0.0475
+1483 0.256 0.0317 0.00663 0.0474
+1484 0.256 0.0316 0.0066 0.0472
+1485 0.256 0.0315 0.00658 0.0471
+1486 0.255 0.0314 0.00656 0.0469
+1487 0.255 0.0314 0.00654 0.0467
+1488 0.255 0.0313 0.00651 0.0466
+1489 0.255 0.0312 0.00649 0.0464
+1490 0.255 0.0311 0.00647 0.0462
+1491 0.255 0.0311 0.00645 0.0461
+1492 0.255 0.031 0.00643 0.0459
+1493 0.254 0.0309 0.0064 0.0458
+1494 0.254 0.0308 0.00638 0.0456
+1495 0.254 0.0308 0.00636 0.0454
+1496 0.254 0.0307 0.00634 0.0453
+1497 0.254 0.0306 0.00632 0.0451
+1498 0.254 0.0305 0.0063 0.045
+1499 0.253 0.0305 0.00627 0.0448
+1500 0.253 0.0304 0.00625 0.0446
+1501 0.253 0.0303 0.00623 0.0445
+1502 0.253 0.0303 0.00621 0.0443
+1503 0.253 0.0302 0.00619 0.0442
+1504 0.253 0.0301 0.00617 0.044
+1505 0.253 0.03 0.00615 0.0438
+1506 0.252 0.03 0.00612 0.0437
+1507 0.252 0.0299 0.0061 0.0435
+1508 0.252 0.0298 0.00608 0.0434
+1509 0.252 0.0298 0.00606 0.0432
+1510 0.252 0.0297 0.00604 0.043
+1511 0.252 0.0296 0.00602 0.0429
+1512 0.251 0.0296 0.006 0.0427
+1513 0.251 0.0295 0.00598 0.0426
+1514 0.251 0.0294 0.00596 0.0424
+1515 0.251 0.0293 0.00594 0.0422
+1516 0.251 0.0293 0.00592 0.0421
+1517 0.251 0.0292 0.0059 0.0419
+1518 0.25 0.0291 0.00588 0.0418
+1519 0.25 0.0291 0.00586 0.0416
+1520 0.25 0.029 0.00584 0.0415
+1521 0.25 0.0289 0.00582 0.0413
+1522 0.25 0.0289 0.0058 0.0411
+1523 0.249 0.0288 0.00578 0.041
+1524 0.249 0.0287 0.00576 0.0408
+1525 0.249 0.0287 0.00574 0.0407
+1526 0.249 0.0286 0.00572 0.0405
+1527 0.249 0.0285 0.0057 0.0404
+1528 0.249 0.0285 0.00568 0.0402
+1529 0.248 0.0284 0.00566 0.04
+1530 0.248 0.0283 0.00564 0.0399
+1531 0.248 0.0283 0.00562 0.0397
+1532 0.248 0.0282 0.0056 0.0396
+1533 0.248 0.0282 0.00558 0.0394
+1534 0.247 0.0281 0.00556 0.0393
+1535 0.247 0.028 0.00555 0.0391
+1536 0.247 0.028 0.00553 0.039
+1537 0.247 0.0279 0.00551 0.0388
+1538 0.247 0.0278 0.00549 0.0387
+1539 0.246 0.0278 0.00547 0.0385
+1540 0.246 0.0277 0.00545 0.0384
+1541 0.246 0.0277 0.00543 0.0382
+1542 0.246 0.0276 0.00542 0.038
+1543 0.246 0.0275 0.0054 0.0379
+1544 0.245 0.0275 0.00538 0.0377
+1545 0.245 0.0274 0.00536 0.0376
+1546 0.245 0.0274 0.00534 0.0374
+1547 0.245 0.0273 0.00533 0.0373
+1548 0.245 0.0272 0.00531 0.0371
+1549 0.244 0.0272 0.00529 0.037
+1550 0.244 0.0271 0.00527 0.0368
+1551 0.244 0.0271 0.00526 0.0367
+1552 0.244 0.027 0.00524 0.0365
+1553 0.244 0.0269 0.00522 0.0364
+1554 0.243 0.0269 0.0052 0.0362
+1555 0.243 0.0268 0.00519 0.0361
+1556 0.243 0.0268 0.00517 0.0359
+1557 0.243 0.0267 0.00515 0.0358
+1558 0.243 0.0267 0.00513 0.0356
+1559 0.242 0.0266 0.00512 0.0355
+1560 0.242 0.0265 0.0051 0.0353
+1561 0.242 0.0265 0.00508 0.0352
+1562 0.242 0.0264 0.00507 0.035
+1563 0.241 0.0264 0.00505 0.0349
+1564 0.241 0.0263 0.00504 0.0347
+1565 0.241 0.0263 0.00502 0.0346
+1566 0.241 0.0262 0.005 0.0344
+1567 0.241 0.0261 0.00499 0.0343
+1568 0.24 0.0261 0.00497 0.0341
+1569 0.24 0.026 0.00495 0.034
+1570 0.24 0.026 0.00494 0.0339
+1571 0.24 0.0259 0.00492 0.0337
+1572 0.239 0.0259 0.00491 0.0336
+1573 0.239 0.0258 0.00489 0.0334
+1574 0.239 0.0258 0.00488 0.0333
+1575 0.239 0.0257 0.00486 0.0331
+1576 0.238 0.0257 0.00484 0.033
+1577 0.238 0.0256 0.00483 0.0328
+1578 0.238 0.0256 0.00481 0.0327
+1579 0.238 0.0255 0.0048 0.0326
+1580 0.238 0.0255 0.00478 0.0324
+1581 0.237 0.0254 0.00477 0.0323
+1582 0.237 0.0254 0.00475 0.0321
+1583 0.237 0.0253 0.00474 0.032
+1584 0.237 0.0253 0.00472 0.0318
+1585 0.236 0.0252 0.00471 0.0317
+1586 0.236 0.0251 0.00469 0.0316
+1587 0.236 0.0251 0.00468 0.0314
+1588 0.236 0.025 0.00467 0.0313
+1589 0.235 0.025 0.00465 0.0311
+1590 0.235 0.0249 0.00464 0.031
+1591 0.235 0.0249 0.00462 0.0308
+1592 0.235 0.0249 0.00461 0.0307
+1593 0.234 0.0248 0.00459 0.0306
+1594 0.234 0.0248 0.00458 0.0304
+1595 0.234 0.0247 0.00457 0.0303
+1596 0.234 0.0247 0.00455 0.0302
+1597 0.233 0.0246 0.00454 0.03
+1598 0.233 0.0246 0.00452 0.0299
+1599 0.233 0.0245 0.00451 0.0297
+1600 0.233 0.0245 0.0045 0.0296
+1601 0.232 0.0244 0.00448 0.0295
+1602 0.232 0.0244 0.00447 0.0293
+1603 0.232 0.0243 0.00446 0.0292
+1604 0.232 0.0243 0.00444 0.0291
+1605 0.231 0.0242 0.00443 0.0289
+1606 0.231 0.0242 0.00442 0.0288
+1607 0.231 0.0241 0.0044 0.0286
+1608 0.231 0.0241 0.00439 0.0285
+1609 0.23 0.024 0.00438 0.0284
+1610 0.23 0.024 0.00437 0.0282
+1611 0.23 0.024 0.00435 0.0281
+1612 0.23 0.0239 0.00434 0.028
+1613 0.229 0.0239 0.00433 0.0278
+1614 0.229 0.0238 0.00432 0.0277
+1615 0.229 0.0238 0.0043 0.0276
+1616 0.228 0.0237 0.00429 0.0274
+1617 0.228 0.0237 0.00428 0.0273
+1618 0.228 0.0236 0.00427 0.0272
+1619 0.228 0.0236 0.00425 0.0271
+1620 0.227 0.0236 0.00424 0.0269
+1621 0.227 0.0235 0.00423 0.0268
+1622 0.227 0.0235 0.00422 0.0267
+1623 0.227 0.0234 0.00421 0.0265
+1624 0.226 0.0234 0.00419 0.0264
+1625 0.226 0.0233 0.00418 0.0263
+1626 0.226 0.0233 0.00417 0.0262
+1627 0.225 0.0232 0.00416 0.026
+1628 0.225 0.0232 0.00415 0.0259
+1629 0.225 0.0232 0.00414 0.0258
+1630 0.225 0.0231 0.00412 0.0256
+1631 0.224 0.0231 0.00411 0.0255
+1632 0.224 0.023 0.0041 0.0254
+1633 0.224 0.023 0.00409 0.0253
+1634 0.223 0.023 0.00408 0.0251
+1635 0.223 0.0229 0.00407 0.025
+1636 0.223 0.0229 0.00406 0.0249
+1637 0.223 0.0228 0.00405 0.0248
+1638 0.222 0.0228 0.00404 0.0246
+1639 0.222 0.0227 0.00402 0.0245
+1640 0.222 0.0227 0.00401 0.0244
+1641 0.221 0.0227 0.004 0.0243
+1642 0.221 0.0226 0.00399 0.0242
+1643 0.221 0.0226 0.00398 0.024
+1644 0.221 0.0225 0.00397 0.0239
+1645 0.22 0.0225 0.00396 0.0238
+1646 0.22 0.0225 0.00395 0.0237
+1647 0.22 0.0224 0.00394 0.0235
+1648 0.219 0.0224 0.00393 0.0234
+1649 0.219 0.0223 0.00392 0.0233
+1650 0.219 0.0223 0.00391 0.0232
+1651 0.219 0.0223 0.0039 0.0231
+1652 0.218 0.0222 0.00389 0.023
+1653 0.218 0.0222 0.00388 0.0228
+1654 0.218 0.0221 0.00387 0.0227
+1655 0.217 0.0221 0.00386 0.0226
+1656 0.217 0.0221 0.00385 0.0225
+1657 0.217 0.022 0.00384 0.0224
+1658 0.216 0.022 0.00383 0.0223
+1659 0.216 0.0219 0.00382 0.0221
+1660 0.216 0.0219 0.00381 0.022
+1661 0.216 0.0219 0.0038 0.0219
+1662 0.215 0.0218 0.00379 0.0218
+1663 0.215 0.0218 0.00378 0.0217
+1664 0.215 0.0218 0.00377 0.0216
+1665 0.214 0.0217 0.00376 0.0215
+1666 0.214 0.0217 0.00375 0.0213
+1667 0.214 0.0216 0.00374 0.0212
+1668 0.213 0.0216 0.00374 0.0211
+1669 0.213 0.0216 0.00373 0.021
+1670 0.213 0.0215 0.00372 0.0209
+1671 0.212 0.0215 0.00371 0.0208
+1672 0.212 0.0215 0.0037 0.0207
+1673 0.212 0.0214 0.00369 0.0206
+1674 0.211 0.0214 0.00368 0.0205
+1675 0.211 0.0213 0.00367 0.0204
+1676 0.211 0.0213 0.00366 0.0203
+1677 0.211 0.0213 0.00365 0.0201
+1678 0.21 0.0212 0.00365 0.02
+1679 0.21 0.0212 0.00364 0.0199
+1680 0.21 0.0212 0.00363 0.0198
+1681 0.209 0.0211 0.00362 0.0197
+1682 0.209 0.0211 0.00361 0.0196
+1683 0.209 0.021 0.0036 0.0195
+1684 0.208 0.021 0.00359 0.0194
+1685 0.208 0.021 0.00359 0.0193
+1686 0.208 0.0209 0.00358 0.0192
+1687 0.207 0.0209 0.00357 0.0191
+1688 0.207 0.0209 0.00356 0.019
+1689 0.207 0.0208 0.00355 0.0189
+1690 0.206 0.0208 0.00354 0.0188
+1691 0.206 0.0208 0.00354 0.0187
+1692 0.206 0.0207 0.00353 0.0186
+1693 0.205 0.0207 0.00352 0.0185
+1694 0.205 0.0206 0.00351 0.0184
+1695 0.205 0.0206 0.0035 0.0183
+1696 0.204 0.0206 0.0035 0.0182
+1697 0.204 0.0205 0.00349 0.0181
+1698 0.204 0.0205 0.00348 0.018
+1699 0.203 0.0205 0.00347 0.0179
+1700 0.203 0.0204 0.00346 0.0178
+1701 0.203 0.0204 0.00346 0.0177
+1702 0.202 0.0204 0.00345 0.0176
+1703 0.202 0.0203 0.00344 0.0175
+1704 0.202 0.0203 0.00343 0.0174
+1705 0.201 0.0203 0.00343 0.0173
+1706 0.201 0.0202 0.00342 0.0172
+1707 0.201 0.0202 0.00341 0.0171
+1708 0.2 0.0201 0.0034 0.017
+1709 0.2 0.0201 0.0034 0.0169
+1710 0.2 0.0201 0.00339 0.0169
+1711 0.199 0.02 0.00338 0.0168
+1712 0.199 0.02 0.00337 0.0167
+1713 0.199 0.02 0.00337 0.0166
+1714 0.198 0.0199 0.00336 0.0165
+1715 0.198 0.0199 0.00335 0.0164
+1716 0.198 0.0199 0.00334 0.0163
+1717 0.197 0.0198 0.00334 0.0162
+1718 0.197 0.0198 0.00333 0.0161
+1719 0.197 0.0198 0.00332 0.016
+1720 0.196 0.0197 0.00332 0.016
+1721 0.196 0.0197 0.00331 0.0159
+1722 0.196 0.0197 0.0033 0.0158
+1723 0.195 0.0196 0.00329 0.0157
+1724 0.195 0.0196 0.00329 0.0156
+1725 0.195 0.0196 0.00328 0.0155
+1726 0.194 0.0195 0.00327 0.0154
+1727 0.194 0.0195 0.00327 0.0153
+1728 0.194 0.0195 0.00326 0.0153
+1729 0.193 0.0194 0.00325 0.0152
+1730 0.193 0.0194 0.00325 0.0151
+1731 0.193 0.0194 0.00324 0.015
+1732 0.192 0.0193 0.00323 0.0149
+1733 0.192 0.0193 0.00323 0.0148
+1734 0.192 0.0192 0.00322 0.0148
+1735 0.191 0.0192 0.00321 0.0147
+1736 0.191 0.0192 0.00321 0.0146
+1737 0.191 0.0191 0.0032 0.0145
+1738 0.19 0.0191 0.00319 0.0144
+1739 0.19 0.0191 0.00319 0.0144
+1740 0.19 0.019 0.00318 0.0143
+1741 0.189 0.019 0.00317 0.0142
+1742 0.189 0.019 0.00317 0.0141
+1743 0.188 0.0189 0.00316 0.014
+1744 0.188 0.0189 0.00315 0.014
+1745 0.188 0.0189 0.00315 0.0139
+1746 0.187 0.0188 0.00314 0.0138
+1747 0.187 0.0188 0.00314 0.0137
+1748 0.187 0.0188 0.00313 0.0137
+1749 0.186 0.0187 0.00312 0.0136
+1750 0.186 0.0187 0.00312 0.0135
+1751 0.186 0.0187 0.00311 0.0134
+1752 0.185 0.0186 0.0031 0.0134
+1753 0.185 0.0186 0.0031 0.0133
+1754 0.185 0.0186 0.00309 0.0132
+1755 0.184 0.0185 0.00309 0.0131
+1756 0.184 0.0185 0.00308 0.0131
+1757 0.184 0.0185 0.00307 0.013
+1758 0.183 0.0184 0.00307 0.0129
+1759 0.183 0.0184 0.00306 0.0128
+1760 0.182 0.0184 0.00306 0.0128
+1761 0.182 0.0183 0.00305 0.0127
+1762 0.182 0.0183 0.00304 0.0126
+1763 0.181 0.0183 0.00304 0.0126
+1764 0.181 0.0182 0.00303 0.0125
+1765 0.181 0.0182 0.00303 0.0124
+1766 0.18 0.0182 0.00302 0.0124
+1767 0.18 0.0181 0.00301 0.0123
+1768 0.18 0.0181 0.00301 0.0122
+1769 0.179 0.0181 0.003 0.0121
+1770 0.179 0.018 0.003 0.0121
+1771 0.179 0.018 0.00299 0.012
+1772 0.178 0.018 0.00298 0.0119
+1773 0.178 0.0179 0.00298 0.0119
+1774 0.177 0.0179 0.00297 0.0118
+1775 0.177 0.0179 0.00297 0.0118
+1776 0.177 0.0178 0.00296 0.0117
+1777 0.176 0.0178 0.00296 0.0116
+1778 0.176 0.0178 0.00295 0.0116
+1779 0.176 0.0177 0.00295 0.0115
+1780 0.175 0.0177 0.00294 0.0114
+1781 0.175 0.0177 0.00293 0.0114
+1782 0.175 0.0176 0.00293 0.0113
+1783 0.174 0.0176 0.00292 0.0112
+1784 0.174 0.0176 0.00292 0.0112
+1785 0.173 0.0175 0.00291 0.0111
+1786 0.173 0.0175 0.00291 0.0111
+1787 0.173 0.0175 0.0029 0.011
+1788 0.172 0.0174 0.0029 0.0109
+1789 0.172 0.0174 0.00289 0.0109
+1790 0.172 0.0174 0.00288 0.0108
+1791 0.171 0.0173 0.00288 0.0108
+1792 0.171 0.0173 0.00287 0.0107
+1793 0.171 0.0172 0.00287 0.0106
+1794 0.17 0.0172 0.00286 0.0106
+1795 0.17 0.0172 0.00286 0.0105
+1796 0.169 0.0171 0.00285 0.0105
+1797 0.169 0.0171 0.00285 0.0104
+1798 0.169 0.0171 0.00284 0.0104
+1799 0.168 0.017 0.00284 0.0103
+1800 0.168 0.017 0.00283 0.0102
+1801 0.168 0.017 0.00283 0.0102
+1802 0.167 0.0169 0.00282 0.0101
+1803 0.167 0.0169 0.00282 0.0101
+1804 0.167 0.0169 0.00281 0.01
+1805 0.166 0.0168 0.0028 0.00997
+1806 0.166 0.0168 0.0028 0.00991
+1807 0.165 0.0168 0.00279 0.00986
+1808 0.165 0.0167 0.00279 0.00981
+1809 0.165 0.0167 0.00278 0.00975
+1810 0.164 0.0167 0.00278 0.0097
+1811 0.164 0.0166 0.00277 0.00965
+1812 0.164 0.0166 0.00277 0.0096
+1813 0.163 0.0166 0.00276 0.00955
+1814 0.163 0.0165 0.00276 0.00949
+1815 0.162 0.0165 0.00275 0.00944
+1816 0.162 0.0165 0.00275 0.00939
+1817 0.162 0.0164 0.00274 0.00934
+1818 0.161 0.0164 0.00274 0.00929
+1819 0.161 0.0164 0.00273 0.00924
+1820 0.161 0.0163 0.00273 0.00919
+1821 0.16 0.0163 0.00272 0.00915
+1822 0.16 0.0163 0.00272 0.0091
+1823 0.16 0.0162 0.00271 0.00905
+1824 0.159 0.0162 0.00271 0.009
+1825 0.159 0.0162 0.0027 0.00895
+1826 0.158 0.0161 0.0027 0.00891
+1827 0.158 0.0161 0.00269 0.00886
+1828 0.158 0.0161 0.00269 0.00881
+1829 0.157 0.016 0.00268 0.00877
+1830 0.157 0.016 0.00268 0.00872
+1831 0.157 0.016 0.00267 0.00867
+1832 0.156 0.0159 0.00267 0.00863
+1833 0.156 0.0159 0.00266 0.00858
+1834 0.155 0.0159 0.00266 0.00854
+1835 0.155 0.0158 0.00265 0.00849
+1836 0.155 0.0158 0.00265 0.00845
+1837 0.154 0.0158 0.00264 0.00841
+1838 0.154 0.0157 0.00264 0.00836
+1839 0.154 0.0157 0.00264 0.00832
+1840 0.153 0.0157 0.00263 0.00828
+1841 0.153 0.0156 0.00263 0.00823
+1842 0.153 0.0156 0.00262 0.00819
+1843 0.152 0.0156 0.00262 0.00815
+1844 0.152 0.0155 0.00261 0.00811
+1845 0.151 0.0155 0.00261 0.00806
+1846 0.151 0.0155 0.0026 0.00802
+1847 0.151 0.0154 0.0026 0.00798
+1848 0.15 0.0154 0.00259 0.00794
+1849 0.15 0.0154 0.00259 0.0079
+1850 0.15 0.0153 0.00258 0.00786
+1851 0.149 0.0153 0.00258 0.00782
+1852 0.149 0.0153 0.00257 0.00778
+1853 0.148 0.0152 0.00257 0.00774
+1854 0.148 0.0152 0.00256 0.0077
+1855 0.148 0.0152 0.00256 0.00766
+1856 0.147 0.0151 0.00255 0.00762
+1857 0.147 0.0151 0.00255 0.00759
+1858 0.147 0.0151 0.00255 0.00755
+1859 0.146 0.015 0.00254 0.00751
+1860 0.146 0.015 0.00254 0.00747
+1861 0.145 0.015 0.00253 0.00743
+1862 0.145 0.0149 0.00253 0.0074
+1863 0.145 0.0149 0.00252 0.00736
+1864 0.144 0.0149 0.00252 0.00732
+1865 0.144 0.0148 0.00251 0.00729
+1866 0.144 0.0148 0.00251 0.00725
+1867 0.143 0.0148 0.0025 0.00722
+1868 0.143 0.0147 0.0025 0.00718
+1869 0.143 0.0147 0.00249 0.00714
+1870 0.142 0.0147 0.00249 0.00711
+1871 0.142 0.0146 0.00249 0.00707
+1872 0.141 0.0146 0.00248 0.00704
+1873 0.141 0.0146 0.00248 0.007
+1874 0.141 0.0145 0.00247 0.00697
+1875 0.14 0.0145 0.00247 0.00694
+1876 0.14 0.0145 0.00246 0.0069
+1877 0.14 0.0144 0.00246 0.00687
+1878 0.139 0.0144 0.00245 0.00684
+1879 0.139 0.0144 0.00245 0.0068
+1880 0.138 0.0143 0.00245 0.00677
+1881 0.138 0.0143 0.00244 0.00674
+1882 0.138 0.0143 0.00244 0.00671
+1883 0.137 0.0142 0.00243 0.00667
+1884 0.137 0.0142 0.00243 0.00664
+1885 0.137 0.0142 0.00242 0.00661
+1886 0.136 0.0141 0.00242 0.00658
+1887 0.136 0.0141 0.00241 0.00655
+1888 0.136 0.0141 0.00241 0.00652
+1889 0.135 0.014 0.00241 0.00648
+1890 0.135 0.014 0.0024 0.00645
+1891 0.134 0.014 0.0024 0.00642
+1892 0.134 0.0139 0.00239 0.00639
+1893 0.134 0.0139 0.00239 0.00636
+1894 0.133 0.0139 0.00238 0.00633
+1895 0.133 0.0138 0.00238 0.0063
+1896 0.133 0.0138 0.00237 0.00627
+1897 0.132 0.0138 0.00237 0.00624
+1898 0.132 0.0137 0.00237 0.00622
+1899 0.132 0.0137 0.00236 0.00619
+1900 0.131 0.0137 0.00236 0.00616
+1901 0.131 0.0136 0.00235 0.00613
+1902 0.13 0.0136 0.00235 0.0061
+1903 0.13 0.0136 0.00234 0.00607
+1904 0.13 0.0135 0.00234 0.00604
+1905 0.129 0.0135 0.00233 0.00602
+1906 0.129 0.0135 0.00233 0.00599
+1907 0.129 0.0134 0.00233 0.00596
+1908 0.128 0.0134 0.00232 0.00593
+1909 0.128 0.0134 0.00232 0.00591
+1910 0.128 0.0133 0.00231 0.00588
+1911 0.127 0.0133 0.00231 0.00585
+1912 0.127 0.0133 0.0023 0.00583
+1913 0.126 0.0132 0.0023 0.0058
+1914 0.126 0.0132 0.0023 0.00578
+1915 0.126 0.0132 0.00229 0.00575
+1916 0.125 0.0131 0.00229 0.00572
+1917 0.125 0.0131 0.00228 0.0057
+1918 0.125 0.0131 0.00228 0.00567
+1919 0.124 0.013 0.00227 0.00565
+1920 0.124 0.013 0.00227 0.00562
+1921 0.124 0.013 0.00227 0.0056
+1922 0.123 0.0129 0.00226 0.00557
+1923 0.123 0.0129 0.00226 0.00555
+1924 0.123 0.0129 0.00225 0.00552
+1925 0.122 0.0128 0.00225 0.0055
+1926 0.122 0.0128 0.00224 0.00547
+1927 0.121 0.0128 0.00224 0.00545
+1928 0.121 0.0127 0.00224 0.00543
+1929 0.121 0.0127 0.00223 0.0054
+1930 0.12 0.0127 0.00223 0.00538
+1931 0.12 0.0126 0.00222 0.00536
+1932 0.12 0.0126 0.00222 0.00533
+1933 0.119 0.0126 0.00222 0.00531
+1934 0.119 0.0125 0.00221 0.00529
+1935 0.119 0.0125 0.00221 0.00526
+1936 0.118 0.0125 0.0022 0.00524
+1937 0.118 0.0124 0.0022 0.00522
+1938 0.118 0.0124 0.00219 0.0052
+1939 0.117 0.0124 0.00219 0.00517
+1940 0.117 0.0124 0.00219 0.00515
+1941 0.116 0.0123 0.00218 0.00513
+1942 0.116 0.0123 0.00218 0.00511
+1943 0.116 0.0123 0.00217 0.00509
+1944 0.115 0.0122 0.00217 0.00506
+1945 0.115 0.0122 0.00216 0.00504
+1946 0.115 0.0122 0.00216 0.00502
+1947 0.114 0.0121 0.00216 0.005
+1948 0.114 0.0121 0.00215 0.00498
+1949 0.114 0.0121 0.00215 0.00496
+1950 0.113 0.012 0.00214 0.00494
+1951 0.113 0.012 0.00214 0.00492
+1952 0.113 0.012 0.00214 0.0049
+1953 0.112 0.0119 0.00213 0.00488
+1954 0.112 0.0119 0.00213 0.00486
+1955 0.112 0.0119 0.00212 0.00484
+1956 0.111 0.0118 0.00212 0.00482
+1957 0.111 0.0118 0.00211 0.0048
+1958 0.111 0.0118 0.00211 0.00478
+1959 0.11 0.0117 0.00211 0.00476
+1960 0.11 0.0117 0.0021 0.00474
+1961 0.109 0.0117 0.0021 0.00472
+1962 0.109 0.0117 0.00209 0.0047
+1963 0.109 0.0116 0.00209 0.00468
+1964 0.108 0.0116 0.00209 0.00466
+1965 0.108 0.0116 0.00208 0.00464
+1966 0.108 0.0115 0.00208 0.00462
+1967 0.107 0.0115 0.00207 0.0046
+1968 0.107 0.0115 0.00207 0.00459
+1969 0.107 0.0114 0.00206 0.00457
+1970 0.106 0.0114 0.00206 0.00455
+1971 0.106 0.0114 0.00206 0.00453
+1972 0.106 0.0113 0.00205 0.00451
+1973 0.105 0.0113 0.00205 0.00449
+1974 0.105 0.0113 0.00204 0.00448
+1975 0.105 0.0113 0.00204 0.00446
+1976 0.104 0.0112 0.00204 0.00444
+1977 0.104 0.0112 0.00203 0.00442
+1978 0.104 0.0112 0.00203 0.00441
+1979 0.103 0.0111 0.00202 0.00439
+1980 0.103 0.0111 0.00202 0.00437
+1981 0.103 0.0111 0.00202 0.00435
+1982 0.102 0.011 0.00201 0.00434
+1983 0.102 0.011 0.00201 0.00432
+1984 0.102 0.011 0.002 0.0043
+1985 0.101 0.0109 0.002 0.00428
+1986 0.101 0.0109 0.002 0.00427
+1987 0.101 0.0109 0.00199 0.00425
+1988 0.1 0.0109 0.00199 0.00423
+1989 0.1 0.0108 0.00198 0.00422
+1990 0.0996 0.0108 0.00198 0.0042
+1991 0.0993 0.0108 0.00197 0.00419
+1992 0.099 0.0107 0.00197 0.00417
+1993 0.0986 0.0107 0.00197 0.00415
+1994 0.0983 0.0107 0.00196 0.00414
+1995 0.098 0.0106 0.00196 0.00412
+1996 0.0977 0.0106 0.00195 0.0041
+1997 0.0973 0.0106 0.00195 0.00409
+1998 0.097 0.0106 0.00195 0.00407
+1999 0.0967 0.0105 0.00194 0.00406
+2000 0.0963 0.0105 0.00194 0.00404
+# end of content independent part
+
+# data set number
+[1]
+# (a,c,g,t)= (0.237, 0.263, 0.263, 0.237)
+#
+# Probabilities file for the exon model
+#
+
+
+# Die P_l's
+[P_ls]
+# k = 4
+# l=
+0
+# Values
+a 0.296 0.315 0.269
+c 0.188 0.228 0.173
+g 0.309 0.174 0.206
+t 0.208 0.284 0.352
+# l=
+1
+# Values
+aa 0.0853 0.111 0.0904
+ac 0.0441 0.0499 0.051
+ag 0.0865 0.0586 0.0705
+at 0.0529 0.0775 0.101
+ca 0.0684 0.0595 0.0796
+cc 0.0347 0.0489 0.0364
+cg 0.0282 0.0201 0.0213
+ct 0.0419 0.0586 0.0912
+ga 0.0691 0.115 0.0454
+gc 0.0401 0.0661 0.0335
+gg 0.0595 0.0631 0.0401
+gt 0.0374 0.0649 0.0547
+ta 0.0732 0.029 0.0534
+tc 0.0689 0.0626 0.0525
+tg 0.134 0.0317 0.074
+tt 0.0754 0.0832 0.105
+# l=
+2
+# Values
+aaa 0.0268 0.0322 0.0323
+aac 0.0151 0.0162 0.0169
+aag 0.0324 0.0192 0.0299
+aat 0.0161 0.0237 0.0313
+aca 0.0203 0.0149 0.0171
+acc 0.0102 0.0127 0.00858
+acg 0.00838 0.0048 0.00479
+act 0.012 0.0146 0.0194
+aga 0.0248 0.035 0.0177
+agc 0.0147 0.0214 0.0113
+agg 0.0187 0.0175 0.0126
+agt 0.0123 0.0195 0.0165
+ata 0.0222 0.0076 0.0152
+atc 0.0188 0.017 0.0128
+atg 0.0394 0.00906 0.022
+att 0.021 0.0225 0.0274
+caa 0.0268 0.0253 0.0216
+cac 0.0131 0.0109 0.00795
+cag 0.0233 0.011 0.0142
+cat 0.0164 0.0176 0.0156
+cca 0.015 0.0109 0.0187
+ccc 0.00664 0.00784 0.0062
+ccg 0.00664 0.00419 0.00502
+cct 0.00802 0.01 0.0193
+cga 0.00644 0.01 0.00572
+cgc 0.00383 0.00479 0.00393
+cgg 0.0064 0.00609 0.004
+cgt 0.00462 0.00591 0.00663
+cta 0.019 0.00588 0.0106
+ctc 0.0185 0.0119 0.012
+ctg 0.0329 0.0057 0.0112
+ctt 0.0208 0.0165 0.0248
+gaa 0.0158 0.0304 0.0363
+gac 0.0065 0.00996 0.015
+gag 0.0145 0.0144 0.0265
+gat 0.00868 0.0169 0.0365
+gca 0.013 0.0134 0.0222
+gcc 0.00701 0.0103 0.0103
+gcg 0.00513 0.00383 0.00541
+gct 0.00831 0.0141 0.0282
+gga 0.0143 0.0257 0.0219
+ggc 0.0078 0.0128 0.0106
+ggg 0.0105 0.00977 0.0109
+ggt 0.00757 0.0127 0.02
+gta 0.0117 0.00591 0.0122
+gtc 0.00939 0.01 0.0102
+gtg 0.021 0.00566 0.0164
+gtt 0.0125 0.017 0.0263
+taa 0.0159 0.0235 4.93e-05
+tac 0.00948 0.0128 0.0111
+tag 0.0163 0.014 4.93e-05
+tat 0.0117 0.0192 0.0179
+tca 0.02 0.0203 0.0216
+tcc 0.0108 0.018 0.0114
+tcg 0.00801 0.00731 0.00608
+tct 0.0136 0.0199 0.0242
+tga 0.0235 0.0443 4.93e-05
+tgc 0.0138 0.0271 0.00773
+tgg 0.0239 0.0297 0.0126
+tgt 0.0128 0.0267 0.0116
+tta 0.0204 0.00966 0.0153
+ttc 0.0222 0.0237 0.0175
+ttg 0.0411 0.0113 0.0245
+ttt 0.0211 0.0272 0.0262
+# l=
+3
+# Values
+aaaa 0.00924 0.0111 0.0083
+aaac 0.00558 0.0055 0.00443
+aaag 0.0112 0.00653 0.00802
+aaat 0.00637 0.00874 0.00929
+aaca 0.00713 0.00627 0.00564
+aacc 0.00343 0.00436 0.00243
+aacg 0.00239 0.00174 0.00131
+aact 0.00395 0.00552 0.00583
+aaga 0.0106 0.0156 0.00584
+aagc 0.00611 0.00818 0.0032
+aagg 0.00799 0.00722 0.00397
+aagt 0.00515 0.00753 0.0049
+aata 0.00698 0.00265 0.00439
+aatc 0.00564 0.00553 0.00342
+aatg 0.0119 0.00331 0.00665
+aatt 0.00679 0.00764 0.00774
+acaa 0.00578 0.0078 0.00575
+acac 0.00266 0.00301 0.00163
+acag 0.00507 0.00335 0.00306
+acat 0.00361 0.00518 0.00341
+acca 0.00373 0.00344 0.00506
+accc 0.0017 0.00233 0.00161
+accg 0.00137 0.00114 0.0011
+acct 0.0018 0.00279 0.00432
+acga 0.00148 0.00329 0.00131
+acgc 0.000771 0.00134 0.000837
+acgg 0.00149 0.00169 0.000883
+acgt 0.00103 0.00167 0.00146
+acta 0.00421 0.00182 0.00278
+actc 0.00376 0.00303 0.0025
+actg 0.00719 0.00183 0.0027
+actt 0.00427 0.00474 0.00567
+agaa 0.00628 0.0135 0.0115
+agac 0.00238 0.00356 0.00372
+agag 0.00564 0.00574 0.00725
+agat 0.0034 0.00677 0.00975
+agca 0.00473 0.00585 0.00728
+agcc 0.00214 0.00383 0.00289
+agcg 0.00134 0.00145 0.00135
+agct 0.00304 0.00633 0.0085
+agga 0.00451 0.0103 0.00595
+aggc 0.00273 0.00442 0.00256
+aggg 0.00322 0.00326 0.00312
+aggt 0.00218 0.00416 0.00448
+agta 0.00402 0.00242 0.00393
+agtc 0.00268 0.00357 0.00257
+agtg 0.00597 0.00206 0.00442
+agtt 0.00378 0.0066 0.00728
+ataa 0.00454 0.00735 1.23e-05
+atac 0.00267 0.00334 0.00244
+atag 0.00423 0.00396 1.23e-05
+atat 0.00378 0.00644 0.00467
+atca 0.00501 0.00582 0.00616
+atcc 0.00267 0.00485 0.00258
+atcg 0.00206 0.00185 0.00149
+atct 0.00302 0.00541 0.00597
+atga 0.00682 0.0135 1.23e-05
+atgc 0.00408 0.00751 0.0019
+atgg 0.00725 0.00875 0.00373
+atgt 0.0038 0.0078 0.00289
+atta 0.00541 0.00282 0.00389
+attc 0.00576 0.00588 0.00399
+attg 0.0107 0.00301 0.0059
+attt 0.00555 0.00831 0.00739
+caaa 0.00654 0.00903 0.00759
+caac 0.00426 0.00495 0.00482
+caag 0.00719 0.00505 0.00716
+caat 0.00365 0.00653 0.007
+caca 0.00295 0.00352 0.00357
+cacc 0.00188 0.00395 0.00238
+cacg 0.0013 0.00115 0.00112
+cact 0.00178 0.00384 0.00441
+caga 0.00468 0.00778 0.00327
+cagc 0.00365 0.0057 0.00264
+cagg 0.003 0.00362 0.00211
+cagt 0.0028 0.0051 0.00351
+cata 0.00323 0.00191 0.00351
+catc 0.0035 0.00512 0.00336
+catg 0.00551 0.0023 0.00525
+catt 0.00343 0.00629 0.00641
+ccaa 0.00632 0.0054 0.00389
+ccac 0.0035 0.00267 0.00184
+ccag 0.00503 0.00209 0.00242
+ccat 0.00381 0.00412 0.00326
+ccca 0.0024 0.00188 0.00266
+cccc 0.00115 0.00161 0.00113
+cccg 0.00128 0.000685 0.000816
+ccct 0.00135 0.00214 0.00361
+ccga 0.00138 0.00222 0.00117
+ccgc 0.00104 0.00122 0.000909
+ccgg 0.0016 0.00151 0.000922
+ccgt 0.00101 0.00135 0.00138
+ccta 0.0042 0.00105 0.00175
+cctc 0.00441 0.00258 0.00258
+cctg 0.0062 0.000923 0.00169
+cctt 0.00452 0.00307 0.00454
+cgaa 0.00179 0.00218 0.00264
+cgac 0.000993 0.00109 0.00198
+cgag 0.00183 0.00136 0.0028
+cgat 0.0011 0.00151 0.00308
+cgca 0.00117 0.000869 0.00122
+cgcc 0.00112 0.00128 0.00145
+cgcg 0.00079 0.000434 0.000685
+cgct 0.000837 0.00105 0.00167
+cgga 0.00132 0.00223 0.00194
+cggc 0.001 0.00155 0.0015
+cggg 0.000835 0.00104 0.00108
+cggt 0.000843 0.00129 0.00186
+cgta 0.00139 0.000557 0.000995
+cgtc 0.0014 0.00145 0.00138
+cgtg 0.00245 0.000665 0.00165
+cgtt 0.00138 0.00173 0.00221
+ctaa 0.00333 0.00595 1.23e-05
+ctac 0.00194 0.00373 0.00251
+ctag 0.00321 0.00356 1.23e-05
+ctat 0.00209 0.00473 0.00362
+ctca 0.00449 0.00518 0.00368
+ctcc 0.0025 0.00509 0.00275
+ctcg 0.00183 0.00199 0.00131
+ctct 0.00317 0.00526 0.00471
+ctga 0.0036 0.0103 1.23e-05
+ctgc 0.00238 0.00758 0.00176
+ctgg 0.00321 0.00674 0.0021
+ctgt 0.00197 0.00658 0.00211
+ctta 0.00456 0.00244 0.00291
+cttc 0.00605 0.00742 0.00412
+cttg 0.00913 0.00297 0.00508
+cttt 0.00505 0.007 0.00523
+gaaa 0.011 0.00691 0.00932
+gaac 0.00523 0.00295 0.00364
+gaag 0.014 0.00447 0.00901
+gaat 0.00608 0.00445 0.00716
+gaca 0.0057 0.00247 0.00344
+gacc 0.00276 0.00189 0.00148
+gacg 0.00303 0.000945 0.00128
+gact 0.00348 0.00239 0.00353
+gaga 0.00955 0.00624 0.00442
+gagc 0.00491 0.00356 0.00241
+gagg 0.00766 0.00384 0.00364
+gagt 0.00437 0.00355 0.00344
+gata 0.00814 0.00156 0.00328
+gatc 0.00638 0.00279 0.00254
+gatg 0.0147 0.00165 0.00498
+gatt 0.00727 0.00431 0.00554
+gcaa 0.0072 0.00461 0.00457
+gcac 0.00352 0.00194 0.00154
+gcag 0.00711 0.00263 0.00365
+gcat 0.00442 0.00318 0.00306
+gcca 0.00429 0.00234 0.00392
+gccc 0.00174 0.00139 0.00115
+gccg 0.00209 0.00104 0.00129
+gcct 0.00213 0.00188 0.00369
+gcga 0.00166 0.00169 0.00107
+gcgc 0.000949 0.000833 0.000723
+gcgg 0.00173 0.00129 0.000756
+gcgt 0.00108 0.00108 0.00117
+gcta 0.00591 0.00122 0.00259
+gctc 0.00517 0.00219 0.00238
+gctg 0.0113 0.0013 0.00308
+gctt 0.00586 0.0032 0.00541
+ggaa 0.0077 0.00571 0.0076
+ggac 0.00312 0.00187 0.00326
+ggag 0.00698 0.00283 0.00673
+ggat 0.00417 0.00316 0.00733
+ggca 0.0038 0.00231 0.00422
+ggcc 0.00215 0.00186 0.00179
+ggcg 0.00211 0.00082 0.00167
+ggct 0.00251 0.00244 0.00489
+ggga 0.00423 0.00407 0.00338
+gggc 0.00182 0.0019 0.00145
+gggg 0.00275 0.00173 0.00173
+gggt 0.00213 0.00228 0.00306
+ggta 0.0038 0.00103 0.00219
+ggtc 0.00341 0.00174 0.00168
+ggtg 0.00802 0.00118 0.00364
+ggtt 0.00477 0.00328 0.00499
+gtaa 0.00363 0.00367 1.23e-05
+gtac 0.00207 0.00208 0.00232
+gtag 0.00399 0.00264 1.23e-05
+gtat 0.00252 0.00275 0.00337
+gtca 0.004 0.00275 0.00337
+gtcc 0.00218 0.00239 0.00178
+gtcg 0.00176 0.00123 0.00127
+gtct 0.0023 0.00256 0.00332
+gtga 0.00544 0.00661 1.23e-05
+gtgc 0.00265 0.00393 0.00125
+gtgg 0.00555 0.00561 0.00243
+gtgt 0.00275 0.00388 0.00184
+gtta 0.00533 0.00166 0.00309
+gttc 0.00519 0.00358 0.00309
+gttg 0.0103 0.00202 0.00507
+gttt 0.00547 0.00467 0.00521
+taaa 1.24e-05 0.00518 0.00711
+taac 1.24e-05 0.00277 0.00402
+taag 1.24e-05 0.00315 0.00567
+taat 1.24e-05 0.00398 0.00785
+taca 0.00453 0.00264 0.00446
+tacc 0.00213 0.00254 0.00229
+tacg 0.00166 0.000959 0.00107
+tact 0.00278 0.00285 0.00565
+taga 1.24e-05 0.00534 0.00419
+tagc 1.24e-05 0.00396 0.00302
+tagg 1.24e-05 0.00285 0.00292
+tagt 1.24e-05 0.00333 0.00461
+tata 0.00381 0.00148 0.00406
+tatc 0.00329 0.00361 0.00343
+tatg 0.00735 0.0018 0.00511
+tatt 0.00352 0.00428 0.00767
+tcaa 0.00754 0.00753 0.00744
+tcac 0.00341 0.00333 0.00294
+tcag 0.00612 0.00295 0.00503
+tcat 0.00457 0.00517 0.00592
+tcca 0.00463 0.00322 0.00701
+tccc 0.00206 0.00251 0.0023
+tccg 0.0019 0.00132 0.00182
+tcct 0.00275 0.00323 0.00771
+tcga 0.00192 0.00281 0.00217
+tcgc 0.00107 0.0014 0.00146
+tcgg 0.00158 0.0016 0.00144
+tcgt 0.0015 0.00181 0.00262
+tcta 0.00464 0.00178 0.00348
+tctc 0.00512 0.00405 0.00453
+tctg 0.00822 0.00165 0.00369
+tctt 0.00619 0.0055 0.0092
+tgaa 1.24e-05 0.00902 0.0146
+tgac 1.24e-05 0.00345 0.00601
+tgag 1.24e-05 0.00444 0.00969
+tgat 1.24e-05 0.00545 0.0163
+tgca 0.00331 0.00436 0.0095
+tgcc 0.00159 0.00334 0.00413
+tgcg 0.00089 0.00112 0.0017
+tgct 0.00192 0.00425 0.0132
+tgga 0.00422 0.00911 0.0106
+tggc 0.00225 0.00497 0.00505
+tggg 0.00368 0.00374 0.00496
+tggt 0.00241 0.00497 0.0106
+tgta 0.00249 0.0019 0.00509
+tgtc 0.0019 0.00323 0.00461
+tgtg 0.00462 0.00176 0.00665
+tgtt 0.00259 0.00535 0.0118
+ttaa 0.00437 0.00649 1.23e-05
+ttac 0.0028 0.00367 0.00387
+ttag 0.00485 0.00387 1.23e-05
+ttat 0.00333 0.00532 0.00628
+ttca 0.00651 0.00656 0.00844
+ttcc 0.00349 0.00564 0.00425
+ttcg 0.00237 0.00223 0.00201
+ttct 0.00513 0.00664 0.0102
+ttga 0.00764 0.0139 1.23e-05
+ttgc 0.00467 0.0081 0.00281
+ttgg 0.00792 0.00861 0.00431
+ttgt 0.00432 0.00846 0.00475
+ttta 0.00506 0.00274 0.00543
+tttc 0.00521 0.00685 0.00634
+tttg 0.0109 0.00329 0.00847
+tttt 0.00501 0.00721 0.00839
+# l=
+4
+# Values
+aaaaa 0.00196 0.0027 0.00226
+aaaac 0.00158 0.00167 0.00139
+aaaag 0.00296 0.00195 0.00266
+aaaat 0.00181 0.00245 0.00301
+aaaca 0.00175 0.00171 0.00163
+aaacc 0.001 0.00144 0.000803
+aaacg 0.000644 0.00058 0.000388
+aaact 0.00105 0.00158 0.00181
+aaaga 0.00275 0.00407 0.00175
+aaagc 0.00175 0.00217 0.00101
+aaagg 0.00224 0.00221 0.0013
+aaagt 0.00127 0.00215 0.00144
+aaata 0.00198 0.000835 0.00144
+aaatc 0.00174 0.00188 0.00117
+aaatg 0.00373 0.00111 0.00235
+aaatt 0.00187 0.00223 0.0024
+aacaa 0.00188 0.00282 0.00226
+aacac 0.000893 0.00101 0.000644
+aacag 0.00176 0.00118 0.00116
+aacat 0.00111 0.00178 0.0012
+aacca 0.00106 0.00116 0.00145
+aaccc 0.000535 0.000811 0.000557
+aaccg 0.000328 0.000375 0.000333
+aacct 0.00052 0.000916 0.00133
+aacga 0.000408 0.00084 0.000424
+aacgc 0.000212 0.000429 0.000303
+aacgg 0.000438 0.00049 0.000246
+aacgt 0.000254 0.000517 0.000494
+aacta 0.00115 0.000582 0.000932
+aactc 0.00122 0.00107 0.000964
+aactg 0.00221 0.000522 0.000883
+aactt 0.00126 0.00157 0.00184
+aagaa 0.00213 0.0048 0.00497
+aagac 0.000788 0.0012 0.00142
+aagag 0.00172 0.00193 0.00288
+aagat 0.0012 0.00216 0.00383
+aagca 0.00131 0.00181 0.00241
+aagcc 0.000627 0.00138 0.000999
+aagcg 0.00037 0.000513 0.000445
+aagct 0.000881 0.00211 0.00303
+aagga 0.00135 0.00348 0.00216
+aaggc 0.000877 0.00146 0.00101
+aaggg 0.00105 0.00118 0.00119
+aaggt 0.000693 0.00148 0.00171
+aagta 0.00114 0.000827 0.0013
+aagtc 0.000801 0.00123 0.000951
+aagtg 0.00178 0.000701 0.00155
+aagtt 0.00116 0.00214 0.00255
+aataa 0.00119 0.00245 3.08e-06
+aatac 0.00076 0.00111 0.00079
+aatag 0.00127 0.00118 3.08e-06
+aatat 0.00116 0.0019 0.00144
+aatca 0.00128 0.00173 0.00166
+aatcc 0.000803 0.00149 0.000824
+aatcg 0.000535 0.000492 0.000388
+aatct 0.000803 0.00167 0.00178
+aatga 0.00197 0.00375 3.08e-06
+aatgc 0.00126 0.00226 0.000646
+aatgg 0.00233 0.00296 0.00122
+aatgt 0.00108 0.00234 0.000928
+aatta 0.00155 0.000871 0.00126
+aattc 0.00182 0.0021 0.00128
+aattg 0.00302 0.000874 0.00188
+aattt 0.00135 0.00262 0.00201
+acaaa 0.00171 0.00187 0.00215
+acaac 0.00123 0.00114 0.00163
+acaag 0.00192 0.00104 0.00223
+acaat 0.000889 0.00145 0.00217
+acaca 0.000653 0.000724 0.00106
+acacc 0.000353 0.000806 0.000583
+acacg 0.000292 0.000223 0.000339
+acact 0.00033 0.000777 0.00117
+acaga 0.00101 0.00168 0.0011
+acagc 0.000765 0.00112 0.000703
+acagg 0.000657 0.000896 0.000748
+acagt 0.000621 0.00114 0.000944
+acata 0.000756 0.00049 0.000995
+acatc 0.000748 0.000934 0.000906
+acatg 0.00127 0.000568 0.00168
+acatt 0.00064 0.00144 0.00185
+accaa 0.0017 0.00128 0.00117
+accac 0.000921 0.000661 0.000564
+accag 0.00148 0.000555 0.000811
+accat 0.000959 0.00105 0.00107
+accca 0.000581 0.000434 0.000744
+acccc 0.000349 0.000434 0.000361
+acccg 0.000324 0.000192 0.000301
+accct 0.000355 0.000544 0.00104
+accga 0.00026 0.000456 0.000284
+accgc 0.00025 0.000248 0.000236
+accgg 0.000404 0.000329 0.000261
+accgt 0.000186 0.000263 0.000416
+accta 0.000891 0.000274 0.000481
+acctc 0.000944 0.000522 0.000636
+acctg 0.00148 0.000232 0.000547
+acctt 0.00101 0.000685 0.00125
+acgaa 0.000368 0.000459 0.0009
+acgac 0.000258 0.00027 0.000629
+acgag 0.000438 0.000355 0.000966
+acgat 0.000246 0.000329 0.000957
+acgca 0.000243 0.000192 0.000358
+acgcc 0.00025 0.000225 0.000367
+acgcg 0.000172 0.0001 0.000215
+acgct 0.000174 0.000218 0.000464
+acgga 0.000281 0.000494 0.000538
+acggc 0.000218 0.000364 0.000397
+acggg 0.000208 0.000257 0.000354
+acggt 0.000172 0.000306 0.000485
+acgta 0.000313 0.000156 0.000312
+acgtc 0.00026 0.000311 0.000327
+acgtg 0.000562 0.000176 0.000568
+acgtt 0.000315 0.000342 0.000553
+actaa 0.000853 0.0012 3.08e-06
+actac 0.00049 0.000901 0.000771
+actag 0.000895 0.000802 3.08e-06
+actat 0.000533 0.0011 0.00113
+actca 0.000948 0.00107 0.000961
+actcc 0.000511 0.00104 0.00064
+actcg 0.000383 0.000398 0.000388
+actct 0.000655 0.00106 0.00119
+actga 0.000879 0.00223 3.08e-06
+actgc 0.00053 0.00156 0.000515
+actgg 0.000851 0.00157 0.000773
+actgt 0.000442 0.00146 0.000633
+actta 0.00098 0.00053 0.000798
+acttc 0.00136 0.0014 0.00111
+acttg 0.00216 0.000724 0.00163
+acttt 0.00116 0.00139 0.00144
+agaaa 0.00356 0.00226 0.00382
+agaac 0.00154 0.000813 0.00136
+agaag 0.00441 0.00151 0.0036
+agaat 0.00194 0.00142 0.00254
+agaca 0.00151 0.000744 0.00109
+agacc 0.00064 0.000564 0.000473
+agacg 0.000685 0.000261 0.000369
+agact 0.000874 0.00069 0.00105
+agaga 0.00263 0.00208 0.00159
+agagc 0.00124 0.00114 0.000788
+agagg 0.00218 0.00112 0.0013
+agagt 0.00119 0.00103 0.00115
+agata 0.00212 0.000445 0.00113
+agatc 0.00155 0.000916 0.000892
+agatg 0.00409 0.000566 0.00173
+agatt 0.00199 0.00131 0.00193
+agcaa 0.00233 0.00162 0.00182
+agcac 0.00115 0.000723 0.000598
+agcag 0.00247 0.0011 0.00151
+agcat 0.00133 0.00104 0.000983
+agcca 0.00136 0.000761 0.00129
+agccc 0.000492 0.000477 0.000454
+agccg 0.000486 0.000259 0.000301
+agcct 0.000543 0.000539 0.00117
+agcga 0.000423 0.000483 0.00036
+agcgc 0.000254 0.000209 0.000233
+agcgg 0.000414 0.000293 0.000242
+agcgt 0.000265 0.000295 0.000384
+agcta 0.0018 0.000389 0.00102
+agctc 0.00163 0.000851 0.000964
+agctg 0.00327 0.00043 0.00125
+agctt 0.00177 0.00123 0.00209
+aggaa 0.00213 0.0019 0.00291
+aggac 0.000872 0.000513 0.00103
+aggag 0.00191 0.000995 0.00238
+aggat 0.00107 0.000881 0.00238
+aggca 0.000967 0.000826 0.00132
+aggcc 0.000588 0.000703 0.000553
+aggcg 0.000448 0.000279 0.000411
+aggct 0.000562 0.000791 0.00142
+aggga 0.00117 0.00138 0.000966
+agggc 0.00055 0.000533 0.000388
+agggg 0.000822 0.000517 0.000511
+agggt 0.000579 0.000634 0.000885
+aggta 0.00071 0.000284 0.000604
+aggtc 0.000824 0.00053 0.000504
+aggtg 0.0018 0.000311 0.000972
+aggtt 0.00115 0.000952 0.00143
+agtaa 0.00118 0.00123 3.08e-06
+agtac 0.000592 0.000728 0.000815
+agtag 0.00139 0.00101 3.08e-06
+agtat 0.000765 0.000858 0.00121
+agtca 0.00105 0.000816 0.000997
+agtcc 0.000569 0.000721 0.000606
+agtcg 0.000366 0.000313 0.000331
+agtct 0.000585 0.000694 0.00107
+agtga 0.00157 0.002 3.08e-06
+agtgc 0.000691 0.00107 0.000377
+agtgg 0.00146 0.00156 0.000743
+agtgt 0.000708 0.00105 0.000616
+agtta 0.00135 0.000445 0.001
+agttc 0.00151 0.00108 0.00106
+agttg 0.00291 0.000587 0.00174
+agttt 0.00152 0.00149 0.00174
+ataaa 3.09e-06 0.00146 0.00204
+ataac 3.09e-06 0.000766 0.00127
+ataag 3.09e-06 0.000896 0.0017
+ataat 3.09e-06 0.0012 0.00269
+ataca 0.00102 0.000678 0.00118
+atacc 0.00048 0.000721 0.000674
+atacg 0.000336 0.000268 0.00028
+atact 0.000587 0.00088 0.00137
+ataga 3.09e-06 0.00138 0.00119
+atagc 3.09e-06 0.000975 0.000817
+atagg 3.09e-06 0.000755 0.000851
+atagt 3.09e-06 0.000916 0.00129
+atata 0.000914 0.000526 0.00133
+atatc 0.000912 0.00103 0.00117
+atatg 0.00192 0.000611 0.00172
+atatt 0.000927 0.00143 0.00255
+atcaa 0.00216 0.00195 0.00204
+atcac 0.000925 0.0008 0.000915
+atcag 0.00188 0.000744 0.00147
+atcat 0.00119 0.00127 0.00167
+atcca 0.00108 0.000816 0.00194
+atccc 0.000501 0.000672 0.000652
+atccg 0.000387 0.000335 0.00047
+atcct 0.000611 0.000705 0.00203
+atcga 0.00045 0.000735 0.000528
+atcgc 0.000263 0.000376 0.000407
+atcgg 0.000416 0.000427 0.000354
+atcgt 0.000366 0.000411 0.000652
+atcta 0.00106 0.000393 0.000847
+atctc 0.00125 0.000903 0.00125
+atctg 0.00219 0.000329 0.000995
+atctt 0.00145 0.00124 0.00258
+atgaa 3.09e-06 0.0025 0.00461
+atgac 3.09e-06 0.000977 0.00196
+atgag 3.09e-06 0.0013 0.00305
+atgat 3.09e-06 0.00171 0.00455
+atgca 0.000862 0.0013 0.00271
+atgcc 0.00036 0.000966 0.0012
+atgcg 0.000235 0.000344 0.000551
+atgct 0.000438 0.00125 0.00345
+atgga 0.00126 0.00269 0.00317
+atggc 0.00071 0.00152 0.0015
+atggg 0.0011 0.00119 0.00161
+atggt 0.000661 0.00151 0.00292
+atgta 0.000585 0.000609 0.00152
+atgtc 0.000455 0.000968 0.00133
+atgtg 0.00124 0.000566 0.00205
+atgtt 0.000608 0.00149 0.0033
+attaa 0.00103 0.00174 3.08e-06
+attac 0.000725 0.000982 0.00115
+attag 0.00132 0.000979 3.08e-06
+attat 0.00082 0.00144 0.00181
+attca 0.00148 0.00159 0.00204
+attcc 0.000758 0.0016 0.00113
+attcg 0.000623 0.000562 0.000543
+attct 0.00111 0.0017 0.00246
+attga 0.00178 0.00365 3.08e-06
+attgc 0.00117 0.00219 0.000733
+attgg 0.00195 0.00218 0.00128
+attgt 0.000999 0.00214 0.00115
+attta 0.00131 0.00066 0.00158
+atttc 0.00145 0.00181 0.00194
+atttg 0.00299 0.000835 0.00252
+atttt 0.00163 0.00198 0.00269
+caaaa 0.00218 0.00231 0.00271
+caaac 0.00114 0.00102 0.00137
+caaag 0.00263 0.00126 0.00249
+caaat 0.00162 0.00161 0.0029
+caaca 0.00216 0.00161 0.00192
+caacc 0.000862 0.000876 0.000739
+caacg 0.000684 0.000376 0.000445
+caact 0.00109 0.00118 0.00209
+caaga 0.00256 0.00265 0.00184
+caagc 0.00127 0.00144 0.0009
+caagg 0.00182 0.00133 0.00103
+caagt 0.0015 0.00142 0.00154
+caata 0.00151 0.000485 0.00136
+caatc 0.00126 0.00097 0.000978
+caatg 0.00263 0.00058 0.00199
+caatt 0.00159 0.00144 0.00254
+cacaa 0.00128 0.00113 0.00154
+cacac 0.000486 0.000429 0.000356
+cacag 0.00106 0.00051 0.000832
+cacat 0.000742 0.00073 0.000989
+cacca 0.00108 0.000759 0.00188
+caccc 0.000389 0.000364 0.000428
+caccg 0.000417 0.000237 0.000377
+cacct 0.00049 0.000427 0.00146
+cacga 0.000364 0.000486 0.000333
+cacgc 0.000174 0.000221 0.0002
+cacgg 0.000324 0.000272 0.000246
+cacgt 0.000254 0.000263 0.000428
+cacta 0.000925 0.000284 0.000741
+cactc 0.000777 0.000434 0.000712
+cactg 0.00168 0.000337 0.000845
+cactt 0.00102 0.000645 0.00174
+cagaa 0.00111 0.00188 0.0029
+cagac 0.000397 0.000557 0.000817
+cagag 0.00113 0.00095 0.00198
+cagat 0.000627 0.00106 0.0025
+cagca 0.00114 0.00136 0.00224
+cagcc 0.000497 0.000748 0.000853
+cagcg 0.000336 0.000268 0.000418
+cagct 0.000676 0.0011 0.00248
+cagga 0.000714 0.00115 0.0014
+caggc 0.000459 0.000638 0.000568
+caggg 0.000594 0.000521 0.000815
+caggt 0.000343 0.000551 0.00103
+cagta 0.000818 0.000434 0.00113
+cagtc 0.00056 0.000636 0.000665
+cagtg 0.00135 0.000418 0.00138
+cagtt 0.00078 0.00118 0.00216
+cataa 0.0011 0.00107 3.08e-06
+catac 0.000583 0.000452 0.000646
+catag 0.00101 0.000647 3.08e-06
+catat 0.000803 0.000889 0.00137
+catca 0.00132 0.0012 0.00209
+catcc 0.000644 0.000833 0.000767
+catcg 0.000535 0.000376 0.00053
+catct 0.000853 0.000921 0.002
+catga 0.00159 0.00173 3.08e-06
+catgc 0.000893 0.00102 0.000519
+catgg 0.00172 0.00128 0.00112
+catgt 0.00103 0.00118 0.000796
+catta 0.00115 0.000458 0.00121
+cattc 0.00127 0.000894 0.00114
+cattg 0.00253 0.000521 0.00183
+cattt 0.00146 0.00139 0.00241
+ccaaa 0.00124 0.00228 0.00176
+ccaac 0.000742 0.00115 0.00094
+ccaag 0.00124 0.0012 0.00142
+ccaat 0.000659 0.00138 0.00155
+ccaca 0.000646 0.00095 0.000815
+ccacc 0.000505 0.00127 0.000663
+ccacg 0.00029 0.000281 0.00027
+ccact 0.0004 0.000824 0.00105
+ccaga 0.000866 0.00178 0.00061
+ccagc 0.000573 0.00113 0.000511
+ccagg 0.000511 0.000771 0.000384
+ccagt 0.000467 0.0011 0.00068
+ccata 0.0006 0.00045 0.000847
+ccatc 0.00071 0.00121 0.000708
+ccatg 0.00116 0.00051 0.00113
+ccatt 0.000784 0.00147 0.00164
+cccaa 0.0009 0.000937 0.000718
+cccac 0.000537 0.000396 0.000297
+cccag 0.000627 0.000315 0.000399
+cccat 0.000598 0.00062 0.000555
+cccca 0.000493 0.000382 0.000564
+ccccc 0.000159 0.000268 0.000168
+ccccg 0.000256 0.00012 0.000189
+cccct 0.00022 0.000326 0.000765
+cccga 0.000282 0.000504 0.000217
+cccgc 0.000153 0.00016 0.000134
+cccgg 0.000218 0.000286 0.000143
+cccgt 0.000165 0.000257 0.000221
+cccta 0.000763 0.000156 0.00032
+ccctc 0.00075 0.000389 0.000526
+ccctg 0.00115 0.000171 0.000346
+ccctt 0.000944 0.000575 0.00106
+ccgaa 0.000385 0.000508 0.00054
+ccgac 0.000182 0.000218 0.000437
+ccgag 0.000379 0.000304 0.000602
+ccgat 0.000214 0.000292 0.000752
+ccgca 0.000258 0.00021 0.000272
+ccgcc 0.0003 0.00045 0.000434
+ccgcg 0.000153 9.49e-05 0.000145
+ccgct 0.000199 0.000232 0.000424
+ccgga 0.000286 0.000589 0.000487
+ccggc 0.000237 0.000389 0.000375
+ccggg 0.000163 0.00021 0.000219
+ccggt 0.000231 0.00034 0.0005
+ccgta 0.0003 0.0001 0.000196
+ccgtc 0.000281 0.000315 0.000337
+ccgtg 0.000499 0.000144 0.000329
+ccgtt 0.000298 0.000405 0.000557
+cctaa 0.0006 0.00138 3.08e-06
+cctac 0.00034 0.000795 0.000451
+cctag 0.00048 0.000838 3.08e-06
+cctat 0.000324 0.000954 0.000652
+cctca 0.000885 0.00118 0.000815
+cctcc 0.000575 0.00142 0.000621
+cctcg 0.000461 0.000474 0.000259
+cctct 0.000661 0.00112 0.00102
+cctga 0.000549 0.00222 3.08e-06
+cctgc 0.00036 0.0012 0.000284
+cctgg 0.000459 0.00119 0.000316
+cctgt 0.000311 0.00128 0.000365
+cctta 0.000906 0.000569 0.00065
+ccttc 0.00104 0.00155 0.000756
+ccttg 0.00159 0.000559 0.000826
+ccttt 0.000997 0.00161 0.000991
+cgaaa 0.000782 0.000632 0.000671
+cgaac 0.000429 0.00031 0.000325
+cgaag 0.000953 0.000366 0.00065
+cgaat 0.000469 0.000389 0.000642
+cgaca 0.000598 0.000264 0.000312
+cgacc 0.000315 0.000223 0.000166
+cgacg 0.000661 0.000162 0.000276
+cgact 0.000412 0.000288 0.000394
+cgaga 0.000904 0.000562 0.00038
+cgagc 0.000554 0.000384 0.000291
+cgagg 0.000794 0.0004 0.000348
+cgagt 0.000541 0.000394 0.000413
+cgata 0.000602 0.000172 0.000316
+cgatc 0.000543 0.000299 0.000261
+cgatg 0.00131 0.000167 0.000526
+cgatt 0.000619 0.000394 0.000481
+cgcaa 0.000431 0.000454 0.000297
+cgcac 0.000174 0.000145 0.000123
+cgcag 0.000383 0.000216 0.000253
+cgcat 0.000227 0.000293 0.000242
+cgcca 0.000497 0.000344 0.000441
+cgccc 0.000176 0.000183 0.000138
+cgccg 0.000531 0.000237 0.000386
+cgcct 0.000248 0.000301 0.00038
+cgcga 0.000218 0.000279 0.000136
+cgcgc 0.000115 0.000144 8.27e-05
+cgcgg 0.000214 0.000169 9.79e-05
+cgcgt 0.000138 0.000162 0.000138
+cgcta 0.000313 0.000118 0.000183
+cgctc 0.000307 0.000214 0.000212
+cgctg 0.00068 0.000144 0.000308
+cgctt 0.000366 0.00032 0.000405
+cggaa 0.00064 0.000474 0.000542
+cggac 0.00025 0.000163 0.00032
+cggag 0.000644 0.000293 0.000796
+cggat 0.000406 0.000319 0.000697
+cggca 0.000404 0.000259 0.000416
+cggcc 0.000244 0.000275 0.000253
+cggcg 0.000575 0.000135 0.000452
+cggct 0.000275 0.000281 0.000506
+cggga 0.000389 0.000277 0.000289
+cgggc 0.000168 0.000191 0.000187
+cgggg 0.00026 0.000111 0.000257
+cgggt 0.000271 0.000219 0.000358
+cggta 0.000351 0.0001 0.000227
+cggtc 0.000311 0.000203 0.000166
+cggtg 0.000796 0.000127 0.000451
+cggtt 0.000406 0.000371 0.000519
+cgtaa 0.000275 0.000443 3.08e-06
+cgtac 0.000178 0.000255 0.000246
+cgtag 0.000322 0.000279 3.08e-06
+cgtat 0.000218 0.000351 0.000329
+cgtca 0.000414 0.000342 0.000458
+cgtcc 0.000246 0.000364 0.000234
+cgtcg 0.000416 0.000216 0.000361
+cgtct 0.000296 0.000407 0.00047
+cgtga 0.000492 0.000831 3.08e-06
+cgtgc 0.000322 0.000483 0.000136
+cgtgg 0.000552 0.000535 0.000314
+cgtgt 0.000292 0.000481 0.000246
+cgtta 0.00048 0.00018 0.000373
+cgttc 0.000406 0.000351 0.000333
+cgttg 0.000866 0.00023 0.000583
+cgttt 0.000457 0.000548 0.00053
+ctaaa 3.09e-06 0.00107 0.00189
+ctaac 3.09e-06 0.00051 0.000866
+ctaag 3.09e-06 0.000777 0.00144
+ctaat 3.09e-06 0.000806 0.00205
+ctaca 0.000988 0.000555 0.00128
+ctacc 0.000404 0.000467 0.000587
+ctacg 0.000448 0.000212 0.000291
+ctact 0.00067 0.0006 0.00176
+ctaga 3.09e-06 0.00111 0.00104
+ctagc 3.09e-06 0.00073 0.000733
+ctagg 3.09e-06 0.000571 0.000697
+ctagt 3.09e-06 0.000643 0.00126
+ctata 0.000723 0.00027 0.000995
+ctatc 0.00059 0.000613 0.000775
+ctatg 0.00163 0.00034 0.0013
+ctatt 0.000668 0.000764 0.0019
+ctcaa 0.0014 0.00176 0.00203
+ctcac 0.000505 0.00066 0.000695
+ctcag 0.000978 0.000672 0.00126
+ctcat 0.000786 0.00116 0.00148
+ctcca 0.00113 0.000762 0.00188
+ctccc 0.000421 0.000504 0.000631
+ctccg 0.000571 0.000351 0.000562
+ctcct 0.000615 0.000753 0.00225
+ctcga 0.000387 0.000638 0.000597
+ctcgc 0.000224 0.000299 0.00036
+ctcgg 0.000364 0.000311 0.00042
+ctcgt 0.00033 0.000497 0.000716
+ctcta 0.00098 0.000385 0.00098
+ctctc 0.000997 0.000973 0.00114
+ctctg 0.00158 0.00042 0.001
+ctctt 0.00114 0.00124 0.00241
+ctgaa 3.09e-06 0.00153 0.00347
+ctgac 3.09e-06 0.000414 0.00114
+ctgag 3.09e-06 0.000697 0.0023
+ctgat 3.09e-06 0.000775 0.00395
+ctgca 0.000735 0.000806 0.0027
+ctgcc 0.00036 0.000517 0.00108
+ctgcg 0.000199 0.000209 0.000424
+ctgct 0.000469 0.00073 0.00374
+ctgga 0.000651 0.00127 0.00239
+ctggc 0.000355 0.00064 0.00103
+ctggg 0.000653 0.000485 0.00101
+ctggt 0.000429 0.000656 0.00263
+ctgta 0.000478 0.00025 0.00119
+ctgtc 0.000355 0.000521 0.00115
+ctgtg 0.000839 0.000301 0.00147
+ctgtt 0.000442 0.000802 0.00308
+cttaa 0.000893 0.00149 3.08e-06
+cttac 0.000429 0.000777 0.000934
+cttag 0.000936 0.000871 3.08e-06
+cttat 0.000649 0.00118 0.00162
+cttca 0.0016 0.00184 0.00267
+cttcc 0.000805 0.0015 0.0012
+cttcg 0.000516 0.000582 0.000519
+cttct 0.00119 0.00182 0.00337
+cttga 0.00165 0.00313 3.08e-06
+cttgc 0.000934 0.00171 0.000699
+cttgg 0.00149 0.00193 0.00106
+cttgt 0.00101 0.00189 0.00136
+cttta 0.00103 0.000656 0.00153
+ctttc 0.00086 0.00157 0.00145
+ctttg 0.00225 0.000743 0.00216
+ctttt 0.00108 0.00183 0.00222
+gaaaa 0.00305 0.00385 0.00171
+gaaac 0.00169 0.00171 0.000862
+gaaag 0.00288 0.00201 0.0014
+gaaat 0.00171 0.00293 0.00184
+gaaca 0.00151 0.00171 0.000868
+gaacc 0.000748 0.00117 0.000403
+gaacg 0.000509 0.000438 0.000227
+gaact 0.000877 0.00165 0.000987
+gaaga 0.00351 0.00576 0.00126
+gaagc 0.00186 0.00293 0.000686
+gaagg 0.0022 0.00224 0.000773
+gaagt 0.00143 0.00246 0.00105
+gaata 0.00162 0.000804 0.000773
+gaatc 0.00124 0.00157 0.000595
+gaatg 0.00269 0.000957 0.00104
+gaatt 0.00163 0.00243 0.00135
+gacaa 0.00111 0.0021 0.000843
+gacac 0.000562 0.000867 0.000274
+gacag 0.00102 0.000865 0.000452
+gacat 0.000754 0.00159 0.000511
+gacca 0.000651 0.000831 0.000648
+gaccc 0.000296 0.000687 0.000255
+gaccg 0.000244 0.000306 0.000157
+gacct 0.00029 0.0008 0.000534
+gacga 0.000419 0.00135 0.000231
+gacgc 0.000197 0.00042 0.00014
+gacgg 0.000419 0.000573 0.000174
+gacgt 0.000248 0.00054 0.000255
+gacta 0.000815 0.000521 0.000416
+gactc 0.000706 0.000865 0.00035
+gactg 0.00125 0.000537 0.00035
+gactt 0.000763 0.00138 0.000879
+gagaa 0.00167 0.00409 0.00179
+gagac 0.000615 0.00109 0.000693
+gagag 0.0013 0.00171 0.00104
+gagat 0.000824 0.0022 0.00171
+gagca 0.000955 0.00151 0.00111
+gagcc 0.00044 0.000932 0.000401
+gagcg 0.000324 0.000376 0.000215
+gagct 0.000682 0.00186 0.00125
+gagga 0.00142 0.00364 0.00133
+gaggc 0.000647 0.00144 0.000507
+gaggg 0.000929 0.00091 0.000543
+gaggt 0.000653 0.0013 0.000858
+gagta 0.000843 0.000676 0.000655
+gagtc 0.000547 0.000991 0.000397
+gagtg 0.0012 0.000531 0.000674
+gagtt 0.000858 0.00196 0.00126
+gataa 0.001 0.00262 3.08e-06
+gatac 0.000539 0.00116 0.000413
+gatag 0.000822 0.00135 3.08e-06
+gatat 0.000915 0.00261 0.000896
+gatca 0.00106 0.00197 0.000944
+gatcc 0.000484 0.00168 0.00039
+gatcg 0.000467 0.000598 0.000198
+gatct 0.000543 0.00182 0.000817
+gatga 0.00174 0.00571 3.08e-06
+gatgc 0.000942 0.00265 0.00027
+gatgg 0.0015 0.00277 0.000638
+gatgt 0.000799 0.00282 0.000477
+gatta 0.00114 0.000964 0.00064
+gattc 0.00109 0.00192 0.000635
+gattg 0.00211 0.00104 0.001
+gattt 0.00121 0.00298 0.00133
+gcaaa 0.00145 0.00245 0.00146
+gcaac 0.000883 0.00122 0.000801
+gcaag 0.00143 0.00122 0.00133
+gcaat 0.000788 0.00197 0.00125
+gcaca 0.000558 0.000918 0.000646
+gcacc 0.000364 0.000885 0.000434
+gcacg 0.000273 0.000349 0.000196
+gcact 0.000341 0.00119 0.000754
+gcaga 0.00114 0.0023 0.000688
+gcagc 0.00112 0.00198 0.000752
+gcagg 0.000729 0.000952 0.000435
+gcagt 0.000663 0.00152 0.000875
+gcata 0.000655 0.00055 0.000672
+gcatc 0.000611 0.00121 0.0005
+gcatg 0.00109 0.000596 0.000999
+gcatt 0.000712 0.00184 0.00117
+gccaa 0.00131 0.00153 0.000849
+gccac 0.000777 0.00078 0.000403
+gccag 0.000999 0.000544 0.000475
+gccat 0.000826 0.00123 0.000712
+gccca 0.000455 0.000459 0.000464
+gcccc 0.000187 0.000382 0.000265
+gcccg 0.000248 0.000223 0.000121
+gccct 0.000248 0.000587 0.000606
+gccga 0.000328 0.000577 0.000276
+gccgc 0.000265 0.000443 0.000229
+gccgg 0.00044 0.000476 0.000234
+gccgt 0.000262 0.00049 0.000358
+gccta 0.000866 0.000317 0.000352
+gcctc 0.000836 0.000573 0.000435
+gcctg 0.00115 0.000281 0.000346
+gcctt 0.000836 0.000851 0.000853
+gcgaa 0.000351 0.000575 0.000475
+gcgac 0.00018 0.000261 0.000318
+gcgag 0.000334 0.000308 0.000426
+gcgat 0.000199 0.000438 0.000551
+gcgca 0.000262 0.000232 0.000221
+gcgcc 0.000167 0.000241 0.000225
+gcgcg 0.000159 0.000124 0.000111
+gcgct 0.000136 0.000302 0.000312
+gcgga 0.000254 0.000607 0.000382
+gcggc 0.000216 0.000488 0.000361
+gcggg 0.000121 0.000245 0.000202
+gcggt 0.000167 0.000304 0.000413
+gcgta 0.000241 0.000136 0.000193
+gcgtc 0.000282 0.000279 0.000255
+gcgtg 0.000404 0.000136 0.000269
+gcgtt 0.000241 0.000472 0.00042
+gctaa 0.000817 0.0019 3.08e-06
+gctac 0.000457 0.00107 0.000481
+gctag 0.000805 0.00104 3.08e-06
+gctat 0.000505 0.00157 0.000798
+gctca 0.000895 0.00151 0.000699
+gctcc 0.000417 0.00117 0.00046
+gctcg 0.00045 0.000672 0.000272
+gctct 0.000609 0.00156 0.000868
+gctga 0.001 0.0033 3.08e-06
+gctgc 0.000685 0.00299 0.000434
+gctgg 0.000891 0.00219 0.000428
+gctgt 0.000505 0.0022 0.000494
+gctta 0.00106 0.000764 0.000667
+gcttc 0.00137 0.00189 0.000733
+gcttg 0.00185 0.000896 0.000957
+gcttt 0.00112 0.00204 0.001
+ggaaa 0.00243 0.00264 0.00199
+ggaac 0.0011 0.00124 0.000741
+ggaag 0.00288 0.0017 0.00169
+ggaat 0.00119 0.00175 0.00156
+ggaca 0.00123 0.000966 0.000727
+ggacc 0.000566 0.000728 0.000274
+ggacg 0.00068 0.000333 0.0002
+ggact 0.000788 0.000934 0.000763
+ggaga 0.00256 0.00235 0.000966
+ggagc 0.0013 0.00132 0.000523
+ggagg 0.0018 0.00155 0.000769
+ggagt 0.00109 0.00141 0.000712
+ggata 0.00179 0.000627 0.000682
+ggatc 0.0012 0.00101 0.0005
+ggatg 0.00278 0.000586 0.000985
+ggatt 0.00156 0.00174 0.00117
+ggcaa 0.00136 0.00131 0.000837
+ggcac 0.000714 0.000573 0.000303
+ggcag 0.00123 0.000706 0.000612
+ggcat 0.000921 0.00101 0.000671
+ggcca 0.000737 0.00075 0.000811
+ggccc 0.000345 0.000355 0.000204
+ggccg 0.000341 0.000326 0.000223
+ggcct 0.00036 0.000616 0.000722
+ggcga 0.00052 0.000642 0.000257
+ggcgc 0.000265 0.00032 0.00017
+ggcgg 0.000541 0.000647 0.000176
+ggcgt 0.000341 0.000394 0.000263
+ggcta 0.0011 0.000454 0.000587
+ggctc 0.000919 0.000609 0.00042
+ggctg 0.00185 0.000391 0.000498
+ggctt 0.00101 0.000939 0.00105
+gggaa 0.00127 0.00181 0.00134
+gggac 0.000503 0.000571 0.00061
+gggag 0.000946 0.00066 0.000959
+gggat 0.000668 0.000982 0.00137
+gggca 0.000512 0.000598 0.000733
+gggcc 0.000279 0.000344 0.000246
+gggcg 0.000262 0.000192 0.000215
+gggct 0.000402 0.000598 0.000803
+gggga 0.000731 0.00109 0.000661
+ggggc 0.000313 0.000458 0.000284
+ggggg 0.000317 0.0004 0.000212
+ggggt 0.000376 0.000665 0.000663
+gggta 0.000684 0.000329 0.000473
+gggtc 0.000566 0.000465 0.000314
+gggtg 0.00108 0.000245 0.000619
+gggtt 0.000739 0.000991 0.000989
+ggtaa 0.000653 0.00116 3.08e-06
+ggtac 0.000393 0.00064 0.000452
+ggtag 0.000712 0.000807 3.08e-06
+ggtat 0.000438 0.001 0.000629
+ggtca 0.000666 0.00108 0.000631
+ggtcc 0.000378 0.000827 0.000352
+ggtcg 0.000275 0.00043 0.0002
+ggtct 0.000362 0.000914 0.000644
+ggtga 0.00115 0.00235 3.08e-06
+ggtgc 0.000571 0.00148 0.000265
+ggtgg 0.00132 0.0023 0.00058
+ggtgt 0.000604 0.00149 0.000397
+ggtta 0.000997 0.000697 0.000661
+ggttc 0.00104 0.00142 0.000684
+ggttg 0.00187 0.000723 0.000974
+ggttt 0.00109 0.00169 0.00114
+gtaaa 3.09e-06 0.00132 0.00127
+gtaac 3.09e-06 0.000656 0.000665
+gtaag 3.09e-06 0.000515 0.000754
+gtaat 3.09e-06 0.000961 0.00117
+gtaca 0.000976 0.0006 0.000754
+gtacc 0.00049 0.000578 0.000341
+gtacg 0.000343 0.000183 0.000185
+gtact 0.000501 0.000595 0.000909
+gtaga 3.09e-06 0.00135 0.00076
+gtagc 3.09e-06 0.001 0.00064
+gtagg 3.09e-06 0.000625 0.000477
+gtagt 3.09e-06 0.000811 0.000894
+gtata 0.000801 0.000337 0.000608
+gtatc 0.000617 0.000752 0.000475
+gtatg 0.00127 0.000347 0.00071
+gtatt 0.000695 0.00097 0.00111
+gtcaa 0.0012 0.00152 0.000949
+gtcac 0.000579 0.000705 0.000424
+gtcag 0.000792 0.000476 0.000636
+gtcat 0.000799 0.00109 0.000866
+gtcca 0.000752 0.00062 0.00101
+gtccc 0.000313 0.00054 0.00028
+gtccg 0.000341 0.000239 0.00024
+gtcct 0.000372 0.000665 0.000978
+gtcga 0.0004 0.000593 0.000365
+gtcgc 0.00021 0.000328 0.000251
+gtcgg 0.0003 0.000364 0.000274
+gtcgt 0.000357 0.000384 0.000405
+gtcta 0.000706 0.000384 0.000483
+gtctc 0.000712 0.000703 0.000597
+gtctg 0.00107 0.000283 0.000458
+gtctt 0.000837 0.000813 0.00116
+gtgaa 3.09e-06 0.00219 0.0023
+gtgac 3.09e-06 0.000849 0.00102
+gtgag 3.09e-06 0.000918 0.00113
+gtgat 3.09e-06 0.00123 0.00253
+gtgca 0.00055 0.000816 0.00135
+gtgcc 0.000252 0.000687 0.000623
+gtgcg 0.000153 0.000198 0.00021
+gtgct 0.000294 0.000822 0.00194
+gtgga 0.000868 0.00211 0.00198
+gtggc 0.000471 0.0012 0.00106
+gtggg 0.000628 0.000715 0.00089
+gtggt 0.000465 0.00126 0.00196
+gtgta 0.00041 0.000458 0.00082
+gtgtc 0.000321 0.000613 0.000629
+gtgtg 0.000676 0.000337 0.000883
+gtgtt 0.000435 0.00121 0.00176
+gttaa 0.000927 0.00171 3.08e-06
+gttac 0.000577 0.000973 0.000623
+gttag 0.000957 0.000943 3.08e-06
+gttat 0.000644 0.00142 0.00112
+gttca 0.00118 0.00155 0.00136
+gttcc 0.000547 0.00131 0.000591
+gttcg 0.000435 0.000566 0.000335
+gttct 0.000921 0.0015 0.00148
+gttga 0.00174 0.00348 3.08e-06
+gttgc 0.000925 0.00211 0.000523
+gttgg 0.00159 0.00203 0.000727
+gttgt 0.00082 0.00216 0.000873
+gttta 0.00106 0.000762 0.00098
+gtttc 0.00108 0.00174 0.000974
+gtttg 0.00201 0.000844 0.00142
+gtttt 0.00107 0.00186 0.00153
+taaaa 0.00205 0.00221 0.00162
+taaac 0.00117 0.0011 0.000818
+taaag 0.00268 0.00131 0.00147
+taaat 0.00123 0.00175 0.00154
+taaca 0.00171 0.00126 0.00122
+taacc 0.000815 0.000872 0.000485
+taacg 0.000552 0.000349 0.000253
+taact 0.000934 0.0011 0.000942
+taaga 0.00178 0.00312 0.000989
+taagc 0.00122 0.00164 0.000602
+taagg 0.00173 0.00144 0.000868
+taagt 0.000953 0.00151 0.000873
+taata 0.00187 0.000531 0.000811
+taatc 0.0014 0.00111 0.000674
+taatg 0.00285 0.000662 0.00126
+taatt 0.00171 0.00153 0.00146
+tacaa 0.00151 0.00175 0.00111
+tacac 0.000716 0.000705 0.000354
+tacag 0.00123 0.000793 0.000614
+tacat 0.000997 0.00108 0.000708
+tacca 0.00094 0.000688 0.00107
+taccc 0.000478 0.00047 0.000375
+taccg 0.000378 0.000227 0.000234
+tacct 0.000499 0.000643 0.000999
+tacga 0.000292 0.000614 0.000325
+tacgc 0.000187 0.00027 0.000195
+tacgg 0.000309 0.000353 0.000217
+tacgt 0.000279 0.000353 0.000278
+tacta 0.00132 0.000434 0.000689
+tactc 0.00106 0.000658 0.000475
+tactg 0.00206 0.000436 0.000625
+tactt 0.00122 0.00114 0.00121
+tagaa 0.00137 0.00269 0.0018
+tagac 0.000579 0.000713 0.000794
+tagag 0.00149 0.00115 0.00136
+tagat 0.000752 0.00136 0.0017
+tagca 0.00133 0.00117 0.00153
+tagcc 0.000577 0.000766 0.000635
+tagcg 0.000311 0.00029 0.000276
+tagct 0.000799 0.00127 0.00174
+tagga 0.00103 0.00207 0.00107
+taggc 0.00075 0.000884 0.000477
+taggg 0.000651 0.000652 0.000576
+taggt 0.000493 0.000833 0.000879
+tagta 0.00122 0.000485 0.000841
+tagtc 0.000773 0.000715 0.000555
+tagtg 0.00164 0.000413 0.000818
+tagtt 0.000982 0.00132 0.0013
+tataa 0.00125 0.0012 3.08e-06
+tatac 0.000792 0.000618 0.000587
+tatag 0.00112 0.00078 3.08e-06
+tatat 0.000902 0.00104 0.000966
+tatca 0.00136 0.000927 0.00146
+tatcc 0.000737 0.000845 0.000602
+tatcg 0.00052 0.000387 0.000377
+tatct 0.000817 0.000993 0.00137
+tatga 0.00152 0.00228 3.08e-06
+tatgc 0.000988 0.00157 0.000466
+tatgg 0.00171 0.00174 0.000758
+tatgt 0.000889 0.00146 0.000686
+tatta 0.00157 0.00053 0.000784
+tattc 0.00158 0.000959 0.000925
+tattg 0.00304 0.000577 0.00118
+tattt 0.00152 0.00132 0.00164
+tcaaa 0.00213 0.00243 0.00223
+tcaac 0.0014 0.00144 0.00145
+tcaag 0.00261 0.00159 0.00218
+tcaat 0.00132 0.00173 0.00203
+tcaca 0.00109 0.000927 0.00105
+tcacc 0.000659 0.000984 0.000705
+tcacg 0.00045 0.000297 0.000316
+tcact 0.000712 0.00105 0.00144
+tcaga 0.00167 0.00201 0.000872
+tcagc 0.0012 0.00147 0.000674
+tcagg 0.00111 0.001 0.00054
+tcagt 0.00105 0.00134 0.00101
+tcata 0.00122 0.000421 0.000991
+tcatc 0.00143 0.00177 0.00124
+tcatg 0.002 0.000631 0.00144
+tcatt 0.00129 0.00154 0.00176
+tccaa 0.00241 0.00166 0.00115
+tccac 0.00127 0.000835 0.00058
+tccag 0.00192 0.000672 0.000739
+tccat 0.00143 0.00123 0.000923
+tccca 0.00087 0.000605 0.00089
+tcccc 0.000454 0.000528 0.000339
+tcccg 0.00045 0.000149 0.000206
+tccct 0.00053 0.000683 0.0012
+tccga 0.000511 0.000685 0.000392
+tccgc 0.000374 0.000367 0.00031
+tccgg 0.000539 0.000416 0.000284
+tccgt 0.000398 0.000342 0.000388
+tccta 0.00168 0.000308 0.000593
+tcctc 0.00188 0.00109 0.000985
+tcctg 0.00241 0.000239 0.000451
+tcctt 0.00173 0.000961 0.00138
+tcgaa 0.000682 0.000638 0.000722
+tcgac 0.000374 0.00034 0.0006
+tcgag 0.000676 0.000396 0.000801
+tcgat 0.000436 0.000447 0.000818
+tcgca 0.000404 0.000234 0.000369
+tcgcc 0.000408 0.000366 0.000428
+tcgcg 0.000305 0.000115 0.000214
+tcgct 0.000328 0.000301 0.000473
+tcgga 0.000495 0.000539 0.00053
+tcggc 0.00033 0.000308 0.000363
+tcggg 0.000343 0.000324 0.000308
+tcggt 0.000273 0.000342 0.000466
+tcgta 0.000537 0.000163 0.000293
+tcgtc 0.000579 0.000546 0.000458
+tcgtg 0.000984 0.000209 0.000488
+tcgtt 0.000522 0.00051 0.00068
+tctaa 0.00106 0.00146 3.08e-06
+tctac 0.000653 0.000963 0.000809
+tctag 0.00103 0.000878 3.08e-06
+tctat 0.000729 0.00111 0.00104
+tctca 0.00176 0.00143 0.00121
+tctcc 0.000995 0.00147 0.00103
+tctcg 0.000535 0.00045 0.000388
+tctct 0.00125 0.00152 0.00164
+tctga 0.00117 0.00256 3.08e-06
+tctgc 0.000809 0.00183 0.000532
+tctgg 0.00101 0.0018 0.000581
+tctgt 0.000714 0.00164 0.000619
+tctta 0.00161 0.000578 0.000798
+tcttc 0.00228 0.00258 0.00151
+tcttg 0.00353 0.000793 0.00166
+tcttt 0.00177 0.00195 0.0018
+tgaaa 0.00424 0.00138 0.00283
+tgaac 0.00215 0.000591 0.00122
+tgaag 0.00581 0.000895 0.00306
+tgaat 0.00247 0.00089 0.00241
+tgaca 0.00237 0.000494 0.00131
+tgacc 0.00124 0.000379 0.000564
+tgacg 0.001 0.00019 0.000439
+tgact 0.0014 0.000479 0.00133
+tgaga 0.00345 0.00125 0.00148
+tgagc 0.00181 0.000713 0.000809
+tgagg 0.00289 0.000768 0.00122
+tgagt 0.00155 0.00071 0.00117
+tgata 0.00362 0.000312 0.00115
+tgatc 0.00309 0.000558 0.00089
+tgatg 0.00651 0.00033 0.00174
+tgatt 0.00311 0.000862 0.00196
+tgcaa 0.00308 0.00122 0.00161
+tgcac 0.00149 0.000499 0.000521
+tgcag 0.00302 0.000605 0.00128
+tgcat 0.00194 0.000836 0.00116
+tgcca 0.00169 0.000485 0.00137
+tgccc 0.000723 0.000378 0.00035
+tgccg 0.000735 0.000221 0.00038
+tgcct 0.000976 0.000429 0.00142
+tgcga 0.000499 0.000283 0.00032
+tgcgc 0.000315 0.00016 0.000238
+tgcgg 0.000558 0.000183 0.00024
+tgcgt 0.000332 0.000225 0.000386
+tgcta 0.00269 0.000263 0.000799
+tgctc 0.00231 0.000519 0.000781
+tgctg 0.00546 0.000331 0.00103
+tgctt 0.00271 0.000714 0.00186
+tggaa 0.00367 0.00153 0.00281
+tggac 0.0015 0.000618 0.0013
+tggag 0.00349 0.000881 0.0026
+tggat 0.00203 0.000977 0.00289
+tggca 0.00192 0.000623 0.00175
+tggcc 0.00104 0.000537 0.000737
+tggcg 0.000822 0.000214 0.000589
+tggct 0.00127 0.00077 0.00216
+tggga 0.00194 0.00131 0.00146
+tgggc 0.00079 0.000717 0.000595
+tgggg 0.00135 0.000706 0.000752
+tgggt 0.000904 0.000762 0.00116
+tggta 0.00206 0.000319 0.000889
+tggtc 0.00171 0.000544 0.000699
+tggtg 0.00435 0.000494 0.0016
+tggtt 0.00247 0.000963 0.00206
+tgtaa 0.00152 0.000827 3.08e-06
+tgtac 0.000904 0.000459 0.000803
+tgtag 0.00156 0.000542 3.08e-06
+tgtat 0.0011 0.00054 0.0012
+tgtca 0.00187 0.000517 0.00129
+tgtcc 0.000988 0.000477 0.000591
+tgtcg 0.000703 0.000274 0.00038
+tgtct 0.00106 0.000542 0.00114
+tgtga 0.00222 0.00143 3.08e-06
+tgtgc 0.00106 0.000899 0.000475
+tgtgg 0.00222 0.00122 0.00079
+tgtgt 0.00114 0.000865 0.000585
+tgtta 0.0025 0.000333 0.00105
+tgttc 0.00223 0.000732 0.00102
+tgttg 0.00467 0.000485 0.00178
+tgttt 0.0024 0.000937 0.0018
+ttaaa 3.09e-06 0.00133 0.00191
+ttaac 3.09e-06 0.000836 0.00122
+ttaag 3.09e-06 0.000966 0.00178
+ttaat 3.09e-06 0.00102 0.00194
+ttaca 0.00154 0.000809 0.00125
+ttacc 0.000752 0.000773 0.000689
+ttacg 0.000535 0.000295 0.00031
+ttact 0.00103 0.00078 0.00161
+ttaga 3.09e-06 0.00151 0.0012
+ttagc 3.09e-06 0.00125 0.000828
+ttagg 3.09e-06 0.000903 0.0009
+ttagt 3.09e-06 0.000955 0.00116
+ttata 0.00137 0.000344 0.00113
+ttatc 0.00117 0.00122 0.00101
+ttatg 0.00253 0.000497 0.00138
+ttatt 0.00123 0.00111 0.00211
+ttcaa 0.00278 0.0023 0.00242
+ttcac 0.0014 0.00117 0.000904
+ttcag 0.00248 0.00106 0.00167
+ttcat 0.00179 0.00166 0.0019
+ttcca 0.00166 0.00103 0.00219
+ttccc 0.000824 0.000789 0.000743
+ttccg 0.000602 0.000391 0.000545
+ttcct 0.00115 0.00111 0.00245
+ttcga 0.00068 0.000842 0.000676
+ttcgc 0.00037 0.000394 0.000437
+ttcgg 0.000505 0.000497 0.000394
+ttcgt 0.00045 0.000521 0.000847
+ttcta 0.0019 0.000614 0.00117
+ttctc 0.00217 0.00147 0.00154
+ttctg 0.00337 0.000618 0.00124
+ttctt 0.00276 0.00221 0.00305
+ttgaa 3.09e-06 0.0028 0.00427
+ttgac 3.09e-06 0.00121 0.00189
+ttgag 3.09e-06 0.00153 0.00321
+ttgat 3.09e-06 0.00173 0.00528
+ttgca 0.00116 0.00144 0.00275
+ttgcc 0.000615 0.00117 0.00122
+ttgcg 0.000303 0.000375 0.000515
+ttgct 0.000718 0.00145 0.00405
+ttgga 0.00144 0.00304 0.0031
+ttggc 0.000712 0.00162 0.00146
+ttggg 0.0013 0.00135 0.00145
+ttggt 0.000858 0.00155 0.00309
+ttgta 0.00102 0.000582 0.00157
+ttgtc 0.000769 0.00113 0.0015
+ttgtg 0.00186 0.000555 0.00224
+ttgtt 0.00111 0.00185 0.00364
+tttaa 0.00153 0.00155 3.08e-06
+tttac 0.00107 0.000934 0.00116
+tttag 0.00163 0.00108 3.08e-06
+tttat 0.00121 0.00127 0.00173
+tttca 0.00225 0.00158 0.00237
+tttcc 0.00138 0.00123 0.00132
+tttcg 0.000794 0.000519 0.00061
+tttct 0.00191 0.00161 0.00289
+tttga 0.00247 0.00359 3.08e-06
+tttgc 0.00164 0.0021 0.000854
+tttgg 0.00289 0.00247 0.00124
+tttgt 0.00148 0.00227 0.00137
+tttta 0.00165 0.000661 0.00133
+ttttc 0.00183 0.00172 0.00198
+ttttg 0.0037 0.000865 0.00237
+ttttt 0.00123 0.00154 0.00195
+
+# translation initiation motif
+[TRANSINIT]
+# width of motif, n=
+20
+# order of markov model, k=
+3
+# markov chain emission probabilities
+ 0 0.429 0.152 0.196 0.223 0.449 0.13 0.087 0.333 0.284 0.205 0.216 0.295 0.272 0.243 0.0388 0.447 0.342 0.151 0.233 0.274 0.37 0.261 0.13 0.239 0.333 0.267 0.2 0.2 0.228 0.228 0.241 0.304 0.458 0.112 0.28 0.15 0.388 0.204 0.163 0.245 0.466 0.121 0.172 0.241 0.338 0.154 0.231 0.277 0.299 0.149 0.209 0.343 0.303 0.197 0.136 0.364 0.25 0.281 0.156 0.312 0.246 0.174 0.126 0.455 0.44 0.16 0.18 0.22 0.408 0.163 0.0408 0.388 0.315 0.0926 0.241 0.352 0.159 0.232 0.116 0.493 0.319 0.188 0.174 0 [...]
+ 1 0.422 0.143 0.207 0.227 0.422 0.186 0.0686 0.324 0.336 0.173 0.2 0.291 0.245 0.231 0.0544 0.469 0.387 0.129 0.237 0.247 0.37 0.241 0.13 0.259 0.368 0.211 0.211 0.211 0.25 0.24 0.25 0.26 0.477 0.114 0.242 0.167 0.364 0.182 0.136 0.318 0.432 0.0946 0.176 0.297 0.398 0.148 0.205 0.25 0.287 0.149 0.218 0.345 0.34 0.196 0.155 0.309 0.195 0.293 0.195 0.317 0.249 0.176 0.132 0.444 0.401 0.182 0.175 0.241 0.403 0.161 0.0645 0.371 0.338 0.135 0.176 0.351 0.173 0.25 0.115 0.462 0.369 0.167 0.1 [...]
+ 2 0.438 0.146 0.185 0.231 0.394 0.165 0.0709 0.37 0.338 0.162 0.197 0.303 0.258 0.204 0.043 0.495 0.415 0.163 0.203 0.22 0.382 0.235 0.103 0.279 0.375 0.167 0.25 0.208 0.263 0.237 0.246 0.254 0.452 0.102 0.277 0.169 0.415 0.159 0.11 0.317 0.407 0.0988 0.198 0.296 0.374 0.168 0.206 0.252 0.296 0.148 0.209 0.348 0.366 0.187 0.138 0.309 0.226 0.302 0.151 0.321 0.236 0.165 0.146 0.453 0.41 0.202 0.162 0.225 0.406 0.174 0.058 0.362 0.365 0.118 0.188 0.329 0.186 0.24 0.101 0.473 0.376 0.188 [...]
+ 3 0.457 0.149 0.165 0.229 0.394 0.189 0.0709 0.346 0.378 0.133 0.178 0.311 0.266 0.191 0.0426 0.5 0.41 0.172 0.213 0.205 0.387 0.161 0.0968 0.355 0.333 0.185 0.222 0.259 0.239 0.265 0.23 0.265 0.468 0.0909 0.247 0.195 0.388 0.118 0.0824 0.412 0.359 0.0897 0.218 0.333 0.354 0.142 0.195 0.31 0.347 0.113 0.194 0.347 0.388 0.174 0.107 0.331 0.205 0.318 0.114 0.364 0.222 0.149 0.169 0.46 0.376 0.212 0.159 0.253 0.39 0.143 0.0649 0.403 0.348 0.124 0.191 0.337 0.189 0.27 0.0902 0.451 0.388 0. [...]
+ 4 0.45 0.152 0.17 0.228 0.371 0.197 0.0758 0.356 0.391 0.12 0.211 0.278 0.263 0.216 0.0464 0.474 0.4 0.176 0.208 0.216 0.417 0.133 0.0833 0.367 0.286 0.214 0.214 0.286 0.274 0.23 0.239 0.257 0.412 0.0915 0.294 0.203 0.368 0.118 0.0526 0.461 0.371 0.1 0.229 0.3 0.336 0.131 0.205 0.328 0.342 0.117 0.2 0.342 0.398 0.141 0.141 0.32 0.283 0.217 0.13 0.37 0.242 0.158 0.169 0.431 0.385 0.219 0.136 0.26 0.417 0.125 0.0556 0.403 0.402 0.163 0.087 0.348 0.216 0.259 0.0862 0.44 0.404 0.183 0.125 [...]
+ 5 0.438 0.14 0.173 0.25 0.341 0.207 0.0667 0.385 0.46 0.101 0.194 0.245 0.256 0.182 0.0443 0.517 0.384 0.216 0.24 0.16 0.362 0.138 0.069 0.431 0.296 0.222 0.148 0.333 0.277 0.25 0.196 0.277 0.445 0.0774 0.277 0.2 0.429 0.0779 0.039 0.455 0.312 0.141 0.25 0.297 0.305 0.136 0.212 0.347 0.352 0.104 0.2 0.344 0.406 0.188 0.12 0.286 0.271 0.188 0.167 0.375 0.257 0.146 0.157 0.441 0.406 0.2 0.143 0.251 0.437 0.141 0.0563 0.366 0.407 0.176 0.0879 0.33 0.185 0.261 0.084 0.471 0.432 0.2 0.116 0 [...]
+ 6 0.447 0.147 0.165 0.24 0.336 0.172 0.0902 0.402 0.451 0.132 0.174 0.243 0.267 0.193 0.0446 0.495 0.387 0.234 0.226 0.153 0.367 0.167 0.0833 0.383 0.269 0.231 0.154 0.346 0.248 0.256 0.162 0.333 0.45 0.071 0.29 0.189 0.464 0.0725 0.0435 0.42 0.309 0.147 0.294 0.25 0.235 0.165 0.217 0.383 0.344 0.102 0.195 0.359 0.372 0.198 0.0909 0.339 0.31 0.19 0.143 0.357 0.254 0.15 0.15 0.446 0.447 0.173 0.151 0.229 0.418 0.152 0.0506 0.38 0.398 0.143 0.133 0.327 0.18 0.26 0.06 0.5 0.388 0.214 0.11 [...]
+ 7 0.443 0.148 0.176 0.232 0.377 0.18 0.0902 0.352 0.497 0.128 0.174 0.201 0.273 0.205 0.0537 0.468 0.357 0.235 0.252 0.157 0.386 0.175 0.0877 0.351 0.25 0.25 0.143 0.357 0.274 0.226 0.169 0.331 0.486 0.0615 0.257 0.196 0.397 0.118 0.0441 0.441 0.292 0.181 0.25 0.278 0.312 0.125 0.203 0.359 0.359 0.111 0.197 0.333 0.347 0.215 0.0909 0.347 0.439 0.122 0.146 0.293 0.253 0.174 0.136 0.438 0.436 0.145 0.18 0.238 0.427 0.146 0.0488 0.378 0.346 0.168 0.112 0.374 0.153 0.276 0.0816 0.49 0.439 [...]
+ 8 0.461 0.136 0.178 0.225 0.36 0.176 0.12 0.344 0.474 0.143 0.183 0.2 0.271 0.198 0.058 0.473 0.362 0.238 0.246 0.154 0.442 0.212 0.0962 0.25 0.259 0.296 0.148 0.296 0.281 0.228 0.175 0.316 0.513 0.0582 0.254 0.175 0.4 0.143 0.0714 0.386 0.354 0.177 0.241 0.228 0.305 0.13 0.229 0.336 0.347 0.136 0.186 0.331 0.35 0.203 0.114 0.333 0.419 0.116 0.209 0.256 0.247 0.167 0.16 0.426 0.444 0.113 0.212 0.231 0.463 0.188 0.0375 0.312 0.314 0.196 0.127 0.363 0.168 0.242 0.0737 0.516 0.444 0.189 0 [...]
+ 9 0.455 0.127 0.184 0.233 0.358 0.198 0.123 0.321 0.511 0.121 0.143 0.225 0.268 0.176 0.0732 0.483 0.371 0.212 0.265 0.152 0.474 0.193 0.14 0.193 0.345 0.207 0.241 0.207 0.248 0.276 0.171 0.305 0.524 0.0471 0.251 0.178 0.411 0.192 0.0548 0.342 0.315 0.191 0.247 0.247 0.336 0.104 0.216 0.344 0.35 0.138 0.195 0.317 0.361 0.213 0.0926 0.333 0.447 0.158 0.184 0.211 0.218 0.159 0.171 0.452 0.4 0.12 0.257 0.223 0.398 0.216 0.0455 0.341 0.287 0.202 0.149 0.362 0.143 0.257 0.0762 0.524 0.433 0 [...]
+10 0.454 0.126 0.185 0.234 0.357 0.196 0.143 0.304 0.485 0.155 0.126 0.233 0.259 0.205 0.0818 0.455 0.385 0.197 0.23 0.189 0.484 0.226 0.145 0.145 0.31 0.276 0.276 0.138 0.235 0.304 0.186 0.275 0.497 0.0508 0.264 0.188 0.389 0.208 0.0694 0.333 0.318 0.176 0.235 0.271 0.301 0.12 0.256 0.323 0.333 0.154 0.179 0.333 0.362 0.2 0.0857 0.352 0.432 0.205 0.136 0.227 0.231 0.183 0.171 0.414 0.402 0.136 0.255 0.207 0.368 0.23 0.0575 0.345 0.278 0.216 0.165 0.34 0.167 0.25 0.0926 0.491 0.441 0.18 [...]
+11 0.461 0.121 0.184 0.234 0.35 0.2 0.133 0.317 0.491 0.134 0.139 0.236 0.267 0.203 0.0645 0.465 0.336 0.185 0.244 0.235 0.492 0.222 0.143 0.143 0.267 0.333 0.267 0.133 0.275 0.265 0.225 0.235 0.507 0.0386 0.266 0.188 0.396 0.176 0.0659 0.363 0.301 0.241 0.193 0.265 0.347 0.0748 0.252 0.327 0.354 0.169 0.169 0.308 0.356 0.178 0.102 0.364 0.471 0.137 0.157 0.235 0.227 0.211 0.178 0.385 0.371 0.147 0.259 0.224 0.346 0.247 0.0494 0.358 0.253 0.241 0.161 0.345 0.191 0.252 0.0957 0.461 0.449 [...]
+12 0.451 0.105 0.2 0.243 0.385 0.213 0.131 0.27 0.491 0.125 0.13 0.255 0.255 0.199 0.0926 0.454 0.339 0.144 0.263 0.254 0.516 0.203 0.141 0.141 0.31 0.345 0.276 0.069 0.216 0.284 0.245 0.255 0.487 0.0406 0.254 0.218 0.416 0.135 0.0899 0.36 0.326 0.202 0.236 0.236 0.262 0.0922 0.298 0.348 0.303 0.159 0.193 0.345 0.4 0.139 0.0957 0.365 0.366 0.146 0.195 0.293 0.211 0.231 0.182 0.377 0.363 0.149 0.256 0.232 0.302 0.256 0.0814 0.36 0.294 0.224 0.212 0.271 0.205 0.268 0.0804 0.446 0.36 0.233 [...]
+13 0.419 0.119 0.205 0.257 0.414 0.224 0.0948 0.267 0.498 0.12 0.134 0.249 0.262 0.226 0.0814 0.43 0.336 0.112 0.276 0.276 0.537 0.194 0.134 0.134 0.333 0.333 0.242 0.0909 0.196 0.245 0.245 0.314 0.495 0.0577 0.245 0.202 0.395 0.128 0.0814 0.395 0.286 0.165 0.242 0.308 0.275 0.113 0.282 0.331 0.271 0.188 0.194 0.347 0.415 0.161 0.0847 0.339 0.37 0.174 0.109 0.348 0.221 0.273 0.156 0.351 0.385 0.183 0.201 0.231 0.289 0.277 0.0843 0.349 0.315 0.196 0.207 0.283 0.254 0.272 0.0702 0.404 0.3 [...]
+14 0.45 0.123 0.205 0.222 0.5 0.169 0.0809 0.25 0.514 0.136 0.145 0.206 0.297 0.247 0.0639 0.393 0.354 0.142 0.239 0.265 0.5 0.235 0.147 0.118 0.267 0.333 0.233 0.167 0.26 0.21 0.26 0.27 0.509 0.0654 0.252 0.173 0.422 0.122 0.0889 0.367 0.319 0.138 0.266 0.277 0.262 0.124 0.31 0.303 0.265 0.187 0.2 0.348 0.409 0.175 0.0876 0.328 0.34 0.16 0.14 0.36 0.24 0.262 0.163 0.335 0.435 0.182 0.153 0.229 0.333 0.295 0.0897 0.282 0.39 0.18 0.21 0.22 0.325 0.254 0.0526 0.368 0.4 0.167 0.189 0.244 0 [...]
+15 0.47 0.111 0.244 0.175 0.519 0.16 0.084 0.237 0.586 0.0995 0.152 0.162 0.333 0.22 0.0806 0.366 0.433 0.104 0.239 0.224 0.522 0.209 0.134 0.134 0.382 0.235 0.235 0.147 0.302 0.146 0.281 0.271 0.515 0.0611 0.262 0.162 0.456 0.122 0.1 0.322 0.394 0.117 0.234 0.255 0.317 0.122 0.285 0.276 0.309 0.16 0.24 0.291 0.441 0.14 0.0882 0.331 0.342 0.132 0.158 0.368 0.245 0.25 0.2 0.305 0.494 0.14 0.151 0.215 0.4 0.267 0.08 0.253 0.433 0.156 0.211 0.2 0.337 0.26 0.0769 0.327 0.414 0.162 0.172 0.2 [...]
+16 0.477 0.14 0.218 0.165 0.547 0.179 0.0855 0.188 0.614 0.123 0.127 0.136 0.329 0.241 0.1 0.329 0.482 0.106 0.213 0.199 0.525 0.213 0.115 0.148 0.486 0.171 0.2 0.143 0.259 0.188 0.259 0.294 0.567 0.0648 0.235 0.134 0.452 0.151 0.0959 0.301 0.461 0.0674 0.225 0.247 0.274 0.168 0.326 0.232 0.284 0.154 0.237 0.325 0.504 0.139 0.0696 0.287 0.279 0.233 0.093 0.395 0.234 0.266 0.213 0.287 0.504 0.142 0.146 0.208 0.464 0.275 0.087 0.174 0.429 0.25 0.152 0.17 0.336 0.29 0.0748 0.299 0.447 0.15 [...]
+17 0.508 0.132 0.212 0.148 0.523 0.212 0.0927 0.172 0.626 0.141 0.115 0.119 0.338 0.318 0.0462 0.297 0.493 0.106 0.218 0.183 0.509 0.211 0.123 0.158 0.455 0.212 0.152 0.182 0.292 0.181 0.236 0.292 0.596 0.0695 0.235 0.0993 0.41 0.282 0.0513 0.256 0.457 0.111 0.198 0.235 0.281 0.177 0.302 0.24 0.318 0.153 0.223 0.306 0.461 0.211 0.0938 0.234 0.319 0.234 0.0851 0.362 0.273 0.248 0.224 0.255 0.539 0.143 0.127 0.192 0.529 0.279 0.0441 0.147 0.41 0.276 0.133 0.181 0.354 0.303 0.0707 0.273 0. [...]
+18 0.534 0.125 0.211 0.129 0.535 0.202 0.109 0.155 0.67 0.143 0.0824 0.104 0.342 0.329 0.0516 0.277 0.54 0.0885 0.204 0.168 0.468 0.234 0.128 0.17 0.462 0.154 0.192 0.192 0.333 0.193 0.246 0.228 0.6 0.0588 0.239 0.102 0.433 0.308 0.0481 0.212 0.508 0.148 0.18 0.164 0.282 0.169 0.31 0.239 0.331 0.126 0.236 0.307 0.462 0.212 0.0962 0.231 0.333 0.242 0.121 0.303 0.268 0.236 0.236 0.26 0.54 0.13 0.14 0.191 0.528 0.264 0.0566 0.151 0.416 0.292 0.124 0.169 0.309 0.309 0.0864 0.296 0.533 0.133 [...]
+19 0.525 0.132 0.211 0.132 0.474 0.247 0.124 0.155 0.66 0.143 0.0816 0.116 0.31 0.362 0.069 0.259 0.545 0.0568 0.227 0.17 0.516 0.226 0.0645 0.194 0.545 0.182 0.136 0.136 0.262 0.214 0.238 0.286 0.613 0.0553 0.23 0.101 0.4 0.329 0.0471 0.224 0.525 0.175 0.1 0.2 0.286 0.204 0.265 0.245 0.352 0.121 0.231 0.297 0.465 0.225 0.0986 0.211 0.333 0.292 0.0833 0.292 0.265 0.289 0.229 0.217 0.549 0.126 0.137 0.189 0.541 0.243 0.0541 0.162 0.358 0.343 0.104 0.194 0.255 0.364 0.127 0.255 0.508 0.15 [...]
+
+# dss upstream motif, reading frame 0(reverse)
+[ETMOTIF0]
+# width of motif, n=
+5
+# order of markov model, k=
+2
+# markov chain emission probabilities
+ 0 0.365 0.219 0.385 0.0312 0.308 0.154 0.22 0.319 0.321 0.132 0.491 0.0566 0.33 0.22 0.0989 0.352 0.375 0.203 0.25 0.172 0.279 0.246 0.246 0.23 0.279 0.116 0.349 0.256 0.2 0.307 0.12 0.373 0.333 0.19 0.405 0.0714 0.136 0.5 0.227 0.136 0.167 0.139 0.25 0.444 0.215 0.2 0.231 0.354 0.322 0.123 0.363 0.192 0.199 0.267 0.267 0.267 0.24 0.18 0.36 0.22 0.321 0.216 0.198 0.265
+ 1 0.227 0.345 0.155 0.273 0.287 0.259 0.176 0.278 0.216 0.098 0.255 0.431 0.262 0.333 0.0873 0.317 0.264 0.25 0.153 0.333 0.326 0.256 0.163 0.256 0.311 0.156 0.2 0.333 0.288 0.26 0.125 0.327 0.341 0.256 0.183 0.22 0.22 0.268 0.22 0.293 0.256 0.154 0.179 0.41 0.306 0.256 0.0813 0.356 0.358 0.209 0.149 0.284 0.196 0.216 0.157 0.431 0.233 0.133 0.233 0.4 0.298 0.316 0.114 0.272
+ 2 0.25 0.292 0.161 0.298 0.319 0.17 0.191 0.319 0.292 0.0876 0.139 0.482 0.286 0.257 0.143 0.314 0.369 0.223 0.0874 0.32 0.235 0.153 0.102 0.51 0.198 0.135 0.115 0.552 0.25 0.196 0.0714 0.482 0.255 0.255 0.106 0.383 0.227 0.227 0.273 0.273 0.2 0.2 0.1 0.5 0.259 0.148 0.148 0.444 0.234 0.312 0.13 0.325 0.28 0.14 0.22 0.36 0.333 0.154 0.103 0.41 0.25 0.182 0.148 0.42
+ 3 0.444 0.233 0.31 0.0129 0.245 0.253 0.233 0.268 0.333 0.167 0.458 0.0417 0.376 0.129 0.129 0.366 0.405 0.143 0.214 0.238 0.258 0.194 0.226 0.323 0.278 0.167 0.333 0.222 0.303 0.182 0.152 0.364 0.312 0.281 0.312 0.0938 0.25 0.25 0.188 0.312 0.158 0.158 0.211 0.474 0.344 0.0938 0.125 0.438 0.297 0.195 0.359 0.148 0.267 0.219 0.248 0.267 0.405 0.108 0.189 0.297 0.219 0.302 0.188 0.292
+ 4 0.333 0.412 0.176 0.0784 0.258 0.419 0.129 0.194 0.522 0.13 0.174 0.174 0.28 0.28 0.24 0.2 0.3 0.3 0.25 0.15 0.357 0.214 0.214 0.214 0.231 0.231 0.231 0.308 0.375 0.25 0.188 0.188 0.364 0.396 0.0973 0.142 0.421 0.211 0.105 0.263 0.239 0.152 0.174 0.435 0.361 0.284 0.0803 0.274 0.25 0.357 0.143 0.25 0.227 0.136 0.227 0.409 0.353 0.176 0.235 0.235 0.269 0.346 0.154 0.231
+
+# dss upstream motif, reading frame 1(reverse)
+[ETMOTIF1]
+# width of motif, n=
+5
+# order of markov model, k=
+2
+# markov chain emission probabilities
+ 0 0.333 0.241 0.218 0.207 0.162 0.273 0.242 0.323 0.333 0.0952 0.214 0.357 0.304 0.304 0.0957 0.296 0.295 0.344 0.115 0.246 0.258 0.333 0.182 0.227 0.261 0.196 0.283 0.261 0.262 0.327 0.121 0.29 0.293 0.253 0.173 0.28 0.324 0.216 0.135 0.324 0.196 0.0784 0.275 0.451 0.26 0.229 0.153 0.359 0.311 0.324 0.135 0.23 0.215 0.215 0.277 0.292 0.415 0.0976 0.171 0.317 0.299 0.316 0.128 0.256
+ 1 0.245 0.279 0.224 0.252 0.253 0.253 0.126 0.368 0.265 0.154 0.171 0.41 0.231 0.231 0.185 0.354 0.253 0.266 0.203 0.278 0.19 0.215 0.177 0.418 0.278 0.125 0.194 0.403 0.167 0.278 0.139 0.417 0.2 0.262 0.215 0.323 0.258 0.194 0.258 0.29 0.214 0.0893 0.179 0.518 0.294 0.216 0.0784 0.412 0.191 0.213 0.223 0.372 0.187 0.253 0.16 0.4 0.245 0.102 0.143 0.51 0.294 0.174 0.138 0.394
+ 2 0.364 0.223 0.388 0.0248 0.235 0.277 0.269 0.218 0.382 0.147 0.426 0.0441 0.407 0.203 0.186 0.203 0.308 0.245 0.168 0.28 0.356 0.205 0.164 0.274 0.275 0.159 0.174 0.391 0.223 0.223 0.0909 0.463 0.426 0.265 0.265 0.0441 0.192 0.192 0.231 0.385 0.275 0.1 0.25 0.375 0.346 0.212 0.192 0.25 0.326 0.163 0.304 0.207 0.238 0.31 0.262 0.19 0.346 0.231 0.192 0.231 0.263 0.263 0.179 0.295
+ 3 0.329 0.333 0.208 0.13 0.365 0.177 0.17 0.287 0.374 0.14 0.224 0.262 0.321 0.357 0.0536 0.268 0.325 0.3 0.2 0.175 0.364 0.152 0.212 0.273 0.367 0.133 0.233 0.267 0.4 0.225 0.125 0.25 0.311 0.311 0.148 0.23 0.263 0.184 0.184 0.368 0.269 0.115 0.231 0.385 0.284 0.25 0.0682 0.398 0.356 0.322 0.136 0.186 0.34 0.208 0.132 0.321 0.435 0.174 0.13 0.261 0.263 0.228 0.158 0.351
+ 4 0.277 0.455 0.152 0.116 0.367 0.2 0.233 0.2 0.267 0.2 0.133 0.4 0.263 0.211 0.158 0.368 0.207 0.414 0.103 0.276 0.261 0.261 0.261 0.217 0.321 0.214 0.214 0.25 0.348 0.217 0.13 0.304 0.305 0.386 0.159 0.15 0.256 0.231 0.205 0.308 0.281 0.175 0.0965 0.447 0.287 0.313 0.087 0.313 0.254 0.39 0.102 0.254 0.255 0.235 0.176 0.333 0.308 0.115 0.115 0.462 0.371 0.229 0.2 0.2
+
+# dss upstream motif, reading frame 2(reverse)
+[ETMOTIF2]
+# width of motif, n=
+5
+# order of markov model, k=
+2
+# markov chain emission probabilities
+ 0 0.262 0.318 0.185 0.235 0.201 0.163 0.179 0.457 0.268 0.0983 0.166 0.468 0.275 0.211 0.119 0.394 0.264 0.296 0.182 0.258 0.23 0.246 0.175 0.349 0.266 0.0847 0.169 0.48 0.229 0.229 0.102 0.44 0.304 0.259 0.196 0.241 0.217 0.188 0.13 0.464 0.224 0.104 0.112 0.56 0.253 0.286 0.11 0.352 0.26 0.19 0.164 0.387 0.202 0.211 0.167 0.421 0.309 0.139 0.0848 0.467 0.308 0.212 0.14 0.339
+ 1 0.427 0.231 0.331 0.0107 0.266 0.222 0.241 0.271 0.328 0.18 0.467 0.0246 0.299 0.208 0.173 0.32 0.294 0.188 0.25 0.269 0.211 0.172 0.328 0.289 0.226 0.174 0.304 0.296 0.239 0.213 0.17 0.378 0.35 0.271 0.357 0.0214 0.375 0.125 0.281 0.219 0.157 0.114 0.257 0.471 0.327 0.19 0.146 0.337 0.278 0.165 0.362 0.194 0.249 0.208 0.291 0.253 0.354 0.192 0.242 0.212 0.269 0.297 0.19 0.245
+ 2 0.342 0.272 0.168 0.218 0.267 0.233 0.168 0.332 0.364 0.0679 0.16 0.407 0.296 0.268 0.06 0.376 0.31 0.254 0.121 0.315 0.269 0.194 0.211 0.326 0.287 0.0419 0.174 0.497 0.281 0.257 0.112 0.35 0.396 0.236 0.17 0.198 0.258 0.21 0.258 0.274 0.269 0.0968 0.129 0.505 0.309 0.24 0.101 0.35 0.397 0.205 0.137 0.26 0.306 0.21 0.21 0.274 0.32 0.2 0.12 0.36 0.343 0.284 0.104 0.269
+ 3 0.306 0.296 0.169 0.229 0.235 0.186 0.179 0.401 0.257 0.0737 0.149 0.52 0.321 0.321 0.107 0.25 0.379 0.253 0.092 0.276 0.25 0.156 0.141 0.453 0.301 0.133 0.108 0.458 0.373 0.239 0.0746 0.313 0.323 0.242 0.161 0.274 0.225 0.225 0.2 0.35 0.238 0.167 0.143 0.452 0.289 0.244 0.156 0.311 0.282 0.275 0.148 0.296 0.301 0.18 0.173 0.346 0.301 0.108 0.0843 0.506 0.299 0.299 0.115 0.287
+ 4 0.286 0.444 0.246 0.0238 0.2 0.255 0.309 0.236 0.441 0.176 0.294 0.0882 0.25 0.25 0.125 0.375 0.227 0.318 0.318 0.136 0.222 0.278 0.333 0.167 0.333 0.2 0.2 0.267 0.304 0.304 0.174 0.217 0.384 0.376 0.238 0.00181 0.325 0.202 0.254 0.219 0.308 0.197 0.205 0.291 0.314 0.305 0.186 0.195 0.379 0.179 0.307 0.136 0.307 0.193 0.272 0.228 0.261 0.348 0.217 0.174 0.362 0.287 0.212 0.138
+
+
+#
+# Emission probabilities
+#
+[EMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+1.625
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.2357 0.3079 0.2426
+aaaac 0.1899 0.1904 0.1489
+aaaag 0.3562 0.2227 0.2853
+aaaat 0.2183 0.279 0.3232
+aaaca 0.3934 0.3215 0.3518
+aaacc 0.2253 0.2715 0.1734
+aaacg 0.1449 0.1093 0.08374
+aaact 0.2364 0.2977 0.3911
+aaaga 0.3435 0.3838 0.3188
+aaagc 0.2185 0.2052 0.1835
+aaagg 0.2792 0.2085 0.2363
+aaagt 0.1588 0.2025 0.2615
+aaata 0.2127 0.1378 0.196
+aaatc 0.1868 0.3105 0.1595
+aaatg 0.4002 0.1828 0.3188
+aaatt 0.2003 0.3689 0.3257
+aacaa 0.3335 0.4158 0.4296
+aacac 0.1579 0.1482 0.1225
+aacag 0.3113 0.1735 0.2202
+aacat 0.1973 0.2625 0.2277
+aacca 0.4329 0.3559 0.3958
+aaccc 0.2194 0.2486 0.1518
+aaccg 0.1345 0.1148 0.09079
+aacct 0.2132 0.2807 0.3617
+aacga 0.3108 0.3691 0.2891
+aacgc 0.1617 0.1884 0.2064
+aacgg 0.334 0.2153 0.1676
+aacgt 0.1935 0.2272 0.3369
+aacta 0.1976 0.1553 0.2018
+aactc 0.2087 0.2867 0.2088
+aactg 0.3775 0.1394 0.1911
+aactt 0.2162 0.4186 0.3984
+aagaa 0.3648 0.4758 0.3792
+aagac 0.1352 0.1188 0.1081
+aagag 0.2947 0.1916 0.22
+aagat 0.2053 0.2138 0.2927
+aagca 0.41 0.3117 0.3498
+aagcc 0.1968 0.2376 0.1452
+aagcg 0.1162 0.08821 0.0647
+aagct 0.2769 0.3625 0.4403
+aagga 0.3404 0.4589 0.3555
+aaggc 0.2208 0.1916 0.1667
+aaggg 0.2644 0.1548 0.1961
+aaggt 0.1744 0.1947 0.2817
+aagta 0.2339 0.1687 0.2048
+aagtc 0.1642 0.2511 0.1498
+aagtg 0.3648 0.143 0.2436
+aagtt 0.237 0.4372 0.4019
+aataa 0.2718 0.3693 0.001378
+aatac 0.1733 0.1664 0.3532
+aatag 0.2909 0.1775 0.001378
+aatat 0.264 0.2867 0.644
+aatca 0.3745 0.3212 0.3569
+aatcc 0.2346 0.2776 0.1769
+aatcg 0.1563 0.09144 0.0833
+aatct 0.2346 0.3098 0.3829
+aatga 0.2969 0.3313 0.001103
+aatgc 0.1893 0.2 0.2312
+aatgg 0.3504 0.2617 0.4354
+aatgt 0.1633 0.207 0.3323
+aatta 0.2003 0.1345 0.1956
+aattc 0.2351 0.3252 0.1997
+aattg 0.3899 0.1351 0.2928
+aattt 0.1748 0.4052 0.312
+acaaa 0.2974 0.3398 0.2627
+acaac 0.2145 0.2066 0.1989
+acaag 0.3337 0.1895 0.2724
+acaat 0.1544 0.264 0.2659
+acaca 0.4012 0.2864 0.3374
+acacc 0.2167 0.3184 0.1851
+acacg 0.1794 0.08815 0.1075
+acact 0.2027 0.307 0.3699
+acaga 0.3301 0.3484 0.3157
+acagc 0.2509 0.2312 0.2008
+acagg 0.2154 0.1853 0.2138
+acagt 0.2036 0.235 0.2696
+acata 0.2216 0.1428 0.1831
+acatc 0.2194 0.2722 0.1667
+acatg 0.3715 0.1655 0.3101
+acatt 0.1876 0.4195 0.3401
+accaa 0.3361 0.3614 0.3234
+accac 0.1821 0.1867 0.1564
+accag 0.2922 0.1567 0.2247
+accat 0.1896 0.2952 0.2956
+accca 0.361 0.2705 0.3042
+acccc 0.2169 0.2705 0.1477
+acccg 0.2016 0.1199 0.1229
+accct 0.2205 0.3391 0.4251
+accga 0.2362 0.3516 0.2369
+accgc 0.2275 0.1915 0.1973
+accgg 0.3675 0.2542 0.2179
+accgt 0.1688 0.2027 0.3478
+accta 0.2059 0.1597 0.165
+acctc 0.2182 0.305 0.2183
+acctg 0.3431 0.1355 0.1877
+acctt 0.2328 0.3998 0.429
+acgaa 0.2808 0.325 0.2607
+acgac 0.1967 0.191 0.1822
+acgag 0.3345 0.251 0.2799
+acgat 0.188 0.2331 0.2772
+acgca 0.2891 0.2617 0.2547
+acgcc 0.2981 0.3058 0.2615
+acgcg 0.2053 0.1365 0.1534
+acgct 0.2075 0.296 0.3304
+acgga 0.3192 0.3475 0.3032
+acggc 0.2478 0.256 0.2241
+acggg 0.237 0.1811 0.1995
+acggt 0.1959 0.2154 0.2732
+acgta 0.2159 0.1585 0.1773
+acgtc 0.1792 0.3159 0.1859
+acgtg 0.3877 0.1786 0.3227
+acgtt 0.2172 0.347 0.3141
+actaa 0.3078 0.2997 0.001618
+actac 0.1768 0.2253 0.4048
+actag 0.3229 0.2005 0.001618
+actat 0.1925 0.2745 0.592
+actca 0.3796 0.299 0.3018
+actcc 0.2045 0.2914 0.2011
+actcg 0.1535 0.1117 0.1219
+actct 0.2624 0.298 0.3751
+actga 0.3254 0.3269 0.001602
+actgc 0.196 0.2291 0.2677
+actgg 0.3149 0.2299 0.4018
+actgt 0.1636 0.214 0.3289
+actta 0.1731 0.1308 0.16
+acttc 0.2398 0.346 0.2235
+acttg 0.3818 0.1789 0.3277
+acttt 0.2053 0.3442 0.2889
+agaaa 0.3111 0.3764 0.3378
+agaac 0.1349 0.1355 0.12
+agaag 0.3846 0.251 0.318
+agaat 0.1694 0.2371 0.2242
+agaca 0.4072 0.3294 0.3667
+agacc 0.1725 0.2496 0.1587
+agacg 0.1848 0.1155 0.1238
+agact 0.2355 0.3055 0.3508
+agaga 0.3635 0.387 0.3297
+agagc 0.1716 0.2131 0.1634
+agagg 0.301 0.208 0.2692
+agagt 0.164 0.1919 0.2377
+agata 0.2178 0.1375 0.1992
+agatc 0.1594 0.283 0.1571
+agatg 0.4192 0.1749 0.3043
+agatt 0.2036 0.4046 0.3394
+agcaa 0.3203 0.3611 0.3707
+agcac 0.1575 0.161 0.1219
+agcag 0.3394 0.2454 0.307
+agcat 0.1828 0.2325 0.2004
+agcca 0.4719 0.3736 0.4023
+agccc 0.1708 0.2345 0.1414
+agccg 0.1688 0.1273 0.09361
+agcct 0.1886 0.2646 0.3627
+agcga 0.312 0.3772 0.2951
+agcgc 0.1873 0.163 0.1909
+agcgg 0.305 0.2292 0.1986
+agcgt 0.1957 0.2306 0.3154
+agcta 0.2128 0.1341 0.1912
+agctc 0.1927 0.2934 0.1812
+agctg 0.3859 0.1484 0.2343
+agctt 0.2086 0.424 0.3932
+aggaa 0.3559 0.443 0.3347
+aggac 0.1458 0.1197 0.1185
+aggag 0.3187 0.2319 0.2737
+aggat 0.1795 0.2054 0.2731
+aggca 0.3769 0.3177 0.3566
+aggcc 0.2294 0.2705 0.1493
+aggcg 0.1746 0.1073 0.1109
+aggct 0.2191 0.3045 0.3832
+aggga 0.3756 0.4511 0.3513
+agggc 0.1761 0.1737 0.1411
+agggg 0.2631 0.1685 0.1859
+agggt 0.1852 0.2067 0.3217
+aggta 0.1585 0.1369 0.1724
+aggtc 0.1839 0.255 0.1437
+aggtg 0.4011 0.1499 0.2773
+aggtt 0.2565 0.4582 0.4066
+agtaa 0.2998 0.3218 0.001518
+agtac 0.151 0.1903 0.4013
+agtag 0.3541 0.2638 0.001518
+agtat 0.1951 0.2242 0.5956
+agtca 0.4086 0.3209 0.3317
+agtcc 0.2215 0.2833 0.2017
+agtcg 0.1424 0.1231 0.1102
+agtct 0.2274 0.2727 0.3563
+agtga 0.3549 0.3527 0.001773
+agtgc 0.1561 0.1879 0.2167
+agtgg 0.3291 0.2744 0.4273
+agtgt 0.16 0.185 0.3542
+agtta 0.1853 0.1235 0.1814
+agttc 0.2069 0.3002 0.191
+agttg 0.3991 0.163 0.3136
+agttt 0.2088 0.4133 0.314
+ataaa 0.25 0.3373 0.2649
+ataac 0.25 0.1776 0.1654
+ataag 0.25 0.2077 0.2206
+ataat 0.25 0.2775 0.3491
+ataca 0.422 0.2661 0.3368
+atacc 0.1979 0.2831 0.1924
+atacg 0.1384 0.1053 0.07986
+atact 0.2418 0.3455 0.3909
+ataga 0.25 0.3427 0.2874
+atagc 0.25 0.2423 0.1969
+atagg 0.25 0.1876 0.2051
+atagt 0.25 0.2275 0.3107
+atata 0.1957 0.1463 0.1962
+atatc 0.1953 0.2852 0.1723
+atatg 0.4104 0.1699 0.2539
+atatt 0.1986 0.3986 0.3776
+atcaa 0.3508 0.4093 0.3345
+atcac 0.1503 0.168 0.1501
+atcag 0.3047 0.1563 0.2412
+atcat 0.1942 0.2665 0.2742
+atcca 0.4189 0.323 0.3813
+atccc 0.1942 0.2659 0.128
+atccg 0.15 0.1324 0.09224
+atcct 0.2369 0.2787 0.3984
+atcga 0.3009 0.3773 0.2722
+atcgc 0.1763 0.1931 0.2097
+atcgg 0.278 0.219 0.1823
+atcgt 0.2449 0.2107 0.3357
+atcta 0.1778 0.137 0.1491
+atctc 0.2098 0.3152 0.2206
+atctg 0.3688 0.115 0.1752
+atctt 0.2436 0.4329 0.455
+atgaa 0.25 0.3851 0.3251
+atgac 0.25 0.1505 0.1384
+atgag 0.25 0.2005 0.2156
+atgat 0.25 0.2639 0.3209
+atgca 0.4548 0.3371 0.342
+atgcc 0.1901 0.2499 0.1521
+atgcg 0.1239 0.08893 0.06967
+atgct 0.2312 0.3241 0.4362
+atgga 0.338 0.389 0.3442
+atggc 0.1903 0.22 0.1636
+atggg 0.2947 0.1725 0.1752
+atggt 0.177 0.2185 0.317
+atgta 0.2027 0.1677 0.1849
+atgtc 0.1579 0.2665 0.1621
+atgtg 0.4287 0.1558 0.2506
+atgtt 0.2106 0.41 0.4024
+attaa 0.264 0.3379 0.001039
+attac 0.186 0.191 0.3877
+attag 0.3396 0.1903 0.001039
+attat 0.2104 0.2808 0.6102
+attca 0.3732 0.2914 0.3307
+attcc 0.1906 0.2933 0.183
+attcg 0.1566 0.1031 0.08804
+attct 0.2795 0.3122 0.3983
+attga 0.3012 0.3598 0.0009722
+attgc 0.1987 0.2152 0.2313
+attgg 0.3308 0.2145 0.4048
+attgt 0.1694 0.2104 0.3629
+attta 0.178 0.1247 0.1813
+atttc 0.196 0.3429 0.2217
+atttg 0.4055 0.1578 0.2885
+atttt 0.2205 0.3746 0.3085
+caaaa 0.2876 0.3722 0.2862
+caaac 0.1504 0.1644 0.1444
+caaag 0.3482 0.2036 0.263
+caaat 0.2138 0.2598 0.3064
+caaca 0.4502 0.3975 0.3701
+caacc 0.18 0.2167 0.1421
+caacg 0.1427 0.09312 0.08558
+caact 0.2272 0.2926 0.4022
+caaga 0.3577 0.3872 0.3467
+caagc 0.1778 0.2104 0.1695
+caagg 0.2551 0.1946 0.1938
+caagt 0.2094 0.2078 0.2899
+caata 0.2159 0.1394 0.1982
+caatc 0.1802 0.2791 0.1424
+caatg 0.3763 0.1669 0.2901
+caatt 0.2276 0.4145 0.3694
+cacaa 0.3591 0.4031 0.4139
+cacac 0.1361 0.1534 0.0958
+cacag 0.2968 0.1824 0.224
+cacat 0.2079 0.2611 0.2663
+cacca 0.4556 0.4247 0.4544
+caccc 0.1634 0.2036 0.1032
+caccg 0.1753 0.1329 0.09084
+cacct 0.2057 0.2389 0.3515
+cacga 0.3262 0.3916 0.2759
+cacgc 0.156 0.1781 0.1659
+cacgg 0.2904 0.2188 0.2037
+cacgt 0.2274 0.2115 0.3545
+cacta 0.2103 0.1672 0.1835
+cactc 0.1766 0.2553 0.1765
+cactg 0.3809 0.198 0.2094
+cactt 0.2323 0.3794 0.4306
+cagaa 0.3408 0.4228 0.3541
+cagac 0.1214 0.125 0.09974
+cagag 0.346 0.2133 0.2413
+cagat 0.1918 0.2389 0.305
+cagca 0.4295 0.3911 0.374
+cagcc 0.188 0.2154 0.1424
+cagcg 0.1269 0.07723 0.0699
+cagct 0.2556 0.3163 0.4136
+cagga 0.3382 0.4018 0.3671
+caggc 0.2176 0.2232 0.1491
+caggg 0.2815 0.1822 0.2138
+caggt 0.1627 0.1929 0.27
+cagta 0.2332 0.1627 0.2118
+cagtc 0.1596 0.2385 0.1244
+cagtg 0.3848 0.1567 0.2586
+cagtt 0.2224 0.4421 0.4052
+cataa 0.3136 0.3509 0.001525
+catac 0.1668 0.1476 0.3197
+catag 0.2897 0.2113 0.001525
+catat 0.2299 0.2902 0.6773
+catca 0.3935 0.3601 0.388
+catcc 0.1921 0.2501 0.1424
+catcg 0.1598 0.113 0.09841
+catct 0.2545 0.2767 0.3712
+catga 0.3041 0.3315 0.001264
+catgc 0.1703 0.1961 0.2129
+catgg 0.3288 0.2459 0.4595
+catgt 0.1968 0.2265 0.3264
+catta 0.1786 0.1404 0.1833
+cattc 0.1979 0.2744 0.1732
+cattg 0.3953 0.1598 0.2775
+cattt 0.2281 0.4255 0.366
+ccaaa 0.3205 0.3801 0.31
+ccaac 0.1912 0.1916 0.1656
+ccaag 0.3185 0.1988 0.2508
+ccaat 0.1697 0.2294 0.2736
+ccaca 0.3507 0.2854 0.2916
+ccacc 0.2743 0.3829 0.2373
+ccacg 0.1576 0.08433 0.09679
+ccact 0.2175 0.2474 0.3744
+ccaga 0.3583 0.372 0.2791
+ccagc 0.2372 0.2358 0.2339
+ccagg 0.2113 0.1614 0.1758
+ccagt 0.1932 0.2308 0.3112
+ccata 0.1845 0.1238 0.1962
+ccatc 0.2184 0.3326 0.1641
+ccatg 0.3558 0.1402 0.2608
+ccatt 0.2412 0.4035 0.3789
+cccaa 0.3382 0.4132 0.3646
+cccac 0.2018 0.1747 0.1508
+cccag 0.2354 0.1389 0.2028
+cccat 0.2247 0.2733 0.2818
+cccca 0.4374 0.3484 0.3346
+ccccc 0.1409 0.2447 0.09963
+ccccg 0.2268 0.1097 0.112
+cccct 0.1948 0.2973 0.4538
+cccga 0.3452 0.4177 0.3036
+cccgc 0.1873 0.1324 0.1871
+cccgg 0.2663 0.2369 0.2003
+cccgt 0.2012 0.213 0.3089
+cccta 0.2113 0.1211 0.142
+ccctc 0.2076 0.3014 0.2338
+ccctg 0.3197 0.1323 0.1538
+ccctt 0.2613 0.4453 0.4704
+ccgaa 0.3319 0.3845 0.2315
+ccgac 0.1566 0.1647 0.1876
+ccgag 0.327 0.2302 0.2583
+ccgat 0.1845 0.2206 0.3226
+ccgca 0.2834 0.213 0.2136
+ccgcc 0.3294 0.4559 0.34
+ccgcg 0.1685 0.09612 0.1139
+ccgct 0.2187 0.2349 0.3325
+ccgga 0.3122 0.3854 0.3079
+ccggc 0.2583 0.2544 0.2371
+ccggg 0.1775 0.1376 0.1387
+ccggt 0.2521 0.2226 0.3163
+ccgta 0.2176 0.1041 0.1384
+ccgtc 0.2038 0.3267 0.2373
+ccgtg 0.3625 0.149 0.232
+ccgtt 0.2162 0.4203 0.3923
+cctaa 0.344 0.3487 0.00278
+cctac 0.1947 0.2001 0.4065
+cctag 0.2753 0.211 0.00278
+cctat 0.186 0.2401 0.5879
+cctca 0.3427 0.2818 0.3005
+cctcc 0.2228 0.3381 0.2292
+cctcg 0.1786 0.1129 0.09558
+cctct 0.2559 0.2672 0.3747
+cctga 0.3267 0.3776 0.003183
+cctgc 0.2146 0.2033 0.2931
+cctgg 0.2735 0.2014 0.3264
+cctgt 0.1852 0.2177 0.3773
+cctta 0.1999 0.1326 0.2016
+ccttc 0.2297 0.3615 0.2346
+ccttg 0.3504 0.1301 0.2563
+ccttt 0.22 0.3758 0.3075
+cgaaa 0.2971 0.3728 0.2931
+cgaac 0.1628 0.1825 0.1423
+cgaag 0.3621 0.2154 0.284
+cgaat 0.178 0.2293 0.2807
+cgaca 0.3012 0.2822 0.2719
+cgacc 0.1586 0.238 0.1447
+cgacg 0.3328 0.1725 0.2405
+cgact 0.2074 0.3073 0.3429
+cgaga 0.3237 0.3231 0.2656
+cgagc 0.1985 0.2205 0.2033
+cgagg 0.2842 0.2298 0.2431
+cgagt 0.1937 0.2267 0.2881
+cgata 0.1956 0.167 0.1994
+cgatc 0.1765 0.2893 0.1647
+cgatg 0.4267 0.1618 0.3323
+cgatt 0.2012 0.3819 0.3036
+cgcaa 0.3544 0.4095 0.3246
+cgcac 0.1433 0.1312 0.1339
+cgcag 0.3153 0.1947 0.2769
+cgcat 0.1871 0.2646 0.2645
+cgcca 0.3422 0.3228 0.3279
+cgccc 0.1212 0.1721 0.1024
+cgccg 0.3658 0.2229 0.287
+cgcct 0.1709 0.2822 0.2828
+cgcga 0.318 0.3704 0.2991
+cgcgc 0.1682 0.1907 0.1822
+cgcgg 0.3124 0.2243 0.2156
+cgcgt 0.2015 0.2147 0.3032
+cgcta 0.1878 0.1486 0.1653
+cgctc 0.1844 0.2687 0.191
+cgctg 0.408 0.1804 0.2782
+cgctt 0.2198 0.4023 0.3655
+cggaa 0.3299 0.3792 0.2301
+cggac 0.129 0.1309 0.1358
+cggag 0.3318 0.2348 0.338
+cggat 0.2093 0.2551 0.2961
+cggca 0.2697 0.2728 0.2558
+cggcc 0.1631 0.2899 0.1556
+cggcg 0.3838 0.1417 0.278
+cggct 0.1834 0.2956 0.3106
+cggga 0.3574 0.3472 0.2652
+cgggc 0.1548 0.2387 0.1714
+cgggg 0.2386 0.1393 0.2357
+cgggt 0.2491 0.2749 0.3278
+cggta 0.1883 0.1251 0.1665
+cggtc 0.1669 0.2534 0.122
+cggtg 0.427 0.1589 0.3307
+cggtt 0.2179 0.4626 0.3808
+cgtaa 0.2768 0.3335 0.005302
+cgtac 0.1792 0.1923 0.4229
+cgtag 0.3246 0.2099 0.005302
+cgtat 0.2194 0.2643 0.5665
+cgtca 0.3016 0.2575 0.3007
+cgtcc 0.1797 0.2738 0.1539
+cgtcg 0.303 0.1624 0.2372
+cgtct 0.2157 0.3063 0.3082
+cgtga 0.2964 0.3567 0.00441
+cgtgc 0.1944 0.2072 0.1944
+cgtgg 0.3331 0.2297 0.4495
+cgtgt 0.1761 0.2064 0.3518
+cgtta 0.2173 0.1373 0.2049
+cgttc 0.1838 0.2683 0.183
+cgttg 0.3919 0.1759 0.3206
+cgttt 0.207 0.4185 0.2914
+ctaaa 0.25 0.3385 0.3028
+ctaac 0.25 0.1612 0.1387
+ctaag 0.25 0.2456 0.2305
+ctaat 0.25 0.2547 0.328
+ctaca 0.3935 0.3026 0.326
+ctacc 0.161 0.2544 0.15
+ctacg 0.1784 0.1157 0.07445
+ctact 0.267 0.3272 0.4495
+ctaga 0.25 0.3628 0.2789
+ctagc 0.25 0.2392 0.1962
+ctagg 0.25 0.1872 0.1866
+ctagt 0.25 0.2108 0.3383
+ctata 0.2001 0.1358 0.2
+ctatc 0.1633 0.3083 0.1558
+ctatg 0.4518 0.1712 0.2618
+ctatt 0.1848 0.3846 0.3823
+ctcaa 0.3822 0.4141 0.3714
+ctcac 0.1375 0.1554 0.1274
+ctcag 0.2663 0.1583 0.2303
+ctcat 0.214 0.2722 0.2709
+ctcca 0.4136 0.3215 0.3529
+ctccc 0.1536 0.2127 0.1186
+ctccg 0.2084 0.1481 0.1058
+ctcct 0.2244 0.3177 0.4228
+ctcga 0.2966 0.3655 0.2851
+ctcgc 0.1713 0.1712 0.1718
+ctcgg 0.2791 0.1784 0.2008
+ctcgt 0.2529 0.2849 0.3422
+ctcta 0.2085 0.1278 0.1773
+ctctc 0.2121 0.3228 0.2061
+ctctg 0.337 0.1392 0.181
+ctctt 0.2424 0.4102 0.4356
+ctgaa 0.25 0.4476 0.3198
+ctgac 0.25 0.1213 0.1049
+ctgag 0.25 0.2042 0.2115
+ctgat 0.25 0.2269 0.3638
+ctgca 0.4168 0.3563 0.3398
+ctgcc 0.2044 0.2287 0.1362
+ctgcg 0.1128 0.09224 0.05338
+ctgct 0.2659 0.3228 0.4706
+ctgga 0.3119 0.4162 0.3387
+ctggc 0.1699 0.2098 0.1461
+ctggg 0.3128 0.1589 0.1432
+ctggt 0.2054 0.2151 0.372
+ctgta 0.2262 0.1335 0.1722
+ctgtc 0.1678 0.2779 0.1675
+ctgtg 0.397 0.1604 0.2135
+ctgtt 0.2091 0.4281 0.4468
+cttaa 0.307 0.3451 0.001202
+cttac 0.1475 0.1798 0.3645
+cttag 0.3221 0.2015 0.001202
+cttat 0.2234 0.2737 0.6331
+cttca 0.3893 0.3206 0.3436
+cttcc 0.1962 0.261 0.155
+cttcg 0.1258 0.1012 0.06684
+cttct 0.2888 0.3172 0.4345
+cttga 0.3243 0.362 0.0009893
+cttgc 0.1838 0.1971 0.2244
+cttgg 0.2925 0.2225 0.3395
+cttgt 0.1994 0.2184 0.4351
+cttta 0.198 0.1367 0.2083
+ctttc 0.1649 0.3274 0.1969
+ctttg 0.4304 0.1548 0.2935
+ctttt 0.2067 0.3811 0.3013
+gaaaa 0.3272 0.3665 0.2942
+gaaac 0.1811 0.1633 0.1482
+gaaag 0.3088 0.1911 0.2407
+gaaat 0.1829 0.2791 0.317
+gaaca 0.4144 0.3436 0.3492
+gaacc 0.2053 0.2353 0.1622
+gaacg 0.1396 0.08815 0.09128
+gaact 0.2407 0.333 0.3973
+gaaga 0.3895 0.4305 0.3336
+gaagc 0.2069 0.2187 0.182
+gaagg 0.2447 0.1671 0.2052
+gaagt 0.1588 0.1838 0.2792
+gaata 0.2256 0.1394 0.2057
+gaatc 0.1729 0.2724 0.1583
+gaatg 0.3748 0.166 0.2774
+gaatt 0.2267 0.4222 0.3586
+gacaa 0.3213 0.3875 0.4051
+gacac 0.1633 0.1599 0.1318
+gacag 0.2964 0.1596 0.2174
+gacat 0.2191 0.293 0.2457
+gacca 0.4395 0.3167 0.4065
+gaccc 0.1996 0.2617 0.1602
+gaccg 0.165 0.1166 0.0983
+gacct 0.1958 0.305 0.3351
+gacga 0.3266 0.4677 0.2886
+gacgc 0.1534 0.1457 0.1747
+gacgg 0.3266 0.199 0.2174
+gacgt 0.1934 0.1877 0.3194
+gacta 0.2305 0.1574 0.2087
+gactc 0.1999 0.2616 0.1754
+gactg 0.3537 0.1623 0.1754
+gactt 0.216 0.4187 0.4405
+gagaa 0.3792 0.45 0.3422
+gagac 0.1393 0.1204 0.1323
+gagag 0.2948 0.1878 0.1985
+gagat 0.1867 0.2418 0.327
+gagca 0.3978 0.3223 0.3735
+gagcc 0.1833 0.1995 0.1345
+gagcg 0.135 0.08057 0.07221
+gagct 0.2838 0.3976 0.4198
+gagga 0.3883 0.4991 0.41
+gaggc 0.1776 0.1975 0.1568
+gaggg 0.2548 0.125 0.168
+gaggt 0.1792 0.1784 0.2652
+gagta 0.2448 0.1626 0.2194
+gagtc 0.1587 0.2386 0.1331
+gagtg 0.3474 0.1279 0.2257
+gagtt 0.2492 0.4709 0.4219
+gataa 0.3058 0.3384 0.002343
+gatac 0.1644 0.1502 0.3138
+gatag 0.2507 0.1744 0.002343
+gatat 0.2791 0.337 0.6815
+gatca 0.4142 0.3244 0.4018
+gatcc 0.1898 0.2765 0.166
+gatcg 0.1831 0.09854 0.08448
+gatct 0.2129 0.3006 0.3477
+gatga 0.3492 0.4092 0.002218
+gatgc 0.1894 0.1901 0.1947
+gatgg 0.3006 0.1985 0.4596
+gatgt 0.1608 0.2021 0.3435
+gatta 0.205 0.1395 0.1774
+gattc 0.1968 0.2783 0.1758
+gattg 0.3801 0.1507 0.2782
+gattt 0.2181 0.4315 0.3686
+gcaaa 0.3193 0.3571 0.3013
+gcaac 0.194 0.1776 0.1659
+gcaag 0.3135 0.1783 0.275
+gcaat 0.1732 0.287 0.2578
+gcaca 0.3632 0.2743 0.3182
+gcacc 0.237 0.2646 0.2136
+gcacg 0.1776 0.1044 0.0968
+gcact 0.2222 0.3568 0.3714
+gcaga 0.3119 0.3408 0.25
+gcagc 0.3067 0.2933 0.2734
+gcagg 0.1999 0.1409 0.1583
+gcagt 0.1816 0.225 0.3183
+gcata 0.2137 0.1309 0.2012
+gcatc 0.1995 0.2886 0.1496
+gcatg 0.3545 0.1421 0.2988
+gcatt 0.2323 0.4385 0.3504
+gccaa 0.3353 0.3745 0.3479
+gccac 0.1984 0.1914 0.1653
+gccag 0.2552 0.1334 0.1948
+gccat 0.211 0.3007 0.292
+gccca 0.3997 0.2781 0.3187
+gcccc 0.1645 0.2312 0.1819
+gcccg 0.2179 0.135 0.0829
+gccct 0.2179 0.3557 0.4164
+gccga 0.2533 0.2904 0.2517
+gccgc 0.2049 0.2232 0.2085
+gccgg 0.3399 0.2396 0.2137
+gccgt 0.2019 0.2468 0.3261
+gccta 0.2347 0.1567 0.1772
+gcctc 0.2264 0.2835 0.2192
+gcctg 0.3125 0.1389 0.1743
+gcctt 0.2264 0.4209 0.4292
+gcgaa 0.33 0.3635 0.2685
+gcgac 0.1691 0.165 0.1796
+gcgag 0.3139 0.1947 0.2406
+gcgat 0.187 0.2768 0.3113
+gcgca 0.3617 0.258 0.2544
+gcgcc 0.2303 0.2681 0.2587
+gcgcg 0.2198 0.1377 0.1279
+gcgct 0.1882 0.3363 0.3591
+gcgga 0.3353 0.3693 0.2814
+gcggc 0.2851 0.2969 0.2661
+gcggg 0.1597 0.1488 0.1488
+gcggt 0.2199 0.185 0.3037
+gcgta 0.2061 0.1333 0.1695
+gcgtc 0.2419 0.2725 0.2246
+gcgtg 0.346 0.1333 0.2362
+gcgtt 0.2061 0.461 0.3697
+gctaa 0.316 0.3404 0.002399
+gctac 0.177 0.1917 0.3744
+gctag 0.3116 0.1866 0.002399
+gctat 0.1954 0.2814 0.6208
+gctca 0.3773 0.307 0.304
+gctcc 0.1761 0.2382 0.2001
+gctcg 0.1897 0.1371 0.1185
+gctct 0.257 0.3177 0.3774
+gctga 0.3248 0.3092 0.002268
+gctgc 0.2224 0.2798 0.3191
+gctgg 0.289 0.2051 0.3149
+gctgt 0.1638 0.2059 0.3637
+gctta 0.1959 0.1368 0.1984
+gcttc 0.2535 0.3385 0.2181
+gcttg 0.3427 0.1603 0.2847
+gcttt 0.2078 0.3644 0.2988
+ggaaa 0.3197 0.3602 0.3328
+ggaac 0.1446 0.1689 0.1236
+ggaag 0.3787 0.2326 0.2825
+ggaat 0.1571 0.2383 0.261
+ggaca 0.3763 0.3263 0.3701
+ggacc 0.1735 0.2459 0.1395
+ggacg 0.2085 0.1125 0.1019
+ggact 0.2417 0.3153 0.3884
+ggaga 0.3787 0.3543 0.3253
+ggagc 0.1928 0.1992 0.1759
+ggagg 0.2669 0.2337 0.2589
+ggagt 0.1616 0.2128 0.2398
+ggata 0.2441 0.1581 0.2045
+ggatc 0.1634 0.2555 0.1499
+ggatg 0.3801 0.1477 0.2955
+ggatt 0.2124 0.4388 0.3501
+ggcaa 0.3209 0.365 0.3457
+ggcac 0.1689 0.1591 0.125
+ggcag 0.2922 0.1962 0.2525
+ggcat 0.218 0.2798 0.2768
+ggcca 0.413 0.3664 0.4138
+ggccc 0.1935 0.1733 0.1041
+ggccg 0.1914 0.1592 0.1138
+ggcct 0.2021 0.3011 0.3683
+ggcga 0.3118 0.3202 0.2971
+ggcgc 0.1591 0.16 0.1963
+ggcgg 0.3244 0.3229 0.2029
+ggcgt 0.2047 0.1969 0.3037
+ggcta 0.2261 0.1897 0.2296
+ggctc 0.1883 0.2545 0.1643
+ggctg 0.3783 0.1633 0.1948
+ggctt 0.2074 0.3925 0.4113
+gggaa 0.3748 0.4492 0.3135
+gggac 0.1485 0.1421 0.1423
+gggag 0.2793 0.1641 0.2237
+gggat 0.1974 0.2445 0.3206
+gggca 0.3522 0.3453 0.367
+gggcc 0.1915 0.1985 0.123
+gggcg 0.1798 0.111 0.1079
+gggct 0.2765 0.3453 0.4021
+gggga 0.421 0.4174 0.3633
+ggggc 0.1802 0.1751 0.1559
+ggggg 0.1824 0.153 0.1163
+ggggt 0.2163 0.2545 0.3644
+gggta 0.2232 0.1623 0.1976
+gggtc 0.1847 0.2289 0.1311
+gggtg 0.351 0.1205 0.2585
+gggtt 0.2412 0.4883 0.4128
+ggtaa 0.2974 0.3221 0.002833
+ggtac 0.1788 0.1769 0.4161
+ggtag 0.3242 0.2233 0.002833
+ggtat 0.1996 0.2777 0.5782
+ggtca 0.3964 0.3314 0.3452
+ggtcc 0.2246 0.2547 0.1927
+ggtcg 0.1635 0.1325 0.1096
+ggtct 0.2155 0.2814 0.3525
+ggtga 0.3162 0.3082 0.002475
+ggtgc 0.1565 0.1943 0.2127
+ggtgg 0.362 0.3025 0.4655
+ggtgt 0.1653 0.195 0.3193
+ggtta 0.1995 0.1539 0.1911
+ggttc 0.209 0.3132 0.1977
+ggttg 0.3733 0.1595 0.2815
+ggttt 0.2181 0.3733 0.3297
+gtaaa 0.25 0.3823 0.3283
+gtaac 0.25 0.19 0.1722
+gtaag 0.25 0.1493 0.1952
+gtaat 0.25 0.2784 0.3043
+gtaca 0.4226 0.3067 0.3444
+gtacc 0.2119 0.2956 0.1556
+gtacg 0.1486 0.09371 0.08456
+gtact 0.2169 0.3039 0.4154
+gtaga 0.25 0.3559 0.2741
+gtagc 0.25 0.265 0.231
+gtagg 0.25 0.165 0.1722
+gtagt 0.25 0.2141 0.3227
+gtata 0.2367 0.14 0.2096
+gtatc 0.1822 0.3124 0.1639
+gtatg 0.3759 0.1445 0.2449
+gtatt 0.2052 0.4032 0.3816
+gtcaa 0.3561 0.4018 0.3301
+gtcac 0.1718 0.1861 0.1475
+gtcag 0.2349 0.1256 0.2213
+gtcat 0.2372 0.2866 0.3011
+gtcca 0.4229 0.3002 0.4027
+gtccc 0.176 0.2618 0.1116
+gtccg 0.192 0.1159 0.09575
+gtcct 0.2091 0.3221 0.3899
+gtcga 0.316 0.3555 0.2818
+gtcgc 0.166 0.1965 0.194
+gtcgg 0.2365 0.2181 0.2116
+gtcgt 0.2815 0.23 0.3125
+gtcta 0.2124 0.1758 0.179
+gtctc 0.2141 0.3221 0.2212
+gtctg 0.3216 0.1295 0.1699
+gtctt 0.2519 0.3726 0.43
+gtgaa 0.25 0.4227 0.3296
+gtgac 0.25 0.1638 0.146
+gtgag 0.25 0.177 0.1618
+gtgat 0.25 0.2365 0.3626
+gtgca 0.4405 0.3237 0.3263
+gtgcc 0.2017 0.2722 0.1511
+gtgcg 0.1226 0.07839 0.05087
+gtgct 0.2352 0.3258 0.4717
+gtgga 0.3569 0.3998 0.3367
+gtggc 0.1935 0.2265 0.1796
+gtggg 0.2584 0.1353 0.1512
+gtggt 0.1912 0.2384 0.3325
+gtgta 0.2226 0.1751 0.2006
+gtgtc 0.1741 0.2345 0.1538
+gtgtg 0.3672 0.1288 0.2159
+gtgtt 0.2361 0.4616 0.4297
+gttaa 0.2985 0.3389 0.001763
+gttac 0.1859 0.1928 0.3566
+gttag 0.3083 0.1867 0.001763
+gttat 0.2073 0.2817 0.6399
+gttca 0.382 0.3143 0.3616
+gttcc 0.1776 0.2664 0.157
+gttcg 0.1412 0.1148 0.089
+gttct 0.2992 0.3045 0.3924
+gttga 0.343 0.3558 0.001449
+gttgc 0.1821 0.2156 0.2458
+gttgg 0.3134 0.2077 0.3421
+gttgt 0.1615 0.2208 0.4107
+gttta 0.2029 0.1465 0.1999
+gtttc 0.2062 0.3346 0.1987
+gtttg 0.3851 0.1621 0.29
+gtttt 0.2058 0.3568 0.3113
+taaaa 0.2874 0.3476 0.2979
+taaac 0.1643 0.1729 0.1501
+taaag 0.3754 0.2051 0.2701
+taaat 0.1729 0.2744 0.2819
+taaca 0.4268 0.3505 0.4208
+taacc 0.2029 0.2435 0.1671
+taacg 0.1376 0.09753 0.08737
+taact 0.2327 0.3085 0.3247
+taaga 0.3132 0.4048 0.2968
+taagc 0.2152 0.2122 0.1807
+taagg 0.3038 0.1874 0.2604
+taagt 0.1677 0.1956 0.2621
+taata 0.239 0.1389 0.1927
+taatc 0.1791 0.289 0.1602
+taatg 0.3641 0.1729 0.3003
+taatt 0.2179 0.3993 0.3468
+tacaa 0.3389 0.4044 0.3989
+tacac 0.1606 0.1631 0.1269
+tacag 0.2767 0.1835 0.2201
+tacat 0.2238 0.2491 0.2541
+tacca 0.4096 0.3394 0.4006
+taccc 0.2084 0.2318 0.1397
+taccg 0.1645 0.1117 0.0874
+tacct 0.2175 0.3171 0.3723
+tacga 0.2736 0.3864 0.3205
+tacgc 0.1756 0.1697 0.1916
+tacgg 0.2896 0.2219 0.2141
+tacgt 0.2611 0.2219 0.2738
+tacta 0.2329 0.1625 0.2296
+tactc 0.1875 0.2463 0.1583
+tactg 0.3636 0.1632 0.2082
+tactt 0.216 0.428 0.4039
+tagaa 0.3273 0.4558 0.3185
+tagac 0.1382 0.1207 0.1404
+tagag 0.355 0.1943 0.2397
+tagat 0.1795 0.2293 0.3014
+tagca 0.4414 0.3349 0.3653
+tagcc 0.191 0.2194 0.1519
+tagcg 0.1029 0.08306 0.06612
+tagct 0.2646 0.3627 0.4166
+tagga 0.352 0.4661 0.357
+taggc 0.2565 0.1992 0.1588
+taggg 0.2227 0.147 0.1916
+taggt 0.1688 0.1878 0.2926
+tagta 0.264 0.1653 0.2393
+tagtc 0.1676 0.2438 0.1579
+tagtg 0.3555 0.1408 0.2329
+tagtt 0.2129 0.4501 0.3699
+tataa 0.3085 0.3306 0.001976
+tatac 0.1948 0.1699 0.3764
+tatag 0.2748 0.2145 0.001976
+tatat 0.2219 0.285 0.6196
+tatca 0.3958 0.2939 0.383
+tatcc 0.2147 0.2682 0.1581
+tatcg 0.1516 0.1228 0.09884
+tatct 0.238 0.3151 0.3601
+tatga 0.2976 0.3231 0.001611
+tatgc 0.1936 0.2232 0.2436
+tatgg 0.3345 0.2465 0.3963
+tatgt 0.1743 0.2071 0.3586
+tatta 0.2041 0.1565 0.1731
+tattc 0.2046 0.2833 0.2041
+tattg 0.3943 0.1703 0.2606
+tattt 0.197 0.3899 0.3623
+tcaaa 0.2854 0.3375 0.2824
+tcaac 0.1875 0.2008 0.1836
+tcaag 0.3502 0.2216 0.2769
+tcaat 0.1768 0.2402 0.2572
+tcaca 0.375 0.2848 0.2986
+tcacc 0.2262 0.3025 0.2008
+tcacg 0.1544 0.09128 0.09004
+tcact 0.2445 0.3214 0.4105
+tcaga 0.333 0.3451 0.2814
+tcagc 0.2381 0.2532 0.2177
+tcagg 0.2203 0.1717 0.1742
+tcagt 0.2086 0.23 0.3267
+tcata 0.2055 0.09672 0.1824
+tcatc 0.2404 0.4056 0.2288
+tcatg 0.3365 0.1447 0.2654
+tcatt 0.2177 0.353 0.3234
+tccaa 0.3422 0.3772 0.3396
+tccac 0.1805 0.19 0.1708
+tccag 0.2738 0.153 0.2177
+tccat 0.2035 0.2799 0.2719
+tccca 0.3777 0.3081 0.3377
+tcccc 0.197 0.2686 0.1285
+tcccg 0.1953 0.07584 0.07812
+tccct 0.23 0.3475 0.4557
+tccga 0.2803 0.3783 0.2852
+tccgc 0.2051 0.2029 0.2258
+tccgg 0.2959 0.2298 0.2065
+tccgt 0.2187 0.189 0.2824
+tccta 0.2177 0.1183 0.1738
+tcctc 0.2444 0.4205 0.2889
+tcctg 0.3127 0.09194 0.1321
+tcctt 0.2251 0.3692 0.4051
+tcgaa 0.3144 0.3503 0.2453
+tcgac 0.1724 0.1868 0.2041
+tcgag 0.3118 0.2176 0.2724
+tcgat 0.2013 0.2453 0.2782
+tcgca 0.2796 0.2304 0.2487
+tcgcc 0.2822 0.3602 0.2883
+tcgcg 0.2112 0.1131 0.1439
+tcgct 0.227 0.2962 0.319
+tcgga 0.3436 0.3561 0.3179
+tcggc 0.2289 0.2035 0.2179
+tcggg 0.2381 0.2142 0.1849
+tcggt 0.1894 0.2261 0.2793
+tcgta 0.2049 0.1145 0.1527
+tcgtc 0.2208 0.3823 0.2386
+tcgtg 0.3752 0.1461 0.2544
+tcgtt 0.1991 0.3571 0.3542
+tctaa 0.3044 0.3315 0.001659
+tctac 0.1882 0.2182 0.4356
+tctag 0.2972 0.199 0.001659
+tctat 0.2101 0.2513 0.5611
+tctca 0.3884 0.2933 0.2833
+tctcc 0.2192 0.3015 0.241
+tctcg 0.1179 0.09261 0.09121
+tctct 0.2745 0.3126 0.3845
+tctga 0.3159 0.3271 0.001775
+tctgc 0.2184 0.2337 0.3065
+tctgg 0.2728 0.2296 0.3349
+tctgt 0.1928 0.2095 0.3568
+tctta 0.1755 0.09798 0.1382
+tcttc 0.2483 0.4366 0.262
+tcttg 0.3836 0.1343 0.2883
+tcttt 0.1925 0.3311 0.3116
+tgaaa 0.289 0.368 0.2971
+tgaac 0.1468 0.1571 0.1279
+tgaag 0.3957 0.238 0.3215
+tgaat 0.1685 0.2368 0.2535
+tgaca 0.3939 0.3206 0.3601
+tgacc 0.2065 0.2461 0.155
+tgacg 0.1664 0.123 0.1206
+tgact 0.2331 0.3104 0.3643
+tgaga 0.3561 0.363 0.3167
+tgagc 0.1868 0.2074 0.1726
+tgagg 0.2975 0.2232 0.2608
+tgagt 0.1596 0.2064 0.2499
+tgata 0.2218 0.1513 0.201
+tgatc 0.1891 0.2705 0.1551
+tgatg 0.3984 0.1602 0.3023
+tgatt 0.1907 0.418 0.3416
+tgcaa 0.3235 0.3854 0.3523
+tgcac 0.1559 0.158 0.1139
+tgcag 0.3173 0.1917 0.2793
+tgcat 0.2032 0.2649 0.2545
+tgcca 0.4101 0.3204 0.3896
+tgccc 0.1753 0.25 0.09939
+tgccg 0.178 0.1462 0.108
+tgcct 0.2365 0.2834 0.403
+tgcga 0.2929 0.3322 0.27
+tgcgc 0.1847 0.188 0.2012
+tgcgg 0.3275 0.2155 0.2028
+tgcgt 0.1948 0.2643 0.3261
+tgcta 0.2041 0.1438 0.1789
+tgctc 0.1756 0.2841 0.1747
+tgctg 0.4144 0.1814 0.2294
+tgctt 0.2059 0.3907 0.417
+tggaa 0.3435 0.3826 0.2926
+tggac 0.14 0.1541 0.1358
+tggag 0.3266 0.2198 0.2708
+tggat 0.1899 0.2436 0.3009
+tggca 0.3792 0.2908 0.3348
+tggcc 0.2061 0.2504 0.1407
+tggcg 0.1628 0.09981 0.1125
+tggct 0.252 0.359 0.412
+tggga 0.3893 0.3755 0.3686
+tgggc 0.1585 0.2049 0.15
+tgggg 0.2707 0.2018 0.1897
+tgggt 0.1814 0.2178 0.2916
+tggta 0.1944 0.1374 0.1694
+tggtc 0.1616 0.2346 0.1332
+tggtg 0.4104 0.2129 0.3049
+tggtt 0.2335 0.4151 0.3924
+tgtaa 0.2995 0.3492 0.001532
+tgtac 0.1777 0.1939 0.3995
+tgtag 0.3074 0.2289 0.001532
+tgtat 0.2154 0.2281 0.5975
+tgtca 0.4049 0.2856 0.3786
+tgtcc 0.2137 0.2637 0.1738
+tgtcg 0.152 0.1511 0.1119
+tgtct 0.2293 0.2996 0.3356
+tgtga 0.3348 0.3244 0.001662
+tgtgc 0.1601 0.2038 0.2564
+tgtgg 0.3334 0.2758 0.4262
+tgtgt 0.1718 0.196 0.3157
+tgtta 0.212 0.1339 0.1864
+tgttc 0.189 0.2943 0.1803
+tgttg 0.3954 0.1949 0.3148
+tgttt 0.2036 0.3769 0.3185
+ttaaa 0.25 0.3207 0.2789
+ttaac 0.25 0.2013 0.1781
+ttaag 0.25 0.2325 0.2598
+ttaat 0.25 0.2456 0.2833
+ttaca 0.4001 0.3045 0.3229
+ttacc 0.195 0.2909 0.1788
+ttacg 0.1388 0.111 0.08046
+ttact 0.266 0.2936 0.4178
+ttaga 0.25 0.3265 0.2932
+ttagc 0.25 0.271 0.2024
+ttagg 0.25 0.1956 0.22
+ttagt 0.25 0.2069 0.2844
+ttata 0.2178 0.1082 0.2004
+ttatc 0.1858 0.3853 0.1802
+ttatg 0.4016 0.1565 0.2446
+ttatt 0.1948 0.3501 0.3747
+ttcaa 0.3289 0.3722 0.3513
+ttcac 0.1659 0.1885 0.1311
+ttcag 0.2931 0.1716 0.242
+ttcat 0.2122 0.2676 0.2756
+ttcca 0.3922 0.3096 0.3689
+ttccc 0.1947 0.2383 0.1253
+ttccg 0.1421 0.118 0.09205
+ttcct 0.271 0.3341 0.4137
+ttcga 0.3391 0.3734 0.2873
+ttcgc 0.1846 0.175 0.1858
+ttcgg 0.2519 0.2206 0.1672
+ttcgt 0.2244 0.231 0.3597
+ttcta 0.1863 0.1252 0.1667
+ttctc 0.2124 0.2993 0.2206
+ttctg 0.3306 0.1259 0.177
+ttctt 0.2707 0.4496 0.4356
+ttgaa 0.25 0.3849 0.2916
+ttgac 0.25 0.1661 0.1292
+ttgag 0.25 0.2103 0.219
+ttgat 0.25 0.2388 0.3602
+ttgca 0.4158 0.3247 0.3224
+ttgcc 0.2196 0.264 0.1429
+ttgcg 0.1083 0.08452 0.06033
+ttgct 0.2563 0.3267 0.4743
+ttgga 0.3332 0.4022 0.3408
+ttggc 0.1652 0.2141 0.1599
+ttggg 0.3024 0.1785 0.1593
+ttggt 0.1992 0.2052 0.34
+ttgta 0.2139 0.1413 0.1756
+ttgtc 0.1616 0.275 0.1673
+ttgtg 0.3915 0.1348 0.2502
+ttgtt 0.233 0.4489 0.4068
+tttaa 0.2807 0.3209 0.001064
+tttac 0.1961 0.1933 0.4011
+tttag 0.2999 0.2235 0.001064
+tttat 0.2233 0.2623 0.5968
+tttca 0.3548 0.3197 0.3292
+tttcc 0.218 0.2488 0.184
+tttcg 0.1253 0.1051 0.08472
+tttct 0.302 0.3263 0.4021
+tttga 0.2915 0.344 0.0008877
+tttgc 0.1932 0.2015 0.2462
+tttgg 0.3405 0.2367 0.3582
+tttgt 0.1748 0.2178 0.3948
+tttta 0.1965 0.1381 0.1746
+ttttc 0.2173 0.3595 0.2596
+ttttg 0.44 0.1806 0.3103
+ttttt 0.1462 0.3218 0.2556
+
+
+#
+# Initial emission probabilities
+#
+[INITEMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+1.62
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.31 0.367 0.276
+aaaac 0.224 0.181 0.226
+aaaag 0.25 0.158 0.247
+aaaat 0.217 0.295 0.251
+aaaca 0.369 0.399 0.366
+aaacc 0.241 0.198 0.215
+aaacg 0.183 0.108 0.109
+aaact 0.206 0.295 0.31
+aaaga 0.411 0.387 0.34
+aaagc 0.237 0.21 0.228
+aaagg 0.172 0.171 0.204
+aaagt 0.18 0.232 0.228
+aaata 0.242 0.107 0.241
+aaatc 0.205 0.351 0.187
+aaatg 0.238 0.131 0.291
+aaatt 0.316 0.412 0.281
+aacaa 0.37 0.418 0.369
+aacac 0.165 0.168 0.21
+aacag 0.264 0.168 0.218
+aacat 0.202 0.246 0.202
+aacca 0.5 0.448 0.425
+aaccc 0.209 0.17 0.154
+aaccg 0.141 0.16 0.118
+aacct 0.15 0.222 0.303
+aacga 0.327 0.384 0.213
+aacgc 0.18 0.213 0.139
+aacgg 0.287 0.189 0.269
+aacgt 0.207 0.213 0.38
+aacta 0.238 0.133 0.183
+aactc 0.262 0.344 0.29
+aactg 0.293 0.133 0.183
+aactt 0.207 0.39 0.344
+aagaa 0.372 0.486 0.403
+aagac 0.126 0.148 0.184
+aagag 0.271 0.153 0.2
+aagat 0.232 0.212 0.213
+aagca 0.386 0.35 0.412
+aagcc 0.183 0.181 0.169
+aagcg 0.159 0.104 0.0682
+aagct 0.272 0.365 0.351
+aagga 0.345 0.396 0.384
+aaggc 0.238 0.233 0.153
+aaggg 0.189 0.181 0.235
+aaggt 0.228 0.189 0.228
+aagta 0.256 0.157 0.279
+aagtc 0.177 0.284 0.105
+aagtg 0.28 0.131 0.272
+aagtt 0.287 0.428 0.344
+aataa 0.224 0.326 0.11
+aatac 0.158 0.19 0.381
+aatag 0.371 0.203 0.11
+aatat 0.246 0.281 0.398
+aatca 0.407 0.36 0.398
+aatcc 0.149 0.289 0.146
+aatcg 0.173 0.107 0.107
+aatct 0.27 0.244 0.349
+aatga 0.319 0.381 0.0813
+aatgc 0.121 0.223 0.244
+aatgg 0.376 0.192 0.394
+aatgt 0.184 0.204 0.281
+aatta 0.225 0.144 0.241
+aattc 0.219 0.336 0.17
+aattg 0.266 0.134 0.307
+aattt 0.29 0.386 0.282
+acaaa 0.294 0.295 0.352
+acaac 0.244 0.281 0.172
+acaag 0.234 0.216 0.255
+acaat 0.229 0.209 0.221
+acaca 0.295 0.258 0.3
+acacc 0.24 0.301 0.224
+acacg 0.144 0.157 0.167
+acact 0.322 0.284 0.31
+acaga 0.316 0.28 0.315
+acagc 0.268 0.328 0.228
+acagg 0.156 0.194 0.194
+acagt 0.26 0.199 0.263
+acata 0.261 0.0789 0.217
+acatc 0.261 0.453 0.24
+acatg 0.195 0.143 0.264
+acatt 0.283 0.325 0.28
+accaa 0.354 0.407 0.371
+accac 0.146 0.214 0.129
+accag 0.239 0.134 0.183
+accat 0.261 0.245 0.317
+accca 0.315 0.3 0.289
+acccc 0.192 0.192 0.184
+acccg 0.162 0.177 0.149
+accct 0.331 0.331 0.377
+accga 0.312 0.344 0.348
+accgc 0.167 0.201 0.152
+accgg 0.297 0.24 0.241
+accgt 0.225 0.214 0.259
+accta 0.213 0.145 0.235
+acctc 0.279 0.407 0.271
+acctg 0.213 0.0888 0.223
+acctt 0.296 0.36 0.271
+acgaa 0.284 0.362 0.378
+acgac 0.233 0.221 0.186
+acgag 0.267 0.179 0.218
+acgat 0.216 0.237 0.218
+acgca 0.239 0.217 0.234
+acgcc 0.261 0.292 0.363
+acgcg 0.261 0.198 0.153
+acgct 0.239 0.292 0.25
+acgga 0.245 0.312 0.331
+acggc 0.209 0.241 0.301
+acggg 0.336 0.182 0.14
+acggt 0.209 0.265 0.228
+acgta 0.285 0.159 0.266
+acgtc 0.215 0.418 0.218
+acgtg 0.174 0.112 0.234
+acgtt 0.326 0.312 0.282
+actaa 0.342 0.322 0.0985
+actac 0.132 0.297 0.417
+actag 0.289 0.153 0.0985
+actat 0.237 0.228 0.386
+actca 0.366 0.281 0.325
+actcc 0.246 0.265 0.257
+actcg 0.159 0.128 0.0719
+actct 0.228 0.325 0.346
+actga 0.374 0.304 0.116
+actgc 0.237 0.309 0.33
+actgg 0.184 0.176 0.187
+actgt 0.205 0.21 0.366
+actta 0.199 0.0689 0.209
+acttc 0.289 0.46 0.229
+acttg 0.193 0.149 0.243
+acttt 0.318 0.322 0.318
+agaaa 0.333 0.387 0.356
+agaac 0.126 0.168 0.122
+agaag 0.374 0.25 0.294
+agaat 0.167 0.195 0.228
+agaca 0.309 0.289 0.302
+agacc 0.208 0.273 0.193
+agacg 0.225 0.195 0.213
+agact 0.258 0.242 0.292
+agaga 0.337 0.297 0.369
+agagc 0.271 0.28 0.234
+agagg 0.252 0.24 0.218
+agagt 0.141 0.183 0.179
+agata 0.207 0.173 0.214
+agatc 0.279 0.288 0.25
+agatg 0.268 0.224 0.301
+agatt 0.246 0.314 0.236
+agcaa 0.347 0.371 0.332
+agcac 0.15 0.154 0.0882
+agcag 0.32 0.329 0.307
+agcat 0.183 0.146 0.273
+agcca 0.401 0.347 0.314
+agccc 0.172 0.161 0.199
+agccg 0.214 0.195 0.224
+agcct 0.214 0.297 0.263
+agcga 0.398 0.292 0.156
+agcgc 0.148 0.225 0.281
+agcgg 0.211 0.275 0.198
+agcgt 0.242 0.208 0.365
+agcta 0.157 0.241 0.263
+agctc 0.269 0.218 0.192
+agctg 0.295 0.182 0.263
+agctt 0.279 0.359 0.281
+aggaa 0.371 0.366 0.346
+aggac 0.146 0.134 0.172
+aggag 0.357 0.31 0.276
+aggat 0.126 0.19 0.206
+aggca 0.349 0.312 0.322
+aggcc 0.178 0.196 0.145
+aggcg 0.283 0.152 0.238
+aggct 0.191 0.341 0.294
+aggga 0.353 0.344 0.324
+agggc 0.147 0.194 0.194
+agggg 0.237 0.219 0.171
+agggt 0.263 0.244 0.312
+aggta 0.226 0.144 0.193
+aggtc 0.139 0.295 0.153
+aggtg 0.361 0.212 0.342
+aggtt 0.274 0.349 0.312
+agtaa 0.347 0.298 0.12
+agtac 0.181 0.161 0.25
+agtag 0.236 0.289 0.12
+agtat 0.236 0.252 0.509
+agtca 0.362 0.253 0.316
+agtcc 0.177 0.24 0.172
+agtcg 0.208 0.199 0.196
+agtct 0.254 0.308 0.316
+agtga 0.312 0.31 0.1
+agtgc 0.184 0.236 0.315
+agtgg 0.278 0.277 0.254
+agtgt 0.226 0.178 0.331
+agtta 0.209 0.123 0.25
+agttc 0.202 0.329 0.197
+agttg 0.295 0.194 0.243
+agttt 0.295 0.353 0.31
+ataaa 0.25 0.301 0.264
+ataac 0.25 0.199 0.198
+ataag 0.25 0.223 0.215
+ataat 0.25 0.277 0.323
+ataca 0.331 0.241 0.289
+atacc 0.215 0.414 0.185
+atacg 0.169 0.0926 0.142
+atact 0.285 0.253 0.384
+ataga 0.25 0.365 0.318
+atagc 0.25 0.323 0.236
+atagg 0.25 0.17 0.153
+atagt 0.25 0.142 0.293
+atata 0.183 0.137 0.221
+atatc 0.183 0.241 0.156
+atatg 0.321 0.156 0.315
+atatt 0.313 0.467 0.308
+atcaa 0.352 0.392 0.41
+atcac 0.172 0.182 0.121
+atcag 0.249 0.201 0.229
+atcat 0.227 0.226 0.24
+atcca 0.368 0.328 0.348
+atccc 0.161 0.213 0.148
+atccg 0.175 0.201 0.203
+atcct 0.296 0.259 0.3
+atcga 0.253 0.276 0.275
+atcgc 0.226 0.231 0.204
+atcgg 0.226 0.261 0.246
+atcgt 0.295 0.231 0.275
+atcta 0.184 0.137 0.153
+atctc 0.231 0.412 0.237
+atctg 0.227 0.146 0.159
+atctt 0.358 0.305 0.452
+atgaa 0.25 0.44 0.351
+atgac 0.25 0.143 0.128
+atgag 0.25 0.195 0.174
+atgat 0.25 0.221 0.347
+atgca 0.345 0.386 0.32
+atgcc 0.17 0.243 0.149
+atgcg 0.119 0.129 0.0945
+atgct 0.366 0.243 0.436
+atgga 0.344 0.391 0.325
+atggc 0.24 0.239 0.132
+atggg 0.253 0.167 0.161
+atggt 0.162 0.203 0.382
+atgta 0.186 0.0975 0.239
+atgtc 0.177 0.292 0.154
+atgtg 0.332 0.208 0.218
+atgtt 0.305 0.403 0.389
+attaa 0.22 0.376 0.0793
+attac 0.202 0.157 0.274
+attag 0.345 0.245 0.0793
+attat 0.233 0.223 0.567
+attca 0.336 0.348 0.393
+attcc 0.193 0.228 0.192
+attcg 0.118 0.109 0.0651
+attct 0.353 0.315 0.35
+attga 0.321 0.314 0.0596
+attgc 0.213 0.212 0.353
+attgg 0.249 0.229 0.17
+attgt 0.218 0.246 0.417
+attta 0.211 0.126 0.18
+atttc 0.229 0.405 0.306
+atttg 0.308 0.137 0.247
+atttt 0.252 0.332 0.267
+caaaa 0.31 0.367 0.276
+caaac 0.224 0.181 0.226
+caaag 0.25 0.158 0.247
+caaat 0.217 0.295 0.251
+caaca 0.369 0.399 0.366
+caacc 0.241 0.198 0.215
+caacg 0.183 0.108 0.109
+caact 0.206 0.295 0.31
+caaga 0.411 0.387 0.34
+caagc 0.237 0.21 0.228
+caagg 0.172 0.171 0.204
+caagt 0.18 0.232 0.228
+caata 0.242 0.107 0.241
+caatc 0.205 0.351 0.187
+caatg 0.238 0.131 0.291
+caatt 0.316 0.412 0.281
+cacaa 0.37 0.418 0.369
+cacac 0.165 0.168 0.21
+cacag 0.264 0.168 0.218
+cacat 0.202 0.246 0.202
+cacca 0.5 0.448 0.425
+caccc 0.209 0.17 0.154
+caccg 0.141 0.16 0.118
+cacct 0.15 0.222 0.303
+cacga 0.327 0.384 0.213
+cacgc 0.18 0.213 0.139
+cacgg 0.287 0.189 0.269
+cacgt 0.207 0.213 0.38
+cacta 0.238 0.133 0.183
+cactc 0.262 0.344 0.29
+cactg 0.293 0.133 0.183
+cactt 0.207 0.39 0.344
+cagaa 0.372 0.486 0.403
+cagac 0.126 0.148 0.184
+cagag 0.271 0.153 0.2
+cagat 0.232 0.212 0.213
+cagca 0.386 0.35 0.412
+cagcc 0.183 0.181 0.169
+cagcg 0.159 0.104 0.0682
+cagct 0.272 0.365 0.351
+cagga 0.345 0.396 0.384
+caggc 0.238 0.233 0.153
+caggg 0.189 0.181 0.235
+caggt 0.228 0.189 0.228
+cagta 0.256 0.157 0.279
+cagtc 0.177 0.284 0.105
+cagtg 0.28 0.131 0.272
+cagtt 0.287 0.428 0.344
+cataa 0.224 0.326 0.11
+catac 0.158 0.19 0.381
+catag 0.371 0.203 0.11
+catat 0.246 0.281 0.398
+catca 0.407 0.36 0.398
+catcc 0.149 0.289 0.146
+catcg 0.173 0.107 0.107
+catct 0.27 0.244 0.349
+catga 0.319 0.381 0.0813
+catgc 0.121 0.223 0.244
+catgg 0.376 0.192 0.394
+catgt 0.184 0.204 0.281
+catta 0.225 0.144 0.241
+cattc 0.219 0.336 0.17
+cattg 0.266 0.134 0.307
+cattt 0.29 0.386 0.282
+ccaaa 0.294 0.295 0.352
+ccaac 0.244 0.281 0.172
+ccaag 0.234 0.216 0.255
+ccaat 0.229 0.209 0.221
+ccaca 0.295 0.258 0.3
+ccacc 0.24 0.301 0.224
+ccacg 0.144 0.157 0.167
+ccact 0.322 0.284 0.31
+ccaga 0.316 0.28 0.315
+ccagc 0.268 0.328 0.228
+ccagg 0.156 0.194 0.194
+ccagt 0.26 0.199 0.263
+ccata 0.261 0.0789 0.217
+ccatc 0.261 0.453 0.24
+ccatg 0.195 0.143 0.264
+ccatt 0.283 0.325 0.28
+cccaa 0.354 0.407 0.371
+cccac 0.146 0.214 0.129
+cccag 0.239 0.134 0.183
+cccat 0.261 0.245 0.317
+cccca 0.315 0.3 0.289
+ccccc 0.192 0.192 0.184
+ccccg 0.162 0.177 0.149
+cccct 0.331 0.331 0.377
+cccga 0.312 0.344 0.348
+cccgc 0.167 0.201 0.152
+cccgg 0.297 0.24 0.241
+cccgt 0.225 0.214 0.259
+cccta 0.213 0.145 0.235
+ccctc 0.279 0.407 0.271
+ccctg 0.213 0.0888 0.223
+ccctt 0.296 0.36 0.271
+ccgaa 0.284 0.362 0.378
+ccgac 0.233 0.221 0.186
+ccgag 0.267 0.179 0.218
+ccgat 0.216 0.237 0.218
+ccgca 0.239 0.217 0.234
+ccgcc 0.261 0.292 0.363
+ccgcg 0.261 0.198 0.153
+ccgct 0.239 0.292 0.25
+ccgga 0.245 0.312 0.331
+ccggc 0.209 0.241 0.301
+ccggg 0.336 0.182 0.14
+ccggt 0.209 0.265 0.228
+ccgta 0.285 0.159 0.266
+ccgtc 0.215 0.418 0.218
+ccgtg 0.174 0.112 0.234
+ccgtt 0.326 0.312 0.282
+cctaa 0.342 0.322 0.0985
+cctac 0.132 0.297 0.417
+cctag 0.289 0.153 0.0985
+cctat 0.237 0.228 0.386
+cctca 0.366 0.281 0.325
+cctcc 0.246 0.265 0.257
+cctcg 0.159 0.128 0.0719
+cctct 0.228 0.325 0.346
+cctga 0.374 0.304 0.116
+cctgc 0.237 0.309 0.33
+cctgg 0.184 0.176 0.187
+cctgt 0.205 0.21 0.366
+cctta 0.199 0.0689 0.209
+ccttc 0.289 0.46 0.229
+ccttg 0.193 0.149 0.243
+ccttt 0.318 0.322 0.318
+cgaaa 0.333 0.387 0.356
+cgaac 0.126 0.168 0.122
+cgaag 0.374 0.25 0.294
+cgaat 0.167 0.195 0.228
+cgaca 0.309 0.289 0.302
+cgacc 0.208 0.273 0.193
+cgacg 0.225 0.195 0.213
+cgact 0.258 0.242 0.292
+cgaga 0.337 0.297 0.369
+cgagc 0.271 0.28 0.234
+cgagg 0.252 0.24 0.218
+cgagt 0.141 0.183 0.179
+cgata 0.207 0.173 0.214
+cgatc 0.279 0.288 0.25
+cgatg 0.268 0.224 0.301
+cgatt 0.246 0.314 0.236
+cgcaa 0.347 0.371 0.332
+cgcac 0.15 0.154 0.0882
+cgcag 0.32 0.329 0.307
+cgcat 0.183 0.146 0.273
+cgcca 0.401 0.347 0.314
+cgccc 0.172 0.161 0.199
+cgccg 0.214 0.195 0.224
+cgcct 0.214 0.297 0.263
+cgcga 0.398 0.292 0.156
+cgcgc 0.148 0.225 0.281
+cgcgg 0.211 0.275 0.198
+cgcgt 0.242 0.208 0.365
+cgcta 0.157 0.241 0.263
+cgctc 0.269 0.218 0.192
+cgctg 0.295 0.182 0.263
+cgctt 0.279 0.359 0.281
+cggaa 0.371 0.366 0.346
+cggac 0.146 0.134 0.172
+cggag 0.357 0.31 0.276
+cggat 0.126 0.19 0.206
+cggca 0.349 0.312 0.322
+cggcc 0.178 0.196 0.145
+cggcg 0.283 0.152 0.238
+cggct 0.191 0.341 0.294
+cggga 0.353 0.344 0.324
+cgggc 0.147 0.194 0.194
+cgggg 0.237 0.219 0.171
+cgggt 0.263 0.244 0.312
+cggta 0.226 0.144 0.193
+cggtc 0.139 0.295 0.153
+cggtg 0.361 0.212 0.342
+cggtt 0.274 0.349 0.312
+cgtaa 0.347 0.298 0.12
+cgtac 0.181 0.161 0.25
+cgtag 0.236 0.289 0.12
+cgtat 0.236 0.252 0.509
+cgtca 0.362 0.253 0.316
+cgtcc 0.177 0.24 0.172
+cgtcg 0.208 0.199 0.196
+cgtct 0.254 0.308 0.316
+cgtga 0.312 0.31 0.1
+cgtgc 0.184 0.236 0.315
+cgtgg 0.278 0.277 0.254
+cgtgt 0.226 0.178 0.331
+cgtta 0.209 0.123 0.25
+cgttc 0.202 0.329 0.197
+cgttg 0.295 0.194 0.243
+cgttt 0.295 0.353 0.31
+ctaaa 0.25 0.301 0.264
+ctaac 0.25 0.199 0.198
+ctaag 0.25 0.223 0.215
+ctaat 0.25 0.277 0.323
+ctaca 0.331 0.241 0.289
+ctacc 0.215 0.414 0.185
+ctacg 0.169 0.0926 0.142
+ctact 0.285 0.253 0.384
+ctaga 0.25 0.365 0.318
+ctagc 0.25 0.323 0.236
+ctagg 0.25 0.17 0.153
+ctagt 0.25 0.142 0.293
+ctata 0.183 0.137 0.221
+ctatc 0.183 0.241 0.156
+ctatg 0.321 0.156 0.315
+ctatt 0.313 0.467 0.308
+ctcaa 0.352 0.392 0.41
+ctcac 0.172 0.182 0.121
+ctcag 0.249 0.201 0.229
+ctcat 0.227 0.226 0.24
+ctcca 0.368 0.328 0.348
+ctccc 0.161 0.213 0.148
+ctccg 0.175 0.201 0.203
+ctcct 0.296 0.259 0.3
+ctcga 0.253 0.276 0.275
+ctcgc 0.226 0.231 0.204
+ctcgg 0.226 0.261 0.246
+ctcgt 0.295 0.231 0.275
+ctcta 0.184 0.137 0.153
+ctctc 0.231 0.412 0.237
+ctctg 0.227 0.146 0.159
+ctctt 0.358 0.305 0.452
+ctgaa 0.25 0.44 0.351
+ctgac 0.25 0.143 0.128
+ctgag 0.25 0.195 0.174
+ctgat 0.25 0.221 0.347
+ctgca 0.345 0.386 0.32
+ctgcc 0.17 0.243 0.149
+ctgcg 0.119 0.129 0.0945
+ctgct 0.366 0.243 0.436
+ctgga 0.344 0.391 0.325
+ctggc 0.24 0.239 0.132
+ctggg 0.253 0.167 0.161
+ctggt 0.162 0.203 0.382
+ctgta 0.186 0.0975 0.239
+ctgtc 0.177 0.292 0.154
+ctgtg 0.332 0.208 0.218
+ctgtt 0.305 0.403 0.389
+cttaa 0.22 0.376 0.0793
+cttac 0.202 0.157 0.274
+cttag 0.345 0.245 0.0793
+cttat 0.233 0.223 0.567
+cttca 0.336 0.348 0.393
+cttcc 0.193 0.228 0.192
+cttcg 0.118 0.109 0.0651
+cttct 0.353 0.315 0.35
+cttga 0.321 0.314 0.0596
+cttgc 0.213 0.212 0.353
+cttgg 0.249 0.229 0.17
+cttgt 0.218 0.246 0.417
+cttta 0.211 0.126 0.18
+ctttc 0.229 0.405 0.306
+ctttg 0.308 0.137 0.247
+ctttt 0.252 0.332 0.267
+gaaaa 0.31 0.367 0.276
+gaaac 0.224 0.181 0.226
+gaaag 0.25 0.158 0.247
+gaaat 0.217 0.295 0.251
+gaaca 0.369 0.399 0.366
+gaacc 0.241 0.198 0.215
+gaacg 0.183 0.108 0.109
+gaact 0.206 0.295 0.31
+gaaga 0.411 0.387 0.34
+gaagc 0.237 0.21 0.228
+gaagg 0.172 0.171 0.204
+gaagt 0.18 0.232 0.228
+gaata 0.242 0.107 0.241
+gaatc 0.205 0.351 0.187
+gaatg 0.238 0.131 0.291
+gaatt 0.316 0.412 0.281
+gacaa 0.37 0.418 0.369
+gacac 0.165 0.168 0.21
+gacag 0.264 0.168 0.218
+gacat 0.202 0.246 0.202
+gacca 0.5 0.448 0.425
+gaccc 0.209 0.17 0.154
+gaccg 0.141 0.16 0.118
+gacct 0.15 0.222 0.303
+gacga 0.327 0.384 0.213
+gacgc 0.18 0.213 0.139
+gacgg 0.287 0.189 0.269
+gacgt 0.207 0.213 0.38
+gacta 0.238 0.133 0.183
+gactc 0.262 0.344 0.29
+gactg 0.293 0.133 0.183
+gactt 0.207 0.39 0.344
+gagaa 0.372 0.486 0.403
+gagac 0.126 0.148 0.184
+gagag 0.271 0.153 0.2
+gagat 0.232 0.212 0.213
+gagca 0.386 0.35 0.412
+gagcc 0.183 0.181 0.169
+gagcg 0.159 0.104 0.0682
+gagct 0.272 0.365 0.351
+gagga 0.345 0.396 0.384
+gaggc 0.238 0.233 0.153
+gaggg 0.189 0.181 0.235
+gaggt 0.228 0.189 0.228
+gagta 0.256 0.157 0.279
+gagtc 0.177 0.284 0.105
+gagtg 0.28 0.131 0.272
+gagtt 0.287 0.428 0.344
+gataa 0.224 0.326 0.11
+gatac 0.158 0.19 0.381
+gatag 0.371 0.203 0.11
+gatat 0.246 0.281 0.398
+gatca 0.407 0.36 0.398
+gatcc 0.149 0.289 0.146
+gatcg 0.173 0.107 0.107
+gatct 0.27 0.244 0.349
+gatga 0.319 0.381 0.0813
+gatgc 0.121 0.223 0.244
+gatgg 0.376 0.192 0.394
+gatgt 0.184 0.204 0.281
+gatta 0.225 0.144 0.241
+gattc 0.219 0.336 0.17
+gattg 0.266 0.134 0.307
+gattt 0.29 0.386 0.282
+gcaaa 0.294 0.295 0.352
+gcaac 0.244 0.281 0.172
+gcaag 0.234 0.216 0.255
+gcaat 0.229 0.209 0.221
+gcaca 0.295 0.258 0.3
+gcacc 0.24 0.301 0.224
+gcacg 0.144 0.157 0.167
+gcact 0.322 0.284 0.31
+gcaga 0.316 0.28 0.315
+gcagc 0.268 0.328 0.228
+gcagg 0.156 0.194 0.194
+gcagt 0.26 0.199 0.263
+gcata 0.261 0.0789 0.217
+gcatc 0.261 0.453 0.24
+gcatg 0.195 0.143 0.264
+gcatt 0.283 0.325 0.28
+gccaa 0.354 0.407 0.371
+gccac 0.146 0.214 0.129
+gccag 0.239 0.134 0.183
+gccat 0.261 0.245 0.317
+gccca 0.315 0.3 0.289
+gcccc 0.192 0.192 0.184
+gcccg 0.162 0.177 0.149
+gccct 0.331 0.331 0.377
+gccga 0.312 0.344 0.348
+gccgc 0.167 0.201 0.152
+gccgg 0.297 0.24 0.241
+gccgt 0.225 0.214 0.259
+gccta 0.213 0.145 0.235
+gcctc 0.279 0.407 0.271
+gcctg 0.213 0.0888 0.223
+gcctt 0.296 0.36 0.271
+gcgaa 0.284 0.362 0.378
+gcgac 0.233 0.221 0.186
+gcgag 0.267 0.179 0.218
+gcgat 0.216 0.237 0.218
+gcgca 0.239 0.217 0.234
+gcgcc 0.261 0.292 0.363
+gcgcg 0.261 0.198 0.153
+gcgct 0.239 0.292 0.25
+gcgga 0.245 0.312 0.331
+gcggc 0.209 0.241 0.301
+gcggg 0.336 0.182 0.14
+gcggt 0.209 0.265 0.228
+gcgta 0.285 0.159 0.266
+gcgtc 0.215 0.418 0.218
+gcgtg 0.174 0.112 0.234
+gcgtt 0.326 0.312 0.282
+gctaa 0.342 0.322 0.0985
+gctac 0.132 0.297 0.417
+gctag 0.289 0.153 0.0985
+gctat 0.237 0.228 0.386
+gctca 0.366 0.281 0.325
+gctcc 0.246 0.265 0.257
+gctcg 0.159 0.128 0.0719
+gctct 0.228 0.325 0.346
+gctga 0.374 0.304 0.116
+gctgc 0.237 0.309 0.33
+gctgg 0.184 0.176 0.187
+gctgt 0.205 0.21 0.366
+gctta 0.199 0.0689 0.209
+gcttc 0.289 0.46 0.229
+gcttg 0.193 0.149 0.243
+gcttt 0.318 0.322 0.318
+ggaaa 0.333 0.387 0.356
+ggaac 0.126 0.168 0.122
+ggaag 0.374 0.25 0.294
+ggaat 0.167 0.195 0.228
+ggaca 0.309 0.289 0.302
+ggacc 0.208 0.273 0.193
+ggacg 0.225 0.195 0.213
+ggact 0.258 0.242 0.292
+ggaga 0.337 0.297 0.369
+ggagc 0.271 0.28 0.234
+ggagg 0.252 0.24 0.218
+ggagt 0.141 0.183 0.179
+ggata 0.207 0.173 0.214
+ggatc 0.279 0.288 0.25
+ggatg 0.268 0.224 0.301
+ggatt 0.246 0.314 0.236
+ggcaa 0.347 0.371 0.332
+ggcac 0.15 0.154 0.0882
+ggcag 0.32 0.329 0.307
+ggcat 0.183 0.146 0.273
+ggcca 0.401 0.347 0.314
+ggccc 0.172 0.161 0.199
+ggccg 0.214 0.195 0.224
+ggcct 0.214 0.297 0.263
+ggcga 0.398 0.292 0.156
+ggcgc 0.148 0.225 0.281
+ggcgg 0.211 0.275 0.198
+ggcgt 0.242 0.208 0.365
+ggcta 0.157 0.241 0.263
+ggctc 0.269 0.218 0.192
+ggctg 0.295 0.182 0.263
+ggctt 0.279 0.359 0.281
+gggaa 0.371 0.366 0.346
+gggac 0.146 0.134 0.172
+gggag 0.357 0.31 0.276
+gggat 0.126 0.19 0.206
+gggca 0.349 0.312 0.322
+gggcc 0.178 0.196 0.145
+gggcg 0.283 0.152 0.238
+gggct 0.191 0.341 0.294
+gggga 0.353 0.344 0.324
+ggggc 0.147 0.194 0.194
+ggggg 0.237 0.219 0.171
+ggggt 0.263 0.244 0.312
+gggta 0.226 0.144 0.193
+gggtc 0.139 0.295 0.153
+gggtg 0.361 0.212 0.342
+gggtt 0.274 0.349 0.312
+ggtaa 0.347 0.298 0.12
+ggtac 0.181 0.161 0.25
+ggtag 0.236 0.289 0.12
+ggtat 0.236 0.252 0.509
+ggtca 0.362 0.253 0.316
+ggtcc 0.177 0.24 0.172
+ggtcg 0.208 0.199 0.196
+ggtct 0.254 0.308 0.316
+ggtga 0.312 0.31 0.1
+ggtgc 0.184 0.236 0.315
+ggtgg 0.278 0.277 0.254
+ggtgt 0.226 0.178 0.331
+ggtta 0.209 0.123 0.25
+ggttc 0.202 0.329 0.197
+ggttg 0.295 0.194 0.243
+ggttt 0.295 0.353 0.31
+gtaaa 0.25 0.301 0.264
+gtaac 0.25 0.199 0.198
+gtaag 0.25 0.223 0.215
+gtaat 0.25 0.277 0.323
+gtaca 0.331 0.241 0.289
+gtacc 0.215 0.414 0.185
+gtacg 0.169 0.0926 0.142
+gtact 0.285 0.253 0.384
+gtaga 0.25 0.365 0.318
+gtagc 0.25 0.323 0.236
+gtagg 0.25 0.17 0.153
+gtagt 0.25 0.142 0.293
+gtata 0.183 0.137 0.221
+gtatc 0.183 0.241 0.156
+gtatg 0.321 0.156 0.315
+gtatt 0.313 0.467 0.308
+gtcaa 0.352 0.392 0.41
+gtcac 0.172 0.182 0.121
+gtcag 0.249 0.201 0.229
+gtcat 0.227 0.226 0.24
+gtcca 0.368 0.328 0.348
+gtccc 0.161 0.213 0.148
+gtccg 0.175 0.201 0.203
+gtcct 0.296 0.259 0.3
+gtcga 0.253 0.276 0.275
+gtcgc 0.226 0.231 0.204
+gtcgg 0.226 0.261 0.246
+gtcgt 0.295 0.231 0.275
+gtcta 0.184 0.137 0.153
+gtctc 0.231 0.412 0.237
+gtctg 0.227 0.146 0.159
+gtctt 0.358 0.305 0.452
+gtgaa 0.25 0.44 0.351
+gtgac 0.25 0.143 0.128
+gtgag 0.25 0.195 0.174
+gtgat 0.25 0.221 0.347
+gtgca 0.345 0.386 0.32
+gtgcc 0.17 0.243 0.149
+gtgcg 0.119 0.129 0.0945
+gtgct 0.366 0.243 0.436
+gtgga 0.344 0.391 0.325
+gtggc 0.24 0.239 0.132
+gtggg 0.253 0.167 0.161
+gtggt 0.162 0.203 0.382
+gtgta 0.186 0.0975 0.239
+gtgtc 0.177 0.292 0.154
+gtgtg 0.332 0.208 0.218
+gtgtt 0.305 0.403 0.389
+gttaa 0.22 0.376 0.0793
+gttac 0.202 0.157 0.274
+gttag 0.345 0.245 0.0793
+gttat 0.233 0.223 0.567
+gttca 0.336 0.348 0.393
+gttcc 0.193 0.228 0.192
+gttcg 0.118 0.109 0.0651
+gttct 0.353 0.315 0.35
+gttga 0.321 0.314 0.0596
+gttgc 0.213 0.212 0.353
+gttgg 0.249 0.229 0.17
+gttgt 0.218 0.246 0.417
+gttta 0.211 0.126 0.18
+gtttc 0.229 0.405 0.306
+gtttg 0.308 0.137 0.247
+gtttt 0.252 0.332 0.267
+taaaa 0.31 0.367 0.276
+taaac 0.224 0.181 0.226
+taaag 0.25 0.158 0.247
+taaat 0.217 0.295 0.251
+taaca 0.369 0.399 0.366
+taacc 0.241 0.198 0.215
+taacg 0.183 0.108 0.109
+taact 0.206 0.295 0.31
+taaga 0.411 0.387 0.34
+taagc 0.237 0.21 0.228
+taagg 0.172 0.171 0.204
+taagt 0.18 0.232 0.228
+taata 0.242 0.107 0.241
+taatc 0.205 0.351 0.187
+taatg 0.238 0.131 0.291
+taatt 0.316 0.412 0.281
+tacaa 0.37 0.418 0.369
+tacac 0.165 0.168 0.21
+tacag 0.264 0.168 0.218
+tacat 0.202 0.246 0.202
+tacca 0.5 0.448 0.425
+taccc 0.209 0.17 0.154
+taccg 0.141 0.16 0.118
+tacct 0.15 0.222 0.303
+tacga 0.327 0.384 0.213
+tacgc 0.18 0.213 0.139
+tacgg 0.287 0.189 0.269
+tacgt 0.207 0.213 0.38
+tacta 0.238 0.133 0.183
+tactc 0.262 0.344 0.29
+tactg 0.293 0.133 0.183
+tactt 0.207 0.39 0.344
+tagaa 0.372 0.486 0.403
+tagac 0.126 0.148 0.184
+tagag 0.271 0.153 0.2
+tagat 0.232 0.212 0.213
+tagca 0.386 0.35 0.412
+tagcc 0.183 0.181 0.169
+tagcg 0.159 0.104 0.0682
+tagct 0.272 0.365 0.351
+tagga 0.345 0.396 0.384
+taggc 0.238 0.233 0.153
+taggg 0.189 0.181 0.235
+taggt 0.228 0.189 0.228
+tagta 0.256 0.157 0.279
+tagtc 0.177 0.284 0.105
+tagtg 0.28 0.131 0.272
+tagtt 0.287 0.428 0.344
+tataa 0.224 0.326 0.11
+tatac 0.158 0.19 0.381
+tatag 0.371 0.203 0.11
+tatat 0.246 0.281 0.398
+tatca 0.407 0.36 0.398
+tatcc 0.149 0.289 0.146
+tatcg 0.173 0.107 0.107
+tatct 0.27 0.244 0.349
+tatga 0.319 0.381 0.0813
+tatgc 0.121 0.223 0.244
+tatgg 0.376 0.192 0.394
+tatgt 0.184 0.204 0.281
+tatta 0.225 0.144 0.241
+tattc 0.219 0.336 0.17
+tattg 0.266 0.134 0.307
+tattt 0.29 0.386 0.282
+tcaaa 0.294 0.295 0.352
+tcaac 0.244 0.281 0.172
+tcaag 0.234 0.216 0.255
+tcaat 0.229 0.209 0.221
+tcaca 0.295 0.258 0.3
+tcacc 0.24 0.301 0.224
+tcacg 0.144 0.157 0.167
+tcact 0.322 0.284 0.31
+tcaga 0.316 0.28 0.315
+tcagc 0.268 0.328 0.228
+tcagg 0.156 0.194 0.194
+tcagt 0.26 0.199 0.263
+tcata 0.261 0.0789 0.217
+tcatc 0.261 0.453 0.24
+tcatg 0.195 0.143 0.264
+tcatt 0.283 0.325 0.28
+tccaa 0.354 0.407 0.371
+tccac 0.146 0.214 0.129
+tccag 0.239 0.134 0.183
+tccat 0.261 0.245 0.317
+tccca 0.315 0.3 0.289
+tcccc 0.192 0.192 0.184
+tcccg 0.162 0.177 0.149
+tccct 0.331 0.331 0.377
+tccga 0.312 0.344 0.348
+tccgc 0.167 0.201 0.152
+tccgg 0.297 0.24 0.241
+tccgt 0.225 0.214 0.259
+tccta 0.213 0.145 0.235
+tcctc 0.279 0.407 0.271
+tcctg 0.213 0.0888 0.223
+tcctt 0.296 0.36 0.271
+tcgaa 0.284 0.362 0.378
+tcgac 0.233 0.221 0.186
+tcgag 0.267 0.179 0.218
+tcgat 0.216 0.237 0.218
+tcgca 0.239 0.217 0.234
+tcgcc 0.261 0.292 0.363
+tcgcg 0.261 0.198 0.153
+tcgct 0.239 0.292 0.25
+tcgga 0.245 0.312 0.331
+tcggc 0.209 0.241 0.301
+tcggg 0.336 0.182 0.14
+tcggt 0.209 0.265 0.228
+tcgta 0.285 0.159 0.266
+tcgtc 0.215 0.418 0.218
+tcgtg 0.174 0.112 0.234
+tcgtt 0.326 0.312 0.282
+tctaa 0.342 0.322 0.0985
+tctac 0.132 0.297 0.417
+tctag 0.289 0.153 0.0985
+tctat 0.237 0.228 0.386
+tctca 0.366 0.281 0.325
+tctcc 0.246 0.265 0.257
+tctcg 0.159 0.128 0.0719
+tctct 0.228 0.325 0.346
+tctga 0.374 0.304 0.116
+tctgc 0.237 0.309 0.33
+tctgg 0.184 0.176 0.187
+tctgt 0.205 0.21 0.366
+tctta 0.199 0.0689 0.209
+tcttc 0.289 0.46 0.229
+tcttg 0.193 0.149 0.243
+tcttt 0.318 0.322 0.318
+tgaaa 0.333 0.387 0.356
+tgaac 0.126 0.168 0.122
+tgaag 0.374 0.25 0.294
+tgaat 0.167 0.195 0.228
+tgaca 0.309 0.289 0.302
+tgacc 0.208 0.273 0.193
+tgacg 0.225 0.195 0.213
+tgact 0.258 0.242 0.292
+tgaga 0.337 0.297 0.369
+tgagc 0.271 0.28 0.234
+tgagg 0.252 0.24 0.218
+tgagt 0.141 0.183 0.179
+tgata 0.207 0.173 0.214
+tgatc 0.279 0.288 0.25
+tgatg 0.268 0.224 0.301
+tgatt 0.246 0.314 0.236
+tgcaa 0.347 0.371 0.332
+tgcac 0.15 0.154 0.0882
+tgcag 0.32 0.329 0.307
+tgcat 0.183 0.146 0.273
+tgcca 0.401 0.347 0.314
+tgccc 0.172 0.161 0.199
+tgccg 0.214 0.195 0.224
+tgcct 0.214 0.297 0.263
+tgcga 0.398 0.292 0.156
+tgcgc 0.148 0.225 0.281
+tgcgg 0.211 0.275 0.198
+tgcgt 0.242 0.208 0.365
+tgcta 0.157 0.241 0.263
+tgctc 0.269 0.218 0.192
+tgctg 0.295 0.182 0.263
+tgctt 0.279 0.359 0.281
+tggaa 0.371 0.366 0.346
+tggac 0.146 0.134 0.172
+tggag 0.357 0.31 0.276
+tggat 0.126 0.19 0.206
+tggca 0.349 0.312 0.322
+tggcc 0.178 0.196 0.145
+tggcg 0.283 0.152 0.238
+tggct 0.191 0.341 0.294
+tggga 0.353 0.344 0.324
+tgggc 0.147 0.194 0.194
+tgggg 0.237 0.219 0.171
+tgggt 0.263 0.244 0.312
+tggta 0.226 0.144 0.193
+tggtc 0.139 0.295 0.153
+tggtg 0.361 0.212 0.342
+tggtt 0.274 0.349 0.312
+tgtaa 0.347 0.298 0.12
+tgtac 0.181 0.161 0.25
+tgtag 0.236 0.289 0.12
+tgtat 0.236 0.252 0.509
+tgtca 0.362 0.253 0.316
+tgtcc 0.177 0.24 0.172
+tgtcg 0.208 0.199 0.196
+tgtct 0.254 0.308 0.316
+tgtga 0.312 0.31 0.1
+tgtgc 0.184 0.236 0.315
+tgtgg 0.278 0.277 0.254
+tgtgt 0.226 0.178 0.331
+tgtta 0.209 0.123 0.25
+tgttc 0.202 0.329 0.197
+tgttg 0.295 0.194 0.243
+tgttt 0.295 0.353 0.31
+ttaaa 0.25 0.301 0.264
+ttaac 0.25 0.199 0.198
+ttaag 0.25 0.223 0.215
+ttaat 0.25 0.277 0.323
+ttaca 0.331 0.241 0.289
+ttacc 0.215 0.414 0.185
+ttacg 0.169 0.0926 0.142
+ttact 0.285 0.253 0.384
+ttaga 0.25 0.365 0.318
+ttagc 0.25 0.323 0.236
+ttagg 0.25 0.17 0.153
+ttagt 0.25 0.142 0.293
+ttata 0.183 0.137 0.221
+ttatc 0.183 0.241 0.156
+ttatg 0.321 0.156 0.315
+ttatt 0.313 0.467 0.308
+ttcaa 0.352 0.392 0.41
+ttcac 0.172 0.182 0.121
+ttcag 0.249 0.201 0.229
+ttcat 0.227 0.226 0.24
+ttcca 0.368 0.328 0.348
+ttccc 0.161 0.213 0.148
+ttccg 0.175 0.201 0.203
+ttcct 0.296 0.259 0.3
+ttcga 0.253 0.276 0.275
+ttcgc 0.226 0.231 0.204
+ttcgg 0.226 0.261 0.246
+ttcgt 0.295 0.231 0.275
+ttcta 0.184 0.137 0.153
+ttctc 0.231 0.412 0.237
+ttctg 0.227 0.146 0.159
+ttctt 0.358 0.305 0.452
+ttgaa 0.25 0.44 0.351
+ttgac 0.25 0.143 0.128
+ttgag 0.25 0.195 0.174
+ttgat 0.25 0.221 0.347
+ttgca 0.345 0.386 0.32
+ttgcc 0.17 0.243 0.149
+ttgcg 0.119 0.129 0.0945
+ttgct 0.366 0.243 0.436
+ttgga 0.344 0.391 0.325
+ttggc 0.24 0.239 0.132
+ttggg 0.253 0.167 0.161
+ttggt 0.162 0.203 0.382
+ttgta 0.186 0.0975 0.239
+ttgtc 0.177 0.292 0.154
+ttgtg 0.332 0.208 0.218
+ttgtt 0.305 0.403 0.389
+tttaa 0.22 0.376 0.0793
+tttac 0.202 0.157 0.274
+tttag 0.345 0.245 0.0793
+tttat 0.233 0.223 0.567
+tttca 0.336 0.348 0.393
+tttcc 0.193 0.228 0.192
+tttcg 0.118 0.109 0.0651
+tttct 0.353 0.315 0.35
+tttga 0.321 0.314 0.0596
+tttgc 0.213 0.212 0.353
+tttgg 0.249 0.229 0.17
+tttgt 0.218 0.246 0.417
+tttta 0.211 0.126 0.18
+ttttc 0.229 0.405 0.306
+ttttg 0.308 0.137 0.247
+ttttt 0.252 0.332 0.267
+
+
+#
+# Internal exon terminal emission probabilities
+#
+[ETEMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+1.62
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.279 0.299 0.321
+aaaac 0.235 0.201 0.15
+aaaag 0.298 0.187 0.222
+aaaat 0.188 0.312 0.307
+aaaca 0.388 0.332 0.34
+aaacc 0.3 0.21 0.294
+aaacg 0.108 0.145 0.0649
+aaact 0.204 0.313 0.302
+aaaga 0.382 0.412 0.354
+aaagc 0.233 0.221 0.254
+aaagg 0.233 0.16 0.179
+aaagt 0.152 0.207 0.213
+aaata 0.264 0.15 0.191
+aaatc 0.225 0.264 0.176
+aaatg 0.346 0.159 0.285
+aaatt 0.166 0.427 0.349
+aacaa 0.341 0.387 0.31
+aacac 0.233 0.223 0.178
+aacag 0.247 0.113 0.202
+aacat 0.179 0.277 0.31
+aacca 0.293 0.31 0.361
+aaccc 0.261 0.299 0.13
+aaccg 0.176 0.114 0.0913
+aacct 0.271 0.277 0.418
+aacga 0.337 0.296 0.302
+aacgc 0.228 0.214 0.233
+aacgg 0.25 0.235 0.267
+aacgt 0.185 0.255 0.198
+aacta 0.303 0.16 0.253
+aactc 0.216 0.296 0.177
+aactg 0.347 0.238 0.17
+aactt 0.134 0.306 0.399
+aagaa 0.371 0.382 0.346
+aagac 0.191 0.197 0.138
+aagag 0.262 0.122 0.201
+aagat 0.176 0.298 0.314
+aagca 0.379 0.372 0.407
+aagcc 0.225 0.236 0.183
+aagcg 0.126 0.128 0.0609
+aagct 0.269 0.264 0.349
+aagga 0.325 0.477 0.509
+aaggc 0.278 0.247 0.173
+aaggg 0.262 0.155 0.164
+aaggt 0.135 0.121 0.154
+aagta 0.204 0.193 0.277
+aagtc 0.237 0.233 0.178
+aagtg 0.354 0.113 0.201
+aagtt 0.204 0.46 0.345
+aataa 0.332 0.243 0.0677
+aatac 0.263 0.214 0.37
+aatag 0.188 0.146 0.0677
+aatat 0.217 0.397 0.495
+aatca 0.438 0.352 0.377
+aatcc 0.229 0.245 0.216
+aatcg 0.171 0.0973 0.106
+aatct 0.162 0.305 0.301
+aatga 0.29 0.36 0.0684
+aatgc 0.254 0.252 0.3
+aatgg 0.344 0.209 0.363
+aatgt 0.111 0.179 0.268
+aatta 0.233 0.173 0.235
+aattc 0.276 0.276 0.231
+aattg 0.327 0.142 0.211
+aattt 0.164 0.409 0.323
+acaaa 0.31 0.339 0.314
+acaac 0.267 0.253 0.215
+acaag 0.218 0.187 0.179
+acaat 0.206 0.22 0.292
+acaca 0.371 0.316 0.362
+acacc 0.242 0.286 0.167
+acacg 0.134 0.112 0.118
+acact 0.253 0.286 0.354
+acaga 0.413 0.419 0.312
+acagc 0.238 0.238 0.187
+acagg 0.18 0.178 0.149
+acagt 0.17 0.164 0.351
+acata 0.265 0.193 0.25
+acatc 0.265 0.242 0.175
+acatg 0.284 0.193 0.158
+acatt 0.186 0.373 0.417
+accaa 0.272 0.369 0.286
+accac 0.257 0.226 0.205
+accag 0.228 0.147 0.195
+accat 0.243 0.258 0.314
+accca 0.372 0.242 0.324
+acccc 0.25 0.289 0.165
+acccg 0.169 0.102 0.108
+accct 0.209 0.367 0.403
+accga 0.256 0.307 0.265
+accgc 0.278 0.219 0.363
+accgg 0.256 0.184 0.147
+accgt 0.211 0.289 0.225
+accta 0.197 0.187 0.126
+acctc 0.266 0.223 0.272
+acctg 0.323 0.151 0.118
+acctt 0.214 0.44 0.484
+acgaa 0.326 0.316 0.312
+acgac 0.21 0.194 0.222
+acgag 0.225 0.153 0.176
+acgat 0.239 0.337 0.29
+acgca 0.366 0.256 0.336
+acgcc 0.216 0.256 0.227
+acgcg 0.216 0.233 0.136
+acgct 0.201 0.256 0.3
+acgga 0.315 0.288 0.3
+acggc 0.25 0.263 0.209
+acggg 0.25 0.238 0.227
+acggt 0.185 0.213 0.264
+acgta 0.242 0.25 0.211
+acgtc 0.275 0.221 0.117
+acgtg 0.292 0.221 0.258
+acgtt 0.192 0.309 0.414
+actaa 0.349 0.364 0.0644
+actac 0.265 0.169 0.332
+actag 0.214 0.163 0.0644
+actat 0.172 0.305 0.54
+actca 0.363 0.307 0.344
+actcc 0.226 0.3 0.212
+actcg 0.184 0.159 0.0991
+actct 0.226 0.233 0.344
+actga 0.335 0.333 0.0813
+actgc 0.325 0.293 0.356
+actgg 0.228 0.209 0.269
+actgt 0.112 0.165 0.294
+actta 0.211 0.183 0.188
+acttc 0.293 0.332 0.257
+acttg 0.313 0.168 0.211
+acttt 0.183 0.317 0.344
+agaaa 0.367 0.384 0.314
+agaac 0.158 0.178 0.15
+agaag 0.33 0.178 0.195
+agaat 0.145 0.26 0.342
+agaca 0.356 0.25 0.342
+agacc 0.248 0.267 0.209
+agacg 0.14 0.198 0.0969
+agact 0.257 0.284 0.352
+agaga 0.332 0.272 0.344
+agagc 0.243 0.285 0.253
+agagg 0.257 0.171 0.162
+agagt 0.168 0.272 0.24
+agata 0.224 0.269 0.246
+agatc 0.258 0.219 0.139
+agatg 0.311 0.206 0.275
+agatt 0.207 0.306 0.339
+agcaa 0.332 0.405 0.35
+agcac 0.219 0.205 0.126
+agcag 0.278 0.165 0.248
+agcat 0.17 0.225 0.276
+agcca 0.522 0.32 0.361
+agccc 0.201 0.205 0.171
+agccg 0.112 0.156 0.146
+agcct 0.165 0.32 0.323
+agcga 0.33 0.315 0.302
+agcgc 0.33 0.207 0.281
+agcgg 0.17 0.25 0.156
+agcgt 0.17 0.228 0.26
+agcta 0.244 0.24 0.189
+agctc 0.235 0.227 0.189
+agctg 0.343 0.162 0.241
+agctt 0.179 0.37 0.382
+aggaa 0.427 0.324 0.317
+aggac 0.179 0.222 0.141
+aggag 0.227 0.21 0.239
+aggat 0.167 0.244 0.304
+aggca 0.428 0.289 0.298
+aggcc 0.253 0.211 0.187
+aggcg 0.16 0.148 0.106
+aggct 0.16 0.352 0.409
+aggga 0.399 0.331 0.385
+agggc 0.259 0.315 0.221
+agggg 0.209 0.192 0.172
+agggt 0.133 0.162 0.221
+aggta 0.121 0.186 0.189
+aggtc 0.309 0.245 0.156
+aggtg 0.348 0.147 0.27
+aggtt 0.223 0.422 0.385
+agtaa 0.314 0.278 0.114
+agtac 0.186 0.198 0.377
+agtag 0.286 0.183 0.114
+agtat 0.214 0.341 0.395
+agtca 0.359 0.24 0.377
+agtcc 0.288 0.201 0.267
+agtcg 0.126 0.149 0.13
+agtct 0.227 0.409 0.226
+agtga 0.316 0.332 0.135
+agtgc 0.286 0.236 0.219
+agtgg 0.199 0.252 0.406
+agtgt 0.199 0.18 0.24
+agtta 0.279 0.197 0.261
+agttc 0.207 0.23 0.192
+agttg 0.36 0.174 0.261
+agttt 0.155 0.399 0.286
+ataaa 0.25 0.361 0.331
+ataac 0.25 0.215 0.204
+ataag 0.25 0.113 0.161
+ataat 0.25 0.31 0.304
+ataca 0.399 0.386 0.321
+atacc 0.241 0.288 0.235
+atacg 0.136 0.103 0.107
+atact 0.224 0.223 0.338
+ataga 0.25 0.365 0.298
+atagc 0.25 0.266 0.307
+atagg 0.25 0.168 0.161
+atagt 0.25 0.201 0.234
+atata 0.206 0.217 0.267
+atatc 0.275 0.279 0.195
+atatg 0.34 0.137 0.166
+atatt 0.179 0.367 0.372
+atcaa 0.371 0.33 0.311
+atcac 0.181 0.197 0.235
+atcag 0.267 0.157 0.184
+atcat 0.181 0.317 0.27
+atcca 0.47 0.287 0.308
+atccc 0.197 0.197 0.189
+atccg 0.146 0.152 0.0868
+atcct 0.187 0.365 0.416
+atcga 0.274 0.318 0.285
+atcgc 0.179 0.236 0.285
+atcgg 0.321 0.182 0.171
+atcgt 0.226 0.264 0.259
+atcta 0.317 0.244 0.187
+atctc 0.251 0.278 0.225
+atctg 0.257 0.141 0.178
+atctt 0.175 0.338 0.41
+atgaa 0.25 0.391 0.29
+atgac 0.25 0.201 0.144
+atgag 0.25 0.151 0.138
+atgat 0.25 0.257 0.427
+atgca 0.299 0.288 0.32
+atgcc 0.266 0.201 0.198
+atgcg 0.158 0.125 0.0608
+atgct 0.277 0.386 0.422
+atgga 0.277 0.431 0.338
+atggc 0.323 0.264 0.218
+atggg 0.214 0.153 0.166
+atggt 0.186 0.153 0.278
+atgta 0.192 0.182 0.168
+atgtc 0.203 0.288 0.228
+atgtg 0.39 0.182 0.164
+atgtt 0.215 0.347 0.44
+attaa 0.259 0.285 0.0533
+attac 0.253 0.215 0.373
+attag 0.283 0.174 0.0533
+attat 0.205 0.326 0.52
+attca 0.382 0.285 0.327
+attcc 0.22 0.291 0.209
+attcg 0.14 0.0897 0.0754
+attct 0.258 0.334 0.388
+attga 0.356 0.359 0.0596
+attgc 0.24 0.22 0.372
+attgg 0.221 0.209 0.381
+attgt 0.183 0.212 0.188
+attta 0.211 0.175 0.223
+atttc 0.25 0.291 0.298
+atttg 0.389 0.132 0.198
+atttt 0.15 0.402 0.281
+caaaa 0.279 0.299 0.321
+caaac 0.235 0.201 0.15
+caaag 0.298 0.187 0.222
+caaat 0.188 0.312 0.307
+caaca 0.388 0.332 0.34
+caacc 0.3 0.21 0.294
+caacg 0.108 0.145 0.0649
+caact 0.204 0.313 0.302
+caaga 0.382 0.412 0.354
+caagc 0.233 0.221 0.254
+caagg 0.233 0.16 0.179
+caagt 0.152 0.207 0.213
+caata 0.264 0.15 0.191
+caatc 0.225 0.264 0.176
+caatg 0.346 0.159 0.285
+caatt 0.166 0.427 0.349
+cacaa 0.341 0.387 0.31
+cacac 0.233 0.223 0.178
+cacag 0.247 0.113 0.202
+cacat 0.179 0.277 0.31
+cacca 0.293 0.31 0.361
+caccc 0.261 0.299 0.13
+caccg 0.176 0.114 0.0913
+cacct 0.271 0.277 0.418
+cacga 0.337 0.296 0.302
+cacgc 0.228 0.214 0.233
+cacgg 0.25 0.235 0.267
+cacgt 0.185 0.255 0.198
+cacta 0.303 0.16 0.253
+cactc 0.216 0.296 0.177
+cactg 0.347 0.238 0.17
+cactt 0.134 0.306 0.399
+cagaa 0.371 0.382 0.346
+cagac 0.191 0.197 0.138
+cagag 0.262 0.122 0.201
+cagat 0.176 0.298 0.314
+cagca 0.379 0.372 0.407
+cagcc 0.225 0.236 0.183
+cagcg 0.126 0.128 0.0609
+cagct 0.269 0.264 0.349
+cagga 0.325 0.477 0.509
+caggc 0.278 0.247 0.173
+caggg 0.262 0.155 0.164
+caggt 0.135 0.121 0.154
+cagta 0.204 0.193 0.277
+cagtc 0.237 0.233 0.178
+cagtg 0.354 0.113 0.201
+cagtt 0.204 0.46 0.345
+cataa 0.332 0.243 0.0677
+catac 0.263 0.214 0.37
+catag 0.188 0.146 0.0677
+catat 0.217 0.397 0.495
+catca 0.438 0.352 0.377
+catcc 0.229 0.245 0.216
+catcg 0.171 0.0973 0.106
+catct 0.162 0.305 0.301
+catga 0.29 0.36 0.0684
+catgc 0.254 0.252 0.3
+catgg 0.344 0.209 0.363
+catgt 0.111 0.179 0.268
+catta 0.233 0.173 0.235
+cattc 0.276 0.276 0.231
+cattg 0.327 0.142 0.211
+cattt 0.164 0.409 0.323
+ccaaa 0.31 0.339 0.314
+ccaac 0.267 0.253 0.215
+ccaag 0.218 0.187 0.179
+ccaat 0.206 0.22 0.292
+ccaca 0.371 0.316 0.362
+ccacc 0.242 0.286 0.167
+ccacg 0.134 0.112 0.118
+ccact 0.253 0.286 0.354
+ccaga 0.413 0.419 0.312
+ccagc 0.238 0.238 0.187
+ccagg 0.18 0.178 0.149
+ccagt 0.17 0.164 0.351
+ccata 0.265 0.193 0.25
+ccatc 0.265 0.242 0.175
+ccatg 0.284 0.193 0.158
+ccatt 0.186 0.373 0.417
+cccaa 0.272 0.369 0.286
+cccac 0.257 0.226 0.205
+cccag 0.228 0.147 0.195
+cccat 0.243 0.258 0.314
+cccca 0.372 0.242 0.324
+ccccc 0.25 0.289 0.165
+ccccg 0.169 0.102 0.108
+cccct 0.209 0.367 0.403
+cccga 0.256 0.307 0.265
+cccgc 0.278 0.219 0.363
+cccgg 0.256 0.184 0.147
+cccgt 0.211 0.289 0.225
+cccta 0.197 0.187 0.126
+ccctc 0.266 0.223 0.272
+ccctg 0.323 0.151 0.118
+ccctt 0.214 0.44 0.484
+ccgaa 0.326 0.316 0.312
+ccgac 0.21 0.194 0.222
+ccgag 0.225 0.153 0.176
+ccgat 0.239 0.337 0.29
+ccgca 0.366 0.256 0.336
+ccgcc 0.216 0.256 0.227
+ccgcg 0.216 0.233 0.136
+ccgct 0.201 0.256 0.3
+ccgga 0.315 0.288 0.3
+ccggc 0.25 0.263 0.209
+ccggg 0.25 0.238 0.227
+ccggt 0.185 0.213 0.264
+ccgta 0.242 0.25 0.211
+ccgtc 0.275 0.221 0.117
+ccgtg 0.292 0.221 0.258
+ccgtt 0.192 0.309 0.414
+cctaa 0.349 0.364 0.0644
+cctac 0.265 0.169 0.332
+cctag 0.214 0.163 0.0644
+cctat 0.172 0.305 0.54
+cctca 0.363 0.307 0.344
+cctcc 0.226 0.3 0.212
+cctcg 0.184 0.159 0.0991
+cctct 0.226 0.233 0.344
+cctga 0.335 0.333 0.0813
+cctgc 0.325 0.293 0.356
+cctgg 0.228 0.209 0.269
+cctgt 0.112 0.165 0.294
+cctta 0.211 0.183 0.188
+ccttc 0.293 0.332 0.257
+ccttg 0.313 0.168 0.211
+ccttt 0.183 0.317 0.344
+cgaaa 0.367 0.384 0.314
+cgaac 0.158 0.178 0.15
+cgaag 0.33 0.178 0.195
+cgaat 0.145 0.26 0.342
+cgaca 0.356 0.25 0.342
+cgacc 0.248 0.267 0.209
+cgacg 0.14 0.198 0.0969
+cgact 0.257 0.284 0.352
+cgaga 0.332 0.272 0.344
+cgagc 0.243 0.285 0.253
+cgagg 0.257 0.171 0.162
+cgagt 0.168 0.272 0.24
+cgata 0.224 0.269 0.246
+cgatc 0.258 0.219 0.139
+cgatg 0.311 0.206 0.275
+cgatt 0.207 0.306 0.339
+cgcaa 0.332 0.405 0.35
+cgcac 0.219 0.205 0.126
+cgcag 0.278 0.165 0.248
+cgcat 0.17 0.225 0.276
+cgcca 0.522 0.32 0.361
+cgccc 0.201 0.205 0.171
+cgccg 0.112 0.156 0.146
+cgcct 0.165 0.32 0.323
+cgcga 0.33 0.315 0.302
+cgcgc 0.33 0.207 0.281
+cgcgg 0.17 0.25 0.156
+cgcgt 0.17 0.228 0.26
+cgcta 0.244 0.24 0.189
+cgctc 0.235 0.227 0.189
+cgctg 0.343 0.162 0.241
+cgctt 0.179 0.37 0.382
+cggaa 0.427 0.324 0.317
+cggac 0.179 0.222 0.141
+cggag 0.227 0.21 0.239
+cggat 0.167 0.244 0.304
+cggca 0.428 0.289 0.298
+cggcc 0.253 0.211 0.187
+cggcg 0.16 0.148 0.106
+cggct 0.16 0.352 0.409
+cggga 0.399 0.331 0.385
+cgggc 0.259 0.315 0.221
+cgggg 0.209 0.192 0.172
+cgggt 0.133 0.162 0.221
+cggta 0.121 0.186 0.189
+cggtc 0.309 0.245 0.156
+cggtg 0.348 0.147 0.27
+cggtt 0.223 0.422 0.385
+cgtaa 0.314 0.278 0.114
+cgtac 0.186 0.198 0.377
+cgtag 0.286 0.183 0.114
+cgtat 0.214 0.341 0.395
+cgtca 0.359 0.24 0.377
+cgtcc 0.288 0.201 0.267
+cgtcg 0.126 0.149 0.13
+cgtct 0.227 0.409 0.226
+cgtga 0.316 0.332 0.135
+cgtgc 0.286 0.236 0.219
+cgtgg 0.199 0.252 0.406
+cgtgt 0.199 0.18 0.24
+cgtta 0.279 0.197 0.261
+cgttc 0.207 0.23 0.192
+cgttg 0.36 0.174 0.261
+cgttt 0.155 0.399 0.286
+ctaaa 0.25 0.361 0.331
+ctaac 0.25 0.215 0.204
+ctaag 0.25 0.113 0.161
+ctaat 0.25 0.31 0.304
+ctaca 0.399 0.386 0.321
+ctacc 0.241 0.288 0.235
+ctacg 0.136 0.103 0.107
+ctact 0.224 0.223 0.338
+ctaga 0.25 0.365 0.298
+ctagc 0.25 0.266 0.307
+ctagg 0.25 0.168 0.161
+ctagt 0.25 0.201 0.234
+ctata 0.206 0.217 0.267
+ctatc 0.275 0.279 0.195
+ctatg 0.34 0.137 0.166
+ctatt 0.179 0.367 0.372
+ctcaa 0.371 0.33 0.311
+ctcac 0.181 0.197 0.235
+ctcag 0.267 0.157 0.184
+ctcat 0.181 0.317 0.27
+ctcca 0.47 0.287 0.308
+ctccc 0.197 0.197 0.189
+ctccg 0.146 0.152 0.0868
+ctcct 0.187 0.365 0.416
+ctcga 0.274 0.318 0.285
+ctcgc 0.179 0.236 0.285
+ctcgg 0.321 0.182 0.171
+ctcgt 0.226 0.264 0.259
+ctcta 0.317 0.244 0.187
+ctctc 0.251 0.278 0.225
+ctctg 0.257 0.141 0.178
+ctctt 0.175 0.338 0.41
+ctgaa 0.25 0.391 0.29
+ctgac 0.25 0.201 0.144
+ctgag 0.25 0.151 0.138
+ctgat 0.25 0.257 0.427
+ctgca 0.299 0.288 0.32
+ctgcc 0.266 0.201 0.198
+ctgcg 0.158 0.125 0.0608
+ctgct 0.277 0.386 0.422
+ctgga 0.277 0.431 0.338
+ctggc 0.323 0.264 0.218
+ctggg 0.214 0.153 0.166
+ctggt 0.186 0.153 0.278
+ctgta 0.192 0.182 0.168
+ctgtc 0.203 0.288 0.228
+ctgtg 0.39 0.182 0.164
+ctgtt 0.215 0.347 0.44
+cttaa 0.259 0.285 0.0533
+cttac 0.253 0.215 0.373
+cttag 0.283 0.174 0.0533
+cttat 0.205 0.326 0.52
+cttca 0.382 0.285 0.327
+cttcc 0.22 0.291 0.209
+cttcg 0.14 0.0897 0.0754
+cttct 0.258 0.334 0.388
+cttga 0.356 0.359 0.0596
+cttgc 0.24 0.22 0.372
+cttgg 0.221 0.209 0.381
+cttgt 0.183 0.212 0.188
+cttta 0.211 0.175 0.223
+ctttc 0.25 0.291 0.298
+ctttg 0.389 0.132 0.198
+ctttt 0.15 0.402 0.281
+gaaaa 0.279 0.299 0.321
+gaaac 0.235 0.201 0.15
+gaaag 0.298 0.187 0.222
+gaaat 0.188 0.312 0.307
+gaaca 0.388 0.332 0.34
+gaacc 0.3 0.21 0.294
+gaacg 0.108 0.145 0.0649
+gaact 0.204 0.313 0.302
+gaaga 0.382 0.412 0.354
+gaagc 0.233 0.221 0.254
+gaagg 0.233 0.16 0.179
+gaagt 0.152 0.207 0.213
+gaata 0.264 0.15 0.191
+gaatc 0.225 0.264 0.176
+gaatg 0.346 0.159 0.285
+gaatt 0.166 0.427 0.349
+gacaa 0.341 0.387 0.31
+gacac 0.233 0.223 0.178
+gacag 0.247 0.113 0.202
+gacat 0.179 0.277 0.31
+gacca 0.293 0.31 0.361
+gaccc 0.261 0.299 0.13
+gaccg 0.176 0.114 0.0913
+gacct 0.271 0.277 0.418
+gacga 0.337 0.296 0.302
+gacgc 0.228 0.214 0.233
+gacgg 0.25 0.235 0.267
+gacgt 0.185 0.255 0.198
+gacta 0.303 0.16 0.253
+gactc 0.216 0.296 0.177
+gactg 0.347 0.238 0.17
+gactt 0.134 0.306 0.399
+gagaa 0.371 0.382 0.346
+gagac 0.191 0.197 0.138
+gagag 0.262 0.122 0.201
+gagat 0.176 0.298 0.314
+gagca 0.379 0.372 0.407
+gagcc 0.225 0.236 0.183
+gagcg 0.126 0.128 0.0609
+gagct 0.269 0.264 0.349
+gagga 0.325 0.477 0.509
+gaggc 0.278 0.247 0.173
+gaggg 0.262 0.155 0.164
+gaggt 0.135 0.121 0.154
+gagta 0.204 0.193 0.277
+gagtc 0.237 0.233 0.178
+gagtg 0.354 0.113 0.201
+gagtt 0.204 0.46 0.345
+gataa 0.332 0.243 0.0677
+gatac 0.263 0.214 0.37
+gatag 0.188 0.146 0.0677
+gatat 0.217 0.397 0.495
+gatca 0.438 0.352 0.377
+gatcc 0.229 0.245 0.216
+gatcg 0.171 0.0973 0.106
+gatct 0.162 0.305 0.301
+gatga 0.29 0.36 0.0684
+gatgc 0.254 0.252 0.3
+gatgg 0.344 0.209 0.363
+gatgt 0.111 0.179 0.268
+gatta 0.233 0.173 0.235
+gattc 0.276 0.276 0.231
+gattg 0.327 0.142 0.211
+gattt 0.164 0.409 0.323
+gcaaa 0.31 0.339 0.314
+gcaac 0.267 0.253 0.215
+gcaag 0.218 0.187 0.179
+gcaat 0.206 0.22 0.292
+gcaca 0.371 0.316 0.362
+gcacc 0.242 0.286 0.167
+gcacg 0.134 0.112 0.118
+gcact 0.253 0.286 0.354
+gcaga 0.413 0.419 0.312
+gcagc 0.238 0.238 0.187
+gcagg 0.18 0.178 0.149
+gcagt 0.17 0.164 0.351
+gcata 0.265 0.193 0.25
+gcatc 0.265 0.242 0.175
+gcatg 0.284 0.193 0.158
+gcatt 0.186 0.373 0.417
+gccaa 0.272 0.369 0.286
+gccac 0.257 0.226 0.205
+gccag 0.228 0.147 0.195
+gccat 0.243 0.258 0.314
+gccca 0.372 0.242 0.324
+gcccc 0.25 0.289 0.165
+gcccg 0.169 0.102 0.108
+gccct 0.209 0.367 0.403
+gccga 0.256 0.307 0.265
+gccgc 0.278 0.219 0.363
+gccgg 0.256 0.184 0.147
+gccgt 0.211 0.289 0.225
+gccta 0.197 0.187 0.126
+gcctc 0.266 0.223 0.272
+gcctg 0.323 0.151 0.118
+gcctt 0.214 0.44 0.484
+gcgaa 0.326 0.316 0.312
+gcgac 0.21 0.194 0.222
+gcgag 0.225 0.153 0.176
+gcgat 0.239 0.337 0.29
+gcgca 0.366 0.256 0.336
+gcgcc 0.216 0.256 0.227
+gcgcg 0.216 0.233 0.136
+gcgct 0.201 0.256 0.3
+gcgga 0.315 0.288 0.3
+gcggc 0.25 0.263 0.209
+gcggg 0.25 0.238 0.227
+gcggt 0.185 0.213 0.264
+gcgta 0.242 0.25 0.211
+gcgtc 0.275 0.221 0.117
+gcgtg 0.292 0.221 0.258
+gcgtt 0.192 0.309 0.414
+gctaa 0.349 0.364 0.0644
+gctac 0.265 0.169 0.332
+gctag 0.214 0.163 0.0644
+gctat 0.172 0.305 0.54
+gctca 0.363 0.307 0.344
+gctcc 0.226 0.3 0.212
+gctcg 0.184 0.159 0.0991
+gctct 0.226 0.233 0.344
+gctga 0.335 0.333 0.0813
+gctgc 0.325 0.293 0.356
+gctgg 0.228 0.209 0.269
+gctgt 0.112 0.165 0.294
+gctta 0.211 0.183 0.188
+gcttc 0.293 0.332 0.257
+gcttg 0.313 0.168 0.211
+gcttt 0.183 0.317 0.344
+ggaaa 0.367 0.384 0.314
+ggaac 0.158 0.178 0.15
+ggaag 0.33 0.178 0.195
+ggaat 0.145 0.26 0.342
+ggaca 0.356 0.25 0.342
+ggacc 0.248 0.267 0.209
+ggacg 0.14 0.198 0.0969
+ggact 0.257 0.284 0.352
+ggaga 0.332 0.272 0.344
+ggagc 0.243 0.285 0.253
+ggagg 0.257 0.171 0.162
+ggagt 0.168 0.272 0.24
+ggata 0.224 0.269 0.246
+ggatc 0.258 0.219 0.139
+ggatg 0.311 0.206 0.275
+ggatt 0.207 0.306 0.339
+ggcaa 0.332 0.405 0.35
+ggcac 0.219 0.205 0.126
+ggcag 0.278 0.165 0.248
+ggcat 0.17 0.225 0.276
+ggcca 0.522 0.32 0.361
+ggccc 0.201 0.205 0.171
+ggccg 0.112 0.156 0.146
+ggcct 0.165 0.32 0.323
+ggcga 0.33 0.315 0.302
+ggcgc 0.33 0.207 0.281
+ggcgg 0.17 0.25 0.156
+ggcgt 0.17 0.228 0.26
+ggcta 0.244 0.24 0.189
+ggctc 0.235 0.227 0.189
+ggctg 0.343 0.162 0.241
+ggctt 0.179 0.37 0.382
+gggaa 0.427 0.324 0.317
+gggac 0.179 0.222 0.141
+gggag 0.227 0.21 0.239
+gggat 0.167 0.244 0.304
+gggca 0.428 0.289 0.298
+gggcc 0.253 0.211 0.187
+gggcg 0.16 0.148 0.106
+gggct 0.16 0.352 0.409
+gggga 0.399 0.331 0.385
+ggggc 0.259 0.315 0.221
+ggggg 0.209 0.192 0.172
+ggggt 0.133 0.162 0.221
+gggta 0.121 0.186 0.189
+gggtc 0.309 0.245 0.156
+gggtg 0.348 0.147 0.27
+gggtt 0.223 0.422 0.385
+ggtaa 0.314 0.278 0.114
+ggtac 0.186 0.198 0.377
+ggtag 0.286 0.183 0.114
+ggtat 0.214 0.341 0.395
+ggtca 0.359 0.24 0.377
+ggtcc 0.288 0.201 0.267
+ggtcg 0.126 0.149 0.13
+ggtct 0.227 0.409 0.226
+ggtga 0.316 0.332 0.135
+ggtgc 0.286 0.236 0.219
+ggtgg 0.199 0.252 0.406
+ggtgt 0.199 0.18 0.24
+ggtta 0.279 0.197 0.261
+ggttc 0.207 0.23 0.192
+ggttg 0.36 0.174 0.261
+ggttt 0.155 0.399 0.286
+gtaaa 0.25 0.361 0.331
+gtaac 0.25 0.215 0.204
+gtaag 0.25 0.113 0.161
+gtaat 0.25 0.31 0.304
+gtaca 0.399 0.386 0.321
+gtacc 0.241 0.288 0.235
+gtacg 0.136 0.103 0.107
+gtact 0.224 0.223 0.338
+gtaga 0.25 0.365 0.298
+gtagc 0.25 0.266 0.307
+gtagg 0.25 0.168 0.161
+gtagt 0.25 0.201 0.234
+gtata 0.206 0.217 0.267
+gtatc 0.275 0.279 0.195
+gtatg 0.34 0.137 0.166
+gtatt 0.179 0.367 0.372
+gtcaa 0.371 0.33 0.311
+gtcac 0.181 0.197 0.235
+gtcag 0.267 0.157 0.184
+gtcat 0.181 0.317 0.27
+gtcca 0.47 0.287 0.308
+gtccc 0.197 0.197 0.189
+gtccg 0.146 0.152 0.0868
+gtcct 0.187 0.365 0.416
+gtcga 0.274 0.318 0.285
+gtcgc 0.179 0.236 0.285
+gtcgg 0.321 0.182 0.171
+gtcgt 0.226 0.264 0.259
+gtcta 0.317 0.244 0.187
+gtctc 0.251 0.278 0.225
+gtctg 0.257 0.141 0.178
+gtctt 0.175 0.338 0.41
+gtgaa 0.25 0.391 0.29
+gtgac 0.25 0.201 0.144
+gtgag 0.25 0.151 0.138
+gtgat 0.25 0.257 0.427
+gtgca 0.299 0.288 0.32
+gtgcc 0.266 0.201 0.198
+gtgcg 0.158 0.125 0.0608
+gtgct 0.277 0.386 0.422
+gtgga 0.277 0.431 0.338
+gtggc 0.323 0.264 0.218
+gtggg 0.214 0.153 0.166
+gtggt 0.186 0.153 0.278
+gtgta 0.192 0.182 0.168
+gtgtc 0.203 0.288 0.228
+gtgtg 0.39 0.182 0.164
+gtgtt 0.215 0.347 0.44
+gttaa 0.259 0.285 0.0533
+gttac 0.253 0.215 0.373
+gttag 0.283 0.174 0.0533
+gttat 0.205 0.326 0.52
+gttca 0.382 0.285 0.327
+gttcc 0.22 0.291 0.209
+gttcg 0.14 0.0897 0.0754
+gttct 0.258 0.334 0.388
+gttga 0.356 0.359 0.0596
+gttgc 0.24 0.22 0.372
+gttgg 0.221 0.209 0.381
+gttgt 0.183 0.212 0.188
+gttta 0.211 0.175 0.223
+gtttc 0.25 0.291 0.298
+gtttg 0.389 0.132 0.198
+gtttt 0.15 0.402 0.281
+taaaa 0.279 0.299 0.321
+taaac 0.235 0.201 0.15
+taaag 0.298 0.187 0.222
+taaat 0.188 0.312 0.307
+taaca 0.388 0.332 0.34
+taacc 0.3 0.21 0.294
+taacg 0.108 0.145 0.0649
+taact 0.204 0.313 0.302
+taaga 0.382 0.412 0.354
+taagc 0.233 0.221 0.254
+taagg 0.233 0.16 0.179
+taagt 0.152 0.207 0.213
+taata 0.264 0.15 0.191
+taatc 0.225 0.264 0.176
+taatg 0.346 0.159 0.285
+taatt 0.166 0.427 0.349
+tacaa 0.341 0.387 0.31
+tacac 0.233 0.223 0.178
+tacag 0.247 0.113 0.202
+tacat 0.179 0.277 0.31
+tacca 0.293 0.31 0.361
+taccc 0.261 0.299 0.13
+taccg 0.176 0.114 0.0913
+tacct 0.271 0.277 0.418
+tacga 0.337 0.296 0.302
+tacgc 0.228 0.214 0.233
+tacgg 0.25 0.235 0.267
+tacgt 0.185 0.255 0.198
+tacta 0.303 0.16 0.253
+tactc 0.216 0.296 0.177
+tactg 0.347 0.238 0.17
+tactt 0.134 0.306 0.399
+tagaa 0.371 0.382 0.346
+tagac 0.191 0.197 0.138
+tagag 0.262 0.122 0.201
+tagat 0.176 0.298 0.314
+tagca 0.379 0.372 0.407
+tagcc 0.225 0.236 0.183
+tagcg 0.126 0.128 0.0609
+tagct 0.269 0.264 0.349
+tagga 0.325 0.477 0.509
+taggc 0.278 0.247 0.173
+taggg 0.262 0.155 0.164
+taggt 0.135 0.121 0.154
+tagta 0.204 0.193 0.277
+tagtc 0.237 0.233 0.178
+tagtg 0.354 0.113 0.201
+tagtt 0.204 0.46 0.345
+tataa 0.332 0.243 0.0677
+tatac 0.263 0.214 0.37
+tatag 0.188 0.146 0.0677
+tatat 0.217 0.397 0.495
+tatca 0.438 0.352 0.377
+tatcc 0.229 0.245 0.216
+tatcg 0.171 0.0973 0.106
+tatct 0.162 0.305 0.301
+tatga 0.29 0.36 0.0684
+tatgc 0.254 0.252 0.3
+tatgg 0.344 0.209 0.363
+tatgt 0.111 0.179 0.268
+tatta 0.233 0.173 0.235
+tattc 0.276 0.276 0.231
+tattg 0.327 0.142 0.211
+tattt 0.164 0.409 0.323
+tcaaa 0.31 0.339 0.314
+tcaac 0.267 0.253 0.215
+tcaag 0.218 0.187 0.179
+tcaat 0.206 0.22 0.292
+tcaca 0.371 0.316 0.362
+tcacc 0.242 0.286 0.167
+tcacg 0.134 0.112 0.118
+tcact 0.253 0.286 0.354
+tcaga 0.413 0.419 0.312
+tcagc 0.238 0.238 0.187
+tcagg 0.18 0.178 0.149
+tcagt 0.17 0.164 0.351
+tcata 0.265 0.193 0.25
+tcatc 0.265 0.242 0.175
+tcatg 0.284 0.193 0.158
+tcatt 0.186 0.373 0.417
+tccaa 0.272 0.369 0.286
+tccac 0.257 0.226 0.205
+tccag 0.228 0.147 0.195
+tccat 0.243 0.258 0.314
+tccca 0.372 0.242 0.324
+tcccc 0.25 0.289 0.165
+tcccg 0.169 0.102 0.108
+tccct 0.209 0.367 0.403
+tccga 0.256 0.307 0.265
+tccgc 0.278 0.219 0.363
+tccgg 0.256 0.184 0.147
+tccgt 0.211 0.289 0.225
+tccta 0.197 0.187 0.126
+tcctc 0.266 0.223 0.272
+tcctg 0.323 0.151 0.118
+tcctt 0.214 0.44 0.484
+tcgaa 0.326 0.316 0.312
+tcgac 0.21 0.194 0.222
+tcgag 0.225 0.153 0.176
+tcgat 0.239 0.337 0.29
+tcgca 0.366 0.256 0.336
+tcgcc 0.216 0.256 0.227
+tcgcg 0.216 0.233 0.136
+tcgct 0.201 0.256 0.3
+tcgga 0.315 0.288 0.3
+tcggc 0.25 0.263 0.209
+tcggg 0.25 0.238 0.227
+tcggt 0.185 0.213 0.264
+tcgta 0.242 0.25 0.211
+tcgtc 0.275 0.221 0.117
+tcgtg 0.292 0.221 0.258
+tcgtt 0.192 0.309 0.414
+tctaa 0.349 0.364 0.0644
+tctac 0.265 0.169 0.332
+tctag 0.214 0.163 0.0644
+tctat 0.172 0.305 0.54
+tctca 0.363 0.307 0.344
+tctcc 0.226 0.3 0.212
+tctcg 0.184 0.159 0.0991
+tctct 0.226 0.233 0.344
+tctga 0.335 0.333 0.0813
+tctgc 0.325 0.293 0.356
+tctgg 0.228 0.209 0.269
+tctgt 0.112 0.165 0.294
+tctta 0.211 0.183 0.188
+tcttc 0.293 0.332 0.257
+tcttg 0.313 0.168 0.211
+tcttt 0.183 0.317 0.344
+tgaaa 0.367 0.384 0.314
+tgaac 0.158 0.178 0.15
+tgaag 0.33 0.178 0.195
+tgaat 0.145 0.26 0.342
+tgaca 0.356 0.25 0.342
+tgacc 0.248 0.267 0.209
+tgacg 0.14 0.198 0.0969
+tgact 0.257 0.284 0.352
+tgaga 0.332 0.272 0.344
+tgagc 0.243 0.285 0.253
+tgagg 0.257 0.171 0.162
+tgagt 0.168 0.272 0.24
+tgata 0.224 0.269 0.246
+tgatc 0.258 0.219 0.139
+tgatg 0.311 0.206 0.275
+tgatt 0.207 0.306 0.339
+tgcaa 0.332 0.405 0.35
+tgcac 0.219 0.205 0.126
+tgcag 0.278 0.165 0.248
+tgcat 0.17 0.225 0.276
+tgcca 0.522 0.32 0.361
+tgccc 0.201 0.205 0.171
+tgccg 0.112 0.156 0.146
+tgcct 0.165 0.32 0.323
+tgcga 0.33 0.315 0.302
+tgcgc 0.33 0.207 0.281
+tgcgg 0.17 0.25 0.156
+tgcgt 0.17 0.228 0.26
+tgcta 0.244 0.24 0.189
+tgctc 0.235 0.227 0.189
+tgctg 0.343 0.162 0.241
+tgctt 0.179 0.37 0.382
+tggaa 0.427 0.324 0.317
+tggac 0.179 0.222 0.141
+tggag 0.227 0.21 0.239
+tggat 0.167 0.244 0.304
+tggca 0.428 0.289 0.298
+tggcc 0.253 0.211 0.187
+tggcg 0.16 0.148 0.106
+tggct 0.16 0.352 0.409
+tggga 0.399 0.331 0.385
+tgggc 0.259 0.315 0.221
+tgggg 0.209 0.192 0.172
+tgggt 0.133 0.162 0.221
+tggta 0.121 0.186 0.189
+tggtc 0.309 0.245 0.156
+tggtg 0.348 0.147 0.27
+tggtt 0.223 0.422 0.385
+tgtaa 0.314 0.278 0.114
+tgtac 0.186 0.198 0.377
+tgtag 0.286 0.183 0.114
+tgtat 0.214 0.341 0.395
+tgtca 0.359 0.24 0.377
+tgtcc 0.288 0.201 0.267
+tgtcg 0.126 0.149 0.13
+tgtct 0.227 0.409 0.226
+tgtga 0.316 0.332 0.135
+tgtgc 0.286 0.236 0.219
+tgtgg 0.199 0.252 0.406
+tgtgt 0.199 0.18 0.24
+tgtta 0.279 0.197 0.261
+tgttc 0.207 0.23 0.192
+tgttg 0.36 0.174 0.261
+tgttt 0.155 0.399 0.286
+ttaaa 0.25 0.361 0.331
+ttaac 0.25 0.215 0.204
+ttaag 0.25 0.113 0.161
+ttaat 0.25 0.31 0.304
+ttaca 0.399 0.386 0.321
+ttacc 0.241 0.288 0.235
+ttacg 0.136 0.103 0.107
+ttact 0.224 0.223 0.338
+ttaga 0.25 0.365 0.298
+ttagc 0.25 0.266 0.307
+ttagg 0.25 0.168 0.161
+ttagt 0.25 0.201 0.234
+ttata 0.206 0.217 0.267
+ttatc 0.275 0.279 0.195
+ttatg 0.34 0.137 0.166
+ttatt 0.179 0.367 0.372
+ttcaa 0.371 0.33 0.311
+ttcac 0.181 0.197 0.235
+ttcag 0.267 0.157 0.184
+ttcat 0.181 0.317 0.27
+ttcca 0.47 0.287 0.308
+ttccc 0.197 0.197 0.189
+ttccg 0.146 0.152 0.0868
+ttcct 0.187 0.365 0.416
+ttcga 0.274 0.318 0.285
+ttcgc 0.179 0.236 0.285
+ttcgg 0.321 0.182 0.171
+ttcgt 0.226 0.264 0.259
+ttcta 0.317 0.244 0.187
+ttctc 0.251 0.278 0.225
+ttctg 0.257 0.141 0.178
+ttctt 0.175 0.338 0.41
+ttgaa 0.25 0.391 0.29
+ttgac 0.25 0.201 0.144
+ttgag 0.25 0.151 0.138
+ttgat 0.25 0.257 0.427
+ttgca 0.299 0.288 0.32
+ttgcc 0.266 0.201 0.198
+ttgcg 0.158 0.125 0.0608
+ttgct 0.277 0.386 0.422
+ttgga 0.277 0.431 0.338
+ttggc 0.323 0.264 0.218
+ttggg 0.214 0.153 0.166
+ttggt 0.186 0.153 0.278
+ttgta 0.192 0.182 0.168
+ttgtc 0.203 0.288 0.228
+ttgtg 0.39 0.182 0.164
+ttgtt 0.215 0.347 0.44
+tttaa 0.259 0.285 0.0533
+tttac 0.253 0.215 0.373
+tttag 0.283 0.174 0.0533
+tttat 0.205 0.326 0.52
+tttca 0.382 0.285 0.327
+tttcc 0.22 0.291 0.209
+tttcg 0.14 0.0897 0.0754
+tttct 0.258 0.334 0.388
+tttga 0.356 0.359 0.0596
+tttgc 0.24 0.22 0.372
+tttgg 0.221 0.209 0.381
+tttgt 0.183 0.212 0.188
+tttta 0.211 0.175 0.223
+ttttc 0.25 0.291 0.298
+ttttg 0.389 0.132 0.198
+ttttt 0.15 0.402 0.281
diff --git a/config/species/coyote_tobacco/coyote_tobacco_igenic_probs.pbl b/config/species/coyote_tobacco/coyote_tobacco_igenic_probs.pbl
new file mode 100644
index 0000000..71e021c
--- /dev/null
+++ b/config/species/coyote_tobacco/coyote_tobacco_igenic_probs.pbl
@@ -0,0 +1,2420 @@
+[1]
+# (a,c,g,t)= (0.237, 0.263, 0.263, 0.237)
+#
+# Probabilities file for the intergenic region model
+#
+
+# k =
+4
+
+# The P_l's
+[P_ls]
+# l=
+0
+# Values
+A 0.321
+C 0.179
+G 0.179
+T 0.321
+# l=
+1
+# Values
+AA 0.117
+AC 0.051
+AG 0.0578
+AT 0.0952
+CA 0.0618
+CC 0.0381
+CG 0.0213
+CT 0.0578
+GA 0.0579
+GC 0.032
+GG 0.0381
+GT 0.051
+TA 0.0843
+TC 0.0579
+TG 0.0618
+TT 0.117
+# l=
+2
+# Values
+AAA 0.045
+AAC 0.0177
+AAG 0.0213
+AAT 0.0331
+ACA 0.0182
+ACC 0.0107
+ACG 0.00568
+ACT 0.0164
+AGA 0.0192
+AGC 0.0105
+AGG 0.0117
+AGT 0.0164
+ATA 0.0287
+ATC 0.0155
+ATG 0.0179
+ATT 0.0331
+CAA 0.0232
+CAC 0.011
+CAG 0.00975
+CAT 0.0179
+CCA 0.0132
+CCC 0.00843
+CCG 0.00481
+CCT 0.0117
+CGA 0.00709
+CGC 0.00376
+CGG 0.00481
+CGT 0.00568
+CTA 0.0144
+CTC 0.0123
+CTG 0.00975
+CTT 0.0213
+GAA 0.0215
+GAC 0.0086
+GAG 0.0123
+GAT 0.0155
+GCA 0.0111
+GCC 0.00669
+GCG 0.00376
+GCT 0.0105
+GGA 0.0123
+GGC 0.00669
+GGG 0.00843
+GGT 0.0107
+GTA 0.0138
+GTC 0.0086
+GTG 0.011
+GTT 0.0177
+TAA 0.0273
+TAC 0.0138
+TAG 0.0144
+TAT 0.0287
+TCA 0.0193
+TCC 0.0123
+TCG 0.00709
+TCT 0.0192
+TGA 0.0193
+TGC 0.0111
+TGG 0.0132
+TGT 0.0182
+TTA 0.0273
+TTC 0.0215
+TTG 0.0232
+TTT 0.045
+# l=
+3
+# Values
+AAAA 0.0177
+AAAC 0.00629
+AAAG 0.00772
+AAAT 0.0133
+AACA 0.0065
+AACC 0.00349
+AACG 0.00176
+AACT 0.00591
+AAGA 0.00742
+AAGC 0.00359
+AAGG 0.00428
+AAGT 0.00606
+AATA 0.0103
+AATC 0.00521
+AATG 0.00579
+AATT 0.0117
+ACAA 0.00707
+ACAC 0.00319
+ACAG 0.00267
+ACAT 0.00527
+ACCA 0.00387
+ACCC 0.00237
+ACCG 0.00129
+ACCT 0.00316
+ACGA 0.00188
+ACGC 0.000981
+ACGG 0.00121
+ACGT 0.00161
+ACTA 0.00446
+ACTC 0.00317
+ACTG 0.00276
+ACTT 0.00606
+AGAA 0.00771
+AGAC 0.00251
+AGAG 0.00403
+AGAT 0.00495
+AGCA 0.0038
+AGCC 0.0021
+AGCG 0.00101
+AGCT 0.00355
+AGGA 0.00397
+AGGC 0.002
+AGGG 0.00255
+AGGT 0.00316
+AGTA 0.00462
+AGTC 0.0026
+AGTG 0.00331
+AGTT 0.00591
+ATAA 0.00937
+ATAC 0.00436
+ATAG 0.00444
+ATAT 0.0105
+ATCA 0.0056
+ATCC 0.00319
+ATCG 0.00178
+ATCT 0.00495
+ATGA 0.00576
+ATGC 0.00319
+ATGG 0.00364
+ATGT 0.00527
+ATTA 0.00844
+ATTC 0.00544
+ATTG 0.00591
+ATTT 0.0133
+CAAA 0.00891
+CAAC 0.00405
+CAAG 0.00431
+CAAT 0.00591
+CACA 0.00383
+CACC 0.00247
+CACG 0.00138
+CACT 0.00331
+CAGA 0.00317
+CAGC 0.00208
+CAGG 0.00174
+CAGT 0.00276
+CATA 0.00502
+CATC 0.00334
+CATG 0.00372
+CATT 0.00579
+CCAA 0.00505
+CCAC 0.00252
+CCAG 0.00196
+CCAT 0.00364
+CCCA 0.00267
+CCCC 0.00206
+CCCG 0.00115
+CCCT 0.00255
+CCGA 0.00158
+CCGC 0.000926
+CCGG 0.0011
+CCGT 0.00121
+CCTA 0.0028
+CCTC 0.00286
+CCTG 0.00174
+CCTT 0.00428
+CGAA 0.00238
+CGAC 0.00127
+CGAG 0.00165
+CGAT 0.00178
+CGCA 0.00115
+CGCC 0.000943
+CGCG 0.000653
+CGCT 0.00101
+CGGA 0.00147
+CGGC 0.000896
+CGGG 0.00115
+CGGT 0.00129
+CGTA 0.00145
+CGTC 0.00108
+CGTG 0.00138
+CGTT 0.00176
+CTAA 0.00465
+CTAC 0.00269
+CTAG 0.00266
+CTAT 0.00444
+CTCA 0.00369
+CTCC 0.00287
+CTCG 0.00165
+CTCT 0.00404
+CTGA 0.00299
+CTGC 0.00213
+CTGG 0.00196
+CTGT 0.00267
+CTTA 0.00457
+CTTC 0.00475
+CTTG 0.00431
+CTTT 0.00772
+GAAA 0.00819
+GAAC 0.00316
+GAAG 0.00475
+GAAT 0.00544
+GACA 0.00295
+GACC 0.00197
+GACG 0.00108
+GACT 0.0026
+GAGA 0.00416
+GAGC 0.00206
+GAGG 0.00286
+GAGT 0.00316
+GATA 0.00428
+GATC 0.00269
+GATG 0.00334
+GATT 0.00521
+GCAA 0.00384
+GCAC 0.00193
+GCAG 0.00213
+GCAT 0.00319
+GCCA 0.00236
+GCCC 0.00144
+GCCG 0.000896
+GCCT 0.002
+GCGA 0.00116
+GCGC 0.000692
+GCGG 0.000926
+GCGT 0.000981
+GCTA 0.00273
+GCTC 0.00206
+GCTG 0.00208
+GCTT 0.00359
+GGAA 0.00435
+GGAC 0.00188
+GGAG 0.00287
+GGAT 0.00319
+GGCA 0.00211
+GGCC 0.00153
+GGCG 0.000943
+GGCT 0.0021
+GGGA 0.00256
+GGGC 0.00144
+GGGG 0.00206
+GGGT 0.00237
+GGTA 0.00275
+GGTC 0.00197
+GGTG 0.00247
+GGTT 0.00349
+GTAA 0.00437
+GTAC 0.00234
+GTAG 0.00269
+GTAT 0.00436
+GTCA 0.00293
+GTCC 0.00188
+GTCG 0.00127
+GTCT 0.00252
+GTGA 0.00336
+GTGC 0.00193
+GTGG 0.00252
+GTGT 0.00319
+GTTA 0.00417
+GTTC 0.00316
+GTTG 0.00405
+GTTT 0.00629
+TAAA 0.0102
+TAAC 0.00417
+TAAG 0.00457
+TAAT 0.00845
+TACA 0.00493
+TACC 0.00275
+TACG 0.00145
+TACT 0.00462
+TAGA 0.00446
+TAGC 0.00273
+TAGG 0.0028
+TAGT 0.00446
+TATA 0.0091
+TATC 0.00428
+TATG 0.00502
+TATT 0.0103
+TCAA 0.00722
+TCAC 0.00336
+TCAG 0.00299
+TCAT 0.00576
+TCCA 0.00428
+TCCC 0.00256
+TCCG 0.00147
+TCCT 0.00397
+TCGA 0.00247
+TCGC 0.00116
+TCGG 0.00158
+TCGT 0.00188
+TCTA 0.00446
+TCTC 0.00416
+TCTG 0.00317
+TCTT 0.00742
+TGAA 0.0071
+TGAC 0.00293
+TGAG 0.00369
+TGAT 0.0056
+TGCA 0.00402
+TGCC 0.00211
+TGCG 0.00115
+TGCT 0.0038
+TGGA 0.00428
+TGGC 0.00236
+TGGG 0.00267
+TGGT 0.00387
+TGTA 0.00493
+TGTC 0.00295
+TGTG 0.00383
+TGTT 0.0065
+TTAA 0.00896
+TTAC 0.00437
+TTAG 0.00465
+TTAT 0.00937
+TTCA 0.0071
+TTCC 0.00435
+TTCG 0.00238
+TTCT 0.00771
+TTGA 0.00722
+TTGC 0.00384
+TTGG 0.00505
+TTGT 0.00707
+TTTA 0.0102
+TTTC 0.00819
+TTTG 0.00891
+TTTT 0.0177
+# l=
+4
+# Values
+AAAAA 0.00694
+AAAAC 0.00229
+AAAAG 0.00314
+AAAAT 0.00531
+AAACA 0.00236
+AAACC 0.00123
+AAACG 0.000632
+AAACT 0.00207
+AAAGA 0.0028
+AAAGC 0.00124
+AAAGG 0.00154
+AAAGT 0.00214
+AAATA 0.00444
+AAATC 0.00209
+AAATG 0.00231
+AAATT 0.00442
+AACAA 0.00266
+AACAC 0.00109
+AACAG 0.000997
+AACAT 0.00176
+AACCA 0.0013
+AACCC 0.000773
+AACCG 0.000418
+AACCT 0.001
+AACGA 0.000617
+AACGC 0.000289
+AACGG 0.000406
+AACGT 0.000453
+AACTA 0.00156
+AACTC 0.00119
+AACTG 0.000961
+AACTT 0.00219
+AAGAA 0.00324
+AAGAC 0.0009
+AAGAG 0.00146
+AAGAT 0.00182
+AAGCA 0.00135
+AAGCC 0.000667
+AAGCG 0.000354
+AAGCT 0.00122
+AAGGA 0.00152
+AAGGC 0.000701
+AAGGG 0.000944
+AAGGT 0.00111
+AAGTA 0.00166
+AAGTC 0.000954
+AAGTG 0.00126
+AAGTT 0.00219
+AATAA 0.0036
+AATAC 0.00155
+AATAG 0.00164
+AATAT 0.00353
+AATCA 0.00192
+AATCC 0.00109
+AATCG 0.000566
+AATCT 0.00163
+AATGA 0.00197
+AATGC 0.00101
+AATGG 0.00122
+AATGT 0.00158
+AATTA 0.00326
+AATTC 0.00195
+AATTG 0.00212
+AATTT 0.00442
+ACAAA 0.0026
+ACAAC 0.0013
+ACAAG 0.00135
+ACAAT 0.00183
+ACACA 0.00123
+ACACC 0.000654
+ACACG 0.000366
+ACACT 0.000938
+ACAGA 0.000922
+ACAGC 0.000481
+ACAGG 0.000474
+ACAGT 0.000793
+ACATA 0.00163
+ACATC 0.000895
+ACATG 0.00116
+ACATT 0.00158
+ACCAA 0.00155
+ACCAC 0.000728
+ACCAG 0.000565
+ACCAT 0.00103
+ACCCA 0.000751
+ACCCC 0.000564
+ACCCG 0.000338
+ACCCT 0.000717
+ACCGA 0.000425
+ACCGC 0.000237
+ACCGG 0.000317
+ACCGT 0.000312
+ACCTA 0.000768
+ACCTC 0.00077
+ACCTG 0.000511
+ACCTT 0.00111
+ACGAA 0.000643
+ACGAC 0.000374
+ACGAG 0.000428
+ACGAT 0.000439
+ACGCA 0.000309
+ACGCC 0.000245
+ACGCG 0.000177
+ACGCT 0.00025
+ACGGA 0.000385
+ACGGC 0.000217
+ACGGG 0.000292
+ACGGT 0.000312
+ACGTA 0.000436
+ACGTC 0.000278
+ACGTG 0.000439
+ACGTT 0.000453
+ACTAA 0.00145
+ACTAC 0.000827
+ACTAG 0.000827
+ACTAT 0.00135
+ACTCA 0.00102
+ACTCC 0.000751
+ACTCG 0.0004
+ACTCT 0.000998
+ACTGA 0.00085
+ACTGC 0.000536
+ACTGG 0.000584
+ACTGT 0.000793
+ACTTA 0.00139
+ACTTC 0.00121
+ACTTG 0.00132
+ACTTT 0.00214
+AGAAA 0.00309
+AGAAC 0.001
+AGAAG 0.00177
+AGAAT 0.00186
+AGACA 0.000922
+AGACC 0.000514
+AGACG 0.000305
+AGACT 0.000775
+AGAGA 0.00158
+AGAGC 0.000585
+AGAGG 0.000871
+AGAGT 0.000998
+AGATA 0.00142
+AGATC 0.000818
+AGATG 0.00108
+AGATT 0.00163
+AGCAA 0.00139
+AGCAC 0.000608
+AGCAG 0.000739
+AGCAT 0.00106
+AGCCA 0.000776
+AGCCC 0.000452
+AGCCG 0.00026
+AGCCT 0.000613
+AGCGA 0.000329
+AGCGC 0.000179
+AGCGG 0.000254
+AGCGT 0.00025
+AGCTA 0.000946
+AGCTC 0.00069
+AGCTG 0.000693
+AGCTT 0.00122
+AGGAA 0.00153
+AGGAC 0.000553
+AGGAG 0.000915
+AGGAT 0.000977
+AGGCA 0.000697
+AGGCC 0.000428
+AGGCG 0.000262
+AGGCT 0.000613
+AGGGA 0.000817
+AGGGC 0.000389
+AGGGG 0.000629
+AGGGT 0.000717
+AGGTA 0.000852
+AGGTC 0.000568
+AGGTG 0.000732
+AGGTT 0.001
+AGTAA 0.00151
+AGTAC 0.000771
+AGTAG 0.000953
+AGTAT 0.00139
+AGTCA 0.000927
+AGTCC 0.000567
+AGTCG 0.000331
+AGTCT 0.000775
+AGTGA 0.00107
+AGTGC 0.000568
+AGTGG 0.000737
+AGTGT 0.000938
+AGTTA 0.00145
+AGTTC 0.00107
+AGTTG 0.00132
+AGTTT 0.00207
+ATAAA 0.00351
+ATAAC 0.0014
+ATAAG 0.0015
+ATAAT 0.00297
+ATACA 0.00173
+ATACC 0.000808
+ATACG 0.000437
+ATACT 0.00139
+ATAGA 0.00145
+ATAGC 0.000823
+ATAGG 0.000819
+ATAGT 0.00135
+ATATA 0.00385
+ATATC 0.0014
+ATATG 0.00177
+ATATT 0.00353
+ATCAA 0.00208
+ATCAC 0.001
+ATCAG 0.000858
+ATCAT 0.00166
+ATCCA 0.00114
+ATCCC 0.00068
+ATCCG 0.0004
+ATCCT 0.000977
+ATCGA 0.000656
+ATCGC 0.000288
+ATCGG 0.000399
+ATCGT 0.000439
+ATCTA 0.00119
+ATCTC 0.00107
+ATCTG 0.000869
+ATCTT 0.00182
+ATGAA 0.00213
+ATGAC 0.000898
+ATGAG 0.00108
+ATGAT 0.00166
+ATGCA 0.00119
+ATGCC 0.000607
+ATGCG 0.000332
+ATGCT 0.00106
+ATGGA 0.00122
+ATGGC 0.000678
+ATGGG 0.00071
+ATGGT 0.00103
+ATGTA 0.0015
+ATGTC 0.000859
+ATGTG 0.00115
+ATGTT 0.00176
+ATTAA 0.0028
+ATTAC 0.00129
+ATTAG 0.00139
+ATTAT 0.00297
+ATTCA 0.0019
+ATTCC 0.00109
+ATTCG 0.000595
+ATTCT 0.00186
+ATTGA 0.00191
+ATTGC 0.000989
+ATTGG 0.00119
+ATTGT 0.00183
+ATTTA 0.00312
+ATTTC 0.00225
+ATTTG 0.00259
+ATTTT 0.00531
+CAAAA 0.00341
+CAAAC 0.00147
+CAAAG 0.00145
+CAAAT 0.00259
+CAACA 0.00154
+CAACC 0.00081
+CAACG 0.000376
+CAACT 0.00132
+CAAGA 0.00141
+CAAGC 0.00076
+CAAGG 0.000817
+CAAGT 0.00132
+CAATA 0.00172
+CAATC 0.000996
+CAATG 0.00108
+CAATT 0.00212
+CACAA 0.00143
+CACAC 0.000736
+CACAG 0.000515
+CACAT 0.00115
+CACCA 0.000929
+CACCC 0.000534
+CACCG 0.000278
+CACCT 0.000732
+CACGA 0.000435
+CACGC 0.000244
+CACGG 0.000259
+CACGT 0.000439
+CACTA 0.0009
+CACTC 0.000607
+CACTG 0.00055
+CACTT 0.00126
+CAGAA 0.00123
+CAGAC 0.000448
+CAGAG 0.000617
+CAGAT 0.000869
+CAGCA 0.000786
+CAGCC 0.00042
+CAGCG 0.000178
+CAGCT 0.000693
+CAGGA 0.000565
+CAGGC 0.000307
+CAGGG 0.000356
+CAGGT 0.000511
+CAGTA 0.000787
+CAGTC 0.000464
+CAGTG 0.00055
+CAGTT 0.000961
+CATAA 0.0017
+CATAC 0.000768
+CATAG 0.000781
+CATAT 0.00177
+CATCA 0.00124
+CATCC 0.000655
+CATCG 0.000362
+CATCT 0.00108
+CATGA 0.00115
+CATGC 0.000675
+CATGG 0.000738
+CATGT 0.00116
+CATTA 0.00139
+CATTC 0.001
+CATTG 0.00108
+CATTT 0.00231
+CCAAA 0.00212
+CCAAC 0.000855
+CCAAG 0.000883
+CCAAT 0.00119
+CCACA 0.000796
+CCACC 0.000664
+CCACG 0.000319
+CCACT 0.000737
+CCAGA 0.000582
+CCAGC 0.000463
+CCAGG 0.000335
+CCAGT 0.000584
+CCATA 0.000972
+CCATC 0.000706
+CCATG 0.000738
+CCATT 0.00122
+CCCAA 0.00104
+CCCAC 0.000541
+CCCAG 0.000378
+CCCAT 0.00071
+CCCCA 0.0006
+CCCCC 0.000585
+CCCCG 0.000249
+CCCCT 0.000629
+CCCGA 0.00039
+CCCGC 0.000216
+CCCGG 0.000252
+CCCGT 0.000292
+CCCTA 0.000612
+CCCTC 0.00064
+CCCTG 0.000356
+CCCTT 0.000944
+CCGAA 0.00053
+CCGAC 0.000277
+CCGAG 0.00037
+CCGAT 0.000399
+CCGCA 0.000291
+CCGCC 0.000238
+CCGCG 0.000143
+CCGCT 0.000254
+CCGGA 0.000333
+CCGGC 0.000201
+CCGGG 0.000252
+CCGGT 0.000317
+CCGTA 0.0003
+CCGTC 0.000241
+CCGTG 0.000259
+CCGTT 0.000406
+CCTAA 0.00095
+CCTAC 0.000529
+CCTAG 0.000502
+CCTAT 0.000819
+CCTCA 0.000809
+CCTCC 0.000721
+CCTCG 0.000463
+CCTCT 0.000871
+CCTGA 0.000529
+CCTGC 0.000401
+CCTGG 0.000335
+CCTGT 0.000474
+CCTTA 0.000964
+CCTTC 0.00095
+CCTTG 0.000817
+CCTTT 0.00154
+CGAAA 0.000831
+CGAAC 0.000446
+CGAAG 0.000507
+CGAAT 0.000595
+CGACA 0.000355
+CGACC 0.000392
+CGACG 0.000196
+CGACT 0.000331
+CGAGA 0.000445
+CGAGC 0.000343
+CGAGG 0.000463
+CGAGT 0.0004
+CGATA 0.000467
+CGATC 0.000386
+CGATG 0.000362
+CGATT 0.000566
+CGCAA 0.000365
+CGCAC 0.000236
+CGCAG 0.000216
+CGCAT 0.000332
+CGCCA 0.000307
+CGCCC 0.000219
+CGCCG 0.000155
+CGCCT 0.000262
+CGCGA 0.000201
+CGCGC 0.000132
+CGCGG 0.000143
+CGCGT 0.000177
+CGCTA 0.000252
+CGCTC 0.000228
+CGCTG 0.000178
+CGCTT 0.000354
+CGGAA 0.000475
+CGGAC 0.000263
+CGGAG 0.000336
+CGGAT 0.0004
+CGGCA 0.000244
+CGGCC 0.000237
+CGGCG 0.000155
+CGGCT 0.00026
+CGGGA 0.000326
+CGGGC 0.000237
+CGGGG 0.000249
+CGGGT 0.000338
+CGGTA 0.00031
+CGGTC 0.000285
+CGGTG 0.000278
+CGGTT 0.000418
+CGTAA 0.000438
+CGTAC 0.000297
+CGTAG 0.000282
+CGTAT 0.000437
+CGTCA 0.000339
+CGTCC 0.000242
+CGTCG 0.000196
+CGTCT 0.000305
+CGTGA 0.000413
+CGTGC 0.00028
+CGTGG 0.000319
+CGTGT 0.000366
+CGTTA 0.000421
+CGTTC 0.000335
+CGTTG 0.000376
+CGTTT 0.000632
+CTAAA 0.0017
+CTAAC 0.000768
+CTAAG 0.000802
+CTAAT 0.00139
+CTACA 0.000875
+CTACC 0.00058
+CTACG 0.000282
+CTACT 0.000953
+CTAGA 0.000803
+CTAGC 0.000529
+CTAGG 0.000502
+CTAGT 0.000827
+CTATA 0.00127
+CTATC 0.000741
+CTATG 0.000781
+CTATT 0.00164
+CTCAA 0.00143
+CTCAC 0.000634
+CTCAG 0.000555
+CTCAT 0.00108
+CTCCA 0.001
+CTCCC 0.000619
+CTCCG 0.000336
+CTCCT 0.000915
+CTCGA 0.000594
+CTCGC 0.00026
+CTCGG 0.00037
+CTCGT 0.000428
+CTCTA 0.00097
+CTCTC 0.000991
+CTCTG 0.000617
+CTCTT 0.00146
+CTGAA 0.00116
+CTGAC 0.000414
+CTGAG 0.000555
+CTGAT 0.000858
+CTGCA 0.000753
+CTGCC 0.000419
+CTGCG 0.000216
+CTGCT 0.000739
+CTGGA 0.000687
+CTGGC 0.000335
+CTGGG 0.000378
+CTGGT 0.000565
+CTGTA 0.000691
+CTGTC 0.000466
+CTGTG 0.000515
+CTGTT 0.000997
+CTTAA 0.00152
+CTTAC 0.000743
+CTTAG 0.000802
+CTTAT 0.0015
+CTTCA 0.00153
+CTTCC 0.00095
+CTTCG 0.000507
+CTTCT 0.00177
+CTTGA 0.00133
+CTTGC 0.000745
+CTTGG 0.000883
+CTTGT 0.00135
+CTTTA 0.00167
+CTTTC 0.00146
+CTTTG 0.00145
+CTTTT 0.00314
+GAAAA 0.00334
+GAAAC 0.00115
+GAAAG 0.00146
+GAAAT 0.00225
+GAACA 0.00108
+GAACC 0.000675
+GAACG 0.000335
+GAACT 0.00107
+GAAGA 0.00179
+GAAGC 0.000801
+GAAGG 0.00095
+GAAGT 0.00121
+GAATA 0.00156
+GAATC 0.000926
+GAATG 0.001
+GAATT 0.00195
+GACAA 0.00111
+GACAC 0.00051
+GACAG 0.000466
+GACAT 0.000859
+GACCA 0.000676
+GACCC 0.000442
+GACCG 0.000285
+GACCT 0.000568
+GACGA 0.00039
+GACGC 0.000172
+GACGG 0.000241
+GACGT 0.000278
+GACTA 0.000681
+GACTC 0.0005
+GACTG 0.000464
+GACTT 0.000954
+GAGAA 0.00158
+GAGAC 0.000527
+GAGAG 0.000991
+GAGAT 0.00107
+GAGCA 0.000729
+GAGCC 0.000416
+GAGCG 0.000228
+GAGCT 0.00069
+GAGGA 0.000956
+GAGGC 0.000498
+GAGGG 0.00064
+GAGGT 0.00077
+GAGTA 0.000865
+GAGTC 0.0005
+GAGTG 0.000607
+GAGTT 0.00119
+GATAA 0.00148
+GATAC 0.000664
+GATAG 0.000741
+GATAT 0.0014
+GATCA 0.000912
+GATCC 0.000578
+GATCG 0.000386
+GATCT 0.000818
+GATGA 0.00114
+GATGC 0.000592
+GATGG 0.000706
+GATGT 0.000895
+GATTA 0.0012
+GATTC 0.000926
+GATTG 0.000996
+GATTT 0.00209
+GCAAA 0.00143
+GCAAC 0.000675
+GCAAG 0.000745
+GCAAT 0.000989
+GCACA 0.000654
+GCACC 0.000424
+GCACG 0.00028
+GCACT 0.000568
+GCAGA 0.000708
+GCAGC 0.000481
+GCAGG 0.000401
+GCAGT 0.000536
+GCATA 0.000914
+GCATC 0.000592
+GCATG 0.000675
+GCATT 0.00101
+GCCAA 0.000878
+GCCAC 0.000468
+GCCAG 0.000335
+GCCAT 0.000678
+GCCCA 0.000486
+GCCCC 0.000325
+GCCCG 0.000237
+GCCCT 0.000389
+GCCGA 0.000285
+GCCGC 0.000193
+GCCGG 0.000201
+GCCGT 0.000217
+GCCTA 0.000494
+GCCTC 0.000498
+GCCTG 0.000307
+GCCTT 0.000701
+GCGAA 0.000388
+GCGAC 0.000222
+GCGAG 0.00026
+GCGAT 0.000288
+GCGCA 0.000205
+GCGCC 0.000176
+GCGCG 0.000132
+GCGCT 0.000179
+GCGGA 0.00028
+GCGGC 0.000193
+GCGGG 0.000216
+GCGGT 0.000237
+GCGTA 0.000276
+GCGTC 0.000172
+GCGTG 0.000244
+GCGTT 0.000289
+GCTAA 0.000866
+GCTAC 0.000511
+GCTAG 0.000529
+GCTAT 0.000823
+GCTCA 0.000666
+GCTCC 0.000468
+GCTCG 0.000343
+GCTCT 0.000585
+GCTGA 0.000652
+GCTGC 0.000481
+GCTGG 0.000463
+GCTGT 0.000481
+GCTTA 0.000788
+GCTTC 0.000801
+GCTTG 0.00076
+GCTTT 0.00124
+GGAAA 0.00167
+GGAAC 0.000637
+GGAAG 0.00095
+GGAAT 0.00109
+GGACA 0.000634
+GGACC 0.000433
+GGACG 0.000242
+GGACT 0.000567
+GGAGA 0.000933
+GGAGC 0.000468
+GGAGG 0.000721
+GGAGT 0.000751
+GGATA 0.000871
+GGATC 0.000578
+GGATG 0.000655
+GGATT 0.00109
+GGCAA 0.000729
+GGCAC 0.00036
+GGCAG 0.000419
+GGCAT 0.000607
+GGCCA 0.000537
+GGCCC 0.000333
+GGCCG 0.000237
+GGCCT 0.000428
+GGCGA 0.000284
+GGCGC 0.000176
+GGCGG 0.000238
+GGCGT 0.000245
+GGCTA 0.000598
+GGCTC 0.000416
+GGCTG 0.00042
+GGCTT 0.000667
+GGGAA 0.000873
+GGGAC 0.000391
+GGGAG 0.000619
+GGGAT 0.00068
+GGGCA 0.000433
+GGGCC 0.000333
+GGGCG 0.000219
+GGGCT 0.000452
+GGGGA 0.000589
+GGGGC 0.000325
+GGGGG 0.000585
+GGGGT 0.000564
+GGGTA 0.000621
+GGGTC 0.000442
+GGGTG 0.000534
+GGGTT 0.000773
+GGTAA 0.000918
+GGTAC 0.000444
+GGTAG 0.00058
+GGTAT 0.000808
+GGTCA 0.000632
+GGTCC 0.000433
+GGTCG 0.000392
+GGTCT 0.000514
+GGTGA 0.000733
+GGTGC 0.000424
+GGTGG 0.000664
+GGTGT 0.000654
+GGTTA 0.000781
+GGTTC 0.000675
+GGTTG 0.00081
+GGTTT 0.00123
+GTAAA 0.00165
+GTAAC 0.000685
+GTAAG 0.000743
+GTAAT 0.00129
+GTACA 0.000827
+GTACC 0.000444
+GTACG 0.000297
+GTACT 0.000771
+GTAGA 0.000823
+GTAGC 0.000511
+GTAGG 0.000529
+GTAGT 0.000827
+GTATA 0.00138
+GTATC 0.000664
+GTATG 0.000768
+GTATT 0.00155
+GTCAA 0.00108
+GTCAC 0.000544
+GTCAG 0.000414
+GTCAT 0.000898
+GTCCA 0.000669
+GTCCC 0.000391
+GTCCG 0.000263
+GTCCT 0.000553
+GTCGA 0.000402
+GTCGC 0.000222
+GTCGG 0.000277
+GTCGT 0.000374
+GTCTA 0.000641
+GTCTC 0.000527
+GTCTG 0.000448
+GTCTT 0.0009
+GTGAA 0.00118
+GTGAC 0.000544
+GTGAG 0.000634
+GTGAT 0.001
+GTGCA 0.000722
+GTGCC 0.00036
+GTGCG 0.000236
+GTGCT 0.000608
+GTGGA 0.000779
+GTGGC 0.000468
+GTGGG 0.000541
+GTGGT 0.000728
+GTGTA 0.000856
+GTGTC 0.00051
+GTGTG 0.000736
+GTGTT 0.00109
+GTTAA 0.00132
+GTTAC 0.000685
+GTTAG 0.000768
+GTTAT 0.0014
+GTTCA 0.00107
+GTTCC 0.000637
+GTTCG 0.000446
+GTTCT 0.001
+GTTGA 0.00122
+GTTGC 0.000675
+GTTGG 0.000855
+GTTGT 0.0013
+GTTTA 0.00138
+GTTTC 0.00115
+GTTTG 0.00147
+GTTTT 0.00229
+TAAAA 0.00399
+TAAAC 0.00138
+TAAAG 0.00167
+TAAAT 0.00312
+TAACA 0.00152
+TAACC 0.000781
+TAACG 0.000421
+TAACT 0.00145
+TAAGA 0.00142
+TAAGC 0.000788
+TAAGG 0.000964
+TAAGT 0.00139
+TAATA 0.0026
+TAATC 0.0012
+TAATG 0.00139
+TAATT 0.00326
+TACAA 0.00188
+TACAC 0.000856
+TACAG 0.000691
+TACAT 0.0015
+TACCA 0.000967
+TACCC 0.000621
+TACCG 0.00031
+TACCT 0.000852
+TACGA 0.000442
+TACGC 0.000276
+TACGG 0.0003
+TACGT 0.000436
+TACTA 0.00131
+TACTC 0.000865
+TACTG 0.000787
+TACTT 0.00166
+TAGAA 0.00165
+TAGAC 0.000641
+TAGAG 0.00097
+TAGAT 0.00119
+TAGCA 0.000934
+TAGCC 0.000598
+TAGCG 0.000252
+TAGCT 0.000946
+TAGGA 0.000927
+TAGGC 0.000494
+TAGGG 0.000612
+TAGGT 0.000768
+TAGTA 0.00131
+TAGTC 0.000681
+TAGTG 0.0009
+TAGTT 0.00156
+TATAA 0.00259
+TATAC 0.00138
+TATAG 0.00127
+TATAT 0.00385
+TATCA 0.00153
+TATCC 0.000871
+TATCG 0.000467
+TATCT 0.00142
+TATGA 0.0015
+TATGC 0.000914
+TATGG 0.000972
+TATGT 0.00163
+TATTA 0.0026
+TATTC 0.00156
+TATTG 0.00172
+TATTT 0.00444
+TCAAA 0.00276
+TCAAC 0.00122
+TCAAG 0.00133
+TCAAT 0.00191
+TCACA 0.00114
+TCACC 0.000733
+TCACG 0.000413
+TCACT 0.00107
+TCAGA 0.000956
+TCAGC 0.000652
+TCAGG 0.000529
+TCAGT 0.00085
+TCATA 0.0015
+TCATC 0.00114
+TCATG 0.00115
+TCATT 0.00197
+TCCAA 0.00159
+TCCAC 0.000779
+TCCAG 0.000687
+TCCAT 0.00122
+TCCCA 0.00083
+TCCCC 0.000589
+TCCCG 0.000326
+TCCCT 0.000817
+TCCGA 0.000476
+TCCGC 0.00028
+TCCGG 0.000333
+TCCGT 0.000385
+TCCTA 0.000927
+TCCTC 0.000956
+TCCTG 0.000565
+TCCTT 0.00152
+TCGAA 0.000818
+TCGAC 0.000402
+TCGAG 0.000594
+TCGAT 0.000656
+TCGCA 0.000344
+TCGCC 0.000284
+TCGCG 0.000201
+TCGCT 0.000329
+TCGGA 0.000476
+TCGGC 0.000285
+TCGGG 0.00039
+TCGGT 0.000425
+TCGTA 0.000442
+TCGTC 0.00039
+TCGTG 0.000435
+TCGTT 0.000617
+TCTAA 0.00138
+TCTAC 0.000823
+TCTAG 0.000803
+TCTAT 0.00145
+TCTCA 0.0012
+TCTCC 0.000933
+TCTCG 0.000445
+TCTCT 0.00158
+TCTGA 0.000956
+TCTGC 0.000708
+TCTGG 0.000582
+TCTGT 0.000922
+TCTTA 0.00142
+TCTTC 0.00179
+TCTTG 0.00141
+TCTTT 0.0028
+TGAAA 0.0026
+TGAAC 0.00107
+TGAAG 0.00153
+TGAAT 0.0019
+TGACA 0.00104
+TGACC 0.000632
+TGACG 0.000339
+TGACT 0.000927
+TGAGA 0.0012
+TGAGC 0.000666
+TGAGG 0.000809
+TGAGT 0.00102
+TGATA 0.00153
+TGATC 0.000912
+TGATG 0.00124
+TGATT 0.00192
+TGCAA 0.00136
+TGCAC 0.000722
+TGCAG 0.000753
+TGCAT 0.00119
+TGCCA 0.000741
+TGCCC 0.000433
+TGCCG 0.000244
+TGCCT 0.000697
+TGCGA 0.000344
+TGCGC 0.000205
+TGCGG 0.000291
+TGCGT 0.000309
+TGCTA 0.000934
+TGCTC 0.000729
+TGCTG 0.000786
+TGCTT 0.00135
+TGGAA 0.00147
+TGGAC 0.000669
+TGGAG 0.001
+TGGAT 0.00114
+TGGCA 0.000741
+TGGCC 0.000537
+TGGCG 0.000307
+TGGCT 0.000776
+TGGGA 0.00083
+TGGGC 0.000486
+TGGGG 0.0006
+TGGGT 0.000751
+TGGTA 0.000967
+TGGTC 0.000676
+TGGTG 0.000929
+TGGTT 0.0013
+TGTAA 0.0015
+TGTAC 0.000827
+TGTAG 0.000875
+TGTAT 0.00173
+TGTCA 0.00104
+TGTCC 0.000634
+TGTCG 0.000355
+TGTCT 0.000922
+TGTGA 0.00114
+TGTGC 0.000654
+TGTGG 0.000796
+TGTGT 0.00123
+TGTTA 0.00152
+TGTTC 0.00108
+TGTTG 0.00154
+TGTTT 0.00236
+TTAAA 0.00332
+TTAAC 0.00132
+TTAAG 0.00152
+TTAAT 0.0028
+TTACA 0.0015
+TTACC 0.000918
+TTACG 0.000438
+TTACT 0.00151
+TTAGA 0.00138
+TTAGC 0.000866
+TTAGG 0.00095
+TTAGT 0.00145
+TTATA 0.00259
+TTATC 0.00148
+TTATG 0.0017
+TTATT 0.0036
+TTCAA 0.00263
+TTCAC 0.00118
+TTCAG 0.00116
+TTCAT 0.00213
+TTCCA 0.00147
+TTCCC 0.000873
+TTCCG 0.000475
+TTCCT 0.00153
+TTCGA 0.000818
+TTCGC 0.000388
+TTCGG 0.00053
+TTCGT 0.000643
+TTCTA 0.00165
+TTCTC 0.00158
+TTCTG 0.00123
+TTCTT 0.00324
+TTGAA 0.00263
+TTGAC 0.00108
+TTGAG 0.00143
+TTGAT 0.00208
+TTGCA 0.00136
+TTGCC 0.000729
+TTGCG 0.000365
+TTGCT 0.00139
+TTGGA 0.00159
+TTGGC 0.000878
+TTGGG 0.00104
+TTGGT 0.00155
+TTGTA 0.00188
+TTGTC 0.00111
+TTGTG 0.00143
+TTGTT 0.00266
+TTTAA 0.00332
+TTTAC 0.00165
+TTTAG 0.0017
+TTTAT 0.00351
+TTTCA 0.0026
+TTTCC 0.00167
+TTTCG 0.000831
+TTTCT 0.00309
+TTTGA 0.00276
+TTTGC 0.00143
+TTTGG 0.00212
+TTTGT 0.0026
+TTTTA 0.00399
+TTTTC 0.00334
+TTTTG 0.00341
+TTTTT 0.00694
+
+[EMISSION]
+
+# Vector size (4^(k+1))
+1024
+# Probabilities
+AAAAA 0.3924
+AAAAC 0.1295
+AAAAG 0.1776
+AAAAT 0.3005
+AAACA 0.3753
+AAACC 0.1949
+AAACG 0.1006
+AAACT 0.3292
+AAAGA 0.3624
+AAAGC 0.1605
+AAAGG 0.2001
+AAAGT 0.277
+AAATA 0.3347
+AAATC 0.1578
+AAATG 0.1743
+AAATT 0.3333
+AACAA 0.4088
+AACAC 0.1678
+AACAG 0.1533
+AACAT 0.2701
+AACCA 0.3712
+AACCC 0.2214
+AACCG 0.1197
+AACCT 0.2877
+AACGA 0.3495
+AACGC 0.1637
+AACGG 0.2302
+AACGT 0.2567
+AACTA 0.2645
+AACTC 0.2018
+AACTG 0.1626
+AACTT 0.371
+AAGAA 0.437
+AAGAC 0.1213
+AAGAG 0.1963
+AAGAT 0.2454
+AAGCA 0.3766
+AAGCC 0.1858
+AAGCG 0.09859
+AAGCT 0.339
+AAGGA 0.3564
+AAGGC 0.164
+AAGGG 0.2208
+AAGGT 0.2588
+AAGTA 0.2737
+AAGTC 0.1574
+AAGTG 0.2072
+AAGTT 0.3618
+AATAA 0.3486
+AATAC 0.1501
+AATAG 0.1593
+AATAT 0.342
+AATCA 0.3689
+AATCC 0.2091
+AATCG 0.1086
+AATCT 0.3134
+AATGA 0.3408
+AATGC 0.1745
+AATGG 0.2112
+AATGT 0.2735
+AATTA 0.2775
+AATTC 0.1658
+AATTG 0.1803
+AATTT 0.3763
+ACAAA 0.3675
+ACAAC 0.184
+ACAAG 0.1905
+ACAAT 0.258
+ACACA 0.3869
+ACACC 0.2047
+ACACG 0.1145
+ACACT 0.2939
+ACAGA 0.3453
+ACAGC 0.1802
+ACAGG 0.1776
+ACAGT 0.2969
+ACATA 0.3094
+ACATC 0.1698
+ACATG 0.2206
+ACATT 0.3002
+ACCAA 0.3998
+ACCAC 0.1882
+ACCAG 0.146
+ACCAT 0.266
+ACCCA 0.3168
+ACCCC 0.238
+ACCCG 0.1425
+ACCCT 0.3027
+ACCGA 0.3293
+ACCGC 0.1834
+ACCGG 0.2458
+ACCGT 0.2414
+ACCTA 0.2434
+ACCTC 0.2439
+ACCTG 0.162
+ACCTT 0.3507
+ACGAA 0.3413
+ACGAC 0.1986
+ACGAG 0.2271
+ACGAT 0.233
+ACGCA 0.315
+ACGCC 0.2499
+ACGCG 0.1803
+ACGCT 0.2548
+ACGGA 0.3197
+ACGGC 0.18
+ACGGG 0.2418
+ACGGT 0.2585
+ACGTA 0.2712
+ACGTC 0.1733
+ACGTG 0.2735
+ACGTT 0.282
+ACTAA 0.3262
+ACTAC 0.1856
+ACTAG 0.1856
+ACTAT 0.3026
+ACTCA 0.321
+ACTCC 0.2373
+ACTCG 0.1264
+ACTCT 0.3152
+ACTGA 0.3076
+ACTGC 0.1941
+ACTGG 0.2114
+ACTGT 0.2869
+ACTTA 0.2297
+ACTTC 0.1998
+ACTTG 0.2176
+ACTTT 0.3528
+AGAAA 0.4003
+AGAAC 0.13
+AGAAG 0.229
+AGAAT 0.2408
+AGACA 0.3667
+AGACC 0.2043
+AGACG 0.1211
+AGACT 0.308
+AGAGA 0.392
+AGAGC 0.145
+AGAGG 0.2158
+AGAGT 0.2472
+AGATA 0.2862
+AGATC 0.1653
+AGATG 0.2184
+AGATT 0.3301
+AGCAA 0.366
+AGCAC 0.16
+AGCAG 0.1945
+AGCAT 0.2794
+AGCCA 0.3693
+AGCCC 0.2154
+AGCCG 0.1236
+AGCCT 0.2917
+AGCGA 0.3255
+AGCGC 0.1769
+AGCGG 0.2505
+AGCGT 0.2471
+AGCTA 0.2668
+AGCTC 0.1946
+AGCTG 0.1956
+AGCTT 0.343
+AGGAA 0.3843
+AGGAC 0.1393
+AGGAG 0.2303
+AGGAT 0.2461
+AGGCA 0.3487
+AGGCC 0.2138
+AGGCG 0.1312
+AGGCT 0.3063
+AGGGA 0.3201
+AGGGC 0.1524
+AGGGG 0.2464
+AGGGT 0.2811
+AGGTA 0.27
+AGGTC 0.1798
+AGGTG 0.232
+AGGTT 0.3182
+AGTAA 0.3274
+AGTAC 0.1669
+AGTAG 0.2061
+AGTAT 0.2996
+AGTCA 0.3566
+AGTCC 0.218
+AGTCG 0.1274
+AGTCT 0.298
+AGTGA 0.3226
+AGTGC 0.1716
+AGTGG 0.2226
+AGTGT 0.2833
+AGTTA 0.2451
+AGTTC 0.1807
+AGTTG 0.224
+AGTTT 0.3502
+ATAAA 0.3743
+ATAAC 0.1494
+ATAAG 0.1597
+ATAAT 0.3166
+ATACA 0.3965
+ATACC 0.1855
+ATACG 0.1002
+ATACT 0.3178
+ATAGA 0.3262
+ATAGC 0.1854
+ATAGG 0.1846
+ATAGT 0.3038
+ATATA 0.3655
+ATATC 0.1323
+ATATG 0.1676
+ATATT 0.3346
+ATCAA 0.3718
+ATCAC 0.1787
+ATCAG 0.1533
+ATCAT 0.2961
+ATCCA 0.3557
+ATCCC 0.2129
+ATCCG 0.1253
+ATCCT 0.3061
+ATCGA 0.3683
+ATCGC 0.1615
+ATCGG 0.2239
+ATCGT 0.2464
+ATCTA 0.2409
+ATCTC 0.2154
+ATCTG 0.1756
+ATCTT 0.3681
+ATGAA 0.3695
+ATGAC 0.1558
+ATGAG 0.1871
+ATGAT 0.2877
+ATGCA 0.3733
+ATGCC 0.1901
+ATGCG 0.1039
+ATGCT 0.3327
+ATGGA 0.3357
+ATGGC 0.1864
+ATGGG 0.1951
+ATGGT 0.2828
+ATGTA 0.2852
+ATGTC 0.163
+ATGTG 0.2187
+ATGTT 0.3331
+ATTAA 0.3313
+ATTAC 0.1531
+ATTAG 0.1643
+ATTAT 0.3513
+ATTCA 0.3489
+ATTCC 0.2004
+ATTCG 0.1094
+ATTCT 0.3413
+ATTGA 0.3224
+ATTGC 0.1672
+ATTGG 0.2018
+ATTGT 0.3086
+ATTTA 0.2353
+ATTTC 0.1694
+ATTTG 0.1948
+ATTTT 0.4005
+CAAAA 0.3829
+CAAAC 0.1649
+CAAAG 0.1622
+CAAAT 0.29
+CAACA 0.3809
+CAACC 0.1999
+CAACG 0.09271
+CAACT 0.3265
+CAAGA 0.3274
+CAAGC 0.1766
+CAAGG 0.1898
+CAAGT 0.3063
+CAATA 0.2905
+CAATC 0.1684
+CAATG 0.1828
+CAATT 0.3583
+CACAA 0.3722
+CACAC 0.1921
+CACAG 0.1345
+CACAT 0.3011
+CACCA 0.3757
+CACCC 0.216
+CACCG 0.1124
+CACCT 0.296
+CACGA 0.3158
+CACGC 0.1773
+CACGG 0.188
+CACGT 0.319
+CACTA 0.2717
+CACTC 0.1832
+CACTG 0.166
+CACTT 0.3791
+CAGAA 0.3896
+CAGAC 0.1414
+CAGAG 0.1948
+CAGAT 0.2742
+CAGCA 0.3784
+CAGCC 0.2021
+CAGCG 0.08587
+CAGCT 0.3336
+CAGGA 0.3249
+CAGGC 0.1763
+CAGGG 0.2048
+CAGGT 0.294
+CAGTA 0.285
+CAGTC 0.1679
+CAGTG 0.1991
+CAGTT 0.348
+CATAA 0.3389
+CATAC 0.1532
+CATAG 0.1556
+CATAT 0.3524
+CATCA 0.371
+CATCC 0.1965
+CATCG 0.1085
+CATCT 0.324
+CATGA 0.3085
+CATGC 0.1811
+CATGG 0.1981
+CATGT 0.3123
+CATTA 0.2404
+CATTC 0.1732
+CATTG 0.1868
+CATTT 0.3996
+CCAAA 0.42
+CCAAC 0.1691
+CCAAG 0.1748
+CCAAT 0.2361
+CCACA 0.3165
+CCACC 0.2639
+CCACG 0.1266
+CCACT 0.293
+CCAGA 0.2965
+CCAGC 0.2358
+CCAGG 0.1704
+CCAGT 0.2973
+CCATA 0.2671
+CCATC 0.1941
+CCATG 0.2028
+CCATT 0.336
+CCCAA 0.3891
+CCCAC 0.2028
+CCCAG 0.1418
+CCCAT 0.2663
+CCCCA 0.2907
+CCCCC 0.2838
+CCCCG 0.1205
+CCCCT 0.305
+CCCGA 0.3392
+CCCGC 0.1877
+CCCGG 0.2194
+CCCGT 0.2537
+CCCTA 0.2398
+CCCTC 0.2507
+CCCTG 0.1395
+CCCTT 0.37
+CCGAA 0.3365
+CCGAC 0.1758
+CCGAG 0.2347
+CCGAT 0.253
+CCGCA 0.3141
+CCGCC 0.2571
+CCGCG 0.1549
+CCGCT 0.2739
+CCGGA 0.302
+CCGGC 0.1818
+CCGGG 0.2286
+CCGGT 0.2877
+CCGTA 0.2486
+CCGTC 0.1999
+CCGTG 0.2148
+CCGTT 0.3368
+CCTAA 0.3393
+CCTAC 0.1889
+CCTAG 0.1792
+CCTAT 0.2925
+CCTCA 0.2825
+CCTCC 0.2517
+CCTCG 0.1617
+CCTCT 0.3041
+CCTGA 0.3043
+CCTGC 0.2308
+CCTGG 0.1924
+CCTGT 0.2725
+CCTTA 0.2255
+CCTTC 0.2222
+CCTTG 0.1911
+CCTTT 0.3612
+CGAAA 0.3494
+CGAAC 0.1875
+CGAAG 0.213
+CGAAT 0.2501
+CGACA 0.2787
+CGACC 0.3075
+CGACG 0.154
+CGACT 0.2598
+CGAGA 0.2693
+CGAGC 0.208
+CGAGG 0.2804
+CGAGT 0.2423
+CGATA 0.2624
+CGATC 0.2167
+CGATG 0.2032
+CGATT 0.3177
+CGCAA 0.318
+CGCAC 0.2057
+CGCAG 0.1876
+CGCAT 0.2887
+CGCCA 0.3252
+CGCCC 0.2318
+CGCCG 0.1648
+CGCCT 0.2783
+CGCGA 0.3074
+CGCGC 0.2021
+CGCGG 0.2196
+CGCGT 0.271
+CGCTA 0.2489
+CGCTC 0.2253
+CGCTG 0.1763
+CGCTT 0.3495
+CGGAA 0.3224
+CGGAC 0.1783
+CGGAG 0.228
+CGGAT 0.2713
+CGGCA 0.2719
+CGGCC 0.265
+CGGCG 0.1735
+CGGCT 0.2896
+CGGGA 0.2837
+CGGGC 0.2061
+CGGGG 0.2163
+CGGGT 0.2939
+CGGTA 0.2402
+CGGTC 0.2208
+CGGTG 0.2153
+CGGTT 0.3237
+CGTAA 0.3014
+CGTAC 0.2043
+CGTAG 0.194
+CGTAT 0.3003
+CGTCA 0.3133
+CGTCC 0.2235
+CGTCG 0.1815
+CGTCT 0.2817
+CGTGA 0.2997
+CGTGC 0.2035
+CGTGG 0.2313
+CGTGT 0.2655
+CGTTA 0.2387
+CGTTC 0.19
+CGTTG 0.213
+CGTTT 0.3583
+CTAAA 0.3645
+CTAAC 0.165
+CTAAG 0.1723
+CTAAT 0.2982
+CTACA 0.3253
+CTACC 0.2155
+CTACG 0.1049
+CTACT 0.3543
+CTAGA 0.3018
+CTAGC 0.1989
+CTAGG 0.1886
+CTAGT 0.3107
+CTATA 0.2867
+CTATC 0.167
+CTATG 0.1759
+CTATT 0.3704
+CTCAA 0.3863
+CTCAC 0.1716
+CTCAG 0.1502
+CTCAT 0.2919
+CTCCA 0.3493
+CTCCC 0.2155
+CTCCG 0.117
+CTCCT 0.3182
+CTCGA 0.3595
+CTCGC 0.1574
+CTCGG 0.224
+CTCGT 0.2591
+CTCTA 0.2404
+CTCTC 0.2455
+CTCTG 0.153
+CTCTT 0.3611
+CTGAA 0.3884
+CTGAC 0.1386
+CTGAG 0.1857
+CTGAT 0.2873
+CTGCA 0.3539
+CTGCC 0.1972
+CTGCG 0.1013
+CTGCT 0.3476
+CTGGA 0.3495
+CTGGC 0.1706
+CTGGG 0.1924
+CTGGT 0.2875
+CTGTA 0.2589
+CTGTC 0.1747
+CTGTG 0.193
+CTGTT 0.3733
+CTTAA 0.334
+CTTAC 0.1627
+CTTAG 0.1756
+CTTAT 0.3277
+CTTCA 0.322
+CTTCC 0.1998
+CTTCG 0.1067
+CTTCT 0.3715
+CTTGA 0.3088
+CTTGC 0.1731
+CTTGG 0.2051
+CTTGT 0.313
+CTTTA 0.2166
+CTTTC 0.1891
+CTTTG 0.1873
+CTTTT 0.407
+GAAAA 0.4075
+GAAAC 0.1399
+GAAAG 0.1782
+GAAAT 0.2744
+GAACA 0.3413
+GAACC 0.214
+GAACG 0.1062
+GAACT 0.3384
+GAAGA 0.3769
+GAAGC 0.1685
+GAAGG 0.1999
+GAAGT 0.2547
+GAATA 0.2876
+GAATC 0.1702
+GAATG 0.1842
+GAATT 0.358
+GACAA 0.3773
+GACAC 0.1729
+GACAG 0.1583
+GACAT 0.2915
+GACCA 0.3431
+GACCC 0.2242
+GACCG 0.1447
+GACCT 0.2881
+GACGA 0.3608
+GACGC 0.1592
+GACGG 0.2228
+GACGT 0.2572
+GACTA 0.2621
+GACTC 0.1925
+GACTG 0.1784
+GACTT 0.3669
+GAGAA 0.3796
+GAGAC 0.1265
+GAGAG 0.2379
+GAGAT 0.256
+GAGCA 0.3535
+GAGCC 0.2017
+GAGCG 0.1105
+GAGCT 0.3343
+GAGGA 0.3338
+GAGGC 0.1739
+GAGGG 0.2235
+GAGGT 0.2688
+GAGTA 0.2734
+GAGTC 0.1581
+GAGTG 0.1917
+GAGTT 0.3768
+GATAA 0.3456
+GATAC 0.1552
+GATAG 0.1731
+GATAT 0.3261
+GATCA 0.3386
+GATCC 0.2145
+GATCG 0.1433
+GATCT 0.3036
+GATGA 0.3424
+GATGC 0.1775
+GATGG 0.2117
+GATGT 0.2684
+GATTA 0.2294
+GATTC 0.1777
+GATTG 0.1911
+GATTT 0.4018
+GCAAA 0.3733
+GCAAC 0.1756
+GCAAG 0.1939
+GCAAT 0.2572
+GCACA 0.3397
+GCACC 0.22
+GCACG 0.1454
+GCACT 0.2949
+GCAGA 0.333
+GCAGC 0.2262
+GCAGG 0.1887
+GCAGT 0.252
+GCATA 0.2865
+GCATC 0.1856
+GCATG 0.2114
+GCATT 0.3165
+GCCAA 0.3721
+GCCAC 0.1984
+GCCAG 0.142
+GCCAT 0.2875
+GCCCA 0.3381
+GCCCC 0.2263
+GCCCG 0.1649
+GCCCT 0.2708
+GCCGA 0.318
+GCCGC 0.2158
+GCCGG 0.2239
+GCCGT 0.2423
+GCCTA 0.2468
+GCCTC 0.2491
+GCCTG 0.1533
+GCCTT 0.3507
+GCGAA 0.3354
+GCGAC 0.1916
+GCGAG 0.2245
+GCGAT 0.2484
+GCGCA 0.2965
+GCGCC 0.2543
+GCGCG 0.1906
+GCGCT 0.2586
+GCGGA 0.3023
+GCGGC 0.2088
+GCGGG 0.233
+GCGGT 0.2558
+GCGTA 0.2816
+GCGTC 0.1754
+GCGTG 0.2487
+GCGTT 0.2942
+GCTAA 0.3174
+GCTAC 0.1871
+GCTAG 0.1939
+GCTAT 0.3016
+GCTCA 0.3229
+GCTCC 0.227
+GCTCG 0.1665
+GCTCT 0.2836
+GCTGA 0.314
+GCTGC 0.2315
+GCTGG 0.2229
+GCTGT 0.2315
+GCTTA 0.2195
+GCTTC 0.2233
+GCTTG 0.2119
+GCTTT 0.3452
+GGAAA 0.3841
+GGAAC 0.1466
+GGAAG 0.2185
+GGAAT 0.2508
+GGACA 0.338
+GGACC 0.2309
+GGACG 0.1289
+GGACT 0.3022
+GGAGA 0.3248
+GGAGC 0.163
+GGAGG 0.2509
+GGAGT 0.2614
+GGATA 0.2726
+GGATC 0.1809
+GGATG 0.2052
+GGATT 0.3412
+GGCAA 0.3446
+GGCAC 0.1701
+GGCAG 0.1984
+GGCAT 0.2869
+GGCCA 0.3496
+GGCCC 0.2172
+GGCCG 0.1547
+GGCCT 0.2785
+GGCGA 0.301
+GGCGC 0.1867
+GGCGG 0.2523
+GGCGT 0.26
+GGCTA 0.2845
+GGCTC 0.1981
+GGCTG 0.2
+GGCTT 0.3174
+GGGAA 0.3405
+GGGAC 0.1525
+GGGAG 0.2417
+GGGAT 0.2653
+GGGCA 0.3011
+GGGCC 0.232
+GGGCG 0.1522
+GGGCT 0.3148
+GGGGA 0.2854
+GGGGC 0.1576
+GGGGG 0.2837
+GGGGT 0.2734
+GGGTA 0.2619
+GGGTC 0.1864
+GGGTG 0.2255
+GGGTT 0.3262
+GGTAA 0.3338
+GGTAC 0.1613
+GGTAG 0.2108
+GGTAT 0.294
+GGTCA 0.3206
+GGTCC 0.2197
+GGTCG 0.1989
+GGTCT 0.2607
+GGTGA 0.2962
+GGTGC 0.1713
+GGTGG 0.2684
+GGTGT 0.2641
+GGTTA 0.2236
+GGTTC 0.1934
+GGTTG 0.2321
+GGTTT 0.3509
+GTAAA 0.3772
+GTAAC 0.1568
+GTAAG 0.17
+GTAAT 0.296
+GTACA 0.3537
+GTACC 0.1896
+GTACG 0.127
+GTACT 0.3298
+GTAGA 0.306
+GTAGC 0.1898
+GTAGG 0.1967
+GTAGT 0.3075
+GTATA 0.3158
+GTATC 0.1524
+GTATG 0.1763
+GTATT 0.3554
+GTCAA 0.3671
+GTCAC 0.1856
+GTCAG 0.1412
+GTCAT 0.3061
+GTCCA 0.3566
+GTCCC 0.2083
+GTCCG 0.1402
+GTCCT 0.2949
+GTCGA 0.3152
+GTCGC 0.174
+GTCGG 0.2173
+GTCGT 0.2934
+GTCTA 0.2548
+GTCTC 0.2094
+GTCTG 0.1781
+GTCTT 0.3578
+GTGAA 0.351
+GTGAC 0.1622
+GTGAG 0.1888
+GTGAT 0.2981
+GTGCA 0.3749
+GTGCC 0.1867
+GTGCG 0.1227
+GTGCT 0.3157
+GTGGA 0.3097
+GTGGC 0.1861
+GTGGG 0.2149
+GTGGT 0.2893
+GTGTA 0.2682
+GTGTC 0.1596
+GTGTG 0.2304
+GTGTT 0.3417
+GTTAA 0.316
+GTTAC 0.1643
+GTTAG 0.184
+GTTAT 0.3357
+GTTCA 0.339
+GTTCC 0.202
+GTTCG 0.1414
+GTTCT 0.3176
+GTTGA 0.3017
+GTTGC 0.1664
+GTTGG 0.2108
+GTTGT 0.321
+GTTTA 0.2197
+GTTTC 0.1822
+GTTTG 0.2339
+GTTTT 0.3642
+TAAAA 0.3927
+TAAAC 0.1358
+TAAAG 0.1644
+TAAAT 0.3071
+TAACA 0.3646
+TAACC 0.1872
+TAACG 0.1009
+TAACT 0.3473
+TAAGA 0.3113
+TAAGC 0.1725
+TAAGG 0.2112
+TAAGT 0.3049
+TAATA 0.3075
+TAATC 0.1416
+TAATG 0.1647
+TAATT 0.3862
+TACAA 0.3812
+TACAC 0.1737
+TACAG 0.1402
+TACAT 0.3049
+TACCA 0.3516
+TACCC 0.2257
+TACCG 0.1128
+TACCT 0.3099
+TACGA 0.304
+TACGC 0.1901
+TACGG 0.2062
+TACGT 0.2996
+TACTA 0.2838
+TACTC 0.1872
+TACTG 0.1703
+TACTT 0.3588
+TAGAA 0.3711
+TAGAC 0.1438
+TAGAG 0.2177
+TAGAT 0.2675
+TAGCA 0.3422
+TAGCC 0.2189
+TAGCG 0.09229
+TAGCT 0.3466
+TAGGA 0.3309
+TAGGC 0.1763
+TAGGG 0.2186
+TAGGT 0.2743
+TAGTA 0.2944
+TAGTC 0.1529
+TAGTG 0.2019
+TAGTT 0.3508
+TATAA 0.2851
+TATAC 0.1513
+TATAG 0.1399
+TATAT 0.4238
+TATCA 0.3566
+TATCC 0.2034
+TATCG 0.1092
+TATCT 0.3309
+TATGA 0.299
+TATGC 0.1822
+TATGG 0.1937
+TATGT 0.3251
+TATTA 0.2516
+TATTC 0.1516
+TATTG 0.1665
+TATTT 0.4303
+TCAAA 0.382
+TCAAC 0.1695
+TCAAG 0.1843
+TCAAT 0.2642
+TCACA 0.3406
+TCACC 0.2183
+TCACG 0.1229
+TCACT 0.3182
+TCAGA 0.32
+TCAGC 0.2184
+TCAGG 0.1772
+TCAGT 0.2844
+TCATA 0.2603
+TCATC 0.1982
+TCATG 0.1994
+TCATT 0.3421
+TCCAA 0.3722
+TCCAC 0.1821
+TCCAG 0.1604
+TCCAT 0.2853
+TCCCA 0.324
+TCCCC 0.2299
+TCCCG 0.1272
+TCCCT 0.3189
+TCCGA 0.3229
+TCCGC 0.1897
+TCCGG 0.226
+TCCGT 0.2614
+TCCTA 0.2333
+TCCTC 0.2407
+TCCTG 0.1422
+TCCTT 0.3837
+TCGAA 0.3312
+TCGAC 0.1627
+TCGAG 0.2404
+TCGAT 0.2656
+TCGCA 0.2967
+TCGCC 0.2452
+TCGCG 0.1734
+TCGCT 0.2846
+TCGGA 0.3021
+TCGGC 0.1807
+TCGGG 0.2473
+TCGGT 0.2698
+TCGTA 0.2346
+TCGTC 0.2072
+TCGTG 0.2309
+TCGTT 0.3273
+TCTAA 0.3102
+TCTAC 0.1847
+TCTAG 0.1803
+TCTAT 0.3249
+TCTCA 0.289
+TCTCC 0.2242
+TCTCG 0.1069
+TCTCT 0.3799
+TCTGA 0.3017
+TCTGC 0.2236
+TCTGG 0.1838
+TCTGT 0.2909
+TCTTA 0.1916
+TCTTC 0.2415
+TCTTG 0.19
+TCTTT 0.3769
+TGAAA 0.3664
+TGAAC 0.1507
+TGAAG 0.2156
+TGAAT 0.2673
+TGACA 0.3532
+TGACC 0.2154
+TGACG 0.1155
+TGACT 0.3159
+TGAGA 0.3257
+TGAGC 0.1804
+TGAGG 0.219
+TGAGT 0.275
+TGATA 0.2726
+TGATC 0.163
+TGATG 0.221
+TGATT 0.3434
+TGCAA 0.3375
+TGCAC 0.1794
+TGCAG 0.187
+TGCAT 0.2961
+TGCCA 0.3504
+TGCCC 0.2046
+TGCCG 0.1152
+TGCCT 0.3298
+TGCGA 0.299
+TGCGC 0.1787
+TGCGG 0.2532
+TGCGT 0.2691
+TGCTA 0.2457
+TGCTC 0.1919
+TGCTG 0.2069
+TGCTT 0.3555
+TGGAA 0.3439
+TGGAC 0.1562
+TGGAG 0.2345
+TGGAT 0.2653
+TGGCA 0.3139
+TGGCC 0.2274
+TGGCG 0.13
+TGGCT 0.3287
+TGGGA 0.3113
+TGGGC 0.1822
+TGGGG 0.2249
+TGGGT 0.2816
+TGGTA 0.2499
+TGGTC 0.1748
+TGGTG 0.2403
+TGGTT 0.335
+TGTAA 0.3042
+TGTAC 0.1678
+TGTAG 0.1775
+TGTAT 0.3505
+TGTCA 0.3515
+TGTCC 0.215
+TGTCG 0.1205
+TGTCT 0.3129
+TGTGA 0.2986
+TGTGC 0.1709
+TGTGG 0.208
+TGTGT 0.3225
+TGTTA 0.2339
+TGTTC 0.1657
+TGTTG 0.2375
+TGTTT 0.3629
+TTAAA 0.3702
+TTAAC 0.1471
+TTAAG 0.1702
+TTAAT 0.3124
+TTACA 0.3433
+TTACC 0.21
+TTACG 0.1003
+TTACT 0.3464
+TTAGA 0.2971
+TTAGC 0.1862
+TTAGG 0.2042
+TTAGT 0.3124
+TTATA 0.2768
+TTATC 0.1579
+TTATG 0.1814
+TTATT 0.3839
+TTCAA 0.3706
+TTCAC 0.166
+TTCAG 0.1634
+TTCAT 0.3
+TTCCA 0.3387
+TTCCC 0.2008
+TTCCG 0.1094
+TTCCT 0.3512
+TTCGA 0.3437
+TTCGC 0.1632
+TTCGG 0.2229
+TTCGT 0.2702
+TTCTA 0.2144
+TTCTC 0.205
+TTCTG 0.1601
+TTCTT 0.4205
+TTGAA 0.3645
+TTGAC 0.1492
+TTGAG 0.1978
+TTGAT 0.2885
+TTGCA 0.3534
+TTGCC 0.1896
+TTGCG 0.09506
+TTGCT 0.3619
+TTGGA 0.3152
+TTGGC 0.1737
+TTGGG 0.2052
+TTGGT 0.3059
+TTGTA 0.2657
+TTGTC 0.1572
+TTGTG 0.2014
+TTGTT 0.3757
+TTTAA 0.3262
+TTTAC 0.1621
+TTTAG 0.1668
+TTTAT 0.3449
+TTTCA 0.3177
+TTTCC 0.2039
+TTTCG 0.1015
+TTTCT 0.3769
+TTTGA 0.3093
+TTTGC 0.1609
+TTTGG 0.2381
+TTTGT 0.2917
+TTTTA 0.2259
+TTTTC 0.1887
+TTTTG 0.193
+TTTTT 0.3924
diff --git a/config/species/coyote_tobacco/coyote_tobacco_intron_probs.pbl b/config/species/coyote_tobacco/coyote_tobacco_intron_probs.pbl
new file mode 100644
index 0000000..a838d5c
--- /dev/null
+++ b/config/species/coyote_tobacco/coyote_tobacco_intron_probs.pbl
@@ -0,0 +1,7191 @@
+#intron model parameters
+# begin of content independent part
+#
+# ASS probabilities
+#only nonpseudocount values are shown
+[ASS]
+# Size of vector
+64
+# c_ass (ASS count)
+4799
+# asspseudocount (added to all possible patterns, no matter if they occur)
+0.00266
+# Probabilities * 1000
+aaa 4.17
+aac 0.834
+aag 6.88
+aat 1.67
+aca 41
+acc 15.6
+acg 92.5
+act 21.5
+ata 8.96
+atc 4.17
+atg 45.4
+att 3.54
+caa 0.417
+cac 0.209
+cag 1.04
+cat 0.834
+cca 15.4
+ccc 5.83
+ccg 31.5
+cct 5.83
+cta 6.67
+ctc 1.67
+ctg 15
+ctt 3.75
+gaa 3.75
+gac 1.25
+gag 13.3
+gat 0.834
+gca 88.6
+gcc 37.5
+gcg 149
+gct 52.1
+ggg 0.626
+gta 16.3
+gtc 4.58
+gtg 43.8
+gtt 8.13
+taa 0.626
+tac 0.626
+tag 5.63
+tat 0.209
+tca 34.2
+tcc 18.3
+tcg 102
+tct 16.9
+tgg 0.417
+tta 8.75
+ttc 3.54
+ttg 49.4
+ttt 5.21
+
+
+#
+# DSS probabilities
+#only nonpseudocount values are shown
+[DSS]
+# Size of vector
+4096
+# c_dss (DSS count)
+4798
+# dsspseudocount (added to all possible patterns, no matter if they occur)
+0.00766
+# Probabilities * 1000
+aaaaaa 0.442
+aaaaac 0.231
+aaaaag 0.421
+aaaaat 1.86
+aaaaca 0.0229
+aaaacc 0.0157
+aaaacg 0.209
+aaaact 0.644
+aaaaga 5.28
+aaaagc 4.67
+aaaagg 1.05
+aaaagt 9.57
+aaaata 0.84
+aaaatc 0.431
+aaaatg 0.227
+aaaatt 3.28
+aaacaa 0.014
+aaacac 0.00675
+aaacag 0.00709
+aaacat 0.0208
+aaacca 0.00743
+aaaccc 0.00571
+aaaccg 0.00227
+aaacct 0.00847
+aaacga 0.218
+aaacgc 0.416
+aaacgg 0.00881
+aaacgt 0.845
+aaacta 0.216
+aaactc 0.0119
+aaactg 0.0095
+aaactt 0.233
+aaagaa 0.00537
+aaagac 0.00365
+aaagag 0.0064
+aaagat 0.00881
+aaagca 0.00296
+aaagcc 0.00296
+aaagcg 0.00262
+aaagct 0.00503
+aaagga 0.0147
+aaaggc 0.014
+aaaggg 0.00778
+aaaggt 0.239
+aaagta 0.00571
+aaagtc 0.00365
+aaagtg 0.00434
+aaagtt 0.0129
+aaataa 0.217
+aaatac 0.0105
+aaatag 0.21
+aaatat 0.241
+aaatca 0.0109
+aaatcc 0.00743
+aaatcg 0.00571
+aaatct 0.0243
+aaatga 0.645
+aaatgc 1.05
+aaatgg 0.63
+aaatgt 6.7
+aaatta 0.214
+aaattc 0.0171
+aaattg 0.0116
+aaattt 0.448
+aacaaa 0.00331
+aacaac 0.00193
+aacaag 0.00262
+aacaat 0.00847
+aacaca 0.00262
+aacacc 0.00262
+aacacg 0.00193
+aacact 0.00468
+aacaga 0.0167
+aacagc 0.0136
+aacagg 0.00503
+aacagt 0.643
+aacata 0.00365
+aacatc 0.00296
+aacatg 0.00227
+aacatt 0.00984
+aaccaa 0.00262
+aaccac 0.00159
+aaccag 0.00159
+aaccat 0.00262
+aaccca 0.00159
+aacccc 0.00227
+aacccg 0.00159
+aaccct 0.00159
+aaccga 0.00193
+aaccgc 0.00296
+aaccgg 0.00193
+aaccgt 0.00571
+aaccta 0.00296
+aacctc 0.00227
+aacctg 0.00159
+aacctt 0.00262
+aacgaa 0.00193
+aacgac 0.00159
+aacgag 0.00159
+aacgat 0.00159
+aacgca 0.00159
+aacgcc 0.00159
+aacgcg 0.00159
+aacgct 0.00159
+aacgga 0.00159
+aacggc 0.00193
+aacggg 0.00159
+aacggt 0.00468
+aacgta 0.00159
+aacgtc 0.00193
+aacgtg 0.00159
+aacgtt 0.00227
+aactaa 0.00331
+aactac 0.00227
+aactag 0.00193
+aactat 0.00365
+aactca 0.00262
+aactcc 0.00159
+aactcg 0.00193
+aactct 0.00296
+aactga 0.00399
+aactgc 0.00537
+aactgg 0.00365
+aactgt 0.223
+aactta 0.00331
+aacttc 0.00193
+aacttg 0.00227
+aacttt 0.00503
+aagaaa 0.00881
+aagaac 0.00434
+aagaag 0.00468
+aagaat 0.0219
+aagaca 0.00434
+aagacc 0.00331
+aagacg 0.00193
+aagact 0.0129
+aagaga 0.834
+aagagc 0.627
+aagagg 0.0171
+aagagt 5.28
+aagata 0.00847
+aagatc 0.00537
+aagatg 0.00399
+aagatt 0.0229
+aagcaa 0.00193
+aagcac 0.00331
+aagcag 0.00296
+aagcat 0.00365
+aagcca 0.00159
+aagccc 0.00159
+aagccg 0.00159
+aagcct 0.00331
+aagcga 0.00399
+aagcgc 0.00434
+aagcgg 0.00227
+aagcgt 0.217
+aagcta 0.00331
+aagctc 0.00227
+aagctg 0.00193
+aagctt 0.00468
+aaggaa 0.00227
+aaggac 0.00159
+aaggag 0.00262
+aaggat 0.00399
+aaggca 0.00193
+aaggcc 0.00159
+aaggcg 0.00159
+aaggct 0.00331
+aaggga 0.00468
+aagggc 0.00434
+aagggg 0.00331
+aagggt 0.617
+aaggta 0.00193
+aaggtc 0.00193
+aaggtg 0.00159
+aaggtt 0.00331
+aagtaa 0.00227
+aagtac 0.00193
+aagtag 0.00193
+aagtat 0.00296
+aagtca 0.00193
+aagtcc 0.00227
+aagtcg 0.00159
+aagtct 0.00262
+aagtga 0.00537
+aagtgc 0.00606
+aagtgg 0.00365
+aagtgt 0.0315
+aagtta 0.00227
+aagttc 0.00227
+aagttg 0.00193
+aagttt 0.00434
+aataaa 0.00365
+aataac 0.00365
+aataag 0.00365
+aataat 0.0116
+aataca 0.00227
+aatacc 0.00193
+aatacg 0.00193
+aatact 0.00571
+aataga 0.0202
+aatagc 0.0174
+aatagg 0.00709
+aatagt 0.854
+aatata 0.0064
+aatatc 0.00468
+aatatg 0.00331
+aatatt 0.0153
+aatcaa 0.00399
+aatcac 0.00227
+aatcag 0.00262
+aatcat 0.00571
+aatcca 0.00159
+aatccc 0.00227
+aatccg 0.00227
+aatcct 0.00296
+aatcga 0.00331
+aatcgc 0.00296
+aatcgg 0.204
+aatcgt 0.211
+aatcta 0.00365
+aatctc 0.00365
+aatctg 0.00262
+aatctt 0.00915
+aatgaa 0.00296
+aatgac 0.00193
+aatgag 0.00193
+aatgat 0.00193
+aatgca 0.00262
+aatgcc 0.00193
+aatgcg 0.00159
+aatgct 0.00365
+aatgga 0.00434
+aatggc 0.00296
+aatggg 0.00296
+aatggt 0.215
+aatgta 0.00227
+aatgtc 0.00262
+aatgtg 0.00193
+aatgtt 0.00399
+aattaa 0.00468
+aattac 0.00262
+aattag 0.00331
+aattat 0.00778
+aattca 0.00365
+aattcc 0.00262
+aattcg 0.00159
+aattct 0.00503
+aattga 0.0122
+aattgc 0.0102
+aattgg 0.00915
+aattgt 0.446
+aattta 0.00399
+aatttc 0.00434
+aatttg 0.00399
+aatttt 0.209
+acaaaa 0.227
+acaaac 0.0174
+acaaag 0.214
+acaaat 0.038
+acaaca 0.0116
+acaacc 0.00571
+acaacg 0.00571
+acaact 0.0208
+acaaga 0.439
+acaagc 0.232
+acaagg 0.22
+acaagt 2.09
+acaata 0.0226
+acaatc 0.0153
+acaatg 0.218
+acaatt 0.0546
+acacaa 0.0122
+acacac 0.00571
+acacag 0.0064
+acacat 0.016
+acacca 0.00675
+acaccc 0.00503
+acaccg 0.00193
+acacct 0.00606
+acacga 0.00537
+acacgc 0.00537
+acacgg 0.00399
+acacgt 0.218
+acacta 0.0129
+acactc 0.0102
+acactg 0.00881
+acactt 0.0253
+acagaa 0.00468
+acagac 0.00331
+acagag 0.00571
+acagat 0.00537
+acagca 0.00296
+acagcc 0.00296
+acagcg 0.00227
+acagct 0.00399
+acagga 0.00537
+acaggc 0.00399
+acaggg 0.00503
+acaggt 0.213
+acagta 0.00365
+acagtc 0.00331
+acagtg 0.00434
+acagtt 0.00675
+acataa 0.0143
+acatac 0.00778
+acatag 0.00778
+acatat 0.026
+acatca 0.0095
+acatcc 0.0064
+acatcg 0.00399
+acatct 0.0129
+acatga 0.221
+acatgc 0.0246
+acatgg 0.014
+acatgt 1.05
+acatta 0.0112
+acattc 0.214
+acattg 0.00984
+acattt 0.231
+accaaa 0.00296
+accaac 0.00159
+accaag 0.00227
+accaat 0.00434
+accaca 0.00262
+accacc 0.00262
+accacg 0.00159
+accact 0.00262
+accaga 0.00606
+accagc 0.00434
+accagg 0.00262
+accagt 0.0198
+accata 0.00227
+accatc 0.00227
+accatg 0.00227
+accatt 0.00331
+acccaa 0.00262
+acccac 0.00159
+acccag 0.00159
+acccat 0.00262
+acccca 0.00159
+accccc 0.00227
+accccg 0.00159
+acccct 0.00159
+acccga 0.00159
+acccgc 0.00227
+acccgg 0.00159
+acccgt 0.00296
+acccta 0.00262
+accctc 0.00227
+accctg 0.00159
+accctt 0.00227
+accgaa 0.00193
+accgac 0.00159
+accgag 0.00159
+accgat 0.00159
+accgca 0.00159
+accgcc 0.00159
+accgcg 0.00159
+accgct 0.00159
+accgga 0.00159
+accggc 0.00193
+accggg 0.00159
+accggt 0.00193
+accgta 0.00159
+accgtc 0.00193
+accgtg 0.00159
+accgtt 0.00227
+acctaa 0.00296
+acctac 0.00227
+acctag 0.00159
+acctat 0.00296
+acctca 0.00262
+acctcc 0.00159
+acctcg 0.00193
+acctct 0.00262
+acctga 0.00296
+acctgc 0.00331
+acctgg 0.00227
+acctgt 0.0112
+acctta 0.00296
+accttc 0.00227
+accttg 0.00227
+accttt 0.00399
+acgaaa 0.00709
+acgaac 0.00331
+acgaag 0.00434
+acgaat 0.0119
+acgaca 0.00296
+acgacc 0.00262
+acgacg 0.00159
+acgact 0.00503
+acgaga 0.0164
+acgagc 0.211
+acgagg 0.00675
+acgagt 1.24
+acgata 0.00571
+acgatc 0.00399
+acgatg 0.00399
+acgatt 0.0105
+acgcaa 0.00193
+acgcac 0.00331
+acgcag 0.00296
+acgcat 0.00365
+acgcca 0.00159
+acgccc 0.00159
+acgccg 0.00159
+acgcct 0.00331
+acgcga 0.00227
+acgcgc 0.00296
+acgcgg 0.00193
+acgcgt 0.208
+acgcta 0.00296
+acgctc 0.00227
+acgctg 0.00193
+acgctt 0.00434
+acggaa 0.00227
+acggac 0.00159
+acggag 0.00262
+acggat 0.00296
+acggca 0.00193
+acggcc 0.00159
+acggcg 0.00159
+acggct 0.00227
+acggga 0.00227
+acgggc 0.00262
+acgggg 0.00227
+acgggt 0.00847
+acggta 0.00193
+acggtc 0.00193
+acggtg 0.00159
+acggtt 0.00227
+acgtaa 0.00193
+acgtac 0.00193
+acgtag 0.00159
+acgtat 0.00262
+acgtca 0.00193
+acgtcc 0.00227
+acgtcg 0.00159
+acgtct 0.00262
+acgtga 0.00331
+acgtgc 0.00365
+acgtgg 0.00262
+acgtgt 0.0129
+acgtta 0.00193
+acgttc 0.00262
+acgttg 0.00193
+acgttt 0.00365
+actaaa 0.00331
+actaac 0.00331
+actaag 0.00296
+actaat 0.00709
+actaca 0.00227
+actacc 0.00193
+actacg 0.00159
+actact 0.00331
+actaga 0.00881
+actagc 0.00778
+actagg 0.00399
+actagt 0.0294
+actata 0.00503
+actatc 0.00399
+actatg 0.00331
+actatt 0.00812
+actcaa 0.00399
+actcac 0.00227
+actcag 0.00193
+actcat 0.00537
+actcca 0.00159
+actccc 0.00227
+actccg 0.00193
+actcct 0.00262
+actcga 0.00227
+actcgc 0.00159
+actcgg 0.00331
+actcgt 0.00709
+actcta 0.00331
+actctc 0.00365
+actctg 0.00227
+actctt 0.00812
+actgaa 0.00296
+actgac 0.00193
+actgag 0.00193
+actgat 0.00159
+actgca 0.00262
+actgcc 0.00193
+actgcg 0.00159
+actgct 0.00331
+actgga 0.00399
+actggc 0.00262
+actggg 0.00193
+actggt 0.0109
+actgta 0.00227
+actgtc 0.00262
+actgtg 0.00193
+actgtt 0.00331
+acttaa 0.00434
+acttac 0.00262
+acttag 0.00296
+acttat 0.0064
+acttca 0.00365
+acttcc 0.00262
+acttcg 0.00159
+acttct 0.00399
+acttga 0.0109
+acttgc 0.00778
+acttgg 0.00709
+acttgt 0.0325
+acttta 0.00331
+actttc 0.00434
+actttg 0.00365
+actttt 0.00709
+agaaaa 13.2
+agaaac 8.54
+agaaag 5.74
+agaaat 15.9
+agaaca 5.32
+agaacc 2.29
+agaacg 1.27
+agaact 8.78
+agaaga 8.2
+agaagc 6.76
+agaagg 4.33
+agaagt 16.1
+agaata 9.8
+agaatc 6.36
+agaatg 7.95
+agaatt 24.1
+agacaa 6.11
+agacac 2.28
+agacag 2.67
+agacat 8.35
+agacca 3.06
+agaccc 2.04
+agaccg 0.233
+agacct 2.49
+agacga 1.08
+agacgc 0.864
+agacgg 1.05
+agacgt 3.74
+agacta 6.52
+agactc 4.7
+agactg 3.89
+agactt 13.2
+agagaa 1.67
+agagac 1.04
+agagag 2.25
+agagat 2.09
+agagca 0.839
+agagcc 0.826
+agagcg 0.422
+agagct 1.25
+agagga 1.46
+agaggc 0.853
+agaggg 1.64
+agaggt 2.71
+agagta 1.26
+agagtc 0.85
+agagtg 1.45
+agagtt 2.72
+agataa 6.74
+agatac 3.31
+agatag 3.29
+agatat 12.6
+agatca 4.49
+agatcc 2.48
+agatcg 1.45
+agatct 5.54
+agatga 8.56
+agatgc 10.2
+agatgg 5.12
+agatgt 17.1
+agatta 4.94
+agattc 6.93
+agattg 4.31
+agattt 15.2
+agcaaa 0.644
+agcaac 0.0277
+agcaag 0.22
+agcaat 1.67
+agcaca 0.624
+agcacc 0.615
+agcacg 0.00847
+agcact 0.64
+agcaga 2.26
+agcagc 1.25
+agcagg 0.433
+agcagt 6.52
+agcata 0.438
+agcatc 0.426
+agcatg 0.224
+agcatt 1.08
+agccaa 0.622
+agccac 0.0122
+agccag 0.0102
+agccat 0.63
+agccca 0.0116
+agcccc 0.41
+agcccg 0.00331
+agccct 0.0133
+agccga 0.0122
+agccgc 0.211
+agccgg 0.00709
+agccgt 0.437
+agccta 0.623
+agcctc 0.418
+agcctg 0.0126
+agcctt 0.443
+agcgaa 0.211
+agcgac 0.00537
+agcgag 0.00743
+agcgat 0.0126
+agcgca 0.00675
+agcgcc 0.00571
+agcgcg 0.00262
+agcgct 0.00915
+agcgga 0.0126
+agcggc 0.21
+agcggg 0.00709
+agcggt 0.0374
+agcgta 0.00915
+agcgtc 0.208
+agcgtg 0.0064
+agcgtt 0.415
+agctaa 0.827
+agctac 0.415
+agctag 0.014
+agctat 0.848
+agctca 0.62
+agctcc 0.0143
+agctcg 0.208
+agctct 0.63
+agctga 0.647
+agctgc 1.04
+agctgg 0.43
+agctgt 4.3
+agctta 0.824
+agcttc 0.226
+agcttg 0.418
+agcttt 1.25
+aggaaa 3.07
+aggaac 0.845
+aggaag 1.44
+aggaat 4.89
+aggaca 0.838
+aggacc 0.418
+aggacg 0.0136
+aggact 0.856
+aggaga 5.69
+aggagc 1.67
+aggagg 1.25
+aggagt 8.17
+aggata 2.46
+aggatc 1.24
+aggatg 1.24
+aggatt 4.11
+aggcaa 0.23
+aggcac 1.02
+aggcag 0.817
+aggcat 1.04
+aggcca 0.0122
+aggccc 0.0119
+aggccg 0.00537
+aggcct 0.82
+aggcga 0.221
+aggcgc 0.215
+aggcgg 0.0129
+aggcgt 1.25
+aggcta 0.828
+aggctc 0.423
+aggctg 0.218
+aggctt 1.45
+agggaa 0.417
+agggac 0.0112
+agggag 0.615
+agggat 0.825
+agggca 0.209
+agggcc 0.00675
+agggcg 0.00503
+agggct 0.416
+agggga 0.425
+aggggc 0.416
+aggggg 0.415
+aggggt 1.65
+agggta 0.214
+agggtc 0.21
+agggtg 0.0102
+agggtt 0.427
+aggtaa 0.228
+aggtac 0.217
+aggtag 0.0164
+aggtat 0.653
+aggtca 0.219
+aggtcc 0.413
+aggtcg 0.00778
+aggtct 0.631
+aggtga 0.851
+aggtgc 1.05
+aggtgg 0.632
+aggtgt 4.11
+aggtta 0.224
+aggttc 0.426
+aggttg 0.219
+aggttt 1.06
+agtaaa 0.859
+agtaac 1.04
+agtaag 0.631
+agtaat 3.29
+agtaca 0.431
+agtacc 0.222
+agtacg 0.0109
+agtact 0.86
+agtaga 3.69
+agtagc 3.27
+agtagg 1.26
+agtagt 11.4
+agtata 2.05
+agtatc 1.45
+agtatg 0.839
+agtatt 3.91
+agtcaa 1.43
+agtcac 0.421
+agtcag 0.22
+agtcat 2.25
+agtcca 0.0174
+agtccc 0.413
+agtccg 0.207
+agtcct 0.631
+agtcga 0.433
+agtcgc 0.0264
+agtcgg 0.822
+agtcgt 2.69
+agtcta 1.04
+agtctc 1.23
+agtctg 0.426
+agtctt 3.87
+agtgaa 0.82
+agtgac 0.212
+agtgag 0.212
+agtgat 0.0346
+agtgca 0.615
+agtgcc 0.211
+agtgcg 0.00675
+agtgct 1.03
+agtgga 1.44
+agtggc 0.631
+agtggg 0.228
+agtggt 5.09
+agtgta 0.421
+agtgtc 0.618
+agtgtg 0.213
+agtgtt 1.04
+agttaa 1.65
+agttac 0.632
+agttag 0.828
+agttat 2.89
+agttca 1.23
+agttcc 0.625
+agttcg 0.0191
+agttct 1.46
+agttga 5.3
+agttgc 3.69
+agttgg 3.28
+agttgt 16.8
+agttta 1.04
+agtttc 1.44
+agtttg 1.23
+agtttt 2.9
+ataaaa 0.437
+ataaac 0.0253
+ataaag 0.22
+ataaat 1.26
+ataaca 0.0191
+ataacc 0.0109
+ataacg 0.409
+ataact 0.0422
+ataaga 3.48
+ataagc 2.27
+ataagg 1.45
+ataagt 11.6
+ataata 0.835
+ataatc 0.624
+ataatg 0.426
+ataatt 1.28
+atacaa 0.0136
+atacac 0.207
+atacag 0.00743
+atacat 0.0212
+atacca 0.00709
+ataccc 0.00571
+ataccg 0.00296
+atacct 0.00812
+atacga 0.214
+atacgc 0.213
+atacgg 0.00915
+atacgt 1.24
+atacta 0.0153
+atactc 0.0119
+atactg 0.21
+atactt 0.23
+atagaa 0.00537
+atagac 0.00434
+atagag 0.00571
+atagat 0.00847
+atagca 0.00296
+atagcc 0.00331
+atagcg 0.00296
+atagct 0.00434
+atagga 0.0119
+ataggc 0.21
+ataggg 0.00847
+ataggt 0.433
+atagta 0.00503
+atagtc 0.00434
+atagtg 0.00503
+atagtt 0.0095
+atataa 0.217
+atatac 0.211
+atatag 0.0095
+atatat 0.431
+atatca 0.0102
+atatcc 0.00847
+atatcg 0.00503
+atatct 0.014
+atatga 0.43
+atatgc 0.634
+atatgg 0.219
+atatgt 1.28
+atatta 0.0129
+atattc 0.0164
+atattg 0.0105
+atattt 0.235
+atcaaa 0.00331
+atcaac 0.00159
+atcaag 0.00227
+atcaat 0.00709
+atcaca 0.00262
+atcacc 0.00262
+atcacg 0.00227
+atcact 0.00365
+atcaga 0.0129
+atcagc 0.00984
+atcagg 0.00571
+atcagt 0.445
+atcata 0.00365
+atcatc 0.00331
+atcatg 0.00262
+atcatt 0.00606
+atccaa 0.00262
+atccac 0.00227
+atccag 0.00159
+atccat 0.00262
+atccca 0.00159
+atcccc 0.00262
+atcccg 0.00159
+atccct 0.00159
+atccga 0.00227
+atccgc 0.203
+atccgg 0.00193
+atccgt 0.00606
+atccta 0.00262
+atcctc 0.00262
+atcctg 0.00193
+atcctt 0.00262
+atcgaa 0.00193
+atcgac 0.00159
+atcgag 0.00159
+atcgat 0.00159
+atcgca 0.00159
+atcgcc 0.00159
+atcgcg 0.00159
+atcgct 0.00159
+atcgga 0.00159
+atcggc 0.00262
+atcggg 0.00159
+atcggt 0.00331
+atcgta 0.00159
+atcgtc 0.00193
+atcgtg 0.00159
+atcgtt 0.00227
+atctaa 0.00331
+atctac 0.00262
+atctag 0.00159
+atctat 0.00365
+atctca 0.00262
+atctcc 0.00159
+atctcg 0.00193
+atctct 0.00262
+atctga 0.00331
+atctgc 0.00468
+atctgg 0.00262
+atctgt 0.0122
+atctta 0.00296
+atcttc 0.00193
+atcttg 0.00227
+atcttt 0.00399
+atgaaa 0.00812
+atgaac 0.00434
+atgaag 0.00468
+atgaat 0.0195
+atgaca 0.00365
+atgacc 0.00365
+atgacg 0.00262
+atgact 0.0109
+atgaga 0.431
+atgagc 0.823
+atgagg 0.217
+atgagt 4.49
+atgata 0.00778
+atgatc 0.00606
+atgatg 0.00468
+atgatt 0.0181
+atgcaa 0.00193
+atgcac 0.00399
+atgcag 0.00296
+atgcat 0.00365
+atgcca 0.00159
+atgccc 0.00193
+atgccg 0.00159
+atgcct 0.00331
+atgcga 0.00365
+atgcgc 0.205
+atgcgg 0.00262
+atgcgt 0.216
+atgcta 0.00296
+atgctc 0.00262
+atgctg 0.00227
+atgctt 0.00468
+atggaa 0.00227
+atggac 0.00159
+atggag 0.00262
+atggat 0.00331
+atggca 0.00193
+atggcc 0.00159
+atggcg 0.00159
+atggct 0.00262
+atggga 0.00331
+atgggc 0.00468
+atgggg 0.00296
+atgggt 0.215
+atggta 0.00193
+atggtc 0.00193
+atggtg 0.00159
+atggtt 0.00262
+atgtaa 0.00227
+atgtac 0.00227
+atgtag 0.00159
+atgtat 0.00365
+atgtca 0.00193
+atgtcc 0.00227
+atgtcg 0.00159
+atgtct 0.00296
+atgtga 0.00468
+atgtgc 0.0064
+atgtgg 0.00365
+atgtgt 0.22
+atgtta 0.00193
+atgttc 0.00227
+atgttg 0.00193
+atgttt 0.00399
+attaaa 0.00399
+attaac 0.00331
+attaag 0.00296
+attaat 0.0109
+attaca 0.00296
+attacc 0.00227
+attacg 0.00262
+attact 0.205
+attaga 0.217
+attagc 0.014
+attagg 0.00812
+attagt 0.855
+attata 0.00675
+attatc 0.00503
+attatg 0.00365
+attatt 0.0119
+attcaa 0.00399
+attcac 0.00262
+attcag 0.00193
+attcat 0.00537
+attcca 0.00159
+attccc 0.00227
+attccg 0.00193
+attcct 0.00296
+attcga 0.00296
+attcgc 0.00262
+attcgg 0.00331
+attcgt 0.0102
+attcta 0.00331
+attctc 0.00365
+attctg 0.00262
+attctt 0.00847
+attgaa 0.00296
+attgac 0.00193
+attgag 0.00193
+attgat 0.00159
+attgca 0.00262
+attgcc 0.00193
+attgcg 0.00159
+attgct 0.00365
+attgga 0.00434
+attggc 0.00296
+attggg 0.00193
+attggt 0.0129
+attgta 0.00227
+attgtc 0.00262
+attgtg 0.00193
+attgtt 0.00331
+atttaa 0.00468
+atttac 0.00296
+atttag 0.00296
+atttat 0.00709
+atttca 0.00365
+atttcc 0.00262
+atttcg 0.00159
+atttct 0.00434
+atttga 0.0116
+atttgc 0.00881
+atttgg 0.00743
+atttgt 0.0346
+atttta 0.00331
+attttc 0.00399
+attttg 0.00365
+attttt 0.00709
+caaaaa 0.00571
+caaaac 0.00503
+caaaag 0.00331
+caaaat 0.0178
+caaaca 0.00399
+caaacc 0.00399
+caaacg 0.00227
+caaact 0.0157
+caaaga 1.24
+caaagc 1.04
+caaagg 0.221
+caaagt 6.29
+caaata 0.0102
+caaatc 0.00571
+caaatg 0.00571
+caaatt 0.425
+caacaa 0.00331
+caacac 0.00159
+caacag 0.00227
+caacat 0.00331
+caacca 0.00193
+caaccc 0.00159
+caaccg 0.00159
+caacct 0.00262
+caacga 0.207
+caacgc 0.00743
+caacgg 0.00365
+caacgt 0.422
+caacta 0.00227
+caactc 0.00296
+caactg 0.00159
+caactt 0.00503
+caagaa 0.00159
+caagac 0.00159
+caagag 0.00193
+caagat 0.00193
+caagca 0.00159
+caagcc 0.00159
+caagcg 0.00193
+caagct 0.00193
+caagga 0.00503
+caaggc 0.00468
+caaggg 0.204
+caaggt 0.218
+caagta 0.00159
+caagtc 0.00159
+caagtg 0.00227
+caagtt 0.00262
+caataa 0.00365
+caatac 0.00296
+caatag 0.00296
+caatat 0.00606
+caatca 0.00227
+caatcc 0.00365
+caatcg 0.00193
+caatct 0.00571
+caatga 0.213
+caatgc 0.415
+caatgg 0.21
+caatgt 1.85
+caatta 0.00296
+caattc 0.00262
+caattg 0.00227
+caattt 0.00743
+cacaaa 0.00159
+cacaac 0.00159
+cacaag 0.00193
+cacaat 0.00159
+cacaca 0.00159
+cacacc 0.00159
+cacacg 0.00159
+cacact 0.00159
+cacaga 0.00399
+cacagc 0.00331
+cacagg 0.00193
+cacagt 0.0188
+cacata 0.00159
+cacatc 0.00159
+cacatg 0.00159
+cacatt 0.00227
+caccaa 0.00159
+caccac 0.00159
+caccag 0.00193
+caccat 0.00159
+caccca 0.00159
+cacccc 0.00159
+cacccg 0.00159
+caccct 0.00159
+caccga 0.00193
+caccgc 0.00159
+caccgg 0.00159
+caccgt 0.00262
+caccta 0.00159
+cacctc 0.00159
+cacctg 0.00159
+cacctt 0.00159
+cacgaa 0.00159
+cacgac 0.00159
+cacgag 0.00159
+cacgat 0.00159
+cacgca 0.00159
+cacgcc 0.00159
+cacgcg 0.00159
+cacgct 0.00193
+cacgga 0.00159
+cacggc 0.00159
+cacggg 0.00193
+cacggt 0.00193
+cacgta 0.00159
+cacgtc 0.00159
+cacgtg 0.00159
+cacgtt 0.00159
+cactaa 0.00159
+cactac 0.00159
+cactag 0.00159
+cactat 0.00159
+cactca 0.00159
+cactcc 0.00159
+cactcg 0.00159
+cactct 0.00159
+cactga 0.00193
+cactgc 0.00227
+cactgg 0.00193
+cactgt 0.00503
+cactta 0.00159
+cacttc 0.00159
+cacttg 0.00159
+cacttt 0.00159
+cagaaa 0.00159
+cagaac 0.00193
+cagaag 0.00193
+cagaat 0.00503
+cagaca 0.00193
+cagacc 0.00159
+cagacg 0.00159
+cagact 0.00503
+cagaga 0.0102
+cagagc 0.00984
+cagagg 0.00571
+cagagt 2.05
+cagata 0.00193
+cagatc 0.00159
+cagatg 0.00159
+cagatt 0.00571
+cagcaa 0.00159
+cagcac 0.00159
+cagcag 0.00193
+cagcat 0.00193
+cagcca 0.00159
+cagccc 0.00159
+cagccg 0.00159
+cagcct 0.00193
+cagcga 0.00227
+cagcgc 0.00193
+cagcgg 0.00193
+cagcgt 0.207
+cagcta 0.00159
+cagctc 0.00159
+cagctg 0.00159
+cagctt 0.00193
+caggaa 0.00159
+caggac 0.00159
+caggag 0.00159
+caggat 0.00159
+caggca 0.00159
+caggcc 0.00159
+caggcg 0.00159
+caggct 0.00159
+caggga 0.00159
+cagggc 0.00159
+cagggg 0.00193
+cagggt 0.00709
+caggta 0.00159
+caggtc 0.00159
+caggtg 0.00159
+caggtt 0.00159
+cagtaa 0.00159
+cagtac 0.00159
+cagtag 0.00159
+cagtat 0.00159
+cagtca 0.00159
+cagtcc 0.00159
+cagtcg 0.00159
+cagtct 0.00159
+cagtga 0.00193
+cagtgc 0.00227
+cagtgg 0.00193
+cagtgt 0.00915
+cagtta 0.00159
+cagttc 0.00159
+cagttg 0.00159
+cagttt 0.00159
+cataaa 0.00227
+cataac 0.00193
+cataag 0.203
+cataat 0.00262
+cataca 0.00193
+catacc 0.00159
+catacg 0.00193
+catact 0.00227
+cataga 0.205
+catagc 0.00503
+catagg 0.00331
+catagt 0.422
+catata 0.00193
+catatc 0.00159
+catatg 0.00193
+catatt 0.00296
+catcaa 0.00193
+catcac 0.00193
+catcag 0.203
+catcat 0.00193
+catcca 0.00159
+catccc 0.00159
+catccg 0.00193
+catcct 0.00159
+catcga 0.00227
+catcgc 0.00159
+catcgg 0.00227
+catcgt 0.00365
+catcta 0.00159
+catctc 0.00159
+catctg 0.00193
+catctt 0.00159
+catgaa 0.00159
+catgac 0.00159
+catgag 0.00227
+catgat 0.00159
+catgca 0.00159
+catgcc 0.00159
+catgcg 0.00159
+catgct 0.00159
+catgga 0.00193
+catggc 0.00159
+catggg 0.00227
+catggt 0.00296
+catgta 0.00159
+catgtc 0.00159
+catgtg 0.00159
+catgtt 0.00159
+cattaa 0.00159
+cattac 0.00159
+cattag 0.00227
+cattat 0.00159
+cattca 0.00159
+cattcc 0.00159
+cattcg 0.00159
+cattct 0.00159
+cattga 0.00227
+cattgc 0.00227
+cattgg 0.00193
+cattgt 0.00812
+cattta 0.00159
+catttc 0.00159
+catttg 0.00159
+catttt 0.00193
+ccaaaa 0.00399
+ccaaac 0.00365
+ccaaag 0.00296
+ccaaat 0.00503
+ccaaca 0.00262
+ccaacc 0.00399
+ccaacg 0.00227
+ccaact 0.00434
+ccaaga 0.417
+ccaagc 0.617
+ccaagg 0.408
+ccaagt 0.852
+ccaata 0.00709
+ccaatc 0.205
+ccaatg 0.00606
+ccaatt 0.00984
+ccacaa 0.00262
+ccacac 0.00227
+ccacag 0.00193
+ccacat 0.00262
+ccacca 0.00159
+ccaccc 0.00262
+ccaccg 0.00159
+ccacct 0.00193
+ccacga 0.00399
+ccacgc 0.206
+ccacgg 0.00262
+ccacgt 0.00675
+ccacta 0.00193
+ccactc 0.204
+ccactg 0.00193
+ccactt 0.00331
+ccagaa 0.00159
+ccagac 0.00159
+ccagag 0.00159
+ccagat 0.00159
+ccagca 0.00159
+ccagcc 0.00193
+ccagcg 0.00159
+ccagct 0.00159
+ccagga 0.00227
+ccaggc 0.00331
+ccaggg 0.00296
+ccaggt 0.00434
+ccagta 0.00159
+ccagtc 0.00227
+ccagtg 0.00193
+ccagtt 0.00159
+ccataa 0.00296
+ccatac 0.00296
+ccatag 0.00227
+ccatat 0.00262
+ccatca 0.00227
+ccatcc 0.204
+ccatcg 0.00193
+ccatct 0.00331
+ccatga 0.00503
+ccatgc 0.208
+ccatgg 0.00503
+ccatgt 0.217
+ccatta 0.00227
+ccattc 0.00365
+ccattg 0.00193
+ccattt 0.00365
+cccaaa 0.00159
+cccaac 0.00159
+cccaag 0.00159
+cccaat 0.00159
+cccaca 0.00159
+cccacc 0.00159
+cccacg 0.00159
+cccact 0.00159
+cccaga 0.00227
+cccagc 0.00262
+cccagg 0.00227
+cccagt 0.00503
+cccata 0.00159
+cccatc 0.00193
+cccatg 0.00159
+cccatt 0.00159
+ccccaa 0.00159
+ccccac 0.00159
+ccccag 0.00159
+ccccat 0.00159
+ccccca 0.00159
+cccccc 0.00159
+cccccg 0.00159
+ccccct 0.00159
+ccccga 0.00159
+ccccgc 0.00193
+ccccgg 0.00159
+ccccgt 0.00159
+ccccta 0.00159
+cccctc 0.00193
+cccctg 0.00159
+cccctt 0.00159
+cccgaa 0.00159
+cccgac 0.00159
+cccgag 0.00159
+cccgat 0.00159
+cccgca 0.00159
+cccgcc 0.00159
+cccgcg 0.00159
+cccgct 0.00193
+cccgga 0.00159
+cccggc 0.00159
+cccggg 0.00159
+cccggt 0.00159
+cccgta 0.00159
+cccgtc 0.00159
+cccgtg 0.00159
+cccgtt 0.00159
+ccctaa 0.00159
+ccctac 0.00159
+ccctag 0.00159
+ccctat 0.00159
+ccctca 0.00159
+ccctcc 0.00193
+ccctcg 0.00159
+ccctct 0.00159
+ccctga 0.00159
+ccctgc 0.00193
+ccctgg 0.00159
+ccctgt 0.00227
+ccctta 0.00159
+cccttc 0.00159
+cccttg 0.00159
+cccttt 0.00159
+ccgaaa 0.00159
+ccgaac 0.00193
+ccgaag 0.00159
+ccgaat 0.00227
+ccgaca 0.00193
+ccgacc 0.00159
+ccgacg 0.00159
+ccgact 0.00227
+ccgaga 0.00434
+ccgagc 0.0064
+ccgagg 0.00331
+ccgagt 0.425
+ccgata 0.00193
+ccgatc 0.00193
+ccgatg 0.00159
+ccgatt 0.00227
+ccgcaa 0.00159
+ccgcac 0.00159
+ccgcag 0.00159
+ccgcat 0.00159
+ccgcca 0.00159
+ccgccc 0.00159
+ccgccg 0.00159
+ccgcct 0.00159
+ccgcga 0.00159
+ccgcgc 0.00193
+ccgcgg 0.00159
+ccgcgt 0.00296
+ccgcta 0.00159
+ccgctc 0.00193
+ccgctg 0.00159
+ccgctt 0.00159
+ccggaa 0.00159
+ccggac 0.00159
+ccggag 0.00159
+ccggat 0.00159
+ccggca 0.00159
+ccggcc 0.00159
+ccggcg 0.00159
+ccggct 0.00159
+ccggga 0.00159
+ccgggc 0.00159
+ccgggg 0.00159
+ccgggt 0.00262
+ccggta 0.00159
+ccggtc 0.00159
+ccggtg 0.00159
+ccggtt 0.00159
+ccgtaa 0.00159
+ccgtac 0.00159
+ccgtag 0.00159
+ccgtat 0.00159
+ccgtca 0.00159
+ccgtcc 0.00193
+ccgtcg 0.00159
+ccgtct 0.00159
+ccgtga 0.00159
+ccgtgc 0.00193
+ccgtgg 0.00159
+ccgtgt 0.00331
+ccgtta 0.00159
+ccgttc 0.00159
+ccgttg 0.00159
+ccgttt 0.00159
+cctaaa 0.00159
+cctaac 0.00159
+cctaag 0.00227
+cctaat 0.00159
+cctaca 0.00159
+cctacc 0.00159
+cctacg 0.00159
+cctact 0.00159
+cctaga 0.00262
+cctagc 0.00331
+cctagg 0.00227
+cctagt 0.00675
+cctata 0.00159
+cctatc 0.00193
+cctatg 0.00159
+cctatt 0.00159
+cctcaa 0.00159
+cctcac 0.00159
+cctcag 0.00193
+cctcat 0.00159
+cctcca 0.00159
+cctccc 0.00159
+cctccg 0.00159
+cctcct 0.00159
+cctcga 0.00159
+cctcgc 0.00193
+cctcgg 0.00159
+cctcgt 0.00159
+cctcta 0.00159
+cctctc 0.00193
+cctctg 0.00159
+cctctt 0.00159
+cctgaa 0.00159
+cctgac 0.00159
+cctgag 0.00159
+cctgat 0.00159
+cctgca 0.00159
+cctgcc 0.00159
+cctgcg 0.00159
+cctgct 0.00159
+cctgga 0.00159
+cctggc 0.00159
+cctggg 0.00159
+cctggt 0.00159
+cctgta 0.00159
+cctgtc 0.00159
+cctgtg 0.00159
+cctgtt 0.00159
+ccttaa 0.00159
+ccttac 0.00159
+ccttag 0.00159
+ccttat 0.00159
+ccttca 0.00159
+ccttcc 0.00193
+ccttcg 0.00159
+ccttct 0.00159
+ccttga 0.00159
+ccttgc 0.00193
+ccttgg 0.00159
+ccttgt 0.00399
+ccttta 0.00159
+cctttc 0.00159
+cctttg 0.00159
+cctttt 0.00159
+cgaaaa 0.641
+cgaaac 0.226
+cgaaag 0.0229
+cgaaat 0.857
+cgaaca 0.222
+cgaacc 0.412
+cgaacg 0.0095
+cgaact 0.838
+cgaaga 1.25
+cgaagc 0.849
+cgaagg 0.0281
+cgaagt 2.53
+cgaata 1.65
+cgaatc 0.23
+cgaatg 1.63
+cgaatt 2.09
+cgacaa 0.62
+cgacac 0.0116
+cgacag 0.0102
+cgacat 0.627
+cgacca 0.0102
+cgaccc 0.00847
+cgaccg 0.00227
+cgacct 0.214
+cgacga 0.414
+cgacgc 0.813
+cgacgg 0.00915
+cgacgt 1.03
+cgacta 0.0219
+cgactc 0.417
+cgactg 0.015
+cgactt 0.839
+cgagaa 0.00743
+cgagac 0.00399
+cgagag 0.00675
+cgagat 0.00915
+cgagca 0.00365
+cgagcc 0.00468
+cgagcg 0.00262
+cgagct 0.00743
+cgagga 0.0095
+cgaggc 0.00881
+cgaggg 0.00743
+cgaggt 0.221
+cgagta 0.00812
+cgagtc 0.00468
+cgagtg 0.208
+cgagtt 0.0136
+cgataa 0.623
+cgatac 0.213
+cgatag 0.414
+cgatat 0.24
+cgatca 0.215
+cgatcc 0.212
+cgatcg 0.00812
+cgatct 0.623
+cgatga 0.437
+cgatgc 0.845
+cgatgg 0.622
+cgatgt 2.09
+cgatta 0.421
+cgattc 0.221
+cgattg 0.218
+cgattt 0.645
+cgcaaa 0.00365
+cgcaac 0.00227
+cgcaag 0.00227
+cgcaat 0.0064
+cgcaca 0.00331
+cgcacc 0.00331
+cgcacg 0.00159
+cgcact 0.00503
+cgcaga 0.00915
+cgcagc 0.00915
+cgcagg 0.00365
+cgcagt 0.43
+cgcata 0.00537
+cgcatc 0.00262
+cgcatg 0.00468
+cgcatt 0.00743
+cgccaa 0.00365
+cgccac 0.00159
+cgccag 0.00159
+cgccat 0.00365
+cgccca 0.00159
+cgcccc 0.00227
+cgcccg 0.00159
+cgccct 0.00227
+cgccga 0.00227
+cgccgc 0.00331
+cgccgg 0.00159
+cgccgt 0.00503
+cgccta 0.00262
+cgcctc 0.00296
+cgcctg 0.00159
+cgcctt 0.00365
+cgcgaa 0.00193
+cgcgac 0.00159
+cgcgag 0.00159
+cgcgat 0.00193
+cgcgca 0.00193
+cgcgcc 0.00193
+cgcgcg 0.00193
+cgcgct 0.202
+cgcgga 0.00159
+cgcggc 0.00193
+cgcggg 0.00159
+cgcggt 0.00331
+cgcgta 0.00159
+cgcgtc 0.00193
+cgcgtg 0.00193
+cgcgtt 0.00262
+cgctaa 0.00399
+cgctac 0.00262
+cgctag 0.00227
+cgctat 0.00331
+cgctca 0.00296
+cgctcc 0.00193
+cgctcg 0.00193
+cgctct 0.00399
+cgctga 0.00365
+cgctgc 0.00537
+cgctgg 0.00331
+cgctgt 0.0164
+cgctta 0.00365
+cgcttc 0.00227
+cgcttg 0.00262
+cgcttt 0.00468
+cggaaa 0.0102
+cggaac 0.206
+cggaag 0.00537
+cggaat 0.016
+cggaca 0.205
+cggacc 0.00571
+cggacg 0.00227
+cggact 0.00915
+cggaga 0.429
+cggagc 1.22
+cggagg 0.213
+cggagt 2.66
+cggata 0.21
+cggatc 0.00675
+cggatg 0.00709
+cggatt 0.0181
+cggcaa 0.00365
+cggcac 0.00365
+cggcag 0.00296
+cggcat 0.00434
+cggcca 0.00193
+cggccc 0.00159
+cggccg 0.00159
+cggcct 0.00331
+cggcga 0.00331
+cggcgc 0.00606
+cggcgg 0.00193
+cggcgt 0.0133
+cggcta 0.00331
+cggctc 0.00296
+cggctg 0.00193
+cggctt 0.00537
+cgggaa 0.00227
+cgggac 0.00193
+cgggag 0.00296
+cgggat 0.00331
+cgggca 0.00227
+cgggcc 0.00159
+cgggcg 0.00159
+cgggct 0.00296
+cgggga 0.00331
+cggggc 0.00503
+cggggg 0.00296
+cggggt 0.212
+cgggta 0.00227
+cgggtc 0.00193
+cgggtg 0.00193
+cgggtt 0.00262
+cggtaa 0.00296
+cggtac 0.00262
+cggtag 0.00227
+cggtat 0.00365
+cggtca 0.00262
+cggtcc 0.00262
+cggtcg 0.00159
+cggtct 0.00434
+cggtga 0.00537
+cggtgc 0.00778
+cggtgg 0.00503
+cggtgt 0.422
+cggtta 0.00296
+cggttc 0.00262
+cggttg 0.00227
+cggttt 0.00503
+cgtaaa 0.00434
+cgtaac 0.00503
+cgtaag 0.204
+cgtaat 0.0116
+cgtaca 0.00296
+cgtacc 0.00331
+cgtacg 0.00193
+cgtact 0.0064
+cgtaga 0.0153
+cgtagc 0.415
+cgtagg 0.00709
+cgtagt 1.25
+cgtata 0.00812
+cgtatc 0.00503
+cgtatg 0.00606
+cgtatt 0.0136
+cgtcaa 0.00503
+cgtcac 0.00227
+cgtcag 0.00262
+cgtcat 0.0064
+cgtcca 0.00159
+cgtccc 0.00227
+cgtccg 0.00193
+cgtcct 0.00296
+cgtcga 0.00296
+cgtcgc 0.00365
+cgtcgg 0.00296
+cgtcgt 0.0136
+cgtcta 0.00331
+cgtctc 0.00434
+cgtctg 0.00227
+cgtctt 0.0095
+cgtgaa 0.00296
+cgtgac 0.00193
+cgtgag 0.00227
+cgtgat 0.00159
+cgtgca 0.00262
+cgtgcc 0.00193
+cgtgcg 0.00159
+cgtgct 0.00365
+cgtgga 0.00434
+cgtggc 0.00331
+cgtggg 0.00193
+cgtggt 0.0167
+cgtgta 0.00227
+cgtgtc 0.00262
+cgtgtg 0.00227
+cgtgtt 0.00331
+cgttaa 0.00537
+cgttac 0.00296
+cgttag 0.00399
+cgttat 0.00881
+cgttca 0.00399
+cgttcc 0.00296
+cgttcg 0.00159
+cgttct 0.00709
+cgttga 0.0133
+cgttgc 0.0119
+cgttgg 0.0102
+cgttgt 1.25
+cgttta 0.00399
+cgtttc 0.00434
+cgtttg 0.00399
+cgtttt 0.0095
+ctaaaa 0.211
+ctaaac 0.209
+ctaaag 0.205
+ctaaat 0.228
+ctaaca 0.00778
+ctaacc 0.00847
+ctaacg 0.00331
+ctaact 0.0243
+ctaaga 2.46
+ctaagc 2.85
+ctaagg 0.438
+ctaagt 11.1
+ctaata 0.816
+ctaatc 0.213
+ctaatg 0.0102
+ctaatt 1.23
+ctacaa 0.00399
+ctacac 0.00296
+ctacag 0.203
+ctacat 0.00399
+ctacca 0.00193
+ctaccc 0.00227
+ctaccg 0.00193
+ctacct 0.00227
+ctacga 0.209
+ctacgc 0.0102
+ctacgg 0.00434
+ctacgt 0.232
+ctacta 0.00331
+ctactc 0.00296
+ctactg 0.00227
+ctactt 0.00606
+ctagaa 0.00227
+ctagac 0.00227
+ctagag 0.00262
+ctagat 0.00227
+ctagca 0.00159
+ctagcc 0.00227
+ctagcg 0.00193
+ctagct 0.00159
+ctagga 0.00709
+ctaggc 0.00812
+ctaggg 0.204
+ctaggt 0.0264
+ctagta 0.00296
+ctagtc 0.00193
+ctagtg 0.00227
+ctagtt 0.00399
+ctataa 0.206
+ctatac 0.206
+ctatag 0.00468
+ctatat 0.209
+ctatca 0.00365
+ctatcc 0.406
+ctatcg 0.00296
+ctatct 0.00778
+ctatga 0.416
+ctatgc 0.62
+ctatgg 0.412
+ctatgt 2.25
+ctatta 0.00503
+ctattc 0.00468
+ctattg 0.00296
+ctattt 0.21
+ctcaaa 0.00193
+ctcaac 0.00193
+ctcaag 0.00193
+ctcaat 0.00262
+ctcaca 0.00159
+ctcacc 0.00159
+ctcacg 0.00159
+ctcact 0.00227
+ctcaga 0.00709
+ctcagc 0.00709
+ctcagg 0.00296
+ctcagt 0.432
+ctcata 0.00296
+ctcatc 0.00193
+ctcatg 0.00159
+ctcatt 0.00434
+ctccaa 0.00159
+ctccac 0.00159
+ctccag 0.00193
+ctccat 0.00159
+ctccca 0.00159
+ctcccc 0.00159
+ctcccg 0.00159
+ctccct 0.00159
+ctccga 0.00193
+ctccgc 0.00193
+ctccgg 0.00159
+ctccgt 0.00296
+ctccta 0.00159
+ctcctc 0.00159
+ctcctg 0.00159
+ctcctt 0.00159
+ctcgaa 0.00159
+ctcgac 0.00159
+ctcgag 0.00159
+ctcgat 0.00159
+ctcgca 0.00159
+ctcgcc 0.00159
+ctcgcg 0.00159
+ctcgct 0.00193
+ctcgga 0.00159
+ctcggc 0.00159
+ctcggg 0.00193
+ctcggt 0.00227
+ctcgta 0.00159
+ctcgtc 0.00159
+ctcgtg 0.00159
+ctcgtt 0.00159
+ctctaa 0.00193
+ctctac 0.00193
+ctctag 0.00159
+ctctat 0.00193
+ctctca 0.00159
+ctctcc 0.00227
+ctctcg 0.00159
+ctctct 0.00159
+ctctga 0.00227
+ctctgc 0.00262
+ctctgg 0.00227
+ctctgt 0.00606
+ctctta 0.00159
+ctcttc 0.00159
+ctcttg 0.00159
+ctcttt 0.00193
+ctgaaa 0.00262
+ctgaac 0.00227
+ctgaag 0.00193
+ctgaat 0.00915
+ctgaca 0.00262
+ctgacc 0.00159
+ctgacg 0.00159
+ctgact 0.00881
+ctgaga 0.417
+ctgagc 0.0184
+ctgagg 0.0112
+ctgagt 4.26
+ctgata 0.00399
+ctgatc 0.00193
+ctgatg 0.00159
+ctgatt 0.0109
+ctgcaa 0.00159
+ctgcac 0.00159
+ctgcag 0.00193
+ctgcat 0.00159
+ctgcca 0.00159
+ctgccc 0.00159
+ctgccg 0.00159
+ctgcct 0.00159
+ctgcga 0.00262
+ctgcgc 0.00193
+ctgcgg 0.00159
+ctgcgt 0.00984
+ctgcta 0.00159
+ctgctc 0.00159
+ctgctg 0.00159
+ctgctt 0.00159
+ctggaa 0.00159
+ctggac 0.00159
+ctggag 0.00159
+ctggat 0.00159
+ctggca 0.00159
+ctggcc 0.00159
+ctggcg 0.00159
+ctggct 0.00159
+ctggga 0.00227
+ctgggc 0.00159
+ctgggg 0.00193
+ctgggt 0.0095
+ctggta 0.00159
+ctggtc 0.00159
+ctggtg 0.00159
+ctggtt 0.00159
+ctgtaa 0.00193
+ctgtac 0.00193
+ctgtag 0.00159
+ctgtat 0.00193
+ctgtca 0.00159
+ctgtcc 0.00227
+ctgtcg 0.00159
+ctgtct 0.00159
+ctgtga 0.00296
+ctgtgc 0.00262
+ctgtgg 0.00227
+ctgtgt 0.0136
+ctgtta 0.00159
+ctgttc 0.00159
+ctgttg 0.00159
+ctgttt 0.00193
+cttaaa 0.00193
+cttaac 0.00193
+cttaag 0.00262
+cttaat 0.00193
+cttaca 0.00159
+cttacc 0.00159
+cttacg 0.00159
+cttact 0.00193
+cttaga 0.00709
+cttagc 0.00709
+cttagg 0.00227
+cttagt 0.0332
+cttata 0.00296
+cttatc 0.00193
+cttatg 0.00159
+cttatt 0.00365
+cttcaa 0.00159
+cttcac 0.00159
+cttcag 0.00227
+cttcat 0.00159
+cttcca 0.00159
+cttccc 0.00159
+cttccg 0.00159
+cttcct 0.00159
+cttcga 0.00193
+cttcgc 0.00159
+cttcgg 0.00159
+cttcgt 0.00193
+cttcta 0.00159
+cttctc 0.00159
+cttctg 0.00159
+cttctt 0.00159
+cttgaa 0.00159
+cttgac 0.00159
+cttgag 0.00159
+cttgat 0.00159
+cttgca 0.00159
+cttgcc 0.00159
+cttgcg 0.00159
+cttgct 0.00159
+cttgga 0.00159
+cttggc 0.00159
+cttggg 0.00193
+cttggt 0.00159
+cttgta 0.00159
+cttgtc 0.00159
+cttgtg 0.00159
+cttgtt 0.00159
+ctttaa 0.00193
+ctttac 0.00193
+ctttag 0.00159
+ctttat 0.00193
+ctttca 0.00159
+ctttcc 0.00227
+ctttcg 0.00159
+ctttct 0.00159
+ctttga 0.00227
+ctttgc 0.00262
+ctttgg 0.00227
+ctttgt 0.00743
+ctttta 0.00159
+cttttc 0.00159
+cttttg 0.00159
+cttttt 0.00193
+gaaaaa 0.00571
+gaaaac 0.407
+gaaaag 0.00468
+gaaaat 0.0129
+gaaaca 0.00399
+gaaacc 0.00503
+gaaacg 0.00296
+gaaact 0.00847
+gaaaga 0.831
+gaaagc 1.43
+gaaagg 0.416
+gaaagt 2.68
+gaaata 0.0064
+gaaatc 0.00709
+gaaatg 0.00399
+gaaatt 0.219
+gaacaa 0.203
+gaacac 0.00296
+gaacag 0.00193
+gaacat 0.00331
+gaacca 0.00262
+gaaccc 0.00193
+gaaccg 0.00159
+gaacct 0.00227
+gaacga 0.207
+gaacgc 0.00778
+gaacgg 0.00365
+gaacgt 0.217
+gaacta 0.00331
+gaactc 0.203
+gaactg 0.00227
+gaactt 0.00399
+gaagaa 0.00193
+gaagac 0.00227
+gaagag 0.00159
+gaagat 0.00193
+gaagca 0.00159
+gaagcc 0.00227
+gaagcg 0.00159
+gaagct 0.00159
+gaagga 0.00537
+gaaggc 0.00675
+gaaggg 0.00262
+gaaggt 0.0129
+gaagta 0.00159
+gaagtc 0.00193
+gaagtg 0.00159
+gaagtt 0.00227
+gaataa 0.00434
+gaatac 0.00468
+gaatag 0.00262
+gaatat 0.209
+gaatca 0.00262
+gaatcc 0.00399
+gaatcg 0.00159
+gaatct 0.00778
+gaatga 0.618
+gaatgc 1.22
+gaatgg 0.0119
+gaatgt 2.84
+gaatta 0.00399
+gaattc 0.00399
+gaattg 0.00159
+gaattt 0.00847
+gacaaa 0.00159
+gacaac 0.00227
+gacaag 0.00159
+gacaat 0.00159
+gacaca 0.00159
+gacacc 0.00159
+gacacg 0.00159
+gacact 0.00159
+gacaga 0.00331
+gacagc 0.00399
+gacagg 0.00227
+gacagt 0.0112
+gacata 0.00159
+gacatc 0.00159
+gacatg 0.00159
+gacatt 0.00193
+gaccaa 0.00193
+gaccac 0.00159
+gaccag 0.00159
+gaccat 0.00159
+gaccca 0.00159
+gacccc 0.00159
+gacccg 0.00159
+gaccct 0.00159
+gaccga 0.00193
+gaccgc 0.00159
+gaccgg 0.00159
+gaccgt 0.00193
+gaccta 0.00159
+gacctc 0.00193
+gacctg 0.00159
+gacctt 0.00159
+gacgaa 0.00159
+gacgac 0.00159
+gacgag 0.00159
+gacgat 0.00159
+gacgca 0.00159
+gacgcc 0.00159
+gacgcg 0.00159
+gacgct 0.00159
+gacgga 0.00159
+gacggc 0.00159
+gacggg 0.00159
+gacggt 0.00159
+gacgta 0.00159
+gacgtc 0.00159
+gacgtg 0.00159
+gacgtt 0.00159
+gactaa 0.00159
+gactac 0.00159
+gactag 0.00159
+gactat 0.00193
+gactca 0.00159
+gactcc 0.00159
+gactcg 0.00159
+gactct 0.00159
+gactga 0.00296
+gactgc 0.00365
+gactgg 0.00159
+gactgt 0.00675
+gactta 0.00159
+gacttc 0.00159
+gacttg 0.00159
+gacttt 0.00159
+gagaaa 0.00193
+gagaac 0.00227
+gagaag 0.00159
+gagaat 0.00434
+gagaca 0.00159
+gagacc 0.00159
+gagacg 0.00159
+gagact 0.00434
+gagaga 0.00778
+gagagc 0.00915
+gagagg 0.00606
+gagagt 1.63
+gagata 0.00159
+gagatc 0.00159
+gagatg 0.00159
+gagatt 0.00503
+gagcaa 0.00227
+gagcac 0.00159
+gagcag 0.00159
+gagcat 0.00159
+gagcca 0.00159
+gagccc 0.00159
+gagccg 0.00159
+gagcct 0.00159
+gagcga 0.00193
+gagcgc 0.00159
+gagcgg 0.00159
+gagcgt 0.00571
+gagcta 0.00159
+gagctc 0.00193
+gagctg 0.00159
+gagctt 0.00159
+gaggaa 0.00159
+gaggac 0.00159
+gaggag 0.00159
+gaggat 0.00159
+gaggca 0.00159
+gaggcc 0.00159
+gaggcg 0.00159
+gaggct 0.00159
+gaggga 0.00159
+gagggc 0.00159
+gagggg 0.00159
+gagggt 0.00606
+gaggta 0.00159
+gaggtc 0.00159
+gaggtg 0.00159
+gaggtt 0.00159
+gagtaa 0.00159
+gagtac 0.00159
+gagtag 0.00159
+gagtat 0.00193
+gagtca 0.00159
+gagtcc 0.00159
+gagtcg 0.00159
+gagtct 0.00159
+gagtga 0.00262
+gagtgc 0.00365
+gagtgg 0.00159
+gagtgt 0.0102
+gagtta 0.00159
+gagttc 0.00159
+gagttg 0.00159
+gagttt 0.00159
+gataaa 0.00159
+gataac 0.00227
+gataag 0.00193
+gataat 0.00193
+gataca 0.00159
+gatacc 0.00159
+gatacg 0.00159
+gatact 0.00193
+gataga 0.00399
+gatagc 0.00434
+gatagg 0.00262
+gatagt 0.216
+gatata 0.00159
+gatatc 0.00159
+gatatg 0.00159
+gatatt 0.00227
+gatcaa 0.00193
+gatcac 0.00159
+gatcag 0.00193
+gatcat 0.00159
+gatcca 0.00159
+gatccc 0.00159
+gatccg 0.00159
+gatcct 0.00159
+gatcga 0.00193
+gatcgc 0.00159
+gatcgg 0.00193
+gatcgt 0.00296
+gatcta 0.00159
+gatctc 0.00193
+gatctg 0.00159
+gatctt 0.00159
+gatgaa 0.00159
+gatgac 0.00159
+gatgag 0.00159
+gatgat 0.00159
+gatgca 0.00159
+gatgcc 0.00159
+gatgcg 0.00159
+gatgct 0.00159
+gatgga 0.00159
+gatggc 0.00159
+gatggg 0.00193
+gatggt 0.00262
+gatgta 0.00159
+gatgtc 0.00159
+gatgtg 0.00159
+gatgtt 0.00159
+gattaa 0.00159
+gattac 0.00159
+gattag 0.00159
+gattat 0.00193
+gattca 0.00159
+gattcc 0.00159
+gattcg 0.00159
+gattct 0.00159
+gattga 0.00262
+gattgc 0.00365
+gattgg 0.00159
+gattgt 0.00915
+gattta 0.00159
+gatttc 0.00159
+gatttg 0.00159
+gatttt 0.00193
+gcaaaa 0.00365
+gcaaac 0.00365
+gcaaag 0.00331
+gcaaat 0.00812
+gcaaca 0.00331
+gcaacc 0.00262
+gcaacg 0.00227
+gcaact 0.00606
+gcaaga 0.216
+gcaagc 0.416
+gcaagg 0.0105
+gcaagt 2.24
+gcaata 0.204
+gcaatc 0.00434
+gcaatg 0.204
+gcaatt 0.0129
+gcacaa 0.00227
+gcacac 0.00159
+gcacag 0.00159
+gcacat 0.00227
+gcacca 0.00193
+gcaccc 0.00159
+gcaccg 0.00159
+gcacct 0.00193
+gcacga 0.00331
+gcacgc 0.00296
+gcacgg 0.00227
+gcacgt 0.00881
+gcacta 0.00227
+gcactc 0.00296
+gcactg 0.00227
+gcactt 0.00227
+gcagaa 0.00159
+gcagac 0.00159
+gcagag 0.00159
+gcagat 0.00159
+gcagca 0.00159
+gcagcc 0.00227
+gcagcg 0.00159
+gcagct 0.00159
+gcagga 0.00296
+gcaggc 0.00296
+gcaggg 0.00159
+gcaggt 0.0064
+gcagta 0.00193
+gcagtc 0.00159
+gcagtg 0.00193
+gcagtt 0.00193
+gcataa 0.00227
+gcatac 0.00159
+gcatag 0.00193
+gcatat 0.00365
+gcatca 0.00159
+gcatcc 0.00227
+gcatcg 0.00159
+gcatct 0.00262
+gcatga 0.0064
+gcatgc 0.00847
+gcatgg 0.00193
+gcatgt 0.0198
+gcatta 0.00296
+gcattc 0.00193
+gcattg 0.00193
+gcattt 0.00262
+gccaaa 0.00159
+gccaac 0.00159
+gccaag 0.00159
+gccaat 0.00159
+gccaca 0.00159
+gccacc 0.00159
+gccacg 0.00159
+gccact 0.00159
+gccaga 0.00227
+gccagc 0.00227
+gccagg 0.00159
+gccagt 0.00778
+gccata 0.00193
+gccatc 0.00159
+gccatg 0.00193
+gccatt 0.00159
+gcccaa 0.00159
+gcccac 0.00159
+gcccag 0.00159
+gcccat 0.00159
+gcccca 0.00159
+gccccc 0.00159
+gccccg 0.00159
+gcccct 0.00159
+gcccga 0.00159
+gcccgc 0.00159
+gcccgg 0.00159
+gcccgt 0.00159
+gcccta 0.00159
+gccctc 0.00159
+gccctg 0.00159
+gccctt 0.00159
+gccgaa 0.00159
+gccgac 0.00159
+gccgag 0.00159
+gccgat 0.00159
+gccgca 0.00159
+gccgcc 0.00159
+gccgcg 0.00159
+gccgct 0.00159
+gccgga 0.00159
+gccggc 0.00159
+gccggg 0.00159
+gccggt 0.00159
+gccgta 0.00159
+gccgtc 0.00159
+gccgtg 0.00159
+gccgtt 0.00159
+gcctaa 0.00159
+gcctac 0.00159
+gcctag 0.00159
+gcctat 0.00159
+gcctca 0.00159
+gcctcc 0.00159
+gcctcg 0.00159
+gcctct 0.00159
+gcctga 0.00193
+gcctgc 0.00159
+gcctgg 0.00159
+gcctgt 0.00193
+gcctta 0.00159
+gccttc 0.00159
+gccttg 0.00159
+gccttt 0.00159
+gcgaaa 0.00193
+gcgaac 0.00159
+gcgaag 0.00159
+gcgaat 0.00262
+gcgaca 0.00159
+gcgacc 0.00159
+gcgacg 0.00159
+gcgact 0.00262
+gcgaga 0.00365
+gcgagc 0.00571
+gcgagg 0.00365
+gcgagt 0.62
+gcgata 0.00193
+gcgatc 0.00159
+gcgatg 0.00193
+gcgatt 0.00296
+gcgcaa 0.00193
+gcgcac 0.00159
+gcgcag 0.00159
+gcgcat 0.00159
+gcgcca 0.00159
+gcgccc 0.00159
+gcgccg 0.00159
+gcgcct 0.00159
+gcgcga 0.00159
+gcgcgc 0.00159
+gcgcgg 0.00159
+gcgcgt 0.00331
+gcgcta 0.00159
+gcgctc 0.00159
+gcgctg 0.00159
+gcgctt 0.00159
+gcggaa 0.00159
+gcggac 0.00159
+gcggag 0.00159
+gcggat 0.00159
+gcggca 0.00159
+gcggcc 0.00159
+gcggcg 0.00159
+gcggct 0.00159
+gcggga 0.00159
+gcgggc 0.00159
+gcgggg 0.00159
+gcgggt 0.00331
+gcggta 0.00159
+gcggtc 0.00159
+gcggtg 0.00159
+gcggtt 0.00159
+gcgtaa 0.00159
+gcgtac 0.00159
+gcgtag 0.00159
+gcgtat 0.00159
+gcgtca 0.00159
+gcgtcc 0.00159
+gcgtcg 0.00159
+gcgtct 0.00159
+gcgtga 0.00159
+gcgtgc 0.00159
+gcgtgg 0.00159
+gcgtgt 0.00365
+gcgtta 0.00159
+gcgttc 0.00159
+gcgttg 0.00159
+gcgttt 0.00159
+gctaaa 0.00159
+gctaac 0.00159
+gctaag 0.00159
+gctaat 0.00193
+gctaca 0.00159
+gctacc 0.00159
+gctacg 0.00159
+gctact 0.00193
+gctaga 0.00262
+gctagc 0.00262
+gctagg 0.00193
+gctagt 0.212
+gctata 0.00193
+gctatc 0.00159
+gctatg 0.00193
+gctatt 0.00193
+gctcaa 0.00159
+gctcac 0.00159
+gctcag 0.00159
+gctcat 0.00159
+gctcca 0.00159
+gctccc 0.00159
+gctccg 0.00159
+gctcct 0.00159
+gctcga 0.00159
+gctcgc 0.00159
+gctcgg 0.00159
+gctcgt 0.00227
+gctcta 0.00159
+gctctc 0.00159
+gctctg 0.00159
+gctctt 0.00159
+gctgaa 0.00159
+gctgac 0.00159
+gctgag 0.00159
+gctgat 0.00159
+gctgca 0.00159
+gctgcc 0.00159
+gctgcg 0.00159
+gctgct 0.00159
+gctgga 0.00159
+gctggc 0.00159
+gctggg 0.00159
+gctggt 0.00227
+gctgta 0.00159
+gctgtc 0.00159
+gctgtg 0.00159
+gctgtt 0.00159
+gcttaa 0.00159
+gcttac 0.00159
+gcttag 0.00159
+gcttat 0.00159
+gcttca 0.00159
+gcttcc 0.00159
+gcttcg 0.00159
+gcttct 0.00159
+gcttga 0.00159
+gcttgc 0.00159
+gcttgg 0.00159
+gcttgt 0.00365
+gcttta 0.00159
+gctttc 0.00159
+gctttg 0.00159
+gctttt 0.00159
+ggaaaa 0.643
+ggaaac 0.431
+ggaaag 0.625
+ggaaat 1.47
+ggaaca 0.622
+ggaacc 0.216
+ggaacg 0.21
+ggaact 0.447
+ggaaga 2.06
+ggaagc 2.66
+ggaagg 0.84
+ggaagt 6.13
+ggaata 0.647
+ggaatc 0.632
+ggaatg 0.435
+ggaatt 3.7
+ggacaa 0.219
+ggacac 0.00915
+ggacag 0.0105
+ggacat 0.428
+ggacca 0.211
+ggaccc 0.00743
+ggaccg 0.00399
+ggacct 0.214
+ggacga 0.419
+ggacgc 0.0181
+ggacgg 0.411
+ggacgt 1.64
+ggacta 0.22
+ggactc 0.416
+ggactg 0.213
+ggactt 0.443
+ggagaa 0.00743
+ggagac 0.00537
+ggagag 0.00709
+ggagat 0.0119
+ggagca 0.00606
+ggagcc 0.406
+ggagcg 0.00331
+ggagct 0.00778
+ggagga 0.616
+ggaggc 0.415
+ggaggg 0.0095
+ggaggt 0.434
+ggagta 0.00812
+ggagtc 0.0064
+ggagtg 0.00606
+ggagtt 0.216
+ggataa 0.424
+ggatac 0.0147
+ggatag 0.213
+ggatat 1.04
+ggatca 0.0171
+ggatcc 0.0122
+ggatcg 0.00606
+ggatct 0.626
+ggatga 1.65
+ggatgc 1.85
+ggatgg 0.0277
+ggatgt 3.7
+ggatta 0.62
+ggattc 0.0222
+ggattg 0.0136
+ggattt 0.45
+ggcaaa 0.00434
+ggcaac 0.00227
+ggcaag 0.00296
+ggcaat 0.00778
+ggcaca 0.00399
+ggcacc 0.00296
+ggcacg 0.00193
+ggcact 0.00434
+ggcaga 0.212
+ggcagc 0.0116
+ggcagg 0.00606
+ggcagt 0.638
+ggcata 0.00365
+ggcatc 0.00331
+ggcatg 0.00262
+ggcatt 0.0109
+ggccaa 0.00331
+ggccac 0.00159
+ggccag 0.00159
+ggccat 0.00331
+ggccca 0.00193
+ggcccc 0.00227
+ggcccg 0.00159
+ggccct 0.00193
+ggccga 0.00296
+ggccgc 0.00193
+ggccgg 0.00227
+ggccgt 0.00709
+ggccta 0.00296
+ggcctc 0.00296
+ggcctg 0.00193
+ggcctt 0.00296
+ggcgaa 0.00193
+ggcgac 0.00159
+ggcgag 0.00159
+ggcgat 0.00159
+ggcgca 0.00159
+ggcgcc 0.00227
+ggcgcg 0.00159
+ggcgct 0.00193
+ggcgga 0.00331
+ggcggc 0.00262
+ggcggg 0.00159
+ggcggt 0.00434
+ggcgta 0.00159
+ggcgtc 0.00193
+ggcgtg 0.00159
+ggcgtt 0.00262
+ggctaa 0.00399
+ggctac 0.00227
+ggctag 0.00193
+ggctat 0.00468
+ggctca 0.00296
+ggctcc 0.00159
+ggctcg 0.00193
+ggctct 0.00365
+ggctga 0.207
+ggctgc 0.00743
+ggctgg 0.00262
+ggctgt 0.0198
+ggctta 0.00434
+ggcttc 0.00193
+ggcttg 0.00227
+ggcttt 0.00434
+gggaaa 0.21
+gggaac 0.00571
+gggaag 0.0064
+gggaat 0.0164
+gggaca 0.00537
+gggacc 0.00399
+gggacg 0.00262
+gggact 0.00743
+gggaga 0.428
+gggagc 0.822
+gggagg 0.414
+gggagt 2.06
+gggata 0.00847
+gggatc 0.0064
+gggatg 0.00537
+gggatt 0.22
+gggcaa 0.204
+gggcac 0.00365
+gggcag 0.00331
+gggcat 0.00468
+gggcca 0.00227
+gggccc 0.00159
+gggccg 0.00159
+gggcct 0.00365
+gggcga 0.00399
+gggcgc 0.00434
+gggcgg 0.00331
+gggcgt 0.214
+gggcta 0.00365
+gggctc 0.00296
+gggctg 0.00227
+gggctt 0.00537
+ggggaa 0.00296
+ggggac 0.00159
+ggggag 0.00296
+ggggat 0.00365
+ggggca 0.00193
+ggggcc 0.00227
+ggggcg 0.00159
+ggggct 0.00296
+ggggga 0.00468
+gggggc 0.00537
+gggggg 0.00365
+gggggt 0.413
+ggggta 0.00193
+ggggtc 0.00193
+ggggtg 0.00159
+ggggtt 0.00365
+gggtaa 0.00331
+gggtac 0.00193
+gggtag 0.00193
+gggtat 0.00537
+gggtca 0.00193
+gggtcc 0.00227
+gggtcg 0.00159
+gggtct 0.00468
+gggtga 0.00812
+gggtgc 0.00915
+gggtgg 0.00468
+gggtgt 0.625
+gggtta 0.00296
+gggttc 0.00227
+gggttg 0.00193
+gggttt 0.00537
+ggtaaa 0.00468
+ggtaac 0.00399
+ggtaag 0.00399
+ggtaat 0.0143
+ggtaca 0.00365
+ggtacc 0.00227
+ggtacg 0.00193
+ggtact 0.00778
+ggtaga 0.219
+ggtagc 0.0188
+ggtagg 0.0102
+ggtagt 2.46
+ggtata 0.0064
+ggtatc 0.00503
+ggtatg 0.00365
+ggtatt 0.0188
+ggtcaa 0.00468
+ggtcac 0.00227
+ggtcag 0.00193
+ggtcat 0.0064
+ggtcca 0.00193
+ggtccc 0.00227
+ggtccg 0.00193
+ggtcct 0.00331
+ggtcga 0.00365
+ggtcgc 0.00193
+ggtcgg 0.00399
+ggtcgt 0.218
+ggtcta 0.00365
+ggtctc 0.00434
+ggtctg 0.00262
+ggtctt 0.00915
+ggtgaa 0.00296
+ggtgac 0.00193
+ggtgag 0.00193
+ggtgat 0.00193
+ggtgca 0.00262
+ggtgcc 0.00262
+ggtgcg 0.00159
+ggtgct 0.00365
+ggtgga 0.00606
+ggtggc 0.00365
+ggtggg 0.00227
+ggtggt 0.22
+ggtgta 0.00227
+ggtgtc 0.00262
+ggtgtg 0.00193
+ggtgtt 0.00399
+ggttaa 0.00503
+ggttac 0.00262
+ggttag 0.00331
+ggttat 0.00984
+ggttca 0.00365
+ggttcc 0.00262
+ggttcg 0.00159
+ggttct 0.00675
+ggttga 0.0157
+ggttgc 0.0126
+ggttgg 0.00881
+ggttgt 1.05
+ggttta 0.00434
+ggtttc 0.00399
+ggtttg 0.00365
+ggtttt 0.00881
+gtaaaa 0.00537
+gtaaac 0.00365
+gtaaag 0.00399
+gtaaat 0.0105
+gtaaca 0.00399
+gtaacc 0.00262
+gtaacg 0.00331
+gtaact 0.0064
+gtaaga 0.829
+gtaagc 0.227
+gtaagg 0.416
+gtaagt 2.49
+gtaata 0.00709
+gtaatc 0.00434
+gtaatg 0.00434
+gtaatt 0.0167
+gtacaa 0.00262
+gtacac 0.00193
+gtacag 0.00193
+gtacat 0.00227
+gtacca 0.00227
+gtaccc 0.00193
+gtaccg 0.00159
+gtacct 0.00193
+gtacga 0.206
+gtacgc 0.00331
+gtacgg 0.00365
+gtacgt 0.014
+gtacta 0.00227
+gtactc 0.00262
+gtactg 0.00227
+gtactt 0.00262
+gtagaa 0.00159
+gtagac 0.00159
+gtagag 0.00159
+gtagat 0.00159
+gtagca 0.00159
+gtagcc 0.00262
+gtagcg 0.00159
+gtagct 0.00159
+gtagga 0.00468
+gtaggc 0.00365
+gtaggg 0.00296
+gtaggt 0.00778
+gtagta 0.00159
+gtagtc 0.00159
+gtagtg 0.00159
+gtagtt 0.00193
+gtataa 0.00331
+gtatac 0.00331
+gtatag 0.00227
+gtatat 0.00537
+gtatca 0.00227
+gtatcc 0.204
+gtatcg 0.00227
+gtatct 0.00365
+gtatga 0.211
+gtatgc 0.414
+gtatgg 0.206
+gtatgt 0.429
+gtatta 0.00296
+gtattc 0.00262
+gtattg 0.00193
+gtattt 0.00399
+gtcaaa 0.00159
+gtcaac 0.00159
+gtcaag 0.00159
+gtcaat 0.00159
+gtcaca 0.00159
+gtcacc 0.00159
+gtcacg 0.00159
+gtcact 0.00159
+gtcaga 0.00331
+gtcagc 0.00193
+gtcagg 0.00262
+gtcagt 0.0095
+gtcata 0.00159
+gtcatc 0.00159
+gtcatg 0.00159
+gtcatt 0.00159
+gtccaa 0.00159
+gtccac 0.00159
+gtccag 0.00159
+gtccat 0.00159
+gtccca 0.00159
+gtcccc 0.00159
+gtcccg 0.00159
+gtccct 0.00159
+gtccga 0.00193
+gtccgc 0.00193
+gtccgg 0.00159
+gtccgt 0.00193
+gtccta 0.00159
+gtcctc 0.00159
+gtcctg 0.00159
+gtcctt 0.00159
+gtcgaa 0.00159
+gtcgac 0.00159
+gtcgag 0.00159
+gtcgat 0.00159
+gtcgca 0.00159
+gtcgcc 0.00159
+gtcgcg 0.00159
+gtcgct 0.00159
+gtcgga 0.00159
+gtcggc 0.00159
+gtcggg 0.00159
+gtcggt 0.00159
+gtcgta 0.00159
+gtcgtc 0.00159
+gtcgtg 0.00159
+gtcgtt 0.00159
+gtctaa 0.00159
+gtctac 0.00159
+gtctag 0.00159
+gtctat 0.00159
+gtctca 0.00159
+gtctcc 0.00193
+gtctcg 0.00159
+gtctct 0.00159
+gtctga 0.00227
+gtctgc 0.00227
+gtctgg 0.00193
+gtctgt 0.00227
+gtctta 0.00159
+gtcttc 0.00159
+gtcttg 0.00159
+gtcttt 0.00159
+gtgaaa 0.00193
+gtgaac 0.00159
+gtgaag 0.00193
+gtgaat 0.00227
+gtgaca 0.00159
+gtgacc 0.00159
+gtgacg 0.00193
+gtgact 0.00227
+gtgaga 0.00675
+gtgagc 0.0064
+gtgagg 0.205
+gtgagt 0.437
+gtgata 0.00159
+gtgatc 0.00159
+gtgatg 0.00193
+gtgatt 0.00262
+gtgcaa 0.00193
+gtgcac 0.00159
+gtgcag 0.00159
+gtgcat 0.00159
+gtgcca 0.00159
+gtgccc 0.00159
+gtgccg 0.00159
+gtgcct 0.00159
+gtgcga 0.00193
+gtgcgc 0.00193
+gtgcgg 0.00193
+gtgcgt 0.00296
+gtgcta 0.00159
+gtgctc 0.00159
+gtgctg 0.00159
+gtgctt 0.00159
+gtggaa 0.00159
+gtggac 0.00159
+gtggag 0.00159
+gtggat 0.00159
+gtggca 0.00159
+gtggcc 0.00159
+gtggcg 0.00159
+gtggct 0.00159
+gtggga 0.00159
+gtgggc 0.00159
+gtgggg 0.00193
+gtgggt 0.00331
+gtggta 0.00159
+gtggtc 0.00159
+gtggtg 0.00159
+gtggtt 0.00159
+gtgtaa 0.00159
+gtgtac 0.00159
+gtgtag 0.00159
+gtgtat 0.00159
+gtgtca 0.00159
+gtgtcc 0.00193
+gtgtcg 0.00159
+gtgtct 0.00159
+gtgtga 0.00193
+gtgtgc 0.00227
+gtgtgg 0.00227
+gtgtgt 0.00434
+gtgtta 0.00159
+gtgttc 0.00159
+gtgttg 0.00159
+gtgttt 0.00159
+gttaaa 0.00159
+gttaac 0.00159
+gttaag 0.00159
+gttaat 0.00159
+gttaca 0.00159
+gttacc 0.00159
+gttacg 0.00159
+gttact 0.00193
+gttaga 0.00365
+gttagc 0.00193
+gttagg 0.00262
+gttagt 0.0133
+gttata 0.00159
+gttatc 0.00159
+gttatg 0.00159
+gttatt 0.00159
+gttcaa 0.00159
+gttcac 0.00159
+gttcag 0.00159
+gttcat 0.00159
+gttcca 0.00159
+gttccc 0.00159
+gttccg 0.00159
+gttcct 0.00159
+gttcga 0.00193
+gttcgc 0.00159
+gttcgg 0.00159
+gttcgt 0.00193
+gttcta 0.00159
+gttctc 0.00159
+gttctg 0.00159
+gttctt 0.00159
+gttgaa 0.00159
+gttgac 0.00159
+gttgag 0.00159
+gttgat 0.00159
+gttgca 0.00159
+gttgcc 0.00159
+gttgcg 0.00159
+gttgct 0.00159
+gttgga 0.00159
+gttggc 0.00159
+gttggg 0.00159
+gttggt 0.00193
+gttgta 0.00159
+gttgtc 0.00159
+gttgtg 0.00159
+gttgtt 0.00159
+gtttaa 0.00159
+gtttac 0.00159
+gtttag 0.00159
+gtttat 0.00159
+gtttca 0.00159
+gtttcc 0.00193
+gtttcg 0.00159
+gtttct 0.00159
+gtttga 0.00193
+gtttgc 0.00227
+gtttgg 0.00193
+gtttgt 0.00399
+gtttta 0.00159
+gttttc 0.00159
+gttttg 0.00159
+gttttt 0.00159
+taaaaa 0.00812
+taaaac 0.00503
+taaaag 0.00606
+taaaat 0.0205
+taaaca 0.00468
+taaacc 0.00262
+taaacg 0.00262
+taaact 0.214
+taaaga 0.636
+taaagc 0.229
+taaagg 0.016
+taaagt 2.89
+taaata 0.213
+taaatc 0.00606
+taaatg 0.0064
+taaatt 0.0298
+taacaa 0.00296
+taacac 0.00296
+taacag 0.00262
+taacat 0.00399
+taacca 0.00193
+taaccc 0.00159
+taaccg 0.00159
+taacct 0.00365
+taacga 0.00503
+taacgc 0.00399
+taacgg 0.00227
+taacgt 0.219
+taacta 0.00434
+taactc 0.00365
+taactg 0.00296
+taactt 0.206
+taagaa 0.00159
+taagac 0.00159
+taagag 0.00193
+taagat 0.00296
+taagca 0.00159
+taagcc 0.00159
+taagcg 0.00159
+taagct 0.00262
+taagga 0.00399
+taaggc 0.00296
+taaggg 0.00331
+taaggt 0.212
+taagta 0.00262
+taagtc 0.00159
+taagtg 0.00193
+taagtt 0.00296
+taataa 0.00331
+taatac 0.00227
+taatag 0.00331
+taatat 0.00778
+taatca 0.00262
+taatcc 0.00262
+taatcg 0.00193
+taatct 0.00434
+taatga 0.211
+taatgc 0.0174
+taatgg 0.00606
+taatgt 0.653
+taatta 0.00434
+taattc 0.00365
+taattg 0.00296
+taattt 0.00675
+tacaaa 0.00159
+tacaac 0.00159
+tacaag 0.00159
+tacaat 0.00159
+tacaca 0.00159
+tacacc 0.00159
+tacacg 0.00159
+tacact 0.00193
+tacaga 0.00262
+tacagc 0.00262
+tacagg 0.00193
+tacagt 0.0126
+tacata 0.00193
+tacatc 0.00159
+tacatg 0.00159
+tacatt 0.00159
+taccaa 0.00159
+taccac 0.00159
+taccag 0.00159
+taccat 0.00159
+taccca 0.00159
+tacccc 0.00159
+tacccg 0.00159
+taccct 0.00159
+taccga 0.00159
+taccgc 0.00159
+taccgg 0.00159
+taccgt 0.00262
+taccta 0.00159
+tacctc 0.00159
+tacctg 0.00159
+tacctt 0.00193
+tacgaa 0.00159
+tacgac 0.00159
+tacgag 0.00159
+tacgat 0.00159
+tacgca 0.00159
+tacgcc 0.00159
+tacgcg 0.00159
+tacgct 0.00159
+tacgga 0.00159
+tacggc 0.00159
+tacggg 0.00193
+tacggt 0.00193
+tacgta 0.00159
+tacgtc 0.00159
+tacgtg 0.00159
+tacgtt 0.00159
+tactaa 0.00159
+tactac 0.00159
+tactag 0.00159
+tactat 0.00159
+tactca 0.00159
+tactcc 0.00159
+tactcg 0.00159
+tactct 0.00159
+tactga 0.00193
+tactgc 0.00227
+tactgg 0.00159
+tactgt 0.00399
+tactta 0.00159
+tacttc 0.00159
+tacttg 0.00159
+tacttt 0.00159
+tagaaa 0.00193
+tagaac 0.00159
+tagaag 0.00193
+tagaat 0.00262
+tagaca 0.00159
+tagacc 0.00159
+tagacg 0.00159
+tagact 0.00296
+tagaga 0.0105
+tagagc 0.00847
+tagagg 0.00331
+tagagt 0.643
+tagata 0.00193
+tagatc 0.00159
+tagatg 0.00159
+tagatt 0.00365
+tagcaa 0.00193
+tagcac 0.00159
+tagcag 0.00159
+tagcat 0.00159
+tagcca 0.00159
+tagccc 0.00159
+tagccg 0.00159
+tagcct 0.00159
+tagcga 0.00159
+tagcgc 0.00227
+tagcgg 0.00159
+tagcgt 0.00537
+tagcta 0.00159
+tagctc 0.00159
+tagctg 0.00159
+tagctt 0.00193
+taggaa 0.00159
+taggac 0.00159
+taggag 0.00193
+taggat 0.00159
+taggca 0.00159
+taggcc 0.00159
+taggcg 0.00159
+taggct 0.00159
+taggga 0.00159
+tagggc 0.00193
+tagggg 0.00193
+tagggt 0.00434
+taggta 0.00159
+taggtc 0.00159
+taggtg 0.00159
+taggtt 0.00159
+tagtaa 0.00159
+tagtac 0.00159
+tagtag 0.00159
+tagtat 0.00159
+tagtca 0.00159
+tagtcc 0.00159
+tagtcg 0.00159
+tagtct 0.00159
+tagtga 0.00227
+tagtgc 0.00193
+tagtgg 0.00193
+tagtgt 0.00434
+tagtta 0.00159
+tagttc 0.00159
+tagttg 0.00159
+tagttt 0.00159
+tataaa 0.00159
+tataac 0.00159
+tataag 0.00193
+tataat 0.00227
+tataca 0.00159
+tatacc 0.00159
+tatacg 0.00159
+tatact 0.00193
+tataga 0.00434
+tatagc 0.00262
+tatagg 0.00193
+tatagt 0.0215
+tatata 0.00193
+tatatc 0.00159
+tatatg 0.00159
+tatatt 0.00159
+tatcaa 0.00159
+tatcac 0.00159
+tatcag 0.00193
+tatcat 0.00159
+tatcca 0.00159
+tatccc 0.00159
+tatccg 0.00159
+tatcct 0.00159
+tatcga 0.00159
+tatcgc 0.00159
+tatcgg 0.00227
+tatcgt 0.00365
+tatcta 0.00159
+tatctc 0.00159
+tatctg 0.00159
+tatctt 0.00193
+tatgaa 0.00159
+tatgac 0.00159
+tatgag 0.00193
+tatgat 0.00159
+tatgca 0.00159
+tatgcc 0.00159
+tatgcg 0.00193
+tatgct 0.00159
+tatgga 0.00227
+tatggc 0.00193
+tatggg 0.202
+tatggt 0.00399
+tatgta 0.00159
+tatgtc 0.00159
+tatgtg 0.00193
+tatgtt 0.00159
+tattaa 0.00159
+tattac 0.00159
+tattag 0.00159
+tattat 0.00159
+tattca 0.00159
+tattcc 0.00159
+tattcg 0.00159
+tattct 0.00159
+tattga 0.00193
+tattgc 0.00159
+tattgg 0.00193
+tattgt 0.00778
+tattta 0.00159
+tatttc 0.00159
+tatttg 0.00159
+tatttt 0.00193
+tcaaaa 0.00812
+tcaaac 0.00434
+tcaaag 0.00606
+tcaaat 0.216
+tcaaca 0.00434
+tcaacc 0.00227
+tcaacg 0.00193
+tcaact 0.0112
+tcaaga 0.823
+tcaagc 0.219
+tcaagg 0.0126
+tcaagt 1.66
+tcaata 0.0119
+tcaatc 0.00571
+tcaatg 0.00675
+tcaatt 0.221
+tcacaa 0.00262
+tcacac 0.00331
+tcacag 0.00262
+tcacat 0.00365
+tcacca 0.00193
+tcaccc 0.00193
+tcaccg 0.00159
+tcacct 0.00262
+tcacga 0.00399
+tcacgc 0.204
+tcacgg 0.00227
+tcacgt 0.014
+tcacta 0.00331
+tcactc 0.00365
+tcactg 0.00262
+tcactt 0.00537
+tcagaa 0.00159
+tcagac 0.00159
+tcagag 0.00193
+tcagat 0.00296
+tcagca 0.00159
+tcagcc 0.00159
+tcagcg 0.00159
+tcagct 0.00193
+tcagga 0.00365
+tcaggc 0.00296
+tcaggg 0.00227
+tcaggt 0.00881
+tcagta 0.00227
+tcagtc 0.00159
+tcagtg 0.00193
+tcagtt 0.00262
+tcataa 0.00262
+tcatac 0.00227
+tcatag 0.00296
+tcatat 0.00709
+tcatca 0.00227
+tcatcc 0.00296
+tcatcg 0.00193
+tcatct 0.00365
+tcatga 0.00881
+tcatgc 0.0129
+tcatgg 0.00399
+tcatgt 0.433
+tcatta 0.00331
+tcattc 0.00399
+tcattg 0.00296
+tcattt 0.00606
+tccaaa 0.00159
+tccaac 0.00159
+tccaag 0.00159
+tccaat 0.00193
+tccaca 0.00159
+tccacc 0.00159
+tccacg 0.00159
+tccact 0.00159
+tccaga 0.00296
+tccagc 0.00331
+tccagg 0.00193
+tccagt 0.0105
+tccata 0.00159
+tccatc 0.00159
+tccatg 0.00159
+tccatt 0.00193
+tcccaa 0.00159
+tcccac 0.00159
+tcccag 0.00159
+tcccat 0.00159
+tcccca 0.00159
+tccccc 0.00159
+tccccg 0.00159
+tcccct 0.00159
+tcccga 0.00159
+tcccgc 0.00193
+tcccgg 0.00159
+tcccgt 0.00262
+tcccta 0.00159
+tccctc 0.00159
+tccctg 0.00159
+tccctt 0.00159
+tccgaa 0.00159
+tccgac 0.00159
+tccgag 0.00159
+tccgat 0.00159
+tccgca 0.00159
+tccgcc 0.00159
+tccgcg 0.00159
+tccgct 0.00159
+tccgga 0.00159
+tccggc 0.00159
+tccggg 0.00159
+tccggt 0.00193
+tccgta 0.00159
+tccgtc 0.00159
+tccgtg 0.00159
+tccgtt 0.00159
+tcctaa 0.00159
+tcctac 0.00159
+tcctag 0.00159
+tcctat 0.00193
+tcctca 0.00159
+tcctcc 0.00159
+tcctcg 0.00159
+tcctct 0.00193
+tcctga 0.00193
+tcctgc 0.00262
+tcctgg 0.00193
+tcctgt 0.204
+tcctta 0.00159
+tccttc 0.00159
+tccttg 0.00159
+tccttt 0.00193
+tcgaaa 0.00193
+tcgaac 0.00227
+tcgaag 0.00193
+tcgaat 0.00365
+tcgaca 0.00159
+tcgacc 0.00227
+tcgacg 0.00159
+tcgact 0.00331
+tcgaga 0.0109
+tcgagc 0.41
+tcgagg 0.00468
+tcgagt 1.03
+tcgata 0.00159
+tcgatc 0.00227
+tcgatg 0.00159
+tcgatt 0.00468
+tcgcaa 0.00193
+tcgcac 0.00159
+tcgcag 0.00159
+tcgcat 0.00159
+tcgcca 0.00159
+tcgccc 0.00159
+tcgccg 0.00159
+tcgcct 0.00159
+tcgcga 0.00159
+tcgcgc 0.00331
+tcgcgg 0.00159
+tcgcgt 0.00537
+tcgcta 0.00159
+tcgctc 0.00159
+tcgctg 0.00159
+tcgctt 0.00159
+tcggaa 0.00159
+tcggac 0.00159
+tcggag 0.00193
+tcggat 0.00159
+tcggca 0.00159
+tcggcc 0.00159
+tcggcg 0.00159
+tcggct 0.00159
+tcggga 0.00159
+tcgggc 0.00262
+tcgggg 0.00159
+tcgggt 0.00365
+tcggta 0.00159
+tcggtc 0.00159
+tcggtg 0.00159
+tcggtt 0.00159
+tcgtaa 0.00159
+tcgtac 0.00159
+tcgtag 0.00159
+tcgtat 0.00159
+tcgtca 0.00159
+tcgtcc 0.00159
+tcgtcg 0.00159
+tcgtct 0.00159
+tcgtga 0.00193
+tcgtgc 0.00262
+tcgtgg 0.00193
+tcgtgt 0.00503
+tcgtta 0.00159
+tcgttc 0.00159
+tcgttg 0.00159
+tcgttt 0.00159
+tctaaa 0.00159
+tctaac 0.00159
+tctaag 0.00159
+tctaat 0.00262
+tctaca 0.00159
+tctacc 0.00159
+tctacg 0.00159
+tctact 0.00159
+tctaga 0.00434
+tctagc 0.00331
+tctagg 0.00159
+tctagt 0.0181
+tctata 0.00159
+tctatc 0.00159
+tctatg 0.00159
+tctatt 0.00193
+tctcaa 0.00159
+tctcac 0.00159
+tctcag 0.00159
+tctcat 0.00159
+tctcca 0.00159
+tctccc 0.00159
+tctccg 0.00159
+tctcct 0.00159
+tctcga 0.00159
+tctcgc 0.00193
+tctcgg 0.00159
+tctcgt 0.00296
+tctcta 0.00159
+tctctc 0.00159
+tctctg 0.00159
+tctctt 0.00159
+tctgaa 0.00159
+tctgac 0.00159
+tctgag 0.00159
+tctgat 0.00159
+tctgca 0.00159
+tctgcc 0.00159
+tctgcg 0.00159
+tctgct 0.00159
+tctgga 0.00193
+tctggc 0.00159
+tctggg 0.00193
+tctggt 0.00296
+tctgta 0.00159
+tctgtc 0.00159
+tctgtg 0.00159
+tctgtt 0.00159
+tcttaa 0.00159
+tcttac 0.00159
+tcttag 0.00159
+tcttat 0.00159
+tcttca 0.00159
+tcttcc 0.00159
+tcttcg 0.00159
+tcttct 0.00159
+tcttga 0.00159
+tcttgc 0.00159
+tcttgg 0.00159
+tcttgt 0.00709
+tcttta 0.00159
+tctttc 0.00159
+tctttg 0.00159
+tctttt 0.00159
+tgaaaa 2.47
+tgaaac 1.25
+tgaaag 2.25
+tgaaat 6.12
+tgaaca 0.844
+tgaacc 0.228
+tgaacg 0.225
+tgaact 3.49
+tgaaga 5.31
+tgaagc 4.5
+tgaagg 2.67
+tgaagt 14
+tgaata 4.68
+tgaatc 1.86
+tgaatg 2.27
+tgaatt 8.95
+tgacaa 0.628
+tgacac 0.817
+tgacag 0.62
+tgacat 1.05
+tgacca 0.214
+tgaccc 0.0109
+tgaccg 0.0064
+tgacct 0.628
+tgacga 0.431
+tgacgc 0.434
+tgacgg 0.221
+tgacgt 3.69
+tgacta 1.04
+tgactc 0.827
+tgactg 0.624
+tgactt 1.87
+tgagaa 0.0133
+tgagac 0.0095
+tgagag 0.215
+tgagat 0.629
+tgagca 0.00709
+tgagcc 0.00571
+tgagcg 0.00468
+tgagct 0.218
+tgagga 0.426
+tgaggc 0.427
+tgaggg 0.418
+tgaggt 1.87
+tgagta 0.418
+tgagtc 0.0119
+tgagtg 0.214
+tgagtt 0.435
+tgataa 0.636
+tgatac 0.431
+tgatag 0.826
+tgatat 2.68
+tgatca 0.423
+tgatcc 0.422
+tgatcg 0.212
+tgatct 0.853
+tgatga 2.68
+tgatgc 5.09
+tgatgg 1.06
+tgatgt 11.8
+tgatta 1.04
+tgattc 1.24
+tgattg 0.828
+tgattt 1.69
+tgcaaa 0.00709
+tgcaac 0.00434
+tgcaag 0.0064
+tgcaat 0.0188
+tgcaca 0.00399
+tgcacc 0.00365
+tgcacg 0.00227
+tgcact 0.0119
+tgcaga 0.0253
+tgcagc 0.421
+tgcagg 0.212
+tgcagt 2.07
+tgcata 0.0102
+tgcatc 0.00606
+tgcatg 0.00606
+tgcatt 0.0229
+tgccaa 0.00399
+tgccac 0.00296
+tgccag 0.00262
+tgccat 0.00468
+tgccca 0.00193
+tgcccc 0.00227
+tgcccg 0.00159
+tgccct 0.00296
+tgccga 0.00262
+tgccgc 0.00503
+tgccgg 0.00262
+tgccgt 0.217
+tgccta 0.00434
+tgcctc 0.00365
+tgcctg 0.00262
+tgcctt 0.00571
+tgcgaa 0.00193
+tgcgac 0.00159
+tgcgag 0.00227
+tgcgat 0.00262
+tgcgca 0.00159
+tgcgcc 0.00159
+tgcgcg 0.00159
+tgcgct 0.00227
+tgcgga 0.00262
+tgcggc 0.00434
+tgcggg 0.00262
+tgcggt 0.0109
+tgcgta 0.00227
+tgcgtc 0.00193
+tgcgtg 0.00193
+tgcgtt 0.00296
+tgctaa 0.00399
+tgctac 0.00365
+tgctag 0.00296
+tgctat 0.00812
+tgctca 0.00331
+tgctcc 0.00296
+tgctcg 0.00227
+tgctct 0.00468
+tgctga 0.00915
+tgctgc 0.415
+tgctgg 0.00606
+tgctgt 0.44
+tgctta 0.00468
+tgcttc 0.00468
+tgcttg 0.00365
+tgcttt 0.00709
+tggaaa 0.218
+tggaac 0.00915
+tggaag 0.21
+tggaat 0.0322
+tggaca 0.00984
+tggacc 0.00571
+tggacg 0.00296
+tggact 0.0195
+tggaga 2.85
+tggagc 1.84
+tggagg 0.429
+tggagt 5.71
+tggata 0.0202
+tggatc 0.0109
+tggatg 0.0095
+tggatt 0.636
+tggcaa 0.205
+tggcac 0.00571
+tggcag 0.00503
+tggcat 0.00709
+tggcca 0.00227
+tggccc 0.00227
+tggccg 0.00159
+tggcct 0.00571
+tggcga 0.0105
+tggcgc 0.41
+tggcgg 0.00537
+tggcgt 1.03
+tggcta 0.00503
+tggctc 0.00434
+tggctg 0.00296
+tggctt 0.00984
+tgggaa 0.00331
+tgggac 0.00227
+tgggag 0.204
+tgggat 0.00468
+tgggca 0.00193
+tgggcc 0.00193
+tgggcg 0.00193
+tgggct 0.00296
+tgggga 0.00915
+tggggc 0.208
+tggggg 0.00503
+tggggt 0.223
+tgggta 0.00262
+tgggtc 0.00227
+tgggtg 0.00227
+tgggtt 0.00434
+tggtaa 0.00399
+tggtac 0.00296
+tggtag 0.00399
+tggtat 0.00778
+tggtca 0.00296
+tggtcc 0.00331
+tggtcg 0.00227
+tggtct 0.00468
+tggtga 0.214
+tggtgc 0.219
+tggtgg 0.207
+tggtgt 0.45
+tggtta 0.00399
+tggttc 0.00468
+tggttg 0.00365
+tggttt 0.00778
+tgtaaa 0.0095
+tgtaac 0.00675
+tgtaag 0.00778
+tgtaat 0.43
+tgtaca 0.00503
+tgtacc 0.00296
+tgtacg 0.00193
+tgtact 0.0205
+tgtaga 0.837
+tgtagc 0.433
+tgtagg 0.0222
+tgtagt 6.5
+tgtata 0.0143
+tgtatc 0.00778
+tgtatg 0.00675
+tgtatt 0.036
+tgtcaa 0.00537
+tgtcac 0.00365
+tgtcag 0.00296
+tgtcat 0.00915
+tgtcca 0.00193
+tgtccc 0.00227
+tgtccg 0.00193
+tgtcct 0.00503
+tgtcga 0.00606
+tgtcgc 0.00503
+tgtcgg 0.00468
+tgtcgt 0.835
+tgtcta 0.00503
+tgtctc 0.00503
+tgtctg 0.00331
+tgtctt 0.0126
+tgtgaa 0.00331
+tgtgac 0.00193
+tgtgag 0.00262
+tgtgat 0.00468
+tgtgca 0.00296
+tgtgcc 0.00193
+tgtgcg 0.00159
+tgtgct 0.00503
+tgtgga 0.208
+tgtggc 0.00606
+tgtggg 0.00468
+tgtggt 0.835
+tgtgta 0.00331
+tgtgtc 0.00262
+tgtgtg 0.00227
+tgtgtt 0.00537
+tgttaa 0.00537
+tgttac 0.00331
+tgttag 0.00434
+tgttat 0.016
+tgttca 0.00434
+tgttcc 0.00331
+tgttcg 0.00193
+tgttct 0.00984
+tgttga 0.0215
+tgttgc 0.0226
+tgttgg 0.0136
+tgttgt 2.68
+tgttta 0.00503
+tgtttc 0.00606
+tgtttg 0.00503
+tgtttt 0.0136
+ttaaaa 0.211
+ttaaac 0.00537
+ttaaag 0.00778
+ttaaat 0.0284
+ttaaca 0.0064
+ttaacc 0.00331
+ttaacg 0.00399
+ttaact 0.0212
+ttaaga 1.85
+ttaagc 0.64
+ttaagg 0.63
+ttaagt 7.73
+ttaata 0.0167
+ttaatc 0.00778
+ttaatg 0.208
+ttaatt 0.236
+ttacaa 0.00296
+ttacac 0.00331
+ttacag 0.00296
+ttacat 0.00503
+ttacca 0.00193
+ttaccc 0.00193
+ttaccg 0.00159
+ttacct 0.00434
+ttacga 0.00812
+ttacgc 0.00675
+ttacgg 0.00468
+ttacgt 1.03
+ttacta 0.00331
+ttactc 0.00296
+ttactg 0.00331
+ttactt 0.00778
+ttagaa 0.00193
+ttagac 0.00159
+ttagag 0.00193
+ttagat 0.00262
+ttagca 0.00159
+ttagcc 0.00193
+ttagcg 0.00159
+ttagct 0.00193
+ttagga 0.00537
+ttaggc 0.00468
+ttaggg 0.00365
+ttaggt 0.0236
+ttagta 0.00227
+ttagtc 0.00159
+ttagtg 0.00227
+ttagtt 0.00296
+ttataa 0.00365
+ttatac 0.00434
+ttatag 0.00296
+ttatat 0.0105
+ttatca 0.00262
+ttatcc 0.205
+ttatcg 0.00227
+ttatct 0.00675
+ttatga 0.0153
+ttatgc 0.62
+ttatgg 0.00984
+ttatgt 1.85
+ttatta 0.00365
+ttattc 0.00537
+ttattg 0.00365
+ttattt 0.209
+ttcaaa 0.00193
+ttcaac 0.00159
+ttcaag 0.00159
+ttcaat 0.00227
+ttcaca 0.00159
+ttcacc 0.00159
+ttcacg 0.00159
+ttcact 0.00227
+ttcaga 0.00606
+ttcagc 0.00468
+ttcagg 0.00365
+ttcagt 0.429
+ttcata 0.00159
+ttcatc 0.00159
+ttcatg 0.00193
+ttcatt 0.00262
+ttccaa 0.00159
+ttccac 0.00159
+ttccag 0.00159
+ttccat 0.00193
+ttccca 0.00159
+ttcccc 0.00159
+ttcccg 0.00159
+ttccct 0.00193
+ttccga 0.00193
+ttccgc 0.00227
+ttccgg 0.00193
+ttccgt 0.205
+ttccta 0.00159
+ttcctc 0.00159
+ttcctg 0.00159
+ttcctt 0.00193
+ttcgaa 0.00159
+ttcgac 0.00159
+ttcgag 0.00159
+ttcgat 0.00159
+ttcgca 0.00159
+ttcgcc 0.00159
+ttcgcg 0.00159
+ttcgct 0.00159
+ttcgga 0.00159
+ttcggc 0.00159
+ttcggg 0.00159
+ttcggt 0.00262
+ttcgta 0.00159
+ttcgtc 0.00159
+ttcgtg 0.00159
+ttcgtt 0.00159
+ttctaa 0.00159
+ttctac 0.00159
+ttctag 0.00159
+ttctat 0.00159
+ttctca 0.00159
+ttctcc 0.00193
+ttctcg 0.00159
+ttctct 0.00159
+ttctga 0.00159
+ttctgc 0.00331
+ttctgg 0.00159
+ttctgt 0.00675
+ttctta 0.00159
+ttcttc 0.00159
+ttcttg 0.00159
+ttcttt 0.00193
+ttgaaa 0.00296
+ttgaac 0.00227
+ttgaag 0.00193
+ttgaat 0.00881
+ttgaca 0.00227
+ttgacc 0.00227
+ttgacg 0.00159
+ttgact 0.00881
+ttgaga 0.421
+ttgagc 0.417
+ttgagg 0.0126
+ttgagt 4.26
+ttgata 0.00227
+ttgatc 0.00227
+ttgatg 0.00193
+ttgatt 0.0102
+ttgcaa 0.00193
+ttgcac 0.00159
+ttgcag 0.00159
+ttgcat 0.00159
+ttgcca 0.00159
+ttgccc 0.00159
+ttgccg 0.00159
+ttgcct 0.00159
+ttgcga 0.00227
+ttgcgc 0.00331
+ttgcgg 0.00159
+ttgcgt 0.0129
+ttgcta 0.00159
+ttgctc 0.00159
+ttgctg 0.00159
+ttgctt 0.00159
+ttggaa 0.00159
+ttggac 0.00159
+ttggag 0.00193
+ttggat 0.00159
+ttggca 0.00159
+ttggcc 0.00159
+ttggcg 0.00159
+ttggct 0.00159
+ttggga 0.00227
+ttgggc 0.00262
+ttgggg 0.00159
+ttgggt 0.0095
+ttggta 0.00159
+ttggtc 0.00159
+ttggtg 0.00159
+ttggtt 0.00159
+ttgtaa 0.00159
+ttgtac 0.00159
+ttgtag 0.00159
+ttgtat 0.00159
+ttgtca 0.00159
+ttgtcc 0.00193
+ttgtcg 0.00159
+ttgtct 0.00159
+ttgtga 0.00262
+ttgtgc 0.00365
+ttgtgg 0.00193
+ttgtgt 0.0129
+ttgtta 0.00159
+ttgttc 0.00159
+ttgttg 0.00159
+ttgttt 0.00193
+tttaaa 0.00193
+tttaac 0.00159
+tttaag 0.00159
+tttaat 0.00296
+tttaca 0.00159
+tttacc 0.00159
+tttacg 0.00159
+tttact 0.00262
+tttaga 0.00778
+tttagc 0.00468
+tttagg 0.00331
+tttagt 0.437
+tttata 0.00159
+tttatc 0.00159
+tttatg 0.00193
+tttatt 0.00262
+tttcaa 0.00159
+tttcac 0.00159
+tttcag 0.00159
+tttcat 0.00159
+tttcca 0.00159
+tttccc 0.00159
+tttccg 0.00159
+tttcct 0.00159
+tttcga 0.00159
+tttcgc 0.00159
+tttcgg 0.00159
+tttcgt 0.00571
+tttcta 0.00159
+tttctc 0.00159
+tttctg 0.00159
+tttctt 0.00159
+tttgaa 0.00159
+tttgac 0.00159
+tttgag 0.00159
+tttgat 0.00159
+tttgca 0.00159
+tttgcc 0.00159
+tttgcg 0.00159
+tttgct 0.00159
+tttgga 0.00193
+tttggc 0.00159
+tttggg 0.00193
+tttggt 0.00365
+tttgta 0.00159
+tttgtc 0.00159
+tttgtg 0.00159
+tttgtt 0.00159
+ttttaa 0.00159
+ttttac 0.00159
+ttttag 0.00159
+ttttat 0.00159
+ttttca 0.00159
+ttttcc 0.00193
+ttttcg 0.00159
+ttttct 0.00159
+ttttga 0.00159
+ttttgc 0.00262
+ttttgg 0.00159
+ttttgt 0.00984
+ttttta 0.00159
+tttttc 0.00159
+tttttg 0.00159
+tttttt 0.00193
+
+#
+# Length probabilities
+#
+[LENGTH]
+# The 'd' variable
+897
+# The length probabilities from '0' to 'd' (*1000)
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+5.82e-22
+4.86e-21
+3.15e-20
+2e-19
+1.2e-18
+6.9e-18
+3.82e-17
+2.03e-16
+1.04e-15
+5.11e-15
+2.42e-14
+1.1e-13
+4.81e-13
+2.02e-12
+8.18e-12
+3.18e-11
+1.19e-10
+4.31e-10
+1.5e-09
+5.03e-09
+1.63e-08
+5.11e-08
+1.55e-07
+4.55e-07
+1.29e-06
+3.58e-06
+9.57e-06
+2.48e-05
+6.24e-05
+0.000151
+0.000354
+0.000797
+0.00172
+0.00357
+0.00709
+0.0135
+0.0244
+0.0423
+0.0702
+0.111
+0.169
+0.247
+0.348
+0.475
+0.63
+0.815
+1.03
+1.29
+1.6
+1.96
+2.38
+2.86
+3.4
+3.98
+4.62
+5.27
+5.94
+6.59
+7.23
+7.82
+8.36
+8.85
+9.29
+9.68
+10
+10.3
+10.6
+10.8
+10.9
+11
+11.1
+11
+10.9
+10.8
+10.5
+10.3
+9.94
+9.6
+9.25
+8.89
+8.54
+8.2
+7.88
+7.57
+7.27
+6.99
+6.72
+6.46
+6.2
+5.96
+5.73
+5.51
+5.3
+5.1
+4.92
+4.75
+4.6
+4.46
+4.33
+4.21
+4.1
+4
+3.9
+3.81
+3.71
+3.63
+3.54
+3.45
+3.37
+3.28
+3.2
+3.12
+3.04
+2.95
+2.87
+2.79
+2.71
+2.63
+2.55
+2.48
+2.4
+2.33
+2.26
+2.2
+2.13
+2.07
+2.01
+1.96
+1.91
+1.86
+1.82
+1.77
+1.73
+1.69
+1.66
+1.62
+1.59
+1.56
+1.53
+1.5
+1.47
+1.44
+1.42
+1.4
+1.37
+1.35
+1.33
+1.31
+1.3
+1.28
+1.27
+1.25
+1.24
+1.23
+1.22
+1.21
+1.2
+1.2
+1.19
+1.19
+1.18
+1.18
+1.18
+1.18
+1.18
+1.18
+1.17
+1.17
+1.17
+1.17
+1.17
+1.17
+1.17
+1.17
+1.17
+1.17
+1.16
+1.16
+1.15
+1.15
+1.15
+1.14
+1.13
+1.13
+1.12
+1.12
+1.11
+1.1
+1.1
+1.09
+1.08
+1.08
+1.07
+1.06
+1.06
+1.05
+1.05
+1.04
+1.04
+1.03
+1.03
+1.02
+1.02
+1.01
+1.01
+1
+1
+0.997
+0.994
+0.991
+0.989
+0.986
+0.984
+0.982
+0.98
+0.978
+0.976
+0.975
+0.974
+0.972
+0.972
+0.971
+0.97
+0.97
+0.969
+0.969
+0.969
+0.969
+0.969
+0.969
+0.969
+0.969
+0.969
+0.97
+0.97
+0.97
+0.971
+0.971
+0.971
+0.971
+0.971
+0.971
+0.971
+0.971
+0.971
+0.97
+0.97
+0.969
+0.968
+0.967
+0.966
+0.965
+0.963
+0.961
+0.959
+0.957
+0.955
+0.953
+0.95
+0.948
+0.945
+0.942
+0.938
+0.935
+0.932
+0.928
+0.924
+0.92
+0.917
+0.912
+0.908
+0.904
+0.9
+0.895
+0.891
+0.886
+0.882
+0.877
+0.873
+0.868
+0.863
+0.859
+0.854
+0.849
+0.845
+0.84
+0.836
+0.831
+0.826
+0.822
+0.818
+0.813
+0.809
+0.805
+0.801
+0.797
+0.793
+0.789
+0.785
+0.781
+0.778
+0.774
+0.771
+0.768
+0.765
+0.762
+0.759
+0.757
+0.754
+0.752
+0.75
+0.748
+0.746
+0.744
+0.743
+0.741
+0.74
+0.739
+0.738
+0.737
+0.736
+0.735
+0.735
+0.734
+0.734
+0.734
+0.734
+0.734
+0.734
+0.734
+0.735
+0.735
+0.735
+0.736
+0.737
+0.737
+0.738
+0.738
+0.739
+0.74
+0.741
+0.741
+0.742
+0.743
+0.743
+0.744
+0.745
+0.745
+0.746
+0.747
+0.747
+0.747
+0.748
+0.748
+0.748
+0.749
+0.749
+0.749
+0.749
+0.749
+0.748
+0.748
+0.748
+0.747
+0.747
+0.746
+0.746
+0.745
+0.744
+0.743
+0.742
+0.741
+0.74
+0.739
+0.738
+0.737
+0.736
+0.735
+0.733
+0.732
+0.731
+0.729
+0.728
+0.726
+0.725
+0.723
+0.722
+0.721
+0.719
+0.718
+0.716
+0.715
+0.713
+0.712
+0.711
+0.709
+0.708
+0.707
+0.705
+0.704
+0.703
+0.701
+0.7
+0.699
+0.698
+0.697
+0.696
+0.695
+0.694
+0.693
+0.692
+0.691
+0.69
+0.689
+0.688
+0.687
+0.686
+0.685
+0.684
+0.683
+0.683
+0.682
+0.681
+0.68
+0.679
+0.679
+0.678
+0.677
+0.676
+0.676
+0.675
+0.674
+0.674
+0.673
+0.672
+0.672
+0.671
+0.67
+0.67
+0.669
+0.668
+0.668
+0.667
+0.667
+0.666
+0.666
+0.665
+0.665
+0.664
+0.664
+0.663
+0.663
+0.662
+0.662
+0.662
+0.661
+0.661
+0.661
+0.661
+0.66
+0.66
+0.66
+0.66
+0.66
+0.66
+0.659
+0.659
+0.659
+0.659
+0.659
+0.659
+0.66
+0.66
+0.66
+0.66
+0.66
+0.66
+0.661
+0.661
+0.661
+0.661
+0.662
+0.662
+0.662
+0.663
+0.663
+0.664
+0.664
+0.664
+0.665
+0.665
+0.666
+0.666
+0.667
+0.667
+0.668
+0.668
+0.669
+0.669
+0.67
+0.67
+0.671
+0.671
+0.671
+0.672
+0.672
+0.673
+0.673
+0.674
+0.674
+0.674
+0.675
+0.675
+0.675
+0.675
+0.676
+0.676
+0.676
+0.676
+0.676
+0.677
+0.677
+0.677
+0.677
+0.677
+0.677
+0.677
+0.677
+0.677
+0.677
+0.676
+0.676
+0.676
+0.676
+0.676
+0.675
+0.675
+0.675
+0.674
+0.674
+0.674
+0.673
+0.673
+0.672
+0.672
+0.671
+0.671
+0.67
+0.67
+0.669
+0.668
+0.668
+0.667
+0.667
+0.666
+0.665
+0.665
+0.664
+0.663
+0.663
+0.662
+0.661
+0.661
+0.66
+0.659
+0.659
+0.658
+0.657
+0.657
+0.656
+0.655
+0.655
+0.654
+0.653
+0.653
+0.652
+0.651
+0.651
+0.65
+0.65
+0.649
+0.649
+0.648
+0.648
+0.647
+0.647
+0.646
+0.646
+0.645
+0.645
+0.644
+0.644
+0.644
+0.643
+0.643
+0.642
+0.642
+0.642
+0.641
+0.641
+0.641
+0.64
+0.64
+0.64
+0.639
+0.639
+0.639
+0.639
+0.638
+0.638
+0.638
+0.637
+0.637
+0.637
+0.637
+0.636
+0.636
+0.636
+0.635
+0.635
+0.635
+0.634
+0.634
+0.634
+0.633
+0.633
+0.633
+0.632
+0.632
+0.631
+0.631
+0.63
+0.63
+0.629
+0.629
+0.628
+0.628
+0.627
+0.627
+0.626
+0.625
+0.625
+0.624
+0.623
+0.622
+0.622
+0.621
+0.62
+0.619
+0.618
+0.617
+0.616
+0.616
+0.615
+0.614
+0.613
+0.612
+0.61
+0.609
+0.608
+0.607
+0.606
+0.605
+0.604
+0.602
+0.601
+0.6
+0.599
+0.597
+0.596
+0.595
+0.593
+0.592
+0.591
+0.589
+0.588
+0.587
+0.585
+0.584
+0.582
+0.581
+0.579
+0.578
+0.576
+0.575
+0.573
+0.572
+0.57
+0.569
+0.567
+0.566
+0.565
+0.563
+0.562
+0.56
+0.559
+0.557
+0.556
+0.554
+0.553
+0.551
+0.55
+0.548
+0.547
+0.545
+0.544
+0.543
+0.541
+0.54
+0.538
+0.537
+0.536
+0.534
+0.533
+0.532
+0.53
+0.529
+0.528
+0.526
+0.525
+0.524
+0.523
+0.521
+0.52
+0.519
+0.518
+0.517
+0.516
+0.515
+0.513
+0.512
+0.511
+0.51
+0.509
+0.508
+0.507
+0.506
+0.505
+0.504
+0.503
+0.502
+0.501
+0.5
+0.499
+0.499
+0.498
+0.497
+0.496
+0.495
+0.494
+0.493
+0.493
+0.492
+0.491
+0.49
+0.489
+0.489
+0.488
+0.487
+0.486
+0.486
+0.485
+0.484
+0.484
+0.483
+0.482
+0.481
+0.481
+0.48
+0.479
+0.479
+0.478
+0.477
+0.477
+0.476
+0.475
+0.475
+0.474
+0.473
+0.473
+0.472
+0.471
+0.471
+0.47
+0.469
+0.469
+0.468
+0.467
+0.466
+0.466
+0.465
+0.464
+0.464
+0.463
+0.462
+0.462
+0.461
+0.46
+0.459
+0.459
+0.458
+0.457
+0.456
+0.456
+0.455
+0.454
+0.453
+0.453
+0.452
+0.451
+0.45
+0.45
+0.449
+0.448
+0.447
+0.446
+0.445
+0.445
+0.444
+0.443
+0.442
+0.441
+0.44
+0.44
+0.439
+0.438
+0.437
+0.436
+0.435
+0.434
+0.433
+0.433
+0.432
+0.431
+0.43
+0.429
+0.428
+0.427
+0.426
+0.425
+0.424
+0.423
+0.423
+0.422
+0.421
+0.42
+0.419
+0.418
+0.417
+0.416
+0.415
+0.414
+0.413
+0.412
+0.411
+0.41
+0.409
+0.409
+0.408
+0.407
+0.406
+0.405
+0.404
+0.403
+0.402
+0.401
+0.4
+0.399
+0.398
+0.398
+0.397
+0.396
+0.395
+0.394
+0.393
+0.392
+0.391
+0.391
+# end of content independent part
+[1]
+# (a,c,g,t)= (0.237, 0.263, 0.263, 0.237)
+#
+# Probabilities file for the intron model
+#
+#
+# Transition probabilities
+#
+[TRANSITION]
+# the probability of an intron of length at most d
+0.867
+# mean additional length of introns with length > d
+394
+
+#
+# The emission probabilities of introns
+#
+[EMISSION]
+# size of the emission vector
+1024
+#k=
+4
+# patpseudo : pseudocount for sequence patterns
+5
+aaaaa 0.3924
+aaaac 0.1295
+aaaag 0.1776
+aaaat 0.3005
+aaaca 0.3753
+aaacc 0.1949
+aaacg 0.1006
+aaact 0.3292
+aaaga 0.3624
+aaagc 0.1605
+aaagg 0.2001
+aaagt 0.277
+aaata 0.3347
+aaatc 0.1578
+aaatg 0.1743
+aaatt 0.3333
+aacaa 0.4088
+aacac 0.1678
+aacag 0.1533
+aacat 0.2701
+aacca 0.3712
+aaccc 0.2214
+aaccg 0.1197
+aacct 0.2877
+aacga 0.3495
+aacgc 0.1637
+aacgg 0.2302
+aacgt 0.2567
+aacta 0.2645
+aactc 0.2018
+aactg 0.1626
+aactt 0.371
+aagaa 0.437
+aagac 0.1213
+aagag 0.1963
+aagat 0.2454
+aagca 0.3766
+aagcc 0.1858
+aagcg 0.09859
+aagct 0.339
+aagga 0.3564
+aaggc 0.164
+aaggg 0.2208
+aaggt 0.2588
+aagta 0.2737
+aagtc 0.1574
+aagtg 0.2072
+aagtt 0.3618
+aataa 0.3486
+aatac 0.1501
+aatag 0.1593
+aatat 0.342
+aatca 0.3689
+aatcc 0.2091
+aatcg 0.1086
+aatct 0.3134
+aatga 0.3408
+aatgc 0.1745
+aatgg 0.2112
+aatgt 0.2735
+aatta 0.2775
+aattc 0.1658
+aattg 0.1803
+aattt 0.3763
+acaaa 0.3675
+acaac 0.184
+acaag 0.1905
+acaat 0.258
+acaca 0.3869
+acacc 0.2047
+acacg 0.1145
+acact 0.2939
+acaga 0.3453
+acagc 0.1802
+acagg 0.1776
+acagt 0.2969
+acata 0.3094
+acatc 0.1698
+acatg 0.2206
+acatt 0.3002
+accaa 0.3998
+accac 0.1882
+accag 0.146
+accat 0.266
+accca 0.3168
+acccc 0.238
+acccg 0.1425
+accct 0.3027
+accga 0.3293
+accgc 0.1834
+accgg 0.2458
+accgt 0.2414
+accta 0.2434
+acctc 0.2439
+acctg 0.162
+acctt 0.3507
+acgaa 0.3413
+acgac 0.1986
+acgag 0.2271
+acgat 0.233
+acgca 0.315
+acgcc 0.2499
+acgcg 0.1803
+acgct 0.2548
+acgga 0.3197
+acggc 0.18
+acggg 0.2418
+acggt 0.2585
+acgta 0.2712
+acgtc 0.1733
+acgtg 0.2735
+acgtt 0.282
+actaa 0.3262
+actac 0.1856
+actag 0.1856
+actat 0.3026
+actca 0.321
+actcc 0.2373
+actcg 0.1264
+actct 0.3152
+actga 0.3076
+actgc 0.1941
+actgg 0.2114
+actgt 0.2869
+actta 0.2297
+acttc 0.1998
+acttg 0.2176
+acttt 0.3528
+agaaa 0.4003
+agaac 0.13
+agaag 0.229
+agaat 0.2408
+agaca 0.3667
+agacc 0.2043
+agacg 0.1211
+agact 0.308
+agaga 0.392
+agagc 0.145
+agagg 0.2158
+agagt 0.2472
+agata 0.2862
+agatc 0.1653
+agatg 0.2184
+agatt 0.3301
+agcaa 0.366
+agcac 0.16
+agcag 0.1945
+agcat 0.2794
+agcca 0.3693
+agccc 0.2154
+agccg 0.1236
+agcct 0.2917
+agcga 0.3255
+agcgc 0.1769
+agcgg 0.2505
+agcgt 0.2471
+agcta 0.2668
+agctc 0.1946
+agctg 0.1956
+agctt 0.343
+aggaa 0.3843
+aggac 0.1393
+aggag 0.2303
+aggat 0.2461
+aggca 0.3487
+aggcc 0.2138
+aggcg 0.1312
+aggct 0.3063
+aggga 0.3201
+agggc 0.1524
+agggg 0.2464
+agggt 0.2811
+aggta 0.27
+aggtc 0.1798
+aggtg 0.232
+aggtt 0.3182
+agtaa 0.3274
+agtac 0.1669
+agtag 0.2061
+agtat 0.2996
+agtca 0.3566
+agtcc 0.218
+agtcg 0.1274
+agtct 0.298
+agtga 0.3226
+agtgc 0.1716
+agtgg 0.2226
+agtgt 0.2833
+agtta 0.2451
+agttc 0.1807
+agttg 0.224
+agttt 0.3502
+ataaa 0.3743
+ataac 0.1494
+ataag 0.1597
+ataat 0.3166
+ataca 0.3965
+atacc 0.1855
+atacg 0.1002
+atact 0.3178
+ataga 0.3262
+atagc 0.1854
+atagg 0.1846
+atagt 0.3038
+atata 0.3655
+atatc 0.1323
+atatg 0.1676
+atatt 0.3346
+atcaa 0.3718
+atcac 0.1787
+atcag 0.1533
+atcat 0.2961
+atcca 0.3557
+atccc 0.2129
+atccg 0.1253
+atcct 0.3061
+atcga 0.3683
+atcgc 0.1615
+atcgg 0.2239
+atcgt 0.2464
+atcta 0.2409
+atctc 0.2154
+atctg 0.1756
+atctt 0.3681
+atgaa 0.3695
+atgac 0.1558
+atgag 0.1871
+atgat 0.2877
+atgca 0.3733
+atgcc 0.1901
+atgcg 0.1039
+atgct 0.3327
+atgga 0.3357
+atggc 0.1864
+atggg 0.1951
+atggt 0.2828
+atgta 0.2852
+atgtc 0.163
+atgtg 0.2187
+atgtt 0.3331
+attaa 0.3313
+attac 0.1531
+attag 0.1643
+attat 0.3513
+attca 0.3489
+attcc 0.2004
+attcg 0.1094
+attct 0.3413
+attga 0.3224
+attgc 0.1672
+attgg 0.2018
+attgt 0.3086
+attta 0.2353
+atttc 0.1694
+atttg 0.1948
+atttt 0.4005
+caaaa 0.3829
+caaac 0.1649
+caaag 0.1622
+caaat 0.29
+caaca 0.3809
+caacc 0.1999
+caacg 0.09271
+caact 0.3265
+caaga 0.3274
+caagc 0.1766
+caagg 0.1898
+caagt 0.3063
+caata 0.2905
+caatc 0.1684
+caatg 0.1828
+caatt 0.3583
+cacaa 0.3722
+cacac 0.1921
+cacag 0.1345
+cacat 0.3011
+cacca 0.3757
+caccc 0.216
+caccg 0.1124
+cacct 0.296
+cacga 0.3158
+cacgc 0.1773
+cacgg 0.188
+cacgt 0.319
+cacta 0.2717
+cactc 0.1832
+cactg 0.166
+cactt 0.3791
+cagaa 0.3896
+cagac 0.1414
+cagag 0.1948
+cagat 0.2742
+cagca 0.3784
+cagcc 0.2021
+cagcg 0.08587
+cagct 0.3336
+cagga 0.3249
+caggc 0.1763
+caggg 0.2048
+caggt 0.294
+cagta 0.285
+cagtc 0.1679
+cagtg 0.1991
+cagtt 0.348
+cataa 0.3389
+catac 0.1532
+catag 0.1556
+catat 0.3524
+catca 0.371
+catcc 0.1965
+catcg 0.1085
+catct 0.324
+catga 0.3085
+catgc 0.1811
+catgg 0.1981
+catgt 0.3123
+catta 0.2404
+cattc 0.1732
+cattg 0.1868
+cattt 0.3996
+ccaaa 0.42
+ccaac 0.1691
+ccaag 0.1748
+ccaat 0.2361
+ccaca 0.3165
+ccacc 0.2639
+ccacg 0.1266
+ccact 0.293
+ccaga 0.2965
+ccagc 0.2358
+ccagg 0.1704
+ccagt 0.2973
+ccata 0.2671
+ccatc 0.1941
+ccatg 0.2028
+ccatt 0.336
+cccaa 0.3891
+cccac 0.2028
+cccag 0.1418
+cccat 0.2663
+cccca 0.2907
+ccccc 0.2838
+ccccg 0.1205
+cccct 0.305
+cccga 0.3392
+cccgc 0.1877
+cccgg 0.2194
+cccgt 0.2537
+cccta 0.2398
+ccctc 0.2507
+ccctg 0.1395
+ccctt 0.37
+ccgaa 0.3365
+ccgac 0.1758
+ccgag 0.2347
+ccgat 0.253
+ccgca 0.3141
+ccgcc 0.2571
+ccgcg 0.1549
+ccgct 0.2739
+ccgga 0.302
+ccggc 0.1818
+ccggg 0.2286
+ccggt 0.2877
+ccgta 0.2486
+ccgtc 0.1999
+ccgtg 0.2148
+ccgtt 0.3368
+cctaa 0.3393
+cctac 0.1889
+cctag 0.1792
+cctat 0.2925
+cctca 0.2825
+cctcc 0.2517
+cctcg 0.1617
+cctct 0.3041
+cctga 0.3043
+cctgc 0.2308
+cctgg 0.1924
+cctgt 0.2725
+cctta 0.2255
+ccttc 0.2222
+ccttg 0.1911
+ccttt 0.3612
+cgaaa 0.3494
+cgaac 0.1875
+cgaag 0.213
+cgaat 0.2501
+cgaca 0.2787
+cgacc 0.3075
+cgacg 0.154
+cgact 0.2598
+cgaga 0.2693
+cgagc 0.208
+cgagg 0.2804
+cgagt 0.2423
+cgata 0.2624
+cgatc 0.2167
+cgatg 0.2032
+cgatt 0.3177
+cgcaa 0.318
+cgcac 0.2057
+cgcag 0.1876
+cgcat 0.2887
+cgcca 0.3252
+cgccc 0.2318
+cgccg 0.1648
+cgcct 0.2783
+cgcga 0.3074
+cgcgc 0.2021
+cgcgg 0.2196
+cgcgt 0.271
+cgcta 0.2489
+cgctc 0.2253
+cgctg 0.1763
+cgctt 0.3495
+cggaa 0.3224
+cggac 0.1783
+cggag 0.228
+cggat 0.2713
+cggca 0.2719
+cggcc 0.265
+cggcg 0.1735
+cggct 0.2896
+cggga 0.2837
+cgggc 0.2061
+cgggg 0.2163
+cgggt 0.2939
+cggta 0.2402
+cggtc 0.2208
+cggtg 0.2153
+cggtt 0.3237
+cgtaa 0.3014
+cgtac 0.2043
+cgtag 0.194
+cgtat 0.3003
+cgtca 0.3133
+cgtcc 0.2235
+cgtcg 0.1815
+cgtct 0.2817
+cgtga 0.2997
+cgtgc 0.2035
+cgtgg 0.2313
+cgtgt 0.2655
+cgtta 0.2387
+cgttc 0.19
+cgttg 0.213
+cgttt 0.3583
+ctaaa 0.3645
+ctaac 0.165
+ctaag 0.1723
+ctaat 0.2982
+ctaca 0.3253
+ctacc 0.2155
+ctacg 0.1049
+ctact 0.3543
+ctaga 0.3018
+ctagc 0.1989
+ctagg 0.1886
+ctagt 0.3107
+ctata 0.2867
+ctatc 0.167
+ctatg 0.1759
+ctatt 0.3704
+ctcaa 0.3863
+ctcac 0.1716
+ctcag 0.1502
+ctcat 0.2919
+ctcca 0.3493
+ctccc 0.2155
+ctccg 0.117
+ctcct 0.3182
+ctcga 0.3595
+ctcgc 0.1574
+ctcgg 0.224
+ctcgt 0.2591
+ctcta 0.2404
+ctctc 0.2455
+ctctg 0.153
+ctctt 0.3611
+ctgaa 0.3884
+ctgac 0.1386
+ctgag 0.1857
+ctgat 0.2873
+ctgca 0.3539
+ctgcc 0.1972
+ctgcg 0.1013
+ctgct 0.3476
+ctgga 0.3495
+ctggc 0.1706
+ctggg 0.1924
+ctggt 0.2875
+ctgta 0.2589
+ctgtc 0.1747
+ctgtg 0.193
+ctgtt 0.3733
+cttaa 0.334
+cttac 0.1627
+cttag 0.1756
+cttat 0.3277
+cttca 0.322
+cttcc 0.1998
+cttcg 0.1067
+cttct 0.3715
+cttga 0.3088
+cttgc 0.1731
+cttgg 0.2051
+cttgt 0.313
+cttta 0.2166
+ctttc 0.1891
+ctttg 0.1873
+ctttt 0.407
+gaaaa 0.4075
+gaaac 0.1399
+gaaag 0.1782
+gaaat 0.2744
+gaaca 0.3413
+gaacc 0.214
+gaacg 0.1062
+gaact 0.3384
+gaaga 0.3769
+gaagc 0.1685
+gaagg 0.1999
+gaagt 0.2547
+gaata 0.2876
+gaatc 0.1702
+gaatg 0.1842
+gaatt 0.358
+gacaa 0.3773
+gacac 0.1729
+gacag 0.1583
+gacat 0.2915
+gacca 0.3431
+gaccc 0.2242
+gaccg 0.1447
+gacct 0.2881
+gacga 0.3608
+gacgc 0.1592
+gacgg 0.2228
+gacgt 0.2572
+gacta 0.2621
+gactc 0.1925
+gactg 0.1784
+gactt 0.3669
+gagaa 0.3796
+gagac 0.1265
+gagag 0.2379
+gagat 0.256
+gagca 0.3535
+gagcc 0.2017
+gagcg 0.1105
+gagct 0.3343
+gagga 0.3338
+gaggc 0.1739
+gaggg 0.2235
+gaggt 0.2688
+gagta 0.2734
+gagtc 0.1581
+gagtg 0.1917
+gagtt 0.3768
+gataa 0.3456
+gatac 0.1552
+gatag 0.1731
+gatat 0.3261
+gatca 0.3386
+gatcc 0.2145
+gatcg 0.1433
+gatct 0.3036
+gatga 0.3424
+gatgc 0.1775
+gatgg 0.2117
+gatgt 0.2684
+gatta 0.2294
+gattc 0.1777
+gattg 0.1911
+gattt 0.4018
+gcaaa 0.3733
+gcaac 0.1756
+gcaag 0.1939
+gcaat 0.2572
+gcaca 0.3397
+gcacc 0.22
+gcacg 0.1454
+gcact 0.2949
+gcaga 0.333
+gcagc 0.2262
+gcagg 0.1887
+gcagt 0.252
+gcata 0.2865
+gcatc 0.1856
+gcatg 0.2114
+gcatt 0.3165
+gccaa 0.3721
+gccac 0.1984
+gccag 0.142
+gccat 0.2875
+gccca 0.3381
+gcccc 0.2263
+gcccg 0.1649
+gccct 0.2708
+gccga 0.318
+gccgc 0.2158
+gccgg 0.2239
+gccgt 0.2423
+gccta 0.2468
+gcctc 0.2491
+gcctg 0.1533
+gcctt 0.3507
+gcgaa 0.3354
+gcgac 0.1916
+gcgag 0.2245
+gcgat 0.2484
+gcgca 0.2965
+gcgcc 0.2543
+gcgcg 0.1906
+gcgct 0.2586
+gcgga 0.3023
+gcggc 0.2088
+gcggg 0.233
+gcggt 0.2558
+gcgta 0.2816
+gcgtc 0.1754
+gcgtg 0.2487
+gcgtt 0.2942
+gctaa 0.3174
+gctac 0.1871
+gctag 0.1939
+gctat 0.3016
+gctca 0.3229
+gctcc 0.227
+gctcg 0.1665
+gctct 0.2836
+gctga 0.314
+gctgc 0.2315
+gctgg 0.2229
+gctgt 0.2315
+gctta 0.2195
+gcttc 0.2233
+gcttg 0.2119
+gcttt 0.3452
+ggaaa 0.3841
+ggaac 0.1466
+ggaag 0.2185
+ggaat 0.2508
+ggaca 0.338
+ggacc 0.2309
+ggacg 0.1289
+ggact 0.3022
+ggaga 0.3248
+ggagc 0.163
+ggagg 0.2509
+ggagt 0.2614
+ggata 0.2726
+ggatc 0.1809
+ggatg 0.2052
+ggatt 0.3412
+ggcaa 0.3446
+ggcac 0.1701
+ggcag 0.1984
+ggcat 0.2869
+ggcca 0.3496
+ggccc 0.2172
+ggccg 0.1547
+ggcct 0.2785
+ggcga 0.301
+ggcgc 0.1867
+ggcgg 0.2523
+ggcgt 0.26
+ggcta 0.2845
+ggctc 0.1981
+ggctg 0.2
+ggctt 0.3174
+gggaa 0.3405
+gggac 0.1525
+gggag 0.2417
+gggat 0.2653
+gggca 0.3011
+gggcc 0.232
+gggcg 0.1522
+gggct 0.3148
+gggga 0.2854
+ggggc 0.1576
+ggggg 0.2837
+ggggt 0.2734
+gggta 0.2619
+gggtc 0.1864
+gggtg 0.2255
+gggtt 0.3262
+ggtaa 0.3338
+ggtac 0.1613
+ggtag 0.2108
+ggtat 0.294
+ggtca 0.3206
+ggtcc 0.2197
+ggtcg 0.1989
+ggtct 0.2607
+ggtga 0.2962
+ggtgc 0.1713
+ggtgg 0.2684
+ggtgt 0.2641
+ggtta 0.2236
+ggttc 0.1934
+ggttg 0.2321
+ggttt 0.3509
+gtaaa 0.3772
+gtaac 0.1568
+gtaag 0.17
+gtaat 0.296
+gtaca 0.3537
+gtacc 0.1896
+gtacg 0.127
+gtact 0.3298
+gtaga 0.306
+gtagc 0.1898
+gtagg 0.1967
+gtagt 0.3075
+gtata 0.3158
+gtatc 0.1524
+gtatg 0.1763
+gtatt 0.3554
+gtcaa 0.3671
+gtcac 0.1856
+gtcag 0.1412
+gtcat 0.3061
+gtcca 0.3566
+gtccc 0.2083
+gtccg 0.1402
+gtcct 0.2949
+gtcga 0.3152
+gtcgc 0.174
+gtcgg 0.2173
+gtcgt 0.2934
+gtcta 0.2548
+gtctc 0.2094
+gtctg 0.1781
+gtctt 0.3578
+gtgaa 0.351
+gtgac 0.1622
+gtgag 0.1888
+gtgat 0.2981
+gtgca 0.3749
+gtgcc 0.1867
+gtgcg 0.1227
+gtgct 0.3157
+gtgga 0.3097
+gtggc 0.1861
+gtggg 0.2149
+gtggt 0.2893
+gtgta 0.2682
+gtgtc 0.1596
+gtgtg 0.2304
+gtgtt 0.3417
+gttaa 0.316
+gttac 0.1643
+gttag 0.184
+gttat 0.3357
+gttca 0.339
+gttcc 0.202
+gttcg 0.1414
+gttct 0.3176
+gttga 0.3017
+gttgc 0.1664
+gttgg 0.2108
+gttgt 0.321
+gttta 0.2197
+gtttc 0.1822
+gtttg 0.2339
+gtttt 0.3642
+taaaa 0.3927
+taaac 0.1358
+taaag 0.1644
+taaat 0.3071
+taaca 0.3646
+taacc 0.1872
+taacg 0.1009
+taact 0.3473
+taaga 0.3113
+taagc 0.1725
+taagg 0.2112
+taagt 0.3049
+taata 0.3075
+taatc 0.1416
+taatg 0.1647
+taatt 0.3862
+tacaa 0.3812
+tacac 0.1737
+tacag 0.1402
+tacat 0.3049
+tacca 0.3516
+taccc 0.2257
+taccg 0.1128
+tacct 0.3099
+tacga 0.304
+tacgc 0.1901
+tacgg 0.2062
+tacgt 0.2996
+tacta 0.2838
+tactc 0.1872
+tactg 0.1703
+tactt 0.3588
+tagaa 0.3711
+tagac 0.1438
+tagag 0.2177
+tagat 0.2675
+tagca 0.3422
+tagcc 0.2189
+tagcg 0.09229
+tagct 0.3466
+tagga 0.3309
+taggc 0.1763
+taggg 0.2186
+taggt 0.2743
+tagta 0.2944
+tagtc 0.1529
+tagtg 0.2019
+tagtt 0.3508
+tataa 0.2851
+tatac 0.1513
+tatag 0.1399
+tatat 0.4238
+tatca 0.3566
+tatcc 0.2034
+tatcg 0.1092
+tatct 0.3309
+tatga 0.299
+tatgc 0.1822
+tatgg 0.1937
+tatgt 0.3251
+tatta 0.2516
+tattc 0.1516
+tattg 0.1665
+tattt 0.4303
+tcaaa 0.382
+tcaac 0.1695
+tcaag 0.1843
+tcaat 0.2642
+tcaca 0.3406
+tcacc 0.2183
+tcacg 0.1229
+tcact 0.3182
+tcaga 0.32
+tcagc 0.2184
+tcagg 0.1772
+tcagt 0.2844
+tcata 0.2603
+tcatc 0.1982
+tcatg 0.1994
+tcatt 0.3421
+tccaa 0.3722
+tccac 0.1821
+tccag 0.1604
+tccat 0.2853
+tccca 0.324
+tcccc 0.2299
+tcccg 0.1272
+tccct 0.3189
+tccga 0.3229
+tccgc 0.1897
+tccgg 0.226
+tccgt 0.2614
+tccta 0.2333
+tcctc 0.2407
+tcctg 0.1422
+tcctt 0.3837
+tcgaa 0.3312
+tcgac 0.1627
+tcgag 0.2404
+tcgat 0.2656
+tcgca 0.2967
+tcgcc 0.2452
+tcgcg 0.1734
+tcgct 0.2846
+tcgga 0.3021
+tcggc 0.1807
+tcggg 0.2473
+tcggt 0.2698
+tcgta 0.2346
+tcgtc 0.2072
+tcgtg 0.2309
+tcgtt 0.3273
+tctaa 0.3102
+tctac 0.1847
+tctag 0.1803
+tctat 0.3249
+tctca 0.289
+tctcc 0.2242
+tctcg 0.1069
+tctct 0.3799
+tctga 0.3017
+tctgc 0.2236
+tctgg 0.1838
+tctgt 0.2909
+tctta 0.1916
+tcttc 0.2415
+tcttg 0.19
+tcttt 0.3769
+tgaaa 0.3664
+tgaac 0.1507
+tgaag 0.2156
+tgaat 0.2673
+tgaca 0.3532
+tgacc 0.2154
+tgacg 0.1155
+tgact 0.3159
+tgaga 0.3257
+tgagc 0.1804
+tgagg 0.219
+tgagt 0.275
+tgata 0.2726
+tgatc 0.163
+tgatg 0.221
+tgatt 0.3434
+tgcaa 0.3375
+tgcac 0.1794
+tgcag 0.187
+tgcat 0.2961
+tgcca 0.3504
+tgccc 0.2046
+tgccg 0.1152
+tgcct 0.3298
+tgcga 0.299
+tgcgc 0.1787
+tgcgg 0.2532
+tgcgt 0.2691
+tgcta 0.2457
+tgctc 0.1919
+tgctg 0.2069
+tgctt 0.3555
+tggaa 0.3439
+tggac 0.1562
+tggag 0.2345
+tggat 0.2653
+tggca 0.3139
+tggcc 0.2274
+tggcg 0.13
+tggct 0.3287
+tggga 0.3113
+tgggc 0.1822
+tgggg 0.2249
+tgggt 0.2816
+tggta 0.2499
+tggtc 0.1748
+tggtg 0.2403
+tggtt 0.335
+tgtaa 0.3042
+tgtac 0.1678
+tgtag 0.1775
+tgtat 0.3505
+tgtca 0.3515
+tgtcc 0.215
+tgtcg 0.1205
+tgtct 0.3129
+tgtga 0.2986
+tgtgc 0.1709
+tgtgg 0.208
+tgtgt 0.3225
+tgtta 0.2339
+tgttc 0.1657
+tgttg 0.2375
+tgttt 0.3629
+ttaaa 0.3702
+ttaac 0.1471
+ttaag 0.1702
+ttaat 0.3124
+ttaca 0.3433
+ttacc 0.21
+ttacg 0.1003
+ttact 0.3464
+ttaga 0.2971
+ttagc 0.1862
+ttagg 0.2042
+ttagt 0.3124
+ttata 0.2768
+ttatc 0.1579
+ttatg 0.1814
+ttatt 0.3839
+ttcaa 0.3706
+ttcac 0.166
+ttcag 0.1634
+ttcat 0.3
+ttcca 0.3387
+ttccc 0.2008
+ttccg 0.1094
+ttcct 0.3512
+ttcga 0.3437
+ttcgc 0.1632
+ttcgg 0.2229
+ttcgt 0.2702
+ttcta 0.2144
+ttctc 0.205
+ttctg 0.1601
+ttctt 0.4205
+ttgaa 0.3645
+ttgac 0.1492
+ttgag 0.1978
+ttgat 0.2885
+ttgca 0.3534
+ttgcc 0.1896
+ttgcg 0.09506
+ttgct 0.3619
+ttgga 0.3152
+ttggc 0.1737
+ttggg 0.2052
+ttggt 0.3059
+ttgta 0.2657
+ttgtc 0.1572
+ttgtg 0.2014
+ttgtt 0.3757
+tttaa 0.3262
+tttac 0.1621
+tttag 0.1668
+tttat 0.3449
+tttca 0.3177
+tttcc 0.2039
+tttcg 0.1015
+tttct 0.3769
+tttga 0.3093
+tttgc 0.1609
+tttgg 0.2381
+tttgt 0.2917
+tttta 0.2259
+ttttc 0.1887
+ttttg 0.193
+ttttt 0.3924
+
+# patterns:
+# aaaaa 138106
+# aaaac 45562
+# aaaag 62523
+# aaaat 105768
+# aaaca 46954
+# aaacc 24383
+# aaacg 12577
+# aaact 41187
+# aaaga 55668
+# aaagc 24651
+# aaagg 30737
+# aaagt 42559
+# aaata 88387
+# aaatc 41680
+# aaatg 46025
+# aaatt 88017
+# aacaa 52908
+# aacac 21713
+# aacag 19832
+# aacat 34948
+# aacca 25795
+# aaccc 15384
+# aaccg 8313
+# aacct 19989
+# aacga 12269
+# aacgc 5742
+# aacgg 8077
+# aacgt 9008
+# aacta 31113
+# aactc 23734
+# aactg 19125
+# aactt 43639
+# aagaa 64544
+# aagac 17907
+# aagag 28995
+# aagat 36252
+# aagca 26889
+# aagcc 13263
+# aagcg 7035
+# aagct 24201
+# aagga 30333
+# aaggc 13958
+# aaggg 18794
+# aaggt 22026
+# aagta 33013
+# aagtc 18978
+# aagtg 24985
+# aagtt 43639
+# aataa 71605
+# aatac 30831
+# aatag 32724
+# aatat 70252
+# aatca 38264
+# aatcc 21685
+# aatcg 11256
+# aatct 32505
+# aatga 39249
+# aatgc 20098
+# aatgg 24327
+# aatgt 31498
+# aatta 64911
+# aattc 38766
+# aattg 42176
+# aattt 88017
+# acaaa 51749
+# acaac 25901
+# acaag 26829
+# acaat 36325
+# acaca 24579
+# acacc 13005
+# acacg 7274
+# acact 18670
+# acaga 18342
+# acagc 9571
+# acagg 9430
+# acagt 15772
+# acata 32460
+# acatc 17813
+# acatg 23150
+# acatt 31498
+# accaa 30776
+# accac 14487
+# accag 11239
+# accat 20478
+# accca 14939
+# acccc 11223
+# acccg 6719
+# accct 14276
+# accga 8459
+# accgc 4709
+# accgg 6313
+# accgt 6200
+# accta 15283
+# acctc 15319
+# acctg 10173
+# acctt 22026
+# acgaa 12791
+# acgac 7441
+# acgag 8511
+# acgat 8729
+# acgca 6148
+# acgcc 4877
+# acgcg 3518
+# acgct 4973
+# acgga 7669
+# acggc 4315
+# acggg 5799
+# acggt 6200
+# acgta 8665
+# acgtc 5533
+# acgtg 8739
+# acgtt 9008
+# actaa 28928
+# actac 16460
+# actag 16457
+# actat 26838
+# actca 20217
+# actcc 14947
+# actcg 7961
+# actct 19856
+# actga 16906
+# actgc 10666
+# actgg 11621
+# actgt 15772
+# actta 27711
+# acttc 24104
+# acttg 26247
+# acttt 42559
+# agaaa 61436
+# agaac 19946
+# agaag 35149
+# agaat 36955
+# agaca 18352
+# agacc 10221
+# agacg 6060
+# agact 15413
+# agaga 31481
+# agagc 11644
+# agagg 17330
+# agagt 19856
+# agata 28187
+# agatc 16277
+# agatg 21508
+# agatt 32505
+# agcaa 27682
+# agcac 12103
+# agcag 14713
+# agcat 21136
+# agcca 15434
+# agccc 8998
+# agccg 5161
+# agcct 12190
+# agcga 6553
+# agcgc 3560
+# agcgg 5042
+# agcgt 4973
+# agcta 18826
+# agctc 13728
+# agctg 13795
+# agctt 24201
+# aggaa 30382
+# aggac 11006
+# aggag 18202
+# aggat 19452
+# aggca 13876
+# aggcc 8506
+# aggcg 5220
+# aggct 12190
+# aggga 16260
+# agggc 7739
+# agggg 12517
+# agggt 14276
+# aggta 16956
+# aggtc 11294
+# aggtg 14570
+# aggtt 19989
+# agtaa 30124
+# agtac 15352
+# agtag 18961
+# agtat 27571
+# agtca 18441
+# agtcc 11275
+# agtcg 6585
+# agtct 15413
+# agtga 21262
+# agtgc 11305
+# agtgg 14667
+# agtgt 18670
+# agtta 28829
+# agttc 21255
+# agttg 26339
+# agttt 41187
+# ataaa 69814
+# ataac 27868
+# ataag 29777
+# ataat 59047
+# ataca 34395
+# atacc 16088
+# atacg 8685
+# atact 27571
+# ataga 28816
+# atagc 16378
+# atagg 16302
+# atagt 26838
+# atata 76735
+# atatc 27783
+# atatg 35186
+# atatt 70252
+# atcaa 41436
+# atcac 19916
+# atcag 17077
+# atcat 32999
+# atcca 22605
+# atccc 13527
+# atccg 7958
+# atcct 19452
+# atcga 13052
+# atcgc 5720
+# atcgg 7931
+# atcgt 8729
+# atcta 23723
+# atctc 21214
+# atctg 17287
+# atctt 36252
+# atgaa 42388
+# atgac 17867
+# atgag 21460
+# atgat 32999
+# atgca 23712
+# atgcc 12071
+# atgcg 6596
+# atgct 21136
+# atgga 24307
+# atggc 13498
+# atggg 14125
+# atggt 20478
+# atgta 29925
+# atgtc 17100
+# atgtg 22946
+# atgtt 34948
+# attaa 55697
+# attac 25742
+# attag 27611
+# attat 59047
+# attca 37773
+# attcc 21700
+# attcg 11844
+# attct 36955
+# attga 37948
+# attgc 19675
+# attgg 23751
+# attgt 36325
+# attta 62154
+# atttc 44731
+# atttg 51460
+# atttt 105768
+# caaaa 67938
+# caaac 29258
+# caaag 28772
+# caaat 51460
+# caaca 30732
+# caacc 16125
+# caacg 7476
+# caact 26339
+# caaga 28054
+# caagc 15127
+# caagg 16260
+# caagt 26247
+# caata 34190
+# caatc 19815
+# caatg 21509
+# caatt 42176
+# cacaa 28362
+# cacac 14637
+# cacag 10249
+# cacat 22946
+# cacca 18498
+# caccc 10630
+# caccg 5529
+# cacct 14570
+# cacga 8651
+# cacgc 4854
+# cacgg 5149
+# cacgt 8739
+# cacta 17905
+# cactc 12075
+# cactg 10939
+# cactt 24985
+# cagaa 24565
+# cagac 8909
+# cagag 12282
+# cagat 17287
+# cagca 15645
+# cagcc 8356
+# cagcg 3547
+# cagct 13795
+# cagga 11241
+# caggc 6099
+# caggg 7085
+# caggt 10173
+# cagta 15665
+# cagtc 9225
+# cagtg 10939
+# cagtt 19125
+# cataa 33838
+# catac 15293
+# catag 15538
+# catat 35186
+# catca 24627
+# catcc 13040
+# catcg 7197
+# catct 21508
+# catga 22874
+# catgc 13426
+# catgg 14682
+# catgt 23150
+# catta 27683
+# cattc 19945
+# cattg 21509
+# cattt 46025
+# ccaaa 42252
+# ccaac 17008
+# ccaag 17577
+# ccaat 23751
+# ccaca 15846
+# ccacc 13214
+# ccacg 6336
+# ccact 14667
+# ccaga 11590
+# ccagc 9214
+# ccagg 6658
+# ccagt 11621
+# ccata 19339
+# ccatc 14051
+# ccatg 14682
+# ccatt 24327
+# cccaa 20640
+# cccac 10759
+# cccag 7521
+# cccat 14125
+# cccca 11930
+# ccccc 11645
+# ccccg 4943
+# cccct 12517
+# cccga 7754
+# cccgc 4288
+# cccgg 5015
+# cccgt 5799
+# cccta 12178
+# ccctc 12736
+# ccctg 7085
+# ccctt 18794
+# ccgaa 10551
+# ccgac 5509
+# ccgag 7359
+# ccgat 7931
+# ccgca 5784
+# ccgcc 4732
+# ccgcg 2850
+# ccgct 5042
+# ccgga 6628
+# ccggc 3987
+# ccggg 5015
+# ccggt 6313
+# ccgta 5962
+# ccgtc 4792
+# ccgtg 5149
+# ccgtt 8077
+# cctaa 18910
+# cctac 10528
+# cctag 9986
+# cctat 16302
+# cctca 16100
+# cctcc 14347
+# cctcg 9213
+# cctct 17330
+# cctga 10530
+# cctgc 7986
+# cctgg 6658
+# cctgt 9430
+# cctta 19192
+# ccttc 18910
+# ccttg 16260
+# ccttt 30737
+# cgaaa 16544
+# cgaac 8875
+# cgaag 10087
+# cgaat 11844
+# cgaca 7065
+# cgacc 7797
+# cgacg 3903
+# cgact 6585
+# cgaga 8850
+# cgagc 6832
+# cgagg 9213
+# cgagt 7961
+# cgata 9298
+# cgatc 7677
+# cgatg 7197
+# cgatt 11256
+# cgcaa 7267
+# cgcac 4699
+# cgcag 4285
+# cgcat 6596
+# cgcca 6102
+# cgccc 4347
+# cgccg 3089
+# cgcct 5220
+# cgcga 3991
+# cgcgc 2622
+# cgcgg 2850
+# cgcgt 3518
+# cgcta 5009
+# cgctc 4533
+# cgctg 3547
+# cgctt 7035
+# cggaa 9460
+# cggac 5230
+# cggag 6687
+# cggat 7958
+# cggca 4845
+# cggcc 4721
+# cggcg 3089
+# cggct 5161
+# cggga 6484
+# cgggc 4710
+# cgggg 4943
+# cgggt 6719
+# cggta 6168
+# cggtc 5669
+# cggtg 5529
+# cggtt 8313
+# cgtaa 8718
+# cgtac 5908
+# cgtag 5610
+# cgtat 8685
+# cgtca 6741
+# cgtcc 4808
+# cgtcg 3903
+# cgtct 6060
+# cgtga 8211
+# cgtgc 5573
+# cgtgg 6336
+# cgtgt 7274
+# cgtta 8376
+# cgttc 6666
+# cgttg 7476
+# cgttt 12577
+# ctaaa 33751
+# ctaac 15276
+# ctaag 15956
+# ctaat 27611
+# ctaca 17412
+# ctacc 11534
+# ctacg 5610
+# ctact 18961
+# ctaga 15985
+# ctagc 10531
+# ctagg 9986
+# ctagt 16457
+# ctata 25324
+# ctatc 14748
+# ctatg 15538
+# ctatt 32724
+# ctcaa 28403
+# ctcac 12613
+# ctcag 11037
+# ctcat 21460
+# ctcca 19978
+# ctccc 12327
+# ctccg 6687
+# ctcct 18202
+# ctcga 11811
+# ctcgc 5168
+# ctcgg 7359
+# ctcgt 8511
+# ctcta 19303
+# ctctc 19714
+# ctctg 12282
+# ctctt 28995
+# ctgaa 23087
+# ctgac 8239
+# ctgag 11037
+# ctgat 17077
+# ctgca 14979
+# ctgcc 8344
+# ctgcg 4285
+# ctgct 14713
+# ctgga 13662
+# ctggc 6667
+# ctggg 7521
+# ctggt 11239
+# ctgta 13754
+# ctgtc 9280
+# ctgtg 10249
+# ctgtt 19832
+# cttaa 30350
+# cttac 14779
+# cttag 15956
+# cttat 29777
+# cttca 30458
+# cttcc 18904
+# cttcg 10087
+# cttct 35149
+# cttga 26464
+# cttgc 14829
+# cttgg 17577
+# cttgt 26829
+# cttta 33269
+# ctttc 29052
+# ctttg 28772
+# ctttt 62523
+# gaaaa 66419
+# gaaac 22796
+# gaaag 29052
+# gaaat 44731
+# gaaca 21437
+# gaacc 13439
+# gaacg 6666
+# gaact 21255
+# gaaga 35664
+# gaagc 15944
+# gaagg 18910
+# gaagt 24104
+# gaata 31142
+# gaatc 18433
+# gaatg 19945
+# gaatt 38766
+# gacaa 22131
+# gacac 10140
+# gacag 9280
+# gacat 17100
+# gacca 13452
+# gaccc 8787
+# gaccg 5669
+# gacct 11294
+# gacga 7763
+# gacgc 3422
+# gacgg 4792
+# gacgt 5533
+# gacta 13557
+# gactc 9956
+# gactg 9225
+# gactt 18978
+# gagaa 31459
+# gagac 10477
+# gagag 19714
+# gagat 21214
+# gagca 14515
+# gagcc 8278
+# gagcg 4533
+# gagct 13728
+# gagga 19027
+# gaggc 9911
+# gaggg 12736
+# gaggt 15319
+# gagta 17220
+# gagtc 9956
+# gagtg 12075
+# gagtt 23734
+# gataa 29444
+# gatac 13220
+# gatag 14748
+# gatat 27783
+# gatca 18155
+# gatcc 11496
+# gatcg 7677
+# gatct 16277
+# gatga 22731
+# gatgc 11783
+# gatgg 14051
+# gatgt 17813
+# gatta 23788
+# gattc 18433
+# gattg 19815
+# gattt 41680
+# gcaaa 28552
+# gcaac 13426
+# gcaag 14829
+# gcaat 19675
+# gcaca 13023
+# gcacc 8433
+# gcacg 5573
+# gcact 11305
+# gcaga 14095
+# gcagc 9572
+# gcagg 7986
+# gcagt 10666
+# gcata 18196
+# gcatc 11783
+# gcatg 13426
+# gcatt 20098
+# gccaa 17471
+# gccac 9316
+# gccag 6667
+# gccat 13498
+# gccca 9666
+# gcccc 6466
+# gcccg 4710
+# gccct 7739
+# gccga 5664
+# gccgc 3843
+# gccgg 3987
+# gccgt 4315
+# gccta 9822
+# gcctc 9911
+# gcctg 6099
+# gcctt 13958
+# gcgaa 7725
+# gcgac 4411
+# gcgag 5168
+# gcgat 5720
+# gcgca 4082
+# gcgcc 3501
+# gcgcg 2622
+# gcgct 3560
+# gcgga 5565
+# gcggc 3843
+# gcggg 4288
+# gcggt 4709
+# gcgta 5497
+# gcgtc 3422
+# gcgtg 4854
+# gcgtt 5742
+# gctaa 17241
+# gctac 10159
+# gctag 10531
+# gctat 16378
+# gctca 13260
+# gctcc 9319
+# gctcg 6832
+# gctct 11644
+# gctga 12984
+# gctgc 9572
+# gctgg 9214
+# gctgt 9571
+# gctta 15674
+# gcttc 15944
+# gcttg 15127
+# gcttt 24651
+# ggaaa 33239
+# ggaac 12681
+# ggaag 18904
+# ggaat 21700
+# ggaca 12609
+# ggacc 8613
+# ggacg 4808
+# ggact 11275
+# ggaga 18576
+# ggagc 9319
+# ggagg 14347
+# ggagt 14947
+# ggata 17325
+# ggatc 11496
+# ggatg 13040
+# ggatt 21685
+# ggcaa 14502
+# ggcac 7155
+# ggcag 8344
+# ggcat 12071
+# ggcca 10677
+# ggccc 6631
+# ggccg 4721
+# ggcct 8506
+# ggcga 5646
+# ggcgc 3501
+# ggcgg 4732
+# ggcgt 4877
+# ggcta 11890
+# ggctc 8278
+# ggctg 8356
+# ggctt 13263
+# gggaa 17367
+# gggac 7774
+# gggag 12327
+# gggat 13527
+# gggca 8606
+# gggcc 6631
+# gggcg 4347
+# gggct 8998
+# gggga 11717
+# ggggc 6466
+# ggggg 11645
+# ggggt 11223
+# gggta 12350
+# gggtc 8787
+# gggtg 10630
+# gggtt 15384
+# ggtaa 18262
+# ggtac 8825
+# ggtag 11534
+# ggtat 16088
+# ggtca 12571
+# ggtcc 8613
+# ggtcg 7797
+# ggtct 10221
+# ggtga 14582
+# ggtgc 8433
+# ggtgg 13214
+# ggtgt 13005
+# ggtta 15538
+# ggttc 13439
+# ggttg 16125
+# ggttt 24383
+# gtaaa 32808
+# gtaac 13637
+# gtaag 14779
+# gtaat 25742
+# gtaca 16466
+# gtacc 8825
+# gtacg 5908
+# gtact 15352
+# gtaga 16379
+# gtagc 10159
+# gtagg 10528
+# gtagt 16460
+# gtata 27390
+# gtatc 13220
+# gtatg 15293
+# gtatt 30831
+# gtcaa 21431
+# gtcac 10833
+# gtcag 8239
+# gtcat 17867
+# gtcca 13308
+# gtccc 7774
+# gtccg 5230
+# gtcct 11006
+# gtcga 7993
+# gtcgc 4411
+# gtcgg 5509
+# gtcgt 7441
+# gtcta 12749
+# gtctc 10477
+# gtctg 8909
+# gtctt 17907
+# gtgaa 23455
+# gtgac 10833
+# gtgag 12613
+# gtgat 19916
+# gtgca 14370
+# gtgcc 7155
+# gtgcg 4699
+# gtgct 12103
+# gtgga 15509
+# gtggc 9316
+# gtggg 10759
+# gtggt 14487
+# gtgta 17040
+# gtgtc 10140
+# gtgtg 14637
+# gtgtt 21713
+# gttaa 26230
+# gttac 13637
+# gttag 15276
+# gttat 27868
+# gttca 21288
+# gttcc 12681
+# gttcg 8875
+# gttct 19946
+# gttga 24342
+# gttgc 13426
+# gttgg 17008
+# gttgt 25901
+# gttta 27483
+# gtttc 22796
+# gtttg 29258
+# gtttt 45562
+# taaaa 79489
+# taaac 27483
+# taaag 33269
+# taaat 62154
+# taaca 30263
+# taacc 15538
+# taacg 8376
+# taact 28829
+# taaga 28291
+# taagc 15674
+# taagg 19192
+# taagt 27711
+# taata 51684
+# taatc 23788
+# taatg 27683
+# taatt 64911
+# tacaa 37413
+# tacac 17040
+# tacag 13754
+# tacat 29925
+# tacca 19239
+# taccc 12350
+# taccg 6168
+# tacct 16956
+# tacga 8793
+# tacgc 5497
+# tacgg 5962
+# tacgt 8665
+# tacta 26112
+# tactc 17220
+# tactg 15665
+# tactt 33013
+# tagaa 32909
+# tagac 12749
+# tagag 19303
+# tagat 23723
+# tagca 18585
+# tagcc 11890
+# tagcg 5009
+# tagct 18826
+# tagga 18441
+# taggc 9822
+# taggg 12178
+# taggt 15283
+# tagta 26112
+# tagtc 13557
+# tagtg 17905
+# tagtt 31113
+# tataa 51615
+# tatac 27390
+# tatag 25324
+# tatat 76735
+# tatca 30377
+# tatcc 17325
+# tatcg 9298
+# tatct 28187
+# tatga 29855
+# tatgc 18196
+# tatgg 19339
+# tatgt 32460
+# tatta 51684
+# tattc 31142
+# tattg 34190
+# tattt 88387
+# tcaaa 54869
+# tcaac 24342
+# tcaag 26464
+# tcaat 37948
+# tcaca 22754
+# tcacc 14582
+# tcacg 8211
+# tcact 21262
+# tcaga 19025
+# tcagc 12984
+# tcagg 10530
+# tcagt 16906
+# tcata 29855
+# tcatc 22731
+# tcatg 22874
+# tcatt 39249
+# tccaa 31703
+# tccac 15509
+# tccag 13662
+# tccat 24307
+# tccca 16517
+# tcccc 11717
+# tcccg 6484
+# tccct 16260
+# tccga 9473
+# tccgc 5565
+# tccgg 6628
+# tccgt 7669
+# tccta 18441
+# tcctc 19027
+# tcctg 11241
+# tcctt 30333
+# tcgaa 16276
+# tcgac 7993
+# tcgag 11811
+# tcgat 13052
+# tcgca 6833
+# tcgcc 5646
+# tcgcg 3991
+# tcgct 6553
+# tcgga 9473
+# tcggc 5664
+# tcggg 7754
+# tcggt 8459
+# tcgta 8793
+# tcgtc 7763
+# tcgtg 8651
+# tcgtt 12269
+# tctaa 27509
+# tctac 16379
+# tctag 15985
+# tctat 28816
+# tctca 23946
+# tctcc 18576
+# tctcg 8850
+# tctct 31481
+# tctga 19025
+# tctgc 14095
+# tctgg 11590
+# tctgt 18342
+# tctta 28291
+# tcttc 35664
+# tcttg 28054
+# tcttt 55668
+# tgaaa 51781
+# tgaac 21288
+# tgaag 30458
+# tgaat 37773
+# tgaca 20617
+# tgacc 12571
+# tgacg 6741
+# tgact 18441
+# tgaga 23946
+# tgagc 13260
+# tgagg 16100
+# tgagt 20217
+# tgata 30377
+# tgatc 18155
+# tgatg 24627
+# tgatt 38264
+# tgcaa 27030
+# tgcac 14370
+# tgcag 14979
+# tgcat 23712
+# tgcca 14742
+# tgccc 8606
+# tgccg 4845
+# tgcct 13876
+# tgcga 6833
+# tgcgc 4082
+# tgcgg 5784
+# tgcgt 6148
+# tgcta 18585
+# tgctc 14515
+# tgctg 15645
+# tgctt 26889
+# tggaa 29300
+# tggac 13308
+# tggag 19978
+# tggat 22605
+# tggca 14742
+# tggcc 10677
+# tggcg 6102
+# tggct 15434
+# tggga 16517
+# tgggc 9666
+# tgggg 11930
+# tgggt 14939
+# tggta 19239
+# tggtc 13452
+# tggtg 18498
+# tggtt 25795
+# tgtaa 29855
+# tgtac 16466
+# tgtag 17412
+# tgtat 34395
+# tgtca 20617
+# tgtcc 12609
+# tgtcg 7065
+# tgtct 18352
+# tgtga 22754
+# tgtgc 13023
+# tgtgg 15846
+# tgtgt 24579
+# tgtta 30263
+# tgttc 21437
+# tgttg 30732
+# tgttt 46954
+# ttaaa 66015
+# ttaac 26230
+# ttaag 30350
+# ttaat 55697
+# ttaca 29855
+# ttacc 18262
+# ttacg 8718
+# ttact 30124
+# ttaga 27509
+# ttagc 17241
+# ttagg 18910
+# ttagt 28928
+# ttata 51615
+# ttatc 29444
+# ttatg 33838
+# ttatt 71605
+# ttcaa 52364
+# ttcac 23455
+# ttcag 23087
+# ttcat 42388
+# ttcca 29300
+# ttccc 17367
+# ttccg 9460
+# ttcct 30382
+# ttcga 16276
+# ttcgc 7725
+# ttcgg 10551
+# ttcgt 12791
+# ttcta 32909
+# ttctc 31459
+# ttctg 24565
+# ttctt 64544
+# ttgaa 52364
+# ttgac 21431
+# ttgag 28403
+# ttgat 41436
+# ttgca 27030
+# ttgcc 14502
+# ttgcg 7267
+# ttgct 27682
+# ttgga 31703
+# ttggc 17471
+# ttggg 20640
+# ttggt 30776
+# ttgta 37413
+# ttgtc 22131
+# ttgtg 28362
+# ttgtt 52908
+# tttaa 66015
+# tttac 32808
+# tttag 33751
+# tttat 69814
+# tttca 51781
+# tttcc 33239
+# tttcg 16544
+# tttct 61436
+# tttga 54869
+# tttgc 28552
+# tttgg 42252
+# tttgt 51749
+# tttta 79489
+# ttttc 66419
+# ttttg 67938
+# ttttt 138106
+
+# motif upstream of acceptor splice site
+[ASSMOTIF]
+# width of motif, n=
+30
+# order of markov model, k=
+3
+# markov chain emission probabilities
+ 0 0.318 0.154 0.164 0.363 0.311 0.138 0.059 0.492 0.284 0.189 0.179 0.347 0.25 0.137 0.21 0.403 0.349 0.125 0.118 0.408 0.238 0.151 0.127 0.484 0.212 0.192 0.173 0.423 0.253 0.145 0.206 0.396 0.404 0.116 0.176 0.304 0.329 0.129 0.0387 0.503 0.4 0.146 0.177 0.277 0.282 0.121 0.228 0.369 0.301 0.118 0.128 0.453 0.33 0.14 0.0633 0.467 0.296 0.182 0.191 0.33 0.245 0.141 0.182 0.432 0.267 0.169 0.166 0.397 0.301 0.179 0.0894 0.431 0.253 0.173 0.173 0.4 0.245 0.129 0.281 0.345 0.321 0.121 0. [...]
+ 1 0.314 0.158 0.153 0.375 0.315 0.146 0.0556 0.484 0.3 0.183 0.169 0.349 0.238 0.131 0.2 0.431 0.339 0.138 0.125 0.398 0.267 0.127 0.127 0.48 0.226 0.177 0.161 0.435 0.246 0.137 0.213 0.404 0.407 0.11 0.167 0.315 0.318 0.135 0.0365 0.51 0.378 0.16 0.173 0.288 0.269 0.129 0.216 0.386 0.312 0.129 0.126 0.433 0.329 0.146 0.0637 0.462 0.299 0.189 0.191 0.321 0.251 0.148 0.182 0.419 0.271 0.168 0.168 0.393 0.275 0.161 0.0738 0.49 0.254 0.16 0.16 0.425 0.245 0.129 0.271 0.355 0.331 0.114 0.1 [...]
+ 2 0.313 0.149 0.156 0.381 0.299 0.146 0.0524 0.502 0.303 0.189 0.157 0.351 0.238 0.139 0.199 0.425 0.344 0.147 0.121 0.388 0.269 0.137 0.115 0.478 0.24 0.187 0.133 0.44 0.243 0.143 0.219 0.395 0.394 0.102 0.169 0.335 0.311 0.129 0.0356 0.524 0.374 0.149 0.178 0.299 0.273 0.126 0.215 0.386 0.312 0.126 0.13 0.433 0.317 0.144 0.0665 0.472 0.304 0.186 0.176 0.334 0.251 0.147 0.191 0.411 0.276 0.175 0.157 0.393 0.254 0.153 0.0794 0.513 0.257 0.167 0.148 0.429 0.247 0.133 0.266 0.354 0.307 0 [...]
+ 3 0.313 0.151 0.148 0.388 0.3 0.144 0.0525 0.503 0.289 0.188 0.148 0.375 0.234 0.14 0.202 0.424 0.339 0.145 0.118 0.398 0.271 0.124 0.101 0.505 0.253 0.209 0.121 0.418 0.268 0.135 0.212 0.385 0.389 0.1 0.174 0.337 0.3 0.118 0.0342 0.548 0.386 0.147 0.168 0.299 0.274 0.131 0.2 0.394 0.317 0.13 0.128 0.426 0.3 0.139 0.0763 0.485 0.301 0.192 0.166 0.341 0.244 0.154 0.195 0.407 0.277 0.174 0.151 0.398 0.264 0.134 0.0736 0.528 0.25 0.169 0.131 0.449 0.247 0.135 0.262 0.355 0.321 0.144 0.149 [...]
+ 4 0.308 0.14 0.15 0.402 0.301 0.137 0.0517 0.51 0.282 0.191 0.128 0.399 0.245 0.136 0.197 0.422 0.346 0.159 0.113 0.382 0.311 0.105 0.0957 0.488 0.253 0.209 0.121 0.418 0.279 0.133 0.211 0.377 0.38 0.0977 0.183 0.339 0.294 0.126 0.0372 0.543 0.335 0.165 0.159 0.341 0.266 0.128 0.2 0.406 0.322 0.127 0.126 0.424 0.28 0.148 0.0852 0.487 0.307 0.203 0.161 0.329 0.242 0.153 0.192 0.412 0.27 0.17 0.147 0.413 0.251 0.141 0.0793 0.529 0.252 0.165 0.107 0.476 0.248 0.136 0.257 0.36 0.327 0.139 [...]
+ 5 0.305 0.137 0.15 0.408 0.285 0.133 0.0505 0.532 0.291 0.192 0.115 0.402 0.244 0.136 0.193 0.427 0.344 0.154 0.116 0.386 0.29 0.0821 0.0966 0.531 0.304 0.207 0.087 0.402 0.265 0.138 0.212 0.385 0.367 0.106 0.176 0.35 0.275 0.122 0.042 0.561 0.333 0.191 0.17 0.305 0.281 0.125 0.179 0.415 0.329 0.117 0.125 0.429 0.282 0.144 0.0805 0.494 0.319 0.204 0.148 0.329 0.238 0.154 0.195 0.413 0.276 0.176 0.163 0.385 0.247 0.126 0.0736 0.554 0.244 0.169 0.0945 0.493 0.237 0.142 0.253 0.367 0.315 [...]
+ 6 0.296 0.132 0.149 0.422 0.284 0.131 0.0499 0.535 0.283 0.191 0.12 0.407 0.246 0.131 0.195 0.428 0.34 0.154 0.111 0.395 0.291 0.0777 0.102 0.529 0.299 0.207 0.0805 0.414 0.269 0.14 0.209 0.383 0.356 0.114 0.171 0.359 0.277 0.114 0.0455 0.564 0.331 0.189 0.157 0.323 0.261 0.13 0.175 0.434 0.345 0.125 0.113 0.416 0.267 0.148 0.0759 0.509 0.323 0.202 0.132 0.343 0.225 0.159 0.204 0.412 0.261 0.165 0.161 0.413 0.243 0.131 0.0717 0.554 0.236 0.174 0.0769 0.513 0.218 0.15 0.254 0.377 0.284 [...]
+ 7 0.294 0.135 0.16 0.411 0.286 0.129 0.057 0.528 0.291 0.193 0.1 0.415 0.239 0.126 0.195 0.439 0.35 0.146 0.117 0.387 0.297 0.0755 0.0896 0.538 0.33 0.209 0.0769 0.385 0.269 0.138 0.21 0.384 0.356 0.105 0.173 0.365 0.263 0.11 0.0588 0.569 0.314 0.186 0.169 0.331 0.266 0.135 0.154 0.445 0.353 0.136 0.109 0.402 0.265 0.144 0.0739 0.517 0.33 0.196 0.121 0.354 0.226 0.148 0.208 0.418 0.286 0.173 0.136 0.406 0.252 0.144 0.08 0.524 0.213 0.207 0.0691 0.511 0.219 0.155 0.239 0.388 0.303 0.176 [...]
+ 8 0.295 0.13 0.162 0.413 0.28 0.121 0.0607 0.538 0.273 0.2 0.0926 0.435 0.24 0.133 0.202 0.425 0.334 0.146 0.111 0.409 0.273 0.0925 0.0837 0.551 0.38 0.19 0.09 0.34 0.273 0.133 0.212 0.383 0.324 0.117 0.184 0.375 0.261 0.0924 0.0562 0.59 0.349 0.16 0.179 0.311 0.281 0.132 0.153 0.434 0.363 0.128 0.107 0.401 0.253 0.134 0.0691 0.543 0.343 0.181 0.106 0.371 0.22 0.147 0.205 0.428 0.289 0.187 0.127 0.397 0.277 0.152 0.0859 0.484 0.211 0.216 0.0541 0.519 0.217 0.158 0.242 0.383 0.314 0.168 [...]
+ 9 0.283 0.141 0.163 0.413 0.299 0.121 0.0655 0.514 0.259 0.196 0.0967 0.448 0.236 0.127 0.207 0.429 0.335 0.13 0.104 0.43 0.282 0.0881 0.0837 0.546 0.396 0.168 0.0891 0.347 0.264 0.12 0.221 0.395 0.327 0.12 0.176 0.377 0.264 0.102 0.0596 0.574 0.364 0.172 0.172 0.293 0.275 0.133 0.152 0.44 0.359 0.136 0.0994 0.406 0.242 0.14 0.0633 0.555 0.34 0.175 0.118 0.367 0.215 0.151 0.2 0.435 0.284 0.184 0.135 0.398 0.276 0.154 0.0772 0.492 0.202 0.225 0.0449 0.528 0.203 0.156 0.24 0.401 0.326 0. [...]
+10 0.274 0.15 0.163 0.413 0.302 0.114 0.0631 0.522 0.26 0.217 0.0969 0.426 0.239 0.126 0.206 0.429 0.332 0.143 0.102 0.423 0.289 0.106 0.0936 0.511 0.412 0.144 0.0825 0.361 0.229 0.129 0.227 0.415 0.322 0.122 0.171 0.385 0.269 0.106 0.0573 0.568 0.333 0.176 0.167 0.324 0.255 0.123 0.169 0.453 0.354 0.13 0.0929 0.423 0.246 0.146 0.0518 0.557 0.343 0.166 0.118 0.373 0.211 0.142 0.195 0.452 0.299 0.192 0.137 0.373 0.26 0.186 0.0823 0.472 0.211 0.23 0.0559 0.503 0.197 0.161 0.233 0.409 0.31 [...]
+11 0.284 0.151 0.156 0.408 0.306 0.115 0.0621 0.517 0.273 0.222 0.0942 0.411 0.227 0.128 0.215 0.429 0.309 0.138 0.102 0.451 0.271 0.123 0.0805 0.525 0.398 0.136 0.0971 0.369 0.224 0.134 0.23 0.413 0.336 0.111 0.149 0.405 0.259 0.0893 0.0536 0.598 0.37 0.139 0.176 0.315 0.253 0.132 0.159 0.456 0.346 0.132 0.0957 0.426 0.262 0.136 0.0453 0.557 0.324 0.154 0.121 0.401 0.207 0.144 0.197 0.452 0.314 0.19 0.141 0.356 0.246 0.18 0.0702 0.504 0.213 0.253 0.06 0.473 0.189 0.163 0.229 0.419 0.31 [...]
+12 0.287 0.16 0.15 0.403 0.311 0.112 0.0616 0.515 0.269 0.209 0.0898 0.431 0.216 0.125 0.221 0.439 0.309 0.139 0.104 0.448 0.286 0.141 0.0855 0.487 0.392 0.127 0.0882 0.392 0.219 0.139 0.241 0.401 0.344 0.112 0.139 0.405 0.236 0.104 0.0472 0.613 0.426 0.099 0.158 0.317 0.234 0.135 0.186 0.445 0.339 0.138 0.0942 0.429 0.245 0.136 0.0542 0.564 0.304 0.164 0.118 0.413 0.197 0.147 0.194 0.462 0.304 0.194 0.126 0.375 0.259 0.164 0.0862 0.491 0.218 0.254 0.0563 0.472 0.189 0.165 0.231 0.415 0 [...]
+13 0.289 0.164 0.146 0.4 0.312 0.119 0.0654 0.503 0.256 0.223 0.0861 0.435 0.207 0.127 0.218 0.448 0.298 0.149 0.102 0.451 0.268 0.152 0.0714 0.509 0.4 0.109 0.0727 0.418 0.207 0.129 0.247 0.417 0.327 0.108 0.133 0.432 0.238 0.114 0.0415 0.606 0.433 0.1 0.156 0.311 0.226 0.131 0.19 0.454 0.324 0.131 0.0939 0.451 0.242 0.14 0.0549 0.562 0.296 0.168 0.122 0.415 0.2 0.142 0.19 0.468 0.321 0.206 0.117 0.356 0.257 0.187 0.0794 0.477 0.252 0.245 0.0576 0.446 0.2 0.16 0.229 0.411 0.328 0.119 0 [...]
+14 0.288 0.165 0.127 0.42 0.31 0.123 0.0635 0.503 0.254 0.21 0.0959 0.44 0.209 0.132 0.225 0.434 0.294 0.142 0.0958 0.469 0.284 0.164 0.0819 0.47 0.369 0.0901 0.0811 0.459 0.201 0.14 0.237 0.422 0.322 0.0963 0.119 0.463 0.265 0.114 0.0216 0.6 0.453 0.0814 0.151 0.314 0.212 0.123 0.202 0.463 0.314 0.115 0.0968 0.474 0.239 0.142 0.0594 0.559 0.283 0.16 0.135 0.423 0.193 0.149 0.191 0.467 0.324 0.204 0.115 0.357 0.279 0.174 0.0731 0.475 0.26 0.237 0.0458 0.458 0.197 0.157 0.227 0.419 0.305 [...]
+15 0.28 0.175 0.123 0.423 0.316 0.126 0.062 0.496 0.258 0.204 0.11 0.428 0.209 0.128 0.222 0.441 0.312 0.131 0.0852 0.472 0.288 0.171 0.0766 0.464 0.306 0.102 0.102 0.491 0.194 0.149 0.233 0.424 0.335 0.0856 0.109 0.471 0.256 0.134 0.0233 0.587 0.439 0.0732 0.134 0.354 0.192 0.119 0.209 0.48 0.284 0.119 0.0916 0.506 0.232 0.153 0.067 0.548 0.263 0.159 0.143 0.435 0.181 0.147 0.195 0.477 0.318 0.187 0.121 0.374 0.271 0.176 0.0704 0.482 0.276 0.259 0.0517 0.414 0.183 0.146 0.231 0.44 0.27 [...]
+16 0.287 0.176 0.109 0.427 0.299 0.121 0.0663 0.513 0.262 0.2 0.106 0.432 0.195 0.131 0.229 0.445 0.308 0.14 0.0864 0.465 0.299 0.161 0.09 0.45 0.279 0.106 0.115 0.5 0.193 0.157 0.218 0.432 0.331 0.089 0.11 0.47 0.25 0.128 0.0244 0.598 0.422 0.0723 0.145 0.361 0.178 0.113 0.213 0.496 0.278 0.115 0.0885 0.518 0.241 0.148 0.0759 0.535 0.246 0.16 0.149 0.445 0.172 0.139 0.202 0.486 0.325 0.182 0.115 0.379 0.29 0.192 0.0674 0.451 0.317 0.25 0.0577 0.375 0.18 0.143 0.243 0.435 0.269 0.13 0.1 [...]
+17 0.29 0.166 0.111 0.433 0.295 0.126 0.0692 0.509 0.274 0.168 0.119 0.439 0.183 0.123 0.23 0.463 0.306 0.136 0.0808 0.477 0.304 0.155 0.0876 0.454 0.248 0.0952 0.124 0.533 0.198 0.146 0.207 0.449 0.33 0.0814 0.0905 0.498 0.245 0.15 0.0272 0.578 0.421 0.0658 0.158 0.355 0.184 0.113 0.21 0.493 0.269 0.122 0.0865 0.523 0.238 0.151 0.0727 0.538 0.236 0.156 0.155 0.453 0.169 0.14 0.203 0.489 0.304 0.178 0.106 0.412 0.302 0.18 0.0635 0.455 0.307 0.248 0.0495 0.396 0.164 0.148 0.244 0.444 0.2 [...]
+18 0.278 0.166 0.0966 0.459 0.287 0.13 0.0795 0.503 0.263 0.159 0.126 0.452 0.178 0.116 0.225 0.481 0.331 0.133 0.0706 0.466 0.319 0.157 0.0919 0.432 0.27 0.11 0.11 0.51 0.17 0.14 0.211 0.479 0.328 0.0833 0.099 0.49 0.246 0.159 0.0397 0.556 0.435 0.058 0.13 0.377 0.182 0.101 0.215 0.501 0.255 0.127 0.0765 0.541 0.239 0.154 0.0747 0.533 0.238 0.154 0.16 0.448 0.165 0.135 0.205 0.496 0.277 0.187 0.0897 0.446 0.298 0.197 0.0745 0.431 0.316 0.221 0.0421 0.421 0.17 0.158 0.219 0.452 0.252 0. [...]
+19 0.278 0.167 0.085 0.47 0.288 0.129 0.0804 0.502 0.262 0.172 0.133 0.433 0.173 0.118 0.222 0.487 0.335 0.136 0.0634 0.465 0.315 0.144 0.0829 0.459 0.267 0.109 0.119 0.505 0.156 0.14 0.199 0.506 0.319 0.0783 0.114 0.488 0.278 0.148 0.0522 0.522 0.4 0.0615 0.123 0.415 0.177 0.102 0.19 0.531 0.251 0.133 0.0589 0.557 0.233 0.164 0.0671 0.537 0.235 0.146 0.17 0.449 0.169 0.13 0.204 0.497 0.283 0.168 0.0765 0.472 0.293 0.196 0.0543 0.457 0.342 0.224 0.0395 0.395 0.155 0.144 0.224 0.478 0.26 [...]
+20 0.279 0.175 0.0719 0.474 0.281 0.128 0.0716 0.519 0.286 0.164 0.143 0.407 0.163 0.125 0.224 0.488 0.345 0.117 0.0475 0.491 0.335 0.132 0.0934 0.44 0.239 0.13 0.13 0.5 0.149 0.139 0.195 0.517 0.324 0.0775 0.12 0.479 0.25 0.14 0.05 0.56 0.426 0.0656 0.115 0.393 0.176 0.105 0.18 0.539 0.254 0.134 0.0504 0.562 0.233 0.156 0.0725 0.538 0.24 0.141 0.169 0.45 0.163 0.132 0.204 0.501 0.273 0.158 0.0714 0.497 0.288 0.179 0.0707 0.462 0.328 0.234 0.0312 0.406 0.144 0.147 0.229 0.48 0.273 0.145 [...]
+21 0.298 0.174 0.0585 0.47 0.276 0.121 0.0711 0.532 0.268 0.181 0.134 0.416 0.158 0.116 0.22 0.506 0.344 0.122 0.0312 0.503 0.327 0.127 0.0788 0.467 0.233 0.14 0.151 0.477 0.139 0.126 0.204 0.531 0.328 0.0902 0.115 0.467 0.25 0.148 0.0682 0.534 0.358 0.0755 0.132 0.434 0.171 0.0926 0.194 0.542 0.254 0.134 0.0376 0.574 0.226 0.142 0.0645 0.568 0.231 0.146 0.177 0.446 0.157 0.131 0.205 0.508 0.271 0.156 0.0678 0.505 0.26 0.178 0.0651 0.497 0.365 0.231 0.0385 0.365 0.146 0.148 0.238 0.468 [...]
+22 0.31 0.161 0.0532 0.475 0.276 0.124 0.0718 0.528 0.266 0.195 0.117 0.422 0.153 0.119 0.219 0.509 0.347 0.125 0.0264 0.502 0.355 0.129 0.0774 0.439 0.247 0.136 0.123 0.494 0.137 0.122 0.2 0.541 0.333 0.0808 0.101 0.485 0.247 0.143 0.0909 0.519 0.364 0.0909 0.136 0.409 0.176 0.0934 0.181 0.549 0.259 0.121 0.0278 0.592 0.237 0.128 0.0609 0.574 0.245 0.147 0.174 0.434 0.159 0.133 0.207 0.501 0.296 0.161 0.051 0.492 0.256 0.183 0.0667 0.494 0.35 0.225 0.05 0.375 0.154 0.166 0.23 0.45 0.29 [...]
+23 0.329 0.15 0.0405 0.48 0.285 0.121 0.0593 0.534 0.286 0.209 0.132 0.374 0.17 0.114 0.209 0.507 0.348 0.111 0.0222 0.519 0.331 0.149 0.0584 0.461 0.25 0.138 0.15 0.463 0.134 0.118 0.206 0.542 0.346 0.0864 0.0864 0.481 0.246 0.13 0.087 0.536 0.353 0.118 0.0882 0.441 0.173 0.109 0.179 0.538 0.255 0.113 0.0167 0.615 0.255 0.123 0.0488 0.573 0.243 0.151 0.16 0.445 0.158 0.139 0.201 0.501 0.328 0.152 0.035 0.485 0.253 0.172 0.0862 0.489 0.242 0.212 0.0909 0.455 0.165 0.168 0.227 0.44 0.3 0 [...]
+24 0.34 0.142 0.0268 0.491 0.276 0.126 0.0557 0.543 0.288 0.227 0.0909 0.394 0.18 0.117 0.218 0.485 0.362 0.0968 0.0179 0.523 0.331 0.152 0.0483 0.469 0.247 0.151 0.178 0.425 0.131 0.122 0.215 0.532 0.391 0.0938 0.109 0.406 0.254 0.102 0.102 0.542 0.379 0.103 0.138 0.379 0.174 0.124 0.165 0.537 0.25 0.0997 0.00949 0.641 0.259 0.118 0.0547 0.568 0.252 0.145 0.169 0.434 0.161 0.135 0.208 0.497 0.324 0.159 0.0268 0.49 0.251 0.177 0.0971 0.474 0.241 0.207 0.103 0.448 0.191 0.15 0.231 0.427 [...]
+25 0.332 0.143 0.0254 0.499 0.29 0.124 0.0473 0.538 0.296 0.222 0.13 0.352 0.182 0.113 0.209 0.496 0.347 0.0982 0.014 0.54 0.311 0.132 0.0596 0.497 0.219 0.137 0.205 0.438 0.129 0.127 0.21 0.534 0.4 0.109 0.0909 0.4 0.283 0.109 0.109 0.5 0.35 0.15 0.2 0.3 0.17 0.149 0.16 0.521 0.256 0.0925 0.00881 0.643 0.238 0.12 0.0508 0.591 0.248 0.143 0.163 0.446 0.153 0.14 0.205 0.502 0.329 0.164 0.0305 0.477 0.256 0.155 0.0893 0.5 0.182 0.227 0.136 0.455 0.188 0.14 0.247 0.425 0.328 0.152 0.0294 0 [...]
+26 0.317 0.133 0.019 0.531 0.269 0.123 0.0439 0.564 0.25 0.25 0.0893 0.411 0.171 0.106 0.194 0.529 0.329 0.0909 0.0105 0.57 0.297 0.142 0.0608 0.5 0.2 0.138 0.215 0.446 0.122 0.109 0.192 0.577 0.409 0.0909 0.0909 0.409 0.27 0.0811 0.108 0.541 0.4 0.15 0.2 0.25 0.145 0.171 0.158 0.526 0.233 0.0865 0.00851 0.672 0.23 0.114 0.056 0.6 0.246 0.135 0.148 0.47 0.135 0.13 0.201 0.534 0.319 0.165 0.0344 0.482 0.236 0.172 0.0955 0.497 0.136 0.227 0.136 0.5 0.172 0.135 0.234 0.458 0.307 0.161 0.02 [...]
+27 0.321 0.121 0.0166 0.542 0.27 0.117 0.0467 0.567 0.224 0.204 0.102 0.469 0.178 0.1 0.191 0.532 0.326 0.095 0.0124 0.566 0.291 0.157 0.0551 0.496 0.2 0.133 0.233 0.433 0.124 0.109 0.188 0.579 0.412 0.0882 0.0882 0.412 0.286 0.0857 0.114 0.514 0.294 0.176 0.235 0.294 0.153 0.169 0.203 0.475 0.226 0.0811 0.00954 0.684 0.238 0.119 0.0491 0.593 0.245 0.133 0.148 0.474 0.131 0.127 0.197 0.545 0.328 0.177 0.0285 0.467 0.243 0.169 0.0882 0.5 0.167 0.222 0.167 0.444 0.175 0.132 0.229 0.464 0. [...]
+28 0.307 0.12 0.0171 0.556 0.264 0.12 0.0465 0.57 0.229 0.2 0.143 0.429 0.178 0.101 0.182 0.539 0.324 0.0986 0.0141 0.563 0.287 0.157 0.0648 0.491 0.196 0.137 0.235 0.431 0.132 0.104 0.181 0.583 0.37 0.111 0.111 0.407 0.231 0.115 0.115 0.538 0.357 0.214 0.214 0.214 0.184 0.204 0.143 0.469 0.216 0.0782 0.0109 0.695 0.244 0.125 0.0538 0.578 0.25 0.128 0.136 0.485 0.127 0.127 0.198 0.549 0.331 0.174 0.0301 0.465 0.239 0.171 0.103 0.487 0.133 0.133 0.2 0.533 0.169 0.129 0.224 0.478 0.302 0. [...]
+29 0.305 0.118 0.0115 0.566 0.254 0.11 0.0431 0.593 0.219 0.219 0.125 0.438 0.179 0.0901 0.183 0.548 0.318 0.095 0.0168 0.57 0.258 0.146 0.0787 0.517 0.175 0.15 0.25 0.425 0.115 0.106 0.179 0.599 0.4 0.15 0.15 0.3 0.316 0.105 0.105 0.474 0.308 0.231 0.231 0.231 0.125 0.219 0.188 0.469 0.207 0.0809 0.0112 0.701 0.24 0.132 0.0521 0.576 0.228 0.13 0.136 0.506 0.118 0.119 0.193 0.571 0.306 0.173 0.0314 0.49 0.223 0.16 0.117 0.5 0.143 0.143 0.214 0.5 0.163 0.116 0.222 0.499 0.292 0.179 0.018 [...]
diff --git a/config/species/lamprey/lamprey_metapars.cfg b/config/species/coyote_tobacco/coyote_tobacco_metapars.cfg
similarity index 79%
copy from config/species/lamprey/lamprey_metapars.cfg
copy to config/species/coyote_tobacco/coyote_tobacco_metapars.cfg
index bce6670..811a8a0 100644
--- a/config/species/lamprey/lamprey_metapars.cfg
+++ b/config/species/coyote_tobacco/coyote_tobacco_metapars.cfg
@@ -1,6 +1,8 @@
-# This file contains the list of meta parameters which are subject to optimization.
-# All other parameters are chosen as given in the species parameter file. The order
-# of the parameters determines the order in the optimisation process.
+# This file contains the list of meta parameters for the coding regions (CDS) which are subject to optimization.
+# All other meta parameters are chosen as given in the species parameter file. The order
+# of the parameters determines the order in the optimization process.
+# Basically, different values for these meta parameters are tried out and the ones
+# giving best performance in a cross-validation on the training set are chosen.
# For each parameter the range of possible values is specified after the parameter
# name and at least one white space.
# 3 cases are possible for the range:
diff --git a/config/species/coyote_tobacco/coyote_tobacco_metapars.utr.cfg b/config/species/coyote_tobacco/coyote_tobacco_metapars.utr.cfg
new file mode 100644
index 0000000..07701bd
--- /dev/null
+++ b/config/species/coyote_tobacco/coyote_tobacco_metapars.utr.cfg
@@ -0,0 +1,30 @@
+# This file contains the list of meta parameters for the Untranslated Regions (UTRs), which are subject to optimization.
+# All other parameters are chosen as given in the species parameter file. The order
+# of the parameters determines the order in the optimization process.
+# Basically, different values for these meta parameters are tried out and the ones
+# giving best performance in a cross-validation on the training set are chosen.
+# For each parameter the range of possible values is specified after the parameter
+# name and at least one white space.
+# 3 cases are possible for the range:
+# - an explicit list is given, e.g. protein "on" "off"
+# - it is an integer range, e.g. window_size "1"-"5"
+# - it is a range of floating point numbers, e.g. pseudocount "0.3"_"1.8"
+#
+#
+# Mario Stanke, 9.5.2008
+#
+
+/UtrModel/prob_polya "0.0"_"1.0"
+/UtrModel/d_polya_cleavage_min "6"-"14"
+/UtrModel/d_polya_cleavage_max "17"-"27"
+/UtrModel/tss_start "0"-"12"
+/UtrModel/tss_end "0"-"8"
+/UtrModel/tts_motif_memory "0"-"2"
+/UtrModel/utr5patternweight "0.1"_"1.0"
+/UtrModel/utr3patternweight "0.1"_"1.0"
+/UtrModel/patpseudocount "1"_"3"
+/UtrModel/tssup_k "0"-"2"
+/UtrModel/slope_of_bandwidth "0.2"_"0.4"
+/UtrModel/minwindowcount "1"-"4"
+#/UtrModel/k "2"-"4"
+
diff --git a/config/species/lamprey/lamprey_parameters.cfg b/config/species/coyote_tobacco/coyote_tobacco_parameters.cfg
similarity index 58%
copy from config/species/lamprey/lamprey_parameters.cfg
copy to config/species/coyote_tobacco/coyote_tobacco_parameters.cfg
index 00f9d7c..ce6c3a3 100644
--- a/config/species/lamprey/lamprey_parameters.cfg
+++ b/config/species/coyote_tobacco/coyote_tobacco_parameters.cfg
@@ -1,16 +1,14 @@
#
-# lamprey parameters (Petromyzon marinus)
-# contributed by Falk Hildebrand and Shigehiro Kuraku
-# based on the genome assembly (PMAR3.0) provided by the Genome Sequencing Center at
-# Washington University School of Medicine (WUGSC) in St. Louis.
-# date : 28.01.2010
+# coyote_tobacco parameters.
+#
+# date : 20.3.2013
#
#
# Properties for augustus
#------------------------------------
/augustus/verbosity 3 # 0-3, 0: only print the neccessary
-maxDNAPieceSize 200000 # maximum segment that is predicted in one piece
+maxDNAPieceSize 500000 # maximum segment that is predicted in one piece
stopCodonExcludedFromCDS false # make this 'true' if the CDS includes the stop codon (training and prediction)
# gff output options:
@@ -28,13 +26,14 @@ checkExAcc off # internal parameter for extrinsic accuracy
# alternative transcripts and posterior probabilities
sample 100 # the number of sampling iterations
-alternatives-from-sampling false # output alternative transcripts
+alternatives-from-sampling false # output alternative suboptimal transcripts
+alternatives-from-evidence false # output alternative transcripts based on explicit evidence from hints
minexonintronprob 0.08 # minimal posterior probability of all (coding) exons
minmeanexonintronprob 0.4 # minimal geometric mean of the posterior probs of introns and exons
maxtracks -1 # maximum number of reported transcripts per gene (-1: no limit)
keep_viterbi true # set to true if all Viterbi transcripts should be reported
uniqueCDS true # don't report transcripts that differ only in the UTR
-UTR off # predict untranslated regions
+UTR on # predict untranslated regions
#
#
@@ -44,93 +43,93 @@ UTR off # predict untranslated regions
# global constants
# ----------------------------
-/Constant/trans_init_window 22
+/Constant/trans_init_window 20
/Constant/ass_upwindow_size 30
-/Constant/ass_start 1
-/Constant/ass_end 2
-/Constant/dss_start 1
-/Constant/dss_end 3
-/Constant/init_coding_len 1
-/Constant/intterm_coding_len 6
+/Constant/ass_start 2
+/Constant/ass_end 1
+/Constant/dss_start 2
+/Constant/dss_end 4
+/Constant/init_coding_len 15
+/Constant/intterm_coding_len 5
/Constant/tss_upwindow_size 45
/Constant/decomp_num_at 1
/Constant/decomp_num_gc 1
/Constant/gc_range_min 0.32 # This range has an effect only when decomp_num_steps>1.
/Constant/gc_range_max 0.73 # States the minimal and maximal percentage of c or g
-/Constant/decomp_num_steps 1
+/Constant/decomp_num_steps 1 # I recomment keeping this to 1 for most species.
/Constant/min_coding_len 201 # no gene with a coding sequence shorter than this is predicted
-/Constant/probNinCoding 0.23
-/Constant/amberprob 0.33 # Prob(stop codon = tag), if 0 tag is assumed to code for amino acid
-/Constant/ochreprob 0.33 # Prob(stop codon = taa), if 0 taa is assumed to code for amino acid
-/Constant/opalprob 0.34 # Prob(stop codon = tga), if 0 tga is assumed to code for amino acid
+/Constant/probNinCoding 0.23 # divide this by .25 to get a malus for making one masked letter part of the coding sequence
+/Constant/amberprob 0.225 # Prob(stop codon = tag), if 0 tag is assumed to code for amino acid
+/Constant/ochreprob 0.368 # Prob(stop codon = taa), if 0 taa is assumed to code for amino acid
+/Constant/opalprob 0.407 # Prob(stop codon = tga), if 0 tga is assumed to code for amino acid
/Constant/subopt_transcript_threshold 0.7
/Constant/almost_identical_maxdiff 10
# type of weighing, one of 1 = equalWeights, 2 = gcContentClasses, 3 = multiNormalKernel
/BaseCount/weighingType 3
# file with the weight matrix (only for multiNormalKernel type weighing)
-/BaseCount/weightMatrixFile lamprey_weightmatrix.txt # change this to your species if at all neccessary
+/BaseCount/weightMatrixFile coyote_tobacco_weightmatrix.txt # change this to your species if at all neccessary
# Properties for IGenicModel
# ----------------------------
/IGenicModel/verbosity 0
-/IGenicModel/infile lamprey_igenic_probs.pbl # change this and the other five filenames *_probs.pbl below to your species
-/IGenicModel/outfile lamprey_igenic_probs.pbl
+/IGenicModel/infile coyote_tobacco_igenic_probs.pbl # change this and the other five filenames *_probs.pbl below to your species
+/IGenicModel/outfile coyote_tobacco_igenic_probs.pbl.wech
/IGenicModel/patpseudocount 5.0
/IGenicModel/k 4 # order of the Markov chain for content model, keep equal to /ExonModel/k
-# Properties f�r ExonModel
+# Properties for ExonModel
# ----------------------------
/ExonModel/verbosity 3
-/ExonModel/infile lamprey_exon_probs.pbl
-/ExonModel/outfile lamprey_exon_probs.pbl
-/ExonModel/patpseudocount 5.0
+/ExonModel/infile coyote_tobacco_exon_probs.pbl
+/ExonModel/outfile coyote_tobacco_exon_probs.pbl.wech
+/ExonModel/patpseudocount 1.625
/ExonModel/minPatSum 233.3
/ExonModel/k 4 # order of the Markov chain for content model
/ExonModel/etorder 2
/ExonModel/etpseudocount 3
/ExonModel/exonlengthD 2000 # beyond this the distribution is geometric
/ExonModel/maxexonlength 15000
-/ExonModel/slope_of_bandwidth 0.325
-/ExonModel/minwindowcount 10
-/ExonModel/tis_motif_memory 2
-/ExonModel/tis_motif_radius 3
+/ExonModel/slope_of_bandwidth 0.4625
+/ExonModel/minwindowcount 8
+/ExonModel/tis_motif_memory 3
+/ExonModel/tis_motif_radius 2
# Properties for IntronModel
# ----------------------------
/IntronModel/verbosity 0
-/IntronModel/infile lamprey_intron_probs.pbl
-/IntronModel/outfile lamprey_intron_probs.pbl
+/IntronModel/infile coyote_tobacco_intron_probs.pbl
+/IntronModel/outfile coyote_tobacco_intron_probs.pbl.wech
/IntronModel/patpseudocount 5.0
/IntronModel/k 4 # order of the Markov chain for content model, keep equal to /ExonModel/k
/IntronModel/slope_of_bandwidth 0.4
/IntronModel/minwindowcount 4
-/IntronModel/asspseudocount 0.007875
-/IntronModel/dsspseudocount 0.0005
-/IntronModel/dssneighborfactor 0.00071875
-#/IntronModel/splicefile lamprey_splicefile.txt # this optional file contains additional windows around splice sites for training, uncomment if you have one
+/IntronModel/asspseudocount 0.00266
+/IntronModel/dsspseudocount 0.0076625
+/IntronModel/dssneighborfactor 0.00173
+#/IntronModel/splicefile coyote_tobacco_splicefile.txt # this optional file contains additional windows around splice sites for training, uncomment if you have one
/IntronModel/sf_with_motif false # if true the splice file is also used to train the branch point region
-/IntronModel/d 100
+/IntronModel/d 897 # constraint: this must be larger than 4 + /Constant/dss_end + /Constant/ass_upwindow_size + /Constant/ass_start
/IntronModel/ass_motif_memory 3
-/IntronModel/ass_motif_radius 4
+/IntronModel/ass_motif_radius 3
# Properties for UtrModel
# ----------------------------
/UtrModel/verbosity 3
-/UtrModel/infile lamprey_utr_probs.pbl
-/UtrModel/outfile lamprey_utr_probs.pbl
+/UtrModel/infile coyote_tobacco_utr_probs.pbl
+/UtrModel/outfile coyote_tobacco_utr_probs.pbl
/UtrModel/k 4
-/UtrModel/utr5patternweight 0
-/UtrModel/utr3patternweight 1.0
+/UtrModel/utr5patternweight 0.5
+/UtrModel/utr3patternweight 0.1
/UtrModel/patpseudocount 1
/UtrModel/tssup_k 0
/UtrModel/tssup_patpseudocount 1
/UtrModel/slope_of_bandwidth 0.2375
/UtrModel/minwindowcount 3
/UtrModel/exonlengthD 800
-/UtrModel/maxexonlength 1800
-/UtrModel/max3singlelength 1800
-/UtrModel/max3termlength 1800
+/UtrModel/maxexonlength 900
+/UtrModel/max3singlelength 1000
+/UtrModel/max3termlength 1000
/UtrModel/tss_start 8
/UtrModel/tss_end 5
/UtrModel/tata_start 2
@@ -138,7 +137,9 @@ UTR off # predict untranslated regions
/UtrModel/tata_pseudocount 2
/UtrModel/d_tss_tata_min 26 # minimal distance between start of tata box (if existent) and tss
/UtrModel/d_tss_tata_max 37 # maximal distance between start of tata box (if existent) and tss
+/UtrModel/polyasig_consensus aataaa # polyadenylation signal training not fully automated yet
/UtrModel/d_polyasig_cleavage 14 # the transcription end is predicted this many bases after the polyadenylation signal
-/UtrModel/d_polya_cleavage_min 7
-/UtrModel/d_polya_cleavage_max 17
-/UtrModel/prob_polya 0.4
+/UtrModel/d_polya_cleavage_min 10
+/UtrModel/d_polya_cleavage_max 10
+/UtrModel/prob_polya 0.0 # there does not appear to be a polyA signal in coyote tobacco
+/UtrModel/tts_motif_memory 1
diff --git a/config/species/coyote_tobacco/coyote_tobacco_trans_shadow_partial_utr.pbl b/config/species/coyote_tobacco/coyote_tobacco_trans_shadow_partial_utr.pbl
new file mode 100644
index 0000000..0464ee1
--- /dev/null
+++ b/config/species/coyote_tobacco/coyote_tobacco_trans_shadow_partial_utr.pbl
@@ -0,0 +1,529 @@
+#
+# transition probabilities and initial probabilities for the overall HMM
+# number of states
+71
+#
+# Transition probabilities of the Generalised Hidden-Markov Model
+# Date: 14.10.2006
+
+# Initial probabilities (a priori probs for a state ending at a
+# certain position, e.g. the position before the first nucleotide in
+# the sequence
+# only non-zero probabilities
+[Initial]
+# number of states where a start is possible
+71
+# state prob statename
+0 .788 # start intergenic region
+1 .001 # single Exon
+2 .001 # initial Exon win 0
+3 .001 # initial Exon win 1
+4 .001 # initial Exon win 2
+5 .001 # internal Exon win 0
+6 .001 # internal Exon win 1
+7 .001 # internal Exon win 2
+8 .001 # terminal exon
+9 .001 # lessD0 Intron win 0
+10 .001 #
+11 .001 #
+12 .01 # geometric0 Intron win 0
+13 .001 #
+14 .001 #
+15 .001 #
+16 .001 #
+17 .01 # geometric1 Intron win 1
+18 .001 #
+19 .001 #
+20 .001 #
+21 .001 #
+22 .01 # geometric2 Intron win 2
+23 .001 #
+24 .012 # 5' UTR single exon
+25 .001 # 5' UTR initial exon
+26 .02 # 5' UTR intron single base
+27 .0 # 5' UTR intron variable length
+28 .001 # 5' UTR internal exon
+29 .006 # 5' UTR terminal exon
+30 .001 # 3' UTR single exon
+31 .001 # 3' UTR initial exon
+32 .02 # 3' UTR intron single base
+33 .0 # 3' UTR intron variable length
+34 .001 # 3' UTR internal exon
+35 .001 # 3' UTR terminal exon
+36 .001 # reverse single Exon
+37 .001 # reverse initial Exon
+38 .001 # reverse internal Exon win 0
+39 .001 # reverse internal Exon win 1
+40 .001 # reverse internal Exon win 2
+41 .001 # reverse terminal exon win 0
+42 .001 # reverse terminal exon win 1
+43 .001 # reverse terminal exon win 2
+44 .001 # reverse lessD0 Intron win 0
+45 .001 # reverse
+46 .001 # reverse
+47 .01 # reverse geometric0 Intron win 0
+48 .001 # reverse
+49 .001 # reverse
+50 .001 # reverse
+51 .001 # reverse
+52 .01 # reverse geometric1 Intron win 1
+53 .001 # reverse
+54 .001 # reverse
+55 .001 # reverse
+56 .001 # reverse
+57 .01 # reverse geometric2 Intron win 2
+58 .001 # reverse
+59 .001 # reverse 5' UTR single exon
+60 .001 # reverse 5' UTR initial exon
+61 .02 # reverse 5' UTR intron single base
+62 .0 # reverse 5' UTR intron variable length
+63 .001 # reverse 5' UTR internal exon
+64 .001 # reverse 5' UTR terminal exon
+65 .001 # reverse 3' UTR single exon
+66 .001 # reverse 3' UTR initial exon
+67 .02 # reverse 3' UTR intron single base
+68 .0 # reverse 3' UTR intron variable length
+69 .001 # reverse 3' UTR internal exon
+70 .001 # reverse 3' UTR terminal exon
+
+
+
+# Terminal probabilities (a priori probs for a state ending at
+# the last position.
+# only non-zero probabilities neccessary
+[Terminal]
+# number of states where terminating is possible
+71
+# state prob statename
+0 .76 # start intergenic region
+1 .003 # single Exon
+2 .001 # initial Exon win 0
+3 .001 # initial Exon win 1
+4 .001 # initial Exon win 2
+5 .001 # internal Exon win 0
+6 .001 # internal Exon win 1
+7 .001 # internal Exon win 2
+8 .003 # terminal exon
+9 .001 # lessD0 Intron win 0
+10 .001 #
+11 .001 #
+12 .009 # geometric0 Intron win 0
+13 .001 #
+14 .001 #
+15 .001 #
+16 .001 #
+17 .009 # geometric1 Intron win 1
+18 .001 #
+19 .001 #
+20 .001 #
+21 .001 #
+22 .009 # geometric2 Intron win 2
+23 .001 #
+24 .001 # 5' UTR single exon
+25 .001 # 5' UTR initial exon
+26 .02 # 5' UTR intron single base
+27 .0 # 5' UTR intron variable length
+28 .001 # 5' UTR internal exon
+29 .001 # 5' UTR terminal exon
+30 .01 # 3' UTR single exon
+31 .005 # 3' UTR initial exon
+32 .02 # 3' UTR intron single base
+33 .0 # 3' UTR intron variable length
+34 .003 # 3' UTR internal exon
+35 .004 # 3' UTR terminal exon
+36 .003 # reverse single Exon
+37 .003 # reverse initial Exon
+38 .001 # reverse internal Exon win 0
+39 .001 # reverse internal Exon win 1
+40 .001 # reverse internal Exon win 2
+41 .001 # reverse terminal exon win 0
+42 .001 # reverse terminal exon win 1
+43 .001 # reverse terminal exon win 2
+44 .001 # reverse lessD0 Intron win 0
+45 .001 # reverse
+46 .001 # reverse
+47 .009 # reverse geometric0 Intron win 0
+48 .001 # reverse
+49 .001 # reverse
+50 .001 # reverse
+51 .001 # reverse
+52 .009 # reverse geometric1 Intron win 1
+53 .001 # reverse
+54 .001 # reverse
+55 .001 # reverse
+56 .001 # reverse
+57 .009 # reverse geometric2 Intron win 2
+58 .001 # reverse
+59 .012 # reverse 5' UTR single exon
+60 .004 # reverse 5' UTR initial exon
+61 .02 # reverse 5' UTR intron single base
+62 .0 # reverse 5' UTR intron variable length
+63 .003 # reverse 5' UTR internal exon
+64 .001 # reverse 5' UTR terminal exon
+65 .001 # reverse 3' UTR single exon
+66 .001 # reverse 3' UTR initial exon
+67 .01 # reverse 3' UTR intron single base
+68 .0 # reverse 3' UTR intron variable length
+69 .001 # reverse 3' UTR internal exon
+70 .001 # reverse 3' UTR terminal exon
+
+#
+# Transition probabilities
+# only non-zero probabilities
+[Transition]
+# ----- Igenic region -----
+# intergenic region
+0 0 .9999
+# 5' UTR single exon
+0 24 .00003
+# 5' UTR initial exon
+0 25 .00002
+# reverse 3' UTR single exon
+0 65 .00004
+# reverse 3' UTR terminal exon
+0 70 .00001
+# ----- Single Exon -----
+# intergenic region
+#1 0 1.0
+# 3' UTR single exon
+1 30 0.8
+# 3' UTR initial exon
+1 31 0.2
+# ----- Initial Exon 0 -----
+# longdss0 Intron
+2 10 1.0
+# ----- Initial Exon 1 -----
+# longdss1 Intron
+3 15 1.0
+# ----- Initial Exon 2 -----
+# longdss2 Intron
+4 20 1.0
+# ----- Internal Exon 0 -----
+# longdss0 Intron
+5 10 1.0
+# ----- Internal Exon 1 -----
+# longdss1 Intron
+6 15 1.0
+# ----- Internal Exon 2 -----
+# longdss2 Intron
+7 20 1.0
+# ----- Terminal Exon -----
+# 3' UTR single exon
+8 30 0.8
+# 3' UTR initial exon
+8 31 0.2
+# ----- lessD0 Intron 0 -----
+# longass0
+9 13 1.0
+# ----- longdss0 Intron 0 -----
+# lessD0
+10 9 .5
+# equalD0
+10 11 .5
+# ----- equalD0 Intron 0 -----
+# geometric0
+11 12 1.0
+# ----- geometric0 Intron 0 -----
+# geometric0 intron
+12 12 .9997447
+# longass0
+12 13 .0002553
+# ----- longass0 Intron 0 -----
+# internal exon 0, 45% of all internal exons
+13 5 .3
+# internal exon 1, 33% of all internal exons
+13 6 .3
+# internal exon 2, 22% of all internal exons
+13 7 .3
+# terminal exon
+13 8 .1
+# ----- lessD1 Intron 1 -----
+# longass1
+14 18 1.0
+# ----- longdss1 Intron 1 -----
+# lessD1
+15 14 .5
+# equalD1
+15 16 .5
+# ----- equalD1 Intron 1 -----
+# geometric1
+16 17 1.0
+# ----- geometric1 Intron 1 -----
+# geometric1 intron
+17 17 .9997447
+# longass1
+17 18 .0002553
+# ----- longass1 Intron 1 -----
+# internal exon 0, 45% of all internal exons
+18 5 .3
+# internal exon 1, 33% of all internal exons
+18 6 .3
+# internal exon 2, 22% of all internal exons
+18 7 .3
+# terminal exon
+18 8 .1
+# ----- lessD2 Intron 2 -----
+# longass2
+19 23 1.0
+# ----- longdss2 Intron 2 -----
+# lessD2
+20 19 .5
+# equalD2
+20 21 .5
+# ----- equalD2 Intron 2 -----
+# geometric0
+21 22 1.0
+# ----- geometric2 Intron 2 -----
+# geometric2 intron
+22 22 .9997447
+# longass2
+22 23 .0002553
+# ----- longass2 Intron 2 -----
+# internal exon 0, 45% of all internal exons
+23 5 .3
+# internal exon 1, 33% of all internal exons
+23 6 .3
+# internal exon 2, 22% of all internal exons
+23 7 .3
+# terminal exon
+23 8 .1
+# ----- 5' UTR single exon -----
+# single
+24 1 .18
+# initial exon 0
+24 2 .28
+# initial exon 1
+24 3 .28
+# initial exon 2
+24 4 .26
+# ----- 5' UTR initial exon -----
+# 5' UTR intron single base
+25 26 1.0
+# 5' UTR intron variable length
+25 27 1.0
+# ----- 5' UTR intron single base -----
+# 5' UTR intron
+26 26 .9995
+# 5' UTR internal exon
+26 28 .00005
+# 5' UTR terminal exon
+26 29 .00045
+# ----- 5' UTR intron variable length ----
+# 5' UTR internal exon
+27 28 .1
+# 5' UTR terminal exon
+27 29 .9
+# ----- 5' UTR internal exon -----
+# 5' UTR intron single base
+28 26 0.01
+# 5' UTR intron variable length
+28 27 0.01
+# ----- 5' UTR terminal exon -----
+# single
+29 1 .18
+# initial exon 0
+29 2 .28
+# initial exon 1
+29 3 .28
+# initial exon 2
+29 4 .26
+# ----- 3' UTR single exon -----
+# intergenic region
+30 0 1.0
+# ----- 3' UTR initial exon -----
+# 3' UTR intron single base
+31 32 1.0
+# 3' UTR intron variable length
+31 33 1.0
+# ----- 3' UTR intron single base -----
+# 3' UTR intron single base
+32 32 .9995
+# 3' UTR internal exon
+32 34 .00005
+# 3' UTR terminal exon
+32 35 .00045
+# ----- 3' UTR intron variable length -----
+# 3' UTR internal exon
+33 34 .1
+# 3' UTR terminal exon
+33 35 .9
+# ----- 3' UTR internal exon -----
+# 3' UTR intron single base
+34 32 0.01
+# 3' UTR intron variable length
+34 33 0.01
+# ----- 3' UTR terminal exon -----
+# intergenic region
+35 0 1.0
+#
+# ------------------------ reverse strand --------------------------
+#
+# ----- reverse Single Exon -----
+# reverse 5' UTR single exon
+36 59 .6
+# reverse 5' UTR terminal exon
+36 64 .4
+# ----- reverse Initial Exon -----
+# reverse 5' UTR single exon
+37 59 .6
+# reverse 5' UTR terminal exon
+37 64 .4
+# ----- reverse Internal Exon 0 -----
+# reverse longass0
+38 48 1.0
+# ----- reverse Internal Exon 1 -----
+# reverse longass1
+39 53 1.0
+# ----- reverse Internal Exon 2 -----
+# reverse longass2
+40 58 1.0
+# ----- reverse Terminal Exon 0 -----
+# reverse longass0
+41 48 1.0
+# ----- reverse Terminal Exon 1 -----
+# reverse longass1
+42 53 1.0
+# ----- reverse Terminal Exon 2 -----
+# reverse longass2
+43 58 1.0
+# ----- reverse lessD0 Intron 0 -----
+# longdss0
+44 45 1.0
+# ----- reverse longdss0 Intron 0 -----
+# reverse internal exon 0, 45% of all internal exons
+45 38 .3
+# reverse internal exon 1, 33% of all internal exons
+45 39 .3
+# reverse internal exon 2, 22% of all internal exons
+45 40 .3
+# reverse initial exon
+45 37 .1
+# ----- reverse equalD0 Intron 0 -----
+# reverse geometric0
+46 47 1.0
+# ----- reverse geometric0 Intron 0 -----
+# reverse geometric0 intron
+47 47 .9997447
+# reverse longdss0
+47 45 .0002553
+# ----- reverse longass0 Intron 0 -----
+# reverse intron equalD0
+48 46 .5
+# reverse intron lessD0
+48 44 .5
+# ----- reverse lessD1 Intron 1 -----
+# longdss1
+49 50 1.0
+# ----- reverse longdss1 Intron 1 -----
+# reverse internal exon 0, 45% of all internal exons
+50 38 .3
+# reverse internal exon 1, 33% of all internal exons
+50 39 .3
+# reverse internal exon 2, 22% of all internal exons
+50 40 .3
+# reverse initial exon
+50 37 .1
+# ----- reverse equalD1 Intron 1 -----
+# reverse geometric1
+51 52 1.0
+# ----- reverse geometric1 Intron 1 -----
+# reverse geometric1 intron
+52 52 .9997447
+# reverse longdss1
+52 50 .0002553
+# ----- reverse longass1 Intron 1 -----
+# reverse intron equalD1
+53 51 .5
+# reverse intron lessD1
+53 49 .5
+# ----- reverse lessD2 Intron 2 -----
+# longdss2
+54 55 1.0
+# ----- reverse longdss2 Intron 2 -----
+# reverse internal exon 0, 45% of all internal exons
+55 38 .3
+# reverse internal exon 1, 33% of all internal exons
+55 39 .3
+# reverse internal exon 2, 22% of all internal exons
+55 40 .3
+# reverse initial exon
+55 37 .1
+# ----- reverse equalD2 Intron 2 -----
+# reverse geometric2
+56 57 1.0
+# ----- reverse geometric2 Intron 2 -----
+# reverse geometric2 intron
+57 57 .9997447
+# reverse longdss2
+57 55 .0002553
+# ----- reverse longass2 Intron 2 -----
+# reverse intron equalD2
+58 56 .5
+# reverse intron lessD2
+58 54 .5
+# ----- reverse 5' UTR single exon -----
+59 0 1.0
+# ----- reverse 5' UTR initial exon -----
+60 0 1.0
+# ----- reverse 5' UTR intron single base -----
+# reverse 5' UTR intron
+61 61 .9995
+# reverse 5' UTR internal exon
+61 63 .00005
+# reverse 5' UTR initial exon
+61 60 .00045
+# ----- reverse 5' UTR intron variable length -----
+# reverse 5' UTR internal exon
+62 63 .1
+# reverse 5' UTR initial exon
+62 60 .9
+# ----- reverse 5' UTR internal exon -----
+# revserse 5' UTR intron single base
+63 61 0.01
+# revserse 5' UTR intron variable length
+63 62 0.01
+# ----- reverse 5' UTR terminal exon -----
+# revserse 5' UTR intron single base
+64 61 1.0
+# revserse 5' UTR intron variable length
+64 62 1.0
+# ----- reverse 3' UTR single exon -----
+# reverse single exon
+65 36 .18
+# reverse terminal exon 0
+65 41 .28
+# reverse terminal exon 1
+65 42 .28
+# reverse terminal exon 2
+65 43 .26
+# ----- reverse 3' UTR initial exon -----
+# reverse single exon
+66 36 .18
+# reverse terminal exon 0
+66 41 .28
+# reverse terminal exon 1
+66 42 .28
+# reverse terminal exon 2
+66 43 .26
+# ----- reverse 3' UTR intron single base -----
+# reverse 3' UTR intron
+67 67 .9995
+# reverse 3' UTR internal exon
+67 69 .00005
+# reverse 3' UTR initial exon
+67 66 .00045
+# ----- reverse 3' UTR intron variable length -----
+# reverse 3' UTR internal exon
+68 69 .1
+# reverse 3' UTR initial exon
+68 66 .9
+# ----- reverse 3' UTR internal exon -----
+# reverse 3' intron single base
+69 67 0.01
+# reverse 3' intron variable length
+69 68 0.01
+# ----- reverse 3' UTR terminal exon -----
+# reverse 3' intron single base
+70 67 1.0
+# reverse 3' intron variable length
+70 68 1.0
diff --git a/config/species/coyote_tobacco/coyote_tobacco_utr_probs.pbl b/config/species/coyote_tobacco/coyote_tobacco_utr_probs.pbl
new file mode 100644
index 0000000..db841e7
--- /dev/null
+++ b/config/species/coyote_tobacco/coyote_tobacco_utr_probs.pbl
@@ -0,0 +1,4037 @@
+# UTR model parameters
+# begin of content independent part
+
+# Length distributions
+[UTRLENGTH]
+# maximal individually stored length probability d=
+800
+# slope of smoothing bandwidth =
+0.2375
+# smoothing minwindowcount =
+3
+# length 5' sing 5' init 5' int 5' term 3' sing 3' init 3' int 3' term
+# total number of exons of above types
+ 147 17 2 17 131 2 0 2
+# number of exons exceeding length d=800
+ 1 0 0 0 0 0 0 0
+# 1000 P(len=k), k=0,1,..., 800
+0 0.111 0.02 1.29 5.07 1.28 1.24 0 1.08
+1 0.168 0.0202 1.29 5.6 1.56 1.24 0 1.08
+2 0.247 0.0204 1.29 6.13 1.84 1.24 0 1.08
+3 0.353 0.0207 1.29 6.68 2.12 1.24 0 1.08
+4 0.489 0.021 1.29 7.22 2.37 1.24 0 1.08
+5 0.659 0.0213 1.29 7.77 2.59 1.25 0 1.08
+6 0.865 0.0216 1.29 8.32 2.75 1.25 0 1.08
+7 1.11 0.0219 1.29 8.85 2.86 1.25 0 1.08
+8 1.38 0.0223 1.29 9.38 2.91 1.25 0 1.08
+9 1.69 0.0227 1.29 9.9 2.9 1.25 0 1.08
+10 2.01 0.0231 1.29 10.4 2.84 1.25 0 1.08
+11 2.33 0.0236 1.29 10.9 2.74 1.25 0 1.08
+12 2.63 0.0241 1.29 11.5 2.61 1.25 0 1.08
+13 2.89 0.0247 1.29 12.2 2.46 1.25 0 1.08
+14 3.09 0.0253 1.29 13 2.31 1.25 0 1.08
+15 3.21 0.0261 1.29 14.2 2.16 1.25 0 1.08
+16 3.25 0.0269 1.29 15.7 2.03 1.25 0 1.08
+17 3.21 0.0278 1.29 17.9 1.9 1.25 0 1.08
+18 3.11 0.0289 1.29 20.7 1.8 1.25 0 1.08
+19 2.98 0.03 1.29 24 1.71 1.25 0 1.08
+20 2.83 0.0314 1.29 27.5 1.63 1.25 0 1.08
+21 2.72 0.0329 1.29 30.5 1.57 1.25 0 1.08
+22 2.67 0.0346 1.29 32.5 1.52 1.25 0 1.08
+23 2.72 0.0365 1.29 33.2 1.48 1.25 0 1.08
+24 2.9 0.0387 1.29 32.4 1.45 1.25 0 1.08
+25 3.23 0.0411 1.29 30.5 1.42 1.25 0 1.08
+26 3.67 0.0439 1.29 27.7 1.4 1.25 0 1.08
+27 4.14 0.047 1.29 24.5 1.38 1.25 0 1.09
+28 4.54 0.0506 1.29 21.2 1.37 1.25 0 1.09
+29 4.77 0.0545 1.29 18.2 1.36 1.25 0 1.09
+30 4.84 0.059 1.29 15.5 1.34 1.25 0 1.09
+31 4.82 0.064 1.29 13.1 1.33 1.25 0 1.09
+32 4.89 0.0696 1.29 11.2 1.31 1.25 0 1.09
+33 5.19 0.0758 1.29 9.74 1.3 1.25 0 1.09
+34 5.78 0.0827 1.29 8.62 1.28 1.25 0 1.09
+35 6.57 0.0904 1.29 7.82 1.25 1.25 0 1.09
+36 7.38 0.0989 1.29 7.28 1.23 1.25 0 1.09
+37 8.01 0.108 1.29 6.94 1.21 1.25 0 1.09
+38 8.32 0.119 1.29 6.74 1.2 1.25 0 1.09
+39 8.29 0.13 1.29 6.65 1.19 1.25 0 1.09
+40 8 0.143 1.29 6.62 1.21 1.25 0 1.09
+41 7.57 0.157 1.29 6.64 1.24 1.25 0 1.09
+42 7.07 0.172 1.29 6.67 1.31 1.25 0 1.09
+43 6.55 0.188 1.29 6.71 1.41 1.25 0 1.09
+44 6.04 0.206 1.29 6.73 1.56 1.25 0 1.09
+45 5.61 0.225 1.29 6.73 1.77 1.25 0 1.09
+46 5.33 0.246 1.29 6.72 2.03 1.25 0 1.09
+47 5.32 0.269 1.29 6.67 2.36 1.25 0 1.09
+48 5.64 0.294 1.29 6.61 2.76 1.25 0 1.09
+49 6.28 0.32 1.29 6.52 3.2 1.25 0 1.09
+50 7.19 0.348 1.29 6.41 3.67 1.25 0 1.09
+51 8.25 0.378 1.29 6.29 4.13 1.25 0 1.09
+52 9.32 0.411 1.29 6.15 4.53 1.25 0 1.09
+53 10.3 0.445 1.29 6 4.83 1.25 0 1.09
+54 11 0.482 1.29 5.85 4.98 1.25 0 1.09
+55 11.6 0.521 1.29 5.7 4.97 1.25 0 1.09
+56 11.8 0.563 1.29 5.55 4.79 1.25 0 1.09
+57 11.9 0.607 1.29 5.41 4.48 1.25 0 1.09
+58 11.7 0.653 1.29 5.27 4.08 1.25 0 1.09
+59 11.6 0.703 1.29 5.14 3.67 1.25 0 1.1
+60 11.4 0.755 1.29 5.02 3.28 1.25 0 1.1
+61 11.2 0.811 1.29 4.92 2.97 1.25 0 1.1
+62 11 0.87 1.29 4.82 2.74 1.25 0 1.1
+63 10.9 0.932 1.29 4.74 2.61 1.25 0 1.1
+64 10.7 0.998 1.29 4.67 2.57 1.25 0 1.1
+65 10.5 1.07 1.29 4.61 2.6 1.25 0 1.1
+66 10.3 1.14 1.29 4.56 2.69 1.26 0 1.1
+67 9.99 1.22 1.29 4.52 2.83 1.26 0 1.1
+68 9.65 1.3 1.29 4.48 2.99 1.26 0 1.1
+69 9.28 1.39 1.29 4.46 3.19 1.26 0 1.1
+70 8.9 1.49 1.29 4.43 3.4 1.26 0 1.1
+71 8.52 1.59 1.29 4.41 3.62 1.26 0 1.1
+72 8.16 1.7 1.29 4.4 3.84 1.26 0 1.1
+73 7.83 1.81 1.29 4.38 4.07 1.26 0 1.1
+74 7.54 1.93 1.29 4.37 4.28 1.26 0 1.1
+75 7.3 2.07 1.29 4.35 4.48 1.26 0 1.1
+76 7.11 2.2 1.29 4.34 4.65 1.26 0 1.1
+77 6.97 2.35 1.29 4.32 4.8 1.26 0 1.1
+78 6.89 2.51 1.29 4.3 4.92 1.26 0 1.1
+79 6.85 2.68 1.29 4.28 5.01 1.26 0 1.1
+80 6.86 2.85 1.29 4.25 5.08 1.26 0 1.1
+81 6.91 3.04 1.29 4.23 5.12 1.26 0 1.1
+82 6.98 3.23 1.29 4.19 5.14 1.26 0 1.1
+83 7.07 3.44 1.29 4.16 5.15 1.26 0 1.1
+84 7.16 3.65 1.29 4.12 5.15 1.26 0 1.1
+85 7.24 3.88 1.29 4.08 5.15 1.26 0 1.1
+86 7.31 4.11 1.29 4.04 5.15 1.26 0 1.1
+87 7.35 4.35 1.29 3.99 5.16 1.26 0 1.1
+88 7.37 4.59 1.29 3.94 5.17 1.26 0 1.1
+89 7.34 4.84 1.29 3.88 5.18 1.26 0 1.1
+90 7.28 5.1 1.29 3.82 5.2 1.26 0 1.1
+91 7.2 5.36 1.29 3.76 5.23 1.26 0 1.1
+92 7.08 5.62 1.29 3.7 5.26 1.26 0 1.1
+93 6.94 5.88 1.29 3.63 5.29 1.26 0 1.1
+94 6.79 6.14 1.29 3.56 5.33 1.26 0 1.1
+95 6.63 6.4 1.29 3.48 5.36 1.26 0 1.1
+96 6.46 6.66 1.29 3.41 5.38 1.26 0 1.1
+97 6.29 6.91 1.29 3.33 5.4 1.26 0 1.1
+98 6.12 7.16 1.29 3.25 5.41 1.26 0 1.1
+99 5.96 7.4 1.29 3.17 5.41 1.26 0 1.11
+100 5.8 7.63 1.29 3.09 5.39 1.26 0 1.11
+101 5.64 7.86 1.29 3.01 5.35 1.26 0 1.11
+102 5.49 8.08 1.29 2.93 5.3 1.26 0 1.11
+103 5.34 8.29 1.29 2.84 5.22 1.26 0 1.11
+104 5.19 8.49 1.29 2.76 5.13 1.26 0 1.11
+105 5.05 8.68 1.29 2.68 5.02 1.26 0 1.11
+106 4.92 8.87 1.29 2.59 4.89 1.26 0 1.11
+107 4.79 9.04 1.29 2.51 4.75 1.26 0 1.11
+108 4.66 9.21 1.29 2.43 4.59 1.26 0 1.11
+109 4.54 9.37 1.29 2.35 4.43 1.26 0 1.11
+110 4.43 9.52 1.29 2.27 4.27 1.26 0 1.11
+111 4.32 9.67 1.29 2.2 4.1 1.26 0 1.11
+112 4.22 9.81 1.29 2.12 3.93 1.26 0 1.11
+113 4.13 9.94 1.29 2.05 3.77 1.26 0 1.11
+114 4.04 10.1 1.29 1.98 3.62 1.26 0 1.11
+115 3.96 10.2 1.29 1.91 3.48 1.26 0 1.11
+116 3.89 10.3 1.29 1.84 3.36 1.26 0 1.11
+117 3.82 10.4 1.29 1.77 3.25 1.26 0 1.11
+118 3.76 10.5 1.29 1.71 3.15 1.26 0 1.11
+119 3.7 10.6 1.29 1.65 3.08 1.26 0 1.11
+120 3.64 10.7 1.29 1.59 3.02 1.26 0 1.11
+121 3.6 10.8 1.29 1.54 2.98 1.26 0 1.11
+122 3.55 10.8 1.29 1.49 2.96 1.26 0 1.11
+123 3.51 10.9 1.29 1.44 2.95 1.26 0 1.11
+124 3.48 10.9 1.29 1.39 2.96 1.26 0 1.11
+125 3.44 11 1.29 1.34 2.99 1.26 0 1.11
+126 3.41 11 1.29 1.3 3.02 1.26 0 1.11
+127 3.38 11 1.29 1.26 3.06 1.26 0 1.11
+128 3.35 11 1.29 1.22 3.12 1.26 0 1.11
+129 3.33 11 1.29 1.18 3.17 1.26 0 1.11
+130 3.3 11 1.29 1.15 3.24 1.26 0 1.11
+131 3.27 10.9 1.29 1.11 3.3 1.26 0 1.11
+132 3.24 10.9 1.29 1.08 3.37 1.26 0 1.11
+133 3.2 10.8 1.29 1.05 3.44 1.26 0 1.11
+134 3.17 10.7 1.29 1.02 3.5 1.26 0 1.11
+135 3.13 10.6 1.29 0.997 3.57 1.26 0 1.11
+136 3.09 10.5 1.29 0.972 3.63 1.26 0 1.11
+137 3.05 10.4 1.29 0.948 3.68 1.26 0 1.11
+138 3.01 10.3 1.29 0.925 3.73 1.26 0 1.11
+139 2.96 10.2 1.29 0.903 3.77 1.26 0 1.11
+140 2.92 10 1.29 0.883 3.81 1.26 0 1.11
+141 2.87 9.9 1.29 0.863 3.84 1.26 0 1.11
+142 2.82 9.75 1.29 0.845 3.86 1.26 0 1.11
+143 2.78 9.6 1.29 0.827 3.87 1.26 0 1.11
+144 2.74 9.43 1.29 0.81 3.87 1.26 0 1.11
+145 2.69 9.27 1.29 0.794 3.87 1.26 0 1.11
+146 2.65 9.1 1.29 0.778 3.86 1.26 0 1.11
+147 2.62 8.93 1.29 0.763 3.83 1.26 0 1.11
+148 2.58 8.76 1.29 0.748 3.81 1.26 0 1.11
+149 2.55 8.59 1.29 0.734 3.77 1.26 0 1.11
+150 2.53 8.42 1.29 0.72 3.73 1.26 0 1.11
+151 2.5 8.25 1.29 0.707 3.69 1.26 0 1.11
+152 2.48 8.08 1.29 0.694 3.63 1.26 0 1.11
+153 2.47 7.91 1.28 0.682 3.58 1.26 0 1.11
+154 2.45 7.74 1.28 0.669 3.52 1.26 0 1.11
+155 2.44 7.58 1.28 0.657 3.46 1.26 0 1.11
+156 2.43 7.42 1.28 0.646 3.39 1.26 0 1.11
+157 2.43 7.26 1.28 0.634 3.32 1.26 0 1.11
+158 2.42 7.11 1.28 0.623 3.25 1.26 0 1.11
+159 2.42 6.95 1.28 0.612 3.18 1.26 0 1.12
+160 2.42 6.8 1.28 0.601 3.12 1.26 0 1.12
+161 2.42 6.65 1.28 0.591 3.05 1.26 0 1.12
+162 2.42 6.51 1.28 0.58 2.98 1.26 0 1.12
+163 2.42 6.37 1.28 0.57 2.91 1.26 0 1.12
+164 2.42 6.23 1.28 0.56 2.85 1.26 0 1.12
+165 2.42 6.09 1.28 0.55 2.79 1.26 0 1.12
+166 2.41 5.96 1.28 0.541 2.73 1.26 0 1.12
+167 2.41 5.82 1.28 0.531 2.67 1.26 0 1.12
+168 2.41 5.69 1.28 0.522 2.62 1.26 0 1.12
+169 2.41 5.56 1.28 0.512 2.57 1.26 0 1.12
+170 2.4 5.43 1.28 0.503 2.52 1.26 0 1.12
+171 2.4 5.31 1.28 0.494 2.48 1.26 0 1.12
+172 2.39 5.18 1.28 0.485 2.44 1.26 0 1.12
+173 2.38 5.06 1.28 0.477 2.41 1.26 0 1.12
+174 2.37 4.93 1.28 0.468 2.38 1.26 0 1.12
+175 2.36 4.81 1.28 0.459 2.36 1.26 0 1.12
+176 2.35 4.69 1.28 0.451 2.34 1.25 0 1.12
+177 2.33 4.57 1.28 0.443 2.32 1.25 0 1.12
+178 2.32 4.45 1.28 0.435 2.31 1.25 0 1.12
+179 2.3 4.33 1.28 0.426 2.3 1.25 0 1.12
+180 2.28 4.22 1.28 0.419 2.29 1.25 0 1.12
+181 2.26 4.1 1.28 0.411 2.29 1.25 0 1.12
+182 2.24 3.99 1.28 0.403 2.29 1.25 0 1.12
+183 2.22 3.87 1.28 0.395 2.3 1.25 0 1.12
+184 2.19 3.76 1.28 0.388 2.31 1.25 0 1.12
+185 2.16 3.64 1.28 0.38 2.32 1.25 0 1.12
+186 2.14 3.53 1.28 0.373 2.33 1.25 0 1.12
+187 2.11 3.42 1.28 0.366 2.35 1.25 0 1.12
+188 2.08 3.31 1.28 0.358 2.37 1.25 0 1.12
+189 2.04 3.2 1.28 0.351 2.39 1.25 0 1.12
+190 2.01 3.1 1.28 0.344 2.41 1.25 0 1.12
+191 1.98 2.99 1.28 0.337 2.43 1.25 0 1.12
+192 1.94 2.89 1.28 0.33 2.46 1.25 0 1.12
+193 1.9 2.79 1.28 0.324 2.49 1.25 0 1.12
+194 1.86 2.69 1.28 0.317 2.51 1.25 0 1.12
+195 1.82 2.59 1.28 0.31 2.54 1.25 0 1.12
+196 1.78 2.49 1.28 0.304 2.57 1.25 0 1.12
+197 1.74 2.4 1.28 0.297 2.59 1.25 0 1.12
+198 1.7 2.31 1.28 0.291 2.62 1.25 0 1.12
+199 1.66 2.22 1.28 0.285 2.65 1.25 0 1.12
+200 1.61 2.13 1.28 0.279 2.68 1.25 0 1.12
+201 1.57 2.04 1.27 0.272 2.7 1.25 0 1.12
+202 1.53 1.96 1.27 0.266 2.73 1.25 0 1.12
+203 1.49 1.88 1.27 0.26 2.76 1.25 0 1.12
+204 1.44 1.81 1.27 0.254 2.78 1.25 0 1.12
+205 1.4 1.73 1.27 0.249 2.8 1.25 0 1.12
+206 1.36 1.66 1.27 0.243 2.83 1.25 0 1.12
+207 1.32 1.59 1.27 0.237 2.85 1.25 0 1.12
+208 1.29 1.52 1.27 0.232 2.87 1.25 0 1.12
+209 1.25 1.46 1.27 0.226 2.89 1.25 0 1.12
+210 1.22 1.4 1.27 0.221 2.9 1.25 0 1.12
+211 1.18 1.34 1.27 0.215 2.92 1.25 0 1.12
+212 1.15 1.29 1.27 0.21 2.93 1.25 0 1.12
+213 1.12 1.23 1.27 0.205 2.95 1.25 0 1.12
+214 1.09 1.18 1.27 0.199 2.96 1.25 0 1.12
+215 1.07 1.13 1.27 0.194 2.97 1.25 0 1.12
+216 1.04 1.09 1.27 0.189 2.98 1.25 0 1.12
+217 1.02 1.05 1.27 0.184 2.98 1.25 0 1.12
+218 0.999 1.01 1.27 0.179 2.99 1.25 0 1.12
+219 0.98 0.967 1.27 0.175 2.99 1.25 0 1.12
+220 0.963 0.931 1.27 0.17 2.99 1.25 0 1.12
+221 0.947 0.897 1.27 0.165 2.99 1.25 0 1.12
+222 0.933 0.865 1.27 0.161 2.99 1.25 0 1.12
+223 0.919 0.836 1.27 0.156 2.98 1.25 0 1.12
+224 0.908 0.808 1.27 0.152 2.98 1.25 0 1.12
+225 0.897 0.782 1.27 0.148 2.97 1.25 0 1.12
+226 0.887 0.757 1.27 0.143 2.96 1.25 0 1.12
+227 0.878 0.735 1.27 0.139 2.95 1.25 0 1.12
+228 0.869 0.714 1.27 0.135 2.94 1.25 0 1.12
+229 0.861 0.694 1.27 0.131 2.93 1.25 0 1.12
+230 0.854 0.676 1.27 0.127 2.91 1.25 0 1.12
+231 0.846 0.659 1.27 0.123 2.9 1.25 0 1.12
+232 0.839 0.643 1.27 0.119 2.88 1.25 0 1.12
+233 0.831 0.628 1.27 0.116 2.86 1.25 0 1.12
+234 0.824 0.615 1.27 0.112 2.84 1.25 0 1.12
+235 0.816 0.602 1.27 0.109 2.82 1.25 0 1.12
+236 0.808 0.591 1.26 0.105 2.8 1.25 0 1.12
+237 0.799 0.58 1.26 0.102 2.78 1.24 0 1.12
+238 0.79 0.57 1.26 0.0984 2.76 1.24 0 1.12
+239 0.78 0.56 1.26 0.0951 2.73 1.24 0 1.12
+240 0.77 0.552 1.26 0.092 2.71 1.24 0 1.12
+241 0.759 0.544 1.26 0.0889 2.69 1.24 0 1.12
+242 0.747 0.536 1.26 0.0858 2.66 1.24 0 1.12
+243 0.734 0.529 1.26 0.0829 2.64 1.24 0 1.12
+244 0.721 0.523 1.26 0.08 2.61 1.24 0 1.12
+245 0.707 0.516 1.26 0.0772 2.58 1.24 0 1.12
+246 0.693 0.51 1.26 0.0745 2.56 1.24 0 1.12
+247 0.678 0.505 1.26 0.0719 2.53 1.24 0 1.12
+248 0.662 0.5 1.26 0.0693 2.5 1.24 0 1.12
+249 0.646 0.495 1.26 0.0668 2.48 1.24 0 1.12
+250 0.629 0.49 1.26 0.0643 2.45 1.24 0 1.12
+251 0.612 0.485 1.26 0.0619 2.42 1.24 0 1.12
+252 0.595 0.481 1.26 0.0596 2.4 1.24 0 1.12
+253 0.577 0.477 1.26 0.0574 2.37 1.24 0 1.12
+254 0.559 0.473 1.26 0.0552 2.34 1.24 0 1.12
+255 0.541 0.468 1.26 0.0531 2.31 1.24 0 1.12
+256 0.523 0.464 1.26 0.051 2.29 1.24 0 1.12
+257 0.505 0.461 1.26 0.0491 2.26 1.24 0 1.12
+258 0.487 0.457 1.26 0.0471 2.23 1.24 0 1.12
+259 0.469 0.453 1.26 0.0453 2.21 1.24 0 1.12
+260 0.451 0.449 1.26 0.0435 2.18 1.24 0 1.12
+261 0.434 0.445 1.26 0.0417 2.15 1.24 0 1.12
+262 0.417 0.442 1.26 0.04 2.13 1.24 0 1.12
+263 0.4 0.438 1.26 0.0384 2.1 1.24 0 1.12
+264 0.384 0.434 1.25 0.0368 2.07 1.24 0 1.12
+265 0.368 0.431 1.25 0.0352 2.05 1.24 0 1.12
+266 0.353 0.427 1.25 0.0338 2.02 1.24 0 1.12
+267 0.338 0.423 1.25 0.0323 1.99 1.24 0 1.12
+268 0.324 0.419 1.25 0.031 1.97 1.24 0 1.12
+269 0.31 0.415 1.25 0.0296 1.94 1.24 0 1.12
+270 0.297 0.412 1.25 0.0283 1.92 1.24 0 1.12
+271 0.285 0.408 1.25 0.0271 1.89 1.24 0 1.12
+272 0.273 0.404 1.25 0.0259 1.87 1.24 0 1.12
+273 0.262 0.4 1.25 0.0248 1.84 1.24 0 1.12
+274 0.251 0.396 1.25 0.0236 1.82 1.24 0 1.12
+275 0.241 0.392 1.25 0.0226 1.79 1.24 0 1.12
+276 0.231 0.389 1.25 0.0216 1.77 1.23 0 1.12
+277 0.222 0.385 1.25 0.0206 1.75 1.23 0 1.12
+278 0.214 0.381 1.25 0.0196 1.72 1.23 0 1.12
+279 0.206 0.377 1.25 0.0187 1.7 1.23 0 1.12
+280 0.198 0.373 1.25 0.0178 1.67 1.23 0 1.12
+281 0.192 0.369 1.25 0.017 1.65 1.23 0 1.12
+282 0.185 0.365 1.25 0.0162 1.63 1.23 0 1.12
+283 0.179 0.361 1.25 0.0154 1.61 1.23 0 1.12
+284 0.173 0.357 1.25 0.0147 1.58 1.23 0 1.12
+285 0.168 0.353 1.25 0.014 1.56 1.23 0 1.12
+286 0.163 0.349 1.25 0.0133 1.54 1.23 0 1.12
+287 0.159 0.345 1.25 0.0126 1.52 1.23 0 1.12
+288 0.154 0.341 1.25 0.012 1.5 1.23 0 1.12
+289 0.15 0.337 1.25 0.0114 1.48 1.23 0 1.12
+290 0.147 0.333 1.24 0.0108 1.46 1.23 0 1.12
+291 0.143 0.329 1.24 0.0103 1.44 1.23 0 1.12
+292 0.14 0.325 1.24 0.00977 1.42 1.23 0 1.12
+293 0.137 0.321 1.24 0.00927 1.4 1.23 0 1.12
+294 0.134 0.317 1.24 0.00879 1.38 1.23 0 1.12
+295 0.131 0.313 1.24 0.00833 1.36 1.23 0 1.11
+296 0.128 0.309 1.24 0.0079 1.34 1.23 0 1.11
+297 0.126 0.305 1.24 0.00748 1.32 1.23 0 1.11
+298 0.124 0.301 1.24 0.00709 1.3 1.23 0 1.11
+299 0.121 0.297 1.24 0.00671 1.29 1.23 0 1.11
+300 0.119 0.294 1.24 0.00635 1.27 1.23 0 1.11
+301 0.117 0.29 1.24 0.00601 1.25 1.23 0 1.11
+302 0.115 0.286 1.24 0.00568 1.24 1.23 0 1.11
+303 0.113 0.282 1.24 0.00537 1.22 1.23 0 1.11
+304 0.112 0.279 1.24 0.00508 1.2 1.23 0 1.11
+305 0.11 0.275 1.24 0.0048 1.19 1.23 0 1.11
+306 0.108 0.271 1.24 0.00453 1.17 1.23 0 1.11
+307 0.106 0.268 1.24 0.00428 1.16 1.22 0 1.11
+308 0.104 0.264 1.24 0.00404 1.15 1.22 0 1.11
+309 0.103 0.261 1.24 0.00381 1.13 1.22 0 1.11
+310 0.101 0.257 1.24 0.00359 1.12 1.22 0 1.11
+311 0.0995 0.254 1.24 0.00339 1.11 1.22 0 1.11
+312 0.0979 0.25 1.23 0.00319 1.09 1.22 0 1.11
+313 0.0963 0.247 1.23 0.00301 1.08 1.22 0 1.11
+314 0.0947 0.244 1.23 0.00283 1.07 1.22 0 1.11
+315 0.0932 0.24 1.23 0.00267 1.06 1.22 0 1.11
+316 0.0916 0.237 1.23 0.00251 1.05 1.22 0 1.11
+317 0.0901 0.234 1.23 0.00236 1.04 1.22 0 1.11
+318 0.0886 0.231 1.23 0.00222 1.02 1.22 0 1.11
+319 0.087 0.228 1.23 0.00209 1.01 1.22 0 1.11
+320 0.0855 0.225 1.23 0.00196 1 1.22 0 1.11
+321 0.0841 0.222 1.23 0.00184 0.995 1.22 0 1.11
+322 0.0826 0.219 1.23 0.00173 0.986 1.22 0 1.11
+323 0.0811 0.216 1.23 0.00162 0.977 1.22 0 1.11
+324 0.0797 0.213 1.23 0.00152 0.969 1.22 0 1.11
+325 0.0783 0.211 1.23 0.00143 0.961 1.22 0 1.11
+326 0.0768 0.208 1.23 0.00134 0.953 1.22 0 1.11
+327 0.0754 0.205 1.23 0.00126 0.945 1.22 0 1.11
+328 0.0741 0.203 1.23 0.00118 0.938 1.22 0 1.11
+329 0.0727 0.2 1.23 0.0011 0.931 1.22 0 1.11
+330 0.0713 0.198 1.23 0.00103 0.924 1.22 0 1.11
+331 0.07 0.195 1.23 0.000968 0.918 1.22 0 1.11
+332 0.0687 0.193 1.23 0.000906 0.912 1.22 0 1.11
+333 0.0674 0.19 1.22 0.000847 0.906 1.22 0 1.11
+334 0.0661 0.188 1.22 0.000792 0.901 1.21 0 1.11
+335 0.0649 0.186 1.22 0.00074 0.895 1.21 0 1.11
+336 0.0636 0.184 1.22 0.000692 0.89 1.21 0 1.11
+337 0.0624 0.182 1.22 0.000646 0.885 1.21 0 1.11
+338 0.0612 0.18 1.22 0.000603 0.88 1.21 0 1.11
+339 0.06 0.177 1.22 0.000563 0.876 1.21 0 1.11
+340 0.0589 0.175 1.22 0.000526 0.871 1.21 0 1.11
+341 0.0577 0.174 1.22 0.00049 0.867 1.21 0 1.11
+342 0.0566 0.172 1.22 0.000457 0.863 1.21 0 1.11
+343 0.0555 0.17 1.22 0.000426 0.859 1.21 0 1.11
+344 0.0544 0.168 1.22 0.000397 0.855 1.21 0 1.11
+345 0.0534 0.166 1.22 0.00037 0.852 1.21 0 1.11
+346 0.0523 0.164 1.22 0.000344 0.848 1.21 0 1.11
+347 0.0513 0.163 1.22 0.000321 0.844 1.21 0 1.11
+348 0.0503 0.161 1.22 0.000298 0.841 1.21 0 1.11
+349 0.0493 0.16 1.22 0.000277 0.837 1.21 0 1.11
+350 0.0484 0.158 1.22 0.000258 0.834 1.21 0 1.11
+351 0.0474 0.157 1.22 0.00024 0.831 1.21 0 1.11
+352 0.0465 0.155 1.22 0.000223 0.827 1.21 0 1.11
+353 0.0456 0.154 1.21 0.000207 0.824 1.21 0 1.11
+354 0.0447 0.152 1.21 0.000192 0.82 1.21 0 1.11
+355 0.0438 0.151 1.21 0.000178 0.817 1.21 0 1.1
+356 0.043 0.15 1.21 0.000165 0.813 1.21 0 1.1
+357 0.0421 0.148 1.21 0.000153 0.81 1.21 0 1.1
+358 0.0413 0.147 1.21 0.000142 0.806 1.2 0 1.1
+359 0.0405 0.146 1.21 0.000132 0.802 1.2 0 1.1
+360 0.0398 0.145 1.21 0.000122 0.798 1.2 0 1.1
+361 0.039 0.144 1.21 0.000113 0.794 1.2 0 1.1
+362 0.0382 0.143 1.21 0.000105 0.79 1.2 0 1.1
+363 0.0375 0.142 1.21 9.69e-05 0.786 1.2 0 1.1
+364 0.0368 0.141 1.21 8.97e-05 0.782 1.2 0 1.1
+365 0.0361 0.14 1.21 8.29e-05 0.778 1.2 0 1.1
+366 0.0354 0.139 1.21 7.67e-05 0.773 1.2 0 1.1
+367 0.0348 0.138 1.21 7.08e-05 0.768 1.2 0 1.1
+368 0.0341 0.137 1.21 6.54e-05 0.764 1.2 0 1.1
+369 0.0335 0.136 1.21 6.04e-05 0.759 1.2 0 1.1
+370 0.0328 0.135 1.21 5.58e-05 0.754 1.2 0 1.1
+371 0.0322 0.134 1.2 5.15e-05 0.749 1.2 0 1.1
+372 0.0316 0.134 1.2 4.75e-05 0.743 1.2 0 1.1
+373 0.031 0.133 1.2 4.38e-05 0.738 1.2 0 1.1
+374 0.0305 0.132 1.2 4.04e-05 0.732 1.2 0 1.1
+375 0.0299 0.131 1.2 3.72e-05 0.726 1.2 0 1.1
+376 0.0294 0.131 1.2 3.43e-05 0.72 1.2 0 1.1
+377 0.0288 0.13 1.2 3.16e-05 0.714 1.2 0 1.1
+378 0.0283 0.13 1.2 2.91e-05 0.708 1.2 0 1.1
+379 0.0278 0.129 1.2 2.67e-05 0.702 1.2 0 1.1
+380 0.0273 0.128 1.2 2.46e-05 0.696 1.19 0 1.1
+381 0.0268 0.128 1.2 2.26e-05 0.689 1.19 0 1.1
+382 0.0263 0.127 1.2 2.08e-05 0.683 1.19 0 1.1
+383 0.0259 0.127 1.2 1.91e-05 0.676 1.19 0 1.1
+384 0.0254 0.126 1.2 1.76e-05 0.669 1.19 0 1.1
+385 0.025 0.126 1.2 1.61e-05 0.663 1.19 0 1.1
+386 0.0245 0.125 1.2 1.48e-05 0.656 1.19 0 1.1
+387 0.0241 0.125 1.2 1.36e-05 0.649 1.19 0 1.1
+388 0.0237 0.124 1.19 1.25e-05 0.642 1.19 0 1.1
+389 0.0233 0.124 1.19 1.14e-05 0.635 1.19 0 1.1
+390 0.0229 0.123 1.19 1.05e-05 0.628 1.19 0 1.1
+391 0.0225 0.123 1.19 9.59e-06 0.621 1.19 0 1.1
+392 0.0221 0.123 1.19 8.79e-06 0.614 1.19 0 1.1
+393 0.0218 0.122 1.19 8.05e-06 0.607 1.19 0 1.1
+394 0.0214 0.122 1.19 7.37e-06 0.6 1.19 0 1.1
+395 0.021 0.122 1.19 6.74e-06 0.593 1.19 0 1.09
+396 0.0207 0.121 1.19 6.16e-06 0.586 1.19 0 1.09
+397 0.0204 0.121 1.19 5.64e-06 0.579 1.19 0 1.09
+398 0.02 0.121 1.19 5.15e-06 0.572 1.19 0 1.09
+399 0.0197 0.12 1.19 4.71e-06 0.566 1.19 0 1.09
+400 0.0194 0.12 1.19 4.3e-06 0.559 1.19 0 1.09
+401 0.0191 0.12 1.19 3.93e-06 0.552 1.18 0 1.09
+402 0.0188 0.119 1.19 3.58e-06 0.546 1.18 0 1.09
+403 0.0186 0.119 1.19 3.27e-06 0.539 1.18 0 1.09
+404 0.0183 0.119 1.19 2.98e-06 0.533 1.18 0 1.09
+405 0.018 0.119 1.18 2.72e-06 0.526 1.18 0 1.09
+406 0.0178 0.118 1.18 2.48e-06 0.52 1.18 0 1.09
+407 0.0175 0.118 1.18 2.26e-06 0.514 1.18 0 1.09
+408 0.0173 0.118 1.18 2.06e-06 0.508 1.18 0 1.09
+409 0.017 0.118 1.18 1.87e-06 0.502 1.18 0 1.09
+410 0.0168 0.117 1.18 1.7e-06 0.497 1.18 0 1.09
+411 0.0166 0.117 1.18 1.55e-06 0.491 1.18 0 1.09
+412 0.0163 0.117 1.18 1.41e-06 0.486 1.18 0 1.09
+413 0.0161 0.117 1.18 1.28e-06 0.48 1.18 0 1.09
+414 0.0159 0.116 1.18 1.17e-06 0.475 1.18 0 1.09
+415 0.0157 0.116 1.18 1.06e-06 0.47 1.18 0 1.09
+416 0.0155 0.116 1.18 9.61e-07 0.465 1.18 0 1.09
+417 0.0153 0.116 1.18 8.73e-07 0.461 1.18 0 1.09
+418 0.0152 0.116 1.18 7.92e-07 0.456 1.18 0 1.09
+419 0.015 0.115 1.18 7.19e-07 0.451 1.18 0 1.09
+420 0.0148 0.115 1.18 6.52e-07 0.447 1.17 0 1.09
+421 0.0146 0.115 1.17 5.91e-07 0.443 1.17 0 1.09
+422 0.0145 0.115 1.17 5.35e-07 0.439 1.17 0 1.09
+423 0.0143 0.115 1.17 4.85e-07 0.435 1.17 0 1.09
+424 0.0142 0.114 1.17 4.39e-07 0.431 1.17 0 1.09
+425 0.014 0.114 1.17 3.98e-07 0.427 1.17 0 1.09
+426 0.0139 0.114 1.17 3.6e-07 0.424 1.17 0 1.09
+427 0.0138 0.114 1.17 3.26e-07 0.42 1.17 0 1.08
+428 0.0136 0.114 1.17 2.94e-07 0.417 1.17 0 1.08
+429 0.0135 0.114 1.17 2.66e-07 0.414 1.17 0 1.08
+430 0.0134 0.113 1.17 2.41e-07 0.411 1.17 0 1.08
+431 0.0133 0.113 1.17 2.17e-07 0.408 1.17 0 1.08
+432 0.0132 0.113 1.17 1.96e-07 0.405 1.17 0 1.08
+433 0.0131 0.113 1.17 1.77e-07 0.402 1.17 0 1.08
+434 0.013 0.113 1.17 1.6e-07 0.399 1.17 0 1.08
+435 0.0129 0.112 1.17 1.44e-07 0.397 1.17 0 1.08
+436 0.0128 0.112 1.16 1.3e-07 0.394 1.17 0 1.08
+437 0.0127 0.112 1.16 1.17e-07 0.392 1.17 0 1.08
+438 0.0126 0.112 1.16 1.06e-07 0.389 1.16 0 1.08
+439 0.0125 0.112 1.16 9.51e-08 0.387 1.16 0 1.08
+440 0.0124 0.112 1.16 8.57e-08 0.385 1.16 0 1.08
+441 0.0124 0.111 1.16 7.71e-08 0.382 1.16 0 1.08
+442 0.0123 0.111 1.16 6.94e-08 0.38 1.16 0 1.08
+443 0.0122 0.111 1.16 6.24e-08 0.378 1.16 0 1.08
+444 0.0121 0.111 1.16 5.61e-08 0.376 1.16 0 1.08
+445 0.0121 0.111 1.16 5.04e-08 0.374 1.16 0 1.08
+446 0.012 0.11 1.16 4.53e-08 0.372 1.16 0 1.08
+447 0.012 0.11 1.16 4.07e-08 0.369 1.16 0 1.08
+448 0.0119 0.11 1.16 3.66e-08 0.367 1.16 0 1.08
+449 0.0119 0.11 1.16 3.28e-08 0.365 1.16 0 1.08
+450 0.0118 0.11 1.16 2.94e-08 0.363 1.16 0 1.08
+451 0.0118 0.109 1.15 2.64e-08 0.361 1.16 0 1.08
+452 0.0117 0.109 1.15 2.37e-08 0.359 1.16 0 1.08
+453 0.0117 0.109 1.15 2.12e-08 0.357 1.16 0 1.08
+454 0.0116 0.109 1.15 1.9e-08 0.355 1.16 0 1.08
+455 0.0116 0.109 1.15 1.7e-08 0.353 1.15 0 1.07
+456 0.0115 0.108 1.15 1.52e-08 0.35 1.15 0 1.07
+457 0.0115 0.108 1.15 1.36e-08 0.348 1.15 0 1.07
+458 0.0115 0.108 1.15 1.22e-08 0.346 1.15 0 1.07
+459 0.0114 0.108 1.15 1.09e-08 0.344 1.15 0 1.07
+460 0.0114 0.108 1.15 9.76e-09 0.341 1.15 0 1.07
+461 0.0114 0.107 1.15 8.73e-09 0.339 1.15 0 1.07
+462 0.0114 0.107 1.15 7.8e-09 0.336 1.15 0 1.07
+463 0.0113 0.107 1.15 6.96e-09 0.334 1.15 0 1.07
+464 0.0113 0.107 1.15 6.22e-09 0.332 1.15 0 1.07
+465 0.0113 0.107 1.15 5.55e-09 0.329 1.15 0 1.07
+466 0.0113 0.106 1.14 4.95e-09 0.326 1.15 0 1.07
+467 0.0112 0.106 1.14 4.42e-09 0.324 1.15 0 1.07
+468 0.0112 0.106 1.14 3.94e-09 0.321 1.15 0 1.07
+469 0.0112 0.106 1.14 3.51e-09 0.318 1.15 0 1.07
+470 0.0112 0.106 1.14 3.13e-09 0.315 1.15 0 1.07
+471 0.0112 0.105 1.14 2.78e-09 0.312 1.15 0 1.07
+472 0.0112 0.105 1.14 2.48e-09 0.309 1.14 0 1.07
+473 0.0111 0.105 1.14 2.21e-09 0.306 1.14 0 1.07
+474 0.0111 0.105 1.14 1.96e-09 0.303 1.14 0 1.07
+475 0.0111 0.104 1.14 1.74e-09 0.3 1.14 0 1.07
+476 0.0111 0.104 1.14 1.55e-09 0.297 1.14 0 1.07
+477 0.0111 0.104 1.14 1.38e-09 0.294 1.14 0 1.07
+478 0.0111 0.104 1.14 1.22e-09 0.291 1.14 0 1.07
+479 0.0111 0.103 1.14 1.09e-09 0.287 1.14 0 1.07
+480 0.0111 0.103 1.13 9.65e-10 0.284 1.14 0 1.06
+481 0.0111 0.103 1.13 8.57e-10 0.28 1.14 0 1.06
+482 0.0111 0.103 1.13 7.6e-10 0.277 1.14 0 1.06
+483 0.011 0.102 1.13 6.74e-10 0.273 1.14 0 1.06
+484 0.011 0.102 1.13 5.97e-10 0.27 1.14 0 1.06
+485 0.011 0.102 1.13 5.29e-10 0.266 1.14 0 1.06
+486 0.011 0.102 1.13 4.69e-10 0.263 1.14 0 1.06
+487 0.011 0.101 1.13 4.15e-10 0.259 1.14 0 1.06
+488 0.011 0.101 1.13 3.68e-10 0.255 1.13 0 1.06
+489 0.011 0.101 1.13 3.25e-10 0.251 1.13 0 1.06
+490 0.011 0.101 1.13 2.88e-10 0.248 1.13 0 1.06
+491 0.011 0.1 1.13 2.54e-10 0.244 1.13 0 1.06
+492 0.011 0.1 1.13 2.25e-10 0.24 1.13 0 1.06
+493 0.011 0.1 1.13 1.99e-10 0.236 1.13 0 1.06
+494 0.011 0.0997 1.12 1.76e-10 0.232 1.13 0 1.06
+495 0.011 0.0994 1.12 1.55e-10 0.228 1.13 0 1.06
+496 0.011 0.0992 1.12 1.37e-10 0.224 1.13 0 1.06
+497 0.011 0.0989 1.12 1.21e-10 0.221 1.13 0 1.06
+498 0.011 0.0986 1.12 1.07e-10 0.217 1.13 0 1.06
+499 0.011 0.0983 1.12 9.39e-11 0.213 1.13 0 1.06
+500 0.011 0.0981 1.12 8.28e-11 0.209 1.13 0 1.06
+501 0.011 0.0978 1.12 7.29e-11 0.205 1.13 0 1.06
+502 0.011 0.0975 1.12 6.42e-11 0.201 1.13 0 1.06
+503 0.011 0.0972 1.12 5.66e-11 0.197 1.13 0 1.05
+504 0.011 0.097 1.12 4.98e-11 0.193 1.12 0 1.05
+505 0.011 0.0967 1.12 4.38e-11 0.189 1.12 0 1.05
+506 0.011 0.0964 1.12 3.85e-11 0.185 1.12 0 1.05
+507 0.011 0.0961 1.11 3.39e-11 0.181 1.12 0 1.05
+508 0.011 0.0958 1.11 2.98e-11 0.177 1.12 0 1.05
+509 0.011 0.0955 1.11 2.62e-11 0.173 1.12 0 1.05
+510 0.011 0.0953 1.11 2.3e-11 0.169 1.12 0 1.05
+511 0.011 0.095 1.11 2.02e-11 0.166 1.12 0 1.05
+512 0.011 0.0947 1.11 1.77e-11 0.162 1.12 0 1.05
+513 0.011 0.0944 1.11 1.55e-11 0.158 1.12 0 1.05
+514 0.011 0.0941 1.11 1.36e-11 0.154 1.12 0 1.05
+515 0.011 0.0938 1.11 1.19e-11 0.15 1.12 0 1.05
+516 0.011 0.0935 1.11 1.05e-11 0.147 1.12 0 1.05
+517 0.011 0.0932 1.11 9.17e-12 0.143 1.12 0 1.05
+518 0.011 0.0929 1.11 8.03e-12 0.139 1.12 0 1.05
+519 0.011 0.0926 1.11 7.03e-12 0.136 1.11 0 1.05
+520 0.011 0.0923 1.1 6.16e-12 0.132 1.11 0 1.05
+521 0.011 0.092 1.1 5.39e-12 0.129 1.11 0 1.05
+522 0.011 0.0917 1.1 4.71e-12 0.125 1.11 0 1.05
+523 0.011 0.0914 1.1 4.12e-12 0.122 1.11 0 1.05
+524 0.011 0.0911 1.1 3.6e-12 0.118 1.11 0 1.05
+525 0.011 0.0908 1.1 3.14e-12 0.115 1.11 0 1.04
+526 0.011 0.0905 1.1 2.75e-12 0.112 1.11 0 1.04
+527 0.011 0.0902 1.1 2.4e-12 0.109 1.11 0 1.04
+528 0.011 0.0899 1.1 2.09e-12 0.105 1.11 0 1.04
+529 0.011 0.0895 1.1 1.82e-12 0.102 1.11 0 1.04
+530 0.011 0.0892 1.1 1.59e-12 0.0992 1.11 0 1.04
+531 0.0109 0.0889 1.1 1.39e-12 0.0962 1.11 0 1.04
+532 0.0109 0.0886 1.1 1.21e-12 0.0932 1.11 0 1.04
+533 0.0109 0.0883 1.09 1.05e-12 0.0903 1.1 0 1.04
+534 0.0109 0.088 1.09 9.17e-13 0.0874 1.1 0 1.04
+535 0.0109 0.0877 1.09 7.98e-13 0.0846 1.1 0 1.04
+536 0.0109 0.0873 1.09 6.95e-13 0.0819 1.1 0 1.04
+537 0.0109 0.087 1.09 6.04e-13 0.0792 1.1 0 1.04
+538 0.0109 0.0867 1.09 5.26e-13 0.0765 1.1 0 1.04
+539 0.0109 0.0864 1.09 4.57e-13 0.074 1.1 0 1.04
+540 0.0109 0.0861 1.09 3.97e-13 0.0714 1.1 0 1.04
+541 0.0109 0.0857 1.09 3.45e-13 0.069 1.1 0 1.04
+542 0.0109 0.0854 1.09 2.99e-13 0.0665 1.1 0 1.04
+543 0.0109 0.0851 1.09 2.6e-13 0.0642 1.1 0 1.04
+544 0.0109 0.0848 1.09 2.26e-13 0.0619 1.1 0 1.04
+545 0.0109 0.0844 1.09 1.96e-13 0.0596 1.1 0 1.03
+546 0.0109 0.0841 1.08 1.7e-13 0.0575 1.1 0 1.03
+547 0.0109 0.0838 1.08 1.47e-13 0.0553 1.09 0 1.03
+548 0.0109 0.0834 1.08 1.27e-13 0.0533 1.09 0 1.03
+549 0.0109 0.0831 1.08 1.1e-13 0.0512 1.09 0 1.03
+550 0.0109 0.0828 1.08 9.56e-14 0.0493 1.09 0 1.03
+551 0.0109 0.0825 1.08 8.27e-14 0.0474 1.09 0 1.03
+552 0.0109 0.0821 1.08 7.16e-14 0.0455 1.09 0 1.03
+553 0.0109 0.0818 1.08 6.19e-14 0.0437 1.09 0 1.03
+554 0.0109 0.0815 1.08 5.35e-14 0.042 1.09 0 1.03
+555 0.0108 0.0811 1.08 4.63e-14 0.0403 1.09 0 1.03
+556 0.0108 0.0808 1.08 4e-14 0.0386 1.09 0 1.03
+557 0.0108 0.0805 1.08 3.45e-14 0.037 1.09 0 1.03
+558 0.0108 0.0801 1.07 2.98e-14 0.0355 1.09 0 1.03
+559 0.0108 0.0798 1.07 2.57e-14 0.034 1.09 0 1.03
+560 0.0108 0.0795 1.07 2.22e-14 0.0325 1.09 0 1.03
+561 0.0108 0.0791 1.07 1.92e-14 0.0311 1.08 0 1.03
+562 0.0108 0.0788 1.07 1.65e-14 0.0298 1.08 0 1.03
+563 0.0108 0.0784 1.07 1.42e-14 0.0285 1.08 0 1.03
+564 0.0108 0.0781 1.07 1.23e-14 0.0272 1.08 0 1.02
+565 0.0108 0.0778 1.07 1.06e-14 0.026 1.08 0 1.02
+566 0.0108 0.0774 1.07 9.09e-15 0.0248 1.08 0 1.02
+567 0.0108 0.0771 1.07 7.83e-15 0.0237 1.08 0 1.02
+568 0.0107 0.0768 1.07 6.73e-15 0.0226 1.08 0 1.02
+569 0.0107 0.0764 1.07 5.79e-15 0.0215 1.08 0 1.02
+570 0.0107 0.0761 1.06 4.98e-15 0.0205 1.08 0 1.02
+571 0.0107 0.0757 1.06 4.28e-15 0.0196 1.08 0 1.02
+572 0.0107 0.0754 1.06 3.68e-15 0.0186 1.08 0 1.02
+573 0.0107 0.075 1.06 3.16e-15 0.0177 1.08 0 1.02
+574 0.0107 0.0747 1.06 2.71e-15 0.0169 1.08 0 1.02
+575 0.0107 0.0744 1.06 2.33e-15 0.016 1.07 0 1.02
+576 0.0107 0.074 1.06 2e-15 0.0152 1.07 0 1.02
+577 0.0107 0.0737 1.06 1.71e-15 0.0145 1.07 0 1.02
+578 0.0107 0.0733 1.06 1.47e-15 0.0137 1.07 0 1.02
+579 0.0106 0.073 1.06 1.26e-15 0.013 1.07 0 1.02
+580 0.0106 0.0727 1.06 1.08e-15 0.0124 1.07 0 1.02
+581 0.0106 0.0723 1.06 9.22e-16 0.0117 1.07 0 1.02
+582 0.0106 0.072 1.05 7.9e-16 0.0111 1.07 0 1.02
+583 0.0106 0.0716 1.05 6.76e-16 0.0105 1.07 0 1.01
+584 0.0106 0.0713 1.05 5.78e-16 0.00997 1.07 0 1.01
+585 0.0106 0.0709 1.05 4.94e-16 0.00944 1.07 0 1.01
+586 0.0106 0.0706 1.05 4.23e-16 0.00893 1.07 0 1.01
+587 0.0106 0.0703 1.05 3.61e-16 0.00844 1.07 0 1.01
+588 0.0105 0.0699 1.05 3.09e-16 0.00798 1.06 0 1.01
+589 0.0105 0.0696 1.05 2.63e-16 0.00754 1.06 0 1.01
+590 0.0105 0.0692 1.05 2.25e-16 0.00711 1.06 0 1.01
+591 0.0105 0.0689 1.05 1.92e-16 0.00671 1.06 0 1.01
+592 0.0105 0.0685 1.05 1.64e-16 0.00633 1.06 0 1.01
+593 0.0105 0.0682 1.05 1.4e-16 0.00597 1.06 0 1.01
+594 0.0105 0.0679 1.04 1.19e-16 0.00563 1.06 0 1.01
+595 0.0105 0.0675 1.04 1.01e-16 0.0053 1.06 0 1.01
+596 0.0104 0.0672 1.04 8.64e-17 0.00499 1.06 0 1.01
+597 0.0104 0.0668 1.04 7.36e-17 0.00469 1.06 0 1.01
+598 0.0104 0.0665 1.04 6.26e-17 0.00441 1.06 0 1.01
+599 0.0104 0.0662 1.04 5.33e-17 0.00415 1.06 0 1.01
+600 0.0104 0.0658 1.04 4.53e-17 0.0039 1.06 0 1
+601 0.0104 0.0655 1.04 3.85e-17 0.00366 1.05 0 1
+602 0.0104 0.0651 1.04 3.28e-17 0.00344 1.05 0 1
+603 0.0104 0.0648 1.04 2.78e-17 0.00322 1.05 0 1
+604 0.0103 0.0644 1.04 2.36e-17 0.00302 1.05 0 1
+605 0.0103 0.0641 1.04 2.01e-17 0.00283 1.05 0 1
+606 0.0103 0.0638 1.03 1.7e-17 0.00265 1.05 0 1
+607 0.0103 0.0634 1.03 1.45e-17 0.00249 1.05 0 1
+608 0.0103 0.0631 1.03 1.23e-17 0.00233 1.05 0 1
+609 0.0103 0.0627 1.03 1.04e-17 0.00218 1.05 0 1
+610 0.0103 0.0624 1.03 8.81e-18 0.00203 1.05 0 0.999
+611 0.0102 0.0621 1.03 7.47e-18 0.0019 1.05 0 0.998
+612 0.0102 0.0617 1.03 6.32e-18 0.00178 1.05 0 0.998
+613 0.0102 0.0614 1.03 5.35e-18 0.00166 1.05 0 0.997
+614 0.0102 0.0611 1.03 4.53e-18 0.00155 1.04 0 0.997
+615 0.0102 0.0607 1.03 3.83e-18 0.00144 1.04 0 0.996
+616 0.0102 0.0604 1.03 3.24e-18 0.00135 1.04 0 0.995
+617 0.0101 0.06 1.02 2.74e-18 0.00125 1.04 0 0.995
+618 0.0101 0.0597 1.02 2.32e-18 0.00117 1.04 0 0.994
+619 0.0101 0.0594 1.02 1.96e-18 0.00109 1.04 0 0.994
+620 0.0101 0.059 1.02 1.65e-18 0.00101 1.04 0 0.993
+621 0.0101 0.0587 1.02 1.4e-18 0.00094 1.04 0 0.992
+622 0.0101 0.0584 1.02 1.18e-18 0.000874 1.04 0 0.992
+623 0.01 0.058 1.02 9.94e-19 0.000812 1.04 0 0.991
+624 0.01 0.0577 1.02 8.38e-19 0.000754 1.04 0 0.991
+625 0.01 0.0574 1.02 7.07e-19 0.0007 1.04 0 0.99
+626 0.01 0.057 1.02 5.96e-19 0.000649 1.04 0 0.989
+627 0.00998 0.0567 1.02 0 0.000602 1.03 0 0.989
+628 0.00996 0.0564 1.02 0 0.000558 1.03 0 0.988
+629 0.00994 0.056 1.01 0 0.000517 1.03 0 0.988
+630 0.00993 0.0557 1.01 0 0.000478 1.03 0 0.987
+631 0.00991 0.0554 1.01 0 0.000442 1.03 0 0.986
+632 0.00989 0.0551 1.01 0 0.000409 1.03 0 0.986
+633 0.00987 0.0547 1.01 0 0.000378 1.03 0 0.985
+634 0.00985 0.0544 1.01 0 0.000349 1.03 0 0.984
+635 0.00983 0.0541 1.01 0 0.000323 1.03 0 0.984
+636 0.00982 0.0538 1.01 0 0.000298 1.03 0 0.983
+637 0.0098 0.0534 1.01 0 0.000275 1.03 0 0.983
+638 0.00978 0.0531 1.01 0 0.000253 1.03 0 0.982
+639 0.00976 0.0528 1.01 0 0.000234 1.02 0 0.981
+640 0.00974 0.0525 1 0 0.000215 1.02 0 0.981
+641 0.00972 0.0521 1 0 0.000198 1.02 0 0.98
+642 0.0097 0.0518 1 0 0.000182 1.02 0 0.979
+643 0.00968 0.0515 1 0 0.000168 1.02 0 0.979
+644 0.00966 0.0512 1 0 0.000154 1.02 0 0.978
+645 0.00964 0.0508 1 0 0.000142 1.02 0 0.978
+646 0.00963 0.0505 0.999 0 0.00013 1.02 0 0.977
+647 0.00961 0.0502 0.998 0 0.000119 1.02 0 0.976
+648 0.00959 0.0499 0.998 0 0.000109 1.02 0 0.976
+649 0.00957 0.0496 0.997 0 0.0001 1.02 0 0.975
+650 0.00955 0.0493 0.996 0 9.2e-05 1.02 0 0.974
+651 0.00952 0.049 0.995 0 8.43e-05 1.01 0 0.974
+652 0.0095 0.0486 0.994 0 7.72e-05 1.01 0 0.973
+653 0.00948 0.0483 0.993 0 7.06e-05 1.01 0 0.972
+654 0.00946 0.048 0.992 0 6.46e-05 1.01 0 0.972
+655 0.00944 0.0477 0.991 0 5.91e-05 1.01 0 0.971
+656 0.00942 0.0474 0.99 0 5.4e-05 1.01 0 0.971
+657 0.0094 0.0471 0.99 0 4.93e-05 1.01 0 0.97
+658 0.00938 0.0468 0.989 0 4.5e-05 1.01 0 0.969
+659 0.00936 0.0465 0.988 0 4.1e-05 1.01 0 0.969
+660 0.00934 0.0462 0.987 0 3.74e-05 1.01 0 0.968
+661 0.00932 0.0459 0.986 0 3.41e-05 1.01 0 0.967
+662 0.0093 0.0455 0.985 0 3.11e-05 1.01 0 0.967
+663 0.00927 0.0452 0.984 0 2.83e-05 1 0 0.966
+664 0.00925 0.0449 0.983 0 2.58e-05 1 0 0.965
+665 0.00923 0.0446 0.982 0 2.34e-05 1 0 0.965
+666 0.00921 0.0443 0.981 0 2.13e-05 1 0 0.964
+667 0.00919 0.044 0.98 0 1.94e-05 1 0 0.963
+668 0.00916 0.0437 0.98 0 1.76e-05 1 0 0.963
+669 0.00914 0.0434 0.979 0 1.6e-05 1 0 0.962
+670 0.00912 0.0431 0.978 0 1.45e-05 0.999 0 0.961
+671 0.0091 0.0428 0.977 0 1.31e-05 0.998 0 0.961
+672 0.00908 0.0426 0.976 0 1.19e-05 0.997 0 0.96
+673 0.00905 0.0423 0.975 0 1.08e-05 0.997 0 0.959
+674 0.00903 0.042 0.974 0 9.76e-06 0.996 0 0.959
+675 0.00901 0.0417 0.973 0 8.84e-06 0.995 0 0.958
+676 0.00899 0.0414 0.972 0 7.99e-06 0.994 0 0.957
+677 0.00896 0.0411 0.971 0 7.23e-06 0.993 0 0.957
+678 0.00894 0.0408 0.97 0 6.53e-06 0.992 0 0.956
+679 0.00892 0.0405 0.97 0 5.9e-06 0.992 0 0.955
+680 0.00889 0.0402 0.969 0 5.33e-06 0.991 0 0.955
+681 0.00887 0.0399 0.968 0 4.81e-06 0.99 0 0.954
+682 0.00885 0.0397 0.967 0 4.33e-06 0.989 0 0.953
+683 0.00882 0.0394 0.966 0 3.91e-06 0.988 0 0.953
+684 0.0088 0.0391 0.965 0 3.52e-06 0.987 0 0.952
+685 0.00878 0.0388 0.964 0 3.17e-06 0.986 0 0.951
+686 0.00875 0.0385 0.963 0 2.85e-06 0.986 0 0.951
+687 0.00873 0.0383 0.962 0 2.57e-06 0.985 0 0.95
+688 0.00871 0.038 0.961 0 2.31e-06 0.984 0 0.949
+689 0.00868 0.0377 0.96 0 2.07e-06 0.983 0 0.949
+690 0.00866 0.0374 0.959 0 1.86e-06 0.982 0 0.948
+691 0.00863 0.0371 0.958 0 1.67e-06 0.981 0 0.947
+692 0.00861 0.0369 0.958 0 1.5e-06 0.98 0 0.947
+693 0.00859 0.0366 0.957 0 1.35e-06 0.98 0 0.946
+694 0.00856 0.0363 0.956 0 1.21e-06 0.979 0 0.945
+695 0.00854 0.0361 0.955 0 1.08e-06 0.978 0 0.945
+696 0.00851 0.0358 0.954 0 9.68e-07 0.977 0 0.944
+697 0.00849 0.0355 0.953 0 8.67e-07 0.976 0 0.943
+698 0.00846 0.0353 0.952 0 7.75e-07 0.975 0 0.943
+699 0.00844 0.035 0.951 0 6.93e-07 0.974 0 0.942
+700 0.00842 0.0347 0.95 0 6.2e-07 0.974 0 0.941
+701 0.00839 0.0345 0.949 0 5.54e-07 0.973 0 0.941
+702 0.00837 0.0342 0.948 0 4.94e-07 0.972 0 0.94
+703 0.00834 0.0339 0.947 0 4.41e-07 0.971 0 0.939
+704 0.00832 0.0337 0.946 0 3.93e-07 0.97 0 0.939
+705 0.00829 0.0334 0.945 0 3.51e-07 0.969 0 0.938
+706 0.00827 0.0332 0.945 0 3.13e-07 0.968 0 0.937
+707 0.00824 0.0329 0.944 0 2.78e-07 0.968 0 0.936
+708 0.00822 0.0327 0.943 0 2.48e-07 0.967 0 0.936
+709 0.00819 0.0324 0.942 0 2.2e-07 0.966 0 0.935
+710 0.00817 0.0322 0.941 0 1.96e-07 0.965 0 0.934
+711 0.00814 0.0319 0.94 0 1.74e-07 0.964 0 0.934
+712 0.00812 0.0317 0.939 0 1.55e-07 0.963 0 0.933
+713 0.00809 0.0314 0.938 0 1.37e-07 0.962 0 0.932
+714 0.00806 0.0312 0.937 0 1.22e-07 0.961 0 0.932
+715 0.00804 0.0309 0.936 0 1.08e-07 0.961 0 0.931
+716 0.00801 0.0307 0.935 0 9.6e-08 0.96 0 0.93
+717 0.00799 0.0304 0.934 0 8.51e-08 0.959 0 0.929
+718 0.00796 0.0302 0.933 0 7.53e-08 0.958 0 0.929
+719 0.00794 0.0299 0.932 0 6.67e-08 0.957 0 0.928
+720 0.00791 0.0297 0.931 0 5.9e-08 0.956 0 0.927
+721 0.00789 0.0295 0.931 0 5.22e-08 0.955 0 0.927
+722 0.00786 0.0292 0.93 0 4.61e-08 0.955 0 0.926
+723 0.00783 0.029 0.929 0 4.08e-08 0.954 0 0.925
+724 0.00781 0.0287 0.928 0 3.6e-08 0.953 0 0.925
+725 0.00778 0.0285 0.927 0 3.18e-08 0.952 0 0.924
+726 0.00776 0.0283 0.926 0 2.8e-08 0.951 0 0.923
+727 0.00773 0.028 0.925 0 2.47e-08 0.95 0 0.922
+728 0.0077 0.0278 0.924 0 2.18e-08 0.949 0 0.922
+729 0.00768 0.0276 0.923 0 1.92e-08 0.948 0 0.921
+730 0.00765 0.0274 0.922 0 1.69e-08 0.947 0 0.92
+731 0.00763 0.0271 0.921 0 1.49e-08 0.947 0 0.92
+732 0.0076 0.0269 0.92 0 1.31e-08 0.946 0 0.919
+733 0.00757 0.0267 0.919 0 1.15e-08 0.945 0 0.918
+734 0.00755 0.0265 0.918 0 1.01e-08 0.944 0 0.917
+735 0.00752 0.0262 0.917 0 8.88e-09 0.943 0 0.917
+736 0.00749 0.026 0.916 0 7.8e-09 0.942 0 0.916
+737 0.00747 0.0258 0.915 0 6.84e-09 0.941 0 0.915
+738 0.00744 0.0256 0.914 0 6e-09 0.94 0 0.914
+739 0.00742 0.0254 0.914 0 5.26e-09 0.94 0 0.914
+740 0.00739 0.0251 0.913 0 4.61e-09 0.939 0 0.913
+741 0.00736 0.0249 0.912 0 4.03e-09 0.938 0 0.912
+742 0.00734 0.0247 0.911 0 3.53e-09 0.937 0 0.912
+743 0.00731 0.0245 0.91 0 3.09e-09 0.936 0 0.911
+744 0.00728 0.0243 0.909 0 2.7e-09 0.935 0 0.91
+745 0.00726 0.0241 0.908 0 2.36e-09 0.934 0 0.909
+746 0.00723 0.0239 0.907 0 2.06e-09 0.933 0 0.909
+747 0.0072 0.0237 0.906 0 1.8e-09 0.932 0 0.908
+748 0.00718 0.0235 0.905 0 1.57e-09 0.932 0 0.907
+749 0.00715 0.0233 0.904 0 1.37e-09 0.931 0 0.906
+750 0.00712 0.0231 0.903 0 1.2e-09 0.93 0 0.906
+751 0.0071 0.0229 0.902 0 1.04e-09 0.929 0 0.905
+752 0.00707 0.0227 0.901 0 9.07e-10 0.928 0 0.904
+753 0.00704 0.0225 0.9 0 7.9e-10 0.927 0 0.904
+754 0.00702 0.0223 0.899 0 6.87e-10 0.926 0 0.903
+755 0.00699 0.0221 0.898 0 5.98e-10 0.925 0 0.902
+756 0.00696 0.0219 0.897 0 5.2e-10 0.924 0 0.901
+757 0.00694 0.0217 0.896 0 4.51e-10 0.923 0 0.901
+758 0.00691 0.0215 0.895 0 3.92e-10 0.923 0 0.9
+759 0.00688 0.0213 0.894 0 3.4e-10 0.922 0 0.899
+760 0.00686 0.0211 0.894 0 2.95e-10 0.921 0 0.898
+761 0.00683 0.0209 0.893 0 2.56e-10 0.92 0 0.898
+762 0.0068 0.0207 0.892 0 2.22e-10 0.919 0 0.897
+763 0.00678 0.0205 0.891 0 1.92e-10 0.918 0 0.896
+764 0.00675 0.0203 0.89 0 1.66e-10 0.917 0 0.895
+765 0.00672 0.0202 0.889 0 1.44e-10 0.916 0 0.895
+766 0.0067 0.02 0.888 0 1.25e-10 0.915 0 0.894
+767 0.00667 0.0198 0.887 0 1.08e-10 0.914 0 0.893
+768 0.00664 0.0196 0.886 0 9.31e-11 0.914 0 0.892
+769 0.00662 0.0194 0.885 0 8.04e-11 0.913 0 0.892
+770 0.00659 0.0192 0.884 0 6.95e-11 0.912 0 0.891
+771 0.00656 0.0191 0.883 0 5.99e-11 0.911 0 0.89
+772 0.00653 0.0189 0.882 0 5.17e-11 0.91 0 0.889
+773 0.00651 0.0187 0.881 0 4.46e-11 0.909 0 0.889
+774 0.00648 0.0185 0.88 0 3.84e-11 0.908 0 0.888
+775 0.00645 0.0184 0.879 0 3.31e-11 0.907 0 0.887
+776 0.00643 0.0182 0.878 0 2.85e-11 0.906 0 0.886
+777 0.0064 0.018 0.877 0 2.45e-11 0.905 0 0.886
+778 0.00637 0.0179 0.876 0 2.11e-11 0.905 0 0.885
+779 0.00635 0.0177 0.875 0 1.81e-11 0.904 0 0.884
+780 0.00632 0.0175 0.874 0 1.56e-11 0.903 0 0.883
+781 0.00629 0.0174 0.873 0 1.34e-11 0.902 0 0.883
+782 0.00627 0.0172 0.872 0 1.15e-11 0.901 0 0.882
+783 0.00624 0.017 0.871 0 9.84e-12 0.9 0 0.881
+784 0.00621 0.0169 0.87 0 8.44e-12 0.899 0 0.88
+785 0.00619 0.0167 0.869 0 7.23e-12 0.898 0 0.88
+786 0.00616 0.0165 0.869 0 6.2e-12 0.897 0 0.879
+787 0.00613 0.0164 0.868 0 5.31e-12 0.896 0 0.878
+788 0.00611 0.0162 0.867 0 4.54e-12 0.895 0 0.877
+789 0.00608 0.0161 0.866 0 3.88e-12 0.895 0 0.877
+790 0.00605 0.0159 0.865 0 3.32e-12 0.894 0 0.876
+791 0.00603 0.0158 0.864 0 2.84e-12 0.893 0 0.875
+792 0.006 0.0156 0.863 0 2.42e-12 0.892 0 0.874
+793 0.00597 0.0154 0.862 0 2.07e-12 0.891 0 0.874
+794 0.00595 0.0153 0.861 0 1.77e-12 0.89 0 0.873
+795 0.00592 0.0151 0.86 0 1.51e-12 0.889 0 0.872
+796 0.0059 0.015 0.859 0 1.28e-12 0.888 0 0.871
+797 0.00587 0.0149 0.858 0 1.09e-12 0.887 0 0.871
+798 0.00584 0.0147 0.857 0 9.33e-13 0.886 0 0.87
+799 0.00582 0.0146 0.856 0 7.94e-13 0.885 0 0.869
+800 0.00579 0.0144 0.855 0 6.76e-13 0.884 0 0.868
+#
+# AATAAA/TGTAA box probabilities
+[AATAAA]
+# Size of vector
+4096
+# Probabilities
+gataaa 0.5
+tataaa 0.5
+# end of content independent part
+[1]
+# (a,c,g,t)= (0.237, 0.263, 0.263, 0.237)
+#
+# Probabilities file for the UTR model
+#
+#
+
+#
+# The emission probabilities of single and initial 5' UTR exons
+#
+[EMISSION-5INITIAL]
+# size of the emission vector
+1024
+#k=
+4
+# patpseudo : pseudocount for sequence patterns
+1
+aaaaa 0.411
+aaaac 0.123
+aaaag 0.173
+aaaat 0.293
+aaaca 0.384
+aaacc 0.182
+aaacg 0.0994
+aaact 0.334
+aaaga 0.368
+aaagc 0.153
+aaagg 0.192
+aaagt 0.287
+aaata 0.34
+aaatc 0.151
+aaatg 0.174
+aaatt 0.335
+aacaa 0.402
+aacac 0.167
+aacag 0.149
+aacat 0.281
+aacca 0.36
+aaccc 0.23
+aaccg 0.116
+aacct 0.294
+aacga 0.355
+aacgc 0.156
+aacgg 0.231
+aacgt 0.259
+aacta 0.28
+aactc 0.192
+aactg 0.156
+aactt 0.372
+aagaa 0.442
+aagac 0.121
+aagag 0.19
+aagat 0.247
+aagca 0.388
+aagcc 0.174
+aagcg 0.0928
+aagct 0.345
+aagga 0.359
+aaggc 0.15
+aaggg 0.236
+aaggt 0.255
+aagta 0.291
+aagtc 0.146
+aagtg 0.203
+aagtt 0.359
+aataa 0.349
+aatac 0.138
+aatag 0.158
+aatat 0.356
+aatca 0.365
+aatcc 0.208
+aatcg 0.103
+aatct 0.324
+aatga 0.341
+aatgc 0.172
+aatgg 0.202
+aatgt 0.285
+aatta 0.29
+aattc 0.158
+aattg 0.169
+aattt 0.383
+acaaa 0.391
+acaac 0.164
+acaag 0.184
+acaat 0.261
+acaca 0.392
+acacc 0.195
+acacg 0.121
+acact 0.292
+acaga 0.345
+acagc 0.179
+acagg 0.171
+acagt 0.304
+acata 0.303
+acatc 0.16
+acatg 0.224
+acatt 0.312
+accaa 0.398
+accac 0.186
+accag 0.141
+accat 0.275
+accca 0.324
+acccc 0.245
+acccg 0.138
+accct 0.293
+accga 0.329
+accgc 0.157
+accgg 0.254
+accgt 0.26
+accta 0.258
+acctc 0.228
+acctg 0.154
+acctt 0.361
+acgaa 0.339
+acgac 0.195
+acgag 0.231
+acgat 0.235
+acgca 0.329
+acgcc 0.242
+acgcg 0.172
+acgct 0.257
+acgga 0.305
+acggc 0.167
+acggg 0.273
+acggt 0.256
+acgta 0.287
+acgtc 0.154
+acgtg 0.274
+acgtt 0.286
+actaa 0.345
+actac 0.176
+actag 0.176
+actat 0.303
+actca 0.314
+actcc 0.249
+actcg 0.121
+actct 0.316
+actga 0.303
+actgc 0.186
+actgg 0.221
+actgt 0.29
+actta 0.231
+acttc 0.19
+acttg 0.211
+acttt 0.368
+agaaa 0.423
+agaac 0.121
+agaag 0.214
+agaat 0.242
+agaca 0.386
+agacc 0.182
+agacg 0.109
+agact 0.322
+agaga 0.411
+agagc 0.144
+agagg 0.195
+agagt 0.249
+agata 0.288
+agatc 0.158
+agatg 0.218
+agatt 0.336
+agcaa 0.374
+agcac 0.147
+agcag 0.18
+agcat 0.3
+agcca 0.401
+agccc 0.21
+agccg 0.128
+agcct 0.262
+agcga 0.32
+agcgc 0.183
+agcgg 0.228
+agcgt 0.269
+agcta 0.277
+agctc 0.187
+agctg 0.194
+agctt 0.343
+aggaa 0.393
+aggac 0.135
+aggag 0.217
+aggat 0.255
+aggca 0.358
+aggcc 0.219
+aggcg 0.136
+aggct 0.287
+aggga 0.33
+agggc 0.154
+agggg 0.243
+agggt 0.273
+aggta 0.279
+aggtc 0.162
+aggtg 0.228
+aggtt 0.332
+agtaa 0.338
+agtac 0.162
+agtag 0.2
+agtat 0.3
+agtca 0.359
+agtcc 0.21
+agtcg 0.118
+agtct 0.312
+agtga 0.316
+agtgc 0.165
+agtgg 0.23
+agtgt 0.289
+agtta 0.257
+agttc 0.175
+agttg 0.212
+agttt 0.356
+ataaa 0.384
+ataac 0.14
+ataag 0.152
+ataat 0.324
+ataca 0.407
+atacc 0.173
+atacg 0.0924
+atact 0.328
+ataga 0.324
+atagc 0.183
+atagg 0.183
+atagt 0.31
+atata 0.387
+atatc 0.12
+atatg 0.153
+atatt 0.34
+atcaa 0.381
+atcac 0.172
+atcag 0.146
+atcat 0.301
+atcca 0.357
+atccc 0.213
+atccg 0.123
+atcct 0.308
+atcga 0.381
+atcgc 0.153
+atcgg 0.215
+atcgt 0.251
+atcta 0.256
+atctc 0.211
+atctg 0.166
+atctt 0.366
+atgaa 0.378
+atgac 0.16
+atgag 0.177
+atgat 0.285
+atgca 0.378
+atgcc 0.181
+atgcg 0.0925
+atgct 0.349
+atgga 0.33
+atggc 0.173
+atggg 0.205
+atggt 0.292
+atgta 0.296
+atgtc 0.157
+atgtg 0.212
+atgtt 0.336
+attaa 0.332
+attac 0.148
+attag 0.166
+attat 0.354
+attca 0.353
+attcc 0.199
+attcg 0.104
+attct 0.344
+attga 0.322
+attgc 0.169
+attgg 0.194
+attgt 0.316
+attta 0.239
+atttc 0.163
+atttg 0.187
+atttt 0.412
+caaaa 0.396
+caaac 0.153
+caaag 0.157
+caaat 0.293
+caaca 0.38
+caacc 0.194
+caacg 0.0891
+caact 0.337
+caaga 0.33
+caagc 0.172
+caagg 0.178
+caagt 0.32
+caata 0.301
+caatc 0.16
+caatg 0.177
+caatt 0.362
+cacaa 0.373
+cacac 0.186
+cacag 0.131
+cacat 0.31
+cacca 0.396
+caccc 0.215
+caccg 0.0992
+cacct 0.29
+cacga 0.284
+cacgc 0.197
+cacgg 0.194
+cacgt 0.325
+cacta 0.273
+cactc 0.167
+cactg 0.168
+cactt 0.392
+cagaa 0.394
+cagac 0.142
+cagag 0.185
+cagat 0.28
+cagca 0.4
+cagcc 0.191
+cagcg 0.0756
+cagct 0.334
+cagga 0.333
+caggc 0.176
+caggg 0.196
+caggt 0.295
+cagta 0.292
+cagtc 0.156
+cagtg 0.203
+cagtt 0.35
+cataa 0.357
+catac 0.148
+catag 0.144
+catat 0.351
+catca 0.367
+catcc 0.193
+catcg 0.0989
+catct 0.342
+catga 0.3
+catgc 0.173
+catgg 0.188
+catgt 0.339
+catta 0.251
+cattc 0.162
+cattg 0.172
+cattt 0.415
+ccaaa 0.427
+ccaac 0.173
+ccaag 0.17
+ccaat 0.231
+ccaca 0.311
+ccacc 0.252
+ccacg 0.128
+ccact 0.308
+ccaga 0.296
+ccagc 0.25
+ccagg 0.146
+ccagt 0.307
+ccata 0.265
+ccatc 0.194
+ccatg 0.195
+ccatt 0.347
+cccaa 0.372
+cccac 0.213
+cccag 0.14
+cccat 0.276
+cccca 0.283
+ccccc 0.318
+ccccg 0.103
+cccct 0.296
+cccga 0.312
+cccgc 0.162
+cccgg 0.219
+cccgt 0.307
+cccta 0.249
+ccctc 0.221
+ccctg 0.124
+ccctt 0.406
+ccgaa 0.344
+ccgac 0.191
+ccgag 0.21
+ccgat 0.256
+ccgca 0.325
+ccgcc 0.272
+ccgcg 0.127
+ccgct 0.276
+ccgga 0.317
+ccggc 0.171
+ccggg 0.224
+ccggt 0.288
+ccgta 0.234
+ccgtc 0.195
+ccgtg 0.223
+ccgtt 0.348
+cctaa 0.34
+cctac 0.193
+cctag 0.168
+cctat 0.299
+cctca 0.291
+cctcc 0.259
+cctcg 0.138
+cctct 0.312
+cctga 0.299
+cctgc 0.225
+cctgg 0.187
+cctgt 0.289
+cctta 0.241
+ccttc 0.206
+ccttg 0.178
+ccttt 0.375
+cgaaa 0.366
+cgaac 0.18
+cgaag 0.192
+cgaat 0.261
+cgaca 0.284
+cgacc 0.304
+cgacg 0.138
+cgact 0.274
+cgaga 0.288
+cgagc 0.196
+cgagg 0.245
+cgagt 0.271
+cgata 0.287
+cgatc 0.18
+cgatg 0.198
+cgatt 0.335
+cgcaa 0.327
+cgcac 0.187
+cgcag 0.195
+cgcat 0.291
+cgcca 0.322
+cgccc 0.256
+cgccg 0.137
+cgcct 0.285
+cgcga 0.27
+cgcgc 0.279
+cgcgg 0.167
+cgcgt 0.284
+cgcta 0.265
+cgctc 0.199
+cgctg 0.173
+cgctt 0.363
+cggaa 0.336
+cggac 0.16
+cggag 0.215
+cggat 0.288
+cggca 0.258
+cggcc 0.252
+cggcg 0.156
+cggct 0.334
+cggga 0.293
+cgggc 0.201
+cgggg 0.201
+cgggt 0.305
+cggta 0.241
+cggtc 0.211
+cggtg 0.204
+cggtt 0.344
+cgtaa 0.31
+cgtac 0.202
+cgtag 0.184
+cgtat 0.304
+cgtca 0.331
+cgtcc 0.224
+cgtcg 0.159
+cgtct 0.285
+cgtga 0.281
+cgtgc 0.182
+cgtgg 0.238
+cgtgt 0.299
+cgtta 0.253
+cgttc 0.175
+cgttg 0.198
+cgttt 0.374
+ctaaa 0.374
+ctaac 0.153
+ctaag 0.16
+ctaat 0.314
+ctaca 0.333
+ctacc 0.214
+ctacg 0.0922
+ctact 0.36
+ctaga 0.315
+ctagc 0.196
+ctagg 0.178
+ctagt 0.312
+ctata 0.296
+ctatc 0.158
+ctatg 0.161
+ctatt 0.385
+ctcaa 0.392
+ctcac 0.172
+ctcag 0.137
+ctcat 0.299
+ctcca 0.364
+ctccc 0.219
+ctccg 0.108
+ctcct 0.309
+ctcga 0.35
+ctcgc 0.152
+ctcgg 0.208
+ctcgt 0.29
+ctcta 0.254
+ctctc 0.237
+ctctg 0.142
+ctctt 0.367
+ctgaa 0.411
+ctgac 0.135
+ctgag 0.168
+ctgat 0.287
+ctgca 0.346
+ctgcc 0.196
+ctgcg 0.104
+ctgct 0.353
+ctgga 0.374
+ctggc 0.168
+ctggg 0.188
+ctggt 0.27
+ctgta 0.256
+ctgtc 0.172
+ctgtg 0.192
+ctgtt 0.38
+cttaa 0.351
+cttac 0.151
+cttag 0.167
+cttat 0.33
+cttca 0.327
+cttcc 0.201
+cttcg 0.0952
+cttct 0.377
+cttga 0.313
+cttgc 0.168
+cttgg 0.202
+cttgt 0.316
+cttta 0.22
+ctttc 0.172
+ctttg 0.178
+ctttt 0.43
+gaaaa 0.429
+gaaac 0.129
+gaaag 0.165
+gaaat 0.276
+gaaca 0.335
+gaacc 0.211
+gaacg 0.101
+gaact 0.354
+gaaga 0.371
+gaagc 0.163
+gaagg 0.194
+gaagt 0.272
+gaata 0.303
+gaatc 0.154
+gaatg 0.179
+gaatt 0.364
+gacaa 0.377
+gacac 0.172
+gacag 0.153
+gacat 0.298
+gacca 0.374
+gaccc 0.222
+gaccg 0.134
+gacct 0.27
+gacga 0.345
+gacgc 0.164
+gacgg 0.237
+gacgt 0.254
+gacta 0.279
+gactc 0.191
+gactg 0.166
+gactt 0.364
+gagaa 0.39
+gagac 0.117
+gagag 0.228
+gagat 0.265
+gagca 0.359
+gagcc 0.192
+gagcg 0.0958
+gagct 0.353
+gagga 0.349
+gaggc 0.153
+gaggg 0.22
+gaggt 0.278
+gagta 0.279
+gagtc 0.159
+gagtg 0.179
+gagtt 0.383
+gataa 0.366
+gatac 0.143
+gatag 0.167
+gatat 0.324
+gatca 0.346
+gatcc 0.219
+gatcg 0.116
+gatct 0.319
+gatga 0.339
+gatgc 0.174
+gatgg 0.212
+gatgt 0.275
+gatta 0.242
+gattc 0.161
+gattg 0.181
+gattt 0.416
+gcaaa 0.385
+gcaac 0.173
+gcaag 0.183
+gcaat 0.26
+gcaca 0.354
+gcacc 0.22
+gcacg 0.13
+gcact 0.296
+gcaga 0.333
+gcagc 0.226
+gcagg 0.179
+gcagt 0.262
+gcata 0.313
+gcatc 0.172
+gcatg 0.194
+gcatt 0.321
+gccaa 0.39
+gccac 0.195
+gccag 0.145
+gccat 0.27
+gccca 0.373
+gcccc 0.207
+gcccg 0.149
+gccct 0.271
+gccga 0.321
+gccgc 0.191
+gccgg 0.23
+gccgt 0.258
+gccta 0.282
+gcctc 0.21
+gcctg 0.152
+gcctt 0.355
+gcgaa 0.359
+gcgac 0.178
+gcgag 0.211
+gcgat 0.252
+gcgca 0.287
+gcgcc 0.246
+gcgcg 0.229
+gcgct 0.238
+gcgga 0.342
+gcggc 0.193
+gcggg 0.225
+gcggt 0.24
+gcgta 0.262
+gcgtc 0.167
+gcgtg 0.28
+gcgtt 0.291
+gctaa 0.322
+gctac 0.181
+gctag 0.19
+gctat 0.307
+gctca 0.334
+gctcc 0.219
+gctcg 0.145
+gctct 0.303
+gctga 0.316
+gctgc 0.214
+gctgg 0.241
+gctgt 0.229
+gctta 0.229
+gcttc 0.208
+gcttg 0.206
+gcttt 0.356
+ggaaa 0.398
+ggaac 0.14
+ggaag 0.208
+ggaat 0.255
+ggaca 0.341
+ggacc 0.227
+ggacg 0.123
+ggact 0.309
+ggaga 0.33
+ggagc 0.151
+ggagg 0.235
+ggagt 0.284
+ggata 0.29
+ggatc 0.172
+ggatg 0.196
+ggatt 0.342
+ggcaa 0.341
+ggcac 0.167
+ggcag 0.193
+ggcat 0.3
+ggcca 0.354
+ggccc 0.235
+ggccg 0.134
+ggcct 0.277
+ggcga 0.299
+ggcgc 0.199
+ggcgg 0.236
+ggcgt 0.266
+ggcta 0.305
+ggctc 0.183
+ggctg 0.2
+ggctt 0.312
+gggaa 0.349
+gggac 0.132
+gggag 0.241
+gggat 0.277
+gggca 0.309
+gggcc 0.239
+gggcg 0.157
+gggct 0.295
+gggga 0.26
+ggggc 0.144
+ggggg 0.318
+ggggt 0.278
+gggta 0.269
+gggtc 0.173
+gggtg 0.22
+gggtt 0.338
+ggtaa 0.343
+ggtac 0.149
+ggtag 0.218
+ggtat 0.29
+ggtca 0.334
+ggtcc 0.223
+ggtcg 0.189
+ggtct 0.254
+ggtga 0.285
+ggtgc 0.174
+ggtgg 0.266
+ggtgt 0.274
+ggtta 0.23
+ggttc 0.191
+ggttg 0.224
+ggttt 0.356
+gtaaa 0.39
+gtaac 0.159
+gtaag 0.153
+gtaat 0.298
+gtaca 0.364
+gtacc 0.172
+gtacg 0.119
+gtact 0.345
+gtaga 0.31
+gtagc 0.183
+gtagg 0.2
+gtagt 0.307
+gtata 0.343
+gtatc 0.14
+gtatg 0.17
+gtatt 0.348
+gtcaa 0.375
+gtcac 0.172
+gtcag 0.131
+gtcat 0.323
+gtcca 0.393
+gtccc 0.186
+gtccg 0.124
+gtcct 0.297
+gtcga 0.301
+gtcgc 0.159
+gtcgg 0.235
+gtcgt 0.305
+gtcta 0.268
+gtctc 0.192
+gtctg 0.172
+gtctt 0.369
+gtgaa 0.358
+gtgac 0.156
+gtgag 0.186
+gtgat 0.299
+gtgca 0.413
+gtgcc 0.179
+gtgcg 0.105
+gtgct 0.303
+gtgga 0.307
+gtggc 0.18
+gtggg 0.229
+gtggt 0.284
+gtgta 0.29
+gtgtc 0.154
+gtgtg 0.216
+gtgtt 0.34
+gttaa 0.333
+gttac 0.168
+gttag 0.172
+gttat 0.326
+gttca 0.36
+gttcc 0.198
+gttcg 0.13
+gttct 0.312
+gttga 0.301
+gttgc 0.172
+gttgg 0.222
+gttgt 0.305
+gttta 0.233
+gtttc 0.169
+gtttg 0.217
+gtttt 0.381
+taaaa 0.407
+taaac 0.133
+taaag 0.157
+taaat 0.303
+taaca 0.37
+taacc 0.174
+taacg 0.0995
+taact 0.357
+taaga 0.311
+taagc 0.168
+taagg 0.212
+taagt 0.309
+taata 0.315
+taatc 0.134
+taatg 0.162
+taatt 0.389
+tacaa 0.381
+tacac 0.18
+tacag 0.127
+tacat 0.312
+tacca 0.364
+taccc 0.227
+taccg 0.102
+tacct 0.307
+tacga 0.295
+tacgc 0.179
+tacgg 0.197
+tacgt 0.33
+tacta 0.289
+tactc 0.174
+tactg 0.161
+tactt 0.376
+tagaa 0.371
+tagac 0.141
+tagag 0.211
+tagat 0.277
+tagca 0.349
+tagcc 0.215
+tagcg 0.0853
+tagct 0.351
+tagga 0.341
+taggc 0.177
+taggg 0.213
+taggt 0.269
+tagta 0.3
+tagtc 0.15
+tagtg 0.189
+tagtt 0.361
+tataa 0.278
+tatac 0.148
+tatag 0.132
+tatat 0.441
+tatca 0.352
+tatcc 0.21
+tatcg 0.106
+tatct 0.332
+tatga 0.298
+tatgc 0.197
+tatgg 0.181
+tatgt 0.324
+tatta 0.262
+tattc 0.147
+tattg 0.157
+tattt 0.434
+tcaaa 0.394
+tcaac 0.161
+tcaag 0.181
+tcaat 0.264
+tcaca 0.345
+tcacc 0.209
+tcacg 0.117
+tcact 0.328
+tcaga 0.312
+tcagc 0.23
+tcagg 0.164
+tcagt 0.295
+tcata 0.266
+tcatc 0.188
+tcatg 0.189
+tcatt 0.356
+tccaa 0.377
+tccac 0.177
+tccag 0.172
+tccat 0.274
+tccca 0.337
+tcccc 0.212
+tcccg 0.123
+tccct 0.329
+tccga 0.32
+tccgc 0.186
+tccgg 0.234
+tccgt 0.259
+tccta 0.253
+tcctc 0.221
+tcctg 0.134
+tcctt 0.392
+tcgaa 0.356
+tcgac 0.149
+tcgag 0.217
+tcgat 0.278
+tcgca 0.3
+tcgcc 0.257
+tcgcg 0.154
+tcgct 0.289
+tcgga 0.318
+tcggc 0.175
+tcggg 0.234
+tcggt 0.273
+tcgta 0.234
+tcgtc 0.19
+tcgtg 0.218
+tcgtt 0.358
+tctaa 0.318
+tctac 0.181
+tctag 0.18
+tctat 0.322
+tctca 0.285
+tctcc 0.22
+tctcg 0.098
+tctct 0.397
+tctga 0.292
+tctgc 0.215
+tctgg 0.194
+tctgt 0.299
+tctta 0.197
+tcttc 0.219
+tcttg 0.184
+tcttt 0.4
+tgaaa 0.376
+tgaac 0.152
+tgaag 0.202
+tgaat 0.27
+tgaca 0.368
+tgacc 0.205
+tgacg 0.109
+tgact 0.318
+tgaga 0.334
+tgagc 0.18
+tgagg 0.206
+tgagt 0.28
+tgata 0.28
+tgatc 0.157
+tgatg 0.215
+tgatt 0.348
+tgcaa 0.346
+tgcac 0.187
+tgcag 0.164
+tgcat 0.303
+tgcca 0.365
+tgccc 0.216
+tgccg 0.0969
+tgcct 0.321
+tgcga 0.284
+tgcgc 0.19
+tgcgg 0.231
+tgcgt 0.295
+tgcta 0.254
+tgctc 0.175
+tgctg 0.215
+tgctt 0.356
+tggaa 0.344
+tggac 0.16
+tggag 0.229
+tggat 0.266
+tggca 0.318
+tggcc 0.219
+tggcg 0.12
+tggct 0.343
+tggga 0.312
+tgggc 0.196
+tgggg 0.214
+tgggt 0.278
+tggta 0.26
+tggtc 0.176
+tggtg 0.245
+tggtt 0.319
+tgtaa 0.318
+tgtac 0.161
+tgtag 0.173
+tgtat 0.348
+tgtca 0.363
+tgtcc 0.203
+tgtcg 0.107
+tgtct 0.327
+tgtga 0.289
+tgtgc 0.172
+tgtgg 0.201
+tgtgt 0.338
+tgtta 0.247
+tgttc 0.153
+tgttg 0.222
+tgttt 0.379
+ttaaa 0.375
+ttaac 0.147
+ttaag 0.166
+ttaat 0.312
+ttaca 0.357
+ttacc 0.197
+ttacg 0.0905
+ttact 0.356
+ttaga 0.299
+ttagc 0.179
+ttagg 0.193
+ttagt 0.329
+ttata 0.281
+ttatc 0.156
+ttatg 0.18
+ttatt 0.383
+ttcaa 0.374
+ttcac 0.158
+ttcag 0.161
+ttcat 0.306
+ttcca 0.343
+ttccc 0.199
+ttccg 0.106
+ttcct 0.352
+ttcga 0.36
+ttcgc 0.161
+ttcgg 0.213
+ttcgt 0.266
+ttcta 0.223
+ttctc 0.202
+ttctg 0.151
+ttctt 0.425
+ttgaa 0.372
+ttgac 0.15
+ttgag 0.187
+ttgat 0.291
+ttgca 0.367
+ttgcc 0.175
+ttgcg 0.0883
+ttgct 0.37
+ttgga 0.324
+ttggc 0.178
+ttggg 0.197
+ttggt 0.301
+ttgta 0.279
+ttgtc 0.153
+ttgtg 0.197
+ttgtt 0.371
+tttaa 0.33
+tttac 0.16
+tttag 0.163
+tttat 0.347
+tttca 0.317
+tttcc 0.2
+tttcg 0.0945
+tttct 0.388
+tttga 0.307
+tttgc 0.16
+tttgg 0.229
+tttgt 0.304
+tttta 0.229
+ttttc 0.18
+ttttg 0.18
+ttttt 0.411
+
+#
+# The emission probabilities of internal and terminal 5' UTR exons
+#
+[EMISSION-5]
+# size of the emission vector
+1024
+#k=
+4
+# patpseudo : pseudocount for sequence patterns
+1
+aaaaa 0.411
+aaaac 0.123
+aaaag 0.173
+aaaat 0.293
+aaaca 0.384
+aaacc 0.182
+aaacg 0.0994
+aaact 0.334
+aaaga 0.368
+aaagc 0.153
+aaagg 0.192
+aaagt 0.287
+aaata 0.34
+aaatc 0.151
+aaatg 0.174
+aaatt 0.335
+aacaa 0.402
+aacac 0.167
+aacag 0.149
+aacat 0.281
+aacca 0.36
+aaccc 0.23
+aaccg 0.116
+aacct 0.294
+aacga 0.355
+aacgc 0.156
+aacgg 0.231
+aacgt 0.259
+aacta 0.28
+aactc 0.192
+aactg 0.156
+aactt 0.372
+aagaa 0.442
+aagac 0.121
+aagag 0.19
+aagat 0.247
+aagca 0.388
+aagcc 0.174
+aagcg 0.0928
+aagct 0.345
+aagga 0.359
+aaggc 0.15
+aaggg 0.236
+aaggt 0.255
+aagta 0.291
+aagtc 0.146
+aagtg 0.203
+aagtt 0.359
+aataa 0.349
+aatac 0.138
+aatag 0.158
+aatat 0.356
+aatca 0.365
+aatcc 0.208
+aatcg 0.103
+aatct 0.324
+aatga 0.341
+aatgc 0.172
+aatgg 0.202
+aatgt 0.285
+aatta 0.29
+aattc 0.158
+aattg 0.169
+aattt 0.383
+acaaa 0.391
+acaac 0.164
+acaag 0.184
+acaat 0.261
+acaca 0.392
+acacc 0.195
+acacg 0.121
+acact 0.292
+acaga 0.345
+acagc 0.179
+acagg 0.171
+acagt 0.304
+acata 0.303
+acatc 0.16
+acatg 0.224
+acatt 0.312
+accaa 0.398
+accac 0.186
+accag 0.141
+accat 0.275
+accca 0.324
+acccc 0.245
+acccg 0.138
+accct 0.293
+accga 0.329
+accgc 0.157
+accgg 0.254
+accgt 0.26
+accta 0.258
+acctc 0.228
+acctg 0.154
+acctt 0.361
+acgaa 0.339
+acgac 0.195
+acgag 0.231
+acgat 0.235
+acgca 0.329
+acgcc 0.242
+acgcg 0.172
+acgct 0.257
+acgga 0.305
+acggc 0.167
+acggg 0.273
+acggt 0.256
+acgta 0.287
+acgtc 0.154
+acgtg 0.274
+acgtt 0.286
+actaa 0.345
+actac 0.176
+actag 0.176
+actat 0.303
+actca 0.314
+actcc 0.249
+actcg 0.121
+actct 0.316
+actga 0.303
+actgc 0.186
+actgg 0.221
+actgt 0.29
+actta 0.231
+acttc 0.19
+acttg 0.211
+acttt 0.368
+agaaa 0.423
+agaac 0.121
+agaag 0.214
+agaat 0.242
+agaca 0.386
+agacc 0.182
+agacg 0.109
+agact 0.322
+agaga 0.411
+agagc 0.144
+agagg 0.195
+agagt 0.249
+agata 0.288
+agatc 0.158
+agatg 0.218
+agatt 0.336
+agcaa 0.374
+agcac 0.147
+agcag 0.18
+agcat 0.3
+agcca 0.401
+agccc 0.21
+agccg 0.128
+agcct 0.262
+agcga 0.32
+agcgc 0.183
+agcgg 0.228
+agcgt 0.269
+agcta 0.277
+agctc 0.187
+agctg 0.194
+agctt 0.343
+aggaa 0.393
+aggac 0.135
+aggag 0.217
+aggat 0.255
+aggca 0.358
+aggcc 0.219
+aggcg 0.136
+aggct 0.287
+aggga 0.33
+agggc 0.154
+agggg 0.243
+agggt 0.273
+aggta 0.279
+aggtc 0.162
+aggtg 0.228
+aggtt 0.332
+agtaa 0.338
+agtac 0.162
+agtag 0.2
+agtat 0.3
+agtca 0.359
+agtcc 0.21
+agtcg 0.118
+agtct 0.312
+agtga 0.316
+agtgc 0.165
+agtgg 0.23
+agtgt 0.289
+agtta 0.257
+agttc 0.175
+agttg 0.212
+agttt 0.356
+ataaa 0.384
+ataac 0.14
+ataag 0.152
+ataat 0.324
+ataca 0.407
+atacc 0.173
+atacg 0.0924
+atact 0.328
+ataga 0.324
+atagc 0.183
+atagg 0.183
+atagt 0.31
+atata 0.387
+atatc 0.12
+atatg 0.153
+atatt 0.34
+atcaa 0.381
+atcac 0.172
+atcag 0.146
+atcat 0.301
+atcca 0.357
+atccc 0.213
+atccg 0.123
+atcct 0.308
+atcga 0.381
+atcgc 0.153
+atcgg 0.215
+atcgt 0.251
+atcta 0.256
+atctc 0.211
+atctg 0.166
+atctt 0.366
+atgaa 0.378
+atgac 0.16
+atgag 0.177
+atgat 0.285
+atgca 0.378
+atgcc 0.181
+atgcg 0.0925
+atgct 0.349
+atgga 0.33
+atggc 0.173
+atggg 0.205
+atggt 0.292
+atgta 0.296
+atgtc 0.157
+atgtg 0.212
+atgtt 0.336
+attaa 0.332
+attac 0.148
+attag 0.166
+attat 0.354
+attca 0.353
+attcc 0.199
+attcg 0.104
+attct 0.344
+attga 0.322
+attgc 0.169
+attgg 0.194
+attgt 0.316
+attta 0.239
+atttc 0.163
+atttg 0.187
+atttt 0.412
+caaaa 0.396
+caaac 0.153
+caaag 0.157
+caaat 0.293
+caaca 0.38
+caacc 0.194
+caacg 0.0891
+caact 0.337
+caaga 0.33
+caagc 0.172
+caagg 0.178
+caagt 0.32
+caata 0.301
+caatc 0.16
+caatg 0.177
+caatt 0.362
+cacaa 0.373
+cacac 0.186
+cacag 0.131
+cacat 0.31
+cacca 0.396
+caccc 0.215
+caccg 0.0992
+cacct 0.29
+cacga 0.284
+cacgc 0.197
+cacgg 0.194
+cacgt 0.325
+cacta 0.273
+cactc 0.167
+cactg 0.168
+cactt 0.392
+cagaa 0.394
+cagac 0.142
+cagag 0.185
+cagat 0.28
+cagca 0.4
+cagcc 0.191
+cagcg 0.0756
+cagct 0.334
+cagga 0.333
+caggc 0.176
+caggg 0.196
+caggt 0.295
+cagta 0.292
+cagtc 0.156
+cagtg 0.203
+cagtt 0.35
+cataa 0.357
+catac 0.148
+catag 0.144
+catat 0.351
+catca 0.367
+catcc 0.193
+catcg 0.0989
+catct 0.342
+catga 0.3
+catgc 0.173
+catgg 0.188
+catgt 0.339
+catta 0.251
+cattc 0.162
+cattg 0.172
+cattt 0.415
+ccaaa 0.427
+ccaac 0.173
+ccaag 0.17
+ccaat 0.231
+ccaca 0.311
+ccacc 0.252
+ccacg 0.128
+ccact 0.308
+ccaga 0.296
+ccagc 0.25
+ccagg 0.146
+ccagt 0.307
+ccata 0.265
+ccatc 0.194
+ccatg 0.195
+ccatt 0.347
+cccaa 0.372
+cccac 0.213
+cccag 0.14
+cccat 0.276
+cccca 0.283
+ccccc 0.318
+ccccg 0.103
+cccct 0.296
+cccga 0.312
+cccgc 0.162
+cccgg 0.219
+cccgt 0.307
+cccta 0.249
+ccctc 0.221
+ccctg 0.124
+ccctt 0.406
+ccgaa 0.344
+ccgac 0.191
+ccgag 0.21
+ccgat 0.256
+ccgca 0.325
+ccgcc 0.272
+ccgcg 0.127
+ccgct 0.276
+ccgga 0.317
+ccggc 0.171
+ccggg 0.224
+ccggt 0.288
+ccgta 0.234
+ccgtc 0.195
+ccgtg 0.223
+ccgtt 0.348
+cctaa 0.34
+cctac 0.193
+cctag 0.168
+cctat 0.299
+cctca 0.291
+cctcc 0.259
+cctcg 0.138
+cctct 0.312
+cctga 0.299
+cctgc 0.225
+cctgg 0.187
+cctgt 0.289
+cctta 0.241
+ccttc 0.206
+ccttg 0.178
+ccttt 0.375
+cgaaa 0.366
+cgaac 0.18
+cgaag 0.192
+cgaat 0.261
+cgaca 0.284
+cgacc 0.304
+cgacg 0.138
+cgact 0.274
+cgaga 0.288
+cgagc 0.196
+cgagg 0.245
+cgagt 0.271
+cgata 0.287
+cgatc 0.18
+cgatg 0.198
+cgatt 0.335
+cgcaa 0.327
+cgcac 0.187
+cgcag 0.195
+cgcat 0.291
+cgcca 0.322
+cgccc 0.256
+cgccg 0.137
+cgcct 0.285
+cgcga 0.27
+cgcgc 0.279
+cgcgg 0.167
+cgcgt 0.284
+cgcta 0.265
+cgctc 0.199
+cgctg 0.173
+cgctt 0.363
+cggaa 0.336
+cggac 0.16
+cggag 0.215
+cggat 0.288
+cggca 0.258
+cggcc 0.252
+cggcg 0.156
+cggct 0.334
+cggga 0.293
+cgggc 0.201
+cgggg 0.201
+cgggt 0.305
+cggta 0.241
+cggtc 0.211
+cggtg 0.204
+cggtt 0.344
+cgtaa 0.31
+cgtac 0.202
+cgtag 0.184
+cgtat 0.304
+cgtca 0.331
+cgtcc 0.224
+cgtcg 0.159
+cgtct 0.285
+cgtga 0.281
+cgtgc 0.182
+cgtgg 0.238
+cgtgt 0.299
+cgtta 0.253
+cgttc 0.175
+cgttg 0.198
+cgttt 0.374
+ctaaa 0.374
+ctaac 0.153
+ctaag 0.16
+ctaat 0.314
+ctaca 0.333
+ctacc 0.214
+ctacg 0.0922
+ctact 0.36
+ctaga 0.315
+ctagc 0.196
+ctagg 0.178
+ctagt 0.312
+ctata 0.296
+ctatc 0.158
+ctatg 0.161
+ctatt 0.385
+ctcaa 0.392
+ctcac 0.172
+ctcag 0.137
+ctcat 0.299
+ctcca 0.364
+ctccc 0.219
+ctccg 0.108
+ctcct 0.309
+ctcga 0.35
+ctcgc 0.152
+ctcgg 0.208
+ctcgt 0.29
+ctcta 0.254
+ctctc 0.237
+ctctg 0.142
+ctctt 0.367
+ctgaa 0.411
+ctgac 0.135
+ctgag 0.168
+ctgat 0.287
+ctgca 0.346
+ctgcc 0.196
+ctgcg 0.104
+ctgct 0.353
+ctgga 0.374
+ctggc 0.168
+ctggg 0.188
+ctggt 0.27
+ctgta 0.256
+ctgtc 0.172
+ctgtg 0.192
+ctgtt 0.38
+cttaa 0.351
+cttac 0.151
+cttag 0.167
+cttat 0.33
+cttca 0.327
+cttcc 0.201
+cttcg 0.0952
+cttct 0.377
+cttga 0.313
+cttgc 0.168
+cttgg 0.202
+cttgt 0.316
+cttta 0.22
+ctttc 0.172
+ctttg 0.178
+ctttt 0.43
+gaaaa 0.429
+gaaac 0.129
+gaaag 0.165
+gaaat 0.276
+gaaca 0.335
+gaacc 0.211
+gaacg 0.101
+gaact 0.354
+gaaga 0.371
+gaagc 0.163
+gaagg 0.194
+gaagt 0.272
+gaata 0.303
+gaatc 0.154
+gaatg 0.179
+gaatt 0.364
+gacaa 0.377
+gacac 0.172
+gacag 0.153
+gacat 0.298
+gacca 0.374
+gaccc 0.222
+gaccg 0.134
+gacct 0.27
+gacga 0.345
+gacgc 0.164
+gacgg 0.237
+gacgt 0.254
+gacta 0.279
+gactc 0.191
+gactg 0.166
+gactt 0.364
+gagaa 0.39
+gagac 0.117
+gagag 0.228
+gagat 0.265
+gagca 0.359
+gagcc 0.192
+gagcg 0.0958
+gagct 0.353
+gagga 0.349
+gaggc 0.153
+gaggg 0.22
+gaggt 0.278
+gagta 0.279
+gagtc 0.159
+gagtg 0.179
+gagtt 0.383
+gataa 0.366
+gatac 0.143
+gatag 0.167
+gatat 0.324
+gatca 0.346
+gatcc 0.219
+gatcg 0.116
+gatct 0.319
+gatga 0.339
+gatgc 0.174
+gatgg 0.212
+gatgt 0.275
+gatta 0.242
+gattc 0.161
+gattg 0.181
+gattt 0.416
+gcaaa 0.385
+gcaac 0.173
+gcaag 0.183
+gcaat 0.26
+gcaca 0.354
+gcacc 0.22
+gcacg 0.13
+gcact 0.296
+gcaga 0.333
+gcagc 0.226
+gcagg 0.179
+gcagt 0.262
+gcata 0.313
+gcatc 0.172
+gcatg 0.194
+gcatt 0.321
+gccaa 0.39
+gccac 0.195
+gccag 0.145
+gccat 0.27
+gccca 0.373
+gcccc 0.207
+gcccg 0.149
+gccct 0.271
+gccga 0.321
+gccgc 0.191
+gccgg 0.23
+gccgt 0.258
+gccta 0.282
+gcctc 0.21
+gcctg 0.152
+gcctt 0.355
+gcgaa 0.359
+gcgac 0.178
+gcgag 0.211
+gcgat 0.252
+gcgca 0.287
+gcgcc 0.246
+gcgcg 0.229
+gcgct 0.238
+gcgga 0.342
+gcggc 0.193
+gcggg 0.225
+gcggt 0.24
+gcgta 0.262
+gcgtc 0.167
+gcgtg 0.28
+gcgtt 0.291
+gctaa 0.322
+gctac 0.181
+gctag 0.19
+gctat 0.307
+gctca 0.334
+gctcc 0.219
+gctcg 0.145
+gctct 0.303
+gctga 0.316
+gctgc 0.214
+gctgg 0.241
+gctgt 0.229
+gctta 0.229
+gcttc 0.208
+gcttg 0.206
+gcttt 0.356
+ggaaa 0.398
+ggaac 0.14
+ggaag 0.208
+ggaat 0.255
+ggaca 0.341
+ggacc 0.227
+ggacg 0.123
+ggact 0.309
+ggaga 0.33
+ggagc 0.151
+ggagg 0.235
+ggagt 0.284
+ggata 0.29
+ggatc 0.172
+ggatg 0.196
+ggatt 0.342
+ggcaa 0.341
+ggcac 0.167
+ggcag 0.193
+ggcat 0.3
+ggcca 0.354
+ggccc 0.235
+ggccg 0.134
+ggcct 0.277
+ggcga 0.299
+ggcgc 0.199
+ggcgg 0.236
+ggcgt 0.266
+ggcta 0.305
+ggctc 0.183
+ggctg 0.2
+ggctt 0.312
+gggaa 0.349
+gggac 0.132
+gggag 0.241
+gggat 0.277
+gggca 0.309
+gggcc 0.239
+gggcg 0.157
+gggct 0.295
+gggga 0.26
+ggggc 0.144
+ggggg 0.318
+ggggt 0.278
+gggta 0.269
+gggtc 0.173
+gggtg 0.22
+gggtt 0.338
+ggtaa 0.343
+ggtac 0.149
+ggtag 0.218
+ggtat 0.29
+ggtca 0.334
+ggtcc 0.223
+ggtcg 0.189
+ggtct 0.254
+ggtga 0.285
+ggtgc 0.174
+ggtgg 0.266
+ggtgt 0.274
+ggtta 0.23
+ggttc 0.191
+ggttg 0.224
+ggttt 0.356
+gtaaa 0.39
+gtaac 0.159
+gtaag 0.153
+gtaat 0.298
+gtaca 0.364
+gtacc 0.172
+gtacg 0.119
+gtact 0.345
+gtaga 0.31
+gtagc 0.183
+gtagg 0.2
+gtagt 0.307
+gtata 0.343
+gtatc 0.14
+gtatg 0.17
+gtatt 0.348
+gtcaa 0.375
+gtcac 0.172
+gtcag 0.131
+gtcat 0.323
+gtcca 0.393
+gtccc 0.186
+gtccg 0.124
+gtcct 0.297
+gtcga 0.301
+gtcgc 0.159
+gtcgg 0.235
+gtcgt 0.305
+gtcta 0.268
+gtctc 0.192
+gtctg 0.172
+gtctt 0.369
+gtgaa 0.358
+gtgac 0.156
+gtgag 0.186
+gtgat 0.299
+gtgca 0.413
+gtgcc 0.179
+gtgcg 0.105
+gtgct 0.303
+gtgga 0.307
+gtggc 0.18
+gtggg 0.229
+gtggt 0.284
+gtgta 0.29
+gtgtc 0.154
+gtgtg 0.216
+gtgtt 0.34
+gttaa 0.333
+gttac 0.168
+gttag 0.172
+gttat 0.326
+gttca 0.36
+gttcc 0.198
+gttcg 0.13
+gttct 0.312
+gttga 0.301
+gttgc 0.172
+gttgg 0.222
+gttgt 0.305
+gttta 0.233
+gtttc 0.169
+gtttg 0.217
+gtttt 0.381
+taaaa 0.407
+taaac 0.133
+taaag 0.157
+taaat 0.303
+taaca 0.37
+taacc 0.174
+taacg 0.0995
+taact 0.357
+taaga 0.311
+taagc 0.168
+taagg 0.212
+taagt 0.309
+taata 0.315
+taatc 0.134
+taatg 0.162
+taatt 0.389
+tacaa 0.381
+tacac 0.18
+tacag 0.127
+tacat 0.312
+tacca 0.364
+taccc 0.227
+taccg 0.102
+tacct 0.307
+tacga 0.295
+tacgc 0.179
+tacgg 0.197
+tacgt 0.33
+tacta 0.289
+tactc 0.174
+tactg 0.161
+tactt 0.376
+tagaa 0.371
+tagac 0.141
+tagag 0.211
+tagat 0.277
+tagca 0.349
+tagcc 0.215
+tagcg 0.0853
+tagct 0.351
+tagga 0.341
+taggc 0.177
+taggg 0.213
+taggt 0.269
+tagta 0.3
+tagtc 0.15
+tagtg 0.189
+tagtt 0.361
+tataa 0.278
+tatac 0.148
+tatag 0.132
+tatat 0.441
+tatca 0.352
+tatcc 0.21
+tatcg 0.106
+tatct 0.332
+tatga 0.298
+tatgc 0.197
+tatgg 0.181
+tatgt 0.324
+tatta 0.262
+tattc 0.147
+tattg 0.157
+tattt 0.434
+tcaaa 0.394
+tcaac 0.161
+tcaag 0.181
+tcaat 0.264
+tcaca 0.345
+tcacc 0.209
+tcacg 0.117
+tcact 0.328
+tcaga 0.312
+tcagc 0.23
+tcagg 0.164
+tcagt 0.295
+tcata 0.266
+tcatc 0.188
+tcatg 0.189
+tcatt 0.356
+tccaa 0.377
+tccac 0.177
+tccag 0.172
+tccat 0.274
+tccca 0.337
+tcccc 0.212
+tcccg 0.123
+tccct 0.329
+tccga 0.32
+tccgc 0.186
+tccgg 0.234
+tccgt 0.259
+tccta 0.253
+tcctc 0.221
+tcctg 0.134
+tcctt 0.392
+tcgaa 0.356
+tcgac 0.149
+tcgag 0.217
+tcgat 0.278
+tcgca 0.3
+tcgcc 0.257
+tcgcg 0.154
+tcgct 0.289
+tcgga 0.318
+tcggc 0.175
+tcggg 0.234
+tcggt 0.273
+tcgta 0.234
+tcgtc 0.19
+tcgtg 0.218
+tcgtt 0.358
+tctaa 0.318
+tctac 0.181
+tctag 0.18
+tctat 0.322
+tctca 0.285
+tctcc 0.22
+tctcg 0.098
+tctct 0.397
+tctga 0.292
+tctgc 0.215
+tctgg 0.194
+tctgt 0.299
+tctta 0.197
+tcttc 0.219
+tcttg 0.184
+tcttt 0.4
+tgaaa 0.376
+tgaac 0.152
+tgaag 0.202
+tgaat 0.27
+tgaca 0.368
+tgacc 0.205
+tgacg 0.109
+tgact 0.318
+tgaga 0.334
+tgagc 0.18
+tgagg 0.206
+tgagt 0.28
+tgata 0.28
+tgatc 0.157
+tgatg 0.215
+tgatt 0.348
+tgcaa 0.346
+tgcac 0.187
+tgcag 0.164
+tgcat 0.303
+tgcca 0.365
+tgccc 0.216
+tgccg 0.0969
+tgcct 0.321
+tgcga 0.284
+tgcgc 0.19
+tgcgg 0.231
+tgcgt 0.295
+tgcta 0.254
+tgctc 0.175
+tgctg 0.215
+tgctt 0.356
+tggaa 0.344
+tggac 0.16
+tggag 0.229
+tggat 0.266
+tggca 0.318
+tggcc 0.219
+tggcg 0.12
+tggct 0.343
+tggga 0.312
+tgggc 0.196
+tgggg 0.214
+tgggt 0.278
+tggta 0.26
+tggtc 0.176
+tggtg 0.245
+tggtt 0.319
+tgtaa 0.318
+tgtac 0.161
+tgtag 0.173
+tgtat 0.348
+tgtca 0.363
+tgtcc 0.203
+tgtcg 0.107
+tgtct 0.327
+tgtga 0.289
+tgtgc 0.172
+tgtgg 0.201
+tgtgt 0.338
+tgtta 0.247
+tgttc 0.153
+tgttg 0.222
+tgttt 0.379
+ttaaa 0.375
+ttaac 0.147
+ttaag 0.166
+ttaat 0.312
+ttaca 0.357
+ttacc 0.197
+ttacg 0.0905
+ttact 0.356
+ttaga 0.299
+ttagc 0.179
+ttagg 0.193
+ttagt 0.329
+ttata 0.281
+ttatc 0.156
+ttatg 0.18
+ttatt 0.383
+ttcaa 0.374
+ttcac 0.158
+ttcag 0.161
+ttcat 0.306
+ttcca 0.343
+ttccc 0.199
+ttccg 0.106
+ttcct 0.352
+ttcga 0.36
+ttcgc 0.161
+ttcgg 0.213
+ttcgt 0.266
+ttcta 0.223
+ttctc 0.202
+ttctg 0.151
+ttctt 0.425
+ttgaa 0.372
+ttgac 0.15
+ttgag 0.187
+ttgat 0.291
+ttgca 0.367
+ttgcc 0.175
+ttgcg 0.0883
+ttgct 0.37
+ttgga 0.324
+ttggc 0.178
+ttggg 0.197
+ttggt 0.301
+ttgta 0.279
+ttgtc 0.153
+ttgtg 0.197
+ttgtt 0.371
+tttaa 0.33
+tttac 0.16
+tttag 0.163
+tttat 0.347
+tttca 0.317
+tttcc 0.2
+tttcg 0.0945
+tttct 0.388
+tttga 0.307
+tttgc 0.16
+tttgg 0.229
+tttgt 0.304
+tttta 0.229
+ttttc 0.18
+ttttg 0.18
+ttttt 0.411
+
+#
+# The emission probabilities of 3' UTR exons
+#
+[EMISSION-3]
+# size of the emission vector
+1024
+#k=
+4
+# patpseudo : pseudocount for sequence patterns
+1
+aaaaa 0.411
+aaaac 0.123
+aaaag 0.173
+aaaat 0.293
+aaaca 0.384
+aaacc 0.182
+aaacg 0.0994
+aaact 0.334
+aaaga 0.368
+aaagc 0.153
+aaagg 0.192
+aaagt 0.287
+aaata 0.34
+aaatc 0.151
+aaatg 0.174
+aaatt 0.335
+aacaa 0.402
+aacac 0.167
+aacag 0.149
+aacat 0.281
+aacca 0.36
+aaccc 0.23
+aaccg 0.116
+aacct 0.294
+aacga 0.355
+aacgc 0.156
+aacgg 0.231
+aacgt 0.259
+aacta 0.28
+aactc 0.192
+aactg 0.156
+aactt 0.372
+aagaa 0.442
+aagac 0.121
+aagag 0.19
+aagat 0.247
+aagca 0.388
+aagcc 0.174
+aagcg 0.0928
+aagct 0.345
+aagga 0.359
+aaggc 0.15
+aaggg 0.236
+aaggt 0.255
+aagta 0.291
+aagtc 0.146
+aagtg 0.203
+aagtt 0.359
+aataa 0.349
+aatac 0.138
+aatag 0.158
+aatat 0.356
+aatca 0.365
+aatcc 0.208
+aatcg 0.103
+aatct 0.324
+aatga 0.341
+aatgc 0.172
+aatgg 0.202
+aatgt 0.285
+aatta 0.29
+aattc 0.158
+aattg 0.169
+aattt 0.383
+acaaa 0.391
+acaac 0.164
+acaag 0.184
+acaat 0.261
+acaca 0.392
+acacc 0.195
+acacg 0.121
+acact 0.292
+acaga 0.345
+acagc 0.179
+acagg 0.171
+acagt 0.304
+acata 0.303
+acatc 0.16
+acatg 0.224
+acatt 0.312
+accaa 0.398
+accac 0.186
+accag 0.141
+accat 0.275
+accca 0.324
+acccc 0.245
+acccg 0.138
+accct 0.293
+accga 0.329
+accgc 0.157
+accgg 0.254
+accgt 0.26
+accta 0.258
+acctc 0.228
+acctg 0.154
+acctt 0.361
+acgaa 0.339
+acgac 0.195
+acgag 0.231
+acgat 0.235
+acgca 0.329
+acgcc 0.242
+acgcg 0.172
+acgct 0.257
+acgga 0.305
+acggc 0.167
+acggg 0.273
+acggt 0.256
+acgta 0.287
+acgtc 0.154
+acgtg 0.274
+acgtt 0.286
+actaa 0.345
+actac 0.176
+actag 0.176
+actat 0.303
+actca 0.314
+actcc 0.249
+actcg 0.121
+actct 0.316
+actga 0.303
+actgc 0.186
+actgg 0.221
+actgt 0.29
+actta 0.231
+acttc 0.19
+acttg 0.211
+acttt 0.368
+agaaa 0.423
+agaac 0.121
+agaag 0.214
+agaat 0.242
+agaca 0.386
+agacc 0.182
+agacg 0.109
+agact 0.322
+agaga 0.411
+agagc 0.144
+agagg 0.195
+agagt 0.249
+agata 0.288
+agatc 0.158
+agatg 0.218
+agatt 0.336
+agcaa 0.374
+agcac 0.147
+agcag 0.18
+agcat 0.3
+agcca 0.401
+agccc 0.21
+agccg 0.128
+agcct 0.262
+agcga 0.32
+agcgc 0.183
+agcgg 0.228
+agcgt 0.269
+agcta 0.277
+agctc 0.187
+agctg 0.194
+agctt 0.343
+aggaa 0.393
+aggac 0.135
+aggag 0.217
+aggat 0.255
+aggca 0.358
+aggcc 0.219
+aggcg 0.136
+aggct 0.287
+aggga 0.33
+agggc 0.154
+agggg 0.243
+agggt 0.273
+aggta 0.279
+aggtc 0.162
+aggtg 0.228
+aggtt 0.332
+agtaa 0.338
+agtac 0.162
+agtag 0.2
+agtat 0.3
+agtca 0.359
+agtcc 0.21
+agtcg 0.118
+agtct 0.312
+agtga 0.316
+agtgc 0.165
+agtgg 0.23
+agtgt 0.289
+agtta 0.257
+agttc 0.175
+agttg 0.212
+agttt 0.356
+ataaa 0.384
+ataac 0.14
+ataag 0.152
+ataat 0.324
+ataca 0.407
+atacc 0.173
+atacg 0.0924
+atact 0.328
+ataga 0.324
+atagc 0.183
+atagg 0.183
+atagt 0.31
+atata 0.387
+atatc 0.12
+atatg 0.153
+atatt 0.34
+atcaa 0.381
+atcac 0.172
+atcag 0.146
+atcat 0.301
+atcca 0.357
+atccc 0.213
+atccg 0.123
+atcct 0.308
+atcga 0.381
+atcgc 0.153
+atcgg 0.215
+atcgt 0.251
+atcta 0.256
+atctc 0.211
+atctg 0.166
+atctt 0.366
+atgaa 0.378
+atgac 0.16
+atgag 0.177
+atgat 0.285
+atgca 0.378
+atgcc 0.181
+atgcg 0.0925
+atgct 0.349
+atgga 0.33
+atggc 0.173
+atggg 0.205
+atggt 0.292
+atgta 0.296
+atgtc 0.157
+atgtg 0.212
+atgtt 0.336
+attaa 0.332
+attac 0.148
+attag 0.166
+attat 0.354
+attca 0.353
+attcc 0.199
+attcg 0.104
+attct 0.344
+attga 0.322
+attgc 0.169
+attgg 0.194
+attgt 0.316
+attta 0.239
+atttc 0.163
+atttg 0.187
+atttt 0.412
+caaaa 0.396
+caaac 0.153
+caaag 0.157
+caaat 0.293
+caaca 0.38
+caacc 0.194
+caacg 0.0891
+caact 0.337
+caaga 0.33
+caagc 0.172
+caagg 0.178
+caagt 0.32
+caata 0.301
+caatc 0.16
+caatg 0.177
+caatt 0.362
+cacaa 0.373
+cacac 0.186
+cacag 0.131
+cacat 0.31
+cacca 0.396
+caccc 0.215
+caccg 0.0992
+cacct 0.29
+cacga 0.284
+cacgc 0.197
+cacgg 0.194
+cacgt 0.325
+cacta 0.273
+cactc 0.167
+cactg 0.168
+cactt 0.392
+cagaa 0.394
+cagac 0.142
+cagag 0.185
+cagat 0.28
+cagca 0.4
+cagcc 0.191
+cagcg 0.0756
+cagct 0.334
+cagga 0.333
+caggc 0.176
+caggg 0.196
+caggt 0.295
+cagta 0.292
+cagtc 0.156
+cagtg 0.203
+cagtt 0.35
+cataa 0.357
+catac 0.148
+catag 0.144
+catat 0.351
+catca 0.367
+catcc 0.193
+catcg 0.0989
+catct 0.342
+catga 0.3
+catgc 0.173
+catgg 0.188
+catgt 0.339
+catta 0.251
+cattc 0.162
+cattg 0.172
+cattt 0.415
+ccaaa 0.427
+ccaac 0.173
+ccaag 0.17
+ccaat 0.231
+ccaca 0.311
+ccacc 0.252
+ccacg 0.128
+ccact 0.308
+ccaga 0.296
+ccagc 0.25
+ccagg 0.146
+ccagt 0.307
+ccata 0.265
+ccatc 0.194
+ccatg 0.195
+ccatt 0.347
+cccaa 0.372
+cccac 0.213
+cccag 0.14
+cccat 0.276
+cccca 0.283
+ccccc 0.318
+ccccg 0.103
+cccct 0.296
+cccga 0.312
+cccgc 0.162
+cccgg 0.219
+cccgt 0.307
+cccta 0.249
+ccctc 0.221
+ccctg 0.124
+ccctt 0.406
+ccgaa 0.344
+ccgac 0.191
+ccgag 0.21
+ccgat 0.256
+ccgca 0.325
+ccgcc 0.272
+ccgcg 0.127
+ccgct 0.276
+ccgga 0.317
+ccggc 0.171
+ccggg 0.224
+ccggt 0.288
+ccgta 0.234
+ccgtc 0.195
+ccgtg 0.223
+ccgtt 0.348
+cctaa 0.34
+cctac 0.193
+cctag 0.168
+cctat 0.299
+cctca 0.291
+cctcc 0.259
+cctcg 0.138
+cctct 0.312
+cctga 0.299
+cctgc 0.225
+cctgg 0.187
+cctgt 0.289
+cctta 0.241
+ccttc 0.206
+ccttg 0.178
+ccttt 0.375
+cgaaa 0.366
+cgaac 0.18
+cgaag 0.192
+cgaat 0.261
+cgaca 0.284
+cgacc 0.304
+cgacg 0.138
+cgact 0.274
+cgaga 0.288
+cgagc 0.196
+cgagg 0.245
+cgagt 0.271
+cgata 0.287
+cgatc 0.18
+cgatg 0.198
+cgatt 0.335
+cgcaa 0.327
+cgcac 0.187
+cgcag 0.195
+cgcat 0.291
+cgcca 0.322
+cgccc 0.256
+cgccg 0.137
+cgcct 0.285
+cgcga 0.27
+cgcgc 0.279
+cgcgg 0.167
+cgcgt 0.284
+cgcta 0.265
+cgctc 0.199
+cgctg 0.173
+cgctt 0.363
+cggaa 0.336
+cggac 0.16
+cggag 0.215
+cggat 0.288
+cggca 0.258
+cggcc 0.252
+cggcg 0.156
+cggct 0.334
+cggga 0.293
+cgggc 0.201
+cgggg 0.201
+cgggt 0.305
+cggta 0.241
+cggtc 0.211
+cggtg 0.204
+cggtt 0.344
+cgtaa 0.31
+cgtac 0.202
+cgtag 0.184
+cgtat 0.304
+cgtca 0.331
+cgtcc 0.224
+cgtcg 0.159
+cgtct 0.285
+cgtga 0.281
+cgtgc 0.182
+cgtgg 0.238
+cgtgt 0.299
+cgtta 0.253
+cgttc 0.175
+cgttg 0.198
+cgttt 0.374
+ctaaa 0.374
+ctaac 0.153
+ctaag 0.16
+ctaat 0.314
+ctaca 0.333
+ctacc 0.214
+ctacg 0.0922
+ctact 0.36
+ctaga 0.315
+ctagc 0.196
+ctagg 0.178
+ctagt 0.312
+ctata 0.296
+ctatc 0.158
+ctatg 0.161
+ctatt 0.385
+ctcaa 0.392
+ctcac 0.172
+ctcag 0.137
+ctcat 0.299
+ctcca 0.364
+ctccc 0.219
+ctccg 0.108
+ctcct 0.309
+ctcga 0.35
+ctcgc 0.152
+ctcgg 0.208
+ctcgt 0.29
+ctcta 0.254
+ctctc 0.237
+ctctg 0.142
+ctctt 0.367
+ctgaa 0.411
+ctgac 0.135
+ctgag 0.168
+ctgat 0.287
+ctgca 0.346
+ctgcc 0.196
+ctgcg 0.104
+ctgct 0.353
+ctgga 0.374
+ctggc 0.168
+ctggg 0.188
+ctggt 0.27
+ctgta 0.256
+ctgtc 0.172
+ctgtg 0.192
+ctgtt 0.38
+cttaa 0.351
+cttac 0.151
+cttag 0.167
+cttat 0.33
+cttca 0.327
+cttcc 0.201
+cttcg 0.0952
+cttct 0.377
+cttga 0.313
+cttgc 0.168
+cttgg 0.202
+cttgt 0.316
+cttta 0.22
+ctttc 0.172
+ctttg 0.178
+ctttt 0.43
+gaaaa 0.429
+gaaac 0.129
+gaaag 0.165
+gaaat 0.276
+gaaca 0.335
+gaacc 0.211
+gaacg 0.101
+gaact 0.354
+gaaga 0.371
+gaagc 0.163
+gaagg 0.194
+gaagt 0.272
+gaata 0.303
+gaatc 0.154
+gaatg 0.179
+gaatt 0.364
+gacaa 0.377
+gacac 0.172
+gacag 0.153
+gacat 0.298
+gacca 0.374
+gaccc 0.222
+gaccg 0.134
+gacct 0.27
+gacga 0.345
+gacgc 0.164
+gacgg 0.237
+gacgt 0.254
+gacta 0.279
+gactc 0.191
+gactg 0.166
+gactt 0.364
+gagaa 0.39
+gagac 0.117
+gagag 0.228
+gagat 0.265
+gagca 0.359
+gagcc 0.192
+gagcg 0.0958
+gagct 0.353
+gagga 0.349
+gaggc 0.153
+gaggg 0.22
+gaggt 0.278
+gagta 0.279
+gagtc 0.159
+gagtg 0.179
+gagtt 0.383
+gataa 0.366
+gatac 0.143
+gatag 0.167
+gatat 0.324
+gatca 0.346
+gatcc 0.219
+gatcg 0.116
+gatct 0.319
+gatga 0.339
+gatgc 0.174
+gatgg 0.212
+gatgt 0.275
+gatta 0.242
+gattc 0.161
+gattg 0.181
+gattt 0.416
+gcaaa 0.385
+gcaac 0.173
+gcaag 0.183
+gcaat 0.26
+gcaca 0.354
+gcacc 0.22
+gcacg 0.13
+gcact 0.296
+gcaga 0.333
+gcagc 0.226
+gcagg 0.179
+gcagt 0.262
+gcata 0.313
+gcatc 0.172
+gcatg 0.194
+gcatt 0.321
+gccaa 0.39
+gccac 0.195
+gccag 0.145
+gccat 0.27
+gccca 0.373
+gcccc 0.207
+gcccg 0.149
+gccct 0.271
+gccga 0.321
+gccgc 0.191
+gccgg 0.23
+gccgt 0.258
+gccta 0.282
+gcctc 0.21
+gcctg 0.152
+gcctt 0.355
+gcgaa 0.359
+gcgac 0.178
+gcgag 0.211
+gcgat 0.252
+gcgca 0.287
+gcgcc 0.246
+gcgcg 0.229
+gcgct 0.238
+gcgga 0.342
+gcggc 0.193
+gcggg 0.225
+gcggt 0.24
+gcgta 0.262
+gcgtc 0.167
+gcgtg 0.28
+gcgtt 0.291
+gctaa 0.322
+gctac 0.181
+gctag 0.19
+gctat 0.307
+gctca 0.334
+gctcc 0.219
+gctcg 0.145
+gctct 0.303
+gctga 0.316
+gctgc 0.214
+gctgg 0.241
+gctgt 0.229
+gctta 0.229
+gcttc 0.208
+gcttg 0.206
+gcttt 0.356
+ggaaa 0.398
+ggaac 0.14
+ggaag 0.208
+ggaat 0.255
+ggaca 0.341
+ggacc 0.227
+ggacg 0.123
+ggact 0.309
+ggaga 0.33
+ggagc 0.151
+ggagg 0.235
+ggagt 0.284
+ggata 0.29
+ggatc 0.172
+ggatg 0.196
+ggatt 0.342
+ggcaa 0.341
+ggcac 0.167
+ggcag 0.193
+ggcat 0.3
+ggcca 0.354
+ggccc 0.235
+ggccg 0.134
+ggcct 0.277
+ggcga 0.299
+ggcgc 0.199
+ggcgg 0.236
+ggcgt 0.266
+ggcta 0.305
+ggctc 0.183
+ggctg 0.2
+ggctt 0.312
+gggaa 0.349
+gggac 0.132
+gggag 0.241
+gggat 0.277
+gggca 0.309
+gggcc 0.239
+gggcg 0.157
+gggct 0.295
+gggga 0.26
+ggggc 0.144
+ggggg 0.318
+ggggt 0.278
+gggta 0.269
+gggtc 0.173
+gggtg 0.22
+gggtt 0.338
+ggtaa 0.343
+ggtac 0.149
+ggtag 0.218
+ggtat 0.29
+ggtca 0.334
+ggtcc 0.223
+ggtcg 0.189
+ggtct 0.254
+ggtga 0.285
+ggtgc 0.174
+ggtgg 0.266
+ggtgt 0.274
+ggtta 0.23
+ggttc 0.191
+ggttg 0.224
+ggttt 0.356
+gtaaa 0.39
+gtaac 0.159
+gtaag 0.153
+gtaat 0.298
+gtaca 0.364
+gtacc 0.172
+gtacg 0.119
+gtact 0.345
+gtaga 0.31
+gtagc 0.183
+gtagg 0.2
+gtagt 0.307
+gtata 0.343
+gtatc 0.14
+gtatg 0.17
+gtatt 0.348
+gtcaa 0.375
+gtcac 0.172
+gtcag 0.131
+gtcat 0.323
+gtcca 0.393
+gtccc 0.186
+gtccg 0.124
+gtcct 0.297
+gtcga 0.301
+gtcgc 0.159
+gtcgg 0.235
+gtcgt 0.305
+gtcta 0.268
+gtctc 0.192
+gtctg 0.172
+gtctt 0.369
+gtgaa 0.358
+gtgac 0.156
+gtgag 0.186
+gtgat 0.299
+gtgca 0.413
+gtgcc 0.179
+gtgcg 0.105
+gtgct 0.303
+gtgga 0.307
+gtggc 0.18
+gtggg 0.229
+gtggt 0.284
+gtgta 0.29
+gtgtc 0.154
+gtgtg 0.216
+gtgtt 0.34
+gttaa 0.333
+gttac 0.168
+gttag 0.172
+gttat 0.326
+gttca 0.36
+gttcc 0.198
+gttcg 0.13
+gttct 0.312
+gttga 0.301
+gttgc 0.172
+gttgg 0.222
+gttgt 0.305
+gttta 0.233
+gtttc 0.169
+gtttg 0.217
+gtttt 0.381
+taaaa 0.407
+taaac 0.133
+taaag 0.157
+taaat 0.303
+taaca 0.37
+taacc 0.174
+taacg 0.0995
+taact 0.357
+taaga 0.311
+taagc 0.168
+taagg 0.212
+taagt 0.309
+taata 0.315
+taatc 0.134
+taatg 0.162
+taatt 0.389
+tacaa 0.381
+tacac 0.18
+tacag 0.127
+tacat 0.312
+tacca 0.364
+taccc 0.227
+taccg 0.102
+tacct 0.307
+tacga 0.295
+tacgc 0.179
+tacgg 0.197
+tacgt 0.33
+tacta 0.289
+tactc 0.174
+tactg 0.161
+tactt 0.376
+tagaa 0.371
+tagac 0.141
+tagag 0.211
+tagat 0.277
+tagca 0.349
+tagcc 0.215
+tagcg 0.0853
+tagct 0.351
+tagga 0.341
+taggc 0.177
+taggg 0.213
+taggt 0.269
+tagta 0.3
+tagtc 0.15
+tagtg 0.189
+tagtt 0.361
+tataa 0.278
+tatac 0.148
+tatag 0.132
+tatat 0.441
+tatca 0.352
+tatcc 0.21
+tatcg 0.106
+tatct 0.332
+tatga 0.298
+tatgc 0.197
+tatgg 0.181
+tatgt 0.324
+tatta 0.262
+tattc 0.147
+tattg 0.157
+tattt 0.434
+tcaaa 0.394
+tcaac 0.161
+tcaag 0.181
+tcaat 0.264
+tcaca 0.345
+tcacc 0.209
+tcacg 0.117
+tcact 0.328
+tcaga 0.312
+tcagc 0.23
+tcagg 0.164
+tcagt 0.295
+tcata 0.266
+tcatc 0.188
+tcatg 0.189
+tcatt 0.356
+tccaa 0.377
+tccac 0.177
+tccag 0.172
+tccat 0.274
+tccca 0.337
+tcccc 0.212
+tcccg 0.123
+tccct 0.329
+tccga 0.32
+tccgc 0.186
+tccgg 0.234
+tccgt 0.259
+tccta 0.253
+tcctc 0.221
+tcctg 0.134
+tcctt 0.392
+tcgaa 0.356
+tcgac 0.149
+tcgag 0.217
+tcgat 0.278
+tcgca 0.3
+tcgcc 0.257
+tcgcg 0.154
+tcgct 0.289
+tcgga 0.318
+tcggc 0.175
+tcggg 0.234
+tcggt 0.273
+tcgta 0.234
+tcgtc 0.19
+tcgtg 0.218
+tcgtt 0.358
+tctaa 0.318
+tctac 0.181
+tctag 0.18
+tctat 0.322
+tctca 0.285
+tctcc 0.22
+tctcg 0.098
+tctct 0.397
+tctga 0.292
+tctgc 0.215
+tctgg 0.194
+tctgt 0.299
+tctta 0.197
+tcttc 0.219
+tcttg 0.184
+tcttt 0.4
+tgaaa 0.376
+tgaac 0.152
+tgaag 0.202
+tgaat 0.27
+tgaca 0.368
+tgacc 0.205
+tgacg 0.109
+tgact 0.318
+tgaga 0.334
+tgagc 0.18
+tgagg 0.206
+tgagt 0.28
+tgata 0.28
+tgatc 0.157
+tgatg 0.215
+tgatt 0.348
+tgcaa 0.346
+tgcac 0.187
+tgcag 0.164
+tgcat 0.303
+tgcca 0.365
+tgccc 0.216
+tgccg 0.0969
+tgcct 0.321
+tgcga 0.284
+tgcgc 0.19
+tgcgg 0.231
+tgcgt 0.295
+tgcta 0.254
+tgctc 0.175
+tgctg 0.215
+tgctt 0.356
+tggaa 0.344
+tggac 0.16
+tggag 0.229
+tggat 0.266
+tggca 0.318
+tggcc 0.219
+tggcg 0.12
+tggct 0.343
+tggga 0.312
+tgggc 0.196
+tgggg 0.214
+tgggt 0.278
+tggta 0.26
+tggtc 0.176
+tggtg 0.245
+tggtt 0.319
+tgtaa 0.318
+tgtac 0.161
+tgtag 0.173
+tgtat 0.348
+tgtca 0.363
+tgtcc 0.203
+tgtcg 0.107
+tgtct 0.327
+tgtga 0.289
+tgtgc 0.172
+tgtgg 0.201
+tgtgt 0.338
+tgtta 0.247
+tgttc 0.153
+tgttg 0.222
+tgttt 0.379
+ttaaa 0.375
+ttaac 0.147
+ttaag 0.166
+ttaat 0.312
+ttaca 0.357
+ttacc 0.197
+ttacg 0.0905
+ttact 0.356
+ttaga 0.299
+ttagc 0.179
+ttagg 0.193
+ttagt 0.329
+ttata 0.281
+ttatc 0.156
+ttatg 0.18
+ttatt 0.383
+ttcaa 0.374
+ttcac 0.158
+ttcag 0.161
+ttcat 0.306
+ttcca 0.343
+ttccc 0.199
+ttccg 0.106
+ttcct 0.352
+ttcga 0.36
+ttcgc 0.161
+ttcgg 0.213
+ttcgt 0.266
+ttcta 0.223
+ttctc 0.202
+ttctg 0.151
+ttctt 0.425
+ttgaa 0.372
+ttgac 0.15
+ttgag 0.187
+ttgat 0.291
+ttgca 0.367
+ttgcc 0.175
+ttgcg 0.0883
+ttgct 0.37
+ttgga 0.324
+ttggc 0.178
+ttggg 0.197
+ttggt 0.301
+ttgta 0.279
+ttgtc 0.153
+ttgtg 0.197
+ttgtt 0.371
+tttaa 0.33
+tttac 0.16
+tttag 0.163
+tttat 0.347
+tttca 0.317
+tttcc 0.2
+tttcg 0.0945
+tttct 0.388
+tttga 0.307
+tttgc 0.16
+tttgg 0.229
+tttgt 0.304
+tttta 0.229
+ttttc 0.18
+ttttg 0.18
+ttttt 0.411
+
+#
+# The emission probabilities of the tss upwindow
+#
+[EMISSION-TSSUPWIN]
+# size of the emission vector
+4
+#tssup_k=
+0
+# patpseudo : pseudocount for sequence patterns
+1
+a 0.326
+c 0.239
+g 0.132
+t 0.303
+
+# motif around the TSS of TATA-less promoters
+[TSSMOTIF]
+# width of motif, n=
+13
+# order of markov model, k=
+0
+# markov chain emission probabilities
+ 0 0.341 0.178 0.186 0.295
+ 1 0.372 0.209 0.163 0.256
+ 2 0.349 0.302 0.116 0.233
+ 3 0.31 0.233 0.132 0.326
+ 4 0.302 0.287 0.101 0.31
+ 5 0.24 0.318 0.093 0.349
+ 6 0.202 0.349 0.186 0.264
+ 7 0.147 0.279 0.0853 0.488
+ 8 0.512 0.178 0.178 0.132
+ 9 0.395 0.186 0.202 0.217
+10 0.388 0.202 0.209 0.202
+11 0.333 0.287 0.155 0.225
+12 0.318 0.302 0.109 0.271
+
+# motif around the TSS of TATA promoters
+[TSSMOTIFTATA]
+# width of motif, n=
+13
+# order of markov model, k=
+0
+# markov chain emission probabilities
+ 0 0.279 0.233 0.233 0.256
+ 1 0.419 0.233 0.093 0.256
+ 2 0.372 0.186 0.116 0.326
+ 3 0.279 0.186 0.093 0.442
+ 4 0.302 0.233 0.0698 0.395
+ 5 0.186 0.279 0.163 0.372
+ 6 0.233 0.186 0.209 0.372
+ 7 0.093 0.512 0.0465 0.349
+ 8 0.698 0.093 0.093 0.116
+ 9 0.488 0.186 0.093 0.233
+10 0.488 0.302 0.14 0.0698
+11 0.465 0.279 0.14 0.116
+12 0.419 0.186 0.14 0.256
+
+# tata box motif
+[TATAMOTIF]
+# width of motif, n=
+12
+# order of markov model, k=
+0
+# markov chain emission probabilities
+ 0 0.362 0.255 0.0638 0.319
+ 1 0.298 0.298 0.191 0.213
+ 2 0.0426 0.0426 0.0426 0.872
+ 3 0.872 0.0426 0.0426 0.0426
+ 4 0.0426 0.0426 0.0426 0.872
+ 5 0.872 0.0426 0.0426 0.0426
+ 6 0.319 0.0426 0.0426 0.596
+ 7 0.872 0.0426 0.0426 0.0426
+ 8 0.298 0.128 0.128 0.447
+ 9 0.574 0.128 0.149 0.149
+10 0.319 0.191 0.128 0.362
+11 0.34 0.277 0.17 0.213
+
+# motif after polyA signal
+[TTSMOTIF]
+# width of motif, n=
+14
+# order of markov model, k=
+1
+# markov chain emission probabilities
+ 0 0.286 0.143 0.143 0.429 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.2 0.2 0.2 0.4
+ 1 0.286 0.143 0.143 0.429 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.286 0.143 0.286 0.286
+ 2 0.167 0.167 0.167 0.5 0.25 0.25 0.25 0.25 0.2 0.4 0.2 0.2 0.286 0.143 0.286 0.286
+ 3 0.2 0.2 0.2 0.4 0.2 0.2 0.2 0.4 0.2 0.4 0.2 0.2 0.429 0.143 0.286 0.143
+ 4 0.167 0.333 0.167 0.333 0.2 0.2 0.2 0.4 0.2 0.4 0.2 0.2 0.333 0.167 0.333 0.167
+ 5 0.2 0.4 0.2 0.2 0.167 0.167 0.333 0.333 0.2 0.2 0.4 0.2 0.333 0.167 0.333 0.167
+ 6 0.2 0.4 0.2 0.2 0.2 0.2 0.4 0.2 0.143 0.143 0.571 0.143 0.2 0.2 0.4 0.2
+ 7 0.25 0.25 0.25 0.25 0.2 0.2 0.4 0.2 0.111 0.111 0.556 0.222 0.25 0.25 0.25 0.25
+ 8 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.111 0.222 0.444 0.222 0.2 0.4 0.2 0.2
+ 9 0.25 0.25 0.25 0.25 0.333 0.167 0.333 0.167 0.143 0.286 0.286 0.286 0.2 0.4 0.2 0.2
+10 0.2 0.2 0.4 0.2 0.333 0.167 0.333 0.167 0.167 0.5 0.167 0.167 0.2 0.4 0.2 0.2
+11 0.2 0.2 0.4 0.2 0.286 0.143 0.286 0.286 0.167 0.5 0.167 0.167 0.25 0.25 0.25 0.25
+12 0.2 0.2 0.4 0.2 0.167 0.167 0.167 0.5 0.167 0.5 0.167 0.167 0.2 0.2 0.4 0.2
+13 0.25 0.25 0.25 0.25 0.167 0.167 0.167 0.5 0.2 0.4 0.2 0.2 0.2 0.2 0.4 0.2
diff --git a/config/species/lamprey/lamprey_weightmatrix.txt b/config/species/coyote_tobacco/coyote_tobacco_weightmatrix.txt
similarity index 100%
copy from config/species/lamprey/lamprey_weightmatrix.txt
copy to config/species/coyote_tobacco/coyote_tobacco_weightmatrix.txt
diff --git a/config/species/japaneselamprey/japaneselamprey_exon_probs.pbl b/config/species/japaneselamprey/japaneselamprey_exon_probs.pbl
new file mode 100644
index 0000000..f649fbc
--- /dev/null
+++ b/config/species/japaneselamprey/japaneselamprey_exon_probs.pbl
@@ -0,0 +1,20253 @@
+#exon model parameters
+# begin of content independent part
+# start codon probabilities
+[STARTCODONS]
+# number of start codons:
+1
+# start codons and their probabilities
+ATG 1
+
+# Length distributions
+[LENGTH]
+# maximal individually stored length probability =
+2000
+# slope of smoothing bandwidth =
+0.3
+# smoothing minwindowcount =
+10
+# length single initial internal terminal
+# total number of exons of above types
+ 1 222 2256 226
+# number of exons exceeding length d
+ 0 0 0 0
+# 1000 P(len=k), k=0,1,..., 2000
+0 0 1.68 0.237 0.268
+1 0 1.77 0.271 0.277
+2 0 1.86 0.309 0.287
+3 0 1.94 0.349 0.297
+4 0 2.03 0.393 0.308
+5 0 2.12 0.439 0.32
+6 0 2.21 0.488 0.332
+7 0 2.3 0.539 0.345
+8 0 2.39 0.592 0.358
+9 0 2.48 0.646 0.372
+10 0 2.58 0.702 0.386
+11 0 2.67 0.759 0.402
+12 0 2.76 0.816 0.418
+13 0 2.86 0.874 0.434
+14 0 2.96 0.932 0.452
+15 0 3.06 0.989 0.47
+16 0 3.16 1.05 0.489
+17 0 3.26 1.1 0.509
+18 0 3.36 1.16 0.53
+19 0 3.46 1.21 0.552
+20 0 3.56 1.26 0.574
+21 0 3.66 1.32 0.598
+22 0 3.76 1.37 0.622
+23 0 3.85 1.42 0.647
+24 0 3.95 1.47 0.674
+25 0 4.03 1.53 0.701
+26 0 4.11 1.58 0.729
+27 0 4.19 1.63 0.758
+28 0 4.26 1.69 0.788
+29 0 4.32 1.74 0.82
+30 0 4.37 1.8 0.852
+31 0 4.41 1.86 0.885
+32 0 4.45 1.92 0.919
+33 0 4.47 1.98 0.955
+34 0 4.49 2.04 0.991
+35 0 4.49 2.11 1.03
+36 0 4.49 2.17 1.07
+37 0 4.47 2.24 1.11
+38 0 4.45 2.31 1.15
+39 0 4.42 2.38 1.19
+40 0 4.38 2.45 1.23
+41 0 4.33 2.53 1.28
+42 0 4.27 2.6 1.33
+43 0 4.21 2.68 1.37
+44 0 4.14 2.76 1.42
+45 0 4.07 2.84 1.47
+46 0 4 2.92 1.52
+47 0 3.92 3 1.58
+48 0 3.84 3.09 1.63
+49 0 3.77 3.17 1.69
+50 0 3.69 3.26 1.74
+51 0 3.61 3.36 1.8
+52 0 3.54 3.45 1.86
+53 0 3.47 3.55 1.93
+54 0 3.41 3.64 1.99
+55 0 3.36 3.75 2.06
+56 0 3.31 3.85 2.13
+57 0 3.26 3.95 2.2
+58 0 3.23 4.06 2.27
+59 0 3.21 4.17 2.34
+60 0 3.19 4.28 2.42
+61 0 3.18 4.39 2.5
+62 0 3.19 4.5 2.59
+63 0 3.2 4.62 2.67
+64 0 3.23 4.73 2.76
+65 0 3.26 4.85 2.86
+66 0 3.31 4.97 2.95
+67 0 3.37 5.08 3.05
+68 0 3.43 5.2 3.16
+69 0 3.51 5.32 3.26
+70 0 3.59 5.44 3.37
+71 0 3.69 5.56 3.49
+72 0 3.79 5.67 3.6
+73 0 3.89 5.79 3.72
+74 0 4 5.91 3.85
+75 0 4.11 6.02 3.97
+76 0 4.22 6.13 4.1
+77 0 4.33 6.23 4.22
+78 0 4.44 6.34 4.35
+79 0 4.54 6.44 4.47
+80 0 4.64 6.53 4.59
+81 0 4.73 6.62 4.71
+82 0 4.81 6.71 4.82
+83 0 4.87 6.79 4.93
+84 0 4.93 6.87 5.03
+85 0 4.97 6.94 5.13
+86 0 5 7 5.21
+87 0 5.01 7.06 5.28
+88 0 5.01 7.12 5.34
+89 0 4.99 7.17 5.39
+90 0 4.96 7.22 5.43
+91 0 4.92 7.26 5.46
+92 0 4.87 7.29 5.47
+93 0 4.81 7.33 5.48
+94 0 4.74 7.35 5.47
+95 0 4.66 7.38 5.45
+96 0 4.58 7.4 5.42
+97 0 4.49 7.41 5.38
+98 0 4.41 7.43 5.34
+99 0 4.33 7.43 5.29
+100 0 4.24 7.44 5.24
+101 0 4.17 7.44 5.19
+102 0 4.09 7.44 5.13
+103 0 4.02 7.43 5.08
+104 0 3.96 7.42 5.03
+105 0 3.91 7.4 4.98
+106 0 3.86 7.38 4.94
+107 0 3.83 7.35 4.91
+108 0 3.8 7.32 4.88
+109 0 3.77 7.29 4.86
+110 0 3.76 7.25 4.85
+111 0 3.75 7.2 4.85
+112 0 3.74 7.15 4.86
+113 0 3.74 7.1 4.88
+114 0 3.75 7.04 4.9
+115 0 3.76 6.98 4.94
+116 0 3.77 6.91 4.98
+117 0 3.79 6.85 5.02
+118 0 3.81 6.78 5.07
+119 0 3.83 6.71 5.13
+120 0 3.85 6.64 5.19
+121 0 3.87 6.58 5.25
+122 0 3.89 6.51 5.31
+123 0 3.91 6.45 5.38
+124 0 3.93 6.39 5.44
+125 0 3.95 6.33 5.5
+126 0 3.97 6.27 5.56
+127 0 3.98 6.22 5.62
+128 0 3.99 6.18 5.67
+129 0 4.01 6.13 5.72
+130 0 4.01 6.09 5.77
+131 0 4.02 6.05 5.81
+132 0 4.03 6.02 5.84
+133 0 4.03 5.98 5.87
+134 0 4.03 5.94 5.9
+135 0 4.02 5.91 5.92
+136 0 4.02 5.87 5.93
+137 0 4.01 5.83 5.94
+138 0 4 5.8 5.95
+139 0 3.99 5.75 5.95
+140 0 3.98 5.71 5.94
+141 0 3.97 5.66 5.93
+142 0 3.95 5.62 5.91
+143 0 3.94 5.56 5.89
+144 0 3.92 5.51 5.87
+145 0 3.9 5.45 5.84
+146 0 3.88 5.4 5.81
+147 0 3.86 5.34 5.77
+148 0 3.84 5.28 5.73
+149 0 3.82 5.22 5.69
+150 0 3.8 5.15 5.64
+151 0 3.77 5.09 5.59
+152 0 3.75 5.03 5.54
+153 0 3.73 4.97 5.49
+154 0 3.7 4.9 5.44
+155 0 3.68 4.84 5.39
+156 0 3.66 4.78 5.34
+157 0 3.63 4.71 5.28
+158 0 3.61 4.65 5.23
+159 0 3.59 4.58 5.18
+160 0 3.57 4.52 5.13
+161 0 3.54 4.45 5.08
+162 0 3.52 4.38 5.03
+163 0 3.5 4.31 4.98
+164 0 3.48 4.24 4.93
+165 0 3.46 4.17 4.88
+166 0 3.44 4.09 4.83
+167 0 3.42 4.02 4.79
+168 0 3.4 3.94 4.74
+169 0 3.38 3.87 4.7
+170 0 3.36 3.8 4.65
+171 0 3.35 3.72 4.61
+172 0 3.33 3.66 4.57
+173 0 3.32 3.59 4.52
+174 0 3.3 3.53 4.48
+175 0 3.29 3.47 4.44
+176 0 3.28 3.41 4.39
+177 0 3.27 3.36 4.35
+178 0 3.26 3.31 4.3
+179 0 3.25 3.26 4.26
+180 0 3.24 3.22 4.21
+181 0 3.23 3.18 4.17
+182 0 3.22 3.15 4.12
+183 0 3.21 3.11 4.08
+184 0 3.21 3.08 4.03
+185 0 3.2 3.05 3.98
+186 0 3.19 3.03 3.94
+187 0 3.18 3 3.89
+188 0 3.18 2.97 3.85
+189 0 3.17 2.95 3.8
+190 0 3.16 2.92 3.76
+191 0 3.15 2.89 3.72
+192 0 3.14 2.86 3.67
+193 0 3.13 2.83 3.63
+194 0 3.12 2.8 3.59
+195 0 3.11 2.77 3.55
+196 0 3.09 2.74 3.52
+197 0 3.08 2.7 3.48
+198 0 3.06 2.67 3.44
+199 0 3.04 2.63 3.41
+200 0 3.03 2.59 3.38
+201 0.256 3.01 2.55 3.35
+202 0.256 2.99 2.51 3.32
+203 0.256 2.96 2.47 3.29
+204 0.256 2.94 2.42 3.27
+205 0.256 2.91 2.38 3.24
+206 0.256 2.89 2.33 3.22
+207 0.256 2.86 2.29 3.19
+208 0.256 2.83 2.24 3.17
+209 0.256 2.8 2.19 3.15
+210 0.256 2.77 2.14 3.13
+211 0.256 2.74 2.09 3.11
+212 0.256 2.71 2.04 3.09
+213 0.257 2.67 1.99 3.07
+214 0.257 2.64 1.94 3.05
+215 0.257 2.6 1.89 3.03
+216 0.257 2.57 1.84 3.01
+217 0.257 2.53 1.79 2.99
+218 0.257 2.5 1.74 2.97
+219 0.257 2.46 1.69 2.95
+220 0.257 2.42 1.65 2.93
+221 0.257 2.38 1.6 2.91
+222 0.257 2.34 1.56 2.89
+223 0.257 2.31 1.51 2.87
+224 0.257 2.27 1.47 2.84
+225 0.257 2.23 1.43 2.82
+226 0.257 2.19 1.38 2.79
+227 0.257 2.15 1.34 2.76
+228 0.257 2.11 1.31 2.74
+229 0.258 2.07 1.27 2.71
+230 0.258 2.03 1.23 2.68
+231 0.258 1.99 1.2 2.65
+232 0.258 1.95 1.16 2.62
+233 0.258 1.91 1.13 2.59
+234 0.258 1.88 1.1 2.55
+235 0.258 1.84 1.07 2.52
+236 0.258 1.8 1.04 2.48
+237 0.258 1.76 1.01 2.45
+238 0.258 1.72 0.984 2.41
+239 0.258 1.69 0.958 2.38
+240 0.258 1.65 0.932 2.34
+241 0.258 1.61 0.908 2.3
+242 0.258 1.58 0.885 2.26
+243 0.258 1.54 0.862 2.22
+244 0.258 1.51 0.841 2.18
+245 0.259 1.47 0.82 2.14
+246 0.259 1.44 0.8 2.1
+247 0.259 1.41 0.781 2.06
+248 0.259 1.37 0.762 2.02
+249 0.259 1.34 0.745 1.98
+250 0.259 1.31 0.728 1.94
+251 0.259 1.28 0.711 1.9
+252 0.259 1.25 0.695 1.85
+253 0.259 1.23 0.68 1.81
+254 0.259 1.2 0.666 1.77
+255 0.259 1.17 0.652 1.73
+256 0.259 1.15 0.638 1.69
+257 0.259 1.12 0.626 1.65
+258 0.259 1.1 0.613 1.61
+259 0.259 1.08 0.601 1.57
+260 0.259 1.06 0.59 1.53
+261 0.259 1.03 0.579 1.49
+262 0.26 1.02 0.568 1.46
+263 0.26 0.996 0.558 1.42
+264 0.26 0.978 0.549 1.38
+265 0.26 0.96 0.539 1.35
+266 0.26 0.944 0.53 1.31
+267 0.26 0.928 0.521 1.28
+268 0.26 0.913 0.513 1.24
+269 0.26 0.899 0.505 1.21
+270 0.26 0.885 0.497 1.18
+271 0.26 0.872 0.49 1.15
+272 0.26 0.86 0.482 1.12
+273 0.26 0.848 0.475 1.09
+274 0.26 0.837 0.468 1.06
+275 0.26 0.827 0.462 1.03
+276 0.26 0.817 0.455 1
+277 0.26 0.807 0.449 0.976
+278 0.26 0.798 0.442 0.95
+279 0.261 0.79 0.436 0.926
+280 0.261 0.782 0.43 0.902
+281 0.261 0.774 0.424 0.879
+282 0.261 0.767 0.418 0.857
+283 0.261 0.76 0.412 0.836
+284 0.261 0.753 0.406 0.816
+285 0.261 0.746 0.4 0.796
+286 0.261 0.74 0.395 0.777
+287 0.261 0.734 0.389 0.759
+288 0.261 0.729 0.383 0.742
+289 0.261 0.723 0.377 0.725
+290 0.261 0.718 0.372 0.709
+291 0.261 0.712 0.366 0.694
+292 0.261 0.707 0.36 0.679
+293 0.261 0.702 0.354 0.665
+294 0.261 0.697 0.349 0.651
+295 0.261 0.693 0.343 0.638
+296 0.262 0.688 0.337 0.626
+297 0.262 0.683 0.331 0.614
+298 0.262 0.679 0.325 0.603
+299 0.262 0.674 0.32 0.592
+300 0.262 0.67 0.314 0.582
+301 0.262 0.665 0.308 0.572
+302 0.262 0.661 0.302 0.562
+303 0.262 0.657 0.296 0.553
+304 0.262 0.652 0.29 0.545
+305 0.262 0.648 0.285 0.536
+306 0.262 0.644 0.279 0.528
+307 0.262 0.639 0.273 0.52
+308 0.262 0.635 0.267 0.513
+309 0.262 0.631 0.262 0.506
+310 0.262 0.626 0.256 0.499
+311 0.262 0.622 0.251 0.493
+312 0.262 0.618 0.245 0.486
+313 0.263 0.613 0.24 0.48
+314 0.263 0.609 0.234 0.474
+315 0.263 0.605 0.229 0.469
+316 0.263 0.6 0.224 0.463
+317 0.263 0.596 0.219 0.458
+318 0.263 0.592 0.214 0.453
+319 0.263 0.587 0.209 0.448
+320 0.263 0.583 0.204 0.443
+321 0.263 0.578 0.2 0.439
+322 0.263 0.574 0.195 0.434
+323 0.263 0.57 0.191 0.43
+324 0.263 0.565 0.187 0.426
+325 0.263 0.561 0.183 0.422
+326 0.263 0.556 0.179 0.418
+327 0.263 0.552 0.175 0.414
+328 0.263 0.547 0.172 0.41
+329 0.263 0.543 0.169 0.407
+330 0.264 0.539 0.165 0.403
+331 0.264 0.534 0.162 0.4
+332 0.264 0.53 0.16 0.396
+333 0.264 0.525 0.157 0.393
+334 0.264 0.521 0.154 0.39
+335 0.264 0.516 0.152 0.387
+336 0.264 0.512 0.15 0.384
+337 0.264 0.508 0.148 0.381
+338 0.264 0.503 0.146 0.378
+339 0.264 0.499 0.144 0.375
+340 0.264 0.495 0.143 0.372
+341 0.264 0.49 0.141 0.369
+342 0.264 0.486 0.14 0.367
+343 0.264 0.482 0.139 0.364
+344 0.264 0.477 0.138 0.362
+345 0.264 0.473 0.137 0.359
+346 0.264 0.469 0.136 0.357
+347 0.264 0.464 0.135 0.354
+348 0.265 0.46 0.135 0.352
+349 0.265 0.456 0.134 0.35
+350 0.265 0.452 0.133 0.347
+351 0.265 0.448 0.133 0.345
+352 0.265 0.443 0.133 0.343
+353 0.265 0.439 0.132 0.341
+354 0.265 0.435 0.132 0.339
+355 0.265 0.431 0.132 0.336
+356 0.265 0.427 0.132 0.334
+357 0.265 0.423 0.131 0.332
+358 0.265 0.419 0.131 0.33
+359 0.265 0.415 0.131 0.328
+360 0.265 0.411 0.131 0.327
+361 0.265 0.407 0.131 0.325
+362 0.265 0.403 0.13 0.323
+363 0.265 0.399 0.13 0.321
+364 0.265 0.395 0.13 0.319
+365 0.265 0.392 0.13 0.317
+366 0.266 0.388 0.13 0.316
+367 0.266 0.384 0.129 0.314
+368 0.266 0.38 0.129 0.312
+369 0.266 0.377 0.129 0.31
+370 0.266 0.373 0.128 0.309
+371 0.266 0.37 0.128 0.307
+372 0.266 0.366 0.128 0.305
+373 0.266 0.362 0.127 0.304
+374 0.266 0.359 0.127 0.302
+375 0.266 0.355 0.126 0.301
+376 0.266 0.352 0.126 0.299
+377 0.266 0.349 0.125 0.297
+378 0.266 0.345 0.124 0.296
+379 0.266 0.342 0.124 0.294
+380 0.266 0.339 0.123 0.293
+381 0.266 0.335 0.122 0.291
+382 0.266 0.332 0.122 0.29
+383 0.266 0.329 0.121 0.288
+384 0.266 0.326 0.12 0.287
+385 0.267 0.323 0.119 0.285
+386 0.267 0.32 0.118 0.284
+387 0.267 0.316 0.117 0.282
+388 0.267 0.313 0.117 0.281
+389 0.267 0.31 0.116 0.28
+390 0.267 0.308 0.115 0.278
+391 0.267 0.305 0.114 0.277
+392 0.267 0.302 0.113 0.275
+393 0.267 0.299 0.112 0.274
+394 0.267 0.296 0.111 0.273
+395 0.267 0.293 0.11 0.271
+396 0.267 0.291 0.109 0.27
+397 0.267 0.288 0.108 0.268
+398 0.267 0.285 0.107 0.267
+399 0.267 0.283 0.105 0.266
+400 0.267 0.28 0.104 0.264
+401 0.267 0.278 0.103 0.263
+402 0.267 0.275 0.102 0.262
+403 0.268 0.273 0.101 0.26
+404 0.268 0.27 0.1 0.259
+405 0.268 0.268 0.0991 0.258
+406 0.268 0.265 0.098 0.256
+407 0.268 0.263 0.097 0.255
+408 0.268 0.261 0.0959 0.254
+409 0.268 0.259 0.0949 0.252
+410 0.268 0.256 0.0938 0.251
+411 0.268 0.254 0.0928 0.25
+412 0.268 0.252 0.0918 0.248
+413 0.268 0.25 0.0907 0.247
+414 0.268 0.248 0.0897 0.246
+415 0.268 0.246 0.0887 0.245
+416 0.268 0.244 0.0877 0.243
+417 0.268 0.242 0.0867 0.242
+418 0.268 0.24 0.0857 0.241
+419 0.268 0.238 0.0848 0.239
+420 0.268 0.236 0.0838 0.238
+421 0.268 0.234 0.0828 0.237
+422 0.268 0.232 0.0819 0.235
+423 0.269 0.23 0.081 0.234
+424 0.269 0.228 0.08 0.233
+425 0.269 0.227 0.0791 0.232
+426 0.269 0.225 0.0782 0.23
+427 0.269 0.223 0.0773 0.229
+428 0.269 0.221 0.0764 0.228
+429 0.269 0.22 0.0755 0.226
+430 0.269 0.218 0.0747 0.225
+431 0.269 0.216 0.0738 0.224
+432 0.269 0.215 0.0729 0.223
+433 0.269 0.213 0.0721 0.221
+434 0.269 0.212 0.0713 0.22
+435 0.269 0.21 0.0704 0.219
+436 0.269 0.209 0.0696 0.217
+437 0.269 0.207 0.0688 0.216
+438 0.269 0.206 0.068 0.215
+439 0.269 0.204 0.0672 0.214
+440 0.269 0.203 0.0664 0.212
+441 0.269 0.202 0.0656 0.211
+442 0.27 0.2 0.0649 0.21
+443 0.27 0.199 0.0641 0.208
+444 0.27 0.198 0.0633 0.207
+445 0.27 0.196 0.0626 0.206
+446 0.27 0.195 0.0619 0.205
+447 0.27 0.194 0.0611 0.203
+448 0.27 0.192 0.0604 0.202
+449 0.27 0.191 0.0597 0.201
+450 0.27 0.19 0.059 0.2
+451 0.27 0.189 0.0583 0.198
+452 0.27 0.188 0.0576 0.197
+453 0.27 0.186 0.0569 0.196
+454 0.27 0.185 0.0562 0.194
+455 0.27 0.184 0.0556 0.193
+456 0.27 0.183 0.0549 0.192
+457 0.27 0.182 0.0542 0.191
+458 0.27 0.181 0.0536 0.189
+459 0.27 0.18 0.0529 0.188
+460 0.27 0.179 0.0523 0.187
+461 0.27 0.178 0.0517 0.186
+462 0.271 0.177 0.0511 0.184
+463 0.271 0.176 0.0505 0.183
+464 0.271 0.175 0.0499 0.182
+465 0.271 0.174 0.0493 0.181
+466 0.271 0.173 0.0487 0.179
+467 0.271 0.172 0.0481 0.178
+468 0.271 0.171 0.0475 0.177
+469 0.271 0.17 0.0469 0.176
+470 0.271 0.169 0.0464 0.174
+471 0.271 0.168 0.0458 0.173
+472 0.271 0.167 0.0453 0.172
+473 0.271 0.166 0.0447 0.171
+474 0.271 0.165 0.0442 0.17
+475 0.271 0.165 0.0437 0.168
+476 0.271 0.164 0.0432 0.167
+477 0.271 0.163 0.0426 0.166
+478 0.271 0.162 0.0421 0.165
+479 0.271 0.161 0.0416 0.163
+480 0.271 0.16 0.0411 0.162
+481 0.271 0.16 0.0406 0.161
+482 0.271 0.159 0.0402 0.16
+483 0.272 0.158 0.0397 0.159
+484 0.272 0.157 0.0392 0.157
+485 0.272 0.156 0.0388 0.156
+486 0.272 0.156 0.0383 0.155
+487 0.272 0.155 0.0379 0.154
+488 0.272 0.154 0.0374 0.153
+489 0.272 0.153 0.037 0.152
+490 0.272 0.153 0.0366 0.15
+491 0.272 0.152 0.0361 0.149
+492 0.272 0.151 0.0357 0.148
+493 0.272 0.151 0.0353 0.147
+494 0.272 0.15 0.0349 0.146
+495 0.272 0.149 0.0345 0.145
+496 0.272 0.148 0.0341 0.143
+497 0.272 0.148 0.0337 0.142
+498 0.272 0.147 0.0333 0.141
+499 0.272 0.146 0.033 0.14
+500 0.272 0.146 0.0326 0.139
+501 0.272 0.145 0.0322 0.138
+502 0.272 0.144 0.0319 0.137
+503 0.272 0.144 0.0315 0.136
+504 0.273 0.143 0.0312 0.134
+505 0.273 0.142 0.0308 0.133
+506 0.273 0.142 0.0305 0.132
+507 0.273 0.141 0.0301 0.131
+508 0.273 0.14 0.0298 0.13
+509 0.273 0.14 0.0295 0.129
+510 0.273 0.139 0.0292 0.128
+511 0.273 0.139 0.0289 0.127
+512 0.273 0.138 0.0286 0.126
+513 0.273 0.137 0.0283 0.125
+514 0.273 0.137 0.028 0.124
+515 0.273 0.136 0.0277 0.123
+516 0.273 0.135 0.0274 0.122
+517 0.273 0.135 0.0271 0.121
+518 0.273 0.134 0.0268 0.12
+519 0.273 0.134 0.0266 0.119
+520 0.273 0.133 0.0263 0.117
+521 0.273 0.132 0.026 0.116
+522 0.273 0.132 0.0258 0.115
+523 0.273 0.131 0.0255 0.114
+524 0.273 0.131 0.0253 0.113
+525 0.273 0.13 0.025 0.112
+526 0.274 0.13 0.0248 0.112
+527 0.274 0.129 0.0245 0.111
+528 0.274 0.128 0.0243 0.11
+529 0.274 0.128 0.0241 0.109
+530 0.274 0.127 0.0238 0.108
+531 0.274 0.127 0.0236 0.107
+532 0.274 0.126 0.0234 0.106
+533 0.274 0.126 0.0232 0.105
+534 0.274 0.125 0.023 0.104
+535 0.274 0.125 0.0228 0.103
+536 0.274 0.124 0.0226 0.102
+537 0.274 0.123 0.0224 0.101
+538 0.274 0.123 0.0222 0.1
+539 0.274 0.122 0.022 0.0993
+540 0.274 0.122 0.0218 0.0984
+541 0.274 0.121 0.0216 0.0975
+542 0.274 0.121 0.0214 0.0967
+543 0.274 0.12 0.0212 0.0958
+544 0.274 0.12 0.021 0.0949
+545 0.274 0.119 0.0209 0.0941
+546 0.274 0.119 0.0207 0.0932
+547 0.274 0.118 0.0205 0.0923
+548 0.275 0.118 0.0203 0.0915
+549 0.275 0.117 0.0202 0.0907
+550 0.275 0.117 0.02 0.0898
+551 0.275 0.116 0.0199 0.089
+552 0.275 0.116 0.0197 0.0882
+553 0.275 0.115 0.0195 0.0874
+554 0.275 0.115 0.0194 0.0866
+555 0.275 0.114 0.0192 0.0858
+556 0.275 0.114 0.0191 0.085
+557 0.275 0.113 0.0189 0.0842
+558 0.275 0.113 0.0188 0.0834
+559 0.275 0.112 0.0187 0.0827
+560 0.275 0.112 0.0185 0.0819
+561 0.275 0.111 0.0184 0.0811
+562 0.275 0.111 0.0183 0.0804
+563 0.275 0.11 0.0181 0.0796
+564 0.275 0.11 0.018 0.0789
+565 0.275 0.109 0.0179 0.0781
+566 0.275 0.109 0.0177 0.0774
+567 0.275 0.108 0.0176 0.0767
+568 0.275 0.108 0.0175 0.076
+569 0.275 0.107 0.0174 0.0753
+570 0.275 0.107 0.0172 0.0746
+571 0.276 0.106 0.0171 0.0739
+572 0.276 0.106 0.017 0.0732
+573 0.276 0.105 0.0169 0.0725
+574 0.276 0.105 0.0168 0.0718
+575 0.276 0.104 0.0167 0.0711
+576 0.276 0.104 0.0166 0.0704
+577 0.276 0.103 0.0165 0.0698
+578 0.276 0.103 0.0164 0.0691
+579 0.276 0.102 0.0162 0.0685
+580 0.276 0.102 0.0161 0.0678
+581 0.276 0.102 0.016 0.0672
+582 0.276 0.101 0.0159 0.0665
+583 0.276 0.101 0.0158 0.0659
+584 0.276 0.1 0.0157 0.0653
+585 0.276 0.0997 0.0156 0.0647
+586 0.276 0.0993 0.0156 0.0641
+587 0.276 0.0988 0.0155 0.0635
+588 0.276 0.0984 0.0154 0.0629
+589 0.276 0.0979 0.0153 0.0623
+590 0.276 0.0975 0.0152 0.0617
+591 0.276 0.097 0.0151 0.0611
+592 0.276 0.0966 0.015 0.0605
+593 0.276 0.0962 0.0149 0.0599
+594 0.276 0.0957 0.0148 0.0594
+595 0.277 0.0953 0.0148 0.0588
+596 0.277 0.0949 0.0147 0.0582
+597 0.277 0.0944 0.0146 0.0577
+598 0.277 0.094 0.0145 0.0571
+599 0.277 0.0936 0.0144 0.0566
+600 0.277 0.0931 0.0143 0.0561
+601 0.277 0.0927 0.0143 0.0555
+602 0.277 0.0923 0.0142 0.055
+603 0.277 0.0919 0.0141 0.0545
+604 0.277 0.0914 0.014 0.054
+605 0.277 0.091 0.014 0.0534
+606 0.277 0.0906 0.0139 0.0529
+607 0.277 0.0902 0.0138 0.0524
+608 0.277 0.0898 0.0137 0.0519
+609 0.277 0.0894 0.0137 0.0514
+610 0.277 0.0889 0.0136 0.051
+611 0.277 0.0885 0.0135 0.0505
+612 0.277 0.0881 0.0135 0.05
+613 0.277 0.0877 0.0134 0.0495
+614 0.277 0.0873 0.0133 0.049
+615 0.277 0.0869 0.0133 0.0486
+616 0.277 0.0865 0.0132 0.0481
+617 0.277 0.0861 0.0131 0.0477
+618 0.277 0.0857 0.0131 0.0472
+619 0.277 0.0853 0.013 0.0468
+620 0.278 0.0849 0.0129 0.0463
+621 0.278 0.0845 0.0129 0.0459
+622 0.278 0.0841 0.0128 0.0454
+623 0.278 0.0837 0.0128 0.045
+624 0.278 0.0833 0.0127 0.0446
+625 0.278 0.0829 0.0126 0.0442
+626 0.278 0.0826 0.0126 0.0437
+627 0.278 0.0822 0.0125 0.0433
+628 0.278 0.0818 0.0125 0.0429
+629 0.278 0.0814 0.0124 0.0425
+630 0.278 0.081 0.0124 0.0421
+631 0.278 0.0806 0.0123 0.0417
+632 0.278 0.0802 0.0122 0.0413
+633 0.278 0.0799 0.0122 0.0409
+634 0.278 0.0795 0.0121 0.0405
+635 0.278 0.0791 0.0121 0.0401
+636 0.278 0.0787 0.012 0.0398
+637 0.278 0.0784 0.012 0.0394
+638 0.278 0.078 0.0119 0.039
+639 0.278 0.0776 0.0119 0.0387
+640 0.278 0.0773 0.0118 0.0383
+641 0.278 0.0769 0.0118 0.0379
+642 0.278 0.0765 0.0117 0.0376
+643 0.278 0.0762 0.0117 0.0372
+644 0.278 0.0758 0.0116 0.0369
+645 0.279 0.0754 0.0116 0.0365
+646 0.279 0.0751 0.0115 0.0362
+647 0.279 0.0747 0.0115 0.0358
+648 0.279 0.0744 0.0114 0.0355
+649 0.279 0.074 0.0114 0.0352
+650 0.279 0.0737 0.0113 0.0348
+651 0.279 0.0733 0.0113 0.0345
+652 0.279 0.073 0.0112 0.0342
+653 0.279 0.0726 0.0112 0.0339
+654 0.279 0.0723 0.0111 0.0335
+655 0.279 0.0719 0.0111 0.0332
+656 0.279 0.0716 0.011 0.0329
+657 0.279 0.0712 0.011 0.0326
+658 0.279 0.0709 0.0109 0.0323
+659 0.279 0.0705 0.0109 0.032
+660 0.279 0.0702 0.0108 0.0317
+661 0.279 0.0699 0.0108 0.0314
+662 0.279 0.0695 0.0107 0.0311
+663 0.279 0.0692 0.0107 0.0308
+664 0.279 0.0689 0.0107 0.0305
+665 0.279 0.0685 0.0106 0.0302
+666 0.279 0.0682 0.0106 0.03
+667 0.279 0.0679 0.0105 0.0297
+668 0.279 0.0675 0.0105 0.0294
+669 0.279 0.0672 0.0104 0.0291
+670 0.279 0.0669 0.0104 0.0289
+671 0.279 0.0666 0.0103 0.0286
+672 0.28 0.0662 0.0103 0.0283
+673 0.28 0.0659 0.0103 0.0281
+674 0.28 0.0656 0.0102 0.0278
+675 0.28 0.0653 0.0102 0.0275
+676 0.28 0.0649 0.0101 0.0273
+677 0.28 0.0646 0.0101 0.027
+678 0.28 0.0643 0.01 0.0268
+679 0.28 0.064 0.01 0.0265
+680 0.28 0.0637 0.00996 0.0263
+681 0.28 0.0634 0.00992 0.0261
+682 0.28 0.0631 0.00988 0.0258
+683 0.28 0.0628 0.00984 0.0256
+684 0.28 0.0624 0.00979 0.0253
+685 0.28 0.0621 0.00975 0.0251
+686 0.28 0.0618 0.00971 0.0249
+687 0.28 0.0615 0.00967 0.0246
+688 0.28 0.0612 0.00963 0.0244
+689 0.28 0.0609 0.00959 0.0242
+690 0.28 0.0606 0.00955 0.024
+691 0.28 0.0603 0.00951 0.0238
+692 0.28 0.06 0.00947 0.0235
+693 0.28 0.0597 0.00943 0.0233
+694 0.28 0.0594 0.00939 0.0231
+695 0.28 0.0591 0.00935 0.0229
+696 0.28 0.0589 0.00931 0.0227
+697 0.28 0.0586 0.00927 0.0225
+698 0.28 0.0583 0.00923 0.0223
+699 0.28 0.058 0.00919 0.0221
+700 0.28 0.0577 0.00915 0.0219
+701 0.281 0.0574 0.00911 0.0217
+702 0.281 0.0571 0.00907 0.0215
+703 0.281 0.0568 0.00903 0.0213
+704 0.281 0.0566 0.00899 0.0211
+705 0.281 0.0563 0.00895 0.0209
+706 0.281 0.056 0.00891 0.0207
+707 0.281 0.0557 0.00887 0.0205
+708 0.281 0.0554 0.00883 0.0203
+709 0.281 0.0552 0.0088 0.0201
+710 0.281 0.0549 0.00876 0.02
+711 0.281 0.0546 0.00872 0.0198
+712 0.281 0.0543 0.00868 0.0196
+713 0.281 0.0541 0.00864 0.0194
+714 0.281 0.0538 0.0086 0.0193
+715 0.281 0.0535 0.00856 0.0191
+716 0.281 0.0533 0.00853 0.0189
+717 0.281 0.053 0.00849 0.0187
+718 0.281 0.0527 0.00845 0.0186
+719 0.281 0.0525 0.00841 0.0184
+720 0.281 0.0522 0.00837 0.0182
+721 0.281 0.0519 0.00834 0.0181
+722 0.281 0.0517 0.0083 0.0179
+723 0.281 0.0514 0.00826 0.0178
+724 0.281 0.0512 0.00822 0.0176
+725 0.281 0.0509 0.00818 0.0174
+726 0.281 0.0506 0.00815 0.0173
+727 0.281 0.0504 0.00811 0.0171
+728 0.281 0.0501 0.00807 0.017
+729 0.281 0.0499 0.00804 0.0168
+730 0.281 0.0496 0.008 0.0167
+731 0.282 0.0494 0.00796 0.0165
+732 0.282 0.0491 0.00792 0.0164
+733 0.282 0.0489 0.00789 0.0162
+734 0.282 0.0486 0.00785 0.0161
+735 0.282 0.0484 0.00781 0.016
+736 0.282 0.0481 0.00778 0.0158
+737 0.282 0.0479 0.00774 0.0157
+738 0.282 0.0477 0.0077 0.0155
+739 0.282 0.0474 0.00767 0.0154
+740 0.282 0.0472 0.00763 0.0153
+741 0.282 0.0469 0.0076 0.0151
+742 0.282 0.0467 0.00756 0.015
+743 0.282 0.0465 0.00752 0.0149
+744 0.282 0.0462 0.00749 0.0147
+745 0.282 0.046 0.00745 0.0146
+746 0.282 0.0458 0.00742 0.0145
+747 0.282 0.0455 0.00738 0.0144
+748 0.282 0.0453 0.00734 0.0142
+749 0.282 0.0451 0.00731 0.0141
+750 0.282 0.0448 0.00727 0.014
+751 0.282 0.0446 0.00724 0.0139
+752 0.282 0.0444 0.0072 0.0138
+753 0.282 0.0442 0.00717 0.0136
+754 0.282 0.0439 0.00713 0.0135
+755 0.282 0.0437 0.0071 0.0134
+756 0.282 0.0435 0.00706 0.0133
+757 0.282 0.0433 0.00703 0.0132
+758 0.282 0.043 0.00699 0.0131
+759 0.282 0.0428 0.00696 0.013
+760 0.282 0.0426 0.00692 0.0129
+761 0.282 0.0424 0.00689 0.0127
+762 0.283 0.0422 0.00685 0.0126
+763 0.283 0.042 0.00682 0.0125
+764 0.283 0.0417 0.00678 0.0124
+765 0.283 0.0415 0.00675 0.0123
+766 0.283 0.0413 0.00672 0.0122
+767 0.283 0.0411 0.00668 0.0121
+768 0.283 0.0409 0.00665 0.012
+769 0.283 0.0407 0.00661 0.0119
+770 0.283 0.0405 0.00658 0.0118
+771 0.283 0.0403 0.00655 0.0117
+772 0.283 0.0401 0.00651 0.0116
+773 0.283 0.0399 0.00648 0.0115
+774 0.283 0.0396 0.00645 0.0114
+775 0.283 0.0394 0.00641 0.0113
+776 0.283 0.0392 0.00638 0.0112
+777 0.283 0.039 0.00635 0.0111
+778 0.283 0.0388 0.00632 0.0111
+779 0.283 0.0386 0.00628 0.011
+780 0.283 0.0384 0.00625 0.0109
+781 0.283 0.0382 0.00622 0.0108
+782 0.283 0.038 0.00619 0.0107
+783 0.283 0.0379 0.00615 0.0106
+784 0.283 0.0377 0.00612 0.0105
+785 0.283 0.0375 0.00609 0.0104
+786 0.283 0.0373 0.00606 0.0104
+787 0.283 0.0371 0.00603 0.0103
+788 0.283 0.0369 0.00599 0.0102
+789 0.283 0.0367 0.00596 0.0101
+790 0.283 0.0365 0.00593 0.01
+791 0.283 0.0363 0.0059 0.00995
+792 0.283 0.0361 0.00587 0.00987
+793 0.283 0.036 0.00584 0.00979
+794 0.283 0.0358 0.00581 0.00971
+795 0.283 0.0356 0.00577 0.00964
+796 0.283 0.0354 0.00574 0.00956
+797 0.284 0.0352 0.00571 0.00949
+798 0.284 0.035 0.00568 0.00941
+799 0.284 0.0349 0.00565 0.00934
+800 0.284 0.0347 0.00562 0.00926
+801 0.284 0.0345 0.00559 0.00919
+802 0.284 0.0343 0.00556 0.00912
+803 0.284 0.0341 0.00553 0.00905
+804 0.284 0.034 0.0055 0.00898
+805 0.284 0.0338 0.00547 0.00891
+806 0.284 0.0336 0.00544 0.00884
+807 0.284 0.0335 0.00541 0.00878
+808 0.284 0.0333 0.00538 0.00871
+809 0.284 0.0331 0.00536 0.00864
+810 0.284 0.0329 0.00533 0.00858
+811 0.284 0.0328 0.0053 0.00851
+812 0.284 0.0326 0.00527 0.00845
+813 0.284 0.0324 0.00524 0.00838
+814 0.284 0.0323 0.00521 0.00832
+815 0.284 0.0321 0.00518 0.00826
+816 0.284 0.0319 0.00515 0.0082
+817 0.284 0.0318 0.00513 0.00814
+818 0.284 0.0316 0.0051 0.00808
+819 0.284 0.0314 0.00507 0.00802
+820 0.284 0.0313 0.00504 0.00796
+821 0.284 0.0311 0.00502 0.0079
+822 0.284 0.031 0.00499 0.00784
+823 0.284 0.0308 0.00496 0.00779
+824 0.284 0.0307 0.00493 0.00773
+825 0.284 0.0305 0.00491 0.00767
+826 0.284 0.0303 0.00488 0.00762
+827 0.284 0.0302 0.00485 0.00756
+828 0.284 0.03 0.00483 0.00751
+829 0.284 0.0299 0.0048 0.00745
+830 0.284 0.0297 0.00477 0.0074
+831 0.284 0.0296 0.00475 0.00735
+832 0.284 0.0294 0.00472 0.0073
+833 0.284 0.0293 0.00469 0.00725
+834 0.285 0.0291 0.00467 0.0072
+835 0.285 0.029 0.00464 0.00714
+836 0.285 0.0288 0.00462 0.0071
+837 0.285 0.0287 0.00459 0.00705
+838 0.285 0.0285 0.00457 0.007
+839 0.285 0.0284 0.00454 0.00695
+840 0.285 0.0282 0.00452 0.0069
+841 0.285 0.0281 0.00449 0.00685
+842 0.285 0.028 0.00447 0.00681
+843 0.285 0.0278 0.00444 0.00676
+844 0.285 0.0277 0.00442 0.00672
+845 0.285 0.0275 0.00439 0.00667
+846 0.285 0.0274 0.00437 0.00663
+847 0.285 0.0273 0.00435 0.00658
+848 0.285 0.0271 0.00432 0.00654
+849 0.285 0.027 0.0043 0.00649
+850 0.285 0.0269 0.00427 0.00645
+851 0.285 0.0267 0.00425 0.00641
+852 0.285 0.0266 0.00423 0.00637
+853 0.285 0.0264 0.0042 0.00633
+854 0.285 0.0263 0.00418 0.00629
+855 0.285 0.0262 0.00416 0.00624
+856 0.285 0.0261 0.00414 0.0062
+857 0.285 0.0259 0.00411 0.00617
+858 0.285 0.0258 0.00409 0.00613
+859 0.285 0.0257 0.00407 0.00609
+860 0.285 0.0255 0.00405 0.00605
+861 0.285 0.0254 0.00402 0.00601
+862 0.285 0.0253 0.004 0.00597
+863 0.285 0.0252 0.00398 0.00594
+864 0.285 0.025 0.00396 0.0059
+865 0.285 0.0249 0.00394 0.00586
+866 0.285 0.0248 0.00392 0.00583
+867 0.285 0.0247 0.00389 0.00579
+868 0.285 0.0245 0.00387 0.00576
+869 0.285 0.0244 0.00385 0.00572
+870 0.285 0.0243 0.00383 0.00569
+871 0.285 0.0242 0.00381 0.00565
+872 0.285 0.0241 0.00379 0.00562
+873 0.285 0.0239 0.00377 0.00559
+874 0.285 0.0238 0.00375 0.00555
+875 0.285 0.0237 0.00373 0.00552
+876 0.286 0.0236 0.00371 0.00549
+877 0.286 0.0235 0.00369 0.00546
+878 0.286 0.0233 0.00367 0.00543
+879 0.286 0.0232 0.00365 0.00539
+880 0.286 0.0231 0.00363 0.00536
+881 0.286 0.023 0.00361 0.00533
+882 0.286 0.0229 0.00359 0.0053
+883 0.286 0.0228 0.00357 0.00527
+884 0.286 0.0227 0.00355 0.00524
+885 0.286 0.0226 0.00353 0.00521
+886 0.286 0.0225 0.00352 0.00519
+887 0.286 0.0223 0.0035 0.00516
+888 0.286 0.0222 0.00348 0.00513
+889 0.286 0.0221 0.00346 0.0051
+890 0.286 0.022 0.00344 0.00507
+891 0.286 0.0219 0.00342 0.00505
+892 0.286 0.0218 0.00341 0.00502
+893 0.286 0.0217 0.00339 0.00499
+894 0.286 0.0216 0.00337 0.00497
+895 0.286 0.0215 0.00335 0.00494
+896 0.286 0.0214 0.00334 0.00491
+897 0.286 0.0213 0.00332 0.00489
+898 0.286 0.0212 0.0033 0.00486
+899 0.286 0.0211 0.00328 0.00484
+900 0.286 0.021 0.00327 0.00482
+901 0.286 0.0209 0.00325 0.00479
+902 0.286 0.0208 0.00323 0.00477
+903 0.286 0.0207 0.00322 0.00474
+904 0.286 0.0206 0.0032 0.00472
+905 0.286 0.0205 0.00318 0.0047
+906 0.286 0.0204 0.00317 0.00467
+907 0.286 0.0203 0.00315 0.00465
+908 0.286 0.0202 0.00314 0.00463
+909 0.286 0.0201 0.00312 0.00461
+910 0.286 0.02 0.0031 0.00458
+911 0.286 0.0199 0.00309 0.00456
+912 0.286 0.0198 0.00307 0.00454
+913 0.286 0.0197 0.00306 0.00452
+914 0.286 0.0196 0.00304 0.0045
+915 0.286 0.0195 0.00303 0.00448
+916 0.286 0.0195 0.00301 0.00446
+917 0.286 0.0194 0.003 0.00444
+918 0.286 0.0193 0.00298 0.00442
+919 0.286 0.0192 0.00297 0.0044
+920 0.286 0.0191 0.00295 0.00438
+921 0.286 0.019 0.00294 0.00436
+922 0.286 0.0189 0.00293 0.00434
+923 0.286 0.0188 0.00291 0.00432
+924 0.287 0.0187 0.0029 0.0043
+925 0.287 0.0187 0.00288 0.00428
+926 0.287 0.0186 0.00287 0.00427
+927 0.287 0.0185 0.00286 0.00425
+928 0.287 0.0184 0.00284 0.00423
+929 0.287 0.0183 0.00283 0.00421
+930 0.287 0.0182 0.00282 0.0042
+931 0.287 0.0182 0.0028 0.00418
+932 0.287 0.0181 0.00279 0.00416
+933 0.287 0.018 0.00278 0.00415
+934 0.287 0.0179 0.00276 0.00413
+935 0.287 0.0178 0.00275 0.00411
+936 0.287 0.0177 0.00274 0.0041
+937 0.287 0.0177 0.00272 0.00408
+938 0.287 0.0176 0.00271 0.00407
+939 0.287 0.0175 0.0027 0.00405
+940 0.287 0.0174 0.00269 0.00403
+941 0.287 0.0174 0.00268 0.00402
+942 0.287 0.0173 0.00266 0.004
+943 0.287 0.0172 0.00265 0.00399
+944 0.287 0.0171 0.00264 0.00397
+945 0.287 0.0171 0.00263 0.00396
+946 0.287 0.017 0.00262 0.00395
+947 0.287 0.0169 0.0026 0.00393
+948 0.287 0.0168 0.00259 0.00392
+949 0.287 0.0168 0.00258 0.0039
+950 0.287 0.0167 0.00257 0.00389
+951 0.287 0.0166 0.00256 0.00388
+952 0.287 0.0165 0.00255 0.00386
+953 0.287 0.0165 0.00254 0.00385
+954 0.287 0.0164 0.00252 0.00384
+955 0.287 0.0163 0.00251 0.00383
+956 0.287 0.0163 0.0025 0.00381
+957 0.287 0.0162 0.00249 0.0038
+958 0.287 0.0161 0.00248 0.00379
+959 0.287 0.016 0.00247 0.00378
+960 0.287 0.016 0.00246 0.00376
+961 0.287 0.0159 0.00245 0.00375
+962 0.287 0.0158 0.00244 0.00374
+963 0.287 0.0158 0.00243 0.00373
+964 0.287 0.0157 0.00242 0.00372
+965 0.287 0.0156 0.00241 0.00371
+966 0.287 0.0156 0.0024 0.0037
+967 0.287 0.0155 0.00239 0.00368
+968 0.287 0.0154 0.00238 0.00367
+969 0.287 0.0154 0.00237 0.00366
+970 0.287 0.0153 0.00236 0.00365
+971 0.287 0.0152 0.00235 0.00364
+972 0.287 0.0152 0.00234 0.00363
+973 0.287 0.0151 0.00233 0.00362
+974 0.287 0.0151 0.00232 0.00361
+975 0.287 0.015 0.00231 0.0036
+976 0.287 0.0149 0.00231 0.00359
+977 0.287 0.0149 0.0023 0.00358
+978 0.287 0.0148 0.00229 0.00357
+979 0.287 0.0148 0.00228 0.00356
+980 0.287 0.0147 0.00227 0.00355
+981 0.287 0.0146 0.00226 0.00355
+982 0.287 0.0146 0.00225 0.00354
+983 0.288 0.0145 0.00224 0.00353
+984 0.288 0.0145 0.00223 0.00352
+985 0.288 0.0144 0.00223 0.00351
+986 0.288 0.0143 0.00222 0.0035
+987 0.288 0.0143 0.00221 0.00349
+988 0.288 0.0142 0.0022 0.00348
+989 0.288 0.0142 0.00219 0.00348
+990 0.288 0.0141 0.00219 0.00347
+991 0.288 0.0141 0.00218 0.00346
+992 0.288 0.014 0.00217 0.00345
+993 0.288 0.0139 0.00216 0.00344
+994 0.288 0.0139 0.00215 0.00344
+995 0.288 0.0138 0.00215 0.00343
+996 0.288 0.0138 0.00214 0.00342
+997 0.288 0.0137 0.00213 0.00341
+998 0.288 0.0137 0.00212 0.00341
+999 0.288 0.0136 0.00212 0.0034
+1000 0.288 0.0136 0.00211 0.00339
+1001 0.288 0.0135 0.0021 0.00339
+1002 0.288 0.0135 0.00209 0.00338
+1003 0.288 0.0134 0.00209 0.00337
+1004 0.288 0.0134 0.00208 0.00337
+1005 0.288 0.0133 0.00207 0.00336
+1006 0.288 0.0133 0.00207 0.00335
+1007 0.288 0.0132 0.00206 0.00335
+1008 0.288 0.0132 0.00205 0.00334
+1009 0.288 0.0131 0.00205 0.00333
+1010 0.288 0.0131 0.00204 0.00333
+1011 0.288 0.013 0.00203 0.00332
+1012 0.288 0.013 0.00202 0.00332
+1013 0.288 0.0129 0.00202 0.00331
+1014 0.288 0.0129 0.00201 0.0033
+1015 0.288 0.0128 0.00201 0.0033
+1016 0.288 0.0128 0.002 0.00329
+1017 0.288 0.0127 0.00199 0.00329
+1018 0.288 0.0127 0.00199 0.00328
+1019 0.288 0.0126 0.00198 0.00328
+1020 0.288 0.0126 0.00197 0.00327
+1021 0.288 0.0125 0.00197 0.00327
+1022 0.288 0.0125 0.00196 0.00326
+1023 0.288 0.0124 0.00196 0.00326
+1024 0.288 0.0124 0.00195 0.00325
+1025 0.288 0.0123 0.00194 0.00325
+1026 0.288 0.0123 0.00194 0.00324
+1027 0.288 0.0123 0.00193 0.00324
+1028 0.288 0.0122 0.00193 0.00323
+1029 0.288 0.0122 0.00192 0.00323
+1030 0.288 0.0121 0.00191 0.00322
+1031 0.288 0.0121 0.00191 0.00322
+1032 0.288 0.012 0.0019 0.00321
+1033 0.288 0.012 0.0019 0.00321
+1034 0.288 0.0119 0.00189 0.00321
+1035 0.288 0.0119 0.00189 0.0032
+1036 0.288 0.0119 0.00188 0.0032
+1037 0.288 0.0118 0.00188 0.00319
+1038 0.288 0.0118 0.00187 0.00319
+1039 0.288 0.0117 0.00187 0.00319
+1040 0.288 0.0117 0.00186 0.00318
+1041 0.288 0.0117 0.00186 0.00318
+1042 0.288 0.0116 0.00185 0.00317
+1043 0.288 0.0116 0.00185 0.00317
+1044 0.288 0.0115 0.00184 0.00317
+1045 0.288 0.0115 0.00184 0.00316
+1046 0.288 0.0115 0.00183 0.00316
+1047 0.288 0.0114 0.00183 0.00316
+1048 0.288 0.0114 0.00182 0.00315
+1049 0.288 0.0113 0.00182 0.00315
+1050 0.288 0.0113 0.00181 0.00315
+1051 0.288 0.0113 0.00181 0.00314
+1052 0.288 0.0112 0.0018 0.00314
+1053 0.288 0.0112 0.0018 0.00314
+1054 0.288 0.0112 0.00179 0.00313
+1055 0.288 0.0111 0.00179 0.00313
+1056 0.288 0.0111 0.00178 0.00313
+1057 0.288 0.011 0.00178 0.00312
+1058 0.288 0.011 0.00177 0.00312
+1059 0.288 0.011 0.00177 0.00312
+1060 0.288 0.0109 0.00177 0.00312
+1061 0.288 0.0109 0.00176 0.00311
+1062 0.288 0.0109 0.00176 0.00311
+1063 0.288 0.0108 0.00175 0.00311
+1064 0.288 0.0108 0.00175 0.00311
+1065 0.288 0.0108 0.00174 0.0031
+1066 0.289 0.0107 0.00174 0.0031
+1067 0.289 0.0107 0.00174 0.0031
+1068 0.289 0.0106 0.00173 0.0031
+1069 0.289 0.0106 0.00173 0.00309
+1070 0.289 0.0106 0.00172 0.00309
+1071 0.289 0.0105 0.00172 0.00309
+1072 0.289 0.0105 0.00172 0.00309
+1073 0.289 0.0105 0.00171 0.00308
+1074 0.289 0.0104 0.00171 0.00308
+1075 0.289 0.0104 0.0017 0.00308
+1076 0.289 0.0104 0.0017 0.00308
+1077 0.289 0.0103 0.0017 0.00308
+1078 0.289 0.0103 0.00169 0.00307
+1079 0.289 0.0103 0.00169 0.00307
+1080 0.289 0.0102 0.00169 0.00307
+1081 0.289 0.0102 0.00168 0.00307
+1082 0.289 0.0102 0.00168 0.00307
+1083 0.289 0.0102 0.00168 0.00307
+1084 0.289 0.0101 0.00167 0.00306
+1085 0.289 0.0101 0.00167 0.00306
+1086 0.289 0.0101 0.00166 0.00306
+1087 0.289 0.01 0.00166 0.00306
+1088 0.289 0.01 0.00166 0.00306
+1089 0.289 0.00997 0.00165 0.00306
+1090 0.289 0.00994 0.00165 0.00305
+1091 0.289 0.00991 0.00165 0.00305
+1092 0.289 0.00988 0.00164 0.00305
+1093 0.289 0.00985 0.00164 0.00305
+1094 0.289 0.00982 0.00164 0.00305
+1095 0.289 0.00979 0.00163 0.00305
+1096 0.289 0.00976 0.00163 0.00305
+1097 0.289 0.00973 0.00163 0.00304
+1098 0.289 0.0097 0.00162 0.00304
+1099 0.289 0.00967 0.00162 0.00304
+1100 0.289 0.00964 0.00162 0.00304
+1101 0.289 0.00962 0.00162 0.00304
+1102 0.289 0.00959 0.00161 0.00304
+1103 0.289 0.00956 0.00161 0.00304
+1104 0.289 0.00953 0.00161 0.00304
+1105 0.289 0.0095 0.0016 0.00304
+1106 0.289 0.00948 0.0016 0.00303
+1107 0.289 0.00945 0.0016 0.00303
+1108 0.289 0.00942 0.00159 0.00303
+1109 0.289 0.00939 0.00159 0.00303
+1110 0.289 0.00937 0.00159 0.00303
+1111 0.289 0.00934 0.00159 0.00303
+1112 0.289 0.00931 0.00158 0.00303
+1113 0.289 0.00929 0.00158 0.00303
+1114 0.289 0.00926 0.00158 0.00303
+1115 0.289 0.00923 0.00157 0.00303
+1116 0.289 0.00921 0.00157 0.00303
+1117 0.289 0.00918 0.00157 0.00302
+1118 0.289 0.00916 0.00157 0.00302
+1119 0.289 0.00913 0.00156 0.00302
+1120 0.289 0.00911 0.00156 0.00302
+1121 0.289 0.00908 0.00156 0.00302
+1122 0.289 0.00906 0.00156 0.00302
+1123 0.289 0.00903 0.00155 0.00302
+1124 0.289 0.00901 0.00155 0.00302
+1125 0.289 0.00898 0.00155 0.00302
+1126 0.289 0.00896 0.00155 0.00302
+1127 0.289 0.00893 0.00154 0.00302
+1128 0.289 0.00891 0.00154 0.00302
+1129 0.289 0.00888 0.00154 0.00302
+1130 0.289 0.00886 0.00154 0.00302
+1131 0.289 0.00883 0.00153 0.00302
+1132 0.289 0.00881 0.00153 0.00302
+1133 0.289 0.00879 0.00153 0.00301
+1134 0.289 0.00876 0.00153 0.00301
+1135 0.289 0.00874 0.00152 0.00301
+1136 0.289 0.00872 0.00152 0.00301
+1137 0.289 0.00869 0.00152 0.00301
+1138 0.289 0.00867 0.00152 0.00301
+1139 0.289 0.00865 0.00151 0.00301
+1140 0.289 0.00863 0.00151 0.00301
+1141 0.289 0.0086 0.00151 0.00301
+1142 0.289 0.00858 0.00151 0.00301
+1143 0.289 0.00856 0.0015 0.00301
+1144 0.289 0.00854 0.0015 0.00301
+1145 0.289 0.00851 0.0015 0.00301
+1146 0.289 0.00849 0.0015 0.00301
+1147 0.289 0.00847 0.0015 0.00301
+1148 0.289 0.00845 0.00149 0.00301
+1149 0.289 0.00843 0.00149 0.00301
+1150 0.289 0.0084 0.00149 0.00301
+1151 0.289 0.00838 0.00149 0.00301
+1152 0.289 0.00836 0.00148 0.00301
+1153 0.289 0.00834 0.00148 0.00301
+1154 0.289 0.00832 0.00148 0.00301
+1155 0.289 0.0083 0.00148 0.00301
+1156 0.289 0.00828 0.00148 0.00301
+1157 0.289 0.00826 0.00147 0.00301
+1158 0.289 0.00824 0.00147 0.00301
+1159 0.289 0.00822 0.00147 0.00301
+1160 0.289 0.00819 0.00147 0.00301
+1161 0.289 0.00817 0.00147 0.00301
+1162 0.289 0.00815 0.00146 0.00301
+1163 0.289 0.00813 0.00146 0.00301
+1164 0.289 0.00811 0.00146 0.00301
+1165 0.289 0.00809 0.00146 0.00301
+1166 0.289 0.00807 0.00146 0.00301
+1167 0.289 0.00805 0.00145 0.00301
+1168 0.289 0.00803 0.00145 0.00301
+1169 0.289 0.00802 0.00145 0.00301
+1170 0.289 0.008 0.00145 0.00301
+1171 0.289 0.00798 0.00145 0.00301
+1172 0.289 0.00796 0.00144 0.00301
+1173 0.289 0.00794 0.00144 0.00301
+1174 0.289 0.00792 0.00144 0.00301
+1175 0.289 0.0079 0.00144 0.00301
+1176 0.289 0.00788 0.00144 0.00301
+1177 0.289 0.00786 0.00144 0.00301
+1178 0.289 0.00784 0.00143 0.00301
+1179 0.289 0.00783 0.00143 0.00301
+1180 0.289 0.00781 0.00143 0.00301
+1181 0.289 0.00779 0.00143 0.00301
+1182 0.289 0.00777 0.00143 0.00301
+1183 0.289 0.00775 0.00142 0.00301
+1184 0.289 0.00774 0.00142 0.00301
+1185 0.289 0.00772 0.00142 0.00301
+1186 0.289 0.0077 0.00142 0.00301
+1187 0.289 0.00768 0.00142 0.00301
+1188 0.289 0.00766 0.00142 0.00301
+1189 0.289 0.00765 0.00141 0.00301
+1190 0.289 0.00763 0.00141 0.00301
+1191 0.289 0.00761 0.00141 0.00301
+1192 0.289 0.00759 0.00141 0.00301
+1193 0.289 0.00758 0.00141 0.00301
+1194 0.289 0.00756 0.00141 0.00301
+1195 0.289 0.00754 0.0014 0.00301
+1196 0.289 0.00753 0.0014 0.00301
+1197 0.289 0.00751 0.0014 0.00302
+1198 0.289 0.00749 0.0014 0.00302
+1199 0.289 0.00748 0.0014 0.00302
+1200 0.289 0.00746 0.0014 0.00302
+1201 0.289 0.00744 0.00139 0.00302
+1202 0.289 0.00743 0.00139 0.00302
+1203 0.289 0.00741 0.00139 0.00302
+1204 0.289 0.00739 0.00139 0.00302
+1205 0.289 0.00738 0.00139 0.00302
+1206 0.289 0.00736 0.00139 0.00302
+1207 0.289 0.00735 0.00138 0.00302
+1208 0.289 0.00733 0.00138 0.00302
+1209 0.289 0.00731 0.00138 0.00302
+1210 0.289 0.0073 0.00138 0.00302
+1211 0.289 0.00728 0.00138 0.00302
+1212 0.289 0.00727 0.00138 0.00302
+1213 0.289 0.00725 0.00138 0.00302
+1214 0.289 0.00724 0.00137 0.00302
+1215 0.289 0.00722 0.00137 0.00302
+1216 0.289 0.0072 0.00137 0.00302
+1217 0.289 0.00719 0.00137 0.00302
+1218 0.289 0.00717 0.00137 0.00302
+1219 0.289 0.00716 0.00137 0.00302
+1220 0.289 0.00714 0.00136 0.00302
+1221 0.289 0.00713 0.00136 0.00302
+1222 0.289 0.00711 0.00136 0.00302
+1223 0.289 0.0071 0.00136 0.00302
+1224 0.289 0.00709 0.00136 0.00303
+1225 0.289 0.00707 0.00136 0.00303
+1226 0.289 0.00706 0.00136 0.00303
+1227 0.289 0.00704 0.00135 0.00303
+1228 0.289 0.00703 0.00135 0.00303
+1229 0.289 0.00701 0.00135 0.00303
+1230 0.289 0.007 0.00135 0.00303
+1231 0.289 0.00698 0.00135 0.00303
+1232 0.289 0.00697 0.00135 0.00303
+1233 0.289 0.00696 0.00135 0.00303
+1234 0.289 0.00694 0.00134 0.00303
+1235 0.289 0.00693 0.00134 0.00303
+1236 0.289 0.00691 0.00134 0.00303
+1237 0.289 0.0069 0.00134 0.00303
+1238 0.289 0.00689 0.00134 0.00303
+1239 0.289 0.00687 0.00134 0.00303
+1240 0.289 0.00686 0.00134 0.00303
+1241 0.289 0.00685 0.00133 0.00303
+1242 0.289 0.00683 0.00133 0.00303
+1243 0.289 0.00682 0.00133 0.00303
+1244 0.289 0.00681 0.00133 0.00303
+1245 0.289 0.00679 0.00133 0.00303
+1246 0.289 0.00678 0.00133 0.00303
+1247 0.289 0.00677 0.00133 0.00304
+1248 0.289 0.00675 0.00133 0.00304
+1249 0.289 0.00674 0.00132 0.00304
+1250 0.289 0.00673 0.00132 0.00304
+1251 0.289 0.00671 0.00132 0.00304
+1252 0.289 0.0067 0.00132 0.00304
+1253 0.289 0.00669 0.00132 0.00304
+1254 0.289 0.00668 0.00132 0.00304
+1255 0.289 0.00666 0.00132 0.00304
+1256 0.289 0.00665 0.00131 0.00304
+1257 0.289 0.00664 0.00131 0.00304
+1258 0.289 0.00663 0.00131 0.00304
+1259 0.289 0.00661 0.00131 0.00304
+1260 0.289 0.0066 0.00131 0.00304
+1261 0.289 0.00659 0.00131 0.00304
+1262 0.289 0.00658 0.00131 0.00304
+1263 0.289 0.00656 0.00131 0.00304
+1264 0.289 0.00655 0.0013 0.00304
+1265 0.289 0.00654 0.0013 0.00304
+1266 0.289 0.00653 0.0013 0.00304
+1267 0.289 0.00652 0.0013 0.00305
+1268 0.289 0.0065 0.0013 0.00305
+1269 0.289 0.00649 0.0013 0.00305
+1270 0.289 0.00648 0.0013 0.00305
+1271 0.289 0.00647 0.0013 0.00305
+1272 0.289 0.00646 0.00129 0.00305
+1273 0.289 0.00645 0.00129 0.00305
+1274 0.289 0.00643 0.00129 0.00305
+1275 0.289 0.00642 0.00129 0.00305
+1276 0.289 0.00641 0.00129 0.00305
+1277 0.289 0.0064 0.00129 0.00305
+1278 0.289 0.00639 0.00129 0.00305
+1279 0.289 0.00638 0.00128 0.00305
+1280 0.289 0.00637 0.00128 0.00305
+1281 0.289 0.00636 0.00128 0.00305
+1282 0.289 0.00634 0.00128 0.00305
+1283 0.289 0.00633 0.00128 0.00305
+1284 0.289 0.00632 0.00128 0.00305
+1285 0.289 0.00631 0.00128 0.00305
+1286 0.289 0.0063 0.00128 0.00305
+1287 0.289 0.00629 0.00127 0.00305
+1288 0.289 0.00628 0.00127 0.00306
+1289 0.289 0.00627 0.00127 0.00306
+1290 0.289 0.00626 0.00127 0.00306
+1291 0.289 0.00625 0.00127 0.00306
+1292 0.289 0.00624 0.00127 0.00306
+1293 0.289 0.00623 0.00127 0.00306
+1294 0.289 0.00621 0.00127 0.00306
+1295 0.289 0.0062 0.00127 0.00306
+1296 0.289 0.00619 0.00126 0.00306
+1297 0.289 0.00618 0.00126 0.00306
+1298 0.289 0.00617 0.00126 0.00306
+1299 0.289 0.00616 0.00126 0.00306
+1300 0.289 0.00615 0.00126 0.00306
+1301 0.289 0.00614 0.00126 0.00306
+1302 0.289 0.00613 0.00126 0.00306
+1303 0.289 0.00612 0.00126 0.00306
+1304 0.289 0.00611 0.00125 0.00306
+1305 0.289 0.0061 0.00125 0.00306
+1306 0.289 0.00609 0.00125 0.00306
+1307 0.289 0.00608 0.00125 0.00306
+1308 0.289 0.00607 0.00125 0.00307
+1309 0.289 0.00606 0.00125 0.00307
+1310 0.289 0.00605 0.00125 0.00307
+1311 0.289 0.00604 0.00125 0.00307
+1312 0.289 0.00603 0.00124 0.00307
+1313 0.289 0.00602 0.00124 0.00307
+1314 0.289 0.00601 0.00124 0.00307
+1315 0.289 0.006 0.00124 0.00307
+1316 0.289 0.006 0.00124 0.00307
+1317 0.288 0.00599 0.00124 0.00307
+1318 0.288 0.00598 0.00124 0.00307
+1319 0.288 0.00597 0.00124 0.00307
+1320 0.288 0.00596 0.00124 0.00307
+1321 0.288 0.00595 0.00123 0.00307
+1322 0.288 0.00594 0.00123 0.00307
+1323 0.288 0.00593 0.00123 0.00307
+1324 0.288 0.00592 0.00123 0.00307
+1325 0.288 0.00591 0.00123 0.00307
+1326 0.288 0.0059 0.00123 0.00307
+1327 0.288 0.00589 0.00123 0.00307
+1328 0.288 0.00588 0.00123 0.00307
+1329 0.288 0.00588 0.00122 0.00307
+1330 0.288 0.00587 0.00122 0.00308
+1331 0.288 0.00586 0.00122 0.00308
+1332 0.288 0.00585 0.00122 0.00308
+1333 0.288 0.00584 0.00122 0.00308
+1334 0.288 0.00583 0.00122 0.00308
+1335 0.288 0.00582 0.00122 0.00308
+1336 0.288 0.00581 0.00122 0.00308
+1337 0.288 0.00581 0.00122 0.00308
+1338 0.288 0.0058 0.00121 0.00308
+1339 0.288 0.00579 0.00121 0.00308
+1340 0.288 0.00578 0.00121 0.00308
+1341 0.288 0.00577 0.00121 0.00308
+1342 0.288 0.00576 0.00121 0.00308
+1343 0.288 0.00575 0.00121 0.00308
+1344 0.288 0.00575 0.00121 0.00308
+1345 0.288 0.00574 0.00121 0.00308
+1346 0.288 0.00573 0.00121 0.00308
+1347 0.288 0.00572 0.0012 0.00308
+1348 0.288 0.00571 0.0012 0.00308
+1349 0.288 0.0057 0.0012 0.00308
+1350 0.288 0.0057 0.0012 0.00308
+1351 0.288 0.00569 0.0012 0.00308
+1352 0.288 0.00568 0.0012 0.00308
+1353 0.288 0.00567 0.0012 0.00309
+1354 0.288 0.00566 0.0012 0.00309
+1355 0.288 0.00566 0.00119 0.00309
+1356 0.288 0.00565 0.00119 0.00309
+1357 0.288 0.00564 0.00119 0.00309
+1358 0.288 0.00563 0.00119 0.00309
+1359 0.288 0.00562 0.00119 0.00309
+1360 0.288 0.00562 0.00119 0.00309
+1361 0.288 0.00561 0.00119 0.00309
+1362 0.288 0.0056 0.00119 0.00309
+1363 0.288 0.00559 0.00119 0.00309
+1364 0.288 0.00559 0.00118 0.00309
+1365 0.288 0.00558 0.00118 0.00309
+1366 0.288 0.00557 0.00118 0.00309
+1367 0.288 0.00556 0.00118 0.00309
+1368 0.288 0.00555 0.00118 0.00309
+1369 0.288 0.00555 0.00118 0.00309
+1370 0.288 0.00554 0.00118 0.00309
+1371 0.288 0.00553 0.00118 0.00309
+1372 0.288 0.00552 0.00118 0.00309
+1373 0.288 0.00552 0.00117 0.00309
+1374 0.288 0.00551 0.00117 0.00309
+1375 0.288 0.0055 0.00117 0.00309
+1376 0.288 0.0055 0.00117 0.00309
+1377 0.288 0.00549 0.00117 0.00309
+1378 0.288 0.00548 0.00117 0.00309
+1379 0.288 0.00547 0.00117 0.0031
+1380 0.288 0.00547 0.00117 0.0031
+1381 0.288 0.00546 0.00117 0.0031
+1382 0.288 0.00545 0.00116 0.0031
+1383 0.288 0.00544 0.00116 0.0031
+1384 0.288 0.00544 0.00116 0.0031
+1385 0.288 0.00543 0.00116 0.0031
+1386 0.288 0.00542 0.00116 0.0031
+1387 0.288 0.00542 0.00116 0.0031
+1388 0.288 0.00541 0.00116 0.0031
+1389 0.288 0.0054 0.00116 0.0031
+1390 0.288 0.0054 0.00115 0.0031
+1391 0.288 0.00539 0.00115 0.0031
+1392 0.288 0.00538 0.00115 0.0031
+1393 0.288 0.00538 0.00115 0.0031
+1394 0.288 0.00537 0.00115 0.0031
+1395 0.288 0.00536 0.00115 0.0031
+1396 0.288 0.00535 0.00115 0.0031
+1397 0.288 0.00535 0.00115 0.0031
+1398 0.288 0.00534 0.00115 0.0031
+1399 0.288 0.00533 0.00114 0.0031
+1400 0.287 0.00533 0.00114 0.0031
+1401 0.287 0.00532 0.00114 0.0031
+1402 0.287 0.00531 0.00114 0.0031
+1403 0.287 0.00531 0.00114 0.0031
+1404 0.287 0.0053 0.00114 0.0031
+1405 0.287 0.0053 0.00114 0.0031
+1406 0.287 0.00529 0.00114 0.0031
+1407 0.287 0.00528 0.00114 0.0031
+1408 0.287 0.00528 0.00113 0.0031
+1409 0.287 0.00527 0.00113 0.0031
+1410 0.287 0.00526 0.00113 0.00311
+1411 0.287 0.00526 0.00113 0.00311
+1412 0.287 0.00525 0.00113 0.00311
+1413 0.287 0.00524 0.00113 0.00311
+1414 0.287 0.00524 0.00113 0.00311
+1415 0.287 0.00523 0.00113 0.00311
+1416 0.287 0.00522 0.00113 0.00311
+1417 0.287 0.00522 0.00112 0.00311
+1418 0.287 0.00521 0.00112 0.00311
+1419 0.287 0.00521 0.00112 0.00311
+1420 0.287 0.0052 0.00112 0.00311
+1421 0.287 0.00519 0.00112 0.00311
+1422 0.287 0.00519 0.00112 0.00311
+1423 0.287 0.00518 0.00112 0.00311
+1424 0.287 0.00518 0.00112 0.00311
+1425 0.287 0.00517 0.00112 0.00311
+1426 0.287 0.00516 0.00111 0.00311
+1427 0.287 0.00516 0.00111 0.00311
+1428 0.287 0.00515 0.00111 0.00311
+1429 0.287 0.00515 0.00111 0.00311
+1430 0.287 0.00514 0.00111 0.00311
+1431 0.287 0.00513 0.00111 0.00311
+1432 0.287 0.00513 0.00111 0.00311
+1433 0.287 0.00512 0.00111 0.00311
+1434 0.287 0.00512 0.00111 0.00311
+1435 0.287 0.00511 0.0011 0.00311
+1436 0.287 0.0051 0.0011 0.00311
+1437 0.287 0.0051 0.0011 0.00311
+1438 0.287 0.00509 0.0011 0.00311
+1439 0.287 0.00509 0.0011 0.00311
+1440 0.287 0.00508 0.0011 0.00311
+1441 0.287 0.00508 0.0011 0.00311
+1442 0.287 0.00507 0.0011 0.00311
+1443 0.287 0.00506 0.0011 0.00311
+1444 0.287 0.00506 0.00109 0.00311
+1445 0.287 0.00505 0.00109 0.00311
+1446 0.287 0.00505 0.00109 0.00311
+1447 0.287 0.00504 0.00109 0.00311
+1448 0.287 0.00504 0.00109 0.00311
+1449 0.287 0.00503 0.00109 0.00311
+1450 0.287 0.00502 0.00109 0.00312
+1451 0.287 0.00502 0.00109 0.00312
+1452 0.287 0.00501 0.00109 0.00312
+1453 0.287 0.00501 0.00108 0.00312
+1454 0.287 0.005 0.00108 0.00312
+1455 0.287 0.005 0.00108 0.00312
+1456 0.287 0.00499 0.00108 0.00312
+1457 0.287 0.00499 0.00108 0.00312
+1458 0.287 0.00498 0.00108 0.00312
+1459 0.286 0.00498 0.00108 0.00312
+1460 0.286 0.00497 0.00108 0.00312
+1461 0.286 0.00496 0.00108 0.00312
+1462 0.286 0.00496 0.00107 0.00312
+1463 0.286 0.00495 0.00107 0.00312
+1464 0.286 0.00495 0.00107 0.00312
+1465 0.286 0.00494 0.00107 0.00312
+1466 0.286 0.00494 0.00107 0.00312
+1467 0.286 0.00493 0.00107 0.00312
+1468 0.286 0.00493 0.00107 0.00312
+1469 0.286 0.00492 0.00107 0.00312
+1470 0.286 0.00492 0.00107 0.00312
+1471 0.286 0.00491 0.00106 0.00312
+1472 0.286 0.00491 0.00106 0.00312
+1473 0.286 0.0049 0.00106 0.00312
+1474 0.286 0.0049 0.00106 0.00312
+1475 0.286 0.00489 0.00106 0.00312
+1476 0.286 0.00489 0.00106 0.00312
+1477 0.286 0.00488 0.00106 0.00312
+1478 0.286 0.00488 0.00106 0.00312
+1479 0.286 0.00487 0.00106 0.00312
+1480 0.286 0.00487 0.00106 0.00312
+1481 0.286 0.00486 0.00105 0.00312
+1482 0.286 0.00486 0.00105 0.00312
+1483 0.286 0.00485 0.00105 0.00312
+1484 0.286 0.00485 0.00105 0.00312
+1485 0.286 0.00484 0.00105 0.00312
+1486 0.286 0.00484 0.00105 0.00312
+1487 0.286 0.00483 0.00105 0.00312
+1488 0.286 0.00483 0.00105 0.00312
+1489 0.286 0.00482 0.00105 0.00312
+1490 0.286 0.00482 0.00104 0.00312
+1491 0.286 0.00481 0.00104 0.00312
+1492 0.286 0.00481 0.00104 0.00312
+1493 0.286 0.0048 0.00104 0.00312
+1494 0.286 0.0048 0.00104 0.00312
+1495 0.286 0.00479 0.00104 0.00312
+1496 0.286 0.00479 0.00104 0.00312
+1497 0.286 0.00478 0.00104 0.00312
+1498 0.286 0.00478 0.00104 0.00312
+1499 0.286 0.00477 0.00103 0.00312
+1500 0.286 0.00477 0.00103 0.00312
+1501 0.286 0.00476 0.00103 0.00312
+1502 0.286 0.00476 0.00103 0.00312
+1503 0.286 0.00475 0.00103 0.00312
+1504 0.286 0.00475 0.00103 0.00312
+1505 0.286 0.00474 0.00103 0.00312
+1506 0.286 0.00474 0.00103 0.00312
+1507 0.285 0.00473 0.00103 0.00312
+1508 0.285 0.00473 0.00102 0.00312
+1509 0.285 0.00472 0.00102 0.00312
+1510 0.285 0.00472 0.00102 0.00312
+1511 0.285 0.00471 0.00102 0.00312
+1512 0.285 0.00471 0.00102 0.00312
+1513 0.285 0.00471 0.00102 0.00312
+1514 0.285 0.0047 0.00102 0.00312
+1515 0.285 0.0047 0.00102 0.00312
+1516 0.285 0.00469 0.00102 0.00312
+1517 0.285 0.00469 0.00101 0.00312
+1518 0.285 0.00468 0.00101 0.00312
+1519 0.285 0.00468 0.00101 0.00312
+1520 0.285 0.00467 0.00101 0.00312
+1521 0.285 0.00467 0.00101 0.00312
+1522 0.285 0.00466 0.00101 0.00312
+1523 0.285 0.00466 0.00101 0.00312
+1524 0.285 0.00466 0.00101 0.00312
+1525 0.285 0.00465 0.00101 0.00312
+1526 0.285 0.00465 0.00101 0.00312
+1527 0.285 0.00464 0.001 0.00312
+1528 0.285 0.00464 0.001 0.00312
+1529 0.285 0.00463 0.001 0.00312
+1530 0.285 0.00463 0.001 0.00312
+1531 0.285 0.00462 0.001 0.00312
+1532 0.285 0.00462 0.000999 0.00312
+1533 0.285 0.00461 0.000998 0.00312
+1534 0.285 0.00461 0.000996 0.00312
+1535 0.285 0.00461 0.000995 0.00312
+1536 0.285 0.0046 0.000994 0.00312
+1537 0.285 0.0046 0.000993 0.00312
+1538 0.285 0.00459 0.000992 0.00312
+1539 0.285 0.00459 0.000991 0.00312
+1540 0.285 0.00458 0.00099 0.00312
+1541 0.285 0.00458 0.000989 0.00312
+1542 0.285 0.00458 0.000988 0.00312
+1543 0.285 0.00457 0.000987 0.00312
+1544 0.285 0.00457 0.000986 0.00312
+1545 0.285 0.00456 0.000985 0.00312
+1546 0.285 0.00456 0.000984 0.00312
+1547 0.285 0.00455 0.000983 0.00312
+1548 0.285 0.00455 0.000981 0.00312
+1549 0.284 0.00455 0.00098 0.00312
+1550 0.284 0.00454 0.000979 0.00312
+1551 0.284 0.00454 0.000978 0.00312
+1552 0.284 0.00453 0.000977 0.00312
+1553 0.284 0.00453 0.000976 0.00312
+1554 0.284 0.00452 0.000975 0.00312
+1555 0.284 0.00452 0.000974 0.00312
+1556 0.284 0.00452 0.000973 0.00312
+1557 0.284 0.00451 0.000972 0.00312
+1558 0.284 0.00451 0.000971 0.00312
+1559 0.284 0.0045 0.00097 0.00312
+1560 0.284 0.0045 0.000969 0.00312
+1561 0.284 0.00449 0.000968 0.00312
+1562 0.284 0.00449 0.000967 0.00312
+1563 0.284 0.00449 0.000965 0.00312
+1564 0.284 0.00448 0.000964 0.00312
+1565 0.284 0.00448 0.000963 0.00312
+1566 0.284 0.00447 0.000962 0.00312
+1567 0.284 0.00447 0.000961 0.00312
+1568 0.284 0.00446 0.00096 0.00312
+1569 0.284 0.00446 0.000959 0.00312
+1570 0.284 0.00446 0.000958 0.00312
+1571 0.284 0.00445 0.000957 0.00312
+1572 0.284 0.00445 0.000956 0.00312
+1573 0.284 0.00444 0.000955 0.00312
+1574 0.284 0.00444 0.000954 0.00312
+1575 0.284 0.00444 0.000953 0.00312
+1576 0.284 0.00443 0.000952 0.00312
+1577 0.284 0.00443 0.000951 0.00312
+1578 0.284 0.00442 0.00095 0.00312
+1579 0.284 0.00442 0.000949 0.00312
+1580 0.284 0.00442 0.000948 0.00312
+1581 0.284 0.00441 0.000946 0.00312
+1582 0.284 0.00441 0.000945 0.00312
+1583 0.284 0.0044 0.000944 0.00312
+1584 0.284 0.0044 0.000943 0.00312
+1585 0.284 0.00439 0.000942 0.00312
+1586 0.283 0.00439 0.000941 0.00312
+1587 0.283 0.00439 0.00094 0.00312
+1588 0.283 0.00438 0.000939 0.00312
+1589 0.283 0.00438 0.000938 0.00312
+1590 0.283 0.00437 0.000937 0.00312
+1591 0.283 0.00437 0.000936 0.00312
+1592 0.283 0.00437 0.000935 0.00312
+1593 0.283 0.00436 0.000934 0.00312
+1594 0.283 0.00436 0.000933 0.00312
+1595 0.283 0.00435 0.000932 0.00312
+1596 0.283 0.00435 0.000931 0.00312
+1597 0.283 0.00435 0.00093 0.00312
+1598 0.283 0.00434 0.000929 0.00312
+1599 0.283 0.00434 0.000928 0.00312
+1600 0.283 0.00433 0.000927 0.00312
+1601 0.283 0.00433 0.000926 0.00312
+1602 0.283 0.00433 0.000925 0.00312
+1603 0.283 0.00432 0.000923 0.00312
+1604 0.283 0.00432 0.000922 0.00312
+1605 0.283 0.00431 0.000921 0.00312
+1606 0.283 0.00431 0.00092 0.00312
+1607 0.283 0.00431 0.000919 0.00312
+1608 0.283 0.0043 0.000918 0.00312
+1609 0.283 0.0043 0.000917 0.00312
+1610 0.283 0.00429 0.000916 0.00312
+1611 0.283 0.00429 0.000915 0.00312
+1612 0.283 0.00429 0.000914 0.00312
+1613 0.283 0.00428 0.000913 0.00312
+1614 0.283 0.00428 0.000912 0.00312
+1615 0.283 0.00428 0.000911 0.00312
+1616 0.283 0.00427 0.00091 0.00312
+1617 0.283 0.00427 0.000909 0.00312
+1618 0.283 0.00426 0.000908 0.00312
+1619 0.283 0.00426 0.000907 0.00312
+1620 0.283 0.00426 0.000906 0.00311
+1621 0.282 0.00425 0.000905 0.00311
+1622 0.282 0.00425 0.000904 0.00311
+1623 0.282 0.00424 0.000903 0.00311
+1624 0.282 0.00424 0.000902 0.00311
+1625 0.282 0.00424 0.000901 0.00311
+1626 0.282 0.00423 0.0009 0.00311
+1627 0.282 0.00423 0.000899 0.00311
+1628 0.282 0.00422 0.000898 0.00311
+1629 0.282 0.00422 0.000897 0.00311
+1630 0.282 0.00422 0.000896 0.00311
+1631 0.282 0.00421 0.000895 0.00311
+1632 0.282 0.00421 0.000894 0.00311
+1633 0.282 0.00421 0.000893 0.00311
+1634 0.282 0.0042 0.000892 0.00311
+1635 0.282 0.0042 0.000891 0.00311
+1636 0.282 0.00419 0.00089 0.00311
+1637 0.282 0.00419 0.000889 0.00311
+1638 0.282 0.00419 0.000887 0.00311
+1639 0.282 0.00418 0.000886 0.00311
+1640 0.282 0.00418 0.000885 0.00311
+1641 0.282 0.00417 0.000884 0.00311
+1642 0.282 0.00417 0.000883 0.00311
+1643 0.282 0.00417 0.000882 0.00311
+1644 0.282 0.00416 0.000881 0.00311
+1645 0.282 0.00416 0.00088 0.00311
+1646 0.282 0.00416 0.000879 0.00311
+1647 0.282 0.00415 0.000878 0.00311
+1648 0.282 0.00415 0.000877 0.00311
+1649 0.282 0.00414 0.000876 0.00311
+1650 0.282 0.00414 0.000875 0.00311
+1651 0.282 0.00414 0.000874 0.00311
+1652 0.281 0.00413 0.000873 0.00311
+1653 0.281 0.00413 0.000872 0.00311
+1654 0.281 0.00412 0.000871 0.00311
+1655 0.281 0.00412 0.00087 0.00311
+1656 0.281 0.00412 0.000869 0.00311
+1657 0.281 0.00411 0.000868 0.00311
+1658 0.281 0.00411 0.000867 0.00311
+1659 0.281 0.00411 0.000866 0.00311
+1660 0.281 0.0041 0.000865 0.0031
+1661 0.281 0.0041 0.000864 0.0031
+1662 0.281 0.00409 0.000863 0.0031
+1663 0.281 0.00409 0.000862 0.0031
+1664 0.281 0.00409 0.000861 0.0031
+1665 0.281 0.00408 0.00086 0.0031
+1666 0.281 0.00408 0.000859 0.0031
+1667 0.281 0.00408 0.000858 0.0031
+1668 0.281 0.00407 0.000857 0.0031
+1669 0.281 0.00407 0.000856 0.0031
+1670 0.281 0.00406 0.000855 0.0031
+1671 0.281 0.00406 0.000854 0.0031
+1672 0.281 0.00406 0.000853 0.0031
+1673 0.281 0.00405 0.000852 0.0031
+1674 0.281 0.00405 0.000851 0.0031
+1675 0.281 0.00404 0.00085 0.0031
+1676 0.281 0.00404 0.000849 0.0031
+1677 0.281 0.00404 0.000848 0.0031
+1678 0.281 0.00403 0.000847 0.0031
+1679 0.281 0.00403 0.000846 0.0031
+1680 0.281 0.00403 0.000845 0.0031
+1681 0.281 0.00402 0.000844 0.0031
+1682 0.28 0.00402 0.000843 0.0031
+1683 0.28 0.00401 0.000842 0.0031
+1684 0.28 0.00401 0.000841 0.0031
+1685 0.28 0.00401 0.00084 0.0031
+1686 0.28 0.004 0.000839 0.0031
+1687 0.28 0.004 0.000838 0.0031
+1688 0.28 0.004 0.000837 0.0031
+1689 0.28 0.00399 0.000836 0.0031
+1690 0.28 0.00399 0.000835 0.00309
+1691 0.28 0.00398 0.000834 0.00309
+1692 0.28 0.00398 0.000833 0.00309
+1693 0.28 0.00398 0.000832 0.00309
+1694 0.28 0.00397 0.000831 0.00309
+1695 0.28 0.00397 0.00083 0.00309
+1696 0.28 0.00397 0.00083 0.00309
+1697 0.28 0.00396 0.000829 0.00309
+1698 0.28 0.00396 0.000828 0.00309
+1699 0.28 0.00395 0.000827 0.00309
+1700 0.28 0.00395 0.000826 0.00309
+1701 0.28 0.00395 0.000825 0.00309
+1702 0.28 0.00394 0.000824 0.00309
+1703 0.28 0.00394 0.000823 0.00309
+1704 0.28 0.00394 0.000822 0.00309
+1705 0.28 0.00393 0.000821 0.00309
+1706 0.28 0.00393 0.00082 0.00309
+1707 0.28 0.00392 0.000819 0.00309
+1708 0.28 0.00392 0.000818 0.00309
+1709 0.28 0.00392 0.000817 0.00309
+1710 0.28 0.00391 0.000816 0.00309
+1711 0.279 0.00391 0.000815 0.00309
+1712 0.279 0.00391 0.000814 0.00309
+1713 0.279 0.0039 0.000813 0.00309
+1714 0.279 0.0039 0.000812 0.00309
+1715 0.279 0.00389 0.000811 0.00308
+1716 0.279 0.00389 0.00081 0.00308
+1717 0.279 0.00389 0.000809 0.00308
+1718 0.279 0.00388 0.000808 0.00308
+1719 0.279 0.00388 0.000807 0.00308
+1720 0.279 0.00388 0.000806 0.00308
+1721 0.279 0.00387 0.000805 0.00308
+1722 0.279 0.00387 0.000804 0.00308
+1723 0.279 0.00386 0.000803 0.00308
+1724 0.279 0.00386 0.000802 0.00308
+1725 0.279 0.00386 0.000801 0.00308
+1726 0.279 0.00385 0.0008 0.00308
+1727 0.279 0.00385 0.000799 0.00308
+1728 0.279 0.00385 0.000798 0.00308
+1729 0.279 0.00384 0.000797 0.00308
+1730 0.279 0.00384 0.000797 0.00308
+1731 0.279 0.00383 0.000796 0.00308
+1732 0.279 0.00383 0.000795 0.00308
+1733 0.279 0.00383 0.000794 0.00308
+1734 0.279 0.00382 0.000793 0.00308
+1735 0.279 0.00382 0.000792 0.00308
+1736 0.279 0.00382 0.000791 0.00308
+1737 0.279 0.00381 0.00079 0.00307
+1738 0.278 0.00381 0.000789 0.00307
+1739 0.278 0.0038 0.000788 0.00307
+1740 0.278 0.0038 0.000787 0.00307
+1741 0.278 0.0038 0.000786 0.00307
+1742 0.278 0.00379 0.000785 0.00307
+1743 0.278 0.00379 0.000784 0.00307
+1744 0.278 0.00379 0.000783 0.00307
+1745 0.278 0.00378 0.000782 0.00307
+1746 0.278 0.00378 0.000781 0.00307
+1747 0.278 0.00377 0.00078 0.00307
+1748 0.278 0.00377 0.000779 0.00307
+1749 0.278 0.00377 0.000778 0.00307
+1750 0.278 0.00376 0.000777 0.00307
+1751 0.278 0.00376 0.000777 0.00307
+1752 0.278 0.00376 0.000776 0.00307
+1753 0.278 0.00375 0.000775 0.00307
+1754 0.278 0.00375 0.000774 0.00307
+1755 0.278 0.00375 0.000773 0.00307
+1756 0.278 0.00374 0.000772 0.00307
+1757 0.278 0.00374 0.000771 0.00306
+1758 0.278 0.00373 0.00077 0.00306
+1759 0.278 0.00373 0.000769 0.00306
+1760 0.278 0.00373 0.000768 0.00306
+1761 0.278 0.00372 0.000767 0.00306
+1762 0.278 0.00372 0.000766 0.00306
+1763 0.277 0.00372 0.000765 0.00306
+1764 0.277 0.00371 0.000764 0.00306
+1765 0.277 0.00371 0.000763 0.00306
+1766 0.277 0.0037 0.000762 0.00306
+1767 0.277 0.0037 0.000761 0.00306
+1768 0.277 0.0037 0.000761 0.00306
+1769 0.277 0.00369 0.00076 0.00306
+1770 0.277 0.00369 0.000759 0.00306
+1771 0.277 0.00369 0.000758 0.00306
+1772 0.277 0.00368 0.000757 0.00306
+1773 0.277 0.00368 0.000756 0.00306
+1774 0.277 0.00367 0.000755 0.00306
+1775 0.277 0.00367 0.000754 0.00305
+1776 0.277 0.00367 0.000753 0.00305
+1777 0.277 0.00366 0.000752 0.00305
+1778 0.277 0.00366 0.000751 0.00305
+1779 0.277 0.00366 0.00075 0.00305
+1780 0.277 0.00365 0.000749 0.00305
+1781 0.277 0.00365 0.000748 0.00305
+1782 0.277 0.00364 0.000747 0.00305
+1783 0.277 0.00364 0.000747 0.00305
+1784 0.277 0.00364 0.000746 0.00305
+1785 0.277 0.00363 0.000745 0.00305
+1786 0.277 0.00363 0.000744 0.00305
+1787 0.277 0.00363 0.000743 0.00305
+1788 0.276 0.00362 0.000742 0.00305
+1789 0.276 0.00362 0.000741 0.00305
+1790 0.276 0.00361 0.00074 0.00305
+1791 0.276 0.00361 0.000739 0.00305
+1792 0.276 0.00361 0.000738 0.00304
+1793 0.276 0.0036 0.000737 0.00304
+1794 0.276 0.0036 0.000736 0.00304
+1795 0.276 0.0036 0.000736 0.00304
+1796 0.276 0.00359 0.000735 0.00304
+1797 0.276 0.00359 0.000734 0.00304
+1798 0.276 0.00358 0.000733 0.00304
+1799 0.276 0.00358 0.000732 0.00304
+1800 0.276 0.00358 0.000731 0.00304
+1801 0.276 0.00357 0.00073 0.00304
+1802 0.276 0.00357 0.000729 0.00304
+1803 0.276 0.00357 0.000728 0.00304
+1804 0.276 0.00356 0.000727 0.00304
+1805 0.276 0.00356 0.000726 0.00304
+1806 0.276 0.00355 0.000725 0.00304
+1807 0.276 0.00355 0.000725 0.00304
+1808 0.276 0.00355 0.000724 0.00303
+1809 0.276 0.00354 0.000723 0.00303
+1810 0.276 0.00354 0.000722 0.00303
+1811 0.276 0.00354 0.000721 0.00303
+1812 0.275 0.00353 0.00072 0.00303
+1813 0.275 0.00353 0.000719 0.00303
+1814 0.275 0.00352 0.000718 0.00303
+1815 0.275 0.00352 0.000717 0.00303
+1816 0.275 0.00352 0.000716 0.00303
+1817 0.275 0.00351 0.000715 0.00303
+1818 0.275 0.00351 0.000715 0.00303
+1819 0.275 0.00351 0.000714 0.00303
+1820 0.275 0.0035 0.000713 0.00303
+1821 0.275 0.0035 0.000712 0.00303
+1822 0.275 0.00349 0.000711 0.00303
+1823 0.275 0.00349 0.00071 0.00303
+1824 0.275 0.00349 0.000709 0.00302
+1825 0.275 0.00348 0.000708 0.00302
+1826 0.275 0.00348 0.000707 0.00302
+1827 0.275 0.00347 0.000706 0.00302
+1828 0.275 0.00347 0.000706 0.00302
+1829 0.275 0.00347 0.000705 0.00302
+1830 0.275 0.00346 0.000704 0.00302
+1831 0.275 0.00346 0.000703 0.00302
+1832 0.275 0.00346 0.000702 0.00302
+1833 0.275 0.00345 0.000701 0.00302
+1834 0.275 0.00345 0.0007 0.00302
+1835 0.274 0.00344 0.000699 0.00302
+1836 0.274 0.00344 0.000698 0.00302
+1837 0.274 0.00344 0.000698 0.00302
+1838 0.274 0.00343 0.000697 0.00301
+1839 0.274 0.00343 0.000696 0.00301
+1840 0.274 0.00343 0.000695 0.00301
+1841 0.274 0.00342 0.000694 0.00301
+1842 0.274 0.00342 0.000693 0.00301
+1843 0.274 0.00341 0.000692 0.00301
+1844 0.274 0.00341 0.000691 0.00301
+1845 0.274 0.00341 0.00069 0.00301
+1846 0.274 0.0034 0.00069 0.00301
+1847 0.274 0.0034 0.000689 0.00301
+1848 0.274 0.0034 0.000688 0.00301
+1849 0.274 0.00339 0.000687 0.00301
+1850 0.274 0.00339 0.000686 0.00301
+1851 0.274 0.00338 0.000685 0.00301
+1852 0.274 0.00338 0.000684 0.003
+1853 0.274 0.00338 0.000683 0.003
+1854 0.274 0.00337 0.000682 0.003
+1855 0.274 0.00337 0.000682 0.003
+1856 0.274 0.00337 0.000681 0.003
+1857 0.273 0.00336 0.00068 0.003
+1858 0.273 0.00336 0.000679 0.003
+1859 0.273 0.00335 0.000678 0.003
+1860 0.273 0.00335 0.000677 0.003
+1861 0.273 0.00335 0.000676 0.003
+1862 0.273 0.00334 0.000675 0.003
+1863 0.273 0.00334 0.000675 0.003
+1864 0.273 0.00334 0.000674 0.003
+1865 0.273 0.00333 0.000673 0.00299
+1866 0.273 0.00333 0.000672 0.00299
+1867 0.273 0.00332 0.000671 0.00299
+1868 0.273 0.00332 0.00067 0.00299
+1869 0.273 0.00332 0.000669 0.00299
+1870 0.273 0.00331 0.000668 0.00299
+1871 0.273 0.00331 0.000668 0.00299
+1872 0.273 0.0033 0.000667 0.00299
+1873 0.273 0.0033 0.000666 0.00299
+1874 0.273 0.0033 0.000665 0.00299
+1875 0.273 0.00329 0.000664 0.00299
+1876 0.273 0.00329 0.000663 0.00299
+1877 0.273 0.00329 0.000662 0.00299
+1878 0.273 0.00328 0.000662 0.00298
+1879 0.272 0.00328 0.000661 0.00298
+1880 0.272 0.00327 0.00066 0.00298
+1881 0.272 0.00327 0.000659 0.00298
+1882 0.272 0.00327 0.000658 0.00298
+1883 0.272 0.00326 0.000657 0.00298
+1884 0.272 0.00326 0.000656 0.00298
+1885 0.272 0.00326 0.000656 0.00298
+1886 0.272 0.00325 0.000655 0.00298
+1887 0.272 0.00325 0.000654 0.00298
+1888 0.272 0.00324 0.000653 0.00298
+1889 0.272 0.00324 0.000652 0.00298
+1890 0.272 0.00324 0.000651 0.00298
+1891 0.272 0.00323 0.00065 0.00297
+1892 0.272 0.00323 0.00065 0.00297
+1893 0.272 0.00323 0.000649 0.00297
+1894 0.272 0.00322 0.000648 0.00297
+1895 0.272 0.00322 0.000647 0.00297
+1896 0.272 0.00321 0.000646 0.00297
+1897 0.272 0.00321 0.000645 0.00297
+1898 0.272 0.00321 0.000644 0.00297
+1899 0.272 0.0032 0.000644 0.00297
+1900 0.271 0.0032 0.000643 0.00297
+1901 0.271 0.00319 0.000642 0.00297
+1902 0.271 0.00319 0.000641 0.00297
+1903 0.271 0.00319 0.00064 0.00296
+1904 0.271 0.00318 0.000639 0.00296
+1905 0.271 0.00318 0.000638 0.00296
+1906 0.271 0.00318 0.000638 0.00296
+1907 0.271 0.00317 0.000637 0.00296
+1908 0.271 0.00317 0.000636 0.00296
+1909 0.271 0.00316 0.000635 0.00296
+1910 0.271 0.00316 0.000634 0.00296
+1911 0.271 0.00316 0.000633 0.00296
+1912 0.271 0.00315 0.000633 0.00296
+1913 0.271 0.00315 0.000632 0.00296
+1914 0.271 0.00315 0.000631 0.00296
+1915 0.271 0.00314 0.00063 0.00295
+1916 0.271 0.00314 0.000629 0.00295
+1917 0.271 0.00313 0.000628 0.00295
+1918 0.271 0.00313 0.000627 0.00295
+1919 0.271 0.00313 0.000627 0.00295
+1920 0.271 0.00312 0.000626 0.00295
+1921 0.27 0.00312 0.000625 0.00295
+1922 0.27 0.00312 0.000624 0.00295
+1923 0.27 0.00311 0.000623 0.00295
+1924 0.27 0.00311 0.000622 0.00295
+1925 0.27 0.0031 0.000622 0.00295
+1926 0.27 0.0031 0.000621 0.00294
+1927 0.27 0.0031 0.00062 0.00294
+1928 0.27 0.00309 0.000619 0.00294
+1929 0.27 0.00309 0.000618 0.00294
+1930 0.27 0.00308 0.000617 0.00294
+1931 0.27 0.00308 0.000617 0.00294
+1932 0.27 0.00308 0.000616 0.00294
+1933 0.27 0.00307 0.000615 0.00294
+1934 0.27 0.00307 0.000614 0.00294
+1935 0.27 0.00307 0.000613 0.00294
+1936 0.27 0.00306 0.000612 0.00294
+1937 0.27 0.00306 0.000612 0.00293
+1938 0.27 0.00305 0.000611 0.00293
+1939 0.27 0.00305 0.00061 0.00293
+1940 0.27 0.00305 0.000609 0.00293
+1941 0.269 0.00304 0.000608 0.00293
+1942 0.269 0.00304 0.000607 0.00293
+1943 0.269 0.00304 0.000607 0.00293
+1944 0.269 0.00303 0.000606 0.00293
+1945 0.269 0.00303 0.000605 0.00293
+1946 0.269 0.00302 0.000604 0.00293
+1947 0.269 0.00302 0.000603 0.00293
+1948 0.269 0.00302 0.000603 0.00292
+1949 0.269 0.00301 0.000602 0.00292
+1950 0.269 0.00301 0.000601 0.00292
+1951 0.269 0.003 0.0006 0.00292
+1952 0.269 0.003 0.000599 0.00292
+1953 0.269 0.003 0.000598 0.00292
+1954 0.269 0.00299 0.000598 0.00292
+1955 0.269 0.00299 0.000597 0.00292
+1956 0.269 0.00299 0.000596 0.00292
+1957 0.269 0.00298 0.000595 0.00292
+1958 0.269 0.00298 0.000594 0.00292
+1959 0.269 0.00297 0.000594 0.00291
+1960 0.268 0.00297 0.000593 0.00291
+1961 0.268 0.00297 0.000592 0.00291
+1962 0.268 0.00296 0.000591 0.00291
+1963 0.268 0.00296 0.00059 0.00291
+1964 0.268 0.00296 0.000589 0.00291
+1965 0.268 0.00295 0.000589 0.00291
+1966 0.268 0.00295 0.000588 0.00291
+1967 0.268 0.00294 0.000587 0.00291
+1968 0.268 0.00294 0.000586 0.00291
+1969 0.268 0.00294 0.000585 0.0029
+1970 0.268 0.00293 0.000585 0.0029
+1971 0.268 0.00293 0.000584 0.0029
+1972 0.268 0.00293 0.000583 0.0029
+1973 0.268 0.00292 0.000582 0.0029
+1974 0.268 0.00292 0.000581 0.0029
+1975 0.268 0.00291 0.000581 0.0029
+1976 0.268 0.00291 0.00058 0.0029
+1977 0.268 0.00291 0.000579 0.0029
+1978 0.268 0.0029 0.000578 0.0029
+1979 0.268 0.0029 0.000577 0.00289
+1980 0.267 0.00289 0.000577 0.00289
+1981 0.267 0.00289 0.000576 0.00289
+1982 0.267 0.00289 0.000575 0.00289
+1983 0.267 0.00288 0.000574 0.00289
+1984 0.267 0.00288 0.000573 0.00289
+1985 0.267 0.00288 0.000573 0.00289
+1986 0.267 0.00287 0.000572 0.00289
+1987 0.267 0.00287 0.000571 0.00289
+1988 0.267 0.00286 0.00057 0.00289
+1989 0.267 0.00286 0.000569 0.00288
+1990 0.267 0.00286 0.000569 0.00288
+1991 0.267 0.00285 0.000568 0.00288
+1992 0.267 0.00285 0.000567 0.00288
+1993 0.267 0.00285 0.000566 0.00288
+1994 0.267 0.00284 0.000565 0.00288
+1995 0.267 0.00284 0.000565 0.00288
+1996 0.267 0.00283 0.000564 0.00288
+1997 0.267 0.00283 0.000563 0.00288
+1998 0.266 0.00283 0.000562 0.00288
+1999 0.266 0.00282 0.000561 0.00287
+2000 0.266 0.00282 0.000561 0.00287
+# end of content independent part
+
+# data set number
+[1]
+# (a,c,g,t)= (0.299, 0.201, 0.201, 0.299)
+#
+# Probabilities file for the exon model
+#
+
+
+# Die P_l's
+[P_ls]
+# k = 4
+# l=
+0
+# Values
+a 0.241 0.303 0.126
+c 0.263 0.23 0.367
+g 0.339 0.191 0.36
+t 0.157 0.276 0.147
+# l=
+1
+# Values
+aa 0.0296 0.0842 0.038
+ac 0.0319 0.0523 0.104
+ag 0.0473 0.0404 0.122
+at 0.0183 0.0648 0.0364
+ca 0.117 0.0704 0.0441
+cc 0.0831 0.053 0.0824
+cg 0.0985 0.0499 0.0665
+ct 0.0658 0.0891 0.0378
+ga 0.0768 0.121 0.0267
+gc 0.111 0.0819 0.0852
+gg 0.123 0.0667 0.0487
+gt 0.0512 0.0701 0.0315
+ta 0.018 0.0278 0.0168
+tc 0.0371 0.043 0.0953
+tg 0.0708 0.0336 0.123
+tt 0.0215 0.0518 0.041
+# l=
+2
+# Values
+aaa 0.00969 0.0116 0.0139
+aac 0.00822 0.00649 0.0243
+aag 0.015 0.00521 0.0365
+aat 0.00516 0.00793 0.00832
+aca 0.0311 0.0097 0.0099
+acc 0.0264 0.00725 0.018
+acg 0.0284 0.00667 0.0177
+act 0.0172 0.00962 0.00667
+aga 0.0319 0.0196 0.00571
+agc 0.0343 0.0127 0.0195
+agg 0.0395 0.0101 0.00886
+agt 0.0162 0.00868 0.00651
+ata 0.00417 0.00339 0.00486
+atc 0.00809 0.00579 0.0254
+atg 0.0184 0.00384 0.0232
+att 0.00522 0.00673 0.0109
+caa 0.00881 0.0372 0.00883
+cac 0.0124 0.025 0.0215
+cag 0.0156 0.0164 0.0333
+cat 0.00668 0.033 0.00632
+cca 0.0288 0.0199 0.0116
+ccc 0.0152 0.0162 0.0192
+ccg 0.0235 0.0151 0.0138
+cct 0.0142 0.0286 0.00855
+cga 0.0101 0.0311 0.0068
+cgc 0.0222 0.0216 0.0224
+cgg 0.023 0.0182 0.0129
+cgt 0.0111 0.0236 0.00795
+cta 0.0044 0.0118 0.00432
+ctc 0.0117 0.0179 0.0284
+ctg 0.0171 0.0128 0.0473
+ctt 0.0053 0.0206 0.00923
+gaa 0.00631 0.0287 0.0152
+gac 0.00587 0.0164 0.0361
+gag 0.0117 0.0166 0.0526
+gat 0.00338 0.0193 0.0156
+gca 0.0253 0.0316 0.0152
+gcc 0.02 0.0211 0.0305
+gcg 0.0229 0.0218 0.0218
+gct 0.0162 0.0398 0.014
+gga 0.0115 0.0498 0.014
+ggc 0.0167 0.0316 0.0277
+ggg 0.0161 0.0223 0.0154
+ggt 0.00601 0.0231 0.00965
+gta 0.00395 0.00912 0.00457
+gtc 0.00761 0.0139 0.0167
+gtg 0.0164 0.0131 0.0405
+gtt 0.00426 0.0168 0.00856
+taa 0.00478 0.00678 0.000126
+tac 0.00543 0.00437 0.0224
+tag 0.00506 0.00218 0.000126
+tat 0.00307 0.00452 0.00614
+tca 0.0315 0.00924 0.00739
+tcc 0.0215 0.00838 0.0147
+tcg 0.0238 0.00633 0.0131
+tct 0.0181 0.0111 0.0086
+tga 0.0232 0.0205 0.000126
+tgc 0.0377 0.016 0.0156
+tgg 0.044 0.0161 0.0116
+tgt 0.0179 0.0147 0.0074
+tta 0.00546 0.00348 0.00311
+ttc 0.00974 0.00539 0.0249
+ttg 0.019 0.0039 0.0117
+ttt 0.00674 0.00767 0.0123
+# l=
+3
+# Values
+aaaa 0.00328 0.0039 0.00239
+aaac 0.00351 0.00239 0.00309
+aaag 0.00496 0.00187 0.00369
+aaat 0.00201 0.00337 0.00161
+aaca 0.00776 0.00301 0.00131
+aacc 0.00647 0.00207 0.00182
+aacg 0.006 0.0017 0.00164
+aact 0.00393 0.00305 0.00121
+aaga 0.01 0.00712 0.00113
+aagc 0.00969 0.00414 0.00194
+aagg 0.0113 0.00346 0.00105
+aagt 0.00522 0.00321 0.0013
+aata 0.000983 0.00151 0.00098
+aatc 0.00188 0.00184 0.00229
+aatg 0.00428 0.00115 0.00241
+aatt 0.00113 0.0017 0.0015
+acaa 0.00207 0.00986 0.00156
+acac 0.00262 0.00613 0.00235
+acag 0.00348 0.00466 0.00409
+acat 0.00164 0.00913 0.0011
+acca 0.00715 0.00648 0.00153
+accc 0.00333 0.00556 0.0025
+accg 0.00419 0.00436 0.00156
+acct 0.00312 0.00896 0.00121
+acga 0.00278 0.00966 0.00109
+acgc 0.00563 0.0062 0.00239
+acgg 0.00618 0.00485 0.00164
+acgt 0.00313 0.0065 0.0012
+acta 0.00107 0.00334 0.000647
+actc 0.00224 0.00425 0.00275
+actg 0.00305 0.00352 0.00421
+actt 0.00132 0.00538 0.00139
+agaa 0.00197 0.0146 0.00331
+agac 0.00136 0.00679 0.00447
+agag 0.00243 0.00708 0.00713
+agat 0.000706 0.00978 0.00288
+agca 0.00639 0.0122 0.00304
+agcc 0.00461 0.00695 0.00367
+agcg 0.00515 0.00746 0.0025
+agct 0.00306 0.0145 0.00239
+agga 0.00296 0.0203 0.00238
+aggc 0.00302 0.0113 0.00293
+aggg 0.00334 0.00764 0.00231
+aggt 0.00111 0.0082 0.00148
+agta 0.000951 0.00384 0.000671
+agtc 0.00172 0.00471 0.00176
+agtg 0.00382 0.00406 0.00388
+agtt 0.00099 0.00684 0.00156
+ataa 0.00149 0.00186 3.15e-05
+atac 0.0012 0.000987 0.00234
+atag 0.00157 0.00053 3.15e-05
+atat 0.00106 0.00127 0.00125
+atca 0.00749 0.00225 0.00142
+atcc 0.00675 0.00153 0.00171
+atcg 0.00719 0.00145 0.00139
+atct 0.004 0.00257 0.00149
+atga 0.00541 0.00635 3.15e-05
+atgc 0.00565 0.00387 0.00136
+atgg 0.00845 0.00373 0.00137
+atgt 0.00366 0.00371 0.00126
+atta 0.00178 0.00101 0.000663
+attc 0.00261 0.00113 0.0023
+attg 0.00483 0.0008 0.0014
+attt 0.00165 0.00208 0.00177
+caaa 0.00224 0.00346 0.00536
+caac 0.00214 0.00176 0.0123
+caag 0.00343 0.0015 0.0176
+caat 0.00106 0.00167 0.00342
+caca 0.00626 0.00344 0.00449
+cacc 0.00547 0.0025 0.0102
+cacg 0.00615 0.00261 0.00854
+cact 0.00351 0.00336 0.00293
+caga 0.00835 0.00585 0.00187
+cagc 0.0108 0.00421 0.00972
+cagg 0.00954 0.0025 0.00295
+cagt 0.00439 0.00238 0.00256
+cata 0.000639 0.000828 0.00189
+catc 0.00196 0.00217 0.0153
+catg 0.00265 0.00123 0.0121
+catt 0.00101 0.00221 0.0053
+ccaa 0.00223 0.00942 0.00213
+ccac 0.00354 0.00661 0.00754
+ccag 0.00406 0.00342 0.00939
+ccat 0.00162 0.00802 0.00177
+ccca 0.0067 0.00353 0.0037
+cccc 0.00366 0.00315 0.00611
+cccg 0.00574 0.0025 0.00449
+ccct 0.00314 0.00535 0.0027
+ccga 0.00204 0.0074 0.00193
+ccgc 0.00508 0.00512 0.00782
+ccgg 0.00439 0.0042 0.0036
+ccgt 0.00223 0.0058 0.00239
+ccta 0.000727 0.00222 0.00136
+cctc 0.00284 0.00399 0.0104
+cctg 0.00372 0.00256 0.0155
+cctt 0.00122 0.0049 0.00272
+cgaa 0.00125 0.00222 0.00256
+cgac 0.00182 0.00264 0.0124
+cgag 0.00273 0.00248 0.0139
+cgat 0.000956 0.00236 0.00372
+cgca 0.00678 0.00526 0.00304
+cgcc 0.00459 0.00446 0.00987
+cgcg 0.00609 0.00392 0.0062
+cgct 0.00486 0.00768 0.00343
+cgga 0.00218 0.00721 0.0035
+cggc 0.00568 0.00687 0.00917
+cggg 0.00386 0.00429 0.00434
+cggt 0.00121 0.0037 0.00213
+cgta 0.000936 0.00181 0.00128
+cgtc 0.00199 0.00279 0.00719
+cgtg 0.00411 0.00297 0.0139
+cgtt 0.000955 0.00305 0.00222
+ctaa 0.00104 0.00159 3.15e-05
+ctac 0.00202 0.00116 0.0103
+ctag 0.00104 0.000529 3.15e-05
+ctat 0.000597 0.00108 0.00194
+ctca 0.0104 0.00263 0.00246
+ctcc 0.00416 0.00305 0.00727
+ctcg 0.00776 0.00201 0.00598
+ctct 0.00586 0.00321 0.00301
+ctga 0.00774 0.00429 3.15e-05
+ctgc 0.0174 0.00453 0.00659
+ctgg 0.0163 0.00362 0.00456
+ctgt 0.006 0.00358 0.00217
+ctta 0.00116 0.000632 0.000679
+cttc 0.00252 0.00159 0.0124
+cttg 0.00377 0.00098 0.00428
+cttt 0.00182 0.00175 0.00419
+gaaa 0.00414 0.00261 0.00447
+gaac 0.00253 0.00146 0.0072
+gaag 0.00656 0.00128 0.013
+gaat 0.00207 0.00177 0.00222
+gaca 0.0106 0.00179 0.00276
+gacc 0.00871 0.00167 0.0045
+gacg 0.0107 0.00143 0.00649
+gact 0.006 0.00191 0.00198
+gaga 0.0135 0.00489 0.00227
+gagc 0.0138 0.0031 0.00704
+gagg 0.0187 0.00333 0.0044
+gagt 0.00655 0.00222 0.00214
+gata 0.00185 0.000696 0.00142
+gatc 0.00278 0.000902 0.00634
+gatg 0.00887 0.000907 0.00728
+gatt 0.00207 0.00164 0.00315
+gcaa 0.0028 0.00764 0.00321
+gcac 0.00416 0.00551 0.00872
+gcag 0.00606 0.00447 0.0163
+gcat 0.00214 0.00664 0.00217
+gcca 0.00994 0.00499 0.00399
+gccc 0.00516 0.00304 0.00778
+gccg 0.0101 0.00417 0.00599
+gcct 0.00502 0.00699 0.00282
+gcga 0.00347 0.00707 0.00266
+gcgc 0.00707 0.00462 0.00937
+gcgg 0.00769 0.0049 0.00608
+gcgt 0.00358 0.00541 0.00317
+gcta 0.00157 0.0028 0.0015
+gctc 0.00379 0.00447 0.0114
+gctg 0.00695 0.00373 0.0222
+gctt 0.00154 0.00453 0.00346
+ggaa 0.00306 0.00395 0.00523
+ggac 0.00267 0.00198 0.0126
+ggag 0.0065 0.00246 0.0243
+ggat 0.00169 0.0022 0.00567
+ggca 0.00806 0.00439 0.00509
+ggcc 0.00636 0.00323 0.0109
+ggcg 0.00783 0.00318 0.00986
+ggct 0.00543 0.00471 0.00483
+ggga 0.00337 0.00574 0.00414
+gggc 0.00512 0.00332 0.00934
+gggg 0.00517 0.00315 0.00513
+gggt 0.0018 0.00273 0.0031
+ggta 0.00116 0.000948 0.00124
+ggtc 0.00213 0.00146 0.00409
+ggtg 0.00507 0.00143 0.0149
+ggtt 0.00133 0.00177 0.00221
+gtaa 0.00127 0.00115 3.15e-05
+gtac 0.00138 0.000992 0.00708
+gtag 0.00162 0.000585 3.15e-05
+gtat 0.000772 0.000904 0.00162
+gtca 0.00631 0.00184 0.00208
+gtcc 0.00308 0.00137 0.00391
+gtcg 0.0043 0.0014 0.0047
+gtct 0.00289 0.00243 0.00283
+gtga 0.00798 0.00398 3.15e-05
+gtgc 0.0116 0.00345 0.00578
+gtgg 0.0146 0.00464 0.00442
+gtgt 0.00638 0.00316 0.00262
+gtta 0.00111 0.000645 0.000785
+gttc 0.00231 0.00106 0.00743
+gttg 0.00345 0.000651 0.0036
+gttt 0.00159 0.00165 0.00442
+taaa 3.15e-05 0.00165 0.00164
+taac 3.15e-05 0.000873 0.00172
+taag 3.15e-05 0.000555 0.00219
+taat 3.15e-05 0.00112 0.00106
+taca 0.00646 0.00147 0.00134
+tacc 0.00571 0.00102 0.0014
+tacg 0.00549 0.000935 0.00107
+tact 0.00375 0.0013 0.000547
+taga 3.15e-05 0.00176 0.000443
+tagc 3.15e-05 0.00125 0.000819
+tagg 3.15e-05 0.000823 0.000462
+tagt 3.15e-05 0.000871 0.000509
+tata 0.000702 0.000358 0.000573
+tatc 0.00148 0.000874 0.00143
+tatg 0.00258 0.000553 0.00143
+tatt 0.00101 0.00117 0.000977
+tcaa 0.00172 0.0102 0.00192
+tcac 0.00209 0.00678 0.00293
+tcag 0.00202 0.00383 0.00352
+tcat 0.00128 0.00923 0.00127
+tcca 0.00496 0.00488 0.00239
+tccc 0.00303 0.00448 0.0028
+tccg 0.0035 0.00407 0.00175
+tcct 0.00296 0.00732 0.00182
+tcga 0.00184 0.00698 0.00112
+tcgc 0.00437 0.0057 0.0028
+tcgg 0.0047 0.00427 0.00154
+tcgt 0.00213 0.00585 0.00119
+tcta 0.00103 0.00346 0.00081
+tctc 0.0028 0.0052 0.00375
+tctg 0.00335 0.00294 0.00546
+tctt 0.00122 0.00576 0.00166
+tgaa 3.15e-05 0.00788 0.0041
+tgac 3.15e-05 0.00502 0.00661
+tgag 3.15e-05 0.00456 0.00727
+tgat 3.15e-05 0.005 0.00331
+tgca 0.00407 0.00968 0.00403
+tgcc 0.00443 0.00647 0.00612
+tgcg 0.0038 0.00727 0.00324
+tgct 0.00289 0.0129 0.00331
+tgga 0.00302 0.0165 0.00402
+tggc 0.00285 0.0101 0.00626
+tggg 0.00372 0.00721 0.00364
+tggt 0.00189 0.00847 0.00293
+tgta 0.000898 0.00252 0.00138
+tgtc 0.00178 0.00492 0.00367
+tgtg 0.00339 0.00466 0.00776
+tgtt 0.000983 0.00517 0.00257
+ttaa 0.000981 0.00218 3.15e-05
+ttac 0.000838 0.00123 0.00271
+ttag 0.00083 0.000537 3.15e-05
+ttat 0.000639 0.00126 0.00134
+ttca 0.00736 0.00253 0.00143
+ttcc 0.00753 0.00242 0.00184
+ttcg 0.00451 0.00147 0.00108
+ttct 0.00538 0.00287 0.00127
+ttga 0.00208 0.00583 3.15e-05
+ttgc 0.00304 0.00414 0.00185
+ttgg 0.00467 0.0041 0.00121
+ttgt 0.00189 0.00427 0.00135
+ttta 0.0014 0.00119 0.00098
+tttc 0.00231 0.00162 0.00271
+tttg 0.00693 0.00147 0.00246
+tttt 0.00167 0.00219 0.00189
+# l=
+4
+# Values
+aaaaa 0.000407 0.00108 0.000833
+aaaac 0.000755 0.000639 0.000887
+aaaag 0.000794 0.000473 0.00113
+aaaat 0.00039 0.000918 0.000462
+aaaca 0.00103 0.000941 0.000403
+aaacc 0.000823 0.000728 0.000699
+aaacg 0.00059 0.000565 0.000512
+aaact 0.00067 0.00114 0.000381
+aaaga 0.000898 0.00177 0.000282
+aaagc 0.00107 0.00113 0.00052
+aaagg 0.0011 0.00084 0.000378
+aaagt 0.00065 0.00101 0.000399
+aaata 0.000189 0.00058 0.000433
+aaatc 0.000324 0.0006 0.00087
+aaatg 0.000742 0.000282 0.000972
+aaatt 0.000337 0.000499 0.000555
+aacaa 0.000264 0.00243 0.000506
+aacac 0.000315 0.00159 0.00066
+aacag 0.000445 0.000998 0.00105
+aacat 0.000288 0.00238 0.000274
+aacca 0.000826 0.00151 0.00041
+aaccc 0.000455 0.00141 0.000526
+aaccg 0.00025 0.00106 0.0004
+aacct 0.000267 0.00224 0.000383
+aacga 0.000356 0.0018 0.000213
+aacgc 0.000511 0.00131 0.00063
+aacgg 0.000522 0.00096 0.000358
+aacgt 0.000261 0.00166 0.000222
+aacta 0.000206 0.000796 0.00021
+aactc 0.00025 0.000929 0.000772
+aactg 0.00054 0.000705 0.00112
+aactt 0.000195 0.00134 0.000449
+aagaa 0.000332 0.00423 0.00117
+aagac 0.00019 0.00139 0.00144
+aagag 0.000409 0.00156 0.00226
+aagat 0.000109 0.00242 0.0011
+aagca 0.000656 0.00273 0.000766
+aagcc 0.000489 0.00172 0.00115
+aagcg 0.000208 0.00169 0.000758
+aagct 0.000322 0.00314 0.000807
+aagga 0.00022 0.00469 0.000629
+aaggc 0.000277 0.00242 0.00098
+aaggg 0.000311 0.00173 0.000665
+aaggt 9.6e-05 0.00201 0.000616
+aagta 0.000173 0.000995 0.000169
+aagtc 0.000313 0.00127 0.000611
+aagtg 0.000505 0.000948 0.00137
+aagtt 0.000176 0.00182 0.000545
+aataa 0.000294 0.00036 7.88e-06
+aatac 0.000234 0.0002 0.000824
+aatag 0.000247 0.00016 7.88e-06
+aatat 0.000173 0.000208 0.000421
+aatca 0.000779 0.000579 0.000347
+aatcc 0.000651 0.000321 0.000386
+aatcg 0.000557 0.000244 0.00041
+aatct 0.000341 0.000666 0.000392
+aatga 0.000706 0.00131 7.88e-06
+aatgc 0.000602 0.000983 0.000301
+aatgg 0.000796 0.000755 0.000302
+aatgt 0.000406 0.00104 0.000367
+aatta 0.000217 0.000288 0.000132
+aattc 0.000382 0.000274 0.000632
+aattg 0.000703 0.00013 0.000284
+aattt 0.000239 0.000387 0.00041
+acaaa 0.000382 0.000811 0.00157
+acaac 0.000444 0.000424 0.00327
+acaag 0.000535 0.000351 0.00455
+acaat 0.000186 0.000372 0.000895
+acaca 0.000771 0.000773 0.00112
+acacc 0.000558 0.00055 0.00215
+acacg 0.000636 0.000478 0.00249
+acact 0.000354 0.000704 0.000674
+acaga 0.00126 0.00129 0.000638
+acagc 0.00126 0.00081 0.00275
+acagg 0.00107 0.000522 0.000878
+acagt 0.000412 0.000707 0.000608
+acata 0.000198 0.000273 0.000588
+acatc 0.000249 0.000534 0.00405
+acatg 0.000461 0.000258 0.00333
+acatt 0.000182 0.000558 0.00164
+accaa 0.00037 0.00242 0.000696
+accac 0.000398 0.00166 0.00248
+accag 0.000484 0.000763 0.00313
+accat 0.000214 0.00202 0.000485
+accca 0.000892 0.000764 0.00139
+acccc 0.000503 0.000712 0.00201
+acccg 0.000621 0.000482 0.00162
+accct 0.000488 0.00125 0.000841
+accga 0.000283 0.00138 0.00051
+accgc 0.000481 0.000797 0.00235
+accgg 0.000464 0.00062 0.00101
+accgt 0.000302 0.00121 0.000695
+accta 0.00019 0.000466 0.000383
+acctc 0.000403 0.000825 0.00293
+acctg 0.000423 0.000543 0.00538
+acctt 0.00019 0.00117 0.000756
+acgaa 0.000216 0.000728 0.000833
+acgac 0.000346 0.000739 0.00373
+acgag 0.000348 0.0006 0.00434
+acgat 0.000137 0.000604 0.00123
+acgca 0.000868 0.00131 0.00108
+acgcc 0.000456 0.000971 0.00243
+acgcg 0.000576 0.00111 0.00198
+acgct 0.000461 0.00201 0.000991
+acgga 0.000296 0.00202 0.000881
+acggc 0.000739 0.00151 0.00228
+acggg 0.000447 0.00137 0.00131
+acggt 0.000156 0.00106 0.000625
+acgta 0.000178 0.0005 0.000348
+acgtc 0.00028 0.000724 0.00166
+acgtg 0.000643 0.000956 0.00414
+acgtt 0.00012 0.000802 0.00063
+actaa 0.000261 0.000252 7.88e-06
+actac 0.000445 0.000268 0.00286
+actag 0.000227 9.2e-05 7.88e-06
+actat 0.000129 0.000225 0.000589
+actca 0.001 0.000442 0.00058
+actcc 0.000379 0.000529 0.00127
+actcg 0.000813 0.000295 0.00188
+actct 0.000522 0.00063 0.000722
+actga 0.00089 0.000535 7.88e-06
+actgc 0.00131 0.00073 0.00186
+actgg 0.00153 0.000564 0.00134
+actgt 0.000467 0.000683 0.00049
+actta 0.000247 0.00013 0.000197
+acttc 0.000308 0.000315 0.0028
+acttg 0.000514 0.000225 0.00131
+acttt 0.00033 0.000415 0.00138
+agaaa 0.000876 0.000591 0.00198
+agaac 0.000552 0.000249 0.00291
+agaag 0.00146 0.000378 0.00631
+agaat 0.000365 0.000374 0.000969
+agaca 0.00136 0.000344 0.000958
+agacc 0.000983 0.000323 0.00161
+agacg 0.00125 0.000205 0.00243
+agact 0.000853 0.000222 0.000701
+agaga 0.00218 0.00087 0.000892
+agagc 0.00159 0.000484 0.00261
+agagg 0.00241 0.000362 0.00173
+agagt 0.000928 0.000279 0.000698
+agata 0.000428 0.000133 0.000451
+agatc 0.000525 0.000171 0.00303
+agatg 0.00156 0.000172 0.00334
+agatt 0.000341 0.000318 0.00137
+agcaa 0.000607 0.002 0.00112
+agcac 0.000703 0.00111 0.00267
+agcag 0.00129 0.00132 0.00566
+agcat 0.000455 0.00169 0.000777
+agcca 0.00119 0.00124 0.00126
+agccc 0.00075 0.000737 0.00213
+agccg 0.001 0.000773 0.00161
+agcct 0.000706 0.00167 0.000827
+agcga 0.000518 0.00178 0.000934
+agcgc 0.000661 0.00092 0.00267
+agcgg 0.000846 0.0011 0.00189
+agcgt 0.000461 0.00114 0.000759
+agcta 0.000289 0.000511 0.000462
+agctc 0.000574 0.000862 0.00322
+agctg 0.00125 0.000715 0.00717
+agctt 0.000249 0.000859 0.00129
+aggaa 0.000527 0.000957 0.00195
+aggac 0.000442 0.000422 0.00393
+aggag 0.00117 0.000522 0.00912
+aggat 0.000219 0.000499 0.00203
+aggca 0.000941 0.000802 0.00169
+aggcc 0.000744 0.000491 0.00321
+aggcg 0.00076 0.000399 0.00309
+aggct 0.000462 0.00073 0.0014
+aggga 0.000651 0.00109 0.00108
+agggc 0.000728 0.00058 0.00288
+agggg 0.000702 0.000552 0.00157
+agggt 0.00028 0.000452 0.000854
+aggta 0.000201 0.00017 0.000454
+aggtc 0.000261 0.000213 0.00123
+aggtg 0.000763 0.000226 0.00431
+aggtt 0.00026 0.000291 0.000893
+agtaa 0.000289 0.00035 7.88e-06
+agtac 0.000325 0.00021 0.00254
+agtag 0.000364 8.29e-05 7.88e-06
+agtat 0.000165 0.000152 0.000657
+agtca 0.000596 0.000336 0.000591
+agtcc 0.000403 0.000348 0.00101
+agtcg 0.000379 0.000252 0.0015
+agtct 0.000343 0.000445 0.00084
+agtga 0.00106 0.00105 7.88e-06
+agtgc 0.000831 0.000648 0.00159
+agtgg 0.00138 0.00093 0.00118
+agtgt 0.000612 0.000496 0.000621
+agtta 0.000192 9.35e-05 0.000214
+agttc 0.000411 0.000306 0.00279
+agttg 0.000697 7.99e-05 0.00116
+agttt 0.000264 0.00036 0.00157
+ataaa 7.87e-06 0.0005 0.000455
+ataac 7.87e-06 0.000232 0.000347
+ataag 7.87e-06 0.000175 0.000547
+ataat 7.87e-06 0.000341 0.000262
+ataca 0.000672 0.000442 0.000263
+atacc 0.000492 0.000151 0.00023
+atacg 0.000433 0.00021 0.000309
+atact 0.000335 0.000202 0.000126
+ataga 7.87e-06 0.000577 0.000111
+atagc 7.87e-06 0.000351 0.000205
+atagg 7.87e-06 0.00014 0.000115
+atagt 7.87e-06 0.000265 0.000127
+atata 0.000132 0.000118 0.00014
+atatc 0.000304 0.000261 0.000361
+atatg 0.000395 0.000167 0.000389
+atatt 0.000187 0.00041 0.000217
+atcaa 0.000253 0.0027 0.000443
+atcac 0.000322 0.00154 0.000701
+atcag 0.000426 0.000936 0.000892
+atcat 0.000225 0.00199 0.000284
+atcca 0.000533 0.00157 0.000493
+atccc 0.000382 0.00139 0.000468
+atccg 0.000227 0.00131 0.000291
+atcct 0.000335 0.00224 0.000364
+atcga 0.000247 0.00233 0.000271
+atcgc 0.000373 0.00178 0.000596
+atcgg 0.000458 0.00113 0.000394
+atcgt 0.000171 0.00166 0.000271
+atcta 0.000187 0.000782 0.000214
+atctc 0.000389 0.00101 0.000822
+atctg 0.000492 0.000749 0.0013
+atctt 0.000282 0.00129 0.000375
+atgaa 7.87e-06 0.00181 0.00137
+atgac 7.87e-06 0.00102 0.00194
+atgag 7.87e-06 0.00096 0.00223
+atgat 7.87e-06 0.00137 0.00109
+atgca 0.00037 0.00145 0.000829
+atgcc 0.000445 0.000806 0.0016
+atgcg 0.00016 0.000972 0.000805
+atgct 0.000182 0.00224 0.000811
+atgga 0.000395 0.00323 0.000955
+atggc 0.000293 0.00198 0.00155
+atggg 0.000423 0.00125 0.000874
+atggt 0.000197 0.00168 0.000509
+atgta 0.000149 0.000517 0.00037
+atgtc 0.000204 0.000897 0.000915
+atgtg 0.000529 0.000751 0.00196
+atgtt 0.000178 0.00134 0.00064
+attaa 0.000222 0.000831 7.88e-06
+attac 0.000205 0.000273 0.000619
+attag 0.000181 0.000127 7.88e-06
+attat 0.000161 0.000469 0.000427
+attca 0.000843 0.000611 0.000233
+attcc 0.000573 0.000693 0.00043
+attcg 0.000332 0.000472 0.000221
+attct 0.000568 0.000678 0.000306
+attga 0.000271 0.00153 7.88e-06
+attgc 0.000354 0.00104 0.000331
+attgg 0.000469 0.00103 0.000255
+attgt 0.000308 0.00107 0.000255
+attta 0.000231 0.000298 0.00029
+atttc 0.000359 0.000433 0.000707
+atttg 0.000939 0.000363 0.000614
+atttt 0.000293 0.000472 0.000578
+caaaa 0.00127 0.000604 0.000693
+caaac 0.00144 0.00046 0.00103
+caaag 0.00192 0.000421 0.00127
+caaat 0.000694 0.000654 0.000561
+caaca 0.00404 0.000713 0.000414
+caacc 0.0031 0.000493 0.000537
+caacg 0.00307 0.000339 0.000506
+caact 0.00188 0.000507 0.000394
+caaga 0.00452 0.00122 0.000325
+caagc 0.00458 0.000763 0.000613
+caagg 0.00562 0.000648 0.000221
+caagt 0.00265 0.000656 0.000424
+caata 0.00034 0.000199 0.000208
+caatc 0.000727 0.000324 0.000589
+caatg 0.00202 0.00022 0.00057
+caatt 0.000327 0.000256 0.000373
+cacaa 0.00101 0.00208 0.000594
+cacac 0.00116 0.00116 0.000884
+cacag 0.00154 0.000998 0.00174
+cacat 0.000691 0.00175 0.000372
+cacca 0.00421 0.00151 0.000572
+caccc 0.00149 0.00113 0.000997
+caccg 0.00246 0.000966 0.000584
+cacct 0.00194 0.00165 0.00046
+cacga 0.00129 0.00177 0.000457
+cacgc 0.00272 0.00154 0.000952
+cacgg 0.00285 0.00111 0.000709
+cacgt 0.00162 0.00148 0.000572
+cacta 0.000486 0.000591 0.000214
+cactc 0.000904 0.000927 0.00105
+cactg 0.00109 0.000841 0.00165
+cactt 0.000393 0.00102 0.00057
+cagaa 0.000489 0.00278 0.00117
+cagac 0.000469 0.00152 0.00138
+cagag 0.000661 0.00151 0.00266
+cagat 0.00023 0.00219 0.000857
+cagca 0.00345 0.00371 0.00126
+cagcc 0.00208 0.0016 0.00139
+cagcg 0.00265 0.0017 0.000852
+cagct 0.00148 0.00337 0.000892
+cagga 0.000903 0.00332 0.000736
+caggc 0.000794 0.00258 0.000797
+caggg 0.000989 0.00168 0.000701
+caggt 0.000264 0.00154 0.000369
+cagta 0.000327 0.00085 0.000221
+cagtc 0.000546 0.001 0.000605
+cagtg 0.00138 0.000935 0.00123
+cagtt 0.00033 0.00141 0.000414
+cataa 0.000477 0.000384 7.88e-06
+catac 0.000382 0.000218 0.000542
+catag 0.000546 0.000125 7.88e-06
+catat 0.000396 0.000263 0.000318
+catca 0.00469 0.000525 0.000553
+catcc 0.00374 0.00032 0.000643
+catcg 0.00451 0.000399 0.000471
+catct 0.00237 0.000618 0.000608
+catga 0.00259 0.000799 7.88e-06
+catgc 0.00294 0.000617 0.000476
+catgg 0.00442 0.000507 0.000438
+catgt 0.00205 0.000617 0.000369
+catta 0.000901 0.000128 0.000228
+cattc 0.00126 0.000229 0.000843
+cattg 0.00238 0.000247 0.000608
+cattt 0.000722 0.000371 0.000644
+ccaaa 0.000659 0.000847 0.00128
+ccaac 0.000409 0.000514 0.00324
+ccaag 0.000864 0.000409 0.00444
+ccaat 0.000247 0.000357 0.000819
+ccaca 0.0021 0.000892 0.00113
+ccacc 0.00195 0.00102 0.00303
+ccacg 0.00206 0.000656 0.00195
+ccact 0.00136 0.000862 0.000811
+ccaga 0.00235 0.00183 0.000364
+ccagc 0.00279 0.000981 0.00199
+ccagg 0.00298 0.000604 0.000627
+ccagt 0.00127 0.000473 0.000592
+ccata 0.000206 0.000217 0.000416
+ccatc 0.000533 0.000428 0.00401
+ccatg 0.000799 0.000345 0.00296
+ccatt 0.000217 0.000567 0.00101
+cccaa 0.000562 0.00221 0.000388
+cccac 0.00118 0.00157 0.00118
+cccag 0.00147 0.00101 0.00176
+cccat 0.000437 0.0016 0.00035
+cccca 0.00215 0.000663 0.000599
+ccccc 0.00123 0.00112 0.00124
+ccccg 0.00196 0.000597 0.00098
+cccct 0.000776 0.00109 0.000449
+cccga 0.000697 0.00205 0.000315
+cccgc 0.00157 0.00105 0.00106
+cccgg 0.00159 0.00109 0.000733
+cccgt 0.000609 0.00131 0.000485
+cccta 0.000195 0.000377 0.000284
+ccctc 0.000908 0.000953 0.00201
+ccctg 0.00116 0.000636 0.00274
+ccctt 0.000392 0.00106 0.00057
+ccgaa 0.000462 0.000398 0.000572
+ccgac 0.000428 0.000565 0.00309
+ccgag 0.000794 0.000537 0.00324
+ccgat 0.000252 0.000463 0.000854
+ccgca 0.00231 0.0012 0.000671
+ccgcc 0.00181 0.00131 0.00246
+ccgcg 0.00211 0.000814 0.00143
+ccgct 0.00156 0.00154 0.000761
+ccgga 0.00048 0.00133 0.000859
+ccggc 0.00173 0.00137 0.0021
+ccggg 0.00111 0.000816 0.00101
+ccggt 0.000286 0.000678 0.00044
+ccgta 0.000258 0.000377 0.000266
+ccgtc 0.000497 0.00058 0.00188
+ccgtg 0.00127 0.000535 0.00334
+ccgtt 0.000354 0.00066 0.000561
+cctaa 0.000305 0.000363 7.88e-06
+cctac 0.000582 0.000273 0.00193
+cctag 0.00031 0.000129 7.88e-06
+cctat 0.000118 0.000249 0.000347
+cctca 0.00384 0.00057 0.000528
+cctcc 0.00168 0.00101 0.0019
+cctcg 0.00258 0.00047 0.00109
+cctct 0.00224 0.000657 0.000638
+cctga 0.00223 0.00105 7.88e-06
+cctgc 0.00556 0.000856 0.00137
+cctgg 0.00588 0.000914 0.000926
+cctgt 0.00175 0.000764 0.000365
+cctta 0.000365 0.000172 0.000183
+ccttc 0.000725 0.000425 0.00308
+ccttg 0.0011 0.00024 0.0011
+ccttt 0.000538 0.000338 0.000767
+cgaaa 0.00054 0.000354 0.000375
+cgaac 0.000582 0.000309 0.000803
+cgaag 0.00109 0.000155 0.000941
+cgaat 0.000365 0.000374 0.000206
+cgaca 0.00308 0.000461 0.000481
+cgacc 0.00308 0.000321 0.000841
+cgacg 0.00396 0.00039 0.00112
+cgact 0.00229 0.000567 0.000288
+cgaga 0.003 0.00101 0.000247
+cgagc 0.00383 0.000585 0.0013
+cgagg 0.00502 0.000534 0.000687
+cgagt 0.00194 0.000499 0.000348
+cgata 0.000398 0.000139 0.000247
+cgatc 0.000694 0.000216 0.000797
+cgatg 0.00206 0.000223 0.000986
+cgatt 0.000549 0.000342 0.000432
+cgcaa 0.000522 0.00232 0.000559
+cgcac 0.00107 0.00164 0.00197
+cgcag 0.00113 0.00092 0.00271
+cgcat 0.0003 0.00165 0.000266
+cgcca 0.00309 0.00123 0.000783
+cgccc 0.00164 0.00063 0.00176
+cgccg 0.00355 0.00109 0.00158
+cgcct 0.00149 0.00148 0.00055
+cgcga 0.000713 0.00193 0.000523
+cgcgc 0.00221 0.00146 0.00181
+cgcgg 0.00208 0.000999 0.00122
+cgcgt 0.00118 0.00151 0.000548
+cgcta 0.000448 0.00093 0.000334
+cgctc 0.00106 0.00128 0.00251
+cgctg 0.00153 0.00115 0.00451
+cgctt 0.000379 0.00131 0.000699
+cggaa 0.000571 0.000683 0.000641
+cggac 0.000771 0.000415 0.00216
+cggag 0.00176 0.000597 0.00385
+cggat 0.000385 0.000398 0.000912
+cggca 0.00249 0.0015 0.000889
+cggcc 0.00188 0.00123 0.00253
+cggcg 0.00301 0.00132 0.00273
+cggct 0.00179 0.00143 0.00104
+cggga 0.000755 0.00165 0.000846
+cgggc 0.00146 0.000764 0.00191
+cgggg 0.00168 0.000757 0.00114
+cgggt 0.000475 0.00057 0.000605
+cggta 0.000225 0.00014 0.00018
+cggtc 0.000431 0.000368 0.000733
+cggtg 0.00117 0.000309 0.00272
+cggtt 0.000319 0.000318 0.00025
+cgtaa 0.00031 0.000264 7.88e-06
+cgtac 0.000337 0.000241 0.00164
+cgtag 0.000507 0.000136 7.88e-06
+cgtat 0.000113 0.000223 0.000239
+cgtca 0.0028 0.000464 0.00031
+cgtcc 0.00108 0.000318 0.000807
+cgtcg 0.00205 0.000354 0.00125
+cgtct 0.00127 0.000767 0.000545
+cgtga 0.00226 0.00101 7.88e-06
+cgtgc 0.00427 0.000953 0.00131
+cgtgg 0.005 0.00106 0.00109
+cgtgt 0.0024 0.000924 0.000692
+cgtta 0.000245 0.000133 0.00018
+cgttc 0.000733 0.000241 0.00167
+cgttg 0.000812 0.000142 0.000673
+cgttt 0.000409 0.000399 0.000681
+ctaaa 7.87e-06 0.000377 0.000345
+ctaac 7.87e-06 0.000234 0.000328
+ctaag 7.87e-06 9.8e-05 0.000651
+ctaat 7.87e-06 0.000291 0.000181
+ctaca 0.00305 0.000445 0.00035
+ctacc 0.00271 0.000353 0.000462
+ctacg 0.00253 0.000326 0.00021
+ctact 0.0019 0.000585 0.000121
+ctaga 7.87e-06 0.00032 0.000111
+ctagc 7.87e-06 0.000271 0.000205
+ctagg 7.87e-06 0.000175 0.000115
+ctagt 7.87e-06 0.000118 0.000127
+ctata 0.000195 8.03e-05 0.00012
+ctatc 0.000475 0.000204 0.00035
+ctatg 0.000942 0.000129 0.00034
+ctatt 0.000299 0.000255 0.00023
+ctcaa 0.000629 0.00345 0.000517
+ctcac 0.00064 0.00222 0.000805
+ctcag 0.000695 0.00107 0.00109
+ctcat 0.000478 0.0031 0.000353
+ctcca 0.00246 0.000882 0.000808
+ctccc 0.00139 0.00082 0.00103
+ctccg 0.00171 0.000852 0.000788
+ctcct 0.00166 0.00146 0.000564
+ctcga 0.000665 0.00211 0.00035
+ctcgc 0.00198 0.00193 0.000958
+ctcgg 0.00241 0.00138 0.000427
+ctcgt 0.000963 0.002 0.000377
+ctcta 0.000365 0.0011 0.000184
+ctctc 0.00103 0.00179 0.00113
+ctctg 0.0012 0.000748 0.00165
+ctctt 0.00039 0.00198 0.000454
+ctgaa 7.87e-06 0.00255 0.000747
+ctgac 7.87e-06 0.00174 0.00148
+ctgag 7.87e-06 0.00169 0.0015
+ctgat 7.87e-06 0.00157 0.000725
+ctgca 0.00176 0.00461 0.0011
+ctgcc 0.00217 0.00289 0.00181
+ctgcg 0.00145 0.00339 0.000797
+ctgct 0.00121 0.00591 0.001
+ctgga 0.00112 0.00608 0.000967
+ctggc 0.000989 0.00362 0.00137
+ctggg 0.0017 0.00301 0.000863
+ctggt 0.000717 0.003 0.000573
+ctgta 0.000253 0.000948 0.000293
+ctgtc 0.000595 0.0017 0.000835
+ctgtg 0.00109 0.00161 0.00196
+ctgtt 0.000255 0.0015 0.000665
+cttaa 0.000222 0.000412 7.88e-06
+cttac 0.000205 0.000306 0.000594
+cttag 0.000181 0.000158 7.88e-06
+cttat 0.000161 0.000235 0.0003
+cttca 0.00361 0.000642 0.000421
+cttcc 0.00372 0.000749 0.000539
+cttcg 0.00215 0.000308 0.00041
+cttct 0.00278 0.000725 0.000279
+cttga 0.000827 0.00101 7.88e-06
+cttgc 0.0012 0.000921 0.000492
+cttgg 0.00158 0.000803 0.000279
+cttgt 0.000585 0.000894 0.000252
+cttta 0.000477 0.000309 0.000247
+ctttc 0.000673 0.000482 0.000629
+ctttg 0.0025 0.000366 0.000649
+ctttt 0.000477 0.000617 0.000291
+gaaaa 0.00112 0.00143 0.000406
+gaaac 0.00098 0.000811 0.000748
+gaaag 0.0017 0.000604 0.000668
+gaaat 0.000651 0.00113 0.000337
+gaaca 0.0021 0.000749 0.000282
+gaacc 0.0021 0.00043 0.000384
+gaacg 0.0019 0.000451 0.000326
+gaact 0.00114 0.000796 0.000214
+gaaga 0.00395 0.0027 0.000263
+gaagc 0.0035 0.00142 0.000377
+gaagg 0.00392 0.00128 0.000225
+gaagt 0.00156 0.000903 0.000189
+gaata 0.000302 0.000427 0.000187
+gaatc 0.000651 0.00055 0.000531
+gaatg 0.00101 0.000415 0.000452
+gaatt 0.000264 0.000604 0.000314
+gacaa 0.000483 0.00321 0.000213
+gacac 0.000876 0.00218 0.000484
+gacag 0.00103 0.00163 0.000619
+gacat 0.000389 0.00321 0.000199
+gacca 0.00152 0.0018 0.00028
+gaccc 0.00109 0.00215 0.000572
+gaccg 0.00118 0.00133 0.000309
+gacct 0.000719 0.00309 0.000233
+gacga 0.00101 0.00405 0.00029
+gacgc 0.00207 0.00232 0.000455
+gacgg 0.00238 0.00174 0.000282
+gacgt 0.00105 0.0022 0.000172
+gacta 0.000156 0.00107 0.000142
+gactc 0.000595 0.00149 0.000528
+gactg 0.000774 0.00122 0.00074
+gactt 0.000447 0.00197 0.000183
+gagaa 0.00073 0.0047 0.00054
+gagac 0.000414 0.00251 0.00123
+gagag 0.000835 0.00259 0.00155
+gagat 0.000212 0.00322 0.000729
+gagca 0.00207 0.00335 0.000681
+gagcc 0.00179 0.00224 0.0008
+gagcg 0.00207 0.00258 0.000619
+gagct 0.00113 0.0051 0.000485
+gagga 0.00122 0.00826 0.000844
+gaggc 0.00132 0.00401 0.000855
+gaggg 0.00134 0.0027 0.000778
+gaggt 0.000516 0.00301 0.000343
+gagta 0.000242 0.00123 0.000184
+gagtc 0.000502 0.0015 0.000427
+gagtg 0.00113 0.00137 0.000844
+gagtt 0.000264 0.00224 0.000403
+gataa 0.000392 0.000733 7.88e-06
+gatac 0.000319 0.00035 0.000487
+gatag 0.000433 0.000121 7.88e-06
+gatat 0.000244 0.000532 0.000254
+gatca 0.00162 0.000764 0.000323
+gatcc 0.0019 0.000564 0.000373
+gatcg 0.00186 0.000543 0.000315
+gatct 0.001 0.00084 0.000334
+gatga 0.00171 0.00336 7.88e-06
+gatgc 0.00181 0.00172 0.00029
+gatgg 0.00274 0.00178 0.000316
+gatgt 0.000993 0.00166 0.000264
+gatta 0.000558 0.000409 0.000164
+gattc 0.000739 0.00039 0.000507
+gattg 0.00135 0.000314 0.00023
+gattt 0.000478 0.000876 0.000416
+gcaaa 0.000654 0.00108 0.00122
+gcaac 0.000779 0.000531 0.0021
+gcaag 0.00139 0.000469 0.00392
+gcaat 0.000423 0.000594 0.000733
+gcaca 0.00248 0.00125 0.00108
+gcacc 0.00219 0.000594 0.00201
+gcacg 0.00269 0.001 0.00206
+gcact 0.00128 0.00113 0.000599
+gcaga 0.00377 0.00204 0.000429
+gcagc 0.00569 0.00182 0.00278
+gcagg 0.00457 0.00103 0.000786
+gcagt 0.00219 0.000945 0.000651
+gcata 0.000167 0.000261 0.000321
+gcatc 0.000742 0.000713 0.00309
+gcatg 0.000875 0.000398 0.00242
+gcatt 0.000354 0.000662 0.00107
+gccaa 0.000826 0.00297 0.000496
+gccac 0.00128 0.00234 0.00213
+gccag 0.00125 0.00111 0.00216
+gccat 0.000606 0.00308 0.000435
+gccca 0.00265 0.00124 0.000687
+gcccc 0.00143 0.000767 0.0012
+gcccg 0.00243 0.000948 0.000718
+gccct 0.00129 0.002 0.000577
+gccga 0.000843 0.00288 0.000525
+gccgc 0.00232 0.00259 0.00246
+gccgg 0.00189 0.00192 0.000827
+gccgt 0.000953 0.00228 0.000573
+gccta 0.000156 0.00092 0.000295
+gcctc 0.000993 0.00134 0.00292
+gcctg 0.00129 0.000903 0.00353
+gcctt 0.000378 0.00165 0.000597
+gcgaa 0.000423 0.000704 0.000592
+gcgac 0.000708 0.000817 0.00262
+gcgag 0.00115 0.000927 0.00337
+gcgat 0.000398 0.000867 0.000807
+gcgca 0.00284 0.00167 0.000477
+gcgcc 0.00172 0.00124 0.00226
+gcgcg 0.00267 0.00136 0.00142
+gcgct 0.00212 0.00255 0.000649
+gcgga 0.00113 0.00215 0.00102
+gcggc 0.00265 0.00277 0.0025
+gcggg 0.00181 0.0012 0.00108
+gcggt 0.000577 0.00129 0.000555
+gcgta 0.000401 0.00058 0.000252
+gcgtc 0.000848 0.000803 0.00166
+gcgtg 0.00162 0.001 0.00319
+gcgtt 0.000311 0.00103 0.00054
+gctaa 0.00033 0.000692 7.88e-06
+gctac 0.000607 0.000333 0.00254
+gctag 0.000261 0.000136 7.88e-06
+gctat 0.00028 0.000362 0.000384
+gctca 0.00428 0.00101 0.000556
+gctcc 0.00136 0.000696 0.00183
+gctcg 0.00352 0.000794 0.00153
+gctct 0.00223 0.00113 0.000755
+gctga 0.00347 0.00183 7.88e-06
+gctgc 0.00839 0.00213 0.00177
+gctgg 0.00725 0.00137 0.00141
+gctgt 0.00317 0.00138 0.00074
+gctta 0.000401 0.000176 0.000137
+gcttc 0.00096 0.000452 0.00266
+gcttg 0.00148 0.000292 0.000914
+gcttt 0.000595 0.000555 0.00104
+ggaaa 0.00143 0.00114 0.00081
+ggaac 0.000903 0.000612 0.00101
+ggaag 0.00227 0.00049 0.00193
+ggaat 0.000697 0.000665 0.000438
+ggaca 0.0039 0.000624 0.000367
+ggacc 0.00296 0.00069 0.000562
+ggacg 0.0039 0.000544 0.000873
+ggact 0.00186 0.000734 0.000274
+ggaga 0.00636 0.00203 0.000477
+ggagc 0.0065 0.00141 0.000969
+ggagg 0.00868 0.00177 0.000753
+ggagt 0.00276 0.000993 0.000359
+ggata 0.000566 0.000292 0.000282
+ggatc 0.00102 0.000344 0.000731
+ggatg 0.00339 0.000339 0.000863
+ggatt 0.000669 0.00066 0.000414
+ggcaa 0.000971 0.00212 0.000532
+ggcac 0.00136 0.00192 0.00123
+ggcag 0.002 0.00143 0.00249
+ggcat 0.000703 0.00223 0.000339
+ggcca 0.00367 0.00144 0.00061
+ggccc 0.00163 0.000876 0.00115
+ggccg 0.00366 0.00146 0.00101
+ggcct 0.00185 0.00232 0.000594
+ggcga 0.00166 0.00225 0.000436
+ggcgc 0.00324 0.00152 0.00137
+ggcgg 0.00361 0.00199 0.00105
+ggcgt 0.00142 0.00176 0.000479
+ggcta 0.000522 0.00084 0.000274
+ggctc 0.00136 0.0017 0.0015
+ggctg 0.00238 0.00114 0.00256
+ggctt 0.000549 0.00152 0.000556
+gggaa 0.00103 0.0013 0.000671
+gggac 0.000742 0.000565 0.00179
+gggag 0.00182 0.000618 0.00294
+gggat 0.000525 0.000725 0.000608
+gggca 0.00273 0.00139 0.000681
+gggcc 0.00236 0.00104 0.0012
+gggcg 0.00257 0.00092 0.000953
+gggct 0.00176 0.00156 0.000629
+gggga 0.0011 0.00178 0.000783
+ggggc 0.00187 0.00113 0.00124
+ggggg 0.00161 0.00115 0.000745
+ggggt 0.000566 0.000898 0.000528
+gggta 0.000365 0.000256 0.000173
+gggtc 0.000862 0.000387 0.000729
+gggtg 0.00153 0.000381 0.00167
+gggtt 0.000341 0.000701 0.000255
+ggtaa 0.000305 0.000298 7.88e-06
+ggtac 0.000371 0.000317 0.000813
+ggtag 0.000382 0.000214 7.88e-06
+ggtat 0.000181 0.000267 0.000156
+ggtca 0.00142 0.000519 0.000293
+ggtcc 0.000868 0.000371 0.00046
+ggtcg 0.00115 0.000516 0.00044
+ggtct 0.000612 0.000642 0.000354
+ggtga 0.00308 0.00111 7.88e-06
+ggtgc 0.00424 0.000935 0.000477
+ggtgg 0.00562 0.00188 0.000614
+ggtgt 0.00206 0.000954 0.000397
+ggtta 0.000244 0.000225 9.45e-05
+ggttc 0.000672 0.00027 0.00072
+ggttg 0.000813 0.000216 0.000515
+ggttt 0.000458 0.000586 0.000528
+gtaaa 7.87e-06 0.00039 0.00031
+gtaac 7.87e-06 0.000226 0.000381
+gtaag 7.87e-06 0.00016 0.000332
+gtaat 7.87e-06 0.000309 0.000203
+gtaca 0.00207 0.000338 0.000406
+gtacc 0.00179 0.00028 0.000285
+gtacg 0.00207 0.000347 0.00026
+gtact 0.00103 0.000264 7.72e-05
+gtaga 7.87e-06 0.000458 0.000111
+gtagc 7.87e-06 0.000354 0.000205
+gtagg 7.87e-06 0.000318 0.000115
+gtagt 7.87e-06 0.000283 0.000127
+gtata 0.000197 8.03e-05 0.00018
+gtatc 0.000403 0.000204 0.000233
+gtatg 0.000714 0.000129 0.000321
+gtatt 0.000289 0.000255 0.000211
+gtcaa 0.000481 0.00192 0.000413
+gtcac 0.000691 0.00155 0.000744
+gtcag 0.000524 0.000775 0.000488
+gtcat 0.000329 0.00183 0.000274
+gtcca 0.00133 0.000629 0.000383
+gtccc 0.000856 0.000773 0.000465
+gtccg 0.00108 0.000497 0.000257
+gtcct 0.000634 0.00107 0.000331
+gtcga 0.000758 0.00104 0.000246
+gtcgc 0.00166 0.00108 0.000703
+gtcgg 0.00149 0.000983 0.000304
+gtcgt 0.000782 0.00101 0.000221
+gtcta 0.000223 0.000547 0.000197
+gtctc 0.000986 0.000784 0.000874
+gtctg 0.00122 0.000436 0.00102
+gtctt 0.000357 0.00101 0.000466
+gtgaa 7.87e-06 0.00286 0.000805
+gtgac 7.87e-06 0.00172 0.0014
+gtgag 7.87e-06 0.00146 0.00127
+gtgat 7.87e-06 0.00168 0.000665
+gtgca 0.00149 0.00283 0.000756
+gtgcc 0.00139 0.00216 0.00131
+gtgcg 0.00187 0.00233 0.000841
+gtgct 0.00103 0.00379 0.000662
+gtgga 0.00119 0.00549 0.00106
+gtggc 0.00124 0.00338 0.00176
+gtggg 0.0013 0.00221 0.000909
+gtggt 0.000724 0.00295 0.00114
+gtgta 0.00028 0.000796 0.00035
+gtgtc 0.000665 0.00173 0.00084
+gtgtg 0.00129 0.0017 0.00168
+gtgtt 0.000387 0.00195 0.00044
+gttaa 0.000222 0.000442 7.88e-06
+gttac 0.000205 0.000274 0.000594
+gttag 0.000181 6.78e-05 7.88e-06
+gttat 0.000161 0.000282 0.0003
+gttca 0.0022 0.000577 0.000235
+gttcc 0.0023 0.000466 0.000381
+gttcg 0.00157 0.000386 0.000235
+gttct 0.00137 0.000787 0.000239
+gttga 0.000562 0.000945 7.88e-06
+gttgc 0.000838 0.000808 0.000415
+gttgg 0.00164 0.000796 0.000293
+gttgt 0.000596 0.000806 0.000311
+gttta 0.0005 0.000253 0.000217
+gtttc 0.000788 0.00032 0.000638
+gtttg 0.00256 0.000401 0.000488
+gtttt 0.00062 0.00054 0.000389
+taaaa 0.00048 0.000782 0.000457
+taaac 0.000332 0.000479 0.000432
+taaag 0.000552 0.000376 0.000625
+taaat 0.000272 0.000676 0.000254
+taaca 0.000587 0.000603 0.000213
+taacc 0.000448 0.000415 0.000199
+taacg 0.000439 0.000341 0.000293
+taact 0.000241 0.000612 0.000224
+taaga 0.000629 0.00143 0.000257
+taagc 0.000544 0.000829 0.000428
+taagg 0.000645 0.000693 0.000226
+taagt 0.000365 0.000644 0.00029
+taata 0.000153 0.000303 0.000151
+taatc 0.000175 0.00037 0.000304
+taatg 0.000505 0.000231 0.000411
+taatt 0.000203 0.000342 0.000263
+tacaa 0.000305 0.00214 0.000249
+tacac 0.000271 0.00119 0.000321
+tacag 0.000464 0.00103 0.000676
+tacat 0.000274 0.0018 0.000257
+tacca 0.000593 0.00166 0.000265
+taccc 0.000291 0.00087 0.0004
+taccg 0.000299 0.00101 0.000263
+tacct 0.000198 0.00197 0.000131
+tacga 0.000115 0.00204 0.000132
+tacgc 0.000322 0.00104 0.00035
+tacgg 0.000426 0.00104 0.00029
+tacgt 0.000204 0.00116 0.000232
+tacta 0.000225 0.000874 8.19e-05
+tactc 0.000488 0.0009 0.000405
+tactg 0.000649 0.000758 0.000696
+tactt 0.000284 0.00105 0.000186
+tagaa 0.000414 0.00293 0.000438
+tagac 0.000284 0.00136 0.000414
+tagag 0.000524 0.00142 0.00066
+tagat 0.000155 0.00196 0.000197
+tagca 0.000214 0.00245 0.000337
+tagcc 0.00026 0.00139 0.000326
+tagcg 0.000219 0.00149 0.000273
+tagct 0.000126 0.0029 0.000202
+tagga 0.000619 0.00407 0.000172
+taggc 0.000634 0.00225 0.000301
+taggg 0.000693 0.00153 0.000169
+taggt 0.000233 0.00164 0.00015
+tagta 0.000208 0.00077 9.77e-05
+tagtc 0.00036 0.000944 0.000118
+tagtg 0.000804 0.000814 0.000441
+tagtt 0.000219 0.00137 0.000195
+tataa 0.000328 0.000384 7.88e-06
+tatac 0.000262 0.000218 0.000487
+tatag 0.000343 0.000125 7.88e-06
+tatat 0.000246 0.000263 0.000254
+tatca 0.000396 0.000378 0.0002
+tatcc 0.000464 0.00033 0.000307
+tatcg 0.000266 0.000259 0.000192
+tatct 0.000286 0.000445 0.000154
+tatga 0.000406 0.00088 7.88e-06
+tatgc 0.000307 0.000541 0.00029
+tatgg 0.000489 0.000686 0.000316
+tatgt 0.000212 0.000387 0.000264
+tatta 0.000105 0.000188 0.000139
+tattc 0.000238 0.000234 0.000314
+tattg 0.000393 0.00011 0.000276
+tattt 0.000216 0.000443 0.000299
+tcaaa 0.00054 0.000722 0.00129
+tcaac 0.000513 0.000295 0.00371
+tcaag 0.00064 0.000274 0.00466
+tcaat 0.000201 0.000342 0.000975
+tcaca 0.000911 0.000523 0.00116
+tcacc 0.000772 0.000338 0.00305
+tcacg 0.000761 0.000472 0.00203
+tcact 0.000513 0.000666 0.000843
+tcaga 0.000974 0.000702 0.000444
+tcagc 0.00105 0.000598 0.0022
+tcagg 0.000922 0.000347 0.000663
+tcagt 0.000513 0.000252 0.000704
+tcata 6.76e-05 7.69e-05 0.000562
+tcatc 0.000436 0.000491 0.00418
+tcatg 0.000519 0.000231 0.00339
+tcatt 0.000258 0.000425 0.00157
+tccaa 0.00047 0.00181 0.000555
+tccac 0.000684 0.00104 0.00176
+tccag 0.000857 0.00054 0.00234
+tccat 0.000363 0.00132 0.000504
+tccca 0.00101 0.000871 0.00102
+tcccc 0.000494 0.000558 0.00166
+tcccg 0.000731 0.000475 0.00117
+tccct 0.000587 0.00102 0.000835
+tccga 0.000222 0.00109 0.000581
+tccgc 0.000716 0.000675 0.00196
+tccgg 0.000445 0.000579 0.00103
+tccgt 0.00037 0.00101 0.000635
+tccta 0.000186 0.000454 0.000402
+tcctc 0.000536 0.000867 0.00259
+tcctg 0.000848 0.000475 0.00383
+tcctt 0.000261 0.00102 0.000797
+tcgaa 0.000149 0.000387 0.000566
+tcgac 0.000333 0.000519 0.00296
+tcgag 0.000436 0.000421 0.00293
+tcgat 0.00017 0.000428 0.000824
+tcgca 0.000763 0.00107 0.000811
+tcgcc 0.000602 0.000936 0.00272
+tcgcg 0.000741 0.000633 0.00138
+tcgct 0.000713 0.00158 0.00103
+tcgga 0.000274 0.00171 0.000742
+tcggc 0.000558 0.00122 0.00229
+tcggg 0.000492 0.000903 0.000944
+tcggt 0.000187 0.000671 0.000515
+tcgta 9.91e-05 0.000354 0.00041
+tcgtc 0.00036 0.000678 0.002
+tcgtg 0.00058 0.00047 0.00325
+tcgtt 0.00017 0.000553 0.000488
+tctaa 0.00014 0.000286 7.88e-06
+tctac 0.000384 0.000289 0.00296
+tctag 0.000242 0.000173 7.88e-06
+tctat 6.92e-05 0.000249 0.000616
+tctca 0.00125 0.000609 0.000797
+tctcc 0.000741 0.00082 0.00226
+tctcg 0.000849 0.000454 0.00148
+tctct 0.00087 0.000796 0.000893
+tctga 0.00114 0.000879 7.88e-06
+tctgc 0.00215 0.000817 0.00158
+tctgg 0.00163 0.000776 0.000876
+tctgt 0.000615 0.000749 0.000575
+tctta 0.000146 0.000154 0.000162
+tcttc 0.000525 0.000393 0.00389
+tcttg 0.000678 0.000223 0.000953
+tcttt 0.00036 0.000446 0.00101
+tgaaa 0.0013 0.000524 0.00131
+tgaac 0.000494 0.000294 0.00248
+tgaag 0.00174 0.000258 0.00382
+tgaat 0.000642 0.000355 0.000607
+tgaca 0.00231 0.000359 0.000952
+tgacc 0.00169 0.000335 0.00149
+tgacg 0.00164 0.000287 0.00207
+tgact 0.000996 0.000383 0.00072
+tgaga 0.002 0.000979 0.000651
+tgagc 0.00184 0.000621 0.00215
+tgagg 0.00255 0.000668 0.00123
+tgagt 0.00092 0.000445 0.000737
+tgata 0.000455 0.000133 0.000436
+tgatc 0.000546 0.000171 0.00178
+tgatg 0.00186 0.000172 0.00209
+tgatt 0.00051 0.000318 0.000929
+tgcaa 0.000698 0.0012 0.00101
+tgcac 0.00103 0.000837 0.00284
+tgcag 0.00164 0.000797 0.00544
+tgcat 0.000683 0.00106 0.000792
+tgcca 0.00199 0.00108 0.00134
+tgccc 0.00114 0.000793 0.00273
+tgccg 0.00185 0.000852 0.00179
+tgcct 0.000978 0.00151 0.000852
+tgcga 0.000577 0.00111 0.000764
+tgcgc 0.000958 0.000722 0.00352
+tgcgg 0.00116 0.000817 0.00193
+tgcgt 0.000518 0.001 0.00139
+tgcta 0.000311 0.00052 0.000425
+tgctc 0.000805 0.000627 0.00419
+tgctg 0.00179 0.000728 0.00793
+tgctt 0.000359 0.000849 0.000914
+tggaa 0.00093 0.00101 0.00196
+tggac 0.000716 0.00058 0.00476
+tggag 0.00176 0.000727 0.00841
+tggat 0.000557 0.000574 0.00213
+tggca 0.0019 0.000698 0.00184
+tggcc 0.00137 0.000469 0.00394
+tggcg 0.0015 0.000538 0.00309
+tggct 0.00143 0.000992 0.00176
+tggga 0.000864 0.00122 0.00143
+tgggc 0.00106 0.000844 0.00332
+tgggg 0.00118 0.000686 0.00167
+tgggt 0.000481 0.000811 0.00112
+tggta 0.00037 0.000381 0.000429
+tggtc 0.000573 0.000488 0.00139
+tggtg 0.00161 0.000511 0.00622
+tggtt 0.000412 0.000458 0.000813
+tgtaa 0.000368 0.00024 7.88e-06
+tgtac 0.000343 0.000225 0.00208
+tgtag 0.000367 0.000152 7.88e-06
+tgtat 0.000313 0.000262 0.00057
+tgtca 0.0015 0.000517 0.000887
+tgtcc 0.00073 0.000332 0.00164
+tgtcg 0.000727 0.000279 0.00151
+tgtct 0.000667 0.000577 0.00109
+tgtga 0.00158 0.000811 7.88e-06
+tgtgc 0.00225 0.000915 0.0024
+tgtgg 0.00261 0.000769 0.00153
+tgtgt 0.00131 0.00079 0.000906
+tgtta 0.000431 0.000194 0.000296
+tgttc 0.000491 0.000246 0.00225
+tgttg 0.00113 0.000214 0.00125
+tgttt 0.000459 0.000305 0.00164
+ttaaa 7.87e-06 0.000384 0.000526
+ttaac 7.87e-06 0.000181 0.000662
+ttaag 7.87e-06 0.000122 0.000655
+ttaat 7.87e-06 0.000178 0.000414
+ttaca 0.000667 0.000244 0.000325
+ttacc 0.000724 0.000234 0.000424
+ttacg 0.00045 5.28e-05 0.000291
+ttact 0.000477 0.00025 0.000222
+ttaga 7.87e-06 0.000409 0.000111
+ttagc 7.87e-06 0.000277 0.000205
+ttagg 7.87e-06 0.00019 0.000115
+ttagt 7.87e-06 0.000205 0.000127
+ttata 0.000178 8.03e-05 0.000134
+ttatc 0.000294 0.000204 0.000487
+ttatg 0.000527 0.000129 0.000381
+ttatt 0.000236 0.000255 0.000318
+ttcaa 0.000357 0.00216 0.000544
+ttcac 0.000437 0.00147 0.000679
+ttcag 0.00037 0.00105 0.00106
+ttcat 0.000249 0.0023 0.000358
+ttcca 0.000637 0.0018 0.000709
+ttccc 0.000409 0.0015 0.00083
+ttccg 0.000494 0.00141 0.000411
+ttcct 0.000324 0.00254 0.000564
+ttcga 0.000167 0.0015 0.00025
+ttcgc 0.00036 0.000917 0.000542
+ttcgg 0.00034 0.000779 0.000411
+ttcgt 0.000212 0.00117 0.00032
+ttcta 0.000258 0.00104 0.000214
+ttctc 0.000387 0.00162 0.000929
+ttctg 0.000429 0.00101 0.0015
+ttctt 0.000192 0.00148 0.000369
+ttgaa 7.87e-06 0.000665 0.00118
+ttgac 7.87e-06 0.000543 0.00179
+ttgag 7.87e-06 0.000454 0.00227
+ttgat 7.87e-06 0.000381 0.000832
+ttgca 0.000453 0.0008 0.00135
+ttgcc 0.000426 0.000614 0.00139
+ttgcg 0.000313 0.00058 0.000794
+ttgct 0.000467 0.000951 0.00084
+ttgga 0.000315 0.00172 0.00103
+ttggc 0.000321 0.00115 0.00157
+ttggg 0.000294 0.00074 0.000994
+ttggt 0.000252 0.000847 0.000709
+ttgta 0.000216 0.000259 0.00037
+ttgtc 0.000315 0.000592 0.00108
+ttgtg 0.00048 0.000597 0.00217
+ttgtt 0.000164 0.00038 0.000824
+tttaa 0.000315 0.000494 7.88e-06
+tttac 0.000222 0.000374 0.000901
+tttag 0.000286 0.000184 7.88e-06
+tttat 0.000156 0.000277 0.00031
+tttca 0.000703 0.000701 0.000542
+tttcc 0.000933 0.000514 0.00049
+tttcg 0.000461 0.000306 0.000214
+tttct 0.000659 0.000683 0.000446
+tttga 0.000425 0.00235 7.88e-06
+tttgc 0.00064 0.00137 0.000614
+tttgg 0.00098 0.00148 0.000386
+tttgt 0.000404 0.0015 0.000534
+tttta 0.000195 0.000327 0.000225
+ttttc 0.000486 0.000381 0.000739
+ttttg 0.000927 0.000338 0.000709
+ttttt 0.000282 0.000558 0.00063
+
+# translation initiation motif
+[TRANSINIT]
+# width of motif, n=
+20
+# order of markov model, k=
+2
+# markov chain emission probabilities
+ 0 0.259 0.402 0.183 0.155 0.361 0.195 0.169 0.274 0.327 0.218 0.291 0.164 0.231 0.292 0.212 0.264 0.149 0.272 0.381 0.198 0.173 0.356 0.242 0.229 0.152 0.36 0.272 0.216 0.157 0.36 0.187 0.296 0.223 0.323 0.31 0.144 0.28 0.274 0.17 0.277 0.231 0.171 0.429 0.168 0.169 0.342 0.243 0.246 0.16 0.215 0.3 0.325 0.183 0.391 0.165 0.26 0.178 0.199 0.251 0.373 0.139 0.108 0.337 0.416
+ 1 0.251 0.39 0.174 0.185 0.304 0.197 0.237 0.261 0.361 0.23 0.283 0.126 0.198 0.263 0.235 0.304 0.147 0.26 0.366 0.227 0.151 0.336 0.229 0.284 0.144 0.403 0.262 0.191 0.141 0.366 0.192 0.301 0.199 0.341 0.305 0.156 0.296 0.266 0.172 0.266 0.197 0.261 0.359 0.183 0.131 0.266 0.269 0.334 0.261 0.188 0.274 0.278 0.194 0.317 0.194 0.295 0.135 0.299 0.22 0.347 0.123 0.132 0.339 0.405
+ 2 0.288 0.353 0.202 0.157 0.308 0.175 0.284 0.232 0.372 0.223 0.258 0.147 0.181 0.253 0.215 0.352 0.138 0.275 0.394 0.193 0.148 0.325 0.216 0.311 0.17 0.36 0.24 0.231 0.107 0.344 0.202 0.347 0.215 0.299 0.342 0.144 0.263 0.234 0.239 0.263 0.177 0.296 0.362 0.165 0.135 0.273 0.287 0.305 0.249 0.224 0.261 0.265 0.221 0.301 0.174 0.305 0.12 0.276 0.212 0.393 0.124 0.164 0.312 0.401
+ 3 0.302 0.328 0.221 0.148 0.278 0.171 0.302 0.248 0.317 0.282 0.261 0.14 0.195 0.248 0.211 0.346 0.155 0.281 0.383 0.181 0.167 0.317 0.231 0.285 0.174 0.377 0.227 0.222 0.125 0.334 0.223 0.317 0.198 0.3 0.364 0.139 0.248 0.239 0.261 0.252 0.189 0.288 0.35 0.174 0.129 0.27 0.325 0.276 0.289 0.201 0.245 0.264 0.219 0.276 0.211 0.295 0.143 0.272 0.209 0.376 0.128 0.175 0.313 0.384
+ 4 0.294 0.311 0.237 0.158 0.218 0.18 0.344 0.258 0.344 0.285 0.194 0.176 0.235 0.209 0.209 0.347 0.125 0.304 0.384 0.187 0.216 0.274 0.2 0.31 0.159 0.404 0.208 0.229 0.126 0.343 0.233 0.298 0.213 0.304 0.349 0.133 0.192 0.233 0.324 0.251 0.191 0.298 0.361 0.151 0.141 0.254 0.328 0.277 0.313 0.197 0.276 0.214 0.22 0.261 0.222 0.297 0.159 0.277 0.199 0.366 0.152 0.18 0.305 0.364
+ 5 0.311 0.271 0.276 0.142 0.236 0.207 0.333 0.225 0.36 0.292 0.164 0.184 0.199 0.21 0.25 0.342 0.126 0.381 0.334 0.158 0.265 0.263 0.173 0.299 0.153 0.413 0.227 0.207 0.137 0.314 0.241 0.309 0.183 0.279 0.338 0.2 0.182 0.278 0.307 0.234 0.141 0.315 0.377 0.168 0.0986 0.224 0.354 0.323 0.34 0.178 0.24 0.243 0.237 0.216 0.233 0.315 0.16 0.337 0.155 0.349 0.155 0.198 0.306 0.341
+ 6 0.28 0.305 0.258 0.158 0.231 0.227 0.371 0.17 0.342 0.227 0.194 0.237 0.265 0.218 0.197 0.32 0.16 0.349 0.327 0.164 0.255 0.25 0.211 0.285 0.162 0.394 0.238 0.206 0.11 0.332 0.261 0.298 0.126 0.279 0.351 0.243 0.184 0.28 0.349 0.187 0.151 0.341 0.361 0.147 0.0686 0.224 0.435 0.273 0.41 0.183 0.142 0.264 0.247 0.231 0.229 0.293 0.148 0.336 0.176 0.34 0.148 0.201 0.299 0.353
+ 7 0.335 0.226 0.246 0.193 0.271 0.19 0.37 0.169 0.348 0.244 0.174 0.233 0.255 0.132 0.274 0.338 0.144 0.358 0.311 0.187 0.268 0.227 0.234 0.271 0.166 0.383 0.223 0.229 0.0994 0.333 0.256 0.312 0.155 0.232 0.365 0.248 0.205 0.268 0.356 0.17 0.143 0.417 0.317 0.122 0.0833 0.236 0.401 0.279 0.427 0.222 0.115 0.237 0.297 0.217 0.217 0.268 0.179 0.313 0.182 0.326 0.171 0.191 0.286 0.352
+ 8 0.349 0.204 0.257 0.19 0.318 0.236 0.3 0.146 0.3 0.226 0.2 0.274 0.247 0.167 0.277 0.31 0.142 0.38 0.3 0.177 0.298 0.237 0.254 0.212 0.169 0.378 0.225 0.228 0.103 0.337 0.262 0.298 0.188 0.164 0.414 0.234 0.198 0.287 0.341 0.174 0.183 0.363 0.354 0.1 0.121 0.24 0.428 0.211 0.374 0.273 0.0969 0.256 0.281 0.266 0.225 0.229 0.205 0.244 0.198 0.354 0.197 0.193 0.274 0.336
+ 9 0.37 0.228 0.218 0.184 0.3 0.276 0.26 0.164 0.339 0.238 0.191 0.232 0.293 0.166 0.293 0.248 0.141 0.365 0.299 0.195 0.301 0.208 0.308 0.182 0.159 0.419 0.217 0.205 0.135 0.358 0.264 0.243 0.193 0.225 0.346 0.236 0.198 0.329 0.31 0.162 0.198 0.319 0.356 0.128 0.12 0.233 0.416 0.231 0.391 0.24 0.0862 0.283 0.283 0.262 0.228 0.228 0.222 0.278 0.19 0.31 0.191 0.167 0.298 0.343
+10 0.359 0.219 0.201 0.221 0.33 0.324 0.221 0.126 0.372 0.22 0.156 0.252 0.294 0.206 0.273 0.227 0.114 0.355 0.307 0.224 0.272 0.243 0.287 0.199 0.158 0.44 0.2 0.202 0.105 0.368 0.246 0.281 0.198 0.213 0.313 0.276 0.231 0.302 0.313 0.154 0.201 0.298 0.372 0.129 0.121 0.246 0.414 0.22 0.36 0.286 0.101 0.253 0.265 0.292 0.169 0.274 0.232 0.271 0.188 0.309 0.255 0.127 0.248 0.37
+11 0.363 0.214 0.245 0.178 0.293 0.319 0.224 0.163 0.345 0.262 0.163 0.23 0.278 0.222 0.264 0.236 0.104 0.338 0.338 0.219 0.298 0.212 0.289 0.201 0.166 0.419 0.213 0.201 0.0807 0.352 0.262 0.306 0.19 0.214 0.324 0.272 0.253 0.289 0.287 0.171 0.21 0.281 0.377 0.132 0.109 0.248 0.417 0.226 0.362 0.276 0.069 0.293 0.236 0.298 0.221 0.245 0.243 0.256 0.198 0.304 0.228 0.162 0.234 0.377
+12 0.367 0.213 0.236 0.184 0.304 0.265 0.271 0.16 0.313 0.279 0.182 0.226 0.273 0.258 0.244 0.225 0.133 0.276 0.352 0.24 0.267 0.219 0.294 0.221 0.209 0.399 0.173 0.219 0.0828 0.375 0.262 0.28 0.203 0.199 0.369 0.229 0.278 0.255 0.311 0.157 0.191 0.33 0.344 0.135 0.119 0.267 0.43 0.183 0.382 0.266 0.0765 0.275 0.214 0.303 0.232 0.252 0.232 0.25 0.225 0.292 0.189 0.169 0.274 0.368
+13 0.432 0.14 0.275 0.153 0.295 0.306 0.248 0.151 0.368 0.315 0.174 0.143 0.221 0.286 0.247 0.247 0.107 0.32 0.365 0.208 0.262 0.225 0.281 0.232 0.209 0.414 0.181 0.196 0.0806 0.382 0.288 0.249 0.208 0.234 0.38 0.178 0.318 0.293 0.229 0.16 0.186 0.324 0.355 0.135 0.15 0.29 0.383 0.176 0.381 0.283 0.0794 0.257 0.238 0.305 0.224 0.232 0.247 0.263 0.221 0.269 0.203 0.179 0.272 0.346
+14 0.379 0.172 0.3 0.148 0.263 0.343 0.241 0.153 0.333 0.313 0.205 0.149 0.237 0.346 0.207 0.21 0.147 0.258 0.402 0.193 0.338 0.211 0.24 0.212 0.226 0.424 0.198 0.152 0.0965 0.358 0.327 0.219 0.201 0.228 0.372 0.199 0.279 0.285 0.286 0.15 0.21 0.262 0.349 0.179 0.158 0.264 0.42 0.158 0.365 0.23 0.125 0.28 0.201 0.279 0.269 0.251 0.26 0.276 0.235 0.229 0.218 0.174 0.278 0.331
+15 0.385 0.208 0.285 0.122 0.256 0.297 0.288 0.159 0.345 0.376 0.162 0.117 0.224 0.338 0.204 0.235 0.192 0.285 0.368 0.154 0.343 0.211 0.216 0.23 0.238 0.42 0.19 0.152 0.122 0.339 0.302 0.237 0.261 0.263 0.283 0.193 0.28 0.254 0.278 0.188 0.216 0.284 0.347 0.153 0.152 0.312 0.364 0.173 0.364 0.205 0.158 0.273 0.225 0.272 0.255 0.248 0.284 0.296 0.242 0.179 0.207 0.151 0.298 0.344
+16 0.347 0.223 0.304 0.126 0.263 0.349 0.271 0.117 0.301 0.387 0.195 0.116 0.192 0.387 0.195 0.226 0.213 0.285 0.341 0.161 0.356 0.262 0.174 0.208 0.237 0.421 0.204 0.138 0.144 0.335 0.333 0.189 0.263 0.229 0.346 0.162 0.27 0.288 0.291 0.151 0.244 0.321 0.318 0.117 0.161 0.325 0.363 0.152 0.364 0.207 0.182 0.246 0.214 0.305 0.268 0.214 0.305 0.271 0.271 0.154 0.27 0.176 0.27 0.285
+17 0.35 0.238 0.321 0.0911 0.253 0.323 0.296 0.128 0.314 0.364 0.212 0.11 0.167 0.367 0.212 0.254 0.236 0.292 0.335 0.138 0.392 0.227 0.169 0.211 0.244 0.389 0.232 0.134 0.153 0.338 0.348 0.161 0.282 0.234 0.361 0.123 0.254 0.316 0.274 0.156 0.235 0.357 0.309 0.0994 0.175 0.314 0.332 0.179 0.373 0.166 0.174 0.286 0.241 0.305 0.295 0.16 0.292 0.285 0.287 0.135 0.207 0.219 0.335 0.238
+18 0.347 0.247 0.302 0.105 0.293 0.339 0.278 0.0899 0.326 0.346 0.227 0.101 0.15 0.4 0.236 0.214 0.273 0.291 0.302 0.134 0.348 0.274 0.153 0.225 0.264 0.403 0.23 0.103 0.185 0.335 0.351 0.129 0.297 0.217 0.36 0.126 0.25 0.345 0.26 0.146 0.251 0.37 0.274 0.106 0.188 0.353 0.326 0.133 0.353 0.182 0.194 0.271 0.272 0.296 0.266 0.167 0.302 0.276 0.267 0.154 0.225 0.19 0.328 0.257
+19 0.346 0.27 0.287 0.0983 0.283 0.419 0.222 0.0753 0.339 0.368 0.231 0.0627 0.107 0.404 0.253 0.236 0.27 0.317 0.307 0.106 0.387 0.284 0.128 0.201 0.221 0.435 0.288 0.0569 0.177 0.325 0.394 0.104 0.325 0.241 0.342 0.0916 0.24 0.348 0.268 0.144 0.301 0.306 0.289 0.104 0.228 0.311 0.333 0.128 0.326 0.23 0.2 0.244 0.325 0.29 0.282 0.102 0.352 0.239 0.284 0.125 0.337 0.16 0.243 0.26
+
+# dss upstream motif, reading frame 0(reverse)
+[ETMOTIF0]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+# dss upstream motif, reading frame 1(reverse)
+[ETMOTIF1]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+# dss upstream motif, reading frame 2(reverse)
+[ETMOTIF2]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+
+#
+# Emission probabilities
+#
+[EMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.1736 0.348 0.2514
+aaaac 0.3217 0.2052 0.2676
+aaaag 0.3385 0.152 0.3417
+aaaat 0.1662 0.2948 0.1393
+aaaca 0.331 0.2788 0.2021
+aaacc 0.2643 0.2158 0.3504
+aaacg 0.1895 0.1676 0.2565
+aaact 0.2153 0.3378 0.191
+aaaga 0.2417 0.3734 0.1786
+aaagc 0.2875 0.2376 0.3293
+aaagg 0.2959 0.1767 0.2395
+aaagt 0.1749 0.2122 0.2525
+aaata 0.1186 0.2959 0.1531
+aaatc 0.2036 0.3059 0.3073
+aaatg 0.4664 0.1437 0.3435
+aaatt 0.2115 0.2544 0.196
+aacaa 0.2014 0.3286 0.203
+aacac 0.2398 0.2151 0.265
+aacag 0.3393 0.1349 0.4219
+aacat 0.2194 0.3215 0.1101
+aacca 0.4593 0.2432 0.2383
+aaccc 0.2528 0.2263 0.3061
+aaccg 0.1391 0.1706 0.2328
+aacct 0.1487 0.3599 0.2227
+aacga 0.2154 0.3145 0.1495
+aacgc 0.3098 0.2289 0.443
+aacgg 0.3165 0.1676 0.2514
+aacgt 0.1582 0.2889 0.1561
+aacta 0.1731 0.2109 0.08205
+aactc 0.21 0.246 0.3023
+aactg 0.4531 0.1869 0.4399
+aactt 0.1638 0.3562 0.1758
+aagaa 0.3192 0.4404 0.1954
+aagac 0.1831 0.1451 0.2416
+aagag 0.3933 0.1626 0.3787
+aagat 0.1044 0.2519 0.1843
+aagca 0.3915 0.2938 0.2199
+aagcc 0.292 0.1856 0.3308
+aagcg 0.1239 0.1817 0.2176
+aagct 0.1925 0.3389 0.2317
+aagga 0.2435 0.4325 0.2176
+aaggc 0.3061 0.2229 0.3391
+aaggg 0.3443 0.1596 0.2301
+aaggt 0.1061 0.185 0.2132
+aagta 0.1482 0.1976 0.06254
+aagtc 0.2682 0.2521 0.2268
+aagtg 0.4326 0.1883 0.5085
+aagtt 0.1509 0.362 0.2022
+aataa 0.3101 0.388 0.00625
+aatac 0.2471 0.2159 0.6537
+aatag 0.2604 0.1721 0.00625
+aatat 0.1824 0.224 0.3338
+aatca 0.3345 0.3197 0.2259
+aatcc 0.2797 0.1774 0.2515
+aatcg 0.2392 0.1349 0.2669
+aatct 0.1466 0.368 0.2556
+aatga 0.2813 0.3206 0.008052
+aatgc 0.24 0.24 0.3076
+aatgg 0.317 0.1844 0.3092
+aatgt 0.1617 0.2551 0.3752
+aatta 0.1408 0.2668 0.09081
+aattc 0.248 0.2542 0.4335
+aattg 0.4561 0.1201 0.1946
+aattt 0.1551 0.3589 0.2811
+acaaa 0.2472 0.4142 0.1528
+acaac 0.2869 0.2163 0.3178
+acaag 0.3459 0.1794 0.4424
+acaat 0.12 0.1901 0.08696
+acaca 0.3324 0.3087 0.1742
+acacc 0.2408 0.2196 0.334
+acacg 0.2741 0.1907 0.3871
+acact 0.1526 0.281 0.1047
+acaga 0.3159 0.3871 0.1309
+acagc 0.3147 0.2434 0.5645
+acagg 0.2664 0.1568 0.18
+acagt 0.1029 0.2126 0.1247
+acata 0.1818 0.1682 0.0612
+acatc 0.228 0.329 0.4213
+acatg 0.4228 0.1589 0.3463
+acatt 0.1674 0.3439 0.1711
+accaa 0.2521 0.3527 0.1025
+accac 0.2715 0.2416 0.3646
+accag 0.3305 0.1111 0.4614
+accat 0.1459 0.2945 0.07145
+accca 0.3562 0.2386 0.237
+acccc 0.201 0.2221 0.3428
+acccg 0.2481 0.1506 0.2767
+accct 0.1947 0.3887 0.1435
+accga 0.185 0.344 0.1118
+accgc 0.3145 0.1993 0.514
+accgg 0.3032 0.1549 0.2221
+accgt 0.1973 0.3018 0.1521
+accta 0.1578 0.1552 0.04053
+acctc 0.3338 0.2747 0.3103
+acctg 0.3507 0.1808 0.5691
+acctt 0.1578 0.3893 0.08007
+acgaa 0.206 0.2726 0.08221
+acgac 0.3308 0.2765 0.3678
+acgag 0.3323 0.2246 0.4283
+acgat 0.1308 0.2263 0.1217
+acgca 0.3678 0.2424 0.1671
+acgcc 0.1932 0.18 0.375
+acgcg 0.2438 0.2055 0.305
+acgct 0.1952 0.3721 0.153
+acgga 0.1806 0.3397 0.173
+acggc 0.4515 0.253 0.4474
+acggg 0.2728 0.2294 0.2568
+acggt 0.0951 0.1778 0.1228
+acgta 0.1456 0.1678 0.05132
+acgtc 0.2294 0.2427 0.2448
+acgtg 0.5271 0.3205 0.611
+acgtt 0.09794 0.269 0.09289
+actaa 0.2456 0.3009 0.002273
+actac 0.4189 0.3207 0.8255
+actag 0.2137 0.1099 0.002273
+actat 0.1219 0.2685 0.17
+actca 0.3692 0.2329 0.1302
+actcc 0.1395 0.279 0.2855
+actcg 0.2992 0.1558 0.4224
+actct 0.1921 0.3323 0.162
+actga 0.2121 0.2131 0.002129
+actgc 0.3115 0.2905 0.5028
+actgg 0.3651 0.2245 0.3627
+actgt 0.1113 0.2719 0.1324
+actta 0.1764 0.1196 0.03459
+acttc 0.2202 0.2907 0.4925
+acttg 0.3674 0.2072 0.2308
+acttt 0.236 0.3825 0.2421
+agaaa 0.2695 0.3712 0.1625
+agaac 0.1698 0.1562 0.2392
+agaag 0.4485 0.2377 0.5187
+agaat 0.1122 0.2348 0.07961
+agaca 0.3056 0.3145 0.1681
+agacc 0.2213 0.2952 0.2826
+agacg 0.2812 0.1876 0.4262
+agact 0.1919 0.2028 0.1231
+agaga 0.3071 0.4361 0.1503
+agagc 0.2238 0.2426 0.4403
+agagg 0.3385 0.1814 0.2918
+agagt 0.1306 0.1398 0.1176
+agata 0.1499 0.1669 0.05496
+agatc 0.1841 0.2157 0.3699
+agatg 0.5463 0.2167 0.4078
+agatt 0.1196 0.4007 0.1674
+agcaa 0.1987 0.3269 0.1091
+agcac 0.2301 0.1817 0.2614
+agcag 0.4225 0.2149 0.5536
+agcat 0.1487 0.2765 0.07594
+agcca 0.3259 0.281 0.2155
+agccc 0.2056 0.1668 0.3656
+agccg 0.275 0.175 0.2769
+agcct 0.1935 0.3772 0.142
+agcga 0.2082 0.3608 0.1494
+agcgc 0.2658 0.186 0.4272
+agcgg 0.3405 0.2223 0.3019
+agcgt 0.1854 0.2309 0.1215
+agcta 0.1226 0.1734 0.03803
+agctc 0.2432 0.2926 0.2649
+agctg 0.529 0.2425 0.5907
+agctt 0.1053 0.2916 0.1063
+aggaa 0.2235 0.3989 0.1145
+aggac 0.1875 0.1759 0.2308
+aggag 0.4963 0.2173 0.5357
+aggat 0.09273 0.2079 0.119
+aggca 0.3236 0.3311 0.1798
+aggcc 0.256 0.2029 0.3421
+aggcg 0.2614 0.1649 0.3288
+aggct 0.1591 0.3012 0.1494
+aggga 0.2758 0.4065 0.1696
+agggc 0.3085 0.2174 0.4505
+agggg 0.2971 0.2067 0.2461
+agggt 0.1186 0.1694 0.1338
+aggta 0.1356 0.1893 0.06583
+aggtc 0.1758 0.2362 0.1787
+aggtg 0.5138 0.2513 0.6258
+aggtt 0.1748 0.3233 0.1296
+agtaa 0.2525 0.4402 0.00245
+agtac 0.2845 0.2638 0.7908
+agtag 0.3185 0.1044 0.00245
+agtat 0.1445 0.1917 0.2043
+agtca 0.3464 0.2434 0.1501
+agtcc 0.234 0.2522 0.2553
+agtcg 0.2203 0.1823 0.3814
+agtct 0.1993 0.3221 0.2133
+agtga 0.2723 0.3353 0.002319
+agtgc 0.2143 0.2077 0.4675
+agtgg 0.3555 0.2981 0.3474
+agtgt 0.1579 0.1589 0.1827
+agtta 0.1227 0.1113 0.03737
+agttc 0.2626 0.3645 0.4869
+agttg 0.4457 0.09515 0.2023
+agttt 0.169 0.4291 0.2734
+ataaa 0.25 0.401 0.2828
+ataac 0.25 0.186 0.2153
+ataag 0.25 0.1401 0.3395
+ataat 0.25 0.2729 0.1624
+ataca 0.3477 0.4399 0.2835
+atacc 0.2549 0.1502 0.2479
+atacg 0.2239 0.2087 0.3328
+atact 0.1735 0.2012 0.1358
+ataga 0.25 0.4328 0.1983
+atagc 0.25 0.2633 0.367
+atagg 0.25 0.1051 0.2068
+atagt 0.25 0.1989 0.2279
+atata 0.1298 0.123 0.1266
+atatc 0.2983 0.2729 0.3257
+atatg 0.3879 0.1751 0.3514
+atatt 0.1839 0.429 0.1963
+atcaa 0.2064 0.3769 0.1909
+atcac 0.2628 0.2151 0.3023
+atcag 0.3474 0.1305 0.3845
+atcat 0.1833 0.2775 0.1223
+atcca 0.361 0.2411 0.3051
+atccc 0.2588 0.2129 0.2895
+atccg 0.1534 0.2015 0.1803
+atcct 0.2268 0.3445 0.2251
+atcga 0.1977 0.3376 0.177
+atcgc 0.2985 0.2581 0.3889
+atcgg 0.3665 0.1635 0.2572
+atcgt 0.1373 0.2408 0.177
+atcta 0.1387 0.2043 0.07902
+atctc 0.2879 0.2642 0.3033
+atctg 0.3648 0.1957 0.4794
+atctt 0.2086 0.3358 0.1383
+atgaa 0.25 0.3505 0.207
+atgac 0.25 0.1981 0.2931
+atgag 0.25 0.1864 0.3361
+atgat 0.25 0.2651 0.1638
+atgca 0.3193 0.2653 0.2049
+atgcc 0.3845 0.1475 0.3954
+atgcg 0.1386 0.1779 0.1991
+atgct 0.1576 0.4093 0.2006
+atgga 0.302 0.3967 0.2455
+atggc 0.2238 0.243 0.3987
+atggg 0.3237 0.1538 0.2249
+atggt 0.1504 0.2065 0.1309
+atgta 0.1409 0.1476 0.09541
+atgtc 0.1929 0.256 0.2359
+atgtg 0.4985 0.2143 0.5039
+atgtt 0.1677 0.3821 0.1648
+attaa 0.2886 0.4889 0.007418
+attac 0.2666 0.1606 0.5831
+attag 0.2354 0.07453 0.007418
+attat 0.2094 0.276 0.4021
+attca 0.3641 0.2488 0.196
+attcc 0.2473 0.2826 0.3616
+attcg 0.1433 0.1923 0.1854
+attct 0.2452 0.2764 0.257
+attga 0.193 0.3276 0.009276
+attgc 0.2525 0.2227 0.3896
+attgg 0.3345 0.2195 0.3006
+attgt 0.22 0.2301 0.3006
+attta 0.1269 0.1906 0.1324
+atttc 0.1969 0.2762 0.323
+atttg 0.5155 0.232 0.2806
+atttt 0.1606 0.3013 0.264
+caaaa 0.2391 0.2826 0.1955
+caaac 0.271 0.2149 0.2896
+caaag 0.3598 0.1966 0.3567
+caaat 0.1302 0.3058 0.1582
+caaca 0.3341 0.3475 0.2238
+caacc 0.2567 0.2403 0.2902
+caacg 0.2541 0.1653 0.2732
+caact 0.1551 0.2469 0.2128
+caaga 0.2604 0.3711 0.2052
+caagc 0.2635 0.2321 0.3875
+caagg 0.3237 0.1972 0.1394
+caagt 0.1524 0.1995 0.2679
+caata 0.09959 0.1991 0.1195
+caatc 0.213 0.3243 0.3385
+caatg 0.5915 0.2202 0.3276
+caatt 0.0959 0.2564 0.2145
+cacaa 0.2303 0.347 0.1655
+cacac 0.2629 0.1943 0.2463
+cacag 0.3498 0.1666 0.4846
+cacat 0.157 0.2921 0.1036
+cacca 0.4169 0.2865 0.2188
+caccc 0.1476 0.2151 0.3816
+caccg 0.2436 0.1838 0.2236
+cacct 0.1919 0.3146 0.176
+cacga 0.1525 0.2998 0.1699
+cacgc 0.321 0.2604 0.3538
+cacgg 0.3362 0.1889 0.2636
+cacgt 0.1903 0.251 0.2127
+cacta 0.1691 0.1751 0.06154
+cactc 0.3147 0.2747 0.3005
+cactg 0.3793 0.2492 0.4742
+cactt 0.1368 0.301 0.1638
+cagaa 0.2647 0.3471 0.1922
+cagac 0.2536 0.1903 0.2281
+cagag 0.3574 0.1892 0.4384
+cagat 0.1243 0.2733 0.1413
+cagca 0.3572 0.3571 0.2869
+cagcc 0.2151 0.1539 0.316
+cagcg 0.2743 0.1639 0.194
+cagct 0.1534 0.3251 0.203
+cagga 0.306 0.3642 0.2827
+caggc 0.2692 0.2826 0.3063
+caggg 0.3353 0.1844 0.2694
+caggt 0.08955 0.1689 0.1416
+cagta 0.1268 0.2024 0.08946
+cagtc 0.2115 0.239 0.2454
+cagtg 0.5338 0.2225 0.4971
+cagtt 0.128 0.3362 0.1681
+cataa 0.2646 0.3879 0.008993
+catac 0.2122 0.2204 0.6187
+catag 0.3031 0.126 0.008993
+catat 0.2201 0.2657 0.3633
+catca 0.3066 0.2818 0.2431
+catcc 0.2443 0.1717 0.2825
+catcg 0.2944 0.2146 0.2071
+catct 0.1547 0.332 0.2673
+catga 0.2156 0.3147 0.006105
+catgc 0.2447 0.2429 0.3687
+catgg 0.3688 0.1995 0.3394
+catgt 0.1709 0.2429 0.2857
+catta 0.1714 0.1314 0.09831
+cattc 0.2387 0.2349 0.3627
+cattg 0.4526 0.2535 0.2617
+cattt 0.1373 0.3802 0.2773
+ccaaa 0.3025 0.3983 0.1313
+ccaac 0.1877 0.2417 0.3309
+ccaag 0.3964 0.1921 0.4541
+ccaat 0.1134 0.168 0.08376
+ccaca 0.2811 0.2601 0.1633
+ccacc 0.2609 0.2975 0.438
+ccacg 0.2758 0.1911 0.2816
+ccact 0.1823 0.2513 0.1171
+ccaga 0.25 0.4701 0.1018
+ccagc 0.2973 0.2525 0.5571
+ccagg 0.3172 0.1555 0.1754
+ccagt 0.1356 0.1218 0.1657
+ccata 0.1174 0.1394 0.04949
+ccatc 0.3038 0.2749 0.4777
+ccatg 0.4552 0.2217 0.3523
+ccatt 0.1237 0.364 0.1205
+cccaa 0.1542 0.3461 0.1052
+cccac 0.3227 0.2453 0.3208
+cccag 0.403 0.1581 0.479
+cccat 0.1201 0.2505 0.09495
+cccca 0.3508 0.1913 0.183
+ccccc 0.2017 0.3222 0.3801
+ccccg 0.3207 0.1722 0.2996
+cccct 0.1267 0.3143 0.1373
+cccga 0.156 0.3732 0.1217
+cccgc 0.3518 0.1915 0.4078
+cccgg 0.356 0.1981 0.283
+cccgt 0.1363 0.2373 0.1875
+cccta 0.07355 0.1248 0.05053
+ccctc 0.3422 0.3154 0.3588
+ccctg 0.4365 0.2106 0.4891
+ccctt 0.1477 0.3493 0.1016
+ccgaa 0.2388 0.2028 0.07378
+ccgac 0.221 0.288 0.3982
+ccgag 0.4102 0.2734 0.4179
+ccgat 0.13 0.2358 0.1102
+ccgca 0.2965 0.2468 0.126
+ccgcc 0.2322 0.2694 0.4627
+ccgcg 0.2706 0.167 0.2683
+ccgct 0.2007 0.3167 0.1429
+ccgga 0.1329 0.3174 0.1946
+ccggc 0.4802 0.326 0.4763
+ccggg 0.3076 0.1947 0.2296
+ccggt 0.0793 0.1619 0.09961
+ccgta 0.1083 0.1751 0.04404
+ccgtc 0.2087 0.2696 0.3104
+ccgtg 0.5343 0.2486 0.5528
+ccgtt 0.1486 0.3067 0.09278
+cctaa 0.2321 0.3579 0.003444
+cctac 0.4426 0.2694 0.8416
+cctag 0.2356 0.1267 0.003444
+cctat 0.08971 0.246 0.1515
+cctca 0.3708 0.2107 0.1268
+cctcc 0.1628 0.3724 0.4578
+cctcg 0.2495 0.1739 0.262
+cctct 0.2168 0.243 0.1534
+cctga 0.1447 0.2922 0.002946
+cctgc 0.3606 0.2392 0.5138
+cctgg 0.3814 0.2552 0.3465
+cctgt 0.1133 0.2135 0.1367
+cctta 0.1339 0.1463 0.03566
+ccttc 0.2662 0.362 0.6004
+ccttg 0.4024 0.2041 0.2143
+ccttt 0.1975 0.2875 0.1497
+cgaaa 0.2093 0.2971 0.1612
+cgaac 0.2257 0.2592 0.3455
+cgaag 0.4234 0.1302 0.4045
+cgaat 0.1415 0.3135 0.08875
+cgaca 0.2485 0.2652 0.1762
+cgacc 0.2477 0.1846 0.3085
+cgacg 0.3192 0.2244 0.4096
+cgact 0.1846 0.3258 0.1057
+cgaga 0.2175 0.3847 0.09567
+cgagc 0.2776 0.2225 0.504
+cgagg 0.3641 0.203 0.2657
+cgagt 0.1408 0.1898 0.1347
+cgata 0.1074 0.1508 0.1004
+cgatc 0.1873 0.2344 0.3237
+cgatg 0.5571 0.2426 0.4005
+cgatt 0.1482 0.3721 0.1753
+cgcaa 0.1728 0.3551 0.1015
+cgcac 0.354 0.2512 0.3581
+cgcag 0.3738 0.1409 0.492
+cgcat 0.09943 0.2528 0.04834
+cgcca 0.3166 0.277 0.1675
+cgccc 0.1675 0.1424 0.3767
+cgccg 0.3634 0.2453 0.3383
+cgcct 0.1525 0.3353 0.1176
+cgcga 0.1152 0.3276 0.1276
+cgcgc 0.3573 0.2473 0.441
+cgcgg 0.3365 0.1696 0.2976
+cgcgt 0.191 0.2555 0.1338
+cgcta 0.1312 0.199 0.04147
+cgctc 0.3094 0.2739 0.3116
+cgctg 0.4484 0.2471 0.5601
+cgctt 0.111 0.28 0.08685
+cggaa 0.1639 0.3264 0.08484
+cggac 0.2212 0.1981 0.2856
+cggag 0.5043 0.2853 0.5089
+cggat 0.1106 0.1902 0.1207
+cggca 0.2718 0.2739 0.1237
+cggcc 0.2048 0.224 0.352
+cggcg 0.3282 0.2411 0.3798
+cggct 0.1952 0.261 0.1445
+cggga 0.1727 0.4416 0.188
+cgggc 0.3345 0.2041 0.4239
+cgggg 0.3842 0.2021 0.2538
+cgggt 0.1086 0.1522 0.1344
+cggta 0.1048 0.1235 0.04629
+cggtc 0.2009 0.324 0.1888
+cggtg 0.5455 0.2722 0.7004
+cggtt 0.1488 0.2802 0.06456
+cgtaa 0.2447 0.3054 0.004163
+cgtac 0.2658 0.2792 0.8651
+cgtag 0.4 0.1571 0.004163
+cgtat 0.08944 0.2583 0.1266
+cgtca 0.389 0.2439 0.1066
+cgtcc 0.1505 0.1671 0.2771
+cgtcg 0.2846 0.1861 0.4291
+cgtct 0.1758 0.403 0.1872
+cgtga 0.1625 0.2559 0.002541
+cgtgc 0.3065 0.241 0.4233
+cgtgg 0.3589 0.2693 0.3511
+cgtgt 0.1721 0.2338 0.2231
+cgtta 0.1116 0.145 0.0561
+cgttc 0.3333 0.2636 0.5212
+cgttg 0.3691 0.1549 0.2101
+cgttt 0.186 0.4366 0.2126
+ctaaa 0.25 0.3771 0.2293
+ctaac 0.25 0.2338 0.2178
+ctaag 0.25 0.09804 0.4325
+ctaat 0.25 0.2911 0.1204
+ctaca 0.2992 0.2604 0.3062
+ctacc 0.2658 0.2065 0.4041
+ctacg 0.2483 0.1906 0.1834
+ctact 0.1866 0.3425 0.1062
+ctaga 0.25 0.3618 0.1983
+ctagc 0.25 0.3072 0.367
+ctagg 0.25 0.198 0.2068
+ctagt 0.25 0.1331 0.2279
+ctata 0.1021 0.1202 0.1152
+ctatc 0.2486 0.3059 0.3364
+ctatg 0.493 0.1924 0.3273
+ctatt 0.1564 0.3815 0.2212
+ctcaa 0.2576 0.3503 0.1872
+ctcac 0.2621 0.2258 0.2917
+ctcag 0.2846 0.1089 0.3933
+ctcat 0.1958 0.315 0.1279
+ctcca 0.3405 0.2198 0.2531
+ctccc 0.1924 0.2044 0.3236
+ctccg 0.2365 0.2122 0.2467
+ctcct 0.2306 0.3636 0.1766
+ctcga 0.1106 0.2843 0.1657
+ctcgc 0.3291 0.2599 0.4537
+ctcgg 0.4002 0.1857 0.2022
+ctcgt 0.1601 0.2701 0.1784
+ctcta 0.1219 0.1954 0.05399
+ctctc 0.3452 0.3185 0.3304
+ctctg 0.4025 0.1333 0.4827
+ctctt 0.1303 0.3527 0.1329
+ctgaa 0.25 0.3379 0.1676
+ctgac 0.25 0.2304 0.3326
+ctgag 0.25 0.2236 0.3372
+ctgat 0.25 0.2082 0.1626
+ctgca 0.2667 0.2742 0.2344
+ctgcc 0.3292 0.1721 0.3842
+ctgcg 0.2202 0.2016 0.1692
+ctgct 0.1839 0.3521 0.2123
+ctgga 0.2477 0.387 0.2562
+ctggc 0.2185 0.2307 0.3634
+ctggg 0.3755 0.1914 0.2286
+ctggt 0.1584 0.1909 0.1519
+ctgta 0.1157 0.1646 0.07809
+ctgtc 0.2717 0.2954 0.2225
+ctgtg 0.496 0.2794 0.5223
+ctgtt 0.1165 0.2606 0.1772
+cttaa 0.2886 0.3704 0.008662
+cttac 0.2666 0.2754 0.6527
+cttag 0.2354 0.1425 0.008662
+cttat 0.2094 0.2117 0.33
+cttca 0.2947 0.2649 0.2553
+cttcc 0.3034 0.3091 0.327
+cttcg 0.1752 0.1269 0.2486
+cttct 0.2267 0.2991 0.1692
+cttga 0.1971 0.279 0.007645
+cttgc 0.287 0.2536 0.4771
+cttgg 0.3765 0.2213 0.2706
+cttgt 0.1394 0.2462 0.2446
+cttta 0.1154 0.1742 0.1362
+ctttc 0.163 0.2719 0.3461
+ctttg 0.6061 0.2065 0.3573
+ctttt 0.1154 0.3475 0.1605
+gaaaa 0.2513 0.3604 0.1882
+gaaac 0.2205 0.2041 0.3465
+gaaag 0.3816 0.1521 0.3093
+gaaat 0.1465 0.2834 0.1561
+gaaca 0.2903 0.3089 0.2337
+gaacc 0.2899 0.1771 0.3185
+gaacg 0.2623 0.1858 0.2702
+gaact 0.1575 0.3282 0.1775
+gaaga 0.3055 0.4288 0.2496
+gaagc 0.271 0.2252 0.3572
+gaagg 0.303 0.2027 0.2138
+gaagt 0.1205 0.1433 0.1794
+gaata 0.1353 0.2137 0.1263
+gaatc 0.2918 0.2757 0.3577
+gaatg 0.4545 0.2077 0.3047
+gaatt 0.1184 0.3029 0.2113
+gacaa 0.1739 0.3139 0.1405
+gacac 0.3156 0.2134 0.3195
+gacag 0.3705 0.1593 0.4089
+gacat 0.1399 0.3134 0.1311
+gacca 0.3369 0.2148 0.2011
+gaccc 0.2423 0.2571 0.4102
+gaccg 0.2612 0.1586 0.2215
+gacct 0.1596 0.3695 0.1672
+gacga 0.1555 0.3929 0.2418
+gacgc 0.3178 0.2251 0.3798
+gacgg 0.3652 0.1684 0.2352
+gacgt 0.1615 0.2137 0.1432
+gacta 0.07901 0.1868 0.08902
+gactc 0.3017 0.2597 0.3314
+gactg 0.3927 0.2117 0.4649
+gactt 0.2267 0.3417 0.1147
+gagaa 0.3331 0.3609 0.1334
+gagac 0.1888 0.1932 0.3044
+gagag 0.3812 0.1988 0.3822
+gagat 0.09691 0.2471 0.18
+gagca 0.2936 0.2525 0.2633
+gagcc 0.2528 0.1688 0.3096
+gagcg 0.2932 0.1946 0.2395
+gagct 0.1604 0.384 0.1877
+gagga 0.2774 0.4594 0.2993
+gaggc 0.2996 0.2228 0.3032
+gaggg 0.3057 0.15 0.2758
+gaggt 0.1174 0.1677 0.1217
+gagta 0.1133 0.1937 0.09915
+gagtc 0.2347 0.2364 0.2297
+gagtg 0.5283 0.2161 0.4542
+gagtt 0.1236 0.3538 0.2169
+gataa 0.2823 0.4222 0.01041
+gatac 0.2302 0.2016 0.6434
+gatag 0.3118 0.0695 0.01041
+gatat 0.1757 0.3067 0.3358
+gatca 0.2541 0.282 0.2398
+gatcc 0.2973 0.208 0.2773
+gatcg 0.2916 0.2002 0.2343
+gatct 0.1569 0.3098 0.2486
+gatga 0.2357 0.3939 0.008973
+gatgc 0.2493 0.2023 0.3302
+gatgg 0.3781 0.209 0.3598
+gatgt 0.1368 0.1948 0.301
+gatta 0.1785 0.2055 0.1244
+gattc 0.2363 0.1964 0.3852
+gattg 0.4324 0.1577 0.1746
+gattt 0.1528 0.4405 0.3158
+gcaaa 0.2016 0.4035 0.1525
+gcaac 0.2398 0.1986 0.2636
+gcaag 0.4283 0.1755 0.492
+gcaat 0.1303 0.2223 0.09188
+gcaca 0.287 0.3147 0.1879
+gcacc 0.2535 0.1492 0.3491
+gcacg 0.3116 0.2522 0.3587
+gcact 0.1479 0.284 0.1042
+gcaga 0.2323 0.3497 0.0922
+gcagc 0.3507 0.3122 0.5986
+gcagg 0.2818 0.1759 0.1692
+gcagt 0.1352 0.1622 0.14
+gcata 0.078 0.1282 0.04649
+gcatc 0.3473 0.3506 0.4474
+gcatg 0.4091 0.1957 0.3507
+gcatt 0.1656 0.3254 0.1554
+gccaa 0.2084 0.3128 0.09522
+gccac 0.3239 0.2465 0.4078
+gccag 0.3148 0.1167 0.4135
+gccat 0.1528 0.324 0.08343
+gccca 0.34 0.2498 0.2162
+gcccc 0.1833 0.1551 0.3763
+gcccg 0.3117 0.1917 0.2261
+gccct 0.165 0.4034 0.1815
+gccga 0.1406 0.2979 0.1197
+gccgc 0.386 0.2683 0.5607
+gccgg 0.3145 0.1983 0.1887
+gccgt 0.1589 0.2355 0.1308
+gccta 0.05521 0.1909 0.04015
+gcctc 0.3519 0.2789 0.3976
+gcctg 0.459 0.1875 0.4809
+gcctt 0.1339 0.3427 0.08137
+gcgaa 0.1578 0.2124 0.08015
+gcgac 0.2639 0.2465 0.3549
+gcgag 0.4299 0.2797 0.4558
+gcgat 0.1484 0.2615 0.1091
+gcgca 0.3036 0.2453 0.09938
+gcgcc 0.1844 0.1811 0.4706
+gcgcg 0.2851 0.1996 0.2949
+gcgct 0.2269 0.374 0.1351
+gcgga 0.1835 0.2896 0.198
+gcggc 0.4297 0.3741 0.485
+gcggg 0.2932 0.1622 0.2093
+gcggt 0.09365 0.174 0.1077
+gcgta 0.1263 0.1698 0.04469
+gcgtc 0.267 0.235 0.2936
+gcgtg 0.5087 0.2937 0.5659
+gcgtt 0.09807 0.3016 0.09581
+gctaa 0.2234 0.4545 0.00268
+gctac 0.4106 0.2188 0.8639
+gctag 0.1766 0.08911 0.00268
+gctat 0.1894 0.2376 0.1308
+gctca 0.3763 0.2781 0.1191
+gctcc 0.1191 0.1918 0.3927
+gctcg 0.3088 0.2188 0.3266
+gctct 0.1958 0.3113 0.1616
+gctga 0.1557 0.2729 0.002002
+gctgc 0.3766 0.317 0.4508
+gctgg 0.3252 0.2041 0.3591
+gctgt 0.1425 0.2059 0.1882
+gctta 0.1167 0.1195 0.02887
+gcttc 0.279 0.3064 0.5606
+gcttg 0.4314 0.1982 0.1925
+gcttt 0.1729 0.3759 0.2181
+ggaaa 0.2698 0.3927 0.1935
+ggaac 0.1706 0.2104 0.2402
+ggaag 0.4279 0.1684 0.4616
+ggaat 0.1316 0.2285 0.1047
+ggaca 0.3091 0.2407 0.1768
+ggacc 0.2343 0.2663 0.2709
+ggacg 0.3092 0.2099 0.4203
+ggact 0.1475 0.2831 0.132
+ggaga 0.2617 0.3271 0.1866
+ggagc 0.2674 0.2271 0.3787
+ggagg 0.3572 0.2855 0.2943
+ggagt 0.1136 0.1604 0.1404
+ggata 0.1004 0.1788 0.1231
+ggatc 0.1804 0.2101 0.3191
+ggatg 0.6007 0.2074 0.3769
+ggatt 0.1185 0.4037 0.1809
+ggcaa 0.1929 0.2755 0.116
+ggcac 0.2699 0.2489 0.2687
+ggcag 0.3974 0.1859 0.5415
+ggcat 0.1398 0.2898 0.07378
+ggcca 0.3393 0.2353 0.1811
+ggccc 0.1511 0.1436 0.3425
+ggccg 0.3387 0.24 0.3
+ggcct 0.1709 0.3811 0.1764
+ggcga 0.1672 0.2992 0.1308
+ggcgc 0.3267 0.2018 0.4117
+ggcgg 0.3634 0.2643 0.314
+ggcgt 0.1427 0.2347 0.1435
+ggcta 0.1087 0.1616 0.05602
+ggctc 0.2822 0.3275 0.3065
+ggctg 0.4949 0.2187 0.5238
+ggctt 0.1142 0.2921 0.1137
+gggaa 0.2508 0.4059 0.1117
+gggac 0.1804 0.176 0.2973
+gggag 0.4411 0.1924 0.4898
+gggat 0.1277 0.2257 0.1012
+gggca 0.2897 0.2831 0.1965
+gggcc 0.2509 0.2126 0.347
+gggcg 0.2728 0.1871 0.2751
+gggct 0.1867 0.3172 0.1814
+gggga 0.2143 0.3584 0.2378
+ggggc 0.363 0.2282 0.3756
+ggggg 0.3125 0.2325 0.2263
+ggggt 0.1102 0.1809 0.1603
+gggta 0.1178 0.1485 0.06138
+gggtc 0.2782 0.2245 0.2584
+gggtg 0.4939 0.221 0.5898
+gggtt 0.1102 0.4061 0.0904
+ggtaa 0.2462 0.2724 0.008
+ggtac 0.2995 0.2889 0.8256
+ggtag 0.3084 0.1953 0.008
+ggtat 0.1459 0.2435 0.1584
+ggtca 0.3504 0.2533 0.1894
+ggtcc 0.2147 0.1811 0.2974
+ggtcg 0.2835 0.2518 0.2841
+ggtct 0.1513 0.3137 0.2291
+ggtga 0.2054 0.2284 0.005263
+ggtgc 0.2826 0.1916 0.3189
+ggtgg 0.3749 0.3844 0.4105
+ggtgt 0.1371 0.1956 0.2653
+ggtta 0.1115 0.1733 0.05089
+ggttc 0.3072 0.2081 0.3876
+ggttg 0.3719 0.1663 0.2774
+ggttt 0.2094 0.4523 0.2841
+gtaaa 0.25 0.3597 0.2529
+gtaac 0.25 0.2083 0.3107
+gtaag 0.25 0.1472 0.2709
+gtaat 0.25 0.2847 0.1656
+gtaca 0.2974 0.2748 0.3951
+gtacc 0.2565 0.2282 0.2772
+gtacg 0.2978 0.2822 0.2527
+gtact 0.1483 0.2147 0.07504
+gtaga 0.25 0.3241 0.1983
+gtagc 0.25 0.2505 0.367
+gtagg 0.25 0.2249 0.2068
+gtagt 0.25 0.2004 0.2279
+gtata 0.1227 0.1202 0.19
+gtatc 0.2512 0.3059 0.2467
+gtatg 0.4455 0.1924 0.34
+gtatt 0.1806 0.3815 0.2233
+gtcaa 0.2378 0.3158 0.2151
+gtcac 0.3411 0.2548 0.3875
+gtcag 0.2587 0.1275 0.2545
+gtcat 0.1624 0.3019 0.1429
+gtcca 0.3419 0.2115 0.2667
+gtccc 0.2194 0.2601 0.3238
+gtccg 0.2762 0.1673 0.1789
+gtcct 0.1625 0.3611 0.2305
+gtcga 0.1615 0.2536 0.1668
+gtcgc 0.3538 0.2616 0.477
+gtcgg 0.3183 0.2386 0.2064
+gtcgt 0.1665 0.2462 0.1497
+gtcta 0.08009 0.197 0.07707
+gtctc 0.3536 0.2821 0.3422
+gtctg 0.4382 0.1568 0.3983
+gtctt 0.128 0.3641 0.1825
+gtgaa 0.25 0.3705 0.1947
+gtgac 0.25 0.2224 0.3384
+gtgag 0.25 0.1893 0.306
+gtgat 0.25 0.2179 0.1608
+gtgca 0.2578 0.2545 0.2116
+gtgcc 0.2401 0.1947 0.3677
+gtgcg 0.3243 0.2095 0.2354
+gtgct 0.1777 0.3413 0.1852
+gtgga 0.2676 0.3915 0.218
+gtggc 0.2786 0.2409 0.3614
+gtggg 0.2916 0.1575 0.1864
+gtggt 0.1622 0.2101 0.2342
+gtgta 0.1067 0.1289 0.1058
+gtgtc 0.2536 0.2804 0.2539
+gtgtg 0.4922 0.2753 0.5074
+gtgtt 0.1475 0.3154 0.1329
+gttaa 0.2886 0.4144 0.008662
+gttac 0.2666 0.2574 0.6527
+gttag 0.2354 0.06365 0.008662
+gttat 0.2094 0.2645 0.33
+gttca 0.2957 0.2605 0.2153
+gttcc 0.3095 0.2102 0.3497
+gttcg 0.2106 0.1741 0.2153
+gttct 0.1842 0.3551 0.2197
+gttga 0.1545 0.2817 0.007678
+gttgc 0.2306 0.2408 0.4042
+gttgg 0.4509 0.2372 0.2852
+gttgt 0.164 0.2403 0.3029
+gttta 0.112 0.1673 0.1255
+gtttc 0.1765 0.2112 0.3682
+gtttg 0.5727 0.2649 0.2818
+gtttt 0.1388 0.3566 0.2245
+taaaa 0.2933 0.3379 0.2585
+taaac 0.2029 0.2071 0.2442
+taaag 0.3375 0.1627 0.3538
+taaat 0.1663 0.2923 0.1435
+taaca 0.3422 0.3059 0.2292
+taacc 0.2615 0.2104 0.2139
+taacg 0.256 0.1729 0.3158
+taact 0.1404 0.3108 0.2411
+taaga 0.2882 0.3969 0.2141
+taagc 0.2493 0.2309 0.3564
+taagg 0.2954 0.1929 0.1879
+taagt 0.1671 0.1792 0.2416
+taata 0.1474 0.2433 0.1339
+taatc 0.1687 0.2972 0.2692
+taatg 0.4878 0.1853 0.364
+taatt 0.196 0.2742 0.2329
+tacaa 0.2323 0.3471 0.1656
+tacac 0.206 0.1938 0.2138
+tacag 0.3533 0.1673 0.4497
+tacat 0.2084 0.2918 0.1709
+tacca 0.4294 0.3019 0.25
+taccc 0.2107 0.1578 0.378
+taccg 0.2164 0.1824 0.2485
+tacct 0.1435 0.3579 0.1235
+tacga 0.1075 0.3869 0.1319
+tacgc 0.3019 0.1965 0.3485
+tacgg 0.3991 0.1967 0.2889
+tacgt 0.1915 0.2199 0.2308
+tacta 0.1365 0.2441 0.05984
+tactc 0.2964 0.2513 0.2957
+tactg 0.3944 0.2117 0.5086
+tactt 0.1728 0.2929 0.1358
+tagaa 0.3007 0.3821 0.2562
+tagac 0.2062 0.1774 0.2424
+tagag 0.3806 0.185 0.3862
+tagat 0.1125 0.2555 0.1152
+tagca 0.2615 0.2971 0.2964
+tagcc 0.3173 0.1689 0.2867
+tagcg 0.2673 0.1814 0.2396
+tagct 0.1538 0.3527 0.1773
+tagga 0.2842 0.4287 0.2171
+taggc 0.2909 0.2372 0.3805
+taggg 0.318 0.1611 0.2131
+taggt 0.1069 0.173 0.1892
+tagta 0.1307 0.1974 0.1146
+tagtc 0.2263 0.2422 0.1386
+tagtg 0.5053 0.2089 0.5176
+tagtt 0.1376 0.3515 0.2292
+tataa 0.2782 0.3879 0.01041
+tatac 0.2225 0.2204 0.6434
+tatag 0.2909 0.126 0.01041
+tatat 0.2085 0.2657 0.3358
+tatca 0.2806 0.2679 0.2343
+tatcc 0.3285 0.2337 0.3598
+tatcg 0.1882 0.1836 0.2251
+tatct 0.2027 0.3148 0.1808
+tatga 0.287 0.3529 0.008973
+tatgc 0.2169 0.2169 0.3302
+tatgg 0.3459 0.2749 0.3598
+tatgt 0.1502 0.1553 0.301
+tatta 0.1107 0.1932 0.135
+tattc 0.2496 0.2396 0.3052
+tattg 0.4132 0.1128 0.2684
+tattt 0.2264 0.4544 0.2914
+tcaaa 0.2849 0.4419 0.1212
+tcaac 0.2708 0.1808 0.3487
+tcaag 0.338 0.1679 0.4384
+tcaat 0.1063 0.2094 0.09173
+tcaca 0.308 0.2617 0.1633
+tcacc 0.2612 0.1689 0.4306
+tcacg 0.2574 0.236 0.2871
+tcact 0.1734 0.3333 0.119
+tcaga 0.2815 0.3698 0.1108
+tcagc 0.3038 0.3151 0.5481
+tcagg 0.2665 0.1825 0.1654
+tcagt 0.1482 0.1325 0.1756
+tcata 0.05283 0.06281 0.05802
+tcatc 0.3403 0.4015 0.431
+tcatg 0.4054 0.1884 0.3493
+tcatt 0.2015 0.3473 0.1617
+tccaa 0.198 0.3843 0.1075
+tccac 0.2881 0.2215 0.3407
+tccag 0.3609 0.1145 0.454
+tccat 0.153 0.2797 0.09777
+tccca 0.3586 0.2981 0.2183
+tcccc 0.1748 0.1908 0.3542
+tcccg 0.2589 0.1625 0.2492
+tccct 0.2077 0.3486 0.1783
+tccga 0.1266 0.3254 0.1382
+tccgc 0.4084 0.2013 0.4661
+tccgg 0.254 0.1726 0.2449
+tccgt 0.211 0.3007 0.1509
+tccta 0.1014 0.161 0.05277
+tcctc 0.293 0.3077 0.34
+tcctg 0.4631 0.1685 0.5025
+tcctt 0.1426 0.3628 0.1047
+tcgaa 0.1373 0.2208 0.07769
+tcgac 0.3064 0.2955 0.4068
+tcgag 0.4003 0.2397 0.4023
+tcgat 0.1561 0.244 0.1132
+tcgca 0.2706 0.254 0.1367
+tcgcc 0.2137 0.2219 0.4575
+tcgcg 0.2628 0.1501 0.232
+tcgct 0.2528 0.3741 0.1738
+tcgga 0.1811 0.3795 0.1653
+tcggc 0.3694 0.2715 0.5098
+tcggg 0.3257 0.2003 0.2102
+tcggt 0.1238 0.1488 0.1147
+tcgta 0.08192 0.1723 0.0666
+tcgtc 0.2978 0.3299 0.3253
+tcgtg 0.4798 0.2287 0.5287
+tcgtt 0.1404 0.2691 0.07941
+tctaa 0.1676 0.287 0.002192
+tctac 0.4595 0.29 0.8242
+tctag 0.29 0.1737 0.002192
+tctat 0.08286 0.2492 0.1714
+tctca 0.3362 0.2273 0.1466
+tctcc 0.1999 0.3061 0.4161
+tctcg 0.2292 0.1694 0.273
+tctct 0.2347 0.2971 0.1643
+tctga 0.2062 0.2728 0.002593
+tctgc 0.3881 0.2536 0.5197
+tctgg 0.2948 0.241 0.2884
+tctgt 0.1109 0.2326 0.1893
+tctta 0.08556 0.1264 0.02699
+tcttc 0.3073 0.3234 0.647
+tcttg 0.3965 0.1834 0.1585
+tcttt 0.2107 0.3668 0.1675
+tgaaa 0.3105 0.3661 0.1592
+tgaac 0.1183 0.2057 0.302
+tgaag 0.4175 0.1801 0.4649
+tgaat 0.1537 0.2481 0.07387
+tgaca 0.3478 0.2633 0.1819
+tgacc 0.2553 0.2459 0.2846
+tgacg 0.2467 0.2103 0.3958
+tgact 0.1502 0.2805 0.1377
+tgaga 0.2741 0.3609 0.1364
+tgagc 0.2517 0.2289 0.4516
+tgagg 0.3483 0.2462 0.2574
+tgagt 0.1259 0.164 0.1546
+tgata 0.1348 0.1669 0.08338
+tgatc 0.1618 0.2157 0.3393
+tgatg 0.5522 0.2167 0.3998
+tgatt 0.1511 0.4007 0.1776
+tgcaa 0.1728 0.3082 0.0998
+tgcac 0.2537 0.2146 0.2819
+tgcag 0.4047 0.2046 0.5397
+tgcat 0.1689 0.2726 0.07856
+tgcca 0.3342 0.2554 0.1996
+tgccc 0.1915 0.1871 0.4071
+tgccg 0.3102 0.201 0.2664
+tgcct 0.1641 0.3565 0.1269
+tgcga 0.1799 0.3032 0.1005
+tgcgc 0.2985 0.1979 0.4632
+tgcgg 0.3603 0.2239 0.2538
+tgcgt 0.1613 0.2751 0.1825
+tgcta 0.09528 0.1909 0.03159
+tgctc 0.2464 0.2302 0.3115
+tgctg 0.5486 0.2673 0.5891
+tgctt 0.1097 0.3116 0.06786
+tggaa 0.2346 0.3486 0.1138
+tggac 0.1806 0.2009 0.2758
+tggag 0.4442 0.2516 0.4872
+tggat 0.1405 0.1989 0.1233
+tggca 0.3065 0.2588 0.1729
+tggcc 0.2217 0.1738 0.3703
+tggcg 0.2417 0.1996 0.291
+tggct 0.2301 0.3678 0.1658
+tggga 0.2408 0.3422 0.1896
+tgggc 0.2952 0.2372 0.4405
+tgggg 0.3298 0.1927 0.2218
+tgggt 0.1342 0.2279 0.148
+tggta 0.1249 0.2074 0.0484
+tggtc 0.1934 0.2656 0.1575
+tggtg 0.5425 0.2779 0.7023
+tggtt 0.1392 0.2492 0.09181
+tgtaa 0.2647 0.2727 0.002952
+tgtac 0.2466 0.2556 0.7804
+tgtag 0.2636 0.1732 0.002952
+tgtat 0.2251 0.2985 0.2137
+tgtca 0.4136 0.3033 0.1731
+tgtcc 0.2016 0.1945 0.3201
+tgtcg 0.2007 0.1636 0.294
+tgtct 0.1842 0.3386 0.2128
+tgtga 0.2043 0.2469 0.001624
+tgtgc 0.2898 0.2786 0.4953
+tgtgg 0.3364 0.2341 0.3163
+tgtgt 0.1694 0.2405 0.1867
+tgtta 0.1718 0.2028 0.05445
+tgttc 0.1956 0.2563 0.4141
+tgttg 0.4495 0.2233 0.2299
+tgttt 0.1831 0.3176 0.3015
+ttaaa 0.25 0.4443 0.2331
+ttaac 0.25 0.2091 0.2931
+ttaag 0.25 0.1411 0.2903
+ttaat 0.25 0.2056 0.1835
+ttaca 0.2878 0.3127 0.2572
+ttacc 0.3123 0.2992 0.3358
+ttacg 0.1942 0.06757 0.231
+ttact 0.2057 0.3205 0.176
+ttaga 0.25 0.3784 0.1983
+ttagc 0.25 0.2564 0.367
+ttagg 0.25 0.1756 0.2068
+ttagt 0.25 0.1895 0.2279
+ttata 0.1439 0.1202 0.1014
+ttatc 0.2382 0.3059 0.3687
+ttatg 0.4268 0.1924 0.2888
+ttatt 0.1911 0.3815 0.2411
+ttcaa 0.2528 0.3096 0.2062
+ttcac 0.3096 0.2103 0.2576
+ttcag 0.2617 0.1502 0.4005
+ttcat 0.1759 0.3299 0.1357
+ttcca 0.3418 0.2478 0.282
+ttccc 0.2194 0.2068 0.3302
+ttccg 0.265 0.1949 0.1635
+ttcct 0.1738 0.3505 0.2243
+ttcga 0.1545 0.3437 0.1644
+ttcgc 0.3338 0.2098 0.3557
+ttcgg 0.3149 0.1784 0.2699
+ttcgt 0.1968 0.2681 0.2099
+ttcta 0.2037 0.2012 0.07124
+ttctc 0.3056 0.3139 0.3091
+ttctg 0.3391 0.1965 0.4971
+ttctt 0.1516 0.2884 0.1226
+ttgaa 0.25 0.3255 0.1937
+ttgac 0.25 0.2657 0.2947
+ttgag 0.25 0.2221 0.3746
+ttgat 0.25 0.1867 0.1371
+ttgca 0.273 0.2718 0.3077
+ttgcc 0.2569 0.2083 0.3186
+ttgcg 0.1886 0.197 0.1816
+ttgct 0.2815 0.3229 0.1921
+ttgga 0.2663 0.3862 0.2395
+ttggc 0.2716 0.2577 0.3653
+ttggg 0.249 0.166 0.2307
+ttggt 0.213 0.1901 0.1645
+ttgta 0.1836 0.1418 0.08345
+ttgtc 0.2681 0.324 0.2425
+ttgtg 0.4088 0.3265 0.4883
+ttgtt 0.1394 0.2077 0.1857
+tttaa 0.3215 0.3719 0.006418
+tttac 0.2267 0.2812 0.7343
+tttag 0.2926 0.1383 0.006418
+tttat 0.1592 0.2086 0.2529
+tttca 0.2551 0.3181 0.3203
+tttcc 0.3385 0.2332 0.2896
+tttcg 0.1672 0.1389 0.1266
+tttct 0.2392 0.3098 0.2635
+tttga 0.1734 0.3503 0.005107
+tttgc 0.2614 0.2053 0.3984
+tttgg 0.4001 0.2211 0.2503
+tttgt 0.1651 0.2233 0.3463
+tttta 0.1032 0.2039 0.09781
+ttttc 0.2573 0.2378 0.3208
+ttttg 0.4904 0.2105 0.3078
+ttttt 0.149 0.3477 0.2736
+
+
+#
+# Initial emission probabilities
+#
+[INITEMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.23 0.241 0.167
+aaaac 0.335 0.357 0.275
+aaaag 0.255 0.179 0.242
+aaaat 0.18 0.223 0.317
+aaaca 0.367 0.429 0.237
+aaacc 0.26 0.186 0.267
+aaacg 0.207 0.186 0.267
+aaact 0.167 0.2 0.23
+aaaga 0.224 0.346 0.337
+aaagc 0.185 0.254 0.27
+aaagg 0.409 0.223 0.215
+aaagt 0.181 0.177 0.178
+aaata 0.314 0.284 0.226
+aaatc 0.131 0.196 0.226
+aaatg 0.366 0.196 0.226
+aaatt 0.19 0.324 0.322
+aacaa 0.185 0.285 0.105
+aacac 0.349 0.321 0.337
+aacag 0.243 0.241 0.332
+aacat 0.222 0.153 0.226
+aacca 0.396 0.231 0.195
+aaccc 0.149 0.19 0.333
+aaccg 0.227 0.374 0.26
+aacct 0.227 0.204 0.211
+aacga 0.265 0.421 0.122
+aacgc 0.18 0.226 0.378
+aacgg 0.42 0.152 0.25
+aacgt 0.135 0.201 0.25
+aacta 0.142 0.174 0.232
+aactc 0.262 0.321 0.32
+aactg 0.255 0.223 0.232
+aactt 0.34 0.283 0.216
+aagaa 0.217 0.383 0.217
+aagac 0.246 0.293 0.314
+aagag 0.354 0.188 0.329
+aagat 0.183 0.137 0.14
+aagca 0.342 0.323 0.308
+aagcc 0.216 0.256 0.258
+aagcg 0.238 0.146 0.278
+aagct 0.203 0.274 0.157
+aagga 0.257 0.29 0.345
+aaggc 0.243 0.196 0.236
+aaggg 0.304 0.251 0.196
+aaggt 0.196 0.263 0.223
+aagta 0.238 0.239 0.205
+aagtc 0.161 0.289 0.316
+aagtg 0.252 0.261 0.282
+aagtt 0.35 0.211 0.197
+aataa 0.252 0.206 0.169
+aatac 0.204 0.142 0.28
+aatag 0.35 0.376 0.169
+aatat 0.194 0.277 0.381
+aatca 0.23 0.289 0.22
+aatcc 0.257 0.39 0.276
+aatcg 0.288 0.164 0.346
+aatct 0.225 0.157 0.157
+aatga 0.246 0.305 0.159
+aatgc 0.257 0.239 0.286
+aatgg 0.393 0.277 0.286
+aatgt 0.105 0.178 0.27
+aatta 0.364 0.171 0.248
+aattc 0.155 0.248 0.273
+aattg 0.271 0.333 0.273
+aattt 0.209 0.248 0.207
+acaaa 0.247 0.132 0.296
+acaac 0.258 0.245 0.236
+acaag 0.237 0.371 0.256
+acaat 0.258 0.252 0.211
+acaca 0.295 0.255 0.341
+acacc 0.205 0.185 0.173
+acacg 0.225 0.352 0.26
+acact 0.275 0.208 0.226
+acaga 0.366 0.418 0.13
+acagc 0.291 0.291 0.495
+acagg 0.23 0.153 0.183
+acagt 0.113 0.138 0.192
+acata 0.13 0.157 0.135
+acatc 0.292 0.373 0.388
+acatg 0.383 0.281 0.306
+acatt 0.195 0.19 0.171
+accaa 0.228 0.213 0.193
+accac 0.364 0.208 0.333
+accag 0.179 0.225 0.26
+accat 0.228 0.354 0.213
+accca 0.231 0.209 0.291
+acccc 0.171 0.407 0.28
+acccg 0.361 0.203 0.234
+accct 0.236 0.181 0.194
+accga 0.167 0.21 0.24
+accgc 0.429 0.406 0.301
+accgg 0.167 0.175 0.224
+accgt 0.237 0.21 0.235
+accta 0.258 0.185 0.154
+acctc 0.281 0.383 0.284
+acctg 0.266 0.198 0.391
+acctt 0.195 0.234 0.172
+acgaa 0.397 0.213 0.17
+acgac 0.198 0.273 0.216
+acgag 0.168 0.306 0.367
+acgat 0.237 0.208 0.248
+acgca 0.154 0.17 0.162
+acgcc 0.271 0.268 0.376
+acgcg 0.379 0.323 0.3
+acgct 0.196 0.238 0.162
+acgga 0.229 0.221 0.261
+acggc 0.276 0.441 0.388
+acggg 0.271 0.176 0.218
+acggt 0.224 0.162 0.133
+acgta 0.188 0.142 0.16
+acgtc 0.315 0.362 0.26
+acgtg 0.295 0.305 0.381
+acgtt 0.201 0.191 0.199
+actaa 0.189 0.194 0.135
+actac 0.321 0.252 0.345
+actag 0.236 0.262 0.135
+actat 0.255 0.291 0.385
+actca 0.203 0.267 0.232
+actcc 0.276 0.289 0.245
+actcg 0.3 0.183 0.291
+actct 0.221 0.261 0.232
+actga 0.306 0.279 0.118
+actgc 0.38 0.343 0.314
+actgg 0.157 0.139 0.402
+actgt 0.157 0.239 0.166
+actta 0.161 0.175 0.211
+acttc 0.274 0.416 0.281
+acttg 0.306 0.197 0.337
+acttt 0.258 0.212 0.171
+agaaa 0.181 0.306 0.193
+agaac 0.187 0.191 0.189
+agaag 0.386 0.318 0.439
+agaat 0.247 0.185 0.18
+agaca 0.297 0.228 0.242
+agacc 0.125 0.281 0.25
+agacg 0.306 0.272 0.363
+agact 0.272 0.219 0.145
+agaga 0.313 0.195 0.235
+agagc 0.18 0.4 0.219
+agagg 0.373 0.295 0.294
+agagt 0.133 0.109 0.251
+agata 0.21 0.172 0.141
+agatc 0.282 0.25 0.306
+agatg 0.398 0.302 0.388
+agatt 0.11 0.276 0.165
+agcaa 0.207 0.276 0.108
+agcac 0.244 0.146 0.247
+agcag 0.341 0.373 0.441
+agcat 0.207 0.205 0.204
+agcca 0.236 0.186 0.24
+agccc 0.262 0.158 0.341
+agccg 0.229 0.355 0.246
+agcct 0.273 0.301 0.173
+agcga 0.233 0.215 0.153
+agcgc 0.259 0.13 0.34
+agcgg 0.33 0.318 0.335
+agcgt 0.178 0.336 0.172
+agcta 0.134 0.203 0.127
+agctc 0.228 0.324 0.324
+agctg 0.396 0.236 0.348
+agctt 0.242 0.236 0.201
+aggaa 0.335 0.271 0.165
+aggac 0.106 0.284 0.201
+aggag 0.452 0.213 0.472
+aggat 0.106 0.232 0.161
+aggca 0.238 0.252 0.234
+aggcc 0.138 0.192 0.238
+aggcg 0.276 0.258 0.355
+aggct 0.348 0.298 0.172
+aggga 0.142 0.273 0.295
+agggc 0.312 0.203 0.245
+agggg 0.255 0.23 0.25
+agggt 0.291 0.294 0.21
+aggta 0.216 0.148 0.196
+aggtc 0.175 0.2 0.183
+aggtg 0.345 0.481 0.404
+aggtt 0.263 0.17 0.217
+agtaa 0.207 0.337 0.194
+agtac 0.193 0.123 0.35
+agtag 0.385 0.258 0.194
+agtat 0.215 0.282 0.262
+agtca 0.267 0.146 0.278
+agtcc 0.291 0.28 0.172
+agtcg 0.169 0.268 0.317
+agtct 0.273 0.305 0.233
+agtga 0.266 0.256 0.102
+agtgc 0.136 0.251 0.179
+agtgg 0.304 0.193 0.23
+agtgt 0.294 0.3 0.49
+agtta 0.164 0.307 0.233
+agttc 0.333 0.131 0.259
+agttg 0.245 0.32 0.216
+agttt 0.258 0.242 0.293
+ataaa 0.25 0.206 0.263
+ataac 0.25 0.258 0.18
+ataag 0.25 0.33 0.338
+ataat 0.25 0.206 0.218
+ataca 0.301 0.371 0.28
+atacc 0.176 0.189 0.215
+atacg 0.235 0.235 0.215
+atact 0.288 0.205 0.29
+ataga 0.25 0.298 0.333
+atagc 0.25 0.161 0.293
+atagg 0.25 0.194 0.136
+atagt 0.25 0.347 0.238
+atata 0.278 0.372 0.189
+atatc 0.159 0.174 0.296
+atatg 0.295 0.231 0.296
+atatt 0.267 0.223 0.22
+atcaa 0.253 0.276 0.193
+atcac 0.235 0.346 0.324
+atcag 0.198 0.211 0.2
+atcat 0.315 0.168 0.283
+atcca 0.181 0.267 0.238
+atccc 0.269 0.267 0.351
+atccg 0.181 0.158 0.211
+atcct 0.369 0.309 0.2
+atcga 0.206 0.293 0.265
+atcgc 0.412 0.282 0.206
+atcgg 0.271 0.287 0.309
+atcgt 0.111 0.138 0.221
+atcta 0.134 0.23 0.14
+atctc 0.315 0.206 0.354
+atctg 0.248 0.248 0.354
+atctt 0.302 0.315 0.152
+atgaa 0.25 0.261 0.194
+atgac 0.25 0.315 0.319
+atgag 0.25 0.18 0.222
+atgat 0.25 0.243 0.264
+atgca 0.19 0.248 0.254
+atgcc 0.183 0.203 0.357
+atgcg 0.366 0.288 0.23
+atgct 0.261 0.261 0.16
+atgga 0.25 0.258 0.2
+atggc 0.147 0.294 0.166
+atggg 0.359 0.167 0.145
+atggt 0.245 0.282 0.49
+atgta 0.288 0.164 0.164
+atgtc 0.223 0.345 0.206
+atgtg 0.296 0.288 0.407
+atgtt 0.193 0.203 0.224
+attaa 0.21 0.232 0.167
+attac 0.244 0.216 0.275
+attag 0.311 0.2 0.167
+attat 0.235 0.352 0.392
+attca 0.273 0.184 0.23
+attcc 0.237 0.211 0.286
+attcg 0.245 0.224 0.23
+attct 0.245 0.381 0.254
+attga 0.162 0.246 0.126
+attgc 0.223 0.24 0.182
+attgg 0.324 0.129 0.22
+attgt 0.291 0.386 0.472
+attta 0.234 0.228 0.155
+atttc 0.242 0.157 0.155
+atttg 0.367 0.346 0.419
+atttt 0.156 0.268 0.271
+caaaa 0.23 0.241 0.167
+caaac 0.335 0.357 0.275
+caaag 0.255 0.179 0.242
+caaat 0.18 0.223 0.317
+caaca 0.367 0.429 0.237
+caacc 0.26 0.186 0.267
+caacg 0.207 0.186 0.267
+caact 0.167 0.2 0.23
+caaga 0.224 0.346 0.337
+caagc 0.185 0.254 0.27
+caagg 0.409 0.223 0.215
+caagt 0.181 0.177 0.178
+caata 0.314 0.284 0.226
+caatc 0.131 0.196 0.226
+caatg 0.366 0.196 0.226
+caatt 0.19 0.324 0.322
+cacaa 0.185 0.285 0.105
+cacac 0.349 0.321 0.337
+cacag 0.243 0.241 0.332
+cacat 0.222 0.153 0.226
+cacca 0.396 0.231 0.195
+caccc 0.149 0.19 0.333
+caccg 0.227 0.374 0.26
+cacct 0.227 0.204 0.211
+cacga 0.265 0.421 0.122
+cacgc 0.18 0.226 0.378
+cacgg 0.42 0.152 0.25
+cacgt 0.135 0.201 0.25
+cacta 0.142 0.174 0.232
+cactc 0.262 0.321 0.32
+cactg 0.255 0.223 0.232
+cactt 0.34 0.283 0.216
+cagaa 0.217 0.383 0.217
+cagac 0.246 0.293 0.314
+cagag 0.354 0.188 0.329
+cagat 0.183 0.137 0.14
+cagca 0.342 0.323 0.308
+cagcc 0.216 0.256 0.258
+cagcg 0.238 0.146 0.278
+cagct 0.203 0.274 0.157
+cagga 0.257 0.29 0.345
+caggc 0.243 0.196 0.236
+caggg 0.304 0.251 0.196
+caggt 0.196 0.263 0.223
+cagta 0.238 0.239 0.205
+cagtc 0.161 0.289 0.316
+cagtg 0.252 0.261 0.282
+cagtt 0.35 0.211 0.197
+cataa 0.252 0.206 0.169
+catac 0.204 0.142 0.28
+catag 0.35 0.376 0.169
+catat 0.194 0.277 0.381
+catca 0.23 0.289 0.22
+catcc 0.257 0.39 0.276
+catcg 0.288 0.164 0.346
+catct 0.225 0.157 0.157
+catga 0.246 0.305 0.159
+catgc 0.257 0.239 0.286
+catgg 0.393 0.277 0.286
+catgt 0.105 0.178 0.27
+catta 0.364 0.171 0.248
+cattc 0.155 0.248 0.273
+cattg 0.271 0.333 0.273
+cattt 0.209 0.248 0.207
+ccaaa 0.247 0.132 0.296
+ccaac 0.258 0.245 0.236
+ccaag 0.237 0.371 0.256
+ccaat 0.258 0.252 0.211
+ccaca 0.295 0.255 0.341
+ccacc 0.205 0.185 0.173
+ccacg 0.225 0.352 0.26
+ccact 0.275 0.208 0.226
+ccaga 0.366 0.418 0.13
+ccagc 0.291 0.291 0.495
+ccagg 0.23 0.153 0.183
+ccagt 0.113 0.138 0.192
+ccata 0.13 0.157 0.135
+ccatc 0.292 0.373 0.388
+ccatg 0.383 0.281 0.306
+ccatt 0.195 0.19 0.171
+cccaa 0.228 0.213 0.193
+cccac 0.364 0.208 0.333
+cccag 0.179 0.225 0.26
+cccat 0.228 0.354 0.213
+cccca 0.231 0.209 0.291
+ccccc 0.171 0.407 0.28
+ccccg 0.361 0.203 0.234
+cccct 0.236 0.181 0.194
+cccga 0.167 0.21 0.24
+cccgc 0.429 0.406 0.301
+cccgg 0.167 0.175 0.224
+cccgt 0.237 0.21 0.235
+cccta 0.258 0.185 0.154
+ccctc 0.281 0.383 0.284
+ccctg 0.266 0.198 0.391
+ccctt 0.195 0.234 0.172
+ccgaa 0.397 0.213 0.17
+ccgac 0.198 0.273 0.216
+ccgag 0.168 0.306 0.367
+ccgat 0.237 0.208 0.248
+ccgca 0.154 0.17 0.162
+ccgcc 0.271 0.268 0.376
+ccgcg 0.379 0.323 0.3
+ccgct 0.196 0.238 0.162
+ccgga 0.229 0.221 0.261
+ccggc 0.276 0.441 0.388
+ccggg 0.271 0.176 0.218
+ccggt 0.224 0.162 0.133
+ccgta 0.188 0.142 0.16
+ccgtc 0.315 0.362 0.26
+ccgtg 0.295 0.305 0.381
+ccgtt 0.201 0.191 0.199
+cctaa 0.189 0.194 0.135
+cctac 0.321 0.252 0.345
+cctag 0.236 0.262 0.135
+cctat 0.255 0.291 0.385
+cctca 0.203 0.267 0.232
+cctcc 0.276 0.289 0.245
+cctcg 0.3 0.183 0.291
+cctct 0.221 0.261 0.232
+cctga 0.306 0.279 0.118
+cctgc 0.38 0.343 0.314
+cctgg 0.157 0.139 0.402
+cctgt 0.157 0.239 0.166
+cctta 0.161 0.175 0.211
+ccttc 0.274 0.416 0.281
+ccttg 0.306 0.197 0.337
+ccttt 0.258 0.212 0.171
+cgaaa 0.181 0.306 0.193
+cgaac 0.187 0.191 0.189
+cgaag 0.386 0.318 0.439
+cgaat 0.247 0.185 0.18
+cgaca 0.297 0.228 0.242
+cgacc 0.125 0.281 0.25
+cgacg 0.306 0.272 0.363
+cgact 0.272 0.219 0.145
+cgaga 0.313 0.195 0.235
+cgagc 0.18 0.4 0.219
+cgagg 0.373 0.295 0.294
+cgagt 0.133 0.109 0.251
+cgata 0.21 0.172 0.141
+cgatc 0.282 0.25 0.306
+cgatg 0.398 0.302 0.388
+cgatt 0.11 0.276 0.165
+cgcaa 0.207 0.276 0.108
+cgcac 0.244 0.146 0.247
+cgcag 0.341 0.373 0.441
+cgcat 0.207 0.205 0.204
+cgcca 0.236 0.186 0.24
+cgccc 0.262 0.158 0.341
+cgccg 0.229 0.355 0.246
+cgcct 0.273 0.301 0.173
+cgcga 0.233 0.215 0.153
+cgcgc 0.259 0.13 0.34
+cgcgg 0.33 0.318 0.335
+cgcgt 0.178 0.336 0.172
+cgcta 0.134 0.203 0.127
+cgctc 0.228 0.324 0.324
+cgctg 0.396 0.236 0.348
+cgctt 0.242 0.236 0.201
+cggaa 0.335 0.271 0.165
+cggac 0.106 0.284 0.201
+cggag 0.452 0.213 0.472
+cggat 0.106 0.232 0.161
+cggca 0.238 0.252 0.234
+cggcc 0.138 0.192 0.238
+cggcg 0.276 0.258 0.355
+cggct 0.348 0.298 0.172
+cggga 0.142 0.273 0.295
+cgggc 0.312 0.203 0.245
+cgggg 0.255 0.23 0.25
+cgggt 0.291 0.294 0.21
+cggta 0.216 0.148 0.196
+cggtc 0.175 0.2 0.183
+cggtg 0.345 0.481 0.404
+cggtt 0.263 0.17 0.217
+cgtaa 0.207 0.337 0.194
+cgtac 0.193 0.123 0.35
+cgtag 0.385 0.258 0.194
+cgtat 0.215 0.282 0.262
+cgtca 0.267 0.146 0.278
+cgtcc 0.291 0.28 0.172
+cgtcg 0.169 0.268 0.317
+cgtct 0.273 0.305 0.233
+cgtga 0.266 0.256 0.102
+cgtgc 0.136 0.251 0.179
+cgtgg 0.304 0.193 0.23
+cgtgt 0.294 0.3 0.49
+cgtta 0.164 0.307 0.233
+cgttc 0.333 0.131 0.259
+cgttg 0.245 0.32 0.216
+cgttt 0.258 0.242 0.293
+ctaaa 0.25 0.206 0.263
+ctaac 0.25 0.258 0.18
+ctaag 0.25 0.33 0.338
+ctaat 0.25 0.206 0.218
+ctaca 0.301 0.371 0.28
+ctacc 0.176 0.189 0.215
+ctacg 0.235 0.235 0.215
+ctact 0.288 0.205 0.29
+ctaga 0.25 0.298 0.333
+ctagc 0.25 0.161 0.293
+ctagg 0.25 0.194 0.136
+ctagt 0.25 0.347 0.238
+ctata 0.278 0.372 0.189
+ctatc 0.159 0.174 0.296
+ctatg 0.295 0.231 0.296
+ctatt 0.267 0.223 0.22
+ctcaa 0.253 0.276 0.193
+ctcac 0.235 0.346 0.324
+ctcag 0.198 0.211 0.2
+ctcat 0.315 0.168 0.283
+ctcca 0.181 0.267 0.238
+ctccc 0.269 0.267 0.351
+ctccg 0.181 0.158 0.211
+ctcct 0.369 0.309 0.2
+ctcga 0.206 0.293 0.265
+ctcgc 0.412 0.282 0.206
+ctcgg 0.271 0.287 0.309
+ctcgt 0.111 0.138 0.221
+ctcta 0.134 0.23 0.14
+ctctc 0.315 0.206 0.354
+ctctg 0.248 0.248 0.354
+ctctt 0.302 0.315 0.152
+ctgaa 0.25 0.261 0.194
+ctgac 0.25 0.315 0.319
+ctgag 0.25 0.18 0.222
+ctgat 0.25 0.243 0.264
+ctgca 0.19 0.248 0.254
+ctgcc 0.183 0.203 0.357
+ctgcg 0.366 0.288 0.23
+ctgct 0.261 0.261 0.16
+ctgga 0.25 0.258 0.2
+ctggc 0.147 0.294 0.166
+ctggg 0.359 0.167 0.145
+ctggt 0.245 0.282 0.49
+ctgta 0.288 0.164 0.164
+ctgtc 0.223 0.345 0.206
+ctgtg 0.296 0.288 0.407
+ctgtt 0.193 0.203 0.224
+cttaa 0.21 0.232 0.167
+cttac 0.244 0.216 0.275
+cttag 0.311 0.2 0.167
+cttat 0.235 0.352 0.392
+cttca 0.273 0.184 0.23
+cttcc 0.237 0.211 0.286
+cttcg 0.245 0.224 0.23
+cttct 0.245 0.381 0.254
+cttga 0.162 0.246 0.126
+cttgc 0.223 0.24 0.182
+cttgg 0.324 0.129 0.22
+cttgt 0.291 0.386 0.472
+cttta 0.234 0.228 0.155
+ctttc 0.242 0.157 0.155
+ctttg 0.367 0.346 0.419
+ctttt 0.156 0.268 0.271
+gaaaa 0.23 0.241 0.167
+gaaac 0.335 0.357 0.275
+gaaag 0.255 0.179 0.242
+gaaat 0.18 0.223 0.317
+gaaca 0.367 0.429 0.237
+gaacc 0.26 0.186 0.267
+gaacg 0.207 0.186 0.267
+gaact 0.167 0.2 0.23
+gaaga 0.224 0.346 0.337
+gaagc 0.185 0.254 0.27
+gaagg 0.409 0.223 0.215
+gaagt 0.181 0.177 0.178
+gaata 0.314 0.284 0.226
+gaatc 0.131 0.196 0.226
+gaatg 0.366 0.196 0.226
+gaatt 0.19 0.324 0.322
+gacaa 0.185 0.285 0.105
+gacac 0.349 0.321 0.337
+gacag 0.243 0.241 0.332
+gacat 0.222 0.153 0.226
+gacca 0.396 0.231 0.195
+gaccc 0.149 0.19 0.333
+gaccg 0.227 0.374 0.26
+gacct 0.227 0.204 0.211
+gacga 0.265 0.421 0.122
+gacgc 0.18 0.226 0.378
+gacgg 0.42 0.152 0.25
+gacgt 0.135 0.201 0.25
+gacta 0.142 0.174 0.232
+gactc 0.262 0.321 0.32
+gactg 0.255 0.223 0.232
+gactt 0.34 0.283 0.216
+gagaa 0.217 0.383 0.217
+gagac 0.246 0.293 0.314
+gagag 0.354 0.188 0.329
+gagat 0.183 0.137 0.14
+gagca 0.342 0.323 0.308
+gagcc 0.216 0.256 0.258
+gagcg 0.238 0.146 0.278
+gagct 0.203 0.274 0.157
+gagga 0.257 0.29 0.345
+gaggc 0.243 0.196 0.236
+gaggg 0.304 0.251 0.196
+gaggt 0.196 0.263 0.223
+gagta 0.238 0.239 0.205
+gagtc 0.161 0.289 0.316
+gagtg 0.252 0.261 0.282
+gagtt 0.35 0.211 0.197
+gataa 0.252 0.206 0.169
+gatac 0.204 0.142 0.28
+gatag 0.35 0.376 0.169
+gatat 0.194 0.277 0.381
+gatca 0.23 0.289 0.22
+gatcc 0.257 0.39 0.276
+gatcg 0.288 0.164 0.346
+gatct 0.225 0.157 0.157
+gatga 0.246 0.305 0.159
+gatgc 0.257 0.239 0.286
+gatgg 0.393 0.277 0.286
+gatgt 0.105 0.178 0.27
+gatta 0.364 0.171 0.248
+gattc 0.155 0.248 0.273
+gattg 0.271 0.333 0.273
+gattt 0.209 0.248 0.207
+gcaaa 0.247 0.132 0.296
+gcaac 0.258 0.245 0.236
+gcaag 0.237 0.371 0.256
+gcaat 0.258 0.252 0.211
+gcaca 0.295 0.255 0.341
+gcacc 0.205 0.185 0.173
+gcacg 0.225 0.352 0.26
+gcact 0.275 0.208 0.226
+gcaga 0.366 0.418 0.13
+gcagc 0.291 0.291 0.495
+gcagg 0.23 0.153 0.183
+gcagt 0.113 0.138 0.192
+gcata 0.13 0.157 0.135
+gcatc 0.292 0.373 0.388
+gcatg 0.383 0.281 0.306
+gcatt 0.195 0.19 0.171
+gccaa 0.228 0.213 0.193
+gccac 0.364 0.208 0.333
+gccag 0.179 0.225 0.26
+gccat 0.228 0.354 0.213
+gccca 0.231 0.209 0.291
+gcccc 0.171 0.407 0.28
+gcccg 0.361 0.203 0.234
+gccct 0.236 0.181 0.194
+gccga 0.167 0.21 0.24
+gccgc 0.429 0.406 0.301
+gccgg 0.167 0.175 0.224
+gccgt 0.237 0.21 0.235
+gccta 0.258 0.185 0.154
+gcctc 0.281 0.383 0.284
+gcctg 0.266 0.198 0.391
+gcctt 0.195 0.234 0.172
+gcgaa 0.397 0.213 0.17
+gcgac 0.198 0.273 0.216
+gcgag 0.168 0.306 0.367
+gcgat 0.237 0.208 0.248
+gcgca 0.154 0.17 0.162
+gcgcc 0.271 0.268 0.376
+gcgcg 0.379 0.323 0.3
+gcgct 0.196 0.238 0.162
+gcgga 0.229 0.221 0.261
+gcggc 0.276 0.441 0.388
+gcggg 0.271 0.176 0.218
+gcggt 0.224 0.162 0.133
+gcgta 0.188 0.142 0.16
+gcgtc 0.315 0.362 0.26
+gcgtg 0.295 0.305 0.381
+gcgtt 0.201 0.191 0.199
+gctaa 0.189 0.194 0.135
+gctac 0.321 0.252 0.345
+gctag 0.236 0.262 0.135
+gctat 0.255 0.291 0.385
+gctca 0.203 0.267 0.232
+gctcc 0.276 0.289 0.245
+gctcg 0.3 0.183 0.291
+gctct 0.221 0.261 0.232
+gctga 0.306 0.279 0.118
+gctgc 0.38 0.343 0.314
+gctgg 0.157 0.139 0.402
+gctgt 0.157 0.239 0.166
+gctta 0.161 0.175 0.211
+gcttc 0.274 0.416 0.281
+gcttg 0.306 0.197 0.337
+gcttt 0.258 0.212 0.171
+ggaaa 0.181 0.306 0.193
+ggaac 0.187 0.191 0.189
+ggaag 0.386 0.318 0.439
+ggaat 0.247 0.185 0.18
+ggaca 0.297 0.228 0.242
+ggacc 0.125 0.281 0.25
+ggacg 0.306 0.272 0.363
+ggact 0.272 0.219 0.145
+ggaga 0.313 0.195 0.235
+ggagc 0.18 0.4 0.219
+ggagg 0.373 0.295 0.294
+ggagt 0.133 0.109 0.251
+ggata 0.21 0.172 0.141
+ggatc 0.282 0.25 0.306
+ggatg 0.398 0.302 0.388
+ggatt 0.11 0.276 0.165
+ggcaa 0.207 0.276 0.108
+ggcac 0.244 0.146 0.247
+ggcag 0.341 0.373 0.441
+ggcat 0.207 0.205 0.204
+ggcca 0.236 0.186 0.24
+ggccc 0.262 0.158 0.341
+ggccg 0.229 0.355 0.246
+ggcct 0.273 0.301 0.173
+ggcga 0.233 0.215 0.153
+ggcgc 0.259 0.13 0.34
+ggcgg 0.33 0.318 0.335
+ggcgt 0.178 0.336 0.172
+ggcta 0.134 0.203 0.127
+ggctc 0.228 0.324 0.324
+ggctg 0.396 0.236 0.348
+ggctt 0.242 0.236 0.201
+gggaa 0.335 0.271 0.165
+gggac 0.106 0.284 0.201
+gggag 0.452 0.213 0.472
+gggat 0.106 0.232 0.161
+gggca 0.238 0.252 0.234
+gggcc 0.138 0.192 0.238
+gggcg 0.276 0.258 0.355
+gggct 0.348 0.298 0.172
+gggga 0.142 0.273 0.295
+ggggc 0.312 0.203 0.245
+ggggg 0.255 0.23 0.25
+ggggt 0.291 0.294 0.21
+gggta 0.216 0.148 0.196
+gggtc 0.175 0.2 0.183
+gggtg 0.345 0.481 0.404
+gggtt 0.263 0.17 0.217
+ggtaa 0.207 0.337 0.194
+ggtac 0.193 0.123 0.35
+ggtag 0.385 0.258 0.194
+ggtat 0.215 0.282 0.262
+ggtca 0.267 0.146 0.278
+ggtcc 0.291 0.28 0.172
+ggtcg 0.169 0.268 0.317
+ggtct 0.273 0.305 0.233
+ggtga 0.266 0.256 0.102
+ggtgc 0.136 0.251 0.179
+ggtgg 0.304 0.193 0.23
+ggtgt 0.294 0.3 0.49
+ggtta 0.164 0.307 0.233
+ggttc 0.333 0.131 0.259
+ggttg 0.245 0.32 0.216
+ggttt 0.258 0.242 0.293
+gtaaa 0.25 0.206 0.263
+gtaac 0.25 0.258 0.18
+gtaag 0.25 0.33 0.338
+gtaat 0.25 0.206 0.218
+gtaca 0.301 0.371 0.28
+gtacc 0.176 0.189 0.215
+gtacg 0.235 0.235 0.215
+gtact 0.288 0.205 0.29
+gtaga 0.25 0.298 0.333
+gtagc 0.25 0.161 0.293
+gtagg 0.25 0.194 0.136
+gtagt 0.25 0.347 0.238
+gtata 0.278 0.372 0.189
+gtatc 0.159 0.174 0.296
+gtatg 0.295 0.231 0.296
+gtatt 0.267 0.223 0.22
+gtcaa 0.253 0.276 0.193
+gtcac 0.235 0.346 0.324
+gtcag 0.198 0.211 0.2
+gtcat 0.315 0.168 0.283
+gtcca 0.181 0.267 0.238
+gtccc 0.269 0.267 0.351
+gtccg 0.181 0.158 0.211
+gtcct 0.369 0.309 0.2
+gtcga 0.206 0.293 0.265
+gtcgc 0.412 0.282 0.206
+gtcgg 0.271 0.287 0.309
+gtcgt 0.111 0.138 0.221
+gtcta 0.134 0.23 0.14
+gtctc 0.315 0.206 0.354
+gtctg 0.248 0.248 0.354
+gtctt 0.302 0.315 0.152
+gtgaa 0.25 0.261 0.194
+gtgac 0.25 0.315 0.319
+gtgag 0.25 0.18 0.222
+gtgat 0.25 0.243 0.264
+gtgca 0.19 0.248 0.254
+gtgcc 0.183 0.203 0.357
+gtgcg 0.366 0.288 0.23
+gtgct 0.261 0.261 0.16
+gtgga 0.25 0.258 0.2
+gtggc 0.147 0.294 0.166
+gtggg 0.359 0.167 0.145
+gtggt 0.245 0.282 0.49
+gtgta 0.288 0.164 0.164
+gtgtc 0.223 0.345 0.206
+gtgtg 0.296 0.288 0.407
+gtgtt 0.193 0.203 0.224
+gttaa 0.21 0.232 0.167
+gttac 0.244 0.216 0.275
+gttag 0.311 0.2 0.167
+gttat 0.235 0.352 0.392
+gttca 0.273 0.184 0.23
+gttcc 0.237 0.211 0.286
+gttcg 0.245 0.224 0.23
+gttct 0.245 0.381 0.254
+gttga 0.162 0.246 0.126
+gttgc 0.223 0.24 0.182
+gttgg 0.324 0.129 0.22
+gttgt 0.291 0.386 0.472
+gttta 0.234 0.228 0.155
+gtttc 0.242 0.157 0.155
+gtttg 0.367 0.346 0.419
+gtttt 0.156 0.268 0.271
+taaaa 0.23 0.241 0.167
+taaac 0.335 0.357 0.275
+taaag 0.255 0.179 0.242
+taaat 0.18 0.223 0.317
+taaca 0.367 0.429 0.237
+taacc 0.26 0.186 0.267
+taacg 0.207 0.186 0.267
+taact 0.167 0.2 0.23
+taaga 0.224 0.346 0.337
+taagc 0.185 0.254 0.27
+taagg 0.409 0.223 0.215
+taagt 0.181 0.177 0.178
+taata 0.314 0.284 0.226
+taatc 0.131 0.196 0.226
+taatg 0.366 0.196 0.226
+taatt 0.19 0.324 0.322
+tacaa 0.185 0.285 0.105
+tacac 0.349 0.321 0.337
+tacag 0.243 0.241 0.332
+tacat 0.222 0.153 0.226
+tacca 0.396 0.231 0.195
+taccc 0.149 0.19 0.333
+taccg 0.227 0.374 0.26
+tacct 0.227 0.204 0.211
+tacga 0.265 0.421 0.122
+tacgc 0.18 0.226 0.378
+tacgg 0.42 0.152 0.25
+tacgt 0.135 0.201 0.25
+tacta 0.142 0.174 0.232
+tactc 0.262 0.321 0.32
+tactg 0.255 0.223 0.232
+tactt 0.34 0.283 0.216
+tagaa 0.217 0.383 0.217
+tagac 0.246 0.293 0.314
+tagag 0.354 0.188 0.329
+tagat 0.183 0.137 0.14
+tagca 0.342 0.323 0.308
+tagcc 0.216 0.256 0.258
+tagcg 0.238 0.146 0.278
+tagct 0.203 0.274 0.157
+tagga 0.257 0.29 0.345
+taggc 0.243 0.196 0.236
+taggg 0.304 0.251 0.196
+taggt 0.196 0.263 0.223
+tagta 0.238 0.239 0.205
+tagtc 0.161 0.289 0.316
+tagtg 0.252 0.261 0.282
+tagtt 0.35 0.211 0.197
+tataa 0.252 0.206 0.169
+tatac 0.204 0.142 0.28
+tatag 0.35 0.376 0.169
+tatat 0.194 0.277 0.381
+tatca 0.23 0.289 0.22
+tatcc 0.257 0.39 0.276
+tatcg 0.288 0.164 0.346
+tatct 0.225 0.157 0.157
+tatga 0.246 0.305 0.159
+tatgc 0.257 0.239 0.286
+tatgg 0.393 0.277 0.286
+tatgt 0.105 0.178 0.27
+tatta 0.364 0.171 0.248
+tattc 0.155 0.248 0.273
+tattg 0.271 0.333 0.273
+tattt 0.209 0.248 0.207
+tcaaa 0.247 0.132 0.296
+tcaac 0.258 0.245 0.236
+tcaag 0.237 0.371 0.256
+tcaat 0.258 0.252 0.211
+tcaca 0.295 0.255 0.341
+tcacc 0.205 0.185 0.173
+tcacg 0.225 0.352 0.26
+tcact 0.275 0.208 0.226
+tcaga 0.366 0.418 0.13
+tcagc 0.291 0.291 0.495
+tcagg 0.23 0.153 0.183
+tcagt 0.113 0.138 0.192
+tcata 0.13 0.157 0.135
+tcatc 0.292 0.373 0.388
+tcatg 0.383 0.281 0.306
+tcatt 0.195 0.19 0.171
+tccaa 0.228 0.213 0.193
+tccac 0.364 0.208 0.333
+tccag 0.179 0.225 0.26
+tccat 0.228 0.354 0.213
+tccca 0.231 0.209 0.291
+tcccc 0.171 0.407 0.28
+tcccg 0.361 0.203 0.234
+tccct 0.236 0.181 0.194
+tccga 0.167 0.21 0.24
+tccgc 0.429 0.406 0.301
+tccgg 0.167 0.175 0.224
+tccgt 0.237 0.21 0.235
+tccta 0.258 0.185 0.154
+tcctc 0.281 0.383 0.284
+tcctg 0.266 0.198 0.391
+tcctt 0.195 0.234 0.172
+tcgaa 0.397 0.213 0.17
+tcgac 0.198 0.273 0.216
+tcgag 0.168 0.306 0.367
+tcgat 0.237 0.208 0.248
+tcgca 0.154 0.17 0.162
+tcgcc 0.271 0.268 0.376
+tcgcg 0.379 0.323 0.3
+tcgct 0.196 0.238 0.162
+tcgga 0.229 0.221 0.261
+tcggc 0.276 0.441 0.388
+tcggg 0.271 0.176 0.218
+tcggt 0.224 0.162 0.133
+tcgta 0.188 0.142 0.16
+tcgtc 0.315 0.362 0.26
+tcgtg 0.295 0.305 0.381
+tcgtt 0.201 0.191 0.199
+tctaa 0.189 0.194 0.135
+tctac 0.321 0.252 0.345
+tctag 0.236 0.262 0.135
+tctat 0.255 0.291 0.385
+tctca 0.203 0.267 0.232
+tctcc 0.276 0.289 0.245
+tctcg 0.3 0.183 0.291
+tctct 0.221 0.261 0.232
+tctga 0.306 0.279 0.118
+tctgc 0.38 0.343 0.314
+tctgg 0.157 0.139 0.402
+tctgt 0.157 0.239 0.166
+tctta 0.161 0.175 0.211
+tcttc 0.274 0.416 0.281
+tcttg 0.306 0.197 0.337
+tcttt 0.258 0.212 0.171
+tgaaa 0.181 0.306 0.193
+tgaac 0.187 0.191 0.189
+tgaag 0.386 0.318 0.439
+tgaat 0.247 0.185 0.18
+tgaca 0.297 0.228 0.242
+tgacc 0.125 0.281 0.25
+tgacg 0.306 0.272 0.363
+tgact 0.272 0.219 0.145
+tgaga 0.313 0.195 0.235
+tgagc 0.18 0.4 0.219
+tgagg 0.373 0.295 0.294
+tgagt 0.133 0.109 0.251
+tgata 0.21 0.172 0.141
+tgatc 0.282 0.25 0.306
+tgatg 0.398 0.302 0.388
+tgatt 0.11 0.276 0.165
+tgcaa 0.207 0.276 0.108
+tgcac 0.244 0.146 0.247
+tgcag 0.341 0.373 0.441
+tgcat 0.207 0.205 0.204
+tgcca 0.236 0.186 0.24
+tgccc 0.262 0.158 0.341
+tgccg 0.229 0.355 0.246
+tgcct 0.273 0.301 0.173
+tgcga 0.233 0.215 0.153
+tgcgc 0.259 0.13 0.34
+tgcgg 0.33 0.318 0.335
+tgcgt 0.178 0.336 0.172
+tgcta 0.134 0.203 0.127
+tgctc 0.228 0.324 0.324
+tgctg 0.396 0.236 0.348
+tgctt 0.242 0.236 0.201
+tggaa 0.335 0.271 0.165
+tggac 0.106 0.284 0.201
+tggag 0.452 0.213 0.472
+tggat 0.106 0.232 0.161
+tggca 0.238 0.252 0.234
+tggcc 0.138 0.192 0.238
+tggcg 0.276 0.258 0.355
+tggct 0.348 0.298 0.172
+tggga 0.142 0.273 0.295
+tgggc 0.312 0.203 0.245
+tgggg 0.255 0.23 0.25
+tgggt 0.291 0.294 0.21
+tggta 0.216 0.148 0.196
+tggtc 0.175 0.2 0.183
+tggtg 0.345 0.481 0.404
+tggtt 0.263 0.17 0.217
+tgtaa 0.207 0.337 0.194
+tgtac 0.193 0.123 0.35
+tgtag 0.385 0.258 0.194
+tgtat 0.215 0.282 0.262
+tgtca 0.267 0.146 0.278
+tgtcc 0.291 0.28 0.172
+tgtcg 0.169 0.268 0.317
+tgtct 0.273 0.305 0.233
+tgtga 0.266 0.256 0.102
+tgtgc 0.136 0.251 0.179
+tgtgg 0.304 0.193 0.23
+tgtgt 0.294 0.3 0.49
+tgtta 0.164 0.307 0.233
+tgttc 0.333 0.131 0.259
+tgttg 0.245 0.32 0.216
+tgttt 0.258 0.242 0.293
+ttaaa 0.25 0.206 0.263
+ttaac 0.25 0.258 0.18
+ttaag 0.25 0.33 0.338
+ttaat 0.25 0.206 0.218
+ttaca 0.301 0.371 0.28
+ttacc 0.176 0.189 0.215
+ttacg 0.235 0.235 0.215
+ttact 0.288 0.205 0.29
+ttaga 0.25 0.298 0.333
+ttagc 0.25 0.161 0.293
+ttagg 0.25 0.194 0.136
+ttagt 0.25 0.347 0.238
+ttata 0.278 0.372 0.189
+ttatc 0.159 0.174 0.296
+ttatg 0.295 0.231 0.296
+ttatt 0.267 0.223 0.22
+ttcaa 0.253 0.276 0.193
+ttcac 0.235 0.346 0.324
+ttcag 0.198 0.211 0.2
+ttcat 0.315 0.168 0.283
+ttcca 0.181 0.267 0.238
+ttccc 0.269 0.267 0.351
+ttccg 0.181 0.158 0.211
+ttcct 0.369 0.309 0.2
+ttcga 0.206 0.293 0.265
+ttcgc 0.412 0.282 0.206
+ttcgg 0.271 0.287 0.309
+ttcgt 0.111 0.138 0.221
+ttcta 0.134 0.23 0.14
+ttctc 0.315 0.206 0.354
+ttctg 0.248 0.248 0.354
+ttctt 0.302 0.315 0.152
+ttgaa 0.25 0.261 0.194
+ttgac 0.25 0.315 0.319
+ttgag 0.25 0.18 0.222
+ttgat 0.25 0.243 0.264
+ttgca 0.19 0.248 0.254
+ttgcc 0.183 0.203 0.357
+ttgcg 0.366 0.288 0.23
+ttgct 0.261 0.261 0.16
+ttgga 0.25 0.258 0.2
+ttggc 0.147 0.294 0.166
+ttggg 0.359 0.167 0.145
+ttggt 0.245 0.282 0.49
+ttgta 0.288 0.164 0.164
+ttgtc 0.223 0.345 0.206
+ttgtg 0.296 0.288 0.407
+ttgtt 0.193 0.203 0.224
+tttaa 0.21 0.232 0.167
+tttac 0.244 0.216 0.275
+tttag 0.311 0.2 0.167
+tttat 0.235 0.352 0.392
+tttca 0.273 0.184 0.23
+tttcc 0.237 0.211 0.286
+tttcg 0.245 0.224 0.23
+tttct 0.245 0.381 0.254
+tttga 0.162 0.246 0.126
+tttgc 0.223 0.24 0.182
+tttgg 0.324 0.129 0.22
+tttgt 0.291 0.386 0.472
+tttta 0.234 0.228 0.155
+ttttc 0.242 0.157 0.155
+ttttg 0.367 0.346 0.419
+ttttt 0.156 0.268 0.271
+
+
+#
+# Internal exon terminal emission probabilities
+#
+[ETEMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.25 0.25 0.25
+aaaac 0.25 0.25 0.25
+aaaag 0.25 0.25 0.25
+aaaat 0.25 0.25 0.25
+aaaca 0.25 0.25 0.25
+aaacc 0.25 0.25 0.25
+aaacg 0.25 0.25 0.25
+aaact 0.25 0.25 0.25
+aaaga 0.25 0.25 0.25
+aaagc 0.25 0.25 0.25
+aaagg 0.25 0.25 0.25
+aaagt 0.25 0.25 0.25
+aaata 0.25 0.25 0.25
+aaatc 0.25 0.25 0.25
+aaatg 0.25 0.25 0.25
+aaatt 0.25 0.25 0.25
+aacaa 0.25 0.25 0.25
+aacac 0.25 0.25 0.25
+aacag 0.25 0.25 0.25
+aacat 0.25 0.25 0.25
+aacca 0.25 0.25 0.25
+aaccc 0.25 0.25 0.25
+aaccg 0.25 0.25 0.25
+aacct 0.25 0.25 0.25
+aacga 0.25 0.25 0.25
+aacgc 0.25 0.25 0.25
+aacgg 0.25 0.25 0.25
+aacgt 0.25 0.25 0.25
+aacta 0.25 0.25 0.25
+aactc 0.25 0.25 0.25
+aactg 0.25 0.25 0.25
+aactt 0.25 0.25 0.25
+aagaa 0.25 0.25 0.25
+aagac 0.25 0.25 0.25
+aagag 0.25 0.25 0.25
+aagat 0.25 0.25 0.25
+aagca 0.25 0.25 0.25
+aagcc 0.25 0.25 0.25
+aagcg 0.25 0.25 0.25
+aagct 0.25 0.25 0.25
+aagga 0.25 0.25 0.25
+aaggc 0.25 0.25 0.25
+aaggg 0.25 0.25 0.25
+aaggt 0.25 0.25 0.25
+aagta 0.25 0.25 0.25
+aagtc 0.25 0.25 0.25
+aagtg 0.25 0.25 0.25
+aagtt 0.25 0.25 0.25
+aataa 0.25 0.25 0.25
+aatac 0.25 0.25 0.25
+aatag 0.25 0.25 0.25
+aatat 0.25 0.25 0.25
+aatca 0.25 0.25 0.25
+aatcc 0.25 0.25 0.25
+aatcg 0.25 0.25 0.25
+aatct 0.25 0.25 0.25
+aatga 0.25 0.25 0.25
+aatgc 0.25 0.25 0.25
+aatgg 0.25 0.25 0.25
+aatgt 0.25 0.25 0.25
+aatta 0.25 0.25 0.25
+aattc 0.25 0.25 0.25
+aattg 0.25 0.25 0.25
+aattt 0.25 0.25 0.25
+acaaa 0.25 0.25 0.25
+acaac 0.25 0.25 0.25
+acaag 0.25 0.25 0.25
+acaat 0.25 0.25 0.25
+acaca 0.25 0.25 0.25
+acacc 0.25 0.25 0.25
+acacg 0.25 0.25 0.25
+acact 0.25 0.25 0.25
+acaga 0.25 0.25 0.25
+acagc 0.25 0.25 0.25
+acagg 0.25 0.25 0.25
+acagt 0.25 0.25 0.25
+acata 0.25 0.25 0.25
+acatc 0.25 0.25 0.25
+acatg 0.25 0.25 0.25
+acatt 0.25 0.25 0.25
+accaa 0.25 0.25 0.25
+accac 0.25 0.25 0.25
+accag 0.25 0.25 0.25
+accat 0.25 0.25 0.25
+accca 0.25 0.25 0.25
+acccc 0.25 0.25 0.25
+acccg 0.25 0.25 0.25
+accct 0.25 0.25 0.25
+accga 0.25 0.25 0.25
+accgc 0.25 0.25 0.25
+accgg 0.25 0.25 0.25
+accgt 0.25 0.25 0.25
+accta 0.25 0.25 0.25
+acctc 0.25 0.25 0.25
+acctg 0.25 0.25 0.25
+acctt 0.25 0.25 0.25
+acgaa 0.25 0.25 0.25
+acgac 0.25 0.25 0.25
+acgag 0.25 0.25 0.25
+acgat 0.25 0.25 0.25
+acgca 0.25 0.25 0.25
+acgcc 0.25 0.25 0.25
+acgcg 0.25 0.25 0.25
+acgct 0.25 0.25 0.25
+acgga 0.25 0.25 0.25
+acggc 0.25 0.25 0.25
+acggg 0.25 0.25 0.25
+acggt 0.25 0.25 0.25
+acgta 0.25 0.25 0.25
+acgtc 0.25 0.25 0.25
+acgtg 0.25 0.25 0.25
+acgtt 0.25 0.25 0.25
+actaa 0.25 0.25 0.25
+actac 0.25 0.25 0.25
+actag 0.25 0.25 0.25
+actat 0.25 0.25 0.25
+actca 0.25 0.25 0.25
+actcc 0.25 0.25 0.25
+actcg 0.25 0.25 0.25
+actct 0.25 0.25 0.25
+actga 0.25 0.25 0.25
+actgc 0.25 0.25 0.25
+actgg 0.25 0.25 0.25
+actgt 0.25 0.25 0.25
+actta 0.25 0.25 0.25
+acttc 0.25 0.25 0.25
+acttg 0.25 0.25 0.25
+acttt 0.25 0.25 0.25
+agaaa 0.25 0.25 0.25
+agaac 0.25 0.25 0.25
+agaag 0.25 0.25 0.25
+agaat 0.25 0.25 0.25
+agaca 0.25 0.25 0.25
+agacc 0.25 0.25 0.25
+agacg 0.25 0.25 0.25
+agact 0.25 0.25 0.25
+agaga 0.25 0.25 0.25
+agagc 0.25 0.25 0.25
+agagg 0.25 0.25 0.25
+agagt 0.25 0.25 0.25
+agata 0.25 0.25 0.25
+agatc 0.25 0.25 0.25
+agatg 0.25 0.25 0.25
+agatt 0.25 0.25 0.25
+agcaa 0.25 0.25 0.25
+agcac 0.25 0.25 0.25
+agcag 0.25 0.25 0.25
+agcat 0.25 0.25 0.25
+agcca 0.25 0.25 0.25
+agccc 0.25 0.25 0.25
+agccg 0.25 0.25 0.25
+agcct 0.25 0.25 0.25
+agcga 0.25 0.25 0.25
+agcgc 0.25 0.25 0.25
+agcgg 0.25 0.25 0.25
+agcgt 0.25 0.25 0.25
+agcta 0.25 0.25 0.25
+agctc 0.25 0.25 0.25
+agctg 0.25 0.25 0.25
+agctt 0.25 0.25 0.25
+aggaa 0.25 0.25 0.25
+aggac 0.25 0.25 0.25
+aggag 0.25 0.25 0.25
+aggat 0.25 0.25 0.25
+aggca 0.25 0.25 0.25
+aggcc 0.25 0.25 0.25
+aggcg 0.25 0.25 0.25
+aggct 0.25 0.25 0.25
+aggga 0.25 0.25 0.25
+agggc 0.25 0.25 0.25
+agggg 0.25 0.25 0.25
+agggt 0.25 0.25 0.25
+aggta 0.25 0.25 0.25
+aggtc 0.25 0.25 0.25
+aggtg 0.25 0.25 0.25
+aggtt 0.25 0.25 0.25
+agtaa 0.25 0.25 0.25
+agtac 0.25 0.25 0.25
+agtag 0.25 0.25 0.25
+agtat 0.25 0.25 0.25
+agtca 0.25 0.25 0.25
+agtcc 0.25 0.25 0.25
+agtcg 0.25 0.25 0.25
+agtct 0.25 0.25 0.25
+agtga 0.25 0.25 0.25
+agtgc 0.25 0.25 0.25
+agtgg 0.25 0.25 0.25
+agtgt 0.25 0.25 0.25
+agtta 0.25 0.25 0.25
+agttc 0.25 0.25 0.25
+agttg 0.25 0.25 0.25
+agttt 0.25 0.25 0.25
+ataaa 0.25 0.25 0.25
+ataac 0.25 0.25 0.25
+ataag 0.25 0.25 0.25
+ataat 0.25 0.25 0.25
+ataca 0.25 0.25 0.25
+atacc 0.25 0.25 0.25
+atacg 0.25 0.25 0.25
+atact 0.25 0.25 0.25
+ataga 0.25 0.25 0.25
+atagc 0.25 0.25 0.25
+atagg 0.25 0.25 0.25
+atagt 0.25 0.25 0.25
+atata 0.25 0.25 0.25
+atatc 0.25 0.25 0.25
+atatg 0.25 0.25 0.25
+atatt 0.25 0.25 0.25
+atcaa 0.25 0.25 0.25
+atcac 0.25 0.25 0.25
+atcag 0.25 0.25 0.25
+atcat 0.25 0.25 0.25
+atcca 0.25 0.25 0.25
+atccc 0.25 0.25 0.25
+atccg 0.25 0.25 0.25
+atcct 0.25 0.25 0.25
+atcga 0.25 0.25 0.25
+atcgc 0.25 0.25 0.25
+atcgg 0.25 0.25 0.25
+atcgt 0.25 0.25 0.25
+atcta 0.25 0.25 0.25
+atctc 0.25 0.25 0.25
+atctg 0.25 0.25 0.25
+atctt 0.25 0.25 0.25
+atgaa 0.25 0.25 0.25
+atgac 0.25 0.25 0.25
+atgag 0.25 0.25 0.25
+atgat 0.25 0.25 0.25
+atgca 0.25 0.25 0.25
+atgcc 0.25 0.25 0.25
+atgcg 0.25 0.25 0.25
+atgct 0.25 0.25 0.25
+atgga 0.25 0.25 0.25
+atggc 0.25 0.25 0.25
+atggg 0.25 0.25 0.25
+atggt 0.25 0.25 0.25
+atgta 0.25 0.25 0.25
+atgtc 0.25 0.25 0.25
+atgtg 0.25 0.25 0.25
+atgtt 0.25 0.25 0.25
+attaa 0.25 0.25 0.25
+attac 0.25 0.25 0.25
+attag 0.25 0.25 0.25
+attat 0.25 0.25 0.25
+attca 0.25 0.25 0.25
+attcc 0.25 0.25 0.25
+attcg 0.25 0.25 0.25
+attct 0.25 0.25 0.25
+attga 0.25 0.25 0.25
+attgc 0.25 0.25 0.25
+attgg 0.25 0.25 0.25
+attgt 0.25 0.25 0.25
+attta 0.25 0.25 0.25
+atttc 0.25 0.25 0.25
+atttg 0.25 0.25 0.25
+atttt 0.25 0.25 0.25
+caaaa 0.25 0.25 0.25
+caaac 0.25 0.25 0.25
+caaag 0.25 0.25 0.25
+caaat 0.25 0.25 0.25
+caaca 0.25 0.25 0.25
+caacc 0.25 0.25 0.25
+caacg 0.25 0.25 0.25
+caact 0.25 0.25 0.25
+caaga 0.25 0.25 0.25
+caagc 0.25 0.25 0.25
+caagg 0.25 0.25 0.25
+caagt 0.25 0.25 0.25
+caata 0.25 0.25 0.25
+caatc 0.25 0.25 0.25
+caatg 0.25 0.25 0.25
+caatt 0.25 0.25 0.25
+cacaa 0.25 0.25 0.25
+cacac 0.25 0.25 0.25
+cacag 0.25 0.25 0.25
+cacat 0.25 0.25 0.25
+cacca 0.25 0.25 0.25
+caccc 0.25 0.25 0.25
+caccg 0.25 0.25 0.25
+cacct 0.25 0.25 0.25
+cacga 0.25 0.25 0.25
+cacgc 0.25 0.25 0.25
+cacgg 0.25 0.25 0.25
+cacgt 0.25 0.25 0.25
+cacta 0.25 0.25 0.25
+cactc 0.25 0.25 0.25
+cactg 0.25 0.25 0.25
+cactt 0.25 0.25 0.25
+cagaa 0.25 0.25 0.25
+cagac 0.25 0.25 0.25
+cagag 0.25 0.25 0.25
+cagat 0.25 0.25 0.25
+cagca 0.25 0.25 0.25
+cagcc 0.25 0.25 0.25
+cagcg 0.25 0.25 0.25
+cagct 0.25 0.25 0.25
+cagga 0.25 0.25 0.25
+caggc 0.25 0.25 0.25
+caggg 0.25 0.25 0.25
+caggt 0.25 0.25 0.25
+cagta 0.25 0.25 0.25
+cagtc 0.25 0.25 0.25
+cagtg 0.25 0.25 0.25
+cagtt 0.25 0.25 0.25
+cataa 0.25 0.25 0.25
+catac 0.25 0.25 0.25
+catag 0.25 0.25 0.25
+catat 0.25 0.25 0.25
+catca 0.25 0.25 0.25
+catcc 0.25 0.25 0.25
+catcg 0.25 0.25 0.25
+catct 0.25 0.25 0.25
+catga 0.25 0.25 0.25
+catgc 0.25 0.25 0.25
+catgg 0.25 0.25 0.25
+catgt 0.25 0.25 0.25
+catta 0.25 0.25 0.25
+cattc 0.25 0.25 0.25
+cattg 0.25 0.25 0.25
+cattt 0.25 0.25 0.25
+ccaaa 0.25 0.25 0.25
+ccaac 0.25 0.25 0.25
+ccaag 0.25 0.25 0.25
+ccaat 0.25 0.25 0.25
+ccaca 0.25 0.25 0.25
+ccacc 0.25 0.25 0.25
+ccacg 0.25 0.25 0.25
+ccact 0.25 0.25 0.25
+ccaga 0.25 0.25 0.25
+ccagc 0.25 0.25 0.25
+ccagg 0.25 0.25 0.25
+ccagt 0.25 0.25 0.25
+ccata 0.25 0.25 0.25
+ccatc 0.25 0.25 0.25
+ccatg 0.25 0.25 0.25
+ccatt 0.25 0.25 0.25
+cccaa 0.25 0.25 0.25
+cccac 0.25 0.25 0.25
+cccag 0.25 0.25 0.25
+cccat 0.25 0.25 0.25
+cccca 0.25 0.25 0.25
+ccccc 0.25 0.25 0.25
+ccccg 0.25 0.25 0.25
+cccct 0.25 0.25 0.25
+cccga 0.25 0.25 0.25
+cccgc 0.25 0.25 0.25
+cccgg 0.25 0.25 0.25
+cccgt 0.25 0.25 0.25
+cccta 0.25 0.25 0.25
+ccctc 0.25 0.25 0.25
+ccctg 0.25 0.25 0.25
+ccctt 0.25 0.25 0.25
+ccgaa 0.25 0.25 0.25
+ccgac 0.25 0.25 0.25
+ccgag 0.25 0.25 0.25
+ccgat 0.25 0.25 0.25
+ccgca 0.25 0.25 0.25
+ccgcc 0.25 0.25 0.25
+ccgcg 0.25 0.25 0.25
+ccgct 0.25 0.25 0.25
+ccgga 0.25 0.25 0.25
+ccggc 0.25 0.25 0.25
+ccggg 0.25 0.25 0.25
+ccggt 0.25 0.25 0.25
+ccgta 0.25 0.25 0.25
+ccgtc 0.25 0.25 0.25
+ccgtg 0.25 0.25 0.25
+ccgtt 0.25 0.25 0.25
+cctaa 0.25 0.25 0.25
+cctac 0.25 0.25 0.25
+cctag 0.25 0.25 0.25
+cctat 0.25 0.25 0.25
+cctca 0.25 0.25 0.25
+cctcc 0.25 0.25 0.25
+cctcg 0.25 0.25 0.25
+cctct 0.25 0.25 0.25
+cctga 0.25 0.25 0.25
+cctgc 0.25 0.25 0.25
+cctgg 0.25 0.25 0.25
+cctgt 0.25 0.25 0.25
+cctta 0.25 0.25 0.25
+ccttc 0.25 0.25 0.25
+ccttg 0.25 0.25 0.25
+ccttt 0.25 0.25 0.25
+cgaaa 0.25 0.25 0.25
+cgaac 0.25 0.25 0.25
+cgaag 0.25 0.25 0.25
+cgaat 0.25 0.25 0.25
+cgaca 0.25 0.25 0.25
+cgacc 0.25 0.25 0.25
+cgacg 0.25 0.25 0.25
+cgact 0.25 0.25 0.25
+cgaga 0.25 0.25 0.25
+cgagc 0.25 0.25 0.25
+cgagg 0.25 0.25 0.25
+cgagt 0.25 0.25 0.25
+cgata 0.25 0.25 0.25
+cgatc 0.25 0.25 0.25
+cgatg 0.25 0.25 0.25
+cgatt 0.25 0.25 0.25
+cgcaa 0.25 0.25 0.25
+cgcac 0.25 0.25 0.25
+cgcag 0.25 0.25 0.25
+cgcat 0.25 0.25 0.25
+cgcca 0.25 0.25 0.25
+cgccc 0.25 0.25 0.25
+cgccg 0.25 0.25 0.25
+cgcct 0.25 0.25 0.25
+cgcga 0.25 0.25 0.25
+cgcgc 0.25 0.25 0.25
+cgcgg 0.25 0.25 0.25
+cgcgt 0.25 0.25 0.25
+cgcta 0.25 0.25 0.25
+cgctc 0.25 0.25 0.25
+cgctg 0.25 0.25 0.25
+cgctt 0.25 0.25 0.25
+cggaa 0.25 0.25 0.25
+cggac 0.25 0.25 0.25
+cggag 0.25 0.25 0.25
+cggat 0.25 0.25 0.25
+cggca 0.25 0.25 0.25
+cggcc 0.25 0.25 0.25
+cggcg 0.25 0.25 0.25
+cggct 0.25 0.25 0.25
+cggga 0.25 0.25 0.25
+cgggc 0.25 0.25 0.25
+cgggg 0.25 0.25 0.25
+cgggt 0.25 0.25 0.25
+cggta 0.25 0.25 0.25
+cggtc 0.25 0.25 0.25
+cggtg 0.25 0.25 0.25
+cggtt 0.25 0.25 0.25
+cgtaa 0.25 0.25 0.25
+cgtac 0.25 0.25 0.25
+cgtag 0.25 0.25 0.25
+cgtat 0.25 0.25 0.25
+cgtca 0.25 0.25 0.25
+cgtcc 0.25 0.25 0.25
+cgtcg 0.25 0.25 0.25
+cgtct 0.25 0.25 0.25
+cgtga 0.25 0.25 0.25
+cgtgc 0.25 0.25 0.25
+cgtgg 0.25 0.25 0.25
+cgtgt 0.25 0.25 0.25
+cgtta 0.25 0.25 0.25
+cgttc 0.25 0.25 0.25
+cgttg 0.25 0.25 0.25
+cgttt 0.25 0.25 0.25
+ctaaa 0.25 0.25 0.25
+ctaac 0.25 0.25 0.25
+ctaag 0.25 0.25 0.25
+ctaat 0.25 0.25 0.25
+ctaca 0.25 0.25 0.25
+ctacc 0.25 0.25 0.25
+ctacg 0.25 0.25 0.25
+ctact 0.25 0.25 0.25
+ctaga 0.25 0.25 0.25
+ctagc 0.25 0.25 0.25
+ctagg 0.25 0.25 0.25
+ctagt 0.25 0.25 0.25
+ctata 0.25 0.25 0.25
+ctatc 0.25 0.25 0.25
+ctatg 0.25 0.25 0.25
+ctatt 0.25 0.25 0.25
+ctcaa 0.25 0.25 0.25
+ctcac 0.25 0.25 0.25
+ctcag 0.25 0.25 0.25
+ctcat 0.25 0.25 0.25
+ctcca 0.25 0.25 0.25
+ctccc 0.25 0.25 0.25
+ctccg 0.25 0.25 0.25
+ctcct 0.25 0.25 0.25
+ctcga 0.25 0.25 0.25
+ctcgc 0.25 0.25 0.25
+ctcgg 0.25 0.25 0.25
+ctcgt 0.25 0.25 0.25
+ctcta 0.25 0.25 0.25
+ctctc 0.25 0.25 0.25
+ctctg 0.25 0.25 0.25
+ctctt 0.25 0.25 0.25
+ctgaa 0.25 0.25 0.25
+ctgac 0.25 0.25 0.25
+ctgag 0.25 0.25 0.25
+ctgat 0.25 0.25 0.25
+ctgca 0.25 0.25 0.25
+ctgcc 0.25 0.25 0.25
+ctgcg 0.25 0.25 0.25
+ctgct 0.25 0.25 0.25
+ctgga 0.25 0.25 0.25
+ctggc 0.25 0.25 0.25
+ctggg 0.25 0.25 0.25
+ctggt 0.25 0.25 0.25
+ctgta 0.25 0.25 0.25
+ctgtc 0.25 0.25 0.25
+ctgtg 0.25 0.25 0.25
+ctgtt 0.25 0.25 0.25
+cttaa 0.25 0.25 0.25
+cttac 0.25 0.25 0.25
+cttag 0.25 0.25 0.25
+cttat 0.25 0.25 0.25
+cttca 0.25 0.25 0.25
+cttcc 0.25 0.25 0.25
+cttcg 0.25 0.25 0.25
+cttct 0.25 0.25 0.25
+cttga 0.25 0.25 0.25
+cttgc 0.25 0.25 0.25
+cttgg 0.25 0.25 0.25
+cttgt 0.25 0.25 0.25
+cttta 0.25 0.25 0.25
+ctttc 0.25 0.25 0.25
+ctttg 0.25 0.25 0.25
+ctttt 0.25 0.25 0.25
+gaaaa 0.25 0.25 0.25
+gaaac 0.25 0.25 0.25
+gaaag 0.25 0.25 0.25
+gaaat 0.25 0.25 0.25
+gaaca 0.25 0.25 0.25
+gaacc 0.25 0.25 0.25
+gaacg 0.25 0.25 0.25
+gaact 0.25 0.25 0.25
+gaaga 0.25 0.25 0.25
+gaagc 0.25 0.25 0.25
+gaagg 0.25 0.25 0.25
+gaagt 0.25 0.25 0.25
+gaata 0.25 0.25 0.25
+gaatc 0.25 0.25 0.25
+gaatg 0.25 0.25 0.25
+gaatt 0.25 0.25 0.25
+gacaa 0.25 0.25 0.25
+gacac 0.25 0.25 0.25
+gacag 0.25 0.25 0.25
+gacat 0.25 0.25 0.25
+gacca 0.25 0.25 0.25
+gaccc 0.25 0.25 0.25
+gaccg 0.25 0.25 0.25
+gacct 0.25 0.25 0.25
+gacga 0.25 0.25 0.25
+gacgc 0.25 0.25 0.25
+gacgg 0.25 0.25 0.25
+gacgt 0.25 0.25 0.25
+gacta 0.25 0.25 0.25
+gactc 0.25 0.25 0.25
+gactg 0.25 0.25 0.25
+gactt 0.25 0.25 0.25
+gagaa 0.25 0.25 0.25
+gagac 0.25 0.25 0.25
+gagag 0.25 0.25 0.25
+gagat 0.25 0.25 0.25
+gagca 0.25 0.25 0.25
+gagcc 0.25 0.25 0.25
+gagcg 0.25 0.25 0.25
+gagct 0.25 0.25 0.25
+gagga 0.25 0.25 0.25
+gaggc 0.25 0.25 0.25
+gaggg 0.25 0.25 0.25
+gaggt 0.25 0.25 0.25
+gagta 0.25 0.25 0.25
+gagtc 0.25 0.25 0.25
+gagtg 0.25 0.25 0.25
+gagtt 0.25 0.25 0.25
+gataa 0.25 0.25 0.25
+gatac 0.25 0.25 0.25
+gatag 0.25 0.25 0.25
+gatat 0.25 0.25 0.25
+gatca 0.25 0.25 0.25
+gatcc 0.25 0.25 0.25
+gatcg 0.25 0.25 0.25
+gatct 0.25 0.25 0.25
+gatga 0.25 0.25 0.25
+gatgc 0.25 0.25 0.25
+gatgg 0.25 0.25 0.25
+gatgt 0.25 0.25 0.25
+gatta 0.25 0.25 0.25
+gattc 0.25 0.25 0.25
+gattg 0.25 0.25 0.25
+gattt 0.25 0.25 0.25
+gcaaa 0.25 0.25 0.25
+gcaac 0.25 0.25 0.25
+gcaag 0.25 0.25 0.25
+gcaat 0.25 0.25 0.25
+gcaca 0.25 0.25 0.25
+gcacc 0.25 0.25 0.25
+gcacg 0.25 0.25 0.25
+gcact 0.25 0.25 0.25
+gcaga 0.25 0.25 0.25
+gcagc 0.25 0.25 0.25
+gcagg 0.25 0.25 0.25
+gcagt 0.25 0.25 0.25
+gcata 0.25 0.25 0.25
+gcatc 0.25 0.25 0.25
+gcatg 0.25 0.25 0.25
+gcatt 0.25 0.25 0.25
+gccaa 0.25 0.25 0.25
+gccac 0.25 0.25 0.25
+gccag 0.25 0.25 0.25
+gccat 0.25 0.25 0.25
+gccca 0.25 0.25 0.25
+gcccc 0.25 0.25 0.25
+gcccg 0.25 0.25 0.25
+gccct 0.25 0.25 0.25
+gccga 0.25 0.25 0.25
+gccgc 0.25 0.25 0.25
+gccgg 0.25 0.25 0.25
+gccgt 0.25 0.25 0.25
+gccta 0.25 0.25 0.25
+gcctc 0.25 0.25 0.25
+gcctg 0.25 0.25 0.25
+gcctt 0.25 0.25 0.25
+gcgaa 0.25 0.25 0.25
+gcgac 0.25 0.25 0.25
+gcgag 0.25 0.25 0.25
+gcgat 0.25 0.25 0.25
+gcgca 0.25 0.25 0.25
+gcgcc 0.25 0.25 0.25
+gcgcg 0.25 0.25 0.25
+gcgct 0.25 0.25 0.25
+gcgga 0.25 0.25 0.25
+gcggc 0.25 0.25 0.25
+gcggg 0.25 0.25 0.25
+gcggt 0.25 0.25 0.25
+gcgta 0.25 0.25 0.25
+gcgtc 0.25 0.25 0.25
+gcgtg 0.25 0.25 0.25
+gcgtt 0.25 0.25 0.25
+gctaa 0.25 0.25 0.25
+gctac 0.25 0.25 0.25
+gctag 0.25 0.25 0.25
+gctat 0.25 0.25 0.25
+gctca 0.25 0.25 0.25
+gctcc 0.25 0.25 0.25
+gctcg 0.25 0.25 0.25
+gctct 0.25 0.25 0.25
+gctga 0.25 0.25 0.25
+gctgc 0.25 0.25 0.25
+gctgg 0.25 0.25 0.25
+gctgt 0.25 0.25 0.25
+gctta 0.25 0.25 0.25
+gcttc 0.25 0.25 0.25
+gcttg 0.25 0.25 0.25
+gcttt 0.25 0.25 0.25
+ggaaa 0.25 0.25 0.25
+ggaac 0.25 0.25 0.25
+ggaag 0.25 0.25 0.25
+ggaat 0.25 0.25 0.25
+ggaca 0.25 0.25 0.25
+ggacc 0.25 0.25 0.25
+ggacg 0.25 0.25 0.25
+ggact 0.25 0.25 0.25
+ggaga 0.25 0.25 0.25
+ggagc 0.25 0.25 0.25
+ggagg 0.25 0.25 0.25
+ggagt 0.25 0.25 0.25
+ggata 0.25 0.25 0.25
+ggatc 0.25 0.25 0.25
+ggatg 0.25 0.25 0.25
+ggatt 0.25 0.25 0.25
+ggcaa 0.25 0.25 0.25
+ggcac 0.25 0.25 0.25
+ggcag 0.25 0.25 0.25
+ggcat 0.25 0.25 0.25
+ggcca 0.25 0.25 0.25
+ggccc 0.25 0.25 0.25
+ggccg 0.25 0.25 0.25
+ggcct 0.25 0.25 0.25
+ggcga 0.25 0.25 0.25
+ggcgc 0.25 0.25 0.25
+ggcgg 0.25 0.25 0.25
+ggcgt 0.25 0.25 0.25
+ggcta 0.25 0.25 0.25
+ggctc 0.25 0.25 0.25
+ggctg 0.25 0.25 0.25
+ggctt 0.25 0.25 0.25
+gggaa 0.25 0.25 0.25
+gggac 0.25 0.25 0.25
+gggag 0.25 0.25 0.25
+gggat 0.25 0.25 0.25
+gggca 0.25 0.25 0.25
+gggcc 0.25 0.25 0.25
+gggcg 0.25 0.25 0.25
+gggct 0.25 0.25 0.25
+gggga 0.25 0.25 0.25
+ggggc 0.25 0.25 0.25
+ggggg 0.25 0.25 0.25
+ggggt 0.25 0.25 0.25
+gggta 0.25 0.25 0.25
+gggtc 0.25 0.25 0.25
+gggtg 0.25 0.25 0.25
+gggtt 0.25 0.25 0.25
+ggtaa 0.25 0.25 0.25
+ggtac 0.25 0.25 0.25
+ggtag 0.25 0.25 0.25
+ggtat 0.25 0.25 0.25
+ggtca 0.25 0.25 0.25
+ggtcc 0.25 0.25 0.25
+ggtcg 0.25 0.25 0.25
+ggtct 0.25 0.25 0.25
+ggtga 0.25 0.25 0.25
+ggtgc 0.25 0.25 0.25
+ggtgg 0.25 0.25 0.25
+ggtgt 0.25 0.25 0.25
+ggtta 0.25 0.25 0.25
+ggttc 0.25 0.25 0.25
+ggttg 0.25 0.25 0.25
+ggttt 0.25 0.25 0.25
+gtaaa 0.25 0.25 0.25
+gtaac 0.25 0.25 0.25
+gtaag 0.25 0.25 0.25
+gtaat 0.25 0.25 0.25
+gtaca 0.25 0.25 0.25
+gtacc 0.25 0.25 0.25
+gtacg 0.25 0.25 0.25
+gtact 0.25 0.25 0.25
+gtaga 0.25 0.25 0.25
+gtagc 0.25 0.25 0.25
+gtagg 0.25 0.25 0.25
+gtagt 0.25 0.25 0.25
+gtata 0.25 0.25 0.25
+gtatc 0.25 0.25 0.25
+gtatg 0.25 0.25 0.25
+gtatt 0.25 0.25 0.25
+gtcaa 0.25 0.25 0.25
+gtcac 0.25 0.25 0.25
+gtcag 0.25 0.25 0.25
+gtcat 0.25 0.25 0.25
+gtcca 0.25 0.25 0.25
+gtccc 0.25 0.25 0.25
+gtccg 0.25 0.25 0.25
+gtcct 0.25 0.25 0.25
+gtcga 0.25 0.25 0.25
+gtcgc 0.25 0.25 0.25
+gtcgg 0.25 0.25 0.25
+gtcgt 0.25 0.25 0.25
+gtcta 0.25 0.25 0.25
+gtctc 0.25 0.25 0.25
+gtctg 0.25 0.25 0.25
+gtctt 0.25 0.25 0.25
+gtgaa 0.25 0.25 0.25
+gtgac 0.25 0.25 0.25
+gtgag 0.25 0.25 0.25
+gtgat 0.25 0.25 0.25
+gtgca 0.25 0.25 0.25
+gtgcc 0.25 0.25 0.25
+gtgcg 0.25 0.25 0.25
+gtgct 0.25 0.25 0.25
+gtgga 0.25 0.25 0.25
+gtggc 0.25 0.25 0.25
+gtggg 0.25 0.25 0.25
+gtggt 0.25 0.25 0.25
+gtgta 0.25 0.25 0.25
+gtgtc 0.25 0.25 0.25
+gtgtg 0.25 0.25 0.25
+gtgtt 0.25 0.25 0.25
+gttaa 0.25 0.25 0.25
+gttac 0.25 0.25 0.25
+gttag 0.25 0.25 0.25
+gttat 0.25 0.25 0.25
+gttca 0.25 0.25 0.25
+gttcc 0.25 0.25 0.25
+gttcg 0.25 0.25 0.25
+gttct 0.25 0.25 0.25
+gttga 0.25 0.25 0.25
+gttgc 0.25 0.25 0.25
+gttgg 0.25 0.25 0.25
+gttgt 0.25 0.25 0.25
+gttta 0.25 0.25 0.25
+gtttc 0.25 0.25 0.25
+gtttg 0.25 0.25 0.25
+gtttt 0.25 0.25 0.25
+taaaa 0.25 0.25 0.25
+taaac 0.25 0.25 0.25
+taaag 0.25 0.25 0.25
+taaat 0.25 0.25 0.25
+taaca 0.25 0.25 0.25
+taacc 0.25 0.25 0.25
+taacg 0.25 0.25 0.25
+taact 0.25 0.25 0.25
+taaga 0.25 0.25 0.25
+taagc 0.25 0.25 0.25
+taagg 0.25 0.25 0.25
+taagt 0.25 0.25 0.25
+taata 0.25 0.25 0.25
+taatc 0.25 0.25 0.25
+taatg 0.25 0.25 0.25
+taatt 0.25 0.25 0.25
+tacaa 0.25 0.25 0.25
+tacac 0.25 0.25 0.25
+tacag 0.25 0.25 0.25
+tacat 0.25 0.25 0.25
+tacca 0.25 0.25 0.25
+taccc 0.25 0.25 0.25
+taccg 0.25 0.25 0.25
+tacct 0.25 0.25 0.25
+tacga 0.25 0.25 0.25
+tacgc 0.25 0.25 0.25
+tacgg 0.25 0.25 0.25
+tacgt 0.25 0.25 0.25
+tacta 0.25 0.25 0.25
+tactc 0.25 0.25 0.25
+tactg 0.25 0.25 0.25
+tactt 0.25 0.25 0.25
+tagaa 0.25 0.25 0.25
+tagac 0.25 0.25 0.25
+tagag 0.25 0.25 0.25
+tagat 0.25 0.25 0.25
+tagca 0.25 0.25 0.25
+tagcc 0.25 0.25 0.25
+tagcg 0.25 0.25 0.25
+tagct 0.25 0.25 0.25
+tagga 0.25 0.25 0.25
+taggc 0.25 0.25 0.25
+taggg 0.25 0.25 0.25
+taggt 0.25 0.25 0.25
+tagta 0.25 0.25 0.25
+tagtc 0.25 0.25 0.25
+tagtg 0.25 0.25 0.25
+tagtt 0.25 0.25 0.25
+tataa 0.25 0.25 0.25
+tatac 0.25 0.25 0.25
+tatag 0.25 0.25 0.25
+tatat 0.25 0.25 0.25
+tatca 0.25 0.25 0.25
+tatcc 0.25 0.25 0.25
+tatcg 0.25 0.25 0.25
+tatct 0.25 0.25 0.25
+tatga 0.25 0.25 0.25
+tatgc 0.25 0.25 0.25
+tatgg 0.25 0.25 0.25
+tatgt 0.25 0.25 0.25
+tatta 0.25 0.25 0.25
+tattc 0.25 0.25 0.25
+tattg 0.25 0.25 0.25
+tattt 0.25 0.25 0.25
+tcaaa 0.25 0.25 0.25
+tcaac 0.25 0.25 0.25
+tcaag 0.25 0.25 0.25
+tcaat 0.25 0.25 0.25
+tcaca 0.25 0.25 0.25
+tcacc 0.25 0.25 0.25
+tcacg 0.25 0.25 0.25
+tcact 0.25 0.25 0.25
+tcaga 0.25 0.25 0.25
+tcagc 0.25 0.25 0.25
+tcagg 0.25 0.25 0.25
+tcagt 0.25 0.25 0.25
+tcata 0.25 0.25 0.25
+tcatc 0.25 0.25 0.25
+tcatg 0.25 0.25 0.25
+tcatt 0.25 0.25 0.25
+tccaa 0.25 0.25 0.25
+tccac 0.25 0.25 0.25
+tccag 0.25 0.25 0.25
+tccat 0.25 0.25 0.25
+tccca 0.25 0.25 0.25
+tcccc 0.25 0.25 0.25
+tcccg 0.25 0.25 0.25
+tccct 0.25 0.25 0.25
+tccga 0.25 0.25 0.25
+tccgc 0.25 0.25 0.25
+tccgg 0.25 0.25 0.25
+tccgt 0.25 0.25 0.25
+tccta 0.25 0.25 0.25
+tcctc 0.25 0.25 0.25
+tcctg 0.25 0.25 0.25
+tcctt 0.25 0.25 0.25
+tcgaa 0.25 0.25 0.25
+tcgac 0.25 0.25 0.25
+tcgag 0.25 0.25 0.25
+tcgat 0.25 0.25 0.25
+tcgca 0.25 0.25 0.25
+tcgcc 0.25 0.25 0.25
+tcgcg 0.25 0.25 0.25
+tcgct 0.25 0.25 0.25
+tcgga 0.25 0.25 0.25
+tcggc 0.25 0.25 0.25
+tcggg 0.25 0.25 0.25
+tcggt 0.25 0.25 0.25
+tcgta 0.25 0.25 0.25
+tcgtc 0.25 0.25 0.25
+tcgtg 0.25 0.25 0.25
+tcgtt 0.25 0.25 0.25
+tctaa 0.25 0.25 0.25
+tctac 0.25 0.25 0.25
+tctag 0.25 0.25 0.25
+tctat 0.25 0.25 0.25
+tctca 0.25 0.25 0.25
+tctcc 0.25 0.25 0.25
+tctcg 0.25 0.25 0.25
+tctct 0.25 0.25 0.25
+tctga 0.25 0.25 0.25
+tctgc 0.25 0.25 0.25
+tctgg 0.25 0.25 0.25
+tctgt 0.25 0.25 0.25
+tctta 0.25 0.25 0.25
+tcttc 0.25 0.25 0.25
+tcttg 0.25 0.25 0.25
+tcttt 0.25 0.25 0.25
+tgaaa 0.25 0.25 0.25
+tgaac 0.25 0.25 0.25
+tgaag 0.25 0.25 0.25
+tgaat 0.25 0.25 0.25
+tgaca 0.25 0.25 0.25
+tgacc 0.25 0.25 0.25
+tgacg 0.25 0.25 0.25
+tgact 0.25 0.25 0.25
+tgaga 0.25 0.25 0.25
+tgagc 0.25 0.25 0.25
+tgagg 0.25 0.25 0.25
+tgagt 0.25 0.25 0.25
+tgata 0.25 0.25 0.25
+tgatc 0.25 0.25 0.25
+tgatg 0.25 0.25 0.25
+tgatt 0.25 0.25 0.25
+tgcaa 0.25 0.25 0.25
+tgcac 0.25 0.25 0.25
+tgcag 0.25 0.25 0.25
+tgcat 0.25 0.25 0.25
+tgcca 0.25 0.25 0.25
+tgccc 0.25 0.25 0.25
+tgccg 0.25 0.25 0.25
+tgcct 0.25 0.25 0.25
+tgcga 0.25 0.25 0.25
+tgcgc 0.25 0.25 0.25
+tgcgg 0.25 0.25 0.25
+tgcgt 0.25 0.25 0.25
+tgcta 0.25 0.25 0.25
+tgctc 0.25 0.25 0.25
+tgctg 0.25 0.25 0.25
+tgctt 0.25 0.25 0.25
+tggaa 0.25 0.25 0.25
+tggac 0.25 0.25 0.25
+tggag 0.25 0.25 0.25
+tggat 0.25 0.25 0.25
+tggca 0.25 0.25 0.25
+tggcc 0.25 0.25 0.25
+tggcg 0.25 0.25 0.25
+tggct 0.25 0.25 0.25
+tggga 0.25 0.25 0.25
+tgggc 0.25 0.25 0.25
+tgggg 0.25 0.25 0.25
+tgggt 0.25 0.25 0.25
+tggta 0.25 0.25 0.25
+tggtc 0.25 0.25 0.25
+tggtg 0.25 0.25 0.25
+tggtt 0.25 0.25 0.25
+tgtaa 0.25 0.25 0.25
+tgtac 0.25 0.25 0.25
+tgtag 0.25 0.25 0.25
+tgtat 0.25 0.25 0.25
+tgtca 0.25 0.25 0.25
+tgtcc 0.25 0.25 0.25
+tgtcg 0.25 0.25 0.25
+tgtct 0.25 0.25 0.25
+tgtga 0.25 0.25 0.25
+tgtgc 0.25 0.25 0.25
+tgtgg 0.25 0.25 0.25
+tgtgt 0.25 0.25 0.25
+tgtta 0.25 0.25 0.25
+tgttc 0.25 0.25 0.25
+tgttg 0.25 0.25 0.25
+tgttt 0.25 0.25 0.25
+ttaaa 0.25 0.25 0.25
+ttaac 0.25 0.25 0.25
+ttaag 0.25 0.25 0.25
+ttaat 0.25 0.25 0.25
+ttaca 0.25 0.25 0.25
+ttacc 0.25 0.25 0.25
+ttacg 0.25 0.25 0.25
+ttact 0.25 0.25 0.25
+ttaga 0.25 0.25 0.25
+ttagc 0.25 0.25 0.25
+ttagg 0.25 0.25 0.25
+ttagt 0.25 0.25 0.25
+ttata 0.25 0.25 0.25
+ttatc 0.25 0.25 0.25
+ttatg 0.25 0.25 0.25
+ttatt 0.25 0.25 0.25
+ttcaa 0.25 0.25 0.25
+ttcac 0.25 0.25 0.25
+ttcag 0.25 0.25 0.25
+ttcat 0.25 0.25 0.25
+ttcca 0.25 0.25 0.25
+ttccc 0.25 0.25 0.25
+ttccg 0.25 0.25 0.25
+ttcct 0.25 0.25 0.25
+ttcga 0.25 0.25 0.25
+ttcgc 0.25 0.25 0.25
+ttcgg 0.25 0.25 0.25
+ttcgt 0.25 0.25 0.25
+ttcta 0.25 0.25 0.25
+ttctc 0.25 0.25 0.25
+ttctg 0.25 0.25 0.25
+ttctt 0.25 0.25 0.25
+ttgaa 0.25 0.25 0.25
+ttgac 0.25 0.25 0.25
+ttgag 0.25 0.25 0.25
+ttgat 0.25 0.25 0.25
+ttgca 0.25 0.25 0.25
+ttgcc 0.25 0.25 0.25
+ttgcg 0.25 0.25 0.25
+ttgct 0.25 0.25 0.25
+ttgga 0.25 0.25 0.25
+ttggc 0.25 0.25 0.25
+ttggg 0.25 0.25 0.25
+ttggt 0.25 0.25 0.25
+ttgta 0.25 0.25 0.25
+ttgtc 0.25 0.25 0.25
+ttgtg 0.25 0.25 0.25
+ttgtt 0.25 0.25 0.25
+tttaa 0.25 0.25 0.25
+tttac 0.25 0.25 0.25
+tttag 0.25 0.25 0.25
+tttat 0.25 0.25 0.25
+tttca 0.25 0.25 0.25
+tttcc 0.25 0.25 0.25
+tttcg 0.25 0.25 0.25
+tttct 0.25 0.25 0.25
+tttga 0.25 0.25 0.25
+tttgc 0.25 0.25 0.25
+tttgg 0.25 0.25 0.25
+tttgt 0.25 0.25 0.25
+tttta 0.25 0.25 0.25
+ttttc 0.25 0.25 0.25
+ttttg 0.25 0.25 0.25
+ttttt 0.25 0.25 0.25
+
+# data set number
+[2]
+# (a,c,g,t)= (0.258, 0.242, 0.242, 0.258)
+#
+# Probabilities file for the exon model
+#
+
+
+# Die P_l's
+[P_ls]
+# k = 4
+# l=
+0
+# Values
+a 0.229 0.296 0.11
+c 0.27 0.236 0.386
+g 0.348 0.198 0.376
+t 0.152 0.269 0.128
+# l=
+1
+# Values
+aa 0.0235 0.0777 0.032
+ac 0.0293 0.0514 0.107
+ag 0.0425 0.0402 0.124
+at 0.0156 0.0604 0.0309
+ca 0.116 0.0696 0.0385
+cc 0.0875 0.055 0.088
+cg 0.113 0.0552 0.0765
+ct 0.0662 0.0901 0.0337
+ga 0.0754 0.122 0.0252
+gc 0.12 0.0867 0.0926
+gg 0.13 0.0692 0.0523
+gt 0.0525 0.0706 0.0294
+ta 0.0149 0.0265 0.0142
+tc 0.0337 0.0432 0.0976
+tg 0.0625 0.0339 0.124
+tt 0.0181 0.0483 0.0341
+# l=
+2
+# Values
+aaa 0.00755 0.00905 0.0112
+aac 0.00718 0.00528 0.0238
+aag 0.0129 0.00438 0.0352
+aat 0.00433 0.00631 0.00663
+aca 0.0302 0.00863 0.0085
+acc 0.0275 0.00682 0.0179
+acg 0.0315 0.00676 0.0194
+act 0.0169 0.00836 0.00577
+aga 0.0308 0.0172 0.00527
+agc 0.0351 0.0117 0.0206
+agg 0.0413 0.00936 0.00893
+agt 0.0158 0.00758 0.00566
+ata 0.00339 0.00283 0.00393
+atc 0.00715 0.00516 0.0256
+atg 0.0155 0.00331 0.022
+att 0.00445 0.0057 0.00866
+caa 0.00706 0.0363 0.00753
+cac 0.0117 0.0257 0.0224
+cag 0.0138 0.0166 0.0337
+cat 0.00562 0.0321 0.00559
+cca 0.0289 0.0202 0.0101
+ccc 0.0159 0.0174 0.021
+ccg 0.028 0.0168 0.0164
+cct 0.0146 0.0298 0.0077
+cga 0.0109 0.0354 0.00667
+cgc 0.0267 0.026 0.026
+cgg 0.0262 0.0211 0.0146
+cgt 0.0125 0.0264 0.00794
+cta 0.00378 0.0117 0.00377
+ctc 0.0109 0.0189 0.0296
+ctg 0.0152 0.013 0.0491
+ctt 0.00457 0.0199 0.00781
+gaa 0.00527 0.0271 0.0132
+gac 0.00578 0.0167 0.0389
+gag 0.0116 0.0173 0.0547
+gat 0.00317 0.0184 0.0138
+gca 0.0257 0.0327 0.0137
+gcc 0.0219 0.0231 0.0338
+gcg 0.0276 0.0253 0.0261
+gct 0.0168 0.0422 0.0129
+gga 0.0119 0.0516 0.0132
+ggc 0.0182 0.0345 0.0301
+ggg 0.0176 0.0243 0.0169
+ggt 0.00625 0.0239 0.00921
+gta 0.00354 0.00919 0.00411
+gtc 0.00722 0.0144 0.0173
+gtg 0.0157 0.0141 0.0422
+gtt 0.00374 0.0166 0.00739
+taa 0.00363 0.00522 8.86e-05
+tac 0.00472 0.00365 0.0221
+tag 0.00422 0.00184 8.86e-05
+tat 0.00246 0.00359 0.00483
+tca 0.0308 0.00811 0.0063
+tcc 0.0221 0.00766 0.0153
+tcg 0.0261 0.00626 0.0146
+tct 0.0179 0.00985 0.00734
+tga 0.0217 0.0177 8.86e-05
+tgc 0.0398 0.0144 0.0158
+tgg 0.0444 0.0145 0.0119
+tgt 0.0179 0.0128 0.00658
+tta 0.00419 0.00274 0.00239
+ttc 0.0084 0.00476 0.0251
+ttg 0.0162 0.00351 0.0107
+ttt 0.00532 0.00614 0.0103
+# l=
+3
+# Values
+aaaa 0.00255 0.00302 0.00176
+aaac 0.00291 0.00182 0.00251
+aaag 0.00404 0.00148 0.00299
+aaat 0.00162 0.00266 0.00114
+aaca 0.00728 0.00251 0.000987
+aacc 0.00637 0.00188 0.0015
+aacg 0.00632 0.00162 0.00148
+aact 0.00368 0.00259 0.000909
+aaga 0.00947 0.00619 0.000945
+aagc 0.00935 0.00356 0.0017
+aagg 0.0112 0.00304 0.000926
+aagt 0.00484 0.00274 0.000979
+aata 0.000822 0.0012 0.000751
+aatc 0.00158 0.0016 0.00201
+aatg 0.00332 0.000964 0.00192
+aatt 0.000873 0.00146 0.00102
+acaa 0.00167 0.00952 0.00134
+acac 0.00245 0.00633 0.00226
+acag 0.00303 0.00456 0.0036
+acat 0.00124 0.00853 0.000897
+acca 0.00674 0.00632 0.00122
+accc 0.00322 0.00593 0.00243
+accg 0.00469 0.00495 0.00166
+acct 0.00305 0.00936 0.00105
+acga 0.00293 0.0108 0.001
+acgc 0.00632 0.007 0.00244
+acgg 0.00671 0.00544 0.00178
+acgt 0.0034 0.00705 0.00118
+acta 0.000935 0.0032 0.000534
+actc 0.00195 0.00432 0.00259
+actg 0.00262 0.00344 0.00356
+actt 0.00114 0.00529 0.00112
+agaa 0.00161 0.0139 0.00259
+agac 0.00145 0.00681 0.00422
+agag 0.00234 0.00725 0.00644
+agat 0.000619 0.00916 0.00238
+agca 0.00623 0.0122 0.00252
+agcc 0.00478 0.00704 0.00351
+agcg 0.00617 0.00853 0.00278
+agct 0.00309 0.0144 0.00196
+agga 0.00297 0.0211 0.00208
+aggc 0.00294 0.0119 0.00283
+aggg 0.00348 0.00807 0.00224
+aggt 0.00111 0.00855 0.0013
+agta 0.000844 0.0038 0.000558
+agtc 0.00154 0.00475 0.00154
+agtg 0.00336 0.00394 0.0035
+agtt 0.000776 0.00654 0.0013
+ataa 0.00121 0.0014 2.22e-05
+atac 0.000988 0.000806 0.00198
+atag 0.00125 0.000403 2.22e-05
+atat 0.000842 0.000941 0.000899
+atca 0.00728 0.00184 0.00113
+atcc 0.00688 0.00142 0.00139
+atcg 0.00758 0.00141 0.00122
+atct 0.00386 0.00222 0.00102
+atga 0.0049 0.00536 2.22e-05
+atgc 0.00555 0.00331 0.00109
+atgg 0.00801 0.00318 0.00125
+atgt 0.0034 0.00308 0.000954
+atta 0.00135 0.000835 0.000505
+attc 0.00211 0.00108 0.00202
+attg 0.00391 0.000716 0.00127
+attt 0.00124 0.00166 0.00137
+caaa 0.00177 0.00272 0.00453
+caac 0.00194 0.00144 0.0126
+caag 0.00297 0.00126 0.0178
+caat 0.000883 0.00134 0.0028
+caca 0.00624 0.00321 0.00404
+cacc 0.00582 0.00238 0.0106
+cacg 0.00665 0.00268 0.00966
+cact 0.00358 0.00293 0.00255
+caga 0.00813 0.00503 0.00171
+cagc 0.0113 0.00382 0.0104
+cagg 0.00996 0.00224 0.00305
+cagt 0.00412 0.0021 0.00221
+cata 0.000524 0.000647 0.00151
+catc 0.00181 0.0019 0.0159
+catg 0.00227 0.001 0.0117
+catt 0.000929 0.00185 0.00436
+ccaa 0.00173 0.00921 0.00186
+ccac 0.00323 0.00687 0.00799
+ccag 0.00351 0.00352 0.00974
+ccat 0.00144 0.00801 0.00156
+ccca 0.00676 0.00368 0.00334
+cccc 0.00396 0.00352 0.00702
+cccg 0.007 0.0027 0.00542
+ccct 0.00335 0.00538 0.00245
+ccga 0.00217 0.0085 0.00185
+ccgc 0.00635 0.0067 0.00932
+ccgg 0.00531 0.00504 0.00406
+ccgt 0.00254 0.00661 0.00237
+ccta 0.000609 0.00228 0.0012
+cctc 0.0026 0.0044 0.0112
+cctg 0.00342 0.00274 0.0164
+cctt 0.00102 0.0046 0.00232
+cgaa 0.00106 0.00229 0.00269
+cgac 0.00174 0.00295 0.0149
+cgag 0.0028 0.00288 0.0157
+cgat 0.000985 0.00239 0.00383
+cgca 0.00738 0.00613 0.00317
+cgcc 0.00578 0.00544 0.0126
+cgcg 0.00753 0.005 0.00766
+cgct 0.00528 0.00911 0.00363
+cgga 0.00241 0.00801 0.00351
+cggc 0.00657 0.0082 0.011
+cggg 0.00434 0.00501 0.00521
+cggt 0.00131 0.00405 0.00237
+cgta 0.000832 0.00199 0.00121
+cgtc 0.00203 0.0032 0.00818
+cgtg 0.00415 0.00358 0.016
+cgtt 0.000932 0.00327 0.00215
+ctaa 0.000856 0.00121 2.22e-05
+ctac 0.00186 0.000982 0.0105
+ctag 0.000951 0.000463 2.22e-05
+ctat 0.000471 0.000805 0.00162
+ctca 0.0103 0.00245 0.00223
+ctcc 0.00439 0.00275 0.00807
+ctcg 0.00863 0.00211 0.00673
+ctct 0.00606 0.00291 0.00273
+ctga 0.00723 0.00366 2.22e-05
+ctgc 0.0188 0.00416 0.00704
+ctgg 0.017 0.00335 0.00455
+ctgt 0.00619 0.0031 0.00203
+ctta 0.000914 0.000474 0.00055
+cttc 0.00235 0.00145 0.0129
+cttg 0.00313 0.000945 0.0039
+cttt 0.00141 0.0014 0.0035
+gaaa 0.00321 0.00201 0.00367
+gaac 0.00231 0.0013 0.00727
+gaag 0.00592 0.00118 0.0126
+gaat 0.0018 0.00147 0.00188
+gaca 0.0106 0.00171 0.00245
+gacc 0.00939 0.00162 0.00449
+gacg 0.0129 0.00157 0.00726
+gact 0.00603 0.00175 0.00186
+gaga 0.0132 0.00464 0.00229
+gagc 0.0144 0.00333 0.00772
+gagg 0.0201 0.00339 0.00452
+gagt 0.0068 0.00203 0.00207
+gata 0.00148 0.000663 0.0012
+gatc 0.00259 0.000883 0.00637
+gatg 0.00792 0.000875 0.00716
+gatt 0.00179 0.00148 0.00256
+gcaa 0.00234 0.00758 0.00274
+gcac 0.00403 0.00575 0.00938
+gcag 0.00547 0.00479 0.0174
+gcat 0.00176 0.00658 0.0021
+gcca 0.0104 0.00528 0.00369
+gccc 0.00554 0.00336 0.00877
+gccg 0.0123 0.00488 0.00751
+gcct 0.00512 0.00758 0.00266
+gcga 0.00393 0.00852 0.00283
+gcgc 0.0089 0.0058 0.0113
+gcgg 0.00901 0.00609 0.00723
+gcgt 0.00419 0.00627 0.00333
+gcta 0.00143 0.00273 0.0014
+gctc 0.00368 0.00481 0.0124
+gctg 0.00632 0.00401 0.0242
+gctt 0.00141 0.00452 0.00297
+ggaa 0.00258 0.00383 0.00467
+ggac 0.00257 0.00215 0.0137
+ggag 0.00639 0.00272 0.0261
+ggat 0.00155 0.00223 0.00501
+ggca 0.00824 0.00464 0.00475
+ggcc 0.00677 0.00361 0.012
+ggcg 0.00955 0.00371 0.0122
+ggct 0.00554 0.00504 0.00456
+ggga 0.00356 0.00604 0.00421
+gggc 0.00555 0.00386 0.0105
+gggg 0.00583 0.00366 0.00594
+gggt 0.00197 0.00286 0.00298
+ggta 0.00109 0.000999 0.00119
+ggtc 0.00201 0.00147 0.00422
+ggtg 0.00496 0.00159 0.0158
+ggtt 0.00118 0.00176 0.00198
+gtaa 0.000884 0.000979 2.22e-05
+gtac 0.0012 0.000912 0.00736
+gtag 0.00137 0.000545 2.22e-05
+gtat 0.000644 0.000814 0.0014
+gtca 0.00626 0.00169 0.00184
+gtcc 0.00313 0.00131 0.00409
+gtcg 0.00484 0.00138 0.00557
+gtct 0.00292 0.00233 0.00256
+gtga 0.00778 0.00382 2.22e-05
+gtgc 0.0126 0.00336 0.00627
+gtgg 0.0152 0.0045 0.00498
+gtgt 0.00659 0.00297 0.00255
+gtta 0.000845 0.000512 0.000617
+gttc 0.0021 0.000966 0.00787
+gttg 0.00299 0.000628 0.00353
+gttt 0.00137 0.00139 0.00401
+taaa 2.21e-05 0.00131 0.00124
+taac 2.21e-05 0.000714 0.00146
+taag 2.21e-05 0.000457 0.00178
+taat 2.21e-05 0.000845 0.00081
+taca 0.00603 0.00119 0.00102
+tacc 0.00597 0.00094 0.00128
+tacg 0.00571 0.000892 0.000999
+tact 0.00361 0.00108 0.000455
+taga 2.21e-05 0.00136 0.000326
+tagc 2.21e-05 0.00101 0.000828
+tagg 2.21e-05 0.00069 0.000437
+tagt 2.21e-05 0.000714 0.00041
+tata 0.000559 0.000324 0.000466
+tatc 0.00116 0.000771 0.0013
+tatg 0.00202 0.000472 0.00116
+tatt 0.000849 0.000906 0.000722
+tcaa 0.00131 0.01 0.00159
+tcac 0.00193 0.00678 0.00282
+tcag 0.00176 0.00374 0.00301
+tcat 0.00118 0.00895 0.00103
+tcca 0.00495 0.00492 0.0018
+tccc 0.00318 0.00461 0.00281
+tccg 0.00397 0.00431 0.00183
+tcct 0.00307 0.00746 0.00154
+tcga 0.00191 0.00761 0.000989
+tcgc 0.00513 0.00655 0.00298
+tcgg 0.0052 0.00451 0.00151
+tcgt 0.00238 0.00643 0.00106
+tcta 0.000798 0.00348 0.000642
+tctc 0.00267 0.00536 0.00342
+tctg 0.00283 0.00285 0.00494
+tctt 0.000997 0.0055 0.0014
+tgaa 2.21e-05 0.00714 0.0032
+tgac 2.21e-05 0.00482 0.00612
+tgag 2.21e-05 0.00448 0.00652
+tgat 2.21e-05 0.00462 0.00261
+tgca 0.00388 0.00969 0.00322
+tgcc 0.0046 0.00703 0.00566
+tgcg 0.0044 0.00805 0.00342
+tgct 0.00284 0.0136 0.00277
+tgga 0.00293 0.0164 0.00339
+tggc 0.00314 0.0105 0.00572
+tggg 0.00399 0.00754 0.00348
+tggt 0.00187 0.00839 0.00256
+tgta 0.000771 0.0024 0.00115
+tgtc 0.00165 0.005 0.00336
+tgtg 0.00318 0.00495 0.00691
+tgtt 0.000852 0.00499 0.00196
+ttaa 0.000683 0.00163 2.22e-05
+ttac 0.000673 0.00095 0.00231
+ttag 0.00065 0.000427 2.22e-05
+ttat 0.000502 0.00103 0.000909
+ttca 0.00702 0.00213 0.0011
+ttcc 0.00773 0.00218 0.0017
+ttcg 0.0051 0.00135 0.0011
+ttct 0.00508 0.00238 0.00103
+ttga 0.00182 0.0049 2.22e-05
+ttgc 0.00287 0.00359 0.00144
+ttgg 0.00421 0.00347 0.00116
+ttgt 0.00177 0.00367 0.00105
+ttta 0.00108 0.000921 0.00072
+tttc 0.00184 0.00126 0.00229
+tttg 0.00613 0.00122 0.00201
+tttt 0.0013 0.0017 0.00139
+# l=
+4
+# Values
+aaaaa 0.000287 0.000844 0.000639
+aaaac 0.000573 0.000492 0.000735
+aaaag 0.00058 0.000389 0.000851
+aaaat 0.000283 0.000679 0.000334
+aaaca 0.000811 0.000712 0.000299
+aaacc 0.00062 0.000647 0.000543
+aaacg 0.000545 0.000536 0.000429
+aaact 0.000534 0.000917 0.000265
+aaaga 0.000707 0.00145 0.000228
+aaagc 0.000883 0.000917 0.000439
+aaagg 0.000913 0.000697 0.000292
+aaagt 0.000504 0.000802 0.000291
+aaata 0.000151 0.00045 0.000326
+aaatc 0.000228 0.000503 0.000762
+aaatg 0.000537 0.000224 0.000794
+aaatt 0.000219 0.000412 0.00034
+aacaa 0.000204 0.00233 0.00046
+aacac 0.000258 0.00155 0.000586
+aacag 0.000354 0.00091 0.000858
+aacat 0.000162 0.00217 0.000178
+aacca 0.000617 0.00133 0.000329
+aaccc 0.000379 0.00144 0.000447
+aaccg 0.000249 0.00111 0.000454
+aacct 0.000233 0.00228 0.000338
+aacga 0.000305 0.00194 0.000212
+aacgc 0.000435 0.00141 0.000567
+aacgg 0.000472 0.00106 0.000367
+aacgt 0.000274 0.00164 0.000205
+aacta 0.00014 0.000731 0.000192
+aactc 0.000209 0.000885 0.000701
+aactg 0.000388 0.000672 0.000898
+aactt 0.00015 0.00125 0.000375
+aagaa 0.000255 0.00399 0.000912
+aagac 0.000188 0.00139 0.00139
+aagag 0.000339 0.00152 0.00199
+aagat 7.4e-05 0.00222 0.000892
+aagca 0.000493 0.00262 0.000571
+aagcc 0.00042 0.00167 0.00104
+aagcg 0.000258 0.00175 0.000802
+aagct 0.000312 0.0029 0.000573
+aagga 0.000189 0.00446 0.000532
+aaggc 0.000285 0.00251 0.000878
+aaggg 0.000248 0.00176 0.000642
+aaggt 7.63e-05 0.00205 0.000484
+aagta 0.000127 0.000943 0.00011
+aagtc 0.000224 0.00121 0.00048
+aagtg 0.000395 0.00085 0.00126
+aagtt 0.00012 0.00168 0.000445
+aataa 0.000239 0.000292 5.54e-06
+aatac 0.00016 0.000189 0.000679
+aatag 0.000202 0.000129 5.54e-06
+aatat 0.000111 0.000174 0.000307
+aatca 0.000645 0.000471 0.000289
+aatcc 0.000596 0.000303 0.000359
+aatcg 0.000517 0.000242 0.000397
+aatct 0.000304 0.000514 0.000291
+aatga 0.00057 0.00108 5.54e-06
+aatgc 0.0005 0.000771 0.000288
+aatgg 0.000619 0.000535 0.000272
+aatgt 0.000305 0.000793 0.00025
+aatta 0.000154 0.000218 0.000102
+aattc 0.000266 0.000228 0.000545
+aattg 0.000473 9.76e-05 0.000274
+aattt 0.000154 0.000286 0.000322
+acaaa 0.000305 0.000668 0.00135
+acaac 0.000456 0.000343 0.00328
+acaag 0.00041 0.000292 0.00454
+acaat 0.000155 0.00029 0.000772
+acaca 0.000722 0.000772 0.00103
+acacc 0.000481 0.000486 0.0021
+acacg 0.000681 0.000489 0.00293
+acact 0.000349 0.000606 0.000574
+acaga 0.00113 0.00109 0.000596
+acagc 0.00115 0.000754 0.00283
+acagg 0.000954 0.000479 0.000831
+acagt 0.000307 0.000567 0.000514
+acata 0.000157 0.00019 0.000473
+acatc 0.000233 0.00042 0.00411
+acatg 0.000342 0.000208 0.00298
+acatt 0.000155 0.000417 0.00138
+accaa 0.000285 0.00224 0.000577
+accac 0.000347 0.00168 0.00254
+accag 0.000366 0.000703 0.00312
+accat 0.000172 0.00187 0.000394
+accca 0.000774 0.000766 0.00124
+acccc 0.000516 0.000712 0.00226
+acccg 0.000682 0.000441 0.00203
+accct 0.00047 0.0012 0.000711
+accga 0.000245 0.00151 0.000491
+accgc 0.000555 0.000987 0.0029
+accgg 0.000531 0.000701 0.00115
+accgt 0.000304 0.00129 0.000659
+accta 0.000153 0.00049 0.000354
+acctc 0.000347 0.000832 0.00319
+acctg 0.000399 0.000522 0.00565
+acctt 0.000153 0.00111 0.000631
+acgaa 0.000167 0.000773 0.000897
+acgac 0.000328 0.00079 0.0044
+acgag 0.000324 0.000628 0.00473
+acgat 0.00013 0.000621 0.00132
+acgca 0.000818 0.00149 0.00106
+acgcc 0.000523 0.00107 0.00294
+acgcg 0.000653 0.00134 0.00237
+acgct 0.000438 0.00216 0.000929
+acgga 0.000315 0.00222 0.000871
+acggc 0.000832 0.00162 0.00266
+acggg 0.000503 0.00149 0.00158
+acggt 0.000133 0.00115 0.000612
+acgta 0.000151 0.000533 0.000338
+acgtc 0.000282 0.00081 0.00188
+acgtg 0.000645 0.00108 0.00457
+acgtt 0.000119 0.000829 0.000584
+actaa 0.00021 0.000224 5.54e-06
+actac 0.00041 0.000266 0.00283
+actag 0.000205 6.58e-05 5.54e-06
+actat 0.000103 0.000166 0.000486
+actca 0.00095 0.000385 0.000506
+actcc 0.000356 0.000423 0.00136
+actcg 0.00078 0.000352 0.00202
+actct 0.000464 0.000489 0.000656
+actga 0.000676 0.000501 5.54e-06
+actgc 0.0012 0.000633 0.00196
+actgg 0.00127 0.000465 0.00122
+actgt 0.00042 0.000561 0.000434
+actta 0.000177 0.000104 0.000144
+acttc 0.000315 0.00029 0.00308
+acttg 0.000389 0.000209 0.00114
+acttt 0.000241 0.000324 0.0012
+agaaa 0.000632 0.000436 0.0016
+agaac 0.00047 0.000226 0.00288
+agaag 0.00115 0.000342 0.00624
+agaat 0.000306 0.000288 0.000823
+agaca 0.0012 0.000331 0.000866
+agacc 0.0009 0.00034 0.00156
+agacg 0.00133 0.000291 0.00264
+agact 0.000758 0.000181 0.00063
+agaga 0.00189 0.000778 0.00089
+agagc 0.00143 0.00047 0.00276
+agagg 0.0023 0.000379 0.00175
+agagt 0.000807 0.000268 0.000651
+agata 0.000336 0.000125 0.000373
+agatc 0.000464 0.000167 0.00305
+agatg 0.00128 0.000165 0.00314
+agatt 0.000286 0.000283 0.00109
+agcaa 0.000462 0.00187 0.000887
+agcac 0.000611 0.00113 0.00267
+agcag 0.00112 0.00137 0.00596
+agcat 0.000334 0.0016 0.000697
+agcca 0.00118 0.00122 0.00111
+agccc 0.000705 0.000786 0.0022
+agccg 0.00105 0.000886 0.00186
+agcct 0.000563 0.00169 0.000725
+agcga 0.000563 0.00215 0.00102
+agcgc 0.0008 0.00117 0.0031
+agcgg 0.00095 0.00128 0.00225
+agcgt 0.000442 0.00133 0.00076
+agcta 0.000279 0.00047 0.000411
+agctc 0.000503 0.000906 0.00327
+agctg 0.000963 0.000747 0.00731
+agctt 0.00021 0.000842 0.00104
+aggaa 0.000443 0.000892 0.00174
+aggac 0.000384 0.00045 0.00424
+aggag 0.00107 0.000532 0.00981
+aggat 0.00016 0.000521 0.00182
+aggca 0.000857 0.000729 0.00153
+aggcc 0.000682 0.000493 0.00351
+aggcg 0.00086 0.000436 0.00359
+aggct 0.000406 0.000712 0.0013
+aggga 0.000598 0.00108 0.00101
+agggc 0.00064 0.000664 0.00318
+agggg 0.000769 0.000566 0.00171
+agggt 0.000265 0.00045 0.000835
+aggta 0.00018 0.000156 0.000415
+aggtc 0.00026 0.000196 0.0013
+aggtg 0.000676 0.000222 0.00463
+aggtt 0.000191 0.000303 0.000822
+agtaa 0.000118 0.000311 5.54e-06
+agtac 0.000188 0.000179 0.00262
+agtag 0.000189 9.02e-05 5.54e-06
+agtat 5.86e-05 0.000121 0.000537
+agtca 0.000475 0.000302 0.000515
+agtcc 0.00037 0.000312 0.00102
+agtcg 0.000375 0.000255 0.00171
+agtct 0.000283 0.000368 0.00071
+agtga 0.000963 0.000944 5.54e-06
+agtgc 0.000775 0.000588 0.00159
+agtgg 0.00124 0.000806 0.00117
+agtgt 0.000512 0.000408 0.000523
+agtta 0.000127 6.47e-05 0.000164
+agttc 0.000339 0.000242 0.0029
+agttg 0.000622 6.58e-05 0.00109
+agttt 0.000208 0.000265 0.00132
+ataaa 5.53e-06 0.000423 0.000358
+ataac 5.53e-06 0.000189 0.000312
+ataag 5.53e-06 0.000129 0.00041
+ataat 5.53e-06 0.000266 0.00021
+ataca 0.000514 0.000335 0.000197
+atacc 0.000437 0.000155 0.000213
+atacg 0.000408 0.000156 0.000286
+atact 0.000321 0.000182 0.000104
+ataga 5.53e-06 0.00048 8.09e-05
+atagc 5.53e-06 0.00026 0.000195
+atagg 5.53e-06 0.000109 9.86e-05
+atagt 5.53e-06 0.000237 0.000101
+atata 9.95e-05 9.55e-05 0.000106
+atatc 0.000211 0.000233 0.000337
+atatg 0.000272 0.000126 0.000288
+atatt 0.000168 0.000293 0.000158
+atcaa 0.000187 0.00252 0.000353
+atcac 0.000295 0.00153 0.00062
+atcag 0.000347 0.000897 0.000707
+atcat 0.000241 0.00204 0.000229
+atcca 0.000476 0.00155 0.000394
+atccc 0.000358 0.00133 0.000494
+atccg 0.00022 0.00143 0.000297
+atcct 0.000326 0.00229 0.00031
+atcga 0.000249 0.00248 0.000226
+atcgc 0.000375 0.00192 0.00061
+atcgg 0.000422 0.00117 0.000384
+atcgt 0.00017 0.00171 0.000262
+atcta 0.000134 0.000752 0.000148
+atctc 0.000317 0.00101 0.000768
+atctg 0.00036 0.000689 0.00115
+atctt 0.000202 0.00126 0.000296
+atgaa 5.53e-06 0.00166 0.00106
+atgac 5.53e-06 0.00095 0.00185
+atgag 5.53e-06 0.000864 0.00187
+atgat 5.53e-06 0.0012 0.000835
+atgca 0.000302 0.0014 0.000647
+atgcc 0.000364 0.000789 0.00143
+atgcg 0.000147 0.00105 0.000762
+atgct 0.000143 0.00214 0.000628
+atgga 0.000378 0.00311 0.000724
+atggc 0.00026 0.00193 0.00141
+atggg 0.000387 0.00119 0.000783
+atggt 0.000165 0.00152 0.000394
+atgta 0.000123 0.000474 0.000274
+atgtc 0.000175 0.000827 0.00079
+atgtg 0.000429 0.000747 0.00169
+atgtt 0.000138 0.00121 0.000482
+attaa 0.00017 0.000624 5.54e-06
+attac 0.00015 0.000205 0.000567
+attag 0.000147 9.12e-05 5.54e-06
+attat 0.000127 0.000384 0.000301
+attca 0.000676 0.000508 0.000182
+attcc 0.000537 0.000577 0.000441
+attcg 0.000316 0.000415 0.000243
+attct 0.000494 0.000491 0.000262
+attga 0.000223 0.00125 5.54e-06
+attgc 0.000314 0.000859 0.000294
+attgg 0.000465 0.000831 0.000255
+attgt 0.000263 0.000832 0.000203
+attta 0.000169 0.000233 0.00019
+atttc 0.000281 0.000312 0.000587
+atttg 0.000768 0.000277 0.000528
+atttt 0.000207 0.000354 0.000428
+caaaa 0.00102 0.0005 0.000515
+caaac 0.00119 0.000334 0.000816
+caaag 0.00167 0.000317 0.00109
+caaat 0.000602 0.000544 0.000373
+caaca 0.004 0.000629 0.000298
+caacc 0.00317 0.000447 0.000473
+caacg 0.00338 0.000319 0.000451
+caact 0.00185 0.000457 0.000281
+caaga 0.00455 0.00102 0.000267
+caagc 0.00463 0.000664 0.000534
+caagg 0.00578 0.000592 0.000205
+caagt 0.00261 0.00057 0.00032
+caata 0.000295 0.000156 0.000175
+caatc 0.000635 0.000321 0.000505
+caatg 0.0016 0.000175 0.000463
+caatt 0.00026 0.00019 0.000255
+cacaa 0.000882 0.00206 0.000522
+cacac 0.00114 0.00126 0.000878
+cacag 0.00138 0.001 0.00163
+cacat 0.000563 0.00165 0.000318
+cacca 0.00425 0.00155 0.000474
+caccc 0.00145 0.00119 0.000969
+caccg 0.00291 0.00111 0.000663
+cacct 0.00188 0.00177 0.000375
+cacga 0.00137 0.00186 0.000397
+cacgc 0.00315 0.00163 0.00102
+cacgg 0.00329 0.00128 0.000796
+cacgt 0.0018 0.00165 0.000548
+cacta 0.000435 0.000664 0.00019
+cactc 0.000761 0.000953 0.000947
+cactg 0.000939 0.000821 0.00146
+cactt 0.000365 0.00102 0.000423
+cagaa 0.000402 0.0027 0.000855
+cagac 0.000433 0.00143 0.00127
+cagag 0.000628 0.00156 0.00235
+cagat 0.000214 0.00211 0.000719
+cagca 0.00358 0.00376 0.00111
+cagcc 0.00213 0.00168 0.00127
+cagcg 0.00313 0.00202 0.000866
+cagct 0.00145 0.00343 0.000734
+cagga 0.000924 0.00348 0.00061
+caggc 0.000763 0.00271 0.000802
+caggg 0.00107 0.00173 0.000604
+caggt 0.000287 0.00162 0.000326
+cagta 0.000282 0.000804 0.000203
+cagtc 0.000506 0.000949 0.000574
+cagtg 0.00117 0.000882 0.00106
+cagtt 0.000252 0.00131 0.000343
+cataa 0.000368 0.000311 5.54e-06
+catac 0.000328 0.00019 0.000459
+catag 0.000422 9.76e-05 5.54e-06
+catat 0.000334 0.000211 0.000215
+catca 0.00481 0.000466 0.000501
+catcc 0.0039 0.000283 0.00057
+catcg 0.00474 0.000394 0.000477
+catct 0.0024 0.000589 0.00045
+catga 0.00237 0.000661 5.54e-06
+catgc 0.00295 0.000506 0.000371
+catgg 0.00437 0.00049 0.000362
+catgt 0.00192 0.000523 0.000303
+catta 0.000712 0.000112 0.000183
+cattc 0.00104 0.000234 0.00074
+cattg 0.00205 0.000227 0.000538
+cattt 0.000537 0.000329 0.000472
+ccaaa 0.000529 0.000638 0.00105
+ccaac 0.000407 0.000408 0.00328
+ccaag 0.000746 0.000321 0.00456
+ccaat 0.000206 0.000303 0.00067
+ccaca 0.00214 0.000764 0.000999
+ccacc 0.0022 0.00097 0.00327
+ccacg 0.0022 0.000694 0.00224
+ccact 0.00139 0.000705 0.000673
+ccaga 0.00231 0.00147 0.000284
+ccagc 0.003 0.00087 0.0022
+ccagg 0.00319 0.000554 0.000686
+ccagt 0.00122 0.000483 0.000503
+ccata 0.00016 0.000188 0.000377
+ccatc 0.000437 0.0004 0.00413
+ccatg 0.000731 0.000296 0.003
+ccatt 0.000213 0.000494 0.000852
+cccaa 0.00045 0.00219 0.00036
+cccac 0.0011 0.00166 0.00128
+cccag 0.00131 0.00105 0.00185
+cccat 0.000429 0.00155 0.000323
+cccca 0.00232 0.000762 0.000553
+ccccc 0.00131 0.00119 0.00144
+ccccg 0.00253 0.000701 0.00123
+cccct 0.000871 0.00112 0.000442
+cccga 0.000802 0.00236 0.000305
+cccgc 0.00197 0.00145 0.00115
+cccgg 0.00189 0.00137 0.000837
+cccgt 0.000734 0.00154 0.000505
+cccta 0.000167 0.000415 0.000243
+ccctc 0.000848 0.00103 0.00207
+ccctg 0.00107 0.000755 0.00283
+ccctt 0.000319 0.00102 0.000492
+ccgaa 0.000417 0.000383 0.000537
+ccgac 0.000403 0.000611 0.0037
+ccgag 0.000763 0.000598 0.00378
+ccgat 0.00026 0.000495 0.000886
+ccgca 0.00264 0.00136 0.000755
+ccgcc 0.00224 0.00173 0.00343
+ccgcg 0.00267 0.00107 0.00189
+ccgct 0.00174 0.00193 0.000892
+ccgga 0.000552 0.00156 0.000852
+ccggc 0.00198 0.00175 0.00258
+ccggg 0.00123 0.00103 0.00132
+ccggt 0.000311 0.000735 0.00054
+ccgta 0.000252 0.00043 0.000275
+ccgtc 0.000501 0.000616 0.00214
+ccgtg 0.00128 0.000688 0.00394
+ccgtt 0.000323 0.000729 0.000527
+cctaa 0.000228 0.000194 5.54e-06
+cctac 0.000566 0.000174 0.00203
+cctag 0.000273 0.000105 5.54e-06
+cctat 9.17e-05 0.00011 0.00031
+cctca 0.00379 0.000501 0.000486
+cctcc 0.00184 0.000877 0.00219
+cctcg 0.00302 0.000438 0.00127
+cctct 0.00245 0.000665 0.000632
+cctga 0.00221 0.000892 5.54e-06
+cctgc 0.00608 0.00086 0.00148
+cctgg 0.00629 0.000876 0.00102
+cctgt 0.00183 0.000656 0.00035
+cctta 0.000288 0.000124 0.000141
+ccttc 0.000663 0.000384 0.00304
+ccttg 0.000931 0.000215 0.000985
+ccttt 0.00043 0.000268 0.000639
+cgaaa 0.000497 0.000291 0.000325
+cgaac 0.000612 0.000251 0.000858
+cgaag 0.00121 0.000142 0.001
+cgaat 0.000386 0.00032 0.000203
+cgaca 0.00362 0.000444 0.000468
+cgacc 0.00371 0.000308 0.000914
+cgacg 0.00506 0.000412 0.00137
+cgact 0.00251 0.000511 0.000294
+cgaga 0.00327 0.000966 0.000308
+cgagc 0.00421 0.000715 0.00156
+cgagg 0.00581 0.000523 0.000744
+cgagt 0.00225 0.000497 0.000395
+cgata 0.000327 0.000129 0.000236
+cgatc 0.000722 0.000207 0.00083
+cgatg 0.00214 0.000237 0.00103
+cgatt 0.000603 0.000364 0.000383
+cgcaa 0.000548 0.0024 0.000546
+cgcac 0.00118 0.00182 0.00238
+cgcag 0.00115 0.00111 0.00319
+cgcat 0.000264 0.00178 0.000321
+cgcca 0.0038 0.00153 0.000813
+cgccc 0.00195 0.000792 0.00213
+cgccg 0.00494 0.00144 0.00219
+cgcct 0.00179 0.00182 0.000565
+cgcga 0.000881 0.00245 0.000595
+cgcgc 0.00281 0.00184 0.00235
+cgcgg 0.00247 0.00125 0.00159
+cgcgt 0.00147 0.00177 0.000679
+cgcta 0.000438 0.000912 0.000344
+cgctc 0.00116 0.00144 0.003
+cgctg 0.00159 0.00131 0.00553
+cgctt 0.000422 0.00141 0.000636
+cggaa 0.00051 0.000754 0.000681
+cggac 0.000771 0.000434 0.00252
+cggag 0.00182 0.000709 0.00436
+cggat 0.000397 0.000418 0.000823
+cggca 0.00281 0.00172 0.000929
+cggcc 0.00223 0.00136 0.00299
+cggcg 0.00396 0.00156 0.00357
+cggct 0.00201 0.00168 0.00107
+cggga 0.000873 0.00171 0.00095
+cgggc 0.00179 0.00094 0.00225
+cgggg 0.00199 0.000946 0.00149
+cgggt 0.000575 0.000639 0.000557
+cggta 0.000254 0.000151 0.000167
+cggtc 0.000445 0.000384 0.000809
+cggtg 0.00134 0.000373 0.00304
+cggtt 0.000337 0.00033 0.000238
+cgtaa 0.000229 0.000218 5.54e-06
+cgtac 0.000353 0.000225 0.0018
+cgtag 0.000484 0.000124 5.54e-06
+cgtat 0.000134 0.000209 0.000259
+cgtca 0.00307 0.000482 0.000333
+cgtcc 0.0012 0.000323 0.000954
+cgtcg 0.0025 0.000361 0.00151
+cgtct 0.00138 0.000792 0.000545
+cgtga 0.00244 0.000964 5.54e-06
+cgtgc 0.00501 0.00103 0.00158
+cgtgg 0.00571 0.00112 0.00142
+cgtgt 0.00276 0.000887 0.000739
+cgtta 0.000217 0.000108 0.000141
+cgttc 0.000744 0.000253 0.00184
+cgttg 0.000748 0.00016 0.000719
+cgttt 0.000408 0.000368 0.000742
+ctaaa 5.53e-06 0.000293 0.000267
+ctaac 5.53e-06 0.000176 0.000286
+ctaag 5.53e-06 0.000103 0.000576
+ctaat 5.53e-06 0.000236 0.000131
+ctaca 0.00299 0.000394 0.000266
+ctacc 0.00287 0.000373 0.000468
+ctacg 0.0027 0.000307 0.00019
+ctact 0.00185 0.0005 0.000101
+ctaga 5.53e-06 0.000273 8.09e-05
+ctagc 5.53e-06 0.000256 0.000195
+ctagg 5.53e-06 0.000169 9.86e-05
+ctagt 5.53e-06 9.87e-05 0.000101
+ctata 0.000191 6.82e-05 9.75e-05
+ctatc 0.000408 0.000174 0.000301
+ctatg 0.000737 0.000111 0.000266
+ctatt 0.000249 0.000204 0.000168
+ctcaa 0.00049 0.00355 0.000457
+ctcac 0.00063 0.00221 0.000806
+ctcag 0.00065 0.00104 0.000996
+ctcat 0.000445 0.00298 0.000305
+ctcca 0.00264 0.000912 0.000586
+ctccc 0.00153 0.000914 0.00101
+ctccg 0.00201 0.000835 0.000803
+ctcct 0.00183 0.00157 0.000471
+ctcga 0.000665 0.00225 0.000315
+ctcgc 0.00235 0.00233 0.00108
+ctcgg 0.00264 0.00144 0.000456
+ctcgt 0.00108 0.00222 0.000362
+ctcta 0.000288 0.00114 0.000166
+ctctc 0.00104 0.00189 0.000977
+ctctg 0.00103 0.000751 0.00156
+ctctt 0.000368 0.00202 0.000397
+ctgaa 5.53e-06 0.00232 0.000573
+ctgac 5.53e-06 0.00167 0.00129
+ctgag 5.53e-06 0.00165 0.00133
+ctgat 5.53e-06 0.00146 0.000599
+ctgca 0.00176 0.00467 0.000914
+ctgcc 0.00231 0.0032 0.00165
+ctgcg 0.00169 0.00371 0.000875
+ctgct 0.00129 0.00655 0.000898
+ctgga 0.000989 0.00624 0.000813
+ctggc 0.00107 0.00391 0.00126
+ctggg 0.00178 0.00333 0.000879
+ctggt 0.000692 0.00297 0.000529
+ctgta 0.00022 0.000875 0.000258
+ctgtc 0.000554 0.00186 0.000764
+ctgtg 0.00105 0.00174 0.00173
+ctgtt 0.000214 0.00149 0.000507
+cttaa 0.00017 0.000312 5.54e-06
+cttac 0.00015 0.000226 0.000501
+cttag 0.000147 0.000156 5.54e-06
+cttat 0.000127 0.000184 0.000205
+cttca 0.00362 0.000612 0.000341
+cttcc 0.00389 0.000699 0.000514
+cttcg 0.00249 0.000296 0.000404
+cttct 0.00269 0.000655 0.000239
+cttga 0.000703 0.000864 5.54e-06
+cttgc 0.00112 0.000758 0.000436
+cttgg 0.00143 0.000644 0.000292
+cttgt 0.000577 0.000753 0.000251
+cttta 0.000371 0.000216 0.000194
+ctttc 0.000556 0.000375 0.000497
+ctttg 0.00218 0.000298 0.000525
+ctttt 0.000365 0.000477 0.00022
+gaaaa 0.000895 0.00107 0.000298
+gaaac 0.00086 0.000632 0.000589
+gaaag 0.00137 0.000477 0.000535
+gaaat 0.000529 0.000901 0.000243
+gaaca 0.00202 0.000669 0.000231
+gaacc 0.00218 0.00041 0.000325
+gaacg 0.00199 0.000439 0.000332
+gaact 0.0011 0.000698 0.000184
+gaaga 0.00369 0.00247 0.000236
+gaagc 0.00339 0.00127 0.000351
+gaagg 0.00397 0.00114 0.000228
+gaagt 0.00146 0.000819 0.000152
+gaata 0.000262 0.000353 0.000136
+gaatc 0.000573 0.000457 0.00049
+gaatg 0.000815 0.000371 0.000369
+gaatt 0.000239 0.000564 0.000239
+gacaa 0.000391 0.00307 0.000184
+gacac 0.0008 0.00237 0.000508
+gacag 0.000936 0.00172 0.000552
+gacat 0.000324 0.00309 0.0002
+gacca 0.00136 0.00184 0.000219
+gaccc 0.00112 0.0023 0.0006
+gaccg 0.00127 0.00157 0.00031
+gacct 0.000738 0.00332 0.000215
+gacga 0.00115 0.00495 0.000267
+gacgc 0.00245 0.00284 0.000512
+gacgg 0.00256 0.00203 0.000343
+gacgt 0.00113 0.00253 0.000207
+gacta 0.000164 0.000977 9.41e-05
+gactc 0.000555 0.00162 0.000581
+gactg 0.000737 0.00122 0.000621
+gactt 0.000378 0.00198 0.000172
+gagaa 0.000616 0.00441 0.000482
+gagac 0.000528 0.00262 0.00122
+gagag 0.00088 0.00272 0.00152
+gagat 0.000197 0.003 0.000629
+gagca 0.002 0.00339 0.000585
+gagcc 0.00199 0.00228 0.000885
+gagcg 0.00253 0.00305 0.000815
+gagct 0.00121 0.00518 0.000485
+gagga 0.00124 0.00893 0.000796
+gaggc 0.00128 0.00432 0.000888
+gaggg 0.00144 0.00296 0.000812
+gaggt 0.000517 0.00316 0.000356
+gagta 0.000253 0.00129 0.000164
+gagtc 0.000484 0.00164 0.000382
+gagtg 0.00108 0.00142 0.000791
+gagtt 0.000238 0.00224 0.000359
+gataa 0.000337 0.00058 5.54e-06
+gatac 0.000282 0.000299 0.000423
+gatag 0.00035 8.49e-05 5.54e-06
+gatat 0.000206 0.000427 0.000189
+gatca 0.00149 0.000626 0.000189
+gatcc 0.00197 0.000579 0.000169
+gatcg 0.00204 0.000558 0.000177
+gatct 0.000911 0.000753 0.000161
+gatga 0.00166 0.003 5.54e-06
+gatgc 0.00185 0.00158 0.000185
+gatgg 0.00266 0.00159 0.000321
+gatgt 0.000947 0.00146 0.000187
+gatta 0.000399 0.000376 0.000126
+gattc 0.000624 0.000404 0.000474
+gattg 0.00111 0.00029 0.00023
+gattt 0.000401 0.00066 0.000344
+gcaaa 0.000538 0.000831 0.00108
+gcaac 0.000686 0.000472 0.00228
+gcaag 0.00123 0.000441 0.00392
+gcaat 0.00033 0.000495 0.000601
+gcaca 0.00252 0.00121 0.000977
+gcacc 0.00244 0.000585 0.00217
+gcacg 0.00302 0.00104 0.00231
+gcact 0.00131 0.00103 0.000534
+gcaga 0.0039 0.00187 0.00043
+gcagc 0.00614 0.00166 0.00309
+gcagg 0.00507 0.000918 0.000844
+gcagt 0.00217 0.00082 0.00063
+gcata 0.000161 0.000197 0.000235
+gcatc 0.000758 0.000606 0.00312
+gcatg 0.00078 0.000324 0.00259
+gcatt 0.000355 0.000545 0.000878
+gccaa 0.000692 0.003 0.000455
+gccac 0.00128 0.0025 0.00234
+gccag 0.00115 0.0012 0.00233
+gccat 0.000543 0.00326 0.000409
+gccca 0.0028 0.00128 0.000643
+gcccc 0.00162 0.000979 0.00145
+gcccg 0.00292 0.00103 0.000897
+gccct 0.00142 0.00205 0.000524
+gccga 0.000882 0.00349 0.000552
+gccgc 0.00305 0.00339 0.003
+gccgg 0.00243 0.0023 0.00101
+gccgt 0.00117 0.00268 0.000556
+gccta 0.000144 0.000931 0.000268
+gcctc 0.000947 0.00149 0.00328
+gcctg 0.00122 0.00101 0.00389
+gcctt 0.000348 0.00149 0.000507
+gcgaa 0.000358 0.000696 0.000689
+gcgac 0.000756 0.00102 0.00335
+gcgag 0.00131 0.00118 0.00404
+gcgat 0.000411 0.000874 0.000807
+gcgca 0.00316 0.00204 0.000585
+gcgcc 0.00233 0.00155 0.003
+gcgcg 0.00338 0.00176 0.00173
+gcgct 0.0024 0.00323 0.000699
+gcgga 0.0013 0.00242 0.00109
+gcggc 0.00318 0.00338 0.00329
+gcggg 0.00215 0.00146 0.00127
+gcggt 0.000668 0.00144 0.000735
+gcgta 0.000334 0.00066 0.000281
+gcgtc 0.000896 0.00101 0.00195
+gcgtg 0.00174 0.00121 0.00377
+gcgtt 0.000351 0.00113 0.000534
+gctaa 0.000308 0.000597 5.54e-06
+gctac 0.000589 0.000326 0.00253
+gctag 0.000283 0.000133 5.54e-06
+gctat 0.000209 0.000329 0.000315
+gctca 0.00441 0.000973 0.000493
+gctcc 0.00155 0.000699 0.00205
+gctcg 0.00406 0.000867 0.00184
+gctct 0.00231 0.00099 0.000639
+gctga 0.0034 0.00158 5.54e-06
+gctgc 0.00954 0.00197 0.00206
+gctgg 0.00795 0.00131 0.00144
+gctgt 0.00338 0.00123 0.000708
+gctta 0.000347 0.000131 0.000123
+gcttc 0.000873 0.000434 0.00286
+gcttg 0.00127 0.000317 0.000886
+gcttt 0.000459 0.000481 0.000851
+ggaaa 0.00116 0.000879 0.000704
+ggaac 0.000789 0.00056 0.0011
+ggaag 0.00214 0.000455 0.00187
+ggaat 0.000631 0.000569 0.000372
+ggaca 0.00385 0.000596 0.000351
+ggacc 0.00327 0.000645 0.000625
+ggacg 0.00468 0.000553 0.00102
+ggact 0.00189 0.000707 0.000265
+ggaga 0.00633 0.00196 0.000519
+ggagc 0.0071 0.00148 0.00113
+ggagg 0.00966 0.00181 0.000856
+ggagt 0.00291 0.000854 0.000334
+ggata 0.000475 0.000282 0.000248
+ggatc 0.00101 0.000343 0.000845
+ggatg 0.00297 0.000309 0.000896
+ggatt 0.000559 0.000555 0.000336
+ggcaa 0.000808 0.00218 0.000518
+ggcac 0.00136 0.00197 0.00132
+ggcag 0.00189 0.00154 0.00272
+ggcat 0.000638 0.0022 0.000284
+ggcca 0.00364 0.00151 0.000605
+ggccc 0.00185 0.000964 0.00137
+ggccg 0.00447 0.00162 0.00121
+ggcct 0.00197 0.00244 0.000566
+ggcga 0.00189 0.00264 0.000466
+ggcgc 0.00423 0.00192 0.00175
+ggcgg 0.00443 0.00256 0.00115
+ggcgt 0.00171 0.00206 0.000536
+ggcta 0.000453 0.000852 0.000278
+ggctc 0.00137 0.00177 0.00167
+ggctg 0.00221 0.00124 0.0028
+ggctt 0.000495 0.00146 0.000482
+gggaa 0.000937 0.00127 0.000639
+gggac 0.000796 0.000669 0.00194
+gggag 0.00192 0.000721 0.00313
+gggat 0.000516 0.000754 0.000609
+gggca 0.00287 0.00146 0.000737
+gggcc 0.00262 0.00123 0.00142
+gggcg 0.0032 0.00107 0.00123
+gggct 0.00192 0.00158 0.000622
+gggga 0.00129 0.00193 0.000907
+ggggc 0.00213 0.00135 0.00144
+ggggg 0.00189 0.00136 0.000956
+ggggt 0.000634 0.000972 0.000534
+gggta 0.000382 0.000359 0.000214
+gggtc 0.000821 0.000416 0.000792
+gggtg 0.00146 0.000457 0.00171
+gggtt 0.000329 0.000651 0.000243
+ggtaa 0.000238 0.00024 5.54e-06
+ggtac 0.00038 0.000327 0.000886
+ggtag 0.000393 0.000208 5.54e-06
+ggtat 0.000174 0.000242 0.00014
+ggtca 0.00147 0.000486 0.000262
+ggtcc 0.000914 0.000378 0.000424
+ggtcg 0.0012 0.000507 0.00054
+ggtct 0.000606 0.000562 0.000334
+ggtga 0.00311 0.0012 5.54e-06
+ggtgc 0.00479 0.000916 0.000542
+ggtgg 0.00588 0.00184 0.000714
+ggtgt 0.00207 0.000847 0.000394
+ggtta 0.000207 0.00019 8.86e-05
+ggttc 0.000635 0.000251 0.000771
+ggttg 0.000704 0.000201 0.000504
+ggttt 0.000409 0.000508 0.000486
+gtaaa 5.53e-06 0.000306 0.000248
+gtaac 5.53e-06 0.000208 0.000333
+gtaag 5.53e-06 0.000128 0.000297
+gtaat 5.53e-06 0.000204 0.000174
+gtaca 0.00202 0.000292 0.000342
+gtacc 0.00202 0.000261 0.000251
+gtacg 0.00221 0.000364 0.000282
+gtact 0.00103 0.00022 7.64e-05
+gtaga 5.53e-06 0.000389 8.31e-05
+gtagc 5.53e-06 0.000375 0.000244
+gtagg 5.53e-06 0.000301 0.000142
+gtagt 5.53e-06 0.000258 0.000106
+gtata 0.000145 9.23e-05 0.000161
+gtatc 0.000335 0.00019 0.000241
+gtatg 0.000655 0.000123 0.000303
+gtatt 0.000265 0.000205 0.000144
+gtcaa 0.000378 0.00187 0.000344
+gtcac 0.00067 0.00155 0.000724
+gtcag 0.000464 0.000787 0.000472
+gtcat 0.000306 0.00183 0.000223
+gtcca 0.0013 0.000604 0.000284
+gtccc 0.000926 0.000838 0.000485
+gtccg 0.00122 0.0005 0.000271
+gtcct 0.000617 0.00109 0.000313
+gtcga 0.000834 0.00117 0.000231
+gtcgc 0.00202 0.00124 0.000713
+gtcgg 0.00178 0.00104 0.000305
+gtcgt 0.000924 0.00119 0.000202
+gtcta 0.000182 0.000537 0.000167
+gtctc 0.000976 0.0009 0.000898
+gtctg 0.00108 0.000441 0.000971
+gtctt 0.000295 0.000927 0.000406
+gtgaa 5.53e-06 0.0026 0.000655
+gtgac 5.53e-06 0.00172 0.0014
+gtgag 5.53e-06 0.00158 0.00134
+gtgat 5.53e-06 0.00164 0.000579
+gtgca 0.00146 0.00288 0.000636
+gtgcc 0.00156 0.00246 0.00134
+gtgcg 0.00225 0.00274 0.000927
+gtgct 0.00101 0.00402 0.000573
+gtgga 0.00129 0.00553 0.001
+gtggc 0.00147 0.00362 0.00171
+gtggg 0.0015 0.00235 0.000956
+gtggt 0.000773 0.00315 0.00106
+gtgta 0.000259 0.000787 0.00034
+gtgtc 0.000644 0.0018 0.000797
+gtgtg 0.00126 0.00189 0.0016
+gtgtt 0.000386 0.00191 0.000348
+gttaa 0.000108 0.0003 5.54e-06
+gttac 0.000225 0.00024 0.000501
+gttag 0.000151 5.52e-05 5.54e-06
+gttat 0.000115 0.000216 0.000205
+gttca 0.00217 0.000473 0.000182
+gttcc 0.0025 0.000484 0.000369
+gttcg 0.00185 0.000379 0.000259
+gttct 0.00135 0.000686 0.000184
+gttga 0.000559 0.000781 5.54e-06
+gttgc 0.000906 0.000689 0.000202
+gttgg 0.00156 0.000721 0.000286
+gttgt 0.000556 0.000724 0.000169
+gttta 0.000398 0.000219 0.000172
+gtttc 0.000708 0.000288 0.000556
+gtttg 0.00246 0.000381 0.000446
+gtttt 0.000492 0.000422 0.00028
+taaaa 0.000348 0.000605 0.000312
+taaac 0.00028 0.000366 0.000368
+taaag 0.000414 0.000297 0.000517
+taaat 0.000208 0.000532 0.000187
+taaca 0.000439 0.000504 0.000158
+taacc 0.0004 0.000377 0.000161
+taacg 0.00041 0.000325 0.000265
+taact 0.0002 0.000519 0.000179
+taaga 0.000529 0.00124 0.000214
+taagc 0.000442 0.000714 0.000378
+taagg 0.000552 0.00061 0.0002
+taagt 0.000258 0.000549 0.000215
+taata 0.000114 0.000241 0.000114
+taatc 0.000149 0.000322 0.000249
+taatg 0.00037 0.000194 0.000297
+taatt 0.000156 0.000293 0.000185
+tacaa 0.000197 0.00206 0.000172
+tacac 0.000255 0.00115 0.000289
+tacag 0.00036 0.000934 0.000566
+tacat 0.000193 0.00162 0.0002
+tacca 0.000513 0.0016 0.000203
+taccc 0.000269 0.001 0.000418
+taccg 0.000263 0.00116 0.000237
+tacct 0.000202 0.00199 0.000123
+tacga 0.000113 0.00206 0.000126
+tacgc 0.000283 0.00112 0.000343
+tacgg 0.000398 0.00108 0.000275
+tacgt 0.000203 0.00123 0.000223
+tacta 0.000195 0.000831 5.76e-05
+tactc 0.000422 0.000866 0.000356
+tactg 0.000558 0.000724 0.000576
+tactt 0.000244 0.00104 0.000148
+tagaa 0.000337 0.00278 0.000346
+tagac 0.0003 0.00136 0.00035
+tagag 0.000497 0.00145 0.000579
+tagat 0.000134 0.00183 0.000143
+tagca 0.000161 0.00245 0.000253
+tagcc 0.000246 0.00141 0.000318
+tagcg 0.000254 0.00171 0.000296
+tagct 0.000114 0.00288 0.000168
+tagga 0.000616 0.00422 0.000141
+taggc 0.000617 0.00239 0.00026
+taggg 0.000716 0.00161 0.000186
+taggt 0.000229 0.00171 0.000135
+tagta 0.000182 0.000761 8.2e-05
+tagtc 0.000322 0.00095 0.000105
+tagtg 0.00071 0.000789 0.000398
+tagtt 0.000166 0.00131 0.000151
+tataa 0.000265 0.000215 5.54e-06
+tatac 0.000217 0.000128 0.000423
+tatag 0.000279 9.12e-05 5.54e-06
+tatat 0.000193 0.000129 0.000189
+tatca 0.000342 0.000278 0.000147
+tatcc 0.000411 0.000258 0.000294
+tatcg 0.000273 0.00022 0.000167
+tatct 0.000242 0.000365 0.000119
+tatga 0.000295 0.000625 5.54e-06
+tatgc 0.000254 0.000458 0.000243
+tatgg 0.000366 0.000561 0.000291
+tatgt 0.000224 0.000308 0.000213
+tatta 8.95e-05 0.000129 9.41e-05
+tattc 0.000187 0.000213 0.000265
+tattg 0.000282 0.000102 0.000227
+tattt 0.000148 0.00038 0.000228
+tcaaa 0.0004 0.000582 0.00106
+tcaac 0.000392 0.000215 0.00376
+tcaag 0.000581 0.000207 0.00478
+tcaat 0.000192 0.000249 0.00076
+tcaca 0.000861 0.000462 0.00104
+tcacc 0.000703 0.000343 0.00308
+tcacg 0.000748 0.000459 0.00218
+tcact 0.000533 0.00059 0.000771
+tcaga 0.000801 0.000593 0.000404
+tcagc 0.00101 0.000536 0.00224
+tcagg 0.000745 0.000294 0.000692
+tcagt 0.000424 0.000233 0.000559
+tcata 4.53e-05 7.21e-05 0.000429
+tcatc 0.00038 0.000479 0.00454
+tcatg 0.000421 0.000175 0.00316
+tcatt 0.000207 0.000389 0.00125
+tccaa 0.000304 0.00179 0.000467
+tccac 0.000505 0.00103 0.00184
+tccag 0.000685 0.000567 0.00244
+tccat 0.000293 0.00133 0.000437
+tccca 0.000865 0.000871 0.000909
+tcccc 0.000523 0.000644 0.00186
+tcccg 0.000869 0.000524 0.00127
+tccct 0.000587 0.00102 0.000769
+tccga 0.000238 0.00115 0.000501
+tccgc 0.000776 0.000866 0.00226
+tccgg 0.000464 0.000668 0.00106
+tccgt 0.000336 0.00111 0.000647
+tccta 0.000146 0.000447 0.000331
+tcctc 0.000461 0.00104 0.00268
+tcctg 0.000723 0.000452 0.00407
+tcctt 0.000204 0.000985 0.000688
+tcgaa 0.000115 0.000436 0.000565
+tcgac 0.000256 0.000535 0.00342
+tcgag 0.000403 0.000477 0.00312
+tcgat 0.000183 0.000397 0.000814
+tcgca 0.000758 0.00124 0.00077
+tcgcc 0.000695 0.00109 0.00326
+tcgcg 0.000829 0.000832 0.00166
+tcgct 0.000702 0.00178 0.00112
+tcgga 0.000245 0.00181 0.000698
+tcggc 0.000576 0.00145 0.00252
+tcggg 0.000469 0.00102 0.00104
+tcggt 0.000196 0.000719 0.000477
+tcgta 9.5e-05 0.000367 0.000318
+tcgtc 0.000348 0.000758 0.0022
+tcgtg 0.000491 0.000599 0.00371
+tcgtt 0.000138 0.000585 0.000503
+tctaa 0.000109 0.000199 5.54e-06
+tctac 0.000291 0.000216 0.0031
+tctag 0.00019 0.000159 5.54e-06
+tctat 6.74e-05 0.000201 0.000505
+tctca 0.00113 0.000593 0.000745
+tctcc 0.000652 0.000748 0.00247
+tctcg 0.00077 0.000457 0.00159
+tctct 0.000841 0.000767 0.000802
+tctga 0.00095 0.000682 5.54e-06
+tctgc 0.00198 0.000696 0.00154
+tctgg 0.00153 0.000699 0.000867
+tctgt 0.000553 0.000656 0.000535
+tctta 0.000102 0.000116 0.000143
+tcttc 0.000496 0.00034 0.00389
+tcttg 0.00054 0.000204 0.000886
+tcttt 0.000276 0.000323 0.000813
+tgaaa 0.000921 0.000403 0.00103
+tgaac 0.00044 0.000261 0.00243
+tgaag 0.00142 0.000236 0.00348
+tgaat 0.000476 0.000295 0.000483
+tgaca 0.00195 0.000344 0.00076
+tgacc 0.0015 0.000324 0.0014
+tgacg 0.00179 0.000315 0.00223
+tgact 0.000876 0.000351 0.000667
+tgaga 0.00173 0.000928 0.000569
+tgagc 0.00166 0.000667 0.00227
+tgagg 0.0023 0.000678 0.00117
+tgagt 0.00083 0.000406 0.000686
+tgata 0.000343 0.000125 0.000347
+tgatc 0.000398 0.000167 0.00165
+tgatg 0.00153 0.000165 0.00209
+tgatt 0.000345 0.000283 0.000745
+tgcaa 0.000524 0.00112 0.000789
+tgcac 0.000875 0.000829 0.00301
+tgcag 0.00131 0.000766 0.00549
+tgcat 0.000523 0.001 0.000799
+tgcca 0.00181 0.00103 0.00117
+tgccc 0.00104 0.000822 0.00306
+tgccg 0.00188 0.000928 0.00225
+tgcct 0.000795 0.00163 0.000807
+tgcga 0.000597 0.00128 0.000754
+tgcgc 0.00105 0.000867 0.00408
+tgcgg 0.00117 0.001 0.00223
+tgcgt 0.000574 0.00111 0.00136
+tgcta 0.000265 0.000494 0.000365
+tgctc 0.000658 0.000683 0.00449
+tgctg 0.00155 0.000714 0.00854
+tgctt 0.000283 0.000802 0.00082
+tggaa 0.000687 0.00091 0.00161
+tggac 0.000615 0.000595 0.00502
+tggag 0.00159 0.000759 0.00875
+tggat 0.000472 0.000534 0.00175
+tggca 0.0017 0.000734 0.00156
+tggcc 0.00124 0.000521 0.0041
+tggcg 0.00153 0.000642 0.00381
+tggct 0.00121 0.00108 0.00156
+tggga 0.000802 0.00133 0.00134
+tgggc 0.000987 0.000907 0.00369
+tgggg 0.00118 0.000788 0.00179
+tgggt 0.000494 0.000803 0.00106
+tggta 0.000276 0.000334 0.000391
+tggtc 0.000486 0.000476 0.00132
+tggtg 0.00149 0.000536 0.00636
+tggtt 0.000323 0.000477 0.000677
+tgtaa 0.0003 0.000211 5.54e-06
+tgtac 0.00028 0.000181 0.00206
+tgtag 0.000301 0.000123 5.54e-06
+tgtat 0.000279 0.000242 0.000468
+tgtca 0.00124 0.000419 0.000733
+tgtcc 0.00065 0.000293 0.00169
+tgtcg 0.00076 0.000258 0.0018
+tgtct 0.000643 0.00061 0.000968
+tgtga 0.00127 0.000709 5.54e-06
+tgtgc 0.00204 0.000819 0.00257
+tgtgg 0.00236 0.00074 0.00168
+tgtgt 0.00125 0.000832 0.00089
+tgtta 0.000295 0.00015 0.000224
+tgttc 0.000381 0.00022 0.00236
+tgttg 0.000912 0.000202 0.00122
+tgttt 0.000345 0.000249 0.00146
+ttaaa 5.53e-06 0.000284 0.000371
+ttaac 5.53e-06 0.000141 0.000529
+ttaag 5.53e-06 9.66e-05 0.000497
+ttaat 5.53e-06 0.000139 0.000295
+ttaca 0.000511 0.000172 0.000217
+ttacc 0.000645 0.000151 0.000343
+ttacg 0.000392 6.58e-05 0.00024
+ttact 0.000402 0.000178 0.000174
+ttaga 5.53e-06 0.000216 8.09e-05
+ttagc 5.53e-06 0.000117 0.000195
+ttagg 5.53e-06 0.00011 9.86e-05
+ttagt 5.53e-06 0.000121 0.000101
+ttata 0.000124 6.82e-05 0.000102
+ttatc 0.000208 0.000174 0.000421
+ttatg 0.000357 0.000111 0.000302
+ttatt 0.000167 0.000204 0.000251
+ttcaa 0.000259 0.00207 0.000434
+ttcac 0.000335 0.0015 0.000667
+ttcag 0.000302 0.00101 0.00084
+ttcat 0.000186 0.00211 0.000269
+ttcca 0.000531 0.00185 0.000536
+ttccc 0.000369 0.00153 0.000826
+ttccg 0.000518 0.00155 0.000457
+ttcct 0.000296 0.00251 0.000446
+ttcga 0.000166 0.00171 0.000217
+ttcgc 0.000379 0.00105 0.00058
+ttcgg 0.000353 0.000863 0.000361
+ttcgt 0.000203 0.0013 0.000229
+ttcta 0.000193 0.00105 0.000161
+ttctc 0.000335 0.00156 0.000778
+ttctg 0.000361 0.000969 0.00126
+ttctt 0.000132 0.0013 0.000298
+ttgaa 5.53e-06 0.000573 0.000912
+ttgac 5.53e-06 0.000484 0.00158
+ttgag 5.53e-06 0.000394 0.00198
+ttgat 5.53e-06 0.000324 0.0006
+ttgca 0.000359 0.000738 0.00102
+ttgcc 0.000379 0.000582 0.00124
+ttgcg 0.000313 0.000546 0.000857
+ttgct 0.000393 0.000924 0.000671
+ttgga 0.000275 0.00154 0.000852
+ttggc 0.00034 0.00109 0.00134
+ttggg 0.000321 0.000666 0.000865
+ttggt 0.000241 0.000746 0.000578
+ttgta 0.00017 0.000259 0.000278
+ttgtc 0.000274 0.000512 0.00101
+ttgtg 0.000435 0.000568 0.00189
+ttgtt 0.000114 0.000378 0.000625
+tttaa 0.000234 0.000389 5.54e-06
+tttac 0.000147 0.000279 0.000744
+tttag 0.000204 0.000124 5.54e-06
+tttat 0.000133 0.000245 0.000198
+tttca 0.000555 0.000537 0.000399
+tttcc 0.000794 0.000424 0.000378
+tttcg 0.000439 0.000259 0.00019
+tttct 0.000545 0.00055 0.000344
+tttga 0.00033 0.002 5.54e-06
+tttgc 0.000533 0.00128 0.000513
+tttgg 0.000755 0.00127 0.000327
+tttgt 0.000379 0.00136 0.000424
+tttta 0.000137 0.000253 0.000164
+ttttc 0.000293 0.000291 0.000655
+ttttg 0.000731 0.000264 0.000508
+ttttt 0.000238 0.000442 0.000462
+
+# translation initiation motif
+[TRANSINIT]
+# width of motif, n=
+20
+# order of markov model, k=
+2
+# markov chain emission probabilities
+ 0 0.33 0.343 0.148 0.179 0.301 0.228 0.22 0.251 0.364 0.203 0.306 0.128 0.22 0.303 0.207 0.27 0.149 0.312 0.322 0.216 0.181 0.361 0.256 0.201 0.184 0.33 0.255 0.231 0.15 0.343 0.173 0.334 0.188 0.275 0.376 0.162 0.223 0.283 0.202 0.292 0.221 0.182 0.42 0.177 0.14 0.386 0.215 0.259 0.183 0.231 0.295 0.291 0.18 0.343 0.218 0.259 0.198 0.181 0.255 0.365 0.17 0.123 0.281 0.427
+ 1 0.317 0.327 0.144 0.211 0.262 0.25 0.248 0.24 0.384 0.203 0.316 0.0981 0.188 0.284 0.23 0.298 0.156 0.309 0.307 0.229 0.171 0.344 0.238 0.248 0.187 0.368 0.243 0.202 0.142 0.34 0.196 0.322 0.167 0.306 0.365 0.162 0.233 0.278 0.203 0.286 0.184 0.261 0.353 0.201 0.112 0.308 0.256 0.324 0.282 0.204 0.272 0.241 0.201 0.287 0.227 0.285 0.152 0.246 0.244 0.358 0.145 0.142 0.309 0.403
+ 2 0.336 0.312 0.175 0.177 0.258 0.219 0.313 0.21 0.393 0.2 0.294 0.113 0.183 0.264 0.222 0.33 0.144 0.333 0.324 0.199 0.17 0.328 0.237 0.265 0.185 0.34 0.236 0.238 0.109 0.331 0.206 0.354 0.172 0.275 0.397 0.155 0.235 0.238 0.254 0.272 0.164 0.299 0.361 0.177 0.109 0.319 0.285 0.287 0.267 0.246 0.258 0.229 0.212 0.281 0.204 0.302 0.13 0.241 0.219 0.41 0.15 0.165 0.294 0.391
+ 3 0.349 0.293 0.184 0.174 0.224 0.217 0.338 0.221 0.34 0.256 0.302 0.103 0.212 0.255 0.215 0.318 0.152 0.329 0.323 0.195 0.181 0.329 0.246 0.244 0.182 0.35 0.238 0.229 0.12 0.338 0.222 0.32 0.17 0.275 0.4 0.155 0.22 0.245 0.283 0.252 0.169 0.297 0.361 0.173 0.11 0.32 0.311 0.258 0.303 0.219 0.251 0.227 0.22 0.266 0.232 0.282 0.15 0.241 0.212 0.397 0.149 0.169 0.313 0.369
+ 4 0.341 0.275 0.2 0.184 0.179 0.218 0.374 0.228 0.358 0.239 0.256 0.147 0.251 0.211 0.201 0.338 0.136 0.354 0.328 0.182 0.228 0.291 0.209 0.272 0.168 0.36 0.233 0.238 0.122 0.348 0.24 0.29 0.172 0.3 0.381 0.147 0.183 0.251 0.334 0.232 0.185 0.306 0.364 0.145 0.112 0.314 0.32 0.255 0.334 0.204 0.256 0.206 0.228 0.27 0.215 0.286 0.151 0.254 0.195 0.4 0.154 0.175 0.309 0.362
+ 5 0.355 0.239 0.233 0.173 0.187 0.25 0.363 0.2 0.371 0.244 0.226 0.159 0.238 0.201 0.225 0.337 0.125 0.446 0.268 0.16 0.256 0.296 0.178 0.27 0.164 0.376 0.246 0.214 0.129 0.327 0.253 0.291 0.149 0.28 0.382 0.189 0.175 0.288 0.314 0.223 0.151 0.324 0.381 0.144 0.0878 0.265 0.361 0.287 0.362 0.169 0.256 0.213 0.25 0.236 0.225 0.288 0.154 0.301 0.154 0.391 0.153 0.2 0.303 0.344
+ 6 0.317 0.271 0.23 0.182 0.186 0.26 0.407 0.146 0.35 0.195 0.238 0.217 0.29 0.222 0.189 0.298 0.167 0.398 0.277 0.158 0.25 0.293 0.209 0.248 0.157 0.353 0.27 0.219 0.104 0.342 0.28 0.275 0.106 0.285 0.386 0.223 0.179 0.293 0.341 0.187 0.167 0.337 0.381 0.115 0.0625 0.263 0.433 0.241 0.421 0.187 0.172 0.221 0.274 0.238 0.224 0.265 0.134 0.317 0.181 0.368 0.127 0.202 0.318 0.353
+ 7 0.346 0.222 0.232 0.2 0.238 0.229 0.386 0.146 0.358 0.219 0.208 0.215 0.238 0.138 0.268 0.356 0.147 0.398 0.281 0.174 0.264 0.28 0.218 0.238 0.154 0.371 0.24 0.234 0.0933 0.33 0.29 0.286 0.139 0.255 0.381 0.225 0.221 0.28 0.342 0.157 0.155 0.402 0.338 0.105 0.0651 0.274 0.423 0.238 0.468 0.184 0.144 0.204 0.308 0.232 0.206 0.254 0.161 0.308 0.177 0.353 0.146 0.198 0.308 0.349
+ 8 0.342 0.194 0.269 0.194 0.274 0.254 0.339 0.133 0.316 0.22 0.218 0.246 0.235 0.176 0.256 0.332 0.144 0.396 0.281 0.179 0.279 0.29 0.241 0.19 0.143 0.368 0.241 0.249 0.0976 0.328 0.293 0.282 0.185 0.193 0.41 0.212 0.219 0.291 0.331 0.158 0.196 0.359 0.374 0.0706 0.0892 0.278 0.449 0.184 0.408 0.224 0.126 0.242 0.29 0.282 0.203 0.224 0.182 0.264 0.189 0.364 0.178 0.205 0.286 0.331
+ 9 0.352 0.215 0.232 0.201 0.28 0.285 0.278 0.158 0.344 0.238 0.209 0.209 0.255 0.201 0.262 0.282 0.143 0.373 0.296 0.188 0.274 0.27 0.291 0.164 0.14 0.401 0.233 0.227 0.128 0.338 0.314 0.22 0.199 0.247 0.34 0.213 0.21 0.337 0.307 0.147 0.218 0.31 0.374 0.0976 0.0884 0.257 0.446 0.208 0.444 0.198 0.111 0.247 0.3 0.26 0.217 0.224 0.202 0.29 0.192 0.317 0.16 0.181 0.315 0.344
+10 0.326 0.208 0.229 0.237 0.317 0.335 0.223 0.125 0.368 0.231 0.165 0.236 0.241 0.233 0.261 0.265 0.129 0.365 0.313 0.193 0.25 0.289 0.286 0.175 0.141 0.424 0.204 0.231 0.106 0.326 0.318 0.25 0.186 0.255 0.33 0.229 0.246 0.311 0.289 0.155 0.234 0.282 0.377 0.106 0.0814 0.263 0.453 0.202 0.443 0.228 0.106 0.223 0.271 0.268 0.171 0.291 0.209 0.278 0.19 0.323 0.206 0.155 0.247 0.392
+11 0.307 0.216 0.282 0.194 0.293 0.323 0.23 0.154 0.352 0.282 0.165 0.202 0.241 0.25 0.265 0.244 0.115 0.341 0.344 0.2 0.281 0.248 0.296 0.176 0.158 0.407 0.194 0.241 0.0877 0.312 0.34 0.26 0.183 0.233 0.36 0.223 0.256 0.297 0.28 0.167 0.238 0.25 0.403 0.11 0.0765 0.241 0.469 0.214 0.44 0.231 0.0824 0.247 0.246 0.291 0.212 0.251 0.214 0.257 0.213 0.316 0.187 0.174 0.268 0.371
+12 0.302 0.209 0.293 0.196 0.326 0.273 0.251 0.15 0.303 0.297 0.188 0.212 0.227 0.28 0.253 0.24 0.162 0.261 0.373 0.205 0.248 0.266 0.297 0.189 0.166 0.402 0.171 0.26 0.0879 0.334 0.328 0.25 0.197 0.216 0.371 0.216 0.275 0.262 0.301 0.162 0.221 0.299 0.363 0.117 0.0829 0.257 0.473 0.187 0.451 0.224 0.0868 0.238 0.224 0.307 0.211 0.258 0.206 0.251 0.225 0.318 0.161 0.161 0.323 0.354
+13 0.343 0.157 0.339 0.161 0.321 0.317 0.216 0.146 0.337 0.333 0.19 0.14 0.189 0.3 0.246 0.265 0.139 0.292 0.391 0.178 0.239 0.277 0.286 0.198 0.177 0.422 0.159 0.242 0.0873 0.365 0.339 0.209 0.216 0.24 0.369 0.176 0.301 0.281 0.253 0.165 0.206 0.305 0.36 0.129 0.114 0.29 0.429 0.168 0.463 0.236 0.0925 0.209 0.221 0.321 0.199 0.258 0.234 0.233 0.228 0.306 0.174 0.161 0.328 0.338
+14 0.313 0.183 0.352 0.152 0.269 0.363 0.212 0.156 0.315 0.321 0.22 0.144 0.212 0.377 0.208 0.203 0.163 0.223 0.434 0.18 0.306 0.248 0.268 0.178 0.201 0.406 0.186 0.206 0.102 0.356 0.375 0.167 0.208 0.227 0.371 0.194 0.26 0.271 0.31 0.158 0.246 0.235 0.358 0.161 0.129 0.264 0.446 0.161 0.406 0.222 0.135 0.237 0.209 0.278 0.237 0.275 0.26 0.223 0.249 0.268 0.18 0.158 0.334 0.328
+15 0.349 0.201 0.325 0.126 0.261 0.314 0.274 0.15 0.318 0.375 0.183 0.125 0.197 0.34 0.214 0.249 0.2 0.257 0.4 0.142 0.316 0.239 0.255 0.19 0.209 0.412 0.178 0.202 0.124 0.362 0.347 0.167 0.262 0.264 0.283 0.191 0.262 0.248 0.307 0.183 0.238 0.274 0.347 0.141 0.136 0.295 0.39 0.179 0.412 0.203 0.148 0.238 0.227 0.277 0.231 0.266 0.285 0.233 0.244 0.238 0.158 0.123 0.359 0.359
+16 0.315 0.201 0.345 0.139 0.235 0.366 0.296 0.104 0.276 0.386 0.21 0.128 0.184 0.377 0.207 0.232 0.21 0.263 0.379 0.148 0.326 0.296 0.201 0.177 0.209 0.421 0.189 0.182 0.134 0.36 0.36 0.146 0.255 0.241 0.34 0.164 0.245 0.281 0.332 0.142 0.247 0.316 0.327 0.109 0.157 0.313 0.366 0.164 0.386 0.185 0.188 0.24 0.222 0.312 0.233 0.232 0.305 0.212 0.272 0.211 0.216 0.167 0.329 0.288
+17 0.324 0.212 0.366 0.0981 0.225 0.333 0.331 0.11 0.289 0.362 0.228 0.121 0.166 0.365 0.212 0.258 0.227 0.266 0.368 0.138 0.36 0.269 0.19 0.181 0.215 0.397 0.213 0.175 0.146 0.368 0.366 0.12 0.281 0.231 0.342 0.146 0.222 0.306 0.338 0.134 0.233 0.354 0.319 0.0942 0.173 0.296 0.35 0.181 0.358 0.174 0.194 0.274 0.252 0.328 0.248 0.172 0.304 0.224 0.292 0.18 0.164 0.203 0.401 0.232
+18 0.333 0.209 0.346 0.112 0.252 0.356 0.315 0.0769 0.29 0.342 0.246 0.121 0.147 0.382 0.229 0.242 0.265 0.274 0.33 0.131 0.306 0.327 0.182 0.184 0.214 0.428 0.228 0.131 0.185 0.375 0.344 0.0951 0.3 0.226 0.318 0.156 0.223 0.325 0.322 0.129 0.246 0.378 0.28 0.096 0.189 0.345 0.324 0.142 0.333 0.204 0.19 0.273 0.284 0.295 0.227 0.194 0.329 0.213 0.26 0.198 0.185 0.188 0.383 0.243
+19 0.336 0.221 0.328 0.115 0.204 0.431 0.3 0.0641 0.299 0.373 0.25 0.0784 0.113 0.397 0.239 0.251 0.238 0.312 0.326 0.124 0.361 0.313 0.166 0.16 0.201 0.452 0.261 0.0861 0.18 0.367 0.386 0.0675 0.327 0.256 0.31 0.107 0.215 0.33 0.342 0.114 0.287 0.318 0.293 0.102 0.232 0.325 0.322 0.122 0.326 0.251 0.183 0.24 0.314 0.286 0.252 0.147 0.395 0.178 0.294 0.133 0.269 0.176 0.295 0.26
+
+# dss upstream motif, reading frame 0(reverse)
+[ETMOTIF0]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+# dss upstream motif, reading frame 1(reverse)
+[ETMOTIF1]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+# dss upstream motif, reading frame 2(reverse)
+[ETMOTIF2]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+
+#
+# Emission probabilities
+#
+[EMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.1668 0.3508 0.2497
+aaaac 0.3323 0.2048 0.2873
+aaaag 0.3368 0.162 0.3323
+aaaat 0.1642 0.2824 0.1307
+aaaca 0.3232 0.2532 0.1948
+aaacc 0.247 0.2302 0.3535
+aaacg 0.2171 0.1906 0.2792
+aaact 0.2127 0.326 0.1724
+aaaga 0.2352 0.375 0.1825
+aaagc 0.2936 0.2372 0.3508
+aaagg 0.3036 0.1803 0.2338
+aaagt 0.1676 0.2075 0.2329
+aaata 0.1334 0.2832 0.1466
+aaatc 0.2006 0.3166 0.343
+aaatg 0.4732 0.1409 0.3574
+aaatt 0.1928 0.2592 0.153
+aacaa 0.209 0.335 0.2207
+aacac 0.2633 0.2228 0.2814
+aacag 0.3616 0.1309 0.4122
+aacat 0.1661 0.3113 0.08564
+aacca 0.4174 0.216 0.2097
+aaccc 0.2565 0.2341 0.2853
+aaccg 0.1683 0.1799 0.2895
+aacct 0.1578 0.37 0.2154
+aacga 0.2052 0.3198 0.1567
+aacgc 0.2929 0.2336 0.42
+aacgg 0.3175 0.1752 0.2715
+aacgt 0.1844 0.2714 0.1518
+aacta 0.1582 0.2068 0.08845
+aactc 0.2354 0.2503 0.3236
+aactg 0.4371 0.19 0.4146
+aactt 0.1694 0.3529 0.1733
+aagaa 0.2981 0.4375 0.176
+aagac 0.2194 0.1529 0.2676
+aagag 0.3961 0.1664 0.3842
+aagat 0.08645 0.2431 0.1722
+aagca 0.3326 0.2935 0.1915
+aagcc 0.2834 0.1866 0.3481
+aagcg 0.1738 0.1955 0.2686
+aagct 0.2103 0.3244 0.1918
+aagga 0.2368 0.4134 0.2096
+aaggc 0.3573 0.2328 0.3463
+aaggg 0.3102 0.1634 0.2533
+aaggt 0.09557 0.1905 0.1908
+aagta 0.1467 0.2013 0.04785
+aagtc 0.2589 0.2586 0.2093
+aagtg 0.4554 0.1814 0.5486
+aagtt 0.139 0.3587 0.1943
+aataa 0.3354 0.3721 0.005556
+aatac 0.2252 0.2409 0.6811
+aatag 0.2842 0.1651 0.005556
+aatat 0.1553 0.2219 0.3078
+aatca 0.313 0.3079 0.2164
+aatcc 0.2889 0.1983 0.2687
+aatcg 0.2508 0.1581 0.2968
+aatct 0.1474 0.3356 0.2181
+aatga 0.286 0.3389 0.006784
+aatgc 0.2506 0.243 0.3528
+aatgg 0.3104 0.1684 0.3338
+aatgt 0.153 0.2497 0.3066
+aatta 0.1468 0.2621 0.082
+aattc 0.2545 0.2749 0.4385
+aattg 0.452 0.1176 0.2201
+aattt 0.1468 0.3453 0.2594
+acaaa 0.23 0.4197 0.1355
+acaac 0.3442 0.2152 0.3298
+acaag 0.3092 0.1832 0.457
+acaat 0.1167 0.1819 0.07773
+acaca 0.3233 0.3282 0.1551
+acacc 0.2153 0.2065 0.3163
+acacg 0.305 0.2078 0.4421
+acact 0.1564 0.2574 0.08651
+acaga 0.3185 0.3781 0.1249
+acagc 0.3245 0.2607 0.5934
+acagg 0.27 0.1654 0.1741
+acagt 0.08698 0.1958 0.1077
+acata 0.1771 0.1538 0.05283
+acatc 0.2631 0.3402 0.4596
+acatg 0.3853 0.1684 0.3332
+acatt 0.1746 0.3376 0.1544
+accaa 0.2436 0.3453 0.08707
+accac 0.2965 0.2588 0.3825
+accag 0.3126 0.1084 0.4709
+accat 0.1473 0.2875 0.05949
+accca 0.3169 0.2457 0.1986
+acccc 0.2114 0.2284 0.3623
+acccg 0.2793 0.1416 0.325
+accct 0.1924 0.3843 0.114
+accga 0.1501 0.3361 0.09422
+accgc 0.3394 0.2198 0.5576
+accgg 0.3245 0.1562 0.2216
+accgt 0.1859 0.2879 0.1265
+accta 0.1451 0.1661 0.0361
+acctc 0.3302 0.2818 0.3246
+acctg 0.3796 0.1769 0.575
+acctt 0.1451 0.3753 0.0643
+acgaa 0.1758 0.275 0.07902
+acgac 0.3458 0.281 0.3879
+acgag 0.3411 0.2233 0.417
+acgat 0.1374 0.2207 0.1161
+acgca 0.3364 0.2463 0.1455
+acgcc 0.215 0.1758 0.4026
+acgcg 0.2686 0.2214 0.3245
+acgct 0.18 0.3565 0.1273
+acgga 0.1767 0.3416 0.1522
+acggc 0.4668 0.2504 0.4646
+acggg 0.2821 0.2301 0.2761
+acggt 0.0744 0.1779 0.1071
+acgta 0.1264 0.1638 0.04582
+acgtc 0.2352 0.2489 0.2555
+acgtg 0.5387 0.3325 0.6195
+acgtt 0.09963 0.2548 0.07916
+actaa 0.2266 0.3103 0.001666
+actac 0.4415 0.3691 0.8504
+actag 0.2212 0.09118 0.001666
+actat 0.1107 0.2294 0.1463
+actca 0.3726 0.2334 0.1114
+actcc 0.1395 0.2566 0.2993
+actcg 0.3059 0.2135 0.445
+actct 0.182 0.2965 0.1443
+actga 0.1901 0.2318 0.001529
+actgc 0.336 0.2932 0.5404
+actgg 0.3559 0.2151 0.3382
+actgt 0.118 0.2598 0.1199
+actta 0.1576 0.1123 0.02585
+acttc 0.2808 0.3127 0.553
+acttg 0.3468 0.2257 0.2054
+acttt 0.2148 0.3494 0.2157
+agaaa 0.2473 0.3377 0.1389
+agaac 0.1837 0.175 0.2496
+agaag 0.4492 0.2646 0.5403
+agaat 0.1198 0.2227 0.07122
+agaca 0.2873 0.2897 0.1522
+agacc 0.2148 0.2971 0.2734
+agacg 0.3169 0.2544 0.4637
+agact 0.181 0.1588 0.1107
+agaga 0.2937 0.4104 0.147
+agagc 0.2231 0.248 0.4563
+agagg 0.3577 0.1999 0.2892
+agagt 0.1255 0.1417 0.1075
+agata 0.1421 0.1695 0.0488
+agatc 0.1964 0.2254 0.3983
+agatg 0.5404 0.2229 0.4101
+agatt 0.1211 0.3823 0.1428
+agcaa 0.1829 0.3133 0.08686
+agcac 0.2419 0.1889 0.2613
+agcag 0.4431 0.2299 0.5836
+agcat 0.1321 0.268 0.06821
+agcca 0.3374 0.2662 0.1878
+agccc 0.2018 0.1715 0.3735
+agccg 0.2998 0.1933 0.3156
+agcct 0.161 0.369 0.1231
+agcga 0.2042 0.3629 0.1425
+agcgc 0.2904 0.1971 0.4346
+agcgg 0.345 0.2159 0.3162
+agcgt 0.1604 0.224 0.1066
+agcta 0.1425 0.1585 0.03418
+agctc 0.2574 0.3055 0.2718
+agctg 0.4926 0.2519 0.6079
+agctt 0.1075 0.2841 0.08614
+aggaa 0.2158 0.3726 0.09889
+aggac 0.1868 0.1879 0.2409
+aggag 0.5194 0.222 0.5569
+aggat 0.07804 0.2175 0.1033
+aggca 0.3055 0.3075 0.1538
+aggcc 0.2432 0.2081 0.3538
+aggcg 0.3067 0.184 0.3615
+aggct 0.1447 0.3004 0.1308
+aggga 0.2631 0.3907 0.1505
+agggc 0.2816 0.241 0.4713
+agggg 0.3385 0.2052 0.2543
+agggt 0.1167 0.1632 0.1239
+aggta 0.1378 0.1778 0.0579
+aggtc 0.1986 0.2237 0.1817
+aggtg 0.5173 0.2527 0.6458
+aggtt 0.1462 0.3458 0.1146
+agtaa 0.2136 0.4433 0.001748
+agtac 0.3393 0.2557 0.8269
+agtag 0.3413 0.1286 0.001748
+agtat 0.1058 0.1725 0.1696
+agtca 0.3162 0.2444 0.1301
+agtcc 0.2463 0.2521 0.2574
+agtcg 0.2493 0.2058 0.4331
+agtct 0.1882 0.2976 0.1794
+agtga 0.2758 0.3438 0.001685
+agtgc 0.222 0.214 0.4826
+agtgg 0.3556 0.2935 0.3566
+agtgt 0.1466 0.1487 0.1591
+agtta 0.09804 0.1015 0.02993
+agttc 0.2617 0.3794 0.5298
+agttg 0.48 0.1032 0.1992
+agttt 0.1603 0.416 0.2411
+ataaa 0.25 0.42 0.2773
+ataac 0.25 0.1874 0.2421
+ataag 0.25 0.1284 0.3176
+ataat 0.25 0.2642 0.1631
+ataca 0.3061 0.4046 0.2465
+atacc 0.26 0.1869 0.2659
+atacg 0.2429 0.1882 0.3573
+atact 0.1909 0.2202 0.1302
+ataga 0.25 0.4418 0.1701
+atagc 0.25 0.2395 0.4094
+atagg 0.25 0.1007 0.2073
+atagt 0.25 0.218 0.2132
+atata 0.1325 0.1277 0.1196
+atatc 0.2813 0.3121 0.3786
+atatg 0.3623 0.1688 0.3238
+atatt 0.2239 0.3915 0.1781
+atcaa 0.1746 0.3605 0.185
+atcac 0.2758 0.2189 0.3248
+atcag 0.3244 0.1285 0.3701
+atcat 0.2252 0.2921 0.1201
+atcca 0.3451 0.2349 0.2637
+atccc 0.2594 0.2014 0.3304
+atccg 0.1593 0.2163 0.1985
+atcct 0.2362 0.3474 0.2074
+atcga 0.2045 0.3403 0.1524
+atcgc 0.3082 0.2641 0.4115
+atcgg 0.3473 0.1603 0.2591
+atcgt 0.14 0.2353 0.177
+atcta 0.132 0.2027 0.06297
+atctc 0.313 0.2731 0.3257
+atctg 0.3555 0.1856 0.4859
+atctt 0.1996 0.3386 0.1255
+atgaa 0.25 0.355 0.1889
+atgac 0.25 0.2035 0.3293
+atgag 0.25 0.1851 0.3329
+atgat 0.25 0.2563 0.1489
+atgca 0.316 0.2607 0.1867
+atgcc 0.3808 0.1468 0.4121
+atgcg 0.1539 0.1952 0.2199
+atgct 0.1493 0.3973 0.1813
+atgga 0.3178 0.4009 0.2185
+atggc 0.2184 0.2487 0.4263
+atggg 0.3253 0.154 0.2362
+atggt 0.1385 0.1964 0.1189
+atgta 0.1419 0.1454 0.08468
+atgtc 0.202 0.2533 0.2444
+atgtg 0.4962 0.2289 0.5218
+atgtt 0.1598 0.3724 0.1491
+attaa 0.2862 0.4784 0.006297
+attac 0.2523 0.157 0.6448
+attag 0.2472 0.06998 0.006297
+attat 0.2142 0.2945 0.3426
+attca 0.3342 0.2552 0.1611
+attcc 0.2654 0.2898 0.391
+attcg 0.1562 0.2083 0.2151
+attct 0.2441 0.2467 0.2328
+attga 0.1764 0.3317 0.007321
+attgc 0.248 0.2277 0.388
+attgg 0.3677 0.2201 0.3367
+attgt 0.2079 0.2204 0.2679
+attta 0.1187 0.1984 0.1099
+atttc 0.1971 0.2651 0.3387
+atttg 0.5392 0.2353 0.3048
+atttt 0.1451 0.3012 0.2466
+caaaa 0.2265 0.2947 0.1842
+caaac 0.2661 0.1971 0.2919
+caaag 0.3731 0.1871 0.3905
+caaat 0.1343 0.321 0.1335
+caaca 0.3229 0.3396 0.1982
+caacc 0.2556 0.2411 0.3147
+caacg 0.2723 0.1724 0.2999
+caact 0.1491 0.2468 0.1872
+caaga 0.2587 0.3593 0.2013
+caagc 0.2636 0.2331 0.4027
+caagg 0.3289 0.2077 0.1546
+caagt 0.1487 0.1999 0.2414
+caata 0.1058 0.1851 0.1252
+caatc 0.2278 0.3816 0.3613
+caatg 0.5733 0.2078 0.3312
+caatt 0.09311 0.2254 0.1823
+cacaa 0.2226 0.3447 0.156
+cacac 0.2876 0.2117 0.2627
+cacag 0.3478 0.1675 0.4863
+cacat 0.142 0.2761 0.09506
+cacca 0.4052 0.2756 0.191
+caccc 0.138 0.2114 0.3905
+caccg 0.2774 0.1982 0.2673
+cacct 0.1794 0.3148 0.1513
+cacga 0.1424 0.2899 0.1438
+cacgc 0.3281 0.2536 0.3687
+cacgg 0.342 0.1996 0.2888
+cacgt 0.1875 0.2569 0.1988
+cacta 0.1741 0.1918 0.063
+cactc 0.3045 0.2752 0.3132
+cactg 0.3756 0.2372 0.4839
+cactt 0.1458 0.2957 0.1399
+cagaa 0.2398 0.3461 0.1646
+cagac 0.2582 0.1836 0.2437
+cagag 0.3742 0.2 0.4533
+cagat 0.1278 0.2703 0.1384
+cagca 0.3481 0.3454 0.2792
+cagcc 0.2066 0.1545 0.319
+cagcg 0.3041 0.1855 0.2175
+cagct 0.1412 0.3146 0.1844
+cagga 0.3037 0.3645 0.2606
+caggc 0.2506 0.2842 0.3425
+caggg 0.3513 0.1811 0.2578
+caggt 0.09444 0.1702 0.1391
+cagta 0.1276 0.204 0.09313
+cagtc 0.2291 0.2406 0.2636
+cagtg 0.5293 0.2237 0.4855
+cagtt 0.1141 0.3316 0.1578
+cataa 0.2534 0.3841 0.008091
+catac 0.226 0.2348 0.6699
+catag 0.2907 0.1207 0.008091
+catat 0.2298 0.2604 0.3139
+catca 0.3032 0.269 0.2506
+catcc 0.2462 0.1636 0.2855
+catcg 0.2991 0.2273 0.2389
+catct 0.1515 0.3401 0.2251
+catga 0.2043 0.3032 0.005313
+catgc 0.2538 0.2321 0.356
+catgg 0.3764 0.2248 0.3475
+catgt 0.1655 0.2399 0.2912
+catta 0.1641 0.1246 0.09456
+cattc 0.239 0.2597 0.3828
+cattg 0.473 0.2515 0.2785
+cattt 0.1239 0.3643 0.2441
+ccaaa 0.2804 0.3816 0.1099
+ccaac 0.2155 0.2444 0.3427
+ccaag 0.3952 0.1924 0.4773
+ccaat 0.1089 0.1816 0.07007
+ccaca 0.2692 0.2439 0.1392
+ccacc 0.2776 0.3096 0.4552
+ccacg 0.2777 0.2215 0.3117
+ccact 0.1755 0.2249 0.09383
+ccaga 0.2375 0.4361 0.07713
+ccagc 0.3083 0.2573 0.5996
+ccagg 0.3284 0.1638 0.1865
+ccagt 0.1257 0.1428 0.1368
+ccata 0.104 0.1363 0.04507
+ccatc 0.2834 0.2902 0.4941
+ccatg 0.4742 0.2148 0.3589
+ccatt 0.1385 0.3587 0.1019
+cccaa 0.1369 0.3389 0.09428
+cccac 0.335 0.2571 0.3354
+cccag 0.3976 0.163 0.4856
+cccat 0.1305 0.241 0.08471
+cccca 0.3304 0.2021 0.1508
+ccccc 0.186 0.3156 0.3937
+ccccg 0.3596 0.1861 0.335
+cccct 0.1239 0.2962 0.1205
+cccga 0.1487 0.3508 0.1088
+cccgc 0.3656 0.2163 0.4116
+cccgg 0.3498 0.2043 0.2992
+cccgt 0.136 0.2286 0.1805
+cccta 0.0693 0.1288 0.04308
+ccctc 0.352 0.3208 0.3673
+ccctg 0.4461 0.2345 0.5023
+ccctt 0.1326 0.3159 0.08735
+ccgaa 0.2262 0.1834 0.06036
+ccgac 0.219 0.2927 0.4156
+ccgag 0.4139 0.2866 0.4245
+ccgat 0.141 0.2373 0.09956
+ccgca 0.2846 0.2238 0.1084
+ccgcc 0.2409 0.2844 0.4923
+ccgcg 0.2868 0.1755 0.2714
+ccgct 0.1877 0.3163 0.1279
+ccgga 0.1354 0.3073 0.161
+ccggc 0.4871 0.3449 0.4868
+ccggg 0.3012 0.2032 0.25
+ccggt 0.07626 0.1446 0.1022
+ccgta 0.1071 0.1745 0.03992
+ccgtc 0.2128 0.2503 0.311
+ccgtg 0.543 0.2792 0.5725
+ccgtt 0.1372 0.296 0.07661
+cctaa 0.1966 0.3327 0.002357
+cctac 0.4885 0.2982 0.8633
+cctag 0.2357 0.18 0.002357
+cctat 0.0792 0.1891 0.132
+cctca 0.3414 0.2018 0.1061
+cctcc 0.1659 0.3536 0.4786
+cctcg 0.2721 0.1766 0.2774
+cctct 0.2206 0.2681 0.138
+cctga 0.1345 0.2716 0.00194
+cctgc 0.3703 0.262 0.5188
+cctgg 0.3835 0.2668 0.3566
+cctgt 0.1116 0.1996 0.1226
+cctta 0.1248 0.1251 0.02928
+ccttc 0.2868 0.3872 0.6328
+ccttg 0.4025 0.2171 0.2049
+ccttt 0.1859 0.2706 0.133
+cgaaa 0.1836 0.2893 0.136
+cgaac 0.226 0.2503 0.3598
+cgaag 0.448 0.1415 0.4192
+cgaat 0.1424 0.3189 0.08496
+cgaca 0.2428 0.2649 0.1537
+cgacc 0.2491 0.1838 0.2998
+cgacg 0.3396 0.2459 0.4502
+cgact 0.1685 0.3054 0.09629
+cgaga 0.2104 0.3576 0.1024
+cgagc 0.2709 0.2648 0.5188
+cgagg 0.3738 0.1937 0.2474
+cgagt 0.1449 0.1839 0.1314
+cgata 0.0862 0.1382 0.09513
+cgatc 0.1902 0.2208 0.3345
+cgatg 0.5646 0.2525 0.4158
+cgatt 0.159 0.3884 0.1545
+cgcaa 0.1742 0.3371 0.08487
+cgcac 0.3757 0.256 0.3698
+cgcag 0.3662 0.1567 0.4954
+cgcat 0.08392 0.2502 0.04992
+cgcca 0.3041 0.2738 0.1426
+cgccc 0.1565 0.1418 0.3745
+cgccg 0.396 0.2587 0.3838
+cgcct 0.1434 0.3257 0.09911
+cgcga 0.1153 0.3353 0.114
+cgcgc 0.3685 0.2516 0.451
+cgcgg 0.3234 0.1712 0.3049
+cgcgt 0.1927 0.2419 0.1301
+cgcta 0.1213 0.1796 0.03622
+cgctc 0.3204 0.2842 0.3154
+cgctg 0.4413 0.2579 0.5815
+cgctt 0.117 0.2783 0.06685
+cggaa 0.1458 0.3258 0.08126
+cggac 0.2208 0.1874 0.3001
+cggag 0.5198 0.3061 0.5205
+cggat 0.1136 0.1806 0.09818
+cggca 0.2556 0.2722 0.1084
+cggcc 0.2021 0.2154 0.3492
+cggcg 0.3597 0.247 0.4171
+cggct 0.1825 0.2653 0.1252
+cggga 0.167 0.4044 0.1812
+cgggc 0.342 0.2217 0.4288
+cgggg 0.3811 0.2232 0.2838
+cgggt 0.1099 0.1507 0.1062
+cggta 0.1068 0.1217 0.03927
+cggtc 0.1872 0.3102 0.1899
+cggtg 0.5643 0.3016 0.715
+cggtt 0.1417 0.2665 0.05592
+cgtaa 0.1908 0.2804 0.002675
+cgtac 0.294 0.29 0.8694
+cgtag 0.4037 0.1601 0.002675
+cgtat 0.1115 0.2695 0.1252
+cgtca 0.3762 0.2462 0.09964
+cgtcc 0.1472 0.1649 0.285
+cgtcg 0.3068 0.1844 0.4525
+cgtct 0.1699 0.4046 0.1629
+cgtga 0.1532 0.2409 0.00148
+cgtgc 0.3149 0.2582 0.4216
+cgtgg 0.3585 0.2794 0.3795
+cgtgt 0.1735 0.2216 0.1975
+cgtta 0.1023 0.1217 0.04086
+cgttc 0.3514 0.284 0.5347
+cgttg 0.3535 0.1802 0.2088
+cgttt 0.1927 0.4141 0.2156
+ctaaa 0.25 0.3627 0.212
+ctaac 0.25 0.2181 0.2269
+ctaag 0.25 0.1275 0.4573
+ctaat 0.25 0.2917 0.1038
+ctaca 0.2869 0.2502 0.2592
+ctacc 0.2755 0.2374 0.4568
+ctacg 0.2596 0.1949 0.1857
+ctact 0.1781 0.3176 0.09827
+ctaga 0.25 0.3427 0.1701
+ctagc 0.25 0.3213 0.4094
+ctagg 0.25 0.212 0.2073
+ctagt 0.25 0.124 0.2132
+ctata 0.1206 0.1223 0.117
+ctatc 0.2573 0.3121 0.3617
+ctatg 0.4651 0.1998 0.3191
+ctatt 0.1569 0.3658 0.2021
+ctcaa 0.2211 0.363 0.1784
+ctcac 0.2844 0.2256 0.3145
+ctcag 0.2934 0.1068 0.3883
+ctcat 0.2011 0.3046 0.1188
+ctcca 0.3298 0.2156 0.2042
+ctccc 0.1908 0.2159 0.3517
+ctccg 0.2509 0.1973 0.2799
+ctcct 0.2285 0.3711 0.1641
+ctcga 0.09879 0.2732 0.1423
+ctcgc 0.3485 0.2828 0.4875
+ctcgg 0.3917 0.1743 0.2064
+ctcgt 0.161 0.2698 0.1638
+ctcta 0.1058 0.196 0.05359
+ctctc 0.3829 0.3259 0.3151
+ctctg 0.3764 0.1297 0.5034
+ctctt 0.1349 0.3484 0.1279
+ctgaa 0.25 0.3267 0.1508
+ctgac 0.25 0.235 0.341
+ctgag 0.25 0.2321 0.3504
+ctgat 0.25 0.2062 0.1578
+ctgca 0.2497 0.2574 0.2109
+ctgcc 0.3275 0.1766 0.3799
+ctgcg 0.24 0.2046 0.2019
+ctgct 0.1828 0.3614 0.2073
+ctgga 0.2181 0.3793 0.2333
+ctggc 0.2364 0.2377 0.3624
+ctggg 0.3929 0.2024 0.2524
+ctggt 0.1526 0.1807 0.1519
+ctgta 0.1077 0.1468 0.07909
+ctgtc 0.2713 0.3113 0.2342
+ctgtg 0.516 0.2919 0.5312
+ctgtt 0.105 0.25 0.1555
+cttaa 0.2862 0.3555 0.007725
+cttac 0.2523 0.2576 0.6991
+cttag 0.2472 0.1778 0.007725
+cttat 0.2142 0.2092 0.2854
+cttca 0.2849 0.2706 0.2276
+cttcc 0.3066 0.3091 0.3429
+cttcg 0.1963 0.1309 0.2698
+cttct 0.2122 0.2894 0.1596
+cttga 0.1835 0.2861 0.005618
+cttgc 0.2921 0.251 0.4427
+cttgg 0.3737 0.2134 0.2966
+cttgt 0.1506 0.2496 0.2551
+cttta 0.1071 0.1584 0.1349
+ctttc 0.1603 0.2741 0.3462
+ctttg 0.6274 0.2182 0.3655
+ctttt 0.1052 0.3494 0.1534
+gaaaa 0.245 0.3475 0.179
+gaaac 0.2353 0.2052 0.354
+gaaag 0.3748 0.155 0.3214
+gaaat 0.1449 0.2924 0.1457
+gaaca 0.2774 0.3021 0.2159
+gaacc 0.2985 0.1848 0.3027
+gaacg 0.2732 0.1982 0.3099
+gaact 0.1508 0.315 0.1715
+gaaga 0.2946 0.4337 0.244
+gaagc 0.2711 0.2222 0.3631
+gaagg 0.3175 0.2005 0.236
+gaagt 0.1167 0.1436 0.1569
+gaata 0.1388 0.2023 0.1104
+gaatc 0.3033 0.2618 0.3968
+gaatg 0.4315 0.2126 0.2989
+gaatt 0.1265 0.3232 0.1939
+gacaa 0.1596 0.2997 0.1273
+gacac 0.3264 0.2311 0.352
+gacag 0.3819 0.1679 0.3819
+gacat 0.1321 0.3013 0.1388
+gacca 0.3036 0.204 0.1631
+gaccc 0.2502 0.2546 0.4465
+gaccg 0.2819 0.174 0.2306
+gacct 0.1643 0.3674 0.1598
+gacga 0.1577 0.4013 0.2008
+gacgc 0.3366 0.2298 0.385
+gacgg 0.3513 0.164 0.2583
+gacgt 0.1545 0.2049 0.1558
+gacta 0.08921 0.1686 0.0641
+gactc 0.3026 0.2791 0.3959
+gactg 0.402 0.2108 0.4231
+gactt 0.2061 0.3415 0.1169
+gagaa 0.2773 0.346 0.1252
+gagac 0.2379 0.2052 0.3168
+gagag 0.3962 0.2135 0.3945
+gagat 0.0886 0.2353 0.1635
+gagca 0.2587 0.2439 0.2111
+gagcc 0.257 0.1639 0.3195
+gagcg 0.3272 0.2196 0.2943
+gagct 0.157 0.3726 0.1751
+gagga 0.2771 0.461 0.2792
+gaggc 0.2855 0.2228 0.3115
+gaggg 0.322 0.153 0.2847
+gaggt 0.1154 0.1632 0.1247
+gagta 0.123 0.1962 0.09667
+gagtc 0.2352 0.2483 0.2253
+gagtg 0.5263 0.2155 0.4664
+gagtt 0.1155 0.34 0.2116
+gataa 0.2869 0.4172 0.008897
+gatac 0.2399 0.2151 0.6793
+gatag 0.2982 0.06102 0.008897
+gatat 0.175 0.3066 0.3029
+gatca 0.2321 0.2487 0.2719
+gatcc 0.307 0.2302 0.2432
+gatcg 0.3187 0.2218 0.2544
+gatct 0.1421 0.2993 0.2305
+gatga 0.2331 0.3933 0.007924
+gatgc 0.2597 0.2066 0.2647
+gatgg 0.374 0.2087 0.4596
+gatgt 0.1332 0.1913 0.2678
+gatta 0.1576 0.2172 0.1074
+gattc 0.2467 0.2337 0.4034
+gattg 0.4371 0.1675 0.196
+gattt 0.1585 0.3816 0.2931
+gcaaa 0.1932 0.3709 0.1366
+gcaac 0.2463 0.2108 0.2897
+gcaag 0.4419 0.1971 0.4974
+gcaat 0.1186 0.2212 0.07625
+gcaca 0.2713 0.3134 0.1631
+gcacc 0.2626 0.151 0.3618
+gcacg 0.3252 0.2685 0.386
+gcact 0.1409 0.2671 0.08914
+gcaga 0.2256 0.3556 0.08611
+gcagc 0.3555 0.3145 0.6185
+gcagg 0.2934 0.1743 0.1691
+gcagt 0.1255 0.1557 0.1263
+gcata 0.07854 0.118 0.0344
+gcatc 0.369 0.3623 0.4578
+gcatg 0.3798 0.1935 0.3791
+gcatt 0.1727 0.3261 0.1287
+gccaa 0.1886 0.301 0.08236
+gccac 0.3494 0.2514 0.4226
+gccag 0.3142 0.1205 0.421
+gccat 0.1479 0.3271 0.07395
+gccca 0.3194 0.2396 0.1829
+gcccc 0.1847 0.1835 0.4131
+gcccg 0.3335 0.193 0.255
+gccct 0.1624 0.3839 0.1489
+gccga 0.1172 0.2942 0.1077
+gccgc 0.4048 0.286 0.5863
+gccgg 0.323 0.1938 0.1976
+gccgt 0.1551 0.226 0.1085
+gccta 0.05405 0.189 0.03373
+gcctc 0.3563 0.303 0.4127
+gcctg 0.4586 0.2047 0.4897
+gcctt 0.131 0.3032 0.06384
+gcgaa 0.1264 0.1848 0.07755
+gcgac 0.2669 0.2699 0.3769
+gcgag 0.4616 0.313 0.4547
+gcgat 0.1451 0.2322 0.09089
+gcgca 0.2806 0.2378 0.09717
+gcgcc 0.2067 0.1806 0.4989
+gcgcg 0.2999 0.205 0.2878
+gcgct 0.2128 0.3766 0.1161
+gcgga 0.1782 0.2783 0.171
+gcggc 0.4363 0.388 0.5151
+gcggg 0.294 0.1677 0.1986
+gcggt 0.0915 0.166 0.1153
+gcgta 0.1005 0.1644 0.04304
+gcgtc 0.2699 0.2522 0.2988
+gcgtg 0.5238 0.3016 0.5765
+gcgtt 0.1058 0.2818 0.08168
+gctaa 0.222 0.4314 0.001938
+gctac 0.424 0.2352 0.886
+gctag 0.2037 0.09579 0.001938
+gctat 0.1504 0.2375 0.1101
+gctca 0.3578 0.2757 0.09821
+gctcc 0.1254 0.1981 0.4079
+gctcg 0.3293 0.2456 0.3666
+gctct 0.1874 0.2805 0.1273
+gctga 0.1401 0.2597 0.001314
+gctgc 0.3929 0.3232 0.489
+gctgg 0.3276 0.2149 0.3418
+gctgt 0.1394 0.2023 0.1679
+gctta 0.1176 0.09579 0.02605
+gcttc 0.2958 0.3185 0.606
+gcttg 0.4313 0.2329 0.1877
+gcttt 0.1554 0.3528 0.1802
+ggaaa 0.246 0.3567 0.1741
+ggaac 0.1673 0.2275 0.271
+ggaag 0.4529 0.1848 0.4629
+ggaat 0.1338 0.2309 0.09198
+ggaca 0.2812 0.2384 0.1555
+ggacc 0.2389 0.258 0.2766
+ggacg 0.3421 0.221 0.4507
+ggact 0.1378 0.2826 0.1172
+ggaga 0.2434 0.3218 0.1831
+ggagc 0.2731 0.2424 0.3973
+ggagg 0.3714 0.2959 0.3017
+ggagt 0.112 0.14 0.1179
+ggata 0.09486 0.1896 0.1067
+ggatc 0.2012 0.2302 0.3635
+ggatg 0.5923 0.2074 0.3854
+ggatt 0.1116 0.3728 0.1444
+ggcaa 0.172 0.277 0.107
+ggcac 0.2905 0.2497 0.2725
+ggcag 0.4018 0.1948 0.5621
+ggcat 0.1357 0.2785 0.05851
+ggcca 0.3049 0.2305 0.1611
+ggccc 0.1547 0.1477 0.3646
+ggccg 0.375 0.2485 0.3236
+ggcct 0.1654 0.3733 0.1507
+ggcga 0.1541 0.2875 0.1195
+ggcgc 0.3455 0.2093 0.4488
+ggcgg 0.3612 0.2784 0.2944
+ggcgt 0.1392 0.2248 0.1374
+ggcta 0.1 0.1601 0.05313
+ggctc 0.3021 0.3331 0.3194
+ggctg 0.4885 0.232 0.5354
+ggctt 0.1093 0.2749 0.09208
+gggaa 0.225 0.372 0.1012
+gggac 0.191 0.196 0.3069
+gggag 0.4601 0.2112 0.4955
+gggat 0.1239 0.2208 0.09644
+gggca 0.2706 0.2733 0.1834
+gggcc 0.2471 0.2304 0.3539
+gggcg 0.3015 0.2012 0.3076
+gggct 0.1808 0.2952 0.155
+gggga 0.2166 0.3437 0.2367
+ggggc 0.3587 0.24 0.3746
+ggggg 0.3182 0.2429 0.2494
+ggggt 0.1066 0.1734 0.1393
+gggta 0.128 0.1904 0.07215
+gggtc 0.2748 0.2208 0.2673
+gggtg 0.4871 0.2428 0.5787
+gggtt 0.1102 0.3459 0.08187
+ggtaa 0.2006 0.2359 0.005342
+ggtac 0.3209 0.3215 0.8547
+ggtag 0.3321 0.2046 0.005342
+ggtat 0.1465 0.238 0.1346
+ggtca 0.3513 0.2514 0.1681
+ggtcc 0.218 0.1954 0.2716
+ggtcg 0.2862 0.2623 0.3461
+ggtct 0.1444 0.2909 0.2142
+ggtga 0.1963 0.2501 0.003344
+ggtgc 0.3022 0.1908 0.3271
+ggtgg 0.371 0.3827 0.4314
+ggtgt 0.1305 0.1764 0.2381
+ggtta 0.1057 0.1651 0.0479
+ggttc 0.325 0.2186 0.4168
+ggttg 0.3601 0.1744 0.2725
+ggttt 0.2092 0.4419 0.2629
+gtaaa 0.25 0.3614 0.2358
+gtaac 0.25 0.2459 0.3168
+gtaag 0.25 0.1518 0.2821
+gtaat 0.25 0.2409 0.1653
+gtaca 0.2773 0.2568 0.3593
+gtacc 0.2776 0.2297 0.264
+gtacg 0.3032 0.3203 0.2965
+gtact 0.1419 0.1933 0.08023
+gtaga 0.25 0.2943 0.1445
+gtagc 0.25 0.2831 0.4239
+gtagg 0.25 0.2277 0.2466
+gtagt 0.25 0.1949 0.185
+gtata 0.1034 0.1513 0.189
+gtatc 0.2391 0.3113 0.2842
+gtatg 0.468 0.2017 0.3572
+gtatt 0.1894 0.3357 0.1695
+gtcaa 0.2079 0.31 0.1954
+gtcac 0.3684 0.2567 0.4108
+gtcag 0.2553 0.1305 0.2676
+gtcat 0.1684 0.3028 0.1263
+gtcca 0.32 0.1994 0.2095
+gtccc 0.2277 0.2769 0.3584
+gtccg 0.3007 0.1651 0.2005
+gtcct 0.1516 0.3586 0.2316
+gtcga 0.1499 0.2519 0.1595
+gtcgc 0.3638 0.2684 0.4916
+gtcgg 0.3203 0.224 0.2099
+gtcgt 0.166 0.2556 0.1389
+gtcta 0.07199 0.1914 0.06845
+gtctc 0.3853 0.3207 0.3676
+gtctg 0.4263 0.1573 0.3976
+gtctt 0.1165 0.3306 0.1664
+gtgaa 0.25 0.3442 0.165
+gtgac 0.25 0.2284 0.3523
+gtgag 0.25 0.2095 0.3367
+gtgat 0.25 0.218 0.146
+gtgca 0.2325 0.2381 0.1828
+gtgcc 0.2475 0.203 0.386
+gtgcg 0.3585 0.2269 0.2666
+gtgct 0.1615 0.3321 0.1646
+gtgga 0.2564 0.3777 0.2119
+gtggc 0.2917 0.247 0.3611
+gtggg 0.2985 0.1603 0.2022
+gtggt 0.1534 0.2149 0.2247
+gtgta 0.1014 0.1232 0.1101
+gtgtc 0.2527 0.2821 0.2582
+gtgtg 0.4946 0.2959 0.519
+gtgtt 0.1513 0.2989 0.1126
+gttaa 0.1805 0.3699 0.007725
+gttac 0.3757 0.2954 0.6991
+gttag 0.2523 0.06797 0.007725
+gttat 0.1915 0.2667 0.2854
+gttca 0.2756 0.234 0.1828
+gttcc 0.3177 0.2392 0.3712
+gttcg 0.2355 0.1873 0.2609
+gttct 0.1712 0.3395 0.1851
+gttga 0.1561 0.2679 0.008361
+gttgc 0.253 0.2363 0.3043
+gttgg 0.4357 0.2475 0.4314
+gttgt 0.1552 0.2483 0.2559
+gttta 0.09815 0.1669 0.1181
+gtttc 0.1748 0.2196 0.3823
+gtttg 0.6058 0.2909 0.3069
+gtttt 0.1213 0.3225 0.1927
+taaaa 0.2785 0.3359 0.2256
+taaac 0.2237 0.2033 0.2656
+taaag 0.3316 0.1651 0.3736
+taaat 0.1662 0.2957 0.1352
+taaca 0.3028 0.2921 0.2075
+taacc 0.2761 0.2186 0.2104
+taacg 0.283 0.1883 0.3469
+taact 0.1381 0.301 0.2351
+taaga 0.2973 0.3981 0.2127
+taagc 0.2483 0.2294 0.3748
+taagg 0.3097 0.196 0.1987
+taagt 0.1446 0.1765 0.2138
+taata 0.1443 0.2297 0.135
+taatc 0.1891 0.3065 0.2949
+taatg 0.4692 0.1847 0.3512
+taatt 0.1975 0.279 0.2189
+tacaa 0.1956 0.3576 0.1399
+tacac 0.2538 0.1992 0.2356
+tacag 0.3582 0.1619 0.4612
+tacat 0.1923 0.2814 0.1634
+tacca 0.4113 0.2787 0.2068
+taccc 0.2154 0.1739 0.426
+taccg 0.211 0.2008 0.2418
+tacct 0.1622 0.3466 0.1254
+tacga 0.1131 0.3753 0.1306
+tacgc 0.2838 0.2046 0.3551
+tacgg 0.3991 0.1961 0.2841
+tacgt 0.204 0.224 0.2302
+tacta 0.1377 0.2399 0.05063
+tactc 0.2975 0.25 0.3126
+tactg 0.3931 0.2089 0.5063
+tactt 0.1717 0.3012 0.1305
+tagaa 0.2658 0.374 0.2437
+tagac 0.2364 0.1835 0.2469
+tagag 0.3921 0.1955 0.4086
+tagat 0.1058 0.2469 0.1008
+tagca 0.208 0.2898 0.2441
+tagcc 0.3177 0.167 0.3073
+tagcg 0.3276 0.2022 0.2859
+tagct 0.1467 0.341 0.1627
+tagga 0.2827 0.4248 0.1948
+taggc 0.2833 0.2403 0.3604
+taggg 0.3288 0.1626 0.2577
+taggt 0.1052 0.1723 0.1871
+tagta 0.1318 0.1999 0.1114
+tagtc 0.2335 0.2495 0.1431
+tagtg 0.5143 0.2072 0.5407
+tagtt 0.1204 0.3435 0.2048
+tataa 0.2777 0.3816 0.008897
+tatac 0.2278 0.2274 0.6793
+tatag 0.2925 0.1617 0.008897
+tatat 0.202 0.2293 0.3029
+tatca 0.2694 0.2481 0.2027
+tatcc 0.3243 0.2301 0.404
+tatcg 0.2153 0.196 0.2302
+tatct 0.1909 0.3258 0.1631
+tatga 0.259 0.3201 0.007353
+tatgc 0.2231 0.2348 0.3224
+tatgg 0.321 0.2875 0.3868
+tatgt 0.1969 0.1576 0.2835
+tatta 0.1268 0.157 0.1156
+tattc 0.2645 0.2587 0.3252
+tattg 0.3991 0.1236 0.2789
+tattt 0.2097 0.4607 0.2803
+tcaaa 0.2555 0.4645 0.1022
+tcaac 0.2505 0.1717 0.3631
+tcaag 0.3712 0.165 0.4614
+tcaat 0.1228 0.1988 0.07338
+tcaca 0.3026 0.249 0.1471
+tcacc 0.2471 0.1849 0.4359
+tcacg 0.263 0.2479 0.3079
+tcact 0.1873 0.3183 0.1091
+tcaga 0.2692 0.3581 0.1037
+tcagc 0.3379 0.3235 0.5753
+tcagg 0.2503 0.1775 0.1776
+tcagt 0.1426 0.1409 0.1435
+tcata 0.04302 0.0647 0.04571
+tcatc 0.361 0.4291 0.484
+tcatg 0.3998 0.157 0.3368
+tcatt 0.1962 0.3492 0.1335
+tccaa 0.1701 0.3792 0.09019
+tccac 0.2826 0.2185 0.355
+tccag 0.3834 0.1202 0.4704
+tccat 0.1639 0.2822 0.08442
+tccca 0.3043 0.2847 0.189
+tcccc 0.1838 0.2105 0.3868
+tcccg 0.3055 0.1713 0.2643
+tccct 0.2064 0.3336 0.1598
+tccga 0.131 0.3028 0.1121
+tccgc 0.4278 0.2286 0.506
+tccgg 0.2559 0.1765 0.2371
+tccgt 0.1853 0.2922 0.1448
+tccta 0.0951 0.1526 0.04262
+tcctc 0.3004 0.3564 0.3451
+tcctg 0.4712 0.1545 0.5237
+tcctt 0.1333 0.3365 0.08852
+tcgaa 0.12 0.2363 0.07133
+tcgac 0.2676 0.2898 0.4317
+tcgag 0.421 0.2588 0.3941
+tcgat 0.1915 0.2151 0.1028
+tcgca 0.2541 0.2498 0.113
+tcgcc 0.233 0.221 0.4789
+tcgcg 0.2778 0.1682 0.2443
+tcgct 0.2352 0.3609 0.1638
+tcgga 0.1652 0.3626 0.1473
+tcggc 0.3876 0.2893 0.5327
+tcggg 0.3155 0.2042 0.2191
+tcggt 0.1317 0.1439 0.1008
+tcgta 0.08866 0.159 0.04723
+tcgtc 0.3247 0.3281 0.3268
+tcgtg 0.4577 0.2597 0.5513
+tcgtt 0.1289 0.2532 0.07471
+tctaa 0.1664 0.2572 0.001533
+tctac 0.442 0.2791 0.8571
+tctag 0.2891 0.2052 0.001533
+tctat 0.1025 0.2585 0.1398
+tctca 0.3336 0.2312 0.1329
+tctcc 0.192 0.2916 0.4401
+tctcg 0.2268 0.1782 0.2841
+tctct 0.2476 0.299 0.1429
+tctga 0.1898 0.2496 0.00188
+tctgc 0.3954 0.2547 0.5222
+tctgg 0.3045 0.2558 0.2944
+tctgt 0.1103 0.2399 0.1816
+tctta 0.07187 0.1178 0.02493
+tcttc 0.3508 0.3459 0.6786
+tcttg 0.382 0.2076 0.1546
+tcttt 0.1953 0.3286 0.1419
+tgaaa 0.2826 0.337 0.1391
+tgaac 0.135 0.2182 0.3267
+tgaag 0.4362 0.1976 0.4691
+tgaat 0.1462 0.2473 0.06502
+tgaca 0.3189 0.2578 0.1505
+tgacc 0.2458 0.243 0.2766
+tgacg 0.292 0.2361 0.4409
+tgact 0.1433 0.2631 0.132
+tgaga 0.2652 0.3463 0.1214
+tgagc 0.2543 0.249 0.4838
+tgagg 0.353 0.2531 0.2485
+tgagt 0.1275 0.1515 0.1462
+tgata 0.1309 0.1695 0.07172
+tgatc 0.152 0.2254 0.3407
+tgatg 0.5853 0.2229 0.4333
+tgatt 0.1318 0.3823 0.1542
+tgcaa 0.1623 0.3021 0.07819
+tgcac 0.2712 0.2228 0.2983
+tgcag 0.4045 0.2059 0.5444
+tgcat 0.162 0.2693 0.07918
+tgcca 0.3271 0.2338 0.1606
+tgccc 0.1883 0.1864 0.4204
+tgccg 0.3407 0.2105 0.3082
+tgcct 0.1439 0.3693 0.1108
+tgcga 0.176 0.3012 0.08957
+tgcgc 0.3103 0.2034 0.484
+tgcgg 0.3445 0.235 0.2653
+tgcgt 0.1692 0.2604 0.1611
+tgcta 0.09635 0.1835 0.02572
+tgctc 0.2389 0.2536 0.3158
+tgctg 0.562 0.2651 0.6008
+tgctt 0.1028 0.2978 0.05767
+tggaa 0.2042 0.3254 0.09402
+tggac 0.1825 0.2127 0.2932
+tggag 0.4731 0.2711 0.5104
+tggat 0.1402 0.1907 0.1024
+tggca 0.2991 0.2469 0.1414
+tggcc 0.2185 0.1752 0.3715
+tggcg 0.2695 0.2158 0.3454
+tggct 0.213 0.3621 0.1417
+tggga 0.2318 0.3466 0.1698
+tgggc 0.2851 0.2372 0.4687
+tgggg 0.3404 0.2062 0.2269
+tgggt 0.1427 0.21 0.1346
+tggta 0.1073 0.1832 0.04471
+tggtc 0.1888 0.2612 0.1507
+tggtg 0.5785 0.2938 0.7272
+tggtt 0.1253 0.2618 0.07738
+tgtaa 0.2586 0.2787 0.002182
+tgtac 0.2414 0.2395 0.811
+tgtag 0.2595 0.1625 0.002182
+tgtat 0.2405 0.3193 0.1846
+tgtca 0.3767 0.2653 0.1412
+tgtcc 0.1972 0.1854 0.3258
+tgtcg 0.2308 0.1632 0.3467
+tgtct 0.1952 0.3862 0.1864
+tgtga 0.1836 0.2287 0.001077
+tgtgc 0.2947 0.2643 0.4995
+tgtgg 0.3413 0.2386 0.3262
+tgtgt 0.1804 0.2684 0.1732
+tgtta 0.1527 0.1824 0.04249
+tgttc 0.1973 0.2678 0.4478
+tgttg 0.4717 0.2458 0.2316
+tgttt 0.1784 0.304 0.2781
+ttaaa 0.25 0.4302 0.2192
+ttaac 0.25 0.2135 0.3128
+ttaag 0.25 0.1461 0.2938
+ttaat 0.25 0.2103 0.1741
+ttaca 0.2618 0.3034 0.2227
+ttacc 0.3309 0.2659 0.3523
+ttacg 0.2011 0.1161 0.2466
+ttact 0.2062 0.3146 0.1784
+ttaga 0.25 0.3835 0.1701
+ttagc 0.25 0.2068 0.4094
+ttagg 0.25 0.1955 0.2073
+ttagt 0.25 0.2143 0.2132
+ttata 0.1447 0.1223 0.09465
+ttatc 0.2429 0.3121 0.3909
+ttatg 0.4173 0.1998 0.2809
+ttatt 0.1951 0.3658 0.2335
+ttcaa 0.2393 0.3092 0.1965
+ttcac 0.3098 0.2244 0.3018
+ttcag 0.2791 0.1508 0.3799
+ttcat 0.1718 0.3157 0.1218
+ttcca 0.3095 0.2486 0.2366
+ttccc 0.2153 0.2059 0.3646
+ttccg 0.3024 0.2085 0.2019
+ttcct 0.1728 0.3369 0.197
+ttcga 0.1506 0.3473 0.1564
+ttcgc 0.3444 0.2138 0.4182
+ttcgg 0.3203 0.1748 0.2602
+ttcgt 0.1847 0.2641 0.1652
+ttcta 0.1894 0.216 0.06436
+ttctc 0.3279 0.3196 0.3116
+ttctg 0.3539 0.1986 0.5047
+ttctt 0.1288 0.2658 0.1194
+ttgaa 0.25 0.323 0.1795
+ttgac 0.25 0.2727 0.312
+ttgag 0.25 0.2219 0.3903
+ttgat 0.25 0.1824 0.1182
+ttgca 0.2487 0.2645 0.2691
+ttgcc 0.2624 0.2087 0.3273
+ttgcg 0.2165 0.1957 0.2264
+ttgct 0.2724 0.3311 0.1772
+ttgga 0.2338 0.381 0.2344
+ttggc 0.2892 0.2693 0.3685
+ttggg 0.2723 0.165 0.238
+ttggt 0.2047 0.1847 0.1591
+ttgta 0.1713 0.1508 0.07314
+ttgtc 0.2759 0.2985 0.2649
+ttgtg 0.4383 0.3307 0.4977
+ttgtt 0.1146 0.22 0.1643
+tttaa 0.3262 0.3753 0.005807
+tttac 0.2046 0.2689 0.7805
+tttag 0.2846 0.1196 0.005807
+tttat 0.1846 0.2362 0.2079
+tttca 0.2379 0.3034 0.3041
+tttcc 0.3403 0.2398 0.288
+tttcg 0.1882 0.1463 0.1453
+tttct 0.2336 0.3106 0.2627
+tttga 0.1655 0.3378 0.004363
+tttgc 0.2667 0.2168 0.404
+tttgg 0.378 0.215 0.2574
+tttgt 0.1898 0.2304 0.3342
+tttta 0.09802 0.202 0.09164
+ttttc 0.2095 0.2326 0.3659
+ttttg 0.5225 0.2114 0.2842
+ttttt 0.17 0.354 0.2582
+
+
+#
+# Initial emission probabilities
+#
+[INITEMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.229 0.23 0.16
+aaaac 0.365 0.357 0.288
+aaaag 0.259 0.159 0.288
+aaaat 0.147 0.254 0.264
+aaaca 0.311 0.417 0.239
+aaacc 0.291 0.178 0.296
+aaacg 0.212 0.196 0.226
+aaact 0.185 0.209 0.239
+aaaga 0.237 0.315 0.347
+aaagc 0.195 0.277 0.235
+aaagg 0.406 0.185 0.265
+aaagt 0.162 0.223 0.153
+aaata 0.348 0.238 0.218
+aaatc 0.129 0.198 0.218
+aaatg 0.355 0.198 0.218
+aaatt 0.168 0.366 0.346
+aacaa 0.173 0.279 0.0962
+aacac 0.366 0.336 0.389
+aacag 0.193 0.206 0.312
+aacat 0.267 0.179 0.202
+aacca 0.42 0.263 0.212
+aaccc 0.155 0.182 0.321
+aaccg 0.213 0.292 0.255
+aacct 0.213 0.263 0.212
+aacga 0.279 0.422 0.101
+aacgc 0.183 0.238 0.384
+aacgg 0.417 0.141 0.247
+aacgt 0.121 0.199 0.268
+aacta 0.127 0.164 0.19
+aactc 0.299 0.31 0.352
+aactg 0.255 0.207 0.261
+aactt 0.318 0.319 0.197
+aagaa 0.158 0.36 0.188
+aagac 0.266 0.315 0.327
+aagag 0.394 0.197 0.359
+aagat 0.182 0.128 0.126
+aagca 0.266 0.314 0.294
+aagcc 0.257 0.261 0.266
+aagcg 0.245 0.128 0.28
+aagct 0.232 0.296 0.159
+aagga 0.243 0.287 0.372
+aaggc 0.316 0.218 0.246
+aaggg 0.294 0.267 0.202
+aaggt 0.147 0.227 0.18
+aagta 0.241 0.226 0.227
+aagtc 0.199 0.337 0.25
+aagtg 0.227 0.237 0.297
+aagtt 0.333 0.2 0.227
+aataa 0.248 0.193 0.175
+aatac 0.222 0.143 0.298
+aatag 0.359 0.329 0.175
+aatat 0.171 0.336 0.351
+aatca 0.243 0.348 0.196
+aatcc 0.243 0.363 0.28
+aatcg 0.279 0.144 0.385
+aatct 0.234 0.144 0.14
+aatga 0.242 0.286 0.148
+aatgc 0.283 0.247 0.319
+aatgg 0.384 0.33 0.244
+aatgt 0.0913 0.137 0.289
+aatta 0.38 0.174 0.243
+aattc 0.141 0.226 0.264
+aattg 0.254 0.374 0.264
+aattt 0.225 0.226 0.229
+acaaa 0.25 0.123 0.275
+acaac 0.25 0.288 0.196
+acaag 0.25 0.325 0.333
+acaat 0.25 0.264 0.196
+acaca 0.282 0.252 0.303
+acacc 0.206 0.176 0.145
+acacg 0.23 0.353 0.329
+acact 0.282 0.218 0.222
+acaga 0.328 0.417 0.139
+acagc 0.341 0.275 0.476
+acagg 0.234 0.171 0.149
+acagt 0.097 0.137 0.236
+acata 0.116 0.176 0.135
+acatc 0.283 0.371 0.367
+acatg 0.387 0.277 0.348
+acatt 0.214 0.176 0.15
+accaa 0.245 0.226 0.203
+accac 0.372 0.195 0.283
+accag 0.202 0.226 0.273
+accat 0.181 0.354 0.241
+accca 0.193 0.213 0.29
+acccc 0.16 0.4 0.294
+acccg 0.39 0.196 0.243
+accct 0.257 0.191 0.173
+accga 0.182 0.191 0.232
+accgc 0.414 0.407 0.384
+accgg 0.172 0.16 0.192
+accgt 0.232 0.241 0.192
+accta 0.252 0.154 0.15
+acctc 0.291 0.395 0.239
+acctg 0.232 0.238 0.5
+acctt 0.225 0.213 0.111
+acgaa 0.4 0.2 0.157
+acgac 0.187 0.25 0.207
+acgag 0.174 0.292 0.407
+acgat 0.239 0.258 0.229
+acgca 0.119 0.169 0.149
+acgcc 0.276 0.225 0.401
+acgcg 0.429 0.331 0.333
+acgct 0.176 0.275 0.117
+acgga 0.229 0.283 0.244
+acggc 0.258 0.425 0.421
+acggg 0.331 0.129 0.219
+acggt 0.182 0.163 0.116
+acgta 0.155 0.111 0.143
+acgtc 0.315 0.411 0.253
+acgtg 0.32 0.317 0.404
+acgtt 0.21 0.161 0.2
+actaa 0.159 0.18 0.122
+actac 0.286 0.261 0.402
+actag 0.23 0.261 0.122
+actat 0.325 0.297 0.354
+actca 0.205 0.231 0.184
+actcc 0.286 0.357 0.294
+actcg 0.317 0.167 0.328
+actct 0.193 0.244 0.194
+actga 0.3 0.25 0.0893
+actgc 0.362 0.386 0.362
+actgg 0.182 0.114 0.353
+actgt 0.156 0.25 0.196
+actta 0.147 0.186 0.167
+acttc 0.272 0.423 0.318
+acttg 0.331 0.224 0.345
+acttt 0.25 0.167 0.171
+agaaa 0.199 0.29 0.195
+agaac 0.231 0.197 0.166
+agaag 0.333 0.316 0.437
+agaat 0.237 0.197 0.202
+agaca 0.247 0.22 0.229
+agacc 0.16 0.28 0.262
+agacg 0.319 0.288 0.384
+agact 0.274 0.212 0.125
+agaga 0.28 0.189 0.26
+agagc 0.178 0.364 0.248
+agagg 0.4 0.342 0.335
+agagt 0.142 0.105 0.157
+agata 0.17 0.152 0.149
+agatc 0.29 0.288 0.33
+agatg 0.44 0.28 0.372
+agatt 0.1 0.28 0.149
+agcaa 0.213 0.274 0.076
+agcac 0.243 0.142 0.205
+agcag 0.349 0.35 0.551
+agcat 0.196 0.234 0.167
+agcca 0.181 0.157 0.201
+agccc 0.32 0.165 0.318
+agccg 0.241 0.352 0.327
+agcct 0.258 0.326 0.154
+agcga 0.188 0.215 0.121
+agcgc 0.303 0.141 0.397
+agcgg 0.312 0.316 0.329
+agcgt 0.197 0.327 0.153
+agcta 0.115 0.212 0.122
+agctc 0.241 0.307 0.3
+agctg 0.391 0.27 0.39
+agctt 0.253 0.212 0.188
+aggaa 0.338 0.251 0.164
+aggac 0.0855 0.285 0.236
+aggag 0.491 0.263 0.466
+aggat 0.0855 0.201 0.134
+aggca 0.218 0.249 0.201
+aggcc 0.122 0.124 0.253
+aggcg 0.256 0.287 0.377
+aggct 0.403 0.34 0.168
+aggga 0.104 0.278 0.262
+agggc 0.342 0.141 0.229
+agggg 0.316 0.308 0.288
+agggt 0.238 0.273 0.221
+aggta 0.167 0.134 0.185
+aggtc 0.182 0.188 0.164
+aggtg 0.463 0.49 0.473
+aggtt 0.187 0.188 0.178
+agtaa 0.257 0.343 0.167
+agtac 0.196 0.118 0.433
+agtag 0.372 0.249 0.167
+agtat 0.176 0.29 0.233
+agtca 0.189 0.162 0.235
+agtcc 0.332 0.299 0.156
+agtcg 0.126 0.264 0.358
+agtct 0.353 0.274 0.251
+agtga 0.243 0.232 0.083
+agtgc 0.136 0.25 0.162
+agtgg 0.33 0.192 0.22
+agtgt 0.291 0.326 0.535
+agtta 0.164 0.235 0.192
+agttc 0.364 0.123 0.308
+agttg 0.221 0.37 0.192
+agttt 0.251 0.272 0.308
+ataaa 0.25 0.19 0.294
+ataac 0.25 0.276 0.213
+ataag 0.25 0.343 0.301
+ataat 0.25 0.19 0.191
+ataca 0.267 0.336 0.287
+atacc 0.225 0.191 0.198
+atacg 0.283 0.289 0.198
+atact 0.225 0.184 0.317
+ataga 0.25 0.318 0.356
+atagc 0.25 0.152 0.26
+atagg 0.25 0.22 0.137
+atagt 0.25 0.311 0.247
+atata 0.299 0.3 0.186
+atatc 0.171 0.186 0.32
+atatg 0.299 0.243 0.279
+atatt 0.232 0.271 0.215
+atcaa 0.241 0.217 0.199
+atcac 0.241 0.377 0.382
+atcag 0.217 0.193 0.199
+atcat 0.301 0.212 0.22
+atcca 0.181 0.249 0.224
+atccc 0.224 0.238 0.39
+atccg 0.205 0.195 0.17
+atcct 0.39 0.319 0.216
+atcga 0.244 0.302 0.297
+atcgc 0.421 0.266 0.181
+atcgg 0.229 0.302 0.277
+atcgt 0.105 0.131 0.245
+atcta 0.114 0.166 0.146
+atctc 0.354 0.224 0.338
+atctg 0.291 0.229 0.374
+atctt 0.24 0.38 0.141
+atgaa 0.25 0.295 0.175
+atgac 0.25 0.279 0.311
+atgag 0.25 0.24 0.254
+atgat 0.25 0.186 0.259
+atgca 0.215 0.279 0.22
+atgcc 0.19 0.178 0.351
+atgcg 0.32 0.356 0.251
+atgct 0.275 0.188 0.178
+atgga 0.257 0.296 0.209
+atggc 0.18 0.292 0.169
+atggg 0.325 0.186 0.145
+atggt 0.238 0.226 0.477
+atgta 0.239 0.16 0.124
+atgtc 0.232 0.333 0.191
+atgtg 0.356 0.286 0.431
+atgtt 0.173 0.221 0.255
+attaa 0.232 0.23 0.177
+attac 0.208 0.237 0.31
+attag 0.288 0.215 0.177
+attat 0.272 0.319 0.336
+attca 0.288 0.22 0.197
+attcc 0.19 0.214 0.333
+attcg 0.288 0.214 0.197
+attct 0.234 0.353 0.273
+attga 0.118 0.206 0.104
+attgc 0.25 0.225 0.193
+attgg 0.336 0.132 0.214
+attgt 0.295 0.436 0.49
+attta 0.186 0.179 0.142
+atttc 0.244 0.138 0.142
+atttg 0.442 0.372 0.468
+atttt 0.128 0.31 0.248
+caaaa 0.229 0.23 0.16
+caaac 0.365 0.357 0.288
+caaag 0.259 0.159 0.288
+caaat 0.147 0.254 0.264
+caaca 0.311 0.417 0.239
+caacc 0.291 0.178 0.296
+caacg 0.212 0.196 0.226
+caact 0.185 0.209 0.239
+caaga 0.237 0.315 0.347
+caagc 0.195 0.277 0.235
+caagg 0.406 0.185 0.265
+caagt 0.162 0.223 0.153
+caata 0.348 0.238 0.218
+caatc 0.129 0.198 0.218
+caatg 0.355 0.198 0.218
+caatt 0.168 0.366 0.346
+cacaa 0.173 0.279 0.0962
+cacac 0.366 0.336 0.389
+cacag 0.193 0.206 0.312
+cacat 0.267 0.179 0.202
+cacca 0.42 0.263 0.212
+caccc 0.155 0.182 0.321
+caccg 0.213 0.292 0.255
+cacct 0.213 0.263 0.212
+cacga 0.279 0.422 0.101
+cacgc 0.183 0.238 0.384
+cacgg 0.417 0.141 0.247
+cacgt 0.121 0.199 0.268
+cacta 0.127 0.164 0.19
+cactc 0.299 0.31 0.352
+cactg 0.255 0.207 0.261
+cactt 0.318 0.319 0.197
+cagaa 0.158 0.36 0.188
+cagac 0.266 0.315 0.327
+cagag 0.394 0.197 0.359
+cagat 0.182 0.128 0.126
+cagca 0.266 0.314 0.294
+cagcc 0.257 0.261 0.266
+cagcg 0.245 0.128 0.28
+cagct 0.232 0.296 0.159
+cagga 0.243 0.287 0.372
+caggc 0.316 0.218 0.246
+caggg 0.294 0.267 0.202
+caggt 0.147 0.227 0.18
+cagta 0.241 0.226 0.227
+cagtc 0.199 0.337 0.25
+cagtg 0.227 0.237 0.297
+cagtt 0.333 0.2 0.227
+cataa 0.248 0.193 0.175
+catac 0.222 0.143 0.298
+catag 0.359 0.329 0.175
+catat 0.171 0.336 0.351
+catca 0.243 0.348 0.196
+catcc 0.243 0.363 0.28
+catcg 0.279 0.144 0.385
+catct 0.234 0.144 0.14
+catga 0.242 0.286 0.148
+catgc 0.283 0.247 0.319
+catgg 0.384 0.33 0.244
+catgt 0.0913 0.137 0.289
+catta 0.38 0.174 0.243
+cattc 0.141 0.226 0.264
+cattg 0.254 0.374 0.264
+cattt 0.225 0.226 0.229
+ccaaa 0.25 0.123 0.275
+ccaac 0.25 0.288 0.196
+ccaag 0.25 0.325 0.333
+ccaat 0.25 0.264 0.196
+ccaca 0.282 0.252 0.303
+ccacc 0.206 0.176 0.145
+ccacg 0.23 0.353 0.329
+ccact 0.282 0.218 0.222
+ccaga 0.328 0.417 0.139
+ccagc 0.341 0.275 0.476
+ccagg 0.234 0.171 0.149
+ccagt 0.097 0.137 0.236
+ccata 0.116 0.176 0.135
+ccatc 0.283 0.371 0.367
+ccatg 0.387 0.277 0.348
+ccatt 0.214 0.176 0.15
+cccaa 0.245 0.226 0.203
+cccac 0.372 0.195 0.283
+cccag 0.202 0.226 0.273
+cccat 0.181 0.354 0.241
+cccca 0.193 0.213 0.29
+ccccc 0.16 0.4 0.294
+ccccg 0.39 0.196 0.243
+cccct 0.257 0.191 0.173
+cccga 0.182 0.191 0.232
+cccgc 0.414 0.407 0.384
+cccgg 0.172 0.16 0.192
+cccgt 0.232 0.241 0.192
+cccta 0.252 0.154 0.15
+ccctc 0.291 0.395 0.239
+ccctg 0.232 0.238 0.5
+ccctt 0.225 0.213 0.111
+ccgaa 0.4 0.2 0.157
+ccgac 0.187 0.25 0.207
+ccgag 0.174 0.292 0.407
+ccgat 0.239 0.258 0.229
+ccgca 0.119 0.169 0.149
+ccgcc 0.276 0.225 0.401
+ccgcg 0.429 0.331 0.333
+ccgct 0.176 0.275 0.117
+ccgga 0.229 0.283 0.244
+ccggc 0.258 0.425 0.421
+ccggg 0.331 0.129 0.219
+ccggt 0.182 0.163 0.116
+ccgta 0.155 0.111 0.143
+ccgtc 0.315 0.411 0.253
+ccgtg 0.32 0.317 0.404
+ccgtt 0.21 0.161 0.2
+cctaa 0.159 0.18 0.122
+cctac 0.286 0.261 0.402
+cctag 0.23 0.261 0.122
+cctat 0.325 0.297 0.354
+cctca 0.205 0.231 0.184
+cctcc 0.286 0.357 0.294
+cctcg 0.317 0.167 0.328
+cctct 0.193 0.244 0.194
+cctga 0.3 0.25 0.0893
+cctgc 0.362 0.386 0.362
+cctgg 0.182 0.114 0.353
+cctgt 0.156 0.25 0.196
+cctta 0.147 0.186 0.167
+ccttc 0.272 0.423 0.318
+ccttg 0.331 0.224 0.345
+ccttt 0.25 0.167 0.171
+cgaaa 0.199 0.29 0.195
+cgaac 0.231 0.197 0.166
+cgaag 0.333 0.316 0.437
+cgaat 0.237 0.197 0.202
+cgaca 0.247 0.22 0.229
+cgacc 0.16 0.28 0.262
+cgacg 0.319 0.288 0.384
+cgact 0.274 0.212 0.125
+cgaga 0.28 0.189 0.26
+cgagc 0.178 0.364 0.248
+cgagg 0.4 0.342 0.335
+cgagt 0.142 0.105 0.157
+cgata 0.17 0.152 0.149
+cgatc 0.29 0.288 0.33
+cgatg 0.44 0.28 0.372
+cgatt 0.1 0.28 0.149
+cgcaa 0.213 0.274 0.076
+cgcac 0.243 0.142 0.205
+cgcag 0.349 0.35 0.551
+cgcat 0.196 0.234 0.167
+cgcca 0.181 0.157 0.201
+cgccc 0.32 0.165 0.318
+cgccg 0.241 0.352 0.327
+cgcct 0.258 0.326 0.154
+cgcga 0.188 0.215 0.121
+cgcgc 0.303 0.141 0.397
+cgcgg 0.312 0.316 0.329
+cgcgt 0.197 0.327 0.153
+cgcta 0.115 0.212 0.122
+cgctc 0.241 0.307 0.3
+cgctg 0.391 0.27 0.39
+cgctt 0.253 0.212 0.188
+cggaa 0.338 0.251 0.164
+cggac 0.0855 0.285 0.236
+cggag 0.491 0.263 0.466
+cggat 0.0855 0.201 0.134
+cggca 0.218 0.249 0.201
+cggcc 0.122 0.124 0.253
+cggcg 0.256 0.287 0.377
+cggct 0.403 0.34 0.168
+cggga 0.104 0.278 0.262
+cgggc 0.342 0.141 0.229
+cgggg 0.316 0.308 0.288
+cgggt 0.238 0.273 0.221
+cggta 0.167 0.134 0.185
+cggtc 0.182 0.188 0.164
+cggtg 0.463 0.49 0.473
+cggtt 0.187 0.188 0.178
+cgtaa 0.257 0.343 0.167
+cgtac 0.196 0.118 0.433
+cgtag 0.372 0.249 0.167
+cgtat 0.176 0.29 0.233
+cgtca 0.189 0.162 0.235
+cgtcc 0.332 0.299 0.156
+cgtcg 0.126 0.264 0.358
+cgtct 0.353 0.274 0.251
+cgtga 0.243 0.232 0.083
+cgtgc 0.136 0.25 0.162
+cgtgg 0.33 0.192 0.22
+cgtgt 0.291 0.326 0.535
+cgtta 0.164 0.235 0.192
+cgttc 0.364 0.123 0.308
+cgttg 0.221 0.37 0.192
+cgttt 0.251 0.272 0.308
+ctaaa 0.25 0.19 0.294
+ctaac 0.25 0.276 0.213
+ctaag 0.25 0.343 0.301
+ctaat 0.25 0.19 0.191
+ctaca 0.267 0.336 0.287
+ctacc 0.225 0.191 0.198
+ctacg 0.283 0.289 0.198
+ctact 0.225 0.184 0.317
+ctaga 0.25 0.318 0.356
+ctagc 0.25 0.152 0.26
+ctagg 0.25 0.22 0.137
+ctagt 0.25 0.311 0.247
+ctata 0.299 0.3 0.186
+ctatc 0.171 0.186 0.32
+ctatg 0.299 0.243 0.279
+ctatt 0.232 0.271 0.215
+ctcaa 0.241 0.217 0.199
+ctcac 0.241 0.377 0.382
+ctcag 0.217 0.193 0.199
+ctcat 0.301 0.212 0.22
+ctcca 0.181 0.249 0.224
+ctccc 0.224 0.238 0.39
+ctccg 0.205 0.195 0.17
+ctcct 0.39 0.319 0.216
+ctcga 0.244 0.302 0.297
+ctcgc 0.421 0.266 0.181
+ctcgg 0.229 0.302 0.277
+ctcgt 0.105 0.131 0.245
+ctcta 0.114 0.166 0.146
+ctctc 0.354 0.224 0.338
+ctctg 0.291 0.229 0.374
+ctctt 0.24 0.38 0.141
+ctgaa 0.25 0.295 0.175
+ctgac 0.25 0.279 0.311
+ctgag 0.25 0.24 0.254
+ctgat 0.25 0.186 0.259
+ctgca 0.215 0.279 0.22
+ctgcc 0.19 0.178 0.351
+ctgcg 0.32 0.356 0.251
+ctgct 0.275 0.188 0.178
+ctgga 0.257 0.296 0.209
+ctggc 0.18 0.292 0.169
+ctggg 0.325 0.186 0.145
+ctggt 0.238 0.226 0.477
+ctgta 0.239 0.16 0.124
+ctgtc 0.232 0.333 0.191
+ctgtg 0.356 0.286 0.431
+ctgtt 0.173 0.221 0.255
+cttaa 0.232 0.23 0.177
+cttac 0.208 0.237 0.31
+cttag 0.288 0.215 0.177
+cttat 0.272 0.319 0.336
+cttca 0.288 0.22 0.197
+cttcc 0.19 0.214 0.333
+cttcg 0.288 0.214 0.197
+cttct 0.234 0.353 0.273
+cttga 0.118 0.206 0.104
+cttgc 0.25 0.225 0.193
+cttgg 0.336 0.132 0.214
+cttgt 0.295 0.436 0.49
+cttta 0.186 0.179 0.142
+ctttc 0.244 0.138 0.142
+ctttg 0.442 0.372 0.468
+ctttt 0.128 0.31 0.248
+gaaaa 0.229 0.23 0.16
+gaaac 0.365 0.357 0.288
+gaaag 0.259 0.159 0.288
+gaaat 0.147 0.254 0.264
+gaaca 0.311 0.417 0.239
+gaacc 0.291 0.178 0.296
+gaacg 0.212 0.196 0.226
+gaact 0.185 0.209 0.239
+gaaga 0.237 0.315 0.347
+gaagc 0.195 0.277 0.235
+gaagg 0.406 0.185 0.265
+gaagt 0.162 0.223 0.153
+gaata 0.348 0.238 0.218
+gaatc 0.129 0.198 0.218
+gaatg 0.355 0.198 0.218
+gaatt 0.168 0.366 0.346
+gacaa 0.173 0.279 0.0962
+gacac 0.366 0.336 0.389
+gacag 0.193 0.206 0.312
+gacat 0.267 0.179 0.202
+gacca 0.42 0.263 0.212
+gaccc 0.155 0.182 0.321
+gaccg 0.213 0.292 0.255
+gacct 0.213 0.263 0.212
+gacga 0.279 0.422 0.101
+gacgc 0.183 0.238 0.384
+gacgg 0.417 0.141 0.247
+gacgt 0.121 0.199 0.268
+gacta 0.127 0.164 0.19
+gactc 0.299 0.31 0.352
+gactg 0.255 0.207 0.261
+gactt 0.318 0.319 0.197
+gagaa 0.158 0.36 0.188
+gagac 0.266 0.315 0.327
+gagag 0.394 0.197 0.359
+gagat 0.182 0.128 0.126
+gagca 0.266 0.314 0.294
+gagcc 0.257 0.261 0.266
+gagcg 0.245 0.128 0.28
+gagct 0.232 0.296 0.159
+gagga 0.243 0.287 0.372
+gaggc 0.316 0.218 0.246
+gaggg 0.294 0.267 0.202
+gaggt 0.147 0.227 0.18
+gagta 0.241 0.226 0.227
+gagtc 0.199 0.337 0.25
+gagtg 0.227 0.237 0.297
+gagtt 0.333 0.2 0.227
+gataa 0.248 0.193 0.175
+gatac 0.222 0.143 0.298
+gatag 0.359 0.329 0.175
+gatat 0.171 0.336 0.351
+gatca 0.243 0.348 0.196
+gatcc 0.243 0.363 0.28
+gatcg 0.279 0.144 0.385
+gatct 0.234 0.144 0.14
+gatga 0.242 0.286 0.148
+gatgc 0.283 0.247 0.319
+gatgg 0.384 0.33 0.244
+gatgt 0.0913 0.137 0.289
+gatta 0.38 0.174 0.243
+gattc 0.141 0.226 0.264
+gattg 0.254 0.374 0.264
+gattt 0.225 0.226 0.229
+gcaaa 0.25 0.123 0.275
+gcaac 0.25 0.288 0.196
+gcaag 0.25 0.325 0.333
+gcaat 0.25 0.264 0.196
+gcaca 0.282 0.252 0.303
+gcacc 0.206 0.176 0.145
+gcacg 0.23 0.353 0.329
+gcact 0.282 0.218 0.222
+gcaga 0.328 0.417 0.139
+gcagc 0.341 0.275 0.476
+gcagg 0.234 0.171 0.149
+gcagt 0.097 0.137 0.236
+gcata 0.116 0.176 0.135
+gcatc 0.283 0.371 0.367
+gcatg 0.387 0.277 0.348
+gcatt 0.214 0.176 0.15
+gccaa 0.245 0.226 0.203
+gccac 0.372 0.195 0.283
+gccag 0.202 0.226 0.273
+gccat 0.181 0.354 0.241
+gccca 0.193 0.213 0.29
+gcccc 0.16 0.4 0.294
+gcccg 0.39 0.196 0.243
+gccct 0.257 0.191 0.173
+gccga 0.182 0.191 0.232
+gccgc 0.414 0.407 0.384
+gccgg 0.172 0.16 0.192
+gccgt 0.232 0.241 0.192
+gccta 0.252 0.154 0.15
+gcctc 0.291 0.395 0.239
+gcctg 0.232 0.238 0.5
+gcctt 0.225 0.213 0.111
+gcgaa 0.4 0.2 0.157
+gcgac 0.187 0.25 0.207
+gcgag 0.174 0.292 0.407
+gcgat 0.239 0.258 0.229
+gcgca 0.119 0.169 0.149
+gcgcc 0.276 0.225 0.401
+gcgcg 0.429 0.331 0.333
+gcgct 0.176 0.275 0.117
+gcgga 0.229 0.283 0.244
+gcggc 0.258 0.425 0.421
+gcggg 0.331 0.129 0.219
+gcggt 0.182 0.163 0.116
+gcgta 0.155 0.111 0.143
+gcgtc 0.315 0.411 0.253
+gcgtg 0.32 0.317 0.404
+gcgtt 0.21 0.161 0.2
+gctaa 0.159 0.18 0.122
+gctac 0.286 0.261 0.402
+gctag 0.23 0.261 0.122
+gctat 0.325 0.297 0.354
+gctca 0.205 0.231 0.184
+gctcc 0.286 0.357 0.294
+gctcg 0.317 0.167 0.328
+gctct 0.193 0.244 0.194
+gctga 0.3 0.25 0.0893
+gctgc 0.362 0.386 0.362
+gctgg 0.182 0.114 0.353
+gctgt 0.156 0.25 0.196
+gctta 0.147 0.186 0.167
+gcttc 0.272 0.423 0.318
+gcttg 0.331 0.224 0.345
+gcttt 0.25 0.167 0.171
+ggaaa 0.199 0.29 0.195
+ggaac 0.231 0.197 0.166
+ggaag 0.333 0.316 0.437
+ggaat 0.237 0.197 0.202
+ggaca 0.247 0.22 0.229
+ggacc 0.16 0.28 0.262
+ggacg 0.319 0.288 0.384
+ggact 0.274 0.212 0.125
+ggaga 0.28 0.189 0.26
+ggagc 0.178 0.364 0.248
+ggagg 0.4 0.342 0.335
+ggagt 0.142 0.105 0.157
+ggata 0.17 0.152 0.149
+ggatc 0.29 0.288 0.33
+ggatg 0.44 0.28 0.372
+ggatt 0.1 0.28 0.149
+ggcaa 0.213 0.274 0.076
+ggcac 0.243 0.142 0.205
+ggcag 0.349 0.35 0.551
+ggcat 0.196 0.234 0.167
+ggcca 0.181 0.157 0.201
+ggccc 0.32 0.165 0.318
+ggccg 0.241 0.352 0.327
+ggcct 0.258 0.326 0.154
+ggcga 0.188 0.215 0.121
+ggcgc 0.303 0.141 0.397
+ggcgg 0.312 0.316 0.329
+ggcgt 0.197 0.327 0.153
+ggcta 0.115 0.212 0.122
+ggctc 0.241 0.307 0.3
+ggctg 0.391 0.27 0.39
+ggctt 0.253 0.212 0.188
+gggaa 0.338 0.251 0.164
+gggac 0.0855 0.285 0.236
+gggag 0.491 0.263 0.466
+gggat 0.0855 0.201 0.134
+gggca 0.218 0.249 0.201
+gggcc 0.122 0.124 0.253
+gggcg 0.256 0.287 0.377
+gggct 0.403 0.34 0.168
+gggga 0.104 0.278 0.262
+ggggc 0.342 0.141 0.229
+ggggg 0.316 0.308 0.288
+ggggt 0.238 0.273 0.221
+gggta 0.167 0.134 0.185
+gggtc 0.182 0.188 0.164
+gggtg 0.463 0.49 0.473
+gggtt 0.187 0.188 0.178
+ggtaa 0.257 0.343 0.167
+ggtac 0.196 0.118 0.433
+ggtag 0.372 0.249 0.167
+ggtat 0.176 0.29 0.233
+ggtca 0.189 0.162 0.235
+ggtcc 0.332 0.299 0.156
+ggtcg 0.126 0.264 0.358
+ggtct 0.353 0.274 0.251
+ggtga 0.243 0.232 0.083
+ggtgc 0.136 0.25 0.162
+ggtgg 0.33 0.192 0.22
+ggtgt 0.291 0.326 0.535
+ggtta 0.164 0.235 0.192
+ggttc 0.364 0.123 0.308
+ggttg 0.221 0.37 0.192
+ggttt 0.251 0.272 0.308
+gtaaa 0.25 0.19 0.294
+gtaac 0.25 0.276 0.213
+gtaag 0.25 0.343 0.301
+gtaat 0.25 0.19 0.191
+gtaca 0.267 0.336 0.287
+gtacc 0.225 0.191 0.198
+gtacg 0.283 0.289 0.198
+gtact 0.225 0.184 0.317
+gtaga 0.25 0.318 0.356
+gtagc 0.25 0.152 0.26
+gtagg 0.25 0.22 0.137
+gtagt 0.25 0.311 0.247
+gtata 0.299 0.3 0.186
+gtatc 0.171 0.186 0.32
+gtatg 0.299 0.243 0.279
+gtatt 0.232 0.271 0.215
+gtcaa 0.241 0.217 0.199
+gtcac 0.241 0.377 0.382
+gtcag 0.217 0.193 0.199
+gtcat 0.301 0.212 0.22
+gtcca 0.181 0.249 0.224
+gtccc 0.224 0.238 0.39
+gtccg 0.205 0.195 0.17
+gtcct 0.39 0.319 0.216
+gtcga 0.244 0.302 0.297
+gtcgc 0.421 0.266 0.181
+gtcgg 0.229 0.302 0.277
+gtcgt 0.105 0.131 0.245
+gtcta 0.114 0.166 0.146
+gtctc 0.354 0.224 0.338
+gtctg 0.291 0.229 0.374
+gtctt 0.24 0.38 0.141
+gtgaa 0.25 0.295 0.175
+gtgac 0.25 0.279 0.311
+gtgag 0.25 0.24 0.254
+gtgat 0.25 0.186 0.259
+gtgca 0.215 0.279 0.22
+gtgcc 0.19 0.178 0.351
+gtgcg 0.32 0.356 0.251
+gtgct 0.275 0.188 0.178
+gtgga 0.257 0.296 0.209
+gtggc 0.18 0.292 0.169
+gtggg 0.325 0.186 0.145
+gtggt 0.238 0.226 0.477
+gtgta 0.239 0.16 0.124
+gtgtc 0.232 0.333 0.191
+gtgtg 0.356 0.286 0.431
+gtgtt 0.173 0.221 0.255
+gttaa 0.232 0.23 0.177
+gttac 0.208 0.237 0.31
+gttag 0.288 0.215 0.177
+gttat 0.272 0.319 0.336
+gttca 0.288 0.22 0.197
+gttcc 0.19 0.214 0.333
+gttcg 0.288 0.214 0.197
+gttct 0.234 0.353 0.273
+gttga 0.118 0.206 0.104
+gttgc 0.25 0.225 0.193
+gttgg 0.336 0.132 0.214
+gttgt 0.295 0.436 0.49
+gttta 0.186 0.179 0.142
+gtttc 0.244 0.138 0.142
+gtttg 0.442 0.372 0.468
+gtttt 0.128 0.31 0.248
+taaaa 0.229 0.23 0.16
+taaac 0.365 0.357 0.288
+taaag 0.259 0.159 0.288
+taaat 0.147 0.254 0.264
+taaca 0.311 0.417 0.239
+taacc 0.291 0.178 0.296
+taacg 0.212 0.196 0.226
+taact 0.185 0.209 0.239
+taaga 0.237 0.315 0.347
+taagc 0.195 0.277 0.235
+taagg 0.406 0.185 0.265
+taagt 0.162 0.223 0.153
+taata 0.348 0.238 0.218
+taatc 0.129 0.198 0.218
+taatg 0.355 0.198 0.218
+taatt 0.168 0.366 0.346
+tacaa 0.173 0.279 0.0962
+tacac 0.366 0.336 0.389
+tacag 0.193 0.206 0.312
+tacat 0.267 0.179 0.202
+tacca 0.42 0.263 0.212
+taccc 0.155 0.182 0.321
+taccg 0.213 0.292 0.255
+tacct 0.213 0.263 0.212
+tacga 0.279 0.422 0.101
+tacgc 0.183 0.238 0.384
+tacgg 0.417 0.141 0.247
+tacgt 0.121 0.199 0.268
+tacta 0.127 0.164 0.19
+tactc 0.299 0.31 0.352
+tactg 0.255 0.207 0.261
+tactt 0.318 0.319 0.197
+tagaa 0.158 0.36 0.188
+tagac 0.266 0.315 0.327
+tagag 0.394 0.197 0.359
+tagat 0.182 0.128 0.126
+tagca 0.266 0.314 0.294
+tagcc 0.257 0.261 0.266
+tagcg 0.245 0.128 0.28
+tagct 0.232 0.296 0.159
+tagga 0.243 0.287 0.372
+taggc 0.316 0.218 0.246
+taggg 0.294 0.267 0.202
+taggt 0.147 0.227 0.18
+tagta 0.241 0.226 0.227
+tagtc 0.199 0.337 0.25
+tagtg 0.227 0.237 0.297
+tagtt 0.333 0.2 0.227
+tataa 0.248 0.193 0.175
+tatac 0.222 0.143 0.298
+tatag 0.359 0.329 0.175
+tatat 0.171 0.336 0.351
+tatca 0.243 0.348 0.196
+tatcc 0.243 0.363 0.28
+tatcg 0.279 0.144 0.385
+tatct 0.234 0.144 0.14
+tatga 0.242 0.286 0.148
+tatgc 0.283 0.247 0.319
+tatgg 0.384 0.33 0.244
+tatgt 0.0913 0.137 0.289
+tatta 0.38 0.174 0.243
+tattc 0.141 0.226 0.264
+tattg 0.254 0.374 0.264
+tattt 0.225 0.226 0.229
+tcaaa 0.25 0.123 0.275
+tcaac 0.25 0.288 0.196
+tcaag 0.25 0.325 0.333
+tcaat 0.25 0.264 0.196
+tcaca 0.282 0.252 0.303
+tcacc 0.206 0.176 0.145
+tcacg 0.23 0.353 0.329
+tcact 0.282 0.218 0.222
+tcaga 0.328 0.417 0.139
+tcagc 0.341 0.275 0.476
+tcagg 0.234 0.171 0.149
+tcagt 0.097 0.137 0.236
+tcata 0.116 0.176 0.135
+tcatc 0.283 0.371 0.367
+tcatg 0.387 0.277 0.348
+tcatt 0.214 0.176 0.15
+tccaa 0.245 0.226 0.203
+tccac 0.372 0.195 0.283
+tccag 0.202 0.226 0.273
+tccat 0.181 0.354 0.241
+tccca 0.193 0.213 0.29
+tcccc 0.16 0.4 0.294
+tcccg 0.39 0.196 0.243
+tccct 0.257 0.191 0.173
+tccga 0.182 0.191 0.232
+tccgc 0.414 0.407 0.384
+tccgg 0.172 0.16 0.192
+tccgt 0.232 0.241 0.192
+tccta 0.252 0.154 0.15
+tcctc 0.291 0.395 0.239
+tcctg 0.232 0.238 0.5
+tcctt 0.225 0.213 0.111
+tcgaa 0.4 0.2 0.157
+tcgac 0.187 0.25 0.207
+tcgag 0.174 0.292 0.407
+tcgat 0.239 0.258 0.229
+tcgca 0.119 0.169 0.149
+tcgcc 0.276 0.225 0.401
+tcgcg 0.429 0.331 0.333
+tcgct 0.176 0.275 0.117
+tcgga 0.229 0.283 0.244
+tcggc 0.258 0.425 0.421
+tcggg 0.331 0.129 0.219
+tcggt 0.182 0.163 0.116
+tcgta 0.155 0.111 0.143
+tcgtc 0.315 0.411 0.253
+tcgtg 0.32 0.317 0.404
+tcgtt 0.21 0.161 0.2
+tctaa 0.159 0.18 0.122
+tctac 0.286 0.261 0.402
+tctag 0.23 0.261 0.122
+tctat 0.325 0.297 0.354
+tctca 0.205 0.231 0.184
+tctcc 0.286 0.357 0.294
+tctcg 0.317 0.167 0.328
+tctct 0.193 0.244 0.194
+tctga 0.3 0.25 0.0893
+tctgc 0.362 0.386 0.362
+tctgg 0.182 0.114 0.353
+tctgt 0.156 0.25 0.196
+tctta 0.147 0.186 0.167
+tcttc 0.272 0.423 0.318
+tcttg 0.331 0.224 0.345
+tcttt 0.25 0.167 0.171
+tgaaa 0.199 0.29 0.195
+tgaac 0.231 0.197 0.166
+tgaag 0.333 0.316 0.437
+tgaat 0.237 0.197 0.202
+tgaca 0.247 0.22 0.229
+tgacc 0.16 0.28 0.262
+tgacg 0.319 0.288 0.384
+tgact 0.274 0.212 0.125
+tgaga 0.28 0.189 0.26
+tgagc 0.178 0.364 0.248
+tgagg 0.4 0.342 0.335
+tgagt 0.142 0.105 0.157
+tgata 0.17 0.152 0.149
+tgatc 0.29 0.288 0.33
+tgatg 0.44 0.28 0.372
+tgatt 0.1 0.28 0.149
+tgcaa 0.213 0.274 0.076
+tgcac 0.243 0.142 0.205
+tgcag 0.349 0.35 0.551
+tgcat 0.196 0.234 0.167
+tgcca 0.181 0.157 0.201
+tgccc 0.32 0.165 0.318
+tgccg 0.241 0.352 0.327
+tgcct 0.258 0.326 0.154
+tgcga 0.188 0.215 0.121
+tgcgc 0.303 0.141 0.397
+tgcgg 0.312 0.316 0.329
+tgcgt 0.197 0.327 0.153
+tgcta 0.115 0.212 0.122
+tgctc 0.241 0.307 0.3
+tgctg 0.391 0.27 0.39
+tgctt 0.253 0.212 0.188
+tggaa 0.338 0.251 0.164
+tggac 0.0855 0.285 0.236
+tggag 0.491 0.263 0.466
+tggat 0.0855 0.201 0.134
+tggca 0.218 0.249 0.201
+tggcc 0.122 0.124 0.253
+tggcg 0.256 0.287 0.377
+tggct 0.403 0.34 0.168
+tggga 0.104 0.278 0.262
+tgggc 0.342 0.141 0.229
+tgggg 0.316 0.308 0.288
+tgggt 0.238 0.273 0.221
+tggta 0.167 0.134 0.185
+tggtc 0.182 0.188 0.164
+tggtg 0.463 0.49 0.473
+tggtt 0.187 0.188 0.178
+tgtaa 0.257 0.343 0.167
+tgtac 0.196 0.118 0.433
+tgtag 0.372 0.249 0.167
+tgtat 0.176 0.29 0.233
+tgtca 0.189 0.162 0.235
+tgtcc 0.332 0.299 0.156
+tgtcg 0.126 0.264 0.358
+tgtct 0.353 0.274 0.251
+tgtga 0.243 0.232 0.083
+tgtgc 0.136 0.25 0.162
+tgtgg 0.33 0.192 0.22
+tgtgt 0.291 0.326 0.535
+tgtta 0.164 0.235 0.192
+tgttc 0.364 0.123 0.308
+tgttg 0.221 0.37 0.192
+tgttt 0.251 0.272 0.308
+ttaaa 0.25 0.19 0.294
+ttaac 0.25 0.276 0.213
+ttaag 0.25 0.343 0.301
+ttaat 0.25 0.19 0.191
+ttaca 0.267 0.336 0.287
+ttacc 0.225 0.191 0.198
+ttacg 0.283 0.289 0.198
+ttact 0.225 0.184 0.317
+ttaga 0.25 0.318 0.356
+ttagc 0.25 0.152 0.26
+ttagg 0.25 0.22 0.137
+ttagt 0.25 0.311 0.247
+ttata 0.299 0.3 0.186
+ttatc 0.171 0.186 0.32
+ttatg 0.299 0.243 0.279
+ttatt 0.232 0.271 0.215
+ttcaa 0.241 0.217 0.199
+ttcac 0.241 0.377 0.382
+ttcag 0.217 0.193 0.199
+ttcat 0.301 0.212 0.22
+ttcca 0.181 0.249 0.224
+ttccc 0.224 0.238 0.39
+ttccg 0.205 0.195 0.17
+ttcct 0.39 0.319 0.216
+ttcga 0.244 0.302 0.297
+ttcgc 0.421 0.266 0.181
+ttcgg 0.229 0.302 0.277
+ttcgt 0.105 0.131 0.245
+ttcta 0.114 0.166 0.146
+ttctc 0.354 0.224 0.338
+ttctg 0.291 0.229 0.374
+ttctt 0.24 0.38 0.141
+ttgaa 0.25 0.295 0.175
+ttgac 0.25 0.279 0.311
+ttgag 0.25 0.24 0.254
+ttgat 0.25 0.186 0.259
+ttgca 0.215 0.279 0.22
+ttgcc 0.19 0.178 0.351
+ttgcg 0.32 0.356 0.251
+ttgct 0.275 0.188 0.178
+ttgga 0.257 0.296 0.209
+ttggc 0.18 0.292 0.169
+ttggg 0.325 0.186 0.145
+ttggt 0.238 0.226 0.477
+ttgta 0.239 0.16 0.124
+ttgtc 0.232 0.333 0.191
+ttgtg 0.356 0.286 0.431
+ttgtt 0.173 0.221 0.255
+tttaa 0.232 0.23 0.177
+tttac 0.208 0.237 0.31
+tttag 0.288 0.215 0.177
+tttat 0.272 0.319 0.336
+tttca 0.288 0.22 0.197
+tttcc 0.19 0.214 0.333
+tttcg 0.288 0.214 0.197
+tttct 0.234 0.353 0.273
+tttga 0.118 0.206 0.104
+tttgc 0.25 0.225 0.193
+tttgg 0.336 0.132 0.214
+tttgt 0.295 0.436 0.49
+tttta 0.186 0.179 0.142
+ttttc 0.244 0.138 0.142
+ttttg 0.442 0.372 0.468
+ttttt 0.128 0.31 0.248
+
+
+#
+# Internal exon terminal emission probabilities
+#
+[ETEMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.25 0.25 0.25
+aaaac 0.25 0.25 0.25
+aaaag 0.25 0.25 0.25
+aaaat 0.25 0.25 0.25
+aaaca 0.25 0.25 0.25
+aaacc 0.25 0.25 0.25
+aaacg 0.25 0.25 0.25
+aaact 0.25 0.25 0.25
+aaaga 0.25 0.25 0.25
+aaagc 0.25 0.25 0.25
+aaagg 0.25 0.25 0.25
+aaagt 0.25 0.25 0.25
+aaata 0.25 0.25 0.25
+aaatc 0.25 0.25 0.25
+aaatg 0.25 0.25 0.25
+aaatt 0.25 0.25 0.25
+aacaa 0.25 0.25 0.25
+aacac 0.25 0.25 0.25
+aacag 0.25 0.25 0.25
+aacat 0.25 0.25 0.25
+aacca 0.25 0.25 0.25
+aaccc 0.25 0.25 0.25
+aaccg 0.25 0.25 0.25
+aacct 0.25 0.25 0.25
+aacga 0.25 0.25 0.25
+aacgc 0.25 0.25 0.25
+aacgg 0.25 0.25 0.25
+aacgt 0.25 0.25 0.25
+aacta 0.25 0.25 0.25
+aactc 0.25 0.25 0.25
+aactg 0.25 0.25 0.25
+aactt 0.25 0.25 0.25
+aagaa 0.25 0.25 0.25
+aagac 0.25 0.25 0.25
+aagag 0.25 0.25 0.25
+aagat 0.25 0.25 0.25
+aagca 0.25 0.25 0.25
+aagcc 0.25 0.25 0.25
+aagcg 0.25 0.25 0.25
+aagct 0.25 0.25 0.25
+aagga 0.25 0.25 0.25
+aaggc 0.25 0.25 0.25
+aaggg 0.25 0.25 0.25
+aaggt 0.25 0.25 0.25
+aagta 0.25 0.25 0.25
+aagtc 0.25 0.25 0.25
+aagtg 0.25 0.25 0.25
+aagtt 0.25 0.25 0.25
+aataa 0.25 0.25 0.25
+aatac 0.25 0.25 0.25
+aatag 0.25 0.25 0.25
+aatat 0.25 0.25 0.25
+aatca 0.25 0.25 0.25
+aatcc 0.25 0.25 0.25
+aatcg 0.25 0.25 0.25
+aatct 0.25 0.25 0.25
+aatga 0.25 0.25 0.25
+aatgc 0.25 0.25 0.25
+aatgg 0.25 0.25 0.25
+aatgt 0.25 0.25 0.25
+aatta 0.25 0.25 0.25
+aattc 0.25 0.25 0.25
+aattg 0.25 0.25 0.25
+aattt 0.25 0.25 0.25
+acaaa 0.25 0.25 0.25
+acaac 0.25 0.25 0.25
+acaag 0.25 0.25 0.25
+acaat 0.25 0.25 0.25
+acaca 0.25 0.25 0.25
+acacc 0.25 0.25 0.25
+acacg 0.25 0.25 0.25
+acact 0.25 0.25 0.25
+acaga 0.25 0.25 0.25
+acagc 0.25 0.25 0.25
+acagg 0.25 0.25 0.25
+acagt 0.25 0.25 0.25
+acata 0.25 0.25 0.25
+acatc 0.25 0.25 0.25
+acatg 0.25 0.25 0.25
+acatt 0.25 0.25 0.25
+accaa 0.25 0.25 0.25
+accac 0.25 0.25 0.25
+accag 0.25 0.25 0.25
+accat 0.25 0.25 0.25
+accca 0.25 0.25 0.25
+acccc 0.25 0.25 0.25
+acccg 0.25 0.25 0.25
+accct 0.25 0.25 0.25
+accga 0.25 0.25 0.25
+accgc 0.25 0.25 0.25
+accgg 0.25 0.25 0.25
+accgt 0.25 0.25 0.25
+accta 0.25 0.25 0.25
+acctc 0.25 0.25 0.25
+acctg 0.25 0.25 0.25
+acctt 0.25 0.25 0.25
+acgaa 0.25 0.25 0.25
+acgac 0.25 0.25 0.25
+acgag 0.25 0.25 0.25
+acgat 0.25 0.25 0.25
+acgca 0.25 0.25 0.25
+acgcc 0.25 0.25 0.25
+acgcg 0.25 0.25 0.25
+acgct 0.25 0.25 0.25
+acgga 0.25 0.25 0.25
+acggc 0.25 0.25 0.25
+acggg 0.25 0.25 0.25
+acggt 0.25 0.25 0.25
+acgta 0.25 0.25 0.25
+acgtc 0.25 0.25 0.25
+acgtg 0.25 0.25 0.25
+acgtt 0.25 0.25 0.25
+actaa 0.25 0.25 0.25
+actac 0.25 0.25 0.25
+actag 0.25 0.25 0.25
+actat 0.25 0.25 0.25
+actca 0.25 0.25 0.25
+actcc 0.25 0.25 0.25
+actcg 0.25 0.25 0.25
+actct 0.25 0.25 0.25
+actga 0.25 0.25 0.25
+actgc 0.25 0.25 0.25
+actgg 0.25 0.25 0.25
+actgt 0.25 0.25 0.25
+actta 0.25 0.25 0.25
+acttc 0.25 0.25 0.25
+acttg 0.25 0.25 0.25
+acttt 0.25 0.25 0.25
+agaaa 0.25 0.25 0.25
+agaac 0.25 0.25 0.25
+agaag 0.25 0.25 0.25
+agaat 0.25 0.25 0.25
+agaca 0.25 0.25 0.25
+agacc 0.25 0.25 0.25
+agacg 0.25 0.25 0.25
+agact 0.25 0.25 0.25
+agaga 0.25 0.25 0.25
+agagc 0.25 0.25 0.25
+agagg 0.25 0.25 0.25
+agagt 0.25 0.25 0.25
+agata 0.25 0.25 0.25
+agatc 0.25 0.25 0.25
+agatg 0.25 0.25 0.25
+agatt 0.25 0.25 0.25
+agcaa 0.25 0.25 0.25
+agcac 0.25 0.25 0.25
+agcag 0.25 0.25 0.25
+agcat 0.25 0.25 0.25
+agcca 0.25 0.25 0.25
+agccc 0.25 0.25 0.25
+agccg 0.25 0.25 0.25
+agcct 0.25 0.25 0.25
+agcga 0.25 0.25 0.25
+agcgc 0.25 0.25 0.25
+agcgg 0.25 0.25 0.25
+agcgt 0.25 0.25 0.25
+agcta 0.25 0.25 0.25
+agctc 0.25 0.25 0.25
+agctg 0.25 0.25 0.25
+agctt 0.25 0.25 0.25
+aggaa 0.25 0.25 0.25
+aggac 0.25 0.25 0.25
+aggag 0.25 0.25 0.25
+aggat 0.25 0.25 0.25
+aggca 0.25 0.25 0.25
+aggcc 0.25 0.25 0.25
+aggcg 0.25 0.25 0.25
+aggct 0.25 0.25 0.25
+aggga 0.25 0.25 0.25
+agggc 0.25 0.25 0.25
+agggg 0.25 0.25 0.25
+agggt 0.25 0.25 0.25
+aggta 0.25 0.25 0.25
+aggtc 0.25 0.25 0.25
+aggtg 0.25 0.25 0.25
+aggtt 0.25 0.25 0.25
+agtaa 0.25 0.25 0.25
+agtac 0.25 0.25 0.25
+agtag 0.25 0.25 0.25
+agtat 0.25 0.25 0.25
+agtca 0.25 0.25 0.25
+agtcc 0.25 0.25 0.25
+agtcg 0.25 0.25 0.25
+agtct 0.25 0.25 0.25
+agtga 0.25 0.25 0.25
+agtgc 0.25 0.25 0.25
+agtgg 0.25 0.25 0.25
+agtgt 0.25 0.25 0.25
+agtta 0.25 0.25 0.25
+agttc 0.25 0.25 0.25
+agttg 0.25 0.25 0.25
+agttt 0.25 0.25 0.25
+ataaa 0.25 0.25 0.25
+ataac 0.25 0.25 0.25
+ataag 0.25 0.25 0.25
+ataat 0.25 0.25 0.25
+ataca 0.25 0.25 0.25
+atacc 0.25 0.25 0.25
+atacg 0.25 0.25 0.25
+atact 0.25 0.25 0.25
+ataga 0.25 0.25 0.25
+atagc 0.25 0.25 0.25
+atagg 0.25 0.25 0.25
+atagt 0.25 0.25 0.25
+atata 0.25 0.25 0.25
+atatc 0.25 0.25 0.25
+atatg 0.25 0.25 0.25
+atatt 0.25 0.25 0.25
+atcaa 0.25 0.25 0.25
+atcac 0.25 0.25 0.25
+atcag 0.25 0.25 0.25
+atcat 0.25 0.25 0.25
+atcca 0.25 0.25 0.25
+atccc 0.25 0.25 0.25
+atccg 0.25 0.25 0.25
+atcct 0.25 0.25 0.25
+atcga 0.25 0.25 0.25
+atcgc 0.25 0.25 0.25
+atcgg 0.25 0.25 0.25
+atcgt 0.25 0.25 0.25
+atcta 0.25 0.25 0.25
+atctc 0.25 0.25 0.25
+atctg 0.25 0.25 0.25
+atctt 0.25 0.25 0.25
+atgaa 0.25 0.25 0.25
+atgac 0.25 0.25 0.25
+atgag 0.25 0.25 0.25
+atgat 0.25 0.25 0.25
+atgca 0.25 0.25 0.25
+atgcc 0.25 0.25 0.25
+atgcg 0.25 0.25 0.25
+atgct 0.25 0.25 0.25
+atgga 0.25 0.25 0.25
+atggc 0.25 0.25 0.25
+atggg 0.25 0.25 0.25
+atggt 0.25 0.25 0.25
+atgta 0.25 0.25 0.25
+atgtc 0.25 0.25 0.25
+atgtg 0.25 0.25 0.25
+atgtt 0.25 0.25 0.25
+attaa 0.25 0.25 0.25
+attac 0.25 0.25 0.25
+attag 0.25 0.25 0.25
+attat 0.25 0.25 0.25
+attca 0.25 0.25 0.25
+attcc 0.25 0.25 0.25
+attcg 0.25 0.25 0.25
+attct 0.25 0.25 0.25
+attga 0.25 0.25 0.25
+attgc 0.25 0.25 0.25
+attgg 0.25 0.25 0.25
+attgt 0.25 0.25 0.25
+attta 0.25 0.25 0.25
+atttc 0.25 0.25 0.25
+atttg 0.25 0.25 0.25
+atttt 0.25 0.25 0.25
+caaaa 0.25 0.25 0.25
+caaac 0.25 0.25 0.25
+caaag 0.25 0.25 0.25
+caaat 0.25 0.25 0.25
+caaca 0.25 0.25 0.25
+caacc 0.25 0.25 0.25
+caacg 0.25 0.25 0.25
+caact 0.25 0.25 0.25
+caaga 0.25 0.25 0.25
+caagc 0.25 0.25 0.25
+caagg 0.25 0.25 0.25
+caagt 0.25 0.25 0.25
+caata 0.25 0.25 0.25
+caatc 0.25 0.25 0.25
+caatg 0.25 0.25 0.25
+caatt 0.25 0.25 0.25
+cacaa 0.25 0.25 0.25
+cacac 0.25 0.25 0.25
+cacag 0.25 0.25 0.25
+cacat 0.25 0.25 0.25
+cacca 0.25 0.25 0.25
+caccc 0.25 0.25 0.25
+caccg 0.25 0.25 0.25
+cacct 0.25 0.25 0.25
+cacga 0.25 0.25 0.25
+cacgc 0.25 0.25 0.25
+cacgg 0.25 0.25 0.25
+cacgt 0.25 0.25 0.25
+cacta 0.25 0.25 0.25
+cactc 0.25 0.25 0.25
+cactg 0.25 0.25 0.25
+cactt 0.25 0.25 0.25
+cagaa 0.25 0.25 0.25
+cagac 0.25 0.25 0.25
+cagag 0.25 0.25 0.25
+cagat 0.25 0.25 0.25
+cagca 0.25 0.25 0.25
+cagcc 0.25 0.25 0.25
+cagcg 0.25 0.25 0.25
+cagct 0.25 0.25 0.25
+cagga 0.25 0.25 0.25
+caggc 0.25 0.25 0.25
+caggg 0.25 0.25 0.25
+caggt 0.25 0.25 0.25
+cagta 0.25 0.25 0.25
+cagtc 0.25 0.25 0.25
+cagtg 0.25 0.25 0.25
+cagtt 0.25 0.25 0.25
+cataa 0.25 0.25 0.25
+catac 0.25 0.25 0.25
+catag 0.25 0.25 0.25
+catat 0.25 0.25 0.25
+catca 0.25 0.25 0.25
+catcc 0.25 0.25 0.25
+catcg 0.25 0.25 0.25
+catct 0.25 0.25 0.25
+catga 0.25 0.25 0.25
+catgc 0.25 0.25 0.25
+catgg 0.25 0.25 0.25
+catgt 0.25 0.25 0.25
+catta 0.25 0.25 0.25
+cattc 0.25 0.25 0.25
+cattg 0.25 0.25 0.25
+cattt 0.25 0.25 0.25
+ccaaa 0.25 0.25 0.25
+ccaac 0.25 0.25 0.25
+ccaag 0.25 0.25 0.25
+ccaat 0.25 0.25 0.25
+ccaca 0.25 0.25 0.25
+ccacc 0.25 0.25 0.25
+ccacg 0.25 0.25 0.25
+ccact 0.25 0.25 0.25
+ccaga 0.25 0.25 0.25
+ccagc 0.25 0.25 0.25
+ccagg 0.25 0.25 0.25
+ccagt 0.25 0.25 0.25
+ccata 0.25 0.25 0.25
+ccatc 0.25 0.25 0.25
+ccatg 0.25 0.25 0.25
+ccatt 0.25 0.25 0.25
+cccaa 0.25 0.25 0.25
+cccac 0.25 0.25 0.25
+cccag 0.25 0.25 0.25
+cccat 0.25 0.25 0.25
+cccca 0.25 0.25 0.25
+ccccc 0.25 0.25 0.25
+ccccg 0.25 0.25 0.25
+cccct 0.25 0.25 0.25
+cccga 0.25 0.25 0.25
+cccgc 0.25 0.25 0.25
+cccgg 0.25 0.25 0.25
+cccgt 0.25 0.25 0.25
+cccta 0.25 0.25 0.25
+ccctc 0.25 0.25 0.25
+ccctg 0.25 0.25 0.25
+ccctt 0.25 0.25 0.25
+ccgaa 0.25 0.25 0.25
+ccgac 0.25 0.25 0.25
+ccgag 0.25 0.25 0.25
+ccgat 0.25 0.25 0.25
+ccgca 0.25 0.25 0.25
+ccgcc 0.25 0.25 0.25
+ccgcg 0.25 0.25 0.25
+ccgct 0.25 0.25 0.25
+ccgga 0.25 0.25 0.25
+ccggc 0.25 0.25 0.25
+ccggg 0.25 0.25 0.25
+ccggt 0.25 0.25 0.25
+ccgta 0.25 0.25 0.25
+ccgtc 0.25 0.25 0.25
+ccgtg 0.25 0.25 0.25
+ccgtt 0.25 0.25 0.25
+cctaa 0.25 0.25 0.25
+cctac 0.25 0.25 0.25
+cctag 0.25 0.25 0.25
+cctat 0.25 0.25 0.25
+cctca 0.25 0.25 0.25
+cctcc 0.25 0.25 0.25
+cctcg 0.25 0.25 0.25
+cctct 0.25 0.25 0.25
+cctga 0.25 0.25 0.25
+cctgc 0.25 0.25 0.25
+cctgg 0.25 0.25 0.25
+cctgt 0.25 0.25 0.25
+cctta 0.25 0.25 0.25
+ccttc 0.25 0.25 0.25
+ccttg 0.25 0.25 0.25
+ccttt 0.25 0.25 0.25
+cgaaa 0.25 0.25 0.25
+cgaac 0.25 0.25 0.25
+cgaag 0.25 0.25 0.25
+cgaat 0.25 0.25 0.25
+cgaca 0.25 0.25 0.25
+cgacc 0.25 0.25 0.25
+cgacg 0.25 0.25 0.25
+cgact 0.25 0.25 0.25
+cgaga 0.25 0.25 0.25
+cgagc 0.25 0.25 0.25
+cgagg 0.25 0.25 0.25
+cgagt 0.25 0.25 0.25
+cgata 0.25 0.25 0.25
+cgatc 0.25 0.25 0.25
+cgatg 0.25 0.25 0.25
+cgatt 0.25 0.25 0.25
+cgcaa 0.25 0.25 0.25
+cgcac 0.25 0.25 0.25
+cgcag 0.25 0.25 0.25
+cgcat 0.25 0.25 0.25
+cgcca 0.25 0.25 0.25
+cgccc 0.25 0.25 0.25
+cgccg 0.25 0.25 0.25
+cgcct 0.25 0.25 0.25
+cgcga 0.25 0.25 0.25
+cgcgc 0.25 0.25 0.25
+cgcgg 0.25 0.25 0.25
+cgcgt 0.25 0.25 0.25
+cgcta 0.25 0.25 0.25
+cgctc 0.25 0.25 0.25
+cgctg 0.25 0.25 0.25
+cgctt 0.25 0.25 0.25
+cggaa 0.25 0.25 0.25
+cggac 0.25 0.25 0.25
+cggag 0.25 0.25 0.25
+cggat 0.25 0.25 0.25
+cggca 0.25 0.25 0.25
+cggcc 0.25 0.25 0.25
+cggcg 0.25 0.25 0.25
+cggct 0.25 0.25 0.25
+cggga 0.25 0.25 0.25
+cgggc 0.25 0.25 0.25
+cgggg 0.25 0.25 0.25
+cgggt 0.25 0.25 0.25
+cggta 0.25 0.25 0.25
+cggtc 0.25 0.25 0.25
+cggtg 0.25 0.25 0.25
+cggtt 0.25 0.25 0.25
+cgtaa 0.25 0.25 0.25
+cgtac 0.25 0.25 0.25
+cgtag 0.25 0.25 0.25
+cgtat 0.25 0.25 0.25
+cgtca 0.25 0.25 0.25
+cgtcc 0.25 0.25 0.25
+cgtcg 0.25 0.25 0.25
+cgtct 0.25 0.25 0.25
+cgtga 0.25 0.25 0.25
+cgtgc 0.25 0.25 0.25
+cgtgg 0.25 0.25 0.25
+cgtgt 0.25 0.25 0.25
+cgtta 0.25 0.25 0.25
+cgttc 0.25 0.25 0.25
+cgttg 0.25 0.25 0.25
+cgttt 0.25 0.25 0.25
+ctaaa 0.25 0.25 0.25
+ctaac 0.25 0.25 0.25
+ctaag 0.25 0.25 0.25
+ctaat 0.25 0.25 0.25
+ctaca 0.25 0.25 0.25
+ctacc 0.25 0.25 0.25
+ctacg 0.25 0.25 0.25
+ctact 0.25 0.25 0.25
+ctaga 0.25 0.25 0.25
+ctagc 0.25 0.25 0.25
+ctagg 0.25 0.25 0.25
+ctagt 0.25 0.25 0.25
+ctata 0.25 0.25 0.25
+ctatc 0.25 0.25 0.25
+ctatg 0.25 0.25 0.25
+ctatt 0.25 0.25 0.25
+ctcaa 0.25 0.25 0.25
+ctcac 0.25 0.25 0.25
+ctcag 0.25 0.25 0.25
+ctcat 0.25 0.25 0.25
+ctcca 0.25 0.25 0.25
+ctccc 0.25 0.25 0.25
+ctccg 0.25 0.25 0.25
+ctcct 0.25 0.25 0.25
+ctcga 0.25 0.25 0.25
+ctcgc 0.25 0.25 0.25
+ctcgg 0.25 0.25 0.25
+ctcgt 0.25 0.25 0.25
+ctcta 0.25 0.25 0.25
+ctctc 0.25 0.25 0.25
+ctctg 0.25 0.25 0.25
+ctctt 0.25 0.25 0.25
+ctgaa 0.25 0.25 0.25
+ctgac 0.25 0.25 0.25
+ctgag 0.25 0.25 0.25
+ctgat 0.25 0.25 0.25
+ctgca 0.25 0.25 0.25
+ctgcc 0.25 0.25 0.25
+ctgcg 0.25 0.25 0.25
+ctgct 0.25 0.25 0.25
+ctgga 0.25 0.25 0.25
+ctggc 0.25 0.25 0.25
+ctggg 0.25 0.25 0.25
+ctggt 0.25 0.25 0.25
+ctgta 0.25 0.25 0.25
+ctgtc 0.25 0.25 0.25
+ctgtg 0.25 0.25 0.25
+ctgtt 0.25 0.25 0.25
+cttaa 0.25 0.25 0.25
+cttac 0.25 0.25 0.25
+cttag 0.25 0.25 0.25
+cttat 0.25 0.25 0.25
+cttca 0.25 0.25 0.25
+cttcc 0.25 0.25 0.25
+cttcg 0.25 0.25 0.25
+cttct 0.25 0.25 0.25
+cttga 0.25 0.25 0.25
+cttgc 0.25 0.25 0.25
+cttgg 0.25 0.25 0.25
+cttgt 0.25 0.25 0.25
+cttta 0.25 0.25 0.25
+ctttc 0.25 0.25 0.25
+ctttg 0.25 0.25 0.25
+ctttt 0.25 0.25 0.25
+gaaaa 0.25 0.25 0.25
+gaaac 0.25 0.25 0.25
+gaaag 0.25 0.25 0.25
+gaaat 0.25 0.25 0.25
+gaaca 0.25 0.25 0.25
+gaacc 0.25 0.25 0.25
+gaacg 0.25 0.25 0.25
+gaact 0.25 0.25 0.25
+gaaga 0.25 0.25 0.25
+gaagc 0.25 0.25 0.25
+gaagg 0.25 0.25 0.25
+gaagt 0.25 0.25 0.25
+gaata 0.25 0.25 0.25
+gaatc 0.25 0.25 0.25
+gaatg 0.25 0.25 0.25
+gaatt 0.25 0.25 0.25
+gacaa 0.25 0.25 0.25
+gacac 0.25 0.25 0.25
+gacag 0.25 0.25 0.25
+gacat 0.25 0.25 0.25
+gacca 0.25 0.25 0.25
+gaccc 0.25 0.25 0.25
+gaccg 0.25 0.25 0.25
+gacct 0.25 0.25 0.25
+gacga 0.25 0.25 0.25
+gacgc 0.25 0.25 0.25
+gacgg 0.25 0.25 0.25
+gacgt 0.25 0.25 0.25
+gacta 0.25 0.25 0.25
+gactc 0.25 0.25 0.25
+gactg 0.25 0.25 0.25
+gactt 0.25 0.25 0.25
+gagaa 0.25 0.25 0.25
+gagac 0.25 0.25 0.25
+gagag 0.25 0.25 0.25
+gagat 0.25 0.25 0.25
+gagca 0.25 0.25 0.25
+gagcc 0.25 0.25 0.25
+gagcg 0.25 0.25 0.25
+gagct 0.25 0.25 0.25
+gagga 0.25 0.25 0.25
+gaggc 0.25 0.25 0.25
+gaggg 0.25 0.25 0.25
+gaggt 0.25 0.25 0.25
+gagta 0.25 0.25 0.25
+gagtc 0.25 0.25 0.25
+gagtg 0.25 0.25 0.25
+gagtt 0.25 0.25 0.25
+gataa 0.25 0.25 0.25
+gatac 0.25 0.25 0.25
+gatag 0.25 0.25 0.25
+gatat 0.25 0.25 0.25
+gatca 0.25 0.25 0.25
+gatcc 0.25 0.25 0.25
+gatcg 0.25 0.25 0.25
+gatct 0.25 0.25 0.25
+gatga 0.25 0.25 0.25
+gatgc 0.25 0.25 0.25
+gatgg 0.25 0.25 0.25
+gatgt 0.25 0.25 0.25
+gatta 0.25 0.25 0.25
+gattc 0.25 0.25 0.25
+gattg 0.25 0.25 0.25
+gattt 0.25 0.25 0.25
+gcaaa 0.25 0.25 0.25
+gcaac 0.25 0.25 0.25
+gcaag 0.25 0.25 0.25
+gcaat 0.25 0.25 0.25
+gcaca 0.25 0.25 0.25
+gcacc 0.25 0.25 0.25
+gcacg 0.25 0.25 0.25
+gcact 0.25 0.25 0.25
+gcaga 0.25 0.25 0.25
+gcagc 0.25 0.25 0.25
+gcagg 0.25 0.25 0.25
+gcagt 0.25 0.25 0.25
+gcata 0.25 0.25 0.25
+gcatc 0.25 0.25 0.25
+gcatg 0.25 0.25 0.25
+gcatt 0.25 0.25 0.25
+gccaa 0.25 0.25 0.25
+gccac 0.25 0.25 0.25
+gccag 0.25 0.25 0.25
+gccat 0.25 0.25 0.25
+gccca 0.25 0.25 0.25
+gcccc 0.25 0.25 0.25
+gcccg 0.25 0.25 0.25
+gccct 0.25 0.25 0.25
+gccga 0.25 0.25 0.25
+gccgc 0.25 0.25 0.25
+gccgg 0.25 0.25 0.25
+gccgt 0.25 0.25 0.25
+gccta 0.25 0.25 0.25
+gcctc 0.25 0.25 0.25
+gcctg 0.25 0.25 0.25
+gcctt 0.25 0.25 0.25
+gcgaa 0.25 0.25 0.25
+gcgac 0.25 0.25 0.25
+gcgag 0.25 0.25 0.25
+gcgat 0.25 0.25 0.25
+gcgca 0.25 0.25 0.25
+gcgcc 0.25 0.25 0.25
+gcgcg 0.25 0.25 0.25
+gcgct 0.25 0.25 0.25
+gcgga 0.25 0.25 0.25
+gcggc 0.25 0.25 0.25
+gcggg 0.25 0.25 0.25
+gcggt 0.25 0.25 0.25
+gcgta 0.25 0.25 0.25
+gcgtc 0.25 0.25 0.25
+gcgtg 0.25 0.25 0.25
+gcgtt 0.25 0.25 0.25
+gctaa 0.25 0.25 0.25
+gctac 0.25 0.25 0.25
+gctag 0.25 0.25 0.25
+gctat 0.25 0.25 0.25
+gctca 0.25 0.25 0.25
+gctcc 0.25 0.25 0.25
+gctcg 0.25 0.25 0.25
+gctct 0.25 0.25 0.25
+gctga 0.25 0.25 0.25
+gctgc 0.25 0.25 0.25
+gctgg 0.25 0.25 0.25
+gctgt 0.25 0.25 0.25
+gctta 0.25 0.25 0.25
+gcttc 0.25 0.25 0.25
+gcttg 0.25 0.25 0.25
+gcttt 0.25 0.25 0.25
+ggaaa 0.25 0.25 0.25
+ggaac 0.25 0.25 0.25
+ggaag 0.25 0.25 0.25
+ggaat 0.25 0.25 0.25
+ggaca 0.25 0.25 0.25
+ggacc 0.25 0.25 0.25
+ggacg 0.25 0.25 0.25
+ggact 0.25 0.25 0.25
+ggaga 0.25 0.25 0.25
+ggagc 0.25 0.25 0.25
+ggagg 0.25 0.25 0.25
+ggagt 0.25 0.25 0.25
+ggata 0.25 0.25 0.25
+ggatc 0.25 0.25 0.25
+ggatg 0.25 0.25 0.25
+ggatt 0.25 0.25 0.25
+ggcaa 0.25 0.25 0.25
+ggcac 0.25 0.25 0.25
+ggcag 0.25 0.25 0.25
+ggcat 0.25 0.25 0.25
+ggcca 0.25 0.25 0.25
+ggccc 0.25 0.25 0.25
+ggccg 0.25 0.25 0.25
+ggcct 0.25 0.25 0.25
+ggcga 0.25 0.25 0.25
+ggcgc 0.25 0.25 0.25
+ggcgg 0.25 0.25 0.25
+ggcgt 0.25 0.25 0.25
+ggcta 0.25 0.25 0.25
+ggctc 0.25 0.25 0.25
+ggctg 0.25 0.25 0.25
+ggctt 0.25 0.25 0.25
+gggaa 0.25 0.25 0.25
+gggac 0.25 0.25 0.25
+gggag 0.25 0.25 0.25
+gggat 0.25 0.25 0.25
+gggca 0.25 0.25 0.25
+gggcc 0.25 0.25 0.25
+gggcg 0.25 0.25 0.25
+gggct 0.25 0.25 0.25
+gggga 0.25 0.25 0.25
+ggggc 0.25 0.25 0.25
+ggggg 0.25 0.25 0.25
+ggggt 0.25 0.25 0.25
+gggta 0.25 0.25 0.25
+gggtc 0.25 0.25 0.25
+gggtg 0.25 0.25 0.25
+gggtt 0.25 0.25 0.25
+ggtaa 0.25 0.25 0.25
+ggtac 0.25 0.25 0.25
+ggtag 0.25 0.25 0.25
+ggtat 0.25 0.25 0.25
+ggtca 0.25 0.25 0.25
+ggtcc 0.25 0.25 0.25
+ggtcg 0.25 0.25 0.25
+ggtct 0.25 0.25 0.25
+ggtga 0.25 0.25 0.25
+ggtgc 0.25 0.25 0.25
+ggtgg 0.25 0.25 0.25
+ggtgt 0.25 0.25 0.25
+ggtta 0.25 0.25 0.25
+ggttc 0.25 0.25 0.25
+ggttg 0.25 0.25 0.25
+ggttt 0.25 0.25 0.25
+gtaaa 0.25 0.25 0.25
+gtaac 0.25 0.25 0.25
+gtaag 0.25 0.25 0.25
+gtaat 0.25 0.25 0.25
+gtaca 0.25 0.25 0.25
+gtacc 0.25 0.25 0.25
+gtacg 0.25 0.25 0.25
+gtact 0.25 0.25 0.25
+gtaga 0.25 0.25 0.25
+gtagc 0.25 0.25 0.25
+gtagg 0.25 0.25 0.25
+gtagt 0.25 0.25 0.25
+gtata 0.25 0.25 0.25
+gtatc 0.25 0.25 0.25
+gtatg 0.25 0.25 0.25
+gtatt 0.25 0.25 0.25
+gtcaa 0.25 0.25 0.25
+gtcac 0.25 0.25 0.25
+gtcag 0.25 0.25 0.25
+gtcat 0.25 0.25 0.25
+gtcca 0.25 0.25 0.25
+gtccc 0.25 0.25 0.25
+gtccg 0.25 0.25 0.25
+gtcct 0.25 0.25 0.25
+gtcga 0.25 0.25 0.25
+gtcgc 0.25 0.25 0.25
+gtcgg 0.25 0.25 0.25
+gtcgt 0.25 0.25 0.25
+gtcta 0.25 0.25 0.25
+gtctc 0.25 0.25 0.25
+gtctg 0.25 0.25 0.25
+gtctt 0.25 0.25 0.25
+gtgaa 0.25 0.25 0.25
+gtgac 0.25 0.25 0.25
+gtgag 0.25 0.25 0.25
+gtgat 0.25 0.25 0.25
+gtgca 0.25 0.25 0.25
+gtgcc 0.25 0.25 0.25
+gtgcg 0.25 0.25 0.25
+gtgct 0.25 0.25 0.25
+gtgga 0.25 0.25 0.25
+gtggc 0.25 0.25 0.25
+gtggg 0.25 0.25 0.25
+gtggt 0.25 0.25 0.25
+gtgta 0.25 0.25 0.25
+gtgtc 0.25 0.25 0.25
+gtgtg 0.25 0.25 0.25
+gtgtt 0.25 0.25 0.25
+gttaa 0.25 0.25 0.25
+gttac 0.25 0.25 0.25
+gttag 0.25 0.25 0.25
+gttat 0.25 0.25 0.25
+gttca 0.25 0.25 0.25
+gttcc 0.25 0.25 0.25
+gttcg 0.25 0.25 0.25
+gttct 0.25 0.25 0.25
+gttga 0.25 0.25 0.25
+gttgc 0.25 0.25 0.25
+gttgg 0.25 0.25 0.25
+gttgt 0.25 0.25 0.25
+gttta 0.25 0.25 0.25
+gtttc 0.25 0.25 0.25
+gtttg 0.25 0.25 0.25
+gtttt 0.25 0.25 0.25
+taaaa 0.25 0.25 0.25
+taaac 0.25 0.25 0.25
+taaag 0.25 0.25 0.25
+taaat 0.25 0.25 0.25
+taaca 0.25 0.25 0.25
+taacc 0.25 0.25 0.25
+taacg 0.25 0.25 0.25
+taact 0.25 0.25 0.25
+taaga 0.25 0.25 0.25
+taagc 0.25 0.25 0.25
+taagg 0.25 0.25 0.25
+taagt 0.25 0.25 0.25
+taata 0.25 0.25 0.25
+taatc 0.25 0.25 0.25
+taatg 0.25 0.25 0.25
+taatt 0.25 0.25 0.25
+tacaa 0.25 0.25 0.25
+tacac 0.25 0.25 0.25
+tacag 0.25 0.25 0.25
+tacat 0.25 0.25 0.25
+tacca 0.25 0.25 0.25
+taccc 0.25 0.25 0.25
+taccg 0.25 0.25 0.25
+tacct 0.25 0.25 0.25
+tacga 0.25 0.25 0.25
+tacgc 0.25 0.25 0.25
+tacgg 0.25 0.25 0.25
+tacgt 0.25 0.25 0.25
+tacta 0.25 0.25 0.25
+tactc 0.25 0.25 0.25
+tactg 0.25 0.25 0.25
+tactt 0.25 0.25 0.25
+tagaa 0.25 0.25 0.25
+tagac 0.25 0.25 0.25
+tagag 0.25 0.25 0.25
+tagat 0.25 0.25 0.25
+tagca 0.25 0.25 0.25
+tagcc 0.25 0.25 0.25
+tagcg 0.25 0.25 0.25
+tagct 0.25 0.25 0.25
+tagga 0.25 0.25 0.25
+taggc 0.25 0.25 0.25
+taggg 0.25 0.25 0.25
+taggt 0.25 0.25 0.25
+tagta 0.25 0.25 0.25
+tagtc 0.25 0.25 0.25
+tagtg 0.25 0.25 0.25
+tagtt 0.25 0.25 0.25
+tataa 0.25 0.25 0.25
+tatac 0.25 0.25 0.25
+tatag 0.25 0.25 0.25
+tatat 0.25 0.25 0.25
+tatca 0.25 0.25 0.25
+tatcc 0.25 0.25 0.25
+tatcg 0.25 0.25 0.25
+tatct 0.25 0.25 0.25
+tatga 0.25 0.25 0.25
+tatgc 0.25 0.25 0.25
+tatgg 0.25 0.25 0.25
+tatgt 0.25 0.25 0.25
+tatta 0.25 0.25 0.25
+tattc 0.25 0.25 0.25
+tattg 0.25 0.25 0.25
+tattt 0.25 0.25 0.25
+tcaaa 0.25 0.25 0.25
+tcaac 0.25 0.25 0.25
+tcaag 0.25 0.25 0.25
+tcaat 0.25 0.25 0.25
+tcaca 0.25 0.25 0.25
+tcacc 0.25 0.25 0.25
+tcacg 0.25 0.25 0.25
+tcact 0.25 0.25 0.25
+tcaga 0.25 0.25 0.25
+tcagc 0.25 0.25 0.25
+tcagg 0.25 0.25 0.25
+tcagt 0.25 0.25 0.25
+tcata 0.25 0.25 0.25
+tcatc 0.25 0.25 0.25
+tcatg 0.25 0.25 0.25
+tcatt 0.25 0.25 0.25
+tccaa 0.25 0.25 0.25
+tccac 0.25 0.25 0.25
+tccag 0.25 0.25 0.25
+tccat 0.25 0.25 0.25
+tccca 0.25 0.25 0.25
+tcccc 0.25 0.25 0.25
+tcccg 0.25 0.25 0.25
+tccct 0.25 0.25 0.25
+tccga 0.25 0.25 0.25
+tccgc 0.25 0.25 0.25
+tccgg 0.25 0.25 0.25
+tccgt 0.25 0.25 0.25
+tccta 0.25 0.25 0.25
+tcctc 0.25 0.25 0.25
+tcctg 0.25 0.25 0.25
+tcctt 0.25 0.25 0.25
+tcgaa 0.25 0.25 0.25
+tcgac 0.25 0.25 0.25
+tcgag 0.25 0.25 0.25
+tcgat 0.25 0.25 0.25
+tcgca 0.25 0.25 0.25
+tcgcc 0.25 0.25 0.25
+tcgcg 0.25 0.25 0.25
+tcgct 0.25 0.25 0.25
+tcgga 0.25 0.25 0.25
+tcggc 0.25 0.25 0.25
+tcggg 0.25 0.25 0.25
+tcggt 0.25 0.25 0.25
+tcgta 0.25 0.25 0.25
+tcgtc 0.25 0.25 0.25
+tcgtg 0.25 0.25 0.25
+tcgtt 0.25 0.25 0.25
+tctaa 0.25 0.25 0.25
+tctac 0.25 0.25 0.25
+tctag 0.25 0.25 0.25
+tctat 0.25 0.25 0.25
+tctca 0.25 0.25 0.25
+tctcc 0.25 0.25 0.25
+tctcg 0.25 0.25 0.25
+tctct 0.25 0.25 0.25
+tctga 0.25 0.25 0.25
+tctgc 0.25 0.25 0.25
+tctgg 0.25 0.25 0.25
+tctgt 0.25 0.25 0.25
+tctta 0.25 0.25 0.25
+tcttc 0.25 0.25 0.25
+tcttg 0.25 0.25 0.25
+tcttt 0.25 0.25 0.25
+tgaaa 0.25 0.25 0.25
+tgaac 0.25 0.25 0.25
+tgaag 0.25 0.25 0.25
+tgaat 0.25 0.25 0.25
+tgaca 0.25 0.25 0.25
+tgacc 0.25 0.25 0.25
+tgacg 0.25 0.25 0.25
+tgact 0.25 0.25 0.25
+tgaga 0.25 0.25 0.25
+tgagc 0.25 0.25 0.25
+tgagg 0.25 0.25 0.25
+tgagt 0.25 0.25 0.25
+tgata 0.25 0.25 0.25
+tgatc 0.25 0.25 0.25
+tgatg 0.25 0.25 0.25
+tgatt 0.25 0.25 0.25
+tgcaa 0.25 0.25 0.25
+tgcac 0.25 0.25 0.25
+tgcag 0.25 0.25 0.25
+tgcat 0.25 0.25 0.25
+tgcca 0.25 0.25 0.25
+tgccc 0.25 0.25 0.25
+tgccg 0.25 0.25 0.25
+tgcct 0.25 0.25 0.25
+tgcga 0.25 0.25 0.25
+tgcgc 0.25 0.25 0.25
+tgcgg 0.25 0.25 0.25
+tgcgt 0.25 0.25 0.25
+tgcta 0.25 0.25 0.25
+tgctc 0.25 0.25 0.25
+tgctg 0.25 0.25 0.25
+tgctt 0.25 0.25 0.25
+tggaa 0.25 0.25 0.25
+tggac 0.25 0.25 0.25
+tggag 0.25 0.25 0.25
+tggat 0.25 0.25 0.25
+tggca 0.25 0.25 0.25
+tggcc 0.25 0.25 0.25
+tggcg 0.25 0.25 0.25
+tggct 0.25 0.25 0.25
+tggga 0.25 0.25 0.25
+tgggc 0.25 0.25 0.25
+tgggg 0.25 0.25 0.25
+tgggt 0.25 0.25 0.25
+tggta 0.25 0.25 0.25
+tggtc 0.25 0.25 0.25
+tggtg 0.25 0.25 0.25
+tggtt 0.25 0.25 0.25
+tgtaa 0.25 0.25 0.25
+tgtac 0.25 0.25 0.25
+tgtag 0.25 0.25 0.25
+tgtat 0.25 0.25 0.25
+tgtca 0.25 0.25 0.25
+tgtcc 0.25 0.25 0.25
+tgtcg 0.25 0.25 0.25
+tgtct 0.25 0.25 0.25
+tgtga 0.25 0.25 0.25
+tgtgc 0.25 0.25 0.25
+tgtgg 0.25 0.25 0.25
+tgtgt 0.25 0.25 0.25
+tgtta 0.25 0.25 0.25
+tgttc 0.25 0.25 0.25
+tgttg 0.25 0.25 0.25
+tgttt 0.25 0.25 0.25
+ttaaa 0.25 0.25 0.25
+ttaac 0.25 0.25 0.25
+ttaag 0.25 0.25 0.25
+ttaat 0.25 0.25 0.25
+ttaca 0.25 0.25 0.25
+ttacc 0.25 0.25 0.25
+ttacg 0.25 0.25 0.25
+ttact 0.25 0.25 0.25
+ttaga 0.25 0.25 0.25
+ttagc 0.25 0.25 0.25
+ttagg 0.25 0.25 0.25
+ttagt 0.25 0.25 0.25
+ttata 0.25 0.25 0.25
+ttatc 0.25 0.25 0.25
+ttatg 0.25 0.25 0.25
+ttatt 0.25 0.25 0.25
+ttcaa 0.25 0.25 0.25
+ttcac 0.25 0.25 0.25
+ttcag 0.25 0.25 0.25
+ttcat 0.25 0.25 0.25
+ttcca 0.25 0.25 0.25
+ttccc 0.25 0.25 0.25
+ttccg 0.25 0.25 0.25
+ttcct 0.25 0.25 0.25
+ttcga 0.25 0.25 0.25
+ttcgc 0.25 0.25 0.25
+ttcgg 0.25 0.25 0.25
+ttcgt 0.25 0.25 0.25
+ttcta 0.25 0.25 0.25
+ttctc 0.25 0.25 0.25
+ttctg 0.25 0.25 0.25
+ttctt 0.25 0.25 0.25
+ttgaa 0.25 0.25 0.25
+ttgac 0.25 0.25 0.25
+ttgag 0.25 0.25 0.25
+ttgat 0.25 0.25 0.25
+ttgca 0.25 0.25 0.25
+ttgcc 0.25 0.25 0.25
+ttgcg 0.25 0.25 0.25
+ttgct 0.25 0.25 0.25
+ttgga 0.25 0.25 0.25
+ttggc 0.25 0.25 0.25
+ttggg 0.25 0.25 0.25
+ttggt 0.25 0.25 0.25
+ttgta 0.25 0.25 0.25
+ttgtc 0.25 0.25 0.25
+ttgtg 0.25 0.25 0.25
+ttgtt 0.25 0.25 0.25
+tttaa 0.25 0.25 0.25
+tttac 0.25 0.25 0.25
+tttag 0.25 0.25 0.25
+tttat 0.25 0.25 0.25
+tttca 0.25 0.25 0.25
+tttcc 0.25 0.25 0.25
+tttcg 0.25 0.25 0.25
+tttct 0.25 0.25 0.25
+tttga 0.25 0.25 0.25
+tttgc 0.25 0.25 0.25
+tttgg 0.25 0.25 0.25
+tttgt 0.25 0.25 0.25
+tttta 0.25 0.25 0.25
+ttttc 0.25 0.25 0.25
+ttttg 0.25 0.25 0.25
+ttttt 0.25 0.25 0.25
+
+# data set number
+[3]
+# (a,c,g,t)= (0.217, 0.283, 0.283, 0.217)
+#
+# Probabilities file for the exon model
+#
+
+
+# Die P_l's
+[P_ls]
+# k = 4
+# l=
+0
+# Values
+a 0.215 0.285 0.0956
+c 0.279 0.245 0.402
+g 0.358 0.207 0.39
+t 0.147 0.263 0.112
+# l=
+1
+# Values
+aa 0.019 0.0699 0.0258
+ac 0.0283 0.051 0.108
+ag 0.0389 0.0394 0.122
+at 0.0136 0.0561 0.0255
+ca 0.112 0.0682 0.0336
+cc 0.0925 0.0581 0.0946
+cg 0.128 0.0609 0.0877
+ct 0.0656 0.0911 0.0303
+ga 0.0718 0.121 0.024
+gc 0.126 0.0929 0.101
+gg 0.134 0.0723 0.0557
+gt 0.0519 0.071 0.0283
+ta 0.0127 0.0255 0.0121
+tc 0.0325 0.043 0.0988
+tg 0.0576 0.0346 0.125
+tt 0.0157 0.0449 0.0281
+# l=
+2
+# Values
+aaa 0.00549 0.00675 0.00848
+aac 0.0059 0.00426 0.0227
+aag 0.0106 0.00363 0.0325
+aat 0.00341 0.00496 0.005
+aca 0.0276 0.00767 0.00735
+acc 0.028 0.00672 0.0182
+acg 0.0334 0.00712 0.021
+act 0.0162 0.00719 0.00496
+aga 0.0284 0.0148 0.00484
+agc 0.0344 0.0111 0.0212
+agg 0.0413 0.00869 0.00846
+agt 0.0149 0.00656 0.00497
+ata 0.00287 0.00236 0.0031
+atc 0.00704 0.00433 0.0256
+atg 0.0138 0.00282 0.0207
+att 0.00388 0.00468 0.0067
+caa 0.00603 0.0341 0.00627
+cac 0.0119 0.0264 0.0231
+cag 0.0125 0.0164 0.0336
+cat 0.00486 0.0305 0.0048
+cca 0.0279 0.0202 0.00863
+ccc 0.0168 0.0192 0.0231
+ccg 0.0324 0.0188 0.0195
+cct 0.0145 0.0307 0.00698
+cga 0.0115 0.039 0.00643
+cgc 0.0315 0.031 0.0301
+cgg 0.0292 0.0242 0.0161
+cgt 0.0134 0.0289 0.00814
+cta 0.00327 0.0115 0.00327
+ctc 0.0109 0.0194 0.0306
+ctg 0.0139 0.0133 0.0508
+ctt 0.00405 0.019 0.00648
+gaa 0.00455 0.0246 0.0109
+gac 0.00608 0.0171 0.0409
+gag 0.012 0.0177 0.0557
+gat 0.00309 0.0174 0.0121
+gca 0.0271 0.0334 0.0121
+gcc 0.0256 0.025 0.0376
+gcg 0.0349 0.0287 0.0309
+gct 0.0178 0.0445 0.0121
+gga 0.0121 0.0524 0.0126
+ggc 0.0195 0.0379 0.033
+ggg 0.0194 0.0262 0.0191
+ggt 0.00633 0.0244 0.00909
+gta 0.00327 0.00935 0.00388
+gtc 0.00713 0.0148 0.0178
+gtg 0.0156 0.015 0.0439
+gtt 0.00349 0.0159 0.00647
+taa 0.00297 0.00442 0.000143
+tac 0.00441 0.00328 0.0212
+tag 0.00378 0.00169 0.000143
+tat 0.0022 0.00328 0.00359
+tca 0.0292 0.00701 0.0055
+tcc 0.0221 0.00713 0.0157
+tcg 0.0273 0.00623 0.0162
+tct 0.0171 0.00861 0.00626
+tga 0.0198 0.015 0.000143
+tgc 0.0408 0.0129 0.0164
+tgg 0.044 0.0131 0.0121
+tgt 0.0172 0.0112 0.00613
+tta 0.00331 0.00234 0.00188
+ttc 0.0075 0.00453 0.0248
+ttg 0.0142 0.00351 0.00957
+ttt 0.00428 0.00534 0.00843
+# l=
+3
+# Values
+aaaa 0.0018 0.00218 0.00119
+aaac 0.00217 0.00133 0.00204
+aaag 0.00303 0.00109 0.00226
+aaat 0.00123 0.00201 0.000738
+aaca 0.00641 0.00202 0.000847
+aacc 0.00602 0.00164 0.00142
+aacg 0.00624 0.0015 0.00136
+aact 0.00341 0.00203 0.000688
+aaga 0.00853 0.00512 0.000768
+aagc 0.00835 0.00302 0.00141
+aagg 0.0105 0.0026 0.000832
+aagt 0.0042 0.0022 0.000669
+aata 0.000755 0.000954 0.00062
+aatc 0.00164 0.00132 0.00196
+aatg 0.00296 0.000841 0.00163
+aatt 0.00072 0.00125 0.000745
+acaa 0.00173 0.00878 0.00111
+acac 0.00294 0.0063 0.00217
+acag 0.00332 0.00423 0.00309
+acat 0.00111 0.00779 0.000709
+acca 0.00624 0.00612 0.000996
+accc 0.00308 0.0063 0.00243
+accg 0.00514 0.00555 0.00181
+acct 0.00285 0.00956 0.000903
+acga 0.00296 0.0115 0.000893
+acgc 0.00712 0.0079 0.00251
+acgg 0.00711 0.00609 0.00193
+acgt 0.00337 0.00738 0.00116
+acta 0.000875 0.00299 0.000413
+actc 0.00189 0.00431 0.00242
+actg 0.00236 0.00339 0.00284
+actt 0.00102 0.00518 0.00088
+agaa 0.00142 0.0126 0.00186
+agac 0.00161 0.00672 0.0038
+agag 0.00236 0.00717 0.00562
+agat 0.000585 0.00844 0.0019
+agca 0.00701 0.0119 0.00203
+agcc 0.0059 0.00702 0.00337
+agcg 0.00839 0.00926 0.00304
+agct 0.00362 0.0141 0.00159
+agga 0.0032 0.0213 0.00207
+aggc 0.00288 0.0125 0.0032
+aggg 0.00391 0.00831 0.00253
+aggt 0.00117 0.00859 0.0013
+agta 0.00079 0.00377 0.000479
+agtc 0.00147 0.00459 0.00156
+agtg 0.00332 0.00386 0.00343
+agtt 0.000617 0.00608 0.00116
+ataa 0.0009 0.00114 3.56e-05
+atac 0.000853 0.000719 0.00147
+atag 0.00101 0.000302 3.56e-05
+atat 0.000663 0.000803 0.000511
+atca 0.00692 0.00146 0.00109
+atcc 0.00658 0.00138 0.0014
+atcg 0.0076 0.0014 0.00144
+atct 0.0038 0.00188 0.00089
+atga 0.00423 0.00437 3.56e-05
+atgc 0.00529 0.00281 0.000764
+atgg 0.0074 0.00263 0.00103
+atgt 0.003 0.00246 0.00073
+atta 0.00124 0.000783 0.000385
+attc 0.00217 0.00115 0.00189
+attg 0.00403 0.000781 0.0012
+attt 0.00111 0.00143 0.00111
+caaa 0.00133 0.00207 0.00363
+caac 0.00169 0.00124 0.0124
+caag 0.00246 0.000994 0.0171
+caat 0.000703 0.00107 0.00216
+caca 0.00576 0.00297 0.00361
+cacc 0.00616 0.00249 0.011
+cacg 0.00698 0.00269 0.0106
+cact 0.00359 0.00249 0.00223
+caga 0.00744 0.00408 0.00154
+cagc 0.0115 0.00344 0.0107
+cagg 0.0101 0.00206 0.00293
+cagt 0.00373 0.00176 0.00188
+cata 0.000473 0.000501 0.00111
+catc 0.00195 0.0016 0.0161
+catg 0.00213 0.000788 0.0112
+catt 0.000937 0.00147 0.00342
+ccaa 0.00124 0.0086 0.00161
+ccac 0.00302 0.00714 0.0083
+ccag 0.00288 0.00363 0.00989
+ccat 0.00119 0.00782 0.00134
+ccca 0.00656 0.00373 0.00303
+cccc 0.00443 0.00427 0.00824
+cccg 0.00819 0.00303 0.00658
+ccct 0.00349 0.00544 0.00225
+ccga 0.0023 0.00948 0.00173
+ccgc 0.00766 0.00857 0.0111
+ccgg 0.00623 0.00615 0.0044
+ccgt 0.00291 0.00753 0.00248
+ccta 0.000502 0.00233 0.00105
+cctc 0.00235 0.00476 0.0119
+cctg 0.00307 0.00289 0.0172
+cctt 0.000849 0.00422 0.00201
+cgaa 0.00105 0.00229 0.00265
+cgac 0.00206 0.00334 0.017
+cgag 0.00346 0.0033 0.0172
+cgat 0.00109 0.0024 0.00378
+cgca 0.00777 0.00716 0.00329
+cgcc 0.00712 0.00664 0.0157
+cgcg 0.00911 0.00624 0.00935
+cgct 0.00551 0.0109 0.00385
+cgga 0.00249 0.00858 0.00347
+cggc 0.00722 0.00983 0.0129
+cggg 0.00477 0.00578 0.00635
+cggt 0.00136 0.00451 0.00265
+cgta 0.000746 0.00217 0.0012
+cgtc 0.00212 0.00364 0.00895
+cgtg 0.00417 0.00407 0.018
+cgtt 0.00092 0.00334 0.002
+ctaa 0.000794 0.0012 3.56e-05
+ctac 0.00178 0.000943 0.0105
+ctag 0.000899 0.000459 3.56e-05
+ctat 0.000401 0.000815 0.00134
+ctca 0.00995 0.00227 0.002
+ctcc 0.00473 0.0025 0.00864
+ctcg 0.00914 0.00225 0.00733
+ctct 0.00598 0.00257 0.00233
+ctga 0.00657 0.00303 3.56e-05
+ctgc 0.0195 0.00374 0.00748
+ctgg 0.0177 0.00313 0.00453
+ctgt 0.0062 0.00272 0.00185
+ctta 0.000694 0.000353 0.000472
+cttc 0.00208 0.00141 0.0131
+cttg 0.00255 0.00102 0.00345
+cttt 0.00101 0.00119 0.00278
+gaaa 0.00232 0.00155 0.00278
+gaac 0.00201 0.00113 0.00699
+gaag 0.00506 0.00114 0.0117
+gaat 0.00144 0.00121 0.00154
+gaca 0.0101 0.00158 0.00215
+gacc 0.00969 0.00148 0.00445
+gacg 0.0145 0.0018 0.00818
+gact 0.00581 0.00163 0.00167
+gaga 0.0124 0.00431 0.00231
+gagc 0.0145 0.00361 0.0083
+gagg 0.0206 0.00334 0.00436
+gagt 0.00689 0.0018 0.00205
+gata 0.00111 0.000635 0.00098
+gatc 0.0024 0.000869 0.0064
+gatg 0.00679 0.000798 0.00691
+gatt 0.00151 0.00129 0.00201
+gcaa 0.00195 0.00725 0.00228
+gcac 0.00385 0.00601 0.00999
+gcag 0.00466 0.00501 0.0181
+gcat 0.00136 0.00633 0.00193
+gcca 0.0105 0.00553 0.00334
+gccc 0.00596 0.00382 0.00955
+gccg 0.0148 0.00573 0.00926
+gcct 0.00519 0.00823 0.00247
+gcga 0.00426 0.0101 0.00293
+gcgc 0.0109 0.00715 0.0133
+gcgg 0.0104 0.00745 0.00825
+gcgt 0.00474 0.00714 0.00352
+gcta 0.00125 0.00268 0.0013
+gctc 0.00361 0.005 0.0133
+gctg 0.00563 0.00421 0.0263
+gctt 0.00128 0.00439 0.00247
+ggaa 0.00204 0.00356 0.00405
+ggac 0.00238 0.0023 0.0146
+ggag 0.00615 0.00287 0.0273
+ggat 0.00138 0.00223 0.0043
+ggca 0.00808 0.00479 0.00432
+ggcc 0.00703 0.00397 0.0133
+ggcg 0.0113 0.00437 0.015
+ggct 0.00544 0.00527 0.00432
+ggga 0.00368 0.00643 0.00423
+gggc 0.00605 0.00452 0.0116
+gggg 0.00663 0.00425 0.00694
+gggt 0.00209 0.00284 0.00284
+ggta 0.000962 0.0012 0.00118
+ggtc 0.00186 0.00162 0.00422
+ggtg 0.00481 0.00193 0.0165
+ggtt 0.00114 0.00178 0.00177
+gtaa 0.000779 0.000833 3.56e-05
+gtac 0.00133 0.00092 0.00756
+gtag 0.00143 0.000611 3.56e-05
+gtat 0.000715 0.000733 0.0012
+gtca 0.00596 0.00159 0.00159
+gtcc 0.00307 0.00127 0.00412
+gtcg 0.00518 0.00133 0.00634
+gtct 0.00281 0.00225 0.00221
+gtga 0.0075 0.00367 3.56e-05
+gtgc 0.0134 0.00327 0.00676
+gtgg 0.0153 0.00449 0.00534
+gtgt 0.0065 0.00287 0.00246
+gtta 0.000621 0.000489 0.000506
+gttc 0.00189 0.00102 0.00796
+gttg 0.00245 0.000668 0.00328
+gttt 0.00117 0.00144 0.00355
+taaa 3.49e-05 0.000952 0.000887
+taac 3.49e-05 0.000567 0.00123
+taag 3.49e-05 0.000405 0.00138
+taat 3.49e-05 0.000666 0.000561
+taca 0.00541 0.00109 0.000753
+tacc 0.00609 0.00111 0.00127
+tacg 0.00568 0.00111 0.000862
+tact 0.00335 0.00104 0.000367
+taga 3.49e-05 0.00125 0.00023
+tagc 3.49e-05 0.000987 0.000748
+tagg 3.49e-05 0.000691 0.000337
+tagt 3.49e-05 0.000796 0.000374
+tata 0.000529 0.00027 0.000388
+tatc 0.00106 0.000535 0.00115
+tatg 0.00192 0.000395 0.00091
+tatt 0.000716 0.00067 0.000527
+tcaa 0.00111 0.00942 0.00127
+tcac 0.00207 0.00694 0.00261
+tcag 0.00169 0.00352 0.00255
+tcat 0.00121 0.00858 0.000821
+tcca 0.00462 0.00482 0.00126
+tccc 0.00332 0.00485 0.00291
+tccg 0.00425 0.00452 0.00186
+tcct 0.00294 0.0075 0.00136
+tcga 0.002 0.0079 0.000873
+tcgc 0.00578 0.00741 0.00313
+tcgg 0.00546 0.00456 0.00148
+tcgt 0.00241 0.00686 0.00098
+tcta 0.000643 0.00349 0.000502
+tctc 0.00303 0.00532 0.00304
+tctg 0.00285 0.00278 0.00443
+tctt 0.000905 0.00516 0.00112
+tgaa 3.49e-05 0.00622 0.00238
+tgac 3.49e-05 0.00472 0.00551
+tgag 3.49e-05 0.00435 0.00563
+tgat 3.49e-05 0.00429 0.00212
+tgca 0.00427 0.00948 0.00248
+tgcc 0.00557 0.00742 0.00513
+tgcg 0.00606 0.00884 0.0036
+tgct 0.00324 0.0143 0.0023
+tgga 0.0027 0.0161 0.00286
+tggc 0.00335 0.011 0.00523
+tggg 0.00412 0.00788 0.00331
+tggt 0.00171 0.0084 0.0023
+tgta 0.000774 0.0022 0.00102
+tgtc 0.00167 0.00493 0.00304
+tgtg 0.00332 0.00517 0.006
+tgtt 0.000809 0.00467 0.00153
+ttaa 0.000493 0.00125 3.56e-05
+ttac 0.000443 0.000698 0.00162
+ttag 0.000443 0.000314 3.56e-05
+ttat 0.00042 0.000925 0.000543
+ttca 0.00635 0.00168 0.000816
+ttcc 0.00777 0.00197 0.00153
+ttcg 0.00535 0.00126 0.00112
+ttct 0.00453 0.00191 0.000832
+ttga 0.00151 0.00394 3.56e-05
+ttgc 0.0026 0.00311 0.00136
+ttgg 0.00363 0.00289 0.00116
+ttgt 0.00154 0.00311 0.00109
+ttta 0.000753 0.000714 0.00052
+tttc 0.00136 0.000955 0.00191
+tttg 0.00518 0.00104 0.00163
+tttt 0.000978 0.00128 0.000996
+# l=
+4
+# Values
+aaaaa 0.00019 0.000619 0.000451
+aaaac 0.000396 0.000349 0.000597
+aaaag 0.00037 0.000284 0.000595
+aaaat 0.00018 0.000473 0.000205
+aaaca 0.000608 0.000499 0.00021
+aaacc 0.000434 0.000526 0.000403
+aaacg 0.00053 0.000468 0.00034
+aaact 0.00042 0.00066 0.000173
+aaaga 0.000542 0.00111 0.000192
+aaagc 0.000685 0.000687 0.000346
+aaagg 0.000664 0.000576 0.000198
+aaagt 0.000338 0.000567 0.000196
+aaata 0.000156 0.000325 0.000235
+aaatc 0.000317 0.000405 0.000622
+aaatg 0.000593 0.000193 0.00062
+aaatt 0.000157 0.000316 0.000208
+aacaa 0.000338 0.00214 0.000415
+aacac 0.000561 0.00142 0.000495
+aacag 0.000645 0.000815 0.000645
+aacat 0.000219 0.00187 0.000118
+aacca 0.000465 0.00114 0.000248
+aaccc 0.000284 0.00141 0.000379
+aaccg 0.000242 0.00118 0.00047
+aacct 0.000202 0.00222 0.000276
+aacga 0.000232 0.00198 0.000205
+aacgc 0.000356 0.00148 0.000477
+aacgg 0.000425 0.00115 0.000367
+aacgt 0.000239 0.0015 0.000196
+aacta 0.00017 0.000639 0.000137
+aactc 0.000366 0.000875 0.000631
+aactg 0.000461 0.000651 0.000661
+aactt 0.000197 0.00117 0.00028
+aagaa 0.000275 0.00356 0.000659
+aagac 0.000306 0.00138 0.00126
+aagag 0.000449 0.00138 0.00168
+aagat 0.000114 0.00207 0.000689
+aagca 0.000349 0.0024 0.000388
+aagcc 0.000347 0.0015 0.000944
+aagcg 0.000286 0.00166 0.000812
+aagct 0.000256 0.00256 0.000387
+aagga 0.000574 0.00412 0.000415
+aaggc 0.000551 0.00255 0.000741
+aaggg 0.000701 0.00168 0.000638
+aaggt 0.000207 0.00193 0.000372
+aagta 0.000156 0.00088 6.06e-05
+aagtc 0.000278 0.0011 0.000347
+aagtg 0.000631 0.000762 0.00109
+aagtt 0.000121 0.00144 0.000337
+aataa 0.000197 0.000235 8.91e-06
+aatac 0.000174 0.000159 0.000367
+aatag 0.000216 7.73e-05 8.91e-06
+aatat 0.000136 0.000162 0.000128
+aatca 0.000495 0.000369 0.000216
+aatcc 0.000532 0.000258 0.000328
+aatcg 0.000481 0.000243 0.000362
+aatct 0.000277 0.000376 0.000216
+aatga 0.000408 0.000806 8.91e-06
+aatgc 0.00038 0.000596 0.000191
+aatgg 0.000467 0.000366 0.000258
+aatgt 0.000223 0.000545 0.000183
+aatta 0.000238 0.000159 6.95e-05
+aattc 0.00041 0.000246 0.000429
+aattg 0.000761 0.000164 0.000244
+aattt 0.000219 0.000316 0.000239
+acaaa 0.000225 0.000554 0.00112
+acaac 0.000438 0.000301 0.00308
+acaag 0.000312 0.000222 0.00429
+acaat 0.000108 0.000239 0.000656
+acaca 0.000675 0.000757 0.000946
+acacc 0.000408 0.00049 0.00193
+acacg 0.000664 0.000494 0.00321
+acact 0.000354 0.000468 0.000488
+acaga 0.000952 0.000885 0.00052
+acagc 0.000974 0.000724 0.00275
+acagg 0.000816 0.000463 0.000711
+acagt 0.000221 0.000444 0.000417
+acata 0.000102 0.000125 0.00034
+acatc 0.000418 0.000314 0.00407
+acatg 0.000446 0.000166 0.00265
+acatt 0.000204 0.000284 0.00111
+accaa 0.000204 0.002 0.000445
+accac 0.000316 0.0018 0.00258
+accag 0.00026 0.00067 0.00308
+accat 0.000153 0.00165 0.000312
+accca 0.000635 0.000733 0.00106
+acccc 0.000539 0.000771 0.00249
+acccg 0.000727 0.000398 0.00249
+accct 0.000481 0.00115 0.000563
+accga 0.000204 0.00155 0.000451
+accgc 0.000652 0.0013 0.00356
+accgg 0.000575 0.000798 0.00121
+accgt 0.000317 0.00139 0.000636
+accta 0.000143 0.000516 0.000328
+acctc 0.000272 0.00081 0.00341
+acctg 0.000357 0.000509 0.00573
+acctt 0.00011 0.000984 0.000526
+acgaa 0.000214 0.000776 0.000884
+acgac 0.000424 0.000813 0.00492
+acgag 0.000682 0.000697 0.0049
+acgat 0.000231 0.0006 0.00136
+acgca 0.000732 0.00175 0.00103
+acgcc 0.000579 0.00122 0.00346
+acgcg 0.000744 0.0016 0.00287
+acgct 0.000408 0.00241 0.000827
+acgga 0.000329 0.00234 0.000885
+acggc 0.000863 0.00182 0.00298
+acggg 0.000579 0.00159 0.0019
+acggt 0.000113 0.00125 0.000629
+acgta 0.000119 0.000545 0.000322
+acgtc 0.000289 0.000844 0.00202
+acgtg 0.000601 0.00111 0.00487
+acgtt 0.000131 0.000795 0.000515
+actaa 0.000169 0.000238 8.91e-06
+actac 0.00036 0.000214 0.00269
+actag 0.000182 0.000108 8.91e-06
+actat 8.28e-05 0.00017 0.000396
+actca 0.000887 0.000318 0.000424
+actcc 0.000326 0.000337 0.00143
+actcg 0.000718 0.00041 0.00215
+actct 0.000418 0.000388 0.000536
+actga 0.000467 0.000466 8.91e-06
+actgc 0.000999 0.000528 0.00201
+actgg 0.001 0.000366 0.0012
+actgt 0.000323 0.000454 0.000367
+actta 0.000113 8.42e-05 0.000102
+acttc 0.000282 0.000328 0.00334
+acttg 0.000316 0.000224 0.000957
+acttt 0.000152 0.000268 0.00102
+agaaa 0.000411 0.00033 0.00121
+agaac 0.000375 0.000203 0.00271
+agaag 0.000791 0.000321 0.00589
+agaat 0.00023 0.00022 0.000647
+agaca 0.00101 0.000306 0.000739
+agacc 0.000797 0.000313 0.00145
+agacg 0.0013 0.000391 0.00288
+agact 0.000596 0.000161 0.000533
+agaga 0.0015 0.00066 0.000862
+agagc 0.00124 0.000436 0.00283
+agagg 0.00212 0.0004 0.0017
+agagt 0.000652 0.000248 0.0006
+agata 0.000239 0.000119 0.00031
+agatc 0.000417 0.000164 0.00298
+agatg 0.000976 0.000152 0.00288
+agatt 0.000223 0.000244 0.000855
+agcaa 0.000338 0.0017 0.000647
+agcac 0.000537 0.00114 0.00267
+agcag 0.000872 0.00136 0.00606
+agcat 0.000241 0.00138 0.000595
+agcca 0.00114 0.00117 0.000896
+agccc 0.000635 0.000868 0.00218
+agccg 0.00106 0.00105 0.00214
+agcct 0.000455 0.00173 0.000654
+agcga 0.0006 0.00243 0.00104
+agcgc 0.000933 0.00137 0.00345
+agcgg 0.00104 0.00149 0.00248
+agcgt 0.000394 0.00151 0.000739
+agcta 0.000263 0.000431 0.000358
+agctc 0.000443 0.000933 0.00325
+agctg 0.000683 0.000757 0.0073
+agctt 0.000169 0.000786 0.000834
+aggaa 0.000336 0.000762 0.00148
+aggac 0.000316 0.000463 0.00447
+aggag 0.00094 0.000499 0.0102
+aggat 9.76e-05 0.000547 0.00157
+aggca 0.000767 0.00061 0.00125
+aggcc 0.000624 0.000489 0.00389
+aggcg 0.000917 0.000436 0.00406
+aggct 0.000342 0.000634 0.00121
+aggga 0.000561 0.00104 0.000923
+agggc 0.000547 0.000757 0.00337
+agggg 0.000852 0.00055 0.00186
+agggt 0.00022 0.000398 0.000795
+aggta 0.000141 0.00027 0.000413
+aggtc 0.000225 0.00036 0.00133
+aggtg 0.000608 0.000425 0.00471
+aggtt 0.000139 0.000412 0.000743
+agtaa 0.000171 0.000217 8.91e-06
+agtac 0.000292 0.000202 0.00272
+agtag 0.000317 0.000136 8.91e-06
+agtat 0.000155 0.00018 0.000406
+agtca 0.000382 0.000279 0.000436
+agtcc 0.000328 0.000248 0.000999
+agtcg 0.000336 0.000255 0.00183
+agtct 0.000207 0.000309 0.000567
+agtga 0.000823 0.000803 8.91e-06
+agtgc 0.000708 0.000586 0.00158
+agtgg 0.00104 0.000728 0.00119
+agtgt 0.000394 0.000362 0.000436
+agtta 6.97e-05 0.000109 0.000132
+agttc 0.000286 0.000232 0.00286
+agttg 0.000493 0.000154 0.000973
+agttt 0.00015 0.000307 0.00113
+ataaa 8.72e-06 0.000238 0.000265
+ataac 8.72e-06 0.000142 0.000287
+ataag 8.72e-06 0.000101 0.000265
+ataat 8.72e-06 0.000167 0.000151
+ataca 0.000384 0.00024 0.000184
+atacc 0.000373 0.000227 0.000277
+atacg 0.000373 0.000219 0.000228
+atact 0.000302 0.00022 9.75e-05
+ataga 8.72e-06 0.000388 5.75e-05
+atagc 8.72e-06 0.000176 0.000187
+atagg 8.72e-06 9.91e-05 8.42e-05
+atagt 8.72e-06 0.000196 9.35e-05
+atata 0.000112 6.75e-05 9.71e-05
+atatc 0.000218 0.000134 0.000287
+atatg 0.000389 9.87e-05 0.000228
+atatt 0.000162 0.000167 0.000132
+atcaa 0.000234 0.00229 0.000278
+atcac 0.000424 0.00155 0.000517
+atcag 0.000365 0.000858 0.000547
+atcat 0.000261 0.00204 0.000171
+atcca 0.000378 0.00147 0.000317
+atccc 0.000335 0.00124 0.000538
+atccg 0.000207 0.00143 0.000294
+atcct 0.000277 0.00228 0.000294
+atcga 0.000261 0.00255 0.000189
+atcgc 0.000377 0.002 0.000636
+atcgg 0.000343 0.00116 0.000365
+atcgt 0.000167 0.00177 0.000262
+atcta 0.000141 0.000764 0.000105
+atctc 0.000595 0.00102 0.000681
+atctg 0.000567 0.00067 0.00102
+atctt 0.000187 0.00127 0.000198
+atgaa 8.72e-06 0.00145 0.000779
+atgac 8.72e-06 0.00088 0.00165
+atgag 8.72e-06 0.000709 0.0015
+atgat 8.72e-06 0.00106 0.000656
+atgca 0.000898 0.00132 0.000526
+atgcc 0.00117 0.000757 0.00124
+atgcg 0.00124 0.00115 0.000736
+atgct 0.000668 0.00201 0.000454
+atgga 0.000343 0.00291 0.000526
+atggc 0.000227 0.00191 0.00123
+atggg 0.000329 0.00115 0.000686
+atggt 0.000113 0.00134 0.00029
+atgta 0.000178 0.000393 0.000192
+atgtc 0.000364 0.000713 0.000663
+atgtg 0.000736 0.000769 0.00134
+atgtt 0.000183 0.00107 0.000383
+attaa 0.000123 0.000408 8.91e-06
+attac 0.000111 0.000159 0.000404
+attag 0.000111 6.15e-05 8.91e-06
+attat 0.000105 0.000316 0.000136
+attca 0.000471 0.000413 0.000128
+attcc 0.000492 0.000496 0.00042
+attcg 0.000279 0.000352 0.000253
+attct 0.000404 0.000331 0.000212
+attga 0.000164 0.000993 8.91e-06
+attgc 0.000275 0.000699 0.000301
+attgg 0.000446 0.000654 0.000288
+attgt 0.000211 0.000642 0.000235
+attta 0.000117 0.000183 0.000103
+atttc 0.00022 0.000205 0.00046
+atttg 0.000593 0.00022 0.000431
+atttt 0.000136 0.000256 0.000319
+caaaa 0.00068 0.000386 0.000362
+caaac 0.000922 0.000244 0.000654
+caaag 0.0014 0.000232 0.000889
+caaat 0.000506 0.000425 0.000242
+caaca 0.00368 0.00056 0.000235
+caacc 0.00313 0.000386 0.000451
+caacg 0.00346 0.000331 0.000401
+caact 0.00176 0.00035 0.000192
+caaga 0.00436 0.000851 0.0002
+caagc 0.00425 0.000572 0.000424
+caagg 0.00558 0.000519 0.000203
+caagt 0.00237 0.000465 0.000216
+caata 0.000235 0.000181 0.000146
+caatc 0.000514 0.00027 0.000431
+caatg 0.00114 0.000163 0.000365
+caatt 0.000211 0.000234 0.00018
+cacaa 0.000755 0.00196 0.000422
+cacac 0.0011 0.00131 0.000866
+cacag 0.0012 0.000899 0.00156
+cacat 0.000425 0.00146 0.000244
+cacca 0.00417 0.00157 0.000424
+caccc 0.0014 0.00128 0.00101
+caccg 0.00338 0.0013 0.000828
+cacct 0.00176 0.00195 0.000322
+cacga 0.00133 0.00185 0.000335
+cacgc 0.00362 0.00178 0.00107
+cacgg 0.0036 0.00145 0.000855
+cacgt 0.00181 0.00181 0.000497
+cacta 0.00037 0.000709 0.00018
+cactc 0.000633 0.000943 0.000841
+cactg 0.000793 0.000839 0.0012
+cactt 0.000356 0.00105 0.000322
+cagaa 0.00031 0.00254 0.000536
+cagac 0.000373 0.00129 0.00108
+cagag 0.000607 0.00153 0.00199
+cagat 0.000185 0.00195 0.000581
+cagca 0.00344 0.00383 0.00096
+cagcc 0.00211 0.00181 0.00116
+cagcg 0.00349 0.00228 0.000907
+cagct 0.0014 0.00344 0.000561
+cagga 0.000887 0.00365 0.000493
+caggc 0.000676 0.00287 0.000855
+caggg 0.00102 0.00174 0.000518
+caggt 0.000281 0.00164 0.00029
+cagta 0.000237 0.000726 0.000182
+cagtc 0.000458 0.000858 0.000518
+cagtg 0.000962 0.000839 0.000864
+cagtt 0.000173 0.0012 0.000262
+cataa 0.000244 0.000235 8.91e-06
+catac 0.000258 0.000159 0.000367
+catag 0.000316 7.73e-05 8.91e-06
+catat 0.000232 0.000162 0.000128
+catca 0.00477 0.000395 0.00042
+catcc 0.00372 0.000285 0.000461
+catcg 0.00472 0.000403 0.000493
+catct 0.00248 0.000559 0.000301
+catga 0.00209 0.000494 8.91e-06
+catgc 0.00291 0.000415 0.000191
+catgg 0.00419 0.000407 0.000258
+catgt 0.00169 0.000437 0.000183
+catta 0.000495 0.000159 0.000143
+cattc 0.000821 0.000246 0.000609
+cattg 0.00165 0.000164 0.000465
+cattt 0.000373 0.000316 0.000319
+ccaaa 0.00039 0.000465 0.000793
+ccaac 0.000415 0.000304 0.00323
+ccaag 0.000596 0.000222 0.00445
+ccaat 0.000174 0.000255 0.000467
+ccaca 0.00195 0.000651 0.000882
+ccacc 0.00245 0.00106 0.0035
+ccacg 0.00229 0.000719 0.0025
+ccact 0.00143 0.000566 0.000563
+ccaga 0.00217 0.00108 0.000205
+ccagc 0.0031 0.000806 0.00245
+ccagg 0.00329 0.000475 0.000743
+ccagt 0.0011 0.000475 0.000383
+ccata 0.000124 0.000162 0.000283
+ccatc 0.000397 0.000366 0.00411
+ccatg 0.000589 0.000234 0.00303
+ccatt 0.000185 0.000395 0.000714
+cccaa 0.000343 0.00208 0.000333
+cccac 0.00107 0.00175 0.00132
+cccag 0.00111 0.0011 0.00192
+cccat 0.000389 0.00145 0.000289
+cccca 0.00239 0.000854 0.000531
+ccccc 0.00148 0.00144 0.00185
+ccccg 0.00324 0.00089 0.00157
+cccct 0.00098 0.00112 0.000506
+cccga 0.000908 0.00257 0.00033
+cccgc 0.00241 0.00196 0.00135
+cccgg 0.0022 0.00169 0.000914
+cccgt 0.00091 0.0018 0.000563
+cccta 0.000119 0.00046 0.0002
+ccctc 0.000837 0.00111 0.00212
+ccctg 0.000971 0.000892 0.00291
+ccctt 0.000253 0.00096 0.000431
+ccgaa 0.000343 0.000393 0.000517
+ccgac 0.000382 0.000706 0.00428
+ccgag 0.00072 0.000661 0.00424
+ccgat 0.000237 0.000513 0.000887
+ccgca 0.00299 0.00155 0.00082
+ccgcc 0.00275 0.00219 0.00457
+ccgcg 0.00335 0.00135 0.00247
+ccgct 0.00182 0.00241 0.00107
+ccgga 0.000582 0.00177 0.000846
+ccggc 0.00213 0.00219 0.00313
+ccggg 0.0013 0.0013 0.00181
+ccggt 0.000324 0.000824 0.000652
+ccgta 0.000242 0.000531 0.000317
+ccgtc 0.000521 0.000738 0.00233
+ccgtg 0.00136 0.000863 0.00467
+ccgtt 0.000288 0.00076 0.00049
+cctaa 0.000174 0.000238 8.91e-06
+cctac 0.000533 0.000214 0.0021
+cctag 0.000241 0.000108 8.91e-06
+cctat 6.62e-05 0.00017 0.000269
+cctca 0.00368 0.000441 0.000467
+cctcc 0.0021 0.000795 0.00242
+cctcg 0.00329 0.000417 0.00145
+cctct 0.00243 0.000629 0.000618
+cctga 0.00213 0.000718 8.91e-06
+cctgc 0.00638 0.000854 0.00159
+cctgg 0.00648 0.000844 0.0011
+cctgt 0.00183 0.000601 0.00031
+cctta 0.000209 8.42e-05 0.00013
+ccttc 0.000608 0.000328 0.00291
+ccttg 0.000786 0.000224 0.000871
+ccttt 0.000352 0.000268 0.000481
+cgaaa 0.000441 0.000296 0.000276
+cgaac 0.000586 0.000225 0.000905
+cgaag 0.00122 0.000214 0.000975
+cgaat 0.00038 0.000245 0.000224
+cgaca 0.0039 0.00042 0.000433
+cgacc 0.00417 0.000297 0.00104
+cgacg 0.00606 0.000465 0.00168
+cgact 0.00263 0.000478 0.000294
+cgaga 0.0034 0.000878 0.000392
+cgagc 0.0045 0.00088 0.00187
+cgagg 0.00634 0.000494 0.000736
+cgagt 0.00252 0.000446 0.000456
+cgata 0.000249 0.00012 0.000212
+cgatc 0.00071 0.000183 0.00093
+cgatg 0.00209 0.000232 0.00102
+cgatt 0.00061 0.00035 0.000322
+cgcaa 0.000563 0.00237 0.000549
+cgcac 0.00129 0.00199 0.00288
+cgcag 0.00109 0.00134 0.00371
+cgcat 0.000244 0.00193 0.000363
+cgcca 0.00442 0.00191 0.000873
+cgccc 0.00222 0.00103 0.00254
+cgccg 0.00654 0.00186 0.00293
+cgcct 0.00208 0.0022 0.000595
+cgcga 0.00102 0.0031 0.000679
+cgcgc 0.00337 0.00229 0.00299
+cgcgg 0.00297 0.00156 0.00203
+cgcgt 0.00179 0.00208 0.000798
+cgcta 0.000417 0.000906 0.000387
+cgctc 0.00126 0.00156 0.0036
+cgctg 0.00162 0.00142 0.00678
+cgctt 0.000446 0.00152 0.000556
+cggaa 0.000452 0.000764 0.000681
+cggac 0.000729 0.000454 0.00278
+cggag 0.00182 0.000789 0.00478
+cggat 0.000377 0.000425 0.000714
+cggca 0.00301 0.00189 0.000939
+cggcc 0.00249 0.00145 0.00351
+cggcg 0.00494 0.0018 0.00473
+cggct 0.00219 0.00192 0.0011
+cggga 0.000964 0.00185 0.00104
+cgggc 0.00219 0.00114 0.00256
+cgggg 0.00241 0.00112 0.00195
+cgggt 0.000685 0.000658 0.000502
+cggta 0.000268 0.000154 0.000159
+cggtc 0.000488 0.000396 0.000873
+cggtg 0.00149 0.00046 0.00348
+cggtt 0.000368 0.000316 0.000251
+cgtaa 0.000171 0.000217 8.91e-06
+cgtac 0.000418 0.000202 0.00193
+cgtag 0.000422 0.000136 8.91e-06
+cgtat 0.000157 0.00018 0.000298
+cgtca 0.00312 0.000521 0.000401
+cgtcc 0.00131 0.000366 0.00108
+cgtcg 0.00294 0.000381 0.00178
+cgtct 0.00136 0.000827 0.000549
+cgtga 0.00265 0.000964 8.91e-06
+cgtgc 0.00568 0.00109 0.0018
+cgtgg 0.00625 0.00123 0.00168
+cgtgt 0.00296 0.000832 0.000759
+cgtta 0.000194 9.23e-05 0.000105
+cgttc 0.000704 0.000277 0.00192
+cgttg 0.000647 0.000167 0.000734
+cgttt 0.00038 0.00035 0.000766
+ctaaa 8.72e-06 0.000238 0.000182
+ctaac 8.72e-06 0.000142 0.000226
+ctaag 8.72e-06 0.000101 0.000497
+ctaat 8.72e-06 0.000167 8.37e-05
+ctaca 0.00279 0.000333 0.000201
+ctacc 0.0029 0.000379 0.000438
+ctacg 0.00276 0.000311 0.000176
+ctact 0.00177 0.000383 7.48e-05
+ctaga 8.72e-06 0.000267 5.75e-05
+ctagc 8.72e-06 0.000222 0.000187
+ctagg 8.72e-06 0.000164 8.42e-05
+ctagt 8.72e-06 0.000159 9.35e-05
+ctata 0.000192 6.75e-05 9.71e-05
+ctatc 0.000356 0.000134 0.000287
+ctatg 0.000563 9.87e-05 0.000228
+ctatt 0.000181 0.000167 0.000132
+ctcaa 0.000377 0.00354 0.000396
+ctcac 0.000605 0.00232 0.000793
+ctcag 0.000549 0.000994 0.000918
+ctcat 0.00042 0.00281 0.000246
+ctcca 0.00266 0.000993 0.000392
+ctccc 0.00167 0.00108 0.00105
+ctccg 0.00225 0.000854 0.000761
+ctcct 0.00182 0.00171 0.000408
+ctcga 0.000645 0.00231 0.000278
+ctcgc 0.00268 0.00279 0.00122
+ctcgg 0.00276 0.00142 0.000474
+ctcgt 0.00109 0.00239 0.000371
+ctcta 0.00022 0.0012 0.000153
+ctctc 0.000938 0.00187 0.000793
+ctctg 0.000819 0.000748 0.00144
+ctctt 0.000309 0.00201 0.000333
+ctgaa 8.72e-06 0.00206 0.00041
+ctgac 8.72e-06 0.00158 0.00108
+ctgag 8.72e-06 0.00157 0.00112
+ctgat 8.72e-06 0.00136 0.000524
+ctgca 0.00171 0.00472 0.000706
+ctgcc 0.00242 0.00342 0.00142
+ctgcg 0.00189 0.00401 0.00098
+ctgct 0.00131 0.00704 0.000793
+ctgga 0.000819 0.00642 0.000681
+ctggc 0.00113 0.00425 0.00119
+ctggg 0.00184 0.00366 0.000907
+ctggt 0.000643 0.00309 0.000474
+ctgta 0.000197 0.000812 0.000251
+ctgtc 0.000483 0.00198 0.000677
+ctgtg 0.000964 0.00185 0.00153
+ctgtt 0.000174 0.00145 0.000397
+cttaa 0.000123 0.000281 8.91e-06
+cttac 0.000111 0.00018 0.000404
+cttag 0.000111 8.42e-05 8.91e-06
+cttat 0.000105 0.000203 0.000136
+cttca 0.0035 0.000526 0.000281
+cttcc 0.00404 0.000642 0.000476
+cttcg 0.00264 0.000296 0.000397
+cttct 0.00246 0.000584 0.000205
+cttga 0.00057 0.000704 8.91e-06
+cttgc 0.00101 0.00063 0.000346
+cttgg 0.00124 0.000516 0.000324
+cttgt 0.000513 0.000649 0.000249
+cttta 0.000267 0.000145 0.000135
+ctttc 0.000417 0.000265 0.000408
+ctttg 0.00177 0.000231 0.000422
+ctttt 0.00026 0.000359 0.000135
+gaaaa 0.000662 0.000735 0.000192
+gaaac 0.000636 0.000468 0.00046
+gaaag 0.000992 0.000355 0.000417
+gaaat 0.000413 0.000711 0.000159
+gaaca 0.00181 0.000557 0.000205
+gaacc 0.0021 0.000398 0.000262
+gaacg 0.0019 0.000402 0.000303
+gaact 0.00106 0.00061 0.000159
+gaaga 0.0032 0.00213 0.000203
+gaagc 0.00309 0.00116 0.000321
+gaagg 0.00384 0.000986 0.000249
+gaagt 0.00129 0.000723 0.00011
+gaata 0.000207 0.000268 9.62e-05
+gaatc 0.000488 0.000376 0.000469
+gaatg 0.000636 0.000321 0.000281
+gaatt 0.000195 0.000465 0.000176
+gacaa 0.0003 0.00272 0.000146
+gacac 0.000711 0.00248 0.000534
+gacag 0.000833 0.00168 0.000456
+gacat 0.000244 0.00303 0.000192
+gacca 0.00118 0.00189 0.000164
+gaccc 0.00116 0.00245 0.000595
+gaccg 0.00132 0.00177 0.000306
+gacct 0.00071 0.00342 0.000167
+gacga 0.00128 0.00565 0.000235
+gacgc 0.00287 0.00346 0.000611
+gacgg 0.00276 0.00237 0.000436
+gacgt 0.00112 0.00278 0.000246
+gacta 0.000166 0.000882 5.88e-05
+gactc 0.000521 0.00168 0.000618
+gactg 0.00065 0.0012 0.000538
+gactt 0.000268 0.00195 0.000159
+gagaa 0.000561 0.00395 0.000424
+gagac 0.000622 0.0027 0.00118
+gagag 0.000858 0.00282 0.00145
+gagat 0.000173 0.00274 0.000526
+gagca 0.00179 0.00332 0.000504
+gagcc 0.00221 0.0023 0.000966
+gagcg 0.00288 0.00346 0.00101
+gagct 0.00122 0.00525 0.000513
+gagga 0.00117 0.00927 0.000723
+gaggc 0.00111 0.00458 0.000921
+gaggg 0.00149 0.00322 0.000816
+gaggt 0.000472 0.0033 0.000351
+gagta 0.000241 0.00141 0.000128
+gagtc 0.000452 0.00171 0.000362
+gagtg 0.00109 0.00148 0.000711
+gagtt 0.000202 0.00222 0.000308
+gataa 0.000263 0.000437 8.91e-06
+gatac 0.000248 0.000241 0.000367
+gatag 0.000265 7.01e-05 8.91e-06
+gatat 0.000159 0.000316 0.000128
+gatca 0.00136 0.000494 0.000226
+gatcc 0.00201 0.000658 0.000306
+gatcg 0.00214 0.000576 0.00029
+gatct 0.000833 0.000641 0.000187
+gatga 0.00154 0.00263 8.91e-06
+gatgc 0.00181 0.00143 0.000191
+gatgg 0.00251 0.00139 0.000258
+gatgt 0.00084 0.00124 0.000183
+gatta 0.000267 0.000306 8.37e-05
+gattc 0.000526 0.00041 0.000424
+gattg 0.000856 0.000289 0.000212
+gattt 0.000298 0.00048 0.000296
+gcaaa 0.000448 0.00061 0.000887
+gcaac 0.000567 0.000475 0.00241
+gcaag 0.00104 0.000412 0.00378
+gcaat 0.000239 0.000405 0.000442
+gcaca 0.00239 0.00117 0.000884
+gcacc 0.00271 0.000603 0.00236
+gcacg 0.00328 0.00108 0.00257
+gcact 0.00131 0.000933 0.000451
+gcaga 0.0037 0.00163 0.000465
+gcagc 0.0065 0.00144 0.00329
+gcagg 0.00546 0.000868 0.000839
+gcagt 0.00204 0.000649 0.000636
+gcata 0.000145 0.000144 0.000171
+gcatc 0.000718 0.000485 0.00306
+gcatg 0.000648 0.000272 0.00265
+gcatt 0.000345 0.000422 0.000668
+gccaa 0.00053 0.00287 0.00041
+gccac 0.00128 0.00264 0.00255
+gccag 0.001 0.00127 0.00247
+gccat 0.000441 0.00342 0.000372
+gccca 0.0028 0.00131 0.00062
+gcccc 0.00184 0.0013 0.00177
+gcccg 0.00324 0.00119 0.0011
+gccct 0.00145 0.00208 0.000501
+gccga 0.000954 0.00418 0.000543
+gccgc 0.0038 0.0043 0.00366
+gccgg 0.00299 0.0029 0.00121
+gccgt 0.00138 0.00316 0.000613
+gccta 0.000131 0.000928 0.000278
+gcctc 0.000852 0.00171 0.00361
+gcctg 0.00112 0.0011 0.00427
+gcctt 0.00031 0.00136 0.000467
+gcgaa 0.000281 0.00067 0.000761
+gcgac 0.000828 0.00123 0.0041
+gcgag 0.00138 0.0014 0.00484
+gcgat 0.000387 0.000888 0.000786
+gcgca 0.00334 0.00244 0.000682
+gcgcc 0.00301 0.00194 0.0039
+gcgcg 0.00411 0.00228 0.00207
+gcgct 0.0026 0.00409 0.000775
+gcgga 0.00138 0.00263 0.00114
+gcggc 0.00365 0.00416 0.0042
+gcggg 0.00239 0.00179 0.00153
+gcggt 0.000748 0.00167 0.000923
+gcgta 0.000282 0.000743 0.000303
+gcgtc 0.000962 0.0013 0.00228
+gcgtg 0.0018 0.0014 0.00437
+gcgtt 0.00039 0.0012 0.000497
+gctaa 0.000282 0.000485 8.91e-06
+gctac 0.000528 0.000302 0.00251
+gctag 0.000295 0.000133 8.91e-06
+gctat 0.000169 0.000306 0.000271
+gctca 0.00445 0.000981 0.00042
+gctcc 0.0017 0.00073 0.00222
+gctcg 0.00448 0.000988 0.0021
+gctct 0.00234 0.000824 0.00049
+gctga 0.00324 0.00135 8.91e-06
+gctgc 0.0104 0.00173 0.00234
+gctgg 0.00879 0.00134 0.00139
+gctgt 0.00352 0.00113 0.000682
+gctta 0.000288 0.000101 0.000119
+gcttc 0.000769 0.000425 0.003
+gcttg 0.00106 0.00035 0.000791
+gcttt 0.000307 0.00039 0.000663
+ggaaa 0.000886 0.000625 0.000527
+ggaac 0.000683 0.000475 0.00112
+ggaag 0.00194 0.000388 0.00179
+ggaat 0.000518 0.000497 0.000306
+ggaca 0.00362 0.000537 0.000369
+ggacc 0.00342 0.000571 0.000684
+ggacg 0.00536 0.000586 0.00114
+ggact 0.00187 0.000665 0.00023
+ggaga 0.00609 0.00191 0.000549
+ggagc 0.00739 0.00157 0.00124
+ggagg 0.0102 0.00177 0.000868
+ggagt 0.003 0.000745 0.000346
+ggata 0.000384 0.000277 0.000208
+ggatc 0.000983 0.000359 0.000951
+ggatg 0.00246 0.000261 0.000882
+ggatt 0.000429 0.000454 0.000269
+ggcaa 0.000664 0.00218 0.000497
+ggcac 0.0013 0.002 0.00141
+ggcag 0.00172 0.00157 0.00284
+ggcat 0.000504 0.00212 0.000239
+ggcca 0.00341 0.00151 0.000568
+ggccc 0.00217 0.00104 0.00162
+ggccg 0.00533 0.0018 0.00138
+ggcct 0.00204 0.00257 0.000552
+ggcga 0.00203 0.00311 0.000486
+ggcgc 0.00548 0.00246 0.00226
+ggcgg 0.00521 0.00321 0.00123
+ggcgt 0.00197 0.00232 0.000618
+ggcta 0.000343 0.000888 0.000248
+ggctc 0.00136 0.00179 0.00182
+ggctg 0.00204 0.00131 0.00302
+ggctt 0.000455 0.00135 0.000394
+gggaa 0.000807 0.00126 0.00059
+gggac 0.000825 0.000791 0.00217
+gggag 0.00192 0.000796 0.00336
+gggat 0.000526 0.000781 0.000584
+gggca 0.00283 0.00152 0.000836
+gggcc 0.00285 0.00147 0.00168
+gggcg 0.00385 0.00138 0.00156
+gggct 0.00192 0.00157 0.000625
+gggga 0.00142 0.00216 0.00104
+ggggc 0.00244 0.00164 0.00168
+ggggg 0.00223 0.00165 0.00119
+ggggt 0.000683 0.00104 0.000536
+gggta 0.000359 0.000478 0.000228
+gggtc 0.000751 0.000432 0.000841
+gggtg 0.00133 0.000545 0.00166
+gggtt 0.00035 0.000574 0.000208
+ggtaa 0.000173 0.000183 8.91e-06
+ggtac 0.000404 0.000313 0.000967
+ggtag 0.000425 0.000203 8.91e-06
+ggtat 0.000143 0.000193 0.00013
+ggtca 0.00148 0.000466 0.000207
+ggtcc 0.000901 0.000402 0.00036
+ggtcg 0.00114 0.000475 0.000665
+ggtct 0.000586 0.000489 0.000278
+ggtga 0.00303 0.00127 8.91e-06
+ggtgc 0.00522 0.000894 0.000625
+ggtgg 0.00602 0.0018 0.000725
+ggtgt 0.002 0.000789 0.00041
+ggtta 0.000171 0.000178 7.3e-05
+ggttc 0.000586 0.00028 0.000793
+ggttg 0.000608 0.000193 0.000467
+ggttt 0.000357 0.00048 0.000394
+gtaaa 8.72e-06 0.000238 0.000191
+gtaac 8.72e-06 0.000142 0.000315
+gtaag 8.72e-06 0.000101 0.00028
+gtaat 8.72e-06 0.000167 0.000144
+gtaca 0.00188 0.000275 0.000184
+gtacc 0.00229 0.000275 0.000277
+gtacg 0.00221 0.000364 0.000228
+gtact 0.000964 0.000215 9.75e-05
+gtaga 8.72e-06 0.000328 5.75e-05
+gtagc 8.72e-06 0.000367 0.000187
+gtagg 8.72e-06 0.000263 8.42e-05
+gtagt 8.72e-06 0.000282 9.35e-05
+gtata 0.000113 6.75e-05 9.71e-05
+gtatc 0.000265 0.000134 0.000287
+gtatg 0.000582 9.87e-05 0.000228
+gtatt 0.000211 0.000167 0.000132
+gtcaa 0.000267 0.00178 0.000285
+gtcac 0.000619 0.00155 0.000714
+gtcag 0.000413 0.000716 0.000449
+gtcat 0.000263 0.00181 0.000212
+gtcca 0.00117 0.000562 0.000182
+gtccc 0.000976 0.000945 0.000508
+gtccg 0.0013 0.000468 0.000326
+gtcct 0.000572 0.00105 0.000283
+gtcga 0.000917 0.00123 0.000223
+gtcgc 0.00233 0.00144 0.000657
+gtcgg 0.00199 0.00107 0.000326
+gtcgt 0.000974 0.00133 0.000184
+gtcta 0.000141 0.000523 0.000132
+gtctc 0.000901 0.000994 0.000932
+gtctg 0.0009 0.000448 0.000944
+gtctt 0.000221 0.000789 0.000347
+gtgaa 8.72e-06 0.00224 0.000545
+gtgac 8.72e-06 0.00183 0.00143
+gtgag 8.72e-06 0.00174 0.00136
+gtgat 8.72e-06 0.00161 0.000495
+gtgca 0.0014 0.00281 0.000513
+gtgcc 0.00166 0.0027 0.00135
+gtgcg 0.00262 0.00316 0.001
+gtgct 0.000964 0.00438 0.000527
+gtgga 0.0013 0.00548 0.000944
+gtggc 0.00165 0.00383 0.00168
+gtggg 0.0016 0.00245 0.00103
+gtggt 0.000736 0.00334 0.00105
+gtgta 0.00026 0.000752 0.000342
+gtgtc 0.000567 0.00182 0.000807
+gtgtg 0.00122 0.00205 0.00154
+gtgtt 0.000361 0.00179 0.000271
+gttaa 0.000123 0.000281 8.91e-06
+gttac 0.000111 0.00018 0.000404
+gttag 0.000111 8.42e-05 8.91e-06
+gttat 0.000105 0.000203 0.000136
+gttca 0.00199 0.000378 0.000135
+gttcc 0.00253 0.000506 0.000363
+gttcg 0.00205 0.000374 0.000314
+gttct 0.00124 0.000591 0.000146
+gttga 0.000523 0.000607 8.91e-06
+gttgc 0.000901 0.00056 0.000301
+gttgg 0.00138 0.000651 0.000288
+gttgt 0.000467 0.000629 0.000235
+gttta 0.000284 0.000203 0.000157
+gtttc 0.00057 0.00026 0.000479
+gtttg 0.00227 0.000381 0.000426
+gtttt 0.000389 0.00032 0.00023
+taaaa 0.000267 0.000437 0.000184
+taaac 0.000213 0.000267 0.00033
+taaag 0.000268 0.00022 0.000356
+taaat 0.000136 0.000405 0.000132
+taaca 0.000314 0.000406 0.000197
+taacc 0.000357 0.00033 0.000309
+taacg 0.00035 0.000302 0.000316
+taact 0.000169 0.000407 0.000164
+taaga 0.000427 0.00102 0.000173
+taagc 0.000312 0.000607 0.00032
+taagg 0.000424 0.000522 0.000181
+taagt 0.000204 0.000441 0.000147
+taata 0.000156 0.000181 0.000143
+taatc 0.000317 0.00027 0.000435
+taatg 0.000593 0.000163 0.000367
+taatt 0.000157 0.000234 0.00018
+tacaa 0.000338 0.00196 0.000126
+tacac 0.000561 0.00109 0.000276
+tacag 0.000645 0.000837 0.000426
+tacat 0.000219 0.00142 0.000155
+tacca 0.000429 0.00152 0.00016
+taccc 0.000235 0.00116 0.000447
+taccg 0.000204 0.00131 0.000208
+tacct 0.000181 0.00197 0.000137
+tacga 0.000112 0.00201 0.000118
+tacgc 0.000263 0.00118 0.000349
+tacgg 0.000321 0.00112 0.000267
+tacgt 0.000199 0.00129 0.000219
+tacta 0.00017 0.000759 3.74e-05
+tactc 0.000366 0.000805 0.000333
+tactg 0.000461 0.000706 0.000436
+tactt 0.000197 0.00102 0.000119
+tagaa 0.000275 0.00251 0.000239
+tagac 0.000306 0.00135 0.000276
+tagag 0.000449 0.00144 0.000495
+tagat 0.000114 0.00169 0.000105
+tagca 0.00143 0.00239 0.000178
+tagcc 0.00123 0.0014 0.000298
+tagcg 0.00173 0.00185 0.000308
+tagct 0.000745 0.00281 0.00013
+tagga 0.000574 0.00426 0.000435
+taggc 0.000551 0.0025 0.000685
+taggg 0.000701 0.00166 0.000554
+taggt 0.000207 0.00172 0.000283
+tagta 0.000156 0.000757 0.000109
+tagtc 0.000278 0.00092 0.000328
+tagtg 0.000631 0.000773 0.000761
+tagtt 0.000121 0.00122 0.000257
+tataa 0.000197 0.000235 8.91e-06
+tatac 0.000174 0.000159 0.000367
+tatag 0.000216 7.73e-05 8.91e-06
+tatat 0.000136 0.000162 0.000128
+tatca 0.000289 0.0002 0.000226
+tatcc 0.000321 0.000179 0.000306
+tatcg 0.000272 0.000176 0.00029
+tatct 0.000206 0.000304 0.000187
+tatga 0.000188 0.000448 8.91e-06
+tatgc 0.000185 0.000374 0.000191
+tatgg 0.000246 0.000465 0.000258
+tatgt 0.000251 0.000243 0.000183
+tatta 0.000238 0.000159 8.91e-05
+tattc 0.00041 0.000246 0.000424
+tattg 0.000761 0.000164 0.000281
+tattt 0.000219 0.000316 0.000256
+tcaaa 0.000267 0.000444 0.000827
+tcaac 0.000272 0.000157 0.0037
+tcaag 0.000513 0.000138 0.00461
+tcaat 0.000181 0.000176 0.000591
+tcaca 0.000739 0.000396 0.000894
+tcacc 0.000594 0.00034 0.00326
+tcacg 0.000744 0.000405 0.00232
+tcact 0.000504 0.000526 0.00073
+tcaga 0.000621 0.000484 0.000346
+tcagc 0.000936 0.000465 0.00224
+tcagg 0.000579 0.000255 0.00064
+tcagt 0.000366 0.000195 0.000447
+tcata 0.000102 7.01e-05 0.000315
+tcatc 0.000418 0.000437 0.00484
+tcatg 0.000446 0.000116 0.00288
+tcatt 0.000204 0.000369 0.000921
+tccaa 0.000167 0.00166 0.000419
+tccac 0.000361 0.000955 0.00185
+tccag 0.0005 0.000586 0.00243
+tccat 0.000202 0.0013 0.000369
+tccca 0.000736 0.000837 0.000821
+tcccc 0.000577 0.000762 0.00213
+tcccg 0.000987 0.000559 0.00141
+tccct 0.000577 0.00109 0.000682
+tccga 0.000237 0.00119 0.000404
+tccgc 0.000795 0.00101 0.00256
+tccgg 0.000464 0.000757 0.00107
+tccgt 0.000303 0.00117 0.000672
+tccta 0.00011 0.000429 0.000249
+tcctc 0.000389 0.00114 0.00271
+tcctg 0.000626 0.000386 0.00428
+tcctt 0.000176 0.000916 0.000584
+tcgaa 0.000214 0.000453 0.000492
+tcgac 0.000424 0.000593 0.00374
+tcgag 0.000682 0.000538 0.00322
+tcgat 0.000231 0.000395 0.000746
+tcgca 0.000708 0.00142 0.000755
+tcgcc 0.000781 0.00129 0.00381
+tcgcg 0.000908 0.00102 0.00193
+tcgct 0.000676 0.00196 0.00118
+tcgga 0.000194 0.00184 0.000595
+tcggc 0.000584 0.00166 0.00263
+tcggg 0.000504 0.0011 0.0011
+tcggt 0.000178 0.000767 0.000451
+tcgta 0.000103 0.000352 0.00026
+tcgtc 0.00035 0.000757 0.00232
+tcgtg 0.000404 0.000695 0.00408
+tcgtt 0.000112 0.000589 0.000499
+tctaa 0.000169 0.000238 8.91e-06
+tctac 0.00036 0.000214 0.00321
+tctag 0.000182 0.000108 8.91e-06
+tctat 8.28e-05 0.00017 0.000408
+tctca 0.000931 0.000531 0.000686
+tctcc 0.000601 0.000641 0.00257
+tctcg 0.000654 0.000434 0.00163
+tctct 0.000795 0.000726 0.000682
+tctga 0.000741 0.000501 8.91e-06
+tctgc 0.00175 0.000627 0.00154
+tctgg 0.00139 0.000581 0.000837
+tctgt 0.000519 0.000535 0.000486
+tctta 8.37e-05 8.42e-05 0.000121
+tcttc 0.000425 0.000328 0.0038
+tcttg 0.000389 0.000224 0.000834
+tcttt 0.000202 0.000268 0.000618
+tgaaa 0.000584 0.000296 0.000766
+tgaac 0.000366 0.000225 0.00226
+tgaag 0.00112 0.000214 0.00307
+tgaat 0.000312 0.000245 0.000367
+tgaca 0.00153 0.000318 0.000606
+tgacc 0.0013 0.000297 0.00128
+tgacg 0.00182 0.000363 0.00249
+tgact 0.000713 0.000328 0.000613
+tgaga 0.00141 0.000863 0.000504
+tgagc 0.0014 0.000724 0.00237
+tgagg 0.00197 0.000669 0.00106
+tgagt 0.000722 0.000362 0.000645
+tgata 0.000242 0.000119 0.000249
+tgatc 0.000288 0.000164 0.00155
+tgatg 0.00127 0.000152 0.00213
+tgatt 0.000244 0.000244 0.000563
+tgcaa 0.00038 0.000994 0.000583
+tgcac 0.000722 0.000877 0.00303
+tgcag 0.000976 0.000738 0.00552
+tgcat 0.000373 0.000902 0.000736
+tgcca 0.00149 0.000945 0.000999
+tgccc 0.000938 0.000883 0.00321
+tgccg 0.0019 0.00102 0.00281
+tgcct 0.000615 0.00173 0.000665
+tgcga 0.000603 0.00145 0.000729
+tgcgc 0.00113 0.00104 0.00462
+tgcgg 0.00119 0.00119 0.00252
+tgcgt 0.000591 0.00124 0.00137
+tgcta 0.000228 0.000456 0.000312
+tgctc 0.000537 0.000709 0.00466
+tgctg 0.00129 0.000719 0.00925
+tgctt 0.000207 0.000738 0.000691
+tggaa 0.000443 0.000777 0.0013
+tggac 0.000507 0.000588 0.00516
+tggag 0.00147 0.000781 0.00888
+tggat 0.00038 0.000475 0.00144
+tggca 0.00147 0.000769 0.00129
+tggcc 0.00106 0.000557 0.00424
+tggcg 0.0016 0.000755 0.00461
+tggct 0.000981 0.00115 0.00138
+tggga 0.000737 0.00137 0.00124
+tgggc 0.000879 0.000986 0.00403
+tgggg 0.00114 0.000921 0.00194
+tgggt 0.000499 0.000747 0.001
+tggta 0.000194 0.000301 0.000376
+tggtc 0.000399 0.000427 0.00118
+tggtg 0.00138 0.000504 0.00664
+tggtt 0.000286 0.000475 0.00057
+tgtaa 0.000265 0.000217 8.91e-06
+tgtac 0.000218 0.000202 0.00194
+tgtag 0.000265 0.000136 8.91e-06
+tgtat 0.00026 0.00018 0.000362
+tgtca 0.000974 0.000326 0.000551
+tgtcc 0.00053 0.000255 0.00168
+tgtcg 0.000758 0.000215 0.00206
+tgtct 0.00065 0.000629 0.000816
+tgtga 0.000999 0.00063 8.91e-06
+tgtgc 0.00175 0.000706 0.00276
+tgtgg 0.00203 0.000726 0.00174
+tgtgt 0.00115 0.000883 0.000852
+tgtta 0.000187 0.000109 0.000196
+tgttc 0.000317 0.000232 0.00238
+tgttg 0.000699 0.000154 0.00111
+tgttt 0.000288 0.000307 0.00126
+ttaaa 8.72e-06 0.000238 0.000249
+ttaac 8.72e-06 0.000142 0.000404
+ttaag 8.72e-06 0.000101 0.00034
+ttaat 8.72e-06 0.000167 0.000182
+ttaca 0.000356 0.00024 0.000184
+ttacc 0.000528 0.000227 0.000277
+ttacg 0.000345 0.000219 0.000228
+ttact 0.00031 0.00022 9.75e-05
+ttaga 8.72e-06 0.000267 5.75e-05
+ttagc 8.72e-06 0.000222 0.000187
+ttagg 8.72e-06 0.000164 8.42e-05
+ttagt 8.72e-06 0.000159 9.35e-05
+ttata 0.000112 6.75e-05 9.71e-05
+ttatc 0.000218 0.000134 0.000287
+ttatg 0.000389 9.87e-05 0.000228
+ttatt 0.000162 0.000167 0.000132
+ttcaa 0.000234 0.00181 0.000315
+ttcac 0.000424 0.00152 0.000584
+ttcag 0.000365 0.000957 0.00064
+ttcat 0.000261 0.00191 0.000192
+ttcca 0.000411 0.00179 0.000372
+ttccc 0.000331 0.00158 0.000814
+ttccg 0.000497 0.00176 0.000481
+ttcct 0.00027 0.00246 0.000374
+ttcga 0.000174 0.0018 0.000184
+ttcgc 0.000394 0.00117 0.000625
+ttcgg 0.000371 0.000914 0.000319
+ttcgt 0.000174 0.00137 0.000164
+ttcta 0.000141 0.00101 0.000112
+ttctc 0.000595 0.00144 0.000634
+ttctg 0.000567 0.000918 0.00102
+ttctt 0.000187 0.00109 0.000242
+ttgaa 8.72e-06 0.000472 0.000643
+ttgac 8.72e-06 0.000437 0.00135
+ttgag 8.72e-06 0.000333 0.00165
+ttgat 8.72e-06 0.00026 0.000442
+ttgca 0.000256 0.000641 0.000738
+ttgcc 0.000319 0.000537 0.00112
+ttgcg 0.000305 0.000518 0.000878
+ttgct 0.000305 0.000883 0.000529
+ttgga 0.000235 0.00125 0.000711
+ttggc 0.000338 0.00104 0.00113
+ttggg 0.000357 0.000627 0.000691
+ttggt 0.000216 0.000632 0.000493
+ttgta 0.000139 0.000243 0.000239
+ttgtc 0.00026 0.000412 0.000894
+ttgtg 0.000399 0.000501 0.00159
+ttgtt 9.07e-05 0.000354 0.000483
+tttaa 0.000123 0.000281 8.91e-06
+tttac 0.000111 0.00018 0.000404
+tttag 0.000111 8.42e-05 8.91e-06
+tttat 0.000105 0.000203 0.000136
+tttca 0.000392 0.000367 0.000271
+tttcc 0.000706 0.00033 0.000274
+tttcg 0.000384 0.000236 0.000159
+tttct 0.00042 0.000403 0.000269
+tttga 0.000258 0.00164 8.91e-06
+tttgc 0.000413 0.00122 0.000413
+tttgg 0.000561 0.00107 0.00026
+tttgt 0.000352 0.00119 0.000374
+tttta 8.54e-05 0.000183 0.000125
+ttttc 0.000152 0.000226 0.000559
+ttttg 0.00056 0.000208 0.000351
+ttttt 0.000194 0.000342 0.000312
+
+# translation initiation motif
+[TRANSINIT]
+# width of motif, n=
+20
+# order of markov model, k=
+2
+# markov chain emission probabilities
+ 0 0.399 0.309 0.0899 0.202 0.233 0.233 0.286 0.248 0.36 0.199 0.351 0.09 0.197 0.328 0.208 0.268 0.155 0.361 0.277 0.206 0.189 0.354 0.278 0.179 0.24 0.275 0.244 0.24 0.124 0.316 0.208 0.352 0.147 0.225 0.442 0.186 0.186 0.27 0.236 0.308 0.227 0.216 0.383 0.174 0.151 0.42 0.174 0.256 0.21 0.238 0.28 0.273 0.155 0.255 0.286 0.303 0.242 0.13 0.246 0.382 0.167 0.136 0.282 0.415
+ 1 0.378 0.289 0.102 0.231 0.208 0.302 0.264 0.226 0.366 0.19 0.373 0.0709 0.162 0.302 0.257 0.279 0.164 0.36 0.268 0.208 0.186 0.345 0.258 0.211 0.245 0.33 0.231 0.194 0.124 0.315 0.232 0.329 0.129 0.263 0.435 0.173 0.19 0.267 0.235 0.308 0.181 0.272 0.341 0.206 0.121 0.337 0.227 0.315 0.291 0.236 0.258 0.214 0.19 0.223 0.279 0.308 0.189 0.159 0.258 0.394 0.141 0.154 0.314 0.391
+ 2 0.381 0.295 0.131 0.194 0.196 0.262 0.346 0.196 0.368 0.182 0.361 0.0894 0.171 0.28 0.248 0.301 0.151 0.382 0.266 0.201 0.18 0.32 0.288 0.212 0.225 0.312 0.233 0.23 0.101 0.319 0.234 0.346 0.125 0.245 0.465 0.165 0.206 0.229 0.268 0.297 0.164 0.28 0.369 0.187 0.106 0.352 0.273 0.27 0.276 0.276 0.245 0.203 0.189 0.228 0.252 0.332 0.153 0.189 0.228 0.429 0.148 0.17 0.311 0.372
+ 3 0.39 0.278 0.136 0.197 0.167 0.26 0.375 0.198 0.323 0.223 0.376 0.078 0.218 0.264 0.234 0.284 0.161 0.371 0.266 0.201 0.19 0.333 0.282 0.195 0.197 0.33 0.25 0.223 0.104 0.343 0.244 0.309 0.134 0.241 0.459 0.165 0.191 0.246 0.298 0.265 0.167 0.276 0.388 0.169 0.105 0.361 0.29 0.245 0.304 0.248 0.252 0.196 0.208 0.231 0.26 0.301 0.165 0.204 0.216 0.415 0.144 0.165 0.338 0.352
+ 4 0.372 0.274 0.144 0.211 0.136 0.259 0.409 0.196 0.335 0.182 0.349 0.134 0.261 0.239 0.2 0.3 0.155 0.414 0.259 0.173 0.234 0.297 0.238 0.23 0.181 0.331 0.249 0.239 0.106 0.352 0.271 0.271 0.126 0.285 0.433 0.156 0.176 0.277 0.332 0.214 0.2 0.281 0.387 0.132 0.101 0.352 0.308 0.239 0.33 0.231 0.222 0.217 0.239 0.263 0.221 0.276 0.148 0.226 0.2 0.426 0.142 0.172 0.33 0.356
+ 5 0.399 0.223 0.176 0.201 0.152 0.291 0.39 0.166 0.325 0.195 0.331 0.148 0.268 0.205 0.205 0.321 0.131 0.509 0.19 0.17 0.244 0.312 0.215 0.229 0.165 0.351 0.264 0.221 0.116 0.337 0.277 0.27 0.112 0.277 0.443 0.168 0.172 0.296 0.324 0.208 0.175 0.291 0.412 0.123 0.0854 0.297 0.362 0.256 0.35 0.203 0.24 0.207 0.261 0.245 0.229 0.264 0.153 0.27 0.155 0.423 0.148 0.2 0.313 0.339
+ 6 0.357 0.242 0.191 0.209 0.15 0.307 0.434 0.109 0.313 0.161 0.33 0.196 0.3 0.22 0.207 0.273 0.195 0.435 0.216 0.155 0.229 0.324 0.239 0.208 0.139 0.33 0.299 0.232 0.0998 0.349 0.297 0.254 0.0829 0.279 0.45 0.188 0.173 0.301 0.346 0.18 0.186 0.284 0.435 0.0947 0.0613 0.29 0.434 0.215 0.397 0.224 0.178 0.201 0.305 0.237 0.21 0.249 0.112 0.311 0.2 0.378 0.115 0.198 0.341 0.346
+ 7 0.373 0.226 0.206 0.195 0.216 0.28 0.391 0.113 0.349 0.191 0.263 0.197 0.225 0.123 0.286 0.366 0.175 0.414 0.246 0.165 0.25 0.321 0.231 0.198 0.133 0.362 0.261 0.245 0.0896 0.339 0.305 0.266 0.114 0.277 0.434 0.175 0.24 0.286 0.331 0.143 0.157 0.341 0.398 0.104 0.0435 0.295 0.454 0.208 0.473 0.183 0.161 0.183 0.342 0.228 0.181 0.248 0.137 0.309 0.186 0.368 0.129 0.201 0.33 0.34
+ 8 0.348 0.192 0.252 0.209 0.263 0.254 0.37 0.113 0.318 0.203 0.258 0.221 0.239 0.164 0.235 0.362 0.17 0.39 0.257 0.183 0.252 0.329 0.254 0.164 0.102 0.357 0.259 0.282 0.101 0.325 0.304 0.269 0.169 0.214 0.454 0.163 0.232 0.283 0.338 0.146 0.187 0.312 0.434 0.067 0.0597 0.301 0.487 0.153 0.435 0.182 0.149 0.234 0.328 0.277 0.167 0.229 0.153 0.291 0.201 0.355 0.166 0.208 0.312 0.314
+ 9 0.338 0.201 0.236 0.226 0.297 0.274 0.291 0.137 0.341 0.255 0.227 0.177 0.249 0.208 0.245 0.298 0.166 0.361 0.29 0.183 0.249 0.322 0.279 0.151 0.101 0.378 0.262 0.26 0.127 0.321 0.338 0.214 0.197 0.256 0.382 0.165 0.223 0.323 0.323 0.13 0.205 0.29 0.415 0.0901 0.0621 0.269 0.49 0.179 0.503 0.156 0.128 0.212 0.341 0.242 0.203 0.214 0.167 0.303 0.207 0.323 0.146 0.187 0.331 0.336
+10 0.305 0.203 0.238 0.253 0.336 0.325 0.223 0.116 0.351 0.272 0.166 0.212 0.201 0.244 0.268 0.287 0.155 0.351 0.32 0.173 0.228 0.326 0.289 0.157 0.111 0.387 0.219 0.283 0.117 0.282 0.351 0.251 0.167 0.294 0.367 0.172 0.26 0.291 0.294 0.154 0.216 0.273 0.404 0.108 0.0501 0.277 0.501 0.172 0.539 0.172 0.0944 0.194 0.304 0.224 0.179 0.293 0.181 0.278 0.201 0.34 0.186 0.174 0.251 0.389
+11 0.269 0.213 0.301 0.216 0.311 0.313 0.246 0.13 0.343 0.33 0.161 0.166 0.216 0.271 0.271 0.242 0.137 0.319 0.364 0.18 0.269 0.278 0.305 0.149 0.138 0.367 0.197 0.298 0.1 0.26 0.392 0.248 0.168 0.261 0.402 0.168 0.254 0.263 0.317 0.166 0.21 0.232 0.429 0.13 0.0618 0.236 0.519 0.183 0.55 0.183 0.0888 0.178 0.27 0.273 0.226 0.232 0.189 0.247 0.23 0.333 0.174 0.177 0.294 0.354
+12 0.246 0.199 0.333 0.221 0.341 0.266 0.252 0.141 0.292 0.329 0.186 0.193 0.195 0.298 0.279 0.229 0.192 0.242 0.397 0.169 0.234 0.313 0.292 0.161 0.134 0.381 0.18 0.305 0.0987 0.273 0.385 0.243 0.192 0.241 0.367 0.2 0.264 0.229 0.328 0.179 0.2 0.279 0.383 0.138 0.0654 0.252 0.509 0.173 0.528 0.167 0.0833 0.222 0.245 0.285 0.218 0.252 0.19 0.236 0.222 0.352 0.151 0.153 0.355 0.341
+13 0.262 0.173 0.386 0.179 0.341 0.302 0.209 0.148 0.317 0.355 0.182 0.146 0.171 0.324 0.24 0.265 0.164 0.264 0.417 0.155 0.232 0.334 0.276 0.158 0.15 0.402 0.15 0.297 0.0987 0.315 0.408 0.178 0.221 0.263 0.337 0.179 0.278 0.245 0.301 0.176 0.188 0.308 0.35 0.153 0.105 0.286 0.461 0.147 0.549 0.173 0.0926 0.185 0.207 0.307 0.204 0.282 0.227 0.197 0.221 0.355 0.162 0.137 0.363 0.338
+14 0.254 0.179 0.393 0.173 0.267 0.365 0.208 0.16 0.297 0.347 0.21 0.146 0.194 0.418 0.203 0.186 0.178 0.196 0.455 0.171 0.283 0.299 0.283 0.136 0.183 0.368 0.192 0.257 0.109 0.318 0.442 0.131 0.214 0.251 0.35 0.184 0.227 0.244 0.358 0.172 0.256 0.233 0.352 0.159 0.124 0.275 0.455 0.147 0.424 0.255 0.12 0.201 0.212 0.252 0.236 0.3 0.257 0.174 0.25 0.319 0.166 0.134 0.366 0.334
+15 0.329 0.188 0.359 0.124 0.238 0.316 0.306 0.14 0.294 0.395 0.178 0.133 0.18 0.369 0.212 0.239 0.198 0.256 0.419 0.127 0.297 0.279 0.281 0.143 0.188 0.388 0.185 0.238 0.124 0.333 0.422 0.121 0.265 0.288 0.253 0.194 0.23 0.232 0.358 0.181 0.267 0.277 0.312 0.144 0.135 0.286 0.393 0.186 0.422 0.24 0.12 0.219 0.219 0.267 0.233 0.281 0.274 0.178 0.228 0.32 0.161 0.0881 0.375 0.375
+16 0.311 0.171 0.374 0.144 0.179 0.377 0.347 0.0964 0.256 0.392 0.207 0.145 0.197 0.385 0.192 0.226 0.204 0.276 0.397 0.123 0.302 0.34 0.223 0.134 0.188 0.422 0.184 0.207 0.126 0.336 0.425 0.113 0.24 0.271 0.319 0.171 0.206 0.266 0.394 0.134 0.265 0.313 0.317 0.105 0.163 0.305 0.359 0.172 0.351 0.213 0.202 0.234 0.218 0.306 0.212 0.263 0.297 0.164 0.248 0.291 0.204 0.154 0.35 0.293
+17 0.327 0.17 0.398 0.105 0.166 0.344 0.391 0.0993 0.274 0.366 0.228 0.133 0.195 0.376 0.176 0.252 0.216 0.285 0.375 0.124 0.329 0.322 0.209 0.139 0.194 0.414 0.206 0.185 0.138 0.343 0.437 0.0821 0.271 0.244 0.32 0.166 0.173 0.29 0.425 0.112 0.264 0.35 0.3 0.0862 0.189 0.271 0.353 0.186 0.285 0.224 0.224 0.267 0.245 0.331 0.217 0.207 0.293 0.176 0.272 0.26 0.164 0.181 0.412 0.244
+18 0.347 0.158 0.376 0.119 0.179 0.366 0.37 0.0854 0.274 0.337 0.251 0.138 0.18 0.371 0.186 0.263 0.254 0.31 0.316 0.121 0.264 0.388 0.214 0.133 0.173 0.46 0.229 0.138 0.18 0.376 0.38 0.0634 0.291 0.237 0.289 0.183 0.182 0.306 0.4 0.112 0.271 0.386 0.271 0.0708 0.205 0.317 0.31 0.168 0.257 0.265 0.206 0.272 0.292 0.269 0.186 0.253 0.32 0.172 0.234 0.275 0.193 0.182 0.38 0.245
+19 0.356 0.162 0.356 0.127 0.12 0.431 0.402 0.0478 0.275 0.385 0.254 0.0861 0.161 0.389 0.188 0.262 0.208 0.349 0.314 0.129 0.327 0.353 0.222 0.0982 0.172 0.487 0.247 0.0936 0.179 0.364 0.416 0.0405 0.31 0.275 0.29 0.125 0.171 0.317 0.43 0.0818 0.302 0.335 0.284 0.0791 0.256 0.307 0.298 0.14 0.27 0.324 0.216 0.189 0.297 0.272 0.213 0.218 0.394 0.128 0.296 0.181 0.261 0.183 0.303 0.254
+
+# dss upstream motif, reading frame 0(reverse)
+[ETMOTIF0]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+# dss upstream motif, reading frame 1(reverse)
+[ETMOTIF1]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+# dss upstream motif, reading frame 2(reverse)
+[ETMOTIF2]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+
+#
+# Emission probabilities
+#
+[EMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.1674 0.3588 0.244
+aaaac 0.3487 0.2022 0.323
+aaaag 0.3257 0.1645 0.3221
+aaaat 0.1582 0.2745 0.1109
+aaaca 0.3053 0.2317 0.1867
+aaacc 0.2178 0.2444 0.3576
+aaacg 0.266 0.2175 0.3022
+aaact 0.2108 0.3063 0.1535
+aaaga 0.2432 0.378 0.2065
+aaagc 0.3073 0.2334 0.3709
+aaagg 0.2979 0.1957 0.2122
+aaagt 0.1517 0.1928 0.2103
+aaata 0.1276 0.2621 0.1395
+aaatc 0.2592 0.3269 0.3689
+aaatg 0.4848 0.1559 0.3679
+aaatt 0.1283 0.2552 0.1237
+aacaa 0.1916 0.3425 0.2481
+aacac 0.3184 0.2273 0.2961
+aacag 0.3656 0.1305 0.3855
+aacat 0.1244 0.2998 0.07029
+aacca 0.3898 0.1913 0.1803
+aaccc 0.238 0.237 0.2763
+aaccg 0.2029 0.1982 0.3424
+aacct 0.1693 0.3736 0.201
+aacga 0.1852 0.3234 0.1645
+aacgc 0.2841 0.2429 0.3834
+aacgg 0.3398 0.1877 0.2947
+aacgt 0.1908 0.2459 0.1574
+aacta 0.1425 0.1919 0.08029
+aactc 0.3065 0.2627 0.3691
+aactg 0.3862 0.1955 0.3869
+aactt 0.1648 0.3499 0.1637
+aagaa 0.2408 0.4239 0.1536
+aagac 0.2674 0.1647 0.2947
+aagag 0.3924 0.1649 0.391
+aagat 0.09943 0.2465 0.1606
+aagca 0.2817 0.2955 0.1534
+aagcc 0.2803 0.1846 0.373
+aagcg 0.231 0.205 0.3209
+aagct 0.207 0.3149 0.1527
+aagga 0.282 0.4009 0.1916
+aaggc 0.2711 0.2483 0.3421
+aaggg 0.3448 0.1633 0.2944
+aaggt 0.102 0.1875 0.1719
+aagta 0.1316 0.2105 0.03301
+aagtc 0.2345 0.2632 0.1893
+aagtg 0.5318 0.1823 0.5942
+aagtt 0.1022 0.3441 0.1835
+aataa 0.2719 0.3702 0.01739
+aatac 0.2405 0.2515 0.7157
+aatag 0.299 0.122 0.01739
+aatat 0.1887 0.2562 0.2496
+aatca 0.2773 0.2963 0.1924
+aatcc 0.2979 0.2071 0.2925
+aatcg 0.2695 0.1948 0.3227
+aatct 0.1553 0.3018 0.1924
+aatga 0.2759 0.3486 0.01391
+aatgc 0.2571 0.2578 0.2983
+aatgg 0.316 0.1581 0.4026
+aatgt 0.1509 0.2356 0.2851
+aatta 0.1465 0.1795 0.07078
+aattc 0.2517 0.278 0.4374
+aattg 0.4672 0.1853 0.2486
+aattt 0.1347 0.3571 0.2432
+acaaa 0.2077 0.4208 0.123
+acaac 0.4042 0.2286 0.3363
+acaag 0.2882 0.1688 0.469
+acaat 0.09984 0.1818 0.07171
+acaca 0.3212 0.3426 0.1438
+acacc 0.1942 0.222 0.2933
+acacg 0.3162 0.2235 0.4886
+acact 0.1685 0.2119 0.07421
+acaga 0.3212 0.3517 0.1183
+acagc 0.3288 0.2878 0.6254
+acagg 0.2753 0.184 0.1616
+acagt 0.07471 0.1765 0.09478
+acata 0.08752 0.1404 0.04168
+acatc 0.3572 0.3538 0.4981
+acatg 0.3814 0.1865 0.324
+acatt 0.1739 0.3192 0.1362
+accaa 0.2187 0.3268 0.06943
+accac 0.3383 0.2939 0.4027
+accag 0.2785 0.1095 0.4793
+accat 0.1645 0.2698 0.0486
+accca 0.2665 0.2405 0.1608
+acccc 0.2262 0.2528 0.3764
+acccg 0.3053 0.1306 0.3775
+accct 0.202 0.3761 0.08527
+accga 0.1167 0.3074 0.07704
+accgc 0.3729 0.2572 0.6081
+accgg 0.329 0.1585 0.2062
+accgt 0.1815 0.2769 0.1087
+accta 0.1621 0.183 0.03279
+acctc 0.3083 0.2873 0.3415
+acctg 0.4051 0.1806 0.5732
+acctt 0.1245 0.3491 0.05258
+acgaa 0.1377 0.2688 0.07321
+acgac 0.2732 0.2818 0.408
+acgag 0.4399 0.2416 0.4059
+acgat 0.1492 0.2078 0.1129
+acgca 0.2972 0.2507 0.1257
+acgcc 0.235 0.1745 0.4226
+acgcg 0.3022 0.2294 0.3508
+acgct 0.1656 0.3455 0.1009
+acgga 0.1748 0.3338 0.1384
+acggc 0.4579 0.2599 0.4655
+acggg 0.3071 0.2275 0.2978
+acggt 0.06013 0.1787 0.09833
+acgta 0.104 0.1656 0.0417
+acgtc 0.2538 0.2565 0.2617
+acgtg 0.5275 0.3364 0.63
+acgtt 0.1147 0.2414 0.06657
+actaa 0.2126 0.3261 0.002874
+actac 0.4538 0.2927 0.8667
+actag 0.2291 0.1487 0.002874
+actat 0.1044 0.2324 0.1276
+actca 0.3776 0.2188 0.09355
+actcc 0.1387 0.2318 0.3149
+actcg 0.3056 0.2824 0.4733
+actct 0.178 0.2671 0.1183
+actga 0.1674 0.2571 0.002484
+actgc 0.3579 0.291 0.5594
+actgg 0.3592 0.2015 0.3358
+actgt 0.1156 0.2505 0.1023
+actta 0.1313 0.09301 0.01874
+acttc 0.3273 0.3626 0.6159
+acttg 0.3657 0.2479 0.1766
+acttt 0.1758 0.2965 0.1888
+agaaa 0.2276 0.3068 0.1155
+agaac 0.2073 0.1892 0.2592
+agaag 0.4378 0.2989 0.5634
+agaat 0.1273 0.2051 0.0619
+agaca 0.2727 0.2613 0.132
+agacc 0.2149 0.2672 0.2589
+agacg 0.3517 0.3343 0.514
+agact 0.1608 0.1372 0.0951
+agaga 0.2713 0.3784 0.144
+agagc 0.2255 0.25 0.4719
+agagg 0.3849 0.2294 0.2838
+agagt 0.1183 0.1422 0.1003
+agata 0.1288 0.1755 0.04417
+agatc 0.2246 0.2409 0.424
+agatg 0.5263 0.2239 0.41
+agatt 0.1203 0.3597 0.1219
+agcaa 0.1702 0.3053 0.06487
+agcac 0.2702 0.2036 0.2677
+agcag 0.4386 0.2431 0.6078
+agcat 0.1211 0.248 0.05969
+agcca 0.3462 0.2432 0.1528
+agccc 0.1927 0.1803 0.3712
+agccg 0.3229 0.218 0.3645
+agcct 0.1382 0.3585 0.1115
+agcga 0.202 0.3575 0.1351
+agcgc 0.3142 0.2016 0.4475
+agcgg 0.3511 0.2195 0.3215
+agcgt 0.1327 0.2215 0.09598
+agcta 0.1689 0.1481 0.03049
+agctc 0.2841 0.321 0.2767
+agctg 0.4385 0.2604 0.6218
+agctt 0.1085 0.2704 0.071
+aggaa 0.1992 0.3356 0.08355
+aggac 0.1868 0.2039 0.2516
+aggag 0.5562 0.2197 0.5767
+aggat 0.05779 0.2408 0.08816
+aggca 0.2895 0.2813 0.1204
+aggcc 0.2355 0.2254 0.3738
+aggcg 0.3461 0.2009 0.3897
+aggct 0.1289 0.2924 0.1161
+aggga 0.2574 0.3797 0.1329
+agggc 0.251 0.2753 0.4845
+agggg 0.3909 0.2001 0.2683
+agggt 0.1007 0.1448 0.1144
+aggta 0.1268 0.184 0.05743
+aggtc 0.2019 0.2452 0.1854
+aggtg 0.5462 0.2897 0.654
+aggtt 0.1252 0.281 0.1032
+agtaa 0.1827 0.2948 0.002838
+agtac 0.3122 0.2756 0.8649
+agtag 0.3392 0.1849 0.002838
+agtat 0.1659 0.2448 0.1294
+agtca 0.3046 0.2555 0.114
+agtcc 0.2615 0.2273 0.2611
+agtcg 0.2684 0.2335 0.477
+agtct 0.1655 0.2837 0.148
+agtga 0.2778 0.3239 0.00277
+agtgc 0.239 0.2364 0.4903
+agtgg 0.3502 0.2936 0.3712
+agtgt 0.133 0.1461 0.1357
+agtta 0.06981 0.1363 0.02588
+agttc 0.2862 0.2891 0.5621
+agttg 0.4939 0.1917 0.191
+agttt 0.1501 0.3829 0.2211
+ataaa 0.25 0.3674 0.2739
+ataac 0.25 0.219 0.296
+ataag 0.25 0.1563 0.2739
+ataat 0.25 0.2573 0.1562
+ataca 0.268 0.2652 0.2337
+atacc 0.2607 0.2506 0.352
+atacg 0.2607 0.2412 0.2903
+atact 0.2107 0.2431 0.1239
+ataga 0.25 0.4513 0.1361
+atagc 0.25 0.2048 0.443
+atagg 0.25 0.1153 0.1994
+atagt 0.25 0.2286 0.2215
+atata 0.1272 0.1444 0.1306
+atatc 0.2475 0.2861 0.3859
+atatg 0.4416 0.2112 0.3062
+atatt 0.1837 0.3583 0.1774
+atcaa 0.1819 0.3396 0.1837
+atcac 0.3302 0.2299 0.3416
+atcag 0.2844 0.1274 0.3616
+atcat 0.2036 0.303 0.1131
+atcca 0.3159 0.2292 0.2198
+atccc 0.2795 0.1925 0.3728
+atccg 0.1732 0.2231 0.2037
+atcct 0.2314 0.3552 0.2037
+atcga 0.2276 0.3413 0.1301
+atcgc 0.3278 0.2678 0.438
+atcgg 0.2989 0.1547 0.2515
+atcgt 0.1457 0.2362 0.1804
+atcta 0.09474 0.205 0.05244
+atctc 0.3994 0.2734 0.3396
+atctg 0.3801 0.1798 0.5093
+atctt 0.1257 0.3417 0.09867
+atgaa 0.25 0.3532 0.1698
+atgac 0.25 0.2145 0.3598
+atgag 0.25 0.1728 0.3275
+atgat 0.25 0.2595 0.143
+atgca 0.2259 0.2513 0.1778
+atgcc 0.2942 0.1446 0.4195
+atgcg 0.3118 0.2196 0.2489
+atgct 0.1681 0.3845 0.1537
+atgga 0.3391 0.3979 0.1923
+atggc 0.2238 0.2609 0.4505
+atggg 0.3253 0.1571 0.251
+atggt 0.1119 0.184 0.1063
+atgta 0.122 0.1333 0.07459
+atgtc 0.249 0.2416 0.2569
+atgtg 0.5037 0.2607 0.52
+atgtt 0.1253 0.3644 0.1485
+attaa 0.2742 0.4322 0.01597
+attac 0.2461 0.1682 0.7244
+attag 0.2461 0.0651 0.01597
+attat 0.2335 0.3345 0.2436
+attca 0.286 0.2597 0.1265
+attcc 0.2987 0.3112 0.4148
+attcg 0.1695 0.221 0.2496
+attct 0.2458 0.2082 0.2091
+attga 0.1494 0.3322 0.0107
+attgc 0.2512 0.2338 0.3617
+attgg 0.407 0.219 0.3456
+attgt 0.1924 0.215 0.282
+attta 0.1097 0.2115 0.0787
+atttc 0.2062 0.2372 0.3501
+atttg 0.5565 0.2549 0.3284
+atttt 0.1277 0.2964 0.2429
+caaaa 0.1937 0.2997 0.1685
+caaac 0.2628 0.1897 0.3046
+caaag 0.3994 0.1804 0.4141
+caaat 0.1441 0.3302 0.1129
+caaca 0.306 0.3442 0.1838
+caacc 0.2598 0.2371 0.3524
+caacg 0.2879 0.2036 0.3134
+caact 0.1462 0.2151 0.1504
+caaga 0.2632 0.3534 0.1915
+caagc 0.2567 0.2378 0.4068
+caagg 0.3369 0.2158 0.1949
+caagt 0.1432 0.193 0.2068
+caata 0.1121 0.2132 0.1302
+caatc 0.245 0.318 0.3841
+caatg 0.5424 0.1925 0.3254
+caatt 0.1005 0.2762 0.1603
+cacaa 0.217 0.3487 0.1366
+cacac 0.3168 0.2323 0.2801
+cacag 0.3439 0.1595 0.5043
+cacat 0.1223 0.2596 0.07896
+cacca 0.3896 0.2576 0.1643
+caccc 0.1305 0.2097 0.3899
+caccg 0.3156 0.2125 0.3209
+cacct 0.1642 0.3202 0.1249
+cacga 0.1283 0.2682 0.1214
+cacgc 0.3499 0.2587 0.3886
+cacgg 0.3474 0.2109 0.3099
+cacgt 0.1744 0.2622 0.1801
+cacta 0.1718 0.2004 0.07063
+cactc 0.2942 0.2665 0.3301
+cactg 0.3687 0.2371 0.4727
+cactt 0.1653 0.296 0.1266
+cagaa 0.2104 0.3472 0.1281
+cagac 0.253 0.1769 0.2571
+cagag 0.4113 0.2094 0.4759
+cagat 0.1253 0.2665 0.1388
+cagca 0.3295 0.3368 0.2675
+cagcc 0.2024 0.1595 0.3236
+cagcg 0.3342 0.2006 0.2526
+cagct 0.134 0.3031 0.1563
+cagga 0.3096 0.3681 0.2287
+caggc 0.236 0.2901 0.3964
+caggg 0.3564 0.1759 0.2403
+caggt 0.09793 0.1659 0.1346
+cagta 0.1295 0.2002 0.09951
+cagtc 0.2505 0.2365 0.2839
+cagtg 0.5257 0.2313 0.4732
+cagtt 0.09429 0.3321 0.1434
+cataa 0.2326 0.3702 0.01739
+catac 0.2458 0.2515 0.7157
+catag 0.3007 0.122 0.01739
+catat 0.2209 0.2562 0.2496
+catca 0.3042 0.2404 0.2508
+catcc 0.2371 0.1738 0.2752
+catcg 0.3005 0.2456 0.2944
+catct 0.1582 0.3403 0.1796
+catga 0.1923 0.2817 0.01391
+catgc 0.2678 0.2368 0.2983
+catgg 0.3848 0.232 0.4026
+catgt 0.155 0.2495 0.2851
+catta 0.1482 0.1795 0.09281
+cattc 0.2458 0.278 0.3968
+cattg 0.4943 0.1853 0.3028
+cattt 0.1117 0.3571 0.2077
+ccaaa 0.2478 0.3731 0.08873
+ccaac 0.2633 0.2442 0.3613
+ccaag 0.3783 0.1783 0.4977
+ccaat 0.1106 0.2044 0.05224
+ccaca 0.24 0.2176 0.1184
+ccacc 0.3016 0.3529 0.4697
+ccacg 0.2825 0.2404 0.3363
+ccact 0.1758 0.189 0.07558
+ccaga 0.2245 0.3807 0.05417
+ccagc 0.3212 0.2843 0.6481
+ccagg 0.3402 0.1675 0.1964
+ccagt 0.1141 0.1675 0.1013
+ccata 0.09556 0.1403 0.03485
+ccatc 0.3069 0.3161 0.5052
+ccatg 0.4549 0.2024 0.3721
+ccatt 0.1427 0.3412 0.08788
+cccaa 0.118 0.3265 0.08645
+cccac 0.3665 0.2738 0.3417
+cccag 0.382 0.1728 0.497
+cccat 0.1335 0.2269 0.0749
+cccca 0.2952 0.1986 0.1192
+ccccc 0.1828 0.3345 0.4154
+ccccg 0.4008 0.207 0.3519
+cccct 0.1212 0.2598 0.1136
+cccga 0.1412 0.3205 0.1044
+cccgc 0.3751 0.2446 0.4278
+cccgg 0.3423 0.2107 0.2895
+cccgt 0.1415 0.2241 0.1783
+cccta 0.0544 0.1344 0.03523
+ccctc 0.384 0.3238 0.375
+ccctg 0.4456 0.2609 0.5137
+ccctt 0.116 0.2809 0.07612
+ccgaa 0.2041 0.1729 0.05206
+ccgac 0.2269 0.3105 0.4312
+ccgag 0.428 0.291 0.4273
+ccgat 0.1409 0.2256 0.08941
+ccgca 0.2742 0.2068 0.09183
+ccgcc 0.252 0.2922 0.5121
+ccgcg 0.3068 0.1795 0.2767
+ccgct 0.1671 0.3215 0.1194
+ccgga 0.1345 0.2916 0.1314
+ccggc 0.4911 0.3601 0.486
+ccggg 0.2995 0.2129 0.2813
+ccggt 0.07488 0.1354 0.1012
+ccgta 0.1004 0.1837 0.04061
+ccgtc 0.216 0.2552 0.298
+ccgtg 0.5643 0.2983 0.5987
+ccgtt 0.1192 0.2628 0.06274
+cctaa 0.1718 0.3261 0.003726
+cctac 0.5258 0.2927 0.88
+cctag 0.2371 0.1487 0.003726
+cctat 0.06529 0.2324 0.1125
+cctca 0.3201 0.1933 0.09418
+cctcc 0.1823 0.3483 0.4878
+cctcg 0.286 0.1828 0.2933
+cctct 0.2116 0.2757 0.1247
+cctga 0.1264 0.2378 0.00296
+cctgc 0.3794 0.2831 0.5293
+cctgg 0.3854 0.2797 0.3647
+cctgt 0.1089 0.1993 0.103
+cctta 0.107 0.09301 0.02959
+ccttc 0.3111 0.3626 0.6627
+ccttg 0.402 0.2479 0.1982
+ccttt 0.18 0.2965 0.1094
+cgaaa 0.1678 0.302 0.116
+cgaac 0.2228 0.2296 0.3802
+cgaag 0.4649 0.2183 0.4094
+cgaat 0.1446 0.2501 0.09431
+cgaca 0.2328 0.2531 0.1258
+cgacc 0.2488 0.179 0.3009
+cgacg 0.3614 0.2798 0.4878
+cgact 0.157 0.2881 0.08545
+cgaga 0.2029 0.3255 0.1136
+cgagc 0.2687 0.3262 0.5408
+cgagg 0.3782 0.183 0.2133
+cgagt 0.1502 0.1653 0.1322
+cgata 0.06816 0.1351 0.08518
+cgatc 0.194 0.2066 0.3737
+cgatg 0.571 0.2625 0.4116
+cgatt 0.1668 0.3958 0.1296
+cgcaa 0.1766 0.3107 0.07314
+cgcac 0.4051 0.2604 0.384
+cgcag 0.3417 0.1761 0.4944
+cgcat 0.07654 0.2528 0.04844
+cgcca 0.2896 0.2725 0.1258
+cgccc 0.1452 0.1473 0.3657
+cgccg 0.4285 0.2662 0.4227
+cgcct 0.1367 0.314 0.08577
+cgcga 0.1118 0.343 0.1046
+cgcgc 0.3684 0.2535 0.4602
+cgcgg 0.3244 0.1728 0.3122
+cgcgt 0.1954 0.2307 0.123
+cgcta 0.1113 0.1674 0.03415
+cgctc 0.3375 0.2889 0.3179
+cgctg 0.432 0.263 0.5988
+cgctt 0.1192 0.2807 0.0491
+cggaa 0.1336 0.3139 0.07597
+cggac 0.2156 0.1868 0.3105
+cggag 0.5395 0.3244 0.5338
+cggat 0.1114 0.1749 0.07975
+cggca 0.2382 0.268 0.09133
+cggcc 0.1974 0.2048 0.3418
+cggcg 0.391 0.2549 0.46
+cggct 0.1734 0.2723 0.1069
+cggga 0.1544 0.3877 0.1712
+cgggc 0.3504 0.2386 0.424
+cgggg 0.3855 0.2358 0.3217
+cgggt 0.1097 0.1379 0.08309
+cggta 0.1026 0.116 0.0333
+cggtc 0.1865 0.299 0.1833
+cggtg 0.5703 0.3466 0.7306
+cggtt 0.1406 0.2384 0.05275
+cgtaa 0.1463 0.2948 0.003959
+cgtac 0.3582 0.2756 0.8599
+cgtag 0.3612 0.1849 0.003959
+cgtat 0.1343 0.2448 0.1322
+cgtca 0.3575 0.2488 0.1052
+cgtcc 0.1496 0.1746 0.2828
+cgtcg 0.3369 0.1819 0.468
+cgtct 0.156 0.3948 0.144
+cgtga 0.1509 0.2345 0.002094
+cgtgc 0.3241 0.2644 0.4242
+cgtgg 0.3564 0.2985 0.3953
+cgtgt 0.1687 0.2025 0.1784
+cgtta 0.1005 0.104 0.02984
+cgttc 0.3659 0.3121 0.5443
+cgttg 0.3361 0.1888 0.2084
+cgttt 0.1975 0.395 0.2175
+ctaaa 0.25 0.3674 0.1838
+ctaac 0.25 0.219 0.2288
+ctaag 0.25 0.1563 0.5027
+ctaat 0.25 0.2573 0.08468
+ctaca 0.2733 0.2369 0.226
+ctacc 0.2837 0.2697 0.492
+ctacg 0.2699 0.2211 0.198
+ctact 0.1731 0.2722 0.084
+ctaga 0.25 0.3291 0.1361
+ctagc 0.25 0.2729 0.443
+ctagg 0.25 0.2024 0.1994
+ctagt 0.25 0.1956 0.2215
+ctata 0.1484 0.1444 0.1306
+ctatc 0.2753 0.2861 0.3859
+ctatg 0.4359 0.2112 0.3062
+ctatt 0.1404 0.3583 0.1774
+ctcaa 0.193 0.3667 0.1682
+ctcac 0.3101 0.2397 0.3371
+ctcag 0.2815 0.1029 0.3902
+ctcat 0.2154 0.2907 0.1045
+ctcca 0.316 0.214 0.1504
+ctccc 0.1992 0.2331 0.4012
+ctccg 0.2678 0.1842 0.2919
+ctcct 0.217 0.3687 0.1565
+ctcga 0.08987 0.2594 0.1189
+ctcgc 0.3733 0.3135 0.5198
+ctcgg 0.3845 0.1593 0.2027
+ctcgt 0.1523 0.2678 0.1585
+ctcta 0.09611 0.2053 0.05628
+ctctc 0.4104 0.3211 0.2912
+ctctg 0.3585 0.1284 0.5301
+ctctt 0.135 0.3452 0.1224
+ctgaa 0.25 0.3133 0.1305
+ctgac 0.25 0.2402 0.3445
+ctgag 0.25 0.2391 0.3581
+ctgat 0.25 0.2074 0.1669
+ctgca 0.2337 0.2458 0.1809
+ctgcc 0.3299 0.1784 0.3646
+ctgcg 0.2584 0.2089 0.2513
+ctgct 0.178 0.3669 0.2033
+ctgga 0.1845 0.3685 0.2091
+ctggc 0.2556 0.244 0.3667
+ctggg 0.415 0.2101 0.2786
+ctggt 0.1449 0.1774 0.1456
+ctgta 0.1083 0.1331 0.08801
+ctgtc 0.2656 0.3246 0.2372
+ctgtg 0.5302 0.3039 0.5356
+ctgtt 0.09588 0.2384 0.1392
+cttaa 0.2742 0.3758 0.01597
+cttac 0.2461 0.2404 0.7244
+cttag 0.2461 0.1125 0.01597
+cttat 0.2335 0.2713 0.2436
+cttca 0.2766 0.2569 0.2071
+cttcc 0.3196 0.3136 0.3499
+cttcg 0.2088 0.1443 0.2923
+cttct 0.1949 0.2852 0.1507
+cttga 0.1708 0.2816 0.009597
+cttgc 0.3039 0.2522 0.3724
+cttgg 0.3718 0.2064 0.3493
+cttgt 0.1535 0.2597 0.2687
+cttta 0.09846 0.1453 0.123
+ctttc 0.1538 0.265 0.3706
+ctttg 0.6519 0.2308 0.3835
+ctttt 0.09588 0.359 0.123
+gaaaa 0.245 0.3238 0.1567
+gaaac 0.2353 0.2063 0.3745
+gaaag 0.3669 0.1566 0.3396
+gaaat 0.1528 0.3133 0.1292
+gaaca 0.263 0.2832 0.2207
+gaacc 0.3064 0.2024 0.2821
+gaacg 0.2765 0.2042 0.3263
+gaact 0.1541 0.3102 0.1708
+gaaga 0.2801 0.4259 0.2298
+gaagc 0.271 0.232 0.3629
+gaagg 0.336 0.1974 0.2823
+gaagt 0.113 0.1447 0.125
+gaata 0.1358 0.1876 0.09408
+gaatc 0.3196 0.2628 0.4582
+gaatg 0.4167 0.2246 0.2753
+gaatt 0.1279 0.325 0.1725
+gacaa 0.1436 0.2742 0.1099
+gacac 0.3406 0.2504 0.4021
+gacag 0.399 0.1695 0.3432
+gacat 0.1169 0.3059 0.1448
+gacca 0.2699 0.1981 0.1329
+gaccc 0.2655 0.2572 0.4827
+gaccg 0.3019 0.1859 0.2486
+gacct 0.1627 0.3588 0.1358
+gacga 0.1597 0.3965 0.1538
+gacgc 0.3572 0.2425 0.3998
+gacgg 0.3434 0.166 0.2855
+gacgt 0.1397 0.1949 0.1608
+gacta 0.1031 0.1544 0.0428
+gactc 0.3246 0.2947 0.4501
+gactg 0.405 0.2095 0.3917
+gactt 0.1672 0.3414 0.1154
+gagaa 0.2535 0.3234 0.1183
+gagac 0.2811 0.2213 0.33
+gagag 0.3874 0.2312 0.4051
+gagat 0.07795 0.2241 0.1466
+gagca 0.2212 0.2319 0.1683
+gagcc 0.2732 0.1605 0.3222
+gagcg 0.3552 0.2414 0.3383
+gagct 0.1504 0.3662 0.1712
+gagga 0.2759 0.4549 0.2573
+gaggc 0.2611 0.2248 0.3276
+gaggg 0.3513 0.1582 0.2902
+gaggt 0.1116 0.1621 0.1248
+gagta 0.1211 0.2068 0.08501
+gagtc 0.2272 0.2508 0.2397
+gagtg 0.55 0.2173 0.4711
+gagtt 0.1018 0.3252 0.2043
+gataa 0.2817 0.4109 0.01739
+gatac 0.2649 0.2263 0.7157
+gatag 0.2836 0.06581 0.01739
+gatat 0.1698 0.297 0.2496
+gatca 0.2141 0.2085 0.2237
+gatcc 0.3171 0.2778 0.3036
+gatcg 0.3372 0.2431 0.2877
+gatct 0.1316 0.2706 0.1849
+gatga 0.2298 0.3931 0.01391
+gatgc 0.2707 0.2138 0.2983
+gatgg 0.374 0.2079 0.4026
+gatgt 0.1255 0.1852 0.2851
+gatta 0.137 0.206 0.08246
+gattc 0.2704 0.2762 0.4175
+gattg 0.4396 0.1945 0.2088
+gattt 0.1531 0.3234 0.2912
+gcaaa 0.1957 0.3208 0.118
+gcaac 0.2475 0.2498 0.3207
+gcaag 0.4524 0.2165 0.5026
+gcaat 0.1043 0.2129 0.05874
+gcaca 0.2472 0.3091 0.1413
+gcacc 0.2796 0.1595 0.3765
+gcacg 0.3383 0.2847 0.4101
+gcact 0.1349 0.2467 0.07206
+gcaga 0.2089 0.3558 0.08899
+gcagc 0.3673 0.3137 0.6287
+gcagg 0.3086 0.1891 0.1606
+gcagt 0.1152 0.1414 0.1217
+gcata 0.07793 0.1085 0.02609
+gcatc 0.3869 0.3669 0.4674
+gcatg 0.3493 0.2054 0.4046
+gcatt 0.1859 0.3191 0.1019
+gccaa 0.1629 0.281 0.07064
+gccac 0.3928 0.259 0.4398
+gccag 0.3087 0.1243 0.4254
+gccat 0.1356 0.3356 0.06419
+gccca 0.3004 0.2224 0.1553
+gcccc 0.1969 0.2216 0.4427
+gcccg 0.347 0.2021 0.2767
+gccct 0.1557 0.3539 0.1254
+gccga 0.1045 0.2873 0.09018
+gccgc 0.4167 0.2955 0.6076
+gccgg 0.3275 0.1997 0.2005
+gccgt 0.1513 0.2176 0.1017
+gccta 0.05423 0.1818 0.03223
+gcctc 0.3536 0.3351 0.4188
+gcctg 0.4635 0.2159 0.4948
+gcctt 0.1287 0.2672 0.05413
+gcgaa 0.09763 0.1601 0.07255
+gcgac 0.2881 0.2929 0.3909
+gcgag 0.4797 0.3346 0.4616
+gcgat 0.1346 0.2124 0.07492
+gcgca 0.256 0.2269 0.09185
+gcgcc 0.2302 0.1807 0.5247
+gcgcg 0.3147 0.2122 0.2791
+gcgct 0.199 0.3802 0.1043
+gcgga 0.169 0.2563 0.1465
+gcggc 0.4464 0.406 0.5386
+gcggg 0.293 0.1747 0.1965
+gcggt 0.09155 0.163 0.1184
+gcgta 0.08211 0.1602 0.04064
+gcgtc 0.2798 0.2795 0.3058
+gcgtg 0.5246 0.3019 0.5869
+gcgtt 0.1135 0.2585 0.0667
+gctaa 0.2216 0.3955 0.003181
+gctac 0.4145 0.2465 0.8969
+gctag 0.2312 0.1086 0.003181
+gctat 0.1327 0.2493 0.09669
+gctca 0.3431 0.2785 0.08027
+gctcc 0.1313 0.2072 0.4245
+gctcg 0.3454 0.2804 0.4017
+gctct 0.1802 0.2339 0.09354
+gctga 0.1249 0.2434 0.002015
+gctgc 0.4001 0.3115 0.5294
+gctgg 0.3391 0.2418 0.3143
+gctgt 0.1359 0.2033 0.1543
+gctta 0.1188 0.07962 0.02609
+gcttc 0.3175 0.336 0.6562
+gcttg 0.437 0.2767 0.1729
+gcttt 0.1267 0.3077 0.1449
+ggaaa 0.2202 0.315 0.141
+ggaac 0.1699 0.2392 0.2981
+ggaag 0.4811 0.1954 0.479
+ggaat 0.1287 0.2504 0.0819
+ggaca 0.2538 0.2275 0.1523
+ggacc 0.2397 0.242 0.2826
+ggacg 0.3755 0.2486 0.4702
+ggact 0.1309 0.2819 0.09492
+ggaga 0.228 0.3177 0.1827
+ggagc 0.2769 0.2624 0.4134
+ggagg 0.3826 0.2957 0.2888
+ggagt 0.1124 0.1242 0.1151
+ggata 0.0902 0.2048 0.09021
+ggatc 0.2312 0.2655 0.4117
+ggatg 0.5777 0.1934 0.3816
+ggatt 0.1009 0.3363 0.1164
+ggcaa 0.1584 0.2768 0.09968
+ggcac 0.3105 0.2547 0.2837
+ggcag 0.4111 0.1995 0.5688
+ggcat 0.1201 0.269 0.04787
+ggcca 0.2633 0.2178 0.1377
+ggccc 0.1676 0.1502 0.3932
+ggccg 0.4118 0.2605 0.3353
+ggcct 0.1572 0.3715 0.1338
+ggcga 0.1383 0.2806 0.1059
+ggcgc 0.3731 0.2215 0.4921
+ggcgg 0.3547 0.2892 0.2675
+ggcgt 0.1338 0.2087 0.1345
+ggcta 0.08167 0.1663 0.04523
+ggctc 0.3246 0.3355 0.3316
+ggctg 0.4855 0.2453 0.5513
+ggctt 0.1082 0.253 0.07192
+gggaa 0.198 0.3468 0.08796
+gggac 0.2023 0.2182 0.3231
+gggag 0.4705 0.2196 0.5017
+gggat 0.1292 0.2154 0.08716
+gggca 0.2472 0.2555 0.1778
+gggcc 0.2486 0.2481 0.3582
+gggcg 0.3363 0.2325 0.3309
+gggct 0.1679 0.2639 0.1331
+gggga 0.2093 0.3331 0.2339
+ggggc 0.3605 0.2525 0.378
+ggggg 0.3293 0.2543 0.2673
+ggggt 0.1009 0.1601 0.1208
+gggta 0.1288 0.2357 0.07753
+gggtc 0.2694 0.213 0.2859
+gggtg 0.4763 0.2685 0.5657
+gggtt 0.1256 0.2828 0.07087
+ggtaa 0.1507 0.205 0.007987
+ggtac 0.3531 0.3506 0.8674
+ggtag 0.3714 0.228 0.007987
+ggtat 0.1248 0.2165 0.1166
+ggtca 0.3605 0.2547 0.137
+ggtcc 0.2195 0.2192 0.2385
+ggtcg 0.2773 0.2593 0.4404
+ggtct 0.1427 0.2668 0.1842
+ggtga 0.1863 0.2677 0.005035
+ggtgc 0.3208 0.1877 0.3535
+ggtgg 0.3699 0.3789 0.4099
+ggtgt 0.1229 0.1658 0.2316
+ggtta 0.09919 0.1571 0.04231
+ggttc 0.3401 0.2477 0.4592
+ggttg 0.3532 0.1707 0.2704
+ggttt 0.2075 0.4245 0.2281
+gtaaa 0.25 0.3674 0.205
+gtaac 0.25 0.219 0.3391
+gtaag 0.25 0.1563 0.3008
+gtaat 0.25 0.2573 0.1552
+gtaca 0.2558 0.2436 0.2337
+gtacc 0.312 0.2436 0.352
+gtacg 0.3009 0.3222 0.2903
+gtact 0.1313 0.1906 0.1239
+gtaga 0.25 0.2645 0.1361
+gtagc 0.25 0.2961 0.443
+gtagg 0.25 0.2121 0.1994
+gtagt 0.25 0.2273 0.2215
+gtata 0.09673 0.1444 0.1306
+gtatc 0.2262 0.2861 0.3859
+gtatg 0.497 0.2112 0.3062
+gtatt 0.1801 0.3583 0.1774
+gtcaa 0.1708 0.3037 0.1717
+gtcac 0.3962 0.2646 0.4303
+gtcag 0.2645 0.1221 0.2704
+gtcat 0.1685 0.3095 0.1277
+gtcca 0.2915 0.186 0.1399
+gtccc 0.243 0.3126 0.3909
+gtccg 0.3232 0.1549 0.251
+gtcct 0.1423 0.3465 0.2181
+gtcga 0.1476 0.2429 0.1603
+gtcgc 0.3754 0.2837 0.4731
+gtcgg 0.3201 0.2113 0.2346
+gtcgt 0.1568 0.2621 0.1321
+gtcta 0.06527 0.1898 0.05598
+gtctc 0.4166 0.361 0.3956
+gtctg 0.4158 0.1625 0.4009
+gtctt 0.1023 0.2866 0.1475
+gtgaa 0.25 0.3021 0.1426
+gtgac 0.25 0.2468 0.3733
+gtgag 0.25 0.2346 0.3546
+gtgat 0.25 0.2166 0.1295
+gtgca 0.2105 0.215 0.1512
+gtgcc 0.2501 0.2067 0.3974
+gtgcg 0.3945 0.2425 0.2961
+gtgct 0.145 0.3358 0.1554
+gtgga 0.2466 0.3632 0.2011
+gtggc 0.312 0.2538 0.3571
+gtggg 0.3021 0.162 0.219
+gtggt 0.1393 0.221 0.2228
+gtgta 0.1078 0.1171 0.1154
+gtgtc 0.2352 0.2843 0.2722
+gtgtg 0.5072 0.3192 0.521
+gtgtt 0.1498 0.2793 0.09135
+gttaa 0.2742 0.3758 0.01597
+gttac 0.2461 0.2404 0.7244
+gttag 0.2461 0.1125 0.01597
+gttat 0.2335 0.2713 0.2436
+gttca 0.2549 0.2043 0.1413
+gttcc 0.3237 0.2736 0.3792
+gttcg 0.2625 0.2024 0.3271
+gttct 0.159 0.3198 0.1524
+gttga 0.1599 0.2479 0.0107
+gttgc 0.2756 0.2291 0.3617
+gttgg 0.4216 0.2661 0.3456
+gttgt 0.1429 0.257 0.282
+gttta 0.08097 0.1747 0.1214
+gtttc 0.1624 0.2232 0.371
+gtttg 0.6458 0.3275 0.3297
+gtttt 0.1108 0.2746 0.1779
+taaaa 0.3018 0.3288 0.1833
+taaac 0.2406 0.2012 0.3292
+taaag 0.3037 0.1655 0.3559
+taaat 0.1538 0.3044 0.1317
+taaca 0.2635 0.281 0.1996
+taacc 0.3001 0.2281 0.313
+taacg 0.2943 0.2092 0.3207
+taact 0.142 0.2816 0.1667
+taaga 0.3125 0.395 0.2104
+taagc 0.2283 0.2338 0.3899
+taagg 0.3099 0.2014 0.2207
+taagt 0.1492 0.1699 0.179
+taata 0.1276 0.2132 0.1267
+taatc 0.2592 0.318 0.3869
+taatg 0.4848 0.1925 0.3263
+taatt 0.1283 0.2762 0.16
+tacaa 0.1916 0.3686 0.1286
+tacac 0.3184 0.2059 0.2808
+tacag 0.3656 0.1576 0.433
+tacat 0.1244 0.2679 0.1576
+tacca 0.4086 0.2554 0.1682
+taccc 0.2243 0.1941 0.4692
+taccg 0.1944 0.2196 0.2187
+tacct 0.1728 0.3308 0.1439
+tacga 0.1248 0.3587 0.1234
+tacgc 0.2943 0.21 0.3664
+tacgg 0.3587 0.2002 0.2804
+tacgt 0.2222 0.2311 0.2299
+tacta 0.1425 0.2305 0.04038
+tactc 0.3065 0.2445 0.3596
+tactg 0.3862 0.2144 0.4712
+tactt 0.1648 0.3105 0.1288
+tagaa 0.2408 0.3597 0.2141
+tagac 0.2674 0.1927 0.2476
+tagag 0.3924 0.2056 0.4441
+tagat 0.09943 0.2419 0.09425
+tagca 0.2778 0.2824 0.1949
+tagcc 0.2392 0.166 0.3255
+tagcg 0.3377 0.219 0.3372
+tagct 0.1452 0.3326 0.1423
+tagga 0.282 0.4199 0.2224
+taggc 0.2711 0.2467 0.3501
+taggg 0.3448 0.1639 0.283
+taggt 0.102 0.1695 0.1445
+tagta 0.1316 0.2063 0.07469
+tagtc 0.2345 0.2508 0.2253
+tagtg 0.5318 0.2108 0.5231
+tagtt 0.1022 0.3321 0.1769
+tataa 0.2719 0.3702 0.01739
+tatac 0.2405 0.2515 0.7157
+tatag 0.299 0.122 0.01739
+tatat 0.1887 0.2562 0.2496
+tatca 0.266 0.2326 0.2237
+tatcc 0.2949 0.2087 0.3036
+tatcg 0.25 0.2048 0.2877
+tatct 0.1891 0.3539 0.1849
+tatga 0.2164 0.2927 0.01391
+tatgc 0.2124 0.2447 0.2983
+tatgg 0.2826 0.3039 0.4026
+tatgt 0.2886 0.1587 0.2851
+tatta 0.1465 0.1795 0.08489
+tattc 0.2517 0.278 0.4037
+tattg 0.4672 0.1853 0.2678
+tattt 0.1347 0.3571 0.2436
+tcaaa 0.2164 0.4851 0.085
+tcaac 0.2207 0.1716 0.3805
+tcaag 0.4158 0.1511 0.4737
+tcaat 0.1471 0.1922 0.06082
+tcaca 0.2863 0.2377 0.1241
+tcacc 0.2302 0.2039 0.4524
+tcacg 0.2883 0.2428 0.3221
+tcact 0.1951 0.3156 0.1014
+tcaga 0.2481 0.346 0.09417
+tcagc 0.3742 0.3325 0.6097
+tcagg 0.2314 0.1822 0.1743
+tcagt 0.1463 0.1394 0.1218
+tcata 0.08752 0.07057 0.0352
+tcatc 0.3572 0.4406 0.5406
+tcatg 0.3814 0.117 0.3214
+tcatt 0.1739 0.3718 0.1028
+tccaa 0.136 0.3685 0.08272
+tccac 0.2932 0.2124 0.3647
+tccag 0.4065 0.1303 0.4798
+tccat 0.1643 0.2888 0.07286
+tccca 0.2558 0.2575 0.1626
+tcccc 0.2006 0.2344 0.4222
+tcccg 0.343 0.1718 0.2801
+tccct 0.2006 0.3363 0.1351
+tccga 0.1318 0.2882 0.08582
+tccgc 0.4419 0.2453 0.544
+tccgg 0.2578 0.1829 0.2276
+tccgt 0.1686 0.2836 0.1425
+tccta 0.08445 0.1496 0.03186
+tcctc 0.2989 0.3963 0.3464
+tcctg 0.4812 0.1347 0.5471
+tcctt 0.1354 0.3194 0.07465
+tcgaa 0.1377 0.2288 0.05996
+tcgac 0.2732 0.2997 0.4558
+tcgag 0.4399 0.272 0.3932
+tcgat 0.1492 0.1995 0.09103
+tcgca 0.2303 0.2495 0.09838
+tcgcc 0.2541 0.2267 0.4958
+tcgcg 0.2955 0.1789 0.2517
+tcgct 0.2201 0.3449 0.1541
+tcgga 0.1326 0.3429 0.1246
+tcggc 0.4002 0.3088 0.5513
+tcggg 0.3453 0.2053 0.2298
+tcggt 0.1219 0.1429 0.09437
+tcgta 0.1061 0.147 0.03631
+tcgtc 0.3615 0.3162 0.324
+tcgtg 0.4173 0.2905 0.57
+tcgtt 0.1151 0.2463 0.06963
+tctaa 0.2126 0.3261 0.002453
+tctac 0.4538 0.2927 0.8827
+tctag 0.2291 0.1487 0.002453
+tctat 0.1044 0.2324 0.1124
+tctca 0.3123 0.2278 0.1232
+tctcc 0.2018 0.2747 0.4619
+tctcg 0.2193 0.1861 0.2923
+tctct 0.2667 0.3114 0.1226
+tctga 0.1683 0.2232 0.003098
+tctgc 0.3975 0.2795 0.5366
+tctgg 0.3163 0.2589 0.2912
+tctgt 0.118 0.2384 0.1691
+tctta 0.07607 0.09301 0.02254
+tcttc 0.3867 0.3626 0.7073
+tcttg 0.3534 0.2479 0.1551
+tcttt 0.1838 0.2965 0.115
+tgaaa 0.2456 0.302 0.1186
+tgaac 0.154 0.2296 0.3495
+tgaag 0.4692 0.2183 0.475
+tgaat 0.1312 0.2501 0.05683
+tgaca 0.2846 0.2434 0.1215
+tgacc 0.2424 0.2277 0.2565
+tgacg 0.3399 0.2777 0.4991
+tgact 0.1331 0.2512 0.1229
+tgaga 0.2557 0.3296 0.1102
+tgagc 0.2544 0.2767 0.5173
+tgagg 0.3585 0.2555 0.2314
+tgagt 0.1313 0.1382 0.141
+tgata 0.1185 0.1755 0.0556
+tgatc 0.1407 0.2409 0.3447
+tgatg 0.6215 0.2239 0.4742
+tgatt 0.1194 0.3597 0.1255
+tgcaa 0.155 0.2832 0.05905
+tgcac 0.2945 0.2496 0.307
+tgcag 0.3983 0.2102 0.5594
+tgcat 0.1522 0.2569 0.07458
+tgcca 0.3015 0.2065 0.13
+tgccc 0.1897 0.1931 0.4182
+tgccg 0.3843 0.2222 0.3653
+tgcct 0.1245 0.3783 0.08646
+tgcga 0.1718 0.2948 0.07884
+tgcgc 0.3217 0.211 0.5004
+tgcgg 0.3381 0.2423 0.2729
+tgcgt 0.1683 0.252 0.1478
+tgcta 0.1009 0.1739 0.02091
+tgctc 0.2373 0.2704 0.3125
+tgctg 0.5701 0.2743 0.6202
+tgctt 0.09168 0.2814 0.04637
+tggaa 0.1584 0.2966 0.07727
+tggac 0.1814 0.2243 0.3076
+tggag 0.5243 0.2979 0.5293
+tggat 0.1359 0.1812 0.08577
+tggca 0.2883 0.2382 0.1118
+tggcc 0.2074 0.1726 0.3678
+tggcg 0.3122 0.234 0.4003
+tggct 0.1921 0.3552 0.12
+tggga 0.2263 0.3408 0.1507
+tgggc 0.2697 0.2449 0.4908
+tgggg 0.351 0.2288 0.2363
+tgggt 0.153 0.1855 0.1223
+tggta 0.08571 0.1762 0.0429
+tggtc 0.1768 0.2503 0.1342
+tggtg 0.6108 0.2953 0.7578
+tggtt 0.1266 0.2783 0.06507
+tgtaa 0.263 0.2948 0.003834
+tgtac 0.2163 0.2756 0.8367
+tgtag 0.263 0.1849 0.003834
+tgtat 0.2578 0.2448 0.1557
+tgtca 0.3345 0.229 0.1077
+tgtcc 0.1819 0.1787 0.3294
+tgtcg 0.2603 0.1511 0.4033
+tgtct 0.2232 0.4412 0.1596
+tgtga 0.1687 0.214 0.001662
+tgtgc 0.295 0.2396 0.5145
+tgtgg 0.3427 0.2465 0.325
+tgtgt 0.1937 0.2999 0.1589
+tgtta 0.1251 0.1363 0.0396
+tgttc 0.2129 0.2891 0.4816
+tgttg 0.469 0.1917 0.2243
+tgttt 0.193 0.3829 0.2545
+ttaaa 0.25 0.3674 0.2121
+ttaac 0.25 0.219 0.3439
+ttaag 0.25 0.1563 0.2894
+ttaat 0.25 0.2573 0.1545
+ttaca 0.231 0.2652 0.2337
+ttacc 0.3431 0.2506 0.352
+ttacg 0.2242 0.2412 0.2903
+ttact 0.2016 0.2431 0.1239
+ttaga 0.25 0.3291 0.1361
+ttagc 0.25 0.2729 0.443
+ttagg 0.25 0.2024 0.1994
+ttagt 0.25 0.1956 0.2215
+ttata 0.1272 0.1444 0.1306
+ttatc 0.2475 0.2861 0.3859
+ttatg 0.4416 0.2112 0.3062
+ttatt 0.1837 0.3583 0.1774
+ttcaa 0.1819 0.2917 0.1821
+ttcac 0.3302 0.2457 0.3374
+ttcag 0.2844 0.1543 0.3693
+ttcat 0.2036 0.3083 0.1111
+ttcca 0.2725 0.2355 0.1824
+ttccc 0.2194 0.2085 0.3988
+ttccg 0.3291 0.2319 0.2356
+ttcct 0.179 0.3241 0.1832
+ttcga 0.1565 0.3423 0.1421
+ttcgc 0.3537 0.2228 0.4841
+ttcgg 0.3333 0.1738 0.2469
+ttcgt 0.1565 0.2611 0.1269
+ttcta 0.09474 0.2267 0.05595
+ttctc 0.3994 0.3234 0.3162
+ttctg 0.3801 0.206 0.5071
+ttctt 0.1257 0.244 0.1208
+ttgaa 0.25 0.314 0.1576
+ttgac 0.25 0.2912 0.3309
+ttgag 0.25 0.2218 0.4033
+ttgat 0.25 0.1729 0.1082
+ttgca 0.2162 0.2485 0.226
+ttgcc 0.2691 0.2081 0.3428
+ttgcg 0.2574 0.2008 0.2691
+ttgct 0.2574 0.3426 0.1621
+ttgga 0.2052 0.3525 0.2347
+ttggc 0.2948 0.2935 0.3741
+ttggg 0.3116 0.1763 0.2282
+ttggt 0.1884 0.1777 0.1629
+ttgta 0.1569 0.1608 0.07453
+ttgtc 0.2922 0.2729 0.2792
+ttgtg 0.449 0.3318 0.4956
+ttgtt 0.102 0.2344 0.1507
+tttaa 0.2742 0.3758 0.01597
+tttac 0.2461 0.2404 0.7244
+tttag 0.2461 0.1125 0.01597
+tttat 0.2335 0.2713 0.2436
+tttca 0.2062 0.2749 0.2784
+tttcc 0.3712 0.2468 0.2821
+tttcg 0.2016 0.1765 0.163
+tttct 0.2209 0.3018 0.2766
+tttga 0.1628 0.3202 0.008432
+tttgc 0.2607 0.238 0.3912
+tttgg 0.3542 0.2086 0.2462
+tttgt 0.2222 0.2333 0.3541
+tttta 0.08627 0.1907 0.09259
+ttttc 0.1532 0.2353 0.4153
+ttttg 0.5651 0.2175 0.2606
+ttttt 0.1954 0.3565 0.2315
+
+
+#
+# Initial emission probabilities
+#
+[INITEMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.27 0.213 0.198
+aaaac 0.311 0.287 0.257
+aaaag 0.246 0.185 0.317
+aaaat 0.172 0.315 0.228
+aaaca 0.232 0.311 0.239
+aaacc 0.286 0.189 0.291
+aaacg 0.268 0.258 0.214
+aaact 0.214 0.242 0.256
+aaaga 0.288 0.257 0.316
+aaagc 0.218 0.267 0.222
+aaagg 0.324 0.208 0.282
+aaagt 0.171 0.267 0.179
+aaata 0.318 0.236 0.214
+aaatc 0.182 0.225 0.277
+aaatg 0.309 0.225 0.214
+aaatt 0.191 0.315 0.295
+aacaa 0.187 0.261 0.152
+aacac 0.351 0.309 0.356
+aacag 0.179 0.182 0.28
+aacat 0.284 0.248 0.212
+aacca 0.376 0.25 0.234
+aaccc 0.2 0.185 0.27
+aaccg 0.216 0.25 0.27
+aacct 0.208 0.315 0.225
+aacga 0.286 0.375 0.126
+aacgc 0.224 0.256 0.371
+aacgg 0.348 0.149 0.252
+aacgt 0.143 0.22 0.252
+aacta 0.164 0.197 0.195
+aactc 0.27 0.272 0.336
+aactg 0.295 0.197 0.265
+aactt 0.27 0.333 0.204
+aagaa 0.168 0.294 0.183
+aagac 0.255 0.322 0.31
+aagag 0.358 0.239 0.352
+aagat 0.219 0.144 0.155
+aagca 0.208 0.253 0.284
+aagcc 0.268 0.312 0.277
+aagcg 0.235 0.14 0.236
+aagct 0.289 0.296 0.203
+aagga 0.24 0.271 0.354
+aaggc 0.326 0.243 0.238
+aaggg 0.271 0.267 0.218
+aaggt 0.163 0.219 0.19
+aagta 0.236 0.245 0.255
+aagtc 0.255 0.34 0.226
+aagtg 0.226 0.211 0.264
+aagtt 0.283 0.204 0.255
+aataa 0.224 0.216 0.22
+aatac 0.271 0.196 0.286
+aatag 0.318 0.265 0.22
+aatat 0.187 0.324 0.275
+aatca 0.242 0.355 0.193
+aatcc 0.275 0.322 0.307
+aatcg 0.255 0.158 0.325
+aatct 0.229 0.164 0.175
+aatga 0.211 0.247 0.175
+aatgc 0.336 0.233 0.298
+aatgg 0.322 0.363 0.211
+aatgt 0.132 0.158 0.316
+aatta 0.319 0.208 0.254
+aattc 0.177 0.229 0.238
+aattg 0.221 0.344 0.221
+aattt 0.283 0.219 0.287
+acaaa 0.25 0.172 0.235
+acaac 0.24 0.293 0.184
+acaag 0.26 0.276 0.368
+acaat 0.25 0.259 0.213
+acaca 0.282 0.222 0.258
+acacc 0.215 0.203 0.159
+acacg 0.238 0.354 0.358
+acact 0.265 0.222 0.225
+acaga 0.287 0.346 0.182
+acagc 0.366 0.257 0.356
+acagg 0.231 0.221 0.167
+acagt 0.116 0.176 0.295
+acata 0.153 0.212 0.178
+acatc 0.267 0.288 0.309
+acatg 0.336 0.314 0.309
+acatt 0.244 0.186 0.204
+accaa 0.254 0.239 0.203
+accac 0.315 0.231 0.268
+accag 0.246 0.224 0.268
+accat 0.185 0.306 0.261
+accca 0.175 0.257 0.275
+acccc 0.185 0.345 0.281
+acccg 0.381 0.193 0.268
+accct 0.259 0.205 0.176
+accga 0.201 0.179 0.229
+accgc 0.331 0.342 0.447
+accgg 0.201 0.179 0.165
+accgt 0.266 0.299 0.159
+accta 0.226 0.153 0.178
+acctc 0.29 0.381 0.22
+acctg 0.21 0.282 0.487
+acctt 0.274 0.183 0.115
+acgaa 0.317 0.185 0.167
+acgac 0.2 0.243 0.212
+acgag 0.242 0.254 0.399
+acgat 0.242 0.318 0.222
+acgca 0.107 0.196 0.18
+acgcc 0.286 0.185 0.361
+acgcg 0.416 0.336 0.332
+acgct 0.191 0.283 0.127
+acgga 0.203 0.341 0.246
+acggc 0.26 0.378 0.383
+acggg 0.384 0.116 0.24
+acggt 0.153 0.165 0.131
+acgta 0.156 0.132 0.152
+acgtc 0.291 0.391 0.228
+acgtg 0.34 0.325 0.396
+acgtt 0.213 0.152 0.223
+actaa 0.174 0.202 0.156
+actac 0.235 0.253 0.406
+actag 0.217 0.232 0.156
+actat 0.374 0.313 0.281
+actca 0.203 0.207 0.163
+actcc 0.291 0.409 0.344
+actcg 0.314 0.171 0.33
+actct 0.192 0.213 0.163
+actga 0.269 0.219 0.109
+actgc 0.304 0.325 0.372
+actgg 0.215 0.138 0.284
+actgt 0.212 0.319 0.235
+actta 0.185 0.208 0.153
+acttc 0.241 0.352 0.339
+acttg 0.296 0.272 0.317
+acttt 0.278 0.168 0.19
+agaaa 0.222 0.295 0.204
+agaac 0.289 0.209 0.204
+agaag 0.267 0.279 0.371
+agaat 0.222 0.217 0.222
+agaca 0.203 0.229 0.24
+agacc 0.208 0.276 0.269
+agacg 0.307 0.276 0.354
+agact 0.282 0.219 0.137
+agaga 0.245 0.186 0.257
+agagc 0.185 0.332 0.292
+agagg 0.395 0.347 0.316
+agagt 0.175 0.136 0.135
+agata 0.169 0.189 0.194
+agatc 0.287 0.292 0.299
+agatg 0.397 0.236 0.336
+agatt 0.147 0.283 0.172
+agcaa 0.214 0.285 0.103
+agcac 0.26 0.168 0.179
+agcag 0.299 0.307 0.549
+agcat 0.227 0.241 0.169
+agcca 0.158 0.156 0.166
+agccc 0.346 0.179 0.252
+agccg 0.254 0.329 0.399
+agcct 0.241 0.335 0.184
+agcga 0.167 0.234 0.112
+agcgc 0.346 0.193 0.403
+agcgg 0.265 0.275 0.314
+agcgt 0.222 0.298 0.171
+agcta 0.141 0.218 0.157
+agctc 0.254 0.302 0.244
+agctg 0.352 0.287 0.415
+agctt 0.254 0.193 0.184
+aggaa 0.286 0.24 0.177
+aggac 0.119 0.264 0.267
+aggag 0.476 0.296 0.421
+aggat 0.119 0.2 0.135
+aggca 0.206 0.238 0.175
+aggcc 0.139 0.125 0.25
+aggcg 0.228 0.315 0.362
+aggct 0.428 0.321 0.212
+aggga 0.122 0.264 0.204
+agggc 0.354 0.132 0.254
+agggg 0.335 0.328 0.303
+agggt 0.189 0.276 0.239
+aggta 0.162 0.171 0.186
+aggtc 0.189 0.197 0.197
+aggtg 0.48 0.402 0.464
+aggtt 0.169 0.231 0.153
+agtaa 0.293 0.308 0.171
+agtac 0.207 0.167 0.462
+agtag 0.319 0.233 0.171
+agtat 0.181 0.292 0.197
+agtca 0.166 0.224 0.221
+agtcc 0.278 0.289 0.16
+agtcg 0.139 0.224 0.359
+agtct 0.417 0.263 0.26
+agtga 0.256 0.232 0.112
+agtgc 0.154 0.237 0.202
+agtgg 0.35 0.188 0.191
+agtgt 0.241 0.343 0.494
+agtta 0.224 0.195 0.185
+agttc 0.303 0.169 0.323
+agttg 0.211 0.356 0.194
+agttt 0.263 0.28 0.298
+ataaa 0.25 0.213 0.327
+ataac 0.25 0.266 0.245
+ataag 0.25 0.309 0.236
+ataat 0.25 0.213 0.191
+ataca 0.22 0.267 0.253
+atacc 0.277 0.208 0.202
+atacg 0.34 0.333 0.202
+atact 0.164 0.192 0.343
+ataga 0.25 0.299 0.311
+atagc 0.25 0.187 0.252
+atagg 0.25 0.252 0.194
+atagt 0.25 0.262 0.243
+atata 0.296 0.195 0.236
+atatc 0.204 0.227 0.276
+atatg 0.278 0.25 0.283
+atatt 0.222 0.328 0.205
+atcaa 0.235 0.21 0.212
+atcac 0.269 0.322 0.397
+atcag 0.244 0.21 0.199
+atcat 0.252 0.259 0.192
+atcca 0.178 0.259 0.189
+atccc 0.224 0.209 0.405
+atccg 0.236 0.245 0.178
+atcct 0.362 0.288 0.227
+atcga 0.258 0.294 0.283
+atcgc 0.412 0.25 0.204
+atcgg 0.186 0.3 0.248
+atcgt 0.144 0.156 0.265
+atcta 0.155 0.146 0.187
+atctc 0.333 0.226 0.291
+atctg 0.318 0.238 0.351
+atctt 0.194 0.39 0.172
+atgaa 0.25 0.308 0.189
+atgac 0.25 0.249 0.297
+atgag 0.25 0.278 0.291
+atgat 0.25 0.166 0.223
+atgca 0.243 0.262 0.2
+atgcc 0.189 0.164 0.321
+atgcg 0.266 0.421 0.267
+atgct 0.302 0.154 0.212
+atgga 0.24 0.309 0.234
+atggc 0.226 0.286 0.197
+atggg 0.295 0.223 0.212
+atggt 0.24 0.182 0.358
+atgta 0.204 0.222 0.126
+atgtc 0.252 0.265 0.231
+atgtg 0.385 0.276 0.377
+atgtt 0.159 0.238 0.266
+attaa 0.243 0.263 0.22
+attac 0.204 0.288 0.297
+attag 0.243 0.212 0.22
+attat 0.311 0.237 0.264
+attca 0.268 0.276 0.208
+attcc 0.183 0.228 0.34
+attcg 0.301 0.22 0.198
+attct 0.248 0.276 0.255
+attga 0.134 0.204 0.137
+attgc 0.248 0.211 0.212
+attgg 0.318 0.204 0.247
+attgt 0.299 0.38 0.404
+attta 0.218 0.191 0.18
+atttc 0.226 0.174 0.18
+atttg 0.406 0.322 0.414
+atttt 0.15 0.313 0.225
+caaaa 0.27 0.213 0.198
+caaac 0.311 0.287 0.257
+caaag 0.246 0.185 0.317
+caaat 0.172 0.315 0.228
+caaca 0.232 0.311 0.239
+caacc 0.286 0.189 0.291
+caacg 0.268 0.258 0.214
+caact 0.214 0.242 0.256
+caaga 0.288 0.257 0.316
+caagc 0.218 0.267 0.222
+caagg 0.324 0.208 0.282
+caagt 0.171 0.267 0.179
+caata 0.318 0.236 0.214
+caatc 0.182 0.225 0.277
+caatg 0.309 0.225 0.214
+caatt 0.191 0.315 0.295
+cacaa 0.187 0.261 0.152
+cacac 0.351 0.309 0.356
+cacag 0.179 0.182 0.28
+cacat 0.284 0.248 0.212
+cacca 0.376 0.25 0.234
+caccc 0.2 0.185 0.27
+caccg 0.216 0.25 0.27
+cacct 0.208 0.315 0.225
+cacga 0.286 0.375 0.126
+cacgc 0.224 0.256 0.371
+cacgg 0.348 0.149 0.252
+cacgt 0.143 0.22 0.252
+cacta 0.164 0.197 0.195
+cactc 0.27 0.272 0.336
+cactg 0.295 0.197 0.265
+cactt 0.27 0.333 0.204
+cagaa 0.168 0.294 0.183
+cagac 0.255 0.322 0.31
+cagag 0.358 0.239 0.352
+cagat 0.219 0.144 0.155
+cagca 0.208 0.253 0.284
+cagcc 0.268 0.312 0.277
+cagcg 0.235 0.14 0.236
+cagct 0.289 0.296 0.203
+cagga 0.24 0.271 0.354
+caggc 0.326 0.243 0.238
+caggg 0.271 0.267 0.218
+caggt 0.163 0.219 0.19
+cagta 0.236 0.245 0.255
+cagtc 0.255 0.34 0.226
+cagtg 0.226 0.211 0.264
+cagtt 0.283 0.204 0.255
+cataa 0.224 0.216 0.22
+catac 0.271 0.196 0.286
+catag 0.318 0.265 0.22
+catat 0.187 0.324 0.275
+catca 0.242 0.355 0.193
+catcc 0.275 0.322 0.307
+catcg 0.255 0.158 0.325
+catct 0.229 0.164 0.175
+catga 0.211 0.247 0.175
+catgc 0.336 0.233 0.298
+catgg 0.322 0.363 0.211
+catgt 0.132 0.158 0.316
+catta 0.319 0.208 0.254
+cattc 0.177 0.229 0.238
+cattg 0.221 0.344 0.221
+cattt 0.283 0.219 0.287
+ccaaa 0.25 0.172 0.235
+ccaac 0.24 0.293 0.184
+ccaag 0.26 0.276 0.368
+ccaat 0.25 0.259 0.213
+ccaca 0.282 0.222 0.258
+ccacc 0.215 0.203 0.159
+ccacg 0.238 0.354 0.358
+ccact 0.265 0.222 0.225
+ccaga 0.287 0.346 0.182
+ccagc 0.366 0.257 0.356
+ccagg 0.231 0.221 0.167
+ccagt 0.116 0.176 0.295
+ccata 0.153 0.212 0.178
+ccatc 0.267 0.288 0.309
+ccatg 0.336 0.314 0.309
+ccatt 0.244 0.186 0.204
+cccaa 0.254 0.239 0.203
+cccac 0.315 0.231 0.268
+cccag 0.246 0.224 0.268
+cccat 0.185 0.306 0.261
+cccca 0.175 0.257 0.275
+ccccc 0.185 0.345 0.281
+ccccg 0.381 0.193 0.268
+cccct 0.259 0.205 0.176
+cccga 0.201 0.179 0.229
+cccgc 0.331 0.342 0.447
+cccgg 0.201 0.179 0.165
+cccgt 0.266 0.299 0.159
+cccta 0.226 0.153 0.178
+ccctc 0.29 0.381 0.22
+ccctg 0.21 0.282 0.487
+ccctt 0.274 0.183 0.115
+ccgaa 0.317 0.185 0.167
+ccgac 0.2 0.243 0.212
+ccgag 0.242 0.254 0.399
+ccgat 0.242 0.318 0.222
+ccgca 0.107 0.196 0.18
+ccgcc 0.286 0.185 0.361
+ccgcg 0.416 0.336 0.332
+ccgct 0.191 0.283 0.127
+ccgga 0.203 0.341 0.246
+ccggc 0.26 0.378 0.383
+ccggg 0.384 0.116 0.24
+ccggt 0.153 0.165 0.131
+ccgta 0.156 0.132 0.152
+ccgtc 0.291 0.391 0.228
+ccgtg 0.34 0.325 0.396
+ccgtt 0.213 0.152 0.223
+cctaa 0.174 0.202 0.156
+cctac 0.235 0.253 0.406
+cctag 0.217 0.232 0.156
+cctat 0.374 0.313 0.281
+cctca 0.203 0.207 0.163
+cctcc 0.291 0.409 0.344
+cctcg 0.314 0.171 0.33
+cctct 0.192 0.213 0.163
+cctga 0.269 0.219 0.109
+cctgc 0.304 0.325 0.372
+cctgg 0.215 0.138 0.284
+cctgt 0.212 0.319 0.235
+cctta 0.185 0.208 0.153
+ccttc 0.241 0.352 0.339
+ccttg 0.296 0.272 0.317
+ccttt 0.278 0.168 0.19
+cgaaa 0.222 0.295 0.204
+cgaac 0.289 0.209 0.204
+cgaag 0.267 0.279 0.371
+cgaat 0.222 0.217 0.222
+cgaca 0.203 0.229 0.24
+cgacc 0.208 0.276 0.269
+cgacg 0.307 0.276 0.354
+cgact 0.282 0.219 0.137
+cgaga 0.245 0.186 0.257
+cgagc 0.185 0.332 0.292
+cgagg 0.395 0.347 0.316
+cgagt 0.175 0.136 0.135
+cgata 0.169 0.189 0.194
+cgatc 0.287 0.292 0.299
+cgatg 0.397 0.236 0.336
+cgatt 0.147 0.283 0.172
+cgcaa 0.214 0.285 0.103
+cgcac 0.26 0.168 0.179
+cgcag 0.299 0.307 0.549
+cgcat 0.227 0.241 0.169
+cgcca 0.158 0.156 0.166
+cgccc 0.346 0.179 0.252
+cgccg 0.254 0.329 0.399
+cgcct 0.241 0.335 0.184
+cgcga 0.167 0.234 0.112
+cgcgc 0.346 0.193 0.403
+cgcgg 0.265 0.275 0.314
+cgcgt 0.222 0.298 0.171
+cgcta 0.141 0.218 0.157
+cgctc 0.254 0.302 0.244
+cgctg 0.352 0.287 0.415
+cgctt 0.254 0.193 0.184
+cggaa 0.286 0.24 0.177
+cggac 0.119 0.264 0.267
+cggag 0.476 0.296 0.421
+cggat 0.119 0.2 0.135
+cggca 0.206 0.238 0.175
+cggcc 0.139 0.125 0.25
+cggcg 0.228 0.315 0.362
+cggct 0.428 0.321 0.212
+cggga 0.122 0.264 0.204
+cgggc 0.354 0.132 0.254
+cgggg 0.335 0.328 0.303
+cgggt 0.189 0.276 0.239
+cggta 0.162 0.171 0.186
+cggtc 0.189 0.197 0.197
+cggtg 0.48 0.402 0.464
+cggtt 0.169 0.231 0.153
+cgtaa 0.293 0.308 0.171
+cgtac 0.207 0.167 0.462
+cgtag 0.319 0.233 0.171
+cgtat 0.181 0.292 0.197
+cgtca 0.166 0.224 0.221
+cgtcc 0.278 0.289 0.16
+cgtcg 0.139 0.224 0.359
+cgtct 0.417 0.263 0.26
+cgtga 0.256 0.232 0.112
+cgtgc 0.154 0.237 0.202
+cgtgg 0.35 0.188 0.191
+cgtgt 0.241 0.343 0.494
+cgtta 0.224 0.195 0.185
+cgttc 0.303 0.169 0.323
+cgttg 0.211 0.356 0.194
+cgttt 0.263 0.28 0.298
+ctaaa 0.25 0.213 0.327
+ctaac 0.25 0.266 0.245
+ctaag 0.25 0.309 0.236
+ctaat 0.25 0.213 0.191
+ctaca 0.22 0.267 0.253
+ctacc 0.277 0.208 0.202
+ctacg 0.34 0.333 0.202
+ctact 0.164 0.192 0.343
+ctaga 0.25 0.299 0.311
+ctagc 0.25 0.187 0.252
+ctagg 0.25 0.252 0.194
+ctagt 0.25 0.262 0.243
+ctata 0.296 0.195 0.236
+ctatc 0.204 0.227 0.276
+ctatg 0.278 0.25 0.283
+ctatt 0.222 0.328 0.205
+ctcaa 0.235 0.21 0.212
+ctcac 0.269 0.322 0.397
+ctcag 0.244 0.21 0.199
+ctcat 0.252 0.259 0.192
+ctcca 0.178 0.259 0.189
+ctccc 0.224 0.209 0.405
+ctccg 0.236 0.245 0.178
+ctcct 0.362 0.288 0.227
+ctcga 0.258 0.294 0.283
+ctcgc 0.412 0.25 0.204
+ctcgg 0.186 0.3 0.248
+ctcgt 0.144 0.156 0.265
+ctcta 0.155 0.146 0.187
+ctctc 0.333 0.226 0.291
+ctctg 0.318 0.238 0.351
+ctctt 0.194 0.39 0.172
+ctgaa 0.25 0.308 0.189
+ctgac 0.25 0.249 0.297
+ctgag 0.25 0.278 0.291
+ctgat 0.25 0.166 0.223
+ctgca 0.243 0.262 0.2
+ctgcc 0.189 0.164 0.321
+ctgcg 0.266 0.421 0.267
+ctgct 0.302 0.154 0.212
+ctgga 0.24 0.309 0.234
+ctggc 0.226 0.286 0.197
+ctggg 0.295 0.223 0.212
+ctggt 0.24 0.182 0.358
+ctgta 0.204 0.222 0.126
+ctgtc 0.252 0.265 0.231
+ctgtg 0.385 0.276 0.377
+ctgtt 0.159 0.238 0.266
+cttaa 0.243 0.263 0.22
+cttac 0.204 0.288 0.297
+cttag 0.243 0.212 0.22
+cttat 0.311 0.237 0.264
+cttca 0.268 0.276 0.208
+cttcc 0.183 0.228 0.34
+cttcg 0.301 0.22 0.198
+cttct 0.248 0.276 0.255
+cttga 0.134 0.204 0.137
+cttgc 0.248 0.211 0.212
+cttgg 0.318 0.204 0.247
+cttgt 0.299 0.38 0.404
+cttta 0.218 0.191 0.18
+ctttc 0.226 0.174 0.18
+ctttg 0.406 0.322 0.414
+ctttt 0.15 0.313 0.225
+gaaaa 0.27 0.213 0.198
+gaaac 0.311 0.287 0.257
+gaaag 0.246 0.185 0.317
+gaaat 0.172 0.315 0.228
+gaaca 0.232 0.311 0.239
+gaacc 0.286 0.189 0.291
+gaacg 0.268 0.258 0.214
+gaact 0.214 0.242 0.256
+gaaga 0.288 0.257 0.316
+gaagc 0.218 0.267 0.222
+gaagg 0.324 0.208 0.282
+gaagt 0.171 0.267 0.179
+gaata 0.318 0.236 0.214
+gaatc 0.182 0.225 0.277
+gaatg 0.309 0.225 0.214
+gaatt 0.191 0.315 0.295
+gacaa 0.187 0.261 0.152
+gacac 0.351 0.309 0.356
+gacag 0.179 0.182 0.28
+gacat 0.284 0.248 0.212
+gacca 0.376 0.25 0.234
+gaccc 0.2 0.185 0.27
+gaccg 0.216 0.25 0.27
+gacct 0.208 0.315 0.225
+gacga 0.286 0.375 0.126
+gacgc 0.224 0.256 0.371
+gacgg 0.348 0.149 0.252
+gacgt 0.143 0.22 0.252
+gacta 0.164 0.197 0.195
+gactc 0.27 0.272 0.336
+gactg 0.295 0.197 0.265
+gactt 0.27 0.333 0.204
+gagaa 0.168 0.294 0.183
+gagac 0.255 0.322 0.31
+gagag 0.358 0.239 0.352
+gagat 0.219 0.144 0.155
+gagca 0.208 0.253 0.284
+gagcc 0.268 0.312 0.277
+gagcg 0.235 0.14 0.236
+gagct 0.289 0.296 0.203
+gagga 0.24 0.271 0.354
+gaggc 0.326 0.243 0.238
+gaggg 0.271 0.267 0.218
+gaggt 0.163 0.219 0.19
+gagta 0.236 0.245 0.255
+gagtc 0.255 0.34 0.226
+gagtg 0.226 0.211 0.264
+gagtt 0.283 0.204 0.255
+gataa 0.224 0.216 0.22
+gatac 0.271 0.196 0.286
+gatag 0.318 0.265 0.22
+gatat 0.187 0.324 0.275
+gatca 0.242 0.355 0.193
+gatcc 0.275 0.322 0.307
+gatcg 0.255 0.158 0.325
+gatct 0.229 0.164 0.175
+gatga 0.211 0.247 0.175
+gatgc 0.336 0.233 0.298
+gatgg 0.322 0.363 0.211
+gatgt 0.132 0.158 0.316
+gatta 0.319 0.208 0.254
+gattc 0.177 0.229 0.238
+gattg 0.221 0.344 0.221
+gattt 0.283 0.219 0.287
+gcaaa 0.25 0.172 0.235
+gcaac 0.24 0.293 0.184
+gcaag 0.26 0.276 0.368
+gcaat 0.25 0.259 0.213
+gcaca 0.282 0.222 0.258
+gcacc 0.215 0.203 0.159
+gcacg 0.238 0.354 0.358
+gcact 0.265 0.222 0.225
+gcaga 0.287 0.346 0.182
+gcagc 0.366 0.257 0.356
+gcagg 0.231 0.221 0.167
+gcagt 0.116 0.176 0.295
+gcata 0.153 0.212 0.178
+gcatc 0.267 0.288 0.309
+gcatg 0.336 0.314 0.309
+gcatt 0.244 0.186 0.204
+gccaa 0.254 0.239 0.203
+gccac 0.315 0.231 0.268
+gccag 0.246 0.224 0.268
+gccat 0.185 0.306 0.261
+gccca 0.175 0.257 0.275
+gcccc 0.185 0.345 0.281
+gcccg 0.381 0.193 0.268
+gccct 0.259 0.205 0.176
+gccga 0.201 0.179 0.229
+gccgc 0.331 0.342 0.447
+gccgg 0.201 0.179 0.165
+gccgt 0.266 0.299 0.159
+gccta 0.226 0.153 0.178
+gcctc 0.29 0.381 0.22
+gcctg 0.21 0.282 0.487
+gcctt 0.274 0.183 0.115
+gcgaa 0.317 0.185 0.167
+gcgac 0.2 0.243 0.212
+gcgag 0.242 0.254 0.399
+gcgat 0.242 0.318 0.222
+gcgca 0.107 0.196 0.18
+gcgcc 0.286 0.185 0.361
+gcgcg 0.416 0.336 0.332
+gcgct 0.191 0.283 0.127
+gcgga 0.203 0.341 0.246
+gcggc 0.26 0.378 0.383
+gcggg 0.384 0.116 0.24
+gcggt 0.153 0.165 0.131
+gcgta 0.156 0.132 0.152
+gcgtc 0.291 0.391 0.228
+gcgtg 0.34 0.325 0.396
+gcgtt 0.213 0.152 0.223
+gctaa 0.174 0.202 0.156
+gctac 0.235 0.253 0.406
+gctag 0.217 0.232 0.156
+gctat 0.374 0.313 0.281
+gctca 0.203 0.207 0.163
+gctcc 0.291 0.409 0.344
+gctcg 0.314 0.171 0.33
+gctct 0.192 0.213 0.163
+gctga 0.269 0.219 0.109
+gctgc 0.304 0.325 0.372
+gctgg 0.215 0.138 0.284
+gctgt 0.212 0.319 0.235
+gctta 0.185 0.208 0.153
+gcttc 0.241 0.352 0.339
+gcttg 0.296 0.272 0.317
+gcttt 0.278 0.168 0.19
+ggaaa 0.222 0.295 0.204
+ggaac 0.289 0.209 0.204
+ggaag 0.267 0.279 0.371
+ggaat 0.222 0.217 0.222
+ggaca 0.203 0.229 0.24
+ggacc 0.208 0.276 0.269
+ggacg 0.307 0.276 0.354
+ggact 0.282 0.219 0.137
+ggaga 0.245 0.186 0.257
+ggagc 0.185 0.332 0.292
+ggagg 0.395 0.347 0.316
+ggagt 0.175 0.136 0.135
+ggata 0.169 0.189 0.194
+ggatc 0.287 0.292 0.299
+ggatg 0.397 0.236 0.336
+ggatt 0.147 0.283 0.172
+ggcaa 0.214 0.285 0.103
+ggcac 0.26 0.168 0.179
+ggcag 0.299 0.307 0.549
+ggcat 0.227 0.241 0.169
+ggcca 0.158 0.156 0.166
+ggccc 0.346 0.179 0.252
+ggccg 0.254 0.329 0.399
+ggcct 0.241 0.335 0.184
+ggcga 0.167 0.234 0.112
+ggcgc 0.346 0.193 0.403
+ggcgg 0.265 0.275 0.314
+ggcgt 0.222 0.298 0.171
+ggcta 0.141 0.218 0.157
+ggctc 0.254 0.302 0.244
+ggctg 0.352 0.287 0.415
+ggctt 0.254 0.193 0.184
+gggaa 0.286 0.24 0.177
+gggac 0.119 0.264 0.267
+gggag 0.476 0.296 0.421
+gggat 0.119 0.2 0.135
+gggca 0.206 0.238 0.175
+gggcc 0.139 0.125 0.25
+gggcg 0.228 0.315 0.362
+gggct 0.428 0.321 0.212
+gggga 0.122 0.264 0.204
+ggggc 0.354 0.132 0.254
+ggggg 0.335 0.328 0.303
+ggggt 0.189 0.276 0.239
+gggta 0.162 0.171 0.186
+gggtc 0.189 0.197 0.197
+gggtg 0.48 0.402 0.464
+gggtt 0.169 0.231 0.153
+ggtaa 0.293 0.308 0.171
+ggtac 0.207 0.167 0.462
+ggtag 0.319 0.233 0.171
+ggtat 0.181 0.292 0.197
+ggtca 0.166 0.224 0.221
+ggtcc 0.278 0.289 0.16
+ggtcg 0.139 0.224 0.359
+ggtct 0.417 0.263 0.26
+ggtga 0.256 0.232 0.112
+ggtgc 0.154 0.237 0.202
+ggtgg 0.35 0.188 0.191
+ggtgt 0.241 0.343 0.494
+ggtta 0.224 0.195 0.185
+ggttc 0.303 0.169 0.323
+ggttg 0.211 0.356 0.194
+ggttt 0.263 0.28 0.298
+gtaaa 0.25 0.213 0.327
+gtaac 0.25 0.266 0.245
+gtaag 0.25 0.309 0.236
+gtaat 0.25 0.213 0.191
+gtaca 0.22 0.267 0.253
+gtacc 0.277 0.208 0.202
+gtacg 0.34 0.333 0.202
+gtact 0.164 0.192 0.343
+gtaga 0.25 0.299 0.311
+gtagc 0.25 0.187 0.252
+gtagg 0.25 0.252 0.194
+gtagt 0.25 0.262 0.243
+gtata 0.296 0.195 0.236
+gtatc 0.204 0.227 0.276
+gtatg 0.278 0.25 0.283
+gtatt 0.222 0.328 0.205
+gtcaa 0.235 0.21 0.212
+gtcac 0.269 0.322 0.397
+gtcag 0.244 0.21 0.199
+gtcat 0.252 0.259 0.192
+gtcca 0.178 0.259 0.189
+gtccc 0.224 0.209 0.405
+gtccg 0.236 0.245 0.178
+gtcct 0.362 0.288 0.227
+gtcga 0.258 0.294 0.283
+gtcgc 0.412 0.25 0.204
+gtcgg 0.186 0.3 0.248
+gtcgt 0.144 0.156 0.265
+gtcta 0.155 0.146 0.187
+gtctc 0.333 0.226 0.291
+gtctg 0.318 0.238 0.351
+gtctt 0.194 0.39 0.172
+gtgaa 0.25 0.308 0.189
+gtgac 0.25 0.249 0.297
+gtgag 0.25 0.278 0.291
+gtgat 0.25 0.166 0.223
+gtgca 0.243 0.262 0.2
+gtgcc 0.189 0.164 0.321
+gtgcg 0.266 0.421 0.267
+gtgct 0.302 0.154 0.212
+gtgga 0.24 0.309 0.234
+gtggc 0.226 0.286 0.197
+gtggg 0.295 0.223 0.212
+gtggt 0.24 0.182 0.358
+gtgta 0.204 0.222 0.126
+gtgtc 0.252 0.265 0.231
+gtgtg 0.385 0.276 0.377
+gtgtt 0.159 0.238 0.266
+gttaa 0.243 0.263 0.22
+gttac 0.204 0.288 0.297
+gttag 0.243 0.212 0.22
+gttat 0.311 0.237 0.264
+gttca 0.268 0.276 0.208
+gttcc 0.183 0.228 0.34
+gttcg 0.301 0.22 0.198
+gttct 0.248 0.276 0.255
+gttga 0.134 0.204 0.137
+gttgc 0.248 0.211 0.212
+gttgg 0.318 0.204 0.247
+gttgt 0.299 0.38 0.404
+gttta 0.218 0.191 0.18
+gtttc 0.226 0.174 0.18
+gtttg 0.406 0.322 0.414
+gtttt 0.15 0.313 0.225
+taaaa 0.27 0.213 0.198
+taaac 0.311 0.287 0.257
+taaag 0.246 0.185 0.317
+taaat 0.172 0.315 0.228
+taaca 0.232 0.311 0.239
+taacc 0.286 0.189 0.291
+taacg 0.268 0.258 0.214
+taact 0.214 0.242 0.256
+taaga 0.288 0.257 0.316
+taagc 0.218 0.267 0.222
+taagg 0.324 0.208 0.282
+taagt 0.171 0.267 0.179
+taata 0.318 0.236 0.214
+taatc 0.182 0.225 0.277
+taatg 0.309 0.225 0.214
+taatt 0.191 0.315 0.295
+tacaa 0.187 0.261 0.152
+tacac 0.351 0.309 0.356
+tacag 0.179 0.182 0.28
+tacat 0.284 0.248 0.212
+tacca 0.376 0.25 0.234
+taccc 0.2 0.185 0.27
+taccg 0.216 0.25 0.27
+tacct 0.208 0.315 0.225
+tacga 0.286 0.375 0.126
+tacgc 0.224 0.256 0.371
+tacgg 0.348 0.149 0.252
+tacgt 0.143 0.22 0.252
+tacta 0.164 0.197 0.195
+tactc 0.27 0.272 0.336
+tactg 0.295 0.197 0.265
+tactt 0.27 0.333 0.204
+tagaa 0.168 0.294 0.183
+tagac 0.255 0.322 0.31
+tagag 0.358 0.239 0.352
+tagat 0.219 0.144 0.155
+tagca 0.208 0.253 0.284
+tagcc 0.268 0.312 0.277
+tagcg 0.235 0.14 0.236
+tagct 0.289 0.296 0.203
+tagga 0.24 0.271 0.354
+taggc 0.326 0.243 0.238
+taggg 0.271 0.267 0.218
+taggt 0.163 0.219 0.19
+tagta 0.236 0.245 0.255
+tagtc 0.255 0.34 0.226
+tagtg 0.226 0.211 0.264
+tagtt 0.283 0.204 0.255
+tataa 0.224 0.216 0.22
+tatac 0.271 0.196 0.286
+tatag 0.318 0.265 0.22
+tatat 0.187 0.324 0.275
+tatca 0.242 0.355 0.193
+tatcc 0.275 0.322 0.307
+tatcg 0.255 0.158 0.325
+tatct 0.229 0.164 0.175
+tatga 0.211 0.247 0.175
+tatgc 0.336 0.233 0.298
+tatgg 0.322 0.363 0.211
+tatgt 0.132 0.158 0.316
+tatta 0.319 0.208 0.254
+tattc 0.177 0.229 0.238
+tattg 0.221 0.344 0.221
+tattt 0.283 0.219 0.287
+tcaaa 0.25 0.172 0.235
+tcaac 0.24 0.293 0.184
+tcaag 0.26 0.276 0.368
+tcaat 0.25 0.259 0.213
+tcaca 0.282 0.222 0.258
+tcacc 0.215 0.203 0.159
+tcacg 0.238 0.354 0.358
+tcact 0.265 0.222 0.225
+tcaga 0.287 0.346 0.182
+tcagc 0.366 0.257 0.356
+tcagg 0.231 0.221 0.167
+tcagt 0.116 0.176 0.295
+tcata 0.153 0.212 0.178
+tcatc 0.267 0.288 0.309
+tcatg 0.336 0.314 0.309
+tcatt 0.244 0.186 0.204
+tccaa 0.254 0.239 0.203
+tccac 0.315 0.231 0.268
+tccag 0.246 0.224 0.268
+tccat 0.185 0.306 0.261
+tccca 0.175 0.257 0.275
+tcccc 0.185 0.345 0.281
+tcccg 0.381 0.193 0.268
+tccct 0.259 0.205 0.176
+tccga 0.201 0.179 0.229
+tccgc 0.331 0.342 0.447
+tccgg 0.201 0.179 0.165
+tccgt 0.266 0.299 0.159
+tccta 0.226 0.153 0.178
+tcctc 0.29 0.381 0.22
+tcctg 0.21 0.282 0.487
+tcctt 0.274 0.183 0.115
+tcgaa 0.317 0.185 0.167
+tcgac 0.2 0.243 0.212
+tcgag 0.242 0.254 0.399
+tcgat 0.242 0.318 0.222
+tcgca 0.107 0.196 0.18
+tcgcc 0.286 0.185 0.361
+tcgcg 0.416 0.336 0.332
+tcgct 0.191 0.283 0.127
+tcgga 0.203 0.341 0.246
+tcggc 0.26 0.378 0.383
+tcggg 0.384 0.116 0.24
+tcggt 0.153 0.165 0.131
+tcgta 0.156 0.132 0.152
+tcgtc 0.291 0.391 0.228
+tcgtg 0.34 0.325 0.396
+tcgtt 0.213 0.152 0.223
+tctaa 0.174 0.202 0.156
+tctac 0.235 0.253 0.406
+tctag 0.217 0.232 0.156
+tctat 0.374 0.313 0.281
+tctca 0.203 0.207 0.163
+tctcc 0.291 0.409 0.344
+tctcg 0.314 0.171 0.33
+tctct 0.192 0.213 0.163
+tctga 0.269 0.219 0.109
+tctgc 0.304 0.325 0.372
+tctgg 0.215 0.138 0.284
+tctgt 0.212 0.319 0.235
+tctta 0.185 0.208 0.153
+tcttc 0.241 0.352 0.339
+tcttg 0.296 0.272 0.317
+tcttt 0.278 0.168 0.19
+tgaaa 0.222 0.295 0.204
+tgaac 0.289 0.209 0.204
+tgaag 0.267 0.279 0.371
+tgaat 0.222 0.217 0.222
+tgaca 0.203 0.229 0.24
+tgacc 0.208 0.276 0.269
+tgacg 0.307 0.276 0.354
+tgact 0.282 0.219 0.137
+tgaga 0.245 0.186 0.257
+tgagc 0.185 0.332 0.292
+tgagg 0.395 0.347 0.316
+tgagt 0.175 0.136 0.135
+tgata 0.169 0.189 0.194
+tgatc 0.287 0.292 0.299
+tgatg 0.397 0.236 0.336
+tgatt 0.147 0.283 0.172
+tgcaa 0.214 0.285 0.103
+tgcac 0.26 0.168 0.179
+tgcag 0.299 0.307 0.549
+tgcat 0.227 0.241 0.169
+tgcca 0.158 0.156 0.166
+tgccc 0.346 0.179 0.252
+tgccg 0.254 0.329 0.399
+tgcct 0.241 0.335 0.184
+tgcga 0.167 0.234 0.112
+tgcgc 0.346 0.193 0.403
+tgcgg 0.265 0.275 0.314
+tgcgt 0.222 0.298 0.171
+tgcta 0.141 0.218 0.157
+tgctc 0.254 0.302 0.244
+tgctg 0.352 0.287 0.415
+tgctt 0.254 0.193 0.184
+tggaa 0.286 0.24 0.177
+tggac 0.119 0.264 0.267
+tggag 0.476 0.296 0.421
+tggat 0.119 0.2 0.135
+tggca 0.206 0.238 0.175
+tggcc 0.139 0.125 0.25
+tggcg 0.228 0.315 0.362
+tggct 0.428 0.321 0.212
+tggga 0.122 0.264 0.204
+tgggc 0.354 0.132 0.254
+tgggg 0.335 0.328 0.303
+tgggt 0.189 0.276 0.239
+tggta 0.162 0.171 0.186
+tggtc 0.189 0.197 0.197
+tggtg 0.48 0.402 0.464
+tggtt 0.169 0.231 0.153
+tgtaa 0.293 0.308 0.171
+tgtac 0.207 0.167 0.462
+tgtag 0.319 0.233 0.171
+tgtat 0.181 0.292 0.197
+tgtca 0.166 0.224 0.221
+tgtcc 0.278 0.289 0.16
+tgtcg 0.139 0.224 0.359
+tgtct 0.417 0.263 0.26
+tgtga 0.256 0.232 0.112
+tgtgc 0.154 0.237 0.202
+tgtgg 0.35 0.188 0.191
+tgtgt 0.241 0.343 0.494
+tgtta 0.224 0.195 0.185
+tgttc 0.303 0.169 0.323
+tgttg 0.211 0.356 0.194
+tgttt 0.263 0.28 0.298
+ttaaa 0.25 0.213 0.327
+ttaac 0.25 0.266 0.245
+ttaag 0.25 0.309 0.236
+ttaat 0.25 0.213 0.191
+ttaca 0.22 0.267 0.253
+ttacc 0.277 0.208 0.202
+ttacg 0.34 0.333 0.202
+ttact 0.164 0.192 0.343
+ttaga 0.25 0.299 0.311
+ttagc 0.25 0.187 0.252
+ttagg 0.25 0.252 0.194
+ttagt 0.25 0.262 0.243
+ttata 0.296 0.195 0.236
+ttatc 0.204 0.227 0.276
+ttatg 0.278 0.25 0.283
+ttatt 0.222 0.328 0.205
+ttcaa 0.235 0.21 0.212
+ttcac 0.269 0.322 0.397
+ttcag 0.244 0.21 0.199
+ttcat 0.252 0.259 0.192
+ttcca 0.178 0.259 0.189
+ttccc 0.224 0.209 0.405
+ttccg 0.236 0.245 0.178
+ttcct 0.362 0.288 0.227
+ttcga 0.258 0.294 0.283
+ttcgc 0.412 0.25 0.204
+ttcgg 0.186 0.3 0.248
+ttcgt 0.144 0.156 0.265
+ttcta 0.155 0.146 0.187
+ttctc 0.333 0.226 0.291
+ttctg 0.318 0.238 0.351
+ttctt 0.194 0.39 0.172
+ttgaa 0.25 0.308 0.189
+ttgac 0.25 0.249 0.297
+ttgag 0.25 0.278 0.291
+ttgat 0.25 0.166 0.223
+ttgca 0.243 0.262 0.2
+ttgcc 0.189 0.164 0.321
+ttgcg 0.266 0.421 0.267
+ttgct 0.302 0.154 0.212
+ttgga 0.24 0.309 0.234
+ttggc 0.226 0.286 0.197
+ttggg 0.295 0.223 0.212
+ttggt 0.24 0.182 0.358
+ttgta 0.204 0.222 0.126
+ttgtc 0.252 0.265 0.231
+ttgtg 0.385 0.276 0.377
+ttgtt 0.159 0.238 0.266
+tttaa 0.243 0.263 0.22
+tttac 0.204 0.288 0.297
+tttag 0.243 0.212 0.22
+tttat 0.311 0.237 0.264
+tttca 0.268 0.276 0.208
+tttcc 0.183 0.228 0.34
+tttcg 0.301 0.22 0.198
+tttct 0.248 0.276 0.255
+tttga 0.134 0.204 0.137
+tttgc 0.248 0.211 0.212
+tttgg 0.318 0.204 0.247
+tttgt 0.299 0.38 0.404
+tttta 0.218 0.191 0.18
+ttttc 0.226 0.174 0.18
+ttttg 0.406 0.322 0.414
+ttttt 0.15 0.313 0.225
+
+
+#
+# Internal exon terminal emission probabilities
+#
+[ETEMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.25 0.25 0.25
+aaaac 0.25 0.25 0.25
+aaaag 0.25 0.25 0.25
+aaaat 0.25 0.25 0.25
+aaaca 0.25 0.25 0.25
+aaacc 0.25 0.25 0.25
+aaacg 0.25 0.25 0.25
+aaact 0.25 0.25 0.25
+aaaga 0.25 0.25 0.25
+aaagc 0.25 0.25 0.25
+aaagg 0.25 0.25 0.25
+aaagt 0.25 0.25 0.25
+aaata 0.25 0.25 0.25
+aaatc 0.25 0.25 0.25
+aaatg 0.25 0.25 0.25
+aaatt 0.25 0.25 0.25
+aacaa 0.25 0.25 0.25
+aacac 0.25 0.25 0.25
+aacag 0.25 0.25 0.25
+aacat 0.25 0.25 0.25
+aacca 0.25 0.25 0.25
+aaccc 0.25 0.25 0.25
+aaccg 0.25 0.25 0.25
+aacct 0.25 0.25 0.25
+aacga 0.25 0.25 0.25
+aacgc 0.25 0.25 0.25
+aacgg 0.25 0.25 0.25
+aacgt 0.25 0.25 0.25
+aacta 0.25 0.25 0.25
+aactc 0.25 0.25 0.25
+aactg 0.25 0.25 0.25
+aactt 0.25 0.25 0.25
+aagaa 0.25 0.25 0.25
+aagac 0.25 0.25 0.25
+aagag 0.25 0.25 0.25
+aagat 0.25 0.25 0.25
+aagca 0.25 0.25 0.25
+aagcc 0.25 0.25 0.25
+aagcg 0.25 0.25 0.25
+aagct 0.25 0.25 0.25
+aagga 0.25 0.25 0.25
+aaggc 0.25 0.25 0.25
+aaggg 0.25 0.25 0.25
+aaggt 0.25 0.25 0.25
+aagta 0.25 0.25 0.25
+aagtc 0.25 0.25 0.25
+aagtg 0.25 0.25 0.25
+aagtt 0.25 0.25 0.25
+aataa 0.25 0.25 0.25
+aatac 0.25 0.25 0.25
+aatag 0.25 0.25 0.25
+aatat 0.25 0.25 0.25
+aatca 0.25 0.25 0.25
+aatcc 0.25 0.25 0.25
+aatcg 0.25 0.25 0.25
+aatct 0.25 0.25 0.25
+aatga 0.25 0.25 0.25
+aatgc 0.25 0.25 0.25
+aatgg 0.25 0.25 0.25
+aatgt 0.25 0.25 0.25
+aatta 0.25 0.25 0.25
+aattc 0.25 0.25 0.25
+aattg 0.25 0.25 0.25
+aattt 0.25 0.25 0.25
+acaaa 0.25 0.25 0.25
+acaac 0.25 0.25 0.25
+acaag 0.25 0.25 0.25
+acaat 0.25 0.25 0.25
+acaca 0.25 0.25 0.25
+acacc 0.25 0.25 0.25
+acacg 0.25 0.25 0.25
+acact 0.25 0.25 0.25
+acaga 0.25 0.25 0.25
+acagc 0.25 0.25 0.25
+acagg 0.25 0.25 0.25
+acagt 0.25 0.25 0.25
+acata 0.25 0.25 0.25
+acatc 0.25 0.25 0.25
+acatg 0.25 0.25 0.25
+acatt 0.25 0.25 0.25
+accaa 0.25 0.25 0.25
+accac 0.25 0.25 0.25
+accag 0.25 0.25 0.25
+accat 0.25 0.25 0.25
+accca 0.25 0.25 0.25
+acccc 0.25 0.25 0.25
+acccg 0.25 0.25 0.25
+accct 0.25 0.25 0.25
+accga 0.25 0.25 0.25
+accgc 0.25 0.25 0.25
+accgg 0.25 0.25 0.25
+accgt 0.25 0.25 0.25
+accta 0.25 0.25 0.25
+acctc 0.25 0.25 0.25
+acctg 0.25 0.25 0.25
+acctt 0.25 0.25 0.25
+acgaa 0.25 0.25 0.25
+acgac 0.25 0.25 0.25
+acgag 0.25 0.25 0.25
+acgat 0.25 0.25 0.25
+acgca 0.25 0.25 0.25
+acgcc 0.25 0.25 0.25
+acgcg 0.25 0.25 0.25
+acgct 0.25 0.25 0.25
+acgga 0.25 0.25 0.25
+acggc 0.25 0.25 0.25
+acggg 0.25 0.25 0.25
+acggt 0.25 0.25 0.25
+acgta 0.25 0.25 0.25
+acgtc 0.25 0.25 0.25
+acgtg 0.25 0.25 0.25
+acgtt 0.25 0.25 0.25
+actaa 0.25 0.25 0.25
+actac 0.25 0.25 0.25
+actag 0.25 0.25 0.25
+actat 0.25 0.25 0.25
+actca 0.25 0.25 0.25
+actcc 0.25 0.25 0.25
+actcg 0.25 0.25 0.25
+actct 0.25 0.25 0.25
+actga 0.25 0.25 0.25
+actgc 0.25 0.25 0.25
+actgg 0.25 0.25 0.25
+actgt 0.25 0.25 0.25
+actta 0.25 0.25 0.25
+acttc 0.25 0.25 0.25
+acttg 0.25 0.25 0.25
+acttt 0.25 0.25 0.25
+agaaa 0.25 0.25 0.25
+agaac 0.25 0.25 0.25
+agaag 0.25 0.25 0.25
+agaat 0.25 0.25 0.25
+agaca 0.25 0.25 0.25
+agacc 0.25 0.25 0.25
+agacg 0.25 0.25 0.25
+agact 0.25 0.25 0.25
+agaga 0.25 0.25 0.25
+agagc 0.25 0.25 0.25
+agagg 0.25 0.25 0.25
+agagt 0.25 0.25 0.25
+agata 0.25 0.25 0.25
+agatc 0.25 0.25 0.25
+agatg 0.25 0.25 0.25
+agatt 0.25 0.25 0.25
+agcaa 0.25 0.25 0.25
+agcac 0.25 0.25 0.25
+agcag 0.25 0.25 0.25
+agcat 0.25 0.25 0.25
+agcca 0.25 0.25 0.25
+agccc 0.25 0.25 0.25
+agccg 0.25 0.25 0.25
+agcct 0.25 0.25 0.25
+agcga 0.25 0.25 0.25
+agcgc 0.25 0.25 0.25
+agcgg 0.25 0.25 0.25
+agcgt 0.25 0.25 0.25
+agcta 0.25 0.25 0.25
+agctc 0.25 0.25 0.25
+agctg 0.25 0.25 0.25
+agctt 0.25 0.25 0.25
+aggaa 0.25 0.25 0.25
+aggac 0.25 0.25 0.25
+aggag 0.25 0.25 0.25
+aggat 0.25 0.25 0.25
+aggca 0.25 0.25 0.25
+aggcc 0.25 0.25 0.25
+aggcg 0.25 0.25 0.25
+aggct 0.25 0.25 0.25
+aggga 0.25 0.25 0.25
+agggc 0.25 0.25 0.25
+agggg 0.25 0.25 0.25
+agggt 0.25 0.25 0.25
+aggta 0.25 0.25 0.25
+aggtc 0.25 0.25 0.25
+aggtg 0.25 0.25 0.25
+aggtt 0.25 0.25 0.25
+agtaa 0.25 0.25 0.25
+agtac 0.25 0.25 0.25
+agtag 0.25 0.25 0.25
+agtat 0.25 0.25 0.25
+agtca 0.25 0.25 0.25
+agtcc 0.25 0.25 0.25
+agtcg 0.25 0.25 0.25
+agtct 0.25 0.25 0.25
+agtga 0.25 0.25 0.25
+agtgc 0.25 0.25 0.25
+agtgg 0.25 0.25 0.25
+agtgt 0.25 0.25 0.25
+agtta 0.25 0.25 0.25
+agttc 0.25 0.25 0.25
+agttg 0.25 0.25 0.25
+agttt 0.25 0.25 0.25
+ataaa 0.25 0.25 0.25
+ataac 0.25 0.25 0.25
+ataag 0.25 0.25 0.25
+ataat 0.25 0.25 0.25
+ataca 0.25 0.25 0.25
+atacc 0.25 0.25 0.25
+atacg 0.25 0.25 0.25
+atact 0.25 0.25 0.25
+ataga 0.25 0.25 0.25
+atagc 0.25 0.25 0.25
+atagg 0.25 0.25 0.25
+atagt 0.25 0.25 0.25
+atata 0.25 0.25 0.25
+atatc 0.25 0.25 0.25
+atatg 0.25 0.25 0.25
+atatt 0.25 0.25 0.25
+atcaa 0.25 0.25 0.25
+atcac 0.25 0.25 0.25
+atcag 0.25 0.25 0.25
+atcat 0.25 0.25 0.25
+atcca 0.25 0.25 0.25
+atccc 0.25 0.25 0.25
+atccg 0.25 0.25 0.25
+atcct 0.25 0.25 0.25
+atcga 0.25 0.25 0.25
+atcgc 0.25 0.25 0.25
+atcgg 0.25 0.25 0.25
+atcgt 0.25 0.25 0.25
+atcta 0.25 0.25 0.25
+atctc 0.25 0.25 0.25
+atctg 0.25 0.25 0.25
+atctt 0.25 0.25 0.25
+atgaa 0.25 0.25 0.25
+atgac 0.25 0.25 0.25
+atgag 0.25 0.25 0.25
+atgat 0.25 0.25 0.25
+atgca 0.25 0.25 0.25
+atgcc 0.25 0.25 0.25
+atgcg 0.25 0.25 0.25
+atgct 0.25 0.25 0.25
+atgga 0.25 0.25 0.25
+atggc 0.25 0.25 0.25
+atggg 0.25 0.25 0.25
+atggt 0.25 0.25 0.25
+atgta 0.25 0.25 0.25
+atgtc 0.25 0.25 0.25
+atgtg 0.25 0.25 0.25
+atgtt 0.25 0.25 0.25
+attaa 0.25 0.25 0.25
+attac 0.25 0.25 0.25
+attag 0.25 0.25 0.25
+attat 0.25 0.25 0.25
+attca 0.25 0.25 0.25
+attcc 0.25 0.25 0.25
+attcg 0.25 0.25 0.25
+attct 0.25 0.25 0.25
+attga 0.25 0.25 0.25
+attgc 0.25 0.25 0.25
+attgg 0.25 0.25 0.25
+attgt 0.25 0.25 0.25
+attta 0.25 0.25 0.25
+atttc 0.25 0.25 0.25
+atttg 0.25 0.25 0.25
+atttt 0.25 0.25 0.25
+caaaa 0.25 0.25 0.25
+caaac 0.25 0.25 0.25
+caaag 0.25 0.25 0.25
+caaat 0.25 0.25 0.25
+caaca 0.25 0.25 0.25
+caacc 0.25 0.25 0.25
+caacg 0.25 0.25 0.25
+caact 0.25 0.25 0.25
+caaga 0.25 0.25 0.25
+caagc 0.25 0.25 0.25
+caagg 0.25 0.25 0.25
+caagt 0.25 0.25 0.25
+caata 0.25 0.25 0.25
+caatc 0.25 0.25 0.25
+caatg 0.25 0.25 0.25
+caatt 0.25 0.25 0.25
+cacaa 0.25 0.25 0.25
+cacac 0.25 0.25 0.25
+cacag 0.25 0.25 0.25
+cacat 0.25 0.25 0.25
+cacca 0.25 0.25 0.25
+caccc 0.25 0.25 0.25
+caccg 0.25 0.25 0.25
+cacct 0.25 0.25 0.25
+cacga 0.25 0.25 0.25
+cacgc 0.25 0.25 0.25
+cacgg 0.25 0.25 0.25
+cacgt 0.25 0.25 0.25
+cacta 0.25 0.25 0.25
+cactc 0.25 0.25 0.25
+cactg 0.25 0.25 0.25
+cactt 0.25 0.25 0.25
+cagaa 0.25 0.25 0.25
+cagac 0.25 0.25 0.25
+cagag 0.25 0.25 0.25
+cagat 0.25 0.25 0.25
+cagca 0.25 0.25 0.25
+cagcc 0.25 0.25 0.25
+cagcg 0.25 0.25 0.25
+cagct 0.25 0.25 0.25
+cagga 0.25 0.25 0.25
+caggc 0.25 0.25 0.25
+caggg 0.25 0.25 0.25
+caggt 0.25 0.25 0.25
+cagta 0.25 0.25 0.25
+cagtc 0.25 0.25 0.25
+cagtg 0.25 0.25 0.25
+cagtt 0.25 0.25 0.25
+cataa 0.25 0.25 0.25
+catac 0.25 0.25 0.25
+catag 0.25 0.25 0.25
+catat 0.25 0.25 0.25
+catca 0.25 0.25 0.25
+catcc 0.25 0.25 0.25
+catcg 0.25 0.25 0.25
+catct 0.25 0.25 0.25
+catga 0.25 0.25 0.25
+catgc 0.25 0.25 0.25
+catgg 0.25 0.25 0.25
+catgt 0.25 0.25 0.25
+catta 0.25 0.25 0.25
+cattc 0.25 0.25 0.25
+cattg 0.25 0.25 0.25
+cattt 0.25 0.25 0.25
+ccaaa 0.25 0.25 0.25
+ccaac 0.25 0.25 0.25
+ccaag 0.25 0.25 0.25
+ccaat 0.25 0.25 0.25
+ccaca 0.25 0.25 0.25
+ccacc 0.25 0.25 0.25
+ccacg 0.25 0.25 0.25
+ccact 0.25 0.25 0.25
+ccaga 0.25 0.25 0.25
+ccagc 0.25 0.25 0.25
+ccagg 0.25 0.25 0.25
+ccagt 0.25 0.25 0.25
+ccata 0.25 0.25 0.25
+ccatc 0.25 0.25 0.25
+ccatg 0.25 0.25 0.25
+ccatt 0.25 0.25 0.25
+cccaa 0.25 0.25 0.25
+cccac 0.25 0.25 0.25
+cccag 0.25 0.25 0.25
+cccat 0.25 0.25 0.25
+cccca 0.25 0.25 0.25
+ccccc 0.25 0.25 0.25
+ccccg 0.25 0.25 0.25
+cccct 0.25 0.25 0.25
+cccga 0.25 0.25 0.25
+cccgc 0.25 0.25 0.25
+cccgg 0.25 0.25 0.25
+cccgt 0.25 0.25 0.25
+cccta 0.25 0.25 0.25
+ccctc 0.25 0.25 0.25
+ccctg 0.25 0.25 0.25
+ccctt 0.25 0.25 0.25
+ccgaa 0.25 0.25 0.25
+ccgac 0.25 0.25 0.25
+ccgag 0.25 0.25 0.25
+ccgat 0.25 0.25 0.25
+ccgca 0.25 0.25 0.25
+ccgcc 0.25 0.25 0.25
+ccgcg 0.25 0.25 0.25
+ccgct 0.25 0.25 0.25
+ccgga 0.25 0.25 0.25
+ccggc 0.25 0.25 0.25
+ccggg 0.25 0.25 0.25
+ccggt 0.25 0.25 0.25
+ccgta 0.25 0.25 0.25
+ccgtc 0.25 0.25 0.25
+ccgtg 0.25 0.25 0.25
+ccgtt 0.25 0.25 0.25
+cctaa 0.25 0.25 0.25
+cctac 0.25 0.25 0.25
+cctag 0.25 0.25 0.25
+cctat 0.25 0.25 0.25
+cctca 0.25 0.25 0.25
+cctcc 0.25 0.25 0.25
+cctcg 0.25 0.25 0.25
+cctct 0.25 0.25 0.25
+cctga 0.25 0.25 0.25
+cctgc 0.25 0.25 0.25
+cctgg 0.25 0.25 0.25
+cctgt 0.25 0.25 0.25
+cctta 0.25 0.25 0.25
+ccttc 0.25 0.25 0.25
+ccttg 0.25 0.25 0.25
+ccttt 0.25 0.25 0.25
+cgaaa 0.25 0.25 0.25
+cgaac 0.25 0.25 0.25
+cgaag 0.25 0.25 0.25
+cgaat 0.25 0.25 0.25
+cgaca 0.25 0.25 0.25
+cgacc 0.25 0.25 0.25
+cgacg 0.25 0.25 0.25
+cgact 0.25 0.25 0.25
+cgaga 0.25 0.25 0.25
+cgagc 0.25 0.25 0.25
+cgagg 0.25 0.25 0.25
+cgagt 0.25 0.25 0.25
+cgata 0.25 0.25 0.25
+cgatc 0.25 0.25 0.25
+cgatg 0.25 0.25 0.25
+cgatt 0.25 0.25 0.25
+cgcaa 0.25 0.25 0.25
+cgcac 0.25 0.25 0.25
+cgcag 0.25 0.25 0.25
+cgcat 0.25 0.25 0.25
+cgcca 0.25 0.25 0.25
+cgccc 0.25 0.25 0.25
+cgccg 0.25 0.25 0.25
+cgcct 0.25 0.25 0.25
+cgcga 0.25 0.25 0.25
+cgcgc 0.25 0.25 0.25
+cgcgg 0.25 0.25 0.25
+cgcgt 0.25 0.25 0.25
+cgcta 0.25 0.25 0.25
+cgctc 0.25 0.25 0.25
+cgctg 0.25 0.25 0.25
+cgctt 0.25 0.25 0.25
+cggaa 0.25 0.25 0.25
+cggac 0.25 0.25 0.25
+cggag 0.25 0.25 0.25
+cggat 0.25 0.25 0.25
+cggca 0.25 0.25 0.25
+cggcc 0.25 0.25 0.25
+cggcg 0.25 0.25 0.25
+cggct 0.25 0.25 0.25
+cggga 0.25 0.25 0.25
+cgggc 0.25 0.25 0.25
+cgggg 0.25 0.25 0.25
+cgggt 0.25 0.25 0.25
+cggta 0.25 0.25 0.25
+cggtc 0.25 0.25 0.25
+cggtg 0.25 0.25 0.25
+cggtt 0.25 0.25 0.25
+cgtaa 0.25 0.25 0.25
+cgtac 0.25 0.25 0.25
+cgtag 0.25 0.25 0.25
+cgtat 0.25 0.25 0.25
+cgtca 0.25 0.25 0.25
+cgtcc 0.25 0.25 0.25
+cgtcg 0.25 0.25 0.25
+cgtct 0.25 0.25 0.25
+cgtga 0.25 0.25 0.25
+cgtgc 0.25 0.25 0.25
+cgtgg 0.25 0.25 0.25
+cgtgt 0.25 0.25 0.25
+cgtta 0.25 0.25 0.25
+cgttc 0.25 0.25 0.25
+cgttg 0.25 0.25 0.25
+cgttt 0.25 0.25 0.25
+ctaaa 0.25 0.25 0.25
+ctaac 0.25 0.25 0.25
+ctaag 0.25 0.25 0.25
+ctaat 0.25 0.25 0.25
+ctaca 0.25 0.25 0.25
+ctacc 0.25 0.25 0.25
+ctacg 0.25 0.25 0.25
+ctact 0.25 0.25 0.25
+ctaga 0.25 0.25 0.25
+ctagc 0.25 0.25 0.25
+ctagg 0.25 0.25 0.25
+ctagt 0.25 0.25 0.25
+ctata 0.25 0.25 0.25
+ctatc 0.25 0.25 0.25
+ctatg 0.25 0.25 0.25
+ctatt 0.25 0.25 0.25
+ctcaa 0.25 0.25 0.25
+ctcac 0.25 0.25 0.25
+ctcag 0.25 0.25 0.25
+ctcat 0.25 0.25 0.25
+ctcca 0.25 0.25 0.25
+ctccc 0.25 0.25 0.25
+ctccg 0.25 0.25 0.25
+ctcct 0.25 0.25 0.25
+ctcga 0.25 0.25 0.25
+ctcgc 0.25 0.25 0.25
+ctcgg 0.25 0.25 0.25
+ctcgt 0.25 0.25 0.25
+ctcta 0.25 0.25 0.25
+ctctc 0.25 0.25 0.25
+ctctg 0.25 0.25 0.25
+ctctt 0.25 0.25 0.25
+ctgaa 0.25 0.25 0.25
+ctgac 0.25 0.25 0.25
+ctgag 0.25 0.25 0.25
+ctgat 0.25 0.25 0.25
+ctgca 0.25 0.25 0.25
+ctgcc 0.25 0.25 0.25
+ctgcg 0.25 0.25 0.25
+ctgct 0.25 0.25 0.25
+ctgga 0.25 0.25 0.25
+ctggc 0.25 0.25 0.25
+ctggg 0.25 0.25 0.25
+ctggt 0.25 0.25 0.25
+ctgta 0.25 0.25 0.25
+ctgtc 0.25 0.25 0.25
+ctgtg 0.25 0.25 0.25
+ctgtt 0.25 0.25 0.25
+cttaa 0.25 0.25 0.25
+cttac 0.25 0.25 0.25
+cttag 0.25 0.25 0.25
+cttat 0.25 0.25 0.25
+cttca 0.25 0.25 0.25
+cttcc 0.25 0.25 0.25
+cttcg 0.25 0.25 0.25
+cttct 0.25 0.25 0.25
+cttga 0.25 0.25 0.25
+cttgc 0.25 0.25 0.25
+cttgg 0.25 0.25 0.25
+cttgt 0.25 0.25 0.25
+cttta 0.25 0.25 0.25
+ctttc 0.25 0.25 0.25
+ctttg 0.25 0.25 0.25
+ctttt 0.25 0.25 0.25
+gaaaa 0.25 0.25 0.25
+gaaac 0.25 0.25 0.25
+gaaag 0.25 0.25 0.25
+gaaat 0.25 0.25 0.25
+gaaca 0.25 0.25 0.25
+gaacc 0.25 0.25 0.25
+gaacg 0.25 0.25 0.25
+gaact 0.25 0.25 0.25
+gaaga 0.25 0.25 0.25
+gaagc 0.25 0.25 0.25
+gaagg 0.25 0.25 0.25
+gaagt 0.25 0.25 0.25
+gaata 0.25 0.25 0.25
+gaatc 0.25 0.25 0.25
+gaatg 0.25 0.25 0.25
+gaatt 0.25 0.25 0.25
+gacaa 0.25 0.25 0.25
+gacac 0.25 0.25 0.25
+gacag 0.25 0.25 0.25
+gacat 0.25 0.25 0.25
+gacca 0.25 0.25 0.25
+gaccc 0.25 0.25 0.25
+gaccg 0.25 0.25 0.25
+gacct 0.25 0.25 0.25
+gacga 0.25 0.25 0.25
+gacgc 0.25 0.25 0.25
+gacgg 0.25 0.25 0.25
+gacgt 0.25 0.25 0.25
+gacta 0.25 0.25 0.25
+gactc 0.25 0.25 0.25
+gactg 0.25 0.25 0.25
+gactt 0.25 0.25 0.25
+gagaa 0.25 0.25 0.25
+gagac 0.25 0.25 0.25
+gagag 0.25 0.25 0.25
+gagat 0.25 0.25 0.25
+gagca 0.25 0.25 0.25
+gagcc 0.25 0.25 0.25
+gagcg 0.25 0.25 0.25
+gagct 0.25 0.25 0.25
+gagga 0.25 0.25 0.25
+gaggc 0.25 0.25 0.25
+gaggg 0.25 0.25 0.25
+gaggt 0.25 0.25 0.25
+gagta 0.25 0.25 0.25
+gagtc 0.25 0.25 0.25
+gagtg 0.25 0.25 0.25
+gagtt 0.25 0.25 0.25
+gataa 0.25 0.25 0.25
+gatac 0.25 0.25 0.25
+gatag 0.25 0.25 0.25
+gatat 0.25 0.25 0.25
+gatca 0.25 0.25 0.25
+gatcc 0.25 0.25 0.25
+gatcg 0.25 0.25 0.25
+gatct 0.25 0.25 0.25
+gatga 0.25 0.25 0.25
+gatgc 0.25 0.25 0.25
+gatgg 0.25 0.25 0.25
+gatgt 0.25 0.25 0.25
+gatta 0.25 0.25 0.25
+gattc 0.25 0.25 0.25
+gattg 0.25 0.25 0.25
+gattt 0.25 0.25 0.25
+gcaaa 0.25 0.25 0.25
+gcaac 0.25 0.25 0.25
+gcaag 0.25 0.25 0.25
+gcaat 0.25 0.25 0.25
+gcaca 0.25 0.25 0.25
+gcacc 0.25 0.25 0.25
+gcacg 0.25 0.25 0.25
+gcact 0.25 0.25 0.25
+gcaga 0.25 0.25 0.25
+gcagc 0.25 0.25 0.25
+gcagg 0.25 0.25 0.25
+gcagt 0.25 0.25 0.25
+gcata 0.25 0.25 0.25
+gcatc 0.25 0.25 0.25
+gcatg 0.25 0.25 0.25
+gcatt 0.25 0.25 0.25
+gccaa 0.25 0.25 0.25
+gccac 0.25 0.25 0.25
+gccag 0.25 0.25 0.25
+gccat 0.25 0.25 0.25
+gccca 0.25 0.25 0.25
+gcccc 0.25 0.25 0.25
+gcccg 0.25 0.25 0.25
+gccct 0.25 0.25 0.25
+gccga 0.25 0.25 0.25
+gccgc 0.25 0.25 0.25
+gccgg 0.25 0.25 0.25
+gccgt 0.25 0.25 0.25
+gccta 0.25 0.25 0.25
+gcctc 0.25 0.25 0.25
+gcctg 0.25 0.25 0.25
+gcctt 0.25 0.25 0.25
+gcgaa 0.25 0.25 0.25
+gcgac 0.25 0.25 0.25
+gcgag 0.25 0.25 0.25
+gcgat 0.25 0.25 0.25
+gcgca 0.25 0.25 0.25
+gcgcc 0.25 0.25 0.25
+gcgcg 0.25 0.25 0.25
+gcgct 0.25 0.25 0.25
+gcgga 0.25 0.25 0.25
+gcggc 0.25 0.25 0.25
+gcggg 0.25 0.25 0.25
+gcggt 0.25 0.25 0.25
+gcgta 0.25 0.25 0.25
+gcgtc 0.25 0.25 0.25
+gcgtg 0.25 0.25 0.25
+gcgtt 0.25 0.25 0.25
+gctaa 0.25 0.25 0.25
+gctac 0.25 0.25 0.25
+gctag 0.25 0.25 0.25
+gctat 0.25 0.25 0.25
+gctca 0.25 0.25 0.25
+gctcc 0.25 0.25 0.25
+gctcg 0.25 0.25 0.25
+gctct 0.25 0.25 0.25
+gctga 0.25 0.25 0.25
+gctgc 0.25 0.25 0.25
+gctgg 0.25 0.25 0.25
+gctgt 0.25 0.25 0.25
+gctta 0.25 0.25 0.25
+gcttc 0.25 0.25 0.25
+gcttg 0.25 0.25 0.25
+gcttt 0.25 0.25 0.25
+ggaaa 0.25 0.25 0.25
+ggaac 0.25 0.25 0.25
+ggaag 0.25 0.25 0.25
+ggaat 0.25 0.25 0.25
+ggaca 0.25 0.25 0.25
+ggacc 0.25 0.25 0.25
+ggacg 0.25 0.25 0.25
+ggact 0.25 0.25 0.25
+ggaga 0.25 0.25 0.25
+ggagc 0.25 0.25 0.25
+ggagg 0.25 0.25 0.25
+ggagt 0.25 0.25 0.25
+ggata 0.25 0.25 0.25
+ggatc 0.25 0.25 0.25
+ggatg 0.25 0.25 0.25
+ggatt 0.25 0.25 0.25
+ggcaa 0.25 0.25 0.25
+ggcac 0.25 0.25 0.25
+ggcag 0.25 0.25 0.25
+ggcat 0.25 0.25 0.25
+ggcca 0.25 0.25 0.25
+ggccc 0.25 0.25 0.25
+ggccg 0.25 0.25 0.25
+ggcct 0.25 0.25 0.25
+ggcga 0.25 0.25 0.25
+ggcgc 0.25 0.25 0.25
+ggcgg 0.25 0.25 0.25
+ggcgt 0.25 0.25 0.25
+ggcta 0.25 0.25 0.25
+ggctc 0.25 0.25 0.25
+ggctg 0.25 0.25 0.25
+ggctt 0.25 0.25 0.25
+gggaa 0.25 0.25 0.25
+gggac 0.25 0.25 0.25
+gggag 0.25 0.25 0.25
+gggat 0.25 0.25 0.25
+gggca 0.25 0.25 0.25
+gggcc 0.25 0.25 0.25
+gggcg 0.25 0.25 0.25
+gggct 0.25 0.25 0.25
+gggga 0.25 0.25 0.25
+ggggc 0.25 0.25 0.25
+ggggg 0.25 0.25 0.25
+ggggt 0.25 0.25 0.25
+gggta 0.25 0.25 0.25
+gggtc 0.25 0.25 0.25
+gggtg 0.25 0.25 0.25
+gggtt 0.25 0.25 0.25
+ggtaa 0.25 0.25 0.25
+ggtac 0.25 0.25 0.25
+ggtag 0.25 0.25 0.25
+ggtat 0.25 0.25 0.25
+ggtca 0.25 0.25 0.25
+ggtcc 0.25 0.25 0.25
+ggtcg 0.25 0.25 0.25
+ggtct 0.25 0.25 0.25
+ggtga 0.25 0.25 0.25
+ggtgc 0.25 0.25 0.25
+ggtgg 0.25 0.25 0.25
+ggtgt 0.25 0.25 0.25
+ggtta 0.25 0.25 0.25
+ggttc 0.25 0.25 0.25
+ggttg 0.25 0.25 0.25
+ggttt 0.25 0.25 0.25
+gtaaa 0.25 0.25 0.25
+gtaac 0.25 0.25 0.25
+gtaag 0.25 0.25 0.25
+gtaat 0.25 0.25 0.25
+gtaca 0.25 0.25 0.25
+gtacc 0.25 0.25 0.25
+gtacg 0.25 0.25 0.25
+gtact 0.25 0.25 0.25
+gtaga 0.25 0.25 0.25
+gtagc 0.25 0.25 0.25
+gtagg 0.25 0.25 0.25
+gtagt 0.25 0.25 0.25
+gtata 0.25 0.25 0.25
+gtatc 0.25 0.25 0.25
+gtatg 0.25 0.25 0.25
+gtatt 0.25 0.25 0.25
+gtcaa 0.25 0.25 0.25
+gtcac 0.25 0.25 0.25
+gtcag 0.25 0.25 0.25
+gtcat 0.25 0.25 0.25
+gtcca 0.25 0.25 0.25
+gtccc 0.25 0.25 0.25
+gtccg 0.25 0.25 0.25
+gtcct 0.25 0.25 0.25
+gtcga 0.25 0.25 0.25
+gtcgc 0.25 0.25 0.25
+gtcgg 0.25 0.25 0.25
+gtcgt 0.25 0.25 0.25
+gtcta 0.25 0.25 0.25
+gtctc 0.25 0.25 0.25
+gtctg 0.25 0.25 0.25
+gtctt 0.25 0.25 0.25
+gtgaa 0.25 0.25 0.25
+gtgac 0.25 0.25 0.25
+gtgag 0.25 0.25 0.25
+gtgat 0.25 0.25 0.25
+gtgca 0.25 0.25 0.25
+gtgcc 0.25 0.25 0.25
+gtgcg 0.25 0.25 0.25
+gtgct 0.25 0.25 0.25
+gtgga 0.25 0.25 0.25
+gtggc 0.25 0.25 0.25
+gtggg 0.25 0.25 0.25
+gtggt 0.25 0.25 0.25
+gtgta 0.25 0.25 0.25
+gtgtc 0.25 0.25 0.25
+gtgtg 0.25 0.25 0.25
+gtgtt 0.25 0.25 0.25
+gttaa 0.25 0.25 0.25
+gttac 0.25 0.25 0.25
+gttag 0.25 0.25 0.25
+gttat 0.25 0.25 0.25
+gttca 0.25 0.25 0.25
+gttcc 0.25 0.25 0.25
+gttcg 0.25 0.25 0.25
+gttct 0.25 0.25 0.25
+gttga 0.25 0.25 0.25
+gttgc 0.25 0.25 0.25
+gttgg 0.25 0.25 0.25
+gttgt 0.25 0.25 0.25
+gttta 0.25 0.25 0.25
+gtttc 0.25 0.25 0.25
+gtttg 0.25 0.25 0.25
+gtttt 0.25 0.25 0.25
+taaaa 0.25 0.25 0.25
+taaac 0.25 0.25 0.25
+taaag 0.25 0.25 0.25
+taaat 0.25 0.25 0.25
+taaca 0.25 0.25 0.25
+taacc 0.25 0.25 0.25
+taacg 0.25 0.25 0.25
+taact 0.25 0.25 0.25
+taaga 0.25 0.25 0.25
+taagc 0.25 0.25 0.25
+taagg 0.25 0.25 0.25
+taagt 0.25 0.25 0.25
+taata 0.25 0.25 0.25
+taatc 0.25 0.25 0.25
+taatg 0.25 0.25 0.25
+taatt 0.25 0.25 0.25
+tacaa 0.25 0.25 0.25
+tacac 0.25 0.25 0.25
+tacag 0.25 0.25 0.25
+tacat 0.25 0.25 0.25
+tacca 0.25 0.25 0.25
+taccc 0.25 0.25 0.25
+taccg 0.25 0.25 0.25
+tacct 0.25 0.25 0.25
+tacga 0.25 0.25 0.25
+tacgc 0.25 0.25 0.25
+tacgg 0.25 0.25 0.25
+tacgt 0.25 0.25 0.25
+tacta 0.25 0.25 0.25
+tactc 0.25 0.25 0.25
+tactg 0.25 0.25 0.25
+tactt 0.25 0.25 0.25
+tagaa 0.25 0.25 0.25
+tagac 0.25 0.25 0.25
+tagag 0.25 0.25 0.25
+tagat 0.25 0.25 0.25
+tagca 0.25 0.25 0.25
+tagcc 0.25 0.25 0.25
+tagcg 0.25 0.25 0.25
+tagct 0.25 0.25 0.25
+tagga 0.25 0.25 0.25
+taggc 0.25 0.25 0.25
+taggg 0.25 0.25 0.25
+taggt 0.25 0.25 0.25
+tagta 0.25 0.25 0.25
+tagtc 0.25 0.25 0.25
+tagtg 0.25 0.25 0.25
+tagtt 0.25 0.25 0.25
+tataa 0.25 0.25 0.25
+tatac 0.25 0.25 0.25
+tatag 0.25 0.25 0.25
+tatat 0.25 0.25 0.25
+tatca 0.25 0.25 0.25
+tatcc 0.25 0.25 0.25
+tatcg 0.25 0.25 0.25
+tatct 0.25 0.25 0.25
+tatga 0.25 0.25 0.25
+tatgc 0.25 0.25 0.25
+tatgg 0.25 0.25 0.25
+tatgt 0.25 0.25 0.25
+tatta 0.25 0.25 0.25
+tattc 0.25 0.25 0.25
+tattg 0.25 0.25 0.25
+tattt 0.25 0.25 0.25
+tcaaa 0.25 0.25 0.25
+tcaac 0.25 0.25 0.25
+tcaag 0.25 0.25 0.25
+tcaat 0.25 0.25 0.25
+tcaca 0.25 0.25 0.25
+tcacc 0.25 0.25 0.25
+tcacg 0.25 0.25 0.25
+tcact 0.25 0.25 0.25
+tcaga 0.25 0.25 0.25
+tcagc 0.25 0.25 0.25
+tcagg 0.25 0.25 0.25
+tcagt 0.25 0.25 0.25
+tcata 0.25 0.25 0.25
+tcatc 0.25 0.25 0.25
+tcatg 0.25 0.25 0.25
+tcatt 0.25 0.25 0.25
+tccaa 0.25 0.25 0.25
+tccac 0.25 0.25 0.25
+tccag 0.25 0.25 0.25
+tccat 0.25 0.25 0.25
+tccca 0.25 0.25 0.25
+tcccc 0.25 0.25 0.25
+tcccg 0.25 0.25 0.25
+tccct 0.25 0.25 0.25
+tccga 0.25 0.25 0.25
+tccgc 0.25 0.25 0.25
+tccgg 0.25 0.25 0.25
+tccgt 0.25 0.25 0.25
+tccta 0.25 0.25 0.25
+tcctc 0.25 0.25 0.25
+tcctg 0.25 0.25 0.25
+tcctt 0.25 0.25 0.25
+tcgaa 0.25 0.25 0.25
+tcgac 0.25 0.25 0.25
+tcgag 0.25 0.25 0.25
+tcgat 0.25 0.25 0.25
+tcgca 0.25 0.25 0.25
+tcgcc 0.25 0.25 0.25
+tcgcg 0.25 0.25 0.25
+tcgct 0.25 0.25 0.25
+tcgga 0.25 0.25 0.25
+tcggc 0.25 0.25 0.25
+tcggg 0.25 0.25 0.25
+tcggt 0.25 0.25 0.25
+tcgta 0.25 0.25 0.25
+tcgtc 0.25 0.25 0.25
+tcgtg 0.25 0.25 0.25
+tcgtt 0.25 0.25 0.25
+tctaa 0.25 0.25 0.25
+tctac 0.25 0.25 0.25
+tctag 0.25 0.25 0.25
+tctat 0.25 0.25 0.25
+tctca 0.25 0.25 0.25
+tctcc 0.25 0.25 0.25
+tctcg 0.25 0.25 0.25
+tctct 0.25 0.25 0.25
+tctga 0.25 0.25 0.25
+tctgc 0.25 0.25 0.25
+tctgg 0.25 0.25 0.25
+tctgt 0.25 0.25 0.25
+tctta 0.25 0.25 0.25
+tcttc 0.25 0.25 0.25
+tcttg 0.25 0.25 0.25
+tcttt 0.25 0.25 0.25
+tgaaa 0.25 0.25 0.25
+tgaac 0.25 0.25 0.25
+tgaag 0.25 0.25 0.25
+tgaat 0.25 0.25 0.25
+tgaca 0.25 0.25 0.25
+tgacc 0.25 0.25 0.25
+tgacg 0.25 0.25 0.25
+tgact 0.25 0.25 0.25
+tgaga 0.25 0.25 0.25
+tgagc 0.25 0.25 0.25
+tgagg 0.25 0.25 0.25
+tgagt 0.25 0.25 0.25
+tgata 0.25 0.25 0.25
+tgatc 0.25 0.25 0.25
+tgatg 0.25 0.25 0.25
+tgatt 0.25 0.25 0.25
+tgcaa 0.25 0.25 0.25
+tgcac 0.25 0.25 0.25
+tgcag 0.25 0.25 0.25
+tgcat 0.25 0.25 0.25
+tgcca 0.25 0.25 0.25
+tgccc 0.25 0.25 0.25
+tgccg 0.25 0.25 0.25
+tgcct 0.25 0.25 0.25
+tgcga 0.25 0.25 0.25
+tgcgc 0.25 0.25 0.25
+tgcgg 0.25 0.25 0.25
+tgcgt 0.25 0.25 0.25
+tgcta 0.25 0.25 0.25
+tgctc 0.25 0.25 0.25
+tgctg 0.25 0.25 0.25
+tgctt 0.25 0.25 0.25
+tggaa 0.25 0.25 0.25
+tggac 0.25 0.25 0.25
+tggag 0.25 0.25 0.25
+tggat 0.25 0.25 0.25
+tggca 0.25 0.25 0.25
+tggcc 0.25 0.25 0.25
+tggcg 0.25 0.25 0.25
+tggct 0.25 0.25 0.25
+tggga 0.25 0.25 0.25
+tgggc 0.25 0.25 0.25
+tgggg 0.25 0.25 0.25
+tgggt 0.25 0.25 0.25
+tggta 0.25 0.25 0.25
+tggtc 0.25 0.25 0.25
+tggtg 0.25 0.25 0.25
+tggtt 0.25 0.25 0.25
+tgtaa 0.25 0.25 0.25
+tgtac 0.25 0.25 0.25
+tgtag 0.25 0.25 0.25
+tgtat 0.25 0.25 0.25
+tgtca 0.25 0.25 0.25
+tgtcc 0.25 0.25 0.25
+tgtcg 0.25 0.25 0.25
+tgtct 0.25 0.25 0.25
+tgtga 0.25 0.25 0.25
+tgtgc 0.25 0.25 0.25
+tgtgg 0.25 0.25 0.25
+tgtgt 0.25 0.25 0.25
+tgtta 0.25 0.25 0.25
+tgttc 0.25 0.25 0.25
+tgttg 0.25 0.25 0.25
+tgttt 0.25 0.25 0.25
+ttaaa 0.25 0.25 0.25
+ttaac 0.25 0.25 0.25
+ttaag 0.25 0.25 0.25
+ttaat 0.25 0.25 0.25
+ttaca 0.25 0.25 0.25
+ttacc 0.25 0.25 0.25
+ttacg 0.25 0.25 0.25
+ttact 0.25 0.25 0.25
+ttaga 0.25 0.25 0.25
+ttagc 0.25 0.25 0.25
+ttagg 0.25 0.25 0.25
+ttagt 0.25 0.25 0.25
+ttata 0.25 0.25 0.25
+ttatc 0.25 0.25 0.25
+ttatg 0.25 0.25 0.25
+ttatt 0.25 0.25 0.25
+ttcaa 0.25 0.25 0.25
+ttcac 0.25 0.25 0.25
+ttcag 0.25 0.25 0.25
+ttcat 0.25 0.25 0.25
+ttcca 0.25 0.25 0.25
+ttccc 0.25 0.25 0.25
+ttccg 0.25 0.25 0.25
+ttcct 0.25 0.25 0.25
+ttcga 0.25 0.25 0.25
+ttcgc 0.25 0.25 0.25
+ttcgg 0.25 0.25 0.25
+ttcgt 0.25 0.25 0.25
+ttcta 0.25 0.25 0.25
+ttctc 0.25 0.25 0.25
+ttctg 0.25 0.25 0.25
+ttctt 0.25 0.25 0.25
+ttgaa 0.25 0.25 0.25
+ttgac 0.25 0.25 0.25
+ttgag 0.25 0.25 0.25
+ttgat 0.25 0.25 0.25
+ttgca 0.25 0.25 0.25
+ttgcc 0.25 0.25 0.25
+ttgcg 0.25 0.25 0.25
+ttgct 0.25 0.25 0.25
+ttgga 0.25 0.25 0.25
+ttggc 0.25 0.25 0.25
+ttggg 0.25 0.25 0.25
+ttggt 0.25 0.25 0.25
+ttgta 0.25 0.25 0.25
+ttgtc 0.25 0.25 0.25
+ttgtg 0.25 0.25 0.25
+ttgtt 0.25 0.25 0.25
+tttaa 0.25 0.25 0.25
+tttac 0.25 0.25 0.25
+tttag 0.25 0.25 0.25
+tttat 0.25 0.25 0.25
+tttca 0.25 0.25 0.25
+tttcc 0.25 0.25 0.25
+tttcg 0.25 0.25 0.25
+tttct 0.25 0.25 0.25
+tttga 0.25 0.25 0.25
+tttgc 0.25 0.25 0.25
+tttgg 0.25 0.25 0.25
+tttgt 0.25 0.25 0.25
+tttta 0.25 0.25 0.25
+ttttc 0.25 0.25 0.25
+ttttg 0.25 0.25 0.25
+ttttt 0.25 0.25 0.25
+
+# data set number
+[4]
+# (a,c,g,t)= (0.176, 0.324, 0.324, 0.176)
+#
+# Probabilities file for the exon model
+#
+
+
+# Die P_l's
+[P_ls]
+# k = 4
+# l=
+0
+# Values
+a 0.216 0.28 0.0998
+c 0.281 0.249 0.397
+g 0.357 0.209 0.387
+t 0.146 0.261 0.117
+# l=
+1
+# Values
+aa 0.0186 0.0679 0.027
+ac 0.027 0.0524 0.105
+ag 0.0368 0.0397 0.12
+at 0.0133 0.0563 0.0264
+ca 0.114 0.0677 0.0354
+cc 0.0972 0.0598 0.0953
+cg 0.129 0.0608 0.0889
+ct 0.0661 0.09 0.0316
+ga 0.0711 0.119 0.024
+gc 0.127 0.0953 0.0995
+gg 0.136 0.0741 0.0551
+gt 0.051 0.0718 0.0292
+ta 0.0123 0.0257 0.0134
+tc 0.0297 0.0419 0.0966
+tg 0.0545 0.0345 0.123
+tt 0.0151 0.0434 0.0293
+# l=
+2
+# Values
+aaa 0.00577 0.0066 0.00911
+aac 0.00593 0.00435 0.0222
+aag 0.0107 0.00347 0.032
+aat 0.0037 0.00502 0.00534
+aca 0.0281 0.00746 0.0079
+acc 0.0295 0.00672 0.0183
+acg 0.0335 0.00663 0.0214
+act 0.0166 0.00648 0.00531
+aga 0.0277 0.0151 0.00483
+agc 0.0326 0.0118 0.0202
+agg 0.0393 0.00934 0.0079
+agt 0.0144 0.00689 0.00519
+ata 0.00268 0.00224 0.00322
+atc 0.0062 0.00402 0.0254
+atg 0.0121 0.00269 0.0209
+att 0.00358 0.00414 0.00712
+caa 0.00616 0.0324 0.00654
+cac 0.0119 0.0265 0.0228
+cag 0.012 0.0159 0.0332
+cat 0.00477 0.0298 0.00491
+cca 0.0282 0.0195 0.00923
+ccc 0.0175 0.0201 0.0241
+ccg 0.0324 0.0189 0.0203
+cct 0.0145 0.0301 0.00735
+cga 0.0125 0.0367 0.00636
+cgc 0.0354 0.0309 0.0306
+cgg 0.0328 0.0243 0.0158
+cgt 0.0139 0.0279 0.00861
+cta 0.0029 0.0113 0.00363
+ctc 0.00947 0.0185 0.03
+ctg 0.0125 0.013 0.05
+ctt 0.00358 0.0183 0.0069
+gaa 0.00397 0.0248 0.011
+gac 0.00541 0.0184 0.0391
+gag 0.0107 0.0185 0.0541
+gat 0.00297 0.0184 0.0121
+gca 0.0255 0.0332 0.0127
+gcc 0.0245 0.0251 0.0374
+gcg 0.0334 0.0284 0.0312
+gct 0.0162 0.0444 0.0126
+gga 0.0118 0.0503 0.0124
+ggc 0.021 0.0383 0.032
+ggg 0.0208 0.0259 0.0194
+ggt 0.00662 0.0244 0.0091
+gta 0.00324 0.00977 0.00426
+gtc 0.00681 0.0151 0.0168
+gtg 0.0155 0.0155 0.0428
+gtt 0.00369 0.0158 0.00657
+taa 0.00266 0.00413 0.000386
+tac 0.00377 0.00314 0.0214
+tag 0.0033 0.00188 0.000386
+tat 0.00191 0.00316 0.00404
+tca 0.0325 0.00757 0.00559
+tcc 0.0257 0.00798 0.0154
+tcg 0.03 0.00683 0.016
+tct 0.0188 0.00898 0.0063
+tga 0.0192 0.0166 0.000386
+tgc 0.0383 0.0143 0.0167
+tgg 0.0434 0.0146 0.012
+tgt 0.016 0.0125 0.00635
+tta 0.00349 0.00241 0.00225
+ttc 0.00719 0.00431 0.0244
+ttg 0.0143 0.00332 0.00938
+ttt 0.00425 0.00521 0.00876
+# l=
+3
+# Values
+aaaa 0.00206 0.00213 0.00129
+aaac 0.0024 0.00139 0.00215
+aaag 0.00358 0.00108 0.00218
+aaat 0.00152 0.00201 0.000855
+aaca 0.00733 0.0017 0.000985
+aacc 0.00721 0.0013 0.0013
+aacg 0.00715 0.00122 0.00125
+aact 0.00398 0.00159 0.000734
+aaga 0.0101 0.005 0.000725
+aagc 0.00946 0.00305 0.00127
+aagg 0.0125 0.00267 0.000773
+aagt 0.00493 0.00217 0.000686
+aata 0.000614 0.000842 0.000638
+aatc 0.0012 0.00111 0.00179
+aatg 0.00221 0.000725 0.00154
+aatt 0.000645 0.000935 0.000894
+acaa 0.00179 0.00829 0.0013
+acac 0.00266 0.00599 0.00256
+acag 0.00295 0.00399 0.00397
+acat 0.00113 0.00767 0.000822
+acca 0.008 0.00591 0.0013
+accc 0.00384 0.00633 0.0031
+accg 0.00658 0.00541 0.00244
+acct 0.00334 0.00919 0.00105
+acga 0.00362 0.0104 0.00106
+acgc 0.00924 0.0079 0.00296
+acgg 0.00907 0.00598 0.00225
+acgt 0.00365 0.00693 0.00135
+acta 0.000632 0.00287 0.000525
+actc 0.00139 0.00418 0.00267
+actg 0.00173 0.00338 0.00321
+actt 0.000766 0.00504 0.00107
+agaa 0.00108 0.0117 0.00215
+agac 0.00111 0.00673 0.00421
+agag 0.00162 0.00697 0.00629
+agat 0.000459 0.00832 0.00229
+agca 0.0069 0.0116 0.00246
+agcc 0.00597 0.00673 0.00382
+agcg 0.00858 0.00855 0.00343
+agct 0.00372 0.0137 0.002
+agga 0.00271 0.0201 0.00199
+aggc 0.00241 0.0123 0.00302
+aggg 0.0034 0.00789 0.00249
+aggt 0.00102 0.00804 0.00119
+agta 0.000593 0.0038 0.000488
+agtc 0.00104 0.00443 0.00135
+agtg 0.00244 0.00383 0.00301
+agtt 0.000506 0.00576 0.00109
+ataa 0.000705 0.000977 9.66e-05
+atac 0.000684 0.000678 0.00153
+atag 0.000848 0.000416 9.66e-05
+atat 0.000541 0.000734 0.000589
+atca 0.00882 0.00164 0.000889
+atcc 0.00774 0.00178 0.00123
+atcg 0.00922 0.00158 0.00117
+atct 0.00485 0.00205 0.000865
+atga 0.00503 0.00531 9.66e-05
+atgc 0.00652 0.00345 0.000836
+atgg 0.00945 0.00308 0.00104
+atgt 0.00343 0.00307 0.000826
+atta 0.00119 0.000683 0.000411
+attc 0.00188 0.000987 0.00168
+attg 0.00357 0.000678 0.00111
+attt 0.001 0.00135 0.00106
+caaa 0.00127 0.00224 0.00364
+caac 0.00153 0.00143 0.0117
+caag 0.00229 0.00104 0.0158
+caat 0.000688 0.00119 0.00218
+caca 0.00557 0.00344 0.00379
+cacc 0.00662 0.00321 0.0111
+cacg 0.00714 0.00296 0.0102
+cact 0.00371 0.00262 0.00232
+caga 0.00647 0.00459 0.0015
+cagc 0.0103 0.00386 0.0102
+cagg 0.0089 0.00243 0.00271
+cagt 0.0033 0.00206 0.00191
+cata 0.00042 0.00058 0.00114
+catc 0.00156 0.00164 0.0154
+catg 0.00161 0.000888 0.0108
+catt 0.000753 0.00151 0.00338
+ccaa 0.00143 0.00816 0.00162
+ccac 0.0037 0.00732 0.0079
+ccag 0.00328 0.00371 0.00936
+ccat 0.00127 0.00757 0.00135
+ccca 0.0059 0.0036 0.00316
+cccc 0.0043 0.00481 0.00854
+cccg 0.00745 0.00318 0.00669
+ccct 0.00315 0.00541 0.00236
+ccga 0.0028 0.00908 0.00168
+ccgc 0.00917 0.00851 0.0112
+ccgg 0.0075 0.00633 0.00414
+ccgt 0.00354 0.00764 0.00261
+ccta 0.000502 0.00238 0.00117
+cctc 0.00221 0.00466 0.0114
+cctg 0.00279 0.00281 0.0165
+cctt 0.000831 0.0041 0.00214
+cgaa 0.00086 0.00249 0.00243
+cgac 0.0019 0.00365 0.0157
+cgag 0.00284 0.00363 0.0165
+cgat 0.000942 0.00267 0.0034
+cgca 0.00699 0.00709 0.00334
+cgcc 0.00663 0.00678 0.0154
+cgcg 0.00837 0.0062 0.00916
+cgct 0.00465 0.011 0.00383
+cgga 0.00259 0.0081 0.00342
+cggc 0.0081 0.0102 0.0125
+cggg 0.00553 0.00578 0.00657
+cggt 0.0016 0.00469 0.0027
+cgta 0.000883 0.00246 0.0013
+cgtc 0.00238 0.00371 0.00836
+cgtg 0.00484 0.00417 0.0173
+cgtt 0.00103 0.00326 0.00192
+ctaa 0.000718 0.000977 9.66e-05
+ctac 0.00135 0.000832 0.0101
+ctag 0.000692 0.000463 9.66e-05
+ctat 0.000376 0.000809 0.0014
+ctca 0.0102 0.00265 0.00195
+ctcc 0.00523 0.00296 0.0082
+ctcg 0.00935 0.0027 0.00688
+ctct 0.00603 0.00264 0.00217
+ctga 0.00574 0.00362 9.66e-05
+ctgc 0.017 0.0044 0.00722
+ctgg 0.0163 0.00395 0.00435
+ctgt 0.00546 0.00324 0.00185
+ctta 0.000782 0.000407 0.000575
+cttc 0.00202 0.0013 0.0124
+cttg 0.00283 0.000893 0.00324
+cttt 0.00102 0.00116 0.00271
+gaaa 0.00235 0.00122 0.00322
+gaac 0.00191 0.000916 0.00708
+gaag 0.00479 0.000879 0.0126
+gaat 0.0014 0.00105 0.00168
+gaca 0.00868 0.00125 0.0023
+gacc 0.00839 0.00115 0.00488
+gacg 0.0124 0.00152 0.00914
+gact 0.00501 0.0013 0.00181
+gaga 0.011 0.00434 0.00228
+gagc 0.0128 0.00402 0.00792
+gagg 0.0178 0.00348 0.00403
+gagt 0.0061 0.00189 0.00214
+gata 0.00115 0.00051 0.000976
+gatc 0.00255 0.000715 0.00695
+gatg 0.00681 0.000613 0.00751
+gatt 0.00153 0.000973 0.00225
+gcaa 0.00203 0.00698 0.0023
+gcac 0.00399 0.00612 0.00983
+gcag 0.00449 0.00482 0.0173
+gcat 0.0014 0.00619 0.00185
+gcca 0.00913 0.00537 0.00333
+gccc 0.00553 0.00399 0.0091
+gccg 0.0134 0.00576 0.00917
+gcct 0.00471 0.00803 0.00238
+gcga 0.00372 0.00987 0.00269
+gcgc 0.0101 0.00716 0.0129
+gcgg 0.00968 0.00762 0.00785
+gcgt 0.00417 0.00694 0.00346
+gcta 0.0012 0.00269 0.00136
+gctc 0.00384 0.00472 0.0128
+gctg 0.00589 0.00398 0.0258
+gctt 0.0013 0.0042 0.00242
+ggaa 0.00194 0.00371 0.00387
+ggac 0.00231 0.00243 0.0139
+ggag 0.00617 0.00286 0.0259
+ggat 0.00149 0.00229 0.00417
+ggca 0.00721 0.0052 0.0043
+ggcc 0.00629 0.00453 0.0133
+ggcg 0.0102 0.00504 0.0151
+ggct 0.00473 0.00569 0.00433
+ggga 0.00358 0.00648 0.00411
+gggc 0.00648 0.00461 0.0112
+gggg 0.00713 0.0044 0.00706
+gggt 0.00217 0.00272 0.00276
+ggta 0.000957 0.00109 0.0013
+ggtc 0.00194 0.00142 0.00401
+ggtg 0.00496 0.00172 0.0165
+ggtt 0.0013 0.00148 0.00183
+gtaa 0.000731 0.000977 9.66e-05
+gtac 0.00122 0.000823 0.00813
+gtag 0.00129 0.000589 9.66e-05
+gtat 0.000558 0.000748 0.00139
+gtca 0.00601 0.00165 0.00183
+gtcc 0.00325 0.00129 0.00448
+gtcg 0.0053 0.00125 0.0068
+gtct 0.00287 0.00233 0.0024
+gtga 0.00684 0.00375 9.66e-05
+gtgc 0.0121 0.00338 0.00748
+gtgg 0.0138 0.00461 0.00552
+gtgt 0.00564 0.00299 0.00266
+gtta 0.000653 0.000552 0.000653
+gttc 0.00177 0.000973 0.00839
+gttg 0.00227 0.000631 0.00334
+gttt 0.00113 0.00132 0.00383
+taaa 8.65e-05 0.00101 0.000966
+taac 8.65e-05 0.000622 0.00129
+taag 8.65e-05 0.000468 0.00141
+taat 8.65e-05 0.000776 0.000618
+taca 0.00648 0.00107 0.000826
+tacc 0.00726 0.00106 0.00108
+tacg 0.00677 0.00093 0.000884
+tact 0.00393 0.000973 0.000454
+taga 8.65e-05 0.00115 0.000328
+tagc 8.65e-05 0.000898 0.000768
+tagg 8.65e-05 0.000757 0.000391
+tagt 8.65e-05 0.000767 0.000454
+tata 0.000498 0.000309 0.000459
+tatc 0.000887 0.000556 0.00118
+tatg 0.00151 0.000463 0.00101
+tatt 0.000649 0.000725 0.000599
+tcaa 0.000922 0.00893 0.00132
+tcac 0.00159 0.0071 0.00249
+tcag 0.00132 0.00334 0.00258
+tcat 0.000956 0.00836 0.000879
+tcca 0.0052 0.00464 0.00143
+tccc 0.00387 0.00491 0.00336
+tccg 0.00497 0.00454 0.00196
+tcct 0.00332 0.00748 0.00157
+tcga 0.00233 0.00737 0.000937
+tcgc 0.00687 0.00731 0.00353
+tcgg 0.00657 0.00435 0.00159
+tcgt 0.00259 0.00641 0.00119
+tcta 0.000567 0.00338 0.000572
+tctc 0.00202 0.00497 0.00316
+tctg 0.00212 0.00287 0.0046
+tctt 0.000679 0.00499 0.00128
+tgaa 8.65e-05 0.0069 0.0025
+tgac 8.65e-05 0.00558 0.00517
+tgag 8.65e-05 0.005 0.00549
+tgat 8.65e-05 0.00507 0.00227
+tgca 0.00443 0.00931 0.00263
+tgcc 0.00564 0.00704 0.00491
+tgcg 0.0062 0.00865 0.00354
+tgct 0.00312 0.014 0.00246
+tgga 0.00291 0.0156 0.00288
+tggc 0.00398 0.0111 0.00532
+tggg 0.00476 0.00779 0.00325
+tggt 0.00182 0.00898 0.00245
+tgta 0.000809 0.00243 0.00117
+tgtc 0.00145 0.0055 0.00305
+tgtg 0.00325 0.00574 0.00595
+tgtt 0.000864 0.00528 0.00173
+ttaa 0.000502 0.0012 9.66e-05
+ttac 0.000511 0.000804 0.00165
+ttag 0.000467 0.000411 9.66e-05
+ttat 0.000437 0.000865 0.000671
+ttca 0.00743 0.00163 0.000918
+ttcc 0.00943 0.00195 0.00151
+ttcg 0.0061 0.0013 0.00112
+ttct 0.00501 0.00196 0.00087
+ttga 0.00159 0.00393 9.66e-05
+ttgc 0.00277 0.0031 0.00118
+ttgg 0.00385 0.00295 0.00113
+ttgt 0.00146 0.00321 0.00101
+ttta 0.000872 0.000772 0.000609
+tttc 0.00152 0.00105 0.00195
+tttg 0.00567 0.00112 0.00169
+tttt 0.0011 0.00138 0.00115
+# l=
+4
+# Values
+aaaaa 0.000423 0.000451 0.000322
+aaaac 0.000495 0.000295 0.000539
+aaaag 0.000704 0.000236 0.000545
+aaaat 0.000308 0.000428 0.000214
+aaaca 0.00137 0.000426 0.000246
+aaacc 0.00132 0.000325 0.000325
+aaacg 0.00133 0.000304 0.000313
+aaact 0.000764 0.000396 0.000184
+aaaga 0.00184 0.00113 0.000181
+aaagc 0.00172 0.000687 0.000316
+aaagg 0.00224 0.000627 0.000193
+aaagt 0.000916 0.000575 0.000171
+aaata 0.000154 0.00021 0.000159
+aaatc 0.000301 0.000277 0.000448
+aaatg 0.000552 0.000181 0.000384
+aaatt 0.000161 0.000234 0.000223
+aacaa 0.000346 0.00204 0.000292
+aacac 0.000538 0.00125 0.000558
+aacag 0.00061 0.000828 0.000781
+aacat 0.000229 0.00179 0.000192
+aacca 0.00148 0.00112 0.000272
+aaccc 0.000721 0.00139 0.000653
+aaccg 0.00116 0.00119 0.000484
+aacct 0.000619 0.00205 0.000234
+aacga 0.000654 0.00182 0.000231
+aacgc 0.00164 0.00143 0.00063
+aacgg 0.00162 0.00111 0.000479
+aacgt 0.000672 0.00138 0.000292
+aacta 0.000158 0.000617 0.000112
+aactc 0.000348 0.00087 0.0006
+aactg 0.000433 0.000627 0.000693
+aactt 0.000191 0.00118 0.000233
+aagaa 0.000269 0.00327 0.000686
+aagac 0.000277 0.00136 0.00116
+aagag 0.000406 0.00128 0.00162
+aagat 0.000115 0.00208 0.000696
+aagca 0.00123 0.0022 0.00043
+aagcc 0.00108 0.00136 0.000923
+aagcg 0.00151 0.00147 0.000763
+aagct 0.000674 0.00235 0.00043
+aagga 0.000492 0.00395 0.000431
+aaggc 0.000466 0.00246 0.000709
+aaggg 0.000619 0.00152 0.000565
+aaggt 0.000187 0.00173 0.000287
+aagta 0.000148 0.000893 0.000122
+aagtc 0.000261 0.00109 0.000338
+aagtg 0.00061 0.000781 0.000754
+aagtt 0.000127 0.00128 0.000273
+aataa 0.000176 0.000244 2.42e-05
+aatac 0.000171 0.000169 0.000383
+aatag 0.000212 0.000104 2.42e-05
+aatat 0.000135 0.000184 0.000147
+aatca 0.00159 0.000378 0.000222
+aatcc 0.00142 0.000364 0.000307
+aatcg 0.00165 0.000347 0.000293
+aatct 0.000895 0.000483 0.000216
+aatga 0.00093 0.000767 2.42e-05
+aatgc 0.00117 0.000622 0.000209
+aatgg 0.0017 0.000416 0.00026
+aatgt 0.000656 0.000575 0.000207
+aatta 0.00024 0.000171 0.000103
+aattc 0.000379 0.000247 0.000419
+aattg 0.000703 0.000169 0.000277
+aattt 0.000216 0.000338 0.000264
+acaaa 0.000317 0.00056 0.00114
+acaac 0.000382 0.000357 0.00285
+acaag 0.000572 0.00026 0.00393
+acaat 0.000172 0.000297 0.000638
+acaca 0.00125 0.000767 0.000966
+acacc 0.00141 0.000613 0.00178
+acacg 0.00154 0.0005 0.00293
+acact 0.000807 0.000444 0.000493
+acaga 0.000839 0.000902 0.000459
+acagc 0.000917 0.000743 0.00259
+acagg 0.000779 0.000491 0.000633
+acagt 0.000212 0.000496 0.000411
+acata 0.000105 0.000145 0.000353
+acatc 0.00039 0.00041 0.00394
+acatg 0.000402 0.000222 0.00259
+acatt 0.000188 0.000376 0.00109
+accaa 0.000307 0.00197 0.000415
+accac 0.00073 0.00205 0.00245
+accag 0.000665 0.000757 0.00292
+accat 0.000269 0.00159 0.000343
+accca 0.000584 0.000729 0.00109
+acccc 0.000506 0.000879 0.0024
+acccg 0.00071 0.000388 0.00251
+accct 0.000541 0.00115 0.000551
+accga 0.000529 0.00141 0.000386
+accgc 0.00175 0.0014 0.00355
+accgg 0.0014 0.0008 0.00106
+accgt 0.000694 0.00139 0.000633
+accta 0.000125 0.000519 0.000362
+acctc 0.000553 0.000762 0.00328
+acctg 0.000698 0.000482 0.00534
+acctt 0.000208 0.000921 0.000536
+acgaa 0.000204 0.000743 0.000763
+acgac 0.000388 0.000757 0.00442
+acgag 0.000579 0.000715 0.00454
+acgat 0.0002 0.000603 0.00114
+acgca 0.000606 0.00178 0.00102
+acgcc 0.000524 0.00126 0.00335
+acgcg 0.000749 0.00153 0.00291
+acgct 0.000376 0.00251 0.000783
+acgga 0.000509 0.00222 0.000923
+acggc 0.00156 0.00198 0.00274
+acggg 0.0011 0.00161 0.00193
+acggt 0.000312 0.00123 0.000618
+acgta 0.000186 0.000538 0.000295
+acgtc 0.000498 0.000687 0.00184
+acgtg 0.000958 0.000963 0.00461
+acgtt 0.000212 0.000706 0.000478
+actaa 0.00018 0.000244 2.42e-05
+actac 0.000337 0.000208 0.00251
+actag 0.000173 0.000116 2.42e-05
+actat 9.41e-05 0.000202 0.000391
+actca 0.00221 0.000576 0.000406
+actcc 0.00111 0.00065 0.00137
+actcg 0.002 0.000583 0.00207
+actct 0.00128 0.000632 0.000493
+actga 0.000437 0.000772 2.42e-05
+actgc 0.00087 0.000941 0.00188
+actgg 0.000891 0.000815 0.00126
+actgt 0.000281 0.000705 0.000386
+actta 0.000174 0.000102 0.000126
+acttc 0.00045 0.000325 0.0032
+acttg 0.000621 0.000223 0.000923
+acttt 0.00025 0.00029 0.000971
+agaaa 0.000554 0.000305 0.00122
+agaac 0.000449 0.000229 0.00245
+agaag 0.0011 0.00022 0.00534
+agaat 0.000325 0.000262 0.000633
+agaca 0.00093 0.000313 0.000729
+agacc 0.000718 0.000289 0.00141
+agacg 0.00107 0.000381 0.00291
+agact 0.000498 0.000325 0.000498
+agaga 0.00136 0.000832 0.00085
+agagc 0.00113 0.000747 0.00269
+agagg 0.00182 0.000651 0.00165
+agagt 0.000593 0.000364 0.000589
+agata 0.000272 0.000127 0.0003
+agatc 0.000537 0.000179 0.00282
+agatg 0.00148 0.000153 0.00285
+agatt 0.000341 0.000243 0.000874
+agcaa 0.000478 0.00166 0.000652
+agcac 0.000906 0.00108 0.00267
+agcag 0.00105 0.00129 0.00571
+agcat 0.000333 0.00126 0.00056
+agcca 0.000995 0.00112 0.00086
+agccc 0.000567 0.000874 0.002
+agccg 0.000922 0.00101 0.00207
+agcct 0.000454 0.00168 0.000652
+agcga 0.000562 0.00227 0.000913
+agcgc 0.00087 0.00133 0.00323
+agcgg 0.000943 0.00152 0.00223
+agcgt 0.000325 0.00142 0.000676
+agcta 0.00029 0.000468 0.000377
+agctc 0.000857 0.000959 0.00313
+agctg 0.00131 0.000725 0.00699
+agctt 0.000291 0.000757 0.000855
+aggaa 0.000449 0.000845 0.00139
+aggac 0.000524 0.000551 0.0042
+aggag 0.0014 0.000671 0.00951
+aggat 0.000317 0.000538 0.00151
+aggca 0.000736 0.00115 0.00114
+aggcc 0.000614 0.00101 0.0039
+aggcg 0.000775 0.00109 0.00389
+aggct 0.000376 0.00125 0.00127
+aggga 0.000831 0.00103 0.00086
+agggc 0.0014 0.00072 0.00307
+agggg 0.00158 0.000547 0.00185
+agggt 0.000469 0.000379 0.000768
+aggta 0.000217 0.000272 0.000444
+aggtc 0.000422 0.000355 0.00125
+aggtg 0.00111 0.00043 0.00426
+aggtt 0.000288 0.000369 0.000729
+agtaa 0.000183 0.000244 2.42e-05
+agtac 0.000306 0.000206 0.00269
+agtag 0.000323 0.000147 2.42e-05
+agtat 0.00014 0.000187 0.000415
+agtca 0.00129 0.000413 0.00044
+agtcc 0.000707 0.000323 0.000995
+agtcg 0.00112 0.000312 0.00168
+agtct 0.000611 0.000582 0.00056
+agtga 0.000718 0.000786 2.42e-05
+agtgc 0.00071 0.000669 0.0015
+agtgg 0.000891 0.000767 0.00119
+agtgt 0.000363 0.000426 0.000464
+agtta 0.000163 0.000138 0.000159
+agttc 0.000441 0.000243 0.00261
+agttg 0.000568 0.000158 0.000903
+agttt 0.000282 0.00033 0.00111
+ataaa 2.16e-05 0.000251 0.000242
+ataac 2.16e-05 0.000155 0.000322
+ataag 2.16e-05 0.000117 0.000353
+ataat 2.16e-05 0.000194 0.000155
+ataca 0.0012 0.000267 0.000207
+atacc 0.00135 0.000264 0.000269
+atacg 0.00124 0.000233 0.000221
+atact 0.000747 0.000243 0.000114
+ataga 2.16e-05 0.000288 8.21e-05
+atagc 2.16e-05 0.000224 0.000192
+atagg 2.16e-05 0.000189 9.78e-05
+atagt 2.16e-05 0.000192 0.000114
+atata 0.000124 7.72e-05 0.000115
+atatc 0.000222 0.000139 0.000295
+atatg 0.000376 0.000116 0.000252
+atatt 0.000162 0.000181 0.00015
+atcaa 0.00023 0.00233 0.00033
+atcac 0.000397 0.00161 0.000622
+atcag 0.00033 0.000865 0.000646
+atcat 0.000239 0.002 0.00022
+atcca 0.000988 0.00138 0.000339
+atccc 0.000752 0.00119 0.000735
+atccg 0.000926 0.00135 0.000429
+atcct 0.000638 0.0022 0.000372
+atcga 0.000459 0.00245 0.000222
+atcgc 0.00127 0.00192 0.000758
+atcgg 0.0012 0.0011 0.000373
+atcgt 0.000481 0.00171 0.000261
+atcta 0.000142 0.000772 0.000139
+atctc 0.000505 0.00103 0.000744
+atctg 0.000529 0.000767 0.00111
+atctt 0.00017 0.00129 0.000291
+atgaa 2.16e-05 0.00138 0.000826
+atgac 2.16e-05 0.000884 0.00145
+atgag 2.16e-05 0.000631 0.00144
+atgat 2.16e-05 0.00109 0.000657
+atgca 0.000817 0.00128 0.000565
+atgcc 0.00104 0.000743 0.00116
+atgcg 0.00111 0.00114 0.000739
+atgct 0.000581 0.00195 0.000473
+atgga 0.000571 0.00287 0.000556
+atggc 0.000751 0.00197 0.00114
+atggg 0.000896 0.00119 0.000686
+atggt 0.000353 0.00134 0.000319
+atgta 0.000186 0.000351 0.000227
+atgtc 0.000319 0.000673 0.000686
+atgtg 0.000698 0.000814 0.00127
+atgtt 0.000178 0.000996 0.000425
+attaa 0.000125 0.0003 2.42e-05
+attac 0.000128 0.000201 0.000412
+attag 0.000117 0.000103 2.42e-05
+attat 0.000109 0.000216 0.000168
+attca 0.00137 0.000408 0.000229
+attcc 0.00176 0.000487 0.000378
+attcg 0.00111 0.000325 0.000279
+attct 0.000963 0.00049 0.000217
+attga 0.000335 0.000973 2.42e-05
+attgc 0.00057 0.000706 0.000296
+attgg 0.000793 0.000645 0.000281
+attgt 0.00033 0.000734 0.000252
+attta 0.000181 0.000193 0.000152
+atttc 0.00032 0.000263 0.000487
+atttg 0.00113 0.000281 0.000423
+atttt 0.000239 0.000345 0.000289
+caaaa 0.000593 0.000451 0.000322
+caaac 0.000878 0.000295 0.000539
+caaag 0.00128 0.000236 0.000545
+caaat 0.00048 0.000428 0.000214
+caaca 0.00312 0.000426 0.000246
+caacc 0.00273 0.000325 0.000325
+caacg 0.00298 0.000304 0.000313
+caact 0.00151 0.000396 0.000184
+caaga 0.00381 0.000902 0.000181
+caagc 0.00346 0.000589 0.000316
+caagg 0.00469 0.000538 0.000193
+caagt 0.00202 0.000444 0.000171
+caata 0.000154 0.00021 0.000159
+caatc 0.000301 0.000277 0.000448
+caatg 0.000552 0.000181 0.000384
+caatt 0.000161 0.000234 0.000223
+cacaa 0.000749 0.0019 0.00042
+cacac 0.00105 0.00129 0.000884
+cacag 0.00112 0.000818 0.00163
+cacat 0.000446 0.00139 0.000246
+cacca 0.00395 0.00151 0.000488
+caccc 0.00127 0.00129 0.00114
+caccg 0.0031 0.00134 0.000985
+cacct 0.00151 0.00201 0.000343
+cacga 0.00112 0.00176 0.000367
+cacgc 0.00335 0.00184 0.00107
+cacgg 0.0032 0.00143 0.000807
+cacgt 0.0014 0.00169 0.000469
+cacta 0.000158 0.000641 0.000188
+cactc 0.000348 0.000949 0.000865
+cactg 0.000433 0.00086 0.00113
+cactt 0.000191 0.00104 0.000367
+cagaa 0.000269 0.00237 0.00057
+cagac 0.000277 0.00126 0.000995
+cagag 0.000406 0.00148 0.00196
+cagat 0.000115 0.00188 0.000604
+cagca 0.00295 0.00387 0.000971
+cagcc 0.00183 0.00177 0.00116
+cagcg 0.00305 0.00215 0.000855
+cagct 0.00131 0.00337 0.000585
+cagga 0.00074 0.00348 0.000431
+caggc 0.000601 0.00288 0.000709
+caggg 0.000839 0.0017 0.000565
+caggt 0.000242 0.00151 0.000287
+cagta 0.000148 0.000697 0.000122
+cagtc 0.000261 0.000874 0.000338
+cagtg 0.00061 0.0008 0.000754
+cagtt 0.000127 0.00116 0.000273
+cataa 0.000176 0.000244 2.42e-05
+catac 0.000171 0.000169 0.000383
+catag 0.000212 0.000104 2.42e-05
+catat 0.000135 0.000184 0.000147
+catca 0.00434 0.000378 0.000222
+catcc 0.0031 0.000364 0.000307
+catcg 0.00408 0.000347 0.000293
+catct 0.00228 0.000483 0.000216
+catga 0.00183 0.00106 2.42e-05
+catgc 0.00259 0.000708 0.000209
+catgg 0.0038 0.000655 0.00026
+catgt 0.00142 0.00063 0.000207
+catta 0.000467 0.000171 0.000103
+cattc 0.00074 0.000247 0.000419
+cattg 0.00146 0.000169 0.000277
+cattt 0.000355 0.000338 0.000264
+ccaaa 0.000317 0.00056 0.000797
+ccaac 0.000382 0.000357 0.00297
+ccaag 0.000572 0.00026 0.00419
+ccaat 0.000172 0.000297 0.000435
+ccaca 0.00159 0.000673 0.00101
+ccacc 0.00221 0.00123 0.00348
+ccacg 0.00197 0.000687 0.00245
+ccact 0.00131 0.000599 0.000638
+ccaga 0.00195 0.00107 0.000213
+ccagc 0.0027 0.000888 0.00248
+ccagg 0.00278 0.000463 0.000763
+ccagt 0.000956 0.000468 0.000377
+ccata 0.000105 0.000145 0.000246
+ccatc 0.00039 0.00041 0.00385
+ccatg 0.000402 0.000222 0.003
+ccatt 0.000188 0.000376 0.000696
+cccaa 0.000333 0.00195 0.000319
+cccac 0.00105 0.0018 0.00123
+cccag 0.00103 0.00115 0.00184
+cccat 0.00035 0.00139 0.000285
+cccca 0.00209 0.000814 0.00058
+ccccc 0.00155 0.00174 0.00214
+ccccg 0.00309 0.000963 0.00167
+cccct 0.000939 0.00107 0.000589
+cccga 0.000818 0.00238 0.000386
+cccgc 0.00222 0.00203 0.00144
+cccgg 0.00206 0.00175 0.000845
+cccgt 0.000913 0.00186 0.000604
+cccta 0.000125 0.000524 0.000222
+ccctc 0.000553 0.00108 0.00204
+ccctg 0.000698 0.000865 0.00283
+ccctt 0.000208 0.00094 0.000478
+ccgaa 0.000204 0.000553 0.000536
+ccgac 0.000388 0.00084 0.00402
+ccgag 0.000579 0.000804 0.00399
+ccgat 0.0002 0.000594 0.000855
+ccgca 0.0028 0.00153 0.000797
+ccgcc 0.0027 0.00221 0.00447
+ccgcg 0.00306 0.00133 0.00242
+ccgct 0.00148 0.00251 0.00109
+ccgga 0.00048 0.00171 0.000787
+ccggc 0.00178 0.00218 0.00308
+ccggg 0.00117 0.00131 0.00201
+ccggt 0.00029 0.000823 0.000676
+ccgta 0.000238 0.000655 0.000411
+ccgtc 0.000493 0.000842 0.00222
+ccgtg 0.00133 0.000879 0.00472
+ccgtt 0.00026 0.000664 0.000483
+cctaa 0.00018 0.000244 2.42e-05
+cctac 0.000337 0.000208 0.00209
+cctag 0.000173 0.000116 2.42e-05
+cctat 9.41e-05 0.000202 0.000295
+cctca 0.00329 0.000468 0.000488
+cctcc 0.00199 0.000884 0.00231
+cctcg 0.00287 0.000454 0.00143
+cctct 0.00199 0.00057 0.000565
+cctga 0.00184 0.000711 2.42e-05
+cctgc 0.00559 0.000823 0.00155
+cctgg 0.00566 0.00086 0.00106
+cctgt 0.00161 0.000631 0.000271
+cctta 0.000174 0.000102 0.000198
+ccttc 0.00045 0.000325 0.00275
+ccttg 0.000621 0.000223 0.000802
+ccttt 0.00025 0.00029 0.000473
+cgaaa 0.000389 0.000305 0.000698
+cgaac 0.000502 0.000229 0.00159
+cgaag 0.000987 0.00022 0.0027
+cgaat 0.000325 0.000262 0.000389
+cgaca 0.00325 0.000313 0.000391
+cgacc 0.00359 0.000289 0.00109
+cgacg 0.00505 0.000381 0.00168
+cgact 0.00226 0.000325 0.00029
+cgaga 0.00298 0.00079 0.000401
+cgagc 0.00406 0.000893 0.00183
+cgagg 0.00547 0.000477 0.000647
+cgagt 0.00219 0.000365 0.000464
+cgata 0.000229 0.000127 0.000203
+cgatc 0.000584 0.000179 0.000961
+cgatg 0.00171 0.000153 0.000966
+cgatt 0.00048 0.000243 0.000319
+cgcaa 0.000532 0.00228 0.000551
+cgcac 0.00123 0.00198 0.00281
+cgcag 0.000922 0.00138 0.00363
+cgcat 0.000264 0.00193 0.000367
+cgcca 0.00388 0.00192 0.000889
+cgccc 0.00197 0.00115 0.00254
+cgccg 0.00594 0.00192 0.00301
+cgcct 0.00189 0.00221 0.00058
+cgcga 0.000865 0.00315 0.000662
+cgcgc 0.00292 0.00218 0.00298
+cgcgg 0.00277 0.00162 0.00201
+cgcgt 0.00165 0.00217 0.000729
+cgcta 0.000363 0.000879 0.000396
+cgctc 0.0012 0.00143 0.00367
+cgctg 0.00148 0.00129 0.00677
+cgctt 0.000372 0.00145 0.000565
+cggaa 0.000415 0.000845 0.000623
+cggac 0.000636 0.000551 0.00258
+cggag 0.00171 0.000671 0.0045
+cggat 0.000303 0.000538 0.000676
+cggca 0.00265 0.00182 0.000956
+cggcc 0.00215 0.00136 0.00355
+cggcg 0.00448 0.00171 0.00503
+cggct 0.00186 0.00185 0.00106
+cggga 0.00087 0.00194 0.00099
+cgggc 0.002 0.00116 0.00247
+cgggg 0.00237 0.00112 0.00204
+cgggt 0.000666 0.000617 0.000473
+cggta 0.000229 0.000272 0.000179
+cggtc 0.000489 0.000355 0.000821
+cggtg 0.00135 0.00043 0.00362
+cggtt 0.000368 0.000369 0.000285
+cgtaa 0.000183 0.000244 2.42e-05
+cgtac 0.000306 0.000206 0.00182
+cgtag 0.000323 0.000147 2.42e-05
+cgtat 0.00014 0.000187 0.000324
+cgtca 0.00254 0.000413 0.000401
+cgtcc 0.00127 0.000323 0.000976
+cgtcg 0.00257 0.000312 0.00168
+cgtct 0.0011 0.000582 0.000546
+cgtga 0.00238 0.00102 2.42e-05
+cgtgc 0.00501 0.00105 0.00175
+cgtgg 0.00553 0.00127 0.0015
+cgtgt 0.0025 0.000814 0.000725
+cgtta 0.000163 0.000138 0.000121
+cgttc 0.000441 0.000243 0.00168
+cgttg 0.000568 0.000158 0.000642
+cgttt 0.000282 0.00033 0.000715
+ctaaa 2.16e-05 0.000251 0.000242
+ctaac 2.16e-05 0.000155 0.000322
+ctaag 2.16e-05 0.000117 0.000353
+ctaat 2.16e-05 0.000194 0.000155
+ctaca 0.00242 0.000267 0.000207
+ctacc 0.00252 0.000264 0.000269
+ctacg 0.00238 0.000233 0.000221
+ctact 0.00159 0.000243 0.000114
+ctaga 2.16e-05 0.000288 8.21e-05
+ctagc 2.16e-05 0.000224 0.000192
+ctagg 2.16e-05 0.000189 9.78e-05
+ctagt 2.16e-05 0.000192 0.000114
+ctata 0.000124 7.72e-05 0.000115
+ctatc 0.000222 0.000139 0.000295
+ctatg 0.000376 0.000116 0.000252
+ctatt 0.000162 0.000181 0.00015
+ctcaa 0.00023 0.00332 0.00033
+ctcac 0.000397 0.00249 0.000622
+ctcag 0.00033 0.00093 0.000646
+ctcat 0.000239 0.00272 0.00022
+ctcca 0.00226 0.00106 0.000415
+ctccc 0.00152 0.0011 0.00115
+ctccg 0.00199 0.000846 0.000671
+ctcct 0.00154 0.00181 0.000449
+ctcga 0.000558 0.0022 0.000271
+ctcgc 0.00234 0.00284 0.00125
+ctcgg 0.00241 0.00132 0.000469
+ctcgt 0.000857 0.00223 0.000406
+ctcta 0.000142 0.00116 0.000159
+ctctc 0.000505 0.00167 0.000773
+ctctg 0.000529 0.000743 0.00136
+ctctt 0.00017 0.00194 0.000343
+ctgaa 2.16e-05 0.00197 0.000435
+ctgac 2.16e-05 0.00153 0.00106
+ctgag 2.16e-05 0.00149 0.0011
+ctgat 2.16e-05 0.00132 0.00056
+ctgca 0.00151 0.00472 0.000705
+ctgcc 0.00218 0.00317 0.00137
+ctgcg 0.00164 0.0039 0.000981
+ctgct 0.00114 0.00662 0.000836
+ctgga 0.000666 0.00636 0.000681
+ctggc 0.00104 0.00433 0.00127
+ctggg 0.00164 0.00359 0.000927
+ctggt 0.000545 0.00341 0.000488
+ctgta 0.000186 0.000846 0.00028
+ctgtc 0.000319 0.00188 0.000652
+ctgtg 0.000698 0.00179 0.00153
+ctgtt 0.000178 0.0014 0.000459
+cttaa 0.000125 0.0003 2.42e-05
+cttac 0.000128 0.000201 0.000412
+cttag 0.000117 0.000103 2.42e-05
+cttat 0.000109 0.000216 0.000168
+cttca 0.00304 0.000408 0.000229
+cttcc 0.00378 0.000487 0.000378
+cttcg 0.00214 0.000325 0.000279
+cttct 0.00204 0.00049 0.000217
+cttga 0.000498 0.000715 2.42e-05
+cttgc 0.000909 0.00065 0.000296
+cttgg 0.00109 0.000589 0.000281
+cttgt 0.000394 0.00072 0.000252
+cttta 0.00026 0.000193 0.000152
+ctttc 0.000407 0.000263 0.000487
+ctttg 0.0015 0.000281 0.000423
+ctttt 0.000247 0.000345 0.000289
+gaaaa 0.000623 0.000776 0.000322
+gaaac 0.000532 0.000505 0.000539
+gaaag 0.000896 0.000374 0.000545
+gaaat 0.000424 0.000729 0.000214
+gaaca 0.00147 0.000426 0.000246
+gaacc 0.00183 0.000325 0.000325
+gaacg 0.00151 0.000304 0.000313
+gaact 0.000935 0.000396 0.000184
+gaaga 0.00264 0.00197 0.000181
+gaagc 0.00256 0.00116 0.000316
+gaagg 0.00334 0.000963 0.000193
+gaagt 0.00108 0.000715 0.000171
+gaata 0.000154 0.00021 0.000159
+gaatc 0.000301 0.000277 0.000448
+gaatg 0.000552 0.000181 0.000384
+gaatt 0.000161 0.000234 0.000223
+gacaa 0.000346 0.00246 0.000292
+gacac 0.000538 0.00237 0.000558
+gacag 0.00061 0.0015 0.000781
+gacat 0.000229 0.00307 0.000192
+gacca 0.00109 0.00187 0.000272
+gaccc 0.00112 0.00242 0.000653
+gaccg 0.00116 0.00161 0.000484
+gacct 0.000588 0.00324 0.000234
+gacga 0.00118 0.00491 0.000231
+gacgc 0.00261 0.00353 0.00063
+gacgg 0.00264 0.00234 0.000479
+gacgt 0.000909 0.00261 0.000292
+gacta 0.000158 0.000879 0.000112
+gactc 0.000348 0.00158 0.0006
+gactg 0.000433 0.00116 0.000693
+gactt 0.000191 0.00182 0.000233
+gagaa 0.000269 0.00372 0.000415
+gagac 0.000277 0.00275 0.00115
+gagag 0.000406 0.00281 0.00135
+gagat 0.000115 0.0027 0.000507
+gagca 0.0015 0.00318 0.000522
+gagcc 0.00198 0.00225 0.000918
+gagcg 0.00251 0.00321 0.00106
+gagct 0.00106 0.00525 0.00056
+gagga 0.000982 0.00862 0.0007
+gaggc 0.000878 0.00452 0.000894
+gaggg 0.00132 0.00308 0.000797
+gaggt 0.000407 0.00319 0.000324
+gagta 0.000148 0.00144 0.000122
+gagtc 0.000261 0.00158 0.000338
+gagtg 0.00061 0.00148 0.000754
+gagtt 0.000127 0.00216 0.000273
+gataa 0.000176 0.000244 2.42e-05
+gatac 0.000171 0.000169 0.000383
+gatag 0.000212 0.000104 2.42e-05
+gatat 0.000135 0.000184 0.000147
+gatca 0.00129 0.00051 0.000222
+gatcc 0.0018 0.000692 0.000307
+gatcg 0.00184 0.000538 0.000293
+gatct 0.000779 0.000603 0.000216
+gatga 0.00133 0.00243 2.42e-05
+gatgc 0.00159 0.00141 0.000209
+gatgg 0.00225 0.00136 0.00026
+gatgt 0.000692 0.00124 0.000207
+gatta 0.00024 0.000171 0.000103
+gattc 0.000379 0.000247 0.000419
+gattg 0.000703 0.000169 0.000277
+gattt 0.000216 0.000338 0.000264
+gcaaa 0.000317 0.00056 0.000826
+gcaac 0.000382 0.000357 0.00233
+gcaag 0.000572 0.00026 0.00355
+gcaat 0.000172 0.000297 0.000454
+gcaca 0.00214 0.00123 0.000908
+gcacc 0.00248 0.000641 0.00239
+gcacg 0.00292 0.00111 0.00256
+gcact 0.00117 0.000945 0.000464
+gcaga 0.0031 0.0016 0.000502
+gcagc 0.00582 0.00137 0.00305
+gcagg 0.00477 0.000935 0.000754
+gcagt 0.00178 0.00065 0.000652
+gcata 0.000105 0.000145 0.000188
+gcatc 0.00039 0.00041 0.00299
+gcatg 0.000402 0.000222 0.00255
+gcatt 0.000188 0.000376 0.000662
+gccaa 0.00048 0.00272 0.00043
+gccac 0.00119 0.00255 0.00252
+gccag 0.000922 0.0012 0.00229
+gccat 0.000385 0.00337 0.000367
+gccca 0.00247 0.00125 0.000613
+gcccc 0.0017 0.00141 0.00189
+gcccg 0.0028 0.00131 0.00111
+gccct 0.00116 0.00205 0.000522
+gccga 0.000926 0.00408 0.000493
+gccgc 0.00345 0.00415 0.00365
+gccgg 0.00264 0.00303 0.00118
+gccgt 0.00123 0.00327 0.000681
+gccta 0.000125 0.000898 0.000338
+gcctc 0.000553 0.00177 0.00345
+gcctg 0.000698 0.00107 0.00403
+gcctt 0.000208 0.00137 0.000541
+gcgaa 0.000247 0.000641 0.000729
+gcgac 0.000736 0.00121 0.00386
+gcgag 0.00111 0.0013 0.00485
+gcgat 0.000342 0.000884 0.000725
+gcgca 0.00295 0.00239 0.000686
+gcgcc 0.00271 0.00195 0.0039
+gcgcg 0.00372 0.00245 0.00199
+gcgct 0.00222 0.00418 0.000797
+gcgga 0.00109 0.00248 0.00114
+gcggc 0.0032 0.00433 0.00424
+gcggg 0.00216 0.00185 0.00161
+gcggt 0.000688 0.00184 0.000908
+gcgta 0.000273 0.000711 0.000314
+gcgtc 0.000887 0.00131 0.00222
+gcgtg 0.00159 0.00136 0.00418
+gcgtt 0.000342 0.00113 0.000444
+gctaa 0.00018 0.000244 2.42e-05
+gctac 0.000337 0.000208 0.00245
+gctag 0.000173 0.000116 2.42e-05
+gctat 9.41e-05 0.000202 0.00029
+gctca 0.00395 0.00103 0.00042
+gctcc 0.00152 0.000772 0.00213
+gctcg 0.00391 0.00108 0.00191
+gctct 0.00206 0.000804 0.000464
+gctga 0.00279 0.00137 2.42e-05
+gctgc 0.00892 0.0017 0.00222
+gctgg 0.00845 0.00146 0.00122
+gctgt 0.00305 0.0012 0.000681
+gctta 0.00026 0.000102 0.000126
+gcttc 0.000675 0.000325 0.00284
+gcttg 0.000969 0.000223 0.00071
+gcttt 0.000268 0.00029 0.000662
+ggaaa 0.000813 0.000305 0.000488
+ggaac 0.000619 0.000229 0.00099
+ggaag 0.00168 0.00022 0.00174
+ggaat 0.000437 0.000262 0.0003
+ggaca 0.00315 0.000313 0.000541
+ggacc 0.0029 0.000289 0.00111
+ggacg 0.00485 0.000381 0.00204
+ggact 0.00162 0.000325 0.0004
+ggaga 0.00541 0.00189 0.000512
+ggagc 0.00635 0.00164 0.00107
+ggagg 0.0088 0.0017 0.000778
+ggagt 0.00266 0.0008 0.000425
+ggata 0.000376 0.000127 0.000237
+ggatc 0.000891 0.000179 0.00158
+ggatg 0.00213 0.000153 0.00166
+ggatt 0.000368 0.000243 0.000504
+ggcaa 0.000632 0.00207 0.000488
+ggcac 0.00119 0.00212 0.00142
+ggcag 0.00158 0.00143 0.00259
+ggcat 0.000433 0.00211 0.000261
+ggcca 0.00299 0.00138 0.000546
+ggccc 0.00216 0.00107 0.00172
+ggccg 0.00489 0.00179 0.0013
+ggcct 0.0018 0.00258 0.000575
+ggcga 0.00175 0.00305 0.000459
+ggcgc 0.0053 0.00261 0.00231
+ggcgg 0.00481 0.00327 0.00116
+ggcgt 0.00172 0.00215 0.000613
+ggcta 0.000286 0.000898 0.000242
+ggctc 0.00128 0.00168 0.00169
+ggctg 0.00187 0.00128 0.00284
+ggctt 0.000437 0.00125 0.000377
+gggaa 0.000679 0.0013 0.000556
+gggac 0.00071 0.000757 0.00221
+gggag 0.00168 0.00079 0.00338
+gggat 0.000524 0.000776 0.000551
+gggca 0.00245 0.00144 0.000841
+gggcc 0.00257 0.00161 0.00173
+gggcg 0.00349 0.0015 0.00156
+gggct 0.00154 0.0015 0.000613
+gggga 0.00122 0.00222 0.00103
+ggggc 0.00231 0.00176 0.00174
+ggggg 0.00216 0.00183 0.00124
+ggggt 0.000571 0.00101 0.000536
+gggta 0.000299 0.000272 0.000208
+gggtc 0.00064 0.000355 0.000792
+gggtg 0.00117 0.00043 0.00159
+gggtt 0.000368 0.000369 0.000198
+ggtaa 0.000183 0.000244 2.42e-05
+ggtac 0.000306 0.000206 0.00182
+ggtag 0.000323 0.000147 2.42e-05
+ggtat 0.00014 0.000187 0.000324
+ggtca 0.00128 0.000413 0.000407
+ggtcc 0.000787 0.000323 0.000961
+ggtcg 0.000939 0.000312 0.0015
+ggtct 0.000532 0.000582 0.00053
+ggtga 0.00276 0.00123 2.42e-05
+ggtgc 0.00476 0.000916 0.00163
+ggtgg 0.00563 0.00182 0.00123
+ggtgt 0.00177 0.00086 0.000622
+ggtta 0.000163 0.000138 0.000146
+ggttc 0.000441 0.000243 0.00182
+ggttg 0.000568 0.000158 0.00075
+ggttt 0.000282 0.00033 0.000834
+gtaaa 2.16e-05 0.000251 0.000242
+gtaac 2.16e-05 0.000155 0.000322
+gtaag 2.16e-05 0.000117 0.000353
+gtaat 2.16e-05 0.000194 0.000155
+gtaca 0.00165 0.000267 0.000207
+gtacc 0.00205 0.000264 0.000269
+gtacg 0.00191 0.000233 0.000221
+gtact 0.000839 0.000243 0.000114
+gtaga 2.16e-05 0.000288 8.21e-05
+gtagc 2.16e-05 0.000224 0.000192
+gtagg 2.16e-05 0.000189 9.78e-05
+gtagt 2.16e-05 0.000192 0.000114
+gtata 0.000124 7.72e-05 0.000115
+gtatc 0.000222 0.000139 0.000295
+gtatg 0.000376 0.000116 0.000252
+gtatt 0.000162 0.000181 0.00015
+gtcaa 0.00023 0.00165 0.00033
+gtcac 0.000397 0.00156 0.000622
+gtcag 0.00033 0.000603 0.000646
+gtcat 0.000239 0.00176 0.00022
+gtcca 0.000969 0.00057 0.000339
+gtccc 0.000844 0.00101 0.000735
+gtccg 0.00112 0.00044 0.000429
+gtcct 0.000502 0.00105 0.000372
+gtcga 0.000852 0.00114 0.000222
+gtcgc 0.00199 0.00144 0.000758
+gtcgg 0.00175 0.00103 0.000373
+gtcgt 0.000775 0.00124 0.000261
+gtcta 0.000142 0.000519 0.000135
+gtctc 0.000505 0.000954 0.000903
+gtctg 0.000529 0.000458 0.00102
+gtctt 0.00017 0.000715 0.000353
+gtgaa 2.16e-05 0.00208 0.000618
+gtgac 2.16e-05 0.00197 0.00141
+gtgag 2.16e-05 0.00181 0.00132
+gtgat 2.16e-05 0.00159 0.000507
+gtgca 0.00129 0.00268 0.000575
+gtgcc 0.00139 0.0026 0.00127
+gtgcg 0.00235 0.00311 0.00104
+gtgct 0.000818 0.00458 0.000594
+gtgga 0.0011 0.00526 0.000927
+gtggc 0.00144 0.00381 0.00177
+gtggg 0.00132 0.00234 0.000981
+gtggt 0.000571 0.0036 0.0011
+gtgta 0.000251 0.000697 0.000357
+gtgtc 0.000493 0.00177 0.00087
+gtgtg 0.00116 0.0019 0.00158
+gtgtt 0.000329 0.00176 0.000295
+gttaa 0.000125 0.0003 2.42e-05
+gttac 0.000128 0.000201 0.000412
+gttag 0.000117 0.000103 2.42e-05
+gttat 0.000109 0.000216 0.000168
+gttca 0.00165 0.000408 0.000229
+gttcc 0.00213 0.000487 0.000378
+gttcg 0.00174 0.000325 0.000279
+gttct 0.00104 0.00049 0.000217
+gttga 0.000424 0.000641 2.42e-05
+gttgc 0.000718 0.000556 0.000296
+gttgg 0.00117 0.00065 0.000281
+gttgt 0.000411 0.00065 0.000252
+gttta 0.000251 0.000193 0.000152
+gtttc 0.000476 0.000263 0.000487
+gtttg 0.00192 0.000281 0.000423
+gtttt 0.000376 0.000345 0.000289
+taaaa 0.000423 0.000451 0.000322
+taaac 0.000495 0.000295 0.000539
+taaag 0.000704 0.000236 0.000545
+taaat 0.000308 0.000428 0.000214
+taaca 0.00137 0.000426 0.000246
+taacc 0.00132 0.000325 0.000325
+taacg 0.00133 0.000304 0.000313
+taact 0.000764 0.000396 0.000184
+taaga 0.00184 0.00101 0.000181
+taagc 0.00172 0.000615 0.000316
+taagg 0.00224 0.000538 0.000193
+taagt 0.000916 0.00044 0.000171
+taata 0.000154 0.00021 0.000159
+taatc 0.000301 0.000277 0.000448
+taatg 0.000552 0.000181 0.000384
+taatt 0.000161 0.000234 0.000223
+tacaa 0.000346 0.00188 0.000292
+tacac 0.000538 0.00108 0.000558
+tacag 0.00061 0.000846 0.000781
+tacat 0.000229 0.00143 0.000192
+tacca 0.00148 0.00141 0.000272
+taccc 0.000721 0.00123 0.000653
+taccg 0.00116 0.00127 0.000484
+tacct 0.000619 0.00189 0.000234
+tacga 0.000654 0.00193 0.000231
+tacgc 0.00164 0.00111 0.00063
+tacgg 0.00162 0.0011 0.000479
+tacgt 0.000672 0.00125 0.000292
+tacta 0.000158 0.000729 0.000112
+tactc 0.000348 0.000776 0.0006
+tactg 0.000433 0.000734 0.000693
+tactt 0.000191 0.00101 0.000233
+tagaa 0.000269 0.00234 0.000478
+tagac 0.000277 0.00135 0.000899
+tagag 0.000406 0.0014 0.00136
+tagat 0.000115 0.00167 0.000484
+tagca 0.00123 0.00232 0.000533
+tagcc 0.00108 0.00135 0.000819
+tagcg 0.00151 0.00171 0.000746
+tagct 0.000674 0.00275 0.000426
+tagga 0.000492 0.00402 0.000431
+taggc 0.000466 0.00247 0.000709
+taggg 0.000619 0.00158 0.000565
+taggt 0.000187 0.00161 0.000287
+tagta 0.000148 0.000765 0.000122
+tagtc 0.000261 0.000891 0.000338
+tagtg 0.00061 0.00077 0.000754
+tagtt 0.000127 0.00116 0.000273
+tataa 0.000176 0.000244 2.42e-05
+tatac 0.000171 0.000169 0.000383
+tatag 0.000212 0.000104 2.42e-05
+tatat 0.000135 0.000184 0.000147
+tatca 0.00159 0.000378 0.000222
+tatcc 0.00142 0.000364 0.000307
+tatcg 0.00165 0.000347 0.000293
+tatct 0.000895 0.000483 0.000216
+tatga 0.00093 0.00106 2.42e-05
+tatgc 0.00117 0.000708 0.000209
+tatgg 0.0017 0.000655 0.00026
+tatgt 0.000656 0.00063 0.000207
+tatta 0.00024 0.000171 0.000103
+tattc 0.000379 0.000247 0.000419
+tattg 0.000703 0.000169 0.000277
+tattt 0.000216 0.000338 0.000264
+tcaaa 0.000317 0.00056 0.000874
+tcaac 0.000382 0.000357 0.0035
+tcaag 0.000572 0.00026 0.00413
+tcaat 0.000172 0.000297 0.000652
+tcaca 0.000593 0.00077 0.000903
+tcacc 0.000524 0.000719 0.00344
+tcacg 0.000714 0.000667 0.00222
+tcact 0.00042 0.000634 0.000725
+tcaga 0.000584 0.00101 0.000324
+tcagc 0.000822 0.000862 0.0021
+tcagg 0.000567 0.000545 0.000556
+tcagt 0.00035 0.000449 0.000473
+tcata 0.000105 0.000145 0.000357
+tcatc 0.00039 0.00041 0.00467
+tcatg 0.000402 0.000222 0.0027
+tcatt 0.000188 0.000376 0.000932
+tccaa 0.000307 0.00151 0.000459
+tccac 0.00073 0.000921 0.0017
+tccag 0.000665 0.000603 0.00231
+tccat 0.000269 0.00121 0.000357
+tccca 0.000749 0.000804 0.000884
+tcccc 0.000545 0.000781 0.00211
+tcccg 0.000852 0.000524 0.0014
+tccct 0.000511 0.00114 0.0007
+tccga 0.000529 0.0012 0.000411
+tccgc 0.00175 0.000921 0.00257
+tccgg 0.0014 0.000743 0.00105
+tccgt 0.000694 0.00112 0.000691
+tccta 0.000125 0.000444 0.000251
+tcctc 0.000553 0.00105 0.00263
+tcctg 0.000698 0.000393 0.00426
+tcctt 0.000208 0.00086 0.000585
+tcgaa 0.000204 0.000553 0.000406
+tcgac 0.000388 0.00084 0.00342
+tcgag 0.000579 0.000804 0.00308
+tcgat 0.0002 0.000594 0.000681
+tcgca 0.000632 0.00139 0.000836
+tcgcc 0.000701 0.00137 0.00367
+tcgcg 0.000835 0.000884 0.00184
+tcgct 0.000571 0.00184 0.00116
+tcgga 0.000509 0.00169 0.000575
+tcggc 0.00156 0.00171 0.00241
+tcggg 0.0011 0.001 0.00101
+tcggt 0.000312 0.000795 0.000498
+tcgta 0.000186 0.000553 0.00028
+tcgtc 0.000498 0.000869 0.00209
+tcgtg 0.000958 0.000963 0.00376
+tcgtt 0.000212 0.000756 0.000512
+tctaa 0.00018 0.000244 2.42e-05
+tctac 0.000337 0.000208 0.00302
+tctag 0.000173 0.000116 2.42e-05
+tctat 9.41e-05 0.000202 0.00042
+tctca 0.000792 0.000576 0.000633
+tctcc 0.00061 0.00065 0.00239
+tctcg 0.000575 0.000583 0.00147
+tctct 0.000701 0.000632 0.000647
+tctga 0.000675 0.000772 2.42e-05
+tctgc 0.00158 0.000941 0.00157
+tctgg 0.00127 0.000815 0.000812
+tctgt 0.000519 0.000705 0.000512
+tctta 0.000174 0.000102 0.000126
+tcttc 0.00045 0.000325 0.00362
+tcttg 0.000621 0.000223 0.000807
+tcttt 0.00025 0.00029 0.000609
+tgaaa 0.000593 0.000305 0.000812
+tgaac 0.000342 0.000229 0.00204
+tgaag 0.00102 0.00022 0.00286
+tgaat 0.000316 0.000262 0.000362
+tgaca 0.00135 0.000313 0.000638
+tgacc 0.00119 0.000289 0.00128
+tgacg 0.00143 0.000381 0.00251
+tgact 0.000632 0.000325 0.000618
+tgaga 0.00126 0.000832 0.000517
+tgagc 0.00125 0.000747 0.00233
+tgagg 0.00174 0.000651 0.000952
+tgagt 0.000662 0.000364 0.000657
+tgata 0.000272 0.000127 0.000237
+tgatc 0.000537 0.000179 0.00159
+tgatg 0.00148 0.000153 0.00204
+tgatt 0.000341 0.000243 0.000556
+tgcaa 0.000385 0.000973 0.000613
+tgcac 0.000671 0.00094 0.00293
+tgcag 0.000943 0.000715 0.0054
+tgcat 0.000372 0.000888 0.000667
+tgcca 0.00126 0.000959 0.00104
+tgccc 0.000839 0.000907 0.00284
+tgccg 0.00168 0.00104 0.00278
+tgcct 0.000562 0.00156 0.00057
+tgcga 0.000537 0.0014 0.000657
+tgcgc 0.000999 0.00103 0.00441
+tgcgg 0.00116 0.0012 0.00245
+tgcgt 0.000476 0.0012 0.00144
+tgcta 0.000264 0.000449 0.000348
+tgctc 0.000511 0.000645 0.00429
+tgctg 0.00122 0.000692 0.00917
+tgctt 0.000203 0.000743 0.000618
+tggaa 0.000398 0.000715 0.00131
+tggac 0.000446 0.00057 0.00494
+tggag 0.00138 0.000729 0.00847
+tggat 0.000342 0.000435 0.00144
+tggca 0.00137 0.000786 0.00137
+tggcc 0.000956 0.000556 0.00411
+tggcg 0.00148 0.000743 0.00463
+tggct 0.000948 0.0011 0.00139
+tggga 0.000658 0.00129 0.00123
+tgggc 0.000779 0.000963 0.00389
+tgggg 0.00102 0.000902 0.00193
+tgggt 0.000463 0.000715 0.000985
+tggta 0.000212 0.000272 0.000473
+tggtc 0.000385 0.000355 0.00115
+tggtg 0.00133 0.00043 0.00707
+tggtt 0.000273 0.000369 0.000613
+tgtaa 0.000183 0.000244 2.42e-05
+tgtac 0.000306 0.000206 0.00182
+tgtag 0.000323 0.000147 2.42e-05
+tgtat 0.00014 0.000187 0.000324
+tgtca 0.000909 0.000413 0.000585
+tgtcc 0.00048 0.000323 0.00155
+tgtcg 0.000671 0.000312 0.00195
+tgtct 0.000623 0.000582 0.000763
+tgtga 0.000974 0.000701 2.42e-05
+tgtgc 0.00159 0.000743 0.0026
+tgtgg 0.00179 0.000748 0.0016
+tgtgt 0.000999 0.000893 0.00085
+tgtta 0.000163 0.000138 0.000227
+tgttc 0.000441 0.000243 0.00228
+tgttg 0.000568 0.000158 0.00105
+tgttt 0.000282 0.00033 0.00117
+ttaaa 2.16e-05 0.000251 0.000242
+ttaac 2.16e-05 0.000155 0.000322
+ttaag 2.16e-05 0.000117 0.000353
+ttaat 2.16e-05 0.000194 0.000155
+ttaca 0.0012 0.000267 0.000207
+ttacc 0.00135 0.000264 0.000269
+ttacg 0.00124 0.000233 0.000221
+ttact 0.000747 0.000243 0.000114
+ttaga 2.16e-05 0.000288 8.21e-05
+ttagc 2.16e-05 0.000224 0.000192
+ttagg 2.16e-05 0.000189 9.78e-05
+ttagt 2.16e-05 0.000192 0.000114
+ttata 0.000124 7.72e-05 0.000115
+ttatc 0.000222 0.000139 0.000295
+ttatg 0.000376 0.000116 0.000252
+ttatt 0.000162 0.000181 0.00015
+ttcaa 0.00023 0.00163 0.00033
+ttcac 0.000397 0.00144 0.000622
+ttcag 0.00033 0.000945 0.000646
+ttcat 0.000239 0.00188 0.00022
+ttcca 0.000988 0.00163 0.000339
+ttccc 0.000752 0.00162 0.000735
+ttccg 0.000926 0.00191 0.000429
+ttcct 0.000638 0.00242 0.000372
+ttcga 0.000459 0.00159 0.000222
+ttcgc 0.00127 0.00111 0.000758
+ttcgg 0.0012 0.000893 0.000373
+ttcgt 0.000481 0.00123 0.000261
+ttcta 0.000142 0.000926 0.000139
+ttctc 0.000505 0.00131 0.000744
+ttctg 0.000529 0.000898 0.00111
+ttctt 0.00017 0.00104 0.000291
+ttgaa 2.16e-05 0.00147 0.000623
+ttgac 2.16e-05 0.0012 0.00126
+ttgag 2.16e-05 0.00106 0.00163
+ttgat 2.16e-05 0.00106 0.000541
+ttgca 0.000817 0.000631 0.000783
+ttgcc 0.00104 0.000528 0.00111
+ttgcg 0.00111 0.000496 0.000773
+ttgct 0.000581 0.000828 0.000556
+ttgga 0.000571 0.00111 0.000715
+ttggc 0.000751 0.00101 0.00115
+ttggg 0.000896 0.000664 0.000657
+ttggt 0.000353 0.000631 0.000541
+ttgta 0.000186 0.000533 0.000304
+ttgtc 0.000319 0.00118 0.000841
+ttgtg 0.000698 0.00124 0.00157
+ttgtt 0.000178 0.00112 0.000556
+tttaa 0.000125 0.0003 2.42e-05
+tttac 0.000128 0.000201 0.000412
+tttag 0.000117 0.000103 2.42e-05
+tttat 0.000109 0.000216 0.000168
+tttca 0.00137 0.000408 0.000229
+tttcc 0.00176 0.000487 0.000378
+tttcg 0.00111 0.000325 0.000279
+tttct 0.000963 0.00049 0.000217
+tttga 0.000335 0.0016 2.42e-05
+tttgc 0.00057 0.00119 0.000296
+tttgg 0.000793 0.00106 0.000281
+tttgt 0.00033 0.0011 0.000252
+tttta 0.000181 0.000193 0.000152
+ttttc 0.00032 0.000263 0.000487
+ttttg 0.00113 0.000281 0.000423
+ttttt 0.000239 0.000345 0.000289
+
+# translation initiation motif
+[TRANSINIT]
+# width of motif, n=
+20
+# order of markov model, k=
+2
+# markov chain emission probabilities
+ 0 0.373 0.343 0.104 0.179 0.253 0.203 0.266 0.278 0.321 0.21 0.37 0.0988 0.159 0.349 0.27 0.222 0.159 0.386 0.273 0.182 0.207 0.322 0.276 0.195 0.27 0.236 0.27 0.225 0.101 0.293 0.283 0.323 0.138 0.218 0.471 0.172 0.205 0.265 0.241 0.289 0.242 0.253 0.347 0.158 0.194 0.389 0.181 0.236 0.196 0.239 0.304 0.261 0.13 0.217 0.304 0.348 0.265 0.108 0.241 0.386 0.149 0.128 0.34 0.383
+ 1 0.362 0.325 0.113 0.2 0.224 0.28 0.252 0.243 0.327 0.198 0.396 0.0792 0.132 0.316 0.316 0.237 0.161 0.376 0.269 0.194 0.198 0.324 0.252 0.225 0.264 0.304 0.264 0.168 0.0973 0.31 0.283 0.31 0.124 0.248 0.467 0.162 0.216 0.261 0.239 0.284 0.19 0.286 0.341 0.183 0.146 0.292 0.229 0.333 0.237 0.288 0.271 0.203 0.164 0.193 0.3 0.343 0.208 0.151 0.245 0.396 0.127 0.153 0.347 0.373
+ 2 0.363 0.33 0.132 0.176 0.21 0.242 0.339 0.21 0.325 0.184 0.395 0.0965 0.131 0.298 0.298 0.274 0.144 0.378 0.279 0.198 0.176 0.294 0.309 0.221 0.252 0.287 0.266 0.196 0.0821 0.306 0.276 0.336 0.123 0.23 0.492 0.156 0.213 0.22 0.276 0.291 0.174 0.261 0.385 0.18 0.13 0.304 0.278 0.287 0.23 0.311 0.262 0.197 0.169 0.201 0.273 0.357 0.17 0.185 0.23 0.415 0.128 0.162 0.358 0.351
+ 3 0.367 0.316 0.143 0.173 0.187 0.245 0.36 0.209 0.284 0.216 0.41 0.0896 0.189 0.278 0.278 0.256 0.167 0.365 0.278 0.19 0.188 0.309 0.302 0.201 0.21 0.328 0.274 0.188 0.0886 0.335 0.278 0.297 0.127 0.224 0.5 0.149 0.199 0.24 0.295 0.267 0.19 0.241 0.41 0.159 0.124 0.31 0.31 0.255 0.254 0.284 0.269 0.194 0.178 0.213 0.276 0.333 0.178 0.215 0.209 0.399 0.128 0.163 0.372 0.337
+ 4 0.33 0.33 0.154 0.187 0.159 0.254 0.389 0.198 0.291 0.187 0.373 0.149 0.243 0.27 0.216 0.27 0.149 0.404 0.272 0.175 0.224 0.283 0.257 0.237 0.188 0.333 0.263 0.215 0.0881 0.34 0.302 0.27 0.126 0.273 0.462 0.14 0.192 0.267 0.331 0.209 0.223 0.245 0.409 0.123 0.126 0.287 0.336 0.252 0.268 0.268 0.239 0.225 0.219 0.252 0.252 0.278 0.157 0.23 0.202 0.41 0.139 0.17 0.364 0.327
+ 5 0.381 0.25 0.19 0.179 0.209 0.269 0.366 0.157 0.273 0.203 0.359 0.164 0.233 0.219 0.233 0.315 0.133 0.475 0.2 0.192 0.233 0.289 0.252 0.226 0.148 0.35 0.295 0.208 0.113 0.317 0.282 0.289 0.113 0.265 0.47 0.152 0.181 0.275 0.346 0.198 0.196 0.249 0.436 0.12 0.1 0.244 0.388 0.269 0.288 0.247 0.233 0.233 0.238 0.238 0.266 0.259 0.163 0.285 0.14 0.413 0.15 0.19 0.346 0.314
+ 6 0.337 0.267 0.198 0.198 0.184 0.301 0.412 0.103 0.273 0.164 0.367 0.195 0.256 0.218 0.256 0.269 0.22 0.386 0.22 0.174 0.205 0.307 0.277 0.211 0.126 0.337 0.321 0.216 0.0977 0.338 0.293 0.271 0.0821 0.269 0.485 0.164 0.179 0.277 0.374 0.169 0.203 0.225 0.473 0.0991 0.0828 0.236 0.452 0.229 0.333 0.25 0.167 0.25 0.295 0.233 0.209 0.264 0.11 0.326 0.198 0.366 0.135 0.187 0.361 0.316
+ 7 0.387 0.247 0.194 0.172 0.25 0.266 0.375 0.109 0.317 0.195 0.293 0.195 0.225 0.113 0.338 0.325 0.205 0.348 0.25 0.197 0.227 0.312 0.261 0.199 0.129 0.356 0.292 0.223 0.0924 0.345 0.277 0.286 0.114 0.268 0.463 0.154 0.246 0.262 0.351 0.141 0.162 0.279 0.445 0.113 0.053 0.238 0.47 0.238 0.403 0.224 0.149 0.224 0.352 0.219 0.172 0.258 0.134 0.317 0.188 0.36 0.155 0.19 0.345 0.31
+ 8 0.346 0.202 0.212 0.24 0.316 0.222 0.359 0.103 0.297 0.195 0.288 0.22 0.237 0.145 0.289 0.329 0.201 0.335 0.268 0.195 0.228 0.311 0.293 0.168 0.0984 0.35 0.284 0.268 0.107 0.33 0.277 0.286 0.154 0.208 0.492 0.146 0.237 0.254 0.362 0.147 0.179 0.254 0.479 0.0875 0.0732 0.268 0.506 0.152 0.407 0.186 0.136 0.271 0.336 0.265 0.159 0.239 0.15 0.294 0.211 0.344 0.186 0.179 0.35 0.286
+ 9 0.345 0.195 0.221 0.239 0.351 0.254 0.272 0.123 0.319 0.283 0.225 0.174 0.261 0.174 0.326 0.239 0.199 0.313 0.295 0.193 0.242 0.315 0.279 0.164 0.0895 0.368 0.289 0.253 0.126 0.34 0.301 0.233 0.179 0.244 0.431 0.146 0.234 0.289 0.348 0.129 0.188 0.255 0.444 0.113 0.0759 0.247 0.5 0.177 0.456 0.162 0.118 0.265 0.333 0.231 0.222 0.214 0.157 0.297 0.222 0.324 0.18 0.164 0.344 0.311
+10 0.328 0.192 0.216 0.264 0.383 0.296 0.217 0.104 0.326 0.311 0.156 0.207 0.211 0.211 0.347 0.232 0.175 0.307 0.319 0.199 0.223 0.319 0.283 0.175 0.104 0.353 0.249 0.295 0.116 0.284 0.305 0.295 0.163 0.289 0.378 0.17 0.271 0.253 0.329 0.147 0.172 0.262 0.425 0.142 0.0629 0.289 0.484 0.164 0.479 0.183 0.0986 0.239 0.309 0.209 0.2 0.282 0.187 0.258 0.22 0.335 0.232 0.143 0.277 0.348
+11 0.302 0.183 0.278 0.238 0.346 0.283 0.252 0.118 0.319 0.362 0.159 0.159 0.217 0.236 0.33 0.217 0.153 0.278 0.375 0.193 0.28 0.268 0.298 0.155 0.131 0.333 0.238 0.298 0.0952 0.257 0.362 0.286 0.162 0.279 0.39 0.169 0.261 0.218 0.36 0.161 0.153 0.227 0.438 0.182 0.0867 0.26 0.486 0.168 0.493 0.194 0.0896 0.224 0.266 0.257 0.275 0.202 0.2 0.229 0.247 0.324 0.209 0.157 0.304 0.33
+12 0.283 0.175 0.292 0.25 0.317 0.244 0.276 0.163 0.287 0.344 0.181 0.188 0.216 0.265 0.333 0.186 0.2 0.229 0.4 0.171 0.25 0.314 0.269 0.167 0.154 0.356 0.191 0.298 0.0928 0.268 0.371 0.268 0.191 0.267 0.336 0.206 0.277 0.188 0.361 0.173 0.145 0.264 0.399 0.192 0.0915 0.287 0.476 0.146 0.458 0.167 0.0833 0.292 0.235 0.261 0.27 0.235 0.198 0.219 0.234 0.349 0.175 0.15 0.358 0.317
+13 0.307 0.142 0.346 0.205 0.315 0.278 0.241 0.167 0.316 0.368 0.161 0.155 0.185 0.306 0.269 0.241 0.152 0.259 0.424 0.165 0.253 0.342 0.247 0.158 0.17 0.369 0.17 0.29 0.0849 0.283 0.434 0.198 0.213 0.305 0.291 0.191 0.284 0.223 0.326 0.167 0.139 0.31 0.348 0.203 0.137 0.305 0.432 0.126 0.463 0.179 0.0896 0.269 0.203 0.271 0.263 0.263 0.23 0.194 0.225 0.351 0.187 0.131 0.355 0.327
+14 0.282 0.137 0.371 0.21 0.246 0.342 0.246 0.167 0.285 0.367 0.19 0.158 0.196 0.381 0.227 0.196 0.173 0.212 0.449 0.167 0.292 0.304 0.267 0.137 0.196 0.35 0.215 0.239 0.0926 0.278 0.481 0.148 0.201 0.295 0.309 0.195 0.226 0.226 0.382 0.166 0.209 0.252 0.331 0.209 0.15 0.3 0.428 0.122 0.347 0.267 0.12 0.267 0.193 0.23 0.281 0.296 0.256 0.174 0.256 0.313 0.189 0.123 0.349 0.34
+15 0.356 0.161 0.364 0.119 0.193 0.298 0.351 0.158 0.287 0.421 0.146 0.146 0.188 0.356 0.228 0.228 0.18 0.293 0.4 0.127 0.308 0.296 0.254 0.142 0.208 0.37 0.214 0.208 0.111 0.274 0.47 0.145 0.248 0.329 0.199 0.224 0.226 0.221 0.374 0.179 0.254 0.29 0.26 0.195 0.157 0.302 0.371 0.17 0.342 0.25 0.132 0.276 0.194 0.254 0.269 0.284 0.271 0.181 0.229 0.319 0.226 0.0968 0.323 0.355
+16 0.333 0.156 0.363 0.148 0.156 0.363 0.363 0.119 0.255 0.393 0.186 0.166 0.233 0.367 0.167 0.233 0.196 0.322 0.364 0.119 0.304 0.354 0.217 0.124 0.205 0.416 0.2 0.179 0.123 0.272 0.474 0.132 0.224 0.301 0.284 0.191 0.204 0.252 0.412 0.133 0.268 0.32 0.275 0.137 0.184 0.316 0.342 0.158 0.282 0.231 0.231 0.256 0.2 0.288 0.232 0.28 0.299 0.174 0.234 0.293 0.26 0.16 0.3 0.28
+17 0.345 0.155 0.388 0.112 0.143 0.336 0.395 0.126 0.281 0.359 0.211 0.148 0.235 0.358 0.148 0.259 0.211 0.336 0.344 0.109 0.327 0.34 0.211 0.122 0.213 0.415 0.226 0.146 0.133 0.276 0.5 0.0918 0.245 0.277 0.296 0.182 0.164 0.279 0.443 0.115 0.296 0.352 0.248 0.104 0.22 0.26 0.339 0.181 0.232 0.232 0.246 0.29 0.223 0.304 0.241 0.232 0.275 0.19 0.261 0.275 0.221 0.186 0.349 0.244
+18 0.363 0.157 0.353 0.127 0.15 0.36 0.37 0.12 0.291 0.327 0.227 0.155 0.231 0.354 0.154 0.262 0.252 0.374 0.262 0.112 0.254 0.402 0.221 0.123 0.194 0.451 0.243 0.111 0.169 0.299 0.455 0.0779 0.266 0.245 0.288 0.201 0.169 0.305 0.409 0.117 0.306 0.387 0.234 0.0721 0.223 0.298 0.309 0.17 0.207 0.259 0.241 0.293 0.276 0.253 0.184 0.287 0.293 0.195 0.228 0.285 0.254 0.183 0.31 0.254
+19 0.366 0.161 0.344 0.129 0.131 0.429 0.393 0.0476 0.28 0.4 0.227 0.0933 0.22 0.356 0.153 0.271 0.217 0.41 0.265 0.108 0.297 0.366 0.238 0.099 0.178 0.475 0.277 0.0693 0.164 0.284 0.493 0.0597 0.279 0.279 0.295 0.148 0.153 0.314 0.438 0.0949 0.333 0.344 0.247 0.0753 0.28 0.28 0.28 0.16 0.217 0.326 0.283 0.174 0.29 0.261 0.203 0.246 0.353 0.153 0.294 0.2 0.333 0.185 0.222 0.259
+
+# dss upstream motif, reading frame 0(reverse)
+[ETMOTIF0]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+# dss upstream motif, reading frame 1(reverse)
+[ETMOTIF1]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+# dss upstream motif, reading frame 2(reverse)
+[ETMOTIF2]
+# width of motif, n=
+0
+# order of markov model, k=
+2
+# markov chain emission probabilities
+
+
+#
+# Emission probabilities
+#
+[EMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.219 0.3201 0.1991
+aaaac 0.2566 0.209 0.3326
+aaaag 0.3647 0.1675 0.3363
+aaaat 0.1597 0.3035 0.132
+aaaca 0.2865 0.2933 0.2308
+aaacc 0.2764 0.224 0.3043
+aaacg 0.2777 0.2095 0.293
+aaact 0.1594 0.2732 0.1719
+aaaga 0.2737 0.3736 0.2101
+aaagc 0.256 0.2279 0.3669
+aaagg 0.3339 0.2078 0.2241
+aaagt 0.1364 0.1907 0.1989
+aaata 0.1316 0.2332 0.1312
+aaatc 0.2576 0.307 0.3688
+aaatg 0.4727 0.2008 0.3161
+aaatt 0.1381 0.2591 0.1839
+aacaa 0.2009 0.3455 0.1603
+aacac 0.312 0.2116 0.306
+aacag 0.354 0.1403 0.4285
+aacat 0.1331 0.3027 0.1053
+aacca 0.3712 0.1943 0.1653
+aaccc 0.1815 0.2423 0.3975
+aaccg 0.2917 0.2065 0.2946
+aacct 0.1556 0.3569 0.1425
+aacga 0.1427 0.3176 0.1413
+aacgc 0.3574 0.2484 0.3861
+aacgg 0.3534 0.1938 0.2936
+aacgt 0.1465 0.2402 0.179
+aacta 0.1397 0.1875 0.06853
+aactc 0.3081 0.2642 0.3662
+aactg 0.3828 0.1903 0.423
+aactt 0.1694 0.358 0.1422
+aagaa 0.2525 0.4095 0.1647
+aagac 0.2596 0.1705 0.2796
+aagag 0.3803 0.1599 0.3886
+aagat 0.1075 0.2601 0.1671
+aagca 0.2733 0.2987 0.1689
+aagcc 0.2408 0.1839 0.3624
+aagcg 0.3361 0.1991 0.2998
+aagct 0.1499 0.3183 0.1689
+aagga 0.279 0.409 0.2164
+aaggc 0.2643 0.2546 0.3558
+aaggg 0.3507 0.1578 0.2836
+aaggt 0.1061 0.1786 0.1442
+aagta 0.1294 0.2208 0.08205
+aagtc 0.2276 0.2694 0.2275
+aagtg 0.5326 0.1931 0.5069
+aagtt 0.1105 0.3168 0.1836
+aataa 0.2539 0.3483 0.04175
+aatac 0.2461 0.2417 0.6618
+aatag 0.3053 0.1483 0.04175
+aatat 0.1947 0.2617 0.2547
+aatca 0.2867 0.2403 0.214
+aatcc 0.2556 0.2314 0.2953
+aatcg 0.2967 0.221 0.2826
+aatct 0.161 0.3073 0.2081
+aatga 0.2088 0.3222 0.03454
+aatgc 0.2632 0.2613 0.2988
+aatgg 0.3809 0.1749 0.3713
+aatgt 0.1471 0.2417 0.2953
+aatta 0.1561 0.1846 0.09659
+aattc 0.2461 0.2668 0.3943
+aattg 0.4571 0.1833 0.2602
+aattt 0.1406 0.3654 0.2489
+acaaa 0.2196 0.3802 0.1333
+acaac 0.2646 0.2421 0.3331
+acaag 0.3966 0.1762 0.4591
+acaat 0.1192 0.2016 0.07453
+acaca 0.2492 0.33 0.1567
+acacc 0.2816 0.2636 0.2884
+acacg 0.308 0.2153 0.4749
+acact 0.1612 0.1911 0.07994
+acaga 0.3055 0.3428 0.1122
+acagc 0.3339 0.2824 0.6328
+acagg 0.2835 0.1865 0.1547
+acagt 0.07717 0.1883 0.1004
+acata 0.09661 0.1256 0.04424
+acatc 0.3596 0.3556 0.4939
+acatg 0.3705 0.1925 0.3255
+acatt 0.1733 0.3262 0.1364
+accaa 0.1558 0.3094 0.06777
+accac 0.3703 0.3218 0.4003
+accag 0.3374 0.1188 0.476
+accat 0.1366 0.25 0.05595
+accca 0.2495 0.2318 0.1659
+acccc 0.2163 0.2793 0.3665
+acccg 0.3031 0.1233 0.3835
+accct 0.2311 0.3655 0.08407
+accga 0.1209 0.282 0.06861
+accgc 0.4006 0.2801 0.6304
+accgg 0.3197 0.1597 0.1887
+accgt 0.1588 0.2782 0.1123
+accta 0.07923 0.1934 0.03803
+acctc 0.349 0.284 0.3448
+acctg 0.4406 0.1794 0.5609
+acctt 0.1311 0.3432 0.05629
+acgaa 0.1491 0.2637 0.07025
+acgac 0.2831 0.2687 0.4073
+acgag 0.4219 0.2537 0.4175
+acgat 0.1459 0.2139 0.1049
+acgca 0.2687 0.251 0.1269
+acgcc 0.2322 0.1777 0.4156
+acgcg 0.3321 0.2166 0.3605
+acgct 0.167 0.3547 0.09701
+acgga 0.1462 0.3154 0.1484
+acggc 0.4477 0.2809 0.4413
+acggg 0.3167 0.2291 0.3108
+acggt 0.08941 0.1746 0.09946
+acgta 0.1004 0.1858 0.0408
+acgtc 0.2684 0.2375 0.2542
+acgtg 0.5169 0.3328 0.6388
+acgtt 0.1144 0.2439 0.06622
+actaa 0.229 0.3171 0.008183
+actac 0.4303 0.2701 0.8511
+actag 0.2207 0.1502 0.008183
+actat 0.12 0.2625 0.1326
+actca 0.3343 0.236 0.09354
+actcc 0.1684 0.2662 0.3151
+actcg 0.3027 0.2389 0.4777
+actct 0.1946 0.259 0.1136
+actga 0.1763 0.2387 0.006803
+actgc 0.3508 0.2911 0.5306
+actgg 0.3595 0.2521 0.3537
+actgt 0.1134 0.2181 0.1088
+actta 0.1165 0.1082 0.02407
+acttc 0.301 0.3458 0.613
+acttg 0.4153 0.2376 0.1769
+acttt 0.1671 0.3085 0.1861
+agaaa 0.228 0.3003 0.1268
+agaac 0.1848 0.2255 0.254
+agaag 0.4537 0.2163 0.5536
+agaat 0.1336 0.2578 0.06563
+agaca 0.289 0.2395 0.1314
+agacc 0.2231 0.2207 0.2541
+agacg 0.3333 0.2913 0.5248
+agact 0.1546 0.2484 0.08964
+agaga 0.2771 0.3209 0.1472
+agagc 0.2304 0.288 0.4649
+agagg 0.3716 0.251 0.286
+agagt 0.1209 0.1402 0.102
+agata 0.1032 0.1814 0.04379
+agatc 0.2039 0.2546 0.4117
+agatg 0.5635 0.218 0.4167
+agatt 0.1295 0.3461 0.1278
+agcaa 0.1729 0.3139 0.06798
+agcac 0.3279 0.2034 0.2784
+agcag 0.3787 0.244 0.5952
+agcat 0.1205 0.2387 0.05841
+agcca 0.3387 0.2385 0.154
+agccc 0.1929 0.1866 0.3581
+agccg 0.3137 0.2166 0.3711
+agcct 0.1546 0.3583 0.1168
+agcga 0.2083 0.3471 0.1296
+agcgc 0.3221 0.2036 0.4582
+agcgg 0.3494 0.2329 0.3162
+agcgt 0.1202 0.2164 0.09602
+agcta 0.1053 0.1608 0.03318
+agctc 0.3113 0.3296 0.2756
+agctg 0.4776 0.2492 0.6159
+agctt 0.1057 0.2605 0.07529
+aggaa 0.1669 0.3245 0.0835
+aggac 0.1947 0.2114 0.2531
+aggag 0.5205 0.2576 0.5726
+aggat 0.1179 0.2065 0.09078
+aggca 0.2941 0.2566 0.1114
+aggcc 0.2457 0.2236 0.3829
+aggcg 0.3097 0.2426 0.3815
+aggct 0.1505 0.2772 0.1242
+aggga 0.194 0.3857 0.1314
+agggc 0.3269 0.2688 0.4694
+agggg 0.3694 0.2042 0.2819
+agggt 0.1097 0.1414 0.1173
+aggta 0.1067 0.1908 0.06657
+aggtc 0.2071 0.249 0.1867
+aggtg 0.5449 0.3014 0.6375
+aggtt 0.1413 0.2588 0.1093
+agtaa 0.192 0.3115 0.007669
+agtac 0.3216 0.2623 0.8528
+agtag 0.3398 0.1878 0.007669
+agtat 0.1466 0.2385 0.1319
+agtca 0.3451 0.2532 0.1196
+agtcc 0.19 0.198 0.2707
+agtcg 0.3007 0.1915 0.4573
+agtct 0.1641 0.3572 0.1524
+agtga 0.2677 0.2968 0.007599
+agtgc 0.2645 0.2527 0.4711
+agtgg 0.3323 0.2898 0.3754
+agtgt 0.1355 0.1608 0.1459
+agtta 0.1123 0.1588 0.03333
+agttc 0.3033 0.2799 0.5465
+agttg 0.3903 0.1817 0.1889
+agttt 0.1941 0.3795 0.2313
+ataaa 0.25 0.3502 0.2255
+ataac 0.25 0.2166 0.301
+ataag 0.25 0.1629 0.3292
+ataat 0.25 0.2704 0.1443
+ataca 0.2652 0.2648 0.2548
+atacc 0.2964 0.2625 0.3323
+atacg 0.2738 0.2311 0.2727
+atact 0.1646 0.2416 0.1401
+ataga 0.25 0.322 0.1692
+atagc 0.25 0.2513 0.3955
+atagg 0.25 0.212 0.2015
+atagt 0.25 0.2147 0.2338
+atata 0.1406 0.1503 0.1414
+atatc 0.2506 0.2711 0.3631
+atatg 0.4254 0.2255 0.311
+atatt 0.1834 0.3531 0.1845
+atcaa 0.1926 0.3423 0.1814
+atcac 0.3318 0.2371 0.3422
+atcag 0.2758 0.1271 0.3555
+atcat 0.1998 0.2935 0.1209
+atcca 0.299 0.2254 0.1809
+atccc 0.2276 0.194 0.3921
+atccg 0.2803 0.2208 0.2286
+atcct 0.1932 0.3598 0.1983
+atcga 0.1346 0.3409 0.1376
+atcgc 0.3715 0.2673 0.4697
+atcgg 0.3525 0.1538 0.2311
+atcgt 0.1413 0.2379 0.1616
+atcta 0.1053 0.1998 0.06088
+atctc 0.3754 0.2676 0.3261
+atctg 0.3931 0.1985 0.4854
+atctt 0.1262 0.3341 0.1276
+atgaa 0.25 0.3458 0.189
+atgac 0.25 0.2216 0.3315
+atgag 0.25 0.1583 0.3293
+atgat 0.25 0.2743 0.1503
+atgca 0.2308 0.2498 0.1921
+atgcc 0.2926 0.1455 0.3957
+atgcg 0.3124 0.2232 0.2512
+atgct 0.1642 0.3815 0.1609
+atgga 0.2222 0.3892 0.2061
+atggc 0.2921 0.2673 0.4211
+atggg 0.3485 0.1619 0.2545
+atggt 0.1372 0.1816 0.1183
+atgta 0.1347 0.1238 0.08704
+atgtc 0.231 0.2376 0.263
+atgtg 0.5051 0.2871 0.487
+atgtt 0.1292 0.3515 0.163
+attaa 0.2619 0.3661 0.03846
+attac 0.2664 0.245 0.6558
+attag 0.2438 0.1254 0.03846
+attat 0.228 0.2635 0.2673
+attca 0.2632 0.2386 0.2079
+attcc 0.3382 0.285 0.3425
+attcg 0.2138 0.19 0.2527
+attct 0.1848 0.2864 0.1969
+attga 0.1653 0.318 0.02829
+attgc 0.2811 0.2309 0.3465
+attgg 0.3909 0.211 0.3296
+attgt 0.1627 0.2401 0.2956
+attta 0.0967 0.1784 0.1127
+atttc 0.1714 0.2432 0.3605
+atttg 0.6039 0.2595 0.3131
+atttt 0.128 0.3189 0.2138
+caaaa 0.1834 0.3201 0.1991
+caaac 0.2718 0.209 0.3326
+caaag 0.3963 0.1675 0.3363
+caaat 0.1486 0.3035 0.132
+caaca 0.3011 0.2933 0.2308
+caacc 0.2643 0.224 0.3043
+caacg 0.2882 0.2095 0.293
+caact 0.1464 0.2732 0.1719
+caaga 0.2723 0.3648 0.2101
+caagc 0.2475 0.2382 0.3669
+caagg 0.3357 0.2174 0.2241
+caagt 0.1445 0.1796 0.1989
+caata 0.1316 0.2332 0.1312
+caatc 0.2576 0.307 0.3688
+caatg 0.4727 0.2008 0.3161
+caatt 0.1381 0.2591 0.1839
+cacaa 0.2229 0.3524 0.1322
+cacac 0.3119 0.2381 0.2781
+cacag 0.3325 0.1515 0.5122
+cacat 0.1327 0.258 0.07751
+cacca 0.4018 0.2462 0.1653
+caccc 0.1292 0.2097 0.3846
+caccg 0.3152 0.2181 0.3339
+cacct 0.1538 0.326 0.1162
+cacga 0.124 0.2618 0.1355
+cacgc 0.3696 0.2737 0.3939
+cacgg 0.3524 0.2124 0.2977
+cacgt 0.154 0.2521 0.1729
+cacta 0.1397 0.1836 0.07386
+cactc 0.3081 0.2721 0.339
+cactg 0.3828 0.2466 0.4432
+cactt 0.1694 0.2976 0.1439
+cagaa 0.2525 0.3387 0.1382
+cagac 0.2596 0.1807 0.2412
+cagag 0.3803 0.2115 0.4742
+cagat 0.1075 0.2691 0.1464
+cagca 0.3224 0.3469 0.272
+cagcc 0.2003 0.1588 0.3248
+cagcg 0.3338 0.1927 0.2395
+cagct 0.1435 0.3016 0.1637
+cagga 0.3054 0.3638 0.2164
+caggc 0.2482 0.3008 0.3558
+caggg 0.3464 0.1777 0.2836
+caggt 0.1 0.1577 0.1442
+cagta 0.1294 0.1974 0.08205
+cagtc 0.2276 0.2477 0.2275
+cagtg 0.5326 0.2265 0.5069
+cagtt 0.1105 0.3285 0.1836
+cataa 0.2539 0.3483 0.04175
+catac 0.2461 0.2417 0.6618
+catag 0.3053 0.1483 0.04175
+catat 0.1947 0.2617 0.2547
+catca 0.3141 0.2403 0.214
+catcc 0.2248 0.2314 0.2953
+catcg 0.2956 0.221 0.2826
+catct 0.1655 0.3073 0.2081
+catga 0.19 0.3462 0.03454
+catgc 0.2685 0.2324 0.2988
+catgg 0.394 0.2147 0.3713
+catgt 0.1475 0.2067 0.2953
+catta 0.1545 0.1846 0.09659
+cattc 0.2446 0.2668 0.3943
+cattg 0.4835 0.1833 0.2602
+cattt 0.1173 0.3654 0.2489
+ccaaa 0.2196 0.3802 0.09499
+ccaac 0.2646 0.2421 0.3541
+ccaag 0.3966 0.1762 0.4991
+ccaat 0.1192 0.2016 0.05181
+ccaca 0.2249 0.2108 0.1333
+ccacc 0.3117 0.3865 0.4592
+ccacg 0.2781 0.2152 0.3233
+ccact 0.1852 0.1874 0.08418
+ccaga 0.2322 0.3695 0.05542
+ccagc 0.3225 0.3079 0.6474
+ccagg 0.3313 0.1605 0.199
+ccagt 0.114 0.1621 0.09824
+ccata 0.09661 0.1256 0.03158
+ccatc 0.3596 0.3556 0.4941
+ccatg 0.3705 0.1925 0.3851
+ccatt 0.1733 0.3262 0.08916
+cccaa 0.1207 0.3105 0.08684
+cccac 0.3793 0.2853 0.3342
+cccag 0.373 0.1828 0.5013
+cccat 0.127 0.2214 0.07763
+cccca 0.2728 0.1774 0.1165
+ccccc 0.2018 0.3802 0.4301
+ccccg 0.403 0.21 0.335
+cccct 0.1223 0.2324 0.1184
+cccga 0.1362 0.297 0.1178
+cccgc 0.3689 0.2533 0.4404
+cccgg 0.3429 0.2178 0.2577
+cccgt 0.152 0.2318 0.1841
+cccta 0.07923 0.1536 0.0399
+ccctc 0.349 0.3169 0.366
+ccctg 0.4406 0.2538 0.5082
+ccctt 0.1311 0.2757 0.08586
+ccgaa 0.1491 0.1981 0.05701
+ccgac 0.2831 0.3011 0.4278
+ccgag 0.4219 0.2881 0.4242
+ccgat 0.1459 0.2127 0.09091
+ccgca 0.2789 0.2019 0.09076
+ccgcc 0.2686 0.292 0.5094
+ccgcg 0.3048 0.1753 0.2756
+ccgct 0.1477 0.3309 0.1243
+ccgga 0.1291 0.2832 0.12
+ccggc 0.4791 0.3623 0.4698
+ccggg 0.314 0.218 0.3071
+ccggt 0.07791 0.1365 0.1031
+ccgta 0.1024 0.2154 0.0524
+ccgtc 0.2123 0.2769 0.283
+ccgtg 0.5736 0.2892 0.603
+ccgtt 0.1117 0.2185 0.06165
+cctaa 0.229 0.3171 0.00994
+cctac 0.4303 0.2701 0.8588
+cctag 0.2207 0.1502 0.00994
+cctat 0.12 0.2625 0.1213
+cctca 0.3247 0.1969 0.1017
+cctcc 0.1967 0.372 0.4824
+cctcg 0.2828 0.1909 0.2981
+cctct 0.1958 0.2402 0.1178
+cctga 0.1254 0.2349 0.008319
+cctgc 0.3803 0.272 0.5341
+cctgg 0.385 0.2844 0.3644
+cctgt 0.1092 0.2087 0.09318
+cctta 0.1165 0.1082 0.04691
+ccttc 0.301 0.3458 0.651
+ccttg 0.4153 0.2376 0.1899
+ccttt 0.1671 0.3085 0.1121
+cgaaa 0.1768 0.3003 0.1298
+cgaac 0.2279 0.2255 0.2964
+cgaag 0.4479 0.2163 0.5016
+cgaat 0.1473 0.2578 0.07229
+cgaca 0.2294 0.2395 0.1136
+cgacc 0.2539 0.2207 0.3156
+cgacg 0.3567 0.2913 0.4867
+cgact 0.16 0.2484 0.08415
+cgaga 0.2028 0.313 0.1201
+cgagc 0.2761 0.3537 0.547
+cgagg 0.3724 0.1889 0.1939
+cgagt 0.1487 0.1444 0.1389
+cgata 0.07637 0.1814 0.08284
+cgatc 0.1945 0.2546 0.3925
+cgatg 0.5692 0.218 0.3945
+cgatt 0.1599 0.3461 0.1302
+cgcaa 0.1806 0.301 0.07485
+cgcac 0.417 0.2614 0.3821
+cgcag 0.3128 0.1829 0.4931
+cgcat 0.08957 0.2546 0.0499
+cgcca 0.2835 0.2668 0.1267
+cgccc 0.1439 0.1594 0.3616
+cgccg 0.4344 0.2668 0.4291
+cgcct 0.1382 0.3071 0.08264
+cgcga 0.1054 0.345 0.1037
+cgcgc 0.3556 0.2394 0.4663
+cgcgg 0.3377 0.1779 0.3157
+cgcgt 0.2013 0.2378 0.1143
+cgcta 0.1063 0.1741 0.03475
+cgctc 0.3506 0.2833 0.322
+cgctg 0.4342 0.2556 0.5936
+cgctt 0.1089 0.287 0.04958
+cggaa 0.1356 0.3245 0.07435
+cggac 0.2076 0.2114 0.3078
+cggag 0.5579 0.2576 0.5372
+cggat 0.09887 0.2065 0.08069
+cggca 0.238 0.2701 0.09029
+cggcc 0.1929 0.2021 0.3347
+cggcg 0.4022 0.2535 0.4747
+cggct 0.1669 0.2743 0.1003
+cggga 0.1473 0.4 0.1656
+cgggc 0.3385 0.2406 0.4136
+cgggg 0.4015 0.2319 0.3417
+cgggt 0.1128 0.1275 0.07916
+cggta 0.09431 0.1908 0.03642
+cggtc 0.2011 0.249 0.1673
+cggtg 0.5534 0.3014 0.7382
+cggtt 0.1512 0.2588 0.05807
+cgtaa 0.192 0.3115 0.01104
+cgtac 0.3216 0.2623 0.83
+cgtag 0.3398 0.1878 0.01104
+cgtat 0.1466 0.2385 0.1479
+cgtca 0.3393 0.2532 0.1114
+cgtcc 0.1699 0.198 0.2711
+cgtcg 0.3439 0.1915 0.4658
+cgtct 0.1468 0.3572 0.1517
+cgtga 0.1546 0.2461 0.006039
+cgtgc 0.3245 0.2528 0.4372
+cgtgg 0.3588 0.3056 0.3756
+cgtgt 0.1621 0.1955 0.1812
+cgtta 0.1123 0.1588 0.03823
+cgttc 0.3033 0.2799 0.5321
+cgttg 0.3903 0.1817 0.2034
+cgttt 0.1941 0.3795 0.2263
+ctaaa 0.25 0.3502 0.2255
+ctaac 0.25 0.2166 0.301
+ctaag 0.25 0.1629 0.3292
+ctaat 0.25 0.2704 0.1443
+ctaca 0.2714 0.2648 0.2548
+ctacc 0.283 0.2625 0.3323
+ctacg 0.267 0.2311 0.2727
+ctact 0.1786 0.2416 0.1401
+ctaga 0.25 0.322 0.1692
+ctagc 0.25 0.2513 0.3955
+ctagg 0.25 0.212 0.2015
+ctagt 0.25 0.2147 0.2338
+ctata 0.1406 0.1503 0.1414
+ctatc 0.2506 0.2711 0.3631
+ctatg 0.4254 0.2255 0.311
+ctatt 0.1834 0.3531 0.1845
+ctcaa 0.1926 0.351 0.1814
+ctcac 0.3318 0.263 0.3422
+ctcag 0.2758 0.09837 0.3555
+ctcat 0.1998 0.2877 0.1209
+ctcca 0.3087 0.2194 0.1547
+ctccc 0.2082 0.2291 0.4281
+ctccg 0.272 0.1757 0.25
+ctcct 0.2111 0.3757 0.1673
+ctcga 0.09046 0.2557 0.1129
+ctcgc 0.3794 0.3308 0.5222
+ctcgg 0.3913 0.154 0.1956
+ctcgt 0.1388 0.2595 0.1694
+ctcta 0.1053 0.2108 0.06044
+ctctc 0.3754 0.3031 0.293
+ctctg 0.3931 0.1346 0.5165
+ctctt 0.1262 0.3514 0.13
+ctgaa 0.25 0.3119 0.138
+ctgac 0.25 0.2422 0.3359
+ctgag 0.25 0.2363 0.3482
+ctgat 0.25 0.2096 0.1779
+ctgca 0.2334 0.2564 0.1814
+ctgcc 0.3371 0.1723 0.3516
+ctgcg 0.2535 0.2119 0.2522
+ctgct 0.1759 0.3595 0.2149
+ctgga 0.1709 0.3594 0.2026
+ctggc 0.2675 0.245 0.3764
+ctggg 0.4218 0.2027 0.2759
+ctggt 0.1398 0.1929 0.1451
+ctgta 0.1347 0.1432 0.09587
+ctgtc 0.231 0.3172 0.2231
+ctgtg 0.5051 0.3022 0.524
+ctgtt 0.1292 0.2373 0.157
+cttaa 0.2619 0.3661 0.03846
+cttac 0.2664 0.245 0.6558
+cttag 0.2438 0.1254 0.03846
+cttat 0.228 0.2635 0.2673
+cttca 0.2764 0.2386 0.2079
+cttcc 0.3437 0.285 0.3425
+cttcg 0.1943 0.19 0.2527
+cttct 0.1856 0.2864 0.1969
+cttga 0.1722 0.2675 0.02829
+cttgc 0.3144 0.243 0.3465
+cttgg 0.3772 0.2203 0.3296
+cttgt 0.1362 0.2692 0.2956
+cttta 0.1077 0.1784 0.1127
+ctttc 0.1688 0.2432 0.3605
+ctttg 0.6212 0.2595 0.3131
+ctttt 0.1023 0.3189 0.2138
+gaaaa 0.2517 0.3255 0.1991
+gaaac 0.215 0.2118 0.3326
+gaaag 0.3619 0.1569 0.3363
+gaaat 0.1713 0.3059 0.132
+gaaca 0.256 0.2933 0.2308
+gaacc 0.3185 0.224 0.3043
+gaacg 0.2628 0.2095 0.293
+gaact 0.1627 0.2732 0.1719
+gaaga 0.2749 0.4095 0.2101
+gaagc 0.2659 0.2412 0.3669
+gaagg 0.3468 0.2004 0.2241
+gaagt 0.1125 0.1488 0.1989
+gaata 0.1316 0.2332 0.1312
+gaatc 0.2576 0.307 0.3688
+gaatg 0.4727 0.2008 0.3161
+gaatt 0.1381 0.2591 0.1839
+gacaa 0.2009 0.2622 0.1603
+gacac 0.312 0.2522 0.306
+gacag 0.354 0.1592 0.4285
+gacat 0.1331 0.3264 0.1053
+gacca 0.2754 0.2046 0.1653
+gaccc 0.2831 0.2645 0.3975
+gaccg 0.2929 0.1765 0.2946
+gacct 0.1486 0.3545 0.1425
+gacga 0.1611 0.3668 0.1413
+gacgc 0.3558 0.2635 0.3861
+gacgg 0.3593 0.1749 0.2936
+gacgt 0.1239 0.1948 0.179
+gacta 0.1397 0.1617 0.06853
+gactc 0.3081 0.2906 0.3662
+gactg 0.3828 0.2132 0.423
+gactt 0.1694 0.3345 0.1422
+gagaa 0.2525 0.3105 0.1213
+gagac 0.2596 0.2297 0.3371
+gagag 0.3803 0.2348 0.3935
+gagat 0.1075 0.225 0.1481
+gagca 0.2125 0.2291 0.1703
+gagcc 0.2807 0.1618 0.2997
+gagcg 0.3563 0.2312 0.347
+gagct 0.1505 0.3779 0.183
+gagga 0.2735 0.4442 0.258
+gaggc 0.2446 0.2327 0.3292
+gaggg 0.3687 0.1588 0.2936
+gaggt 0.1133 0.1643 0.1192
+gagta 0.1294 0.2168 0.08205
+gagtc 0.2276 0.2365 0.2275
+gagtg 0.5326 0.2218 0.5069
+gagtt 0.1105 0.3249 0.1836
+gataa 0.2539 0.3483 0.04175
+gatac 0.2461 0.2417 0.6618
+gatag 0.3053 0.1483 0.04175
+gatat 0.1947 0.2617 0.2547
+gatca 0.2265 0.2176 0.214
+gatcc 0.3152 0.2954 0.2953
+gatcg 0.322 0.2295 0.2826
+gatct 0.1364 0.2575 0.2081
+gatga 0.2273 0.3779 0.03454
+gatgc 0.2708 0.2188 0.2988
+gatgg 0.3838 0.2108 0.3713
+gatgt 0.1181 0.1926 0.2953
+gatta 0.1561 0.1846 0.09659
+gattc 0.2461 0.2668 0.3943
+gattg 0.4571 0.1833 0.2602
+gattt 0.1406 0.3654 0.2489
+gcaaa 0.2196 0.3802 0.1153
+gcaac 0.2646 0.2421 0.3257
+gcaag 0.3966 0.1762 0.4956
+gcaat 0.1192 0.2016 0.06339
+gcaca 0.2458 0.3135 0.1437
+gcacc 0.2845 0.1633 0.3777
+gcacg 0.3352 0.2825 0.4052
+gcact 0.1346 0.2408 0.07339
+gcaga 0.2003 0.3522 0.1013
+gcagc 0.3759 0.2998 0.6154
+gcagg 0.3085 0.2053 0.1519
+gcagt 0.1152 0.1427 0.1315
+gcata 0.09661 0.1256 0.02952
+gcatc 0.3596 0.3556 0.4678
+gcatg 0.3705 0.1925 0.3989
+gcatt 0.1733 0.3262 0.1037
+gccaa 0.1613 0.2761 0.07672
+gccac 0.3997 0.259 0.4491
+gccag 0.3096 0.1221 0.4086
+gccat 0.1294 0.3427 0.06552
+gccca 0.3042 0.2076 0.1484
+gcccc 0.2088 0.2341 0.4568
+gcccg 0.3442 0.2177 0.2687
+gccct 0.1428 0.3406 0.1262
+gccga 0.1122 0.2809 0.08206
+gccgc 0.4179 0.2854 0.6082
+gccgg 0.3204 0.2088 0.1963
+gccgt 0.1494 0.2249 0.1134
+gccta 0.07923 0.1758 0.04046
+gcctc 0.349 0.3462 0.4127
+gcctg 0.4406 0.2088 0.4821
+gcctt 0.1311 0.2692 0.06474
+gcgaa 0.1014 0.1586 0.0718
+gcgac 0.3025 0.2998 0.3799
+gcgag 0.4555 0.3229 0.4769
+gcgat 0.1406 0.2188 0.07133
+gcgca 0.2541 0.2179 0.09299
+gcgcc 0.2336 0.1774 0.5291
+gcgcg 0.3209 0.2239 0.2698
+gcgct 0.1914 0.3808 0.1081
+gcgga 0.1532 0.2364 0.1444
+gcggc 0.4482 0.4118 0.5367
+gcggg 0.3022 0.1763 0.2038
+gcggt 0.09631 0.1754 0.1151
+gcgta 0.08811 0.1575 0.04383
+gcgtc 0.2867 0.2902 0.3102
+gcgtg 0.5147 0.3016 0.584
+gcgtt 0.1105 0.2508 0.06204
+gctaa 0.229 0.3171 0.008666
+gctac 0.4303 0.2701 0.8787
+gctag 0.2207 0.1502 0.008666
+gctat 0.12 0.2625 0.104
+gctca 0.3456 0.2788 0.08538
+gctcc 0.1329 0.2091 0.4328
+gctcg 0.3418 0.294 0.3876
+gctct 0.1798 0.218 0.09421
+gctga 0.1201 0.2388 0.005821
+gctgc 0.3844 0.2968 0.5355
+gctgg 0.3641 0.2551 0.2945
+gctgt 0.1314 0.2093 0.1641
+gctta 0.1195 0.1082 0.02895
+gcttc 0.3108 0.3458 0.6548
+gcttg 0.4462 0.2376 0.1637
+gcttt 0.1235 0.3085 0.1526
+ggaaa 0.2293 0.3003 0.1387
+ggaac 0.1744 0.2255 0.2816
+ggaag 0.4732 0.2163 0.4945
+ggaat 0.1232 0.2578 0.08516
+ggaca 0.252 0.2395 0.1323
+ggacc 0.2316 0.2207 0.2706
+ggacg 0.3871 0.2913 0.4993
+ggact 0.1293 0.2484 0.09778
+ggaga 0.233 0.3134 0.1837
+ggagc 0.2735 0.2715 0.3847
+ggagg 0.379 0.2824 0.279
+ggagt 0.1145 0.1327 0.1525
+ggata 0.09989 0.1814 0.05956
+ggatc 0.2365 0.2546 0.3971
+ggatg 0.566 0.218 0.4166
+ggatt 0.09759 0.3461 0.1267
+ggcaa 0.165 0.2678 0.1024
+ggcac 0.3096 0.2745 0.2982
+ggcag 0.4124 0.1844 0.5446
+ggcat 0.113 0.2733 0.05477
+ggcca 0.2526 0.2025 0.1315
+ggccc 0.1824 0.1565 0.4156
+ggccg 0.413 0.2622 0.3143
+ggcct 0.152 0.3789 0.1385
+ggcga 0.1291 0.2754 0.101
+ggcgc 0.3901 0.2358 0.508
+ggcgg 0.3544 0.2948 0.2561
+ggcgt 0.1265 0.194 0.135
+ggcta 0.07383 0.1758 0.04699
+ggctc 0.33 0.3297 0.328
+ggctg 0.4832 0.25 0.5517
+ggctt 0.113 0.2445 0.07331
+gggaa 0.1889 0.3595 0.08297
+gggac 0.1974 0.2088 0.3297
+gggag 0.4681 0.2178 0.5051
+gggat 0.1456 0.2139 0.08225
+gggca 0.2439 0.2382 0.177
+gggcc 0.2555 0.266 0.3652
+gggcg 0.3471 0.2483 0.3286
+gggct 0.1535 0.2475 0.1292
+gggga 0.195 0.326 0.2261
+ggggc 0.3686 0.2581 0.3832
+ggggg 0.3451 0.2684 0.2728
+ggggt 0.09129 0.1476 0.1178
+gggta 0.1204 0.1908 0.07439
+gggtc 0.2583 0.249 0.2837
+gggtg 0.4729 0.3014 0.5709
+gggtt 0.1483 0.2588 0.07093
+ggtaa 0.192 0.3115 0.01104
+ggtac 0.3216 0.2623 0.83
+ggtag 0.3398 0.1878 0.01104
+ggtat 0.1466 0.2385 0.1479
+ggtca 0.3619 0.2532 0.1199
+ggtcc 0.2225 0.198 0.2833
+ggtcg 0.2653 0.1915 0.4406
+ggtct 0.1504 0.3572 0.1562
+ggtga 0.1852 0.2553 0.006887
+ggtgc 0.3186 0.1896 0.4652
+ggtgg 0.3774 0.3772 0.3506
+ggtgt 0.1188 0.1779 0.1773
+ggtta 0.1123 0.1588 0.04116
+ggttc 0.3033 0.2799 0.5126
+ggttg 0.3903 0.1817 0.2112
+ggttt 0.1941 0.3795 0.235
+gtaaa 0.25 0.3502 0.2255
+gtaac 0.25 0.2166 0.301
+gtaag 0.25 0.1629 0.3292
+gtaat 0.25 0.2704 0.1443
+gtaca 0.2559 0.2648 0.2548
+gtacc 0.3177 0.2625 0.3323
+gtacg 0.2962 0.2311 0.2727
+gtact 0.1303 0.2416 0.1401
+gtaga 0.25 0.322 0.1692
+gtagc 0.25 0.2513 0.3955
+gtagg 0.25 0.212 0.2015
+gtagt 0.25 0.2147 0.2338
+gtata 0.1406 0.1503 0.1414
+gtatc 0.2506 0.2711 0.3631
+gtatg 0.4254 0.2255 0.311
+gtatt 0.1834 0.3531 0.1845
+gtcaa 0.1926 0.2961 0.1814
+gtcac 0.3318 0.2802 0.3422
+gtcag 0.2758 0.1082 0.3555
+gtcat 0.1998 0.3154 0.1209
+gtcca 0.2818 0.186 0.1809
+gtccc 0.2453 0.3277 0.3921
+gtccg 0.327 0.1433 0.2286
+gtcct 0.1459 0.343 0.1983
+gtcga 0.1586 0.2351 0.1376
+gtcgc 0.3712 0.2977 0.4697
+gtcgg 0.3261 0.2119 0.2311
+gtcgt 0.1441 0.2553 0.1616
+gtcta 0.1053 0.1961 0.05611
+gtctc 0.3754 0.3604 0.3747
+gtctg 0.3931 0.1731 0.4228
+gtctt 0.1262 0.2703 0.1463
+gtgaa 0.25 0.2793 0.1602
+gtgac 0.25 0.2643 0.3655
+gtgag 0.25 0.2436 0.3429
+gtgat 0.25 0.2128 0.1314
+gtgca 0.2204 0.2069 0.1653
+gtgcc 0.2382 0.2001 0.3639
+gtgcg 0.4016 0.2401 0.3
+gtgct 0.1398 0.3529 0.1708
+gtgga 0.248 0.3506 0.1941
+gtggc 0.3242 0.2537 0.3701
+gtggg 0.2988 0.156 0.2053
+gtggt 0.1289 0.2397 0.2305
+gtgta 0.1124 0.1137 0.1153
+gtgtc 0.2209 0.2893 0.2804
+gtgtg 0.5194 0.3099 0.5093
+gtgtt 0.1473 0.287 0.09502
+gttaa 0.2619 0.3661 0.03846
+gttac 0.2664 0.245 0.6558
+gttag 0.2438 0.1254 0.03846
+gttat 0.228 0.2635 0.2673
+gttca 0.2515 0.2386 0.2079
+gttcc 0.3248 0.285 0.3425
+gttcg 0.2647 0.19 0.2527
+gttct 0.1591 0.2864 0.1969
+gttga 0.1556 0.2566 0.02829
+gttgc 0.2635 0.2228 0.3465
+gttgg 0.4302 0.2603 0.3296
+gttgt 0.1508 0.2603 0.2956
+gttta 0.08298 0.1784 0.1127
+gtttc 0.1574 0.2432 0.3605
+gtttg 0.6352 0.2595 0.3131
+gtttt 0.1245 0.3189 0.2138
+taaaa 0.219 0.3201 0.1991
+taaac 0.2566 0.209 0.3326
+taaag 0.3647 0.1675 0.3363
+taaat 0.1597 0.3035 0.132
+taaca 0.2865 0.2933 0.2308
+taacc 0.2764 0.224 0.3043
+taacg 0.2777 0.2095 0.293
+taact 0.1594 0.2732 0.1719
+taaga 0.2737 0.387 0.2101
+taagc 0.256 0.2367 0.3669
+taagg 0.3339 0.207 0.2241
+taagt 0.1364 0.1692 0.1989
+taata 0.1316 0.2332 0.1312
+taatc 0.2576 0.307 0.3688
+taatg 0.4727 0.2008 0.3161
+taatt 0.1381 0.2591 0.1839
+tacaa 0.2009 0.3592 0.1603
+tacac 0.312 0.2064 0.306
+tacag 0.354 0.1618 0.4285
+tacat 0.1331 0.2726 0.1053
+tacca 0.3712 0.2425 0.1653
+taccc 0.1815 0.2119 0.3975
+taccg 0.2917 0.2192 0.2946
+tacct 0.1556 0.3263 0.1425
+tacga 0.1427 0.3576 0.1413
+tacgc 0.3574 0.2057 0.3861
+tacgg 0.3534 0.204 0.2936
+tacgt 0.1465 0.2326 0.179
+tacta 0.1397 0.2248 0.06853
+tactc 0.3081 0.2392 0.3662
+tactg 0.3828 0.2262 0.423
+tactt 0.1694 0.3098 0.1422
+tagaa 0.2525 0.3468 0.1483
+tagac 0.2596 0.1997 0.2785
+tagag 0.3803 0.2067 0.4231
+tagat 0.1075 0.2468 0.1501
+tagca 0.2733 0.2854 0.211
+tagcc 0.2408 0.166 0.3244
+tagcg 0.3361 0.2108 0.2957
+tagct 0.1499 0.3378 0.1689
+tagga 0.279 0.4151 0.2164
+taggc 0.2643 0.255 0.3558
+taggg 0.3507 0.1634 0.2836
+taggt 0.1061 0.1664 0.1442
+tagta 0.1294 0.2134 0.08205
+tagtc 0.2276 0.2486 0.2275
+tagtg 0.5326 0.215 0.5069
+tagtt 0.1105 0.323 0.1836
+tataa 0.2539 0.3483 0.04175
+tatac 0.2461 0.2417 0.6618
+tatag 0.3053 0.1483 0.04175
+tatat 0.1947 0.2617 0.2547
+tatca 0.2867 0.2403 0.214
+tatcc 0.2556 0.2314 0.2953
+tatcg 0.2967 0.221 0.2826
+tatct 0.161 0.3073 0.2081
+tatga 0.2088 0.3462 0.03454
+tatgc 0.2632 0.2324 0.2988
+tatgg 0.3809 0.2147 0.3713
+tatgt 0.1471 0.2067 0.2953
+tatta 0.1561 0.1846 0.09659
+tattc 0.2461 0.2668 0.3943
+tattg 0.4571 0.1833 0.2602
+tattt 0.1406 0.3654 0.2489
+tcaaa 0.2196 0.3802 0.09546
+tcaac 0.2646 0.2421 0.3824
+tcaag 0.3966 0.1762 0.4509
+tcaat 0.1192 0.2016 0.0712
+tcaca 0.2635 0.2761 0.1238
+tcacc 0.2327 0.2576 0.4722
+tcacg 0.3173 0.2392 0.3046
+tcact 0.1865 0.2271 0.09934
+tcaga 0.2514 0.3533 0.09371
+tcagc 0.3538 0.3003 0.6084
+tcagg 0.2439 0.1899 0.1608
+tcagt 0.1508 0.1565 0.1371
+tcata 0.09661 0.1256 0.04132
+tcatc 0.3596 0.3556 0.5394
+tcatg 0.3705 0.1925 0.3116
+tcatt 0.1733 0.3262 0.1078
+tccaa 0.1558 0.3568 0.0951
+tccac 0.3703 0.217 0.3524
+tccag 0.3374 0.1421 0.4785
+tccat 0.1366 0.2841 0.07407
+tccca 0.2818 0.2475 0.1736
+tcccc 0.2052 0.2403 0.4146
+tcccg 0.3208 0.1612 0.2742
+tccct 0.1922 0.3511 0.1376
+tccga 0.1209 0.3008 0.087
+tccgc 0.4006 0.2315 0.5445
+tccgg 0.3197 0.1868 0.2221
+tccgt 0.1588 0.2808 0.1464
+tccta 0.07923 0.1618 0.03252
+tcctc 0.349 0.3816 0.3408
+tcctg 0.4406 0.1431 0.551
+tcctt 0.1311 0.3135 0.07567
+tcgaa 0.1491 0.1981 0.05344
+tcgac 0.2831 0.3011 0.451
+tcgag 0.4219 0.2881 0.4059
+tcgat 0.1459 0.2127 0.08969
+tcgca 0.2306 0.254 0.1113
+tcgcc 0.2559 0.2489 0.4891
+tcgcg 0.3049 0.1611 0.2452
+tcgct 0.2085 0.3359 0.1544
+tcgga 0.1462 0.3258 0.1278
+tcggc 0.4477 0.3285 0.536
+tcggg 0.3167 0.1926 0.2256
+tcggt 0.08941 0.153 0.1106
+tcgta 0.1004 0.176 0.04221
+tcgtc 0.2684 0.2765 0.3144
+tcgtg 0.5169 0.3067 0.5662
+tcgtt 0.1144 0.2408 0.07715
+tctaa 0.229 0.3171 0.006925
+tctac 0.4303 0.2701 0.8657
+tctag 0.2207 0.1502 0.006925
+tctat 0.12 0.2625 0.1205
+tctca 0.2956 0.236 0.123
+tctcc 0.2278 0.2662 0.4648
+tctcg 0.2149 0.2389 0.2864
+tctct 0.2617 0.259 0.1258
+tctga 0.1668 0.2387 0.008292
+tctgc 0.3904 0.2911 0.5373
+tctgg 0.3144 0.2521 0.2786
+tctgt 0.1283 0.2181 0.1758
+tctta 0.1165 0.1082 0.02432
+tcttc 0.301 0.3458 0.7016
+tcttg 0.4153 0.2376 0.1562
+tcttt 0.1671 0.3085 0.1179
+tgaaa 0.261 0.3003 0.1335
+tgaac 0.1505 0.2255 0.3362
+tgaag 0.4495 0.2163 0.4706
+tgaat 0.139 0.2578 0.05962
+tgaca 0.2928 0.2395 0.1264
+tgacc 0.258 0.2207 0.2529
+tgacg 0.3117 0.2913 0.4981
+tgact 0.1375 0.2484 0.1226
+tgaga 0.2559 0.3209 0.1159
+tgagc 0.2551 0.288 0.5233
+tgagg 0.3544 0.251 0.2134
+tgagt 0.1346 0.1402 0.1473
+tgata 0.1032 0.1814 0.05355
+tgatc 0.2039 0.2546 0.3596
+tgatg 0.5635 0.218 0.4612
+tgatt 0.1295 0.3461 0.1257
+tgcaa 0.1624 0.2766 0.06388
+tgcac 0.2828 0.2673 0.3048
+tgcag 0.3978 0.2035 0.5619
+tgcat 0.1569 0.2527 0.06942
+tgcca 0.2905 0.2144 0.1437
+tgccc 0.193 0.2029 0.3924
+tgccg 0.3871 0.2333 0.385
+tgcct 0.1294 0.3494 0.07888
+tgcga 0.1694 0.2894 0.07332
+tgcgc 0.3156 0.213 0.4922
+tgcgg 0.3648 0.2488 0.2733
+tgcgt 0.1503 0.2488 0.1612
+tgcta 0.1201 0.1774 0.0241
+tgctc 0.2323 0.2551 0.2976
+tgctg 0.5551 0.2736 0.6354
+tgctt 0.09252 0.2939 0.04285
+tggaa 0.1554 0.292 0.08099
+tggac 0.174 0.2328 0.3057
+tggag 0.5372 0.2977 0.5242
+tggat 0.1334 0.1775 0.08906
+tggca 0.2875 0.2467 0.1193
+tggcc 0.2011 0.1747 0.357
+tggcg 0.3121 0.2335 0.4028
+tggct 0.1993 0.3451 0.121
+tggga 0.2252 0.3325 0.1532
+tgggc 0.2667 0.2491 0.4841
+tgggg 0.3496 0.2334 0.2402
+tgggt 0.1585 0.185 0.1225
+tggta 0.09627 0.1908 0.05086
+tggtc 0.1749 0.249 0.1235
+tggtg 0.6051 0.3014 0.7597
+tggtt 0.1238 0.2588 0.06591
+tgtaa 0.192 0.3115 0.01104
+tgtac 0.3216 0.2623 0.83
+tgtag 0.3398 0.1878 0.01104
+tgtat 0.1466 0.2385 0.1479
+tgtca 0.3387 0.2532 0.1206
+tgtcc 0.179 0.198 0.32
+tgtcg 0.25 0.1915 0.4018
+tgtct 0.2323 0.3572 0.1575
+tgtga 0.182 0.2273 0.004762
+tgtgc 0.2969 0.2409 0.5124
+tgtgg 0.3341 0.2424 0.3152
+tgtgt 0.1869 0.2894 0.1676
+tgtta 0.1123 0.1588 0.04801
+tgttc 0.3033 0.2799 0.4821
+tgttg 0.3903 0.1817 0.2217
+tgttt 0.1941 0.3795 0.2482
+ttaaa 0.25 0.3502 0.2255
+ttaac 0.25 0.2166 0.301
+ttaag 0.25 0.1629 0.3292
+ttaat 0.25 0.2704 0.1443
+ttaca 0.2652 0.2648 0.2548
+ttacc 0.2964 0.2625 0.3323
+ttacg 0.2738 0.2311 0.2727
+ttact 0.1646 0.2416 0.1401
+ttaga 0.25 0.322 0.1692
+ttagc 0.25 0.2513 0.3955
+ttagg 0.25 0.212 0.2015
+ttagt 0.25 0.2147 0.2338
+ttata 0.1406 0.1503 0.1414
+ttatc 0.2506 0.2711 0.3631
+ttatg 0.4254 0.2255 0.311
+ttatt 0.1834 0.3531 0.1845
+ttcaa 0.1926 0.277 0.1814
+ttcac 0.3318 0.2437 0.3422
+ttcag 0.2758 0.1603 0.3555
+ttcat 0.1998 0.319 0.1209
+ttcca 0.299 0.2154 0.1809
+ttccc 0.2276 0.2136 0.3921
+ttccg 0.2803 0.2519 0.2286
+ttcct 0.1932 0.3191 0.1983
+ttcga 0.1346 0.3295 0.1376
+ttcgc 0.3715 0.2297 0.4697
+ttcgg 0.3525 0.1851 0.2311
+ttcgt 0.1413 0.2558 0.1616
+ttcta 0.1053 0.2217 0.06088
+ttctc 0.3754 0.3135 0.3261
+ttctg 0.3931 0.215 0.4854
+ttctt 0.1262 0.2497 0.1276
+ttgaa 0.25 0.3068 0.1538
+ttgac 0.25 0.2501 0.3099
+ttgag 0.25 0.2214 0.4029
+ttgat 0.25 0.2217 0.1335
+ttgca 0.2308 0.2542 0.2429
+ttgcc 0.2926 0.2128 0.3448
+ttgcg 0.3124 0.1996 0.2399
+ttgct 0.1642 0.3333 0.1724
+ttgga 0.2222 0.3251 0.2334
+ttggc 0.2921 0.2964 0.3754
+ttggg 0.3485 0.194 0.2145
+ttggt 0.1372 0.1844 0.1767
+ttgta 0.1347 0.1309 0.0932
+ttgtc 0.231 0.2899 0.2574
+ttgtg 0.5051 0.3045 0.4793
+ttgtt 0.1292 0.2747 0.1701
+tttaa 0.2619 0.3661 0.03846
+tttac 0.2664 0.245 0.6558
+tttag 0.2438 0.1254 0.03846
+tttat 0.228 0.2635 0.2673
+tttca 0.2632 0.2386 0.2079
+tttcc 0.3382 0.285 0.3425
+tttcg 0.2138 0.19 0.2527
+tttct 0.1848 0.2864 0.1969
+tttga 0.1653 0.3236 0.02829
+tttgc 0.2811 0.2396 0.3465
+tttgg 0.3909 0.2142 0.3296
+tttgt 0.1627 0.2226 0.2956
+tttta 0.0967 0.1784 0.1127
+ttttc 0.1714 0.2432 0.3605
+ttttg 0.6039 0.2595 0.3131
+ttttt 0.128 0.3189 0.2138
+
+
+#
+# Initial emission probabilities
+#
+[INITEMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.289 0.231 0.227
+aaaac 0.258 0.253 0.25
+aaaag 0.237 0.22 0.273
+aaaat 0.216 0.297 0.25
+aaaca 0.255 0.257 0.247
+aaacc 0.255 0.208 0.258
+aaacg 0.266 0.277 0.247
+aaact 0.223 0.257 0.247
+aaaga 0.279 0.261 0.28
+aaagc 0.234 0.25 0.247
+aaagg 0.279 0.239 0.247
+aaagt 0.207 0.25 0.226
+aaata 0.267 0.253 0.228
+aaatc 0.222 0.241 0.293
+aaatg 0.278 0.241 0.228
+aaatt 0.233 0.265 0.25
+aacaa 0.22 0.248 0.208
+aacac 0.29 0.265 0.281
+aacag 0.23 0.221 0.271
+aacat 0.26 0.265 0.24
+aacca 0.316 0.231 0.239
+aaccc 0.221 0.205 0.261
+aaccg 0.232 0.274 0.261
+aacct 0.232 0.291 0.239
+aacga 0.286 0.319 0.18
+aacgc 0.229 0.267 0.333
+aacgg 0.286 0.181 0.252
+aacgt 0.2 0.233 0.234
+aacta 0.208 0.225 0.226
+aactc 0.24 0.265 0.301
+aactg 0.302 0.225 0.247
+aactt 0.25 0.284 0.226
+aagaa 0.222 0.277 0.225
+aagac 0.253 0.268 0.275
+aagag 0.293 0.259 0.294
+aagat 0.232 0.196 0.206
+aagca 0.255 0.225 0.269
+aagcc 0.236 0.325 0.269
+aagcg 0.236 0.175 0.24
+aagct 0.274 0.275 0.221
+aagga 0.245 0.259 0.307
+aaggc 0.266 0.237 0.238
+aaggg 0.266 0.259 0.228
+aaggt 0.223 0.245 0.228
+aagta 0.242 0.263 0.25
+aagtc 0.242 0.283 0.25
+aagtg 0.242 0.232 0.25
+aagtt 0.275 0.222 0.25
+aataa 0.236 0.239 0.235
+aatac 0.27 0.227 0.259
+aatag 0.27 0.273 0.235
+aatat 0.225 0.261 0.271
+aatca 0.236 0.294 0.231
+aatcc 0.292 0.294 0.286
+aatcg 0.236 0.206 0.264
+aatct 0.236 0.206 0.22
+aatga 0.229 0.248 0.206
+aatgc 0.305 0.238 0.268
+aatgg 0.276 0.305 0.227
+aatgt 0.19 0.21 0.299
+aatta 0.258 0.233 0.258
+aattc 0.215 0.244 0.227
+aattg 0.237 0.279 0.227
+aattt 0.29 0.244 0.289
+acaaa 0.247 0.22 0.25
+acaac 0.247 0.253 0.23
+acaag 0.259 0.275 0.29
+acaat 0.247 0.253 0.23
+acaca 0.284 0.234 0.267
+acacc 0.224 0.224 0.21
+acacg 0.25 0.308 0.295
+acact 0.241 0.234 0.229
+acaga 0.269 0.296 0.21
+acagc 0.319 0.255 0.31
+acagg 0.235 0.235 0.22
+acagt 0.176 0.214 0.26
+acata 0.206 0.216 0.212
+acatc 0.268 0.258 0.279
+acatg 0.289 0.309 0.25
+acatt 0.237 0.216 0.26
+accaa 0.245 0.235 0.208
+accac 0.277 0.265 0.292
+accag 0.245 0.235 0.255
+accat 0.234 0.265 0.245
+accca 0.207 0.267 0.26
+acccc 0.216 0.295 0.26
+acccg 0.336 0.219 0.26
+accct 0.241 0.219 0.22
+accga 0.217 0.2 0.228
+accgc 0.278 0.285 0.368
+accgg 0.226 0.215 0.202
+accgt 0.278 0.3 0.202
+accta 0.232 0.192 0.217
+acctc 0.274 0.325 0.235
+acctg 0.232 0.275 0.365
+acctt 0.263 0.208 0.183
+acgaa 0.275 0.214 0.19
+acgac 0.231 0.268 0.23
+acgag 0.253 0.241 0.333
+acgat 0.242 0.277 0.246
+acgca 0.15 0.218 0.228
+acgcc 0.279 0.211 0.293
+acgcg 0.354 0.31 0.301
+acgct 0.218 0.261 0.179
+acgga 0.216 0.308 0.264
+acggc 0.267 0.323 0.3
+acggg 0.319 0.18 0.245
+acggt 0.198 0.188 0.191
+acgta 0.208 0.189 0.184
+acgtc 0.277 0.302 0.216
+acgtg 0.297 0.311 0.36
+acgtt 0.218 0.198 0.24
+actaa 0.217 0.23 0.208
+actac 0.239 0.241 0.323
+actag 0.228 0.241 0.208
+actat 0.315 0.287 0.26
+actca 0.216 0.222 0.202
+actcc 0.261 0.352 0.31
+actcg 0.306 0.204 0.295
+actct 0.216 0.222 0.194
+actga 0.255 0.236 0.168
+actgc 0.277 0.255 0.319
+actgg 0.213 0.191 0.277
+actgt 0.255 0.318 0.235
+actta 0.225 0.223 0.2
+acttc 0.247 0.287 0.304
+acttg 0.27 0.266 0.27
+acttt 0.258 0.223 0.226
+agaaa 0.23 0.281 0.218
+agaac 0.27 0.229 0.245
+agaag 0.26 0.26 0.318
+agaat 0.24 0.229 0.218
+agaca 0.221 0.241 0.257
+agacc 0.221 0.253 0.265
+agacg 0.279 0.264 0.283
+agact 0.279 0.241 0.195
+agaga 0.232 0.217 0.257
+agagc 0.219 0.308 0.266
+agagg 0.358 0.292 0.266
+agagt 0.192 0.183 0.211
+agata 0.218 0.23 0.212
+agatc 0.257 0.253 0.263
+agatg 0.327 0.253 0.313
+agatt 0.198 0.264 0.212
+agcaa 0.222 0.277 0.179
+agcac 0.25 0.208 0.214
+agcag 0.259 0.287 0.393
+agcat 0.269 0.228 0.214
+agcca 0.205 0.198 0.202
+agccc 0.291 0.198 0.228
+agccg 0.26 0.315 0.351
+agcct 0.244 0.288 0.219
+agcga 0.203 0.254 0.156
+agcgc 0.32 0.215 0.333
+agcgg 0.242 0.238 0.298
+agcgt 0.234 0.292 0.213
+agcta 0.192 0.22 0.2
+agctc 0.25 0.299 0.24
+agctg 0.327 0.276 0.352
+agctt 0.231 0.205 0.208
+aggaa 0.264 0.245 0.211
+aggac 0.182 0.255 0.261
+aggag 0.373 0.266 0.359
+aggat 0.182 0.234 0.169
+aggca 0.221 0.245 0.201
+aggcc 0.186 0.198 0.239
+aggcg 0.23 0.283 0.299
+aggct 0.363 0.274 0.261
+aggga 0.189 0.27 0.218
+agggc 0.321 0.191 0.286
+agggg 0.274 0.27 0.261
+agggt 0.217 0.27 0.235
+aggta 0.216 0.211 0.214
+aggtc 0.216 0.221 0.231
+aggtg 0.343 0.337 0.35
+aggtt 0.225 0.232 0.205
+agtaa 0.261 0.271 0.204
+agtac 0.228 0.208 0.378
+agtag 0.283 0.24 0.204
+agtat 0.228 0.281 0.214
+agtca 0.215 0.239 0.239
+agtcc 0.234 0.266 0.202
+agtcg 0.196 0.22 0.303
+agtct 0.355 0.275 0.257
+agtga 0.274 0.238 0.168
+agtgc 0.178 0.246 0.244
+agtgg 0.322 0.213 0.202
+agtgt 0.226 0.303 0.387
+agtta 0.257 0.247 0.226
+agttc 0.248 0.215 0.28
+agttg 0.22 0.28 0.226
+agttt 0.275 0.258 0.269
+ataaa 0.25 0.238 0.298
+ataac 0.25 0.25 0.234
+ataag 0.25 0.274 0.245
+ataat 0.25 0.238 0.223
+ataca 0.223 0.258 0.236
+atacc 0.25 0.226 0.225
+atacg 0.321 0.29 0.225
+atact 0.205 0.226 0.315
+ataga 0.25 0.27 0.27
+atagc 0.25 0.225 0.258
+atagg 0.25 0.247 0.225
+atagt 0.25 0.258 0.247
+atata 0.261 0.223 0.255
+atatc 0.228 0.233 0.245
+atatg 0.261 0.243 0.276
+atatt 0.25 0.301 0.224
+atcaa 0.245 0.24 0.221
+atcac 0.255 0.28 0.337
+atcag 0.245 0.23 0.212
+atcat 0.255 0.25 0.231
+atcca 0.196 0.284 0.203
+atccc 0.241 0.225 0.347
+atccg 0.25 0.235 0.22
+atcct 0.312 0.255 0.229
+atcga 0.233 0.278 0.258
+atcgc 0.353 0.25 0.236
+atcgg 0.216 0.278 0.258
+atcgt 0.198 0.194 0.247
+atcta 0.211 0.2 0.21
+atctc 0.274 0.227 0.26
+atctg 0.274 0.255 0.32
+atctt 0.242 0.318 0.21
+atgaa 0.25 0.283 0.221
+atgac 0.25 0.257 0.269
+atgag 0.25 0.248 0.269
+atgat 0.25 0.212 0.24
+atgca 0.235 0.226 0.236
+atgcc 0.2 0.194 0.292
+atgcg 0.278 0.371 0.245
+atgct 0.287 0.21 0.226
+atgga 0.24 0.272 0.238
+atggc 0.221 0.288 0.218
+atggg 0.298 0.224 0.248
+atggt 0.24 0.216 0.297
+atgta 0.222 0.269 0.177
+atgtc 0.274 0.235 0.25
+atgtg 0.319 0.261 0.306
+atgtt 0.185 0.235 0.266
+attaa 0.236 0.273 0.235
+attac 0.236 0.283 0.259
+attag 0.247 0.212 0.235
+attat 0.281 0.232 0.271
+attca 0.252 0.258 0.239
+attcc 0.223 0.237 0.273
+attcg 0.272 0.237 0.239
+attct 0.252 0.269 0.25
+attga 0.206 0.232 0.202
+attgc 0.235 0.232 0.222
+attgg 0.275 0.232 0.253
+attgt 0.284 0.303 0.323
+attta 0.267 0.236 0.222
+atttc 0.228 0.225 0.222
+atttg 0.307 0.27 0.311
+atttt 0.198 0.27 0.244
+caaaa 0.289 0.231 0.227
+caaac 0.258 0.253 0.25
+caaag 0.237 0.22 0.273
+caaat 0.216 0.297 0.25
+caaca 0.255 0.257 0.247
+caacc 0.255 0.208 0.258
+caacg 0.266 0.277 0.247
+caact 0.223 0.257 0.247
+caaga 0.279 0.261 0.28
+caagc 0.234 0.25 0.247
+caagg 0.279 0.239 0.247
+caagt 0.207 0.25 0.226
+caata 0.267 0.253 0.228
+caatc 0.222 0.241 0.293
+caatg 0.278 0.241 0.228
+caatt 0.233 0.265 0.25
+cacaa 0.22 0.248 0.208
+cacac 0.29 0.265 0.281
+cacag 0.23 0.221 0.271
+cacat 0.26 0.265 0.24
+cacca 0.316 0.231 0.239
+caccc 0.221 0.205 0.261
+caccg 0.232 0.274 0.261
+cacct 0.232 0.291 0.239
+cacga 0.286 0.319 0.18
+cacgc 0.229 0.267 0.333
+cacgg 0.286 0.181 0.252
+cacgt 0.2 0.233 0.234
+cacta 0.208 0.225 0.226
+cactc 0.24 0.265 0.301
+cactg 0.302 0.225 0.247
+cactt 0.25 0.284 0.226
+cagaa 0.222 0.277 0.225
+cagac 0.253 0.268 0.275
+cagag 0.293 0.259 0.294
+cagat 0.232 0.196 0.206
+cagca 0.255 0.225 0.269
+cagcc 0.236 0.325 0.269
+cagcg 0.236 0.175 0.24
+cagct 0.274 0.275 0.221
+cagga 0.245 0.259 0.307
+caggc 0.266 0.237 0.238
+caggg 0.266 0.259 0.228
+caggt 0.223 0.245 0.228
+cagta 0.242 0.263 0.25
+cagtc 0.242 0.283 0.25
+cagtg 0.242 0.232 0.25
+cagtt 0.275 0.222 0.25
+cataa 0.236 0.239 0.235
+catac 0.27 0.227 0.259
+catag 0.27 0.273 0.235
+catat 0.225 0.261 0.271
+catca 0.236 0.294 0.231
+catcc 0.292 0.294 0.286
+catcg 0.236 0.206 0.264
+catct 0.236 0.206 0.22
+catga 0.229 0.248 0.206
+catgc 0.305 0.238 0.268
+catgg 0.276 0.305 0.227
+catgt 0.19 0.21 0.299
+catta 0.258 0.233 0.258
+cattc 0.215 0.244 0.227
+cattg 0.237 0.279 0.227
+cattt 0.29 0.244 0.289
+ccaaa 0.247 0.22 0.25
+ccaac 0.247 0.253 0.23
+ccaag 0.259 0.275 0.29
+ccaat 0.247 0.253 0.23
+ccaca 0.284 0.234 0.267
+ccacc 0.224 0.224 0.21
+ccacg 0.25 0.308 0.295
+ccact 0.241 0.234 0.229
+ccaga 0.269 0.296 0.21
+ccagc 0.319 0.255 0.31
+ccagg 0.235 0.235 0.22
+ccagt 0.176 0.214 0.26
+ccata 0.206 0.216 0.212
+ccatc 0.268 0.258 0.279
+ccatg 0.289 0.309 0.25
+ccatt 0.237 0.216 0.26
+cccaa 0.245 0.235 0.208
+cccac 0.277 0.265 0.292
+cccag 0.245 0.235 0.255
+cccat 0.234 0.265 0.245
+cccca 0.207 0.267 0.26
+ccccc 0.216 0.295 0.26
+ccccg 0.336 0.219 0.26
+cccct 0.241 0.219 0.22
+cccga 0.217 0.2 0.228
+cccgc 0.278 0.285 0.368
+cccgg 0.226 0.215 0.202
+cccgt 0.278 0.3 0.202
+cccta 0.232 0.192 0.217
+ccctc 0.274 0.325 0.235
+ccctg 0.232 0.275 0.365
+ccctt 0.263 0.208 0.183
+ccgaa 0.275 0.214 0.19
+ccgac 0.231 0.268 0.23
+ccgag 0.253 0.241 0.333
+ccgat 0.242 0.277 0.246
+ccgca 0.15 0.218 0.228
+ccgcc 0.279 0.211 0.293
+ccgcg 0.354 0.31 0.301
+ccgct 0.218 0.261 0.179
+ccgga 0.216 0.308 0.264
+ccggc 0.267 0.323 0.3
+ccggg 0.319 0.18 0.245
+ccggt 0.198 0.188 0.191
+ccgta 0.208 0.189 0.184
+ccgtc 0.277 0.302 0.216
+ccgtg 0.297 0.311 0.36
+ccgtt 0.218 0.198 0.24
+cctaa 0.217 0.23 0.208
+cctac 0.239 0.241 0.323
+cctag 0.228 0.241 0.208
+cctat 0.315 0.287 0.26
+cctca 0.216 0.222 0.202
+cctcc 0.261 0.352 0.31
+cctcg 0.306 0.204 0.295
+cctct 0.216 0.222 0.194
+cctga 0.255 0.236 0.168
+cctgc 0.277 0.255 0.319
+cctgg 0.213 0.191 0.277
+cctgt 0.255 0.318 0.235
+cctta 0.225 0.223 0.2
+ccttc 0.247 0.287 0.304
+ccttg 0.27 0.266 0.27
+ccttt 0.258 0.223 0.226
+cgaaa 0.23 0.281 0.218
+cgaac 0.27 0.229 0.245
+cgaag 0.26 0.26 0.318
+cgaat 0.24 0.229 0.218
+cgaca 0.221 0.241 0.257
+cgacc 0.221 0.253 0.265
+cgacg 0.279 0.264 0.283
+cgact 0.279 0.241 0.195
+cgaga 0.232 0.217 0.257
+cgagc 0.219 0.308 0.266
+cgagg 0.358 0.292 0.266
+cgagt 0.192 0.183 0.211
+cgata 0.218 0.23 0.212
+cgatc 0.257 0.253 0.263
+cgatg 0.327 0.253 0.313
+cgatt 0.198 0.264 0.212
+cgcaa 0.222 0.277 0.179
+cgcac 0.25 0.208 0.214
+cgcag 0.259 0.287 0.393
+cgcat 0.269 0.228 0.214
+cgcca 0.205 0.198 0.202
+cgccc 0.291 0.198 0.228
+cgccg 0.26 0.315 0.351
+cgcct 0.244 0.288 0.219
+cgcga 0.203 0.254 0.156
+cgcgc 0.32 0.215 0.333
+cgcgg 0.242 0.238 0.298
+cgcgt 0.234 0.292 0.213
+cgcta 0.192 0.22 0.2
+cgctc 0.25 0.299 0.24
+cgctg 0.327 0.276 0.352
+cgctt 0.231 0.205 0.208
+cggaa 0.264 0.245 0.211
+cggac 0.182 0.255 0.261
+cggag 0.373 0.266 0.359
+cggat 0.182 0.234 0.169
+cggca 0.221 0.245 0.201
+cggcc 0.186 0.198 0.239
+cggcg 0.23 0.283 0.299
+cggct 0.363 0.274 0.261
+cggga 0.189 0.27 0.218
+cgggc 0.321 0.191 0.286
+cgggg 0.274 0.27 0.261
+cgggt 0.217 0.27 0.235
+cggta 0.216 0.211 0.214
+cggtc 0.216 0.221 0.231
+cggtg 0.343 0.337 0.35
+cggtt 0.225 0.232 0.205
+cgtaa 0.261 0.271 0.204
+cgtac 0.228 0.208 0.378
+cgtag 0.283 0.24 0.204
+cgtat 0.228 0.281 0.214
+cgtca 0.215 0.239 0.239
+cgtcc 0.234 0.266 0.202
+cgtcg 0.196 0.22 0.303
+cgtct 0.355 0.275 0.257
+cgtga 0.274 0.238 0.168
+cgtgc 0.178 0.246 0.244
+cgtgg 0.322 0.213 0.202
+cgtgt 0.226 0.303 0.387
+cgtta 0.257 0.247 0.226
+cgttc 0.248 0.215 0.28
+cgttg 0.22 0.28 0.226
+cgttt 0.275 0.258 0.269
+ctaaa 0.25 0.238 0.298
+ctaac 0.25 0.25 0.234
+ctaag 0.25 0.274 0.245
+ctaat 0.25 0.238 0.223
+ctaca 0.223 0.258 0.236
+ctacc 0.25 0.226 0.225
+ctacg 0.321 0.29 0.225
+ctact 0.205 0.226 0.315
+ctaga 0.25 0.27 0.27
+ctagc 0.25 0.225 0.258
+ctagg 0.25 0.247 0.225
+ctagt 0.25 0.258 0.247
+ctata 0.261 0.223 0.255
+ctatc 0.228 0.233 0.245
+ctatg 0.261 0.243 0.276
+ctatt 0.25 0.301 0.224
+ctcaa 0.245 0.24 0.221
+ctcac 0.255 0.28 0.337
+ctcag 0.245 0.23 0.212
+ctcat 0.255 0.25 0.231
+ctcca 0.196 0.284 0.203
+ctccc 0.241 0.225 0.347
+ctccg 0.25 0.235 0.22
+ctcct 0.312 0.255 0.229
+ctcga 0.233 0.278 0.258
+ctcgc 0.353 0.25 0.236
+ctcgg 0.216 0.278 0.258
+ctcgt 0.198 0.194 0.247
+ctcta 0.211 0.2 0.21
+ctctc 0.274 0.227 0.26
+ctctg 0.274 0.255 0.32
+ctctt 0.242 0.318 0.21
+ctgaa 0.25 0.283 0.221
+ctgac 0.25 0.257 0.269
+ctgag 0.25 0.248 0.269
+ctgat 0.25 0.212 0.24
+ctgca 0.235 0.226 0.236
+ctgcc 0.2 0.194 0.292
+ctgcg 0.278 0.371 0.245
+ctgct 0.287 0.21 0.226
+ctgga 0.24 0.272 0.238
+ctggc 0.221 0.288 0.218
+ctggg 0.298 0.224 0.248
+ctggt 0.24 0.216 0.297
+ctgta 0.222 0.269 0.177
+ctgtc 0.274 0.235 0.25
+ctgtg 0.319 0.261 0.306
+ctgtt 0.185 0.235 0.266
+cttaa 0.236 0.273 0.235
+cttac 0.236 0.283 0.259
+cttag 0.247 0.212 0.235
+cttat 0.281 0.232 0.271
+cttca 0.252 0.258 0.239
+cttcc 0.223 0.237 0.273
+cttcg 0.272 0.237 0.239
+cttct 0.252 0.269 0.25
+cttga 0.206 0.232 0.202
+cttgc 0.235 0.232 0.222
+cttgg 0.275 0.232 0.253
+cttgt 0.284 0.303 0.323
+cttta 0.267 0.236 0.222
+ctttc 0.228 0.225 0.222
+ctttg 0.307 0.27 0.311
+ctttt 0.198 0.27 0.244
+gaaaa 0.289 0.231 0.227
+gaaac 0.258 0.253 0.25
+gaaag 0.237 0.22 0.273
+gaaat 0.216 0.297 0.25
+gaaca 0.255 0.257 0.247
+gaacc 0.255 0.208 0.258
+gaacg 0.266 0.277 0.247
+gaact 0.223 0.257 0.247
+gaaga 0.279 0.261 0.28
+gaagc 0.234 0.25 0.247
+gaagg 0.279 0.239 0.247
+gaagt 0.207 0.25 0.226
+gaata 0.267 0.253 0.228
+gaatc 0.222 0.241 0.293
+gaatg 0.278 0.241 0.228
+gaatt 0.233 0.265 0.25
+gacaa 0.22 0.248 0.208
+gacac 0.29 0.265 0.281
+gacag 0.23 0.221 0.271
+gacat 0.26 0.265 0.24
+gacca 0.316 0.231 0.239
+gaccc 0.221 0.205 0.261
+gaccg 0.232 0.274 0.261
+gacct 0.232 0.291 0.239
+gacga 0.286 0.319 0.18
+gacgc 0.229 0.267 0.333
+gacgg 0.286 0.181 0.252
+gacgt 0.2 0.233 0.234
+gacta 0.208 0.225 0.226
+gactc 0.24 0.265 0.301
+gactg 0.302 0.225 0.247
+gactt 0.25 0.284 0.226
+gagaa 0.222 0.277 0.225
+gagac 0.253 0.268 0.275
+gagag 0.293 0.259 0.294
+gagat 0.232 0.196 0.206
+gagca 0.255 0.225 0.269
+gagcc 0.236 0.325 0.269
+gagcg 0.236 0.175 0.24
+gagct 0.274 0.275 0.221
+gagga 0.245 0.259 0.307
+gaggc 0.266 0.237 0.238
+gaggg 0.266 0.259 0.228
+gaggt 0.223 0.245 0.228
+gagta 0.242 0.263 0.25
+gagtc 0.242 0.283 0.25
+gagtg 0.242 0.232 0.25
+gagtt 0.275 0.222 0.25
+gataa 0.236 0.239 0.235
+gatac 0.27 0.227 0.259
+gatag 0.27 0.273 0.235
+gatat 0.225 0.261 0.271
+gatca 0.236 0.294 0.231
+gatcc 0.292 0.294 0.286
+gatcg 0.236 0.206 0.264
+gatct 0.236 0.206 0.22
+gatga 0.229 0.248 0.206
+gatgc 0.305 0.238 0.268
+gatgg 0.276 0.305 0.227
+gatgt 0.19 0.21 0.299
+gatta 0.258 0.233 0.258
+gattc 0.215 0.244 0.227
+gattg 0.237 0.279 0.227
+gattt 0.29 0.244 0.289
+gcaaa 0.247 0.22 0.25
+gcaac 0.247 0.253 0.23
+gcaag 0.259 0.275 0.29
+gcaat 0.247 0.253 0.23
+gcaca 0.284 0.234 0.267
+gcacc 0.224 0.224 0.21
+gcacg 0.25 0.308 0.295
+gcact 0.241 0.234 0.229
+gcaga 0.269 0.296 0.21
+gcagc 0.319 0.255 0.31
+gcagg 0.235 0.235 0.22
+gcagt 0.176 0.214 0.26
+gcata 0.206 0.216 0.212
+gcatc 0.268 0.258 0.279
+gcatg 0.289 0.309 0.25
+gcatt 0.237 0.216 0.26
+gccaa 0.245 0.235 0.208
+gccac 0.277 0.265 0.292
+gccag 0.245 0.235 0.255
+gccat 0.234 0.265 0.245
+gccca 0.207 0.267 0.26
+gcccc 0.216 0.295 0.26
+gcccg 0.336 0.219 0.26
+gccct 0.241 0.219 0.22
+gccga 0.217 0.2 0.228
+gccgc 0.278 0.285 0.368
+gccgg 0.226 0.215 0.202
+gccgt 0.278 0.3 0.202
+gccta 0.232 0.192 0.217
+gcctc 0.274 0.325 0.235
+gcctg 0.232 0.275 0.365
+gcctt 0.263 0.208 0.183
+gcgaa 0.275 0.214 0.19
+gcgac 0.231 0.268 0.23
+gcgag 0.253 0.241 0.333
+gcgat 0.242 0.277 0.246
+gcgca 0.15 0.218 0.228
+gcgcc 0.279 0.211 0.293
+gcgcg 0.354 0.31 0.301
+gcgct 0.218 0.261 0.179
+gcgga 0.216 0.308 0.264
+gcggc 0.267 0.323 0.3
+gcggg 0.319 0.18 0.245
+gcggt 0.198 0.188 0.191
+gcgta 0.208 0.189 0.184
+gcgtc 0.277 0.302 0.216
+gcgtg 0.297 0.311 0.36
+gcgtt 0.218 0.198 0.24
+gctaa 0.217 0.23 0.208
+gctac 0.239 0.241 0.323
+gctag 0.228 0.241 0.208
+gctat 0.315 0.287 0.26
+gctca 0.216 0.222 0.202
+gctcc 0.261 0.352 0.31
+gctcg 0.306 0.204 0.295
+gctct 0.216 0.222 0.194
+gctga 0.255 0.236 0.168
+gctgc 0.277 0.255 0.319
+gctgg 0.213 0.191 0.277
+gctgt 0.255 0.318 0.235
+gctta 0.225 0.223 0.2
+gcttc 0.247 0.287 0.304
+gcttg 0.27 0.266 0.27
+gcttt 0.258 0.223 0.226
+ggaaa 0.23 0.281 0.218
+ggaac 0.27 0.229 0.245
+ggaag 0.26 0.26 0.318
+ggaat 0.24 0.229 0.218
+ggaca 0.221 0.241 0.257
+ggacc 0.221 0.253 0.265
+ggacg 0.279 0.264 0.283
+ggact 0.279 0.241 0.195
+ggaga 0.232 0.217 0.257
+ggagc 0.219 0.308 0.266
+ggagg 0.358 0.292 0.266
+ggagt 0.192 0.183 0.211
+ggata 0.218 0.23 0.212
+ggatc 0.257 0.253 0.263
+ggatg 0.327 0.253 0.313
+ggatt 0.198 0.264 0.212
+ggcaa 0.222 0.277 0.179
+ggcac 0.25 0.208 0.214
+ggcag 0.259 0.287 0.393
+ggcat 0.269 0.228 0.214
+ggcca 0.205 0.198 0.202
+ggccc 0.291 0.198 0.228
+ggccg 0.26 0.315 0.351
+ggcct 0.244 0.288 0.219
+ggcga 0.203 0.254 0.156
+ggcgc 0.32 0.215 0.333
+ggcgg 0.242 0.238 0.298
+ggcgt 0.234 0.292 0.213
+ggcta 0.192 0.22 0.2
+ggctc 0.25 0.299 0.24
+ggctg 0.327 0.276 0.352
+ggctt 0.231 0.205 0.208
+gggaa 0.264 0.245 0.211
+gggac 0.182 0.255 0.261
+gggag 0.373 0.266 0.359
+gggat 0.182 0.234 0.169
+gggca 0.221 0.245 0.201
+gggcc 0.186 0.198 0.239
+gggcg 0.23 0.283 0.299
+gggct 0.363 0.274 0.261
+gggga 0.189 0.27 0.218
+ggggc 0.321 0.191 0.286
+ggggg 0.274 0.27 0.261
+ggggt 0.217 0.27 0.235
+gggta 0.216 0.211 0.214
+gggtc 0.216 0.221 0.231
+gggtg 0.343 0.337 0.35
+gggtt 0.225 0.232 0.205
+ggtaa 0.261 0.271 0.204
+ggtac 0.228 0.208 0.378
+ggtag 0.283 0.24 0.204
+ggtat 0.228 0.281 0.214
+ggtca 0.215 0.239 0.239
+ggtcc 0.234 0.266 0.202
+ggtcg 0.196 0.22 0.303
+ggtct 0.355 0.275 0.257
+ggtga 0.274 0.238 0.168
+ggtgc 0.178 0.246 0.244
+ggtgg 0.322 0.213 0.202
+ggtgt 0.226 0.303 0.387
+ggtta 0.257 0.247 0.226
+ggttc 0.248 0.215 0.28
+ggttg 0.22 0.28 0.226
+ggttt 0.275 0.258 0.269
+gtaaa 0.25 0.238 0.298
+gtaac 0.25 0.25 0.234
+gtaag 0.25 0.274 0.245
+gtaat 0.25 0.238 0.223
+gtaca 0.223 0.258 0.236
+gtacc 0.25 0.226 0.225
+gtacg 0.321 0.29 0.225
+gtact 0.205 0.226 0.315
+gtaga 0.25 0.27 0.27
+gtagc 0.25 0.225 0.258
+gtagg 0.25 0.247 0.225
+gtagt 0.25 0.258 0.247
+gtata 0.261 0.223 0.255
+gtatc 0.228 0.233 0.245
+gtatg 0.261 0.243 0.276
+gtatt 0.25 0.301 0.224
+gtcaa 0.245 0.24 0.221
+gtcac 0.255 0.28 0.337
+gtcag 0.245 0.23 0.212
+gtcat 0.255 0.25 0.231
+gtcca 0.196 0.284 0.203
+gtccc 0.241 0.225 0.347
+gtccg 0.25 0.235 0.22
+gtcct 0.312 0.255 0.229
+gtcga 0.233 0.278 0.258
+gtcgc 0.353 0.25 0.236
+gtcgg 0.216 0.278 0.258
+gtcgt 0.198 0.194 0.247
+gtcta 0.211 0.2 0.21
+gtctc 0.274 0.227 0.26
+gtctg 0.274 0.255 0.32
+gtctt 0.242 0.318 0.21
+gtgaa 0.25 0.283 0.221
+gtgac 0.25 0.257 0.269
+gtgag 0.25 0.248 0.269
+gtgat 0.25 0.212 0.24
+gtgca 0.235 0.226 0.236
+gtgcc 0.2 0.194 0.292
+gtgcg 0.278 0.371 0.245
+gtgct 0.287 0.21 0.226
+gtgga 0.24 0.272 0.238
+gtggc 0.221 0.288 0.218
+gtggg 0.298 0.224 0.248
+gtggt 0.24 0.216 0.297
+gtgta 0.222 0.269 0.177
+gtgtc 0.274 0.235 0.25
+gtgtg 0.319 0.261 0.306
+gtgtt 0.185 0.235 0.266
+gttaa 0.236 0.273 0.235
+gttac 0.236 0.283 0.259
+gttag 0.247 0.212 0.235
+gttat 0.281 0.232 0.271
+gttca 0.252 0.258 0.239
+gttcc 0.223 0.237 0.273
+gttcg 0.272 0.237 0.239
+gttct 0.252 0.269 0.25
+gttga 0.206 0.232 0.202
+gttgc 0.235 0.232 0.222
+gttgg 0.275 0.232 0.253
+gttgt 0.284 0.303 0.323
+gttta 0.267 0.236 0.222
+gtttc 0.228 0.225 0.222
+gtttg 0.307 0.27 0.311
+gtttt 0.198 0.27 0.244
+taaaa 0.289 0.231 0.227
+taaac 0.258 0.253 0.25
+taaag 0.237 0.22 0.273
+taaat 0.216 0.297 0.25
+taaca 0.255 0.257 0.247
+taacc 0.255 0.208 0.258
+taacg 0.266 0.277 0.247
+taact 0.223 0.257 0.247
+taaga 0.279 0.261 0.28
+taagc 0.234 0.25 0.247
+taagg 0.279 0.239 0.247
+taagt 0.207 0.25 0.226
+taata 0.267 0.253 0.228
+taatc 0.222 0.241 0.293
+taatg 0.278 0.241 0.228
+taatt 0.233 0.265 0.25
+tacaa 0.22 0.248 0.208
+tacac 0.29 0.265 0.281
+tacag 0.23 0.221 0.271
+tacat 0.26 0.265 0.24
+tacca 0.316 0.231 0.239
+taccc 0.221 0.205 0.261
+taccg 0.232 0.274 0.261
+tacct 0.232 0.291 0.239
+tacga 0.286 0.319 0.18
+tacgc 0.229 0.267 0.333
+tacgg 0.286 0.181 0.252
+tacgt 0.2 0.233 0.234
+tacta 0.208 0.225 0.226
+tactc 0.24 0.265 0.301
+tactg 0.302 0.225 0.247
+tactt 0.25 0.284 0.226
+tagaa 0.222 0.277 0.225
+tagac 0.253 0.268 0.275
+tagag 0.293 0.259 0.294
+tagat 0.232 0.196 0.206
+tagca 0.255 0.225 0.269
+tagcc 0.236 0.325 0.269
+tagcg 0.236 0.175 0.24
+tagct 0.274 0.275 0.221
+tagga 0.245 0.259 0.307
+taggc 0.266 0.237 0.238
+taggg 0.266 0.259 0.228
+taggt 0.223 0.245 0.228
+tagta 0.242 0.263 0.25
+tagtc 0.242 0.283 0.25
+tagtg 0.242 0.232 0.25
+tagtt 0.275 0.222 0.25
+tataa 0.236 0.239 0.235
+tatac 0.27 0.227 0.259
+tatag 0.27 0.273 0.235
+tatat 0.225 0.261 0.271
+tatca 0.236 0.294 0.231
+tatcc 0.292 0.294 0.286
+tatcg 0.236 0.206 0.264
+tatct 0.236 0.206 0.22
+tatga 0.229 0.248 0.206
+tatgc 0.305 0.238 0.268
+tatgg 0.276 0.305 0.227
+tatgt 0.19 0.21 0.299
+tatta 0.258 0.233 0.258
+tattc 0.215 0.244 0.227
+tattg 0.237 0.279 0.227
+tattt 0.29 0.244 0.289
+tcaaa 0.247 0.22 0.25
+tcaac 0.247 0.253 0.23
+tcaag 0.259 0.275 0.29
+tcaat 0.247 0.253 0.23
+tcaca 0.284 0.234 0.267
+tcacc 0.224 0.224 0.21
+tcacg 0.25 0.308 0.295
+tcact 0.241 0.234 0.229
+tcaga 0.269 0.296 0.21
+tcagc 0.319 0.255 0.31
+tcagg 0.235 0.235 0.22
+tcagt 0.176 0.214 0.26
+tcata 0.206 0.216 0.212
+tcatc 0.268 0.258 0.279
+tcatg 0.289 0.309 0.25
+tcatt 0.237 0.216 0.26
+tccaa 0.245 0.235 0.208
+tccac 0.277 0.265 0.292
+tccag 0.245 0.235 0.255
+tccat 0.234 0.265 0.245
+tccca 0.207 0.267 0.26
+tcccc 0.216 0.295 0.26
+tcccg 0.336 0.219 0.26
+tccct 0.241 0.219 0.22
+tccga 0.217 0.2 0.228
+tccgc 0.278 0.285 0.368
+tccgg 0.226 0.215 0.202
+tccgt 0.278 0.3 0.202
+tccta 0.232 0.192 0.217
+tcctc 0.274 0.325 0.235
+tcctg 0.232 0.275 0.365
+tcctt 0.263 0.208 0.183
+tcgaa 0.275 0.214 0.19
+tcgac 0.231 0.268 0.23
+tcgag 0.253 0.241 0.333
+tcgat 0.242 0.277 0.246
+tcgca 0.15 0.218 0.228
+tcgcc 0.279 0.211 0.293
+tcgcg 0.354 0.31 0.301
+tcgct 0.218 0.261 0.179
+tcgga 0.216 0.308 0.264
+tcggc 0.267 0.323 0.3
+tcggg 0.319 0.18 0.245
+tcggt 0.198 0.188 0.191
+tcgta 0.208 0.189 0.184
+tcgtc 0.277 0.302 0.216
+tcgtg 0.297 0.311 0.36
+tcgtt 0.218 0.198 0.24
+tctaa 0.217 0.23 0.208
+tctac 0.239 0.241 0.323
+tctag 0.228 0.241 0.208
+tctat 0.315 0.287 0.26
+tctca 0.216 0.222 0.202
+tctcc 0.261 0.352 0.31
+tctcg 0.306 0.204 0.295
+tctct 0.216 0.222 0.194
+tctga 0.255 0.236 0.168
+tctgc 0.277 0.255 0.319
+tctgg 0.213 0.191 0.277
+tctgt 0.255 0.318 0.235
+tctta 0.225 0.223 0.2
+tcttc 0.247 0.287 0.304
+tcttg 0.27 0.266 0.27
+tcttt 0.258 0.223 0.226
+tgaaa 0.23 0.281 0.218
+tgaac 0.27 0.229 0.245
+tgaag 0.26 0.26 0.318
+tgaat 0.24 0.229 0.218
+tgaca 0.221 0.241 0.257
+tgacc 0.221 0.253 0.265
+tgacg 0.279 0.264 0.283
+tgact 0.279 0.241 0.195
+tgaga 0.232 0.217 0.257
+tgagc 0.219 0.308 0.266
+tgagg 0.358 0.292 0.266
+tgagt 0.192 0.183 0.211
+tgata 0.218 0.23 0.212
+tgatc 0.257 0.253 0.263
+tgatg 0.327 0.253 0.313
+tgatt 0.198 0.264 0.212
+tgcaa 0.222 0.277 0.179
+tgcac 0.25 0.208 0.214
+tgcag 0.259 0.287 0.393
+tgcat 0.269 0.228 0.214
+tgcca 0.205 0.198 0.202
+tgccc 0.291 0.198 0.228
+tgccg 0.26 0.315 0.351
+tgcct 0.244 0.288 0.219
+tgcga 0.203 0.254 0.156
+tgcgc 0.32 0.215 0.333
+tgcgg 0.242 0.238 0.298
+tgcgt 0.234 0.292 0.213
+tgcta 0.192 0.22 0.2
+tgctc 0.25 0.299 0.24
+tgctg 0.327 0.276 0.352
+tgctt 0.231 0.205 0.208
+tggaa 0.264 0.245 0.211
+tggac 0.182 0.255 0.261
+tggag 0.373 0.266 0.359
+tggat 0.182 0.234 0.169
+tggca 0.221 0.245 0.201
+tggcc 0.186 0.198 0.239
+tggcg 0.23 0.283 0.299
+tggct 0.363 0.274 0.261
+tggga 0.189 0.27 0.218
+tgggc 0.321 0.191 0.286
+tgggg 0.274 0.27 0.261
+tgggt 0.217 0.27 0.235
+tggta 0.216 0.211 0.214
+tggtc 0.216 0.221 0.231
+tggtg 0.343 0.337 0.35
+tggtt 0.225 0.232 0.205
+tgtaa 0.261 0.271 0.204
+tgtac 0.228 0.208 0.378
+tgtag 0.283 0.24 0.204
+tgtat 0.228 0.281 0.214
+tgtca 0.215 0.239 0.239
+tgtcc 0.234 0.266 0.202
+tgtcg 0.196 0.22 0.303
+tgtct 0.355 0.275 0.257
+tgtga 0.274 0.238 0.168
+tgtgc 0.178 0.246 0.244
+tgtgg 0.322 0.213 0.202
+tgtgt 0.226 0.303 0.387
+tgtta 0.257 0.247 0.226
+tgttc 0.248 0.215 0.28
+tgttg 0.22 0.28 0.226
+tgttt 0.275 0.258 0.269
+ttaaa 0.25 0.238 0.298
+ttaac 0.25 0.25 0.234
+ttaag 0.25 0.274 0.245
+ttaat 0.25 0.238 0.223
+ttaca 0.223 0.258 0.236
+ttacc 0.25 0.226 0.225
+ttacg 0.321 0.29 0.225
+ttact 0.205 0.226 0.315
+ttaga 0.25 0.27 0.27
+ttagc 0.25 0.225 0.258
+ttagg 0.25 0.247 0.225
+ttagt 0.25 0.258 0.247
+ttata 0.261 0.223 0.255
+ttatc 0.228 0.233 0.245
+ttatg 0.261 0.243 0.276
+ttatt 0.25 0.301 0.224
+ttcaa 0.245 0.24 0.221
+ttcac 0.255 0.28 0.337
+ttcag 0.245 0.23 0.212
+ttcat 0.255 0.25 0.231
+ttcca 0.196 0.284 0.203
+ttccc 0.241 0.225 0.347
+ttccg 0.25 0.235 0.22
+ttcct 0.312 0.255 0.229
+ttcga 0.233 0.278 0.258
+ttcgc 0.353 0.25 0.236
+ttcgg 0.216 0.278 0.258
+ttcgt 0.198 0.194 0.247
+ttcta 0.211 0.2 0.21
+ttctc 0.274 0.227 0.26
+ttctg 0.274 0.255 0.32
+ttctt 0.242 0.318 0.21
+ttgaa 0.25 0.283 0.221
+ttgac 0.25 0.257 0.269
+ttgag 0.25 0.248 0.269
+ttgat 0.25 0.212 0.24
+ttgca 0.235 0.226 0.236
+ttgcc 0.2 0.194 0.292
+ttgcg 0.278 0.371 0.245
+ttgct 0.287 0.21 0.226
+ttgga 0.24 0.272 0.238
+ttggc 0.221 0.288 0.218
+ttggg 0.298 0.224 0.248
+ttggt 0.24 0.216 0.297
+ttgta 0.222 0.269 0.177
+ttgtc 0.274 0.235 0.25
+ttgtg 0.319 0.261 0.306
+ttgtt 0.185 0.235 0.266
+tttaa 0.236 0.273 0.235
+tttac 0.236 0.283 0.259
+tttag 0.247 0.212 0.235
+tttat 0.281 0.232 0.271
+tttca 0.252 0.258 0.239
+tttcc 0.223 0.237 0.273
+tttcg 0.272 0.237 0.239
+tttct 0.252 0.269 0.25
+tttga 0.206 0.232 0.202
+tttgc 0.235 0.232 0.222
+tttgg 0.275 0.232 0.253
+tttgt 0.284 0.303 0.323
+tttta 0.267 0.236 0.222
+ttttc 0.228 0.225 0.222
+ttttg 0.307 0.27 0.311
+ttttt 0.198 0.27 0.244
+
+
+#
+# Internal exon terminal emission probabilities
+#
+[ETEMISSION]
+# Size of vector
+1024
+# k : order of the markov model
+4
+# patpseudocount (pseudocount of sequence patterns)
+5
+# Probabilities
+# Format: pattern win0 win1 win2
+aaaaa 0.25 0.25 0.25
+aaaac 0.25 0.25 0.25
+aaaag 0.25 0.25 0.25
+aaaat 0.25 0.25 0.25
+aaaca 0.25 0.25 0.25
+aaacc 0.25 0.25 0.25
+aaacg 0.25 0.25 0.25
+aaact 0.25 0.25 0.25
+aaaga 0.25 0.25 0.25
+aaagc 0.25 0.25 0.25
+aaagg 0.25 0.25 0.25
+aaagt 0.25 0.25 0.25
+aaata 0.25 0.25 0.25
+aaatc 0.25 0.25 0.25
+aaatg 0.25 0.25 0.25
+aaatt 0.25 0.25 0.25
+aacaa 0.25 0.25 0.25
+aacac 0.25 0.25 0.25
+aacag 0.25 0.25 0.25
+aacat 0.25 0.25 0.25
+aacca 0.25 0.25 0.25
+aaccc 0.25 0.25 0.25
+aaccg 0.25 0.25 0.25
+aacct 0.25 0.25 0.25
+aacga 0.25 0.25 0.25
+aacgc 0.25 0.25 0.25
+aacgg 0.25 0.25 0.25
+aacgt 0.25 0.25 0.25
+aacta 0.25 0.25 0.25
+aactc 0.25 0.25 0.25
+aactg 0.25 0.25 0.25
+aactt 0.25 0.25 0.25
+aagaa 0.25 0.25 0.25
+aagac 0.25 0.25 0.25
+aagag 0.25 0.25 0.25
+aagat 0.25 0.25 0.25
+aagca 0.25 0.25 0.25
+aagcc 0.25 0.25 0.25
+aagcg 0.25 0.25 0.25
+aagct 0.25 0.25 0.25
+aagga 0.25 0.25 0.25
+aaggc 0.25 0.25 0.25
+aaggg 0.25 0.25 0.25
+aaggt 0.25 0.25 0.25
+aagta 0.25 0.25 0.25
+aagtc 0.25 0.25 0.25
+aagtg 0.25 0.25 0.25
+aagtt 0.25 0.25 0.25
+aataa 0.25 0.25 0.25
+aatac 0.25 0.25 0.25
+aatag 0.25 0.25 0.25
+aatat 0.25 0.25 0.25
+aatca 0.25 0.25 0.25
+aatcc 0.25 0.25 0.25
+aatcg 0.25 0.25 0.25
+aatct 0.25 0.25 0.25
+aatga 0.25 0.25 0.25
+aatgc 0.25 0.25 0.25
+aatgg 0.25 0.25 0.25
+aatgt 0.25 0.25 0.25
+aatta 0.25 0.25 0.25
+aattc 0.25 0.25 0.25
+aattg 0.25 0.25 0.25
+aattt 0.25 0.25 0.25
+acaaa 0.25 0.25 0.25
+acaac 0.25 0.25 0.25
+acaag 0.25 0.25 0.25
+acaat 0.25 0.25 0.25
+acaca 0.25 0.25 0.25
+acacc 0.25 0.25 0.25
+acacg 0.25 0.25 0.25
+acact 0.25 0.25 0.25
+acaga 0.25 0.25 0.25
+acagc 0.25 0.25 0.25
+acagg 0.25 0.25 0.25
+acagt 0.25 0.25 0.25
+acata 0.25 0.25 0.25
+acatc 0.25 0.25 0.25
+acatg 0.25 0.25 0.25
+acatt 0.25 0.25 0.25
+accaa 0.25 0.25 0.25
+accac 0.25 0.25 0.25
+accag 0.25 0.25 0.25
+accat 0.25 0.25 0.25
+accca 0.25 0.25 0.25
+acccc 0.25 0.25 0.25
+acccg 0.25 0.25 0.25
+accct 0.25 0.25 0.25
+accga 0.25 0.25 0.25
+accgc 0.25 0.25 0.25
+accgg 0.25 0.25 0.25
+accgt 0.25 0.25 0.25
+accta 0.25 0.25 0.25
+acctc 0.25 0.25 0.25
+acctg 0.25 0.25 0.25
+acctt 0.25 0.25 0.25
+acgaa 0.25 0.25 0.25
+acgac 0.25 0.25 0.25
+acgag 0.25 0.25 0.25
+acgat 0.25 0.25 0.25
+acgca 0.25 0.25 0.25
+acgcc 0.25 0.25 0.25
+acgcg 0.25 0.25 0.25
+acgct 0.25 0.25 0.25
+acgga 0.25 0.25 0.25
+acggc 0.25 0.25 0.25
+acggg 0.25 0.25 0.25
+acggt 0.25 0.25 0.25
+acgta 0.25 0.25 0.25
+acgtc 0.25 0.25 0.25
+acgtg 0.25 0.25 0.25
+acgtt 0.25 0.25 0.25
+actaa 0.25 0.25 0.25
+actac 0.25 0.25 0.25
+actag 0.25 0.25 0.25
+actat 0.25 0.25 0.25
+actca 0.25 0.25 0.25
+actcc 0.25 0.25 0.25
+actcg 0.25 0.25 0.25
+actct 0.25 0.25 0.25
+actga 0.25 0.25 0.25
+actgc 0.25 0.25 0.25
+actgg 0.25 0.25 0.25
+actgt 0.25 0.25 0.25
+actta 0.25 0.25 0.25
+acttc 0.25 0.25 0.25
+acttg 0.25 0.25 0.25
+acttt 0.25 0.25 0.25
+agaaa 0.25 0.25 0.25
+agaac 0.25 0.25 0.25
+agaag 0.25 0.25 0.25
+agaat 0.25 0.25 0.25
+agaca 0.25 0.25 0.25
+agacc 0.25 0.25 0.25
+agacg 0.25 0.25 0.25
+agact 0.25 0.25 0.25
+agaga 0.25 0.25 0.25
+agagc 0.25 0.25 0.25
+agagg 0.25 0.25 0.25
+agagt 0.25 0.25 0.25
+agata 0.25 0.25 0.25
+agatc 0.25 0.25 0.25
+agatg 0.25 0.25 0.25
+agatt 0.25 0.25 0.25
+agcaa 0.25 0.25 0.25
+agcac 0.25 0.25 0.25
+agcag 0.25 0.25 0.25
+agcat 0.25 0.25 0.25
+agcca 0.25 0.25 0.25
+agccc 0.25 0.25 0.25
+agccg 0.25 0.25 0.25
+agcct 0.25 0.25 0.25
+agcga 0.25 0.25 0.25
+agcgc 0.25 0.25 0.25
+agcgg 0.25 0.25 0.25
+agcgt 0.25 0.25 0.25
+agcta 0.25 0.25 0.25
+agctc 0.25 0.25 0.25
+agctg 0.25 0.25 0.25
+agctt 0.25 0.25 0.25
+aggaa 0.25 0.25 0.25
+aggac 0.25 0.25 0.25
+aggag 0.25 0.25 0.25
+aggat 0.25 0.25 0.25
+aggca 0.25 0.25 0.25
+aggcc 0.25 0.25 0.25
+aggcg 0.25 0.25 0.25
+aggct 0.25 0.25 0.25
+aggga 0.25 0.25 0.25
+agggc 0.25 0.25 0.25
+agggg 0.25 0.25 0.25
+agggt 0.25 0.25 0.25
+aggta 0.25 0.25 0.25
+aggtc 0.25 0.25 0.25
+aggtg 0.25 0.25 0.25
+aggtt 0.25 0.25 0.25
+agtaa 0.25 0.25 0.25
+agtac 0.25 0.25 0.25
+agtag 0.25 0.25 0.25
+agtat 0.25 0.25 0.25
+agtca 0.25 0.25 0.25
+agtcc 0.25 0.25 0.25
+agtcg 0.25 0.25 0.25
+agtct 0.25 0.25 0.25
+agtga 0.25 0.25 0.25
+agtgc 0.25 0.25 0.25
+agtgg 0.25 0.25 0.25
+agtgt 0.25 0.25 0.25
+agtta 0.25 0.25 0.25
+agttc 0.25 0.25 0.25
+agttg 0.25 0.25 0.25
+agttt 0.25 0.25 0.25
+ataaa 0.25 0.25 0.25
+ataac 0.25 0.25 0.25
+ataag 0.25 0.25 0.25
+ataat 0.25 0.25 0.25
+ataca 0.25 0.25 0.25
+atacc 0.25 0.25 0.25
+atacg 0.25 0.25 0.25
+atact 0.25 0.25 0.25
+ataga 0.25 0.25 0.25
+atagc 0.25 0.25 0.25
+atagg 0.25 0.25 0.25
+atagt 0.25 0.25 0.25
+atata 0.25 0.25 0.25
+atatc 0.25 0.25 0.25
+atatg 0.25 0.25 0.25
+atatt 0.25 0.25 0.25
+atcaa 0.25 0.25 0.25
+atcac 0.25 0.25 0.25
+atcag 0.25 0.25 0.25
+atcat 0.25 0.25 0.25
+atcca 0.25 0.25 0.25
+atccc 0.25 0.25 0.25
+atccg 0.25 0.25 0.25
+atcct 0.25 0.25 0.25
+atcga 0.25 0.25 0.25
+atcgc 0.25 0.25 0.25
+atcgg 0.25 0.25 0.25
+atcgt 0.25 0.25 0.25
+atcta 0.25 0.25 0.25
+atctc 0.25 0.25 0.25
+atctg 0.25 0.25 0.25
+atctt 0.25 0.25 0.25
+atgaa 0.25 0.25 0.25
+atgac 0.25 0.25 0.25
+atgag 0.25 0.25 0.25
+atgat 0.25 0.25 0.25
+atgca 0.25 0.25 0.25
+atgcc 0.25 0.25 0.25
+atgcg 0.25 0.25 0.25
+atgct 0.25 0.25 0.25
+atgga 0.25 0.25 0.25
+atggc 0.25 0.25 0.25
+atggg 0.25 0.25 0.25
+atggt 0.25 0.25 0.25
+atgta 0.25 0.25 0.25
+atgtc 0.25 0.25 0.25
+atgtg 0.25 0.25 0.25
+atgtt 0.25 0.25 0.25
+attaa 0.25 0.25 0.25
+attac 0.25 0.25 0.25
+attag 0.25 0.25 0.25
+attat 0.25 0.25 0.25
+attca 0.25 0.25 0.25
+attcc 0.25 0.25 0.25
+attcg 0.25 0.25 0.25
+attct 0.25 0.25 0.25
+attga 0.25 0.25 0.25
+attgc 0.25 0.25 0.25
+attgg 0.25 0.25 0.25
+attgt 0.25 0.25 0.25
+attta 0.25 0.25 0.25
+atttc 0.25 0.25 0.25
+atttg 0.25 0.25 0.25
+atttt 0.25 0.25 0.25
+caaaa 0.25 0.25 0.25
+caaac 0.25 0.25 0.25
+caaag 0.25 0.25 0.25
+caaat 0.25 0.25 0.25
+caaca 0.25 0.25 0.25
+caacc 0.25 0.25 0.25
+caacg 0.25 0.25 0.25
+caact 0.25 0.25 0.25
+caaga 0.25 0.25 0.25
+caagc 0.25 0.25 0.25
+caagg 0.25 0.25 0.25
+caagt 0.25 0.25 0.25
+caata 0.25 0.25 0.25
+caatc 0.25 0.25 0.25
+caatg 0.25 0.25 0.25
+caatt 0.25 0.25 0.25
+cacaa 0.25 0.25 0.25
+cacac 0.25 0.25 0.25
+cacag 0.25 0.25 0.25
+cacat 0.25 0.25 0.25
+cacca 0.25 0.25 0.25
+caccc 0.25 0.25 0.25
+caccg 0.25 0.25 0.25
+cacct 0.25 0.25 0.25
+cacga 0.25 0.25 0.25
+cacgc 0.25 0.25 0.25
+cacgg 0.25 0.25 0.25
+cacgt 0.25 0.25 0.25
+cacta 0.25 0.25 0.25
+cactc 0.25 0.25 0.25
+cactg 0.25 0.25 0.25
+cactt 0.25 0.25 0.25
+cagaa 0.25 0.25 0.25
+cagac 0.25 0.25 0.25
+cagag 0.25 0.25 0.25
+cagat 0.25 0.25 0.25
+cagca 0.25 0.25 0.25
+cagcc 0.25 0.25 0.25
+cagcg 0.25 0.25 0.25
+cagct 0.25 0.25 0.25
+cagga 0.25 0.25 0.25
+caggc 0.25 0.25 0.25
+caggg 0.25 0.25 0.25
+caggt 0.25 0.25 0.25
+cagta 0.25 0.25 0.25
+cagtc 0.25 0.25 0.25
+cagtg 0.25 0.25 0.25
+cagtt 0.25 0.25 0.25
+cataa 0.25 0.25 0.25
+catac 0.25 0.25 0.25
+catag 0.25 0.25 0.25
+catat 0.25 0.25 0.25
+catca 0.25 0.25 0.25
+catcc 0.25 0.25 0.25
+catcg 0.25 0.25 0.25
+catct 0.25 0.25 0.25
+catga 0.25 0.25 0.25
+catgc 0.25 0.25 0.25
+catgg 0.25 0.25 0.25
+catgt 0.25 0.25 0.25
+catta 0.25 0.25 0.25
+cattc 0.25 0.25 0.25
+cattg 0.25 0.25 0.25
+cattt 0.25 0.25 0.25
+ccaaa 0.25 0.25 0.25
+ccaac 0.25 0.25 0.25
+ccaag 0.25 0.25 0.25
+ccaat 0.25 0.25 0.25
+ccaca 0.25 0.25 0.25
+ccacc 0.25 0.25 0.25
+ccacg 0.25 0.25 0.25
+ccact 0.25 0.25 0.25
+ccaga 0.25 0.25 0.25
+ccagc 0.25 0.25 0.25
+ccagg 0.25 0.25 0.25
+ccagt 0.25 0.25 0.25
+ccata 0.25 0.25 0.25
+ccatc 0.25 0.25 0.25
+ccatg 0.25 0.25 0.25
+ccatt 0.25 0.25 0.25
+cccaa 0.25 0.25 0.25
+cccac 0.25 0.25 0.25
+cccag 0.25 0.25 0.25
+cccat 0.25 0.25 0.25
+cccca 0.25 0.25 0.25
+ccccc 0.25 0.25 0.25
+ccccg 0.25 0.25 0.25
+cccct 0.25 0.25 0.25
+cccga 0.25 0.25 0.25
+cccgc 0.25 0.25 0.25
+cccgg 0.25 0.25 0.25
+cccgt 0.25 0.25 0.25
+cccta 0.25 0.25 0.25
+ccctc 0.25 0.25 0.25
+ccctg 0.25 0.25 0.25
+ccctt 0.25 0.25 0.25
+ccgaa 0.25 0.25 0.25
+ccgac 0.25 0.25 0.25
+ccgag 0.25 0.25 0.25
+ccgat 0.25 0.25 0.25
+ccgca 0.25 0.25 0.25
+ccgcc 0.25 0.25 0.25
+ccgcg 0.25 0.25 0.25
+ccgct 0.25 0.25 0.25
+ccgga 0.25 0.25 0.25
+ccggc 0.25 0.25 0.25
+ccggg 0.25 0.25 0.25
+ccggt 0.25 0.25 0.25
+ccgta 0.25 0.25 0.25
+ccgtc 0.25 0.25 0.25
+ccgtg 0.25 0.25 0.25
+ccgtt 0.25 0.25 0.25
+cctaa 0.25 0.25 0.25
+cctac 0.25 0.25 0.25
+cctag 0.25 0.25 0.25
+cctat 0.25 0.25 0.25
+cctca 0.25 0.25 0.25
+cctcc 0.25 0.25 0.25
+cctcg 0.25 0.25 0.25
+cctct 0.25 0.25 0.25
+cctga 0.25 0.25 0.25
+cctgc 0.25 0.25 0.25
+cctgg 0.25 0.25 0.25
+cctgt 0.25 0.25 0.25
+cctta 0.25 0.25 0.25
+ccttc 0.25 0.25 0.25
+ccttg 0.25 0.25 0.25
+ccttt 0.25 0.25 0.25
+cgaaa 0.25 0.25 0.25
+cgaac 0.25 0.25 0.25
+cgaag 0.25 0.25 0.25
+cgaat 0.25 0.25 0.25
+cgaca 0.25 0.25 0.25
+cgacc 0.25 0.25 0.25
+cgacg 0.25 0.25 0.25
+cgact 0.25 0.25 0.25
+cgaga 0.25 0.25 0.25
+cgagc 0.25 0.25 0.25
+cgagg 0.25 0.25 0.25
+cgagt 0.25 0.25 0.25
+cgata 0.25 0.25 0.25
+cgatc 0.25 0.25 0.25
+cgatg 0.25 0.25 0.25
+cgatt 0.25 0.25 0.25
+cgcaa 0.25 0.25 0.25
+cgcac 0.25 0.25 0.25
+cgcag 0.25 0.25 0.25
+cgcat 0.25 0.25 0.25
+cgcca 0.25 0.25 0.25
+cgccc 0.25 0.25 0.25
+cgccg 0.25 0.25 0.25
+cgcct 0.25 0.25 0.25
+cgcga 0.25 0.25 0.25
+cgcgc 0.25 0.25 0.25
+cgcgg 0.25 0.25 0.25
+cgcgt 0.25 0.25 0.25
+cgcta 0.25 0.25 0.25
+cgctc 0.25 0.25 0.25
+cgctg 0.25 0.25 0.25
+cgctt 0.25 0.25 0.25
+cggaa 0.25 0.25 0.25
+cggac 0.25 0.25 0.25
+cggag 0.25 0.25 0.25
+cggat 0.25 0.25 0.25
+cggca 0.25 0.25 0.25
+cggcc 0.25 0.25 0.25
+cggcg 0.25 0.25 0.25
+cggct 0.25 0.25 0.25
+cggga 0.25 0.25 0.25
+cgggc 0.25 0.25 0.25
+cgggg 0.25 0.25 0.25
+cgggt 0.25 0.25 0.25
+cggta 0.25 0.25 0.25
+cggtc 0.25 0.25 0.25
+cggtg 0.25 0.25 0.25
+cggtt 0.25 0.25 0.25
+cgtaa 0.25 0.25 0.25
+cgtac 0.25 0.25 0.25
+cgtag 0.25 0.25 0.25
+cgtat 0.25 0.25 0.25
+cgtca 0.25 0.25 0.25
+cgtcc 0.25 0.25 0.25
+cgtcg 0.25 0.25 0.25
+cgtct 0.25 0.25 0.25
+cgtga 0.25 0.25 0.25
+cgtgc 0.25 0.25 0.25
+cgtgg 0.25 0.25 0.25
+cgtgt 0.25 0.25 0.25
+cgtta 0.25 0.25 0.25
+cgttc 0.25 0.25 0.25
+cgttg 0.25 0.25 0.25
+cgttt 0.25 0.25 0.25
+ctaaa 0.25 0.25 0.25
+ctaac 0.25 0.25 0.25
+ctaag 0.25 0.25 0.25
+ctaat 0.25 0.25 0.25
+ctaca 0.25 0.25 0.25
+ctacc 0.25 0.25 0.25
+ctacg 0.25 0.25 0.25
+ctact 0.25 0.25 0.25
+ctaga 0.25 0.25 0.25
+ctagc 0.25 0.25 0.25
+ctagg 0.25 0.25 0.25
+ctagt 0.25 0.25 0.25
+ctata 0.25 0.25 0.25
+ctatc 0.25 0.25 0.25
+ctatg 0.25 0.25 0.25
+ctatt 0.25 0.25 0.25
+ctcaa 0.25 0.25 0.25
+ctcac 0.25 0.25 0.25
+ctcag 0.25 0.25 0.25
+ctcat 0.25 0.25 0.25
+ctcca 0.25 0.25 0.25
+ctccc 0.25 0.25 0.25
+ctccg 0.25 0.25 0.25
+ctcct 0.25 0.25 0.25
+ctcga 0.25 0.25 0.25
+ctcgc 0.25 0.25 0.25
+ctcgg 0.25 0.25 0.25
+ctcgt 0.25 0.25 0.25
+ctcta 0.25 0.25 0.25
+ctctc 0.25 0.25 0.25
+ctctg 0.25 0.25 0.25
+ctctt 0.25 0.25 0.25
+ctgaa 0.25 0.25 0.25
+ctgac 0.25 0.25 0.25
+ctgag 0.25 0.25 0.25
+ctgat 0.25 0.25 0.25
+ctgca 0.25 0.25 0.25
+ctgcc 0.25 0.25 0.25
+ctgcg 0.25 0.25 0.25
+ctgct 0.25 0.25 0.25
+ctgga 0.25 0.25 0.25
+ctggc 0.25 0.25 0.25
+ctggg 0.25 0.25 0.25
+ctggt 0.25 0.25 0.25
+ctgta 0.25 0.25 0.25
+ctgtc 0.25 0.25 0.25
+ctgtg 0.25 0.25 0.25
+ctgtt 0.25 0.25 0.25
+cttaa 0.25 0.25 0.25
+cttac 0.25 0.25 0.25
+cttag 0.25 0.25 0.25
+cttat 0.25 0.25 0.25
+cttca 0.25 0.25 0.25
+cttcc 0.25 0.25 0.25
+cttcg 0.25 0.25 0.25
+cttct 0.25 0.25 0.25
+cttga 0.25 0.25 0.25
+cttgc 0.25 0.25 0.25
+cttgg 0.25 0.25 0.25
+cttgt 0.25 0.25 0.25
+cttta 0.25 0.25 0.25
+ctttc 0.25 0.25 0.25
+ctttg 0.25 0.25 0.25
+ctttt 0.25 0.25 0.25
+gaaaa 0.25 0.25 0.25
+gaaac 0.25 0.25 0.25
+gaaag 0.25 0.25 0.25
+gaaat 0.25 0.25 0.25
+gaaca 0.25 0.25 0.25
+gaacc 0.25 0.25 0.25
+gaacg 0.25 0.25 0.25
+gaact 0.25 0.25 0.25
+gaaga 0.25 0.25 0.25
+gaagc 0.25 0.25 0.25
+gaagg 0.25 0.25 0.25
+gaagt 0.25 0.25 0.25
+gaata 0.25 0.25 0.25
+gaatc 0.25 0.25 0.25
+gaatg 0.25 0.25 0.25
+gaatt 0.25 0.25 0.25
+gacaa 0.25 0.25 0.25
+gacac 0.25 0.25 0.25
+gacag 0.25 0.25 0.25
+gacat 0.25 0.25 0.25
+gacca 0.25 0.25 0.25
+gaccc 0.25 0.25 0.25
+gaccg 0.25 0.25 0.25
+gacct 0.25 0.25 0.25
+gacga 0.25 0.25 0.25
+gacgc 0.25 0.25 0.25
+gacgg 0.25 0.25 0.25
+gacgt 0.25 0.25 0.25
+gacta 0.25 0.25 0.25
+gactc 0.25 0.25 0.25
+gactg 0.25 0.25 0.25
+gactt 0.25 0.25 0.25
+gagaa 0.25 0.25 0.25
+gagac 0.25 0.25 0.25
+gagag 0.25 0.25 0.25
+gagat 0.25 0.25 0.25
+gagca 0.25 0.25 0.25
+gagcc 0.25 0.25 0.25
+gagcg 0.25 0.25 0.25
+gagct 0.25 0.25 0.25
+gagga 0.25 0.25 0.25
+gaggc 0.25 0.25 0.25
+gaggg 0.25 0.25 0.25
+gaggt 0.25 0.25 0.25
+gagta 0.25 0.25 0.25
+gagtc 0.25 0.25 0.25
+gagtg 0.25 0.25 0.25
+gagtt 0.25 0.25 0.25
+gataa 0.25 0.25 0.25
+gatac 0.25 0.25 0.25
+gatag 0.25 0.25 0.25
+gatat 0.25 0.25 0.25
+gatca 0.25 0.25 0.25
+gatcc 0.25 0.25 0.25
+gatcg 0.25 0.25 0.25
+gatct 0.25 0.25 0.25
+gatga 0.25 0.25 0.25
+gatgc 0.25 0.25 0.25
+gatgg 0.25 0.25 0.25
+gatgt 0.25 0.25 0.25
+gatta 0.25 0.25 0.25
+gattc 0.25 0.25 0.25
+gattg 0.25 0.25 0.25
+gattt 0.25 0.25 0.25
+gcaaa 0.25 0.25 0.25
+gcaac 0.25 0.25 0.25
+gcaag 0.25 0.25 0.25
+gcaat 0.25 0.25 0.25
+gcaca 0.25 0.25 0.25
+gcacc 0.25 0.25 0.25
+gcacg 0.25 0.25 0.25
+gcact 0.25 0.25 0.25
+gcaga 0.25 0.25 0.25
+gcagc 0.25 0.25 0.25
+gcagg 0.25 0.25 0.25
+gcagt 0.25 0.25 0.25
+gcata 0.25 0.25 0.25
+gcatc 0.25 0.25 0.25
+gcatg 0.25 0.25 0.25
+gcatt 0.25 0.25 0.25
+gccaa 0.25 0.25 0.25
+gccac 0.25 0.25 0.25
+gccag 0.25 0.25 0.25
+gccat 0.25 0.25 0.25
+gccca 0.25 0.25 0.25
+gcccc 0.25 0.25 0.25
+gcccg 0.25 0.25 0.25
+gccct 0.25 0.25 0.25
+gccga 0.25 0.25 0.25
+gccgc 0.25 0.25 0.25
+gccgg 0.25 0.25 0.25
+gccgt 0.25 0.25 0.25
+gccta 0.25 0.25 0.25
+gcctc 0.25 0.25 0.25
+gcctg 0.25 0.25 0.25
+gcctt 0.25 0.25 0.25
+gcgaa 0.25 0.25 0.25
+gcgac 0.25 0.25 0.25
+gcgag 0.25 0.25 0.25
+gcgat 0.25 0.25 0.25
+gcgca 0.25 0.25 0.25
+gcgcc 0.25 0.25 0.25
+gcgcg 0.25 0.25 0.25
+gcgct 0.25 0.25 0.25
+gcgga 0.25 0.25 0.25
+gcggc 0.25 0.25 0.25
+gcggg 0.25 0.25 0.25
+gcggt 0.25 0.25 0.25
+gcgta 0.25 0.25 0.25
+gcgtc 0.25 0.25 0.25
+gcgtg 0.25 0.25 0.25
+gcgtt 0.25 0.25 0.25
+gctaa 0.25 0.25 0.25
+gctac 0.25 0.25 0.25
+gctag 0.25 0.25 0.25
+gctat 0.25 0.25 0.25
+gctca 0.25 0.25 0.25
+gctcc 0.25 0.25 0.25
+gctcg 0.25 0.25 0.25
+gctct 0.25 0.25 0.25
+gctga 0.25 0.25 0.25
+gctgc 0.25 0.25 0.25
+gctgg 0.25 0.25 0.25
+gctgt 0.25 0.25 0.25
+gctta 0.25 0.25 0.25
+gcttc 0.25 0.25 0.25
+gcttg 0.25 0.25 0.25
+gcttt 0.25 0.25 0.25
+ggaaa 0.25 0.25 0.25
+ggaac 0.25 0.25 0.25
+ggaag 0.25 0.25 0.25
+ggaat 0.25 0.25 0.25
+ggaca 0.25 0.25 0.25
+ggacc 0.25 0.25 0.25
+ggacg 0.25 0.25 0.25
+ggact 0.25 0.25 0.25
+ggaga 0.25 0.25 0.25
+ggagc 0.25 0.25 0.25
+ggagg 0.25 0.25 0.25
+ggagt 0.25 0.25 0.25
+ggata 0.25 0.25 0.25
+ggatc 0.25 0.25 0.25
+ggatg 0.25 0.25 0.25
+ggatt 0.25 0.25 0.25
+ggcaa 0.25 0.25 0.25
+ggcac 0.25 0.25 0.25
+ggcag 0.25 0.25 0.25
+ggcat 0.25 0.25 0.25
+ggcca 0.25 0.25 0.25
+ggccc 0.25 0.25 0.25
+ggccg 0.25 0.25 0.25
+ggcct 0.25 0.25 0.25
+ggcga 0.25 0.25 0.25
+ggcgc 0.25 0.25 0.25
+ggcgg 0.25 0.25 0.25
+ggcgt 0.25 0.25 0.25
+ggcta 0.25 0.25 0.25
+ggctc 0.25 0.25 0.25
+ggctg 0.25 0.25 0.25
+ggctt 0.25 0.25 0.25
+gggaa 0.25 0.25 0.25
+gggac 0.25 0.25 0.25
+gggag 0.25 0.25 0.25
+gggat 0.25 0.25 0.25
+gggca 0.25 0.25 0.25
+gggcc 0.25 0.25 0.25
+gggcg 0.25 0.25 0.25
+gggct 0.25 0.25 0.25
+gggga 0.25 0.25 0.25
+ggggc 0.25 0.25 0.25
+ggggg 0.25 0.25 0.25
+ggggt 0.25 0.25 0.25
+gggta 0.25 0.25 0.25
+gggtc 0.25 0.25 0.25
+gggtg 0.25 0.25 0.25
+gggtt 0.25 0.25 0.25
+ggtaa 0.25 0.25 0.25
+ggtac 0.25 0.25 0.25
+ggtag 0.25 0.25 0.25
+ggtat 0.25 0.25 0.25
+ggtca 0.25 0.25 0.25
+ggtcc 0.25 0.25 0.25
+ggtcg 0.25 0.25 0.25
+ggtct 0.25 0.25 0.25
+ggtga 0.25 0.25 0.25
+ggtgc 0.25 0.25 0.25
+ggtgg 0.25 0.25 0.25
+ggtgt 0.25 0.25 0.25
+ggtta 0.25 0.25 0.25
+ggttc 0.25 0.25 0.25
+ggttg 0.25 0.25 0.25
+ggttt 0.25 0.25 0.25
+gtaaa 0.25 0.25 0.25
+gtaac 0.25 0.25 0.25
+gtaag 0.25 0.25 0.25
+gtaat 0.25 0.25 0.25
+gtaca 0.25 0.25 0.25
+gtacc 0.25 0.25 0.25
+gtacg 0.25 0.25 0.25
+gtact 0.25 0.25 0.25
+gtaga 0.25 0.25 0.25
+gtagc 0.25 0.25 0.25
+gtagg 0.25 0.25 0.25
+gtagt 0.25 0.25 0.25
+gtata 0.25 0.25 0.25
+gtatc 0.25 0.25 0.25
+gtatg 0.25 0.25 0.25
+gtatt 0.25 0.25 0.25
+gtcaa 0.25 0.25 0.25
+gtcac 0.25 0.25 0.25
+gtcag 0.25 0.25 0.25
+gtcat 0.25 0.25 0.25
+gtcca 0.25 0.25 0.25
+gtccc 0.25 0.25 0.25
+gtccg 0.25 0.25 0.25
+gtcct 0.25 0.25 0.25
+gtcga 0.25 0.25 0.25
+gtcgc 0.25 0.25 0.25
+gtcgg 0.25 0.25 0.25
+gtcgt 0.25 0.25 0.25
+gtcta 0.25 0.25 0.25
+gtctc 0.25 0.25 0.25
+gtctg 0.25 0.25 0.25
+gtctt 0.25 0.25 0.25
+gtgaa 0.25 0.25 0.25
+gtgac 0.25 0.25 0.25
+gtgag 0.25 0.25 0.25
+gtgat 0.25 0.25 0.25
+gtgca 0.25 0.25 0.25
+gtgcc 0.25 0.25 0.25
+gtgcg 0.25 0.25 0.25
+gtgct 0.25 0.25 0.25
+gtgga 0.25 0.25 0.25
+gtggc 0.25 0.25 0.25
+gtggg 0.25 0.25 0.25
+gtggt 0.25 0.25 0.25
+gtgta 0.25 0.25 0.25
+gtgtc 0.25 0.25 0.25
+gtgtg 0.25 0.25 0.25
+gtgtt 0.25 0.25 0.25
+gttaa 0.25 0.25 0.25
+gttac 0.25 0.25 0.25
+gttag 0.25 0.25 0.25
+gttat 0.25 0.25 0.25
+gttca 0.25 0.25 0.25
+gttcc 0.25 0.25 0.25
+gttcg 0.25 0.25 0.25
+gttct 0.25 0.25 0.25
+gttga 0.25 0.25 0.25
+gttgc 0.25 0.25 0.25
+gttgg 0.25 0.25 0.25
+gttgt 0.25 0.25 0.25
+gttta 0.25 0.25 0.25
+gtttc 0.25 0.25 0.25
+gtttg 0.25 0.25 0.25
+gtttt 0.25 0.25 0.25
+taaaa 0.25 0.25 0.25
+taaac 0.25 0.25 0.25
+taaag 0.25 0.25 0.25
+taaat 0.25 0.25 0.25
+taaca 0.25 0.25 0.25
+taacc 0.25 0.25 0.25
+taacg 0.25 0.25 0.25
+taact 0.25 0.25 0.25
+taaga 0.25 0.25 0.25
+taagc 0.25 0.25 0.25
+taagg 0.25 0.25 0.25
+taagt 0.25 0.25 0.25
+taata 0.25 0.25 0.25
+taatc 0.25 0.25 0.25
+taatg 0.25 0.25 0.25
+taatt 0.25 0.25 0.25
+tacaa 0.25 0.25 0.25
+tacac 0.25 0.25 0.25
+tacag 0.25 0.25 0.25
+tacat 0.25 0.25 0.25
+tacca 0.25 0.25 0.25
+taccc 0.25 0.25 0.25
+taccg 0.25 0.25 0.25
+tacct 0.25 0.25 0.25
+tacga 0.25 0.25 0.25
+tacgc 0.25 0.25 0.25
+tacgg 0.25 0.25 0.25
+tacgt 0.25 0.25 0.25
+tacta 0.25 0.25 0.25
+tactc 0.25 0.25 0.25
+tactg 0.25 0.25 0.25
+tactt 0.25 0.25 0.25
+tagaa 0.25 0.25 0.25
+tagac 0.25 0.25 0.25
+tagag 0.25 0.25 0.25
+tagat 0.25 0.25 0.25
+tagca 0.25 0.25 0.25
+tagcc 0.25 0.25 0.25
+tagcg 0.25 0.25 0.25
+tagct 0.25 0.25 0.25
+tagga 0.25 0.25 0.25
+taggc 0.25 0.25 0.25
+taggg 0.25 0.25 0.25
+taggt 0.25 0.25 0.25
+tagta 0.25 0.25 0.25
+tagtc 0.25 0.25 0.25
+tagtg 0.25 0.25 0.25
+tagtt 0.25 0.25 0.25
+tataa 0.25 0.25 0.25
+tatac 0.25 0.25 0.25
+tatag 0.25 0.25 0.25
+tatat 0.25 0.25 0.25
+tatca 0.25 0.25 0.25
+tatcc 0.25 0.25 0.25
+tatcg 0.25 0.25 0.25
+tatct 0.25 0.25 0.25
+tatga 0.25 0.25 0.25
+tatgc 0.25 0.25 0.25
+tatgg 0.25 0.25 0.25
+tatgt 0.25 0.25 0.25
+tatta 0.25 0.25 0.25
+tattc 0.25 0.25 0.25
+tattg 0.25 0.25 0.25
+tattt 0.25 0.25 0.25
+tcaaa 0.25 0.25 0.25
+tcaac 0.25 0.25 0.25
+tcaag 0.25 0.25 0.25
+tcaat 0.25 0.25 0.25
+tcaca 0.25 0.25 0.25
+tcacc 0.25 0.25 0.25
+tcacg 0.25 0.25 0.25
+tcact 0.25 0.25 0.25
+tcaga 0.25 0.25 0.25
+tcagc 0.25 0.25 0.25
+tcagg 0.25 0.25 0.25
+tcagt 0.25 0.25 0.25
+tcata 0.25 0.25 0.25
+tcatc 0.25 0.25 0.25
+tcatg 0.25 0.25 0.25
+tcatt 0.25 0.25 0.25
+tccaa 0.25 0.25 0.25
+tccac 0.25 0.25 0.25
+tccag 0.25 0.25 0.25
+tccat 0.25 0.25 0.25
+tccca 0.25 0.25 0.25
+tcccc 0.25 0.25 0.25
+tcccg 0.25 0.25 0.25
+tccct 0.25 0.25 0.25
+tccga 0.25 0.25 0.25
+tccgc 0.25 0.25 0.25
+tccgg 0.25 0.25 0.25
+tccgt 0.25 0.25 0.25
+tccta 0.25 0.25 0.25
+tcctc 0.25 0.25 0.25
+tcctg 0.25 0.25 0.25
+tcctt 0.25 0.25 0.25
+tcgaa 0.25 0.25 0.25
+tcgac 0.25 0.25 0.25
+tcgag 0.25 0.25 0.25
+tcgat 0.25 0.25 0.25
+tcgca 0.25 0.25 0.25
+tcgcc 0.25 0.25 0.25
+tcgcg 0.25 0.25 0.25
+tcgct 0.25 0.25 0.25
+tcgga 0.25 0.25 0.25
+tcggc 0.25 0.25 0.25
+tcggg 0.25 0.25 0.25
+tcggt 0.25 0.25 0.25
+tcgta 0.25 0.25 0.25
+tcgtc 0.25 0.25 0.25
+tcgtg 0.25 0.25 0.25
+tcgtt 0.25 0.25 0.25
+tctaa 0.25 0.25 0.25
+tctac 0.25 0.25 0.25
+tctag 0.25 0.25 0.25
+tctat 0.25 0.25 0.25
+tctca 0.25 0.25 0.25
+tctcc 0.25 0.25 0.25
+tctcg 0.25 0.25 0.25
+tctct 0.25 0.25 0.25
+tctga 0.25 0.25 0.25
+tctgc 0.25 0.25 0.25
+tctgg 0.25 0.25 0.25
+tctgt 0.25 0.25 0.25
+tctta 0.25 0.25 0.25
+tcttc 0.25 0.25 0.25
+tcttg 0.25 0.25 0.25
+tcttt 0.25 0.25 0.25
+tgaaa 0.25 0.25 0.25
+tgaac 0.25 0.25 0.25
+tgaag 0.25 0.25 0.25
+tgaat 0.25 0.25 0.25
+tgaca 0.25 0.25 0.25
+tgacc 0.25 0.25 0.25
+tgacg 0.25 0.25 0.25
+tgact 0.25 0.25 0.25
+tgaga 0.25 0.25 0.25
+tgagc 0.25 0.25 0.25
+tgagg 0.25 0.25 0.25
+tgagt 0.25 0.25 0.25
+tgata 0.25 0.25 0.25
+tgatc 0.25 0.25 0.25
+tgatg 0.25 0.25 0.25
+tgatt 0.25 0.25 0.25
+tgcaa 0.25 0.25 0.25
+tgcac 0.25 0.25 0.25
+tgcag 0.25 0.25 0.25
+tgcat 0.25 0.25 0.25
+tgcca 0.25 0.25 0.25
+tgccc 0.25 0.25 0.25
+tgccg 0.25 0.25 0.25
+tgcct 0.25 0.25 0.25
+tgcga 0.25 0.25 0.25
+tgcgc 0.25 0.25 0.25
+tgcgg 0.25 0.25 0.25
+tgcgt 0.25 0.25 0.25
+tgcta 0.25 0.25 0.25
+tgctc 0.25 0.25 0.25
+tgctg 0.25 0.25 0.25
+tgctt 0.25 0.25 0.25
+tggaa 0.25 0.25 0.25
+tggac 0.25 0.25 0.25
+tggag 0.25 0.25 0.25
+tggat 0.25 0.25 0.25
+tggca 0.25 0.25 0.25
+tggcc 0.25 0.25 0.25
+tggcg 0.25 0.25 0.25
+tggct 0.25 0.25 0.25
+tggga 0.25 0.25 0.25
+tgggc 0.25 0.25 0.25
+tgggg 0.25 0.25 0.25
+tgggt 0.25 0.25 0.25
+tggta 0.25 0.25 0.25
+tggtc 0.25 0.25 0.25
+tggtg 0.25 0.25 0.25
+tggtt 0.25 0.25 0.25
+tgtaa 0.25 0.25 0.25
+tgtac 0.25 0.25 0.25
+tgtag 0.25 0.25 0.25
+tgtat 0.25 0.25 0.25
+tgtca 0.25 0.25 0.25
+tgtcc 0.25 0.25 0.25
+tgtcg 0.25 0.25 0.25
+tgtct 0.25 0.25 0.25
+tgtga 0.25 0.25 0.25
+tgtgc 0.25 0.25 0.25
+tgtgg 0.25 0.25 0.25
+tgtgt 0.25 0.25 0.25
+tgtta 0.25 0.25 0.25
+tgttc 0.25 0.25 0.25
+tgttg 0.25 0.25 0.25
+tgttt 0.25 0.25 0.25
+ttaaa 0.25 0.25 0.25
+ttaac 0.25 0.25 0.25
+ttaag 0.25 0.25 0.25
+ttaat 0.25 0.25 0.25
+ttaca 0.25 0.25 0.25
+ttacc 0.25 0.25 0.25
+ttacg 0.25 0.25 0.25
+ttact 0.25 0.25 0.25
+ttaga 0.25 0.25 0.25
+ttagc 0.25 0.25 0.25
+ttagg 0.25 0.25 0.25
+ttagt 0.25 0.25 0.25
+ttata 0.25 0.25 0.25
+ttatc 0.25 0.25 0.25
+ttatg 0.25 0.25 0.25
+ttatt 0.25 0.25 0.25
+ttcaa 0.25 0.25 0.25
+ttcac 0.25 0.25 0.25
+ttcag 0.25 0.25 0.25
+ttcat 0.25 0.25 0.25
+ttcca 0.25 0.25 0.25
+ttccc 0.25 0.25 0.25
+ttccg 0.25 0.25 0.25
+ttcct 0.25 0.25 0.25
+ttcga 0.25 0.25 0.25
+ttcgc 0.25 0.25 0.25
+ttcgg 0.25 0.25 0.25
+ttcgt 0.25 0.25 0.25
+ttcta 0.25 0.25 0.25
+ttctc 0.25 0.25 0.25
+ttctg 0.25 0.25 0.25
+ttctt 0.25 0.25 0.25
+ttgaa 0.25 0.25 0.25
+ttgac 0.25 0.25 0.25
+ttgag 0.25 0.25 0.25
+ttgat 0.25 0.25 0.25
+ttgca 0.25 0.25 0.25
+ttgcc 0.25 0.25 0.25
+ttgcg 0.25 0.25 0.25
+ttgct 0.25 0.25 0.25
+ttgga 0.25 0.25 0.25
+ttggc 0.25 0.25 0.25
+ttggg 0.25 0.25 0.25
+ttggt 0.25 0.25 0.25
+ttgta 0.25 0.25 0.25
+ttgtc 0.25 0.25 0.25
+ttgtg 0.25 0.25 0.25
+ttgtt 0.25 0.25 0.25
+tttaa 0.25 0.25 0.25
+tttac 0.25 0.25 0.25
+tttag 0.25 0.25 0.25
+tttat 0.25 0.25 0.25
+tttca 0.25 0.25 0.25
+tttcc 0.25 0.25 0.25
+tttcg 0.25 0.25 0.25
+tttct 0.25 0.25 0.25
+tttga 0.25 0.25 0.25
+tttgc 0.25 0.25 0.25
+tttgg 0.25 0.25 0.25
+tttgt 0.25 0.25 0.25
+tttta 0.25 0.25 0.25
+ttttc 0.25 0.25 0.25
+ttttg 0.25 0.25 0.25
+ttttt 0.25 0.25 0.25
diff --git a/config/species/japaneselamprey/japaneselamprey_igenic_probs.pbl b/config/species/japaneselamprey/japaneselamprey_igenic_probs.pbl
new file mode 100644
index 0000000..19bc368
--- /dev/null
+++ b/config/species/japaneselamprey/japaneselamprey_igenic_probs.pbl
@@ -0,0 +1,9680 @@
+[1]
+# (a,c,g,t)= (0.299, 0.201, 0.201, 0.299)
+#
+# Probabilities file for the intergenic region model
+#
+
+# k =
+4
+
+# The P_l's
+[P_ls]
+# l=
+0
+# Values
+A 0.273
+C 0.227
+G 0.227
+T 0.273
+# l=
+1
+# Values
+AA 0.0848
+AC 0.0629
+AG 0.054
+AT 0.0715
+CA 0.0756
+CC 0.0542
+CG 0.0429
+CT 0.054
+GA 0.0547
+GC 0.0549
+GG 0.0542
+GT 0.0629
+TA 0.058
+TC 0.0548
+TG 0.0756
+TT 0.0849
+# l=
+2
+# Values
+AAA 0.0297
+AAC 0.0172
+AAG 0.015
+AAT 0.0229
+ACA 0.0228
+ACC 0.0138
+ACG 0.0125
+ACT 0.0138
+AGA 0.014
+AGC 0.0136
+AGG 0.0126
+AGT 0.0138
+ATA 0.0171
+ATC 0.0131
+ATG 0.0183
+ATT 0.0229
+CAA 0.0203
+CAC 0.0209
+CAG 0.0161
+CAT 0.0183
+CCA 0.0172
+CCC 0.0151
+CCG 0.00934
+CCT 0.0126
+CGA 0.0104
+CGC 0.0107
+CGG 0.00934
+CGT 0.0125
+CTA 0.0089
+CTC 0.014
+CTG 0.0161
+CTT 0.015
+GAA 0.0157
+GAC 0.0119
+GAG 0.014
+GAT 0.0131
+GCA 0.0179
+GCC 0.0127
+GCG 0.0107
+GCT 0.0136
+GGA 0.0126
+GGC 0.0127
+GGG 0.0151
+GGT 0.0138
+GTA 0.0129
+GTC 0.0119
+GTG 0.0209
+GTT 0.0172
+TAA 0.019
+TAC 0.0129
+TAG 0.0089
+TAT 0.0171
+TCA 0.0178
+TCC 0.0126
+TCG 0.0104
+TCT 0.014
+TGA 0.0178
+TGC 0.0179
+TGG 0.0172
+TGT 0.0228
+TTA 0.0191
+TTC 0.0157
+TTG 0.0203
+TTT 0.0297
+# l=
+3
+# Values
+AAAA 0.0105
+AAAC 0.00602
+AAAG 0.00503
+AAAT 0.00817
+AACA 0.00682
+AACC 0.00361
+AACG 0.00309
+AACT 0.00368
+AAGA 0.00394
+AAGC 0.00358
+AAGG 0.00339
+AAGT 0.00409
+AATA 0.0065
+AATC 0.00389
+AATG 0.00623
+AATT 0.00627
+ACAA 0.00667
+ACAC 0.00602
+ACAG 0.00437
+ACAT 0.00577
+ACCA 0.00472
+ACCC 0.00355
+ACCG 0.00243
+ACCT 0.00314
+ACGA 0.00311
+ACGC 0.00275
+ACGG 0.00254
+ACGT 0.00412
+ACTA 0.00234
+ACTC 0.00319
+ACTG 0.00413
+ACTT 0.00409
+AGAA 0.00421
+AGAC 0.00291
+AGAG 0.00357
+AGAT 0.0033
+AGCA 0.00476
+AGCC 0.00313
+AGCG 0.0025
+AGCT 0.0032
+AGGA 0.00319
+AGGC 0.00287
+AGGG 0.00344
+AGGT 0.00314
+AGTA 0.00294
+AGTC 0.00267
+AGTG 0.00447
+AGTT 0.00368
+ATAA 0.0058
+ATAC 0.00351
+ATAG 0.00249
+ATAT 0.00534
+ATCA 0.00439
+ATCC 0.00279
+ATCG 0.00265
+ATCT 0.0033
+ATGA 0.00467
+ATGC 0.00403
+ATGG 0.00382
+ATGT 0.00577
+ATTA 0.00543
+ATTC 0.004
+ATTG 0.0053
+ATTT 0.00817
+CAAA 0.00651
+CAAC 0.00464
+CAAG 0.00387
+CAAT 0.0053
+CACA 0.00689
+CACC 0.00504
+CACG 0.00452
+CACT 0.00447
+CAGA 0.00384
+CAGC 0.00467
+CAGG 0.00348
+CAGT 0.00413
+CATA 0.00335
+CATC 0.00435
+CATG 0.00435
+CATT 0.00623
+CCAA 0.00422
+CCAC 0.00549
+CCAG 0.00364
+CCAT 0.00382
+CCCA 0.00405
+CCCC 0.00525
+CCCG 0.00233
+CCCT 0.00345
+CCGA 0.00227
+CCGC 0.00264
+CCGG 0.00188
+CCGT 0.00254
+CCTA 0.00196
+CCTC 0.00381
+CCTG 0.00348
+CCTT 0.00339
+CGAA 0.00248
+CGAC 0.00248
+CGAG 0.00278
+CGAT 0.00265
+CGCA 0.00296
+CGCC 0.00268
+CGCG 0.00255
+CGCT 0.0025
+CGGA 0.00191
+CGGC 0.00267
+CGGG 0.00233
+CGGT 0.00243
+CGTA 0.0021
+CGTC 0.00281
+CGTG 0.00452
+CGTT 0.00308
+CTAA 0.00265
+CTAC 0.00245
+CTAG 0.00132
+CTAT 0.00249
+CTCA 0.00375
+CTCC 0.00386
+CTCG 0.00278
+CTCT 0.00357
+CTGA 0.00327
+CTGC 0.00484
+CTGG 0.00364
+CTGT 0.00437
+CTTA 0.00267
+CTTC 0.00344
+CTTG 0.00387
+CTTT 0.00503
+GAAA 0.00526
+GAAC 0.00302
+GAAG 0.00343
+GAAT 0.004
+GACA 0.00385
+GACC 0.00262
+GACG 0.00281
+GACT 0.00267
+GAGA 0.00381
+GAGC 0.00314
+GAGG 0.00381
+GAGT 0.00319
+GATA 0.0027
+GATC 0.00218
+GATG 0.00435
+GATT 0.00389
+GCAA 0.00467
+GCAC 0.00431
+GCAG 0.00484
+GCAT 0.00403
+GCCA 0.00429
+GCCC 0.00291
+GCCG 0.00267
+GCCT 0.00287
+GCGA 0.00269
+GCGC 0.00262
+GCGG 0.00264
+GCGT 0.00275
+GCTA 0.00219
+GCTC 0.00314
+GCTG 0.00467
+GCTT 0.00359
+GGAA 0.0036
+GGAC 0.00234
+GGAG 0.00386
+GGAT 0.00279
+GGCA 0.00379
+GGCC 0.00313
+GGCG 0.00268
+GGCT 0.00313
+GGGA 0.00336
+GGGC 0.00291
+GGGG 0.00525
+GGGT 0.00355
+GGTA 0.00258
+GGTC 0.00261
+GGTG 0.00504
+GGTT 0.00361
+GTAA 0.00408
+GTAC 0.00285
+GTAG 0.00245
+GTAT 0.00351
+GTCA 0.00421
+GTCC 0.00234
+GTCG 0.00248
+GTCT 0.00291
+GTGA 0.0051
+GTGC 0.00431
+GTGG 0.00548
+GTGT 0.00602
+GTTA 0.00351
+GTTC 0.00303
+GTTG 0.00464
+GTTT 0.00602
+TAAA 0.00744
+TAAC 0.00351
+TAAG 0.00266
+TAAT 0.00543
+TACA 0.00527
+TACC 0.00258
+TACG 0.0021
+TACT 0.00294
+TAGA 0.0024
+TAGC 0.00219
+TAGG 0.00196
+TAGT 0.00234
+TATA 0.00459
+TATC 0.00271
+TATG 0.00335
+TATT 0.0065
+TCAA 0.00475
+TCAC 0.0051
+TCAG 0.00327
+TCAT 0.00467
+TCCA 0.00412
+TCCC 0.00336
+TCCG 0.00191
+TCCT 0.00319
+TCGA 0.00231
+TCGC 0.00269
+TCGG 0.00227
+TCGT 0.00311
+TCTA 0.0024
+TCTC 0.00381
+TCTG 0.00384
+TCTT 0.00394
+TGAA 0.00544
+TGAC 0.00421
+TGAG 0.00375
+TGAT 0.00439
+TGCA 0.00635
+TGCC 0.00379
+TGCG 0.00296
+TGCT 0.00476
+TGGA 0.00412
+TGGC 0.00429
+TGGG 0.00405
+TGGT 0.00471
+TGTA 0.00527
+TGTC 0.00385
+TGTG 0.00689
+TGTT 0.00682
+TTAA 0.00652
+TTAC 0.00408
+TTAG 0.00265
+TTAT 0.0058
+TTCA 0.00544
+TTCC 0.0036
+TTCG 0.00248
+TTCT 0.00421
+TTGA 0.00475
+TTGC 0.00467
+TTGG 0.00422
+TTGT 0.00667
+TTTA 0.00744
+TTTC 0.00527
+TTTG 0.00651
+TTTT 0.0105
+# l=
+4
+# Values
+AAAAA 0.00411
+AAAAC 0.0021
+AAAAG 0.00144
+AAAAT 0.00289
+AAACA 0.00249
+AAACC 0.00114
+AAACG 0.0011
+AAACT 0.00129
+AAAGA 0.00129
+AAAGC 0.00121
+AAAGG 0.00104
+AAAGT 0.00149
+AAATA 0.00274
+AAATC 0.00132
+AAATG 0.00222
+AAATT 0.00189
+AACAA 0.00209
+AACAC 0.00169
+AACAG 0.00116
+AACAT 0.00188
+AACCA 0.00122
+AACCC 0.00101
+AACCG 0.00054
+AACCT 0.00083
+AACGA 0.000748
+AACGC 0.000732
+AACGG 0.000531
+AACGT 0.00107
+AACTA 0.000746
+AACTC 0.000899
+AACTG 0.000959
+AACTT 0.00108
+AAGAA 0.00132
+AAGAC 0.000784
+AAGAG 0.000957
+AAGAT 0.000886
+AAGCA 0.00124
+AAGCC 0.000793
+AAGCG 0.00063
+AAGCT 0.000923
+AAGGA 0.000837
+AAGGC 0.000828
+AAGGG 0.000887
+AAGGT 0.000836
+AAGTA 0.000904
+AAGTC 0.00083
+AAGTG 0.00128
+AAGTT 0.00108
+AATAA 0.00255
+AATAC 0.00122
+AATAG 0.000811
+AATAT 0.00193
+AATCA 0.00122
+AATCC 0.000893
+AATCG 0.000833
+AATCT 0.000948
+AATGA 0.00153
+AATGC 0.00135
+AATGG 0.00112
+AATGT 0.00224
+AATTA 0.00174
+AATTC 0.00114
+AATTG 0.0015
+AATTT 0.00189
+ACAAA 0.00225
+ACAAC 0.00149
+ACAAG 0.00117
+ACAAT 0.00176
+ACACA 0.00245
+ACACC 0.00113
+ACACG 0.0012
+ACACT 0.00124
+ACAGA 0.00113
+ACAGC 0.00128
+ACAGG 0.000899
+ACAGT 0.00106
+ACATA 0.00103
+ACATC 0.00124
+ACATG 0.00126
+ACATT 0.00224
+ACCAA 0.0012
+ACCAC 0.00156
+ACCAG 0.00098
+ACCAT 0.000976
+ACCCA 0.00112
+ACCCC 0.00105
+ACCCG 0.000608
+ACCCT 0.000769
+ACCGA 0.00068
+ACCGC 0.000676
+ACCGG 0.000458
+ACCGT 0.000616
+ACCTA 0.00057
+ACCTC 0.000831
+ACCTG 0.000904
+ACCTT 0.000836
+ACGAA 0.000809
+ACGAC 0.000771
+ACGAG 0.000791
+ACGAT 0.00074
+ACGCA 0.000916
+ACGCC 0.000582
+ACGCG 0.000671
+ACGCT 0.000576
+ACGGA 0.000574
+ACGGC 0.000721
+ACGGG 0.000633
+ACGGT 0.000616
+ACGTA 0.00076
+ACGTC 0.000909
+ACGTG 0.00137
+ACGTT 0.00107
+ACTAA 0.00072
+ACTAC 0.000616
+ACTAG 0.000334
+ACTAT 0.000673
+ACTCA 0.000959
+ACTCC 0.000709
+ACTCG 0.000753
+ACTCT 0.000771
+ACTGA 0.000908
+ACTGC 0.00129
+ACTGG 0.000879
+ACTGT 0.00106
+ACTTA 0.000784
+ACTTC 0.000803
+ACTTG 0.00101
+ACTTT 0.00149
+AGAAA 0.00138
+AGAAC 0.00084
+AGAAG 0.000951
+AGAAT 0.00104
+AGACA 0.00107
+AGACC 0.000593
+AGACG 0.000634
+AGACT 0.000622
+AGAGA 0.00107
+AGAGC 0.00078
+AGAGG 0.000946
+AGAGT 0.000771
+AGATA 0.000711
+AGATC 0.000543
+AGATG 0.0011
+AGATT 0.000948
+AGCAA 0.00122
+AGCAC 0.00111
+AGCAG 0.00143
+AGCAT 0.000993
+AGCCA 0.00115
+AGCCC 0.000722
+AGCCG 0.000587
+AGCCT 0.000672
+AGCGA 0.000681
+AGCGC 0.000613
+AGCGG 0.000635
+AGCGT 0.000576
+AGCTA 0.000542
+AGCTC 0.000768
+AGCTG 0.000967
+AGCTT 0.000923
+AGGAA 0.000997
+AGGAC 0.000629
+AGGAG 0.000922
+AGGAT 0.000641
+AGGCA 0.000884
+AGGCC 0.000738
+AGGCG 0.000571
+AGGCT 0.000672
+AGGGA 0.000842
+AGGGC 0.000734
+AGGGG 0.0011
+AGGGT 0.000769
+AGGTA 0.000611
+AGGTC 0.000641
+AGGTG 0.00106
+AGGTT 0.00083
+AGTAA 0.000901
+AGTAC 0.000659
+AGTAG 0.000535
+AGTAT 0.000844
+AGTCA 0.00101
+AGTCC 0.000479
+AGTCG 0.000557
+AGTCT 0.000622
+AGTGA 0.00108
+AGTGC 0.000969
+AGTGG 0.00118
+AGTGT 0.00124
+AGTTA 0.000787
+AGTTC 0.000652
+AGTTG 0.000951
+AGTTT 0.00129
+ATAAA 0.00234
+ATAAC 0.000975
+ATAAG 0.000741
+ATAAT 0.00174
+ATACA 0.0016
+ATACC 0.000558
+ATACG 0.000509
+ATACT 0.000844
+ATAGA 0.000681
+ATAGC 0.000632
+ATAGG 0.000503
+ATAGT 0.000673
+ATATA 0.00158
+ATATC 0.00085
+ATATG 0.000985
+ATATT 0.00193
+ATCAA 0.00116
+ATCAC 0.00118
+ATCAG 0.000831
+ATCAT 0.00122
+ATCCA 0.00104
+ATCCC 0.00069
+ATCCG 0.000414
+ATCCT 0.000641
+ATCGA 0.00068
+ATCGC 0.000695
+ATCGG 0.000534
+ATCGT 0.00074
+ATCTA 0.00065
+ATCTC 0.000852
+ATCTG 0.000915
+ATCTT 0.000886
+ATGAA 0.00156
+ATGAC 0.000988
+ATGAG 0.000898
+ATGAT 0.00122
+ATGCA 0.00162
+ATGCC 0.000813
+ATGCG 0.000604
+ATGCT 0.000993
+ATGGA 0.00104
+ATGGC 0.000934
+ATGGG 0.000878
+ATGGT 0.000976
+ATGTA 0.00143
+ATGTC 0.000936
+ATGTG 0.00152
+ATGTT 0.00188
+ATTAA 0.00182
+ATTAC 0.00114
+ATTAG 0.000728
+ATTAT 0.00174
+ATTCA 0.00141
+ATTCC 0.000965
+ATTCG 0.000595
+ATTCT 0.00104
+ATTGA 0.00125
+ATTGC 0.0012
+ATTGG 0.00108
+ATTGT 0.00176
+ATTTA 0.0021
+ATTTC 0.00138
+ATTTG 0.0018
+ATTTT 0.00289
+CAAAA 0.00199
+CAAAC 0.00145
+CAAAG 0.00127
+CAAAT 0.0018
+CAACA 0.00194
+CAACC 0.000952
+CAACG 0.000803
+CAACT 0.000951
+CAAGA 0.00101
+CAAGC 0.000986
+CAAGG 0.000863
+CAAGT 0.00101
+CAATA 0.00129
+CAATC 0.000938
+CAATG 0.00157
+CAATT 0.0015
+CACAA 0.00196
+CACAC 0.00207
+CACAG 0.00135
+CACAT 0.00152
+CACCA 0.00182
+CACCC 0.00124
+CACCG 0.000924
+CACCT 0.00106
+CACGA 0.00108
+CACGC 0.00108
+CACGG 0.000986
+CACGT 0.00137
+CACTA 0.000707
+CACTC 0.00102
+CACTG 0.00146
+CACTT 0.00128
+CAGAA 0.00108
+CAGAC 0.00084
+CAGAG 0.001
+CAGAT 0.000915
+CAGCA 0.00183
+CAGCC 0.00108
+CAGCG 0.000799
+CAGCT 0.000967
+CAGGA 0.000928
+CAGGC 0.000758
+CAGGG 0.000891
+CAGGT 0.000904
+CAGTA 0.000871
+CAGTC 0.000843
+CAGTG 0.00146
+CAGTT 0.000959
+CATAA 0.000979
+CATAC 0.000822
+CATAG 0.000561
+CATAT 0.000985
+CATCA 0.00155
+CATCC 0.000834
+CATCG 0.000864
+CATCT 0.0011
+CATGA 0.00107
+CATGC 0.00106
+CATGG 0.000964
+CATGT 0.00126
+CATTA 0.0013
+CATTC 0.00114
+CATTG 0.00157
+CATTT 0.00222
+CCAAA 0.00133
+CCAAC 0.000976
+CCAAG 0.00084
+CCAAT 0.00108
+CCACA 0.00151
+CCACC 0.00166
+CCACG 0.00113
+CCACT 0.00118
+CCAGA 0.000826
+CCAGC 0.00106
+CCAGG 0.000881
+CCAGT 0.000879
+CCATA 0.000709
+CCATC 0.00103
+CCATG 0.000964
+CCATT 0.00112
+CCCAA 0.000948
+CCCAC 0.00136
+CCCAG 0.00086
+CCCAT 0.000878
+CCCCA 0.00117
+CCCCC 0.00226
+CCCCG 0.000713
+CCCCT 0.0011
+CCCGA 0.000551
+CCCGC 0.000651
+CCCGG 0.000495
+CCCGT 0.000633
+CCCTA 0.000482
+CCCTC 0.00119
+CCCTG 0.000891
+CCCTT 0.000887
+CCGAA 0.000568
+CCGAC 0.000519
+CCGAG 0.00065
+CCGAT 0.000534
+CCGCA 0.000669
+CCGCC 0.000785
+CCGCG 0.000552
+CCGCT 0.000635
+CCGGA 0.000391
+CCGGC 0.000535
+CCGGG 0.000495
+CCGGT 0.000458
+CCGTA 0.000437
+CCGTC 0.00059
+CCGTG 0.000986
+CCGTT 0.000531
+CCTAA 0.000536
+CCTAC 0.000615
+CCTAG 0.000308
+CCTAT 0.000503
+CCTCA 0.000831
+CCTCC 0.00133
+CCTCG 0.000708
+CCTCT 0.000946
+CCTGA 0.000667
+CCTGC 0.00104
+CCTGG 0.000881
+CCTGT 0.000899
+CCTTA 0.000607
+CCTTC 0.000879
+CCTTG 0.000863
+CCTTT 0.00104
+CGAAA 0.000898
+CGAAC 0.000518
+CGAAG 0.000471
+CGAAT 0.000595
+CGACA 0.000668
+CGACC 0.000578
+CGACG 0.000677
+CGACT 0.000557
+CGAGA 0.000658
+CGAGC 0.000659
+CGAGG 0.000708
+CGAGT 0.000753
+CGATA 0.00048
+CGATC 0.000471
+CGATG 0.000864
+CGATT 0.000833
+CGCAA 0.00073
+CGCAC 0.000899
+CGCAG 0.000725
+CGCAT 0.000604
+CGCCA 0.000768
+CGCCC 0.000629
+CGCCG 0.000716
+CGCCT 0.000571
+CGCGA 0.00058
+CGCGC 0.000742
+CGCGG 0.000552
+CGCGT 0.000671
+CGCTA 0.000388
+CGCTC 0.000688
+CGCTG 0.000799
+CGCTT 0.00063
+CGGAA 0.000464
+CGGAC 0.000386
+CGGAG 0.000645
+CGGAT 0.000414
+CGGCA 0.000694
+CGGCC 0.000671
+CGGCG 0.000716
+CGGCT 0.000587
+CGGGA 0.000498
+CGGGC 0.000513
+CGGGG 0.000713
+CGGGT 0.000608
+CGGTA 0.000491
+CGGTC 0.000475
+CGGTG 0.000924
+CGGTT 0.00054
+CGTAA 0.0006
+CGTAC 0.000491
+CGTAG 0.000505
+CGTAT 0.000509
+CGTCA 0.000975
+CGTCC 0.000528
+CGTCG 0.000677
+CGTCT 0.000634
+CGTGA 0.00123
+CGTGC 0.000959
+CGTGG 0.00113
+CGTGT 0.0012
+CGTTA 0.000583
+CGTTC 0.0006
+CGTTG 0.000803
+CGTTT 0.0011
+CTAAA 0.000991
+CTAAC 0.000525
+CTAAG 0.000404
+CTAAT 0.000728
+CTACA 0.000864
+CTACC 0.000547
+CTACG 0.000505
+CTACT 0.000535
+CTAGA 0.000374
+CTAGC 0.000299
+CTAGG 0.000308
+CTAGT 0.000334
+CTATA 0.000659
+CTATC 0.000459
+CTATG 0.000561
+CTATT 0.000811
+CTCAA 0.00108
+CTCAC 0.0011
+CTCAG 0.000666
+CTCAT 0.000898
+CTCCA 0.00114
+CTCCC 0.00115
+CTCCG 0.000645
+CTCCT 0.000922
+CTCGA 0.000529
+CTCGC 0.000806
+CTCGG 0.00065
+CTCGT 0.000791
+CTCTA 0.000534
+CTCTC 0.00108
+CTCTG 0.001
+CTCTT 0.000957
+CTGAA 0.00105
+CTGAC 0.000726
+CTGAG 0.000666
+CTGAT 0.000831
+CTGCA 0.00162
+CTGCC 0.00106
+CTGCG 0.000725
+CTGCT 0.00143
+CTGGA 0.000872
+CTGGC 0.000929
+CTGGG 0.00086
+CTGGT 0.00098
+CTGTA 0.00107
+CTGTC 0.000796
+CTGTG 0.00135
+CTGTT 0.00116
+CTTAA 0.000954
+CTTAC 0.000565
+CTTAG 0.000404
+CTTAT 0.000741
+CTTCA 0.0012
+CTTCC 0.000813
+CTTCG 0.000471
+CTTCT 0.000951
+CTTGA 0.000872
+CTTGC 0.000991
+CTTGG 0.00084
+CTTGT 0.00117
+CTTTA 0.00128
+CTTTC 0.00105
+CTTTG 0.00127
+CTTTT 0.00144
+GAAAA 0.00173
+GAAAC 0.00111
+GAAAG 0.00105
+GAAAT 0.00138
+GAACA 0.00104
+GAACC 0.000737
+GAACG 0.0006
+GAACT 0.000652
+GAAGA 0.000955
+GAAGC 0.000799
+GAAGG 0.000879
+GAAGT 0.000803
+GAATA 0.000972
+GAATC 0.000751
+GAATG 0.00114
+GAATT 0.00114
+GACAA 0.00114
+GACAC 0.000978
+GACAG 0.000796
+GACAT 0.000936
+GACCA 0.000831
+GACCC 0.000667
+GACCG 0.000475
+GACCT 0.000641
+GACGA 0.000755
+GACGC 0.000556
+GACGG 0.00059
+GACGT 0.000909
+GACTA 0.000368
+GACTC 0.000626
+GACTG 0.000843
+GACTT 0.00083
+GAGAA 0.00102
+GAGAC 0.000859
+GAGAG 0.00108
+GAGAT 0.000852
+GAGCA 0.000955
+GAGCC 0.000732
+GAGCG 0.000688
+GAGCT 0.000768
+GAGGA 0.000938
+GAGGC 0.000861
+GAGGG 0.00119
+GAGGT 0.000831
+GAGTA 0.000643
+GAGTC 0.000626
+GAGTG 0.00102
+GAGTT 0.000899
+GATAA 0.000889
+GATAC 0.000508
+GATAG 0.000459
+GATAT 0.00085
+GATCA 0.000689
+GATCC 0.000473
+GATCG 0.000471
+GATCT 0.000543
+GATGA 0.00121
+GATGC 0.000864
+GATGG 0.00103
+GATGT 0.00124
+GATTA 0.000886
+GATTC 0.000751
+GATTG 0.000938
+GATTT 0.00132
+GCAAA 0.00144
+GCAAC 0.00103
+GCAAG 0.000991
+GCAAT 0.0012
+GCACA 0.00146
+GCACC 0.000921
+GCACG 0.000959
+GCACT 0.000969
+GCAGA 0.00104
+GCAGC 0.00147
+GCAGG 0.00104
+GCAGT 0.00129
+GCATA 0.000754
+GCATC 0.000864
+GCATG 0.00106
+GCATT 0.00135
+GCCAA 0.0011
+GCCAC 0.00132
+GCCAG 0.000929
+GCCAT 0.000934
+GCCCA 0.000792
+GCCCC 0.000871
+GCCCG 0.000513
+GCCCT 0.000734
+GCCGA 0.000593
+GCCGC 0.000816
+GCCGG 0.000535
+GCCGT 0.000721
+GCCTA 0.00042
+GCCTC 0.000861
+GCCTG 0.000758
+GCCTT 0.000828
+GCGAA 0.000571
+GCGAC 0.000616
+GCGAG 0.000806
+GCGAT 0.000695
+GCGCA 0.000675
+GCGCC 0.000588
+GCGCG 0.000742
+GCGCT 0.000613
+GCGGA 0.000497
+GCGGC 0.000816
+GCGGG 0.000651
+GCGGT 0.000676
+GCGTA 0.000379
+GCGTC 0.000556
+GCGTG 0.00108
+GCGTT 0.000732
+GCTAA 0.000681
+GCTAC 0.00058
+GCTAG 0.000299
+GCTAT 0.000632
+GCTCA 0.000927
+GCTCC 0.000776
+GCTCG 0.000659
+GCTCT 0.00078
+GCTGA 0.000859
+GCTGC 0.00147
+GCTGG 0.00106
+GCTGT 0.00128
+GCTTA 0.000588
+GCTTC 0.000799
+GCTTG 0.000986
+GCTTT 0.00121
+GGAAA 0.0012
+GGAAC 0.00062
+GGAAG 0.000813
+GGAAT 0.000965
+GGACA 0.000839
+GGACC 0.000494
+GGACG 0.000528
+GGACT 0.000479
+GGAGA 0.00105
+GGAGC 0.000776
+GGAGG 0.00133
+GGAGT 0.000709
+GGATA 0.000586
+GGATC 0.000473
+GGATG 0.000834
+GGATT 0.000893
+GGCAA 0.00102
+GGCAC 0.000896
+GGCAG 0.00106
+GGCAT 0.000813
+GGCCA 0.00107
+GGCCC 0.000659
+GGCCG 0.000671
+GGCCT 0.000738
+GGCGA 0.000727
+GGCGC 0.000588
+GGCGG 0.000785
+GGCGT 0.000582
+GGCTA 0.000526
+GGCTC 0.000732
+GGCTG 0.00108
+GGCTT 0.000793
+GGGAA 0.000961
+GGGAC 0.000555
+GGGAG 0.00115
+GGGAT 0.00069
+GGGCA 0.000904
+GGGCC 0.000659
+GGGCG 0.000629
+GGGCT 0.000722
+GGGGA 0.00106
+GGGGC 0.000871
+GGGGG 0.00226
+GGGGT 0.00105
+GGGTA 0.000632
+GGGTC 0.000667
+GGGTG 0.00124
+GGGTT 0.00101
+GGTAA 0.000969
+GGTAC 0.000505
+GGTAG 0.000547
+GGTAT 0.000558
+GGTCA 0.000952
+GGTCC 0.000494
+GGTCG 0.000578
+GGTCT 0.000593
+GGTGA 0.00132
+GGTGC 0.000921
+GGTGG 0.00166
+GGTGT 0.00113
+GGTTA 0.000784
+GGTTC 0.000737
+GGTTG 0.000952
+GGTTT 0.00114
+GTAAA 0.00163
+GTAAC 0.000753
+GTAAG 0.000565
+GTAAT 0.00114
+GTACA 0.0012
+GTACC 0.000505
+GTACG 0.000491
+GTACT 0.000659
+GTAGA 0.000638
+GTAGC 0.00058
+GTAGG 0.000615
+GTAGT 0.000616
+GTATA 0.000961
+GTATC 0.000508
+GTATG 0.000822
+GTATT 0.00122
+GTCAA 0.00107
+GTCAC 0.00143
+GTCAG 0.000726
+GTCAT 0.000988
+GTCCA 0.000771
+GTCCC 0.000555
+GTCCG 0.000386
+GTCCT 0.000629
+GTCGA 0.000573
+GTCGC 0.000616
+GTCGG 0.000519
+GTCGT 0.000771
+GTCTA 0.00043
+GTCTC 0.000859
+GTCTG 0.00084
+GTCTT 0.000784
+GTGAA 0.00139
+GTGAC 0.00143
+GTGAG 0.0011
+GTGAT 0.00118
+GTGCA 0.00141
+GTGCC 0.000896
+GTGCG 0.000899
+GTGCT 0.00111
+GTGGA 0.00124
+GTGGC 0.00132
+GTGGG 0.00136
+GTGGT 0.00156
+GTGTA 0.00128
+GTGTC 0.000978
+GTGTG 0.00207
+GTGTT 0.00169
+GTTAA 0.00126
+GTTAC 0.000753
+GTTAG 0.000525
+GTTAT 0.000975
+GTTCA 0.00105
+GTTCC 0.00062
+GTTCG 0.000518
+GTTCT 0.00084
+GTTGA 0.00115
+GTTGC 0.00103
+GTTGG 0.000976
+GTTGT 0.00149
+GTTTA 0.00136
+GTTTC 0.00111
+GTTTG 0.00145
+GTTTT 0.0021
+TAAAA 0.0027
+TAAAC 0.00136
+TAAAG 0.00128
+TAAAT 0.0021
+TAACA 0.00136
+TAACC 0.000784
+TAACG 0.000583
+TAACT 0.000787
+TAAGA 0.000686
+TAAGC 0.000588
+TAAGG 0.000607
+TAAGT 0.000784
+TAATA 0.0015
+TAATC 0.000886
+TAATG 0.0013
+TAATT 0.00174
+TACAA 0.00149
+TACAC 0.00128
+TACAG 0.00107
+TACAT 0.00143
+TACCA 0.000845
+TACCC 0.000632
+TACCG 0.000491
+TACCT 0.000611
+TACGA 0.000528
+TACGC 0.000379
+TACGG 0.000437
+TACGT 0.00076
+TACTA 0.000522
+TACTC 0.000643
+TACTG 0.000871
+TACTT 0.000904
+TAGAA 0.000789
+TAGAC 0.00043
+TAGAG 0.000534
+TAGAT 0.00065
+TAGCA 0.000737
+TAGCC 0.000526
+TAGCG 0.000388
+TAGCT 0.000542
+TAGGA 0.000487
+TAGGC 0.00042
+TAGGG 0.000482
+TAGGT 0.00057
+TAGTA 0.000522
+TAGTC 0.000368
+TAGTG 0.000707
+TAGTT 0.000746
+TATAA 0.00139
+TATAC 0.000961
+TATAG 0.000659
+TATAT 0.00158
+TATCA 0.000927
+TATCC 0.000586
+TATCG 0.00048
+TATCT 0.000711
+TATGA 0.000852
+TATGC 0.000754
+TATGG 0.000709
+TATGT 0.00103
+TATTA 0.0015
+TATTC 0.000972
+TATTG 0.00129
+TATTT 0.00274
+TCAAA 0.00148
+TCAAC 0.00115
+TCAAG 0.000872
+TCAAT 0.00125
+TCACA 0.00146
+TCACC 0.00132
+TCACG 0.00123
+TCACT 0.00108
+TCAGA 0.00084
+TCAGC 0.000859
+TCAGG 0.000667
+TCAGT 0.000908
+TCATA 0.000852
+TCATC 0.00121
+TCATG 0.00107
+TCATT 0.00153
+TCCAA 0.000979
+TCCAC 0.00124
+TCCAG 0.000872
+TCCAT 0.00104
+TCCCA 0.000961
+TCCCC 0.00106
+TCCCG 0.000498
+TCCCT 0.000842
+TCCGA 0.000446
+TCCGC 0.000497
+TCCGG 0.000391
+TCCGT 0.000574
+TCCTA 0.000487
+TCCTC 0.000938
+TCCTG 0.000928
+TCCTT 0.000837
+TCGAA 0.000533
+TCGAC 0.000573
+TCGAG 0.000529
+TCGAT 0.00068
+TCGCA 0.000699
+TCGCC 0.000727
+TCGCG 0.00058
+TCGCT 0.000681
+TCGGA 0.000446
+TCGGC 0.000593
+TCGGG 0.000551
+TCGGT 0.00068
+TCGTA 0.000528
+TCGTC 0.000755
+TCGTG 0.00108
+TCGTT 0.000748
+TCTAA 0.00071
+TCTAC 0.000638
+TCTAG 0.000374
+TCTAT 0.000681
+TCTCA 0.00103
+TCTCC 0.00105
+TCTCG 0.000658
+TCTCT 0.00107
+TCTGA 0.00084
+TCTGC 0.00104
+TCTGG 0.000826
+TCTGT 0.00113
+TCTTA 0.000686
+TCTTC 0.000955
+TCTTG 0.00101
+TCTTT 0.00129
+TGAAA 0.00179
+TGAAC 0.00105
+TGAAG 0.0012
+TGAAT 0.00141
+TGACA 0.00127
+TGACC 0.000952
+TGACG 0.000975
+TGACT 0.00101
+TGAGA 0.00103
+TGAGC 0.000927
+TGAGG 0.000831
+TGAGT 0.000959
+TGATA 0.000927
+TGATC 0.000689
+TGATG 0.00155
+TGATT 0.00122
+TGCAA 0.0017
+TGCAC 0.00141
+TGCAG 0.00162
+TGCAT 0.00162
+TGCCA 0.0013
+TGCCC 0.000904
+TGCCG 0.000694
+TGCCT 0.000884
+TGCGA 0.000699
+TGCGC 0.000675
+TGCGG 0.000669
+TGCGT 0.000916
+TGCTA 0.000737
+TGCTC 0.000955
+TGCTG 0.00183
+TGCTT 0.00124
+TGGAA 0.00117
+TGGAC 0.000771
+TGGAG 0.00114
+TGGAT 0.00104
+TGGCA 0.0013
+TGGCC 0.00107
+TGGCG 0.000768
+TGGCT 0.00115
+TGGGA 0.000961
+TGGGC 0.000792
+TGGGG 0.00117
+TGGGT 0.00112
+TGGTA 0.000845
+TGGTC 0.000831
+TGGTG 0.00182
+TGGTT 0.00122
+TGTAA 0.00161
+TGTAC 0.0012
+TGTAG 0.000864
+TGTAT 0.0016
+TGTCA 0.00127
+TGTCC 0.000839
+TGTCG 0.000668
+TGTCT 0.00107
+TGTGA 0.00146
+TGTGC 0.00146
+TGTGG 0.00151
+TGTGT 0.00245
+TGTTA 0.00136
+TGTTC 0.00104
+TGTTG 0.00194
+TGTTT 0.00249
+TTAAA 0.00248
+TTAAC 0.00126
+TTAAG 0.000954
+TTAAT 0.00182
+TTACA 0.00161
+TTACC 0.000969
+TTACG 0.0006
+TTACT 0.000901
+TTAGA 0.00071
+TTAGC 0.000681
+TTAGG 0.000536
+TTAGT 0.00072
+TTATA 0.00139
+TTATC 0.000889
+TTATG 0.000979
+TTATT 0.00255
+TTCAA 0.00145
+TTCAC 0.00139
+TTCAG 0.00105
+TTCAT 0.00156
+TTCCA 0.00117
+TTCCC 0.000961
+TTCCG 0.000464
+TTCCT 0.000997
+TTCGA 0.000533
+TTCGC 0.000571
+TTCGG 0.000568
+TTCGT 0.000809
+TTCTA 0.000789
+TTCTC 0.00102
+TTCTG 0.00108
+TTCTT 0.00132
+TTGAA 0.00145
+TTGAC 0.00107
+TTGAG 0.00108
+TTGAT 0.00116
+TTGCA 0.0017
+TTGCC 0.00102
+TTGCG 0.00073
+TTGCT 0.00122
+TTGGA 0.000979
+TTGGC 0.0011
+TTGGG 0.000948
+TTGGT 0.0012
+TTGTA 0.00149
+TTGTC 0.00114
+TTGTG 0.00196
+TTGTT 0.00209
+TTTAA 0.00248
+TTTAC 0.00163
+TTTAG 0.000991
+TTTAT 0.00234
+TTTCA 0.00179
+TTTCC 0.0012
+TTTCG 0.000898
+TTTCT 0.00138
+TTTGA 0.00148
+TTTGC 0.00144
+TTTGG 0.00133
+TTTGT 0.00225
+TTTTA 0.0027
+TTTTC 0.00173
+TTTTG 0.00199
+TTTTT 0.00411
+
+[EMISSION]
+
+# Vector size (4^(k+1))
+1024
+# Probabilities
+AAAAA 0.3899
+AAAAC 0.1992
+AAAAG 0.1365
+AAAAT 0.2744
+AAACA 0.4132
+AAACC 0.1889
+AAACG 0.183
+AAACT 0.2149
+AAAGA 0.257
+AAAGC 0.2407
+AAAGG 0.2064
+AAAGT 0.2959
+AAATA 0.3354
+AAATC 0.1615
+AAATG 0.2714
+AAATT 0.2317
+AACAA 0.306
+AACAC 0.2481
+AACAG 0.1696
+AACAT 0.2763
+AACCA 0.3392
+AACCC 0.281
+AACCG 0.1497
+AACCT 0.2301
+AACGA 0.2427
+AACGC 0.2372
+AACGG 0.172
+AACGT 0.3481
+AACTA 0.2026
+AACTC 0.2442
+AACTG 0.2602
+AACTT 0.293
+AAGAA 0.3337
+AAGAC 0.1989
+AAGAG 0.2426
+AAGAT 0.2248
+AAGCA 0.3457
+AAGCC 0.2213
+AAGCG 0.1756
+AAGCT 0.2574
+AAGGA 0.2471
+AAGGC 0.2445
+AAGGG 0.2617
+AAGGT 0.2467
+AAGTA 0.221
+AAGTC 0.2029
+AAGTG 0.3124
+AAGTT 0.2638
+AATAA 0.3917
+AATAC 0.1876
+AATAG 0.1247
+AATAT 0.2961
+AATCA 0.3133
+AATCC 0.2294
+AATCG 0.2139
+AATCT 0.2434
+AATGA 0.246
+AATGC 0.2159
+AATGG 0.1792
+AATGT 0.359
+AATTA 0.2777
+AATTC 0.181
+AATTG 0.2397
+AATTT 0.3016
+ACAAA 0.3378
+ACAAC 0.2227
+ACAAG 0.175
+ACAAT 0.2646
+ACACA 0.4064
+ACACC 0.1885
+ACACG 0.1996
+ACACT 0.2055
+ACAGA 0.2581
+ACAGC 0.2941
+ACAGG 0.2059
+ACAGT 0.2419
+ACATA 0.1788
+ACATC 0.2151
+ACATG 0.218
+ACATT 0.3881
+ACCAA 0.2539
+ACCAC 0.3313
+ACCAG 0.2078
+ACCAT 0.207
+ACCCA 0.3162
+ACCCC 0.2966
+ACCCG 0.1709
+ACCCT 0.2162
+ACCGA 0.2799
+ACCGC 0.2781
+ACCGG 0.1885
+ACCGT 0.2534
+ACCTA 0.1816
+ACCTC 0.2644
+ACCTG 0.2878
+ACCTT 0.2661
+ACGAA 0.26
+ACGAC 0.2478
+ACGAG 0.2542
+ACGAT 0.238
+ACGCA 0.3336
+ACGCC 0.2121
+ACGCG 0.2445
+ACGCT 0.2099
+ACGGA 0.2255
+ACGGC 0.2833
+ACGGG 0.249
+ACGGT 0.2421
+ACGTA 0.1847
+ACGTC 0.2208
+ACGTG 0.3339
+ACGTT 0.2607
+ACTAA 0.3071
+ACTAC 0.263
+ACTAG 0.1427
+ACTAT 0.2872
+ACTCA 0.3004
+ACTCC 0.2222
+ACTCG 0.2359
+ACTCT 0.2416
+ACTGA 0.2197
+ACTGC 0.3122
+ACTGG 0.2126
+ACTGT 0.2556
+ACTTA 0.1916
+ACTTC 0.1964
+ACTTG 0.2479
+ACTTT 0.3641
+AGAAA 0.3273
+AGAAC 0.1997
+AGAAG 0.226
+AGAAT 0.247
+AGACA 0.3656
+AGACC 0.2033
+AGACG 0.2176
+AGACT 0.2135
+AGAGA 0.3008
+AGAGC 0.2185
+AGAGG 0.2648
+AGAGT 0.2159
+AGATA 0.2153
+AGATC 0.1646
+AGATG 0.3332
+AGATT 0.2869
+AGCAA 0.2569
+AGCAC 0.2332
+AGCAG 0.3013
+AGCAT 0.2087
+AGCCA 0.367
+AGCCC 0.2307
+AGCCG 0.1875
+AGCCT 0.2148
+AGCGA 0.2719
+AGCGC 0.2448
+AGCGG 0.2533
+AGCGT 0.23
+AGCTA 0.1694
+AGCTC 0.2399
+AGCTG 0.3023
+AGCTT 0.2884
+AGGAA 0.3126
+AGGAC 0.1972
+AGGAG 0.2892
+AGGAT 0.2009
+AGGCA 0.3086
+AGGCC 0.2577
+AGGCG 0.1992
+AGGCT 0.2345
+AGGGA 0.2444
+AGGGC 0.2129
+AGGGG 0.3196
+AGGGT 0.2231
+AGGTA 0.1945
+AGGTC 0.2041
+AGGTG 0.337
+AGGTT 0.2643
+AGTAA 0.3064
+AGTAC 0.2243
+AGTAG 0.182
+AGTAT 0.2872
+AGTCA 0.378
+AGTCC 0.1797
+AGTCG 0.2089
+AGTCT 0.2334
+AGTGA 0.2415
+AGTGC 0.2169
+AGTGG 0.2647
+AGTGT 0.277
+AGTTA 0.2137
+AGTTC 0.1771
+AGTTG 0.2581
+AGTTT 0.3511
+ATAAA 0.4034
+ATAAC 0.168
+ATAAG 0.1278
+ATAAT 0.3008
+ATACA 0.4551
+ATACC 0.1591
+ATACG 0.1452
+ATACT 0.2406
+ATAGA 0.2737
+ATAGC 0.254
+ATAGG 0.2019
+ATAGT 0.2704
+ATATA 0.2961
+ATATC 0.1592
+ATATG 0.1844
+ATATT 0.3603
+ATCAA 0.2639
+ATCAC 0.2686
+ATCAG 0.1894
+ATCAT 0.2781
+ATCCA 0.3739
+ATCCC 0.2477
+ATCCG 0.1485
+ATCCT 0.23
+ATCGA 0.2566
+ATCGC 0.2623
+ATCGG 0.2016
+ATCGT 0.2795
+ATCTA 0.1968
+ATCTC 0.2579
+ATCTG 0.277
+ATCTT 0.2683
+ATGAA 0.3342
+ATGAC 0.2118
+ATGAG 0.1924
+ATGAT 0.2615
+ATGCA 0.4018
+ATGCC 0.2018
+ATGCG 0.15
+ATGCT 0.2464
+ATGGA 0.2708
+ATGGC 0.2443
+ATGGG 0.2296
+ATGGT 0.2553
+ATGTA 0.2478
+ATGTC 0.1623
+ATGTG 0.2632
+ATGTT 0.3267
+ATTAA 0.3355
+ATTAC 0.2094
+ATTAG 0.1339
+ATTAT 0.3211
+ATTCA 0.3511
+ATTCC 0.241
+ATTCG 0.1485
+ATTCT 0.2594
+ATTGA 0.2358
+ATTGC 0.2271
+ATTGG 0.2041
+ATTGT 0.333
+ATTTA 0.2575
+ATTTC 0.1687
+ATTTG 0.2201
+ATTTT 0.3537
+CAAAA 0.3058
+CAAAC 0.2234
+CAAAG 0.1946
+CAAAT 0.2762
+CAACA 0.4171
+CAACC 0.2051
+CAACG 0.173
+CAACT 0.2048
+CAAGA 0.26
+CAAGC 0.2548
+CAAGG 0.2231
+CAAGT 0.2621
+CAATA 0.243
+CAATC 0.177
+CAATG 0.2962
+CAATT 0.2838
+CACAA 0.2841
+CACAC 0.3003
+CACAG 0.1954
+CACAT 0.2202
+CACCA 0.3604
+CACCC 0.2461
+CACCG 0.1835
+CACCT 0.2101
+CACGA 0.2393
+CACGC 0.2385
+CACGG 0.2182
+CACGT 0.304
+CACTA 0.1582
+CACTC 0.2286
+CACTG 0.3271
+CACTT 0.2861
+CAGAA 0.2813
+CAGAC 0.219
+CAGAG 0.2614
+CAGAT 0.2384
+CAGCA 0.3911
+CAGCC 0.2306
+CAGCG 0.1711
+CAGCT 0.2072
+CAGGA 0.2666
+CAGGC 0.2179
+CAGGG 0.2559
+CAGGT 0.2597
+CAGTA 0.2107
+CAGTC 0.2038
+CAGTG 0.3536
+CAGTT 0.2319
+CATAA 0.2924
+CATAC 0.2456
+CATAG 0.1676
+CATAT 0.2943
+CATCA 0.3569
+CATCC 0.1917
+CATCG 0.1985
+CATCT 0.2529
+CATGA 0.2452
+CATGC 0.2445
+CATGG 0.2215
+CATGT 0.2888
+CATTA 0.209
+CATTC 0.1836
+CATTG 0.2518
+CATTT 0.3556
+CCAAA 0.3139
+CCAAC 0.2311
+CCAAG 0.199
+CCAAT 0.2561
+CCACA 0.276
+CCACC 0.3023
+CCACG 0.206
+CCACT 0.2156
+CCAGA 0.2267
+CCAGC 0.2903
+CCAGG 0.2419
+CCAGT 0.2411
+CCATA 0.1854
+CCATC 0.2703
+CCATG 0.2522
+CCATT 0.2921
+CCCAA 0.2341
+CCCAC 0.3366
+CCCAG 0.2125
+CCCAT 0.2168
+CCCCA 0.2229
+CCCCC 0.4314
+CCCCG 0.1359
+CCCCT 0.2098
+CCCGA 0.2364
+CCCGC 0.2794
+CCCGG 0.2125
+CCCGT 0.2717
+CCCTA 0.1399
+CCCTC 0.344
+CCCTG 0.2586
+CCCTT 0.2574
+CCGAA 0.2503
+CCGAC 0.2284
+CCGAG 0.2863
+CCGAT 0.235
+CCGCA 0.2534
+CCGCC 0.2972
+CCGCG 0.2091
+CCGCT 0.2403
+CCGGA 0.2081
+CCGGC 0.2847
+CCGGG 0.2635
+CCGGT 0.2437
+CCGTA 0.1718
+CCGTC 0.232
+CCGTG 0.3877
+CCGTT 0.2085
+CCTAA 0.2733
+CCTAC 0.3134
+CCTAG 0.1569
+CCTAT 0.2564
+CCTCA 0.218
+CCTCC 0.3485
+CCTCG 0.1855
+CCTCT 0.248
+CCTGA 0.1914
+CCTGC 0.2975
+CCTGG 0.253
+CCTGT 0.2581
+CCTTA 0.1792
+CCTTC 0.2594
+CCTTG 0.2548
+CCTTT 0.3065
+CGAAA 0.3618
+CGAAC 0.2086
+CGAAG 0.19
+CGAAT 0.2396
+CGACA 0.2692
+CGACC 0.2333
+CGACG 0.2729
+CGACT 0.2246
+CGAGA 0.2368
+CGAGC 0.2374
+CGAGG 0.2548
+CGAGT 0.271
+CGATA 0.1812
+CGATC 0.1779
+CGATG 0.3263
+CGATT 0.3146
+CGCAA 0.2467
+CGCAC 0.3039
+CGCAG 0.245
+CGCAT 0.2043
+CGCCA 0.2862
+CGCCC 0.2343
+CGCCG 0.2668
+CGCCT 0.2127
+CGCGA 0.228
+CGCGC 0.2914
+CGCGG 0.2169
+CGCGT 0.2637
+CGCTA 0.155
+CGCTC 0.2746
+CGCTG 0.319
+CGCTT 0.2514
+CGGAA 0.2433
+CGGAC 0.2021
+CGGAG 0.338
+CGGAT 0.2167
+CGGCA 0.2601
+CGGCC 0.2517
+CGGCG 0.2683
+CGGCT 0.22
+CGGGA 0.2135
+CGGGC 0.2201
+CGGGG 0.3059
+CGGGT 0.2605
+CGGTA 0.2021
+CGGTC 0.1953
+CGGTG 0.3803
+CGGTT 0.2222
+CGTAA 0.2851
+CGTAC 0.2331
+CGTAG 0.2397
+CGTAT 0.242
+CGTCA 0.3466
+CGTCC 0.1875
+CGTCG 0.2405
+CGTCT 0.2254
+CGTGA 0.2719
+CGTGC 0.2122
+CGTGG 0.25
+CGTGT 0.2659
+CGTTA 0.1888
+CGTTC 0.1945
+CGTTG 0.2602
+CGTTT 0.3566
+CTAAA 0.3744
+CTAAC 0.1982
+CTAAG 0.1525
+CTAAT 0.2749
+CTACA 0.3527
+CTACC 0.2232
+CTACG 0.2059
+CTACT 0.2183
+CTAGA 0.2844
+CTAGC 0.2276
+CTAGG 0.2338
+CTAGT 0.2543
+CTATA 0.2645
+CTATC 0.1845
+CTATG 0.2253
+CTATT 0.3256
+CTCAA 0.2883
+CTCAC 0.2942
+CTCAG 0.1779
+CTCAT 0.2397
+CTCCA 0.2949
+CTCCC 0.2988
+CTCCG 0.1672
+CTCCT 0.2391
+CTCGA 0.1906
+CTCGC 0.2904
+CTCGG 0.2341
+CTCGT 0.2849
+CTCTA 0.1495
+CTCTC 0.3017
+CTCTG 0.2809
+CTCTT 0.2679
+CTGAA 0.3207
+CTGAC 0.2217
+CTGAG 0.2037
+CTGAT 0.2539
+CTGCA 0.3354
+CTGCC 0.2185
+CTGCG 0.1498
+CTGCT 0.2963
+CTGGA 0.2396
+CTGGC 0.2551
+CTGGG 0.2363
+CTGGT 0.269
+CTGTA 0.2449
+CTGTC 0.1822
+CTGTG 0.3082
+CTGTT 0.2647
+CTTAA 0.3581
+CTTAC 0.2122
+CTTAG 0.1515
+CTTAT 0.2782
+CTTCA 0.3493
+CTTCC 0.2367
+CTTCG 0.1372
+CTTCT 0.2768
+CTTGA 0.2252
+CTTGC 0.2561
+CTTGG 0.2171
+CTTGT 0.3016
+CTTTA 0.2542
+CTTTC 0.2082
+CTTTG 0.2518
+CTTTT 0.2857
+GAAAA 0.3295
+GAAAC 0.21
+GAAAG 0.1989
+GAAAT 0.2617
+GAACA 0.3427
+GAACC 0.2435
+GAACG 0.1983
+GAACT 0.2155
+GAAGA 0.2779
+GAAGC 0.2326
+GAAGG 0.2557
+GAAGT 0.2338
+GAATA 0.2429
+GAATC 0.1876
+GAATG 0.2858
+GAATT 0.2837
+GACAA 0.2958
+GACAC 0.2541
+GACAG 0.2069
+GACAT 0.2432
+GACCA 0.318
+GACCC 0.2553
+GACCG 0.1816
+GACCT 0.2452
+GACGA 0.2688
+GACGC 0.1979
+GACGG 0.2099
+GACGT 0.3234
+GACTA 0.1378
+GACTC 0.2347
+GACTG 0.316
+GACTT 0.3114
+GAGAA 0.2681
+GAGAC 0.2255
+GAGAG 0.2829
+GAGAT 0.2236
+GAGCA 0.3038
+GAGCC 0.2329
+GAGCG 0.2189
+GAGCT 0.2444
+GAGGA 0.2459
+GAGGC 0.2257
+GAGGG 0.3107
+GAGGT 0.2177
+GAGTA 0.2015
+GAGTC 0.1962
+GAGTG 0.3202
+GAGTT 0.282
+GATAA 0.3284
+GATAC 0.1876
+GATAG 0.1697
+GATAT 0.3142
+GATCA 0.3166
+GATCC 0.2172
+GATCG 0.2164
+GATCT 0.2498
+GATGA 0.2789
+GATGC 0.1985
+GATGG 0.2376
+GATGT 0.285
+GATTA 0.2275
+GATTC 0.1929
+GATTG 0.2408
+GATTT 0.3387
+GCAAA 0.3092
+GCAAC 0.2212
+GCAAG 0.2121
+GCAAT 0.2575
+GCACA 0.3395
+GCACC 0.2135
+GCACG 0.2224
+GCACT 0.2246
+GCAGA 0.216
+GCAGC 0.3029
+GCAGG 0.2143
+GCAGT 0.2668
+GCATA 0.1871
+GCATC 0.2144
+GCATG 0.2643
+GCATT 0.3342
+GCCAA 0.2564
+GCCAC 0.3089
+GCCAG 0.2167
+GCCAT 0.2179
+GCCCA 0.2723
+GCCCC 0.2994
+GCCCG 0.1763
+GCCCT 0.252
+GCCGA 0.2225
+GCCGC 0.3062
+GCCGG 0.2009
+GCCGT 0.2704
+GCCTA 0.1464
+GCCTC 0.3002
+GCCTG 0.2645
+GCCTT 0.2889
+GCGAA 0.2125
+GCGAC 0.2293
+GCGAG 0.2999
+GCGAT 0.2584
+GCGCA 0.2577
+GCGCC 0.2246
+GCGCG 0.2834
+GCGCT 0.2343
+GCGGA 0.1882
+GCGGC 0.3092
+GCGGG 0.2467
+GCGGT 0.256
+GCGTA 0.1382
+GCGTC 0.2026
+GCGTG 0.3927
+GCGTT 0.2664
+GCTAA 0.3107
+GCTAC 0.2645
+GCTAG 0.1365
+GCTAT 0.2883
+GCTCA 0.2949
+GCTCC 0.247
+GCTCG 0.2098
+GCTCT 0.2483
+GCTGA 0.1841
+GCTGC 0.314
+GCTGG 0.2267
+GCTGT 0.2753
+GCTTA 0.164
+GCTTC 0.223
+GCTTG 0.275
+GCTTT 0.3379
+GGAAA 0.3335
+GGAAC 0.1723
+GGAAG 0.2259
+GGAAT 0.2682
+GGACA 0.3585
+GGACC 0.2111
+GGACG 0.2255
+GGACT 0.2048
+GGAGA 0.2709
+GGAGC 0.2011
+GGAGG 0.3444
+GGAGT 0.1837
+GGATA 0.2105
+GGATC 0.1696
+GGATG 0.2994
+GGATT 0.3205
+GGCAA 0.2694
+GGCAC 0.2367
+GGCAG 0.2791
+GGCAT 0.2147
+GGCCA 0.3401
+GGCCC 0.2102
+GGCCG 0.2141
+GGCCT 0.2356
+GGCGA 0.2711
+GGCGC 0.2193
+GGCGG 0.2926
+GGCGT 0.2171
+GGCTA 0.1681
+GGCTC 0.2339
+GGCTG 0.3442
+GGCTT 0.2537
+GGGAA 0.2862
+GGGAC 0.1651
+GGGAG 0.3433
+GGGAT 0.2054
+GGGCA 0.3104
+GGGCC 0.2261
+GGGCG 0.2157
+GGGCT 0.2478
+GGGGA 0.2016
+GGGGC 0.166
+GGGGG 0.4315
+GGGGT 0.2009
+GGGTA 0.1778
+GGGTC 0.1879
+GGGTG 0.3489
+GGGTT 0.2854
+GGTAA 0.3757
+GGTAC 0.1957
+GGTAG 0.2122
+GGTAT 0.2165
+GGTCA 0.3637
+GGTCC 0.1888
+GGTCG 0.2211
+GGTCT 0.2265
+GGTGA 0.2628
+GGTGC 0.1829
+GGTGG 0.3291
+GGTGT 0.2253
+GGTTA 0.2171
+GGTTC 0.2043
+GGTTG 0.2638
+GGTTT 0.3148
+GTAAA 0.3982
+GTAAC 0.1844
+GTAAG 0.1385
+GTAAT 0.2788
+GTACA 0.4202
+GTACC 0.1768
+GTACG 0.1719
+GTACT 0.231
+GTAGA 0.2606
+GTAGC 0.2369
+GTAGG 0.2509
+GTAGT 0.2517
+GTATA 0.2737
+GTATC 0.1447
+GTATG 0.2342
+GTATT 0.3474
+GTCAA 0.253
+GTCAC 0.3397
+GTCAG 0.1724
+GTCAT 0.2348
+GTCCA 0.3293
+GTCCC 0.237
+GTCCG 0.1649
+GTCCT 0.2688
+GTCGA 0.231
+GTCGC 0.2487
+GTCGG 0.2093
+GTCGT 0.311
+GTCTA 0.1477
+GTCTC 0.2948
+GTCTG 0.2884
+GTCTT 0.2691
+GTGAA 0.2719
+GTGAC 0.2806
+GTGAG 0.2163
+GTGAT 0.2313
+GTGCA 0.3268
+GTGCC 0.2078
+GTGCG 0.2084
+GTGCT 0.2571
+GTGGA 0.2255
+GTGGC 0.2413
+GTGGG 0.2484
+GTGGT 0.2847
+GTGTA 0.2133
+GTGTC 0.1623
+GTGTG 0.3435
+GTGTT 0.2809
+GTTAA 0.3588
+GTTAC 0.2143
+GTTAG 0.1494
+GTTAT 0.2775
+GTTCA 0.3464
+GTTCC 0.2049
+GTTCG 0.1711
+GTTCT 0.2776
+GTTGA 0.2471
+GTTGC 0.2227
+GTTGG 0.2102
+GTTGT 0.32
+GTTTA 0.2259
+GTTTC 0.1838
+GTTTG 0.2417
+GTTTT 0.3486
+TAAAA 0.3628
+TAAAC 0.1827
+TAAAG 0.1719
+TAAAT 0.2827
+TAACA 0.3869
+TAACC 0.2232
+TAACG 0.1659
+TAACT 0.2241
+TAAGA 0.2573
+TAAGC 0.2206
+TAAGG 0.2279
+TAAGT 0.2942
+TAATA 0.2765
+TAATC 0.163
+TAATG 0.2398
+TAATT 0.3207
+TACAA 0.2824
+TACAC 0.2436
+TACAG 0.2029
+TACAT 0.271
+TACCA 0.3276
+TACCC 0.245
+TACCG 0.1905
+TACCT 0.2369
+TACGA 0.2507
+TACGC 0.1803
+TACGG 0.2077
+TACGT 0.3613
+TACTA 0.1774
+TACTC 0.2187
+TACTG 0.2963
+TACTT 0.3077
+TAGAA 0.3283
+TAGAC 0.1791
+TAGAG 0.2222
+TAGAT 0.2705
+TAGCA 0.3361
+TAGCC 0.2398
+TAGCG 0.177
+TAGCT 0.2472
+TAGGA 0.2488
+TAGGC 0.2143
+TAGGG 0.2459
+TAGGT 0.2911
+TAGTA 0.2227
+TAGTC 0.1569
+TAGTG 0.3018
+TAGTT 0.3186
+TATAA 0.3024
+TATAC 0.2094
+TATAG 0.1435
+TATAT 0.3448
+TATCA 0.3429
+TATCC 0.2168
+TATCG 0.1774
+TATCT 0.2629
+TATGA 0.2548
+TATGC 0.2252
+TATGG 0.2119
+TATGT 0.3081
+TATTA 0.2311
+TATTC 0.1495
+TATTG 0.1981
+TATTT 0.4213
+TCAAA 0.3123
+TCAAC 0.2414
+TCAAG 0.1834
+TCAAT 0.2629
+TCACA 0.2874
+TCACC 0.2597
+TCACG 0.2412
+TCACT 0.2117
+TCAGA 0.2565
+TCAGC 0.2625
+TCAGG 0.2037
+TCAGT 0.2774
+TCATA 0.1827
+TCATC 0.2601
+TCATG 0.2287
+TCATT 0.3286
+TCCAA 0.2375
+TCCAC 0.3
+TCCAG 0.2115
+TCCAT 0.251
+TCCCA 0.2862
+TCCCC 0.315
+TCCCG 0.1482
+TCCCT 0.2507
+TCCGA 0.234
+TCCGC 0.2604
+TCCGG 0.205
+TCCGT 0.3006
+TCCTA 0.1528
+TCCTC 0.2939
+TCCTG 0.2909
+TCCTT 0.2623
+TCGAA 0.2304
+TCGAC 0.2474
+TCGAG 0.2286
+TCGAT 0.2936
+TCGCA 0.2601
+TCGCC 0.2706
+TCGCG 0.2159
+TCGCT 0.2534
+TCGGA 0.1966
+TCGGC 0.2612
+TCGGG 0.2427
+TCGGT 0.2995
+TCGTA 0.1695
+TCGTC 0.2427
+TCGTG 0.3475
+TCGTT 0.2404
+TCTAA 0.2954
+TCTAC 0.2655
+TCTAG 0.1556
+TCTAT 0.2834
+TCTCA 0.2706
+TCTCC 0.2746
+TCTCG 0.1728
+TCTCT 0.2821
+TCTGA 0.2188
+TCTGC 0.2722
+TCTGG 0.2152
+TCTGT 0.2938
+TCTTA 0.174
+TCTTC 0.2424
+TCTTG 0.2553
+TCTTT 0.3283
+TGAAA 0.3288
+TGAAC 0.1925
+TGAAG 0.2204
+TGAAT 0.2583
+TGACA 0.3029
+TGACC 0.2261
+TGACG 0.2317
+TGACT 0.2394
+TGAGA 0.275
+TGAGC 0.2473
+TGAGG 0.2219
+TGAGT 0.2558
+TGATA 0.2113
+TGATC 0.157
+TGATG 0.3538
+TGATT 0.2779
+TGCAA 0.2676
+TGCAC 0.222
+TGCAG 0.2555
+TGCAT 0.2549
+TGCCA 0.3444
+TGCCC 0.2389
+TGCCG 0.1832
+TGCCT 0.2335
+TGCGA 0.2363
+TGCGC 0.2281
+TGCGG 0.2261
+TGCGT 0.3095
+TGCTA 0.1549
+TGCTC 0.2007
+TGCTG 0.3838
+TGCTT 0.2606
+TGGAA 0.2847
+TGGAC 0.1868
+TGGAG 0.2759
+TGGAT 0.2525
+TGGCA 0.3042
+TGGCC 0.2488
+TGGCG 0.1791
+TGGCT 0.2679
+TGGGA 0.2375
+TGGGC 0.1958
+TGGGG 0.289
+TGGGT 0.2777
+TGGTA 0.1791
+TGGTC 0.1763
+TGGTG 0.385
+TGGTT 0.2596
+TGTAA 0.3054
+TGTAC 0.2275
+TGTAG 0.164
+TGTAT 0.303
+TGTCA 0.3314
+TGTCC 0.2181
+TGTCG 0.1735
+TGTCT 0.2769
+TGTGA 0.2126
+TGTGC 0.2126
+TGTGG 0.2197
+TGTGT 0.3551
+TGTTA 0.1993
+TGTTC 0.1522
+TGTTG 0.2839
+TGTTT 0.3646
+TTAAA 0.3809
+TTAAC 0.1933
+TTAAG 0.1464
+TTAAT 0.2795
+TTACA 0.3946
+TTACC 0.2375
+TTACG 0.1471
+TTACT 0.2208
+TTAGA 0.2682
+TTAGC 0.2574
+TTAGG 0.2024
+TTAGT 0.2719
+TTATA 0.2391
+TTATC 0.1532
+TTATG 0.1687
+TTATT 0.4389
+TTCAA 0.266
+TTCAC 0.2546
+TTCAG 0.1928
+TTCAT 0.2866
+TTCCA 0.3265
+TTCCC 0.2672
+TTCCG 0.1291
+TTCCT 0.2772
+TTCGA 0.2148
+TTCGC 0.2302
+TTCGG 0.229
+TTCGT 0.3259
+TTCTA 0.1877
+TTCTC 0.2428
+TTCTG 0.2567
+TTCTT 0.3129
+TTGAA 0.3047
+TTGAC 0.2242
+TTGAG 0.2273
+TTGAT 0.2437
+TTGCA 0.3638
+TTGCC 0.2184
+TTGCG 0.1562
+TTGCT 0.2616
+TTGGA 0.2319
+TTGGC 0.2602
+TTGGG 0.2244
+TTGGT 0.2835
+TTGTA 0.2232
+TTGTC 0.1706
+TTGTG 0.2934
+TTGTT 0.3128
+TTTAA 0.3338
+TTTAC 0.2185
+TTTAG 0.1332
+TTTAT 0.3145
+TTTCA 0.34
+TTTCC 0.2279
+TTTCG 0.1706
+TTTCT 0.2615
+TTTGA 0.2281
+TTTGC 0.222
+TTTGG 0.2037
+TTTGT 0.3462
+TTTTA 0.2563
+TTTTC 0.1648
+TTTTG 0.189
+TTTTT 0.3899
+[2]
+# (a,c,g,t)= (0.258, 0.242, 0.242, 0.258)
+#
+# Probabilities file for the intergenic region model
+#
+
+# k =
+4
+
+# The P_l's
+[P_ls]
+# l=
+0
+# Values
+A 0.265
+C 0.235
+G 0.235
+T 0.265
+# l=
+1
+# Values
+AA 0.0795
+AC 0.0637
+AG 0.0545
+AT 0.067
+CA 0.0755
+CC 0.0581
+CG 0.0473
+CT 0.0545
+GA 0.0556
+GC 0.058
+GG 0.0581
+GT 0.0636
+TA 0.0539
+TC 0.0556
+TG 0.0755
+TT 0.0795
+# l=
+2
+# Values
+AAA 0.0274
+AAC 0.0168
+AAG 0.0144
+AAT 0.021
+ACA 0.0223
+ACC 0.0146
+ACG 0.0134
+ACT 0.0134
+AGA 0.0139
+AGC 0.014
+AGG 0.0131
+AGT 0.0134
+ATA 0.0156
+ATC 0.013
+ATG 0.0173
+ATT 0.021
+CAA 0.0195
+CAC 0.0222
+CAG 0.0165
+CAT 0.0173
+CCA 0.0177
+CCC 0.0167
+CCG 0.0106
+CCT 0.0131
+CGA 0.0112
+CGC 0.0122
+CGG 0.0106
+CGT 0.0134
+CTA 0.00862
+CTC 0.015
+CTG 0.0165
+CTT 0.0144
+GAA 0.0152
+GAC 0.0125
+GAG 0.015
+GAT 0.013
+GCA 0.018
+GCC 0.0138
+GCG 0.0122
+GCT 0.014
+GGA 0.013
+GGC 0.0138
+GGG 0.0167
+GGT 0.0146
+GTA 0.0122
+GTC 0.0125
+GTG 0.0222
+GTT 0.0168
+TAA 0.0174
+TAC 0.0122
+TAG 0.00863
+TAT 0.0156
+TCA 0.0175
+TCC 0.013
+TCG 0.0112
+TCT 0.0139
+TGA 0.0175
+TGC 0.018
+TGG 0.0177
+TGT 0.0223
+TTA 0.0174
+TTC 0.0152
+TTG 0.0196
+TTT 0.0274
+# l=
+3
+# Values
+AAAA 0.00955
+AAAC 0.00571
+AAAG 0.00471
+AAAT 0.00739
+AACA 0.00649
+AACC 0.00364
+AACG 0.00315
+AACT 0.00349
+AAGA 0.00377
+AAGC 0.00347
+AAGG 0.00333
+AAGT 0.00385
+AATA 0.00586
+AATC 0.00375
+AATG 0.00567
+AATT 0.00569
+ACAA 0.0063
+ACAC 0.00634
+ACAG 0.00439
+ACAT 0.00533
+ACCA 0.00484
+ACCC 0.00386
+ACCG 0.00267
+ACCT 0.00318
+ACGA 0.00328
+ACGC 0.00306
+ACGG 0.00282
+ACGT 0.0042
+ACTA 0.0022
+ACTC 0.00335
+ACTG 0.00399
+ACTT 0.00385
+AGAA 0.00397
+AGAC 0.00302
+AGAG 0.00374
+AGAT 0.00322
+AGCA 0.00472
+AGCC 0.00328
+AGCG 0.00282
+AGCT 0.00321
+AGGA 0.00323
+AGGC 0.003
+AGGG 0.00368
+AGGT 0.00318
+AGTA 0.00269
+AGTC 0.0027
+AGTG 0.00451
+AGTT 0.00349
+ATAA 0.00527
+ATAC 0.00324
+ATAG 0.00236
+ATAT 0.00477
+ATCA 0.00425
+ATCC 0.00277
+ATCG 0.00278
+ATCT 0.00322
+ATGA 0.00447
+ATGC 0.00379
+ATGG 0.00376
+ATGT 0.00533
+ATTA 0.00489
+ATTC 0.00381
+ATTG 0.00488
+ATTT 0.00739
+CAAA 0.00612
+CAAC 0.00473
+CAAG 0.00382
+CAAT 0.00488
+CACA 0.0071
+CACC 0.00556
+CACG 0.00499
+CACT 0.00451
+CAGA 0.00388
+CAGC 0.00495
+CAGG 0.00365
+CAGT 0.00399
+CATA 0.00309
+CATC 0.00448
+CATG 0.00411
+CATT 0.00567
+CCAA 0.00418
+CCAC 0.00597
+CCAG 0.00382
+CCAT 0.00376
+CCCA 0.00434
+CCCC 0.00592
+CCCG 0.00272
+CCCT 0.00368
+CCGA 0.00247
+CCGC 0.00309
+CCGG 0.00224
+CCGT 0.00282
+CCTA 0.00194
+CCTC 0.00417
+CCTG 0.00365
+CCTT 0.00333
+CGAA 0.00253
+CGAC 0.00277
+CGAG 0.00309
+CGAT 0.00278
+CGCA 0.00325
+CGCC 0.00312
+CGCG 0.00301
+CGCT 0.00282
+CGGA 0.0021
+CGGC 0.00312
+CGGG 0.00272
+CGGT 0.00267
+CGTA 0.00213
+CGTC 0.00309
+CGTG 0.00499
+CGTT 0.00314
+CTAA 0.00248
+CTAC 0.00248
+CTAG 0.00131
+CTAT 0.00236
+CTCA 0.00389
+CTCC 0.00424
+CTCG 0.00309
+CTCT 0.00374
+CTGA 0.00321
+CTGC 0.00505
+CTGG 0.00382
+CTGT 0.00439
+CTTA 0.00246
+CTTC 0.00341
+CTTG 0.00382
+CTTT 0.00472
+GAAA 0.00493
+GAAC 0.00302
+GAAG 0.00341
+GAAT 0.00381
+GACA 0.00389
+GACC 0.00281
+GACG 0.00309
+GACT 0.0027
+GAGA 0.00401
+GAGC 0.00344
+GAGG 0.00417
+GAGT 0.00335
+GATA 0.00257
+GATC 0.00222
+GATG 0.00448
+GATT 0.00375
+GCAA 0.00454
+GCAC 0.00457
+GCAG 0.00505
+GCAT 0.00379
+GCCA 0.00446
+GCCC 0.00326
+GCCG 0.00312
+GCCT 0.003
+GCGA 0.00298
+GCGC 0.00307
+GCGG 0.00309
+GCGT 0.00306
+GCTA 0.00218
+GCTC 0.00344
+GCTG 0.00495
+GCTT 0.00347
+GGAA 0.00356
+GGAC 0.00247
+GGAG 0.00424
+GGAT 0.00277
+GGCA 0.00394
+GGCC 0.00349
+GGCG 0.00312
+GGCT 0.00329
+GGGA 0.00362
+GGGC 0.00326
+GGGG 0.00592
+GGGT 0.00386
+GGTA 0.00255
+GGTC 0.00281
+GGTG 0.00556
+GGTT 0.00364
+GTAA 0.00375
+GTAC 0.00278
+GTAG 0.00248
+GTAT 0.00324
+GTCA 0.00424
+GTCC 0.00247
+GTCG 0.00277
+GTCT 0.00302
+GTGA 0.00529
+GTGC 0.00457
+GTGG 0.00597
+GTGT 0.00634
+GTTA 0.00331
+GTTC 0.00302
+GTTG 0.00473
+GTTT 0.0057
+TAAA 0.00675
+TAAC 0.00331
+TAAG 0.00246
+TAAT 0.00489
+TACA 0.00487
+TACC 0.00255
+TACG 0.00213
+TACT 0.00269
+TAGA 0.0023
+TAGC 0.00218
+TAGG 0.00195
+TAGT 0.00221
+TATA 0.00411
+TATC 0.00258
+TATG 0.00309
+TATT 0.00586
+TCAA 0.00452
+TCAC 0.00529
+TCAG 0.00321
+TCAT 0.00447
+TCCA 0.00409
+TCCC 0.00362
+TCCG 0.0021
+TCCT 0.00323
+TCGA 0.00244
+TCGC 0.00298
+TCGG 0.00247
+TCGT 0.00328
+TCTA 0.0023
+TCTC 0.00401
+TCTG 0.00387
+TCTT 0.00377
+TGAA 0.0051
+TGAC 0.00424
+TGAG 0.00389
+TGAT 0.00425
+TGCA 0.00605
+TGCC 0.00394
+TGCG 0.00325
+TGCT 0.00472
+TGGA 0.00409
+TGGC 0.00446
+TGGG 0.00434
+TGGT 0.00484
+TGTA 0.00487
+TGTC 0.00389
+TGTG 0.0071
+TGTT 0.00649
+TTAA 0.00591
+TTAC 0.00375
+TTAG 0.00248
+TTAT 0.00527
+TTCA 0.0051
+TTCC 0.00356
+TTCG 0.00253
+TTCT 0.00397
+TTGA 0.00452
+TTGC 0.00455
+TTGG 0.00418
+TTGT 0.0063
+TTTA 0.00675
+TTTC 0.00494
+TTTG 0.00613
+TTTT 0.00955
+# l=
+4
+# Values
+AAAAA 0.00373
+AAAAC 0.00194
+AAAAG 0.0013
+AAAAT 0.00258
+AAACA 0.0023
+AAACC 0.00112
+AAACG 0.00108
+AAACT 0.0012
+AAAGA 0.00122
+AAAGC 0.00113
+AAAGG 0.000988
+AAAGT 0.00138
+AAATA 0.00247
+AAATC 0.00125
+AAATG 0.00197
+AAATT 0.0017
+AACAA 0.00194
+AACAC 0.00169
+AACAG 0.00113
+AACAT 0.00173
+AACCA 0.0012
+AACCC 0.00105
+AACCG 0.00059
+AACCT 0.000795
+AACGA 0.000764
+AACGC 0.000768
+AACGG 0.000566
+AACGT 0.00105
+AACTA 0.000675
+AACTC 0.000902
+AACTG 0.000898
+AACTT 0.00101
+AAGAA 0.00121
+AAGAC 0.000776
+AAGAG 0.000937
+AAGAT 0.000842
+AAGCA 0.00114
+AAGCC 0.000789
+AAGCG 0.000666
+AAGCT 0.000876
+AAGGA 0.000802
+AAGGC 0.000836
+AAGGG 0.00089
+AAGGT 0.000798
+AAGTA 0.000802
+AAGTC 0.000806
+AAGTG 0.00123
+AAGTT 0.00101
+AATAA 0.00233
+AATAC 0.0011
+AATAG 0.000734
+AATAT 0.0017
+AATCA 0.00115
+AATCC 0.000872
+AATCG 0.000851
+AATCT 0.000879
+AATGA 0.00144
+AATGC 0.00121
+AATGG 0.00104
+AATGT 0.00199
+AATTA 0.00157
+AATTC 0.00105
+AATTG 0.00137
+AATTT 0.0017
+ACAAA 0.00212
+ACAAC 0.00149
+ACAAG 0.00111
+ACAAT 0.00158
+ACACA 0.00263
+ACACC 0.00119
+ACACG 0.00132
+ACACT 0.0012
+ACAGA 0.00114
+ACAGC 0.00132
+ACAGG 0.000928
+ACAGT 0.000997
+ACATA 0.000942
+ACATC 0.00125
+ACATG 0.00115
+ACATT 0.00199
+ACCAA 0.00118
+ACCAC 0.00169
+ACCAG 0.00102
+ACCAT 0.00095
+ACCCA 0.00121
+ACCCC 0.00115
+ACCCG 0.000705
+ACCCT 0.000789
+ACCGA 0.000706
+ACCGC 0.000782
+ACCGG 0.000523
+ACCGT 0.000662
+ACCTA 0.000561
+ACCTC 0.000898
+ACCTG 0.000927
+ACCTT 0.000798
+ACGAA 0.000802
+ACGAC 0.000837
+ACGAG 0.000873
+ACGAT 0.000766
+ACGCA 0.000991
+ACGCC 0.000661
+ACGCG 0.00079
+ACGCT 0.000618
+ACGGA 0.000612
+ACGGC 0.000818
+ACGGG 0.000724
+ACGGT 0.000662
+ACGTA 0.000736
+ACGTC 0.000958
+ACGTG 0.00146
+ACGTT 0.00105
+ACTAA 0.000671
+ACTAC 0.000606
+ACTAG 0.000323
+ACTAT 0.000606
+ACTCA 0.001
+ACTCC 0.000757
+ACTCG 0.000818
+ACTCT 0.000769
+ACTGA 0.000851
+ACTGC 0.00126
+ACTGG 0.000877
+ACTGT 0.000997
+ACTTA 0.000697
+ACTTC 0.000782
+ACTTG 0.00099
+ACTTT 0.00138
+AGAAA 0.00127
+AGAAC 0.000809
+AGAAG 0.000913
+AGAAT 0.000977
+AGACA 0.00108
+AGACC 0.000621
+AGACG 0.000688
+AGACT 0.000631
+AGAGA 0.00114
+AGAGC 0.000834
+AGAGG 0.001
+AGAGT 0.000769
+AGATA 0.000679
+AGATC 0.000557
+AGATG 0.0011
+AGATT 0.000879
+AGCAA 0.00117
+AGCAC 0.00114
+AGCAG 0.00149
+AGCAT 0.000914
+AGCCA 0.00117
+AGCCC 0.000758
+AGCCG 0.000668
+AGCCT 0.000686
+AGCGA 0.000755
+AGCGC 0.000708
+AGCGG 0.000744
+AGCGT 0.000618
+AGCTA 0.000526
+AGCTC 0.000827
+AGCTG 0.00098
+AGCTT 0.000876
+AGGAA 0.000956
+AGGAC 0.000643
+AGGAG 0.001
+AGGAT 0.000627
+AGGCA 0.000886
+AGGCC 0.000793
+AGGCG 0.000637
+AGGCT 0.000686
+AGGGA 0.000885
+AGGGC 0.000775
+AGGGG 0.00123
+AGGGT 0.000789
+AGGTA 0.000597
+AGGTC 0.000678
+AGGTG 0.00111
+AGGTT 0.000795
+AGTAA 0.000805
+AGTAC 0.000612
+AGTAG 0.000516
+AGTAT 0.00076
+AGTCA 0.000973
+AGTCC 0.000495
+AGTCG 0.000603
+AGTCT 0.000631
+AGTGA 0.00109
+AGTGC 0.000969
+AGTGG 0.00124
+AGTGT 0.0012
+AGTTA 0.000715
+AGTTC 0.000645
+AGTTG 0.000927
+AGTTT 0.0012
+ATAAA 0.00213
+ATAAC 0.000902
+ATAAG 0.000662
+ATAAT 0.00157
+ATACA 0.00147
+ATACC 0.000526
+ATACG 0.000489
+ATACT 0.00076
+ATAGA 0.000651
+ATAGC 0.000611
+ATAGG 0.00049
+ATAGT 0.000606
+ATATA 0.00142
+ATATC 0.000791
+ATATG 0.00086
+ATATT 0.0017
+ATCAA 0.00108
+ATCAC 0.00121
+ATCAG 0.000797
+ATCAT 0.00116
+ATCCA 0.001
+ATCCC 0.000712
+ATCCG 0.000429
+ATCCT 0.000627
+ATCGA 0.000702
+ATCGC 0.000733
+ATCGG 0.000577
+ATCGT 0.000766
+ATCTA 0.000607
+ATCTC 0.000887
+ATCTG 0.000884
+ATCTT 0.000842
+ATGAA 0.00145
+ATGAC 0.000959
+ATGAG 0.000898
+ATGAT 0.00116
+ATGCA 0.00146
+ATGCC 0.000785
+ATGCG 0.000631
+ATGCT 0.000914
+ATGGA 0.000983
+ATGGC 0.000922
+ATGGG 0.000907
+ATGGT 0.00095
+ATGTA 0.00127
+ATGTC 0.000884
+ATGTG 0.00144
+ATGTT 0.00173
+ATTAA 0.00163
+ATTAC 0.00102
+ATTAG 0.000658
+ATTAT 0.00157
+ATTCA 0.0013
+ATTCC 0.00094
+ATTCG 0.000594
+ATTCT 0.000977
+ATTGA 0.00114
+ATTGC 0.00113
+ATTGG 0.00103
+ATTGT 0.00158
+ATTTA 0.00187
+ATTTC 0.00128
+ATTTG 0.00166
+ATTTT 0.00258
+CAAAA 0.00182
+CAAAC 0.00142
+CAAAG 0.00123
+CAAAT 0.00166
+CAACA 0.00195
+CAACC 0.000979
+CAACG 0.000866
+CAACT 0.000927
+CAAGA 0.000986
+CAAGC 0.000976
+CAAGG 0.000868
+CAAGT 0.00099
+CAATA 0.00116
+CAATC 0.00091
+CAATG 0.00144
+CAATT 0.00137
+CACAA 0.0019
+CACAC 0.00233
+CACAG 0.00143
+CACAT 0.00144
+CACCA 0.002
+CACCC 0.00139
+CACCG 0.00106
+CACCT 0.00111
+CACGA 0.00116
+CACGC 0.00125
+CACGG 0.00112
+CACGT 0.00146
+CACTA 0.000695
+CACTC 0.00113
+CACTG 0.00145
+CACTT 0.00123
+CAGAA 0.00104
+CAGAC 0.000886
+CAGAG 0.00107
+CAGAT 0.000884
+CAGCA 0.00191
+CAGCC 0.00116
+CAGCG 0.000906
+CAGCT 0.00098
+CAGGA 0.000939
+CAGGC 0.000819
+CAGGG 0.000967
+CAGGT 0.000927
+CAGTA 0.000783
+CAGTC 0.000855
+CAGTG 0.00145
+CAGTT 0.000898
+CATAA 0.000898
+CATAC 0.000776
+CATAG 0.000556
+CATAT 0.00086
+CATCA 0.0016
+CATCC 0.000855
+CATCG 0.000925
+CATCT 0.0011
+CATGA 0.000988
+CATGC 0.00101
+CATGG 0.000961
+CATGT 0.00115
+CATTA 0.00115
+CATTC 0.00111
+CATTG 0.00144
+CATTT 0.00197
+CCAAA 0.00127
+CCAAC 0.00103
+CCAAG 0.000857
+CCAAT 0.00103
+CCACA 0.00155
+CCACC 0.00189
+CCACG 0.00128
+CCACT 0.00124
+CCAGA 0.000848
+CCAGC 0.00114
+CCAGG 0.000954
+CCAGT 0.000877
+CCATA 0.000675
+CCATC 0.00109
+CCATG 0.000961
+CCATT 0.00104
+CCCAA 0.000987
+CCCAC 0.00151
+CCCAG 0.000942
+CCCAT 0.000907
+CCCCA 0.00128
+CCCCC 0.00257
+CCCCG 0.000839
+CCCCT 0.00123
+CCCGA 0.000618
+CCCGC 0.000776
+CCCGG 0.000601
+CCCGT 0.000724
+CCCTA 0.000504
+CCCTC 0.00131
+CCCTG 0.000967
+CCCTT 0.00089
+CCGAA 0.00059
+CCGAC 0.000583
+CCGAG 0.000718
+CCGAT 0.000577
+CCGCA 0.000737
+CCGCC 0.000924
+CCGCG 0.000683
+CCGCT 0.000744
+CCGGA 0.000452
+CCGGC 0.000665
+CCGGG 0.000601
+CCGGT 0.000523
+CCGTA 0.000458
+CCGTC 0.000674
+CCGTG 0.00112
+CCGTT 0.000566
+CCTAA 0.000507
+CCTAC 0.000624
+CCTAG 0.000325
+CCTAT 0.00049
+CCTCA 0.000885
+CCTCC 0.00147
+CCTCG 0.000815
+CCTCT 0.001
+CCTGA 0.00067
+CCTGC 0.0011
+CCTGG 0.000954
+CCTGT 0.000928
+CCTTA 0.000584
+CCTTC 0.000886
+CCTTG 0.000868
+CCTTT 0.000988
+CGAAA 0.000888
+CGAAC 0.00056
+CGAAG 0.000492
+CGAAT 0.000594
+CGACA 0.00073
+CGACC 0.000666
+CGACG 0.000767
+CGACT 0.000603
+CGAGA 0.000692
+CGAGC 0.000764
+CGAGG 0.000815
+CGAGT 0.000818
+CGATA 0.000499
+CGATC 0.000501
+CGATG 0.000925
+CGATT 0.000851
+CGCAA 0.00077
+CGCAC 0.00103
+CGCAG 0.000812
+CGCAT 0.000631
+CGCCA 0.000864
+CGCCC 0.000758
+CGCCG 0.000864
+CGCCT 0.000637
+CGCGA 0.00065
+CGCGC 0.000883
+CGCGG 0.000683
+CGCGT 0.00079
+CGCTA 0.000426
+CGCTC 0.000827
+CGCTG 0.000906
+CGCTT 0.000666
+CGGAA 0.000498
+CGGAC 0.000433
+CGGAG 0.000742
+CGGAT 0.000429
+CGGCA 0.00079
+CGGCC 0.0008
+CGGCG 0.000864
+CGGCT 0.000668
+CGGGA 0.000564
+CGGGC 0.000612
+CGGGG 0.000839
+CGGGT 0.000705
+CGGTA 0.000499
+CGGTC 0.000523
+CGGTG 0.00106
+CGGTT 0.00059
+CGTAA 0.000576
+CGTAC 0.000523
+CGTAG 0.000541
+CGTAT 0.000489
+CGTCA 0.00104
+CGTCC 0.000594
+CGTCG 0.000767
+CGTCT 0.000688
+CGTGA 0.00131
+CGTGC 0.00109
+CGTGG 0.00128
+CGTGT 0.00132
+CGTTA 0.00057
+CGTTC 0.000628
+CGTTG 0.000866
+CGTTT 0.00108
+CTAAA 0.000909
+CTAAC 0.00052
+CTAAG 0.000389
+CTAAT 0.000658
+CTACA 0.000852
+CTACC 0.000571
+CTACG 0.000541
+CTACT 0.000516
+CTAGA 0.00036
+CTAGC 0.000304
+CTAGG 0.000325
+CTAGT 0.000323
+CTATA 0.000613
+CTATC 0.000457
+CTATG 0.000556
+CTATT 0.000734
+CTCAA 0.00107
+CTCAC 0.00123
+CTCAG 0.000694
+CTCAT 0.000898
+CTCCA 0.00119
+CTCCC 0.0013
+CTCCG 0.000742
+CTCCT 0.001
+CTCGA 0.000563
+CTCGC 0.000936
+CTCGG 0.000718
+CTCGT 0.000873
+CTCTA 0.000533
+CTCTC 0.0012
+CTCTG 0.00107
+CTCTT 0.000937
+CTGAA 0.000988
+CTGAC 0.000728
+CTGAG 0.000694
+CTGAT 0.000797
+CTGCA 0.0016
+CTGCC 0.00115
+CTGCG 0.000812
+CTGCT 0.00149
+CTGGA 0.000873
+CTGGC 0.000984
+CTGGG 0.000942
+CTGGT 0.00102
+CTGTA 0.00101
+CTGTC 0.000822
+CTGTG 0.00143
+CTGTT 0.00113
+CTTAA 0.000872
+CTTAC 0.000536
+CTTAG 0.000389
+CTTAT 0.000662
+CTTCA 0.00116
+CTTCC 0.000845
+CTTCG 0.000492
+CTTCT 0.000913
+CTTGA 0.000855
+CTTGC 0.000999
+CTTGG 0.000857
+CTTGT 0.00111
+CTTTA 0.00118
+CTTTC 0.001
+CTTTG 0.00123
+CTTTT 0.0013
+GAAAA 0.00159
+GAAAC 0.00106
+GAAAG 0.001
+GAAAT 0.00128
+GAACA 0.000976
+GAACC 0.000771
+GAACG 0.000628
+GAACT 0.000645
+GAAGA 0.000938
+GAAGC 0.000804
+GAAGG 0.000886
+GAAGT 0.000782
+GAATA 0.000885
+GAATC 0.000766
+GAATG 0.00111
+GAATT 0.00105
+GACAA 0.00112
+GACAC 0.00107
+GACAG 0.000822
+GACAT 0.000884
+GACCA 0.000841
+GACCC 0.000764
+GACCG 0.000523
+GACCT 0.000678
+GACGA 0.000824
+GACGC 0.000634
+GACGG 0.000674
+GACGT 0.000958
+GACTA 0.000352
+GACTC 0.00069
+GACTG 0.000855
+GACTT 0.000806
+GAGAA 0.000995
+GAGAC 0.000926
+GAGAG 0.0012
+GAGAT 0.000887
+GAGCA 0.000978
+GAGCC 0.000805
+GAGCG 0.000827
+GAGCT 0.000827
+GAGGA 0.00102
+GAGGC 0.000933
+GAGGG 0.00131
+GAGGT 0.000898
+GAGTA 0.000626
+GAGTC 0.00069
+GAGTG 0.00113
+GAGTT 0.000902
+GATAA 0.00083
+GATAC 0.000499
+GATAG 0.000457
+GATAT 0.000791
+GATCA 0.000659
+GATCC 0.000498
+GATCG 0.000501
+GATCT 0.000557
+GATGA 0.00126
+GATGC 0.000885
+GATGG 0.00109
+GATGT 0.00125
+GATTA 0.000822
+GATTC 0.000766
+GATTG 0.00091
+GATTT 0.00125
+GCAAA 0.00136
+GCAAC 0.00106
+GCAAG 0.000999
+GCAAT 0.00113
+GCACA 0.00148
+GCACC 0.00104
+GCACG 0.00109
+GCACT 0.000969
+GCAGA 0.00106
+GCAGC 0.00162
+GCAGG 0.0011
+GCAGT 0.00126
+GCATA 0.00069
+GCATC 0.000885
+GCATG 0.00101
+GCATT 0.00121
+GCCAA 0.0011
+GCCAC 0.00146
+GCCAG 0.000984
+GCCAT 0.000922
+GCCCA 0.000859
+GCCCC 0.00101
+GCCCG 0.000612
+GCCCT 0.000775
+GCCGA 0.000663
+GCCGC 0.000975
+GCCGG 0.000665
+GCCGT 0.000818
+GCCTA 0.000416
+GCCTC 0.000933
+GCCTG 0.000819
+GCCTT 0.000836
+GCGAA 0.000595
+GCGAC 0.000717
+GCGAG 0.000936
+GCGAT 0.000733
+GCGCA 0.000774
+GCGCC 0.000709
+GCGCG 0.000883
+GCGCT 0.000708
+GCGGA 0.000555
+GCGGC 0.000975
+GCGGG 0.000776
+GCGGT 0.000782
+GCGTA 0.000406
+GCGTC 0.000634
+GCGTG 0.00125
+GCGTT 0.000768
+GCTAA 0.000646
+GCTAC 0.000616
+GCTAG 0.000304
+GCTAT 0.000611
+GCTCA 0.000964
+GCTCC 0.000874
+GCTCG 0.000764
+GCTCT 0.000834
+GCTGA 0.000865
+GCTGC 0.00162
+GCTGG 0.00114
+GCTGT 0.00132
+GCTTA 0.000552
+GCTTC 0.000804
+GCTTG 0.000976
+GCTTT 0.00113
+GGAAA 0.00115
+GGAAC 0.000633
+GGAAG 0.000845
+GGAAT 0.00094
+GGACA 0.000847
+GGACC 0.000532
+GGACG 0.000594
+GGACT 0.000495
+GGAGA 0.00114
+GGAGC 0.000874
+GGAGG 0.00147
+GGAGT 0.000757
+GGATA 0.000546
+GGATC 0.000498
+GGATG 0.000855
+GGATT 0.000872
+GGCAA 0.00104
+GGCAC 0.000975
+GGCAG 0.00115
+GGCAT 0.000785
+GGCCA 0.00114
+GGCCC 0.00076
+GGCCG 0.0008
+GGCCT 0.000793
+GGCGA 0.000828
+GGCGC 0.000709
+GGCGG 0.000924
+GGCGT 0.000661
+GGCTA 0.000533
+GGCTC 0.000805
+GGCTG 0.00116
+GGCTT 0.000789
+GGGAA 0.000986
+GGGAC 0.00062
+GGGAG 0.0013
+GGGAT 0.000712
+GGGCA 0.000984
+GGGCC 0.00076
+GGGCG 0.000758
+GGGCT 0.000758
+GGGGA 0.00118
+GGGGC 0.00101
+GGGGG 0.00257
+GGGGT 0.00115
+GGGTA 0.000657
+GGGTC 0.000764
+GGGTG 0.00139
+GGGTT 0.00105
+GGTAA 0.000925
+GGTAC 0.000533
+GGTAG 0.000571
+GGTAT 0.000526
+GGTCA 0.000989
+GGTCC 0.000532
+GGTCG 0.000666
+GGTCT 0.000621
+GGTGA 0.00144
+GGTGC 0.00104
+GGTGG 0.00189
+GGTGT 0.00119
+GGTTA 0.000761
+GGTTC 0.000771
+GGTTG 0.000979
+GGTTT 0.00112
+GTAAA 0.00148
+GTAAC 0.000709
+GTAAG 0.000536
+GTAAT 0.00102
+GTACA 0.00111
+GTACC 0.000533
+GTACG 0.000523
+GTACT 0.000612
+GTAGA 0.000632
+GTAGC 0.000616
+GTAGG 0.000624
+GTAGT 0.000606
+GTATA 0.000865
+GTATC 0.000499
+GTATG 0.000776
+GTATT 0.0011
+GTCAA 0.00104
+GTCAC 0.00151
+GTCAG 0.000728
+GTCAT 0.000959
+GTCCA 0.000771
+GTCCC 0.00062
+GTCCG 0.000433
+GTCCT 0.000643
+GTCGA 0.000628
+GTCGC 0.000717
+GTCGG 0.000583
+GTCGT 0.000837
+GTCTA 0.00043
+GTCTC 0.000926
+GTCTG 0.000886
+GTCTT 0.000776
+GTGAA 0.00134
+GTGAC 0.00151
+GTGAG 0.00123
+GTGAT 0.00121
+GTGCA 0.00142
+GTGCC 0.000975
+GTGCG 0.00103
+GTGCT 0.00114
+GTGGA 0.00131
+GTGGC 0.00146
+GTGGG 0.00151
+GTGGT 0.00169
+GTGTA 0.00125
+GTGTC 0.00107
+GTGTG 0.00233
+GTGTT 0.00169
+GTTAA 0.00117
+GTTAC 0.000709
+GTTAG 0.00052
+GTTAT 0.000902
+GTTCA 0.00101
+GTTCC 0.000633
+GTTCG 0.00056
+GTTCT 0.000809
+GTTGA 0.00115
+GTTGC 0.00106
+GTTGG 0.00103
+GTTGT 0.00149
+GTTTA 0.00128
+GTTTC 0.00106
+GTTTG 0.00142
+GTTTT 0.00194
+TAAAA 0.00242
+TAAAC 0.00128
+TAAAG 0.00118
+TAAAT 0.00187
+TAACA 0.00126
+TAACC 0.000761
+TAACG 0.00057
+TAACT 0.000715
+TAAGA 0.000627
+TAAGC 0.000552
+TAAGG 0.000584
+TAAGT 0.000697
+TAATA 0.00135
+TAATC 0.000822
+TAATG 0.00115
+TAATT 0.00157
+TACAA 0.00134
+TACAC 0.00125
+TACAG 0.00101
+TACAT 0.00127
+TACCA 0.000802
+TACCC 0.000657
+TACCG 0.000499
+TACCT 0.000597
+TACGA 0.000529
+TACGC 0.000406
+TACGG 0.000458
+TACGT 0.000736
+TACTA 0.000482
+TACTC 0.000626
+TACTG 0.000783
+TACTT 0.000802
+TAGAA 0.000726
+TAGAC 0.00043
+TAGAG 0.000533
+TAGAT 0.000607
+TAGCA 0.000692
+TAGCC 0.000533
+TAGCG 0.000426
+TAGCT 0.000526
+TAGGA 0.000464
+TAGGC 0.000416
+TAGGG 0.000504
+TAGGT 0.000561
+TAGTA 0.000482
+TAGTC 0.000352
+TAGTG 0.000695
+TAGTT 0.000675
+TATAA 0.00122
+TATAC 0.000865
+TATAG 0.000613
+TATAT 0.00142
+TATCA 0.00085
+TATCC 0.000546
+TATCG 0.000499
+TATCT 0.000679
+TATGA 0.000782
+TATGC 0.00069
+TATGG 0.000675
+TATGT 0.000942
+TATTA 0.00135
+TATTC 0.000885
+TATTG 0.00116
+TATTT 0.00247
+TCAAA 0.00137
+TCAAC 0.00115
+TCAAG 0.000855
+TCAAT 0.00114
+TCACA 0.00145
+TCACC 0.00144
+TCACG 0.00131
+TCACT 0.00109
+TCAGA 0.000822
+TCAGC 0.000865
+TCAGG 0.00067
+TCAGT 0.000851
+TCATA 0.000782
+TCATC 0.00126
+TCATG 0.000988
+TCATT 0.00144
+TCCAA 0.000926
+TCCAC 0.00131
+TCCAG 0.000873
+TCCAT 0.000983
+TCCCA 0.000992
+TCCCC 0.00118
+TCCCG 0.000564
+TCCCT 0.000885
+TCCGA 0.000481
+TCCGC 0.000555
+TCCGG 0.000452
+TCCGT 0.000612
+TCCTA 0.000464
+TCCTC 0.00102
+TCCTG 0.000939
+TCCTT 0.000802
+TCGAA 0.000547
+TCGAC 0.000628
+TCGAG 0.000563
+TCGAT 0.000702
+TCGCA 0.000746
+TCGCC 0.000828
+TCGCG 0.00065
+TCGCT 0.000755
+TCGGA 0.000481
+TCGGC 0.000663
+TCGGG 0.000618
+TCGGT 0.000706
+TCGTA 0.000529
+TCGTC 0.000824
+TCGTG 0.00116
+TCGTT 0.000764
+TCTAA 0.000652
+TCTAC 0.000632
+TCTAG 0.00036
+TCTAT 0.000651
+TCTCA 0.00104
+TCTCC 0.00114
+TCTCG 0.000692
+TCTCT 0.00114
+TCTGA 0.000822
+TCTGC 0.00106
+TCTGG 0.000848
+TCTGT 0.00114
+TCTTA 0.000627
+TCTTC 0.000938
+TCTTG 0.000986
+TCTTT 0.00122
+TGAAA 0.00163
+TGAAC 0.00101
+TGAAG 0.00116
+TGAAT 0.0013
+TGACA 0.00123
+TGACC 0.000989
+TGACG 0.00104
+TGACT 0.000973
+TGAGA 0.00104
+TGAGC 0.000964
+TGAGG 0.000885
+TGAGT 0.001
+TGATA 0.00085
+TGATC 0.000659
+TGATG 0.0016
+TGATT 0.00115
+TGCAA 0.00157
+TGCAC 0.00142
+TGCAG 0.0016
+TGCAT 0.00146
+TGCCA 0.00128
+TGCCC 0.000984
+TGCCG 0.00079
+TGCCT 0.000886
+TGCGA 0.000746
+TGCGC 0.000774
+TGCGG 0.000737
+TGCGT 0.000991
+TGCTA 0.000692
+TGCTC 0.000978
+TGCTG 0.00191
+TGCTT 0.00114
+TGGAA 0.00113
+TGGAC 0.000771
+TGGAG 0.00119
+TGGAT 0.001
+TGGCA 0.00128
+TGGCC 0.00114
+TGGCG 0.000864
+TGGCT 0.00117
+TGGGA 0.000992
+TGGGC 0.000859
+TGGGG 0.00128
+TGGGT 0.00121
+TGGTA 0.000802
+TGGTC 0.000841
+TGGTG 0.002
+TGGTT 0.0012
+TGTAA 0.00145
+TGTAC 0.00111
+TGTAG 0.000852
+TGTAT 0.00147
+TGTCA 0.00123
+TGTCC 0.000847
+TGTCG 0.00073
+TGTCT 0.00108
+TGTGA 0.00145
+TGTGC 0.00148
+TGTGG 0.00155
+TGTGT 0.00263
+TGTTA 0.00126
+TGTTC 0.000976
+TGTTG 0.00195
+TGTTT 0.0023
+TTAAA 0.00223
+TTAAC 0.00117
+TTAAG 0.000872
+TTAAT 0.00163
+TTACA 0.00145
+TTACC 0.000925
+TTACG 0.000576
+TTACT 0.000805
+TTAGA 0.000652
+TTAGC 0.000646
+TTAGG 0.000507
+TTAGT 0.000671
+TTATA 0.00122
+TTATC 0.00083
+TTATG 0.000898
+TTATT 0.00233
+TTCAA 0.00132
+TTCAC 0.00134
+TTCAG 0.000988
+TTCAT 0.00145
+TTCCA 0.00113
+TTCCC 0.000986
+TTCCG 0.000498
+TTCCT 0.000956
+TTCGA 0.000547
+TTCGC 0.000595
+TTCGG 0.00059
+TTCGT 0.000802
+TTCTA 0.000726
+TTCTC 0.000995
+TTCTG 0.00104
+TTCTT 0.00121
+TTGAA 0.00132
+TTGAC 0.00104
+TTGAG 0.00107
+TTGAT 0.00108
+TTGCA 0.00157
+TTGCC 0.00104
+TTGCG 0.00077
+TTGCT 0.00117
+TTGGA 0.000926
+TTGGC 0.0011
+TTGGG 0.000987
+TTGGT 0.00118
+TTGTA 0.00134
+TTGTC 0.00112
+TTGTG 0.0019
+TTGTT 0.00194
+TTTAA 0.00223
+TTTAC 0.00148
+TTTAG 0.000909
+TTTAT 0.00213
+TTTCA 0.00163
+TTTCC 0.00115
+TTTCG 0.000888
+TTTCT 0.00127
+TTTGA 0.00137
+TTTGC 0.00136
+TTTGG 0.00127
+TTTGT 0.00212
+TTTTA 0.00242
+TTTTC 0.00159
+TTTTG 0.00182
+TTTTT 0.00373
+
+[EMISSION]
+
+# Vector size (4^(k+1))
+1024
+# Probabilities
+AAAAA 0.3899
+AAAAC 0.1992
+AAAAG 0.1365
+AAAAT 0.2744
+AAACA 0.4132
+AAACC 0.1889
+AAACG 0.183
+AAACT 0.2149
+AAAGA 0.257
+AAAGC 0.2407
+AAAGG 0.2064
+AAAGT 0.2959
+AAATA 0.3354
+AAATC 0.1615
+AAATG 0.2714
+AAATT 0.2317
+AACAA 0.306
+AACAC 0.2481
+AACAG 0.1696
+AACAT 0.2763
+AACCA 0.3392
+AACCC 0.281
+AACCG 0.1497
+AACCT 0.2301
+AACGA 0.2427
+AACGC 0.2372
+AACGG 0.172
+AACGT 0.3481
+AACTA 0.2026
+AACTC 0.2442
+AACTG 0.2602
+AACTT 0.293
+AAGAA 0.3337
+AAGAC 0.1989
+AAGAG 0.2426
+AAGAT 0.2248
+AAGCA 0.3457
+AAGCC 0.2213
+AAGCG 0.1756
+AAGCT 0.2574
+AAGGA 0.2471
+AAGGC 0.2445
+AAGGG 0.2617
+AAGGT 0.2467
+AAGTA 0.221
+AAGTC 0.2029
+AAGTG 0.3124
+AAGTT 0.2638
+AATAA 0.3917
+AATAC 0.1876
+AATAG 0.1247
+AATAT 0.2961
+AATCA 0.3133
+AATCC 0.2294
+AATCG 0.2139
+AATCT 0.2434
+AATGA 0.246
+AATGC 0.2159
+AATGG 0.1792
+AATGT 0.359
+AATTA 0.2777
+AATTC 0.181
+AATTG 0.2397
+AATTT 0.3016
+ACAAA 0.3378
+ACAAC 0.2227
+ACAAG 0.175
+ACAAT 0.2646
+ACACA 0.4064
+ACACC 0.1885
+ACACG 0.1996
+ACACT 0.2055
+ACAGA 0.2581
+ACAGC 0.2941
+ACAGG 0.2059
+ACAGT 0.2419
+ACATA 0.1788
+ACATC 0.2151
+ACATG 0.218
+ACATT 0.3881
+ACCAA 0.2539
+ACCAC 0.3313
+ACCAG 0.2078
+ACCAT 0.207
+ACCCA 0.3162
+ACCCC 0.2966
+ACCCG 0.1709
+ACCCT 0.2162
+ACCGA 0.2799
+ACCGC 0.2781
+ACCGG 0.1885
+ACCGT 0.2534
+ACCTA 0.1816
+ACCTC 0.2644
+ACCTG 0.2878
+ACCTT 0.2661
+ACGAA 0.26
+ACGAC 0.2478
+ACGAG 0.2542
+ACGAT 0.238
+ACGCA 0.3336
+ACGCC 0.2121
+ACGCG 0.2445
+ACGCT 0.2099
+ACGGA 0.2255
+ACGGC 0.2833
+ACGGG 0.249
+ACGGT 0.2421
+ACGTA 0.1847
+ACGTC 0.2208
+ACGTG 0.3339
+ACGTT 0.2607
+ACTAA 0.3071
+ACTAC 0.263
+ACTAG 0.1427
+ACTAT 0.2872
+ACTCA 0.3004
+ACTCC 0.2222
+ACTCG 0.2359
+ACTCT 0.2416
+ACTGA 0.2197
+ACTGC 0.3122
+ACTGG 0.2126
+ACTGT 0.2556
+ACTTA 0.1916
+ACTTC 0.1964
+ACTTG 0.2479
+ACTTT 0.3641
+AGAAA 0.3273
+AGAAC 0.1997
+AGAAG 0.226
+AGAAT 0.247
+AGACA 0.3656
+AGACC 0.2033
+AGACG 0.2176
+AGACT 0.2135
+AGAGA 0.3008
+AGAGC 0.2185
+AGAGG 0.2648
+AGAGT 0.2159
+AGATA 0.2153
+AGATC 0.1646
+AGATG 0.3332
+AGATT 0.2869
+AGCAA 0.2569
+AGCAC 0.2332
+AGCAG 0.3013
+AGCAT 0.2087
+AGCCA 0.367
+AGCCC 0.2307
+AGCCG 0.1875
+AGCCT 0.2148
+AGCGA 0.2719
+AGCGC 0.2448
+AGCGG 0.2533
+AGCGT 0.23
+AGCTA 0.1694
+AGCTC 0.2399
+AGCTG 0.3023
+AGCTT 0.2884
+AGGAA 0.3126
+AGGAC 0.1972
+AGGAG 0.2892
+AGGAT 0.2009
+AGGCA 0.3086
+AGGCC 0.2577
+AGGCG 0.1992
+AGGCT 0.2345
+AGGGA 0.2444
+AGGGC 0.2129
+AGGGG 0.3196
+AGGGT 0.2231
+AGGTA 0.1945
+AGGTC 0.2041
+AGGTG 0.337
+AGGTT 0.2643
+AGTAA 0.3064
+AGTAC 0.2243
+AGTAG 0.182
+AGTAT 0.2872
+AGTCA 0.378
+AGTCC 0.1797
+AGTCG 0.2089
+AGTCT 0.2334
+AGTGA 0.2415
+AGTGC 0.2169
+AGTGG 0.2647
+AGTGT 0.277
+AGTTA 0.2137
+AGTTC 0.1771
+AGTTG 0.2581
+AGTTT 0.3511
+ATAAA 0.4034
+ATAAC 0.168
+ATAAG 0.1278
+ATAAT 0.3008
+ATACA 0.4551
+ATACC 0.1591
+ATACG 0.1452
+ATACT 0.2406
+ATAGA 0.2737
+ATAGC 0.254
+ATAGG 0.2019
+ATAGT 0.2704
+ATATA 0.2961
+ATATC 0.1592
+ATATG 0.1844
+ATATT 0.3603
+ATCAA 0.2639
+ATCAC 0.2686
+ATCAG 0.1894
+ATCAT 0.2781
+ATCCA 0.3739
+ATCCC 0.2477
+ATCCG 0.1485
+ATCCT 0.23
+ATCGA 0.2566
+ATCGC 0.2623
+ATCGG 0.2016
+ATCGT 0.2795
+ATCTA 0.1968
+ATCTC 0.2579
+ATCTG 0.277
+ATCTT 0.2683
+ATGAA 0.3342
+ATGAC 0.2118
+ATGAG 0.1924
+ATGAT 0.2615
+ATGCA 0.4018
+ATGCC 0.2018
+ATGCG 0.15
+ATGCT 0.2464
+ATGGA 0.2708
+ATGGC 0.2443
+ATGGG 0.2296
+ATGGT 0.2553
+ATGTA 0.2478
+ATGTC 0.1623
+ATGTG 0.2632
+ATGTT 0.3267
+ATTAA 0.3355
+ATTAC 0.2094
+ATTAG 0.1339
+ATTAT 0.3211
+ATTCA 0.3511
+ATTCC 0.241
+ATTCG 0.1485
+ATTCT 0.2594
+ATTGA 0.2358
+ATTGC 0.2271
+ATTGG 0.2041
+ATTGT 0.333
+ATTTA 0.2575
+ATTTC 0.1687
+ATTTG 0.2201
+ATTTT 0.3537
+CAAAA 0.3058
+CAAAC 0.2234
+CAAAG 0.1946
+CAAAT 0.2762
+CAACA 0.4171
+CAACC 0.2051
+CAACG 0.173
+CAACT 0.2048
+CAAGA 0.26
+CAAGC 0.2548
+CAAGG 0.2231
+CAAGT 0.2621
+CAATA 0.243
+CAATC 0.177
+CAATG 0.2962
+CAATT 0.2838
+CACAA 0.2841
+CACAC 0.3003
+CACAG 0.1954
+CACAT 0.2202
+CACCA 0.3604
+CACCC 0.2461
+CACCG 0.1835
+CACCT 0.2101
+CACGA 0.2393
+CACGC 0.2385
+CACGG 0.2182
+CACGT 0.304
+CACTA 0.1582
+CACTC 0.2286
+CACTG 0.3271
+CACTT 0.2861
+CAGAA 0.2813
+CAGAC 0.219
+CAGAG 0.2614
+CAGAT 0.2384
+CAGCA 0.3911
+CAGCC 0.2306
+CAGCG 0.1711
+CAGCT 0.2072
+CAGGA 0.2666
+CAGGC 0.2179
+CAGGG 0.2559
+CAGGT 0.2597
+CAGTA 0.2107
+CAGTC 0.2038
+CAGTG 0.3536
+CAGTT 0.2319
+CATAA 0.2924
+CATAC 0.2456
+CATAG 0.1676
+CATAT 0.2943
+CATCA 0.3569
+CATCC 0.1917
+CATCG 0.1985
+CATCT 0.2529
+CATGA 0.2452
+CATGC 0.2445
+CATGG 0.2215
+CATGT 0.2888
+CATTA 0.209
+CATTC 0.1836
+CATTG 0.2518
+CATTT 0.3556
+CCAAA 0.3139
+CCAAC 0.2311
+CCAAG 0.199
+CCAAT 0.2561
+CCACA 0.276
+CCACC 0.3023
+CCACG 0.206
+CCACT 0.2156
+CCAGA 0.2267
+CCAGC 0.2903
+CCAGG 0.2419
+CCAGT 0.2411
+CCATA 0.1854
+CCATC 0.2703
+CCATG 0.2522
+CCATT 0.2921
+CCCAA 0.2341
+CCCAC 0.3366
+CCCAG 0.2125
+CCCAT 0.2168
+CCCCA 0.2229
+CCCCC 0.4314
+CCCCG 0.1359
+CCCCT 0.2098
+CCCGA 0.2364
+CCCGC 0.2794
+CCCGG 0.2125
+CCCGT 0.2717
+CCCTA 0.1399
+CCCTC 0.344
+CCCTG 0.2586
+CCCTT 0.2574
+CCGAA 0.2503
+CCGAC 0.2284
+CCGAG 0.2863
+CCGAT 0.235
+CCGCA 0.2534
+CCGCC 0.2972
+CCGCG 0.2091
+CCGCT 0.2403
+CCGGA 0.2081
+CCGGC 0.2847
+CCGGG 0.2635
+CCGGT 0.2437
+CCGTA 0.1718
+CCGTC 0.232
+CCGTG 0.3877
+CCGTT 0.2085
+CCTAA 0.2733
+CCTAC 0.3134
+CCTAG 0.1569
+CCTAT 0.2564
+CCTCA 0.218
+CCTCC 0.3485
+CCTCG 0.1855
+CCTCT 0.248
+CCTGA 0.1914
+CCTGC 0.2975
+CCTGG 0.253
+CCTGT 0.2581
+CCTTA 0.1792
+CCTTC 0.2594
+CCTTG 0.2548
+CCTTT 0.3065
+CGAAA 0.3618
+CGAAC 0.2086
+CGAAG 0.19
+CGAAT 0.2396
+CGACA 0.2692
+CGACC 0.2333
+CGACG 0.2729
+CGACT 0.2246
+CGAGA 0.2368
+CGAGC 0.2374
+CGAGG 0.2548
+CGAGT 0.271
+CGATA 0.1812
+CGATC 0.1779
+CGATG 0.3263
+CGATT 0.3146
+CGCAA 0.2467
+CGCAC 0.3039
+CGCAG 0.245
+CGCAT 0.2043
+CGCCA 0.2862
+CGCCC 0.2343
+CGCCG 0.2668
+CGCCT 0.2127
+CGCGA 0.228
+CGCGC 0.2914
+CGCGG 0.2169
+CGCGT 0.2637
+CGCTA 0.155
+CGCTC 0.2746
+CGCTG 0.319
+CGCTT 0.2514
+CGGAA 0.2433
+CGGAC 0.2021
+CGGAG 0.338
+CGGAT 0.2167
+CGGCA 0.2601
+CGGCC 0.2517
+CGGCG 0.2683
+CGGCT 0.22
+CGGGA 0.2135
+CGGGC 0.2201
+CGGGG 0.3059
+CGGGT 0.2605
+CGGTA 0.2021
+CGGTC 0.1953
+CGGTG 0.3803
+CGGTT 0.2222
+CGTAA 0.2851
+CGTAC 0.2331
+CGTAG 0.2397
+CGTAT 0.242
+CGTCA 0.3466
+CGTCC 0.1875
+CGTCG 0.2405
+CGTCT 0.2254
+CGTGA 0.2719
+CGTGC 0.2122
+CGTGG 0.25
+CGTGT 0.2659
+CGTTA 0.1888
+CGTTC 0.1945
+CGTTG 0.2602
+CGTTT 0.3566
+CTAAA 0.3744
+CTAAC 0.1982
+CTAAG 0.1525
+CTAAT 0.2749
+CTACA 0.3527
+CTACC 0.2232
+CTACG 0.2059
+CTACT 0.2183
+CTAGA 0.2844
+CTAGC 0.2276
+CTAGG 0.2338
+CTAGT 0.2543
+CTATA 0.2645
+CTATC 0.1845
+CTATG 0.2253
+CTATT 0.3256
+CTCAA 0.2883
+CTCAC 0.2942
+CTCAG 0.1779
+CTCAT 0.2397
+CTCCA 0.2949
+CTCCC 0.2988
+CTCCG 0.1672
+CTCCT 0.2391
+CTCGA 0.1906
+CTCGC 0.2904
+CTCGG 0.2341
+CTCGT 0.2849
+CTCTA 0.1495
+CTCTC 0.3017
+CTCTG 0.2809
+CTCTT 0.2679
+CTGAA 0.3207
+CTGAC 0.2217
+CTGAG 0.2037
+CTGAT 0.2539
+CTGCA 0.3354
+CTGCC 0.2185
+CTGCG 0.1498
+CTGCT 0.2963
+CTGGA 0.2396
+CTGGC 0.2551
+CTGGG 0.2363
+CTGGT 0.269
+CTGTA 0.2449
+CTGTC 0.1822
+CTGTG 0.3082
+CTGTT 0.2647
+CTTAA 0.3581
+CTTAC 0.2122
+CTTAG 0.1515
+CTTAT 0.2782
+CTTCA 0.3493
+CTTCC 0.2367
+CTTCG 0.1372
+CTTCT 0.2768
+CTTGA 0.2252
+CTTGC 0.2561
+CTTGG 0.2171
+CTTGT 0.3016
+CTTTA 0.2542
+CTTTC 0.2082
+CTTTG 0.2518
+CTTTT 0.2857
+GAAAA 0.3295
+GAAAC 0.21
+GAAAG 0.1989
+GAAAT 0.2617
+GAACA 0.3427
+GAACC 0.2435
+GAACG 0.1983
+GAACT 0.2155
+GAAGA 0.2779
+GAAGC 0.2326
+GAAGG 0.2557
+GAAGT 0.2338
+GAATA 0.2429
+GAATC 0.1876
+GAATG 0.2858
+GAATT 0.2837
+GACAA 0.2958
+GACAC 0.2541
+GACAG 0.2069
+GACAT 0.2432
+GACCA 0.318
+GACCC 0.2553
+GACCG 0.1816
+GACCT 0.2452
+GACGA 0.2688
+GACGC 0.1979
+GACGG 0.2099
+GACGT 0.3234
+GACTA 0.1378
+GACTC 0.2347
+GACTG 0.316
+GACTT 0.3114
+GAGAA 0.2681
+GAGAC 0.2255
+GAGAG 0.2829
+GAGAT 0.2236
+GAGCA 0.3038
+GAGCC 0.2329
+GAGCG 0.2189
+GAGCT 0.2444
+GAGGA 0.2459
+GAGGC 0.2257
+GAGGG 0.3107
+GAGGT 0.2177
+GAGTA 0.2015
+GAGTC 0.1962
+GAGTG 0.3202
+GAGTT 0.282
+GATAA 0.3284
+GATAC 0.1876
+GATAG 0.1697
+GATAT 0.3142
+GATCA 0.3166
+GATCC 0.2172
+GATCG 0.2164
+GATCT 0.2498
+GATGA 0.2789
+GATGC 0.1985
+GATGG 0.2376
+GATGT 0.285
+GATTA 0.2275
+GATTC 0.1929
+GATTG 0.2408
+GATTT 0.3387
+GCAAA 0.3092
+GCAAC 0.2212
+GCAAG 0.2121
+GCAAT 0.2575
+GCACA 0.3395
+GCACC 0.2135
+GCACG 0.2224
+GCACT 0.2246
+GCAGA 0.216
+GCAGC 0.3029
+GCAGG 0.2143
+GCAGT 0.2668
+GCATA 0.1871
+GCATC 0.2144
+GCATG 0.2643
+GCATT 0.3342
+GCCAA 0.2564
+GCCAC 0.3089
+GCCAG 0.2167
+GCCAT 0.2179
+GCCCA 0.2723
+GCCCC 0.2994
+GCCCG 0.1763
+GCCCT 0.252
+GCCGA 0.2225
+GCCGC 0.3062
+GCCGG 0.2009
+GCCGT 0.2704
+GCCTA 0.1464
+GCCTC 0.3002
+GCCTG 0.2645
+GCCTT 0.2889
+GCGAA 0.2125
+GCGAC 0.2293
+GCGAG 0.2999
+GCGAT 0.2584
+GCGCA 0.2577
+GCGCC 0.2246
+GCGCG 0.2834
+GCGCT 0.2343
+GCGGA 0.1882
+GCGGC 0.3092
+GCGGG 0.2467
+GCGGT 0.256
+GCGTA 0.1382
+GCGTC 0.2026
+GCGTG 0.3927
+GCGTT 0.2664
+GCTAA 0.3107
+GCTAC 0.2645
+GCTAG 0.1365
+GCTAT 0.2883
+GCTCA 0.2949
+GCTCC 0.247
+GCTCG 0.2098
+GCTCT 0.2483
+GCTGA 0.1841
+GCTGC 0.314
+GCTGG 0.2267
+GCTGT 0.2753
+GCTTA 0.164
+GCTTC 0.223
+GCTTG 0.275
+GCTTT 0.3379
+GGAAA 0.3335
+GGAAC 0.1723
+GGAAG 0.2259
+GGAAT 0.2682
+GGACA 0.3585
+GGACC 0.2111
+GGACG 0.2255
+GGACT 0.2048
+GGAGA 0.2709
+GGAGC 0.2011
+GGAGG 0.3444
+GGAGT 0.1837
+GGATA 0.2105
+GGATC 0.1696
+GGATG 0.2994
+GGATT 0.3205
+GGCAA 0.2694
+GGCAC 0.2367
+GGCAG 0.2791
+GGCAT 0.2147
+GGCCA 0.3401
+GGCCC 0.2102
+GGCCG 0.2141
+GGCCT 0.2356
+GGCGA 0.2711
+GGCGC 0.2193
+GGCGG 0.2926
+GGCGT 0.2171
+GGCTA 0.1681
+GGCTC 0.2339
+GGCTG 0.3442
+GGCTT 0.2537
+GGGAA 0.2862
+GGGAC 0.1651
+GGGAG 0.3433
+GGGAT 0.2054
+GGGCA 0.3104
+GGGCC 0.2261
+GGGCG 0.2157
+GGGCT 0.2478
+GGGGA 0.2016
+GGGGC 0.166
+GGGGG 0.4315
+GGGGT 0.2009
+GGGTA 0.1778
+GGGTC 0.1879
+GGGTG 0.3489
+GGGTT 0.2854
+GGTAA 0.3757
+GGTAC 0.1957
+GGTAG 0.2122
+GGTAT 0.2165
+GGTCA 0.3637
+GGTCC 0.1888
+GGTCG 0.2211
+GGTCT 0.2265
+GGTGA 0.2628
+GGTGC 0.1829
+GGTGG 0.3291
+GGTGT 0.2253
+GGTTA 0.2171
+GGTTC 0.2043
+GGTTG 0.2638
+GGTTT 0.3148
+GTAAA 0.3982
+GTAAC 0.1844
+GTAAG 0.1385
+GTAAT 0.2788
+GTACA 0.4202
+GTACC 0.1768
+GTACG 0.1719
+GTACT 0.231
+GTAGA 0.2606
+GTAGC 0.2369
+GTAGG 0.2509
+GTAGT 0.2517
+GTATA 0.2737
+GTATC 0.1447
+GTATG 0.2342
+GTATT 0.3474
+GTCAA 0.253
+GTCAC 0.3397
+GTCAG 0.1724
+GTCAT 0.2348
+GTCCA 0.3293
+GTCCC 0.237
+GTCCG 0.1649
+GTCCT 0.2688
+GTCGA 0.231
+GTCGC 0.2487
+GTCGG 0.2093
+GTCGT 0.311
+GTCTA 0.1477
+GTCTC 0.2948
+GTCTG 0.2884
+GTCTT 0.2691
+GTGAA 0.2719
+GTGAC 0.2806
+GTGAG 0.2163
+GTGAT 0.2313
+GTGCA 0.3268
+GTGCC 0.2078
+GTGCG 0.2084
+GTGCT 0.2571
+GTGGA 0.2255
+GTGGC 0.2413
+GTGGG 0.2484
+GTGGT 0.2847
+GTGTA 0.2133
+GTGTC 0.1623
+GTGTG 0.3435
+GTGTT 0.2809
+GTTAA 0.3588
+GTTAC 0.2143
+GTTAG 0.1494
+GTTAT 0.2775
+GTTCA 0.3464
+GTTCC 0.2049
+GTTCG 0.1711
+GTTCT 0.2776
+GTTGA 0.2471
+GTTGC 0.2227
+GTTGG 0.2102
+GTTGT 0.32
+GTTTA 0.2259
+GTTTC 0.1838
+GTTTG 0.2417
+GTTTT 0.3486
+TAAAA 0.3628
+TAAAC 0.1827
+TAAAG 0.1719
+TAAAT 0.2827
+TAACA 0.3869
+TAACC 0.2232
+TAACG 0.1659
+TAACT 0.2241
+TAAGA 0.2573
+TAAGC 0.2206
+TAAGG 0.2279
+TAAGT 0.2942
+TAATA 0.2765
+TAATC 0.163
+TAATG 0.2398
+TAATT 0.3207
+TACAA 0.2824
+TACAC 0.2436
+TACAG 0.2029
+TACAT 0.271
+TACCA 0.3276
+TACCC 0.245
+TACCG 0.1905
+TACCT 0.2369
+TACGA 0.2507
+TACGC 0.1803
+TACGG 0.2077
+TACGT 0.3613
+TACTA 0.1774
+TACTC 0.2187
+TACTG 0.2963
+TACTT 0.3077
+TAGAA 0.3283
+TAGAC 0.1791
+TAGAG 0.2222
+TAGAT 0.2705
+TAGCA 0.3361
+TAGCC 0.2398
+TAGCG 0.177
+TAGCT 0.2472
+TAGGA 0.2488
+TAGGC 0.2143
+TAGGG 0.2459
+TAGGT 0.2911
+TAGTA 0.2227
+TAGTC 0.1569
+TAGTG 0.3018
+TAGTT 0.3186
+TATAA 0.3024
+TATAC 0.2094
+TATAG 0.1435
+TATAT 0.3448
+TATCA 0.3429
+TATCC 0.2168
+TATCG 0.1774
+TATCT 0.2629
+TATGA 0.2548
+TATGC 0.2252
+TATGG 0.2119
+TATGT 0.3081
+TATTA 0.2311
+TATTC 0.1495
+TATTG 0.1981
+TATTT 0.4213
+TCAAA 0.3123
+TCAAC 0.2414
+TCAAG 0.1834
+TCAAT 0.2629
+TCACA 0.2874
+TCACC 0.2597
+TCACG 0.2412
+TCACT 0.2117
+TCAGA 0.2565
+TCAGC 0.2625
+TCAGG 0.2037
+TCAGT 0.2774
+TCATA 0.1827
+TCATC 0.2601
+TCATG 0.2287
+TCATT 0.3286
+TCCAA 0.2375
+TCCAC 0.3
+TCCAG 0.2115
+TCCAT 0.251
+TCCCA 0.2862
+TCCCC 0.315
+TCCCG 0.1482
+TCCCT 0.2507
+TCCGA 0.234
+TCCGC 0.2604
+TCCGG 0.205
+TCCGT 0.3006
+TCCTA 0.1528
+TCCTC 0.2939
+TCCTG 0.2909
+TCCTT 0.2623
+TCGAA 0.2304
+TCGAC 0.2474
+TCGAG 0.2286
+TCGAT 0.2936
+TCGCA 0.2601
+TCGCC 0.2706
+TCGCG 0.2159
+TCGCT 0.2534
+TCGGA 0.1966
+TCGGC 0.2612
+TCGGG 0.2427
+TCGGT 0.2995
+TCGTA 0.1695
+TCGTC 0.2427
+TCGTG 0.3475
+TCGTT 0.2404
+TCTAA 0.2954
+TCTAC 0.2655
+TCTAG 0.1556
+TCTAT 0.2834
+TCTCA 0.2706
+TCTCC 0.2746
+TCTCG 0.1728
+TCTCT 0.2821
+TCTGA 0.2188
+TCTGC 0.2722
+TCTGG 0.2152
+TCTGT 0.2938
+TCTTA 0.174
+TCTTC 0.2424
+TCTTG 0.2553
+TCTTT 0.3283
+TGAAA 0.3288
+TGAAC 0.1925
+TGAAG 0.2204
+TGAAT 0.2583
+TGACA 0.3029
+TGACC 0.2261
+TGACG 0.2317
+TGACT 0.2394
+TGAGA 0.275
+TGAGC 0.2473
+TGAGG 0.2219
+TGAGT 0.2558
+TGATA 0.2113
+TGATC 0.157
+TGATG 0.3538
+TGATT 0.2779
+TGCAA 0.2676
+TGCAC 0.222
+TGCAG 0.2555
+TGCAT 0.2549
+TGCCA 0.3444
+TGCCC 0.2389
+TGCCG 0.1832
+TGCCT 0.2335
+TGCGA 0.2363
+TGCGC 0.2281
+TGCGG 0.2261
+TGCGT 0.3095
+TGCTA 0.1549
+TGCTC 0.2007
+TGCTG 0.3838
+TGCTT 0.2606
+TGGAA 0.2847
+TGGAC 0.1868
+TGGAG 0.2759
+TGGAT 0.2525
+TGGCA 0.3042
+TGGCC 0.2488
+TGGCG 0.1791
+TGGCT 0.2679
+TGGGA 0.2375
+TGGGC 0.1958
+TGGGG 0.289
+TGGGT 0.2777
+TGGTA 0.1791
+TGGTC 0.1763
+TGGTG 0.385
+TGGTT 0.2596
+TGTAA 0.3054
+TGTAC 0.2275
+TGTAG 0.164
+TGTAT 0.303
+TGTCA 0.3314
+TGTCC 0.2181
+TGTCG 0.1735
+TGTCT 0.2769
+TGTGA 0.2126
+TGTGC 0.2126
+TGTGG 0.2197
+TGTGT 0.3551
+TGTTA 0.1993
+TGTTC 0.1522
+TGTTG 0.2839
+TGTTT 0.3646
+TTAAA 0.3809
+TTAAC 0.1933
+TTAAG 0.1464
+TTAAT 0.2795
+TTACA 0.3946
+TTACC 0.2375
+TTACG 0.1471
+TTACT 0.2208
+TTAGA 0.2682
+TTAGC 0.2574
+TTAGG 0.2024
+TTAGT 0.2719
+TTATA 0.2391
+TTATC 0.1532
+TTATG 0.1687
+TTATT 0.4389
+TTCAA 0.266
+TTCAC 0.2546
+TTCAG 0.1928
+TTCAT 0.2866
+TTCCA 0.3265
+TTCCC 0.2672
+TTCCG 0.1291
+TTCCT 0.2772
+TTCGA 0.2148
+TTCGC 0.2302
+TTCGG 0.229
+TTCGT 0.3259
+TTCTA 0.1877
+TTCTC 0.2428
+TTCTG 0.2567
+TTCTT 0.3129
+TTGAA 0.3047
+TTGAC 0.2242
+TTGAG 0.2273
+TTGAT 0.2437
+TTGCA 0.3638
+TTGCC 0.2184
+TTGCG 0.1562
+TTGCT 0.2616
+TTGGA 0.2319
+TTGGC 0.2602
+TTGGG 0.2244
+TTGGT 0.2835
+TTGTA 0.2232
+TTGTC 0.1706
+TTGTG 0.2934
+TTGTT 0.3128
+TTTAA 0.3338
+TTTAC 0.2185
+TTTAG 0.1332
+TTTAT 0.3145
+TTTCA 0.34
+TTTCC 0.2279
+TTTCG 0.1706
+TTTCT 0.2615
+TTTGA 0.2281
+TTTGC 0.222
+TTTGG 0.2037
+TTTGT 0.3462
+TTTTA 0.2563
+TTTTC 0.1648
+TTTTG 0.189
+TTTTT 0.3899
+[3]
+# (a,c,g,t)= (0.217, 0.283, 0.283, 0.217)
+#
+# Probabilities file for the intergenic region model
+#
+
+# k =
+4
+
+# The P_l's
+[P_ls]
+# l=
+0
+# Values
+A 0.254
+C 0.246
+G 0.246
+T 0.254
+# l=
+1
+# Values
+AA 0.0729
+AC 0.0645
+AG 0.0549
+AT 0.0615
+CA 0.0755
+CC 0.063
+CG 0.0528
+CT 0.0549
+GA 0.0564
+GC 0.0622
+GG 0.063
+GT 0.0645
+TA 0.049
+TC 0.0564
+TG 0.0755
+TT 0.0729
+# l=
+2
+# Values
+AAA 0.0245
+AAC 0.0162
+AAG 0.0136
+AAT 0.0186
+ACA 0.0219
+ACC 0.0154
+ACG 0.0143
+ACT 0.0129
+AGA 0.0138
+AGC 0.0146
+AGG 0.0136
+AGT 0.0129
+ATA 0.0138
+ATC 0.0128
+ATG 0.0163
+ATT 0.0186
+CAA 0.0186
+CAC 0.0238
+CAG 0.0169
+CAT 0.0163
+CCA 0.0184
+CCC 0.0187
+CCG 0.0123
+CCT 0.0136
+CGA 0.012
+CGC 0.0142
+CGG 0.0123
+CGT 0.0143
+CTA 0.00825
+CTC 0.0162
+CTG 0.0169
+CTT 0.0136
+GAA 0.0144
+GAC 0.0131
+GAG 0.0162
+GAT 0.0128
+GCA 0.0182
+GCC 0.0153
+GCG 0.0142
+GCT 0.0146
+GGA 0.0136
+GGC 0.0152
+GGG 0.0187
+GGT 0.0154
+GTA 0.0115
+GTC 0.0131
+GTG 0.0238
+GTT 0.0162
+TAA 0.0155
+TAC 0.0115
+TAG 0.00825
+TAT 0.0138
+TCA 0.0171
+TCC 0.0136
+TCG 0.012
+TCT 0.0138
+TGA 0.0171
+TGC 0.0182
+TGG 0.0184
+TGT 0.0219
+TTA 0.0155
+TTC 0.0144
+TTG 0.0186
+TTT 0.0245
+# l=
+3
+# Values
+AAAA 0.00841
+AAAC 0.00531
+AAAG 0.00431
+AAAT 0.00649
+AACA 0.00611
+AACC 0.00365
+AACG 0.00318
+AACT 0.00324
+AAGA 0.00353
+AAGC 0.00333
+AAGG 0.0032
+AAGT 0.00355
+AATA 0.0051
+AATC 0.00352
+AATG 0.00502
+AATT 0.005
+ACAA 0.00585
+ACAC 0.00677
+ACAG 0.00442
+ACAT 0.00485
+ACCA 0.00499
+ACCC 0.00426
+ACCG 0.003
+ACCT 0.00319
+ACGA 0.00343
+ACGC 0.00347
+ACGG 0.00316
+ACGT 0.00423
+ACTA 0.00202
+ACTC 0.00354
+ACTG 0.00381
+ACTT 0.00355
+AGAA 0.00366
+AGAC 0.00313
+AGAG 0.00392
+AGAT 0.0031
+AGCA 0.00473
+AGCC 0.00345
+AGCG 0.00324
+AGCT 0.00322
+AGGA 0.00326
+AGGC 0.00316
+AGGG 0.00396
+AGGT 0.00319
+AGTA 0.00241
+AGTC 0.00273
+AGTG 0.00454
+AGTT 0.00324
+ATAA 0.00465
+ATAC 0.00288
+ATAG 0.00219
+ATAT 0.00411
+ATCA 0.00406
+ATCC 0.00271
+ATCG 0.00287
+ATCT 0.0031
+ATGA 0.00421
+ATGC 0.00352
+ATGG 0.00368
+ATGT 0.00485
+ATTA 0.00424
+ATTC 0.00353
+ATTG 0.00438
+ATTT 0.00649
+CAAA 0.00566
+CAAC 0.00482
+CAAG 0.00371
+CAAT 0.00437
+CACA 0.00745
+CACC 0.00623
+CACG 0.00555
+CACT 0.00454
+CAGA 0.00389
+CAGC 0.00535
+CAGG 0.00385
+CAGT 0.00381
+CATA 0.00278
+CATC 0.00461
+CATG 0.00385
+CATT 0.00502
+CCAA 0.00412
+CCAC 0.00658
+CCAG 0.00399
+CCAT 0.00368
+CCCA 0.00468
+CCCC 0.00683
+CCCG 0.00324
+CCCT 0.00396
+CCGA 0.00271
+CCGC 0.00372
+CCGG 0.00274
+CCGT 0.00316
+CCTA 0.00193
+CCTC 0.00459
+CCTG 0.00384
+CCTT 0.0032
+CGAA 0.00253
+CGAC 0.0031
+CGAG 0.00348
+CGAT 0.00287
+CGCA 0.0036
+CGCC 0.00372
+CGCG 0.00362
+CGCT 0.00323
+CGGA 0.00232
+CGGC 0.00375
+CGGG 0.00324
+CGGT 0.003
+CGTA 0.00215
+CGTC 0.0034
+CGTG 0.00555
+CGTT 0.00318
+CTAA 0.00227
+CTAC 0.00251
+CTAG 0.00128
+CTAT 0.00219
+CTCA 0.00407
+CTCC 0.00472
+CTCG 0.00348
+CTCT 0.00392
+CTGA 0.00312
+CTGC 0.00536
+CTGG 0.00399
+CTGT 0.00442
+CTTA 0.00222
+CTTC 0.00336
+CTTG 0.00371
+CTTT 0.00431
+GAAA 0.00451
+GAAC 0.00298
+GAAG 0.00336
+GAAT 0.00353
+GACA 0.00395
+GACC 0.00303
+GACG 0.00341
+GACT 0.00273
+GAGA 0.00425
+GAGC 0.00381
+GAGG 0.0046
+GAGT 0.00354
+GATA 0.0024
+GATC 0.00222
+GATG 0.00461
+GATT 0.00352
+GCAA 0.00437
+GCAC 0.0049
+GCAG 0.00536
+GCAT 0.00352
+GCCA 0.00466
+GCCC 0.00367
+GCCG 0.00376
+GCCT 0.00316
+GCGA 0.00331
+GCGC 0.00368
+GCGG 0.00372
+GCGT 0.00347
+GCTA 0.00214
+GCTC 0.00381
+GCTG 0.00535
+GCTT 0.00333
+GGAA 0.0035
+GGAC 0.00264
+GGAG 0.00472
+GGAT 0.00271
+GGCA 0.00413
+GGCC 0.00395
+GGCG 0.00372
+GGCT 0.00345
+GGGA 0.00394
+GGGC 0.00367
+GGGG 0.00683
+GGGT 0.00426
+GGTA 0.00252
+GGTC 0.00303
+GGTG 0.00623
+GGTT 0.00365
+GTAA 0.00336
+GTAC 0.00272
+GTAG 0.00251
+GTAT 0.00287
+GTCA 0.00424
+GTCC 0.00264
+GTCG 0.0031
+GTCT 0.00313
+GTGA 0.00551
+GTGC 0.0049
+GTGG 0.00658
+GTGT 0.00677
+GTTA 0.00307
+GTTC 0.00299
+GTTG 0.00482
+GTTT 0.00531
+TAAA 0.00594
+TAAC 0.00307
+TAAG 0.00222
+TAAT 0.00424
+TACA 0.00439
+TACC 0.00252
+TACG 0.00215
+TACT 0.00241
+TAGA 0.00216
+TAGC 0.00214
+TAGG 0.00193
+TAGT 0.00202
+TATA 0.00356
+TATC 0.0024
+TATG 0.00278
+TATT 0.0051
+TCAA 0.00421
+TCAC 0.00551
+TCAG 0.00312
+TCAT 0.00421
+TCCA 0.00404
+TCCC 0.00394
+TCCG 0.00232
+TCCT 0.00326
+TCGA 0.00256
+TCGC 0.00331
+TCGG 0.00271
+TCGT 0.00342
+TCTA 0.00216
+TCTC 0.00425
+TCTG 0.00389
+TCTT 0.00353
+TGAA 0.00469
+TGAC 0.00424
+TGAG 0.00407
+TGAT 0.00406
+TGCA 0.0057
+TGCC 0.00413
+TGCG 0.0036
+TGCT 0.00473
+TGGA 0.00404
+TGGC 0.00466
+TGGG 0.00468
+TGGT 0.00499
+TGTA 0.00439
+TGTC 0.00395
+TGTG 0.00745
+TGTT 0.00611
+TTAA 0.00518
+TTAC 0.00336
+TTAG 0.00227
+TTAT 0.00465
+TTCA 0.00469
+TTCC 0.0035
+TTCG 0.00253
+TTCT 0.00366
+TTGA 0.00421
+TTGC 0.00438
+TTGG 0.00412
+TTGT 0.00585
+TTTA 0.00594
+TTTC 0.00451
+TTTG 0.00566
+TTTT 0.00841
+# l=
+4
+# Values
+AAAAA 0.00329
+AAAAC 0.00175
+AAAAG 0.00114
+AAAAT 0.00223
+AAACA 0.00208
+AAACC 0.0011
+AAACG 0.00105
+AAACT 0.00108
+AAAGA 0.00112
+AAAGC 0.00104
+AAAGG 0.000914
+AAAGT 0.00124
+AAATA 0.00215
+AAATC 0.00115
+AAATG 0.0017
+AAATT 0.00148
+AACAA 0.00176
+AACAC 0.00168
+AACAG 0.00109
+AACAT 0.00157
+AACCA 0.00116
+AACCC 0.00109
+AACCG 0.00066
+AACCT 0.000747
+AACGA 0.000767
+AACGC 0.000812
+AACGG 0.000609
+AACGT 0.000993
+AACTA 0.000596
+AACTC 0.000886
+AACTG 0.000831
+AACTT 0.000925
+AAGAA 0.00109
+AAGAC 0.000754
+AAGAG 0.000906
+AAGAT 0.000778
+AAGCA 0.00103
+AAGCC 0.000774
+AAGCG 0.0007
+AAGCT 0.000826
+AAGGA 0.000745
+AAGGC 0.00084
+AAGGG 0.000875
+AAGGT 0.000738
+AAGTA 0.000684
+AAGTC 0.000771
+AAGTG 0.00117
+AAGTT 0.000925
+AATAA 0.00205
+AATAC 0.000958
+AATAG 0.000635
+AATAT 0.00146
+AATCA 0.00105
+AATCC 0.000827
+AATCG 0.000848
+AATCT 0.000793
+AATGA 0.00131
+AATGC 0.00105
+AATGG 0.000946
+AATGT 0.00171
+AATTA 0.00136
+AATTC 0.000929
+AATTG 0.00122
+AATTT 0.00148
+ACAAA 0.00196
+ACAAC 0.0015
+ACAAG 0.00103
+ACAAT 0.00136
+ACACA 0.00287
+ACACC 0.00128
+ACACG 0.00147
+ACACT 0.00116
+ACAGA 0.00117
+ACAGC 0.00136
+ACAGG 0.000955
+ACAGT 0.000936
+ACATA 0.000846
+ACATC 0.00125
+ACATG 0.00104
+ACATT 0.00171
+ACCAA 0.00114
+ACCAC 0.00188
+ACCAG 0.00105
+ACCAT 0.000928
+ACCCA 0.0013
+ACCCC 0.00131
+ACCCG 0.000844
+ACCCT 0.000812
+ACCGA 0.00074
+ACCGC 0.000922
+ACCGG 0.000616
+ACCGT 0.00072
+ACCTA 0.000547
+ACCTC 0.000966
+ACCTG 0.000937
+ACCTT 0.000738
+ACGAA 0.000783
+ACGAC 0.000903
+ACGAG 0.000962
+ACGAT 0.000776
+ACGCA 0.00109
+ACGCC 0.000763
+ACGCG 0.000941
+ACGCT 0.000673
+ACGGA 0.000657
+ACGGC 0.000938
+ACGGG 0.000842
+ACGGT 0.00072
+ACGTA 0.000702
+ACGTC 0.000992
+ACGTG 0.00154
+ACGTT 0.000993
+ACTAA 0.000614
+ACTAC 0.000591
+ACTAG 0.000298
+ACTAT 0.000521
+ACTCA 0.00105
+ACTCC 0.000814
+ACTCG 0.000908
+ACTCT 0.00076
+ACTGA 0.000788
+ACTGC 0.00123
+ACTGG 0.000855
+ACTGT 0.000936
+ACTTA 0.000608
+ACTTC 0.000754
+ACTTG 0.000946
+ACTTT 0.00124
+AGAAA 0.00114
+AGAAC 0.000767
+AGAAG 0.00087
+AGAAT 0.000888
+AGACA 0.0011
+AGACC 0.000657
+AGACG 0.000751
+AGACT 0.000629
+AGAGA 0.00122
+AGAGC 0.000884
+AGAGG 0.00106
+AGAGT 0.00076
+AGATA 0.00063
+AGATC 0.000566
+AGATG 0.00111
+AGATT 0.000793
+AGCAA 0.00109
+AGCAC 0.0012
+AGCAG 0.00162
+AGCAT 0.000823
+AGCCA 0.00118
+AGCCC 0.000802
+AGCCG 0.000771
+AGCCT 0.000696
+AGCGA 0.000835
+AGCGC 0.000834
+AGCGG 0.000892
+AGCGT 0.000673
+AGCTA 0.000494
+AGCTC 0.000883
+AGCTG 0.00101
+AGCTT 0.000826
+AGGAA 0.000906
+AGGAC 0.000648
+AGGAG 0.0011
+AGGAT 0.000604
+AGGCA 0.000887
+AGGCC 0.000862
+AGGCG 0.000713
+AGGCT 0.000696
+AGGGA 0.000925
+AGGGC 0.000826
+AGGGG 0.00139
+AGGGT 0.000812
+AGGTA 0.000559
+AGGTC 0.000713
+AGGTG 0.00117
+AGGTT 0.000747
+AGTAA 0.000701
+AGTAC 0.000563
+AGTAG 0.000497
+AGTAT 0.00065
+AGTCA 0.000932
+AGTCC 0.000508
+AGTCG 0.00066
+AGTCT 0.000629
+AGTGA 0.00112
+AGTGC 0.000969
+AGTGG 0.0013
+AGTGT 0.00116
+AGTTA 0.000629
+AGTTC 0.000633
+AGTTG 0.000893
+AGTTT 0.00108
+ATAAA 0.00189
+ATAAC 0.00082
+ATAAG 0.000569
+ATAAT 0.00137
+ATACA 0.00128
+ATACC 0.000491
+ATACG 0.000453
+ATACT 0.00065
+ATAGA 0.000606
+ATAGC 0.000579
+ATAGG 0.000488
+ATAGT 0.000521
+ATATA 0.00121
+ATATC 0.000713
+ATATG 0.000725
+ATATT 0.00146
+ATCAA 0.000987
+ATCAC 0.00123
+ATCAG 0.000755
+ATCAT 0.00109
+ATCCA 0.000942
+ATCCC 0.000731
+ATCCG 0.000438
+ATCCT 0.000604
+ATCGA 0.000714
+ATCGC 0.000768
+ATCGG 0.000616
+ATCGT 0.000776
+ATCTA 0.000554
+ATCTC 0.00093
+ATCTG 0.000842
+ATCTT 0.000778
+ATGAA 0.00132
+ATGAC 0.000913
+ATGAG 0.000894
+ATGAT 0.00109
+ATGCA 0.00129
+ATGCC 0.000739
+ATGCG 0.000664
+ATGCT 0.000823
+ATGGA 0.000925
+ATGGC 0.000898
+ATGGG 0.000929
+ATGGT 0.000928
+ATGTA 0.0011
+ATGTC 0.000815
+ATGTG 0.00137
+ATGTT 0.00157
+ATTAA 0.00141
+ATTAC 0.000884
+ATTAG 0.000574
+ATTAT 0.00137
+ATTCA 0.00116
+ATTCC 0.000915
+ATTCG 0.000573
+ATTCT 0.000888
+ATTGA 0.00102
+ATTGC 0.00102
+ATTGG 0.000979
+ATTGT 0.00136
+ATTTA 0.00162
+ATTTC 0.00115
+ATTTG 0.00149
+ATTTT 0.00223
+CAAAA 0.00161
+CAAAC 0.00138
+CAAAG 0.00118
+CAAAT 0.00149
+CAACA 0.00198
+CAACC 0.00102
+CAACG 0.000925
+CAACT 0.000893
+CAAGA 0.000942
+CAAGC 0.000979
+CAAGG 0.000843
+CAAGT 0.000946
+CAATA 0.001
+CAATC 0.000871
+CAATG 0.00128
+CAATT 0.00122
+CACAA 0.00185
+CACAC 0.0027
+CACAG 0.00153
+CACAT 0.00137
+CACCA 0.00224
+CACCC 0.00157
+CACCG 0.00125
+CACCT 0.00117
+CACGA 0.00124
+CACGC 0.00148
+CACGG 0.00129
+CACGT 0.00154
+CACTA 0.000675
+CACTC 0.00127
+CACTG 0.00143
+CACTT 0.00117
+CAGAA 0.00097
+CAGAC 0.000938
+CAGAG 0.00114
+CAGAT 0.000842
+CAGCA 0.00203
+CAGCC 0.00125
+CAGCG 0.00105
+CAGCT 0.00101
+CAGGA 0.000958
+CAGGC 0.000884
+CAGGG 0.00106
+CAGGT 0.000937
+CAGTA 0.000689
+CAGTC 0.000862
+CAGTG 0.00143
+CAGTT 0.000831
+CATAA 0.00081
+CATAC 0.000701
+CATAG 0.000539
+CATAT 0.000725
+CATCA 0.00164
+CATCC 0.000869
+CATCG 0.000991
+CATCT 0.00111
+CATGA 0.000894
+CATGC 0.000961
+CATGG 0.000959
+CATGT 0.00104
+CATTA 0.000985
+CATTC 0.00104
+CATTG 0.00128
+CATTT 0.0017
+CCAAA 0.00119
+CCAAC 0.00109
+CCAAG 0.00086
+CCAAT 0.000979
+CCACA 0.00163
+CCACC 0.00221
+CCACG 0.00145
+CCACT 0.0013
+CCAGA 0.000855
+CCAGC 0.00125
+CCAGG 0.00103
+CCAGT 0.000855
+CCATA 0.000633
+CCATC 0.00114
+CCATG 0.000959
+CCATT 0.000946
+CCCAA 0.00101
+CCCAC 0.00169
+CCCAG 0.00104
+CCCAT 0.000929
+CCCCA 0.00143
+CCCCC 0.003
+CCCCG 0.00101
+CCCCT 0.00139
+CCCGA 0.000702
+CCCGC 0.000949
+CCCGG 0.000748
+CCCGT 0.000842
+CCCTA 0.000536
+CCCTC 0.00148
+CCCTG 0.00106
+CCCTT 0.000875
+CCGAA 0.000606
+CCGAC 0.00067
+CCGAG 0.000815
+CCGAT 0.000616
+CCGCA 0.000835
+CCGCC 0.00113
+CCGCG 0.000865
+CCGCT 0.000892
+CCGGA 0.00052
+CCGGC 0.000852
+CCGGG 0.000748
+CCGGT 0.000616
+CCGTA 0.000479
+CCGTC 0.000784
+CCGTG 0.00129
+CCGTT 0.000609
+CCTAA 0.000472
+CCTAC 0.000631
+CCTAG 0.000335
+CCTAT 0.000488
+CCTCA 0.00094
+CCTCC 0.00164
+CCTCG 0.000955
+CCTCT 0.00106
+CCTGA 0.000668
+CCTGC 0.00119
+CCTGG 0.00103
+CCTGT 0.000955
+CCTTA 0.000549
+CCTTC 0.00089
+CCTTG 0.000843
+CCTTT 0.000914
+CGAAA 0.000855
+CGAAC 0.000596
+CGAAG 0.000508
+CGAAT 0.000573
+CGACA 0.0008
+CGACC 0.000769
+CGACG 0.000875
+CGACT 0.00066
+CGAGA 0.000732
+CGAGC 0.000888
+CGAGG 0.000955
+CGAGT 0.000908
+CGATA 0.000505
+CGATC 0.000528
+CGATG 0.000991
+CGATT 0.000848
+CGCAA 0.000812
+CGCAC 0.0012
+CGCAG 0.000917
+CGCAT 0.000664
+CGCCA 0.000982
+CGCCC 0.000932
+CGCCG 0.00109
+CGCCT 0.000713
+CGCGA 0.000741
+CGCGC 0.00107
+CGCGG 0.000865
+CGCGT 0.000941
+CGCTA 0.000468
+CGCTC 0.00102
+CGCTG 0.00105
+CGCTT 0.0007
+CGGAA 0.000519
+CGGAC 0.000497
+CGGAG 0.00087
+CGGAT 0.000438
+CGGCA 0.000912
+CGGCC 0.00098
+CGGCG 0.00109
+CGGCT 0.000771
+CGGGA 0.000654
+CGGGC 0.000735
+CGGGG 0.00101
+CGGGT 0.000844
+CGGTA 0.000505
+CGGTC 0.000585
+CGGTG 0.00125
+CGGTT 0.00066
+CGTAA 0.000544
+CGTAC 0.00058
+CGTAG 0.000573
+CGTAT 0.000453
+CGTCA 0.00111
+CGTCC 0.000675
+CGTCG 0.000875
+CGTCT 0.000751
+CGTGA 0.00139
+CGTGC 0.00124
+CGTGG 0.00145
+CGTGT 0.00147
+CGTTA 0.00055
+CGTTC 0.000658
+CGTTG 0.000925
+CGTTT 0.00105
+CTAAA 0.0008
+CTAAC 0.000521
+CTAAG 0.00037
+CTAAT 0.000574
+CTACA 0.000833
+CTACC 0.000608
+CTACG 0.000573
+CTACT 0.000497
+CTAGA 0.000341
+CTAGC 0.000307
+CTAGG 0.000335
+CTAGT 0.000298
+CTATA 0.000559
+CTATC 0.000461
+CTATG 0.000539
+CTATT 0.000635
+CTCAA 0.00105
+CTCAC 0.0014
+CTCAG 0.000726
+CTCAT 0.000894
+CTCCA 0.00127
+CTCCC 0.00148
+CTCCG 0.00087
+CTCCT 0.0011
+CTCGA 0.000609
+CTCGC 0.0011
+CTCGG 0.000815
+CTCGT 0.000962
+CTCTA 0.000528
+CTCTC 0.00135
+CTCTG 0.00114
+CTCTT 0.000906
+CTGAA 0.000909
+CTGAC 0.000728
+CTGAG 0.000726
+CTGAT 0.000755
+CTGCA 0.00157
+CTGCC 0.00126
+CTGCG 0.000917
+CTGCT 0.00162
+CTGGA 0.000865
+CTGGC 0.00104
+CTGGG 0.00104
+CTGGT 0.00105
+CTGTA 0.000935
+CTGTC 0.00086
+CTGTG 0.00153
+CTGTT 0.00109
+CTTAA 0.000769
+CTTAC 0.000508
+CTTAG 0.00037
+CTTAT 0.000569
+CTTCA 0.00111
+CTTCC 0.00087
+CTTCG 0.000508
+CTTCT 0.00087
+CTTGA 0.000816
+CTTGC 0.001
+CTTGG 0.00086
+CTTGT 0.00103
+CTTTA 0.00105
+CTTTC 0.00094
+CTTTG 0.00118
+CTTTT 0.00114
+GAAAA 0.00141
+GAAAC 0.00101
+GAAAG 0.00094
+GAAAT 0.00115
+GAACA 0.000903
+GAACC 0.000793
+GAACG 0.000658
+GAACT 0.000633
+GAAGA 0.000907
+GAAGC 0.000805
+GAAGG 0.00089
+GAAGT 0.000754
+GAATA 0.000791
+GAATC 0.000765
+GAATG 0.00104
+GAATT 0.000929
+GACAA 0.00107
+GACAC 0.00121
+GACAG 0.00086
+GACAT 0.000815
+GACCA 0.000853
+GACCC 0.000883
+GACCG 0.000585
+GACCT 0.000713
+GACGA 0.000898
+GACGC 0.00073
+GACGG 0.000784
+GACGT 0.000992
+GACTA 0.000327
+GACTC 0.000769
+GACTG 0.000862
+GACTT 0.000771
+GAGAA 0.000956
+GAGAC 0.00101
+GAGAG 0.00135
+GAGAT 0.00093
+GAGCA 0.00102
+GAGCC 0.000888
+GAGCG 0.00102
+GAGCT 0.000883
+GAGGA 0.00112
+GAGGC 0.00103
+GAGGG 0.00148
+GAGGT 0.000966
+GAGTA 0.000612
+GAGTC 0.000769
+GAGTG 0.00127
+GAGTT 0.000886
+GATAA 0.000748
+GATAC 0.000476
+GATAG 0.000461
+GATAT 0.000713
+GATCA 0.000614
+GATCC 0.000514
+GATCG 0.000528
+GATCT 0.000566
+GATGA 0.00131
+GATGC 0.000904
+GATGG 0.00114
+GATGT 0.00125
+GATTA 0.000735
+GATTC 0.000765
+GATTG 0.000871
+GATTT 0.00115
+GCAAA 0.00126
+GCAAC 0.00109
+GCAAG 0.001
+GCAAT 0.00102
+GCACA 0.00152
+GCACC 0.00118
+GCACG 0.00124
+GCACT 0.000969
+GCAGA 0.00108
+GCAGC 0.00186
+GCAGG 0.00119
+GCAGT 0.00123
+GCATA 0.000605
+GCATC 0.000904
+GCATG 0.000961
+GCATT 0.00105
+GCCAA 0.0011
+GCCAC 0.00163
+GCCAG 0.00104
+GCCAT 0.000898
+GCCCA 0.000932
+GCCCC 0.00118
+GCCCG 0.000735
+GCCCT 0.000826
+GCCGA 0.000751
+GCCGC 0.00121
+GCCGG 0.000852
+GCCGT 0.000938
+GCCTA 0.00041
+GCCTC 0.00103
+GCCTG 0.000884
+GCCTT 0.00084
+GCGAA 0.000606
+GCGAC 0.000835
+GCGAG 0.0011
+GCGAT 0.000768
+GCGCA 0.000887
+GCGCC 0.000883
+GCGCG 0.00107
+GCGCT 0.000834
+GCGGA 0.000634
+GCGGC 0.00121
+GCGGG 0.000949
+GCGGT 0.000922
+GCGTA 0.000446
+GCGTC 0.00073
+GCGTG 0.00148
+GCGTT 0.000812
+GCTAA 0.000597
+GCTAC 0.000658
+GCTAG 0.000307
+GCTAT 0.000579
+GCTCA 0.00103
+GCTCC 0.00102
+GCTCG 0.000888
+GCTCT 0.000884
+GCTGA 0.000878
+GCTGC 0.00186
+GCTGG 0.00125
+GCTGT 0.00136
+GCTTA 0.000505
+GCTTC 0.000805
+GCTTG 0.000979
+GCTTT 0.00104
+GGAAA 0.00107
+GGAAC 0.000638
+GGAAG 0.00087
+GGAAT 0.000915
+GGACA 0.00087
+GGACC 0.000585
+GGACG 0.000675
+GGACT 0.000508
+GGAGA 0.00125
+GGAGC 0.00102
+GGAGG 0.00164
+GGAGT 0.000814
+GGATA 0.000503
+GGATC 0.000514
+GGATG 0.000869
+GGATT 0.000827
+GGCAA 0.00106
+GGCAC 0.00108
+GGCAG 0.00126
+GGCAT 0.000739
+GGCCA 0.00123
+GGCCC 0.000875
+GGCCG 0.00098
+GGCCT 0.000862
+GGCGA 0.000947
+GGCGC 0.000883
+GGCGG 0.00113
+GGCGT 0.000763
+GGCTA 0.000536
+GGCTC 0.000888
+GGCTG 0.00125
+GGCTT 0.000774
+GGGAA 0.001
+GGGAC 0.000726
+GGGAG 0.00148
+GGGAT 0.000731
+GGGCA 0.00107
+GGGCC 0.000875
+GGGCG 0.000932
+GGGCT 0.000802
+GGGGA 0.00134
+GGGGC 0.00118
+GGGGG 0.003
+GGGGT 0.00131
+GGGTA 0.000718
+GGGTC 0.000883
+GGGTG 0.00157
+GGGTT 0.00109
+GGTAA 0.000851
+GGTAC 0.000573
+GGTAG 0.000608
+GGTAT 0.000491
+GGTCA 0.00102
+GGTCC 0.000585
+GGTCG 0.000769
+GGTCT 0.000657
+GGTGA 0.00157
+GGTGC 0.00118
+GGTGG 0.00221
+GGTGT 0.00128
+GGTTA 0.000744
+GGTTC 0.000793
+GGTTG 0.00102
+GGTTT 0.0011
+GTAAA 0.00132
+GTAAC 0.000654
+GTAAG 0.000508
+GTAAT 0.000884
+GTACA 0.00101
+GTACC 0.000573
+GTACG 0.00058
+GTACT 0.000563
+GTAGA 0.000629
+GTAGC 0.000658
+GTAGG 0.000631
+GTAGT 0.000591
+GTATA 0.000739
+GTATC 0.000476
+GTATG 0.000701
+GTATT 0.000958
+GTCAA 0.001
+GTCAC 0.0016
+GTCAG 0.000728
+GTCAT 0.000913
+GTCCA 0.000766
+GTCCC 0.000726
+GTCCG 0.000497
+GTCCT 0.000648
+GTCGA 0.000695
+GTCGC 0.000835
+GTCGG 0.00067
+GTCGT 0.000903
+GTCTA 0.000428
+GTCTC 0.00101
+GTCTG 0.000938
+GTCTT 0.000754
+GTGAA 0.00129
+GTGAC 0.0016
+GTGAG 0.0014
+GTGAT 0.00123
+GTGCA 0.00143
+GTGCC 0.00108
+GTGCG 0.0012
+GTGCT 0.0012
+GTGGA 0.00138
+GTGGC 0.00163
+GTGGG 0.00169
+GTGGT 0.00188
+GTGTA 0.00118
+GTGTC 0.00121
+GTGTG 0.0027
+GTGTT 0.00168
+GTTAA 0.00107
+GTTAC 0.000654
+GTTAG 0.000521
+GTTAT 0.00082
+GTTCA 0.000984
+GTTCC 0.000638
+GTTCG 0.000596
+GTTCT 0.000767
+GTTGA 0.00114
+GTTGC 0.00109
+GTTGG 0.00109
+GTTGT 0.0015
+GTTTA 0.00118
+GTTTC 0.00101
+GTTTG 0.00138
+GTTTT 0.00175
+TAAAA 0.0021
+TAAAC 0.00118
+TAAAG 0.00105
+TAAAT 0.00162
+TAACA 0.00114
+TAACC 0.000744
+TAACG 0.00055
+TAACT 0.000629
+TAAGA 0.000554
+TAAGC 0.000505
+TAAGG 0.000549
+TAAGT 0.000608
+TAATA 0.00116
+TAATC 0.000735
+TAATG 0.000985
+TAATT 0.00136
+TACAA 0.00118
+TACAC 0.00118
+TACAG 0.000935
+TACAT 0.0011
+TACCA 0.000739
+TACCC 0.000718
+TACCG 0.000505
+TACCT 0.000559
+TACGA 0.000522
+TACGC 0.000446
+TACGG 0.000479
+TACGT 0.000702
+TACTA 0.000425
+TACTC 0.000612
+TACTG 0.000689
+TACTT 0.000684
+TAGAA 0.000647
+TAGAC 0.000428
+TAGAG 0.000528
+TAGAT 0.000554
+TAGCA 0.000644
+TAGCC 0.000536
+TAGCG 0.000468
+TAGCT 0.000494
+TAGGA 0.000432
+TAGGC 0.00041
+TAGGG 0.000536
+TAGGT 0.000547
+TAGTA 0.000425
+TAGTC 0.000327
+TAGTG 0.000675
+TAGTT 0.000596
+TATAA 0.00104
+TATAC 0.000739
+TATAG 0.000559
+TATAT 0.00121
+TATCA 0.000758
+TATCC 0.000503
+TATCG 0.000505
+TATCT 0.00063
+TATGA 0.000691
+TATGC 0.000605
+TATGG 0.000633
+TATGT 0.000846
+TATTA 0.00116
+TATTC 0.000791
+TATTG 0.001
+TATTT 0.00215
+TCAAA 0.00124
+TCAAC 0.00114
+TCAAG 0.000816
+TCAAT 0.00102
+TCACA 0.00144
+TCACC 0.00157
+TCACG 0.00139
+TCACT 0.00112
+TCAGA 0.000784
+TCAGC 0.000878
+TCAGG 0.000668
+TCAGT 0.000788
+TCATA 0.000691
+TCATC 0.00131
+TCATG 0.000894
+TCATT 0.00131
+TCCAA 0.00087
+TCCAC 0.00138
+TCCAG 0.000865
+TCCAT 0.000925
+TCCCA 0.00102
+TCCCC 0.00134
+TCCCG 0.000654
+TCCCT 0.000925
+TCCGA 0.000513
+TCCGC 0.000634
+TCCGG 0.00052
+TCCGT 0.000657
+TCCTA 0.000432
+TCCTC 0.00112
+TCCTG 0.000958
+TCCTT 0.000745
+TCGAA 0.000537
+TCGAC 0.000695
+TCGAG 0.000609
+TCGAT 0.000714
+TCGCA 0.000784
+TCGCC 0.000947
+TCGCG 0.000741
+TCGCT 0.000835
+TCGGA 0.000513
+TCGGC 0.000751
+TCGGG 0.000702
+TCGGT 0.00074
+TCGTA 0.000522
+TCGTC 0.000898
+TCGTG 0.00124
+TCGTT 0.000767
+TCTAA 0.000582
+TCTAC 0.000629
+TCTAG 0.000341
+TCTAT 0.000606
+TCTCA 0.00105
+TCTCC 0.00125
+TCTCG 0.000732
+TCTCT 0.00122
+TCTGA 0.000784
+TCTGC 0.00108
+TCTGG 0.000855
+TCTGT 0.00117
+TCTTA 0.000554
+TCTTC 0.000907
+TCTTG 0.000942
+TCTTT 0.00112
+TGAAA 0.00144
+TGAAC 0.000984
+TGAAG 0.00111
+TGAAT 0.00116
+TGACA 0.00118
+TGACC 0.00102
+TGACG 0.00111
+TGACT 0.000932
+TGAGA 0.00105
+TGAGC 0.00103
+TGAGG 0.00094
+TGAGT 0.00105
+TGATA 0.000758
+TGATC 0.000614
+TGATG 0.00164
+TGATT 0.00105
+TGCAA 0.00141
+TGCAC 0.00143
+TGCAG 0.00157
+TGCAT 0.00129
+TGCCA 0.00127
+TGCCC 0.00107
+TGCCG 0.000912
+TGCCT 0.000887
+TGCGA 0.000784
+TGCGC 0.000887
+TGCGG 0.000835
+TGCGT 0.00109
+TGCTA 0.000644
+TGCTC 0.00102
+TGCTG 0.00203
+TGCTT 0.00103
+TGGAA 0.00107
+TGGAC 0.000766
+TGGAG 0.00127
+TGGAT 0.000942
+TGGCA 0.00127
+TGGCC 0.00123
+TGGCG 0.000982
+TGGCT 0.00118
+TGGGA 0.00102
+TGGGC 0.000932
+TGGGG 0.00143
+TGGGT 0.0013
+TGGTA 0.000739
+TGGTC 0.000853
+TGGTG 0.00224
+TGGTT 0.00116
+TGTAA 0.00127
+TGTAC 0.00101
+TGTAG 0.000833
+TGTAT 0.00128
+TGTCA 0.00118
+TGTCC 0.00087
+TGTCG 0.0008
+TGTCT 0.0011
+TGTGA 0.00144
+TGTGC 0.00152
+TGTGG 0.00163
+TGTGT 0.00287
+TGTTA 0.00114
+TGTTC 0.000903
+TGTTG 0.00198
+TGTTT 0.00208
+TTAAA 0.00193
+TTAAC 0.00107
+TTAAG 0.000769
+TTAAT 0.00141
+TTACA 0.00127
+TTACC 0.000851
+TTACG 0.000544
+TTACT 0.000701
+TTAGA 0.000582
+TTAGC 0.000597
+TTAGG 0.000472
+TTAGT 0.000614
+TTATA 0.00104
+TTATC 0.000748
+TTATG 0.00081
+TTATT 0.00205
+TTCAA 0.00117
+TTCAC 0.00129
+TTCAG 0.000909
+TTCAT 0.00132
+TTCCA 0.00107
+TTCCC 0.001
+TTCCG 0.000519
+TTCCT 0.000906
+TTCGA 0.000537
+TTCGC 0.000606
+TTCGG 0.000606
+TTCGT 0.000783
+TTCTA 0.000647
+TTCTC 0.000956
+TTCTG 0.00097
+TTCTT 0.00109
+TTGAA 0.00117
+TTGAC 0.001
+TTGAG 0.00105
+TTGAT 0.000987
+TTGCA 0.00141
+TTGCC 0.00106
+TTGCG 0.000812
+TTGCT 0.00109
+TTGGA 0.00087
+TTGGC 0.0011
+TTGGG 0.00101
+TTGGT 0.00114
+TTGTA 0.00118
+TTGTC 0.00107
+TTGTG 0.00185
+TTGTT 0.00176
+TTTAA 0.00193
+TTTAC 0.00132
+TTTAG 0.0008
+TTTAT 0.00189
+TTTCA 0.00144
+TTTCC 0.00107
+TTTCG 0.000855
+TTTCT 0.00114
+TTTGA 0.00124
+TTTGC 0.00126
+TTTGG 0.00119
+TTTGT 0.00196
+TTTTA 0.0021
+TTTTC 0.00141
+TTTTG 0.00161
+TTTTT 0.00329
+
+[EMISSION]
+
+# Vector size (4^(k+1))
+1024
+# Probabilities
+AAAAA 0.3899
+AAAAC 0.1992
+AAAAG 0.1365
+AAAAT 0.2744
+AAACA 0.4132
+AAACC 0.1889
+AAACG 0.183
+AAACT 0.2149
+AAAGA 0.257
+AAAGC 0.2407
+AAAGG 0.2064
+AAAGT 0.2959
+AAATA 0.3354
+AAATC 0.1615
+AAATG 0.2714
+AAATT 0.2317
+AACAA 0.306
+AACAC 0.2481
+AACAG 0.1696
+AACAT 0.2763
+AACCA 0.3392
+AACCC 0.281
+AACCG 0.1497
+AACCT 0.2301
+AACGA 0.2427
+AACGC 0.2372
+AACGG 0.172
+AACGT 0.3481
+AACTA 0.2026
+AACTC 0.2442
+AACTG 0.2602
+AACTT 0.293
+AAGAA 0.3337
+AAGAC 0.1989
+AAGAG 0.2426
+AAGAT 0.2248
+AAGCA 0.3457
+AAGCC 0.2213
+AAGCG 0.1756
+AAGCT 0.2574
+AAGGA 0.2471
+AAGGC 0.2445
+AAGGG 0.2617
+AAGGT 0.2467
+AAGTA 0.221
+AAGTC 0.2029
+AAGTG 0.3124
+AAGTT 0.2638
+AATAA 0.3917
+AATAC 0.1876
+AATAG 0.1247
+AATAT 0.2961
+AATCA 0.3133
+AATCC 0.2294
+AATCG 0.2139
+AATCT 0.2434
+AATGA 0.246
+AATGC 0.2159
+AATGG 0.1792
+AATGT 0.359
+AATTA 0.2777
+AATTC 0.181
+AATTG 0.2397
+AATTT 0.3016
+ACAAA 0.3378
+ACAAC 0.2227
+ACAAG 0.175
+ACAAT 0.2646
+ACACA 0.4064
+ACACC 0.1885
+ACACG 0.1996
+ACACT 0.2055
+ACAGA 0.2581
+ACAGC 0.2941
+ACAGG 0.2059
+ACAGT 0.2419
+ACATA 0.1788
+ACATC 0.2151
+ACATG 0.218
+ACATT 0.3881
+ACCAA 0.2539
+ACCAC 0.3313
+ACCAG 0.2078
+ACCAT 0.207
+ACCCA 0.3162
+ACCCC 0.2966
+ACCCG 0.1709
+ACCCT 0.2162
+ACCGA 0.2799
+ACCGC 0.2781
+ACCGG 0.1885
+ACCGT 0.2534
+ACCTA 0.1816
+ACCTC 0.2644
+ACCTG 0.2878
+ACCTT 0.2661
+ACGAA 0.26
+ACGAC 0.2478
+ACGAG 0.2542
+ACGAT 0.238
+ACGCA 0.3336
+ACGCC 0.2121
+ACGCG 0.2445
+ACGCT 0.2099
+ACGGA 0.2255
+ACGGC 0.2833
+ACGGG 0.249
+ACGGT 0.2421
+ACGTA 0.1847
+ACGTC 0.2208
+ACGTG 0.3339
+ACGTT 0.2607
+ACTAA 0.3071
+ACTAC 0.263
+ACTAG 0.1427
+ACTAT 0.2872
+ACTCA 0.3004
+ACTCC 0.2222
+ACTCG 0.2359
+ACTCT 0.2416
+ACTGA 0.2197
+ACTGC 0.3122
+ACTGG 0.2126
+ACTGT 0.2556
+ACTTA 0.1916
+ACTTC 0.1964
+ACTTG 0.2479
+ACTTT 0.3641
+AGAAA 0.3273
+AGAAC 0.1997
+AGAAG 0.226
+AGAAT 0.247
+AGACA 0.3656
+AGACC 0.2033
+AGACG 0.2176
+AGACT 0.2135
+AGAGA 0.3008
+AGAGC 0.2185
+AGAGG 0.2648
+AGAGT 0.2159
+AGATA 0.2153
+AGATC 0.1646
+AGATG 0.3332
+AGATT 0.2869
+AGCAA 0.2569
+AGCAC 0.2332
+AGCAG 0.3013
+AGCAT 0.2087
+AGCCA 0.367
+AGCCC 0.2307
+AGCCG 0.1875
+AGCCT 0.2148
+AGCGA 0.2719
+AGCGC 0.2448
+AGCGG 0.2533
+AGCGT 0.23
+AGCTA 0.1694
+AGCTC 0.2399
+AGCTG 0.3023
+AGCTT 0.2884
+AGGAA 0.3126
+AGGAC 0.1972
+AGGAG 0.2892
+AGGAT 0.2009
+AGGCA 0.3086
+AGGCC 0.2577
+AGGCG 0.1992
+AGGCT 0.2345
+AGGGA 0.2444
+AGGGC 0.2129
+AGGGG 0.3196
+AGGGT 0.2231
+AGGTA 0.1945
+AGGTC 0.2041
+AGGTG 0.337
+AGGTT 0.2643
+AGTAA 0.3064
+AGTAC 0.2243
+AGTAG 0.182
+AGTAT 0.2872
+AGTCA 0.378
+AGTCC 0.1797
+AGTCG 0.2089
+AGTCT 0.2334
+AGTGA 0.2415
+AGTGC 0.2169
+AGTGG 0.2647
+AGTGT 0.277
+AGTTA 0.2137
+AGTTC 0.1771
+AGTTG 0.2581
+AGTTT 0.3511
+ATAAA 0.4034
+ATAAC 0.168
+ATAAG 0.1278
+ATAAT 0.3008
+ATACA 0.4551
+ATACC 0.1591
+ATACG 0.1452
+ATACT 0.2406
+ATAGA 0.2737
+ATAGC 0.254
+ATAGG 0.2019
+ATAGT 0.2704
+ATATA 0.2961
+ATATC 0.1592
+ATATG 0.1844
+ATATT 0.3603
+ATCAA 0.2639
+ATCAC 0.2686
+ATCAG 0.1894
+ATCAT 0.2781
+ATCCA 0.3739
+ATCCC 0.2477
+ATCCG 0.1485
+ATCCT 0.23
+ATCGA 0.2566
+ATCGC 0.2623
+ATCGG 0.2016
+ATCGT 0.2795
+ATCTA 0.1968
+ATCTC 0.2579
+ATCTG 0.277
+ATCTT 0.2683
+ATGAA 0.3342
+ATGAC 0.2118
+ATGAG 0.1924
+ATGAT 0.2615
+ATGCA 0.4018
+ATGCC 0.2018
+ATGCG 0.15
+ATGCT 0.2464
+ATGGA 0.2708
+ATGGC 0.2443
+ATGGG 0.2296
+ATGGT 0.2553
+ATGTA 0.2478
+ATGTC 0.1623
+ATGTG 0.2632
+ATGTT 0.3267
+ATTAA 0.3355
+ATTAC 0.2094
+ATTAG 0.1339
+ATTAT 0.3211
+ATTCA 0.3511
+ATTCC 0.241
+ATTCG 0.1485
+ATTCT 0.2594
+ATTGA 0.2358
+ATTGC 0.2271
+ATTGG 0.2041
+ATTGT 0.333
+ATTTA 0.2575
+ATTTC 0.1687
+ATTTG 0.2201
+ATTTT 0.3537
+CAAAA 0.3058
+CAAAC 0.2234
+CAAAG 0.1946
+CAAAT 0.2762
+CAACA 0.4171
+CAACC 0.2051
+CAACG 0.173
+CAACT 0.2048
+CAAGA 0.26
+CAAGC 0.2548
+CAAGG 0.2231
+CAAGT 0.2621
+CAATA 0.243
+CAATC 0.177
+CAATG 0.2962
+CAATT 0.2838
+CACAA 0.2841
+CACAC 0.3003
+CACAG 0.1954
+CACAT 0.2202
+CACCA 0.3604
+CACCC 0.2461
+CACCG 0.1835
+CACCT 0.2101
+CACGA 0.2393
+CACGC 0.2385
+CACGG 0.2182
+CACGT 0.304
+CACTA 0.1582
+CACTC 0.2286
+CACTG 0.3271
+CACTT 0.2861
+CAGAA 0.2813
+CAGAC 0.219
+CAGAG 0.2614
+CAGAT 0.2384
+CAGCA 0.3911
+CAGCC 0.2306
+CAGCG 0.1711
+CAGCT 0.2072
+CAGGA 0.2666
+CAGGC 0.2179
+CAGGG 0.2559
+CAGGT 0.2597
+CAGTA 0.2107
+CAGTC 0.2038
+CAGTG 0.3536
+CAGTT 0.2319
+CATAA 0.2924
+CATAC 0.2456
+CATAG 0.1676
+CATAT 0.2943
+CATCA 0.3569
+CATCC 0.1917
+CATCG 0.1985
+CATCT 0.2529
+CATGA 0.2452
+CATGC 0.2445
+CATGG 0.2215
+CATGT 0.2888
+CATTA 0.209
+CATTC 0.1836
+CATTG 0.2518
+CATTT 0.3556
+CCAAA 0.3139
+CCAAC 0.2311
+CCAAG 0.199
+CCAAT 0.2561
+CCACA 0.276
+CCACC 0.3023
+CCACG 0.206
+CCACT 0.2156
+CCAGA 0.2267
+CCAGC 0.2903
+CCAGG 0.2419
+CCAGT 0.2411
+CCATA 0.1854
+CCATC 0.2703
+CCATG 0.2522
+CCATT 0.2921
+CCCAA 0.2341
+CCCAC 0.3366
+CCCAG 0.2125
+CCCAT 0.2168
+CCCCA 0.2229
+CCCCC 0.4314
+CCCCG 0.1359
+CCCCT 0.2098
+CCCGA 0.2364
+CCCGC 0.2794
+CCCGG 0.2125
+CCCGT 0.2717
+CCCTA 0.1399
+CCCTC 0.344
+CCCTG 0.2586
+CCCTT 0.2574
+CCGAA 0.2503
+CCGAC 0.2284
+CCGAG 0.2863
+CCGAT 0.235
+CCGCA 0.2534
+CCGCC 0.2972
+CCGCG 0.2091
+CCGCT 0.2403
+CCGGA 0.2081
+CCGGC 0.2847
+CCGGG 0.2635
+CCGGT 0.2437
+CCGTA 0.1718
+CCGTC 0.232
+CCGTG 0.3877
+CCGTT 0.2085
+CCTAA 0.2733
+CCTAC 0.3134
+CCTAG 0.1569
+CCTAT 0.2564
+CCTCA 0.218
+CCTCC 0.3485
+CCTCG 0.1855
+CCTCT 0.248
+CCTGA 0.1914
+CCTGC 0.2975
+CCTGG 0.253
+CCTGT 0.2581
+CCTTA 0.1792
+CCTTC 0.2594
+CCTTG 0.2548
+CCTTT 0.3065
+CGAAA 0.3618
+CGAAC 0.2086
+CGAAG 0.19
+CGAAT 0.2396
+CGACA 0.2692
+CGACC 0.2333
+CGACG 0.2729
+CGACT 0.2246
+CGAGA 0.2368
+CGAGC 0.2374
+CGAGG 0.2548
+CGAGT 0.271
+CGATA 0.1812
+CGATC 0.1779
+CGATG 0.3263
+CGATT 0.3146
+CGCAA 0.2467
+CGCAC 0.3039
+CGCAG 0.245
+CGCAT 0.2043
+CGCCA 0.2862
+CGCCC 0.2343
+CGCCG 0.2668
+CGCCT 0.2127
+CGCGA 0.228
+CGCGC 0.2914
+CGCGG 0.2169
+CGCGT 0.2637
+CGCTA 0.155
+CGCTC 0.2746
+CGCTG 0.319
+CGCTT 0.2514
+CGGAA 0.2433
+CGGAC 0.2021
+CGGAG 0.338
+CGGAT 0.2167
+CGGCA 0.2601
+CGGCC 0.2517
+CGGCG 0.2683
+CGGCT 0.22
+CGGGA 0.2135
+CGGGC 0.2201
+CGGGG 0.3059
+CGGGT 0.2605
+CGGTA 0.2021
+CGGTC 0.1953
+CGGTG 0.3803
+CGGTT 0.2222
+CGTAA 0.2851
+CGTAC 0.2331
+CGTAG 0.2397
+CGTAT 0.242
+CGTCA 0.3466
+CGTCC 0.1875
+CGTCG 0.2405
+CGTCT 0.2254
+CGTGA 0.2719
+CGTGC 0.2122
+CGTGG 0.25
+CGTGT 0.2659
+CGTTA 0.1888
+CGTTC 0.1945
+CGTTG 0.2602
+CGTTT 0.3566
+CTAAA 0.3744
+CTAAC 0.1982
+CTAAG 0.1525
+CTAAT 0.2749
+CTACA 0.3527
+CTACC 0.2232
+CTACG 0.2059
+CTACT 0.2183
+CTAGA 0.2844
+CTAGC 0.2276
+CTAGG 0.2338
+CTAGT 0.2543
+CTATA 0.2645
+CTATC 0.1845
+CTATG 0.2253
+CTATT 0.3256
+CTCAA 0.2883
+CTCAC 0.2942
+CTCAG 0.1779
+CTCAT 0.2397
+CTCCA 0.2949
+CTCCC 0.2988
+CTCCG 0.1672
+CTCCT 0.2391
+CTCGA 0.1906
+CTCGC 0.2904
+CTCGG 0.2341
+CTCGT 0.2849
+CTCTA 0.1495
+CTCTC 0.3017
+CTCTG 0.2809
+CTCTT 0.2679
+CTGAA 0.3207
+CTGAC 0.2217
+CTGAG 0.2037
+CTGAT 0.2539
+CTGCA 0.3354
+CTGCC 0.2185
+CTGCG 0.1498
+CTGCT 0.2963
+CTGGA 0.2396
+CTGGC 0.2551
+CTGGG 0.2363
+CTGGT 0.269
+CTGTA 0.2449
+CTGTC 0.1822
+CTGTG 0.3082
+CTGTT 0.2647
+CTTAA 0.3581
+CTTAC 0.2122
+CTTAG 0.1515
+CTTAT 0.2782
+CTTCA 0.3493
+CTTCC 0.2367
+CTTCG 0.1372
+CTTCT 0.2768
+CTTGA 0.2252
+CTTGC 0.2561
+CTTGG 0.2171
+CTTGT 0.3016
+CTTTA 0.2542
+CTTTC 0.2082
+CTTTG 0.2518
+CTTTT 0.2857
+GAAAA 0.3295
+GAAAC 0.21
+GAAAG 0.1989
+GAAAT 0.2617
+GAACA 0.3427
+GAACC 0.2435
+GAACG 0.1983
+GAACT 0.2155
+GAAGA 0.2779
+GAAGC 0.2326
+GAAGG 0.2557
+GAAGT 0.2338
+GAATA 0.2429
+GAATC 0.1876
+GAATG 0.2858
+GAATT 0.2837
+GACAA 0.2958
+GACAC 0.2541
+GACAG 0.2069
+GACAT 0.2432
+GACCA 0.318
+GACCC 0.2553
+GACCG 0.1816
+GACCT 0.2452
+GACGA 0.2688
+GACGC 0.1979
+GACGG 0.2099
+GACGT 0.3234
+GACTA 0.1378
+GACTC 0.2347
+GACTG 0.316
+GACTT 0.3114
+GAGAA 0.2681
+GAGAC 0.2255
+GAGAG 0.2829
+GAGAT 0.2236
+GAGCA 0.3038
+GAGCC 0.2329
+GAGCG 0.2189
+GAGCT 0.2444
+GAGGA 0.2459
+GAGGC 0.2257
+GAGGG 0.3107
+GAGGT 0.2177
+GAGTA 0.2015
+GAGTC 0.1962
+GAGTG 0.3202
+GAGTT 0.282
+GATAA 0.3284
+GATAC 0.1876
+GATAG 0.1697
+GATAT 0.3142
+GATCA 0.3166
+GATCC 0.2172
+GATCG 0.2164
+GATCT 0.2498
+GATGA 0.2789
+GATGC 0.1985
+GATGG 0.2376
+GATGT 0.285
+GATTA 0.2275
+GATTC 0.1929
+GATTG 0.2408
+GATTT 0.3387
+GCAAA 0.3092
+GCAAC 0.2212
+GCAAG 0.2121
+GCAAT 0.2575
+GCACA 0.3395
+GCACC 0.2135
+GCACG 0.2224
+GCACT 0.2246
+GCAGA 0.216
+GCAGC 0.3029
+GCAGG 0.2143
+GCAGT 0.2668
+GCATA 0.1871
+GCATC 0.2144
+GCATG 0.2643
+GCATT 0.3342
+GCCAA 0.2564
+GCCAC 0.3089
+GCCAG 0.2167
+GCCAT 0.2179
+GCCCA 0.2723
+GCCCC 0.2994
+GCCCG 0.1763
+GCCCT 0.252
+GCCGA 0.2225
+GCCGC 0.3062
+GCCGG 0.2009
+GCCGT 0.2704
+GCCTA 0.1464
+GCCTC 0.3002
+GCCTG 0.2645
+GCCTT 0.2889
+GCGAA 0.2125
+GCGAC 0.2293
+GCGAG 0.2999
+GCGAT 0.2584
+GCGCA 0.2577
+GCGCC 0.2246
+GCGCG 0.2834
+GCGCT 0.2343
+GCGGA 0.1882
+GCGGC 0.3092
+GCGGG 0.2467
+GCGGT 0.256
+GCGTA 0.1382
+GCGTC 0.2026
+GCGTG 0.3927
+GCGTT 0.2664
+GCTAA 0.3107
+GCTAC 0.2645
+GCTAG 0.1365
+GCTAT 0.2883
+GCTCA 0.2949
+GCTCC 0.247
+GCTCG 0.2098
+GCTCT 0.2483
+GCTGA 0.1841
+GCTGC 0.314
+GCTGG 0.2267
+GCTGT 0.2753
+GCTTA 0.164
+GCTTC 0.223
+GCTTG 0.275
+GCTTT 0.3379
+GGAAA 0.3335
+GGAAC 0.1723
+GGAAG 0.2259
+GGAAT 0.2682
+GGACA 0.3585
+GGACC 0.2111
+GGACG 0.2255
+GGACT 0.2048
+GGAGA 0.2709
+GGAGC 0.2011
+GGAGG 0.3444
+GGAGT 0.1837
+GGATA 0.2105
+GGATC 0.1696
+GGATG 0.2994
+GGATT 0.3205
+GGCAA 0.2694
+GGCAC 0.2367
+GGCAG 0.2791
+GGCAT 0.2147
+GGCCA 0.3401
+GGCCC 0.2102
+GGCCG 0.2141
+GGCCT 0.2356
+GGCGA 0.2711
+GGCGC 0.2193
+GGCGG 0.2926
+GGCGT 0.2171
+GGCTA 0.1681
+GGCTC 0.2339
+GGCTG 0.3442
+GGCTT 0.2537
+GGGAA 0.2862
+GGGAC 0.1651
+GGGAG 0.3433
+GGGAT 0.2054
+GGGCA 0.3104
+GGGCC 0.2261
+GGGCG 0.2157
+GGGCT 0.2478
+GGGGA 0.2016
+GGGGC 0.166
+GGGGG 0.4315
+GGGGT 0.2009
+GGGTA 0.1778
+GGGTC 0.1879
+GGGTG 0.3489
+GGGTT 0.2854
+GGTAA 0.3757
+GGTAC 0.1957
+GGTAG 0.2122
+GGTAT 0.2165
+GGTCA 0.3637
+GGTCC 0.1888
+GGTCG 0.2211
+GGTCT 0.2265
+GGTGA 0.2628
+GGTGC 0.1829
+GGTGG 0.3291
+GGTGT 0.2253
+GGTTA 0.2171
+GGTTC 0.2043
+GGTTG 0.2638
+GGTTT 0.3148
+GTAAA 0.3982
+GTAAC 0.1844
+GTAAG 0.1385
+GTAAT 0.2788
+GTACA 0.4202
+GTACC 0.1768
+GTACG 0.1719
+GTACT 0.231
+GTAGA 0.2606
+GTAGC 0.2369
+GTAGG 0.2509
+GTAGT 0.2517
+GTATA 0.2737
+GTATC 0.1447
+GTATG 0.2342
+GTATT 0.3474
+GTCAA 0.253
+GTCAC 0.3397
+GTCAG 0.1724
+GTCAT 0.2348
+GTCCA 0.3293
+GTCCC 0.237
+GTCCG 0.1649
+GTCCT 0.2688
+GTCGA 0.231
+GTCGC 0.2487
+GTCGG 0.2093
+GTCGT 0.311
+GTCTA 0.1477
+GTCTC 0.2948
+GTCTG 0.2884
+GTCTT 0.2691
+GTGAA 0.2719
+GTGAC 0.2806
+GTGAG 0.2163
+GTGAT 0.2313
+GTGCA 0.3268
+GTGCC 0.2078
+GTGCG 0.2084
+GTGCT 0.2571
+GTGGA 0.2255
+GTGGC 0.2413
+GTGGG 0.2484
+GTGGT 0.2847
+GTGTA 0.2133
+GTGTC 0.1623
+GTGTG 0.3435
+GTGTT 0.2809
+GTTAA 0.3588
+GTTAC 0.2143
+GTTAG 0.1494
+GTTAT 0.2775
+GTTCA 0.3464
+GTTCC 0.2049
+GTTCG 0.1711
+GTTCT 0.2776
+GTTGA 0.2471
+GTTGC 0.2227
+GTTGG 0.2102
+GTTGT 0.32
+GTTTA 0.2259
+GTTTC 0.1838
+GTTTG 0.2417
+GTTTT 0.3486
+TAAAA 0.3628
+TAAAC 0.1827
+TAAAG 0.1719
+TAAAT 0.2827
+TAACA 0.3869
+TAACC 0.2232
+TAACG 0.1659
+TAACT 0.2241
+TAAGA 0.2573
+TAAGC 0.2206
+TAAGG 0.2279
+TAAGT 0.2942
+TAATA 0.2765
+TAATC 0.163
+TAATG 0.2398
+TAATT 0.3207
+TACAA 0.2824
+TACAC 0.2436
+TACAG 0.2029
+TACAT 0.271
+TACCA 0.3276
+TACCC 0.245
+TACCG 0.1905
+TACCT 0.2369
+TACGA 0.2507
+TACGC 0.1803
+TACGG 0.2077
+TACGT 0.3613
+TACTA 0.1774
+TACTC 0.2187
+TACTG 0.2963
+TACTT 0.3077
+TAGAA 0.3283
+TAGAC 0.1791
+TAGAG 0.2222
+TAGAT 0.2705
+TAGCA 0.3361
+TAGCC 0.2398
+TAGCG 0.177
+TAGCT 0.2472
+TAGGA 0.2488
+TAGGC 0.2143
+TAGGG 0.2459
+TAGGT 0.2911
+TAGTA 0.2227
+TAGTC 0.1569
+TAGTG 0.3018
+TAGTT 0.3186
+TATAA 0.3024
+TATAC 0.2094
+TATAG 0.1435
+TATAT 0.3448
+TATCA 0.3429
+TATCC 0.2168
+TATCG 0.1774
+TATCT 0.2629
+TATGA 0.2548
+TATGC 0.2252
+TATGG 0.2119
+TATGT 0.3081
+TATTA 0.2311
+TATTC 0.1495
+TATTG 0.1981
+TATTT 0.4213
+TCAAA 0.3123
+TCAAC 0.2414
+TCAAG 0.1834
+TCAAT 0.2629
+TCACA 0.2874
+TCACC 0.2597
+TCACG 0.2412
+TCACT 0.2117
+TCAGA 0.2565
+TCAGC 0.2625
+TCAGG 0.2037
+TCAGT 0.2774
+TCATA 0.1827
+TCATC 0.2601
+TCATG 0.2287
+TCATT 0.3286
+TCCAA 0.2375
+TCCAC 0.3
+TCCAG 0.2115
+TCCAT 0.251
+TCCCA 0.2862
+TCCCC 0.315
+TCCCG 0.1482
+TCCCT 0.2507
+TCCGA 0.234
+TCCGC 0.2604
+TCCGG 0.205
+TCCGT 0.3006
+TCCTA 0.1528
+TCCTC 0.2939
+TCCTG 0.2909
+TCCTT 0.2623
+TCGAA 0.2304
+TCGAC 0.2474
+TCGAG 0.2286
+TCGAT 0.2936
+TCGCA 0.2601
+TCGCC 0.2706
+TCGCG 0.2159
+TCGCT 0.2534
+TCGGA 0.1966
+TCGGC 0.2612
+TCGGG 0.2427
+TCGGT 0.2995
+TCGTA 0.1695
+TCGTC 0.2427
+TCGTG 0.3475
+TCGTT 0.2404
+TCTAA 0.2954
+TCTAC 0.2655
+TCTAG 0.1556
+TCTAT 0.2834
+TCTCA 0.2706
+TCTCC 0.2746
+TCTCG 0.1728
+TCTCT 0.2821
+TCTGA 0.2188
+TCTGC 0.2722
+TCTGG 0.2152
+TCTGT 0.2938
+TCTTA 0.174
+TCTTC 0.2424
+TCTTG 0.2553
+TCTTT 0.3283
+TGAAA 0.3288
+TGAAC 0.1925
+TGAAG 0.2204
+TGAAT 0.2583
+TGACA 0.3029
+TGACC 0.2261
+TGACG 0.2317
+TGACT 0.2394
+TGAGA 0.275
+TGAGC 0.2473
+TGAGG 0.2219
+TGAGT 0.2558
+TGATA 0.2113
+TGATC 0.157
+TGATG 0.3538
+TGATT 0.2779
+TGCAA 0.2676
+TGCAC 0.222
+TGCAG 0.2555
+TGCAT 0.2549
+TGCCA 0.3444
+TGCCC 0.2389
+TGCCG 0.1832
+TGCCT 0.2335
+TGCGA 0.2363
+TGCGC 0.2281
+TGCGG 0.2261
+TGCGT 0.3095
+TGCTA 0.1549
+TGCTC 0.2007
+TGCTG 0.3838
+TGCTT 0.2606
+TGGAA 0.2847
+TGGAC 0.1868
+TGGAG 0.2759
+TGGAT 0.2525
+TGGCA 0.3042
+TGGCC 0.2488
+TGGCG 0.1791
+TGGCT 0.2679
+TGGGA 0.2375
+TGGGC 0.1958
+TGGGG 0.289
+TGGGT 0.2777
+TGGTA 0.1791
+TGGTC 0.1763
+TGGTG 0.385
+TGGTT 0.2596
+TGTAA 0.3054
+TGTAC 0.2275
+TGTAG 0.164
+TGTAT 0.303
+TGTCA 0.3314
+TGTCC 0.2181
+TGTCG 0.1735
+TGTCT 0.2769
+TGTGA 0.2126
+TGTGC 0.2126
+TGTGG 0.2197
+TGTGT 0.3551
+TGTTA 0.1993
+TGTTC 0.1522
+TGTTG 0.2839
+TGTTT 0.3646
+TTAAA 0.3809
+TTAAC 0.1933
+TTAAG 0.1464
+TTAAT 0.2795
+TTACA 0.3946
+TTACC 0.2375
+TTACG 0.1471
+TTACT 0.2208
+TTAGA 0.2682
+TTAGC 0.2574
+TTAGG 0.2024
+TTAGT 0.2719
+TTATA 0.2391
+TTATC 0.1532
+TTATG 0.1687
+TTATT 0.4389
+TTCAA 0.266
+TTCAC 0.2546
+TTCAG 0.1928
+TTCAT 0.2866
+TTCCA 0.3265
+TTCCC 0.2672
+TTCCG 0.1291
+TTCCT 0.2772
+TTCGA 0.2148
+TTCGC 0.2302
+TTCGG 0.229
+TTCGT 0.3259
+TTCTA 0.1877
+TTCTC 0.2428
+TTCTG 0.2567
+TTCTT 0.3129
+TTGAA 0.3047
+TTGAC 0.2242
+TTGAG 0.2273
+TTGAT 0.2437
+TTGCA 0.3638
+TTGCC 0.2184
+TTGCG 0.1562
+TTGCT 0.2616
+TTGGA 0.2319
+TTGGC 0.2602
+TTGGG 0.2244
+TTGGT 0.2835
+TTGTA 0.2232
+TTGTC 0.1706
+TTGTG 0.2934
+TTGTT 0.3128
+TTTAA 0.3338
+TTTAC 0.2185
+TTTAG 0.1332
+TTTAT 0.3145
+TTTCA 0.34
+TTTCC 0.2279
+TTTCG 0.1706
+TTTCT 0.2615
+TTTGA 0.2281
+TTTGC 0.222
+TTTGG 0.2037
+TTTGT 0.3462
+TTTTA 0.2563
+TTTTC 0.1648
+TTTTG 0.189
+TTTTT 0.3899
+[4]
+# (a,c,g,t)= (0.176, 0.324, 0.324, 0.176)
+#
+# Probabilities file for the intergenic region model
+#
+
+# k =
+4
+
+# The P_l's
+[P_ls]
+# l=
+0
+# Values
+A 0.252
+C 0.248
+G 0.248
+T 0.252
+# l=
+1
+# Values
+AA 0.0716
+AC 0.0648
+AG 0.0549
+AT 0.0605
+CA 0.0756
+CC 0.0642
+CG 0.0535
+CT 0.0549
+GA 0.0561
+GC 0.0631
+GG 0.0642
+GT 0.0648
+TA 0.0485
+TC 0.0561
+TG 0.0756
+TT 0.0716
+# l=
+2
+# Values
+AAA 0.024
+AAC 0.0161
+AAG 0.0133
+AAT 0.0182
+ACA 0.022
+ACC 0.0157
+ACG 0.0143
+ACT 0.0129
+AGA 0.0137
+AGC 0.0147
+AGG 0.0136
+AGT 0.0129
+ATA 0.0136
+ATC 0.0126
+ATG 0.0161
+ATT 0.0182
+CAA 0.0183
+CAC 0.0242
+CAG 0.017
+CAT 0.0161
+CCA 0.0185
+CCC 0.0193
+CCG 0.0127
+CCT 0.0136
+CGA 0.0119
+CGC 0.0146
+CGG 0.0127
+CGT 0.0142
+CTA 0.00821
+CTC 0.0164
+CTG 0.017
+CTT 0.0133
+GAA 0.014
+GAC 0.0131
+GAG 0.0164
+GAT 0.0125
+GCA 0.0182
+GCC 0.0155
+GCG 0.0146
+GCT 0.0147
+GGA 0.0136
+GGC 0.0155
+GGG 0.0193
+GGT 0.0157
+GTA 0.0114
+GTC 0.0131
+GTG 0.0242
+GTT 0.0161
+TAA 0.0152
+TAC 0.0114
+TAG 0.00821
+TAT 0.0136
+TCA 0.0169
+TCC 0.0136
+TCG 0.0119
+TCT 0.0137
+TGA 0.0169
+TGC 0.0182
+TGG 0.0185
+TGT 0.022
+TTA 0.0152
+TTC 0.014
+TTG 0.0183
+TTT 0.024
+# l=
+3
+# Values
+AAAA 0.00821
+AAAC 0.00524
+AAAG 0.0042
+AAAT 0.00635
+AACA 0.00607
+AACC 0.00367
+AACG 0.00313
+AACT 0.00319
+AAGA 0.00343
+AAGC 0.00328
+AAGG 0.00312
+AAGT 0.00347
+AATA 0.00499
+AATC 0.00342
+AATG 0.00492
+AATT 0.00486
+ACAA 0.0058
+ACAC 0.00691
+ACAG 0.00446
+ACAT 0.00483
+ACCA 0.00505
+ACCC 0.00443
+ACCG 0.00309
+ACCT 0.00315
+ACGA 0.00335
+ACGC 0.00355
+ACGG 0.0032
+ACGT 0.00415
+ACTA 0.00202
+ACTC 0.00357
+ACTG 0.00379
+ACTT 0.00347
+AGAA 0.00356
+AGAC 0.00314
+AGAG 0.0039
+AGAT 0.00306
+AGCA 0.00483
+AGCC 0.00344
+AGCG 0.0033
+AGCT 0.00317
+AGGA 0.00326
+AGGC 0.0032
+AGGG 0.00402
+AGGT 0.00315
+AGTA 0.00239
+AGTC 0.00271
+AGTG 0.00457
+AGTT 0.00319
+ATAA 0.00462
+ATAC 0.00281
+ATAG 0.00219
+ATAT 0.00401
+ATCA 0.00405
+ATCC 0.00264
+ATCG 0.0028
+ATCT 0.00306
+ATGA 0.00416
+ATGC 0.00348
+ATGG 0.00364
+ATGT 0.00483
+ATTA 0.00414
+ATTC 0.00342
+ATTG 0.00428
+ATTT 0.00635
+CAAA 0.00557
+CAAC 0.00483
+CAAG 0.00362
+CAAT 0.00428
+CACA 0.00758
+CACC 0.00646
+CACG 0.0056
+CACT 0.00457
+CAGA 0.00384
+CAGC 0.00548
+CAGG 0.00387
+CAGT 0.00379
+CATA 0.00274
+CATC 0.0046
+CATG 0.00386
+CATT 0.00492
+CCAA 0.00406
+CCAC 0.00678
+CCAG 0.00399
+CCAT 0.00364
+CCCA 0.00476
+CCCC 0.00716
+CCCG 0.00339
+CCCT 0.00402
+CCGA 0.00274
+CCGC 0.00391
+CCGG 0.00289
+CCGT 0.0032
+CCTA 0.00197
+CCTC 0.00468
+CCTG 0.00387
+CCTT 0.00312
+CGAA 0.00244
+CGAC 0.00313
+CGAG 0.00355
+CGAT 0.0028
+CGCA 0.00363
+CGCC 0.0039
+CGCG 0.00377
+CGCT 0.0033
+CGGA 0.00231
+CGGC 0.00395
+CGGG 0.00339
+CGGT 0.00309
+CGTA 0.00213
+CGTC 0.0034
+CGTG 0.0056
+CGTT 0.00313
+CTAA 0.00224
+CTAC 0.00253
+CTAG 0.00125
+CTAT 0.00219
+CTCA 0.00409
+CTCC 0.00486
+CTCG 0.00355
+CTCT 0.0039
+CTGA 0.0031
+CTGC 0.00544
+CTGG 0.00399
+CTGT 0.00446
+CTTA 0.00219
+CTTC 0.0033
+CTTG 0.00362
+CTTT 0.0042
+GAAA 0.00436
+GAAC 0.00295
+GAAG 0.0033
+GAAT 0.00342
+GACA 0.00397
+GACC 0.00305
+GACG 0.0034
+GACT 0.00271
+GAGA 0.00428
+GAGC 0.00387
+GAGG 0.00468
+GAGT 0.00357
+GATA 0.00235
+GATC 0.00217
+GATG 0.0046
+GATT 0.00342
+GCAA 0.00429
+GCAC 0.005
+GCAG 0.00544
+GCAT 0.00348
+GCCA 0.00465
+GCCC 0.00373
+GCCG 0.00395
+GCCT 0.0032
+GCGA 0.00332
+GCGC 0.00381
+GCGG 0.00391
+GCGT 0.00355
+GCTA 0.00211
+GCTC 0.00387
+GCTG 0.00548
+GCTT 0.00329
+GGAA 0.00344
+GGAC 0.00267
+GGAG 0.00486
+GGAT 0.00264
+GGCA 0.00416
+GGCC 0.00403
+GGCG 0.0039
+GGCT 0.00344
+GGGA 0.00402
+GGGC 0.00373
+GGGG 0.00716
+GGGT 0.00443
+GGTA 0.00254
+GGTC 0.00305
+GGTG 0.00646
+GGTT 0.00367
+GTAA 0.0033
+GTAC 0.00277
+GTAG 0.00253
+GTAT 0.00281
+GTCA 0.0042
+GTCC 0.00267
+GTCG 0.00313
+GTCT 0.00314
+GTGA 0.00551
+GTGC 0.005
+GTGG 0.00678
+GTGT 0.00691
+GTTA 0.00304
+GTTC 0.00295
+GTTG 0.00483
+GTTT 0.00524
+TAAA 0.00586
+TAAC 0.00304
+TAAG 0.00219
+TAAT 0.00414
+TACA 0.00436
+TACC 0.00254
+TACG 0.00213
+TACT 0.00239
+TAGA 0.00211
+TAGC 0.00211
+TAGG 0.00197
+TAGT 0.00202
+TATA 0.00355
+TATC 0.00235
+TATG 0.00274
+TATT 0.00499
+TCAA 0.00415
+TCAC 0.00551
+TCAG 0.0031
+TCAT 0.00417
+TCCA 0.00402
+TCCC 0.00402
+TCCG 0.00231
+TCCT 0.00326
+TCGA 0.00251
+TCGC 0.00332
+TCGG 0.00274
+TCGT 0.00335
+TCTA 0.00211
+TCTC 0.00428
+TCTG 0.00384
+TCTT 0.00343
+TGAA 0.0046
+TGAC 0.0042
+TGAG 0.00409
+TGAT 0.00405
+TGCA 0.00559
+TGCC 0.00417
+TGCG 0.00362
+TGCT 0.00483
+TGGA 0.00402
+TGGC 0.00465
+TGGG 0.00476
+TGGT 0.00505
+TGTA 0.00436
+TGTC 0.00398
+TGTG 0.00758
+TGTT 0.00608
+TTAA 0.00507
+TTAC 0.0033
+TTAG 0.00224
+TTAT 0.00461
+TTCA 0.0046
+TTCC 0.00344
+TTCG 0.00244
+TTCT 0.00356
+TTGA 0.00416
+TTGC 0.00429
+TTGG 0.00406
+TTGT 0.00579
+TTTA 0.00586
+TTTC 0.00436
+TTTG 0.00557
+TTTT 0.00821
+# l=
+4
+# Values
+AAAAA 0.0032
+AAAAC 0.00171
+AAAAG 0.00112
+AAAAT 0.00218
+AAACA 0.00207
+AAACC 0.00109
+AAACG 0.00103
+AAACT 0.00106
+AAAGA 0.0011
+AAAGC 0.001
+AAAGG 0.000898
+AAAGT 0.0012
+AAATA 0.00211
+AAATC 0.00111
+AAATG 0.00169
+AAATT 0.00145
+AACAA 0.00174
+AACAC 0.00167
+AACAG 0.00109
+AACAT 0.00158
+AACCA 0.00113
+AACCC 0.0011
+AACCG 0.000699
+AACCT 0.000736
+AACGA 0.000743
+AACGC 0.000814
+AACGG 0.000611
+AACGT 0.000959
+AACTA 0.000596
+AACTC 0.00087
+AACTG 0.000825
+AACTT 0.000898
+AAGAA 0.00106
+AAGAC 0.000734
+AAGAG 0.000884
+AAGAT 0.000757
+AAGCA 0.00104
+AAGCC 0.000757
+AAGCG 0.000675
+AAGCT 0.000818
+AAGGA 0.000718
+AAGGC 0.000832
+AAGGG 0.000856
+AAGGT 0.000717
+AAGTA 0.000671
+AAGTC 0.000757
+AAGTG 0.00115
+AAGTT 0.000898
+AATAA 0.002
+AATAC 0.000938
+AATAG 0.000615
+AATAT 0.00144
+AATCA 0.00104
+AATCC 0.000791
+AATCG 0.000809
+AATCT 0.000779
+AATGA 0.00127
+AATGC 0.00103
+AATGG 0.000918
+AATGT 0.0017
+AATTA 0.00133
+AATTC 0.000897
+AATTG 0.00119
+AATTT 0.00145
+ACAAA 0.00194
+ACAAC 0.00151
+ACAAG 0.00101
+ACAAT 0.00133
+ACACA 0.00294
+ACACC 0.00131
+ACACG 0.0015
+ACACT 0.00116
+ACAGA 0.00118
+ACAGC 0.00137
+ACAGG 0.000959
+ACAGT 0.000944
+ACATA 0.000859
+ACATC 0.00122
+ACATG 0.00105
+ACATT 0.0017
+ACCAA 0.00111
+ACCAC 0.00197
+ACCAG 0.00103
+ACCAT 0.000939
+ACCCA 0.00131
+ACCCC 0.0014
+ACCCG 0.000894
+ACCCT 0.00082
+ACCGA 0.000746
+ACCGC 0.000957
+ACCGG 0.00066
+ACCGT 0.000727
+ACCTA 0.000548
+ACCTC 0.000956
+ACCTG 0.000929
+ACCTT 0.000717
+ACGAA 0.000757
+ACGAC 0.000893
+ACGAG 0.000953
+ACGAT 0.000749
+ACGCA 0.00111
+ACGCC 0.00079
+ACGCG 0.00097
+ACGCT 0.000676
+ACGGA 0.000648
+ACGGC 0.000957
+ACGGG 0.00087
+ACGGT 0.000727
+ACGTA 0.00069
+ACGTC 0.000967
+ACGTG 0.00153
+ACGTT 0.000959
+ACTAA 0.000608
+ACTAC 0.000606
+ACTAG 0.000286
+ACTAT 0.000521
+ACTCA 0.00106
+ACTCC 0.000822
+ACTCG 0.000925
+ACTCT 0.000758
+ACTGA 0.000789
+ACTGC 0.00122
+ACTGG 0.000836
+ACTGT 0.000944
+ACTTA 0.000615
+ACTTC 0.000735
+ACTTG 0.000919
+ACTTT 0.0012
+AGAAA 0.0011
+AGAAC 0.000746
+AGAAG 0.000857
+AGAAT 0.000855
+AGACA 0.00112
+AGACC 0.00066
+AGACG 0.000745
+AGACT 0.000615
+AGAGA 0.00123
+AGAGC 0.000857
+AGAGG 0.00106
+AGAGT 0.000758
+AGATA 0.000609
+AGATC 0.000557
+AGATG 0.00112
+AGATT 0.000779
+AGCAA 0.00106
+AGCAC 0.00123
+AGCAG 0.00172
+AGCAT 0.000822
+AGCCA 0.00114
+AGCCC 0.000816
+AGCCG 0.000798
+AGCCT 0.00069
+AGCGA 0.000828
+AGCGC 0.000857
+AGCGG 0.00094
+AGCGT 0.000676
+AGCTA 0.000465
+AGCTC 0.000862
+AGCTG 0.00102
+AGCTT 0.000818
+AGGAA 0.000902
+AGGAC 0.000632
+AGGAG 0.00114
+AGGAT 0.000587
+AGGCA 0.000917
+AGGCC 0.000875
+AGGCG 0.000721
+AGGCT 0.00069
+AGGGA 0.000931
+AGGGC 0.000824
+AGGGG 0.00145
+AGGGT 0.00082
+AGGTA 0.000539
+AGGTC 0.000704
+AGGTG 0.00117
+AGGTT 0.000736
+AGTAA 0.000697
+AGTAC 0.000559
+AGTAG 0.000501
+AGTAT 0.000633
+AGTCA 0.000927
+AGTCC 0.000504
+AGTCG 0.000666
+AGTCT 0.000615
+AGTGA 0.00114
+AGTGC 0.000981
+AGTGG 0.00129
+AGTGT 0.00116
+AGTTA 0.000615
+AGTTC 0.00063
+AGTTG 0.000883
+AGTTT 0.00106
+ATAAA 0.00187
+ATAAC 0.000822
+ATAAG 0.000575
+ATAAT 0.00134
+ATACA 0.00125
+ATACC 0.000495
+ATACG 0.000434
+ATACT 0.000633
+ATAGA 0.000581
+ATAGC 0.000559
+ATAGG 0.000532
+ATAGT 0.000521
+ATATA 0.00117
+ATATC 0.000684
+ATATG 0.000723
+ATATT 0.00144
+ATCAA 0.000976
+ATCAC 0.00121
+ATCAG 0.000763
+ATCAT 0.0011
+ATCCA 0.000907
+ATCCC 0.000726
+ATCCG 0.000418
+ATCCT 0.000587
+ATCGA 0.000692
+ATCGC 0.000755
+ATCGG 0.000605
+ATCGT 0.000749
+ATCTA 0.000541
+ATCTC 0.000938
+ATCTG 0.000826
+ATCTT 0.000757
+ATGAA 0.00129
+ATGAC 0.000887
+ATGAG 0.000892
+ATGAT 0.0011
+ATGCA 0.00127
+ATGCC 0.000721
+ATGCG 0.000671
+ATGCT 0.000822
+ATGGA 0.000912
+ATGGC 0.000872
+ATGGG 0.00092
+ATGGT 0.000939
+ATGTA 0.00108
+ATGTC 0.000793
+ATGTG 0.00137
+ATGTT 0.00158
+ATTAA 0.00137
+ATTAC 0.000865
+ATTAG 0.000564
+ATTAT 0.00134
+ATTCA 0.00111
+ATTCC 0.000904
+ATTCG 0.00055
+ATTCT 0.000855
+ATTGA 0.00101
+ATTGC 0.000978
+ATTGG 0.000964
+ATTGT 0.00133
+ATTTA 0.0016
+ATTTC 0.00111
+ATTTG 0.00146
+ATTTT 0.00218
+CAAAA 0.00158
+CAAAC 0.00136
+CAAAG 0.00117
+CAAAT 0.00146
+CAACA 0.00199
+CAACC 0.00105
+CAACG 0.000905
+CAACT 0.000883
+CAAGA 0.000907
+CAAGC 0.000992
+CAAGG 0.000806
+CAAGT 0.000919
+CAATA 0.000979
+CAATC 0.000861
+CAATG 0.00125
+CAATT 0.00119
+CACAA 0.00185
+CACAC 0.0028
+CACAG 0.00155
+CACAT 0.00137
+CACCA 0.00235
+CACCC 0.00164
+CACCG 0.00129
+CACCT 0.00117
+CACGA 0.00123
+CACGC 0.00152
+CACGG 0.00132
+CACGT 0.00153
+CACTA 0.000687
+CACTC 0.0013
+CACTG 0.00143
+CACTT 0.00115
+CAGAA 0.000934
+CAGAC 0.000957
+CAGAG 0.00112
+CAGAT 0.000826
+CAGCA 0.00211
+CAGCC 0.00127
+CAGCG 0.00108
+CAGCT 0.00102
+CAGGA 0.000966
+CAGGC 0.000891
+CAGGG 0.00108
+CAGGT 0.000929
+CAGTA 0.000687
+CAGTC 0.000853
+CAGTG 0.00143
+CAGTT 0.000825
+CATAA 0.000824
+CATAC 0.000675
+CATAG 0.000521
+CATAT 0.000723
+CATCA 0.00165
+CATCC 0.000859
+CATCG 0.000977
+CATCT 0.00112
+CATGA 0.000886
+CATGC 0.00097
+CATGG 0.000948
+CATGT 0.00105
+CATTA 0.000972
+CATTC 0.00101
+CATTG 0.00125
+CATTT 0.00169
+CCAAA 0.00117
+CCAAC 0.00109
+CCAAG 0.000834
+CCAAT 0.000964
+CCACA 0.00166
+CCACC 0.00236
+CCACG 0.00147
+CCACT 0.00129
+CCAGA 0.000828
+CCAGC 0.00128
+CCAGG 0.00104
+CCAGT 0.000836
+CCATA 0.000627
+CCATC 0.00115
+CCATG 0.000948
+CCATT 0.000918
+CCCAA 0.001
+CCCAC 0.00177
+CCCAG 0.00106
+CCCAT 0.00092
+CCCCA 0.00149
+CCCCC 0.00317
+CCCCG 0.00106
+CCCCT 0.00145
+CCCGA 0.00072
+CCCGC 0.001
+CCCGG 0.0008
+CCCGT 0.00087
+CCCTA 0.000555
+CCCTC 0.00153
+CCCTG 0.00108
+CCCTT 0.000856
+CCGAA 0.00059
+CCGAC 0.000697
+CCGAG 0.000844
+CCGAT 0.000605
+CCGCA 0.000853
+CCGCC 0.00121
+CCGCG 0.000915
+CCGCT 0.00094
+CCGGA 0.000513
+CCGGC 0.00092
+CCGGG 0.0008
+CCGGT 0.00066
+CCGTA 0.00047
+CCGTC 0.000804
+CCGTG 0.00132
+CCGTT 0.000611
+CCTAA 0.000475
+CCTAC 0.000635
+CCTAG 0.000326
+CCTAT 0.000532
+CCTCA 0.000932
+CCTCC 0.0017
+CCTCG 0.000988
+CCTCT 0.00106
+CCTGA 0.000658
+CCTGC 0.00121
+CCTGG 0.00104
+CCTGT 0.000959
+CCTTA 0.000537
+CCTTC 0.000881
+CCTTG 0.000806
+CCTTT 0.000898
+CGAAA 0.000816
+CGAAC 0.000581
+CGAAG 0.000493
+CGAAT 0.00055
+CGACA 0.000798
+CGACC 0.000779
+CGACG 0.000888
+CGACT 0.000666
+CGAGA 0.000733
+CGAGC 0.000902
+CGAGG 0.000988
+CGAGT 0.000925
+CGATA 0.000492
+CGATC 0.000522
+CGATG 0.000977
+CGATT 0.000809
+CGCAA 0.0008
+CGCAC 0.00123
+CGCAG 0.00092
+CGCAT 0.000671
+CGCCA 0.00101
+CGCCC 0.00098
+CGCCG 0.00119
+CGCCT 0.000721
+CGCGA 0.000757
+CGCGC 0.00112
+CGCGG 0.000915
+CGCGT 0.00097
+CGCTA 0.000468
+CGCTC 0.00108
+CGCTG 0.00108
+CGCTT 0.000675
+CGGAA 0.000498
+CGGAC 0.000504
+CGGAG 0.00089
+CGGAT 0.000418
+CGGCA 0.000932
+CGGCC 0.00104
+CGGCG 0.00119
+CGGCT 0.000798
+CGGGA 0.000682
+CGGGC 0.000761
+CGGGG 0.00106
+CGGGT 0.000894
+CGGTA 0.000496
+CGGTC 0.0006
+CGGTG 0.00129
+CGGTT 0.000699
+CGTAA 0.00053
+CGTAC 0.000605
+CGTAG 0.00056
+CGTAT 0.000434
+CGTCA 0.00109
+CGTCC 0.000679
+CGTCG 0.000888
+CGTCT 0.000745
+CGTGA 0.00135
+CGTGC 0.00127
+CGTGG 0.00147
+CGTGT 0.0015
+CGTTA 0.000542
+CGTTC 0.000656
+CGTTG 0.000905
+CGTTT 0.00103
+CTAAA 0.000781
+CTAAC 0.000528
+CTAAG 0.000363
+CTAAT 0.000564
+CTACA 0.00083
+CTACC 0.000638
+CTACG 0.00056
+CTACT 0.000501
+CTAGA 0.000333
+CTAGC 0.000306
+CTAGG 0.000326
+CTAGT 0.000286
+CTATA 0.000581
+CTATC 0.000475
+CTATG 0.000521
+CTATT 0.000615
+CTCAA 0.00103
+CTCAC 0.00144
+CTCAG 0.000721
+CTCAT 0.000892
+CTCCA 0.00131
+CTCCC 0.00152
+CTCCG 0.00089
+CTCCT 0.00114
+CTCGA 0.000612
+CTCGC 0.00114
+CTCGG 0.000844
+CTCGT 0.000953
+CTCTA 0.000515
+CTCTC 0.00138
+CTCTG 0.00112
+CTCTT 0.000884
+CTGAA 0.000888
+CTGAC 0.000727
+CTGAG 0.000721
+CTGAT 0.000763
+CTGCA 0.00153
+CTGCC 0.00127
+CTGCG 0.00092
+CTGCT 0.00172
+CTGGA 0.000855
+CTGGC 0.00103
+CTGGG 0.00106
+CTGGT 0.00103
+CTGTA 0.000945
+CTGTC 0.000868
+CTGTG 0.00155
+CTGTT 0.00109
+CTTAA 0.000752
+CTTAC 0.000497
+CTTAG 0.000363
+CTTAT 0.000575
+CTTCA 0.00109
+CTTCC 0.000858
+CTTCG 0.000493
+CTTCT 0.000857
+CTTGA 0.000795
+CTTGC 0.00098
+CTTGG 0.000834
+CTTGT 0.00101
+CTTTA 0.00101
+CTTTC 0.000904
+CTTTG 0.00117
+CTTTT 0.00112
+GAAAA 0.00136
+GAAAC 0.000989
+GAAAG 0.000904
+GAAAT 0.00111
+GAACA 0.000893
+GAACC 0.000771
+GAACG 0.000656
+GAACT 0.00063
+GAAGA 0.000889
+GAAGC 0.000793
+GAAGG 0.000881
+GAAGT 0.000735
+GAATA 0.000778
+GAATC 0.000743
+GAATG 0.00101
+GAATT 0.000897
+GACAA 0.00104
+GACAC 0.00127
+GACAG 0.000868
+GACAT 0.000793
+GACCA 0.000842
+GACCC 0.000907
+GACCG 0.0006
+GACCT 0.000704
+GACGA 0.000882
+GACGC 0.000745
+GACGG 0.000804
+GACGT 0.000967
+GACTA 0.000324
+GACTC 0.000777
+GACTG 0.000853
+GACTT 0.000757
+GAGAA 0.000938
+GAGAC 0.00103
+GAGAG 0.00138
+GAGAT 0.000938
+GAGCA 0.00104
+GAGCC 0.000884
+GAGCG 0.00108
+GAGCT 0.000862
+GAGGA 0.00114
+GAGGC 0.00105
+GAGGG 0.00153
+GAGGT 0.000956
+GAGTA 0.000619
+GAGTC 0.000777
+GAGTG 0.0013
+GAGTT 0.00087
+GATAA 0.00072
+GATAC 0.000471
+GATAG 0.000475
+GATAT 0.000684
+GATCA 0.000603
+GATCC 0.000493
+GATCG 0.000522
+GATCT 0.000557
+GATGA 0.00134
+GATGC 0.000893
+GATGG 0.00115
+GATGT 0.00122
+GATTA 0.000714
+GATTC 0.000743
+GATTG 0.000861
+GATTT 0.00111
+GCAAA 0.00123
+GCAAC 0.0011
+GCAAG 0.00098
+GCAAT 0.000978
+GCACA 0.00155
+GCACC 0.0012
+GCACG 0.00127
+GCACT 0.000981
+GCAGA 0.00107
+GCAGC 0.00193
+GCAGG 0.00121
+GCAGT 0.00122
+GCATA 0.000588
+GCATC 0.000893
+GCATG 0.00097
+GCATT 0.00103
+GCCAA 0.0011
+GCCAC 0.00165
+GCCAG 0.00103
+GCCAT 0.000872
+GCCCA 0.000939
+GCCCC 0.0012
+GCCCG 0.000761
+GCCCT 0.000824
+GCCGA 0.000768
+GCCGC 0.00131
+GCCGG 0.00092
+GCCGT 0.000957
+GCCTA 0.000433
+GCCTC 0.00105
+GCCTG 0.000891
+GCCTT 0.000832
+GCGAA 0.000588
+GCGAC 0.000836
+GCGAG 0.00114
+GCGAT 0.000755
+GCGCA 0.000892
+GCGCC 0.000941
+GCGCG 0.00112
+GCGCT 0.000857
+GCGGA 0.000648
+GCGGC 0.00131
+GCGGG 0.001
+GCGGT 0.000957
+GCGTA 0.000468
+GCGTC 0.000745
+GCGTG 0.00152
+GCGTT 0.000814
+GCTAA 0.000582
+GCTAC 0.000659
+GCTAG 0.000306
+GCTAT 0.000559
+GCTCA 0.00106
+GCTCC 0.00105
+GCTCG 0.000902
+GCTCT 0.000857
+GCTGA 0.000894
+GCTGC 0.00193
+GCTGG 0.00128
+GCTGT 0.00137
+GCTTA 0.000496
+GCTTC 0.000793
+GCTTG 0.000992
+GCTTT 0.001
+GGAAA 0.00104
+GGAAC 0.000632
+GGAAG 0.000858
+GGAAT 0.000904
+GGACA 0.000883
+GGACC 0.000603
+GGACG 0.000679
+GGACT 0.000504
+GGAGA 0.00129
+GGAGC 0.00105
+GGAGG 0.0017
+GGAGT 0.000822
+GGATA 0.000496
+GGATC 0.000493
+GGATG 0.000859
+GGATT 0.000791
+GGCAA 0.00107
+GGCAC 0.0011
+GGCAG 0.00127
+GGCAT 0.000721
+GGCCA 0.00124
+GGCCC 0.00087
+GGCCG 0.00104
+GGCCT 0.000875
+GGCGA 0.000964
+GGCGC 0.000941
+GGCGG 0.00121
+GGCGT 0.00079
+GGCTA 0.00053
+GGCTC 0.000884
+GGCTG 0.00127
+GGCTT 0.000757
+GGGAA 0.000996
+GGGAC 0.000776
+GGGAG 0.00152
+GGGAT 0.000726
+GGGCA 0.00106
+GGGCC 0.00087
+GGGCG 0.00098
+GGGCT 0.000816
+GGGGA 0.00139
+GGGGC 0.0012
+GGGGG 0.00317
+GGGGT 0.0014
+GGGTA 0.000774
+GGGTC 0.000907
+GGGTG 0.00164
+GGGTT 0.0011
+GGTAA 0.000818
+GGTAC 0.000592
+GGTAG 0.000638
+GGTAT 0.000495
+GGTCA 0.00101
+GGTCC 0.000603
+GGTCG 0.000779
+GGTCT 0.00066
+GGTGA 0.00159
+GGTGC 0.0012
+GGTGG 0.00236
+GGTGT 0.00131
+GGTTA 0.000763
+GGTTC 0.000771
+GGTTG 0.00105
+GGTTT 0.00109
+GTAAA 0.0013
+GTAAC 0.000645
+GTAAG 0.000497
+GTAAT 0.000865
+GTACA 0.00102
+GTACC 0.000592
+GTACG 0.000605
+GTACT 0.000559
+GTAGA 0.000628
+GTAGC 0.000659
+GTAGG 0.000635
+GTAGT 0.000606
+GTATA 0.00073
+GTATC 0.000471
+GTATG 0.000675
+GTATT 0.000938
+GTCAA 0.001
+GTCAC 0.00158
+GTCAG 0.000727
+GTCAT 0.000887
+GTCCA 0.000757
+GTCCC 0.000776
+GTCCG 0.000504
+GTCCT 0.000632
+GTCGA 0.000704
+GTCGC 0.000836
+GTCGG 0.000697
+GTCGT 0.000893
+GTCTA 0.000424
+GTCTC 0.00103
+GTCTG 0.000957
+GTCTT 0.000734
+GTGAA 0.00127
+GTGAC 0.00158
+GTGAG 0.00144
+GTGAT 0.00121
+GTGCA 0.00143
+GTGCC 0.0011
+GTGCG 0.00123
+GTGCT 0.00123
+GTGGA 0.00139
+GTGGC 0.00165
+GTGGG 0.00177
+GTGGT 0.00197
+GTGTA 0.00118
+GTGTC 0.00127
+GTGTG 0.0028
+GTGTT 0.00167
+GTTAA 0.00105
+GTTAC 0.000645
+GTTAG 0.000528
+GTTAT 0.000822
+GTTCA 0.000991
+GTTCC 0.000632
+GTTCG 0.000581
+GTTCT 0.000746
+GTTGA 0.00112
+GTTGC 0.0011
+GTTGG 0.00109
+GTTGT 0.00151
+GTTTA 0.00118
+GTTTC 0.000989
+GTTTG 0.00136
+GTTTT 0.00171
+TAAAA 0.00206
+TAAAC 0.00118
+TAAAG 0.00101
+TAAAT 0.0016
+TAACA 0.00112
+TAACC 0.000763
+TAACG 0.000542
+TAACT 0.000615
+TAAGA 0.00054
+TAAGC 0.000496
+TAAGG 0.000537
+TAAGT 0.000615
+TAATA 0.00113
+TAATC 0.000714
+TAATG 0.000972
+TAATT 0.00133
+TACAA 0.00116
+TACAC 0.00118
+TACAG 0.000945
+TACAT 0.00108
+TACCA 0.000731
+TACCC 0.000774
+TACCG 0.000496
+TACCT 0.000539
+TACGA 0.000502
+TACGC 0.000468
+TACGG 0.00047
+TACGT 0.00069
+TACTA 0.000412
+TACTC 0.000619
+TACTG 0.000687
+TACTT 0.000671
+TAGAA 0.000632
+TAGAC 0.000424
+TAGAG 0.000515
+TAGAT 0.000541
+TAGCA 0.000643
+TAGCC 0.00053
+TAGCG 0.000468
+TAGCT 0.000465
+TAGGA 0.000431
+TAGGC 0.000433
+TAGGG 0.000555
+TAGGT 0.000548
+TAGTA 0.000412
+TAGTC 0.000324
+TAGTG 0.000687
+TAGTT 0.000596
+TATAA 0.00107
+TATAC 0.00073
+TATAG 0.000581
+TATAT 0.00117
+TATCA 0.000754
+TATCC 0.000496
+TATCG 0.000492
+TATCT 0.000609
+TATGA 0.00067
+TATGC 0.000588
+TATGG 0.000627
+TATGT 0.000859
+TATTA 0.00113
+TATTC 0.000778
+TATTG 0.000979
+TATTT 0.00211
+TCAAA 0.00123
+TCAAC 0.00112
+TCAAG 0.000795
+TCAAT 0.00101
+TCACA 0.00143
+TCACC 0.00159
+TCACG 0.00135
+TCACT 0.00114
+TCAGA 0.000758
+TCAGC 0.000894
+TCAGG 0.000658
+TCAGT 0.000789
+TCATA 0.00067
+TCATC 0.00134
+TCATG 0.000886
+TCATT 0.00127
+TCCAA 0.000859
+TCCAC 0.00139
+TCCAG 0.000855
+TCCAT 0.000912
+TCCCA 0.00101
+TCCCC 0.00139
+TCCCG 0.000682
+TCCCT 0.000931
+TCCGA 0.000502
+TCCGC 0.000648
+TCCGG 0.000513
+TCCGT 0.000648
+TCCTA 0.000431
+TCCTC 0.00114
+TCCTG 0.000966
+TCCTT 0.000718
+TCGAA 0.000506
+TCGAC 0.000704
+TCGAG 0.000612
+TCGAT 0.000692
+TCGCA 0.000769
+TCGCC 0.000964
+TCGCG 0.000757
+TCGCT 0.000828
+TCGGA 0.000502
+TCGGC 0.000768
+TCGGG 0.00072
+TCGGT 0.000746
+TCGTA 0.000502
+TCGTC 0.000882
+TCGTG 0.00123
+TCGTT 0.000743
+TCTAA 0.00057
+TCTAC 0.000628
+TCTAG 0.000333
+TCTAT 0.000581
+TCTCA 0.00104
+TCTCC 0.00129
+TCTCG 0.000733
+TCTCT 0.00123
+TCTGA 0.000758
+TCTGC 0.00107
+TCTGG 0.000828
+TCTGT 0.00118
+TCTTA 0.00054
+TCTTC 0.000889
+TCTTG 0.000907
+TCTTT 0.0011
+TGAAA 0.0014
+TGAAC 0.000991
+TGAAG 0.00109
+TGAAT 0.00111
+TGACA 0.00117
+TGACC 0.00101
+TGACG 0.00109
+TGACT 0.000927
+TGAGA 0.00104
+TGAGC 0.00106
+TGAGG 0.000932
+TGAGT 0.00106
+TGATA 0.000754
+TGATC 0.000603
+TGATG 0.00165
+TGATT 0.00104
+TGCAA 0.00136
+TGCAC 0.00143
+TGCAG 0.00153
+TGCAT 0.00127
+TGCCA 0.00125
+TGCCC 0.00106
+TGCCG 0.000932
+TGCCT 0.000917
+TGCGA 0.000769
+TGCGC 0.000892
+TGCGG 0.000853
+TGCGT 0.00111
+TGCTA 0.000643
+TGCTC 0.00104
+TGCTG 0.00211
+TGCTT 0.00104
+TGGAA 0.00104
+TGGAC 0.000757
+TGGAG 0.00131
+TGGAT 0.000907
+TGGCA 0.00125
+TGGCC 0.00124
+TGGCG 0.00101
+TGGCT 0.00114
+TGGGA 0.00101
+TGGGC 0.000939
+TGGGG 0.00149
+TGGGT 0.00131
+TGGTA 0.000731
+TGGTC 0.000842
+TGGTG 0.00235
+TGGTT 0.00113
+TGTAA 0.00126
+TGTAC 0.00102
+TGTAG 0.00083
+TGTAT 0.00125
+TGTCA 0.00117
+TGTCC 0.000883
+TGTCG 0.000798
+TGTCT 0.00112
+TGTGA 0.00143
+TGTGC 0.00155
+TGTGG 0.00166
+TGTGT 0.00294
+TGTTA 0.00112
+TGTTC 0.000893
+TGTTG 0.00199
+TGTTT 0.00207
+TTAAA 0.00191
+TTAAC 0.00105
+TTAAG 0.000752
+TTAAT 0.00137
+TTACA 0.00126
+TTACC 0.000818
+TTACG 0.00053
+TTACT 0.000697
+TTAGA 0.00057
+TTAGC 0.000582
+TTAGG 0.000475
+TTAGT 0.000608
+TTATA 0.00107
+TTATC 0.00072
+TTATG 0.000824
+TTATT 0.002
+TTCAA 0.00115
+TTCAC 0.00127
+TTCAG 0.000888
+TTCAT 0.00129
+TTCCA 0.00104
+TTCCC 0.000996
+TTCCG 0.000498
+TTCCT 0.000902
+TTCGA 0.000506
+TTCGC 0.000588
+TTCGG 0.00059
+TTCGT 0.000757
+TTCTA 0.000632
+TTCTC 0.000938
+TTCTG 0.000934
+TTCTT 0.00106
+TTGAA 0.00115
+TTGAC 0.001
+TTGAG 0.00103
+TTGAT 0.000976
+TTGCA 0.00136
+TTGCC 0.00107
+TTGCG 0.0008
+TTGCT 0.00106
+TTGGA 0.000859
+TTGGC 0.0011
+TTGGG 0.001
+TTGGT 0.00111
+TTGTA 0.00116
+TTGTC 0.00104
+TTGTG 0.00185
+TTGTT 0.00174
+TTTAA 0.00191
+TTTAC 0.0013
+TTTAG 0.000781
+TTTAT 0.00187
+TTTCA 0.0014
+TTTCC 0.00104
+TTTCG 0.000816
+TTTCT 0.0011
+TTTGA 0.00123
+TTTGC 0.00123
+TTTGG 0.00117
+TTTGT 0.00194
+TTTTA 0.00206
+TTTTC 0.00136
+TTTTG 0.00158
+TTTTT 0.0032
+
+[EMISSION]
+
+# Vector size (4^(k+1))
+1024
+# Probabilities
+AAAAA 0.3899
+AAAAC 0.1992
+AAAAG 0.1365
+AAAAT 0.2744
+AAACA 0.4132
+AAACC 0.1889
+AAACG 0.183
+AAACT 0.2149
+AAAGA 0.257
+AAAGC 0.2407
+AAAGG 0.2064
+AAAGT 0.2959
+AAATA 0.3354
+AAATC 0.1615
+AAATG 0.2714
+AAATT 0.2317
+AACAA 0.306
+AACAC 0.2481
+AACAG 0.1696
+AACAT 0.2763
+AACCA 0.3392
+AACCC 0.281
+AACCG 0.1497
+AACCT 0.2301
+AACGA 0.2427
+AACGC 0.2372
+AACGG 0.172
+AACGT 0.3481
+AACTA 0.2026
+AACTC 0.2442
+AACTG 0.2602
+AACTT 0.293
+AAGAA 0.3337
+AAGAC 0.1989
+AAGAG 0.2426
+AAGAT 0.2248
+AAGCA 0.3457
+AAGCC 0.2213
+AAGCG 0.1756
+AAGCT 0.2574
+AAGGA 0.2471
+AAGGC 0.2445
+AAGGG 0.2617
+AAGGT 0.2467
+AAGTA 0.221
+AAGTC 0.2029
+AAGTG 0.3124
+AAGTT 0.2638
+AATAA 0.3917
+AATAC 0.1876
+AATAG 0.1247
+AATAT 0.2961
+AATCA 0.3133
+AATCC 0.2294
+AATCG 0.2139
+AATCT 0.2434
+AATGA 0.246
+AATGC 0.2159
+AATGG 0.1792
+AATGT 0.359
+AATTA 0.2777
+AATTC 0.181
+AATTG 0.2397
+AATTT 0.3016
+ACAAA 0.3378
+ACAAC 0.2227
+ACAAG 0.175
+ACAAT 0.2646
+ACACA 0.4064
+ACACC 0.1885
+ACACG 0.1996
+ACACT 0.2055
+ACAGA 0.2581
+ACAGC 0.2941
+ACAGG 0.2059
+ACAGT 0.2419
+ACATA 0.1788
+ACATC 0.2151
+ACATG 0.218
+ACATT 0.3881
+ACCAA 0.2539
+ACCAC 0.3313
+ACCAG 0.2078
+ACCAT 0.207
+ACCCA 0.3162
+ACCCC 0.2966
+ACCCG 0.1709
+ACCCT 0.2162
+ACCGA 0.2799
+ACCGC 0.2781
+ACCGG 0.1885
+ACCGT 0.2534
+ACCTA 0.1816
+ACCTC 0.2644
+ACCTG 0.2878
+ACCTT 0.2661
+ACGAA 0.26
+ACGAC 0.2478
+ACGAG 0.2542
+ACGAT 0.238
+ACGCA 0.3336
+ACGCC 0.2121
+ACGCG 0.2445
+ACGCT 0.2099
+ACGGA 0.2255
+ACGGC 0.2833
+ACGGG 0.249
+ACGGT 0.2421
+ACGTA 0.1847
+ACGTC 0.2208
+ACGTG 0.3339
+ACGTT 0.2607
+ACTAA 0.3071
+ACTAC 0.263
+ACTAG 0.1427
+ACTAT 0.2872
+ACTCA 0.3004
+ACTCC 0.2222
+ACTCG 0.2359
+ACTCT 0.2416
+ACTGA 0.2197
+ACTGC 0.3122
+ACTGG 0.2126
+ACTGT 0.2556
+ACTTA 0.1916
+ACTTC 0.1964
+ACTTG 0.2479
+ACTTT 0.3641
+AGAAA 0.3273
+AGAAC 0.1997
+AGAAG 0.226
+AGAAT 0.247
+AGACA 0.3656
+AGACC 0.2033
+AGACG 0.2176
+AGACT 0.2135
+AGAGA 0.3008
+AGAGC 0.2185
+AGAGG 0.2648
+AGAGT 0.2159
+AGATA 0.2153
+AGATC 0.1646
+AGATG 0.3332
+AGATT 0.2869
+AGCAA 0.2569
+AGCAC 0.2332
+AGCAG 0.3013
+AGCAT 0.2087
+AGCCA 0.367
+AGCCC 0.2307
+AGCCG 0.1875
+AGCCT 0.2148
+AGCGA 0.2719
+AGCGC 0.2448
+AGCGG 0.2533
+AGCGT 0.23
+AGCTA 0.1694
+AGCTC 0.2399
+AGCTG 0.3023
+AGCTT 0.2884
+AGGAA 0.3126
+AGGAC 0.1972
+AGGAG 0.2892
+AGGAT 0.2009
+AGGCA 0.3086
+AGGCC 0.2577
+AGGCG 0.1992
+AGGCT 0.2345
+AGGGA 0.2444
+AGGGC 0.2129
+AGGGG 0.3196
+AGGGT 0.2231
+AGGTA 0.1945
+AGGTC 0.2041
+AGGTG 0.337
+AGGTT 0.2643
+AGTAA 0.3064
+AGTAC 0.2243
+AGTAG 0.182
+AGTAT 0.2872
+AGTCA 0.378
+AGTCC 0.1797
+AGTCG 0.2089
+AGTCT 0.2334
+AGTGA 0.2415
+AGTGC 0.2169
+AGTGG 0.2647
+AGTGT 0.277
+AGTTA 0.2137
+AGTTC 0.1771
+AGTTG 0.2581
+AGTTT 0.3511
+ATAAA 0.4034
+ATAAC 0.168
+ATAAG 0.1278
+ATAAT 0.3008
+ATACA 0.4551
+ATACC 0.1591
+ATACG 0.1452
+ATACT 0.2406
+ATAGA 0.2737
+ATAGC 0.254
+ATAGG 0.2019
+ATAGT 0.2704
+ATATA 0.2961
+ATATC 0.1592
+ATATG 0.1844
+ATATT 0.3603
+ATCAA 0.2639
+ATCAC 0.2686
+ATCAG 0.1894
+ATCAT 0.2781
+ATCCA 0.3739
+ATCCC 0.2477
+ATCCG 0.1485
+ATCCT 0.23
+ATCGA 0.2566
+ATCGC 0.2623
+ATCGG 0.2016
+ATCGT 0.2795
+ATCTA 0.1968
+ATCTC 0.2579
+ATCTG 0.277
+ATCTT 0.2683
+ATGAA 0.3342
+ATGAC 0.2118
+ATGAG 0.1924
+ATGAT 0.2615
+ATGCA 0.4018
+ATGCC 0.2018
+ATGCG 0.15
+ATGCT 0.2464
+ATGGA 0.2708
+ATGGC 0.2443
+ATGGG 0.2296
+ATGGT 0.2553
+ATGTA 0.2478
+ATGTC 0.1623
+ATGTG 0.2632
+ATGTT 0.3267
+ATTAA 0.3355
+ATTAC 0.2094
+ATTAG 0.1339
+ATTAT 0.3211
+ATTCA 0.3511
+ATTCC 0.241
+ATTCG 0.1485
+ATTCT 0.2594
+ATTGA 0.2358
+ATTGC 0.2271
+ATTGG 0.2041
+ATTGT 0.333
+ATTTA 0.2575
+ATTTC 0.1687
+ATTTG 0.2201
+ATTTT 0.3537
+CAAAA 0.3058
+CAAAC 0.2234
+CAAAG 0.1946
+CAAAT 0.2762
+CAACA 0.4171
+CAACC 0.2051
+CAACG 0.173
+CAACT 0.2048
+CAAGA 0.26
+CAAGC 0.2548
+CAAGG 0.2231
+CAAGT 0.2621
+CAATA 0.243
+CAATC 0.177
+CAATG 0.2962
+CAATT 0.2838
+CACAA 0.2841
+CACAC 0.3003
+CACAG 0.1954
+CACAT 0.2202
+CACCA 0.3604
+CACCC 0.2461
+CACCG 0.1835
+CACCT 0.2101
+CACGA 0.2393
+CACGC 0.2385
+CACGG 0.2182
+CACGT 0.304
+CACTA 0.1582
+CACTC 0.2286
+CACTG 0.3271
+CACTT 0.2861
+CAGAA 0.2813
+CAGAC 0.219
+CAGAG 0.2614
+CAGAT 0.2384
+CAGCA 0.3911
+CAGCC 0.2306
+CAGCG 0.1711
+CAGCT 0.2072
+CAGGA 0.2666
+CAGGC 0.2179
+CAGGG 0.2559
+CAGGT 0.2597
+CAGTA 0.2107
+CAGTC 0.2038
+CAGTG 0.3536
+CAGTT 0.2319
+CATAA 0.2924
+CATAC 0.2456
+CATAG 0.1676
+CATAT 0.2943
+CATCA 0.3569
+CATCC 0.1917
+CATCG 0.1985
+CATCT 0.2529
+CATGA 0.2452
+CATGC 0.2445
+CATGG 0.2215
+CATGT 0.2888
+CATTA 0.209
+CATTC 0.1836
+CATTG 0.2518
+CATTT 0.3556
+CCAAA 0.3139
+CCAAC 0.2311
+CCAAG 0.199
+CCAAT 0.2561
+CCACA 0.276
+CCACC 0.3023
+CCACG 0.206
+CCACT 0.2156
+CCAGA 0.2267
+CCAGC 0.2903
+CCAGG 0.2419
+CCAGT 0.2411
+CCATA 0.1854
+CCATC 0.2703
+CCATG 0.2522
+CCATT 0.2921
+CCCAA 0.2341
+CCCAC 0.3366
+CCCAG 0.2125
+CCCAT 0.2168
+CCCCA 0.2229
+CCCCC 0.4314
+CCCCG 0.1359
+CCCCT 0.2098
+CCCGA 0.2364
+CCCGC 0.2794
+CCCGG 0.2125
+CCCGT 0.2717
+CCCTA 0.1399
+CCCTC 0.344
+CCCTG 0.2586
+CCCTT 0.2574
+CCGAA 0.2503
+CCGAC 0.2284
+CCGAG 0.2863
+CCGAT 0.235
+CCGCA 0.2534
+CCGCC 0.2972
+CCGCG 0.2091
+CCGCT 0.2403
+CCGGA 0.2081
+CCGGC 0.2847
+CCGGG 0.2635
+CCGGT 0.2437
+CCGTA 0.1718
+CCGTC 0.232
+CCGTG 0.3877
+CCGTT 0.2085
+CCTAA 0.2733
+CCTAC 0.3134
+CCTAG 0.1569
+CCTAT 0.2564
+CCTCA 0.218
+CCTCC 0.3485
+CCTCG 0.1855
+CCTCT 0.248
+CCTGA 0.1914
+CCTGC 0.2975
+CCTGG 0.253
+CCTGT 0.2581
+CCTTA 0.1792
+CCTTC 0.2594
+CCTTG 0.2548
+CCTTT 0.3065
+CGAAA 0.3618
+CGAAC 0.2086
+CGAAG 0.19
+CGAAT 0.2396
+CGACA 0.2692
+CGACC 0.2333
+CGACG 0.2729
+CGACT 0.2246
+CGAGA 0.2368
+CGAGC 0.2374
+CGAGG 0.2548
+CGAGT 0.271
+CGATA 0.1812
+CGATC 0.1779
+CGATG 0.3263
+CGATT 0.3146
+CGCAA 0.2467
+CGCAC 0.3039
+CGCAG 0.245
+CGCAT 0.2043
+CGCCA 0.2862
+CGCCC 0.2343
+CGCCG 0.2668
+CGCCT 0.2127
+CGCGA 0.228
+CGCGC 0.2914
+CGCGG 0.2169
+CGCGT 0.2637
+CGCTA 0.155
+CGCTC 0.2746
+CGCTG 0.319
+CGCTT 0.2514
+CGGAA 0.2433
+CGGAC 0.2021
+CGGAG 0.338
+CGGAT 0.2167
+CGGCA 0.2601
+CGGCC 0.2517
+CGGCG 0.2683
+CGGCT 0.22
+CGGGA 0.2135
+CGGGC 0.2201
+CGGGG 0.3059
+CGGGT 0.2605
+CGGTA 0.2021
+CGGTC 0.1953
+CGGTG 0.3803
+CGGTT 0.2222
+CGTAA 0.2851
+CGTAC 0.2331
+CGTAG 0.2397
+CGTAT 0.242
+CGTCA 0.3466
+CGTCC 0.1875
+CGTCG 0.2405
+CGTCT 0.2254
+CGTGA 0.2719
+CGTGC 0.2122
+CGTGG 0.25
+CGTGT 0.2659
+CGTTA 0.1888
+CGTTC 0.1945
+CGTTG 0.2602
+CGTTT 0.3566
+CTAAA 0.3744
+CTAAC 0.1982
+CTAAG 0.1525
+CTAAT 0.2749
+CTACA 0.3527
+CTACC 0.2232
+CTACG 0.2059
+CTACT 0.2183
+CTAGA 0.2844
+CTAGC 0.2276
+CTAGG 0.2338
+CTAGT 0.2543
+CTATA 0.2645
+CTATC 0.1845
+CTATG 0.2253
+CTATT 0.3256
+CTCAA 0.2883
+CTCAC 0.2942
+CTCAG 0.1779
+CTCAT 0.2397
+CTCCA 0.2949
+CTCCC 0.2988
+CTCCG 0.1672
+CTCCT 0.2391
+CTCGA 0.1906
+CTCGC 0.2904
+CTCGG 0.2341
+CTCGT 0.2849
+CTCTA 0.1495
+CTCTC 0.3017
+CTCTG 0.2809
+CTCTT 0.2679
+CTGAA 0.3207
+CTGAC 0.2217
+CTGAG 0.2037
+CTGAT 0.2539
+CTGCA 0.3354
+CTGCC 0.2185
+CTGCG 0.1498
+CTGCT 0.2963
+CTGGA 0.2396
+CTGGC 0.2551
+CTGGG 0.2363
+CTGGT 0.269
+CTGTA 0.2449
+CTGTC 0.1822
+CTGTG 0.3082
+CTGTT 0.2647
+CTTAA 0.3581
+CTTAC 0.2122
+CTTAG 0.1515
+CTTAT 0.2782
+CTTCA 0.3493
+CTTCC 0.2367
+CTTCG 0.1372
+CTTCT 0.2768
+CTTGA 0.2252
+CTTGC 0.2561
+CTTGG 0.2171
+CTTGT 0.3016
+CTTTA 0.2542
+CTTTC 0.2082
+CTTTG 0.2518
+CTTTT 0.2857
+GAAAA 0.3295
+GAAAC 0.21
+GAAAG 0.1989
+GAAAT 0.2617
+GAACA 0.3427
+GAACC 0.2435
+GAACG 0.1983
+GAACT 0.2155
+GAAGA 0.2779
+GAAGC 0.2326
+GAAGG 0.2557
+GAAGT 0.2338
+GAATA 0.2429
+GAATC 0.1876
+GAATG 0.2858
+GAATT 0.2837
+GACAA 0.2958
+GACAC 0.2541
+GACAG 0.2069
+GACAT 0.2432
+GACCA 0.318
+GACCC 0.2553
+GACCG 0.1816
+GACCT 0.2452
+GACGA 0.2688
+GACGC 0.1979
+GACGG 0.2099
+GACGT 0.3234
+GACTA 0.1378
+GACTC 0.2347
+GACTG 0.316
+GACTT 0.3114
+GAGAA 0.2681
+GAGAC 0.2255
+GAGAG 0.2829
+GAGAT 0.2236
+GAGCA 0.3038
+GAGCC 0.2329
+GAGCG 0.2189
+GAGCT 0.2444
+GAGGA 0.2459
+GAGGC 0.2257
+GAGGG 0.3107
+GAGGT 0.2177
+GAGTA 0.2015
+GAGTC 0.1962
+GAGTG 0.3202
+GAGTT 0.282
+GATAA 0.3284
+GATAC 0.1876
+GATAG 0.1697
+GATAT 0.3142
+GATCA 0.3166
+GATCC 0.2172
+GATCG 0.2164
+GATCT 0.2498
+GATGA 0.2789
+GATGC 0.1985
+GATGG 0.2376
+GATGT 0.285
+GATTA 0.2275
+GATTC 0.1929
+GATTG 0.2408
+GATTT 0.3387
+GCAAA 0.3092
+GCAAC 0.2212
+GCAAG 0.2121
+GCAAT 0.2575
+GCACA 0.3395
+GCACC 0.2135
+GCACG 0.2224
+GCACT 0.2246
+GCAGA 0.216
+GCAGC 0.3029
+GCAGG 0.2143
+GCAGT 0.2668
+GCATA 0.1871
+GCATC 0.2144
+GCATG 0.2643
+GCATT 0.3342
+GCCAA 0.2564
+GCCAC 0.3089
+GCCAG 0.2167
+GCCAT 0.2179
+GCCCA 0.2723
+GCCCC 0.2994
+GCCCG 0.1763
+GCCCT 0.252
+GCCGA 0.2225
+GCCGC 0.3062
+GCCGG 0.2009
+GCCGT 0.2704
+GCCTA 0.1464
+GCCTC 0.3002
+GCCTG 0.2645
+GCCTT 0.2889
+GCGAA 0.2125
+GCGAC 0.2293
+GCGAG 0.2999
+GCGAT 0.2584
+GCGCA 0.2577
+GCGCC 0.2246
+GCGCG 0.2834
+GCGCT 0.2343
+GCGGA 0.1882
+GCGGC 0.3092
+GCGGG 0.2467
+GCGGT 0.256
+GCGTA 0.1382
+GCGTC 0.2026
+GCGTG 0.3927
+GCGTT 0.2664
+GCTAA 0.3107
+GCTAC 0.2645
+GCTAG 0.1365
+GCTAT 0.2883
+GCTCA 0.2949
+GCTCC 0.247
+GCTCG 0.2098
+GCTCT 0.2483
+GCTGA 0.1841
+GCTGC 0.314
+GCTGG 0.2267
+GCTGT 0.2753
+GCTTA 0.164
+GCTTC 0.223
+GCTTG 0.275
+GCTTT 0.3379
+GGAAA 0.3335
+GGAAC 0.1723
+GGAAG 0.2259
+GGAAT 0.2682
+GGACA 0.3585
+GGACC 0.2111
+GGACG 0.2255
+GGACT 0.2048
+GGAGA 0.2709
+GGAGC 0.2011
+GGAGG 0.3444
+GGAGT 0.1837
+GGATA 0.2105
+GGATC 0.1696
+GGATG 0.2994
+GGATT 0.3205
+GGCAA 0.2694
+GGCAC 0.2367
+GGCAG 0.2791
+GGCAT 0.2147
+GGCCA 0.3401
+GGCCC 0.2102
+GGCCG 0.2141
+GGCCT 0.2356
+GGCGA 0.2711
+GGCGC 0.2193
+GGCGG 0.2926
+GGCGT 0.2171
+GGCTA 0.1681
+GGCTC 0.2339
+GGCTG 0.3442
+GGCTT 0.2537
+GGGAA 0.2862
+GGGAC 0.1651
+GGGAG 0.3433
+GGGAT 0.2054
+GGGCA 0.3104
+GGGCC 0.2261
+GGGCG 0.2157
+GGGCT 0.2478
+GGGGA 0.2016
+GGGGC 0.166
+GGGGG 0.4315
+GGGGT 0.2009
+GGGTA 0.1778
+GGGTC 0.1879
+GGGTG 0.3489
+GGGTT 0.2854
+GGTAA 0.3757
+GGTAC 0.1957
+GGTAG 0.2122
+GGTAT 0.2165
+GGTCA 0.3637
+GGTCC 0.1888
+GGTCG 0.2211
+GGTCT 0.2265
+GGTGA 0.2628
+GGTGC 0.1829
+GGTGG 0.3291
+GGTGT 0.2253
+GGTTA 0.2171
+GGTTC 0.2043
+GGTTG 0.2638
+GGTTT 0.3148
+GTAAA 0.3982
+GTAAC 0.1844
+GTAAG 0.1385
+GTAAT 0.2788
+GTACA 0.4202
+GTACC 0.1768
+GTACG 0.1719
+GTACT 0.231
+GTAGA 0.2606
+GTAGC 0.2369
+GTAGG 0.2509
+GTAGT 0.2517
+GTATA 0.2737
+GTATC 0.1447
+GTATG 0.2342
+GTATT 0.3474
+GTCAA 0.253
+GTCAC 0.3397
+GTCAG 0.1724
+GTCAT 0.2348
+GTCCA 0.3293
+GTCCC 0.237
+GTCCG 0.1649
+GTCCT 0.2688
+GTCGA 0.231
+GTCGC 0.2487
+GTCGG 0.2093
+GTCGT 0.311
+GTCTA 0.1477
+GTCTC 0.2948
+GTCTG 0.2884
+GTCTT 0.2691
+GTGAA 0.2719
+GTGAC 0.2806
+GTGAG 0.2163
+GTGAT 0.2313
+GTGCA 0.3268
+GTGCC 0.2078
+GTGCG 0.2084
+GTGCT 0.2571
+GTGGA 0.2255
+GTGGC 0.2413
+GTGGG 0.2484
+GTGGT 0.2847
+GTGTA 0.2133
+GTGTC 0.1623
+GTGTG 0.3435
+GTGTT 0.2809
+GTTAA 0.3588
+GTTAC 0.2143
+GTTAG 0.1494
+GTTAT 0.2775
+GTTCA 0.3464
+GTTCC 0.2049
+GTTCG 0.1711
+GTTCT 0.2776
+GTTGA 0.2471
+GTTGC 0.2227
+GTTGG 0.2102
+GTTGT 0.32
+GTTTA 0.2259
+GTTTC 0.1838
+GTTTG 0.2417
+GTTTT 0.3486
+TAAAA 0.3628
+TAAAC 0.1827
+TAAAG 0.1719
+TAAAT 0.2827
+TAACA 0.3869
+TAACC 0.2232
+TAACG 0.1659
+TAACT 0.2241
+TAAGA 0.2573
+TAAGC 0.2206
+TAAGG 0.2279
+TAAGT 0.2942
+TAATA 0.2765
+TAATC 0.163
+TAATG 0.2398
+TAATT 0.3207
+TACAA 0.2824
+TACAC 0.2436
+TACAG 0.2029
+TACAT 0.271
+TACCA 0.3276
+TACCC 0.245
+TACCG 0.1905
+TACCT 0.2369
+TACGA 0.2507
+TACGC 0.1803
+TACGG 0.2077
+TACGT 0.3613
+TACTA 0.1774
+TACTC 0.2187
+TACTG 0.2963
+TACTT 0.3077
+TAGAA 0.3283
+TAGAC 0.1791
+TAGAG 0.2222
+TAGAT 0.2705
+TAGCA 0.3361
+TAGCC 0.2398
+TAGCG 0.177
+TAGCT 0.2472
+TAGGA 0.2488
+TAGGC 0.2143
+TAGGG 0.2459
+TAGGT 0.2911
+TAGTA 0.2227
+TAGTC 0.1569
+TAGTG 0.3018
+TAGTT 0.3186
+TATAA 0.3024
+TATAC 0.2094
+TATAG 0.1435
+TATAT 0.3448
+TATCA 0.3429
+TATCC 0.2168
+TATCG 0.1774
+TATCT 0.2629
+TATGA 0.2548
+TATGC 0.2252
+TATGG 0.2119
+TATGT 0.3081
+TATTA 0.2311
+TATTC 0.1495
+TATTG 0.1981
+TATTT 0.4213
+TCAAA 0.3123
+TCAAC 0.2414
+TCAAG 0.1834
+TCAAT 0.2629
+TCACA 0.2874
+TCACC 0.2597
+TCACG 0.2412
+TCACT 0.2117
+TCAGA 0.2565
+TCAGC 0.2625
+TCAGG 0.2037
+TCAGT 0.2774
+TCATA 0.1827
+TCATC 0.2601
+TCATG 0.2287
+TCATT 0.3286
+TCCAA 0.2375
+TCCAC 0.3
+TCCAG 0.2115
+TCCAT 0.251
+TCCCA 0.2862
+TCCCC 0.315
+TCCCG 0.1482
+TCCCT 0.2507
+TCCGA 0.234
+TCCGC 0.2604
+TCCGG 0.205
+TCCGT 0.3006
+TCCTA 0.1528
+TCCTC 0.2939
+TCCTG 0.2909
+TCCTT 0.2623
+TCGAA 0.2304
+TCGAC 0.2474
+TCGAG 0.2286
+TCGAT 0.2936
+TCGCA 0.2601
+TCGCC 0.2706
+TCGCG 0.2159
+TCGCT 0.2534
+TCGGA 0.1966
+TCGGC 0.2612
+TCGGG 0.2427
+TCGGT 0.2995
+TCGTA 0.1695
+TCGTC 0.2427
+TCGTG 0.3475
+TCGTT 0.2404
+TCTAA 0.2954
+TCTAC 0.2655
+TCTAG 0.1556
+TCTAT 0.2834
+TCTCA 0.2706
+TCTCC 0.2746
+TCTCG 0.1728
+TCTCT 0.2821
+TCTGA 0.2188
+TCTGC 0.2722
+TCTGG 0.2152
+TCTGT 0.2938
+TCTTA 0.174
+TCTTC 0.2424
+TCTTG 0.2553
+TCTTT 0.3283
+TGAAA 0.3288
+TGAAC 0.1925
+TGAAG 0.2204
+TGAAT 0.2583
+TGACA 0.3029
+TGACC 0.2261
+TGACG 0.2317
+TGACT 0.2394
+TGAGA 0.275
+TGAGC 0.2473
+TGAGG 0.2219
+TGAGT 0.2558
+TGATA 0.2113
+TGATC 0.157
+TGATG 0.3538
+TGATT 0.2779
+TGCAA 0.2676
+TGCAC 0.222
+TGCAG 0.2555
+TGCAT 0.2549
+TGCCA 0.3444
+TGCCC 0.2389
+TGCCG 0.1832
+TGCCT 0.2335
+TGCGA 0.2363
+TGCGC 0.2281
+TGCGG 0.2261
+TGCGT 0.3095
+TGCTA 0.1549
+TGCTC 0.2007
+TGCTG 0.3838
+TGCTT 0.2606
+TGGAA 0.2847
+TGGAC 0.1868
+TGGAG 0.2759
+TGGAT 0.2525
+TGGCA 0.3042
+TGGCC 0.2488
+TGGCG 0.1791
+TGGCT 0.2679
+TGGGA 0.2375
+TGGGC 0.1958
+TGGGG 0.289
+TGGGT 0.2777
+TGGTA 0.1791
+TGGTC 0.1763
+TGGTG 0.385
+TGGTT 0.2596
+TGTAA 0.3054
+TGTAC 0.2275
+TGTAG 0.164
+TGTAT 0.303
+TGTCA 0.3314
+TGTCC 0.2181
+TGTCG 0.1735
+TGTCT 0.2769
+TGTGA 0.2126
+TGTGC 0.2126
+TGTGG 0.2197
+TGTGT 0.3551
+TGTTA 0.1993
+TGTTC 0.1522
+TGTTG 0.2839
+TGTTT 0.3646
+TTAAA 0.3809
+TTAAC 0.1933
+TTAAG 0.1464
+TTAAT 0.2795
+TTACA 0.3946
+TTACC 0.2375
+TTACG 0.1471
+TTACT 0.2208
+TTAGA 0.2682
+TTAGC 0.2574
+TTAGG 0.2024
+TTAGT 0.2719
+TTATA 0.2391
+TTATC 0.1532
+TTATG 0.1687
+TTATT 0.4389
+TTCAA 0.266
+TTCAC 0.2546
+TTCAG 0.1928
+TTCAT 0.2866
+TTCCA 0.3265
+TTCCC 0.2672
+TTCCG 0.1291
+TTCCT 0.2772
+TTCGA 0.2148
+TTCGC 0.2302
+TTCGG 0.229
+TTCGT 0.3259
+TTCTA 0.1877
+TTCTC 0.2428
+TTCTG 0.2567
+TTCTT 0.3129
+TTGAA 0.3047
+TTGAC 0.2242
+TTGAG 0.2273
+TTGAT 0.2437
+TTGCA 0.3638
+TTGCC 0.2184
+TTGCG 0.1562
+TTGCT 0.2616
+TTGGA 0.2319
+TTGGC 0.2602
+TTGGG 0.2244
+TTGGT 0.2835
+TTGTA 0.2232
+TTGTC 0.1706
+TTGTG 0.2934
+TTGTT 0.3128
+TTTAA 0.3338
+TTTAC 0.2185
+TTTAG 0.1332
+TTTAT 0.3145
+TTTCA 0.34
+TTTCC 0.2279
+TTTCG 0.1706
+TTTCT 0.2615
+TTTGA 0.2281
+TTTGC 0.222
+TTTGG 0.2037
+TTTGT 0.3462
+TTTTA 0.2563
+TTTTC 0.1648
+TTTTG 0.189
+TTTTT 0.3899
diff --git a/config/species/japaneselamprey/japaneselamprey_intron_probs.pbl b/config/species/japaneselamprey/japaneselamprey_intron_probs.pbl
new file mode 100644
index 0000000..9ce607b
--- /dev/null
+++ b/config/species/japaneselamprey/japaneselamprey_intron_probs.pbl
@@ -0,0 +1,13746 @@
+#intron model parameters
+# begin of content independent part
+#
+# ASS probabilities
+#only nonpseudocount values are shown
+[ASS]
+# Size of vector
+256
+# c_ass (ASS count)
+2482
+# asspseudocount (added to all possible patterns, no matter if they occur)
+0.00788
+# Probabilities * 1000
+aaaa 4.03
+aaac 1.21
+aaat 0.808
+aaca 1.21
+aacc 0.406
+aacg 0.406
+aaga 1.21
+aagc 0.808
+aagg 0.808
+aagt 1.61
+aata 1.21
+aatc 0.808
+aatg 2.02
+aatt 0.406
+acaa 6.85
+acac 7.65
+acag 9.66
+acat 13.7
+acca 4.83
+accc 8.46
+accg 4.03
+acct 10.9
+acga 19.7
+acgc 16.1
+acgg 11.3
+acgt 25.4
+acta 1.21
+actc 4.43
+actg 9.66
+actt 4.03
+agaa 1.21
+agac 0.808
+agag 0.808
+agca 0.808
+agcc 0.808
+agcg 2.42
+agga 1.21
+aggc 0.808
+aggg 0.406
+aggt 0.808
+agtg 0.406
+ataa 1.21
+atac 0.808
+atca 0.406
+atcc 0.808
+atcg 0.808
+atct 0.406
+atga 1.21
+atgc 3.22
+atgg 2.02
+atgt 4.43
+attc 0.406
+attg 1.21
+attt 1.21
+caac 1.21
+caag 0.808
+caat 0.406
+caca 1.21
+cacg 0.406
+caga 0.808
+cagc 0.808
+cagg 2.42
+cagt 3.22
+catg 0.406
+ccaa 2.82
+ccac 6.04
+ccag 3.63
+ccat 5.64
+ccca 4.43
+cccc 4.03
+cccg 4.43
+ccct 10.1
+ccga 18.9
+ccgc 18.1
+ccgg 11.3
+ccgt 24.6
+ccta 2.02
+cctc 1.61
+cctg 4.83
+cctt 2.42
+cgaa 0.406
+cgat 0.808
+cgca 3.63
+cgcc 0.808
+cgcg 3.22
+cgga 0.808
+cggc 0.406
+cggg 0.406
+cggt 0.808
+cgtc 0.406
+cgtg 1.21
+cgtt 0.808
+ctaa 0.808
+ctac 0.406
+ctag 1.21
+ctat 2.02
+ctca 0.808
+ctct 0.808
+ctga 3.63
+ctgc 3.22
+ctgg 1.61
+ctgt 5.24
+ctta 0.406
+cttg 1.21
+gaaa 2.02
+gaac 0.406
+gaag 2.42
+gaca 0.406
+gacc 0.406
+gacg 0.808
+gact 0.808
+gagc 4.43
+gagg 3.22
+gagt 1.21
+gatc 0.406
+gatg 1.61
+gcaa 17.3
+gcac 19.7
+gcag 15.7
+gcat 18.5
+gcca 13.3
+gccc 13.3
+gccg 8.46
+gcct 18.9
+gcga 41.1
+gcgc 43.5
+gcgg 36.2
+gcgt 68.8
+gcta 4.83
+gctc 8.05
+gctg 12.9
+gctt 9.66
+ggaa 1.21
+ggac 2.02
+ggag 1.21
+ggca 0.808
+ggcg 0.808
+ggct 0.808
+ggga 0.406
+gggc 2.42
+gggg 2.02
+gggt 1.21
+ggta 0.406
+ggtc 1.61
+ggtg 0.406
+ggtt 0.406
+gtaa 1.61
+gtac 1.61
+gtag 4.03
+gtat 2.42
+gtca 2.02
+gtcc 1.61
+gtcg 1.21
+gtct 4.83
+gtga 7.25
+gtgc 4.03
+gtgg 6.44
+gtgt 10.9
+gtta 0.808
+gttc 1.21
+gttg 0.808
+gttt 0.406
+taaa 0.406
+taac 0.406
+taca 0.808
+tacg 0.406
+taga 0.406
+tagc 1.21
+tagg 1.61
+tagt 2.82
+tatc 0.808
+tatg 0.406
+tatt 0.406
+tcaa 7.25
+tcac 5.64
+tcag 8.86
+tcat 10.1
+tcca 2.82
+tccc 4.03
+tccg 2.42
+tcct 6.85
+tcga 14.5
+tcgc 11.3
+tcgg 12.9
+tcgt 22.5
+tcta 1.21
+tctc 2.42
+tctg 6.44
+tctt 3.22
+tgaa 1.21
+tgac 0.808
+tgag 0.808
+tgat 2.02
+tgca 1.21
+tgcc 0.808
+tgcg 2.02
+tgct 0.808
+tggg 0.406
+tggt 0.406
+tgtg 0.808
+tgtt 0.406
+ttaa 2.82
+ttac 2.82
+ttag 2.02
+ttat 2.82
+ttca 1.61
+ttcc 2.42
+ttcg 1.21
+ttct 2.42
+ttga 3.22
+ttgc 4.43
+ttgg 4.43
+ttgt 8.05
+tttc 0.406
+tttg 3.22
+tttt 3.63
+
+
+#
+# DSS probabilities
+#only nonpseudocount values are shown
+[DSS]
+# Size of vector
+4096
+# c_dss (DSS count)
+2482
+# dsspseudocount (added to all possible patterns, no matter if they occur)
+0.0005
+# Probabilities * 1000
+aaaaaa 0.0618
+aaaaac 0.0567
+aaaaag 4.41
+aaaaat 0.0618
+aaaaca 0.0259
+aaaacc 0.0259
+aaaacg 0.798
+aaaact 0.0284
+aaaaga 0.013
+aaaagc 0.0156
+aaaagg 0.416
+aaaagt 0.00533
+aaaata 0.0079
+aaaatc 0.013
+aaaatg 0.436
+aaaatt 0.0233
+aaacaa 0.0079
+aaacac 0.00533
+aaacag 0.0567
+aaacat 0.0079
+aaacca 0.00533
+aaaccc 0.00277
+aaaccg 0.0156
+aaacct 0.00533
+aaacga 0.000201
+aaacgc 0.0079
+aaacgg 0.0156
+aaacgt 0.00533
+aaacta 0.00533
+aaactc 0.00533
+aaactg 0.0182
+aaactt 0.000201
+aaagaa 0.0336
+aaagac 0.0387
+aaagag 1.42
+aaagat 0.0105
+aaagca 0.367
+aaagcc 0.0284
+aaagcg 0.09
+aaagct 0.0336
+aaagga 0.013
+aaaggc 0.0079
+aaaggg 0.0669
+aaaggt 0.000201
+aaagta 0.00533
+aaagtc 0.00277
+aaagtg 0.0643
+aaagtt 0.000201
+aaataa 0.364
+aaatac 0.00277
+aaatag 0.049
+aaatat 0.00533
+aaatca 0.0079
+aaatcc 0.00277
+aaatcg 0.013
+aaatct 0.00533
+aaatga 0.0079
+aaatgc 0.00277
+aaatgg 0.369
+aaatgt 0.00277
+aaatta 0.0079
+aaattc 0.00533
+aaattg 0.0207
+aaattt 0.000201
+aacaaa 0.0413
+aacaac 0.0387
+aacaag 1.23
+aacaat 0.757
+aacaca 0.0182
+aacacc 0.0284
+aacacg 0.418
+aacact 0.387
+aacaga 0.0079
+aacagc 0.0105
+aacagg 0.0284
+aacagt 0.0182
+aacata 0.013
+aacatc 0.0207
+aacatg 0.0567
+aacatt 0.382
+aaccaa 0.0105
+aaccac 0.0156
+aaccag 0.405
+aaccat 0.377
+aaccca 0.0105
+aacccc 0.00533
+aacccg 0.0233
+aaccct 0.0182
+aaccga 0.0105
+aaccgc 0.0156
+aaccgg 0.369
+aaccgt 0.721
+aaccta 0.357
+aacctc 0.0105
+aacctg 0.0233
+aacctt 0.013
+aacgaa 0.0413
+aacgac 0.413
+aacgag 3.08
+aacgat 0.0336
+aacgca 0.0207
+aacgcc 0.0438
+aacgcg 0.818
+aacgct 0.0387
+aacgga 0.0207
+aacggc 0.013
+aacggg 0.0874
+aacggt 0.0079
+aacgta 0.0105
+aacgtc 0.0105
+aacgtg 0.0797
+aacgtt 0.00277
+aactaa 0.00533
+aactac 0.00533
+aactag 0.0361
+aactat 0.0105
+aactca 0.000201
+aactcc 0.00277
+aactcg 0.013
+aactct 0.0105
+aactga 0.000201
+aactgc 0.000201
+aactgg 0.0105
+aactgt 0.0079
+aactta 0.00533
+aacttc 0.00277
+aacttg 0.013
+aacttt 0.00277
+aagaaa 3.79
+aagaac 3.1
+aagaag 7.99
+aagaat 3.77
+aagaca 1.95
+aagacc 3.05
+aagacg 3.91
+aagact 3.02
+aagaga 1.15
+aagagc 1.53
+aagagg 1.67
+aagagt 0.459
+aagata 0.48
+aagatc 1.56
+aagatg 5.25
+aagatt 2.62
+aagcaa 0.423
+aagcac 0.449
+aagcag 2.07
+aagcat 0.767
+aagcca 0.0464
+aagccc 0.434
+aagccg 1.57
+aagcct 0.787
+aagcga 0.0207
+aagcgc 0.398
+aagcgg 0.48
+aagcgt 0.0233
+aagcta 0.0336
+aagctc 0.749
+aagctg 2.29
+aagctt 0.049
+aaggaa 2.75
+aaggac 3.85
+aaggag 21.5
+aaggat 0.295
+aaggca 1.61
+aaggcc 3.77
+aaggcg 8.34
+aaggct 4.08
+aaggga 0.816
+aagggc 1.21
+aagggg 6.81
+aagggt 0.1
+aaggta 0.449
+aaggtc 0.498
+aaggtg 7.55
+aaggtt 0.108
+aagtaa 0.423
+aagtac 0.0643
+aagtag 0.97
+aagtat 0.4
+aagtca 0.0515
+aagtcc 0.416
+aagtcg 0.862
+aagtct 0.78
+aagtga 0.0233
+aagtgc 0.031
+aagtgg 0.821
+aagtgt 0.0207
+aagtta 0.377
+aagttc 0.0438
+aagttg 1.95
+aagttt 0.0464
+aataaa 0.0413
+aataac 0.0336
+aataag 1.92
+aataat 0.0464
+aataca 0.0182
+aatacc 0.0233
+aatacg 0.0669
+aatact 0.0259
+aataga 0.013
+aatagc 0.0105
+aatagg 0.0336
+aatagt 0.00277
+aatata 0.367
+aatatc 0.0207
+aatatg 0.416
+aatatt 0.0284
+aatcaa 0.00277
+aatcac 0.00533
+aatcag 0.0438
+aatcat 0.0079
+aatcca 0.00533
+aatccc 0.00277
+aatccg 0.013
+aatcct 0.00533
+aatcga 0.00277
+aatcgc 0.00533
+aatcgg 0.00533
+aatcgt 0.00533
+aatcta 0.00533
+aatctc 0.0105
+aatctg 0.0207
+aatctt 0.000201
+aatgaa 0.031
+aatgac 0.0438
+aatgag 1.67
+aatgat 0.013
+aatgca 0.0207
+aatgcc 0.031
+aatgcg 0.431
+aatgct 0.0361
+aatgga 0.364
+aatggc 0.013
+aatggg 0.0618
+aatggt 0.00533
+aatgta 0.0105
+aatgtc 0.00533
+aatgtg 0.072
+aatgtt 0.000201
+aattaa 0.0079
+aattac 0.00533
+aattag 0.031
+aattat 0.0079
+aattca 0.000201
+aattcc 0.00533
+aattcg 0.0079
+aattct 0.00533
+aattga 0.00277
+aattgc 0.00533
+aattgg 0.0105
+aattgt 0.000201
+aattta 0.0105
+aatttc 0.357
+aatttg 0.0207
+aatttt 0.00277
+acaaaa 0.0259
+acaaac 0.38
+acaaag 0.826
+acaaat 0.0182
+acaaca 0.00533
+acaacc 0.0156
+acaacg 0.398
+acaact 0.0105
+acaaga 0.0105
+acaagc 0.362
+acaagg 0.0336
+acaagt 0.00533
+acaata 0.0079
+acaatc 0.0156
+acaatg 0.372
+acaatt 0.00533
+acacaa 0.359
+acacac 0.367
+acacag 0.0413
+acacat 0.0079
+acacca 0.00533
+acaccc 0.0079
+acaccg 0.0079
+acacct 0.000201
+acacga 0.0079
+acacgc 0.0079
+acacgg 0.013
+acacgt 0.00277
+acacta 0.0079
+acactc 0.00533
+acactg 0.00533
+acactt 0.00277
+acagaa 0.0336
+acagac 0.0438
+acagag 3.35
+acagat 0.382
+acagca 0.0079
+acagcc 0.013
+acagcg 0.0567
+acagct 0.0079
+acagga 0.357
+acaggc 0.013
+acaggg 0.0387
+acaggt 0.00533
+acagta 0.0079
+acagtc 0.00533
+acagtg 0.0284
+acagtt 0.00277
+acataa 0.0079
+acatac 0.0079
+acatag 0.0361
+acatat 0.00277
+acatca 0.00277
+acatcc 0.00277
+acatcg 0.0105
+acatct 0.000201
+acatga 0.0105
+acatgc 0.0105
+acatgg 0.721
+acatgt 0.00533
+acatta 0.359
+acattc 0.359
+acattg 0.013
+acattt 0.0079
+accaaa 0.0207
+accaac 0.0361
+accaag 1.12
+accaat 0.0207
+accaca 0.0079
+accacc 0.0207
+accacg 0.754
+accact 0.0105
+accaga 0.00277
+accagc 0.013
+accagg 0.0284
+accagt 0.00277
+accata 0.00533
+accatc 0.362
+accatg 0.0233
+accatt 0.0079
+acccaa 0.0079
+acccac 0.364
+acccag 0.0182
+acccat 0.00533
+acccca 0.00277
+accccc 0.0182
+accccg 0.0182
+acccct 0.000201
+acccga 0.0079
+acccgc 0.362
+acccgg 0.367
+acccgt 0.013
+acccta 0.00533
+accctc 0.013
+accctg 0.0079
+accctt 0.000201
+accgaa 0.00277
+accgac 0.393
+accgag 0.157
+accgat 0.0079
+accgca 0.013
+accgcc 0.736
+accgcg 0.762
+accgct 0.0156
+accgga 0.0156
+accggc 0.0259
+accggg 0.372
+accggt 0.00533
+accgta 0.00533
+accgtc 0.375
+accgtg 0.0207
+accgtt 0.00277
+acctaa 0.00277
+acctac 0.00533
+acctag 0.0105
+acctat 0.000201
+acctca 0.000201
+acctcc 0.0079
+acctcg 0.013
+acctct 0.000201
+acctga 0.000201
+acctgc 0.00277
+acctgg 0.013
+acctgt 0.00277
+acctta 0.00277
+accttc 0.0079
+accttg 0.00277
+accttt 0.00277
+acgaaa 1.85
+acgaac 1.87
+acgaag 0.988
+acgaat 1.15
+acgaca 0.0669
+acgacc 0.795
+acgacg 1.91
+acgact 0.0567
+acgaga 0.387
+acgagc 0.403
+acgagg 0.777
+acgagt 0.382
+acgata 0.0284
+acgatc 0.0464
+acgatg 0.439
+acgatt 0.398
+acgcaa 0.0207
+acgcac 0.0438
+acgcag 0.459
+acgcat 0.0156
+acgcca 0.00533
+acgccc 0.0233
+acgccg 0.767
+acgcct 0.0105
+acgcga 0.00533
+acgcgc 0.013
+acgcgg 0.382
+acgcgt 0.00533
+acgcta 0.00277
+acgctc 0.0079
+acgctg 0.385
+acgctt 0.0105
+acggaa 0.0926
+acggac 1.19
+acggag 7.99
+acggat 0.0874
+acggca 0.0413
+acggcc 0.79
+acggcg 2.67
+acggct 0.0618
+acggga 0.0156
+acgggc 0.387
+acgggg 0.513
+acgggt 0.0079
+acggta 0.00533
+acggtc 0.0207
+acggtg 0.144
+acggtt 0.0079
+acgtaa 0.0233
+acgtac 0.0233
+acgtag 0.426
+acgtat 0.013
+acgtca 0.00533
+acgtcc 0.0156
+acgtcg 0.403
+acgtct 0.0105
+acgtga 0.00277
+acgtgc 0.00533
+acgtgg 0.031
+acgtgt 0.00277
+acgtta 0.00533
+acgttc 0.00277
+acgttg 0.0284
+acgttt 0.00533
+actaaa 0.0233
+actaac 0.0259
+actaag 1.14
+actaat 0.0182
+actaca 0.0105
+actacc 0.013
+actacg 0.408
+actact 0.364
+actaga 0.00533
+actagc 0.00533
+actagg 0.0182
+actagt 0.00533
+actata 0.364
+actatc 0.0105
+actatg 0.0233
+actatt 0.0079
+actcaa 0.00277
+actcac 0.013
+actcag 0.0233
+actcat 0.000201
+actcca 0.00277
+actccc 0.00277
+actccg 0.0105
+actcct 0.0079
+actcga 0.000201
+actcgc 0.00277
+actcgg 0.0079
+actcgt 0.00277
+actcta 0.00533
+actctc 0.00277
+actctg 0.00533
+actctt 0.000201
+actgaa 0.0156
+actgac 0.385
+actgag 1.59
+actgat 0.0233
+actgca 0.0105
+actgcc 0.0233
+actgcg 0.405
+actgct 0.721
+actgga 0.0105
+actggc 0.0105
+actggg 0.0233
+actggt 0.0105
+actgta 0.364
+actgtc 0.0105
+actgtg 0.377
+actgtt 0.0105
+acttaa 0.000201
+acttac 0.00533
+acttag 0.0259
+acttat 0.000201
+acttca 0.00533
+acttcc 0.000201
+acttcg 0.0105
+acttct 0.0079
+acttga 0.00277
+acttgc 0.00277
+acttgg 0.362
+acttgt 0.00277
+acttta 0.0105
+actttc 0.00533
+actttg 0.0079
+actttt 0.000201
+agaaaa 0.031
+agaaac 0.0336
+agaaag 2.59
+agaaat 0.031
+agaaca 0.0105
+agaacc 0.00277
+agaacg 0.405
+agaact 0.00277
+agaaga 0.357
+agaagc 0.00533
+agaagg 0.0361
+agaagt 0.00277
+agaata 0.00277
+agaatc 0.0079
+agaatg 0.0284
+agaatt 0.00277
+agacaa 0.00533
+agacac 0.00533
+agacag 0.0438
+agacat 0.000201
+agacca 0.0105
+agaccc 0.00533
+agaccg 0.00277
+agacct 0.000201
+agacga 0.00277
+agacgc 0.000201
+agacgg 0.00277
+agacgt 0.00277
+agacta 0.00277
+agactc 0.00277
+agactg 0.00277
+agactt 0.000201
+agagaa 0.375
+agagac 0.0284
+agagag 2.65
+agagat 0.0233
+agagca 0.0079
+agagcc 0.0079
+agagcg 0.0387
+agagct 0.000201
+agagga 0.0156
+agaggc 0.00533
+agaggg 0.0259
+agaggt 0.00277
+agagta 0.00277
+agagtc 0.000201
+agagtg 0.0233
+agagtt 0.000201
+agataa 0.0105
+agatac 0.000201
+agatag 0.0361
+agatat 0.000201
+agatca 0.00277
+agatcc 0.000201
+agatcg 0.00277
+agatct 0.000201
+agatga 0.00533
+agatgc 0.00277
+agatgg 0.013
+agatgt 0.0079
+agatta 0.00533
+agattc 0.00277
+agattg 0.00533
+agattt 0.000201
+agcaaa 0.0105
+agcaac 0.0156
+agcaag 0.428
+agcaat 0.0233
+agcaca 0.00533
+agcacc 0.0079
+agcacg 0.0284
+agcact 0.00533
+agcaga 0.0105
+agcagc 0.00533
+agcagg 0.364
+agcagt 0.0079
+agcata 0.00277
+agcatc 0.364
+agcatg 0.0105
+agcatt 0.0105
+agccaa 0.00533
+agccac 0.013
+agccag 0.0156
+agccat 0.00533
+agccca 0.362
+agcccc 0.367
+agcccg 0.00533
+agccct 0.0079
+agccga 0.0105
+agccgc 0.0105
+agccgg 0.0105
+agccgt 0.367
+agccta 0.00533
+agcctc 0.013
+agcctg 0.000201
+agcctt 0.00533
+agcgaa 0.013
+agcgac 0.0182
+agcgag 0.852
+agcgat 0.0105
+agcgca 0.0105
+agcgcc 0.0156
+agcgcg 0.0284
+agcgct 0.000201
+agcgga 0.718
+agcggc 0.0105
+agcggg 0.0233
+agcggt 0.013
+agcgta 0.00533
+agcgtc 0.013
+agcgtg 0.0156
+agcgtt 0.00277
+agctaa 0.00533
+agctac 0.000201
+agctag 0.0079
+agctat 0.00277
+agctca 0.00533
+agctcc 0.0079
+agctcg 0.00277
+agctct 0.00277
+agctga 0.0105
+agctgc 0.00533
+agctgg 0.013
+agctgt 0.364
+agctta 0.00533
+agcttc 0.00277
+agcttg 0.0079
+agcttt 0.00277
+aggaaa 1.17
+aggaac 1.52
+aggaag 2.76
+aggaat 1.86
+aggaca 0.403
+aggacc 0.0567
+aggacg 1.55
+aggact 0.0515
+aggaga 0.0284
+aggagc 0.031
+aggagg 0.426
+aggagt 0.0284
+aggata 0.0233
+aggatc 0.39
+aggatg 0.457
+aggatt 0.4
+aggcaa 0.0207
+aggcac 0.377
+aggcag 0.467
+aggcat 0.0233
+aggcca 0.013
+aggccc 0.0105
+aggccg 0.0413
+aggcct 0.0105
+aggcga 0.000201
+aggcgc 0.0105
+aggcgg 0.0182
+aggcgt 0.00277
+aggcta 0.000201
+aggctc 0.0182
+aggctg 0.0361
+aggctt 0.00277
+agggaa 0.0977
+agggac 0.48
+agggag 9.02
+agggat 0.0926
+agggca 0.0284
+agggcc 0.0567
+agggcg 1.6
+agggct 0.0387
+agggga 0.0182
+aggggc 0.382
+aggggg 0.518
+aggggt 0.0105
+agggta 0.0079
+agggtc 0.0156
+agggtg 0.852
+agggtt 0.0156
+aggtaa 0.726
+aggtac 0.0207
+aggtag 0.1
+aggtat 0.0207
+aggtca 0.364
+aggtcc 0.00533
+aggtcg 0.0541
+aggtct 0.0156
+aggtga 0.013
+aggtgc 0.00533
+aggtgg 0.372
+aggtgt 0.00533
+aggtta 0.0182
+aggttc 0.00533
+aggttg 0.385
+aggttt 0.0079
+agtaaa 0.013
+agtaac 0.0207
+agtaag 0.793
+agtaat 0.0207
+agtaca 0.0105
+agtacc 0.0105
+agtacg 0.0336
+agtact 0.00533
+agtaga 0.00277
+agtagc 0.013
+agtagg 0.0156
+agtagt 0.000201
+agtata 0.013
+agtatc 0.367
+agtatg 0.0156
+agtatt 0.00533
+agtcaa 0.00277
+agtcac 0.0105
+agtcag 0.0182
+agtcat 0.000201
+agtcca 0.362
+agtccc 0.013
+agtccg 0.00533
+agtcct 0.00277
+agtcga 0.00277
+agtcgc 0.0079
+agtcgg 0.00533
+agtcgt 0.00277
+agtcta 0.0079
+agtctc 0.362
+agtctg 0.0079
+agtctt 0.00277
+agtgaa 0.013
+agtgac 0.377
+agtgag 1.22
+agtgat 0.0105
+agtgca 0.00533
+agtgcc 0.377
+agtgcg 0.0336
+agtgct 0.0105
+agtgga 0.013
+agtggc 0.367
+agtggg 0.0207
+agtggt 0.0105
+agtgta 0.0105
+agtgtc 0.013
+agtgtg 0.0284
+agtgtt 0.00277
+agttaa 0.0079
+agttac 0.00533
+agttag 0.0182
+agttat 0.00277
+agttca 0.0079
+agttcc 0.00277
+agttcg 0.00277
+agttct 0.000201
+agttga 0.00533
+agttgc 0.00533
+agttgg 0.0079
+agttgt 0.00277
+agttta 0.359
+agtttc 0.013
+agtttg 0.362
+agtttt 0.00533
+ataaaa 0.0079
+ataaac 0.0079
+ataaag 0.441
+ataaat 0.00533
+ataaca 0.364
+ataacc 0.0105
+ataacg 0.0259
+ataact 0.00533
+ataaga 0.00533
+ataagc 0.00277
+ataagg 0.013
+ataagt 0.00277
+ataata 0.0079
+ataatc 0.00277
+ataatg 0.0105
+ataatt 0.00533
+atacaa 0.0079
+atacac 0.0105
+atacag 0.013
+atacat 0.000201
+atacca 0.362
+ataccc 0.00277
+ataccg 0.00277
+atacct 0.00277
+atacga 0.00533
+atacgc 0.000201
+atacgg 0.00277
+atacgt 0.00277
+atacta 0.359
+atactc 0.00277
+atactg 0.00277
+atactt 0.00277
+atagaa 0.0079
+atagac 0.0079
+atagag 0.854
+atagat 0.0207
+atagca 0.0105
+atagcc 0.00533
+atagcg 0.013
+atagct 0.00277
+atagga 0.00277
+ataggc 0.00277
+ataggg 0.0079
+ataggt 0.00533
+atagta 0.00277
+atagtc 0.000201
+atagtg 0.013
+atagtt 0.00277
+atataa 0.00277
+atatac 0.00277
+atatag 0.0105
+atatat 0.000201
+atatca 0.00533
+atatcc 0.000201
+atatcg 0.00277
+atatct 0.000201
+atatga 0.000201
+atatgc 0.000201
+atatgg 0.0079
+atatgt 0.000201
+atatta 0.00533
+atattc 0.00277
+atattg 0.000201
+atattt 0.000201
+atcaaa 0.00533
+atcaac 0.00533
+atcaag 0.413
+atcaat 0.0105
+atcaca 0.0105
+atcacc 0.013
+atcacg 0.39
+atcact 0.0079
+atcaga 0.000201
+atcagc 0.000201
+atcagg 0.0182
+atcagt 0.00533
+atcata 0.00277
+atcatc 0.0105
+atcatg 0.0079
+atcatt 0.0079
+atccaa 0.000201
+atccac 0.0079
+atccag 0.0182
+atccat 0.00533
+atccca 0.00533
+atcccc 0.0079
+atcccg 0.00533
+atccct 0.000201
+atccga 0.000201
+atccgc 0.00533
+atccgg 0.013
+atccgt 0.0105
+atccta 0.00533
+atcctc 0.00277
+atcctg 0.000201
+atcctt 0.000201
+atcgaa 0.0079
+atcgac 0.0182
+atcgag 1.2
+atcgat 0.0233
+atcgca 0.0079
+atcgcc 0.369
+atcgcg 0.387
+atcgct 0.0079
+atcgga 0.013
+atcggc 0.0079
+atcggg 0.375
+atcggt 0.362
+atcgta 0.000201
+atcgtc 0.00533
+atcgtg 0.0259
+atcgtt 0.0105
+atctaa 0.000201
+atctac 0.00277
+atctag 0.013
+atctat 0.000201
+atctca 0.000201
+atctcc 0.00533
+atctcg 0.0079
+atctct 0.00277
+atctga 0.000201
+atctgc 0.00277
+atctgg 0.00277
+atctgt 0.00533
+atctta 0.000201
+atcttc 0.00277
+atcttg 0.000201
+atcttt 0.000201
+atgaaa 0.439
+atgaac 0.444
+atgaag 2.73
+atgaat 0.459
+atgaca 0.754
+atgacc 0.775
+atgacg 0.844
+atgact 0.405
+atgaga 0.0284
+atgagc 0.0336
+atgagg 1.12
+atgagt 0.385
+atgata 0.0233
+atgatc 0.385
+atgatg 0.449
+atgatt 0.751
+atgcaa 0.0105
+atgcac 0.377
+atgcag 0.49
+atgcat 0.0259
+atgcca 0.0105
+atgccc 0.0156
+atgccg 0.0336
+atgcct 0.0079
+atgcga 0.00277
+atgcgc 0.0079
+atgcgg 0.372
+atgcgt 0.00533
+atgcta 0.00277
+atgctc 0.013
+atgctg 0.0336
+atgctt 0.0105
+atggaa 0.108
+atggac 0.485
+atggag 10.1
+atggat 1.86
+atggca 0.387
+atggcc 0.418
+atggcg 0.905
+atggct 0.0567
+atggga 0.0105
+atgggc 0.0207
+atgggg 0.162
+atgggt 0.0233
+atggta 0.0105
+atggtc 0.0156
+atggtg 0.5
+atggtt 0.377
+atgtaa 0.0105
+atgtac 0.0105
+atgtag 0.123
+atgtat 0.0182
+atgtca 0.013
+atgtcc 0.013
+atgtcg 0.375
+atgtct 0.0105
+atgtga 0.00277
+atgtgc 0.000201
+atgtgg 0.0207
+atgtgt 0.00277
+atgtta 0.00277
+atgttc 0.00277
+atgttg 0.0233
+atgttt 0.0079
+attaaa 0.013
+attaac 0.0156
+attaag 0.787
+attaat 0.0079
+attaca 0.0156
+attacc 0.364
+attacg 0.375
+attact 0.0105
+attaga 0.00277
+attagc 0.00533
+attagg 0.0156
+attagt 0.00533
+attata 0.367
+attatc 0.0156
+attatg 0.0182
+attatt 0.0079
+attcaa 0.00533
+attcac 0.364
+attcag 0.38
+attcat 0.00533
+attcca 0.00533
+attccc 0.00533
+attccg 0.00533
+attcct 0.000201
+attcga 0.000201
+attcgc 0.00277
+attcgg 0.00533
+attcgt 0.00277
+attcta 0.0079
+attctc 0.00533
+attctg 0.0079
+attctt 0.000201
+attgaa 0.0105
+attgac 0.0233
+attgag 1.56
+attgat 0.0259
+attgca 0.00277
+attgcc 0.0105
+attgcg 0.0284
+attgct 0.0079
+attgga 0.00533
+attggc 0.00533
+attggg 0.0207
+attggt 0.359
+attgta 0.0105
+attgtc 0.0079
+attgtg 0.375
+attgtt 0.0156
+atttaa 0.00533
+atttac 0.362
+atttag 0.377
+atttat 0.00533
+atttca 0.00277
+atttcc 0.0105
+atttcg 0.0079
+atttct 0.000201
+atttga 0.000201
+atttgc 0.00277
+atttgg 0.00533
+atttgt 0.00533
+atttta 0.0156
+attttc 0.00533
+attttg 0.0079
+attttt 0.00277
+caaaaa 0.416
+caaaac 0.41
+caaaag 2.34
+caaaat 0.0387
+caaaca 0.398
+caaacc 0.0669
+caaacg 1.91
+caaact 0.0413
+caaaga 0.0182
+caaagc 0.0336
+caaagg 1.15
+caaagt 0.013
+caaata 0.0105
+caaatc 0.0105
+caaatg 0.0695
+caaatt 0.0105
+caacaa 0.0079
+caacac 0.013
+caacag 0.113
+caacat 0.00277
+caacca 0.0105
+caaccc 0.00533
+caaccg 0.0361
+caacct 0.00533
+caacga 0.00533
+caacgc 0.0156
+caacgg 0.382
+caacgt 0.00277
+caacta 0.000201
+caactc 0.00277
+caactg 0.0182
+caactt 0.000201
+caagaa 0.0977
+caagac 0.464
+caagag 9.23
+caagat 0.0926
+caagca 0.0515
+caagcc 0.0618
+caagcg 1.6
+caagct 0.39
+caagga 0.0207
+caaggc 0.0182
+caaggg 1.23
+caaggt 0.0156
+caagta 0.00533
+caagtc 0.0105
+caagtg 0.17
+caagtt 0.00533
+caataa 0.723
+caatac 0.0156
+caatag 0.0951
+caatat 0.0079
+caatca 0.0156
+caatcc 0.000201
+caatcg 0.0361
+caatct 0.00533
+caatga 0.362
+caatgc 0.0079
+caatgg 0.0464
+caatgt 0.0079
+caatta 0.0105
+caattc 0.0079
+caattg 0.395
+caattt 0.00533
+cacaaa 0.408
+cacaac 0.0669
+cacaag 2.61
+cacaat 0.049
+cacaca 0.0515
+cacacc 0.416
+cacacg 0.841
+cacact 0.0361
+cacaga 0.0105
+cacagc 0.031
+cacagg 0.072
+cacagt 0.00533
+cacata 0.367
+cacatc 0.0182
+cacatg 0.0592
+cacatt 0.0156
+caccaa 0.0156
+caccac 0.031
+caccag 0.0618
+caccat 0.359
+caccca 0.718
+cacccc 0.0259
+cacccg 0.0284
+caccct 0.0182
+caccga 0.0105
+caccgc 0.369
+caccgg 0.0259
+caccgt 0.0105
+caccta 0.0182
+cacctc 0.362
+cacctg 0.0207
+cacctt 0.00533
+cacgaa 0.0567
+cacgac 0.785
+cacgag 2.5
+cacgat 0.049
+cacgca 0.41
+cacgcc 0.423
+cacgcg 1.21
+cacgct 0.395
+cacgga 0.393
+cacggc 0.387
+cacggg 1.18
+cacggt 0.0207
+cacgta 0.723
+cacgtc 0.0361
+cacgtg 0.48
+cacgtt 0.0207
+cactaa 0.013
+cactac 0.364
+cactag 0.0438
+cactat 0.0105
+cactca 0.013
+cactcc 0.0156
+cactcg 0.0259
+cactct 0.359
+cactga 0.0079
+cactgc 0.013
+cactgg 0.0259
+cactgt 0.00533
+cactta 0.0105
+cacttc 0.0105
+cacttg 0.0464
+cacttt 0.00277
+cagaaa 4.15
+cagaac 4.56
+cagaag 8.79
+cagaat 2.37
+cagaca 3.45
+cagacc 6.68
+cagacg 8.63
+cagact 3.06
+cagaga 0.49
+cagagc 3.36
+cagagg 4.58
+cagagt 0.828
+cagata 0.459
+cagatc 1.23
+cagatg 3.6
+cagatt 1.53
+cagcaa 0.0874
+cagcac 1.18
+cagcag 3.18
+cagcat 0.0746
+cagcca 0.428
+cagccc 0.482
+cagccg 1.64
+cagcct 0.423
+cagcga 0.0259
+cagcgc 0.775
+cagcgg 1.24
+cagcgt 0.0284
+cagcta 0.0182
+cagctc 0.0618
+cagctg 1.98
+cagctt 0.0284
+caggaa 3.53
+caggac 5.35
+caggag 25.2
+caggat 3.14
+caggca 3.79
+caggcc 5.97
+caggcg 11.3
+caggct 3.09
+caggga 1.21
+cagggc 0.926
+cagggg 9.8
+cagggt 0.849
+caggta 0.157
+caggtc 1.25
+caggtg 11.5
+caggtt 0.5
+cagtaa 0.428
+cagtac 0.452
+cagtag 1.42
+cagtat 0.0567
+cagtca 0.426
+cagtcc 0.116
+cagtcg 1.66
+cagtct 0.0746
+cagtga 0.0438
+cagtgc 0.418
+cagtgg 2.67
+cagtgt 0.39
+cagtta 0.0541
+cagttc 0.772
+cagttg 5.53
+cagttt 0.0695
+cataaa 0.0438
+cataac 0.0413
+cataag 0.882
+cataat 0.38
+cataca 0.395
+catacc 0.0618
+catacg 1.18
+catact 0.0336
+cataga 0.0079
+catagc 0.031
+catagg 0.418
+catagt 0.0105
+catata 0.0156
+catatc 0.0156
+catatg 0.754
+catatt 0.0207
+catcaa 0.000201
+catcac 0.0079
+catcag 0.0515
+catcat 0.0079
+catcca 0.0156
+catccc 0.00277
+catccg 0.0182
+catcct 0.00277
+catcga 0.000201
+catcgc 0.0105
+catcgg 0.013
+catcgt 0.00277
+catcta 0.000201
+catctc 0.00277
+catctg 0.0233
+catctt 0.000201
+catgaa 0.049
+catgac 0.0695
+catgag 3.53
+catgat 0.0515
+catgca 0.387
+catgcc 0.0541
+catgcg 0.131
+catgct 0.031
+catgga 0.0182
+catggc 0.0079
+catggg 0.108
+catggt 0.0079
+catgta 0.013
+catgtc 0.013
+catgtg 0.116
+catgtt 0.0079
+cattaa 0.013
+cattac 0.0079
+cattag 0.0387
+cattat 0.362
+cattca 0.0105
+cattcc 0.00277
+cattcg 0.0182
+cattct 0.00533
+cattga 0.00277
+cattgc 0.00533
+cattgg 0.0207
+cattgt 0.00533
+cattta 0.000201
+catttc 0.0079
+catttg 0.0464
+catttt 0.00277
+ccaaaa 0.364
+ccaaac 0.0182
+ccaaag 0.441
+ccaaat 0.0105
+ccaaca 0.0182
+ccaacc 0.0233
+ccaacg 0.416
+ccaact 0.362
+ccaaga 0.00533
+ccaagc 0.0079
+ccaagg 0.377
+ccaagt 0.00533
+ccaata 0.00277
+ccaatc 0.00277
+ccaatg 0.0182
+ccaatt 0.00533
+ccacaa 0.013
+ccacac 0.0156
+ccacag 0.739
+ccacat 0.0079
+ccacca 0.000201
+ccaccc 0.0156
+ccaccg 0.0105
+ccacct 0.00277
+ccacga 0.00277
+ccacgc 0.000201
+ccacgg 0.013
+ccacgt 0.00533
+ccacta 0.000201
+ccactc 0.000201
+ccactg 0.0079
+ccactt 0.00533
+ccagaa 0.0156
+ccagac 0.0233
+ccagag 1.64
+ccagat 0.369
+ccagca 0.0105
+ccagcc 0.013
+ccagcg 0.0387
+ccagct 0.0079
+ccagga 0.00277
+ccaggc 0.0105
+ccaggg 0.0361
+ccaggt 0.00277
+ccagta 0.00277
+ccagtc 0.00533
+ccagtg 0.0182
+ccagtt 0.00533
+ccataa 0.0079
+ccatac 0.000201
+ccatag 0.0182
+ccatat 0.00533
+ccatca 0.000201
+ccatcc 0.000201
+ccatcg 0.00277
+ccatct 0.0079
+ccatga 0.00277
+ccatgc 0.00277
+ccatgg 0.013
+ccatgt 0.00533
+ccatta 0.00533
+ccattc 0.00533
+ccattg 0.0079
+ccattt 0.359
+cccaaa 0.0182
+cccaac 0.0233
+cccaag 0.785
+cccaat 0.00533
+cccaca 0.369
+cccacc 0.385
+cccacg 0.772
+cccact 0.013
+cccaga 0.00277
+cccagc 0.013
+cccagg 0.0182
+cccagt 0.000201
+cccata 0.00533
+cccatc 0.0105
+cccatg 0.0259
+cccatt 0.000201
+ccccaa 0.359
+ccccac 0.0233
+ccccag 0.031
+ccccat 0.00533
+ccccca 0.013
+cccccc 0.372
+cccccg 0.0156
+ccccct 0.00277
+ccccga 0.00533
+ccccgc 0.0156
+ccccgg 0.0105
+ccccgt 0.00277
+ccccta 0.0079
+cccctc 0.0182
+cccctg 0.362
+cccctt 0.00277
+cccgaa 0.013
+cccgac 0.746
+cccgag 0.849
+cccgat 0.0156
+cccgca 0.0156
+cccgcc 0.0464
+cccgcg 0.393
+cccgct 0.00533
+cccgga 0.0207
+cccggc 0.731
+cccggg 0.393
+cccggt 0.0079
+cccgta 0.0156
+cccgtc 0.731
+cccgtg 0.395
+cccgtt 0.0156
+ccctaa 0.00533
+ccctac 0.0079
+ccctag 0.013
+ccctat 0.000201
+ccctca 0.00277
+ccctcc 0.013
+ccctcg 0.0105
+ccctct 0.00533
+ccctga 0.00277
+ccctgc 0.0079
+ccctgg 0.00533
+ccctgt 0.000201
+ccctta 0.00533
+cccttc 0.0079
+cccttg 0.362
+cccttt 0.0105
+ccgaaa 0.444
+ccgaac 0.823
+ccgaag 3.09
+ccgaat 0.0695
+ccgaca 0.795
+ccgacc 1.9
+ccgacg 2.68
+ccgact 0.0643
+ccgaga 0.0182
+ccgagc 0.4
+ccgagg 0.105
+ccgagt 0.013
+ccgata 0.0182
+ccgatc 0.0361
+ccgatg 0.803
+ccgatt 0.0233
+ccgcaa 0.0207
+ccgcac 0.746
+ccgcag 1.54
+ccgcat 0.0156
+ccgcca 0.0207
+ccgccc 0.749
+ccgccg 0.41
+ccgcct 0.0182
+ccgcga 0.000201
+ccgcgc 0.0207
+ccgcgg 0.0284
+ccgcgt 0.00277
+ccgcta 0.000201
+ccgctc 0.0156
+ccgctg 0.0413
+ccgctt 0.0079
+ccggaa 0.0797
+ccggac 0.134
+ccggag 7.32
+ccggat 0.0772
+ccggca 0.762
+ccggcc 1.15
+ccggcg 0.577
+ccggct 0.0438
+ccggga 0.0207
+ccgggc 0.031
+ccgggg 0.885
+ccgggt 0.0105
+ccggta 0.0105
+ccggtc 0.0233
+ccggtg 0.505
+ccggtt 0.0105
+ccgtaa 0.00533
+ccgtac 0.013
+ccgtag 0.105
+ccgtat 0.00533
+ccgtca 0.0156
+ccgtcc 0.0284
+ccgtcg 0.0464
+ccgtct 0.362
+ccgtga 0.00277
+ccgtgc 0.00533
+ccgtgg 0.0259
+ccgtgt 0.0079
+ccgtta 0.00277
+ccgttc 0.0079
+ccgttg 0.0567
+ccgttt 0.364
+cctaaa 0.013
+cctaac 0.0156
+cctaag 1.15
+cctaat 0.0105
+cctaca 0.0207
+cctacc 0.0233
+cctacg 0.777
+cctact 0.0105
+cctaga 0.000201
+cctagc 0.0079
+cctagg 0.0207
+cctagt 0.00277
+cctata 0.00533
+cctatc 0.00533
+cctatg 0.0259
+cctatt 0.000201
+cctcaa 0.00277
+cctcac 0.0105
+cctcag 0.0413
+cctcat 0.00277
+cctcca 0.000201
+cctccc 0.0105
+cctccg 0.0079
+cctcct 0.00277
+cctcga 0.00277
+cctcgc 0.00277
+cctcgg 0.00277
+cctcgt 0.357
+cctcta 0.00277
+cctctc 0.000201
+cctctg 0.0079
+cctctt 0.00277
+cctgaa 0.0233
+cctgac 0.385
+cctgag 2.66
+cctgat 0.0259
+cctgca 0.0105
+cctgcc 0.0182
+cctgcg 0.0361
+cctgct 0.0105
+cctgga 0.00533
+cctggc 0.0105
+cctggg 0.0284
+cctggt 0.0079
+cctgta 0.364
+cctgtc 0.0182
+cctgtg 0.387
+cctgtt 0.0105
+ccttaa 0.000201
+ccttac 0.00277
+ccttag 0.0259
+ccttat 0.00277
+ccttca 0.0079
+ccttcc 0.00277
+ccttcg 0.00533
+ccttct 0.00277
+ccttga 0.000201
+ccttgc 0.000201
+ccttgg 0.00277
+ccttgt 0.00277
+ccttta 0.00277
+cctttc 0.000201
+cctttg 0.00533
+cctttt 0.00533
+cgaaaa 0.013
+cgaaac 0.369
+cgaaag 0.0951
+cgaaat 0.00533
+cgaaca 0.0182
+cgaacc 0.0182
+cgaacg 0.782
+cgaact 0.0079
+cgaaga 0.0079
+cgaagc 0.013
+cgaagg 0.39
+cgaagt 0.00533
+cgaata 0.000201
+cgaatc 0.00277
+cgaatg 0.0182
+cgaatt 0.000201
+cgacaa 0.00533
+cgacac 0.013
+cgacag 0.38
+cgacat 0.00277
+cgacca 0.0079
+cgaccc 0.367
+cgaccg 0.0182
+cgacct 0.0079
+cgacga 0.000201
+cgacgc 0.0079
+cgacgg 0.0182
+cgacgt 0.00277
+cgacta 0.000201
+cgactc 0.0079
+cgactg 0.00533
+cgactt 0.000201
+cgagaa 0.0207
+cgagac 0.0284
+cgagag 2.33
+cgagat 0.0182
+cgagca 0.364
+cgagcc 0.38
+cgagcg 0.767
+cgagct 0.0156
+cgagga 0.0182
+cgaggc 0.0105
+cgaggg 0.764
+cgaggt 0.013
+cgagta 0.00533
+cgagtc 0.00277
+cgagtg 0.0284
+cgagtt 0.00277
+cgataa 0.00533
+cgatac 0.00533
+cgatag 0.0207
+cgatat 0.00277
+cgatca 0.00277
+cgatcc 0.013
+cgatcg 0.0207
+cgatct 0.00533
+cgatga 0.0156
+cgatgc 0.362
+cgatgg 0.372
+cgatgt 0.364
+cgatta 0.00277
+cgattc 0.00277
+cgattg 0.0079
+cgattt 0.0079
+cgcaaa 0.0105
+cgcaac 0.0207
+cgcaag 0.0592
+cgcaat 0.00533
+cgcaca 0.013
+cgcacc 0.375
+cgcacg 0.0643
+cgcact 0.00533
+cgcaga 0.0105
+cgcagc 0.0079
+cgcagg 0.0182
+cgcagt 0.000201
+cgcata 0.00533
+cgcatc 0.0079
+cgcatg 0.0105
+cgcatt 0.00533
+cgccaa 0.364
+cgccac 0.723
+cgccag 0.0207
+cgccat 0.0105
+cgccca 0.0156
+cgcccc 0.741
+cgcccg 0.0079
+cgccct 0.0105
+cgccga 0.0105
+cgccgc 0.0233
+cgccgg 0.00533
+cgccgt 0.00533
+cgccta 0.0079
+cgcctc 0.375
+cgcctg 0.00533
+cgcctt 0.0079
+cgcgaa 0.0156
+cgcgac 0.0284
+cgcgag 1.2
+cgcgat 0.0156
+cgcgca 0.013
+cgcgcc 0.0336
+cgcgcg 0.0361
+cgcgct 0.0079
+cgcgga 0.728
+cgcggc 0.0156
+cgcggg 0.403
+cgcggt 0.013
+cgcgta 0.0182
+cgcgtc 0.0182
+cgcgtg 0.031
+cgcgtt 0.362
+cgctaa 0.0079
+cgctac 0.013
+cgctag 0.0079
+cgctat 0.000201
+cgctca 0.0105
+cgctcc 0.721
+cgctcg 0.0156
+cgctct 0.0105
+cgctga 0.364
+cgctgc 0.0156
+cgctgg 0.0156
+cgctgt 0.013
+cgctta 0.359
+cgcttc 0.0105
+cgcttg 0.0105
+cgcttt 0.0079
+cggaaa 0.8
+cggaac 1.51
+cggaag 2.77
+cggaat 0.428
+cggaca 0.787
+cggacc 0.121
+cggacg 3.75
+cggact 0.0643
+cggaga 0.377
+cggagc 0.0515
+cggagg 0.828
+cggagt 0.0207
+cggata 0.0284
+cggatc 0.0336
+cggatg 1.52
+cggatt 0.0284
+cggcaa 0.0079
+cggcac 0.0438
+cggcag 0.131
+cggcat 0.0079
+cggcca 0.0207
+cggccc 0.387
+cggccg 0.421
+cggcct 0.723
+cggcga 0.0079
+cggcgc 0.367
+cggcgg 0.0361
+cggcgt 0.0079
+cggcta 0.00277
+cggctc 0.369
+cggctg 0.0387
+cggctt 0.0105
+cgggaa 0.0874
+cgggac 0.469
+cgggag 8.01
+cgggat 0.0849
+cgggca 0.0618
+cgggcc 0.439
+cgggcg 1.64
+cgggct 0.0438
+cgggga 0.387
+cggggc 0.0413
+cggggg 2.32
+cggggt 0.031
+cgggta 0.00533
+cgggtc 0.0156
+cgggtg 0.19
+cgggtt 0.013
+cggtaa 0.013
+cggtac 0.0156
+cggtag 0.108
+cggtat 0.0079
+cggtca 0.0207
+cggtcc 0.0207
+cggtcg 1.13
+cggtct 0.38
+cggtga 0.0156
+cggtgc 0.0105
+cggtgg 0.41
+cggtgt 0.013
+cggtta 0.0105
+cggttc 0.013
+cggttg 0.421
+cggttt 0.364
+cgtaaa 0.0105
+cgtaac 0.0233
+cgtaag 0.428
+cgtaat 0.0105
+cgtaca 0.38
+cgtacc 0.385
+cgtacg 1.48
+cgtact 0.0207
+cgtaga 0.013
+cgtagc 0.721
+cgtagg 0.387
+cgtagt 0.0105
+cgtata 0.00533
+cgtatc 0.0156
+cgtatg 0.0336
+cgtatt 0.000201
+cgtcaa 0.00277
+cgtcac 0.00533
+cgtcag 0.0233
+cgtcat 0.000201
+cgtcca 0.0079
+cgtccc 0.0233
+cgtccg 0.0156
+cgtcct 0.0079
+cgtcga 0.000201
+cgtcgc 0.0105
+cgtcgg 0.0079
+cgtcgt 0.00533
+cgtcta 0.00277
+cgtctc 0.0105
+cgtctg 0.0079
+cgtctt 0.000201
+cgtgaa 0.0207
+cgtgac 0.0361
+cgtgag 2.64
+cgtgat 0.0233
+cgtgca 0.0207
+cgtgcc 1.09
+cgtgcg 0.0643
+cgtgct 0.367
+cgtgga 0.0156
+cgtggc 0.0207
+cgtggg 0.0567
+cgtggt 0.362
+cgtgta 0.364
+cgtgtc 0.0182
+cgtgtg 0.385
+cgtgtt 0.0207
+cgttaa 0.000201
+cgttac 0.000201
+cgttag 0.0207
+cgttat 0.00533
+cgttca 0.00533
+cgttcc 0.0182
+cgttcg 0.0182
+cgttct 0.00533
+cgttga 0.00533
+cgttgc 0.0105
+cgttgg 0.0079
+cgttgt 0.00533
+cgttta 0.0079
+cgtttc 0.000201
+cgtttg 0.0079
+cgtttt 0.00277
+ctaaaa 0.013
+ctaaac 0.0105
+ctaaag 0.0464
+ctaaat 0.0079
+ctaaca 0.0105
+ctaacc 0.0105
+ctaacg 0.0438
+ctaact 0.00533
+ctaaga 0.000201
+ctaagc 0.000201
+ctaagg 0.013
+ctaagt 0.00277
+ctaata 0.000201
+ctaatc 0.00277
+ctaatg 0.0079
+ctaatt 0.000201
+ctacaa 0.000201
+ctacac 0.00533
+ctacag 0.0207
+ctacat 0.000201
+ctacca 0.00277
+ctaccc 0.00277
+ctaccg 0.000201
+ctacct 0.000201
+ctacga 0.000201
+ctacgc 0.00277
+ctacgg 0.00533
+ctacgt 0.00277
+ctacta 0.00277
+ctactc 0.00277
+ctactg 0.00533
+ctactt 0.000201
+ctagaa 0.00277
+ctagac 0.0079
+ctagag 0.544
+ctagat 0.0079
+ctagca 0.0105
+ctagcc 0.0105
+ctagcg 0.0259
+ctagct 0.00533
+ctagga 0.000201
+ctaggc 0.00277
+ctaggg 0.031
+ctaggt 0.000201
+ctagta 0.000201
+ctagtc 0.00533
+ctagtg 0.013
+ctagtt 0.0105
+ctataa 0.00533
+ctatac 0.000201
+ctatag 0.0182
+ctatat 0.000201
+ctatca 0.00277
+ctatcc 0.00277
+ctatcg 0.000201
+ctatct 0.000201
+ctatga 0.00533
+ctatgc 0.00533
+ctatgg 0.00277
+ctatgt 0.00277
+ctatta 0.000201
+ctattc 0.000201
+ctattg 0.00277
+ctattt 0.00277
+ctcaaa 0.0105
+ctcaac 0.00533
+ctcaag 0.0669
+ctcaat 0.0079
+ctcaca 0.0182
+ctcacc 0.031
+ctcacg 1.45
+ctcact 0.013
+ctcaga 0.000201
+ctcagc 0.00533
+ctcagg 0.0156
+ctcagt 0.00277
+ctcata 0.00277
+ctcatc 0.00533
+ctcatg 0.0233
+ctcatt 0.00533
+ctccaa 0.00533
+ctccac 0.0105
+ctccag 0.0182
+ctccat 0.00533
+ctccca 0.00533
+ctcccc 0.0156
+ctcccg 0.013
+ctccct 0.000201
+ctccga 0.00533
+ctccgc 0.364
+ctccgg 0.362
+ctccgt 0.00533
+ctccta 0.000201
+ctcctc 0.013
+ctcctg 0.0156
+ctcctt 0.00533
+ctcgaa 0.00533
+ctcgac 0.0207
+ctcgag 0.849
+ctcgat 0.013
+ctcgca 0.013
+ctcgcc 0.367
+ctcgcg 0.0464
+ctcgct 0.0105
+ctcgga 0.013
+ctcggc 0.0182
+ctcggg 0.398
+ctcggt 0.0105
+ctcgta 0.0156
+ctcgtc 0.0233
+ctcgtg 0.736
+ctcgtt 0.726
+ctctaa 0.000201
+ctctac 0.00533
+ctctag 0.0207
+ctctat 0.000201
+ctctca 0.00277
+ctctcc 0.0156
+ctctcg 0.0105
+ctctct 0.00533
+ctctga 0.0079
+ctctgc 0.359
+ctctgg 0.0079
+ctctgt 0.00277
+ctctta 0.00277
+ctcttc 0.00533
+ctcttg 0.0079
+ctcttt 0.00533
+ctgaaa 1.15
+ctgaac 0.818
+ctgaag 3.5
+ctgaat 1.14
+ctgaca 0.793
+ctgacc 1.52
+ctgacg 1.97
+ctgact 0.418
+ctgaga 0.0233
+ctgagc 0.0438
+ctgagg 0.105
+ctgagt 0.377
+ctgata 0.0233
+ctgatc 0.0387
+ctgatg 1.15
+ctgatt 0.0361
+ctgcaa 0.0207
+ctgcac 0.395
+ctgcag 1.59
+ctgcat 0.0233
+ctgcca 0.0156
+ctgccc 0.0336
+ctgccg 0.049
+ctgcct 0.0105
+ctgcga 0.00277
+ctgcgc 0.0156
+ctgcgg 0.0387
+ctgcgt 0.00277
+ctgcta 0.00533
+ctgctc 0.364
+ctgctg 0.398
+ctgctt 0.0079
+ctggaa 0.123
+ctggac 0.493
+ctggag 11.5
+ctggat 0.48
+ctggca 1.12
+ctggcc 0.805
+ctggcg 1.3
+ctggct 0.0464
+ctggga 0.0361
+ctgggc 0.0284
+ctgggg 1.97
+ctgggt 0.0233
+ctggta 0.0105
+ctggtc 0.0259
+ctggtg 0.559
+ctggtt 0.0207
+ctgtaa 0.0284
+ctgtac 0.0284
+ctgtag 2.26
+ctgtat 0.0259
+ctgtca 0.0207
+ctgtcc 0.0182
+ctgtcg 0.0567
+ctgtct 0.0079
+ctgtga 0.357
+ctgtgc 0.0079
+ctgtgg 0.0515
+ctgtgt 0.0079
+ctgtta 0.00277
+ctgttc 0.0079
+ctgttg 0.0695
+ctgttt 0.00533
+cttaaa 0.0105
+cttaac 0.0079
+cttaag 0.0592
+cttaat 0.0105
+cttaca 0.013
+cttacc 0.0207
+cttacg 0.049
+cttact 0.00277
+cttaga 0.000201
+cttagc 0.0105
+cttagg 0.00533
+cttagt 0.00277
+cttata 0.0105
+cttatc 0.364
+cttatg 0.0182
+cttatt 0.0079
+cttcaa 0.000201
+cttcac 0.00533
+cttcag 0.0233
+cttcat 0.000201
+cttcca 0.00277
+cttccc 0.00277
+cttccg 0.00277
+cttcct 0.000201
+cttcga 0.000201
+cttcgc 0.00277
+cttcgg 0.00533
+cttcgt 0.00277
+cttcta 0.00533
+cttctc 0.013
+cttctg 0.359
+cttctt 0.0079
+cttgaa 0.0079
+cttgac 0.0182
+cttgag 1.23
+cttgat 0.0156
+cttgca 0.013
+cttgcc 0.0233
+cttgcg 0.0156
+cttgct 0.0079
+cttgga 0.000201
+cttggc 0.00533
+cttggg 0.0259
+cttggt 0.0105
+cttgta 0.0182
+cttgtc 0.721
+cttgtg 0.0387
+cttgtt 0.726
+ctttaa 0.00277
+ctttac 0.00533
+ctttag 0.0259
+ctttat 0.00277
+ctttca 0.359
+ctttcc 0.362
+ctttcg 0.00533
+ctttct 0.00533
+ctttga 0.00533
+ctttgc 0.00533
+ctttgg 0.000201
+ctttgt 0.00277
+ctttta 0.013
+cttttc 0.0105
+cttttg 0.00277
+cttttt 0.0079
+gaaaaa 0.0284
+gaaaac 0.013
+gaaaag 0.139
+gaaaat 0.0156
+gaaaca 0.0284
+gaaacc 0.013
+gaaacg 0.395
+gaaact 0.0079
+gaaaga 0.00277
+gaaagc 0.00533
+gaaagg 0.031
+gaaagt 0.000201
+gaaata 0.00277
+gaaatc 0.0079
+gaaatg 0.0336
+gaaatt 0.0079
+gaacaa 0.00277
+gaacac 0.0182
+gaacag 0.405
+gaacat 0.00277
+gaacca 0.0079
+gaaccc 0.00533
+gaaccg 0.013
+gaacct 0.000201
+gaacga 0.0079
+gaacgc 0.723
+gaacgg 0.375
+gaacgt 0.013
+gaacta 0.000201
+gaactc 0.00533
+gaactg 0.0156
+gaactt 0.00277
+gaagaa 0.0438
+gaagac 0.0464
+gaagag 4.58
+gaagat 0.0413
+gaagca 0.0079
+gaagcc 0.0105
+gaagcg 0.0874
+gaagct 0.0156
+gaagga 0.0079
+gaaggc 0.0207
+gaaggg 0.0797
+gaaggt 0.0079
+gaagta 0.00277
+gaagtc 0.0105
+gaagtg 0.403
+gaagtt 0.00277
+gaataa 0.013
+gaatac 0.000201
+gaatag 0.0361
+gaatat 0.00277
+gaatca 0.362
+gaatcc 0.00277
+gaatcg 0.0105
+gaatct 0.00277
+gaatga 0.00533
+gaatgc 0.0079
+gaatgg 0.0079
+gaatgt 0.00277
+gaatta 0.00277
+gaattc 0.000201
+gaattg 0.0105
+gaattt 0.00533
+gacaaa 0.0361
+gacaac 0.377
+gacaag 0.459
+gacaat 0.385
+gacaca 0.0207
+gacacc 0.0156
+gacacg 0.0387
+gacact 0.0079
+gacaga 0.00533
+gacagc 0.0079
+gacagg 0.0156
+gacagt 0.00277
+gacata 0.0105
+gacatc 0.367
+gacatg 0.382
+gacatt 0.0207
+gaccaa 0.00277
+gaccac 0.364
+gaccag 0.049
+gaccat 0.0156
+gaccca 0.0079
+gacccc 0.0079
+gacccg 0.00533
+gaccct 0.00277
+gaccga 0.00533
+gaccgc 0.0182
+gaccgg 0.0105
+gaccgt 0.0079
+gaccta 0.00533
+gacctc 0.0105
+gacctg 0.0079
+gacctt 0.000201
+gacgaa 0.0387
+gacgac 0.41
+gacgag 2.77
+gacgat 0.395
+gacgca 0.0079
+gacgcc 0.0182
+gacgcg 0.0772
+gacgct 0.0182
+gacgga 0.372
+gacggc 0.0207
+gacggg 0.0618
+gacggt 0.0105
+gacgta 0.0105
+gacgtc 0.375
+gacgtg 0.049
+gacgtt 0.00533
+gactaa 0.00277
+gactac 0.0105
+gactag 0.0233
+gactat 0.0079
+gactca 0.0079
+gactcc 0.000201
+gactcg 0.0079
+gactct 0.00277
+gactga 0.00277
+gactgc 0.00277
+gactgg 0.00533
+gactgt 0.00277
+gactta 0.000201
+gacttc 0.00533
+gacttg 0.0105
+gacttt 0.0079
+gagaaa 3.72
+gagaac 1.23
+gagaag 5.45
+gagaat 1.92
+gagaca 2.95
+gagacc 1.2
+gagacg 2.75
+gagact 0.475
+gagaga 0.423
+gagagc 0.0746
+gagagg 1.24
+gagagt 0.0515
+gagata 0.439
+gagatc 0.431
+gagatg 3.02
+gagatt 0.793
+gagcaa 0.0567
+gagcac 0.408
+gagcag 2.06
+gagcat 0.0413
+gagcca 0.0387
+gagccc 0.031
+gagccg 0.81
+gagcct 0.0284
+gagcga 0.013
+gagcgc 0.744
+gagcgg 0.795
+gagcgt 0.0182
+gagcta 0.00533
+gagctc 0.0259
+gagctg 0.459
+gagctt 0.0156
+gaggaa 2.05
+gaggac 1.73
+gaggag 25.6
+gaggat 1.33
+gaggca 0.126
+gaggcc 0.867
+gaggcg 5.06
+gaggct 1.89
+gaggga 0.0823
+gagggc 1.15
+gagggg 5.03
+gagggt 0.782
+gaggta 0.0387
+gaggtc 0.767
+gaggtg 2.56
+gaggtt 0.0592
+gagtaa 0.0541
+gagtac 0.0259
+gagtag 0.611
+gagtat 0.0361
+gagtca 0.744
+gagtcc 0.0259
+gagtcg 0.808
+gagtct 0.0464
+gagtga 0.0156
+gagtgc 0.0233
+gagtgg 0.441
+gagtgt 0.372
+gagtta 0.0207
+gagttc 0.0233
+gagttg 0.821
+gagttt 0.726
+gataaa 0.0387
+gataac 0.0207
+gataag 1.5
+gataat 0.0361
+gataca 0.0259
+gatacc 0.0079
+gatacg 0.0515
+gatact 0.00533
+gataga 0.0079
+gatagc 0.0079
+gatagg 0.38
+gatagt 0.00533
+gatata 0.0079
+gatatc 0.0105
+gatatg 0.049
+gatatt 0.362
+gatcaa 0.0079
+gatcac 0.013
+gatcag 0.387
+gatcat 0.00533
+gatcca 0.357
+gatccc 0.0079
+gatccg 0.0156
+gatcct 0.00277
+gatcga 0.0079
+gatcgc 0.369
+gatcgg 0.0207
+gatcgt 0.00277
+gatcta 0.00533
+gatctc 0.00533
+gatctg 0.362
+gatctt 0.00533
+gatgaa 0.0207
+gatgac 0.0156
+gatgag 0.647
+gatgat 0.0207
+gatgca 0.0079
+gatgcc 0.0105
+gatgcg 0.0438
+gatgct 0.0156
+gatgga 0.362
+gatggc 0.0207
+gatggg 0.049
+gatggt 0.0105
+gatgta 0.0079
+gatgtc 0.0079
+gatgtg 0.0233
+gatgtt 0.00277
+gattaa 0.359
+gattac 0.0079
+gattag 0.0233
+gattat 0.362
+gattca 0.0182
+gattcc 0.00277
+gattcg 0.00533
+gattct 0.00277
+gattga 0.0105
+gattgc 0.362
+gattgg 0.0079
+gattgt 0.0079
+gattta 0.0079
+gatttc 0.00533
+gatttg 0.0079
+gatttt 0.0105
+gcaaaa 0.00533
+gcaaac 0.0156
+gcaaag 0.418
+gcaaat 0.00533
+gcaaca 0.0105
+gcaacc 0.375
+gcaacg 0.4
+gcaact 0.364
+gcaaga 0.00533
+gcaagc 0.0207
+gcaagg 0.736
+gcaagt 0.0105
+gcaata 0.00533
+gcaatc 0.367
+gcaatg 0.377
+gcaatt 0.0105
+gcacaa 0.00533
+gcacac 0.367
+gcacag 0.0336
+gcacat 0.0079
+gcacca 0.00533
+gcaccc 0.0182
+gcaccg 0.0105
+gcacct 0.0079
+gcacga 0.0105
+gcacgc 0.0182
+gcacgg 0.369
+gcacgt 0.364
+gcacta 0.00533
+gcactc 0.0079
+gcactg 0.0105
+gcactt 0.362
+gcagaa 0.0207
+gcagac 0.0438
+gcagag 2.68
+gcagat 0.0284
+gcagca 0.367
+gcagcc 0.38
+gcagcg 0.759
+gcagct 0.0207
+gcagga 0.0207
+gcaggc 0.728
+gcaggg 0.403
+gcaggt 0.0156
+gcagta 0.00277
+gcagtc 0.013
+gcagtg 0.0336
+gcagtt 0.00277
+gcataa 0.000201
+gcatac 0.00277
+gcatag 0.0207
+gcatat 0.000201
+gcatca 0.0105
+gcatcc 0.00533
+gcatcg 0.0079
+gcatct 0.00277
+gcatga 0.000201
+gcatgc 0.00533
+gcatgg 0.0182
+gcatgt 0.00277
+gcatta 0.00277
+gcattc 0.00533
+gcattg 0.00533
+gcattt 0.0079
+gccaaa 0.00277
+gccaac 0.0207
+gccaag 0.403
+gccaat 0.0105
+gccaca 0.00533
+gccacc 0.0233
+gccacg 0.0387
+gccact 0.00277
+gccaga 0.0105
+gccagc 0.359
+gccagg 0.0207
+gccagt 0.00277
+gccata 0.00277
+gccatc 0.0182
+gccatg 0.0182
+gccatt 0.00533
+gcccaa 0.0079
+gcccac 0.0207
+gcccag 0.0156
+gcccat 0.00533
+gcccca 0.0105
+gccccc 0.369
+gccccg 0.0079
+gcccct 0.00277
+gcccga 0.364
+gcccgc 0.013
+gcccgg 0.0079
+gcccgt 0.0079
+gcccta 0.359
+gccctc 0.0105
+gccctg 0.0079
+gccctt 0.0105
+gccgaa 0.0259
+gccgac 0.762
+gccgag 1.58
+gccgat 0.382
+gccgca 0.375
+gccgcc 0.741
+gccgcg 0.757
+gccgct 0.0233
+gccgga 0.726
+gccggc 0.393
+gccggg 0.0438
+gccggt 0.013
+gccgta 0.0156
+gccgtc 0.387
+gccgtg 0.382
+gccgtt 0.0105
+gcctaa 0.00277
+gcctac 0.00533
+gcctag 0.013
+gcctat 0.00533
+gcctca 0.0079
+gcctcc 0.0105
+gcctcg 0.0079
+gcctct 0.00277
+gcctga 0.0079
+gcctgc 0.00533
+gcctgg 0.00277
+gcctgt 0.00277
+gcctta 0.00533
+gccttc 0.00533
+gccttg 0.013
+gccttt 0.357
+gcgaaa 0.0515
+gcgaac 0.418
+gcgaag 0.936
+gcgaat 0.0387
+gcgaca 0.049
+gcgacc 1.12
+gcgacg 1.18
+gcgact 0.0259
+gcgaga 0.013
+gcgagc 0.031
+gcgagg 1.12
+gcgagt 0.0156
+gcgata 0.013
+gcgatc 0.38
+gcgatg 0.777
+gcgatt 0.0207
+gcgcaa 0.00277
+gcgcac 0.382
+gcgcag 0.116
+gcgcat 0.00533
+gcgcca 0.00277
+gcgccc 0.0207
+gcgccg 0.0284
+gcgcct 0.0079
+gcgcga 0.00277
+gcgcgc 0.0105
+gcgcgg 0.0284
+gcgcgt 0.00533
+gcgcta 0.00533
+gcgctc 0.0105
+gcgctg 0.0233
+gcgctt 0.362
+gcggaa 0.0977
+gcggac 1.53
+gcggag 10.8
+gcggat 0.108
+gcggca 0.0233
+gcggcc 0.072
+gcggcg 1.25
+gcggct 0.736
+gcggga 0.0207
+gcgggc 0.4
+gcgggg 1.58
+gcgggt 0.0259
+gcggta 0.000201
+gcggtc 0.0233
+gcggtg 0.128
+gcggtt 0.0105
+gcgtaa 0.000201
+gcgtac 0.0156
+gcgtag 0.0874
+gcgtat 0.000201
+gcgtca 0.0105
+gcgtcc 0.0079
+gcgtcg 0.0284
+gcgtct 0.013
+gcgtga 0.00277
+gcgtgc 0.00277
+gcgtgg 0.0233
+gcgtgt 0.00277
+gcgtta 0.00277
+gcgttc 0.00533
+gcgttg 0.367
+gcgttt 0.0156
+gctaaa 0.0079
+gctaac 0.0156
+gctaag 1.13
+gctaat 0.013
+gctaca 0.0156
+gctacc 0.0233
+gctacg 1.1
+gctact 0.0156
+gctaga 0.000201
+gctagc 0.0079
+gctagg 0.0336
+gctagt 0.00277
+gctata 0.00533
+gctatc 0.362
+gctatg 0.0259
+gctatt 0.00533
+gctcaa 0.00277
+gctcac 0.364
+gctcag 0.0259
+gctcat 0.00533
+gctcca 0.0105
+gctccc 0.362
+gctccg 0.0156
+gctcct 0.00533
+gctcga 0.00277
+gctcgc 0.0105
+gctcgg 0.00533
+gctcgt 0.0079
+gctcta 0.00277
+gctctc 0.0079
+gctctg 0.00277
+gctctt 0.00533
+gctgaa 0.0156
+gctgac 0.0438
+gctgag 1.94
+gctgat 0.377
+gctgca 0.0156
+gctgcc 0.0233
+gctgcg 0.403
+gctgct 0.375
+gctgga 0.0156
+gctggc 0.372
+gctggg 0.0413
+gctggt 0.364
+gctgta 0.0105
+gctgtc 0.0079
+gctgtg 0.0233
+gctgtt 0.0079
+gcttaa 0.0079
+gcttac 0.00277
+gcttag 0.0207
+gcttat 0.00533
+gcttca 0.713
+gcttcc 0.0079
+gcttcg 0.0156
+gcttct 0.0079
+gcttga 0.0079
+gcttgc 0.0079
+gcttgg 0.00277
+gcttgt 0.00277
+gcttta 0.0105
+gctttc 0.00277
+gctttg 0.00277
+gctttt 0.00277
+ggaaaa 0.0079
+ggaaac 0.0079
+ggaaag 0.759
+ggaaat 0.013
+ggaaca 0.00277
+ggaacc 0.00533
+ggaacg 0.0361
+ggaact 0.00277
+ggaaga 0.00533
+ggaagc 0.000201
+ggaagg 0.0207
+ggaagt 0.00533
+ggaata 0.000201
+ggaatc 0.00277
+ggaatg 0.0156
+ggaatt 0.00277
+ggacaa 0.00277
+ggacac 0.00533
+ggacag 0.0207
+ggacat 0.000201
+ggacca 0.359
+ggaccc 0.0079
+ggaccg 0.0105
+ggacct 0.00277
+ggacga 0.00533
+ggacgc 0.00533
+ggacgg 0.013
+ggacgt 0.0105
+ggacta 0.00533
+ggactc 0.00533
+ggactg 0.362
+ggactt 0.00533
+ggagaa 0.0079
+ggagac 0.013
+ggagag 0.49
+ggagat 0.013
+ggagca 0.0156
+ggagcc 0.372
+ggagcg 0.377
+ggagct 0.0079
+ggagga 0.359
+ggaggc 0.0182
+ggaggg 0.0361
+ggaggt 0.359
+ggagta 0.00533
+ggagtc 0.0079
+ggagtg 0.0156
+ggagtt 0.00277
+ggataa 0.000201
+ggatac 0.000201
+ggatag 0.0079
+ggatat 0.000201
+ggatca 0.00533
+ggatcc 0.00277
+ggatcg 0.0079
+ggatct 0.00533
+ggatga 0.0105
+ggatgc 0.00533
+ggatgg 0.00533
+ggatgt 0.0079
+ggatta 0.000201
+ggattc 0.000201
+ggattg 0.00533
+ggattt 0.000201
+ggcaaa 0.0079
+ggcaac 0.0105
+ggcaag 0.4
+ggcaat 0.375
+ggcaca 0.000201
+ggcacc 0.00277
+ggcacg 0.0156
+ggcact 0.0079
+ggcaga 0.000201
+ggcagc 0.00277
+ggcagg 0.0156
+ggcagt 0.0105
+ggcata 0.00277
+ggcatc 0.013
+ggcatg 0.0156
+ggcatt 0.359
+ggccaa 0.00533
+ggccac 0.013
+ggccag 0.367
+ggccat 0.0156
+ggccca 0.0079
+ggcccc 0.0156
+ggcccg 0.0079
+ggccct 0.00277
+ggccga 0.00533
+ggccgc 0.00533
+ggccgg 0.0105
+ggccgt 0.359
+ggccta 0.00277
+ggcctc 0.013
+ggcctg 0.013
+ggcctt 0.0079
+ggcgaa 0.0156
+ggcgac 0.385
+ggcgag 1.16
+ggcgat 0.733
+ggcgca 0.00533
+ggcgcc 0.0259
+ggcgcg 0.0233
+ggcgct 0.00533
+ggcgga 0.0233
+ggcggc 0.013
+ggcggg 0.031
+ggcggt 0.0105
+ggcgta 0.0079
+ggcgtc 0.723
+ggcgtg 0.031
+ggcgtt 0.0156
+ggctaa 0.000201
+ggctac 0.00277
+ggctag 0.0207
+ggctat 0.0079
+ggctca 0.00277
+ggctcc 0.0079
+ggctcg 0.364
+ggctct 0.0079
+ggctga 0.0105
+ggctgc 0.0079
+ggctgg 0.364
+ggctgt 0.013
+ggctta 0.00533
+ggcttc 0.0079
+ggcttg 0.362
+ggcttt 0.0079
+gggaaa 0.413
+gggaac 0.0618
+gggaag 2.31
+gggaat 0.413
+gggaca 0.0438
+gggacc 0.0284
+gggacg 1.17
+gggact 0.0207
+gggaga 0.0156
+gggagc 0.00533
+gggagg 0.423
+gggagt 0.364
+gggata 0.013
+gggatc 0.0156
+gggatg 0.79
+gggatt 0.0207
+gggcaa 0.00533
+gggcac 0.013
+gggcag 0.0849
+gggcat 0.00533
+gggcca 0.359
+gggccc 0.0105
+gggccg 0.031
+gggcct 0.013
+gggcga 0.00533
+gggcgc 0.0105
+gggcgg 0.0259
+gggcgt 0.00533
+gggcta 0.0105
+gggctc 0.364
+gggctg 0.733
+gggctt 0.0105
+ggggaa 0.0515
+ggggac 0.423
+ggggag 4.77
+ggggat 0.405
+ggggca 0.0079
+ggggcc 0.385
+ggggcg 0.495
+ggggct 0.031
+ggggga 0.0207
+gggggc 0.0413
+gggggg 1.54
+gggggt 0.0284
+ggggta 0.0079
+ggggtc 0.0233
+ggggtg 0.79
+ggggtt 0.013
+gggtaa 0.0105
+gggtac 0.00277
+gggtag 0.0515
+gggtat 0.0105
+gggtca 0.0207
+gggtcc 0.0105
+gggtcg 0.393
+gggtct 0.718
+gggtga 0.359
+gggtgc 0.00533
+gggtgg 0.0284
+gggtgt 0.013
+gggtta 0.00533
+gggttc 0.00277
+gggttg 0.0336
+gggttt 0.013
+ggtaaa 0.00533
+ggtaac 0.00277
+ggtaag 0.0592
+ggtaat 0.362
+ggtaca 0.00533
+ggtacc 0.0079
+ggtacg 0.0336
+ggtact 0.00533
+ggtaga 0.00533
+ggtagc 0.0156
+ggtagg 0.375
+ggtagt 0.0079
+ggtata 0.00277
+ggtatc 0.0079
+ggtatg 0.0079
+ggtatt 0.0079
+ggtcaa 0.000201
+ggtcac 0.00277
+ggtcag 0.0105
+ggtcat 0.00277
+ggtcca 0.0156
+ggtccc 0.013
+ggtccg 0.362
+ggtcct 0.00277
+ggtcga 0.00533
+ggtcgc 0.013
+ggtcgg 0.372
+ggtcgt 0.00533
+ggtcta 0.00277
+ggtctc 0.0079
+ggtctg 0.0182
+ggtctt 0.000201
+ggtgaa 0.00277
+ggtgac 0.0182
+ggtgag 0.1
+ggtgat 0.013
+ggtgca 0.0105
+ggtgcc 0.736
+ggtgcg 0.385
+ggtgct 0.013
+ggtgga 0.0233
+ggtggc 0.377
+ggtggg 1.09
+ggtggt 0.0207
+ggtgta 0.362
+ggtgtc 0.0156
+ggtgtg 0.0259
+ggtgtt 0.00533
+ggttaa 0.00533
+ggttac 0.00277
+ggttag 0.000201
+ggttat 0.0079
+ggttca 0.0079
+ggttcc 0.0079
+ggttcg 0.0105
+ggttct 0.00533
+ggttga 0.362
+ggttgc 0.364
+ggttgg 0.0207
+ggttgt 0.00533
+ggttta 0.013
+ggtttc 0.00277
+ggtttg 0.00533
+ggtttt 0.000201
+gtaaaa 0.000201
+gtaaac 0.00533
+gtaaag 0.0207
+gtaaat 0.000201
+gtaaca 0.00277
+gtaacc 0.00533
+gtaacg 0.0156
+gtaact 0.00277
+gtaaga 0.000201
+gtaagc 0.00277
+gtaagg 0.00533
+gtaagt 0.00533
+gtaata 0.000201
+gtaatc 0.00277
+gtaatg 0.00533
+gtaatt 0.000201
+gtacaa 0.00277
+gtacac 0.359
+gtacag 0.0105
+gtacat 0.0079
+gtacca 0.00533
+gtaccc 0.00533
+gtaccg 0.000201
+gtacct 0.00277
+gtacga 0.00277
+gtacgc 0.013
+gtacgg 0.0079
+gtacgt 0.359
+gtacta 0.00277
+gtactc 0.00277
+gtactg 0.00533
+gtactt 0.00533
+gtagaa 0.000201
+gtagac 0.00533
+gtagag 0.0977
+gtagat 0.000201
+gtagca 0.00277
+gtagcc 0.0156
+gtagcg 0.0156
+gtagct 0.00277
+gtagga 0.0105
+gtaggc 0.364
+gtaggg 0.0105
+gtaggt 0.0079
+gtagta 0.00277
+gtagtc 0.00277
+gtagtg 0.0105
+gtagtt 0.000201
+gtataa 0.000201
+gtatac 0.00277
+gtatag 0.000201
+gtatat 0.000201
+gtatca 0.00277
+gtatcc 0.000201
+gtatcg 0.000201
+gtatct 0.000201
+gtatga 0.000201
+gtatgc 0.00277
+gtatgg 0.000201
+gtatgt 0.00277
+gtatta 0.00533
+gtattc 0.000201
+gtattg 0.000201
+gtattt 0.000201
+gtcaaa 0.000201
+gtcaac 0.00533
+gtcaag 0.0284
+gtcaat 0.0079
+gtcaca 0.00277
+gtcacc 0.0079
+gtcacg 0.377
+gtcact 0.00277
+gtcaga 0.00277
+gtcagc 0.00277
+gtcagg 0.00277
+gtcagt 0.00277
+gtcata 0.000201
+gtcatc 0.00533
+gtcatg 0.0105
+gtcatt 0.00277
+gtccaa 0.00277
+gtccac 0.0105
+gtccag 0.013
+gtccat 0.357
+gtccca 0.00277
+gtcccc 0.359
+gtcccg 0.00533
+gtccct 0.00533
+gtccga 0.00533
+gtccgc 0.00533
+gtccgg 0.00277
+gtccgt 0.0079
+gtccta 0.00277
+gtcctc 0.00533
+gtcctg 0.00533
+gtcctt 0.00277
+gtcgaa 0.00533
+gtcgac 0.013
+gtcgag 0.444
+gtcgat 0.0156
+gtcgca 0.00533
+gtcgcc 0.0207
+gtcgcg 0.0233
+gtcgct 0.000201
+gtcgga 0.367
+gtcggc 0.0105
+gtcggg 0.0182
+gtcggt 0.00533
+gtcgta 0.0079
+gtcgtc 0.013
+gtcgtg 0.369
+gtcgtt 0.0079
+gtctaa 0.000201
+gtctac 0.000201
+gtctag 0.00277
+gtctat 0.00277
+gtctca 0.000201
+gtctcc 0.00533
+gtctcg 0.00533
+gtctct 0.00277
+gtctga 0.00277
+gtctgc 0.00277
+gtctgg 0.00277
+gtctgt 0.000201
+gtctta 0.00533
+gtcttc 0.00277
+gtcttg 0.00533
+gtcttt 0.00277
+gtgaaa 0.0515
+gtgaac 0.387
+gtgaag 1.6
+gtgaat 0.0438
+gtgaca 0.0413
+gtgacc 0.405
+gtgacg 1.15
+gtgact 0.0207
+gtgaga 0.0079
+gtgagc 0.0105
+gtgagg 0.0567
+gtgagt 0.364
+gtgata 0.00533
+gtgatc 0.0156
+gtgatg 0.421
+gtgatt 0.0156
+gtgcaa 0.00533
+gtgcac 0.0233
+gtgcag 0.793
+gtgcat 0.0079
+gtgcca 0.00277
+gtgccc 0.0156
+gtgccg 0.0284
+gtgcct 0.000201
+gtgcga 0.00277
+gtgcgc 0.0079
+gtgcgg 0.0207
+gtgcgt 0.00533
+gtgcta 0.00277
+gtgctc 0.0079
+gtgctg 0.377
+gtgctt 0.0079
+gtggaa 0.0515
+gtggac 0.0772
+gtggag 5.47
+gtggat 0.0618
+gtggca 0.0284
+gtggcc 1.1
+gtggcg 1.19
+gtggct 0.0336
+gtggga 0.367
+gtgggc 0.385
+gtgggg 0.834
+gtgggt 0.0182
+gtggta 0.0079
+gtggtc 0.0182
+gtggtg 0.439
+gtggtt 0.00533
+gtgtaa 0.000201
+gtgtac 0.00277
+gtgtag 0.0746
+gtgtat 0.000201
+gtgtca 0.00533
+gtgtcc 0.0105
+gtgtcg 0.0259
+gtgtct 0.00533
+gtgtga 0.0079
+gtgtgc 0.00277
+gtgtgg 0.0079
+gtgtgt 0.00533
+gtgtta 0.00533
+gtgttc 0.000201
+gtgttg 0.0156
+gtgttt 0.00533
+gttaaa 0.00277
+gttaac 0.00277
+gttaag 0.0413
+gttaat 0.00277
+gttaca 0.000201
+gttacc 0.00533
+gttacg 0.0207
+gttact 0.000201
+gttaga 0.000201
+gttagc 0.00277
+gttagg 0.00533
+gttagt 0.00277
+gttata 0.0156
+gttatc 0.0079
+gttatg 0.00277
+gttatt 0.00277
+gttcaa 0.000201
+gttcac 0.0079
+gttcag 0.0105
+gttcat 0.00277
+gttcca 0.00277
+gttccc 0.00533
+gttccg 0.00277
+gttcct 0.000201
+gttcga 0.000201
+gttcgc 0.00277
+gttcgg 0.00277
+gttcgt 0.00277
+gttcta 0.0105
+gttctc 0.000201
+gttctg 0.0079
+gttctt 0.000201
+gttgaa 0.00277
+gttgac 0.000201
+gttgag 0.0746
+gttgat 0.00277
+gttgca 0.00277
+gttgcc 0.013
+gttgcg 0.013
+gttgct 0.00277
+gttgga 0.0105
+gttggc 0.0105
+gttggg 0.0156
+gttggt 0.00533
+gttgta 0.364
+gttgtc 0.0079
+gttgtg 0.013
+gttgtt 0.0105
+gtttaa 0.0079
+gtttac 0.00277
+gtttag 0.00277
+gtttat 0.00277
+gtttca 0.013
+gtttcc 0.00533
+gtttcg 0.000201
+gtttct 0.000201
+gtttga 0.0079
+gtttgc 0.00533
+gtttgg 0.000201
+gtttgt 0.00277
+gtttta 0.721
+gttttc 0.00533
+gttttg 0.00533
+gttttt 0.0079
+taaaaa 0.00533
+taaaac 0.0105
+taaaag 0.0746
+taaaat 0.00533
+taaaca 0.00277
+taaacc 0.000201
+taaacg 0.0387
+taaact 0.000201
+taaaga 0.000201
+taaagc 0.000201
+taaagg 0.0156
+taaagt 0.000201
+taaata 0.000201
+taaatc 0.00277
+taaatg 0.00533
+taaatt 0.00277
+taacaa 0.000201
+taacac 0.000201
+taacag 0.0105
+taacat 0.000201
+taacca 0.000201
+taaccc 0.00533
+taaccg 0.000201
+taacct 0.00277
+taacga 0.00277
+taacgc 0.00533
+taacgg 0.0079
+taacgt 0.000201
+taacta 0.000201
+taactc 0.000201
+taactg 0.000201
+taactt 0.000201
+taagaa 0.00277
+taagac 0.0079
+taagag 0.485
+taagat 0.00533
+taagca 0.00277
+taagcc 0.000201
+taagcg 0.0207
+taagct 0.00533
+taagga 0.00277
+taaggc 0.000201
+taaggg 0.0105
+taaggt 0.000201
+taagta 0.000201
+taagtc 0.000201
+taagtg 0.0105
+taagtt 0.000201
+taataa 0.0079
+taatac 0.000201
+taatag 0.00277
+taatat 0.000201
+taatca 0.00277
+taatcc 0.000201
+taatcg 0.00533
+taatct 0.00277
+taatga 0.00533
+taatgc 0.000201
+taatgg 0.00533
+taatgt 0.00277
+taatta 0.000201
+taattc 0.000201
+taattg 0.00277
+taattt 0.000201
+tacaaa 0.00533
+tacaac 0.0156
+tacaag 0.0567
+tacaat 0.013
+tacaca 0.00277
+tacacc 0.00533
+tacacg 0.38
+tacact 0.0105
+tacaga 0.00277
+tacagc 0.000201
+tacagg 0.0105
+tacagt 0.000201
+tacata 0.00277
+tacatc 0.0079
+tacatg 0.0105
+tacatt 0.00533
+taccaa 0.00277
+taccac 0.00533
+taccag 0.359
+taccat 0.0105
+taccca 0.0079
+tacccc 0.00533
+tacccg 0.0156
+taccct 0.357
+taccga 0.00277
+taccgc 0.00533
+taccgg 0.00533
+taccgt 0.0079
+taccta 0.00277
+tacctc 0.0105
+tacctg 0.00277
+tacctt 0.00533
+tacgaa 0.00277
+tacgac 0.013
+tacgag 0.0849
+tacgat 0.00533
+tacgca 0.0156
+tacgcc 0.013
+tacgcg 1.08
+tacgct 0.013
+tacgga 0.362
+tacggc 0.00533
+tacggg 0.0182
+tacggt 0.00277
+tacgta 0.0079
+tacgtc 0.00533
+tacgtg 0.0207
+tacgtt 0.000201
+tactaa 0.00277
+tactac 0.00277
+tactag 0.00277
+tactat 0.000201
+tactca 0.000201
+tactcc 0.00533
+tactcg 0.0156
+tactct 0.0105
+tactga 0.00277
+tactgc 0.00277
+tactgg 0.00277
+tactgt 0.00533
+tactta 0.000201
+tacttc 0.00277
+tacttg 0.000201
+tacttt 0.000201
+tagaaa 0.462
+tagaac 1.16
+tagaag 2.03
+tagaat 0.803
+tagaca 0.0746
+tagacc 0.0926
+tagacg 0.867
+tagact 0.0592
+tagaga 0.0182
+tagagc 0.0464
+tagagg 0.431
+tagagt 0.0182
+tagata 0.0233
+tagatc 0.39
+tagatg 0.464
+tagatt 0.403
+tagcaa 0.00533
+tagcac 0.0233
+tagcag 0.0874
+tagcat 0.0105
+tagcca 0.00277
+tagccc 0.0079
+tagccg 0.0361
+tagcct 0.013
+tagcga 0.000201
+tagcgc 0.013
+tagcgg 0.0182
+tagcgt 0.000201
+tagcta 0.000201
+tagctc 0.0079
+tagctg 0.0361
+tagctt 0.0079
+taggaa 0.0643
+taggac 0.09
+taggag 1.68
+taggat 0.0464
+taggca 0.0361
+taggcc 0.0746
+taggcg 0.213
+taggct 0.0643
+taggga 0.0156
+tagggc 0.0284
+tagggg 0.172
+tagggt 0.0156
+taggta 0.00533
+taggtc 0.0207
+taggtg 0.513
+taggtt 0.0156
+tagtaa 0.0079
+tagtac 0.0105
+tagtag 0.0464
+tagtat 0.0105
+tagtca 0.0156
+tagtcc 0.0105
+tagtcg 0.746
+tagtct 0.367
+tagtga 0.000201
+tagtgc 0.00277
+tagtgg 0.0336
+tagtgt 0.0079
+tagtta 0.00533
+tagttc 0.0079
+tagttg 0.0669
+tagttt 0.0105
+tataaa 0.0079
+tataac 0.0105
+tataag 0.421
+tataat 0.013
+tataca 0.0105
+tatacc 0.00277
+tatacg 0.377
+tatact 0.00533
+tataga 0.000201
+tatagc 0.00533
+tatagg 0.013
+tatagt 0.000201
+tatata 0.0079
+tatatc 0.0079
+tatatg 0.0156
+tatatt 0.00533
+tatcaa 0.000201
+tatcac 0.000201
+tatcag 0.0105
+tatcat 0.00277
+tatcca 0.00533
+tatccc 0.00277
+tatccg 0.00277
+tatcct 0.00277
+tatcga 0.000201
+tatcgc 0.00533
+tatcgg 0.00277
+tatcgt 0.000201
+tatcta 0.00277
+tatctc 0.00277
+tatctg 0.00533
+tatctt 0.000201
+tatgaa 0.00533
+tatgac 0.0105
+tatgag 0.434
+tatgat 0.359
+tatgca 0.00277
+tatgcc 0.00277
+tatgcg 0.0207
+tatgct 0.00277
+tatgga 0.013
+tatggc 0.000201
+tatggg 0.00533
+tatggt 0.00533
+tatgta 0.000201
+tatgtc 0.000201
+tatgtg 0.013
+tatgtt 0.0079
+tattaa 0.00277
+tattac 0.000201
+tattag 0.00533
+tattat 0.0105
+tattca 0.000201
+tattcc 0.00277
+tattcg 0.0079
+tattct 0.00277
+tattga 0.000201
+tattgc 0.00277
+tattgg 0.000201
+tattgt 0.00277
+tattta 0.00533
+tatttc 0.00277
+tatttg 0.000201
+tatttt 0.00277
+tcaaaa 0.0079
+tcaaac 0.0182
+tcaaag 0.772
+tcaaat 0.013
+tcaaca 0.0105
+tcaacc 0.0105
+tcaacg 0.031
+tcaact 0.00533
+tcaaga 0.00277
+tcaagc 0.00277
+tcaagg 0.0233
+tcaagt 0.000201
+tcaata 0.00277
+tcaatc 0.00277
+tcaatg 0.013
+tcaatt 0.00277
+tcacaa 0.00533
+tcacac 0.0105
+tcacag 0.0259
+tcacat 0.000201
+tcacca 0.0079
+tcaccc 0.713
+tcaccg 0.00533
+tcacct 0.00533
+tcacga 0.357
+tcacgc 0.0079
+tcacgg 0.0105
+tcacgt 0.00533
+tcacta 0.00277
+tcactc 0.0079
+tcactg 0.000201
+tcactt 0.00533
+tcagaa 0.0105
+tcagac 0.0182
+tcagag 1.54
+tcagat 0.0182
+tcagca 0.00277
+tcagcc 0.0105
+tcagcg 0.0233
+tcagct 0.00277
+tcagga 0.0079
+tcaggc 0.00533
+tcaggg 0.0233
+tcaggt 0.000201
+tcagta 0.000201
+tcagtc 0.000201
+tcagtg 0.0156
+tcagtt 0.00277
+tcataa 0.00277
+tcatac 0.000201
+tcatag 0.0182
+tcatat 0.000201
+tcatca 0.000201
+tcatcc 0.0079
+tcatcg 0.00277
+tcatct 0.000201
+tcatga 0.0079
+tcatgc 0.00277
+tcatgg 0.362
+tcatgt 0.00533
+tcatta 0.00277
+tcattc 0.00277
+tcattg 0.00277
+tcattt 0.00277
+tccaaa 0.0105
+tccaac 0.723
+tccaag 0.426
+tccaat 0.0156
+tccaca 0.013
+tccacc 0.013
+tccacg 0.031
+tccact 0.00277
+tccaga 0.00277
+tccagc 0.0105
+tccagg 0.367
+tccagt 0.00277
+tccata 0.00533
+tccatc 0.0156
+tccatg 0.364
+tccatt 0.00533
+tcccaa 0.00533
+tcccac 0.013
+tcccag 0.0105
+tcccat 0.000201
+tcccca 0.000201
+tccccc 0.0182
+tccccg 0.000201
+tcccct 0.00277
+tcccga 0.00533
+tcccgc 0.0079
+tcccgg 0.00533
+tcccgt 0.000201
+tcccta 0.00533
+tccctc 0.362
+tccctg 0.0105
+tccctt 0.0079
+tccgaa 0.0079
+tccgac 0.38
+tccgag 0.444
+tccgat 0.0105
+tccgca 0.00533
+tccgcc 0.0207
+tccgcg 0.0336
+tccgct 0.000201
+tccgga 0.0105
+tccggc 0.0105
+tccggg 0.0207
+tccggt 0.000201
+tccgta 0.00277
+tccgtc 0.0207
+tccgtg 0.372
+tccgtt 0.00533
+tcctaa 0.357
+tcctac 0.013
+tcctag 0.0079
+tcctat 0.00277
+tcctca 0.00533
+tcctcc 0.359
+tcctcg 0.00277
+tcctct 0.00533
+tcctga 0.00277
+tcctgc 0.00533
+tcctgg 0.0079
+tcctgt 0.00533
+tcctta 0.00277
+tccttc 0.0079
+tccttg 0.0079
+tccttt 0.00277
+tcgaaa 0.0669
+tcgaac 0.787
+tcgaag 3.72
+tcgaat 1.12
+tcgaca 1.09
+tcgacc 0.405
+tcgacg 1.18
+tcgact 0.0284
+tcgaga 0.0156
+tcgagc 0.0156
+tcgagg 0.418
+tcgagt 0.0156
+tcgata 0.369
+tcgatc 0.0182
+tcgatg 0.0592
+tcgatt 0.377
+tcgcaa 0.00277
+tcgcac 0.0182
+tcgcag 0.444
+tcgcat 0.0156
+tcgcca 0.0079
+tcgccc 0.0182
+tcgccg 0.0259
+tcgcct 0.00277
+tcgcga 0.00277
+tcgcgc 0.000201
+tcgcgg 0.0156
+tcgcgt 0.00277
+tcgcta 0.00533
+tcgctc 0.00533
+tcgctg 0.0079
+tcgctt 0.367
+tcggaa 0.0361
+tcggac 0.0695
+tcggag 4.95
+tcggat 0.4
+tcggca 0.0233
+tcggcc 0.38
+tcggcg 1.16
+tcggct 0.0207
+tcggga 0.0105
+tcgggc 0.0233
+tcgggg 1.14
+tcgggt 0.0182
+tcggta 0.00533
+tcggtc 0.00533
+tcggtg 0.0592
+tcggtt 0.369
+tcgtaa 0.00277
+tcgtac 0.00533
+tcgtag 0.0695
+tcgtat 0.0105
+tcgtca 0.0079
+tcgtcc 0.0079
+tcgtcg 0.0284
+tcgtct 0.00533
+tcgtga 0.000201
+tcgtgc 0.000201
+tcgtgg 0.013
+tcgtgt 0.000201
+tcgtta 0.00533
+tcgttc 0.000201
+tcgttg 0.00277
+tcgttt 0.0105
+tctaaa 0.0105
+tctaac 0.0182
+tctaag 0.803
+tctaat 0.013
+tctaca 0.369
+tctacc 0.0079
+tctacg 0.39
+tctact 0.0105
+tctaga 0.00533
+tctagc 0.00533
+tctagg 0.013
+tctagt 0.000201
+tctata 0.013
+tctatc 0.0079
+tctatg 0.0105
+tctatt 0.00277
+tctcaa 0.000201
+tctcac 0.00533
+tctcag 0.0233
+tctcat 0.000201
+tctcca 0.00533
+tctccc 0.0105
+tctccg 0.00277
+tctcct 0.000201
+tctcga 0.00533
+tctcgc 0.00277
+tctcgg 0.00277
+tctcgt 0.00277
+tctcta 0.00277
+tctctc 0.00533
+tctctg 0.00277
+tctctt 0.00277
+tctgaa 0.0207
+tctgac 0.382
+tctgag 2.25
+tctgat 0.0259
+tctgca 0.00533
+tctgcc 0.0079
+tctgcg 0.0361
+tctgct 0.0079
+tctgga 0.359
+tctggc 0.0079
+tctggg 0.0284
+tctggt 0.0079
+tctgta 0.0079
+tctgtc 0.00277
+tctgtg 0.031
+tctgtt 0.0079
+tcttaa 0.00277
+tcttac 0.00277
+tcttag 0.0207
+tcttat 0.00277
+tcttca 0.0079
+tcttcc 0.00533
+tcttcg 0.00277
+tcttct 0.000201
+tcttga 0.00277
+tcttgc 0.000201
+tcttgg 0.00533
+tcttgt 0.00277
+tcttta 0.00533
+tctttc 0.000201
+tctttg 0.000201
+tctttt 0.00277
+tgaaaa 0.00533
+tgaaac 0.0156
+tgaaag 0.79
+tgaaat 0.00533
+tgaaca 0.013
+tgaacc 0.0079
+tgaacg 1.09
+tgaact 0.013
+tgaaga 0.0079
+tgaagc 0.00533
+tgaagg 0.377
+tgaagt 0.00533
+tgaata 0.00277
+tgaatc 0.00277
+tgaatg 0.0156
+tgaatt 0.000201
+tgacaa 0.00277
+tgacac 0.00533
+tgacag 0.382
+tgacat 0.00277
+tgacca 0.00533
+tgaccc 0.013
+tgaccg 0.013
+tgacct 0.000201
+tgacga 0.0079
+tgacgc 0.0079
+tgacgg 0.364
+tgacgt 0.00533
+tgacta 0.000201
+tgactc 0.00533
+tgactg 0.0105
+tgactt 0.00277
+tgagaa 0.0105
+tgagac 0.367
+tgagag 0.826
+tgagat 0.0079
+tgagca 0.00533
+tgagcc 0.013
+tgagcg 0.031
+tgagct 0.00277
+tgagga 0.0079
+tgaggc 0.0105
+tgaggg 0.0182
+tgaggt 0.013
+tgagta 0.000201
+tgagtc 0.00533
+tgagtg 0.0182
+tgagtt 0.0079
+tgataa 0.00277
+tgatac 0.00277
+tgatag 0.013
+tgatat 0.00533
+tgatca 0.00277
+tgatcc 0.000201
+tgatcg 0.013
+tgatct 0.00277
+tgatga 0.359
+tgatgc 0.0105
+tgatgg 0.0182
+tgatgt 0.367
+tgatta 0.00533
+tgattc 0.000201
+tgattg 0.000201
+tgattt 0.00277
+tgcaaa 0.00277
+tgcaac 0.013
+tgcaag 0.408
+tgcaat 0.0079
+tgcaca 0.0105
+tgcacc 0.0105
+tgcacg 0.0259
+tgcact 0.359
+tgcaga 0.00277
+tgcagc 0.0105
+tgcagg 0.369
+tgcagt 0.0105
+tgcata 0.00277
+tgcatc 0.013
+tgcatg 0.013
+tgcatt 0.0079
+tgccaa 0.00277
+tgccac 0.013
+tgccag 0.0259
+tgccat 0.00277
+tgccca 0.0105
+tgcccc 0.375
+tgcccg 0.00277
+tgccct 0.0105
+tgccga 0.00277
+tgccgc 0.367
+tgccgg 0.013
+tgccgt 0.0156
+tgccta 0.00533
+tgcctc 0.377
+tgcctg 0.013
+tgcctt 0.359
+tgcgaa 0.0079
+tgcgac 0.0233
+tgcgag 0.798
+tgcgat 0.0105
+tgcgca 0.359
+tgcgcc 0.367
+tgcgcg 0.0336
+tgcgct 0.0079
+tgcgga 0.0182
+tgcggc 0.0182
+tgcggg 0.0207
+tgcggt 0.013
+tgcgta 0.0105
+tgcgtc 0.372
+tgcgtg 0.728
+tgcgtt 0.0207
+tgctaa 0.00277
+tgctac 0.00277
+tgctag 0.0105
+tgctat 0.0079
+tgctca 0.00277
+tgctcc 0.0182
+tgctcg 0.0105
+tgctct 0.0105
+tgctga 0.0156
+tgctgc 0.367
+tgctgg 0.369
+tgctgt 0.723
+tgctta 0.00533
+tgcttc 0.0105
+tgcttg 0.0105
+tgcttt 0.0079
+tggaaa 0.0515
+tggaac 0.772
+tggaag 3.39
+tggaat 0.0618
+tggaca 0.385
+tggacc 0.0182
+tggacg 1.18
+tggact 0.0156
+tggaga 0.0079
+tggagc 0.0156
+tggagg 0.0567
+tggagt 0.0079
+tggata 0.364
+tggatc 0.0156
+tggatg 0.0541
+tggatt 0.0156
+tggcaa 0.0105
+tggcac 0.0233
+tggcag 1.5
+tggcat 0.0105
+tggcca 0.0079
+tggccc 0.0105
+tggccg 0.031
+tggcct 0.00533
+tggcga 0.000201
+tggcgc 0.0156
+tggcgg 0.0182
+tggcgt 0.00533
+tggcta 0.00533
+tggctc 0.0105
+tggctg 0.0182
+tggctt 0.013
+tgggaa 0.0438
+tgggac 0.423
+tgggag 5.97
+tgggat 0.0592
+tgggca 0.0105
+tgggcc 0.0284
+tgggcg 0.81
+tgggct 0.0156
+tgggga 0.0207
+tggggc 1.08
+tggggg 0.454
+tggggt 0.731
+tgggta 0.0105
+tgggtc 0.0182
+tgggtg 0.0772
+tgggtt 0.723
+tggtaa 0.0079
+tggtac 0.0079
+tggtag 0.0849
+tggtat 0.00277
+tggtca 0.013
+tggtcc 0.00533
+tggtcg 0.741
+tggtct 0.0156
+tggtga 0.0079
+tggtgc 0.0105
+tggtgg 0.0156
+tggtgt 0.013
+tggtta 0.359
+tggttc 0.00277
+tggttg 0.013
+tggttt 0.0105
+tgtaaa 0.0105
+tgtaac 0.0182
+tgtaag 0.775
+tgtaat 0.013
+tgtaca 0.369
+tgtacc 0.0182
+tgtacg 0.0464
+tgtact 0.362
+tgtaga 0.0079
+tgtagc 0.369
+tgtagg 0.0207
+tgtagt 0.0079
+tgtata 0.013
+tgtatc 0.367
+tgtatg 0.0156
+tgtatt 0.0079
+tgtcaa 0.00277
+tgtcac 0.0105
+tgtcag 0.031
+tgtcat 0.00277
+tgtcca 0.364
+tgtccc 0.369
+tgtccg 0.0182
+tgtcct 0.0079
+tgtcga 0.0105
+tgtcgc 0.369
+tgtcgg 0.367
+tgtcgt 0.0079
+tgtcta 0.0105
+tgtctc 0.372
+tgtctg 0.367
+tgtctt 0.0105
+tgtgaa 0.013
+tgtgac 0.377
+tgtgag 1.18
+tgtgat 0.0207
+tgtgca 0.0182
+tgtgcc 0.385
+tgtgcg 0.736
+tgtgct 0.0182
+tgtgga 0.362
+tgtggc 0.0284
+tgtggg 0.0387
+tgtggt 0.369
+tgtgta 0.0156
+tgtgtc 0.0207
+tgtgtg 0.741
+tgtgtt 0.372
+tgttaa 0.00277
+tgttac 0.00533
+tgttag 0.0156
+tgttat 0.357
+tgttca 0.00533
+tgttcc 0.0079
+tgttcg 0.0105
+tgttct 0.00533
+tgttga 0.0079
+tgttgc 0.0105
+tgttgg 0.00533
+tgttgt 0.0156
+tgttta 0.0105
+tgtttc 0.00533
+tgtttg 0.0105
+tgtttt 0.0079
+ttaaaa 0.00277
+ttaaac 0.000201
+ttaaag 0.0413
+ttaaat 0.00277
+ttaaca 0.00277
+ttaacc 0.000201
+ttaacg 0.0156
+ttaact 0.00277
+ttaaga 0.000201
+ttaagc 0.00277
+ttaagg 0.00533
+ttaagt 0.000201
+ttaata 0.00533
+ttaatc 0.00533
+ttaatg 0.00277
+ttaatt 0.000201
+ttacaa 0.000201
+ttacac 0.00533
+ttacag 0.0079
+ttacat 0.000201
+ttacca 0.00277
+ttaccc 0.0079
+ttaccg 0.000201
+ttacct 0.00277
+ttacga 0.00277
+ttacgc 0.000201
+ttacgg 0.00277
+ttacgt 0.00277
+ttacta 0.00533
+ttactc 0.00277
+ttactg 0.00277
+ttactt 0.00277
+ttagaa 0.000201
+ttagac 0.00277
+ttagag 0.0464
+ttagat 0.00277
+ttagca 0.00277
+ttagcc 0.00277
+ttagcg 0.0105
+ttagct 0.357
+ttagga 0.000201
+ttaggc 0.00277
+ttaggg 0.0079
+ttaggt 0.00277
+ttagta 0.00277
+ttagtc 0.00277
+ttagtg 0.359
+ttagtt 0.0079
+ttataa 0.000201
+ttatac 0.000201
+ttatag 0.00533
+ttatat 0.000201
+ttatca 0.000201
+ttatcc 0.00533
+ttatcg 0.000201
+ttatct 0.00533
+ttatga 0.00277
+ttatgc 0.000201
+ttatgg 0.00277
+ttatgt 0.00533
+ttatta 0.00533
+ttattc 0.00277
+ttattg 0.00277
+ttattt 0.00277
+ttcaaa 0.00533
+ttcaac 0.0105
+ttcaag 0.39
+ttcaat 0.00533
+ttcaca 0.000201
+ttcacc 0.00533
+ttcacg 0.0284
+ttcact 0.00533
+ttcaga 0.000201
+ttcagc 0.00533
+ttcagg 0.0105
+ttcagt 0.000201
+ttcata 0.0079
+ttcatc 0.364
+ttcatg 0.0079
+ttcatt 0.00277
+ttccaa 0.000201
+ttccac 0.00533
+ttccag 0.0105
+ttccat 0.00277
+ttccca 0.000201
+ttcccc 0.013
+ttcccg 0.000201
+ttccct 0.00533
+ttccga 0.000201
+ttccgc 0.0079
+ttccgg 0.00277
+ttccgt 0.000201
+ttccta 0.00533
+ttcctc 0.367
+ttcctg 0.00277
+ttcctt 0.0079
+ttcgaa 0.000201
+ttcgac 0.00277
+ttcgag 0.0438
+ttcgat 0.000201
+ttcgca 0.00277
+ttcgcc 0.0105
+ttcgcg 0.0156
+ttcgct 0.00533
+ttcgga 0.00533
+ttcggc 0.000201
+ttcggg 0.0105
+ttcggt 0.00277
+ttcgta 0.000201
+ttcgtc 0.0105
+ttcgtg 0.0207
+ttcgtt 0.0079
+ttctaa 0.00277
+ttctac 0.00533
+ttctag 0.0079
+ttctat 0.00277
+ttctca 0.00533
+ttctcc 0.367
+ttctcg 0.00533
+ttctct 0.359
+ttctga 0.000201
+ttctgc 0.0105
+ttctgg 0.00277
+ttctgt 0.0105
+ttctta 0.0079
+ttcttc 0.364
+ttcttg 0.00277
+ttcttt 0.0079
+ttgaaa 0.0361
+ttgaac 0.0515
+ttgaag 2.66
+ttgaat 0.398
+ttgaca 0.0284
+ttgacc 0.031
+ttgacg 1.14
+ttgact 0.0156
+ttgaga 0.00277
+ttgagc 0.00533
+ttgagg 0.398
+ttgagt 0.013
+ttgata 0.0105
+ttgatc 0.0105
+ttgatg 0.0438
+ttgatt 0.0156
+ttgcaa 0.0079
+ttgcac 0.369
+ttgcag 0.785
+ttgcat 0.013
+ttgcca 0.00277
+ttgccc 0.359
+ttgccg 0.0207
+ttgcct 0.00533
+ttgcga 0.000201
+ttgcgc 0.00533
+ttgcgg 0.013
+ttgcgt 0.00277
+ttgcta 0.00533
+ttgctc 0.013
+ttgctg 0.013
+ttgctt 0.359
+ttggaa 0.0156
+ttggac 0.0259
+ttggag 2.44
+ttggat 0.0361
+ttggca 0.0156
+ttggcc 0.0259
+ttggcg 0.772
+ttggct 0.0079
+ttggga 0.00533
+ttgggc 0.013
+ttgggg 0.41
+ttgggt 0.0079
+ttggta 0.000201
+ttggtc 0.000201
+ttggtg 0.0387
+ttggtt 0.0156
+ttgtaa 0.00533
+ttgtac 0.0079
+ttgtag 0.767
+ttgtat 0.0079
+ttgtca 0.000201
+ttgtcc 0.0079
+ttgtcg 0.031
+ttgtct 0.00533
+ttgtga 0.00277
+ttgtgc 0.000201
+ttgtgg 0.0105
+ttgtgt 0.00277
+ttgtta 0.0079
+ttgttc 0.00277
+ttgttg 0.00533
+ttgttt 0.00533
+tttaaa 0.369
+tttaac 0.0156
+tttaag 1.11
+tttaat 0.013
+tttaca 0.013
+tttacc 0.0105
+tttacg 0.0233
+tttact 0.00277
+tttaga 0.0105
+tttagc 0.362
+tttagg 0.0156
+tttagt 0.00533
+tttata 0.728
+tttatc 0.372
+tttatg 0.0182
+tttatt 0.013
+tttcaa 0.00533
+tttcac 0.00533
+tttcag 0.0182
+tttcat 0.000201
+tttcca 0.00533
+tttccc 0.0079
+tttccg 0.000201
+tttcct 0.000201
+tttcga 0.00277
+tttcgc 0.00533
+tttcgg 0.00533
+tttcgt 0.00277
+tttcta 0.367
+tttctc 0.0105
+tttctg 0.0105
+tttctt 0.0105
+tttgaa 0.00533
+tttgac 0.0079
+tttgag 0.428
+tttgat 0.0079
+tttgca 0.000201
+tttgcc 0.00533
+tttgcg 0.0182
+tttgct 0.00533
+tttgga 0.0079
+tttggc 0.00533
+tttggg 0.364
+tttggt 0.013
+tttgta 0.0207
+tttgtc 0.013
+tttgtg 0.375
+tttgtt 0.369
+ttttaa 0.0079
+ttttac 0.00533
+ttttag 0.0182
+ttttat 0.0079
+ttttca 0.0105
+ttttcc 0.362
+ttttcg 0.00277
+ttttct 0.0105
+ttttga 0.0079
+ttttgc 0.0079
+ttttgg 0.00533
+ttttgt 0.359
+ttttta 0.728
+tttttc 0.0156
+tttttg 0.0105
+tttttt 0.367
+
+#
+# Length probabilities
+#
+[LENGTH]
+# The 'd' variable
+950
+# The length probabilities from '0' to 'd' (*1000)
+1.48e-18
+8.43e-18
+4.61e-17
+2.43e-16
+1.23e-15
+5.95e-15
+2.78e-14
+1.24e-13
+5.36e-13
+2.22e-12
+8.81e-12
+3.37e-11
+1.24e-10
+4.36e-10
+1.48e-09
+4.82e-09
+1.51e-08
+4.57e-08
+1.33e-07
+3.74e-07
+1.02e-06
+2.67e-06
+6.84e-06
+1.7e-05
+4.14e-05
+9.81e-05
+0.000227
+0.000514
+0.00113
+0.0024
+0.00492
+0.00971
+0.0183
+0.0331
+0.0568
+0.0928
+0.144
+0.213
+0.298
+0.398
+0.506
+0.615
+0.716
+0.802
+0.869
+0.915
+0.94
+0.949
+0.946
+0.935
+0.921
+0.91
+0.907
+0.918
+0.944
+0.987
+1.04
+1.1
+1.16
+1.2
+1.22
+1.22
+1.2
+1.17
+1.13
+1.09
+1.07
+1.05
+1.04
+1.03
+1.03
+1.03
+1.02
+1.01
+0.994
+0.968
+0.933
+0.892
+0.848
+0.808
+0.782
+0.776
+0.797
+0.845
+0.919
+1.01
+1.11
+1.21
+1.29
+1.36
+1.41
+1.44
+1.46
+1.46
+1.47
+1.47
+1.48
+1.5
+1.52
+1.55
+1.57
+1.58
+1.59
+1.59
+1.59
+1.6
+1.61
+1.64
+1.67
+1.72
+1.77
+1.82
+1.87
+1.91
+1.93
+1.94
+1.94
+1.94
+1.93
+1.93
+1.94
+1.96
+2
+2.03
+2.06
+2.07
+2.06
+2.03
+1.98
+1.92
+1.85
+1.79
+1.73
+1.69
+1.66
+1.63
+1.62
+1.62
+1.62
+1.63
+1.64
+1.64
+1.64
+1.64
+1.63
+1.61
+1.58
+1.54
+1.5
+1.46
+1.4
+1.35
+1.29
+1.23
+1.18
+1.13
+1.09
+1.05
+1.03
+1.01
+1.01
+1.01
+1.02
+1.04
+1.07
+1.1
+1.14
+1.19
+1.23
+1.27
+1.31
+1.35
+1.38
+1.4
+1.41
+1.42
+1.42
+1.43
+1.42
+1.42
+1.42
+1.41
+1.4
+1.39
+1.38
+1.37
+1.34
+1.32
+1.28
+1.24
+1.2
+1.15
+1.1
+1.05
+1
+0.956
+0.912
+0.874
+0.841
+0.814
+0.794
+0.78
+0.773
+0.772
+0.778
+0.789
+0.805
+0.827
+0.853
+0.882
+0.914
+0.948
+0.984
+1.02
+1.05
+1.09
+1.12
+1.14
+1.17
+1.18
+1.2
+1.21
+1.21
+1.21
+1.21
+1.21
+1.2
+1.19
+1.19
+1.18
+1.17
+1.17
+1.17
+1.17
+1.17
+1.17
+1.17
+1.18
+1.18
+1.18
+1.18
+1.18
+1.18
+1.18
+1.17
+1.16
+1.15
+1.14
+1.13
+1.11
+1.09
+1.08
+1.06
+1.04
+1.03
+1.01
+1
+0.99
+0.982
+0.977
+0.974
+0.973
+0.974
+0.977
+0.982
+0.988
+0.996
+1.01
+1.01
+1.02
+1.04
+1.05
+1.06
+1.07
+1.08
+1.09
+1.1
+1.1
+1.11
+1.12
+1.13
+1.13
+1.14
+1.14
+1.15
+1.15
+1.16
+1.16
+1.16
+1.17
+1.17
+1.17
+1.18
+1.18
+1.18
+1.18
+1.18
+1.18
+1.17
+1.17
+1.16
+1.16
+1.15
+1.14
+1.13
+1.12
+1.11
+1.09
+1.08
+1.07
+1.06
+1.05
+1.04
+1.03
+1.02
+1.01
+1
+0.993
+0.987
+0.982
+0.978
+0.975
+0.972
+0.97
+0.968
+0.966
+0.965
+0.964
+0.964
+0.963
+0.963
+0.963
+0.964
+0.965
+0.966
+0.968
+0.97
+0.973
+0.976
+0.98
+0.985
+0.99
+0.996
+1
+1.01
+1.01
+1.02
+1.03
+1.04
+1.04
+1.05
+1.06
+1.06
+1.07
+1.07
+1.08
+1.08
+1.09
+1.09
+1.1
+1.1
+1.1
+1.1
+1.1
+1.1
+1.1
+1.1
+1.1
+1.1
+1.1
+1.1
+1.1
+1.1
+1.09
+1.09
+1.09
+1.09
+1.08
+1.08
+1.08
+1.07
+1.07
+1.07
+1.06
+1.06
+1.06
+1.06
+1.06
+1.05
+1.05
+1.05
+1.05
+1.05
+1.06
+1.06
+1.06
+1.07
+1.07
+1.08
+1.08
+1.09
+1.09
+1.1
+1.11
+1.12
+1.13
+1.13
+1.14
+1.15
+1.16
+1.17
+1.18
+1.19
+1.19
+1.2
+1.21
+1.22
+1.22
+1.23
+1.23
+1.24
+1.25
+1.25
+1.26
+1.26
+1.26
+1.27
+1.27
+1.28
+1.28
+1.28
+1.29
+1.29
+1.29
+1.3
+1.3
+1.31
+1.31
+1.31
+1.32
+1.32
+1.33
+1.33
+1.33
+1.34
+1.34
+1.35
+1.35
+1.35
+1.36
+1.36
+1.36
+1.37
+1.37
+1.37
+1.38
+1.38
+1.38
+1.38
+1.39
+1.39
+1.39
+1.39
+1.39
+1.39
+1.4
+1.4
+1.4
+1.4
+1.4
+1.41
+1.41
+1.41
+1.41
+1.42
+1.42
+1.43
+1.43
+1.43
+1.44
+1.44
+1.45
+1.45
+1.46
+1.46
+1.47
+1.47
+1.47
+1.48
+1.48
+1.48
+1.49
+1.49
+1.49
+1.49
+1.49
+1.49
+1.49
+1.49
+1.49
+1.49
+1.48
+1.48
+1.47
+1.47
+1.46
+1.46
+1.45
+1.44
+1.43
+1.42
+1.41
+1.4
+1.39
+1.38
+1.37
+1.36
+1.35
+1.34
+1.32
+1.31
+1.3
+1.29
+1.28
+1.26
+1.25
+1.24
+1.23
+1.22
+1.2
+1.19
+1.18
+1.17
+1.16
+1.15
+1.14
+1.13
+1.12
+1.11
+1.1
+1.1
+1.09
+1.08
+1.07
+1.07
+1.06
+1.06
+1.05
+1.05
+1.04
+1.04
+1.04
+1.03
+1.03
+1.03
+1.03
+1.03
+1.03
+1.03
+1.03
+1.03
+1.03
+1.03
+1.03
+1.04
+1.04
+1.04
+1.05
+1.05
+1.05
+1.06
+1.06
+1.07
+1.07
+1.08
+1.08
+1.09
+1.09
+1.1
+1.1
+1.11
+1.11
+1.12
+1.12
+1.13
+1.14
+1.14
+1.15
+1.15
+1.16
+1.16
+1.16
+1.17
+1.17
+1.18
+1.18
+1.19
+1.19
+1.19
+1.2
+1.2
+1.2
+1.21
+1.21
+1.21
+1.21
+1.21
+1.22
+1.22
+1.22
+1.22
+1.22
+1.22
+1.22
+1.23
+1.23
+1.23
+1.23
+1.23
+1.23
+1.23
+1.23
+1.23
+1.23
+1.22
+1.22
+1.22
+1.22
+1.22
+1.22
+1.22
+1.22
+1.21
+1.21
+1.21
+1.21
+1.21
+1.2
+1.2
+1.2
+1.2
+1.19
+1.19
+1.19
+1.19
+1.18
+1.18
+1.18
+1.17
+1.17
+1.17
+1.16
+1.16
+1.16
+1.15
+1.15
+1.15
+1.14
+1.14
+1.14
+1.13
+1.13
+1.13
+1.12
+1.12
+1.12
+1.11
+1.11
+1.11
+1.1
+1.1
+1.1
+1.09
+1.09
+1.09
+1.08
+1.08
+1.08
+1.07
+1.07
+1.07
+1.07
+1.06
+1.06
+1.06
+1.06
+1.06
+1.05
+1.05
+1.05
+1.05
+1.05
+1.05
+1.04
+1.04
+1.04
+1.04
+1.04
+1.04
+1.03
+1.03
+1.03
+1.03
+1.03
+1.03
+1.03
+1.02
+1.02
+1.02
+1.02
+1.02
+1.02
+1.01
+1.01
+1.01
+1.01
+1.01
+1
+1
+0.998
+0.995
+0.993
+0.99
+0.987
+0.984
+0.981
+0.978
+0.975
+0.971
+0.968
+0.965
+0.961
+0.958
+0.954
+0.95
+0.947
+0.943
+0.94
+0.936
+0.933
+0.929
+0.926
+0.922
+0.919
+0.915
+0.912
+0.909
+0.906
+0.902
+0.899
+0.897
+0.894
+0.891
+0.889
+0.886
+0.884
+0.882
+0.88
+0.878
+0.876
+0.874
+0.873
+0.871
+0.87
+0.869
+0.868
+0.867
+0.866
+0.865
+0.865
+0.864
+0.864
+0.863
+0.863
+0.863
+0.863
+0.862
+0.862
+0.862
+0.862
+0.862
+0.862
+0.863
+0.863
+0.863
+0.863
+0.863
+0.863
+0.863
+0.863
+0.862
+0.862
+0.862
+0.862
+0.861
+0.861
+0.861
+0.86
+0.859
+0.859
+0.858
+0.857
+0.856
+0.855
+0.854
+0.853
+0.851
+0.85
+0.849
+0.847
+0.845
+0.844
+0.842
+0.84
+0.839
+0.837
+0.835
+0.833
+0.831
+0.829
+0.827
+0.825
+0.823
+0.821
+0.819
+0.817
+0.815
+0.813
+0.81
+0.808
+0.806
+0.804
+0.802
+0.8
+0.799
+0.797
+0.795
+0.793
+0.791
+0.79
+0.788
+0.786
+0.785
+0.783
+0.782
+0.78
+0.779
+0.778
+0.776
+0.775
+0.774
+0.773
+0.772
+0.771
+0.77
+0.769
+0.768
+0.767
+0.766
+0.766
+0.765
+0.764
+0.763
+0.763
+0.762
+0.761
+0.761
+0.76
+0.759
+0.759
+0.758
+0.757
+0.757
+0.756
+0.756
+0.755
+0.754
+0.754
+0.753
+0.752
+0.752
+0.751
+0.75
+0.75
+0.749
+0.748
+0.748
+0.747
+0.746
+0.745
+0.744
+0.744
+0.743
+0.742
+0.741
+0.74
+0.739
+0.739
+0.738
+0.737
+0.736
+0.735
+0.734
+0.733
+0.732
+0.731
+0.731
+0.73
+0.729
+0.728
+0.727
+0.726
+0.725
+0.724
+0.723
+0.722
+0.722
+0.721
+0.72
+0.719
+0.718
+0.717
+0.716
+0.715
+0.714
+0.714
+0.713
+0.712
+0.711
+0.71
+0.709
+0.708
+0.707
+0.706
+0.705
+0.704
+0.703
+0.702
+0.701
+0.7
+0.699
+0.698
+0.697
+0.696
+0.695
+0.694
+0.692
+0.691
+0.69
+0.689
+0.687
+# end of content independent part
+[1]
+# (a,c,g,t)= (0.299, 0.201, 0.201, 0.299)
+#
+# Probabilities file for the intron model
+#
+#
+# Transition probabilities
+#
+[TRANSITION]
+# the probability of an intron of length at most d
+0.524
+# mean additional length of introns with length > d
+1.32e+03
+
+#
+# The emission probabilities of introns
+#
+[EMISSION]
+# size of the emission vector
+1024
+#k=
+4
+# patpseudo : pseudocount for sequence patterns
+5
+aaaaa 0.3899
+aaaac 0.1992
+aaaag 0.1365
+aaaat 0.2744
+aaaca 0.4132
+aaacc 0.1889
+aaacg 0.183
+aaact 0.2149
+aaaga 0.257
+aaagc 0.2407
+aaagg 0.2064
+aaagt 0.2959
+aaata 0.3354
+aaatc 0.1615
+aaatg 0.2714
+aaatt 0.2317
+aacaa 0.306
+aacac 0.2481
+aacag 0.1696
+aacat 0.2763
+aacca 0.3392
+aaccc 0.281
+aaccg 0.1497
+aacct 0.2301
+aacga 0.2427
+aacgc 0.2372
+aacgg 0.172
+aacgt 0.3481
+aacta 0.2026
+aactc 0.2442
+aactg 0.2602
+aactt 0.293
+aagaa 0.3337
+aagac 0.1989
+aagag 0.2426
+aagat 0.2248
+aagca 0.3457
+aagcc 0.2213
+aagcg 0.1756
+aagct 0.2574
+aagga 0.2471
+aaggc 0.2445
+aaggg 0.2617
+aaggt 0.2467
+aagta 0.221
+aagtc 0.2029
+aagtg 0.3124
+aagtt 0.2638
+aataa 0.3917
+aatac 0.1876
+aatag 0.1247
+aatat 0.2961
+aatca 0.3133
+aatcc 0.2294
+aatcg 0.2139
+aatct 0.2434
+aatga 0.246
+aatgc 0.2159
+aatgg 0.1792
+aatgt 0.359
+aatta 0.2777
+aattc 0.181
+aattg 0.2397
+aattt 0.3016
+acaaa 0.3378
+acaac 0.2227
+acaag 0.175
+acaat 0.2646
+acaca 0.4064
+acacc 0.1885
+acacg 0.1996
+acact 0.2055
+acaga 0.2581
+acagc 0.2941
+acagg 0.2059
+acagt 0.2419
+acata 0.1788
+acatc 0.2151
+acatg 0.218
+acatt 0.3881
+accaa 0.2539
+accac 0.3313
+accag 0.2078
+accat 0.207
+accca 0.3162
+acccc 0.2966
+acccg 0.1709
+accct 0.2162
+accga 0.2799
+accgc 0.2781
+accgg 0.1885
+accgt 0.2534
+accta 0.1816
+acctc 0.2644
+acctg 0.2878
+acctt 0.2661
+acgaa 0.26
+acgac 0.2478
+acgag 0.2542
+acgat 0.238
+acgca 0.3336
+acgcc 0.2121
+acgcg 0.2445
+acgct 0.2099
+acgga 0.2255
+acggc 0.2833
+acggg 0.249
+acggt 0.2421
+acgta 0.1847
+acgtc 0.2208
+acgtg 0.3339
+acgtt 0.2607
+actaa 0.3071
+actac 0.263
+actag 0.1427
+actat 0.2872
+actca 0.3004
+actcc 0.2222
+actcg 0.2359
+actct 0.2416
+actga 0.2197
+actgc 0.3122
+actgg 0.2126
+actgt 0.2556
+actta 0.1916
+acttc 0.1964
+acttg 0.2479
+acttt 0.3641
+agaaa 0.3273
+agaac 0.1997
+agaag 0.226
+agaat 0.247
+agaca 0.3656
+agacc 0.2033
+agacg 0.2176
+agact 0.2135
+agaga 0.3008
+agagc 0.2185
+agagg 0.2648
+agagt 0.2159
+agata 0.2153
+agatc 0.1646
+agatg 0.3332
+agatt 0.2869
+agcaa 0.2569
+agcac 0.2332
+agcag 0.3013
+agcat 0.2087
+agcca 0.367
+agccc 0.2307
+agccg 0.1875
+agcct 0.2148
+agcga 0.2719
+agcgc 0.2448
+agcgg 0.2533
+agcgt 0.23
+agcta 0.1694
+agctc 0.2399
+agctg 0.3023
+agctt 0.2884
+aggaa 0.3126
+aggac 0.1972
+aggag 0.2892
+aggat 0.2009
+aggca 0.3086
+aggcc 0.2577
+aggcg 0.1992
+aggct 0.2345
+aggga 0.2444
+agggc 0.2129
+agggg 0.3196
+agggt 0.2231
+aggta 0.1945
+aggtc 0.2041
+aggtg 0.337
+aggtt 0.2643
+agtaa 0.3064
+agtac 0.2243
+agtag 0.182
+agtat 0.2872
+agtca 0.378
+agtcc 0.1797
+agtcg 0.2089
+agtct 0.2334
+agtga 0.2415
+agtgc 0.2169
+agtgg 0.2647
+agtgt 0.277
+agtta 0.2137
+agttc 0.1771
+agttg 0.2581
+agttt 0.3511
+ataaa 0.4034
+ataac 0.168
+ataag 0.1278
+ataat 0.3008
+ataca 0.4551
+atacc 0.1591
+atacg 0.1452
+atact 0.2406
+ataga 0.2737
+atagc 0.254
+atagg 0.2019
+atagt 0.2704
+atata 0.2961
+atatc 0.1592
+atatg 0.1844
+atatt 0.3603
+atcaa 0.2639
+atcac 0.2686
+atcag 0.1894
+atcat 0.2781
+atcca 0.3739
+atccc 0.2477
+atccg 0.1485
+atcct 0.23
+atcga 0.2566
+atcgc 0.2623
+atcgg 0.2016
+atcgt 0.2795
+atcta 0.1968
+atctc 0.2579
+atctg 0.277
+atctt 0.2683
+atgaa 0.3342
+atgac 0.2118
+atgag 0.1924
+atgat 0.2615
+atgca 0.4018
+atgcc 0.2018
+atgcg 0.15
+atgct 0.2464
+atgga 0.2708
+atggc 0.2443
+atggg 0.2296
+atggt 0.2553
+atgta 0.2478
+atgtc 0.1623
+atgtg 0.2632
+atgtt 0.3267
+attaa 0.3355
+attac 0.2094
+attag 0.1339
+attat 0.3211
+attca 0.3511
+attcc 0.241
+attcg 0.1485
+attct 0.2594
+attga 0.2358
+attgc 0.2271
+attgg 0.2041
+attgt 0.333
+attta 0.2575
+atttc 0.1687
+atttg 0.2201
+atttt 0.3537
+caaaa 0.3058
+caaac 0.2234
+caaag 0.1946
+caaat 0.2762
+caaca 0.4171
+caacc 0.2051
+caacg 0.173
+caact 0.2048
+caaga 0.26
+caagc 0.2548
+caagg 0.2231
+caagt 0.2621
+caata 0.243
+caatc 0.177
+caatg 0.2962
+caatt 0.2838
+cacaa 0.2841
+cacac 0.3003
+cacag 0.1954
+cacat 0.2202
+cacca 0.3604
+caccc 0.2461
+caccg 0.1835
+cacct 0.2101
+cacga 0.2393
+cacgc 0.2385
+cacgg 0.2182
+cacgt 0.304
+cacta 0.1582
+cactc 0.2286
+cactg 0.3271
+cactt 0.2861
+cagaa 0.2813
+cagac 0.219
+cagag 0.2614
+cagat 0.2384
+cagca 0.3911
+cagcc 0.2306
+cagcg 0.1711
+cagct 0.2072
+cagga 0.2666
+caggc 0.2179
+caggg 0.2559
+caggt 0.2597
+cagta 0.2107
+cagtc 0.2038
+cagtg 0.3536
+cagtt 0.2319
+cataa 0.2924
+catac 0.2456
+catag 0.1676
+catat 0.2943
+catca 0.3569
+catcc 0.1917
+catcg 0.1985
+catct 0.2529
+catga 0.2452
+catgc 0.2445
+catgg 0.2215
+catgt 0.2888
+catta 0.209
+cattc 0.1836
+cattg 0.2518
+cattt 0.3556
+ccaaa 0.3139
+ccaac 0.2311
+ccaag 0.199
+ccaat 0.2561
+ccaca 0.276
+ccacc 0.3023
+ccacg 0.206
+ccact 0.2156
+ccaga 0.2267
+ccagc 0.2903
+ccagg 0.2419
+ccagt 0.2411
+ccata 0.1854
+ccatc 0.2703
+ccatg 0.2522
+ccatt 0.2921
+cccaa 0.2341
+cccac 0.3366
+cccag 0.2125
+cccat 0.2168
+cccca 0.2229
+ccccc 0.4314
+ccccg 0.1359
+cccct 0.2098
+cccga 0.2364
+cccgc 0.2794
+cccgg 0.2125
+cccgt 0.2717
+cccta 0.1399
+ccctc 0.344
+ccctg 0.2586
+ccctt 0.2574
+ccgaa 0.2503
+ccgac 0.2284
+ccgag 0.2863
+ccgat 0.235
+ccgca 0.2534
+ccgcc 0.2972
+ccgcg 0.2091
+ccgct 0.2403
+ccgga 0.2081
+ccggc 0.2847
+ccggg 0.2635
+ccggt 0.2437
+ccgta 0.1718
+ccgtc 0.232
+ccgtg 0.3877
+ccgtt 0.2085
+cctaa 0.2733
+cctac 0.3134
+cctag 0.1569
+cctat 0.2564
+cctca 0.218
+cctcc 0.3485
+cctcg 0.1855
+cctct 0.248
+cctga 0.1914
+cctgc 0.2975
+cctgg 0.253
+cctgt 0.2581
+cctta 0.1792
+ccttc 0.2594
+ccttg 0.2548
+ccttt 0.3065
+cgaaa 0.3618
+cgaac 0.2086
+cgaag 0.19
+cgaat 0.2396
+cgaca 0.2692
+cgacc 0.2333
+cgacg 0.2729
+cgact 0.2246
+cgaga 0.2368
+cgagc 0.2374
+cgagg 0.2548
+cgagt 0.271
+cgata 0.1812
+cgatc 0.1779
+cgatg 0.3263
+cgatt 0.3146
+cgcaa 0.2467
+cgcac 0.3039
+cgcag 0.245
+cgcat 0.2043
+cgcca 0.2862
+cgccc 0.2343
+cgccg 0.2668
+cgcct 0.2127
+cgcga 0.228
+cgcgc 0.2914
+cgcgg 0.2169
+cgcgt 0.2637
+cgcta 0.155
+cgctc 0.2746
+cgctg 0.319
+cgctt 0.2514
+cggaa 0.2433
+cggac 0.2021
+cggag 0.338
+cggat 0.2167
+cggca 0.2601
+cggcc 0.2517
+cggcg 0.2683
+cggct 0.22
+cggga 0.2135
+cgggc 0.2201
+cgggg 0.3059
+cgggt 0.2605
+cggta 0.2021
+cggtc 0.1953
+cggtg 0.3803
+cggtt 0.2222
+cgtaa 0.2851
+cgtac 0.2331
+cgtag 0.2397
+cgtat 0.242
+cgtca 0.3466
+cgtcc 0.1875
+cgtcg 0.2405
+cgtct 0.2254
+cgtga 0.2719
+cgtgc 0.2122
+cgtgg 0.25
+cgtgt 0.2659
+cgtta 0.1888
+cgttc 0.1945
+cgttg 0.2602
+cgttt 0.3566
+ctaaa 0.3744
+ctaac 0.1982
+ctaag 0.1525
+ctaat 0.2749
+ctaca 0.3527
+ctacc 0.2232
+ctacg 0.2059
+ctact 0.2183
+ctaga 0.2844
+ctagc 0.2276
+ctagg 0.2338
+ctagt 0.2543
+ctata 0.2645
+ctatc 0.1845
+ctatg 0.2253
+ctatt 0.3256
+ctcaa 0.2883
+ctcac 0.2942
+ctcag 0.1779
+ctcat 0.2397
+ctcca 0.2949
+ctccc 0.2988
+ctccg 0.1672
+ctcct 0.2391
+ctcga 0.1906
+ctcgc 0.2904
+ctcgg 0.2341
+ctcgt 0.2849
+ctcta 0.1495
+ctctc 0.3017
+ctctg 0.2809
+ctctt 0.2679
+ctgaa 0.3207
+ctgac 0.2217
+ctgag 0.2037
+ctgat 0.2539
+ctgca 0.3354
+ctgcc 0.2185
+ctgcg 0.1498
+ctgct 0.2963
+ctgga 0.2396
+ctggc 0.2551
+ctggg 0.2363
+ctggt 0.269
+ctgta 0.2449
+ctgtc 0.1822
+ctgtg 0.3082
+ctgtt 0.2647
+cttaa 0.3581
+cttac 0.2122
+cttag 0.1515
+cttat 0.2782
+cttca 0.3493
+cttcc 0.2367
+cttcg 0.1372
+cttct 0.2768
+cttga 0.2252
+cttgc 0.2561
+cttgg 0.2171
+cttgt 0.3016
+cttta 0.2542
+ctttc 0.2082
+ctttg 0.2518
+ctttt 0.2857
+gaaaa 0.3295
+gaaac 0.21
+gaaag 0.1989
+gaaat 0.2617
+gaaca 0.3427
+gaacc 0.2435
+gaacg 0.1983
+gaact 0.2155
+gaaga 0.2779
+gaagc 0.2326
+gaagg 0.2557
+gaagt 0.2338
+gaata 0.2429
+gaatc 0.1876
+gaatg 0.2858
+gaatt 0.2837
+gacaa 0.2958
+gacac 0.2541
+gacag 0.2069
+gacat 0.2432
+gacca 0.318
+gaccc 0.2553
+gaccg 0.1816
+gacct 0.2452
+gacga 0.2688
+gacgc 0.1979
+gacgg 0.2099
+gacgt 0.3234
+gacta 0.1378
+gactc 0.2347
+gactg 0.316
+gactt 0.3114
+gagaa 0.2681
+gagac 0.2255
+gagag 0.2829
+gagat 0.2236
+gagca 0.3038
+gagcc 0.2329
+gagcg 0.2189
+gagct 0.2444
+gagga 0.2459
+gaggc 0.2257
+gaggg 0.3107
+gaggt 0.2177
+gagta 0.2015
+gagtc 0.1962
+gagtg 0.3202
+gagtt 0.282
+gataa 0.3284
+gatac 0.1876
+gatag 0.1697
+gatat 0.3142
+gatca 0.3166
+gatcc 0.2172
+gatcg 0.2164
+gatct 0.2498
+gatga 0.2789
+gatgc 0.1985
+gatgg 0.2376
+gatgt 0.285
+gatta 0.2275
+gattc 0.1929
+gattg 0.2408
+gattt 0.3387
+gcaaa 0.3092
+gcaac 0.2212
+gcaag 0.2121
+gcaat 0.2575
+gcaca 0.3395
+gcacc 0.2135
+gcacg 0.2224
+gcact 0.2246
+gcaga 0.216
+gcagc 0.3029
+gcagg 0.2143
+gcagt 0.2668
+gcata 0.1871
+gcatc 0.2144
+gcatg 0.2643
+gcatt 0.3342
+gccaa 0.2564
+gccac 0.3089
+gccag 0.2167
+gccat 0.2179
+gccca 0.2723
+gcccc 0.2994
+gcccg 0.1763
+gccct 0.252
+gccga 0.2225
+gccgc 0.3062
+gccgg 0.2009
+gccgt 0.2704
+gccta 0.1464
+gcctc 0.3002
+gcctg 0.2645
+gcctt 0.2889
+gcgaa 0.2125
+gcgac 0.2293
+gcgag 0.2999
+gcgat 0.2584
+gcgca 0.2577
+gcgcc 0.2246
+gcgcg 0.2834
+gcgct 0.2343
+gcgga 0.1882
+gcggc 0.3092
+gcggg 0.2467
+gcggt 0.256
+gcgta 0.1382
+gcgtc 0.2026
+gcgtg 0.3927
+gcgtt 0.2664
+gctaa 0.3107
+gctac 0.2645
+gctag 0.1365
+gctat 0.2883
+gctca 0.2949
+gctcc 0.247
+gctcg 0.2098
+gctct 0.2483
+gctga 0.1841
+gctgc 0.314
+gctgg 0.2267
+gctgt 0.2753
+gctta 0.164
+gcttc 0.223
+gcttg 0.275
+gcttt 0.3379
+ggaaa 0.3335
+ggaac 0.1723
+ggaag 0.2259
+ggaat 0.2682
+ggaca 0.3585
+ggacc 0.2111
+ggacg 0.2255
+ggact 0.2048
+ggaga 0.2709
+ggagc 0.2011
+ggagg 0.3444
+ggagt 0.1837
+ggata 0.2105
+ggatc 0.1696
+ggatg 0.2994
+ggatt 0.3205
+ggcaa 0.2694
+ggcac 0.2367
+ggcag 0.2791
+ggcat 0.2147
+ggcca 0.3401
+ggccc 0.2102
+ggccg 0.2141
+ggcct 0.2356
+ggcga 0.2711
+ggcgc 0.2193
+ggcgg 0.2926
+ggcgt 0.2171
+ggcta 0.1681
+ggctc 0.2339
+ggctg 0.3442
+ggctt 0.2537
+gggaa 0.2862
+gggac 0.1651
+gggag 0.3433
+gggat 0.2054
+gggca 0.3104
+gggcc 0.2261
+gggcg 0.2157
+gggct 0.2478
+gggga 0.2016
+ggggc 0.166
+ggggg 0.4315
+ggggt 0.2009
+gggta 0.1778
+gggtc 0.1879
+gggtg 0.3489
+gggtt 0.2854
+ggtaa 0.3757
+ggtac 0.1957
+ggtag 0.2122
+ggtat 0.2165
+ggtca 0.3637
+ggtcc 0.1888
+ggtcg 0.2211
+ggtct 0.2265
+ggtga 0.2628
+ggtgc 0.1829
+ggtgg 0.3291
+ggtgt 0.2253
+ggtta 0.2171
+ggttc 0.2043
+ggttg 0.2638
+ggttt 0.3148
+gtaaa 0.3982
+gtaac 0.1844
+gtaag 0.1385
+gtaat 0.2788
+gtaca 0.4202
+gtacc 0.1768
+gtacg 0.1719
+gtact 0.231
+gtaga 0.2606
+gtagc 0.2369
+gtagg 0.2509
+gtagt 0.2517
+gtata 0.2737
+gtatc 0.1447
+gtatg 0.2342
+gtatt 0.3474
+gtcaa 0.253
+gtcac 0.3397
+gtcag 0.1724
+gtcat 0.2348
+gtcca 0.3293
+gtccc 0.237
+gtccg 0.1649
+gtcct 0.2688
+gtcga 0.231
+gtcgc 0.2487
+gtcgg 0.2093
+gtcgt 0.311
+gtcta 0.1477
+gtctc 0.2948
+gtctg 0.2884
+gtctt 0.2691
+gtgaa 0.2719
+gtgac 0.2806
+gtgag 0.2163
+gtgat 0.2313
+gtgca 0.3268
+gtgcc 0.2078
+gtgcg 0.2084
+gtgct 0.2571
+gtgga 0.2255
+gtggc 0.2413
+gtggg 0.2484
+gtggt 0.2847
+gtgta 0.2133
+gtgtc 0.1623
+gtgtg 0.3435
+gtgtt 0.2809
+gttaa 0.3588
+gttac 0.2143
+gttag 0.1494
+gttat 0.2775
+gttca 0.3464
+gttcc 0.2049
+gttcg 0.1711
+gttct 0.2776
+gttga 0.2471
+gttgc 0.2227
+gttgg 0.2102
+gttgt 0.32
+gttta 0.2259
+gtttc 0.1838
+gtttg 0.2417
+gtttt 0.3486
+taaaa 0.3628
+taaac 0.1827
+taaag 0.1719
+taaat 0.2827
+taaca 0.3869
+taacc 0.2232
+taacg 0.1659
+taact 0.2241
+taaga 0.2573
+taagc 0.2206
+taagg 0.2279
+taagt 0.2942
+taata 0.2765
+taatc 0.163
+taatg 0.2398
+taatt 0.3207
+tacaa 0.2824
+tacac 0.2436
+tacag 0.2029
+tacat 0.271
+tacca 0.3276
+taccc 0.245
+taccg 0.1905
+tacct 0.2369
+tacga 0.2507
+tacgc 0.1803
+tacgg 0.2077
+tacgt 0.3613
+tacta 0.1774
+tactc 0.2187
+tactg 0.2963
+tactt 0.3077
+tagaa 0.3283
+tagac 0.1791
+tagag 0.2222
+tagat 0.2705
+tagca 0.3361
+tagcc 0.2398
+tagcg 0.177
+tagct 0.2472
+tagga 0.2488
+taggc 0.2143
+taggg 0.2459
+taggt 0.2911
+tagta 0.2227
+tagtc 0.1569
+tagtg 0.3018
+tagtt 0.3186
+tataa 0.3024
+tatac 0.2094
+tatag 0.1435
+tatat 0.3448
+tatca 0.3429
+tatcc 0.2168
+tatcg 0.1774
+tatct 0.2629
+tatga 0.2548
+tatgc 0.2252
+tatgg 0.2119
+tatgt 0.3081
+tatta 0.2311
+tattc 0.1495
+tattg 0.1981
+tattt 0.4213
+tcaaa 0.3123
+tcaac 0.2414
+tcaag 0.1834
+tcaat 0.2629
+tcaca 0.2874
+tcacc 0.2597
+tcacg 0.2412
+tcact 0.2117
+tcaga 0.2565
+tcagc 0.2625
+tcagg 0.2037
+tcagt 0.2774
+tcata 0.1827
+tcatc 0.2601
+tcatg 0.2287
+tcatt 0.3286
+tccaa 0.2375
+tccac 0.3
+tccag 0.2115
+tccat 0.251
+tccca 0.2862
+tcccc 0.315
+tcccg 0.1482
+tccct 0.2507
+tccga 0.234
+tccgc 0.2604
+tccgg 0.205
+tccgt 0.3006
+tccta 0.1528
+tcctc 0.2939
+tcctg 0.2909
+tcctt 0.2623
+tcgaa 0.2304
+tcgac 0.2474
+tcgag 0.2286
+tcgat 0.2936
+tcgca 0.2601
+tcgcc 0.2706
+tcgcg 0.2159
+tcgct 0.2534
+tcgga 0.1966
+tcggc 0.2612
+tcggg 0.2427
+tcggt 0.2995
+tcgta 0.1695
+tcgtc 0.2427
+tcgtg 0.3475
+tcgtt 0.2404
+tctaa 0.2954
+tctac 0.2655
+tctag 0.1556
+tctat 0.2834
+tctca 0.2706
+tctcc 0.2746
+tctcg 0.1728
+tctct 0.2821
+tctga 0.2188
+tctgc 0.2722
+tctgg 0.2152
+tctgt 0.2938
+tctta 0.174
+tcttc 0.2424
+tcttg 0.2553
+tcttt 0.3283
+tgaaa 0.3288
+tgaac 0.1925
+tgaag 0.2204
+tgaat 0.2583
+tgaca 0.3029
+tgacc 0.2261
+tgacg 0.2317
+tgact 0.2394
+tgaga 0.275
+tgagc 0.2473
+tgagg 0.2219
+tgagt 0.2558
+tgata 0.2113
+tgatc 0.157
+tgatg 0.3538
+tgatt 0.2779
+tgcaa 0.2676
+tgcac 0.222
+tgcag 0.2555
+tgcat 0.2549
+tgcca 0.3444
+tgccc 0.2389
+tgccg 0.1832
+tgcct 0.2335
+tgcga 0.2363
+tgcgc 0.2281
+tgcgg 0.2261
+tgcgt 0.3095
+tgcta 0.1549
+tgctc 0.2007
+tgctg 0.3838
+tgctt 0.2606
+tggaa 0.2847
+tggac 0.1868
+tggag 0.2759
+tggat 0.2525
+tggca 0.3042
+tggcc 0.2488
+tggcg 0.1791
+tggct 0.2679
+tggga 0.2375
+tgggc 0.1958
+tgggg 0.289
+tgggt 0.2777
+tggta 0.1791
+tggtc 0.1763
+tggtg 0.385
+tggtt 0.2596
+tgtaa 0.3054
+tgtac 0.2275
+tgtag 0.164
+tgtat 0.303
+tgtca 0.3314
+tgtcc 0.2181
+tgtcg 0.1735
+tgtct 0.2769
+tgtga 0.2126
+tgtgc 0.2126
+tgtgg 0.2197
+tgtgt 0.3551
+tgtta 0.1993
+tgttc 0.1522
+tgttg 0.2839
+tgttt 0.3646
+ttaaa 0.3809
+ttaac 0.1933
+ttaag 0.1464
+ttaat 0.2795
+ttaca 0.3946
+ttacc 0.2375
+ttacg 0.1471
+ttact 0.2208
+ttaga 0.2682
+ttagc 0.2574
+ttagg 0.2024
+ttagt 0.2719
+ttata 0.2391
+ttatc 0.1532
+ttatg 0.1687
+ttatt 0.4389
+ttcaa 0.266
+ttcac 0.2546
+ttcag 0.1928
+ttcat 0.2866
+ttcca 0.3265
+ttccc 0.2672
+ttccg 0.1291
+ttcct 0.2772
+ttcga 0.2148
+ttcgc 0.2302
+ttcgg 0.229
+ttcgt 0.3259
+ttcta 0.1877
+ttctc 0.2428
+ttctg 0.2567
+ttctt 0.3129
+ttgaa 0.3047
+ttgac 0.2242
+ttgag 0.2273
+ttgat 0.2437
+ttgca 0.3638
+ttgcc 0.2184
+ttgcg 0.1562
+ttgct 0.2616
+ttgga 0.2319
+ttggc 0.2602
+ttggg 0.2244
+ttggt 0.2835
+ttgta 0.2232
+ttgtc 0.1706
+ttgtg 0.2934
+ttgtt 0.3128
+tttaa 0.3338
+tttac 0.2185
+tttag 0.1332
+tttat 0.3145
+tttca 0.34
+tttcc 0.2279
+tttcg 0.1706
+tttct 0.2615
+tttga 0.2281
+tttgc 0.222
+tttgg 0.2037
+tttgt 0.3462
+tttta 0.2563
+ttttc 0.1648
+ttttg 0.189
+ttttt 0.3899
+
+# patterns:
+# aaaaa 15060
+# aaaac 8021
+# aaaag 5255
+# aaaat 10260
+# aaaca 9717
+# aaacc 5109
+# aaacg 4826
+# aaact 4987
+# aaaga 5148
+# aaagc 4719
+# aaagg 4220
+# aaagt 5662
+# aaata 9920
+# aaatc 5195
+# aaatg 7927
+# aaatt 6823
+# aacaa 8174
+# aacac 7839
+# aacag 5123
+# aacat 7441
+# aacca 5310
+# aaccc 5175
+# aaccg 3284
+# aacct 3458
+# aacga 3491
+# aacgc 3827
+# aacgg 2868
+# aacgt 4510
+# aacta 2801
+# aactc 4088
+# aactg 3879
+# aactt 4220
+# aagaa 4968
+# aagac 3448
+# aagag 4157
+# aagat 3559
+# aagca 4875
+# aagcc 3556
+# aagcg 3169
+# aagct 3846
+# aagga 3374
+# aaggc 3910
+# aaggg 4022
+# aaggt 3369
+# aagta 3151
+# aagtc 3559
+# aagtg 5400
+# aagtt 4220
+# aataa 9420
+# aatac 4411
+# aatag 2889
+# aatat 6758
+# aatca 4901
+# aatcc 3716
+# aatcg 3800
+# aatct 3663
+# aatga 5984
+# aatgc 4844
+# aatgg 4314
+# aatgt 7980
+# aatta 6241
+# aattc 4214
+# aattg 5590
+# aattt 6823
+# acaaa 9112
+# acaac 7120
+# acaag 4763
+# acaat 6247
+# acaca 13840
+# acacc 6141
+# acacg 7071
+# acact 5461
+# acaga 5550
+# acagc 6464
+# acagg 4510
+# acagt 4437
+# acata 4036
+# acatc 5749
+# acatg 4948
+# acatt 7980
+# accaa 5205
+# accac 9249
+# accag 4862
+# accat 4415
+# accca 6177
+# acccc 6582
+# acccg 4203
+# accct 3855
+# accga 3505
+# accgc 4496
+# accgg 3103
+# accgt 3414
+# accta 2572
+# acctc 4495
+# acctg 4368
+# acctt 3369
+# acgaa 3555
+# acgac 4199
+# acgag 4478
+# acgat 3518
+# acgca 5226
+# acgcc 3713
+# acgcg 4561
+# acgct 3176
+# acgga 3042
+# acggc 4499
+# acggg 4087
+# acggt 3414
+# acgta 3241
+# acgtc 4547
+# acgtg 7191
+# acgtt 4510
+# actaa 2857
+# actac 2848
+# actag 1341
+# actat 2449
+# actca 4996
+# actcc 3863
+# actcg 4348
+# actct 3561
+# actga 3708
+# actgc 5752
+# actgg 3929
+# actgt 4437
+# actta 2889
+# acttc 3452
+# acttg 4321
+# acttt 5662
+# agaaa 5183
+# agaac 3504
+# agaag 4028
+# agaat 4020
+# agaca 5278
+# agacc 3102
+# agacg 3499
+# agact 2887
+# agaga 5766
+# agagc 4027
+# agagg 4993
+# agagt 3561
+# agata 2861
+# agatc 2614
+# agatg 5256
+# agatt 3663
+# agcaa 4996
+# agcac 5776
+# agcag 8077
+# agcat 3862
+# agcca 5364
+# agccc 3834
+# agccg 3750
+# agcct 3242
+# agcga 3892
+# agcgc 4029
+# agcgg 4417
+# agcgt 3176
+# agcta 2182
+# agctc 4049
+# agctg 4806
+# agctt 3846
+# aggaa 4238
+# aggac 2970
+# aggag 5338
+# aggat 2759
+# aggca 4311
+# aggcc 4112
+# aggcg 3388
+# aggct 3242
+# aggga 4375
+# agggc 3873
+# agggg 6808
+# agggt 3855
+# aggta 2530
+# aggtc 3310
+# aggtg 5500
+# aggtt 3458
+# agtaa 3275
+# agtac 2624
+# agtag 2351
+# agtat 2975
+# agtca 4355
+# agtcc 2369
+# agtcg 3127
+# agtct 2887
+# agtga 5345
+# agtgc 4612
+# agtgg 6050
+# agtgt 5461
+# agtta 2889
+# agttc 2960
+# agttg 4152
+# agttt 4987
+# ataaa 8804
+# ataac 3863
+# ataag 2701
+# ataat 6316
+# ataca 5884
+# atacc 2324
+# atacg 2037
+# atact 2975
+# ataga 2731
+# atagc 2624
+# atagg 2500
+# atagt 2449
+# atata 5483
+# atatc 3216
+# atatg 3398
+# atatt 6758
+# atcaa 4588
+# atcac 5673
+# atcag 3585
+# atcat 5177
+# atcca 4264
+# atccc 3409
+# atccg 1960
+# atcct 2759
+# atcga 3253
+# atcgc 3549
+# atcgg 2841
+# atcgt 3518
+# atcta 2543
+# atctc 4411
+# atctg 3884
+# atctt 3559
+# atgaa 6043
+# atgac 4170
+# atgag 4193
+# atgat 5177
+# atgca 5962
+# atgcc 3388
+# atgcg 3151
+# atgct 3862
+# atgga 4285
+# atggc 4098
+# atggg 4326
+# atggt 4415
+# atgta 5091
+# atgtc 3726
+# atgtg 6458
+# atgtt 7441
+# attaa 6427
+# attac 4067
+# attag 2647
+# attat 6316
+# attca 5235
+# attcc 4250
+# attcg 2583
+# attct 4020
+# attga 4750
+# attgc 4598
+# attgg 4529
+# attgt 6247
+# attta 7535
+# atttc 5213
+# atttg 6859
+# atttt 10260
+# caaaa 7445
+# caaac 6414
+# caaag 5482
+# caaat 6859
+# caaca 9371
+# caacc 4919
+# caacg 4253
+# caact 4152
+# caaga 4263
+# caagc 4662
+# caagg 3790
+# caagt 4321
+# caata 4602
+# caatc 4045
+# caatg 5895
+# caatt 5590
+# cacaa 8723
+# cacac 13152
+# cacag 7312
+# cacat 6458
+# cacca 11041
+# caccc 7734
+# caccg 6086
+# cacct 5500
+# cacga 5774
+# cacgc 7148
+# cacgg 6205
+# cacgt 7191
+# cacta 3230
+# cactc 6125
+# cactg 6707
+# cactt 5400
+# cagaa 4388
+# cagac 4499
+# cagag 5278
+# cagat 3884
+# cagca 9919
+# cagcc 5991
+# cagcg 5065
+# cagct 4806
+# cagga 4539
+# caggc 4188
+# caggg 5094
+# caggt 4368
+# cagta 3229
+# cagtc 4010
+# cagtg 6707
+# cagtt 3879
+# cataa 3874
+# catac 3170
+# catag 2448
+# catat 3398
+# catca 7758
+# catcc 4036
+# catcg 4593
+# catct 5256
+# catga 4163
+# catgc 4559
+# catgg 4456
+# catgt 4948
+# catta 4570
+# cattc 4725
+# cattg 5895
+# cattt 7927
+# ccaaa 5515
+# ccaac 5128
+# ccaag 3921
+# ccaat 4529
+# ccaca 7810
+# ccacc 11108
+# ccacg 6924
+# ccact 6050
+# ccaga 3893
+# ccagc 6011
+# ccagg 4911
+# ccagt 3929
+# ccata 2946
+# ccatc 5413
+# ccatg 4456
+# ccatt 4314
+# cccaa 4709
+# cccac 8343
+# cccag 4995
+# cccat 4326
+# cccca 7022
+# ccccc 14899
+# ccccg 4962
+# cccct 6808
+# cccga 3383
+# cccgc 4716
+# cccgg 3761
+# cccgt 4087
+# cccta 2607
+# ccctc 7189
+# ccctg 5094
+# ccctt 4022
+# ccgaa 2769
+# ccgac 3277
+# ccgag 3965
+# ccgat 2841
+# ccgca 4009
+# ccgcc 5670
+# ccgcg 4299
+# ccgct 4417
+# ccgga 2407
+# ccggc 4322
+# ccggg 3761
+# ccggt 3103
+# ccgta 2205
+# ccgtc 3778
+# ccgtg 6205
+# ccgtt 2868
+# cctaa 2230
+# cctac 2981
+# cctag 1527
+# cctat 2500
+# cctca 4379
+# cctcc 7976
+# cctcg 4643
+# cctct 4993
+# cctga 3090
+# cctgc 5684
+# cctgg 4911
+# cctgt 4510
+# cctta 2520
+# ccttc 4141
+# ccttg 3790
+# ccttt 4220
+# cgaaa 3836
+# cgaac 2727
+# cgaag 2317
+# cgaat 2583
+# cgaca 3750
+# cgacc 3661
+# cgacg 4172
+# cgact 3127
+# cgaga 3446
+# cgagc 4239
+# cgagg 4643
+# cgagt 4348
+# cgata 2311
+# cgatc 2451
+# cgatg 4593
+# cgatt 3800
+# cgcaa 3758
+# cgcac 5803
+# cgcag 4326
+# cgcat 3151
+# cgcca 4769
+# cgccc 4606
+# cgccg 5574
+# cgcct 3388
+# cgcga 3556
+# cgcgc 5286
+# cgcgg 4299
+# cgcgt 4561
+# cgcta 2199
+# cgctc 5082
+# cgctg 5065
+# cgctt 3169
+# cggaa 2340
+# cggac 2368
+# cggag 4184
+# cggat 1960
+# cggca 4379
+# cggcc 4877
+# cggcg 5574
+# cggct 3750
+# cggga 3206
+# cgggc 3575
+# cgggg 4962
+# cgggt 4203
+# cggta 2330
+# cggtc 2820
+# cggtg 6086
+# cggtt 3284
+# cgtaa 2487
+# cgtac 2841
+# cgtag 2630
+# cgtat 2037
+# cgtca 5127
+# cgtcc 3189
+# cgtcg 4172
+# cgtct 3499
+# cgtga 6345
+# cgtgc 5985
+# cgtgg 6924
+# cgtgt 7071
+# cgtta 2546
+# cgttc 3080
+# cgttg 4253
+# cgttt 4826
+# ctaaa 3668
+# ctaac 2481
+# ctaag 1703
+# ctaat 2647
+# ctaca 3902
+# ctacc 2997
+# ctacg 2630
+# ctact 2351
+# ctaga 1560
+# ctagc 1434
+# ctagg 1527
+# ctagt 1341
+# ctata 2730
+# ctatc 2232
+# ctatg 2448
+# ctatt 2889
+# ctcaa 4837
+# ctcac 6792
+# ctcag 3387
+# ctcat 4193
+# ctcca 6170
+# ctccc 7139
+# ctccg 4184
+# ctcct 5338
+# ctcga 2874
+# ctcgc 5358
+# ctcgg 3965
+# ctcgt 4478
+# ctcta 2418
+# ctctc 6501
+# ctctg 5278
+# ctctt 4157
+# ctgaa 4175
+# ctgac 3416
+# ctgag 3387
+# ctgat 3585
+# ctgca 7189
+# ctgcc 5988
+# ctgcg 4326
+# ctgct 8077
+# ctgga 4018
+# ctggc 4862
+# ctggg 4995
+# ctggt 4862
+# ctgta 4442
+# ctgtc 4081
+# ctgtg 7312
+# ctgtt 5123
+# cttaa 3532
+# cttac 2336
+# cttag 1703
+# cttat 2701
+# cttca 5123
+# cttcc 4033
+# cttcg 2317
+# cttct 4028
+# cttga 3735
+# cttgc 4607
+# cttgg 3921
+# cttgt 4763
+# cttta 4759
+# ctttc 4249
+# ctttg 5482
+# ctttt 5255
+# gaaaa 6402
+# gaaac 4651
+# gaaag 4249
+# gaaat 5213
+# gaaca 4199
+# gaacc 3624
+# gaacg 3080
+# gaact 2960
+# gaaga 4180
+# gaagc 3728
+# gaagg 4141
+# gaagt 3452
+# gaata 3658
+# gaatc 3491
+# gaatg 4725
+# gaatt 4214
+# gacaa 4910
+# gacac 5978
+# gacag 4081
+# gacat 3726
+# gacca 3955
+# gaccc 4263
+# gaccg 2820
+# gacct 3310
+# gacga 4146
+# gacgc 3503
+# gacgg 3778
+# gacgt 4547
+# gacta 1519
+# gactc 3651
+# gactg 4010
+# gactt 3559
+# gagaa 4410
+# gagac 4821
+# gagag 6501
+# gagat 4411
+# gagca 4895
+# gagcc 4153
+# gagcg 5082
+# gagct 4049
+# gagga 5377
+# gaggc 4926
+# gaggg 7189
+# gaggt 4495
+# gagta 2909
+# gagtc 3651
+# gagtg 6125
+# gagtt 4088
+# gataa 3384
+# gatac 2213
+# gatag 2232
+# gatat 3216
+# gatca 2834
+# gatcc 2314
+# gatcg 2451
+# gatct 2614
+# gatga 6286
+# gatgc 4196
+# gatgg 5413
+# gatgt 5749
+# gatta 3355
+# gattc 3491
+# gattg 4045
+# gattt 5195
+# gcaaa 5790
+# gcaac 5184
+# gcaag 4607
+# gcaat 4598
+# gcaca 7271
+# gcacc 5637
+# gcacg 5985
+# gcact 4612
+# gcaga 5047
+# gcagc 9096
+# gcagg 5684
+# gcagt 5752
+# gcata 2761
+# gcatc 4196
+# gcatg 4559
+# gcatt 4844
+# gccaa 5148
+# gccac 7754
+# gccag 4862
+# gccat 4098
+# gccca 4413
+# gcccc 5664
+# gcccg 3575
+# gccct 3873
+# gccga 3609
+# gccgc 6144
+# gccgg 4322
+# gccgt 4499
+# gccta 2034
+# gcctc 4926
+# gcctg 4188
+# gcctt 3910
+# gcgaa 2764
+# gcgac 3927
+# gcgag 5358
+# gcgat 3549
+# gcgca 4193
+# gcgcc 4423
+# gcgcg 5286
+# gcgct 4029
+# gcgga 3044
+# gcggc 6144
+# gcggg 4716
+# gcggt 4496
+# gcgta 2197
+# gcgtc 3503
+# gcgtg 7148
+# gcgtt 3827
+# gctaa 2735
+# gctac 3095
+# gctag 1434
+# gctat 2624
+# gctca 4969
+# gctcc 4941
+# gctcg 4239
+# gctct 4027
+# gctga 4202
+# gctgc 9096
+# gctgg 6011
+# gctgt 6464
+# gctta 2328
+# gcttc 3728
+# gcttg 4662
+# gcttt 4719
+# ggaaa 4898
+# ggaac 2969
+# ggaag 4033
+# ggaat 4250
+# ggaca 4152
+# ggacc 2834
+# ggacg 3189
+# ggact 2369
+# ggaga 6057
+# ggagc 4941
+# ggagg 7976
+# ggagt 3863
+# ggata 2327
+# ggatc 2314
+# ggatg 4036
+# ggatt 3716
+# ggcaa 5013
+# ggcac 5191
+# ggcag 5988
+# ggcat 3388
+# ggcca 5846
+# ggccc 4091
+# ggccg 4877
+# ggcct 4112
+# ggcga 4530
+# ggcgc 4423
+# ggcgg 5670
+# ggcgt 3713
+# ggcta 2488
+# ggctc 4153
+# ggctg 5991
+# ggctt 3556
+# gggaa 4681
+# gggac 3645
+# gggag 7139
+# gggat 3409
+# gggca 5003
+# gggcc 4091
+# gggcg 4606
+# gggct 3834
+# gggga 6532
+# ggggc 5664
+# ggggg 14899
+# ggggt 6582
+# gggta 3637
+# gggtc 4263
+# gggtg 7734
+# gggtt 5175
+# ggtaa 3842
+# ggtac 2780
+# ggtag 2997
+# ggtat 2324
+# ggtca 4750
+# ggtcc 2834
+# ggtcg 3661
+# ggtct 3102
+# ggtga 7479
+# ggtgc 5637
+# ggtgg 11108
+# ggtgt 6141
+# ggtta 3584
+# ggttc 3624
+# ggttg 4919
+# ggttt 5109
+# gtaaa 6093
+# gtaac 3032
+# gtaag 2336
+# gtaat 4067
+# gtaca 4788
+# gtacc 2780
+# gtacg 2841
+# gtact 2624
+# gtaga 2952
+# gtagc 3095
+# gtagg 2981
+# gtagt 2848
+# gtata 3429
+# gtatc 2213
+# gtatg 3170
+# gtatt 4411
+# gtcaa 4704
+# gtcac 7446
+# gtcag 3416
+# gtcat 4170
+# gtcca 3557
+# gtccc 3645
+# gtccg 2368
+# gtcct 2970
+# gtcga 3306
+# gtcgc 3927
+# gtcgg 3277
+# gtcgt 4199
+# gtcta 1992
+# gtctc 4821
+# gtctg 4499
+# gtctt 3448
+# gtgaa 5994
+# gtgac 7446
+# gtgag 6792
+# gtgat 5673
+# gtgca 6733
+# gtgcc 5191
+# gtgcg 5803
+# gtgct 5776
+# gtgga 6542
+# gtggc 7754
+# gtggg 8343
+# gtggt 9249
+# gtgta 5533
+# gtgtc 5978
+# gtgtg 13152
+# gtgtt 7839
+# gttaa 4926
+# gttac 3032
+# gttag 2481
+# gttat 3863
+# gttca 4657
+# gttcc 2969
+# gttcg 2727
+# gttct 3504
+# gttga 5272
+# gttgc 5184
+# gttgg 5128
+# gttgt 7120
+# gttta 5555
+# gtttc 4651
+# gtttg 6414
+# gtttt 8021
+# taaaa 9692
+# taaac 5555
+# taaag 4759
+# taaat 7535
+# taaca 5279
+# taacc 3584
+# taacg 2546
+# taact 2889
+# taaga 2536
+# taagc 2328
+# taagg 2520
+# taagt 2889
+# taata 5299
+# taatc 3355
+# taatg 4570
+# taatt 6241
+# tacaa 5443
+# tacac 5533
+# tacag 4442
+# tacat 5091
+# tacca 3437
+# taccc 3637
+# taccg 2330
+# tacct 2530
+# tacga 2356
+# tacgc 2197
+# tacgg 2205
+# tacgt 3241
+# tacta 1936
+# tactc 2909
+# tactg 3229
+# tactt 3151
+# tagaa 2968
+# tagac 1992
+# tagag 2418
+# tagat 2543
+# tagca 3020
+# tagcc 2488
+# tagcg 2199
+# tagct 2182
+# tagga 2023
+# taggc 2034
+# taggg 2607
+# taggt 2572
+# tagta 1936
+# tagtc 1519
+# tagtg 3230
+# tagtt 2801
+# tataa 5021
+# tatac 3429
+# tatag 2730
+# tatat 5483
+# tatca 3541
+# tatcc 2327
+# tatcg 2311
+# tatct 2861
+# tatga 3146
+# tatgc 2761
+# tatgg 2946
+# tatgt 4036
+# tatta 5299
+# tattc 3658
+# tattg 4602
+# tattt 9920
+# tcaaa 5780
+# tcaac 5272
+# tcaag 3735
+# tcaat 4750
+# tcaca 6734
+# tcacc 7479
+# tcacg 6345
+# tcact 5345
+# tcaga 3560
+# tcagc 4202
+# tcagg 3090
+# tcagt 3708
+# tcata 3146
+# tcatc 6286
+# tcatg 4163
+# tcatt 5984
+# tccaa 4035
+# tccac 6542
+# tccag 4018
+# tccat 4285
+# tccca 4766
+# tcccc 6532
+# tcccg 3206
+# tccct 4375
+# tccga 2355
+# tccgc 3044
+# tccgg 2407
+# tccgt 3042
+# tccta 2023
+# tcctc 5377
+# tcctg 4539
+# tcctt 3374
+# tcgaa 2377
+# tcgac 3306
+# tcgag 2874
+# tcgat 3253
+# tcgca 3616
+# tcgcc 4530
+# tcgcg 3556
+# tcgct 3892
+# tcgga 2355
+# tcggc 3609
+# tcggg 3383
+# tcggt 3505
+# tcgta 2356
+# tcgtc 4146
+# tcgtg 5774
+# tcgtt 3491
+# tctaa 2678
+# tctac 2952
+# tctag 1560
+# tctat 2731
+# tctca 4872
+# tctcc 6057
+# tctcg 3446
+# tctct 5766
+# tctga 3560
+# tctgc 5047
+# tctgg 3893
+# tctgt 5550
+# tctta 2536
+# tcttc 4180
+# tcttg 4263
+# tcttt 5148
+# tgaaa 6592
+# tgaac 4657
+# tgaag 5123
+# tgaat 5235
+# tgaca 5504
+# tgacc 4750
+# tgacg 5127
+# tgact 4355
+# tgaga 4872
+# tgagc 4969
+# tgagg 4379
+# tgagt 4996
+# tgata 3541
+# tgatc 2834
+# tgatg 7758
+# tgatt 4901
+# tgcaa 6411
+# tgcac 6733
+# tgcag 7189
+# tgcat 5962
+# tgcca 5881
+# tgccc 5003
+# tgccg 4379
+# tgcct 4311
+# tgcga 3616
+# tgcgc 4193
+# tgcgg 4009
+# tgcgt 5226
+# tgcta 3020
+# tgctc 4895
+# tgctg 9919
+# tgctt 4875
+# tggaa 4890
+# tggac 3557
+# tggag 6170
+# tggat 4264
+# tggca 5881
+# tggcc 5846
+# tggcg 4769
+# tggct 5364
+# tggga 4766
+# tgggc 4413
+# tgggg 7022
+# tgggt 6177
+# tggta 3437
+# tggtc 3955
+# tggtg 11041
+# tggtt 5310
+# tgtaa 5919
+# tgtac 4788
+# tgtag 3902
+# tgtat 5884
+# tgtca 5504
+# tgtcc 4152
+# tgtcg 3750
+# tgtct 5278
+# tgtga 6734
+# tgtgc 7271
+# tgtgg 7810
+# tgtgt 13840
+# tgtta 5279
+# tgttc 4199
+# tgttg 9371
+# tgttt 9717
+# ttaaa 8976
+# ttaac 4926
+# ttaag 3532
+# ttaat 6427
+# ttaca 5919
+# ttacc 3842
+# ttacg 2487
+# ttact 3275
+# ttaga 2678
+# ttagc 2735
+# ttagg 2230
+# ttagt 2857
+# ttata 5021
+# ttatc 3384
+# ttatg 3874
+# ttatt 9420
+# ttcaa 5400
+# ttcac 5994
+# ttcag 4175
+# ttcat 6043
+# ttcca 4890
+# ttccc 4681
+# ttccg 2340
+# ttcct 4238
+# ttcga 2377
+# ttcgc 2764
+# ttcgg 2769
+# ttcgt 3555
+# ttcta 2968
+# ttctc 4410
+# ttctg 4388
+# ttctt 4968
+# ttgaa 5400
+# ttgac 4704
+# ttgag 4837
+# ttgat 4588
+# ttgca 6411
+# ttgcc 5013
+# ttgcg 3758
+# ttgct 4996
+# ttgga 4035
+# ttggc 5148
+# ttggg 4709
+# ttggt 5205
+# ttgta 5443
+# ttgtc 4910
+# ttgtg 8723
+# ttgtt 8174
+# tttaa 8976
+# tttac 6093
+# tttag 3668
+# tttat 8804
+# tttca 6592
+# tttcc 4898
+# tttcg 3836
+# tttct 5183
+# tttga 5780
+# tttgc 5790
+# tttgg 5515
+# tttgt 9112
+# tttta 9692
+# ttttc 6402
+# ttttg 7445
+# ttttt 15060
+
+# motif upstream of acceptor splice site
+[ASSMOTIF]
+# width of motif, n=
+30
+# order of markov model, k=
+3
+# markov chain emission probabilities
+ 0 0.384 0.186 0.154 0.276 0.296 0.218 0.224 0.261 0.199 0.184 0.222 0.394 0.194 0.116 0.41 0.28 0.209 0.291 0.168 0.332 0.265 0.381 0.205 0.149 0.206 0.283 0.199 0.312 0.167 0.286 0.248 0.298 0.311 0.154 0.22 0.315 0.4 0.228 0.119 0.254 0.188 0.198 0.234 0.38 0.253 0.193 0.311 0.243 0.34 0.146 0.0764 0.438 0.275 0.262 0.186 0.277 0.251 0.227 0.161 0.36 0.189 0.194 0.263 0.354 0.24 0.242 0.188 0.329 0.237 0.311 0.207 0.246 0.212 0.322 0.239 0.227 0.154 0.16 0.331 0.356 0.215 0.347 0.119 [...]
+ 1 0.372 0.202 0.137 0.29 0.299 0.21 0.221 0.27 0.226 0.192 0.207 0.376 0.204 0.119 0.41 0.268 0.271 0.248 0.164 0.317 0.227 0.41 0.201 0.162 0.214 0.25 0.175 0.36 0.144 0.243 0.293 0.321 0.329 0.17 0.19 0.311 0.354 0.234 0.137 0.275 0.171 0.225 0.258 0.346 0.233 0.163 0.374 0.23 0.327 0.167 0.0796 0.426 0.264 0.255 0.179 0.302 0.249 0.233 0.194 0.325 0.173 0.204 0.244 0.379 0.234 0.237 0.168 0.362 0.272 0.291 0.214 0.224 0.274 0.307 0.207 0.211 0.162 0.176 0.306 0.356 0.197 0.373 0.099 [...]
+ 2 0.375 0.223 0.133 0.269 0.286 0.202 0.233 0.278 0.239 0.213 0.201 0.348 0.181 0.127 0.414 0.278 0.276 0.26 0.143 0.321 0.211 0.418 0.206 0.165 0.216 0.267 0.173 0.343 0.164 0.218 0.315 0.302 0.348 0.151 0.172 0.329 0.318 0.247 0.161 0.273 0.186 0.239 0.258 0.317 0.22 0.164 0.368 0.248 0.345 0.153 0.109 0.394 0.261 0.252 0.185 0.302 0.245 0.224 0.206 0.325 0.189 0.195 0.254 0.362 0.267 0.226 0.154 0.352 0.279 0.272 0.201 0.249 0.264 0.325 0.204 0.207 0.147 0.184 0.309 0.361 0.184 0.38 [...]
+ 3 0.385 0.249 0.121 0.245 0.277 0.204 0.233 0.286 0.216 0.238 0.254 0.293 0.204 0.14 0.371 0.284 0.272 0.246 0.131 0.351 0.222 0.369 0.187 0.222 0.222 0.247 0.179 0.352 0.155 0.215 0.356 0.274 0.32 0.124 0.173 0.382 0.301 0.24 0.165 0.294 0.182 0.226 0.261 0.331 0.182 0.142 0.378 0.298 0.364 0.152 0.103 0.381 0.28 0.252 0.188 0.28 0.262 0.179 0.195 0.364 0.205 0.188 0.289 0.318 0.246 0.245 0.145 0.364 0.264 0.277 0.222 0.237 0.283 0.301 0.223 0.194 0.135 0.194 0.301 0.369 0.192 0.364 0 [...]
+ 4 0.341 0.254 0.139 0.266 0.287 0.201 0.222 0.29 0.229 0.266 0.235 0.271 0.226 0.145 0.364 0.265 0.262 0.227 0.122 0.389 0.227 0.333 0.211 0.229 0.172 0.256 0.178 0.393 0.147 0.248 0.34 0.265 0.327 0.132 0.191 0.35 0.286 0.214 0.214 0.286 0.26 0.264 0.227 0.25 0.174 0.109 0.395 0.322 0.369 0.158 0.116 0.357 0.29 0.23 0.176 0.304 0.271 0.174 0.202 0.352 0.2 0.155 0.31 0.335 0.239 0.2 0.15 0.411 0.281 0.238 0.217 0.264 0.337 0.272 0.211 0.179 0.141 0.211 0.265 0.382 0.171 0.401 0.13 0.29 [...]
+ 5 0.314 0.253 0.137 0.296 0.298 0.207 0.2 0.295 0.215 0.309 0.213 0.263 0.23 0.126 0.382 0.262 0.301 0.231 0.102 0.366 0.22 0.317 0.218 0.244 0.17 0.261 0.168 0.4 0.134 0.241 0.354 0.271 0.308 0.141 0.197 0.355 0.243 0.236 0.227 0.295 0.32 0.24 0.218 0.222 0.162 0.113 0.412 0.313 0.378 0.165 0.096 0.361 0.258 0.216 0.146 0.38 0.252 0.182 0.214 0.352 0.182 0.152 0.307 0.358 0.202 0.207 0.153 0.438 0.293 0.236 0.222 0.249 0.264 0.243 0.203 0.29 0.178 0.218 0.231 0.373 0.152 0.39 0.108 0. [...]
+ 6 0.291 0.264 0.164 0.281 0.305 0.198 0.211 0.286 0.217 0.29 0.225 0.267 0.198 0.141 0.392 0.269 0.251 0.265 0.102 0.382 0.274 0.259 0.227 0.239 0.158 0.305 0.19 0.347 0.173 0.273 0.336 0.218 0.276 0.136 0.229 0.359 0.211 0.268 0.238 0.283 0.386 0.217 0.167 0.23 0.166 0.172 0.367 0.295 0.382 0.167 0.107 0.344 0.25 0.186 0.138 0.426 0.274 0.183 0.177 0.366 0.202 0.142 0.329 0.327 0.236 0.18 0.158 0.426 0.28 0.236 0.215 0.268 0.246 0.238 0.192 0.324 0.172 0.219 0.25 0.359 0.146 0.394 0.1 [...]
+ 7 0.25 0.234 0.187 0.329 0.316 0.221 0.189 0.273 0.184 0.301 0.242 0.273 0.251 0.122 0.373 0.254 0.217 0.285 0.113 0.384 0.281 0.243 0.229 0.246 0.132 0.314 0.201 0.352 0.148 0.297 0.34 0.215 0.21 0.217 0.236 0.337 0.221 0.275 0.23 0.274 0.433 0.186 0.162 0.22 0.159 0.149 0.426 0.267 0.377 0.175 0.0713 0.377 0.223 0.209 0.127 0.441 0.248 0.229 0.178 0.345 0.199 0.152 0.313 0.336 0.196 0.184 0.145 0.474 0.293 0.264 0.214 0.229 0.265 0.215 0.175 0.345 0.175 0.197 0.279 0.348 0.156 0.347 [...]
+ 8 0.194 0.268 0.203 0.335 0.305 0.253 0.197 0.245 0.225 0.282 0.232 0.261 0.22 0.112 0.417 0.251 0.222 0.281 0.136 0.361 0.271 0.264 0.256 0.208 0.135 0.341 0.185 0.338 0.185 0.292 0.303 0.219 0.199 0.234 0.269 0.297 0.2 0.319 0.234 0.246 0.402 0.195 0.163 0.24 0.174 0.152 0.416 0.258 0.423 0.189 0.0802 0.308 0.204 0.192 0.146 0.458 0.227 0.25 0.205 0.318 0.193 0.167 0.299 0.34 0.216 0.164 0.149 0.472 0.31 0.248 0.21 0.232 0.281 0.226 0.131 0.362 0.149 0.211 0.311 0.33 0.143 0.351 0.09 [...]
+ 9 0.232 0.255 0.187 0.326 0.323 0.237 0.197 0.242 0.242 0.264 0.236 0.259 0.219 0.132 0.397 0.252 0.233 0.289 0.164 0.313 0.251 0.308 0.232 0.21 0.175 0.33 0.212 0.282 0.175 0.236 0.338 0.251 0.217 0.205 0.243 0.335 0.186 0.315 0.214 0.285 0.36 0.148 0.233 0.26 0.188 0.132 0.431 0.249 0.424 0.189 0.0674 0.319 0.188 0.215 0.154 0.442 0.195 0.231 0.21 0.363 0.189 0.175 0.296 0.34 0.222 0.189 0.132 0.458 0.298 0.252 0.206 0.244 0.225 0.281 0.128 0.366 0.131 0.187 0.341 0.342 0.182 0.324 0 [...]
+10 0.202 0.246 0.182 0.37 0.33 0.251 0.198 0.222 0.278 0.241 0.252 0.229 0.217 0.148 0.364 0.271 0.224 0.256 0.178 0.342 0.225 0.311 0.237 0.227 0.174 0.327 0.224 0.275 0.181 0.21 0.372 0.238 0.196 0.199 0.29 0.315 0.22 0.286 0.198 0.296 0.338 0.136 0.249 0.277 0.177 0.136 0.434 0.253 0.426 0.182 0.0841 0.308 0.179 0.238 0.184 0.399 0.203 0.232 0.198 0.367 0.192 0.174 0.29 0.344 0.263 0.182 0.122 0.433 0.295 0.251 0.196 0.258 0.25 0.31 0.129 0.312 0.104 0.19 0.378 0.329 0.178 0.352 0.06 [...]
+11 0.236 0.228 0.156 0.38 0.302 0.263 0.212 0.222 0.218 0.25 0.238 0.295 0.217 0.151 0.332 0.3 0.282 0.228 0.162 0.328 0.191 0.347 0.228 0.234 0.175 0.311 0.219 0.296 0.154 0.191 0.365 0.291 0.164 0.199 0.312 0.324 0.263 0.257 0.198 0.281 0.293 0.169 0.286 0.252 0.205 0.0736 0.411 0.31 0.439 0.164 0.0725 0.325 0.186 0.274 0.2 0.339 0.18 0.216 0.203 0.402 0.179 0.173 0.254 0.395 0.235 0.216 0.108 0.441 0.268 0.257 0.217 0.258 0.196 0.313 0.165 0.326 0.109 0.166 0.379 0.346 0.22 0.319 0.0 [...]
+12 0.271 0.242 0.129 0.357 0.287 0.249 0.23 0.233 0.236 0.22 0.241 0.303 0.192 0.154 0.324 0.329 0.297 0.202 0.17 0.331 0.205 0.334 0.205 0.255 0.171 0.27 0.214 0.344 0.146 0.155 0.372 0.327 0.217 0.102 0.371 0.31 0.294 0.203 0.215 0.288 0.242 0.18 0.295 0.283 0.21 0.0896 0.382 0.318 0.433 0.158 0.104 0.304 0.181 0.24 0.205 0.374 0.182 0.174 0.184 0.46 0.168 0.157 0.293 0.382 0.271 0.196 0.139 0.394 0.238 0.237 0.24 0.285 0.192 0.285 0.171 0.353 0.103 0.188 0.349 0.36 0.23 0.407 0.0463 [...]
+13 0.296 0.214 0.112 0.377 0.313 0.207 0.233 0.247 0.208 0.254 0.155 0.383 0.216 0.168 0.294 0.322 0.272 0.188 0.186 0.355 0.181 0.38 0.181 0.257 0.165 0.271 0.213 0.351 0.0987 0.143 0.397 0.361 0.232 0.0782 0.381 0.308 0.331 0.181 0.233 0.255 0.215 0.21 0.313 0.262 0.22 0.111 0.386 0.284 0.341 0.138 0.0948 0.427 0.164 0.247 0.183 0.406 0.165 0.196 0.176 0.463 0.169 0.149 0.284 0.399 0.25 0.223 0.129 0.397 0.215 0.259 0.254 0.273 0.165 0.302 0.183 0.35 0.103 0.173 0.327 0.397 0.217 0.43 [...]
+14 0.278 0.214 0.111 0.397 0.299 0.206 0.239 0.256 0.188 0.255 0.168 0.389 0.188 0.169 0.322 0.32 0.256 0.188 0.152 0.404 0.198 0.376 0.171 0.255 0.124 0.309 0.235 0.332 0.107 0.135 0.392 0.365 0.256 0.0901 0.397 0.256 0.326 0.202 0.247 0.226 0.199 0.237 0.288 0.276 0.188 0.143 0.356 0.313 0.365 0.145 0.092 0.398 0.141 0.263 0.175 0.421 0.177 0.238 0.162 0.423 0.155 0.151 0.265 0.428 0.299 0.191 0.123 0.387 0.199 0.295 0.257 0.249 0.202 0.21 0.265 0.323 0.117 0.167 0.332 0.384 0.182 0.4 [...]
+15 0.333 0.226 0.077 0.365 0.275 0.187 0.265 0.274 0.134 0.254 0.172 0.44 0.176 0.163 0.353 0.308 0.248 0.234 0.162 0.356 0.252 0.349 0.175 0.225 0.118 0.295 0.204 0.384 0.093 0.177 0.359 0.371 0.221 0.129 0.378 0.272 0.268 0.204 0.327 0.202 0.248 0.256 0.24 0.256 0.188 0.146 0.355 0.311 0.326 0.165 0.0816 0.427 0.146 0.268 0.147 0.438 0.15 0.249 0.166 0.436 0.15 0.16 0.269 0.422 0.29 0.209 0.0863 0.414 0.193 0.285 0.262 0.26 0.182 0.212 0.3 0.306 0.106 0.167 0.332 0.394 0.209 0.436 0.0 [...]
+16 0.326 0.212 0.0734 0.388 0.273 0.197 0.244 0.285 0.128 0.284 0.198 0.391 0.204 0.144 0.387 0.265 0.135 0.289 0.197 0.379 0.239 0.368 0.175 0.218 0.102 0.307 0.193 0.398 0.0776 0.182 0.396 0.344 0.278 0.12 0.344 0.259 0.275 0.182 0.334 0.209 0.245 0.259 0.226 0.27 0.149 0.186 0.407 0.258 0.277 0.187 0.0744 0.462 0.168 0.237 0.146 0.449 0.111 0.27 0.161 0.458 0.149 0.172 0.299 0.38 0.322 0.199 0.0905 0.388 0.194 0.274 0.264 0.269 0.205 0.228 0.312 0.255 0.0908 0.187 0.323 0.399 0.189 0 [...]
+17 0.311 0.211 0.0832 0.395 0.3 0.202 0.223 0.275 0.121 0.309 0.166 0.404 0.191 0.173 0.403 0.233 0.148 0.328 0.177 0.347 0.231 0.362 0.192 0.215 0.0862 0.324 0.178 0.413 0.0961 0.227 0.351 0.326 0.227 0.121 0.326 0.326 0.295 0.209 0.306 0.189 0.253 0.25 0.193 0.304 0.159 0.194 0.422 0.225 0.254 0.208 0.0388 0.499 0.178 0.238 0.133 0.451 0.116 0.266 0.143 0.475 0.13 0.161 0.298 0.411 0.243 0.25 0.0651 0.442 0.2 0.273 0.248 0.28 0.151 0.276 0.337 0.236 0.0829 0.173 0.352 0.392 0.175 0.39 [...]
+18 0.315 0.197 0.108 0.379 0.277 0.219 0.226 0.278 0.0942 0.325 0.236 0.346 0.141 0.192 0.388 0.279 0.122 0.346 0.128 0.405 0.265 0.311 0.229 0.195 0.115 0.304 0.159 0.422 0.11 0.252 0.316 0.322 0.209 0.146 0.317 0.328 0.24 0.185 0.287 0.287 0.316 0.206 0.168 0.309 0.0982 0.158 0.474 0.27 0.263 0.226 0.0302 0.481 0.182 0.229 0.142 0.447 0.108 0.254 0.132 0.505 0.131 0.183 0.302 0.384 0.243 0.204 0.123 0.43 0.218 0.259 0.214 0.308 0.19 0.251 0.372 0.187 0.099 0.189 0.324 0.387 0.2 0.36 0 [...]
+19 0.308 0.196 0.104 0.392 0.281 0.242 0.208 0.27 0.0538 0.296 0.224 0.426 0.131 0.191 0.385 0.292 0.131 0.461 0.11 0.298 0.237 0.314 0.234 0.215 0.135 0.263 0.147 0.455 0.0994 0.241 0.312 0.347 0.159 0.194 0.306 0.341 0.288 0.146 0.266 0.3 0.348 0.249 0.13 0.273 0.151 0.114 0.506 0.229 0.179 0.224 0.0591 0.537 0.186 0.217 0.148 0.448 0.116 0.236 0.115 0.532 0.129 0.193 0.3 0.378 0.195 0.216 0.123 0.466 0.224 0.244 0.211 0.32 0.158 0.278 0.331 0.233 0.0859 0.199 0.319 0.397 0.199 0.365 [...]
+20 0.271 0.158 0.132 0.44 0.26 0.252 0.211 0.276 0.0758 0.284 0.19 0.45 0.0942 0.239 0.365 0.302 0.122 0.454 0.0963 0.327 0.191 0.33 0.265 0.214 0.157 0.254 0.151 0.438 0.112 0.215 0.32 0.353 0.197 0.152 0.263 0.389 0.305 0.143 0.219 0.333 0.255 0.282 0.185 0.278 0.135 0.124 0.504 0.237 0.195 0.186 0.0763 0.542 0.154 0.255 0.149 0.442 0.134 0.229 0.0858 0.551 0.112 0.177 0.274 0.436 0.203 0.232 0.124 0.441 0.247 0.258 0.201 0.294 0.174 0.272 0.337 0.217 0.0798 0.211 0.324 0.385 0.173 0. [...]
+21 0.259 0.178 0.148 0.415 0.288 0.209 0.184 0.319 0.113 0.271 0.172 0.443 0.0685 0.279 0.31 0.343 0.153 0.405 0.0861 0.356 0.166 0.302 0.28 0.252 0.172 0.219 0.158 0.45 0.108 0.218 0.275 0.399 0.16 0.149 0.263 0.428 0.266 0.139 0.193 0.401 0.311 0.219 0.197 0.272 0.114 0.122 0.486 0.278 0.248 0.157 0.0688 0.526 0.138 0.284 0.131 0.447 0.156 0.201 0.099 0.544 0.099 0.186 0.287 0.428 0.173 0.242 0.138 0.446 0.243 0.268 0.228 0.261 0.189 0.211 0.322 0.278 0.0885 0.193 0.321 0.397 0.149 0. [...]
+22 0.287 0.162 0.117 0.434 0.301 0.185 0.22 0.294 0.133 0.199 0.265 0.403 0.0538 0.282 0.313 0.351 0.157 0.333 0.126 0.384 0.143 0.338 0.285 0.235 0.177 0.224 0.128 0.47 0.12 0.194 0.247 0.439 0.137 0.214 0.335 0.313 0.194 0.128 0.231 0.446 0.322 0.318 0.185 0.175 0.118 0.118 0.421 0.343 0.282 0.121 0.101 0.497 0.129 0.306 0.139 0.426 0.145 0.225 0.101 0.529 0.118 0.203 0.231 0.448 0.226 0.218 0.139 0.417 0.225 0.274 0.246 0.254 0.252 0.176 0.374 0.197 0.108 0.211 0.286 0.395 0.133 0.32 [...]
+23 0.239 0.187 0.0727 0.501 0.292 0.22 0.204 0.284 0.191 0.112 0.319 0.378 0.0758 0.261 0.325 0.337 0.171 0.346 0.133 0.35 0.0936 0.398 0.259 0.249 0.127 0.277 0.157 0.439 0.119 0.187 0.285 0.409 0.183 0.162 0.36 0.294 0.186 0.144 0.287 0.383 0.261 0.29 0.318 0.131 0.149 0.139 0.373 0.338 0.252 0.108 0.105 0.535 0.136 0.329 0.118 0.417 0.161 0.226 0.0839 0.53 0.108 0.183 0.22 0.489 0.262 0.237 0.123 0.378 0.192 0.282 0.254 0.273 0.19 0.202 0.354 0.255 0.0891 0.19 0.324 0.397 0.0974 0.38 [...]
+24 0.252 0.211 0.0849 0.452 0.325 0.203 0.206 0.267 0.243 0.102 0.418 0.237 0.0834 0.276 0.324 0.316 0.155 0.258 0.159 0.428 0.132 0.389 0.262 0.217 0.126 0.285 0.121 0.468 0.138 0.195 0.323 0.344 0.162 0.112 0.376 0.35 0.217 0.211 0.23 0.342 0.239 0.29 0.337 0.133 0.1 0.225 0.416 0.258 0.265 0.17 0.0686 0.497 0.128 0.34 0.113 0.419 0.125 0.25 0.0923 0.532 0.098 0.16 0.234 0.508 0.232 0.286 0.144 0.338 0.206 0.281 0.27 0.244 0.247 0.205 0.297 0.251 0.107 0.191 0.291 0.411 0.0877 0.407 0 [...]
+25 0.256 0.244 0.0974 0.403 0.335 0.245 0.181 0.239 0.25 0.2 0.38 0.17 0.111 0.239 0.313 0.337 0.133 0.24 0.175 0.452 0.132 0.422 0.22 0.226 0.123 0.281 0.171 0.425 0.12 0.216 0.316 0.348 0.116 0.12 0.412 0.352 0.264 0.27 0.195 0.27 0.303 0.284 0.288 0.125 0.123 0.211 0.427 0.24 0.213 0.193 0.0574 0.537 0.162 0.276 0.0996 0.462 0.123 0.263 0.102 0.511 0.0919 0.18 0.264 0.464 0.231 0.284 0.16 0.325 0.157 0.274 0.298 0.271 0.299 0.162 0.299 0.24 0.112 0.177 0.286 0.425 0.136 0.423 0.0573 [...]
+26 0.26 0.196 0.0925 0.452 0.363 0.28 0.18 0.177 0.214 0.208 0.469 0.109 0.105 0.246 0.374 0.275 0.0968 0.271 0.171 0.461 0.134 0.47 0.208 0.188 0.129 0.299 0.187 0.385 0.118 0.233 0.319 0.329 0.106 0.146 0.429 0.319 0.369 0.294 0.15 0.188 0.287 0.255 0.328 0.13 0.124 0.195 0.467 0.213 0.227 0.202 0.0993 0.472 0.148 0.272 0.122 0.457 0.114 0.285 0.139 0.462 0.114 0.167 0.241 0.478 0.266 0.283 0.116 0.334 0.151 0.329 0.234 0.286 0.313 0.166 0.317 0.205 0.0744 0.2 0.303 0.422 0.119 0.454 [...]
+27 0.184 0.263 0.111 0.441 0.359 0.289 0.162 0.19 0.182 0.242 0.418 0.158 0.0934 0.258 0.278 0.37 0.0894 0.323 0.12 0.467 0.161 0.42 0.209 0.211 0.125 0.298 0.232 0.345 0.0596 0.262 0.301 0.378 0.0873 0.197 0.367 0.349 0.358 0.302 0.136 0.204 0.216 0.209 0.301 0.273 0.161 0.221 0.443 0.174 0.168 0.237 0.126 0.469 0.157 0.314 0.12 0.408 0.119 0.304 0.162 0.415 0.0932 0.177 0.254 0.476 0.239 0.339 0.103 0.318 0.143 0.353 0.22 0.283 0.297 0.151 0.297 0.255 0.0662 0.19 0.256 0.488 0.134 0.5 [...]
+28 0.172 0.259 0.151 0.418 0.392 0.238 0.174 0.196 0.138 0.262 0.421 0.179 0.0848 0.283 0.257 0.375 0.105 0.313 0.118 0.464 0.185 0.399 0.195 0.221 0.125 0.273 0.225 0.377 0.0408 0.264 0.297 0.398 0.0523 0.25 0.326 0.372 0.397 0.281 0.0959 0.226 0.217 0.253 0.175 0.355 0.171 0.214 0.429 0.186 0.206 0.252 0.154 0.388 0.149 0.304 0.138 0.409 0.112 0.306 0.187 0.395 0.0983 0.18 0.242 0.48 0.223 0.368 0.0595 0.349 0.148 0.384 0.233 0.235 0.376 0.104 0.283 0.237 0.0719 0.206 0.22 0.502 0.137 [...]
+29 0.122 0.273 0.14 0.465 0.325 0.301 0.191 0.182 0.135 0.25 0.344 0.271 0.0767 0.282 0.195 0.446 0.108 0.31 0.108 0.475 0.148 0.408 0.194 0.25 0.115 0.291 0.232 0.362 0.00557 0.304 0.217 0.474 0.0507 0.312 0.312 0.326 0.39 0.254 0.0763 0.28 0.213 0.201 0.178 0.408 0.153 0.112 0.49 0.245 0.228 0.193 0.193 0.386 0.159 0.316 0.114 0.411 0.131 0.312 0.214 0.342 0.104 0.207 0.226 0.463 0.248 0.368 0.0331 0.351 0.116 0.407 0.212 0.264 0.325 0.143 0.357 0.175 0.0555 0.203 0.217 0.525 0.155 0. [...]
+[2]
+# (a,c,g,t)= (0.258, 0.242, 0.242, 0.258)
+#
+# Probabilities file for the intron model
+#
+#
+# Transition probabilities
+#
+[TRANSITION]
+# the probability of an intron of length at most d
+0.524
+# mean additional length of introns with length > d
+1.32e+03
+
+#
+# The emission probabilities of introns
+#
+[EMISSION]
+# size of the emission vector
+1024
+#k=
+4
+# patpseudo : pseudocount for sequence patterns
+5
+aaaaa 0.3901
+aaaac 0.2034
+aaaag 0.1362
+aaaat 0.2703
+aaaca 0.4029
+aaacc 0.1972
+aaacg 0.1898
+aaact 0.2101
+aaaga 0.2578
+aaagc 0.2405
+aaagg 0.2095
+aaagt 0.2922
+aaata 0.3341
+aaatc 0.1691
+aaatg 0.2665
+aaatt 0.2303
+aacaa 0.2988
+aacac 0.2609
+aacag 0.1741
+aacat 0.2661
+aacca 0.33
+aaccc 0.2889
+aaccg 0.1624
+aacct 0.2187
+aacga 0.2429
+aacgc 0.2443
+aacgg 0.1799
+aacgt 0.3328
+aacta 0.1937
+aactc 0.2587
+aactg 0.2576
+aactt 0.29
+aagaa 0.3222
+aagac 0.206
+aagag 0.2486
+aagat 0.2233
+aagca 0.3278
+aagcc 0.2277
+aagcg 0.192
+aagct 0.2525
+aagga 0.2412
+aaggc 0.2514
+aaggg 0.2676
+aaggt 0.2399
+aagta 0.2084
+aagtc 0.2094
+aagtg 0.3194
+aagtt 0.2627
+aataa 0.3969
+aatac 0.1878
+aatag 0.1252
+aatat 0.2901
+aatca 0.3057
+aatcc 0.2327
+aatcg 0.2271
+aatct 0.2345
+aatga 0.2536
+aatgc 0.2128
+aatgg 0.1833
+aatgt 0.3503
+aatta 0.2756
+aattc 0.1842
+aattg 0.241
+aattt 0.2991
+acaaa 0.3371
+acaac 0.2369
+acaag 0.176
+acaat 0.2501
+acaca 0.4146
+acacc 0.1882
+acacg 0.2077
+acact 0.1896
+acaga 0.2605
+acagc 0.3008
+acagg 0.2114
+acagt 0.2272
+acata 0.1769
+acatc 0.2349
+acatg 0.2153
+acatt 0.373
+accaa 0.2428
+accac 0.3501
+accag 0.2108
+accat 0.1963
+accca 0.3134
+acccc 0.2993
+acccg 0.1827
+accct 0.2046
+accga 0.2642
+accgc 0.2925
+accgg 0.1958
+accgt 0.2476
+accta 0.1763
+acctc 0.282
+acctg 0.2912
+acctt 0.2505
+acgaa 0.2447
+acgac 0.2554
+acgag 0.2662
+acgat 0.2337
+acgca 0.3238
+acgcc 0.216
+acgcg 0.2583
+acgct 0.2019
+acgga 0.2175
+acggc 0.2904
+acggg 0.2571
+acggt 0.2351
+acgta 0.1754
+acgtc 0.2283
+acgtg 0.347
+acgtt 0.2493
+actaa 0.3042
+actac 0.2748
+actag 0.1463
+actat 0.2746
+actca 0.2995
+actcc 0.2262
+actcg 0.2445
+actct 0.2298
+actga 0.2133
+actgc 0.317
+actgg 0.2198
+actgt 0.2499
+actta 0.1811
+acttc 0.2033
+acttg 0.2575
+acttt 0.3582
+agaaa 0.3201
+agaac 0.2038
+agaag 0.23
+agaat 0.2461
+agaca 0.3576
+agacc 0.2058
+agacg 0.2278
+agact 0.2089
+agaga 0.3038
+agagc 0.223
+agagg 0.2675
+agagt 0.2057
+agata 0.2109
+agatc 0.1732
+agatg 0.3428
+agatt 0.2731
+agcaa 0.2473
+agcac 0.2424
+agcag 0.3165
+agcat 0.1938
+agcca 0.3571
+agccc 0.2308
+agccg 0.2032
+agcct 0.2089
+agcga 0.2673
+agcgc 0.2506
+agcgg 0.2633
+agcgt 0.2188
+agcta 0.164
+agctc 0.2576
+agctg 0.3055
+agctt 0.2729
+aggaa 0.2962
+aggac 0.1993
+aggag 0.31
+aggat 0.1944
+aggca 0.2952
+aggcc 0.264
+aggcg 0.2122
+aggct 0.2286
+aggga 0.2406
+agggc 0.2108
+agggg 0.3338
+agggt 0.2148
+aggta 0.1874
+aggtc 0.213
+aggtg 0.3498
+aggtt 0.2497
+agtaa 0.2989
+agtac 0.2273
+agtag 0.1917
+agtat 0.2821
+agtca 0.3602
+agtcc 0.1832
+agtcg 0.2233
+agtct 0.2333
+agtga 0.2424
+agtgc 0.2151
+agtgg 0.2759
+agtgt 0.2666
+agtta 0.2053
+agttc 0.185
+agttg 0.2658
+agttt 0.3438
+ataaa 0.4047
+ataac 0.1712
+ataag 0.1255
+ataat 0.2987
+ataca 0.4521
+atacc 0.1624
+atacg 0.151
+atact 0.2344
+ataga 0.2762
+atagc 0.2591
+atagg 0.2078
+atagt 0.2569
+atata 0.2968
+atatc 0.166
+atatg 0.1804
+atatt 0.3568
+atcaa 0.2545
+atcac 0.2849
+atcag 0.1875
+atcat 0.2731
+atcca 0.3618
+atccc 0.257
+atccg 0.1548
+atcct 0.2264
+atcga 0.2528
+atcgc 0.2637
+atcgg 0.2078
+atcgt 0.2757
+atcta 0.1885
+atctc 0.2755
+atctg 0.2746
+atctt 0.2614
+atgaa 0.3245
+atgac 0.2146
+atgag 0.2009
+atgat 0.26
+atgca 0.3857
+atgcc 0.207
+atgcg 0.1663
+atgct 0.241
+atgga 0.2612
+atggc 0.2451
+atggg 0.2411
+atggt 0.2526
+atgta 0.2391
+atgtc 0.1659
+atgtg 0.2706
+atgtt 0.3243
+attaa 0.3342
+attac 0.2095
+attag 0.1345
+attat 0.3218
+attca 0.3403
+attcc 0.247
+attcg 0.156
+attct 0.2567
+attga 0.2344
+attgc 0.2307
+attgg 0.2119
+attgt 0.3231
+attta 0.2535
+atttc 0.1734
+atttg 0.2239
+atttt 0.3492
+caaaa 0.2969
+caaac 0.2322
+caaag 0.2006
+caaat 0.2703
+caaca 0.4136
+caacc 0.2072
+caacg 0.1832
+caact 0.196
+caaga 0.2582
+caagc 0.2556
+caagg 0.2271
+caagt 0.2592
+caata 0.2374
+caatc 0.1865
+caatg 0.2947
+caatt 0.2813
+cacaa 0.2677
+cacac 0.3283
+cacag 0.201
+cacat 0.2029
+cacca 0.3596
+caccc 0.2492
+caccg 0.1908
+cacct 0.2004
+cacga 0.233
+cacgc 0.2509
+cacgg 0.2243
+cacgt 0.2918
+cacta 0.1543
+cactc 0.2504
+cactg 0.3225
+cactt 0.2728
+cagaa 0.2671
+cagac 0.2286
+cagag 0.2761
+cagat 0.2281
+cagca 0.3855
+cagcc 0.2337
+cagcg 0.1829
+cagct 0.1979
+cagga 0.2571
+caggc 0.2243
+caggg 0.2647
+caggt 0.2538
+cagta 0.1962
+cagtc 0.2143
+cagtg 0.3644
+cagtt 0.2251
+cataa 0.2906
+catac 0.2512
+catag 0.1798
+catat 0.2784
+catca 0.3567
+catcc 0.1907
+catcg 0.2064
+catct 0.2462
+catga 0.2407
+catgc 0.2459
+catgg 0.2342
+catgt 0.2792
+catta 0.2033
+cattc 0.1954
+cattg 0.2536
+cattt 0.3477
+ccaaa 0.3029
+ccaac 0.2455
+ccaag 0.2048
+ccaat 0.2469
+ccaca 0.2602
+ccacc 0.3174
+ccacg 0.214
+ccact 0.2083
+ccaga 0.2218
+ccagc 0.299
+ccagg 0.2496
+ccagt 0.2295
+ccata 0.1793
+ccatc 0.289
+ccatg 0.2555
+ccatt 0.2761
+cccaa 0.2272
+cccac 0.3472
+cccag 0.2169
+cccat 0.2087
+cccca 0.2169
+ccccc 0.4343
+ccccg 0.1416
+cccct 0.2072
+cccga 0.2273
+cccgc 0.2853
+cccgg 0.2211
+cccgt 0.2663
+cccta 0.137
+ccctc 0.3577
+ccctg 0.2631
+ccctt 0.2421
+ccgaa 0.2392
+ccgac 0.2363
+ccgag 0.2907
+ccgat 0.2339
+ccgca 0.2387
+ccgcc 0.2993
+ccgcg 0.2213
+ccgct 0.2408
+ccgga 0.2018
+ccggc 0.2965
+ccggg 0.2682
+ccggt 0.2335
+ccgta 0.1627
+ccgtc 0.2392
+ccgtg 0.3974
+ccgtt 0.2007
+cctaa 0.2606
+cctac 0.3206
+cctag 0.167
+cctat 0.2519
+cctca 0.2123
+cctcc 0.3521
+cctcg 0.1957
+cctct 0.24
+cctga 0.1833
+cctgc 0.3019
+cctgg 0.261
+cctgt 0.2538
+cctta 0.1756
+ccttc 0.2664
+ccttg 0.2609
+ccttt 0.2971
+cgaaa 0.3503
+cgaac 0.2211
+cgaag 0.1941
+cgaat 0.2344
+cgaca 0.264
+cgacc 0.2406
+cgacg 0.2772
+cgact 0.2181
+cgaga 0.224
+cgagc 0.2472
+cgagg 0.2639
+cgagt 0.2649
+cgata 0.1798
+cgatc 0.1805
+cgatg 0.3331
+cgatt 0.3066
+cgcaa 0.2372
+cgcac 0.3184
+cgcag 0.2502
+cgcat 0.1942
+cgcca 0.2765
+cgccc 0.2428
+cgccg 0.2767
+cgcct 0.204
+cgcga 0.2163
+cgcgc 0.2936
+cgcgg 0.2272
+cgcgt 0.2629
+cgcta 0.1508
+cgctc 0.2928
+cgctg 0.3207
+cgctt 0.2357
+cggaa 0.2368
+cggac 0.206
+cggag 0.353
+cggat 0.2041
+cggca 0.2531
+cggcc 0.2562
+cggcg 0.2768
+cggct 0.2138
+cggga 0.2074
+cgggc 0.225
+cgggg 0.3084
+cgggt 0.2593
+cggta 0.1866
+cggtc 0.1958
+cggtg 0.3968
+cggtt 0.2209
+cgtaa 0.2705
+cgtac 0.2457
+cgtag 0.254
+cgtat 0.2298
+cgtca 0.3377
+cgtcc 0.1921
+cgtcg 0.2479
+cgtct 0.2223
+cgtga 0.2627
+cgtgc 0.2177
+cgtgg 0.2559
+cgtgt 0.2637
+cgtta 0.1813
+cgttc 0.1994
+cgttg 0.2751
+cgttt 0.3442
+ctaaa 0.3669
+ctaac 0.2102
+ctaag 0.1572
+ctaat 0.2657
+ctaca 0.3435
+ctacc 0.2301
+ctacg 0.2181
+ctact 0.2082
+ctaga 0.2746
+ctagc 0.232
+ctagg 0.2475
+ctagt 0.2459
+ctata 0.2598
+ctatc 0.1936
+ctatg 0.2355
+ctatt 0.3111
+ctcaa 0.2748
+ctcac 0.3162
+ctcag 0.1784
+ctcat 0.2306
+ctcca 0.2809
+ctccc 0.3078
+ctccg 0.1751
+ctcct 0.2362
+ctcga 0.1822
+ctcgc 0.303
+ctcgg 0.2323
+ctcgt 0.2825
+ctcta 0.1426
+ctctc 0.3208
+ctctg 0.2861
+ctctt 0.2505
+ctgaa 0.3081
+ctgac 0.2269
+ctgag 0.2164
+ctgat 0.2485
+ctgca 0.3166
+ctgcc 0.2273
+ctgcg 0.1608
+ctgct 0.2953
+ctgga 0.2286
+ctggc 0.2576
+ctggg 0.2466
+ctggt 0.2672
+ctgta 0.2296
+ctgtc 0.1874
+ctgtg 0.3255
+ctgtt 0.2575
+cttaa 0.3546
+cttac 0.218
+cttag 0.1583
+cttat 0.2691
+cttca 0.3399
+cttcc 0.248
+cttcg 0.1443
+cttct 0.2679
+cttga 0.2239
+cttgc 0.2616
+cttgg 0.2243
+cttgt 0.2902
+cttta 0.2506
+ctttc 0.2127
+ctttg 0.2607
+ctttt 0.276
+gaaaa 0.3217
+gaaac 0.2155
+gaaag 0.2031
+gaaat 0.2598
+gaaca 0.3232
+gaacc 0.2554
+gaacg 0.2078
+gaact 0.2136
+gaaga 0.2752
+gaagc 0.2357
+gaagg 0.2597
+gaagt 0.2293
+gaata 0.2325
+gaatc 0.2012
+gaatg 0.2909
+gaatt 0.2754
+gacaa 0.2869
+gacac 0.2741
+gacag 0.2116
+gacat 0.2273
+gacca 0.2998
+gaccc 0.2721
+gaccg 0.1865
+gacct 0.2416
+gacga 0.2668
+gacgc 0.205
+gacgg 0.2181
+gacgt 0.31
+gacta 0.1301
+gactc 0.2553
+gactg 0.3164
+gactt 0.2982
+gagaa 0.2482
+gagac 0.2311
+gagag 0.2994
+gagat 0.2213
+gagca 0.2846
+gagcc 0.2342
+gagcg 0.2407
+gagct 0.2406
+gagga 0.2452
+gaggc 0.2239
+gaggg 0.3155
+gaggt 0.2154
+gagta 0.1871
+gagtc 0.2062
+gagtg 0.3372
+gagtt 0.2695
+gataa 0.3221
+gatac 0.1935
+gatag 0.1772
+gatat 0.3072
+gatca 0.2974
+gatcc 0.2247
+gatcg 0.2263
+gatct 0.2517
+gatga 0.281
+gatgc 0.1974
+gatgg 0.2426
+gatgt 0.279
+gatta 0.2194
+gattc 0.2043
+gattg 0.2427
+gattt 0.3336
+gcaaa 0.3001
+gcaac 0.2326
+gcaag 0.2198
+gcaat 0.2475
+gcaca 0.3233
+gcacc 0.2267
+gcacg 0.2379
+gcact 0.2121
+gcaga 0.2102
+gcagc 0.3212
+gcagg 0.2183
+gcagt 0.2503
+gcata 0.1821
+gcatc 0.2334
+gcatg 0.2663
+gcatt 0.3183
+gccaa 0.2457
+gccac 0.3272
+gccag 0.2205
+gccat 0.2066
+gccca 0.2636
+gcccc 0.3106
+gcccg 0.1879
+gccct 0.2379
+gccga 0.2125
+gccgc 0.3125
+gccgg 0.213
+gccgt 0.262
+gccta 0.1384
+gcctc 0.3106
+gcctg 0.2727
+gcctt 0.2783
+gcgaa 0.1996
+gcgac 0.2405
+gcgag 0.3141
+gcgat 0.2458
+gcgca 0.2519
+gcgcc 0.2307
+gcgcg 0.2873
+gcgct 0.2302
+gcgga 0.1798
+gcggc 0.3158
+gcggg 0.2512
+gcggt 0.2532
+gcgta 0.1326
+gcgtc 0.2071
+gcgtg 0.4093
+gcgtt 0.2511
+gctaa 0.2968
+gctac 0.2828
+gctag 0.1398
+gctat 0.2806
+gctca 0.2806
+gctcc 0.2544
+gctcg 0.2223
+gctct 0.2427
+gctga 0.1747
+gctgc 0.3279
+gctgg 0.2308
+gctgt 0.2666
+gctta 0.1592
+gcttc 0.2319
+gcttg 0.2817
+gcttt 0.3272
+ggaaa 0.3214
+ggaac 0.1777
+ggaag 0.2372
+ggaat 0.2638
+ggaca 0.3432
+ggacc 0.2155
+ggacg 0.2407
+ggact 0.2006
+ggaga 0.2686
+ggagc 0.2064
+ggagg 0.3463
+ggagt 0.1787
+ggata 0.1972
+ggatc 0.1796
+ggatg 0.3084
+ggatt 0.3148
+ggcaa 0.2627
+ggcac 0.2471
+ggcag 0.2912
+ggcat 0.199
+ggcca 0.3269
+ggccc 0.2174
+ggccg 0.2289
+ggcct 0.2268
+ggcga 0.2653
+ggcgc 0.2271
+ggcgg 0.2959
+ggcgt 0.2117
+ggcta 0.1623
+ggctc 0.245
+ggctg 0.3523
+ggctt 0.2404
+gggaa 0.2723
+gggac 0.1713
+gggag 0.3599
+gggat 0.1966
+gggca 0.3018
+gggcc 0.233
+gggcg 0.2326
+gggct 0.2326
+gggga 0.1997
+ggggc 0.1709
+ggggg 0.4343
+ggggt 0.1951
+gggta 0.1704
+gggtc 0.198
+gggtg 0.3592
+gggtt 0.2723
+ggtaa 0.362
+ggtac 0.2086
+ggtag 0.2234
+ggtat 0.206
+ggtca 0.3523
+ggtcc 0.1894
+ggtcg 0.2371
+ggtct 0.2213
+ggtga 0.2584
+ggtgc 0.1863
+ggtgg 0.3408
+ggtgt 0.2145
+ggtta 0.2094
+ggttc 0.2121
+ggttg 0.2693
+ggttt 0.3093
+gtaaa 0.3952
+gtaac 0.189
+gtaag 0.1428
+gtaat 0.273
+gtaca 0.3989
+gtacc 0.1921
+gtacg 0.1885
+gtact 0.2205
+gtaga 0.2552
+gtagc 0.2485
+gtagg 0.2517
+gtagt 0.2446
+gtata 0.2669
+gtatc 0.1539
+gtatg 0.2395
+gtatt 0.3398
+gtcaa 0.2458
+gtcac 0.3561
+gtcag 0.1718
+gtcat 0.2264
+gtcca 0.3125
+gtccc 0.2514
+gtccg 0.1755
+gtcct 0.2606
+gtcga 0.2272
+gtcgc 0.2592
+gtcgg 0.2108
+gtcgt 0.3028
+gtcta 0.1423
+gtctc 0.307
+gtctg 0.2935
+gtctt 0.2572
+gtgaa 0.253
+gtgac 0.2852
+gtgag 0.2328
+gtgat 0.229
+gtgca 0.31
+gtgcc 0.2134
+gtgcg 0.2264
+gtgct 0.2502
+gtgga 0.2188
+gtggc 0.2446
+gtggg 0.2527
+gtggt 0.2839
+gtgta 0.1967
+gtgtc 0.1681
+gtgtg 0.368
+gtgtt 0.2672
+gttaa 0.3552
+gttac 0.2146
+gttag 0.1574
+gttat 0.2729
+gttca 0.3363
+gttcc 0.2099
+gttcg 0.1857
+gttct 0.2682
+gttga 0.2433
+gttgc 0.2237
+gttgg 0.2173
+gttgt 0.3157
+gttta 0.2237
+gtttc 0.1864
+gtttg 0.2493
+gtttt 0.3405
+taaaa 0.3584
+taaac 0.1891
+taaag 0.175
+taaat 0.2776
+taaca 0.3809
+taacc 0.2303
+taacg 0.1725
+taact 0.2164
+taaga 0.2549
+taagc 0.2244
+taagg 0.2375
+taagt 0.2833
+taata 0.2757
+taatc 0.1681
+taatg 0.2356
+taatt 0.3206
+tacaa 0.276
+tacac 0.2559
+tacag 0.2067
+tacat 0.2614
+tacca 0.3139
+taccc 0.2573
+taccg 0.1952
+tacct 0.2336
+tacga 0.2485
+tacgc 0.1905
+tacgg 0.2152
+tacgt 0.3457
+tacta 0.179
+tactc 0.2325
+tactg 0.2907
+tactt 0.2978
+tagaa 0.3163
+tagac 0.1871
+tagag 0.2323
+tagat 0.2643
+tagca 0.3179
+tagcc 0.2448
+tagcg 0.1956
+tagct 0.2417
+tagga 0.2387
+taggc 0.2137
+taggg 0.2589
+taggt 0.2886
+tagta 0.2187
+tagtc 0.1595
+tagtg 0.3154
+tagtt 0.3063
+tataa 0.2962
+tatac 0.2105
+tatag 0.149
+tatat 0.3443
+tatca 0.3302
+tatcc 0.2122
+tatcg 0.1939
+tatct 0.2637
+tatga 0.2531
+tatgc 0.2235
+tatgg 0.2184
+tatgt 0.305
+tatta 0.2301
+tattc 0.151
+tattg 0.1975
+tattt 0.4213
+tcaaa 0.3032
+tcaac 0.2546
+tcaag 0.1893
+tcaat 0.253
+tcaca 0.2738
+tcacc 0.2716
+tcacg 0.248
+tcact 0.2066
+tcaga 0.2564
+tcagc 0.2696
+tcagg 0.2088
+tcagt 0.2653
+tcata 0.175
+tcatc 0.2819
+tcatg 0.2212
+tcatt 0.3218
+tccaa 0.2265
+tccac 0.3195
+tccag 0.2136
+tccat 0.2403
+tccca 0.2739
+tcccc 0.3263
+tcccg 0.1556
+tccct 0.2441
+tccga 0.2289
+tccgc 0.2643
+tccgg 0.2153
+tccgt 0.2915
+tccta 0.1439
+tcctc 0.3166
+tcctg 0.291
+tcctt 0.2485
+tcgaa 0.224
+tcgac 0.2575
+tcgag 0.2306
+tcgat 0.2878
+tcgca 0.2503
+tcgcc 0.278
+tcgcg 0.2183
+tcgct 0.2533
+tcgga 0.1948
+tcggc 0.2686
+tcggg 0.2504
+tcggt 0.2862
+tcgta 0.1614
+tcgtc 0.2513
+tcgtg 0.3544
+tcgtt 0.2329
+tctaa 0.2838
+tctac 0.2754
+tctag 0.157
+tctat 0.2838
+tctca 0.2599
+tctcc 0.284
+tctcg 0.1727
+tctct 0.2834
+tctga 0.2122
+tctgc 0.2741
+tctgg 0.2187
+tctgt 0.295
+tctta 0.1664
+tcttc 0.2491
+tcttg 0.2618
+tcttt 0.3227
+tgaaa 0.3197
+tgaac 0.199
+tgaag 0.2272
+tgaat 0.2541
+tgaca 0.2902
+tgacc 0.2335
+tgacg 0.2465
+tgact 0.2298
+tgaga 0.2675
+tgagc 0.2477
+tgagg 0.2272
+tgagt 0.2576
+tgata 0.1999
+tgatc 0.1549
+tgatg 0.3758
+tgatt 0.2694
+tgcaa 0.2598
+tgcac 0.234
+tgcag 0.2644
+tgcat 0.2417
+tgcca 0.3254
+tgccc 0.2495
+tgccg 0.2004
+tgcct 0.2247
+tgcga 0.2296
+tgcgc 0.2384
+tgcgg 0.2269
+tgcgt 0.3051
+tgcta 0.1468
+tgctc 0.2073
+tgctg 0.4048
+tgctt 0.2411
+tggaa 0.2752
+tggac 0.1886
+tggag 0.291
+tggat 0.2452
+tggca 0.2875
+tggcc 0.256
+tggcg 0.1936
+tggct 0.2629
+tggga 0.2284
+tgggc 0.1976
+tgggg 0.2956
+tgggt 0.2783
+tggta 0.1656
+tggtc 0.1738
+tggtg 0.4128
+tggtt 0.2478
+tgtaa 0.2969
+tgtac 0.2273
+tgtag 0.1749
+tgtat 0.3008
+tgtca 0.3163
+tgtcc 0.2179
+tgtcg 0.188
+tgtct 0.2778
+tgtga 0.2037
+tgtgc 0.2079
+tgtgg 0.2186
+tgtgt 0.3698
+tgtta 0.1941
+tgttc 0.1504
+tgttg 0.3013
+tgttt 0.3542
+ttaaa 0.3769
+ttaac 0.1988
+ttaag 0.1476
+ttaat 0.2767
+ttaca 0.3855
+ttacc 0.2465
+ttacg 0.1535
+ttact 0.2145
+ttaga 0.2632
+ttagc 0.2611
+ttagg 0.2048
+ttagt 0.271
+ttata 0.231
+ttatc 0.1574
+ttatg 0.1703
+ttatt 0.4413
+ttcaa 0.2596
+ttcac 0.2623
+ttcag 0.1938
+ttcat 0.2842
+ttcca 0.3157
+ttccc 0.2767
+ttccg 0.1396
+ttcct 0.2681
+ttcga 0.2157
+ttcgc 0.2348
+ttcgg 0.233
+ttcgt 0.3165
+ttcta 0.1829
+ttctc 0.2506
+ttctg 0.2607
+ttctt 0.3058
+ttgaa 0.2931
+ttgac 0.2305
+ttgag 0.2368
+ttgat 0.2396
+ttgca 0.3459
+ttgcc 0.228
+ttgcg 0.1695
+ttgct 0.2566
+ttgga 0.2213
+ttggc 0.262
+ttggg 0.2359
+ttggt 0.2809
+ttgta 0.2134
+ttgtc 0.177
+ttgtg 0.3018
+ttgtt 0.3078
+tttaa 0.3297
+tttac 0.2197
+tttag 0.1346
+tttat 0.316
+tttca 0.3304
+tttcc 0.2322
+tttcg 0.1799
+tttct 0.2576
+tttga 0.2237
+tttgc 0.2227
+tttgg 0.2069
+tttgt 0.3467
+tttta 0.2533
+ttttc 0.1663
+ttttg 0.1904
+ttttt 0.39
+
+# patterns:
+# aaaaa 15060
+# aaaac 8021
+# aaaag 5255
+# aaaat 10260
+# aaaca 9717
+# aaacc 5109
+# aaacg 4826
+# aaact 4987
+# aaaga 5148
+# aaagc 4719
+# aaagg 4220
+# aaagt 5662
+# aaata 9920
+# aaatc 5195
+# aaatg 7927
+# aaatt 6823
+# aacaa 8174
+# aacac 7839
+# aacag 5123
+# aacat 7441
+# aacca 5310
+# aaccc 5175
+# aaccg 3284
+# aacct 3458
+# aacga 3491
+# aacgc 3827
+# aacgg 2868
+# aacgt 4510
+# aacta 2801
+# aactc 4088
+# aactg 3879
+# aactt 4220
+# aagaa 4968
+# aagac 3448
+# aagag 4157
+# aagat 3559
+# aagca 4875
+# aagcc 3556
+# aagcg 3169
+# aagct 3846
+# aagga 3374
+# aaggc 3910
+# aaggg 4022
+# aaggt 3369
+# aagta 3151
+# aagtc 3559
+# aagtg 5400
+# aagtt 4220
+# aataa 9420
+# aatac 4411
+# aatag 2889
+# aatat 6758
+# aatca 4901
+# aatcc 3716
+# aatcg 3800
+# aatct 3663
+# aatga 5984
+# aatgc 4844
+# aatgg 4314
+# aatgt 7980
+# aatta 6241
+# aattc 4214
+# aattg 5590
+# aattt 6823
+# acaaa 9112
+# acaac 7120
+# acaag 4763
+# acaat 6247
+# acaca 13840
+# acacc 6141
+# acacg 7071
+# acact 5461
+# acaga 5550
+# acagc 6464
+# acagg 4510
+# acagt 4437
+# acata 4036
+# acatc 5749
+# acatg 4948
+# acatt 7980
+# accaa 5205
+# accac 9249
+# accag 4862
+# accat 4415
+# accca 6177
+# acccc 6582
+# acccg 4203
+# accct 3855
+# accga 3505
+# accgc 4496
+# accgg 3103
+# accgt 3414
+# accta 2572
+# acctc 4495
+# acctg 4368
+# acctt 3369
+# acgaa 3555
+# acgac 4199
+# acgag 4478
+# acgat 3518
+# acgca 5226
+# acgcc 3713
+# acgcg 4561
+# acgct 3176
+# acgga 3042
+# acggc 4499
+# acggg 4087
+# acggt 3414
+# acgta 3241
+# acgtc 4547
+# acgtg 7191
+# acgtt 4510
+# actaa 2857
+# actac 2848
+# actag 1341
+# actat 2449
+# actca 4996
+# actcc 3863
+# actcg 4348
+# actct 3561
+# actga 3708
+# actgc 5752
+# actgg 3929
+# actgt 4437
+# actta 2889
+# acttc 3452
+# acttg 4321
+# acttt 5662
+# agaaa 5183
+# agaac 3504
+# agaag 4028
+# agaat 4020
+# agaca 5278
+# agacc 3102
+# agacg 3499
+# agact 2887
+# agaga 5766
+# agagc 4027
+# agagg 4993
+# agagt 3561
+# agata 2861
+# agatc 2614
+# agatg 5256
+# agatt 3663
+# agcaa 4996
+# agcac 5776
+# agcag 8077
+# agcat 3862
+# agcca 5364
+# agccc 3834
+# agccg 3750
+# agcct 3242
+# agcga 3892
+# agcgc 4029
+# agcgg 4417
+# agcgt 3176
+# agcta 2182
+# agctc 4049
+# agctg 4806
+# agctt 3846
+# aggaa 4238
+# aggac 2970
+# aggag 5338
+# aggat 2759
+# aggca 4311
+# aggcc 4112
+# aggcg 3388
+# aggct 3242
+# aggga 4375
+# agggc 3873
+# agggg 6808
+# agggt 3855
+# aggta 2530
+# aggtc 3310
+# aggtg 5500
+# aggtt 3458
+# agtaa 3275
+# agtac 2624
+# agtag 2351
+# agtat 2975
+# agtca 4355
+# agtcc 2369
+# agtcg 3127
+# agtct 2887
+# agtga 5345
+# agtgc 4612
+# agtgg 6050
+# agtgt 5461
+# agtta 2889
+# agttc 2960
+# agttg 4152
+# agttt 4987
+# ataaa 8804
+# ataac 3863
+# ataag 2701
+# ataat 6316
+# ataca 5884
+# atacc 2324
+# atacg 2037
+# atact 2975
+# ataga 2731
+# atagc 2624
+# atagg 2500
+# atagt 2449
+# atata 5483
+# atatc 3216
+# atatg 3398
+# atatt 6758
+# atcaa 4588
+# atcac 5673
+# atcag 3585
+# atcat 5177
+# atcca 4264
+# atccc 3409
+# atccg 1960
+# atcct 2759
+# atcga 3253
+# atcgc 3549
+# atcgg 2841
+# atcgt 3518
+# atcta 2543
+# atctc 4411
+# atctg 3884
+# atctt 3559
+# atgaa 6043
+# atgac 4170
+# atgag 4193
+# atgat 5177
+# atgca 5962
+# atgcc 3388
+# atgcg 3151
+# atgct 3862
+# atgga 4285
+# atggc 4098
+# atggg 4326
+# atggt 4415
+# atgta 5091
+# atgtc 3726
+# atgtg 6458
+# atgtt 7441
+# attaa 6427
+# attac 4067
+# attag 2647
+# attat 6316
+# attca 5235
+# attcc 4250
+# attcg 2583
+# attct 4020
+# attga 4750
+# attgc 4598
+# attgg 4529
+# attgt 6247
+# attta 7535
+# atttc 5213
+# atttg 6859
+# atttt 10260
+# caaaa 7445
+# caaac 6414
+# caaag 5482
+# caaat 6859
+# caaca 9371
+# caacc 4919
+# caacg 4253
+# caact 4152
+# caaga 4263
+# caagc 4662
+# caagg 3790
+# caagt 4321
+# caata 4602
+# caatc 4045
+# caatg 5895
+# caatt 5590
+# cacaa 8723
+# cacac 13152
+# cacag 7312
+# cacat 6458
+# cacca 11041
+# caccc 7734
+# caccg 6086
+# cacct 5500
+# cacga 5774
+# cacgc 7148
+# cacgg 6205
+# cacgt 7191
+# cacta 3230
+# cactc 6125
+# cactg 6707
+# cactt 5400
+# cagaa 4388
+# cagac 4499
+# cagag 5278
+# cagat 3884
+# cagca 9919
+# cagcc 5991
+# cagcg 5065
+# cagct 4806
+# cagga 4539
+# caggc 4188
+# caggg 5094
+# caggt 4368
+# cagta 3229
+# cagtc 4010
+# cagtg 6707
+# cagtt 3879
+# cataa 3874
+# catac 3170
+# catag 2448
+# catat 3398
+# catca 7758
+# catcc 4036
+# catcg 4593
+# catct 5256
+# catga 4163
+# catgc 4559
+# catgg 4456
+# catgt 4948
+# catta 4570
+# cattc 4725
+# cattg 5895
+# cattt 7927
+# ccaaa 5515
+# ccaac 5128
+# ccaag 3921
+# ccaat 4529
+# ccaca 7810
+# ccacc 11108
+# ccacg 6924
+# ccact 6050
+# ccaga 3893
+# ccagc 6011
+# ccagg 4911
+# ccagt 3929
+# ccata 2946
+# ccatc 5413
+# ccatg 4456
+# ccatt 4314
+# cccaa 4709
+# cccac 8343
+# cccag 4995
+# cccat 4326
+# cccca 7022
+# ccccc 14899
+# ccccg 4962
+# cccct 6808
+# cccga 3383
+# cccgc 4716
+# cccgg 3761
+# cccgt 4087
+# cccta 2607
+# ccctc 7189
+# ccctg 5094
+# ccctt 4022
+# ccgaa 2769
+# ccgac 3277
+# ccgag 3965
+# ccgat 2841
+# ccgca 4009
+# ccgcc 5670
+# ccgcg 4299
+# ccgct 4417
+# ccgga 2407
+# ccggc 4322
+# ccggg 3761
+# ccggt 3103
+# ccgta 2205
+# ccgtc 3778
+# ccgtg 6205
+# ccgtt 2868
+# cctaa 2230
+# cctac 2981
+# cctag 1527
+# cctat 2500
+# cctca 4379
+# cctcc 7976
+# cctcg 4643
+# cctct 4993
+# cctga 3090
+# cctgc 5684
+# cctgg 4911
+# cctgt 4510
+# cctta 2520
+# ccttc 4141
+# ccttg 3790
+# ccttt 4220
+# cgaaa 3836
+# cgaac 2727
+# cgaag 2317
+# cgaat 2583
+# cgaca 3750
+# cgacc 3661
+# cgacg 4172
+# cgact 3127
+# cgaga 3446
+# cgagc 4239
+# cgagg 4643
+# cgagt 4348
+# cgata 2311
+# cgatc 2451
+# cgatg 4593
+# cgatt 3800
+# cgcaa 3758
+# cgcac 5803
+# cgcag 4326
+# cgcat 3151
+# cgcca 4769
+# cgccc 4606
+# cgccg 5574
+# cgcct 3388
+# cgcga 3556
+# cgcgc 5286
+# cgcgg 4299
+# cgcgt 4561
+# cgcta 2199
+# cgctc 5082
+# cgctg 5065
+# cgctt 3169
+# cggaa 2340
+# cggac 2368
+# cggag 4184
+# cggat 1960
+# cggca 4379
+# cggcc 4877
+# cggcg 5574
+# cggct 3750
+# cggga 3206
+# cgggc 3575
+# cgggg 4962
+# cgggt 4203
+# cggta 2330
+# cggtc 2820
+# cggtg 6086
+# cggtt 3284
+# cgtaa 2487
+# cgtac 2841
+# cgtag 2630
+# cgtat 2037
+# cgtca 5127
+# cgtcc 3189
+# cgtcg 4172
+# cgtct 3499
+# cgtga 6345
+# cgtgc 5985
+# cgtgg 6924
+# cgtgt 7071
+# cgtta 2546
+# cgttc 3080
+# cgttg 4253
+# cgttt 4826
+# ctaaa 3668
+# ctaac 2481
+# ctaag 1703
+# ctaat 2647
+# ctaca 3902
+# ctacc 2997
+# ctacg 2630
+# ctact 2351
+# ctaga 1560
+# ctagc 1434
+# ctagg 1527
+# ctagt 1341
+# ctata 2730
+# ctatc 2232
+# ctatg 2448
+# ctatt 2889
+# ctcaa 4837
+# ctcac 6792
+# ctcag 3387
+# ctcat 4193
+# ctcca 6170
+# ctccc 7139
+# ctccg 4184
+# ctcct 5338
+# ctcga 2874
+# ctcgc 5358
+# ctcgg 3965
+# ctcgt 4478
+# ctcta 2418
+# ctctc 6501
+# ctctg 5278
+# ctctt 4157
+# ctgaa 4175
+# ctgac 3416
+# ctgag 3387
+# ctgat 3585
+# ctgca 7189
+# ctgcc 5988
+# ctgcg 4326
+# ctgct 8077
+# ctgga 4018
+# ctggc 4862
+# ctggg 4995
+# ctggt 4862
+# ctgta 4442
+# ctgtc 4081
+# ctgtg 7312
+# ctgtt 5123
+# cttaa 3532
+# cttac 2336
+# cttag 1703
+# cttat 2701
+# cttca 5123
+# cttcc 4033
+# cttcg 2317
+# cttct 4028
+# cttga 3735
+# cttgc 4607
+# cttgg 3921
+# cttgt 4763
+# cttta 4759
+# ctttc 4249
+# ctttg 5482
+# ctttt 5255
+# gaaaa 6402
+# gaaac 4651
+# gaaag 4249
+# gaaat 5213
+# gaaca 4199
+# gaacc 3624
+# gaacg 3080
+# gaact 2960
+# gaaga 4180
+# gaagc 3728
+# gaagg 4141
+# gaagt 3452
+# gaata 3658
+# gaatc 3491
+# gaatg 4725
+# gaatt 4214
+# gacaa 4910
+# gacac 5978
+# gacag 4081
+# gacat 3726
+# gacca 3955
+# gaccc 4263
+# gaccg 2820
+# gacct 3310
+# gacga 4146
+# gacgc 3503
+# gacgg 3778
+# gacgt 4547
+# gacta 1519
+# gactc 3651
+# gactg 4010
+# gactt 3559
+# gagaa 4410
+# gagac 4821
+# gagag 6501
+# gagat 4411
+# gagca 4895
+# gagcc 4153
+# gagcg 5082
+# gagct 4049
+# gagga 5377
+# gaggc 4926
+# gaggg 7189
+# gaggt 4495
+# gagta 2909
+# gagtc 3651
+# gagtg 6125
+# gagtt 4088
+# gataa 3384
+# gatac 2213
+# gatag 2232
+# gatat 3216
+# gatca 2834
+# gatcc 2314
+# gatcg 2451
+# gatct 2614
+# gatga 6286
+# gatgc 4196
+# gatgg 5413
+# gatgt 5749
+# gatta 3355
+# gattc 3491
+# gattg 4045
+# gattt 5195
+# gcaaa 5790
+# gcaac 5184
+# gcaag 4607
+# gcaat 4598
+# gcaca 7271
+# gcacc 5637
+# gcacg 5985
+# gcact 4612
+# gcaga 5047
+# gcagc 9096
+# gcagg 5684
+# gcagt 5752
+# gcata 2761
+# gcatc 4196
+# gcatg 4559
+# gcatt 4844
+# gccaa 5148
+# gccac 7754
+# gccag 4862
+# gccat 4098
+# gccca 4413
+# gcccc 5664
+# gcccg 3575
+# gccct 3873
+# gccga 3609
+# gccgc 6144
+# gccgg 4322
+# gccgt 4499
+# gccta 2034
+# gcctc 4926
+# gcctg 4188
+# gcctt 3910
+# gcgaa 2764
+# gcgac 3927
+# gcgag 5358
+# gcgat 3549
+# gcgca 4193
+# gcgcc 4423
+# gcgcg 5286
+# gcgct 4029
+# gcgga 3044
+# gcggc 6144
+# gcggg 4716
+# gcggt 4496
+# gcgta 2197
+# gcgtc 3503
+# gcgtg 7148
+# gcgtt 3827
+# gctaa 2735
+# gctac 3095
+# gctag 1434
+# gctat 2624
+# gctca 4969
+# gctcc 4941
+# gctcg 4239
+# gctct 4027
+# gctga 4202
+# gctgc 9096
+# gctgg 6011
+# gctgt 6464
+# gctta 2328
+# gcttc 3728
+# gcttg 4662
+# gcttt 4719
+# ggaaa 4898
+# ggaac 2969
+# ggaag 4033
+# ggaat 4250
+# ggaca 4152
+# ggacc 2834
+# ggacg 3189
+# ggact 2369
+# ggaga 6057
+# ggagc 4941
+# ggagg 7976
+# ggagt 3863
+# ggata 2327
+# ggatc 2314
+# ggatg 4036
+# ggatt 3716
+# ggcaa 5013
+# ggcac 5191
+# ggcag 5988
+# ggcat 3388
+# ggcca 5846
+# ggccc 4091
+# ggccg 4877
+# ggcct 4112
+# ggcga 4530
+# ggcgc 4423
+# ggcgg 5670
+# ggcgt 3713
+# ggcta 2488
+# ggctc 4153
+# ggctg 5991
+# ggctt 3556
+# gggaa 4681
+# gggac 3645
+# gggag 7139
+# gggat 3409
+# gggca 5003
+# gggcc 4091
+# gggcg 4606
+# gggct 3834
+# gggga 6532
+# ggggc 5664
+# ggggg 14899
+# ggggt 6582
+# gggta 3637
+# gggtc 4263
+# gggtg 7734
+# gggtt 5175
+# ggtaa 3842
+# ggtac 2780
+# ggtag 2997
+# ggtat 2324
+# ggtca 4750
+# ggtcc 2834
+# ggtcg 3661
+# ggtct 3102
+# ggtga 7479
+# ggtgc 5637
+# ggtgg 11108
+# ggtgt 6141
+# ggtta 3584
+# ggttc 3624
+# ggttg 4919
+# ggttt 5109
+# gtaaa 6093
+# gtaac 3032
+# gtaag 2336
+# gtaat 4067
+# gtaca 4788
+# gtacc 2780
+# gtacg 2841
+# gtact 2624
+# gtaga 2952
+# gtagc 3095
+# gtagg 2981
+# gtagt 2848
+# gtata 3429
+# gtatc 2213
+# gtatg 3170
+# gtatt 4411
+# gtcaa 4704
+# gtcac 7446
+# gtcag 3416
+# gtcat 4170
+# gtcca 3557
+# gtccc 3645
+# gtccg 2368
+# gtcct 2970
+# gtcga 3306
+# gtcgc 3927
+# gtcgg 3277
+# gtcgt 4199
+# gtcta 1992
+# gtctc 4821
+# gtctg 4499
+# gtctt 3448
+# gtgaa 5994
+# gtgac 7446
+# gtgag 6792
+# gtgat 5673
+# gtgca 6733
+# gtgcc 5191
+# gtgcg 5803
+# gtgct 5776
+# gtgga 6542
+# gtggc 7754
+# gtggg 8343
+# gtggt 9249
+# gtgta 5533
+# gtgtc 5978
+# gtgtg 13152
+# gtgtt 7839
+# gttaa 4926
+# gttac 3032
+# gttag 2481
+# gttat 3863
+# gttca 4657
+# gttcc 2969
+# gttcg 2727
+# gttct 3504
+# gttga 5272
+# gttgc 5184
+# gttgg 5128
+# gttgt 7120
+# gttta 5555
+# gtttc 4651
+# gtttg 6414
+# gtttt 8021
+# taaaa 9692
+# taaac 5555
+# taaag 4759
+# taaat 7535
+# taaca 5279
+# taacc 3584
+# taacg 2546
+# taact 2889
+# taaga 2536
+# taagc 2328
+# taagg 2520
+# taagt 2889
+# taata 5299
+# taatc 3355
+# taatg 4570
+# taatt 6241
+# tacaa 5443
+# tacac 5533
+# tacag 4442
+# tacat 5091
+# tacca 3437
+# taccc 3637
+# taccg 2330
+# tacct 2530
+# tacga 2356
+# tacgc 2197
+# tacgg 2205
+# tacgt 3241
+# tacta 1936
+# tactc 2909
+# tactg 3229
+# tactt 3151
+# tagaa 2968
+# tagac 1992
+# tagag 2418
+# tagat 2543
+# tagca 3020
+# tagcc 2488
+# tagcg 2199
+# tagct 2182
+# tagga 2023
+# taggc 2034
+# taggg 2607
+# taggt 2572
+# tagta 1936
+# tagtc 1519
+# tagtg 3230
+# tagtt 2801
+# tataa 5021
+# tatac 3429
+# tatag 2730
+# tatat 5483
+# tatca 3541
+# tatcc 2327
+# tatcg 2311
+# tatct 2861
+# tatga 3146
+# tatgc 2761
+# tatgg 2946
+# tatgt 4036
+# tatta 5299
+# tattc 3658
+# tattg 4602
+# tattt 9920
+# tcaaa 5780
+# tcaac 5272
+# tcaag 3735
+# tcaat 4750
+# tcaca 6734
+# tcacc 7479
+# tcacg 6345
+# tcact 5345
+# tcaga 3560
+# tcagc 4202
+# tcagg 3090
+# tcagt 3708
+# tcata 3146
+# tcatc 6286
+# tcatg 4163
+# tcatt 5984
+# tccaa 4035
+# tccac 6542
+# tccag 4018
+# tccat 4285
+# tccca 4766
+# tcccc 6532
+# tcccg 3206
+# tccct 4375
+# tccga 2355
+# tccgc 3044
+# tccgg 2407
+# tccgt 3042
+# tccta 2023
+# tcctc 5377
+# tcctg 4539
+# tcctt 3374
+# tcgaa 2377
+# tcgac 3306
+# tcgag 2874
+# tcgat 3253
+# tcgca 3616
+# tcgcc 4530
+# tcgcg 3556
+# tcgct 3892
+# tcgga 2355
+# tcggc 3609
+# tcggg 3383
+# tcggt 3505
+# tcgta 2356
+# tcgtc 4146
+# tcgtg 5774
+# tcgtt 3491
+# tctaa 2678
+# tctac 2952
+# tctag 1560
+# tctat 2731
+# tctca 4872
+# tctcc 6057
+# tctcg 3446
+# tctct 5766
+# tctga 3560
+# tctgc 5047
+# tctgg 3893
+# tctgt 5550
+# tctta 2536
+# tcttc 4180
+# tcttg 4263
+# tcttt 5148
+# tgaaa 6592
+# tgaac 4657
+# tgaag 5123
+# tgaat 5235
+# tgaca 5504
+# tgacc 4750
+# tgacg 5127
+# tgact 4355
+# tgaga 4872
+# tgagc 4969
+# tgagg 4379
+# tgagt 4996
+# tgata 3541
+# tgatc 2834
+# tgatg 7758
+# tgatt 4901
+# tgcaa 6411
+# tgcac 6733
+# tgcag 7189
+# tgcat 5962
+# tgcca 5881
+# tgccc 5003
+# tgccg 4379
+# tgcct 4311
+# tgcga 3616
+# tgcgc 4193
+# tgcgg 4009
+# tgcgt 5226
+# tgcta 3020
+# tgctc 4895
+# tgctg 9919
+# tgctt 4875
+# tggaa 4890
+# tggac 3557
+# tggag 6170
+# tggat 4264
+# tggca 5881
+# tggcc 5846
+# tggcg 4769
+# tggct 5364
+# tggga 4766
+# tgggc 4413
+# tgggg 7022
+# tgggt 6177
+# tggta 3437
+# tggtc 3955
+# tggtg 11041
+# tggtt 5310
+# tgtaa 5919
+# tgtac 4788
+# tgtag 3902
+# tgtat 5884
+# tgtca 5504
+# tgtcc 4152
+# tgtcg 3750
+# tgtct 5278
+# tgtga 6734
+# tgtgc 7271
+# tgtgg 7810
+# tgtgt 13840
+# tgtta 5279
+# tgttc 4199
+# tgttg 9371
+# tgttt 9717
+# ttaaa 8976
+# ttaac 4926
+# ttaag 3532
+# ttaat 6427
+# ttaca 5919
+# ttacc 3842
+# ttacg 2487
+# ttact 3275
+# ttaga 2678
+# ttagc 2735
+# ttagg 2230
+# ttagt 2857
+# ttata 5021
+# ttatc 3384
+# ttatg 3874
+# ttatt 9420
+# ttcaa 5400
+# ttcac 5994
+# ttcag 4175
+# ttcat 6043
+# ttcca 4890
+# ttccc 4681
+# ttccg 2340
+# ttcct 4238
+# ttcga 2377
+# ttcgc 2764
+# ttcgg 2769
+# ttcgt 3555
+# ttcta 2968
+# ttctc 4410
+# ttctg 4388
+# ttctt 4968
+# ttgaa 5400
+# ttgac 4704
+# ttgag 4837
+# ttgat 4588
+# ttgca 6411
+# ttgcc 5013
+# ttgcg 3758
+# ttgct 4996
+# ttgga 4035
+# ttggc 5148
+# ttggg 4709
+# ttggt 5205
+# ttgta 5443
+# ttgtc 4910
+# ttgtg 8723
+# ttgtt 8174
+# tttaa 8976
+# tttac 6093
+# tttag 3668
+# tttat 8804
+# tttca 6592
+# tttcc 4898
+# tttcg 3836
+# tttct 5183
+# tttga 5780
+# tttgc 5790
+# tttgg 5515
+# tttgt 9112
+# tttta 9692
+# ttttc 6402
+# ttttg 7445
+# ttttt 15060
+
+# motif upstream of acceptor splice site
+[ASSMOTIF]
+# width of motif, n=
+30
+# order of markov model, k=
+3
+# markov chain emission probabilities
+ 0 0.362 0.196 0.161 0.281 0.248 0.265 0.24 0.247 0.184 0.203 0.241 0.373 0.199 0.115 0.41 0.276 0.202 0.328 0.172 0.298 0.241 0.379 0.228 0.152 0.218 0.293 0.223 0.266 0.145 0.321 0.261 0.273 0.294 0.2 0.192 0.314 0.33 0.231 0.185 0.255 0.19 0.239 0.241 0.331 0.185 0.185 0.401 0.229 0.336 0.128 0.127 0.408 0.213 0.272 0.189 0.326 0.29 0.221 0.145 0.343 0.181 0.175 0.294 0.35 0.197 0.285 0.185 0.333 0.214 0.287 0.243 0.256 0.22 0.32 0.233 0.227 0.143 0.19 0.372 0.295 0.225 0.38 0.125 0. [...]
+ 1 0.345 0.212 0.147 0.296 0.256 0.262 0.232 0.25 0.204 0.213 0.228 0.355 0.213 0.13 0.399 0.258 0.247 0.287 0.181 0.285 0.203 0.415 0.221 0.16 0.222 0.266 0.193 0.319 0.137 0.288 0.286 0.288 0.283 0.211 0.176 0.331 0.304 0.233 0.204 0.258 0.165 0.253 0.278 0.304 0.174 0.159 0.444 0.224 0.336 0.162 0.112 0.39 0.215 0.263 0.173 0.348 0.274 0.232 0.186 0.308 0.16 0.191 0.286 0.363 0.19 0.276 0.173 0.361 0.239 0.273 0.242 0.246 0.265 0.327 0.204 0.204 0.145 0.201 0.349 0.306 0.206 0.391 0. [...]
+ 2 0.353 0.229 0.145 0.274 0.245 0.255 0.245 0.255 0.215 0.235 0.214 0.336 0.191 0.147 0.405 0.258 0.248 0.297 0.172 0.283 0.19 0.417 0.224 0.169 0.222 0.271 0.188 0.32 0.156 0.268 0.304 0.272 0.306 0.191 0.168 0.335 0.278 0.245 0.22 0.257 0.191 0.251 0.28 0.278 0.178 0.152 0.427 0.243 0.352 0.153 0.146 0.349 0.218 0.261 0.19 0.332 0.268 0.229 0.193 0.31 0.173 0.179 0.29 0.357 0.221 0.268 0.164 0.347 0.25 0.26 0.228 0.262 0.259 0.34 0.206 0.195 0.129 0.204 0.352 0.314 0.193 0.412 0.129 [...]
+ 3 0.359 0.26 0.132 0.249 0.232 0.266 0.245 0.257 0.194 0.264 0.254 0.287 0.208 0.154 0.374 0.263 0.248 0.281 0.164 0.306 0.211 0.381 0.203 0.205 0.24 0.242 0.197 0.321 0.153 0.265 0.347 0.235 0.297 0.159 0.165 0.379 0.258 0.222 0.234 0.286 0.216 0.218 0.274 0.292 0.158 0.119 0.431 0.291 0.362 0.163 0.125 0.35 0.236 0.256 0.188 0.321 0.284 0.195 0.187 0.334 0.195 0.178 0.31 0.316 0.2 0.272 0.154 0.375 0.217 0.288 0.247 0.248 0.289 0.323 0.217 0.171 0.112 0.226 0.326 0.336 0.203 0.404 0. [...]
+ 4 0.324 0.26 0.148 0.268 0.24 0.268 0.233 0.26 0.186 0.266 0.251 0.296 0.22 0.166 0.368 0.247 0.239 0.255 0.156 0.35 0.204 0.352 0.224 0.22 0.193 0.268 0.191 0.348 0.144 0.298 0.323 0.235 0.296 0.162 0.201 0.341 0.253 0.205 0.275 0.267 0.257 0.25 0.257 0.235 0.151 0.08 0.449 0.32 0.37 0.177 0.131 0.323 0.234 0.25 0.183 0.333 0.276 0.202 0.196 0.327 0.188 0.159 0.329 0.324 0.211 0.209 0.155 0.425 0.236 0.272 0.235 0.258 0.329 0.299 0.212 0.16 0.111 0.242 0.31 0.337 0.195 0.422 0.134 0.2 [...]
+ 5 0.304 0.257 0.14 0.298 0.277 0.24 0.223 0.26 0.199 0.304 0.229 0.268 0.228 0.146 0.376 0.25 0.272 0.253 0.135 0.34 0.193 0.343 0.227 0.238 0.176 0.267 0.195 0.362 0.134 0.288 0.328 0.25 0.265 0.174 0.211 0.35 0.225 0.215 0.283 0.277 0.312 0.244 0.233 0.21 0.16 0.0867 0.427 0.327 0.389 0.196 0.103 0.312 0.219 0.214 0.171 0.396 0.245 0.202 0.215 0.338 0.167 0.167 0.324 0.341 0.194 0.206 0.174 0.427 0.245 0.275 0.231 0.249 0.275 0.267 0.194 0.263 0.141 0.244 0.27 0.345 0.167 0.431 0.11 [...]
+ 6 0.29 0.266 0.171 0.273 0.291 0.213 0.249 0.248 0.235 0.279 0.226 0.26 0.193 0.157 0.39 0.26 0.239 0.278 0.129 0.354 0.232 0.296 0.231 0.241 0.169 0.304 0.219 0.308 0.16 0.315 0.323 0.202 0.253 0.157 0.24 0.351 0.188 0.251 0.285 0.276 0.365 0.223 0.182 0.231 0.178 0.154 0.369 0.299 0.384 0.194 0.118 0.304 0.217 0.186 0.171 0.427 0.279 0.206 0.17 0.345 0.188 0.168 0.327 0.316 0.226 0.177 0.177 0.421 0.232 0.283 0.227 0.259 0.266 0.241 0.194 0.299 0.137 0.251 0.276 0.336 0.154 0.453 0.1 [...]
+ 7 0.247 0.247 0.19 0.317 0.297 0.22 0.231 0.252 0.198 0.276 0.256 0.27 0.239 0.132 0.368 0.261 0.212 0.299 0.131 0.358 0.236 0.283 0.235 0.245 0.151 0.318 0.221 0.309 0.143 0.323 0.326 0.208 0.217 0.226 0.235 0.322 0.189 0.256 0.283 0.273 0.393 0.204 0.174 0.23 0.159 0.149 0.427 0.265 0.382 0.21 0.0745 0.333 0.195 0.182 0.153 0.47 0.248 0.235 0.178 0.339 0.185 0.185 0.312 0.317 0.192 0.176 0.162 0.47 0.235 0.317 0.226 0.222 0.264 0.227 0.182 0.328 0.135 0.238 0.301 0.325 0.161 0.409 0. [...]
+ 8 0.202 0.261 0.204 0.332 0.296 0.241 0.239 0.224 0.249 0.249 0.242 0.26 0.211 0.124 0.401 0.264 0.214 0.296 0.154 0.336 0.21 0.302 0.26 0.227 0.145 0.347 0.182 0.325 0.169 0.316 0.302 0.213 0.206 0.241 0.261 0.292 0.181 0.311 0.282 0.226 0.343 0.231 0.181 0.245 0.177 0.178 0.408 0.237 0.425 0.224 0.0876 0.263 0.194 0.165 0.173 0.469 0.232 0.243 0.189 0.337 0.176 0.194 0.301 0.328 0.215 0.176 0.168 0.441 0.265 0.284 0.22 0.231 0.261 0.223 0.162 0.355 0.123 0.253 0.313 0.311 0.151 0.41 [...]
+ 9 0.222 0.259 0.193 0.326 0.326 0.23 0.234 0.211 0.272 0.246 0.249 0.232 0.213 0.151 0.379 0.256 0.218 0.309 0.174 0.299 0.192 0.336 0.236 0.236 0.175 0.317 0.21 0.298 0.168 0.269 0.328 0.235 0.228 0.209 0.242 0.321 0.173 0.311 0.256 0.26 0.325 0.189 0.221 0.264 0.2 0.161 0.417 0.222 0.436 0.217 0.0741 0.273 0.185 0.187 0.171 0.456 0.209 0.228 0.198 0.366 0.17 0.197 0.305 0.328 0.224 0.195 0.144 0.438 0.245 0.291 0.219 0.244 0.206 0.29 0.144 0.36 0.113 0.239 0.321 0.327 0.174 0.402 0.0 [...]
+10 0.197 0.26 0.181 0.362 0.313 0.259 0.219 0.209 0.286 0.24 0.257 0.218 0.214 0.172 0.347 0.266 0.214 0.279 0.19 0.317 0.171 0.347 0.254 0.228 0.175 0.311 0.211 0.304 0.184 0.228 0.371 0.217 0.219 0.187 0.299 0.295 0.216 0.298 0.232 0.253 0.29 0.175 0.264 0.27 0.183 0.156 0.444 0.217 0.428 0.213 0.0987 0.26 0.178 0.212 0.202 0.409 0.224 0.23 0.188 0.358 0.181 0.192 0.308 0.319 0.241 0.198 0.124 0.436 0.244 0.296 0.214 0.246 0.227 0.335 0.157 0.281 0.0862 0.249 0.354 0.311 0.165 0.423 0 [...]
+11 0.223 0.255 0.148 0.374 0.291 0.281 0.221 0.207 0.219 0.25 0.262 0.269 0.217 0.165 0.33 0.288 0.258 0.268 0.168 0.306 0.144 0.359 0.259 0.238 0.17 0.309 0.201 0.32 0.159 0.201 0.37 0.27 0.196 0.194 0.312 0.298 0.273 0.272 0.213 0.242 0.259 0.215 0.294 0.232 0.2 0.0853 0.455 0.26 0.442 0.194 0.103 0.262 0.18 0.243 0.223 0.354 0.191 0.21 0.205 0.393 0.172 0.18 0.284 0.364 0.223 0.22 0.109 0.448 0.224 0.308 0.235 0.233 0.178 0.36 0.19 0.272 0.0872 0.221 0.37 0.322 0.209 0.377 0.0759 0.3 [...]
+12 0.257 0.26 0.112 0.37 0.287 0.272 0.229 0.211 0.26 0.227 0.253 0.26 0.19 0.171 0.322 0.317 0.267 0.243 0.173 0.317 0.16 0.372 0.23 0.238 0.172 0.279 0.214 0.335 0.141 0.171 0.395 0.294 0.203 0.0992 0.403 0.294 0.314 0.222 0.227 0.238 0.202 0.242 0.291 0.266 0.219 0.0983 0.41 0.272 0.435 0.186 0.137 0.242 0.179 0.232 0.227 0.363 0.206 0.174 0.188 0.432 0.165 0.163 0.319 0.353 0.259 0.206 0.13 0.405 0.202 0.278 0.259 0.26 0.187 0.328 0.195 0.29 0.0901 0.235 0.341 0.334 0.196 0.46 0.055 [...]
+13 0.297 0.244 0.0959 0.363 0.301 0.22 0.231 0.248 0.228 0.259 0.183 0.329 0.208 0.189 0.296 0.307 0.228 0.234 0.196 0.341 0.148 0.391 0.221 0.24 0.159 0.3 0.217 0.324 0.0959 0.157 0.419 0.328 0.213 0.0704 0.447 0.27 0.353 0.192 0.236 0.22 0.183 0.237 0.336 0.244 0.235 0.112 0.401 0.251 0.367 0.154 0.123 0.356 0.163 0.241 0.198 0.398 0.178 0.199 0.194 0.428 0.163 0.152 0.314 0.371 0.234 0.24 0.115 0.411 0.186 0.3 0.281 0.233 0.161 0.329 0.218 0.292 0.0796 0.217 0.353 0.351 0.168 0.501 0 [...]
+14 0.292 0.243 0.0918 0.373 0.28 0.213 0.242 0.265 0.216 0.266 0.17 0.348 0.185 0.182 0.319 0.314 0.231 0.245 0.166 0.358 0.167 0.395 0.211 0.226 0.128 0.344 0.227 0.301 0.107 0.157 0.396 0.339 0.199 0.0814 0.472 0.248 0.349 0.208 0.237 0.207 0.173 0.253 0.327 0.247 0.193 0.154 0.366 0.287 0.39 0.145 0.12 0.345 0.148 0.261 0.189 0.402 0.19 0.234 0.179 0.397 0.154 0.158 0.291 0.397 0.259 0.215 0.12 0.406 0.176 0.323 0.275 0.226 0.185 0.231 0.318 0.266 0.0848 0.205 0.381 0.33 0.157 0.5 0. [...]
+15 0.354 0.241 0.0723 0.333 0.255 0.194 0.278 0.273 0.169 0.278 0.169 0.383 0.173 0.172 0.345 0.31 0.216 0.303 0.164 0.316 0.205 0.363 0.227 0.205 0.121 0.338 0.192 0.349 0.0861 0.222 0.365 0.327 0.181 0.133 0.431 0.255 0.293 0.199 0.304 0.203 0.222 0.257 0.256 0.264 0.186 0.18 0.346 0.288 0.342 0.155 0.103 0.401 0.155 0.267 0.157 0.422 0.158 0.241 0.173 0.428 0.147 0.154 0.293 0.406 0.263 0.235 0.0825 0.42 0.168 0.304 0.28 0.247 0.161 0.227 0.348 0.265 0.0816 0.191 0.384 0.343 0.187 0. [...]
+16 0.343 0.223 0.0696 0.365 0.246 0.197 0.274 0.283 0.146 0.303 0.157 0.394 0.204 0.156 0.364 0.276 0.123 0.347 0.196 0.334 0.206 0.383 0.222 0.19 0.101 0.331 0.194 0.373 0.0746 0.233 0.384 0.308 0.232 0.129 0.419 0.219 0.291 0.168 0.337 0.205 0.238 0.243 0.252 0.266 0.137 0.221 0.378 0.263 0.3 0.201 0.0757 0.423 0.168 0.241 0.148 0.443 0.123 0.25 0.174 0.453 0.147 0.165 0.314 0.373 0.271 0.245 0.0869 0.397 0.177 0.293 0.265 0.264 0.178 0.222 0.356 0.244 0.0735 0.209 0.368 0.349 0.173 0 [...]
+17 0.349 0.217 0.0905 0.343 0.264 0.21 0.255 0.271 0.131 0.325 0.142 0.403 0.205 0.177 0.386 0.232 0.142 0.366 0.181 0.311 0.191 0.372 0.226 0.211 0.0846 0.35 0.171 0.395 0.0852 0.28 0.324 0.311 0.211 0.131 0.379 0.279 0.292 0.194 0.332 0.182 0.258 0.223 0.239 0.28 0.134 0.217 0.413 0.236 0.272 0.212 0.0385 0.478 0.178 0.245 0.131 0.446 0.121 0.247 0.157 0.475 0.129 0.16 0.31 0.401 0.193 0.278 0.0659 0.463 0.179 0.303 0.254 0.265 0.137 0.261 0.354 0.248 0.0633 0.198 0.385 0.354 0.174 0. [...]
+18 0.36 0.2 0.11 0.33 0.258 0.23 0.26 0.252 0.113 0.366 0.179 0.342 0.149 0.198 0.381 0.272 0.131 0.377 0.132 0.36 0.221 0.354 0.241 0.184 0.116 0.303 0.166 0.416 0.0963 0.306 0.286 0.312 0.201 0.134 0.348 0.318 0.245 0.178 0.316 0.262 0.316 0.199 0.185 0.3 0.0746 0.167 0.45 0.308 0.274 0.223 0.0412 0.461 0.179 0.225 0.159 0.437 0.118 0.239 0.145 0.499 0.14 0.178 0.3 0.381 0.198 0.224 0.117 0.461 0.19 0.296 0.219 0.294 0.174 0.253 0.378 0.195 0.0844 0.204 0.347 0.364 0.192 0.394 0.0795 [...]
+19 0.353 0.199 0.117 0.33 0.269 0.261 0.233 0.237 0.0678 0.342 0.186 0.403 0.138 0.194 0.384 0.284 0.125 0.461 0.128 0.286 0.206 0.333 0.248 0.212 0.122 0.273 0.137 0.468 0.0751 0.285 0.293 0.347 0.173 0.194 0.323 0.311 0.255 0.147 0.307 0.291 0.338 0.249 0.152 0.261 0.109 0.127 0.476 0.287 0.189 0.244 0.0794 0.488 0.182 0.205 0.177 0.436 0.126 0.226 0.128 0.52 0.132 0.182 0.309 0.377 0.18 0.246 0.123 0.451 0.196 0.285 0.215 0.304 0.166 0.269 0.34 0.225 0.0756 0.216 0.326 0.383 0.182 0. [...]
+20 0.287 0.191 0.13 0.392 0.262 0.262 0.22 0.257 0.104 0.286 0.171 0.439 0.111 0.234 0.366 0.289 0.131 0.457 0.119 0.293 0.174 0.356 0.247 0.223 0.143 0.283 0.145 0.429 0.088 0.257 0.3 0.355 0.201 0.15 0.286 0.364 0.271 0.134 0.276 0.318 0.272 0.282 0.216 0.23 0.105 0.11 0.523 0.263 0.219 0.217 0.099 0.464 0.148 0.226 0.178 0.448 0.142 0.224 0.107 0.527 0.114 0.175 0.277 0.434 0.175 0.274 0.127 0.424 0.206 0.311 0.21 0.274 0.185 0.282 0.329 0.204 0.0712 0.23 0.33 0.368 0.155 0.416 0.089 [...]
+21 0.293 0.219 0.136 0.352 0.292 0.235 0.182 0.292 0.13 0.289 0.184 0.397 0.0809 0.282 0.312 0.326 0.157 0.417 0.116 0.31 0.143 0.334 0.265 0.258 0.155 0.267 0.156 0.422 0.0789 0.267 0.263 0.391 0.168 0.148 0.306 0.377 0.235 0.138 0.243 0.383 0.292 0.279 0.194 0.235 0.0967 0.124 0.498 0.281 0.248 0.171 0.0953 0.486 0.128 0.247 0.169 0.456 0.154 0.219 0.108 0.519 0.104 0.179 0.289 0.428 0.166 0.293 0.142 0.399 0.209 0.329 0.231 0.232 0.219 0.251 0.312 0.219 0.0769 0.214 0.338 0.372 0.131 [...]
+22 0.282 0.214 0.0953 0.409 0.31 0.194 0.246 0.251 0.155 0.229 0.261 0.356 0.0598 0.283 0.314 0.343 0.178 0.349 0.163 0.311 0.125 0.374 0.278 0.223 0.152 0.269 0.133 0.446 0.0898 0.236 0.255 0.419 0.142 0.215 0.368 0.274 0.18 0.133 0.26 0.427 0.301 0.361 0.187 0.152 0.0881 0.129 0.437 0.346 0.28 0.138 0.128 0.455 0.118 0.275 0.174 0.433 0.148 0.248 0.107 0.497 0.118 0.209 0.237 0.436 0.225 0.275 0.154 0.346 0.201 0.327 0.246 0.226 0.273 0.226 0.375 0.127 0.0929 0.233 0.31 0.363 0.125 0. [...]
+23 0.216 0.259 0.0654 0.46 0.296 0.212 0.252 0.239 0.241 0.135 0.302 0.322 0.0859 0.257 0.311 0.346 0.187 0.356 0.168 0.289 0.09 0.403 0.274 0.233 0.0938 0.336 0.162 0.408 0.105 0.228 0.274 0.393 0.185 0.201 0.373 0.242 0.166 0.162 0.308 0.364 0.256 0.342 0.294 0.108 0.112 0.161 0.43 0.297 0.255 0.143 0.126 0.476 0.119 0.294 0.133 0.453 0.16 0.245 0.0966 0.499 0.0972 0.203 0.24 0.459 0.274 0.286 0.138 0.303 0.175 0.326 0.256 0.243 0.211 0.24 0.321 0.228 0.0762 0.217 0.351 0.356 0.106 0. [...]
+24 0.213 0.275 0.0711 0.44 0.329 0.19 0.258 0.223 0.281 0.107 0.413 0.198 0.0989 0.273 0.313 0.315 0.18 0.282 0.183 0.355 0.105 0.42 0.277 0.198 0.0996 0.332 0.166 0.403 0.135 0.234 0.312 0.319 0.18 0.142 0.397 0.281 0.234 0.203 0.27 0.293 0.281 0.316 0.302 0.102 0.105 0.224 0.471 0.2 0.262 0.195 0.0816 0.461 0.104 0.303 0.13 0.463 0.129 0.263 0.0972 0.51 0.085 0.185 0.23 0.5 0.226 0.336 0.138 0.299 0.199 0.321 0.266 0.214 0.249 0.244 0.28 0.227 0.0859 0.21 0.323 0.381 0.0909 0.462 0.10 [...]
+25 0.242 0.27 0.0909 0.397 0.342 0.238 0.238 0.181 0.296 0.187 0.397 0.121 0.127 0.246 0.311 0.316 0.148 0.257 0.213 0.382 0.103 0.447 0.244 0.206 0.105 0.299 0.204 0.393 0.116 0.236 0.324 0.325 0.125 0.135 0.458 0.282 0.271 0.239 0.243 0.247 0.326 0.305 0.248 0.121 0.123 0.238 0.429 0.21 0.192 0.238 0.0836 0.486 0.133 0.275 0.117 0.476 0.127 0.274 0.112 0.487 0.0806 0.206 0.265 0.449 0.241 0.301 0.157 0.301 0.176 0.306 0.288 0.229 0.305 0.188 0.281 0.226 0.0902 0.202 0.323 0.385 0.126 [...]
+26 0.255 0.185 0.106 0.455 0.356 0.258 0.21 0.175 0.257 0.178 0.461 0.104 0.131 0.241 0.376 0.252 0.118 0.284 0.209 0.389 0.111 0.493 0.243 0.153 0.124 0.303 0.21 0.364 0.118 0.245 0.331 0.306 0.103 0.154 0.468 0.275 0.36 0.246 0.199 0.195 0.343 0.271 0.266 0.12 0.128 0.218 0.477 0.177 0.196 0.261 0.131 0.412 0.144 0.274 0.129 0.453 0.132 0.296 0.126 0.445 0.0917 0.196 0.244 0.468 0.268 0.307 0.114 0.311 0.161 0.332 0.25 0.258 0.297 0.183 0.304 0.215 0.0637 0.238 0.326 0.372 0.115 0.5 0 [...]
+27 0.224 0.257 0.141 0.378 0.366 0.249 0.173 0.211 0.218 0.202 0.424 0.155 0.125 0.259 0.284 0.333 0.0888 0.358 0.149 0.404 0.133 0.426 0.255 0.186 0.118 0.307 0.246 0.329 0.0738 0.299 0.306 0.321 0.108 0.21 0.389 0.293 0.325 0.244 0.211 0.22 0.254 0.221 0.245 0.28 0.143 0.223 0.45 0.185 0.163 0.309 0.122 0.406 0.141 0.322 0.142 0.394 0.134 0.307 0.153 0.406 0.0788 0.192 0.265 0.464 0.239 0.37 0.102 0.289 0.142 0.371 0.233 0.253 0.295 0.167 0.283 0.255 0.0548 0.227 0.279 0.439 0.126 0.5 [...]
+28 0.218 0.218 0.183 0.38 0.407 0.214 0.157 0.223 0.141 0.206 0.467 0.186 0.122 0.276 0.288 0.313 0.106 0.361 0.142 0.391 0.149 0.414 0.242 0.195 0.134 0.281 0.237 0.349 0.0504 0.306 0.322 0.322 0.072 0.239 0.367 0.322 0.374 0.215 0.159 0.252 0.251 0.251 0.144 0.353 0.154 0.204 0.443 0.199 0.19 0.328 0.142 0.34 0.135 0.338 0.168 0.359 0.13 0.311 0.173 0.385 0.0814 0.19 0.256 0.473 0.212 0.421 0.065 0.302 0.147 0.402 0.24 0.211 0.368 0.14 0.305 0.188 0.0556 0.247 0.247 0.45 0.126 0.536 0 [...]
+29 0.204 0.223 0.17 0.403 0.33 0.274 0.168 0.228 0.145 0.183 0.389 0.282 0.122 0.284 0.227 0.368 0.0959 0.364 0.141 0.399 0.116 0.416 0.25 0.217 0.132 0.289 0.234 0.345 0.00419 0.35 0.277 0.369 0.055 0.315 0.35 0.28 0.339 0.199 0.146 0.316 0.205 0.223 0.155 0.417 0.123 0.138 0.478 0.261 0.193 0.284 0.178 0.345 0.149 0.357 0.135 0.359 0.149 0.319 0.204 0.328 0.0928 0.221 0.252 0.434 0.244 0.417 0.0489 0.29 0.116 0.432 0.223 0.229 0.335 0.187 0.335 0.143 0.0485 0.246 0.25 0.456 0.136 0.51 [...]
+[3]
+# (a,c,g,t)= (0.217, 0.283, 0.283, 0.217)
+#
+# Probabilities file for the intron model
+#
+#
+# Transition probabilities
+#
+[TRANSITION]
+# the probability of an intron of length at most d
+0.524
+# mean additional length of introns with length > d
+1.32e+03
+
+#
+# The emission probabilities of introns
+#
+[EMISSION]
+# size of the emission vector
+1024
+#k=
+4
+# patpseudo : pseudocount for sequence patterns
+5
+aaaaa 0.3912
+aaaac 0.2077
+aaaag 0.1358
+aaaat 0.2653
+aaaca 0.392
+aaacc 0.2064
+aaacg 0.1977
+aaact 0.2039
+aaaga 0.2604
+aaagc 0.2403
+aaagg 0.2121
+aaagt 0.2872
+aaata 0.3319
+aaatc 0.1772
+aaatg 0.2625
+aaatt 0.2284
+aacaa 0.2884
+aacac 0.2755
+aacag 0.1792
+aacat 0.2569
+aacca 0.3169
+aaccc 0.2976
+aaccg 0.1807
+aacct 0.2047
+aacga 0.2411
+aacgc 0.2554
+aacgg 0.1914
+aacgt 0.3121
+aacta 0.1841
+aactc 0.2737
+aactg 0.2566
+aactt 0.2856
+aagaa 0.309
+aagac 0.2136
+aagag 0.2568
+aagat 0.2206
+aagca 0.3086
+aagcc 0.2327
+aagcg 0.2105
+aagct 0.2482
+aagga 0.2329
+aaggc 0.2627
+aaggg 0.2736
+aaggt 0.2308
+aagta 0.1929
+aagtc 0.2173
+aagtg 0.3292
+aagtt 0.2606
+aataa 0.4024
+aatac 0.1878
+aatag 0.1244
+aatat 0.2855
+aatca 0.2989
+aatcc 0.2349
+aatcg 0.2408
+aatct 0.2253
+aatga 0.2618
+aatgc 0.2089
+aatgg 0.1885
+aatgt 0.3407
+aatta 0.2728
+aattc 0.1861
+aattg 0.2443
+aattt 0.2968
+acaaa 0.3353
+acaac 0.2566
+acaag 0.1762
+acaat 0.2319
+acaca 0.4237
+acacc 0.1884
+acacg 0.2168
+acact 0.1711
+acaga 0.2639
+acagc 0.3085
+acagg 0.216
+acagt 0.2116
+acata 0.1745
+acatc 0.2582
+acatg 0.2147
+acatt 0.3527
+accaa 0.2276
+accac 0.3765
+accag 0.2098
+accat 0.1861
+accca 0.3044
+acccc 0.3068
+acccg 0.1982
+accct 0.1907
+accga 0.2467
+accgc 0.3074
+accgg 0.2055
+accgt 0.2403
+accta 0.1717
+acctc 0.303
+acctg 0.2939
+acctt 0.2314
+acgaa 0.2287
+acgac 0.2637
+acgag 0.2809
+acgat 0.2267
+acgca 0.3147
+acgcc 0.2199
+acgcg 0.2713
+acgct 0.194
+acgga 0.208
+acggc 0.2971
+acggg 0.2667
+acggt 0.2282
+acgta 0.1661
+acgtc 0.2346
+acgtg 0.3644
+acgtt 0.2348
+actaa 0.3034
+actac 0.292
+actag 0.1472
+actat 0.2574
+actca 0.298
+actcc 0.2301
+actcg 0.2568
+actct 0.2151
+actga 0.2069
+actgc 0.3234
+actgg 0.2242
+actgt 0.2455
+actta 0.1714
+acttc 0.2126
+acttg 0.2669
+acttt 0.3491
+agaaa 0.3107
+agaac 0.2092
+agaag 0.2376
+agaat 0.2425
+agaca 0.3499
+agacc 0.2097
+agacg 0.2396
+agact 0.2008
+agaga 0.3109
+agagc 0.2254
+agagg 0.2699
+agagt 0.1938
+agata 0.2032
+agatc 0.1823
+agatg 0.3589
+agatt 0.2557
+agcaa 0.2305
+agcac 0.2535
+agcag 0.342
+agcat 0.174
+agcca 0.3422
+agccc 0.2323
+agccg 0.2236
+agcct 0.2019
+agcga 0.2581
+agcgc 0.258
+agcgg 0.2758
+agcgt 0.2081
+agcta 0.1535
+agctc 0.2745
+agctg 0.3154
+agctt 0.2567
+aggaa 0.2781
+aggac 0.1989
+aggag 0.3377
+aggat 0.1853
+aggca 0.2809
+aggcc 0.273
+aggcg 0.2256
+aggct 0.2205
+aggga 0.234
+agggc 0.2088
+agggg 0.3519
+agggt 0.2054
+aggta 0.1753
+aggtc 0.2236
+aggtg 0.3667
+aggtt 0.2344
+agtaa 0.2908
+agtac 0.2336
+agtag 0.2061
+agtat 0.2695
+agtca 0.3416
+agtcc 0.186
+agtcg 0.2418
+agtct 0.2306
+agtga 0.2463
+agtgc 0.2134
+agtgg 0.2852
+agtgt 0.2551
+agtta 0.1943
+agttc 0.1954
+agttg 0.2758
+agttt 0.3345
+ataaa 0.4068
+ataac 0.1763
+ataag 0.1224
+ataat 0.2945
+ataca 0.4458
+atacc 0.1707
+atacg 0.1575
+atact 0.226
+ataga 0.2763
+atagc 0.2638
+atagg 0.2223
+atagt 0.2375
+atata 0.2955
+atatc 0.1735
+atatg 0.1765
+atatt 0.3545
+atcaa 0.2432
+atcac 0.3025
+atcag 0.1861
+atcat 0.2682
+atcca 0.347
+atccc 0.2692
+atccg 0.1614
+atcct 0.2224
+atcga 0.2486
+atcgc 0.2672
+atcgg 0.2142
+atcgt 0.27
+atcta 0.1785
+atctc 0.2996
+atctg 0.2711
+atctt 0.2507
+atgaa 0.3123
+atgac 0.2168
+atgag 0.2124
+atgat 0.2585
+atgca 0.3675
+atgcc 0.21
+atgcg 0.1887
+atgct 0.2338
+atgga 0.2513
+atggc 0.244
+atggg 0.2525
+atggt 0.2523
+atgta 0.2265
+atgtc 0.168
+atgtg 0.2819
+atgtt 0.3236
+attaa 0.3325
+attac 0.2086
+attag 0.1355
+attat 0.3234
+attca 0.3271
+attcc 0.259
+attcg 0.1624
+attct 0.2516
+attga 0.2323
+attgc 0.2336
+attgg 0.2238
+attgt 0.3103
+attta 0.2494
+atttc 0.1777
+atttg 0.2293
+atttt 0.3436
+caaaa 0.2851
+caaac 0.2435
+caaag 0.2085
+caaat 0.2629
+caaca 0.411
+caacc 0.2116
+caacg 0.192
+caact 0.1854
+caaga 0.2539
+caagc 0.2639
+caagg 0.2272
+caagt 0.255
+caata 0.2288
+caatc 0.1991
+caatg 0.2932
+caatt 0.2789
+cacaa 0.2482
+cacac 0.3627
+cacag 0.2057
+cacat 0.1834
+cacca 0.3598
+caccc 0.2521
+caccg 0.2004
+cacct 0.1878
+cacga 0.2237
+cacgc 0.2666
+cacgg 0.2321
+cacgt 0.2776
+cacta 0.1486
+cactc 0.2793
+cactg 0.3149
+cactt 0.2572
+cagaa 0.2496
+cagac 0.2414
+cagag 0.2924
+cagat 0.2165
+cagca 0.3803
+cagcc 0.234
+cagcg 0.1959
+cagct 0.1897
+cagga 0.2491
+caggc 0.2301
+caggg 0.277
+caggt 0.2438
+cagta 0.1807
+cagtc 0.2261
+cagtg 0.3752
+cagtt 0.218
+cataa 0.2919
+catac 0.2527
+catag 0.1941
+catat 0.2613
+catca 0.3548
+catcc 0.1886
+catcg 0.215
+catct 0.2416
+catga 0.232
+catgc 0.2493
+catgg 0.2487
+catgt 0.27
+catta 0.1964
+cattc 0.2083
+cattg 0.2558
+cattt 0.3396
+ccaaa 0.2896
+ccaac 0.264
+ccaag 0.2088
+ccaat 0.2375
+ccaca 0.2469
+ccacc 0.3357
+ccacg 0.2205
+ccact 0.1968
+ccaga 0.2145
+ccagc 0.3125
+ccagg 0.2587
+ccagt 0.2143
+ccata 0.1721
+ccatc 0.3106
+ccatg 0.2604
+ccatt 0.2569
+cccaa 0.2169
+cccac 0.3623
+cccag 0.2222
+cccat 0.1986
+cccca 0.2092
+ccccc 0.4394
+ccccg 0.1476
+cccct 0.2038
+cccga 0.2165
+cccgc 0.2929
+cccgg 0.2308
+cccgt 0.2598
+cccta 0.1354
+ccctc 0.3741
+ccctg 0.2692
+ccctt 0.2212
+ccgaa 0.2238
+ccgac 0.2476
+ccgag 0.301
+ccgat 0.2275
+ccgca 0.2246
+ccgcc 0.3028
+ccgcg 0.2327
+ccgct 0.2399
+ccgga 0.1899
+ccggc 0.3114
+ccggg 0.2734
+ccggt 0.2252
+ccgta 0.1517
+ccgtc 0.2479
+ccgtg 0.4077
+ccgtt 0.1927
+cctaa 0.2453
+cctac 0.3275
+cctag 0.1738
+cctat 0.2534
+cctca 0.2046
+cctcc 0.3571
+cctcg 0.2079
+cctct 0.2304
+cctga 0.1736
+cctgc 0.3096
+cctgg 0.2683
+cctgt 0.2484
+cctta 0.1717
+ccttc 0.2784
+ccttg 0.2638
+ccttt 0.2861
+cgaaa 0.3378
+cgaac 0.2352
+cgaag 0.2006
+cgaat 0.2264
+cgaca 0.2577
+cgacc 0.2479
+cgacg 0.2819
+cgact 0.2126
+cgaga 0.2102
+cgagc 0.2549
+cgagg 0.2743
+cgagt 0.2606
+cgata 0.1758
+cgatc 0.184
+cgatg 0.3451
+cgatt 0.2952
+cgcaa 0.2259
+cgcac 0.3345
+cgcag 0.255
+cgcat 0.1847
+cgcca 0.264
+cgccc 0.2505
+cgccg 0.2939
+cgcct 0.1917
+cgcga 0.2047
+cgcgc 0.296
+cgcgg 0.2391
+cgcgt 0.2601
+cgcta 0.1445
+cgctc 0.3152
+cgctg 0.3238
+cgctt 0.2165
+cggaa 0.2235
+cggac 0.2137
+cggag 0.3744
+cggat 0.1884
+cggca 0.2427
+cggcc 0.261
+cggcg 0.291
+cggct 0.2054
+cggga 0.2017
+cgggc 0.2268
+cgggg 0.3111
+cgggt 0.2604
+cggta 0.1684
+cggtc 0.1952
+cggtg 0.4163
+cggtt 0.2202
+cgtaa 0.253
+cgtac 0.2698
+cgtag 0.2665
+cgtat 0.2107
+cgtca 0.3246
+cgtcc 0.1982
+cgtcg 0.2568
+cgtct 0.2204
+cgtga 0.2499
+cgtgc 0.2241
+cgtgg 0.2616
+cgtgt 0.2645
+cgtta 0.1729
+cgttc 0.2066
+cgttg 0.2906
+cgttt 0.3298
+ctaaa 0.3533
+ctaac 0.23
+ctaag 0.1632
+ctaat 0.2534
+ctaca 0.3318
+ctacc 0.2422
+ctacg 0.2281
+ctact 0.1979
+ctaga 0.266
+ctagc 0.24
+ctagg 0.2613
+ctagt 0.2327
+ctata 0.2546
+ctatc 0.2104
+ctatg 0.2456
+ctatt 0.2894
+ctcaa 0.2576
+ctcac 0.344
+ctcag 0.1786
+ctcat 0.2199
+ctcca 0.2685
+ctccc 0.314
+ctccg 0.1844
+ctcct 0.2331
+ctcga 0.1749
+ctcgc 0.3152
+ctcgg 0.2338
+ctcgt 0.2761
+ctcta 0.1345
+ctctc 0.345
+ctctg 0.2896
+ctctt 0.2309
+ctgaa 0.2916
+ctgac 0.2333
+ctgag 0.2329
+ctgat 0.2422
+ctgca 0.2921
+ctgcc 0.2352
+ctgcg 0.171
+ctgct 0.3017
+ctgga 0.217
+ctggc 0.26
+ctggg 0.2607
+ctggt 0.2624
+ctgta 0.2114
+ctgtc 0.1944
+ctgtg 0.3466
+ctgtt 0.2476
+cttaa 0.3472
+cttac 0.2291
+cttag 0.1668
+cttat 0.2569
+cttca 0.3299
+cttcc 0.2594
+cttcg 0.1514
+cttct 0.2594
+cttga 0.22
+cttgc 0.27
+cttgg 0.232
+cttgt 0.278
+cttta 0.2432
+ctttc 0.2182
+ctttg 0.2738
+ctttt 0.2649
+gaaaa 0.3117
+gaaac 0.2239
+gaaag 0.2086
+gaaat 0.2559
+gaaca 0.3024
+gaacc 0.2655
+gaacg 0.2202
+gaact 0.2118
+gaaga 0.2703
+gaagc 0.2399
+gaagg 0.2652
+gaagt 0.2247
+gaata 0.2241
+gaatc 0.2167
+gaatg 0.2959
+gaatt 0.2632
+gacaa 0.2705
+gacac 0.3054
+gacag 0.2177
+gacat 0.2063
+gacca 0.2811
+gaccc 0.2911
+gaccg 0.1928
+gacct 0.235
+gacga 0.2637
+gacgc 0.2145
+gacgg 0.2302
+gacgt 0.2915
+gacta 0.1198
+gactc 0.2819
+gactg 0.3158
+gactt 0.2826
+gagaa 0.2248
+gagac 0.238
+gagag 0.3185
+gagat 0.2188
+gagca 0.2684
+gagcc 0.2328
+gagcg 0.2673
+gagct 0.2315
+gagga 0.2446
+gaggc 0.2231
+gaggg 0.322
+gaggt 0.2102
+gagta 0.1732
+gagtc 0.2176
+gagtg 0.3587
+gagtt 0.2505
+gataa 0.3118
+gatac 0.1986
+gatag 0.1924
+gatat 0.2973
+gatca 0.2763
+gatcc 0.2314
+gatcg 0.2377
+gatct 0.2545
+gatga 0.2845
+gatgc 0.1961
+gatgg 0.248
+gatgt 0.2714
+gatta 0.2088
+gattc 0.2173
+gattg 0.2474
+gattt 0.3266
+gcaaa 0.2884
+gcaac 0.2491
+gcaag 0.2289
+gcaat 0.2336
+gcaca 0.3092
+gcacc 0.2397
+gcacg 0.2536
+gcact 0.1976
+gcaga 0.2016
+gcagc 0.3464
+gcagg 0.2221
+gcagt 0.2299
+gcata 0.1719
+gcatc 0.2569
+gcatg 0.2732
+gcatt 0.298
+gccaa 0.2363
+gccac 0.3487
+gccag 0.2224
+gccat 0.1926
+gccca 0.2538
+gcccc 0.3212
+gcccg 0.2001
+gccct 0.2248
+gccga 0.2001
+gccgc 0.3231
+gccgg 0.2269
+gccgt 0.2498
+gccta 0.1298
+gcctc 0.3245
+gcctg 0.2799
+gcctt 0.2658
+gcgaa 0.1833
+gcgac 0.2525
+gcgag 0.332
+gcgat 0.2322
+gcgca 0.2412
+gcgcc 0.2403
+gcgcg 0.2914
+gcgct 0.227
+gcgga 0.1705
+gcggc 0.3263
+gcggg 0.2553
+gcggt 0.2479
+gcgta 0.1286
+gcgtc 0.2105
+gcgtg 0.4266
+gcgtt 0.2343
+gctaa 0.2789
+gctac 0.3072
+gctag 0.1435
+gctat 0.2703
+gctca 0.2689
+gctcc 0.2663
+gctcg 0.2329
+gctct 0.2319
+gctga 0.1642
+gctgc 0.3474
+gctgg 0.2331
+gctgt 0.2552
+gctta 0.1519
+gcttc 0.242
+gcttg 0.2945
+gcttt 0.3116
+ggaaa 0.3069
+ggaac 0.1826
+ggaag 0.249
+ggaat 0.2616
+ggaca 0.3298
+ggacc 0.2218
+ggacg 0.256
+ggact 0.1925
+ggaga 0.2648
+ggagc 0.2152
+ggagg 0.3476
+ggagt 0.1724
+ggata 0.1855
+ggatc 0.1895
+ggatg 0.3202
+ggatt 0.3048
+ggcaa 0.2558
+ggcac 0.2604
+ggcag 0.3051
+ggcat 0.1788
+ggcca 0.3119
+ggccc 0.2216
+ggccg 0.2482
+ggcct 0.2183
+ggcga 0.2546
+ggcgc 0.2376
+ggcgg 0.3027
+ggcgt 0.2052
+ggcta 0.1553
+ggctc 0.2574
+ggctg 0.3628
+ggctt 0.2245
+gggaa 0.2543
+gggac 0.1842
+gggag 0.376
+gggat 0.1854
+gggca 0.2901
+gggcc 0.2382
+gggcg 0.2535
+gggct 0.2182
+gggga 0.1963
+ggggc 0.1728
+ggggg 0.4396
+ggggt 0.1914
+gggta 0.1687
+gggtc 0.2075
+gggtg 0.3686
+gggtt 0.2552
+ggtaa 0.3372
+ggtac 0.2272
+ggtag 0.241
+ggtat 0.1946
+ggtca 0.3372
+ggtcc 0.1928
+ggtcg 0.2535
+ggtct 0.2165
+ggtga 0.2514
+ggtgc 0.1888
+ggtgg 0.3549
+ggtgt 0.2049
+ggtta 0.2038
+ggttc 0.2171
+ggttg 0.279
+ggttt 0.3001
+gtaaa 0.3917
+gtaac 0.1944
+gtaag 0.151
+gtaat 0.2629
+gtaca 0.3699
+gtacc 0.2104
+gtacg 0.2129
+gtact 0.2068
+gtaga 0.2508
+gtagc 0.2622
+gtagg 0.2513
+gtagt 0.2356
+gtata 0.2572
+gtatc 0.1656
+gtatg 0.2439
+gtatt 0.3333
+gtcaa 0.2366
+gtcac 0.3765
+gtcag 0.1716
+gtcat 0.2153
+gtcca 0.2906
+gtccc 0.2753
+gtccg 0.1884
+gtcct 0.2457
+gtcga 0.2239
+gtcgc 0.2691
+gtcgg 0.216
+gtcgt 0.2911
+gtcta 0.1367
+gtctc 0.3231
+gtctg 0.2996
+gtctt 0.2406
+gtgaa 0.2339
+gtgac 0.2897
+gtgag 0.2538
+gtgat 0.2227
+gtgca 0.2908
+gtgcc 0.2195
+gtgcg 0.2453
+gtgct 0.2445
+gtgga 0.2102
+gtggc 0.247
+gtggg 0.2575
+gtggt 0.2853
+gtgta 0.1744
+gtgtc 0.1781
+gtgtg 0.399
+gtgtt 0.2485
+gttaa 0.3496
+gttac 0.2131
+gttag 0.1699
+gttat 0.2674
+gttca 0.3297
+gttcc 0.2139
+gttcg 0.1996
+gttct 0.2569
+gttga 0.2364
+gttgc 0.2262
+gttgg 0.2258
+gttgt 0.3117
+gttta 0.2216
+gtttc 0.1901
+gtttg 0.2595
+gtttt 0.3288
+taaaa 0.3531
+taaac 0.1981
+taaag 0.1764
+taaat 0.2724
+taaca 0.3727
+taacc 0.2427
+taacg 0.1795
+taact 0.2051
+taaga 0.25
+taagc 0.228
+taagg 0.2477
+taagt 0.2744
+taata 0.2728
+taatc 0.1734
+taatg 0.2324
+taatt 0.3214
+tacaa 0.2678
+tacac 0.269
+tacag 0.213
+tacat 0.2502
+tacca 0.2932
+taccc 0.2849
+taccg 0.2002
+tacct 0.2217
+tacga 0.2426
+tacgc 0.2075
+tacgg 0.2231
+tacgt 0.3268
+tacta 0.1763
+tactc 0.254
+tactg 0.2857
+tactt 0.284
+tagaa 0.3001
+tagac 0.1984
+tagag 0.2447
+tagat 0.2568
+tagca 0.3009
+tagcc 0.2501
+tagcg 0.2183
+tagct 0.2307
+tagga 0.2243
+taggc 0.2131
+taggg 0.2782
+taggt 0.2844
+tagta 0.2101
+tagtc 0.1616
+tagtg 0.3337
+tagtt 0.2946
+tataa 0.2933
+tatac 0.208
+tatag 0.1571
+tatat 0.3416
+tatca 0.3164
+tatcc 0.21
+tatcg 0.2106
+tatct 0.263
+tatga 0.2491
+tatgc 0.2179
+tatgg 0.2282
+tatgt 0.3047
+tatta 0.2266
+tattc 0.155
+tattg 0.1962
+tattt 0.4221
+tcaaa 0.2948
+tcaac 0.2703
+tcaag 0.1937
+tcaat 0.2412
+tcaca 0.2614
+tcacc 0.284
+tcacg 0.2516
+tcact 0.2029
+tcaga 0.2515
+tcagc 0.2815
+tcagg 0.2141
+tcagt 0.2529
+tcata 0.1642
+tcatc 0.3115
+tcatg 0.2124
+tcatt 0.312
+tccaa 0.2151
+tccac 0.3422
+tccag 0.214
+tccat 0.2287
+tccca 0.2593
+tcccc 0.34
+tcccg 0.1659
+tccct 0.2348
+tccga 0.2208
+tccgc 0.2729
+tccgg 0.2236
+tccgt 0.2827
+tccta 0.1325
+tcctc 0.3449
+tcctg 0.2939
+tcctt 0.2286
+tcgaa 0.2103
+tcgac 0.2718
+tcgag 0.2384
+tcgat 0.2795
+tcgca 0.2371
+tcgcc 0.2863
+tcgcg 0.2241
+tcgct 0.2525
+tcgga 0.1896
+tcggc 0.2777
+tcggg 0.2594
+tcggt 0.2733
+tcgta 0.1522
+tcgtc 0.2619
+tcgtg 0.3622
+tcgtt 0.2238
+tctaa 0.2695
+tctac 0.2916
+tctag 0.1579
+tctat 0.281
+tctca 0.2469
+tctcc 0.294
+tctcg 0.1722
+tctct 0.2868
+tctga 0.2017
+tctgc 0.2781
+tctgg 0.22
+tctgt 0.3002
+tctta 0.1571
+tcttc 0.2572
+tcttg 0.2673
+tcttt 0.3184
+tgaaa 0.3073
+tgaac 0.21
+tgaag 0.2362
+tgaat 0.2465
+tgaca 0.2786
+tgacc 0.2411
+tgacg 0.2606
+tgact 0.2197
+tgaga 0.258
+tgagc 0.2521
+tgagg 0.231
+tgagt 0.259
+tgata 0.1868
+tgatc 0.1513
+tgatg 0.4028
+tgatt 0.2592
+tgcaa 0.2482
+tgcac 0.2501
+tgcag 0.2748
+tgcat 0.2269
+tgcca 0.3067
+tgccc 0.258
+tgccg 0.2206
+tgcct 0.2147
+tgcga 0.2179
+tgcgc 0.2465
+tgcgg 0.2321
+tgcgt 0.3035
+tgcta 0.1363
+tgctc 0.2165
+tgctg 0.4301
+tgctt 0.2172
+tggaa 0.2644
+tggac 0.1895
+tggag 0.3132
+tggat 0.2329
+tggca 0.2719
+tggcc 0.2643
+tggcg 0.2106
+tggct 0.2533
+tggga 0.2184
+tgggc 0.1992
+tgggg 0.3053
+tgggt 0.2771
+tggta 0.1482
+tggtc 0.1709
+tggtg 0.449
+tggtt 0.2319
+tgtaa 0.2885
+tgtac 0.2296
+tgtag 0.1898
+tgtat 0.2921
+tgtca 0.2994
+tgtcc 0.2204
+tgtcg 0.2025
+tgtct 0.2777
+tgtga 0.1934
+tgtgc 0.2035
+tgtgg 0.2181
+tgtgt 0.385
+tgtta 0.1872
+tgttc 0.1479
+tgttg 0.3241
+tgttt 0.3408
+ttaaa 0.3729
+ttaac 0.2069
+ttaag 0.1484
+ttaat 0.2718
+ttaca 0.3766
+ttacc 0.2531
+ttacg 0.1618
+ttact 0.2086
+ttaga 0.2567
+ttagc 0.2637
+ttagg 0.2085
+ttagt 0.2711
+ttata 0.2241
+ttatc 0.1607
+ttatg 0.1741
+ttatt 0.4412
+ttcaa 0.2503
+ttcac 0.2751
+ttcag 0.194
+ttcat 0.2807
+ttcca 0.3058
+ttccc 0.2866
+ttccg 0.1486
+ttcct 0.259
+ttcga 0.2122
+ttcgc 0.2394
+ttcgg 0.2391
+ttcgt 0.3093
+ttcta 0.1767
+ttctc 0.2608
+ttctg 0.2649
+ttctt 0.2975
+ttgaa 0.2786
+ttgac 0.2383
+ttgag 0.2488
+ttgat 0.2344
+ttgca 0.3234
+ttgcc 0.2417
+ttgcg 0.1857
+ttgct 0.2492
+ttgga 0.2111
+ttggc 0.2673
+ttggg 0.2462
+ttggt 0.2754
+ttgta 0.2008
+ttgtc 0.1825
+ttgtg 0.3158
+ttgtt 0.3009
+tttaa 0.3252
+tttac 0.2216
+tttag 0.1347
+tttat 0.3185
+tttca 0.3196
+tttcc 0.2381
+tttcg 0.1898
+tttct 0.2526
+tttga 0.2194
+tttgc 0.223
+tttgg 0.2109
+tttgt 0.3467
+tttta 0.2497
+ttttc 0.1672
+ttttg 0.192
+ttttt 0.3912
+
+# patterns:
+# aaaaa 15060
+# aaaac 8021
+# aaaag 5255
+# aaaat 10260
+# aaaca 9717
+# aaacc 5109
+# aaacg 4826
+# aaact 4987
+# aaaga 5148
+# aaagc 4719
+# aaagg 4220
+# aaagt 5662
+# aaata 9920
+# aaatc 5195
+# aaatg 7927
+# aaatt 6823
+# aacaa 8174
+# aacac 7839
+# aacag 5123
+# aacat 7441
+# aacca 5310
+# aaccc 5175
+# aaccg 3284
+# aacct 3458
+# aacga 3491
+# aacgc 3827
+# aacgg 2868
+# aacgt 4510
+# aacta 2801
+# aactc 4088
+# aactg 3879
+# aactt 4220
+# aagaa 4968
+# aagac 3448
+# aagag 4157
+# aagat 3559
+# aagca 4875
+# aagcc 3556
+# aagcg 3169
+# aagct 3846
+# aagga 3374
+# aaggc 3910
+# aaggg 4022
+# aaggt 3369
+# aagta 3151
+# aagtc 3559
+# aagtg 5400
+# aagtt 4220
+# aataa 9420
+# aatac 4411
+# aatag 2889
+# aatat 6758
+# aatca 4901
+# aatcc 3716
+# aatcg 3800
+# aatct 3663
+# aatga 5984
+# aatgc 4844
+# aatgg 4314
+# aatgt 7980
+# aatta 6241
+# aattc 4214
+# aattg 5590
+# aattt 6823
+# acaaa 9112
+# acaac 7120
+# acaag 4763
+# acaat 6247
+# acaca 13840
+# acacc 6141
+# acacg 7071
+# acact 5461
+# acaga 5550
+# acagc 6464
+# acagg 4510
+# acagt 4437
+# acata 4036
+# acatc 5749
+# acatg 4948
+# acatt 7980
+# accaa 5205
+# accac 9249
+# accag 4862
+# accat 4415
+# accca 6177
+# acccc 6582
+# acccg 4203
+# accct 3855
+# accga 3505
+# accgc 4496
+# accgg 3103
+# accgt 3414
+# accta 2572
+# acctc 4495
+# acctg 4368
+# acctt 3369
+# acgaa 3555
+# acgac 4199
+# acgag 4478
+# acgat 3518
+# acgca 5226
+# acgcc 3713
+# acgcg 4561
+# acgct 3176
+# acgga 3042
+# acggc 4499
+# acggg 4087
+# acggt 3414
+# acgta 3241
+# acgtc 4547
+# acgtg 7191
+# acgtt 4510
+# actaa 2857
+# actac 2848
+# actag 1341
+# actat 2449
+# actca 4996
+# actcc 3863
+# actcg 4348
+# actct 3561
+# actga 3708
+# actgc 5752
+# actgg 3929
+# actgt 4437
+# actta 2889
+# acttc 3452
+# acttg 4321
+# acttt 5662
+# agaaa 5183
+# agaac 3504
+# agaag 4028
+# agaat 4020
+# agaca 5278
+# agacc 3102
+# agacg 3499
+# agact 2887
+# agaga 5766
+# agagc 4027
+# agagg 4993
+# agagt 3561
+# agata 2861
+# agatc 2614
+# agatg 5256
+# agatt 3663
+# agcaa 4996
+# agcac 5776
+# agcag 8077
+# agcat 3862
+# agcca 5364
+# agccc 3834
+# agccg 3750
+# agcct 3242
+# agcga 3892
+# agcgc 4029
+# agcgg 4417
+# agcgt 3176
+# agcta 2182
+# agctc 4049
+# agctg 4806
+# agctt 3846
+# aggaa 4238
+# aggac 2970
+# aggag 5338
+# aggat 2759
+# aggca 4311
+# aggcc 4112
+# aggcg 3388
+# aggct 3242
+# aggga 4375
+# agggc 3873
+# agggg 6808
+# agggt 3855
+# aggta 2530
+# aggtc 3310
+# aggtg 5500
+# aggtt 3458
+# agtaa 3275
+# agtac 2624
+# agtag 2351
+# agtat 2975
+# agtca 4355
+# agtcc 2369
+# agtcg 3127
+# agtct 2887
+# agtga 5345
+# agtgc 4612
+# agtgg 6050
+# agtgt 5461
+# agtta 2889
+# agttc 2960
+# agttg 4152
+# agttt 4987
+# ataaa 8804
+# ataac 3863
+# ataag 2701
+# ataat 6316
+# ataca 5884
+# atacc 2324
+# atacg 2037
+# atact 2975
+# ataga 2731
+# atagc 2624
+# atagg 2500
+# atagt 2449
+# atata 5483
+# atatc 3216
+# atatg 3398
+# atatt 6758
+# atcaa 4588
+# atcac 5673
+# atcag 3585
+# atcat 5177
+# atcca 4264
+# atccc 3409
+# atccg 1960
+# atcct 2759
+# atcga 3253
+# atcgc 3549
+# atcgg 2841
+# atcgt 3518
+# atcta 2543
+# atctc 4411
+# atctg 3884
+# atctt 3559
+# atgaa 6043
+# atgac 4170
+# atgag 4193
+# atgat 5177
+# atgca 5962
+# atgcc 3388
+# atgcg 3151
+# atgct 3862
+# atgga 4285
+# atggc 4098
+# atggg 4326
+# atggt 4415
+# atgta 5091
+# atgtc 3726
+# atgtg 6458
+# atgtt 7441
+# attaa 6427
+# attac 4067
+# attag 2647
+# attat 6316
+# attca 5235
+# attcc 4250
+# attcg 2583
+# attct 4020
+# attga 4750
+# attgc 4598
+# attgg 4529
+# attgt 6247
+# attta 7535
+# atttc 5213
+# atttg 6859
+# atttt 10260
+# caaaa 7445
+# caaac 6414
+# caaag 5482
+# caaat 6859
+# caaca 9371
+# caacc 4919
+# caacg 4253
+# caact 4152
+# caaga 4263
+# caagc 4662
+# caagg 3790
+# caagt 4321
+# caata 4602
+# caatc 4045
+# caatg 5895
+# caatt 5590
+# cacaa 8723
+# cacac 13152
+# cacag 7312
+# cacat 6458
+# cacca 11041
+# caccc 7734
+# caccg 6086
+# cacct 5500
+# cacga 5774
+# cacgc 7148
+# cacgg 6205
+# cacgt 7191
+# cacta 3230
+# cactc 6125
+# cactg 6707
+# cactt 5400
+# cagaa 4388
+# cagac 4499
+# cagag 5278
+# cagat 3884
+# cagca 9919
+# cagcc 5991
+# cagcg 5065
+# cagct 4806
+# cagga 4539
+# caggc 4188
+# caggg 5094
+# caggt 4368
+# cagta 3229
+# cagtc 4010
+# cagtg 6707
+# cagtt 3879
+# cataa 3874
+# catac 3170
+# catag 2448
+# catat 3398
+# catca 7758
+# catcc 4036
+# catcg 4593
+# catct 5256
+# catga 4163
+# catgc 4559
+# catgg 4456
+# catgt 4948
+# catta 4570
+# cattc 4725
+# cattg 5895
+# cattt 7927
+# ccaaa 5515
+# ccaac 5128
+# ccaag 3921
+# ccaat 4529
+# ccaca 7810
+# ccacc 11108
+# ccacg 6924
+# ccact 6050
+# ccaga 3893
+# ccagc 6011
+# ccagg 4911
+# ccagt 3929
+# ccata 2946
+# ccatc 5413
+# ccatg 4456
+# ccatt 4314
+# cccaa 4709
+# cccac 8343
+# cccag 4995
+# cccat 4326
+# cccca 7022
+# ccccc 14899
+# ccccg 4962
+# cccct 6808
+# cccga 3383
+# cccgc 4716
+# cccgg 3761
+# cccgt 4087
+# cccta 2607
+# ccctc 7189
+# ccctg 5094
+# ccctt 4022
+# ccgaa 2769
+# ccgac 3277
+# ccgag 3965
+# ccgat 2841
+# ccgca 4009
+# ccgcc 5670
+# ccgcg 4299
+# ccgct 4417
+# ccgga 2407
+# ccggc 4322
+# ccggg 3761
+# ccggt 3103
+# ccgta 2205
+# ccgtc 3778
+# ccgtg 6205
+# ccgtt 2868
+# cctaa 2230
+# cctac 2981
+# cctag 1527
+# cctat 2500
+# cctca 4379
+# cctcc 7976
+# cctcg 4643
+# cctct 4993
+# cctga 3090
+# cctgc 5684
+# cctgg 4911
+# cctgt 4510
+# cctta 2520
+# ccttc 4141
+# ccttg 3790
+# ccttt 4220
+# cgaaa 3836
+# cgaac 2727
+# cgaag 2317
+# cgaat 2583
+# cgaca 3750
+# cgacc 3661
+# cgacg 4172
+# cgact 3127
+# cgaga 3446
+# cgagc 4239
+# cgagg 4643
+# cgagt 4348
+# cgata 2311
+# cgatc 2451
+# cgatg 4593
+# cgatt 3800
+# cgcaa 3758
+# cgcac 5803
+# cgcag 4326
+# cgcat 3151
+# cgcca 4769
+# cgccc 4606
+# cgccg 5574
+# cgcct 3388
+# cgcga 3556
+# cgcgc 5286
+# cgcgg 4299
+# cgcgt 4561
+# cgcta 2199
+# cgctc 5082
+# cgctg 5065
+# cgctt 3169
+# cggaa 2340
+# cggac 2368
+# cggag 4184
+# cggat 1960
+# cggca 4379
+# cggcc 4877
+# cggcg 5574
+# cggct 3750
+# cggga 3206
+# cgggc 3575
+# cgggg 4962
+# cgggt 4203
+# cggta 2330
+# cggtc 2820
+# cggtg 6086
+# cggtt 3284
+# cgtaa 2487
+# cgtac 2841
+# cgtag 2630
+# cgtat 2037
+# cgtca 5127
+# cgtcc 3189
+# cgtcg 4172
+# cgtct 3499
+# cgtga 6345
+# cgtgc 5985
+# cgtgg 6924
+# cgtgt 7071
+# cgtta 2546
+# cgttc 3080
+# cgttg 4253
+# cgttt 4826
+# ctaaa 3668
+# ctaac 2481
+# ctaag 1703
+# ctaat 2647
+# ctaca 3902
+# ctacc 2997
+# ctacg 2630
+# ctact 2351
+# ctaga 1560
+# ctagc 1434
+# ctagg 1527
+# ctagt 1341
+# ctata 2730
+# ctatc 2232
+# ctatg 2448
+# ctatt 2889
+# ctcaa 4837
+# ctcac 6792
+# ctcag 3387
+# ctcat 4193
+# ctcca 6170
+# ctccc 7139
+# ctccg 4184
+# ctcct 5338
+# ctcga 2874
+# ctcgc 5358
+# ctcgg 3965
+# ctcgt 4478
+# ctcta 2418
+# ctctc 6501
+# ctctg 5278
+# ctctt 4157
+# ctgaa 4175
+# ctgac 3416
+# ctgag 3387
+# ctgat 3585
+# ctgca 7189
+# ctgcc 5988
+# ctgcg 4326
+# ctgct 8077
+# ctgga 4018
+# ctggc 4862
+# ctggg 4995
+# ctggt 4862
+# ctgta 4442
+# ctgtc 4081
+# ctgtg 7312
+# ctgtt 5123
+# cttaa 3532
+# cttac 2336
+# cttag 1703
+# cttat 2701
+# cttca 5123
+# cttcc 4033
+# cttcg 2317
+# cttct 4028
+# cttga 3735
+# cttgc 4607
+# cttgg 3921
+# cttgt 4763
+# cttta 4759
+# ctttc 4249
+# ctttg 5482
+# ctttt 5255
+# gaaaa 6402
+# gaaac 4651
+# gaaag 4249
+# gaaat 5213
+# gaaca 4199
+# gaacc 3624
+# gaacg 3080
+# gaact 2960
+# gaaga 4180
+# gaagc 3728
+# gaagg 4141
+# gaagt 3452
+# gaata 3658
+# gaatc 3491
+# gaatg 4725
+# gaatt 4214
+# gacaa 4910
+# gacac 5978
+# gacag 4081
+# gacat 3726
+# gacca 3955
+# gaccc 4263
+# gaccg 2820
+# gacct 3310
+# gacga 4146
+# gacgc 3503
+# gacgg 3778
+# gacgt 4547
+# gacta 1519
+# gactc 3651
+# gactg 4010
+# gactt 3559
+# gagaa 4410
+# gagac 4821
+# gagag 6501
+# gagat 4411
+# gagca 4895
+# gagcc 4153
+# gagcg 5082
+# gagct 4049
+# gagga 5377
+# gaggc 4926
+# gaggg 7189
+# gaggt 4495
+# gagta 2909
+# gagtc 3651
+# gagtg 6125
+# gagtt 4088
+# gataa 3384
+# gatac 2213
+# gatag 2232
+# gatat 3216
+# gatca 2834
+# gatcc 2314
+# gatcg 2451
+# gatct 2614
+# gatga 6286
+# gatgc 4196
+# gatgg 5413
+# gatgt 5749
+# gatta 3355
+# gattc 3491
+# gattg 4045
+# gattt 5195
+# gcaaa 5790
+# gcaac 5184
+# gcaag 4607
+# gcaat 4598
+# gcaca 7271
+# gcacc 5637
+# gcacg 5985
+# gcact 4612
+# gcaga 5047
+# gcagc 9096
+# gcagg 5684
+# gcagt 5752
+# gcata 2761
+# gcatc 4196
+# gcatg 4559
+# gcatt 4844
+# gccaa 5148
+# gccac 7754
+# gccag 4862
+# gccat 4098
+# gccca 4413
+# gcccc 5664
+# gcccg 3575
+# gccct 3873
+# gccga 3609
+# gccgc 6144
+# gccgg 4322
+# gccgt 4499
+# gccta 2034
+# gcctc 4926
+# gcctg 4188
+# gcctt 3910
+# gcgaa 2764
+# gcgac 3927
+# gcgag 5358
+# gcgat 3549
+# gcgca 4193
+# gcgcc 4423
+# gcgcg 5286
+# gcgct 4029
+# gcgga 3044
+# gcggc 6144
+# gcggg 4716
+# gcggt 4496
+# gcgta 2197
+# gcgtc 3503
+# gcgtg 7148
+# gcgtt 3827
+# gctaa 2735
+# gctac 3095
+# gctag 1434
+# gctat 2624
+# gctca 4969
+# gctcc 4941
+# gctcg 4239
+# gctct 4027
+# gctga 4202
+# gctgc 9096
+# gctgg 6011
+# gctgt 6464
+# gctta 2328
+# gcttc 3728
+# gcttg 4662
+# gcttt 4719
+# ggaaa 4898
+# ggaac 2969
+# ggaag 4033
+# ggaat 4250
+# ggaca 4152
+# ggacc 2834
+# ggacg 3189
+# ggact 2369
+# ggaga 6057
+# ggagc 4941
+# ggagg 7976
+# ggagt 3863
+# ggata 2327
+# ggatc 2314
+# ggatg 4036
+# ggatt 3716
+# ggcaa 5013
+# ggcac 5191
+# ggcag 5988
+# ggcat 3388
+# ggcca 5846
+# ggccc 4091
+# ggccg 4877
+# ggcct 4112
+# ggcga 4530
+# ggcgc 4423
+# ggcgg 5670
+# ggcgt 3713
+# ggcta 2488
+# ggctc 4153
+# ggctg 5991
+# ggctt 3556
+# gggaa 4681
+# gggac 3645
+# gggag 7139
+# gggat 3409
+# gggca 5003
+# gggcc 4091
+# gggcg 4606
+# gggct 3834
+# gggga 6532
+# ggggc 5664
+# ggggg 14899
+# ggggt 6582
+# gggta 3637
+# gggtc 4263
+# gggtg 7734
+# gggtt 5175
+# ggtaa 3842
+# ggtac 2780
+# ggtag 2997
+# ggtat 2324
+# ggtca 4750
+# ggtcc 2834
+# ggtcg 3661
+# ggtct 3102
+# ggtga 7479
+# ggtgc 5637
+# ggtgg 11108
+# ggtgt 6141
+# ggtta 3584
+# ggttc 3624
+# ggttg 4919
+# ggttt 5109
+# gtaaa 6093
+# gtaac 3032
+# gtaag 2336
+# gtaat 4067
+# gtaca 4788
+# gtacc 2780
+# gtacg 2841
+# gtact 2624
+# gtaga 2952
+# gtagc 3095
+# gtagg 2981
+# gtagt 2848
+# gtata 3429
+# gtatc 2213
+# gtatg 3170
+# gtatt 4411
+# gtcaa 4704
+# gtcac 7446
+# gtcag 3416
+# gtcat 4170
+# gtcca 3557
+# gtccc 3645
+# gtccg 2368
+# gtcct 2970
+# gtcga 3306
+# gtcgc 3927
+# gtcgg 3277
+# gtcgt 4199
+# gtcta 1992
+# gtctc 4821
+# gtctg 4499
+# gtctt 3448
+# gtgaa 5994
+# gtgac 7446
+# gtgag 6792
+# gtgat 5673
+# gtgca 6733
+# gtgcc 5191
+# gtgcg 5803
+# gtgct 5776
+# gtgga 6542
+# gtggc 7754
+# gtggg 8343
+# gtggt 9249
+# gtgta 5533
+# gtgtc 5978
+# gtgtg 13152
+# gtgtt 7839
+# gttaa 4926
+# gttac 3032
+# gttag 2481
+# gttat 3863
+# gttca 4657
+# gttcc 2969
+# gttcg 2727
+# gttct 3504
+# gttga 5272
+# gttgc 5184
+# gttgg 5128
+# gttgt 7120
+# gttta 5555
+# gtttc 4651
+# gtttg 6414
+# gtttt 8021
+# taaaa 9692
+# taaac 5555
+# taaag 4759
+# taaat 7535
+# taaca 5279
+# taacc 3584
+# taacg 2546
+# taact 2889
+# taaga 2536
+# taagc 2328
+# taagg 2520
+# taagt 2889
+# taata 5299
+# taatc 3355
+# taatg 4570
+# taatt 6241
+# tacaa 5443
+# tacac 5533
+# tacag 4442
+# tacat 5091
+# tacca 3437
+# taccc 3637
+# taccg 2330
+# tacct 2530
+# tacga 2356
+# tacgc 2197
+# tacgg 2205
+# tacgt 3241
+# tacta 1936
+# tactc 2909
+# tactg 3229
+# tactt 3151
+# tagaa 2968
+# tagac 1992
+# tagag 2418
+# tagat 2543
+# tagca 3020
+# tagcc 2488
+# tagcg 2199
+# tagct 2182
+# tagga 2023
+# taggc 2034
+# taggg 2607
+# taggt 2572
+# tagta 1936
+# tagtc 1519
+# tagtg 3230
+# tagtt 2801
+# tataa 5021
+# tatac 3429
+# tatag 2730
+# tatat 5483
+# tatca 3541
+# tatcc 2327
+# tatcg 2311
+# tatct 2861
+# tatga 3146
+# tatgc 2761
+# tatgg 2946
+# tatgt 4036
+# tatta 5299
+# tattc 3658
+# tattg 4602
+# tattt 9920
+# tcaaa 5780
+# tcaac 5272
+# tcaag 3735
+# tcaat 4750
+# tcaca 6734
+# tcacc 7479
+# tcacg 6345
+# tcact 5345
+# tcaga 3560
+# tcagc 4202
+# tcagg 3090
+# tcagt 3708
+# tcata 3146
+# tcatc 6286
+# tcatg 4163
+# tcatt 5984
+# tccaa 4035
+# tccac 6542
+# tccag 4018
+# tccat 4285
+# tccca 4766
+# tcccc 6532
+# tcccg 3206
+# tccct 4375
+# tccga 2355
+# tccgc 3044
+# tccgg 2407
+# tccgt 3042
+# tccta 2023
+# tcctc 5377
+# tcctg 4539
+# tcctt 3374
+# tcgaa 2377
+# tcgac 3306
+# tcgag 2874
+# tcgat 3253
+# tcgca 3616
+# tcgcc 4530
+# tcgcg 3556
+# tcgct 3892
+# tcgga 2355
+# tcggc 3609
+# tcggg 3383
+# tcggt 3505
+# tcgta 2356
+# tcgtc 4146
+# tcgtg 5774
+# tcgtt 3491
+# tctaa 2678
+# tctac 2952
+# tctag 1560
+# tctat 2731
+# tctca 4872
+# tctcc 6057
+# tctcg 3446
+# tctct 5766
+# tctga 3560
+# tctgc 5047
+# tctgg 3893
+# tctgt 5550
+# tctta 2536
+# tcttc 4180
+# tcttg 4263
+# tcttt 5148
+# tgaaa 6592
+# tgaac 4657
+# tgaag 5123
+# tgaat 5235
+# tgaca 5504
+# tgacc 4750
+# tgacg 5127
+# tgact 4355
+# tgaga 4872
+# tgagc 4969
+# tgagg 4379
+# tgagt 4996
+# tgata 3541
+# tgatc 2834
+# tgatg 7758
+# tgatt 4901
+# tgcaa 6411
+# tgcac 6733
+# tgcag 7189
+# tgcat 5962
+# tgcca 5881
+# tgccc 5003
+# tgccg 4379
+# tgcct 4311
+# tgcga 3616
+# tgcgc 4193
+# tgcgg 4009
+# tgcgt 5226
+# tgcta 3020
+# tgctc 4895
+# tgctg 9919
+# tgctt 4875
+# tggaa 4890
+# tggac 3557
+# tggag 6170
+# tggat 4264
+# tggca 5881
+# tggcc 5846
+# tggcg 4769
+# tggct 5364
+# tggga 4766
+# tgggc 4413
+# tgggg 7022
+# tgggt 6177
+# tggta 3437
+# tggtc 3955
+# tggtg 11041
+# tggtt 5310
+# tgtaa 5919
+# tgtac 4788
+# tgtag 3902
+# tgtat 5884
+# tgtca 5504
+# tgtcc 4152
+# tgtcg 3750
+# tgtct 5278
+# tgtga 6734
+# tgtgc 7271
+# tgtgg 7810
+# tgtgt 13840
+# tgtta 5279
+# tgttc 4199
+# tgttg 9371
+# tgttt 9717
+# ttaaa 8976
+# ttaac 4926
+# ttaag 3532
+# ttaat 6427
+# ttaca 5919
+# ttacc 3842
+# ttacg 2487
+# ttact 3275
+# ttaga 2678
+# ttagc 2735
+# ttagg 2230
+# ttagt 2857
+# ttata 5021
+# ttatc 3384
+# ttatg 3874
+# ttatt 9420
+# ttcaa 5400
+# ttcac 5994
+# ttcag 4175
+# ttcat 6043
+# ttcca 4890
+# ttccc 4681
+# ttccg 2340
+# ttcct 4238
+# ttcga 2377
+# ttcgc 2764
+# ttcgg 2769
+# ttcgt 3555
+# ttcta 2968
+# ttctc 4410
+# ttctg 4388
+# ttctt 4968
+# ttgaa 5400
+# ttgac 4704
+# ttgag 4837
+# ttgat 4588
+# ttgca 6411
+# ttgcc 5013
+# ttgcg 3758
+# ttgct 4996
+# ttgga 4035
+# ttggc 5148
+# ttggg 4709
+# ttggt 5205
+# ttgta 5443
+# ttgtc 4910
+# ttgtg 8723
+# ttgtt 8174
+# tttaa 8976
+# tttac 6093
+# tttag 3668
+# tttat 8804
+# tttca 6592
+# tttcc 4898
+# tttcg 3836
+# tttct 5183
+# tttga 5780
+# tttgc 5790
+# tttgg 5515
+# tttgt 9112
+# tttta 9692
+# ttttc 6402
+# ttttg 7445
+# ttttt 15060
+
+# motif upstream of acceptor splice site
+[ASSMOTIF]
+# width of motif, n=
+30
+# order of markov model, k=
+3
+# markov chain emission probabilities
+ 0 0.32 0.221 0.187 0.273 0.196 0.319 0.254 0.231 0.18 0.198 0.254 0.367 0.228 0.106 0.397 0.269 0.203 0.383 0.176 0.237 0.202 0.377 0.264 0.157 0.222 0.314 0.236 0.228 0.128 0.319 0.295 0.259 0.288 0.253 0.142 0.318 0.26 0.236 0.26 0.243 0.184 0.322 0.234 0.261 0.132 0.158 0.507 0.203 0.294 0.159 0.194 0.353 0.171 0.272 0.196 0.361 0.353 0.21 0.117 0.321 0.165 0.18 0.341 0.314 0.168 0.358 0.16 0.314 0.202 0.262 0.279 0.258 0.21 0.304 0.222 0.265 0.131 0.244 0.389 0.237 0.218 0.418 0.11 [...]
+ 1 0.314 0.226 0.173 0.286 0.206 0.333 0.242 0.219 0.193 0.21 0.255 0.342 0.237 0.136 0.372 0.255 0.222 0.339 0.206 0.234 0.173 0.424 0.238 0.166 0.227 0.298 0.207 0.269 0.129 0.303 0.316 0.252 0.261 0.257 0.139 0.343 0.26 0.223 0.291 0.226 0.153 0.308 0.289 0.25 0.127 0.155 0.502 0.216 0.311 0.193 0.157 0.34 0.181 0.26 0.17 0.389 0.317 0.224 0.166 0.293 0.137 0.211 0.329 0.323 0.161 0.333 0.163 0.342 0.215 0.252 0.281 0.253 0.243 0.337 0.201 0.219 0.123 0.244 0.379 0.254 0.203 0.41 0.1 [...]
+ 2 0.326 0.233 0.181 0.26 0.198 0.328 0.254 0.22 0.2 0.231 0.243 0.326 0.215 0.16 0.382 0.244 0.222 0.343 0.204 0.232 0.158 0.435 0.235 0.172 0.216 0.28 0.21 0.295 0.146 0.295 0.323 0.237 0.278 0.234 0.159 0.329 0.253 0.227 0.292 0.227 0.178 0.288 0.309 0.225 0.141 0.139 0.487 0.233 0.34 0.18 0.176 0.304 0.178 0.258 0.192 0.373 0.309 0.222 0.164 0.306 0.146 0.186 0.33 0.338 0.177 0.328 0.165 0.33 0.23 0.248 0.263 0.259 0.242 0.344 0.209 0.205 0.114 0.235 0.383 0.268 0.193 0.439 0.13 0.2 [...]
+ 3 0.333 0.265 0.166 0.236 0.187 0.349 0.246 0.218 0.177 0.279 0.262 0.282 0.219 0.167 0.367 0.247 0.224 0.324 0.201 0.251 0.185 0.408 0.211 0.196 0.253 0.243 0.211 0.294 0.147 0.3 0.373 0.18 0.274 0.19 0.17 0.365 0.239 0.193 0.312 0.256 0.236 0.209 0.313 0.241 0.131 0.108 0.485 0.276 0.346 0.206 0.136 0.313 0.202 0.249 0.189 0.361 0.324 0.204 0.165 0.306 0.174 0.185 0.334 0.307 0.147 0.322 0.161 0.37 0.182 0.304 0.282 0.232 0.29 0.335 0.22 0.154 0.091 0.267 0.343 0.3 0.196 0.44 0.127 0 [...]
+ 4 0.314 0.249 0.181 0.256 0.188 0.355 0.234 0.223 0.141 0.254 0.275 0.329 0.216 0.185 0.367 0.232 0.209 0.306 0.185 0.3 0.176 0.392 0.218 0.215 0.197 0.282 0.201 0.32 0.133 0.328 0.342 0.196 0.276 0.181 0.219 0.324 0.237 0.173 0.35 0.24 0.241 0.231 0.303 0.225 0.126 0.0723 0.477 0.324 0.359 0.219 0.133 0.289 0.188 0.258 0.183 0.372 0.292 0.224 0.18 0.305 0.174 0.174 0.337 0.314 0.176 0.243 0.166 0.415 0.196 0.317 0.263 0.225 0.313 0.317 0.226 0.144 0.0864 0.259 0.363 0.291 0.199 0.462 [...]
+ 5 0.312 0.241 0.153 0.295 0.248 0.295 0.245 0.212 0.178 0.29 0.254 0.279 0.23 0.166 0.368 0.235 0.241 0.287 0.172 0.301 0.16 0.393 0.207 0.239 0.171 0.261 0.232 0.336 0.125 0.342 0.328 0.205 0.233 0.213 0.226 0.329 0.216 0.19 0.351 0.242 0.287 0.236 0.265 0.212 0.155 0.0806 0.431 0.333 0.39 0.233 0.0975 0.28 0.175 0.202 0.19 0.432 0.24 0.225 0.203 0.332 0.155 0.186 0.333 0.326 0.177 0.212 0.201 0.41 0.199 0.327 0.254 0.22 0.284 0.289 0.199 0.227 0.107 0.258 0.332 0.303 0.166 0.483 0.11 [...]
+ 6 0.3 0.255 0.182 0.263 0.274 0.239 0.276 0.21 0.226 0.289 0.224 0.261 0.192 0.176 0.403 0.23 0.228 0.299 0.159 0.315 0.177 0.346 0.226 0.25 0.163 0.293 0.258 0.287 0.137 0.36 0.329 0.175 0.226 0.18 0.251 0.343 0.175 0.233 0.347 0.245 0.328 0.218 0.22 0.234 0.19 0.116 0.408 0.286 0.38 0.23 0.123 0.267 0.174 0.179 0.205 0.442 0.278 0.239 0.156 0.328 0.176 0.186 0.329 0.31 0.215 0.184 0.199 0.403 0.192 0.336 0.24 0.232 0.276 0.248 0.214 0.262 0.107 0.273 0.316 0.304 0.148 0.528 0.102 0.2 [...]
+ 7 0.249 0.267 0.179 0.305 0.277 0.226 0.27 0.226 0.19 0.283 0.259 0.268 0.225 0.145 0.377 0.253 0.201 0.327 0.151 0.321 0.181 0.314 0.249 0.256 0.158 0.326 0.24 0.277 0.137 0.342 0.328 0.193 0.219 0.234 0.228 0.319 0.163 0.244 0.347 0.246 0.355 0.207 0.197 0.241 0.168 0.136 0.441 0.254 0.367 0.261 0.0821 0.289 0.162 0.151 0.193 0.495 0.237 0.254 0.175 0.334 0.179 0.222 0.309 0.29 0.194 0.177 0.182 0.447 0.192 0.368 0.236 0.203 0.262 0.255 0.202 0.281 0.0957 0.283 0.332 0.288 0.144 0.49 [...]
+ 8 0.21 0.27 0.187 0.333 0.29 0.223 0.288 0.198 0.244 0.249 0.249 0.257 0.198 0.139 0.396 0.267 0.201 0.33 0.169 0.3 0.143 0.35 0.268 0.239 0.145 0.357 0.197 0.301 0.15 0.334 0.319 0.197 0.202 0.239 0.236 0.323 0.182 0.3 0.333 0.184 0.284 0.248 0.215 0.253 0.184 0.191 0.411 0.214 0.411 0.265 0.0988 0.225 0.165 0.132 0.219 0.483 0.215 0.245 0.17 0.37 0.171 0.222 0.296 0.311 0.219 0.181 0.191 0.408 0.226 0.314 0.231 0.229 0.246 0.234 0.208 0.312 0.102 0.287 0.321 0.289 0.143 0.488 0.109 0 [...]
+ 9 0.21 0.276 0.181 0.333 0.336 0.215 0.273 0.176 0.277 0.266 0.256 0.201 0.208 0.171 0.364 0.257 0.194 0.343 0.183 0.28 0.123 0.351 0.263 0.262 0.174 0.312 0.233 0.281 0.162 0.301 0.327 0.21 0.223 0.205 0.223 0.348 0.182 0.336 0.282 0.2 0.298 0.215 0.233 0.254 0.214 0.181 0.421 0.185 0.444 0.245 0.0825 0.228 0.172 0.154 0.195 0.479 0.202 0.235 0.178 0.385 0.164 0.218 0.314 0.303 0.228 0.199 0.157 0.416 0.208 0.319 0.231 0.243 0.2 0.298 0.181 0.32 0.0975 0.295 0.3 0.308 0.154 0.484 0.09 [...]
+10 0.189 0.303 0.165 0.343 0.288 0.269 0.24 0.203 0.261 0.279 0.273 0.188 0.214 0.194 0.324 0.267 0.19 0.331 0.194 0.285 0.116 0.369 0.291 0.224 0.171 0.313 0.22 0.295 0.185 0.241 0.371 0.202 0.233 0.158 0.305 0.305 0.22 0.319 0.266 0.195 0.255 0.203 0.3 0.242 0.186 0.177 0.462 0.175 0.438 0.237 0.113 0.212 0.165 0.181 0.233 0.421 0.231 0.227 0.173 0.369 0.178 0.223 0.315 0.284 0.227 0.215 0.129 0.429 0.209 0.328 0.224 0.239 0.208 0.379 0.196 0.218 0.0738 0.315 0.318 0.293 0.141 0.493 0 [...]
+11 0.209 0.31 0.128 0.353 0.259 0.311 0.236 0.194 0.214 0.267 0.285 0.234 0.221 0.175 0.309 0.295 0.219 0.35 0.162 0.269 0.106 0.381 0.288 0.225 0.162 0.312 0.207 0.319 0.159 0.22 0.363 0.257 0.226 0.17 0.319 0.286 0.293 0.282 0.233 0.193 0.233 0.248 0.323 0.196 0.188 0.122 0.47 0.22 0.447 0.213 0.141 0.199 0.165 0.212 0.251 0.372 0.194 0.195 0.198 0.414 0.175 0.196 0.311 0.318 0.211 0.237 0.11 0.443 0.191 0.346 0.252 0.21 0.164 0.417 0.202 0.217 0.0739 0.29 0.339 0.297 0.185 0.436 0.10 [...]
+12 0.261 0.29 0.0882 0.361 0.258 0.318 0.224 0.201 0.274 0.248 0.252 0.226 0.194 0.184 0.309 0.313 0.231 0.316 0.17 0.283 0.12 0.426 0.247 0.206 0.166 0.284 0.234 0.316 0.125 0.212 0.396 0.267 0.199 0.0809 0.431 0.288 0.328 0.235 0.249 0.188 0.168 0.302 0.293 0.236 0.224 0.121 0.42 0.235 0.443 0.201 0.174 0.182 0.164 0.226 0.253 0.358 0.229 0.161 0.182 0.428 0.162 0.178 0.34 0.32 0.235 0.233 0.124 0.408 0.165 0.311 0.291 0.233 0.19 0.366 0.21 0.234 0.0897 0.284 0.317 0.31 0.161 0.505 0. [...]
+13 0.326 0.28 0.0701 0.324 0.256 0.268 0.212 0.264 0.258 0.246 0.196 0.3 0.206 0.203 0.289 0.302 0.183 0.306 0.206 0.305 0.122 0.412 0.256 0.21 0.146 0.328 0.234 0.292 0.0869 0.202 0.403 0.308 0.212 0.0536 0.505 0.23 0.34 0.207 0.266 0.188 0.171 0.273 0.357 0.198 0.265 0.119 0.396 0.22 0.399 0.168 0.162 0.271 0.156 0.24 0.216 0.387 0.193 0.192 0.209 0.407 0.152 0.163 0.346 0.339 0.214 0.278 0.103 0.405 0.16 0.323 0.32 0.197 0.149 0.351 0.228 0.272 0.0623 0.275 0.363 0.299 0.126 0.548 0. [...]
+14 0.335 0.278 0.0695 0.317 0.228 0.259 0.23 0.283 0.26 0.255 0.148 0.337 0.185 0.188 0.316 0.31 0.208 0.313 0.178 0.301 0.143 0.424 0.242 0.192 0.122 0.371 0.23 0.277 0.0979 0.225 0.371 0.307 0.168 0.0629 0.545 0.225 0.357 0.199 0.265 0.18 0.157 0.285 0.361 0.197 0.208 0.16 0.378 0.254 0.39 0.146 0.164 0.3 0.14 0.275 0.22 0.364 0.205 0.211 0.194 0.39 0.141 0.176 0.321 0.362 0.217 0.253 0.119 0.411 0.15 0.34 0.301 0.209 0.157 0.27 0.316 0.256 0.0618 0.258 0.394 0.286 0.137 0.546 0.0726 [...]
+15 0.405 0.251 0.07 0.274 0.225 0.233 0.273 0.27 0.208 0.301 0.139 0.352 0.173 0.175 0.346 0.306 0.191 0.375 0.166 0.268 0.158 0.384 0.275 0.182 0.117 0.374 0.182 0.328 0.0728 0.309 0.342 0.277 0.158 0.148 0.473 0.222 0.311 0.181 0.319 0.189 0.213 0.262 0.277 0.248 0.2 0.197 0.348 0.256 0.333 0.155 0.144 0.368 0.151 0.274 0.178 0.398 0.164 0.219 0.184 0.433 0.138 0.153 0.326 0.383 0.239 0.29 0.0763 0.394 0.136 0.318 0.318 0.229 0.146 0.24 0.342 0.272 0.0641 0.231 0.402 0.303 0.168 0.504 [...]
+16 0.379 0.234 0.0652 0.322 0.219 0.22 0.285 0.276 0.158 0.322 0.116 0.404 0.205 0.165 0.349 0.281 0.114 0.4 0.199 0.287 0.171 0.398 0.267 0.164 0.0993 0.35 0.192 0.359 0.0702 0.329 0.348 0.253 0.2 0.155 0.462 0.183 0.29 0.153 0.374 0.183 0.249 0.223 0.291 0.237 0.15 0.235 0.378 0.238 0.312 0.223 0.0692 0.396 0.159 0.243 0.159 0.439 0.144 0.213 0.194 0.449 0.145 0.164 0.337 0.353 0.223 0.31 0.0796 0.387 0.154 0.305 0.285 0.256 0.162 0.223 0.361 0.255 0.0576 0.236 0.402 0.304 0.153 0.528 [...]
+17 0.393 0.224 0.102 0.28 0.244 0.223 0.275 0.258 0.129 0.345 0.129 0.396 0.225 0.183 0.372 0.22 0.14 0.411 0.184 0.265 0.159 0.378 0.252 0.211 0.0828 0.375 0.168 0.374 0.072 0.373 0.285 0.27 0.196 0.164 0.407 0.233 0.265 0.181 0.405 0.149 0.282 0.167 0.31 0.241 0.128 0.224 0.432 0.216 0.277 0.232 0.0369 0.454 0.174 0.251 0.135 0.441 0.13 0.216 0.185 0.469 0.135 0.163 0.334 0.368 0.17 0.315 0.0617 0.454 0.149 0.321 0.272 0.257 0.124 0.245 0.361 0.27 0.042 0.233 0.408 0.317 0.162 0.479 0 [...]
+18 0.398 0.225 0.115 0.262 0.251 0.251 0.289 0.21 0.11 0.411 0.144 0.336 0.158 0.205 0.377 0.259 0.142 0.407 0.139 0.312 0.179 0.386 0.253 0.182 0.123 0.292 0.17 0.415 0.0897 0.405 0.252 0.252 0.188 0.173 0.34 0.299 0.233 0.175 0.387 0.206 0.357 0.158 0.214 0.271 0.0614 0.175 0.456 0.307 0.273 0.238 0.0654 0.423 0.166 0.227 0.186 0.422 0.127 0.209 0.166 0.498 0.156 0.178 0.302 0.364 0.169 0.258 0.106 0.467 0.149 0.329 0.233 0.289 0.159 0.255 0.4 0.186 0.072 0.217 0.364 0.347 0.175 0.457 [...]
+19 0.382 0.236 0.133 0.249 0.267 0.275 0.277 0.181 0.0727 0.406 0.152 0.37 0.141 0.207 0.383 0.269 0.111 0.474 0.153 0.263 0.174 0.35 0.269 0.207 0.121 0.275 0.128 0.476 0.0566 0.38 0.257 0.307 0.175 0.24 0.306 0.279 0.217 0.159 0.385 0.239 0.36 0.227 0.178 0.235 0.0904 0.144 0.457 0.309 0.215 0.287 0.112 0.386 0.17 0.193 0.215 0.422 0.14 0.205 0.153 0.503 0.141 0.178 0.323 0.358 0.167 0.295 0.116 0.422 0.153 0.329 0.233 0.285 0.158 0.255 0.378 0.208 0.069 0.224 0.346 0.361 0.155 0.467 [...]
+20 0.288 0.252 0.129 0.332 0.25 0.264 0.269 0.217 0.122 0.299 0.177 0.401 0.117 0.233 0.37 0.28 0.124 0.477 0.148 0.251 0.166 0.383 0.231 0.22 0.139 0.306 0.136 0.418 0.0741 0.343 0.261 0.323 0.201 0.142 0.302 0.355 0.216 0.138 0.381 0.265 0.316 0.274 0.237 0.174 0.0909 0.102 0.535 0.273 0.252 0.261 0.128 0.358 0.139 0.224 0.21 0.427 0.158 0.213 0.139 0.49 0.117 0.176 0.294 0.414 0.141 0.329 0.125 0.405 0.153 0.367 0.227 0.253 0.178 0.285 0.352 0.186 0.0747 0.247 0.34 0.339 0.125 0.501 [...]
+21 0.31 0.286 0.135 0.269 0.299 0.235 0.216 0.25 0.143 0.314 0.2 0.343 0.0862 0.304 0.308 0.302 0.146 0.455 0.146 0.254 0.128 0.379 0.242 0.251 0.142 0.305 0.163 0.39 0.0651 0.343 0.235 0.357 0.177 0.134 0.339 0.349 0.192 0.153 0.325 0.329 0.282 0.346 0.154 0.218 0.0925 0.121 0.497 0.289 0.241 0.211 0.136 0.412 0.111 0.235 0.22 0.433 0.157 0.234 0.125 0.484 0.101 0.177 0.309 0.413 0.158 0.34 0.139 0.363 0.167 0.383 0.238 0.212 0.209 0.293 0.322 0.176 0.0789 0.23 0.339 0.352 0.109 0.492 [...]
+22 0.278 0.282 0.0827 0.357 0.325 0.179 0.289 0.207 0.167 0.264 0.264 0.306 0.0556 0.308 0.306 0.331 0.178 0.386 0.213 0.223 0.11 0.412 0.267 0.211 0.136 0.303 0.144 0.417 0.0769 0.293 0.252 0.378 0.16 0.182 0.385 0.273 0.183 0.153 0.298 0.366 0.283 0.404 0.177 0.136 0.0964 0.127 0.41 0.367 0.262 0.182 0.166 0.39 0.0946 0.269 0.219 0.417 0.16 0.274 0.114 0.452 0.104 0.232 0.25 0.415 0.221 0.337 0.156 0.286 0.169 0.382 0.246 0.203 0.251 0.304 0.357 0.087 0.0906 0.253 0.323 0.333 0.107 0. [...]
+23 0.201 0.314 0.0711 0.414 0.309 0.192 0.312 0.186 0.286 0.188 0.286 0.241 0.0795 0.274 0.293 0.353 0.18 0.392 0.214 0.214 0.0906 0.417 0.275 0.218 0.0716 0.379 0.176 0.373 0.0813 0.29 0.248 0.38 0.185 0.205 0.371 0.239 0.179 0.199 0.311 0.311 0.223 0.395 0.279 0.102 0.118 0.176 0.419 0.287 0.245 0.201 0.138 0.415 0.0947 0.278 0.156 0.471 0.169 0.265 0.117 0.449 0.0741 0.251 0.269 0.405 0.279 0.338 0.134 0.248 0.154 0.374 0.262 0.21 0.195 0.315 0.266 0.225 0.0647 0.259 0.371 0.305 0.10 [...]
+24 0.195 0.314 0.0575 0.434 0.341 0.182 0.287 0.189 0.313 0.13 0.405 0.153 0.106 0.287 0.287 0.32 0.191 0.327 0.218 0.264 0.0885 0.461 0.269 0.182 0.0836 0.373 0.196 0.347 0.127 0.277 0.293 0.303 0.197 0.15 0.394 0.258 0.277 0.237 0.266 0.22 0.314 0.323 0.274 0.0885 0.128 0.2 0.489 0.183 0.241 0.228 0.0966 0.434 0.073 0.294 0.148 0.485 0.138 0.275 0.104 0.483 0.0619 0.227 0.239 0.473 0.224 0.39 0.118 0.268 0.197 0.356 0.264 0.183 0.217 0.315 0.251 0.217 0.0656 0.25 0.352 0.333 0.0962 0. [...]
+25 0.241 0.283 0.0802 0.396 0.347 0.269 0.25 0.134 0.344 0.188 0.391 0.0781 0.136 0.282 0.291 0.291 0.147 0.3 0.258 0.296 0.0849 0.484 0.244 0.188 0.0997 0.324 0.225 0.351 0.106 0.252 0.347 0.295 0.145 0.145 0.466 0.244 0.31 0.257 0.246 0.187 0.345 0.311 0.218 0.126 0.148 0.232 0.413 0.206 0.156 0.289 0.133 0.422 0.0962 0.286 0.136 0.481 0.133 0.28 0.128 0.459 0.0588 0.251 0.267 0.423 0.256 0.307 0.148 0.289 0.2 0.329 0.274 0.198 0.273 0.239 0.269 0.22 0.0661 0.232 0.373 0.329 0.12 0.52 [...]
+26 0.28 0.176 0.104 0.44 0.337 0.273 0.223 0.167 0.29 0.166 0.455 0.0897 0.161 0.236 0.373 0.229 0.126 0.312 0.265 0.297 0.099 0.5 0.276 0.125 0.122 0.322 0.22 0.336 0.108 0.279 0.35 0.263 0.104 0.161 0.479 0.255 0.371 0.265 0.199 0.166 0.377 0.292 0.226 0.104 0.153 0.213 0.46 0.173 0.153 0.305 0.214 0.328 0.144 0.297 0.123 0.436 0.148 0.305 0.119 0.428 0.0623 0.246 0.241 0.45 0.25 0.354 0.111 0.285 0.181 0.341 0.26 0.218 0.256 0.221 0.315 0.208 0.0511 0.28 0.36 0.308 0.111 0.563 0.074 [...]
+27 0.291 0.233 0.164 0.312 0.35 0.253 0.175 0.222 0.26 0.183 0.42 0.137 0.16 0.251 0.287 0.303 0.0818 0.391 0.202 0.325 0.117 0.425 0.296 0.162 0.111 0.334 0.24 0.315 0.0823 0.346 0.327 0.245 0.115 0.255 0.375 0.255 0.3 0.231 0.263 0.206 0.294 0.235 0.202 0.268 0.14 0.213 0.473 0.173 0.147 0.349 0.178 0.326 0.136 0.351 0.153 0.36 0.148 0.302 0.153 0.397 0.0678 0.202 0.285 0.446 0.215 0.415 0.0981 0.272 0.161 0.399 0.234 0.205 0.27 0.209 0.294 0.227 0.0427 0.264 0.319 0.375 0.126 0.586 0 [...]
+28 0.289 0.174 0.208 0.329 0.397 0.232 0.129 0.241 0.141 0.152 0.525 0.182 0.17 0.267 0.308 0.255 0.0973 0.408 0.192 0.303 0.126 0.423 0.279 0.173 0.134 0.315 0.23 0.32 0.0654 0.343 0.366 0.225 0.0909 0.255 0.37 0.285 0.353 0.184 0.221 0.243 0.289 0.262 0.124 0.324 0.151 0.18 0.482 0.187 0.162 0.368 0.197 0.274 0.132 0.396 0.184 0.288 0.151 0.312 0.162 0.375 0.0692 0.187 0.285 0.458 0.177 0.483 0.0788 0.261 0.17 0.427 0.231 0.172 0.339 0.191 0.35 0.12 0.0441 0.278 0.285 0.392 0.121 0.55 [...]
+29 0.315 0.167 0.204 0.315 0.324 0.286 0.137 0.253 0.159 0.13 0.449 0.261 0.168 0.276 0.255 0.301 0.0762 0.413 0.206 0.305 0.1 0.412 0.301 0.187 0.136 0.309 0.228 0.327 0.00712 0.388 0.356 0.249 0.0588 0.353 0.353 0.235 0.277 0.149 0.248 0.327 0.199 0.265 0.144 0.392 0.13 0.169 0.468 0.234 0.15 0.34 0.23 0.28 0.149 0.406 0.153 0.292 0.177 0.332 0.197 0.295 0.0912 0.228 0.28 0.401 0.212 0.459 0.0824 0.247 0.13 0.472 0.214 0.184 0.317 0.246 0.338 0.0986 0.0455 0.275 0.289 0.39 0.116 0.543 [...]
+[4]
+# (a,c,g,t)= (0.176, 0.324, 0.324, 0.176)
+#
+# Probabilities file for the intron model
+#
+#
+# Transition probabilities
+#
+[TRANSITION]
+# the probability of an intron of length at most d
+0.524
+# mean additional length of introns with length > d
+1.32e+03
+
+#
+# The emission probabilities of introns
+#
+[EMISSION]
+# size of the emission vector
+1024
+#k=
+4
+# patpseudo : pseudocount for sequence patterns
+5
+aaaaa 0.3901
+aaaac 0.2078
+aaaag 0.1362
+aaaat 0.2658
+aaaca 0.3943
+aaacc 0.2074
+aaacg 0.1959
+aaact 0.2024
+aaaga 0.2607
+aaagc 0.239
+aaagg 0.2137
+aaagt 0.2867
+aaata 0.3321
+aaatc 0.174
+aaatg 0.2654
+aaatt 0.2285
+aacaa 0.286
+aacac 0.2743
+aacag 0.1793
+aacat 0.2604
+aacca 0.3082
+aaccc 0.3003
+aaccg 0.1907
+aacct 0.2008
+aacga 0.2376
+aacgc 0.2604
+aacgg 0.1952
+aacgt 0.3068
+aacta 0.187
+aactc 0.2727
+aactg 0.2588
+aactt 0.2815
+aagaa 0.3079
+aagac 0.2138
+aagag 0.2577
+aagat 0.2207
+aagca 0.3155
+aagcc 0.2302
+aagcg 0.2052
+aagct 0.249
+aagga 0.2299
+aaggc 0.2664
+aaggg 0.274
+aaggt 0.2296
+aagta 0.193
+aagtc 0.218
+aagtg 0.3306
+aagtt 0.2584
+aataa 0.4011
+aatac 0.1879
+aatag 0.1232
+aatat 0.2878
+aatca 0.3047
+aatcc 0.2311
+aatcg 0.2363
+aatct 0.2278
+aatga 0.2588
+aatgc 0.2095
+aatgg 0.1866
+aatgt 0.345
+aatta 0.2729
+aattc 0.1843
+aattg 0.2445
+aattt 0.2983
+acaaa 0.3344
+acaac 0.2614
+acaag 0.1749
+acaat 0.2293
+acaca 0.4256
+acacc 0.1889
+acacg 0.2175
+acact 0.168
+acaga 0.2648
+acagc 0.3083
+acagg 0.2152
+acagt 0.2117
+acata 0.1778
+acatc 0.2531
+acatg 0.2179
+acatt 0.3513
+accaa 0.2194
+accac 0.3896
+accag 0.2049
+accat 0.1861
+accca 0.2967
+acccc 0.3161
+acccg 0.2019
+accct 0.1852
+accga 0.2414
+accgc 0.3096
+accgg 0.2138
+accgt 0.2352
+accta 0.1738
+acctc 0.3036
+acctg 0.295
+acctt 0.2276
+acgaa 0.2257
+acgac 0.2666
+acgag 0.2843
+acgat 0.2234
+acgca 0.3133
+acgcc 0.2227
+acgcg 0.2735
+acgct 0.1905
+acgga 0.2023
+acggc 0.299
+acggg 0.2717
+acggt 0.227
+acgta 0.1664
+acgtc 0.2333
+acgtg 0.3689
+acgtt 0.2314
+actaa 0.3008
+actac 0.2998
+actag 0.1415
+actat 0.2579
+actca 0.2979
+actcc 0.2304
+actcg 0.2593
+actct 0.2124
+actga 0.2081
+actgc 0.3226
+actgg 0.2204
+actgt 0.2489
+actta 0.1771
+acttc 0.2115
+acttg 0.2647
+acttt 0.3467
+agaaa 0.3096
+agaac 0.2094
+agaag 0.2407
+agaat 0.2402
+agaca 0.3573
+agacc 0.2101
+agacg 0.237
+agact 0.1956
+agaga 0.3142
+agagc 0.2195
+agagg 0.2721
+agagt 0.1942
+agata 0.1988
+agatc 0.1817
+agatg 0.365
+agatt 0.2545
+agcaa 0.22
+agcac 0.2543
+agcag 0.3555
+agcat 0.1701
+agcca 0.3312
+agccc 0.2368
+agccg 0.2316
+agcct 0.2003
+agcga 0.2509
+agcgc 0.2597
+agcgg 0.2847
+agcgt 0.2048
+agcta 0.1467
+agctc 0.272
+agctg 0.3228
+agctt 0.2584
+aggaa 0.2769
+aggac 0.1941
+aggag 0.3486
+aggat 0.1804
+aggca 0.2863
+aggcc 0.2731
+aggcg 0.2251
+aggct 0.2154
+aggga 0.2314
+agggc 0.2048
+agggg 0.3599
+agggt 0.2039
+aggta 0.1711
+aggtc 0.2237
+aggtg 0.3715
+aggtt 0.2337
+agtaa 0.2917
+agtac 0.2338
+agtag 0.2095
+agtat 0.265
+agtca 0.3417
+agtcc 0.1861
+agtcg 0.2455
+agtct 0.2267
+agtga 0.249
+agtgc 0.2149
+agtgg 0.2818
+agtgt 0.2544
+agtta 0.1928
+agttc 0.1976
+agttg 0.277
+agttt 0.3326
+ataaa 0.4059
+ataac 0.1782
+ataag 0.1247
+ataat 0.2912
+ataca 0.4448
+atacc 0.1759
+atacg 0.1542
+atact 0.2251
+ataga 0.265
+atagc 0.2546
+atagg 0.2426
+atagt 0.2377
+atata 0.2908
+atatc 0.1706
+atatg 0.1803
+atatt 0.3583
+atcaa 0.2412
+atcac 0.2982
+atcag 0.1885
+atcat 0.2721
+atcca 0.3439
+atccc 0.2751
+atccg 0.1583
+atcct 0.2227
+atcga 0.2472
+atcgc 0.2696
+atcgg 0.2159
+atcgt 0.2673
+atcta 0.1767
+atctc 0.3063
+atctg 0.2698
+atctt 0.2472
+atgaa 0.3085
+atgac 0.213
+atgag 0.2142
+atgat 0.2643
+atgca 0.3642
+atgcc 0.2071
+atgcg 0.1926
+atgct 0.236
+atgga 0.2502
+atggc 0.2393
+atggg 0.2526
+atggt 0.2578
+atgta 0.2241
+atgtc 0.1641
+atgtg 0.2843
+atgtt 0.3275
+attaa 0.3302
+attac 0.2091
+attag 0.1362
+attat 0.3245
+attca 0.3253
+attcc 0.2642
+attcg 0.1607
+attct 0.2499
+attga 0.2361
+attgc 0.2285
+attgg 0.2251
+attgt 0.3104
+attta 0.2523
+atttc 0.1746
+atttg 0.2297
+atttt 0.3435
+caaaa 0.2841
+caaac 0.2448
+caaag 0.2093
+caaat 0.2618
+caaca 0.4128
+caacc 0.2168
+caacg 0.1875
+caact 0.183
+caaga 0.2502
+caagc 0.2736
+caagg 0.2225
+caagt 0.2536
+caata 0.2286
+caatc 0.201
+caatg 0.2928
+caatt 0.2776
+cacaa 0.2447
+cacac 0.3689
+cacag 0.2052
+cacat 0.1812
+cacca 0.3636
+caccc 0.2547
+caccg 0.2005
+cacct 0.1812
+cacga 0.2194
+cacgc 0.2716
+cacgg 0.2358
+cacgt 0.2732
+cacta 0.1506
+cactc 0.2854
+cactg 0.3124
+cactt 0.2516
+cagaa 0.2431
+cagac 0.2493
+cagag 0.2924
+cagat 0.2152
+cagca 0.3846
+cagcc 0.2324
+cagcg 0.1965
+cagct 0.1865
+cagga 0.2495
+caggc 0.2303
+caggg 0.28
+caggt 0.2402
+cagta 0.1812
+cagtc 0.225
+cagtg 0.3761
+cagtt 0.2177
+cataa 0.3005
+catac 0.2459
+catag 0.19
+catat 0.2636
+catca 0.3584
+catcc 0.1865
+catcg 0.2123
+catct 0.2429
+catga 0.2297
+catgc 0.2515
+catgg 0.2458
+catgt 0.273
+catta 0.1977
+cattc 0.2044
+cattg 0.255
+cattt 0.3428
+ccaaa 0.2888
+ccaac 0.2686
+ccaag 0.2054
+ccaat 0.2372
+ccaca 0.2449
+ccacc 0.3482
+ccacg 0.2171
+ccact 0.1897
+ccaga 0.2077
+ccagc 0.3206
+ccagg 0.262
+ccagt 0.2097
+ccata 0.1721
+ccatc 0.3159
+ccatg 0.2601
+ccatt 0.2519
+cccaa 0.2105
+cccac 0.3728
+cccag 0.2233
+cccat 0.1934
+cccca 0.2084
+ccccc 0.4421
+ccccg 0.1473
+cccct 0.2021
+cccga 0.2122
+cccgc 0.2957
+cccgg 0.2359
+cccgt 0.2563
+cccta 0.138
+ccctc 0.38
+ccctg 0.2693
+ccctt 0.2127
+ccgaa 0.2155
+ccgac 0.255
+ccgag 0.3084
+ccgat 0.2211
+ccgca 0.218
+ccgcc 0.3082
+ccgcg 0.2337
+ccgct 0.2401
+ccgga 0.1772
+ccggc 0.3179
+ccggg 0.2766
+ccggt 0.2283
+ccgta 0.1466
+ccgtc 0.2509
+ccgtg 0.4119
+ccgtt 0.1906
+cctaa 0.2414
+cctac 0.3225
+cctag 0.1655
+cctat 0.2706
+cctca 0.1992
+cctcc 0.3626
+cctcg 0.2112
+cctct 0.2271
+cctga 0.1699
+cctgc 0.3123
+cctgg 0.2699
+cctgt 0.2479
+cctta 0.1719
+ccttc 0.2822
+ccttg 0.2583
+ccttt 0.2876
+cgaaa 0.3345
+cgaac 0.2379
+cgaag 0.2022
+cgaat 0.2254
+cgaca 0.2549
+cgacc 0.2489
+cgacg 0.2836
+cgact 0.2126
+cgaga 0.2067
+cgagc 0.2542
+cgagg 0.2784
+cgagt 0.2607
+cgata 0.1758
+cgatc 0.1864
+cgatg 0.349
+cgatt 0.2888
+cgcaa 0.2206
+cgcac 0.3405
+cgcag 0.2539
+cgcat 0.185
+cgcca 0.2601
+cgccc 0.2512
+cgccg 0.3039
+cgcct 0.1848
+cgcga 0.2009
+cgcgc 0.2986
+cgcgg 0.2429
+cgcgt 0.2576
+cgcta 0.1419
+cgctc 0.3275
+cgctg 0.3264
+cgctt 0.2043
+cggaa 0.2157
+cggac 0.2183
+cggag 0.3853
+cggat 0.1807
+cggca 0.2357
+cggcc 0.2625
+cggcg 0.2999
+cggct 0.2019
+cggga 0.2011
+cgggc 0.2242
+cgggg 0.3111
+cgggt 0.2636
+cggta 0.1606
+cggtc 0.1943
+cggtg 0.4189
+cggtt 0.2262
+cgtaa 0.2488
+cgtac 0.2842
+cgtag 0.2631
+cgtat 0.2039
+cgtca 0.3206
+cgtcc 0.1995
+cgtcg 0.2609
+cgtct 0.2189
+cgtga 0.241
+cgtgc 0.2274
+cgtgg 0.263
+cgtgt 0.2686
+cgtta 0.1732
+cgttc 0.2095
+cgttg 0.2892
+cgttt 0.3281
+ctaaa 0.3492
+ctaac 0.2363
+ctaag 0.1624
+ctaat 0.2521
+ctaca 0.3283
+ctacc 0.2523
+ctacg 0.2214
+ctact 0.198
+ctaga 0.2661
+ctagc 0.2446
+ctagg 0.2605
+ctagt 0.2288
+ctata 0.265
+ctatc 0.2168
+ctatg 0.2377
+ctatt 0.2805
+ctcaa 0.2518
+ctcac 0.3535
+ctcag 0.1764
+ctcat 0.2183
+ctcca 0.2702
+ctccc 0.3126
+ctccg 0.1833
+ctcct 0.2338
+ctcga 0.1724
+ctcgc 0.3212
+ctcgg 0.2378
+ctcgt 0.2685
+ctcta 0.1319
+ctctc 0.3541
+ctctg 0.2875
+ctctt 0.2265
+ctgaa 0.2866
+ctgac 0.2346
+ctgag 0.2326
+ctgat 0.2462
+ctgca 0.281
+ctgcc 0.2341
+ctgcg 0.1692
+ctgct 0.3157
+ctgga 0.2145
+ctggc 0.2595
+ctggg 0.2666
+ctggt 0.2595
+ctgta 0.212
+ctgtc 0.1948
+ctgtg 0.3488
+ctgtt 0.2444
+cttaa 0.3437
+cttac 0.2275
+cttag 0.166
+cttat 0.2629
+cttca 0.3304
+cttcc 0.2602
+cttcg 0.1496
+cttct 0.2598
+cttga 0.2194
+cttgc 0.2706
+cttgg 0.2303
+cttgt 0.2797
+cttta 0.241
+ctttc 0.2152
+ctttg 0.2776
+ctttt 0.2661
+gaaaa 0.312
+gaaac 0.2267
+gaaag 0.2072
+gaaat 0.2541
+gaaca 0.3028
+gaacc 0.2614
+gaacg 0.2222
+gaact 0.2136
+gaaga 0.2696
+gaagc 0.2405
+gaagg 0.2671
+gaagt 0.2227
+gaata 0.2274
+gaatc 0.217
+gaatg 0.2936
+gaatt 0.2619
+gacaa 0.2626
+gacac 0.3197
+gacag 0.2183
+gacat 0.1994
+gacca 0.2756
+gaccc 0.297
+gaccg 0.1966
+gacct 0.2307
+gacga 0.2595
+gacgc 0.2193
+gacgg 0.2365
+gacgt 0.2846
+gacta 0.1194
+gactc 0.2865
+gactg 0.3147
+gactt 0.2793
+gagaa 0.219
+gagac 0.2393
+gagag 0.3227
+gagat 0.219
+gagca 0.2692
+gagcc 0.2285
+gagcg 0.2795
+gagct 0.2228
+gagga 0.2446
+gaggc 0.2241
+gaggg 0.3269
+gaggt 0.2045
+gagta 0.1735
+gagtc 0.2177
+gagtg 0.365
+gagtt 0.2437
+gataa 0.3063
+gatac 0.2005
+gatag 0.2022
+gatat 0.2911
+gatca 0.2774
+gatcc 0.2266
+gatcg 0.24
+gatct 0.2559
+gatga 0.2904
+gatgc 0.1939
+gatgg 0.2501
+gatgt 0.2656
+gatta 0.2086
+gattc 0.2171
+gattg 0.2515
+gattt 0.3229
+gcaaa 0.2869
+gcaac 0.2569
+gcaag 0.2283
+gcaat 0.2279
+gcaca 0.3093
+gcacc 0.2398
+gcacg 0.2546
+gcact 0.1963
+gcaga 0.1974
+gcagc 0.3555
+gcagg 0.2222
+gcagt 0.2249
+gcata 0.1689
+gcatc 0.2565
+gcatg 0.2786
+gcatt 0.296
+gccaa 0.2355
+gccac 0.3546
+gccag 0.2224
+gccat 0.1875
+gccca 0.2518
+gcccc 0.3231
+gcccg 0.204
+gccct 0.221
+gccga 0.1944
+gccgc 0.3307
+gccgg 0.2327
+gccgt 0.2422
+gccta 0.1352
+gcctc 0.327
+gcctg 0.2781
+gcctt 0.2596
+gcgaa 0.1773
+gcgac 0.2518
+gcgag 0.3434
+gcgat 0.2276
+gcgca 0.2339
+gcgcc 0.2467
+gcgcg 0.2947
+gcgct 0.2247
+gcgga 0.1655
+gcggc 0.3338
+gcggg 0.2563
+gcggt 0.2444
+gcgta 0.1319
+gcgtc 0.2101
+gcgtg 0.4285
+gcgtt 0.2295
+gctaa 0.2765
+gctac 0.3129
+gctag 0.1452
+gctat 0.2653
+gctca 0.2734
+gctcc 0.2718
+gctcg 0.2332
+gctct 0.2216
+gctga 0.1631
+gctgc 0.3528
+gctgg 0.2332
+gctgt 0.2508
+gctta 0.1509
+gcttc 0.2415
+gcttg 0.3019
+gcttt 0.3056
+ggaaa 0.3032
+ggaac 0.1839
+ggaag 0.2497
+ggaat 0.2631
+ggaca 0.3309
+ggacc 0.226
+ggacg 0.2542
+ggact 0.189
+ggaga 0.2652
+ggagc 0.2164
+ggagg 0.3492
+ggagt 0.1692
+ggata 0.1879
+ggatc 0.1868
+ggatg 0.3255
+ggatt 0.2998
+ggcaa 0.256
+ggcac 0.2651
+ggcag 0.3058
+ggcat 0.1731
+ggcca 0.3088
+ggccc 0.2162
+ggccg 0.2577
+ggcct 0.2173
+ggcga 0.2471
+ggcgc 0.2412
+ggcgg 0.3092
+ggcgt 0.2025
+ggcta 0.1538
+ggctc 0.2565
+ggctg 0.3699
+ggctt 0.2197
+gggaa 0.248
+gggac 0.1932
+gggag 0.3781
+gggat 0.1807
+gggca 0.2853
+gggcc 0.2333
+gggcg 0.2627
+gggct 0.2187
+gggga 0.194
+ggggc 0.1682
+ggggg 0.4423
+ggggt 0.1955
+gggta 0.1749
+gggtc 0.2049
+gggtg 0.3715
+gggtt 0.2487
+ggtaa 0.3216
+ggtac 0.2328
+ggtag 0.2509
+ggtat 0.1947
+ggtca 0.331
+ggtcc 0.1976
+ggtcg 0.2552
+ggtct 0.2163
+ggtga 0.2463
+ggtgc 0.1857
+ggtgg 0.3657
+ggtgt 0.2023
+ggtta 0.208
+ggttc 0.2103
+ggttg 0.2854
+ggttt 0.2964
+gtaaa 0.3922
+gtaac 0.1953
+gtaag 0.1506
+gtaat 0.2619
+gtaca 0.3672
+gtacc 0.2134
+gtacg 0.218
+gtact 0.2014
+gtaga 0.2486
+gtagc 0.2606
+gtagg 0.251
+gtagt 0.2398
+gtata 0.2593
+gtatc 0.1675
+gtatg 0.2397
+gtatt 0.3335
+gtcaa 0.2384
+gtcac 0.3772
+gtcag 0.1732
+gtcat 0.2113
+gtcca 0.2836
+gtccc 0.2906
+gtccg 0.1889
+gtcct 0.2369
+gtcga 0.2248
+gtcgc 0.267
+gtcgg 0.2228
+gtcgt 0.2854
+gtcta 0.1351
+gtctc 0.3265
+gtctg 0.3047
+gtctt 0.2336
+gtgaa 0.2314
+gtgac 0.2874
+gtgag 0.2622
+gtgat 0.219
+gtgca 0.2864
+gtgcc 0.2209
+gtgcg 0.2469
+gtgct 0.2458
+gtgga 0.2052
+gtggc 0.2432
+gtggg 0.2616
+gtggt 0.29
+gtgta 0.1703
+gtgtc 0.184
+gtgtg 0.4046
+gtgtt 0.2412
+gttaa 0.3443
+gttac 0.2121
+gttag 0.1736
+gttat 0.2701
+gttca 0.336
+gttcc 0.2143
+gttcg 0.1969
+gttct 0.2529
+gttga 0.2322
+gttgc 0.2283
+gttgg 0.2259
+gttgt 0.3135
+gttta 0.2255
+gtttc 0.1888
+gtttg 0.2603
+gtttt 0.3255
+taaaa 0.3518
+taaac 0.2017
+taaag 0.1729
+taaat 0.2736
+taaca 0.369
+taacc 0.2507
+taacg 0.1782
+taact 0.2021
+taaga 0.2469
+taagc 0.2267
+taagg 0.2453
+taagt 0.2812
+taata 0.2722
+taatc 0.1724
+taatg 0.2348
+taatt 0.3206
+tacaa 0.2654
+tacac 0.2698
+tacag 0.2166
+tacat 0.2482
+tacca 0.2879
+taccc 0.3047
+taccg 0.1953
+tacct 0.2121
+tacga 0.2357
+tacgc 0.2198
+tacgg 0.2206
+tacgt 0.324
+tacta 0.1726
+tactc 0.2591
+tactg 0.2876
+tactt 0.2807
+tagaa 0.2991
+tagac 0.2009
+tagag 0.2437
+tagat 0.2563
+tagca 0.3053
+tagcc 0.2516
+tagcg 0.2224
+tagct 0.2207
+tagga 0.2191
+taggc 0.2203
+taggg 0.2822
+taggt 0.2784
+tagta 0.2042
+tagtc 0.1603
+tagtg 0.3403
+tagtt 0.2952
+tataa 0.3013
+tatac 0.2058
+tatag 0.1639
+tatat 0.329
+tatca 0.3206
+tatcc 0.2108
+tatcg 0.2094
+tatct 0.2591
+tatga 0.2441
+tatgc 0.2143
+tatgg 0.2286
+tatgt 0.313
+tatta 0.2257
+tattc 0.1559
+tattg 0.1961
+tattt 0.4224
+tcaaa 0.2958
+tcaac 0.2698
+tcaag 0.1912
+tcaat 0.2431
+tcaca 0.26
+tcacc 0.2887
+tcacg 0.245
+tcact 0.2064
+tcaga 0.2445
+tcagc 0.2885
+tcagg 0.2123
+tcagt 0.2547
+tcata 0.1608
+tcatc 0.321
+tcatg 0.2127
+tcatt 0.3056
+tccaa 0.2138
+tccac 0.3464
+tccag 0.2129
+tccat 0.227
+tccca 0.2524
+tcccc 0.3459
+tcccg 0.1699
+tccct 0.2318
+tccga 0.2172
+tccgc 0.2805
+tccgg 0.2219
+tccgt 0.2804
+tccta 0.1323
+tcctc 0.351
+tcctg 0.2964
+tcctt 0.2204
+tcgaa 0.2014
+tcgac 0.2799
+tcgag 0.2434
+tcgat 0.2754
+tcgca 0.2319
+tcgcc 0.2904
+tcgcg 0.2281
+tcgct 0.2496
+tcgga 0.1833
+tcggc 0.2808
+tcggg 0.2632
+tcggt 0.2727
+tcgta 0.1496
+tcgtc 0.2629
+tcgtg 0.3661
+tcgtt 0.2214
+tctaa 0.2699
+tctac 0.2975
+tctag 0.1574
+tctat 0.2752
+tctca 0.2419
+tctcc 0.3007
+tctcg 0.1712
+tctct 0.2862
+tctga 0.1973
+tctgc 0.2796
+tctgg 0.2157
+tctgt 0.3074
+tctta 0.1574
+tcttc 0.2592
+tcttg 0.2643
+tcttt 0.3191
+tgaaa 0.305
+tgaac 0.2156
+tgaag 0.2371
+tgaat 0.2423
+tgaca 0.2789
+tgacc 0.2407
+tgacg 0.2598
+tgact 0.2207
+tgaga 0.2535
+tgagc 0.2586
+tgagg 0.2279
+tgagt 0.26
+tgata 0.1861
+tgatc 0.149
+tgatg 0.4074
+tgatt 0.2575
+tgcaa 0.2438
+tgcac 0.2561
+tgcag 0.2734
+tgcat 0.2268
+tgcca 0.3004
+tgccc 0.2556
+tgccg 0.2237
+tgcct 0.2203
+tgcga 0.2122
+tgcgc 0.246
+tgcgg 0.2352
+tgcgt 0.3066
+tgcta 0.1331
+tgctc 0.2156
+tgctg 0.4366
+tgctt 0.2147
+tggaa 0.259
+tggac 0.1885
+tggag 0.3267
+tggat 0.2259
+tggca 0.269
+tggcc 0.2674
+tggcg 0.2182
+tggct 0.2454
+tggga 0.213
+tgggc 0.1972
+tgggg 0.3137
+tgggt 0.276
+tggta 0.1448
+tggtc 0.1666
+tggtg 0.4648
+tggtt 0.2237
+tgtaa 0.2888
+tgtac 0.2337
+tgtag 0.1905
+tgtat 0.2871
+tgtca 0.2945
+tgtcc 0.2223
+tgtcg 0.2008
+tgtct 0.2825
+tgtga 0.1889
+tgtgc 0.204
+tgtgg 0.2191
+tgtgt 0.3881
+tgtta 0.1848
+tgttc 0.1471
+tgttg 0.328
+tgttt 0.3401
+ttaaa 0.3761
+ttaac 0.2065
+ttaag 0.1481
+ttaat 0.2693
+ttaca 0.3811
+ttacc 0.2475
+ttacg 0.1603
+ttact 0.211
+ttaga 0.255
+ttagc 0.2605
+ttagg 0.2125
+ttagt 0.2721
+ttata 0.2314
+ttatc 0.156
+ttatg 0.1786
+ttatt 0.434
+ttcaa 0.2499
+ttcac 0.2773
+ttcag 0.1932
+ttcat 0.2796
+ttcca 0.3027
+ttccc 0.2898
+ttccg 0.145
+ttcct 0.2624
+ttcga 0.2074
+ttcgc 0.2411
+ttcgg 0.2415
+ttcgt 0.31
+ttcta 0.1775
+ttctc 0.2635
+ttctg 0.2622
+ttctt 0.2968
+ttgaa 0.2765
+ttgac 0.2409
+ttgag 0.2477
+ttgat 0.2349
+ttgca 0.3177
+ttgcc 0.2484
+ttgcg 0.1863
+ttgct 0.2476
+ttgga 0.2113
+ttggc 0.2696
+ttggg 0.2466
+ttggt 0.2725
+ttgta 0.1998
+ttgtc 0.1802
+ttgtg 0.3201
+ttgtt 0.2999
+tttaa 0.3259
+tttac 0.2213
+tttag 0.1333
+tttat 0.3196
+tttca 0.3214
+tttcc 0.2388
+tttcg 0.1871
+tttct 0.2527
+tttga 0.2207
+tttgc 0.221
+tttgg 0.2106
+tttgt 0.3478
+tttta 0.2511
+ttttc 0.1659
+ttttg 0.1929
+ttttt 0.3901
+
+# patterns:
+# aaaaa 15060
+# aaaac 8021
+# aaaag 5255
+# aaaat 10260
+# aaaca 9717
+# aaacc 5109
+# aaacg 4826
+# aaact 4987
+# aaaga 5148
+# aaagc 4719
+# aaagg 4220
+# aaagt 5662
+# aaata 9920
+# aaatc 5195
+# aaatg 7927
+# aaatt 6823
+# aacaa 8174
+# aacac 7839
+# aacag 5123
+# aacat 7441
+# aacca 5310
+# aaccc 5175
+# aaccg 3284
+# aacct 3458
+# aacga 3491
+# aacgc 3827
+# aacgg 2868
+# aacgt 4510
+# aacta 2801
+# aactc 4088
+# aactg 3879
+# aactt 4220
+# aagaa 4968
+# aagac 3448
+# aagag 4157
+# aagat 3559
+# aagca 4875
+# aagcc 3556
+# aagcg 3169
+# aagct 3846
+# aagga 3374
+# aaggc 3910
+# aaggg 4022
+# aaggt 3369
+# aagta 3151
+# aagtc 3559
+# aagtg 5400
+# aagtt 4220
+# aataa 9420
+# aatac 4411
+# aatag 2889
+# aatat 6758
+# aatca 4901
+# aatcc 3716
+# aatcg 3800
+# aatct 3663
+# aatga 5984
+# aatgc 4844
+# aatgg 4314
+# aatgt 7980
+# aatta 6241
+# aattc 4214
+# aattg 5590
+# aattt 6823
+# acaaa 9112
+# acaac 7120
+# acaag 4763
+# acaat 6247
+# acaca 13840
+# acacc 6141
+# acacg 7071
+# acact 5461
+# acaga 5550
+# acagc 6464
+# acagg 4510
+# acagt 4437
+# acata 4036
+# acatc 5749
+# acatg 4948
+# acatt 7980
+# accaa 5205
+# accac 9249
+# accag 4862
+# accat 4415
+# accca 6177
+# acccc 6582
+# acccg 4203
+# accct 3855
+# accga 3505
+# accgc 4496
+# accgg 3103
+# accgt 3414
+# accta 2572
+# acctc 4495
+# acctg 4368
+# acctt 3369
+# acgaa 3555
+# acgac 4199
+# acgag 4478
+# acgat 3518
+# acgca 5226
+# acgcc 3713
+# acgcg 4561
+# acgct 3176
+# acgga 3042
+# acggc 4499
+# acggg 4087
+# acggt 3414
+# acgta 3241
+# acgtc 4547
+# acgtg 7191
+# acgtt 4510
+# actaa 2857
+# actac 2848
+# actag 1341
+# actat 2449
+# actca 4996
+# actcc 3863
+# actcg 4348
+# actct 3561
+# actga 3708
+# actgc 5752
+# actgg 3929
+# actgt 4437
+# actta 2889
+# acttc 3452
+# acttg 4321
+# acttt 5662
+# agaaa 5183
+# agaac 3504
+# agaag 4028
+# agaat 4020
+# agaca 5278
+# agacc 3102
+# agacg 3499
+# agact 2887
+# agaga 5766
+# agagc 4027
+# agagg 4993
+# agagt 3561
+# agata 2861
+# agatc 2614
+# agatg 5256
+# agatt 3663
+# agcaa 4996
+# agcac 5776
+# agcag 8077
+# agcat 3862
+# agcca 5364
+# agccc 3834
+# agccg 3750
+# agcct 3242
+# agcga 3892
+# agcgc 4029
+# agcgg 4417
+# agcgt 3176
+# agcta 2182
+# agctc 4049
+# agctg 4806
+# agctt 3846
+# aggaa 4238
+# aggac 2970
+# aggag 5338
+# aggat 2759
+# aggca 4311
+# aggcc 4112
+# aggcg 3388
+# aggct 3242
+# aggga 4375
+# agggc 3873
+# agggg 6808
+# agggt 3855
+# aggta 2530
+# aggtc 3310
+# aggtg 5500
+# aggtt 3458
+# agtaa 3275
+# agtac 2624
+# agtag 2351
+# agtat 2975
+# agtca 4355
+# agtcc 2369
+# agtcg 3127
+# agtct 2887
+# agtga 5345
+# agtgc 4612
+# agtgg 6050
+# agtgt 5461
+# agtta 2889
+# agttc 2960
+# agttg 4152
+# agttt 4987
+# ataaa 8804
+# ataac 3863
+# ataag 2701
+# ataat 6316
+# ataca 5884
+# atacc 2324
+# atacg 2037
+# atact 2975
+# ataga 2731
+# atagc 2624
+# atagg 2500
+# atagt 2449
+# atata 5483
+# atatc 3216
+# atatg 3398
+# atatt 6758
+# atcaa 4588
+# atcac 5673
+# atcag 3585
+# atcat 5177
+# atcca 4264
+# atccc 3409
+# atccg 1960
+# atcct 2759
+# atcga 3253
+# atcgc 3549
+# atcgg 2841
+# atcgt 3518
+# atcta 2543
+# atctc 4411
+# atctg 3884
+# atctt 3559
+# atgaa 6043
+# atgac 4170
+# atgag 4193
+# atgat 5177
+# atgca 5962
+# atgcc 3388
+# atgcg 3151
+# atgct 3862
+# atgga 4285
+# atggc 4098
+# atggg 4326
+# atggt 4415
+# atgta 5091
+# atgtc 3726
+# atgtg 6458
+# atgtt 7441
+# attaa 6427
+# attac 4067
+# attag 2647
+# attat 6316
+# attca 5235
+# attcc 4250
+# attcg 2583
+# attct 4020
+# attga 4750
+# attgc 4598
+# attgg 4529
+# attgt 6247
+# attta 7535
+# atttc 5213
+# atttg 6859
+# atttt 10260
+# caaaa 7445
+# caaac 6414
+# caaag 5482
+# caaat 6859
+# caaca 9371
+# caacc 4919
+# caacg 4253
+# caact 4152
+# caaga 4263
+# caagc 4662
+# caagg 3790
+# caagt 4321
+# caata 4602
+# caatc 4045
+# caatg 5895
+# caatt 5590
+# cacaa 8723
+# cacac 13152
+# cacag 7312
+# cacat 6458
+# cacca 11041
+# caccc 7734
+# caccg 6086
+# cacct 5500
+# cacga 5774
+# cacgc 7148
+# cacgg 6205
+# cacgt 7191
+# cacta 3230
+# cactc 6125
+# cactg 6707
+# cactt 5400
+# cagaa 4388
+# cagac 4499
+# cagag 5278
+# cagat 3884
+# cagca 9919
+# cagcc 5991
+# cagcg 5065
+# cagct 4806
+# cagga 4539
+# caggc 4188
+# caggg 5094
+# caggt 4368
+# cagta 3229
+# cagtc 4010
+# cagtg 6707
+# cagtt 3879
+# cataa 3874
+# catac 3170
+# catag 2448
+# catat 3398
+# catca 7758
+# catcc 4036
+# catcg 4593
+# catct 5256
+# catga 4163
+# catgc 4559
+# catgg 4456
+# catgt 4948
+# catta 4570
+# cattc 4725
+# cattg 5895
+# cattt 7927
+# ccaaa 5515
+# ccaac 5128
+# ccaag 3921
+# ccaat 4529
+# ccaca 7810
+# ccacc 11108
+# ccacg 6924
+# ccact 6050
+# ccaga 3893
+# ccagc 6011
+# ccagg 4911
+# ccagt 3929
+# ccata 2946
+# ccatc 5413
+# ccatg 4456
+# ccatt 4314
+# cccaa 4709
+# cccac 8343
+# cccag 4995
+# cccat 4326
+# cccca 7022
+# ccccc 14899
+# ccccg 4962
+# cccct 6808
+# cccga 3383
+# cccgc 4716
+# cccgg 3761
+# cccgt 4087
+# cccta 2607
+# ccctc 7189
+# ccctg 5094
+# ccctt 4022
+# ccgaa 2769
+# ccgac 3277
+# ccgag 3965
+# ccgat 2841
+# ccgca 4009
+# ccgcc 5670
+# ccgcg 4299
+# ccgct 4417
+# ccgga 2407
+# ccggc 4322
+# ccggg 3761
+# ccggt 3103
+# ccgta 2205
+# ccgtc 3778
+# ccgtg 6205
+# ccgtt 2868
+# cctaa 2230
+# cctac 2981
+# cctag 1527
+# cctat 2500
+# cctca 4379
+# cctcc 7976
+# cctcg 4643
+# cctct 4993
+# cctga 3090
+# cctgc 5684
+# cctgg 4911
+# cctgt 4510
+# cctta 2520
+# ccttc 4141
+# ccttg 3790
+# ccttt 4220
+# cgaaa 3836
+# cgaac 2727
+# cgaag 2317
+# cgaat 2583
+# cgaca 3750
+# cgacc 3661
+# cgacg 4172
+# cgact 3127
+# cgaga 3446
+# cgagc 4239
+# cgagg 4643
+# cgagt 4348
+# cgata 2311
+# cgatc 2451
+# cgatg 4593
+# cgatt 3800
+# cgcaa 3758
+# cgcac 5803
+# cgcag 4326
+# cgcat 3151
+# cgcca 4769
+# cgccc 4606
+# cgccg 5574
+# cgcct 3388
+# cgcga 3556
+# cgcgc 5286
+# cgcgg 4299
+# cgcgt 4561
+# cgcta 2199
+# cgctc 5082
+# cgctg 5065
+# cgctt 3169
+# cggaa 2340
+# cggac 2368
+# cggag 4184
+# cggat 1960
+# cggca 4379
+# cggcc 4877
+# cggcg 5574
+# cggct 3750
+# cggga 3206
+# cgggc 3575
+# cgggg 4962
+# cgggt 4203
+# cggta 2330
+# cggtc 2820
+# cggtg 6086
+# cggtt 3284
+# cgtaa 2487
+# cgtac 2841
+# cgtag 2630
+# cgtat 2037
+# cgtca 5127
+# cgtcc 3189
+# cgtcg 4172
+# cgtct 3499
+# cgtga 6345
+# cgtgc 5985
+# cgtgg 6924
+# cgtgt 7071
+# cgtta 2546
+# cgttc 3080
+# cgttg 4253
+# cgttt 4826
+# ctaaa 3668
+# ctaac 2481
+# ctaag 1703
+# ctaat 2647
+# ctaca 3902
+# ctacc 2997
+# ctacg 2630
+# ctact 2351
+# ctaga 1560
+# ctagc 1434
+# ctagg 1527
+# ctagt 1341
+# ctata 2730
+# ctatc 2232
+# ctatg 2448
+# ctatt 2889
+# ctcaa 4837
+# ctcac 6792
+# ctcag 3387
+# ctcat 4193
+# ctcca 6170
+# ctccc 7139
+# ctccg 4184
+# ctcct 5338
+# ctcga 2874
+# ctcgc 5358
+# ctcgg 3965
+# ctcgt 4478
+# ctcta 2418
+# ctctc 6501
+# ctctg 5278
+# ctctt 4157
+# ctgaa 4175
+# ctgac 3416
+# ctgag 3387
+# ctgat 3585
+# ctgca 7189
+# ctgcc 5988
+# ctgcg 4326
+# ctgct 8077
+# ctgga 4018
+# ctggc 4862
+# ctggg 4995
+# ctggt 4862
+# ctgta 4442
+# ctgtc 4081
+# ctgtg 7312
+# ctgtt 5123
+# cttaa 3532
+# cttac 2336
+# cttag 1703
+# cttat 2701
+# cttca 5123
+# cttcc 4033
+# cttcg 2317
+# cttct 4028
+# cttga 3735
+# cttgc 4607
+# cttgg 3921
+# cttgt 4763
+# cttta 4759
+# ctttc 4249
+# ctttg 5482
+# ctttt 5255
+# gaaaa 6402
+# gaaac 4651
+# gaaag 4249
+# gaaat 5213
+# gaaca 4199
+# gaacc 3624
+# gaacg 3080
+# gaact 2960
+# gaaga 4180
+# gaagc 3728
+# gaagg 4141
+# gaagt 3452
+# gaata 3658
+# gaatc 3491
+# gaatg 4725
+# gaatt 4214
+# gacaa 4910
+# gacac 5978
+# gacag 4081
+# gacat 3726
+# gacca 3955
+# gaccc 4263
+# gaccg 2820
+# gacct 3310
+# gacga 4146
+# gacgc 3503
+# gacgg 3778
+# gacgt 4547
+# gacta 1519
+# gactc 3651
+# gactg 4010
+# gactt 3559
+# gagaa 4410
+# gagac 4821
+# gagag 6501
+# gagat 4411
+# gagca 4895
+# gagcc 4153
+# gagcg 5082
+# gagct 4049
+# gagga 5377
+# gaggc 4926
+# gaggg 7189
+# gaggt 4495
+# gagta 2909
+# gagtc 3651
+# gagtg 6125
+# gagtt 4088
+# gataa 3384
+# gatac 2213
+# gatag 2232
+# gatat 3216
+# gatca 2834
+# gatcc 2314
+# gatcg 2451
+# gatct 2614
+# gatga 6286
+# gatgc 4196
+# gatgg 5413
+# gatgt 5749
+# gatta 3355
+# gattc 3491
+# gattg 4045
+# gattt 5195
+# gcaaa 5790
+# gcaac 5184
+# gcaag 4607
+# gcaat 4598
+# gcaca 7271
+# gcacc 5637
+# gcacg 5985
+# gcact 4612
+# gcaga 5047
+# gcagc 9096
+# gcagg 5684
+# gcagt 5752
+# gcata 2761
+# gcatc 4196
+# gcatg 4559
+# gcatt 4844
+# gccaa 5148
+# gccac 7754
+# gccag 4862
+# gccat 4098
+# gccca 4413
+# gcccc 5664
+# gcccg 3575
+# gccct 3873
+# gccga 3609
+# gccgc 6144
+# gccgg 4322
+# gccgt 4499
+# gccta 2034
+# gcctc 4926
+# gcctg 4188
+# gcctt 3910
+# gcgaa 2764
+# gcgac 3927
+# gcgag 5358
+# gcgat 3549
+# gcgca 4193
+# gcgcc 4423
+# gcgcg 5286
+# gcgct 4029
+# gcgga 3044
+# gcggc 6144
+# gcggg 4716
+# gcggt 4496
+# gcgta 2197
+# gcgtc 3503
+# gcgtg 7148
+# gcgtt 3827
+# gctaa 2735
+# gctac 3095
+# gctag 1434
+# gctat 2624
+# gctca 4969
+# gctcc 4941
+# gctcg 4239
+# gctct 4027
+# gctga 4202
+# gctgc 9096
+# gctgg 6011
+# gctgt 6464
+# gctta 2328
+# gcttc 3728
+# gcttg 4662
+# gcttt 4719
+# ggaaa 4898
+# ggaac 2969
+# ggaag 4033
+# ggaat 4250
+# ggaca 4152
+# ggacc 2834
+# ggacg 3189
+# ggact 2369
+# ggaga 6057
+# ggagc 4941
+# ggagg 7976
+# ggagt 3863
+# ggata 2327
+# ggatc 2314
+# ggatg 4036
+# ggatt 3716
+# ggcaa 5013
+# ggcac 5191
+# ggcag 5988
+# ggcat 3388
+# ggcca 5846
+# ggccc 4091
+# ggccg 4877
+# ggcct 4112
+# ggcga 4530
+# ggcgc 4423
+# ggcgg 5670
+# ggcgt 3713
+# ggcta 2488
+# ggctc 4153
+# ggctg 5991
+# ggctt 3556
+# gggaa 4681
+# gggac 3645
+# gggag 7139
+# gggat 3409
+# gggca 5003
+# gggcc 4091
+# gggcg 4606
+# gggct 3834
+# gggga 6532
+# ggggc 5664
+# ggggg 14899
+# ggggt 6582
+# gggta 3637
+# gggtc 4263
+# gggtg 7734
+# gggtt 5175
+# ggtaa 3842
+# ggtac 2780
+# ggtag 2997
+# ggtat 2324
+# ggtca 4750
+# ggtcc 2834
+# ggtcg 3661
+# ggtct 3102
+# ggtga 7479
+# ggtgc 5637
+# ggtgg 11108
+# ggtgt 6141
+# ggtta 3584
+# ggttc 3624
+# ggttg 4919
+# ggttt 5109
+# gtaaa 6093
+# gtaac 3032
+# gtaag 2336
+# gtaat 4067
+# gtaca 4788
+# gtacc 2780
+# gtacg 2841
+# gtact 2624
+# gtaga 2952
+# gtagc 3095
+# gtagg 2981
+# gtagt 2848
+# gtata 3429
+# gtatc 2213
+# gtatg 3170
+# gtatt 4411
+# gtcaa 4704
+# gtcac 7446
+# gtcag 3416
+# gtcat 4170
+# gtcca 3557
+# gtccc 3645
+# gtccg 2368
+# gtcct 2970
+# gtcga 3306
+# gtcgc 3927
+# gtcgg 3277
+# gtcgt 4199
+# gtcta 1992
+# gtctc 4821
+# gtctg 4499
+# gtctt 3448
+# gtgaa 5994
+# gtgac 7446
+# gtgag 6792
+# gtgat 5673
+# gtgca 6733
+# gtgcc 5191
+# gtgcg 5803
+# gtgct 5776
+# gtgga 6542
+# gtggc 7754
+# gtggg 8343
+# gtggt 9249
+# gtgta 5533
+# gtgtc 5978
+# gtgtg 13152
+# gtgtt 7839
+# gttaa 4926
+# gttac 3032
+# gttag 2481
+# gttat 3863
+# gttca 4657
+# gttcc 2969
+# gttcg 2727
+# gttct 3504
+# gttga 5272
+# gttgc 5184
+# gttgg 5128
+# gttgt 7120
+# gttta 5555
+# gtttc 4651
+# gtttg 6414
+# gtttt 8021
+# taaaa 9692
+# taaac 5555
+# taaag 4759
+# taaat 7535
+# taaca 5279
+# taacc 3584
+# taacg 2546
+# taact 2889
+# taaga 2536
+# taagc 2328
+# taagg 2520
+# taagt 2889
+# taata 5299
+# taatc 3355
+# taatg 4570
+# taatt 6241
+# tacaa 5443
+# tacac 5533
+# tacag 4442
+# tacat 5091
+# tacca 3437
+# taccc 3637
+# taccg 2330
+# tacct 2530
+# tacga 2356
+# tacgc 2197
+# tacgg 2205
+# tacgt 3241
+# tacta 1936
+# tactc 2909
+# tactg 3229
+# tactt 3151
+# tagaa 2968
+# tagac 1992
+# tagag 2418
+# tagat 2543
+# tagca 3020
+# tagcc 2488
+# tagcg 2199
+# tagct 2182
+# tagga 2023
+# taggc 2034
+# taggg 2607
+# taggt 2572
+# tagta 1936
+# tagtc 1519
+# tagtg 3230
+# tagtt 2801
+# tataa 5021
+# tatac 3429
+# tatag 2730
+# tatat 5483
+# tatca 3541
+# tatcc 2327
+# tatcg 2311
+# tatct 2861
+# tatga 3146
+# tatgc 2761
+# tatgg 2946
+# tatgt 4036
+# tatta 5299
+# tattc 3658
+# tattg 4602
+# tattt 9920
+# tcaaa 5780
+# tcaac 5272
+# tcaag 3735
+# tcaat 4750
+# tcaca 6734
+# tcacc 7479
+# tcacg 6345
+# tcact 5345
+# tcaga 3560
+# tcagc 4202
+# tcagg 3090
+# tcagt 3708
+# tcata 3146
+# tcatc 6286
+# tcatg 4163
+# tcatt 5984
+# tccaa 4035
+# tccac 6542
+# tccag 4018
+# tccat 4285
+# tccca 4766
+# tcccc 6532
+# tcccg 3206
+# tccct 4375
+# tccga 2355
+# tccgc 3044
+# tccgg 2407
+# tccgt 3042
+# tccta 2023
+# tcctc 5377
+# tcctg 4539
+# tcctt 3374
+# tcgaa 2377
+# tcgac 3306
+# tcgag 2874
+# tcgat 3253
+# tcgca 3616
+# tcgcc 4530
+# tcgcg 3556
+# tcgct 3892
+# tcgga 2355
+# tcggc 3609
+# tcggg 3383
+# tcggt 3505
+# tcgta 2356
+# tcgtc 4146
+# tcgtg 5774
+# tcgtt 3491
+# tctaa 2678
+# tctac 2952
+# tctag 1560
+# tctat 2731
+# tctca 4872
+# tctcc 6057
+# tctcg 3446
+# tctct 5766
+# tctga 3560
+# tctgc 5047
+# tctgg 3893
+# tctgt 5550
+# tctta 2536
+# tcttc 4180
+# tcttg 4263
+# tcttt 5148
+# tgaaa 6592
+# tgaac 4657
+# tgaag 5123
+# tgaat 5235
+# tgaca 5504
+# tgacc 4750
+# tgacg 5127
+# tgact 4355
+# tgaga 4872
+# tgagc 4969
+# tgagg 4379
+# tgagt 4996
+# tgata 3541
+# tgatc 2834
+# tgatg 7758
+# tgatt 4901
+# tgcaa 6411
+# tgcac 6733
+# tgcag 7189
+# tgcat 5962
+# tgcca 5881
+# tgccc 5003
+# tgccg 4379
+# tgcct 4311
+# tgcga 3616
+# tgcgc 4193
+# tgcgg 4009
+# tgcgt 5226
+# tgcta 3020
+# tgctc 4895
+# tgctg 9919
+# tgctt 4875
+# tggaa 4890
+# tggac 3557
+# tggag 6170
+# tggat 4264
+# tggca 5881
+# tggcc 5846
+# tggcg 4769
+# tggct 5364
+# tggga 4766
+# tgggc 4413
+# tgggg 7022
+# tgggt 6177
+# tggta 3437
+# tggtc 3955
+# tggtg 11041
+# tggtt 5310
+# tgtaa 5919
+# tgtac 4788
+# tgtag 3902
+# tgtat 5884
+# tgtca 5504
+# tgtcc 4152
+# tgtcg 3750
+# tgtct 5278
+# tgtga 6734
+# tgtgc 7271
+# tgtgg 7810
+# tgtgt 13840
+# tgtta 5279
+# tgttc 4199
+# tgttg 9371
+# tgttt 9717
+# ttaaa 8976
+# ttaac 4926
+# ttaag 3532
+# ttaat 6427
+# ttaca 5919
+# ttacc 3842
+# ttacg 2487
+# ttact 3275
+# ttaga 2678
+# ttagc 2735
+# ttagg 2230
+# ttagt 2857
+# ttata 5021
+# ttatc 3384
+# ttatg 3874
+# ttatt 9420
+# ttcaa 5400
+# ttcac 5994
+# ttcag 4175
+# ttcat 6043
+# ttcca 4890
+# ttccc 4681
+# ttccg 2340
+# ttcct 4238
+# ttcga 2377
+# ttcgc 2764
+# ttcgg 2769
+# ttcgt 3555
+# ttcta 2968
+# ttctc 4410
+# ttctg 4388
+# ttctt 4968
+# ttgaa 5400
+# ttgac 4704
+# ttgag 4837
+# ttgat 4588
+# ttgca 6411
+# ttgcc 5013
+# ttgcg 3758
+# ttgct 4996
+# ttgga 4035
+# ttggc 5148
+# ttggg 4709
+# ttggt 5205
+# ttgta 5443
+# ttgtc 4910
+# ttgtg 8723
+# ttgtt 8174
+# tttaa 8976
+# tttac 6093
+# tttag 3668
+# tttat 8804
+# tttca 6592
+# tttcc 4898
+# tttcg 3836
+# tttct 5183
+# tttga 5780
+# tttgc 5790
+# tttgg 5515
+# tttgt 9112
+# tttta 9692
+# ttttc 6402
+# ttttg 7445
+# ttttt 15060
+
+# motif upstream of acceptor splice site
+[ASSMOTIF]
+# width of motif, n=
+30
+# order of markov model, k=
+3
+# markov chain emission probabilities
+ 0 0.337 0.217 0.199 0.247 0.212 0.288 0.256 0.244 0.194 0.163 0.245 0.398 0.231 0.11 0.396 0.264 0.201 0.402 0.161 0.236 0.178 0.391 0.276 0.155 0.22 0.302 0.241 0.237 0.134 0.257 0.324 0.285 0.306 0.235 0.141 0.318 0.277 0.257 0.228 0.238 0.185 0.348 0.196 0.272 0.153 0.153 0.504 0.19 0.27 0.221 0.164 0.344 0.189 0.264 0.189 0.358 0.35 0.208 0.113 0.329 0.174 0.204 0.323 0.299 0.21 0.345 0.168 0.277 0.217 0.26 0.279 0.244 0.179 0.305 0.211 0.305 0.133 0.266 0.35 0.251 0.179 0.449 0.10 [...]
+ 1 0.34 0.218 0.175 0.267 0.215 0.316 0.239 0.23 0.208 0.169 0.262 0.362 0.237 0.131 0.367 0.265 0.221 0.352 0.188 0.239 0.151 0.435 0.234 0.18 0.224 0.293 0.217 0.266 0.125 0.259 0.353 0.263 0.301 0.243 0.136 0.32 0.269 0.231 0.276 0.224 0.157 0.322 0.256 0.264 0.141 0.169 0.486 0.203 0.282 0.231 0.141 0.346 0.194 0.243 0.165 0.398 0.314 0.221 0.162 0.304 0.15 0.233 0.295 0.322 0.201 0.324 0.165 0.309 0.22 0.248 0.306 0.226 0.212 0.341 0.197 0.25 0.129 0.255 0.353 0.263 0.171 0.427 0.1 [...]
+ 2 0.341 0.228 0.187 0.244 0.206 0.31 0.242 0.242 0.215 0.188 0.255 0.342 0.213 0.145 0.382 0.26 0.228 0.35 0.179 0.243 0.135 0.464 0.224 0.178 0.203 0.256 0.236 0.305 0.137 0.259 0.36 0.245 0.311 0.209 0.169 0.311 0.274 0.217 0.28 0.229 0.164 0.303 0.303 0.23 0.144 0.154 0.486 0.216 0.323 0.206 0.153 0.317 0.184 0.235 0.18 0.4 0.299 0.206 0.156 0.339 0.161 0.201 0.304 0.334 0.215 0.316 0.169 0.299 0.232 0.247 0.288 0.232 0.208 0.339 0.202 0.25 0.123 0.242 0.365 0.271 0.163 0.455 0.133 [...]
+ 3 0.349 0.244 0.176 0.231 0.205 0.327 0.224 0.244 0.182 0.243 0.284 0.291 0.214 0.159 0.362 0.266 0.233 0.329 0.173 0.265 0.154 0.433 0.203 0.21 0.241 0.221 0.221 0.317 0.133 0.265 0.417 0.186 0.278 0.158 0.203 0.361 0.273 0.186 0.295 0.246 0.218 0.19 0.338 0.254 0.124 0.129 0.483 0.264 0.333 0.224 0.121 0.322 0.217 0.23 0.183 0.37 0.32 0.185 0.159 0.336 0.183 0.19 0.319 0.308 0.18 0.32 0.174 0.326 0.182 0.308 0.311 0.199 0.268 0.328 0.235 0.169 0.108 0.264 0.333 0.295 0.161 0.444 0.13 [...]
+ 4 0.323 0.231 0.197 0.249 0.199 0.324 0.217 0.261 0.151 0.24 0.288 0.322 0.222 0.173 0.353 0.252 0.208 0.329 0.154 0.308 0.161 0.417 0.194 0.228 0.171 0.256 0.214 0.359 0.118 0.29 0.392 0.2 0.283 0.152 0.248 0.317 0.248 0.145 0.341 0.266 0.225 0.231 0.319 0.225 0.118 0.106 0.453 0.324 0.343 0.217 0.12 0.319 0.213 0.231 0.167 0.389 0.292 0.2 0.174 0.334 0.186 0.169 0.322 0.322 0.182 0.267 0.182 0.369 0.189 0.315 0.286 0.21 0.286 0.318 0.24 0.156 0.106 0.223 0.37 0.3 0.162 0.493 0.125 0. [...]
+ 5 0.315 0.23 0.16 0.296 0.242 0.274 0.234 0.25 0.186 0.279 0.271 0.264 0.227 0.158 0.363 0.253 0.249 0.293 0.161 0.297 0.147 0.422 0.176 0.255 0.153 0.227 0.254 0.366 0.106 0.348 0.363 0.183 0.236 0.205 0.242 0.317 0.217 0.177 0.34 0.266 0.279 0.221 0.285 0.215 0.141 0.11 0.417 0.331 0.383 0.198 0.0926 0.327 0.185 0.185 0.176 0.455 0.238 0.217 0.186 0.359 0.171 0.168 0.322 0.339 0.174 0.23 0.213 0.382 0.197 0.326 0.278 0.199 0.262 0.292 0.215 0.231 0.13 0.222 0.352 0.296 0.142 0.493 0. [...]
+ 6 0.297 0.244 0.187 0.273 0.266 0.219 0.253 0.262 0.204 0.307 0.234 0.255 0.187 0.164 0.414 0.235 0.23 0.307 0.156 0.307 0.166 0.355 0.221 0.258 0.145 0.262 0.276 0.317 0.125 0.354 0.358 0.163 0.215 0.18 0.267 0.337 0.182 0.215 0.34 0.263 0.325 0.211 0.241 0.223 0.183 0.111 0.428 0.278 0.382 0.213 0.112 0.292 0.177 0.172 0.192 0.458 0.264 0.239 0.144 0.353 0.192 0.155 0.333 0.32 0.216 0.205 0.205 0.374 0.194 0.342 0.241 0.223 0.251 0.257 0.235 0.257 0.13 0.239 0.333 0.297 0.129 0.542 0 [...]
+ 7 0.248 0.271 0.173 0.308 0.279 0.212 0.257 0.252 0.172 0.317 0.255 0.255 0.221 0.137 0.38 0.262 0.189 0.346 0.15 0.314 0.169 0.296 0.272 0.263 0.147 0.318 0.241 0.294 0.137 0.331 0.346 0.186 0.187 0.239 0.245 0.329 0.163 0.24 0.342 0.255 0.376 0.191 0.204 0.229 0.176 0.127 0.436 0.261 0.353 0.241 0.0824 0.324 0.162 0.162 0.194 0.481 0.232 0.267 0.163 0.338 0.197 0.197 0.31 0.296 0.194 0.206 0.183 0.417 0.204 0.366 0.229 0.2 0.251 0.28 0.217 0.251 0.118 0.261 0.334 0.286 0.128 0.502 0. [...]
+ 8 0.205 0.297 0.179 0.318 0.282 0.206 0.294 0.218 0.214 0.307 0.236 0.243 0.2 0.131 0.397 0.272 0.196 0.348 0.163 0.293 0.14 0.353 0.286 0.222 0.139 0.353 0.221 0.287 0.154 0.327 0.335 0.185 0.171 0.241 0.241 0.348 0.187 0.286 0.33 0.197 0.308 0.226 0.214 0.252 0.189 0.171 0.409 0.232 0.4 0.249 0.0919 0.259 0.155 0.142 0.205 0.498 0.198 0.265 0.165 0.373 0.199 0.195 0.294 0.312 0.217 0.189 0.183 0.411 0.229 0.31 0.222 0.239 0.241 0.255 0.213 0.291 0.122 0.257 0.325 0.296 0.13 0.5 0.095 [...]
+ 9 0.211 0.3 0.167 0.322 0.335 0.2 0.278 0.187 0.244 0.321 0.237 0.198 0.204 0.15 0.368 0.279 0.191 0.354 0.188 0.267 0.117 0.34 0.301 0.241 0.176 0.307 0.27 0.248 0.167 0.306 0.326 0.202 0.189 0.213 0.207 0.39 0.195 0.355 0.266 0.183 0.333 0.177 0.241 0.248 0.212 0.167 0.423 0.199 0.425 0.238 0.0773 0.26 0.165 0.157 0.177 0.5 0.183 0.251 0.169 0.398 0.188 0.194 0.324 0.294 0.233 0.222 0.144 0.4 0.226 0.317 0.211 0.246 0.207 0.297 0.2 0.297 0.115 0.272 0.301 0.311 0.145 0.459 0.116 0.28 [...]
+10 0.193 0.326 0.155 0.326 0.286 0.267 0.235 0.212 0.234 0.333 0.252 0.18 0.211 0.165 0.326 0.298 0.179 0.354 0.186 0.282 0.107 0.365 0.319 0.208 0.167 0.331 0.248 0.254 0.197 0.231 0.359 0.214 0.21 0.153 0.306 0.331 0.218 0.328 0.264 0.19 0.276 0.187 0.299 0.239 0.185 0.172 0.459 0.185 0.423 0.232 0.0952 0.25 0.152 0.176 0.236 0.436 0.219 0.232 0.17 0.379 0.194 0.216 0.305 0.286 0.25 0.227 0.116 0.407 0.224 0.328 0.196 0.252 0.205 0.411 0.192 0.192 0.0946 0.29 0.322 0.293 0.139 0.464 0 [...]
+11 0.21 0.326 0.133 0.331 0.251 0.317 0.236 0.196 0.216 0.297 0.252 0.234 0.218 0.154 0.289 0.339 0.215 0.372 0.149 0.264 0.105 0.412 0.286 0.197 0.161 0.319 0.232 0.289 0.166 0.219 0.34 0.275 0.203 0.161 0.322 0.315 0.29 0.278 0.249 0.183 0.242 0.218 0.331 0.21 0.186 0.136 0.424 0.254 0.421 0.204 0.118 0.257 0.162 0.212 0.242 0.385 0.188 0.185 0.193 0.434 0.181 0.194 0.302 0.324 0.224 0.255 0.106 0.416 0.208 0.339 0.228 0.225 0.169 0.426 0.176 0.23 0.0938 0.272 0.328 0.306 0.175 0.417 [...]
+12 0.271 0.288 0.106 0.335 0.231 0.34 0.224 0.204 0.258 0.269 0.226 0.247 0.196 0.163 0.297 0.344 0.236 0.332 0.162 0.271 0.119 0.467 0.226 0.188 0.161 0.284 0.253 0.301 0.13 0.225 0.359 0.286 0.197 0.0833 0.417 0.303 0.301 0.235 0.257 0.208 0.165 0.293 0.293 0.248 0.225 0.123 0.406 0.246 0.424 0.188 0.146 0.243 0.16 0.226 0.239 0.374 0.217 0.15 0.172 0.461 0.166 0.175 0.331 0.328 0.241 0.247 0.126 0.385 0.168 0.308 0.284 0.24 0.201 0.371 0.189 0.239 0.11 0.254 0.306 0.33 0.159 0.488 0. [...]
+13 0.322 0.264 0.092 0.322 0.23 0.326 0.184 0.261 0.265 0.229 0.169 0.337 0.212 0.176 0.278 0.333 0.198 0.314 0.198 0.29 0.127 0.445 0.23 0.197 0.144 0.336 0.236 0.284 0.0942 0.224 0.354 0.327 0.219 0.0584 0.489 0.234 0.285 0.209 0.291 0.215 0.192 0.283 0.333 0.192 0.272 0.112 0.4 0.216 0.354 0.162 0.138 0.346 0.154 0.247 0.22 0.379 0.187 0.172 0.198 0.443 0.151 0.167 0.336 0.346 0.226 0.289 0.113 0.371 0.17 0.301 0.318 0.21 0.159 0.36 0.177 0.305 0.0824 0.258 0.341 0.319 0.129 0.508 0. [...]
+14 0.328 0.254 0.096 0.322 0.204 0.318 0.208 0.271 0.26 0.233 0.151 0.356 0.191 0.17 0.315 0.324 0.214 0.311 0.163 0.311 0.15 0.443 0.223 0.185 0.115 0.381 0.222 0.281 0.0946 0.261 0.333 0.311 0.185 0.0672 0.538 0.21 0.322 0.171 0.303 0.204 0.162 0.305 0.333 0.2 0.222 0.133 0.415 0.23 0.333 0.151 0.143 0.373 0.131 0.296 0.233 0.34 0.198 0.191 0.191 0.419 0.136 0.178 0.311 0.375 0.248 0.241 0.128 0.383 0.146 0.323 0.304 0.227 0.166 0.308 0.231 0.296 0.0849 0.247 0.351 0.317 0.13 0.532 0. [...]
+15 0.389 0.229 0.0857 0.297 0.217 0.285 0.249 0.249 0.193 0.289 0.145 0.373 0.181 0.167 0.348 0.305 0.211 0.349 0.157 0.283 0.167 0.393 0.26 0.18 0.111 0.374 0.172 0.344 0.0746 0.333 0.311 0.281 0.167 0.184 0.447 0.202 0.292 0.143 0.364 0.201 0.214 0.277 0.277 0.232 0.22 0.146 0.415 0.22 0.292 0.167 0.133 0.408 0.146 0.296 0.166 0.392 0.156 0.199 0.185 0.46 0.135 0.155 0.32 0.389 0.258 0.303 0.0833 0.356 0.127 0.297 0.337 0.239 0.162 0.266 0.266 0.305 0.0847 0.226 0.339 0.351 0.154 0.50 [...]
+16 0.368 0.211 0.076 0.345 0.223 0.26 0.26 0.256 0.136 0.322 0.153 0.39 0.211 0.158 0.368 0.263 0.121 0.389 0.185 0.306 0.179 0.393 0.26 0.168 0.0969 0.349 0.178 0.376 0.0718 0.368 0.325 0.234 0.2 0.19 0.429 0.181 0.259 0.129 0.415 0.197 0.252 0.244 0.286 0.218 0.175 0.183 0.458 0.183 0.269 0.204 0.0741 0.454 0.149 0.255 0.154 0.441 0.145 0.205 0.187 0.464 0.147 0.171 0.331 0.352 0.256 0.302 0.0853 0.357 0.143 0.289 0.303 0.266 0.179 0.269 0.297 0.255 0.0729 0.215 0.381 0.332 0.138 0.53 [...]
+17 0.362 0.202 0.11 0.325 0.267 0.222 0.261 0.25 0.127 0.345 0.145 0.382 0.22 0.191 0.382 0.208 0.141 0.41 0.179 0.269 0.176 0.366 0.242 0.216 0.0866 0.378 0.165 0.37 0.0794 0.402 0.28 0.238 0.198 0.208 0.365 0.229 0.242 0.148 0.469 0.141 0.293 0.162 0.303 0.242 0.146 0.188 0.5 0.167 0.245 0.218 0.0455 0.491 0.168 0.26 0.133 0.439 0.128 0.204 0.186 0.482 0.136 0.165 0.326 0.373 0.213 0.306 0.0648 0.417 0.14 0.302 0.279 0.279 0.121 0.273 0.333 0.273 0.0541 0.212 0.394 0.34 0.142 0.49 0.0 [...]
+18 0.358 0.233 0.119 0.289 0.273 0.24 0.279 0.208 0.109 0.382 0.164 0.345 0.152 0.207 0.378 0.262 0.135 0.405 0.135 0.324 0.179 0.374 0.26 0.187 0.119 0.285 0.162 0.435 0.112 0.435 0.242 0.211 0.183 0.254 0.282 0.282 0.219 0.148 0.453 0.18 0.375 0.148 0.216 0.261 0.0824 0.165 0.518 0.235 0.252 0.233 0.068 0.447 0.15 0.233 0.192 0.425 0.12 0.198 0.164 0.519 0.149 0.182 0.302 0.367 0.209 0.252 0.113 0.426 0.139 0.317 0.235 0.309 0.156 0.279 0.41 0.156 0.0766 0.199 0.364 0.36 0.164 0.481 0 [...]
+19 0.336 0.255 0.128 0.282 0.278 0.25 0.292 0.181 0.082 0.377 0.164 0.377 0.138 0.212 0.375 0.275 0.112 0.485 0.142 0.261 0.175 0.347 0.278 0.199 0.115 0.257 0.133 0.495 0.0922 0.417 0.243 0.248 0.167 0.318 0.242 0.273 0.198 0.14 0.471 0.19 0.366 0.237 0.172 0.226 0.119 0.149 0.478 0.254 0.207 0.264 0.103 0.425 0.152 0.22 0.209 0.419 0.138 0.196 0.156 0.509 0.144 0.188 0.306 0.362 0.191 0.287 0.113 0.409 0.144 0.325 0.242 0.289 0.126 0.284 0.411 0.179 0.0714 0.199 0.368 0.361 0.147 0.48 [...]
+20 0.272 0.265 0.132 0.331 0.233 0.233 0.31 0.225 0.12 0.28 0.2 0.4 0.106 0.235 0.353 0.306 0.112 0.485 0.134 0.269 0.175 0.389 0.229 0.207 0.139 0.287 0.134 0.44 0.112 0.372 0.25 0.266 0.2 0.145 0.291 0.364 0.188 0.139 0.455 0.218 0.32 0.293 0.2 0.187 0.118 0.132 0.5 0.25 0.235 0.235 0.118 0.412 0.128 0.261 0.207 0.404 0.163 0.208 0.135 0.495 0.118 0.176 0.287 0.419 0.167 0.306 0.12 0.407 0.152 0.366 0.227 0.254 0.151 0.279 0.395 0.174 0.0802 0.233 0.355 0.332 0.115 0.514 0.066 0.306 0 [...]
+21 0.281 0.298 0.149 0.272 0.295 0.188 0.259 0.259 0.143 0.286 0.204 0.367 0.0809 0.301 0.295 0.324 0.138 0.447 0.13 0.285 0.136 0.402 0.231 0.231 0.139 0.287 0.176 0.398 0.105 0.353 0.221 0.321 0.194 0.129 0.323 0.355 0.185 0.163 0.38 0.272 0.292 0.333 0.125 0.25 0.119 0.119 0.475 0.288 0.24 0.213 0.12 0.427 0.107 0.27 0.214 0.408 0.161 0.221 0.129 0.489 0.0981 0.181 0.313 0.408 0.167 0.315 0.13 0.389 0.163 0.367 0.24 0.23 0.173 0.284 0.358 0.185 0.0887 0.226 0.31 0.375 0.106 0.5 0.072 [...]
+22 0.267 0.297 0.099 0.337 0.319 0.155 0.302 0.224 0.157 0.235 0.275 0.333 0.0566 0.308 0.289 0.346 0.147 0.382 0.206 0.265 0.116 0.429 0.254 0.201 0.136 0.277 0.155 0.432 0.108 0.328 0.226 0.339 0.175 0.159 0.381 0.286 0.207 0.171 0.317 0.305 0.292 0.389 0.167 0.153 0.148 0.115 0.361 0.377 0.265 0.191 0.147 0.397 0.0936 0.305 0.202 0.399 0.169 0.268 0.118 0.445 0.105 0.231 0.253 0.412 0.215 0.318 0.14 0.327 0.162 0.381 0.241 0.216 0.211 0.324 0.352 0.113 0.1 0.251 0.301 0.347 0.0961 0. [...]
+23 0.207 0.276 0.092 0.425 0.304 0.183 0.313 0.2 0.255 0.191 0.298 0.255 0.0733 0.287 0.287 0.353 0.149 0.388 0.224 0.239 0.103 0.432 0.251 0.214 0.09 0.34 0.19 0.38 0.0795 0.33 0.239 0.352 0.191 0.176 0.368 0.265 0.211 0.225 0.296 0.268 0.234 0.377 0.26 0.13 0.173 0.154 0.346 0.327 0.25 0.2 0.117 0.433 0.107 0.316 0.134 0.444 0.183 0.253 0.124 0.44 0.083 0.245 0.261 0.411 0.248 0.337 0.119 0.297 0.146 0.378 0.266 0.21 0.174 0.348 0.25 0.228 0.0772 0.26 0.337 0.325 0.0949 0.529 0.0912 0 [...]
+24 0.218 0.269 0.0769 0.436 0.347 0.188 0.257 0.208 0.289 0.156 0.378 0.178 0.101 0.295 0.273 0.331 0.162 0.315 0.231 0.292 0.0996 0.476 0.234 0.19 0.0917 0.358 0.188 0.362 0.116 0.301 0.277 0.306 0.211 0.127 0.38 0.282 0.319 0.261 0.232 0.188 0.338 0.275 0.263 0.125 0.154 0.185 0.431 0.231 0.25 0.232 0.0893 0.429 0.092 0.333 0.126 0.448 0.14 0.259 0.111 0.49 0.0751 0.217 0.245 0.462 0.194 0.409 0.118 0.28 0.2 0.345 0.268 0.186 0.198 0.333 0.25 0.219 0.0862 0.246 0.319 0.349 0.102 0.545 [...]
+25 0.25 0.25 0.0938 0.406 0.343 0.306 0.204 0.148 0.311 0.222 0.333 0.133 0.13 0.304 0.261 0.304 0.124 0.323 0.261 0.292 0.0972 0.486 0.218 0.199 0.108 0.329 0.221 0.343 0.0952 0.274 0.339 0.292 0.169 0.138 0.415 0.277 0.343 0.284 0.224 0.149 0.372 0.267 0.221 0.14 0.179 0.196 0.375 0.25 0.182 0.255 0.127 0.436 0.118 0.304 0.112 0.466 0.128 0.269 0.137 0.466 0.0717 0.249 0.266 0.414 0.22 0.33 0.165 0.286 0.204 0.3 0.283 0.213 0.228 0.248 0.317 0.208 0.0837 0.213 0.351 0.351 0.128 0.534 [...]
+26 0.29 0.177 0.0968 0.435 0.326 0.316 0.2 0.158 0.265 0.204 0.429 0.102 0.16 0.25 0.34 0.25 0.103 0.321 0.291 0.285 0.11 0.461 0.283 0.146 0.124 0.332 0.213 0.332 0.0964 0.319 0.343 0.241 0.123 0.154 0.415 0.308 0.39 0.305 0.153 0.153 0.361 0.313 0.229 0.0964 0.179 0.196 0.393 0.232 0.192 0.231 0.212 0.365 0.156 0.325 0.104 0.416 0.134 0.295 0.138 0.433 0.0866 0.247 0.221 0.446 0.212 0.384 0.131 0.273 0.202 0.324 0.264 0.21 0.224 0.224 0.364 0.187 0.0623 0.257 0.35 0.331 0.117 0.576 0. [...]
+27 0.273 0.227 0.167 0.333 0.326 0.295 0.147 0.232 0.25 0.227 0.386 0.136 0.152 0.257 0.257 0.333 0.0864 0.37 0.241 0.302 0.13 0.394 0.299 0.177 0.111 0.357 0.226 0.307 0.0719 0.341 0.335 0.251 0.111 0.292 0.306 0.292 0.322 0.254 0.237 0.186 0.314 0.275 0.196 0.216 0.151 0.208 0.453 0.189 0.154 0.25 0.212 0.385 0.153 0.369 0.127 0.35 0.145 0.293 0.165 0.397 0.0922 0.194 0.272 0.442 0.185 0.435 0.12 0.261 0.184 0.4 0.227 0.189 0.229 0.239 0.339 0.193 0.0564 0.237 0.308 0.398 0.133 0.583 [...]
+28 0.269 0.192 0.212 0.327 0.366 0.268 0.11 0.256 0.147 0.206 0.471 0.176 0.169 0.277 0.265 0.289 0.0993 0.383 0.234 0.284 0.143 0.383 0.281 0.194 0.127 0.348 0.222 0.304 0.0652 0.319 0.37 0.246 0.0984 0.295 0.295 0.311 0.373 0.196 0.216 0.216 0.302 0.314 0.128 0.256 0.16 0.18 0.46 0.2 0.174 0.261 0.239 0.326 0.145 0.419 0.153 0.282 0.15 0.305 0.17 0.375 0.0978 0.179 0.272 0.451 0.169 0.481 0.104 0.247 0.198 0.422 0.214 0.166 0.274 0.219 0.397 0.11 0.0644 0.243 0.272 0.421 0.121 0.554 0 [...]
+29 0.268 0.195 0.22 0.317 0.31 0.31 0.113 0.268 0.154 0.192 0.423 0.231 0.152 0.288 0.227 0.333 0.082 0.385 0.254 0.279 0.118 0.373 0.314 0.196 0.136 0.331 0.229 0.305 0.0189 0.349 0.358 0.274 0.0652 0.391 0.283 0.261 0.27 0.162 0.27 0.297 0.214 0.343 0.143 0.3 0.167 0.167 0.433 0.233 0.175 0.225 0.275 0.325 0.167 0.402 0.137 0.294 0.183 0.331 0.204 0.282 0.117 0.219 0.258 0.406 0.2 0.431 0.108 0.262 0.153 0.481 0.187 0.179 0.254 0.271 0.39 0.0847 0.0606 0.242 0.267 0.43 0.112 0.538 0.0 [...]
diff --git a/config/species/lamprey/lamprey_metapars.cfg b/config/species/japaneselamprey/japaneselamprey_metapars.cfg
similarity index 79%
copy from config/species/lamprey/lamprey_metapars.cfg
copy to config/species/japaneselamprey/japaneselamprey_metapars.cfg
index bce6670..811a8a0 100644
--- a/config/species/lamprey/lamprey_metapars.cfg
+++ b/config/species/japaneselamprey/japaneselamprey_metapars.cfg
@@ -1,6 +1,8 @@
-# This file contains the list of meta parameters which are subject to optimization.
-# All other parameters are chosen as given in the species parameter file. The order
-# of the parameters determines the order in the optimisation process.
+# This file contains the list of meta parameters for the coding regions (CDS) which are subject to optimization.
+# All other meta parameters are chosen as given in the species parameter file. The order
+# of the parameters determines the order in the optimization process.
+# Basically, different values for these meta parameters are tried out and the ones
+# giving best performance in a cross-validation on the training set are chosen.
# For each parameter the range of possible values is specified after the parameter
# name and at least one white space.
# 3 cases are possible for the range:
diff --git a/config/species/japaneselamprey/japaneselamprey_metapars.utr.cfg b/config/species/japaneselamprey/japaneselamprey_metapars.utr.cfg
new file mode 100644
index 0000000..b872034
--- /dev/null
+++ b/config/species/japaneselamprey/japaneselamprey_metapars.utr.cfg
@@ -0,0 +1,30 @@
+# This file contains the list of meta parameters for the Untranslated Regions (UTRs), which are subject to optimization.
+# All other parameters are chosen as given in the species parameter file. The order
+# of the parameters determines the order in the optimization process.
+# Basically, different values for these meta parameters are tried out and the ones
+# giving best performance in a cross-validation on the training set are chosen.
+# For each parameter the range of possible values is specified after the parameter
+# name and at least one white space.
+# 3 cases are possible for the range:
+# - an explicit list is given, e.g. protein "on" "off"
+# - it is an integer range, e.g. window_size "1"-"5"
+# - it is a range of floating point numbers, e.g. pseudocount "0.3"_"1.8"
+#
+#
+# Mario Stanke, 9.5.2008
+#
+
+/UtrModel/prob_polya "0.0"_"0.99"
+/UtrModel/d_polya_cleavage_min "6"-"14"
+/UtrModel/d_polya_cleavage_max "17"-"27"
+/UtrModel/tss_start "0"-"12"
+/UtrModel/tss_end "0"-"8"
+/UtrModel/tts_motif_memory "0"-"2"
+/UtrModel/utr5patternweight "0.1"_"1.0"
+/UtrModel/utr3patternweight "0.1"_"1.0"
+/UtrModel/patpseudocount "1"_"3"
+/UtrModel/tssup_k "0"-"2"
+/UtrModel/slope_of_bandwidth "0.2"_"0.4"
+/UtrModel/minwindowcount "1"-"4"
+#/UtrModel/k "2"-"4"
+
diff --git a/config/species/lamprey/lamprey_parameters.cfg b/config/species/japaneselamprey/japaneselamprey_parameters.cfg
similarity index 63%
copy from config/species/lamprey/lamprey_parameters.cfg
copy to config/species/japaneselamprey/japaneselamprey_parameters.cfg
index 00f9d7c..f12722b 100644
--- a/config/species/lamprey/lamprey_parameters.cfg
+++ b/config/species/japaneselamprey/japaneselamprey_parameters.cfg
@@ -1,17 +1,15 @@
#
-# lamprey parameters (Petromyzon marinus)
-# contributed by Falk Hildebrand and Shigehiro Kuraku
-# based on the genome assembly (PMAR3.0) provided by the Genome Sequencing Center at
-# Washington University School of Medicine (WUGSC) in St. Louis.
-# date : 28.01.2010
+# japaneselamprey parameters.
+#
+# date : 19.12.2006
#
#
# Properties for augustus
#------------------------------------
/augustus/verbosity 3 # 0-3, 0: only print the neccessary
-maxDNAPieceSize 200000 # maximum segment that is predicted in one piece
-stopCodonExcludedFromCDS false # make this 'true' if the CDS includes the stop codon (training and prediction)
+maxDNAPieceSize 500000 # maximum segment that is predicted in one piece
+stopCodonExcludedFromCDS false # make this 'true' if the CDS does not include the stop codon (training and prediction)
# gff output options:
protein on # output predicted protein sequence
@@ -28,7 +26,8 @@ checkExAcc off # internal parameter for extrinsic accuracy
# alternative transcripts and posterior probabilities
sample 100 # the number of sampling iterations
-alternatives-from-sampling false # output alternative transcripts
+alternatives-from-sampling false # output alternative suboptimal transcripts
+alternatives-from-evidence false # output alternative transcripts based on explicit evidence from hints
minexonintronprob 0.08 # minimal posterior probability of all (coding) exons
minmeanexonintronprob 0.4 # minimal geometric mean of the posterior probs of introns and exons
maxtracks -1 # maximum number of reported transcripts per gene (-1: no limit)
@@ -44,54 +43,54 @@ UTR off # predict untranslated regions
# global constants
# ----------------------------
-/Constant/trans_init_window 22
+/Constant/trans_init_window 20
/Constant/ass_upwindow_size 30
-/Constant/ass_start 1
+/Constant/ass_start 2
/Constant/ass_end 2
-/Constant/dss_start 1
+/Constant/dss_start 3
/Constant/dss_end 3
-/Constant/init_coding_len 1
-/Constant/intterm_coding_len 6
+/Constant/init_coding_len 15
+/Constant/intterm_coding_len 0
/Constant/tss_upwindow_size 45
/Constant/decomp_num_at 1
/Constant/decomp_num_gc 1
/Constant/gc_range_min 0.32 # This range has an effect only when decomp_num_steps>1.
/Constant/gc_range_max 0.73 # States the minimal and maximal percentage of c or g
-/Constant/decomp_num_steps 1
+/Constant/decomp_num_steps 4 # I recomment keeping this to 1 for most species.
/Constant/min_coding_len 201 # no gene with a coding sequence shorter than this is predicted
-/Constant/probNinCoding 0.23
-/Constant/amberprob 0.33 # Prob(stop codon = tag), if 0 tag is assumed to code for amino acid
-/Constant/ochreprob 0.33 # Prob(stop codon = taa), if 0 taa is assumed to code for amino acid
-/Constant/opalprob 0.34 # Prob(stop codon = tga), if 0 tga is assumed to code for amino acid
+/Constant/probNinCoding 0.23 # divide this by .25 to get a malus for making one masked letter part of the coding sequence
+/Constant/amberprob 0.198 # Prob(stop codon = tag), if 0 tag is assumed to code for amino acid
+/Constant/ochreprob 0.15 # Prob(stop codon = taa), if 0 taa is assumed to code for amino acid
+/Constant/opalprob 0.652 # Prob(stop codon = tga), if 0 tga is assumed to code for amino acid
/Constant/subopt_transcript_threshold 0.7
/Constant/almost_identical_maxdiff 10
# type of weighing, one of 1 = equalWeights, 2 = gcContentClasses, 3 = multiNormalKernel
/BaseCount/weighingType 3
# file with the weight matrix (only for multiNormalKernel type weighing)
-/BaseCount/weightMatrixFile lamprey_weightmatrix.txt # change this to your species if at all neccessary
+/BaseCount/weightMatrixFile japaneselamprey_weightmatrix.txt # change this to your species if at all neccessary
# Properties for IGenicModel
# ----------------------------
/IGenicModel/verbosity 0
-/IGenicModel/infile lamprey_igenic_probs.pbl # change this and the other five filenames *_probs.pbl below to your species
-/IGenicModel/outfile lamprey_igenic_probs.pbl
+/IGenicModel/infile japaneselamprey_igenic_probs.pbl # change this and the other five filenames *_probs.pbl below to your species
+/IGenicModel/outfile japaneselamprey_igenic_probs.pbl
/IGenicModel/patpseudocount 5.0
/IGenicModel/k 4 # order of the Markov chain for content model, keep equal to /ExonModel/k
-# Properties f�r ExonModel
+# Properties for ExonModel
# ----------------------------
/ExonModel/verbosity 3
-/ExonModel/infile lamprey_exon_probs.pbl
-/ExonModel/outfile lamprey_exon_probs.pbl
+/ExonModel/infile japaneselamprey_exon_probs.pbl
+/ExonModel/outfile japaneselamprey_exon_probs.pbl
/ExonModel/patpseudocount 5.0
-/ExonModel/minPatSum 233.3
+/ExonModel/minPatSum 475
/ExonModel/k 4 # order of the Markov chain for content model
/ExonModel/etorder 2
/ExonModel/etpseudocount 3
/ExonModel/exonlengthD 2000 # beyond this the distribution is geometric
/ExonModel/maxexonlength 15000
-/ExonModel/slope_of_bandwidth 0.325
+/ExonModel/slope_of_bandwidth 0.3
/ExonModel/minwindowcount 10
/ExonModel/tis_motif_memory 2
/ExonModel/tis_motif_radius 3
@@ -99,29 +98,29 @@ UTR off # predict untranslated regions
# Properties for IntronModel
# ----------------------------
/IntronModel/verbosity 0
-/IntronModel/infile lamprey_intron_probs.pbl
-/IntronModel/outfile lamprey_intron_probs.pbl
+/IntronModel/infile japaneselamprey_intron_probs.pbl
+/IntronModel/outfile japaneselamprey_intron_probs.pbl
/IntronModel/patpseudocount 5.0
/IntronModel/k 4 # order of the Markov chain for content model, keep equal to /ExonModel/k
-/IntronModel/slope_of_bandwidth 0.4
+/IntronModel/slope_of_bandwidth 0.1875
/IntronModel/minwindowcount 4
/IntronModel/asspseudocount 0.007875
/IntronModel/dsspseudocount 0.0005
-/IntronModel/dssneighborfactor 0.00071875
-#/IntronModel/splicefile lamprey_splicefile.txt # this optional file contains additional windows around splice sites for training, uncomment if you have one
+/IntronModel/dssneighborfactor 0.007525
+#/IntronModel/splicefile japaneselamprey_splicefile.txt # this optional file contains additional windows around splice sites for training, uncomment if you have one
/IntronModel/sf_with_motif false # if true the splice file is also used to train the branch point region
-/IntronModel/d 100
+/IntronModel/d 950 # constraint: this must be larger than 4 + /Constant/dss_end + /Constant/ass_upwindow_size + /Constant/ass_start
/IntronModel/ass_motif_memory 3
-/IntronModel/ass_motif_radius 4
+/IntronModel/ass_motif_radius 2
# Properties for UtrModel
# ----------------------------
/UtrModel/verbosity 3
-/UtrModel/infile lamprey_utr_probs.pbl
-/UtrModel/outfile lamprey_utr_probs.pbl
+/UtrModel/infile japaneselamprey_utr_probs.pbl
+/UtrModel/outfile japaneselamprey_utr_probs.pbl
/UtrModel/k 4
-/UtrModel/utr5patternweight 0
-/UtrModel/utr3patternweight 1.0
+/UtrModel/utr5patternweight 0.5
+/UtrModel/utr3patternweight 0.5
/UtrModel/patpseudocount 1
/UtrModel/tssup_k 0
/UtrModel/tssup_patpseudocount 1
@@ -129,8 +128,8 @@ UTR off # predict untranslated regions
/UtrModel/minwindowcount 3
/UtrModel/exonlengthD 800
/UtrModel/maxexonlength 1800
-/UtrModel/max3singlelength 1800
-/UtrModel/max3termlength 1800
+/UtrModel/max3singlelength 2000
+/UtrModel/max3termlength 1500
/UtrModel/tss_start 8
/UtrModel/tss_end 5
/UtrModel/tata_start 2
@@ -138,7 +137,9 @@ UTR off # predict untranslated regions
/UtrModel/tata_pseudocount 2
/UtrModel/d_tss_tata_min 26 # minimal distance between start of tata box (if existent) and tss
/UtrModel/d_tss_tata_max 37 # maximal distance between start of tata box (if existent) and tss
+/UtrModel/polyasig_consensus aataaa # polyadenylation signal training not fully automated yet
/UtrModel/d_polyasig_cleavage 14 # the transcription end is predicted this many bases after the polyadenylation signal
/UtrModel/d_polya_cleavage_min 7
-/UtrModel/d_polya_cleavage_max 17
+/UtrModel/d_polya_cleavage_max 19
/UtrModel/prob_polya 0.4
+/UtrModel/tts_motif_memory 1
diff --git a/config/species/lamprey/lamprey_weightmatrix.txt b/config/species/japaneselamprey/japaneselamprey_weightmatrix.txt
similarity index 100%
copy from config/species/lamprey/lamprey_weightmatrix.txt
copy to config/species/japaneselamprey/japaneselamprey_weightmatrix.txt
diff --git a/config/species/schistosoma2/README.TXT b/config/species/schistosoma2/README.TXT
new file mode 100644
index 0000000..5cd918c
--- /dev/null
+++ b/config/species/schistosoma2/README.TXT
@@ -0,0 +1,7 @@
+- update of parameters and addition of UTR parameters to schistosoma: schistosoma2
+ nucleotide level 0.852 | 0.738
+ exon level 0.607 | 0.655
+ transcript level 0.115 | 0.116
+
+Decreased min_intron_len to 30 and ass_upwindow_size to 19:
+Schistosoma introns can be exceptionally short.
\ No newline at end of file
diff --git a/config/species/lamprey/lamprey_exon_probs.pbl b/config/species/sealamprey/sealamprey_exon_probs.pbl
similarity index 100%
rename from config/species/lamprey/lamprey_exon_probs.pbl
rename to config/species/sealamprey/sealamprey_exon_probs.pbl
diff --git a/config/species/lamprey/lamprey_igenic_probs.pbl b/config/species/sealamprey/sealamprey_igenic_probs.pbl
similarity index 100%
rename from config/species/lamprey/lamprey_igenic_probs.pbl
rename to config/species/sealamprey/sealamprey_igenic_probs.pbl
diff --git a/config/species/lamprey/lamprey_intron_probs.pbl b/config/species/sealamprey/sealamprey_intron_probs.pbl
similarity index 100%
rename from config/species/lamprey/lamprey_intron_probs.pbl
rename to config/species/sealamprey/sealamprey_intron_probs.pbl
diff --git a/config/species/lamprey/lamprey_metapars.cfg b/config/species/sealamprey/sealamprey_metapars.cfg
similarity index 100%
rename from config/species/lamprey/lamprey_metapars.cfg
rename to config/species/sealamprey/sealamprey_metapars.cfg
diff --git a/config/species/lamprey/lamprey_parameters.cfg b/config/species/sealamprey/sealamprey_parameters.cfg
similarity index 87%
rename from config/species/lamprey/lamprey_parameters.cfg
rename to config/species/sealamprey/sealamprey_parameters.cfg
index 00f9d7c..565a0c4 100644
--- a/config/species/lamprey/lamprey_parameters.cfg
+++ b/config/species/sealamprey/sealamprey_parameters.cfg
@@ -1,5 +1,5 @@
#
-# lamprey parameters (Petromyzon marinus)
+# sealamprey parameters (Petromyzon marinus)
# contributed by Falk Hildebrand and Shigehiro Kuraku
# based on the genome assembly (PMAR3.0) provided by the Genome Sequencing Center at
# Washington University School of Medicine (WUGSC) in St. Louis.
@@ -69,21 +69,21 @@ UTR off # predict untranslated regions
# type of weighing, one of 1 = equalWeights, 2 = gcContentClasses, 3 = multiNormalKernel
/BaseCount/weighingType 3
# file with the weight matrix (only for multiNormalKernel type weighing)
-/BaseCount/weightMatrixFile lamprey_weightmatrix.txt # change this to your species if at all neccessary
+/BaseCount/weightMatrixFile sealamprey_weightmatrix.txt # change this to your species if at all neccessary
# Properties for IGenicModel
# ----------------------------
/IGenicModel/verbosity 0
-/IGenicModel/infile lamprey_igenic_probs.pbl # change this and the other five filenames *_probs.pbl below to your species
-/IGenicModel/outfile lamprey_igenic_probs.pbl
+/IGenicModel/infile sealamprey_igenic_probs.pbl # change this and the other five filenames *_probs.pbl below to your species
+/IGenicModel/outfile sealamprey_igenic_probs.pbl
/IGenicModel/patpseudocount 5.0
/IGenicModel/k 4 # order of the Markov chain for content model, keep equal to /ExonModel/k
# Properties f�r ExonModel
# ----------------------------
/ExonModel/verbosity 3
-/ExonModel/infile lamprey_exon_probs.pbl
-/ExonModel/outfile lamprey_exon_probs.pbl
+/ExonModel/infile sealamprey_exon_probs.pbl
+/ExonModel/outfile sealamprey_exon_probs.pbl
/ExonModel/patpseudocount 5.0
/ExonModel/minPatSum 233.3
/ExonModel/k 4 # order of the Markov chain for content model
@@ -99,8 +99,8 @@ UTR off # predict untranslated regions
# Properties for IntronModel
# ----------------------------
/IntronModel/verbosity 0
-/IntronModel/infile lamprey_intron_probs.pbl
-/IntronModel/outfile lamprey_intron_probs.pbl
+/IntronModel/infile sealamprey_intron_probs.pbl
+/IntronModel/outfile sealamprey_intron_probs.pbl
/IntronModel/patpseudocount 5.0
/IntronModel/k 4 # order of the Markov chain for content model, keep equal to /ExonModel/k
/IntronModel/slope_of_bandwidth 0.4
@@ -108,7 +108,7 @@ UTR off # predict untranslated regions
/IntronModel/asspseudocount 0.007875
/IntronModel/dsspseudocount 0.0005
/IntronModel/dssneighborfactor 0.00071875
-#/IntronModel/splicefile lamprey_splicefile.txt # this optional file contains additional windows around splice sites for training, uncomment if you have one
+#/IntronModel/splicefile sealamprey_splicefile.txt # this optional file contains additional windows around splice sites for training, uncomment if you have one
/IntronModel/sf_with_motif false # if true the splice file is also used to train the branch point region
/IntronModel/d 100
/IntronModel/ass_motif_memory 3
@@ -117,8 +117,8 @@ UTR off # predict untranslated regions
# Properties for UtrModel
# ----------------------------
/UtrModel/verbosity 3
-/UtrModel/infile lamprey_utr_probs.pbl
-/UtrModel/outfile lamprey_utr_probs.pbl
+/UtrModel/infile sealamprey_utr_probs.pbl
+/UtrModel/outfile sealamprey_utr_probs.pbl
/UtrModel/k 4
/UtrModel/utr5patternweight 0
/UtrModel/utr3patternweight 1.0
diff --git a/config/species/lamprey/lamprey_weightmatrix.txt b/config/species/sealamprey/sealamprey_weightmatrix.txt
similarity index 100%
rename from config/species/lamprey/lamprey_weightmatrix.txt
rename to config/species/sealamprey/sealamprey_weightmatrix.txt
diff --git a/docs/espoca/README b/docs/espoca/README
new file mode 100644
index 0000000..b159ce4
--- /dev/null
+++ b/docs/espoca/README
@@ -0,0 +1,52 @@
+ESPOCA - Estimate Selective Pressure on Codon Alignments
+
+This directory contains example input files:
+example.fa codon alignment file in multi fasta format
+tree.nwk phylogenetik tree file in newick format with branch length
+
+Example Command:
+
+espoca --species=fly --alnfile=example.fa --treefile=tree.nwk
+
+Output:
+
+#
+# ESPOCA - Estimate Selective Preassure on Codon Alignments.
+#
+# Description of the table columns:
+# ali_pos ref_pos AS_ref Pr(w>1) post_mean +- SE_for_w num_subst
+# 1. ali_pos position of codon site in the alignment
+# 2. ref_pos position of codon in reference species (first species in the alignment file), -1 if gap in reference
+# 3. AS_ref amino acid of reference sequence at ref_pos
+# 4. Pr(w>1) probability of omega > 1 at alipos (*: Pr(w>1) > 0.90, **: Pr(w>1) > 0.95)
+# 5. post_mean posterior mean estimate of omega at ali_pos
+# 6. SE_for_w standard deviation of omega at ali_pos
+# 7. num_subst number of subsitution calculated by the Fitch algorithm
+
+ ali_pos ref_pos AS_ref Pr(w>1) post_mean +- SE_for_w num_subst
+ 0 0 M 0.249188 0.814206 +- 0.362779 0
+ 1 1 I 0.489331 1.22654 +- 0.606094 0
+ 2 2 M 0.278273 0.865713 +- 0.391453 0
+ 3 -1 - 0.375208 1.02205 +- 0.387321 2
+ 4 -1 - 0.510076 1.22844 +- 0.484266 3
+ 5 -1 - 0.520523 1.27867 +- 0.620131 1
+ 6 -1 - 0.42937 1.12316 +- 0.538455 0
+ 7 -1 - 0.479403 1.20924 +- 0.595183 0
+ 8 3 M 0.249188 0.814206 +- 0.362779 0
+ 9 4 I 0.495239 1.23701 +- 0.613456 0
+ 10 5 M 0.270909 0.852741 +- 0.384469 0
+ 11 6 M 0.249188 0.814206 +- 0.362779 0
+ 12 7 L 0.592153 1.41444 +- 0.726155 0
+ 13 8 L 0.556823 1.34642 +- 0.677838 0
+ 14 9 Y 0.286488 0.879981 +- 0.3289 1
+ 15 10 L 0.556823 1.34642 +- 0.677838 0
+ 16 11 A 0.48803 1.22396 +- 0.594927 1
+ 17 12 K 0.475777 1.20248 +- 0.578938 1
+ 18 13 N 0.417649 1.10366 +- 0.53543 0
+ 19 -1 - 0.489014 1.22646 +- 0.609409 0
+ 20 14 * 0.604201 1.18131 +- 0.528847 0
+
+# posterior mean estimate of omega for whole alignment : 0.543365
+# total time: 4.73954s
+# command line:
+# espoca --species=fly --alnfile=example.fa --treefile=tree.nwk
diff --git a/docs/espoca/example.fa b/docs/espoca/example.fa
new file mode 100644
index 0000000..00d234d
--- /dev/null
+++ b/docs/espoca/example.fa
@@ -0,0 +1,25 @@
+>dmoj
+atgattatg---------------atgattatgatgttgttatacttagcgaagaac---tag
+>dvir
+atgattatg---------------atgattatgatgttgttatacttagagaacaac---tag
+>dgri
+atgattatg---------------atgattatgatgttgttatacttagagaacaac---tag
+>dmel
+atgattatgatcgcgaatatgattatgattatgatgttgttatatttagagaacaacgaatag
+>dsim
+atgattatgatcgcgaatatgattatgattatgatgttgttatatttagagaacaacgaatag
+>dsec
+atgattatgatcgcgaatatgattatgattatgatgttgttatatttagagaacaacgaatag
+>dere
+atgattatgatcacgaatatgattatgattatgatgttgttatatttagagaacaacgaatag
+>dyak
+atgattatgatcacgagtatgattatgattatgatgttgttatatttagagaacaacgaatag
+>dana
+atgattatgattacg------attatgattatgatgttgttatatttagagaacaacgaatag
+>dpse
+atgattatgattgcg------attatgatt---atgttgttatatttagagaacaacgaatag
+>dper
+atgattatgattgcg------attatgatt---atgttgttatatttagagaacaacgaatag
+>dwil
+atg------actgaa------attatgattatgatgttgttatatttagagaacaacgaatag
+
diff --git a/docs/espoca/tree.nwk b/docs/espoca/tree.nwk
new file mode 100644
index 0000000..8c679e8
--- /dev/null
+++ b/docs/espoca/tree.nwk
@@ -0,0 +1 @@
+(((dmoj:0.25614,dvir:0.18990):0.07899,dgri:0.26011):0.23315,((((dmel:0.03950,(dsim:0.01469,dsec:0.01884):0.02436):0.05146,(dere:0.07535,dyak:0.07325):0.02924):0.21132,dana:0.29141):0.11754,(dpse:0.00907,dper:0.01259):0.27622):0.11258,dwil:0.40988);
diff --git a/include/codonMSA.hh b/include/codonMSA.hh
new file mode 100644
index 0000000..872df34
--- /dev/null
+++ b/include/codonMSA.hh
@@ -0,0 +1,40 @@
+/**********************************************************************
+ * file: codonMSA.hh
+ * licence: Artistic Licence, see file LICENCE.TXT or
+ * http://www.opensource.org/licenses/artistic-license.php
+ * descr.: datastructure for the codon alignment
+ * author: Lizzy Gerischer
+ *
+ * date | author | changes
+ * --------|--------------------|------------------------------------------
+ * 14.07.16| Lizzy Gerischer | creation of the file
+ **********************************************************************/
+
+
+#ifndef _CODONMSA
+#define _CODONMSA
+
+#include <fstream>
+
+#include "properties.hh"
+#include "phylotree.hh"
+#include "contTimeMC.hh"
+
+class CodonMSA{
+public:
+ CodonMSA(string filename);
+ ~CodonMSA(){
+ delete ctree;
+ }
+
+ void readAlignment(string filename);
+ void printOmegaStats();
+
+ vector<string> aliRows;
+ vector<string> speciesNames;
+ size_t aliLen;
+ CodonEvo codonevo;
+ PhyloTree* ctree;
+};
+
+#endif
diff --git a/include/contTimeMC.hh b/include/contTimeMC.hh
index d077b29..aaf74f5 100644
--- a/include/contTimeMC.hh
+++ b/include/contTimeMC.hh
@@ -35,7 +35,7 @@ using namespace std;
*/
class Evo {
public:
- Evo(int s) : states(s), m(0) {};
+ Evo(int s) : states(s), m(0), pi(NULL) {};
virtual ~Evo();
int getNumStates(){return states;}
@@ -112,7 +112,7 @@ public:
double getOmega(int u){return omegas[u];}
int getK(){ return k;}
void printOmegas();
-
+ void setAAPostProbs();
void computeLogPmatrices(); // precomputes and stores the array of matrices
/*
@@ -166,6 +166,8 @@ private:
double kappa;
vector<double> omegas; // sorted vector of omegas (contains values below, around and above 1)
vector<double> omegaPrior; // prior distribution on omega, centered at 1
+ vector<double> aaUsage; // amino acid usage for incorporation into rate matrix
+ vector<vector<double> > aaPostProb; // retreived from BLOSUM (amino acid substitution rate matrix)
};
/*
@@ -174,7 +176,10 @@ private:
gsl_matrix *getCodonRateMatrix(double *pi, // codon usage, normalized vector with 64 elements
double omega, // dN/dS, nonsynonymous/synonymous ratio
- double kappa); // transition/transversion ratio, usually >1
+ double kappa, // transition/transversion ratio, usually >1
+ vector<vector<double> > *aaPostProb = NULL); // posterior probs for AA substitutions
+
+gsl_matrix *getNonCodingRateMatrix(vector<double> *pi_nuc, double kappa); // rate matrix for non-coding model
/*
* perform a decompososition of the rate matrix as Q = U * diag(lambda) * U^{-1}
diff --git a/include/geneMSA.hh b/include/geneMSA.hh
index 70f253d..f79b4b1 100644
--- a/include/geneMSA.hh
+++ b/include/geneMSA.hh
@@ -1,5 +1,5 @@
/**********************************************************************
- * file: genomicMSA.hh
+ * file: geneMSA.hh
* licence: Artistic Licence, see file LICENCE.TXT or
* http://www.opensource.org/licenses/artistic-license.php
* descr.: multiple sequence alignment of genomes for comparative gene prediction
@@ -96,7 +96,10 @@ public:
void printOrthoExons(list<OrthoExon> &orthoExonsList);
void computeOmegas(list<OrthoExon> &orthoExonsList, vector<AnnoSequence*> const &seqRanges, PhyloTree *ctree);
void computeOmegasEff(list<OrthoExon> &orthoExonsList, vector<AnnoSequence*> const &seqRanges, PhyloTree *ctree, ofstream *codonAli);
- vector<string> pruneToBV(vector<string> *cs, bit_vector bv);
+ vector<string> pruneToBV(vector<string> *cs, bit_vector bv); // prune codon strings to bit_vector
+ vector<int> pruneToBV(vector<int> *rfc, bit_vector bv); // prune RFC to bit_vector
+ double omegaForCodonTuple(vector<double> *loglik);
+ void printOmegaForCodon(string outdir);
void printCumOmega();
void comparativeSignalScoring(list<OrthoExon> &orthoExonsList);
// Charlotte Janas playground
@@ -141,6 +144,7 @@ private:
vector< list<ExonCandidate*>* > exoncands; // exon candidates found in the different species in a gene segment
//list<OrthoExon> orthoExonsList; // Steffi: due to multiple copying, I remove this as attribute of any class. Instead it can be passed from compgenepred.cc by reference, whenever necessary.
unordered_map<bit_vector, vector<pair<vector<int>, cumValues> >, boost::hash<bit_vector> > cumOmega; // stores cumulative omega values for every reading frame combination and every bitvector that exist
+ map<bit_vector, map<vector<int>, vector<double> > > codonOmega;
};
diff --git a/include/igenicmodel.hh b/include/igenicmodel.hh
index 9f08deb..d6f34f1 100644
--- a/include/igenicmodel.hh
+++ b/include/igenicmodel.hh
@@ -40,7 +40,6 @@ public:
void buildModel ( const AnnoSequence* annoseq, int parIndex );
void registerPars ( Parameters* parameters);
void printProbabilities ( int zusNumber, BaseCount *bc, const char* suffix = NULL );
-
void initAlgorithms ( Matrix<Double>&, int);
void viterbiForwardAndSampling(ViterbiMatrixType&, ViterbiMatrixType&, int, int,
AlgorithmVariant, OptionListItem&);
@@ -55,6 +54,8 @@ public:
static void readAllParameters();
static void storeGCPars(int idx);
static double getGeoProb(){return geoProb;}
+ static vector<double> getNucleotideProbs(){return nucProbs[0];}
+
private:
void processSequence( const char* start, const char* end );
public:
@@ -68,6 +69,7 @@ private:
static vector<Integer> emicount;
static vector<vector<Double> > Pls;
static vector<vector<Double> >* GCPls;
+ static vector<vector<double> > nucProbs;
static int lastParIndex; // GC-index of current parameter set
static int verbosity;
static double geoProb;
diff --git a/include/orthoexon.hh b/include/orthoexon.hh
index 460dad8..df932e7 100644
--- a/include/orthoexon.hh
+++ b/include/orthoexon.hh
@@ -35,8 +35,10 @@ public:
double getOmega() const { return omega; }
double getEomega() const { return Eomega; }
double getVarOmega() const { return VarOmega; }
- double getLeftOmega() const { return leftBoundaryOmega;}
- double getRightOmega() const { return rightBoundaryOmega;}
+ double getLeftExtOmega() const { return leftBoundaryExtOmega;}
+ double getRightExtOmega() const { return rightBoundaryExtOmega;}
+ double getLeftIntOmega() const { return leftBoundaryIntOmega;}
+ double getRightIntOmega() const { return rightBoundaryIntOmega;}
double getSubst() const { return subst; }
double getConsScore() const {return cons;}
double getLeftConsScore() const {return leftCons;}
@@ -94,9 +96,11 @@ private:
double omega;
double Eomega;
double VarOmega;
- double leftBoundaryOmega;
- double rightBoundaryOmega;
- vector<double> loglikOmegas;
+ double leftBoundaryExtOmega;
+ double rightBoundaryExtOmega;
+ double leftBoundaryIntOmega;
+ double rightBoundaryIntOmega;
+ list<vector<double> > loglikOmegaStarts;
int intervalCount;
int subst;
double cons; // conservation score
diff --git a/include/properties.hh b/include/properties.hh
index 9547032..7134963 100644
--- a/include/properties.hh
+++ b/include/properties.hh
@@ -29,7 +29,7 @@
#endif
-#define NUMPARNAMES 251
+#define NUMPARNAMES 254
#define GENEMODEL_KEY "genemodel"
#define NONCODING_KEY "nc"
@@ -48,6 +48,7 @@
#define TREE_KEY "treefile"
#define DB_KEY "dbaccess"
#define SEQ_KEY "speciesfilenames"
+#define CODONALN_KEY "codonAlignmentFile"
#define OVLPLENFILE "ovlp_len.pbl"
/**
diff --git a/include/sqliteDB.hh b/include/sqliteDB.hh
index a220ad7..14994a1 100644
--- a/include/sqliteDB.hh
+++ b/include/sqliteDB.hh
@@ -48,7 +48,12 @@ public:
void createTableSeqnames();
void createTableHints();
void createTableFeatureTypes();
- int getSpeciesID(string species);
+ int getSpeciesID(string species, bool clean=false, bool noInsert=false);
+
+ void deleteHints(int speciesid);
+ void deleteGenome(int speciesid);
+ void deleteSeqNames(int speciesid);
+
void beginTransaction();
void endTransaction();
diff --git a/include/types.hh b/include/types.hh
index 4acc741..3a85e36 100644
--- a/include/types.hh
+++ b/include/types.hh
@@ -66,7 +66,7 @@ ostream& operator<< (ostream& strm, const Strand s);
#define MODEL_SUBDIR "model/"
#define EXTRINSIC_SUBDIR "extrinsic/"
-#define VERSION "3.2.2"
+#define VERSION "3.2.3"
#define PREAMBLE "# This output was generated with AUGUSTUS (version " VERSION ").\n\
# AUGUSTUS is a gene prediction tool written by M. Stanke (mario.stanke at uni-greifswald.de),\n\
@@ -310,6 +310,7 @@ public:
static string speciesfilenames; // file name to file which contains the names of species and the corresponding file names
static string dbaccess; // comma separated string with database access (hostname, database name, table name, user, passwd
static string alnfile; // name of file that contains MSA of genomes
+ static string codonalnfile; // name of file that contains MSA of codon sequences
static bool overlapmode; // whether overlapping exons are allowed in Viterbi algorithm
static Boolean printOEs; //output ortho exons to file
static Integer maxOvlp; // parameters for overlapping coding regions in bacteria
@@ -326,6 +327,8 @@ public:
static vector<double> lg_es;
static int oeExtensionWidth;
static bool computeNumSubs;
+ static bool useAArates;
+ static bool useNonCodingModel;
};
diff --git a/mansrc/aln2wig.1 b/mansrc/aln2wig.1
new file mode 100644
index 0000000..9cf7461
--- /dev/null
+++ b/mansrc/aln2wig.1
@@ -0,0 +1,47 @@
+'\" t
+.\" Title: aln2wig
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "ALN2WIG" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+aln2wig \- convert alignments to wig files
+.SH "SYNOPSIS"
+.sp
+\fBaln2wig\fP [parameters] \-f filename
+.SH "OPTIONS"
+.sp
+\fB\-f\fP
+.RS 4
+Input filename (in psl or shrimp format)
+.RE
+.sp
+\fB\-s\fP
+.RS 4
+Use span notation
+.RE
+.sp
+\fB\-t\fP
+.RS 4
+Name of the track
+.RE
+.SH "AUTHORS"
+.sp
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+.SH "ADDITIONAL DOCUMENTATION"
+.sp
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
\ No newline at end of file
diff --git a/mansrc/aln2wig.1.adoc b/mansrc/aln2wig.1.adoc
new file mode 100644
index 0000000..42d5059
--- /dev/null
+++ b/mansrc/aln2wig.1.adoc
@@ -0,0 +1,29 @@
+# aln2wig(1)
+
+## NAME
+
+aln2wig - convert alignments to wig files
+
+## SYNOPSIS
+
+*aln2wig* [parameters] -f filename
+
+## OPTIONS
+
+*-f*::
+ Input filename (in psl or shrimp format)
+
+*-s*::
+ Use span notation
+
+*-t*::
+ Name of the track
+
+## AUTHORS
+
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+
+## ADDITIONAL DOCUMENTATION
+
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
+
diff --git a/mansrc/augustus.1 b/mansrc/augustus.1
new file mode 100644
index 0000000..e10fcd2
--- /dev/null
+++ b/mansrc/augustus.1
@@ -0,0 +1,180 @@
+'\" t
+.\" Title: augustus
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "AUGUSTUS" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+augustus \- a gene prediction tool
+.SH "SYNOPSIS"
+.sp
+\fBaugustus\fP [parameters] \-\-species=SPECIES queryfilename
+.SH "OPTIONS"
+.sp
+The mandatory option \(aqqueryfilename\(aq specifies the filename (including relative path) to the file containing the query sequence(s) in FASTA format.
+.sp
+SPECIES is an identifier for the species. Use \fB\-\-species=help\fP to see a list.
+.SS "Further parameters:"
+.sp
+\fB\-\-strand=both\fP, \fB\-\-strand=forward\fP or \fB\-\-strand=backward\fP
+.RS 4
+define the strand to search on
+.RE
+.sp
+\fB\-\-genemodel=genemodel\fP
+.RS 4
+where genemodel is one of:
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+partial \- allow prediction of incomplete genes at the sequence boundaries (default)
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+intronless \- only predict single\-exon genes like in prokaryotes and some eukaryotes
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+complete \- only predict complete genes
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+atleastone \- predict at least one complete gene
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+exactlyone \- predict exactly one complete gene
+.RE
+.RE
+.sp
+\fB\-\-singlestrand=true\fP
+.RS 4
+predict genes independently on each strand, allow overlapping genes on opposite strands.
+This option is turned off by default.
+.RE
+.sp
+*\-\-hintsfile=hintsfilenam*e
+.RS 4
+When this option is used the prediction considering hints (extrinsic information) is turned on.
+hintsfilename contains the hints in gff format.
+.RE
+.sp
+\fB\-\-AUGUSTUS_CONFIG_PATH=path\fP
+.RS 4
+path to config directory (if not specified as environment variable)
+.RE
+.sp
+\fB\-\-alternatives\-from\-evidence=true/false\fP
+.RS 4
+report alternative transcripts when they are suggested by hints
+.RE
+.sp
+\fB\-\-alternatives\-from\-sampling=true/false\fP
+.RS 4
+report alternative transcripts generated through probabilistic sampling
+.RE
+.sp
+\fB\-\-maxtracks=n\fP
+.RS 4
+For a description of these parameters see section 4 of README.TXT.
+.RE
+.sp
+\fB\-\-proteinprofile=filename\fP
+.RS 4
+When this option is used the prediction will consider the protein profile provided as parameter.
+The protein profile extension is described in section 7 of README.TXT.
+.RE
+.sp
+\fB\-\-progress=true\fP
+.RS 4
+show a progressmeter
+.RE
+.sp
+\fB\-\-gff3=on/off\fP
+.RS 4
+output in gff3 format
+.RE
+.sp
+\fB\-\-predictionStart=A\fP, \fB\-\-predictionEnd=B\fP
+.RS 4
+A and B define the range of the sequence for which predictions should be found.
+.RE
+.sp
+\fB\-\-UTR=on/off\fP
+.RS 4
+predict the untranslated regions in addition to the coding sequence. This currently works only for a subset of species.
+.RE
+.sp
+\fB\-\-noInFrameStop=true/false\fP
+.RS 4
+Do not report transcripts with in\-frame stop codons. Otherwise, intron\-spanning stop codons could occur. Default: false
+.RE
+.sp
+\fB\-\-noprediction=true/false\fP
+.RS 4
+If true and input is in genbank format, no prediction is made. Useful for getting the annotated protein sequences.
+.RE
+.sp
+\fB\-\-uniqueGeneId=true/false\fP
+.RS 4
+If true, output gene identifyers like this: seqname.gN
+.RE
+.sp
+\fB\-\-paramlist\fP
+.RS 4
+Show full list of supported parameters.
+.RE
+.SH "AUTHORS"
+.sp
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+.SH "ADDITIONAL DOCUMENTATION"
+.sp
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
\ No newline at end of file
diff --git a/mansrc/augustus.1.adoc b/mansrc/augustus.1.adoc
new file mode 100644
index 0000000..0039e37
--- /dev/null
+++ b/mansrc/augustus.1.adoc
@@ -0,0 +1,85 @@
+# augustus(1)
+
+## NAME
+
+augustus - a gene prediction tool
+
+## SYNOPSIS
+
+*augustus* [parameters] --species=SPECIES queryfilename
+
+## OPTIONS
+
+The mandatory option 'queryfilename' specifies the filename (including relative path) to the file containing the query sequence(s) in FASTA format.
+
+SPECIES is an identifier for the species. Use *--species=help* to see a list.
+
+### Further parameters:
+
+*--strand=both*, *--strand=forward* or *--strand=backward*::
+ define the strand to search on
+
+*--genemodel=genemodel*::
+ where genemodel is one of:
+ - partial - allow prediction of incomplete genes at the sequence boundaries (default)
+ - intronless - only predict single-exon genes like in prokaryotes and some eukaryotes
+ - complete - only predict complete genes
+ - atleastone - predict at least one complete gene
+ - exactlyone - predict exactly one complete gene
+
+*--singlestrand=true*::
+ predict genes independently on each strand, allow overlapping genes on opposite strands.
+ This option is turned off by default.
+
+*--hintsfile=hintsfilenam*e::
+ When this option is used the prediction considering hints (extrinsic information) is turned on.
+ hintsfilename contains the hints in gff format.
+
+*--AUGUSTUS_CONFIG_PATH=path*::
+ path to config directory (if not specified as environment variable)
+
+*--alternatives-from-evidence=true/false*::
+ report alternative transcripts when they are suggested by hints
+
+*--alternatives-from-sampling=true/false*::
+ report alternative transcripts generated through probabilistic sampling
+
+*--maxtracks=n*::
+ For a description of these parameters see section 4 of README.TXT.
+
+*--proteinprofile=filename*::
+ When this option is used the prediction will consider the protein profile provided as parameter.
+ The protein profile extension is described in section 7 of README.TXT.
+
+*--progress=true*::
+ show a progressmeter
+
+*--gff3=on/off*::
+ output in gff3 format
+
+*--predictionStart=A*, *--predictionEnd=B*::
+ A and B define the range of the sequence for which predictions should be found.
+
+*--UTR=on/off*::
+ predict the untranslated regions in addition to the coding sequence. This currently works only for a subset of species.
+
+*--noInFrameStop=true/false*::
+ Do not report transcripts with in-frame stop codons. Otherwise, intron-spanning stop codons could occur. Default: false
+
+*--noprediction=true/false*::
+ If true and input is in genbank format, no prediction is made. Useful for getting the annotated protein sequences.
+
+*--uniqueGeneId=true/false*::
+ If true, output gene identifyers like this: seqname.gN
+
+*--paramlist*::
+ Show full list of supported parameters.
+
+## AUTHORS
+
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+
+## ADDITIONAL DOCUMENTATION
+
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
+
diff --git a/mansrc/bam2hints.1 b/mansrc/bam2hints.1
new file mode 100644
index 0000000..a8f6d11
--- /dev/null
+++ b/mansrc/bam2hints.1
@@ -0,0 +1,120 @@
+'\" t
+.\" Title: bam2hints
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "BAM2HINTS" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+bam2hints \- convert mRNA\-to\-genome alignments in BAM format into a hint file for AUGUSTUS
+.SH "SYNOPSIS"
+.sp
+\fBbam2hints\fP [parameters] \-\-in=example.bam \-\-out=hints.gff
+.SH "OPTIONS"
+.sp
+The input BAM file must be sorted by target (=genome) sequence names and within the sequences by begin coordinates.
+.SS "Parameters:"
+.sp
+\fB\-\-priority=n\fP/\fB\-p\fP
+.RS 4
+priority of hint group (set to 4)
+.RE
+.sp
+\fB\-\-maxgaplen=n\fP/\fB\-g\fP
+.RS 4
+gaps at most this length are simply closed (set to 14)
+.RE
+.sp
+\fB\-\-minintronlen=n\fP/\fB\-m\fP
+.RS 4
+alignments with gaps shorter than this and longer than maxgaplen are discarded (set to 32)
+.RE
+.sp
+\fB\-\-maxintronlen=n\fP/\fB\-M\fP
+.RS 4
+alignments with longer gaps are discarded (set to 350000)
+.RE
+.sp
+\fB\-\-MinEndBlockLen=n\fP/\fB\-b\fP
+.RS 4
+minimum length of a \(aqdangling\(aq exon (set to 8)
+.RE
+.sp
+\fB\-\-maxQgaplen=n\fP/\fB\-q\fP
+.RS 4
+maximum length of gap in query (cDNA) sequence (set to 5)
+.RE
+.sp
+\fB\-\-exonhints\fP/\fB\-x\fP
+.RS 4
+compute exonpart, exon and splice site hints in addition to intron hints (set to 0=Off). You should generate exonpart hints from RNA\-Seq using wiggle (.wig) input to wig2hints.
+.RE
+.sp
+\fB\-\-ep_cutoff=n\fP/\fB\-e\fP
+.RS 4
+this many bp are cut off of each exonpart hint at end of alignment (set to 10)
+.RE
+.sp
+\fB\-\-source=s\fP/\fB\-s\fP
+.RS 4
+source identifier (set to \(aqE\(aq)
+.RE
+.sp
+\fB\-\-intronsonly\fP/\fB\-I\fP
+.RS 4
+only retrieve intron hints (e.g. because the exon(part) hints are retrieved by converting to a wig track, set to 1=On). Deprecated as this is the default now.
+.RE
+.sp
+\fB\-\-nomult\fP/\fB\-n\fP
+.RS 4
+do not summarize multiple identical intron hints to a single one (set to 0=Off)
+.RE
+.sp
+\fB\-\-remove_redundant\fP/\fB\-r\fP
+.RS 4
+only keep the strongest hint for a region (set to 0=Off)
+.RE
+.sp
+\fB\-\-maxcoverage=n\fP/\fB\-C\fP
+.RS 4
+maximal number of hints at a given position (0: filtering deactivated). A high value causes long running time of AUGUSTUS in regions with thousands of cDNA alignments. (set to 0)
+.RE
+.sp
+\fB\-\-ssOn\fP/\fB\-S\fP
+.RS 4
+include splice site (dss, ass) hints in output (set to 0=Off)
+.RE
+.sp
+\fB\-\-trunkSS\fP/\fB\-T\fP
+.RS 4
+include splice sites hints from the ends of a truncated alignment (contig too short, set to 0=Off)
+.RE
+.sp
+\fB\-\-score=f\fP/\fB\-s\fP
+.RS 4
+fill this number in in the score column (set to 0)
+.RE
+.sp
+\fB\-\-maxgenelen=n\fP/\fB\-G\fP
+.RS 4
+alignments of the same clone are considered to be of the same gene if not separeted by more than this (set to 400000). Alignments that span more than this are ignored, but better filter long introns through an alignment program.
+.RE
+.SH "AUTHORS"
+.sp
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+.SH "ADDITIONAL DOCUMENTATION"
+.sp
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
\ No newline at end of file
diff --git a/mansrc/bam2hints.1.adoc b/mansrc/bam2hints.1.adoc
new file mode 100644
index 0000000..787fdc0
--- /dev/null
+++ b/mansrc/bam2hints.1.adoc
@@ -0,0 +1,75 @@
+# bam2hints(1)
+
+## NAME
+
+bam2hints - convert mRNA-to-genome alignments in BAM format into a hint file for AUGUSTUS
+
+## SYNOPSIS
+
+*bam2hints* [parameters] --in=example.bam --out=hints.gff
+
+## OPTIONS
+
+The input BAM file must be sorted by target (=genome) sequence names and within the sequences by begin coordinates.
+
+### Parameters:
+
+*--priority=n*/*-p*::
+ priority of hint group (set to 4)
+
+*--maxgaplen=n*/*-g*::
+ gaps at most this length are simply closed (set to 14)
+
+*--minintronlen=n*/*-m*::
+ alignments with gaps shorter than this and longer than maxgaplen are discarded (set to 32)
+
+*--maxintronlen=n*/*-M*::
+ alignments with longer gaps are discarded (set to 350000)
+
+*--MinEndBlockLen=n*/*-b*::
+ minimum length of a 'dangling' exon (set to 8)
+
+*--maxQgaplen=n*/*-q*::
+ maximum length of gap in query (cDNA) sequence (set to 5)
+
+*--exonhints*/*-x*::
+ compute exonpart, exon and splice site hints in addition to intron hints (set to 0=Off). You should generate exonpart hints from RNA-Seq using wiggle (.wig) input to wig2hints.
+
+*--ep_cutoff=n*/*-e*::
+ this many bp are cut off of each exonpart hint at end of alignment (set to 10)
+
+*--source=s*/*-s*::
+ source identifier (set to 'E')
+
+*--intronsonly*/*-I*::
+ only retrieve intron hints (e.g. because the exon(part) hints are retrieved by converting to a wig track, set to 1=On). Deprecated as this is the default now.
+
+*--nomult*/*-n*::
+ do not summarize multiple identical intron hints to a single one (set to 0=Off)
+
+*--remove_redundant*/*-r*::
+ only keep the strongest hint for a region (set to 0=Off)
+
+*--maxcoverage=n*/*-C*::
+ maximal number of hints at a given position (0: filtering deactivated). A high value causes long running time of AUGUSTUS in regions with thousands of cDNA alignments. (set to 0)
+
+*--ssOn*/*-S*::
+ include splice site (dss, ass) hints in output (set to 0=Off)
+
+*--trunkSS*/*-T*::
+ include splice sites hints from the ends of a truncated alignment (contig too short, set to 0=Off)
+
+*--score=f*/*-s*::
+ fill this number in in the score column (set to 0)
+
+*--maxgenelen=n*/*-G*::
+ alignments of the same clone are considered to be of the same gene if not separeted by more than this (set to 400000). Alignments that span more than this are ignored, but better filter long introns through an alignment program.
+
+## AUTHORS
+
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+
+## ADDITIONAL DOCUMENTATION
+
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
+
diff --git a/mansrc/checkTargetSortedness.1 b/mansrc/checkTargetSortedness.1
new file mode 100644
index 0000000..7fc92df
--- /dev/null
+++ b/mansrc/checkTargetSortedness.1
@@ -0,0 +1,35 @@
+'\" t
+.\" Title: checktargetsortedness
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "CHECKTARGETSORTEDNESS" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+checktargetsortedness \- check BAM file for sortedness
+.SH "SYNOPSIS"
+.sp
+\fBcheckTargetSortedness\fP infile.bam
+.SH "OPTIONS"
+.sp
+\(aqinfile.bam\(aq is the name of the BAM file to check for sortedness. The program will output a
+short message describing the sortedness status of the file.
+.SH "AUTHORS"
+.sp
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+.SH "ADDITIONAL DOCUMENTATION"
+.sp
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
\ No newline at end of file
diff --git a/mansrc/checkTargetSortedness.1.adoc b/mansrc/checkTargetSortedness.1.adoc
new file mode 100644
index 0000000..7c6873c
--- /dev/null
+++ b/mansrc/checkTargetSortedness.1.adoc
@@ -0,0 +1,23 @@
+# checkTargetSortedness(1)
+
+## NAME
+
+checkTargetSortedness - check BAM file for sortedness
+
+## SYNOPSIS
+
+*checkTargetSortedness* infile.bam
+
+## OPTIONS
+
+'infile.bam' is the name of the BAM file to check for sortedness. The program will output a
+short message describing the sortedness status of the file.
+
+## AUTHORS
+
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+
+## ADDITIONAL DOCUMENTATION
+
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
+
diff --git a/mansrc/consensusFinder.1 b/mansrc/consensusFinder.1
new file mode 100644
index 0000000..b62f55b
--- /dev/null
+++ b/mansrc/consensusFinder.1
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: consensusfinder
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "CONSENSUSFINDER" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+consensusfinder \- consensus finder
+.SH "SYNOPSIS"
+.sp
+\fBconsensusFinder\fP input_fasta_file [options]
+.SH "OPTIONS"
+.sp
+\fB\-l\fP
+.RS 4
+pattern length
+.RE
+.sp
+\fB\-p\fP
+.RS 4
+p\-value for finding the significant strings
+.RE
+.sp
+\fB\-d\fP
+.RS 4
+delta to find the relevant strings
+.RE
+.sp
+\fB\-s\fP
+.RS 4
+starting position
+.RE
+.sp
+\fB\-e\fP
+.RS 4
+ending position
+.RE
+.sp
+\fB\-m\fP
+.RS 4
+no. of mismatches to consider while finding neighbours
+.RE
+.sp
+\fB\-c\fP
+.RS 4
+string to consider for analysis
+.RE
+.sp
+\fB\-n\fP
+.RS 4
+specify the number of consensus patterns to store
+.RE
+.sp
+\fB\-t\fP
+.RS 4
+print the histogram
+.RE
+.SH "AUTHORS"
+.sp
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+.SH "ADDITIONAL DOCUMENTATION"
+.sp
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
\ No newline at end of file
diff --git a/mansrc/consensusFinder.1.adoc b/mansrc/consensusFinder.1.adoc
new file mode 100644
index 0000000..6610fd4
--- /dev/null
+++ b/mansrc/consensusFinder.1.adoc
@@ -0,0 +1,47 @@
+# consensusFinder(1)
+
+## NAME
+
+consensusFinder - consensus finder
+
+## SYNOPSIS
+
+*consensusFinder* input_fasta_file [options]
+
+## OPTIONS
+
+*-l*::
+ pattern length
+
+*-p*::
+ p-value for finding the significant strings
+
+*-d*::
+ delta to find the relevant strings
+
+*-s*::
+ starting position
+
+*-e*::
+ ending position
+
+*-m*::
+ no. of mismatches to consider while finding neighbours
+
+*-c*::
+ string to consider for analysis
+
+*-n*::
+ specify the number of consensus patterns to store
+
+*-t*::
+ print the histogram
+
+## AUTHORS
+
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+
+## ADDITIONAL DOCUMENTATION
+
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
+
diff --git a/mansrc/curve2hints.1 b/mansrc/curve2hints.1
new file mode 100644
index 0000000..a22e6ce
--- /dev/null
+++ b/mansrc/curve2hints.1
@@ -0,0 +1,77 @@
+'\" t
+.\" Title: curve2hints
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "CURVE2HINTS" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+curve2hints \- tool to make exon segmentation and grouping the exons together to form AUGUSTUS hints
+.SH "SYNOPSIS"
+.sp
+\fBcurve2hints\fP \-\-in=file \-\-outexons=out.gff \-\-c=int \-\-s=float
+.SH "OPTIONS"
+.sp
+\fB\-\-in=s\fP
+.RS 4
+iput file is single file containing tracks in wig format
+.RE
+.sp
+\fB\-\-outexons=s\fP
+.RS 4
+file for the output segmentaion
+.RE
+.sp
+\fB\-\-c\fP
+.RS 4
+specify the threshold to distinguish between introns and exons in terms of coverage depths (default 4)
+.RE
+.sp
+\fB\-\-s\fP
+.RS 4
+specify the ratio \fB(1\-lambda1)/(1\-lambda2)\fP It should be >1 (default 1.12)
+.RE
+.sp
+\fB\-\-z\fP
+.RS 4
+specify the chunk size (default value 50000)
+.RE
+.sp
+\fB\-\-r\fP
+.RS 4
+To enable re\-estimation of distribution from the output produced
+.RE
+.sp
+\fB\-\-train_file\fP
+.RS 4
+Specify the gff file to be used for training the distributions.It should contain the position of both introns and exons
+.RE
+.sp
+\fB\-\-bed_file\fP
+.RS 4
+Specify the output bedfile which contains the position of gene jumps (default: output.bed)
+.RE
+.sp
+\fB\-\-augustus_hints\fP
+.RS 4
+Specify the output augustus hint file(default: augustus_hints.gff)
+.RE
+.SH "AUTHORS"
+.sp
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+.SH "ADDITIONAL DOCUMENTATION"
+.sp
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
\ No newline at end of file
diff --git a/mansrc/curve2hints.1.adoc b/mansrc/curve2hints.1.adoc
new file mode 100644
index 0000000..22bee26
--- /dev/null
+++ b/mansrc/curve2hints.1.adoc
@@ -0,0 +1,47 @@
+# curve2hints(1)
+
+## NAME
+
+curve2hints - tool to make exon segmentation and grouping the exons together to form AUGUSTUS hints
+
+## SYNOPSIS
+
+*curve2hints* --in=file --outexons=out.gff --c=int --s=float
+
+## OPTIONS
+
+*--in=s*::
+ iput file is single file containing tracks in wig format
+
+*--outexons=s*::
+ file for the output segmentaion
+
+*--c*::
+ specify the threshold to distinguish between introns and exons in terms of coverage depths (default 4)
+
+*--s*::
+ specify the ratio *(1-lambda1)/(1-lambda2)* It should be >1 (default 1.12)
+
+*--z*::
+ specify the chunk size (default value 50000)
+
+*--r*::
+ To enable re-estimation of distribution from the output produced
+
+*--train_file*::
+ Specify the gff file to be used for training the distributions.It should contain the position of both introns and exons
+
+*--bed_file*::
+ Specify the output bedfile which contains the position of gene jumps (default: output.bed)
+
+*--augustus_hints*::
+ Specify the output augustus hint file(default: augustus_hints.gff)
+
+## AUTHORS
+
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+
+## ADDITIONAL DOCUMENTATION
+
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
+
diff --git a/mansrc/etraining.1 b/mansrc/etraining.1
new file mode 100644
index 0000000..00ac220
--- /dev/null
+++ b/mansrc/etraining.1
@@ -0,0 +1,41 @@
+'\" t
+.\" Title: etraining
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "ETRAINING" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+etraining \- train AUGUSTUS models
+.SH "SYNOPSIS"
+.sp
+\fBetraining\fP [parameters] \-\-species=SPECIES trainfilename
+.SH "OPTIONS"
+.sp
+\(aqtrainfilename\(aq is the filename (including relative path) to the file in genbank format containing the training sequences. These can be multi\-gene sequences.
+SPECIES is a name for your species.
+.SS "Further parameters:"
+.sp
+\fB\-\-/genbank/verbosity=n\fP
+.RS 4
+Choose one of 0,1,2 or 3. The larger the verbosity, the more (error) messages you get.
+.RE
+.SH "AUTHORS"
+.sp
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+.SH "ADDITIONAL DOCUMENTATION"
+.sp
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
\ No newline at end of file
diff --git a/mansrc/etraining.1.adoc b/mansrc/etraining.1.adoc
new file mode 100644
index 0000000..63d3c53
--- /dev/null
+++ b/mansrc/etraining.1.adoc
@@ -0,0 +1,28 @@
+# etraining(1)
+
+## NAME
+
+etraining - train AUGUSTUS models
+
+## SYNOPSIS
+
+*etraining* [parameters] --species=SPECIES trainfilename
+
+## OPTIONS
+
+'trainfilename' is the filename (including relative path) to the file in genbank format containing the training sequences. These can be multi-gene sequences.
+SPECIES is a name for your species.
+
+### Further parameters:
+
+*--/genbank/verbosity=n*::
+ Choose one of 0,1,2 or 3. The larger the verbosity, the more (error) messages you get.
+
+## AUTHORS
+
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+
+## ADDITIONAL DOCUMENTATION
+
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
+
diff --git a/mansrc/fastBlockSearch.1 b/mansrc/fastBlockSearch.1
new file mode 100644
index 0000000..265fb5f
--- /dev/null
+++ b/mansrc/fastBlockSearch.1
@@ -0,0 +1,85 @@
+'\" t
+.\" Title: fastblocksearch
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "FASTBLOCKSEARCH" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+fastblocksearch \- search loci matching protein block profiles
+.SH "SYNOPSIS"
+.sp
+\fBfastBlockSearch\fP [options] seqs.fa fam.prfl
+.SH "DESCRIPTION"
+.sp
+.if n \{\
+.RS 4
+.\}
+.nf
+Searches hits (matches) of the blocks in the profile given by fam.prfl within the genomic sequences in the file seqs.fa.
+Hits are sorted increasingly by score, so the last displayed hit is the best one found in the region. The format is similar
+to that of the blockscore file (which is optionally generated by msa2prfl.pl): It shows coordinate, strand,
+mean odds\-ratio score, and specificity of score, and the motif.
+From the output users can chose regions with matching blocks to perform gene prediction with AUGUSTUS\-PPX using the same block profile.
+.fi
+.if n \{\
+.RE
+.\}
+.SH "EXAMPLE"
+.sp
+.if n \{\
+.RS 4
+.\}
+.nf
+> fastBlockSearch \-\-cutoff=1.1 chr4.103M.fa PF00225_seed.prfl
+.fi
+.if n \{\
+.RE
+.\}
+.sp
+.if n \{\
+.RS 4
+.\}
+.nf
+Hits found in chr4 103000000 105000000
+Score:207.987
+Mult. score:4.83391
+1081586 unknown_M[5,13] \- 2.32574 5.04633 .....YATRLKNI
+1103952 unknown_L \- 4.85363 6.75245 NAKTRIICTITP
+1103991 unknown_K \- 8.38065 9.92928 YRDSKLTRILQNSLG
+1104375 unknown_J \- 3.96065 6.79408 RSLFILGQVIKKL
+1106992 unknown_I \- 9.22487 7.64306 LVDLAGSE
+1115567 unknown_H[5,16] \- 2.31869 5.58986 .....ESRHYGETKMN
+1116319 unknown_G \- 7.34282 8.29425 EIYNETITDLL
+1117092 unknown_F \- 5.10694 6.10274 VIPRAIHDIF
+1117146 unknown_E \- 9.43596 9.18891 QTASGKTYTM
+1117176 unknown_D[1,8] \- 5.73796 6.31532 .GTIFAYG
+1117399 unknown_B[1,7] \- 3.59083 5.03059 .CLDRVF
+1119420 unknown_A[0,8] \- 4.64107 6.44285 RVRPLNSR.
+.fi
+.if n \{\
+.RE
+.\}
+.SH "OPTIONS"
+.sp
+\fB\-\-cutoff=c\fP
+.RS 4
+This minimum for the average log score of the motifs found can be used to adjust the sensitivity of the block search.
+The standard cutoff is 0.7, which is very sensitive but can give many false positive hits for smaller profiles.
+.RE
+.SH "AUTHORS"
+.sp
+Oliver Keller
\ No newline at end of file
diff --git a/mansrc/fastBlockSearch.1.adoc b/mansrc/fastBlockSearch.1.adoc
new file mode 100644
index 0000000..5eaf20f
--- /dev/null
+++ b/mansrc/fastBlockSearch.1.adoc
@@ -0,0 +1,45 @@
+# fastBlockSearch(1)
+
+## NAME
+
+fastBlockSearch - search loci matching protein block profiles
+
+## SYNOPSIS
+
+*fastBlockSearch* [options] seqs.fa fam.prfl
+
+## DESCRIPTION
+ Searches hits (matches) of the blocks in the profile given by fam.prfl within the genomic sequences in the file seqs.fa.
+ Hits are sorted increasingly by score, so the last displayed hit is the best one found in the region. The format is similar
+ to that of the blockscore file (which is optionally generated by msa2prfl.pl): It shows coordinate, strand,
+ mean odds-ratio score, and specificity of score, and the motif.
+ From the output users can chose regions with matching blocks to perform gene prediction with AUGUSTUS-PPX using the same block profile.
+
+## EXAMPLE
+ > fastBlockSearch --cutoff=1.1 chr4.103M.fa PF00225_seed.prfl
+
+ Hits found in chr4 103000000 105000000
+ Score:207.987
+ Mult. score:4.83391
+ 1081586 unknown_M[5,13] - 2.32574 5.04633 .....YATRLKNI
+ 1103952 unknown_L - 4.85363 6.75245 NAKTRIICTITP
+ 1103991 unknown_K - 8.38065 9.92928 YRDSKLTRILQNSLG
+ 1104375 unknown_J - 3.96065 6.79408 RSLFILGQVIKKL
+ 1106992 unknown_I - 9.22487 7.64306 LVDLAGSE
+ 1115567 unknown_H[5,16] - 2.31869 5.58986 .....ESRHYGETKMN
+ 1116319 unknown_G - 7.34282 8.29425 EIYNETITDLL
+ 1117092 unknown_F - 5.10694 6.10274 VIPRAIHDIF
+ 1117146 unknown_E - 9.43596 9.18891 QTASGKTYTM
+ 1117176 unknown_D[1,8] - 5.73796 6.31532 .GTIFAYG
+ 1117399 unknown_B[1,7] - 3.59083 5.03059 .CLDRVF
+ 1119420 unknown_A[0,8] - 4.64107 6.44285 RVRPLNSR.
+
+## OPTIONS
+
+*--cutoff=c*::
+ This minimum for the average log score of the motifs found can be used to adjust the sensitivity of the block search.
+ The standard cutoff is 0.7, which is very sensitive but can give many false positive hits for smaller profiles.
+
+## AUTHORS
+
+Oliver Keller
diff --git a/mansrc/filterBam.1 b/mansrc/filterBam.1
new file mode 100644
index 0000000..83c3b35
--- /dev/null
+++ b/mansrc/filterBam.1
@@ -0,0 +1,165 @@
+'\" t
+.\" Title: filterbam
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "FILTERBAM" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+filterbam \- filter BAM file for use with AUGUSTUS tools
+.SH "SYNOPSIS"
+.sp
+\fBfilterBam\fP \-\-in in.bam \-\-out out.bam [options]
+.SH "DESCRIPTION"
+.sp
+The input file must be sorted lexicographically by \(aqqueryname\(aq, with e.g.
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+\fBsort \-k 1,1\fP [be aware: \(aqexport LC_ALL=C\(aq might be used because sort ignores characters like \(aq:\(aq]
+Also, please bear in mind that this will require converting your BAM file into SAM.
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+\fBsamtools\fP and \fBbamtools\fP provide facilities to do the sorting,
+but they are not guaranteed to work because of the problem mentioned above.
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+In the case of \fBsamtools\fP, the command is: \(aqsamtools sort [\-n] file.bam\(aq.
+The option [\-n] should sort by query name, just as \(aqsort \-k 10,10\(aq would do in a PSL file.
+Without options, the sorting will be done by reference name and target coordinate, just as a \(aqsort \-n \-k 16,16 | sort \-k 14,14\(aq would do with PSL.
+For more information check the man page included in samtools distribution.
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+bamtools can also sort bam files: \fBbamtools sort \-queryname \-in file.bam\fP,
+but only provides the option to do it by queryname.
+.RE
+.sp
+If the option \(aqpaired\(aq is used, then alignment names must include suffixes /1,/2 or /f,/r.
+.SH "OPTIONS"
+.sp
+\fB\-\-best\fP
+.RS 4
+output all best matches that satisfy minId and minCover (default 0)
+.RE
+.sp
+\fB\-\-noIntrons\fP
+.RS 4
+do not allow longer gaps \-for RNA\-RNA alignments\- (default 0)
+.RE
+.sp
+\fB\-\-paired\fP
+.RS 4
+require that paired reads are on opposite strands of same target
+(default 0). NOTE: see prerequisite section above.
+.RE
+.sp
+\fB\-\-uniq\fP
+.RS 4
+take only best match, iff, second best is much worse (default 0)
+.RE
+.sp
+\fB\-\-verbose\fP
+.RS 4
+output debugging info (default 0)
+.RE
+.sp
+\fB\-\-insertLimit n\fP
+.RS 4
+maximum assumed size of inserts (default 10)
+.RE
+.sp
+\fB\-\-maxIntronLen n\fP
+.RS 4
+maximal separation of paired reads (default 500000)
+.RE
+.sp
+\fB\-\-maxSortesTest n\fP
+.RS 4
+maximal sortedness (default 100000)
+.RE
+.sp
+\fB\-\-minCover n\fP
+.RS 4
+minimal percentage of coverage of the query read (default 80)
+.RE
+.sp
+\fB\-\-minId n\fP
+.RS 4
+minimal percentage of identity (default 92)
+.RE
+.sp
+\fB\-\-minIntronLen n\fP
+.RS 4
+minimal intron length (default 35)
+.RE
+.sp
+\fB\-\-uniqThresh n\fP
+.RS 4
+threshold % for uniq, second best must be at most this fraction of best (default 0.96)
+.RE
+.sp
+\fB\-\-commonGeneFile s\fP
+.RS 4
+file name in which to write cases where one read maps several different genes
+.RE
+.sp
+\fB\-\-pairBedFile s\fP
+.RS 4
+file name of pairedness coverage: a BED format file in which for each position the number of
+filtered read pairs is reported that contain the position in
+or between the reads
+.RE
+.sp
+\fB\-\-pairwiseAlignments\fP
+.RS 4
+use in case alignments were done in pairwise fashion (default: 0)
+.RE
+.SH "AUTHORS"
+.sp
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+.SH "ADDITIONAL DOCUMENTATION"
+.sp
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
\ No newline at end of file
diff --git a/mansrc/filterBam.1.adoc b/mansrc/filterBam.1.adoc
new file mode 100644
index 0000000..e3091c4
--- /dev/null
+++ b/mansrc/filterBam.1.adoc
@@ -0,0 +1,87 @@
+# filterBam(1)
+
+## NAME
+
+filterBam - filter BAM file for use with AUGUSTUS tools
+
+## SYNOPSIS
+
+*filterBam* --in in.bam --out out.bam [options]
+
+## DESCRIPTION
+
+The input file must be sorted lexicographically by 'queryname', with e.g.
+
+ - *sort -k 1,1* [be aware: 'export LC_ALL=C' might be used because sort ignores characters like ':']
+ Also, please bear in mind that this will require converting your BAM file into SAM.
+
+ - *samtools* and *bamtools* provide facilities to do the sorting,
+ but they are not guaranteed to work because of the problem mentioned above.
+
+ - In the case of *samtools*, the command is: 'samtools sort [-n] file.bam'.
+ The option [-n] should sort by query name, just as 'sort -k 10,10' would do in a PSL file.
+ Without options, the sorting will be done by reference name and target coordinate, just as a 'sort -n -k 16,16 | sort -k 14,14' would do with PSL.
+ For more information check the man page included in samtools distribution.
+
+ - bamtools can also sort bam files: *bamtools sort -queryname -in file.bam*,
+ but only provides the option to do it by queryname.
+
+If the option 'paired' is used, then alignment names must include suffixes /1,/2 or /f,/r.
+
+## OPTIONS
+
+*--best*::
+ output all best matches that satisfy minId and minCover (default 0)
+
+*--noIntrons*::
+ do not allow longer gaps -for RNA-RNA alignments- (default 0)
+
+*--paired*::
+ require that paired reads are on opposite strands of same target
+ (default 0). NOTE: see prerequisite section above.
+
+*--uniq*::
+ take only best match, iff, second best is much worse (default 0)
+
+*--verbose*::
+ output debugging info (default 0)
+
+*--insertLimit n*::
+ maximum assumed size of inserts (default 10)
+
+*--maxIntronLen n*::
+ maximal separation of paired reads (default 500000)
+
+*--maxSortesTest n*::
+ maximal sortedness (default 100000)
+
+*--minCover n*::
+ minimal percentage of coverage of the query read (default 80)
+
+*--minId n*::
+ minimal percentage of identity (default 92)
+
+*--minIntronLen n*::
+ minimal intron length (default 35)
+
+*--uniqThresh n*::
+ threshold % for uniq, second best must be at most this fraction of best (default 0.96)
+
+*--commonGeneFile s*::
+ file name in which to write cases where one read maps several different genes
+
+*--pairBedFile s*::
+ file name of pairedness coverage: a BED format file in which for each position the number of
+ filtered read pairs is reported that contain the position in
+ or between the reads
+
+*--pairwiseAlignments*::
+ use in case alignments were done in pairwise fashion (default: 0)
+
+## AUTHORS
+
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+
+## ADDITIONAL DOCUMENTATION
+
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
diff --git a/mansrc/homGeneMapping.1 b/mansrc/homGeneMapping.1
new file mode 100644
index 0000000..4136b4a
--- /dev/null
+++ b/mansrc/homGeneMapping.1
@@ -0,0 +1,151 @@
+'\" t
+.\" Title: homgenemapping
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "HOMGENEMAPPING" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+homgenemapping \- create summary of gene homology
+.SH "SYNOPSIS"
+.sp
+\fBhomGeneMapping\fP [options] \-\-gtfs=gffilenames.tbl \-\-halfile=aln.hal
+.SH "DESCRIPTION"
+.sp
+\fBhomGeneMapping\fP takes a set of gene predictions of different genomes and a hal
+alignment of the genomes and prints a summary for each gene, e.g.
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+how many of its exons/introns are in agreement with genes of other genomes
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+how many of its exons/introns are supported by extrinsic evidence from any of the genomes
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+a list of geneids of homologous genes
+.RE
+.SH "OPTIONS"
+.SS "Mandatory parameters"
+.sp
+\fB\-\-halfile=aln.hal\fP
+.RS 4
+input hal file
+.RE
+.sp
+\fB\-\-gtfs=gtffilenames.tbl\fP
+.RS 4
+a text file containing the locations of the input gene files
+and optionally the hints files (both in GTF format).
+The file is formatted as follows:
+.sp
+.if n \{\
+.RS 4
+.\}
+.nf
+name_of_genome_1 path/to/genefile/of/genome_1 path/to/hintsfile/of/genome_1
+name_of_genome_2 path/to/genefile/of/genome_2 path/to/hintsfile/of/genome_2
+\&...
+name_of_genome_N path/to/genefile/of/genome_N path/to/hintsfile/of/genome_N
+.fi
+.if n \{\
+.RE
+.\}
+.RE
+.SS "Additional options"
+.sp
+\fB\-\-cpus=N\fP
+.RS 4
+N is the number of CPUs to use (default: 1)
+.RE
+.sp
+\fB\-\-noDupes\fP
+.RS 4
+do not map between duplications in hal graph. (default: off)
+.RE
+.sp
+\fB\-\-halLiftover_exec_dir=DIR\fP
+.RS 4
+Directory that contains the executable halLiftover
+If not specified it must be in $PATH environment variable.
+.RE
+.sp
+\fB\-\-tmpdir=DIR\fP
+.RS 4
+a temporary file directory that stores lifted over files. (default \(aqtmp/\(aq in current directory)
+.RE
+.sp
+\fB\-\-outdir=DIR\fP
+.RS 4
+file direcory that stores output gene files. (default: current directory)
+.RE
+.sp
+\fB\-\-printHomologs=FILE\fP
+.RS 4
+prints disjunct sets of homologous transcripts to FILE, e.g.
+.sp
+.if n \{\
+.RS 4
+.\}
+.nf
+# 0 dana
+# 1 dere
+# 2 dgri
+# 3 dmel
+# 4 dmoj
+# 5 dper
+(0, jg4139.t1) (0, jg4140.t1) (1, jg7797.t1) (2, jg3247.t1) (4, jg6720.t1) (5, jg313.t1)
+(1, jg14269.t1) (3, jg89.t1) (5, jg290.t1)
+\&...
+Two transcripts are in the same set, if all their exons/introns are homologs and their are
+no additional exons/introns.
+This option requires the Boost C++ Library
+.fi
+.if n \{\
+.RE
+.\}
+.RE
+.SH "EXAMPLE"
+.sp
+homGeneMapping \-\-noDupes \-\-halLiftover_exec_dir=~/tools/progressiveCactus/submodules/hal/bin \-\-gtfs=gtffilenames.tbl \-\-halfile=msca.hal
+.SH "AUTHORS"
+.sp
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+.SH "ADDITIONAL DOCUMENTATION"
+.sp
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
\ No newline at end of file
diff --git a/mansrc/homGeneMapping.1.adoc b/mansrc/homGeneMapping.1.adoc
new file mode 100644
index 0000000..15a5669
--- /dev/null
+++ b/mansrc/homGeneMapping.1.adoc
@@ -0,0 +1,81 @@
+# homGeneMapping(1)
+
+## NAME
+
+homGeneMapping - create summary of gene homology
+
+## SYNOPSIS
+
+*homGeneMapping* [options] --gtfs=gffilenames.tbl --halfile=aln.hal
+
+## DESCRIPTION
+
+*homGeneMapping* takes a set of gene predictions of different genomes and a hal
+alignment of the genomes and prints a summary for each gene, e.g.
+
+ - how many of its exons/introns are in agreement with genes of other genomes
+ - how many of its exons/introns are supported by extrinsic evidence from any of the genomes
+ - a list of geneids of homologous genes
+
+## OPTIONS
+
+### Mandatory parameters
+
+*--halfile=aln.hal*::
+ input hal file
+
+*--gtfs=gtffilenames.tbl*::
+ a text file containing the locations of the input gene files
+ and optionally the hints files (both in GTF format).
+ The file is formatted as follows:
+
+ name_of_genome_1 path/to/genefile/of/genome_1 path/to/hintsfile/of/genome_1
+ name_of_genome_2 path/to/genefile/of/genome_2 path/to/hintsfile/of/genome_2
+ ...
+ name_of_genome_N path/to/genefile/of/genome_N path/to/hintsfile/of/genome_N
+
+### Additional options
+
+*--cpus=N*::
+ N is the number of CPUs to use (default: 1)
+
+*--noDupes*::
+ do not map between duplications in hal graph. (default: off)
+
+*--halLiftover_exec_dir=DIR*::
+ Directory that contains the executable halLiftover
+ If not specified it must be in $PATH environment variable.
+
+*--tmpdir=DIR*::
+ a temporary file directory that stores lifted over files. (default 'tmp/' in current directory)
+
+*--outdir=DIR*::
+ file direcory that stores output gene files. (default: current directory)
+
+*--printHomologs=FILE*::
+ prints disjunct sets of homologous transcripts to FILE, e.g.
+
+ # 0 dana
+ # 1 dere
+ # 2 dgri
+ # 3 dmel
+ # 4 dmoj
+ # 5 dper
+ (0, jg4139.t1) (0, jg4140.t1) (1, jg7797.t1) (2, jg3247.t1) (4, jg6720.t1) (5, jg313.t1)
+ (1, jg14269.t1) (3, jg89.t1) (5, jg290.t1)
+ ...
+ Two transcripts are in the same set, if all their exons/introns are homologs and their are
+ no additional exons/introns.
+ This option requires the Boost C++ Library
+
+## EXAMPLE
+
+homGeneMapping --noDupes --halLiftover_exec_dir=~/tools/progressiveCactus/submodules/hal/bin --gtfs=gtffilenames.tbl --halfile=msca.hal
+
+## AUTHORS
+
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+
+## ADDITIONAL DOCUMENTATION
+
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
diff --git a/mansrc/joingenes.1 b/mansrc/joingenes.1
new file mode 100644
index 0000000..4ebdeaf
--- /dev/null
+++ b/mansrc/joingenes.1
@@ -0,0 +1,199 @@
+'\" t
+.\" Title: joingenes
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "JOINGENES" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+joingenes \- merge several gene sets into one
+.SH "SYNOPSIS"
+.sp
+\fBjoingenes\fP [parameters] \-\-genesets=file1,file2,... \-\-output=ofile
+.SH "DESCRIPTION"
+.sp
+This program works in several steps:
+.sp
+.RS 4
+.ie n \{\
+\h'-04' 1.\h'+01'\c
+.\}
+.el \{\
+.sp -1
+.IP " 1." 4.2
+.\}
+divide the set of all transcripts into smaller sets, in which all transcripts are on the same sequence and are overlapping at least with one other transcript in this set (set is called "overlap")
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04' 2.\h'+01'\c
+.\}
+.el \{\
+.sp -1
+.IP " 2." 4.2
+.\}
+delete all duplications of transcripts and save the variant with the highest "score"
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04' 3.\h'+01'\c
+.\}
+.el \{\
+.sp -1
+.IP " 3." 4.2
+.\}
+if sequence ranges are set for some transcripts, the program detects, whether the distance to that range is dangerously close
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04' 4.\h'+01'\c
+.\}
+.el \{\
+.sp -1
+.IP " 4." 4.2
+.\}
+join:
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+if there is a transcript dangerously close to one/both end(s) of a sequence range, the program creates a copy without the corresponding terminal exon
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+if there is a transcript with start or stop codon in a set and a second one without this codon and they are "joinable", than this step joins the corresponding terminal exons
+.RE
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04' 5.\h'+01'\c
+.\}
+.el \{\
+.sp -1
+.IP " 5." 4.2
+.\}
+selection: selects the "best" gene structure out of all possible "maximum" gene structures
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+"maximum" gene structure is a set of transcripts from an overlap so that there is no other transcript in the overlap, which can be added to the set without producing a "contradiction"
+.RE
+.sp
+.RS 4
+.ie n \{\
+\h'-04'\(bu\h'+03'\c
+.\}
+.el \{\
+.sp -1
+.IP \(bu 2.3
+.\}
+a gene structure is "better" than another one, if it has the transcript with the highest "score", which is not present in the other gene structure.
+.RE
+.RE
+.SH "OPTIONS"
+.SS "Mandatory parameters:"
+.sp
+\fB\-\-genesets=file1,file2,...\fP/\fB\-g file1,file2,...\fP
+.RS 4
+where "file1,file2,...,filen" have to be data files with genesets in GTF format
+.RE
+.sp
+\fB\-\-output=ofile\fP/\fB\-o ofile\fP
+.RS 4
+where "ofile" is the name for an output file (GTF)
+.RE
+.SS "Optional parameters:"
+.sp
+\fB\-\-priorities=pr1,pr2,...\fP/\fB\-p pr1,pr2,...\fP
+.RS 4
+where "pr1,pr2,...,prn" have to be positiv integers (different from 0).
+Have to be as many as filenames are added. Bigger numbers means a higher priority.
+If no priorities are added, the program will set all priorties to 1.
+This option is only useful if there is more than one geneset.
+If there is a conflict between two transcripts, so that they can not be picked in the same genestructure, joingenes decides for the one with the highest priority.
+.RE
+.sp
+\fB\-\-errordistance=x\fP/\fB\-e x\fP
+.RS 4
+where "x" is a non\-negative integer. If a prediction is \(lAx bases next to a prediction range border, the program supposes, that there could be a mistake. Default is 1000.
+To disable the function, set errordistance to a negative number (e.g. \-1).
+.RE
+.sp
+\fB\-\-genemodel=x\fP/\fB\-m x\fP
+.RS 4
+where "x" is a genemodel from the set {eukaryote, bacterium}. Default is eukaryotic.
+.RE
+.sp
+\fB\-\-alternatives\fP/\fB\-a\fP
+.RS 4
+If this flag is set, the program joins different genes if the transcripts of the genes are alternative variants.
+.RE
+.sp
+\fB\-\-suppress=pr1,pr2,..\fP/\fB\-s pr1,pr2,...\fP
+.RS 4
+where "pr1,pr2,...,prm" have to be positive integers (different from 0). Default is none.
+If the core of a joined/non\-joined transcript has one of these priorities it will not occur in the output file.
+.RE
+.sp
+\fB\-\-stopincoding\fP/\fB\-i\fP
+.RS 4
+If this flag is set, the program joins the stop_codons to the CDS.
+.RE
+.sp
+\fB\-\-nojoin\fP/\fB\-j\fP
+.RS 4
+If this flag is set, the program will not join/merge/shuffle; it will only decide between the unchanged input transcripts and output them.
+.RE
+.sp
+\fB\-\-noselection\fP/\fB\-l\fP
+.RS 4
+If this flag is set, the program will NOT select at the end between "contradictory" transcripts. "contradictory" is self defined with respect to known biological terms.
+The selection works with a self defined scoring function.
+.RE
+.sp
+\fB\-\-onlycompare\fP/\fB\-c\fP
+.RS 4
+If this flag is set, it disables the normal function of the program and
+activates a compare and separate mode to separate equal transcripts from non equal ones.
+.RE
+.SH "AUTHORS"
+.sp
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+.SH "ADDITIONAL DOCUMENTATION"
+.sp
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
\ No newline at end of file
diff --git a/mansrc/joingenes.1.adoc b/mansrc/joingenes.1.adoc
new file mode 100644
index 0000000..055a89a
--- /dev/null
+++ b/mansrc/joingenes.1.adoc
@@ -0,0 +1,83 @@
+# joingenes(1)
+
+## NAME
+
+joingenes - merge several gene sets into one
+
+## SYNOPSIS
+
+*joingenes* [parameters] --genesets=file1,file2,... --output=ofile
+
+## DESCRIPTION
+
+This program works in several steps:
+
+ 1. divide the set of all transcripts into smaller sets, in which all transcripts are on the same sequence and are overlapping at least with one other transcript in this set (set is called "overlap")
+
+ 2. delete all duplications of transcripts and save the variant with the highest "score"
+
+ 3. if sequence ranges are set for some transcripts, the program detects, whether the distance to that range is dangerously close
+
+ 4. join:
+ - if there is a transcript dangerously close to one/both end(s) of a sequence range, the program creates a copy without the corresponding terminal exon
+ - if there is a transcript with start or stop codon in a set and a second one without this codon and they are "joinable", than this step joins the corresponding terminal exons
+
+ 5. selection: selects the "best" gene structure out of all possible "maximum" gene structures
+ - "maximum" gene structure is a set of transcripts from an overlap so that there is no other transcript in the overlap, which can be added to the set without producing a "contradiction"
+ - a gene structure is "better" than another one, if it has the transcript with the highest "score", which is not present in the other gene structure.
+
+## OPTIONS
+
+### Mandatory parameters:
+
+*--genesets=file1,file2,...*/*-g file1,file2,...*::
+ where "file1,file2,...,filen" have to be data files with genesets in GTF format
+
+*--output=ofile*/*-o ofile*::
+ where "ofile" is the name for an output file (GTF)
+
+### Optional parameters:
+
+*--priorities=pr1,pr2,...*/*-p pr1,pr2,...*::
+ where "pr1,pr2,...,prn" have to be positiv integers (different from 0).
+ Have to be as many as filenames are added. Bigger numbers means a higher priority.
+ If no priorities are added, the program will set all priorties to 1.
+ This option is only useful if there is more than one geneset.
+ If there is a conflict between two transcripts, so that they can not be picked in the same genestructure, joingenes decides for the one with the highest priority.
+
+*--errordistance=x*/*-e x*::
+ where "x" is a non-negative integer. If a prediction is <=x bases next to a prediction range border, the program supposes, that there could be a mistake. Default is 1000.
+ To disable the function, set errordistance to a negative number (e.g. -1).
+
+*--genemodel=x*/*-m x*::
+ where "x" is a genemodel from the set {eukaryote, bacterium}. Default is eukaryotic.
+
+*--alternatives*/*-a*::
+ If this flag is set, the program joins different genes if the transcripts of the genes are alternative variants.
+
+*--suppress=pr1,pr2,..*/*-s pr1,pr2,...*::
+ where "pr1,pr2,...,prm" have to be positive integers (different from 0). Default is none.
+ If the core of a joined/non-joined transcript has one of these priorities it will not occur in the output file.
+
+*--stopincoding*/*-i*::
+ If this flag is set, the program joins the stop_codons to the CDS.
+
+*--nojoin*/*-j*::
+ If this flag is set, the program will not join/merge/shuffle; it will only decide between the unchanged input transcripts and output them.
+
+*--noselection*/*-l*::
+ If this flag is set, the program will NOT select at the end between "contradictory" transcripts. "contradictory" is self defined with respect to known biological terms.
+ The selection works with a self defined scoring function.
+
+*--onlycompare*/*-c*::
+ If this flag is set, it disables the normal function of the program and
+ activates a compare and separate mode to separate equal transcripts from non equal ones.
+
+## AUTHORS
+
+AUGUSTUS was written by M. Stanke, O. Keller, S. König, L. Gerischer and L. Romoth.
+
+## ADDITIONAL DOCUMENTATION
+
+An exhaustive documentation can be found in the file /usr/share/augustus/README.TXT.
+
diff --git a/mansrc/make.doc b/mansrc/make.doc
new file mode 100644
index 0000000..8fd10c2
--- /dev/null
+++ b/mansrc/make.doc
@@ -0,0 +1,2 @@
+# requires asciidoctor version 1.5.3 or higher
+asciidoctor -a docdate='' -b manpage *adoc
diff --git a/mansrc/prepareAlign.1 b/mansrc/prepareAlign.1
new file mode 100644
index 0000000..03c4bf1
--- /dev/null
+++ b/mansrc/prepareAlign.1
@@ -0,0 +1,51 @@
+'\" t
+.\" Title: preparealign
+.\" Author: [see the "AUTHORS" section]
+.\" Generator: Asciidoctor 1.5.5.dev
+.\" Date:
+.\" Manual: \ \&
+.\" Source: \ \&
+.\" Language: English
+.\"
+.TH "PREPAREALIGN" "1" "" "\ \&" "\ \&"
+.ie \n(.g .ds Aq \(aq
+.el .ds Aq '
+.ss \n[.ss] 0
+.nh
+.ad l
+.de URL
+\\$2 \(laURL: \\$1 \(ra\\$3
+..
+.if \n[.g] .mso www.tmac
+.LINKSTYLE blue R < >
+.SH "NAME"
+preparealign \- prepare an alignment for block profile creation by deleting gap\-rich rows
+.SH "SYNOPSIS"
+.sp
+\fBprepareAlign\fP < input.fa > output.fa
+.SH "DESCRIPTION"
+.sp
+.if n \{\
+.RS 4
+.\}
+.nf
+An input multiple alignment of proteins is read from standard input. prepareAlign removes rows from it
+with the aim of producing fully conserved blocks in the remaining alignment which is then output to standard output.
+.fi
+.if n \{\
+.RE
+.\}
+.sp
+.if n \{\
+.RS 4
+.\}
+.nf
+When an alignment contains many sequences and too many gaps, e.g. a full PFAM alignment, trying to run msa2prfl.pl
+results in the message "No blocks found in MSA". Then use "prepareAlign" first to eliminate sequences.
+.fi
+.if n \{\
+.RE
+.\}
+.SH "AUTHORS"
+.sp
+Oliver Keller
\ No newline at end of file
diff --git a/mansrc/prepareAlign.1.adoc b/mansrc/prepareAlign.1.adoc
new file mode 100644
index 0000000..34da081
--- /dev/null
+++ b/mansrc/prepareAlign.1.adoc
@@ -0,0 +1,31 @@
+# prepareAlign(1)
+
+## NAME
+
+prepareAlign - prepare an alignment for block profile creation by deleting gap-rich rows
+
+## SYNOPSIS
+
+*prepareAlign* < input.fa > output.fa
+
+## DESCRIPTION
+ An input multiple alignment of proteins is read from standard input. prepareAlign removes rows from it
+ with the aim of producing fully conserved blocks in the remaining alignment which is then output to standard output.
+
+ When an alignment contains many sequences and too many gaps, e.g. a full PFAM alignment, trying to run msa2prfl.pl
+ results in the message "No blocks found in MSA". Then use "prepareAlign" first to eliminate sequences.
+
+## AUTHORS
+
+Oliver Keller
+
+
+
+
+
+
+
+
+
+
+
diff --git a/scripts/gtf2bed.pl b/scripts/gtf2bed.pl
new file mode 100755
index 0000000..c1e05b8
--- /dev/null
+++ b/scripts/gtf2bed.pl
@@ -0,0 +1,259 @@
+#!/usr/bin/perl
+#
+# convert gtf/gff/gff3 to BED format
+# 23.9.2016 Stefanie Koenig
+
+use strict;
+use Getopt::Long;
+
+
+my $help = 0;
+my $verbose = 0;
+my $itemRgb="0,0,255";
+my $includeStopInCDS = 0;
+
+GetOptions(
+ 'itemRgb=s'=>\$itemRgb,
+ 'help!'=>\$help,
+ 'verbose!'=>\$verbose,
+ 'includeStopInCDS!'=>\$includeStopInCDS);
+
+exec("perldoc $0") if ($help);
+
+my @txorder = (); # tx ids in the order of the input file
+my %geneOf = (); # keys tx ids, values: gene ids
+my %geneLine = (); # keys gene ids, values: array refs for the gene GTF line (if exists)
+# hash of transcripts
+# keys: transcript ids
+# values: hash reference
+# keys: txstart
+# txend
+# codingstart
+# codingend
+# strand, chr, source
+# txline array of columns if a transcript/mRNA line exists
+# CDS array of arrays (lines and columns) for coding parts of exons
+# UTR array of arrays for UTR exons
+# exon array of arrays for complete exons
+# intron array of arrays for introns
+# rest array of arrays all other features, like tts,tss start_codon, stop_codon
+
+my %txs = ();
+
+parseAndStoreGTF();
+convert();
+printBed();
+
+sub parseAndStoreGTF{
+ my %seen = ();
+ my ($txid, $geneid, $chr, $start, $end, $feature, $strand, $source, $stop_codon);
+ foreach my $line (<STDIN>){
+ my @f = split /\t/, $line;
+ next if (@f<8);
+ ($chr,$source,$feature,$start,$end,$strand) = ($f[0],$f[1],$f[2],$f[3],$f[4],$f[6]);
+ # check whether it is a line with 'gene' feature
+ if ($f[2] eq "gene" && ($f[8] =~ /ID=([^;]+)/ || $f[8] =~ /gene_id."?([^";]+)"?/ || $f[8] =~ /^(\S+)$/)){
+ $geneid = $1;
+ $geneLine{$geneid} = \@f;
+ next;
+ }
+ # check whether it is a line with 'transcript' feature
+ if ($f[2] =~ "(transcript|mRNA)" && ($f[8] =~ /ID=([^;]+)/ || $f[8] =~ /transcript_id."?([^";]+)"?/ || $f[8] =~ /^(\S+)$/)){
+ $txid = $1;
+ $txs{$txid} = {"strand"=>$strand, "chr"=>$chr, "source"=>$source, "CDS"=>[], "UTR"=>[], "exon"=>[], "intron"=>[], "rest"=>[]} if (!exists($txs{$txid}));
+ $txs{$txid}{"txline"} = \@f;
+ if($f[8] =~ /Parent=([^;]+)/ || $f[8] =~ /gene_id."?([^";]+)"?/){
+ $geneOf{$txid} = $1;
+ }
+ next;
+ }
+
+ $txs{$txid}{"CDS"} = [] if (!defined($txs{$txid}{"CDS"}));
+ $txs{$txid}{"UTR"} = [] if (!defined($txs{$txid}{"UTR"}));
+ $txs{$txid}{"exon"} = [] if (!defined($txs{$txid}{"exon"}));
+ $txs{$txid}{"rest"} = [] if (!defined($txs{$txid}{"rest"}));
+
+ # all other lines must belong to a transcript and a gene
+ if ($f[8] =~ /(transcript_id|Transcript)."?([^";]+)"?/ ){
+ $txid = $2;
+ } else {
+ if($f[8] =~ /Parent=([^;]+)/){
+ $txid = $1;
+ }else{
+ die ("Neither GTF nor GFF format in the following line:\n$line\ntranscript_id not found.\n");
+ }
+ }
+ if ($f[8] =~ /gene_id."?([^";]+)"?/){
+ $geneid = $1;
+ } else {
+ if($f[8] =~ /Parent=([^;]+)/){
+ $geneid = $geneOf{$1};
+ }else{
+ die ("Neither GTF nor GFF format in the following line:\n$line\ngene_id not found.\n");
+ }
+ }
+ $txs{$txid} = {"strand"=>$strand, "chr"=>$chr, "source"=>$source, "CDS"=>[], "UTR"=>[], "exon"=>[], "intron"=>[], "rest"=>[]} if (!exists($txs{$txid}));
+
+ if (!$seen{$txid}){
+ push @txorder, $txid; # remember the input order for transcripts for the output
+ $seen{$txid} = 1;
+ }
+ # assign parental gene id to tx id
+ die ("transcript $txid has conflicting gene parents: and $geneid. Remember: In GTF txids need to be overall unique.")
+ if (defined($geneOf{$txid}) && $geneOf{$txid} ne $geneid);
+
+ if ($feature eq "CDS" || $feature eq "coding_exon" || $feature eq "exon" || $feature =~ /UTR/i){
+ $txs{$txid} = {"strand"=>$strand, "chr"=>$chr, "source"=>$source, "CDS"=>[], "UTR"=>[], "exon"=>[], "intron"=>[], "rest"=>[]} if (!exists($txs{$txid}));
+ $txs{$txid}{"txstart"} = $start if (!defined($txs{$txid}{"txstart"}) || $txs{$txid}{"txstart"} > $start);
+ $txs{$txid}{"txend"} = $end if (!defined($txs{$txid}{"txend"}) || $txs{$txid}{"txend"} < $end);
+ }
+ if ($feature eq "CDS" || $feature eq "coding_exon"){
+ $txs{$txid}{"codingstart"} = $start if (!defined($txs{$txid}{"codingstart"}) || $txs{$txid}{"codingstart"} > $start);
+ $txs{$txid}{"codingend"} = $end if (!defined($txs{$txid}{"codingend"}) || $txs{$txid}{"codingend"} < $end);
+ push @{$txs{$txid}{"CDS"}}, \@f;
+ } elsif ($feature =~ /UTR/i){
+ push @{$txs{$txid}{"UTR"}}, \@f;
+ } elsif ($feature eq "exon"){
+ push @{$txs{$txid}{"exon"}}, \@f;
+ } elsif ($feature eq "intron") {
+ $txs{$txid}{"intron"} = [] if (!defined($txs{$txid}{"intron"}));
+ push @{$txs{$txid}{"intron"}}, \@f;
+ } else {
+ push @{$txs{$txid}{"rest"}}, \@f;
+ }
+ if ($feature eq "stop_codon"){
+ $txs{$txid}{"stop_codon"} = $start
+ }
+ }
+}
+
+
+sub convert{
+ my @f;
+ foreach my $txid (keys %txs){
+
+ # optionally, include stop codon in CDS
+ if($includeStopInCDS){
+ my @cdslines = sort {$a->[3] <=> $b->[3] || $a->[4] <=> $b->[4]} @{$txs{$txid}{"CDS"}};
+ if( $txs{$txid}{"strand"} eq '-' && $txs{$txid}{"stop_codon"}+3 == $txs{$txid}{"codingstart"}){
+ $cdslines[0]->[3]-=3;
+ }
+ if( $txs{$txid}{"strand"} eq '+' && $txs{$txid}{"stop_codon"} == $txs{$txid}{"codingend"}+1){
+ $cdslines[$#cdslines]->[4]+=3;
+ }
+ # TODO: if stop_codon is a separate CDS exon, then insert new CDS exon
+ }
+
+ # remember whether exons were not in the input file
+ my $exonArrayWasEmpty;
+ if(@{$txs{$txid}{"exon"}} == 0){
+ $exonArrayWasEmpty = 1;
+ }else{
+ $exonArrayWasEmpty = 0;
+ }
+ # add exon lines if not already present and if desired in output
+ if (@{$txs{$txid}{"exon"}} == 0){
+ print "Creating exon lines for $txid\n" if ($verbose);
+ # sort UTR and CDS lines by coordinates
+ my @exonpartlines = sort {$a->[3] <=> $b->[3] || $a->[4] <=> $b->[4]} (@{$txs{$txid}{"CDS"}}, @{$txs{$txid}{"UTR"}});
+ next if (@exonpartlines == 0);
+ @f = @{$exonpartlines[0]};
+ shift @exonpartlines;
+ ($f[2], $f[5], $f[7]) = ("exon", '.', '.'); # score and frame are not defined
+ foreach my $g (@exonpartlines){
+ if ($f[4] >= $g->[3]){ # check for non-overlappingness
+ die ("In transcript $txid two UTR/CDS features are overlapping. Not allowed by definition.");
+ } elsif ($f[4] + 1 == $g->[3]){ # exactly adjacent
+ # join two UTR/CDS features to one
+ $f[4] = $g->[4];
+ } else {
+ # push exon
+ my @ff = @f; # deep copy array
+ push @{$txs{$txid}{"exon"}}, \@ff;
+ @f = @$g;
+ ($f[2], $f[5], $f[7]) = ("exon", '.', '.'); # score and frame are not defined
+ }
+ }
+ # push remaining, last exon
+ my @ff = @f;
+ push @{$txs{$txid}{"exon"}}, \@ff;
+ }
+
+ }
+}
+
+sub printBed {
+
+ foreach my $txid (@txorder){
+
+ my @lines = sort {$a->[3] <=> $b->[3] || $a->[4] <=> $b->[4]} @{$txs{$txid}{"exon"}};
+ my $blockCount = @lines;
+ my @blockSizes = ();
+ my @blockStarts = ();
+
+ foreach my $line (@lines){
+ push @blockSizes, $line->[4] - $line->[3] + 1;
+ push @blockStarts, $line->[3] - $txs{$txid}{"txstart"};
+ }
+
+ print $txs{$txid}{"chr"} . "\t";
+ print $txs{$txid}{"txstart"}-1 . "\t";
+ print $txs{$txid}{"txend"} . "\t";
+ print $txid . "\t0\t";
+ print $txs{$txid}{"strand"} . "\t";
+ if(@{$txs{$txid}{"CDS"}} == 0){
+ print $txs{$txid}{"txstart"}-1 . "\t";
+ print $txs{$txid}{"txend"} . "\t";
+ }
+ else{
+ print $txs{$txid}{"codingstart"}-1 . "\t";
+ print $txs{$txid}{"codingend"} . "\t";
+ }
+ print "$itemRgb\t";
+ print "$blockCount\t";
+ print join(',', at blockSizes) ."\t";
+ print join(',', at blockStarts) ."\n";
+ }
+}
+
+__END__
+
+=pod
+
+=head1 NAME
+
+gtf2bed.pl convert gtf/gff/gff3 to BED format
+
+=head1 SYNOPSIS
+
+gtf2bed.pl <in.gtf >out.bed
+
+=head1 OPTIONS
+
+ --itemRgb=s a string s encoding the RGB value of the form R,G,B (default 0,0,225).
+ --includeStopInCDS include stop codon into the coding sequence (default off)
+
+=head1 DESCRIPTION
+
+ example input:
+ chr16 AUGUSTUS transcript 100472 160062 . - . jg7.t1
+ chr16 AUGUSTUS tts 100472 100472 . - . transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS UTR 100472 101158 0 - . transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS stop_codon 101159 101161 . - 0 transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS CDS 101159 101285 1 - 1 transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS CDS 102477 102644 1 - 1 transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS CDS 104227 104334 0.9 - 1 transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS CDS 106525 106755 1 - 1 transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS CDS 110093 110263 1 - 1 transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS CDS 110759 111288 1 - 0 transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS CDS 117341 117478 1 - 0 transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS CDS 123010 123106 1 - 1 transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS CDS 127580 127720 1 - 1 transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS CDS 159185 160062 0 - 0 transcript_id "jg7.t1"; gene_id "jg7";
+ chr16 AUGUSTUS start_codon 160060 160062 . - 0 transcript_id "jg7.t1"; gene_id "jg7";
+
+ example output :
+
+ chr16 100471 160062 jg7.t1 0 - 101158 160062 0,0,255 10 814,168,108,231,171,530,138,97,141,878 100471,102476,104226,106524,110092,110758,117340,123009,127579,159184
+
+=cut
diff --git a/scripts/gtf2gff.pl b/scripts/gtf2gff.pl
index ec09574..45b7e91 100755
--- a/scripts/gtf2gff.pl
+++ b/scripts/gtf2gff.pl
@@ -14,7 +14,7 @@ my $printUTR = 0;
my $gff3 = 0;
my $printIntron = 0;
my $outfile;
-my $trcp_pattern = '\.t\d+';
+my $includeStopInCDS = 0;
GetOptions(
'out=s'=>\$outfile,
@@ -24,7 +24,7 @@ GetOptions(
'printUTR!'=>\$printUTR,
'printIntron!'=>\$printIntron,
'gff3!'=>\$gff3,
- 'trcp_pattern=s'=>\$trcp_pattern);
+ 'includeStopInCDS!'=>\$includeStopInCDS);
exec("perldoc $0") if ($help || !defined($outfile));
@@ -56,7 +56,7 @@ close OUT;
sub parseAndStoreGTF{
my %seen = ();
- my ($txid, $geneid, $chr, $start, $end, $feature, $strand, $source);
+ my ($txid, $geneid, $chr, $start, $end, $feature, $strand, $source, $stop_codon);
foreach my $line (<STDIN>){
my @f = split /\t/, $line;
next if (@f<8);
@@ -72,6 +72,9 @@ sub parseAndStoreGTF{
$txid = $1;
$txs{$txid} = {"strand"=>$strand, "chr"=>$chr, "source"=>$source, "CDS"=>[], "UTR"=>[], "exon"=>[], "intron"=>[], "rest"=>[]} if (!exists($txs{$txid}));
$txs{$txid}{"txline"} = \@f;
+ if($f[8] =~ /Parent=([^;]+)/ || $f[8] =~ /gene_id."?([^";]+)"?/ || $f[8] =~ /(g\d+)\.t\d+/){
+ $geneOf{$txid} = $1;
+ }
next;
}
@@ -93,12 +96,14 @@ sub parseAndStoreGTF{
if ($f[8] =~ /gene_id."?([^";]+)"?/){
$geneid = $1;
} else {
- if($f[8] =~ /Parent=([^;]+)$trcp_pattern/){
- $geneid = $1;
+ if($f[8] =~ /Parent=([^;]+)/){
+ $geneid = $geneOf{$1};
}else{
die ("Neither GTF nor GFF format in the following line:\n$line\ngene_id not found.\n");
}
}
+ $txs{$txid} = {"strand"=>$strand, "chr"=>$chr, "source"=>$source, "CDS"=>[], "UTR"=>[], "exon"=>[], "intron"=>[], "rest"=>[]} if (!exists($txs{$txid}));
+
if (!$seen{$txid}){
push @txorder, $txid; # remember the input order for transcripts for the output
$seen{$txid} = 1;
@@ -106,8 +111,7 @@ sub parseAndStoreGTF{
# assign parental gene id to tx id
die ("transcript $txid has conflicting gene parents: and $geneid. Remember: In GTF txids need to be overall unique.")
if (defined($geneOf{$txid}) && $geneOf{$txid} ne $geneid);
- $geneOf{$txid} = $geneid;
-
+
if ($feature eq "CDS" || $feature eq "coding_exon" || $feature eq "exon" || $feature =~ /UTR/i){
$txs{$txid} = {"strand"=>$strand, "chr"=>$chr, "source"=>$source, "CDS"=>[], "UTR"=>[], "exon"=>[], "intron"=>[], "rest"=>[]} if (!exists($txs{$txid}));
$txs{$txid}{"txstart"} = $start if (!defined($txs{$txid}{"txstart"}) || $txs{$txid}{"txstart"} > $start);
@@ -127,6 +131,9 @@ sub parseAndStoreGTF{
} else {
push @{$txs{$txid}{"rest"}}, \@f;
}
+ if ($feature eq "stop_codon"){
+ $txs{$txid}{"stop_codon"} = $start
+ }
}
}
@@ -134,6 +141,19 @@ sub parseAndStoreGTF{
sub convert{
my @f;
foreach my $txid (keys %txs){
+
+ # optionally, include stop codon in CDS
+ if($includeStopInCDS){
+ my @cdslines = sort {$a->[3] <=> $b->[3] || $a->[4] <=> $b->[4]} @{$txs{$txid}{"CDS"}};
+ if( $txs{$txid}{"strand"} eq '-' && $txs{$txid}{"stop_codon"}+3 == $txs{$txid}{"codingstart"}){
+ $cdslines[0]->[3]-=3;
+ }
+ if( $txs{$txid}{"strand"} eq '+' && $txs{$txid}{"stop_codon"} == $txs{$txid}{"codingend"}+1){
+ $cdslines[$#cdslines]->[4]+=3;
+ }
+ # TODO: if stop_codon is a separate CDS exon, then insert new CDS exon
+ }
+
# remember whether exons were not in the input file
my $exonArrayWasEmpty;
if(@{$txs{$txid}{"exon"}} == 0){
@@ -291,7 +311,6 @@ sub printConvertedGTF {
}
}
-
__END__
=pod
@@ -315,7 +334,6 @@ gtf2gff.pl <in.gtf --out=out.gff
--printUTR print UTR features
--printIntron print intron features
--gff3 output in gff3 format
- --trcp_pattern regex pattern that identifies trancripts (default: '\.t\d+'), only if GFF is input
=head1 DESCRIPTION
diff --git a/scripts/hal2maf_split.pl b/scripts/hal2maf_split.pl
index e183b62..0ea7091 100755
--- a/scripts/hal2maf_split.pl
+++ b/scripts/hal2maf_split.pl
@@ -33,6 +33,7 @@ OPTIONS
--keepAncestors export ancestral sequences (default: off)
--refSequence S S is the name of the reference sequence within the reference genome
(default: all sequences in the reference genome)
+ --outdir D D is the directory to which the output MAF files are written (default: current directory)
--chunksize N size of the aligment chunk. N is the number of bases in the reference
genome that are covered by the alignment chunks (default: 2500000)
--overlap N overlap between to consecutive alignment chunks. N is the nunber of overlapping
@@ -64,6 +65,7 @@ my $hal_exec_dir;
my $chunksize = 2500000;
my $overlap = 500000;
my $padding = 10000;
+my $outdir;
my $min_intergenic = 2000; # when a list of genic intervals is given,
# all intervals that are within this distance are combined to a single interval
my $cpus = 1;
@@ -78,6 +80,7 @@ GetOptions('halfile:s'=>\$halfile,
'cpus:i' =>\$cpus,
'no_split_list:s' =>\$no_split_list,
'hal_exec_dir:s' =>\$hal_exec_dir,
+ 'outdir:s' =>\$outdir,
'help!'=>\$help);
if ($help){
@@ -106,6 +109,18 @@ if(!defined($keepAncestors)){
$h2m_param.=" --noAncestors";
}
+if(defined($outdir)){
+ if($outdir =~/[^\/]$/){
+ $outdir .= '/';
+ }
+ unless (-e $outdir) {
+ mkdir $outdir;
+ }
+}
+else{
+ $outdir = "";
+}
+
# check whether this perl module for paralell execution is installed
my $got_ForkManager = 0;
eval { require Parallel::ForkManager };
@@ -293,7 +308,7 @@ if($cpus > 1){
my $pid = $pm->start and next;
my ($seq, $start, $end) = ($_->[0], $_->[1], $_->[2]);
my $chunksize = $end - $start + 1;
- my $cmd = "$hal2maf --refGenome $refGenome $h2m_param --refSequence $seq --start $start --length $chunksize $halfile $seq.$start-$end.maf";
+ my $cmd = "$hal2maf --refGenome $refGenome $h2m_param --refSequence $seq --start $start --length $chunksize $halfile $outdir$seq.$start-$end.maf";
print "$cmd\n";
qx($cmd);
my $r_c = $?; # return code
@@ -309,7 +324,7 @@ else{ # export alignment chunks sequentially to maf format
foreach(@aln_chunks){
my ($seq, $start, $end) = ($_->[0], $_->[1], $_->[2]);
my $chunksize = $end - $start + 1;
- my $cmd = "$hal2maf --refGenome $refGenome $h2m_param --refSequence $seq --start $start --length $chunksize $halfile $seq.$start-$end.maf";
+ my $cmd = "$hal2maf --refGenome $refGenome $h2m_param --refSequence $seq --start $start --length $chunksize $halfile $outdir$seq.$start-$end.maf";
print "$cmd\n";
qx($cmd);
my $r_c = $?;
diff --git a/scripts/join_mult_hints.pl b/scripts/join_mult_hints.pl
index bd2b59b..4a55e06 100755
--- a/scripts/join_mult_hints.pl
+++ b/scripts/join_mult_hints.pl
@@ -11,7 +11,7 @@ my $usage = "$0 -- summarize multiple identical hints to one with mult=n\n";
$usage .= "\n";
$usage .= "Usage: $0 <in.psl >joined.psl\n";
$usage .= " PREREQUISITE: input GFF file must be sorted so that hints that should be summarized are below each other\n";
-$usage .= " e.g. do a cat hints.gff | sort -n -k 4,4 | sort -s -n -k 5,5 | sort -s -k 3,3 | sort -s -k 1,1 | join_mult_hints.gff\n";
+$usage .= " e.g. do a cat hints.gff | sort -n -k 4,4 | sort -s -n -k 5,5 | sort -s -k 3,3 | sort -s -k 1,1 | join_mult_hints.pl\n";
my $help=0;
diff --git a/scripts/selectLongestORFs.pl b/scripts/selectLongestORFs.pl
deleted file mode 100755
index e8543e0..0000000
--- a/scripts/selectLongestORFs.pl
+++ /dev/null
@@ -1,20 +0,0 @@
-#!/usr/bin/perl
-
-# Jonas Behr's tool Transcript Skimmer will report two ORFs in assembled transcripts if strand unspecific RNA-Seq data was used for assembly. This script selects and reports the longer of those two transcripts.
-
-# Katharina Hoff, 11.10.2012
-
-my $usage = "selectLongestORFs.pl input.gff > output.gff";
-
-if (@ARGV != 1) {
- print $usage;
- exit;
-}
-
-my
-
-open(INPUT, "<", $ARGV[0]) or die("Could not open input file $ARGV[0]!\n");
-while(<INPUT>){
-
-}
-close(INPUT) or die("Could not close input file $ARGV[0]!\n");
diff --git a/scripts/splitMfasta.pl b/scripts/splitMfasta.pl
index 0e17041..e5900d0 100755
--- a/scripts/splitMfasta.pl
+++ b/scripts/splitMfasta.pl
@@ -68,6 +68,6 @@ while (<SEQ>) {
}
print SPLIT;
if (!/^>/) {
- $cursize += length $_;
+ $cursize += (length $_) - 1;
}
}
diff --git a/scripts/transMap2hints.pl b/scripts/transMap2hints.pl
index 657c57d..384d99e 100755
--- a/scripts/transMap2hints.pl
+++ b/scripts/transMap2hints.pl
@@ -164,20 +164,20 @@ while (<TRANSMAP>) {
$numBlocks = scalar @s;
# start and stop hint
if ($strand eq '+') {
- if ($txStart != $cdsStart && $cdsStart > 0) {
+ if ($txStart != $cdsStart && $cdsStart > 0 && $leftcmpl == 'cmpl') {
@hint = ($cdsStart+1-$start_stop_radius, $cdsStart+3+$start_stop_radius, '+', $qname);
addSignalHint(\@starthints, [@hint]);
}
- if ($txEnd != $cdsEnd && $cdsEnd > 0) {
+ if ($txEnd != $cdsEnd && $cdsEnd > 0 && $rightcmpl == 'cmpl') {
@hint = ($cdsEnd-2-$start_stop_radius, $cdsEnd+$start_stop_radius, '+', $qname);
addSignalHint(\@stophints, [@hint]);
}
} else{
- if ($txStart != $cdsStart && $cdsStart > 0) {
+ if ($txStart != $cdsStart && $cdsStart > 0 && $leftcmpl == 'cmpl') {
@hint = ($cdsStart+1-$start_stop_radius, $cdsStart+3+$start_stop_radius, '-', $qname);
addSignalHint(\@stophints, [@hint]);
}
- if ($txEnd != $cdsEnd && $cdsEnd > 0) {
+ if ($txEnd != $cdsEnd && $cdsEnd > 0 && $rightcmpl == 'cmpl') {
@hint = ($cdsEnd-2-$start_stop_radius, $cdsEnd+$start_stop_radius, '-', $qname);
addSignalHint(\@starthints, [@hint]);
}
@@ -208,72 +208,74 @@ while (<TRANSMAP>) {
for ($i=0; $i<$numBlocks; $i++) {
$from = $s[$i]+1;
$to = $e[$i];
- if ($i==0) {
- if ($from + $utrend_cutoff <= $to) {
- $from += $utrend_cutoff;
- } else {
- $from = $to;
- }
- if ($from > $cdsStart && $cdsStart >= $txStart ) {
- $from = $cdsStart;
+ if ($in[$i] == 1) {
+ if ($i==0) {
+ if ($from + $utrend_cutoff <= $to) {
+ $from += $utrend_cutoff;
+ } else {
+ $from = $to;
}
- }
- if ($i == $numBlocks-1) {
- if ($to - $utrend_cutoff >= $from) {
- $to -= $utrend_cutoff;
- } else {
- $to = $from;
- }
- if ($to < $cdsEnd && $cdsEnd <= $txEnd) {
- $to = $cdsEnd;
+ if ($from > $cdsStart && $cdsStart >= $txStart ) {
+ $from = $cdsStart;
+ }
+ }
+ if ($i == $numBlocks-1) {
+ if ($to - $utrend_cutoff >= $from) {
+ $to -= $utrend_cutoff;
+ } else {
+ $to = $from;
}
- }
- if ($ephintbegin<0 || $ephintend <0) {
- $ephintbegin = $from;
- $ephintend = $to;
- } elsif ((($ephintend < $cdsStart || $ephintbegin>$cdsEnd) && ($ephintend + $min_intron_len_utr + 1 >= $from))||
- ($ephintend + $min_intron_len + 1 >= $from)){
- $ephintend = $to;
- } else { # large gap
- $ifrom = $ephintend+1;
- $ito = $from-1;
- if ($ito-$ifrom+1 >= $min_intron_len && $in[$i-1]) {
- @hint = ($ifrom, $ito, $strand, $qname);
- addIntervalHint(\@intronhints, [@hint]);
- # also add dss and ass hints in case it is an utr intron. those intron hints don't help
- if ($ifrom < $cdsStart || $ifrom > $cdsEnd ) {
- @hint = ($ifrom, $ifrom, $strand, $qname);
- if ($strand eq '+') {
- addSignalHint(\@dsshints, [@hint]);
- } else {
- addSignalHint(\@asshints, [@hint]);
- }
- }
- if ($ito < $cdsStart || $ito > $cdsEnd ) {
- @hint = ($ito, $ito, $strand, $qname);
- if ($strand eq '+') {
- addSignalHint(\@asshints, [@hint]);
- } else {
- addSignalHint(\@dsshints, [@hint]);
- }
- }
- $ifrom += $ip_cutoff;
- $ito -= $ip_cutoff;
- if ($ifrom < $ito && $ifrom > $cdsStart && $ito < $cdsEnd && $ito-$ifrom+1 <= $max_intronpart_len) {
- @hint = ($ifrom, $ito, $strand, $qname);
- addIntervalHint(\@intronparthints, [@hint]);
- }
- }
- addExonpartFuzzyHint($ephintbegin, $ephintend, $strand, $qname);
- $ephintbegin = $from;
- $ephintend = $to;
- }
+ if ($to < $cdsEnd && $cdsEnd <= $txEnd) {
+ $to = $cdsEnd;
+ }
+ }
+ if ($ephintbegin<0 || $ephintend <0) {
+ $ephintbegin = $from;
+ $ephintend = $to;
+ } elsif ((($ephintend < $cdsStart || $ephintbegin>$cdsEnd) && ($ephintend + $min_intron_len_utr + 1 >= $from))||
+ ($ephintend + $min_intron_len + 1 >= $from)){
+ $ephintend = $to;
+ } else { # large gap
+ $ifrom = $ephintend+1;
+ $ito = $from-1;
+ if ($ito-$ifrom+1 >= $min_intron_len && $in[$i-1]) {
+ @hint = ($ifrom, $ito, $strand, $qname);
+ addIntervalHint(\@intronhints, [@hint]);
+ # also add dss and ass hints in case it is an utr intron. those intron hints don't help
+ if ($ifrom < $cdsStart || $ifrom > $cdsEnd ) {
+ @hint = ($ifrom, $ifrom, $strand, $qname);
+ if ($strand eq '+') {
+ addSignalHint(\@dsshints, [@hint]);
+ } else {
+ addSignalHint(\@asshints, [@hint]);
+ }
+ }
+ if ($ito < $cdsStart || $ito > $cdsEnd ) {
+ @hint = ($ito, $ito, $strand, $qname);
+ if ($strand eq '+') {
+ addSignalHint(\@asshints, [@hint]);
+ } else {
+ addSignalHint(\@dsshints, [@hint]);
+ }
+ }
+ $ifrom += $ip_cutoff;
+ $ito -= $ip_cutoff;
+ if ($ifrom < $ito && $ifrom > $cdsStart && $ito < $cdsEnd && $ito-$ifrom+1 <= $max_intronpart_len) {
+ @hint = ($ifrom, $ito, $strand, $qname);
+ addIntervalHint(\@intronparthints, [@hint]);
+ }
+ }
+ addExonpartFuzzyHint($ephintbegin, $ephintend, $strand, $qname);
+ $ephintbegin = $from;
+ $ephintend = $to;
+ }
+ }
+ addExonpartFuzzyHint($ephintbegin, $ephintend, $strand, $qname);
+ $ephintbegin = $from;
+ $ephintend = $to;
+
+ $oldtargetname = $targetname;
}
- addExonpartFuzzyHint($ephintbegin, $ephintend, $strand, $qname);
- $ephintbegin = $from;
- $ephintend = $to;
-
- $oldtargetname = $targetname;
}
printHints();
diff --git a/src/Makefile b/src/Makefile
index 92504b1..183f4ee 100644
--- a/src/Makefile
+++ b/src/Makefile
@@ -31,7 +31,7 @@ OBJS = genbank.o properties.o pp_profile.o pp_hitseq.o pp_scoring.o statemodel.o
intronmodel.o exonmodel.o igenicmodel.o utrmodel.o merkmal.o vitmatrix.o lldouble.o mea.o graph.o \
meaPath.o exoncand.o randseqaccess.o fasta.o ncmodel.o
ifdef COMPGENEPRED
- OBJS += parser/parse.o scanner/lex.o genomicMSA.o geneMSA.o contTimeMC.o compgenepred.o phylotree.o orthograph.o orthoexon.o alignment.o speciesgraph.o
+ OBJS += parser/parse.o scanner/lex.o genomicMSA.o geneMSA.o contTimeMC.o compgenepred.o phylotree.o orthograph.o orthoexon.o alignment.o speciesgraph.o codonMSA.o
LIBS += -lgsl -lgslcblas # for matrix exponentiation that is required in comparative gene finding
LIBS += -llpsolve55 -lcolamd -ldl # for mixed integer linear programming (alignment.cc)
INCLS += -I/usr/include/lpsolve
@@ -58,6 +58,10 @@ CXXFLAGS += -DSQLITE
PROGR += load2sqlitedb getSeq
endif
+ifdef COMPGENEPRED
+PROGR += espoca
+endif
+
all: $(OBJS) $(TOBJS) $(DUMOBJS) $(PROGR) info
.SUFFIXES:
@@ -106,6 +110,10 @@ getSeq: getSeq.cc $(OBJS) $(DUMOBJS)
$(CXX) $(CPPFLAGS) $(CXXFLAGS) $(LDFLAGS) -o $@ $^ $(INCLS) $(LIBS)
cp getSeq ../bin/
+espoca: espoca.cc $(OBJS) $(DUMOBJS)
+ $(CXX) $(CPPFLAGS) $(CXXFLAGS) $(LDFLAGS) -o $@ $^ $(INCLS) $(LIBS)
+ cp espoca ../bin/
+
info:
echo "$(CXXFLAGS)" > $(INFO)
@@ -132,6 +140,7 @@ augustus.o : \
../include/properties.hh \
../include/statemodel.hh \
../include/types.hh \
+ ../include/codonMSA.hh \
augustus.cc
dummy.o : \
@@ -688,6 +697,10 @@ sqliteDB.o: \
../include/sqliteDB.hh \
sqliteDB.cc
+codonMSA.o: \
+ ../include/codonMSA.hh \
+ codonMSA.cc
+
# 1) signed-unsigned comparisons are needed because the methods
# std::vector<T>::size or std::string::length unfortunately
# return unsigned types. Using a negative integer in a
diff --git a/src/augustus.cc b/src/augustus.cc
index 47d2567..339d2e4 100644
--- a/src/augustus.cc
+++ b/src/augustus.cc
@@ -116,8 +116,7 @@ int main( int argc, char* argv[] ){
Gene::init();
GeneticCode::init();
setParameters(); // NOTE: need Constant and GeneticCode to be initialised first
- StateModel::init(); // set global parameters of state models
-
+ StateModel::init(); // set global parameters of state models
if (Constant::MultSpeciesMode){
#ifdef COMPGENEPRED
@@ -224,6 +223,7 @@ int main( int argc, char* argv[] ){
throw ProjectError("File format of " + filename + " not recognized.");
}
} // single species mode
+
// if (verbosity>2)
cout << "# command line:" << endl << "# " << commandline << endl;
@@ -508,7 +508,7 @@ void setParameters(){
cerr << "Warning: The gff3 standard requires that the stop codon is included in the CDS. "
<< "Unless this is your intention, set stopCodonExcludedFromCDS to false in your "
<< "species' configuration file or on the command line." << endl;
-
+
if (Properties::hasProperty("translation_table")){
GeneticCode::chooseTranslationTable(Properties::getIntProperty("translation_table"));
}
diff --git a/src/codonMSA.cc b/src/codonMSA.cc
new file mode 100644
index 0000000..7deb18a
--- /dev/null
+++ b/src/codonMSA.cc
@@ -0,0 +1,146 @@
+/**********************************************************************
+ * file: codonMSA.cc
+ * licence: Artistic Licence, see file LICENCE.TXT or
+ * http://www.opensource.org/licenses/artistic-license.php
+ * descr.: datastructure for the codon alignment
+ * author: Lizzy Gerischer
+ *
+ * date | author | changes
+ * --------|--------------------|------------------------------------------
+ * 14.07.16| Lizzy Gerischer | creation of the file
+ **********************************************************************/
+
+#include "codonMSA.hh"
+#include "exonmodel.hh"
+#include <iostream>
+#include <unistd.h>
+
+using namespace std;
+
+CodonMSA::CodonMSA(string codonAliFilename){
+
+ aliLen = 0;
+ ctree=NULL;
+
+ if(Properties::hasProperty(TREE_KEY)){
+ string treeFilename = Properties::getProperty(TREE_KEY);
+ ctree = new PhyloTree(treeFilename);
+ readAlignment(codonAliFilename);
+ }else{
+ readAlignment(codonAliFilename);
+ ctree = new PhyloTree(speciesNames);
+ }
+
+ vector<string> species;
+ ctree->getSpeciesNames(species);
+ //for(int i = 0; i<species.size();i++)
+ //cout << "species: " << species[i] << " speciesNames: " << speciesNames[i] << endl;
+
+ if(species != speciesNames)
+ throw ProjectError("inconsistent species name vectors");
+
+ /* double ctree_scaling_factor = 1; // scaling factor to scale branch lengths in codon tree to one codon substitution per time unit
+ try {
+ ctree_scaling_factor = Properties::getdoubleProperty("/CompPred/scale_codontree");
+ } catch (...) {
+ ctree_scaling_factor = 1;
+ }
+ if(ctree_scaling_factor <= 0.0){
+ cerr << "No negative scaling factor allowed. /CompPred/scale_codontree must be a positive real number. Will use =1." << endl;
+ ctree_scaling_factor=1;
+ }
+
+ ctree->scaleTree(ctree_scaling_factor); // scale branch lengths to codon substitutions
+ */
+
+vector<double> ct_branchset;
+ ctree->getBranchLengths(ct_branchset);
+ int k = 20; // number of omegas
+ // TODO: codonusage
+
+ //BaseCount::init();
+
+ //PP::initConstants();
+ // NAMGene namgene; // creates and initializes the states
+ StateModel::readAllParameters(); // read in the parameter files: species_{igenic,exon,intron,utr}_probs.pbl
+
+ double *pi = ExonModel::getCodonUsage();
+ /**********
+ double pi[64];
+ cout << "pi: ";
+ for (int i=0; i<64; i++){
+ pi[i] = (double)1/64;
+ cout << pi[i] << " ";
+ }
+ cout << endl;
+ ***********/
+ codonevo.setKappa(4.0);
+ codonevo.setPi(pi);
+ codonevo.setBranchLengths(ct_branchset, 25);
+ codonevo.setOmegas(k);
+ codonevo.setPrior(0.5);
+ if(Constant::useAArates){
+ codonevo.setAAPostProbs();
+ }
+ /*cout << "Omegas, for which substitution matrices are stored:" << endl;
+ codonevo.printOmegas();*/
+ codonevo.computeLogPmatrices();
+
+ // gsl_matrix *P = codonevo.getSubMatrixLogP(0.3, 0.25);
+ // printCodonMatrix(P);
+ //GeneMSA::setCodonEvo(&codonevo);
+}
+
+void CodonMSA::readAlignment(string filename){
+
+ string rowseq;
+ string speciesName;
+
+ if(ctree != NULL){
+ ctree->getSpeciesNames(speciesNames);
+ aliRows.resize(speciesNames.size(),"");
+ }
+
+ ifstream Alignmentfile;
+ Alignmentfile.open(filename.c_str(), ifstream::in);
+ if (!Alignmentfile) {
+ string errmsg = "Could not open the codon alignment file " + filename + ".";
+ throw PropertiesError(errmsg);
+ }
+ while (!Alignmentfile.eof()) {
+ try {
+ Alignmentfile >> speciesName >> rowseq;
+ if(!Alignmentfile.eof()){
+ speciesName.erase(0,1);
+ if(ctree == NULL){
+ aliRows.push_back(rowseq);
+ speciesNames.push_back(speciesName);
+ }else{
+ int pos = find(speciesNames.begin(), speciesNames.end(), speciesName) - speciesNames.begin();
+ if(pos >= speciesNames.size()){
+ throw ProjectError( string("Species ") + speciesName + " not found in phylogenetik tree.");
+ }
+ aliRows[pos] = rowseq;
+ }
+ }
+ // cout << "species name: " << speciesName << "\t rowseq: " << rowseq << endl;
+ } catch (std::ios_base::failure e) {
+ throw ProjectError(string("Could not open file ") + filename + ". Make sure this is not a directory.\n");
+ }
+ if(aliLen){
+ if(aliLen != rowseq.length()){
+ throw ProjectError("codon alignment rows have different size.");
+ }
+ }else{
+ aliLen = rowseq.size();
+ }
+ }
+}
+
+
+void CodonMSA::printOmegaStats(){
+
+ codonevo.graphOmegaOnCodonAli(aliRows, ctree);
+}
+
+
diff --git a/src/compgenepred.cc b/src/compgenepred.cc
index 8b59cac..5f7b493 100644
--- a/src/compgenepred.cc
+++ b/src/compgenepred.cc
@@ -302,7 +302,7 @@ void CompGenePred::start(){
if(printCodons){
codonAli.open(outdir + "orthoexons_codonAlignment.maf");
}
-
+
BaseCount::init();
PP::initConstants();
NAMGene namgene; // creates and initializes the states
@@ -320,7 +320,11 @@ void CompGenePred::start(){
codonevo.setBranchLengths(ct_branchset, 25);
//codonevo.printBranchLengths();
codonevo.setOmegas(20);
+ // TODO: different prior for coding and noncoding
codonevo.setPrior(0.5);
+ if(Constant::useAArates){
+ codonevo.setAAPostProbs();
+ }
/*cout << "Omegas, for which substitution matrices are stored:" << endl;
codonevo.printOmegas();*/
codonevo.computeLogPmatrices();
@@ -479,11 +483,13 @@ void CompGenePred::start(){
geneRange->comparativeSignalScoring(hects);
} catch (...) {}
- if(use_omega)
+ if(use_omega){
geneRange->computeOmegasEff(hects, seqRanges, &ctree, &codonAli); // omega and number of substitutions is stored as OrthoExon attribute
+ // calculates an omega for every single codon alignment and prints wiggle trac for ever reding frame and species combination that exists in an ortho exon
+ //geneRange->printOmegaForCodon(outdir);
//inefficient omega calculation, only use for debugging purpose
//geneRange->computeOmegas(hects, seqRanges, &ctree);
-
+ }
if (conservation)
geneRange->calcConsScore(hects, seqRanges, outdir);
@@ -493,7 +499,7 @@ void CompGenePred::start(){
orthograph.outputGenes(baseGenes,base_geneid);
if(!hects.empty()){
- // optimization via dual decomposition
+ // optimization via dual decomposition
vector< list<Transcript*> *> genelist(OrthoGraph::numSpecies);
orthograph.dualdecomp(hects,evo,genelist,GeneMSA::geneRangeID-1,maxIterations, dd_factors);
orthograph.filterGeneList(genelist,opt_geneid);
diff --git a/src/contTimeMC.cc b/src/contTimeMC.cc
index 925a1f9..2df6ea4 100644
--- a/src/contTimeMC.cc
+++ b/src/contTimeMC.cc
@@ -19,6 +19,7 @@
#include "properties.hh"
#include "phylotree.hh"
#include "geneMSA.hh"
+#include "igenicmodel.hh"
// standard C/C++ includes
#include <iostream>
@@ -39,7 +40,8 @@ Evo::~Evo(){
gsl_matrix_free(allLogPs[i][j]);
}
allLogPs.assign(0, 0, NULL);
- delete[] pi;
+ if(pi != NULL)
+ delete[] pi;
}
/* Determine the branch lengths for which matrices P should be stored, at most m.
@@ -141,7 +143,12 @@ void CodonEvo::setOmegas(int k){
omegas.push_back(1);
for (int i=1; i<=rr; i++)
omegas.push_back(1.0 / (1 - (double) i/(c+r)));
- this->k = k;
+ if(Constant::useNonCodingModel){
+ this->k = k+1;
+ omegas.push_back(0);
+ }
+ else
+ this->k = k;
/*cout<<"omega: ";
for(int j=0; j<omegas.size(); j++){
cout<<omegas[j]<<"\t";
@@ -173,6 +180,80 @@ void CodonEvo::printOmegas(){
cout << i << " " << omegas[i] << endl;
}
+/*
+ * Read BLOSUM from file. BLOSUM file contains joint probabilities of pairs.
+ * Use them to calculate posterior probabilities of AA substitutions.
+ */
+
+void CodonEvo::setAAPostProbs(){
+ aaUsage.resize(20,0);
+ vector<vector<double> > b(20, vector<double>(20));
+ ifstream blosumfile;
+ string filename = Constant::configPath + "profile/default.qij";
+ string buffer = "";
+ //char aaNames[20] = {""};
+ int aaIndex[20] = {-1};
+ char aa = 'X';
+ blosumfile.open(filename.c_str(), ifstream::in);
+ if(!blosumfile){
+ string errmsg = "Could not open the BLOSUM file " + filename + ".";
+ throw PropertiesError(errmsg);
+ }
+ while(blosumfile >> buffer && buffer.substr(0,1) == "#"){
+ blosumfile.ignore( numeric_limits<streamsize>::max(), '\n');
+ }
+ //aaNames[GeneticCode::get_aa_from_symbol(buffer[0])] = buffer[0];
+ aaIndex[0] = GeneticCode::get_aa_from_symbol(buffer[0]);
+ for(int i=1; i<20; i++){
+ blosumfile >> aa;
+ //aaNames[GeneticCode::get_aa_from_symbol(aa)] = aa;
+ aaIndex[i] = GeneticCode::get_aa_from_symbol(aa);
+ }
+
+ for(int i = 0; i < 20; i++){
+ for(int j = 0; j <= i; j++){
+ blosumfile >> b[aaIndex[i]][aaIndex[j]];
+ }
+ }
+ for(int i = 0; i < 20; i++){
+ for(int j = i+1; j < 20; j++){
+ b[aaIndex[i]][aaIndex[j]] = b[aaIndex[j]][aaIndex[i]];
+ }
+ }
+
+ for(int i = 0; i < 20; i++){
+ for(int j = 0; j < 20; j++){
+ aaUsage[aaIndex[i]] += b[aaIndex[j]][aaIndex[i]]; // set aaUsage
+ }
+ }
+
+ /***
+ // print Matrix
+ cout << "blosum: " << endl << "\t";
+ for (int i = 0; i < 20; i++)
+ cout << aaNames[i] << "\t";
+ cout << endl;
+ for(int i = 0; i < 20; i++) {
+ cout << aaNames[i] << "\t";
+ for (int j = 0; j < 20; j++) {
+ cout << b[i][j] << "\t";
+ }
+ cout << endl;
+ }
+ ***/
+
+ // compute posterior probabilities: P(i|j) = P(i,j)/P(j)
+ for(int i = 0; i < 20; i++){
+ for(int j = 0; j < 20; j++){
+ b[i][j] = (b[i][j] / aaUsage[j]);
+ }
+ }
+
+ aaPostProb = b;
+}
+
+
+
/*
* Precompute and store the array of matrices.
* Takes approximate k * m * 0.015 seconds on greif1: Time for eigendecompose is small compared to time for expQt.
@@ -188,7 +269,15 @@ void CodonEvo::computeLogPmatrices(){
for (int u=0; u<k; u++){
omega = omegas[u];
// compute decomposition of Q, which does not require t yet
- Q = getCodonRateMatrix(pi, omega, kappa);
+ if(u < k){
+ if(!aaPostProb.empty()) // use amino acid score in codon rate matrix
+ Q = getCodonRateMatrix(pi, omega, kappa, &aaPostProb);
+ else
+ Q = getCodonRateMatrix(pi, omega, kappa);
+ }else{
+ vector<double> pi_nuc = IGenicModel::getNucleotideProbs();
+ Q = getNonCodingRateMatrix(&pi_nuc, kappa);
+ }
status = eigendecompose(Q, pi, lambda, U, Uinv);
if (status) {
stringstream s;
@@ -295,7 +384,8 @@ CodonEvo::~CodonEvo(){
gsl_matrix *getCodonRateMatrix(double *pi, // codon usage, normalized vector with 64 elements
double omega, // dN/dS, nonsynonymous/synonymous ratio
- double kappa){ // transition/transversion ratio, usually >1
+ double kappa, // transition/transversion ratio, usually >1
+ vector<vector<double> > *aaPostProb){ // posterior probabilities of aa substitutions
gsl_matrix* Q = gsl_matrix_calloc (64, 64); // initialize Q as the zero-matrix
Seq2Int s2i(3);
@@ -304,6 +394,10 @@ gsl_matrix *getCodonRateMatrix(double *pi, // codon usage, normalized vector
vector<int> num_nonsyn(64,0);
vector<int> num_wk(64,0);
+ // numerator and denominator of lambda, the normalizing factor for using amino acid scores in codon rate matrix
+ vector<double> lambda1(64,0);
+ vector<double> lambda2(64,0);
+
// initialize off-diagonal elements
// codon i (row) abc
// codon j (col) dbc
@@ -332,8 +426,13 @@ gsl_matrix *getCodonRateMatrix(double *pi, // codon usage, normalized vector
qij *= kappa; // transition
}
if (GeneticCode::translate(i) != GeneticCode::translate(j)){
- qij *= omega; // non-synonymous subst.
- num_nonsyn[i]++;
+ qij *= omega; // non-synonymous subst.
+ if(aaPostProb != NULL && GeneticCode::map[i] != -1 && GeneticCode::map[j] != -1){
+ //qij *= (*aaPostProb)[GeneticCode::map[i]][GeneticCode::map[j]];
+ lambda1[i] += pi[j];
+ lambda2[i] += pi[j] * (*aaPostProb)[GeneticCode::map[i]][GeneticCode::map[j]];
+ }
+ num_nonsyn[i]++;
}else{
num_syn[i]++;
}
@@ -355,6 +454,19 @@ gsl_matrix *getCodonRateMatrix(double *pi, // codon usage, normalized vector
}
*/
+ // add posterior prob. of AAs and lambda to non-syn. substitutions if animo acid score is used
+ if(aaPostProb != NULL){
+ double qij = 0;
+ for (int i=0; i<64; i++){
+ for (int j=0; j<64; j++){
+ if (GeneticCode::translate(i) != GeneticCode::translate(j) && GeneticCode::map[i] != -1 && GeneticCode::map[j] != -1){
+ qij = gsl_matrix_get(Q, i, j);
+ qij *= (*aaPostProb)[GeneticCode::map[i]][GeneticCode::map[j]] * lambda1[i]/lambda2[i];
+ gsl_matrix_set(Q, i, j, qij);
+ }
+ }
+ }
+ }
// initialize diagonal elements (each row must sum to 0)
double rowsum;
@@ -376,6 +488,72 @@ gsl_matrix *getCodonRateMatrix(double *pi, // codon usage, normalized vector
}
/*
+ * compute rate matrix for non-codong model
+ */
+
+gsl_matrix *getNonCodingRateMatrix(vector<double> *pi_nuc, double kappa){
+
+ gsl_matrix* Q = gsl_matrix_calloc (64, 64); // initialize Q as the zero-matrix
+ Seq2Int s2i(3);
+ vector<double> pi(64,0);
+
+ // initialize off-diagonal elements
+ // codon i (row) abc
+ // codon j (col) dbc
+ // f 012
+ int codoni[3], codonj[3];
+ for (int a=0; a<4; a++){
+ codoni[0] = a;
+ for (int b=0; b<4; b++){
+ codoni[1] = b;
+ for (int c=0; c<4; c++){
+ codoni[2] = c;
+ int i = 16*codoni[0] + 4*codoni[1] + codoni[2]; // in {0,...63}
+ // go through the 3x3 codons that differ from codon i by a single mutation
+ for (int f=0;f<3; f++){ // position of mutation
+ for (int d=0; d<4; d++){ // d = substituted base
+ if (d != codoni[f]){
+ codonj[0] = codoni[0];
+ codonj[1] = codoni[1];
+ codonj[2] = codoni[2];
+ codonj[f] = d;
+ int j = 16*codonj[0] + 4*codonj[1] + codonj[2]; // in {0,...63}
+ double qij = (*pi_nuc)[codonj[f]];
+ pi[i] = (*pi_nuc)[codonj[f]];
+ if (GeneticCode::is_purine(codonj[f]) == GeneticCode::is_purine(codoni[f])){
+ qij *= kappa; // transition
+ }
+ gsl_matrix_set (Q, i, j, qij);
+ }
+ }
+ }
+ }
+ }
+ }
+
+ // initialize diagonal elements (each row must sum to 0)
+ double rowsum;
+ double scale = 0.0; // factor by which matrix must be scaled to achieve one expected mutation per time unit
+ for (int i=0; i<64; i++){
+ rowsum = 0.0;
+ for (int j=0; j<64; j++)
+ rowsum += gsl_matrix_get(Q, i, j);
+ gsl_matrix_set(Q, i, i, -rowsum); // q_{i,i} = - sum_{j!=i} q_{i,j}
+ scale += rowsum * pi[i];
+ }
+ if (scale != 0.0)
+ scale = 1.0/scale;
+ else
+ scale = 1.0; // should not happen
+ // normalize Q so that the exptected number of codon mutations per time unit is 1
+ gsl_matrix_scale(Q, scale);
+
+ return Q;
+
+}
+
+
+/*
* perform a decompososition of the rate matrix as Q = U * diag(lambda) * U^{-1}
*/
int eigendecompose(gsl_matrix *Q, // input
@@ -886,81 +1064,140 @@ vector<double> CodonEvo::loglikForCodonTuple(vector<string> &seqtuple, PhyloTree
}
double CodonEvo::graphOmegaOnCodonAli(vector<string> &seqtuple, PhyloTree *tree){
- if (seqtuple.size() != tree->numSpecies())
- throw ProjectError("CodonEvo::estOmegaOnSeqTuple: inconsistent number of species.");
- for(int i=1; i<seqtuple.size();i++){
- if(seqtuple[0].length() != seqtuple[i].length()){
- throw ProjectError("CodonEvo::estOmegaOnSeqTuple: wrong exon lengths");
- }
+ if (seqtuple.size() != tree->numSpecies())
+ throw ProjectError("CodonEvo::graphOmegaOnCodonAli: inconsistent number of species. Tree and alignment file must have the same (number of) species.");
+
+ vector<string> speciesnames;
+ tree->getSpeciesNames(speciesnames);
+ int n = 0; // number of nucleotide triples
+
+ for(int i=0; i<seqtuple.size();i++){
+ if(seqtuple[i].length() != 0){
+ n = seqtuple[i].length()/3;
+ break;
}
-
- int n = seqtuple[0].length()/3; // number of nucleotide triples
- int numCodons;
- double Eomega, loglik, sum;
- Seq2Int s2i(3);
- vector<double> logliks(k, 0.0);
- vector<double> postprobs(k, 0.0);
- for (int i=0; i<n; i++){
- Eomega = sum = 0.0;
- for (int u=0; u < k; u++){ // loop over omegas
- vector<int> codontuple(tree->numSpecies(), 64); // 64 = missing codon
- numCodons = 0;
- for(size_t s=0; s < tree->numSpecies(); s++){
- if (seqtuple[s].size()>0)
- try {
- codontuple[s] = s2i(seqtuple[s].c_str() + 3*i);
- numCodons++;
- } catch(...){} // gap or n character
- }
- if (numCodons >= 2){
- loglik = tree->pruningAlgor(codontuple, this, u);
- logliks[u] += loglik;
- }
+ }
+ int numCodons;
+ double Eomega, loglik, sum;
+ Seq2Int s2i(3);
+ vector<double> logliks(k, 0.0);
+ vector<double> postprobs(k, 0.0);
+ // output: stats of codon alignment sites
+ vector<char> aminoAcidsRef(n,'\0');
+ vector<int> refPos(n,-1);
+ vector<int> numSubst(n,-1);
+ vector<double> postmeanSite(n,0.0);
+ vector<double> stdPostmeanSite(n,0.0);
+ vector<double> postProb_gt1(n,0.0);
+ int codonIdx = 0;
+ int refCodonIdx = 0;
+
+ for (int i=0; i<n; i++){
+ vector<double> logliksSite(k,0.0);
+ Eomega = sum = 0.0;
+ vector<int> codontuple(tree->numSpecies(), 64); // 64 = missing codon
+ numCodons = 0;
+ PhyloTree pruned_tr(*tree);
+ for(size_t s=0; s < tree->numSpecies(); s++){
+ if (seqtuple[s].size()>0){
+ try {
+ codontuple[s] = s2i(seqtuple[s].c_str() + 3*i);
+ numCodons++;
+ if(s == 0){
+ refPos[codonIdx] = refCodonIdx;
+ refCodonIdx++;
+ }
+ } catch(...){ // gap or n character
+ pruned_tr.drop(speciesnames[s]);
+ }
+ }else{ // species missing in alignfile
+ pruned_tr.drop(speciesnames[s]);
+ }
+ }
+ if(codontuple[0] == 64)
+ aminoAcidsRef[codonIdx] = '-';
+ else
+ aminoAcidsRef[codonIdx] = GeneticCode::translate(codontuple[0]);
+
+ numSubst[codonIdx] = pruned_tr.fitch(codontuple);
+ if (numCodons >= 2){
+ for (int u=0; u < k; u++){ // loop over omegas
+ loglik = pruned_tr.pruningAlgor(codontuple, this, u);
+ logliks[u] += loglik;
+ logliksSite[u] += loglik;
+ }
+ double meanloglik(0.0);
+ for (int u=0; u < k; u++)
+ meanloglik += logliksSite[u];
+ meanloglik /= k;
+
+ for (int u=0; u < k; u++){
+ sum += postprobs[u] = exp(logliksSite[u]) * omegaPrior[u];
+ }
+ for (int u=0; u < k; u++){
+ postprobs[u] /= sum;
+ }
+ for (int u=0; u < k; u++){
+ Eomega += postprobs[u] * omegas[u];
+ }
+ postmeanSite[codonIdx] = Eomega;
+ for (int u=0; u < k; u++)
+ stdPostmeanSite[codonIdx] += postprobs[u] * pow(omegas[u] - Eomega, 2);
+
+ /***
+ for(size_t s=0; s < pruned_tr.numSpecies(); s++){
+ if (seqtuple[s].size()>0)
+ cout << codontuple[s] << "\t" << seqtuple[s].substr(i*3,3) << endl;
+ }
+ cout << "index\tomega\tloglik\tmeanloglik\tpostProb\tsum\tpostMean" << endl;
+ for(int u=0; u < k; u++){
+ cout << u << "\t" << omegas[u] << "\t" << logliksSite[u] << "\t" << meanloglik << "\t" << postprobs[u] << "\t" << sum << "\t" << Eomega << endl;
+ }
+ ***/
+
+ for(int u=0; u<k; u++){
+ if(omegas[u] > 1){
+ postProb_gt1[codonIdx] += postprobs[u];
}
+ }
}
+ codonIdx++;
+ }
+
+ cout << setw(10) << "ali_pos" << setw(10) << "ref_pos" << setw(10) << "AS_ref" << setw(10) << "Pr(w>1)" << setw(10) << "post_mean" << setw(4) << "+-" << setw(10) << "SE_for_w" << setw(10) << "num_subst" << endl;
+ for(int i = 0; i < codonIdx; i++){
+ cout << setw(10)<< i << setw(10) << refPos[i] << setw(10) << aminoAcidsRef[i] << setw(10) << postProb_gt1[i];
+ if(postProb_gt1[i] > 0.95)
+ cout << "*";
+ if(postProb_gt1[i] > 0.99)
+ cout << "*";
+ cout << setw(10) << postmeanSite[i] << setw(4) << "+-" << setw(10) << stdPostmeanSite[i] << setw(10) << numSubst[i] << endl;
+ }
+
// posterior mean estimate of omega
double meanloglik(0.0);
for (int u=0; u < k; u++)
- meanloglik += logliks[u];
+ meanloglik += logliks[u];
meanloglik /= k;
sum = 0.0;
for (int u=0; u < k; u++)
- sum += postprobs[u] = exp(logliks[u] - meanloglik) * omegaPrior[u];
- // cout << "posterior distribution of omega" << endl;
+ sum += postprobs[u] = exp(logliks[u] - meanloglik) * omegaPrior[u];
+ // cout << "posterior distribution of omega" << endl;
for (int u=0; u < k; u++){
- postprobs[u] /= sum;
- // cout << omegas[u] << " " << postprobs[u] << endl;
+ postprobs[u] /= sum;
+ // cout << omegas[u] << " " << postprobs[u] << endl;
}
Eomega = 0.0;
for (int u=0; u < k; u++){
- Eomega += postprobs[u] * omegas[u];
+ Eomega += postprobs[u] * omegas[u];
}
- // cout << "Eomega=" << Eomega << endl;
- // count number of substitutions
- //int subst;
-
- // settings to reduce MAP algorithm to Fitch Algorithm
- // vector<double> weights(tree->numSpecies(),0);
- //Parsimony parsi;
- //parsi.computeLogPmatrices();
- //Evo *parsi_base = &parsi;
- /* cout << "graph substitutions" << endl;
- for (int i=0; i<n; i++){
- vector<int> codontuple(tree->numSpecies(), 64);
- numCodons=0;
- for(size_t s=0; s < tree->numSpecies(); s++){
- if (seqtuple[s].size() > 0)
- try {
- codontuple[s] = s2i(seqtuple[s].c_str() + 3*i);
- numCodons++;
- } catch(...){} // gap or n character
- }
- if(numCodons >= 2){
- PhyloTree temp(*tree); // only use a copy of the tree !!!
- subst = -temp.MAP(codontuple, weights, parsi_base, 1, true); // Fitch Algorithm
- //cout << i << "\t" << subst << endl;
- }
- }*/
+
+ /* cout << "whole alignment: " << endl << "index\tomega\tloglik\tmeanloglik\tpostProb\tsum\tpostMean" << endl;
+ for(int u=0; u < k; u++){
+ cout << u << "\t" << omegas[u] << "\t" << logliks[u] << "\t" << meanloglik << "\t" << postprobs[u] << "\t" << sum << "\t" << Eomega << endl;
+ }
+ */
+ cout << endl << "# posterior mean estimate of omega for whole alignment : " << Eomega << endl;
return Eomega;
}
diff --git a/src/cxxflags b/src/cxxflags
index 896b1d9..94005a0 100644
--- a/src/cxxflags
+++ b/src/cxxflags
@@ -1 +1 @@
--Wall -Wno-sign-compare -Wno-strict-overflow -ansi -pedantic -O3 -DZIPINPUT
+-Wall -Wno-sign-compare -Wno-strict-overflow -ansi -pedantic -O3
diff --git a/src/espoca.cc b/src/espoca.cc
new file mode 100644
index 0000000..b2ba944
--- /dev/null
+++ b/src/espoca.cc
@@ -0,0 +1,174 @@
+/**********************************************************************
+ * file: espoca.cc
+ * licence: Artistic Licence, see file LICENCE.TXT or
+ * http://www.opensource.org/licenses/artistic-license.php
+ *
+ * authors: Lizzy Gerischer
+ *
+ * date | author | changes
+ * ---------|-----------------|------------------------------------------
+ * 05.08.16 | Lizzy Gerischer | creation of the file
+ **********************************************************************/
+
+// project includes
+#include "types.hh"
+#include "gene.hh"
+#include "genbank.hh"
+#include "namgene.hh"
+#include "evaluation.hh"
+#include "statemodel.hh"
+#include "codonMSA.hh"
+#ifdef COMPGENEPRED
+#include "compgenepred.hh"
+#endif
+// standard C/C++ includes
+#include <fstream>
+#include <sys/stat.h>
+#include <getopt.h> /* for getopt_long; standard getopt is in unistd.h */
+#include <stdlib.h> /* for exit() */
+
+
+/*
+ * Set the global variables according to command line options or configuration file
+ */
+
+void printUsage();
+void printIntro();
+
+/*
+ * main
+ */
+int main( int argc, char* argv[] ){
+ string configfile;
+ string commandline;
+ int errorcode = 0;
+ string species;
+ int help = 0;
+
+
+ LLDouble::setOutputPrecision(3);
+
+
+ for (int i=0; i<argc; i++){
+ commandline += argv[i];
+ if (i<argc-1)
+ commandline += " ";
+ }
+
+ static struct option long_options[] = {
+ {"species",1, 0, 's'},
+ {"alnfile",1, 0, 'a'},
+ {"treefile",1, 0, 't'},
+ {"help",0,0,'h'},
+ {"useAminoAcidRates",1,0,'r'},
+ {0,0,0,0}
+ };
+
+ int option_index = 0;
+ int c;
+ while ((c = getopt_long(argc, argv, "s:a:t:r:h", long_options, &option_index)) != -1) {
+ switch(c)
+ {
+ case 's':
+ species = optarg;
+ break;
+ case 'a':
+ Constant::codonalnfile = optarg;
+ break;
+ case 't':
+ Constant::treefile = optarg;
+ break;
+ case 'r':
+ Constant::useAArates = optarg;
+ break;
+ case 'h':
+ help=1;
+ break;
+ }
+ }
+
+ if (help){
+ printUsage();
+ exit(1);
+ }
+ if (species.empty()){
+ cerr << "Missing species name." << endl;
+ printUsage();
+ exit(1);
+ }
+ if (Constant::codonalnfile.empty()){
+ cerr << "Missing codon alignment file." << endl;
+ printUsage();
+ exit(1);
+ }
+ if(Constant::treefile.empty()){
+ cerr << "Warning: No treefile spezified. Using startree with branchlength of one." << endl;
+ }
+
+ try{
+ Properties::init( argc, argv );
+ Constant::init();
+ // Gene::init();
+ GeneticCode::init();
+ if (Properties::hasProperty("translation_table")){
+ GeneticCode::chooseTranslationTable(Properties::getIntProperty("translation_table"));
+ }
+
+ // setParameters(); // NOTE: need Constant and GeneticCode to be initialised first
+ StateModel::init(); // set global parameters of state models
+
+ // calculate omega on input codon alignment
+
+ clock_t start;
+ start = clock();
+ // CompGenePred cgp;
+ //cgp.start();
+
+ CodonMSA cAli(Constant::codonalnfile);
+ printIntro();
+
+ cAli.printOmegaStats();
+ cout << "# total time: " << (double) (clock()-start) / CLOCKS_PER_SEC << "s" << endl;
+
+
+ // if (verbosity>2)
+ cout << "# command line:" << endl << "# " << commandline << endl;
+
+ } catch( ProjectError& err ){
+ cerr << "\n" << argv[0] << ": ERROR\n\t" << err.getMessage( ) << "\n\n";
+ errorcode=1;
+ } catch ( HelpException help ) {
+ cerr << help.message << endl;
+ }
+ // if (outputfile.is_open())
+ // outputfile.close();
+ // if (errorfile.is_open())
+ // errorfile.close();
+ return errorcode;
+}
+
+
+void printUsage(){
+
+ cerr << "\nESPOCA - Estimate Selective Pressure on Codon Alignments\n\n";
+ cerr << "USAGE:\nespoca [options] --species=SPECIES --alnfile=ALNFILE --treefile=TREEFILE > outfile\n\n";
+ cerr << "DESCRIPTON:\n\
+ SPECIES species parameter for calculation of the codon usage. type 'augustus --species=help' to see what species are available\n\
+ ALNFILE codon alignment file in multi fasta format\n\
+ TREEFILE phylogenetik tree with branchlength in newick format (startree is used if not specified)\n\n";
+ cerr << "OPTIONS:\n\
+ --help print this usage\n";
+}
+
+void printIntro(){
+
+ cout << "#\n# ESPOCA - Estimate Selective Preassure on Codon Alignments.\n#\n";
+ cout << "# Description of the table columns:\n# ali_pos ref_pos AS_ref Pr(w>1) post_mean +- SE_for_w num_subst\n";
+ cout << "# 1. ali_pos position of codon site in the alignment\n";
+ cout << "# 2. ref_pos position of codon in reference species (first species in the alignment file), -1 if gap in reference\n";
+ cout << "# 3. AS_ref amino acid of reference sequence at ref_pos\n";
+ cout << "# 4. Pr(w>1) probability of omega > 1 at alipos (*: Pr(w>1) > 0.90, **: Pr(w>1) > 0.95)\n";
+ cout << "# 5. post_mean posterior mean estimate of omega at ali_pos\n";
+ cout << "# 6. SE_for_w standard deviation of omega at ali_pos\n";
+ cout << "# 7. num_subst number of subsitution calculated by the Fitch algorithm\n\n";
+}
diff --git a/src/gene.cc b/src/gene.cc
index f0bda43..31cef87 100644
--- a/src/gene.cc
+++ b/src/gene.cc
@@ -2485,7 +2485,8 @@ void filterGenePrediction(list<Transcript*> &gl, list<Transcript*> &filteredTran
// delete gene if the combined CDS is too short, unless a CDS exon is truncated
Gene *g = dynamic_cast<Gene *>(*git);
if (g && ((g->clength < Constant::min_coding_len && g->completeCDS())
- || (g->hasInFrameStop(annoseq) && noInFrameStop)))
+ || (g->hasInFrameStop(annoseq) && noInFrameStop)
+ || (g->clength < 4 && g->clength < Constant::min_coding_len && !g->completeCDS())))
keep = false;
if (keep && (*git)->hasProbs) {
diff --git a/src/geneMSA.cc b/src/geneMSA.cc
index 08aaf90..0e81f65 100644
--- a/src/geneMSA.cc
+++ b/src/geneMSA.cc
@@ -1,3 +1,4 @@
+
/**********************************************************************
* file: geneMSA.cc
* licence: Artistic Licence, see file LICENCE.TXT or
@@ -40,13 +41,13 @@ vector<ofstream*> GeneMSA::omega_outfiles;
unordered_map< bit_vector, PhyloTree*, boost::hash<bit_vector>> GeneMSA::topologies;
map<vector<string>, pair<vector<double>, int> > GeneMSA::computedCumValues;
+
/*
* constructor of GeneMSA
*/
GeneMSA::GeneMSA(RandSeqAccess *rsa, Alignment *a) {
int maxDNAPieceSize = Properties::getIntProperty( "maxDNAPieceSize" );
-
this->rsa = rsa;
alignment = a;
if (!alignment)
@@ -56,6 +57,7 @@ GeneMSA::GeneMSA(RandSeqAccess *rsa, Alignment *a) {
+ ") is not matching the one in the tree (" + itoa(rsa->getNumSpecies()) + ").");
ltree = NULL; // locus/gene tree, may be different from species tree
exoncands.resize(alignment->numRows(), NULL);
+
/** construct the gene ranges
* now: simple copy. TODO: extend region when apparently part of the alignment is missing
* human ***********---*******************
@@ -560,17 +562,29 @@ void GeneMSA::printSingleOrthoExon(OrthoExon &oe, bool files) {
else
cout << ";VarOmega=" << oe.getVarOmega();
}
- if (oe.getLeftOmega() >= 0.0){
+ if (oe.getLeftExtOmega() >= 0.0){
if (GBrowseStyle)
- cout << "|" << oe.getLeftOmega();
+ cout << "|" << oe.getLeftExtOmega();
else
- cout << ";leftBoundaryOmega=" << oe.getLeftOmega();
+ cout << ";leftBoundaryExtOmega=" << oe.getLeftExtOmega();
+ }
+ if (oe.getRightExtOmega() >= 0.0){
+ if (GBrowseStyle)
+ cout << "|" << oe.getRightExtOmega();
+ else
+ cout << ";rightBoundaryExtOmega=" << oe.getRightExtOmega();
}
- if (oe.getRightOmega() >= 0.0){
+ if (oe.getLeftIntOmega() >= 0.0){
if (GBrowseStyle)
- cout << "|" << oe.getRightOmega();
+ cout << "|" << oe.getLeftIntOmega();
else
- cout << ";rightBoundaryOmega=" << oe.getRightOmega();
+ cout << ";leftBoundaryIntOmega=" << oe.getLeftIntOmega();
+ }
+ if (oe.getRightIntOmega() >= 0.0){
+ if (GBrowseStyle)
+ cout << "|" << oe.getRightIntOmega();
+ else
+ cout << ";rightBoundaryIntOmega=" << oe.getRightIntOmega();
}
if (oe.getSubst() >= 0){ // number of substitutions
if (GBrowseStyle)
@@ -685,6 +699,8 @@ vector<string> GeneMSA::getCodonAlignment(OrthoExon const &oe, vector<AnnoSequen
ExonCandidate *ec = oe.orthoex[s];
int firstCodonBase = oe.getStartInWindow(s) + ( (offsets[s] + ec->getFirstCodingBase() - oe.getStartInWindow(s)) % 3);
int lastCodonBase = oe.getEndInWindow(s) - ( (oe.getEndInWindow(s) - (offsets[s] + ec->getLastCodingBase())) % 3);
+ int firstCodonBaseOE = ec->getFirstCodingBase() + offsets[s];
+ int lastCodonBaseOE = ec->getLastCodingBase() + offsets[s];
//cout << " firstCodingBase: " << ec->getFirstCodingBase() + offsets[s] << " lastCodingBase: " << ec->getLastCodingBase() + offsets[s] << endl;
//cout<<" firstCodonBase in window: "<<firstCodonBase<<" lastCodonBase in window: "<<lastCodonBase<<" frame: "<<(firstCodonBase % 3)<<endl;
if ((lastCodonBase - firstCodonBase + 1) % 3 != 0)
@@ -718,7 +734,6 @@ vector<string> GeneMSA::getCodonAlignment(OrthoExon const &oe, vector<AnnoSequen
+ (aliPosOf3rdBase - aliPosOf2ndBase - 1);
//cout << "key:" << chrCodon1 << " " << aliPosOf1stBase << " " << (aliPosOf2ndBase - aliPosOf1stBase - 1) << " " << (aliPosOf3rdBase - aliPosOf2ndBase - 1) << " / " << key << endl;
acit = alignedCodons->find(key);
- oeit = codonAliOE.find(key);
if (acit == alignedCodons->end()){ // insert new vector
vector<int> cod(k, -1); // -1 missing codon
cod[s] = chrCodon1;
@@ -730,12 +745,15 @@ vector<string> GeneMSA::getCodonAlignment(OrthoExon const &oe, vector<AnnoSequen
}
acit->second[s] = chrCodon1;
}
- if(oeit == codonAliOE.end()){
- vector<int> cod(k, -1); // -1 missing codon
- cod[s] = chrCodon1;
- codonAliOE.insert(pair<unsigned,vector<int> >(key, cod));
- }else{
- oeit->second[s] = chrCodon1;
+ if(firstCodonBaseOE >= firstCodonBase && lastCodonBaseOE <= lastCodonBase){
+ oeit = codonAliOE.find(key);
+ if(oeit == codonAliOE.end()){
+ vector<int> cod(k, -1); // -1 missing codon
+ cod[s] = chrCodon1;
+ codonAliOE.insert(pair<unsigned,vector<int> >(key, cod));
+ }else{
+ oeit->second[s] = chrCodon1;
+ }
}
}
}
@@ -950,8 +968,20 @@ void GeneMSA::computeOmegasEff(list<OrthoExon> &orthoExonsList, vector<AnnoSeque
froms[s] = alignment->rows[s]->frags.begin();
cumOmega.clear();
+ codonOmega.clear();
+
map<int, posElements> aliPos; // contains all positions where either an orthoExon or a bitvector starts or ends
- map<unsigned, vector<int> > alignedCodons;
+ map<unsigned, vector<int> > alignedCodons;
+ /*
+ * Store for each aligned codon the triplet of alignment columns encoded in a single long integer
+ * key = aliPosOf1stBase * 2^8 + gapsTo2ndBase * 2^4 + gapsTo3rdBase
+ * This assumes even on a rare 32 bit machine only that the alignment is shorter than 16,777,216,
+ * and that gaps within a codon are at most 15bp. Where this is violated, wrong codon alignments
+ * may happen.
+ * Values of alignedCodons are pairs of 1) species index s and 2) the chromosomal position of the
+ * first codon base.
+ */
+
alignedCodons.insert(pair<unsigned, vector<int> >(0,vector<int>(numSpecies(),-1))); // guaratee that codon alignment starts before first OrthoExon
vector<vector<int> > posStoredCodons(numSpecies(),vector<int>(3,0)); // stores the position of the last codon aligned in getCodonAlignment() for each species and reading frame
@@ -976,10 +1006,19 @@ void GeneMSA::computeOmegasEff(list<OrthoExon> &orthoExonsList, vector<AnnoSeque
int windowEnd = min(alignment->aliLen - oe->getAliEnd(), Constant::oeExtensionWidth);
map<int, posElements>::iterator start = aliPos.find(oe->getAliStart());
map<int, posElements>::iterator end = aliPos.find(oe->getAliEnd());
+ // add two windows that extend the OE at both bounadries
map<int, posElements>::iterator leftBoundaryWindowStart = aliPos.find(oe->getAliStart() - windowStart);
map<int, posElements>::iterator leftBoundaryWindowEnd = aliPos.find(oe->getAliStart() - 1);
map<int, posElements>::iterator rightBoundaryWindowStart = aliPos.find(oe->getAliEnd() + 1);
map<int, posElements>::iterator rightBoundaryWindowEnd = aliPos.find(oe->getAliEnd() + windowEnd);
+ // add two windows inside OE at both boundaries
+ map<int, posElements>::iterator leftBoundaryWindowStartInside = start;
+ map<int, posElements>::iterator leftBoundaryWindowEndInside = aliPos.find(oe->getAliStart() + min(oe->getAliLen(), Constant::oeExtensionWidth));
+ map<int, posElements>::iterator rightBoundaryWindowStartInside = aliPos.find(oe->getAliEnd() - min(oe->getAliLen(), Constant::oeExtensionWidth));
+ map<int, posElements>::iterator rightBoundaryWindowEndInside = end;
+
+
+ // order is important! iterative start and end positions are assumed
list<pair<map<int, posElements>::iterator, int> > tlist;
tlist.push_back(make_pair(start, oe->getAliStart()));
tlist.push_back(make_pair(end, oe->getAliEnd()));
@@ -987,6 +1026,11 @@ void GeneMSA::computeOmegasEff(list<OrthoExon> &orthoExonsList, vector<AnnoSeque
tlist.push_back(make_pair(leftBoundaryWindowEnd, oe->getAliStart() - 1));
tlist.push_back(make_pair(rightBoundaryWindowStart, oe->getAliEnd() + 1));
tlist.push_back(make_pair(rightBoundaryWindowEnd, oe->getAliEnd() + windowEnd));
+ tlist.push_back(make_pair(leftBoundaryWindowStartInside, oe->getAliStart()));
+ tlist.push_back(make_pair(leftBoundaryWindowEndInside, oe->getAliStart() + min(oe->getAliLen(), Constant::oeExtensionWidth)));
+ tlist.push_back(make_pair(rightBoundaryWindowStartInside, oe->getAliEnd() - min(oe->getAliLen(), Constant::oeExtensionWidth)));
+ tlist.push_back(make_pair(rightBoundaryWindowEndInside, oe->getAliEnd()));
+
for (list<pair<map<int, posElements>::iterator, int> >::iterator lit = tlist.begin(); lit != tlist.end(); ++lit){
pair<map<int, posElements>::iterator, int> aliPosIt = *lit;
@@ -1071,11 +1115,11 @@ void GeneMSA::computeOmegasEff(list<OrthoExon> &orthoExonsList, vector<AnnoSeque
cout<<" strand in current gene range!"<<endl;
continue;
}
-
+
// walk through codon alignment left to right
for(map<unsigned, vector<int> >::iterator codonIt = alignedCodons.begin(); codonIt != alignedCodons.end(); codonIt++){
-
- /*cout<<"++++codon: "<<(codonIt->first >> 8)<<endl<<"chrom Pos / RFC : "<<endl;
+ /*
+ cout<<"++++codon: "<<(codonIt->first >> 8)<<endl<<"chrom Pos / RFC : "<<endl;
for(vector<int>::iterator cit=codonIt->second.begin(); cit!=codonIt->second.end(); cit++){
cout<<*cit<<" / "<<(*cit % 3)<<endl;
}
@@ -1212,7 +1256,7 @@ void GeneMSA::computeOmegasEff(list<OrthoExon> &orthoExonsList, vector<AnnoSeque
}
aliPosIt++;
}
-
+
// compute omega for current codon alignment
// generate array of strings representing one codon alignment
vector<string> codonStrings(numSpecies(),"");
@@ -1265,6 +1309,10 @@ void GeneMSA::computeOmegasEff(list<OrthoExon> &orthoExonsList, vector<AnnoSeque
int subs = 0; // store number of substitutions
vector<double> loglik;
vector<string> cs = pruneToBV(&codonStrings, bvit->first);
+ // scipt the next step if cs only consists of "---" entries
+ if(cs[0] == "---" && adjacent_find(cs.begin(), cs.end(), not_equal_to<string>()) == cs.end())
+ continue;
+
map<vector<string>, pair<vector<double>, int> >::iterator oit = computedCumValues.find(cs);
if(oit==computedCumValues.end()){
if(Constant::computeNumSubs)
@@ -1277,7 +1325,37 @@ void GeneMSA::computeOmegasEff(list<OrthoExon> &orthoExonsList, vector<AnnoSeque
loglik = oit->second.first;
subs = oit->second.second;
}
-
+ // calculate columnwise omega and store in appropriate data structure
+ /*
+ //cout << "calculate omega for codon " << (codonIt->first >> 8) << " ...";
+ vector<int> pruned_rfc = pruneToBV(&rfc, bvit->first);
+ //cout << "current (reduced) RFC " << printRFC(pruned_rfc) << endl;
+ map<bit_vector, map<vector<int>, vector<double> > >::iterator omegaIt = codonOmega.find(bvit->first);
+ if(omegaIt==codonOmega.end()){
+ map<vector<int>, vector<double> > currRFC;
+ vector<double> o(alignment->aliLen,-1);
+ o[codonIt->first >> 8] = omegaForCodonTuple(&loglik);
+ currRFC.insert(pair<vector<int>, vector<double> >(pruned_rfc, o));
+ codonOmega.insert(pair<bit_vector, map<vector<int>, vector<double> > >(bvit->first, currRFC));
+ int sum_of_rfc = 0;
+ for(map<bit_vector, map<vector<int>, vector<double> > >::iterator oi = codonOmega.begin(); oi != codonOmega.end(); oi++){
+ sum_of_rfc += oi->second.size();
+ }
+ cout << "size of codonOmega: " << codonOmega.size() << "\tsum of RFCs: " << sum_of_rfc << endl;
+ }else{
+ map<vector<int>, vector<double> >::iterator rfcIt = omegaIt->second.find(pruned_rfc);
+ if(rfcIt == omegaIt->second.end()){
+ vector<double> o(alignment->aliLen,-1);
+ o[codonIt->first >> 8] = omegaForCodonTuple(&loglik);
+ omegaIt->second.insert(pair<vector<int>, vector<double> >(pruned_rfc, o));
+ }else{
+ if(rfcIt->second[codonIt->first >> 8] != -1)
+ cerr << "Warning: omega was already calculated for same alignment position of first codon, bit_vector and RFC!" << endl;
+ rfcIt->second[codonIt->first >> 8] = omegaForCodonTuple(&loglik);
+ }
+ }
+ */
+ //cout << "done" << endl;
//cout<<"loglik of omega: "<<loglik<<endl;
// store cumulative sum of omega, omega squared and one
cv->addLogliks(&loglik);
@@ -1294,11 +1372,11 @@ void GeneMSA::computeOmegasEff(list<OrthoExon> &orthoExonsList, vector<AnnoSeque
//cout << "+++ process orthoExon that start or end after the end of the codon alignment!"<<endl;
int lastPos = aliPosIt->first;
while(aliPosIt != aliPos.end()){ // process remaining orthoExon ends
- if(aliPosIt->second.oeStart.size() > 0){
- //cerr<<"Warning: there are still orthoexon(s) beginning although codon alignment ended"<<endl;
- }
+ //if(aliPosIt->second.oeStart.size() > 0)
+ //cerr<<"Warning: there are still orthoexon(s) beginning although codon alignment ended"<<endl;
+
for(int i=0; i<aliPosIt->second.oeEnd.size(); i++){
- //cout<<"################ortho exon ("<<aliPosIt->second.oeEnd[i]->ID<<") ends: "<<aliPosIt->second.oeEnd[i]->getAliStart()<<":"<<aliPosIt->second.oeEnd[i]->getAliEnd()<<endl;
+ //cout<<"################ortho exon ("<<aliPosIt->second.oeEnd[i]->ID<<") ends after aliEnd: "<<aliPosIt->second.oeEnd[i]->getAliStart()<<":"<<aliPosIt->second.oeEnd[i]->getAliEnd()<<endl;
cumValues *cv;
if(aliPosIt->second.oeEnd[i]->getAliStart() >= lastPos){
cv = NULL;
@@ -1315,6 +1393,7 @@ void GeneMSA::computeOmegasEff(list<OrthoExon> &orthoExonsList, vector<AnnoSeque
}
aliPosIt++;
}
+ //printOmegaForCodon(outdir); need to parse outdir
}
cout<<"compute omegas done"<<endl;
}
@@ -1328,6 +1407,66 @@ vector<string> GeneMSA::pruneToBV(vector<string> *cs, bit_vector bv){
return cs_pruned;
}
+// prune RFC so that only active bitvector is used
+vector<int> GeneMSA::pruneToBV(vector<int> *rfc, bit_vector bv){
+ vector<int> rfc_pruned(numSpecies(),-1);
+ for(int s = 0; s < numSpecies(); s++)
+ if(bv[s])
+ rfc_pruned[s] = (*rfc)[s];
+ return rfc_pruned;
+}
+
+
+
+double GeneMSA::omegaForCodonTuple(vector<double> *loglik){
+
+ if(loglik==NULL)
+ cerr << "no likelihood was calculated in this pruning step" << endl;
+ double sum = 0;
+ int k = codonevo->getK();
+ vector<double> postprobs(k, 0.0);
+ double maxloglik = *max_element(loglik->begin(), loglik->end());
+ for (int u=0; u < k; u++){
+ sum += postprobs[u] = exp((*loglik)[u] - maxloglik) * codonevo->getPrior(u);
+ }
+
+ //cout << "posterior distribution and prior of omega" << endl;
+ for (int u=0; u < k; u++){
+ // cout << codonevo->getOmega(u) << "\t" << postprobs[u] <<"\t"<<codonevo->getPrior(u)<< endl;
+ postprobs[u] /= sum;
+ }
+ double omega = 0;
+
+ //cout<<"---------------------------------------------------------------------------"<<endl;
+ //cout<<"wi\t\tloglikOmegas\tmaxloglik\tpostprobs/sum\tprior\tsum\texp(loglik - maxloglik)"<<endl;
+
+ for (int u=0; u < k; u++){
+ omega += postprobs[u] * codonevo->getOmega(u);
+ //cout<<codonevo->getOmega(u)<<"\t\t"<<loglikOmegas[u]<<"\t\t"<<maxloglik<<"\t\t"<<postprobs[u]<<"\t\t"<<codonevo->getPrior(u)<<"\t\t"<<sum<<"\t\t"<<exp(loglikOmegas[u] - maxloglik)<<endl;
+ }
+
+ return omega;
+}
+
+void GeneMSA::printOmegaForCodon(string outdir){
+
+ for(map<bit_vector, map<vector<int>, vector<double> > >::iterator bvIt = codonOmega.begin(); bvIt != codonOmega.end(); bvIt++){
+ int bvToDecimal = 0;
+ for(int s = 0; s<numSpecies(); s++)
+ bvToDecimal += pow(3,s) * bvIt->first[s]+1;
+ string bvStr = "BV" + to_string(bvToDecimal);
+ for(map<vector<int>, vector<double> >::iterator rfcIt = bvIt->second.begin(); rfcIt != bvIt->second.end(); rfcIt++){
+ int rfcToDecimal = 0;
+ for(int s = 0; s<numSpecies(); s++)
+ rfcToDecimal += pow(4,s) * rfcIt->first[s]+1;
+ string rfcStr = "RFC" + to_string(rfcToDecimal);
+ consToWig(rfcIt->second, outdir + "omega." + bvStr + rfcStr);
+ }
+ }
+}
+
+
+
// calculate a columnwise conservation score and output it (for each species) in wiggle format
void GeneMSA::calcConsScore(list<OrthoExon> &orthoExonsList, vector<AnnoSequence*> const &seqRanges, string outdir){
diff --git a/src/getSeq b/src/getSeq
new file mode 100755
index 0000000..deb18f1
Binary files /dev/null and b/src/getSeq differ
diff --git a/src/igenicmodel.cc b/src/igenicmodel.cc
index be20d21..9e46139 100644
--- a/src/igenicmodel.cc
+++ b/src/igenicmodel.cc
@@ -37,6 +37,7 @@ PatMMGroup* IGenicModel::GCemiprobs = NULL;
int IGenicModel::lastParIndex = -1;
vector<vector<Double> > IGenicModel::Pls;
vector<vector<Double> >* IGenicModel::GCPls = NULL;
+vector<vector<double> > IGenicModel::nucProbs;
int IGenicModel::verbosity;
double IGenicModel::geoProb = 0.9999;
@@ -153,7 +154,7 @@ void IGenicModel::readProbabilities( int parIndex ) {
void IGenicModel::readAllParameters(){
string filename = Constant::fullSpeciesPath() + Properties::getProperty("/IGenicModel/infile");
ifstream istrm(filename.c_str());
-
+
if( istrm ){
// all GC content dependent parameters
int l;
@@ -169,11 +170,14 @@ void IGenicModel::readAllParameters(){
throw ProjectError("IgenicModel::readAllParameters: Error reading file " + filename + ". Truncated?");
GCPls[idx].resize( k+1 );
+ nucProbs.resize(k+1);
istrm >> goto_line_after( "[P_ls]" );
for( int i = 0; i <= k; i++ ){
istrm >> comment >> l >> comment;
int size = POWER4TOTHE(l+1);
GCPls[idx][i].assign( size, 0.0 );
+ if(idx == 0)
+ nucProbs[i].assign( size, 0.0 );
Seq2Int s2i(i+1);
for( int j = 0; j < size; j++ ) {
istrm >> comment;
@@ -181,7 +185,12 @@ void IGenicModel::readAllParameters(){
if (pn != j)
throw ProjectError("IgenicModel::readProbabilities: Error reading file " + filename +
" at P_ls, pattern " + s2i.INV(pn));
- istrm >> GCPls[idx][i][j];
+ if(idx == 0){
+ istrm >> nucProbs[i][j];
+ GCPls[0][i][j] = nucProbs[i][j];
+ }else
+ istrm >> GCPls[idx][i][j];
+
if (!Constant::contentmodels)
GCPls[idx][i][j] = 1.0/size; // use uniform distribution
}
@@ -350,3 +359,4 @@ Double IGenicModel::emiProbUnderModel(int begin, int end) const {
}
return p * extrinsicProb;
}
+
diff --git a/src/load2sqlitedb b/src/load2sqlitedb
new file mode 100755
index 0000000..656e083
Binary files /dev/null and b/src/load2sqlitedb differ
diff --git a/src/load2sqlitedb.cc b/src/load2sqlitedb.cc
index 86e9779..2853f1a 100644
--- a/src/load2sqlitedb.cc
+++ b/src/load2sqlitedb.cc
@@ -41,6 +41,7 @@ int main( int argc, char* argv[] ){
int help = 0;
int noIdx = 0;
int makeIdx = 0;
+ bool clean = false;
string species;
string dbfile;
string fastafile;
@@ -51,11 +52,12 @@ int main( int argc, char* argv[] ){
{"help", 0, 0, 'h'},
{"chunksize", 1, 0, 'c'},
{"noIdx", 0, 0, 'i'},
- {"makeIdx", 0, 0, 'm'},
+ {"makeIdx", 0, 0, 'm'},
+ {"clean", 0, 0, 'r'},
{NULL, 0, NULL, 0}
};
int option_index = 0;
- while ((c = getopt_long(argc, argv, "s:d:hc:im", long_options, &option_index)) != -1) {
+ while ((c = getopt_long(argc, argv, "s:d:hc:imr", long_options, &option_index)) != -1) {
switch (c) {
case 's':
species = optarg;
@@ -75,6 +77,8 @@ int main( int argc, char* argv[] ){
case 'm':
makeIdx = 1;
break;
+ case 'r':
+ clean = true;
default:
break;
}
@@ -149,6 +153,9 @@ int main( int argc, char* argv[] ){
try {
db.createTableSpeciesnames();
db.createTableSeqnames();
+ db.createTableGenomes();
+ db.createTableHints();
+ db.createTableFeatureTypes();
ifstream ifstrm;
ifstrm.open(fastafile.c_str());
@@ -159,14 +166,13 @@ int main( int argc, char* argv[] ){
// if input file is in Fasta format, try to load sequences
if(isFasta(ifstrm)){
cout << "Looks like " << fastafile << " is in fasta format." << endl;
- db.createTableGenomes();
// drop index on genomes table for faster insertion
db.exec("DROP INDEX IF EXISTS gidx;");
int seqCount = 0, chunkCount = 0;
unsigned int lenCount = 0;
- int speciesid = db.getSpeciesID(species);
+ int speciesid = db.getSpeciesID(species,clean);
db.beginTransaction();
@@ -187,26 +193,52 @@ int main( int argc, char* argv[] ){
}catch(const char* err){
cerr << "failed inserting sequence "<< name << " for species "<< species <<" (ID="<<speciesid<<")"<< endl;
cerr << "Is it possible that the sequence is already in the database?" << endl;
- cerr << "If so, please delete it, before reloading it" << endl;
+ cerr << "If you want to replace the existing genome, please make a clean load with option --clean" << endl;
throw err;
}
int seqnr = db.lastInsertID();
int start = 0;
+ int length = 0;
string line;
+ char c;
+ streampos file_start = ifstrm.tellg();
+ streampos file_end = file_start;
+ streampos pos = file_end;
+
+ while (ifstrm && ifstrm.peek() != '>' && ifstrm.peek() != EOF){
+ ifstrm.get(c);
+ pos += streamoff(1);
+ if(isalpha(c)){
+ length++;
+ file_end = pos;
+ }
+ if(length >= chunksize){
+ stmt1.bindInt(2,seqnr);
+ stmt1.bindInt(3,speciesid);
+ stmt1.bindInt(4,start);
+ stmt1.bindInt(5,start+length-1);
+ stmt1.bindInt64(6,(uint64_t)file_start);
+ stmt1.bindInt(7,file_end-file_start);
+ stmt1.step();
+ stmt1.reset();
- while (ifstrm && ifstrm.peek( ) != '>'){
- streampos file_start = ifstrm.tellg(), file_end = ifstrm.tellg();
- int length = 0;
- while(length < chunksize && ifstrm && ifstrm.peek( ) != '>'){
- if(getline(ifstrm, line)){
- length+=line.size();
- if(ifstrm.tellg() == EOF) // if file does not end properly with newline, tellg() fails
- file_end = line.size() + file_end + 1;
- else
- file_end = ifstrm.tellg();
+ chunkCount++;
+ lenCount +=length;
+
+ start += length;
+ // next file_start position is the character preceeding
+ // the next non-whitespace character
+ while (ifstrm && !isalpha(ifstrm.peek()) && ifstrm.peek() != '>' && ifstrm.peek() != EOF){
+ ifstrm.get(c);
+ pos += streamoff(1);
}
+ file_start = pos;
+ length = 0;
}
+ }
+ // last chunk
+ if(length > 0){
stmt1.bindInt(2,seqnr);
stmt1.bindInt(3,speciesid);
stmt1.bindInt(4,start);
@@ -215,13 +247,13 @@ int main( int argc, char* argv[] ){
stmt1.bindInt(7,file_end-file_start);
stmt1.step();
stmt1.reset();
-
+
chunkCount++;
- start += length;
lenCount +=length;
}
delete name;
seqCount++;
+
}
db.endTransaction();
@@ -238,13 +270,19 @@ int main( int argc, char* argv[] ){
}
else if(isGFF(ifstrm)){ // if input file is in GFF format, try to load hints
cout << "Looks like " << fastafile << " is in gff format." << endl;
- db.createTableHints();
- db.createTableFeatureTypes();
+
int hintCount=0; // number of hints inserted into the database
// drop index on hints table (for faster insertion)
db.exec("DROP INDEX IF EXISTS hidx");
+ if(clean){
+ int id = db.getSpeciesID(species,false,true);
+ if(id >= 0){
+ db.deleteHints(id); // delete existing hints from DB
+ cout << "Deleted existing hints for " << species << " from database." << endl;
+ }
+ }
// bulk insert of all hints
db.beginTransaction();
@@ -341,6 +379,9 @@ parameters:\n\
--makeIdx use this flag to build the indices on the database tables after loading several\n\
genomes and/or hint files with --noIdx. Only call this once for all species, e.g.\n\
load2sqlitedb --makeIdx --dbaccess=database.db\n\
+--clean makes a clean load deleting existing hints/genome for the species from the dabase.\n\
+ When called with a gff file, only the hints for the species are delete, but not the genome.\n\
+ When called with a fasta file, both hints and genome for the species are deleted.\n\
\n\
examples:\n\
load2sqlitedb --species=chicken --dbaccess=chicken.db chickengenome.fa\n\
diff --git a/src/orthoexon.cc b/src/orthoexon.cc
index 5e8112e..befa012 100644
--- a/src/orthoexon.cc
+++ b/src/orthoexon.cc
@@ -18,7 +18,7 @@
const char* phyleticPatternIdentifiers[6]={"0", "1", "-", "_", "g", "l"};
-OrthoExon::OrthoExon(int_fast64_t k, size_t n) : key(k), omega(-1.0), Eomega(-1.0), VarOmega(-1.0), leftBoundaryOmega(-1.0), rightBoundaryOmega(-1.0), intervalCount(0), subst(-1), cons(-1.0), diversity(-1.0) {
+OrthoExon::OrthoExon(int_fast64_t k, size_t n) : key(k), omega(-1.0), Eomega(-1.0), VarOmega(-1.0), leftBoundaryExtOmega(-1.0), rightBoundaryExtOmega(-1.0), leftBoundaryIntOmega(-1.0), rightBoundaryIntOmega(-1.0), intervalCount(0), subst(-1), cons(-1.0), diversity(-1.0) {
orthoex.resize(n);
orthonode.resize(n);
weights.resize(n,0);
@@ -135,11 +135,25 @@ vector<int> OrthoExon::getRFC(vector<int> offsets) const{
void OrthoExon::setOmega(vector<double>* llo, CodonEvo* codonevo , bool oeStart){
if(oeStart){
- loglikOmegas = *llo;
- //cout<<"set Omega at oeStart: "<<getAliStart()<<":"<<getAliEnd()<<":"<<getStateType()<<"\t(omega, omega squared, count) = "<<"("<<omega<<", "<<omegaSquared<<", "<<omegaCount<<")"<<endl;
+ loglikOmegaStarts.push_back(*llo);
+ //cout<<"set Omega at oeStart: "<<getAliStart()<<":"<<getAliEnd()<<":"<<getStateType()<<"\t(omega, omega squared, count) = "<<"("<<omega<<", "<<omegaSquared<<", "<<omegaCount<<")"<<endl;
}else{
- //calculate posterior mean of omega
- int k = llo->size();
+
+ vector<double> loglikOmegas;
+ if(!loglikOmegaStarts.empty()){
+ loglikOmegas = loglikOmegaStarts.front();
+ loglikOmegaStarts.pop_front();
+ }else{
+ if(!llo->empty()){
+ loglikOmegas = *llo;
+ }
+ }
+
+ //calculate posterior mean of omega
+ int k = llo->size();
+
+ if(*llo == loglikOmegas)
+ k = 0;
double currOmega;
double currVarOmega;
@@ -176,7 +190,7 @@ void OrthoExon::setOmega(vector<double>* llo, CodonEvo* codonevo , bool oeStart)
}
currOmega = 0;
- //cout<<"---------------------------------------------------------------------------"<<endl;
+ //cout<<"---------------------------------------------------------------------------"<<endl;
//cout<<"wi\t\tloglikOmegas\tmaxloglik\tpostprobs/sum\tprior\tsum\texp(loglik - maxloglik)"<<endl;
for (int u=0; u < k; u++){
@@ -204,13 +218,17 @@ void OrthoExon::setOmega(vector<double>* llo, CodonEvo* codonevo , bool oeStart)
}
void OrthoExon::storeOmega(double currOmega){
-
+
switch(intervalCount){
- case 0: leftBoundaryOmega = currOmega;
+ case 0: leftBoundaryExtOmega = currOmega;
+ break;
+ case 1: leftBoundaryIntOmega = currOmega;
+ break;
+ case 2: Eomega = currOmega;
break;
- case 1: Eomega = currOmega;
+ case 3:rightBoundaryIntOmega = currOmega;
break;
- case 2: rightBoundaryOmega = currOmega;
+ case 4: rightBoundaryExtOmega = currOmega;
break;
default: throw ProjectError("Error in setOmega(): too many intervals were calculated.");
break;
@@ -223,14 +241,14 @@ void OrthoExon::setSubst(int subs, bool oeStart){
if(intervalCount == 1)
subst = subs;
}else{
- if(subs != -1 && intervalCount == 2){
+ if(subs != -1 && intervalCount == 3){
if(subst >= 0)
subst = subs - subst;
else
subst = subs - subst - 1;
}
else{
- if(subst >= 0 && intervalCount == 2)
+ if(subst >= 0 && intervalCount == 3)
throw ProjectError("Error in setSubs(): numSubs was defined at OE start but is not at OE end!");
}
}
@@ -249,6 +267,7 @@ double OrthoExon::getLogRegScore(){
+ Constant::ex_sc[13] * cons * diversity
+ Constant::ex_sc[14] * Eomega * hasOmega() * diversity
+ Constant::ex_sc[1] * -1 * hasOmega()
+ + Constant::ex_sc[16] * min( abs(getLeftExtOmega() - getLeftIntOmega()), abs(getRightExtOmega() - getRightIntOmega()) )
+ Constant::ex_sc[2] * -1 ); // for being a HECT
/*
diff --git a/src/orthograph.cc b/src/orthograph.cc
index 328d251..8a9f986 100644
--- a/src/orthograph.cc
+++ b/src/orthograph.cc
@@ -104,6 +104,22 @@ void OrthoGraph::filterGeneList(vector< list<Transcript*> *> &genelist, vector<i
if (genelist[pos]){
AnnoSequence *annoseq = graphs[pos]->getAnnoSeq();
+ // filter criteria that apply to coding genes only
+ // delete gene if the combined CDS is too short, unless a CDS exon is truncated
+ for(list<Transcript*>::iterator git = genelist[pos]->begin(); git != genelist[pos]->end();){
+ Gene *g = dynamic_cast<Gene *>(*git);
+ if (g && ((g->clength < Constant::min_coding_len && g->completeCDS())
+ || (g->clength < 4 && g->clength < Constant::min_coding_len && !g->completeCDS()))){
+ //(*git)->printGFF();
+ //cout << "Gene deleted! (clength " << g->clength << ")" << endl;
+ delete *git;
+ git = genelist[pos]->erase(git);
+ }
+ else{
+ ++git;
+ }
+ }
+
list<AltGene> *agl = groupTranscriptsToGenes(*genelist[pos]);
if(sfcs[pos] && sfcs[pos]->collection->hasHintsFile){
diff --git a/src/parser/parse.cc b/src/parser/parse.cc
index c151b38..57ccbbd 100644
--- a/src/parser/parse.cc
+++ b/src/parser/parse.cc
@@ -644,7 +644,7 @@ void Parser::executeAction(int production)
#line 76 "grammar"
{
pspecies->push_back(d_scanner.matched());
- }
+ }
break;
case 7:
@@ -675,7 +675,7 @@ void Parser::executeAction(int production)
Treenode *temp = new Treenode(pspecies->at(atoi(d_scanner.matched().c_str())-1));
ptree->push_back(temp);
d_val__.nodeptr = temp;
- }
+ }
break;
case 11:
@@ -685,7 +685,7 @@ void Parser::executeAction(int production)
ptree->push_back(temp);
pspecies->push_back(d_scanner.matched());
d_val__.nodeptr = temp;
- }
+ }
break;
case 12:
@@ -710,7 +710,6 @@ void Parser::executeAction(int production)
{
d_vsp__[-2].nodeptr->addDistance(atof(d_scanner.matched().c_str()));
d_val__.nodeptr=d_vsp__[-2].nodeptr;
-
}
break;
diff --git a/src/phylotree.cc b/src/phylotree.cc
index c3f8244..3b7786f 100644
--- a/src/phylotree.cc
+++ b/src/phylotree.cc
@@ -85,20 +85,29 @@ PhyloTree::PhyloTree(string filename){
if(error_message == 1){
throw ProjectError("the parsing of " + filename + " has been unsuccessful. Please check, whether the syntax of your input file is correct" );
}
+
numSp=species.size();
/*
* if only a subset of the species is sought, drop all leaf nodes
* which are not in the given subset
*/
- string only_species;
- Properties::assignProperty("/CompPred/only_species", only_species);
+ string only_species = Constant::speciesfilenames; // by default use only the species from speciesfilenames
+ /* old code: read in species list from separate file
+ * only required with mysql dbaccess
+ * if(only_species.empty())
+ * Properties::assignProperty("/CompPred/only_species", only_species);
+ */
if(!only_species.empty()){
+
ifstream ifstrm(only_species.c_str());
if (ifstrm.is_open()){
vector<string> keep; // the subset of species to be kept
- string s;
- while(std::getline(ifstrm,s,'\n')){
- keep.push_back(s);
+ char buf[256];
+ while(ifstrm.getline(buf,255)){
+ stringstream stm(buf);
+ string s;
+ if(stm >> s)
+ keep.push_back(s);
}
ifstrm.close();
for(int i=0; i<species.size(); i++){
@@ -111,7 +120,6 @@ PhyloTree::PhyloTree(string filename){
}
if(!found){ //if species name ist not in list, remove leaf
drop(species[i]);
- numSp--;
}
}
if(species.size() < 2 || species.size() < keep.size())
@@ -121,7 +129,7 @@ PhyloTree::PhyloTree(string filename){
}
else
throw ProjectError("Could not open input file " + only_species);
- printNewick("subtree.nwk");
+ //printNewick("subtree.nwk");
}
}
else
@@ -225,7 +233,7 @@ double PhyloTree::pruningAlgor(string labelpattern, Evo *evo, int u){
double PhyloTree::pruningAlgor(vector<int> &tuple, Evo *evo, int u){
int states = evo->getNumStates();
-
+
for(list<Treenode*>::iterator node = treenodes.begin(); node != treenodes.end(); node++){
if((*node)->isLeaf()){
// initialization
@@ -247,15 +255,15 @@ double PhyloTree::pruningAlgor(vector<int> &tuple, Evo *evo, int u){
for(list<Treenode*>::iterator it = (*node)->children.begin(); it != (*node)->children.end(); it++){
double sum=0;
gsl_matrix *P = evo->getSubMatrixP(u,(*it)->getDist());
- //cout<<"---------- codon Matrix for omega nr "<<u<<" and branch lenght = "<<(*it)->getDist()<<"---------"<<endl;
+ //cout<<"---------- Transition Matrix for omega nr "<<u<<" and branch lenght = "<<(*it)->getDist()<<"---------"<<endl;
//printCodonMatrix(P);
for(int j=0; j<states; j++){
- sum += gsl_matrix_get(P, i, j) * (*it)->getTable(j);
- // cout<<gsl_matrix_get(P, i, j)<<"\t";
+ sum += gsl_matrix_get(P, i, j) * (*it)->getTable(j);
+ //cout<<gsl_matrix_get(P, i, j)<<"\t";
}
score *= sum;
}
- // cout<<endl;
+ //cout<<endl;
(*node)->setTable(i, score);
}
}
@@ -265,7 +273,8 @@ double PhyloTree::pruningAlgor(vector<int> &tuple, Evo *evo, int u){
//in the root, we take the weighted average over all states
double tree_score = 0;
for(int i=0; i<states; i++){
- tree_score += (evo->getPi(i) * treenodes.back()->getTable(i));
+ double ts = (evo->getPi(i) * treenodes.back()->getTable(i));
+ tree_score += ts;
}
return log(tree_score);
}
@@ -342,6 +351,7 @@ void PhyloTree::drop(Treenode *node, Evo *evo){
}
treenodes.remove(node);
delete node;
+ numSp--;
}
}
@@ -502,13 +512,11 @@ void PhyloTree::prune(bit_vector &bv, Evo *evo){
Treenode* tmp=*node;
if(node == treenodes.begin()){
drop(tmp,evo);
- numSp--;
goto start;
}
else{
node--;
drop(tmp,evo);
- numSp--;
}
}
}
@@ -523,7 +531,7 @@ int PhyloTree::fitch(vector<int> &labels, int states){
int idx = (*node)->getIdx();
int c = labels[idx];
if(c >= states || c < 0)
- throw ProjectError("PhyloTree::fith(): index "+ itoa(c) + " out of bounds.");
+ throw ProjectError("PhyloTree::fitch(): index "+ itoa(c) + " out of bounds.");
(*node)->resizeTable(states, 100000); // any number > 1
(*node)->setTable(c,0);
diff --git a/src/properties.cc b/src/properties.cc
index fe59cff..0cda912 100644
--- a/src/properties.cc
+++ b/src/properties.cc
@@ -51,6 +51,7 @@ const char* Properties::parameternames[NUMPARNAMES]=
"cds",
"checkExAcc",
"codingseq",
+"codonAlignmentFile",
"complete_genes",
"/CompPred/assmotifqthresh",
"/CompPred/assqthresh",
@@ -259,6 +260,8 @@ SINGLESTRAND_KEY,
"tts",
"uniqueCDS",
"uniqueGeneId",
+"useAminoAcidRates",
+"useNonCodingModel",
UTR_KEY,
"/UtrModel/d_polya_cleavage_max",
"/UtrModel/d_polya_cleavage_min",
@@ -353,7 +356,8 @@ void Properties::init( int argc, char* argv[] ){
name == ALN_KEY ||
name == TREE_KEY ||
name == DB_KEY ||
- name == SEQ_KEY)
+ name == SEQ_KEY ||
+ name == CODONALN_KEY)
{
if (pos >= argstr.length()-1)
throw ProjectError(string("Wrong argument format for ") + name + ". Use: --argument=value");
@@ -371,17 +375,18 @@ void Properties::init( int argc, char* argv[] ){
Properties::assignProperty(SEQ_KEY, Constant::speciesfilenames);
Properties::assignProperty(DB_KEY, Constant::dbaccess);
Properties::assignProperty(ALN_KEY, Constant::alnfile);
- if (!Constant::alnfile.empty() && !Constant::treefile.empty() && (!Constant::speciesfilenames.empty() || !Constant::dbaccess.empty())){
+ if(Constant::codonalnfile.empty()){
+ if (!Constant::alnfile.empty() && !Constant::treefile.empty() && (!Constant::speciesfilenames.empty() || !Constant::dbaccess.empty())){
Constant::MultSpeciesMode = true;
- } else if (!(Constant::alnfile.empty() && Constant::treefile.empty() && Constant::speciesfilenames.empty() && Constant::dbaccess.empty())){
+ } else if (!(Constant::alnfile.empty() && Constant::speciesfilenames.empty() && Constant::dbaccess.empty()) ){
throw ProjectError("In comparative gene prediction mode you must specify parameters alnfile, treefile\n\
- and one of the following combinations of parameters\n\n\
- - dbaccess (retrieving genomes from a MySQL db)\n\
- - speciesfilenames and dbaccess (retrieving genomes from an SQLite db)\n\
- - speciesfilenames (retrieving genomes from flat files)\n\n\
+ and one of the following combinations of parameters\n\n \
+ - dbaccess (retrieving genomes from a MySQL db)\n \
+ - speciesfilenames and dbaccess (retrieving genomes from an SQLite db)\n \
+ - speciesfilenames (retrieving genomes from flat files)\n\n \
In single species mode specify none of these parameters.\n");
+ }
}
-
// set configPath variable
string& configPath = properties[CFGPATH_KEY]; // first priority: command line
if (configPath == "") {
@@ -474,7 +479,7 @@ void Properties::init( int argc, char* argv[] ){
if (name == GENEMODEL_KEY || name == NONCODING_KEY || name == SINGLESTRAND_KEY ||
name == SPECIES_KEY || name == CFGPATH_KEY ||
name == EXTERNAL_KEY || name == ALN_KEY ||
- name == TREE_KEY || name == DB_KEY || name == SEQ_KEY)
+ name == TREE_KEY || name == DB_KEY || name == SEQ_KEY || name == CODONALN_KEY)
continue;
if (pos == string::npos)
throw PropertiesError(string("'=' missing for parameter: ") + name);
@@ -595,7 +600,7 @@ void Properties::init( int argc, char* argv[] ){
if (!hasProperty(EXTRFILE_KEY)) {
properties[EXTRFILE_KEY] = configPath + EXTRINSIC_SUBDIR + "extrinsic.cfg";
if (Constant::MultSpeciesMode)
- properties[EXTRFILE_KEY] = configPath + EXTRINSIC_SUBDIR + "cgp.extrinsic.cfg";
+ properties[EXTRFILE_KEY] = configPath + EXTRINSIC_SUBDIR + "extrinsic-cgp.cfg";
#ifdef DEBUG
cerr << "# No extrinsicCfgFile given. Taking default file: " << properties[EXTRFILE_KEY] << endl;
#endif
@@ -676,6 +681,29 @@ void Properties::readLine( istream& strm ) {
properties[name] = value;
}
+static char* get_self(void){
+ char *path = NULL;
+ size_t allocated = 256;
+
+ while (1) {
+ ssize_t pos = 0;
+ if (!(path = (char*) malloc(allocated)))
+ abort();
+ if ((pos = readlink( "/proc/self/exe", path, allocated - 1 )) != -1)
+ path[pos] = '\0';
+ else {
+ free(path);
+ return NULL;
+ }
+ if (pos < allocated - 1)
+ break;
+ free(path);
+ allocated *= 2;
+ }
+ return path;
+}
+
+
string findLocationOfSelfBinary(){
string self;
@@ -689,18 +717,23 @@ string findLocationOfSelfBinary(){
// need to program workaround with new/free.\n";
}
#else // LINUX
- char path[PATH_MAX];
- ssize_t pos = readlink( "/proc/self/exe", path, PATH_MAX-1 );
+ char *path = get_self();
+ ssize_t pos = 0;
+ if (path)
+ pos = strlen(path);
if (pos > 0){
- self = string(path);
+ self = string(path);
+ free(path);
pos = self.find_last_of("/");
if (pos>0)
pos = self.find_last_of("/", pos-1);
if (pos >= 0)
self.resize(pos);
self += "/config";
- } else
+ } else {
+ free(path);
throw ProjectError("/proc/self/exe not found.\nPlease specify environment variable or parameter " CFGPATH_KEY ".");
+ }
#endif // WINDOWS not supported
return self;
}
diff --git a/src/properties.cc b/src/properties.cc.backup
similarity index 96%
copy from src/properties.cc
copy to src/properties.cc.backup
index fe59cff..24aa29e 100644
--- a/src/properties.cc
+++ b/src/properties.cc.backup
@@ -51,6 +51,7 @@ const char* Properties::parameternames[NUMPARNAMES]=
"cds",
"checkExAcc",
"codingseq",
+"codonAlignmentFile",
"complete_genes",
"/CompPred/assmotifqthresh",
"/CompPred/assqthresh",
@@ -353,7 +354,8 @@ void Properties::init( int argc, char* argv[] ){
name == ALN_KEY ||
name == TREE_KEY ||
name == DB_KEY ||
- name == SEQ_KEY)
+ name == SEQ_KEY ||
+ name == CODONALN_KEY)
{
if (pos >= argstr.length()-1)
throw ProjectError(string("Wrong argument format for ") + name + ". Use: --argument=value");
@@ -371,17 +373,18 @@ void Properties::init( int argc, char* argv[] ){
Properties::assignProperty(SEQ_KEY, Constant::speciesfilenames);
Properties::assignProperty(DB_KEY, Constant::dbaccess);
Properties::assignProperty(ALN_KEY, Constant::alnfile);
- if (!Constant::alnfile.empty() && !Constant::treefile.empty() && (!Constant::speciesfilenames.empty() || !Constant::dbaccess.empty())){
+ if(Constant::codonalnfile.empty()){
+ if (!Constant::alnfile.empty() && !Constant::treefile.empty() && (!Constant::speciesfilenames.empty() || !Constant::dbaccess.empty())){
Constant::MultSpeciesMode = true;
- } else if (!(Constant::alnfile.empty() && Constant::treefile.empty() && Constant::speciesfilenames.empty() && Constant::dbaccess.empty())){
+ } else if (!(Constant::alnfile.empty() && Constant::speciesfilenames.empty() && Constant::dbaccess.empty()) ){
throw ProjectError("In comparative gene prediction mode you must specify parameters alnfile, treefile\n\
- and one of the following combinations of parameters\n\n\
- - dbaccess (retrieving genomes from a MySQL db)\n\
- - speciesfilenames and dbaccess (retrieving genomes from an SQLite db)\n\
- - speciesfilenames (retrieving genomes from flat files)\n\n\
+ and one of the following combinations of parameters\n\n \
+ - dbaccess (retrieving genomes from a MySQL db)\n \
+ - speciesfilenames and dbaccess (retrieving genomes from an SQLite db)\n \
+ - speciesfilenames (retrieving genomes from flat files)\n\n \
In single species mode specify none of these parameters.\n");
+ }
}
-
// set configPath variable
string& configPath = properties[CFGPATH_KEY]; // first priority: command line
if (configPath == "") {
@@ -474,7 +477,7 @@ void Properties::init( int argc, char* argv[] ){
if (name == GENEMODEL_KEY || name == NONCODING_KEY || name == SINGLESTRAND_KEY ||
name == SPECIES_KEY || name == CFGPATH_KEY ||
name == EXTERNAL_KEY || name == ALN_KEY ||
- name == TREE_KEY || name == DB_KEY || name == SEQ_KEY)
+ name == TREE_KEY || name == DB_KEY || name == SEQ_KEY || name == CODONALN_KEY)
continue;
if (pos == string::npos)
throw PropertiesError(string("'=' missing for parameter: ") + name);
@@ -595,7 +598,7 @@ void Properties::init( int argc, char* argv[] ){
if (!hasProperty(EXTRFILE_KEY)) {
properties[EXTRFILE_KEY] = configPath + EXTRINSIC_SUBDIR + "extrinsic.cfg";
if (Constant::MultSpeciesMode)
- properties[EXTRFILE_KEY] = configPath + EXTRINSIC_SUBDIR + "cgp.extrinsic.cfg";
+ properties[EXTRFILE_KEY] = configPath + EXTRINSIC_SUBDIR + "extrinsic-cgp.cfg";
#ifdef DEBUG
cerr << "# No extrinsicCfgFile given. Taking default file: " << properties[EXTRFILE_KEY] << endl;
#endif
diff --git a/src/properties.cc b/src/properties.cc.orig
similarity index 96%
copy from src/properties.cc
copy to src/properties.cc.orig
index fe59cff..bbd6556 100644
--- a/src/properties.cc
+++ b/src/properties.cc.orig
@@ -51,6 +51,7 @@ const char* Properties::parameternames[NUMPARNAMES]=
"cds",
"checkExAcc",
"codingseq",
+"codonAlignmentFile",
"complete_genes",
"/CompPred/assmotifqthresh",
"/CompPred/assqthresh",
@@ -259,6 +260,8 @@ SINGLESTRAND_KEY,
"tts",
"uniqueCDS",
"uniqueGeneId",
+"useAminoAcidRates",
+"useNonCodingModel",
UTR_KEY,
"/UtrModel/d_polya_cleavage_max",
"/UtrModel/d_polya_cleavage_min",
@@ -353,7 +356,8 @@ void Properties::init( int argc, char* argv[] ){
name == ALN_KEY ||
name == TREE_KEY ||
name == DB_KEY ||
- name == SEQ_KEY)
+ name == SEQ_KEY ||
+ name == CODONALN_KEY)
{
if (pos >= argstr.length()-1)
throw ProjectError(string("Wrong argument format for ") + name + ". Use: --argument=value");
@@ -371,17 +375,18 @@ void Properties::init( int argc, char* argv[] ){
Properties::assignProperty(SEQ_KEY, Constant::speciesfilenames);
Properties::assignProperty(DB_KEY, Constant::dbaccess);
Properties::assignProperty(ALN_KEY, Constant::alnfile);
- if (!Constant::alnfile.empty() && !Constant::treefile.empty() && (!Constant::speciesfilenames.empty() || !Constant::dbaccess.empty())){
+ if(Constant::codonalnfile.empty()){
+ if (!Constant::alnfile.empty() && !Constant::treefile.empty() && (!Constant::speciesfilenames.empty() || !Constant::dbaccess.empty())){
Constant::MultSpeciesMode = true;
- } else if (!(Constant::alnfile.empty() && Constant::treefile.empty() && Constant::speciesfilenames.empty() && Constant::dbaccess.empty())){
+ } else if (!(Constant::alnfile.empty() && Constant::speciesfilenames.empty() && Constant::dbaccess.empty()) ){
throw ProjectError("In comparative gene prediction mode you must specify parameters alnfile, treefile\n\
- and one of the following combinations of parameters\n\n\
- - dbaccess (retrieving genomes from a MySQL db)\n\
- - speciesfilenames and dbaccess (retrieving genomes from an SQLite db)\n\
- - speciesfilenames (retrieving genomes from flat files)\n\n\
+ and one of the following combinations of parameters\n\n \
+ - dbaccess (retrieving genomes from a MySQL db)\n \
+ - speciesfilenames and dbaccess (retrieving genomes from an SQLite db)\n \
+ - speciesfilenames (retrieving genomes from flat files)\n\n \
In single species mode specify none of these parameters.\n");
+ }
}
-
// set configPath variable
string& configPath = properties[CFGPATH_KEY]; // first priority: command line
if (configPath == "") {
@@ -474,7 +479,7 @@ void Properties::init( int argc, char* argv[] ){
if (name == GENEMODEL_KEY || name == NONCODING_KEY || name == SINGLESTRAND_KEY ||
name == SPECIES_KEY || name == CFGPATH_KEY ||
name == EXTERNAL_KEY || name == ALN_KEY ||
- name == TREE_KEY || name == DB_KEY || name == SEQ_KEY)
+ name == TREE_KEY || name == DB_KEY || name == SEQ_KEY || name == CODONALN_KEY)
continue;
if (pos == string::npos)
throw PropertiesError(string("'=' missing for parameter: ") + name);
@@ -595,7 +600,7 @@ void Properties::init( int argc, char* argv[] ){
if (!hasProperty(EXTRFILE_KEY)) {
properties[EXTRFILE_KEY] = configPath + EXTRINSIC_SUBDIR + "extrinsic.cfg";
if (Constant::MultSpeciesMode)
- properties[EXTRFILE_KEY] = configPath + EXTRINSIC_SUBDIR + "cgp.extrinsic.cfg";
+ properties[EXTRFILE_KEY] = configPath + EXTRINSIC_SUBDIR + "extrinsic-cgp.cfg";
#ifdef DEBUG
cerr << "# No extrinsicCfgFile given. Taking default file: " << properties[EXTRFILE_KEY] << endl;
#endif
diff --git a/src/randseqaccess.cc b/src/randseqaccess.cc
index b050004..ed79006 100644
--- a/src/randseqaccess.cc
+++ b/src/randseqaccess.cc
@@ -80,13 +80,17 @@ void SpeciesCollection::readExtrinsicCFGFile(vector<string> &speciesNames){
if(datei){
// reading in the species group for which the table is valid
getline(datei,skey);
- if(skey == "[GROUP]"){
- cout << "extrinsic group " << groupCount << ":";
+ if (skey.find("[GROUP]") != std::string::npos) {
+ cout << "extrinsic group " << groupCount << ":";
datei.getline(buf, 1024); // reading in the set of species that belongs to the group
stringstream stm(buf);
if(stm >> skey){
do{
- if(skey == "all" || skey == "other"){ // this config table is valid for all other species
+ if(skey == "none" || skey == "None"){
+ cout <<" none ... is deleted";
+ continue;
+ }
+ if(skey == "all" || skey == "All" || skey == "other" || skey == "Other"){ // this config table is valid for all other species
for(int i=0; i<speciesNames.size(); i++){
try{
addSpeciesToGroup(speciesNames[i],groupCount);
@@ -111,8 +115,10 @@ void SpeciesCollection::readExtrinsicCFGFile(vector<string> &speciesNames){
throw ProjectError("SpeciesCollection::readExtrinsicCFGFile: Please specify a set of species for which config table " +
itoa(groupCount) +" in\n " + filename + "is valid");
}
- speciesColl.insert(pair<int,FeatureCollection>(groupCount,sc));
- groupCount++;
+ if(skey != "none" && skey != "None"){
+ speciesColl.insert(pair<int,FeatureCollection>(groupCount,sc));
+ groupCount++;
+ }
while(datei >> comment >> ws, datei && datei.peek() != '[')
;
}
diff --git a/src/remove_PATH_MAX.patch b/src/remove_PATH_MAX.patch
new file mode 100644
index 0000000..52d23f7
--- /dev/null
+++ b/src/remove_PATH_MAX.patch
@@ -0,0 +1,71 @@
+diff --git a/src/properties.cc b/src/properties.cc
+index fe59cff..dc3e045 100644
+--- a/src/properties.cc
++++ b/src/properties.cc
+@@ -676,6 +676,30 @@ void Properties::readLine( istream& strm ) {
+ properties[name] = value;
+ }
+
++static char* get_self(void)
++{
++ char *path = NULL;
++ size_t allocated = 256;
++
++ while (1) {
++ ssize_t pos = 0;
++ if (!(path = (char*) malloc(allocated)))
++ abort();
++ if ((pos = readlink( "/proc/self/exe", path, allocated - 1 )) != -1)
++ path[pos] = '\0';
++ else {
++ free(path);
++ return NULL;
++ }
++ if (pos < allocated - 1)
++ break;
++ free(path);
++ allocated *= 2;
++ }
++ return path;
++}
++
++
+ string findLocationOfSelfBinary(){
+ string self;
+
+@@ -689,18 +713,23 @@ string findLocationOfSelfBinary(){
+ // need to program workaround with new/free.\n";
+ }
+ #else // LINUX
+- char path[PATH_MAX];
+- ssize_t pos = readlink( "/proc/self/exe", path, PATH_MAX-1 );
+- if (pos > 0){
+- self = string(path);
+- pos = self.find_last_of("/");
+- if (pos>0)
+- pos = self.find_last_of("/", pos-1);
+- if (pos >= 0)
+- self.resize(pos);
+- self += "/config";
+- } else
+- throw ProjectError("/proc/self/exe not found.\nPlease specify environment variable or parameter " CFGPATH_KEY ".");
++ char *path = get_self();
++ ssize_t pos = 0;
++ if (path)
++ pos = strlen(path);
++ if (pos > 0){
++ self = string(path);
++ free(path);
++ pos = self.find_last_of("/");
++ if (pos>0)
++ pos = self.find_last_of("/", pos-1);
++ if (pos >= 0)
++ self.resize(pos);
++ self += "/config";
++ } else {
++ free(path);
++ throw ProjectError("/proc/self/exe not found.\nPlease specify environment variable or parameter " CFGPATH_KEY ".");
++ }
+ #endif // WINDOWS not supported
+ return self;
+ }
diff --git a/src/scanner/lex.cc b/src/scanner/lex.cc
index c0f7358..3850fab 100644
--- a/src/scanner/lex.cc
+++ b/src/scanner/lex.cc
@@ -1,4 +1,4 @@
-// Generated by Flexc++ V0.94.00 on Thu, 14 May 2015 11:55:16 +0200
+// Generated by Flexc++ V0.94.00 on Thu, 04 Aug 2016 06:15:29 +0200
#include <iostream>
#include <fstream>
@@ -16,16 +16,16 @@
size_t const ScannerBase::s_ranges__[] =
{
0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2,
- 2, 2, 2, 2, 2, 2, 2, 3, 4, 4, 4, 4, 4, 4, 4, 5, 5, 6, 7, 8, 9,10,11,12,12,
- 12,12,12,12,12,12,12,12,13,13,14,15,16,16,16,17,18,19,19,20,21,21,21,21,21,
- 21,21,21,21,21,21,21,21,21,22,23,23,23,23,23,23,24,25,26,27,28,29,30,31,32,
- 33,34,35,36,37,38,39,39,40,41,42,43,43,43,44,45,46,47,47,47,47,47,47,48,48,
- 48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,
- 48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,
- 48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,
- 48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,
- 48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,48,
- 48,48,48,48,48,49,
+ 2, 2, 2, 2, 2, 2, 2, 3, 4, 4, 4, 4, 4, 4, 4, 5, 6, 7, 8, 9,10,11,12,13,13,
+ 13,13,13,13,13,13,13,13,14,14,15,16,17,17,17,18,19,20,20,21,22,22,22,22,22,
+ 22,22,22,22,22,22,22,22,22,23,24,24,24,24,24,24,25,26,27,28,29,30,31,32,33,
+ 34,35,36,37,38,39,40,40,41,42,43,44,44,44,45,46,47,48,48,48,48,48,48,49,49,
+ 49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,
+ 49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,
+ 49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,
+ 49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,
+ 49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,49,
+ 49,49,49,49,49,50,
};
// s_dfa__ contains the rows of *all* DFAs ordered by start state.
@@ -36,129 +36,132 @@ size_t const ScannerBase::s_ranges__[] =
// used DFA and d_dfaBase__ is set to the first row of the subset to use.
// The row's final two values are begin and end indices in
// s_rfc__[] (rule, flags and count), defining the state's rule details
-int const ScannerBase::s_dfa__[][53] =
+int const ScannerBase::s_dfa__[][54] =
{
// INITIAL
- {-1, 1,-1, 1,-1, 2,-1, 3, 2, 4, 5,-1, 6, 2,-1, 2,-1, 7, 8, 7,
- 9, 7,10, 7,11,-1,-1,-1,12,-1, 7, 8, 7, 7, 9, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7,10, 7,-1,-1,-1, 0, 0}, // 0
+ {-1, 1,-1, 1,-1, 2, 3,-1, 4, 2, 5, 6,-1, 7, 2,-1, 2,-1, 8, 9,
+ 8,10, 8,11, 8,12,-1,-1,-1,13,-1, 8, 9, 8, 8,10, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8,11, 8,-1,-1,-1, 0, 0}, // 0
{-1, 1,-1, 1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,
-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,
- -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 0, 1}, // 1
+ -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 0, 1}, // 1
{-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,
-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,
- -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 1, 2}, // 2
- {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 5,-1,13,-1,-1,-1,-1,-1,-1,-1,
+ -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 1, 2}, // 2
+ {-1, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3,-1, 3, 3, 3, 3, 3,
+ 3, 3, 3, 3, 3, 3, 3, 3,-1, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3,
+ 3, 3, 3, 3, 3, 3, 3, 3, 3, 3,-1,-1, 2, 3}, // 3
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 6,-1,14,-1,-1,-1,-1,-1,-1,
-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,
- -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 2, 2}, // 3
- {-1,-1,-1,-1,-1,-1,-1,-1,-1,12, 5,-1,14,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1,12,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 2, 2}, // 4
- {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,15,-1,-1,-1,-1,-1,-1,-1,
+ -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 3, 3}, // 4
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,13, 6,-1,15,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1,13,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 3, 3}, // 5
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,16,-1,-1,-1,-1,-1,-1,
-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,
- -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 2, 2}, // 5
- {-1,-1,-1,-1,-1,-1,-1,-1,-1,12, 5,-1, 6,-1,-1,-1,-1, 7, 7, 7,
- 16, 7, 7, 7,-1,-1,-1,-1,12,-1, 7, 7, 7, 7,16, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 2, 3}, // 6
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 3, 4}, // 7
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7,17, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 4, 5}, // 8
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7,18, 7, 7, 7, 7, 7,-1,-1,-1, 5, 6}, // 9
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7,19, 7, 7, 7,-1,-1,-1, 6, 7}, // 10
- {-1,11,11,11,11,11,11,11,11,11,11,11,11,11,11,11,11,11,11,11,
- 11,11,11,11,-1,11,20,11,11,11,11,11,11,11,11,11,11,11,11,11,
- 11,11,11,11,11,11,11,11,11,-1,-1, 7, 7}, // 11
- {-1,-1,-1,-1,-1,-1,-1,-1,-1,12,-1,-1,12,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1,12,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 7, 7}, // 12
- {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 5,-1,13,-1,-1,-1,-1,-1,-1,-1,
- 21,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,21,-1,-1,-1,-1,-1,
- -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 7, 8}, // 13
- {-1,-1,-1,-1,-1,-1,-1,-1,-1,12, 5,-1,14,-1,-1,-1,-1, 7, 7, 7,
- 16, 7, 7, 7,-1,-1,-1,-1,12,-1, 7, 7, 7, 7,16, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 8, 9}, // 14
- {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,15,-1,-1,-1,-1,-1,-1,-1,
- 21,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,21,-1,-1,-1,-1,-1,
- -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 9,10}, // 15
- {-1,-1,-1,-1,-1,-1,-1,22,-1,23,-1,-1,24,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 10,11}, // 16
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7,25, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 11,12}, // 17
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7,26, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 12,13}, // 18
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1,27, 7, 7, 7,28, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 13,14}, // 19
- {-1,11,11,11,11,11,11,11,11,11,11,11,11,11,11,11,11,11,11,11,
- 11,11,11,11,-1,11,20,11,11,11,11,11,11,11,11,11,11,11,11,11,
- 11,11,11,11,11,11,11,11,11,-1,-1, 14,15}, // 20
- {-1,-1,-1,-1,-1,-1,-1,22,-1,22,-1,-1,29,-1,-1,-1,-1,-1,-1,-1,
+ -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 3, 3}, // 6
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,13, 6,-1, 7,-1,-1,-1,-1, 8, 8,
+ 8,17, 8, 8, 8,-1,-1,-1,-1,13,-1, 8, 8, 8, 8,17, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 3, 4}, // 7
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 4, 5}, // 8
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8,18, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 5, 6}, // 9
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8,19, 8, 8, 8, 8, 8,-1,-1,-1, 6, 7}, // 10
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8,20, 8, 8, 8,-1,-1,-1, 7, 8}, // 11
+ {-1,12,12,12,12,12,12,12,12,12,12,12,12,12,12,12,12,12,12,12,
+ 12,12,12,12,12,-1,12,21,12,12,12,12,12,12,12,12,12,12,12,12,
+ 12,12,12,12,12,12,12,12,12,12,-1,-1, 8, 8}, // 12
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,13,-1,-1,13,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1,13,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 8, 8}, // 13
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 6,-1,14,-1,-1,-1,-1,-1,-1,
+ -1,22,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,22,-1,-1,-1,-1,
+ -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8, 9}, // 14
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,13, 6,-1,15,-1,-1,-1,-1, 8, 8,
+ 8,17, 8, 8, 8,-1,-1,-1,-1,13,-1, 8, 8, 8, 8,17, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 9,10}, // 15
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,16,-1,-1,-1,-1,-1,-1,
+ -1,22,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,22,-1,-1,-1,-1,
+ -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 10,11}, // 16
+ {-1,-1,-1,-1,-1,-1,-1,-1,23,-1,24,-1,-1,25,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 11,12}, // 17
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8,26, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 12,13}, // 18
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8,27, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 13,14}, // 19
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1,28, 8, 8, 8,29, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 14,15}, // 20
+ {-1,12,12,12,12,12,12,12,12,12,12,12,12,12,12,12,12,12,12,12,
+ 12,12,12,12,12,-1,12,21,12,12,12,12,12,12,12,12,12,12,12,12,
+ 12,12,12,12,12,12,12,12,12,12,-1,-1, 15,16}, // 21
+ {-1,-1,-1,-1,-1,-1,-1,-1,23,-1,23,-1,-1,30,-1,-1,-1,-1,-1,-1,
-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,
- -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 15,15}, // 21
- {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,29,-1,-1,-1,-1,-1,-1,-1,
+ -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 16,16}, // 22
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,30,-1,-1,-1,-1,-1,-1,
-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,
- -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 15,15}, // 22
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1,24,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 15,16}, // 23
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1,24,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 16,17}, // 24
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7,30, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 17,18}, // 25
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 18,19}, // 26
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7,31, 7, 7, 7, 7, 7,-1,-1,-1, 19,20}, // 27
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7,32, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 20,21}, // 28
- {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,29,-1,-1,-1,-1,-1,-1,-1,
+ -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 16,16}, // 23
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1,25,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 16,17}, // 24
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1,25,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 17,18}, // 25
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8,31,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 18,19}, // 26
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 19,20}, // 27
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8,32, 8, 8, 8, 8, 8,-1,-1,-1, 20,21}, // 28
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8,33, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 21,22}, // 29
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,30,-1,-1,-1,-1,-1,-1,
-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,
- -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 21,22}, // 29
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7,33, 7, 7, 7, 7, 7,-1,-1,-1, 22,23}, // 30
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7,34, 7, 7,-1,-1,-1, 23,24}, // 31
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7,35, 7, 7,-1,-1,-1, 24,25}, // 32
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 25,26}, // 33
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 36, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 26,27}, // 34
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 27,28}, // 35
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1,37, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 28,29}, // 36
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7,38, 7,-1,-1,-1, 29,30}, // 37
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7,39, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 30,31}, // 38
- {-1,-1,-1,-1,-1,-1,-1,-1,-1, 7,-1,-1, 7,-1,-1,-1,-1, 7, 7, 7,
- 7, 7, 7, 7,-1,-1,-1,-1, 7,-1, 7, 7, 7, 7, 7, 7, 7, 7, 7, 7,
- 7, 7, 7, 7, 7, 7, 7, 7,-1,-1,-1, 31,32}, // 39
+ -1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 22,23}, // 30
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8,34, 8, 8, 8, 8, 8,-1,-1,-1, 23,24}, // 31
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8,35, 8, 8,-1,-1,-1, 24,25}, // 32
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8,36, 8, 8,-1,-1,-1, 25,26}, // 33
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 26,27}, // 34
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8,37, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 27,28}, // 35
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 28,29}, // 36
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1,38, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 29,30}, // 37
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8,39, 8,-1,-1,-1, 30,31}, // 38
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8,40, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 31,32}, // 39
+ {-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 8,-1,-1, 8,-1,-1,-1,-1, 8, 8,
+ 8, 8, 8, 8, 8,-1,-1,-1,-1, 8,-1, 8, 8, 8, 8, 8, 8, 8, 8, 8,
+ 8, 8, 8, 8, 8, 8, 8, 8, 8,-1,-1,-1, 32,33}, // 40
};
// The first value is the rule index
@@ -171,40 +174,41 @@ size_t const ScannerBase::s_rfc__[][3] =
{
// R F C
{ 0, 1, 0}, // 0
- { 9, 1, 0}, // 1
- { 6, 1, 0}, // 2
- { 8, 1, 0}, // 3
+ {10, 1, 0}, // 1
+ { 9, 1, 0}, // 2
+ { 6, 1, 0}, // 3
{ 8, 1, 0}, // 4
{ 8, 1, 0}, // 5
{ 8, 1, 0}, // 6
- { 7, 1, 0}, // 7
+ { 8, 1, 0}, // 7
{ 7, 1, 0}, // 8
{ 7, 1, 0}, // 9
- { 8, 1, 0}, // 10
+ { 7, 1, 0}, // 10
{ 8, 1, 0}, // 11
{ 8, 1, 0}, // 12
{ 8, 1, 0}, // 13
- { 1, 1, 0}, // 14
- { 8, 1, 0}, // 15
- { 7, 1, 0}, // 16
- { 8, 1, 0}, // 17
- { 4, 1, 0}, // 18
- { 8, 1, 0}, // 19
+ { 8, 1, 0}, // 14
+ { 1, 1, 0}, // 15
+ { 8, 1, 0}, // 16
+ { 7, 1, 0}, // 17
+ { 8, 1, 0}, // 18
+ { 4, 1, 0}, // 19
{ 8, 1, 0}, // 20
- { 7, 1, 0}, // 21
- { 8, 1, 0}, // 22
+ { 8, 1, 0}, // 21
+ { 7, 1, 0}, // 22
{ 8, 1, 0}, // 23
- { 3, 1, 0}, // 24
- { 2, 1, 0}, // 25
- { 8, 1, 0}, // 26
- { 3, 1, 0}, // 27
- { 8, 1, 0}, // 28
+ { 8, 1, 0}, // 24
+ { 3, 1, 0}, // 25
+ { 2, 1, 0}, // 26
+ { 8, 1, 0}, // 27
+ { 3, 1, 0}, // 28
{ 8, 1, 0}, // 29
{ 8, 1, 0}, // 30
- { 5, 1, 0}, // 31
+ { 8, 1, 0}, // 31
+ { 5, 1, 0}, // 32
};
-int const (*ScannerBase::s_dfaBase__[])[53] =
+int const (*ScannerBase::s_dfaBase__[])[54] =
{
s_dfa__ + 0,
};
@@ -279,7 +283,7 @@ ScannerBase::ScannerBase(std::istream &in, std::ostream &out)
d_out(new std::ostream(out.rdbuf())),
d_sawEOF(false),
d_atBOL(true),
- d_tailCount(10, UINT_MAX),
+ d_tailCount(11, UINT_MAX),
// $insert interactiveInit
d_in(0),
d_input(new std::istream(in.rdbuf())),
@@ -306,7 +310,7 @@ ScannerBase::ScannerBase(std::string const &infilename, std::string const &outfi
new std::ofstream(outfilename)),
d_sawEOF(false),
d_atBOL(true),
- d_tailCount(10, UINT_MAX),
+ d_tailCount(11, UINT_MAX),
d_input(new std::ifstream(infilename)),
d_dfaBase__(s_dfa__)
{}
@@ -634,6 +638,13 @@ try
}
break;
+ case 10:
+ {
+#line 13 "lexer"
+ return matched()[0];
+
+ }
+ break;
}
noReturn__();
return 0;
diff --git a/src/scanner/lexer b/src/scanner/lexer
index 715ecb8..b9b402f 100644
--- a/src/scanner/lexer
+++ b/src/scanner/lexer
@@ -9,4 +9,5 @@
[0-9]+ return Parser::NUM;
[-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)? return Parser::DISTANCE;
[A-Za-z0-9_-]*[A-Za-z][A-Za-z0-9_-]* return Parser::SPECIES;
-[();,:=] return matched()[0];
+\)[^:^;]* return matched()[0];
+[(;,:=] return matched()[0];
diff --git a/src/scanner/scannerbase.h b/src/scanner/scannerbase.h
index e1e609d..5a81ae9 100644
--- a/src/scanner/scannerbase.h
+++ b/src/scanner/scannerbase.h
@@ -1,4 +1,4 @@
-// Generated by Flexc++ V0.94.00 on Thu, 14 May 2015 11:55:16 +0200
+// Generated by Flexc++ V0.94.00 on Thu, 04 Aug 2016 06:15:29 +0200
#ifndef ScannerBASE_H_INCLUDED
#define ScannerBASE_H_INCLUDED
@@ -47,7 +47,7 @@ protected:
ECHO_CH, // echo ch itself (d_matched empty)
ECHO_FIRST, // echo d_matched[0], push back the rest
MATCH, // matched a rule
- RETURN // no further continuation, lex returns 0.
+ RETURN // no further continuation, lex returns 0.
};
public:
@@ -142,15 +142,15 @@ protected:
- int const (*d_dfaBase__)[53];
+ int const (*d_dfaBase__)[54];
- static int const s_dfa__[][53];
- static int const (*s_dfaBase__[])[53];
+ static int const s_dfa__[][54];
+ static int const (*s_dfaBase__[])[54];
enum: bool { s_interactive__ = false };
enum: size_t {
- s_rangeOfEOF__ = 50,
- s_finacIdx__ = 51,
- s_nRules__ = 10,
+ s_rangeOfEOF__ = 51,
+ s_finacIdx__ = 52,
+ s_nRules__ = 11,
s_maxSizeofStreamStack__ = 10
};
static size_t const s_ranges__[];
diff --git a/src/sqliteDB.cc b/src/sqliteDB.cc
index cc41542..e2279ad 100644
--- a/src/sqliteDB.cc
+++ b/src/sqliteDB.cc
@@ -150,23 +150,45 @@ void SQLiteDB::createTableFeatureTypes(){
endTransaction();
}
-int SQLiteDB::getSpeciesID(string species){
+int SQLiteDB::getSpeciesID(string species, bool clean, bool noInsert){
Statement stmt(this);
stmt.prepare("SELECT speciesid FROM speciesnames WHERE speciesname=?1;");
stmt.bindText(1,species.c_str());
if(stmt.nextResult()){
int id = stmt.intColumn(0);
+ if(clean){ // remove all existing entries for that species
+ deleteHints(id);
+ deleteGenome(id);
+ deleteSeqNames(id);
+ cout << "Deleted existing genome + hints for " << species << " from database " << endl;
+ }
return id;
}
else{
+ if(noInsert)
+ return -1;
string sql = "INSERT INTO speciesnames (speciesname) VALUES (\"" + species + "\")";
exec(sql.c_str());
return lastInsertID();
}
}
+void SQLiteDB::deleteHints(int speciesid){
+ string sql = "DELETE FROM hints WHERE speciesid = (\"" + itoa(speciesid) + "\")";
+ exec(sql.c_str());
+}
+
+void SQLiteDB::deleteGenome(int speciesid){
+ string sql = "DELETE FROM genomes WHERE speciesid = (\"" + itoa(speciesid) + "\")";
+ exec(sql.c_str());
+}
+
+void SQLiteDB::deleteSeqNames(int speciesid){
+ string sql = "DELETE FROM seqnames WHERE speciesid = (\"" + itoa(speciesid) + "\")";
+ exec(sql.c_str());
+}
void Statement::prepare(const char *sql){
diff --git a/src/types.cc b/src/types.cc
index 2fcaf93..e35852b 100644
--- a/src/types.cc
+++ b/src/types.cc
@@ -87,6 +87,7 @@ string Constant::treefile; // file name in which a tree is specified in Newick f
string Constant::speciesfilenames; // file name to file which contains the names of species and the corresponding file names
string Constant::dbaccess; // comma separated string with database access (database name,host name,user,passwd, table name"
string Constant::alnfile; // name of file that contains MSA of genomes
+string Constant::codonalnfile; // name of file that contains MSA of codon sequences
bool Constant::overlapmode = false;
Boolean Constant::printOEs = true; // output ortho exons
Integer Constant::maxOvlp = 60; // maximum overlap of coding regions for bacteria
@@ -105,6 +106,8 @@ vector<double>Constant::in_sc;
vector<double>Constant::lg_es;
int Constant::oeExtensionWidth;
bool Constant::computeNumSubs; // cumpute number of substitutions in OE
+bool Constant::useAArates;
+bool Constant::useNonCodingModel;
// moved here from hints.cc
const int power2id[31] = {1,2,4,8,16,32,64,128,
256,512,1024,2048,4096,8192,16384,32768,
@@ -331,7 +334,7 @@ void Constant::init(){
} catch (...) {
logreg = true;
}
- for(int i=0; i<16; i++){
+ for(int i=0; i<17; i++){
try {
ex_sc.push_back(Properties::getdoubleProperty("/CompPred/exon_score" + itoa(i) ));
} catch (...) {
@@ -365,8 +368,20 @@ void Constant::init(){
computeNumSubs = false;
}
-
+ try {
+ useAArates = Properties::getBoolProperty("useAminoAcidRates");
+ } catch(...){
+ useAArates = false;
+ }
+ try {
+ useNonCodingModel = Properties::getBoolProperty("useNonCodingModel");
+ } catch(...){
+ useNonCodingModel = false;
+ }
+
+
+
Properties::assignProperty("/UtrModel/d_polyasig_cleavage", d_polyasig_cleavage);
Properties::assignProperty("keep_viterbi", keep_viterbi);
Properties::assignProperty("/Constant/gc_range_min", gc_range_min);
--
Alioth's /usr/local/bin/git-commit-notice on /srv/git.debian.org/git/debian-med/augustus.git
More information about the debian-med-commit
mailing list